#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_EVS_AA	i_EVS_All	i_EVS_EA	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains_WU	i_amino_acid_change_WU	i_annotation_transcript	i_build	i_c_position_WU	i_ccds_id	i_chromosome_name_WU	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name_WU	i_deletion_substructures_WU	i_domain_WU	i_ensembl_gene_id	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name_WU	i_gene_name_source_WU	i_gene_type	i_havana_transcript	i_normal_ref_reads	i_normal_vaf	i_normal_var_reads	i_reference_WU	i_refseq_mrna_id	i_secondary_variant_classification	i_start_WU	i_stop_WU	i_strand_WU	i_transcript_error_WU	i_transcript_name_WU	i_transcript_source_WU	i_transcript_species_WU	i_transcript_status_WU	i_transcript_version_WU	i_trv_type_WU	i_tumor_ref_reads	i_tumor_vaf	i_tumors_var_reads	i_type_WU	i_ucsc_cons_WU	i_variant_WU
ABCB1	5243	genome.wustl.edu	37	7	87148737	87148737	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:87148737G>A	ENST00000265724.3	-	24	3249	c.2832C>T	c.(2830-2832)ttC>ttT	p.F944F	ABCB1_ENST00000543898.1_Silent_p.F880F|ABCB1_ENST00000488737.2_5'UTR	NM_000927.4	NP_000918.2	P08183	MDR1_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 1	944	ABC transmembrane type-1 2. {ECO:0000255|PROSITE-ProRule:PRU00441}.				drug transmembrane transport (GO:0006855)|G2/M transition of mitotic cell cycle (GO:0000086)|response to drug (GO:0042493)|small molecule metabolic process (GO:0044281)|stem cell proliferation (GO:0072089)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)|xenobiotic-transporting ATPase activity (GO:0008559)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(14)|kidney(9)|large_intestine(14)|lung(48)|ovary(4)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	111	Esophageal squamous(14;0.00164)				Acebutolol(DB01193)|Acetaminophen(DB00316)|Acetylsalicylic acid(DB00945)|Adenosine triphosphate(DB00171)|ado-trastuzumab emtansine(DB05773)|Afatinib(DB08916)|Albendazole(DB00518)|Alfentanil(DB00802)|Alitretinoin(DB00523)|Amantadine(DB00915)|Aminohippurate(DB00345)|Amiodarone(DB01118)|Amitriptyline(DB00321)|Amlodipine(DB00381)|Amprenavir(DB00701)|Amsacrine(DB00276)|Apixaban(DB06605)|Arsenic trioxide(DB01169)|Astemizole(DB00637)|Atazanavir(DB01072)|Atenolol(DB00335)|Atorvastatin(DB01076)|Axitinib(DB06626)|Azelastine(DB00972)|Azithromycin(DB00207)|Benzocaine(DB01086)|Bepridil(DB01244)|Betamethasone(DB00443)|Biperiden(DB00810)|Boceprevir(DB08873)|Bosutinib(DB06616)|Brentuximab vedotin(DB08870)|Bromocriptine(DB01200)|Buprenorphine(DB00921)|Buspirone(DB00490)|Cabazitaxel(DB06772)|Caffeine(DB00201)|Canagliflozin(DB08907)|Candesartan(DB00796)|Captopril(DB01197)|Carbamazepine(DB00564)|Carfilzomib(DB08889)|Carvedilol(DB01136)|Caspofungin(DB00520)|Chloroquine(DB00608)|Chlorpromazine(DB00477)|Chlorpropamide(DB00672)|Chlorprothixene(DB01239)|Cilazapril(DB01340)|Cimetidine(DB00501)|Ciprofloxacin(DB00537)|Cisplatin(DB00515)|Citalopram(DB00215)|Clarithromycin(DB01211)|Clobazam(DB00349)|Clofazimine(DB00845)|Clomifene(DB00882)|Clomipramine(DB01242)|Clonidine(DB00575)|Clopidogrel(DB00758)|Clotrimazole(DB00257)|Clozapine(DB00363)|Colchicine(DB01394)|Conjugated Estrogens(DB00286)|Crizotinib(DB08865)|Cyclophosphamide(DB00531)|Cyclosporine(DB00091)|Dabigatran etexilate(DB06695)|Dabrafenib(DB08912)|Dactinomycin(DB00970)|Dapagliflozin(DB06292)|Dasatinib(DB01254)|Daunorubicin(DB00694)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desloratadine(DB00967)|Dexamethasone(DB01234)|Dextromethorphan(DB00514)|Diazepam(DB00829)|Diclofenac(DB00586)|Diethylstilbestrol(DB00255)|Digitoxin(DB01396)|Digoxin(DB00390)|Dihydroergotamine(DB00320)|Diltiazem(DB00343)|Dipyridamole(DB00975)|Docetaxel(DB01248)|Domperidone(DB01184)|Doxazosin(DB00590)|Doxepin(DB01142)|Doxorubicin(DB00997)|Dronabinol(DB00470)|Dronedarone(DB04855)|Eletriptan(DB00216)|Enalapril(DB00584)|Enzalutamide(DB08899)|Epinastine(DB00751)|Ergonovine(DB01253)|Ergotamine(DB00696)|Erlotinib(DB00530)|Erythromycin(DB00199)|Estradiol(DB00783)|Estramustine(DB01196)|Estriol(DB04573)|Estrone(DB00655)|Ethinyl Estradiol(DB00977)|Etoposide(DB00773)|Etravirine(DB06414)|Ezetimibe(DB00973)|Felodipine(DB01023)|Fentanyl(DB00813)|Fesoterodine(DB06702)|Fexofenadine(DB00950)|Fidaxomicin(DB08874)|Fluconazole(DB00196)|Fluoxetine(DB00472)|Flupentixol(DB00875)|Fluphenazine(DB00623)|Flurazepam(DB00690)|Fluticasone furoate(DB08906)|Fluvoxamine(DB00176)|Gefitinib(DB00317)|Gemcitabine(DB00441)|Glyburide(DB01016)|Gramicidin D(DB00027)|Haloperidol(DB00502)|Hydrocortisone(DB00741)|Ibuprofen(DB01050)|Imatinib(DB00619)|Imipramine(DB00458)|Indacaterol(DB05039)|Indinavir(DB00224)|Indomethacin(DB00328)|Irinotecan(DB00762)|Itraconazole(DB01167)|Ivacaftor(DB08820)|Ivermectin(DB00602)|Ketamine(DB01221)|Ketazolam(DB01587)|Ketoconazole(DB01026)|Lamivudine(DB00709)|Lamotrigine(DB00555)|Lansoprazole(DB00448)|Lapatinib(DB01259)|Lenalidomide(DB00480)|Levetiracetam(DB01202)|Levofloxacin(DB01137)|Levomilnacipran(DB08918)|Levothyroxine(DB00451)|Lidocaine(DB00281)|Linagliptin(DB08882)|Liothyronine(DB00279)|Liotrix(DB01583)|Lisinopril(DB00722)|Lomitapide(DB08827)|Loperamide(DB00836)|Lopinavir(DB01601)|Loratadine(DB00455)|Losartan(DB00678)|Lovastatin(DB00227)|Mannitol(DB00742)|Maprotiline(DB00934)|Mebendazole(DB00643)|Mefloquine(DB00358)|Megestrol acetate(DB00351)|Meprobamate(DB00371)|Methadone(DB00333)|Methotrexate(DB00563)|Methylprednisolone(DB00959)|Metoprolol(DB00264)|Miconazole(DB01110)|Midazolam(DB00683)|Mifepristone(DB00834)|Mirabegron(DB08893)|Mitomycin(DB00305)|Mitoxantrone(DB01204)|Morphine(DB00295)|Mycophenolate mofetil(DB00688)|Nadolol(DB01203)|Naloxone(DB01183)|Naltrexone(DB00704)|Nefazodone(DB01149)|Nelfinavir(DB00220)|Neostigmine(DB01400)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilotinib(DB04868)|Nisoldipine(DB00401)|Nitrazepam(DB01595)|Nitrendipine(DB01054)|Nizatidine(DB00585)|Norethindrone(DB00717)|Olanzapine(DB00334)|Omeprazole(DB00338)|Paclitaxel(DB01229)|Pantoprazole(DB00213)|Paroxetine(DB00715)|Pazopanib(DB06589)|Perindopril(DB00790)|Phenobarbital(DB01174)|Phenytoin(DB00252)|Pimozide(DB01100)|Pitavastatin(DB08860)|Pomalidomide(DB08910)|Ponatinib(DB08901)|Posaconazole(DB01263)|Pravastatin(DB00175)|Prazosin(DB00457)|Prednisolone(DB00860)|Prednisone(DB00635)|Probenecid(DB01032)|Progesterone(DB00396)|Promethazine(DB01069)|Propafenone(DB01182)|Propranolol(DB00571)|Protriptyline(DB00344)|Quetiapine(DB01224)|Quinacrine(DB01103)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reboxetine(DB00234)|Regorafenib(DB08896)|Reserpine(DB00206)|Rifampicin(DB01045)|Rilpivirine(DB08864)|Risperidone(DB00734)|Ritonavir(DB00503)|Rivaroxaban(DB06228)|Roxithromycin(DB00778)|Salicylic acid(DB00936)|Saquinavir(DB01232)|Scopolamine(DB00747)|Selegiline(DB01037)|Sertraline(DB01104)|Silodosin(DB06207)|SIMEPREVIR(DB06290)|Simvastatin(DB00641)|Sirolimus(DB00877)|Sitagliptin(DB01261)|SOFOSBUVIR(DB08934)|Sorafenib(DB00398)|Sparfloxacin(DB01208)|Spironolactone(DB00421)|Streptozocin(DB00428)|Sulfinpyrazone(DB01138)|Sumatriptan(DB00669)|Sunitinib(DB01268)|Tacrolimus(DB00864)|Tamoxifen(DB00675)|Telaprevir(DB05521)|Telmisartan(DB00966)|Temsirolimus(DB06287)|Terazosin(DB01162)|Testosterone(DB00624)|Ticagrelor(DB08816)|Timolol(DB00373)|Tolvaptan(DB06212)|Topotecan(DB01030)|Toremifene(DB00539)|Trazodone(DB00656)|Trifluoperazine(DB00831)|Triflupromazine(DB00508)|Trimethoprim(DB00440)|Trimipramine(DB00726)|Troleandomycin(DB01361)|Vecuronium(DB01339)|Venlafaxine(DB00285)|Verapamil(DB00661)|Vinblastine(DB00570)|Vincristine(DB00541)|Vinorelbine(DB00361)|Vismodegib(DB08828)|Voacamine(DB04877)|Zidovudine(DB00495)	TTGCCTGGGTGAAGGAAAATG	0.383																																						dbGAP											0													92.0	87.0	89.0					7																	87148737		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M14758	CCDS5608.1	7q21.12	2012-03-14	2004-05-12		ENSG00000085563	ENSG00000085563		"""CD molecules"", ""ATP binding cassette transporters / subfamily B"""	40	protein-coding gene	gene with protein product	"""multidrug resistance protein 1"""	171050	"""colchicin sensitivity"""	PGY1, MDR1, CLCS		3027054	Standard	NM_000927		Approved	P-gp, CD243, GP170, ABC20	uc003uiz.2	P08183	OTTHUMG00000023393	ENST00000265724.3:c.2832C>T	7.37:g.87148737G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K294|B5AK60|Q12755|Q14812	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,pfam_ABC_ATPase_put,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.F944	ENST00000265724.3	37	c.2832	CCDS5608.1	7																																																																																			ABCB1	-	pfam_ABC_transptr_TM_dom,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1	ENSG00000085563		0.383	ABCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB1	HGNC	protein_coding	OTTHUMT00000335444.2	43	0.00	0	G	NM_000927		87148737	87148737	-1	no_errors	ENST00000265724	ensembl	human	known	69_37n	silent	51	15.00	9	SNP	0.992	A
ABCE1	6059	genome.wustl.edu	37	4	146031300	146031300	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr4:146031300G>A	ENST00000296577.4	+	6	966	c.451G>A	c.(451-453)Gaa>Aaa	p.E151K	OTUD4_ENST00000455611.2_5'Flank|ABCE1_ENST00000502803.1_Intron	NM_001040876.1|NM_002940.2	NP_001035809.1|NP_002931.2	P61221	ABCE1_HUMAN	ATP-binding cassette, sub-family E (OABP), member 1	151	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				negative regulation of catalytic activity (GO:0043086)|response to virus (GO:0009615)|RNA catabolic process (GO:0006401)|viral process (GO:0016032)	cytoplasm (GO:0005737)|membrane (GO:0016020)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|iron-sulfur cluster binding (GO:0051536)|ribonuclease inhibitor activity (GO:0008428)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|lung(5)|prostate(2)|skin(3)	18	all_hematologic(180;0.151)					CCGTGGATCTGAATTACAAAA	0.333																																						dbGAP											0													49.0	54.0	52.0					4																	146031300		2203	4300	6503	-	-	-	SO:0001583	missense	0			X74987	CCDS34071.1	4q31	2012-03-14			ENSG00000164163	ENSG00000164163		"""ATP binding cassette transporters / subfamily E"""	69	protein-coding gene	gene with protein product		601213		RNASEL1, RNASELI, RNS4I		7539425	Standard	NM_002940		Approved	RLI, OABP	uc003ijy.3	P61221	OTTHUMG00000161478	ENST00000296577.4:c.451G>A	4.37:g.146031300G>A	ENSP00000296577:p.Glu151Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O88793|Q13181|Q13864|Q6NR76|Q96AL0|Q96B10|Q99K66	Missense_Mutation	SNP	pfam_ABC_transporter-like,pfam_RNaseL-inhib_metal-bd_dom,pfam_4Fe4S-bd_dom,smart_AAA+_ATPase,pfscan_ABC_transporter-like,prints_ABC_E	p.E151K	ENST00000296577.4	37	c.451	CCDS34071.1	4	.	.	.	.	.	.	.	.	.	.	G	36	5.814078	0.96975	.	.	ENSG00000164163	ENST00000296577;ENST00000502586	D	0.94000	-3.33	5.76	5.76	0.90799	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.96836	0.8967	M	0.81802	2.56	0.80722	D	1	D	0.69078	0.997	D	0.68765	0.96	D	0.96641	0.9474	10	0.72032	D	0.01	-26.6025	20.3431	0.98773	0.0:0.0:1.0:0.0	.	151	P61221	ABCE1_HUMAN	K	151	ENSP00000296577:E151K	ENSP00000296577:E151K	E	+	1	0	ABCE1	146250750	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.864000	0.99589	2.880000	0.98712	0.650000	0.86243	GAA	ABCE1	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,prints_ABC_E	ENSG00000164163		0.333	ABCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCE1	HGNC	protein_coding	OTTHUMT00000365104.1	30	0.00	0	G	NM_002940		146031300	146031300	+1	no_errors	ENST00000296577	ensembl	human	known	69_37n	missense	29	21.62	8	SNP	1.000	A
ABHD14A	25864	genome.wustl.edu	37	3	52011898	52011898	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:52011898G>C	ENST00000273596.3	+	2	149	c.81G>C	c.(79-81)caG>caC	p.Q27H	ABHD14A_ENST00000491470.1_Missense_Mutation_p.Q27H|ACY1_ENST00000458031.2_5'UTR|ABHD14A-ACY1_ENST00000463937.1_Missense_Mutation_p.Q27H|ABHD14B_ENST00000483233.1_Intron	NM_015407.4	NP_056222.2	Q9BUJ0	ABHEA_HUMAN	abhydrolase domain containing 14A	27						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|stomach(1)	6				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CTGTGGTACAGACCTCCATGA	0.612																																						dbGAP											0													100.0	111.0	107.0					3																	52011898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358201	CCDS2843.1	3p21.1	2011-02-14			ENSG00000248487	ENSG00000248487		"""Abhydrolase domain containing"""	24538	protein-coding gene	gene with protein product							Standard	NM_015407		Approved	DKFZP564O243, DORZ1	uc003dco.3	Q9BUJ0	OTTHUMG00000157818	ENST00000273596.3:c.81G>C	3.37:g.52011898G>C	ENSP00000273596:p.Gln27His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6UXU8|Q9Y3T7	Missense_Mutation	SNP	pfam_AB_hydrolase_N	p.Q27H	ENST00000273596.3	37	c.81	CCDS2843.1	3	.	.	.	.	.	.	.	.	.	.	G	16.65	3.181905	0.57800	.	.	ENSG00000248487;ENSG00000248487;ENSG00000248487;ENSG00000248487;ENSG00000114786	ENST00000497864;ENST00000494478;ENST00000273596;ENST00000491470;ENST00000463937	T;T;T;T;T	0.69561	1.1;1.32;1.35;1.11;-0.41	5.82	4.03	0.46877	.	1.307360	0.05005	N	0.469919	T	0.75488	0.3856	L	0.53249	1.67	0.09310	N	1	D;P	0.64830	0.994;0.94	P;P	0.56865	0.808;0.533	T	0.55829	-0.8079	10	0.87932	D	0	-8.9229	8.8199	0.35018	0.1716:0.0:0.8284:0.0	.	27;27	C9JMV9;Q9BUJ0	.;ABHEA_HUMAN	H	92;22;27;27;27	ENSP00000418242:Q92H;ENSP00000420475:Q22H;ENSP00000273596:Q27H;ENSP00000418824:Q27H;ENSP00000420487:Q27H	ENSP00000273596:Q27H	Q	+	3	2	RP11-155D18.11;ABHD14A	51986938	0.000000	0.05858	0.419000	0.26584	0.990000	0.78478	0.315000	0.19451	0.812000	0.34326	0.655000	0.94253	CAG	ABHD14A	-	NULL	ENSG00000248487		0.612	ABHD14A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABHD14A	HGNC	protein_coding	OTTHUMT00000349689.1	26	0.00	0	G	NM_015407		52011898	52011898	+1	no_errors	ENST00000273596	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	0.057	C
ABT1	29777	genome.wustl.edu	37	6	26598833	26598833	+	Nonsense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:26598833C>G	ENST00000274849.1	+	3	810	c.779C>G	c.(778-780)tCa>tGa	p.S260*		NM_013375.3	NP_037507.1	Q9ULW3	ABT1_HUMAN	activator of basal transcription 1	260					regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord motor neuron differentiation (GO:0021522)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(1)|urinary_tract(1)	11						CCGCCACCCTCAGAGAGCATG	0.642																																						dbGAP											0													22.0	25.0	24.0					6																	26598833		2159	4233	6392	-	-	-	SO:0001587	stop_gained	0			AB027258	CCDS4616.1	6p21.31	2008-07-07			ENSG00000146109	ENSG00000146109			17369	protein-coding gene	gene with protein product						10648625	Standard	NM_013375		Approved		uc003nii.3	Q9ULW3	OTTHUMG00000016319	ENST00000274849.1:c.779C>G	6.37:g.26598833C>G	ENSP00000274849:p.Ser260*	Somatic		WXS	Illumina GAIIx	Phase_IV		Nonsense_Mutation	SNP	NULL	p.S260*	ENST00000274849.1	37	c.779	CCDS4616.1	6	.	.	.	.	.	.	.	.	.	.	C	31	5.099906	0.94197	.	.	ENSG00000146109	ENST00000274849	.	.	.	4.43	4.43	0.53597	.	0.648887	0.14521	N	0.314491	.	.	.	.	.	.	0.48341	D	0.999637	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.4923	12.8528	0.57867	0.0:1.0:0.0:0.0	.	.	.	.	X	260	.	ENSP00000274849:S260X	S	+	2	0	ABT1	26706812	0.324000	0.24652	0.271000	0.24616	0.584000	0.36387	2.550000	0.45811	2.741000	0.93983	0.655000	0.94253	TCA	ABT1	-	NULL	ENSG00000146109		0.642	ABT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABT1	HGNC	protein_coding	OTTHUMT00000043698.1	28	0.00	0	C			26598833	26598833	+1	no_errors	ENST00000274849	ensembl	human	known	69_37n	nonsense	35	16.67	7	SNP	0.628	G
ACCSL	390110	genome.wustl.edu	37	11	44069628	44069628	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:44069628G>C	ENST00000378832.1	+	1	98	c.42G>C	c.(40-42)caG>caC	p.Q14H		NM_001031854.2	NP_001027025.2	Q4AC99	1A1L2_HUMAN	1-aminocyclopropane-1-carboxylate synthase homolog (Arabidopsis)(non-functional)-like	14					biosynthetic process (GO:0009058)		catalytic activity (GO:0003824)|pyridoxal phosphate binding (GO:0030170)			central_nervous_system(1)|endometrium(6)|large_intestine(5)|lung(14)|ovary(5)|pancreas(1)|skin(2)	34						CCTCTGGTCAGAGGAGAGGCC	0.572																																						dbGAP											0													55.0	58.0	57.0					11																	44069628		1966	4161	6127	-	-	-	SO:0001583	missense	0				CCDS41636.1	11p11.2	2008-11-26			ENSG00000205126	ENSG00000205126			34391	protein-coding gene	gene with protein product							Standard	NM_001031854		Approved		uc001mxw.1	Q4AC99	OTTHUMG00000166426	ENST00000378832.1:c.42G>C	11.37:g.44069628G>C	ENSP00000368109:p.Gln14His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom,prints_ACC_synthase	p.Q14H	ENST00000378832.1	37	c.42	CCDS41636.1	11	.	.	.	.	.	.	.	.	.	.	G	12.51	1.958601	0.34565	.	.	ENSG00000205126	ENST00000378832	T	0.70164	-0.46	2.73	1.73	0.24493	.	0.717774	0.12338	N	0.477732	T	0.70771	0.3262	L	0.59436	1.845	0.09310	N	1	D	0.65815	0.995	P	0.56278	0.795	T	0.58787	-0.7575	10	0.72032	D	0.01	-10.2443	7.2606	0.26201	0.1549:0.0:0.8451:0.0	.	14	Q4AC99	1A1L2_HUMAN	H	14	ENSP00000368109:Q14H	ENSP00000368109:Q14H	Q	+	3	2	ACCSL	44026204	0.031000	0.19500	0.011000	0.14972	0.006000	0.05464	1.191000	0.32138	0.636000	0.30508	0.563000	0.77884	CAG	ACCSL	-	NULL	ENSG00000205126		0.572	ACCSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACCSL	HGNC	protein_coding	OTTHUMT00000389717.1	20	0.00	0	G	NM_001031854		44069628	44069628	+1	no_errors	ENST00000378832	ensembl	human	known	69_37n	missense	27	25.00	9	SNP	0.074	C
ADAMTS9	56999	genome.wustl.edu	37	3	64554192	64554192	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:64554192C>T	ENST00000498707.1	-	29	4718	c.4376G>A	c.(4375-4377)cGa>cAa	p.R1459Q	ADAMTS9-AS1_ENST00000474313.1_RNA|ADAMTS9-AS1_ENST00000493124.1_RNA|ADAMTS9-AS1_ENST00000594810.1_RNA|ADAMTS9-AS1_ENST00000492209.1_RNA|ADAMTS9_ENST00000295903.4_Missense_Mutation_p.R1431Q|ADAMTS9-AS1_ENST00000601022.1_RNA|ADAMTS9-AS1_ENST00000470447.1_RNA	NM_182920.1	NP_891550.1	Q9P2N4	ATS9_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 9	1459	TSP type-1 11. {ECO:0000255|PROSITE- ProRule:PRU00210}.				glycoprotein catabolic process (GO:0006516)|multicellular organismal development (GO:0007275)|positive regulation of melanocyte differentiation (GO:0045636)|protein transport (GO:0015031)|proteolysis (GO:0006508)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(4)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(17)|liver(4)|lung(43)|ovary(3)|prostate(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	100		Lung NSC(201;0.00682)		BRCA - Breast invasive adenocarcinoma(55;0.00142)|Kidney(15;0.00202)|KIRC - Kidney renal clear cell carcinoma(15;0.00221)		TTTATGCCCTCGACCACAAGA	0.408																																						dbGAP											0													140.0	131.0	134.0					3																	64554192		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF261918	CCDS2903.1	3p14.1	2008-05-15	2005-08-19		ENSG00000163638	ENSG00000163638		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13202	protein-coding gene	gene with protein product		605421	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 9"""			10936055	Standard	NM_182920		Approved	KIAA1312	uc003dmg.3	Q9P2N4	OTTHUMG00000158722	ENST00000498707.1:c.4376G>A	3.37:g.64554192C>T	ENSP00000418735:p.Arg1459Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L0|B7ZVX9|B9ZVN0|Q9NR29	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.R1459Q	ENST00000498707.1	37	c.4376	CCDS2903.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	27.4|27.4	4.830508|4.830508	0.91036|0.91036	.|.	.|.	ENSG00000163638|ENSG00000163638	ENST00000481060|ENST00000295903;ENST00000498707	.|T;T	.|0.52526	.|0.66;0.66	5.68|5.68	5.68|5.68	0.88126|0.88126	.|.	.|0.000000	.|0.64402	.|D	.|0.000001	T|T	0.63534|0.63534	0.2519|0.2519	L|L	0.48642|0.48642	1.525|1.525	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.76494	.|0.999;0.997;0.999	.|D;P;D	.|0.70935	.|0.971;0.776;0.941	T|T	0.56366|0.56366	-0.7991|-0.7991	5|10	.|0.34782	.|T	.|0.22	.|.	20.1594|20.1594	0.98130|0.98130	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|1431;1459;1459	.|B7ZVX9;Q9P2N4-1;Q9P2N4	.|.;.;ATS9_HUMAN	K|Q	515|1431;1459	.|ENSP00000295903:R1431Q;ENSP00000418735:R1459Q	.|ENSP00000295903:R1431Q	E|R	-|-	1|2	0|0	ADAMTS9|ADAMTS9	64529232|64529232	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.976000|0.976000	0.68499|0.68499	3.416000|3.416000	0.52707|0.52707	2.843000|2.843000	0.97960|0.97960	0.650000|0.650000	0.86243|0.86243	GAG|CGA	ADAMTS9	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000163638		0.408	ADAMTS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS9	HGNC	protein_coding	OTTHUMT00000351891.1	38	0.00	0	C			64554192	64554192	-1	no_errors	ENST00000498707	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	1.000	T
ADCK1	57143	genome.wustl.edu	37	14	78365553	78365553	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:78365553G>T	ENST00000238561.5	+	6	792	c.693G>T	c.(691-693)agG>agT	p.R231S	ADCK1_ENST00000341211.5_Missense_Mutation_p.R163S	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	238	Protein kinase.					extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		ATGAAGGGAGGAATGCTGAGA	0.502																																						dbGAP											0													175.0	153.0	161.0					14																	78365553		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.693G>T	14.37:g.78365553G>T	ENSP00000238561:p.Arg231Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KUD5|Q6PD65|Q9UIE6	Missense_Mutation	SNP	pfam_UbiB_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom	p.R231S	ENST00000238561.5	37	c.693	CCDS9869.1	14	.	.	.	.	.	.	.	.	.	.	G	13.42	2.231808	0.39399	.	.	ENSG00000063761	ENST00000238561;ENST00000557501;ENST00000341211	T;T;T	0.54279	0.6;0.58;0.6	5.43	2.51	0.30379	.	0.097561	0.64402	D	0.000003	T	0.36580	0.0972	L	0.35288	1.05	0.80722	D	1	B;B	0.18166	0.018;0.026	B;B	0.26517	0.07;0.025	T	0.16070	-1.0415	10	0.33940	T	0.23	-18.574	4.8836	0.13692	0.1768:0.377:0.4462:0.0	.	163;231	Q9UIE6;Q86TW2-2	.;.	S	231;231;163	ENSP00000238561:R231S;ENSP00000451549:R231S;ENSP00000339663:R163S	ENSP00000238561:R231S	R	+	3	2	ADCK1	77435306	0.998000	0.40836	0.998000	0.56505	0.996000	0.88848	0.554000	0.23407	1.243000	0.43853	0.591000	0.81541	AGG	ADCK1	-	pfam_UbiB_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom	ENSG00000063761		0.502	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK1	HGNC	protein_coding	OTTHUMT00000413864.1	168	0.00	0	G	NM_020421		78365553	78365553	+1	no_errors	ENST00000238561	ensembl	human	known	69_37n	missense	189	16.37	37	SNP	1.000	T
ADCY2	108	genome.wustl.edu	37	5	7757647	7757647	+	Missense_Mutation	SNP	C	C	T	rs52827085	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:7757647C>T	ENST00000338316.4	+	16	2131	c.2042C>T	c.(2041-2043)tCt>tTt	p.S681F	ADCY2_ENST00000537121.1_Missense_Mutation_p.S501F	NM_020546.2	NP_065433.2	Q08462	ADCY2_HUMAN	adenylate cyclase 2 (brain)	681					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|cAMP biosynthetic process (GO:0006171)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|membrane (GO:0016020)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|calcium- and calmodulin-responsive adenylate cyclase activity (GO:0008294)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			NS(3)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(22)|lung(56)|ovary(8)|pancreas(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(7)	119						CCACGGATCTCTCTCACGATC	0.527																																						dbGAP											0													92.0	90.0	91.0					5																	7757647		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB028983	CCDS3872.2	5p15.3	2013-02-04			ENSG00000078295	ENSG00000078295	4.6.1.1	"""Adenylate cyclases"""	233	protein-coding gene	gene with protein product		103071				1427768	Standard	NM_020546		Approved	HBAC2, KIAA1060, AC2	uc003jdz.1	Q08462	OTTHUMG00000090476	ENST00000338316.4:c.2042C>T	5.37:g.7757647C>T	ENSP00000342952:p.Ser681Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2C1|Q2NKL8|Q9UDB2|Q9UPU2	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.S681F	ENST00000338316.4	37	c.2042	CCDS3872.2	5	.	.	.	.	.	.	.	.	.	.	C	2.776	-0.254610	0.05829	.	.	ENSG00000078295	ENST00000338316;ENST00000541993;ENST00000537121	T;T	0.46063	0.88;0.88	5.49	1.38	0.22167	.	0.437584	0.25372	N	0.031153	T	0.30103	0.0754	L	0.40543	1.245	0.32037	N	0.598771	B;B	0.27380	0.177;0.0	B;B	0.28553	0.091;0.001	T	0.22695	-1.0209	10	0.46703	T	0.11	.	6.545	0.22400	0.0:0.3994:0.4289:0.1717	.	501;681	B7Z2C1;Q08462	.;ADCY2_HUMAN	F	681;514;501	ENSP00000342952:S681F;ENSP00000444803:S501F	ENSP00000342952:S681F	S	+	2	0	ADCY2	7810647	0.780000	0.28664	0.878000	0.34440	0.128000	0.20619	0.530000	0.23036	-0.039000	0.13602	-0.345000	0.07892	TCT	ADCY2	-	NULL	ENSG00000078295		0.527	ADCY2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY2	HGNC	protein_coding	OTTHUMT00000206930.2	45	0.00	0	C	NM_020546		7757647	7757647	+1	no_errors	ENST00000338316	ensembl	human	known	69_37n	missense	52	13.33	8	SNP	0.995	T
ADH5	128	genome.wustl.edu	37	4	99998046	99998046	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr4:99998046C>T	ENST00000296412.8	-	5	423	c.373G>A	c.(373-375)Gat>Aat	p.D125N	ADH5_ENST00000512991.1_5'UTR	NM_000671.3	NP_000662.3			alcohol dehydrogenase 5 (class III), chi polypeptide											endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.5e-07)		CTGGTACCATCTGGCATTAAT	0.368																																						dbGAP											0													33.0	31.0	32.0					4																	99998046		1837	4076	5913	-	-	-	SO:0001583	missense	0			M29872	CCDS47111.1	4q23	2012-07-13	2003-06-19		ENSG00000197894	ENSG00000197894	1.1.1.284	"""Alcohol dehydrogenases"""	253	protein-coding gene	gene with protein product		103710	"""formaldehyde dehydrogenase"""	FDH		1446828, 6424546	Standard	NM_000671		Approved	ADH-3, ADHX	uc003hui.3	P11766	OTTHUMG00000161230	ENST00000296412.8:c.373G>A	4.37:g.99998046C>T	ENSP00000296412:p.Asp125Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_ADH_GroES-like,pfam_ADH_C,superfamily_GroES-like,tigrfam_ADH_3	p.D125N	ENST00000296412.8	37	c.373	CCDS47111.1	4	.	.	.	.	.	.	.	.	.	.	C	22.6	4.307077	0.81247	.	.	ENSG00000197894	ENST00000296412;ENST00000503130	T;T	0.03982	3.74;3.74	5.2	5.2	0.72013	GroES-like (1);Alcohol dehydrogenase GroES-like (1);	0.000000	0.85682	D	0.000000	T	0.11495	0.0280	M	0.75777	2.31	0.80722	D	1	P;P;P	0.37708	0.606;0.606;0.606	B;B;B	0.40228	0.323;0.323;0.323	T	0.03212	-1.1060	9	.	.	.	.	18.9285	0.92554	0.0:1.0:0.0:0.0	.	125;125;125	Q5U043;Q6IRT1;P11766	.;.;ADHX_HUMAN	N	125;112	ENSP00000296412:D125N;ENSP00000427049:D112N	.	D	-	1	0	ADH5	100217069	0.997000	0.39634	1.000000	0.80357	0.998000	0.95712	4.188000	0.58351	2.716000	0.92895	0.650000	0.86243	GAT	ADH5	-	pfam_ADH_GroES-like,superfamily_GroES-like,tigrfam_ADH_3	ENSG00000197894		0.368	ADH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADH5	HGNC	protein_coding	OTTHUMT00000364224.1	41	0.00	0	C	NM_000671		99998046	99998046	-1	no_errors	ENST00000296412	ensembl	human	known	69_37n	missense	43	17.31	9	SNP	1.000	T
ADRA1A	148	genome.wustl.edu	37	8	26721895	26721895	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:26721895C>T	ENST00000519229.1	-	1	598	c.592G>A	c.(592-594)Gcc>Acc	p.A198T	ADRA1A_ENST00000380587.1_Missense_Mutation_p.A198T|ADRA1A_ENST00000380572.3_Missense_Mutation_p.A198T|ADRA1A_ENST00000358857.5_Missense_Mutation_p.A198T|ADRA1A_ENST00000380586.1_Missense_Mutation_p.A198T|ADRA1A_ENST00000380582.3_Missense_Mutation_p.A198T|ADRA1A_ENST00000380581.2_Missense_Mutation_p.A198T|ADRA1A_ENST00000276393.4_Missense_Mutation_p.A198T|ADRA1A_ENST00000354550.4_Missense_Mutation_p.A198T|ADRA1A_ENST00000380573.3_Missense_Mutation_p.A198T			P25100	ADA1D_HUMAN	adrenoceptor alpha 1A	268					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|adrenergic receptor signaling pathway (GO:0071875)|cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|DNA metabolic process (GO:0006259)|G-protein coupled receptor signaling pathway (GO:0007186)|multicellular organismal development (GO:0007275)|negative regulation of the force of heart contraction involved in baroreceptor response to increased systemic arterial blood pressure (GO:0001986)|norepinephrine-epinephrine vasoconstriction involved in regulation of systemic arterial blood pressure (GO:0001994)|positive regulation of cell proliferation (GO:0008284)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	alpha1-adrenergic receptor activity (GO:0004937)			breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(17)|ovary(1)|prostate(1)|skin(1)	36		all_cancers(63;0.122)|Ovarian(32;2.61e-05)|all_epithelial(46;0.118)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0228)|Epithelial(17;4.92e-10)|Colorectal(74;0.0132)|READ - Rectum adenocarcinoma(644;0.115)	Alfuzosin(DB00346)|Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Carvedilol(DB01136)|Chlorpromazine(DB00477)|Clonidine(DB00575)|Dapiprazole(DB00298)|Desipramine(DB01151)|Doxazosin(DB00590)|Doxepin(DB01142)|Dronedarone(DB04855)|Droxidopa(DB06262)|Epinephrine(DB00668)|Ergoloid mesylate(DB01049)|Ergotamine(DB00696)|Fenoldopam(DB00800)|Imipramine(DB00458)|Labetalol(DB00598)|Maprotiline(DB00934)|Mephentermine(DB01365)|Methotrimeprazine(DB01403)|Methoxamine(DB00723)|Mianserin(DB06148)|Midodrine(DB00211)|Mirtazapine(DB00370)|Nicardipine(DB00622)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Oxymetazoline(DB00935)|Pergolide(DB01186)|Phenoxybenzamine(DB00925)|Phenylephrine(DB00388)|Prazosin(DB00457)|Promazine(DB00420)|Propiomazine(DB00777)|Quetiapine(DB01224)|Sertindole(DB06144)|Silodosin(DB06207)|Tamsulosin(DB00706)|Terazosin(DB01162)|Xylometazoline(DB06694)	AGGATGATGGCCAGAGGCAGG	0.642																																						dbGAP											0													28.0	29.0	29.0					8																	26721895		2203	4300	6503	-	-	-	SO:0001583	missense	0			L31774	CCDS6052.1, CCDS6053.1, CCDS6054.1, CCDS34869.1	8p21.2	2012-08-08	2012-05-09		ENSG00000120907	ENSG00000120907		"""GPCR / Class A : Adrenoceptors : alpha"""	277	protein-coding gene	gene with protein product		104221	"""adrenergic, alpha-1A-, receptor"""	ADRA1C			Standard	NM_033303		Approved	ADRA1L1	uc003xfh.1	P35348	OTTHUMG00000099459	ENST00000519229.1:c.592G>A	8.37:g.26721895C>T	ENSP00000430793:p.Ala198Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9NPY0	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Adrene_rcpt_A1Cs,prints_7TM_GPCR_Rhodpsn,prints_Adrnrgc_rcpt	p.A198T	ENST00000519229.1	37	c.592		8	.	.	.	.	.	.	.	.	.	.	c	12.51	1.959644	0.34565	.	.	ENSG00000120907	ENST00000380586;ENST00000380587;ENST00000380582;ENST00000380581;ENST00000519229;ENST00000354550;ENST00000276393;ENST00000380573;ENST00000380572;ENST00000358857	T;T;T;T;T;T;T;T;T;T	0.37915	1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17;1.17	5.11	-2.78	0.05859	GPCR, rhodopsin-like superfamily (1);	0.408803	0.26193	N	0.025795	T	0.23846	0.0577	L	0.31294	0.92	0.24055	N	0.996036	B;B;B;B;B;B	0.18741	0.03;0.03;0.0;0.005;0.0;0.003	B;B;B;B;B;B	0.20577	0.03;0.03;0.004;0.007;0.002;0.02	T	0.10776	-1.0615	10	0.33141	T	0.24	.	13.862	0.63566	0.0:0.2618:0.0:0.7382	.	198;198;198;198;198;198	P35348-9;P35348-8;P35348;P35348-4;P35348-3;B0ZBD3	.;.;ADA1A_HUMAN;.;.;.	T	198	ENSP00000369960:A198T;ENSP00000369961:A198T;ENSP00000369956:A198T;ENSP00000369955:A198T;ENSP00000430793:A198T;ENSP00000346557:A198T;ENSP00000276393:A198T;ENSP00000369947:A198T;ENSP00000369946:A198T;ENSP00000351725:A198T	ENSP00000276393:A198T	A	-	1	0	ADRA1A	26777812	0.801000	0.28930	0.925000	0.36789	0.968000	0.65278	0.236000	0.17967	-0.892000	0.03935	0.558000	0.71614	GCC	ADRA1A	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000120907		0.642	ADRA1A-009	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	ADRA1A	HGNC	protein_coding	OTTHUMT00000376207.1	48	0.00	0	C	NM_033303		26721895	26721895	-1	no_errors	ENST00000380586	ensembl	human	known	69_37n	missense	32	38.46	20	SNP	0.989	T
AEBP1	165	genome.wustl.edu	37	7	44151612	44151612	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:44151612C>T	ENST00000223357.3	+	16	2305	c.2000C>T	c.(1999-2001)tCa>tTa	p.S667L	MIR4649_ENST00000582839.1_RNA|AEBP1_ENST00000450684.2_Missense_Mutation_p.S242L	NM_001129.3	NP_001120.3	Q8IUX7	AEBP1_HUMAN	AE binding protein 1	667	Interaction with PTEN. {ECO:0000250}.				cell adhesion (GO:0007155)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	carboxypeptidase activity (GO:0004180)|metallocarboxypeptidase activity (GO:0004181)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(8)|lung(13)|upper_aerodigestive_tract(2)	33						CTGGTGCCCTCACTGAACCCT	0.642																																						dbGAP											0													66.0	56.0	59.0					7																	44151612		2203	4300	6503	-	-	-	SO:0001583	missense	0			D86479	CCDS5476.1	7p	2008-07-18	2001-11-28		ENSG00000106624	ENSG00000106624			303	protein-coding gene	gene with protein product	"""aortic carboxypeptidase-like protein"", ""adipocyte enhancer binding protein 1"""	602981	"""AE-binding protein 1"""			8920928	Standard	NM_001129		Approved	ACLP	uc003tkb.4	Q8IUX7	OTTHUMG00000023362	ENST00000223357.3:c.2000C>T	7.37:g.44151612C>T	ENSP00000223357:p.Ser667Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14113|Q59ER7|Q6ZSC7|Q7KZ79	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.S667L	ENST00000223357.3	37	c.2000	CCDS5476.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.203266	0.95033	.	.	ENSG00000106624	ENST00000223357;ENST00000450684	T;T	0.11495	2.77;2.77	5.42	5.42	0.78866	Peptidase M14, carboxypeptidase A (2);	0.000000	0.85682	D	0.000000	T	0.40094	0.1103	M	0.85542	2.76	0.80722	D	1	D;D	0.71674	0.981;0.998	P;D	0.76575	0.829;0.988	T	0.39354	-0.9618	10	0.87932	D	0	-10.7461	18.8301	0.92135	0.0:1.0:0.0:0.0	.	242;667	Q8IUX7-2;Q8IUX7	.;AEBP1_HUMAN	L	667;242	ENSP00000223357:S667L;ENSP00000398878:S242L	ENSP00000223357:S667L	S	+	2	0	AEBP1	44118137	1.000000	0.71417	0.949000	0.38748	0.953000	0.61014	7.752000	0.85141	2.538000	0.85594	0.462000	0.41574	TCA	AEBP1	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000106624		0.642	AEBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AEBP1	HGNC	protein_coding	OTTHUMT00000250993.2	75	0.00	0	C	NM_001129		44151612	44151612	+1	no_errors	ENST00000223357	ensembl	human	known	69_37n	missense	87	13.86	14	SNP	1.000	T
AGAP2	116986	genome.wustl.edu	37	12	58129195	58129195	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:58129195C>G	ENST00000547588.1	-	2	1183	c.1184G>C	c.(1183-1185)aGc>aCc	p.S395T	AGAP2_ENST00000257897.3_Missense_Mutation_p.S59T	NM_001122772.2	NP_001116244.1	Q99490	AGAP2_HUMAN	ArfGAP with GTPase domain, ankyrin repeat and PH domain 2	395					axon guidance (GO:0007411)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of protein catabolic process (GO:0042177)|protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ARF GTPase activator activity (GO:0008060)|GTP binding (GO:0005525)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|large_intestine(7)|lung(20)|prostate(3)|skin(1)|stomach(1)	48						CCATTCCTGGCTATTGATCAC	0.597																																						dbGAP											0													108.0	89.0	96.0					12																	58129195		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF413077	CCDS8951.1, CCDS44932.1	12q13.2	2013-05-30	2008-09-22	2008-09-22	ENSG00000135439	ENSG00000135439		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16921	protein-coding gene	gene with protein product		605476	"""centaurin, gamma 1"""	CENTG1			Standard	NM_001122772		Approved		uc001spq.3	Q99490	OTTHUMG00000170285	ENST00000547588.1:c.1184G>C	12.37:g.58129195C>G	ENSP00000449241:p.Ser395Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9F7|O00578|Q548E0|Q8IWU3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_MIRO-like,pfam_Small_GTPase,pfam_Ankyrin_rpt,pfam_Pleckstrin_homology,superfamily_ArfGAP,superfamily_Ankyrin_rpt-contain_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Pleckstrin_homology,smart_ArfGAP,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_ArfGAP,prints_ArfGAP,prints_Small_GTPase	p.S395T	ENST00000547588.1	37	c.1184	CCDS44932.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.84|18.84	3.708545|3.708545	0.68615|0.68615	.|.	.|.	ENSG00000135439|ENSG00000135439	ENST00000257897;ENST00000547588|ENST00000328568	T;T|.	0.49432|.	1.25;0.78|.	4.75|4.75	4.75|4.75	0.60458|0.60458	.|.	0.092472|.	0.64402|.	D|.	0.000001|.	T|.	0.62502|.	0.2433|.	L|L	0.47190|0.47190	1.495|1.495	0.41683|0.41683	D|D	0.989308|0.989308	P;P;P|.	0.48503|.	0.911;0.569;0.64|.	P;B;B|.	0.50617|.	0.646;0.332;0.314|.	T|.	0.59716|.	-0.7402|.	10|.	0.56958|.	D|.	0.05|.	.|.	15.5011|15.5011	0.75700|0.75700	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	59;395;395|.	Q99490-2;F8VVT9;Q99490|.	.;.;AGAP2_HUMAN|.	T|Y	59;395|258	ENSP00000257897:S59T;ENSP00000449241:S395T|.	ENSP00000257897:S59T|.	S|X	-|-	2|3	0|2	AGAP2|AGAP2	56415462|56415462	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	3.567000|3.567000	0.53813|0.53813	2.582000|2.582000	0.87167|0.87167	0.561000|0.561000	0.74099|0.74099	AGC|TAG	AGAP2	-	NULL	ENSG00000135439		0.597	AGAP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AGAP2	HGNC	protein_coding	OTTHUMT00000408367.1	38	0.00	0	C	NM_014770		58129195	58129195	-1	no_errors	ENST00000547588	ensembl	human	known	69_37n	missense	51	17.46	11	SNP	1.000	G
AGBL1	123624	genome.wustl.edu	37	15	87097660	87097660	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:87097660G>A	ENST00000441037.2	+	20	2843	c.2748G>A	c.(2746-2748)gaG>gaA	p.E916E	AGBL1_ENST00000389298.3_Silent_p.E647E|AGBL1_ENST00000421325.2_Silent_p.E916E	NM_152336.2	NP_689549.2	Q96MI9	CBPC4_HUMAN	ATP/GTP binding protein-like 1	916					C-terminal protein deglutamylation (GO:0035609)|protein side chain deglutamylation (GO:0035610)	cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(3)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|liver(2)|lung(28)|ovary(2)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	62						TTCTCGTGGAGAAATCTCGAG	0.502																																						dbGAP											0													34.0	35.0	35.0					15																	87097660		1899	4110	6009	-	-	-	SO:0001819	synonymous_variant	0			AK056872	CCDS58398.1	15q25.3	2014-06-23			ENSG00000166748	ENSG00000166748			26504	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 4"""	615496				21074048, 24094747	Standard	NM_152336		Approved	FLJ32310, CCP4	uc002blz.1	Q96MI9	OTTHUMG00000149978	ENST00000441037.2:c.2748G>A	15.37:g.87097660G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1A4X5|A6NJH6|C9JHL5	Silent	SNP	pfam_Peptidase_M14,superfamily_ARM-type_fold	p.E916	ENST00000441037.2	37	c.2748	CCDS58398.1	15																																																																																			AGBL1	-	pfam_Peptidase_M14	ENSG00000166748		0.502	AGBL1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	AGBL1	HGNC	protein_coding	OTTHUMT00000314929.5	44	0.00	0	G	NM_152336		87097660	87097660	+1	no_errors	ENST00000441037	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.998	A
AGR2	10551	genome.wustl.edu	37	7	16834591	16834591	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:16834591G>A	ENST00000419304.2	-	7	599	c.447C>T	c.(445-447)ctC>ctT	p.L149L	AGR2_ENST00000401412.1_Silent_p.L149L|AGR2_ENST00000419572.2_Silent_p.L169L	NM_006408.3	NP_006399.1	O95994	AGR2_HUMAN	anterior gradient 2	149					lung goblet cell differentiation (GO:0060480)|mucus secretion (GO:0070254)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|mitochondrion (GO:0005739)	dystroglycan binding (GO:0002162)			endometrium(2)|lung(1)|prostate(1)|skin(2)	6	Lung NSC(10;0.0376)|all_lung(11;0.0855)			UCEC - Uterine corpus endometrioid carcinoma (126;0.184)		CGTAAGCATAGAGACGATTTG	0.418																																						dbGAP											0													153.0	122.0	133.0					7																	16834591		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF038451	CCDS5364.1	7p21.3	2013-07-31	2013-07-31		ENSG00000106541	ENSG00000106541		"""Protein disulfide isomerases"""	328	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 17"""	606358	"""anterior gradient 2 homolog (Xenopus laevis)"""			9790916	Standard	NM_006408		Approved	XAG-2, HAG-2, AG2, PDIA17	uc003str.3	O95994	OTTHUMG00000023446	ENST00000419304.2:c.447C>T	7.37:g.16834591G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	superfamily_Thioredoxin-like_fold	p.L169	ENST00000419304.2	37	c.507	CCDS5364.1	7																																																																																			AGR2	-	NULL	ENSG00000106541		0.418	AGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGR2	HGNC	protein_coding	OTTHUMT00000207594.2	68	0.00	0	G	NM_006408		16834591	16834591	-1	no_errors	ENST00000419572	ensembl	human	known	69_37n	silent	69	15.85	13	SNP	1.000	A
PHYKPL	85007	genome.wustl.edu	37	5	177649544	177649544	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:177649544C>T	ENST00000308158.5	-	8	973	c.739G>A	c.(739-741)Gag>Aag	p.E247K	PHYKPL_ENST00000481811.1_Intron	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	247						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	ACCTGGATCTCATCTGCAACA	0.582																																						dbGAP											0													77.0	83.0	81.0					5																	177649544		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.739G>A	5.37:g.177649544C>T	ENSP00000310978:p.Glu247Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.E247K	ENST00000308158.5	37	c.739	CCDS4434.1	5	.	.	.	.	.	.	.	.	.	.	C	36	5.615215	0.96649	.	.	ENSG00000175309	ENST00000308158	D	0.96685	-4.09	5.34	5.34	0.76211	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.116040	0.64402	D	0.000009	D	0.99208	0.9725	H	0.99903	4.92	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.98391	1.0563	10	0.87932	D	0	-0.3133	16.9191	0.86159	0.0:1.0:0.0:0.0	.	247;247	A8K7P6;Q8IUZ5	.;AT2L2_HUMAN	K	247	ENSP00000310978:E247K	ENSP00000310978:E247K	E	-	1	0	AGXT2L2	177582150	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	7.681000	0.84073	2.680000	0.91292	0.563000	0.77884	GAG	AGXT2L2	-	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000175309		0.582	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2L2	HGNC	protein_coding	OTTHUMT00000253477.1	48	0.00	0	C	NM_032921		177649544	177649544	-1	no_errors	ENST00000308158	ensembl	human	known	69_37n	missense	72	10.98	9	SNP	1.000	T
AIM1	202	genome.wustl.edu	37	6	107016364	107016364	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:107016364C>G	ENST00000369066.3	+	20	5582	c.5095C>G	c.(5095-5097)Caa>Gaa	p.Q1699E	AIM1_ENST00000535438.1_Missense_Mutation_p.Q518E	NM_001624.2	NP_001615	Q9UMX9	S45A2_HUMAN	absent in melanoma 1	0					developmental pigmentation (GO:0048066)|melanin biosynthetic process (GO:0042438)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)				breast(8)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(7)|large_intestine(13)|lung(20)|ovary(5)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	69	Breast(9;0.0138)|all_epithelial(6;0.169)	all_cancers(87;4.67e-25)|all_epithelial(87;5.46e-21)|Acute lymphoblastic leukemia(125;2.15e-07)|all_hematologic(75;5.28e-06)|Colorectal(196;3.46e-05)|all_lung(197;5.94e-05)|Lung NSC(302;7.26e-05)|Ovarian(999;0.00473)	Epithelial(6;0.00114)|all cancers(7;0.00726)|BRCA - Breast invasive adenocarcinoma(8;0.0114)|OV - Ovarian serous cystadenocarcinoma(5;0.0305)	all cancers(137;1.73e-50)|Epithelial(106;2.42e-48)|OV - Ovarian serous cystadenocarcinoma(136;1.51e-27)|BRCA - Breast invasive adenocarcinoma(108;0.00104)|GBM - Glioblastoma multiforme(226;0.00858)		ACAGTATGATCAAAATCACAT	0.398																																						dbGAP											0													173.0	172.0	172.0					6																	107016364		2203	4300	6503	-	-	-	SO:0001583	missense	0			U83115	CCDS34506.1	6q21	2014-01-29			ENSG00000112297	ENSG00000112297			356	protein-coding gene	gene with protein product	"""suppression of tumorigenicity 4"", ""beta-gamma crystallin domain containing 1"""	601797	"""suppression of tumorigenicity 4 (malignant melanoma)"""	ST4		1680551, 12693952	Standard	NM_001624		Approved	CRYBG1	uc003prh.3	Q9Y4K1	OTTHUMG00000015302	ENST00000369066.3:c.5095C>G	6.37:g.107016364C>G	ENSP00000358062:p.Gln1699Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P2P0|Q9BTM3	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.Q1699E	ENST00000369066.3	37	c.5095	CCDS34506.1	6	.	.	.	.	.	.	.	.	.	.	C	23.2	4.381489	0.82792	.	.	ENSG00000112297	ENST00000369066;ENST00000535438	T;T	0.26223	1.75;1.75	6.17	6.17	0.99709	Ricin B-related lectin (1);Ricin B lectin (3);	0.101172	0.64402	D	0.000002	T	0.26268	0.0641	L	0.36672	1.1	0.35537	D	0.802778	P;P	0.50272	0.855;0.933	B;P	0.56343	0.339;0.796	T	0.02047	-1.1223	10	0.72032	D	0.01	.	14.1996	0.65693	0.0:0.9299:0.0:0.0701	.	518;1699	B4DU04;Q9Y4K1	.;AIM1_HUMAN	E	1699;518	ENSP00000358062:Q1699E;ENSP00000439183:Q518E	ENSP00000358062:Q1699E	Q	+	1	0	AIM1	107123057	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	3.037000	0.49775	2.941000	0.99782	0.655000	0.94253	CAA	AIM1	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	ENSG00000112297		0.398	AIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AIM1	HGNC	protein_coding	OTTHUMT00000041669.1	56	0.00	0	C			107016364	107016364	+1	no_errors	ENST00000369066	ensembl	human	known	69_37n	missense	50	15.25	9	SNP	1.000	G
AKAP13	11214	genome.wustl.edu	37	15	86064806	86064806	+	Splice_Site	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:86064806G>C	ENST00000394518.2	+	3	276	c.181G>C	c.(181-183)Ggt>Cgt	p.G61R	AKAP13_ENST00000361243.2_Splice_Site_p.G61R|AKAP13_ENST00000560302.1_Splice_Site_p.G61R	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	61					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						CATTGCTCCTGGTAAGTATTT	0.403																																					Melanoma(94;603 1453 3280 32295 32951)	dbGAP											0													165.0	155.0	158.0					15																	86064806		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.181+1G>C	15.37:g.86064806G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.G61R	ENST00000394518.2	37	c.181	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	G	21.8	4.200939	0.79015	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.62232	0.04;0.04	5.52	4.6	0.57074	.	.	.	.	.	T	0.75361	0.3839	M	0.62723	1.935	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;1.0	T	0.77968	-0.2388	9	0.87932	D	0	.	12.5564	0.56257	0.0816:0.0:0.9184:0.0	.	61;61;61	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	R	61;61;60;60	ENSP00000354718:G61R;ENSP00000378026:G61R	ENSP00000354718:G61R	G	+	1	0	AKAP13	83865810	1.000000	0.71417	1.000000	0.80357	0.942000	0.58702	4.518000	0.60510	1.465000	0.48006	0.591000	0.81541	GGT	AKAP13	-	NULL	ENSG00000170776		0.403	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	55	0.00	0	G	NM_007200	Missense_Mutation	86064806	86064806	+1	no_errors	ENST00000361243	ensembl	human	known	69_37n	missense	48	17.24	10	SNP	1.000	C
AKAP17A	8227	genome.wustl.edu	37	X	1714352	1714352	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:1714352G>A	ENST00000313871.3	+	3	1034	c.838G>A	c.(838-840)Gaa>Aaa	p.E280K	AKAP17A_ENST00000381261.3_Missense_Mutation_p.E280K	NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	280					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						GAAGCTTCAGGAACTGGAGCA	0.522																																						dbGAP											0													252.0	267.0	262.0					X																	1714352		2203	4296	6499	-	-	-	SO:0001583	missense	0			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.838G>A	X.37:g.1714352G>A	ENSP00000324827:p.Glu280Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	NULL	p.E280K	ENST00000313871.3	37	c.838	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	g	6.507	0.461743	0.12342	.	.	ENSG00000197976	ENST00000313871;ENST00000381261	T;T	0.62639	1.69;0.01	2.43	1.5	0.22942	.	0.000000	0.64402	U	0.000001	T	0.56187	0.1968	.	.	.	0.09310	N	1	P;P	0.47962	0.84;0.903	B;P	0.52554	0.298;0.702	T	0.51601	-0.8685	9	0.09843	T	0.71	.	11.0242	0.47736	0.0:0.1871:0.8129:0.0	.	280;280	Q02040-3;Q02040	.;AK17A_HUMAN	K	280	ENSP00000324827:E280K;ENSP00000370660:E280K	ENSP00000324827:E280K	E	+	1	0	AKAP17A	1674352	1.000000	0.71417	0.012000	0.15200	0.399000	0.30720	6.516000	0.73755	0.111000	0.17947	0.100000	0.15512	GAA	AKAP17A	-	NULL	ENSG00000197976		0.522	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	79	0.00	0	G	NM_005088		1714352	1714352	+1	no_errors	ENST00000313871	ensembl	human	known	69_37n	missense	124	10.14	14	SNP	1.000	A
ALKBH1	8846	genome.wustl.edu	37	14	78140451	78140451	+	Missense_Mutation	SNP	C	C	T	rs373180036		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:78140451C>T	ENST00000216489.3	-	6	889	c.874G>A	c.(874-876)Gtc>Atc	p.V292I		NM_006020.2	NP_006011.2	Q13686	ALKB1_HUMAN	alkB, alkylation repair homolog 1 (E. coli)	292	Fe2OG dioxygenase. {ECO:0000255|PROSITE- ProRule:PRU00805}.				developmental growth (GO:0048589)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA dealkylation involved in DNA repair (GO:0006307)|DNA demethylation (GO:0080111)|DNA repair (GO:0006281)|in utero embryonic development (GO:0001701)|negative regulation of neuron apoptotic process (GO:0043524)|neuron migration (GO:0001764)|neuron projection development (GO:0031175)|oxidative demethylation (GO:0070989)|placenta development (GO:0001890)|RNA repair (GO:0042245)	mitochondrion (GO:0005739)|nuclear euchromatin (GO:0005719)	chemoattractant activity (GO:0042056)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)			endometrium(2)|lung(4)|ovary(1)|prostate(1)|skin(1)	9			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0291)		TTTGGAAGGACACGAGGGACT	0.547																																						dbGAP											0													60.0	57.0	58.0					14																	78140451		2203	4300	6503	-	-	-	SO:0001583	missense	0			X91992	CCDS32127.1	14q24	2014-07-23	2006-02-09	2006-02-09	ENSG00000100601	ENSG00000100601		"""Alkylation repair homologs"""	17911	protein-coding gene	gene with protein product		605345	"""alkB, alkylation repair homolog (E. coli)"""	ALKBH		8600462	Standard	XM_005268165		Approved	hABH, alkB, ABH	uc001xuc.1	Q13686	OTTHUMG00000171542	ENST00000216489.3:c.874G>A	14.37:g.78140451C>T	ENSP00000216489:p.Val292Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TAU1|Q9ULA7	Missense_Mutation	SNP	tigrfam_Alkb	p.V292I	ENST00000216489.3	37	c.874	CCDS32127.1	14	.	.	.	.	.	.	.	.	.	.	C	9.469	1.095160	0.20471	.	.	ENSG00000100601	ENST00000216489	T	0.10763	2.84	5.95	5.95	0.96441	Oxoglutarate/iron-dependent oxygenase (1);	0.059696	0.64402	D	0.000001	T	0.05044	0.0135	N	0.03881	-0.34	0.50171	D	0.999855	P	0.48089	0.905	B	0.43331	0.416	T	0.38265	-0.9669	10	0.02654	T	1	-26.1834	13.5695	0.61838	0.0:0.9294:0.0:0.0706	.	292	Q13686	ALKB1_HUMAN	I	292	ENSP00000216489:V292I	ENSP00000216489:V292I	V	-	1	0	ALKBH1	77210204	1.000000	0.71417	0.996000	0.52242	0.995000	0.86356	4.423000	0.59861	2.824000	0.97209	0.655000	0.94253	GTC	ALKBH1	-	NULL	ENSG00000100601		0.547	ALKBH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALKBH1	HGNC	protein_coding	OTTHUMT00000414037.1	37	0.00	0	C	NM_006020		78140451	78140451	-1	no_errors	ENST00000216489	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	0.997	T
ALOXE3	59344	genome.wustl.edu	37	17	8012650	8012650	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:8012650G>A	ENST00000448843.2	-	12	1744	c.1404C>T	c.(1402-1404)atC>atT	p.I468I	ALOXE3_ENST00000318227.3_Silent_p.I600I|ALOXE3_ENST00000380149.1_Silent_p.I624I	NM_021628.2	NP_067641.2	Q9BYJ1	LOXE3_HUMAN	arachidonate lipoxygenase 3	468	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|ceramide biosynthetic process (GO:0046513)|establishment of skin barrier (GO:0061436)|fat cell differentiation (GO:0045444)|hepoxilin biosynthetic process (GO:0051122)|linoleic acid metabolic process (GO:0043651)|lipoxygenase pathway (GO:0019372)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|sensory perception of pain (GO:0019233)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)	hepoxilin A3 synthase activity (GO:0051120)|iron ion binding (GO:0005506)|lyase activity (GO:0016829)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen, incorporation of two atoms of oxygen (GO:0016702)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)	31						CTTGCCTCCCGATGGACGTGA	0.672																																						dbGAP											0													53.0	45.0	48.0					17																	8012650		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ269499	CCDS11130.1, CCDS54084.1	17p13.1	2009-07-10			ENSG00000179148	ENSG00000179148	1.13.11.-	"""Arachidonate lipoxygenases"""	13743	protein-coding gene	gene with protein product		607206					Standard	NM_021628		Approved	eLOX3, E-LOX	uc010vuo.2	Q9BYJ1	OTTHUMG00000108179	ENST00000448843.2:c.1404C>T	17.37:g.8012650G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R981|B7Z3W0|Q3ZB74|Q9H4F2|Q9HC22	Silent	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_LipOase_C	p.I600	ENST00000448843.2	37	c.1800	CCDS11130.1	17																																																																																			ALOXE3	-	pfam_LipOase_C,superfamily_LipOase_C	ENSG00000179148		0.672	ALOXE3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOXE3	HGNC	protein_coding	OTTHUMT00000441475.1	71	0.00	0	G			8012650	8012650	-1	no_errors	ENST00000318227	ensembl	human	known	69_37n	silent	66	21.43	18	SNP	0.987	A
ANKDD1B	728780	genome.wustl.edu	37	5	74959223	74959223	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:74959223G>A	ENST00000601380.2	+	11	1276	c.1100G>A	c.(1099-1101)gGa>gAa	p.G367E	ANKDD1B_ENST00000506596.1_3'UTR	NM_001276713.1	NP_001263642.1	A6NHY2	AKD1B_HUMAN	ankyrin repeat and death domain containing 1B	367					signal transduction (GO:0007165)												TTTTAGCAAGGAAAGACTGCC	0.458																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS64180.1	5q13.3	2013-01-10	2006-02-16		ENSG00000189045	ENSG00000189045		"""Ankyrin repeat domain containing"""	32525	protein-coding gene	gene with protein product							Standard	NM_001276713		Approved		uc031ski.1	A6NHY2	OTTHUMG00000162490	ENST00000601380.2:c.1100G>A	5.37:g.74959223G>A	ENSP00000471417:p.Gly367Glu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E300K	ENST00000601380.2	37	c.898		5	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500866	0.64298	.	.	ENSG00000189045	ENST00000504514	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	T	0.72463	0.3463	M	0.85197	2.74	.	.	.	.	.	.	.	.	.	T	0.81102	-0.1085	4	.	.	.	-21.5976	10.8809	0.46937	0.087:0.0:0.913:0.0	.	.	.	.	K	300	.	.	E	+	1	0	ANKDD1B	74994979	1.000000	0.71417	0.997000	0.53966	0.851000	0.48451	4.171000	0.58236	2.635000	0.89317	0.561000	0.74099	GAA	ANKDD1B	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000189045		0.458	ANKDD1B-002	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	ANKDD1B	HGNC	protein_coding	OTTHUMT00000369148.4	43	0.00	0	G	XM_373090		74959223	74959223	+1	pseudogene:no_stop_codon	ENST00000504514	ensembl	human	putative	69_37n	missense	30	16.67	6	SNP	1.000	A
ANKDD1B	728780	genome.wustl.edu	37	5	74959226	74959226	+	Missense_Mutation	SNP	A	A	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:74959226A>G	ENST00000601380.2	+	11	1279	c.1103A>G	c.(1102-1104)aAg>aGg	p.K368R	ANKDD1B_ENST00000506596.1_3'UTR	NM_001276713.1	NP_001263642.1	A6NHY2	AKD1B_HUMAN	ankyrin repeat and death domain containing 1B	368					signal transduction (GO:0007165)												TAGCAAGGAAAGACTGCCCTG	0.463																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS64180.1	5q13.3	2013-01-10	2006-02-16		ENSG00000189045	ENSG00000189045		"""Ankyrin repeat domain containing"""	32525	protein-coding gene	gene with protein product							Standard	NM_001276713		Approved		uc031ski.1	A6NHY2	OTTHUMG00000162490	ENST00000601380.2:c.1103A>G	5.37:g.74959226A>G	ENSP00000471417:p.Lys368Arg	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R301G	ENST00000601380.2	37	c.901		5	.	.	.	.	.	.	.	.	.	.	A	13.90	2.373937	0.42105	.	.	ENSG00000189045	ENST00000504514	.	.	.	5.07	-1.37	0.09056	.	.	.	.	.	T	0.29321	0.0730	N	0.16066	0.365	.	.	.	.	.	.	.	.	.	T	0.40175	-0.9577	4	.	.	.	-9.9116	9.6005	0.39601	0.5881:0.0:0.4119:0.0	.	.	.	.	G	301	.	.	R	+	1	2	ANKDD1B	74994982	1.000000	0.71417	0.950000	0.38849	0.881000	0.50899	1.977000	0.40589	-0.387000	0.07809	-0.379000	0.06801	AGA	ANKDD1B	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000189045		0.463	ANKDD1B-002	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	ANKDD1B	HGNC	protein_coding	OTTHUMT00000369148.4	42	0.00	0	A	XM_373090		74959226	74959226	+1	pseudogene:no_stop_codon	ENST00000504514	ensembl	human	putative	69_37n	missense	30	18.92	7	SNP	0.999	G
ANKRD31	256006	genome.wustl.edu	37	5	74412437	74412437	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:74412437G>A	ENST00000274361.3	-	18	4129	c.3938C>T	c.(3937-3939)tCa>tTa	p.S1313L	ANKRD31_ENST00000504022.1_5'UTR|ANKRD31_ENST00000506364.2_Missense_Mutation_p.S1370L	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	1313										endometrium(1)|kidney(4)	5						AAGGGAAGATGAGTCAATAGT	0.313																																						dbGAP											0													117.0	101.0	106.0					5																	74412437		692	1591	2283	-	-	-	SO:0001583	missense	0			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.3938C>T	5.37:g.74412437G>A	ENSP00000274361:p.Ser1313Leu	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S1313L	ENST00000274361.3	37	c.3938		5	.	.	.	.	.	.	.	.	.	.	G	7.738	0.700693	0.15172	.	.	ENSG00000145700	ENST00000274361	T	0.60171	0.21	5.65	0.499	0.16914	.	.	.	.	.	T	0.33469	0.0864	N	0.16478	0.41	0.09310	N	1	.	.	.	.	.	.	T	0.18524	-1.0334	7	0.29301	T	0.29	.	1.231	0.01943	0.2535:0.1505:0.4411:0.155	.	.	.	.	L	1313	ENSP00000274361:S1313L	ENSP00000274361:S1313L	S	-	2	0	ANKRD31	74448193	0.002000	0.14202	0.031000	0.17742	0.005000	0.04900	-0.051000	0.11885	0.058000	0.16222	-0.136000	0.14681	TCA	ANKRD31	-	NULL	ENSG00000145700		0.313	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		31	0.00	0	G	NM_001164443		74412437	74412437	-1	no_errors	ENST00000274361	ensembl	human	known	69_37n	missense	34	12.82	5	SNP	0.429	A
ANKDD1B	728780	genome.wustl.edu	37	5	74959231	74959231	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:74959231G>A	ENST00000601380.2	+	11	1284	c.1108G>A	c.(1108-1110)Gcc>Acc	p.A370T	ANKDD1B_ENST00000506596.1_3'UTR	NM_001276713.1	NP_001263642.1	A6NHY2	AKD1B_HUMAN	ankyrin repeat and death domain containing 1B	370					signal transduction (GO:0007165)												AGGAAAGACTGCCCTGGCTGT	0.473																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS64180.1	5q13.3	2013-01-10	2006-02-16		ENSG00000189045	ENSG00000189045		"""Ankyrin repeat domain containing"""	32525	protein-coding gene	gene with protein product							Standard	NM_001276713		Approved		uc031ski.1	A6NHY2	OTTHUMG00000162490	ENST00000601380.2:c.1108G>A	5.37:g.74959231G>A	ENSP00000471417:p.Ala370Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.L302	ENST00000601380.2	37	c.906		5																																																																																			ANKDD1B	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	ENSG00000189045		0.473	ANKDD1B-002	PUTATIVE	not_organism_supported|basic|appris_principal	protein_coding	ANKDD1B	HGNC	protein_coding	OTTHUMT00000369148.4	42	0.00	0	G	XM_373090		74959231	74959231	+1	pseudogene:no_stop_codon	ENST00000504514	ensembl	human	putative	69_37n	silent	28	22.22	8	SNP	1.000	A
ANXA1	301	genome.wustl.edu	37	9	75778434	75778434	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:75778434G>A	ENST00000376911.1	+	7	1480	c.598G>A	c.(598-600)Gat>Aat	p.D200N	ANXA1_ENST00000257497.6_Missense_Mutation_p.D200N			P04083	ANXA1_HUMAN	annexin A1	200					alpha-beta T cell differentiation (GO:0046632)|arachidonic acid secretion (GO:0050482)|cell surface receptor signaling pathway (GO:0007166)|cellular component movement (GO:0006928)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to hydrogen peroxide (GO:0070301)|endocrine pancreas development (GO:0031018)|estrous cycle phase (GO:0060206)|gliogenesis (GO:0042063)|hepatocyte differentiation (GO:0070365)|inflammatory response (GO:0006954)|insulin secretion (GO:0030073)|keratinocyte differentiation (GO:0030216)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of interleukin-8 secretion (GO:2000483)|neutrophil clearance (GO:0097350)|neutrophil homeostasis (GO:0001780)|peptide cross-linking (GO:0018149)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|positive regulation of neutrophil apoptotic process (GO:0033031)|positive regulation of prostaglandin biosynthetic process (GO:0031394)|positive regulation of vesicle fusion (GO:0031340)|regulation of cell proliferation (GO:0042127)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to interleukin-1 (GO:0070555)|response to peptide hormone (GO:0043434)|response to X-ray (GO:0010165)|signal transduction (GO:0007165)	cell surface (GO:0009986)|cilium (GO:0005929)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|calcium-dependent protein binding (GO:0048306)|phospholipase A2 inhibitor activity (GO:0019834)|phospholipid binding (GO:0005543)|protein binding, bridging (GO:0030674)|receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(1)|large_intestine(1)|lung(5)	8		all_epithelial(88;2.54e-11)		OV - Ovarian serous cystadenocarcinoma(323;2.82e-06)|GBM - Glioblastoma multiforme(74;0.0325)	Amcinonide(DB00288)|Dexamethasone(DB01234)|Hydrocortisone(DB00741)	AGACTTGGCTGATTCAGATGC	0.433																																						dbGAP											0													182.0	163.0	170.0					9																	75778434		2203	4300	6503	-	-	-	SO:0001583	missense	0			X05908	CCDS6645.1	9q21.13	2013-02-25			ENSG00000135046	ENSG00000135046		"""Annexins"", ""Endogenous ligands"""	533	protein-coding gene	gene with protein product		151690		ANX1, LPC1		2936963	Standard	NM_000700		Approved		uc004ajf.1	P04083	OTTHUMG00000020016	ENST00000376911.1:c.598G>A	9.37:g.75778434G>A	ENSP00000366109:p.Asp200Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Annexin_repeat,superfamily_Annexin,smart_Annexin_repeat,prints_Annexin,prints_AnnexinI	p.D200N	ENST00000376911.1	37	c.598	CCDS6645.1	9	.	.	.	.	.	.	.	.	.	.	G	34	5.297895	0.95574	.	.	ENSG00000135046	ENST00000257497;ENST00000376911	T;T	0.05319	3.46;3.46	6.03	6.03	0.97812	.	0.040777	0.85682	N	0.000000	T	0.15825	0.0381	L	0.58669	1.825	0.80722	D	1	P	0.45283	0.855	P	0.49361	0.608	T	0.00456	-1.1728	10	0.29301	T	0.29	.	20.5568	0.99304	0.0:0.0:1.0:0.0	.	200	P04083	ANXA1_HUMAN	N	200	ENSP00000257497:D200N;ENSP00000366109:D200N	ENSP00000257497:D200N	D	+	1	0	ANXA1	74968254	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.163000	0.77524	2.861000	0.98227	0.655000	0.94253	GAT	ANXA1	-	superfamily_Annexin,prints_AnnexinI	ENSG00000135046		0.433	ANXA1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ANXA1	HGNC	protein_coding	OTTHUMT00000052665.1	77	0.00	0	G	NM_000700		75778434	75778434	+1	no_errors	ENST00000257497	ensembl	human	known	69_37n	missense	81	14.74	14	SNP	1.000	A
ANKS6	203286	genome.wustl.edu	37	9	101536318	101536318	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:101536318C>T	ENST00000353234.4	-	9	1709	c.1662G>A	c.(1660-1662)ctG>ctA	p.L554L	ANKS6_ENST00000375018.1_Silent_p.L554L|ANKS6_ENST00000375019.2_Silent_p.L253L|ANKS6_ENST00000540940.1_Silent_p.L359L			Q68DC2	ANKS6_HUMAN	ankyrin repeat and sterile alpha motif domain containing 6	554						cilium (GO:0005929)|cytoplasm (GO:0005737)				endometrium(3)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|prostate(2)|skin(1)	21		Acute lymphoblastic leukemia(62;0.0527)				TGACTGCTTTCAGCTTGTCAC	0.582																																						dbGAP											0													42.0	48.0	46.0					9																	101536318		1930	4134	6064	-	-	-	SO:0001819	synonymous_variant	0			AK094247	CCDS43856.1	9q31.1	2013-09-10	2006-02-17	2006-02-17	ENSG00000165138	ENSG00000165138		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	26724	protein-coding gene	gene with protein product		615370	"""sterile alpha motif domain containing 6"", ""ankyrin repeat domain 14"""	SAMD6, ANKRD14		23793029	Standard	XM_005251793		Approved	FLJ36928, NPHP16	uc004ayu.3	Q68DC2	OTTHUMG00000020347	ENST00000353234.4:c.1662G>A	9.37:g.101536318C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A0SE62|Q5VSL0|Q5VSL2|Q5VSL3|Q5VSL4|Q68DB8|Q6P2R2|Q8N9L6|Q96D62	Missense_Mutation	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.E23K	ENST00000353234.4	37	c.67	CCDS43856.1	9	.	.	.	.	.	.	.	.	.	.	C	10.21	1.287742	0.23478	.	.	ENSG00000165138	ENST00000444472	.	.	.	5.48	3.62	0.41486	.	.	.	.	.	T	0.61261	0.2333	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.56811	-0.7917	4	.	.	.	-13.0884	10.5287	0.44965	0.0:0.8419:0.0:0.1581	.	.	.	.	K	23	.	.	E	-	1	0	ANKS6	100576139	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	1.592000	0.36676	0.670000	0.31165	0.561000	0.74099	GAA	ANKS6	-	NULL	ENSG00000165138		0.582	ANKS6-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKS6	HGNC	protein_coding	OTTHUMT00000277053.1	50	0.00	0	C	NM_173551		101536318	101536318	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000444472	ensembl	human	putative	69_37n	missense	46	11.54	6	SNP	1.000	T
AP1B1	162	genome.wustl.edu	37	22	29750804	29750804	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr22:29750804G>C	ENST00000405198.1	-	6	804	c.773C>G	c.(772-774)tCt>tGt	p.S258C	AP1B1_ENST00000356015.2_Missense_Mutation_p.S258C|AP1B1_ENST00000402502.1_Missense_Mutation_p.S258C|AP1B1_ENST00000317368.7_Missense_Mutation_p.S258C|AP1B1_ENST00000357586.2_Missense_Mutation_p.S258C|AP1B1_ENST00000415447.1_Missense_Mutation_p.S258C|AP1B1_ENST00000432560.2_Missense_Mutation_p.S258C			Q10567	AP1B1_HUMAN	adaptor-related protein complex 1, beta 1 subunit	258					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	clathrin adaptor complex (GO:0030131)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)|transporter activity (GO:0005215)			endometrium(3)|large_intestine(4)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						CTTCACAGCAGAGAGCACCAC	0.577																																						dbGAP											0													99.0	80.0	86.0					22																	29750804		2203	4300	6503	-	-	-	SO:0001583	missense	0			L13939	CCDS13855.1, CCDS13856.1, CCDS13856.2, CCDS54515.1	22q12.2	2010-06-18			ENSG00000100280	ENSG00000100280			554	protein-coding gene	gene with protein product		600157		ADTB1, CLAPB2		7987321, 8812422	Standard	NM_145730		Approved	BAM22, AP105A	uc003afj.3	Q10567	OTTHUMG00000151109	ENST00000405198.1:c.773C>G	22.37:g.29750804G>C	ENSP00000384194:p.Ser258Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JRD1|F8WDL0|P78436|Q20WL3|Q86X54	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_B-adaptin_app_sub_C,pfam_HEAT,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Armadillo,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP_complex_bsu	p.S258C	ENST00000405198.1	37	c.773	CCDS13855.1	22	.	.	.	.	.	.	.	.	.	.	G	28.6	4.934701	0.92458	.	.	ENSG00000100280	ENST00000357586;ENST00000356015;ENST00000432560;ENST00000405198;ENST00000317368;ENST00000402502;ENST00000415447;ENST00000421126	T;T;T;T;T;T;T;T	0.28895	1.59;1.59;1.59;1.59;1.59;1.59;1.59;1.59	5.29	5.29	0.74685	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.64159	0.2573	M	0.89287	3.02	0.80722	D	1	D;D;D;D	0.89917	0.961;0.986;1.0;1.0	P;P;D;D	0.91635	0.737;0.629;0.999;0.999	T	0.70706	-0.4798	10	0.87932	D	0	-14.6378	18.7168	0.91678	0.0:0.0:1.0:0.0	.	258;258;258;258	F8WDL0;Q10567-2;Q10567;Q10567-3	.;.;AP1B1_HUMAN;.	C	258	ENSP00000350199:S258C;ENSP00000348297:S258C;ENSP00000400065:S258C;ENSP00000384194:S258C;ENSP00000319361:S258C;ENSP00000386071:S258C;ENSP00000387612:S258C;ENSP00000400022:S258C	ENSP00000319361:S258C	S	-	2	0	AP1B1	28080804	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.657000	0.98554	2.761000	0.94854	0.655000	0.94253	TCT	AP1B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP_complex_bsu	ENSG00000100280		0.577	AP1B1-001	KNOWN	basic|CCDS	protein_coding	AP1B1	HGNC	protein_coding	OTTHUMT00000321374.1	78	0.00	0	G	NM_001127		29750804	29750804	-1	no_errors	ENST00000357586	ensembl	human	known	69_37n	missense	59	21.33	16	SNP	1.000	C
APLNR	187	genome.wustl.edu	37	11	57004110	57004110	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:57004110G>C	ENST00000606794.1	-	1	565	c.369C>G	c.(367-369)ctC>ctG	p.L123L		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	123					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GGTCGAAGCTGAGGCCGGTGA	0.627																																						dbGAP											0													44.0	33.0	36.0					11																	57004110		2200	4295	6495	-	-	-	SO:0001819	synonymous_variant	0			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.369C>G	11.37:g.57004110G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_APJ_rcpt,prints_7TM_GPCR_Rhodpsn,prints_P2_purnocptor,prints_ATII_rcpt,pfscan_GPCR_Rhodpsn_supfam	p.L123	ENST00000606794.1	37	c.369	CCDS7950.1	11																																																																																			APLNR	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,prints_7TM_GPCR_Rhodpsn,prints_ATII_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000134817		0.627	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1	52	0.00	0	G	NM_005161		57004110	57004110	-1	no_errors	ENST00000257254	ensembl	human	known	69_37n	silent	42	23.64	13	SNP	1.000	C
APOL2	23780	genome.wustl.edu	37	22	36633125	36633125	+	Intron	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr22:36633125G>A	ENST00000249066.6	-	2	344				APOL2_ENST00000451256.2_Missense_Mutation_p.S62F|APOL2_ENST00000476579.1_5'UTR|APOL2_ENST00000358502.5_Intron	NM_145637.1	NP_663612.1	Q9BQE5	APOL2_HUMAN	apolipoprotein L, 2						acute-phase response (GO:0006953)|cholesterol metabolic process (GO:0008203)|lipid metabolic process (GO:0006629)|lipid transport (GO:0006869)|lipoprotein metabolic process (GO:0042157)|maternal process involved in female pregnancy (GO:0060135)|multicellular organismal development (GO:0007275)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|membrane (GO:0016020)	high-density lipoprotein particle binding (GO:0008035)|lipid binding (GO:0008289)|receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)|urinary_tract(2)	9						TACTTGTGAGGAGCTGCATCC	0.612																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF324224	CCDS43014.1	22q12.3	2013-09-20			ENSG00000128335	ENSG00000128335		"""Apolipoproteins"""	619	protein-coding gene	gene with protein product	"""apolipoprotein L-II"""	607252				10591208, 11374903	Standard	NM_145637		Approved	APOL-II	uc003apa.3	Q9BQE5	OTTHUMG00000150634	ENST00000249066.6:c.132+2361C>T	22.37:g.36633125G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B0QYK7|O95915|Q59GW9|Q5TH96|Q969T6|Q9BT28|Q9UGT1|Q9UH10	Missense_Mutation	SNP	pfam_ApoL	p.S62F	ENST00000249066.6	37	c.185	CCDS43014.1	22	.	.	.	.	.	.	.	.	.	.	G	10.73	1.431329	0.25813	.	.	ENSG00000128335	ENST00000451256	T	0.05447	3.44	1.26	-2.52	0.06346	.	.	.	.	.	T	0.03871	0.0109	.	.	.	0.09310	N	1	P	0.50156	0.932	B	0.38106	0.265	T	0.35126	-0.9801	8	0.72032	D	0.01	.	2.7647	0.05317	0.0:0.3114:0.3764:0.3122	.	62	B4E1T5	.	F	62	ENSP00000403153:S62F	ENSP00000403153:S62F	S	-	2	0	APOL2	34963071	.	.	0.000000	0.03702	0.019000	0.09904	.	.	-0.203000	0.10251	0.205000	0.17691	TCC	APOL2	-	NULL	ENSG00000128335		0.612	APOL2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	APOL2	HGNC	protein_coding	OTTHUMT00000319279.1	20	0.00	0	G	NM_145637		36633125	36633125	-1	no_errors	ENST00000451256	ensembl	human	putative	69_37n	missense	8	52.94	9	SNP	0.000	A
ARHGAP39	80728	genome.wustl.edu	37	8	145770835	145770835	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:145770835C>T	ENST00000276826.5	-	5	2520	c.2319G>A	c.(2317-2319)aaG>aaA	p.K773K	ARHGAP39_ENST00000377307.2_Silent_p.K773K|ARHGAP39_ENST00000540274.1_Silent_p.K773K|ARHGAP39_ENST00000528810.1_5'UTR			Q9C0H5	RHG39_HUMAN	Rho GTPase activating protein 39	773	MyTH4. {ECO:0000255|PROSITE- ProRule:PRU00359}.				axon guidance (GO:0007411)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|nucleus (GO:0005634)				NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	22						CGCTCCAGCCCTTGGTGGCCA	0.677																																						dbGAP											0													45.0	45.0	45.0					8																	145770835		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0				CCDS34971.1	8q24.3	2011-06-29			ENSG00000147799	ENSG00000147799		"""Rho GTPase activating proteins"""	29351	protein-coding gene	gene with protein product	"""RhoGAP93B homolog (Drosophila)"", ""crossGAP homolog (Drosophila)"""	615880				15755809	Standard	XM_005272344		Approved	KIAA1688, Vilse, CrGAP	uc003zds.1	Q9C0H5	OTTHUMG00000165182	ENST00000276826.5:c.2319G>A	8.37:g.145770835C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1I1	Silent	SNP	pfam_RhoGAP_dom,pfam_MyTH4_dom,superfamily_Rho_GTPase_activation_prot,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_MyTH4_dom,smart_RhoGAP_dom,pfscan_MyTH4_dom,pfscan_WW_Rsp5_WWP,pfscan_RhoGAP_dom	p.K773	ENST00000276826.5	37	c.2319		8																																																																																			ARHGAP39	-	pfam_MyTH4_dom,smart_MyTH4_dom,pfscan_MyTH4_dom	ENSG00000147799		0.677	ARHGAP39-001	KNOWN	basic|appris_principal	protein_coding	ARHGAP39	HGNC	protein_coding	OTTHUMT00000382509.1	32	0.00	0	C			145770835	145770835	-1	no_errors	ENST00000377307	ensembl	human	known	69_37n	silent	47	20.34	12	SNP	0.990	T
ARID2	196528	genome.wustl.edu	37	12	46240703	46240703	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:46240703G>A	ENST00000334344.6	+	12	1735	c.1563G>A	c.(1561-1563)gaG>gaA	p.E521E	ARID2_ENST00000479608.1_3'UTR|ARID2_ENST00000444670.1_Silent_p.E131E|ARID2_ENST00000422737.1_Silent_p.E372E	NM_152641.2	NP_689854.2	Q68CP9	ARID2_HUMAN	AT rich interactive domain 2 (ARID, RFX-like)	521					chromatin modification (GO:0016568)|nucleosome disassembly (GO:0006337)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|liver(20)|lung(34)|ovary(7)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	116	Lung SC(27;0.192)|Renal(347;0.236)	Lung NSC(34;0.106)|all_lung(34;0.22)	OV - Ovarian serous cystadenocarcinoma(5;0.00691)	GBM - Glioblastoma multiforme(48;0.0153)		TAGATAGTGAGAAGTTTGCTT	0.368			"""N, S, F"""		hepatocellular carcinoma																																	dbGAP		Rec	yes		12	12q12	196528	AT rich interactive domain 2		E	0													164.0	167.0	166.0					12																	46240703		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS31783.1	12q13.11	2013-02-07			ENSG00000189079	ENSG00000189079		"""-"""	18037	protein-coding gene	gene with protein product		609539					Standard	NM_152641		Approved	KIAA1557, DKFZp686G052, FLJ30619, BAF200	uc001ros.1	Q68CP9	OTTHUMG00000150487	ENST00000334344.6:c.1563G>A	12.37:g.46240703G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15KG9|Q5EB51|Q645I3|Q6ZRY5|Q7Z3I5|Q86T28|Q96SJ6|Q9HCL5	Silent	SNP	pfam_ARID/BRIGHT_DNA-bd,pfam_DNA-bd_RFX,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.E521	ENST00000334344.6	37	c.1563	CCDS31783.1	12																																																																																			ARID2	-	pfam_DNA-bd_RFX	ENSG00000189079		0.368	ARID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARID2	HGNC	protein_coding	OTTHUMT00000318380.2	89	0.00	0	G	XM_350875		46240703	46240703	+1	no_errors	ENST00000334344	ensembl	human	known	69_37n	silent	70	11.39	9	SNP	1.000	A
ATAD2	29028	genome.wustl.edu	37	8	124361560	124361560	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:124361560C>G	ENST00000287394.5	-	14	1878	c.1771G>C	c.(1771-1773)Gat>Cat	p.D591H	MIR548AA1_ENST00000384971.2_RNA|ATAD2_ENST00000521903.1_5'UTR	NM_014109.3	NP_054828.2	Q6PL18	ATAD2_HUMAN	ATPase family, AAA domain containing 2	591					ATP catabolic process (GO:0006200)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(12)|lung(16)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	48	Lung NSC(37;1.25e-09)|Ovarian(258;0.00838)		STAD - Stomach adenocarcinoma(47;0.00288)			AATTCTCTATCAAAGCGACCA	0.383																																						dbGAP											0													116.0	106.0	110.0					8																	124361560		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC019909	CCDS6343.1	8q24.13	2014-01-21		2007-02-08	ENSG00000156802	ENSG00000156802		"""ATPases / AAA-type"""	30123	protein-coding gene	gene with protein product		611941				12477932	Standard	NM_014109		Approved	PRO2000, DKFZp667N1320, MGC5254, MGC29843, CT137	uc003yqh.4	Q6PL18	OTTHUMG00000165090	ENST00000287394.5:c.1771G>C	8.37:g.124361560C>G	ENSP00000287394:p.Asp591His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CR1|Q658P2|Q68CQ0|Q6PJV6|Q8N890|Q9UHS5	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_Bromodomain,superfamily_Bromodomain,smart_AAA+_ATPase,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.D591H	ENST00000287394.5	37	c.1771	CCDS6343.1	8	.	.	.	.	.	.	.	.	.	.	C	29.1	4.977506	0.92982	.	.	ENSG00000156802	ENST00000287394	D	0.96073	-3.9	5.7	5.7	0.88788	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.144353	0.64402	N	0.000008	D	0.98324	0.9444	M	0.90870	3.155	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98925	1.0785	10	0.87932	D	0	-17.6267	19.8338	0.96646	0.0:1.0:0.0:0.0	.	591	Q6PL18	ATAD2_HUMAN	H	591	ENSP00000287394:D591H	ENSP00000287394:D591H	D	-	1	0	ATAD2	124430741	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.818000	0.86416	2.692000	0.91855	0.591000	0.81541	GAT	ATAD2	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase	ENSG00000156802		0.383	ATAD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATAD2	HGNC	protein_coding	OTTHUMT00000381766.2	26	0.00	0	C	NM_014109		124361560	124361560	-1	no_errors	ENST00000287394	ensembl	human	known	69_37n	missense	37	17.78	8	SNP	1.000	G
ATF3	467	genome.wustl.edu	37	1	212788564	212788564	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:212788564C>T	ENST00000341491.4	+	2	466	c.201C>T	c.(199-201)gtC>gtT	p.V67V	ATF3_ENST00000366987.2_Silent_p.V67V|ATF3_ENST00000336937.4_Silent_p.V38V|ATF3_ENST00000366983.1_Silent_p.V67V|ATF3_ENST00000492118.1_Intron|ATF3_ENST00000366985.1_Silent_p.V10V|RN7SL512P_ENST00000578962.1_RNA	NM_001040619.2|NM_001206488.2|NM_001674.3	NP_001035709.1|NP_001193417.2|NP_001665.1	P18847	ATF3_HUMAN	activating transcription factor 3	67					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|gluconeogenesis (GO:0006094)|positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal muscle cell differentiation (GO:0035914)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	6				OV - Ovarian serous cystadenocarcinoma(81;0.00628)|all cancers(67;0.0097)|GBM - Glioblastoma multiforme(131;0.0388)|Epithelial(68;0.0933)	Pseudoephedrine(DB00852)	CAGTCACTGTCAGCGACAGAC	0.542																																						dbGAP											0													62.0	60.0	61.0					1																	212788564		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			L19871	CCDS1506.1, CCDS41464.1, CCDS55688.1, CCDS58059.1	1q32.3	2013-01-10			ENSG00000162772	ENSG00000162772		"""basic leucine zipper proteins"""	785	protein-coding gene	gene with protein product		603148				7515060	Standard	NM_001674		Approved		uc021pit.1	P18847	OTTHUMG00000036747	ENST00000341491.4:c.201C>T	1.37:g.212788564C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VTZ2|Q6ICQ9|Q7Z566|Q8WYM6	Silent	SNP	pfam_bZIP_1,pfam_bZIP_2,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.V67	ENST00000341491.4	37	c.201	CCDS1506.1	1																																																																																			ATF3	-	superfamily_Euk_TF_DNA-bd	ENSG00000162772		0.542	ATF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATF3	HGNC	protein_coding	OTTHUMT00000089296.1	29	0.00	0	C	NM_001674		212788564	212788564	+1	no_errors	ENST00000341491	ensembl	human	known	69_37n	silent	57	10.94	7	SNP	0.947	T
ATP7B	540	genome.wustl.edu	37	13	52531744	52531744	+	Splice_Site	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:52531744C>G	ENST00000242839.4	-	9	2512		c.e9-1		ATP7B_ENST00000400366.3_Splice_Site|ATP7B_ENST00000344297.5_Splice_Site|ATP7B_ENST00000417240.2_Splice_Site|ATP7B_ENST00000400370.3_Intron|ATP7B_ENST00000482841.1_Splice_Site|ATP7B_ENST00000448424.2_Splice_Site|ATP7B_ENST00000418097.2_Splice_Site	NM_000053.3	NP_000044.2	P35670	ATP7B_HUMAN	ATPase, Cu++ transporting, beta polypeptide						cellular copper ion homeostasis (GO:0006878)|cellular zinc ion homeostasis (GO:0006882)|copper ion import (GO:0015677)|copper ion transport (GO:0006825)|intracellular copper ion transport (GO:0015680)|ion transmembrane transport (GO:0034220)|lactation (GO:0007595)|response to copper ion (GO:0046688)|sequestering of calcium ion (GO:0051208)|transmembrane transport (GO:0055085)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|late endosome (GO:0005770)|membrane (GO:0016020)|mitochondrion (GO:0005739)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|copper ion binding (GO:0005507)|copper-exporting ATPase activity (GO:0004008)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(7)|lung(23)|ovary(1)|prostate(3)|skin(4)|stomach(2)	55		Breast(56;0.000207)|Lung NSC(96;0.000845)|Prostate(109;0.0235)|Hepatocellular(98;0.065)|all_neural(104;0.19)		GBM - Glioblastoma multiforme(99;5.25e-08)	Carboplatin(DB00958)|Cisplatin(DB00515)|Oxaliplatin(DB00526)	AGGTTTTGCTCTAGGAAATAA	0.488									Wilson disease																													dbGAP											0													113.0	116.0	115.0					13																	52531744		1925	4140	6065	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database		U11700	CCDS41892.1, CCDS45049.1, CCDS58293.1	13q14.3	2012-10-22	2005-11-29		ENSG00000123191	ENSG00000123191	3.6.3.4	"""ATPases / P-type"""	870	protein-coding gene	gene with protein product	"""Wilson disease"", ""copper pump 2"", ""copper-transporting ATPase 2"""	606882	"""ATPase, Cu++ transporting, beta polypeptide (Wilson disease)"""	WND		8298641, 8298639	Standard	NM_000053		Approved		uc001vfw.2	P35670	OTTHUMG00000017406	ENST00000242839.4:c.2356-1G>C	13.37:g.52531744C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16318|Q16319|Q4U3V3|Q59FJ9|Q5T7X7	Splice_Site	SNP	-	e9-1	ENST00000242839.4	37	c.2356-1	CCDS41892.1	13	.	.	.	.	.	.	.	.	.	.	C	24.7	4.563808	0.86335	.	.	ENSG00000123191	ENST00000242839;ENST00000400366;ENST00000344297;ENST00000417240;ENST00000448424;ENST00000418097	.	.	.	5.05	5.05	0.67936	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.4199	0.90587	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ATP7B	51429745	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.674000	0.83992	2.343000	0.79666	0.655000	0.94253	.	ATP7B	-	-	ENSG00000123191		0.488	ATP7B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP7B	HGNC	protein_coding	OTTHUMT00000045981.1	43	0.00	0	C	NM_000053	Intron	52531744	52531744	-1	no_errors	ENST00000242839	ensembl	human	known	69_37n	splice_site	41	10.87	5	SNP	1.000	G
ATP8B2	57198	genome.wustl.edu	37	1	154306644	154306644	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:154306644G>T	ENST00000368489.3	+	10	750	c.750G>T	c.(748-750)tgG>tgT	p.W250C	ATP8B2_ENST00000426445.1_3'UTR|ATP8B2_ENST00000368487.3_Missense_Mutation_p.W217C|ATP8B2_ENST00000341822.2_Missense_Mutation_p.W236C	NM_020452.3	NP_065185.1	P98198	AT8B2_HUMAN	ATPase, aminophospholipid transporter, class I, type 8B, member 2	236					ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)		IL6R/ATP8B2(2)	breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(25)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	51	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCCTCTACTGGAAGGAAAATA	0.512																																						dbGAP											0													216.0	225.0	222.0					1																	154306644		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB032963	CCDS1066.1, CCDS41405.1	1q21.3	2012-03-09	2012-03-09		ENSG00000143515	ENSG00000143515		"""ATPases / P-type"""	13534	protein-coding gene	gene with protein product		605867	"""ATPase, class I, type 8B, member 2"""			10574461, 11015572	Standard	NM_020452		Approved	ATPID, KIAA1137	uc001fex.3	P98198	OTTHUMG00000035979	ENST00000368489.3:c.750G>T	1.37:g.154306644G>T	ENSP00000357475:p.Trp250Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3P4|Q6NT69|Q7Z486|Q96I43|Q96NQ7	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.W250C	ENST00000368489.3	37	c.750	CCDS1066.1	1	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907377	0.72868	.	.	ENSG00000143515	ENST00000368487;ENST00000368489;ENST00000341822	T;T;T	0.75589	-0.95;-0.95;-0.95	5.3	5.3	0.74995	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.069961	0.64402	D	0.000008	D	0.86632	0.5979	M	0.91406	3.205	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.999	D;D;D	0.77004	0.989;0.927;0.951	D	0.88694	0.3211	10	0.87932	D	0	.	13.4199	0.60992	0.0:0.1576:0.8424:0.0	.	236;250;217	P98198;P98198-3;P98198-4	AT8B2_HUMAN;.;.	C	217;250;236	ENSP00000357472:W217C;ENSP00000357475:W250C;ENSP00000340448:W236C	ENSP00000340448:W236C	W	+	3	0	ATP8B2	152573268	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.665000	0.83852	2.761000	0.94854	0.591000	0.81541	TGG	ATP8B2	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl	ENSG00000143515		0.512	ATP8B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B2	HGNC	protein_coding	OTTHUMT00000087658.2	47	0.00	0	G	NM_020452		154306644	154306644	+1	no_errors	ENST00000368489	ensembl	human	known	69_37n	missense	61	11.59	8	SNP	1.000	T
AURKA	6790	genome.wustl.edu	37	20	54961556	54961556	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:54961556G>C	ENST00000347343.2	-	3	343	c.76C>G	c.(76-78)Ctc>Gtc	p.L26V	AURKA_ENST00000395914.1_Missense_Mutation_p.L26V|AURKA_ENST00000395909.4_Missense_Mutation_p.L26V|AURKA_ENST00000395915.3_Missense_Mutation_p.L26V|AURKA_ENST00000371356.2_Missense_Mutation_p.L26V|AURKA_ENST00000395911.1_Missense_Mutation_p.L26V|AURKA_ENST00000395913.3_Missense_Mutation_p.L26V|AURKA_ENST00000395907.1_Missense_Mutation_p.L26V|AURKA_ENST00000312783.6_Missense_Mutation_p.L26V	NM_003600.2	NP_003591.2	O14965	AURKA_HUMAN	aurora kinase A	26					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|anterior/posterior axis specification (GO:0009948)|centrosome localization (GO:0051642)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein binding (GO:0032091)|negative regulation of spindle checkpoint (GO:0090233)|neuron projection extension (GO:1990138)|positive regulation of mitosis (GO:0045840)|positive regulation of oocyte maturation (GO:1900195)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|protein autophosphorylation (GO:0046777)|protein localization to centrosome (GO:0071539)|protein phosphorylation (GO:0006468)|regulation of centrosome cycle (GO:0046605)|regulation of protein stability (GO:0031647)|spindle assembly involved in female meiosis I (GO:0007057)|spindle stabilization (GO:0043146)	axon hillock (GO:0043203)|centrosome (GO:0005813)|cytosol (GO:0005829)|germinal vesicle (GO:0042585)|meiotic spindle (GO:0072687)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(2)|cervix(1)|endometrium(1)|large_intestine(4)|lung(9)|ovary(2)|prostate(1)|skin(2)	22			Colorectal(105;0.202)			TGAGTCACGAGAACACGTTTT	0.418																																					Melanoma(34;439 1292 51416 52695)|GBM(144;1525 2517 48902 51835)|Esophageal Squamous(191;569 2880 14195 30540)	dbGAP											0													68.0	67.0	68.0					20																	54961556		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC001280	CCDS13451.1	20q13	2012-07-23	2003-07-21	2003-07-23	ENSG00000087586	ENSG00000087586		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11393	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 47"", ""Aurora-A kinase"""	603072	"""serine/threonine kinase 15"", "" serine/threonine kinase 6"""	STK15, STK6		9174055, 9771714	Standard	NM_003600		Approved	BTAK, AurA, STK7, ARK1, PPP1R47, AIK	uc002xxi.1	O14965	OTTHUMG00000032796	ENST00000347343.2:c.76C>G	20.37:g.54961556G>C	ENSP00000216911:p.Leu26Val	Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5F9|O60445|O75873|Q9BQD6|Q9UPG5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L26V	ENST00000347343.2	37	c.76	CCDS13451.1	20	.	.	.	.	.	.	.	.	.	.	G	3.316	-0.139736	0.06669	.	.	ENSG00000087586	ENST00000395909;ENST00000395914;ENST00000347343;ENST00000395915;ENST00000312783;ENST00000371356;ENST00000395913;ENST00000395911;ENST00000395907;ENST00000441357;ENST00000420474;ENST00000422322;ENST00000456249;ENST00000451915	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.69561	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.41;0.06;2.79;2.56;2.48;2.21	5.11	2.04	0.26737	.	0.469084	0.21074	N	0.080607	T	0.47985	0.1475	L	0.34521	1.04	0.09310	N	1	B;B;B;B;B;B;B	0.18310	0.027;0.003;0.001;0.0;0.001;0.0;0.0	B;B;B;B;B;B;B	0.22880	0.042;0.007;0.002;0.0;0.001;0.001;0.001	T	0.27773	-1.0064	10	0.09590	T	0.72	-21.3396	7.2709	0.26256	0.1487:0.0:0.7136:0.1377	.	26;26;26;26;26;26;26	Q5QPD1;Q5QPD2;A3KFJ1;Q5QPD4;A3KFJ0;B2R6Z3;O14965	.;.;.;.;.;.;AURKA_HUMAN	V	26	ENSP00000379245:L26V;ENSP00000379250:L26V;ENSP00000216911:L26V;ENSP00000379251:L26V;ENSP00000321591:L26V;ENSP00000360407:L26V;ENSP00000379249:L26V;ENSP00000379247:L26V;ENSP00000379243:L26V;ENSP00000393452:L26V;ENSP00000388073:L26V;ENSP00000405042:L26V;ENSP00000405170:L26V;ENSP00000401358:L26V	ENSP00000321591:L26V	L	-	1	0	AURKA	54394963	0.019000	0.18553	0.003000	0.11579	0.021000	0.10359	1.915000	0.39976	0.245000	0.21373	0.563000	0.77884	CTC	AURKA	-	NULL	ENSG00000087586		0.418	AURKA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AURKA	HGNC	protein_coding	OTTHUMT00000079804.3	35	0.00	0	G	NM_003600		54961556	54961556	-1	no_errors	ENST00000312783	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.007	C
BAG5	9529	genome.wustl.edu	37	14	104027051	104027051	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:104027051G>A	ENST00000445922.2	-	2	697	c.451C>T	c.(451-453)Cac>Tac	p.H151Y	APOPT1_ENST00000409074.2_5'Flank|RP11-73M18.2_ENST00000472726.2_5'Flank|BAG5_ENST00000299204.4_Missense_Mutation_p.H151Y|BAG5_ENST00000337322.4_Missense_Mutation_p.H192Y|RP11-894P9.2_ENST00000556332.1_RNA|APOPT1_ENST00000247618.4_5'Flank|APOPT1_ENST00000556253.2_5'Flank	NM_004873.3	NP_004864.1	Q9UL15	BAG5_HUMAN	BCL2-associated athanogene 5	151	BAG 2. {ECO:0000255|PROSITE- ProRule:PRU00369}.				negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|negative regulation of protein refolding (GO:0061084)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of ubiquitin-protein transferase activity (GO:0051444)|neuron death (GO:0070997)|protein folding (GO:0006457)|regulation of inclusion body assembly (GO:0090083)	inclusion body (GO:0016234)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	chaperone binding (GO:0051087)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)			endometrium(5)|large_intestine(4)|lung(7)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	24		Melanoma(154;0.155)	Epithelial(46;0.144)			GTTAAAGTGTGATACCTTGCT	0.458																																					NSCLC(171;1832 2055 18950 31566 41632)	dbGAP											0													96.0	94.0	95.0					14																	104027051		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF095195	CCDS9982.1, CCDS41995.1	14q32	2008-08-01				ENSG00000166170			941	protein-coding gene	gene with protein product		603885				9873016, 15603737	Standard	NM_001015048		Approved		uc001ynh.2	Q9UL15		ENST00000445922.2:c.451C>T	14.37:g.104027051G>A	ENSP00000391713:p.His151Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	O94950|Q86W59	Missense_Mutation	SNP	pfam_BAG_domain,smart_BAG_domain,pfscan_BAG_domain	p.H192Y	ENST00000445922.2	37	c.574	CCDS9982.1	14	.	.	.	.	.	.	.	.	.	.	G	12.68	2.011645	0.35511	.	.	ENSG00000166170	ENST00000299204;ENST00000445922;ENST00000337322;ENST00000557666	T;T;T;T	0.80909	-1.41;-1.41;-1.43;-1.42	5.55	4.66	0.58398	.	0.259245	0.37012	N	0.002289	T	0.69717	0.3142	N	0.19112	0.55	0.22866	N	0.998638	B;B	0.06786	0.0;0.001	B;B	0.08055	0.0;0.003	T	0.63346	-0.6658	10	0.66056	D	0.02	-21.6388	14.6693	0.68932	0.0699:0.0:0.9301:0.0	.	151;192	Q9UL15;Q9UL15-2	BAG5_HUMAN;.	Y	151;151;192;151	ENSP00000299204:H151Y;ENSP00000391713:H151Y;ENSP00000338814:H192Y;ENSP00000450497:H151Y	ENSP00000299204:H151Y	H	-	1	0	BAG5	103096804	1.000000	0.71417	0.377000	0.26055	0.998000	0.95712	4.631000	0.61304	1.355000	0.45865	0.655000	0.94253	CAC	BAG5	-	NULL	ENSG00000166170		0.458	BAG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAG5	HGNC	protein_coding	OTTHUMT00000414990.1	61	0.00	0	G			104027051	104027051	-1	no_errors	ENST00000337322	ensembl	human	known	69_37n	missense	74	15.91	14	SNP	0.991	A
BAI2	576	genome.wustl.edu	37	1	32203099	32203099	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:32203099C>T	ENST00000373658.3	-	20	3251	c.2910G>A	c.(2908-2910)ctG>ctA	p.L970L	BAI2_ENST00000527361.1_Silent_p.L970L|BAI2_ENST00000465256.1_5'Flank|BAI2_ENST00000373655.2_Silent_p.L970L|BAI2_ENST00000257070.4_Silent_p.L970L|BAI2_ENST00000440175.2_Silent_p.L612L|BAI2_ENST00000398538.1_Silent_p.L958L|BAI2_ENST00000398547.1_Silent_p.L903L|BAI2_ENST00000398542.1_Silent_p.L903L|BAI2_ENST00000398556.3_Silent_p.L918L	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	970					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		GGCAGAAGTTCAGCAAGATGA	0.617																																						dbGAP											0													133.0	118.0	123.0					1																	32203099		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.2910G>A	1.37:g.32203099C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.L970	ENST00000373658.3	37	c.2910	CCDS346.2	1																																																																																			BAI2	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like	ENSG00000121753		0.617	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	38	0.00	0	C	NM_001703		32203099	32203099	-1	no_errors	ENST00000373658	ensembl	human	known	69_37n	silent	63	12.50	9	SNP	0.996	T
DHX32	55760	genome.wustl.edu	37	10	127541804	127541804	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:127541804C>G	ENST00000284690.3	-	5	1583				BCCIP_ENST00000368759.5_Missense_Mutation_p.L321V|DHX32_ENST00000368721.1_Intron|DHX32_ENST00000284688.6_Intron	NM_018180.2	NP_060650.2	Q7L7V1	DHX32_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 32							mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|stomach(1)	29		all_lung(145;0.00751)|Lung NSC(174;0.0115)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGGAATTGCTCTGTCATAATA	0.418																																						dbGAP											0													121.0	123.0	123.0					10																	127541804		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0				CCDS7652.1	10q26.11-q26.2	2008-01-07	2004-01-29	2004-01-30	ENSG00000089876	ENSG00000089876		"""DEAH-boxes"""	16717	protein-coding gene	gene with protein product		607960	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 32"""	DDX32			Standard	NM_018180		Approved	FLJ10889, FLJ10694, DHLP1	uc001ljf.1	Q7L7V1	OTTHUMG00000019238	ENST00000284690.3:c.1093-593G>C	10.37:g.127541804C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSV2|D3DRF9|Q49AG5|Q5T3L0|Q5T3L5|Q96NY1|Q9BUN0|Q9H769|Q9NSL5|Q9NV74|Q9NVJ7	Missense_Mutation	SNP	NULL	p.L321V	ENST00000284690.3	37	c.961	CCDS7652.1	10	.	.	.	.	.	.	.	.	.	.	C	8.266	0.812277	0.16537	.	.	ENSG00000107949	ENST00000368759	T	0.52295	0.67	2.93	1.01	0.19927	.	0.240790	0.36066	N	0.002811	T	0.30696	0.0773	.	.	.	0.09310	N	1	P	0.36909	0.573	B	0.33521	0.165	T	0.22277	-1.0221	9	0.87932	D	0	-38.1008	3.6153	0.08075	0.2433:0.6209:0.0:0.1359	.	321	Q9P287-2	.	V	321	ENSP00000357748:L321V	ENSP00000357748:L321V	L	+	1	2	BCCIP	127531794	0.000000	0.05858	0.002000	0.10522	0.002000	0.02628	-0.315000	0.08081	0.264000	0.21851	-0.136000	0.14681	CTG	BCCIP	-	NULL	ENSG00000107949		0.418	DHX32-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCCIP	HGNC	protein_coding	OTTHUMT00000050945.2	30	0.00	0	C	NM_018180		127541804	127541804	+1	no_errors	ENST00000368759	ensembl	human	known	69_37n	missense	23	39.47	15	SNP	0.002	G
BCL2L11	10018	genome.wustl.edu	37	2	111921798	111921798	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:111921798G>C	ENST00000393256.3	+	4	860	c.587G>C	c.(586-588)aGa>aCa	p.R196T	BCL2L11_ENST00000308659.8_Missense_Mutation_p.R136T	NM_001204106.1|NM_006538.4|NM_138621.4|NM_138627.3	NP_001191035.1|NP_006529.1|NP_619527.1|NP_619533.1	O43521	B2L11_HUMAN	BCL2-like 11 (apoptosis facilitator)	196					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|apoptotic process involved in embryonic digit morphogenesis (GO:1902263)|apoptotic signaling pathway (GO:0097190)|B cell apoptotic process (GO:0001783)|B cell homeostasis (GO:0001782)|brain development (GO:0007420)|cell-matrix adhesion (GO:0007160)|cellular process regulating host cell cycle in response to virus (GO:0060154)|developmental pigmentation (GO:0048066)|ear development (GO:0043583)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|kidney development (GO:0001822)|male gonad development (GO:0008584)|mammary gland development (GO:0030879)|myeloid cell homeostasis (GO:0002262)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis of dentin-containing tooth (GO:0042475)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic process by virus (GO:0060139)|positive regulation of cell cycle (GO:0045787)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902110)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of protein homooligomerization (GO:0032464)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|post-embryonic organ morphogenesis (GO:0048563)|regulation of developmental pigmentation (GO:0048070)|regulation of organ growth (GO:0046620)|response to endoplasmic reticulum stress (GO:0034976)|spermatogenesis (GO:0007283)|spleen development (GO:0048536)|T cell homeostasis (GO:0043029)|thymocyte apoptotic process (GO:0070242)|thymus development (GO:0048538)|tube formation (GO:0035148)	BIM-BCL-2 complex (GO:0097141)|BIM-BCL-xl complex (GO:0097140)|cytosol (GO:0005829)|extrinsic component of membrane (GO:0019898)|mitochondrial outer membrane (GO:0005741)				endometrium(4)|large_intestine(3)|lung(2)|prostate(2)	11						CTGGTGTGGAGAATGCATTGA	0.463																																						dbGAP											0													125.0	103.0	111.0					2																	111921798		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF032458	CCDS2089.1, CCDS2092.1, CCDS42731.1, CCDS56131.1, CCDS56132.1, CCDS56133.1, CCDS56134.1, CCDS56135.1, CCDS56136.1, CCDS74560.1, CCDS74561.1, CCDS74559.1	2q13	2014-09-17			ENSG00000153094	ENSG00000153094			994	protein-coding gene	gene with protein product		603827				9731710, 9430630	Standard	NM_006538		Approved	BOD, BimL, BimEL, BimS, BIM	uc002tgv.1	O43521	OTTHUMG00000131256	ENST00000393256.3:c.587G>C	2.37:g.111921798G>C	ENSP00000376943:p.Arg196Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2W2|O43522|Q0MSE7|Q0MSE8|Q0MSE9|Q53R28|Q6JTU6|Q6T851|Q6TE14|Q6TE15|Q6TE16|Q6V402|Q8WYL6|Q8WYL7|Q8WYL8|Q8WYL9|Q8WYM0|Q8WYM1	Missense_Mutation	SNP	pfam_Bcl-x_interacting,pfam_Apoptosis_Bim_N,pirsf_Bcl-2-like_11	p.R196T	ENST00000393256.3	37	c.587	CCDS2089.1	2	.	.	.	.	.	.	.	.	.	.	G	15.22	2.768017	0.49680	.	.	ENSG00000153094	ENST00000308659;ENST00000393256	.	.	.	5.48	5.48	0.80851	.	0.000000	0.64402	D	0.000002	T	0.68311	0.2987	L	0.32530	0.975	0.80722	D	1	D;D;D	0.76494	0.999;0.981;0.989	D;D;D	0.80764	0.994;0.966;0.985	T	0.70695	-0.4801	9	0.87932	D	0	-10.3149	18.2781	0.90089	0.0:0.0:1.0:0.0	.	106;196;136	O43521-3;O43521;O43521-2	.;B2L11_HUMAN;.	T	136;196	.	ENSP00000309226:R136T	R	+	2	0	BCL2L11	111638269	1.000000	0.71417	0.975000	0.42487	0.208000	0.24298	6.295000	0.72744	2.744000	0.94065	0.563000	0.77884	AGA	BCL2L11	-	pirsf_Bcl-2-like_11	ENSG00000153094		0.463	BCL2L11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCL2L11	HGNC	protein_coding	OTTHUMT00000254022.3	36	0.00	0	G			111921798	111921798	+1	no_errors	ENST00000393256	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	0.998	C
BEND7	222389	genome.wustl.edu	37	10	13485197	13485197	+	Intron	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:13485197G>C	ENST00000396900.2	-	9	1234				BEND7_ENST00000396898.2_Intron|BEND7_ENST00000486542.1_Intron|BEND7_ENST00000341083.3_Intron|BEND7_ENST00000378605.3_Intron			Q8N7W2	BEND7_HUMAN	BEN domain containing 7							extracellular vesicular exosome (GO:0070062)				breast(2)|endometrium(1)|kidney(1)|large_intestine(7)|lung(2)|ovary(2)|prostate(1)|stomach(1)	17						ACATTACAAAGAAAGTATATG	0.348																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC031618	CCDS7099.1, CCDS41490.1	10p14	2012-11-22	2008-10-03	2008-10-03	ENSG00000165626	ENSG00000165626		"""BEN domain containing"""	23514	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 30"""	C10orf30			Standard	NM_152751		Approved	FLJ40283	uc001imm.2	Q8N7W2	OTTHUMG00000017699	ENST00000396900.2:c.1235-3700C>G	10.37:g.13485197G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYY7|Q5SYY8|Q5SYY9|Q8N5T7	RNA	SNP	-	NULL	ENST00000396900.2	37	NULL		10																																																																																			BEND7	-	-	ENSG00000165626		0.348	BEND7-202	KNOWN	basic	protein_coding	BEND7	HGNC	protein_coding		30	0.00	0	G	NM_152751		13485197	13485197	-1	no_errors	ENST00000465276	ensembl	human	known	69_37n	rna	36	20.00	9	SNP	0.937	C
BRCA1	672	genome.wustl.edu	37	17	41234523	41234523	+	Missense_Mutation	SNP	C	C	T	rs80357309		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:41234523C>T	ENST00000357654.3	-	12	4373	c.4255G>A	c.(4255-4257)Gaa>Aaa	p.E1419K	BRCA1_ENST00000586385.1_Intron|BRCA1_ENST00000493795.1_Missense_Mutation_p.E1372K|BRCA1_ENST00000471181.2_Missense_Mutation_p.E1419K|BRCA1_ENST00000352993.3_Missense_Mutation_p.E277K|BRCA1_ENST00000346315.3_Missense_Mutation_p.E1419K|BRCA1_ENST00000491747.2_Missense_Mutation_p.E316K|BRCA1_ENST00000591534.1_Intron|BRCA1_ENST00000351666.3_Missense_Mutation_p.E236K|BRCA1_ENST00000468300.1_Missense_Mutation_p.E316K|BRCA1_ENST00000354071.3_Missense_Mutation_p.E1419K|BRCA1_ENST00000591849.1_Intron|BRCA1_ENST00000309486.4_Missense_Mutation_p.E1123K	NM_007294.3	NP_009225.1	P38398	BRCA1_HUMAN	breast cancer 1, early onset	1419	Interaction with PALB2.				androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to indole-3-methanol (GO:0071681)|cellular response to tumor necrosis factor (GO:0071356)|chromosome segregation (GO:0007059)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|fatty acid biosynthetic process (GO:0006633)|G2 DNA damage checkpoint (GO:0031572)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of centriole replication (GO:0046600)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of histone H3-K9 methylation (GO:0051573)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of DNA repair (GO:0045739)|positive regulation of gene expression (GO:0010628)|positive regulation of histone acetylation (GO:0035066)|positive regulation of histone H3-K4 methylation (GO:0051571)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of histone H4-K16 acetylation (GO:2000620)|positive regulation of histone H4-K20 methylation (GO:0070512)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation vascular endothelial growth factor production (GO:0010575)|postreplication repair (GO:0006301)|protein autoubiquitination (GO:0051865)|protein K6-linked ubiquitination (GO:0085020)|protein ubiquitination (GO:0016567)|regulation of apoptotic process (GO:0042981)|regulation of cell proliferation (GO:0042127)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|response to estrogen (GO:0043627)|response to ionizing radiation (GO:0010212)	BRCA1-A complex (GO:0070531)|BRCA1-BARD1 complex (GO:0031436)|chromosome (GO:0005694)|cytoplasm (GO:0005737)|gamma-tubulin ring complex (GO:0008274)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ribonucleoprotein complex (GO:0030529)|ubiquitin ligase complex (GO:0000151)	androgen receptor binding (GO:0050681)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|tubulin binding (GO:0015631)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(30)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(7)|lung(28)|ovary(36)|skin(2)|stomach(4)|urinary_tract(2)	120		Breast(137;0.000717)		BRCA - Breast invasive adenocarcinoma(366;0.126)		CCATGCTGTTCTAACACAGCT	0.448			"""D, Mis, N, F, S"""		ovarian	"""breast, ovarian"""		Homologous recombination	Hereditary Breast-Ovarian Cancer, BRCA1 type	TCGA Ovarian(2;0.000030)																												dbGAP	yes	Rec	yes	Hereditary breast/ovarian cancer	17	17q21	672	familial breast/ovarian cancer gene 1		E	0													176.0	151.0	159.0					17																	41234523		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database		U14680	CCDS11453.1, CCDS11454.1, CCDS11455.1, CCDS11456.1, CCDS11459.1, CCDS11455.2, CCDS11456.2, CCDS11459.2, CCDS11454.2	17q21.31	2014-09-17			ENSG00000012048	ENSG00000012048		"""RING-type (C3HC4) zinc fingers"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1100	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 1"", ""protein phosphatase 1, regulatory subunit 53"""	113705				1676470	Standard	NM_007300		Approved	RNF53, BRCC1, PPP1R53	uc002ict.3	P38398	OTTHUMG00000157426	ENST00000357654.3:c.4255G>A	17.37:g.41234523C>T	ENSP00000350283:p.Glu1419Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O15129|Q1RMC1|Q3LRJ0|Q3LRJ6|Q6IN79|Q7KYU9	Missense_Mutation	SNP	pirsf_BRCA1,pfam_BRCT_dom,pfam_Znf_C3HC4_RING-type,superfamily_BRCT_dom,smart_Znf_RING,smart_BRCT_dom,pfscan_BRCT_dom,pfscan_Znf_RING	p.E1419K	ENST00000357654.3	37	c.4255	CCDS11453.1	17	.	.	.	.	.	.	.	.	.	.	C	17.65	3.443155	0.63067	.	.	ENSG00000012048	ENST00000357654;ENST00000412061;ENST00000354071;ENST00000352993;ENST00000346315;ENST00000351666;ENST00000309486;ENST00000468300;ENST00000393691;ENST00000471181;ENST00000493795;ENST00000491747;ENST00000478531;ENST00000484087;ENST00000493919;ENST00000487825	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.63096	-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02;-0.02	5.5	4.51	0.55191	.	0.000000	0.53938	D	0.000045	T	0.60818	0.2298	N	0.20986	0.625	0.36606	D	0.874937	P;D;P;D;P;P;B;P	0.67145	0.953;0.996;0.953;0.982;0.953;0.816;0.146;0.884	P;D;P;D;P;B;B;B	0.65140	0.519;0.932;0.52;0.916;0.617;0.311;0.038;0.411	T	0.68606	-0.5364	10	0.87932	D	0	.	5.7584	0.18186	0.0:0.6839:0.1974:0.1186	.	315;269;315;316;316;1419;1419;1419	E7EUM2;B4DES0;E7ETR2;P38398-3;Q6IN79;E9PFC7;P38398;P38398-2	.;.;.;.;.;.;BRCA1_HUMAN;.	K	1419;1419;1419;277;1419;236;1123;316;269;1419;1372;315;315;190;269;191	ENSP00000350283:E1419K;ENSP00000326002:E1419K;ENSP00000312236:E277K;ENSP00000246907:E1419K;ENSP00000338007:E236K;ENSP00000310938:E1123K;ENSP00000417148:E316K;ENSP00000377294:E269K;ENSP00000418960:E1419K;ENSP00000418775:E1372K;ENSP00000420412:E315K;ENSP00000419481:E190K;ENSP00000418819:E269K;ENSP00000418212:E191K	ENSP00000310938:E1123K	E	-	1	0	BRCA1	38488049	0.596000	0.26866	0.990000	0.47175	0.878000	0.50629	0.858000	0.27845	1.518000	0.48934	0.655000	0.94253	GAA	BRCA1	-	pirsf_BRCA1	ENSG00000012048		0.448	BRCA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA1	HGNC	protein_coding	OTTHUMT00000348798.2	76	0.00	0	C	NM_007294		41234523	41234523	-1	no_errors	ENST00000471181	ensembl	human	known	69_37n	missense	70	14.63	12	SNP	0.947	T
BTN1A1	696	genome.wustl.edu	37	6	26502135	26502135	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:26502135G>A	ENST00000244513.6	+	2	463	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K		NM_001732.2	NP_001723.2	Q13410	BT1A1_HUMAN	butyrophilin, subfamily 1, member A1	133	Ig-like V-type 1.					extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)			endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|skin(1)|soft_tissue(1)|urinary_tract(1)	26						TGGAAGCTACGAAGAAGCCCT	0.562																																						dbGAP											0													41.0	41.0	41.0					6																	26502135		2185	4276	6461	-	-	-	SO:0001583	missense	0			U39576	CCDS4614.1	6p22.1	2014-01-14			ENSG00000124557	ENSG00000124557		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Butyrophilins"""	1135	protein-coding gene	gene with protein product		601610		BTN		8114113, 9382921	Standard	NM_001732		Approved	BT, BTN1	uc003nif.4	Q13410	OTTHUMG00000016358	ENST00000244513.6:c.397G>A	6.37:g.26502135G>A	ENSP00000244513:p.Glu133Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4VAN3|Q4VAN4|Q9H458	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,pfam_CD80_C2-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_Ig_V-set_subgr,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Ig-like,prints_Butyrophylin	p.E133K	ENST00000244513.6	37	c.397	CCDS4614.1	6	.	.	.	.	.	.	.	.	.	.	G	15.37	2.812537	0.50527	.	.	ENSG00000124557	ENST00000244513;ENST00000377586	T	0.02631	4.22	6.08	3.35	0.38373	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	1.810430	0.02529	N	0.093441	T	0.02494	0.0076	L	0.61218	1.895	0.09310	N	1	P	0.52061	0.95	P	0.47744	0.556	T	0.44081	-0.9351	10	0.52906	T	0.07	.	6.1957	0.20548	0.1663:0.1683:0.6654:0.0	.	133	Q13410	BT1A1_HUMAN	K	133	ENSP00000244513:E133K	ENSP00000244513:E133K	E	+	1	0	BTN1A1	26610114	0.002000	0.14202	0.000000	0.03702	0.002000	0.02628	1.122000	0.31295	0.444000	0.26612	-0.140000	0.14226	GAA	BTN1A1	-	smart_Ig_sub,pfscan_Ig-like	ENSG00000124557		0.562	BTN1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTN1A1	HGNC	protein_coding	OTTHUMT00000043776.1	34	0.00	0	G	NM_001732		26502135	26502135	+1	no_errors	ENST00000244513	ensembl	human	known	69_37n	missense	45	16.67	9	SNP	0.000	A
BTNL8	79908	genome.wustl.edu	37	5	180377136	180377136	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:180377136G>A	ENST00000340184.4	+	8	1301	c.1095G>A	c.(1093-1095)agG>agA	p.R365R	BTNL8_ENST00000511704.1_Silent_p.R249R|BTNL8_ENST00000505126.1_Silent_p.R158R|BTNL8_ENST00000231229.4_3'UTR|BTNL8_ENST00000400707.3_Silent_p.R240R|BTNL8_ENST00000508408.1_3'UTR|BTNL8_ENST00000533815.2_Silent_p.R181R	NM_001040462.2	NP_001035552.1	Q6UX41	BTNL8_HUMAN	butyrophilin-like 8	365	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				immune system process (GO:0002376)	integral component of membrane (GO:0016021)				breast(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	28	all_cancers(89;3.37e-05)|all_epithelial(37;3.77e-06)|Renal(175;0.000159)|Lung NSC(126;0.00211)|all_lung(126;0.00371)|Breast(19;0.114)	all_cancers(40;0.0801)|Medulloblastoma(196;0.0392)|all_neural(177;0.0529)|all_hematologic(541;0.191)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGGACAGGAGGAAGGAGTACG	0.498																																						dbGAP											0													140.0	138.0	139.0					5																	180377136		2121	3916	6037	-	-	-	SO:0001819	synonymous_variant	0			AK025111	CCDS4459.1, CCDS43413.1, CCDS54956.1, CCDS54957.1, CCDS54958.1, CCDS54959.1	5q35.3	2014-01-14			ENSG00000113303	ENSG00000113303		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	26131	protein-coding gene	gene with protein product		615606				12975309	Standard	NM_024850		Approved	FLJ21458, BTN9.2	uc003mmp.3	Q6UX41	OTTHUMG00000130932	ENST00000340184.4:c.1095G>A	5.37:g.180377136G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4QMZ8|A6NEX6|B7Z409|B7Z5B1|E9PEF6|E9PG07|F2Z2B2|F8W712|Q9H730	Silent	SNP	pfam_SPRY_rcpt,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,smart_Ig_sub,smart_PRY,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY,pfscan_Ig-like	p.R365	ENST00000340184.4	37	c.1095	CCDS43413.1	5																																																																																			BTNL8	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl,smart_SPla/RYanodine_receptor_subgr,prints_Butyrophylin,pfscan_B30.2/SPRY	ENSG00000113303		0.498	BTNL8-002	KNOWN	basic|CCDS	protein_coding	BTNL8	HGNC	protein_coding	OTTHUMT00000368440.1	45	0.00	0	G	NM_024850		180377136	180377136	+1	no_errors	ENST00000340184	ensembl	human	known	69_37n	silent	36	23.40	11	SNP	0.018	A
C14orf177	283598	genome.wustl.edu	37	14	99182494	99182494	+	5'UTR	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:99182494G>A	ENST00000325812.2	+	0	385				C14orf177_ENST00000546029.2_3'UTR	NM_182560.2	NP_872366.2	Q52M58	CN177_HUMAN	chromosome 14 open reading frame 177											endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	13		Melanoma(154;0.128)				TCAGCCGTGGGAGCCACGGGA	0.592																																						dbGAP											0													35.0	31.0	33.0					14																	99182494		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			AK098639	CCDS9948.1	14q32.2	2012-05-30			ENSG00000176605	ENSG00000176605			26375	protein-coding gene	gene with protein product						12477932	Standard	NM_182560		Approved	FLJ25773	uc001yfz.2	Q52M58	OTTHUMG00000167745	ENST00000325812.2:c.-35G>A	14.37:g.99182494G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N7D2	RNA	SNP	-	NULL	ENST00000325812.2	37	NULL	CCDS9948.1	14																																																																																			C14orf177	-	-	ENSG00000176605		0.592	C14orf177-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf177	HGNC	protein_coding	OTTHUMT00000396078.1	23	0.00	0	G	NM_182560		99182494	99182494	+1	no_errors	ENST00000546029	ensembl	human	known	69_37n	rna	26	21.21	7	SNP	0.004	A
MFRP	83552	genome.wustl.edu	37	11	119215632	119215632	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:119215632C>T	ENST00000530681.1	-	6	868	c.724G>A	c.(724-726)Gaa>Aaa	p.E242K	MFRP_ENST00000555262.1_Missense_Mutation_p.E242K|C1QTNF5_ENST00000445041.2_5'UTR|MFRP_ENST00000529147.1_5'Flank|MFRP_ENST00000449574.2_Missense_Mutation_p.E242K|MFRP_ENST00000360167.4_Missense_Mutation_p.E242K	NM_001278431.1	NP_001265360.1	Q9BY79	MFRP_HUMAN	membrane frizzled-related protein	242	CUB 1. {ECO:0000255|PROSITE- ProRule:PRU00059}.				embryo development (GO:0009790)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(8)|prostate(1)|urinary_tract(1)	18		Medulloblastoma(222;0.0523)|Breast(348;0.174)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.84e-05)		CCAAATCCTTCCACACTGCTG	0.597																																						dbGAP											0													39.0	29.0	32.0					11																	119215632		2198	4295	6493	-	-	-	SO:0001583	missense	0			AB055505	CCDS8421.1	11q23.3	2014-01-28			ENSG00000235718	ENSG00000235718			18121	protein-coding gene	gene with protein product	"""membrane-type frizzled-related protein"", ""complement C1q tumor necrosis factor-related protein 5 precursor variant 1"""	606227				11263980	Standard	NM_031433		Approved	FLJ30570, rd6, NNO2, C1QTNF5	uc001pwj.2	Q9BY79		ENST00000530681.1:c.724G>A	11.37:g.119215632C>T	ENSP00000456533:p.Glu242Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJ36|B0YJ37|B4DHN8|Q335M3|Q96DQ9	Missense_Mutation	SNP	pfam_CUB,pfam_Frizzled_dom,pfam_LDrepeatLR_classA_rpt,superfamily_CUB,superfamily_Frizzled_dom,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,smart_Frizzled_dom,pfscan_CUB,pfscan_Frizzled_dom,pfscan_LDrepeatLR_classA_rpt	p.E242K	ENST00000530681.1	37	c.724	CCDS8421.1	11	.	.	.	.	.	.	.	.	.	.	C	21.2	4.110647	0.77210	.	.	ENSG00000235718	ENST00000555262;ENST00000449574;ENST00000360167	T;T;T	0.17691	2.26;2.26;2.26	5.1	4.16	0.48862	CUB (5);	0.178204	0.48767	D	0.000167	T	0.30039	0.0752	L	0.49256	1.55	0.39292	D	0.964744	D;D	0.59357	0.979;0.985	P;P	0.58928	0.76;0.848	T	0.06338	-1.0832	10	0.21540	T	0.41	-6.6948	15.6534	0.77115	0.0:0.8621:0.1378:0.0	.	242;242	B4DHN8;Q9BY79	.;MFRP_HUMAN	K	242	ENSP00000450509:E242K;ENSP00000391664:E242K;ENSP00000353291:E242K	ENSP00000353291:E242K	E	-	1	0	MFRP	118720842	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.162000	0.58177	1.237000	0.43756	0.561000	0.74099	GAA	MFRP	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB	ENSG00000235718		0.597	MFRP-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C1QTNF5	Clone_based_vega_gene	protein_coding	OTTHUMT00000415179.1	15	0.00	0	C	NM_031433		119215632	119215632	-1	no_errors	ENST00000449574	ensembl	human	known	69_37n	missense	18	18.18	4	SNP	1.000	T
C6	729	genome.wustl.edu	37	5	41172441	41172441	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:41172441C>T	ENST00000263413.3	-	9	1441	c.1177G>A	c.(1177-1179)Gag>Aag	p.E393K	C6_ENST00000337836.5_Missense_Mutation_p.E393K|C6_ENST00000475349.1_5'UTR	NM_001115131.1	NP_001108603.2	P13671	CO6_HUMAN	complement component 6	393	MACPF. {ECO:0000255|PROSITE- ProRule:PRU00745}.				complement activation (GO:0006956)|complement activation, classical pathway (GO:0006958)|cytolysis (GO:0019835)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane attack complex (GO:0005579)				central_nervous_system(2)|cervix(2)|endometrium(2)|kidney(7)|large_intestine(16)|liver(1)|lung(51)|ovary(3)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)	96		Breast(839;1.07e-05)|Ovarian(839;0.0228)|Lung SC(612;0.0548)|Lung NSC(810;0.128)|all_neural(839;0.157)				GCTTCTTCCTCGGTTAAACCT	0.423																																						dbGAP											0													144.0	123.0	130.0					5																	41172441		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05024	CCDS3936.1	5p13.1	2014-09-17			ENSG00000039537	ENSG00000039537		"""Complement system"""	1339	protein-coding gene	gene with protein product		217050					Standard	NM_001115131		Approved		uc003jmk.3	P13671	OTTHUMG00000094781	ENST00000263413.3:c.1177G>A	5.37:g.41172441C>T	ENSP00000263413:p.Glu393Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MACPF,pfam_Sushi_SCR_CCP,pfam_Thrombospondin_1_rpt,pfam_LDrepeatLR_classA_rpt,pfam_Kazal-type_dom,superfamily_Complement_control_module,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,smart_Sushi_SCR_CCP,smart_FacI_MAC,pfscan_LDrepeatLR_classA_rpt,pfscan_Sushi_SCR_CCP,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.E393K	ENST00000263413.3	37	c.1177	CCDS3936.1	5	.	.	.	.	.	.	.	.	.	.	C	10.71	1.425848	0.25726	.	.	ENSG00000039537	ENST00000337836;ENST00000263413	D;D	0.83506	-1.73;-1.73	4.89	0.816	0.18768	Membrane attack complex component/perforin (MACPF) domain (3);	0.154508	0.56097	D	0.000026	T	0.76948	0.4059	M	0.77616	2.38	0.45822	D	0.998693	B	0.32382	0.368	B	0.33750	0.169	T	0.64584	-0.6373	10	0.08837	T	0.75	-8.9659	6.5345	0.22346	0.0:0.5447:0.2392:0.2161	.	393	P13671	CO6_HUMAN	K	393	ENSP00000338861:E393K;ENSP00000263413:E393K	ENSP00000263413:E393K	E	-	1	0	C6	41208198	0.000000	0.05858	0.971000	0.41717	0.252000	0.25951	-0.157000	0.10085	0.159000	0.19401	-0.150000	0.13652	GAG	C6	-	pfam_MACPF,smart_MACPF	ENSG00000039537		0.423	C6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6	HGNC	protein_coding	OTTHUMT00000211592.1	103	0.00	0	C			41172441	41172441	-1	no_errors	ENST00000263413	ensembl	human	known	69_37n	missense	118	15.71	22	SNP	0.973	T
KEL	3792	genome.wustl.edu	37	7	142636835	142636835	+	IGR	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:142636835G>C	ENST00000355265.2	-	0	2812				C7orf34_ENST00000409607.3_Missense_Mutation_p.E64D	NM_000420.2	NP_000411.1	P23276	KELL_HUMAN	Kell blood group, metallo-endopeptidase						vasoconstriction (GO:0042310)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)			central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(11)|lung(34)|ovary(3)|prostate(2)|skin(1)	60	Melanoma(164;0.059)					GCCAGACAGAGAAAACGCCCT	0.547																																						dbGAP											0													48.0	53.0	51.0					7																	142636835		2203	4300	6503	-	-	-	SO:0001628	intergenic_variant	0			BC003135	CCDS34766.1	7q33	2014-07-19	2006-10-10		ENSG00000197993	ENSG00000197993		"""CD molecules"", ""Blood group antigens"""	6308	protein-coding gene	gene with protein product		613883	"""Kell blood group"", ""Kell blood group, metalloendopeptidase"""			1712490, 7683930	Standard	NM_000420		Approved	ECE3, CD238	uc003wcb.3	P23276	OTTHUMG00000157159		7.37:g.142636835G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RBV4|Q96RS8|Q99885	Missense_Mutation	SNP	NULL	p.E64D	ENST00000355265.2	37	c.192	CCDS34766.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	12.95|12.95	2.090470|2.090470	0.36855|0.36855	.|.	.|.	ENSG00000165131|ENSG00000165131	ENST00000409607|ENST00000458732	.|.	.|.	.|.	3.5|3.5	-3.57|-3.57	0.04612|0.04612	.|.	1.113020|1.113020	0.06947|0.06947	N|N	0.813873|0.813873	T|T	0.30386|0.30386	0.0763|0.0763	L|L	0.34521|0.34521	1.04|1.04	0.09310|0.09310	N|N	1|1	B|.	0.20550|.	0.046|.	B|.	0.18871|.	0.023|.	T|T	0.35126|0.35126	-0.9801|-0.9801	9|7	0.34782|0.46703	T|T	0.22|0.11	-5.1258|-5.1258	4.2209|4.2209	0.10558|0.10558	0.3996:0.332:0.2685:0.0|0.3996:0.332:0.2685:0.0	.|.	39|.	Q96L11|.	CG034_HUMAN|.	D|Q	64|70	.|.	ENSP00000386450:E64D|ENSP00000401055:E70Q	E|E	+|+	3|1	2|0	C7orf34|C7orf34	142346957|142346957	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-1.159000|-1.159000	0.03150|0.03150	-0.937000|-0.937000	0.03719|0.03719	-0.387000|-0.387000	0.06579|0.06579	GAG|GAA	C7orf34	-	NULL	ENSG00000165131		0.547	KEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C7orf34	HGNC	protein_coding	OTTHUMT00000347671.2	33	0.00	0	G	NM_000420		142636835	142636835	+1	no_errors	ENST00000409607	ensembl	human	known	69_37n	missense	22	26.67	8	SNP	0.000	C
C9	735	genome.wustl.edu	37	5	39342213	39342213	+	Missense_Mutation	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:39342213C>A	ENST00000263408.4	-	2	258	c.163G>T	c.(163-165)Gat>Tat	p.D55Y	C9_ENST00000509186.1_5'UTR	NM_001737.3	NP_001728.1	P02748	CO9_HUMAN	complement component 9	55	TSP type-1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				complement activation, alternative pathway (GO:0006957)|complement activation, classical pathway (GO:0006958)|hemolysis by symbiont of host erythrocytes (GO:0019836)|innate immune response (GO:0045087)|regulation of complement activation (GO:0030449)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane attack complex (GO:0005579)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(2)|large_intestine(6)|lung(17)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32	all_lung(31;0.000197)	all_neural(839;7.57e-10)|Lung NSC(810;2.62e-08)|Ovarian(839;0.00384)|Breast(839;0.0184)|Myeloproliferative disorder(839;0.0511)	Epithelial(62;0.158)			AGACAAGGATCGCATTGTGAC	0.458																																						dbGAP											0													176.0	147.0	157.0					5																	39342213		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3929.1	5p14-p12	2014-09-17			ENSG00000113600	ENSG00000113600		"""Complement system"""	1358	protein-coding gene	gene with protein product		120940					Standard	NM_001737		Approved		uc003jlv.4	P02748	OTTHUMG00000094767	ENST00000263408.4:c.163G>T	5.37:g.39342213C>A	ENSP00000263408:p.Asp55Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_MACPF,pfam_LDrepeatLR_classA_rpt,pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,superfamily_LDrepeatLR_classA_rpt,smart_Thrombospondin_1_rpt,smart_LDrepeatLR_classA_rpt,smart_MACPF,pfscan_LDrepeatLR_classA_rpt,pfscan_Thrombospondin_1_rpt,prints_MAC_perforin	p.D55Y	ENST00000263408.4	37	c.163	CCDS3929.1	5	.	.	.	.	.	.	.	.	.	.	c	13.48	2.249671	0.39797	.	.	ENSG00000113600	ENST00000263408	T	0.55052	0.54	5.41	2.61	0.31194	.	0.215706	0.46442	D	0.000297	T	0.70649	0.3248	M	0.86805	2.84	0.39261	D	0.964216	D	0.89917	1.0	D	0.83275	0.996	T	0.71826	-0.4475	10	0.87932	D	0	-19.6119	6.1846	0.20490	0.0:0.6764:0.152:0.1716	.	55	P02748	CO9_HUMAN	Y	55	ENSP00000263408:D55Y	ENSP00000263408:D55Y	D	-	1	0	C9	39377970	0.997000	0.39634	0.999000	0.59377	0.262000	0.26303	0.174000	0.16743	0.646000	0.30693	-0.185000	0.12909	GAT	C9	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	ENSG00000113600		0.458	C9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9	HGNC	protein_coding	OTTHUMT00000211576.3	82	0.00	0	C			39342213	39342213	-1	no_errors	ENST00000263408	ensembl	human	known	69_37n	missense	105	11.76	14	SNP	0.998	A
C9orf106	414318	genome.wustl.edu	37	9	132084459	132084459	+	RNA	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:132084459C>T	ENST00000316786.1	+	0	420							Q8NAJ2	CI106_HUMAN	chromosome 9 open reading frame 106											large_intestine(1)|lung(1)|ovary(1)|skin(1)	4		Ovarian(14;0.00556)|Medulloblastoma(224;0.235)				TCTGAATCCTCTGCTCTGTGA	0.612																																						dbGAP											0													44.0	45.0	45.0					9																	132084459		2027	4193	6220	-	-	-			0			AK092588		9q34.11	2013-12-05	2013-12-05	2013-12-05	ENSG00000179082	ENSG00000179082			31370	other	unknown							Standard	NM_001012715		Approved	bA65J3.5	uc004bxs.2	Q8NAJ2	OTTHUMG00000020781		9.37:g.132084459C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000316786.1	37	NULL		9																																																																																			C9orf106	-	-	ENSG00000179082		0.612	C9orf106-001	KNOWN	basic	processed_transcript	C9orf106	HGNC	processed_transcript	OTTHUMT00000054576.2	31	0.00	0	C			132084459	132084459	+1	no_errors	ENST00000316786	ensembl	human	known	69_37n	rna	31	13.89	5	SNP	0.000	T
CAAP1	79886	genome.wustl.edu	37	9	26892705	26892705	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:26892705C>T	ENST00000333916.5	-	1	97	c.9G>A	c.(7-9)ggG>ggA	p.G3G	CAAP1_ENST00000495958.1_5'Flank|CAAP1_ENST00000535437.1_5'Flank|RN7SL100P_ENST00000460565.2_RNA|CAAP1_ENST00000520187.1_Silent_p.G3G	NM_001167575.1|NM_024828.3	NP_001161047.1|NP_079104.3	Q9H8G2	CAAP1_HUMAN	caspase activity and apoptosis inhibitor 1	3					apoptotic process (GO:0006915)												AGGACTTTTTCCCCGTCATGA	0.677																																						dbGAP											0													17.0	21.0	20.0					9																	26892705		2150	4220	6370	-	-	-	SO:0001819	synonymous_variant	0			BC014658	CCDS6516.1	9p21.2	2012-04-20	2012-04-20	2012-04-20	ENSG00000120159	ENSG00000120159			25834	protein-coding gene	gene with protein product	"""conserved anti-apoptotic protein"""		"""chromosome 9 open reading frame 82"""	C9orf82		21980415	Standard	NM_024828		Approved	FLJ13657, CAAP	uc003zqc.3	Q9H8G2	OTTHUMG00000019706	ENST00000333916.5:c.9G>A	9.37:g.26892705C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DWT4|D3DRK4|Q5VY32|Q6IPE6|Q96C59	Silent	SNP	NULL	p.G3	ENST00000333916.5	37	c.9	CCDS6516.1	9																																																																																			CAAP1	-	NULL	ENSG00000120159		0.677	CAAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAAP1	HGNC	protein_coding	OTTHUMT00000051954.1	136	0.00	0	C	NM_024828		26892705	26892705	-1	no_errors	ENST00000333916	ensembl	human	known	69_37n	silent	126	13.70	20	SNP	1.000	T
C9orf172	389813	genome.wustl.edu	37	9	139739806	139739806	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:139739806G>A	ENST00000436881.1	+	1	940	c.940G>A	c.(940-942)Gag>Aag	p.E314K		NM_001080482.2	NP_001073951.2	C9J069	CI172_HUMAN	chromosome 9 open reading frame 172	314	Pro-rich.									endometrium(2)|large_intestine(1)|lung(6)	9						TCCGTCCGAGGAGCTCTCGGG	0.647																																						dbGAP											0													24.0	27.0	26.0					9																	139739806		1935	4112	6047	-	-	-	SO:0001583	missense	0				CCDS48059.1	9q34.3	2012-04-03			ENSG00000232434	ENSG00000232434			37284	protein-coding gene	gene with protein product							Standard	NM_001080482		Approved		uc011meh.2	C9J069		ENST00000436881.1:c.940G>A	9.37:g.139739806G>A	ENSP00000412388:p.Glu314Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E314K	ENST00000436881.1	37	c.940	CCDS48059.1	9	.	.	.	.	.	.	.	.	.	.	.	10.86	1.471053	0.26423	.	.	ENSG00000232434	ENST00000436881	.	.	.	4.03	4.03	0.46877	.	.	.	.	.	T	0.29355	0.0731	N	0.24115	0.695	0.09310	N	1	P	0.47253	0.892	B	0.44163	0.443	T	0.07849	-1.0751	8	0.33141	T	0.24	.	13.6996	0.62599	0.0:0.0:1.0:0.0	.	314	C9J069	CI172_HUMAN	K	314	.	ENSP00000412388:E314K	E	+	1	0	C9orf172	138859627	0.204000	0.23447	0.097000	0.21041	0.004000	0.04260	1.021000	0.30040	1.794000	0.52575	0.537000	0.68136	GAG	C9orf172	-	NULL	ENSG00000232434		0.647	C9orf172-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf172	HGNC	protein_coding		47	0.00	0	G	NM_001080482		139739806	139739806	+1	no_errors	ENST00000436881	ensembl	human	known	69_37n	missense	73	10.84	9	SNP	0.209	A
CAMSAP2	23271	genome.wustl.edu	37	1	200816366	200816366	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:200816366C>T	ENST00000236925.4	+	10	1220	c.1171C>T	c.(1171-1173)Cat>Tat	p.H391Y	CAMSAP2_ENST00000413307.2_Intron|CAMSAP2_ENST00000358823.2_Missense_Mutation_p.H380Y			Q08AD1	CAMP2_HUMAN	calmodulin regulated spectrin-associated protein family, member 2	391					microtubule cytoskeleton organization (GO:0000226)|regulation of organelle organization (GO:0033043)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)	microtubule minus-end binding (GO:0051011)										TACACAGTCTCATCATCATTT	0.333																																						dbGAP											0													125.0	117.0	120.0					1																	200816366		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB029001	CCDS1404.1, CCDS72998.1, CCDS72999.1	1q32	2011-08-18	2011-08-18	2011-08-18	ENSG00000118200	ENSG00000118200			29188	protein-coding gene	gene with protein product		613775	"""calmodulin regulated spectrin-associated protein 1-like 1"""	CAMSAP1L1		15897902, 19508979	Standard	XM_005245040		Approved	KIAA1078	uc001gvk.3	Q08AD1	OTTHUMG00000035740	ENST00000236925.4:c.1171C>T	1.37:g.200816366C>T	ENSP00000236925:p.His391Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B1APG6|Q08AD2|Q6PGN8|Q96FB3|Q9UG20|Q9UPS4	Missense_Mutation	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.H391Y	ENST00000236925.4	37	c.1171		1	.	.	.	.	.	.	.	.	.	.	C	3.308	-0.141419	0.06669	.	.	ENSG00000118200	ENST00000358823;ENST00000236925	T;T	0.15487	2.42;2.42	3.13	2.2	0.27929	.	0.586195	0.17420	N	0.174873	T	0.08537	0.0212	N	0.19112	0.55	0.25428	N	0.988207	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.39921	-0.9590	10	0.10902	T	0.67	.	6.3478	0.21359	0.0:0.8504:0.0:0.1496	.	391;380	Q08AD1;Q08AD1-3	CAMP2_HUMAN;.	Y	380;391	ENSP00000351684:H380Y;ENSP00000236925:H391Y	ENSP00000236925:H391Y	H	+	1	0	CAMSAP1L1	199082989	0.101000	0.21875	0.418000	0.26571	0.992000	0.81027	1.877000	0.39598	0.449000	0.26747	0.462000	0.41574	CAT	CAMSAP2	-	NULL	ENSG00000118200		0.333	CAMSAP2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CAMSAP2	HGNC	protein_coding	OTTHUMT00000086956.2	38	0.00	0	C	NM_203459		200816366	200816366	+1	no_errors	ENST00000236925	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.988	T
CAMSAP3	57662	genome.wustl.edu	37	19	7681485	7681485	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:7681485C>G	ENST00000160298.4	+	14	3290	c.3189C>G	c.(3187-3189)ctC>ctG	p.L1063L	CAMSAP3_ENST00000446248.2_Silent_p.L1090L	NM_020902.1	NP_065953.1	Q9P1Y5	CAMP3_HUMAN	calmodulin regulated spectrin-associated protein family, member 3	1063					epithelial cell-cell adhesion (GO:0090136)|microtubule anchoring (GO:0034453)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of phosphatase activity (GO:0010923)|regulation of microtubule cytoskeleton organization (GO:0070507)|regulation of organelle organization (GO:0033043)|zonula adherens maintenance (GO:0045218)	cytoplasm (GO:0005737)|microtubule minus-end (GO:0036449)|zonula adherens (GO:0005915)	microtubule minus-end binding (GO:0051011)			cervix(1)|endometrium(7)|kidney(3)|lung(6)|urinary_tract(2)	19						ACAATAACCTCGGGGTGAAGA	0.612																																						dbGAP											0													58.0	62.0	60.0					19																	7681485		2020	4175	6195	-	-	-	SO:0001819	synonymous_variant	0			AB040976	CCDS42489.1, CCDS45947.1	19p13.3-p13.2	2014-06-12	2011-08-18	2011-08-18		ENSG00000076826			29307	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 80"""	612685	"""KIAA1543"""	KIAA1543		11318610, 10819331, 19041755, 19508979	Standard	NM_001080429		Approved	Nezha, PPP1R80	uc002mgu.4	Q9P1Y5		ENST00000160298.4:c.3189C>G	19.37:g.7681485C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDF1	Silent	SNP	pfam_CKK_domain,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_PRC_barrell-like,superfamily_CH-domain	p.L1090	ENST00000160298.4	37	c.3270	CCDS42489.1	19																																																																																			CAMSAP3	-	NULL	ENSG00000076826		0.612	CAMSAP3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CAMSAP3	HGNC	protein_coding	OTTHUMT00000459300.1	35	0.00	0	C	XM_048362		7681485	7681485	+1	no_errors	ENST00000446248	ensembl	human	known	69_37n	silent	22	25.81	8	SNP	0.654	G
CASP8	841	genome.wustl.edu	37	2	202131498	202131498	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:202131498C>T	ENST00000432109.2	+	3	478	c.289C>T	c.(289-291)Caa>Taa	p.Q97*	CASP8_ENST00000323492.7_Nonsense_Mutation_p.Q97*|CASP8_ENST00000392259.2_Nonsense_Mutation_p.Q97*|CASP8_ENST00000392266.3_Nonsense_Mutation_p.Q97*|CASP8_ENST00000392258.3_Nonsense_Mutation_p.Q97*|CASP8_ENST00000264275.5_Nonsense_Mutation_p.Q97*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.Q156*|CASP8_ENST00000264274.9_Nonsense_Mutation_p.Q97*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	97					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						AGGCAGGGCTCAAATTTCTGC	0.488										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)	dbGAP											0													43.0	41.0	42.0					2																	202131498		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.289C>T	2.37:g.202131498C>T	ENSP00000412523:p.Gln97*	Somatic		WXS	Illumina GAIIx	Phase_IV	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.Q156*	ENST00000432109.2	37	c.466	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.736296	0.96865	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	.	.	.	5.58	5.58	0.84498	.	1.143620	0.06237	N	0.689670	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	18.5483	0.91055	0.0:1.0:0.0:0.0	.	.	.	.	X	97;97;97;97;97;97;97;97;97;156;97;97;97;97	.	ENSP00000264274:Q97X	Q	+	1	0	CASP8	201839743	0.909000	0.30893	0.998000	0.56505	0.231000	0.25187	0.895000	0.28363	2.612000	0.88384	0.561000	0.74099	CAA	CASP8	-	superfamily_DEATH-like	ENSG00000064012		0.488	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	50	0.00	0	C	NM_001228		202131498	202131498	+1	no_errors	ENST00000358485	ensembl	human	known	69_37n	nonsense	51	16.39	10	SNP	0.995	T
CASR	846	genome.wustl.edu	37	3	122003562	122003562	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:122003562G>A	ENST00000490131.1	+	7	3133	c.2761G>A	c.(2761-2763)Gaa>Aaa	p.E921K	CASR_ENST00000498619.1_Missense_Mutation_p.E931K|CASR_ENST00000296154.5_Missense_Mutation_p.E921K|AC068754.1_ENST00000408547.1_RNA	NM_000388.3	NP_000379	P41180	CASR_HUMAN	calcium-sensing receptor	921					anatomical structure morphogenesis (GO:0009653)|calcium ion import (GO:0070509)|cellular calcium ion homeostasis (GO:0006874)|chemosensory behavior (GO:0007635)|detection of calcium ion (GO:0005513)|G-protein coupled receptor signaling pathway (GO:0007186)|metabolic process (GO:0008152)|ossification (GO:0001503)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|phosphatidylinositol phospholipase C activity (GO:0004435)			NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(13)|lung(45)|ovary(4)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	84				GBM - Glioblastoma multiforme(114;0.226)	Cinacalcet(DB01012)	GAGCAACAGCGAAGACCCATT	0.662																																						dbGAP											0													42.0	44.0	43.0					3																	122003562		2203	4300	6503	-	-	-	SO:0001583	missense	0			U20760	CCDS3010.1, CCDS54632.1	3q21.1	2012-08-29	2008-08-01		ENSG00000036828	ENSG00000036828		"""GPCR / Class C : Calcium-sensing receptors"""	1514	protein-coding gene	gene with protein product	"""severe neonatal hyperparathyroidism"""	601199	"""hypocalciuric hypercalcemia 1"""	HHC, HHC1		7677761	Standard	NM_000388		Approved	FHH, NSHPT, GPRC2A	uc003eew.4	P41180	OTTHUMG00000159491	ENST00000490131.1:c.2761G>A	3.37:g.122003562G>A	ENSP00000418685:p.Glu921Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13912|Q16108|Q16109|Q16110|Q16379|Q2M1T0|Q4PJ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C,prints_GPCR_3	p.E931K	ENST00000490131.1	37	c.2791	CCDS3010.1	3	.	.	.	.	.	.	.	.	.	.	G	15.95	2.982539	0.53827	.	.	ENSG00000036828	ENST00000490131;ENST00000498619;ENST00000296154	D;D;D	0.89196	-2.47;-2.48;-2.47	5.77	5.77	0.91146	.	0.156761	0.56097	D	0.000022	D	0.82462	0.5042	N	0.14661	0.345	0.43050	D	0.994655	B;B	0.18166	0.026;0.026	B;B	0.10450	0.005;0.005	T	0.77739	-0.2475	10	0.66056	D	0.02	.	18.9784	0.92746	0.0:0.0:1.0:0.0	.	931;921	E7ENE0;P41180	.;CASR_HUMAN	K	921;931;921	ENSP00000418685:E921K;ENSP00000420194:E931K;ENSP00000296154:E921K	ENSP00000296154:E921K	E	+	1	0	CASR	123486252	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	7.316000	0.79007	2.728000	0.93425	0.561000	0.74099	GAA	CASR	-	NULL	ENSG00000036828		0.662	CASR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASR	HGNC	protein_coding	OTTHUMT00000355761.1	61	0.00	0	G	NM_000388		122003562	122003562	+1	no_errors	ENST00000498619	ensembl	human	known	69_37n	missense	59	13.24	9	SNP	1.000	A
CBWD1	55871	genome.wustl.edu	37	9	166518	166518	+	Intron	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:166518G>C	ENST00000356521.4	-	5	519				CBWD1_ENST00000314367.10_Intron|CBWD1_ENST00000382447.4_Intron|CBWD1_ENST00000431099.2_Intron|CBWD1_ENST00000377400.4_Intron|CBWD1_ENST00000377447.3_Intron	NM_018491.3	NP_060961.3	Q9BRT8	CBWD1_HUMAN	COBW domain containing 1								ATP binding (GO:0005524)			kidney(1)|lung(2)|ovary(1)|skin(1)	5	all_lung(41;0.218)	all_cancers(5;3.04e-16)|all_epithelial(5;4.68e-12)|all_lung(10;1.94e-10)|Lung NSC(10;3.61e-10)|Acute lymphoblastic leukemia(5;0.00439)|Breast(48;0.0148)|all_hematologic(5;0.024)|Prostate(43;0.122)	Kidney(42;0.112)|KIRC - Kidney renal clear cell carcinoma(5;0.157)	all cancers(5;0.000704)|Lung(218;0.00755)|GBM - Glioblastoma multiforme(5;0.0149)|Epithelial(6;0.0154)		acaaaatgaagaaatgaatag	0.348																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AY343911	CCDS6438.1, CCDS47947.1, CCDS47948.1	9p24.3	2008-02-05			ENSG00000172785	ENSG00000172785			17134	protein-coding gene	gene with protein product		611078				15233989, 12421752	Standard	NM_018491		Approved		uc003zga.4	Q9BRT8	OTTHUMG00000019425	ENST00000356521.4:c.431-2481C>G	9.37:g.166518G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RU55|A8K3N3|B0AZR4|Q49AJ1|Q5VVK2|Q6VBU6|Q7Z5Z0|Q7Z652|Q9BY38|Q9NYD0	RNA	SNP	-	NULL	ENST00000356521.4	37	NULL	CCDS6438.1	9																																																																																			CBWD1	-	-	ENSG00000172785		0.348	CBWD1-008	KNOWN	basic|appris_principal|CCDS	protein_coding	CBWD1	HGNC	protein_coding	OTTHUMT00000051463.1	65	0.00	0	G	NM_018491		166518	166518	-1	no_errors	ENST00000487575	ensembl	human	known	69_37n	rna	106	13.11	16	SNP	0.000	C
CCDC15	80071	genome.wustl.edu	37	11	124857539	124857539	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:124857539C>T	ENST00000344762.5	+	8	1676	c.1417C>T	c.(1417-1419)Cta>Tta	p.L473L	CCDC15_ENST00000529051.1_Silent_p.L473L	NM_025004.2	NP_079280.2	Q0P6D6	CCD15_HUMAN	coiled-coil domain containing 15	473						centrosome (GO:0005813)				central_nervous_system(1)|cervix(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(3)|skin(1)	23	all_hematologic(175;0.215)	Breast(109;0.00222)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;1.68e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0413)		CCAGAATTTTCTACCTAAGGA	0.403																																						dbGAP											0													115.0	112.0	113.0					11																	124857539		1816	4076	5892	-	-	-	SO:0001819	synonymous_variant	0			BC018540	CCDS44756.1	11q24.2	2008-02-05			ENSG00000149548	ENSG00000149548			25798	protein-coding gene	gene with protein product							Standard	NM_025004		Approved	FLJ13215	uc001qbm.4	Q0P6D6	OTTHUMG00000165940	ENST00000344762.5:c.1417C>T	11.37:g.124857539C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H8U7	Silent	SNP	NULL	p.L473	ENST00000344762.5	37	c.1417	CCDS44756.1	11																																																																																			CCDC15	-	NULL	ENSG00000149548		0.403	CCDC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC15	HGNC	protein_coding	OTTHUMT00000387131.1	56	0.00	0	C	NM_025004		124857539	124857539	+1	no_errors	ENST00000344762	ensembl	human	known	69_37n	silent	64	13.51	10	SNP	0.006	T
CCNB3	85417	genome.wustl.edu	37	X	50053243	50053243	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:50053243G>C	ENST00000376042.1	+	6	2372	c.2074G>C	c.(2074-2076)Gag>Cag	p.E692Q	CCNB3_ENST00000376038.1_Intron|CCNB3_ENST00000348603.2_Intron|CCNB3_ENST00000276014.7_Missense_Mutation_p.E692Q			Q8WWL7	CCNB3_HUMAN	cyclin B3	692					meiotic nuclear division (GO:0007126)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)	nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(9)|lung(41)|ovary(4)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Ovarian(276;0.236)					CCTCTTCCAGGAGGCTTTGGT	0.458																																						dbGAP											0													28.0	25.0	26.0					X																	50053243		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ314764	CCDS14331.1, CCDS14332.1	Xp11	2008-07-03			ENSG00000147082	ENSG00000147082			18709	protein-coding gene	gene with protein product		300456				11846420, 12185076	Standard	XM_006724610		Approved		uc004doy.3	Q8WWL7	OTTHUMG00000021519	ENST00000376042.1:c.2074G>C	X.37:g.50053243G>C	ENSP00000365210:p.Glu692Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AQI5|B1AQI6|Q96SB5|Q96SB6|Q96SB7|Q9NT38	Missense_Mutation	SNP	pfam_Cyclin_N,pfam_Cyclin_C,superfamily_Cyclin-like,smart_Cyclin-like	p.E692Q	ENST00000376042.1	37	c.2074	CCDS14331.1	X	.	.	.	.	.	.	.	.	.	.	G	9.369	1.070045	0.20147	.	.	ENSG00000147082	ENST00000376042;ENST00000276014	T;T	0.36340	1.26;1.26	4.28	-0.971	0.10303	.	.	.	.	.	T	0.20495	0.0493	L	0.29908	0.895	0.09310	N	1	B	0.11235	0.004	B	0.06405	0.002	T	0.23976	-1.0173	8	.	.	.	.	3.9601	0.09407	0.4338:0.1988:0.3674:0.0	.	692	Q8WWL7	CCNB3_HUMAN	Q	692	ENSP00000365210:E692Q;ENSP00000276014:E692Q	.	E	+	1	0	CCNB3	50069983	0.127000	0.22367	0.000000	0.03702	0.005000	0.04900	0.385000	0.20685	-0.273000	0.09246	-1.113000	0.02065	GAG	CCNB3	-	NULL	ENSG00000147082		0.458	CCNB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNB3	HGNC	protein_coding	OTTHUMT00000056558.1	46	0.00	0	G			50053243	50053243	+1	no_errors	ENST00000276014	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.000	C
CCT8L2	150160	genome.wustl.edu	37	22	17071960	17071960	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr22:17071960C>T	ENST00000359963.3	-	1	1740	c.1481G>A	c.(1480-1482)tGg>tAg	p.W494*		NM_014406.4	NP_055221.1	Q96SF2	TCPQM_HUMAN	chaperonin containing TCP1, subunit 8 (theta)-like 2	494					anion transport (GO:0006820)|cellular protein metabolic process (GO:0044267)|potassium ion transmembrane transport (GO:0071805)|transport (GO:0006810)	cytoplasm (GO:0005737)	anion channel activity (GO:0005253)|ATP binding (GO:0005524)|calcium-activated potassium channel activity (GO:0015269)			breast(3)|endometrium(7)|kidney(1)|large_intestine(8)|liver(2)|lung(37)|ovary(3)|prostate(3)|skin(2)|stomach(1)	67	all_hematologic(4;0.00567)|Acute lymphoblastic leukemia(84;0.0977)	all_epithelial(15;0.0157)|Lung NSC(13;0.147)|all_lung(157;0.175)				TAGGGTGTCCCACACCCCTTC	0.517																																						dbGAP											0													129.0	123.0	125.0					22																	17071960		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AP003553	CCDS13738.1	22q11.1	2011-09-01			ENSG00000198445	ENSG00000198445			15553	protein-coding gene	gene with protein product							Standard	NM_014406		Approved	CESK1	uc002zlp.1	Q96SF2	OTTHUMG00000141302	ENST00000359963.3:c.1481G>A	22.37:g.17071960C>T	ENSP00000353048:p.Trp494*	Somatic		WXS	Illumina GAIIx	Phase_IV	A4QPH3|Q9UJS3	Nonsense_Mutation	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1	p.W494*	ENST00000359963.3	37	c.1481	CCDS13738.1	22	.	.	.	.	.	.	.	.	.	.	c	27.7	4.855917	0.91355	.	.	ENSG00000198445	ENST00000359963	.	.	.	1.98	0.709	0.18150	.	0.432859	0.17278	U	0.180116	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.35671	T	0.21	-17.0643	4.9701	0.14111	0.3542:0.6458:0.0:0.0	.	.	.	.	X	494	.	ENSP00000353048:W494X	W	-	2	0	CCT8L2	15451960	0.999000	0.42202	0.924000	0.36721	0.531000	0.34715	1.736000	0.38187	1.115000	0.41800	0.379000	0.24179	TGG	CCT8L2	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1	ENSG00000198445		0.517	CCT8L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT8L2	HGNC	protein_coding	OTTHUMT00000280580.1	105	0.00	0	C			17071960	17071960	-1	no_errors	ENST00000359963	ensembl	human	known	69_37n	nonsense	122	12.23	17	SNP	0.847	T
CD47	961	genome.wustl.edu	37	3	107766132	107766132	+	3'UTR	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:107766132C>T	ENST00000361309.5	-	0	1080				CD47_ENST00000471694.1_5'UTR|CD47_ENST00000355354.7_Silent_p.*306*	NM_001777.3	NP_001768.1	Q08722	CD47_HUMAN	CD47 molecule						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			CACTTCACTTCAGTTATTCTG	0.343																																						dbGAP											0													103.0	94.0	97.0					3																	107766132		1845	4096	5941	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000361309.5:c.*3G>A	3.37:g.107766132C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K198|D3DN59|Q53Y71|Q96A60	Silent	SNP	pfam_CD47_Vset,pfam_CD47_TM,pfscan_Ig-like	p.*306	ENST00000361309.5	37	c.917	CCDS43126.1	3																																																																																			CD47	-	NULL	ENSG00000196776		0.343	CD47-004	KNOWN	basic|CCDS	protein_coding	CD47	HGNC	protein_coding	OTTHUMT00000102793.1	39	0.00	0	C	NM_001777		107766132	107766132	-1	no_errors	ENST00000355354	ensembl	human	known	69_37n	silent	69	11.54	9	SNP	0.996	T
CD5	921	genome.wustl.edu	37	11	60890436	60890436	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:60890436C>T	ENST00000347785.3	+	7	1323	c.1157C>T	c.(1156-1158)gCc>gTc	p.A386V		NM_014207.3	NP_055022.2	P06127	CD5_HUMAN	CD5 molecule	386					apoptotic signaling pathway (GO:0097190)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|T cell costimulation (GO:0031295)	external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|scavenger receptor activity (GO:0005044)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|large_intestine(4)|lung(10)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_lung(304;5.94e-05)|Lung NSC(402;7.26e-05)		BRCA - Breast invasive adenocarcinoma(625;0.000946)|Lung(977;0.0086)|LUSC - Lung squamous cell carcinoma(625;0.0528)		ATCATCCTGGCCCTGGTGCTC	0.637																																						dbGAP											0													84.0	76.0	78.0					11																	60890436		2203	4299	6502	-	-	-	SO:0001583	missense	0			X04391	CCDS8000.1	11q13	2008-07-18	2006-03-28		ENSG00000110448	ENSG00000110448		"""CD molecules"""	1685	protein-coding gene	gene with protein product		153340	"""CD5 antigen (p56-62)"""	LEU1		1711157	Standard	NM_014207		Approved	T1	uc009ynk.3	P06127	OTTHUMG00000167825	ENST00000347785.3:c.1157C>T	11.37:g.60890436C>T	ENSP00000342681:p.Ala386Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A0N0P4|A8K9I3	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Tcell_CD5,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.A386V	ENST00000347785.3	37	c.1157	CCDS8000.1	11	.	.	.	.	.	.	.	.	.	.	C	15.71	2.912626	0.52439	.	.	ENSG00000110448	ENST00000347785	T	0.01725	4.67	4.8	2.88	0.33553	.	0.504341	0.17998	N	0.154986	T	0.03348	0.0097	L	0.27053	0.805	0.25380	N	0.988628	D	0.61697	0.99	P	0.54889	0.763	T	0.47182	-0.9137	10	0.35671	T	0.21	-8.5833	13.7288	0.62774	0.0:0.5529:0.4471:0.0	.	386	P06127	CD5_HUMAN	V	386	ENSP00000342681:A386V	ENSP00000342681:A386V	A	+	2	0	CD5	60647012	1.000000	0.71417	0.993000	0.49108	0.309000	0.27889	1.366000	0.34193	0.429000	0.26202	0.297000	0.19635	GCC	CD5	-	prints_Tcell_CD5	ENSG00000110448		0.637	CD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD5	HGNC	protein_coding	OTTHUMT00000396465.2	67	0.00	0	C	NM_014207		60890436	60890436	+1	no_errors	ENST00000347785	ensembl	human	known	69_37n	missense	75	13.79	12	SNP	0.872	T
CD68	968	genome.wustl.edu	37	17	7483208	7483208	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:7483208G>A	ENST00000250092.6	+	2	341	c.130G>A	c.(130-132)Gag>Aag	p.E44K	AC113189.5_ENST00000573187.1_RNA|AC113189.5_ENST00000572046.1_RNA|SNORA67_ENST00000384423.1_RNA|SNORD10_ENST00000459579.1_RNA|AC113189.5_ENST00000415124.1_RNA|CD68_ENST00000380498.6_Splice_Site|AC113189.5_ENST00000417897.1_RNA|SENP3-EIF4A1_ENST00000579777.1_RNA	NM_001251.2	NP_001242.2	P34810	CD68_HUMAN	CD68 molecule	44	Mucin-like.				cellular response to organic substance (GO:0071310)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|membrane (GO:0016020)|plasma membrane (GO:0005886)				endometrium(1)|lung(1)|skin(1)	3						CACGGTTACAGAGAGCACTGG	0.557																																						dbGAP											0													168.0	159.0	162.0					17																	7483208		2203	4300	6503	-	-	-	SO:0001583	missense	0			S57235	CCDS11114.1, CCDS58512.1	17p13	2011-11-24	2006-03-28		ENSG00000129226	ENSG00000129226		"""CD molecules"""	1693	protein-coding gene	gene with protein product	"""scavenger receptor class D, member 1"", ""CD68 antigen"", ""macrophage antigen CD68"""	153634	"""CD68 antigen"""			9790779	Standard	NM_001251		Approved	SCARD1, macrosialin, GP110, DKFZp686M18236, LAMP4	uc002ghv.3	P34810	OTTHUMG00000108146	ENST00000250092.6:c.130G>A	17.37:g.7483208G>A	ENSP00000250092:p.Glu44Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DVT4|Q53HR6|Q53XI3|Q96BI7	Splice_Site	SNP	-	e2-1	ENST00000250092.6	37	c.50-1	CCDS11114.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	9.311|9.311	1.055528|1.055528	0.19907|0.19907	.|.	.|.	ENSG00000129226|ENSG00000129226	ENST00000380498|ENST00000250092	.|T	.|0.35236	.|1.32	5.89|5.89	2.73|2.73	0.32206|0.32206	.|.	.|0.309084	.|0.28057	.|N	.|0.016764	.|T	.|0.31979	.|0.0814	M|M	0.70595|0.70595	2.14|2.14	0.32313|0.32313	N|N	0.563424|0.563424	.|B	.|0.17852	.|0.024	.|B	.|0.23018	.|0.043	.|T	.|0.26018	.|-1.0115	.|10	.|0.22706	.|T	.|0.39	.|-6.1819	5.5661|5.5661	0.17170|0.17170	0.1735:0.1642:0.6623:0.0|0.1735:0.1642:0.6623:0.0	.|.	.|44	.|P34810	.|CD68_HUMAN	.|K	-1|44	.|ENSP00000250092:E44K	.|ENSP00000250092:E44K	.|E	+|+	.|1	.|0	CD68|CD68	7423932|7423932	0.902000|0.902000	0.30710|0.30710	0.926000|0.926000	0.36857|0.36857	0.235000|0.235000	0.25334|0.25334	0.968000|0.968000	0.29357|0.29357	1.504000|1.504000	0.48704|0.48704	0.655000|0.655000	0.94253|0.94253	.|GAG	CD68	-	-	ENSG00000129226		0.557	CD68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD68	HGNC	protein_coding	OTTHUMT00000226949.3	60	0.00	0	G	NM_001251		7483208	7483208	+1	no_errors	ENST00000380498	ensembl	human	known	69_37n	splice_site	80	11.96	11	SNP	0.243	A
CDC42BPB	9578	genome.wustl.edu	37	14	103452869	103452869	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:103452869G>C	ENST00000361246.2	-	6	933	c.645C>G	c.(643-645)cgC>cgG	p.R215R		NM_006035.3	NP_006026.3			CDC42 binding protein kinase beta (DMPK-like)											NS(1)|breast(4)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(11)|liver(1)|lung(14)|ovary(2)|prostate(2)|skin(3)|stomach(1)	49		Melanoma(154;0.155)		Colorectal(3;0.0129)|READ - Rectum adenocarcinoma(2;0.0419)|Epithelial(152;0.0474)|all cancers(159;0.199)		AGTCAGCCAGGCGGATATGAC	0.383																																						dbGAP											0													215.0	183.0	194.0					14																	103452869		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF128625	CCDS9978.1	14q32.32	2010-05-12	2001-11-28		ENSG00000198752	ENSG00000198752			1738	protein-coding gene	gene with protein product		614062	"""CDC42-binding protein kinase beta (DMPK-like)"""			10198171	Standard	NM_006035		Approved	MRCKB, KIAA1124	uc001ymi.1	Q9Y5S2		ENST00000361246.2:c.645C>G	14.37:g.103452869G>C		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Citron,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Myotonic_dystrophy_kinase_coil,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Citron,smart_PAK_box_Rho-bd,prints_DAG/PE-bd,pfscan_PAK_box_Rho-bd,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.R215	ENST00000361246.2	37	c.645	CCDS9978.1	14																																																																																			CDC42BPB	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000198752		0.383	CDC42BPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPB	HGNC	protein_coding	OTTHUMT00000415711.1	66	0.00	0	G	NM_006035		103452869	103452869	-1	no_errors	ENST00000361246	ensembl	human	known	69_37n	silent	54	32.50	26	SNP	1.000	C
CDH1	999	genome.wustl.edu	37	16	68845587	68845587	+	Splice_Site	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:68845587G>T	ENST00000261769.5	+	7	1024	c.833G>T	c.(832-834)gGa>gTa	p.G278V	CDH1_ENST00000562836.1_3'UTR|CDH1_ENST00000422392.2_Splice_Site_p.G278V|RP11-354M1.2_ENST00000563916.1_RNA	NM_004360.3	NP_004351.1	P12830	CADH1_HUMAN	cadherin 1, type 1, E-cadherin (epithelial)	278	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|apoptotic process (GO:0006915)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to amino acid stimulus (GO:0071230)|cellular response to indole-3-methanol (GO:0071681)|cellular response to lithium ion (GO:0071285)|cochlea development (GO:0090102)|epithelial cell morphogenesis (GO:0003382)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|homophilic cell adhesion (GO:0007156)|intestinal epithelial cell development (GO:0060576)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of epithelial cell proliferation (GO:0050680)|neuron projection development (GO:0031175)|pituitary gland development (GO:0021983)|positive regulation of transcription factor import into nucleus (GO:0042993)|positive regulation of transcription, DNA-templated (GO:0045893)|protein homooligomerization (GO:0051260)|protein localization to plasma membrane (GO:0072659)|protein metabolic process (GO:0019538)|regulation of branching involved in salivary gland morphogenesis (GO:0060693)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of immune response (GO:0050776)|regulation of neuron migration (GO:2001222)|regulation of protein localization to cell surface (GO:2000008)|regulation of water loss via skin (GO:0033561)|response to drug (GO:0042493)|response to toxic substance (GO:0009636)|salivary gland cavitation (GO:0060662)|sensory perception of sound (GO:0007605)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|tight junction assembly (GO:0070830)|trophectodermal cell differentiation (GO:0001829)	actin cytoskeleton (GO:0015629)|aggresome (GO:0016235)|apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|axon terminus (GO:0043679)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell junction (GO:0030054)|cell surface (GO:0009986)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|lateral loop (GO:0043219)|lateral plasma membrane (GO:0016328)|node of Ranvier (GO:0033268)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|Schmidt-Lanterman incisure (GO:0043220)|trans-Golgi network (GO:0005802)	ankyrin binding (GO:0030506)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|cell adhesion molecule binding (GO:0050839)|gamma-catenin binding (GO:0045295)|glycoprotein binding (GO:0001948)|GTPase activating protein binding (GO:0032794)	p.?(1)		NS(6)|biliary_tract(8)|breast(161)|central_nervous_system(4)|endometrium(9)|kidney(4)|large_intestine(13)|lung(13)|oesophagus(3)|ovary(2)|prostate(3)|soft_tissue(2)|stomach(76)|thyroid(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	311		all_neural(199;0.0189)|Ovarian(137;0.0563)		Epithelial(162;8.44e-05)|all cancers(182;0.000404)|OV - Ovarian serous cystadenocarcinoma(108;0.000426)|BRCA - Breast invasive adenocarcinoma(181;0.0261)		ACTCTTCCAGGAACCTCTGTG	0.517			"""Mis, N, F, S"""		"""lobular breast, gastric"""	gastric			Hereditary Diffuse Gastric Cancer																													dbGAP	yes	Rec	yes	Familial gastric carcinoma	16	16q22.1	999	"""cadherin 1, type 1, E-cadherin (epithelial) (ECAD)"""		E	1	Unknown(1)	breast(1)											87.0	79.0	82.0					16																	68845587		2198	4300	6498	-	-	-	SO:0001630	splice_region_variant	0	Familial Cancer Database	HDGC	L08599	CCDS10869.1	16q22.1	2014-09-17			ENSG00000039068	ENSG00000039068		"""CD molecules"", ""Cadherins / Major cadherins"""	1748	protein-coding gene	gene with protein product	"""E-Cadherin"""	192090		UVO		9925936	Standard	NM_004360		Approved	uvomorulin, CD324	uc002ewg.1	P12830	OTTHUMG00000137561	ENST00000261769.5:c.833-1G>T	16.37:g.68845587G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1U7|Q13799|Q14216|Q15855|Q16194|Q4PJ14|Q9UII8	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G278V	ENST00000261769.5	37	c.833	CCDS10869.1	16	.	.	.	.	.	.	.	.	.	.	G	12.95	2.092907	0.36952	.	.	ENSG00000039068	ENST00000261769;ENST00000379120;ENST00000268794;ENST00000422392	T;T	0.70399	-0.48;-0.48	5.19	5.19	0.71726	Cadherin (4);Cadherin-like (1);	0.000000	0.49305	D	0.000149	D	0.90400	0.6995	H	0.98089	4.145	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.996;1.0	D	0.93843	0.7138	9	.	.	.	.	17.8831	0.88846	0.0:0.0:1.0:0.0	.	278;278	Q9UII8;P12830	.;CADH1_HUMAN	V	278	ENSP00000261769:G278V;ENSP00000414946:G278V	.	G	+	2	0	CDH1	67403088	1.000000	0.71417	0.985000	0.45067	0.038000	0.13279	5.659000	0.68010	2.583000	0.87209	0.561000	0.74099	GGA	CDH1	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin	ENSG00000039068		0.517	CDH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH1	HGNC	protein_coding	OTTHUMT00000268897.2	55	0.00	0	G	NM_004360	Missense_Mutation	68845587	68845587	+1	no_errors	ENST00000261769	ensembl	human	known	69_37n	missense	43	35.82	24	SNP	0.997	T
CDKN1B	1027	genome.wustl.edu	37	12	12870831	12870831	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:12870831C>T	ENST00000228872.4	+	1	774	c.58C>T	c.(58-60)Cag>Tag	p.Q20*	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Nonsense_Mutation_p.Q20*	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	20					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)			breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		GGACGCCAGGCAGGCGGAGCA	0.622																																						dbGAP											0													41.0	51.0	48.0					12																	12870831		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.58C>T	12.37:g.12870831C>T	ENSP00000228872:p.Gln20*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16307|Q5U0H2|Q9BUS6	Nonsense_Mutation	SNP	pfam_CDI	p.Q20*	ENST00000228872.4	37	c.58	CCDS8653.1	12	.	.	.	.	.	.	.	.	.	.	C	44	10.938028	0.99491	.	.	ENSG00000111276	ENST00000228872;ENST00000396340;ENST00000442489	.	.	.	4.56	3.65	0.41850	.	0.336665	0.29066	N	0.013243	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	-17.674	11.877	0.52552	0.1749:0.8251:0.0:0.0	.	.	.	.	X	20;20;13	.	ENSP00000228872:Q20X	Q	+	1	0	CDKN1B	12762098	1.000000	0.71417	0.938000	0.37757	0.994000	0.84299	3.591000	0.53986	1.100000	0.41517	0.655000	0.94253	CAG	CDKN1B	-	NULL	ENSG00000111276		0.622	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1B	HGNC	protein_coding	OTTHUMT00000313878.2	44	0.00	0	C	NM_004064		12870831	12870831	+1	no_errors	ENST00000228872	ensembl	human	known	69_37n	nonsense	57	12.31	8	SNP	0.997	T
CDKN1B	1027	genome.wustl.edu	37	12	12871194	12871194	+	Nonsense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:12871194C>T	ENST00000228872.4	+	1	1137	c.421C>T	c.(421-423)Cag>Tag	p.Q141*	CDKN1B_ENST00000477087.1_Intron|CDKN1B_ENST00000396340.1_Nonsense_Mutation_p.Q141*	NM_004064.3	NP_004055.1	P46527	CDN1B_HUMAN	cyclin-dependent kinase inhibitor 1B (p27, Kip1)	141					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|autophagic cell death (GO:0048102)|cell cycle arrest (GO:0007050)|cellular response to antibiotic (GO:0071236)|cellular response to lithium ion (GO:0071285)|cellular response to organic cyclic compound (GO:0071407)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|mitotic cell cycle (GO:0000278)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular component movement (GO:0051271)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of kinase activity (GO:0033673)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of phosphorylation (GO:0042326)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cell death (GO:0010942)|positive regulation of cell proliferation (GO:0008284)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of protein catabolic process (GO:0045732)|potassium ion transport (GO:0006813)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|response to amino acid (GO:0043200)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hypoxia (GO:0001666)|response to peptide hormone (GO:0043434)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|protein phosphatase binding (GO:0019903)|transforming growth factor beta receptor, cytoplasmic mediator activity (GO:0005072)			breast(1)|large_intestine(3)|lung(3)|ovary(1)|prostate(5)	13		Prostate(47;0.0322)|all_epithelial(100;0.159)		BRCA - Breast invasive adenocarcinoma(232;0.0336)		GTCGGACAGCCAGACGGGGTT	0.592																																						dbGAP											0													35.0	35.0	35.0					12																	12871194		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF480891	CCDS8653.1	12p13.1-p12	2008-08-04			ENSG00000111276	ENSG00000111276			1785	protein-coding gene	gene with protein product		600778				8033212	Standard	NM_004064		Approved	KIP1, P27KIP1	uc001rat.2	P46527	OTTHUMG00000149914	ENST00000228872.4:c.421C>T	12.37:g.12871194C>T	ENSP00000228872:p.Gln141*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q16307|Q5U0H2|Q9BUS6	Nonsense_Mutation	SNP	pfam_CDI	p.Q141*	ENST00000228872.4	37	c.421	CCDS8653.1	12	.	.	.	.	.	.	.	.	.	.	C	44	10.943655	0.99492	.	.	ENSG00000111276	ENST00000228872;ENST00000535674;ENST00000396340	.	.	.	5.3	5.3	0.74995	.	0.543603	0.18423	N	0.141686	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.10636	T	0.68	-8.511	17.1536	0.86784	0.0:1.0:0.0:0.0	.	.	.	.	X	141;90;141	.	ENSP00000228872:Q141X	Q	+	1	0	CDKN1B	12762461	1.000000	0.71417	0.959000	0.39883	0.832000	0.47134	4.982000	0.63825	2.482000	0.83794	0.650000	0.86243	CAG	CDKN1B	-	NULL	ENSG00000111276		0.592	CDKN1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDKN1B	HGNC	protein_coding	OTTHUMT00000313878.2	38	0.00	0	C	NM_004064		12871194	12871194	+1	no_errors	ENST00000228872	ensembl	human	known	69_37n	nonsense	44	18.52	10	SNP	1.000	T
CELA2B	51032	genome.wustl.edu	37	1	15807649	15807649	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:15807649G>A	ENST00000375910.3	+	3	211	c.186G>A	c.(184-186)ctG>ctA	p.L62L	CELA2B_ENST00000494280.1_3'UTR	NM_015849.2	NP_056933	P08218	CEL2B_HUMAN	chymotrypsin-like elastase family, member 2B	62	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(1)|endometrium(1)|large_intestine(1)|lung(4)|ovary(1)	8						GAGGGTCCCTGATAGCCAACA	0.607																																						dbGAP											0													125.0	109.0	115.0					1																	15807649		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS30605.1	1p36.21	2009-07-09			ENSG00000215704	ENSG00000215704			29995	protein-coding gene	gene with protein product	"""pancreatic elastase IIB"""	609444				3646943, 16327289	Standard	NM_015849		Approved	RP11-265F14.2, ELA2B	uc001awl.3	P08218	OTTHUMG00000002259	ENST00000375910.3:c.186G>A	1.37:g.15807649G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14D16|Q6ISM5|Q96QV5	Silent	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.L62	ENST00000375910.3	37	c.186	CCDS30605.1	1																																																																																			CELA2B	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	ENSG00000215704		0.607	CELA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELA2B	HGNC	protein_coding	OTTHUMT00000006448.1	81	0.00	0	G	NM_015849		15807649	15807649	+1	no_errors	ENST00000375910	ensembl	human	known	69_37n	silent	83	12.63	12	SNP	0.991	A
CELSR2	1952	genome.wustl.edu	37	1	109794721	109794721	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:109794721G>C	ENST00000271332.3	+	1	2081	c.2020G>C	c.(2020-2022)Gac>Cac	p.D674H		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	674	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		CCTGCCACTGGACTACAAACT	0.557																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													117.0	115.0	116.0					1																	109794721		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.2020G>C	1.37:g.109794721G>C	ENSP00000271332:p.Asp674His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.D674H	ENST00000271332.3	37	c.2020	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	N	19.62	3.861195	0.71949	.	.	ENSG00000143126	ENST00000271332	T	0.65364	-0.15	4.95	4.95	0.65309	Cadherin (4);Cadherin-like (1);	.	.	.	.	D	0.85622	0.5739	H	0.97265	3.97	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90579	0.4528	9	0.87932	D	0	.	18.4313	0.90627	0.0:0.0:1.0:0.0	.	674	Q9HCU4	CELR2_HUMAN	H	674	ENSP00000271332:D674H	ENSP00000271332:D674H	D	+	1	0	CELSR2	109596244	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.208000	0.95075	2.600000	0.87896	0.650000	0.86243	GAC	CELSR2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin	ENSG00000143126		0.557	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	63	0.00	0	G	NM_001408		109794721	109794721	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	79	15.96	15	SNP	1.000	C
CELSR2	1952	genome.wustl.edu	37	1	109795780	109795780	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:109795780G>C	ENST00000271332.3	+	1	3140	c.3079G>C	c.(3079-3081)Gag>Cag	p.E1027Q		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1027					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)			NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		GGGCAACTTTGAGATCCTTTT	0.567																																					NSCLC(158;1285 2011 34800 34852 42084)	dbGAP											0													87.0	86.0	87.0					1																	109795780		2203	4300	6503	-	-	-	SO:0001583	missense	0			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3079G>C	1.37:g.109795780G>C	ENSP00000271332:p.Glu1027Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EGF-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl,superfamily_Cadherin-like,smart_Cadherin,smart_EGF-like,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.E1027Q	ENST00000271332.3	37	c.3079	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	N	1.421	-0.572761	0.03882	.	.	ENSG00000143126	ENST00000271332	T	0.68624	-0.34	5.16	5.16	0.70880	Cadherin-like (1);	.	.	.	.	T	0.25232	0.0613	N	0.05012	-0.13	0.36982	D	0.894332	B	0.17852	0.024	B	0.17722	0.019	T	0.11591	-1.0581	9	0.06099	T	0.92	.	16.0132	0.80417	0.0:0.134:0.866:0.0	.	1027	Q9HCU4	CELR2_HUMAN	Q	1027	ENSP00000271332:E1027Q	ENSP00000271332:E1027Q	E	+	1	0	CELSR2	109597303	0.924000	0.31332	1.000000	0.80357	0.987000	0.75469	1.402000	0.34600	2.706000	0.92434	0.650000	0.86243	GAG	CELSR2	-	superfamily_Cadherin-like	ENSG00000143126		0.567	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	68	0.00	0	G	NM_001408		109795780	109795780	+1	no_errors	ENST00000271332	ensembl	human	known	69_37n	missense	63	19.23	15	SNP	1.000	C
CEP250	11190	genome.wustl.edu	37	20	34054796	34054796	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:34054796C>T	ENST00000397527.1	+	8	1218	c.498C>T	c.(496-498)ttC>ttT	p.F166F	CEP250_ENST00000342580.4_Silent_p.F166F|CEP250_ENST00000397524.1_Silent_p.F166F	NM_007186.3	NP_009117.2	Q9BV73	CP250_HUMAN	centrosomal protein 250kDa	166					centriole-centriole cohesion (GO:0010457)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|protein localization (GO:0008104)|protein localization to organelle (GO:0033365)|regulation of centriole-centriole cohesion (GO:0030997)	centriole (GO:0005814)|centrosome (GO:0005813)|cilium (GO:0005929)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule organizing center (GO:0005815)|protein complex (GO:0043234)|spindle pole centrosome (GO:0031616)	protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45	Lung NSC(9;0.00156)|all_lung(11;0.00243)		BRCA - Breast invasive adenocarcinoma(18;0.0106)			CACAGTTCTTCAAGGGCTACC	0.517																																						dbGAP											0													79.0	72.0	74.0					20																	34054796		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF022655	CCDS13255.1	20q11.22	2014-02-20	2006-01-11	2006-01-11	ENSG00000126001	ENSG00000126001			1859	protein-coding gene	gene with protein product		609689	"""centrosomal protein 2"""	CEP2		9506584, 9647649	Standard	NM_007186		Approved	C-NAP1	uc021wco.1	Q9BV73	OTTHUMG00000032343	ENST00000397527.1:c.498C>T	20.37:g.34054796C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5Q3|O14812|O60588|Q9H450	Silent	SNP	superfamily_Prefoldin	p.F166	ENST00000397527.1	37	c.498	CCDS13255.1	20																																																																																			CEP250	-	NULL	ENSG00000126001		0.517	CEP250-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP250	HGNC	protein_coding	OTTHUMT00000078877.7	40	0.00	0	C	NM_007186		34054796	34054796	+1	no_errors	ENST00000397527	ensembl	human	known	69_37n	silent	33	17.50	7	SNP	1.000	T
CEP350	9857	genome.wustl.edu	37	1	180000560	180000560	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:180000560C>T	ENST00000367607.3	+	15	4074	c.3656C>T	c.(3655-3657)tCt>tTt	p.S1219F		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1219	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S1219Y(2)		central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AGCAAACTTTCTGTTAAAGAT	0.373																																						dbGAP											2	Substitution - Missense(2)	endometrium(2)											43.0	43.0	43.0					1																	180000560		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.3656C>T	1.37:g.180000560C>T	ENSP00000356579:p.Ser1219Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.S1219F	ENST00000367607.3	37	c.3656	CCDS1336.1	1	.	.	.	.	.	.	.	.	.	.	C	15.66	2.900147	0.52227	.	.	ENSG00000135837	ENST00000367607	T	0.61980	0.06	5.93	5.93	0.95920	.	0.147288	0.31566	N	0.007430	T	0.51160	0.1658	L	0.29908	0.895	0.23665	N	0.99716	P;P	0.43169	0.8;0.8	B;B	0.41088	0.259;0.347	T	0.50709	-0.8796	9	.	.	.	.	13.1827	0.59663	0.0:0.9267:0.0:0.0733	.	1219;1219	E7EU22;Q5VT06	.;CE350_HUMAN	F	1219	ENSP00000356579:S1219F	.	S	+	2	0	CEP350	178267183	1.000000	0.71417	0.253000	0.24343	0.467000	0.32768	5.311000	0.65786	2.803000	0.96430	0.650000	0.86243	TCT	CEP350	-	NULL	ENSG00000135837		0.373	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	28	0.00	0	C	NM_014810		180000560	180000560	+1	no_errors	ENST00000367607	ensembl	human	known	69_37n	missense	50	10.71	6	SNP	0.406	T
CHL1	10752	genome.wustl.edu	37	3	386364	386364	+	Missense_Mutation	SNP	T	T	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:386364T>A	ENST00000256509.2	+	9	1462	c.820T>A	c.(820-822)Ttg>Atg	p.L274M	CHL1_ENST00000397491.2_Missense_Mutation_p.L258M	NM_001253387.1|NM_001253388.1|NM_006614.3	NP_001240316.1|NP_001240317.1|NP_006605.2	Q96FC9	DDX11_HUMAN	cell adhesion molecule L1-like	0	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|sister chromatid cohesion (GO:0007062)|viral process (GO:0016032)	midbody (GO:0030496)|nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle pole (GO:0000922)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA-dependent ATPase activity (GO:0008094)|double-stranded DNA binding (GO:0003690)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			NS(1)|central_nervous_system(5)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(25)|lung(31)|ovary(1)|prostate(4)|skin(10)|stomach(1)	93		all_cancers(2;1.14e-06)|all_epithelial(2;0.00367)|all_lung(1;0.061)|Lung NSC(2;0.201)		Epithelial(13;5.36e-06)|all cancers(10;1.4e-05)|OV - Ovarian serous cystadenocarcinoma(96;0.00323)|COAD - Colon adenocarcinoma(1;0.00925)|Colorectal(20;0.0198)		AGGGGAAATCTTGCTGCTTGA	0.423																																						dbGAP											0													171.0	153.0	159.0					3																	386364		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF002246	CCDS2556.1, CCDS58812.1, CCDS74887.1	3p26	2013-05-01	2013-05-01		ENSG00000134121	ENSG00000134121		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	1939	protein-coding gene	gene with protein product	"""neural cell adhesion molecule"", ""close homolog of L1"""	607416	"""cell adhesion molecule with homology to L1CAM (close homologue of L1)"", ""cell adhesion molecule with homology to L1CAM (close homolog of L1)"""			9799093	Standard	NM_006614		Approved	CALL, L1CAM2, FLJ44930, MGC132578	uc003bot.3	O00533	OTTHUMG00000090601	ENST00000256509.2:c.820T>A	3.37:g.386364T>A	ENSP00000256509:p.Leu274Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q13333|Q86VQ4|Q86W62|Q92498|Q92770|Q92998|Q92999	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.L274M	ENST00000256509.2	37	c.820	CCDS2556.1	3	.	.	.	.	.	.	.	.	.	.	T	18.56	3.649460	0.67358	.	.	ENSG00000134121	ENST00000256509;ENST00000397491	T;T	0.33654	1.4;1.4	5.51	1.67	0.24075	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000005	T	0.53578	0.1805	M	0.73372	2.23	0.46631	D	0.99913	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.99;0.99;1.0	T	0.52102	-0.8620	10	0.87932	D	0	.	8.4933	0.33112	0.0:0.6866:0.0:0.3134	.	258;258;274	B3KX75;O00533;O00533-2	.;CHL1_HUMAN;.	M	274;258	ENSP00000256509:L274M;ENSP00000380628:L258M	ENSP00000256509:L274M	L	+	1	2	CHL1	361364	0.278000	0.24230	0.988000	0.46212	0.930000	0.56654	0.816000	0.27267	0.276000	0.22118	-0.248000	0.11899	TTG	CHL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000134121		0.423	CHL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHL1	HGNC	protein_coding	OTTHUMT00000207155.2	80	0.00	0	T	NM_006614		386364	386364	+1	no_errors	ENST00000256509	ensembl	human	known	69_37n	missense	70	17.65	15	SNP	0.788	A
CHN1	1123	genome.wustl.edu	37	2	175809639	175809639	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:175809639G>C	ENST00000409900.3	-	3	404	c.91C>G	c.(91-93)Cga>Gga	p.R31G	CHN1_ENST00000488080.1_5'UTR|CHN1_ENST00000409156.3_Missense_Mutation_p.R31G	NM_001822.5	NP_001813.1	P15882	CHIN_HUMAN	chimerin 1	31					ephrin receptor signaling pathway (GO:0048013)|motor neuron axon guidance (GO:0008045)|positive regulation of signal transduction (GO:0009967)|regulation of axonogenesis (GO:0050770)|regulation of Rac GTPase activity (GO:0032314)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(117;0.226)			GTAATTCTTCGAGGATGAGGG	0.388			T	TAF15	extraskeletal myxoid chondrosarcoma																																	dbGAP		Dom	yes		2	2q31-q32.1	1123	chimerin (chimaerin) 1		M	0													81.0	77.0	78.0					2																	175809639		1860	4104	5964	-	-	-	SO:0001583	missense	0				CCDS46454.1, CCDS46455.1, CCDS56147.1	2q31-q32.1	2013-02-14	2012-10-17		ENSG00000128656	ENSG00000128656		"""Rho GTPase activating proteins"", ""SH2 domain containing"""	1943	protein-coding gene	gene with protein product	"""Chimerin 1 (GTPase-activating protein, rho, 2)"", ""chimaerin 1"""	118423	"""Duane retraction syndrome 2"", ""chimerin (chimaerin) 1"""	CHN, DURS2		2299665, 15013773, 18653847	Standard	NM_001822		Approved	RhoGAP2, ARHGAP2, n-chimerin	uc002uji.3	P15882	OTTHUMG00000154225	ENST00000409900.3:c.91C>G	2.37:g.175809639G>C	ENSP00000386741:p.Arg31Gly	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1M6|B3KNU6|B4DV19|Q53SD6|Q53SH5|Q96FB0	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_SH2,superfamily_Rho_GTPase_activation_prot,smart_SH2,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pirsf_N-chimaerin,pfscan_SH2,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_DAG/PE-bd	p.R31G	ENST00000409900.3	37	c.91	CCDS46455.1	2	.	.	.	.	.	.	.	.	.	.	G	13.65	2.300466	0.40694	.	.	ENSG00000128656	ENST00000409900;ENST00000409156	T;T	0.60548	0.18;0.18	5.75	2.76	0.32466	.	.	.	.	.	T	0.54303	0.1850	L	0.54323	1.7	0.47476	D	0.999434	P;P	0.46621	0.863;0.881	P;P	0.48030	0.564;0.524	T	0.46400	-0.9194	9	0.24483	T	0.36	.	8.6223	0.33868	0.0:0.1482:0.5455:0.3064	.	31;31	B4DV19;P15882	.;CHIN_HUMAN	G	31	ENSP00000386741:R31G;ENSP00000386470:R31G	ENSP00000386470:R31G	R	-	1	2	CHN1	175517885	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	1.499000	0.35671	0.715000	0.32103	0.491000	0.48974	CGA	CHN1	-	pirsf_N-chimaerin	ENSG00000128656		0.388	CHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHN1	HGNC	protein_coding	OTTHUMT00000334453.1	32	0.00	0	G	NM_001822		175809639	175809639	-1	no_errors	ENST00000409900	ensembl	human	known	69_37n	missense	25	16.67	5	SNP	1.000	C
CLIP3	25999	genome.wustl.edu	37	19	36515468	36515468	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:36515468C>T	ENST00000360535.4	-	7	975	c.748G>A	c.(748-750)Gag>Aag	p.E250K	AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Missense_Mutation_p.E250K	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3	250					chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			AGTGCCGCCTCTGCCTTGTCC	0.597																																						dbGAP											0													76.0	68.0	70.0					19																	36515468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.748G>A	19.37:g.36515468C>T	ENSP00000353732:p.Glu250Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	Missense_Mutation	SNP	pfam_CAP-Gly_domain,pfam_Ankyrin_rpt,superfamily_CAP-Gly_domain,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_CAP-Gly_domain	p.E250K	ENST00000360535.4	37	c.748	CCDS12486.1	19	.	.	.	.	.	.	.	.	.	.	C	25.3	4.621175	0.87460	.	.	ENSG00000105270	ENST00000360535;ENST00000544037;ENST00000534959	T	0.71934	-0.61	5.88	5.88	0.94601	.	0.000000	0.85682	D	0.000000	T	0.67069	0.2854	L	0.53249	1.67	0.58432	D	0.999999	P	0.46987	0.888	B	0.40165	0.321	T	0.65994	-0.6033	10	0.28530	T	0.3	-34.2167	17.7145	0.88332	0.0:1.0:0.0:0.0	.	250	Q96DZ5	CLIP3_HUMAN	K	250;132;226	ENSP00000353732:E250K	ENSP00000353732:E250K	E	-	1	0	CLIP3	41207308	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.530000	0.81962	2.790000	0.95986	0.591000	0.81541	GAG	CLIP3	-	NULL	ENSG00000105270		0.597	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP3	HGNC	protein_coding	OTTHUMT00000457426.1	18	0.00	0	C	NM_015526		36515468	36515468	-1	no_errors	ENST00000360535	ensembl	human	known	69_37n	missense	42	20.75	11	SNP	1.000	T
CNTN2	6900	genome.wustl.edu	37	1	205030518	205030518	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:205030518G>A	ENST00000331830.4	+	8	1227	c.943G>A	c.(943-945)Gac>Aac	p.D315N	AL583832.1_ENST00000515887.1_RNA	NM_005076.3	NP_005067.1	Q02246	CNTN2_HUMAN	contactin 2 (axonal)	315	Ig-like C2-type 3.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|cell adhesion (GO:0007155)|cellular protein localization (GO:0034613)|central nervous system myelination (GO:0022010)|cerebral cortex GABAergic interneuron migration (GO:0021853)|clustering of voltage-gated potassium channels (GO:0045163)|establishment of protein localization to juxtaparanode region of axon (GO:0071206)|learning (GO:0007612)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of neuron differentiation (GO:0045665)|positive regulation of adenosine receptor signaling pathway (GO:0060168)|positive regulation of protein processing (GO:0010954)|presynaptic membrane organization (GO:0097090)|receptor internalization (GO:0031623)|regulation of astrocyte differentiation (GO:0048710)|regulation of axon diameter (GO:0031133)|regulation of neuronal synaptic plasticity (GO:0048168)	anchored component of membrane (GO:0031225)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|juxtaparanode region of axon (GO:0044224)|myelin sheath (GO:0043209)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|synapse (GO:0045202)|voltage-gated potassium channel complex (GO:0008076)	carbohydrate binding (GO:0030246)|identical protein binding (GO:0042802)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(11)|lung(23)|ovary(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	54	all_cancers(21;0.144)|Breast(84;0.0437)		KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.158)			CAAGGGCCGAGACACCGTGCA	0.657											OREG0014144	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(183;2548 2817 37099 41192)	dbGAP											0													69.0	57.0	61.0					1																	205030518		2203	4300	6503	-	-	-	SO:0001583	missense	0			X67734	CCDS1449.1	1q32.1	2013-02-11			ENSG00000184144	ENSG00000184144		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2172	protein-coding gene	gene with protein product		190197		TAX, AXT		8307567, 8586965	Standard	NM_005076		Approved	TAG-1, TAX1	uc001hbr.3	Q02246	OTTHUMG00000037105	ENST00000331830.4:c.943G>A	1.37:g.205030518G>A	ENSP00000330633:p.Asp315Asn	Somatic	2149	WXS	Illumina GAIIx	Phase_IV	P78432|Q5T054	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D315N	ENST00000331830.4	37	c.943	CCDS1449.1	1	.	.	.	.	.	.	.	.	.	.	G	13.45	2.239921	0.39598	.	.	ENSG00000184144	ENST00000331830	T	0.67698	-0.28	5.33	4.42	0.53409	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000027	T	0.68970	0.3059	L	0.41632	1.29	0.47037	D	0.999293	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.77557	0.99;0.99;0.99	T	0.64837	-0.6313	10	0.08179	T	0.78	.	9.963	0.41708	0.1577:0.0:0.8423:0.0	.	315;315;206	A1L3A3;Q02246;Q68DA2	.;CNTN2_HUMAN;.	N	315	ENSP00000330633:D315N	ENSP00000330633:D315N	D	+	1	0	CNTN2	203297141	1.000000	0.71417	0.837000	0.33122	0.898000	0.52572	6.847000	0.75404	1.259000	0.44117	0.467000	0.42956	GAC	CNTN2	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	ENSG00000184144		0.657	CNTN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN2	HGNC	protein_coding	OTTHUMT00000090080.3	42	0.00	0	G	NM_005076		205030518	205030518	+1	no_errors	ENST00000331830	ensembl	human	known	69_37n	missense	64	12.33	9	SNP	0.985	A
CNTNAP3B	728577	genome.wustl.edu	37	9	43891708	43891708	+	Missense_Mutation	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:43891708C>A	ENST00000377564.3	+	17	3144	c.2751C>A	c.(2749-2751)ttC>ttA	p.F917L		NM_001201380.1	NP_001188309.1	Q96NU0	CNT3B_HUMAN	contactin associated protein-like 3B	917	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(2)|lung(3)|pancreas(1)|prostate(3)	10						GCCAGCTCTTCATTGGTGAGT	0.463																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0			BX538190	CCDS75836.1	9p12	2007-12-14			ENSG00000154529	ENSG00000154529			32035	protein-coding gene	gene with protein product						15820314	Standard	XM_006716853		Approved		uc004abr.1	Q96NU0	OTTHUMG00000013174	ENST00000377564.3:c.2751C>A	9.37:g.43891708C>A	ENSP00000366787:p.Phe917Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B1B0V7|B1B0V8|B1B0V9|B1B0W0|B1B0X8|B1B162|Q4VXF0|Q9H7W3	Nonsense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_ConA-like_lec_gl,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_EGF-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.S966*	ENST00000377564.3	37	c.2897	CCDS55312.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.79|13.79	2.341508|2.341508	0.41498|0.41498	.|.	.|.	ENSG00000154529|ENSG00000154529	ENST00000377564|ENST00000377561	T|.	0.78707|.	-1.2|.	2.67|2.67	-0.376|-0.376	0.12505|0.12505	.|.	.|.	.|.	.|.	.|.	T|.	0.71375|.	0.3332|.	M|M	0.86805|0.86805	2.84|2.84	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.68934|.	-0.5278|.	7|.	0.72032|.	D|.	0.01|.	.|.	5.9005|5.9005	0.18964|0.18964	0.0:0.3618:0.0:0.6382|0.0:0.3618:0.0:0.6382	.|.	.|.	.|.	.|.	L|X	917|966	ENSP00000366787:F917L|.	ENSP00000366787:F917L|.	F|S	+|+	3|2	2|0	CNTNAP3B|CNTNAP3B	43831704|43831704	0.784000|0.784000	0.28713|0.28713	0.986000|0.986000	0.45419|0.45419	0.646000|0.646000	0.38490|0.38490	-0.190000|-0.190000	0.09615|0.09615	0.055000|0.055000	0.16094|0.16094	0.121000|0.121000	0.15741|0.15741	TTC|TCA	CNTNAP3B	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl,smart_Laminin_G,pfscan_Laminin_G	ENSG00000154529		0.463	CNTNAP3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP3B	HGNC	protein_coding	OTTHUMT00000036930.3	21	0.00	0	C			43891708	43891708	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000377561	ensembl	human	known	69_37n	nonsense	25	21.88	7	SNP	0.974	A
COBLL1	22837	genome.wustl.edu	37	2	165578606	165578606	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:165578606C>T	ENST00000392717.2	-	7	1093	c.1089G>A	c.(1087-1089)atG>atA	p.M363I	COBLL1_ENST00000409184.3_Missense_Mutation_p.M363I|COBLL1_ENST00000194871.6_Missense_Mutation_p.M391I|COBLL1_ENST00000491126.2_Intron|COBLL1_ENST00000342193.4_Missense_Mutation_p.M325I|COBLL1_ENST00000375458.2_Missense_Mutation_p.M325I			Q53SF7	COBL1_HUMAN	cordon-bleu WH2 repeat protein-like 1	363						extracellular vesicular exosome (GO:0070062)				central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(12)|ovary(3)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	47						CATCCACGCTCATGGATTTCA	0.458																																						dbGAP											0													77.0	82.0	80.0					2																	165578606		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB023194	CCDS2223.2, CCDS63045.1	2q24.3	2012-12-07	2012-12-07		ENSG00000082438	ENSG00000082438			23571	protein-coding gene	gene with protein product		610318	"""COBL-like 1"""				Standard	NM_001278458		Approved	KIAA0977	uc002ucp.3	Q53SF7	OTTHUMG00000074019	ENST00000392717.2:c.1089G>A	2.37:g.165578606C>T	ENSP00000376478:p.Met363Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NMZ3|Q6IQ33|Q7Z3I6|Q9BRH4|Q9UG88|Q9Y2I3	Missense_Mutation	SNP	pfam_Cordon-bleu_domain,pfscan_WH2_dom	p.M391I	ENST00000392717.2	37	c.1173		2	.	.	.	.	.	.	.	.	.	.	C	4.329	0.060412	0.08339	.	.	ENSG00000082438	ENST00000375458;ENST00000342193;ENST00000409184;ENST00000392717;ENST00000194871	.	.	.	6.17	-1.53	0.08611	Cordon-bleu domain (1);	0.686784	0.15055	N	0.283092	T	0.11410	0.0278	N	0.02011	-0.69	0.09310	N	1	B;B;B	0.10296	0.003;0.003;0.002	B;B;B	0.15484	0.013;0.013;0.008	T	0.20605	-1.0270	9	0.36615	T	0.2	3.286	4.7573	0.13090	0.0993:0.1926:0.531:0.1772	.	363;391;363	Q53SF7;B7Z2P5;Q53SF7-2	COBL1_HUMAN;.;.	I	325;325;363;363;391	.	ENSP00000194871:M391I	M	-	3	0	COBLL1	165286852	0.002000	0.14202	0.074000	0.20217	0.414000	0.31173	-0.402000	0.07223	0.057000	0.16193	0.655000	0.94253	ATG	COBLL1	-	pfam_Cordon-bleu_domain	ENSG00000082438		0.458	COBLL1-202	KNOWN	basic|appris_candidate	protein_coding	COBLL1	HGNC	protein_coding		45	0.00	0	C	NM_014900		165578606	165578606	-1	no_errors	ENST00000194871	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	0.024	T
COL17A1	1308	genome.wustl.edu	37	10	105819932	105819932	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:105819932G>C	ENST00000353479.5	-	14	1376	c.1086C>G	c.(1084-1086)atC>atG	p.I362M	COL17A1_ENST00000393211.3_Missense_Mutation_p.I362M|COL17A1_ENST00000369733.3_Missense_Mutation_p.I362M	NM_000494.3	NP_000485.3	Q9UMD9	COHA1_HUMAN	collagen, type XVII, alpha 1	362	Nonhelical region (NC16).				cell junction assembly (GO:0034329)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|hemidesmosome (GO:0030056)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				NS(1)|breast(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|liver(1)|lung(22)|ovary(5)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(1)	62		Colorectal(252;0.103)|Breast(234;0.122)		Epithelial(162;2.5e-09)|all cancers(201;7.94e-08)|BRCA - Breast invasive adenocarcinoma(275;0.0165)		CCTTGGTCATGATGAGCAGCT	0.522																																						dbGAP											0													222.0	150.0	175.0					10																	105819932		2203	4300	6503	-	-	-	SO:0001583	missense	0			M91669	CCDS7554.1	10q24.3	2013-01-16			ENSG00000065618	ENSG00000065618		"""Collagens"""	2194	protein-coding gene	gene with protein product		113811		BPAG2		7916703	Standard	NM_000494		Approved	BP180	uc001kxr.3	Q9UMD9	OTTHUMG00000018998	ENST00000353479.5:c.1086C>G	10.37:g.105819932G>C	ENSP00000340937:p.Ile362Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q02802|Q5JV36|Q99018|Q9NQK9|Q9UC14	Missense_Mutation	SNP	pfam_Collagen	p.I362M	ENST00000353479.5	37	c.1086	CCDS7554.1	10	.	.	.	.	.	.	.	.	.	.	G	15.19	2.760279	0.49468	.	.	ENSG00000065618	ENST00000353479;ENST00000369733;ENST00000541872;ENST00000393211	T;T;T	0.60424	0.19;0.19;0.19	5.73	5.73	0.89815	.	0.143379	0.31370	N	0.007770	T	0.52338	0.1728	M	0.69823	2.125	0.42150	D	0.991554	P;P	0.41131	0.739;0.469	B;B	0.29785	0.107;0.092	T	0.62680	-0.6803	10	0.87932	D	0	-14.1489	12.8023	0.57593	0.0752:0.0:0.9248:0.0	.	362;362	Q9UMD9-2;Q9UMD9	.;COHA1_HUMAN	M	362;362;346;362	ENSP00000340937:I362M;ENSP00000358748:I362M;ENSP00000376905:I362M	ENSP00000340937:I362M	I	-	3	3	COL17A1	105809922	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	2.733000	0.47360	2.713000	0.92767	0.655000	0.94253	ATC	COL17A1	-	NULL	ENSG00000065618		0.522	COL17A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL17A1	HGNC	protein_coding	OTTHUMT00000050181.1	81	0.00	0	G	NM_130778, NM_000494		105819932	105819932	-1	no_errors	ENST00000353479	ensembl	human	known	69_37n	missense	70	14.63	12	SNP	1.000	C
COL6A4P1	344875	genome.wustl.edu	37	3	15219625	15219625	+	RNA	SNP	C	C	T	rs533165200	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:15219625C>T	ENST00000446690.2	-	0	318					NR_027927.1				collagen, type VI, alpha 4 pseudogene 1																		CCGCACACTGCGTGCATGTTG	0.498													C|||	2	0.000399361	0.0008	0.0014	5008	,	,		23374	0.0		0.0	False		,,,				2504	0.0					dbGAP											0																																										-	-	-			0			AB299979		3p25.1	2013-01-16	2010-05-24	2010-05-24	ENSG00000230524	ENSG00000230524		"""Collagens"""	33484	pseudogene	pseudogene	"""von Willebrand factor A domain containing 6"", ""collagen, type VI, alpha 4"", ""collagen, type VI, alpha 4, pseudogene"""	612397	"""dual von Willebrand factor A domains"""	DVWA		19507504, 19486942	Standard	NR_027927		Approved	VWA6, DIVA, COL6A4, COL6A4P	uc011avo.1		OTTHUMG00000154983		3.37:g.15219625C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000446690.2	37	NULL		3																																																																																			COL6A4P1	-	-	ENSG00000230524		0.498	COL6A4P1-002	KNOWN	basic	processed_transcript	COL6A4P1	HGNC	pseudogene	OTTHUMT00000337912.1	63	0.00	0	C	NR_027927		15219625	15219625	-1	no_errors	ENST00000446690	ensembl	human	known	69_37n	rna	49	16.95	10	SNP	0.000	T
CPXM2	119587	genome.wustl.edu	37	10	125521468	125521468	+	Missense_Mutation	SNP	C	C	T	rs529727115		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:125521468C>T	ENST00000241305.3	-	11	1851	c.1697G>A	c.(1696-1698)cGg>cAg	p.R566Q	CPXM2_ENST00000368854.3_5'UTR	NM_198148.2	NP_937791.2	Q8N436	CPXM2_HUMAN	carboxypeptidase X (M14 family), member 2	566					cell adhesion (GO:0007155)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(7)|kidney(2)|large_intestine(13)|lung(15)|ovary(2)|prostate(2)|skin(3)	47		all_lung(145;0.174)|Colorectal(57;0.178)|Glioma(114;0.222)|all_neural(114;0.226)|Lung NSC(174;0.233)		COAD - Colon adenocarcinoma(40;0.212)|Colorectal(40;0.237)		CACCCTCCTCCGGGCGTCTGT	0.652													C|||	1	0.000199681	0.0008	0.0	5008	,	,		16474	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													38.0	39.0	39.0					10																	125521468		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY358565	CCDS7637.1	10q26	2012-02-10			ENSG00000121898	ENSG00000121898			26977	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase"""					12975309	Standard	NM_198148		Approved	UNQ676, CPX2	uc001lhk.1	Q8N436	OTTHUMG00000019206	ENST00000241305.3:c.1697G>A	10.37:g.125521468C>T	ENSP00000241305:p.Arg566Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E3Q2	Missense_Mutation	SNP	pfam_Peptidase_M14,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,superfamily_CarboxyPept-like_regulatory,smart_Coagulation_fac_5/8-C_type_dom,smart_Peptidase_M14,pfscan_Coagulation_fac_5/8-C_type_dom,prints_Peptidase_M14	p.R566Q	ENST00000241305.3	37	c.1697	CCDS7637.1	10	.	.	.	.	.	.	.	.	.	.	C	9.815	1.184153	0.21870	.	.	ENSG00000121898	ENST00000368854;ENST00000241305;ENST00000540123;ENST00000418782	D	0.95918	-3.85	5.36	4.46	0.54185	Peptidase M14, carboxypeptidase A (2);	0.106110	0.64402	D	0.000006	D	0.92028	0.7474	N	0.20986	0.625	0.30179	N	0.80058	D	0.54601	0.967	P	0.47376	0.545	D	0.88591	0.3143	10	0.25751	T	0.34	-8.1167	14.153	0.65398	0.0:0.9285:0.0:0.0715	.	566	Q8N436	CPXM2_HUMAN	Q	62;566;399;541	ENSP00000241305:R566Q	ENSP00000241305:R566Q	R	-	2	0	CPXM2	125511458	0.056000	0.20664	0.453000	0.27007	0.153000	0.21895	2.005000	0.40864	1.505000	0.48720	-0.192000	0.12808	CGG	CPXM2	-	pfam_Peptidase_M14,smart_Peptidase_M14	ENSG00000121898		0.652	CPXM2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXM2	HGNC	protein_coding	OTTHUMT00000050853.1	83	0.00	0	C	NM_198148		125521468	125521468	-1	no_errors	ENST00000241305	ensembl	human	known	69_37n	missense	57	12.31	8	SNP	0.995	T
CSDE1	7812	genome.wustl.edu	37	1	115262273	115262273	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:115262273C>T	ENST00000358528.4	-	18	2569	c.2143G>A	c.(2143-2145)Gat>Aat	p.D715N	CSDE1_ENST00000261443.5_Missense_Mutation_p.D684N|CSDE1_ENST00000483407.1_5'Flank|CSDE1_ENST00000534699.1_Missense_Mutation_p.D715N|NRAS_ENST00000369535.4_5'Flank|CSDE1_ENST00000369530.1_Missense_Mutation_p.D730N|CSDE1_ENST00000530886.1_Missense_Mutation_p.D585N|CSDE1_ENST00000339438.6_Missense_Mutation_p.D684N|CSDE1_ENST00000438362.2_Missense_Mutation_p.D761N	NM_001007553.2	NP_001007554.1	O75534	CSDE1_HUMAN	cold shock domain containing E1, RNA-binding	715	CSD 9.				male gonad development (GO:0008584)|nuclear-transcribed mRNA catabolic process, no-go decay (GO:0070966)|regulation of transcription, DNA-templated (GO:0006355)	CRD-mediated mRNA stability complex (GO:0070937)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(11)|kidney(2)|large_intestine(12)|lung(17)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	51	all_epithelial(7;5.11e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;2.21e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		TCCACCTCATCTCCTGCCTGT	0.428																																						dbGAP											0													168.0	171.0	170.0					1																	115262273		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS30811.1, CCDS30812.1, CCDS44197.1, CCDS55626.1	1p13.2	2011-11-02			ENSG00000009307	ENSG00000009307			29905	protein-coding gene	gene with protein product	"""upstream of NRAS"""	191510				2204029, 10048485	Standard	NM_007158		Approved	D1S155E, UNR	uc001efi.3	O75534	OTTHUMG00000012060	ENST00000358528.4:c.2143G>A	1.37:g.115262273C>T	ENSP00000351329:p.Asp715Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K281|E9PGZ0|G5E9Q2|O94961|Q5TF04|Q5TF05|Q68DF1|Q68DI9|Q9Y2S4	Missense_Mutation	SNP	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_Cold_shock_prot	p.D730N	ENST00000358528.4	37	c.2188	CCDS30812.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.859251	0.97036	.	.	ENSG00000009307	ENST00000339438;ENST00000438362;ENST00000358528;ENST00000261443;ENST00000530886;ENST00000369530;ENST00000534699	.	.	.	6.17	6.17	0.99709	Cold shock protein (1);Nucleic acid-binding, OB-fold-like (1);Cold-shock protein, DNA-binding (1);Nucleic acid-binding, OB-fold (1);	0.000000	0.85682	D	0.000000	D	0.84297	0.5441	M	0.89214	3.015	0.80722	D	1	D;D;D	0.71674	0.998;0.997;0.99	D;D;P	0.80764	0.963;0.994;0.794	D	0.85291	0.1067	9	0.87932	D	0	-17.8368	20.8794	0.99867	0.0:1.0:0.0:0.0	.	730;715;761	E9PGZ0;O75534;G5E9Q2	.;CSDE1_HUMAN;.	N	684;761;715;684;585;730;715	.	ENSP00000261443:D684N	D	-	1	0	CSDE1	115063796	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.433000	0.80362	2.941000	0.99782	0.655000	0.94253	GAT	CSDE1	-	pfam_CSP_DNA-bd,superfamily_NA-bd_OB-fold-like,smart_Cold_shock_prot	ENSG00000009307		0.428	CSDE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CSDE1	HGNC	protein_coding	OTTHUMT00000033397.1	44	0.00	0	C	NM_007158		115262273	115262273	-1	no_errors	ENST00000369530	ensembl	human	known	69_37n	missense	59	20.27	15	SNP	1.000	T
DNM1P51	0	genome.wustl.edu	37	15	84954363	84954363	+	RNA	SNP	G	G	A	rs529399767	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:84954363G>A	ENST00000558801.1	-	0	7402									DNM1 pseudogene 51																		CAGTGGCTCCGAGATGATGAA	0.577													.|||	2	0.000399361	0.0	0.0	5008	,	,		18768	0.0		0.0	False		,,,				2504	0.002					dbGAP											0																																										-	-	-			0					15q25.2	2013-05-16			ENSG00000259297	ENSG00000235370			48500	pseudogene	pseudogene							Standard			Approved				OTTHUMG00000172438		15.37:g.84954363G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000558801.1	37	NULL		15																																																																																			CSPG4P5	-	-	ENSG00000235370		0.577	DNM1P51-001	KNOWN	basic	processed_transcript	CSPG4P5	HGNC	pseudogene	OTTHUMT00000471721.1	229	0.00	0	G			84954363	84954363	-1	no_errors	ENST00000456932	ensembl	human	known	69_37n	rna	190	14.41	32	SNP	1.000	A
CTAGE9	643854	genome.wustl.edu	37	6	132031248	132031248	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:132031248C>T	ENST00000314099.8	-	1	958	c.910G>A	c.(910-912)Ggt>Agt	p.G304S	ENPP3_ENST00000358229.5_Intron|ENPP3_ENST00000357639.3_Intron|ENPP3_ENST00000414305.1_Intron	NM_001145659.1|NM_001278507.1	NP_001139131.1|NP_001265436.1	A4FU28	CTGE9_HUMAN	CTAGE family, member 9	304						integral component of membrane (GO:0016021)				endometrium(1)|lung(1)	2						AAGTTAGCACCATTTTCCCAT	0.388																																						dbGAP											0													130.0	86.0	99.0					6																	132031248		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS47475.1	6q23.2	2010-06-23			ENSG00000236761	ENSG00000236761			37275	protein-coding gene	gene with protein product							Standard	NM_001145659		Approved		uc011ece.2	A4FU28	OTTHUMG00000047966	ENST00000314099.8:c.910G>A	6.37:g.132031248C>T	ENSP00000395587:p.Gly304Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G304S	ENST00000314099.8	37	c.910	CCDS47475.1	6	.	.	.	.	.	.	.	.	.	.	-	7.250	0.603022	0.13939	.	.	ENSG00000236761	ENST00000314099	T	0.35789	1.29	.	.	.	.	.	.	.	.	T	0.26882	0.0658	M	0.86651	2.83	0.09310	N	1	P	0.39737	0.685	B	0.42282	0.382	T	0.14144	-1.0483	6	0.41790	T	0.15	.	.	.	.	.	304	A4FU28	CTGE9_HUMAN	S	304	ENSP00000395587:G304S	ENSP00000395587:G304S	G	-	1	0	CTAGE9	132072941	0.450000	0.25697	.	.	.	.	0.984000	0.29565	.	.	.	.	GGT	CTAGE9	-	NULL	ENSG00000236761		0.388	CTAGE9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTAGE9	HGNC	protein_coding	OTTHUMT00000109220.1	154	0.00	0	C	NM_001145659		132031248	132031248	-1	no_errors	ENST00000314099	ensembl	human	known	69_37n	missense	107	24.11	34	SNP	0.000	T
CWH43	80157	genome.wustl.edu	37	4	48990513	48990513	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr4:48990513C>G	ENST00000226432.4	+	2	246	c.63C>G	c.(61-63)ctC>ctG	p.L21L	CWH43_ENST00000513409.1_5'UTR	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	21					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)				cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						CTTGGTCTCTCTACCATGACC	0.393																																						dbGAP											0													103.0	101.0	102.0					4																	48990513		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.63C>G	4.37:g.48990513C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPD7	Silent	SNP	superfamily_Endo/exonuclease/phosphatase	p.L21	ENST00000226432.4	37	c.63	CCDS3486.1	4																																																																																			CWH43	-	NULL	ENSG00000109182		0.393	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2	45	0.00	0	C	NM_025087		48990513	48990513	+1	no_errors	ENST00000226432	ensembl	human	known	69_37n	silent	33	20.93	9	SNP	1.000	G
CXCL17	284340	genome.wustl.edu	37	19	42933115	42933115	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:42933115C>T	ENST00000601181.1	-	4	496	c.281G>A	c.(280-282)aGa>aAa	p.R94K	LIPE-AS1_ENST00000457234.2_RNA|LIPE_ENST00000244289.4_5'Flank|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000597203.1_RNA|LIPE-AS1_ENST00000593740.2_RNA|LIPE-AS1_ENST00000594688.1_RNA	NM_198477.1	NP_940879.1	Q6UXB2	VCC1_HUMAN	chemokine (C-X-C motif) ligand 17	94					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|chemotaxis (GO:0006935)	extracellular region (GO:0005576)				large_intestine(2)|skin(1)	3		Prostate(69;0.00899)				GTTTGGCTTTCTGTGGTGCCT	0.448																																						dbGAP											0													236.0	236.0	236.0					19																	42933115		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS12608.1	19q13.2	2007-10-15				ENSG00000189377			19232	protein-coding gene	gene with protein product		611387				17201934	Standard	NM_198477		Approved	Dcip1, UNQ473, DMC, VCC1	uc002otu.3	Q6UXB2		ENST00000601181.1:c.281G>A	19.37:g.42933115C>T	ENSP00000472467:p.Arg94Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAC0	Missense_Mutation	SNP	NULL	p.R94K	ENST00000601181.1	37	c.281	CCDS12608.1	19	.	.	.	.	.	.	.	.	.	.	C	12.92	2.083382	0.36758	.	.	ENSG00000189377	ENST00000341918	.	.	.	4.95	-2.29	0.06805	.	0.742403	0.11604	N	0.547475	T	0.26412	0.0645	N	0.20986	0.625	0.09310	N	1	B	0.11235	0.004	B	0.14578	0.011	T	0.27400	-1.0075	9	0.87932	D	0	-1.1011	9.0114	0.36144	0.0:0.5367:0.0:0.4633	.	94	Q6UXB2	VCC1_HUMAN	K	94	.	ENSP00000345317:R94K	R	-	2	0	CXCL17	47624955	0.504000	0.26123	0.419000	0.26584	0.973000	0.67179	-0.071000	0.11505	-0.321000	0.08627	0.650000	0.86243	AGA	CXCL17	-	NULL	ENSG00000189377		0.448	CXCL17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXCL17	HGNC	protein_coding	OTTHUMT00000463872.1	67	0.00	0	C			42933115	42933115	-1	no_errors	ENST00000341918	ensembl	human	known	69_37n	missense	54	18.18	12	SNP	0.295	T
CXXC1	30827	genome.wustl.edu	37	18	47810867	47810867	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr18:47810867C>T	ENST00000285106.6	-	9	1800	c.1086G>A	c.(1084-1086)gaG>gaA	p.E362E	CXXC1_ENST00000589940.1_Silent_p.E362E|CXXC1_ENST00000587396.1_5'Flank|MBD1_ENST00000269471.5_5'Flank|MBD1_ENST00000347968.3_5'Flank|MBD1_ENST00000591416.1_5'Flank|MBD1_ENST00000349085.2_5'Flank|MBD1_ENST00000382948.5_5'Flank|MBD1_ENST00000269468.5_5'Flank|MBD1_ENST00000436910.1_5'Flank|MBD1_ENST00000587605.1_5'Flank|MBD1_ENST00000398493.1_5'Flank|CXXC1_ENST00000412036.2_Silent_p.E366E|MBD1_ENST00000590208.1_5'Flank	NM_001101654.1|NM_014593.3	NP_001095124.1|NP_055408.2	Q9P0U4	CXXC1_HUMAN	CXXC finger protein 1	362					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|histone H3-K4 methylation (GO:0051568)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	24						CATCAGCCCTCTCTGGGTGTT	0.597																																						dbGAP											0													165.0	172.0	170.0					18																	47810867		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC014940	CCDS11945.1, CCDS45866.1	18q12	2014-02-20	2014-02-20		ENSG00000154832	ENSG00000154832		"""Zinc fingers, PHD-type"""	24343	protein-coding gene	gene with protein product	"""CpG binding protein"", ""DNA-binding protein with PHD finger and CXXC domain"", ""zinc finger, CpG binding-type containing 1"""	609150	"""CXXC finger 1 (PHD domain)"""			10799292, 10688657	Standard	NM_014593		Approved	HsT2645, PCCX1, hCGBP, PHF18, CGBP, SPP1, CFP1, ZCGPC1	uc002ler.4	Q9P0U4	OTTHUMG00000132670	ENST00000285106.6:c.1086G>A	18.37:g.47810867C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RC03|Q8N2W4|Q96BC8|Q9P2V7	Silent	SNP	pfam_CpG-bd_C,pfam_Znf_CXXC,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.E366	ENST00000285106.6	37	c.1098	CCDS11945.1	18																																																																																			CXXC1	-	NULL	ENSG00000154832		0.597	CXXC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CXXC1	HGNC	protein_coding	OTTHUMT00000255927.2	57	0.00	0	C	NM_014593		47810867	47810867	-1	no_errors	ENST00000412036	ensembl	human	known	69_37n	silent	45	19.64	11	SNP	0.831	T
DACH2	117154	genome.wustl.edu	37	X	86082772	86082772	+	Intron	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:86082772G>C	ENST00000373125.4	+	12	1750				DACH2_ENST00000508860.1_Intron|DACH2_ENST00000373131.1_Nonstop_Mutation_p.*572S|DACH2_ENST00000510272.1_Intron	NM_053281.3	NP_444511.1	Q96NX9	DACH2_HUMAN	dachshund family transcription factor 2						development of primary female sexual characteristics (GO:0046545)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|large_intestine(14)|lung(28)|ovary(5)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	71						TGTGCAGCCTGAACACTGATG	0.378																																						dbGAP											0													257.0	182.0	205.0					X																	86082772		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AF428101	CCDS14455.1, CCDS48140.1, CCDS55457.1	Xq21.3	2014-02-03	2014-02-03		ENSG00000126733	ENSG00000126733			16814	protein-coding gene	gene with protein product		300608	"""dachshund homolog 2 (Drosophila)"""				Standard	NM_053281		Approved		uc004eew.2	Q96NX9	OTTHUMG00000021944	ENST00000373125.4:c.1751-4337G>C	X.37:g.86082772G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AJV3|B4DQG3|Q8NAY3|Q8ND17|Q96N55	Nonstop_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.*572S	ENST00000373125.4	37	c.1715	CCDS14455.1	X	.	.	.	.	.	.	.	.	.	.	G	13.46	2.244210	0.39697	.	.	ENSG00000126733	ENST00000373131;ENST00000484479	.	.	.	4.08	4.08	0.47627	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.8509	0.41057	0.0991:0.0:0.9009:0.0	.	.	.	.	S	572;250	.	.	X	+	2	2	DACH2	85969428	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.135000	0.57997	1.756000	0.51951	0.506000	0.49869	TGA	DACH2	-	NULL	ENSG00000126733		0.378	DACH2-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DACH2	HGNC	protein_coding	OTTHUMT00000359266.1	36	0.00	0	G	NM_053281		86082772	86082772	+1	no_errors	ENST00000373131	ensembl	human	known	69_37n	nonstop	40	14.89	7	SNP	0.996	C
DAO	1610	genome.wustl.edu	37	12	109273444	109273444	+	5'Flank	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:109273444C>A	ENST00000228476.3	+	0	0				DAO_ENST00000551281.1_Intron|DAO_ENST00000548052.1_3'UTR	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase						cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	TCCTTGGCCTCATCTCCCCAG	0.662																																						dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360		12.37:g.109273444C>A	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R7I5|Q16758|Q8N6R2	RNA	SNP	-	NULL	ENST00000228476.3	37	NULL	CCDS9122.1	12																																																																																			DAO	-	-	ENSG00000110887		0.662	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAO	HGNC	protein_coding	OTTHUMT00000403682.1	66	0.00	0	C			109273444	109273444	+1	no_errors	ENST00000548052	ensembl	human	known	69_37n	rna	93	11.43	12	SNP	0.000	A
DAXX	1616	genome.wustl.edu	37	6	33289225	33289225	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:33289225G>C	ENST00000374542.5	-	3	531	c.327C>G	c.(325-327)ctC>ctG	p.L109L	DAXX_ENST00000414083.2_Silent_p.L34L|DAXX_ENST00000266000.6_Silent_p.L109L|DAXX_ENST00000477162.1_Intron	NM_001141969.1|NM_001141970.1|NM_001350.4	NP_001135441.1|NP_001135442.1|NP_001341.1	Q9UER7	DAXX_HUMAN	death-domain associated protein	109	Necessary for interaction with USP7 and ATRX.				activation of JUN kinase activity (GO:0007257)|androgen receptor signaling pathway (GO:0030521)|apoptotic process (GO:0006915)|chromatin remodeling (GO:0006338)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|mitotic cytokinesis (GO:0000281)|negative regulation of transcription, DNA-templated (GO:0045892)|nucleosome assembly (GO:0006334)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of neuron death (GO:1901216)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein ubiquitination (GO:0031396)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromosome, centromeric region (GO:0000775)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|PML body (GO:0016605)|SWI/SNF superfamily-type complex (GO:0070603)	androgen receptor binding (GO:0050681)|enzyme binding (GO:0019899)|heat shock protein binding (GO:0031072)|histone binding (GO:0042393)|p53 binding (GO:0002039)|protein homodimerization activity (GO:0042803)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|receptor signaling protein activity (GO:0005057)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(2)|lung(7)|ovary(3)|pancreas(18)|prostate(3)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	55						GGACCCTAGAGAGGATGTTGC	0.572			"""Mis, F, N"""		Pancreatic neuroendocrine tumors. Paediatric GBM																																	dbGAP		Rec	yes		6	6p21.3	1616	death-domain associated protein		E	0													63.0	69.0	67.0					6																	33289225		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF006041	CCDS4776.1, CCDS59008.1	6p21.3	2008-08-29	2008-08-29			ENSG00000204209			2681	protein-coding gene	gene with protein product		603186	"""death-associated protein 6"""			9407001, 9215629	Standard	NM_001141970		Approved	DAP6	uc011dre.2	Q9UER7		ENST00000374542.5:c.327C>G	6.37:g.33289225G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E1I3|F5H082|O14747|O15141|O15208|Q5STK9|Q9BWI3	Silent	SNP	pfam_Daxx	p.L109	ENST00000374542.5	37	c.327	CCDS4776.1	6																																																																																			DAXX	-	pfam_Daxx	ENSG00000204209		0.572	DAXX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAXX	HGNC	protein_coding	OTTHUMT00000076403.1	22	0.00	0	G			33289225	33289225	-1	no_errors	ENST00000266000	ensembl	human	known	69_37n	silent	38	17.39	8	SNP	0.999	C
DBH	1621	genome.wustl.edu	37	9	136508598	136508598	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:136508598G>A	ENST00000393056.2	+	4	820	c.808G>A	c.(808-810)Gcc>Acc	p.A270T		NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	270					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	CTTCCAGTGCGCCCCCGAGAT	0.662																																						dbGAP											0													79.0	77.0	78.0					9																	136508598		2203	4300	6503	-	-	-	SO:0001583	missense	0			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.808G>A	9.37:g.136508598G>A	ENSP00000376776:p.Ala270Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T381|Q96AG2	Missense_Mutation	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.A270T	ENST00000393056.2	37	c.808	CCDS6977.2	9	.	.	.	.	.	.	.	.	.	.	G	3.229	-0.157890	0.06544	.	.	ENSG00000123454	ENST00000393056;ENST00000371880;ENST00000263611	T;T	0.28666	1.6;1.6	4.9	-0.282	0.12878	Copper type II, ascorbate-dependent monooxygenase, N-terminal (2);PHM/PNGase F domain (1);	0.481294	0.24825	N	0.035296	T	0.15392	0.0371	N	0.20685	0.6	0.09310	N	1	B	0.24483	0.104	B	0.19391	0.025	T	0.14282	-1.0478	10	0.33940	T	0.23	-12.7422	6.4904	0.22113	0.3589:0.1165:0.5246:0.0	.	270	P09172	DOPO_HUMAN	T	270;207;207	ENSP00000376776:A270T;ENSP00000263611:A207T	ENSP00000263611:A207T	A	+	1	0	DBH	135498419	0.005000	0.15991	0.006000	0.13384	0.020000	0.10135	0.193000	0.17116	-0.387000	0.07809	-1.172000	0.01736	GCC	DBH	-	pfam_Cu2_ascorb_mOase_N,superfamily_PHM/PNGase_F_dom,prints_Dopamine_b_mOase	ENSG00000123454		0.662	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	HGNC	protein_coding	OTTHUMT00000054929.2	65	0.00	0	G	NM_000787		136508598	136508598	+1	no_errors	ENST00000393056	ensembl	human	known	69_37n	missense	63	25.58	22	SNP	0.011	A
DEPDC1	55635	genome.wustl.edu	37	1	68948311	68948311	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:68948311C>T	ENST00000456315.2	-	8	1294	c.1180G>A	c.(1180-1182)Gac>Aac	p.D394N	RP4-694A7.2_ENST00000425820.1_RNA|DEPDC1_ENST00000370966.5_Intron	NM_001114120.1	NP_001107592.1	Q5TB30	DEP1A_HUMAN	DEP domain containing 1	394					intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(3)|lung(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(397;7.21e-36)		CCCATTATGTCATTAGCACTC	0.358																																						dbGAP											0													103.0	93.0	96.0					1																	68948311		1568	3580	5148	-	-	-	SO:0001583	missense	0			AK000361	CCDS644.1, CCDS44159.1	1p31.2	2008-08-19			ENSG00000024526	ENSG00000024526			22949	protein-coding gene	gene with protein product		612002					Standard	NM_001114120		Approved	DEP.8, FLJ20354, SDP35, DEPDC1A	uc001dem.4	Q5TB30	OTTHUMG00000009212	ENST00000456315.2:c.1180G>A	1.37:g.68948311C>T	ENSP00000412292:p.Asp394Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A8QXE0|A8QXE1|Q05DU3|Q5TB28|Q9H9I3|Q9NX21|Q9NXZ0	Missense_Mutation	SNP	pfam_DEP_dom,superfamily_Rho_GTPase_activation_prot,smart_DEP_dom,pfscan_DEP_dom	p.D394N	ENST00000456315.2	37	c.1180	CCDS44159.1	1	.	.	.	.	.	.	.	.	.	.	C	3.382	-0.126172	0.06795	.	.	ENSG00000024526	ENST00000456315	T	0.11277	2.79	5.68	2.71	0.32032	Rho GTPase activation protein (1);	0.690833	0.14872	N	0.293483	T	0.01940	0.0061	N	0.24115	0.695	0.09310	N	0.999998	B	0.06786	0.001	B	0.04013	0.001	T	0.46638	-0.9177	10	0.23302	T	0.38	-0.0015	6.9144	0.24352	0.1254:0.6662:0.0:0.2084	.	394	Q5TB30	DEP1A_HUMAN	N	394	ENSP00000412292:D394N	ENSP00000412292:D394N	D	-	1	0	DEPDC1	68720899	0.000000	0.05858	0.448000	0.26945	0.744000	0.42396	0.699000	0.25586	0.717000	0.32145	0.650000	0.86243	GAC	DEPDC1	-	superfamily_Rho_GTPase_activation_prot	ENSG00000024526		0.358	DEPDC1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DEPDC1	HGNC	protein_coding	OTTHUMT00000025514.2	108	0.00	0	C	NM_017779		68948311	68948311	-1	no_errors	ENST00000456315	ensembl	human	known	69_37n	missense	95	15.18	17	SNP	0.003	T
DGAT2L6	347516	genome.wustl.edu	37	X	69421894	69421894	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:69421894G>A	ENST00000333026.3	+	5	727	c.627G>A	c.(625-627)gtG>gtA	p.V209V		NM_198512.1	NP_940914.1	Q6ZPD8	DG2L6_HUMAN	diacylglycerol O-acyltransferase 2-like 6	209					lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring acyl groups other than amino-acyl groups (GO:0016747)			breast(1)|endometrium(2)|large_intestine(3)|lung(5)|ovary(1)	12						AAGGTTTTGTGAAGATGGCAC	0.562																																						dbGAP											0													92.0	65.0	74.0					X																	69421894		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK129500	CCDS14397.1	Xq13.1	2008-02-05			ENSG00000184210	ENSG00000184210			23250	protein-coding gene	gene with protein product		300926				15671038	Standard	NM_198512		Approved	DC3, FLJ25989	uc004dxx.1	Q6ZPD8	OTTHUMG00000021774	ENST00000333026.3:c.627G>A	X.37:g.69421894G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IEE2	Silent	SNP	pfam_DAGAT	p.V209	ENST00000333026.3	37	c.627	CCDS14397.1	X																																																																																			DGAT2L6	-	pfam_DAGAT	ENSG00000184210		0.562	DGAT2L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DGAT2L6	HGNC	protein_coding	OTTHUMT00000057067.1	73	0.00	0	G	NM_198512		69421894	69421894	+1	no_errors	ENST00000333026	ensembl	human	known	69_37n	silent	81	11.96	11	SNP	1.000	A
DGKD	8527	genome.wustl.edu	37	2	234350626	234350626	+	Silent	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:234350626C>A	ENST00000264057.2	+	10	1191	c.1179C>A	c.(1177-1179)ctC>ctA	p.L393L	DGKD_ENST00000409813.3_Silent_p.L349L	NM_152879.2	NP_690618.2	Q16760	DGKD_HUMAN	diacylglycerol kinase, delta 130kDa	393	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				blood coagulation (GO:0007596)|cell growth (GO:0016049)|diacylglycerol metabolic process (GO:0046339)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|multicellular organismal development (GO:0007275)|platelet activation (GO:0030168)|protein homooligomerization (GO:0051260)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|protein transport (GO:0015031)|response to organic substance (GO:0010033)|second-messenger-mediated signaling (GO:0019932)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol binding (GO:0019992)|diacylglycerol kinase activity (GO:0004143)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(13)|lung(15)|ovary(1)|pancreas(1)|skin(1)	38		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.0179)|Acute lymphoblastic leukemia(138;0.0326)|Lung NSC(271;0.0538)		Epithelial(121;1.31e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000416)|Lung(119;0.00285)|LUSC - Lung squamous cell carcinoma(224;0.00655)	Phosphatidylserine(DB00144)	TCGACAGCCTCAACCTTCATA	0.537																																						dbGAP											0													96.0	87.0	90.0					2																	234350626		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D63479	CCDS2504.1, CCDS46546.1	2q37	2013-01-10	2002-08-29		ENSG00000077044	ENSG00000077044		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	2851	protein-coding gene	gene with protein product	"""diglyceride kinase"""	601826	"""diacylglycerol kinase, delta (130kD)"""			8626538, 12810723	Standard	NM_003648		Approved	KIAA0145, DGKdelta	uc002vui.1	Q16760	OTTHUMG00000133290	ENST00000264057.2:c.1179C>A	2.37:g.234350626C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q14158|Q6PK55|Q8NG53	Nonsense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.S54*	ENST00000264057.2	37	c.161	CCDS2504.1	2																																																																																			DGKD	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	ENSG00000077044		0.537	DGKD-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKD	HGNC	protein_coding	OTTHUMT00000257072.2	68	0.00	0	C	NM_003648		234350626	234350626	+1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000430834	ensembl	human	known	69_37n	nonsense	77	16.30	15	SNP	1.000	A
DGKI	9162	genome.wustl.edu	37	7	137075578	137075578	+	3'UTR	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:137075578G>A	ENST00000288490.5	-	0	3586				DGKI_ENST00000446122.1_3'UTR|DGKI_ENST00000453654.2_3'UTR|DGKI_ENST00000424189.2_3'UTR|DGKI_ENST00000494390.1_5'UTR	NM_004717.2	NP_004708.1	O75912	DGKI_HUMAN	diacylglycerol kinase, iota						blood coagulation (GO:0007596)|intracellular signal transduction (GO:0035556)|platelet activation (GO:0030168)|positive regulation of Ras protein signal transduction (GO:0046579)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of Rap GTPase activity (GO:0032317)	cytoplasm (GO:0005737)|guanyl-nucleotide exchange factor complex (GO:0032045)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|diacylglycerol kinase activity (GO:0004143)|GTPase inhibitor activity (GO:0005095)|metal ion binding (GO:0046872)|NAD+ kinase activity (GO:0003951)			breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(46)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	84						AGTTACAGTAGAATTGTATGG	0.358																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF061936	CCDS5845.1	7q32.3-q33	2013-01-10			ENSG00000157680	ENSG00000157680		"""Ankyrin repeat domain containing"""	2855	protein-coding gene	gene with protein product		604072				9830018	Standard	NM_004717		Approved	DGK-IOTA	uc003vtt.3	O75912	OTTHUMG00000155697	ENST00000288490.5:c.*388C>T	7.37:g.137075578G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D1Q9|Q9NZ49	RNA	SNP	-	NULL	ENST00000288490.5	37	NULL	CCDS5845.1	7																																																																																			DGKI	-	-	ENSG00000157680		0.358	DGKI-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DGKI	HGNC	protein_coding	OTTHUMT00000341286.3	20	0.00	0	G	NM_004717		137075578	137075578	-1	no_errors	ENST00000494390	ensembl	human	known	69_37n	rna	33	17.50	7	SNP	0.804	A
DLG2	1740	genome.wustl.edu	37	11	84027938	84027938	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:84027938G>A	ENST00000398301.2	-	1	444	c.251C>T	c.(250-252)aCg>aTg	p.T84M	DLG2_ENST00000398309.2_Intron|DLG2_ENST00000532653.1_Intron|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000280241.8_Missense_Mutation_p.T84M|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000524982.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)	0	L27 2. {ECO:0000255|PROSITE- ProRule:PRU00365}.				nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				CTTGGTGCTCGTCTTGTGGGG	0.582																																						dbGAP											0													71.0	69.0	69.0					11																	84027938		876	1990	2866	-	-	-	SO:0001583	missense	0			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000398301.2:c.251C>T	11.37:g.84027938G>A	ENSP00000381346:p.Thr84Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	Missense_Mutation	SNP	pfam_PDZ,pfam_Guanylate_kin,pfam_PDZ_assoc,pfam_MAGUK_PEST_N,pfam_SH3_2,pfam_SH3_domain,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.T84M	ENST00000398301.2	37	c.251		11	.	.	.	.	.	.	.	.	.	.	G	14.29	2.491639	0.44249	.	.	ENSG00000150672	ENST00000280241;ENST00000398301	T;T	0.43294	0.95;0.95	5.86	2.15	0.27550	.	.	.	.	.	T	0.16854	0.0405	N	0.03608	-0.345	0.22446	N	0.999095	B	0.32918	0.39	B	0.24155	0.051	T	0.13442	-1.0509	8	.	.	.	.	9.7386	0.40404	0.3579:0.0:0.6421:0.0	.	84	Q6ZSU2	.	M	84	ENSP00000280241:T84M;ENSP00000381346:T84M	.	T	-	2	0	DLG2	83705586	0.329000	0.24696	0.911000	0.35937	0.989000	0.77384	0.558000	0.23469	0.633000	0.30452	0.585000	0.79938	ACG	DLG2	-	pfam_MAGUK_PEST_N,pirsf_M-assoc_guanylate_kinase	ENSG00000150672		0.582	DLG2-002	PUTATIVE	basic	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259244.2	32	0.00	0	G	NM_001364		84027938	84027938	-1	no_errors	ENST00000280241	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	0.168	A
DLX5	1749	genome.wustl.edu	37	7	96653581	96653581	+	Splice_Site	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:96653581C>T	ENST00000222598.4	-	1	828	c.355G>A	c.(355-357)Gag>Aag	p.E119K	DLX5_ENST00000493764.1_5'UTR|DLX5_ENST00000486603.2_Splice_Site_p.E119K	NM_005221.5	NP_005212.1	P56178	DLX5_HUMAN	distal-less homeobox 5	119					anatomical structure formation involved in morphogenesis (GO:0048646)|axon guidance (GO:0007411)|BMP signaling pathway (GO:0030509)|cell proliferation (GO:0008283)|cellular response to BMP stimulus (GO:0071773)|embryonic limb morphogenesis (GO:0030326)|endochondral ossification (GO:0001958)|epithelial cell differentiation (GO:0030855)|face morphogenesis (GO:0060325)|inner ear morphogenesis (GO:0042472)|nervous system development (GO:0007399)|olfactory pit development (GO:0060166)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter involved in cellular response to chemical stimulus (GO:1901522)|positive regulation of transcription, DNA-templated (GO:0045893)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(7)|lung(9)|ovary(1)|prostate(1)	20	all_cancers(62;9.56e-09)|all_epithelial(64;7.38e-09)|Esophageal squamous(72;0.0125)|all_lung(186;0.0855)|Lung NSC(181;0.0858)					GTCCATGTACCTGGCTGGTTG	0.627																																						dbGAP											0													42.0	37.0	39.0					7																	96653581		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0				CCDS5647.1	7q21.3	2011-06-20	2005-12-22		ENSG00000105880	ENSG00000105880		"""Homeoboxes / ANTP class : NKL subclass"""	2918	protein-coding gene	gene with protein product		600028	"""distal-less homeo box 5"""			7907794	Standard	XM_005250185		Approved		uc003uon.3	P56178	OTTHUMG00000154200	ENST00000222598.4:c.355+1G>A	7.37:g.96653581C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z4P3|Q9UPL1	Missense_Mutation	SNP	pfam_Distal-less_N,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif,prints_Homeobox_metazoa	p.E119K	ENST00000222598.4	37	c.355	CCDS5647.1	7	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362365	0.82353	.	.	ENSG00000105880	ENST00000222598	D	0.89050	-2.46	5.29	4.41	0.53225	.	0.050175	0.85682	D	0.000000	D	0.87783	0.6264	L	0.61218	1.895	0.80722	D	1	P;P	0.46395	0.877;0.871	B;B	0.43194	0.411;0.341	D	0.87023	0.2130	9	.	.	.	-4.9325	14.234	0.65913	0.0:0.9285:0.0:0.0715	.	119;119	B7Z4P3;P56178	.;DLX5_HUMAN	K	119	ENSP00000222598:E119K	.	E	-	1	0	DLX5	96491517	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	4.102000	0.57776	1.467000	0.48044	0.561000	0.74099	GAG	DLX5	-	NULL	ENSG00000105880		0.627	DLX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLX5	HGNC	protein_coding	OTTHUMT00000334371.2	83	0.00	0	C		Missense_Mutation	96653581	96653581	-1	no_errors	ENST00000222598	ensembl	human	known	69_37n	missense	86	16.50	17	SNP	1.000	T
DMD	1756	genome.wustl.edu	37	X	32360361	32360361	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:32360361C>T	ENST00000357033.4	-	41	5984	c.5778G>A	c.(5776-5778)ctG>ctA	p.L1926L	DMD_ENST00000378677.2_Silent_p.L1922L	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1926					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				GCACTGCATTCAGCTCCTCTT	0.527																																						dbGAP											0													101.0	72.0	82.0					X																	32360361		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.5778G>A	X.37:g.32360361C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Silent	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.L1926	ENST00000357033.4	37	c.5778	CCDS14233.1	X																																																																																			DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin	ENSG00000198947		0.527	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	56	0.00	0	C	NM_004006		32360361	32360361	-1	no_errors	ENST00000357033	ensembl	human	known	69_37n	silent	74	11.90	10	SNP	1.000	T
DMRT2	10655	genome.wustl.edu	37	9	1057202	1057202	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:1057202G>A	ENST00000358146.2	+	3	1615	c.1615G>A	c.(1615-1617)Gaa>Aaa	p.E539K	DMRT2_ENST00000259622.6_3'UTR|DMRT2_ENST00000382251.3_Missense_Mutation_p.E539K|DMRT2_ENST00000302441.6_Missense_Mutation_p.E539K|DMRT2_ENST00000382255.3_3'UTR			Q9Y5R5	DMRT2_HUMAN	doublesex and mab-3 related transcription factor 2	539					embryonic skeletal system development (GO:0048706)|positive regulation of myotome development (GO:2000287)|regulation of somitogenesis (GO:0014807)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(1)|prostate(2)	4		all_lung(10;1.49e-09)|Lung NSC(10;1.86e-09)		Lung(218;0.0195)|GBM - Glioblastoma multiforme(50;0.0388)		CTCGGTGAATGAACCACTGTC	0.393																																						dbGAP											0													81.0	82.0	82.0					9																	1057202		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF130729	CCDS6444.1, CCDS6445.1	9p24.3	2008-07-21			ENSG00000173253	ENSG00000173253			2935	protein-coding gene	gene with protein product	"""terra-like protein"""	604935				10332030	Standard	NM_181872		Approved		uc003zha.3	Q9Y5R5	OTTHUMG00000019437	ENST00000358146.2:c.1615G>A	9.37:g.1057202G>A	ENSP00000350865:p.Glu539Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ANC0|B9EGJ1|Q9NPG6|Q9NQR6	Missense_Mutation	SNP	pfam_DM_DNA-bd,superfamily_DM_DNA-bd,smart_DM_DNA-bd,pfscan_DM_DNA-bd	p.E539K	ENST00000358146.2	37	c.1615	CCDS6444.1	9	.	.	.	.	.	.	.	.	.	.	G	25.7	4.669401	0.88348	.	.	ENSG00000173253	ENST00000382251;ENST00000302441;ENST00000358146	T;T;T	0.38560	1.13;1.13;1.13	6.06	6.06	0.98353	.	0.050644	0.85682	D	0.000000	T	0.65428	0.2690	M	0.62723	1.935	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.996;0.997	T	0.64584	-0.6373	10	0.87932	D	0	-21.4439	20.2501	0.98402	0.0:0.0:1.0:0.0	.	539;383	Q9Y5R5;Q5HYK2	DMRT2_HUMAN;.	K	539	ENSP00000371686:E539K;ENSP00000305785:E539K;ENSP00000350865:E539K	ENSP00000305785:E539K	E	+	1	0	DMRT2	1047202	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.198000	0.94994	2.880000	0.98712	0.650000	0.86243	GAA	DMRT2	-	NULL	ENSG00000173253		0.393	DMRT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMRT2	HGNC	protein_coding	OTTHUMT00000051492.1	21	0.00	0	G	NM_006557		1057202	1057202	+1	no_errors	ENST00000302441	ensembl	human	known	69_37n	missense	32	17.95	7	SNP	1.000	A
DNA2	1763	genome.wustl.edu	37	10	70179590	70179590	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:70179590G>C	ENST00000358410.3	-	18	2807	c.2757C>G	c.(2755-2757)ctC>ctG	p.L919L	DNA2_ENST00000399179.2_Silent_p.L681L|DNA2_ENST00000399180.2_Silent_p.L1005L	NM_001080449.2	NP_001073918.2	P51530	DNA2_HUMAN	DNA replication helicase/nuclease 2	919	Helicase activity. {ECO:0000250}.				ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA double-strand break processing (GO:0000729)|DNA duplex unwinding (GO:0032508)|DNA replication (GO:0006260)|DNA replication checkpoint (GO:0000076)|DNA replication, Okazaki fragment processing (GO:0033567)|DNA replication, removal of RNA primer (GO:0043137)|DNA strand elongation involved in DNA replication (GO:0006271)|mitochondrial DNA repair (GO:0043504)|mitochondrial DNA replication (GO:0006264)|mitotic cell cycle (GO:0000278)|positive regulation of DNA replication (GO:0045740)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)	mitochondrial nucleoid (GO:0042645)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|5'-3' DNA helicase activity (GO:0043139)|5'-flap endonuclease activity (GO:0017108)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|nuclease activity (GO:0004518)|single-stranded DNA-dependent ATPase activity (GO:0043142)|site-specific endodeoxyribonuclease activity, specific for altered base (GO:0016890)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(7)|prostate(1)	20						GGAAAACTATGAGTTTGGCTT	0.353																																						dbGAP											0													125.0	125.0	125.0					10																	70179590		1812	4075	5887	-	-	-	SO:0001819	synonymous_variant	0			D42046	CCDS44415.1, CCDS44415.2	10q21.3-q22.1	2013-05-13	2013-05-13	2008-01-08	ENSG00000138346	ENSG00000138346			2939	protein-coding gene	gene with protein product		601810	"""DNA2 DNA replication helicase 2-like (yeast)"", ""DNA replication helicase 2 homolog (yeast)"""	DNA2L		8938459, 17032657, 23352259	Standard	NM_001080449		Approved	KIAA0083	uc031pvh.1	P51530	OTTHUMG00000018352	ENST00000358410.3:c.2757C>G	10.37:g.70179590G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q2NKM1|Q5TC49|Q5TC50|Q6P455|Q6PI80|Q7Z6H9|Q8N346	Missense_Mutation	SNP	NULL	p.H241D	ENST00000358410.3	37	c.721		10	.	.	.	.	.	.	.	.	.	.	G	1.113	-0.657726	0.03454	.	.	ENSG00000138346	ENST00000440722	.	.	.	5.92	2.93	0.34026	.	.	.	.	.	T	0.44582	0.1300	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	T	0.32025	-0.9922	4	.	.	.	.	2.5284	0.04696	0.1388:0.1154:0.3675:0.3782	.	.	.	.	D	241	.	.	H	-	1	0	DNA2	69849596	0.780000	0.28664	0.915000	0.36163	0.215000	0.24574	0.122000	0.15687	0.807000	0.34208	0.585000	0.79938	CAT	DNA2	-	NULL	ENSG00000138346		0.353	DNA2-001	KNOWN	basic|appris_principal	protein_coding	DNA2	HGNC	protein_coding	OTTHUMT00000048334.2	69	0.00	0	G			70179590	70179590	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000440722	ensembl	human	putative	69_37n	missense	53	14.52	9	SNP	0.799	C
DNAJB4	11080	genome.wustl.edu	37	1	78478888	78478888	+	Missense_Mutation	SNP	C	C	G	rs267598730		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:78478888C>G	ENST00000370763.5	+	2	622	c.365C>G	c.(364-366)tCt>tGt	p.S122C	DNAJB4_ENST00000487931.1_3'UTR|GIPC2_ENST00000476882.1_Intron	NM_007034.3	NP_008965.2	Q9UDY4	DNJB4_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 4	122					protein folding (GO:0006457)|response to heat (GO:0009408)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chaperone binding (GO:0051087)|unfolded protein binding (GO:0051082)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	10						GGTAGAGATTCTGAAGAAATG	0.448																																						dbGAP											0													161.0	162.0	162.0					1																	78478888		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40992	CCDS684.1	1p31.1	2011-09-02			ENSG00000162616	ENSG00000162616		"""Heat shock proteins / DNAJ (HSP40)"""	14886	protein-coding gene	gene with protein product		611327				9546042, 11147971	Standard	NM_007034		Approved	HLJ1	uc001dij.3	Q9UDY4	OTTHUMG00000040905	ENST00000370763.5:c.365C>G	1.37:g.78478888C>G	ENSP00000359799:p.Ser122Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R824|Q13431	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.S122C	ENST00000370763.5	37	c.365	CCDS684.1	1	.	.	.	.	.	.	.	.	.	.	C	12.34	1.907390	0.33628	.	.	ENSG00000162616	ENST00000426517;ENST00000370763	T;T	0.65549	-0.16;0.25	5.13	0.558	0.17266	.	0.875207	0.10293	N	0.692099	T	0.35451	0.0932	L	0.29908	0.895	0.09310	N	0.999998	P	0.36599	0.56	B	0.42087	0.375	T	0.32534	-0.9903	10	0.54805	T	0.06	.	10.1062	0.42535	0.5138:0.3609:0.1253:0.0	.	122	Q9UDY4	DNJB4_HUMAN	C	122	ENSP00000399494:S122C;ENSP00000359799:S122C	ENSP00000359799:S122C	S	+	2	0	DNAJB4	78251476	0.896000	0.30565	0.395000	0.26283	0.972000	0.66771	1.821000	0.39041	0.120000	0.18254	-0.334000	0.08254	TCT	DNAJB4	-	NULL	ENSG00000162616		0.448	DNAJB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB4	HGNC	protein_coding	OTTHUMT00000098248.3	60	0.00	0	C			78478888	78478888	+1	no_errors	ENST00000370763	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	0.110	G
DNM2	1785	genome.wustl.edu	37	19	10887807	10887807	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:10887807C>T	ENST00000355667.6	+	5	683	c.603C>T	c.(601-603)atC>atT	p.I201I	DNM2_ENST00000314646.5_Silent_p.I201I|DNM2_ENST00000359692.6_Silent_p.I201I|DNM2_ENST00000389253.4_Silent_p.I201I|DNM2_ENST00000408974.4_Silent_p.I201I|DNM2_ENST00000585892.1_Silent_p.I201I|DNM2_ENST00000591819.1_3'UTR	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	201	Dynamin-type G.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			TACGGACCATCGGTGTCATCA	0.602			"""F, N, Splice, Mis, O"""		ETP ALL																																	dbGAP		Rec	yes		19	19p13.2	1785	dynamin 2		L	0													98.0	85.0	89.0					19																	10887807		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.603C>T	19.37:g.10887807C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.I201	ENST00000355667.6	37	c.603	CCDS45968.1	19																																																																																			DNM2	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin	ENSG00000079805		0.602	DNM2-001	KNOWN	basic|CCDS	protein_coding	DNM2	HGNC	protein_coding	OTTHUMT00000452592.1	53	0.00	0	C	NM_004945		10887807	10887807	+1	no_errors	ENST00000314646	ensembl	human	known	69_37n	silent	69	15.85	13	SNP	0.727	T
DUOX2	50506	genome.wustl.edu	37	15	45386382	45386382	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:45386382C>T	ENST00000603300.1	-	34	4815	c.4613G>A	c.(4612-4614)cGa>cAa	p.R1538Q	DUOX2_ENST00000389039.6_Missense_Mutation_p.R1538Q	NM_014080.4	NP_054799.4	Q9NRD8	DUOX2_HUMAN	dual oxidase 2	1538					adenohypophysis morphogenesis (GO:0048855)|bone mineralization (GO:0030282)|cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|fertilization (GO:0009566)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide catabolic process (GO:0042744)|inner ear development (GO:0048839)|multicellular organism growth (GO:0035264)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|response to virus (GO:0009615)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|peroxidase activity (GO:0004601)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(9)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(7)|urinary_tract(1)	63		all_cancers(109;3.79e-11)|all_epithelial(112;2.92e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.05e-18)|GBM - Glioblastoma multiforme(94;4.23e-07)|COAD - Colon adenocarcinoma(120;0.0668)|Colorectal(133;0.068)		GAAGTGGGCTCGGTCCTGCCT	0.567																																						dbGAP											0													146.0	125.0	132.0					15																	45386382		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF181972	CCDS10117.1	15q15.3-q21	2013-01-10			ENSG00000140279	ENSG00000140279		"""EF-hand domain containing"""	13273	protein-coding gene	gene with protein product	"""dual oxidase-like domains 2"", ""nicotinamide adenine dinucleotide phosphate oxidase"", ""flavoprotein NADPH oxidase"", ""NADPH thyroid oxidase 2"", ""NADH/NADPH thyroid oxidase p138-tox"", ""NADPH oxidase/peroxidase DUOX2"""	606759				10601291, 10806195	Standard	NM_014080		Approved	P138-TOX, P138(TOX), THOX2, LNOX2	uc010bea.3	Q9NRD8	OTTHUMG00000131355	ENST00000603300.1:c.4613G>A	15.37:g.45386382C>T	ENSP00000475084:p.Arg1538Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MQ13|D2XI64|Q9NR02|Q9UHF9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.R1538Q	ENST00000603300.1	37	c.4613	CCDS10117.1	15	.	.	.	.	.	.	.	.	.	.	C	7.142	0.582026	0.13749	.	.	ENSG00000140279	ENST00000389039	.	.	.	5.36	-2.84	0.05751	.	0.237809	0.43416	N	0.000564	T	0.13072	0.0317	N	0.01624	-0.795	0.30416	N	0.77858	B	0.06786	0.001	B	0.04013	0.001	T	0.32322	-0.9911	9	0.10377	T	0.69	-6.5582	12.562	0.56286	0.0:0.1781:0.0:0.8219	.	1538	Q9NRD8	DUOX2_HUMAN	Q	1538	.	ENSP00000373691:R1538Q	R	-	2	0	DUOX2	43173674	0.904000	0.30761	0.822000	0.32727	0.659000	0.38960	0.751000	0.26348	-0.517000	0.06461	-1.106000	0.02097	CGA	DUOX2	-	NULL	ENSG00000140279		0.567	DUOX2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DUOX2	HGNC	protein_coding		73	0.00	0	C	NM_014080		45386382	45386382	-1	no_errors	ENST00000389039	ensembl	human	known	69_37n	missense	79	12.22	11	SNP	0.989	T
DUOX1	53905	genome.wustl.edu	37	15	45444113	45444113	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:45444113G>A	ENST00000321429.4	+	25	3463	c.3056G>A	c.(3055-3057)cGa>cAa	p.R1019Q	CTD-2651B20.1_ENST00000558039.1_lincRNA|DUOX1_ENST00000561166.1_Missense_Mutation_p.R665Q|DUOX1_ENST00000389037.3_Missense_Mutation_p.R1019Q	NM_017434.3	NP_059130.2	Q9NRD9	DUOX1_HUMAN	dual oxidase 1	1019	Interaction with TXNDC11. {ECO:0000250}.				cuticle development (GO:0042335)|cytokine-mediated signaling pathway (GO:0019221)|hormone biosynthetic process (GO:0042446)|hydrogen peroxide biosynthetic process (GO:0050665)|hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)|response to cAMP (GO:0051591)|superoxide anion generation (GO:0042554)|thyroid hormone generation (GO:0006590)	apical plasma membrane (GO:0016324)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)|heme binding (GO:0020037)|NAD(P)H oxidase activity (GO:0016174)|NADP binding (GO:0050661)|peroxidase activity (GO:0004601)			breast(2)|central_nervous_system(1)|endometrium(5)|kidney(5)|large_intestine(13)|lung(16)|ovary(6)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(1)	57		all_cancers(109;5.7e-11)|all_epithelial(112;4.65e-09)|Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;5.77e-18)|GBM - Glioblastoma multiforme(94;5.11e-07)|COAD - Colon adenocarcinoma(120;0.071)|Colorectal(133;0.0717)		GAGGCGCACCGAGAGAAGTTC	0.592																																						dbGAP											0													80.0	77.0	78.0					15																	45444113		2198	4298	6496	-	-	-	SO:0001583	missense	0			AF213465	CCDS32221.1	15q21	2013-01-10				ENSG00000137857		"""EF-hand domain containing"""	3062	protein-coding gene	gene with protein product	"""NADPH thyroid oxidase 1"", ""flavoprotein NADPH oxidase"", ""nicotinamide adenine dinucleotide phosphate oxidase"""	606758				10806195	Standard	XM_005254463		Approved	NOXEF1, THOX1, LNOX1	uc001zut.1	Q9NRD9		ENST00000321429.4:c.3056G>A	15.37:g.45444113G>A	ENSP00000317997:p.Arg1019Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NH28|Q14C94|Q6ZMB3|Q6ZR09|Q9NZC1	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_EF-hand,superfamily_Haem_peroxidase,superfamily_Riboflavin_synthase-like_b-brl,smart_EF_hand_Ca-bd,prints_Haem_peroxidase_animal_subgr,prints_Recoverin,pfscan_EF_HAND_2,pfscan_Haem_peroxidase_animal	p.R1019Q	ENST00000321429.4	37	c.3056	CCDS32221.1	15	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429733	0.43122	.	.	ENSG00000137857	ENST00000431588;ENST00000321429;ENST00000389037	D;D	0.86164	-2.08;-2.08	4.17	4.17	0.49024	.	0.130899	0.48286	D	0.000181	T	0.80639	0.4661	L	0.33189	0.99	0.58432	D	0.999998	D;B	0.58620	0.983;0.184	P;B	0.48089	0.566;0.021	T	0.75516	-0.3290	10	0.14252	T	0.57	-9.5769	8.0338	0.30480	0.1106:0.0:0.8894:0.0	.	152;1019	Q9NT13;Q9NRD9	.;DUOX1_HUMAN	Q	1019	ENSP00000317997:R1019Q;ENSP00000373689:R1019Q	ENSP00000317997:R1019Q	R	+	2	0	DUOX1	43231405	0.979000	0.34478	0.959000	0.39883	0.827000	0.46813	5.478000	0.66806	2.302000	0.77476	0.655000	0.94253	CGA	DUOX1	-	NULL	ENSG00000137857		0.592	DUOX1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUOX1	HGNC	protein_coding	OTTHUMT00000416251.1	48	0.00	0	G	NM_017434		45444113	45444113	+1	no_errors	ENST00000321429	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	0.952	A
DUSP27	92235	genome.wustl.edu	37	1	167097333	167097333	+	Missense_Mutation	SNP	G	G	A	rs35440343		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:167097333G>A	ENST00000361200.2	+	6	3131	c.2965G>A	c.(2965-2967)Gac>Aac	p.D989N	DUSP27_ENST00000271385.5_Missense_Mutation_p.D989N|DUSP27_ENST00000443333.1_Missense_Mutation_p.D989N|DUSP27_ENST00000485151.1_Intron			Q5VZP5	DUS27_HUMAN	dual specificity phosphatase 27 (putative)	989	Ser-rich.				protein dephosphorylation (GO:0006470)		protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(11)|liver(1)|lung(46)|ovary(5)|prostate(5)|skin(4)|upper_aerodigestive_tract(3)	89						AGAGGAACAGGACACCTCCTC	0.512																																						dbGAP											0													85.0	79.0	81.0					1																	167097333		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF119045	CCDS30932.1	1q22-q24	2008-02-05			ENSG00000198842	ENSG00000198842			25034	protein-coding gene	gene with protein product							Standard	NM_001080426		Approved		uc001geb.1	Q5VZP5	OTTHUMG00000034434	ENST00000361200.2:c.2965G>A	1.37:g.167097333G>A	ENSP00000354483:p.Asp989Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUM4|Q9C074	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.D989N	ENST00000361200.2	37	c.2965	CCDS30932.1	1	.	.	.	.	.	.	.	.	.	.	G	17.90	3.501094	0.64298	.	.	ENSG00000198842	ENST00000361200;ENST00000271385;ENST00000443333	T;T;T	0.03889	3.77;3.77;3.77	5.42	5.42	0.78866	.	0.000000	0.53938	D	0.000054	T	0.10165	0.0249	L	0.50919	1.6	0.39824	D	0.97287	D	0.76494	0.999	D	0.64144	0.922	T	0.12578	-1.0542	10	0.38643	T	0.18	-40.3169	19.2273	0.93822	0.0:0.0:1.0:0.0	.	989	Q5VZP5	DUS27_HUMAN	N	989	ENSP00000354483:D989N;ENSP00000271385:D989N;ENSP00000404874:D989N	ENSP00000271385:D989N	D	+	1	0	DUSP27	165363957	1.000000	0.71417	1.000000	0.80357	0.651000	0.38670	5.072000	0.64389	2.530000	0.85305	0.643000	0.83706	GAC	DUSP27	-	NULL	ENSG00000198842		0.512	DUSP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP27	HGNC	protein_coding	OTTHUMT00000083244.1	29	0.00	0	G	NM_001080426		167097333	167097333	+1	no_errors	ENST00000271385	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	0.998	A
DYX1C1	161582	genome.wustl.edu	37	15	55722912	55722912	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:55722912C>T	ENST00000321149.3	-	10	1586	c.1219G>A	c.(1219-1221)Gag>Aag	p.E407K	DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000457155.2_Silent_p.L371L|DYX1C1_ENST00000348518.3_Silent_p.L371L|DYX1C1_ENST00000448430.2_Intron|DYX1C1_ENST00000380679.1_Intron	NM_130810.3	NP_570722.2	Q8WXU2	DYXC1_HUMAN	dyslexia susceptibility 1 candidate 1	407					cilium movement (GO:0003341)|determination of left/right symmetry (GO:0007368)|inner dynein arm assembly (GO:0036159)|neuron migration (GO:0001764)|outer dynein arm assembly (GO:0036158)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of proteasomal protein catabolic process (GO:0061136)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	estrogen receptor binding (GO:0030331)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	18				all cancers(107;0.0118)|GBM - Glioblastoma multiforme(80;0.171)		CGAATCTTCTCAGCATCAATT	0.308																																						dbGAP											0													125.0	125.0	125.0					15																	55722912		2192	4290	6482	-	-	-	SO:0001583	missense	0				CCDS10154.1, CCDS32243.1, CCDS32244.1	15q21.3	2014-09-11			ENSG00000256061	ENSG00000256061		"""Tetratricopeptide (TTC) repeat domain containing"""	21493	protein-coding gene	gene with protein product		608706				12954984	Standard	NM_130810		Approved	EKN1, FLJ37882, CILD25	uc002adc.3	Q8WXU2	OTTHUMG00000132008	ENST00000321149.3:c.1219G>A	15.37:g.55722912C>T	ENSP00000323275:p.Glu407Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P5Y9|Q8N1S6	Missense_Mutation	SNP	pfam_TPR-1,pfam_CS_domain,superfamily_HSP20-like_chaperone,smart_TPR_repeat,pfscan_CS-like_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E407K	ENST00000321149.3	37	c.1219	CCDS10154.1	15	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300152	0.60195	.	.	ENSG00000256061	ENST00000321149	T	0.06608	3.28	5.6	4.68	0.58851	.	0.141770	0.45126	U	0.000390	T	0.06554	0.0168	.	.	.	0.80722	D	1	B	0.17268	0.021	B	0.18561	0.022	T	0.31475	-0.9942	9	0.34782	T	0.22	.	13.9424	0.64064	0.0:0.9261:0.0:0.0739	.	407	Q8WXU2	DYXC1_HUMAN	K	407	ENSP00000323275:E407K	ENSP00000323275:E407K	E	-	1	0	DYX1C1	53510204	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.893000	0.48633	2.650000	0.89964	0.558000	0.71614	GAG	DYX1C1	-	NULL	ENSG00000256061		0.308	DYX1C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYX1C1	HGNC	protein_coding	OTTHUMT00000254976.1	68	0.00	0	C	NM_130810		55722912	55722912	-1	no_errors	ENST00000321149	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	1.000	T
ECD	11319	genome.wustl.edu	37	10	74899224	74899224	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:74899224G>C	ENST00000372979.4	-	11	1470	c.1264C>G	c.(1264-1266)Cag>Gag	p.Q422E	ECD_ENST00000454759.2_Missense_Mutation_p.Q379E|ECD_ENST00000430082.2_Missense_Mutation_p.Q455E	NM_007265.2	NP_009196.1	O95905	SGT1_HUMAN	ecdysoneless homolog (Drosophila)	422					cell proliferation (GO:0008283)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|regulation of glycolytic process (GO:0006110)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|pancreas(1)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Prostate(51;0.0119)					TGGTCCAGCTGATCTGGTGAG	0.448																																						dbGAP											0													83.0	86.0	85.0					10																	74899224		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC000721	CCDS7321.1, CCDS44433.1, CCDS44434.1	10q22.3	2006-02-07				ENSG00000122882			17029	protein-coding gene	gene with protein product						9928932, 15128659	Standard	NM_007265		Approved	hSGT1, GCR2	uc001jtn.3	O95905		ENST00000372979.4:c.1264C>G	10.37:g.74899224G>C	ENSP00000362070:p.Gln422Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JX46|E9PAW8	Missense_Mutation	SNP	pfam_SGT1	p.Q455E	ENST00000372979.4	37	c.1363	CCDS7321.1	10	.	.	.	.	.	.	.	.	.	.	G	3.371	-0.128503	0.06753	.	.	ENSG00000122882	ENST00000372979;ENST00000430082;ENST00000454759	T;T;T	0.14022	2.54;2.54;2.54	5.4	4.43	0.53597	.	0.504604	0.23479	N	0.047739	T	0.06325	0.0163	N	0.04686	-0.185	0.25051	N	0.991132	B;B;B	0.19331	0.035;0.026;0.026	B;B;B	0.24974	0.057;0.023;0.013	T	0.37709	-0.9694	10	0.09843	T	0.71	0.2895	10.5295	0.44969	0.0:0.0:0.6905:0.3095	.	379;455;422	E9PAW8;C9JX46;O95905	.;.;SGT1_HUMAN	E	422;455;379	ENSP00000362070:Q422E;ENSP00000401566:Q455E;ENSP00000395786:Q379E	ENSP00000362070:Q422E	Q	-	1	0	ECD	74569230	1.000000	0.71417	1.000000	0.80357	0.917000	0.54804	2.076000	0.41548	2.519000	0.84933	0.467000	0.42956	CAG	ECD	-	pfam_SGT1	ENSG00000122882		0.448	ECD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECD	HGNC	protein_coding	OTTHUMT00000048606.1	104	0.00	0	G	NM_007265		74899224	74899224	-1	no_errors	ENST00000430082	ensembl	human	known	69_37n	missense	83	16.16	16	SNP	1.000	C
ECE2	9718	genome.wustl.edu	37	3	183976326	183976326	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:183976326C>G	ENST00000402825.3	+	2	480				EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000324557.4_Nonsense_Mutation_p.S244*	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2						brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CTTCAGGACTCAGATCATGAG	0.592																																						dbGAP											0													81.0	81.0	81.0					3																	183976326		2203	4300	6503	-	-	-	SO:0001627	intron_variant	0			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.480+782C>G	3.37:g.183976326C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Nonsense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12	p.S244*	ENST00000402825.3	37	c.731	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	C	18.15	3.560649	0.65538	.	.	ENSG00000145194	ENST00000324557	.	.	.	5.13	5.13	0.70059	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	11.0585	0.47933	0.1849:0.8151:0.0:0.0	.	.	.	.	X	244	.	ENSP00000314295:S244X	S	+	2	0	ECE2	185459020	0.973000	0.33851	0.999000	0.59377	0.945000	0.59286	2.060000	0.41394	2.663000	0.90544	0.655000	0.94253	TCA	ECE2	-	NULL	ENSG00000145194		0.592	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	36	0.00	0	C	NM_014693		183976326	183976326	+1	no_errors	ENST00000324557	ensembl	human	known	69_37n	nonsense	44	21.43	12	SNP	0.984	G
ECI2	10455	genome.wustl.edu	37	6	4116138	4116138	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:4116138C>T	ENST00000380118.3	-	10	1191	c.1155G>A	c.(1153-1155)gtG>gtA	p.V385V	ECI2_ENST00000413766.2_Silent_p.V218V|ECI2_ENST00000361538.2_Silent_p.V355V|C6orf201_ENST00000333388.5_Intron|ECI2_ENST00000380125.2_Silent_p.V355V|C6orf201_ENST00000380175.4_Intron|C6orf201_ENST00000430835.2_Intron|ECI2_ENST00000465828.1_Silent_p.V355V			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	385					fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						ATAAGAAGTTCACCACAGCAT	0.418																																						dbGAP											0													285.0	228.0	247.0					6																	4116138		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.1155G>A	6.37:g.4116138C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Silent	SNP	pfam_Acyl-CoA-binding_protein,pfam_Crotonase_core,superfamily_Acyl-CoA-binding_protein,prints_Acyl-CoA-binding_protein	p.V385	ENST00000380118.3	37	c.1155	CCDS43420.2	6																																																																																			ECI2	-	NULL	ENSG00000198721		0.418	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ECI2	HGNC	protein_coding	OTTHUMT00000039716.4	47	0.00	0	C	NM_006117		4116138	4116138	-1	no_errors	ENST00000380118	ensembl	human	known	69_37n	silent	61	12.86	9	SNP	0.178	T
EPHA1	2041	genome.wustl.edu	37	7	143096459	143096459	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:143096459G>C	ENST00000275815.3	-	5	969	c.883C>G	c.(883-885)Ctc>Gtc	p.L295V		NM_005232.4	NP_005223.4	P21709	EPHA1_HUMAN	EPH receptor A1	295	Cys-rich.				activation of Rho GTPase activity (GO:0032862)|angiogenesis (GO:0001525)|cell surface receptor signaling pathway (GO:0007166)|negative regulation of cell migration (GO:0030336)|negative regulation of protein kinase activity (GO:0006469)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of stress fiber assembly (GO:0051496)|protein autophosphorylation (GO:0046777)|regulation of Rac GTPase activity (GO:0032314)|substrate adhesion-dependent cell spreading (GO:0034446)	integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(21)|ovary(4)|skin(1)|stomach(1)|urinary_tract(3)	51	Melanoma(164;0.205)	Myeloproliferative disorder(862;0.0255)				GGGCACGTGAGACAATGGGGT	0.607																																						dbGAP											0													43.0	40.0	41.0					7																	143096459		2203	4300	6503	-	-	-	SO:0001583	missense	0			M18391	CCDS5884.1	7q32-q36	2013-02-11	2004-10-28		ENSG00000146904	ENSG00000146904	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3385	protein-coding gene	gene with protein product		179610	"""EphA1"""	EPHT, EPHT1		9267020	Standard	NM_005232		Approved	EPH	uc003wcz.3	P21709	OTTHUMG00000155894	ENST00000275815.3:c.883C>G	7.37:g.143096459G>C	ENSP00000275815:p.Leu295Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3V3|B5A966|B5A967|Q15405	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_Galactose-bd-like,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.L295V	ENST00000275815.3	37	c.883	CCDS5884.1	7	.	.	.	.	.	.	.	.	.	.	G	9.355	1.066541	0.20067	.	.	ENSG00000146904	ENST00000275815	D	0.97404	-4.37	5.21	2.27	0.28462	Growth factor, receptor (1);	0.384546	0.22308	N	0.061762	D	0.94387	0.8195	L	0.53249	1.67	0.28051	N	0.933376	B	0.02656	0.0	B	0.01281	0.0	D	0.87649	0.2527	10	0.38643	T	0.18	.	10.5669	0.45177	0.0:0.3313:0.5337:0.135	.	295	P21709	EPHA1_HUMAN	V	295	ENSP00000275815:L295V	ENSP00000275815:L295V	L	-	1	0	EPHA1	142806581	0.729000	0.28090	0.909000	0.35828	0.721000	0.41392	0.504000	0.22626	0.271000	0.22005	0.650000	0.86243	CTC	EPHA1	-	pirsf_Tyr_kinase_ephrin_rcpt,superfamily_Growth_fac_rcpt	ENSG00000146904		0.607	EPHA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA1	HGNC	protein_coding	OTTHUMT00000342154.1	41	0.00	0	G			143096459	143096459	-1	no_errors	ENST00000275815	ensembl	human	known	69_37n	missense	51	12.07	7	SNP	0.995	C
EN2	2020	genome.wustl.edu	37	7	155255355	155255355	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:155255355C>T	ENST00000297375.4	+	2	1224	c.975C>T	c.(973-975)gcC>gcT	p.A325A		NM_001427.3	NP_001418.2	P19622	HME2_HUMAN	engrailed homeobox 2	325					hindbrain development (GO:0030902)|midbrain development (GO:0030901)|multicellular organismal development (GO:0007275)|neuron development (GO:0048666)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	membrane (GO:0016020)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)|large_intestine(1)|lung(2)	4	all_neural(206;0.119)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CCACCACAGCCAAGGAGGGCA	0.567																																						dbGAP											0													35.0	31.0	32.0					7																	155255355		2200	4300	6500	-	-	-	SO:0001819	synonymous_variant	0				CCDS5940.1	7q36.2	2011-06-20	2007-02-15		ENSG00000164778	ENSG00000164778		"""Homeoboxes / ANTP class : NKL subclass"""	3343	protein-coding gene	gene with protein product		131310					Standard	NM_001427		Approved		uc003wmb.3	P19622	OTTHUMG00000151354	ENST00000297375.4:c.975C>T	7.37:g.155255355C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D252|Q549U3|Q9UD58	Silent	SNP	pfam_Homeodomain,pfam_Homeobox-engrailed_C-terminal,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeodomain_engrailed,prints_Homeobox_metazoa	p.A325	ENST00000297375.4	37	c.975	CCDS5940.1	7																																																																																			EN2	-	pfam_Homeobox-engrailed_C-terminal	ENSG00000164778		0.567	EN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EN2	HGNC	protein_coding	OTTHUMT00000322337.1	53	0.00	0	C	NM_001427		155255355	155255355	+1	no_errors	ENST00000297375	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.998	T
ERCC6L	54821	genome.wustl.edu	37	X	71428226	71428226	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:71428226G>A	ENST00000334463.3	-	2	526	c.391C>T	c.(391-393)Caa>Taa	p.Q131*	PIN4_ENST00000423432.2_Intron|ERCC6L_ENST00000373657.1_Nonsense_Mutation_p.Q8*	NM_017669.2	NP_060139.2	Q2NKX8	ERC6L_HUMAN	excision repair cross-complementation group 6-like	131	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)			breast(2)|cervix(1)|endometrium(9)|kidney(4)|large_intestine(9)|lung(9)|ovary(3)|skin(1)	38	Renal(35;0.156)					GCAATGATTTGAACAGTCTTC	0.408																																						dbGAP											0													170.0	158.0	162.0					X																	71428226		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AK000112	CCDS35329.1	Xq13.1	2014-03-07	2014-03-07		ENSG00000186871	ENSG00000186871			20794	protein-coding gene	gene with protein product	"""PLK1-interacting checkpoint helicase"""	300687	"""excision repair cross-complementing rodent repair deficiency, complementation group 6-like"""			17218258	Standard	NM_017669		Approved	FLJ20105, PICH, RAD26L	uc004eaq.1	Q2NKX8	OTTHUMG00000021810	ENST00000334463.3:c.391C>T	X.37:g.71428226G>A	ENSP00000334675:p.Gln131*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NCI1|Q96H93|Q9NXQ8	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_TPR-contain_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.Q131*	ENST00000334463.3	37	c.391	CCDS35329.1	X	.	.	.	.	.	.	.	.	.	.	G	39	7.894890	0.98548	.	.	ENSG00000186871	ENST00000373657;ENST00000334463	.	.	.	5.0	5.0	0.66597	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-9.2912	14.7484	0.69505	0.0:0.0:1.0:0.0	.	.	.	.	X	8;131	.	ENSP00000334675:Q131X	Q	-	1	0	ERCC6L	71344951	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.702000	0.98712	2.063000	0.61619	0.594000	0.82650	CAA	ERCC6L	-	pfam_SNF2_N,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd	ENSG00000186871		0.408	ERCC6L-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6L	HGNC	protein_coding	OTTHUMT00000057174.2	62	0.00	0	G	NM_017669		71428226	71428226	-1	no_errors	ENST00000334463	ensembl	human	known	69_37n	nonsense	61	12.86	9	SNP	1.000	A
ESPN	83715	genome.wustl.edu	37	1	6505739	6505739	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:6505739G>C	ENST00000377828.1	+	7	1376	c.1208G>C	c.(1207-1209)aGa>aCa	p.R403T	RP1-202O8.2_ENST00000419034.1_RNA|ESPN_ENST00000461727.1_5'Flank	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	403					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		TCCAGCGCTAGAGCTGCAGAC	0.622																																						dbGAP											0													26.0	26.0	26.0					1																	6505739		2202	4300	6502	-	-	-	SO:0001583	missense	0			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1208G>C	1.37:g.6505739G>C	ENSP00000367059:p.Arg403Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_WH2_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_WH2_dom	p.R403T	ENST00000377828.1	37	c.1208	CCDS70.1	1	.	.	.	.	.	.	.	.	.	.	G	8.147	0.786435	0.16189	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	D;D	0.85955	-2.05;-2.05	5.2	3.27	0.37495	.	0.276446	0.30085	N	0.010441	T	0.65471	0.2694	N	0.11560	0.145	0.19945	N	0.999943	B	0.09022	0.002	B	0.04013	0.001	T	0.48714	-0.9011	10	0.26408	T	0.33	-4.8797	2.985	0.05965	0.1029:0.2231:0.52:0.1539	.	403	B1AK53	ESPN_HUMAN	T	403;188	ENSP00000367059:R403T;ENSP00000401793:R188T	ENSP00000367059:R403T	R	+	2	0	ESPN	6428326	0.045000	0.20229	0.352000	0.25734	0.474000	0.32979	1.589000	0.36644	1.201000	0.43203	0.491000	0.48974	AGA	ESPN	-	NULL	ENSG00000187017		0.622	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	HGNC	protein_coding	OTTHUMT00000001887.3	57	0.00	0	G	NM_031475		6505739	6505739	+1	no_errors	ENST00000377828	ensembl	human	known	69_37n	missense	73	16.09	14	SNP	0.001	C
EXO1	9156	genome.wustl.edu	37	1	242048771	242048771	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:242048771C>G	ENST00000366548.3	+	15	2960	c.2367C>G	c.(2365-2367)atC>atG	p.I789M	EXO1_ENST00000518483.1_Missense_Mutation_p.I789M|EXO1_ENST00000348581.5_Missense_Mutation_p.I789M	NM_130398.3	NP_569082.2	Q9UQ84	EXO1_HUMAN	exonuclease 1	789	Interaction with MLH1.|Interaction with MSH2.				DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|isotype switching (GO:0045190)|meiotic nuclear division (GO:0007126)|mismatch repair (GO:0006298)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	5'-3' exodeoxyribonuclease activity (GO:0035312)|5'-3' exonuclease activity (GO:0008409)|DNA binding (GO:0003677)|double-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0051908)|exonuclease activity (GO:0004527)|flap endonuclease activity (GO:0048256)|metal ion binding (GO:0046872)|RNA-DNA hybrid ribonuclease activity (GO:0004523)|single-stranded DNA 5'-3' exodeoxyribonuclease activity (GO:0045145)|structure-specific DNA binding (GO:0043566)	p.I789M(1)		NS(1)|central_nervous_system(2)|endometrium(3)|large_intestine(3)|lung(29)|ovary(2)|skin(1)|stomach(2)|urinary_tract(2)	45	Ovarian(103;0.103)	all_cancers(173;0.0555)	OV - Ovarian serous cystadenocarcinoma(106;0.0107)			GGTTACAGATCAAACTCAATG	0.428								Editing and processing nucleases																														dbGAP											1	Substitution - Missense(1)	urinary_tract(1)											84.0	92.0	90.0					1																	242048771		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF042282	CCDS1620.1, CCDS44336.1	1q42-q43	2008-07-18			ENSG00000174371	ENSG00000174371			3511	protein-coding gene	gene with protein product	"""rad2 nuclease family member, homolog of S. cerevisiae exonuclease 1"""	606063				9685493, 9788596	Standard	NM_003686		Approved	HEX1, hExoI	uc001hzh.3	Q9UQ84	OTTHUMG00000039965	ENST00000366548.3:c.2367C>G	1.37:g.242048771C>G	ENSP00000355506:p.Ile789Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O60545|O75214|O75466|Q5T396|Q96IJ1|Q9UG38|Q9UNW0	Missense_Mutation	SNP	pfam_XPG/RAD2_endonuclease,pfam_XPG_DNA_repair_N,superfamily_5-3_exonuclease_C,smart_XPG_DNA_repair_N,smart_XPG/RAD2_endonuclease,smart_HhH2,prints_XPGC_Rad_DNA_repair	p.I789M	ENST00000366548.3	37	c.2367	CCDS1620.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.59|14.59	2.580396|2.580396	0.46006|0.46006	.|.	.|.	ENSG00000174371|ENSG00000174371	ENST00000366548;ENST00000348581;ENST00000518483|ENST00000521202	T;T;T|.	0.65916|.	-0.18;-0.18;-0.18|.	5.86|5.86	-5.79|-5.79	0.02354|0.02354	.|.	0.336729|.	0.29660|.	N|.	0.011540|.	T|T	0.45994|0.45994	0.1370|0.1370	L|L	0.57536|0.57536	1.79|1.79	0.22034|0.22034	N|N	0.999407|0.999407	P;P;P|.	0.49783|.	0.883;0.928;0.883|.	B;P;B|.	0.48189|.	0.438;0.57;0.438|.	T|T	0.54022|0.54022	-0.8355|-0.8355	10|5	0.51188|.	T|.	0.08|.	-18.0023|-18.0023	10.6079|10.6079	0.45404|0.45404	0.3583:0.5143:0.1273:0.0|0.3583:0.5143:0.1273:0.0	.|.	788;789;789|.	A8K5H6;Q9UQ84-4;Q9UQ84|.	.;.;EXO1_HUMAN|.	M|E	789|154	ENSP00000355506:I789M;ENSP00000311873:I789M;ENSP00000430251:I789M|.	ENSP00000311873:I789M|.	I|Q	+|+	3|1	3|0	EXO1|EXO1	240115394|240115394	0.563000|0.563000	0.26594|0.26594	0.982000|0.982000	0.44146|0.44146	0.601000|0.601000	0.36947|0.36947	-0.280000|-0.280000	0.08468|0.08468	-0.427000|-0.427000	0.07350|0.07350	-0.402000|-0.402000	0.06365|0.06365	ATC|CAA	EXO1	-	NULL	ENSG00000174371		0.428	EXO1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EXO1	HGNC	protein_coding	OTTHUMT00000096405.1	29	0.00	0	C	NM_006027		242048771	242048771	+1	no_errors	ENST00000348581	ensembl	human	known	69_37n	missense	43	14.00	7	SNP	0.855	G
F8	2157	genome.wustl.edu	37	X	154159467	154159467	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:154159467C>T	ENST00000360256.4	-	14	2798	c.2598G>A	c.(2596-2598)atG>atA	p.M866I		NM_000132.3	NP_000123.1	P00451	FA8_HUMAN	coagulation factor VIII, procoagulant component	866	B.				acute-phase response (GO:0006953)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	copper ion binding (GO:0005507)|oxidoreductase activity (GO:0016491)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(27)|liver(1)|lung(47)|ovary(5)|pancreas(3)|prostate(1)|skin(5)|upper_aerodigestive_tract(5)|urinary_tract(2)	120	all_cancers(53;7.19e-17)|all_epithelial(53;9.83e-11)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)				Coagulation Factor IX(DB00100)|Drotrecogin alfa(DB00055)	GGGTAAATACCATGTCCCCAC	0.428																																						dbGAP											0													80.0	70.0	74.0					X																	154159467		2203	4298	6501	-	-	-	SO:0001583	missense	0			M90707	CCDS35457.1, CCDS44026.1	Xq28	2014-09-17	2008-07-29		ENSG00000185010	ENSG00000185010			3546	protein-coding gene	gene with protein product	"""Factor VIIIF8B"", ""hemophilia A"""	300841		F8C		6438528, 3935400	Standard	NM_000132		Approved	FVIII, DXS1253E, HEMA	uc004fmt.3	P00451	OTTHUMG00000022688	ENST00000360256.4:c.2598G>A	X.37:g.154159467C>T	ENSP00000353393:p.Met866Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14286|Q5HY69	Missense_Mutation	SNP	pfam_Coagulation_fac_5/8-C_type_dom,pfam_Cu-oxidase_3,pfam_Cu-oxidase_2,superfamily_Galactose-bd-like,superfamily_Cupredoxin,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.M866I	ENST00000360256.4	37	c.2598	CCDS35457.1	X	.	.	.	.	.	.	.	.	.	.	C	3.057	-0.194153	0.06259	.	.	ENSG00000185010	ENST00000360256	D	0.98996	-5.31	4.81	1.83	0.25207	.	0.964568	0.08592	N	0.922837	D	0.94208	0.8141	N	0.03324	-0.35	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	D	0.90511	0.4481	10	0.38643	T	0.18	-0.382	4.8116	0.13345	0.0:0.4103:0.0:0.5897	.	866	P00451	FA8_HUMAN	I	866	ENSP00000353393:M866I	ENSP00000353393:M866I	M	-	3	0	F8	153812661	0.060000	0.20803	0.190000	0.23270	0.644000	0.38419	0.310000	0.19356	0.562000	0.29204	-0.268000	0.10319	ATG	F8	-	NULL	ENSG00000185010		0.428	F8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	F8	HGNC	protein_coding	OTTHUMT00000058869.4	30	0.00	0	C			154159467	154159467	-1	no_errors	ENST00000360256	ensembl	human	known	69_37n	missense	46	12.96	7	SNP	0.024	T
FAM129A	116496	genome.wustl.edu	37	1	184863324	184863324	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:184863324C>G	ENST00000367511.3	-	3	396	c.203G>C	c.(202-204)gGa>gCa	p.G68A		NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	68					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						CAAAATAGTTCCAGGCGCCAA	0.363																																						dbGAP											0													127.0	118.0	121.0					1																	184863324		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.203G>C	1.37:g.184863324C>G	ENSP00000356481:p.Gly68Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Missense_Mutation	SNP	NULL	p.G68A	ENST00000367511.3	37	c.203	CCDS1364.1	1	.	.	.	.	.	.	.	.	.	.	C	13.55	2.271716	0.40194	.	.	ENSG00000135842	ENST00000367511	T	0.09723	2.95	5.21	4.23	0.50019	.	0.330933	0.31051	N	0.008343	T	0.08980	0.0222	L	0.45581	1.43	0.26664	N	0.971853	P	0.48294	0.908	B	0.40677	0.337	T	0.16958	-1.0385	10	0.09338	T	0.73	-22.6796	10.5275	0.44957	0.0:0.8989:0.0:0.1011	.	68	Q9BZQ8	NIBAN_HUMAN	A	68	ENSP00000356481:G68A	ENSP00000356481:G68A	G	-	2	0	FAM129A	183129947	0.996000	0.38824	0.995000	0.50966	0.924000	0.55760	1.526000	0.35964	2.707000	0.92482	0.557000	0.71058	GGA	FAM129A	-	NULL	ENSG00000135842		0.363	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129A	HGNC	protein_coding	OTTHUMT00000085786.1	27	0.00	0	C			184863324	184863324	-1	no_errors	ENST00000367511	ensembl	human	known	69_37n	missense	40	11.11	5	SNP	0.597	G
FAM153C	653316	genome.wustl.edu	37	5	177434006	177434006	+	5'UTR	SNP	G	G	T	rs113892656		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:177434006G>T	ENST00000507848.1	+	0	34				FAM153C_ENST00000398106.2_5'Flank			Q494X1	F153C_HUMAN	family with sequence similarity 153, member C											kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	4	all_cancers(89;0.00176)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CGCCAGTGTCGCTGCTGAAGG	0.647																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			BC101338		5q35.3	2008-01-09				ENSG00000204677			33936	protein-coding gene	gene with protein product							Standard	NR_038353		Approved	NY-REN-7-like	uc011dge.2	Q494X1		ENST00000507848.1:c.-168G>T	5.37:g.177434006G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A4IF33|B2RUV5|B7ZW12	RNA	SNP	-	NULL	ENST00000507848.1	37	NULL		5																																																																																			FAM153C	-	-	ENSG00000204677		0.647	FAM153C-002	KNOWN	basic|appris_candidate	protein_coding	FAM153C	HGNC	protein_coding	OTTHUMT00000373556.1	13	0.00	0	G	NM_001079527		177434006	177434006	+1	no_errors	ENST00000508839	ensembl	human	known	69_37n	rna	4	63.64	7	SNP	0.055	T
FAM189A1	23359	genome.wustl.edu	37	15	29488713	29488713	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:29488713G>A	ENST00000261275.4	-	4	442	c.443C>T	c.(442-444)tCc>tTc	p.S148F		NM_015307.1	NP_056122.1	O60320	F1891_HUMAN	family with sequence similarity 189, member A1	148						integral component of membrane (GO:0016021)				central_nervous_system(2)|endometrium(2)|kidney(1)|lung(1)|stomach(1)	7						GCTGCAGCCGGACGACTGGTG	0.582																																						dbGAP											0													100.0	86.0	90.0					15																	29488713		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS45198.1	15q12	2014-02-12				ENSG00000104059			29075	protein-coding gene	gene with protein product	"""transmembrane protein 228"""					9628581	Standard	NM_015307		Approved	KIAA0574, TMEM228	uc010azk.1	O60320		ENST00000261275.4:c.443C>T	15.37:g.29488713G>A	ENSP00000261275:p.Ser148Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A0PK09	Missense_Mutation	SNP	pfam_CD20-like	p.S148F	ENST00000261275.4	37	c.443	CCDS45198.1	15	.	.	.	.	.	.	.	.	.	.	G	19.70	3.876373	0.72180	.	.	ENSG00000104059	ENST00000261275	T	0.02656	4.21	5.55	5.55	0.83447	.	0.120182	0.64402	D	0.000019	T	0.08802	0.0218	L	0.29908	0.895	0.18873	N	0.999981	D	0.71674	0.998	D	0.66979	0.948	T	0.06698	-1.0812	10	0.87932	D	0	-16.3776	16.9981	0.86373	0.0:0.0:1.0:0.0	.	148	O60320	F1891_HUMAN	F	148	ENSP00000261275:S148F	ENSP00000261275:S148F	S	-	2	0	FAM189A1	27276005	0.996000	0.38824	0.007000	0.13788	0.992000	0.81027	6.671000	0.74472	2.602000	0.87976	0.655000	0.94253	TCC	FAM189A1	-	pfam_CD20-like	ENSG00000104059		0.582	FAM189A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM189A1	HGNC	protein_coding	OTTHUMT00000417254.1	41	0.00	0	G	NM_015307		29488713	29488713	-1	no_errors	ENST00000261275	ensembl	human	known	69_37n	missense	34	20.93	9	SNP	0.060	A
FAM205A	259308	genome.wustl.edu	37	9	34725691	34725691	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:34725691G>A	ENST00000378788.3	-	4	1585	c.1546C>T	c.(1546-1548)Ctg>Ttg	p.L516L		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	516						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						TACTCAGCCAGAGTCAGAAAT	0.567																																						dbGAP											0													2.0	3.0	2.0					9																	34725691		607	1393	2000	-	-	-	SO:0001819	synonymous_variant	0				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.1546C>T	9.37:g.34725691G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MVW7	Silent	SNP	NULL	p.L516	ENST00000378788.3	37	c.1546	CCDS55305.1	9																																																																																			FAM205A	-	NULL	ENSG00000205108		0.567	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2	55	0.00	0	G	NM_001141917		34725691	34725691	-1	no_errors	ENST00000378788	ensembl	human	novel	69_37n	silent	63	11.27	8	SNP	0.178	A
FAM47C	442444	genome.wustl.edu	37	X	37028317	37028317	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:37028317G>A	ENST00000358047.3	+	1	1886	c.1834G>A	c.(1834-1836)Gag>Aag	p.E612K		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	612										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						GGAGCCTCCAGAGACTCGCGT	0.647																																						dbGAP											0													23.0	26.0	25.0					X																	37028317		2188	4276	6464	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.1834G>A	X.37:g.37028317G>A	ENSP00000367913:p.Glu612Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU46	Missense_Mutation	SNP	NULL	p.E612K	ENST00000358047.3	37	c.1834	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	0.006	-2.069222	0.00382	.	.	ENSG00000198173	ENST00000358047	T	0.13307	2.6	1.64	-3.28	0.05033	.	.	.	.	.	T	0.02342	0.0072	N	0.00656	-1.285	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.12167	-1.0558	9	0.05525	T	0.97	.	1.8146	0.03098	0.2102:0.172:0.4463:0.1714	.	612	Q5HY64	FA47C_HUMAN	K	612	ENSP00000367913:E612K	ENSP00000367913:E612K	E	+	1	0	FAM47C	36938238	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.123000	0.03263	-3.619000	0.00131	-3.342000	0.00043	GAG	FAM47C	-	NULL	ENSG00000198173		0.647	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	111	0.00	0	G	NM_001013736		37028317	37028317	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	97	13.39	15	SNP	0.000	A
FAM47C	442444	genome.wustl.edu	37	X	37028695	37028695	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:37028695C>T	ENST00000358047.3	+	1	2264	c.2212C>T	c.(2212-2214)Ctc>Ttc	p.L738F		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	738								p.L738V(2)		breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGTGTCCCATCTCCGCCCAGA	0.632																																						dbGAP											2	Substitution - Missense(2)	lung(2)											48.0	47.0	47.0					X																	37028695		2202	4300	6502	-	-	-	SO:0001583	missense	0			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.2212C>T	X.37:g.37028695C>T	ENSP00000367913:p.Leu738Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZU46	Missense_Mutation	SNP	NULL	p.L738F	ENST00000358047.3	37	c.2212	CCDS35227.1	X	.	.	.	.	.	.	.	.	.	.	-	0.696	-0.792652	0.02884	.	.	ENSG00000198173	ENST00000358047	T	0.22539	1.95	0.929	0.929	0.19449	.	.	.	.	.	T	0.33933	0.0880	M	0.61703	1.905	0.09310	N	1	D	0.62365	0.991	D	0.65323	0.934	T	0.10989	-1.0606	9	0.52906	T	0.07	.	3.882	0.09082	0.0:0.6818:0.0:0.3182	.	738	Q5HY64	FA47C_HUMAN	F	738	ENSP00000367913:L738F	ENSP00000367913:L738F	L	+	1	0	FAM47C	36938616	0.001000	0.12720	0.006000	0.13384	0.006000	0.05464	-0.321000	0.08018	0.253000	0.21552	0.257000	0.18616	CTC	FAM47C	-	NULL	ENSG00000198173		0.632	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	141	0.00	0	C	NM_001013736		37028695	37028695	+1	no_errors	ENST00000358047	ensembl	human	known	69_37n	missense	142	13.41	22	SNP	0.386	T
FAM65C	140876	genome.wustl.edu	37	20	49226253	49226253	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:49226253C>T	ENST00000327979.2	-	7	832	c.421G>A	c.(421-423)Gag>Aag	p.E141K	FAM65C_ENST00000045083.2_Missense_Mutation_p.E141K|FAM65C_ENST00000535356.1_Missense_Mutation_p.E145K			Q96MK2	FA65C_HUMAN	family with sequence similarity 65, member C	141										endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|liver(1)|lung(12)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						TCGTACAGCTCATCCACCTGT	0.721																																						dbGAP											0													10.0	11.0	10.0					20																	49226253		2090	4032	6122	-	-	-	SO:0001583	missense	0			AL133230	CCDS13431.2	20q13.13	2011-11-24	2008-06-13	2008-06-13	ENSG00000042062	ENSG00000042062			16168	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 175"", ""chromosome 20 open reading frame 176"""	C20orf175, C20orf176			Standard	XM_005260294		Approved	dJ530I15.2, dJ530I15.3	uc002xvm.3	Q96MK2	OTTHUMG00000032724	ENST00000327979.2:c.421G>A	20.37:g.49226253C>T	ENSP00000332663:p.Glu141Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5QPB6|Q9NQQ2	Missense_Mutation	SNP	superfamily_ARM-type_fold,superfamily_Chemokine_IL8-like_dom	p.E145K	ENST00000327979.2	37	c.433	CCDS13431.2	20	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979961	0.92982	.	.	ENSG00000042062	ENST00000327979;ENST00000045083;ENST00000535356	T;T;T	0.02323	4.34;4.34;4.34	5.2	5.2	0.72013	.	0.000000	0.85682	D	0.000000	T	0.14960	0.0361	M	0.82716	2.605	0.80722	D	1	P;D	0.57571	0.53;0.98	B;P	0.60682	0.432;0.878	T	0.00880	-1.1529	10	0.39692	T	0.17	-30.4952	17.5027	0.87736	0.0:1.0:0.0:0.0	.	145;141	F5H0X2;Q96MK2	.;FA65C_HUMAN	K	141;141;145	ENSP00000332663:E141K;ENSP00000045083:E141K;ENSP00000439802:E145K	ENSP00000045083:E141K	E	-	1	0	FAM65C	48659660	1.000000	0.71417	0.864000	0.33941	0.500000	0.33767	7.530000	0.81962	2.410000	0.81850	0.555000	0.69702	GAG	FAM65C	-	NULL	ENSG00000042062		0.721	FAM65C-004	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM65C	HGNC	protein_coding	OTTHUMT00000257962.1	21	0.00	0	C			49226253	49226253	-1	no_errors	ENST00000535356	ensembl	human	known	69_37n	missense	21	22.22	6	SNP	1.000	T
FAM71B	153745	genome.wustl.edu	37	5	156592823	156592823	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:156592823G>A	ENST00000302938.4	-	1	452	c.357C>T	c.(355-357)ctC>ctT	p.L119L		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	119						nucleus (GO:0005634)				NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			GCAGTCTCGTGAGCTCTAGAG	0.522																																						dbGAP											0													77.0	81.0	80.0					5																	156592823		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.357C>T	5.37:g.156592823G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q1EDD9|Q8TC64|Q96LY8	Silent	SNP	pfam_DUF3699	p.L119	ENST00000302938.4	37	c.357	CCDS4335.1	5																																																																																			FAM71B	-	pfam_DUF3699	ENSG00000170613		0.522	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	54	0.00	0	G	NM_130899		156592823	156592823	-1	no_errors	ENST00000302938	ensembl	human	known	69_37n	silent	76	17.39	16	SNP	1.000	A
FDPS	2224	genome.wustl.edu	37	1	155289532	155289532	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:155289532C>G	ENST00000356657.6	+	10	1086				FDPS_ENST00000368356.4_Intron|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368352.5_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|FDPS_ENST00000447866.1_Intron	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase						cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	CACTCCTCCTCTGCCCAGGAA	0.547																																						dbGAP											0													68.0	59.0	62.0					1																	155289532		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.925-53C>G	1.37:g.155289532C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV91|E9PCI9|Q96G29	RNA	SNP	-	NULL	ENST00000356657.6	37	NULL	CCDS1110.1	1																																																																																			FDPS	-	-	ENSG00000160752		0.547	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FDPS	HGNC	protein_coding	OTTHUMT00000039053.1	95	0.00	0	C	NM_002004		155289532	155289532	+1	no_errors	ENST00000489324	ensembl	human	known	69_37n	rna	138	10.97	17	SNP	0.000	G
FDPS	2224	genome.wustl.edu	37	1	155289696	155289696	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:155289696C>G	ENST00000356657.6	+	10	1198	c.1036C>G	c.(1036-1038)Cca>Gca	p.P346A	FDPS_ENST00000368356.4_Missense_Mutation_p.P346A|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1_ENST00000368352.5_5'Flank|RUSC1-AS1_ENST00000446880.1_RNA|FDPS_ENST00000447866.1_Missense_Mutation_p.P280A	NM_001135821.1	NP_001129293.1	P14324	FPPS_HUMAN	farnesyl diphosphate synthase	346					cholesterol biosynthetic process (GO:0006695)|farnesyl diphosphate biosynthetic process (GO:0045337)|geranyl diphosphate biosynthetic process (GO:0033384)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	dimethylallyltranstransferase activity (GO:0004161)|geranyltranstransferase activity (GO:0004337)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)	10	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;2.03e-10)|all cancers(21;5.23e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)		Alendronate(DB00630)|Ibandronate(DB00710)|Pamidronate(DB00282)|Risedronate(DB00884)|Zoledronate(DB00399)	ACGGGCCACTCCAGAACAGTA	0.547																																						dbGAP											0													83.0	79.0	80.0					1																	155289696		2203	4300	6503	-	-	-	SO:0001583	missense	0			J05262	CCDS1110.1, CCDS44241.1, CCDS72940.1	1q22	2012-07-13	2010-06-24		ENSG00000160752	ENSG00000160752	2.5.1.1, 2.5.1.10		3631	protein-coding gene	gene with protein product	"""farnesyl pyrophosphate synthetase, dimethylallyltranstransferase, geranyltranstransferase"""	134629				1968462	Standard	NM_002004		Approved		uc001fkc.2	P14324	OTTHUMG00000013909	ENST00000356657.6:c.1036C>G	1.37:g.155289696C>G	ENSP00000349078:p.Pro346Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DV91|E9PCI9|Q96G29	Missense_Mutation	SNP	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	p.P346A	ENST00000356657.6	37	c.1036	CCDS1110.1	1	.	.	.	.	.	.	.	.	.	.	C	13.61	2.289900	0.40494	.	.	ENSG00000160752	ENST00000447866;ENST00000368356;ENST00000356657	T;T;T	0.64438	-0.1;-0.1;-0.1	4.28	4.28	0.50868	Terpenoid synthase (2);	0.172150	0.28146	N	0.016429	T	0.43010	0.1228	L	0.51914	1.62	0.58432	D	0.999998	B	0.02656	0.0	B	0.06405	0.002	T	0.38499	-0.9658	10	0.35671	T	0.21	-5.1025	14.6536	0.68817	0.0:1.0:0.0:0.0	.	346	P14324	FPPS_HUMAN	A	280;346;346	ENSP00000391755:P280A;ENSP00000357340:P346A;ENSP00000349078:P346A	ENSP00000349078:P346A	P	+	1	0	FDPS	153556320	0.997000	0.39634	0.847000	0.33407	0.617000	0.37484	5.190000	0.65104	2.673000	0.90976	0.561000	0.74099	CCA	FDPS	-	pfam_Polyprenyl_synt,superfamily_Terpenoid_synth	ENSG00000160752		0.547	FDPS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FDPS	HGNC	protein_coding	OTTHUMT00000039053.1	84	0.00	0	C	NM_002004		155289696	155289696	+1	no_errors	ENST00000356657	ensembl	human	known	69_37n	missense	152	12.14	21	SNP	1.000	G
FGFR2	2263	genome.wustl.edu	37	10	123279672	123279672	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:123279672G>A	ENST00000358487.5	-	7	1032	c.760C>T	c.(760-762)Cac>Tac	p.H254Y	FGFR2_ENST00000478859.1_Missense_Mutation_p.H26Y|FGFR2_ENST00000457416.2_Missense_Mutation_p.H254Y|FGFR2_ENST00000346997.2_Missense_Mutation_p.H254Y|FGFR2_ENST00000360144.3_Missense_Mutation_p.H165Y|FGFR2_ENST00000369060.4_Missense_Mutation_p.H254Y|FGFR2_ENST00000356226.4_Missense_Mutation_p.H139Y|FGFR2_ENST00000357555.5_Missense_Mutation_p.H165Y|FGFR2_ENST00000490349.1_5'UTR|FGFR2_ENST00000351936.6_Missense_Mutation_p.H254Y|FGFR2_ENST00000369059.1_Missense_Mutation_p.H139Y|FGFR2_ENST00000369056.1_Missense_Mutation_p.H254Y|FGFR2_ENST00000369061.4_Intron	NM_000141.4	NP_000132.3	P21802	FGFR2_HUMAN	fibroblast growth factor receptor 2	254					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axonogenesis (GO:0007409)|bone development (GO:0060348)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|branch elongation involved in salivary gland morphogenesis (GO:0060667)|branching involved in labyrinthine layer morphogenesis (GO:0060670)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in salivary gland morphogenesis (GO:0060445)|branching morphogenesis of a nerve (GO:0048755)|bud elongation involved in lung branching (GO:0060449)|cell fate commitment (GO:0045165)|cell-cell signaling (GO:0007267)|coronal suture morphogenesis (GO:0060365)|digestive tract development (GO:0048565)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic digestive tract morphogenesis (GO:0048557)|embryonic organ development (GO:0048568)|embryonic organ morphogenesis (GO:0048562)|embryonic pattern specification (GO:0009880)|endodermal digestive tract morphogenesis (GO:0061031)|epidermal growth factor receptor signaling pathway (GO:0007173)|epidermis morphogenesis (GO:0048730)|epithelial cell differentiation (GO:0030855)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|fibroblast growth factor receptor signaling pathway involved in hemopoiesis (GO:0035603)|fibroblast growth factor receptor signaling pathway involved in mammary gland specification (GO:0060595)|fibroblast growth factor receptor signaling pathway involved in negative regulation of apoptotic process in bone marrow (GO:0035602)|fibroblast growth factor receptor signaling pathway involved in orbitofrontal cortex development (GO:0035607)|fibroblast growth factor receptor signaling pathway involved in positive regulation of cell proliferation in bone marrow (GO:0035604)|gland morphogenesis (GO:0022612)|hair follicle morphogenesis (GO:0031069)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|lacrimal gland development (GO:0032808)|lateral sprouting from an epithelium (GO:0060601)|lens fiber cell development (GO:0070307)|limb bud formation (GO:0060174)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung lobe morphogenesis (GO:0060463)|lung-associated mesenchyme development (GO:0060484)|mammary gland bud formation (GO:0060615)|membranous septum morphogenesis (GO:0003149)|mesenchymal cell differentiation (GO:0048762)|mesenchymal cell differentiation involved in lung development (GO:0060915)|mesenchymal cell proliferation involved in lung development (GO:0060916)|mesodermal cell differentiation (GO:0048333)|midbrain development (GO:0030901)|morphogenesis of embryonic epithelium (GO:0016331)|multicellular organism growth (GO:0035264)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuromuscular junction development (GO:0007528)|neurotrophin TRK receptor signaling pathway (GO:0048011)|odontogenesis (GO:0042476)|orbitofrontal cortex development (GO:0021769)|organ growth (GO:0035265)|organ morphogenesis (GO:0009887)|otic vesicle formation (GO:0030916)|outflow tract septum morphogenesis (GO:0003148)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell cycle (GO:0045787)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of Wnt signaling pathway (GO:0030177)|post-embryonic development (GO:0009791)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|prostate epithelial cord elongation (GO:0060523)|prostate gland morphogenesis (GO:0060512)|protein autophosphorylation (GO:0046777)|pyramidal neuron development (GO:0021860)|regulation of branching involved in prostate gland morphogenesis (GO:0060687)|regulation of cell fate commitment (GO:0010453)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)|regulation of morphogenesis of a branching structure (GO:0060688)|regulation of multicellular organism growth (GO:0040014)|regulation of osteoblast differentiation (GO:0045667)|regulation of osteoblast proliferation (GO:0033688)|regulation of smooth muscle cell differentiation (GO:0051150)|regulation of smoothened signaling pathway (GO:0008589)|reproductive structure development (GO:0048608)|skeletal system morphogenesis (GO:0048705)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|synaptic vesicle transport (GO:0048489)|ureteric bud development (GO:0001657)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|ventricular zone neuroblast division (GO:0021847)	cell cortex (GO:0005938)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|excitatory synapse (GO:0060076)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|heparin binding (GO:0008201)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)			breast(3)|central_nervous_system(3)|cervix(2)|endometrium(98)|haematopoietic_and_lymphoid_tissue(4)|kidney(4)|large_intestine(7)|lung(21)|ovary(4)|skin(30)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(2)	181		Lung NSC(174;0.0841)|all_lung(145;0.106)|all_neural(114;0.107)	STAD - Stomach adenocarcinoma(1;7.52e-05)|all cancers(1;0.0722)	all cancers(201;9.73e-05)|GBM - Glioblastoma multiforme(135;0.0845)	Palifermin(DB00039)|Ponatinib(DB08901)|Regorafenib(DB08896)|Thalidomide(DB01041)	ATGGGCCGGTGAGGCGATCGC	0.567		5	Mis		"""gastric. NSCLC, endometrial"""		"""Crouzon, Pfeiffer, and Apert syndromes"""		Saethre-Chotzen syndrome;Apert syndrome																													dbGAP		Dom	yes		10	10q26	2263	fibroblast growth factor receptor 2	yes	E	0													58.0	47.0	51.0					10																	123279672		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Acrocephalosyndactyly type III;Acrocephalosyndactyly type I and II, ACS1. ACS2, incl Apert-Crouzon s.	AK026508	CCDS7620.2, CCDS31298.1, CCDS44485.1, CCDS44486.1, CCDS44487.1, CCDS44488.1, CCDS44489.1, CCDS53584.1, CCDS73210.1	10q25.3-q26	2013-01-11	2008-08-01		ENSG00000066468	ENSG00000066468		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3689	protein-coding gene	gene with protein product	"""Crouzon syndrome"", ""Pfeiffer syndrome"""	176943	"""bacteria-expressed kinase"", ""keratinocyte growth factor receptor"", ""craniofacial dysostosis 1"", ""Jackson-Weiss syndrome"""	KGFR, BEK, CFD1, JWS			Standard	NM_022970		Approved	CEK3, TK14, TK25, ECT1, K-SAM, CD332	uc021pzy.1	P21802	OTTHUMG00000019175	ENST00000358487.5:c.760C>T	10.37:g.123279672G>A	ENSP00000351276:p.His254Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFC2|E7EVR6|E9PCR0|P18443|Q01742|Q12922|Q14300|Q14301|Q14302|Q14303|Q14304|Q14305|Q14672|Q14718|Q14719|Q1KHY5|Q86YI4|Q8IXC7|Q96KL9|Q96KM0|Q96KM1|Q96KM2|Q9NZU2|Q9NZU3|Q9UD01|Q9UD02|Q9UIH3|Q9UIH4|Q9UIH5|Q9UIH6|Q9UIH7|Q9UIH8|Q9UM87|Q9UMC6|Q9UNS7|Q9UQH7|Q9UQH8|Q9UQH9|Q9UQI0	Missense_Mutation	SNP	pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H254Y	ENST00000358487.5	37	c.760	CCDS31298.1	10	.	.	.	.	.	.	.	.	.	.	G	29.5	5.010803	0.93346	.	.	ENSG00000066468	ENST00000357555;ENST00000369062;ENST00000358487;ENST00000356226;ENST00000369060;ENST00000369059;ENST00000346997;ENST00000457416;ENST00000351936;ENST00000360144;ENST00000369056;ENST00000369058;ENST00000336553	T;T;T;T;T;T;T;T;T;T;T;T	0.80304	-1.26;-1.28;-1.25;-1.36;-1.25;-1.29;-1.26;-1.28;-1.27;-1.25;-1.25;-1.25	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	D	0.90683	0.7077	M	0.82823	2.61	0.80722	D	1	B;P;D;B;P;B;P;D;P;D	0.65815	0.377;0.773;0.986;0.038;0.841;0.391;0.546;0.985;0.465;0.995	B;B;P;B;P;P;P;P;B;D	0.70016	0.04;0.28;0.785;0.027;0.791;0.637;0.655;0.728;0.187;0.967	D	0.90368	0.4378	10	0.52906	T	0.07	.	20.0368	0.97565	0.0:0.0:1.0:0.0	.	273;139;254;273;254;165;139;273;165;254	D3DRD4;B5A963;B5A960;D3DRD5;P21802-18;P21802-21;P21802-20;D3DRE0;P21802-22;P21802-17	.;.;.;.;.;.;.;.;.;.	Y	165;254;254;139;254;139;254;254;254;165;254;254;165	ENSP00000350166:H165Y;ENSP00000351276:H254Y;ENSP00000348559:H139Y;ENSP00000358056:H254Y;ENSP00000358055:H139Y;ENSP00000263451:H254Y;ENSP00000410294:H254Y;ENSP00000309878:H254Y;ENSP00000353262:H165Y;ENSP00000358052:H254Y;ENSP00000358054:H254Y;ENSP00000337665:H165Y	ENSP00000337665:H165Y	H	-	1	0	FGFR2	123269662	1.000000	0.71417	0.994000	0.49952	0.878000	0.50629	9.860000	0.99555	2.735000	0.93741	0.563000	0.77884	CAC	FGFR2	-	pirsf_Tyr_kinase_fibroblast_GF_rcpt	ENSG00000066468		0.567	FGFR2-001	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	FGFR2	HGNC	protein_coding	OTTHUMT00000050715.1	76	0.00	0	G	NM_022976, NM_000141		123279672	123279672	-1	no_errors	ENST00000457416	ensembl	human	known	69_37n	missense	56	18.84	13	SNP	1.000	A
FJX1	24147	genome.wustl.edu	37	11	35641376	35641376	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:35641376C>T	ENST00000317811.4	+	1	1642	c.1192C>T	c.(1192-1194)Cgc>Tgc	p.R398C	FJX1_ENST00000532914.1_3'UTR	NM_014344.3	NP_055159.2	Q86VR8	FJX1_HUMAN	four jointed box 1 (Drosophila)	398					retina layer formation (GO:0010842)	extracellular space (GO:0005615)				lung(1)|urinary_tract(1)	2	all_cancers(35;0.177)|all_lung(20;0.0238)|Lung NSC(22;0.0494)|all_epithelial(35;0.0739)	all_hematologic(20;0.107)				CCACGAGCCTCGCTTCCCCGA	0.706																																					Melanoma(161;10 2587 27165 47356)	dbGAP											0													3.0	4.0	4.0					11																	35641376		1696	3664	5360	-	-	-	SO:0001583	missense	0			AJ245599	CCDS44570.1	11p13	2012-05-18				ENSG00000179431			17166	protein-coding gene	gene with protein product	"""putative secreted ligand homologous to fjx1"""	612206				7647465, 10072791	Standard	NM_014344		Approved	FLJ22416, FLJ25593	uc001mwh.3	Q86VR8		ENST00000317811.4:c.1192C>T	11.37:g.35641376C>T	ENSP00000400223:p.Arg398Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RCA9|Q9UGK6	Missense_Mutation	SNP	pfam_DUF1193	p.R398C	ENST00000317811.4	37	c.1192	CCDS44570.1	11	.	.	.	.	.	.	.	.	.	.	C	19.14	3.769845	0.69992	.	.	ENSG00000179431	ENST00000317811	T	0.76186	-1.0	5.21	4.27	0.50696	.	.	.	.	.	T	0.71937	0.3399	N	0.08118	0	0.45979	D	0.998791	D	0.89917	1.0	D	0.68621	0.959	T	0.74615	-0.3606	9	0.36615	T	0.2	-6.4564	15.1857	0.72999	0.0:0.858:0.142:0.0	.	398	Q86VR8	FJX1_HUMAN	C	398	ENSP00000400223:R398C	ENSP00000400223:R398C	R	+	1	0	FJX1	35597952	0.999000	0.42202	1.000000	0.80357	0.997000	0.91878	3.384000	0.52478	1.151000	0.42436	0.555000	0.69702	CGC	FJX1	-	pfam_DUF1193	ENSG00000179431		0.706	FJX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FJX1	HGNC	protein_coding	OTTHUMT00000389078.1	17	0.00	0	C	NM_014344		35641376	35641376	+1	no_errors	ENST00000317811	ensembl	human	known	69_37n	missense	12	33.33	6	SNP	1.000	T
FLAD1	80308	genome.wustl.edu	37	1	154960718	154960718	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:154960718C>T	ENST00000292180.3	+	2	832	c.510C>T	c.(508-510)ttC>ttT	p.F170F	FLAD1_ENST00000368431.3_Silent_p.F71F|FLAD1_ENST00000315144.10_Silent_p.F73F|FLAD1_ENST00000405236.2_Silent_p.F71F|FLAD1_ENST00000368432.1_Silent_p.F73F|FLAD1_ENST00000368433.1_Silent_p.F170F|FLAD1_ENST00000368428.1_5'Flank|FLAD1_ENST00000487371.1_3'UTR|FLAD1_ENST00000295530.2_5'UTR	NM_025207.4	NP_079483.3	Q8NFF5	FAD1_HUMAN	flavin adenine dinucleotide synthetase 1	170	Molybdenum cofactor biosynthesis protein- like.				FAD biosynthetic process (GO:0006747)|Mo-molybdopterin cofactor biosynthetic process (GO:0006777)|riboflavin metabolic process (GO:0006771)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|FMN adenylyltransferase activity (GO:0003919)			endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|ovary(3)|skin(3)	22	all_epithelial(22;2.77e-30)|all_lung(78;4.1e-28)|all_hematologic(923;0.0359)|Hepatocellular(266;0.0877)		BRCA - Breast invasive adenocarcinoma(34;0.00034)			CCAACCGCTTCACCCATGTCC	0.577																																						dbGAP											0													112.0	101.0	104.0					1																	154960718		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS1078.1, CCDS1079.1, CCDS53371.1, CCDS53372.1	1q22	2013-03-05	2013-03-05		ENSG00000160688	ENSG00000160688	2.7.7.2		24671	protein-coding gene	gene with protein product		610595	"""Fad1, flavin adenine dinucleotide synthetase, homolog (yeast)"", ""FAD1 flavin adenine dinucleotide synthetase homolog (S. cerevisiae)"", ""flavin adenine dinucleotide synthetase"""				Standard	NM_001184891		Approved	PP591, FAD1	uc001fgf.2	Q8NFF5	OTTHUMG00000037416	ENST00000292180.3:c.510C>T	1.37:g.154960718C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N5J1|Q8N686|Q8WU93|Q8WUJ4|Q96CR8|Q99764|Q9HBN6	Silent	SNP	pfam_Mopterin-bd,pfam_PAPS_reduct,superfamily_Mopterin-bd,smart_Mopterin-bd,pirsf_FAD_synth_Mopterin-bd	p.F170	ENST00000292180.3	37	c.510	CCDS1078.1	1																																																																																			FLAD1	-	pfam_Mopterin-bd,superfamily_Mopterin-bd,smart_Mopterin-bd,pirsf_FAD_synth_Mopterin-bd	ENSG00000160688		0.577	FLAD1-001	NOVEL	basic|CCDS	protein_coding	FLAD1	HGNC	protein_coding	OTTHUMT00000091089.1	71	0.00	0	C	NM_025207		154960718	154960718	+1	no_errors	ENST00000292180	ensembl	human	known	69_37n	silent	100	19.20	24	SNP	1.000	T
C15orf65	145788	genome.wustl.edu	37	15	55710686	55710686	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:55710686G>C	ENST00000569691.1	+	2	505	c.284G>C	c.(283-285)gGa>gCa	p.G95A	C15orf65_ENST00000570794.1_3'UTR|DYX1C1-CCPG1_ENST00000565113.1_RNA|DYX1C1_ENST00000448430.2_Intron|DYX1C1_ENST00000380679.1_Intron	NM_001198784.1	NP_001185713.1	H3BRN8	CO065_HUMAN	chromosome 15 open reading frame 65	95																	AGAGCAACTGGATTTTATCAA	0.333																																						dbGAP											0																																										-	-	-	SO:0001583	missense	0				CCDS58363.1	15q21.3	2013-06-06			ENSG00000261652	ENSG00000261652			44654	protein-coding gene	gene with protein product							Standard	NM_001198784		Approved	FLJ27352		H3BRN8	OTTHUMG00000172679	ENST00000569691.1:c.284G>C	15.37:g.55710686G>C	ENSP00000456337:p.Gly95Ala	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.G95A	ENST00000569691.1	37	c.284	CCDS58363.1	15																																																																																			RP11-178D12.1	-	NULL	ENSG00000261652		0.333	C15orf65-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FLJ27352	Clone_based_vega_gene	protein_coding	OTTHUMT00000419859.2	13	0.00	0	G			55710686	55710686	+1	no_errors	ENST00000569691	ensembl	human	novel	69_37n	missense	11	26.67	4	SNP	1.000	C
FLNC	2318	genome.wustl.edu	37	7	128483575	128483575	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:128483575G>C	ENST00000325888.8	+	18	3016	c.2755G>C	c.(2755-2757)Gag>Cag	p.E919Q	FLNC_ENST00000346177.6_Missense_Mutation_p.E919Q	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	919					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						GCGGGACTTTGAGATCATAGA	0.622																																						dbGAP											0													95.0	106.0	102.0					7																	128483575		2158	4245	6403	-	-	-	SO:0001583	missense	0			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.2755G>C	7.37:g.128483575G>C	ENSP00000327145:p.Glu919Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.E919Q	ENST00000325888.8	37	c.2755	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	G	27.2	4.813139	0.90707	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.85773	-2.03;-2.03	5.32	5.32	0.75619	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.89701	0.6791	L	0.41710	1.295	0.58432	D	0.999998	D;B	0.76494	0.999;0.363	D;B	0.87578	0.998;0.196	D	0.89917	0.4056	10	0.52906	T	0.07	.	18.9962	0.92813	0.0:0.0:1.0:0.0	.	919;919	Q14315-2;Q14315	.;FLNC_HUMAN	Q	919	ENSP00000327145:E919Q;ENSP00000344002:E919Q	ENSP00000327145:E919Q	E	+	1	0	FLNC	128270811	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	9.831000	0.99420	2.481000	0.83766	0.561000	0.74099	GAG	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like	ENSG00000128591		0.622	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	13	0.00	0	G			128483575	128483575	+1	no_errors	ENST00000325888	ensembl	human	known	69_37n	missense	22	24.14	7	SNP	1.000	C
FOXA3	3171	genome.wustl.edu	37	19	46375436	46375436	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:46375436C>G	ENST00000302177.2	+	2	370	c.173C>G	c.(172-174)tCc>tGc	p.S58C		NM_004497.2	NP_004488.2	P55318	FOXA3_HUMAN	forkhead box A3	58					cell differentiation (GO:0030154)|cellular glucose homeostasis (GO:0001678)|cellular response to starvation (GO:0009267)|chromatin modification (GO:0016568)|endocrine pancreas development (GO:0031018)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)|pancreas(1)|prostate(1)	13		Ovarian(192;0.0308)|all_neural(266;0.0476)		OV - Ovarian serous cystadenocarcinoma(262;0.00453)|GBM - Glioblastoma multiforme(486;0.0518)|Epithelial(262;0.236)		CTCCCTGCCTCCCCACTGCCC	0.692																																						dbGAP											0													32.0	39.0	36.0					19																	46375436		2199	4293	6492	-	-	-	SO:0001583	missense	0			L12141	CCDS12677.1	19q13.32	2014-09-11		2002-09-20	ENSG00000170608	ENSG00000170608		"""Forkhead boxes"""	5023	protein-coding gene	gene with protein product		602295	"""hepatocyte nuclear factor 3, gamma"""	HNF3G		9119385	Standard	NM_004497		Approved		uc002pdr.3	P55318	OTTHUMG00000182484	ENST00000302177.2:c.173C>G	19.37:g.46375436C>G	ENSP00000304004:p.Ser58Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A9LYI5|Q53F16|Q9UMW9	Missense_Mutation	SNP	pfam_TF_fork_head,pfam_Fork-head_N,pfam_Forkhead_box_C,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.S58C	ENST00000302177.2	37	c.173	CCDS12677.1	19	.	.	.	.	.	.	.	.	.	.	C	12.29	1.892962	0.33442	.	.	ENSG00000170608	ENST00000302177	T	0.21031	2.03	4.3	4.3	0.51218	Fork-head N-terminal (1);	0.466521	0.20578	N	0.089585	T	0.29389	0.0732	N	0.19112	0.55	0.53005	D	0.999964	D	0.89917	1.0	D	0.74348	0.983	T	0.06075	-1.0847	10	0.62326	D	0.03	.	12.1282	0.53928	0.0:1.0:0.0:0.0	.	58	P55318	FOXA3_HUMAN	C	58	ENSP00000304004:S58C	ENSP00000304004:S58C	S	+	2	0	FOXA3	51067276	0.803000	0.28956	0.992000	0.48379	0.378000	0.30076	1.510000	0.35790	2.236000	0.73375	0.297000	0.19635	TCC	FOXA3	-	pfam_Fork-head_N	ENSG00000170608		0.692	FOXA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXA3	HGNC	protein_coding	OTTHUMT00000461682.1	68	0.00	0	C			46375436	46375436	+1	no_errors	ENST00000302177	ensembl	human	known	69_37n	missense	61	17.57	13	SNP	1.000	G
FSIP2	401024	genome.wustl.edu	37	2	186659336	186659336	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:186659336G>A	ENST00000424728.1	+	16	7473	c.7473G>A	c.(7471-7473)ttG>ttA	p.L2491L	AC008174.3_ENST00000429929.1_RNA|FSIP2_ENST00000343098.5_Silent_p.L2580L|AC008174.3_ENST00000436557.1_RNA			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	2491										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AAGAACTTTTGAATAAGTTGT	0.328																																						dbGAP											0																																										-	-	-	SO:0001819	synonymous_variant	0			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.7473G>A	2.37:g.186659336G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Silent	SNP	NULL	p.L2580	ENST00000424728.1	37	c.7740		2																																																																																			FSIP2	-	NULL	ENSG00000188738		0.328	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	15	0.00	0	G	NM_173651		186659336	186659336	+1	no_errors	ENST00000343098	ensembl	human	known	69_37n	silent	20	20.00	5	SNP	0.639	A
FUK	197258	genome.wustl.edu	37	16	70508500	70508500	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:70508500G>A	ENST00000288078.6	+	17	2290	c.2058G>A	c.(2056-2058)gtG>gtA	p.V686V	FUK_ENST00000571514.1_Silent_p.V177V|FUK_ENST00000378912.2_Silent_p.V718V	NM_145059.2	NP_659496.2	Q8N0W3	FUK_HUMAN	fucokinase	686						cytoplasm (GO:0005737)	ATP binding (GO:0005524)|fucokinase activity (GO:0050201)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(11)|ovary(2)|prostate(2)	23		Ovarian(137;0.0694)				GCCAGGCTGTGATGTCAGCCC	0.647																																						dbGAP											0													29.0	35.0	33.0					16																	70508500		2053	4199	6252	-	-	-	SO:0001819	synonymous_variant	0				CCDS10891.2	16q22.1	2008-02-05			ENSG00000157353	ENSG00000157353	2.7.1.52		29500	protein-coding gene	gene with protein product	"""L-fucose kinase"""	608675				12056818	Standard	XM_006721161		Approved	FLJ39408	uc002eyy.3	Q8N0W3	OTTHUMG00000074085	ENST00000288078.6:c.2058G>A	16.37:g.70508500G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5PSM3|Q5XKL6|Q6ZRA0|Q96MT9	Silent	SNP	pfam_Fucokinase,pfam_GHMP_kinase_C_dom,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Trimer_LpxA-like,prints_Galkinase	p.V718	ENST00000288078.6	37	c.2154	CCDS10891.2	16																																																																																			FUK	-	NULL	ENSG00000157353		0.647	FUK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FUK	HGNC	protein_coding	OTTHUMT00000157291.2	65	0.00	0	G	NM_145059		70508500	70508500	+1	no_errors	ENST00000378912	ensembl	human	known	69_37n	silent	63	17.95	14	SNP	1.000	A
FZD4	8322	genome.wustl.edu	37	11	86662326	86662326	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:86662326G>A	ENST00000531380.1	-	2	1777	c.1472C>T	c.(1471-1473)tCa>tTa	p.S491L	PRSS23_ENST00000531521.1_3'UTR|PRSS23_ENST00000533902.2_Silent_p.*92*	NM_012193.3	NP_036325.2	Q9ULV1	FZD4_HUMAN	frizzled class receptor 4	491					brain development (GO:0007420)|canonical Wnt signaling pathway (GO:0060070)|cellular response to retinoic acid (GO:0071300)|cerebellum vasculature morphogenesis (GO:0061301)|extracellular matrix-cell signaling (GO:0035426)|locomotion involved in locomotory behavior (GO:0031987)|negative regulation of cell-substrate adhesion (GO:0010812)|neuron differentiation (GO:0030182)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)|retina vasculature morphogenesis in camera-type eye (GO:0061299)|retinal blood vessel morphogenesis (GO:0061304)|sensory perception of sound (GO:0007605)|substrate adhesion-dependent cell spreading (GO:0034446)|vasculogenesis (GO:0001570)|Wnt signaling pathway (GO:0016055)|Wnt signaling pathway, calcium modulating pathway (GO:0007223)	cell projection (GO:0042995)|cell surface (GO:0009986)|cell-cell junction (GO:0005911)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine binding (GO:0019955)|G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			breast(1)|kidney(1)|large_intestine(3)|lung(9)|prostate(6)|skin(1)	21		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				CCACATGCCTGAAGTGATGCC	0.418																																						dbGAP											0													102.0	100.0	100.0					11																	86662326		2201	4299	6500	-	-	-	SO:0001583	missense	0			AB032417	CCDS8279.1	11q14-q21	2014-01-29	2014-01-29			ENSG00000174804		"""GPCR / Class F : Frizzled receptors"", ""CD molecules"""	4042	protein-coding gene	gene with protein product		604579	"""frizzled (Drosophila) homolog 4"", ""exudative vitreoretinopathy 1"", ""frizzled homolog 4 (Drosophila)"", ""frizzled 4, seven transmembrane spanning receptor"", ""frizzled family receptor 4"""	EVR1		10544037, 15024691	Standard	NM_012193		Approved	CD344	uc001pce.3	Q9ULV1		ENST00000531380.1:c.1472C>T	11.37:g.86662326G>A	ENSP00000434034:p.Ser491Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9Q3|Q14C97|Q6S9E4	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.S491L	ENST00000531380.1	37	c.1472	CCDS8279.1	11	.	.	.	.	.	.	.	.	.	.	G	20.3	3.966850	0.74131	.	.	ENSG00000174804	ENST00000531380	D	0.83837	-1.77	6.06	6.06	0.98353	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.93956	0.8065	M	0.94063	3.49	0.80722	D	1	D	0.76494	0.999	D	0.81914	0.995	D	0.94415	0.7635	9	.	.	.	.	20.6208	0.99490	0.0:0.0:1.0:0.0	.	491	Q9ULV1	FZD4_HUMAN	L	491	ENSP00000434034:S491L	.	S	-	2	0	FZD4	86339974	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	5.508000	0.67006	2.882000	0.98803	0.655000	0.94253	TCA	FZD4	-	pfam_Frizzled,pfscan_GPCR_2-like,prints_Frizzled	ENSG00000174804		0.418	FZD4-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	FZD4	HGNC	protein_coding	OTTHUMT00000393818.2	54	0.00	0	G	NM_012193		86662326	86662326	-1	no_errors	ENST00000531380	ensembl	human	known	69_37n	missense	50	16.67	10	SNP	1.000	A
GAD1	2571	genome.wustl.edu	37	2	171702291	171702291	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:171702291G>A	ENST00000358196.3	+	9	1493	c.943G>A	c.(943-945)Gaa>Aaa	p.E315K		NM_000817.2	NP_000808.2	Q99259	DCE1_HUMAN	glutamate decarboxylase 1 (brain, 67kDa)	315					gamma-aminobutyric acid biosynthetic process (GO:0009449)|glutamate catabolic process (GO:0006538)|glutamate decarboxylation to succinate (GO:0006540)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|protein-pyridoxal-5-phosphate linkage (GO:0018352)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	glutamate binding (GO:0016595)|glutamate decarboxylase activity (GO:0004351)|pyridoxal phosphate binding (GO:0030170)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(15)|ovary(1)|urinary_tract(2)	35						AAAGTGCAATGAAAGGTAGGC	0.398																																						dbGAP											0													75.0	72.0	73.0					2																	171702291		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS2239.1, CCDS2240.1	2q31	2008-02-05	2002-08-29		ENSG00000128683	ENSG00000128683	4.1.1.15		4092	protein-coding gene	gene with protein product		605363	"""glutamate decarboxylase 1 (brain, 67kD)"""	GAD		1549570	Standard	XM_005246443		Approved		uc002ugi.3	Q99259	OTTHUMG00000044175	ENST00000358196.3:c.943G>A	2.37:g.171702291G>A	ENSP00000350928:p.Glu315Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q49AK1|Q53TQ7|Q9BU91|Q9UHH4	Missense_Mutation	SNP	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	p.E315K	ENST00000358196.3	37	c.943	CCDS2239.1	2	.	.	.	.	.	.	.	.	.	.	G	18.43	3.622158	0.66787	.	.	ENSG00000128683	ENST00000358196	T	0.39592	1.07	5.75	5.75	0.90469	Pyridoxal phosphate-dependent transferase, major region, subdomain 1 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.044653	0.85682	D	0.000000	T	0.45256	0.1333	L	0.55213	1.73	0.80722	D	1	B	0.18013	0.025	B	0.22753	0.041	T	0.30851	-0.9964	10	0.52906	T	0.07	-18.023	19.9662	0.97271	0.0:0.0:1.0:0.0	.	315	Q99259	DCE1_HUMAN	K	315	ENSP00000350928:E315K	ENSP00000350928:E315K	E	+	1	0	GAD1	171410537	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.334000	0.96470	2.701000	0.92244	0.650000	0.86243	GAA	GAD1	-	pfam_PyrdxlP-dep_de-COase,pfam_Aminotrans_V/Cys_dSase,pfam_ArAA_b-elim_lyase/Thr_aldolase,superfamily_PyrdxlP-dep_Trfase_major_dom	ENSG00000128683		0.398	GAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GAD1	HGNC	protein_coding	OTTHUMT00000102664.2	43	0.00	0	G			171702291	171702291	+1	no_errors	ENST00000358196	ensembl	human	known	69_37n	missense	46	20.69	12	SNP	1.000	A
GALNTL5	168391	genome.wustl.edu	37	7	151699921	151699921	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:151699921G>A	ENST00000392800.2	+	6	1035	c.781G>A	c.(781-783)Gat>Aat	p.D261N	GALNTL5_ENST00000483959.1_3'UTR|GALNTL5_ENST00000431418.2_Missense_Mutation_p.D261N	NM_145292.3	NP_660335.2	Q7Z4T8	GLTL5_HUMAN	polypeptide N-acetylgalactosaminyltransferase-like 5	261					spermatid development (GO:0007286)	endosome (GO:0005768)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)			NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(11)|ovary(2)|prostate(2)|skin(3)	32	all_neural(206;0.187)	all_hematologic(28;0.0749)	OV - Ovarian serous cystadenocarcinoma(82;0.00427)	UCEC - Uterine corpus endometrioid carcinoma (81;0.18)|BRCA - Breast invasive adenocarcinoma(188;0.166)		TGTCATTGATGATAGAACTCT	0.468																																						dbGAP											0													158.0	156.0	157.0					7																	151699921		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF440400	CCDS5929.1	7q36.2	2014-03-13	2014-03-13	2004-07-28	ENSG00000106648	ENSG00000106648		"""Glycosyltransferase family 2 domain containing"""	21725	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase-like 5"""	615133	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 15"", ""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase-like 5"""	GALNT15			Standard	NM_145292		Approved	GalNAc-T5L	uc003wkp.3	Q7Z4T8	OTTHUMG00000157306	ENST00000392800.2:c.781G>A	7.37:g.151699921G>A	ENSP00000376548:p.Asp261Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	Q75KN2|Q75MD3|Q8NCV4|Q8WW05|Q9UDR9	Missense_Mutation	SNP	pfam_Glyco_trans_2	p.D261N	ENST00000392800.2	37	c.781	CCDS5929.1	7	.	.	.	.	.	.	.	.	.	.	G	12.34	1.907985	0.33721	.	.	ENSG00000106648	ENST00000431418;ENST00000392800	T;T	0.59364	0.27;0.27	4.83	-5.29	0.02747	Glycosyl transferase, family 2 (1);	1.390520	0.04835	N	0.439410	T	0.45915	0.1366	L	0.54323	1.7	0.09310	N	1	B;B	0.27316	0.037;0.175	B;B	0.22152	0.017;0.038	T	0.25779	-1.0122	10	0.36615	T	0.2	.	5.0983	0.14745	0.0662:0.173:0.3845:0.3763	.	12;261	A8MZD3;Q7Z4T8	.;GLTL5_HUMAN	N	261	ENSP00000392582:D261N;ENSP00000376548:D261N	ENSP00000376548:D261N	D	+	1	0	GALNTL5	151330854	0.000000	0.05858	0.000000	0.03702	0.039000	0.13416	0.644000	0.24766	-1.314000	0.02300	-0.983000	0.02560	GAT	GALNTL5	-	pfam_Glyco_trans_2	ENSG00000106648		0.468	GALNTL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNTL5	HGNC	protein_coding	OTTHUMT00000348395.1	71	0.00	0	G	NM_145292		151699921	151699921	+1	no_errors	ENST00000392800	ensembl	human	known	69_37n	missense	73	15.12	13	SNP	0.000	A
GALP	85569	genome.wustl.edu	37	19	56688525	56688525	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:56688525G>A	ENST00000357330.2	+	2	130	c.48G>A	c.(46-48)ctG>ctA	p.L16L	GALP_ENST00000440823.1_Silent_p.L16L|GALP_ENST00000590002.1_Silent_p.L16L	NM_033106.3	NP_149097.1	Q9UBC7	GALP_HUMAN	galanin-like peptide	16					behavioral response to starvation (GO:0042595)|defense response to bacterium (GO:0042742)|neuropeptide signaling pathway (GO:0007218)|regulation of appetite (GO:0032098)|response to insulin (GO:0032868)	extracellular region (GO:0005576)				lung(4)	4		Colorectal(82;0.000147)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0507)		TCCTCTTGCTGAGCCTGGCAG	0.627																																						dbGAP											0													71.0	45.0	53.0					19																	56688525		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF188493	CCDS12940.1, CCDS46202.1	19q13.42	2013-02-26	2007-08-24			ENSG00000197487		"""Endogenous ligands"""	24840	protein-coding gene	gene with protein product		611178				10601261	Standard	NM_033106		Approved		uc002qmo.1	Q9UBC7		ENST00000357330.2:c.48G>A	19.37:g.56688525G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A1KXL3	Silent	SNP	pfam_Galanin	p.L16	ENST00000357330.2	37	c.48	CCDS12940.1	19																																																																																			GALP	-	NULL	ENSG00000197487		0.627	GALP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GALP	HGNC	protein_coding	OTTHUMT00000457832.1	46	0.00	0	G	NM_033106		56688525	56688525	+1	no_errors	ENST00000357330	ensembl	human	known	69_37n	silent	55	12.70	8	SNP	0.734	A
GALT	2592	genome.wustl.edu	37	9	34647847	34647847	+	Silent	SNP	C	C	T	rs367543256		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:34647847C>T	ENST00000378842.3	+	5	438	c.396C>T	c.(394-396)caC>caT	p.H132H	GALT_ENST00000556278.1_Intron|IL11RA_ENST00000555003.1_5'Flank|GALT_ENST00000450095.2_Silent_p.H23H	NM_000155.3	NP_000146.2	P07902	GALT_HUMAN	galactose-1-phosphate uridylyltransferase	132			H -> Q (in GALCT; affects protein stability). {ECO:0000269|PubMed:22461411}.|H -> Y (in GALCT).		carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|galactose metabolic process (GO:0006012)|small molecule metabolic process (GO:0044281)|UDP-glucose catabolic process (GO:0006258)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)	UDP-glucose:hexose-1-phosphate uridylyltransferase activity (GO:0008108)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|liver(2)|lung(5)|upper_aerodigestive_tract(1)	16	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.173)		TGTGCTTCCACCCCTGGTCGG	0.592									Galactosemia																													dbGAP											0													123.0	113.0	116.0					9																	34647847		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database	Galactose-1-Phosphate Uridyltransferase Deficiency	M60091	CCDS6565.1, CCDS59122.1	9p13	2013-01-08			ENSG00000213930	ENSG00000213930	2.7.7.12		4135	protein-coding gene	gene with protein product		606999					Standard	NM_000155		Approved		uc003zve.4	P07902	OTTHUMG00000019836	ENST00000378842.3:c.396C>T	9.37:g.34647847C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B4E097|E7ET32|Q14355|Q14356|Q14357|Q14358|Q14359|Q14360|Q14361|Q14363|Q14364|Q14365|Q14369|Q14370|Q14371|Q14372|Q14373|Q14374|Q14375|Q14377|Q14378|Q14380|Q14381|Q14382|Q14383|Q14384|Q14385|Q14386|Q14387|Q14389|Q16766|Q53XK1|Q5VZ81|Q96BY1	Missense_Mutation	SNP	pfam_GalP_Utransf_N,superfamily_HIT-like	p.T116I	ENST00000378842.3	37	c.347	CCDS6565.1	9																																																																																			GALT	-	NULL	ENSG00000213930		0.592	GALT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GALT	HGNC	protein_coding	OTTHUMT00000052231.1	100	0.00	0	C	NM_000155		34647847	34647847	+1	no_errors	ENST00000473506	ensembl	human	known	69_37n	missense	123	11.43	16	SNP	1.000	T
PAXBP1	94104	genome.wustl.edu	37	21	34133372	34133372	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr21:34133372G>A	ENST00000331923.4	-	5	1162	c.973C>T	c.(973-975)Cag>Tag	p.Q325*	PAXBP1_ENST00000290178.4_Nonsense_Mutation_p.Q325*|PAXBP1_ENST00000472588.1_5'UTR	NM_016631.3	NP_057715.2	Q9Y5B6	PAXB1_HUMAN	PAX3 and PAX7 binding protein 1	325					muscle organ development (GO:0007517)|positive regulation of histone methylation (GO:0031062)|positive regulation of myoblast proliferation (GO:2000288)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of satellite cell proliferation (GO:0014842)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)										TGTCGTACCTGAGGGATATTA	0.333																																						dbGAP											0													204.0	208.0	207.0					21																	34133372		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF231920	CCDS13619.1, CCDS33541.1	21q22.11	2014-01-23	2013-01-08	2013-01-08	ENSG00000159086	ENSG00000159086			13579	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 105"", ""GC-rich sequence DNA-binding factor candidate"""		"""chromosome 21 open reading frame 66"", ""GC-rich sequence DNA-binding factor 1"""	C21orf66, GCFC1		11707072, 22862948	Standard	NM_016631		Approved	GCFC, fSAP105	uc002yqn.3	Q9Y5B6	OTTHUMG00000064980	ENST00000331923.4:c.973C>T	21.37:g.34133372G>A	ENSP00000328992:p.Gln325*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DSE7|Q96DU8|Q9NYQ0	Nonsense_Mutation	SNP	pfam_GCFC_dom	p.Q325*	ENST00000331923.4	37	c.973	CCDS13619.1	21	.	.	.	.	.	.	.	.	.	.	G	36	5.711882	0.96830	.	.	ENSG00000159086	ENST00000331923;ENST00000290178	.	.	.	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	-18.4726	20.2672	0.98462	0.0:0.0:1.0:0.0	.	.	.	.	X	325	.	ENSP00000290178:Q325X	Q	-	1	0	GCFC1	33055243	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.320000	0.96346	2.894000	0.99253	0.591000	0.81541	CAG	GCFC1	-	NULL	ENSG00000159086		0.333	PAXBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GCFC1	HGNC	protein_coding	OTTHUMT00000139563.1	32	0.00	0	G	NM_013329		34133372	34133372	-1	no_errors	ENST00000331923	ensembl	human	known	69_37n	nonsense	42	10.64	5	SNP	1.000	A
GGCX	2677	genome.wustl.edu	37	2	85777092	85777092	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:85777092C>T	ENST00000233838.4	-	15	2322	c.2242G>A	c.(2242-2244)Gag>Aag	p.E748K	GGCX_ENST00000473665.1_5'Flank|GGCX_ENST00000430215.3_Missense_Mutation_p.E691K	NM_000821.5	NP_000812.2	P38435	VKGC_HUMAN	gamma-glutamyl carboxylase	748					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular protein modification process (GO:0006464)|peptidyl-glutamic acid carboxylation (GO:0017187)|post-translational protein modification (GO:0043687)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	gamma-glutamyl carboxylase activity (GO:0008488)			endometrium(3)|large_intestine(5)|lung(3)|ovary(1)|stomach(1)|urinary_tract(2)	15					Anisindione(DB01125)|Coagulation Factor IX(DB00100)|Coagulation factor VIIa(DB00036)|Drotrecogin alfa(DB00055)|Menadione(DB00170)|Phylloquinone(DB01022)	GGATTTGACTCAGGAGGATTA	0.502																																						dbGAP											0													72.0	70.0	71.0					2																	85777092		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1978.1, CCDS46353.1	2p12	2008-05-21			ENSG00000115486	ENSG00000115486			4247	protein-coding gene	gene with protein product	"""vitamin K-dependent gamma-carboxylase"""	137167				1749935	Standard	NM_000821		Approved	VKCFD1	uc002sps.3	P38435	OTTHUMG00000130173	ENST00000233838.4:c.2242G>A	2.37:g.85777092C>T	ENSP00000233838:p.Glu748Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DMC5|E9PEE1|Q14415|Q6GU45	Missense_Mutation	SNP	pfam_VKG_COase,superfamily_RmlC_Cupin,smart_HTTM	p.E748K	ENST00000233838.4	37	c.2242	CCDS1978.1	2	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885763	0.51908	.	.	ENSG00000115486	ENST00000233838;ENST00000430215	D;D	0.94330	-3.4;-3.32	6.07	5.19	0.71726	.	0.590539	0.18553	N	0.137880	D	0.90202	0.6937	L	0.47716	1.5	0.09310	N	0.999996	B;B;B	0.06786	0.001;0.001;0.001	B;B;B	0.06405	0.002;0.002;0.002	T	0.83314	-0.0021	10	0.66056	D	0.02	-14.9333	11.12	0.48284	0.0:0.9162:0.0:0.0838	.	691;564;748	E9PEE1;B4DQW4;P38435	.;.;VKGC_HUMAN	K	748;691	ENSP00000233838:E748K;ENSP00000408045:E691K	ENSP00000233838:E748K	E	-	1	0	GGCX	85630603	0.788000	0.28762	0.047000	0.18901	0.072000	0.16883	1.692000	0.37731	1.582000	0.49881	0.655000	0.94253	GAG	GGCX	-	NULL	ENSG00000115486		0.502	GGCX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GGCX	HGNC	protein_coding	OTTHUMT00000252490.3	36	0.00	0	C	NM_000821		85777092	85777092	-1	no_errors	ENST00000233838	ensembl	human	known	69_37n	missense	32	11.11	4	SNP	0.184	T
GK	2710	genome.wustl.edu	37	X	30742132	30742132	+	Intron	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:30742132G>A	ENST00000378943.3	+	18	1662				GK_ENST00000378945.3_Intron|RP11-242C19.2_ENST00000497961.1_RNA|GK-AS1_ENST00000464659.1_RNA|GK_ENST00000378946.3_Intron|GK_ENST00000427190.1_Intron	NM_001128127.2	NP_001121599.1	P32189	GLPK_HUMAN	glycerol kinase						cellular lipid metabolic process (GO:0044255)|glucose homeostasis (GO:0042593)|glycerol catabolic process (GO:0019563)|glycerol metabolic process (GO:0006071)|glycerol-3-phosphate biosynthetic process (GO:0046167)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|triglyceride metabolic process (GO:0006641)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|nucleus (GO:0005634)	ATP binding (GO:0005524)|glycerol kinase activity (GO:0004370)			central_nervous_system(1)|large_intestine(3)	4						AATTTGTCAAGAATGTTGAGT	0.378																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			X78711	CCDS14225.1, CCDS35224.1, CCDS48090.1, CCDS75963.1	Xp21.3	2014-09-17			ENSG00000198814	ENSG00000198814	2.7.1.30	"""Glycerol kinases"""	4289	protein-coding gene	gene with protein product		300474				7987308	Standard	NM_203391		Approved	GK1, GKD	uc022buj.1	P32189	OTTHUMG00000021328	ENST00000378943.3:c.1484-86G>A	X.37:g.30742132G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NJP5|B2R833|Q6IQ27|Q8IVR5|Q9UMP0|Q9UMP1	RNA	SNP	-	NULL	ENST00000378943.3	37	NULL	CCDS48090.1	X																																																																																			GK-AS1	-	-	ENSG00000243055		0.378	GK-004	KNOWN	basic|appris_principal|CCDS	protein_coding	GK-AS1	HGNC	protein_coding	OTTHUMT00000056170.1	26	0.00	0	G	NM_000167		30742132	30742132	-1	no_errors	ENST00000464659	ensembl	human	putative	69_37n	rna	36	12.20	5	SNP	0.000	A
GJB1	2705	genome.wustl.edu	37	X	70444262	70444262	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:70444262C>T	ENST00000374022.3	+	2	800	c.705C>T	c.(703-705)ttC>ttT	p.F235F	GJB1_ENST00000374029.1_Silent_p.F235F|GJB1_ENST00000361726.6_Silent_p.F235F	NM_001097642.2	NP_001091111.1	P08034	CXB1_HUMAN	gap junction protein, beta 1, 32kDa	235			F -> C (in CMTX1; the mutation causes abnormal hemichannel opening with excessive permeability of the plasma membrane and decreased cell survival; dbSNP:rs104894825). {ECO:0000269|PubMed:15852376, ECO:0000269|PubMed:9361298}.		cell death (GO:0008219)|cell-cell signaling (GO:0007267)|gap junction assembly (GO:0016264)|membrane organization (GO:0061024)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)|purine ribonucleotide transport (GO:0015868)|transport (GO:0006810)	connexon complex (GO:0005922)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	gap junction channel activity (GO:0005243)			breast(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(1)	10	Renal(35;0.156)					GCTCGGGCTTCGGCCACCGCC	0.617																																						dbGAP											0													22.0	18.0	19.0					X																	70444262		2203	4298	6501	-	-	-	SO:0001819	synonymous_variant	0			X04325	CCDS14408.1	Xq13.1	2014-09-17	2007-01-16		ENSG00000169562	ENSG00000169562		"""Ion channels / Gap junction proteins (connexins)"""	4283	protein-coding gene	gene with protein product	"""Charcot-Marie-Tooth neuropathy, X-linked"", ""connexin 32"""	304040	"""gap junction protein, beta 1, 32kD (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32, Charcot-Marie-Tooth neuropathy, X-linked)"", ""gap junction protein, beta 1, 32kDa (connexin 32)"""	CMTX1, CMTX		1319395	Standard	NM_000166		Approved	CX32	uc004dzf.3	P08034	OTTHUMG00000021797	ENST00000374022.3:c.705C>T	X.37:g.70444262C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8R2|D3DVV2|Q5U0S4	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin32	p.F235	ENST00000374022.3	37	c.705	CCDS14408.1	X																																																																																			GJB1	-	NULL	ENSG00000169562		0.617	GJB1-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GJB1	HGNC	protein_coding	OTTHUMT00000057133.1	112	0.00	0	C	NM_000166		70444262	70444262	+1	no_errors	ENST00000361726	ensembl	human	known	69_37n	silent	117	15.83	22	SNP	0.000	T
GNAS	2778	genome.wustl.edu	37	20	57428833	57428833	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:57428833G>C	ENST00000371100.4	+	1	1065	c.513G>C	c.(511-513)caG>caC	p.Q171H	GNAS_ENST00000371075.3_Intron|GNAS_ENST00000306120.3_Missense_Mutation_p.R108T|GNAS-AS1_ENST00000424094.2_RNA|GNAS_ENST00000464624.2_3'UTR|GNAS_ENST00000313949.7_Intron|GNAS_ENST00000371099.2_Missense_Mutation_p.Q171H|GNAS_ENST00000371102.4_Missense_Mutation_p.Q171H|GNAS_ENST00000371098.2_Intron|GNAS-AS1_ENST00000598163.1_RNA	NM_001077490.1|NM_080425.2	NP_001070958.1|NP_536350.2	P63092	GNAS2_HUMAN	GNAS complex locus	0					activation of adenylate cyclase activity (GO:0007190)|adenylate cyclase-activating adrenergic receptor signaling pathway (GO:0071880)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|bone development (GO:0060348)|cAMP biosynthetic process (GO:0006171)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|cognition (GO:0050890)|developmental growth (GO:0048589)|energy reserve metabolic process (GO:0006112)|hair follicle placode formation (GO:0060789)|intracellular transport (GO:0046907)|platelet aggregation (GO:0070527)|positive regulation of cAMP biosynthetic process (GO:0030819)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of Ras GTPase activity (GO:0032320)|regulation of insulin secretion (GO:0050796)|sensory perception of smell (GO:0007608)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intrinsic component of membrane (GO:0031224)|membrane (GO:0016020)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)	adenylate cyclase activity (GO:0004016)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)			adrenal_gland(12)|autonomic_ganglia(1)|biliary_tract(5)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(37)|liver(9)|lung(9)|ovary(16)|pancreas(56)|parathyroid(5)|pituitary(228)|prostate(2)|small_intestine(1)|stomach(1)|testis(2)|thyroid(35)|upper_aerodigestive_tract(3)|urinary_tract(1)	441	all_lung(29;0.0104)		BRCA - Breast invasive adenocarcinoma(13;2.19e-08)|Colorectal(105;0.109)			AGCCTGCCCAGAGAGGCTGCA	0.632			Mis		pituitary adenoma		"""McCune-Albright syndrome; pseudohypoparathyroidism, type IA"""			TSP Lung(22;0.16)																											Colon(117;935 1597 6045 8307 46442)	dbGAP		Dom	yes		20	20q13.2	2778	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	yes	E	0													25.0	29.0	28.0					20																	57428833		1944	4145	6089	-	-	-	SO:0001583	missense	0			M21142	CCDS13471.1, CCDS13472.1, CCDS42892.1, CCDS46622.1, CCDS46623.1, CCDS46624.1	20q13.2-q13.3	2010-03-01	2001-12-19	2001-12-20	ENSG00000087460	ENSG00000087460			4392	protein-coding gene	gene with protein product	"""secretogranin VI"""	139320	"""guanine nucleotide binding protein (G protein), alpha stimulating activity polypeptide 1"""	GNAS1			Standard	NM_000516		Approved	NESP55, NESP, GNASXL, GPSA, SCG6	uc002xzw.3	O95467	OTTHUMG00000033069	ENST00000371100.4:c.513G>C	20.37:g.57428833G>C	ENSP00000360141:p.Gln171His	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NI00|E1P5G5|P04895|Q12927|Q14433|Q32P26|Q5JWD2|Q5JWD4|Q5JWD5|Q6NR75|Q6NXS0|Q8TBC0|Q96H70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_S,prints_Gprotein_alpha_su	p.Q171H	ENST00000371100.4	37	c.513	CCDS46622.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	4.777|4.777	0.144453|0.144453	0.09134|0.09134	.|.	.|.	ENSG00000087460|ENSG00000087460	ENST00000371099;ENST00000371100;ENST00000371102|ENST00000306120	D;D|.	0.90844|.	-2.74;-2.73|.	4.99|4.99	1.69|1.69	0.24217|0.24217	.|.	.|.	.|.	.|.	.|.	T|T	0.40956|0.40956	0.1138|0.1138	L|L	0.57536|0.57536	1.79|1.79	0.25952|0.25952	N|N	0.982734|0.982734	B|.	0.14438|.	0.01|.	B|.	0.14023|.	0.01|.	T|T	0.31280|0.31280	-0.9949|-0.9949	9|6	0.49607|0.36615	T|T	0.09|0.2	.|.	5.0072|5.0072	0.14293|0.14293	0.1904:0.1717:0.6379:0.0|0.1904:0.1717:0.6379:0.0	.|.	171|.	Q5JWF2|.	GNAS1_HUMAN|.	H|T	171|108	ENSP00000360141:Q171H;ENSP00000360143:Q171H|.	ENSP00000360140:Q171H|ENSP00000302237:R108T	Q|R	+|+	3|2	2|0	GNAS|GNAS	56862228|56862228	0.979000|0.979000	0.34478|0.34478	0.084000|0.084000	0.20598|0.20598	0.015000|0.015000	0.08874|0.08874	2.252000|2.252000	0.43196|0.43196	0.764000|0.764000	0.33197|0.33197	-0.150000|-0.150000	0.13652|0.13652	CAG|AGA	GNAS	-	NULL	ENSG00000087460		0.632	GNAS-001	PUTATIVE	basic|CCDS	protein_coding	GNAS	HGNC	protein_coding	OTTHUMT00000080417.3	67	0.00	0	G	NM_000516		57428833	57428833	+1	no_errors	ENST00000371100	ensembl	human	putative	69_37n	missense	62	11.43	8	SNP	0.409	C
GNS	2799	genome.wustl.edu	37	12	65113890	65113890	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:65113890C>T	ENST00000258145.3	-	13	1662	c.1492G>A	c.(1492-1494)Gag>Aag	p.E498K	GNS_ENST00000543646.1_Missense_Mutation_p.E530K|GNS_ENST00000542058.1_Missense_Mutation_p.E478K|GNS_ENST00000418919.2_Missense_Mutation_p.E442K	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	498					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		CCTAAAAGCTCTGGGTCTATG	0.448																																						dbGAP											0													249.0	247.0	248.0					12																	65113890		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.1492G>A	12.37:g.65113890C>T	ENSP00000258145:p.Glu498Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DYH8|Q53F05	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	p.E498K	ENST00000258145.3	37	c.1492	CCDS8970.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.59|12.59	1.984099|1.984099	0.35036|0.35036	.|.	.|.	ENSG00000135677|ENSG00000135677	ENST00000418919;ENST00000258145;ENST00000543646;ENST00000542058;ENST00000539825|ENST00000540196	T;T;T;T|.	0.65732|.	-0.17;-0.17;-0.17;-0.17|.	5.39|5.39	5.39|5.39	0.77823|0.77823	Alkaline-phosphatase-like, core domain (1);|.	0.205093|.	0.50627|.	D|.	0.000101|.	T|T	0.70789|0.70789	0.3264|0.3264	L|L	0.52364|0.52364	1.645|1.645	0.58432|0.58432	D|D	0.999991|0.999991	B;P;B;B|.	0.34864|.	0.078;0.473;0.044;0.031|.	B;B;B;B|.	0.27887|.	0.013;0.084;0.013;0.01|.	T|T	0.66516|0.66516	-0.5904|-0.5904	9|5	.|.	.|.	.|.	-30.4134|-30.4134	19.5406|19.5406	0.95272|0.95272	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	478;530;498;442|.	B4DYH8;F6S8M0;P15586;Q7Z3X3|.	.;.;GNS_HUMAN;.|.	K|K	442;498;530;478;415|283	ENSP00000413130:E442K;ENSP00000258145:E498K;ENSP00000438497:E530K;ENSP00000444819:E478K|.	.|.	E|R	-|-	1|2	0|0	GNS|GNS	63400157|63400157	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.989000|0.989000	0.77384|0.77384	5.816000|5.816000	0.69222|0.69222	2.699000|2.699000	0.92147|0.92147	0.561000|0.561000	0.74099|0.74099	GAG|AGA	GNS	-	superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	ENSG00000135677		0.448	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	HGNC	protein_coding	OTTHUMT00000401195.2	63	0.00	0	C			65113890	65113890	-1	no_errors	ENST00000258145	ensembl	human	known	69_37n	missense	99	10.81	12	SNP	1.000	T
GPC2	221914	genome.wustl.edu	37	7	99771588	99771588	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:99771588C>G	ENST00000292377.2	-	5	929	c.762G>C	c.(760-762)ctG>ctC	p.L254L	GPC2_ENST00000471050.1_5'UTR	NM_152742.1	NP_689955.1	Q8N158	GPC2_HUMAN	glypican 2	254					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuron differentiation (GO:0030182)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|smoothened signaling pathway (GO:0007224)	anchored component of membrane (GO:0031225)|endoplasmic reticulum (GO:0005783)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(8)|pancreas(1)|skin(3)	18	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TGAGACGCATCAGAGCCTGGC	0.652																																						dbGAP											0													63.0	69.0	67.0					7																	99771588		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX375153	CCDS5689.1	7q22.1	2007-02-16	2007-02-15		ENSG00000213420	ENSG00000213420		"""Proteoglycans / Cell Surface : Glypicans"""	4450	protein-coding gene	gene with protein product	"""glypican proteoglycan 2, cerebroglycan proteoglycan"""		"""glypican 2 (cerebroglycan)"""			8294498	Standard	NM_152742		Approved	cerebroglycan, FLJ38962, DKFZp547M109	uc003utv.3	Q8N158	OTTHUMG00000154894	ENST00000292377.2:c.762G>C	7.37:g.99771588C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2A7	Silent	SNP	pfam_Glypican	p.L254	ENST00000292377.2	37	c.762	CCDS5689.1	7																																																																																			GPC2	-	pfam_Glypican	ENSG00000213420		0.652	GPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC2	HGNC	protein_coding	OTTHUMT00000337556.1	54	0.00	0	C	NM_152742		99771588	99771588	-1	no_errors	ENST00000292377	ensembl	human	known	69_37n	silent	81	11.96	11	SNP	0.997	G
GPD1	2819	genome.wustl.edu	37	12	50498439	50498439	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:50498439G>A	ENST00000301149.3	+	2	356	c.124G>A	c.(124-126)Gag>Aag	p.E42K	GPD1_ENST00000548814.1_Missense_Mutation_p.E42K|GPD1_ENST00000547190.1_3'UTR	NM_001257199.1|NM_005276.3	NP_001244128.1|NP_005267.2	P21695	GPDA_HUMAN	glycerol-3-phosphate dehydrogenase 1 (soluble)	42					cellular lipid metabolic process (GO:0044255)|cellular response to cAMP (GO:0071320)|cellular response to tumor necrosis factor (GO:0071356)|gluconeogenesis (GO:0006094)|glycerol-3-phosphate catabolic process (GO:0046168)|glycerophosphate shuttle (GO:0006127)|glycerophospholipid biosynthetic process (GO:0046474)|NADH oxidation (GO:0006116)|phosphatidic acid biosynthetic process (GO:0006654)|phospholipid metabolic process (GO:0006644)|positive regulation of glycolytic process (GO:0045821)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycerol-3-phosphate dehydrogenase complex (GO:0009331)|mitochondrion (GO:0005739)	glycerol-3-phosphate dehydrogenase [NAD+] activity (GO:0004367)|glycerol-3-phosphate dehydrogenase activity (GO:0004368)|NAD binding (GO:0051287)			breast(1)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	8						GTGGGTATTTGAGGAAGACAT	0.557																																					NSCLC(141;1402 1905 9497 13391 44868)	dbGAP											0													116.0	107.0	110.0					12																	50498439		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS8799.1, CCDS58229.1	12q13.12	2013-09-20			ENSG00000167588	ENSG00000167588	1.1.1.8		4455	protein-coding gene	gene with protein product		138420					Standard	NM_005276		Approved		uc001rvz.4	P21695	OTTHUMG00000169813	ENST00000301149.3:c.124G>A	12.37:g.50498439G>A	ENSP00000301149:p.Glu42Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W1L5|Q8N1B0	Missense_Mutation	SNP	pfam_G3P_DH_NAD-dep_N,pfam_G3P_DH_NAD-dep_C,superfamily_6-PGluconate_DH_C-like,pirsf_G3P_DH_NAD-dep,prints_G3P_DH_NAD-dep,tigrfam_G3P_DH_NAD-dep_euk	p.E42K	ENST00000301149.3	37	c.124	CCDS8799.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.828430	0.96996	.	.	ENSG00000167588	ENST00000301149;ENST00000547190;ENST00000548814	T;T	0.51817	0.69;0.69	5.7	5.7	0.88788	Glycerol-3-phosphate dehydrogenase, NAD-dependent, N-terminal (1);NAD(P)-binding domain (1);	0.000000	0.85682	D	0.000000	T	0.76564	0.4005	M	0.91196	3.185	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.998	D;D;D	0.71656	0.974;0.969;0.952	T	0.80491	-0.1359	10	0.66056	D	0.02	-11.7051	20.2274	0.98342	0.0:0.0:1.0:0.0	.	42;42;42	B4DJ37;F8W1L5;P21695	.;.;GPDA_HUMAN	K	42	ENSP00000301149:E42K;ENSP00000446768:E42K	ENSP00000301149:E42K	E	+	1	0	GPD1	48784706	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.698000	0.74608	2.868000	0.98415	0.555000	0.69702	GAG	GPD1	-	pfam_G3P_DH_NAD-dep_N,pirsf_G3P_DH_NAD-dep,tigrfam_G3P_DH_NAD-dep_euk	ENSG00000167588		0.557	GPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPD1	HGNC	protein_coding	OTTHUMT00000406018.1	25	0.00	0	G			50498439	50498439	+1	no_errors	ENST00000301149	ensembl	human	known	69_37n	missense	31	11.43	4	SNP	1.000	A
GPR108	56927	genome.wustl.edu	37	19	6732543	6732543	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:6732543G>C	ENST00000264080.7	-	11	977	c.951C>G	c.(949-951)atC>atG	p.I317M	GPR108_ENST00000430424.4_Missense_Mutation_p.I75M|GPR108_ENST00000598626.1_5'Flank	NM_001080452.1	NP_001073921.1	Q9NPR9	GP108_HUMAN	G protein-coupled receptor 108	317						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|large_intestine(4)|lung(4)|skin(1)|urinary_tract(1)	13						CCTGGCTGTTGATGAAGTAGT	0.612																																						dbGAP											0													69.0	71.0	70.0					19																	6732543		2123	4218	6341	-	-	-	SO:0001583	missense	0				CCDS42479.1	19p13.3	2014-01-30				ENSG00000125734		"""GPCR / Unclassified : 7TM orphan receptors"""	17829	protein-coding gene	gene with protein product							Standard	NM_001080452		Approved	LUSTR2	uc002mfp.3	Q9NPR9	OTTHUMG00000170129	ENST00000264080.7:c.951C>G	19.37:g.6732543G>C	ENSP00000264080:p.Ile317Met	Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJD7	Missense_Mutation	SNP	pfam_TM_rcpt_euk	p.I317M	ENST00000264080.7	37	c.951	CCDS42479.1	19	.	.	.	.	.	.	.	.	.	.	G	18.39	3.614538	0.66672	.	.	ENSG00000125734	ENST00000264080;ENST00000430424	T	0.31769	1.48	4.02	4.02	0.46733	.	0.000000	0.64402	U	0.000010	T	0.55321	0.1913	M	0.80847	2.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.61222	-0.7106	10	0.87932	D	0	-7.7764	11.8473	0.52391	0.0:0.0:1.0:0.0	.	317	Q9NPR9	GP108_HUMAN	M	317;75	ENSP00000264080:I317M	ENSP00000264080:I317M	I	-	3	3	GPR108	6683543	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	2.160000	0.42348	2.228000	0.72767	0.491000	0.48974	ATC	GPR108	-	pfam_TM_rcpt_euk	ENSG00000125734		0.612	GPR108-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR108	HGNC	protein_coding	OTTHUMT00000407508.2	75	0.00	0	G			6732543	6732543	-1	no_errors	ENST00000264080	ensembl	human	known	69_37n	missense	98	10.91	12	SNP	1.000	C
GPR179	440435	genome.wustl.edu	37	17	36485104	36485104	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:36485104C>T	ENST00000342292.4	-	11	4368	c.4348G>A	c.(4348-4350)Gag>Aag	p.E1450K	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1450					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CCTGAACACTCTGAGCTTCCT	0.552																																						dbGAP											0													97.0	100.0	99.0					17																	36485104		1975	4164	6139	-	-	-	SO:0001583	missense	0				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.4348G>A	17.37:g.36485104C>T	ENSP00000345060:p.Glu1450Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.E1450K	ENST00000342292.4	37	c.4348	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	C	2.872	-0.233865	0.05983	.	.	ENSG00000188888	ENST00000342292	T	0.49432	0.78	4.34	3.35	0.38373	.	0.635768	0.13668	N	0.371074	T	0.31765	0.0807	L	0.39898	1.24	0.09310	N	1	B	0.18741	0.03	B	0.15870	0.014	T	0.27739	-1.0065	10	0.08179	T	0.78	-1.1955	5.9011	0.18967	0.0:0.6983:0.198:0.1038	.	1450	Q6PRD1	GP179_HUMAN	K	1450	ENSP00000345060:E1450K	ENSP00000345060:E1450K	E	-	1	0	GPR179	33738630	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-0.407000	0.07178	1.027000	0.39758	0.455000	0.32223	GAG	GPR179	-	NULL	ENSG00000188888		0.552	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	46	0.00	0	C			36485104	36485104	-1	no_errors	ENST00000342292	ensembl	human	known	69_37n	missense	46	14.81	8	SNP	0.004	T
GRHPR	9380	genome.wustl.edu	37	9	37429743	37429743	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:37429743C>T	ENST00000318158.6	+	6	593	c.508C>T	c.(508-510)Cgg>Tgg	p.R170W	GRHPR_ENST00000607784.1_Missense_Mutation_p.R170W	NM_012203.1	NP_036335.1	Q9UBQ7	GRHPR_HUMAN	glyoxylate reductase/hydroxypyruvate reductase	170			R -> Q (in dbSNP:rs12002324).		cellular nitrogen compound metabolic process (GO:0034641)|dicarboxylic acid metabolic process (GO:0043648)|excretion (GO:0007588)|glyoxylate metabolic process (GO:0046487)|metabolic process (GO:0008152)|oxidation-reduction process (GO:0055114)|protein oligomerization (GO:0051259)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|peroxisomal matrix (GO:0005782)	carboxylic acid binding (GO:0031406)|glycerate dehydrogenase activity (GO:0008465)|glyoxylate reductase (NADP) activity (GO:0030267)|hydroxypyruvate reductase activity (GO:0016618)|NAD binding (GO:0051287)|NADPH binding (GO:0070402)|protein homodimerization activity (GO:0042803)			endometrium(2)|kidney(1)|large_intestine(1)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	12				GBM - Glioblastoma multiforme(29;0.00687)		GGCCATTGCTCGGCGTCTGAA	0.577																																						dbGAP											0													105.0	100.0	102.0					9																	37429743		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF134895	CCDS6609.1	9q12	2012-07-13			ENSG00000137106	ENSG00000137106	1.1.1.79, 1.1.1.81		4570	protein-coding gene	gene with protein product	"""primary hyperoxaluria type 2"""	604296		GLXR		10524214, 10484776	Standard	XM_005251631		Approved	PH2	uc003zzu.1	Q9UBQ7	OTTHUMG00000019914	ENST00000318158.6:c.508C>T	9.37:g.37429743C>T	ENSP00000313432:p.Arg170Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T945|Q9H3E9|Q9H636|Q9UKX1	Missense_Mutation	SNP	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_NADP-bd,pfam_NADP_OxRdtase_F420	p.R170W	ENST00000318158.6	37	c.508	CCDS6609.1	9	.	.	.	.	.	.	.	.	.	.	C	23.0	4.365612	0.82463	.	.	ENSG00000137106	ENST00000377824;ENST00000318158;ENST00000438860	D;D	0.81739	-1.53;-1.53	5.44	4.49	0.54785	D-isomer specific 2-hydroxyacid dehydrogenase, NAD-binding (1);D-isomer specific 2-hydroxyacid dehydrogenase, catalytic domain (1);NAD(P)-binding domain (1);	0.281459	0.39759	N	0.001265	D	0.91341	0.7269	M	0.91612	3.225	0.58432	D	0.999998	D;D;D;D	0.89917	1.0;1.0;1.0;0.994	D;D;D;P	0.78314	0.975;0.923;0.991;0.78	D	0.93137	0.6538	10	0.87932	D	0	-0.2497	15.6662	0.77230	0.0:0.8628:0.1371:0.0	.	170;183;27;170	Q5T946;Q5M7Z5;Q9H636;Q9UBQ7	.;.;.;GRHPR_HUMAN	W	170;170;27	ENSP00000367055:R170W;ENSP00000313432:R170W	ENSP00000313432:R170W	R	+	1	2	GRHPR	37419743	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	1.903000	0.39858	2.560000	0.86352	0.655000	0.94253	CGG	GRHPR	-	pfam_D-isomer_2_OHA_DH_NAD-bd,pfam_D-isomer_2_OHA_DH_cat_dom,pfam_6PGDH_NADP-bd,pfam_NADP_OxRdtase_F420	ENSG00000137106		0.577	GRHPR-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRHPR	HGNC	protein_coding	OTTHUMT00000052442.1	45	0.00	0	C	NM_012203		37429743	37429743	+1	no_errors	ENST00000377824	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	0.997	T
GRIN2A	2903	genome.wustl.edu	37	16	10273974	10273974	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:10273974C>T	ENST00000396573.2	-	3	604	c.295G>A	c.(295-297)Gtg>Atg	p.V99M	GRIN2A_ENST00000562109.1_Missense_Mutation_p.V99M|GRIN2A_ENST00000404927.2_Missense_Mutation_p.V99M|GRIN2A_ENST00000330684.3_Missense_Mutation_p.V99M|GRIN2A_ENST00000396575.2_Missense_Mutation_p.V99M	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	99					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)			NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	TCCCCAAACACGAGGCCGTGG	0.617																																						dbGAP											0													95.0	91.0	92.0					16																	10273974		2197	4300	6497	-	-	-	SO:0001583	missense	0				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.295G>A	16.37:g.10273974C>T	ENSP00000379818:p.Val99Met	Somatic		WXS	Illumina GAIIx	Phase_IV	O00669|Q17RZ6	Missense_Mutation	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.V99M	ENST00000396573.2	37	c.295	CCDS10539.1	16	.	.	.	.	.	.	.	.	.	.	C	22.1	4.243819	0.79912	.	.	ENSG00000183454	ENST00000396573;ENST00000404927;ENST00000330684;ENST00000396575	D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28	4.54	4.54	0.55810	.	0.000000	0.64402	D	0.000001	D	0.93739	0.7999	M	0.86028	2.79	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.78314	0.991;0.991;0.971	D	0.94418	0.7638	9	.	.	.	.	16.2901	0.82747	0.0:1.0:0.0:0.0	.	99;99;99	Q547U9;Q17RZ6;Q12879	.;.;NMDE1_HUMAN	M	99	ENSP00000379818:V99M;ENSP00000385872:V99M;ENSP00000332549:V99M;ENSP00000379820:V99M	.	V	-	1	0	GRIN2A	10181475	1.000000	0.71417	0.993000	0.49108	0.995000	0.86356	4.748000	0.62148	2.088000	0.63022	0.561000	0.74099	GTG	GRIN2A	-	NULL	ENSG00000183454		0.617	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	73	0.00	0	C			10273974	10273974	-1	no_errors	ENST00000330684	ensembl	human	known	69_37n	missense	102	15.00	18	SNP	1.000	T
GTF3C4	9329	genome.wustl.edu	37	9	135553388	135553388	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:135553388G>C	ENST00000372146.4	+	2	946	c.382G>C	c.(382-384)Gag>Cag	p.E128Q	GTF3C4_ENST00000483873.2_Missense_Mutation_p.E128Q	NM_012204.2	NP_036336.2	Q9UKN8	TF3C4_HUMAN	general transcription factor IIIC, polypeptide 4, 90kDa	128					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|histone acetylation (GO:0016573)|positive regulation of catalytic activity (GO:0043085)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)|enzyme activator activity (GO:0008047)|histone acetyltransferase activity (GO:0004402)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|skin(1)	20				OV - Ovarian serous cystadenocarcinoma(145;8.15e-07)|Epithelial(140;2.6e-05)		AGAAGTTGCTGAGTGCAAGGA	0.423																																					Pancreas(142;417 1875 11086 31973 47667)	dbGAP											0													54.0	57.0	56.0					9																	135553388		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF142328	CCDS6953.1	9q34.3	2011-07-01	2002-08-29		ENSG00000125484	ENSG00000125484		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""General transcription factors"""	4667	protein-coding gene	gene with protein product		604892	"""general transcription factor IIIC, polypeptide 4 (90kD)"""			10523658	Standard	NM_012204		Approved	TFIIIC90, KAT12	uc010mzv.3	Q9UKN8	OTTHUMG00000020842	ENST00000372146.4:c.382G>C	9.37:g.135553388G>C	ENSP00000361219:p.Glu128Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZJ7	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.E128Q	ENST00000372146.4	37	c.382	CCDS6953.1	9	.	.	.	.	.	.	.	.	.	.	G	14.76	2.631702	0.46944	.	.	ENSG00000125484	ENST00000372146	T	0.46451	0.87	5.55	4.65	0.58169	Transcription factor IIIC, 90kDa subunit, N-terminal (1);	0.109041	0.64402	N	0.000010	T	0.28830	0.0715	N	0.14661	0.345	0.41617	D	0.988949	B	0.21225	0.053	B	0.23018	0.043	T	0.04976	-1.0914	10	0.35671	T	0.21	-26.2883	15.1367	0.72572	0.0:0.1422:0.8578:0.0	.	128	Q9UKN8	TF3C4_HUMAN	Q	128	ENSP00000361219:E128Q	ENSP00000361219:E128Q	E	+	1	0	GTF3C4	134543209	1.000000	0.71417	0.995000	0.50966	0.973000	0.67179	3.556000	0.53734	1.328000	0.45358	0.561000	0.74099	GAG	GTF3C4	-	NULL	ENSG00000125484		0.423	GTF3C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C4	HGNC	protein_coding	OTTHUMT00000054792.1	47	0.00	0	G			135553388	135553388	+1	no_errors	ENST00000372146	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	1.000	C
GYS1	2997	genome.wustl.edu	37	19	49494595	49494595	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:49494595C>T	ENST00000323798.3	-	2	460	c.264G>A	c.(262-264)aaG>aaA	p.K88K	GYS1_ENST00000544287.1_Intron|RUVBL2_ENST00000413176.2_5'Flank|RUVBL2_ENST00000601968.1_5'Flank|GYS1_ENST00000540532.1_Intron|GYS1_ENST00000541188.1_Intron|GYS1_ENST00000263276.6_Silent_p.K88K|RUVBL2_ENST00000595090.1_5'Flank|GYS1_ENST00000457974.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	88					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CCAGTGTCCTCTTCAGGGCCG	0.667																																						dbGAP											0													76.0	82.0	80.0					19																	49494595		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.264G>A	19.37:g.49494595C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTT9	Silent	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.K88	ENST00000323798.3	37	c.264	CCDS12747.1	19																																																																																			GYS1	-	pfam_Glycogen_synth	ENSG00000104812		0.667	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1	53	0.00	0	C	NM_002103		49494595	49494595	-1	no_errors	ENST00000323798	ensembl	human	known	69_37n	silent	83	17.82	18	SNP	1.000	T
GYS1	2997	genome.wustl.edu	37	19	49494640	49494640	+	Silent	SNP	C	C	T	rs1042152		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:49494640C>T	ENST00000323798.3	-	2	415	c.219G>A	c.(217-219)gtG>gtA	p.V73V	GYS1_ENST00000544287.1_Intron|RUVBL2_ENST00000413176.2_5'Flank|RUVBL2_ENST00000601968.1_5'Flank|GYS1_ENST00000540532.1_Intron|GYS1_ENST00000541188.1_Intron|GYS1_ENST00000263276.6_Silent_p.V73V|RUVBL2_ENST00000595090.1_5'Flank|GYS1_ENST00000457974.1_5'UTR	NM_002103.4	NP_002094.2	P13807	GYS1_HUMAN	glycogen synthase 1 (muscle)	73					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|heart development (GO:0007507)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|inclusion body (GO:0016234)|membrane (GO:0016020)	glucose binding (GO:0005536)|glycogen (starch) synthase activity (GO:0004373)|glycogen synthase activity, transferring glucose-1-phosphate (GO:0061547)|protein kinase binding (GO:0019901)			breast(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(5)|ovary(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000164)|all cancers(93;0.000226)|GBM - Glioblastoma multiforme(486;0.00561)|Epithelial(262;0.0286)		CCTGGGTCCTCACGCCCTGCT	0.647																																						dbGAP											0													113.0	123.0	119.0					19																	49494640		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS12747.1, CCDS54292.1	19q13.3	2013-02-22			ENSG00000104812	ENSG00000104812	2.4.1.11	"""Glycosyltransferase group 1 domain containing"""	4706	protein-coding gene	gene with protein product		138570		GYS			Standard	NM_002103		Approved	GSY	uc002plp.3	P13807	OTTHUMG00000150723	ENST00000323798.3:c.219G>A	19.37:g.49494640C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BTT9	Silent	SNP	pfam_Glycogen_synth,pfam_Glyco_trans_1,pfam_Starch_synth_cat_dom	p.V73	ENST00000323798.3	37	c.219	CCDS12747.1	19																																																																																			GYS1	-	pfam_Glycogen_synth	ENSG00000104812		0.647	GYS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GYS1	HGNC	protein_coding	OTTHUMT00000319791.1	63	0.00	0	C	NM_002103		49494640	49494640	-1	no_errors	ENST00000323798	ensembl	human	known	69_37n	silent	77	16.30	15	SNP	1.000	T
HAGHL	84264	genome.wustl.edu	37	16	777579	777579	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:777579G>C	ENST00000341413.4	+	2	351	c.70G>C	c.(70-72)Gag>Cag	p.E24Q	HAGHL_ENST00000549114.1_Missense_Mutation_p.E24Q|NARFL_ENST00000562862.1_5'Flank|HAGHL_ENST00000561546.1_Missense_Mutation_p.E24Q|HAGHL_ENST00000389703.3_Missense_Mutation_p.E24Q|HAGHL_ENST00000564545.1_Missense_Mutation_p.E24Q|HAGHL_ENST00000564537.1_Missense_Mutation_p.E24Q|CCDC78_ENST00000293889.6_5'Flank			Q6PII5	HAGHL_HUMAN	hydroxyacylglutathione hydrolase-like	24							hydrolase activity (GO:0016787)|metal ion binding (GO:0046872)	p.E24K(1)		lung(3)	3		Hepatocellular(780;0.00335)				GCTCACGCGCGAGGCGGTGGC	0.701																																					Pancreas(46;538 1326 12403 32360)	dbGAP											1	Substitution - Missense(1)	lung(1)											58.0	43.0	48.0					16																	777579		2186	4296	6482	-	-	-	SO:0001583	missense	0			AK054841	CCDS32354.1	16p13.3	2008-02-05	2003-11-04						14177	protein-coding gene	gene with protein product			"""hydroxyacyl glutathione hydrolase-like"""			12477932	Standard	XM_005255629		Approved	MGC2605	uc002cjo.1	Q6PII5		ENST00000341413.4:c.70G>C	16.37:g.777579G>C	ENSP00000341952:p.Glu24Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCC4|D3DU64|Q59FX8|Q96BZ3|Q96NR5|Q96S11|Q9BT45	Missense_Mutation	SNP	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	p.E24Q	ENST00000341413.4	37	c.70		16	.	.	.	.	.	.	.	.	.	.	G	12.87	2.066272	0.36470	.	.	ENSG00000103253	ENST00000549114;ENST00000341413;ENST00000389701;ENST00000389703	T;T;T	0.81078	-1.45;-1.45;-1.45	3.19	2.22	0.28083	Beta-lactamase-like (2);	0.359397	0.25543	N	0.029954	T	0.63486	0.2515	L	0.31752	0.955	0.20821	N	0.999841	B;P;P;B	0.41131	0.299;0.739;0.525;0.449	B;B;B;B	0.32022	0.139;0.086;0.069;0.082	T	0.54589	-0.8271	10	0.37606	T	0.19	-20.4216	8.9499	0.35783	0.1149:0.0:0.8851:0.0	.	24;24;24;24	B4DED4;Q6PII5-2;Q6PII5-3;Q6PII5	.;.;.;HAGHL_HUMAN	Q	24	ENSP00000447170:E24Q;ENSP00000341952:E24Q;ENSP00000374353:E24Q	ENSP00000341952:E24Q	E	+	1	0	HAGHL	717580	0.019000	0.18553	0.013000	0.15412	0.322000	0.28314	0.828000	0.27435	0.525000	0.28522	0.561000	0.74099	GAG	HAGHL	-	pfam_Beta-lactamas-like,smart_Beta-lactamas-like	ENSG00000103253		0.701	HAGHL-001	KNOWN	basic	protein_coding	HAGHL	HGNC	protein_coding	OTTHUMT00000409607.1	119	0.00	0	G	NM_032304		777579	777579	+1	no_errors	ENST00000341413	ensembl	human	known	69_37n	missense	138	16.36	27	SNP	0.326	C
HEATR6	63897	genome.wustl.edu	37	17	58156227	58156227	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:58156227C>T	ENST00000184956.6	-	1	65	c.49G>A	c.(49-51)Gag>Aag	p.E17K	HEATR6_ENST00000585976.1_Missense_Mutation_p.E17K|HEATR6_ENST00000585712.1_5'UTR|CTD-2319I12.2_ENST00000589740.1_lincRNA	NM_022070.4	NP_071353.4	Q6AI08	HEAT6_HUMAN	HEAT repeat containing 6	17							poly(A) RNA binding (GO:0044822)			NS(1)|breast(4)|endometrium(5)|kidney(2)|large_intestine(4)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	44	all_cancers(5;2.25e-13)|Breast(5;4.84e-25)|all_neural(34;0.0878)|Medulloblastoma(34;0.0922)		BRCA - Breast invasive adenocarcinoma(1;5.93e-19)|Epithelial(12;7.59e-12)|all cancers(12;1.26e-10)			CGCGGTGCCTCCCGCGGCTGC	0.662																																						dbGAP											0													22.0	20.0	21.0					17																	58156227		2202	4298	6500	-	-	-	SO:0001583	missense	0			BX640819	CCDS11623.1	17q23.2	2007-05-01				ENSG00000068097			24076	protein-coding gene	gene with protein product	"""amplified in breast cancer 1"""					12755490	Standard	NM_022070		Approved	ABC1, FLJ22087	uc002iyk.1	Q6AI08		ENST00000184956.6:c.49G>A	17.37:g.58156227C>T	ENSP00000184956:p.Glu17Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXP3|Q6MZX1|Q6MZY2|Q8TDM9|Q9H6B3|Q9H6M7	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E17K	ENST00000184956.6	37	c.49	CCDS11623.1	17	.	.	.	.	.	.	.	.	.	.	C	10.58	1.390659	0.25118	.	.	ENSG00000068097	ENST00000184956	T	0.41400	1.0	4.88	1.71	0.24356	.	1.074000	0.07077	N	0.836356	T	0.29914	0.0748	L	0.36672	1.1	0.09310	N	1	B	0.13594	0.008	B	0.14578	0.011	T	0.26326	-1.0106	10	0.33141	T	0.24	0.1786	2.9552	0.05874	0.1898:0.5296:0.1833:0.0973	.	17	Q6AI08	HEAT6_HUMAN	K	17	ENSP00000184956:E17K	ENSP00000184956:E17K	E	-	1	0	HEATR6	55511009	0.000000	0.05858	0.002000	0.10522	0.006000	0.05464	0.654000	0.24918	0.695000	0.31675	0.650000	0.86243	GAG	HEATR6	-	NULL	ENSG00000068097		0.662	HEATR6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEATR6	HGNC	protein_coding	OTTHUMT00000449165.1	47	0.00	0	C	NM_022070		58156227	58156227	-1	no_errors	ENST00000184956	ensembl	human	known	69_37n	missense	41	24.07	13	SNP	0.001	T
HENMT1	113802	genome.wustl.edu	37	1	109197412	109197412	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:109197412G>A	ENST00000370032.5	-	5	744	c.324C>T	c.(322-324)atC>atT	p.I108I	HENMT1_ENST00000402983.1_Silent_p.I108I|HENMT1_ENST00000370031.1_Silent_p.I108I|HENMT1_ENST00000493676.1_5'UTR	NM_144584.2	NP_653185.2	Q5T8I9	HENMT_HUMAN	HEN1 methyltransferase homolog 1 (Arabidopsis)	108					gene silencing by RNA (GO:0031047)|piRNA metabolic process (GO:0034587)|RNA methylation (GO:0001510)	P granule (GO:0043186)	metal ion binding (GO:0046872)|O-methyltransferase activity (GO:0008171)|RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|ovary(2)|prostate(1)|skin(2)|stomach(1)	16						GATACAATGTGATGGTCAAAT	0.378																																						dbGAP											0													85.0	78.0	81.0					1																	109197412		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS787.1	1p13.3	2011-01-28	2011-01-28	2011-01-28	ENSG00000162639	ENSG00000162639			26400	protein-coding gene	gene with protein product	"""HEN1 methyltransferase homolog (Arabidopsis)"""	612178	"""chromosome 1 open reading frame 59"""	C1orf59			Standard	NM_144584		Approved	FLJ30525, HEN1	uc001dvt.4	Q5T8I9	OTTHUMG00000011123	ENST00000370032.5:c.324C>T	1.37:g.109197412G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MRR6|B1AM16|B1AM17|Q96EJ7|Q96NN0	Silent	SNP	NULL	p.I108	ENST00000370032.5	37	c.324	CCDS787.1	1																																																																																			HENMT1	-	NULL	ENSG00000162639		0.378	HENMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HENMT1	HGNC	protein_coding	OTTHUMT00000030592.1	34	0.00	0	G	NM_144584		109197412	109197412	-1	no_errors	ENST00000370031	ensembl	human	known	69_37n	silent	31	22.50	9	SNP	0.001	A
HIF1A	3091	genome.wustl.edu	37	14	62162435	62162435	+	5'UTR	SNP	C	C	T	rs11549466	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:62162435C>T	ENST00000337138.4	+	0	178				HIF1A_ENST00000394997.1_5'UTR|HIF1A_ENST00000323441.6_5'Flank|HIF1A-AS1_ENST00000557544.1_lincRNA|HIF1A_ENST00000557538.1_5'Flank|HIF1A_ENST00000539097.1_5'Flank	NM_001530.3	NP_001521.1	Q16665	HIF1A_HUMAN	hypoxia inducible factor 1, alpha subunit (basic helix-loop-helix transcription factor)						angiogenesis (GO:0001525)|axon transport of mitochondrion (GO:0019896)|B-1 B cell homeostasis (GO:0001922)|cardiac ventricle morphogenesis (GO:0003208)|cartilage development (GO:0051216)|cellular iron ion homeostasis (GO:0006879)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cerebral cortex development (GO:0021987)|collagen metabolic process (GO:0032963)|connective tissue replacement involved in inflammatory response wound healing (GO:0002248)|digestive tract morphogenesis (GO:0048546)|dopaminergic neuron differentiation (GO:0071542)|elastin metabolic process (GO:0051541)|embryonic hemopoiesis (GO:0035162)|embryonic placenta development (GO:0001892)|epithelial cell differentiation involved in mammary gland alveolus development (GO:0061030)|epithelial to mesenchymal transition (GO:0001837)|glucose homeostasis (GO:0042593)|heart looping (GO:0001947)|hemoglobin biosynthetic process (GO:0042541)|intestinal epithelial cell maturation (GO:0060574)|lactate metabolic process (GO:0006089)|lactation (GO:0007595)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of bone mineralization (GO:0030502)|negative regulation of growth (GO:0045926)|negative regulation of mesenchymal cell apoptotic process (GO:2001054)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903377)|negative regulation of thymocyte apoptotic process (GO:0070244)|negative regulation of TOR signaling (GO:0032007)|neural crest cell migration (GO:0001755)|neural fold elevation formation (GO:0021502)|Notch signaling pathway (GO:0007219)|outflow tract morphogenesis (GO:0003151)|oxygen homeostasis (GO:0032364)|positive regulation of angiogenesis (GO:0045766)|positive regulation of chemokine production (GO:0032722)|positive regulation of chemokine-mediated signaling pathway (GO:0070101)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of glycolytic process (GO:0045821)|positive regulation of hormone biosynthetic process (GO:0046886)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of nitric-oxide synthase activity (GO:0051000)|positive regulation of receptor biosynthetic process (GO:0010870)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061419)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|positive regulation vascular endothelial growth factor production (GO:0010575)|regulation of gene expression (GO:0010468)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|regulation of transcription, DNA-templated (GO:0006355)|regulation of transforming growth factor beta2 production (GO:0032909)|response to hypoxia (GO:0001666)|response to muscle activity (GO:0014850)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|vascular endothelial growth factor production (GO:0010573)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|motile cilium (GO:0031514)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|Hsp90 protein binding (GO:0051879)|nuclear hormone receptor binding (GO:0035257)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|endometrium(8)|kidney(6)|large_intestine(3)|lung(4)	23				OV - Ovarian serous cystadenocarcinoma(108;1.62e-09)|BRCA - Breast invasive adenocarcinoma(234;0.189)	Carvedilol(DB01136)	CTTTCCTTCTCTTCTCCGCGT	0.701																																						dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U22431	CCDS9753.1, CCDS9754.1, CCDS58324.1	14q23.2	2013-05-21	2008-12-02		ENSG00000100644	ENSG00000100644		"""Basic helix-loop-helix proteins"""	4910	protein-coding gene	gene with protein product		603348				8786149, 9079689	Standard	NM_001530		Approved	MOP1, HIF-1alpha, PASD8, HIF1, bHLHe78	uc001xfq.2	Q16665	OTTHUMG00000140344	ENST00000337138.4:c.-88C>T	14.37:g.62162435C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C0LZJ3|Q53XP6|Q96PT9|Q9UPB1	RNA	SNP	-	NULL	ENST00000337138.4	37	NULL	CCDS9753.1	14																																																																																			HIF1A	-	-	ENSG00000100644		0.701	HIF1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	HIF1A	HGNC	protein_coding	OTTHUMT00000276977.2	25	0.00	0	C	NM_001530		62162435	62162435	+1	no_errors	ENST00000553999	ensembl	human	known	69_37n	rna	48	12.73	7	SNP	0.082	T
HIST1H3B	8358	genome.wustl.edu	37	6	26032115	26032115	+	Silent	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:26032115C>A	ENST00000244661.2	-	1	173	c.174G>T	c.(172-174)tcG>tcT	p.S58S		NM_003537.3	NP_003528.1	P68431	H31_HUMAN	histone cluster 1, H3b	58					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			breast(3)|central_nervous_system(10)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)|ovary(2)|skin(1)	25						GCAACTCGGTCGACTTTTGGT	0.627																																						dbGAP											0													64.0	75.0	71.0					6																	26032115		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X00090	CCDS4573.1	6p22.1	2011-01-27	2006-10-11	2003-03-14	ENSG00000124693	ENSG00000274267		"""Histones / Replication-dependent"""	4776	protein-coding gene	gene with protein product		602819	"""H3 histone family, member L"", ""histone 1, H3b"""	H3FL		6647026, 9119399, 12408966	Standard	NM_003537		Approved	H3/l	uc003nfs.1	P68431	OTTHUMG00000014415	ENST00000244661.2:c.174G>T	6.37:g.26032115C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Silent	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.S58	ENST00000244661.2	37	c.174	CCDS4573.1	6																																																																																			HIST1H3B	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	ENSG00000124693		0.627	HIST1H3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3B	HGNC	protein_coding	OTTHUMT00000040077.1	75	0.00	0	C	NM_003537		26032115	26032115	-1	no_errors	ENST00000244661	ensembl	human	known	69_37n	silent	87	17.92	19	SNP	1.000	A
HIST1H2BG	8339	genome.wustl.edu	37	6	26216590	26216590	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:26216590C>T	ENST00000244601.3	-	1	282	c.282G>A	c.(280-282)gaG>gaA	p.E94E	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	94					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				CGGTCTGGATCTCCCTGGAGG	0.562																																						dbGAP											0													95.0	95.0	95.0					6																	26216590		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.282G>A	6.37:g.26216590C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Silent	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.E94	ENST00000244601.3	37	c.282	CCDS4594.1	6																																																																																			HIST1H2BG	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	ENSG00000187990		0.562	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BG	HGNC	protein_coding	OTTHUMT00000040109.2	78	0.00	0	C	NM_003518		26216590	26216590	-1	no_errors	ENST00000244601	ensembl	human	known	69_37n	silent	110	14.73	19	SNP	1.000	T
HIST1H2AK	8330	genome.wustl.edu	37	6	27806056	27806056	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:27806056C>T	ENST00000330180.2	-	1	61	c.62G>A	c.(61-63)aGg>aAg	p.R21K	HIST1H2BN_ENST00000606613.1_5'Flank|HIST1H2BN_ENST00000396980.3_5'Flank	NM_003510.2	NP_003501.1	P0C0S8	H2A1_HUMAN	histone cluster 1, H2ak	21						extracellular vesicular exosome (GO:0070062)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)|enzyme binding (GO:0019899)			breast(2)|endometrium(2)|kidney(1)|lung(3)|upper_aerodigestive_tract(2)	10						AAGACCCGCCCTTGAAGAACG	0.617																																						dbGAP											0													44.0	45.0	44.0					6																	27806056		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z83739	CCDS4632.1	6p22.1	2011-01-27	2006-10-11	2003-02-28	ENSG00000184348	ENSG00000275221		"""Histones / Replication-dependent"""	4726	protein-coding gene	gene with protein product		602788	"""H2A histone family, member D"", ""histone 1, H2ak"""	H2AFD		9439656, 12408966	Standard	NM_003510		Approved	H2A/d	uc003njs.3	P0C0S8	OTTHUMG00000016382	ENST00000330180.2:c.62G>A	6.37:g.27806056C>T	ENSP00000330307:p.Arg21Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P02261|Q2M1R2|Q76PA6	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	p.R21K	ENST00000330180.2	37	c.62	CCDS4632.1	6	.	.	.	.	.	.	.	.	.	.	.	9.744	1.165659	0.21538	.	.	ENSG00000184348	ENST00000330180	T	0.47869	0.83	4.53	3.64	0.41730	.	0.000000	0.28766	U	0.014216	T	0.31857	0.0810	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.07102	-1.0790	7	0.38643	T	0.18	.	11.7769	0.51991	0.0:0.9117:0.0:0.0883	.	.	.	.	K	21	ENSP00000330307:R21K	ENSP00000330307:R21K	R	-	2	0	HIST1H2AK	27914035	0.998000	0.40836	0.040000	0.18447	0.014000	0.08584	7.104000	0.77024	2.427000	0.82271	0.655000	0.94253	AGG	HIST1H2AK	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H2A,prints_Histone_H2A	ENSG00000184348		0.617	HIST1H2AK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2AK	HGNC	protein_coding	OTTHUMT00000043814.1	61	0.00	0	C	NM_003510		27806056	27806056	-1	no_errors	ENST00000330180	ensembl	human	known	69_37n	missense	74	10.84	9	SNP	0.339	T
ZNRD1-AS1	80862	genome.wustl.edu	37	6	29974674	29974674	+	RNA	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:29974674C>T	ENST00000376797.3	-	0	1346				ZNRD1-AS1_ENST00000448093.1_RNA|ZNRD1-AS1_ENST00000425604.1_RNA|ZNRD1-AS1_ENST00000420251.1_RNA|HLA-J_ENST00000462773.1_RNA			Q2KJ03	ZRAS1_HUMAN	ZNRD1 antisense RNA 1																		ACACGCAGTTCGTGCGGGTCG	0.662																																						dbGAP											0																																										-	-	-			0			AF032110		6p21.33	2014-08-14	2012-08-15	2010-11-25	ENSG00000204623	ENSG00000204623		"""Long non-coding RNAs"""	13924	non-coding RNA	RNA, long non-coding		615714	"""chromosome 6 open reading frame 12"", ""non-protein coding RNA 171"", ""ZNRD1 antisense RNA (non-protein coding)"", ""ZNRD1 antisense RNA 1 (non-protein coding)"""	C6orf12, NCRNA00171, ZNRD1AS, ZNRD1-AS		9553157, 11130983, 25110835	Standard	NR_026751		Approved	HTEX4, Em:AB023056.3	uc003rto.3	Q2KJ03	OTTHUMG00000031109		6.37:g.29974674C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000376797.3	37	NULL		6																																																																																			HLA-J	-	-	ENSG00000204622		0.662	ZNRD1-AS1-006	KNOWN	basic|exp_conf	antisense	HLA-J	HGNC	antisense	OTTHUMT00000253083.1	69	0.00	0	C	NR_026751		29974674	29974674	+1	no_errors	ENST00000462773	ensembl	human	known	69_37n	rna	114	12.98	17	SNP	0.996	T
HOXB2	3212	genome.wustl.edu	37	17	46620887	46620887	+	Missense_Mutation	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:46620887C>A	ENST00000330070.4	-	2	1781	c.614G>T	c.(613-615)cGa>cTa	p.R205L	HOXB-AS1_ENST00000504972.3_RNA|HOXB-AS1_ENST00000435312.1_RNA|HOXB2_ENST00000504772.3_5'Flank|HOXB-AS1_ENST00000508688.1_RNA	NM_002145.3	NP_002136.1	P14652	HXB2_HUMAN	homeobox B2	205					anterior/posterior pattern specification (GO:0009952)|blood circulation (GO:0008015)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|facial nerve structural organization (GO:0021612)|morphogenesis of an epithelial sheet (GO:0002011)|multicellular organismal development (GO:0007275)|neural nucleus development (GO:0048857)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	11						CGGCGGCTCTCGGTGCTGCGT	0.706																																						dbGAP											0													26.0	31.0	29.0					17																	46620887		2088	4091	6179	-	-	-	SO:0001583	missense	0				CCDS11527.1	17q21.32	2012-02-22	2005-12-22		ENSG00000173917	ENSG00000173917		"""Homeoboxes / ANTP class : HOXL subclass"""	5113	protein-coding gene	gene with protein product		142967	"""homeo box B2"""	HOX2, HOX2H		1973146, 1358459	Standard	XM_005257276		Approved		uc002inm.3	P14652	OTTHUMG00000159930	ENST00000330070.4:c.614G>T	17.37:g.46620887C>A	ENSP00000331741:p.Arg205Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	P10913|P17485	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,prints_Homeobox_metazoa,pfscan_Homeodomain	p.R205L	ENST00000330070.4	37	c.614	CCDS11527.1	17	.	.	.	.	.	.	.	.	.	.	C	21.0	4.087959	0.76642	.	.	ENSG00000173917	ENST00000330070;ENST00000326226	D	0.89552	-2.53	4.56	3.52	0.40303	Homeobox (1);Homeodomain-like (1);	0.153239	0.40908	D	0.000991	T	0.74898	0.3777	N	0.14661	0.345	0.49582	D	0.999809	B	0.33826	0.427	B	0.30943	0.122	T	0.74365	-0.3689	10	0.66056	D	0.02	.	3.9401	0.09323	0.0:0.675:0.0:0.325	.	205	P14652	HXB2_HUMAN	L	205;114	ENSP00000331741:R205L	ENSP00000316334:R114L	R	-	2	0	HOXB2	43975886	0.957000	0.32711	1.000000	0.80357	0.951000	0.60555	2.794000	0.47853	2.393000	0.81446	0.556000	0.70494	CGA	HOXB2	-	superfamily_Homeodomain-like,smart_Homeodomain	ENSG00000173917		0.706	HOXB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXB2	HGNC	protein_coding	OTTHUMT00000358384.2	39	0.00	0	C			46620887	46620887	-1	no_errors	ENST00000330070	ensembl	human	known	69_37n	missense	24	17.24	5	SNP	1.000	A
HSPA12A	259217	genome.wustl.edu	37	10	118435994	118435994	+	Missense_Mutation	SNP	A	A	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:118435994A>T	ENST00000369209.3	-	11	1410	c.1306T>A	c.(1306-1308)Tcc>Acc	p.S436T		NM_025015.2	NP_079291.2	O43301	HS12A_HUMAN	heat shock 70kDa protein 12A	436						extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(15)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	32				all cancers(201;0.0158)		CCCTGCGAGGACCACTTCACA	0.532																																						dbGAP											0													101.0	104.0	103.0					10																	118435994		2132	4255	6387	-	-	-	SO:0001583	missense	0			AB007877	CCDS41569.1	10q25.3	2011-09-02	2002-08-29		ENSG00000165868	ENSG00000165868		"""Heat shock proteins / HSP70"""	19022	protein-coding gene	gene with protein product		610701	"""heat shock 70kD protein 12A"""			12552099	Standard	NM_025015		Approved	FLJ13874, KIAA0417	uc001lct.3	O43301	OTTHUMG00000019107	ENST00000369209.3:c.1306T>A	10.37:g.118435994A>T	ENSP00000358211:p.Ser436Thr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.S436T	ENST00000369209.3	37	c.1306	CCDS41569.1	10	.	.	.	.	.	.	.	.	.	.	A	21.2	4.117994	0.77323	.	.	ENSG00000165868	ENST00000369209	T	0.45668	0.89	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.64327	0.2588	M	0.76170	2.325	0.80722	D	1	D	0.76494	0.999	D	0.78314	0.991	T	0.63107	-0.6711	10	0.34782	T	0.22	.	16.1778	0.81874	1.0:0.0:0.0:0.0	.	436	O43301	HS12A_HUMAN	T	436	ENSP00000358211:S436T	ENSP00000358211:S436T	S	-	1	0	HSPA12A	118425984	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	8.910000	0.92685	2.279000	0.76181	0.533000	0.62120	TCC	HSPA12A	-	NULL	ENSG00000165868		0.532	HSPA12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA12A	HGNC	protein_coding	OTTHUMT00000050530.1	39	0.00	0	A	NM_025015		118435994	118435994	-1	no_errors	ENST00000369209	ensembl	human	known	69_37n	missense	31	29.79	14	SNP	1.000	T
HSPA8	3312	genome.wustl.edu	37	11	122931861	122931861	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:122931861G>C	ENST00000532636.1	-	2	291	c.172C>G	c.(172-174)Caa>Gaa	p.Q58E	HSPA8_ENST00000526862.1_5'Flank|HSPA8_ENST00000227378.3_Missense_Mutation_p.Q58E|HSPA8_ENST00000533540.1_Missense_Mutation_p.Q58E|SNORD14E_ENST00000364009.1_RNA|HSPA8_ENST00000453788.2_Missense_Mutation_p.Q58E|HSPA8_ENST00000534624.1_Missense_Mutation_p.Q58E|HSPA8_ENST00000526110.1_Missense_Mutation_p.Q58E|SNORD14C_ENST00000365382.1_RNA|HSPA8_ENST00000534319.1_5'Flank|SNORD14D_ENST00000384390.1_RNA			P11142	HSP7C_HUMAN	heat shock 70kDa protein 8	58					ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|chaperone mediated protein folding requiring cofactor (GO:0051085)|clathrin coat disassembly (GO:0072318)|gene expression (GO:0010467)|membrane organization (GO:0061024)|mRNA metabolic process (GO:0016071)|mRNA processing (GO:0006397)|negative regulation of fibril organization (GO:1902904)|negative regulation of transcription, DNA-templated (GO:0045892)|neurotransmitter secretion (GO:0007269)|post-Golgi vesicle-mediated transport (GO:0006892)|protein folding (GO:0006457)|protein refolding (GO:0042026)|regulation of cell cycle (GO:0051726)|response to unfolded protein (GO:0006986)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	blood microparticle (GO:0072562)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|Prp19 complex (GO:0000974)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|enzyme binding (GO:0019899)|G-protein coupled receptor binding (GO:0001664)|heat shock protein binding (GO:0031072)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|central_nervous_system(7)|endometrium(1)|kidney(9)|large_intestine(4)|lung(13)|upper_aerodigestive_tract(1)	36		Breast(109;0.00249)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		ATTGCAACTTGATTCTTTGCG	0.418																																					Colon(21;486 594 5900 6733 14272)	dbGAP											0													80.0	69.0	73.0					11																	122931861		2202	4299	6501	-	-	-	SO:0001583	missense	0			Y00371	CCDS8440.1, CCDS44754.1	11q24.1	2011-09-02	2002-08-29		ENSG00000109971	ENSG00000109971		"""Heat shock proteins / HSP70"""	5241	protein-coding gene	gene with protein product		600816	"""heat shock 70kD protein 8"""	HSPA10		8530083, 3037489	Standard	NM_006597		Approved	HSC71, HSC70, HSP73	uc001pyo.3	P11142	OTTHUMG00000166030	ENST00000532636.1:c.172C>G	11.37:g.122931861G>C	ENSP00000437125:p.Gln58Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3R6	Missense_Mutation	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.Q58E	ENST00000532636.1	37	c.172	CCDS8440.1	11	.	.	.	.	.	.	.	.	.	.	G	25.4	4.632282	0.87660	.	.	ENSG00000109971	ENST00000532636;ENST00000533540;ENST00000534624;ENST00000453788;ENST00000227378;ENST00000526110;ENST00000525463;ENST00000525624;ENST00000534567;ENST00000527387;ENST00000532182;ENST00000524590;ENST00000530391	T;T;T;T;T;T;T;T;T;T;T;T;T	0.04234	5.26;5.26;5.26;5.26;5.26;5.26;3.67;5.26;5.26;5.26;5.26;5.26;5.26	4.42	4.42	0.53409	.	0.000000	0.85682	D	0.000000	T	0.39145	0.1067	H	0.98918	4.37	0.80722	D	1	D;D;D;D;D	0.89917	0.998;1.0;0.968;0.961;1.0	D;D;P;P;D	0.80764	0.994;0.968;0.866;0.789;0.968	T	0.67317	-0.5701	10	0.87932	D	0	-18.7622	17.4081	0.87479	0.0:0.0:1.0:0.0	.	58;58;58;58;58	B4DTX2;Q53GZ6;E7ET08;P11142-2;P11142	.;.;.;.;HSP7C_HUMAN	E	58	ENSP00000437125:Q58E;ENSP00000437189:Q58E;ENSP00000432083:Q58E;ENSP00000404372:Q58E;ENSP00000227378:Q58E;ENSP00000433584:Q58E;ENSP00000436762:Q58E;ENSP00000435154:Q58E;ENSP00000431641:Q58E;ENSP00000436183:Q58E;ENSP00000434415:Q58E;ENSP00000434565:Q58E;ENSP00000434851:Q58E	ENSP00000227378:Q58E	Q	-	1	0	HSPA8	122437071	1.000000	0.71417	0.989000	0.46669	0.819000	0.46315	9.866000	0.99616	2.151000	0.67156	0.484000	0.47621	CAA	HSPA8	-	pfam_Hsp_70_fam,prints_Hsp_70_fam	ENSG00000109971		0.418	HSPA8-004	PUTATIVE	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	HSPA8	HGNC	protein_coding	OTTHUMT00000387515.1	36	0.00	0	G			122931861	122931861	-1	no_errors	ENST00000534624	ensembl	human	known	69_37n	missense	40	18.37	9	SNP	1.000	C
HSPB9	94086	genome.wustl.edu	37	17	40275312	40275312	+	Silent	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:40275312G>T	ENST00000355067.3	+	1	557	c.444G>T	c.(442-444)ggG>ggT	p.G148G	KAT2A_ENST00000225916.5_5'Flank|CTD-2132N18.3_ENST00000592574.1_Intron	NM_033194.2	NP_149971.1	Q9BQS6	HSPB9_HUMAN	heat shock protein, alpha-crystallin-related, B9	148					response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(2)	4		all_cancers(22;0.00064)|Breast(137;0.00104)|all_epithelial(22;0.00866)		BRCA - Breast invasive adenocarcinoma(366;0.124)		CGAGACTCGGGAGCCTCGGCT	0.627																																						dbGAP											0													55.0	56.0	56.0					17																	40275312		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			AJ302068	CCDS11418.1	17q21	2011-09-02			ENSG00000197723	ENSG00000260325		"""Heat shock proteins / HSPB"""	30589	protein-coding gene	gene with protein product	"""cancer/testis antigen 51"""	608344				11470154, 12820654	Standard	NM_033194		Approved	CT51	uc002hyy.2	Q9BQS6	OTTHUMG00000133500	ENST00000355067.3:c.444G>T	17.37:g.40275312G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KSG6|Q52LB4	Silent	SNP	pfam_Hsp20,superfamily_HSP20-like_chaperone,pfscan_Hsp20	p.G148	ENST00000355067.3	37	c.444	CCDS11418.1	17																																																																																			HSPB9	-	NULL	ENSG00000197723		0.627	HSPB9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB9	HGNC	protein_coding	OTTHUMT00000257438.1	22	0.00	0	G	NM_033194		40275312	40275312	+1	no_errors	ENST00000355067	ensembl	human	known	69_37n	silent	27	20.59	7	SNP	0.000	T
IARS	3376	genome.wustl.edu	37	9	95013095	95013095	+	Missense_Mutation	SNP	T	T	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:95013095T>C	ENST00000375643.3	-	23	2595	c.2329A>G	c.(2329-2331)Act>Gct	p.T777A	IARS_ENST00000375629.3_5'UTR|IARS_ENST00000443024.2_Missense_Mutation_p.T777A|IARS_ENST00000447699.2_Missense_Mutation_p.T667A	NM_013417.2	NP_038203.2	P41252	SYIC_HUMAN	isoleucyl-tRNA synthetase	777					gene expression (GO:0010467)|isoleucyl-tRNA aminoacylation (GO:0006428)|osteoblast differentiation (GO:0001649)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	aminoacyl-tRNA editing activity (GO:0002161)|ATP binding (GO:0005524)|isoleucine-tRNA ligase activity (GO:0004822)			breast(3)|endometrium(2)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	35					L-Isoleucine(DB00167)	ATCAATTCAGTGAGAAAAGGT	0.433																																						dbGAP											0													135.0	105.0	115.0					9																	95013095		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB209234	CCDS6694.1	9q21	2011-07-01	2007-02-26		ENSG00000196305	ENSG00000196305	6.1.1.5	"""Aminoacyl tRNA synthetases / Class I"""	5330	protein-coding gene	gene with protein product	"""isoleucine tRNA ligase 1, cytoplasmic"""	600709				8812440	Standard	NM_002161		Approved	ILRS, IARS1	uc004aru.4	P41252	OTTHUMG00000020219	ENST00000375643.3:c.2329A>G	9.37:g.95013095T>C	ENSP00000364794:p.Thr777Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KAE9|Q5TCD0|Q7Z3T4|Q9H588	Missense_Mutation	SNP	pfam_aa-tRNA-synth_Ia,pfam_V/L/I-tRNA-synth_anticodon-bd,pfam_Methionyl/Leucyl_tRNA_Synth,superfamily_Val/Leu/Ile-tRNA-synth_edit,superfamily_tRNAsynth_1a_anticodon-bd,prints_Ile-tRNA-synt,tigrfam_Ile-tRNA-synt	p.T777A	ENST00000375643.3	37	c.2329	CCDS6694.1	9	.	.	.	.	.	.	.	.	.	.	T	21.8	4.205509	0.79127	.	.	ENSG00000196305	ENST00000375643;ENST00000451588;ENST00000443024;ENST00000447699;ENST00000375660;ENST00000436450;ENST00000449893	T;T;T	0.15952	2.38;2.38;2.38	5.52	5.52	0.82312	Valyl/Leucyl/Isoleucyl-tRNA synthetase, class I, anticodon-binding (1);Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.000000	0.85682	D	0.000000	T	0.19604	0.0471	L	0.41824	1.3	0.80722	D	1	B;P	0.35700	0.338;0.516	B;B	0.39904	0.196;0.313	T	0.01858	-1.1259	10	0.45353	T	0.12	-18.7666	15.3206	0.74117	0.0:0.0:0.0:1.0	.	777;622	P41252;Q6P0M4	SYIC_HUMAN;.	A	777;9;777;667;777;9;9	ENSP00000364794:T777A;ENSP00000406448:T777A;ENSP00000415020:T667A	ENSP00000364794:T777A	T	-	1	0	IARS	94052916	1.000000	0.71417	0.973000	0.42090	0.963000	0.63663	7.580000	0.82523	2.111000	0.64477	0.533000	0.62120	ACT	IARS	-	pfam_V/L/I-tRNA-synth_anticodon-bd,superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Ile-tRNA-synt	ENSG00000196305		0.433	IARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IARS	HGNC	protein_coding	OTTHUMT00000053059.2	47	0.00	0	T	NM_002161		95013095	95013095	-1	no_errors	ENST00000375643	ensembl	human	known	69_37n	missense	32	30.43	14	SNP	1.000	C
ICOS	29851	genome.wustl.edu	37	2	204820495	204820495	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:204820495C>G	ENST00000316386.6	+	2	262	c.195C>G	c.(193-195)ctC>ctG	p.L65L	ICOS_ENST00000435193.1_Silent_p.L65L	NM_012092.3	NP_036224.1	Q9Y6W8	ICOS_HUMAN	inducible T-cell co-stimulator	65	Ig-like V-type.				immune response (GO:0006955)|single organismal cell-cell adhesion (GO:0016337)|T cell costimulation (GO:0031295)|T cell tolerance induction (GO:0002517)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|large_intestine(1)|lung(4)	6						TCTGCGATCTCACTAAGACAA	0.378																																						dbGAP											0													137.0	131.0	133.0					2																	204820495		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB023135	CCDS2363.1	2q33	2014-09-17			ENSG00000163600	ENSG00000163600		"""CD molecules"""	5351	protein-coding gene	gene with protein product	"""activation-inducible lymphocyte immunomediatory molecule"""	604558				9930702, 10617205	Standard	NM_012092		Approved	AILIM, CD278	uc002vam.3	Q9Y6W8	OTTHUMG00000132880	ENST00000316386.6:c.195C>G	2.37:g.204820495C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N6W8	Silent	SNP	NULL	p.L65	ENST00000316386.6	37	c.195	CCDS2363.1	2																																																																																			ICOS	-	NULL	ENSG00000163600		0.378	ICOS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ICOS	HGNC	protein_coding	OTTHUMT00000256369.1	47	0.00	0	C	NM_012092		204820495	204820495	+1	no_errors	ENST00000316386	ensembl	human	known	69_37n	silent	49	10.91	6	SNP	0.637	G
INSRR	3645	genome.wustl.edu	37	1	156819150	156819150	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:156819150G>A	ENST00000368195.3	-	6	1728	c.1332C>T	c.(1330-1332)ttC>ttT	p.F444F	NTRK1_ENST00000392302.2_Intron	NM_014215.2	NP_055030.1	P14616	INSRR_HUMAN	insulin receptor-related receptor	444					actin cytoskeleton reorganization (GO:0031532)|cellular response to alkaline pH (GO:0071469)|male sex determination (GO:0030238)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(13)|ovary(7)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)	42	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					GGCGCGGGTTGAAGGCGAAGT	0.602																																						dbGAP											0													121.0	120.0	120.0					1																	156819150		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			J05046	CCDS1160.1	1q21-q23	2013-02-11			ENSG00000027644	ENSG00000027644		"""Fibronectin type III domain containing"""	6093	protein-coding gene	gene with protein product		147671				2768234, 2249481	Standard	NM_014215		Approved	IRR	uc010pht.2	P14616	OTTHUMG00000041291	ENST00000368195.3:c.1332C>T	1.37:g.156819150G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O60724|Q5VZS3	Silent	SNP	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F444	ENST00000368195.3	37	c.1332	CCDS1160.1	1																																																																																			INSRR	-	pirsf_Tyr_kinase_insulin-like_rcpt,pfam_EGF_rcpt_L	ENSG00000027644		0.602	INSRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INSRR	HGNC	protein_coding	OTTHUMT00000098929.1	29	0.00	0	G	NM_014215		156819150	156819150	-1	no_errors	ENST00000368195	ensembl	human	known	69_37n	silent	73	14.12	12	SNP	1.000	A
INTS7	25896	genome.wustl.edu	37	1	212141900	212141900	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:212141900C>T	ENST00000366994.3	-	14	2069	c.1965G>A	c.(1963-1965)atG>atA	p.M655I	INTS7_ENST00000469606.1_5'UTR|INTS7_ENST00000366992.3_Missense_Mutation_p.M655I|INTS7_ENST00000440600.2_Missense_Mutation_p.M606I|INTS7_ENST00000366993.3_Missense_Mutation_p.M655I	NM_001199811.1|NM_001199812.1|NM_015434.3	NP_001186740.1|NP_001186741.1|NP_056249.1	Q9NVH2	INT7_HUMAN	integrator complex subunit 7	655					cellular response to ionizing radiation (GO:0071479)|DNA damage checkpoint (GO:0000077)|snRNA processing (GO:0016180)	chromosome (GO:0005694)|integrator complex (GO:0032039)				NS(1)|breast(1)|kidney(1)|large_intestine(8)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20				OV - Ovarian serous cystadenocarcinoma(81;0.00584)|all cancers(67;0.0318)|Epithelial(68;0.0852)		TTCCTAAGGTCATGGCAATTG	0.418																																						dbGAP											0													144.0	125.0	132.0					1																	212141900		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK022509	CCDS1501.1, CCDS55684.1, CCDS55683.1, CCDS55685.1	1q32.3	2008-02-05	2006-03-15	2006-03-15	ENSG00000143493	ENSG00000143493			24484	protein-coding gene	gene with protein product		611350	"""chromosome 1 open reading frame 73"""	C1orf73		16239144	Standard	NM_015434		Approved	DKFZP434B168, INT7	uc001hiw.2	Q9NVH2	OTTHUMG00000037119	ENST00000366994.3:c.1965G>A	1.37:g.212141900C>T	ENSP00000355961:p.Met655Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DLZ6|B7WNP6|B7WPB6|Q8N4K7|Q8WUH5|Q9H9V3|Q9NVU5|Q9UFC6|Q9UFM3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M655I	ENST00000366994.3	37	c.1965	CCDS1501.1	1	.	.	.	.	.	.	.	.	.	.	C	12.01	1.810720	0.32053	.	.	ENSG00000143493	ENST00000366994;ENST00000366993;ENST00000366992;ENST00000440600	T;T;T;T	0.64438	0.97;0.98;0.97;-0.1	5.39	5.39	0.77823	.	0.086330	0.85682	D	0.000000	T	0.47820	0.1466	N	0.14661	0.345	0.43771	D	0.99629	B;B;B;B	0.20780	0.048;0.048;0.048;0.048	B;B;B;B	0.19391	0.025;0.025;0.025;0.025	T	0.36407	-0.9749	10	0.22109	T	0.4	-18.4264	19.1841	0.93635	0.0:1.0:0.0:0.0	.	606;655;655;655	B4DLZ6;Q9NVH2-3;Q9NVH2-2;Q9NVH2	.;.;.;INT7_HUMAN	I	655;655;655;606	ENSP00000355961:M655I;ENSP00000355960:M655I;ENSP00000355959:M655I;ENSP00000388908:M606I	ENSP00000355959:M655I	M	-	3	0	INTS7	210208523	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.631000	0.54280	2.537000	0.85549	0.655000	0.94253	ATG	INTS7	-	NULL	ENSG00000143493		0.418	INTS7-001	NOVEL	basic|appris_principal|CCDS	protein_coding	INTS7	HGNC	protein_coding	OTTHUMT00000090142.1	68	0.00	0	C	NM_015434		212141900	212141900	-1	no_errors	ENST00000366994	ensembl	human	known	69_37n	missense	79	14.13	13	SNP	1.000	T
INVS	27130	genome.wustl.edu	37	9	103055193	103055193	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:103055193C>T	ENST00000262457.2	+	14	2839	c.2654C>T	c.(2653-2655)tCt>tTt	p.S885F	INVS_ENST00000262456.2_Intron|INVS_ENST00000541287.1_Missense_Mutation_p.S789F	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	885					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				GGTCCCCTCTCTGGGCAGAGT	0.517																																						dbGAP											0													79.0	81.0	80.0					9																	103055193		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.2654C>T	9.37:g.103055193C>T	ENSP00000262457:p.Ser885Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_IQ_motif_EF-hand-BS,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Ankyrin_rpt	p.S885F	ENST00000262457.2	37	c.2654	CCDS6746.1	9	.	.	.	.	.	.	.	.	.	.	C	12.18	1.859929	0.32884	.	.	ENSG00000119509	ENST00000262457;ENST00000541287	T;T	0.41065	1.01;1.02	5.21	3.34	0.38264	.	1.276030	0.05120	N	0.490505	T	0.28732	0.0712	N	0.14661	0.345	0.23478	N	0.997592	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.23476	-1.0187	10	0.46703	T	0.11	.	6.9953	0.24779	0.0:0.7305:0.1756:0.0939	.	789;885	F5GZH2;Q9Y283	.;INVS_HUMAN	F	885;789	ENSP00000262457:S885F;ENSP00000444454:S789F	ENSP00000262457:S885F	S	+	2	0	INVS	102095014	0.663000	0.27448	0.882000	0.34594	0.934000	0.57294	2.088000	0.41663	0.574000	0.29417	0.650000	0.86243	TCT	INVS	-	NULL	ENSG00000119509		0.517	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	INVS	HGNC	protein_coding	OTTHUMT00000053407.1	91	0.00	0	C	NM_014425		103055193	103055193	+1	no_errors	ENST00000262457	ensembl	human	known	69_37n	missense	84	10.64	10	SNP	0.723	T
IPO11	51194	genome.wustl.edu	37	5	61923315	61923315	+	3'UTR	SNP	A	A	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:61923315A>G	ENST00000325324.6	+	0	3267				IPO11_ENST00000409534.1_3'UTR|IPO11_ENST00000512177.1_3'UTR|IPO11_ENST00000409296.3_3'UTR	NM_016338.4	NP_057422.3	Q9UI26	IPO11_HUMAN	importin 11						ribosomal protein import into nucleus (GO:0006610)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	protein transporter activity (GO:0008565)			endometrium(2)|kidney(3)|large_intestine(5)|lung(14)|skin(4)|stomach(2)	30		Lung NSC(810;8.99e-06)|Prostate(74;0.0235)|Ovarian(174;0.0511)|Breast(144;0.077)		Lung(70;0.0613)		CTGCATAACTAAAATCACAAA	0.318																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF111109	CCDS34167.1, CCDS47217.1	5q12.1	2008-09-19			ENSG00000086200	ENSG00000086200		"""Importins"""	20628	protein-coding gene	gene with protein product		610889					Standard	NM_016338		Approved	RanBP11	uc011cqr.2	Q9UI26	OTTHUMG00000154400	ENST00000325324.6:c.*170A>G	5.37:g.61923315A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NGJ5|B4DZ73|D3DW98|Q8N5R2|Q9NSJ6|Q9NVB1	RNA	SNP	-	NULL	ENST00000325324.6	37	NULL	CCDS34167.1	5																																																																																			IPO11	-	-	ENSG00000086200		0.318	IPO11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO11	HGNC	protein_coding	OTTHUMT00000335062.1	23	0.00	0	A	NM_016338		61923315	61923315	+1	no_errors	ENST00000512177	ensembl	human	known	69_37n	rna	17	22.73	5	SNP	0.855	G
IRF2BPL	64207	genome.wustl.edu	37	14	77492728	77492728	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:77492728C>G	ENST00000238647.3	-	1	2306	c.1408G>C	c.(1408-1410)Gac>Cac	p.D470H		NM_024496.3	NP_078772.1	Q9H1B7	I2BPL_HUMAN	interferon regulatory factor 2 binding protein-like	470					development of secondary female sexual characteristics (GO:0046543)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	extracellular space (GO:0005615)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	11						AGGCGCCAGTCCCCGGAGCCG	0.637																																						dbGAP											0													18.0	19.0	19.0					14																	77492728		2203	4299	6502	-	-	-	SO:0001583	missense	0			AJ277365	CCDS9854.1	14q24.3	2011-02-23	2011-02-23	2011-02-23	ENSG00000119669	ENSG00000119669			14282	protein-coding gene	gene with protein product	"""enhanced at puberty 1"""	611720	"""chromosome 14 open reading frame 4"""	C14orf4		11095982, 17627301	Standard	NM_024496		Approved	EAP1, KIAA1865	uc001xsy.4	Q9H1B7		ENST00000238647.3:c.1408G>C	14.37:g.77492728C>G	ENSP00000238647:p.Asp470His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8NDQ2|Q96JG2|Q9H3I7	Missense_Mutation	SNP	pfam_Interferon_reg_fac2-bd1_2_Znf	p.D470H	ENST00000238647.3	37	c.1408	CCDS9854.1	14	.	.	.	.	.	.	.	.	.	.	C	16.82	3.229864	0.58777	.	.	ENSG00000119669	ENST00000238647	T	0.21734	1.99	3.92	3.92	0.45320	.	0.000000	0.64402	U	0.000002	T	0.37293	0.0998	L	0.48642	1.525	0.46927	D	0.999251	D	0.71674	0.998	D	0.66602	0.945	T	0.25328	-1.0135	10	0.87932	D	0	.	14.6747	0.68969	0.0:1.0:0.0:0.0	.	470	Q9H1B7	I2BPL_HUMAN	H	470	ENSP00000238647:D470H	ENSP00000238647:D470H	D	-	1	0	IRF2BPL	76562481	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.060000	0.76692	2.013000	0.59113	0.462000	0.41574	GAC	IRF2BPL	-	pfam_Interferon_reg_fac2-bd1_2_Znf	ENSG00000119669		0.637	IRF2BPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF2BPL	HGNC	protein_coding	OTTHUMT00000414298.1	34	0.00	0	C	NM_024496		77492728	77492728	-1	no_errors	ENST00000238647	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	1.000	G
ITPR1	3708	genome.wustl.edu	37	3	4776888	4776888	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:4776888G>A	ENST00000443694.2	+	41	5349	c.5349G>A	c.(5347-5349)atG>atA	p.M1783I	ITPR1_ENST00000357086.4_Missense_Mutation_p.M1750I|ITPR1_ENST00000456211.2_Missense_Mutation_p.M1735I|ITPR1_ENST00000423119.2_Missense_Mutation_p.M1750I|ITPR1_ENST00000544951.1_Intron|ITPR1_ENST00000354582.6_Missense_Mutation_p.M1783I|ITPR1_ENST00000302640.8_Missense_Mutation_p.M1783I			Q14643	ITPR1_HUMAN	inositol 1,4,5-trisphosphate receptor, type 1	1798					activation of phospholipase C activity (GO:0007202)|blood coagulation (GO:0007596)|calcium ion transport (GO:0006816)|endoplasmic reticulum calcium ion homeostasis (GO:0032469)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inositol phosphate-mediated signaling (GO:0048016)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|negative regulation of calcium-mediated signaling (GO:0050849)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|post-embryonic development (GO:0009791)|regulation of insulin secretion (GO:0050796)|release of sequestered calcium ion into cytosol (GO:0051209)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|voluntary musculoskeletal movement (GO:0050882)	calcineurin complex (GO:0005955)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear inner membrane (GO:0005637)|nucleolus (GO:0005730)|platelet dense granule membrane (GO:0031088)|platelet dense tubular network (GO:0031094)|platelet dense tubular network membrane (GO:0031095)|postsynaptic density (GO:0014069)|sarcoplasmic reticulum (GO:0016529)	calcium channel inhibitor activity (GO:0019855)|calcium ion transmembrane transporter activity (GO:0015085)|inositol 1,4,5-trisphosphate-sensitive calcium-release channel activity (GO:0005220)|intracellular ligand-gated calcium channel activity (GO:0005218)|phosphatidylinositol binding (GO:0035091)			NS(1)|autonomic_ganglia(1)|breast(10)|endometrium(15)|kidney(6)|large_intestine(27)|liver(1)|lung(27)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(2)	106				Epithelial(13;0.0199)|OV - Ovarian serous cystadenocarcinoma(96;0.0361)|all cancers(10;0.0982)	Caffeine(DB00201)	GGGGTGAGATGAGTCTGGCCG	0.478																																						dbGAP											0													101.0	104.0	103.0					3																	4776888		2009	4161	6170	-	-	-	SO:0001583	missense	0			D26070	CCDS46740.1, CCDS46740.2, CCDS54550.1, CCDS54551.1	3p26.1	2014-06-12	2011-04-28			ENSG00000150995		"""Ion channels / Inositol triphosphate receptors"""	6180	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 94"""	147265	"""spinocerebellar ataxia 15"", ""spinocerebellar ataxia 16"", ""spinocerebellar ataxia 29"""	SCA15, SCA16, SCA29		7945203, 7500840, 17590087, 17932120, 22986007	Standard	NM_001099952		Approved	Insp3r1, IP3R1, ACV, PPP1R94	uc003bqc.3	Q14643		ENST00000443694.2:c.5349G>A	3.37:g.4776888G>A	ENSP00000401671:p.Met1783Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EPX7|E9PDE9|Q14660|Q99897	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ins145_P3_rcpt,pfam_MIR,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR,smart_MIR_motif,prints_InsP3_rcpt-bd,pfscan_MIR_motif	p.M1783I	ENST00000443694.2	37	c.5349	CCDS54551.1	3	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745825	0.49151	.	.	ENSG00000150995	ENST00000356617;ENST00000302640;ENST00000354582;ENST00000423119;ENST00000426160;ENST00000357086;ENST00000456211;ENST00000443694	D;D;D;D;D;D	0.89343	-2.5;-2.5;-2.5;-2.5;-2.5;-2.5	5.09	5.09	0.68999	.	0.135849	0.64402	D	0.000004	D	0.85057	0.5610	L	0.36672	1.1	0.80722	D	1	B;B	0.06786	0.001;0.0	B;B	0.08055	0.003;0.002	T	0.79748	-0.1673	10	0.35671	T	0.21	.	18.9273	0.92550	0.0:0.0:1.0:0.0	.	1798;1750	Q14643;G5E9P1	ITPR1_HUMAN;.	I	1798;1783;1783;1750;244;1750;1735;1783	ENSP00000306253:M1783I;ENSP00000346595:M1783I;ENSP00000405934:M1750I;ENSP00000349597:M1750I;ENSP00000397885:M1735I;ENSP00000401671:M1783I	ENSP00000306253:M1783I	M	+	3	0	ITPR1	4751888	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	7.410000	0.80065	2.541000	0.85698	0.585000	0.79938	ATG	ITPR1	-	NULL	ENSG00000150995		0.478	ITPR1-004	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	ITPR1	HGNC	protein_coding	OTTHUMT00000337982.3	62	0.00	0	G	NM_002222		4776888	4776888	+1	no_errors	ENST00000302640	ensembl	human	known	69_37n	missense	60	22.08	17	SNP	1.000	A
KANK2	25959	genome.wustl.edu	37	19	11287291	11287291	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:11287291C>T	ENST00000586659.1	-	7	2037	c.1723G>A	c.(1723-1725)Gag>Aag	p.E575K	KANK2_ENST00000432929.2_Missense_Mutation_p.E583K|KANK2_ENST00000355150.5_Missense_Mutation_p.E575K|KANK2_ENST00000589359.1_Missense_Mutation_p.E583K|KANK2_ENST00000589894.1_Missense_Mutation_p.E575K			Q63ZY3	KANK2_HUMAN	KN motif and ankyrin repeat domains 2	575					apoptotic process (GO:0006915)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of programmed cell death (GO:0043069)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)				endometrium(2)|large_intestine(1)|lung(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14						GATGCCCCCTCAGCAGTGGGT	0.627																																						dbGAP											0													139.0	134.0	135.0					19																	11287291		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK000011	CCDS12255.1, CCDS54219.1	19p13.2	2013-01-10	2008-01-29	2008-01-29		ENSG00000197256		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	29300	protein-coding gene	gene with protein product		614610	"""matrix-remodelling associated 3"", ""ankyrin repeat domain 25"""	MXRA3, ANKRD25		10819331, 17996375, 19554261	Standard	NM_015493		Approved	KIAA1518	uc002mqm.3	Q63ZY3		ENST00000586659.1:c.1723G>A	19.37:g.11287291C>T	ENSP00000465650:p.Glu575Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0I1P4|Q3KQZ3|Q6GUF5|Q9H8S4|Q9NUP0|Q9P210	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E583K	ENST00000586659.1	37	c.1747	CCDS12255.1	19	.	.	.	.	.	.	.	.	.	.	C	10.32	1.318131	0.23994	.	.	ENSG00000197256	ENST00000432929;ENST00000355150	T;T	0.68025	-0.3;-0.3	5.31	1.99	0.26369	.	1.005170	0.08008	N	0.989851	T	0.57021	0.2025	L	0.44542	1.39	0.09310	N	0.999994	B;B	0.06786	0.0;0.001	B;B	0.04013	0.001;0.001	T	0.43294	-0.9400	10	0.30078	T	0.28	-13.21	8.6553	0.34060	0.0:0.7442:0.0:0.2558	.	575;583	Q63ZY3;Q63ZY3-2	KANK2_HUMAN;.	K	583;575	ENSP00000395650:E583K;ENSP00000347276:E575K	ENSP00000347276:E575K	E	-	1	0	KANK2	11148291	0.113000	0.22115	0.175000	0.22980	0.001000	0.01503	1.444000	0.35068	0.616000	0.30141	-0.379000	0.06801	GAG	KANK2	-	NULL	ENSG00000197256		0.627	KANK2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KANK2	HGNC	protein_coding	OTTHUMT00000453066.2	53	0.00	0	C	NM_015493		11287291	11287291	-1	no_errors	ENST00000432929	ensembl	human	known	69_37n	missense	49	23.44	15	SNP	0.192	T
KANSL1	284058	genome.wustl.edu	37	17	44116048	44116048	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:44116048C>T	ENST00000262419.6	-	10	2867	c.2397G>A	c.(2395-2397)ttG>ttA	p.L799L	RP11-669E14.6_ENST00000570454.1_RNA|KANSL1_ENST00000575318.1_Silent_p.L736L|KANSL1_ENST00000432791.1_Silent_p.L799L|KANSL1_ENST00000572904.1_Silent_p.L799L|KANSL1_ENST00000393476.3_Silent_p.L93L|KANSL1_ENST00000574590.1_Silent_p.L799L	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	799					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											TGTGATGCTTCAACACTGCAG	0.488																																						dbGAP											0													162.0	136.0	145.0					17																	44116048		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2397G>A	17.37:g.44116048C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Silent	SNP	NULL	p.L799	ENST00000262419.6	37	c.2397	CCDS11503.1	17																																																																																			KANSL1	-	NULL	ENSG00000120071		0.488	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KANSL1	HGNC	protein_coding	OTTHUMT00000440274.1	117	0.00	0	C	NM_015443		44116048	44116048	-1	no_errors	ENST00000262419	ensembl	human	known	69_37n	silent	95	14.41	16	SNP	1.000	T
KANSL1	284058	genome.wustl.edu	37	17	44116427	44116427	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:44116427C>T	ENST00000262419.6	-	9	2828	c.2358G>A	c.(2356-2358)atG>atA	p.M786I	KANSL1_ENST00000575318.1_Intron|KANSL1_ENST00000432791.1_Missense_Mutation_p.M786I|KANSL1_ENST00000572904.1_Missense_Mutation_p.M786I|KANSL1_ENST00000393476.3_Intron|KANSL1_ENST00000574590.1_Missense_Mutation_p.M786I	NM_001193466.1	NP_001180395	Q7Z3B3	KANL1_HUMAN	KAT8 regulatory NSL complex subunit 1	786					chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)	histone acetyltransferase complex (GO:0000123)|MLL1 complex (GO:0071339)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)											CTCGCAATCTCATTTTGCTGT	0.587																																						dbGAP											0													241.0	202.0	215.0					17																	44116427		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX538006	CCDS11503.1, CCDS11503.2, CCDS74084.1	17q21.31	2012-02-20	2012-02-20	2012-02-20	ENSG00000120071	ENSG00000120071			24565	protein-coding gene	gene with protein product	"""centromere protein 36"""	612452	"""KIAA1267"""	KIAA1267		10574462	Standard	NM_015443		Approved	DKFZP727C091, MSL1v1, CENP-36, NSL1	uc002ikd.3	Q7Z3B3		ENST00000262419.6:c.2358G>A	17.37:g.44116427C>T	ENSP00000262419:p.Met786Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5E4|Q6AW85|Q8IYH1|Q9BRH0|Q9NTE7|Q9UFT0|Q9ULF3	Missense_Mutation	SNP	NULL	p.M786I	ENST00000262419.6	37	c.2358	CCDS11503.1	17	.	.	.	.	.	.	.	.	.	.	C	14.19	2.462315	0.43736	.	.	ENSG00000120071	ENST00000262419;ENST00000432791	T;T	0.11385	2.78;2.78	5.93	5.93	0.95920	.	0.050229	0.85682	D	0.000000	T	0.08313	0.0207	N	0.14661	0.345	0.80722	D	1	B;B;B	0.21606	0.058;0.034;0.034	B;B;B	0.19148	0.024;0.015;0.015	T	0.27400	-1.0075	10	0.42905	T	0.14	-8.596	15.854	0.78960	0.0:1.0:0.0:0.0	.	117;786;786	Q7Z3B3-2;C9JHY2;Q7Z3B3	.;.;K1267_HUMAN	I	786	ENSP00000262419:M786I;ENSP00000387393:M786I	ENSP00000262419:M786I	M	-	3	0	KIAA1267	41472274	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.200000	0.51051	2.826000	0.97356	0.655000	0.94253	ATG	KANSL1	-	NULL	ENSG00000120071		0.587	KANSL1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KANSL1	HGNC	protein_coding	OTTHUMT00000440274.1	107	0.00	0	C	NM_015443		44116427	44116427	-1	no_errors	ENST00000262419	ensembl	human	known	69_37n	missense	75	12.79	11	SNP	1.000	T
KCNK3	3777	genome.wustl.edu	37	2	26950898	26950898	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:26950898C>T	ENST00000302909.3	+	2	772	c.647C>T	c.(646-648)aCg>aTg	p.T216M		NM_002246.2	NP_002237.1	O14649	KCNK3_HUMAN	potassium channel, subfamily K, member 3	216					brain development (GO:0007420)|cellular response to hypoxia (GO:0071456)|cellular response to zinc ion (GO:0071294)|cochlea development (GO:0090102)|ion transmembrane transport (GO:0034220)|negative regulation of cytosolic calcium ion concentration (GO:0051481)|potassium ion transport (GO:0006813)|response to drug (GO:0042493)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ion channel activity (GO:0005216)|open rectifier potassium channel activity (GO:0005252)|potassium channel activity (GO:0005267)|potassium ion leak channel activity (GO:0022841)|S100 protein binding (GO:0044548)			endometrium(3)|large_intestine(4)|lung(5)|ovary(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)				Doxapram(DB00561)|Halothane(DB01159)	GCCCTGCAGACGCAGCCGCAG	0.607																																					GBM(80;1457 1631 27100 45946)	dbGAP											0													80.0	63.0	69.0					2																	26950898		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF006823	CCDS1727.1	2p23	2012-03-07			ENSG00000171303	ENSG00000171303		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6278	protein-coding gene	gene with protein product		603220				9312005, 9721223, 16382106	Standard	NM_002246		Approved	K2p3.1, TASK, TASK-1	uc002rhn.2	O14649	OTTHUMG00000125530	ENST00000302909.3:c.647C>T	2.37:g.26950898C>T	ENSP00000306275:p.Thr216Met	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53SU2	Missense_Mutation	SNP	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TASK,prints_2pore_dom_K_chnl_TASK1,prints_2pore_dom_K_chnl	p.T216M	ENST00000302909.3	37	c.647	CCDS1727.1	2	.	.	.	.	.	.	.	.	.	.	c	17.25	3.341845	0.61073	.	.	ENSG00000171303	ENST00000538762;ENST00000302909	T	0.25250	1.81	4.72	4.72	0.59763	Ion transport 2 (1);	0.255913	0.36893	N	0.002358	T	0.36441	0.0967	L	0.38175	1.15	0.46044	D	0.99883	P	0.50272	0.933	P	0.56788	0.806	T	0.11991	-1.0565	10	0.62326	D	0.03	.	15.5289	0.75936	0.0:1.0:0.0:0.0	.	216	O14649	KCNK3_HUMAN	M	93;216	ENSP00000306275:T216M	ENSP00000306275:T216M	T	+	2	0	KCNK3	26804402	0.971000	0.33674	1.000000	0.80357	0.994000	0.84299	1.475000	0.35409	2.303000	0.77524	0.556000	0.70494	ACG	KCNK3	-	pfam_Ion_trans_2,pirsf_2pore_dom_K_chnl_TASK/TWIK,prints_2pore_dom_K_chnl_TASK1	ENSG00000171303		0.607	KCNK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK3	HGNC	protein_coding	OTTHUMT00000246861.2	45	0.00	0	C	NM_002246		26950898	26950898	+1	no_errors	ENST00000302909	ensembl	human	known	69_37n	missense	37	21.28	10	SNP	1.000	T
KCNH7	90134	genome.wustl.edu	37	2	163291988	163291988	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:163291988G>A	ENST00000332142.5	-	8	1773	c.1674C>T	c.(1672-1674)atC>atT	p.I558I	KCNH7_ENST00000328032.4_Silent_p.I551I	NM_033272.3	NP_150375.2	Q9NS40	KCNH7_HUMAN	potassium voltage-gated channel, subfamily H (eag-related), member 7	558					circadian rhythm (GO:0007623)|potassium ion transmembrane transport (GO:0071805)|protein heterooligomerization (GO:0051291)|regulation of membrane potential (GO:0042391)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inward rectifier potassium channel activity (GO:0005242)|signal transducer activity (GO:0004871)|voltage-gated potassium channel activity (GO:0005249)			NS(1)|biliary_tract(1)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(22)|lung(53)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	108					Doxazosin(DB00590)|Ibutilide(DB00308)|Miconazole(DB01110)|Prazosin(DB00457)|Terazosin(DB01162)	TCAGGGCAAAGATGCACATTA	0.483																																					GBM(196;1492 2208 17507 24132 45496)	dbGAP											0													90.0	85.0	87.0					2																	163291988		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF032897	CCDS2219.1, CCDS2220.1	2q24.3	2012-07-05			ENSG00000184611	ENSG00000184611		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18863	protein-coding gene	gene with protein product		608169				16382104	Standard	NM_173162		Approved	Kv11.3, HERG3, erg3	uc002uch.2	Q9NS40	OTTHUMG00000132069	ENST00000332142.5:c.1674C>T	2.37:g.163291988G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QU4|Q53TB7|Q53TP9|Q8IV15	Silent	SNP	pfam_Ion_trans_dom,pfam_cNMP-bd_dom,pfam_Ion_trans_2,pfam_PAS_fold_3,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG,prints_K_chnl_volt-dep_ERG,pfscan_cNMP-bd_dom,tigrfam_PAS	p.I558	ENST00000332142.5	37	c.1674	CCDS2219.1	2																																																																																			KCNH7	-	pfam_Ion_trans_dom	ENSG00000184611		0.483	KCNH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNH7	HGNC	protein_coding	OTTHUMT00000255093.1	51	0.00	0	G	NM_033272		163291988	163291988	-1	no_errors	ENST00000332142	ensembl	human	known	69_37n	silent	35	14.63	6	SNP	0.979	A
KCNT1	57582	genome.wustl.edu	37	9	138669256	138669256	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:138669256G>A	ENST00000263604.3	+	21	2365	c.2365G>A	c.(2365-2367)Gag>Aag	p.E789K	KCNT1_ENST00000486577.2_Missense_Mutation_p.E767K|KCNT1_ENST00000487664.1_Missense_Mutation_p.E763K|KCNT1_ENST00000490355.2_Missense_Mutation_p.E787K|KCNT1_ENST00000491806.2_Missense_Mutation_p.E775K|KCNT1_ENST00000488444.2_Missense_Mutation_p.E789K|KCNT1_ENST00000298480.5_Missense_Mutation_p.E808K|KCNT1_ENST00000371757.2_Missense_Mutation_p.E808K			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	789					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CGTCTCGGCAGAGACGGCCGG	0.587																																						dbGAP											0													106.0	92.0	97.0					9																	138669256		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.2365G>A	9.37:g.138669256G>A	ENSP00000263604:p.Glu789Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.E808K	ENST00000263604.3	37	c.2422		9	.	.	.	.	.	.	.	.	.	.	G	23.6	4.434786	0.83885	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.75704	-0.96;-0.96;-0.96;-0.96	4.38	4.38	0.52667	.	0.000000	0.85682	U	0.000000	D	0.84831	0.5559	M	0.69823	2.125	0.80722	D	1	D;D;D;D	0.89917	1.0;0.999;1.0;0.987	D;D;D;P	0.76071	0.979;0.971;0.987;0.893	D	0.85291	0.1067	10	0.41790	T	0.15	-16.5406	16.9486	0.86237	0.0:0.0:1.0:0.0	.	775;808;763;789	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	K	763;808;808;767;775;789;787;789	ENSP00000417851:E763K;ENSP00000298480:E808K;ENSP00000360822:E808K;ENSP00000263604:E789K	ENSP00000263604:E789K	E	+	1	0	KCNT1	137809077	1.000000	0.71417	0.899000	0.35326	0.474000	0.32979	9.639000	0.98448	1.976000	0.57569	0.561000	0.74099	GAG	KCNT1	-	NULL	ENSG00000107147		0.587	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		44	0.00	0	G	NM_020822		138669256	138669256	+1	no_errors	ENST00000298480	ensembl	human	known	69_37n	missense	62	13.89	10	SNP	1.000	A
KDM3B	51780	genome.wustl.edu	37	5	137761226	137761226	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:137761226G>A	ENST00000314358.5	+	17	4566	c.4366G>A	c.(4366-4368)Gat>Aat	p.D1456N	KDM3B_ENST00000542866.1_Missense_Mutation_p.D488N|KDM3B_ENST00000394866.1_Missense_Mutation_p.D1112N	NM_016604.3	NP_057688	Q7LBC6	KDM3B_HUMAN	lysine (K)-specific demethylase 3B	1456					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(4)|large_intestine(15)|liver(2)|lung(18)|ovary(4)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	65						TATAATTTCCGATGTGAAAGT	0.428																																						dbGAP											0													159.0	158.0	159.0					5																	137761226		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF251039	CCDS34242.1	5q31	2011-07-01	2009-04-06	2009-04-06	ENSG00000120733	ENSG00000120733		"""Chromatin-modifying enzymes / K-demethylases"""	1337	protein-coding gene	gene with protein product		609373	"""chromosome 5 open reading frame 7"", ""jumonji domain containing 1B"""	C5orf7, JMJD1B		15138608	Standard	NM_016604		Approved	KIAA1082, NET22	uc003lcy.1	Q7LBC6	OTTHUMG00000163469	ENST00000314358.5:c.4366G>A	5.37:g.137761226G>A	ENSP00000326563:p.Asp1456Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8X7|Q9BVH6|Q9BW93|Q9BZ52|Q9NYF4|Q9UPS0	Missense_Mutation	SNP	pfam_JmjC_dom,smart_JmjC_dom,pfscan_JmjC_dom	p.D1456N	ENST00000314358.5	37	c.4366	CCDS34242.1	5	.	.	.	.	.	.	.	.	.	.	G	13.02	2.111904	0.37242	.	.	ENSG00000120733	ENST00000314358;ENST00000545151;ENST00000394866;ENST00000542866	T;T;T	0.71579	-0.58;-0.58;-0.58	5.17	5.17	0.71159	.	0.000000	0.85682	D	0.000000	T	0.49508	0.1561	N	0.05330	-0.07	0.80722	D	1	P;B	0.51351	0.944;0.101	B;B	0.40009	0.316;0.059	T	0.54390	-0.8301	10	0.08179	T	0.78	-7.3406	18.6718	0.91514	0.0:0.0:1.0:0.0	.	1112;1456	Q7LBC6-2;Q7LBC6	.;KDM3B_HUMAN	N	1456;1246;1112;488	ENSP00000326563:D1456N;ENSP00000378335:D1112N;ENSP00000439462:D488N	ENSP00000326563:D1456N	D	+	1	0	KDM3B	137789125	1.000000	0.71417	0.975000	0.42487	0.943000	0.58893	9.869000	0.99810	2.403000	0.81681	0.563000	0.77884	GAT	KDM3B	-	NULL	ENSG00000120733		0.428	KDM3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM3B	HGNC	protein_coding	OTTHUMT00000373597.1	76	0.00	0	G	NM_016604		137761226	137761226	+1	no_errors	ENST00000314358	ensembl	human	known	69_37n	missense	94	11.32	12	SNP	1.000	A
KIAA0100	9703	genome.wustl.edu	37	17	26966443	26966443	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:26966443C>G	ENST00000528896.2	-	11	1193	c.1119G>C	c.(1117-1119)ctG>ctC	p.L373L	KIAA0100_ENST00000389003.3_Silent_p.L230L|KIAA0100_ENST00000544884.1_Silent_p.L230L	NM_014680.3	NP_055495.2	Q14667	K0100_HUMAN	KIAA0100	373						extracellular region (GO:0005576)				breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(13)|lung(23)|ovary(2)|prostate(2)|skin(6)|stomach(2)|urinary_tract(3)	68	Lung NSC(42;0.00431)					TGCAAGTGTTCAGAACTAGGG	0.453																																						dbGAP											0													76.0	79.0	78.0					17																	26966443		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D43947	CCDS32595.1	17q11.2	2012-11-29			ENSG00000007202	ENSG00000007202			28960	protein-coding gene	gene with protein product	"""cancer/testis antigen 101"", ""breast cancer overexpressed gene 1"""	610664				16289875	Standard	NM_014680		Approved	DKFZp686M0843, MGC111488, BCOX1, CT101, BCOX	uc002hbu.3	Q14667	OTTHUMG00000166587	ENST00000528896.2:c.1119G>C	17.37:g.26966443C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NCX3|Q3SYN5|Q49A07|Q5H9T4|Q6WG74|Q6ZP51|Q96HH8	Silent	SNP	pfam_FMP27_C,pfam_FMP27_N,pfam_FMP27_GFWDK_dom	p.L373	ENST00000528896.2	37	c.1119	CCDS32595.1	17																																																																																			KIAA0100	-	pfam_FMP27_N	ENSG00000007202		0.453	KIAA0100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0100	HGNC	protein_coding	OTTHUMT00000390571.3	56	0.00	0	C	NM_014680		26966443	26966443	-1	no_errors	ENST00000005905	ensembl	human	known	69_37n	silent	65	24.42	21	SNP	1.000	G
CEP170B	283638	genome.wustl.edu	37	14	105355912	105355912	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:105355912C>T	ENST00000556508.1	+	12	3929	c.3590C>T	c.(3589-3591)tCc>tTc	p.S1197F	CEP170B_ENST00000414716.3_Intron|CEP170B_ENST00000418279.1_Intron|CEP170B_ENST00000453495.1_Missense_Mutation_p.S1268F	NM_015005.2	NP_055820.2	Q9Y4F5	C170B_HUMAN	centrosomal protein 170B	1267						cytoplasm (GO:0005737)|microtubule (GO:0005874)											GAGTACGGCTCCCGCCACGGC	0.637																																						dbGAP											0													10.0	13.0	12.0					14																	105355912		1896	4077	5973	-	-	-	SO:0001583	missense	0			AB006622	CCDS45175.1, CCDS45176.1, CCDS45176.2	14q32.33	2014-02-20	2012-11-30	2012-11-30	ENSG00000099814	ENSG00000099814			20362	protein-coding gene	gene with protein product	"""Cep170-related"""		"""KIAA0284"""	KIAA0284		23087211	Standard	NM_015005		Approved	FAM68C, Cep170R	uc010axb.4	Q9Y4F5	OTTHUMG00000170763	ENST00000556508.1:c.3590C>T	14.37:g.105355912C>T	ENSP00000451249:p.Ser1197Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2KHR7|Q86TI7	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S1268F	ENST00000556508.1	37	c.3803	CCDS45176.2	14	.	.	.	.	.	.	.	.	.	.	C	26.1	4.703031	0.88924	.	.	ENSG00000099814	ENST00000556508;ENST00000453495	T;T	0.61158	0.17;0.13	4.28	4.28	0.50868	.	0.294118	0.28279	U	0.015929	T	0.77363	0.4119	M	0.80183	2.485	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.82151	-0.0599	10	0.87932	D	0	-15.6961	16.7212	0.85410	0.0:1.0:0.0:0.0	.	1267	Q9Y4F5	K0284_HUMAN	F	1197;1268	ENSP00000451249:S1197F;ENSP00000407238:S1268F	ENSP00000407238:S1268F	S	+	2	0	KIAA0284	104426957	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.216000	0.77974	1.918000	0.55548	0.423000	0.28283	TCC	KIAA0284	-	NULL	ENSG00000099814		0.637	CEP170B-002	PUTATIVE	basic|CCDS	protein_coding	KIAA0284	HGNC	protein_coding	OTTHUMT00000410288.1	93	0.00	0	C	NM_001112726		105355912	105355912	+1	no_errors	ENST00000453495	ensembl	human	known	69_37n	missense	103	17.60	22	SNP	1.000	T
KIAA0319L	79932	genome.wustl.edu	37	1	35916036	35916036	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:35916036C>T	ENST00000325722.3	-	14	2371	c.2137G>A	c.(2137-2139)Gat>Aat	p.D713N	KIAA0319L_ENST00000373266.4_Missense_Mutation_p.D150N|KIAA0319L_ENST00000485551.1_5'UTR	NM_024874.4	NP_079150.3	Q8IZA0	K319L_HUMAN	KIAA0319-like	713	PKD 5. {ECO:0000255|PROSITE- ProRule:PRU00151}.					cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(12)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|urinary_tract(1)	34		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0887)				TTAGAGCCATCCAGCTCTGCT	0.478																																						dbGAP											0													145.0	126.0	133.0					1																	35916036		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY163234	CCDS390.1	1p34.3	2008-10-24			ENSG00000142687	ENSG00000142687			30071	protein-coding gene	gene with protein product		613535				11347906	Standard	NM_024874		Approved	KIAA1837	uc001byx.3	Q8IZA0	OTTHUMG00000004370	ENST00000325722.3:c.2137G>A	1.37:g.35916036C>T	ENSP00000318406:p.Asp713Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AN13|D3DPR8|O95010|Q6PJJ7|Q7L1C9|Q8N2B3|Q8NDA0|Q8WY39|Q8WYZ5|Q96IC3|Q96JJ0|Q9BUW6|Q9H7V0	Missense_Mutation	SNP	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom,pfscan_MANSC,pfscan_PKD_dom	p.D713N	ENST00000325722.3	37	c.2137	CCDS390.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.111555	0.77210	.	.	ENSG00000142687	ENST00000325722;ENST00000373266;ENST00000426982	T;T;T	0.78816	2.56;-1.21;2.56	5.87	5.87	0.94306	PKD/Chitinase domain (1);Fibronectin, type III (1);PKD/REJ-like protein (1);PKD domain (2);	0.000000	0.85682	D	0.000000	D	0.83622	0.5294	L	0.38733	1.17	0.80722	D	1	D;D;P	0.89917	1.0;0.957;0.724	D;P;B	0.87578	0.998;0.86;0.203	T	0.80861	-0.1193	10	0.33141	T	0.24	-12.3767	19.2028	0.93717	0.0:1.0:0.0:0.0	.	713;713;155	Q8IZA0-2;Q8IZA0;Q8IZA0-3	.;K319L_HUMAN;.	N	713;150;713	ENSP00000318406:D713N;ENSP00000362363:D150N;ENSP00000395883:D713N	ENSP00000318406:D713N	D	-	1	0	KIAA0319L	35688623	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.247000	0.78257	2.785000	0.95823	0.591000	0.81541	GAT	KIAA0319L	-	pfam_PKD/REJ-like,superfamily_PKD_dom,smart_PKD/Chitinase_dom	ENSG00000142687		0.478	KIAA0319L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0319L	HGNC	protein_coding	OTTHUMT00000012684.2	53	0.00	0	C	NM_024874		35916036	35916036	-1	no_errors	ENST00000325722	ensembl	human	known	69_37n	missense	40	24.53	13	SNP	1.000	T
KIAA0586	9786	genome.wustl.edu	37	14	58934473	58934473	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:58934473G>A	ENST00000556134.1	+	17	2504	c.2230G>A	c.(2230-2232)Gat>Aat	p.D744N	KIAA0586_ENST00000538571.2_3'UTR|KIAA0586_ENST00000261244.5_Missense_Mutation_p.D683N|KIAA0586_ENST00000354386.6_Missense_Mutation_p.D812N|KIAA0586_ENST00000423743.3_Missense_Mutation_p.D715N	NM_001244190.1|NM_001244193.1	NP_001231119.1|NP_001231122.1	Q9BVV6	TALD3_HUMAN	KIAA0586	744					cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|regulation of establishment of protein localization (GO:0070201)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)				endometrium(4)|kidney(6)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						AAGTAATAGTGATACCATGCC	0.383																																						dbGAP											0													154.0	148.0	150.0					14																	58934473		1905	4133	6038	-	-	-	SO:0001583	missense	0			AB011158	CCDS45115.1, CCDS58320.1, CCDS58321.1, CCDS58322.1, CCDS73639.1	14q23.1	2012-12-06			ENSG00000100578	ENSG00000100578			19960	protein-coding gene	gene with protein product		610178				16702409	Standard	NM_014749		Approved	Talpid3	uc010trr.2	Q9BVV6	OTTHUMG00000171141	ENST00000556134.1:c.2230G>A	14.37:g.58934473G>A	ENSP00000452351:p.Asp744Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DZB6|E7EWM8|J3KQH9|O60328|Q6NYC6|Q6UV20	Missense_Mutation	SNP	NULL	p.D744N	ENST00000556134.1	37	c.2230	CCDS58321.1	14	.	.	.	.	.	.	.	.	.	.	G	19.49	3.836536	0.71373	.	.	ENSG00000100578	ENST00000354386;ENST00000556134;ENST00000423743;ENST00000261244;ENST00000546216	T;T;T;T	0.46819	0.86;0.86;0.86;0.86	5.23	5.23	0.72850	.	0.405748	0.23916	N	0.043287	T	0.59252	0.2180	M	0.68317	2.08	0.29230	N	0.873317	P;D;D;D;D;D	0.71674	0.763;0.993;0.998;0.998;0.993;0.993	P;P;P;D;P;P	0.81914	0.463;0.775;0.905;0.995;0.775;0.775	T	0.55231	-0.8173	10	0.16420	T	0.52	.	7.1368	0.25533	0.2101:0.0:0.7899:0.0	.	619;619;812;683;744;715	F5GWA3;B7Z7W7;E7EWM8;E9PGW8;Q9BVV6;Q6UV20	.;.;.;.;K0586_HUMAN;.	N	812;744;715;683;619	ENSP00000346359:D812N;ENSP00000452351:D744N;ENSP00000399427:D715N;ENSP00000261244:D683N	ENSP00000261244:D683N	D	+	1	0	KIAA0586	58004226	1.000000	0.71417	1.000000	0.80357	0.883000	0.51084	2.936000	0.48971	2.593000	0.87608	0.655000	0.94253	GAT	KIAA0586	-	NULL	ENSG00000100578		0.383	KIAA0586-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0586	HGNC	protein_coding	OTTHUMT00000411887.1	41	0.00	0	G	NM_014749		58934473	58934473	+1	no_errors	ENST00000556134	ensembl	human	known	69_37n	missense	26	16.13	5	SNP	1.000	A
KIAA2018	205717	genome.wustl.edu	37	3	113376553	113376553	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:113376553C>G	ENST00000478658.1	-	5	3993	c.3976G>C	c.(3976-3978)Gat>Cat	p.D1326H	KIAA2018_ENST00000316407.4_Missense_Mutation_p.D1326H|KIAA2018_ENST00000491165.1_Intron			Q68DE3	K2018_HUMAN	KIAA2018	1326						membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)	p.D1326N(1)		NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						TTAGCAGAATCCTTACGGCTT	0.448																																						dbGAP											1	Substitution - Missense(1)	NS(1)											118.0	116.0	117.0					3																	113376553		1960	4159	6119	-	-	-	SO:0001583	missense	0			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.3976G>C	3.37:g.113376553C>G	ENSP00000420721:p.Asp1326His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.D1326H	ENST00000478658.1	37	c.3976	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	C	12.50	1.957445	0.34565	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.16196	2.36;2.36	5.78	4.9	0.64082	.	0.000000	0.64402	D	0.000001	T	0.21022	0.0506	L	0.32530	0.975	0.52099	D	0.999941	D	0.58620	0.983	P	0.48952	0.596	T	0.01256	-1.1404	10	0.72032	D	0.01	-11.1238	15.0971	0.72244	0.0:0.9319:0.0:0.0681	.	1326	Q68DE3	K2018_HUMAN	H	1326	ENSP00000320794:D1326H;ENSP00000420721:D1326H	ENSP00000320794:D1326H	D	-	1	0	KIAA2018	114859243	0.998000	0.40836	1.000000	0.80357	0.351000	0.29236	2.749000	0.47492	1.453000	0.47775	0.561000	0.74099	GAT	KIAA2018	-	NULL	ENSG00000176542		0.448	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	57	0.00	0	C	NM_001009899		113376553	113376553	-1	no_errors	ENST00000316407	ensembl	human	known	69_37n	missense	72	12.20	10	SNP	1.000	G
KIF20B	9585	genome.wustl.edu	37	10	91518585	91518585	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:91518585G>A	ENST00000371728.3	+	27	4691	c.4626G>A	c.(4624-4626)caG>caA	p.Q1542Q	KIF20B_ENST00000260753.4_Silent_p.Q1502Q|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000416354.1_Silent_p.Q1572Q|KIF20B_ENST00000394289.2_Silent_p.Q1542Q	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1542					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GTAATGTACAGAAAGATAATG	0.333																																						dbGAP											0													64.0	63.0	63.0					10																	91518585		2202	4300	6502	-	-	-	SO:0001819	synonymous_variant	0			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.4626G>A	10.37:g.91518585G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Silent	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.Q1572	ENST00000371728.3	37	c.4716		10																																																																																			KIF20B	-	NULL	ENSG00000138182		0.333	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	31	0.00	0	G	NM_016195		91518585	91518585	+1	no_errors	ENST00000416354	ensembl	human	known	69_37n	silent	28	12.50	4	SNP	0.967	A
KIRREL2	84063	genome.wustl.edu	37	19	36353838	36353838	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:36353838C>G	ENST00000360202.5	+	13	1823	c.1625C>G	c.(1624-1626)tCt>tGt	p.S542C	NPHS1_ENST00000591817.1_Intron|KIRREL2_ENST00000592409.1_Missense_Mutation_p.S507C|KIRREL2_ENST00000347900.6_Missense_Mutation_p.S492C|KIRREL2_ENST00000262625.7_Missense_Mutation_p.S542C	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)	542					cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GCCTCAGCCTCTTTCTCCGAG	0.582																																						dbGAP											0													43.0	38.0	40.0					19																	36353838		2200	4294	6494	-	-	-	SO:0001583	missense	0			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.1625C>G	19.37:g.36353838C>G	ENSP00000353331:p.Ser542Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S542C	ENST00000360202.5	37	c.1625	CCDS12481.1	19	.	.	.	.	.	.	.	.	.	.	C	10.68	1.418977	0.25552	.	.	ENSG00000126259	ENST00000262625;ENST00000347900;ENST00000360202;ENST00000341658;ENST00000270294	T;T;T	0.66638	-0.22;0.01;-0.17	5.1	2.73	0.32206	.	.	.	.	.	T	0.42562	0.1208	N	0.08118	0	0.27855	N	0.940612	B;B;B;B;P	0.34462	0.142;0.222;0.142;0.222;0.454	B;B;B;B;B	0.24701	0.014;0.031;0.014;0.055;0.055	T	0.36890	-0.9729	9	0.48119	T	0.1	-15.5279	11.5015	0.50441	0.0:0.7207:0.2793:0.0	.	542;522;542;492;542	F1T0I2;Q6UWL6-4;Q6UWL6;Q6UWL6-3;Q6UWL6-2	.;.;KIRR2_HUMAN;.;.	C	542;492;542;522;53	ENSP00000262625:S542C;ENSP00000345067:S492C;ENSP00000353331:S542C	ENSP00000262625:S542C	S	+	2	0	KIRREL2	41045678	0.999000	0.42202	0.999000	0.59377	0.359000	0.29487	0.950000	0.29122	2.387000	0.81309	0.561000	0.74099	TCT	KIRREL2	-	NULL	ENSG00000126259		0.582	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL2	HGNC	protein_coding	OTTHUMT00000452561.1	24	0.00	0	C	NM_032123		36353838	36353838	+1	no_errors	ENST00000360202	ensembl	human	known	69_37n	missense	47	18.97	11	SNP	0.962	G
KLHL24	54800	genome.wustl.edu	37	3	183368615	183368615	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:183368615G>C	ENST00000454652.2	+	4	857	c.471G>C	c.(469-471)aaG>aaC	p.K157N	KLHL24_ENST00000476808.1_Missense_Mutation_p.K157N|KLHL24_ENST00000242810.6_Missense_Mutation_p.K157N	NM_017644.3	NP_060114.2	Q6TFL4	KLH24_HUMAN	kelch-like family member 24	157						cell projection (GO:0042995)|cytoplasm (GO:0005737)				NS(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(10)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	27	all_cancers(143;2.88e-10)|Ovarian(172;0.0303)		all cancers(12;1.43e-42)|Epithelial(37;1.73e-36)|OV - Ovarian serous cystadenocarcinoma(80;8.75e-22)			CATGTGCCAAGTTCTTGGAGG	0.398																																						dbGAP											0													128.0	116.0	120.0					3																	183368615		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS3246.1	3q27.1	2013-02-22	2013-02-22		ENSG00000114796	ENSG00000114796		"""Kelch-like"", ""BTB/POZ domain containing"""	25947	protein-coding gene	gene with protein product		611295	"""kelch-like 24 (Drosophila)"""				Standard	XM_005247552		Approved	DRE1, FLJ20059	uc003flv.3	Q6TFL4	OTTHUMG00000156911	ENST00000454652.2:c.471G>C	3.37:g.183368615G>C	ENSP00000395012:p.Lys157Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A5PLN8|Q9H620|Q9NXT9	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.K157N	ENST00000454652.2	37	c.471	CCDS3246.1	3	.	.	.	.	.	.	.	.	.	.	G	16.70	3.196063	0.58126	.	.	ENSG00000114796	ENST00000242810;ENST00000454652;ENST00000476808	T;T;T	0.70631	-0.5;-0.5;-0.5	5.34	4.46	0.54185	BTB/POZ-like (1);BTB/POZ (1);BTB/POZ fold (2);	0.042684	0.85682	D	0.000000	T	0.56848	0.2013	N	0.05383	-0.06	0.58432	D	0.999999	P;B	0.50528	0.936;0.034	P;B	0.50270	0.636;0.115	T	0.54977	-0.8212	10	0.23891	T	0.37	.	11.0821	0.48066	0.15:0.0:0.85:0.0	.	157;157	Q6TFL4-2;Q6TFL4	.;KLH24_HUMAN	N	157	ENSP00000242810:K157N;ENSP00000395012:K157N;ENSP00000419010:K157N	ENSP00000242810:K157N	K	+	3	2	KLHL24	184851309	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	2.761000	0.47589	1.247000	0.43917	0.460000	0.39030	AAG	KLHL24	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin	ENSG00000114796		0.398	KLHL24-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KLHL24	HGNC	protein_coding	OTTHUMT00000346586.2	25	0.00	0	G	NM_017644		183368615	183368615	+1	no_errors	ENST00000242810	ensembl	human	known	69_37n	missense	27	12.90	4	SNP	1.000	C
KPRP	448834	genome.wustl.edu	37	1	152733174	152733174	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:152733174G>A	ENST00000606109.1	+	1	1138	c.1110G>A	c.(1108-1110)ctG>ctA	p.L370L	KPRP_ENST00000368773.1_Silent_p.L370L			Q5T749	KPRP_HUMAN	keratinocyte proline-rich protein	370	Pro-rich.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				NS(1)|breast(1)|endometrium(9)|kidney(1)|large_intestine(10)|lung(21)|ovary(6)|pancreas(1)|prostate(6)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.206)			GCCCTGAGCTGAGGCCACACG	0.642																																						dbGAP											0													74.0	73.0	73.0					1																	152733174		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AY960854	CCDS30862.1	1q21.3	2008-02-05	2007-02-02	2006-12-07	ENSG00000203786	ENSG00000203786			31823	protein-coding gene	gene with protein product		613260	"""chromosome 1 open reading frame 45"""	C1orf45		16297201	Standard	NM_001025231		Approved		uc001fal.1	Q5T749	OTTHUMG00000012402	ENST00000606109.1:c.1110G>A	1.37:g.152733174G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L370	ENST00000606109.1	37	c.1110	CCDS30862.1	1																																																																																			KPRP	-	NULL	ENSG00000203786		0.642	KPRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KPRP	HGNC	protein_coding	OTTHUMT00000034522.2	49	0.00	0	G	NM_001025231		152733174	152733174	+1	no_errors	ENST00000368773	ensembl	human	known	69_37n	silent	60	16.67	12	SNP	0.614	A
KRT25	147183	genome.wustl.edu	37	17	38911249	38911249	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:38911249G>C	ENST00000312150.4	-	1	335	c.275C>G	c.(274-276)tCc>tGc	p.S92C		NM_181534.3	NP_853512.1			keratin 25											endometrium(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(4)	16		Breast(137;0.00526)				GTCCAGGTAGGATGCCAGGCG	0.572																																						dbGAP											0													159.0	148.0	151.0					17																	38911249		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK129503	CCDS11373.1	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000204897	ENSG00000204897		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	30839	protein-coding gene	gene with protein product			"""keratin 25A"""	KRT25A		16831889	Standard	NM_181534		Approved		uc002hve.3	Q7Z3Z0	OTTHUMG00000133373	ENST00000312150.4:c.275C>G	17.37:g.38911249G>C	ENSP00000310573:p.Ser92Cys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_F,prints_Keratin_I	p.S92C	ENST00000312150.4	37	c.275	CCDS11373.1	17	.	.	.	.	.	.	.	.	.	.	G	14.34	2.504863	0.44558	.	.	ENSG00000204897	ENST00000394042;ENST00000312150	D	0.91295	-2.82	5.76	5.76	0.90799	Filament (1);	0.000000	0.64402	D	0.000004	D	0.93318	0.7870	M	0.90483	3.12	0.32280	N	0.567721	B	0.32031	0.352	B	0.41510	0.359	D	0.94954	0.8102	10	0.72032	D	0.01	.	11.2713	0.49140	0.0:0.1367:0.7216:0.1417	.	92	Q7Z3Z0	K1C25_HUMAN	C	92	ENSP00000310573:S92C	ENSP00000310573:S92C	S	-	2	0	KRT25	36164775	0.841000	0.29509	0.999000	0.59377	0.978000	0.69477	1.144000	0.31565	2.727000	0.93392	0.655000	0.94253	TCC	KRT25	-	pfam_F	ENSG00000204897		0.572	KRT25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT25	HGNC	protein_coding	OTTHUMT00000257218.1	119	0.00	0	G	NM_181534		38911249	38911249	-1	no_errors	ENST00000312150	ensembl	human	known	69_37n	missense	86	14.85	15	SNP	0.960	C
KRT36	8689	genome.wustl.edu	37	17	39645670	39645670	+	Silent	SNP	A	A	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:39645670A>G	ENST00000328119.6	-	1	446	c.447T>C	c.(445-447)gaT>gaC	p.D149D	KRT36_ENST00000393986.2_Silent_p.D99D	NM_003771.4	NP_003762.1	O76013	KRT36_HUMAN	keratin 36	149	Coil 1B.|Rod.				regulation of keratinocyte differentiation (GO:0045616)	extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural constituent of epidermis (GO:0030280)			breast(2)|cervix(1)|kidney(2)|large_intestine(3)|lung(8)|skin(1)	17		Breast(137;0.000286)				TCTGCTGGAAATCTTCGATGG	0.567																																						dbGAP											0													127.0	120.0	122.0					17																	39645670		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y16792	CCDS11395.1	17q21.2	2013-06-20	2006-07-17	2006-07-17	ENSG00000126337	ENSG00000126337		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6454	protein-coding gene	gene with protein product		604540	"""keratin, hair, acidic, 6"""	KRTHA6		9756910, 16831889	Standard	XM_005257762		Approved		uc002hwt.3	O76013	OTTHUMG00000133431	ENST00000328119.6:c.447T>C	17.37:g.39645670A>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86XG4	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.D149	ENST00000328119.6	37	c.447	CCDS11395.1	17																																																																																			KRT36	-	pfam_F	ENSG00000126337		0.567	KRT36-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT36	HGNC	protein_coding	OTTHUMT00000259508.1	73	0.00	0	A	NM_003771		39645670	39645670	-1	no_errors	ENST00000328119	ensembl	human	known	69_37n	silent	67	12.99	10	SNP	0.065	G
KRTAP21-2	337978	genome.wustl.edu	37	21	32119357	32119357	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr21:32119357G>A	ENST00000333892.2	-	1	194	c.164C>T	c.(163-165)tCt>tTt	p.S55F		NM_181617.1	NP_853648.1	Q3LI59	KR212_HUMAN	keratin associated protein 21-2	55						intermediate filament (GO:0005882)	structural constituent of cutaneous appendage (GO:0030281)			lung(4)|skin(2)|upper_aerodigestive_tract(1)	7						tccacagccagagccgtatcc	0.517																																						dbGAP											0													122.0	102.0	109.0					21																	32119357		2203	4300	6503	-	-	-	SO:0001583	missense	0			AP001709	CCDS13605.1	21q22.1	2006-03-13			ENSG00000187026	ENSG00000187026		"""Keratin associated proteins"""	18946	protein-coding gene	gene with protein product						12359730	Standard	NM_181617		Approved	KAP21.2	uc011adh.2	Q3LI59	OTTHUMG00000057769	ENST00000333892.2:c.164C>T	21.37:g.32119357G>A	ENSP00000334287:p.Ser55Phe	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_KRTAP	p.S55F	ENST00000333892.2	37	c.164	CCDS13605.1	21	.	.	.	.	.	.	.	.	.	.	A	3.564	-0.089131	0.07097	.	.	ENSG00000187026	ENST00000333892	.	.	.	2.81	-4.42	0.03579	.	0.442570	0.16428	N	0.214837	T	0.22126	0.0533	.	.	.	0.09310	N	1	B	0.06786	0.001	B	0.01281	0.0	T	0.12451	-1.0547	8	0.87932	D	0	-2.2713	1.3739	0.02216	0.1237:0.3058:0.2195:0.351	.	55	Q3LI59	KR212_HUMAN	F	55	.	ENSP00000334287:S55F	S	-	2	0	KRTAP21-2	31041228	0.000000	0.05858	0.004000	0.12327	0.034000	0.12701	-1.858000	0.01659	-0.711000	0.04995	-1.214000	0.01621	TCT	KRTAP21-2	-	pfam_KRTAP	ENSG00000187026		0.517	KRTAP21-2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP21-2	HGNC	protein_coding	OTTHUMT00000128221.2	87	0.00	0	G			32119357	32119357	-1	no_errors	ENST00000333892	ensembl	human	known	69_37n	missense	69	23.33	21	SNP	0.004	A
L3MBTL2	83746	genome.wustl.edu	37	22	41621831	41621831	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr22:41621831G>C	ENST00000216237.5	+	12	1548	c.1390G>C	c.(1390-1392)Gac>Cac	p.D464H		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	464					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GATCTGTGTGGACGGGGGGCC	0.577																																						dbGAP											0													96.0	73.0	81.0					22																	41621831		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1390G>C	22.37:g.41621831G>C	ENSP00000216237:p.Asp464His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.D464H	ENST00000216237.5	37	c.1390	CCDS14011.1	22	.	.	.	.	.	.	.	.	.	.	G	31	5.104906	0.94245	.	.	ENSG00000100395	ENST00000216237	T	0.51325	0.71	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.81269	0.4787	H	0.97540	4.025	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.988;1.0	D	0.87835	0.2647	10	0.87932	D	0	.	19.48	0.95005	0.0:0.0:1.0:0.0	.	464;464	Q969R5-3;Q969R5	.;LMBL2_HUMAN	H	464	ENSP00000216237:D464H	ENSP00000216237:D464H	D	+	1	0	L3MBTL2	39951777	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	9.869000	0.99810	2.606000	0.88127	0.655000	0.94253	GAC	L3MBTL2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000100395		0.577	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	HGNC	protein_coding	OTTHUMT00000320613.1	48	0.00	0	G	NM_031488		41621831	41621831	+1	no_errors	ENST00000216237	ensembl	human	known	69_37n	missense	56	17.65	12	SNP	1.000	C
L3MBTL2	83746	genome.wustl.edu	37	22	41621914	41621914	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr22:41621914G>C	ENST00000216237.5	+	12	1631	c.1473G>C	c.(1471-1473)caG>caC	p.Q491H		NM_031488.4	NP_113676.2	Q969R5	LMBL2_HUMAN	l(3)mbt-like 2 (Drosophila)	491					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(4)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						CCTTCTGTCAGAAGAATGACA	0.592																																						dbGAP											0													94.0	68.0	77.0					22																	41621914		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ305226	CCDS14011.1	22q13.31-q13.33	2008-06-11			ENSG00000100395	ENSG00000100395			18594	protein-coding gene	gene with protein product		611865				11682070	Standard	NM_031488		Approved	H-l(3)mbt-l, DKFZP761I141, dJ756G23.3	uc003azo.3	Q969R5	OTTHUMG00000150942	ENST00000216237.5:c.1473G>C	22.37:g.41621914G>C	ENSP00000216237:p.Gln491His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TEN1|Q96SC4|Q9BQI2|Q9UGS4	Missense_Mutation	SNP	pfam_Mbt,smart_Mbt,pfscan_Mbt,pfscan_Znf_FCS	p.Q491H	ENST00000216237.5	37	c.1473	CCDS14011.1	22	.	.	.	.	.	.	.	.	.	.	G	12.90	2.077259	0.36662	.	.	ENSG00000100395	ENST00000216237	T	0.30182	1.54	5.23	-2.64	0.06114	.	0.260567	0.45126	D	0.000394	T	0.20414	0.0491	L	0.31207	0.915	0.37787	D	0.92723	B;B	0.14805	0.007;0.011	B;B	0.21546	0.002;0.035	T	0.03818	-1.1001	10	0.56958	D	0.05	.	11.6947	0.51536	0.1225:0.0:0.7589:0.1186	.	491;491	Q969R5-3;Q969R5	.;LMBL2_HUMAN	H	491	ENSP00000216237:Q491H	ENSP00000216237:Q491H	Q	+	3	2	L3MBTL2	39951860	0.987000	0.35691	0.963000	0.40424	0.832000	0.47134	0.218000	0.17622	-0.835000	0.04234	-0.258000	0.10820	CAG	L3MBTL2	-	pfam_Mbt,smart_Mbt,pfscan_Mbt	ENSG00000100395		0.592	L3MBTL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	L3MBTL2	HGNC	protein_coding	OTTHUMT00000320613.1	49	0.00	0	G	NM_031488		41621914	41621914	+1	no_errors	ENST00000216237	ensembl	human	known	69_37n	missense	67	23.86	21	SNP	0.992	C
LINC00238	440184	genome.wustl.edu	37	14	66958842	66958842	+	lincRNA	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:66958842G>A	ENST00000556874.1	-	0	643				LINC00238_ENST00000389594.3_RNA																							CCAATGACCTGAAATTATCAC	0.388																																						dbGAP											0																																										-	-	-			0																															14.37:g.66958842G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000556874.1	37	NULL		14																																																																																			LINC00238	-	-	ENSG00000196553		0.388	RP11-72M17.1-001	KNOWN	basic	lincRNA	LINC00238	HGNC	lincRNA	OTTHUMT00000412209.1	34	0.00	0	G			66958842	66958842	+1	no_errors	ENST00000359454	ensembl	human	known	69_37n	rna	42	16.00	8	SNP	0.706	A
LMBRD2	92255	genome.wustl.edu	37	5	36105264	36105264	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:36105264C>T	ENST00000296603.4	-	17	2395	c.1933G>A	c.(1933-1935)Gaa>Aaa	p.E645K		NM_001007527.1	NP_001007528.1	Q68DH5	LMBD2_HUMAN	LMBR1 domain containing 2	645						integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(31;0.000146)		Epithelial(62;0.0396)|Lung(74;0.111)|all cancers(62;0.115)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CGGTCCCTTTCAGTCCTGTTA	0.408																																						dbGAP											0													164.0	157.0	159.0					5																	36105264		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS34145.1	5p13.2	2008-02-05			ENSG00000164187	ENSG00000164187			25287	protein-coding gene	gene with protein product							Standard	NM_001007527		Approved	DKFZp434H2226	uc003jkb.1	Q68DH5	OTTHUMG00000162150	ENST00000296603.4:c.1933G>A	5.37:g.36105264C>T	ENSP00000296603:p.Glu645Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KRB6|Q9NTC7	Missense_Mutation	SNP	pfam_LMBR1-like_membr_prot	p.E645K	ENST00000296603.4	37	c.1933	CCDS34145.1	5	.	.	.	.	.	.	.	.	.	.	C	21.3	4.129572	0.77549	.	.	ENSG00000164187	ENST00000296603;ENST00000546130	.	.	.	5.57	5.57	0.84162	.	0.153343	0.64402	D	0.000020	T	0.53174	0.1780	L	0.43152	1.355	0.50313	D	0.999867	B	0.30406	0.278	B	0.24974	0.057	T	0.51834	-0.8655	9	0.08179	T	0.78	-20.1502	19.9278	0.97110	0.0:1.0:0.0:0.0	.	645	Q68DH5	LMBD2_HUMAN	K	645;539	.	ENSP00000296603:E645K	E	-	1	0	LMBRD2	36141021	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	6.260000	0.72502	2.770000	0.95276	0.650000	0.86243	GAA	LMBRD2	-	NULL	ENSG00000164187		0.408	LMBRD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBRD2	HGNC	protein_coding	OTTHUMT00000367552.1	72	0.00	0	C	NM_001007527		36105264	36105264	-1	no_errors	ENST00000296603	ensembl	human	known	69_37n	missense	82	13.68	13	SNP	1.000	T
LPP	4026	genome.wustl.edu	37	3	188326971	188326971	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:188326971C>G	ENST00000312675.4	+	6	698	c.452C>G	c.(451-453)tCt>tGt	p.S151C	LPP_ENST00000543006.1_Missense_Mutation_p.S151C|LPP_ENST00000448637.1_Missense_Mutation_p.S151C|LPP_ENST00000471917.1_3'UTR	NM_001167672.1|NM_005578.3	NP_001161144.1|NP_005569.1	Q93052	LPP_HUMAN	LIM domain containing preferred translocation partner in lipoma	151	Pro-rich.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)		HMGA2/LPP(161)	NS(1)|breast(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(2)	10	all_cancers(143;1.37e-09)|all_hematologic(3;0.0429)|Ovarian(172;0.088)	all_lung(153;0.00139)|Lung NSC(153;0.00202)		GBM - Glioblastoma multiforme(93;0.00602)		TCAACAGCCTCTCCTCCAGTT	0.413			T	"""HMGA2, MLL, C12orf9"""	"""lipoma, leukemia"""																																	dbGAP		Dom	yes		3	3q28	4026	LIM domain containing preferred translocation partner in lipoma		"""L, M"""	0													124.0	120.0	122.0					3																	188326971		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL833171	CCDS3291.1	3q27-q28	2004-03-02	2002-01-14		ENSG00000145012	ENSG00000145012			6679	protein-coding gene	gene with protein product		600700	"""LIM domain-containing preferred translocation partner in lipoma"""			8812423	Standard	XM_005247453		Approved		uc003frs.2	Q93052	OTTHUMG00000156387	ENST00000312675.4:c.452C>G	3.37:g.188326971C>G	ENSP00000318089:p.Ser151Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L4L6|D3DNV6|Q8NFX5	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S151C	ENST00000312675.4	37	c.452	CCDS3291.1	3	.	.	.	.	.	.	.	.	.	.	C	19.48	3.835012	0.71373	.	.	ENSG00000145012	ENST00000448637;ENST00000416784;ENST00000312675;ENST00000543006	T;T;T;T	0.57436	1.81;0.64;0.4;0.4	5.64	5.64	0.86602	.	0.703682	0.14450	N	0.318859	T	0.61299	0.2336	L	0.40543	1.245	0.33998	D	0.64999	D;D;D	0.76494	0.999;0.959;0.999	P;P;P	0.61201	0.846;0.642;0.885	T	0.66139	-0.5998	10	0.41790	T	0.15	.	13.6291	0.62186	0.1547:0.8453:0.0:0.0	.	151;151;151	B7Z8W0;C9JUT4;Q93052	.;.;LPP_HUMAN	C	151	ENSP00000393602:S151C;ENSP00000410340:S151C;ENSP00000318089:S151C;ENSP00000438891:S151C	ENSP00000318089:S151C	S	+	2	0	LPP	189809665	0.821000	0.29204	0.997000	0.53966	0.871000	0.50021	4.885000	0.63142	2.674000	0.91012	0.655000	0.94253	TCT	LPP	-	NULL	ENSG00000145012		0.413	LPP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPP	HGNC	protein_coding	OTTHUMT00000344030.1	31	0.00	0	C	NM_005578		188326971	188326971	+1	no_errors	ENST00000312675	ensembl	human	known	69_37n	missense	28	14.71	5	SNP	0.999	G
LRP1B	53353	genome.wustl.edu	37	2	141253250	141253250	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:141253250G>A	ENST00000389484.3	-	56	9889	c.8918C>T	c.(8917-8919)tCt>tTt	p.S2973F		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	2973	EGF-like 12; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)			NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		AAAGCCTGAAGAGCATTCATC	0.428										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)	dbGAP											0													157.0	141.0	147.0					2																	141253250		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.8918C>T	2.37:g.141253250G>A	ENSP00000374135:p.Ser2973Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EGF-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S2973F	ENST00000389484.3	37	c.8918	CCDS2182.1	2	.	.	.	.	.	.	.	.	.	.	G	21.8	4.202629	0.79127	.	.	ENSG00000168702	ENST00000389484;ENST00000544579	D	0.90732	-2.72	5.73	5.73	0.89815	EGF-like calcium-binding, conserved site (1);Growth factor, receptor (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	0.075525	0.56097	D	0.000036	D	0.86838	0.6029	L	0.53780	1.695	0.40124	D	0.976637	P	0.45902	0.868	B	0.37047	0.24	D	0.87459	0.2406	10	0.45353	T	0.12	.	13.1479	0.59472	0.0728:0.0:0.9272:0.0	.	2973	Q9NZR2	LRP1B_HUMAN	F	2973;2911	ENSP00000374135:S2973F	ENSP00000374135:S2973F	S	-	2	0	LRP1B	140969720	1.000000	0.71417	0.962000	0.40283	0.994000	0.84299	5.542000	0.67218	2.718000	0.92993	0.585000	0.79938	TCT	LRP1B	-	superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000168702		0.428	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	72	0.00	0	G	NM_018557		141253250	141253250	-1	no_errors	ENST00000389484	ensembl	human	known	69_37n	missense	67	15.19	12	SNP	0.998	A
LTBP4	8425	genome.wustl.edu	37	19	41105378	41105378	+	De_novo_Start_OutOfFrame	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:41105378G>A	ENST00000545697.1	+	0	146				LTBP4_ENST00000204005.9_Missense_Mutation_p.R49Q|LTBP4_ENST00000308370.7_Missense_Mutation_p.R86Q|LTBP4_ENST00000396819.3_5'Flank|LTBP4_ENST00000602240.1_3'UTR			Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4						extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGCCCCCAGCGGTGCCTGAAC	0.632																																						dbGAP											0													79.0	92.0	88.0					19																	41105378		1996	4144	6140	-	-	-			0			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000545697.1:c.-1385G>A	19.37:g.41105378G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EGF-like,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.R86Q	ENST00000545697.1	37	c.257		19	.	.	.	.	.	.	.	.	.	.	G	12.71	2.020981	0.35606	.	.	ENSG00000090006	ENST00000204005;ENST00000308370	T;T	0.80909	-1.42;-1.43	4.41	-6.27	0.02026	.	1.627550	0.04190	N	0.328201	T	0.56046	0.1959	N	0.08118	0	0.09310	N	0.999996	B;B	0.06786	0.001;0.001	B;B	0.01281	0.0;0.0	T	0.41734	-0.9492	10	0.59425	D	0.04	.	0.7386	0.00970	0.4172:0.1268:0.1757:0.2803	.	86;49	Q8N2S1;E7ENG9	LTBP4_HUMAN;.	Q	49;86	ENSP00000204005:R49Q;ENSP00000311905:R86Q	ENSP00000204005:R49Q	R	+	2	0	LTBP4	45797218	0.011000	0.17503	0.000000	0.03702	0.202000	0.24057	-0.674000	0.05233	-0.652000	0.05408	0.555000	0.69702	CGG	LTBP4	-	NULL	ENSG00000090006		0.632	LTBP4-205	KNOWN	basic	protein_coding	LTBP4	HGNC	protein_coding		47	0.00	0	G	NM_003573		41105378	41105378	+1	no_errors	ENST00000308370	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	0.000	A
LY9	4063	genome.wustl.edu	37	1	160783497	160783497	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:160783497C>G	ENST00000263285.6	+	3	556	c.526C>G	c.(526-528)Cta>Gta	p.L176V	LY9_ENST00000471816.1_3'UTR|LY9_ENST00000392203.4_Missense_Mutation_p.L176V|LY9_ENST00000368041.2_Missense_Mutation_p.L136V|LY9_ENST00000341032.4_Missense_Mutation_p.L176V|LY9_ENST00000368037.5_Missense_Mutation_p.L176V|LY9_ENST00000368040.1_5'UTR			Q9HBG7	LY9_HUMAN	lymphocyte antigen 9	176	Ig-like C2-type 1.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			autonomic_ganglia(1)|breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(17)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	36	all_cancers(52;2.72e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00737)			TAACATCACTCTAATGTGCTC	0.527																																						dbGAP											0													111.0	106.0	108.0					1																	160783497		2203	4300	6503	-	-	-	SO:0001583	missense	0			L42621	CCDS30916.1, CCDS30917.1, CCDS65695.1, CCDS65696.1	1q23.3	2013-01-11			ENSG00000122224	ENSG00000122224		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6730	protein-coding gene	gene with protein product		600684				8537117, 7797269	Standard	NM_001261457		Approved	CD229, mLY9, SLAMF3, hly9	uc001fwu.4	Q9HBG7	OTTHUMG00000024007	ENST00000263285.6:c.526C>G	1.37:g.160783497C>G	ENSP00000263285:p.Leu176Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K7N3|Q14775|Q5VYI3|Q6P2J4|Q9H4N5|Q9NQ24	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.L176V	ENST00000263285.6	37	c.526	CCDS30916.1	1	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426435	0.43020	.	.	ENSG00000122224	ENST00000368041;ENST00000341032;ENST00000263285;ENST00000542780;ENST00000392203;ENST00000368037;ENST00000368036	T;T	0.08008	3.14;3.14	4.13	2.16	0.27623	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.56097	D	0.000028	T	0.17916	0.0430	M	0.91510	3.215	0.24281	N	0.995204	D;D;D;D;D;D	0.89917	0.997;0.999;1.0;0.999;1.0;0.999	D;D;D;D;D;D	0.87578	0.997;0.998;0.985;0.998;0.998;0.998	T	0.04855	-1.0922	10	0.87932	D	0	-8.8467	6.6284	0.22843	0.0:0.753:0.0:0.247	.	176;136;136;176;176;176	B4E0J5;Q5VYH7;Q5VYH9;E7EME5;Q9HBG7-2;Q9HBG7	.;.;.;.;.;LY9_HUMAN	V	176;176;176;176;136;136;78	ENSP00000342921:L176V;ENSP00000263285:L176V	ENSP00000263285:L176V	L	+	1	2	LY9	159050121	0.019000	0.18553	0.030000	0.17652	0.021000	0.10359	0.305000	0.19254	0.405000	0.25532	-0.251000	0.11542	CTA	LY9	-	pfscan_Ig-like	ENSG00000122224		0.527	LY9-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LY9	HGNC	protein_coding	OTTHUMT00000060457.3	40	0.00	0	C	NM_002348		160783497	160783497	+1	no_errors	ENST00000263285	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	0.303	G
LYPD2	137797	genome.wustl.edu	37	8	143833840	143833840	+	Silent	SNP	C	C	T	rs78400087	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:143833840C>T	ENST00000359228.3	-	1	112	c.30G>A	c.(28-30)gcG>gcA	p.A10A		NM_205545.1	NP_991108.1	Q6UXB3	LYPD2_HUMAN	LY6/PLAUR domain containing 2	10						anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|skin(2)	7	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CCAGCACCAGCGCCAGGAGCG	0.687																																						dbGAP											0													44.0	50.0	48.0					8																	143833840		2202	4296	6498	-	-	-	SO:0001819	synonymous_variant	0			AY358432	CCDS6388.1	8q24.3	2005-08-30		2005-08-30	ENSG00000197353	ENSG00000197353			25215	protein-coding gene	gene with protein product				LYPDC2		12975309	Standard	NM_205545		Approved	RGTR430, UNQ430	uc003ywz.3	Q6UXB3	OTTHUMG00000164686	ENST00000359228.3:c.30G>A	8.37:g.143833840C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2R6|Q0VD64|Q0VF31	Silent	SNP	pfam_LY6_UPAR,smart_LY6_UPA_recep-like	p.A10	ENST00000359228.3	37	c.30	CCDS6388.1	8																																																																																			LYPD2	-	NULL	ENSG00000197353		0.687	LYPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYPD2	HGNC	protein_coding	OTTHUMT00000379742.1	107	0.00	0	C	NM_205545		143833840	143833840	-1	no_errors	ENST00000359228	ensembl	human	known	69_37n	silent	77	38.40	48	SNP	0.021	T
MAB21L1	4081	genome.wustl.edu	37	13	36049917	36049917	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:36049917G>A	ENST00000379919.4	-	1	915	c.359C>T	c.(358-360)tCc>tTc	p.S120F	NBEA_ENST00000400445.3_Intron|NBEA_ENST00000379939.2_Intron|NBEA_ENST00000310336.4_Intron|NBEA_ENST00000540320.1_Intron|NBEA_ENST00000537702.1_5'Flank	NM_005584.4	NP_005575.1	Q13394	MB211_HUMAN	mab-21-like 1 (C. elegans)	120					anatomical structure morphogenesis (GO:0009653)|camera-type eye development (GO:0043010)|positive regulation of cell proliferation (GO:0008284)	nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	20		Breast(139;0.014)|Lung SC(185;0.051)|Prostate(109;0.202)		all cancers(112;9.63e-08)|Epithelial(112;1.37e-06)|BRCA - Breast invasive adenocarcinoma(63;0.000659)|OV - Ovarian serous cystadenocarcinoma(117;0.00372)|GBM - Glioblastoma multiforme(144;0.115)		GAGGTAGCCGGAGGCGGTAAT	0.592																																						dbGAP											0													45.0	46.0	46.0					13																	36049917		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC028170	CCDS9353.1	13q13.3	2008-02-05	2001-11-28		ENSG00000180660	ENSG00000180660			6757	protein-coding gene	gene with protein product		601280	"""mab-21 (C. elegans)-like 1"""			8733127	Standard	NM_005584		Approved	CAGR1		Q13394	OTTHUMG00000016723	ENST00000379919.4:c.359C>T	13.37:g.36049917G>A	ENSP00000369251:p.Ser120Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6I9T5	Missense_Mutation	SNP	pfam_Mab-21_dom	p.S120F	ENST00000379919.4	37	c.359	CCDS9353.1	13	.	.	.	.	.	.	.	.	.	.	G	21.8	4.204611	0.79127	.	.	ENSG00000180660	ENST00000379919	T	0.09073	3.02	5.66	5.66	0.87406	.	0.000000	0.85682	D	0.000000	T	0.35393	0.0930	M	0.83852	2.665	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.09058	-1.0692	10	0.72032	D	0.01	-15.5188	19.7375	0.96212	0.0:0.0:1.0:0.0	.	120	Q13394	MB211_HUMAN	F	120	ENSP00000369251:S120F	ENSP00000369251:S120F	S	-	2	0	MAB21L1	34947917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.869000	0.99810	2.680000	0.91292	0.655000	0.94253	TCC	MAB21L1	-	pfam_Mab-21_dom	ENSG00000180660		0.592	MAB21L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAB21L1	HGNC	protein_coding	OTTHUMT00000044459.3	34	0.00	0	G	NM_005584		36049917	36049917	-1	no_errors	ENST00000379919	ensembl	human	known	69_37n	missense	39	15.22	7	SNP	1.000	A
MACROD2	140733	genome.wustl.edu	37	20	14032577	14032577	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:14032577C>G	ENST00000310348.4	+	3	163				MACROD2_ENST00000217246.4_Intron			A1Z1Q3	MACD2_HUMAN	MACRO domain containing 2						brain development (GO:0007420)|cellular response to DNA damage stimulus (GO:0006974)|protein de-ADP-ribosylation (GO:0051725)|purine nucleoside metabolic process (GO:0042278)	nucleus (GO:0005634)	deacetylase activity (GO:0019213)|hydrolase activity, acting on glycosyl bonds (GO:0016798)			breast(2)|kidney(4)|large_intestine(5)|lung(8)|skin(1)	20		all_neural(2;0.0381)|Acute lymphoblastic leukemia(2;0.175)				GGATGCATCTCTCATGGTTGA	0.443																																						dbGAP											0													97.0	83.0	87.0					20																	14032577		1568	3582	5150	-	-	-	SO:0001627	intron_variant	0			BC101218	CCDS13120.2, CCDS33443.1	20p12.1	2011-04-28	2007-07-24	2007-07-24	ENSG00000172264	ENSG00000172264			16126	protein-coding gene	gene with protein product		611567	"""chromosome 20 open reading frame 133"""	C20orf133			Standard	NM_080676		Approved	dJ631M13.5	uc002wot.3	A1Z1Q3	OTTHUMG00000031919	ENST00000310348.4:c.164-33690C>G	20.37:g.14032577C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFF7|B0QZ39|B3KWV0|Q0P6D5|Q495E0|Q5W199|Q6ZN71	RNA	SNP	-	NULL	ENST00000310348.4	37	NULL	CCDS13120.2	20																																																																																			MACROD2	-	-	ENSG00000172264		0.443	MACROD2-201	KNOWN	basic|CCDS	protein_coding	MACROD2	HGNC	protein_coding		74	0.00	0	C	NM_080676		14032577	14032577	+1	no_errors	ENST00000462552	ensembl	human	known	69_37n	rna	78	20.41	20	SNP	0.995	G
MAGIX	79917	genome.wustl.edu	37	X	49022629	49022629	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:49022629C>T	ENST00000412696.2	+	6	896	c.896C>T	c.(895-897)tCc>tTc	p.S299F	MAGIX_ENST00000425661.2_Missense_Mutation_p.S223F|MAGIX_ENST00000498742.1_3'UTR|MAGIX_ENST00000376339.1_Missense_Mutation_p.S235F|MAGIX_ENST00000376338.3_Missense_Mutation_p.S240F	NM_024859.2	NP_079135.3	Q9H6Y5	MAGIX_HUMAN	MAGI family member, X-linked	299																	ATCCCGGGTTCCCCGGGGCCC	0.731																																						dbGAP											0													5.0	6.0	6.0					X																	49022629		1727	3899	5626	-	-	-	SO:0001583	missense	0			AK025340	CCDS48106.1, CCDS48107.1, CCDS75976.1	Xp11.23	2014-05-06			ENSG00000017621	ENSG00000269313			30006	protein-coding gene	gene with protein product							Standard	XM_005278065		Approved	PDZX, JM10, FLJ21687	uc010nin.1	Q9H6Y5	OTTHUMG00000188218	ENST00000412696.2:c.896C>T	X.37:g.49022629C>T	ENSP00000387928:p.Ser299Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	A6XND4|A8MSX9|B7WP26|Q14C81	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.S299F	ENST00000412696.2	37	c.896	CCDS48106.1	X	.	.	.	.	.	.	.	.	.	.	.	18.85	3.711360	0.68730	.	.	ENSG00000017621	ENST00000376339;ENST00000425661;ENST00000412696;ENST00000376338	T;T;T;T	0.27256	1.84;1.92;1.71;1.68	3.86	3.86	0.44501	.	0.237699	0.21888	N	0.067623	T	0.35480	0.0933	L	0.29908	0.895	0.28784	N	0.899696	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.71656	0.961;0.942;0.974;0.974	T	0.09164	-1.0687	10	0.87932	D	0	-12.2987	11.0003	0.47602	0.0:1.0:0.0:0.0	.	223;299;235;240	F8WCY7;Q9H6Y5;Q9H6Y5-3;Q9H6Y5-2	.;MAGIX_HUMAN;.;.	F	235;223;299;240	ENSP00000365517:S235F;ENSP00000403515:S223F;ENSP00000387928:S299F;ENSP00000365516:S240F	ENSP00000365516:S240F	S	+	2	0	MAGIX	48909573	0.985000	0.35326	0.826000	0.32828	0.582000	0.36321	0.970000	0.29383	1.865000	0.54081	0.538000	0.68166	TCC	MAGIX	-	NULL	ENSG00000017621		0.731	MAGIX-009	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGIX	HGNC	protein_coding	OTTHUMT00000378832.1	45	0.00	0	C	NM_024859		49022629	49022629	+1	no_errors	ENST00000412696	ensembl	human	known	69_37n	missense	40	14.89	7	SNP	0.978	T
MAGEA8	4107	genome.wustl.edu	37	X	149014002	149014002	+	Nonstop_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:149014002G>C	ENST00000542674.1	+	3	1477	c.956G>C	c.(955-957)tGa>tCa	p.*319S	MAGEA8_ENST00000535454.1_Nonstop_Mutation_p.*319S|MAGEA8_ENST00000286482.1_Nonstop_Mutation_p.*319S	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	0										NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					AAAGGAGTTTGAGCAGGAGTT	0.557																																						dbGAP											0													56.0	56.0	56.0					X																	149014002		2199	4292	6491	-	-	-	SO:0001578	stop_lost	0				CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.956G>C	X.37:g.149014002G>C	ENSP00000443776:p.*319Serext*42	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUN9	Nonstop_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.*319S	ENST00000542674.1	37	c.956	CCDS14692.1	X	.	.	.	.	.	.	.	.	.	.	.	0.030	-1.342230	0.01277	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	.	.	.	0.68	-1.36	0.09085	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	S	319	.	.	X	+	2	2	MAGEA8	148774660	0.000000	0.05858	0.001000	0.08648	0.222000	0.24845	0.110000	0.15437	-1.195000	0.02680	0.190000	0.17370	TGA	MAGEA8	-	NULL	ENSG00000156009		0.557	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA8	HGNC	protein_coding	OTTHUMT00000058728.1	130	0.00	0	G	NM_005364		149014002	149014002	+1	no_errors	ENST00000286482	ensembl	human	known	69_37n	nonstop	153	15.00	27	SNP	0.001	C
MAP2	4133	genome.wustl.edu	37	2	210557365	210557365	+	Silent	SNP	G	G	C	rs369308118		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:210557365G>C	ENST00000360351.4	+	7	977	c.471G>C	c.(469-471)tcG>tcC	p.S157S	MAP2_ENST00000447185.1_Silent_p.S153S|MAP2_ENST00000392194.1_Intron|MAP2_ENST00000199940.6_Intron|MAP2_ENST00000361559.4_Intron	NM_002374.3	NP_002365.3	P11137	MTAP2_HUMAN	microtubule-associated protein 2	157					axonogenesis (GO:0007409)|cellular response to organic substance (GO:0071310)|central nervous system neuron development (GO:0021954)|dendrite morphogenesis (GO:0048813)|microtubule bundle formation (GO:0001578)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|neuronal cell body (GO:0043025)|nuclear periphery (GO:0034399)	dystroglycan binding (GO:0002162)|structural molecule activity (GO:0005198)			breast(7)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(36)|liver(2)|lung(42)|ovary(11)|pancreas(2)|prostate(2)|skin(2)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	124		Hepatocellular(293;0.137)|Lung NSC(271;0.163)|Renal(323;0.202)		UCEC - Uterine corpus endometrioid carcinoma (47;6.64e-05)|Epithelial(149;3.12e-100)|all cancers(144;6.88e-91)|Lung(261;0.0624)|LUSC - Lung squamous cell carcinoma(261;0.0662)|STAD - Stomach adenocarcinoma(1183;0.18)	Docetaxel(DB01248)|Estramustine(DB01196)|Paclitaxel(DB01229)	TTACAGCCTCGAAGATGGAGT	0.393																																					Pancreas(27;423 979 28787 29963)	dbGAP											0													60.0	58.0	59.0					2																	210557365		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS2384.1, CCDS2385.1, CCDS33369.1	2q34-q35	2008-05-27			ENSG00000078018	ENSG00000078018		"""A-kinase anchor proteins"""	6839	protein-coding gene	gene with protein product		157130				3103857, 7479905	Standard	XM_005246554		Approved	MAP2A, MAP2B, MAP2C	uc002vde.1	P11137	OTTHUMG00000132962	ENST00000360351.4:c.471G>C	2.37:g.210557365G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q17S04|Q8IUX2|Q99975|Q99976	Silent	SNP	pfam_MAP2_projctn,pfam_Tau/MAP_tubulin-bd_rpt	p.S157	ENST00000360351.4	37	c.471	CCDS2384.1	2																																																																																			MAP2	-	NULL	ENSG00000078018		0.393	MAP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP2	HGNC	protein_coding	OTTHUMT00000256521.2	62	0.00	0	G	NM_001039538		210557365	210557365	+1	no_errors	ENST00000360351	ensembl	human	known	69_37n	silent	62	21.52	17	SNP	1.000	C
MAP2K1	5604	genome.wustl.edu	37	15	66781598	66781598	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:66781598G>C	ENST00000307102.5	+	9	1537	c.1006G>C	c.(1006-1008)Gat>Cat	p.D336H	CTD-3185P2.2_ENST00000602360.1_RNA|CTD-3185P2.1_ENST00000565387.1_RNA|MAP2K1_ENST00000566326.1_Missense_Mutation_p.D160H	NM_002755.3	NP_002746.1	Q02750	MP2K1_HUMAN	mitogen-activated protein kinase kinase 1	336	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cell proliferation (GO:0008283)|cellular component movement (GO:0006928)|cellular senescence (GO:0090398)|chemotaxis (GO:0006935)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|Golgi inheritance (GO:0048313)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|keratinocyte differentiation (GO:0030216)|labyrinthine layer development (GO:0060711)|MAPK cascade (GO:0000165)|melanosome transport (GO:0032402)|mitotic nuclear division (GO:0007067)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell proliferation (GO:0008285)|negative regulation of homotypic cell-cell adhesion (GO:0034111)|neurotrophin TRK receptor signaling pathway (GO:0048011)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell migration (GO:0030335)|positive regulation of gene expression (GO:0010628)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|protein heterooligomerization (GO:0051291)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|regulation of vascular smooth muscle contraction (GO:0003056)|response to axon injury (GO:0048678)|response to glucocorticoid (GO:0051384)|response to oxidative stress (GO:0006979)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vesicle transport along microtubule (GO:0047496)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine phosphatase activity (GO:0004728)			endometrium(2)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(8)|urinary_tract(1)	20					Bosutinib(DB06616)|Trametinib(DB08911)	GGAATTTCAAGATTTTGTGAA	0.473																																						dbGAP											0													115.0	103.0	107.0					15																	66781598		2201	4299	6500	-	-	-	SO:0001583	missense	0			L11284	CCDS10216.1	15q22.1-q22.33	2014-09-17			ENSG00000169032	ENSG00000169032	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6840	protein-coding gene	gene with protein product		176872		PRKMK1		9465908, 8388392	Standard	NM_002755		Approved	MEK1, MAPKK1	uc010bhq.3	Q02750	OTTHUMG00000133196	ENST00000307102.5:c.1006G>C	15.37:g.66781598G>C	ENSP00000302486:p.Asp336His	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D336H	ENST00000307102.5	37	c.1006	CCDS10216.1	15	.	.	.	.	.	.	.	.	.	.	G	27.5	4.836628	0.91117	.	.	ENSG00000169032	ENST00000307102	D	0.94576	-3.46	5.63	5.63	0.86233	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	D	0.96589	0.8887	M	0.68593	2.085	0.80722	D	1	D;D	0.64830	0.994;0.989	D;P	0.64877	0.93;0.897	D	0.96359	0.9264	10	0.52906	T	0.07	-24.9385	18.2734	0.90076	0.0:0.0:1.0:0.0	.	314;336	B4DFY5;Q02750	.;MP2K1_HUMAN	H	336	ENSP00000302486:D336H	ENSP00000302486:D336H	D	+	1	0	MAP2K1	64568652	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.513000	0.98010	2.652000	0.90054	0.655000	0.94253	GAT	MAP2K1	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	ENSG00000169032		0.473	MAP2K1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K1	HGNC	protein_coding	OTTHUMT00000256906.4	35	0.00	0	G			66781598	66781598	+1	no_errors	ENST00000307102	ensembl	human	known	69_37n	missense	33	17.50	7	SNP	1.000	C
MAP7D2	256714	genome.wustl.edu	37	X	20030534	20030534	+	Missense_Mutation	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:20030534C>A	ENST00000379651.3	-	14	1900	c.1882G>T	c.(1882-1884)Gat>Tat	p.D628Y	MAP7D2_ENST00000379643.5_Missense_Mutation_p.D669Y|MAP7D2_ENST00000543767.1_Missense_Mutation_p.D513Y|MAP7D2_ENST00000452324.3_Missense_Mutation_p.D576Y|MAP7D2_ENST00000443379.3_Missense_Mutation_p.D583Y	NM_152780.3	NP_689993.2	Q96T17	MA7D2_HUMAN	MAP7 domain containing 2	628					microtubule cytoskeleton organization (GO:0000226)	microtubule (GO:0005874)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	37						TCAAGGGCATCCAGATGAATG	0.443																																						dbGAP											0													153.0	143.0	146.0					X																	20030534		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC089400	CCDS14195.1, CCDS55384.1, CCDS55385.1, CCDS55386.1	Xp22.12	2008-02-05			ENSG00000184368	ENSG00000184368			25899	protein-coding gene	gene with protein product						12477932	Standard	NM_152780		Approved	FLJ14503	uc010nfo.2	Q96T17	OTTHUMG00000021228	ENST00000379651.3:c.1882G>T	X.37:g.20030534C>A	ENSP00000368972:p.Asp628Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2J8|B7Z3S7|B9EGC7|C9JMA4|C9JYW0|Q5EBN1|Q5JPS7|Q6PIC7|Q8N792	Missense_Mutation	SNP	pfam_E-MAP-115	p.D669Y	ENST00000379651.3	37	c.2005	CCDS14195.1	X	.	.	.	.	.	.	.	.	.	.	C	19.97	3.924959	0.73213	.	.	ENSG00000184368	ENST00000379651;ENST00000379643;ENST00000543767;ENST00000443379;ENST00000544957;ENST00000452324	D;D;D;D;D	0.88431	-2.38;-2.38;-2.38;-2.38;-2.38	5.54	5.54	0.83059	.	0.073354	0.56097	D	0.000034	D	0.93203	0.7835	L	0.54323	1.7	0.43583	D	0.995924	D;D;D;D;D	0.76494	0.998;0.999;0.999;0.998;0.998	D;D;D;D;D	0.75020	0.966;0.985;0.985;0.966;0.968	D	0.93815	0.7113	10	0.87932	D	0	-12.023	18.598	0.91236	0.0:1.0:0.0:0.0	.	583;576;669;628;513	B7Z3S7;C9JYW0;Q96T17-2;Q96T17;F5GYC2	.;.;.;MA7D2_HUMAN;.	Y	628;669;513;583;311;576	ENSP00000368972:D628Y;ENSP00000368964:D669Y;ENSP00000440691:D513Y;ENSP00000388239:D583Y;ENSP00000413301:D576Y	ENSP00000368964:D669Y	D	-	1	0	MAP7D2	19940455	1.000000	0.71417	0.729000	0.30791	0.777000	0.43975	5.762000	0.68809	2.335000	0.79485	0.525000	0.51046	GAT	MAP7D2	-	NULL	ENSG00000184368		0.443	MAP7D2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP7D2	HGNC	protein_coding	OTTHUMT00000056001.1	59	0.00	0	C	NM_152780		20030534	20030534	-1	no_errors	ENST00000379643	ensembl	human	known	69_37n	missense	79	11.24	10	SNP	1.000	A
MAS1	4142	genome.wustl.edu	37	6	160328584	160328584	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:160328584C>T	ENST00000252660.4	+	1	611	c.597C>T	c.(595-597)ttC>ttT	p.F199F		NM_002377.2	NP_002368.1	P04201	MAS_HUMAN	MAS1 proto-oncogene, G protein-coupled receptor	199					activation of NF-kappaB-inducing kinase activity (GO:0007250)|anatomical structure morphogenesis (GO:0009653)|cell proliferation (GO:0008283)|cellular response to peptide hormone stimulus (GO:0071375)|G-protein coupled receptor signaling pathway (GO:0007186)|hippocampus development (GO:0021766)|male gonad development (GO:0008584)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA replication (GO:0045740)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|protein kinase C signaling (GO:0070528)|regulation of inflammatory response (GO:0050727)|response to activity (GO:0014823)|response to drug (GO:0042493)|response to gonadotropin (GO:0034698)|spermatogenesis (GO:0007283)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	angiotensin receptor activity (GO:0001595)|angiotensin type II receptor activity (GO:0004945)|G-protein coupled receptor activity (GO:0004930)|peptide binding (GO:0042277)|peptide hormone binding (GO:0017046)			breast(2)|endometrium(3)|kidney(1)|large_intestine(2)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	23		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;2.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.6e-06)		TCCTGGTCTTCACGCCCCTCA	0.507																																						dbGAP											0													116.0	112.0	113.0					6																	160328584		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			M13150	CCDS5272.1	6q24-q27	2014-06-26	2014-06-26		ENSG00000130368	ENSG00000130368		"""GPCR / Class A : Orphans"""	6899	protein-coding gene	gene with protein product		165180	"""MAS1 oncogene"""				Standard	NM_002377		Approved		uc003qsz.3	P04201	OTTHUMG00000015944	ENST00000252660.4:c.597C>T	6.37:g.160328584C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	E1P5B3|Q2TBC9|Q6FG47	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam,prints_Mas_TM,prints_7TM_GPCR_Rhodpsn	p.F199	ENST00000252660.4	37	c.597	CCDS5272.1	6																																																																																			MAS1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_supfam	ENSG00000130368		0.507	MAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAS1	HGNC	protein_coding	OTTHUMT00000042930.2	20	0.00	0	C	NM_002377		160328584	160328584	+1	no_errors	ENST00000252660	ensembl	human	known	69_37n	silent	31	20.51	8	SNP	0.912	T
MBD3	53615	genome.wustl.edu	37	19	1592612	1592612	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:1592612C>T	ENST00000434436.3	-	1	148	c.19G>A	c.(19-21)Gag>Aag	p.E7K	MBD3_ENST00000592012.1_Intron|MBD3_ENST00000585967.1_5'Flank|UQCR11_ENST00000585937.1_Intron|MBD3_ENST00000156825.1_Missense_Mutation_p.E7K	NM_001281453.1	NP_001268382.1	O95983	MBD3_HUMAN	methyl-CpG binding domain protein 3	7	MBD. {ECO:0000255|PROSITE- ProRule:PRU00338}.				ATP-dependent chromatin remodeling (GO:0043044)|histone acetylation (GO:0016573)|in utero embryonic development (GO:0001701)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|tissue development (GO:0009888)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|heterochromatin (GO:0000792)|nuclear chromatin (GO:0000790)|NuRD complex (GO:0016581)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|methyl-CpG binding (GO:0008327)			central_nervous_system(1)|large_intestine(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	8		Acute lymphoblastic leukemia(61;3.02e-13)|all_hematologic(61;4.32e-09)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.179)|STAD - Stomach adenocarcinoma(1328;0.18)		GCCGGGCACTCCCACCTCTTC	0.731																																						dbGAP											0													18.0	19.0	19.0					19																	1592612		2199	4289	6488	-	-	-	SO:0001583	missense	0			AF072247	CCDS12072.1, CCDS62481.1	19p13	2008-07-17				ENSG00000071655			6918	protein-coding gene	gene with protein product		603573				9774669, 10441743	Standard	NM_001281454		Approved		uc002ltl.1	O95983		ENST00000434436.3:c.19G>A	19.37:g.1592612C>T	ENSP00000412302:p.Glu7Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4B7|D6W5Z2|Q6PIL9|Q6PJZ9|Q86XF4	Missense_Mutation	SNP	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,superfamily_ARM-type_fold,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.E7K	ENST00000434436.3	37	c.19	CCDS12072.1	19	.	.	.	.	.	.	.	.	.	.	C	20.9	4.072705	0.76415	.	.	ENSG00000071655	ENST00000156825	D	0.99376	-5.79	3.03	3.03	0.35002	Methyl-CpG DNA binding (4);DNA-binding, integrase-type (1);	0.565508	0.15032	U	0.284409	D	0.97964	0.9330	L	0.54323	1.7	0.50813	D	0.999891	B	0.27594	0.182	B	0.31614	0.133	D	0.99236	1.0883	10	0.56958	D	0.05	-18.8749	11.492	0.50387	0.0:1.0:0.0:0.0	.	7	O95983	MBD3_HUMAN	K	7	ENSP00000156825:E7K	ENSP00000156825:E7K	E	-	1	0	MBD3	1543612	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	3.207000	0.51106	1.540000	0.49301	0.174000	0.16983	GAG	MBD3	-	pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	ENSG00000071655		0.731	MBD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3	HGNC	protein_coding	OTTHUMT00000449658.2	9	0.00	0	C	NM_003926		1592612	1592612	-1	no_errors	ENST00000156825	ensembl	human	known	69_37n	missense	5	44.44	4	SNP	1.000	T
MCM3AP	8888	genome.wustl.edu	37	21	47697514	47697514	+	Silent	SNP	C	C	T	rs374057302		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr21:47697514C>T	ENST00000397708.1	-	6	2039	c.1785G>A	c.(1783-1785)ctG>ctA	p.L595L	MCM3AP_ENST00000291688.1_Silent_p.L595L			O60318	GANP_HUMAN	minichromosome maintenance complex component 3 associated protein	595					DNA replication (GO:0006260)|immune system process (GO:0002376)|mRNA transport (GO:0051028)|protein import into nucleus (GO:0006606)	cytosol (GO:0005829)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|transferase activity, transferring acyl groups (GO:0016746)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(10)|kidney(5)|large_intestine(17)|lung(24)|ovary(4)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	72	Breast(49;0.112)					CAGTGCCTATCAGGGTACTGA	0.567																																						dbGAP											0													155.0	130.0	139.0					21																	47697514		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB005543	CCDS13734.1	21q22.3	2012-12-19	2007-04-04		ENSG00000160294	ENSG00000160294			6946	protein-coding gene	gene with protein product	"""germinal-centre associated nuclear protein"""	603294	"""minichromosome maintenance deficient (S. cerevisiae) 3-associated protein"", ""MCM3 minichromosome maintenance deficient 3 (S. cerevisiae) associated protein"""			9712829, 16914116, 21195085	Standard	XM_005261205		Approved	Map80, KIAA0572, GANP, SAC3	uc002zir.1	O60318	OTTHUMG00000090630	ENST00000397708.1:c.1785G>A	21.37:g.47697514C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	C9JL56|Q2M3C1|Q6PJP6|Q9BSY5|Q9UMT4	Silent	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.L595	ENST00000397708.1	37	c.1785	CCDS13734.1	21																																																																																			MCM3AP	-	NULL	ENSG00000160294		0.567	MCM3AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM3AP	HGNC	protein_coding	OTTHUMT00000207254.1	101	0.00	0	C	NM_003906		47697514	47697514	-1	no_errors	ENST00000291688	ensembl	human	known	69_37n	silent	76	11.63	10	SNP	0.339	T
MDGA2	161357	genome.wustl.edu	37	14	47324259	47324259	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:47324259G>A	ENST00000399232.2	-	15	3008	c.2644C>T	c.(2644-2646)Cat>Tat	p.H882Y	MDGA2_ENST00000399222.3_Missense_Mutation_p.H84Y|MDGA2_ENST00000439988.3_Missense_Mutation_p.H951Y|MDGA2_ENST00000357362.3_Missense_Mutation_p.H653Y|MDGA2_ENST00000426342.1_Missense_Mutation_p.H653Y	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	882	MAM. {ECO:0000255|PROSITE- ProRule:PRU00128}.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						ATATTAACATGAGCCTCATTC	0.343																																						dbGAP											0													143.0	132.0	135.0					14																	47324259		1826	4077	5903	-	-	-	SO:0001583	missense	0			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.2644C>T	14.37:g.47324259G>A	ENSP00000382178:p.His882Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like	p.H951Y	ENST00000399232.2	37	c.2851		14	.	.	.	.	.	.	.	.	.	.	G	14.36	2.513199	0.44660	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000399222;ENST00000357362	T;T;T;T;T	0.02216	4.39;4.39;4.39;4.39;4.39	4.73	4.73	0.59995	Concanavalin A-like lectin/glucanase (1);MAM domain (3);	0.000000	0.53938	U	0.000057	T	0.03783	0.0107	L	0.28694	0.88	0.38623	D	0.951197	B	0.31256	0.316	B	0.39971	0.315	T	0.53507	-0.8429	10	0.72032	D	0.01	.	15.5477	0.76118	0.0:0.0:1.0:0.0	.	882	Q7Z553	MDGA2_HUMAN	Y	882;653;951;84;653	ENSP00000400011:H882Y;ENSP00000405456:H653Y;ENSP00000382178:H951Y;ENSP00000382168:H84Y;ENSP00000349925:H653Y	ENSP00000349925:H653Y	H	-	1	0	MDGA2	46394009	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.009000	0.63998	2.333000	0.79357	0.557000	0.71058	CAT	MDGA2	-	pfam_MAM_dom,superfamily_ConA-like_lec_gl,smart_MAM_dom,pfscan_MAM_dom	ENSG00000139915		0.343	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	51	0.00	0	G	NM_182830		47324259	47324259	-1	no_errors	ENST00000399232	ensembl	human	known	69_37n	missense	48	12.73	7	SNP	1.000	A
MED14	9282	genome.wustl.edu	37	X	40573051	40573051	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:40573051G>A	ENST00000324817.1	-	5	749	c.631C>T	c.(631-633)Cag>Tag	p.Q211*		NM_004229.3	NP_004220.2	O60244	MED14_HUMAN	mediator complex subunit 14	211	Interaction with STAT2.				androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|receptor activity (GO:0004872)|RNA polymerase II transcription cofactor activity (GO:0001104)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(2)|breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						TTTGCTAACTGAGGAGGAAGA	0.413																																						dbGAP											0													172.0	152.0	158.0					X																	40573051		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB006651	CCDS14254.1	Xp11.4	2008-05-14	2007-07-30	2007-07-30	ENSG00000180182	ENSG00000180182			2370	protein-coding gene	gene with protein product		300182	"""cofactor required for Sp1 transcriptional activation, subunit 2, 150kDa"""	CXorf4, CRSP2		9989412, 9598311	Standard	NM_004229		Approved	EXLM1, CRSP150, TRAP170, RGR1, CSRP	uc004dex.4	O60244	OTTHUMG00000024107	ENST00000324817.1:c.631C>T	X.37:g.40573051G>A	ENSP00000323720:p.Gln211*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q4KMR7|Q9UNB3	Nonsense_Mutation	SNP	pfam_Mediator_Med14	p.Q211*	ENST00000324817.1	37	c.631	CCDS14254.1	X	.	.	.	.	.	.	.	.	.	.	G	37	6.112257	0.97296	.	.	ENSG00000180182	ENST00000324817	.	.	.	4.91	4.91	0.64330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	17.5503	0.87873	0.0:0.0:1.0:0.0	.	.	.	.	X	211	.	ENSP00000323720:Q211X	Q	-	1	0	MED14	40457995	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.355000	0.97087	2.161000	0.67846	0.544000	0.68410	CAG	MED14	-	pfam_Mediator_Med14	ENSG00000180182		0.413	MED14-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MED14	HGNC	protein_coding	OTTHUMT00000060692.1	53	0.00	0	G	NM_004229		40573051	40573051	-1	no_errors	ENST00000324817	ensembl	human	known	69_37n	nonsense	63	11.27	8	SNP	1.000	A
MED16	10025	genome.wustl.edu	37	19	881682	881682	+	Missense_Mutation	SNP	G	G	A	rs556826884		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:881682G>A	ENST00000589119.1	-	6	1017	c.1018C>T	c.(1018-1020)Cgg>Tgg	p.R340W	MED16_ENST00000269814.4_Missense_Mutation_p.R340W|MED16_ENST00000325464.1_Missense_Mutation_p.R340W|MED16_ENST00000312090.6_Missense_Mutation_p.R340W|MED16_ENST00000606828.1_Intron|MED16_ENST00000395808.3_Missense_Mutation_p.R340W			Q9Y2X0	MED16_HUMAN	mediator complex subunit 16	340					androgen receptor signaling pathway (GO:0030521)|gene expression (GO:0010467)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|positive regulation of receptor activity (GO:2000273)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|receptor activity (GO:0004872)|thyroid hormone receptor binding (GO:0046966)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(12)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	21		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;6.59e-06)|all_lung(49;9.97e-06)|Breast(49;9.42e-05)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GATAGGATCCGCCATTTGAGA	0.577													G|||	1	0.000199681	0.0	0.0	5008	,	,		18695	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													100.0	92.0	95.0					19																	881682		2203	4295	6498	-	-	-	SO:0001583	missense	0			AF121228	CCDS12047.1	19p13.3	2013-01-10	2007-07-30	2007-07-30		ENSG00000175221		"""WD repeat domain containing"""	17556	protein-coding gene	gene with protein product		604062	"""thyroid hormone receptor associated protein 5"""	THRAP5		10235266, 10198638	Standard	NM_005481		Approved	DRIP92, TRAP95	uc002lqd.1	Q9Y2X0		ENST00000589119.1:c.1018C>T	19.37:g.881682G>A	ENSP00000464810:p.Arg340Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6PJT2|Q96AD4|Q96I35|Q9Y652	Missense_Mutation	SNP	pfam_Mediator_Med16,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R340W	ENST00000589119.1	37	c.1018	CCDS12047.1	19	.	.	.	.	.	.	.	.	.	.	G	20.3	3.967404	0.74131	.	.	ENSG00000175221	ENST00000325464;ENST00000312090;ENST00000395808;ENST00000269814;ENST00000534906;ENST00000537596;ENST00000424039	T;T;T;T	0.50277	0.75;0.75;0.75;0.75	4.46	4.46	0.54185	WD40 repeat-like-containing domain (2);	0.000000	0.85682	D	0.000000	T	0.63343	0.2503	L	0.50333	1.59	0.58432	D	0.999999	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.996;0.996;0.999;0.997;0.998	T	0.66212	-0.5980	10	0.56958	D	0.05	-0.5081	16.1288	0.81412	0.0:0.0:1.0:0.0	.	340;340;340;340;340	Q9Y2X0-2;E7ETV0;Q9Y2X0-4;Q9Y2X0-3;Q9Y2X0	.;.;.;.;MED16_HUMAN	W	340;340;340;340;340;196;340	ENSP00000325612:R340W;ENSP00000308528:R340W;ENSP00000379153:R340W;ENSP00000269814:R340W	ENSP00000269814:R340W	R	-	1	2	MED16	832682	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.373000	0.52394	2.036000	0.60181	0.561000	0.74099	CGG	MED16	-	pfam_Mediator_Med16,superfamily_WD40_repeat_dom	ENSG00000175221		0.577	MED16-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MED16	HGNC	protein_coding	OTTHUMT00000457902.3	73	0.00	0	G	NM_005481		881682	881682	-1	no_errors	ENST00000325464	ensembl	human	known	69_37n	missense	93	16.22	18	SNP	1.000	A
MED25	81857	genome.wustl.edu	37	19	50321680	50321680	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:50321680C>G	ENST00000312865.6	+	1	135	c.82C>G	c.(82-84)Ctg>Gtg	p.L28V	MED25_ENST00000538643.1_Missense_Mutation_p.L28V	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	28	Interaction with the Mediator complex.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		TACGGCCAACCTGGGACCCTA	0.677																																					GBM(51;894 1657 37868)	dbGAP											0													60.0	56.0	57.0					19																	50321680		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.82C>G	19.37:g.50321680C>G	ENSP00000326767:p.Leu28Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Missense_Mutation	SNP	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.L28V	ENST00000312865.6	37	c.82	CCDS33075.1	19	.	.	.	.	.	.	.	.	.	.	C	25.1	4.604719	0.87157	.	.	ENSG00000104973	ENST00000355584;ENST00000377077;ENST00000312881;ENST00000312865;ENST00000456294;ENST00000538643;ENST00000377070;ENST00000542221;ENST00000544580	T;T	0.79454	2.71;-1.27	4.62	0.924	0.19418	.	0.000000	0.64402	D	0.000003	D	0.82701	0.5094	M	0.66939	2.045	0.24833	N	0.992516	D;D	0.69078	0.997;0.997	D;D	0.79108	0.992;0.992	T	0.71755	-0.4497	10	0.49607	T	0.09	.	6.9869	0.24733	0.0:0.6568:0.0:0.3432	.	28;28	B9TX30;Q71SY5	.;MED25_HUMAN	V	28	ENSP00000326767:L28V;ENSP00000437496:L28V	ENSP00000326767:L28V	L	+	1	2	MED25	55013492	0.999000	0.42202	0.992000	0.48379	0.997000	0.91878	1.452000	0.35156	0.151000	0.19162	0.655000	0.94253	CTG	MED25	-	pfam_Mediator_Med25_VWA	ENSG00000104973		0.677	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	52	0.00	0	C	NM_030973		50321680	50321680	+1	no_errors	ENST00000312865	ensembl	human	known	69_37n	missense	58	18.31	13	SNP	1.000	G
MED25	81857	genome.wustl.edu	37	19	50335408	50335408	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:50335408G>A	ENST00000312865.6	+	12	1421	c.1368G>A	c.(1366-1368)caG>caA	p.Q456Q	MED25_ENST00000538643.1_Silent_p.Q243Q	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	456	Interaction with CREBBP.|Interaction with VP16.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		TCCCCCAGCAGCTGCTGGTGA	0.682																																					GBM(51;894 1657 37868)	dbGAP											0													23.0	26.0	25.0					19																	50335408		2203	4297	6500	-	-	-	SO:0001819	synonymous_variant	0			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1368G>A	19.37:g.50335408G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Silent	SNP	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.Q456	ENST00000312865.6	37	c.1368	CCDS33075.1	19																																																																																			MED25	-	pfam_Mediator_Med25	ENSG00000104973		0.682	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	27	0.00	0	G	NM_030973		50335408	50335408	+1	no_errors	ENST00000312865	ensembl	human	known	69_37n	silent	50	10.71	6	SNP	1.000	A
MEGF10	84466	genome.wustl.edu	37	5	126778807	126778807	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:126778807G>C	ENST00000274473.6	+	20	2747	c.2480G>C	c.(2479-2481)aGa>aCa	p.R827T	MEGF10_ENST00000503335.2_Missense_Mutation_p.R827T	NM_032446.2	NP_115822.1	Q96KG7	MEG10_HUMAN	multiple EGF-like-domains 10	827	EGF-like 15. {ECO:0000255|PROSITE- ProRule:PRU00076}.|Necessary for interaction with AP2M1, self-assembly and formation of the irregular, mosaic-like adhesion pattern.				homotypic cell-cell adhesion (GO:0034109)|muscle cell development (GO:0055001)|recognition of apoptotic cell (GO:0043654)|regulation of muscle cell differentiation (GO:0051147)|regulation of skeletal muscle tissue development (GO:0048641)|skeletal muscle satellite cell activation (GO:0014719)|skeletal muscle satellite cell differentiation (GO:0014816)|skeletal muscle satellite cell proliferation (GO:0014841)	cell projection (GO:0042995)|integral component of membrane (GO:0016021)|phagocytic cup (GO:0001891)				breast(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(28)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	68		Prostate(80;0.165)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	OV - Ovarian serous cystadenocarcinoma(64;0.0657)|Epithelial(69;0.123)		AAGGGAGCGAGATGTGATCAA	0.458																																						dbGAP											0													86.0	79.0	82.0					5																	126778807		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK021631	CCDS4142.1	5q33	2008-02-05			ENSG00000145794	ENSG00000145794			29634	protein-coding gene	gene with protein product		612453				11347906	Standard	NM_032446		Approved	KIAA1780	uc003kui.4	Q96KG7	OTTHUMG00000128984	ENST00000274473.6:c.2480G>C	5.37:g.126778807G>C	ENSP00000274473:p.Arg827Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q68DE5|Q8WUL3	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,superfamily_Proteinase_amylase_inhib_dom,smart_EGF-like,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EMI_domain	p.R827T	ENST00000274473.6	37	c.2480	CCDS4142.1	5	.	.	.	.	.	.	.	.	.	.	G	22.8	4.341636	0.81911	.	.	ENSG00000145794	ENST00000503335;ENST00000274473	T;T	0.33216	1.42;1.42	5.76	5.76	0.90799	EGF-like, laminin (1);Epidermal growth factor-like (1);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.64402	D	0.000004	T	0.46014	0.1371	L	0.28504	0.86	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.10800	-1.0614	10	0.28530	T	0.3	-12.3234	20.3242	0.98691	0.0:0.0:1.0:0.0	.	827	Q96KG7	MEG10_HUMAN	T	827	ENSP00000423354:R827T;ENSP00000274473:R827T	ENSP00000274473:R827T	R	+	2	0	MEGF10	126806706	1.000000	0.71417	0.881000	0.34555	0.429000	0.31625	9.813000	0.99286	2.882000	0.98803	0.655000	0.94253	AGA	MEGF10	-	pfam_EGF_laminin,smart_EGF-like,smart_EGF_laminin	ENSG00000145794		0.458	MEGF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF10	HGNC	protein_coding	OTTHUMT00000250973.2	98	0.00	0	G	NM_032446		126778807	126778807	+1	no_errors	ENST00000274473	ensembl	human	known	69_37n	missense	86	15.69	16	SNP	0.971	C
MEPCE	56257	genome.wustl.edu	37	7	100029166	100029166	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:100029166G>A	ENST00000310512.2	+	1	1913	c.1525G>A	c.(1525-1527)Gag>Aag	p.E509K	ZCWPW1_ENST00000324725.6_5'Flank|MEPCE_ENST00000414441.1_Missense_Mutation_p.E40K|ZCWPW1_ENST00000360951.4_5'Flank|ZCWPW1_ENST00000398027.2_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	509	Bin3-type SAM. {ECO:0000255|PROSITE- ProRule:PRU00848}.				negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					CCCGGGGGCAGAGGGTGAGGA	0.642																																						dbGAP											0													37.0	34.0	35.0					7																	100029166		2203	4298	6501	-	-	-	SO:0001583	missense	0			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.1525G>A	7.37:g.100029166G>A	ENSP00000308546:p.Glu509Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KP86|D6W5V7|Q9NPD4	Missense_Mutation	SNP	pfam_Bin3	p.E509K	ENST00000310512.2	37	c.1525	CCDS5693.1	7	.	.	.	.	.	.	.	.	.	.	G	18.06	3.538526	0.65085	.	.	ENSG00000146834	ENST00000414441;ENST00000425355;ENST00000310512	.	.	.	5.48	5.48	0.80851	Bin3-type S-adenosyl-L-methionine binding domain (1);	0.529823	0.19507	N	0.112615	T	0.46405	0.1391	L	0.34521	1.04	0.39414	D	0.966791	B	0.17465	0.022	B	0.09377	0.004	T	0.37103	-0.9720	9	0.20046	T	0.44	-20.9509	14.8527	0.70309	0.0:0.0:1.0:0.0	.	509	Q7L2J0	MEPCE_HUMAN	K	40;40;509	.	ENSP00000308546:E509K	E	+	1	0	MEPCE	99867102	0.138000	0.22547	0.990000	0.47175	0.389000	0.30415	1.307000	0.33516	2.577000	0.86979	0.561000	0.74099	GAG	MEPCE	-	NULL	ENSG00000146834		0.642	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	HGNC	protein_coding	OTTHUMT00000339135.1	28	0.00	0	G			100029166	100029166	+1	no_errors	ENST00000310512	ensembl	human	known	69_37n	missense	44	10.20	5	SNP	1.000	A
METTL22	79091	genome.wustl.edu	37	16	8722830	8722830	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:8722830G>C	ENST00000381920.3	+	3	635	c.377G>C	c.(376-378)aGa>aCa	p.R126T	METTL22_ENST00000561758.1_Intron	NM_024109.2	NP_077014.2	Q9BUU2	MET22_HUMAN	methyltransferase like 22	126						nucleus (GO:0005634)	methyltransferase activity (GO:0008168)			large_intestine(5)|lung(4)	9						GACGTGGTGAGAAGACCACGA	0.572																																						dbGAP											0													85.0	96.0	93.0					16																	8722830		2017	4191	6208	-	-	-	SO:0001583	missense	0			AK022495	CCDS10533.2	16p13.2	2014-07-15	2011-03-03	2011-03-03	ENSG00000067365	ENSG00000067365			28368	protein-coding gene	gene with protein product		615261	"""chromosome 16 open reading frame 68"""	C16orf68		24140279	Standard	XM_005255570		Approved	FLJ12433,MGC2654	uc002cyz.3	Q9BUU2	OTTHUMG00000129694	ENST00000381920.3:c.377G>C	16.37:g.8722830G>C	ENSP00000371345:p.Arg126Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RD29|D3DUF2|Q6XYB4|Q9HA03	Missense_Mutation	SNP	pfam_Nicotinamide_N-MeTfrase-like	p.R126T	ENST00000381920.3	37	c.377	CCDS10533.2	16	.	.	.	.	.	.	.	.	.	.	G	18.54	3.645229	0.67358	.	.	ENSG00000067365	ENST00000381920;ENST00000163678	T;T	0.59083	1.9;0.29	5.43	4.44	0.53790	.	0.063552	0.64402	D	0.000011	T	0.72236	0.3435	M	0.71581	2.175	0.80722	D	1	D	0.89917	1.0	D	0.68765	0.96	T	0.75382	-0.3337	10	0.87932	D	0	-30.2998	12.678	0.56906	0.0:0.0:0.836:0.164	.	126	Q9BUU2	MET22_HUMAN	T	126	ENSP00000371345:R126T;ENSP00000163678:R126T	ENSP00000163678:R126T	R	+	2	0	METTL22	8630331	1.000000	0.71417	0.995000	0.50966	0.507000	0.33981	5.506000	0.66993	2.545000	0.85829	0.561000	0.74099	AGA	METTL22	-	NULL	ENSG00000067365		0.572	METTL22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL22	HGNC	protein_coding	OTTHUMT00000251901.1	20	0.00	0	G	NM_024109		8722830	8722830	+1	no_errors	ENST00000381920	ensembl	human	known	69_37n	missense	29	17.14	6	SNP	1.000	C
MFAP1	4236	genome.wustl.edu	37	15	44106742	44106742	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:44106742C>T	ENST00000267812.3	-	4	806	c.574G>A	c.(574-576)Gaa>Aaa	p.E192K		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	192					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		ATCTCATCTTCACTGTCTGTG	0.448																																						dbGAP											0													230.0	216.0	221.0					15																	44106742		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.574G>A	15.37:g.44106742C>T	ENSP00000267812:p.Glu192Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86TG6	Missense_Mutation	SNP	pfam_MFAP1_C	p.E192K	ENST00000267812.3	37	c.574	CCDS10105.1	15	.	.	.	.	.	.	.	.	.	.	C	27.2	4.807532	0.90623	.	.	ENSG00000140259	ENST00000267812	.	.	.	5.59	5.59	0.84812	.	0.047803	0.85682	D	0.000000	D	0.86381	0.5919	M	0.92604	3.325	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	D	0.87984	0.2745	9	0.54805	T	0.06	-13.0182	19.5698	0.95407	0.0:1.0:0.0:0.0	.	192	P55081	MFAP1_HUMAN	K	192	.	ENSP00000267812:E192K	E	-	1	0	MFAP1	41894034	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.445000	0.80570	2.797000	0.96272	0.563000	0.77884	GAA	MFAP1	-	pfam_MFAP1_C	ENSG00000140259		0.448	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP1	HGNC	protein_coding	OTTHUMT00000133491.2	52	0.00	0	C	NM_005926		44106742	44106742	-1	no_errors	ENST00000267812	ensembl	human	known	69_37n	missense	56	20.00	14	SNP	1.000	T
MFAP1	4236	genome.wustl.edu	37	15	44106757	44106757	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:44106757C>G	ENST00000267812.3	-	4	791	c.559G>C	c.(559-561)Gag>Cag	p.E187Q		NM_005926.2	NP_005917.2	P55081	MFAP1_HUMAN	microfibrillar-associated protein 1	187					extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|microfibril (GO:0001527)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(1)|lung(6)|skin(2)|upper_aerodigestive_tract(3)	15		all_cancers(109;7.57e-15)|all_epithelial(112;3.51e-12)|Lung NSC(122;4.72e-08)|all_lung(180;4.9e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;4.33e-07)		TCTGTGTACTCTTCATACTCA	0.448																																						dbGAP											0													230.0	216.0	221.0					15																	44106757		2198	4298	6496	-	-	-	SO:0001583	missense	0				CCDS10105.1	15q15-q21	2014-05-20			ENSG00000140259	ENSG00000140259			7032	protein-coding gene	gene with protein product		600215				7835894	Standard	NM_005926		Approved		uc001zth.1	P55081	OTTHUMG00000060145	ENST00000267812.3:c.559G>C	15.37:g.44106757C>G	ENSP00000267812:p.Glu187Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86TG6	Missense_Mutation	SNP	pfam_MFAP1_C	p.E187Q	ENST00000267812.3	37	c.559	CCDS10105.1	15	.	.	.	.	.	.	.	.	.	.	C	22.2	4.258678	0.80246	.	.	ENSG00000140259	ENST00000267812	.	.	.	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	D	0.85031	0.5604	M	0.89287	3.02	0.80722	D	1	D	0.62365	0.991	D	0.74023	0.982	D	0.85531	0.1209	9	0.48119	T	0.1	-22.9795	19.5698	0.95407	0.0:1.0:0.0:0.0	.	187	P55081	MFAP1_HUMAN	Q	187	.	ENSP00000267812:E187Q	E	-	1	0	MFAP1	41894049	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.445000	0.80570	2.797000	0.96272	0.563000	0.77884	GAG	MFAP1	-	pfam_MFAP1_C	ENSG00000140259		0.448	MFAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFAP1	HGNC	protein_coding	OTTHUMT00000133491.2	53	0.00	0	C	NM_005926		44106757	44106757	-1	no_errors	ENST00000267812	ensembl	human	known	69_37n	missense	48	19.67	12	SNP	1.000	G
PKD1	5310	genome.wustl.edu	37	16	2186044	2186044	+	5'Flank	SNP	C	C	T	rs552000932	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:2186044C>T	ENST00000262304.4	-	0	0				PKD1_ENST00000423118.1_5'Flank|MIR4516_ENST00000583451.1_RNA|MIR3180-5_ENST00000583743.1_RNA	NM_001009944.2	NP_001009944	P98161	PKD1_HUMAN	polycystic kidney disease 1 (autosomal dominant)						anatomical structure morphogenesis (GO:0009653)|branching morphogenesis of an epithelial tube (GO:0048754)|calcium ion transmembrane transport (GO:0070588)|calcium-independent cell-matrix adhesion (GO:0007161)|cartilage condensation (GO:0001502)|cartilage development (GO:0051216)|cation transmembrane transport (GO:0098655)|cell cycle arrest (GO:0007050)|cell-matrix adhesion (GO:0007160)|cytoplasmic sequestering of transcription factor (GO:0042994)|detection of mechanical stimulus (GO:0050982)|digestive tract development (GO:0048565)|embryonic placenta development (GO:0001892)|genitalia development (GO:0048806)|heart development (GO:0007507)|homophilic cell adhesion (GO:0007156)|in utero embryonic development (GO:0001701)|JAK-STAT cascade (GO:0007259)|kidney development (GO:0001822)|liver development (GO:0001889)|lung epithelium development (GO:0060428)|mesonephric duct development (GO:0072177)|mesonephric tubule development (GO:0072164)|metanephric ascending thin limb development (GO:0072218)|metanephric collecting duct development (GO:0072205)|metanephric distal tubule morphogenesis (GO:0072287)|metanephric proximal tubule development (GO:0072237)|neural tube development (GO:0021915)|neuropeptide signaling pathway (GO:0007218)|nitrogen compound metabolic process (GO:0006807)|peptidyl-serine phosphorylation (GO:0018105)|placenta blood vessel development (GO:0060674)|positive regulation of cyclin-dependent protein serine/threonine kinase activity involved in G1/S transition of mitotic cell cycle (GO:0031659)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of protein binding (GO:0032092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein export from nucleus (GO:0006611)|regulation of mitotic spindle organization (GO:0060236)|regulation of proteasomal protein catabolic process (GO:0061136)|response to fluid shear stress (GO:0034405)|skin development (GO:0043588)|spinal cord development (GO:0021510)	basolateral plasma membrane (GO:0016323)|cilium (GO:0005929)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lateral plasma membrane (GO:0016328)|motile primary cilium (GO:0031512)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|polycystin complex (GO:0002133)	calcium channel activity (GO:0005262)|carbohydrate binding (GO:0030246)|cation channel activity (GO:0005261)|ion channel binding (GO:0044325)|protein domain specific binding (GO:0019904)|protein kinase binding (GO:0019901)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|kidney(6)|lung(34)|prostate(4)|skin(10)|upper_aerodigestive_tract(3)|urinary_tract(3)	72						AGGCTTCACCCTCCGCTCCAC	0.771													c|||	5	0.000998403	0.0	0.0029	5008	,	,		10285	0.0		0.003	False		,,,				2504	0.0					dbGAP											0																																										-	-	-	SO:0001631	upstream_gene_variant	0			L33243	CCDS32369.1, CCDS45385.1	16p13.3	2014-01-28			ENSG00000008710	ENSG00000008710		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	9008	protein-coding gene	gene with protein product	"""polycystin 1"", ""transient receptor potential cation channel, subfamily P, member 1"""	601313					Standard	NM_001009944		Approved	PBP, Pc-1, TRPP1	uc002cos.1	P98161	OTTHUMG00000155795		16.37:g.2186044C>T	Exception_encountered	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15140|Q15141	RNA	SNP	-	NULL	ENST00000262304.4	37	NULL	CCDS32369.1	16																																																																																			MIR3180-5	-	-	ENSG00000264397		0.771	PKD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MIR3180-5	HGNC	protein_coding	OTTHUMT00000341688.1	8	0.00	0	C			2186044	2186044	-1	no_errors	ENST00000583743	ensembl	human	known	69_37n	rna	2	66.67	4	SNP	0.537	T
MIR4268	100422959	genome.wustl.edu	37	2	220771269	220771269	+	lincRNA	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:220771269C>G	ENST00000438659.1	-	0	0				MIR4268_ENST00000581624.1_RNA																							GGCAAAACCTCTAGAACCTGA	0.463																																						dbGAP											0																																										-	-	-			0																															2.37:g.220771269C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000438659.1	37	NULL		2																																																																																			MIR4268	-	-	ENSG00000266518		0.463	AC008281.1-001	KNOWN	basic	lincRNA	MIR4268	HGNC	lincRNA	OTTHUMT00000131980.2	52	0.00	0	C			220771269	220771269	-1	no_errors	ENST00000581624	ensembl	human	known	69_37n	rna	31	27.91	12	SNP	0.000	G
MSH4	4438	genome.wustl.edu	37	1	76349502	76349502	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:76349502G>A	ENST00000263187.3	+	15	2207	c.2103G>A	c.(2101-2103)caG>caA	p.Q701Q		NM_002440.3	NP_002431.2	O15457	MSH4_HUMAN	mutS homolog 4	701					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|female gamete generation (GO:0007292)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|ovarian follicle development (GO:0001541)|reciprocal meiotic recombination (GO:0007131)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)|synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)			breast(1)|endometrium(2)|kidney(4)|large_intestine(9)|lung(26)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	47						TTATGGCCCAGATTGGTAAGT	0.348								Mismatch excision repair (MMR)																														dbGAP											0													132.0	130.0	130.0					1																	76349502		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			U89293	CCDS670.1	1p31	2013-09-12	2013-09-12		ENSG00000057468	ENSG00000057468			7327	protein-coding gene	gene with protein product		602105	"""mutS (E. coli) homolog 4"", ""mutS homolog 4 (E. coli)"""			9299235	Standard	NM_002440		Approved		uc001dhd.2	O15457	OTTHUMG00000009788	ENST00000263187.3:c.2103G>A	1.37:g.76349502G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T4U6|Q8NEB3|Q9UNP8	Silent	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_connt,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_connt,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.Q701	ENST00000263187.3	37	c.2103	CCDS670.1	1																																																																																			MSH4	-	pfam_DNA_mismatch_repair_MutS_C,smart_DNA_mismatch_repair_MutS_C	ENSG00000057468		0.348	MSH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSH4	HGNC	protein_coding	OTTHUMT00000026983.1	53	0.00	0	G	NM_002440		76349502	76349502	+1	no_errors	ENST00000263187	ensembl	human	known	69_37n	silent	49	10.71	6	SNP	0.998	A
MTPN	136319	genome.wustl.edu	37	7	135661842	135661842	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:135661842C>T	ENST00000393085.3	-	1	222	c.7G>A	c.(7-9)Gac>Aac	p.D3N	MTPN_ENST00000435723.1_Missense_Mutation_p.D3N	NM_001128619.2|NM_145808.3	NP_001122091.2|NP_665807.1	P58546	MTPN_HUMAN	myotrophin	3					catecholamine metabolic process (GO:0006584)|cell growth (GO:0016049)|cerebellar granule cell differentiation (GO:0021707)|neuron differentiation (GO:0030182)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of cell growth (GO:0030307)|positive regulation of macromolecule biosynthetic process (GO:0010557)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein metabolic process (GO:0051247)|regulation of barbed-end actin filament capping (GO:2000812)|regulation of striated muscle tissue development (GO:0016202)|regulation of translation (GO:0006417)|skeletal muscle tissue regeneration (GO:0043403)|striated muscle cell differentiation (GO:0051146)	axon (GO:0030424)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|F-actin capping protein complex (GO:0008290)|nucleus (GO:0005634)				endometrium(1)|lung(4)|prostate(1)	6						AACTCCTTGTCGCACATCACT	0.627																																						dbGAP											0													148.0	127.0	134.0					7																	135661842		2203	4300	6503	-	-	-	SO:0001583	missense	0			AC015987	CCDS5842.1	7q33-q35	2013-01-10			ENSG00000105887	ENSG00000105887		"""Ankyrin repeat domain containing"""	15667	protein-coding gene	gene with protein product	"""granule cell differentiation protein"""	606484				11474205	Standard	NM_145808		Approved	MYOTROPHIN, GCDP, V-1		P58546	OTTHUMG00000155627	ENST00000393085.3:c.7G>A	7.37:g.135661842C>T	ENSP00000376800:p.Asp3Asn	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D3N	ENST00000393085.3	37	c.7	CCDS5842.1	7	.	.	.	.	.	.	.	.	.	.	C	16.06	3.016553	0.54468	.	.	ENSG00000105887	ENST00000393085;ENST00000435723	T	0.33216	1.42	4.69	4.69	0.59074	Ankyrin repeat-containing domain (1);	0.168813	0.51477	D	0.000096	T	0.35219	0.0924	L	0.55481	1.735	0.27317	N	0.957149	D	0.53885	0.963	P	0.47162	0.54	T	0.21827	-1.0234	10	0.27082	T	0.32	.	15.1587	0.72764	0.0:1.0:0.0:0.0	.	3	P58546	MTPN_HUMAN	N	3	ENSP00000376800:D3N	ENSP00000376800:D3N	D	-	1	0	MTPN	135312382	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.493000	0.60341	2.427000	0.82271	0.561000	0.74099	GAC	MTPN	-	superfamily_Ankyrin_rpt-contain_dom	ENSG00000105887		0.627	MTPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPN	HGNC	protein_coding	OTTHUMT00000340921.1	63	0.00	0	C	NM_145808		135661842	135661842	-1	no_errors	ENST00000393085	ensembl	human	known	69_37n	missense	80	12.09	11	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9033260	9033260	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:9033260G>A	ENST00000397910.4	-	10	36569	c.36366C>T	c.(36364-36366)ctC>ctT	p.L12122L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12124	SEA 1. {ECO:0000255|PROSITE- ProRule:PRU00188}.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						AGCCTGAATAGAGGTATTCCA	0.527																																						dbGAP											0													66.0	65.0	66.0					19																	9033260		1980	4154	6134	-	-	-	SO:0001819	synonymous_variant	0			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.36366C>T	19.37:g.9033260G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.L12122	ENST00000397910.4	37	c.36366	CCDS54212.1	19																																																																																			MUC16	-	pfam_SEA,smart_SEA,pfscan_SEA	ENSG00000181143		0.527	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	59	0.00	0	G	NM_024690		9033260	9033260	-1	no_errors	ENST00000397910	ensembl	human	known	69_37n	silent	53	15.62	10	SNP	0.002	A
MUC3A	4584	genome.wustl.edu	37	7	100551848	100551848	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:100551848C>T	ENST00000319509.7	+	1	599	c.599C>T	c.(598-600)tCa>tTa	p.S200L				Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated	1865	Thr-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						TCTACTCCCTCATTGCAAACT	0.433																																						dbGAP											0													615.0	601.0	605.0					7																	100551848		876	1991	2867	-	-	-	SO:0001583	missense	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.599C>T	7.37:g.100551848C>T	ENSP00000324834:p.Ser200Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	Missense_Mutation	SNP	pfam_SEA,smart_EGF-like,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S200L	ENST00000319509.7	37	c.599		7	.	.	.	.	.	.	.	.	.	.	C	7.798	0.713082	0.15306	.	.	ENSG00000169894	ENST00000319509	T	0.07444	3.19	0.895	-1.79	0.07932	.	.	.	.	.	T	0.03178	0.0093	N	0.08118	0	0.30974	N	0.7227589999999999	B	0.25007	0.116	B	0.12156	0.007	T	0.39583	-0.9607	8	0.46703	T	0.11	.	1.4762	0.02426	0.3426:0.3555:0.0:0.3019	.	1865	Q02505	MUC3A_HUMAN	L	200	ENSP00000324834:S200L	ENSP00000324834:S200L	S	+	2	0	MUC3A	100389784	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.750000	0.26334	-0.808000	0.04387	0.313000	0.20887	TCA	MUC3A	-	NULL	ENSG00000169894		0.433	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	MUC3A	HGNC	protein_coding	OTTHUMT00000347215.1	101	0.00	0	C	XM_001725354		100551848	100551848	+1	no_start_codon	ENST00000319509	ensembl	human	known	69_37n	missense	127	10.56	15	SNP	0.000	T
MUC17	140453	genome.wustl.edu	37	7	100684537	100684537	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:100684537C>T	ENST00000306151.4	+	3	9904	c.9840C>T	c.(9838-9840)agC>agT	p.S3280S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	3280	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GTGAAGGAAGCACTCCATTAA	0.512																																						dbGAP											0													344.0	339.0	341.0					7																	100684537		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.9840C>T	7.37:g.100684537C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O14761|Q685J2|Q8TDH7	Silent	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S3280	ENST00000306151.4	37	c.9840	CCDS34711.1	7																																																																																			MUC17	-	NULL	ENSG00000169876		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	114	0.00	0	C	NM_001040105		100684537	100684537	+1	no_errors	ENST00000306151	ensembl	human	known	69_37n	silent	126	16.56	25	SNP	0.000	T
MXRA5	25878	genome.wustl.edu	37	X	3229058	3229058	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:3229058G>A	ENST00000217939.6	-	7	7340	c.7186C>T	c.(7186-7188)Cag>Tag	p.Q2396*		NM_015419.3	NP_056234.2	Q9NR99	MXRA5_HUMAN	matrix-remodelling associated 5	2396	Ig-like C2-type 8.					extracellular vesicular exosome (GO:0070062)				NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(3)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(32)|lung(81)|ovary(6)|prostate(3)|skin(9)|stomach(3)|urinary_tract(2)	157		all_lung(23;0.00031)|Lung NSC(23;0.000946)				TGGTATATCTGATACTTCTCA	0.537																																						dbGAP											0													96.0	83.0	88.0					X																	3229058		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF245505	CCDS14124.1	Xp22.33	2013-01-29			ENSG00000101825	ENSG00000101825		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	7539	protein-coding gene	gene with protein product	"""adlican"""					12101425	Standard	NM_015419		Approved	DKFZp564I1922	uc004crg.4	Q9NR99	OTTHUMG00000021083	ENST00000217939.6:c.7186C>T	X.37:g.3229058G>A	ENSP00000217939:p.Gln2396*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6P1M7|Q9Y3Y8	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q2396*	ENST00000217939.6	37	c.7186	CCDS14124.1	X	.	.	.	.	.	.	.	.	.	.	G	44	10.878915	0.99482	.	.	ENSG00000101825	ENST00000381114;ENST00000217939	.	.	.	3.97	2.12	0.27331	.	0.454536	0.16206	U	0.224700	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	8.2747	0.31866	0.0903:0.1541:0.7557:0.0	.	.	.	.	X	2396	.	ENSP00000217939:Q2396X	Q	-	1	0	MXRA5	3239058	1.000000	0.71417	0.014000	0.15608	0.055000	0.15305	2.620000	0.46410	0.092000	0.17331	0.597000	0.82753	CAG	MXRA5	-	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	ENSG00000101825		0.537	MXRA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MXRA5	HGNC	protein_coding	OTTHUMT00000055655.2	56	0.00	0	G	NM_015419		3229058	3229058	-1	no_errors	ENST00000217939	ensembl	human	known	69_37n	nonsense	61	16.44	12	SNP	0.005	A
MYH10	4628	genome.wustl.edu	37	17	8395802	8395802	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:8395802G>C	ENST00000269243.4	-	32	4529	c.4391C>G	c.(4390-4392)tCt>tGt	p.S1464C	MYH10_ENST00000379980.4_Missense_Mutation_p.S1480C|MYH10_ENST00000360416.3_Missense_Mutation_p.S1495C|MYH10_ENST00000396239.1_Missense_Mutation_p.S1485C	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1464					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						ATAGCGAGCAGAGATGCTCTT	0.567																																						dbGAP											0													34.0	38.0	37.0					17																	8395802		2203	4300	6503	-	-	-	SO:0001583	missense	0			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.4391C>G	17.37:g.8395802G>C	ENSP00000269243:p.Ser1464Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1485C	ENST00000269243.4	37	c.4454	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	G	31	5.058795	0.93846	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	T;T;T;T	0.78364	-1.17;-1.17;-1.17;-1.17	5.5	5.5	0.81552	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.86594	0.5970	L	0.58302	1.8	0.80722	D	1	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.79108	0.992;0.981;0.992	D	0.85565	0.1230	10	0.49607	T	0.09	.	19.5916	0.95514	0.0:0.0:1.0:0.0	.	1473;1495;1464	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	C	1464;1495;1485;1480	ENSP00000269243:S1464C;ENSP00000353590:S1495C;ENSP00000379539:S1485C;ENSP00000369315:S1480C	ENSP00000269243:S1464C	S	-	2	0	MYH10	8336527	1.000000	0.71417	0.997000	0.53966	0.955000	0.61496	9.601000	0.98297	2.861000	0.98227	0.655000	0.94253	TCT	MYH10	-	pfam_Myosin_tail	ENSG00000133026		0.567	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	35	0.00	0	G			8395802	8395802	-1	no_errors	ENST00000396239	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	1.000	C
MYH4	4622	genome.wustl.edu	37	17	10355546	10355546	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:10355546G>A	ENST00000255381.2	-	27	3560	c.3450C>T	c.(3448-3450)atC>atT	p.I1150I	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_017533.2	NP_060003.2	Q9Y623	MYH4_HUMAN	myosin, heavy chain 4, skeletal muscle	1150					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|membrane organization (GO:0061024)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|response to activity (GO:0014823)	muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|microfilament motor activity (GO:0000146)			NS(4)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(72)|ovary(10)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	149						GCCTCTCACTGATCTCCTCCA	0.612																																						dbGAP											0													78.0	87.0	84.0					17																	10355546		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS11154.1	17p13.1	2013-09-19	2006-09-29		ENSG00000264424	ENSG00000264424		"""Myosins / Myosin superfamily : Class II"""	7574	protein-coding gene	gene with protein product		160742	"""myosin, heavy polypeptide 4, skeletal muscle"""			8518795	Standard	NM_017533		Approved	MYH2B, MyHC-2B, MyHC-IIb	uc002gmn.3	Q9Y623	OTTHUMG00000130365	ENST00000255381.2:c.3450C>T	17.37:g.10355546G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I1150	ENST00000255381.2	37	c.3450	CCDS11154.1	17																																																																																			MYH4	-	pfam_Myosin_tail	ENSG00000264424		0.612	MYH4-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	MYH4	HGNC	protein_coding	OTTHUMT00000252731.1	69	0.00	0	G	NM_017533		10355546	10355546	-1	no_errors	ENST00000255381	ensembl	human	known	69_37n	silent	73	13.95	12	SNP	1.000	A
TIAF1	9220	genome.wustl.edu	37	17	27401804	27401804	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:27401804G>A	ENST00000359450.6	-	0	4071				MYO18A_ENST00000354329.4_Missense_Mutation_p.T2050M|MYO18A_ENST00000531253.1_Missense_Mutation_p.T2035M|TIAF1_ENST00000408971.2_De_novo_Start_InFrame|MYO18A_ENST00000527372.1_Missense_Mutation_p.T2050M|MYO18A_ENST00000529578.1_5'UTR|MYO18A_ENST00000533112.1_Missense_Mutation_p.T1998M	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1						apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)				kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GTTAGTCTCCGTCAGCTTGGC	0.622																																						dbGAP											0													137.0	138.0	138.0					17																	27401804		2138	4248	6386	-	-	-			0			AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411			17.37:g.27401804G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A2RRE2|Q6PEG2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.T2050M	ENST00000359450.6	37	c.6149	CCDS32599.1	17	.	.	.	.	.	.	.	.	.	.	G	6.177	0.400777	0.11696	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428;ENST00000546105	D;D;D;D	0.88354	-2.26;-2.37;-2.26;-2.26	5.42	-3.41	0.04839	.	0.737577	0.11712	N	0.536841	T	0.72977	0.3528	N	0.08118	0	0.09310	N	0.999996	P;P;P;B	0.52577	0.923;0.954;0.923;0.0	B;P;B;B	0.45474	0.276;0.482;0.188;0.0	T	0.67772	-0.5584	10	0.37606	T	0.19	.	2.1965	0.03912	0.2964:0.2232:0.3756:0.1047	.	1638;1998;2035;2050	F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;MY18A_HUMAN	M	2050;1998;1998;2035;2050;931;931;1638;316	ENSP00000346291:T2050M;ENSP00000435932:T1998M;ENSP00000434228:T2035M;ENSP00000437073:T2050M	ENSP00000346291:T2050M	T	-	2	0	MYO18A	24425930	0.000000	0.05858	0.009000	0.14445	0.499000	0.33736	0.123000	0.15708	-0.196000	0.10366	-0.122000	0.15005	ACG	MYO18A	-	NULL	ENSG00000196535		0.622	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000372394.2	79	0.00	0	G	NM_004740		27401804	27401804	-1	no_errors	ENST00000354329	ensembl	human	known	69_37n	missense	78	14.29	13	SNP	0.000	A
MYSM1	114803	genome.wustl.edu	37	1	59127121	59127121	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:59127121C>T	ENST00000472487.1	-	18	2266	c.2227G>A	c.(2227-2229)Gaa>Aaa	p.E743K	MYSM1_ENST00000493821.1_5'UTR	NM_001085487.2	NP_001078956.1	Q5VVJ2	MYSM1_HUMAN	Myb-like, SWIRM and MPN domains 1	743					chromatin remodeling (GO:0006338)|monoubiquitinated histone H2A deubiquitination (GO:0035522)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone binding (GO:0042393)|metal ion binding (GO:0046872)|metallopeptidase activity (GO:0008237)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24	all_cancers(7;9.36e-06)					CTTGTCTTTTCAAATACTAAT	0.363																																						dbGAP											0													192.0	171.0	177.0					1																	59127121		1818	4075	5893	-	-	-	SO:0001583	missense	0			AB067502	CCDS41343.1	1p32.1	2009-02-11	2009-02-11		ENSG00000162601	ENSG00000162601			29401	protein-coding gene	gene with protein product		612176				11572484, 17428495, 17707232	Standard	NM_001085487		Approved	KIAA1915	uc009wab.2	Q5VVJ2	OTTHUMG00000009533	ENST00000472487.1:c.2227G>A	1.37:g.59127121C>T	ENSP00000418734:p.Glu743Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8KA54|B3KX65|Q68DD3|Q6AI53|Q7Z3G8|Q96PX3	Missense_Mutation	SNP	pfam_SWIRM,pfam_JAB1_Mov34_MPN_PAD1,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,smart_JAB1_Mov34_MPN_PAD1,pfscan_SWIRM,pfscan_Myb-like_dom	p.E743K	ENST00000472487.1	37	c.2227	CCDS41343.1	1	.	.	.	.	.	.	.	.	.	.	C	15.93	2.977968	0.53720	.	.	ENSG00000162601	ENST00000472487	T	0.23348	1.91	5.13	5.13	0.70059	.	0.161344	0.56097	D	0.000031	T	0.22936	0.0554	L	0.51422	1.61	0.38037	D	0.935337	P	0.44816	0.844	B	0.36666	0.23	T	0.09143	-1.0688	10	0.23302	T	0.38	-22.5552	15.8908	0.79296	0.0:1.0:0.0:0.0	.	743	Q5VVJ2	MYSM1_HUMAN	K	743	ENSP00000418734:E743K	ENSP00000418734:E743K	E	-	1	0	MYSM1	58899709	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	4.030000	0.57260	2.672000	0.90937	0.460000	0.39030	GAA	MYSM1	-	NULL	ENSG00000162601		0.363	MYSM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYSM1	HGNC	protein_coding	OTTHUMT00000026343.2	33	0.00	0	C	XM_055481		59127121	59127121	-1	no_errors	ENST00000472487	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	1.000	T
N4BP3	23138	genome.wustl.edu	37	5	177548700	177548700	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:177548700G>T	ENST00000274605.5	+	5	1692	c.1333G>T	c.(1333-1335)Gat>Tat	p.D445Y		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	445						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CTGTGAGACTGATGACTGCAA	0.687																																						dbGAP											0													20.0	24.0	22.0					5																	177548700		2203	4292	6495	-	-	-	SO:0001583	missense	0			AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.1333G>T	5.37:g.177548700G>T	ENSP00000274605:p.Asp445Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	pfam_Fez1	p.D445Y	ENST00000274605.5	37	c.1333	CCDS34307.1	5	.	.	.	.	.	.	.	.	.	.	G	14.70	2.612860	0.46631	.	.	ENSG00000145911	ENST00000274605	T	0.54071	0.59	4.67	4.67	0.58626	.	0.299349	0.36444	N	0.002582	T	0.67571	0.2907	M	0.62723	1.935	0.35005	D	0.756375	D	0.71674	0.998	D	0.70487	0.969	T	0.77429	-0.2591	10	0.87932	D	0	-23.4263	12.9504	0.58397	0.0:0.0:1.0:0.0	.	445	O15049	N4BP3_HUMAN	Y	445	ENSP00000274605:D445Y	ENSP00000274605:D445Y	D	+	1	0	N4BP3	177481306	0.990000	0.36364	0.907000	0.35723	0.852000	0.48524	4.051000	0.57412	2.434000	0.82447	0.462000	0.41574	GAT	N4BP3	-	pfam_Fez1	ENSG00000145911		0.687	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP3	HGNC	protein_coding	OTTHUMT00000373552.2	9	0.00	0	G	NM_015111		177548700	177548700	+1	no_errors	ENST00000274605	ensembl	human	known	69_37n	missense	21	19.23	5	SNP	0.698	T
NAA35	60560	genome.wustl.edu	37	9	88632435	88632435	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:88632435C>T	ENST00000361671.5	+	19	1861	c.1728C>T	c.(1726-1728)atC>atT	p.I576I		NM_024635.3	NP_078911.3	Q5VZE5	NAA35_HUMAN	N(alpha)-acetyltransferase 35, NatC auxiliary subunit	576					negative regulation of apoptotic process (GO:0043066)|smooth muscle cell proliferation (GO:0048659)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(9)|ovary(2)|skin(2)|urinary_tract(1)	25						GCCGAGAGATCACAATGAGCC	0.353																																						dbGAP											0													142.0	129.0	134.0					9																	88632435		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025266	CCDS6673.1	9q22.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000135040	ENSG00000135040		"""N(alpha)-acetyltransferase subunits"""	24340	protein-coding gene	gene with protein product			"""MAK10 homolog, amino-acid N-acetyltransferase subunit (S. cerevisiae)"""	MAK10		14702039, 19660095	Standard	NM_024635		Approved	FLJ21613, FLJ22643, bA379P1.1	uc004aoi.4	Q5VZE5	OTTHUMG00000020131	ENST00000361671.5:c.1728C>T	9.37:g.88632435C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5VZE6|Q9H631|Q9H703	Silent	SNP	pfam_NatC_AcTrfase_Mak10	p.I576	ENST00000361671.5	37	c.1728	CCDS6673.1	9																																																																																			NAA35	-	NULL	ENSG00000135040		0.353	NAA35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA35	HGNC	protein_coding	OTTHUMT00000052906.1	76	0.00	0	C	NM_024635		88632435	88632435	+1	no_errors	ENST00000361671	ensembl	human	known	69_37n	silent	90	20.00	23	SNP	1.000	T
NARS	4677	genome.wustl.edu	37	18	55269589	55269589	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr18:55269589G>A	ENST00000256854.5	-	13	1968	c.1513C>T	c.(1513-1515)Cag>Tag	p.Q505*	NARS_ENST00000423481.2_Nonsense_Mutation_p.Q256*	NM_004539.3	NP_004530.1	O43776	SYNC_HUMAN	asparaginyl-tRNA synthetase	505					asparaginyl-tRNA aminoacylation (GO:0006421)|gene expression (GO:0010467)|tRNA aminoacylation for protein translation (GO:0006418)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	asparagine-tRNA ligase activity (GO:0004816)|ATP binding (GO:0005524)|nucleic acid binding (GO:0003676)			breast(1)|endometrium(5)|large_intestine(5)|lung(8)|skin(1)	20		Colorectal(73;0.227)			L-Asparagine(DB00174)	GGTTTTACCTGATCCGTATAC	0.368																																						dbGAP											0													81.0	77.0	79.0					18																	55269589		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			D84273	CCDS32837.1	18q21.31	2014-05-06			ENSG00000134440	ENSG00000134440	6.1.1.22	"""Aminoacyl tRNA synthetases / Class II"""	7643	protein-coding gene	gene with protein product	"""asparagine tRNA ligase 1, cytoplasmic"""	108410				6836455, 9421509	Standard	NM_004539		Approved	NARS1	uc002lgs.2	O43776	OTTHUMG00000180125	ENST00000256854.5:c.1513C>T	18.37:g.55269589G>A	ENSP00000256854:p.Gln505*	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DG16|Q53GU6	Nonsense_Mutation	SNP	pfam_aa-tRNA-synt_II,pfam_NA-bd_OB_tRNA-helicase,superfamily_NA-bd_OB-fold-like,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asn-tRNA-synth_IIb	p.Q505*	ENST00000256854.5	37	c.1513	CCDS32837.1	18	.	.	.	.	.	.	.	.	.	.	G	40	8.033106	0.98619	.	.	ENSG00000134440	ENST00000256854;ENST00000423481	.	.	.	6.03	6.03	0.97812	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-6.1759	20.1547	0.98103	0.0:0.0:1.0:0.0	.	.	.	.	X	505;256	.	ENSP00000256854:Q505X	Q	-	1	0	NARS	53420587	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.436000	0.97532	2.868000	0.98415	0.555000	0.69702	CAG	NARS	-	pfam_aa-tRNA-synt_II,pfscan_aa-tRNA-synth_II,prints_Asp/Asn-tRNA-synth_IIb,tigrfam_Asn-tRNA-synth_IIb	ENSG00000134440		0.368	NARS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NARS	HGNC	protein_coding	OTTHUMT00000449872.2	21	0.00	0	G	NM_004539		55269589	55269589	-1	no_errors	ENST00000256854	ensembl	human	known	69_37n	nonsense	16	23.81	5	SNP	1.000	A
NBPF4	148545	genome.wustl.edu	37	1	108766295	108766295	+	3'UTR	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:108766295C>G	ENST00000415641.3	-	0	2152					NM_001143989.2	NP_001137461.1	Q96M43	NBPF4_HUMAN	neuroblastoma breakpoint family, member 4							cytoplasm (GO:0005737)				endometrium(2)|lung(1)|skin(1)	4						TTGTTTTTATCAAGTGGAAAA	0.398																																						dbGAP											0													109.0	93.0	98.0					1																	108766295		692	1591	2283	-	-	-	SO:0001624	3_prime_UTR_variant	0			AK057395	CCDS44182.1	1p13.3	2013-01-17			ENSG00000196427	ENSG00000196427		"""neuroblastoma breakpoint family"""	26550	protein-coding gene	gene with protein product		613994				16079250	Standard	NM_001143989		Approved	FLJ32833	uc009weo.2	Q96M43	OTTHUMG00000011318	ENST00000415641.3:c.*32G>C	1.37:g.108766295C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T483	RNA	SNP	-	NULL	ENST00000415641.3	37	NULL	CCDS44182.1	1																																																																																			NBPF4	-	-	ENSG00000196427		0.398	NBPF4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF4	HGNC	protein_coding	OTTHUMT00000031255.5	85	0.00	0	C	NM_152488		108766295	108766295	-1	no_errors	ENST00000487594	ensembl	human	known	69_37n	rna	99	10.81	12	SNP	0.005	G
NCOA2	10499	genome.wustl.edu	37	8	71068636	71068636	+	Missense_Mutation	SNP	G	G	A	rs576207905	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:71068636G>A	ENST00000452400.2	-	11	2145	c.1964C>T	c.(1963-1965)tCg>tTg	p.S655L	NCOA2_ENST00000524223.1_5'UTR	NM_006540.2	NP_006531.1	Q15596	NCOA2_HUMAN	nuclear receptor coactivator 2	655					cellular lipid metabolic process (GO:0044255)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucose metabolic process (GO:0010906)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|histone acetyltransferase activity (GO:0004402)|ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|signal transducer activity (GO:0004871)|thyroid hormone receptor coactivator activity (GO:0030375)|transcription coactivator activity (GO:0003713)		PAX3/NCOA2(4)|HEY1/NCOA2(10)	NS(1)|breast(4)|endometrium(7)|kidney(4)|large_intestine(10)|lung(25)|ovary(1)|pancreas(2)|prostate(2)|skin(4)	60	Breast(64;0.201)		Epithelial(68;0.0147)|OV - Ovarian serous cystadenocarcinoma(28;0.0455)|all cancers(69;0.0606)			GGCTAAGGGCGAGGGCTCCAT	0.532			T	"""RUNXBP2, HEY1"""	"""AML, Chondrosarcoma"""								G|||	2	0.000399361	0.0008	0.0	5008	,	,		18135	0.001		0.0	False		,,,				2504	0.0					dbGAP		Dom	yes		8	8q13.1	10499	nuclear receptor coactivator 2 (TIF2)		L	0													98.0	96.0	97.0					8																	71068636		1975	4174	6149	-	-	-	SO:0001583	missense	0			X97674	CCDS47872.1	8q13.3	2011-07-01			ENSG00000140396	ENSG00000140396		"""Chromatin-modifying enzymes / K-acetyltransferases"", ""Basic helix-loop-helix proteins"""	7669	protein-coding gene	gene with protein product		601993				9111344, 8670870	Standard	XM_005251128		Approved	TIF2, GRIP1, NCoA-2, KAT13C, bHLHe75	uc003xyn.1	Q15596	OTTHUMG00000164671	ENST00000452400.2:c.1964C>T	8.37:g.71068636G>A	ENSP00000399968:p.Ser655Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CD2	Missense_Mutation	SNP	pfam_DUF1518,pfam_SRC-1,pfam_Nuc_rcpt_coact_Ncoa-typ,pfam_PAS_fold,superfamily_Nuc_rcpt_coact,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,smart_PAS,pirsf_Nuclear_rcpt_coactivator,pfscan_PAS,pfscan_HLH_DNA-bd	p.S655L	ENST00000452400.2	37	c.1964	CCDS47872.1	8	.	.	.	.	.	.	.	.	.	.	G	22.4	4.286266	0.80803	.	.	ENSG00000140396	ENST00000452400	T	0.01647	4.71	5.77	5.77	0.91146	Steroid receptor coactivator (1);	0.241877	0.42682	D	0.000675	T	0.03915	0.0110	L	0.55481	1.735	0.80722	D	1	D	0.54047	0.964	B	0.42386	0.386	T	0.44605	-0.9317	10	0.62326	D	0.03	.	19.9981	0.97395	0.0:0.0:1.0:0.0	.	655	Q15596	NCOA2_HUMAN	L	655	ENSP00000399968:S655L	ENSP00000399968:S655L	S	-	2	0	NCOA2	71231190	1.000000	0.71417	0.877000	0.34402	0.861000	0.49209	9.624000	0.98398	2.729000	0.93468	0.655000	0.94253	TCG	NCOA2	-	pfam_SRC-1,pirsf_Nuclear_rcpt_coactivator	ENSG00000140396		0.532	NCOA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA2	HGNC	protein_coding	OTTHUMT00000379696.1	64	0.00	0	G			71068636	71068636	-1	no_errors	ENST00000452400	ensembl	human	known	69_37n	missense	68	16.05	13	SNP	0.990	A
NECAB1	64168	genome.wustl.edu	37	8	91804137	91804137	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:91804137C>T	ENST00000417640.2	+	1	360	c.23C>T	c.(22-24)tCg>tTg	p.S8L	NECAB1_ENST00000521954.1_3'UTR|TMEM64_ENST00000519519.1_5'Flank	NM_022351.4	NP_071746.1	Q8N987	NECA1_HUMAN	N-terminal EF-hand calcium binding protein 1	8						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(7)	12			BRCA - Breast invasive adenocarcinoma(11;0.0499)			CAGGAGACATCGCCGTCCTCC	0.652																																						dbGAP											0													39.0	47.0	44.0					8																	91804137		1928	3898	5826	-	-	-	SO:0001583	missense	0			AF414126	CCDS47889.1	8q21.3	2013-01-10	2007-12-06	2007-12-06	ENSG00000123119	ENSG00000123119		"""N-terminal EF-hand calcium binding proteins"", ""EF-hand domain containing"""	20983	protein-coding gene	gene with protein product			"""EF-hand calcium binding protein 1"""	EFCBP1			Standard	NM_022351		Approved		uc011lgg.2	Q8N987	OTTHUMG00000164009	ENST00000417640.2:c.23C>T	8.37:g.91804137C>T	ENSP00000387380:p.Ser8Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NUS7|Q96AZ7|Q9HBW8	Missense_Mutation	SNP	pfam_Antibiotic_mOase,superfamily_Dimeric_a/b-barrel,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.S8L	ENST00000417640.2	37	c.23	CCDS47889.1	8	.	.	.	.	.	.	.	.	.	.	C	16.40	3.112226	0.56398	.	.	ENSG00000123119	ENST00000417640	T	0.20069	2.1	4.52	4.52	0.55395	.	0.527286	0.19627	N	0.109772	T	0.27384	0.0672	N	0.19112	0.55	0.80722	D	1	D	0.64830	0.994	P	0.61201	0.885	T	0.03287	-1.1052	10	0.59425	D	0.04	-0.0464	12.5902	0.56439	0.0:1.0:0.0:0.0	.	8	Q8N987	NECA1_HUMAN	L	8	ENSP00000387380:S8L	ENSP00000387380:S8L	S	+	2	0	NECAB1	91873313	1.000000	0.71417	1.000000	0.80357	0.570000	0.35934	3.471000	0.53107	2.318000	0.78349	0.591000	0.81541	TCG	NECAB1	-	NULL	ENSG00000123119		0.652	NECAB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NECAB1	HGNC	protein_coding	OTTHUMT00000376728.1	57	0.00	0	C	NM_022351		91804137	91804137	+1	no_errors	ENST00000417640	ensembl	human	known	69_37n	missense	28	20.00	7	SNP	0.998	T
NFATC1	4772	genome.wustl.edu	37	18	77227491	77227491	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr18:77227491G>C	ENST00000427363.2	+	8	2001	c.2001G>C	c.(1999-2001)agG>agC	p.R667S	NFATC1_ENST00000542384.1_Missense_Mutation_p.R667S|NFATC1_ENST00000587635.1_Missense_Mutation_p.G639A|NFATC1_ENST00000397790.2_Missense_Mutation_p.R195S|NFATC1_ENST00000586434.1_Missense_Mutation_p.R654S|NFATC1_ENST00000318065.5_Missense_Mutation_p.R654S|NFATC1_ENST00000592223.1_Missense_Mutation_p.R654S|NFATC1_ENST00000545796.1_Missense_Mutation_p.R195S|NFATC1_ENST00000253506.5_Missense_Mutation_p.R667S|NFATC1_ENST00000591814.1_Missense_Mutation_p.R667S|NFATC1_ENST00000329101.4_Missense_Mutation_p.R654S			O95644	NFAC1_HUMAN	nuclear factor of activated T-cells, cytoplasmic, calcineurin-dependent 1	667					calcium ion transport (GO:0006816)|epithelial to mesenchymal transition (GO:0001837)|Fc-epsilon receptor signaling pathway (GO:0038095)|G1/S transition of mitotic cell cycle (GO:0000082)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|osteoclast differentiation (GO:0030316)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	FK506 binding (GO:0005528)|mitogen-activated protein kinase p38 binding (GO:0048273)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(17)|ovary(2)|prostate(4)|skin(1)|soft_tissue(1)	40		Esophageal squamous(42;0.0157)|Melanoma(33;0.144)		OV - Ovarian serous cystadenocarcinoma(15;3.73e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0257)	Pseudoephedrine(DB00852)	GGAATCAGAGGATAACCAGCC	0.572																																					GBM(151;1210 2593 28719 45011)	dbGAP											0													110.0	82.0	92.0					18																	77227491		2203	4300	6503	-	-	-	SO:0001583	missense	0			U08015	CCDS12015.1, CCDS12016.1, CCDS32850.1, CCDS59326.1, CCDS59327.1, CCDS62467.1, CCDS62468.1, CCDS62469.1, CCDS62470.1, CCDS62471.1	18q23	2009-11-24			ENSG00000131196	ENSG00000131196		"""Nuclear factor of activated T-cells"""	7775	protein-coding gene	gene with protein product		600489				8202141	Standard	NM_001278669		Approved	NF-ATC, NFATc, NFAT2	uc002lnf.3	O95644	OTTHUMG00000132897	ENST00000427363.2:c.2001G>C	18.37:g.77227491G>C	ENSP00000389377:p.Arg667Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	B5B2M4|B5B2M5|B5B2M6|B5B2M7|B5B2M8|B5B2M9|B5B2N1|Q12865|Q15793|Q2M1S3	Missense_Mutation	SNP	pfam_RHD,pfam_IPT_TIG_rcpt,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,prints_NFAT,pfscan_RHD	p.R667S	ENST00000427363.2	37	c.2001		18	.	.	.	.	.	.	.	.	.	.	G	10.84	1.464268	0.26335	.	.	ENSG00000131196	ENST00000318065;ENST00000253506;ENST00000397790;ENST00000542384;ENST00000329101;ENST00000545796;ENST00000427363;ENST00000397794	T;T;T;T;T	0.28069	1.99;1.99;1.63;1.99;1.99	4.99	-6.22	0.02058	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.29524	0.0736	L	0.38692	1.165	0.47214	D	0.999352	D;D;P;D;B;P	0.59767	0.986;0.972;0.6;0.973;0.213;0.6	P;P;B;P;B;B	0.59056	0.851;0.742;0.437;0.843;0.262;0.437	T	0.51356	-0.8716	10	0.12103	T	0.63	-33.1333	13.3356	0.60516	0.4377:0.0:0.5623:0.0	.	654;654;667;667;654;667	B5B2M7;B5B2N1;B5B2M6;O95644;B5B2M5;Q2M1S3	.;.;.;NFAC1_HUMAN;.;.	S	667;667;195;667;654;195;654;631	ENSP00000253506:R667S;ENSP00000380892:R195S;ENSP00000442435:R667S;ENSP00000327850:R654S;ENSP00000439992:R195S	ENSP00000253506:R667S	R	+	3	2	NFATC1	75328479	0.414000	0.25408	0.637000	0.29366	0.442000	0.32017	-0.126000	0.10563	-1.237000	0.02539	0.650000	0.86243	AGG	NFATC1	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt	ENSG00000131196		0.572	NFATC1-007	KNOWN	basic	protein_coding	NFATC1	HGNC	protein_coding	OTTHUMT00000450507.1	94	0.00	0	G	NM_172390		77227491	77227491	+1	no_errors	ENST00000427363	ensembl	human	known	69_37n	missense	74	11.90	10	SNP	0.991	C
NIPAL3	57185	genome.wustl.edu	37	1	24792493	24792493	+	Intron	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:24792493G>C	ENST00000374399.4	+	11	1389				NIPAL3_ENST00000339255.2_Splice_Site|NIPAL3_ENST00000003912.3_Intron	NM_020448.4	NP_065181.1	Q6P499	NPAL3_HUMAN	NIPA-like domain containing 3							integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			endometrium(1)|kidney(1)|large_intestine(6)|lung(5)|skin(1)	14						TGTCTACCTAGATTCATATCT	0.413																																						dbGAP											0													27.0	26.0	26.0					1																	24792493		876	1991	2867	-	-	-	SO:0001627	intron_variant	0			BX640883	CCDS30631.1	1p36.12-p35.1	2009-03-24		2009-03-24	ENSG00000001461	ENSG00000001461			25233	protein-coding gene	gene with protein product				NPAL3		8619474, 9110174	Standard	NM_020448		Approved	DJ462O23.2	uc001bjh.3	Q6P499	OTTHUMG00000003299	ENST00000374399.4:c.1021+1883G>C	1.37:g.24792493G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	A2A298|Q6MZT9|Q9BVE6	Splice_Site	SNP	-	e11-1	ENST00000374399.4	37	c.1022-1	CCDS30631.1	1	.	.	.	.	.	.	.	.	.	.	G	6.948	0.544811	0.13312	.	.	ENSG00000001461	ENST00000339255	.	.	.	4.18	2.24	0.28232	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.4991	0.16819	0.1089:0.2048:0.6863:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	NIPAL3	24665080	0.018000	0.18449	0.001000	0.08648	0.021000	0.10359	2.204000	0.42761	0.685000	0.31468	0.655000	0.94253	.	NIPAL3	-	-	ENSG00000001461		0.413	NIPAL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPAL3	HGNC	protein_coding	OTTHUMT00000276996.1	34	0.00	0	G	NM_020448		24792493	24792493	+1	no_errors	ENST00000339255	ensembl	human	known	69_37n	splice_site	47	14.55	8	SNP	0.002	C
NIPAL4	348938	genome.wustl.edu	37	5	156887500	156887500	+	Intron	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:156887500C>T	ENST00000311946.7	+	1	339				NIPAL4_ENST00000435489.2_Intron|ADAM19_ENST00000430702.2_Intron|NIPAL4_ENST00000521390.1_Intron	NM_001099287.1	NP_001092757.1	Q0D2K0	NIPA4_HUMAN	NIPA-like domain containing 4							integral component of membrane (GO:0016021)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(3)|endometrium(3)|kidney(1)|large_intestine(1)|lung(12)|prostate(1)|skin(1)	22						CGAGGTGGCTCCCACCCAGCT	0.637																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AK026158	CCDS47328.1, CCDS54944.1	5q33.3	2009-03-24	2009-03-24		ENSG00000172548	ENSG00000172548			28018	protein-coding gene	gene with protein product	"""ichthyin"""	609383	"""NIPA-like 4"""			8619474, 9110174, 15317751	Standard	NM_001099287		Approved	ICHYN	uc003lwx.4	Q0D2K0	OTTHUMG00000163497	ENST00000311946.7:c.223+135C>T	5.37:g.156887500C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8S6F1|A8S6F5|A8S6F8|B4DLF3|Q0D2J8|Q0D2J9	RNA	SNP	-	NULL	ENST00000311946.7	37	NULL	CCDS47328.1	5																																																																																			NIPAL4	-	-	ENSG00000172548		0.637	NIPAL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIPAL4	HGNC	protein_coding	OTTHUMT00000373789.1	45	0.00	0	C	NM_001099287		156887500	156887500	+1	no_errors	ENST00000519946	ensembl	human	known	69_37n	rna	51	15.00	9	SNP	0.002	T
NLRP1	22861	genome.wustl.edu	37	17	5487160	5487160	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:5487160C>T	ENST00000572272.1	-	1	117	c.118G>A	c.(118-120)Gag>Aag	p.E40K	NLRP1_ENST00000354411.3_Missense_Mutation_p.E40K|NLRP1_ENST00000262467.5_Missense_Mutation_p.E40K|NLRP1_ENST00000269280.4_Missense_Mutation_p.E40K|NLRP1_ENST00000577119.1_Missense_Mutation_p.E40K|NLRP1_ENST00000345221.3_Missense_Mutation_p.E40K|NLRP1_ENST00000571307.1_5'UTR			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	40	DAPIN. {ECO:0000255|PROSITE- ProRule:PRU00061}.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				GCGGGTGTCTCACCCGAAGAG	0.612																																						dbGAP											0													32.0	26.0	28.0					17																	5487160		2201	4293	6494	-	-	-	SO:0001583	missense	0			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.118G>A	17.37:g.5487160C>T	ENSP00000460475:p.Glu40Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.E40K	ENST00000572272.1	37	c.118	CCDS42246.1	17	.	.	.	.	.	.	.	.	.	.	C	6.759	0.508954	0.12883	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221	T;T;T;T;T	0.57436	0.4;0.4;0.4;0.4;0.4	3.42	1.32	0.21799	Pyrin (2);DEATH-like (2);	1.953080	0.03190	N	0.173275	T	0.36663	0.0975	L	0.44542	1.39	0.09310	N	1	P;B;P;P;P	0.39282	0.615;0.358;0.666;0.615;0.666	B;B;B;B;B	0.34991	0.073;0.073;0.12;0.073;0.193	T	0.21075	-1.0256	10	0.02654	T	1	.	3.4288	0.07421	0.2527:0.6062:0.0:0.1411	.	40;40;40;40;40	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	K	40	ENSP00000442029:E40K;ENSP00000262467:E40K;ENSP00000269280:E40K;ENSP00000346390:E40K;ENSP00000324366:E40K	ENSP00000262467:E40K	E	-	1	0	NLRP1	5427884	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.287000	0.08388	0.403000	0.25479	0.555000	0.69702	GAG	NLRP1	-	pfam_DAPIN,superfamily_DEATH-like,pfscan_DAPIN	ENSG00000091592		0.612	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	47	0.00	0	C	NM_033004		5487160	5487160	-1	no_errors	ENST00000572272	ensembl	human	known	69_37n	missense	53	13.11	8	SNP	0.000	T
NME4	4833	genome.wustl.edu	37	16	449629	449629	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:449629C>T	ENST00000219479.2	+	4	344	c.330C>T	c.(328-330)gtC>gtT	p.V110V	DECR2_ENST00000397710.1_5'Flank|NME4_ENST00000397722.1_Silent_p.V40V|DECR2_ENST00000424398.2_5'Flank|DECR2_ENST00000219481.5_5'Flank|NME4_ENST00000382940.4_Silent_p.V118V|NME4_ENST00000450036.1_Silent_p.V40V	NM_005009.2	NP_005000.1	O00746	NDKM_HUMAN	NME/NM23 nucleoside diphosphate kinase 4	110					CTP biosynthetic process (GO:0006241)|GTP biosynthetic process (GO:0006183)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleoside metabolic process (GO:0009116)|small molecule metabolic process (GO:0044281)|UTP biosynthetic process (GO:0006228)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			NS(1)|lung(1)|stomach(1)|urinary_tract(1)	4		Hepatocellular(16;0.00015)				CGCTGCAGGTCTGGGAAGGGT	0.622																																						dbGAP											0													93.0	95.0	94.0					16																	449629		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			Y07604	CCDS10408.1, CCDS66886.1, CCDS73797.1	16p13.3	2013-04-29	2012-05-18		ENSG00000103202	ENSG00000103202			7852	protein-coding gene	gene with protein product		601818	"""non-metastatic cells 4, protein expressed in"""			9099850, 19852809	Standard	NM_005009		Approved	nm23-H4, NM23H4, NDPKD	uc002cgz.3	O00746	OTTHUMG00000047995	ENST00000219479.2:c.330C>T	16.37:g.449629C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A2IDD0|Q5U0M9	Silent	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	p.V110	ENST00000219479.2	37	c.330	CCDS10408.1	16																																																																																			NME4	-	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Nucleoside_diP_kinase,prints_Nucleoside_diP_kinase	ENSG00000103202		0.622	NME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME4	HGNC	protein_coding	OTTHUMT00000109256.2	40	0.00	0	C	NM_005009		449629	449629	+1	no_errors	ENST00000444498	ensembl	human	known	69_37n	silent	72	18.18	16	SNP	1.000	T
RPP38	10557	genome.wustl.edu	37	10	15145310	15145310	+	5'UTR	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:15145310C>T	ENST00000378197.4	+	0	511				RPP38_ENST00000378202.5_5'UTR|NMT2_ENST00000466201.1_5'UTR|RPP38_ENST00000451677.1_Intron	NM_183005.4	NP_892117.1	P78345	RPP38_HUMAN	ribonuclease P/MRP 38kDa subunit						RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|tRNA processing (GO:0008033)	nucleolar ribonuclease P complex (GO:0005655)|nucleus (GO:0005634)	ribonuclease P activity (GO:0004526)			breast(1)|endometrium(3)|large_intestine(1)|lung(2)|ovary(1)	8						GAAGGATTTTCAAAATGGCTG	0.438																																					GBM(118;1591 1611 9649 34378 50720)	dbGAP											0													58.0	63.0	61.0					10																	15145310		2203	4300	6503	-	-	-	SO:0001623	5_prime_UTR_variant	0			U77664	CCDS7108.1	10p13	2012-05-21			ENSG00000152464	ENSG00000152464			30329	protein-coding gene	gene with protein product		606116				9037013, 9630247	Standard	NM_183005		Approved		uc001inx.5	P78345	OTTHUMG00000017728	ENST00000378197.4:c.-4C>T	10.37:g.15145310C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KPY0|D3DRT8|Q53F71|Q8NHS8	RNA	SNP	-	NULL	ENST00000378197.4	37	NULL	CCDS7108.1	10																																																																																			NMT2	-	-	ENSG00000152465		0.438	RPP38-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NMT2	HGNC	protein_coding	OTTHUMT00000046976.1	21	0.00	0	C	NM_006414		15145310	15145310	-1	no_errors	ENST00000466201	ensembl	human	known	69_37n	rna	22	21.43	6	SNP	0.000	T
NRG1	3084	genome.wustl.edu	37	8	32406297	32406297	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:32406297G>A	ENST00000405005.3	+	1	53	c.53G>A	c.(52-54)cGa>cAa	p.R18Q	NRG1_ENST00000523079.1_Missense_Mutation_p.R18Q|NRG1_ENST00000519301.1_Intron|NRG1_ENST00000287842.3_Missense_Mutation_p.R18Q|NRG1_ENST00000520407.1_Intron|NRG1_ENST00000356819.4_Missense_Mutation_p.R18Q|NRG1_ENST00000521670.1_Missense_Mutation_p.R18Q|NRG1_ENST00000338921.4_Missense_Mutation_p.R18Q|NRG1_ENST00000287845.5_Missense_Mutation_p.R18Q|NRG1_ENST00000341377.5_Missense_Mutation_p.R18Q			Q02297	NRG1_HUMAN	neuregulin 1	18					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cardiac conduction system development (GO:0003161)|cardiac muscle cell differentiation (GO:0055007)|cardiac muscle cell myoblast differentiation (GO:0060379)|cell communication (GO:0007154)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|cellular protein complex disassembly (GO:0043624)|embryo development (GO:0009790)|endocardial cell differentiation (GO:0060956)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell fate commitment (GO:0021781)|innate immune response (GO:0045087)|locomotory behavior (GO:0007626)|mammary gland development (GO:0030879)|MAPK cascade (GO:0000165)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of secretion (GO:0051048)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|neural crest cell development (GO:0014032)|neuron fate commitment (GO:0048663)|neurotransmitter receptor metabolic process (GO:0045213)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peripheral nervous system development (GO:0007422)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of cardiac muscle cell proliferation (GO:0060045)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell growth (GO:0030307)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of Ras protein signal transduction (GO:0046579)|positive regulation of striated muscle cell differentiation (GO:0051155)|regulation of protein heterodimerization activity (GO:0043497)|regulation of protein homodimerization activity (GO:0043496)|synapse assembly (GO:0007416)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|ventricular cardiac muscle cell differentiation (GO:0055012)|ventricular trabecula myocardium morphogenesis (GO:0003222)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)	cytokine activity (GO:0005125)|ErbB-3 class receptor binding (GO:0043125)|growth factor activity (GO:0008083)|protein tyrosine kinase activator activity (GO:0030296)|receptor binding (GO:0005102)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(18)|ovary(1)|prostate(1)|skin(1)	39		Breast(100;0.203)		KIRC - Kidney renal clear cell carcinoma(67;0.0768)|Kidney(114;0.0943)		AAGAAGGAGCGAGGCTCCGGC	0.697																																						dbGAP											0													34.0	46.0	42.0					8																	32406297		2179	4286	6465	-	-	-	SO:0001583	missense	0			L12261	CCDS6084.1, CCDS6085.1, CCDS6086.1, CCDS6087.1, CCDS47836.1, CCDS55218.1, CCDS55219.1, CCDS75727.1	8p21-p12	2014-06-23			ENSG00000157168	ENSG00000157168		"""Immunoglobulin superfamily / I-set domain containing"""	7997	protein-coding gene	gene with protein product		142445	"""NRG1 intronic transcript 2 (non-protein coding)"""	HGL, NRG1-IT2		1350381, 8095334	Standard	NM_013962		Approved	HRG, NDF, GGF	uc003xiu.2	Q02297	OTTHUMG00000163918	ENST00000405005.3:c.53G>A	8.37:g.32406297G>A	ENSP00000384620:p.Arg18Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A5YAK4|A5YAK5|A8K1L2|B7Z4Z3|E9PHH4|O14667|P98202|Q02298|Q02299|Q07110|Q07111|Q12779|Q12780|Q12781|Q12782|Q12783|Q12784|Q15491|Q7RTV9|Q7RTW0|Q7RTW1|Q7RTW2|Q8NFN1|Q8NFN2|Q8NFN3|Q9UPE3	Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_EGF-like,pfscan_EG-like_dom,pfscan_Ig-like,prints_Neuregulin	p.R18Q	ENST00000405005.3	37	c.53	CCDS6085.1	8	.	.	.	.	.	.	.	.	.	.	G	18.59	3.656807	0.67586	.	.	ENSG00000157168	ENST00000523079;ENST00000338921;ENST00000356819;ENST00000287840;ENST00000287845;ENST00000341377;ENST00000287842;ENST00000405005;ENST00000521670	T;T;T;T;T;T;T;T;T	0.77620	-0.54;-0.56;-0.56;-0.25;-0.49;-1.11;-0.35;-0.25;-0.48	4.89	4.89	0.63831	.	1.138130	0.06568	N	0.747941	T	0.68723	0.3032	N	0.24115	0.695	0.28918	N	0.892282	P;P;P;D;P;P;P;P;P	0.53619	0.804;0.799;0.804;0.961;0.876;0.804;0.876;0.953;0.953	B;B;B;B;B;B;B;B;B	0.43445	0.042;0.058;0.058;0.304;0.091;0.042;0.091;0.124;0.42	T	0.59705	-0.7404	10	0.40728	T	0.16	-5.5023	9.3455	0.38107	0.0993:0.0:0.9007:0.0	.	18;17;17;18;18;18;18;18;18	E9PHH4;B0FYA9;B0FWZ3;B7Z4Z3;Q02297-7;Q02297;Q02297-6;Q02297-3;Q02297-8	.;.;.;.;.;NRG1_HUMAN;.;.;.	Q	18	ENSP00000430120:R18Q;ENSP00000343395:R18Q;ENSP00000349275:R18Q;ENSP00000287840:R18Q;ENSP00000287845:R18Q;ENSP00000340497:R18Q;ENSP00000287842:R18Q;ENSP00000384620:R18Q;ENSP00000428828:R18Q	ENSP00000287840:R18Q	R	+	2	0	NRG1	32525839	0.184000	0.23200	0.928000	0.36995	0.962000	0.63368	2.490000	0.45294	2.252000	0.74401	0.462000	0.41574	CGA	NRG1	-	NULL	ENSG00000157168		0.697	NRG1-017	KNOWN	basic|appris_candidate|CCDS	protein_coding	NRG1	HGNC	protein_coding	OTTHUMT00000472504.1	43	0.00	0	G			32406297	32406297	+1	no_errors	ENST00000338921	ensembl	human	known	69_37n	missense	20	16.67	4	SNP	0.288	A
NPBWR1	2831	genome.wustl.edu	37	8	53853333	53853333	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:53853333C>T	ENST00000331251.3	+	1	2343	c.866C>T	c.(865-867)tCc>tTc	p.S289F		NM_005285.3	NP_005276.2	P48145	NPBW1_HUMAN	neuropeptides B/W receptor 1	289					G-protein coupled receptor signaling pathway (GO:0007186)|opioid receptor signaling pathway (GO:0038003)|regulation of metabolic process (GO:0019222)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|opioid receptor activity (GO:0004985)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)	17		Lung NSC(129;0.0222)|all_epithelial(80;0.0301)|all_lung(136;0.0431)				ATCGCTATCTCCTACTTCATC	0.637																																						dbGAP											0													57.0	49.0	52.0					8																	53853333		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC033145	CCDS6151.1	8p22-q21.13	2012-08-08	2006-02-15	2006-02-15		ENSG00000183729		"""GPCR / Class A : Neuropeptide receptors : W/B"""	4522	protein-coding gene	gene with protein product		600730	"""G protein-coupled receptor 7"""	GPR7		7590751, 12401809	Standard	NM_005285		Approved		uc011ldu.2	P48145		ENST00000331251.3:c.866C>T	8.37:g.53853333C>T	ENSP00000330284:p.Ser289Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6NTC7	Missense_Mutation	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Neuropept_W_rcpt,prints_7TM_GPCR_Rhodpsn,prints_NPY_rcpt,prints_Opioid_rcpt	p.S289F	ENST00000331251.3	37	c.866	CCDS6151.1	8	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255307	0.59321	.	.	ENSG00000183729	ENST00000331251	T	0.70986	-0.53	4.87	4.87	0.63330	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	U	0.000101	T	0.73860	0.3641	L	0.31207	0.915	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.66152	-0.5995	10	0.06757	T	0.87	.	18.1845	0.89789	0.0:1.0:0.0:0.0	.	289	P48145	NPBW1_HUMAN	F	289	ENSP00000330284:S289F	ENSP00000330284:S289F	S	+	2	0	NPBWR1	54015886	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	5.705000	0.68355	2.529000	0.85273	0.561000	0.74099	TCC	NPBWR1	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000183729		0.637	NPBWR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPBWR1	HGNC	protein_coding	OTTHUMT00000378047.1	141	0.00	0	C	NM_005285		53853333	53853333	+1	no_errors	ENST00000331251	ensembl	human	known	69_37n	missense	70	18.60	16	SNP	1.000	T
NT5M	56953	genome.wustl.edu	37	17	17250283	17250283	+	3'UTR	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:17250283C>T	ENST00000389022.4	+	0	925				NT5M_ENST00000582909.1_3'UTR	NM_020201.3	NP_064586.1	Q9NPB1	NT5M_HUMAN	5',3'-nucleotidase, mitochondrial						dephosphorylation (GO:0016311)|DNA replication (GO:0006260)|dUMP catabolic process (GO:0046079)|nucleobase-containing small molecule metabolic process (GO:0055086)|pyrimidine deoxyribonucleotide catabolic process (GO:0009223)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5'-nucleotidase activity (GO:0008253)|metal ion binding (GO:0046872)|nucleotidase activity (GO:0008252)|nucleotide binding (GO:0000166)			endometrium(1)|kidney(1)|large_intestine(1)|lung(1)	4						CTTCGGGCTCCTCTGTGGGGC	0.687																																						dbGAP											0													23.0	29.0	27.0					17																	17250283		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF210652	CCDS32581.1	17p11.2	2007-08-01	2002-05-23		ENSG00000205309	ENSG00000205309	3.1.3.5		15769	protein-coding gene	gene with protein product		605292	"""5' nucleotidase, mitochondrial"""			10899995	Standard	XM_005256731		Approved	dNT-2, dNT2, mdN	uc002grf.3	Q9NPB1	OTTHUMG00000059277	ENST00000389022.4:c.*22C>T	17.37:g.17250283C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_5'(3')-deoxyribonucleotidase,superfamily_HAD-like_dom	p.S235	ENST00000389022.4	37	c.705	CCDS32581.1	17																																																																																			NT5M	-	NULL	ENSG00000205309		0.687	NT5M-007	KNOWN	basic|appris_principal|CCDS	protein_coding	NT5M	HGNC	protein_coding	OTTHUMT00000446045.1	41	0.00	0	C			17250283	17250283	+1	no_errors	ENST00000446264	ensembl	human	novel	69_37n	silent	51	12.07	7	SNP	0.000	T
NUP188	23511	genome.wustl.edu	37	9	131768563	131768563	+	Silent	SNP	C	C	T	rs144808385		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:131768563C>T	ENST00000372577.2	+	43	5010	c.4989C>T	c.(4987-4989)atC>atT	p.I1663I	RP11-167N5.5_ENST00000594418.1_lincRNA	NM_015354.1	NP_056169.1	Q5SRE5	NU188_HUMAN	nucleoporin 188kDa	1663					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				breast(2)|central_nervous_system(3)|endometrium(6)|kidney(4)|large_intestine(9)|lung(20)|ovary(6)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	60						ACCTGCTCATCTCTCAGGCGA	0.577											OREG0019528	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																										dbGAP											0													120.0	117.0	118.0					9																	131768563		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			D79991	CCDS35156.1	9q34.13	2014-01-28	2004-03-19	2004-03-24	ENSG00000095319	ENSG00000095319			17859	protein-coding gene	gene with protein product		615587	"""KIAA0169"""	KIAA0169		11029043	Standard	NM_015354		Approved		uc004bws.2	Q5SRE5	OTTHUMG00000020768	ENST00000372577.2:c.4989C>T	9.37:g.131768563C>T		Somatic	1590	WXS	Illumina GAIIx	Phase_IV	Q14675|Q2TA87|Q7Z3K8|Q8IWF1	Silent	SNP	pfam_Nucleoporin_Nup188,superfamily_ARM-type_fold	p.I1663	ENST00000372577.2	37	c.4989	CCDS35156.1	9																																																																																			NUP188	-	NULL	ENSG00000095319		0.577	NUP188-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP188	HGNC	protein_coding	OTTHUMT00000054529.2	67	0.00	0	C			131768563	131768563	+1	no_errors	ENST00000372577	ensembl	human	known	69_37n	silent	103	10.43	12	SNP	1.000	T
NWD1	284434	genome.wustl.edu	37	19	16902356	16902356	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:16902356G>C	ENST00000552788.1	+	12	3136	c.3136G>C	c.(3136-3138)Gaa>Caa	p.E1046Q	NWD1_ENST00000549814.1_Missense_Mutation_p.E1046Q|NWD1_ENST00000339803.6_Missense_Mutation_p.E911Q|NWD1_ENST00000524140.2_Missense_Mutation_p.E1046Q|NWD1_ENST00000379808.3_Missense_Mutation_p.E1046Q|NWD1_ENST00000523826.1_Missense_Mutation_p.E840Q			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1046							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CATCAAAGAAGAAACACCTAC	0.502																																						dbGAP											0													123.0	98.0	106.0					19																	16902356		2203	4300	6503	-	-	-	SO:0001583	missense	0			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3136G>C	19.37:g.16902356G>C	ENSP00000447224:p.Glu1046Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1046Q	ENST00000552788.1	37	c.3136		19	.	.	.	.	.	.	.	.	.	.	G	15.86	2.958465	0.53400	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.46451	1.6;0.87;1.6;3.56;3.56;3.56	5.34	5.34	0.76211	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.526595	0.20846	N	0.084604	T	0.42517	0.1206	L	0.29908	0.895	0.09310	N	0.999998	D;P;D	0.63880	0.967;0.948;0.993	B;P;P	0.53266	0.425;0.628;0.722	T	0.27773	-1.0064	10	0.23302	T	0.38	-9.0978	14.5172	0.67827	0.0:0.0:1.0:0.0	.	1046;1046;911	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	Q	911;1046;1046;1046;840;1046;911	ENSP00000428579:E1046Q;ENSP00000447548:E1046Q;ENSP00000369136:E1046Q;ENSP00000428955:E840Q;ENSP00000447224:E1046Q;ENSP00000340159:E911Q	ENSP00000340159:E911Q	E	+	1	0	NWD1	16763356	0.989000	0.36119	0.054000	0.19295	0.006000	0.05464	5.060000	0.64312	2.494000	0.84150	0.655000	0.94253	GAA	NWD1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000188039		0.502	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	25	0.00	0	G	NM_001007525		16902356	16902356	+1	no_errors	ENST00000379808	ensembl	human	known	69_37n	missense	35	12.50	5	SNP	0.240	C
ODF2L	57489	genome.wustl.edu	37	1	86848880	86848880	+	Splice_Site	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:86848880C>T	ENST00000359242.3	-	5	654		c.e5-1		ODF2L_ENST00000394731.1_Splice_Site|ODF2L_ENST00000370566.3_Splice_Site|ODF2L_ENST00000317336.7_Splice_Site|ODF2L_ENST00000370567.1_Splice_Site|ODF2L_ENST00000294678.2_Splice_Site	NM_001007022.2	NP_001007023.2	Q9ULJ1	ODF2L_HUMAN	outer dense fiber of sperm tails 2-like							centrosome (GO:0005813)				endometrium(2)|kidney(2)|large_intestine(10)|lung(6)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	24				all cancers(265;0.0313)|Epithelial(280;0.0611)		TGTCTCCTGTCTGAGAAAAGA	0.299																																						dbGAP											0													70.0	72.0	72.0					1																	86848880		2202	4299	6501	-	-	-	SO:0001630	splice_region_variant	0				CCDS30763.1, CCDS41354.1, CCDS30763.2, CCDS41354.2, CCDS53339.1	1p22.3	2008-02-05			ENSG00000122417	ENSG00000122417			29225	protein-coding gene	gene with protein product						10574462	Standard	NM_020729		Approved	KIAA1229	uc001dll.2	Q9ULJ1	OTTHUMG00000010080	ENST00000359242.3:c.373-1G>A	1.37:g.86848880C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MU56|B4E037|Q05C40|Q5BJG5|Q5TBX3|Q5TBX4|Q86X31	Splice_Site	SNP	-	e4-1	ENST00000359242.3	37	c.373-1	CCDS41354.2	1	.	.	.	.	.	.	.	.	.	.	C	14.36	2.512124	0.44660	.	.	ENSG00000122417	ENST00000441121;ENST00000370566;ENST00000359242;ENST00000317336;ENST00000370567;ENST00000294678;ENST00000465959	.	.	.	5.35	4.37	0.52481	.	.	.	.	.	.	.	.	.	.	.	0.30517	N	0.768815	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.6169	0.33838	0.1695:0.6666:0.1639:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ODF2L	86621468	0.748000	0.28294	0.820000	0.32676	0.686000	0.39977	1.496000	0.35638	2.669000	0.90835	0.650000	0.86243	.	ODF2L	-	-	ENSG00000122417		0.299	ODF2L-001	KNOWN	basic|CCDS	protein_coding	ODF2L	HGNC	protein_coding	OTTHUMT00000027873.2	31	0.00	0	C		Intron	86848880	86848880	-1	no_errors	ENST00000317336	ensembl	human	known	69_37n	splice_site	44	16.67	9	SNP	0.124	T
OLFM1	10439	genome.wustl.edu	37	9	138011559	138011559	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:138011559C>G	ENST00000371793.3	+	6	1244	c.993C>G	c.(991-993)ctC>ctG	p.L331L	OLFM1_ENST00000371796.3_Silent_p.L304L|OLFM1_ENST00000252854.4_Silent_p.L313L	NM_001282611.1	NP_001269540.1	Q99784	NOE1_HUMAN	olfactomedin 1	331	Olfactomedin-like. {ECO:0000255|PROSITE- ProRule:PRU00446}.				negative regulation of beta-amyloid formation (GO:1902430)|negative regulation of neuron migration (GO:2001223)|nervous system development (GO:0007399)|protein oligomerization (GO:0051259)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|extracellular space (GO:0005615)|synapse (GO:0045202)	beta-amyloid binding (GO:0001540)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)	21		Myeloproliferative disorder(178;0.0333)		Epithelial(140;5.49e-08)|OV - Ovarian serous cystadenocarcinoma(145;9.68e-08)|all cancers(34;1.88e-07)		AGACCATCCTCAAGACCCGCA	0.562																																						dbGAP											0													102.0	88.0	93.0					9																	138011559		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF035301	CCDS6986.1, CCDS6987.1, CCDS65183.1, CCDS65184.1	9q34.3	2014-01-20			ENSG00000130558	ENSG00000130558			17187	protein-coding gene	gene with protein product	"""pancortin"""	605366				9039501	Standard	NM_006334		Approved	NOE1, OlfA, AMY, NOELIN	uc004cfl.4	Q99784	OTTHUMG00000020897	ENST00000371793.3:c.993C>G	9.37:g.138011559C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53XZ8|Q6IMJ4|Q6IMJ5|Q8N8R0|Q969S7|Q99452	Silent	SNP	pfam_Olfac-like,pfam_Noelin-1,superfamily_Quinonprotein_ADH-like,smart_Olfac-like,pfscan_Olfac-like	p.L331	ENST00000371793.3	37	c.993		9																																																																																			OLFM1	-	pfam_Olfac-like,superfamily_Quinonprotein_ADH-like,smart_Olfac-like,pfscan_Olfac-like	ENSG00000130558		0.562	OLFM1-004	KNOWN	basic|appris_principal	protein_coding	OLFM1	HGNC	protein_coding	OTTHUMT00000054974.1	27	0.00	0	C	NM_014279		138011559	138011559	+1	no_errors	ENST00000371793	ensembl	human	known	69_37n	silent	47	14.55	8	SNP	0.999	G
OR2W5	441932	genome.wustl.edu	37	1	247655180	247655180	+	RNA	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:247655180C>T	ENST00000522351.1	+	0	811							A6NFC9	OR2W5_HUMAN	olfactory receptor, family 2, subfamily W, member 5							integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(24)|ovary(1)|skin(4)	39	all_cancers(71;4.51e-05)|all_epithelial(71;1.3e-05)|Breast(184;0.0149)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.222)	OV - Ovarian serous cystadenocarcinoma(106;0.0188)			TGGTCTCTCTCTTCTACGGAA	0.542																																						dbGAP											0													138.0	121.0	127.0					1																	247655180		2203	4300	6503	-	-	-			0					1q44	2013-03-27		2004-03-10	ENSG00000203664	ENSG00000203664		"""GPCR / Class A : Olfactory receptors"""	15424	other	unknown				OR2W5P		12213199	Standard	NM_001004698		Approved	OST722	uc001icz.2	A6NFC9	OTTHUMG00000040573		1.37:g.247655180C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EH85	RNA	SNP	-	NULL	ENST00000522351.1	37	NULL		1																																																																																			OR2W5	-	-	ENSG00000203664		0.542	OR2W5-002	KNOWN	basic	processed_transcript	OR2W5	HGNC	pseudogene	OTTHUMT00000375789.1	62	0.00	0	C	NM_001004698		247655180	247655180	+1	no_errors	ENST00000522351	ensembl	human	known	69_37n	rna	100	13.79	16	SNP	0.946	T
OR52I2	143502	genome.wustl.edu	37	11	4608426	4608426	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:4608426C>T	ENST00000312614.4	+	1	406	c.384C>T	c.(382-384)ttC>ttT	p.F128F		NM_001005170.2	NP_001005170.1	Q8NH67	O52I2_HUMAN	olfactory receptor, family 52, subfamily I, member 2	128						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|pancreas(1)|skin(1)	19		Medulloblastoma(188;0.0075)|Breast(177;0.0461)|all_neural(188;0.0577)		Epithelial(150;8.45e-12)|BRCA - Breast invasive adenocarcinoma(625;0.0285)|LUSC - Lung squamous cell carcinoma(625;0.19)		GTGCTTGTTTCACTCAGATGT	0.512																																						dbGAP											0													126.0	118.0	121.0					11																	4608426		2201	4298	6499	-	-	-	SO:0001819	synonymous_variant	0			BK004264	CCDS31355.1	11p15.4	2012-08-09			ENSG00000226288	ENSG00000226288		"""GPCR / Class A : Olfactory receptors"""	15221	protein-coding gene	gene with protein product							Standard	NM_001005170		Approved		uc010qyh.2	Q8NH67	OTTHUMG00000165721	ENST00000312614.4:c.384C>T	11.37:g.4608426C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNJ5|B9EKV8|Q6IFJ8	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F128	ENST00000312614.4	37	c.384	CCDS31355.1	11																																																																																			OR52I2	-	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000226288		0.512	OR52I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52I2	HGNC	protein_coding	OTTHUMT00000385946.1	139	0.00	0	C	NM_001005170		4608426	4608426	+1	no_errors	ENST00000312614	ensembl	human	known	69_37n	silent	101	15.13	18	SNP	0.348	T
OR51Q1	390061	genome.wustl.edu	37	11	5444150	5444150	+	Silent	SNP	C	C	G	rs118011081	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:5444150C>G	ENST00000300778.4	+	1	810	c.720C>G	c.(718-720)ctC>ctG	p.L240L	HBG2_ENST00000380259.2_Intron|AC104389.28_ENST00000415970.1_RNA|HBG2_ENST00000380252.1_Intron|HBE1_ENST00000380237.1_Intron	NM_001004757.2	NP_001004757.1	Q8NH59	O51Q1_HUMAN	olfactory receptor, family 51, subfamily Q, member 1 (gene/pseudogene)	240						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|kidney(2)|large_intestine(3)|liver(2)|lung(21)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	37		Medulloblastoma(188;0.0075)|all_neural(188;0.0572)|Breast(177;0.0675)		Epithelial(150;2.18e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)		TCCGTGCCCTCAATAACTGCC	0.488																																						dbGAP											0													137.0	114.0	122.0					11																	5444150		2201	4297	6498	-	-	-	SO:0001819	synonymous_variant	0			AB065531	CCDS31381.1	11p15.4	2013-10-10	2013-10-10		ENSG00000167360	ENSG00000167360		"""GPCR / Class A : Olfactory receptors"""	14851	protein-coding gene	gene with protein product			"""olfactory receptor, family 51, subfamily Q, member 1"""				Standard	NM_001004757		Approved		uc010qzd.2	Q8NH59	OTTHUMG00000066896	ENST00000300778.4:c.720C>G	11.37:g.5444150C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNN1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L240	ENST00000300778.4	37	c.720	CCDS31381.1	11																																																																																			OR51Q1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000167360		0.488	OR51Q1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR51Q1	HGNC	protein_coding	OTTHUMT00000143373.1	61	0.00	0	C	NM_001004757		5444150	5444150	+1	no_errors	ENST00000300778	ensembl	human	known	69_37n	silent	57	14.93	10	SNP	0.997	G
OR5H2	79310	genome.wustl.edu	37	3	98002001	98002001	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:98002001C>T	ENST00000355273.2	+	1	270	c.270C>T	c.(268-270)ttC>ttT	p.F90F	RP11-325B23.2_ENST00000508616.1_lincRNA	NM_001005482.1	NP_001005482.1	Q8NGV7	OR5H2_HUMAN	olfactory receptor, family 5, subfamily H, member 2	90						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(1)|large_intestine(5)|lung(13)|ovary(3)|upper_aerodigestive_tract(1)	24						TGGTTAATTTCTTGGCCAAAA	0.383																																						dbGAP											0													173.0	169.0	170.0					3																	98002001		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS33801.1	3q11.2	2013-09-23			ENSG00000197938	ENSG00000197938		"""GPCR / Class A : Olfactory receptors"""	14752	protein-coding gene	gene with protein product							Standard	NM_001005482		Approved		uc003dsj.1	Q8NGV7	OTTHUMG00000160080	ENST00000355273.2:c.270C>T	3.37:g.98002001C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6IF87	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F90	ENST00000355273.2	37	c.270	CCDS33801.1	3																																																																																			OR5H2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	ENSG00000197938		0.383	OR5H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5H2	HGNC	protein_coding	OTTHUMT00000359113.2	58	0.00	0	C			98002001	98002001	+1	no_errors	ENST00000355273	ensembl	human	known	69_37n	silent	54	12.90	8	SNP	0.002	T
OR5L1	219437	genome.wustl.edu	37	11	55579224	55579224	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:55579224C>T	ENST00000333973.2	+	1	371	c.282C>T	c.(280-282)ttC>ttT	p.F94F		NM_001004738.1	NP_001004738.1	Q8NGL2	OR5L1_HUMAN	olfactory receptor, family 5, subfamily L, member 1	94						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(4)|liver(4)|lung(36)|ovary(2)|pancreas(1)|prostate(5)|skin(9)|stomach(4)|upper_aerodigestive_tract(3)	78		all_epithelial(135;0.208)				CCATCTCCTTCCTAGGGTGCA	0.458																																						dbGAP											0													227.0	206.0	213.0					11																	55579224		2200	4296	6496	-	-	-	SO:0001819	synonymous_variant	0			AB065780	CCDS31509.1	11q11	2012-08-09			ENSG00000186117	ENSG00000186117		"""GPCR / Class A : Olfactory receptors"""	8350	protein-coding gene	gene with protein product							Standard	NM_001004738		Approved	OST262	uc001nhw.1	Q8NGL2	OTTHUMG00000166810	ENST00000333973.2:c.282C>T	11.37:g.55579224C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNK6|Q6IFD0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam	p.F94	ENST00000333973.2	37	c.282	CCDS31509.1	11																																																																																			OR5L1	-	pfam_7TM_GPCR_Rhodpsn,prints_Olfact_rcpt,pfscan_GPCR_Rhodpsn_supfam	ENSG00000186117		0.458	OR5L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L1	HGNC	protein_coding	OTTHUMT00000391514.1	175	0.00	0	C	NM_001004738		55579224	55579224	+1	no_errors	ENST00000333973	ensembl	human	known	69_37n	silent	121	15.97	23	SNP	0.000	T
OR6B2	389090	genome.wustl.edu	37	2	240969292	240969292	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:240969292G>C	ENST00000402971.2	-	1	614	c.555C>G	c.(553-555)ctC>ctG	p.L185L		NM_001005853.1	NP_001005853.1	Q6IFH4	OR6B2_HUMAN	olfactory receptor, family 6, subfamily B, member 2	185						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(4)|lung(9)|prostate(1)	15		all_epithelial(40;1.64e-11)|Breast(86;0.000327)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.229)|Melanoma(123;0.238)		Epithelial(121;3.4e-29)|all cancers(36;2.08e-27)|OV - Ovarian serous cystadenocarcinoma(60;4.63e-14)|Kidney(56;2.99e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;1.56e-05)|Lung(119;0.00344)|LUSC - Lung squamous cell carcinoma(224;0.0148)		AGGCCAGCTTGAGGATGGGGG	0.517																																						dbGAP											0													35.0	41.0	39.0					2																	240969292		1983	4147	6130	-	-	-	SO:0001819	synonymous_variant	0				CCDS46559.1	2q37.3	2012-08-09	2004-10-07	2004-10-07	ENSG00000182083	ENSG00000182083		"""GPCR / Class A : Olfactory receptors"""	15041	protein-coding gene	gene with protein product			"""olfactory receptor, family 6, subfamily B, member 2 pseudogene"""	OR6B2P			Standard	XM_005247004		Approved		uc010zoc.2	Q6IFH4	OTTHUMG00000152400	ENST00000402971.2:c.555C>G	2.37:g.240969292G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RPR3|Q8NGW0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L185	ENST00000402971.2	37	c.555	CCDS46559.1	2																																																																																			OR6B2	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt	ENSG00000182083		0.517	OR6B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6B2	HGNC	protein_coding	OTTHUMT00000326079.1	49	0.00	0	G	NM_001005853		240969292	240969292	-1	no_errors	ENST00000402971	ensembl	human	known	69_37n	silent	55	17.91	12	SNP	1.000	C
OR6X1	390260	genome.wustl.edu	37	11	123624915	123624915	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:123624915G>A	ENST00000327930.2	-	1	338	c.312C>T	c.(310-312)ttC>ttT	p.F104F		NM_001005188.1	NP_001005188.1	Q8NH79	OR6X1_HUMAN	olfactory receptor, family 6, subfamily X, member 1	104						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(3)|endometrium(3)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|skin(2)	23		Breast(109;0.0109)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0279)		TGGTGCCCACGAAGAAGTGGA	0.522																																						dbGAP											0													142.0	139.0	140.0					11																	123624915		2202	4299	6501	-	-	-	SO:0001819	synonymous_variant	0			AB065510	CCDS31695.1	11q24.1	2012-08-09			ENSG00000221931	ENSG00000221931		"""GPCR / Class A : Olfactory receptors"""	14737	protein-coding gene	gene with protein product							Standard	NM_001005188		Approved		uc010rzy.2	Q8NH79	OTTHUMG00000166011	ENST00000327930.2:c.312C>T	11.37:g.123624915G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EGW9|Q6IFA0	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.F104	ENST00000327930.2	37	c.312	CCDS31695.1	11																																																																																			OR6X1	-	pfam_7TM_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_supfam,prints_7TM_GPCR_Rhodpsn	ENSG00000221931		0.522	OR6X1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6X1	HGNC	protein_coding	OTTHUMT00000387436.1	82	0.00	0	G	NM_001005188		123624915	123624915	-1	no_errors	ENST00000327930	ensembl	human	known	69_37n	silent	94	14.55	16	SNP	0.195	A
OR7E24	26648	genome.wustl.edu	37	19	9361812	9361812	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:9361812C>T	ENST00000456448.1	+	1	207	c.93C>T	c.(91-93)ctC>ctT	p.L31L		NM_001079935.1	NP_001073404.1	Q6IFN5	O7E24_HUMAN	olfactory receptor, family 7, subfamily E, member 24	31						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(2)	16						CAGAATTCCTCCTCCTGGGAC	0.502																																						dbGAP											0													34.0	36.0	35.0					19																	9361812		2160	4270	6430	-	-	-	SO:0001819	synonymous_variant	0			Y10529	CCDS45955.1	19p13.2	2012-08-09	2004-03-04	2004-03-05		ENSG00000237521		"""GPCR / Class A : Olfactory receptors"""	8396	protein-coding gene	gene with protein product			"""olfactory receptor, family 7, subfamily E, member 24 pseudogene"""	OR7E24P		9268701	Standard	NM_001079935		Approved	OR19-8, HSHT2, OR7E24Q	uc002mlb.1	Q6IFN5		ENST00000456448.1:c.93C>T	19.37:g.9361812C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B9EJD9|Q9UPJ1	Silent	SNP	pfam_7TM_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_supfam,prints_Olfact_rcpt,prints_7TM_GPCR_Rhodpsn	p.L31	ENST00000456448.1	37	c.93	CCDS45955.1	19																																																																																			OR7E24	-	NULL	ENSG00000237521		0.502	OR7E24-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7E24	HGNC	protein_coding	OTTHUMT00000449006.1	49	0.00	0	C			9361812	9361812	+1	no_errors	ENST00000456448	ensembl	human	known	69_37n	silent	58	10.77	7	SNP	0.622	T
OTOGL	283310	genome.wustl.edu	37	12	80712466	80712466	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:80712466C>G	ENST00000547103.1	+	32	3754	c.3748C>G	c.(3748-3750)Cca>Gca	p.P1250A	OTOGL_ENST00000458043.2_Missense_Mutation_p.P1250A			Q3ZCN5	OTOGL_HUMAN	otogelin-like	1250					L-arabinose metabolic process (GO:0046373)	extracellular region (GO:0005576)	alpha-L-arabinofuranosidase activity (GO:0046556)			breast(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(14)|prostate(1)	23						TATGATCACTCCAGGCCTTTT	0.348																																						dbGAP											0													24.0	22.0	23.0					12																	80712466		1774	4005	5779	-	-	-	SO:0001583	missense	0			AK096852		12q21.31	2011-02-11	2011-02-11	2011-02-11	ENSG00000165899	ENSG00000165899			26901	protein-coding gene	gene with protein product		614925	"""chromosome 12 open reading frame 64"""	C12orf64			Standard	NM_173591		Approved	FLJ90579	uc001szd.3	Q3ZCN5	OTTHUMG00000150509	ENST00000547103.1:c.3748C>G	12.37:g.80712466C>G	ENSP00000447211:p.Pro1250Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	F8W0C3|Q495U8|Q8N8G5|Q8NC28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_AbfB,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C	p.P1250A	ENST00000547103.1	37	c.3748		12	.	.	.	.	.	.	.	.	.	.	C	4.270	0.049130	0.08243	.	.	ENSG00000165899	ENST00000547103;ENST00000458043	T;T	0.14391	2.51;2.51	5.91	5.91	0.95273	.	.	.	.	.	T	0.19327	0.0464	L	0.33753	1.03	0.38145	D	0.938578	.	.	.	.	.	.	T	0.03773	-1.1005	7	0.12766	T	0.61	.	20.2985	0.98592	0.0:1.0:0.0:0.0	.	.	.	.	A	1250	ENSP00000447211:P1250A;ENSP00000400895:P1250A	ENSP00000400895:P1250A	P	+	1	0	OTOGL	79236597	1.000000	0.71417	1.000000	0.80357	0.864000	0.49448	2.556000	0.45862	2.793000	0.96121	0.655000	0.94253	CCA	OTOGL	-	pfam_AbfB,superfamily_AbfB	ENSG00000165899		0.348	OTOGL-001	NOVEL	not_organism_supported|basic	protein_coding	OTOGL	HGNC	protein_coding	OTTHUMT00000407438.1	34	0.00	0	C	NM_173591		80712466	80712466	+1	no_errors	ENST00000458043	ensembl	human	known	69_37n	missense	29	12.12	4	SNP	1.000	G
PAPPA	5069	genome.wustl.edu	37	9	118950121	118950121	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:118950121G>A	ENST00000328252.3	+	2	1473	c.1104G>A	c.(1102-1104)ccG>ccA	p.P368P	PAPPA_ENST00000534838.1_5'Flank	NM_002581.3	NP_002572.2	Q13219	PAPP1_HUMAN	pregnancy-associated plasma protein A, pappalysin 1	368	Metalloprotease.				cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|female pregnancy (GO:0007565)|response to follicle-stimulating hormone (GO:0032354)|response to glucocorticoid (GO:0051384)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|membrane (GO:0016020)	endopeptidase activity (GO:0004175)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|endometrium(9)|kidney(2)|large_intestine(23)|lung(33)|ovary(4)|pancreas(2)|prostate(5)|skin(7)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	98						ATAAGAACCCGACGGTGACGC	0.567																																						dbGAP											0													51.0	47.0	48.0					9																	118950121		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS6813.1	9q33.1	2014-03-05			ENSG00000182752	ENSG00000182752			8602	protein-coding gene	gene with protein product	"""insulin-like growth factor-dependent IGF binding protein-4 protease"", ""aspecific BCL2 ARE-binding protein 2"", ""differentially placenta 1 expressed protein"""	176385				7679961	Standard	NM_002581		Approved	PAPP-A, PAPPA1, IGFBP-4ase, PAPA, ASBABP2, DIPLA1	uc004bjn.3	Q13219	OTTHUMG00000021045	ENST00000328252.3:c.1104G>A	9.37:g.118950121G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B1AMF9|Q08371|Q68G52|Q9UDK7	Silent	SNP	pfam_Sushi_SCR_CCP,pfam_Notch_dom,pfam_Peptidase_M43,superfamily_ConA-like_lec_gl,superfamily_Complement_control_module,superfamily_Fibronectin_type3,superfamily_Notch_dom,smart_LamG-like,smart_Notch_dom,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP,tigrfam_Myxo_disulph_rpt	p.P368	ENST00000328252.3	37	c.1104	CCDS6813.1	9																																																																																			PAPPA	-	NULL	ENSG00000182752		0.567	PAPPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPPA	HGNC	protein_coding	OTTHUMT00000055546.1	51	0.00	0	G	NM_002581		118950121	118950121	+1	no_errors	ENST00000328252	ensembl	human	known	69_37n	silent	51	13.56	8	SNP	0.005	A
PBX2P1	5088	genome.wustl.edu	37	3	142895584	142895584	+	RNA	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:142895584C>T	ENST00000560287.1	+	0	458									pre-B-cell leukemia homeobox 2 pseudogene 1																		TCAGCAGCAGCAGCTGCAGCC	0.622																																						dbGAP											0																																										-	-	-			0					3q24	2014-03-25	2007-01-30	2007-01-30	ENSG00000244171	ENSG00000244171		"""Homeoboxes / TALE class"""	8635	pseudogene	pseudogene			"""pre-B-cell leukemia transcription factor pseudogene 1"""	PBX2, PBXP1		1682799	Standard	NG_002434		Approved				OTTHUMG00000159350		3.37:g.142895584C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000560287.1	37	NULL		3																																																																																			PBX2P1	-	-	ENSG00000244171		0.622	PBX2P1-002	KNOWN	basic	processed_transcript	PBX2P1	HGNC	pseudogene	OTTHUMT00000417717.1	133	0.00	0	C	NG_002434		142895584	142895584	+1	no_errors	ENST00000560287	ensembl	human	known	69_37n	rna	102	26.09	36	SNP	1.000	T
PCCA	5095	genome.wustl.edu	37	13	101182391	101182391	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:101182391G>A	ENST00000376285.1	+	24	2196	c.2158G>A	c.(2158-2160)Gaa>Aaa	p.E720K	PCCA_ENST00000376279.3_Missense_Mutation_p.E673K|PCCA_ENST00000376286.4_Missense_Mutation_p.E694K	NM_000282.3	NP_000273.2	P05165	PCCA_HUMAN	propionyl CoA carboxylase, alpha polypeptide	720	Biotinyl-binding. {ECO:0000255|PROSITE- ProRule:PRU01066}.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|biotin binding (GO:0009374)|biotin carboxylase activity (GO:0004075)|enzyme binding (GO:0019899)|metal ion binding (GO:0046872)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|lung(8)|prostate(1)|skin(2)	26	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)				Biotin(DB00121)	CACAGTTGGAGAAGGGGATCT	0.428																																						dbGAP											0													109.0	99.0	103.0					13																	101182391		2203	4300	6503	-	-	-	SO:0001583	missense	0			X14608	CCDS9496.2, CCDS45065.1, CCDS53878.1	13q32	2011-01-14	2010-04-30		ENSG00000175198	ENSG00000175198	6.4.1.3		8653	protein-coding gene	gene with protein product		232000	"""propionyl Coenzyme A carboxylase, alpha polypeptide"""			1427880	Standard	NM_000282		Approved		uc001voo.3	P05165	OTTHUMG00000017284	ENST00000376285.1:c.2158G>A	13.37:g.101182391G>A	ENSP00000365462:p.Glu720Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DKY8|B4DPF9|C9JPQ8|Q15979|Q8WXQ7	Missense_Mutation	SNP	pfam_CbamoylP_synth_lsu-like_ATP-bd,pfam_CarbamoylP_synth_lsu_N,pfam_Biotin_COase_C,pfam_Biotin_lipoyl,pfam_Dala_Dala_lig_C,pfam_ATP-grasp_RimK-type,pfam_ATP-grasp_carboxylate-amine,superfamily_PreATP-grasp_fold,superfamily_Rudment_hybrid_motif,superfamily_Single_hybrid_motif,smart_Biotin_COase_C,pfscan_ATP-grasp,pfscan_Biotin_carboxylation_dom,pfscan_Biotin_lipoyl	p.E720K	ENST00000376285.1	37	c.2158	CCDS9496.2	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.6|22.6	4.312369|4.312369	0.81358|0.81358	.|.	.|.	ENSG00000175198|ENSG00000175198	ENST00000376286;ENST00000376279;ENST00000376285;ENST00000376277;ENST00000428969|ENST00000458283	T;T;T;T|.	0.57595|.	0.39;0.39;0.39;0.39|.	5.51|5.51	5.51|5.51	0.81932|0.81932	Single hybrid motif (1);Biotin/lipoyl attachment (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.47451|0.47451	0.1446|0.1446	N|N	0.05619|0.05619	-0.0049999999999999|-0.0049999999999999	0.80722|0.80722	D|D	1|1	P;P;P|.	0.52316|.	0.82;0.887;0.952|.	P;P;D|.	0.65233|.	0.652;0.811;0.933|.	T|T	0.43261|0.43261	-0.9402|-0.9402	10|5	0.06625|.	T|.	0.88|.	.|.	19.4315|19.4315	0.94772|0.94772	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	673;694;720|.	C9JPQ8;P05165-2;P05165|.	.;.;PCCA_HUMAN|.	K|K	694;673;720;112;103|125	ENSP00000365463:E694K;ENSP00000365456:E673K;ENSP00000365462:E720K;ENSP00000399413:E103K|.	ENSP00000365454:E112K|.	E|R	+|+	1|2	0|0	PCCA|PCCA	99980392|99980392	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.977000|0.977000	0.68977|0.68977	7.599000|7.599000	0.82757|0.82757	2.600000|2.600000	0.87896|0.87896	0.655000|0.655000	0.94253|0.94253	GAA|AGA	PCCA	-	pfam_Biotin_lipoyl,superfamily_Single_hybrid_motif,pfscan_Biotin_lipoyl	ENSG00000175198		0.428	PCCA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCCA	HGNC	protein_coding	OTTHUMT00000045627.2	54	0.00	0	G			101182391	101182391	+1	no_errors	ENST00000376285	ensembl	human	known	69_37n	missense	48	11.11	6	SNP	1.000	A
PCCB	5096	genome.wustl.edu	37	3	136012615	136012615	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:136012615C>T	ENST00000251654.4	+	7	742	c.672C>T	c.(670-672)ttC>ttT	p.F224F	PCCB_ENST00000478469.1_Silent_p.F224F|PCCB_ENST00000462637.1_Silent_p.F201F|PCCB_ENST00000468777.1_Silent_p.F255F|PCCB_ENST00000466072.1_Silent_p.F224F|PCCB_ENST00000471595.1_Silent_p.F224F|PCCB_ENST00000474833.1_3'UTR|PCCB_ENST00000482086.1_Silent_p.F108F|PCCB_ENST00000483687.1_Silent_p.F205F|PCCB_ENST00000469217.1_Silent_p.F244F|PCCB_ENST00000490504.1_Silent_p.F167F	NM_000532.4	NP_000523.2	P05166	PCCB_HUMAN	propionyl CoA carboxylase, beta polypeptide	224	Carboxyltransferase.				biotin metabolic process (GO:0006768)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|short-chain fatty acid catabolic process (GO:0019626)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|propionyl-CoA carboxylase activity (GO:0004658)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|urinary_tract(1)	25					Biotin(DB00121)|L-Valine(DB00161)	CCTACCTGTTCATCACTGGCC	0.512																																						dbGAP											0													220.0	209.0	213.0					3																	136012615		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0				CCDS3089.1, CCDS54643.1	3q21-q22	2010-07-01	2010-04-30		ENSG00000114054	ENSG00000114054	6.4.1.3		8654	protein-coding gene	gene with protein product		232050	"""propionyl Coenzyme A carboxylase, beta polypeptide"""			2895916	Standard	NM_000532		Approved		uc003eqy.2	P05166	OTTHUMG00000159792	ENST00000251654.4:c.672C>T	3.37:g.136012615C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z2Z4|Q16813|Q96CX0	Silent	SNP	pfam_Carboxyl_trans,pfscan_COA_CT_N,pfscan_COA_CT_C	p.F224	ENST00000251654.4	37	c.672	CCDS3089.1	3																																																																																			PCCB	-	pfam_Carboxyl_trans,pfscan_COA_CT_N	ENSG00000114054		0.512	PCCB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCCB	HGNC	protein_coding	OTTHUMT00000357335.1	56	0.00	0	C			136012615	136012615	+1	no_errors	ENST00000251654	ensembl	human	known	69_37n	silent	47	21.67	13	SNP	0.996	T
PCDHB1	29930	genome.wustl.edu	37	5	140433360	140433360	+	Missense_Mutation	SNP	C	C	T	rs180731232		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:140433360C>T	ENST00000306549.3	+	1	2382	c.2305C>T	c.(2305-2307)Cgc>Tgc	p.R769C		NM_013340.2	NP_037472.2	Q9Y5F3	PCDB1_HUMAN	protocadherin beta 1	769					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(16)|liver(1)|lung(13)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	53			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TAGTGAGTTTCGCTTTCTTAA	0.463													C|||	1	0.000199681	0.0008	0.0	5008	,	,		19656	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													138.0	138.0	138.0					5																	140433360		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF152488	CCDS4243.1	5q31	2010-01-26			ENSG00000171815	ENSG00000171815		"""Cadherins / Protocadherins : Clustered"""	8680	other	protocadherin		606327				10380929	Standard	NM_013340		Approved	PCDH-BETA1	uc003lik.1	Q9Y5F3	OTTHUMG00000129627	ENST00000306549.3:c.2305C>T	5.37:g.140433360C>T	ENSP00000307234:p.Arg769Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2M257	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R769C	ENST00000306549.3	37	c.2305	CCDS4243.1	5	1	4.578754578754579E-4	1	0.0020325203252032522	0	0.0	0	0.0	0	0.0	C	14.94	2.686159	0.47991	.	.	ENSG00000171815	ENST00000306549	T	0.51325	0.71	5.76	1.78	0.24846	.	0.000000	0.44902	D	0.000406	T	0.51041	0.1651	M	0.64404	1.975	0.28520	N	0.913105	D	0.76494	0.999	P	0.53185	0.72	T	0.49744	-0.8907	10	0.87932	D	0	.	6.9346	0.24459	0.4722:0.3954:0.0:0.1324	.	769	Q9Y5F3	PCDB1_HUMAN	C	769	ENSP00000307234:R769C	ENSP00000307234:R769C	R	+	1	0	PCDHB1	140413544	0.000000	0.05858	0.984000	0.44739	0.532000	0.34746	-0.229000	0.09098	0.342000	0.23796	-0.119000	0.15052	CGC	PCDHB1	-	NULL	ENSG00000171815		0.463	PCDHB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB1	HGNC	protein_coding	OTTHUMT00000251822.2	59	0.00	0	C	NM_013340		140433360	140433360	+1	no_errors	ENST00000306549	ensembl	human	known	69_37n	missense	50	24.24	16	SNP	0.402	T
PCDHB11	56125	genome.wustl.edu	37	5	140581362	140581362	+	Missense_Mutation	SNP	C	C	T	rs140365279|rs386692911	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:140581362C>T	ENST00000354757.3	+	1	2015	c.2015C>T	c.(2014-2016)cCg>cTg	p.P672L	PCDHB11_ENST00000536699.1_Missense_Mutation_p.P307L	NM_018931.2	NP_061754.1	Q9Y5F2	PCDBB_HUMAN	protocadherin beta 11	672					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)|synapse assembly (GO:0007416)|synaptic transmission (GO:0007268)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|prostate(3)|skin(6)|upper_aerodigestive_tract(5)|urinary_tract(1)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			CCCTACCTGCCGCTCCCTGAG	0.682																																						dbGAP											0													51.0	56.0	54.0					5																	140581362		2175	4268	6443	-	-	-	SO:0001583	missense	0			AF152490	CCDS4253.1	5q31	2010-01-26			ENSG00000197479	ENSG00000197479		"""Cadherins / Protocadherins : Clustered"""	8682	other	protocadherin	"""cadherin ME2"""	606337				10380929	Standard	NM_018931		Approved	PCDH-BETA11, ME2	uc003liy.3	Q9Y5F2	OTTHUMG00000129618	ENST00000354757.3:c.2015C>T	5.37:g.140581362C>T	ENSP00000346802:p.Pro672Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DSF7|Q2M223	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P672L	ENST00000354757.3	37	c.2015	CCDS4253.1	5	.	.	.	.	.	.	.	.	.	.	c	13.49	2.252057	0.39797	.	.	ENSG00000197479	ENST00000536699;ENST00000354757	T;T	0.54071	0.59;0.82	2.77	1.75	0.24633	.	.	.	.	.	T	0.53094	0.1775	M	0.88979	2.995	0.09310	N	1	B	0.33919	0.432	B	0.23852	0.049	T	0.55250	-0.8170	9	0.62326	D	0.03	.	8.5856	0.33655	0.3543:0.6457:0.0:0.0	.	672	Q9Y5F2	PCDBB_HUMAN	L	307;672	ENSP00000440344:P307L;ENSP00000346802:P672L	ENSP00000346802:P672L	P	+	2	0	PCDHB11	140561546	0.000000	0.05858	0.403000	0.26384	0.325000	0.28411	-1.337000	0.02657	1.554000	0.49487	0.549000	0.68633	CCG	PCDHB11	-	NULL	ENSG00000197479		0.682	PCDHB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB11	HGNC	protein_coding	OTTHUMT00000251813.1	178	0.00	0	C	NM_018931		140581362	140581362	+1	no_errors	ENST00000354757	ensembl	human	known	69_37n	missense	149	17.68	32	SNP	0.000	T
PCDHGB4	8641	genome.wustl.edu	37	5	140769580	140769580	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:140769580C>T	ENST00000519479.1	+	1	2129	c.2129C>T	c.(2128-2130)gCc>gTc	p.A710V	PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA8_ENST00000398604.2_5'Flank|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_003736.2|NM_018925.2|NM_032098.1	NP_003727.1|NP_061748.1|NP_115269.1	Q9UN71	PCDGG_HUMAN	protocadherin gamma subfamily B, 4	710					calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(9)|kidney(3)|large_intestine(4)|lung(14)|ovary(1)|prostate(1)|stomach(3)|urinary_tract(2)	37			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CTGGCCATTGCCTTGCGCCTG	0.607																																						dbGAP											0													153.0	167.0	163.0					5																	140769580		2104	4216	6320	-	-	-	SO:0001583	missense	0			AF152520	CCDS54928.1, CCDS75337.1	5q31	2010-01-26				ENSG00000253953		"""Cadherins / Protocadherins : Clustered"""	8711	other	protocadherin	"""fibroblast cadherin FIB2"", ""cadherin 20"""	603058				10380929	Standard	NM_003736		Approved	FIB2, CDH20, PCDH-GAMMA-B4		Q9UN71		ENST00000519479.1:c.2129C>T	5.37:g.140769580C>T	ENSP00000428288:p.Ala710Val	Somatic		WXS	Illumina GAIIx	Phase_IV	O15099|Q2M267|Q9UN64	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A710V	ENST00000519479.1	37	c.2129	CCDS54928.1	5	.	.	.	.	.	.	.	.	.	.	.	12.03	1.815044	0.32053	.	.	ENSG00000253953	ENST00000519479	T	0.15603	2.41	5.31	4.43	0.53597	.	.	.	.	.	T	0.25382	0.0617	M	0.80847	2.515	0.09310	N	1	B;B	0.26635	0.155;0.085	B;B	0.26310	0.068;0.033	T	0.11817	-1.0572	9	0.48119	T	0.1	.	12.1257	0.53915	0.0:0.8279:0.1721:0.0	.	710;710	Q9UN71-2;Q9UN71	.;PCDGG_HUMAN	V	710	ENSP00000428288:A710V	ENSP00000428288:A710V	A	+	2	0	PCDHGB4	140749764	0.000000	0.05858	0.417000	0.26559	0.784000	0.44337	0.264000	0.18497	1.205000	0.43262	0.563000	0.77884	GCC	PCDHGB4	-	NULL	ENSG00000253953		0.607	PCDHGB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB4	HGNC	protein_coding	OTTHUMT00000374745.1	68	0.00	0	C	NM_003736		140769580	140769580	+1	no_errors	ENST00000519479	ensembl	human	known	69_37n	missense	78	10.34	9	SNP	0.054	T
PCDHGB7	56099	genome.wustl.edu	37	5	140799815	140799815	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:140799815G>C	ENST00000398594.2	+	1	2389	c.2389G>C	c.(2389-2391)Gaa>Caa	p.E797Q	PCDHGB2_ENST00000522605.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA11_ENST00000518882.1_5'Flank|PCDHGA6_ENST00000517434.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA11_ENST00000398587.2_5'Flank|PCDHGB6_ENST00000520790.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018927.3	NP_061750.1	Q9Y5F8	PCDGJ_HUMAN	protocadherin gamma subfamily B, 7	797					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(13)|lung(15)|ovary(4)|prostate(3)|stomach(1)|upper_aerodigestive_tract(3)	56			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCCCAGCGTTGAAGCAGATAA	0.303																																						dbGAP											0													69.0	67.0	67.0					5																	140799815		1826	4102	5928	-	-	-	SO:0001583	missense	0			AF152523	CCDS47293.1, CCDS75344.1	5q31	2010-01-26			ENSG00000254122	ENSG00000254122		"""Cadherins / Protocadherins : Clustered"""	8714	other	protocadherin	"""cadherin ME6"""	606304				10380929	Standard	NM_032101		Approved	ME6, PCDH-GAMMA-B7		Q9Y5F8	OTTHUMG00000164054	ENST00000398594.2:c.2389G>C	5.37:g.140799815G>C	ENSP00000381594:p.Glu797Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9UN63	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.E797Q	ENST00000398594.2	37	c.2389	CCDS47293.1	5	.	.	.	.	.	.	.	.	.	.	g	0.855	-0.737326	0.03111	.	.	ENSG00000254122	ENST00000398594	T	0.47869	0.83	5.51	4.57	0.56435	.	425.529000	0.00819	U	0.001572	T	0.41396	0.1157	N	0.08118	0	0.09310	N	1	P;D	0.59357	0.557;0.985	B;P	0.52217	0.084;0.693	T	0.46569	-0.9182	10	0.20519	T	0.43	.	9.4481	0.38710	0.1381:0.0:0.8619:0.0	.	797;797	Q9Y5F8;Q9Y5F8-2	PCDGJ_HUMAN;.	Q	797	ENSP00000381594:E797Q	ENSP00000381594:E797Q	E	+	1	0	PCDHGB7	140779999	0.940000	0.31905	0.969000	0.41365	0.030000	0.12068	2.473000	0.45145	2.873000	0.98535	0.561000	0.74099	GAA	PCDHGB7	-	NULL	ENSG00000254122		0.303	PCDHGB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB7	HGNC	protein_coding	OTTHUMT00000376973.1	42	0.00	0	G	NM_018927		140799815	140799815	+1	no_errors	ENST00000398594	ensembl	human	known	69_37n	missense	64	14.67	11	SNP	0.034	C
PCGF6	84108	genome.wustl.edu	37	10	105108721	105108721	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:105108721G>C	ENST00000369847.3	-	2	463	c.396C>G	c.(394-396)atC>atG	p.I132M	PCGF6_ENST00000337211.4_Missense_Mutation_p.I132M|PCGF6_ENST00000490296.1_5'UTR	NM_001011663.1	NP_001011663.1	Q9BYE7	PCGF6_HUMAN	polycomb group ring finger 6	132					negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	DNA binding (GO:0003677)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(3)	8		Colorectal(252;0.0747)|Breast(234;0.128)		Epithelial(162;2.57e-09)|all cancers(201;7.21e-08)|BRCA - Breast invasive adenocarcinoma(275;0.205)		TGGAACACAAGATGTATGGGG	0.343																																						dbGAP											0													96.0	94.0	95.0					10																	105108721		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB047006	CCDS7546.1, CCDS31275.1	10q24.33	2013-01-09	2005-01-17	2005-01-19	ENSG00000156374	ENSG00000156374		"""RING-type (C3HC4) zinc fingers"", ""Polycomb group ring fingers"""	21156	protein-coding gene	gene with protein product		607816	"""ring finger protein 134"""	RNF134		12167161	Standard	NM_032154		Approved	MBLR	uc001kwt.3	Q9BYE7	OTTHUMG00000018982	ENST00000369847.3:c.396C>G	10.37:g.105108721G>C	ENSP00000358862:p.Ile132Met	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3R4|Q5SYD1|Q5SYD6|Q96ID9|Q96SJ1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I132M	ENST00000369847.3	37	c.396	CCDS31275.1	10	.	.	.	.	.	.	.	.	.	.	G	16.39	3.110875	0.56398	.	.	ENSG00000156374	ENST00000369847;ENST00000337211	T;T	0.35048	1.33;1.42	4.29	4.29	0.51040	Zinc finger, RING/FYVE/PHD-type (1);	0.000000	0.85682	D	0.000000	T	0.44286	0.1286	L	0.27053	0.805	0.39841	D	0.973103	D;D	0.89917	1.0;0.998	D;D	0.91635	0.999;0.995	T	0.46569	-0.9182	10	0.87932	D	0	.	10.5626	0.45154	0.0906:0.0:0.9094:0.0	.	132;132	Q9BYE7-3;Q9BYE7	.;PCGF6_HUMAN	M	132	ENSP00000358862:I132M;ENSP00000338845:I132M	ENSP00000338845:I132M	I	-	3	3	PCGF6	105098711	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.959000	0.56744	2.370000	0.80446	0.561000	0.74099	ATC	PCGF6	-	NULL	ENSG00000156374		0.343	PCGF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCGF6	HGNC	protein_coding	OTTHUMT00000050132.1	37	0.00	0	G	NM_032154		105108721	105108721	-1	no_errors	ENST00000369847	ensembl	human	known	69_37n	missense	25	30.56	11	SNP	1.000	C
PDLIM5	10611	genome.wustl.edu	37	4	95444938	95444938	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr4:95444938G>C	ENST00000317968.4	+	3	296	c.160G>C	c.(160-162)Gat>Cat	p.D54H	PDLIM5_ENST00000380180.3_Missense_Mutation_p.D54H|PDLIM5_ENST00000508216.1_Missense_Mutation_p.D54H|PDLIM5_ENST00000514743.1_Missense_Mutation_p.D54H|PDLIM5_ENST00000437932.1_Missense_Mutation_p.D54H|PDLIM5_ENST00000538141.1_Missense_Mutation_p.D54H|PDLIM5_ENST00000318007.5_Missense_Mutation_p.D54H|PDLIM5_ENST00000450793.1_Missense_Mutation_p.D54H|PDLIM5_ENST00000542407.1_Intron	NM_001256428.1|NM_006457.4	NP_001243357.1|NP_006448	Q96HC4	PDLI5_HUMAN	PDZ and LIM domain 5	54	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				regulation of dendritic spine morphogenesis (GO:0061001)|regulation of synapse assembly (GO:0051963)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|membrane (GO:0016020)|neuron projection (GO:0043005)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|actinin binding (GO:0042805)|protein kinase C binding (GO:0005080)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	22		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;1.84e-09)		TCTCAGCATTGATGGAATAAA	0.398																																						dbGAP											0													125.0	116.0	119.0					4																	95444938		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF061258	CCDS3641.1, CCDS47103.1, CCDS47104.1, CCDS58915.1, CCDS58916.1, CCDS58917.1, CCDS75166.1	4q22	2006-04-12			ENSG00000163110	ENSG00000163110			17468	protein-coding gene	gene with protein product		605904				15346770	Standard	NM_006457		Approved	LIM, Enh	uc003htk.4	Q96HC4	OTTHUMG00000130973	ENST00000317968.4:c.160G>C	4.37:g.95444938G>C	ENSP00000321746:p.Asp54His	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6F9|D6RB78|E9PBF5|O60705|Q56VN4|Q5UW38|Q8WVK0	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.D54H	ENST00000317968.4	37	c.160	CCDS3641.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.3|21.3	4.132913|4.132913	0.77662|0.77662	.|.	.|.	ENSG00000163110|ENSG00000163110	ENST00000437932;ENST00000380180;ENST00000318007;ENST00000450793;ENST00000538141;ENST00000317968;ENST00000503974;ENST00000508216;ENST00000514743|ENST00000513341	T;T;T;T;T;T;T;T;T|.	0.30448|.	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53|.	5.96|5.96	5.96|5.96	0.96718|0.96718	PDZ/DHR/GLGF (4);|.	0.000000|.	0.85682|.	D|.	0.000000|.	D|D	0.86606|0.86606	0.5973|0.5973	M|M	0.91768|0.91768	3.24|3.24	0.80722|0.80722	D|D	1|1	P;D;P;D;P;B|.	0.76494|.	0.919;0.999;0.531;0.999;0.95;0.003|.	P;D;B;D;P;B|.	0.75020|.	0.88;0.964;0.376;0.985;0.824;0.067|.	D|D	0.88279|0.88279	0.2935|0.2935	10|5	0.87932|.	D|.	0|.	.|.	20.0147|20.0147	0.97475|0.97475	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	54;54;54;54;54;54|.	E9PBF5;D6RB78;Q96HC4;Q96HC4-4;Q96HC4-2;Q96HC4-3|.	.;.;PDLI5_HUMAN;.;.;.|.	H|F	54|21	ENSP00000398469:D54H;ENSP00000369527:D54H;ENSP00000322021:D54H;ENSP00000401579:D54H;ENSP00000439795:D54H;ENSP00000321746:D54H;ENSP00000424297:D54H;ENSP00000426804:D54H;ENSP00000424360:D54H|.	ENSP00000321746:D54H|.	D|L	+|+	1|3	0|2	PDLIM5|PDLIM5	95663961|95663961	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	5.936000|5.936000	0.70153|0.70153	2.823000|2.823000	0.97156|0.97156	0.650000|0.650000	0.86243|0.86243	GAT|TTG	PDLIM5	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	ENSG00000163110		0.398	PDLIM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM5	HGNC	protein_coding	OTTHUMT00000253586.1	29	0.00	0	G			95444938	95444938	+1	no_errors	ENST00000317968	ensembl	human	known	69_37n	missense	39	13.33	6	SNP	1.000	C
PEA15	8682	genome.wustl.edu	37	1	160183238	160183238	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:160183238G>A	ENST00000360472.4	+	4	543	c.355G>A	c.(355-357)Gag>Aag	p.E119K	PEA15_ENST00000368077.1_Missense_Mutation_p.E97K|PEA15_ENST00000488858.1_3'UTR|PEA15_ENST00000368076.1_Missense_Mutation_p.E140K	NM_003768.3	NP_003759.1	Q15121	PEA15_HUMAN	phosphoprotein enriched in astrocytes 15	119					apoptotic process (GO:0006915)|carbohydrate transport (GO:0008643)|DNA damage checkpoint (GO:0000077)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of glucose import (GO:0046325)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|response to morphine (GO:0043278)|transport (GO:0006810)	cytoplasm (GO:0005737)|microtubule associated complex (GO:0005875)				large_intestine(1)|lung(4)	5	all_cancers(52;3.11e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			CTCTGAGGAAGAGATCATCAA	0.582																																						dbGAP											0													75.0	66.0	69.0					1																	160183238		2203	4300	6503	-	-	-	SO:0001583	missense	0			Y13736	CCDS1199.1, CCDS72954.1	1q21.1	2008-07-18			ENSG00000162734	ENSG00000162734			8822	protein-coding gene	gene with protein product	"""Phosphoprotein enriched in astrocytes, 15kD"", ""homolog of mouse MAT-1 oncogene"""	603434				9205133	Standard	XM_005245564		Approved	HMAT1, MAT1, PED, PEA-15, MAT1H, HUMMAT1H	uc001fvk.3	Q15121	OTTHUMG00000031605	ENST00000360472.4:c.355G>A	1.37:g.160183238G>A	ENSP00000353660:p.Glu119Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1AKZ3|O00511	Missense_Mutation	SNP	pfam_DED,superfamily_DEATH-like,smart_DED,pfscan_DED	p.E140K	ENST00000360472.4	37	c.418	CCDS1199.1	1	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129247	0.77549	.	.	ENSG00000162734	ENST00000360472;ENST00000368077;ENST00000368076	D;D;D	0.82711	-1.64;-1.64;-1.64	5.99	5.99	0.97316	DEATH-like (2);	0.055575	0.64402	D	0.000001	T	0.62938	0.2469	N	0.14661	0.345	0.80722	D	1	B;P;B	0.39311	0.447;0.667;0.117	B;B;B	0.33690	0.051;0.168;0.009	T	0.70132	-0.4956	10	0.48119	T	0.1	-12.1947	19.2492	0.93917	0.0:0.0:1.0:0.0	.	97;140;119	B1AKZ5;B1AKZ3;Q15121	.;.;PEA15_HUMAN	K	119;97;140	ENSP00000353660:E119K;ENSP00000357056:E97K;ENSP00000357055:E140K	ENSP00000353660:E119K	E	+	1	0	PEA15	158449862	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	8.521000	0.90569	2.840000	0.97914	0.655000	0.94253	GAG	PEA15	-	superfamily_DEATH-like	ENSG00000162734		0.582	PEA15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEA15	HGNC	protein_coding	OTTHUMT00000077407.1	34	0.00	0	G	NM_003768		160183238	160183238	+1	no_errors	ENST00000368076	ensembl	human	known	69_37n	missense	32	23.81	10	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)	dbGAP		Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	-	-	-	SO:0001583	missense	0				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom	ENSG00000121879		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	59	0.00	0	G			178936091	178936091	+1	no_errors	ENST00000263967	ensembl	human	known	69_37n	missense	55	20.29	14	SNP	1.000	A
PIP4K2C	79837	genome.wustl.edu	37	12	57987892	57987892	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:57987892C>T	ENST00000354947.5	+	2	275	c.259C>T	c.(259-261)Cac>Tac	p.H87Y	PIP4K2C_ENST00000550465.1_Intron|PIP4K2C_ENST00000422156.3_Missense_Mutation_p.H87Y|PIP4K2C_ENST00000540759.2_Missense_Mutation_p.H87Y			Q8TBX8	PI42C_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, gamma	87	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)|identical protein binding (GO:0042802)			autonomic_ganglia(1)|breast(3)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(3)|lung(13)|pancreas(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	33	Melanoma(17;0.122)					GGTCAACAATCACCTTTTCCA	0.433																																						dbGAP											0													110.0	93.0	99.0					12																	57987892		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK125526	CCDS8946.1, CCDS53808.1, CCDS55839.1	12q13.3	2014-09-04	2007-08-14	2007-08-14	ENSG00000166908	ENSG00000166908			23786	protein-coding gene	gene with protein product			"""phosphatidylinositol-4-phosphate 5-kinase, type II, gamma"""	PIP5K2C		9367159	Standard	NM_024779		Approved	FLJ22055	uc001sot.3	Q8TBX8	OTTHUMG00000170144	ENST00000354947.5:c.259C>T	12.37:g.57987892C>T	ENSP00000347032:p.His87Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RDL3|B4DM11|B4DY44|Q9H6N2	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.H87Y	ENST00000354947.5	37	c.259	CCDS8946.1	12	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308348	0.60305	.	.	ENSG00000166908	ENST00000422156;ENST00000540759;ENST00000436866;ENST00000551772;ENST00000354947	T;T;T;T	0.44083	1.51;1.51;0.93;1.51	4.62	3.73	0.42828	Phosphatidylinositol-4-phosphate 5-kinase, core (1);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.110699	0.64402	N	0.000013	T	0.57504	0.2058	M	0.83012	2.62	0.80722	D	1	D;P	0.56035	0.974;0.947	P;P	0.54100	0.677;0.742	T	0.63368	-0.6653	10	0.49607	T	0.09	-12.9471	12.1454	0.54020	0.0:0.9143:0.0:0.0857	.	87;87	B4DM11;Q8TBX8	.;PI42C_HUMAN	Y	87;87;87;66;87	ENSP00000412035:H87Y;ENSP00000439878:H87Y;ENSP00000450197:H66Y;ENSP00000347032:H87Y	ENSP00000347032:H87Y	H	+	1	0	PIP4K2C	56274159	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.625000	0.83145	1.306000	0.44926	0.563000	0.77884	CAC	PIP4K2C	-	smart_PInositol-4P-5-kinase_core_sub	ENSG00000166908		0.433	PIP4K2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2C	HGNC	protein_coding	OTTHUMT00000407644.1	49	0.00	0	C	NM_024779		57987892	57987892	+1	no_errors	ENST00000354947	ensembl	human	known	69_37n	missense	60	18.92	14	SNP	1.000	T
PLCB2	5330	genome.wustl.edu	37	15	40590496	40590496	+	Missense_Mutation	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:40590496C>A	ENST00000260402.3	-	11	1332	c.1083G>T	c.(1081-1083)tgG>tgT	p.W361C	PLCB2-AS1_ENST00000559520.1_RNA|PLCB2_ENST00000557821.1_Missense_Mutation_p.W361C|PLCB2_ENST00000456256.2_Missense_Mutation_p.W361C	NM_001284297.1|NM_004573.2	NP_001271226.1|NP_004564.2	Q00722	PLCB2_HUMAN	phospholipase C, beta 2	361	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				activation of phospholipase C activity (GO:0007202)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|sensory perception of bitter taste (GO:0050913)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(4)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(3)	39		all_cancers(109;9.35e-19)|all_epithelial(112;1.18e-15)|Lung NSC(122;2.45e-11)|all_lung(180;6.47e-10)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.117)		GBM - Glioblastoma multiforme(113;9.38e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0508)		GTTTCCCCTTCCAGCAGTCTA	0.602																																						dbGAP											0													57.0	63.0	61.0					15																	40590496		2128	4275	6403	-	-	-	SO:0001583	missense	0				CCDS42020.1, CCDS61591.1, CCDS61592.1, CCDS73704.1	15q15.1	2012-01-23			ENSG00000137841	ENSG00000137841	3.1.4.11		9055	protein-coding gene	gene with protein product		604114				1644792, 9925923	Standard	XM_005254448		Approved	FLJ38135	uc001zld.3	Q00722	OTTHUMG00000172412	ENST00000260402.3:c.1083G>T	15.37:g.40590496C>A	ENSP00000260402:p.Trp361Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K6J2|B9EGH5	Missense_Mutation	SNP	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLC-beta_C,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,prints_Pinositol_PLipase_C,pfscan_C2_membr_targeting,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.W361C	ENST00000260402.3	37	c.1083	CCDS42020.1	15	.	.	.	.	.	.	.	.	.	.	C	22.0	4.236352	0.79800	.	.	ENSG00000137841	ENST00000260402;ENST00000456256	T;T	0.61040	0.14;0.14	4.38	4.38	0.52667	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.131415	0.56097	D	0.000034	D	0.85062	0.5611	H	0.98178	4.165	0.80722	D	1	D;D;D	0.89917	1.0;0.998;1.0	D;D;D	0.97110	1.0;0.981;1.0	D	0.91154	0.4955	10	0.87932	D	0	.	17.4798	0.87670	0.0:1.0:0.0:0.0	.	361;361;361	B9EGH5;Q00722-2;Q00722	.;.;PLCB2_HUMAN	C	361	ENSP00000260402:W361C;ENSP00000411991:W361C	ENSP00000260402:W361C	W	-	3	0	PLCB2	38377788	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.651000	0.83577	2.438000	0.82558	0.563000	0.77884	TGG	PLCB2	-	pirsf_PLC-beta,pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,prints_Pinositol_PLipase_C,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000137841		0.602	PLCB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCB2	HGNC	protein_coding	OTTHUMT00000418430.1	60	0.00	0	C			40590496	40590496	-1	no_errors	ENST00000260402	ensembl	human	known	69_37n	missense	67	16.25	13	SNP	1.000	A
PLCG2	5336	genome.wustl.edu	37	16	81934351	81934351	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:81934351C>T	ENST00000359376.3	+	14	1542	c.1328C>T	c.(1327-1329)tCg>tTg	p.S443L		NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	443	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						CAGCTGCCCTCGCCCAGCCAG	0.637																																						dbGAP											0													38.0	43.0	42.0					16																	81934351		2124	4238	6362	-	-	-	SO:0001583	missense	0				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.1328C>T	16.37:g.81934351C>T	ENSP00000352336:p.Ser443Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_Ca-dep,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pirsf_PLC-gamma,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y	p.S443L	ENST00000359376.3	37	c.1328	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	C	35	5.547760	0.96488	.	.	ENSG00000197943	ENST00000359376	T	0.60424	0.19	5.03	5.03	0.67393	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (3);	0.064498	0.64402	D	0.000003	D	0.85287	0.5662	H	0.98238	4.18	0.80722	D	1	D;D	0.89917	1.0;0.999	D;P	0.74674	0.984;0.808	D	0.91307	0.5071	10	0.87932	D	0	.	18.3581	0.90365	0.0:1.0:0.0:0.0	.	310;443	B4E3H3;P16885	.;PLCG2_HUMAN	L	443	ENSP00000352336:S443L	ENSP00000352336:S443L	S	+	2	0	PLCG2	80491852	1.000000	0.71417	0.966000	0.40874	0.832000	0.47134	7.442000	0.80503	2.325000	0.78763	0.563000	0.77884	TCG	PLCG2	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pirsf_PLC-gamma,prints_Pinositol_PLipase_C,pfscan_PLipase_C_PInositol-sp_X_dom	ENSG00000197943		0.637	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	69	0.00	0	C			81934351	81934351	+1	no_errors	ENST00000359376	ensembl	human	known	69_37n	missense	67	11.84	9	SNP	0.998	T
PLCH2	9651	genome.wustl.edu	37	1	2435866	2435866	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:2435866C>G	ENST00000419816.2	+	22	3739	c.3465C>G	c.(3463-3465)gtC>gtG	p.V1155V	PLCH2_ENST00000449969.1_3'UTR|PLCH2_ENST00000378488.3_Silent_p.V1119V|PLCH2_ENST00000378486.3_Silent_p.V1155V			O75038	PLCH2_HUMAN	phospholipase C, eta 2	1155					inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|lipid catabolic process (GO:0016042)|phosphatidylinositol metabolic process (GO:0046488)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			central_nervous_system(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|ovary(1)|prostate(3)|skin(1)	20	all_cancers(77;0.000161)|all_epithelial(69;5.98e-05)|all_lung(157;0.016)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;7.32e-16)|all_lung(118;1.15e-06)|Lung NSC(185;6.26e-05)|Renal(390;0.00571)|Breast(487;0.00832)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Medulloblastoma(700;0.151)|Lung SC(97;0.217)		Epithelial(90;1.44e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.78e-23)|GBM - Glioblastoma multiforme(42;2.8e-08)|Colorectal(212;4.19e-05)|COAD - Colon adenocarcinoma(227;0.000195)|Kidney(185;0.00034)|BRCA - Breast invasive adenocarcinoma(365;0.00443)|KIRC - Kidney renal clear cell carcinoma(229;0.00548)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.2)		GCGACACTGTCATTGACCTCT	0.687																																						dbGAP											0													39.0	44.0	42.0					1																	2435866		2185	4268	6453	-	-	-	SO:0001819	synonymous_variant	0			AB007919	CCDS59959.1	1p36.32	2013-01-10	2006-03-16	2006-03-16	ENSG00000149527	ENSG00000149527	3.1.4.11	"""EF-hand domain containing"""	29037	protein-coding gene	gene with protein product		612836	"""phospholipase C-like 4"""	PLCL4		15899900	Standard	XM_006711054		Approved	KIAA0450, PLCeta2, RP3-395M20.1, PLC-eta2	uc001aji.1	O75038	OTTHUMG00000000719	ENST00000419816.2:c.3465C>G	1.37:g.2435866C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2VCM3|B9DI80|Q3LUA8|Q86XJ2|Q86XU1|Q86YU7|Q8TEH5|Q8WUS6	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PLipase_C_Pinositol-sp_Y,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PLipase_C_Pinositol-sp_Y	p.S450*	ENST00000419816.2	37	c.1349		1	.	.	.	.	.	.	.	.	.	.	C	1.387	-0.581865	0.03827	.	.	ENSG00000149527	ENST00000419816	.	.	.	4.75	4.75	0.60458	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.107	0.65096	0.0:0.8488:0.1512:0.0	.	.	.	.	X	450	.	.	S	+	2	0	PLCH2	2425726	1.000000	0.71417	0.987000	0.45799	0.264000	0.26372	1.469000	0.35343	2.189000	0.69895	0.561000	0.74099	TCA	PLCH2	-	NULL	ENSG00000149527		0.687	PLCH2-009	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	PLCH2	HGNC	protein_coding	OTTHUMT00000467514.1	120	0.00	0	C	NM_014638		2435866	2435866	+1	pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000419816	ensembl	human	known	69_37n	nonsense	134	14.10	22	SNP	1.000	G
PLCXD2	257068	genome.wustl.edu	37	3	111439652	111439652	+	Intron	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:111439652G>A	ENST00000477665.1	+	3	1190				PLCXD2_ENST00000472215.1_3'UTR|PLCXD2_ENST00000393934.3_Intron	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2						lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						TGACTTCGTGGACCTGGTGGA	0.453																																						dbGAP											0													167.0	141.0	149.0					3																	111439652		692	1591	2283	-	-	-	SO:0001627	intron_variant	0			AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.866+6677G>A	3.37:g.111439652G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q96N12	RNA	SNP	-	NULL	ENST00000477665.1	37	NULL	CCDS54619.1	3																																																																																			PLCXD2	-	-	ENSG00000240891		0.453	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCXD2	HGNC	protein_coding	OTTHUMT00000354322.1	60	0.00	0	G	NM_153268		111439652	111439652	+1	no_errors	ENST00000472215	ensembl	human	putative	69_37n	rna	84	16.83	17	SNP	1.000	A
PLK3	1263	genome.wustl.edu	37	1	45271370	45271370	+	3'UTR	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:45271370G>C	ENST00000372201.4	+	0	2200				BTBD19_ENST00000450269.1_5'Flank|BTBD19_ENST00000409335.2_5'Flank|PLK3_ENST00000465443.1_3'UTR|BTBD19_ENST00000453418.1_5'Flank	NM_004073.2	NP_004064.2	Q9H4B4	PLK3_HUMAN	polo-like kinase 3						apoptotic process (GO:0006915)|cellular response to DNA damage stimulus (GO:0006974)|cytoplasmic microtubule organization (GO:0031122)|endomitotic cell cycle (GO:0007113)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi disassembly (GO:0090166)|mitotic cell cycle checkpoint (GO:0007093)|mitotic G1/S transition checkpoint (GO:0044819)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process involved in cellular response to hypoxia (GO:2000777)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|regulation of cell division (GO:0051302)|regulation of cytokinesis (GO:0032465)|response to osmotic stress (GO:0006970)|response to radiation (GO:0009314)|response to reactive oxygen species (GO:0000302)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|Golgi stack (GO:0005795)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|p53 binding (GO:0002039)|protein serine/threonine kinase activity (GO:0004674)			endometrium(4)|large_intestine(2)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(166;0.155)					CCTGAGGCCTGAGGCCTGTGC	0.677																																						dbGAP											0													21.0	22.0	22.0					1																	45271370		2198	4270	6468	-	-	-	SO:0001624	3_prime_UTR_variant	0			AJ293866	CCDS515.1	1p34.1	2013-01-18	2010-06-24	2004-01-28	ENSG00000173846	ENSG00000173846			2154	protein-coding gene	gene with protein product		602913	"""cytokine-inducible kinase"", ""polo-like kinase 3 (Drosophila)"""	CNK		8702627	Standard	NM_004073		Approved	FNK, PRK	uc001cmn.3	Q9H4B4	OTTHUMG00000008491	ENST00000372201.4:c.*20G>C	1.37:g.45271370G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q15767|Q5JR99|Q96CV1	RNA	SNP	-	NULL	ENST00000372201.4	37	NULL	CCDS515.1	1																																																																																			PLK3	-	-	ENSG00000173846		0.677	PLK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLK3	HGNC	protein_coding	OTTHUMT00000023429.1	64	0.00	0	G	NM_004073		45271370	45271370	+1	no_errors	ENST00000465443	ensembl	human	known	69_37n	rna	80	10.11	9	SNP	0.000	C
PLS1	5357	genome.wustl.edu	37	3	142402873	142402873	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:142402873C>G	ENST00000337777.3	+	7	818	c.605C>G	c.(604-606)tCt>tGt	p.S202C	PLS1_ENST00000497002.1_Missense_Mutation_p.S202C|PLS1_ENST00000457734.2_Missense_Mutation_p.S202C	NM_002670.2	NP_002661.2	Q14651	PLSI_HUMAN	plastin 1	202	Actin-binding 1.|CH 1. {ECO:0000255|PROSITE- ProRule:PRU00044}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|pancreas(1)|skin(1)|stomach(1)	27						GCTCTGAATTCTGCCTCAGCC	0.373																																						dbGAP											0													98.0	94.0	96.0					3																	142402873		2203	4300	6503	-	-	-	SO:0001583	missense	0			L20826	CCDS3125.1	3q23	2013-01-10	2010-02-10		ENSG00000120756	ENSG00000120756		"""EF-hand domain containing"""	9090	protein-coding gene	gene with protein product		602734	"""plastin 1 (I isoform)"""			8139549	Standard	NM_002670		Approved	I-plastin, Plastin-1	uc003euz.3	Q14651	OTTHUMG00000159292	ENST00000337777.3:c.605C>G	3.37:g.142402873C>G	ENSP00000336831:p.Ser202Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K2Q1|D3DNG3|Q8NEG6	Missense_Mutation	SNP	pfam_CH-domain,pfam_EF-hand,superfamily_CH-domain,smart_EF_hand_Ca-bd,smart_CH-domain,pfscan_CH-domain,pfscan_EF_HAND_2	p.S202C	ENST00000337777.3	37	c.605	CCDS3125.1	3	.	.	.	.	.	.	.	.	.	.	C	24.4	4.523798	0.85600	.	.	ENSG00000120756	ENST00000457734;ENST00000476044;ENST00000337777;ENST00000497002	D;D;D;D	0.95171	-3.63;-3.63;-3.63;-3.63	4.98	4.98	0.66077	Calponin homology domain (5);	0.105000	0.64402	D	0.000002	D	0.97424	0.9157	M	0.85041	2.73	0.80722	D	1	D	0.89917	1.0	D	0.71414	0.973	D	0.97922	1.0315	10	0.87932	D	0	-15.3984	18.8032	0.92027	0.0:1.0:0.0:0.0	.	202	Q14651	PLSI_HUMAN	C	202;123;202;202	ENSP00000387890:S202C;ENSP00000417481:S123C;ENSP00000336831:S202C;ENSP00000418700:S202C	ENSP00000336831:S202C	S	+	2	0	PLS1	143885563	1.000000	0.71417	1.000000	0.80357	0.939000	0.58152	7.207000	0.77899	2.734000	0.93682	0.650000	0.86243	TCT	PLS1	-	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	ENSG00000120756		0.373	PLS1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLS1	HGNC	protein_coding	OTTHUMT00000354435.1	34	0.00	0	C	NM_002670		142402873	142402873	+1	no_errors	ENST00000337777	ensembl	human	known	69_37n	missense	50	21.88	14	SNP	1.000	G
PMS2CL	441194	genome.wustl.edu	37	7	6776865	6776865	+	RNA	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:6776865C>G	ENST00000486256.1	+	0	992					NR_002217.1		Q68D20	PMS2L_HUMAN	PMS2 C-terminal like pseudogene																		GAACAAGCCTCACAGCCCAAA	0.493																																						dbGAP											0																																										-	-	-			0			BC041364		7p22.1	2010-10-26			ENSG00000187953	ENSG00000187953			30061	pseudogene	pseudogene	"""postmeiotic segregation increased 2 pseudogene 13"""					15256438, 17253626	Standard	NR_002217		Approved	PMS2P13	uc011jxb.1	Q68D20	OTTHUMG00000151857		7.37:g.6776865C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DK88|Q764P1	RNA	SNP	-	NULL	ENST00000486256.1	37	NULL		7																																																																																			PMS2CL	-	-	ENSG00000187953		0.493	PMS2CL-002	KNOWN	basic	processed_transcript	PMS2CL	HGNC	pseudogene	OTTHUMT00000324193.1	119	0.00	0	C	NR_002217		6776865	6776865	+1	no_errors	ENST00000486256	ensembl	human	known	69_37n	rna	132	14.29	22	SNP	0.003	G
POLE4	56655	genome.wustl.edu	37	2	75196697	75196697	+	3'UTR	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:75196697C>T	ENST00000483063.1	+	0	690					NM_019896.2	NP_063949.2	Q9NR33	DPOE4_HUMAN	polymerase (DNA-directed), epsilon 4, accessory subunit						DNA-dependent DNA replication (GO:0006261)|histone H3 acetylation (GO:0043966)	Ada2/Gcn5/Ada3 transcription activator complex (GO:0005671)|epsilon DNA polymerase complex (GO:0008622)|nucleus (GO:0005634)	DNA-directed DNA polymerase activity (GO:0003887)|sequence-specific DNA binding (GO:0043565)			lung(1)	1					Cladribine(DB00242)	GCAGAGATCTCATCAATTAGC	0.488																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF261688	CCDS1957.1	2p12	2012-05-18	2012-05-18		ENSG00000115350	ENSG00000115350		"""DNA polymerases"""	18755	protein-coding gene	gene with protein product		607269	"""polymerase (DNA-directed), epsilon 4 (p12 subunit)"""			10801849	Standard	NM_019896		Approved	p12	uc002snf.3	Q9NR33	OTTHUMG00000129971	ENST00000483063.1:c.*148C>T	2.37:g.75196697C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q53TR2	RNA	SNP	-	NULL	ENST00000483063.1	37	NULL	CCDS1957.1	2																																																																																			POLE4	-	-	ENSG00000115350		0.488	POLE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLE4	HGNC	protein_coding	OTTHUMT00000252237.2	50	0.00	0	C	NM_019896		75196697	75196697	+1	no_errors	ENST00000233699	ensembl	human	known	69_37n	rna	38	11.63	5	SNP	0.069	T
POLR1A	25885	genome.wustl.edu	37	2	86265851	86265851	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:86265851C>T	ENST00000263857.6	-	27	4384	c.4006G>A	c.(4006-4008)Gag>Aag	p.E1336K	POLR1A_ENST00000409681.1_Missense_Mutation_p.E1336K			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1336					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						AGGATGTCCTCGGGTCTCAGG	0.512																																						dbGAP											0													78.0	76.0	77.0					2																	86265851		2016	4169	6185	-	-	-	SO:0001583	missense	0			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4006G>A	2.37:g.86265851C>T	ENSP00000263857:p.Glu1336Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.E1336K	ENST00000263857.6	37	c.4006	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	C	5.843	0.339677	0.11069	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.66815	-0.23;-0.23	5.8	2.04	0.26737	RNA polymerase Rpb1, domain 5 (1);	0.852286	0.10988	N	0.611895	T	0.52125	0.1715	L	0.37800	1.135	0.09310	N	1	B;B	0.22346	0.068;0.01	B;B	0.18263	0.021;0.011	T	0.31752	-0.9932	10	0.14656	T	0.56	-3.2341	9.2239	0.37393	0.0:0.5759:0.0:0.4241	.	702;1336	B7Z8X7;O95602	.;RPA1_HUMAN	K	1336	ENSP00000263857:E1336K;ENSP00000386300:E1336K	ENSP00000263857:E1336K	E	-	1	0	POLR1A	86119362	0.000000	0.05858	0.025000	0.17156	0.996000	0.88848	-0.207000	0.09384	0.100000	0.17581	0.655000	0.94253	GAG	POLR1A	-	pfam_RNA_pol_Rpb1_5	ENSG00000068654		0.512	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	62	0.00	0	C	NM_015425		86265851	86265851	-1	no_errors	ENST00000263857	ensembl	human	known	69_37n	missense	74	10.84	9	SNP	0.001	T
POLR2D	5433	genome.wustl.edu	37	2	128605577	128605577	+	3'UTR	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:128605577C>G	ENST00000272645.4	-	0	589				POLR2D_ENST00000409698.1_3'UTR|RNU6-395P_ENST00000365662.1_RNA|POLR2D_ENST00000487079.1_5'UTR|POLR2D_ENST00000409955.1_3'UTR|RP5-935K16.1_ENST00000602909.1_lincRNA	NM_004805.3	NP_004796.1	O15514	RPB4_HUMAN	polymerase (RNA) II (DNA directed) polypeptide D						7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus in response to heat stress (GO:0031990)|mRNA splicing, via spliceosome (GO:0000398)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleotide-excision repair (GO:0006289)|positive regulation of translational initiation (GO:0045948)|positive regulation of viral transcription (GO:0050434)|recruitment of 3'-end processing factors to RNA polymerase II holoenzyme complex (GO:0034402)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	cytoplasmic mRNA processing body (GO:0000932)|DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)|nucleotide binding (GO:0000166)|translation initiation factor binding (GO:0031369)			large_intestine(1)|lung(4)|urinary_tract(1)	6	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0675)		AAGGAATTCTCAACTGTCTTC	0.507																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			U85510	CCDS2151.1	2q21	2013-01-21			ENSG00000144231	ENSG00000144231		"""RNA polymerase subunits"""	9191	protein-coding gene	gene with protein product	"""RNA polymerase II subunit hsRBP4"""	606017				9528765	Standard	NM_004805		Approved	RBP4	uc002tpj.3	O15514	OTTHUMG00000131531	ENST00000272645.4:c.*104G>C	2.37:g.128605577C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	Q52LT4	RNA	SNP	-	NULL	ENST00000272645.4	37	NULL	CCDS2151.1	2																																																																																			POLR2D	-	-	ENSG00000144231		0.507	POLR2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2D	HGNC	protein_coding	OTTHUMT00000254388.3	41	0.00	0	C	NM_004805		128605577	128605577	-1	no_errors	ENST00000487079	ensembl	human	known	69_37n	rna	47	20.34	12	SNP	0.001	G
POLR3F	10621	genome.wustl.edu	37	20	18448047	18448047	+	5'UTR	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:18448047C>T	ENST00000377603.4	+	0	277				DZANK1_ENST00000262547.5_5'Flank|DZANK1_ENST00000358866.6_5'Flank|POLR3F_ENST00000462997.1_3'UTR|DZANK1_ENST00000329494.5_5'Flank|DZANK1_ENST00000357236.4_5'Flank	NM_006466.2	NP_006457.2	Q9H1D9	RPC6_HUMAN	polymerase (RNA) III (DNA directed) polypeptide F, 39 kDa						defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of innate immune response (GO:0045089)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of type I interferon production (GO:0032481)|regulation of transcription from RNA polymerase III promoter (GO:0006359)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)			breast(2)	2						GAAGGCCCCTCGGCCTCAGCA	0.682																																					GBM(69;898 1468 19907 52011)	dbGAP											0																																										-	-	-	SO:0001623	5_prime_UTR_variant	0			U93869	CCDS13135.1	20p11.23	2013-01-21	2002-08-29		ENSG00000132664	ENSG00000132664		"""RNA polymerase subunits"""	15763	protein-coding gene	gene with protein product	"""RNA polymerase III C39 subunit"""		"""polymerase (RNA) III (DNA directed) polypeptide F (39 kDa)"""			9171375	Standard	NM_006466		Approved	RPC39, RPC6	uc002wqv.3	Q9H1D9	OTTHUMG00000031971	ENST00000377603.4:c.-104C>T	20.37:g.18448047C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K4C7|O15319	RNA	SNP	-	NULL	ENST00000377603.4	37	NULL	CCDS13135.1	20																																																																																			POLR3F	-	-	ENSG00000132664		0.682	POLR3F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3F	HGNC	protein_coding	OTTHUMT00000078170.2	52	0.00	0	C	NM_006466		18448047	18448047	+1	no_errors	ENST00000462997	ensembl	human	known	69_37n	rna	70	17.65	15	SNP	0.000	T
POM121	9883	genome.wustl.edu	37	7	72400518	72400518	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:72400518G>A	ENST00000434423.2	+	5	1144	c.1144G>A	c.(1144-1146)Gat>Aat	p.D382N	POM121_ENST00000446813.1_Missense_Mutation_p.D117N|POM121_ENST00000257622.4_Missense_Mutation_p.D117N|POM121_ENST00000358357.3_Missense_Mutation_p.D117N|POM121_ENST00000395270.1_Missense_Mutation_p.D117N			Q96HA1	P121A_HUMAN	POM121 transmembrane nucleoporin	382	Pore side. {ECO:0000255}.|Ser-rich.				carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|nuclear envelope (GO:0005635)|nuclear pore (GO:0005643)				NS(1)|breast(1)|endometrium(9)|kidney(4)|large_intestine(6)|lung(12)|prostate(3)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	41		Lung NSC(55;0.163)				TCAGAGCTCAGATGACCACTT	0.463																																						dbGAP											0													58.0	65.0	63.0					7																	72400518		2201	4297	6498	-	-	-	SO:0001583	missense	0			AB014518	CCDS5542.1, CCDS59059.1	7q11.23	2013-01-08	2012-03-13		ENSG00000196313	ENSG00000196313		"""-"""	19702	protein-coding gene	gene with protein product		615753	"""POM121 membrane glycoprotein (rat)"", ""POM121 membrane glycoprotein"""			8335683, 9734811, 17900573	Standard	NM_172020		Approved	KIAA0618, DKFZP586G1822, DKFZP586P2220, POM121A	uc003twk.2	Q96HA1	OTTHUMG00000023527	ENST00000434423.2:c.1144G>A	7.37:g.72400518G>A	ENSP00000405562:p.Asp382Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NFS9|A8CDT4|A8K933|A8MXF9|O75115|Q96DI0|Q9H9X1|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.D382N	ENST00000434423.2	37	c.1144		7	.	.	.	.	.	.	.	.	.	.	G	21.7	4.194938	0.78902	.	.	ENSG00000196313	ENST00000446813;ENST00000257622;ENST00000395270;ENST00000358357;ENST00000434423	T;T;T;T;T	0.14766	2.48;2.48;2.48;2.48;2.48	4.1	4.1	0.47936	.	0.516547	0.16129	N	0.228283	T	0.30039	0.0752	M	0.67953	2.075	0.35981	D	0.836034	P;P	0.50272	0.925;0.933	P;P	0.56127	0.691;0.792	T	0.37686	-0.9695	10	0.87932	D	0	.	13.6851	0.62511	0.0:0.0:1.0:0.0	.	117;382	A8MXF9;Q96HA1	.;P121A_HUMAN	N	117;117;117;117;382	ENSP00000393020:D117N;ENSP00000257622:D117N;ENSP00000378687:D117N;ENSP00000351124:D117N;ENSP00000405562:D382N	ENSP00000257622:D117N	D	+	1	0	POM121	72038454	1.000000	0.71417	1.000000	0.80357	0.640000	0.38277	7.103000	0.77014	2.110000	0.64415	0.461000	0.40582	GAT	POM121	-	NULL	ENSG00000196313		0.463	POM121-001	KNOWN	basic|appris_candidate_longest	protein_coding	POM121	HGNC	protein_coding	OTTHUMT00000347344.1	34	0.00	0	G			72400518	72400518	+1	no_errors	ENST00000434423	ensembl	human	known	69_37n	missense	33	28.26	13	SNP	0.992	A
POPDC3	64208	genome.wustl.edu	37	6	105609709	105609709	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:105609709C>T	ENST00000254765.3	-	2	354	c.76G>A	c.(76-78)Gaa>Aaa	p.E26K	BVES-AS1_ENST00000580854.1_RNA|BVES-AS1_ENST00000369122.3_RNA|BVES-AS1_ENST00000580511.1_RNA|POPDC3_ENST00000474760.1_5'UTR|BVES-AS1_ENST00000369120.2_RNA	NM_022361.4	NP_071756.2	Q9HBV1	POPD3_HUMAN	popeye domain containing 3	26					regulation of membrane potential (GO:0042391)	integral component of membrane (GO:0016021)		p.E26K(1)		NS(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(5)|lung(10)|ovary(2)|skin(3)|urinary_tract(1)	26		all_cancers(87;4.87e-05)|Acute lymphoblastic leukemia(125;1.9e-08)|all_hematologic(75;9.25e-07)|all_epithelial(87;0.0157)|Colorectal(196;0.202)|Lung NSC(302;0.238)				ATGGCTCCTTCGGCCTCTTGC	0.438																																						dbGAP											1	Substitution - Missense(1)	NS(1)											86.0	90.0	89.0					6																	105609709		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC022323	CCDS5052.1	6q21	2003-06-12			ENSG00000132429	ENSG00000132429			17649	protein-coding gene	gene with protein product		605824				10882522	Standard	NM_022361		Approved	POP3, MGC22671, bA355M14.1	uc003prb.3	Q9HBV1	OTTHUMG00000015293	ENST00000254765.3:c.76G>A	6.37:g.105609709C>T	ENSP00000254765:p.Glu26Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RA98|Q5T3Y8|Q8TBW6	Missense_Mutation	SNP	pfam_Popeye_prot,superfamily_cNMP-bd-like	p.E26K	ENST00000254765.3	37	c.76	CCDS5052.1	6	.	.	.	.	.	.	.	.	.	.	C	29.5	5.013678	0.93404	.	.	ENSG00000132429	ENST00000254765	T	0.45668	0.89	5.93	5.93	0.95920	.	0.046631	0.85682	D	0.000000	T	0.48132	0.1483	M	0.78049	2.395	0.58432	D	0.999999	D	0.67145	0.996	P	0.47786	0.557	T	0.55679	-0.8103	10	0.66056	D	0.02	-19.7045	20.3261	0.98701	0.0:1.0:0.0:0.0	.	26	Q9HBV1	POPD3_HUMAN	K	26	ENSP00000254765:E26K	ENSP00000254765:E26K	E	-	1	0	POPDC3	105716402	1.000000	0.71417	0.962000	0.40283	0.979000	0.70002	6.040000	0.70980	2.814000	0.96858	0.655000	0.94253	GAA	POPDC3	-	NULL	ENSG00000132429		0.438	POPDC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POPDC3	HGNC	protein_coding	OTTHUMT00000041651.1	39	0.00	0	C	NM_022361		105609709	105609709	-1	no_errors	ENST00000254765	ensembl	human	known	69_37n	missense	16	20.00	4	SNP	1.000	T
POSTN	10631	genome.wustl.edu	37	13	38145546	38145546	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:38145546C>T	ENST00000379747.4	-	18	2256	c.2139G>A	c.(2137-2139)ctG>ctA	p.L713L	POSTN_ENST00000379742.4_Intron|POSTN_ENST00000379743.4_Silent_p.L686L|POSTN_ENST00000497145.1_5'UTR|POSTN_ENST00000541179.1_Silent_p.L686L|POSTN_ENST00000541481.1_Intron|POSTN_ENST00000379749.4_Silent_p.L713L	NM_006475.2	NP_006466.2	Q15063	POSTN_HUMAN	periostin, osteoblast specific factor	713					cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|regulation of Notch signaling pathway (GO:0008593)|skeletal system development (GO:0001501)|tissue development (GO:0009888)	proteinaceous extracellular matrix (GO:0005578)|trans-Golgi network (GO:0005802)	heparin binding (GO:0008201)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(16)|lung(22)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	59		Lung NSC(96;2.09e-05)|Prostate(109;0.0513)|Breast(139;0.0538)|Lung SC(185;0.0743)		all cancers(112;2.48e-08)|Epithelial(112;2.78e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000853)|BRCA - Breast invasive adenocarcinoma(63;0.013)|GBM - Glioblastoma multiforme(144;0.0154)		CTTCTTTAATCAGTCTGAATT	0.378																																						dbGAP											0													222.0	190.0	201.0					13																	38145546		2203	4299	6502	-	-	-	SO:0001819	synonymous_variant	0			D13665	CCDS9364.1, CCDS45034.1, CCDS53864.1, CCDS66530.1, CCDS66531.1	13q13.3	2008-02-05			ENSG00000133110	ENSG00000133110			16953	protein-coding gene	gene with protein product		608777				8363580, 12235007	Standard	NM_006475		Approved	OSF-2, PN, periostin	uc001uwo.4	Q15063	OTTHUMG00000016751	ENST00000379747.4:c.2139G>A	13.37:g.38145546C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALD8|C0IMJ1|C0IMJ2|C0IMJ4|D2KRH7|F5H628|Q15064|Q29XZ0|Q3KPJ5|Q5VSY5|Q8IZF9	Silent	SNP	pfam_FAS1_domain,superfamily_FAS1_domain,smart_FAS1_domain,pirsf_TGFb-ind_bIGH3/osteoblast_fac2,pfscan_EMI_domain,pfscan_FAS1_domain	p.L713	ENST00000379747.4	37	c.2139	CCDS9364.1	13																																																																																			POSTN	-	pirsf_TGFb-ind_bIGH3/osteoblast_fac2	ENSG00000133110		0.378	POSTN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	POSTN	HGNC	protein_coding	OTTHUMT00000044566.2	90	0.00	0	C	NM_006475		38145546	38145546	-1	no_errors	ENST00000379747	ensembl	human	known	69_37n	silent	78	15.22	14	SNP	0.494	T
PPARG	5468	genome.wustl.edu	37	3	12434121	12434121	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:12434121C>G	ENST00000287820.6	+	4	610	c.489C>G	c.(487-489)ttC>ttG	p.F163L	PPARG_ENST00000397010.2_Missense_Mutation_p.F135L|PPARG_ENST00000397000.1_Missense_Mutation_p.F135L|PPARG_ENST00000397026.2_Missense_Mutation_p.F141L|PPARG_ENST00000397015.2_Missense_Mutation_p.F135L|PPARG_ENST00000539812.1_Missense_Mutation_p.F133L|PPARG_ENST00000309576.6_Missense_Mutation_p.F135L|PPARG_ENST00000397012.2_Missense_Mutation_p.F135L	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	163					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	AGGGTTTCTTCCGGAGAACAA	0.393			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																															dbGAP		Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	0													78.0	79.0	79.0					3																	12434121		2203	4300	6503	-	-	-	SO:0001583	missense	0			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.489C>G	3.37:g.12434121C>G	ENSP00000287820:p.Phe163Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_PPARgamma_N,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt,prints_1Cnucl_rcpt_G,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.F163L	ENST00000287820.6	37	c.489	CCDS2609.1	3	.	.	.	.	.	.	.	.	.	.	C	23.5	4.423561	0.83559	.	.	ENSG00000132170	ENST00000397010;ENST00000309576;ENST00000397015;ENST00000397012;ENST00000397026;ENST00000397000;ENST00000539812;ENST00000287820	D;D;D;D;D;D;D;D	0.98937	-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25;-5.25	5.57	5.57	0.84162	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (5);	0.000000	0.85682	D	0.000000	D	0.99471	0.9812	H	0.98542	4.26	0.80722	D	1	D;D;P	0.89917	0.971;1.0;0.921	P;D;P	0.87578	0.742;0.998;0.512	D	0.98256	1.0496	10	0.87932	D	0	.	12.4258	0.55546	0.0:0.8799:0.0:0.1201	.	163;149;135	P37231;Q4W4C7;E9PFX5	PPARG_HUMAN;.;.	L	135;135;135;135;141;135;133;163	ENSP00000380205:F135L;ENSP00000312472:F135L;ENSP00000380210:F135L;ENSP00000380207:F135L;ENSP00000380221:F141L;ENSP00000380196:F135L;ENSP00000438940:F133L;ENSP00000287820:F163L	ENSP00000287820:F163L	F	+	3	2	PPARG	12409121	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.103000	0.50298	2.606000	0.88127	0.491000	0.48974	TTC	PPARG	-	pfam_Znf_hrmn_rcpt,smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt	ENSG00000132170		0.393	PPARG-002	KNOWN	basic|CCDS	protein_coding	PPARG	HGNC	protein_coding	OTTHUMT00000251979.2	68	0.00	0	C	NM_005037		12434121	12434121	+1	no_errors	ENST00000287820	ensembl	human	known	69_37n	missense	68	15.00	12	SNP	1.000	G
PPID	5481	genome.wustl.edu	37	4	159636499	159636499	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr4:159636499G>A	ENST00000307720.3	-	6	809	c.702C>T	c.(700-702)ttC>ttT	p.F234F		NM_005038.2	NP_005029.1	Q08752	PPID_HUMAN	peptidylprolyl isomerase D	234	Interaction with HSP90AB1. {ECO:0000250}.				apoptotic process (GO:0006915)|cellular response to UV-A (GO:0071492)|chaperone-mediated protein folding (GO:0061077)|lipid particle organization (GO:0034389)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein secretion (GO:0050714)|positive regulation of viral genome replication (GO:0045070)|protein complex assembly (GO:0006461)|protein folding (GO:0006457)|protein transport (GO:0015031)|viral release from host cell (GO:0019076)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|estrogen receptor binding (GO:0030331)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|transcription factor binding (GO:0008134)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(2)|skin(1)	8	all_hematologic(180;0.24)			COAD - Colon adenocarcinoma(41;0.0159)		TCTGGGATTTGAAAAAAGTAT	0.209																																						dbGAP											0													8.0	8.0	8.0					4																	159636499		1945	4003	5948	-	-	-	SO:0001819	synonymous_variant	0				CCDS3801.1	4q31.3	2013-01-10	2008-10-24		ENSG00000171497	ENSG00000171497		"""Tetratricopeptide (TTC) repeat domain containing"""	9257	protein-coding gene	gene with protein product	"""cyclophilin 40"""	601753	"""peptidylprolyl isomerase D (cyclophilin D)"""			8509368	Standard	NM_005038		Approved	CYP-40	uc003iqc.3	Q08752	OTTHUMG00000161927	ENST00000307720.3:c.702C>T	4.37:g.159636499G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R9V2	Silent	SNP	pfam_Cyclophilin-like_PPIase_dom,pfam_TPR-1,superfamily_Cyclophilin-like_PPIase_dom,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Cyclophilin-like_PPIase_dom,prints_Cyclophilin-like_PPIase_dom	p.F234	ENST00000307720.3	37	c.702	CCDS3801.1	4																																																																																			PPID	-	smart_TPR_repeat	ENSG00000171497		0.209	PPID-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPID	HGNC	protein_coding	OTTHUMT00000366436.1	33	0.00	0	G	NM_005038		159636499	159636499	-1	no_errors	ENST00000307720	ensembl	human	known	69_37n	silent	35	18.60	8	SNP	1.000	A
PPP1R9A	55607	genome.wustl.edu	37	7	94879487	94879487	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:94879487C>G	ENST00000433881.1	+	9	2782	c.2250C>G	c.(2248-2250)ctC>ctG	p.L750L	PPP1R9A_ENST00000424654.1_Silent_p.L750L|PPP1R9A_ENST00000433360.1_Silent_p.L772L|PPP1R9A_ENST00000289495.5_Silent_p.L750L|PPP1R9A_ENST00000456331.2_Silent_p.L750L|PPP1R9A_ENST00000340694.4_Silent_p.L750L			Q9ULJ8	NEB1_HUMAN	protein phosphatase 1, regulatory subunit 9A	750	Interacts with TGN38. {ECO:0000250}.				actin filament organization (GO:0007015)|calcium-mediated signaling (GO:0019722)|neuron projection development (GO:0031175)	cell junction (GO:0030054)|cortical actin cytoskeleton (GO:0030864)|dendritic spine (GO:0043197)|filopodium (GO:0030175)|growth cone (GO:0030426)|synapse (GO:0045202)				breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(11)|liver(2)|lung(22)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(8)|urinary_tract(5)	71	all_cancers(62;9.12e-11)|all_epithelial(64;4.34e-09)		STAD - Stomach adenocarcinoma(171;0.0031)			ATGAGCATCTCAAAGAGACTC	0.383										HNSCC(28;0.073)																												dbGAP											0													80.0	74.0	76.0					7																	94879487		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB033048	CCDS34683.1, CCDS55127.1, CCDS55128.1	7q21.3	2013-01-10	2011-10-04		ENSG00000158528	ENSG00000158528		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Sterile alpha motif (SAM) domain containing"""	14946	protein-coding gene	gene with protein product		602468	"""protein phosphatase 1, regulatory (inhibitor) subunit 9A"""			10574462	Standard	NM_001166160		Approved	Neurabin-I, KIAA1222, FLJ20068	uc010lfj.3	Q9ULJ8	OTTHUMG00000155566	ENST00000433881.1:c.2250C>G	7.37:g.94879487C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A1L494|B2RWQ1|E9PCA0|E9PCK6|E9PDX1|F8W7J9|O76059|Q9NXT2	Silent	SNP	pfam_SAM_2,pfam_SAM_type1,pfam_PDZ,superfamily_PDZ,superfamily_SAM/pointed,superfamily_Smac_DIABLO-like,smart_PDZ,smart_SAM,pfscan_PDZ,pfscan_SAM	p.L750	ENST00000433881.1	37	c.2250	CCDS34683.1	7																																																																																			PPP1R9A	-	superfamily_Smac_DIABLO-like	ENSG00000158528		0.383	PPP1R9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R9A	HGNC	protein_coding	OTTHUMT00000340662.1	44	0.00	0	C	NM_001166160		94879487	94879487	+1	no_errors	ENST00000289495	ensembl	human	known	69_37n	silent	36	12.20	5	SNP	0.997	G
PPP2CA	5515	genome.wustl.edu	37	5	133541618	133541618	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:133541618G>A	ENST00000481195.1	-	2	587	c.307C>T	c.(307-309)Ctt>Ttt	p.L103F	PPP2CA_ENST00000231504.5_5'UTR|CTD-2410N18.4_ENST00000518409.1_RNA|CDKL3_ENST00000609654.1_Missense_Mutation_p.L453F|CTD-2410N18.5_ENST00000519718.1_Intron	NM_002715.2	NP_002706.1	P67775	PP2AA_HUMAN	protein phosphatase 2, catalytic subunit, alpha isozyme	103					apoptotic process (GO:0006915)|ceramide metabolic process (GO:0006672)|fibroblast growth factor receptor signaling pathway (GO:0008543)|gene expression (GO:0010467)|inactivation of MAPK activity (GO:0000188)|meiotic nuclear division (GO:0007126)|mesoderm development (GO:0007498)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope reassembly (GO:0007084)|mRNA metabolic process (GO:0016071)|negative regulation of cell growth (GO:0030308)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|protein dephosphorylation (GO:0006470)|protein heterotrimerization (GO:0070208)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of DNA replication (GO:0006275)|regulation of growth (GO:0040008)|regulation of protein autophosphorylation (GO:0031952)|regulation of protein catabolic process (GO:0042176)|regulation of receptor activity (GO:0010469)|regulation of transcription, DNA-templated (GO:0006355)|regulation of Wnt signaling pathway (GO:0030111)|response to organic substance (GO:0010033)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)|second-messenger-mediated signaling (GO:0019932)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein phosphatase type 2A complex (GO:0000159)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)			endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(2)|skin(1)	12			KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)		Vitamin E(DB00163)	ATTACCTTAAGAGCTACAAGC	0.343																																						dbGAP											0													76.0	75.0	75.0					5																	133541618		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS4173.1	5q31.1	2013-01-24	2010-03-05		ENSG00000113575	ENSG00000113575	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"""	9299	protein-coding gene	gene with protein product	"""protein phosphatase 2A catalytic subunit, alpha isoform"""	176915	"""protein phosphatase 2 (formerly 2A), catalytic subunit, alpha isoform"""			8383590	Standard	NM_002715		Approved	PP2Calpha		P67775	OTTHUMG00000129119	ENST00000481195.1:c.307C>T	5.37:g.133541618G>A	ENSP00000418447:p.Leu103Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	P05323|P13197	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	p.L103F	ENST00000481195.1	37	c.307	CCDS4173.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.241792	0.95272	.	.	ENSG00000113575	ENST00000481195;ENST00000522385;ENST00000523082	T;T;T	0.42513	0.97;0.97;0.97	5.34	5.34	0.76211	Serine/threonine-specific protein phosphatase/bis(5-nucleosyl)-tetraphosphatase (2);Metallophosphoesterase domain (1);	0.000000	0.85682	D	0.000000	T	0.66674	0.2813	M	0.76574	2.34	0.80722	D	1	P;P	0.50272	0.933;0.666	D;P	0.69307	0.963;0.477	T	0.68258	-0.5456	10	0.66056	D	0.02	-13.0176	19.3944	0.94601	0.0:0.0:1.0:0.0	.	453;103	B7Z2C5;P67775	.;PP2AA_HUMAN	F	103;38;90	ENSP00000418447:L103F;ENSP00000430869:L38F;ENSP00000428816:L90F	ENSP00000418447:L103F	L	-	1	0	PPP2CA	133569517	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.919000	0.87513	2.665000	0.90641	0.591000	0.81541	CTT	PPP2CA	-	pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase,prints_Ser/Thr-sp_prot-phosphatase	ENSG00000113575		0.343	PPP2CA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2CA	HGNC	protein_coding	OTTHUMT00000251165.1	32	0.00	0	G	NM_002715		133541618	133541618	-1	no_errors	ENST00000481195	ensembl	human	known	69_37n	missense	41	10.87	5	SNP	1.000	A
PRCC	5546	genome.wustl.edu	37	1	156737729	156737729	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:156737729C>G	ENST00000271526.4	+	1	438	c.166C>G	c.(166-168)Cag>Gag	p.Q56E	PRCC_ENST00000353233.3_Missense_Mutation_p.Q56E|PRCC_ENST00000491853.1_Intron|HDGF_ENST00000465180.1_5'Flank	NM_005973.4	NP_005964.3	Q92733	PRCC_HUMAN	papillary renal cell carcinoma (translocation-associated)	56	Mediates interaction with MAD2L2.				mitotic cell cycle checkpoint (GO:0007093)	intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)			PRCC/TFE3(25)	breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(1)|liver(1)|lung(5)|upper_aerodigestive_tract(1)	15	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					TCCGCCCCCTCAGATGCTGGC	0.697			T	TFE3	papillary renal																																	dbGAP		Dom	yes		1	1q21.1	5546	papillary renal cell carcinoma (translocation-associated)		E	0													9.0	9.0	9.0					1																	156737729		2190	4278	6468	-	-	-	SO:0001583	missense	0			X99720	CCDS1157.1	1q21.1	2008-02-05			ENSG00000143294	ENSG00000143294			9343	protein-coding gene	gene with protein product		179755				8872474	Standard	NM_005973		Approved	RCCP1	uc001fqa.3	Q92733	OTTHUMG00000041294	ENST00000271526.4:c.166C>G	1.37:g.156737729C>G	ENSP00000271526:p.Gln56Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K1F7|O00665|O00724|Q5SZ06	Missense_Mutation	SNP	pfam_PRCC_C	p.Q56E	ENST00000271526.4	37	c.166	CCDS1157.1	1	.	.	.	.	.	.	.	.	.	.	C	14.10	2.434229	0.43224	.	.	ENSG00000143294	ENST00000271526;ENST00000353233	T;T	0.36157	1.27;1.27	5.55	4.64	0.57946	.	0.201259	0.35067	N	0.003469	T	0.18341	0.0440	L	0.36672	1.1	0.34961	D	0.752212	P;P	0.40332	0.713;0.713	P;P	0.48654	0.585;0.585	T	0.03761	-1.1006	10	0.07813	T	0.8	-5.3506	11.2803	0.49190	0.0:0.9165:0.0:0.0835	.	56;56	A6NG79;Q92733	.;PRCC_HUMAN	E	56	ENSP00000271526:Q56E;ENSP00000339300:Q56E	ENSP00000271526:Q56E	Q	+	1	0	PRCC	155004353	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	3.501000	0.53325	1.582000	0.49881	0.655000	0.94253	CAG	PRCC	-	NULL	ENSG00000143294		0.697	PRCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRCC	HGNC	protein_coding	OTTHUMT00000098941.2	30	0.00	0	C	NM_005973		156737729	156737729	+1	no_errors	ENST00000271526	ensembl	human	known	69_37n	missense	47	14.55	8	SNP	1.000	G
PREX2	80243	genome.wustl.edu	37	8	68982077	68982077	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:68982077G>A	ENST00000288368.4	+	13	1728	c.1451G>A	c.(1450-1452)aGa>aAa	p.R484K	PREX2_ENST00000529398.1_3'UTR	NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	484					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TAGGGTGTAAGATTATATTGT	0.303																																						dbGAP											0													195.0	199.0	198.0					8																	68982077		2203	4296	6499	-	-	-	SO:0001583	missense	0			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.1451G>A	8.37:g.68982077G>A	ENSP00000288368:p.Arg484Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.R484K	ENST00000288368.4	37	c.1451	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	28.8	4.955670	0.92726	.	.	ENSG00000046889	ENST00000288368;ENST00000396539;ENST00000354677	T	0.13657	2.57	5.66	5.66	0.87406	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.059215	0.64402	D	0.000002	T	0.26702	0.0653	L	0.27053	0.805	0.49299	D	0.999775	D;D;D	0.76494	0.999;0.998;0.999	D;D;D	0.85130	0.997;0.97;0.98	T	0.01118	-1.1446	10	0.59425	D	0.04	.	16.7992	0.85609	0.0:0.1284:0.8716:0.0	.	484;484;484	Q70Z35-2;Q70Z35;Q70Z35-3	.;PREX2_HUMAN;.	K	484	ENSP00000288368:R484K	ENSP00000288368:R484K	R	+	2	0	PREX2	69144631	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	5.015000	0.64035	2.692000	0.91855	0.644000	0.83932	AGA	PREX2	-	NULL	ENSG00000046889		0.303	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	84	0.00	0	G	NM_025170		68982077	68982077	+1	no_errors	ENST00000288368	ensembl	human	known	69_37n	missense	55	19.12	13	SNP	1.000	A
PRPF39	55015	genome.wustl.edu	37	14	45564611	45564611	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:45564611G>C	ENST00000355765.6	+	2	339	c.169G>C	c.(169-171)Gaa>Caa	p.E57Q		NM_017922.3	NP_060392.3	Q86UA1	PRP39_HUMAN	pre-mRNA processing factor 39	57					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)				breast(2)|endometrium(2)|kidney(4)|lung(3)|ovary(1)	12						ATCTACAGAAGAAACTGAAAT	0.398																																						dbGAP											0													78.0	78.0	78.0					14																	45564611		2071	4231	6302	-	-	-	SO:0001583	missense	0			AK000673	CCDS9682.2	14q21.1	2013-10-03	2013-10-03		ENSG00000185246	ENSG00000185246			20314	protein-coding gene	gene with protein product		614907	"""PRP39 pre-mRNA processing factor 39 homolog (yeast)"", ""PRP39 pre-mRNA processing factor 39 homolog (S. cerevisiae)"""				Standard	NM_017922		Approved	FLJ20666, FLJ11128	uc001wvz.4	Q86UA1	OTTHUMG00000140265	ENST00000355765.6:c.169G>C	14.37:g.45564611G>C	ENSP00000348010:p.Glu57Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AL1|Q08AL2|Q9NUU5	Missense_Mutation	SNP	smart_HAT	p.E57Q	ENST00000355765.6	37	c.169	CCDS9682.2	14	.	.	.	.	.	.	.	.	.	.	G	14.33	2.502263	0.44455	.	.	ENSG00000185246	ENST00000355765;ENST00000553605	T	0.46063	0.88	5.81	5.81	0.92471	.	.	.	.	.	T	0.32852	0.0843	L	0.42245	1.32	0.37279	D	0.907731	B	0.33238	0.403	B	0.30782	0.12	T	0.20075	-1.0286	9	0.13470	T	0.59	-4.9645	12.9619	0.58464	0.0746:0.0:0.9254:0.0	.	57	Q86UA1	PRP39_HUMAN	Q	57	ENSP00000348010:E57Q	ENSP00000348010:E57Q	E	+	1	0	PRPF39	44634361	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.507000	0.60434	2.759000	0.94783	0.591000	0.81541	GAA	PRPF39	-	NULL	ENSG00000185246		0.398	PRPF39-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF39	HGNC	protein_coding	OTTHUMT00000319683.2	28	0.00	0	G			45564611	45564611	+1	no_errors	ENST00000355765	ensembl	human	known	69_37n	missense	25	19.35	6	SNP	1.000	C
PRUNE2	158471	genome.wustl.edu	37	9	79438433	79438433	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:79438433C>G	ENST00000376718.3	-	6	880				PRUNE2_ENST00000376713.3_Intron|PRUNE2_ENST00000428286.1_Intron	NM_015225.2	NP_056040.2	Q8WUY3	PRUN2_HUMAN	prune homolog 2 (Drosophila)						apoptotic process (GO:0006915)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|pyrophosphatase activity (GO:0016462)			endometrium(1)|kidney(4)|large_intestine(3)|lung(7)|prostate(1)	16						TCAAATGTATCACAAAGAAGC	0.373																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			BC019095	CCDS47982.1	9q21.32	2013-04-29	2006-11-24	2006-11-24	ENSG00000106772	ENSG00000106772			25209	protein-coding gene	gene with protein product	"""olfaxin"""	610691	"""chromosome 9 open reading frame 65"", ""KIAA0367"""	C9orf65, KIAA0367		16288218	Standard	NM_015225		Approved	BMCC1, BNIPXL, A214N16.3, bA214N16.3	uc010mpk.3	Q8WUY3	OTTHUMG00000020047	ENST00000376718.3:c.756+114G>C	9.37:g.79438433C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KYC4|B4DQH8|O15073|Q58A63|Q5JUB6|Q5T304|Q5T476|Q6T2V6|Q6T2V7|Q8N665	RNA	SNP	-	NULL	ENST00000376718.3	37	NULL	CCDS47982.1	9																																																																																			PRUNE2	-	-	ENSG00000106772		0.373	PRUNE2-003	NOVEL	basic|appris_principal|CCDS	protein_coding	PRUNE2	HGNC	protein_coding	OTTHUMT00000052730.2	37	0.00	0	C	NM_138818		79438433	79438433	-1	no_errors	ENST00000492157	ensembl	human	known	69_37n	rna	25	26.47	9	SNP	0.000	G
PSMD3	5709	genome.wustl.edu	37	17	38146170	38146170	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:38146170C>T	ENST00000264639.4	+	5	1039	c.865C>T	c.(865-867)Ctc>Ttc	p.L289F	PSMD3_ENST00000541736.1_Missense_Mutation_p.L151F	NM_002809.3	NP_002800.2	O43242	PSMD3_HUMAN	proteasome (prosome, macropain) 26S subunit, non-ATPase, 3	289					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of protein catabolic process (GO:0042176)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome accessory complex (GO:0022624)|proteasome complex (GO:0000502)|proteasome regulatory particle (GO:0005838)	enzyme regulator activity (GO:0030234)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	26	Colorectal(19;0.000442)					GGCCAGGTACCTCTACTACAC	0.542																																					Ovarian(186;531 2051 6385 19668 48409)	dbGAP											0													58.0	49.0	52.0					17																	38146170		2203	4300	6503	-	-	-	SO:0001583	missense	0			D67025	CCDS11356.1	17q21.2	2010-07-23			ENSG00000108344	ENSG00000108344		"""Proteasome (prosome, macropain) subunits"""	9560	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 2"""	TSTA2		9017604	Standard	NM_002809		Approved	S3, P58, Rpn3	uc002htn.2	O43242	OTTHUMG00000133251	ENST00000264639.4:c.865C>T	17.37:g.38146170C>T	ENSP00000264639:p.Leu289Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KMW9|B4DT72|Q96EI2|Q9BQA4	Missense_Mutation	SNP	pfam_26S_Psome_reg_C,pfam_PCI_dom,smart_PAM,smart_PCI_dom	p.L289F	ENST00000264639.4	37	c.865	CCDS11356.1	17	.	.	.	.	.	.	.	.	.	.	C	15.36	2.811966	0.50527	.	.	ENSG00000108344	ENST00000264639;ENST00000415039;ENST00000541736	T;T	0.78003	-1.14;-1.14	5.23	4.26	0.50523	Tetratricopeptide-like helical (1);PCI/PINT associated module (1);	0.061993	0.64402	N	0.000003	T	0.70753	0.3260	L	0.49126	1.545	0.80722	D	1	B	0.14805	0.011	B	0.15870	0.014	T	0.68550	-0.5379	10	0.54805	T	0.06	-22.568	9.9439	0.41598	0.0:0.8469:0.0:0.1531	.	289	O43242	PSMD3_HUMAN	F	289;276;151	ENSP00000264639:L289F;ENSP00000442508:L151F	ENSP00000264639:L289F	L	+	1	0	PSMD3	35399696	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	5.906000	0.69900	1.443000	0.47586	0.655000	0.94253	CTC	PSMD3	-	smart_PAM	ENSG00000108344		0.542	PSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMD3	HGNC	protein_coding	OTTHUMT00000257018.1	36	0.00	0	C	NM_002809		38146170	38146170	+1	no_errors	ENST00000264639	ensembl	human	known	69_37n	missense	34	19.05	8	SNP	1.000	T
PTAR1	375743	genome.wustl.edu	37	9	72333321	72333321	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:72333321C>T	ENST00000340434.4	-	8	1149	c.1146G>A	c.(1144-1146)cgG>cgA	p.R382R	PTAR1_ENST00000377200.5_Silent_p.R330R	NM_001099666.1	NP_001093136.1	Q7Z6K3	PTAR1_HUMAN	protein prenyltransferase alpha subunit repeat containing 1	382					protein prenylation (GO:0018342)		protein prenyltransferase activity (GO:0008318)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)	5						GCTCCACGTTCCGACAGGTGG	0.488																																						dbGAP											0													94.0	89.0	91.0					9																	72333321		1919	4147	6066	-	-	-	SO:0001819	synonymous_variant	0			BC053622	CCDS47978.1	9q21.13	2008-10-01			ENSG00000188647	ENSG00000188647		"""Prenyltransferase alpha subunit repeat containing"""	30449	protein-coding gene	gene with protein product						12477932	Standard	NM_001099666		Approved		uc004ahj.4	Q7Z6K3	OTTHUMG00000019982	ENST00000340434.4:c.1146G>A	9.37:g.72333321C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T7V5|Q5T7V6	Missense_Mutation	SNP	pfam_Prenyl_trans_a,pfscan_Prenyl_trans_a	p.E148K	ENST00000340434.4	37	c.442	CCDS47978.1	9	.	.	.	.	.	.	.	.	.	.	C	8.725	0.915380	0.17907	.	.	ENSG00000188647	ENST00000415701	.	.	.	6.02	3.95	0.45737	.	.	.	.	.	T	0.48447	0.1500	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.44651	-0.9314	4	.	.	.	.	4.4904	0.11810	0.1728:0.5667:0.0:0.2605	.	.	.	.	K	148	.	.	E	-	1	0	PTAR1	71523141	0.998000	0.40836	0.997000	0.53966	0.942000	0.58702	0.487000	0.22356	1.537000	0.49254	0.655000	0.94253	GAA	PTAR1	-	NULL	ENSG00000188647		0.488	PTAR1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PTAR1	HGNC	protein_coding	OTTHUMT00000052582.4	81	0.00	0	C	NM_001099666		72333321	72333321	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000415701	ensembl	human	novel	69_37n	missense	131	10.27	15	SNP	0.995	T
PTPRG	5793	genome.wustl.edu	37	3	62118323	62118323	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:62118323G>C	ENST00000474889.1	+	6	1040	c.663G>C	c.(661-663)ttG>ttC	p.L221F	PTPRG_ENST00000295874.10_Missense_Mutation_p.L221F	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	221	Alpha-carbonic anhydrase.				brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		TCCACGGGTTGAAGGGTGTCG	0.438																																						dbGAP											0													257.0	220.0	232.0					3																	62118323		2203	4300	6503	-	-	-	SO:0001583	missense	0			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.663G>C	3.37:g.62118323G>C	ENSP00000418112:p.Leu221Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.L221F	ENST00000474889.1	37	c.663	CCDS2895.1	3	.	.	.	.	.	.	.	.	.	.	G	18.45	3.625638	0.66901	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.80033	-1.33;-1.33	5.8	5.8	0.92144	Carbonic anhydrase, alpha-class, catalytic domain (4);	0.000000	0.64402	D	0.000001	D	0.88540	0.6464	M	0.67700	2.07	0.80722	D	1	D;D	0.63880	0.96;0.993	P;D	0.65874	0.711;0.939	D	0.88852	0.3320	10	0.72032	D	0.01	.	18.2499	0.89998	0.0:0.0:1.0:0.0	.	221;221	P23470-2;P23470	.;PTPRG_HUMAN	F	221	ENSP00000418112:L221F;ENSP00000295874:L221F	ENSP00000295874:L221F	L	+	3	2	PTPRG	62093363	1.000000	0.71417	1.000000	0.80357	0.946000	0.59487	6.780000	0.75063	2.758000	0.94735	0.563000	0.77884	TTG	PTPRG	-	pfam_Carbonic_anhydrase_a,superfamily_Carbonic_anhydrase_a,pfscan_Carbonic_anhydrase_a	ENSG00000144724		0.438	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRG	HGNC	protein_coding	OTTHUMT00000351674.1	103	0.00	0	G	NM_002841		62118323	62118323	+1	no_errors	ENST00000474889	ensembl	human	known	69_37n	missense	89	16.82	18	SNP	1.000	C
PTPRG	5793	genome.wustl.edu	37	3	62189284	62189284	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:62189284G>C	ENST00000474889.1	+	12	2192	c.1815G>C	c.(1813-1815)aaG>aaC	p.K605N	PTPRG_ENST00000295874.10_Missense_Mutation_p.K605N	NM_002841.3	NP_002832.3	P23470	PTPRG_HUMAN	protein tyrosine phosphatase, receptor type, G	605					brain development (GO:0007420)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of neuron projection development (GO:0010977)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	identical protein binding (GO:0042802)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|liver(2)|lung(15)|ovary(7)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	62				BRCA - Breast invasive adenocarcinoma(55;0.000376)|KIRC - Kidney renal clear cell carcinoma(10;0.0499)|Kidney(10;0.065)		actccgaaaagaaggagaagA	0.622																																						dbGAP											0													100.0	60.0	74.0					3																	62189284		2159	4236	6395	-	-	-	SO:0001583	missense	0			L09247	CCDS2895.1	3p21-p14	2013-02-11			ENSG00000144724	ENSG00000144724		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Fibronectin type III domain containing"""	9671	protein-coding gene	gene with protein product		176886		PTPG		1711217	Standard	NM_002841		Approved	RPTPG	uc003dlb.3	P23470	OTTHUMG00000158660	ENST00000474889.1:c.1815G>C	3.37:g.62189284G>C	ENSP00000418112:p.Lys605Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RU12|B7ZLX5|Q15623|Q59EE0|Q68DU5	Missense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Carbonic_anhydrase_a,pfam_Fibronectin_type3,superfamily_Carbonic_anhydrase_a,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Carbonic_anhydrase_a,prints_Tyr_Pase_rcpt/non-rcpt	p.K605N	ENST00000474889.1	37	c.1815	CCDS2895.1	3	.	.	.	.	.	.	.	.	.	.	G	18.10	3.548516	0.65311	.	.	ENSG00000144724	ENST00000474889;ENST00000295874	T;T	0.57595	0.39;0.43	4.39	3.52	0.40303	.	0.207941	0.41001	D	0.000977	T	0.54191	0.1843	L	0.56769	1.78	0.44852	D	0.997863	P;B	0.46142	0.873;0.006	P;B	0.47346	0.544;0.003	T	0.55036	-0.8203	10	0.45353	T	0.12	.	12.0462	0.53480	0.0859:0.0:0.9141:0.0	.	605;605	P23470-2;P23470	.;PTPRG_HUMAN	N	605	ENSP00000418112:K605N;ENSP00000295874:K605N	ENSP00000295874:K605N	K	+	3	2	PTPRG	62164324	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.228000	0.51270	0.973000	0.38340	0.591000	0.81541	AAG	PTPRG	-	NULL	ENSG00000144724		0.622	PTPRG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRG	HGNC	protein_coding	OTTHUMT00000351674.1	30	0.00	0	G	NM_002841		62189284	62189284	+1	no_errors	ENST00000474889	ensembl	human	known	69_37n	missense	25	13.79	4	SNP	1.000	C
PTPRR	5801	genome.wustl.edu	37	12	71054753	71054753	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:71054753G>A	ENST00000283228.2	-	12	2185	c.1733C>T	c.(1732-1734)tCc>tTc	p.S578F	PTPRR_ENST00000378778.1_Missense_Mutation_p.S372F|PTPRR_ENST00000440835.2_Missense_Mutation_p.S333F|PTPRR_ENST00000537619.2_5'UTR|PTPRR_ENST00000342084.4_Missense_Mutation_p.S466F|PTPRR_ENST00000549308.1_Missense_Mutation_p.S333F	NM_002849.3	NP_002840.2	Q15256	PTPRR_HUMAN	protein tyrosine phosphatase, receptor type, R	578	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				ERBB2 signaling pathway (GO:0038128)|in utero embryonic development (GO:0001701)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(22)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	41			GBM - Glioblastoma multiforme(2;5.67e-07)|Lung(24;0.00283)|OV - Ovarian serous cystadenocarcinoma(12;0.00578)|LUSC - Lung squamous cell carcinoma(43;0.132)	COAD - Colon adenocarcinoma(1;0.136)		TCGGCCCTGGGAAGCAAGTCT	0.527																																						dbGAP											0													123.0	102.0	109.0					12																	71054753		2203	4300	6503	-	-	-	SO:0001583	missense	0			D64053	CCDS8998.1, CCDS44945.1, CCDS55847.1, CCDS55848.1	12q15	2011-10-07			ENSG00000153233	ENSG00000153233		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"""	9680	protein-coding gene	gene with protein product		602853		PTPRQ		7557444, 10393441	Standard	NM_002849		Approved	PTPBR7, PTP-SL, EC-PTP, PCPTP1	uc001swi.2	Q15256	OTTHUMG00000169502	ENST00000283228.2:c.1733C>T	12.37:g.71054753G>A	ENSP00000283228:p.Ser578Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R5Z7|B7Z3J1|F5GXR7|O00342|Q92682|Q9UE65	Missense_Mutation	SNP	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_KIM-con,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S578F	ENST00000283228.2	37	c.1733	CCDS8998.1	12	.	.	.	.	.	.	.	.	.	.	G	15.60	2.881257	0.51801	.	.	ENSG00000153233	ENST00000440835;ENST00000283228;ENST00000378778;ENST00000342084;ENST00000549308	D;D;D;D;D	0.84146	-1.81;-1.81;-1.81;-1.81;-1.81	5.38	4.49	0.54785	Protein-tyrosine phosphatase, receptor/non-receptor type (3);Protein-tyrosine/Dual-specificity phosphatase (1);	0.127056	0.35970	N	0.002862	D	0.84871	0.5568	L	0.31752	0.955	0.30767	N	0.743402	B;B;D	0.65815	0.017;0.017;0.995	B;B;P	0.60173	0.008;0.008;0.87	D	0.83492	0.0070	10	0.51188	T	0.08	-5.2871	10.6711	0.45760	0.1473:0.0:0.8527:0.0	.	466;372;578	F5GXR7;Q15256-4;Q15256	.;.;PTPRR_HUMAN	F	333;578;372;466;333	ENSP00000391750:S333F;ENSP00000283228:S578F;ENSP00000368054:S372F;ENSP00000339605:S466F;ENSP00000446943:S333F	ENSP00000283228:S578F	S	-	2	0	PTPRR	69341020	1.000000	0.71417	0.637000	0.29366	0.992000	0.81027	6.288000	0.72679	1.410000	0.46936	0.650000	0.86243	TCC	PTPRR	-	pirsf_Tyr_Pase_rcpt_R/non-rcpt_5,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	ENSG00000153233		0.527	PTPRR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPRR	HGNC	protein_coding	OTTHUMT00000404485.1	67	0.00	0	G	NM_002849		71054753	71054753	-1	no_errors	ENST00000283228	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.718	A
RAD51	5888	genome.wustl.edu	37	15	41023451	41023451	+	3'UTR	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:41023451C>G	ENST00000267868.3	+	0	1363				RAD51_ENST00000557850.1_3'UTR|RAD51_ENST00000532743.1_3'UTR|RAD51_ENST00000382643.3_3'UTR|RAD51_ENST00000530766.1_3'UTR|RAD51_ENST00000423169.2_3'UTR	NM_002875.4	NP_002866.2	Q06609	RAD51_HUMAN	RAD51 recombinase						ATP catabolic process (GO:0006200)|cellular response to camptothecin (GO:0072757)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to ionizing radiation (GO:0071479)|DNA recombinase assembly (GO:0000730)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA unwinding involved in DNA replication (GO:0006268)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|meiotic nuclear division (GO:0007126)|mitotic recombination (GO:0006312)|positive regulation of DNA ligation (GO:0051106)|protein homooligomerization (GO:0051260)|reciprocal meiotic recombination (GO:0007131)|regulation of double-strand break repair via homologous recombination (GO:0010569)	condensed chromosome (GO:0000793)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|lateral element (GO:0000800)|mitochondrion (GO:0005739)|nuclear chromosome (GO:0000228)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|PML body (GO:0016605)	ATP binding (GO:0005524)|damaged DNA binding (GO:0003684)|DNA polymerase binding (GO:0070182)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)|single-stranded DNA binding (GO:0003697)|single-stranded DNA-dependent ATPase activity (GO:0043142)			breast(2)|endometrium(1)|kidney(3)|large_intestine(1)|lung(1)|ovary(1)	9		all_cancers(109;1.19e-18)|all_epithelial(112;2.33e-15)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.45e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000421)|COAD - Colon adenocarcinoma(120;0.163)		CTGGGGTTCTCTACAGGCCTC	0.458								Homologous recombination																														dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D13804	CCDS10062.1, CCDS53931.1, CCDS53932.1	15q15.1	2014-06-12	2013-07-02		ENSG00000051180	ENSG00000051180			9817	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 5"""	179617	"""RAD51 (S. cerevisiae) homolog (E coli RecA homolog)"", ""RAD51 homolog (RecA homolog, E. coli) (S. cerevisiae)"", ""RAD51 homolog (S. cerevisiae)"""	RAD51A, RECA		8358431, 8479919	Standard	NM_002875		Approved	HsRad51, HsT16930, BRCC5	uc010bbx.3	Q06609	OTTHUMG00000130067	ENST00000267868.3:c.*75C>G	15.37:g.41023451C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B0FXP0|B2R8T6|Q6FHX9|Q6ZNA8|Q9BV60	RNA	SNP	-	NULL	ENST00000267868.3	37	NULL	CCDS10062.1	15																																																																																			RAD51	-	-	ENSG00000051180		0.458	RAD51-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	RAD51	HGNC	protein_coding	OTTHUMT00000252358.1	20	0.00	0	C	NM_002875, NM_133487		41023451	41023451	+1	no_errors	ENST00000530766	ensembl	human	known	69_37n	rna	29	19.44	7	SNP	0.016	G
RAD54B	25788	genome.wustl.edu	37	8	95416366	95416366	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:95416366G>A	ENST00000336148.5	-	6	1007	c.883C>T	c.(883-885)Cat>Tat	p.H295Y		NM_012415.3	NP_036547.1	Q9Y620	RA54B_HUMAN	RAD54 homolog B (S. cerevisiae)	295					ATP catabolic process (GO:0006200)|DNA duplex unwinding (GO:0032508)|double-strand break repair via homologous recombination (GO:0000724)|mitotic recombination (GO:0006312)|reciprocal meiotic recombination (GO:0007131)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|RNA helicase activity (GO:0003724)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(10)|lung(15)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	39	Breast(36;4.5e-05)		BRCA - Breast invasive adenocarcinoma(8;0.00217)			GGTCGAAGATGATATACAAGG	0.358								Direct reversal of damage;Homologous recombination																														dbGAP											0													111.0	97.0	102.0					8																	95416366		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF112481	CCDS6262.1, CCDS56546.1, CCDS75768.1	8q22.1	2014-08-08			ENSG00000197275	ENSG00000197275			17228	protein-coding gene	gene with protein product		604289				10362364, 10851248	Standard	NM_012415		Approved	RDH54	uc003ygk.3	Q9Y620	OTTHUMG00000133658	ENST00000336148.5:c.883C>T	8.37:g.95416366G>A	ENSP00000336606:p.His295Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	F6WBS8	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_HDA_complex_subunit-2/3,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.H295Y	ENST00000336148.5	37	c.883	CCDS6262.1	8	.	.	.	.	.	.	.	.	.	.	G	13.90	2.375806	0.42105	.	.	ENSG00000197275	ENST00000336148	D	0.93247	-3.19	5.24	3.45	0.39498	DEAD-like helicase (1);	0.208150	0.49305	N	0.000141	D	0.89238	0.6658	M	0.69823	2.125	0.80722	D	1	B	0.12630	0.006	B	0.16722	0.016	T	0.77536	-0.2551	10	0.02654	T	1	-21.6487	7.5386	0.27725	0.148:0.0:0.7104:0.1417	.	295	Q9Y620	RA54B_HUMAN	Y	295	ENSP00000336606:H295Y	ENSP00000336606:H295Y	H	-	1	0	RAD54B	95485542	1.000000	0.71417	0.768000	0.31515	0.955000	0.61496	4.677000	0.61634	0.600000	0.29862	0.655000	0.94253	CAT	RAD54B	-	smart_Helicase_ATP-bd	ENSG00000197275		0.358	RAD54B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54B	HGNC	protein_coding	OTTHUMT00000257806.3	54	0.00	0	G	NM_012415		95416366	95416366	-1	no_errors	ENST00000336148	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	0.992	A
RALGPS1	9649	genome.wustl.edu	37	9	129796710	129796710	+	Splice_Site	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:129796710G>C	ENST00000259351.5	+	5	484	c.217G>C	c.(217-219)Gaa>Caa	p.E73Q	RALGPS1_ENST00000424082.2_Splice_Site_p.E73Q|RALGPS1_ENST00000373434.1_Splice_Site_p.E73Q|RALGPS1_ENST00000373436.1_Splice_Site_p.E73Q|RALGPS1_ENST00000394022.3_Splice_Site_p.E73Q	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	73	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)			kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						TGCTTCCTAGGAACTAGCCAG	0.473																																						dbGAP											0													181.0	130.0	147.0					9																	129796710		2203	4300	6503	-	-	-	SO:0001630	splice_region_variant	0			AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.217-1G>C	9.37:g.129796710G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.E73Q	ENST00000259351.5	37	c.217	CCDS35143.1	9	.	.	.	.	.	.	.	.	.	.	G	26.5	4.747195	0.89663	.	.	ENSG00000136828	ENST00000259351;ENST00000424082;ENST00000394022;ENST00000373439;ENST00000319107;ENST00000373436;ENST00000373434	T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51	4.71	4.71	0.59529	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.062539	0.64402	D	0.000007	T	0.73860	0.3641	M	0.81942	2.565	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;1.0	T	0.76903	-0.2787	9	.	.	.	.	16.8152	0.85732	0.0:0.0:1.0:0.0	.	73;73;73;73	E9PBQ5;Q5JS13-3;Q5JS13-2;Q5JS13	.;.;.;RGPS1_HUMAN	Q	73	ENSP00000259351:E73Q;ENSP00000415630:E73Q;ENSP00000377590:E73Q;ENSP00000317149:E73Q;ENSP00000362535:E73Q;ENSP00000362533:E73Q	.	E	+	1	0	RALGPS1	128836531	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.955000	0.93058	2.328000	0.79073	0.563000	0.77884	GAA	RALGPS1	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25	ENSG00000136828		0.473	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS1	HGNC	protein_coding	OTTHUMT00000054133.1	55	0.00	0	G	NM_014636	Missense_Mutation	129796710	129796710	+1	no_errors	ENST00000259351	ensembl	human	known	69_37n	missense	85	13.27	13	SNP	1.000	C
RANGRF	29098	genome.wustl.edu	37	17	8193159	8193159	+	Missense_Mutation	SNP	G	G	A	rs552055941	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:8193159G>A	ENST00000226105.6	+	5	758	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K	SLC25A35_ENST00000580340.1_Intron|SLC25A35_ENST00000380067.2_Intron|SLC25A35_ENST00000579192.1_Intron|RANGRF_ENST00000580434.1_3'UTR|RANGRF_ENST00000407006.4_3'UTR|SLC25A35_ENST00000581320.1_5'Flank|SLC25A35_ENST00000396278.1_Intron|RANGRF_ENST00000439238.3_3'UTR	NM_016492.4	NP_057576.2	Q9HD47	MOG1_HUMAN	RAN guanine nucleotide release factor	156					ER to Golgi vesicle-mediated transport (GO:0006888)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein localization to cell surface (GO:2000010)|protein exit from endoplasmic reticulum (GO:0032527)|regulation of heart rate (GO:0002027)|regulation of membrane depolarization (GO:0003254)|regulation of membrane depolarization during cardiac muscle cell action potential (GO:1900825)|regulation of membrane potential (GO:0042391)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of sodium ion transmembrane transporter activity (GO:2000649)	caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	guanyl-nucleotide exchange factor activity (GO:0005085)|ion channel binding (GO:0044325)|protein transporter activity (GO:0008565)|Ran GTPase binding (GO:0008536)|sodium channel regulator activity (GO:0017080)			endometrium(1)	1						TCTTGGCCCCGAAAATCTGTC	0.537													G|||	2	0.000399361	0.0	0.0	5008	,	,		18434	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													108.0	105.0	106.0					17																	8193159		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF151070	CCDS11137.1, CCDS54086.1, CCDS54087.1	17p13	2014-05-09				ENSG00000108961			17679	protein-coding gene	gene with protein product	"""MOG1 homolog (S. cerevisiae)"""	607954				11290418	Standard	NM_016492		Approved	MOG1, HSPC165, HSPC236, RANGNRF	uc002gkv.3	Q9HD47		ENST00000226105.6:c.466G>A	17.37:g.8193159G>A	ENSP00000226105:p.Glu156Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DTR6|Q68DI3|Q9BR68|Q9HD48|Q9NRU9|Q9P001|Q9P0P2	Missense_Mutation	SNP	pfam_Mog1,superfamily_Mog1/PsbP/DUF1795_a/b/a-sand	p.E156K	ENST00000226105.6	37	c.466	CCDS11137.1	17	.	.	.	.	.	.	.	.	.	.	G	11.51	1.660703	0.29515	.	.	ENSG00000108961	ENST00000226105	T	0.76578	-1.03	5.61	3.46	0.39613	Mog1/PsbP, alpha/beta/alpha sandwich (1);Mog1/PsbP/DUF1795, alpha/beta/alpha sandwich (1);	0.385828	0.25820	N	0.028089	T	0.55862	0.1947	N	0.19112	0.55	0.80722	D	1	B	0.12630	0.006	B	0.09377	0.004	T	0.48364	-0.9042	10	0.07644	T	0.81	-0.399	7.3064	0.26451	0.0913:0.1706:0.7381:0.0	.	156	Q9HD47	MOG1_HUMAN	K	156	ENSP00000226105:E156K	ENSP00000226105:E156K	E	+	1	0	RANGRF	8133884	1.000000	0.71417	0.998000	0.56505	0.968000	0.65278	2.254000	0.43214	2.633000	0.89246	0.511000	0.50034	GAA	RANGRF	-	superfamily_Mog1/PsbP/DUF1795_a/b/a-sand	ENSG00000108961		0.537	RANGRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RANGRF	HGNC	protein_coding	OTTHUMT00000442127.1	27	0.00	0	G	NM_016492		8193159	8193159	+1	no_errors	ENST00000226105	ensembl	human	known	69_37n	missense	31	24.39	10	SNP	0.953	A
RASGRF1	5923	genome.wustl.edu	37	15	79382571	79382571	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:79382571C>G	ENST00000419573.3	-	1	544	c.270G>C	c.(268-270)gaG>gaC	p.E90D	RASGRF1_ENST00000558480.2_Missense_Mutation_p.E90D	NM_002891.4	NP_002882.3	Q13972	RGRF1_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 1	90	PH 1. {ECO:0000255|PROSITE- ProRule:PRU00145}.				activation of Rac GTPase activity (GO:0032863)|cell proliferation (GO:0008283)|long-term memory (GO:0007616)|neuron projection development (GO:0031175)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of Ras protein signal transduction (GO:0046579)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of neuronal synaptic plasticity (GO:0048168)|regulation of Rac protein signal transduction (GO:0035020)|regulation of Ras protein signal transduction (GO:0046578)|regulation of synaptic plasticity (GO:0048167)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|growth cone (GO:0030426)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ras guanyl-nucleotide exchange factor activity (GO:0005088)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(4)|large_intestine(18)|lung(23)|ovary(2)|prostate(6)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						TCACCTGTTTCTCCAGCGGCT	0.721																																						dbGAP											0													12.0	13.0	13.0					15																	79382571		2179	4281	6460	-	-	-	SO:0001583	missense	0			M91815	CCDS10309.1, CCDS42065.1, CCDS45320.1	15q24	2013-01-10			ENSG00000058335	ENSG00000058335		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9875	protein-coding gene	gene with protein product		606600		GRF1		7684828, 1379731	Standard	NM_153815		Approved	CDC25L, CDC25, GRF55, H-GRF55, GNRP, PP13187	uc002beq.3	Q13972	OTTHUMG00000144172	ENST00000419573.3:c.270G>C	15.37:g.79382571C>G	ENSP00000405963:p.Glu90Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	F8VPA5|H0YKF2|J3KQP9|Q16027	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,superfamily_DH-domain,smart_Pleckstrin_homology,smart_DH-domain,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.E90D	ENST00000419573.3	37	c.270	CCDS10309.1	15	.	.	.	.	.	.	.	.	.	.	C	7.759	0.705017	0.15172	.	.	ENSG00000058335	ENST00000419573;ENST00000394741	T	0.12255	2.7	3.6	2.67	0.31697	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.342946	0.18603	U	0.136395	T	0.07324	0.0185	N	0.17723	0.515	0.80722	D	1	B;B;B	0.10296	0.003;0.0;0.001	B;B;B	0.11329	0.006;0.006;0.004	T	0.18493	-1.0335	10	0.08179	T	0.78	.	8.6692	0.34140	0.0:0.8826:0.0:0.1174	.	90;90;90	Q8IUU5;Q13972;F8VPA5	.;RGRF1_HUMAN;.	D	90	ENSP00000405963:E90D	ENSP00000378224:E90D	E	-	3	2	RASGRF1	77169626	0.995000	0.38212	0.996000	0.52242	0.833000	0.47200	0.261000	0.18442	0.716000	0.32124	0.313000	0.20887	GAG	RASGRF1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	ENSG00000058335		0.721	RASGRF1-001	KNOWN	basic|CCDS	protein_coding	RASGRF1	HGNC	protein_coding	OTTHUMT00000291371.3	86	0.00	0	C	NM_002891		79382571	79382571	-1	no_errors	ENST00000419573	ensembl	human	known	69_37n	missense	99	16.81	20	SNP	1.000	G
RBM44	375316	genome.wustl.edu	37	2	238742663	238742663	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:238742663G>C	ENST00000409864.1	+	14	3167	c.2913G>C	c.(2911-2913)caG>caC	p.Q971H	RBM44_ENST00000316997.4_Missense_Mutation_p.Q971H			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	970						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		ATTGTAAGCAGATTGAATCTG	0.328																																						dbGAP											0													47.0	42.0	44.0					2																	238742663		1811	4067	5878	-	-	-	SO:0001583	missense	0			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2913G>C	2.37:g.238742663G>C	ENSP00000386727:p.Gln971His	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUW3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.Q971H	ENST00000409864.1	37	c.2913	CCDS46554.1	2	.	.	.	.	.	.	.	.	.	.	G	11.94	1.788666	0.31685	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.26223	1.75;1.75	5.07	3.28	0.37604	.	.	.	.	.	T	0.38825	0.1055	M	0.70595	2.14	0.09310	N	1	D	0.65815	0.995	P	0.54460	0.753	T	0.19451	-1.0305	9	0.72032	D	0.01	-2.8629	7.3098	0.26467	0.273:0.0:0.727:0.0	.	970	Q6ZP01	RBM44_HUMAN	H	971	ENSP00000321179:Q971H;ENSP00000386727:Q971H	ENSP00000321179:Q971H	Q	+	3	2	RBM44	238407402	0.829000	0.29322	0.371000	0.25978	0.948000	0.59901	1.101000	0.31037	0.556000	0.29098	-0.224000	0.12420	CAG	RBM44	-	NULL	ENSG00000177483		0.328	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM44	HGNC	protein_coding	OTTHUMT00000328733.2	46	0.00	0	G	NM_001080504		238742663	238742663	+1	no_errors	ENST00000316997	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	0.016	C
RBM44	375316	genome.wustl.edu	37	2	238742667	238742667	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:238742667G>A	ENST00000409864.1	+	14	3171	c.2917G>A	c.(2917-2919)Gaa>Aaa	p.E973K	RBM44_ENST00000316997.4_Missense_Mutation_p.E973K			Q6ZP01	RBM44_HUMAN	RNA binding motif protein 44	972						cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)	nucleotide binding (GO:0000166)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)			breast(1)|endometrium(4)|kidney(4)|large_intestine(11)|lung(7)|ovary(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	33		Breast(86;0.0042)|Renal(207;0.00571)|Ovarian(221;0.17)|all_hematologic(139;0.182)		Epithelial(121;3.74e-22)|OV - Ovarian serous cystadenocarcinoma(60;5.3e-11)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;6.5e-08)|BRCA - Breast invasive adenocarcinoma(100;0.000118)|Lung(119;0.0112)|LUSC - Lung squamous cell carcinoma(224;0.0266)		TAAGCAGATTGAATCTGCTAA	0.333																																						dbGAP											0													49.0	44.0	45.0					2																	238742667		1809	4068	5877	-	-	-	SO:0001583	missense	0			AK097730	CCDS46554.1	2q37.3	2013-02-12			ENSG00000177483	ENSG00000177483		"""RNA binding motif (RRM) containing"""	24756	protein-coding gene	gene with protein product							Standard	NM_001080504		Approved	FLJ40411	uc002vxi.4	Q6ZP01	OTTHUMG00000152937	ENST00000409864.1:c.2917G>A	2.37:g.238742667G>A	ENSP00000386727:p.Glu973Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A0AUW3	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.E973K	ENST00000409864.1	37	c.2917	CCDS46554.1	2	.	.	.	.	.	.	.	.	.	.	G	11.16	1.556419	0.27827	.	.	ENSG00000177483	ENST00000316997;ENST00000409864	T;T	0.20598	2.06;2.06	5.07	1.65	0.23941	.	.	.	.	.	T	0.09905	0.0243	N	0.16743	0.435	0.09310	N	1	B	0.14012	0.009	B	0.12156	0.007	T	0.39860	-0.9593	9	0.10902	T	0.67	-6.402	4.5505	0.12110	0.2677:0.1891:0.5431:0.0	.	972	Q6ZP01	RBM44_HUMAN	K	973	ENSP00000321179:E973K;ENSP00000386727:E973K	ENSP00000321179:E973K	E	+	1	0	RBM44	238407406	0.008000	0.16893	0.027000	0.17364	0.969000	0.65631	0.698000	0.25571	0.490000	0.27771	0.585000	0.79938	GAA	RBM44	-	NULL	ENSG00000177483		0.333	RBM44-004	KNOWN	basic|appris_principal|CCDS	protein_coding	RBM44	HGNC	protein_coding	OTTHUMT00000328733.2	45	0.00	0	G	NM_001080504		238742667	238742667	+1	no_errors	ENST00000316997	ensembl	human	known	69_37n	missense	39	17.02	8	SNP	0.007	A
RERE	473	genome.wustl.edu	37	1	8424175	8424175	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:8424175C>T	ENST00000337907.3	-	16	2315	c.1681G>A	c.(1681-1683)Gaa>Aaa	p.E561K	RERE_ENST00000460659.1_5'Flank|RERE_ENST00000377464.1_Missense_Mutation_p.E293K|RERE_ENST00000400907.2_Intron|RERE_ENST00000400908.2_Missense_Mutation_p.E561K|RERE_ENST00000476556.1_Missense_Mutation_p.E7K	NM_012102.3	NP_036234.3	Q9P2R6	RERE_HUMAN	arginine-glutamic acid dipeptide (RE) repeats	561					chromatin remodeling (GO:0006338)|multicellular organismal development (GO:0007275)|NLS-bearing protein import into nucleus (GO:0006607)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|poly-glutamine tract binding (GO:0008267)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(5)|liver(1)|lung(16)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	49	Ovarian(185;0.0661)	all_epithelial(116;1.17e-21)|all_lung(118;1.4e-06)|Lung NSC(185;3.06e-06)|Renal(390;0.000147)|Breast(348;0.000206)|Colorectal(325;0.00187)|Hepatocellular(190;0.00825)|Ovarian(437;0.0253)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;9.64e-67)|GBM - Glioblastoma multiforme(8;9.89e-33)|Colorectal(212;1.45e-07)|COAD - Colon adenocarcinoma(227;3.42e-05)|Kidney(185;6e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000533)|KIRC - Kidney renal clear cell carcinoma(229;0.00106)|STAD - Stomach adenocarcinoma(132;0.00118)|READ - Rectum adenocarcinoma(331;0.0419)|Lung(427;0.195)		TCATCCTCTTCCTTGACGGGT	0.592																																						dbGAP											0													87.0	77.0	80.0					1																	8424175		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF016005	CCDS95.1, CCDS41243.1	1p36.23	2013-01-25			ENSG00000142599	ENSG00000142599		"""GATA zinc finger domain containing"""	9965	protein-coding gene	gene with protein product		605226		ATN1L		10814707, 10729226	Standard	NM_012102		Approved	KIAA0458, ARP, ARG, DNB1	uc001apf.3	Q9P2R6	OTTHUMG00000001765	ENST00000337907.3:c.1681G>A	1.37:g.8424175C>T	ENSP00000338629:p.Glu561Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43393|O75046|O75359|Q5VXL9|Q6P6B9|Q9Y2W4	Missense_Mutation	SNP	pfam_Atrophin-like,pfam_BAH_dom,pfam_ELM2_dom,pfam_Znf_GATA,superfamily_Homeodomain-like,smart_BAH_dom,smart_SANT/Myb,smart_Znf_GATA,pfscan_BAH_dom,pfscan_ELM2_dom	p.E561K	ENST00000337907.3	37	c.1681	CCDS95.1	1	.	.	.	.	.	.	.	.	.	.	C	31	5.087150	0.94100	.	.	ENSG00000142599	ENST00000337907;ENST00000377464;ENST00000476556;ENST00000400908	T;T;T	0.50001	0.76;0.76;0.76	5.17	5.17	0.71159	.	.	.	.	.	T	0.55065	0.1897	L	0.46157	1.445	0.80722	D	1	D;D	0.67145	0.996;0.982	P;P	0.57620	0.824;0.622	T	0.42258	-0.9462	9	0.13108	T	0.6	-26.2835	17.8323	0.88686	0.0:1.0:0.0:0.0	.	293;561	B1AKN3;Q9P2R6	.;RERE_HUMAN	K	561;293;7;561	ENSP00000338629:E561K;ENSP00000366684:E293K;ENSP00000383700:E561K	ENSP00000338629:E561K	E	-	1	0	RERE	8346762	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.281000	0.78621	2.689000	0.91719	0.561000	0.74099	GAA	RERE	-	NULL	ENSG00000142599		0.592	RERE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RERE	HGNC	protein_coding	OTTHUMT00000004916.1	79	0.00	0	C			8424175	8424175	-1	no_errors	ENST00000337907	ensembl	human	known	69_37n	missense	75	14.77	13	SNP	1.000	T
RGAG1	57529	genome.wustl.edu	37	X	109695735	109695735	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:109695735G>C	ENST00000465301.2	+	3	2136	c.1890G>C	c.(1888-1890)gaG>gaC	p.E630D	RGAG1_ENST00000540313.1_Missense_Mutation_p.E630D	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	630										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						TGTTCACGGAGAAAATGACAA	0.507																																						dbGAP											0													141.0	109.0	120.0					X																	109695735		2203	4300	6503	-	-	-	SO:0001583	missense	0			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.1890G>C	X.37:g.109695735G>C	ENSP00000419786:p.Glu630Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.E630D	ENST00000465301.2	37	c.1890	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	G	0.200	-1.045376	0.01997	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.44881	0.91;0.91	4.35	0.586	0.17434	.	0.249881	0.20966	N	0.082474	T	0.27933	0.0688	L	0.34521	1.04	0.09310	N	1	B	0.27732	0.187	B	0.27500	0.08	T	0.16689	-1.0394	9	.	.	.	-0.1778	9.7363	0.40390	0.2911:0.0:0.7089:0.0	.	630	Q8NET4	RGAG1_HUMAN	D	630	ENSP00000419786:E630D;ENSP00000441452:E630D	.	E	+	3	2	RGAG1	109582391	0.915000	0.31059	0.003000	0.11579	0.009000	0.06853	0.117000	0.15583	-0.029000	0.13827	-1.159000	0.01794	GAG	RGAG1	-	NULL	ENSG00000243978		0.507	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	28	0.00	0	G	NM_020769		109695735	109695735	+1	no_errors	ENST00000465301	ensembl	human	known	69_37n	missense	43	10.42	5	SNP	0.002	C
RGS6	9628	genome.wustl.edu	37	14	72961968	72961968	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:72961968G>A	ENST00000553530.1	+	13	1170	c.963G>A	c.(961-963)atG>atA	p.M321I	RGS6_ENST00000434263.2_Missense_Mutation_p.M252I|RGS6_ENST00000553525.1_Missense_Mutation_p.M321I|RGS6_ENST00000407322.4_Missense_Mutation_p.M321I|RGS6_ENST00000404301.2_Missense_Mutation_p.M321I|RGS6_ENST00000554782.1_Missense_Mutation_p.M182I|RGS6_ENST00000343854.6_Intron|RGS6_ENST00000355512.6_Missense_Mutation_p.M321I|RGS6_ENST00000556437.1_Missense_Mutation_p.M321I|RGS6_ENST00000402788.2_Missense_Mutation_p.M321I|RGS6_ENST00000406236.4_Missense_Mutation_p.M321I|RGS6_ENST00000555571.1_Missense_Mutation_p.M321I	NM_001204417.1|NM_001204418.1|NM_001204420.1|NM_001204421.1|NM_001204422.1|NM_004296.5	NP_001191346.1|NP_001191347.1|NP_001191349.1|NP_001191350.1|NP_001191351.1|NP_004287.3	P49758	RGS6_HUMAN	regulator of G-protein signaling 6	321	G protein gamma.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neuron differentiation (GO:0045666)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|heterotrimeric G-protein complex (GO:0005834)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			endometrium(2)|kidney(3)|large_intestine(6)|lung(14)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33				all cancers(60;0.00309)|BRCA - Breast invasive adenocarcinoma(234;0.0281)|STAD - Stomach adenocarcinoma(64;0.0302)|OV - Ovarian serous cystadenocarcinoma(108;0.0476)		ACATAGAGATGAGGTAAAAAA	0.383																																					Ovarian(143;1926 2468 21071 48641)	dbGAP											0													184.0	166.0	172.0					14																	72961968		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF073920	CCDS9808.1, CCDS55924.1, CCDS73655.1	14q24.3	2008-07-28	2007-08-14			ENSG00000182732		"""Regulators of G-protein signaling"""	10002	protein-coding gene	gene with protein product		603894	"""regulator of G-protein signalling 6"""			10083744, 14734556	Standard	NM_004296		Approved		uc010ttn.2	P49758		ENST00000553530.1:c.963G>A	14.37:g.72961968G>A	ENSP00000452331:p.Met321Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JE95|F8W7W5|O75576|O75577|Q7Z4K3|Q7Z4K4|Q7Z4K5|Q7Z4K6|Q8TE13|Q8TE14|Q8TE15|Q8TE16|Q8TE17|Q8TE18|Q8TE19|Q8TE20|Q8TE21|Q8TE22|Q9UDS8|Q9UDT0|Q9Y245|Q9Y647	Missense_Mutation	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.M321I	ENST00000553530.1	37	c.963	CCDS9808.1	14	.	.	.	.	.	.	.	.	.	.	G	12.07	1.826185	0.32237	.	.	ENSG00000182732	ENST00000553525;ENST00000555571;ENST00000553530;ENST00000556437;ENST00000355512;ENST00000404301;ENST00000406236;ENST00000407322;ENST00000402788;ENST00000453330;ENST00000434263;ENST00000554782;ENST00000535521	T;T;T;T;T;T;T;T;T;T;T	0.28666	1.78;1.63;1.63;1.78;1.6;1.78;1.78;1.78;1.63;1.73;1.77	5.81	4.92	0.64577	.	0.293288	0.46442	D	0.000294	T	0.21186	0.0510	L	0.34521	1.04	0.80722	D	1	B;B;B;B	0.22211	0.066;0.03;0.036;0.004	B;B;B;B	0.19391	0.025;0.004;0.017;0.001	T	0.07829	-1.0752	10	0.45353	T	0.12	-13.4052	5.8827	0.18864	0.1568:0.0:0.6878:0.1554	.	252;321;326;321	B7Z7N5;P49758-2;Q59FJ8;P49758	.;.;.;RGS6_HUMAN	I	321;321;321;321;321;321;321;321;321;293;252;182;182	ENSP00000451030:M321I;ENSP00000450936:M321I;ENSP00000452331:M321I;ENSP00000451855:M321I;ENSP00000347699:M321I;ENSP00000385243:M321I;ENSP00000384218:M321I;ENSP00000384612:M321I;ENSP00000383953:M321I;ENSP00000412144:M252I;ENSP00000451912:M182I	ENSP00000347699:M321I	M	+	3	0	RGS6	72031721	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	0.971000	0.29396	1.458000	0.47871	0.655000	0.94253	ATG	RGS6	-	NULL	ENSG00000182732		0.383	RGS6-003	NOVEL	basic|appris_candidate|CCDS	protein_coding	RGS6	HGNC	protein_coding	OTTHUMT00000413033.2	112	0.00	0	G			72961968	72961968	+1	no_errors	ENST00000553525	ensembl	human	known	69_37n	missense	105	13.22	16	SNP	1.000	A
RGS7	6000	genome.wustl.edu	37	1	240969544	240969544	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:240969544G>A	ENST00000407727.1	-	14	1164	c.1165C>T	c.(1165-1167)Ctg>Ttg	p.L389L	RGS7_ENST00000366562.4_Silent_p.L389L|RGS7_ENST00000446183.2_Silent_p.L305L|RGS7_ENST00000366564.1_Silent_p.L389L|RGS7_ENST00000366565.1_Silent_p.L389L|RGS7_ENST00000348120.2_Silent_p.L336L|RGS7_ENST00000401882.1_Silent_p.L336L|RGS7_ENST00000366563.1_Silent_p.L389L|RGS7_ENST00000331110.7_Silent_p.L363L			P49802	RGS7_HUMAN	regulator of G-protein signaling 7	389	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite terminus (GO:0044292)|heterotrimeric G-protein complex (GO:0005834)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein beta-subunit binding (GO:0031681)|GTPase activator activity (GO:0005096)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(51)|ovary(4)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	76		all_cancers(173;0.0131)	OV - Ovarian serous cystadenocarcinoma(106;0.027)			CCGGGAGCCAGAAACTCTTGC	0.458																																						dbGAP											0													129.0	128.0	128.0					1																	240969544		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			BC022009	CCDS31071.1, CCDS60457.1, CCDS60458.1, CCDS60459.1	1q43	2008-02-05	2007-08-14		ENSG00000182901	ENSG00000182901		"""Regulators of G-protein signaling"""	10003	protein-coding gene	gene with protein product		602517	"""regulator of G-protein signalling 7"""			8548815	Standard	XM_005273218		Approved		uc001hyv.2	P49802	OTTHUMG00000040107	ENST00000407727.1:c.1165C>T	1.37:g.240969544G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5T3H4|Q8TD66|Q8TD67|Q8WW09|Q9UNU7|Q9Y6B9	Silent	SNP	pfam_Regulat_G_prot_signal,pfam_G-protein_gamma-like_dom,pfam_DEP_dom,superfamily_Regulat_G_prot_signal_superfam,superfamily_G-protein_gamma-like_dom,smart_DEP_dom,smart_G-protein_gamma-like_dom,smart_Regulat_G_prot_signal,pfscan_DEP_dom,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.L389	ENST00000407727.1	37	c.1165		1																																																																																			RGS7	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	ENSG00000182901		0.458	RGS7-204	KNOWN	basic	protein_coding	RGS7	HGNC	protein_coding		50	0.00	0	G	NM_002924		240969544	240969544	-1	no_errors	ENST00000407727	ensembl	human	known	69_37n	silent	50	13.79	8	SNP	1.000	A
RNF180	285671	genome.wustl.edu	37	5	63626151	63626151	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:63626151G>C	ENST00000389100.4	+	7	1569	c.1497G>C	c.(1495-1497)ttG>ttC	p.L499F		NM_001113561.1	NP_001107033.1	Q86T96	RN180_HUMAN	ring finger protein 180	499					adult behavior (GO:0030534)|norepinephrine metabolic process (GO:0042415)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein ubiquitination (GO:0031398)|protein polyubiquitination (GO:0000209)|regulation of catalytic activity (GO:0050790)|serotonin metabolic process (GO:0042428)	integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(4)|lung(9)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	20		Lung NSC(810;3.55e-06)|Prostate(74;0.0352)|Ovarian(174;0.0545)|Breast(144;0.0848)|Colorectal(97;0.234)		Lung(70;0.114)		AAGAATATTTGAAAATAAAAC	0.318																																						dbGAP											0													50.0	44.0	46.0					5																	63626151		692	1591	2283	-	-	-	SO:0001583	missense	0			AK090756	CCDS34169.1, CCDS47219.1	5q12.3	2013-01-09			ENSG00000164197	ENSG00000164197		"""RING-type (C3HC4) zinc fingers"""	27752	protein-coding gene	gene with protein product							Standard	NM_178532		Approved		uc003jti.3	Q86T96	OTTHUMG00000162278	ENST00000389100.4:c.1497G>C	5.37:g.63626151G>C	ENSP00000373752:p.Leu499Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q0JSU3|Q495A8|Q8NBD1	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.L499F	ENST00000389100.4	37	c.1497	CCDS47219.1	5	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461666	0.43736	.	.	ENSG00000164197	ENST00000389100	T	0.50813	0.73	5.5	1.71	0.24356	.	0.341645	0.25117	N	0.033003	T	0.30479	0.0766	N	0.24115	0.695	0.80722	D	1	P	0.39216	0.664	B	0.37304	0.246	T	0.03576	-1.1023	10	0.38643	T	0.18	-6.8279	9.5064	0.39048	0.2833:0.0:0.7167:0.0	.	499	Q86T96	RN180_HUMAN	F	499	ENSP00000373752:L499F	ENSP00000373752:L499F	L	+	3	2	RNF180	63661907	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.256000	0.32921	0.291000	0.22468	0.643000	0.83706	TTG	RNF180	-	NULL	ENSG00000164197		0.318	RNF180-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF180	HGNC	protein_coding	OTTHUMT00000368394.1	38	0.00	0	G	NM_178532		63626151	63626151	+1	no_errors	ENST00000389100	ensembl	human	known	69_37n	missense	58	16.90	12	SNP	1.000	C
ROCK2	9475	genome.wustl.edu	37	2	11348448	11348448	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:11348448C>G	ENST00000315872.6	-	19	2777	c.2329G>C	c.(2329-2331)Gag>Cag	p.E777Q	ROCK2_ENST00000401753.1_Missense_Mutation_p.E534Q	NM_004850.3	NP_004841.2	O75116	ROCK2_HUMAN	Rho-associated, coiled-coil containing protein kinase 2	777	Interaction with PPP1R12A.				actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of angiogenesis (GO:0016525)|neural tube closure (GO:0001843)|positive regulation of centrosome duplication (GO:0010825)|protein phosphorylation (GO:0006468)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of circadian rhythm (GO:0042752)|regulation of establishment of cell polarity (GO:2000114)|regulation of focal adhesion assembly (GO:0051893)|regulation of keratinocyte differentiation (GO:0045616)|regulation of stress fiber assembly (GO:0051492)|rhythmic process (GO:0048511)|smooth muscle contraction (GO:0006939)	centrosome (GO:0005813)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole centrosome (GO:0031616)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(6)|lung(10)|prostate(1)|skin(4)|stomach(3)|urinary_tract(2)	43	all_hematologic(175;0.127)|Acute lymphoblastic leukemia(172;0.155)			Epithelial(75;0.137)|OV - Ovarian serous cystadenocarcinoma(76;0.162)		TTAAGGAGCTCATTTATTTTC	0.313																																						dbGAP											0													84.0	78.0	80.0					2																	11348448		1811	4069	5880	-	-	-	SO:0001583	missense	0			D87931	CCDS42654.1	2p24	2013-01-10			ENSG00000134318	ENSG00000134318	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	10252	protein-coding gene	gene with protein product		604002				9933571	Standard	NM_004850		Approved		uc002rbd.1	O75116	OTTHUMG00000149916	ENST00000315872.6:c.2329G>C	2.37:g.11348448C>G	ENSP00000317985:p.Glu777Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q53QZ0|Q53SJ7|Q9UQN5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Rho-bd,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pleckstrin_homology,pfam_Pkinase_C,superfamily_Kinase-like_dom,superfamily_tRNA-bd_arm,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,smart_Pleckstrin_homology,smart_Prot_Kinase_C-like_PE/DAG-bd,pirsf_Rho-assoc_coiled-coil_kinase,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.E777Q	ENST00000315872.6	37	c.2329	CCDS42654.1	2	.	.	.	.	.	.	.	.	.	.	C	12.70	2.018087	0.35606	.	.	ENSG00000134318	ENST00000315872;ENST00000401753;ENST00000399089	T;T	0.62232	0.04;1.1	5.61	5.61	0.85477	.	0.000000	0.85682	D	0.000000	T	0.55561	0.1928	L	0.36672	1.1	0.51233	D	0.999913	B	0.17268	0.021	B	0.20184	0.028	T	0.48186	-0.9057	10	0.22706	T	0.39	.	19.6299	0.95698	0.0:1.0:0.0:0.0	.	777	O75116	ROCK2_HUMAN	Q	777;534;135	ENSP00000317985:E777Q;ENSP00000385509:E534Q	ENSP00000317985:E777Q	E	-	1	0	ROCK2	11265899	0.966000	0.33281	0.964000	0.40570	0.991000	0.79684	2.392000	0.44433	2.639000	0.89480	0.655000	0.94253	GAG	ROCK2	-	pirsf_Rho-assoc_coiled-coil_kinase	ENSG00000134318		0.313	ROCK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROCK2	HGNC	protein_coding	OTTHUMT00000313886.3	26	0.00	0	C			11348448	11348448	-1	no_errors	ENST00000315872	ensembl	human	known	69_37n	missense	35	16.67	7	SNP	1.000	G
RNPEPL1	57140	genome.wustl.edu	37	2	241513987	241513987	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:241513987G>C	ENST00000270357.4	+	6	1130	c.537G>C	c.(535-537)caG>caC	p.Q179H		NM_018226.4	NP_060696.4	Q9HAU8	RNPL1_HUMAN	arginyl aminopeptidase (aminopeptidase B)-like 1	179					leukotriene biosynthetic process (GO:0019370)		aminopeptidase activity (GO:0004177)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	13		all_epithelial(40;1.13e-11)|Breast(86;0.000169)|Renal(207;0.00571)|Ovarian(221;0.104)|all_hematologic(139;0.182)|all_lung(227;0.204)|Melanoma(123;0.238)		Epithelial(32;3.05e-31)|all cancers(36;8.2e-29)|OV - Ovarian serous cystadenocarcinoma(60;8.55e-15)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;5.12e-06)|Lung(119;0.00168)|Colorectal(34;0.005)|LUSC - Lung squamous cell carcinoma(224;0.00813)|COAD - Colon adenocarcinoma(134;0.0322)		TGCACCGGCAGATGAAGCTTC	0.642																																						dbGAP											0													38.0	42.0	41.0					2																	241513987		2202	4299	6501	-	-	-	SO:0001583	missense	0					2q37.3	2012-03-06			ENSG00000142327	ENSG00000142327			10079	protein-coding gene	gene with protein product		605287				19508204	Standard	NM_018226		Approved		uc002vzi.4	Q9HAU8	OTTHUMG00000133357	ENST00000270357.4:c.537G>C	2.37:g.241513987G>C	ENSP00000270357:p.Gln179His	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5XKC3|Q6NX56|Q96AC9|Q9H033|Q9NVD0	Missense_Mutation	SNP	pfam_Peptidase_M1_C,pfam_Peptidase_M1_N,superfamily_ARM-type_fold,prints_Peptidase_M1_N	p.Q179H	ENST00000270357.4	37	c.537		2	.	.	.	.	.	.	.	.	.	.	G	7.478	0.648160	0.14516	.	.	ENSG00000142327	ENST00000270357	T	0.02787	4.16	4.64	3.72	0.42706	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.129305	0.53938	D	0.000057	T	0.01320	0.0043	N	0.03294	-0.36	0.49299	D	0.99977	B;B	0.34290	0.447;0.003	B;B	0.27262	0.078;0.015	T	0.62258	-0.6892	10	0.11485	T	0.65	-30.5261	11.7722	0.51965	0.0:0.0:0.8222:0.1778	.	85;179	A4FTX9;Q9HAU8	.;RNPL1_HUMAN	H	179	ENSP00000270357:Q179H	ENSP00000270357:Q179H	Q	+	3	2	RNPEPL1	241162660	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.488000	0.53229	1.009000	0.39289	0.591000	0.81541	CAG	RNPEPL1	-	pfam_Peptidase_M1_N	ENSG00000142327		0.642	RNPEPL1-001	KNOWN	basic|appris_principal	protein_coding	RNPEPL1	HGNC	protein_coding	OTTHUMT00000257190.4	36	0.00	0	G	NM_018226		241513987	241513987	+1	no_errors	ENST00000270357	ensembl	human	known	69_37n	missense	41	32.79	20	SNP	1.000	C
RPGR	6103	genome.wustl.edu	37	X	38146013	38146013	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:38146013C>G	ENST00000339363.3	-	14	2688				RPGR_ENST00000338898.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.E747Q|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000342811.3_Intron|RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						tcttcttcctcttctctgtct	0.532																																						dbGAP											0													203.0	118.0	146.0					X																	38146013		2054	4068	6122	-	-	-	SO:0001627	intron_variant	0			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+333G>C	X.37:g.38146013C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.E747Q	ENST00000339363.3	37	c.2239		X	.	.	.	.	.	.	.	.	.	.	c	3.745	-0.052708	0.07362	.	.	ENSG00000156313	ENST00000378505	T	0.02472	4.28	0.738	0.738	0.18319	.	.	.	.	.	T	0.03263	0.0095	L	0.54323	1.7	0.30675	N	0.752987	D	0.55385	0.971	B	0.41723	0.365	T	0.41395	-0.9511	9	0.27785	T	0.31	.	6.8388	0.23951	0.0:1.0:0.0:0.0	.	747	E9PE28	.	Q	747	ENSP00000367766:E747Q	ENSP00000367766:E747Q	E	-	1	0	RPGR	38030957	0.000000	0.05858	0.011000	0.14972	0.086000	0.17979	0.237000	0.17985	0.631000	0.30412	0.339000	0.21740	GAG	RPGR	-	NULL	ENSG00000156313		0.532	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		106	0.00	0	C	NM_000328		38146013	38146013	-1	no_errors	ENST00000378505	ensembl	human	known	69_37n	missense	97	10.19	11	SNP	0.089	G
RPL3L	6123	genome.wustl.edu	37	16	2004125	2004125	+	Missense_Mutation	SNP	G	G	A	rs530918397		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:2004125G>A	ENST00000268661.7	-	2	122	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	RPL3L_ENST00000566484.1_5'Flank	NM_005061.2	NP_005052.1	Q92901	RL3L_HUMAN	ribosomal protein L3-like	10					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)|ribosome (GO:0005840)	RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			NS(1)|endometrium(5)|kidney(2)|large_intestine(2)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	17						TGTCCGTGCCGAGGGGCGGAA	0.667													G|||	1	0.000199681	0.0	0.0	5008	,	,		15980	0.0		0.0	False		,,,				2504	0.001					dbGAP											0													12.0	13.0	13.0					16																	2004125		2191	4291	6482	-	-	-	SO:0001583	missense	0			U65581	CCDS10450.1	16p13.3	2008-02-05			ENSG00000140986	ENSG00000140986		"""L ribosomal proteins"""	10351	protein-coding gene	gene with protein product						8921388	Standard	NM_005061		Approved		uc002cnh.3	Q92901	OTTHUMG00000128685	ENST00000268661.7:c.28C>T	16.37:g.2004125G>A	ENSP00000268661:p.Arg10Trp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Ribosomal_L3,superfamily_Transl_elong_init/rib_B-barrel	p.R10W	ENST00000268661.7	37	c.28	CCDS10450.1	16	.	.	.	.	.	.	.	.	.	.	G	14.69	2.612188	0.46631	.	.	ENSG00000140986	ENST00000268661	T	0.54866	0.55	4.84	3.87	0.44632	Translation elongation/initiation factor/Ribosomal, beta-barrel (1);	0.000000	0.85682	D	0.000000	T	0.80199	0.4579	H	0.97158	3.95	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.85756	0.1346	10	0.87932	D	0	-6.4589	12.394	0.55374	0.0:0.0:0.678:0.322	.	10	Q92901	RL3L_HUMAN	W	10	ENSP00000268661:R10W	ENSP00000268661:R10W	R	-	1	2	RPL3L	1944126	1.000000	0.71417	0.988000	0.46212	0.003000	0.03518	3.802000	0.55553	1.161000	0.42604	-0.181000	0.13052	CGG	RPL3L	-	superfamily_Transl_elong_init/rib_B-barrel	ENSG00000140986		0.667	RPL3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL3L	HGNC	protein_coding	OTTHUMT00000250582.2	42	0.00	0	G	NM_005061		2004125	2004125	-1	no_errors	ENST00000268661	ensembl	human	known	69_37n	missense	78	20.41	20	SNP	1.000	A
RPS6KA6	27330	genome.wustl.edu	37	X	83389807	83389807	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:83389807C>T	ENST00000262752.2	-	8	636	c.629G>A	c.(628-630)gGa>gAa	p.G210E	RPS6KA6_ENST00000543399.1_Missense_Mutation_p.G210E	NM_014496.4	NP_055311.1	Q9UK32	KS6A6_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 6	210	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				axon guidance (GO:0007411)|central nervous system development (GO:0007417)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation of embryonic development (GO:0045992)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of mesoderm development (GO:2000381)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(26)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	46						TTTGATATGTCCTATTTCATC	0.234																																						dbGAP											0													32.0	32.0	32.0					X																	83389807		2177	4233	6410	-	-	-	SO:0001583	missense	0			AF184965	CCDS14451.1	Xq21.1	2011-04-05	2002-08-29		ENSG00000072133	ENSG00000072133			10435	protein-coding gene	gene with protein product		300303	"""ribosomal protein S6 kinase, 90kD, polypeptide 6"""			10644430	Standard	NM_014496		Approved	RSK4	uc004eej.2	Q9UK32	OTTHUMG00000021923	ENST00000262752.2:c.629G>A	X.37:g.83389807C>T	ENSP00000262752:p.Gly210Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	B2R854|B7ZL90|Q6FHX2|Q8WX28|Q9H4S6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	p.G210E	ENST00000262752.2	37	c.629	CCDS14451.1	X	.	.	.	.	.	.	.	.	.	.	C	20.5	4.003414	0.74932	.	.	ENSG00000072133	ENST00000262752;ENST00000543399	T;T	0.31510	1.49;1.49	4.4	4.4	0.53042	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.61590	0.2359	M	0.87758	2.905	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.71513	-0.4570	10	0.87932	D	0	.	16.4253	0.83813	0.0:1.0:0.0:0.0	.	210;210	B7ZL90;Q9UK32	.;KS6A6_HUMAN	E	210	ENSP00000262752:G210E;ENSP00000440830:G210E	ENSP00000262752:G210E	G	-	2	0	RPS6KA6	83276463	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.130000	0.77235	1.784000	0.52394	0.523000	0.50628	GGA	RPS6KA6	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ribosomal_S6_kinase_II,pfscan_Prot_kinase_cat_dom	ENSG00000072133		0.234	RPS6KA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA6	HGNC	protein_coding	OTTHUMT00000057372.1	111	0.00	0	C	NM_014496		83389807	83389807	-1	no_errors	ENST00000262752	ensembl	human	known	69_37n	missense	102	16.39	20	SNP	1.000	T
RPSA	3921	genome.wustl.edu	37	3	39448480	39448480	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:39448480C>G	ENST00000301821.6	+	1	76				RPSA_ENST00000443003.1_Intron|SNORA6_ENST00000384033.1_RNA	NM_001012321.1|NM_002295.4	NP_001012321.1|NP_002286.2			ribosomal protein SA											endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0509)|Kidney(284;0.064)		AGCGGAGGCTCCGAGCTGGGG	0.721																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			S37431	CCDS2686.1	3p21.3	2014-09-17	2002-08-29	2005-02-11	ENSG00000168028	ENSG00000168028			6502	protein-coding gene	gene with protein product		150370	"""laminin receptor 1 (67kD, ribosomal protein SA)"""	LAMR1		1534510, 8760291	Standard	NM_001012321		Approved	LRP, 37LRP, p40, SA	uc003cjp.3	P08865	OTTHUMG00000131296	ENST00000301821.6:c.-34+225C>G	3.37:g.39448480C>G		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	NULL	p.L54	ENST00000301821.6	37	c.162	CCDS2686.1	3																																																																																			RPSA	-	NULL	ENSG00000168028		0.721	RPSA-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RPSA	HGNC	protein_coding	OTTHUMT00000254064.3	67	0.00	0	C	NM_002295		39448480	39448480	+1	no_errors	ENST00000444512	ensembl	human	known	69_37n	silent	52	18.75	12	SNP	0.001	G
RRP8	23378	genome.wustl.edu	37	11	6621412	6621412	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:6621412G>A	ENST00000254605.6	-	7	1452	c.1335C>T	c.(1333-1335)ggC>ggT	p.G445G	RRP8_ENST00000534343.1_Silent_p.G129G	NM_015324.3	NP_056139.1	O43159	RRP8_HUMAN	ribosomal RNA processing 8, methyltransferase, homolog (yeast)	445					cellular response to glucose starvation (GO:0042149)|chromatin modification (GO:0016568)|chromatin silencing at rDNA (GO:0000183)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|positive regulation of cell cycle arrest (GO:0071158)|regulation of transcription by glucose (GO:0046015)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|rDNA heterochromatin (GO:0033553)	methylated histone binding (GO:0035064)|poly(A) RNA binding (GO:0044822)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)	13						GAAGCTGCAGGCCTGAAAGCT	0.532																																						dbGAP											0													60.0	65.0	63.0					11																	6621412		2201	4296	6497	-	-	-	SO:0001819	synonymous_variant	0			AB007869	CCDS31411.1	11p15.4	2009-02-23	2009-02-23	2009-02-23	ENSG00000132275	ENSG00000132275			29030	protein-coding gene	gene with protein product	RRP8 methyltransferase homolog (S. cerevisiae)	615818	"""KIAA0409"""	KIAA0409		9455477	Standard	NM_015324		Approved		uc001med.3	O43159		ENST00000254605.6:c.1335C>T	11.37:g.6621412G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q7KZ78|Q9BVM6	Silent	SNP	pfam_Methyltransferase-rel,pfam_Methyltransf_11	p.G445	ENST00000254605.6	37	c.1335	CCDS31411.1	11																																																																																			RRP8	-	pfam_Methyltransferase-rel	ENSG00000132275		0.532	RRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP8	HGNC	protein_coding	OTTHUMT00000384505.1	56	0.00	0	G	NM_015324		6621412	6621412	-1	no_errors	ENST00000254605	ensembl	human	known	69_37n	silent	52	16.13	10	SNP	1.000	A
RSRC2	65117	genome.wustl.edu	37	12	123001881	123001881	+	Silent	SNP	C	C	T	rs572371574	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:123001881C>T	ENST00000331738.7	-	5	640	c.495G>A	c.(493-495)tcG>tcA	p.S165S	RSRC2_ENST00000354654.2_Silent_p.S117S	NM_023012.5	NP_075388.2	Q7L4I2	RSRC2_HUMAN	arginine/serine-rich coiled-coil 2	165	Ser-rich.						poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|skin(2)|urinary_tract(2)	24	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;5.14e-05)|Epithelial(86;0.000183)|BRCA - Breast invasive adenocarcinoma(302;0.201)		TTCTGGATCTCGATTTCTTCC	0.517													C|||	2	0.000399361	0.0	0.0	5008	,	,		17202	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													215.0	176.0	189.0					12																	123001881		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF161432	CCDS31920.1	12q24.31	2007-02-13			ENSG00000111011	ENSG00000111011			30559	protein-coding gene	gene with protein product						17203224	Standard	NM_023012		Approved	FLJ11021	uc001ucr.3	Q7L4I2	OTTHUMG00000167572	ENST00000331738.7:c.495G>A	12.37:g.123001881C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q6N040|Q6NW16|Q9H864	Missense_Mutation	SNP	NULL	p.R59Q	ENST00000331738.7	37	c.176	CCDS31920.1	12	.	.	.	.	.	.	.	.	.	.	C	6.418	0.445237	0.12164	.	.	ENSG00000111011	ENST00000526560	T	0.56275	0.47	5.15	1.16	0.20824	.	.	.	.	.	T	0.50735	0.1633	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.51973	-0.8637	6	0.87932	D	0	.	1.7881	0.03046	0.1665:0.0922:0.1732:0.5681	.	.	.	.	Q	59	ENSP00000446470:R59Q	ENSP00000446470:R59Q	R	-	2	0	RSRC2	121567834	0.998000	0.40836	0.990000	0.47175	0.050000	0.14768	0.430000	0.21428	0.381000	0.24851	-1.147000	0.01851	CGA	RSRC2	-	NULL	ENSG00000111011		0.517	RSRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSRC2	HGNC	protein_coding	OTTHUMT00000395096.3	127	0.00	0	C	NM_023012		123001881	123001881	-1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000526560	ensembl	human	putative	69_37n	missense	154	12.50	22	SNP	0.970	T
SAG	6295	genome.wustl.edu	37	2	234255501	234255501	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:234255501G>A	ENST00000409110.1	+	16	1391	c.1161G>A	c.(1159-1161)ctG>ctA	p.L387L		NM_000541.4	NP_000532.2	P10523	ARRS_HUMAN	S-antigen; retina and pineal gland (arrestin)	387					cell surface receptor signaling pathway (GO:0007166)|negative regulation of catalytic activity (GO:0043086)|phototransduction, visible light (GO:0007603)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|visual perception (GO:0007601)	cytosol (GO:0005829)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	protein phosphatase inhibitor activity (GO:0004864)			cervix(1)|kidney(2)|lung(4)|ovary(1)|upper_aerodigestive_tract(1)	9		Breast(86;0.0013)|Renal(207;0.00339)|all_hematologic(139;0.0116)|all_lung(227;0.018)|Acute lymphoblastic leukemia(138;0.0327)|Lung NSC(271;0.054)		Epithelial(121;2.86e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00608)|Lung(119;0.00714)|GBM - Glioblastoma multiforme(43;0.207)		GCCATAATCTGAAAGATGCAG	0.418																																						dbGAP											0													90.0	92.0	92.0					2																	234255501		1949	4148	6097	-	-	-	SO:0001819	synonymous_variant	0				CCDS46545.1	2q37.1	2013-02-14			ENSG00000130561	ENSG00000130561			10521	protein-coding gene	gene with protein product	"""arrestin 1"""	181031				2249983	Standard	NM_000541		Approved	ARRESTIN, RP47	uc002vuh.2	P10523	OTTHUMG00000153213	ENST00000409110.1:c.1161G>A	2.37:g.234255501G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A0FDN6|Q53SV3|Q99858	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set,prints_Arrestin	p.L387	ENST00000409110.1	37	c.1161	CCDS46545.1	2																																																																																			SAG	-	superfamily_Ig_E-set,prints_Arrestin	ENSG00000130561		0.418	SAG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAG	HGNC	protein_coding	OTTHUMT00000330126.1	91	0.00	0	G	NM_000541		234255501	234255501	+1	no_errors	ENST00000409110	ensembl	human	known	69_37n	silent	88	21.43	24	SNP	1.000	A
SAPCD2	89958	genome.wustl.edu	37	9	139960064	139960064	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:139960064C>G	ENST00000409687.3	-	3	868	c.741G>C	c.(739-741)gaG>gaC	p.E247D	RP11-229P13.23_ENST00000456356.2_RNA	NM_178448.3	NP_848543.2	Q86UD0	SAPC2_HUMAN	suppressor APC domain containing 2	247						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)											GCGCCATCATCTCCAAACCCT	0.632																																						dbGAP											0													108.0	103.0	105.0					9																	139960064		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024299	CCDS7027.2	9q34.3	2012-02-08	2012-02-08	2012-02-08	ENSG00000186193	ENSG00000186193			28055	protein-coding gene	gene with protein product		612057	"""chromosome 9 open reading frame 140"""	C9orf140		12477932	Standard	NM_178448		Approved	p42.3	uc011men.2	Q86UD0	OTTHUMG00000020961	ENST00000409687.3:c.741G>C	9.37:g.139960064C>G	ENSP00000386348:p.Glu247Asp	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E247D	ENST00000409687.3	37	c.741	CCDS7027.2	9	.	.	.	.	.	.	.	.	.	.	C	12.56	1.975147	0.34848	.	.	ENSG00000186193	ENST00000409687	D	0.81908	-1.55	4.44	3.54	0.40534	.	0.000000	0.64402	D	0.000001	T	0.76786	0.4036	L	0.47190	1.495	0.39385	D	0.966312	P	0.44344	0.833	B	0.42738	0.396	T	0.73228	-0.4049	10	0.26408	T	0.33	5.9445	9.4664	0.38816	0.0:0.9004:0.0:0.0996	.	247	Q86UD0	CI140_HUMAN	D	247	ENSP00000386348:E247D	ENSP00000386348:E247D	E	-	3	2	C9orf140	139079885	0.988000	0.35896	1.000000	0.80357	0.808000	0.45660	0.561000	0.23515	1.088000	0.41272	0.561000	0.74099	GAG	SAPCD2	-	NULL	ENSG00000186193		0.632	SAPCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAPCD2	HGNC	protein_coding	OTTHUMT00000055215.2	37	0.00	0	C	NM_178448		139960064	139960064	-1	no_errors	ENST00000409687	ensembl	human	known	69_37n	missense	85	10.53	10	SNP	1.000	G
SAPCD2	89958	genome.wustl.edu	37	9	139960099	139960099	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:139960099C>G	ENST00000409687.3	-	3	833	c.706G>C	c.(706-708)Gag>Cag	p.E236Q	RP11-229P13.23_ENST00000456356.2_RNA	NM_178448.3	NP_848543.2	Q86UD0	SAPC2_HUMAN	suppressor APC domain containing 2	236						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)											TTCTCCTGCTCCAGCTCCTTC	0.612																																						dbGAP											0													119.0	114.0	115.0					9																	139960099		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC024299	CCDS7027.2	9q34.3	2012-02-08	2012-02-08	2012-02-08	ENSG00000186193	ENSG00000186193			28055	protein-coding gene	gene with protein product		612057	"""chromosome 9 open reading frame 140"""	C9orf140		12477932	Standard	NM_178448		Approved	p42.3	uc011men.2	Q86UD0	OTTHUMG00000020961	ENST00000409687.3:c.706G>C	9.37:g.139960099C>G	ENSP00000386348:p.Glu236Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	NULL	p.E236Q	ENST00000409687.3	37	c.706	CCDS7027.2	9	.	.	.	.	.	.	.	.	.	.	C	22.1	4.238023	0.79800	.	.	ENSG00000186193	ENST00000409687	D	0.87412	-2.25	4.14	4.14	0.48551	.	0.071226	0.56097	D	0.000040	D	0.91150	0.7213	M	0.82517	2.595	0.45962	D	0.998784	D	0.56746	0.977	P	0.54210	0.745	D	0.92387	0.5918	10	0.66056	D	0.02	-15.5091	13.3016	0.60328	0.0:1.0:0.0:0.0	.	236	Q86UD0	CI140_HUMAN	Q	236	ENSP00000386348:E236Q	ENSP00000386348:E236Q	E	-	1	0	C9orf140	139079920	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	3.167000	0.50793	2.142000	0.66516	0.561000	0.74099	GAG	SAPCD2	-	NULL	ENSG00000186193		0.612	SAPCD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SAPCD2	HGNC	protein_coding	OTTHUMT00000055215.2	36	0.00	0	C	NM_178448		139960099	139960099	-1	no_errors	ENST00000409687	ensembl	human	known	69_37n	missense	74	10.84	9	SNP	1.000	G
SASH1	23328	genome.wustl.edu	37	6	148664318	148664318	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:148664318G>A	ENST00000367467.3	+	1	590	c.115G>A	c.(115-117)Gag>Aag	p.E39K	SASH1_ENST00000367469.1_Intron	NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	39					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		TGGCACATCCGAGGCGTTCTC	0.701																																						dbGAP											0													26.0	33.0	30.0					6																	148664318		2199	4300	6499	-	-	-	SO:0001583	missense	0			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.115G>A	6.37:g.148664318G>A	ENSP00000356437:p.Glu39Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.E39K	ENST00000367467.3	37	c.115	CCDS5212.1	6	.	.	.	.	.	.	.	.	.	.	G	13.79	2.342330	0.41498	.	.	ENSG00000111961	ENST00000367467	T	0.13420	2.59	4.97	4.1	0.47936	.	0.284783	0.31188	N	0.008094	T	0.02494	0.0076	N	0.08118	0	0.32792	N	0.501083	B	0.18310	0.027	B	0.06405	0.002	T	0.28870	-1.0030	10	0.72032	D	0.01	-11.1483	9.3083	0.37889	0.1005:0.0:0.8995:0.0	.	39	O94885	SASH1_HUMAN	K	39	ENSP00000356437:E39K	ENSP00000356437:E39K	E	+	1	0	SASH1	148706011	1.000000	0.71417	0.916000	0.36221	0.043000	0.13939	3.919000	0.56439	1.091000	0.41335	0.305000	0.20034	GAG	SASH1	-	NULL	ENSG00000111961		0.701	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	HGNC	protein_coding	OTTHUMT00000042619.1	44	0.00	0	G	NM_015278		148664318	148664318	+1	no_errors	ENST00000367467	ensembl	human	known	69_37n	missense	33	21.43	9	SNP	0.895	A
SASH1	23328	genome.wustl.edu	37	6	148865467	148865467	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:148865467G>A	ENST00000367467.3	+	18	3336	c.2861G>A	c.(2860-2862)gGa>gAa	p.G954E		NM_015278.3	NP_056093.3	O94885	SASH1_HUMAN	SAM and SH3 domain containing 1	954					positive regulation of angiogenesis (GO:0045766)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of lipopolysaccharide-mediated signaling pathway (GO:0031666)|positive regulation of NIK/NF-kappaB signaling (GO:1901224)|positive regulation of p38MAPK cascade (GO:1900745)|protein polyubiquitination (GO:0000209)|regulation of protein autoubiquitination (GO:1902498)|regulation of protein K63-linked ubiquitination (GO:1900044)	membrane (GO:0016020)|protein complex (GO:0043234)	mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein C-terminus binding (GO:0008022)|protein complex scaffold (GO:0032947)|protein kinase binding (GO:0019901)			breast(4)|central_nervous_system(1)|endometrium(9)|kidney(1)|large_intestine(11)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	52		Ovarian(120;0.0169)		OV - Ovarian serous cystadenocarcinoma(155;5.63e-11)|GBM - Glioblastoma multiforme(68;0.0701)		CACAGAAAAGGACACGAGTTT	0.542																																						dbGAP											0													78.0	79.0	79.0					6																	148865467		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018333	CCDS5212.1	6q24.3	2013-01-10			ENSG00000111961	ENSG00000111961		"""SAM and SH3 domain containing"", ""Sterile alpha motif (SAM) domain containing"""	19182	protein-coding gene	gene with protein product		607955				9872452, 12771949	Standard	NM_015278		Approved	KIAA0790, dJ323M4.1, SH3D6A	uc003qme.1	O94885	OTTHUMG00000015773	ENST00000367467.3:c.2861G>A	6.37:g.148865467G>A	ENSP00000356437:p.Gly954Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5TGN5|Q8TAI0|Q9H7R7	Missense_Mutation	SNP	pfam_rSAM/SH3_domain-containing,pfam_SAM_2,pfam_SAM_type1,pfam_SH3_2,superfamily_SAM/pointed,superfamily_SH3_domain,smart_SH3_domain,smart_SAM,pfscan_SAM	p.G954E	ENST00000367467.3	37	c.2861	CCDS5212.1	6	.	.	.	.	.	.	.	.	.	.	G	12.98	2.099963	0.37048	.	.	ENSG00000111961	ENST00000367467;ENST00000537769	T	0.37584	1.19	5.36	4.43	0.53597	.	0.207171	0.33792	N	0.004553	T	0.20047	0.0482	L	0.29908	0.895	0.37883	D	0.930468	D;P	0.55605	0.972;0.926	P;P	0.48304	0.573;0.454	T	0.03728	-1.1009	10	0.62326	D	0.03	-19.774	8.6103	0.33797	0.0788:0.0:0.7702:0.151	.	935;954	Q6P4R9;O94885	.;SASH1_HUMAN	E	954;364	ENSP00000356437:G954E	ENSP00000356437:G954E	G	+	2	0	SASH1	148907160	0.997000	0.39634	0.956000	0.39512	0.277000	0.26821	2.375000	0.44283	2.511000	0.84671	0.650000	0.86243	GGA	SASH1	-	NULL	ENSG00000111961		0.542	SASH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SASH1	HGNC	protein_coding	OTTHUMT00000042619.1	24	0.00	0	G	NM_015278		148865467	148865467	+1	no_errors	ENST00000367467	ensembl	human	known	69_37n	missense	28	17.65	6	SNP	0.998	A
SBNO2	22904	genome.wustl.edu	37	19	1119982	1119982	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:1119982G>C	ENST00000361757.3	-	12	1427	c.1190C>G	c.(1189-1191)tCc>tGc	p.S397C	SBNO2_ENST00000438103.2_Missense_Mutation_p.S340C|SBNO2_ENST00000587024.1_Missense_Mutation_p.S397C	NM_014963.2	NP_055778.2	Q9Y2G9	SBNO2_HUMAN	strawberry notch homolog 2 (Drosophila)	397					bone mineralization (GO:0030282)|bone trabecula morphogenesis (GO:0061430)|macrophage activation involved in immune response (GO:0002281)|negative regulation of transcription, DNA-templated (GO:0045892)|osteoclast fusion (GO:0072675)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of inflammatory response (GO:0050727)|transcription, DNA-templated (GO:0006351)					NS(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CATCTTGGTGGAGCCGGCATT	0.632																																						dbGAP											0													50.0	54.0	53.0					19																	1119982		2007	4030	6037	-	-	-	SO:0001583	missense	0			AK074102	CCDS45894.1, CCDS45895.1	19p13.3	2008-02-05	2006-10-06	2006-10-06		ENSG00000064932			29158	protein-coding gene	gene with protein product		615729	"""KIAA0963"""	KIAA0963		10231032	Standard	NM_014963		Approved	FLJ00173, Stno, Sno	uc002lrk.4	Q9Y2G9		ENST00000361757.3:c.1190C>G	19.37:g.1119982G>C	ENSP00000354733:p.Ser397Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K8P2|B3KWJ1|O75257|Q3KQX0|Q8TEM0	Missense_Mutation	SNP	NULL	p.S397C	ENST00000361757.3	37	c.1190	CCDS45894.1	19	.	.	.	.	.	.	.	.	.	.	G	15.69	2.906658	0.52333	.	.	ENSG00000064932	ENST00000361757;ENST00000438103;ENST00000250872	D;D	0.93953	-3.32;-3.32	3.91	2.84	0.33178	.	0.186679	0.48767	D	0.000176	D	0.95865	0.8654	M	0.81497	2.545	0.38258	D	0.941793	D;D;D;D	0.76494	0.999;0.971;0.999;0.999	D;P;D;D	0.70227	0.968;0.886;0.954;0.946	D	0.95865	0.8886	10	0.52906	T	0.07	-35.0783	11.3978	0.49851	0.0:0.3537:0.6463:0.0	.	340;397;397;340	B4DL53;B4DV91;Q9Y2G9;Q9Y2G9-3	.;.;SBNO2_HUMAN;.	C	397;340;421	ENSP00000354733:S397C;ENSP00000400762:S340C	ENSP00000250872:S421C	S	-	2	0	SBNO2	1070982	1.000000	0.71417	1.000000	0.80357	0.557000	0.35523	6.299000	0.72770	0.934000	0.37316	0.551000	0.68910	TCC	SBNO2	-	NULL	ENSG00000064932		0.632	SBNO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SBNO2	HGNC	protein_coding	OTTHUMT00000458065.2	47	0.00	0	G	NM_014963		1119982	1119982	-1	no_errors	ENST00000361757	ensembl	human	known	69_37n	missense	72	12.20	10	SNP	1.000	C
SEC22A	26984	genome.wustl.edu	37	3	122928120	122928120	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:122928120C>T	ENST00000309934.4	+	1	952	c.56C>T	c.(55-57)tCt>tTt	p.S19F	SEC22A_ENST00000492595.1_Missense_Mutation_p.S19F|SEC22A_ENST00000477063.1_3'UTR|SEC22A_ENST00000481965.2_Missense_Mutation_p.S19F	NM_012430.4	NP_036562.2	Q96IW7	SC22A_HUMAN	SEC22 vesicle trafficking protein homolog A (S. cerevisiae)	19	Longin. {ECO:0000255|PROSITE- ProRule:PRU00231}.				ER to Golgi vesicle-mediated transport (GO:0006888)|protein transport (GO:0015031)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			NS(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(1)	10				GBM - Glioblastoma multiforme(114;0.0548)		CTGCCACTTTCTGCTTCTACT	0.383																																						dbGAP											0													120.0	110.0	113.0					3																	122928120		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF100749	CCDS3021.1	3q21.1	2006-04-25	2006-04-25	2006-04-25	ENSG00000121542	ENSG00000121542			20260	protein-coding gene	gene with protein product		612442	"""SEC22 vesicle trafficking protein-like 2 (S. cerevisiae)"""	SEC22L2		9094723, 9501016	Standard	NM_012430		Approved		uc003ege.3	Q96IW7	OTTHUMG00000159495	ENST00000309934.4:c.56C>T	3.37:g.122928120C>T	ENSP00000310521:p.Ser19Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE26|Q9Y682	Missense_Mutation	SNP	superfamily_Longin-like_dom,pfscan_Longin_dom	p.S19F	ENST00000309934.4	37	c.56	CCDS3021.1	3	.	.	.	.	.	.	.	.	.	.	C	23.3	4.395654	0.83011	.	.	ENSG00000121542	ENST00000492595;ENST00000473494;ENST00000481965;ENST00000466519;ENST00000480631;ENST00000491366;ENST00000487572;ENST00000309934	T;T;T;T;T;T;T;T	0.24538	1.85;1.85;1.85;1.85;1.85;1.85;1.85;1.85	4.63	4.63	0.57726	Longin (2);Longin-like (1);	0.000000	0.85682	D	0.000000	T	0.55513	0.1925	M	0.82716	2.605	0.80722	D	1	D	0.65815	0.995	D	0.75484	0.986	T	0.62530	-0.6835	10	0.62326	D	0.03	-14.0632	17.6695	0.88212	0.0:1.0:0.0:0.0	.	19	Q96IW7	SC22A_HUMAN	F	19	ENSP00000417972:S19F;ENSP00000420343:S19F;ENSP00000420128:S19F;ENSP00000419039:S19F;ENSP00000420574:S19F;ENSP00000417219:S19F;ENSP00000420015:S19F;ENSP00000310521:S19F	ENSP00000310521:S19F	S	+	2	0	SEC22A	124410810	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.169000	0.77578	2.408000	0.81797	0.650000	0.86243	TCT	SEC22A	-	superfamily_Longin-like_dom,pfscan_Longin_dom	ENSG00000121542		0.383	SEC22A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC22A	HGNC	protein_coding	OTTHUMT00000355770.2	47	0.00	0	C	NM_012430		122928120	122928120	+1	no_errors	ENST00000309934	ensembl	human	known	69_37n	missense	36	30.77	16	SNP	1.000	T
SEC23B	10483	genome.wustl.edu	37	20	18523792	18523792	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:18523792G>A	ENST00000336714.3	+	14	2073	c.1641G>A	c.(1639-1641)tgG>tgA	p.W547*	SEC23B_ENST00000262544.2_Nonsense_Mutation_p.W547*|AL121893.1_ENST00000578930.1_RNA|SEC23B_ENST00000377475.3_Nonsense_Mutation_p.W547*|SEC23B_ENST00000377465.1_Nonsense_Mutation_p.W547*	NM_006363.4|NM_032985.4|NM_032986.3	NP_006354.2|NP_116780.1|NP_116781.1	Q15437	SC23B_HUMAN	Sec23 homolog B (S. cerevisiae)	547					ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|vesicle-mediated transport (GO:0016192)	COPII vesicle coat (GO:0030127)|endomembrane system (GO:0012505)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	32						TGCTCCGGTGGCTGGACCGAC	0.522																																						dbGAP											0													113.0	111.0	112.0					20																	18523792		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			X97065	CCDS13137.1	20p11.23	2010-02-09	2001-11-28		ENSG00000101310	ENSG00000101310			10702	protein-coding gene	gene with protein product		610512	"""Sec23 (S. cerevisiae) homolog B"", ""congenital dyserythropoietic anemia, type II"""	CDAN2		8898360, 10329445, 19621418	Standard	NM_032985		Approved	CDA-II, CDAII, HEMPAS	uc002wrb.2	Q15437	OTTHUMG00000031976	ENST00000336714.3:c.1641G>A	20.37:g.18523792G>A	ENSP00000338844:p.Trp547*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DW33|Q503A9|Q5W183|Q9BS15|Q9BSI2|Q9H1D7	Nonsense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Gelsolin_dom,pfam_Znf_Sec23_Sec24,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.W547*	ENST00000336714.3	37	c.1641	CCDS13137.1	20	.	.	.	.	.	.	.	.	.	.	G	43	10.515172	0.99419	.	.	ENSG00000101310	ENST00000336714;ENST00000262544;ENST00000377475;ENST00000377465;ENST00000422877	.	.	.	4.55	4.55	0.56014	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.0109	16.4889	0.84193	0.0:0.0:1.0:0.0	.	.	.	.	X	547;547;547;547;55	.	ENSP00000262544:W547X	W	+	3	0	SEC23B	18471792	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.623000	0.98386	2.367000	0.80283	0.655000	0.94253	TGG	SEC23B	-	pfam_Sec23/24_helical_dom,superfamily_Sec23/24_helical_dom	ENSG00000101310		0.522	SEC23B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEC23B	HGNC	protein_coding	OTTHUMT00000078184.5	34	0.00	0	G			18523792	18523792	+1	no_errors	ENST00000262544	ensembl	human	known	69_37n	nonsense	53	13.11	8	SNP	1.000	A
SENP7	57337	genome.wustl.edu	37	3	101212728	101212728	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:101212728G>C	ENST00000394095.2	-	3	228	c.175C>G	c.(175-177)Ctc>Gtc	p.L59V	SENP7_ENST00000394091.1_Missense_Mutation_p.L26V|SENP7_ENST00000358203.3_Missense_Mutation_p.L26V|SENP7_ENST00000314261.7_Missense_Mutation_p.L59V|SENP7_ENST00000394094.2_Missense_Mutation_p.L59V|SENP7_ENST00000348610.3_Missense_Mutation_p.L26V	NM_001282802.1|NM_020654.3	NP_001269731.1|NP_065705.3	Q9BQF6	SENP7_HUMAN	SUMO1/sentrin specific peptidase 7	59						intracellular (GO:0005622)|nucleus (GO:0005634)	cysteine-type peptidase activity (GO:0008234)			breast(2)|endometrium(1)|kidney(1)|large_intestine(16)|lung(15)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	44						TGCAAAGGGAGAGTCCAGCGT	0.308																																						dbGAP											0													96.0	90.0	92.0					3																	101212728		2203	4299	6502	-	-	-	SO:0001583	missense	0				CCDS2941.2, CCDS43121.1, CCDS63704.1, CCDS63705.1, CCDS63706.1	3q12	2008-02-05	2005-08-17		ENSG00000138468	ENSG00000138468			30402	protein-coding gene	gene with protein product		612846	"""SUMO1/sentrin specific protease 7"""			11214970, 11230166	Standard	NM_001282802		Approved		uc003dut.3	Q9BQF6	OTTHUMG00000149927	ENST00000394095.2:c.175C>G	3.37:g.101212728G>C	ENSP00000377655:p.Leu59Val	Somatic		WXS	Illumina GAIIx	Phase_IV	A1L3A5|A8MW39|B7WNW8|Q7Z3F4|Q96PS5|Q9C0F6|Q9HBT5	Missense_Mutation	SNP	pfam_Peptidase_C48,pfscan_Peptidase_C48	p.L59V	ENST00000394095.2	37	c.175	CCDS2941.2	3	.	.	.	.	.	.	.	.	.	.	G	0.522	-0.861812	0.02610	.	.	ENSG00000138468	ENST00000394095;ENST00000394094;ENST00000314261;ENST00000394091;ENST00000358203;ENST00000348610	T;T;T;T;T;T	0.21543	2.13;2.08;2.07;2.0;2.0;2.13	4.82	1.99	0.26369	.	0.364252	0.19771	N	0.106429	T	0.08582	0.0213	N	0.08118	0	0.09310	N	0.999992	B;B;B;B	0.09022	0.002;0.002;0.002;0.001	B;B;B;B	0.09377	0.004;0.004;0.004;0.002	T	0.23619	-1.0183	10	0.40728	T	0.16	-0.4897	3.1986	0.06641	0.096:0.1752:0.5475:0.1813	.	26;59;26;59	Q9BQF6-4;Q9BQF6-5;Q9BQF6-2;Q9BQF6	.;.;.;SENP7_HUMAN	V	59;59;59;26;26;26	ENSP00000377655:L59V;ENSP00000377654:L59V;ENSP00000313624:L59V;ENSP00000377651:L26V;ENSP00000350936:L26V;ENSP00000342159:L26V	ENSP00000313624:L59V	L	-	1	0	SENP7	102695418	0.837000	0.29446	0.992000	0.48379	0.440000	0.31957	0.050000	0.14120	0.228000	0.21019	-0.291000	0.09656	CTC	SENP7	-	NULL	ENSG00000138468		0.308	SENP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SENP7	HGNC	protein_coding	OTTHUMT00000313957.2	47	0.00	0	G	NM_020654		101212728	101212728	-1	no_errors	ENST00000394095	ensembl	human	known	69_37n	missense	31	16.22	6	SNP	0.995	C
SEPHS2	22928	genome.wustl.edu	37	16	30456500	30456500	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:30456500C>G	ENST00000478753.2	-	1	1002	c.549G>C	c.(547-549)atG>atC	p.M183I	SEPHS2_ENST00000542752.1_Missense_Mutation_p.M126I|SEPHS2_ENST00000500504.2_Missense_Mutation_p.M183I			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	183					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)			breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						CCTCCTCACTCATACTCTGGC	0.562																																					Esophageal Squamous(81;1142 1261 11202 24614 35697)	dbGAP											0													115.0	111.0	112.0					16																	30456500		2148	4244	6392	-	-	-	SO:0001583	missense	0			BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.549G>C	16.37:g.30456500C>G	ENSP00000418669:p.Met183Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUQ2	Missense_Mutation	SNP	pfam_AIR_synth_C,pfam_AIR_synth,superfamily_AIR_synth_C,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.M126I	ENST00000478753.2	37	c.378		16	.	.	.	.	.	.	.	.	.	.	C	17.91	3.504753	0.64410	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.47528	0.84;0.9;0.85	5.64	5.64	0.86602	PurM, N-terminal-like (1);AIR synthase-related protein (1);	0.039008	0.85682	D	0.000000	T	0.59348	0.2187	L	0.54863	1.705	0.80722	D	1	P;P	0.46220	0.874;0.629	P;P	0.53760	0.734;0.475	T	0.58070	-0.7701	10	0.56958	D	0.05	-15.4533	17.5809	0.87968	0.0:1.0:0.0:0.0	.	183;126	Q99611;F5H8F9	SPS2_HUMAN;.	I	183;126;134;183	ENSP00000418669:M183I;ENSP00000443601:M126I;ENSP00000426234:M183I	ENSP00000390233:M134I	M	-	3	0	SEPHS2	30364001	1.000000	0.71417	0.283000	0.24790	0.613000	0.37349	5.968000	0.70413	2.828000	0.97474	0.655000	0.94253	ATG	SEPHS2	-	pfam_AIR_synth,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	ENSG00000179918		0.562	SEPHS2-001	KNOWN	basic|seleno	protein_coding	SEPHS2	HGNC	protein_coding	OTTHUMT00000109640.11	57	0.00	0	C	NM_012248		30456500	30456500	-1	no_errors	ENST00000542752	ensembl	human	known	69_37n	missense	93	16.96	19	SNP	0.997	G
SERTAD1	29950	genome.wustl.edu	37	19	40928882	40928882	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:40928882G>A	ENST00000357949.4	-	2	730	c.572C>T	c.(571-573)tCt>tTt	p.S191F		NM_013376.3	NP_037508.2	Q9UHV2	SRTD1_HUMAN	SERTA domain containing 1	191					positive regulation of cell proliferation (GO:0008284)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription, DNA-templated (GO:0006351)			p.S191F(1)		endometrium(2)|lung(1)|prostate(1)|skin(1)	5			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAGGCCCTCAGAGGCTGGTGC	0.592																																						dbGAP											1	Substitution - Missense(1)	skin(1)											23.0	20.0	21.0					19																	40928882		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF117959	CCDS12557.1	19q13.1-q13.2	2008-02-05				ENSG00000197019			17932	protein-coding gene	gene with protein product	"""CDK4-binding protein p34SEI"", ""transcriptional regulator interacting with the PHD-bromodomain 1"""					6434876, 10580009	Standard	NM_013376		Approved	SEI1, TRIP-Br1	uc002ont.4	Q9UHV2		ENST00000357949.4:c.572C>T	19.37:g.40928882G>A	ENSP00000350633:p.Ser191Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9BUE7	Missense_Mutation	SNP	pfam_SERTA,pfscan_SERTA	p.S191F	ENST00000357949.4	37	c.572	CCDS12557.1	19	.	.	.	.	.	.	.	.	.	.	G	14.08	2.429073	0.43122	.	.	ENSG00000197019	ENST00000357949	T	0.46451	0.87	3.92	3.92	0.45320	.	0.246265	0.28996	N	0.013471	T	0.28962	0.0719	L	0.29908	0.895	0.34104	D	0.662177	B	0.10296	0.003	B	0.12837	0.008	T	0.35425	-0.9789	10	0.62326	D	0.03	-1.4123	7.7038	0.28638	0.1121:0.0:0.8879:0.0	.	191	Q9UHV2	SRTD1_HUMAN	F	191	ENSP00000350633:S191F	ENSP00000350633:S191F	S	-	2	0	SERTAD1	45620722	0.998000	0.40836	0.989000	0.46669	0.944000	0.59088	2.200000	0.42724	2.494000	0.84150	0.556000	0.70494	TCT	SERTAD1	-	NULL	ENSG00000197019		0.592	SERTAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERTAD1	HGNC	protein_coding	OTTHUMT00000462571.1	63	0.00	0	G	NM_013376		40928882	40928882	-1	no_errors	ENST00000357949	ensembl	human	known	69_37n	missense	71	15.48	13	SNP	1.000	A
SETD2	29072	genome.wustl.edu	37	3	47103760	47103760	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:47103760C>T	ENST00000409792.3	-	14	6228	c.6186G>A	c.(6184-6186)gaG>gaA	p.E2062E	SETD2_ENST00000492397.1_5'UTR	NM_014159.6	NP_054878.5	Q9BYW2	SETD2_HUMAN	SET domain containing 2	2062					angiogenesis (GO:0001525)|cell migration involved in vasculogenesis (GO:0035441)|coronary vasculature morphogenesis (GO:0060977)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic placenta morphogenesis (GO:0060669)|forebrain development (GO:0030900)|histone H3-K36 trimethylation (GO:0097198)|mesoderm morphogenesis (GO:0048332)|mismatch repair (GO:0006298)|morphogenesis of a branching structure (GO:0001763)|neural tube closure (GO:0001843)|nucleosome organization (GO:0034728)|pericardium development (GO:0060039)|regulation of mRNA export from nucleus (GO:0010793)|regulation of transcription, DNA-templated (GO:0006355)|stem cell development (GO:0048864)|transcription elongation from RNA polymerase II promoter (GO:0006368)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)			breast(6)|central_nervous_system(5)|endometrium(4)|kidney(63)|large_intestine(18)|lung(26)|ovary(6)|prostate(2)|skin(3)|soft_tissue(1)|stomach(2)|urinary_tract(5)	141		Acute lymphoblastic leukemia(5;0.0169)		BRCA - Breast invasive adenocarcinoma(193;0.000302)|KIRC - Kidney renal clear cell carcinoma(197;0.00732)|Kidney(197;0.00844)		CTGGGTCTCTCTCTCTTGACC	0.483			"""N, F, S, Mis"""		clear cell renal carcinoma																																	dbGAP		Rec	yes		3	3p21.31	29072	SET domain containing 2		E	0													289.0	290.0	290.0					3																	47103760		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AJ238403	CCDS2749.2	3p21.31	2014-09-17			ENSG00000181555	ENSG00000181555		"""Chromatin-modifying enzymes / K-methyltransferases"""	18420	protein-coding gene	gene with protein product		612778				16118227, 11461154	Standard	NM_014159		Approved	HYPB, HIF-1, KIAA1732, FLJ23184, KMT3A	uc003cqs.3	Q9BYW2	OTTHUMG00000133514	ENST00000409792.3:c.6186G>A	3.37:g.47103760C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	O75397|O75405|Q17RW8|Q5BKS9|Q5QGN2|Q69YI5|Q6IN64|Q6ZN53|Q6ZS25|Q8N3R0|Q8TCN0|Q9C0D1|Q9H696|Q9NZW9	Silent	SNP	pfam_SRI,pfam_SET_dom,pfam_WW_Rsp5_WWP,superfamily_WW_Rsp5_WWP,superfamily_Ferritin/RR-like,smart_AWS,smart_SET_dom,smart_Post-SET_dom,smart_WW_Rsp5_WWP,pfscan_AWS,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_WW_Rsp5_WWP	p.E2062	ENST00000409792.3	37	c.6186	CCDS2749.2	3																																																																																			SETD2	-	NULL	ENSG00000181555		0.483	SETD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD2	HGNC	protein_coding	OTTHUMT00000257479.2	113	0.00	0	C	NM_014159		47103760	47103760	-1	no_errors	ENST00000409792	ensembl	human	known	69_37n	silent	111	11.20	14	SNP	1.000	T
SETD7	80854	genome.wustl.edu	37	4	140444559	140444559	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr4:140444559G>A	ENST00000274031.3	-	5	1229	c.593C>T	c.(592-594)tCa>tTa	p.S198L	SETD7_ENST00000506866.2_Missense_Mutation_p.S198L	NM_030648.2	NP_085151.1	Q8WTS6	SETD7_HUMAN	SET domain containing (lysine methyltransferase) 7	198					chromatin modification (GO:0016568)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|ovary(1)|upper_aerodigestive_tract(1)	8	all_hematologic(180;0.156)					AATGCAAGATGAAGTCGACTT	0.363																																						dbGAP											0													134.0	137.0	136.0					4																	140444559		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB051504	CCDS3748.1	4q31.1	2011-07-01			ENSG00000145391	ENSG00000145391		"""Chromatin-modifying enzymes / K-methyltransferases"""	30412	protein-coding gene	gene with protein product		606594				11850410, 11779497	Standard	NM_030648		Approved	KIAA1717, SET7, SET7/9, Set9, KMT7	uc003ihw.3	Q8WTS6	OTTHUMG00000133385	ENST00000274031.3:c.593C>T	4.37:g.140444559G>A	ENSP00000274031:p.Ser198Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B5WWL3|Q0VAH3|Q4W5A9|Q9C0E6	Missense_Mutation	SNP	pfam_MORN,pfam_SET_dom,smart_SET_dom,pirsf_Hist-Lys_N-MeTrfase_SET,pfscan_SET_dom	p.S198L	ENST00000274031.3	37	c.593	CCDS3748.1	4	.	.	.	.	.	.	.	.	.	.	G	23.0	4.365816	0.82463	.	.	ENSG00000145391	ENST00000506866;ENST00000274031	D;D	0.85013	-1.93;-1.93	5.67	5.67	0.87782	.	0.178722	0.51477	D	0.000088	T	0.79805	0.4509	L	0.33485	1.01	0.80722	D	1	B	0.31680	0.335	B	0.28638	0.092	T	0.76072	-0.3093	10	0.31617	T	0.26	-4.553	19.7714	0.96367	0.0:0.0:1.0:0.0	.	198	Q8WTS6	SETD7_HUMAN	L	198	ENSP00000427300:S198L;ENSP00000274031:S198L	ENSP00000274031:S198L	S	-	2	0	SETD7	140664009	1.000000	0.71417	1.000000	0.80357	0.853000	0.48598	8.599000	0.90856	2.666000	0.90696	0.655000	0.94253	TCA	SETD7	-	pirsf_Hist-Lys_N-MeTrfase_SET	ENSG00000145391		0.363	SETD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD7	HGNC	protein_coding	OTTHUMT00000257236.1	19	0.00	0	G	NM_030648		140444559	140444559	-1	no_errors	ENST00000274031	ensembl	human	known	69_37n	missense	17	29.17	7	SNP	1.000	A
SH3BGRL	6451	genome.wustl.edu	37	X	80532647	80532647	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:80532647C>T	ENST00000373212.5	+	2	468	c.210C>T	c.(208-210)ttC>ttT	p.F70F	SH3BGRL_ENST00000481106.1_3'UTR	NM_003022.2	NP_003013.1	O75368	SH3L1_HUMAN	SH3 domain binding glutamate-rich protein like	70					positive regulation of signal transduction (GO:0009967)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	SH3/SH2 adaptor activity (GO:0005070)			endometrium(1)|lung(2)|ovary(1)	4		all_lung(315;5.94e-05)				CTCAGATTTTCAATGAAAGCC	0.408																																						dbGAP											0													58.0	53.0	55.0					X																	80532647		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF042081	CCDS14449.1	Xq13.3	2014-02-19	2014-02-19		ENSG00000131171	ENSG00000131171			10823	protein-coding gene	gene with protein product		300190	"""SH3 domain binding glutamic acid-rich protein like"""			9642120	Standard	NM_003022		Approved	MGC117402	uc004eef.3	O75368	OTTHUMG00000021910	ENST00000373212.5:c.210C>T	X.37:g.80532647C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q3SYL1|Q5JT50|Q6FIE8|Q9H0N8	Silent	SNP	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	p.F70	ENST00000373212.5	37	c.210	CCDS14449.1	X																																																																																			SH3BGRL	-	pfam_Glut_rich_SH3-bd,superfamily_Thioredoxin-like_fold	ENSG00000131171		0.408	SH3BGRL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BGRL	HGNC	protein_coding	OTTHUMT00000057350.1	45	0.00	0	C	NM_003022		80532647	80532647	+1	no_errors	ENST00000373212	ensembl	human	known	69_37n	silent	58	15.94	11	SNP	1.000	T
SH3BP5	9467	genome.wustl.edu	37	3	15300422	15300422	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:15300422G>A	ENST00000383791.3	-	7	1025	c.805C>T	c.(805-807)Cgg>Tgg	p.R269W	SH3BP5_ENST00000426925.1_Missense_Mutation_p.R112W|SH3BP5_ENST00000408919.3_Missense_Mutation_p.R112W|SH3BP5_ENST00000253688.5_Missense_Mutation_p.R112W|SH3BP5-AS1_ENST00000413977.1_RNA|SH3BP5-AS1_ENST00000420195.1_RNA|SH3BP5-AS1_ENST00000436602.1_RNA	NM_004844.4	NP_004835.2	O60239	3BP5_HUMAN	SH3-domain binding protein 5 (BTK-associated)	269					intracellular signal transduction (GO:0035556)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	protein kinase inhibitor activity (GO:0004860)			NS(1)|endometrium(3)|large_intestine(3)|lung(3)|ovary(1)|prostate(1)	12						CCGCATCCCCGAGGCCCCATG	0.597																																						dbGAP											0													71.0	65.0	67.0					3																	15300422		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB005047	CCDS2625.2, CCDS43055.1	3p24.3	2008-07-10			ENSG00000131370	ENSG00000131370			10827	protein-coding gene	gene with protein product	"""SH3 binding protein"""	605612				9571151, 10339589	Standard	NM_004844		Approved	Sab	uc003bzp.2	O60239	OTTHUMG00000129859	ENST00000383791.3:c.805C>T	3.37:g.15300422G>A	ENSP00000373301:p.Arg269Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQW6|Q5JWV9	Missense_Mutation	SNP	pfam_SH3-bd_5	p.R269W	ENST00000383791.3	37	c.805	CCDS2625.2	3	.	.	.	.	.	.	.	.	.	.	G	23.8	4.460214	0.84317	.	.	ENSG00000131370	ENST00000383791;ENST00000426925;ENST00000253688;ENST00000408919;ENST00000366391	.	.	.	5.32	5.32	0.75619	.	0.109704	0.64402	D	0.000007	T	0.75332	0.3835	M	0.70275	2.135	0.53688	D	0.999978	D	0.76494	0.999	D	0.64595	0.927	T	0.78054	-0.2354	9	0.87932	D	0	-7.913	12.4556	0.55702	0.0:0.0:0.7117:0.2882	.	269	O60239	3BP5_HUMAN	W	269;112;112;112;112	.	ENSP00000253688:R112W	R	-	1	2	SH3BP5	15275426	1.000000	0.71417	0.969000	0.41365	0.929000	0.56500	6.535000	0.73838	2.507000	0.84556	0.505000	0.49811	CGG	SH3BP5	-	pfam_SH3-bd_5	ENSG00000131370		0.597	SH3BP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3BP5	HGNC	protein_coding	OTTHUMT00000340740.2	53	0.00	0	G	NM_004844		15300422	15300422	-1	no_errors	ENST00000383791	ensembl	human	known	69_37n	missense	47	16.07	9	SNP	1.000	A
SI	6476	genome.wustl.edu	37	3	164700809	164700809	+	Missense_Mutation	SNP	A	A	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:164700809A>T	ENST00000264382.3	-	46	5290	c.5228T>A	c.(5227-5229)gTa>gAa	p.V1743E		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	1743	Sucrase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	ATTAAATTGTACAGATAAATA	0.323										HNSCC(35;0.089)																												dbGAP											0													37.0	43.0	41.0					3																	164700809		2197	4299	6496	-	-	-	SO:0001583	missense	0			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.5228T>A	3.37:g.164700809A>T	ENSP00000264382:p.Val1743Glu	Somatic		WXS	Illumina GAIIx	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.V1743E	ENST00000264382.3	37	c.5228	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	A	1.576	-0.532766	0.04112	.	.	ENSG00000090402	ENST00000264382	D	0.89196	-2.48	4.92	-1.5	0.08691	.	1.260090	0.05109	N	0.488471	D	0.88377	0.6420	M	0.83118	2.625	0.09310	N	1	B	0.27823	0.19	B	0.26202	0.067	T	0.71111	-0.4687	10	0.30854	T	0.27	.	8.7025	0.34334	0.5294:0.0:0.4706:0.0	.	1743	P14410	SUIS_HUMAN	E	1743	ENSP00000264382:V1743E	ENSP00000264382:V1743E	V	-	2	0	SI	166183503	0.007000	0.16637	0.011000	0.14972	0.005000	0.04900	-0.014000	0.12656	-0.420000	0.07427	-0.326000	0.08463	GTA	SI	-	NULL	ENSG00000090402		0.323	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	47	0.00	0	A	NM_001041		164700809	164700809	-1	no_errors	ENST00000264382	ensembl	human	known	69_37n	missense	42	22.22	12	SNP	0.027	T
SLC17A6	57084	genome.wustl.edu	37	11	22396411	22396411	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:22396411G>A	ENST00000263160.3	+	9	1589	c.1152G>A	c.(1150-1152)gtG>gtA	p.V384V		NM_020346.2	NP_065079.1	Q9P2U8	VGLU2_HUMAN	solute carrier family 17 (vesicular glutamate transporter), member 6	384					ion transport (GO:0006811)|neurotransmitter uptake (GO:0001504)|sodium ion transport (GO:0006814)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|synaptic vesicle membrane (GO:0030672)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(28)|ovary(3)|skin(4)|upper_aerodigestive_tract(3)	50						CTACGACAGTGAGAAAGATCA	0.363																																						dbGAP											0													202.0	201.0	201.0					11																	22396411		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AB032435	CCDS7856.1	11p14.3	2013-07-18	2013-07-18		ENSG00000091664	ENSG00000091664		"""Solute carriers"""	16703	protein-coding gene	gene with protein product	"""vesicular glutamate transporter 2"", ""differentiation-associated Na-dependent inorganic phosphate cotransporter"""	607563	"""solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6"""			11306821	Standard	NM_020346		Approved	DNPI, VGLUT2	uc001mqk.3	Q9P2U8	OTTHUMG00000166063	ENST00000263160.3:c.1152G>A	11.37:g.22396411G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKS2	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.V384	ENST00000263160.3	37	c.1152	CCDS7856.1	11																																																																																			SLC17A6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	ENSG00000091664		0.363	SLC17A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A6	HGNC	protein_coding	OTTHUMT00000387671.1	56	0.00	0	G	NM_020346		22396411	22396411	+1	no_errors	ENST00000263160	ensembl	human	known	69_37n	silent	44	12.00	6	SNP	0.996	A
SLC2A1	6513	genome.wustl.edu	37	1	43392841	43392841	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:43392841G>A	ENST00000426263.3	-	10	1528	c.1350C>T	c.(1348-1350)ttC>ttT	p.F450F	SLC2A1_ENST00000475162.1_Intron	NM_006516.2	NP_006507.2	P11166	GTR1_HUMAN	solute carrier family 2 (facilitated glucose transporter), member 1	450					carbohydrate metabolic process (GO:0005975)|cellular response to glucose starvation (GO:0042149)|energy reserve metabolic process (GO:0006112)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|L-ascorbic acid metabolic process (GO:0019852)|protein complex assembly (GO:0006461)|regulation of insulin secretion (GO:0050796)|response to osmotic stress (GO:0006970)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|caveola (GO:0005901)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|female pronucleus (GO:0001939)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|midbody (GO:0030496)|plasma membrane (GO:0005886)	D-glucose transmembrane transporter activity (GO:0055056)|dehydroascorbic acid transporter activity (GO:0033300)|glucose transmembrane transporter activity (GO:0005355)|identical protein binding (GO:0042802)|protein self-association (GO:0043621)|xenobiotic transporter activity (GO:0042910)			autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(2)|large_intestine(1)|lung(2)|ovary(1)|pancreas(2)	13	Ovarian(52;0.00579)|all_hematologic(146;0.0977)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0122)			Etomidate(DB00292)	CAGGAACTTTGAAGTAGGTGA	0.532																																						dbGAP											0													80.0	69.0	73.0					1																	43392841		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			K03195	CCDS477.1	1p34.2	2013-05-22			ENSG00000117394	ENSG00000117394		"""Solute carriers"""	11005	protein-coding gene	gene with protein product		138140	"""human T-cell leukemia virus (I and II) receptor"""	GLUT1, GLUT, HTLVR		8839927, 14622599, 18451999	Standard	NM_006516		Approved	DYT18	uc001cik.2	P11166	OTTHUMG00000007657	ENST00000426263.3:c.1350C>T	1.37:g.43392841G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9S6|B2R620|D3DPX0|O75535|Q147X2	Silent	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,prints_Sugar/inositol_transpt,prints_Glu_transpt_1,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	p.F450	ENST00000426263.3	37	c.1350	CCDS477.1	1																																																																																			SLC2A1	-	pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Sugar/inositol_transpt	ENSG00000117394		0.532	SLC2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC2A1	HGNC	protein_coding	OTTHUMT00000020358.2	65	0.00	0	G	NM_006516		43392841	43392841	-1	no_errors	ENST00000426263	ensembl	human	known	69_37n	silent	57	13.64	9	SNP	1.000	A
SLC30A4	7782	genome.wustl.edu	37	15	45783004	45783004	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:45783004C>G	ENST00000261867.4	-	4	928	c.614G>C	c.(613-615)aGa>aCa	p.R205T	RP11-519G16.3_ENST00000558536.1_RNA|snoU13_ENST00000459592.1_RNA|RP11-519G16.3_ENST00000560647.1_RNA	NM_013309.4	NP_037441.2	O14863	ZNT4_HUMAN	solute carrier family 30 (zinc transporter), member 4	205					regulation of sequestering of zinc ion (GO:0061088)|response to toxic substance (GO:0009636)|zinc ion homeostasis (GO:0055069)|zinc ion transmembrane transport (GO:0071577)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(3)|large_intestine(2)|lung(8)|prostate(1)|stomach(1)	15		Lung NSC(122;3.55e-06)|all_lung(180;2.56e-05)|Melanoma(134;0.027)		all cancers(107;1.58e-16)|GBM - Glioblastoma multiforme(94;2.15e-06)		ATGGATAGTTCTTTGCACAGC	0.348																																						dbGAP											0													104.0	102.0	103.0					15																	45783004		2198	4297	6495	-	-	-	SO:0001583	missense	0				CCDS10125.1	15q21.1	2013-05-22			ENSG00000104154	ENSG00000104154		"""Solute carriers"""	11015	protein-coding gene	gene with protein product		602095		ZNT4			Standard	NM_013309		Approved		uc001zvj.3	O14863	OTTHUMG00000131439	ENST00000261867.4:c.614G>C	15.37:g.45783004C>G	ENSP00000261867:p.Arg205Thr	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8TC39	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.R205T	ENST00000261867.4	37	c.614	CCDS10125.1	15	.	.	.	.	.	.	.	.	.	.	C	27.7	4.857119	0.91433	.	.	ENSG00000104154	ENST00000261867	T	0.68624	-0.34	5.71	5.71	0.89125	.	0.087492	0.85682	D	0.000000	D	0.87807	0.6270	H	0.95745	3.715	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.90909	0.4774	10	0.87932	D	0	-22.9185	18.4966	0.90867	0.0:1.0:0.0:0.0	.	205	O14863	ZNT4_HUMAN	T	205	ENSP00000261867:R205T	ENSP00000261867:R205T	R	-	2	0	SLC30A4	43570296	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.123000	0.77176	2.697000	0.92050	0.580000	0.79431	AGA	SLC30A4	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000104154		0.348	SLC30A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A4	HGNC	protein_coding	OTTHUMT00000254236.1	37	0.00	0	C			45783004	45783004	-1	no_errors	ENST00000261867	ensembl	human	known	69_37n	missense	41	12.77	6	SNP	1.000	G
SLC30A5	64924	genome.wustl.edu	37	5	68419223	68419223	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:68419223G>A	ENST00000396591.3	+	14	2579	c.1969G>A	c.(1969-1971)Gaa>Aaa	p.E657K	CTC-498J12.3_ENST00000504129.1_RNA	NM_022902.4	NP_075053.2	Q8TAD4	ZNT5_HUMAN	solute carrier family 30 (zinc transporter), member 5	657					cellular protein metabolic process (GO:0044267)|cellular zinc ion homeostasis (GO:0006882)|cobalt ion transport (GO:0006824)|regulation of proton transport (GO:0010155)|response to zinc ion (GO:0010043)|transmembrane transport (GO:0055085)|zinc ion transmembrane transport (GO:0071577)|zinc ion transport (GO:0006829)	apical plasma membrane (GO:0016324)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|secretory granule (GO:0030141)|secretory granule membrane (GO:0030667)	zinc ion binding (GO:0008270)|zinc ion transmembrane transporter activity (GO:0005385)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	25		Lung NSC(167;0.000986)|Prostate(74;0.00809)|Colorectal(97;0.0508)|Ovarian(174;0.16)		OV - Ovarian serous cystadenocarcinoma(47;1.24e-56)|Epithelial(20;1.12e-52)|all cancers(19;2.63e-48)|Lung(70;0.0177)		ACCAGAATATGAAAAAGAACT	0.333																																						dbGAP											0													72.0	76.0	75.0					5																	68419223		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF212235	CCDS3996.1, CCDS34173.1, CCDS58955.1	5q13.1	2013-05-22			ENSG00000145740	ENSG00000145740		"""Solute carriers"""	19089	protein-coding gene	gene with protein product		607819				11937503, 11904301	Standard	NM_022902		Approved	ZTL1, ZnT-5, FLJ12496, FLJ12756, ZNT5, MGC5499, ZNTL1	uc003jvh.3	Q8TAD4	OTTHUMG00000131253	ENST00000396591.3:c.1969G>A	5.37:g.68419223G>A	ENSP00000379836:p.Glu657Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZM89|Q6UX54|Q7L4M4|Q8TDG3|Q9BVY8|Q9H9H1	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.E657K	ENST00000396591.3	37	c.1969	CCDS3996.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.122936|5.122936	0.94429|0.94429	.|.	.|.	ENSG00000145740|ENSG00000145740	ENST00000396591;ENST00000438236|ENST00000511158	T|.	0.62941|.	-0.01|.	5.11|5.11	5.11|5.11	0.69529|0.69529	.|.	0.092418|.	0.64402|.	D|.	0.000001|.	T|T	0.72153|0.72153	0.3425|0.3425	L|L	0.58428|0.58428	1.81|1.81	0.80722|0.80722	D|D	1|1	B;P;B|.	0.42078|.	0.256;0.77;0.168|.	B;B;B|.	0.39876|.	0.312;0.216;0.143|.	T|T	0.69658|0.69658	-0.5086|-0.5086	10|5	0.59425|.	D|.	0.04|.	-1.3395|-1.3395	18.3235|18.3235	0.90246|0.90246	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	486;486;657|.	Q9H9X0;Q8TAD4-2;Q8TAD4|.	.;.;ZNT5_HUMAN|.	K|I	657;252|18	ENSP00000379836:E657K|.	ENSP00000379836:E657K|.	E|M	+|+	1|3	0|0	SLC30A5|SLC30A5	68454979|68454979	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.986000|0.986000	0.74619|0.74619	9.318000|9.318000	0.96334|0.96334	2.654000|2.654000	0.90174|0.90174	0.650000|0.650000	0.86243|0.86243	GAA|ATG	SLC30A5	-	pfam_Cation_efflux,tigrfam_Cation_efflux	ENSG00000145740		0.333	SLC30A5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A5	HGNC	protein_coding	OTTHUMT00000254017.2	28	0.00	0	G			68419223	68419223	+1	no_errors	ENST00000396591	ensembl	human	known	69_37n	missense	50	13.79	8	SNP	1.000	A
SLC35B2	347734	genome.wustl.edu	37	6	44224149	44224149	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:44224149C>T	ENST00000393812.3	-	3	433	c.290G>A	c.(289-291)cGa>cAa	p.R97Q	SLC35B2_ENST00000495706.1_5'UTR|SLC35B2_ENST00000537814.1_Intron|SLC35B2_ENST00000393810.1_Intron|MIR4647_ENST00000583964.1_RNA|SLC35B2_ENST00000538577.1_Intron	NM_178148.2	NP_835361.1	Q8TB61	S35B2_HUMAN	solute carrier family 35 (adenosine 3'-phospho 5'-phosphosulfate transporter), member B2	97					3'-phospho-5'-adenylyl sulfate transmembrane transport (GO:1902559)|3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|3'-phosphoadenosine 5'-phosphosulfate transport (GO:0046963)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|xenobiotic metabolic process (GO:0006805)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	3'-phosphoadenosine 5'-phosphosulfate transmembrane transporter activity (GO:0046964)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|kidney(3)|large_intestine(2)|lung(4)|ovary(2)|urinary_tract(1)	15	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			CGCCTCTGTTCGGGGCGCCAG	0.612																																						dbGAP											0													56.0	64.0	61.0					6																	44224149		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK075456	CCDS34462.1, CCDS69127.1, CCDS75462.1, CCDS75463.1	6p12.1-p11.21	2013-07-17	2013-07-17		ENSG00000157593	ENSG00000157593		"""Solute carriers"""	16872	protein-coding gene	gene with protein product		610788	"""solute carrier family 35, member B2"""				Standard	NM_001286517		Approved	UGTrel4	uc003oxd.3	Q8TB61	OTTHUMG00000014760	ENST00000393812.3:c.290G>A	6.37:g.44224149C>T	ENSP00000377401:p.Arg97Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DDU9|F5H7Y9|Q2VY06|Q53GA3|Q5T9W1|Q5T9W2|Q7Z2G3|Q8NBK6|Q96AR6	Missense_Mutation	SNP	pfam_UAA,pfam_DMT	p.R97Q	ENST00000393812.3	37	c.290	CCDS34462.1	6	.	.	.	.	.	.	.	.	.	.	c	15.94	2.980825	0.53827	.	.	ENSG00000157593	ENST00000393812;ENST00000341553	T	0.30714	1.52	4.26	4.26	0.50523	.	0.062950	0.64402	D	0.000010	T	0.12518	0.0304	L	0.34521	1.04	0.80722	D	1	B	0.31893	0.345	B	0.21360	0.034	T	0.04481	-1.0948	10	0.37606	T	0.19	-7.9371	16.8933	0.86093	0.0:1.0:0.0:0.0	.	97	Q8TB61	S35B2_HUMAN	Q	97	ENSP00000377401:R97Q	ENSP00000342455:R97Q	R	-	2	0	SLC35B2	44332127	0.994000	0.37717	0.407000	0.26434	0.738000	0.42128	5.490000	0.66881	2.191000	0.70037	0.561000	0.74099	CGA	SLC35B2	-	NULL	ENSG00000157593		0.612	SLC35B2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35B2	HGNC	protein_coding	OTTHUMT00000040724.2	55	0.00	0	C			44224149	44224149	-1	no_errors	ENST00000393812	ensembl	human	known	69_37n	missense	68	11.69	9	SNP	0.529	T
SLC35A1	10559	genome.wustl.edu	37	6	88221297	88221297	+	3'UTR	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:88221297G>A	ENST00000369552.4	+	0	1094				C6orf165_ENST00000506888.1_3'UTR|SLC35A1_ENST00000464978.1_3'UTR|SLC35A1_ENST00000544441.1_3'UTR|SLC35A1_ENST00000369556.3_3'UTR	NM_006416.4	NP_006407.1	P78382	S35A1_HUMAN	solute carrier family 35 (CMP-sialic acid transporter), member A1						carbohydrate metabolic process (GO:0005975)|cellular protein modification process (GO:0006464)|CMP-N-acetylneuraminate transport (GO:0015782)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	CMP-N-acetylneuraminate transmembrane transporter activity (GO:0005456)|sugar:proton symporter activity (GO:0005351)			breast(1)|kidney(3)|large_intestine(2)|lung(3)	9		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		CATTAAACTAGAGCCTTAAGT	0.373																																					NSCLC(183;214 2117 17033 22638 44782)|Ovarian(87;1008 1343 9644 42916 50932)	dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			D87969	CCDS5010.1, CCDS55043.1	6q15	2013-05-22			ENSG00000164414	ENSG00000164414		"""Solute carriers"""	11021	protein-coding gene	gene with protein product		605634	"""solute carrier family 35 (UDP-galactose transporter), member 1"""			9010752, 9644260	Standard	NM_006416		Approved	CMPST, hCST	uc011dzj.2	P78382	OTTHUMG00000015177	ENST00000369552.4:c.*53G>A	6.37:g.88221297G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5W1L8	RNA	SNP	-	NULL	ENST00000369552.4	37	NULL	CCDS5010.1	6																																																																																			SLC35A1	-	-	ENSG00000164414		0.373	SLC35A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC35A1	HGNC	protein_coding	OTTHUMT00000041446.1	34	0.00	0	G			88221297	88221297	+1	no_errors	ENST00000464978	ensembl	human	known	69_37n	rna	46	14.81	8	SNP	1.000	A
SLC39A12	221074	genome.wustl.edu	37	10	18284605	18284605	+	Missense_Mutation	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:18284605G>T	ENST00000377369.2	+	10	1827	c.1554G>T	c.(1552-1554)caG>caT	p.Q518H	SLC39A12_ENST00000377371.3_Missense_Mutation_p.Q517H|SLC39A12_ENST00000377374.4_Missense_Mutation_p.Q481H|SLC39A12_ENST00000539911.1_Missense_Mutation_p.Q384H	NM_001145195.1|NM_001282733.1|NM_001282734.1	NP_001138667.1|NP_001269662.1|NP_001269663.1	Q504Y0	S39AC_HUMAN	solute carrier family 39 (zinc transporter), member 12	518					regulation of microtubule polymerization (GO:0031113)|regulation of neuron projection development (GO:0010975)|signal transduction (GO:0007165)|zinc ion transmembrane import (GO:0071578)	integral component of membrane (GO:0016021)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	zinc ion transmembrane transporter activity (GO:0005385)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(5)|lung(38)|ovary(3)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	60						AAGATTCACAGGCAGCTGAAA	0.348																																						dbGAP											0													51.0	58.0	56.0					10																	18284605		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7124.1, CCDS44362.1, CCDS60493.1, CCDS60494.1	10p12.33	2013-05-22			ENSG00000148482	ENSG00000148482		"""Solute carriers"""	20860	protein-coding gene	gene with protein product		608734	"""solute carrier family 39 (metal ion transporter), member 12"""			12659941	Standard	NM_152725		Approved	FLJ30499	uc001ipo.2	Q504Y0	OTTHUMG00000017759	ENST00000377369.2:c.1554G>T	10.37:g.18284605G>T	ENSP00000366586:p.Gln518His	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZL35|C9JJL4|Q49AN8|Q4G0L3|Q5VWV8|Q5VWV9|Q6NZY5|Q96NN4	Missense_Mutation	SNP	pfam_ZIP	p.Q518H	ENST00000377369.2	37	c.1554	CCDS44362.1	10	.	.	.	.	.	.	.	.	.	.	G	16.35	3.098858	0.56183	.	.	ENSG00000148482	ENST00000377369;ENST00000377374;ENST00000377371;ENST00000539911;ENST00000425219	T;T;T;T	0.46451	0.87;0.87;0.87;0.87	4.65	0.464	0.16706	.	2.030910	0.01749	N	0.029797	T	0.45994	0.1370	L	0.33245	0.995	0.29332	N	0.866641	D;P;D	0.61080	0.98;0.951;0.989	P;P;P	0.56343	0.735;0.796;0.735	T	0.33240	-0.9876	10	0.40728	T	0.16	-12.8513	5.3352	0.15953	0.2681:0.1498:0.5821:0.0	.	517;518;481	Q504Y0-4;Q504Y0;Q504Y0-3	.;S39AC_HUMAN;.	H	518;481;517;384;438	ENSP00000366586:Q518H;ENSP00000366591:Q481H;ENSP00000366588:Q517H;ENSP00000440445:Q384H	ENSP00000366586:Q518H	Q	+	3	2	SLC39A12	18324611	0.751000	0.28327	0.999000	0.59377	0.981000	0.71138	0.423000	0.21313	0.300000	0.22699	0.650000	0.86243	CAG	SLC39A12	-	pfam_ZIP	ENSG00000148482		0.348	SLC39A12-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLC39A12	HGNC	protein_coding		35	0.00	0	G	NM_152725		18284605	18284605	+1	no_errors	ENST00000377369	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	0.987	T
SLC7A8	23428	genome.wustl.edu	37	14	23607216	23607216	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:23607216G>C	ENST00000316902.7	-	7	1655	c.930C>G	c.(928-930)ctC>ctG	p.L310L	SLC7A8_ENST00000453702.1_Silent_p.L107L|SLC7A8_ENST00000422941.2_Silent_p.L86L|SLC7A8_ENST00000532568.1_5'Flank|SLC7A8_ENST00000469263.1_Intron|SLC7A8_ENST00000529705.2_Silent_p.L205L	NM_012244.3	NP_036376.2	Q9UHI5	LAT2_HUMAN	solute carrier family 7 (amino acid transporter light chain, L system), member 8	310					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|leukocyte migration (GO:0050900)|metal ion homeostasis (GO:0055065)|neutral amino acid transport (GO:0015804)|organic cation transport (GO:0015695)|response to toxic substance (GO:0009636)|toxin transport (GO:1901998)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-amino acid transmembrane transporter activity (GO:0015179)|neutral amino acid transmembrane transporter activity (GO:0015175)|organic cation transmembrane transporter activity (GO:0015101)|peptide antigen binding (GO:0042605)|toxin transporter activity (GO:0019534)			autonomic_ganglia(1)|endometrium(6)|kidney(4)|large_intestine(6)|lung(5)|ovary(1)|skin(1)	24	all_cancers(95;4.6e-05)			GBM - Glioblastoma multiforme(265;0.00809)	L-Alanine(DB00160)|L-DOPA(DB01235)|L-Glutamine(DB00130)|L-Phenylalanine(DB00120)	TGACTCCTAGGAGCTTCTCTC	0.547																																						dbGAP											0													95.0	89.0	91.0					14																	23607216		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y18483	CCDS9590.1, CCDS41924.1, CCDS58304.1, CCDS58305.1	14q11.2	2013-05-22	2011-07-12		ENSG00000092068	ENSG00000092068		"""Solute carriers"""	11066	protein-coding gene	gene with protein product		604235				10080183, 10391915	Standard	NM_001267036		Approved	LPI-PC1, LAT2	uc001wiz.4	Q9UHI5	OTTHUMG00000028720	ENST00000316902.7:c.930C>G	14.37:g.23607216G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R8Q4|B4DKT4|B4DTV6|D3DS46|F2Z2J4|Q86U05|Q9UKQ6|Q9UKQ7|Q9UKQ8|Q9Y445	Silent	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	p.L310	ENST00000316902.7	37	c.930	CCDS9590.1	14																																																																																			SLC7A8	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1,tigrfam_L_AA_transporter	ENSG00000092068		0.547	SLC7A8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A8	HGNC	protein_coding	OTTHUMT00000071718.3	25	0.00	0	G			23607216	23607216	-1	no_errors	ENST00000316902	ensembl	human	known	69_37n	silent	16	27.27	6	SNP	0.993	C
SLITRK1	114798	genome.wustl.edu	37	13	84453559	84453559	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:84453559G>A	ENST00000377084.2	-	1	2969	c.2084C>T	c.(2083-2085)tCa>tTa	p.S695L		NM_001281503.1|NM_052910.1	NP_001268432.1|NP_443142.1	Q96PX8	SLIK1_HUMAN	SLIT and NTRK-like family, member 1	695					adult behavior (GO:0030534)|axonogenesis (GO:0007409)|homeostatic process (GO:0042592)|multicellular organism growth (GO:0035264)	integral component of membrane (GO:0016021)				NS(2)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|liver(1)|lung(36)|ovary(4)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	80	Medulloblastoma(90;0.18)	Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.07)		GTCTTAGTCTGAGAGCGAGTG	0.587																																						dbGAP											0													44.0	44.0	44.0					13																	84453559		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB067497	CCDS9464.1	13q31.1	2004-01-08	2004-01-08		ENSG00000178235	ENSG00000178235			20297	protein-coding gene	gene with protein product		609678	"""leucine rich repeat containing 12"""	LRRC12		14557068, 12975309	Standard	NM_001281503		Approved	KIAA1910	uc001vlk.3	Q96PX8	OTTHUMG00000017149	ENST00000377084.2:c.2084C>T	13.37:g.84453559G>A	ENSP00000366288:p.Ser695Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5U5I6|Q96SF9	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.S695L	ENST00000377084.2	37	c.2084	CCDS9464.1	13	.	.	.	.	.	.	.	.	.	.	G	18.64	3.667527	0.67814	.	.	ENSG00000178235	ENST00000377084	T	0.59224	0.28	4.98	4.98	0.66077	.	0.082046	0.51477	D	0.000082	T	0.40398	0.1115	N	0.08118	0	0.54753	D	0.999988	B	0.25667	0.131	B	0.22386	0.039	T	0.38693	-0.9649	10	0.59425	D	0.04	-4.5072	17.3561	0.87336	0.0:0.0:1.0:0.0	.	695	Q96PX8	SLIK1_HUMAN	L	695	ENSP00000366288:S695L	ENSP00000366288:S695L	S	-	2	0	SLITRK1	83351560	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	6.228000	0.72288	2.756000	0.94617	0.655000	0.94253	TCA	SLITRK1	-	NULL	ENSG00000178235		0.587	SLITRK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLITRK1	HGNC	protein_coding	OTTHUMT00000045396.1	40	0.00	0	G	NM_052910		84453559	84453559	-1	no_errors	ENST00000377084	ensembl	human	known	69_37n	missense	28	12.50	4	SNP	1.000	A
SMARCC1	6599	genome.wustl.edu	37	3	47629740	47629740	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:47629740G>C	ENST00000254480.5	-	28	3396	c.3277C>G	c.(3277-3279)Ccg>Gcg	p.P1093A	SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1	1093	Pro-rich.				ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		GCAGGAGGCGGAGGGACCCCA	0.597																																						dbGAP											0													56.0	60.0	59.0					3																	47629740		2203	4300	6503	-	-	-	SO:0001583	missense	0			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.3277C>G	3.37:g.47629740G>C	ENSP00000254480:p.Pro1093Ala	Somatic		WXS	Illumina GAIIx	Phase_IV	Q17RS0|Q6P172|Q8IWH2	Missense_Mutation	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,superfamily_BRCT_dom,smart_Chromo_domain/shadow,smart_SANT/Myb,pfscan_SWIRM,pfscan_Myb-like_dom	p.P1093A	ENST00000254480.5	37	c.3277	CCDS2758.1	3	.	.	.	.	.	.	.	.	.	.	G	8.309	0.821619	0.16678	.	.	ENSG00000173473	ENST00000254480	T	0.47177	0.85	5.77	5.77	0.91146	.	0.341140	0.27240	N	0.020261	T	0.33962	0.0881	N	0.14661	0.345	0.40935	D	0.984429	B	0.26876	0.162	B	0.26310	0.068	T	0.18429	-1.0337	10	0.48119	T	0.1	-10.8037	15.4916	0.75611	0.0:0.0:1.0:0.0	.	1093	Q92922	SMRC1_HUMAN	A	1093	ENSP00000254480:P1093A	ENSP00000254480:P1093A	P	-	1	0	SMARCC1	47604744	1.000000	0.71417	0.998000	0.56505	0.933000	0.57130	4.019000	0.57181	2.723000	0.93209	0.655000	0.94253	CCG	SMARCC1	-	NULL	ENSG00000173473		0.597	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	68	0.00	0	G			47629740	47629740	-1	no_errors	ENST00000254480	ensembl	human	known	69_37n	missense	84	14.29	14	SNP	1.000	C
SMG5	23381	genome.wustl.edu	37	1	156235970	156235970	+	Nonsense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:156235970G>C	ENST00000361813.5	-	12	1601	c.1457C>G	c.(1456-1458)tCa>tGa	p.S486*	SMG5_ENST00000489907.2_5'UTR|SMG5_ENST00000368267.5_Intron	NM_015327.2	NP_056142.2	Q9UPR3	SMG5_HUMAN	SMG5 nonsense mediated mRNA decay factor	486					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	protein phosphatase 2A binding (GO:0051721)			NS(1)|breast(3)|endometrium(8)|kidney(2)|large_intestine(7)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	48	Hepatocellular(266;0.158)					GGCCCGGGCTGAGTCATGGCT	0.567																																						dbGAP											0													79.0	76.0	77.0					1																	156235970		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB029012	CCDS1137.1	1q21	2013-07-02	2013-07-02		ENSG00000198952	ENSG00000198952			24644	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog B (S. cerevisiae)"""	610962	"""smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans)"""			12676087, 12699629	Standard	NM_015327		Approved	KIAA1089, LPTS-RP1, LPTSRP1, RP11-54H19.7, SMG-5, EST1B	uc001foc.4	Q9UPR3	OTTHUMG00000017491	ENST00000361813.5:c.1457C>G	1.37:g.156235970G>C	ENSP00000355261:p.Ser486*	Somatic		WXS	Illumina GAIIx	Phase_IV	D3DVB7|Q5QJE7|Q659C7|Q8IXC0|Q8IY09|Q96IJ7	Nonsense_Mutation	SNP	pfam_EST1,smart_PINc_nuc-bd	p.S486*	ENST00000361813.5	37	c.1457	CCDS1137.1	1	.	.	.	.	.	.	.	.	.	.	G	37	6.372519	0.97515	.	.	ENSG00000198952	ENST00000361813	.	.	.	4.99	4.99	0.66335	.	0.423794	0.23807	N	0.044364	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-6.8933	17.0102	0.86404	0.0:0.0:1.0:0.0	.	.	.	.	X	486	.	ENSP00000355261:S486X	S	-	2	0	SMG5	154502594	1.000000	0.71417	0.961000	0.40146	0.986000	0.74619	4.292000	0.59031	2.576000	0.86940	0.655000	0.94253	TCA	SMG5	-	NULL	ENSG00000198952		0.567	SMG5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG5	HGNC	protein_coding	OTTHUMT00000046308.1	56	0.00	0	G	NM_015327		156235970	156235970	-1	no_errors	ENST00000361813	ensembl	human	known	69_37n	nonsense	85	18.27	19	SNP	0.995	C
SNAI3	333929	genome.wustl.edu	37	16	88747983	88747983	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:88747983G>C	ENST00000332281.5	-	2	302	c.216C>G	c.(214-216)ctC>ctG	p.L72L	SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	72					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		TCCGTGGCAGGAGGGGCAGGG	0.706																																					Colon(27;366 710 19748 23199 27567)	dbGAP											0													17.0	22.0	20.0					16																	88747983		2193	4290	6483	-	-	-	SO:0001819	synonymous_variant	0			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.216C>G	16.37:g.88747983G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SU5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L72	ENST00000332281.5	37	c.216	CCDS32505.1	16																																																																																			SNAI3	-	NULL	ENSG00000185669		0.706	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3	HGNC	protein_coding	OTTHUMT00000422582.1	43	0.00	0	G			88747983	88747983	-1	no_errors	ENST00000332281	ensembl	human	known	69_37n	silent	61	28.24	24	SNP	0.867	C
SNAI3	333929	genome.wustl.edu	37	16	88748011	88748011	+	Missense_Mutation	SNP	G	G	C	rs570395342		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:88748011G>C	ENST00000332281.5	-	2	274	c.188C>G	c.(187-189)tCg>tGg	p.S63W	SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	63					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		GGCGACGGCCGAGGAGCGGTC	0.711																																					Colon(27;366 710 19748 23199 27567)	dbGAP											0													13.0	17.0	15.0					16																	88748011		2188	4276	6464	-	-	-	SO:0001583	missense	0			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.188C>G	16.37:g.88748011G>C	ENSP00000327968:p.Ser63Trp	Somatic		WXS	Illumina GAIIx	Phase_IV	Q86SU5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S63W	ENST00000332281.5	37	c.188	CCDS32505.1	16	.	.	.	.	.	.	.	.	.	.	G	18.55	3.648338	0.67358	.	.	ENSG00000185669	ENST00000332281	T	0.11385	2.78	4.15	4.15	0.48705	.	0.582194	0.16784	N	0.199667	T	0.25717	0.0626	M	0.62723	1.935	0.29430	N	0.859947	D	0.69078	0.997	P	0.58873	0.847	T	0.02844	-1.1103	10	0.62326	D	0.03	-6.1356	13.7183	0.62712	0.0:0.0:1.0:0.0	.	63	Q3KNW1	SNAI3_HUMAN	W	63	ENSP00000327968:S63W	ENSP00000327968:S63W	S	-	2	0	SNAI3	87275512	0.962000	0.33011	0.007000	0.13788	0.001000	0.01503	4.636000	0.61339	2.042000	0.60477	0.561000	0.74099	TCG	SNAI3	-	NULL	ENSG00000185669		0.711	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3	HGNC	protein_coding	OTTHUMT00000422582.1	38	0.00	0	G			88748011	88748011	-1	no_errors	ENST00000332281	ensembl	human	known	69_37n	missense	35	37.50	21	SNP	0.195	C
SPINK1	6690	genome.wustl.edu	37	5	147204248	147204248	+	Silent	SNP	G	G	A	rs543864495	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:147204248G>A	ENST00000296695.5	-	4	424	c.216C>T	c.(214-216)ctC>ctT	p.L72L		NM_003122.3	NP_003113.2	P00995	ISK1_HUMAN	serine peptidase inhibitor, Kazal type 1	72	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				negative regulation of calcium ion import (GO:0090281)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of peptidyl-tyrosine phosphorylation (GO:0050732)|negative regulation of serine-type endopeptidase activity (GO:1900004)|regulation of acrosome reaction (GO:0060046)|regulation of store-operated calcium entry (GO:2001256)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			endometrium(1)|skin(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ATTTTTGAATGAGGATAGAAG	0.403									Hereditary Pancreatitis				G|||	2	0.000399361	0.0	0.0	5008	,	,		16933	0.0		0.0	False		,,,				2504	0.002					dbGAP											0													67.0	69.0	68.0					5																	147204248		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0	Familial Cancer Database			CCDS4286.1	5q32	2011-08-31	2005-08-17		ENSG00000164266	ENSG00000164266		"""Serine peptidase inhibitors, Kazal type"""	11244	protein-coding gene	gene with protein product		167790	"""serine protease inhibitor, Kazal type 1"""				Standard	XM_005268501		Approved	Spink3, PCTT, PSTI, TATI	uc003los.2	P00995	OTTHUMG00000129730	ENST00000296695.5:c.216C>T	5.37:g.147204248G>A		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal,prints_Prot_inh_Kazal-m	p.L72	ENST00000296695.5	37	c.216	CCDS4286.1	5																																																																																			SPINK1	-	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal	ENSG00000164266		0.403	SPINK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPINK1	HGNC	protein_coding	OTTHUMT00000251940.2	12	0.00	0	G	NM_003122		147204248	147204248	-1	no_errors	ENST00000296695	ensembl	human	known	69_37n	silent	17	19.05	4	SNP	0.916	A
SRSF2	6427	genome.wustl.edu	37	17	74733140	74733140	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:74733140C>G	ENST00000392485.2	-	1	275	c.103G>C	c.(103-105)Gag>Cag	p.E35Q	MFSD11_ENST00000591864.1_5'UTR|MFSD11_ENST00000586622.1_5'UTR|MIR636_ENST00000384825.1_RNA|MFSD11_ENST00000355954.3_5'Flank|SRSF2_ENST00000508921.3_Missense_Mutation_p.E35Q|MFSD11_ENST00000590393.1_5'Flank|MFSD11_ENST00000588460.1_5'UTR|MFSD11_ENST00000336509.4_5'Flank|MFSD11_ENST00000593181.1_5'Flank|SRSF2_ENST00000359995.5_Missense_Mutation_p.E35Q|RP11-318A15.7_ENST00000587459.1_Intron|MFSD11_ENST00000590514.1_5'Flank	NM_003016.4	NP_003007.2	Q01130	SRSF2_HUMAN	serine/arginine-rich splicing factor 2	35	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA biosynthetic process (GO:2001141)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|transcription corepressor activity (GO:0003714)			haematopoietic_and_lymphoid_tissue(320)|kidney(2)|large_intestine(1)|lung(4)|prostate(2)	329						CCGTACTTCTCGAAGACGCGC	0.667			Mis		"""MDS, CLL"""																																	dbGAP		Dom	yes		17	17q25	6427	serine/arginine-rich splicing factor 2		L	0													23.0	26.0	25.0					17																	74733140		2202	4299	6501	-	-	-	SO:0001583	missense	0			M90104	CCDS11749.1	17q25.2	2014-09-17	2010-06-22	2010-06-22	ENSG00000161547	ENSG00000161547		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10783	protein-coding gene	gene with protein product	"""SR splicing factor 2"""	600813	"""splicing factor, arginine/serine-rich 2"""	SFRS2		8530103, 20516191	Standard	NM_003016		Approved	SC-35, SC35, PR264, SFRS2A	uc002jsv.3	Q01130		ENST00000392485.2:c.103G>C	17.37:g.74733140C>G	ENSP00000376276:p.Glu35Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KWD5|B4DN89|H0YG49	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.E35Q	ENST00000392485.2	37	c.103	CCDS11749.1	17	.	.	.	.	.	.	.	.	.	.	C	19.33	3.806523	0.70682	.	.	ENSG00000161547	ENST00000452355;ENST00000392485;ENST00000508921;ENST00000358156;ENST00000359995	T;T;T	0.17213	2.29;2.29;2.29	4.71	4.71	0.59529	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.32645	0.0836	L	0.46670	1.46	0.80722	D	1	P;P	0.39809	0.689;0.689	P;P	0.54346	0.667;0.749	T	0.05419	-1.0886	10	0.66056	D	0.02	.	17.2677	0.87092	0.0:1.0:0.0:0.0	.	35;35	B4DN89;Q01130	.;SRSF2_HUMAN	Q	35;35;62;23;35	ENSP00000391278:E35Q;ENSP00000376276:E35Q;ENSP00000353089:E35Q	ENSP00000350877:E23Q	E	-	1	0	SRSF2	72244735	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.372000	0.79612	2.176000	0.68965	0.462000	0.41574	GAG	SRSF2	-	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	ENSG00000161547		0.667	SRSF2-003	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SRSF2	HGNC	protein_coding	OTTHUMT00000437489.1	100	0.00	0	C	NM_003016		74733140	74733140	-1	no_errors	ENST00000359995	ensembl	human	known	69_37n	missense	76	17.39	16	SNP	1.000	G
SSC5D	284297	genome.wustl.edu	37	19	56029595	56029595	+	Missense_Mutation	SNP	G	G	A	rs201516796		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:56029595G>A	ENST00000389623.6	+	14	3975	c.3952G>A	c.(3952-3954)Gat>Aat	p.D1318N		NM_001144950.1	NP_001138422.1	A1L4H1	SRCRL_HUMAN	scavenger receptor cysteine rich family, 5 domains	1318	Pro-rich.|Thr-rich.				defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|detection of bacterial lipoprotein (GO:0042494)|innate immune response (GO:0045087)|multicellular organismal development (GO:0007275)|negative regulation of interleukin-8 secretion (GO:2000483)|receptor-mediated endocytosis (GO:0006898)	cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|intracellular (GO:0005622)|membrane (GO:0016020)	extracellular matrix binding (GO:0050840)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)|scavenger receptor activity (GO:0005044)			NS(1)|breast(1)|skin(2)	4						cactactcctgatcccaccac	0.612																																						dbGAP											0													337.0	313.0	320.0					19																	56029595		692	1591	2283	-	-	-	SO:0001583	missense	0				CCDS46196.1, CCDS59424.1	19q13.42	2014-07-09	2014-07-09		ENSG00000179954	ENSG00000179954			26641	protein-coding gene	gene with protein product	"""soluble scavenger with 5 domains"""		"""scavenger receptor cysteine rich domain containing (5 domains)"""			19535143	Standard	NM_001144950		Approved	FLJ35258	uc002qlg.4	A1L4H1		ENST00000389623.6:c.3952G>A	19.37:g.56029595G>A	ENSP00000374274:p.Asp1318Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B5MDQ5|C7S7T9|C7S7U0|K7EP70	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,prints_Srcr_rcpt,pfscan_Srcr_rcpt	p.D1318N	ENST00000389623.6	37	c.3952	CCDS46196.1	19	.	.	.	.	.	.	.	.	.	.	-	8.751	0.921308	0.17982	.	.	ENSG00000179954	ENST00000389623	T	0.01172	5.23	2.09	-0.966	0.10320	.	.	.	.	.	T	0.00608	0.0020	N	0.08118	0	0.09310	N	1	B	0.24963	0.115	B	0.10450	0.005	T	0.46261	-0.9204	9	0.12430	T	0.62	.	3.8342	0.08886	0.1907:0.2536:0.5556:0.0	.	1318	A1L4H1	SRCRL_HUMAN	N	1318	ENSP00000374274:D1318N	ENSP00000374274:D1318N	D	+	1	0	SSC5D	60721407	0.000000	0.05858	0.018000	0.16275	0.055000	0.15305	-0.955000	0.03869	-0.051000	0.13334	0.165000	0.16767	GAT	SSC5D	-	NULL	ENSG00000179954		0.612	SSC5D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SSC5D	HGNC	protein_coding	OTTHUMT00000453345.2	51	0.00	0	G	XM_001718392		56029595	56029595	+1	no_errors	ENST00000389623	ensembl	human	known	69_37n	missense	77	11.49	10	SNP	0.005	A
STAG1	10274	genome.wustl.edu	37	3	136192453	136192453	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:136192453C>G	ENST00000383202.2	-	11	1309	c.1053G>C	c.(1051-1053)ttG>ttC	p.L351F	STAG1_ENST00000236698.5_Missense_Mutation_p.L351F|STAG1_ENST00000536929.1_5'Flank|STAG1_ENST00000434713.2_Missense_Mutation_p.L125F	NM_005862.2	NP_005853.2	Q8WVM7	STAG1_HUMAN	stromal antigen 1	351	SCD. {ECO:0000255|PROSITE- ProRule:PRU00750}.				chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	cell junction (GO:0030054)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(16)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	58						GCAGAGCTTTCAAACACTTCA	0.353																																						dbGAP											0													82.0	84.0	84.0					3																	136192453		2203	4300	6503	-	-	-	SO:0001583	missense	0			Z75330	CCDS3090.1	3q22.2-q22.3	2011-08-12			ENSG00000118007	ENSG00000118007			11354	protein-coding gene	gene with protein product		604358				9305759	Standard	XM_006713471		Approved	SA-1, SCC3A	uc003era.1	Q8WVM7	OTTHUMG00000159798	ENST00000383202.2:c.1053G>C	3.37:g.136192453C>G	ENSP00000372689:p.Leu351Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	O00539|Q6P275	Missense_Mutation	SNP	pfam_STAG,superfamily_ARM-type_fold	p.L351F	ENST00000383202.2	37	c.1053	CCDS3090.1	3	.	.	.	.	.	.	.	.	.	.	C	18.68	3.676875	0.67928	.	.	ENSG00000118007	ENST00000383202;ENST00000236698;ENST00000434713	T;T;T	0.41065	1.01;1.01;1.01	5.7	3.58	0.41010	Stromalin conservative domain (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.66036	0.2749	M	0.87758	2.905	0.80722	D	1	D;D;D	0.89917	0.991;1.0;0.991	D;D;D	0.91635	0.939;0.999;0.939	T	0.71059	-0.4702	10	0.62326	D	0.03	.	10.9846	0.47514	0.0:0.7782:0.0:0.2218	.	368;351;351	Q4LE48;Q6P275;Q8WVM7	.;.;STAG1_HUMAN	F	351;351;125	ENSP00000372689:L351F;ENSP00000236698:L351F;ENSP00000404396:L125F	ENSP00000236698:L351F	L	-	3	2	STAG1	137675143	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	2.098000	0.41757	1.403000	0.46800	-0.150000	0.13652	TTG	STAG1	-	superfamily_ARM-type_fold	ENSG00000118007		0.353	STAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAG1	HGNC	protein_coding	OTTHUMT00000357366.1	24	0.00	0	C	NM_005862		136192453	136192453	-1	no_errors	ENST00000383202	ensembl	human	known	69_37n	missense	22	15.38	4	SNP	1.000	G
STON1	11037	genome.wustl.edu	37	2	48808393	48808393	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:48808393C>T	ENST00000406226.1	+	3	816	c.621C>T	c.(619-621)ttC>ttT	p.F207F	STON1-GTF2A1L_ENST00000394751.3_Silent_p.F207F|STON1-GTF2A1L_ENST00000405008.1_Silent_p.F207F|STON1_ENST00000309835.3_Silent_p.F207F|STON1_ENST00000404752.1_Silent_p.F207F|STON1-GTF2A1L_ENST00000394754.1_Silent_p.F207F|STON1-GTF2A1L_ENST00000309827.2_Silent_p.F207F|STON1-GTF2A1L_ENST00000402114.2_Silent_p.F207F	NM_001198595.1	NP_001185524.1	Q9Y6Q2	STON1_HUMAN	stonin 1	207					endocytosis (GO:0006897)|intracellular protein transport (GO:0006886)|regulation of endocytosis (GO:0030100)	clathrin adaptor complex (GO:0030131)				NS(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(19)|prostate(3)|skin(2)	37		all_hematologic(82;0.151)|Acute lymphoblastic leukemia(82;0.175)	Lung(47;0.101)|LUSC - Lung squamous cell carcinoma(58;0.151)			AAAAGATGTTCTCATCAAGAA	0.408																																						dbGAP											0													80.0	75.0	77.0					2																	48808393		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF026169	CCDS1841.1	2p16.3	2008-02-05			ENSG00000243244	ENSG00000243244			17003	protein-coding gene	gene with protein product	"""stoned B homolog 1 (Drosophila)"""	605357				14504226, 10364255	Standard	NM_001198595		Approved	SBLF, stoned-b1		Q9Y6Q2	OTTHUMG00000129169	ENST00000406226.1:c.621C>T	2.37:g.48808393C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8MXJ1|B5MCF5|B7ZL16|Q96JE3|Q9BYX3	Silent	SNP	pfam_TFIIA_asu/bsu,pfam_Clathrin_mu_C,superfamily_Clathrin_mu_C,superfamily_TFIIA_b-brl,superfamily_TFIIA_a-hlx,pfscan_Clathrin_mu_C,pfscan_SHD	p.F207	ENST00000406226.1	37	c.621	CCDS1841.1	2																																																																																			STON1-GTF2A1L	-	NULL	ENSG00000068781		0.408	STON1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STON1-GTF2A1L	HGNC	protein_coding	OTTHUMT00000323848.2	23	0.00	0	C	NM_006873		48808393	48808393	+1	no_errors	ENST00000309827	ensembl	human	known	69_37n	silent	35	12.50	5	SNP	0.003	T
JMJD8	339123	genome.wustl.edu	37	16	732207	732207	+	3'UTR	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:732207G>C	ENST00000293882.4	-	0	1591				LA16c-313D11.9_ENST00000567091.1_RNA|LA16c-313D11.9_ENST00000571933.1_RNA|STUB1_ENST00000564370.1_Missense_Mutation_p.E166Q|JMJD8_ENST00000412368.2_3'UTR|JMJD8_ENST00000454700.1_3'UTR|STUB1_ENST00000219548.4_Missense_Mutation_p.E238Q|JMJD8_ENST00000609261.1_3'UTR|STUB1_ENST00000565677.1_Missense_Mutation_p.E166Q|STUB1_ENST00000566181.2_3'UTR			Q96S16	JMJD8_HUMAN	jumonji domain containing 8							extracellular vesicular exosome (GO:0070062)				breast(1)	1						GATCAGCTTTGAGCTGATGCG	0.637																																						dbGAP											0													90.0	78.0	82.0					16																	732207		2201	4297	6498	-	-	-	SO:0001624	3_prime_UTR_variant	0				CCDS45369.1	16p13.3	2008-07-28	2008-07-28	2008-07-28		ENSG00000161999			14148	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 20"""	C16orf20			Standard	NM_001005920		Approved		uc002ciw.1	Q96S16		ENST00000293882.4:c.*587C>G	16.37:g.732207G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	B2RNS7|D3DU58|Q4PKE3|Q4VBY1|Q6GMW5|Q71RB8	Missense_Mutation	SNP	pfam_Ubox_domain,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,smart_Ubox_domain,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E238Q	ENST00000293882.4	37	c.712		16	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856675	0.91433	.	.	ENSG00000103266	ENST00000219548	T	0.16743	2.32	5.14	5.14	0.70334	Zinc finger, RING/FYVE/PHD-type (1);U box domain (2);	0.000000	0.85682	D	0.000000	T	0.42630	0.1211	M	0.72353	2.195	0.80722	D	1	D	0.89917	1.0	D	0.76071	0.987	T	0.18777	-1.0326	10	0.46703	T	0.11	-27.7033	17.952	0.89056	0.0:0.0:1.0:0.0	.	238	Q9UNE7	CHIP_HUMAN	Q	238	ENSP00000219548:E238Q	ENSP00000219548:E238Q	E	+	1	0	STUB1	672208	1.000000	0.71417	0.995000	0.50966	0.945000	0.59286	9.753000	0.98904	2.550000	0.86006	0.555000	0.69702	GAG	STUB1	-	pfam_Ubox_domain,smart_Ubox_domain	ENSG00000103266		0.637	JMJD8-201	KNOWN	basic	protein_coding	STUB1	HGNC	protein_coding		74	0.00	0	G	NM_001005920		732207	732207	+1	no_errors	ENST00000219548	ensembl	human	known	69_37n	missense	96	19.33	23	SNP	1.000	C
SUV39H1	6839	genome.wustl.edu	37	X	48565975	48565975	+	3'UTR	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chrX:48565975G>A	ENST00000376687.3	+	0	1443				AF196970.3_ENST00000416061.1_RNA|SUV39H1_ENST00000453214.2_3'UTR|SUV39H1_ENST00000337852.6_3'UTR|SUV39H1_ENST00000482260.1_3'UTR	NM_003173.2	NP_003164.1	O43463	SUV91_HUMAN	suppressor of variegation 3-9 homolog 1 (Drosophila)						cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chromatin organization (GO:0006325)|chromatin silencing at rDNA (GO:0000183)|histone H3-K9 dimethylation (GO:0036123)|histone H3-K9 trimethylation (GO:0036124)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of transcription, DNA-templated (GO:0045892)|rhythmic process (GO:0048511)|rRNA processing (GO:0006364)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	chromatin silencing complex (GO:0005677)|chromosome, centromeric region (GO:0000775)|condensed nuclear chromosome (GO:0000794)|heterochromatin (GO:0000792)|nucleus (GO:0005634)|rDNA heterochromatin (GO:0033553)	chromatin binding (GO:0003682)|histone methyltransferase activity (GO:0042054)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|protein N-terminus binding (GO:0047485)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)|transcription regulatory region sequence-specific DNA binding (GO:0000976)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(4)|lung(5)|prostate(1)|upper_aerodigestive_tract(1)	14						TTAGAAGTCTGAGGCCAGACT	0.612																																						dbGAP											0													80.0	66.0	71.0					X																	48565975		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF019968	CCDS14304.1, CCDS65252.1	Xp11.23	2011-07-01	2001-11-28		ENSG00000101945	ENSG00000101945		"""Chromatin-modifying enzymes / K-methyltransferases"""	11479	protein-coding gene	gene with protein product		300254	"""suppressor of variegation 3-9 (Drosophila) homolog 1"""	SUV39H		10202156	Standard	NM_001282166		Approved	KMT1A	uc004dkn.3	O43463	OTTHUMG00000022701	ENST00000376687.3:c.*14G>A	X.37:g.48565975G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B2R6E8|B4DST0|Q53G60|Q6FHK6	RNA	SNP	-	NULL	ENST00000376687.3	37	NULL	CCDS14304.1	X																																																																																			SUV39H1	-	-	ENSG00000101945		0.612	SUV39H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV39H1	HGNC	protein_coding	OTTHUMT00000058909.1	84	0.00	0	G	NM_003173		48565975	48565975	+1	no_errors	ENST00000482260	ensembl	human	known	69_37n	rna	106	10.17	12	SNP	0.579	A
SWI5	375757	genome.wustl.edu	37	9	131038977	131038977	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:131038977C>T	ENST00000320188.5	+	2	369	c.369C>T	c.(367-369)ttC>ttT	p.F123F	SWI5_ENST00000608796.1_Silent_p.F58F|SWI5_ENST00000418976.1_Intron|SWI5_ENST00000419867.2_Silent_p.F58F|GOLGA2_ENST00000490628.1_5'Flank|SWI5_ENST00000495313.1_Intron|GOLGA2_ENST00000421699.2_5'Flank|GOLGA2_ENST00000609374.1_5'Flank	NM_001040011.1	NP_001035100.1	Q1ZZU3	SWI5_HUMAN	SWI5 recombination repair homolog (yeast)	123					cellular response to ionizing radiation (GO:0071479)|double-strand break repair via homologous recombination (GO:0000724)	nucleus (GO:0005634)|Swi5-Sfr1 complex (GO:0032798)											CCCTCGGATTCCTCTCTAGGA	0.607																																						dbGAP											0													122.0	130.0	127.0					9																	131038977		1911	4125	6036	-	-	-	SO:0001819	synonymous_variant	0			BC029911	CCDS43883.1	9q34.13	2011-07-29	2011-07-29	2011-07-29	ENSG00000175854	ENSG00000175854			31412	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 119"""	C9orf119		21252223, 20976249	Standard	NM_001040011		Approved	bA395P17.9	uc004bup.3	Q1ZZU3	OTTHUMG00000020729	ENST00000320188.5:c.369C>T	9.37:g.131038977C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q5SYX7|Q5SYX8|Q8N2W6	Silent	SNP	pfam_DNA-repair_Swi5	p.F123	ENST00000320188.5	37	c.369	CCDS43883.1	9																																																																																			SWI5	-	NULL	ENSG00000175854		0.607	SWI5-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SWI5	HGNC	protein_coding		51	0.00	0	C	NM_001040011		131038977	131038977	+1	no_errors	ENST00000320188	ensembl	human	known	69_37n	silent	81	18.18	18	SNP	0.756	T
SYNE1	23345	genome.wustl.edu	37	6	152576056	152576056	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:152576056G>A	ENST00000367255.5	-	104	20030	c.19429C>T	c.(19429-19431)Cat>Tat	p.H6477Y	SYNE1_ENST00000356820.4_Missense_Mutation_p.H1001Y|SYNE1_ENST00000423061.1_Missense_Mutation_p.H6406Y|SYNE1_ENST00000341594.5_Missense_Mutation_p.H6089Y|SYNE1_ENST00000448038.1_Missense_Mutation_p.H6406Y|SYNE1_ENST00000265368.4_Missense_Mutation_p.H6477Y	NM_182961.3	NP_892006.3	Q8NF91	SYNE1_HUMAN	spectrin repeat containing, nuclear envelope 1	6477					cell death (GO:0008219)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment of nucleus localization (GO:0040023)|Golgi organization (GO:0007030)|muscle cell differentiation (GO:0042692)|nuclear matrix anchoring at nuclear membrane (GO:0090292)|nucleus organization (GO:0006997)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)|SUN-KASH complex (GO:0034993)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|lamin binding (GO:0005521)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)			NS(3)|biliary_tract(1)|breast(17)|central_nervous_system(21)|cervix(3)|endometrium(27)|haematopoietic_and_lymphoid_tissue(4)|kidney(16)|large_intestine(138)|liver(1)|lung(190)|ovary(11)|pancreas(5)|prostate(12)|skin(20)|stomach(3)|upper_aerodigestive_tract(33)|urinary_tract(19)	524		Ovarian(120;0.0955)	BRCA - Breast invasive adenocarcinoma(37;0.243)	OV - Ovarian serous cystadenocarcinoma(155;2.24e-10)		TTCATCTGATGACATCGTTGA	0.363										HNSCC(10;0.0054)																												dbGAP											0													98.0	88.0	91.0					6																	152576056		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB018339	CCDS5235.1, CCDS5236.1, CCDS5236.2	6q24.2-q25.3	2014-09-17			ENSG00000131018	ENSG00000131018			17089	protein-coding gene	gene with protein product	"""myocyte nuclear envelope protein 1"", ""nuclear envelope spectrin repeat-1"""	608441	"""chromosome 6 open reading frame 98"""	C6orf98		9872452, 10878022	Standard	NM_182961		Approved	SYNE-1B, KIAA0796, 8B, Nesprin-1, enaptin, MYNE1, CPG2, dJ45H2.2, SCAR8, ARCA1, Nesp1	uc003qou.4	Q8NF91	OTTHUMG00000015841	ENST00000367255.5:c.19429C>T	6.37:g.152576056G>A	ENSP00000356224:p.His6477Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	E7EQI5|O94890|Q5JV19|Q5JV22|Q8N9P7|Q8TCP1|Q8WWW6|Q8WWW7|Q8WXF6|Q96N17|Q9C0A7|Q9H525|Q9H526|Q9NS36|Q9NU50|Q9UJ06|Q9UJ07|Q9ULF8	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_KASH,superfamily_CH-domain,superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.H6477Y	ENST00000367255.5	37	c.19429	CCDS5236.2	6	.	.	.	.	.	.	.	.	.	.	G	13.48	2.248968	0.39797	.	.	ENSG00000131018	ENST00000367255;ENST00000423061;ENST00000265368;ENST00000448038;ENST00000341594;ENST00000356820	T;T;T;T;T;T	0.54675	0.65;0.64;0.56;0.64;0.76;2.67	5.76	3.92	0.45320	.	0.295669	0.28971	N	0.013541	T	0.31606	0.0802	L	0.51422	1.61	0.26181	N	0.97972	P;P;P	0.43633	0.586;0.586;0.813	B;B;B	0.43754	0.248;0.248;0.43	T	0.08785	-1.0705	10	0.46703	T	0.11	.	9.7532	0.40487	0.199:0.0:0.801:0.0	.	6477;6477;6406	Q8NF91;E7EQI5;Q8NF91-4	SYNE1_HUMAN;.;.	Y	6477;6406;6477;6406;6089;1001	ENSP00000356224:H6477Y;ENSP00000396024:H6406Y;ENSP00000265368:H6477Y;ENSP00000390975:H6406Y;ENSP00000341887:H6089Y;ENSP00000349276:H1001Y	ENSP00000265368:H6477Y	H	-	1	0	SYNE1	152617749	1.000000	0.71417	0.996000	0.52242	0.735000	0.41995	3.417000	0.52714	0.727000	0.32360	-0.302000	0.09304	CAT	SYNE1	-	superfamily_Calpain_domain_III,superfamily_ABC_transptrTM_dom_typ1	ENSG00000131018		0.363	SYNE1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE1	HGNC	protein_coding	OTTHUMT00000334755.2	66	0.00	0	G	NM_182961		152576056	152576056	-1	no_errors	ENST00000265368	ensembl	human	known	69_37n	missense	35	18.60	8	SNP	1.000	A
SYNE3	161176	genome.wustl.edu	37	14	95903285	95903285	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:95903285C>T	ENST00000334258.5	-	14	2424	c.2410G>A	c.(2410-2412)Gaa>Aaa	p.E804K	SYNE3_ENST00000554873.1_Missense_Mutation_p.E561K|SYNE3_ENST00000557275.1_Missense_Mutation_p.E799K	NM_152592.3	NP_689805.3	Q6ZMZ3	SYNE3_HUMAN	spectrin repeat containing, nuclear envelope family member 3	804					cytoskeletal anchoring at nuclear membrane (GO:0090286)|cytoskeleton organization (GO:0007010)|establishment of protein localization to membrane (GO:0090150)|regulation of cell shape (GO:0008360)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear outer membrane (GO:0005640)|SUN-KASH complex (GO:0034993)	actin filament binding (GO:0051015)			breast(1)|endometrium(2)|lung(25)	28						GAGAAATCTTCATGGCTCCCT	0.512																																						dbGAP											0													98.0	93.0	95.0					14																	95903285		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK098471	CCDS9935.1	14q32.13	2012-05-31	2012-05-31	2012-05-31	ENSG00000176438	ENSG00000176438			19861	protein-coding gene	gene with protein product		610861	"""chromosome 14 open reading frame 49"""	C14orf49			Standard	NM_152592		Approved	FLJ25605, NET53, Nesprin-3, Nesp3	uc001yei.4	Q6ZMZ3	OTTHUMG00000171632	ENST00000334258.5:c.2410G>A	14.37:g.95903285C>T	ENSP00000334308:p.Glu804Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6H8H3|Q86SX5|Q8N7G8	Missense_Mutation	SNP	pfam_KASH,pfam_Spectrin_repeat,superfamily_Retrov_capsid_C,smart_Spectrin/alpha-actinin,pfscan_KASH	p.E804K	ENST00000334258.5	37	c.2410	CCDS9935.1	14	.	.	.	.	.	.	.	.	.	.	C	13.45	2.239448	0.39598	.	.	ENSG00000176438	ENST00000334258;ENST00000554873;ENST00000557275	T;T;T	0.15372	3.36;2.43;3.48	5.13	4.24	0.50183	.	0.734950	0.11607	N	0.547142	T	0.21186	0.0510	M	0.63428	1.95	0.30531	N	0.767444	B;B	0.10296	0.003;0.002	B;B	0.09377	0.004;0.002	T	0.08126	-1.0737	10	0.59425	D	0.04	-6.2119	11.447	0.50129	0.0:0.9133:0.0:0.0867	.	799;804	Q6ZMZ3-2;Q6ZMZ3	.;SYNE3_HUMAN	K	804;561;799	ENSP00000334308:E804K;ENSP00000452154:E561K;ENSP00000450562:E799K	ENSP00000334308:E804K	E	-	1	0	C14orf49	94973038	0.009000	0.17119	0.010000	0.14722	0.102000	0.19082	2.082000	0.41605	1.280000	0.44463	0.561000	0.74099	GAA	SYNE3	-	superfamily_Retrov_capsid_C	ENSG00000176438		0.512	SYNE3-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SYNE3	HGNC	protein_coding	OTTHUMT00000420529.2	53	0.00	0	C	NM_152592		95903285	95903285	-1	no_errors	ENST00000334258	ensembl	human	known	69_37n	missense	54	12.90	8	SNP	0.033	T
TAF2	6873	genome.wustl.edu	37	8	120816164	120816164	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:120816164C>T	ENST00000378164.2	-	5	812	c.514G>A	c.(514-516)Gag>Aag	p.E172K		NM_003184.3	NP_003175	Q6P1X5	TAF2_HUMAN	TAF2 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 150kDa	172					G2/M transition of mitotic cell cycle (GO:0000086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to organic cyclic compound (GO:0014070)|transcription initiation from RNA polymerase II promoter (GO:0006367)	transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	metallopeptidase activity (GO:0008237)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(2)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(21)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	49	Lung NSC(37;9.35e-07)|Ovarian(258;0.011)|Hepatocellular(40;0.161)		STAD - Stomach adenocarcinoma(47;0.00185)			GCACCTCTCTCTGCCATACTT	0.348																																						dbGAP											0													151.0	152.0	152.0					8																	120816164		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF040701	CCDS34937.1	8q24	2012-07-18	2002-08-29	2001-12-07	ENSG00000064313	ENSG00000064313			11536	protein-coding gene	gene with protein product		604912	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, B, 150kD"""	TAF2B		9774672, 9418870	Standard	NM_003184		Approved	TAFII150, CIF150	uc003you.3	Q6P1X5	OTTHUMG00000165009	ENST00000378164.2:c.514G>A	8.37:g.120816164C>T	ENSP00000367406:p.Glu172Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B2RE82|O43487|O43604|O60668|Q86WW7|Q8IWK4	Missense_Mutation	SNP	pfam_Peptidase_M1_N,superfamily_ARM-type_fold	p.E172K	ENST00000378164.2	37	c.514	CCDS34937.1	8	.	.	.	.	.	.	.	.	.	.	C	21.3	4.124366	0.77436	.	.	ENSG00000064313	ENST00000378164	T	0.41065	1.01	5.89	5.02	0.67125	Peptidase M1, membrane alanine aminopeptidase, N-terminal (1);	0.051164	0.85682	N	0.000000	T	0.42200	0.1192	L	0.35854	1.095	0.80722	D	1	P	0.37207	0.587	P	0.46299	0.511	T	0.14755	-1.0461	10	0.15952	T	0.53	-21.0329	15.2134	0.73244	0.0:0.9326:0.0:0.0674	.	172	Q6P1X5	TAF2_HUMAN	K	172	ENSP00000367406:E172K	ENSP00000367406:E172K	E	-	1	0	TAF2	120885345	1.000000	0.71417	0.988000	0.46212	0.996000	0.88848	7.776000	0.85560	1.499000	0.48617	0.655000	0.94253	GAG	TAF2	-	pfam_Peptidase_M1_N	ENSG00000064313		0.348	TAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF2	HGNC	protein_coding	OTTHUMT00000381436.1	62	0.00	0	C	NM_003184		120816164	120816164	-1	no_errors	ENST00000378164	ensembl	human	known	69_37n	missense	46	11.54	6	SNP	1.000	T
MIR1257	100302168	genome.wustl.edu	37	20	60528535	60528535	+	RNA	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:60528535C>T	ENST00000408490.1	-	0	117					NR_031658.1				microRNA 1257																		caaagcaagtcacatggctga	0.592																																						dbGAP											0																																										-	-	-			0					20q13.33	2011-09-12		2008-12-18	ENSG00000221417	ENSG00000221417		"""ncRNAs / Micro RNAs"""	35322	non-coding RNA	RNA, micro				MIRN1257			Standard	NR_031658		Approved	hsa-mir-1257	uc021wfv.1				20.37:g.60528535C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000408490.1	37	NULL		20																																																																																			TAF4	-	-	ENSG00000130699		0.592	MIR1257-201	KNOWN	basic	miRNA	TAF4	HGNC	miRNA		20	0.00	0	C	NR_031658		60528535	60528535	-1	no_errors	ENST00000474089	ensembl	human	known	69_37n	rna	40	24.53	13	SNP	0.019	T
TAP1	6890	genome.wustl.edu	37	6	32813494	32813494	+	Silent	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:32813494G>C	ENST00000354258.4	-	11	2450	c.2289C>G	c.(2287-2289)ctC>ctG	p.L763L	PSMB8_ENST00000395339.3_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000374882.3_5'Flank|PSMB9_ENST00000395330.1_Intron|PSMB8_ENST00000374881.2_5'Flank|TAP1_ENST00000425148.2_Silent_p.L502L	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)	763	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.				antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	CCACCAGGCTGAGGTGCTGGG	0.607																																						dbGAP											0													51.0	51.0	51.0					6																	32813494		1509	2708	4217	-	-	-	SO:0001819	synonymous_variant	0				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.2289C>G	6.37:g.32813494G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	Q16149|Q96CP4	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,prints_ABC_B2,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Ag_transporter2	p.L763	ENST00000354258.4	37	c.2289	CCDS4758.1	6																																																																																			TAP1	-	smart_AAA+_ATPase,prints_ABC_B2,pfscan_ABC_transporter-like,tigrfam_Ag_transporter2	ENSG00000168394		0.607	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAP1	HGNC	protein_coding	OTTHUMT00000076087.2	53	0.00	0	G	NM_000593		32813494	32813494	-1	no_errors	ENST00000354258	ensembl	human	known	69_37n	silent	78	15.22	14	SNP	0.905	C
TARBP1	6894	genome.wustl.edu	37	1	234556513	234556513	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:234556513G>C	ENST00000040877.1	-	21	3489	c.3490C>G	c.(3490-3492)Cta>Gta	p.L1164V		NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1	1164					regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			CTGTGCTGTAGAGAATTCACA	0.378																																						dbGAP											0													126.0	136.0	133.0					1																	234556513		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.3490C>G	1.37:g.234556513G>C	ENSP00000040877:p.Leu1164Val	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H581	Missense_Mutation	SNP	pfam_SpoU_MeTrfase,superfamily_ARM-type_fold	p.L1164V	ENST00000040877.1	37	c.3490	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	G	12.32	1.903831	0.33628	.	.	ENSG00000059588	ENST00000040877	T	0.07114	3.22	5.74	2.43	0.29744	Armadillo-type fold (1);	0.072831	0.56097	D	0.000037	T	0.07954	0.0199	L	0.59436	1.845	0.33082	D	0.536753	B	0.32573	0.376	B	0.28991	0.097	T	0.17961	-1.0352	10	0.17369	T	0.5	-8.2035	9.337	0.38056	0.3383:0.0:0.6617:0.0	.	1164	Q13395	TARB1_HUMAN	V	1164	ENSP00000040877:L1164V	ENSP00000040877:L1164V	L	-	1	2	TARBP1	232623136	1.000000	0.71417	0.700000	0.30305	0.989000	0.77384	2.539000	0.45718	0.783000	0.33636	-0.142000	0.14014	CTA	TARBP1	-	superfamily_ARM-type_fold	ENSG00000059588		0.378	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	32	0.00	0	G	NM_005646		234556513	234556513	-1	no_errors	ENST00000040877	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	0.707	C
TBC1D4	9882	genome.wustl.edu	37	13	75930355	75930355	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:75930355G>A	ENST00000377636.3	-	4	1549	c.1203C>T	c.(1201-1203)atC>atT	p.I401I	TBC1D4_ENST00000431480.2_Silent_p.I401I|TBC1D4_ENST00000425511.1_5'UTR|TBC1D4_ENST00000377625.2_Silent_p.I401I	NM_014832.2	NP_055647.2	O60343	TBCD4_HUMAN	TBC1 domain family, member 4	401	PID 2. {ECO:0000255|PROSITE- ProRule:PRU00148}.				cellular response to insulin stimulus (GO:0032869)|membrane organization (GO:0061024)|negative regulation of vesicle fusion (GO:0031339)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)	Rab GTPase activator activity (GO:0005097)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(12)|lung(18)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Prostate(6;0.014)|Breast(118;0.0982)		GBM - Glioblastoma multiforme(99;0.0116)		ACTCCCGGCAGATAAAGCCAA	0.413																																						dbGAP											0													62.0	59.0	60.0					13																	75930355		1914	4136	6050	-	-	-	SO:0001819	synonymous_variant	0			AB011175	CCDS41901.1, CCDS66563.1, CCDS66564.1	13q22.2	2013-07-09			ENSG00000136111	ENSG00000136111			19165	protein-coding gene	gene with protein product	"""Akt substrate of 160 kDa"""	612465				11829485, 11994271, 15304337	Standard	XM_005266603		Approved	KIAA0603, AS160, DKFZp779C0666	uc001vjl.1	O60343	OTTHUMG00000017088	ENST00000377636.3:c.1203C>T	13.37:g.75930355G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A7E2X8|B4DU25|B4E235|B6ETN8|B6ETN9|Q5W0B9|Q68D14	Silent	SNP	pfam_Rab-GTPase-TBC_dom,pfam_DUF3350,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.I401	ENST00000377636.3	37	c.1203	CCDS41901.1	13																																																																																			TBC1D4	-	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	ENSG00000136111		0.413	TBC1D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D4	HGNC	protein_coding	OTTHUMT00000045283.1	39	0.00	0	G	NM_014832		75930355	75930355	-1	no_errors	ENST00000377636	ensembl	human	known	69_37n	silent	21	12.50	3	SNP	1.000	A
TFAP4	7023	genome.wustl.edu	37	16	4322736	4322736	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:4322736G>C	ENST00000204517.6	-	1	340	c.12C>G	c.(10-12)ttC>ttG	p.F4L		NM_003223.2	NP_003214.1	Q01664	TFAP4_HUMAN	transcription factor AP-4 (activating enhancer binding protein 4)	4					cellular response to dexamethasone stimulus (GO:0071549)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|negative regulation by host of viral transcription (GO:0043922)|negative regulation of cell cycle arrest (GO:0071157)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of DNA binding (GO:0043392)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:2001269)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|E-box binding (GO:0070888)|histone deacetylase binding (GO:0042826)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|endometrium(2)|lung(8)|ovary(1)|prostate(1)|skin(1)	14						TGGGCACCATGAAATACTCCA	0.562																																						dbGAP											0													97.0	89.0	92.0					16																	4322736		2197	4300	6497	-	-	-	SO:0001583	missense	0			X57435	CCDS10510.1	16p13	2013-05-21	2001-11-28		ENSG00000090447	ENSG00000090447		"""Basic helix-loop-helix proteins"""	11745	protein-coding gene	gene with protein product		600743	"""transcription factor AP-4 (activating enhancer-binding protein 4)"""			2123466	Standard	NM_003223		Approved	AP-4, bHLHc41	uc010uxg.2	Q01664	OTTHUMG00000129435	ENST00000204517.6:c.12C>G	16.37:g.4322736G>C	ENSP00000204517:p.Phe4Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	O60409	Missense_Mutation	SNP	pfam_HLH_DNA-bd,superfamily_HLH_DNA-bd,smart_HLH_DNA-bd,pfscan_HLH_DNA-bd	p.F4L	ENST00000204517.6	37	c.12	CCDS10510.1	16	.	.	.	.	.	.	.	.	.	.	G	14.35	2.507868	0.44558	.	.	ENSG00000090447	ENST00000204517	D	0.99226	-5.59	4.49	3.53	0.40419	.	0.000000	0.85682	D	0.000000	D	0.97813	0.9282	N	0.08118	0	0.47153	D	0.99933	P	0.43392	0.805	P	0.57776	0.827	D	0.97277	0.9915	10	0.49607	T	0.09	.	11.403	0.49880	0.091:0.0:0.909:0.0	.	4	Q01664	TFAP4_HUMAN	L	4	ENSP00000204517:F4L	ENSP00000204517:F4L	F	-	3	2	TFAP4	4262737	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.278000	0.65592	0.889000	0.36185	0.462000	0.41574	TTC	TFAP4	-	NULL	ENSG00000090447		0.562	TFAP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFAP4	HGNC	protein_coding	OTTHUMT00000251595.2	80	0.00	0	G	NM_003223		4322736	4322736	-1	no_errors	ENST00000204517	ensembl	human	known	69_37n	missense	85	12.37	12	SNP	1.000	C
TFF3	7033	genome.wustl.edu	37	21	43732333	43732333	+	3'UTR	SNP	C	C	A	rs370223274	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr21:43732333C>A	ENST00000518498.1	-	0	552				TFF3_ENST00000489676.1_5'UTR|TFF3_ENST00000291525.10_3'UTR			Q07654	TFF3_HUMAN	trefoil factor 3 (intestinal)						defense response (GO:0006952)|digestion (GO:0007586)|response to peptide hormone (GO:0043434)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)|secretory granule (GO:0030141)				cervix(1)|haematopoietic_and_lymphoid_tissue(1)|lung(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	6						CTCCGAGCCTCGCATCCCCCG	0.607																																						dbGAP											0													60.0	64.0	62.0					21																	43732333		2203	4300	6503	-	-	-	SO:0001624	3_prime_UTR_variant	0			AF432265	CCDS33565.1, CCDS33565.2	21q22.3	2006-05-16			ENSG00000160180	ENSG00000160180			11757	protein-coding gene	gene with protein product		600633				7718582, 9043862	Standard	NM_003226		Approved	HITF, ITF	uc002zav.3	Q07654	OTTHUMG00000086798	ENST00000518498.1:c.*33G>T	21.37:g.43732333C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	E9PBB5|Q96NX0|Q9UDA5	Silent	SNP	NULL	p.A94	ENST00000518498.1	37	c.282	CCDS33565.2	21																																																																																			TFF3	-	NULL	ENSG00000160180		0.607	TFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFF3	HGNC	protein_coding	OTTHUMT00000195358.2	37	0.00	0	C	NM_003226		43732333	43732333	-1	no_start_codon:pseudogene:no_stop_codon:bad_bp_length_for_coding_region	ENST00000398431	ensembl	human	novel	69_37n	silent	30	21.05	8	SNP	0.002	A
TGM3	7053	genome.wustl.edu	37	20	2315917	2315917	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:2315917G>A	ENST00000381458.5	+	11	1861	c.1798G>A	c.(1798-1800)Gag>Aag	p.E600K		NM_003245.3	NP_003236.3	Q08188	TGM3_HUMAN	transglutaminase 3	600					cell envelope organization (GO:0043163)|cellular protein modification process (GO:0006464)|hair follicle morphogenesis (GO:0031069)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|protein tetramerization (GO:0051262)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)	calcium ion binding (GO:0005509)|catalytic activity (GO:0003824)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)|transferase activity, transferring acyl groups (GO:0016746)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(11)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(2)	39					L-Glutamine(DB00130)	CTTGACCCTGGAGGTAATGGG	0.627																																						dbGAP											0													101.0	84.0	89.0					20																	2315917		2203	4300	6503	-	-	-	SO:0001583	missense	0			L10386	CCDS33435.1	20q11.2	2013-05-02	2013-05-02		ENSG00000125780	ENSG00000125780	2.3.2.13	"""Transglutaminases"""	11779	protein-coding gene	gene with protein product	"""E polypeptide, protein-glutamine-gamma-glutamyltransferase"""	600238	"""transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase)"""			7851911, 9452468	Standard	NM_003245		Approved	TGE	uc002wfx.4	Q08188	OTTHUMG00000031690	ENST00000381458.5:c.1798G>A	20.37:g.2315917G>A	ENSP00000370867:p.Glu600Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5N6|B2RCR6|D3DVX1|O95933|Q32ML9|Q32MM0	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.E600K	ENST00000381458.5	37	c.1798	CCDS33435.1	20	.	.	.	.	.	.	.	.	.	.	G	10.14	1.268579	0.23136	.	.	ENSG00000125780	ENST00000381458	T	0.66460	-0.21	5.13	5.13	0.70059	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.255751	0.41194	D	0.000936	T	0.47619	0.1455	N	0.25957	0.775	0.40214	D	0.97766	B	0.14012	0.009	B	0.13407	0.009	T	0.40308	-0.9570	10	0.07644	T	0.81	2.4346	9.664	0.39972	0.0952:0.0:0.9048:0.0	.	600	Q08188	TGM3_HUMAN	K	600	ENSP00000370867:E600K	ENSP00000370867:E600K	E	+	1	0	TGM3	2263917	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	0.821000	0.27338	2.363000	0.80096	0.561000	0.74099	GAG	TGM3	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C	ENSG00000125780		0.627	TGM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM3	HGNC	protein_coding	OTTHUMT00000077579.2	88	0.00	0	G	NM_003245		2315917	2315917	+1	no_errors	ENST00000381458	ensembl	human	known	69_37n	missense	94	12.96	14	SNP	1.000	A
THBD	7056	genome.wustl.edu	37	20	23028944	23028944	+	Missense_Mutation	SNP	C	C	T	rs200712265		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr20:23028944C>T	ENST00000377103.2	-	1	1434	c.1198G>A	c.(1198-1200)Gag>Aag	p.E400K		NM_000361.2	NP_000352.1	P07204	TRBM_HUMAN	thrombomodulin	400	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.				blood coagulation (GO:0007596)|female pregnancy (GO:0007565)|leukocyte migration (GO:0050900)|negative regulation of blood coagulation (GO:0030195)|negative regulation of fibrinolysis (GO:0051918)|negative regulation of platelet activation (GO:0010544)|response to cAMP (GO:0051591)|response to lipopolysaccharide (GO:0032496)|response to X-ray (GO:0010165)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(3)|ovary(1)|skin(1)	7	Colorectal(13;0.0518)|Lung NSC(19;0.0542)|all_lung(19;0.118)				Drotrecogin alfa(DB00055)|Ibuprofen(DB01050)	CTGTGCGGCTCGTGGGGAATG	0.622													C|||	1	0.000199681	0.0	0.0014	5008	,	,		17658	0.0		0.0	False		,,,				2504	0.0					dbGAP											0													53.0	52.0	52.0					20																	23028944		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS13148.1	20p11.21	2014-09-17			ENSG00000178726	ENSG00000178726		"""CD molecules"""	11784	protein-coding gene	gene with protein product		188040					Standard	NM_000361		Approved	CD141	uc002wss.3	P07204	OTTHUMG00000032053	ENST00000377103.2:c.1198G>A	20.37:g.23028944C>T	ENSP00000366307:p.Glu400Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q8IV29|Q9UC32	Missense_Mutation	SNP	pirsf_CD93/CD141,pfam_Tme5_EGF-like,pfam_EGF-like_Ca-bd,superfamily_C-type_lectin_fold,smart_C-type_lectin,smart_EGF-like,smart_EGF-like_Ca-bd,prints_Thrombomodulin,pfscan_C-type_lectin	p.E400K	ENST00000377103.2	37	c.1198	CCDS13148.1	20	1	4.578754578754579E-4	0	0.0	1	0.0027624309392265192	0	0.0	0	0.0	C	2.413	-0.334981	0.05278	.	.	ENSG00000178726	ENST00000377103;ENST00000503590	D	0.82433	-1.61	4.81	2.78	0.32641	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);	1.451430	0.04444	U	0.371387	T	0.75019	0.3793	L	0.38175	1.15	0.09310	N	1	B	0.27951	0.195	B	0.14578	0.011	T	0.63435	-0.6638	10	0.72032	D	0.01	-4.503	5.625	0.17477	0.0:0.3775:0.4417:0.1808	.	400	P07204	TRBM_HUMAN	K	400;382	ENSP00000366307:E400K	ENSP00000366307:E400K	E	-	1	0	THBD	22976944	0.000000	0.05858	0.003000	0.11579	0.087000	0.18053	-0.519000	0.06260	1.023000	0.39654	-0.273000	0.10243	GAG	THBD	-	pirsf_CD93/CD141,smart_EGF-like_Ca-bd,smart_EGF-like	ENSG00000178726		0.622	THBD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THBD	HGNC	protein_coding	OTTHUMT00000078307.2	63	0.00	0	C			23028944	23028944	-1	no_errors	ENST00000377103	ensembl	human	known	69_37n	missense	72	18.18	16	SNP	0.000	T
THSD7B	80731	genome.wustl.edu	37	2	138163218	138163218	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:138163218G>A	ENST00000409968.1	+	13	2714	c.2536G>A	c.(2536-2538)Gaa>Aaa	p.E846K	THSD7B_ENST00000543459.1_Intron|THSD7B_ENST00000272643.3_Missense_Mutation_p.E846K|THSD7B_ENST00000413152.2_Missense_Mutation_p.E815K			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	846	TSP type-1 10. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)				NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		CCGGTCAGCAGAAATGATGGA	0.438																																						dbGAP											0													69.0	67.0	67.0					2																	138163218		1942	4149	6091	-	-	-	SO:0001583	missense	0					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.2536G>A	2.37:g.138163218G>A	ENSP00000387145:p.Glu846Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.E846K	ENST00000409968.1	37	c.2536		2	.	.	.	.	.	.	.	.	.	.	G	14.04	2.416769	0.42918	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152	T;T;T	0.60920	0.15;0.15;0.15	5.58	5.58	0.84498	.	0.225052	0.47455	D	0.000234	T	0.53417	0.1795	M	0.67953	2.075	0.80722	D	1	P;P	0.42827	0.791;0.57	B;B	0.37387	0.248;0.248	T	0.52924	-0.8510	10	0.19590	T	0.45	.	14.7485	0.69508	0.0712:0.0:0.9288:0.0	.	846;815	Q9C0I4;C9JKN6	THS7B_HUMAN;.	K	846;846;815	ENSP00000387145:E846K;ENSP00000272643:E846K;ENSP00000413841:E815K	ENSP00000272643:E846K	E	+	1	0	THSD7B	137879688	1.000000	0.71417	1.000000	0.80357	0.268000	0.26511	5.257000	0.65473	2.624000	0.88883	0.655000	0.94253	GAA	THSD7B	-	superfamily_Thrombospondin_1_rpt	ENSG00000144229		0.438	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	25	0.00	0	G	XM_046570.9		138163218	138163218	+1	no_errors	ENST00000272643	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	1.000	A
TLE2	7089	genome.wustl.edu	37	19	3011063	3011063	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:3011063G>A	ENST00000262953.6	-	12	1231	c.969C>T	c.(967-969)ctC>ctT	p.L323L	TLE2_ENST00000443826.3_Silent_p.L201L|TLE2_ENST00000586422.1_Intron|TLE2_ENST00000591529.1_Silent_p.L337L|TLE2_ENST00000590536.1_Silent_p.L324L|TLE2_ENST00000587217.1_5'Flank|TLE2_ENST00000447365.2_Missense_Mutation_p.S32F|TLE2_ENST00000455444.2_Silent_p.L201L|TLE2_ENST00000426948.2_Silent_p.L337L	NM_003260.4	NP_003251.2	Q04725	TLE2_HUMAN	transducin-like enhancer of split 2	323	Pro/Ser-rich.				negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)|Wnt signaling pathway (GO:0016055)	extracellular space (GO:0005615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(6)|prostate(1)	13				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CAAGCTGGCAGAGGTGACTGG	0.652																																						dbGAP											0													15.0	20.0	18.0					19																	3011063		2060	4199	6259	-	-	-	SO:0001819	synonymous_variant	0			M99436	CCDS45911.1, CCDS45912.1, CCDS45913.1, CCDS74255.1	19p13.3	2014-03-07	2014-03-07					"""WD repeat domain containing"""	11838	protein-coding gene	gene with protein product	"""enhancer of split groucho 2"""	601041	"""transducin-like enhancer of split 2, homolog of Drosophila E(sp1)"", ""transducin-like enhancer of split 2 (E(sp1) homolog, Drosophila)"""			8808280	Standard	NM_003260		Approved	ESG2, GRG2, ESG, FLJ41188	uc002lww.3	Q04725		ENST00000262953.6:c.969C>T	19.37:g.3011063G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	B4DE03|E9PEV7|F8WCH2|Q8WVY0|Q9Y6S0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Groucho_enhance	p.S32F	ENST00000262953.6	37	c.95	CCDS45911.1	19	.	.	.	.	.	.	.	.	.	.	G	9.630	1.136089	0.21123	.	.	ENSG00000065717	ENST00000447365	T	0.58797	0.31	4.58	-0.495	0.12030	.	.	.	.	.	T	0.45875	0.1364	.	.	.	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.31668	-0.9935	8	0.30078	T	0.28	-1.6103	15.4357	0.75143	0.0:0.5473:0.4527:0.0	.	32	B4DE62	.	F	32	ENSP00000406523:S32F	ENSP00000406523:S32F	S	-	2	0	TLE2	2962063	0.971000	0.33674	0.993000	0.49108	0.579000	0.36224	0.060000	0.14342	-0.148000	0.11234	-1.303000	0.01326	TCT	TLE2	-	NULL	ENSG00000065717		0.652	TLE2-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	TLE2	HGNC	protein_coding	OTTHUMT00000452194.2	109	0.00	0	G	NM_003260		3011063	3011063	-1	no_errors	ENST00000447365	ensembl	human	known	69_37n	missense	111	13.95	18	SNP	0.995	A
TLR1	7096	genome.wustl.edu	37	4	38800365	38800365	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr4:38800365C>G	ENST00000502213.2	-	3	317	c.88G>C	c.(88-90)Gat>Cat	p.D30H	TLR1_ENST00000308979.2_Missense_Mutation_p.D30H			Q15399	TLR1_HUMAN	toll-like receptor 1	30					cellular response to triacyl bacterial lipopeptide (GO:0071727)|detection of triacyl bacterial lipopeptide (GO:0042495)|immune response (GO:0006955)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|macrophage activation (GO:0042116)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|positive regulation of interleukin-6 biosynthetic process (GO:0045410)|positive regulation of tumor necrosis factor biosynthetic process (GO:0042535)|regulation of cytokine secretion (GO:0050707)|signal transduction (GO:0007165)|toll-like receptor 1 signaling pathway (GO:0034130)	cytoplasmic vesicle (GO:0031410)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|Toll-like receptor 1-Toll-like receptor 2 protein complex (GO:0035354)	protein heterodimerization activity (GO:0046982)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|skin(4)|stomach(2)	28						TTTGACCTATCAACTAAAAAT	0.328																																					GBM(5;216 373 40795 46382)	dbGAP											0													54.0	59.0	57.0					4																	38800365		2199	4298	6497	-	-	-	SO:0001583	missense	0			U88540	CCDS33973.1	4p14	2008-02-05				ENSG00000174125		"""CD molecules"""	11847	protein-coding gene	gene with protein product		601194				9435236, 7584026	Standard	NM_003263		Approved	rsc786, KIAA0012, CD281	uc003gtl.3	Q15399		ENST00000502213.2:c.88G>C	4.37:g.38800365C>G	ENSP00000421259:p.Asp30His	Somatic		WXS	Illumina GAIIx	Phase_IV	D1CS39|D1CS41|O15452|Q32MK3|Q32MK4|Q9UG90	Missense_Mutation	SNP	pirsf_Toll-like_receptor,pfam_TIR_dom,pfam_Leu-rich_rpt,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,prints_IL1_rcpt_1,pfscan_TIR_dom	p.D30H	ENST00000502213.2	37	c.88	CCDS33973.1	4	.	.	.	.	.	.	.	.	.	.	C	16.07	3.018309	0.54576	.	.	ENSG00000174125	ENST00000308979;ENST00000502213;ENST00000505940;ENST00000515861;ENST00000506146	T;T;T;D;T	0.84873	2.1;2.1;4.16;-1.91;0.23	5.2	-2.02	0.07388	.	0.734122	0.12857	N	0.433467	D	0.88764	0.6525	M	0.73962	2.25	0.22017	N	0.999417	D	0.56968	0.978	P	0.56865	0.808	T	0.83144	-0.0107	10	0.87932	D	0	.	12.9907	0.58616	0.0:0.1852:0.0:0.8148	.	30	Q15399	TLR1_HUMAN	H	30	ENSP00000354932:D30H;ENSP00000421259:D30H;ENSP00000421856:D30H;ENSP00000423017:D30H;ENSP00000423725:D30H	ENSP00000354932:D30H	D	-	1	0	TLR1	38476760	0.073000	0.21202	0.030000	0.17652	0.817000	0.46193	0.071000	0.14594	-0.329000	0.08527	0.655000	0.94253	GAT	TLR1	-	pirsf_Toll-like_receptor	ENSG00000174125		0.328	TLR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR1	HGNC	protein_coding	OTTHUMT00000360510.3	49	0.00	0	C			38800365	38800365	-1	no_errors	ENST00000308979	ensembl	human	known	69_37n	missense	37	11.90	5	SNP	0.023	G
TMEM38A	79041	genome.wustl.edu	37	19	16791268	16791268	+	Silent	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:16791268G>T	ENST00000187762.2	+	3	433	c.342G>T	c.(340-342)gtG>gtT	p.V114V		NM_024074.1	NP_076979.1	Q9H6F2	TM38A_HUMAN	transmembrane protein 38A	114						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)|sarcoplasmic reticulum membrane (GO:0033017)	potassium channel activity (GO:0005267)			central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(6)|ovary(1)	15						TCCTGCCTGTGAAACTCATCT	0.562																																						dbGAP											0													261.0	247.0	252.0					19																	16791268		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AK025981	CCDS12349.1	19p13.11	2013-05-23				ENSG00000072954			28462	protein-coding gene	gene with protein product		611235				17611541	Standard	NM_024074		Approved	MGC3169, TRIC-A	uc002nes.3	Q9H6F2		ENST00000187762.2:c.342G>T	19.37:g.16791268G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K9P9	Silent	SNP	pfam_TRIC_channel	p.V114	ENST00000187762.2	37	c.342	CCDS12349.1	19																																																																																			TMEM38A	-	pfam_TRIC_channel	ENSG00000072954		0.562	TMEM38A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM38A	HGNC	protein_coding	OTTHUMT00000462841.1	92	0.00	0	G	NM_024074		16791268	16791268	+1	no_errors	ENST00000187762	ensembl	human	known	69_37n	silent	92	16.36	18	SNP	1.000	T
TMTC1	83857	genome.wustl.edu	37	12	29812815	29812815	+	Intron	SNP	C	C	T	rs577945801		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:29812815C>T	ENST00000539277.1	-	6	997				TMTC1_ENST00000256062.5_Intron|TMTC1_ENST00000381224.2_Silent_p.T266T|TMTC1_ENST00000551659.1_Silent_p.T374T|TMTC1_ENST00000552618.1_Silent_p.T374T	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1							integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					ATACTAACCTCGTAAGAATGT	0.348																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.939-26546G>A	12.37:g.29812815C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Silent	SNP	pfam_DUF1736,pfam_TPR_2,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.T266	ENST00000539277.1	37	c.798	CCDS53772.1	12																																																																																			TMTC1	-	pfam_DUF1736	ENSG00000133687		0.348	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	54	0.00	0	C	NM_031920		29812815	29812815	-1	no_errors	ENST00000381224	ensembl	human	known	69_37n	silent	38	17.39	8	SNP	0.997	T
TNXB	7148	genome.wustl.edu	37	6	32023869	32023869	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:32023869C>G	ENST00000375244.3	-	24	8427	c.8226G>C	c.(8224-8226)ctG>ctC	p.L2742L	TNXB_ENST00000375247.2_Silent_p.L2742L			P22105	TENX_HUMAN	tenascin XB	2800	Fibronectin type-III 19. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTGTCACTGTCAGCTCCCCCA	0.637																																						dbGAP											0													50.0	56.0	54.0					6																	32023869		1221	2523	3744	-	-	-	SO:0001819	synonymous_variant	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.8226G>C	6.37:g.32023869C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.L2742	ENST00000375244.3	37	c.8226		6																																																																																			TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.637	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	35	0.00	0	C	NM_019105		32023869	32023869	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	silent	42	14.29	7	SNP	0.997	G
TNXB	7148	genome.wustl.edu	37	6	32062954	32062954	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:32062954C>T	ENST00000479795.1	-	4	2397	c.2257G>A	c.(2257-2259)Gag>Aag	p.E753K	TNXB_ENST00000375244.3_Missense_Mutation_p.E753K|TNXB_ENST00000375247.2_Missense_Mutation_p.E753K			P22105	TENX_HUMAN	tenascin XB	1344					actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						CTCATGCCCTCAATGGTTGGC	0.562																																						dbGAP											0													129.0	123.0	125.0					6																	32062954		692	1591	2283	-	-	-	SO:0001583	missense	0			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000479795.1:c.2257G>A	6.37:g.32062954C>T	ENSP00000418248:p.Glu753Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EGF-like,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.E753K	ENST00000479795.1	37	c.2257		6	.	.	.	.	.	.	.	.	.	.	C	15.50	2.851000	0.51270	.	.	ENSG00000168477	ENST00000375244;ENST00000375247;ENST00000479795	T;T;D	0.92348	0.68;0.51;-3.02	4.64	2.62	0.31277	.	.	.	.	.	T	0.67202	0.2868	N	0.14661	0.345	0.21861	N	0.999502	P	0.39424	0.673	B	0.36464	0.225	T	0.60722	-0.7207	9	0.17369	T	0.5	.	4.7688	0.13146	0.0:0.6328:0.2399:0.1273	.	753	P22105-3	.	K	753	ENSP00000364393:E753K;ENSP00000364396:E753K;ENSP00000418248:E753K	ENSP00000364393:E753K	E	-	1	0	TNXB	32170932	0.053000	0.20554	0.972000	0.41901	0.995000	0.86356	0.748000	0.26305	1.135000	0.42183	0.655000	0.94253	GAG	TNXB	-	smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000168477		0.562	TNXB-007	PUTATIVE	basic|exp_conf	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000357059.1	42	0.00	0	C	NM_019105		32062954	32062954	-1	no_errors	ENST00000375247	ensembl	human	known	69_37n	missense	58	19.44	14	SNP	0.882	T
TP53	7157	genome.wustl.edu	37	17	7578423	7578423	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:7578423C>T	ENST00000269305.4	-	5	696	c.507G>A	c.(505-507)atG>atA	p.M169I	TP53_ENST00000445888.2_Missense_Mutation_p.M169I|TP53_ENST00000455263.2_Missense_Mutation_p.M169I|TP53_ENST00000359597.4_Missense_Mutation_p.M169I|TP53_ENST00000413465.2_Missense_Mutation_p.M169I|TP53_ENST00000574684.1_5'UTR|TP53_ENST00000420246.2_Missense_Mutation_p.M169I	NM_000546.5|NM_001126112.2|NM_001126118.1|NM_001276760.1|NM_001276761.1	NP_000537.3|NP_001119584.1|NP_001119590.1|NP_001263689.1|NP_001263690.1	P04637	P53_HUMAN	tumor protein p53	169	Interaction with AXIN1. {ECO:0000250}.|Interaction with HIPK1. {ECO:0000250}.|Required for interaction with FBXO42.|Required for interaction with ZNF385A.		HM -> LI (in a sporadic cancer; somatic mutation).|M -> I (in sporadic cancers; somatic mutation). {ECO:0000269|PubMed:9450901}.|M -> K (in sporadic cancers; somatic mutation).|M -> T (in sporadic cancers; somatic mutation).|M -> V (in sporadic cancers; somatic mutation).|MT -> IS (in a sporadic cancer; somatic mutation).		apoptotic process (GO:0006915)|B cell lineage commitment (GO:0002326)|base-excision repair (GO:0006284)|blood coagulation (GO:0007596)|cell aging (GO:0007569)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to drug (GO:0035690)|cellular response to glucose starvation (GO:0042149)|cellular response to hypoxia (GO:0071456)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|cerebellum development (GO:0021549)|chromatin assembly (GO:0031497)|determination of adult lifespan (GO:0008340)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA strand renaturation (GO:0000733)|double-strand break repair (GO:0006302)|embryonic organ development (GO:0048568)|ER overload response (GO:0006983)|gastrulation (GO:0007369)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|mitotic cell cycle arrest (GO:0071850)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|multicellular organismal development (GO:0007275)|necroptotic process (GO:0070266)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of DNA replication (GO:0008156)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of helicase activity (GO:0051097)|negative regulation of macromitophagy (GO:1901525)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of reactive oxygen species metabolic process (GO:2000378)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|nucleotide-excision repair (GO:0006289)|oligodendrocyte apoptotic process (GO:0097252)|oxidative stress-induced premature senescence (GO:0090403)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of cell aging (GO:0090343)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of histone deacetylation (GO:0031065)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitochondrial membrane permeability (GO:0035794)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of protein oligomerization (GO:0032461)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of release of cytochrome c from mitochondria (GO:0090200)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein complex assembly (GO:0006461)|protein import into nucleus, translocation (GO:0000060)|protein localization (GO:0008104)|protein tetramerization (GO:0051262)|Ras protein signal transduction (GO:0007265)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrial membrane permeability (GO:0046902)|regulation of mitochondrial membrane permeability involved in apoptotic process (GO:1902108)|regulation of tissue remodeling (GO:0034103)|regulation of transcription, DNA-templated (GO:0006355)|release of cytochrome c from mitochondria (GO:0001836)|replicative senescence (GO:0090399)|response to antibiotic (GO:0046677)|response to gamma radiation (GO:0010332)|response to ischemia (GO:0002931)|response to salt stress (GO:0009651)|response to X-ray (GO:0010165)|rRNA transcription (GO:0009303)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell proliferation involved in immune response (GO:0002309)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nuclear chromatin (GO:0000790)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|protein complex (GO:0043234)|replication fork (GO:0005657)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|chromatin binding (GO:0003682)|copper ion binding (GO:0005507)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|enzyme binding (GO:0019899)|histone acetyltransferase binding (GO:0035035)|histone deacetylase regulator activity (GO:0035033)|identical protein binding (GO:0042802)|p53 binding (GO:0002039)|protease binding (GO:0002020)|protein heterodimerization activity (GO:0046982)|protein kinase binding (GO:0019901)|protein N-terminus binding (GO:0047485)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|receptor tyrosine kinase binding (GO:0030971)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|ubiquitin protein ligase binding (GO:0031625)|zinc ion binding (GO:0008270)	p.0?(8)|p.M169I(8)|p.V157_C176del20(1)|p.H168fs*69(1)|p.T170fs*5(1)|p.P151_V173del23(1)|p.H168fs*3(1)|p.H168fs*4(1)|p.M169_T170insX(1)|p.H168_M169>LI(1)|p.S149fs*72(1)|p.M169fs*12(1)|p.Q165_M169delQSQHM(1)		NS(16)|adrenal_gland(37)|autonomic_ganglia(16)|biliary_tract(273)|bone(108)|breast(2530)|central_nervous_system(1264)|cervix(68)|endometrium(223)|eye(24)|fallopian_tube(1)|gastrointestinal_tract_(site_indeterminate)(1)|genital_tract(16)|haematopoietic_and_lymphoid_tissue(1301)|kidney(96)|large_intestine(5124)|liver(897)|lung(2388)|meninges(5)|oesophagus(1473)|ovary(1659)|pancreas(452)|penis(10)|peritoneum(33)|pituitary(4)|placenta(1)|pleura(3)|prostate(235)|salivary_gland(43)|skin(791)|small_intestine(14)|soft_tissue(220)|stomach(1158)|testis(11)|thymus(21)|thyroid(54)|upper_aerodigestive_tract(2271)|urinary_tract(1259)|vagina(6)|vulva(79)	24185		all_cancers(10;1.01e-06)|Myeloproliferative disorder(207;0.0122)|Prostate(122;0.081)		GBM - Glioblastoma multiforme(2;1.59e-06)|READ - Rectum adenocarcinoma(115;0.174)	Acetylsalicylic acid(DB00945)	CAACCTCCGTCATGTGCTGTG	0.652		111	"""Mis, N, F"""		"""breast, colorectal, lung, sarcoma, adrenocortical, glioma, multiple other tumour types"""	"""breast, sarcoma, adrenocortical carcinoma, glioma, multiple other tumour types"""		Other conserved DNA damage response genes	Osteosarcoma, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Breast-Ovarian Cancer, non-BRCA1/2;Hereditary Adrenocortical Cancer;Endometrial Cancer, Familial Clustering of	HNSCC(1;<9.43e-08)|TCGA GBM(1;<1E-08)|TSP Lung(2;<1E-08)|TCGA Ovarian(1;<1.89e-07)|Multiple Myeloma(5;0.019)																											Pancreas(47;798 1329 9957 10801)	dbGAP	yes	Rec	yes	Li-Fraumeni syndrome	17	17p13	7157	tumor protein p53		"""L, E, M, O"""	27	Whole gene deletion(8)|Substitution - Missense(8)|Deletion - Frameshift(4)|Deletion - In frame(3)|Insertion - Frameshift(2)|Insertion - In frame(1)|Complex - compound substitution(1)	bone(4)|large_intestine(3)|stomach(3)|lung(3)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|oesophagus(2)|skin(2)|breast(2)|upper_aerodigestive_tract(1)|liver(1)|ovary(1)|prostate(1)											53.0	53.0	53.0					17																	7578423		2203	4300	6503	-	-	-	SO:0001583	missense	0	Familial Cancer Database	Familial Osteogenic Sarcoma;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;BRCAX;Familial Adrenocortical Carcinoma;	AF307851	CCDS11118.1, CCDS45605.1, CCDS45606.1, CCDS73963.1, CCDS73964.1, CCDS73965.1, CCDS73966.1, CCDS73967.1, CCDS73968.1, CCDS73969.1, CCDS73970.1, CCDS73971.1	17p13.1	2014-09-17	2008-01-16		ENSG00000141510	ENSG00000141510			11998	protein-coding gene	gene with protein product	"""Li-Fraumeni syndrome"""	191170				6396087, 3456488, 2047879	Standard	NM_001126115		Approved	p53, LFS1	uc002gij.3	P04637	OTTHUMG00000162125	ENST00000269305.4:c.507G>A	17.37:g.7578423C>T	ENSP00000269305:p.Met169Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q15086|Q15087|Q15088|Q16535|Q16807|Q16808|Q16809|Q16810|Q16811|Q16848|Q2XN98|Q3LRW1|Q3LRW2|Q3LRW3|Q3LRW4|Q3LRW5|Q86UG1|Q8J016|Q99659|Q9BTM4|Q9HAQ8|Q9NP68|Q9NPJ2|Q9NZD0|Q9UBI2|Q9UQ61	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_p53_transactivation_domain,superfamily_p53-like_TF_DNA-bd,superfamily_p53_tetrameristn,prints_p53_tumour_suppressor	p.M169I	ENST00000269305.4	37	c.507	CCDS11118.1	17	.	.	.	.	.	.	.	.	.	.	C	14.57	2.576144	0.45902	.	.	ENSG00000141510	ENST00000413465;ENST00000359597;ENST00000269305;ENST00000455263;ENST00000420246;ENST00000445888;ENST00000396473;ENST00000545858;ENST00000509690;ENST00000514944;ENST00000414315	D;D;D;D;D;D;D;D	0.99701	-6.45;-6.45;-6.45;-6.45;-6.45;-6.45;-6.45;-6.45	5.59	3.6	0.41247	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.215967	0.49916	N	0.000135	D	0.98890	0.9624	L	0.55481	1.735	0.43164	D	0.994952	B;B;B;B;B;B;B	0.22604	0.021;0.007;0.001;0.037;0.006;0.02;0.072	B;B;B;B;B;B;B	0.33196	0.06;0.099;0.008;0.025;0.058;0.159;0.064	D	0.99274	1.0894	10	0.72032	D	0.01	-15.6184	9.8441	0.41017	0.0:0.7826:0.1403:0.0771	.	130;169;169;76;169;169;169	B4E095;P04637-2;P04637-3;E9PFT5;P04637;Q1MSW8;E7EQX7	.;.;.;.;P53_HUMAN;.;.	I	169;169;169;169;169;169;158;76;37;76;37	ENSP00000410739:M169I;ENSP00000352610:M169I;ENSP00000269305:M169I;ENSP00000398846:M169I;ENSP00000391127:M169I;ENSP00000391478:M169I;ENSP00000425104:M37I;ENSP00000423862:M76I	ENSP00000269305:M169I	M	-	3	0	TP53	7519148	0.996000	0.38824	0.620000	0.29132	0.282000	0.26991	0.802000	0.27069	0.840000	0.34995	-0.140000	0.14226	ATG	TP53	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor	ENSG00000141510		0.652	TP53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TP53	HGNC	protein_coding	OTTHUMT00000367397.1	22	0.00	0	C	NM_000546		7578423	7578423	-1	no_errors	ENST00000269305	ensembl	human	known	69_37n	missense	28	24.32	9	SNP	1.000	T
TPH1	7166	genome.wustl.edu	37	11	18048072	18048072	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:18048072C>T	ENST00000250018.2	-	6	1330	c.768G>A	c.(766-768)gtG>gtA	p.V256V	TPH1_ENST00000341556.2_Silent_p.V256V	NM_004179.2	NP_004170.1	P17752	TPH1_HUMAN	tryptophan hydroxylase 1	256					aromatic amino acid family metabolic process (GO:0009072)|bone remodeling (GO:0046849)|cellular nitrogen compound metabolic process (GO:0034641)|circadian rhythm (GO:0007623)|indolalkylamine biosynthetic process (GO:0046219)|mammary gland alveolus development (GO:0060749)|negative regulation of ossification (GO:0030279)|response to immobilization stress (GO:0035902)|serotonin biosynthetic process (GO:0042427)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|neuron projection (GO:0043005)	amino acid binding (GO:0016597)|iron ion binding (GO:0005506)|tryptophan 5-monooxygenase activity (GO:0004510)			NS(1)|breast(1)|endometrium(1)|kidney(3)|large_intestine(3)|lung(14)|prostate(1)|stomach(1)	25					L-Tryptophan(DB00150)|Tetrahydrobiopterin(DB00360)	AACTGTGTCTCACATATTGAG	0.403																																						dbGAP											0													95.0	97.0	96.0					11																	18048072		2200	4293	6493	-	-	-	SO:0001819	synonymous_variant	0			X52836	CCDS7829.1	11p15.3-p14	2012-10-02	2008-07-31	2003-04-04	ENSG00000129167	ENSG00000129167	1.14.16.4		12008	protein-coding gene	gene with protein product	"""tryptophan 5-monooxygenase"""	191060	"""tryptophan hydroxylase (tryptophan 5-monooxygenase)"""	TPRH, TPH		1463016	Standard	NM_004179		Approved		uc001mnp.2	P17752	OTTHUMG00000166421	ENST00000250018.2:c.768G>A	11.37:g.18048072C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	D3DQX6|O95188|O95189|Q16736|Q3KPG8	Missense_Mutation	SNP	pfam_Aromatic-AA_hydroxylase_C,pfam_ACT_dom,superfamily_Aromatic-AA_hydroxylase_C	p.E191K	ENST00000250018.2	37	c.571	CCDS7829.1	11																																																																																			TPH1	-	NULL	ENSG00000129167		0.403	TPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPH1	HGNC	protein_coding	OTTHUMT00000389696.1	92	0.00	0	C	NM_004179		18048072	18048072	-1	no_errors	ENST00000417164	ensembl	human	known	69_37n	missense	100	13.04	15	SNP	1.000	T
TPST1	8460	genome.wustl.edu	37	7	65705509	65705509	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:65705509C>T	ENST00000304842.5	+	2	522	c.97C>T	c.(97-99)Cac>Tac	p.H33Y	TPST1_ENST00000480281.1_Intron	NM_003596.3	NP_003587.1	O60507	TPST1_HUMAN	tyrosylprotein sulfotransferase 1	33					inflammatory response (GO:0006954)|peptidyl-tyrosine sulfation (GO:0006478)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	protein-tyrosine sulfotransferase activity (GO:0008476)			NS(1)|biliary_tract(1)|breast(1)|kidney(3)|lung(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	11						GGAATGCCATCACCGGATAGA	0.488																																						dbGAP											0													88.0	72.0	77.0					7																	65705509		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF038009	CCDS5533.1	7q11.21	2012-12-13			ENSG00000169902	ENSG00000169902	2.8.2.20	"""Sulfotransferases, membrane-bound"""	12020	protein-coding gene	gene with protein product	"""transport and golgi organization 13 homolog A (Drosophila)"""	603125				9501187	Standard	NM_003596		Approved	TANGO13A	uc003tuw.3	O60507	OTTHUMG00000023871	ENST00000304842.5:c.97C>T	7.37:g.65705509C>T	ENSP00000302413:p.His33Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV	A4D2M0|Q6FGM7	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.H33Y	ENST00000304842.5	37	c.97	CCDS5533.1	7	.	.	.	.	.	.	.	.	.	.	C	12.90	2.075182	0.36662	.	.	ENSG00000169902	ENST00000304842;ENST00000442120;ENST00000544114;ENST00000451388	.	.	.	5.93	5.93	0.95920	.	0.045304	0.85682	D	0.000000	T	0.49184	0.1542	L	0.27053	0.805	0.80722	D	1	P;B	0.43750	0.816;0.172	P;B	0.45712	0.491;0.067	T	0.41752	-0.9491	9	0.02654	T	1	-17.9531	19.3279	0.94270	0.0:1.0:0.0:0.0	.	33;33	F5H7U7;O60507	.;TPST1_HUMAN	Y	33	.	ENSP00000302413:H33Y	H	+	1	0	TPST1	65342944	1.000000	0.71417	1.000000	0.80357	0.968000	0.65278	6.900000	0.75687	2.803000	0.96430	0.585000	0.79938	CAC	TPST1	-	NULL	ENSG00000169902		0.488	TPST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPST1	HGNC	protein_coding	OTTHUMT00000251705.2	48	0.00	0	C	NM_003596		65705509	65705509	+1	no_errors	ENST00000304842	ensembl	human	known	69_37n	missense	51	10.53	6	SNP	1.000	T
TPTEP1	387590	genome.wustl.edu	37	22	17094952	17094952	+	lincRNA	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr22:17094952C>T	ENST00000426585.1	+	0	172				KB-7G2.9_ENST00000438850.1_lincRNA					transmembrane phosphatase with tensin homology pseudogene 1																		ccaaggctctctgactccttc	0.592																																						dbGAP											0																																										-	-	-			0					22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17094952C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		RNA	SNP	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			TPTEP1	-	-	ENSG00000100181		0.592	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	HGNC	lincRNA	OTTHUMT00000280575.1	30	0.00	0	C	NR_001591		17094952	17094952	+1	no_errors	ENST00000588548	ensembl	human	known	69_37n	rna	22	18.52	5	SNP	0.000	T
TRAFD1	10906	genome.wustl.edu	37	12	112579878	112579879	+	Intron	INS	-	-	T	rs200216113|rs373642082	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:112579878_112579879insT	ENST00000257604.5	+	6	1260				TRAFD1_ENST00000412615.2_Intron	NM_001143906.1	NP_001137378.1	O14545	TRAD1_HUMAN	TRAF-type zinc finger domain containing 1						negative regulation of innate immune response (GO:0045824)|response to cytokine (GO:0034097)		metal ion binding (GO:0046872)			kidney(5)|large_intestine(3)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	17						ATGTTGGTTGGTTTTTTTTTTT	0.431																																						dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AB007447	CCDS9160.1	12q24.13	2013-01-25			ENSG00000135148	ENSG00000135148			24808	protein-coding gene	gene with protein product		613197				12477932	Standard	NM_006700		Approved	FLN29	uc001ttp.3	O14545	OTTHUMG00000169640	ENST00000257604.5:c.644-14->T	12.37:g.112579889_112579889dupT		Somatic		WXS	Illumina GAIIx	Phase_IV	A8K5L6|B4DI89	Frame_Shift_Ins	INS	NULL	p.F8fs	ENST00000257604.5	37	c.11_12	CCDS9160.1	12																																																																																			TRAFD1	-	NULL	ENSG00000135148		0.431	TRAFD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAFD1	HGNC	protein_coding	OTTHUMT00000405214.1	9	0.00	0	-	NM_006700		112579878	112579879	+1	no_stop_codon:bad_bp_length_for_coding_region	ENST00000548277	ensembl	human	putative	69_37n	frame_shift_ins	3	50.00	3	INS	0.016:0.000	T
TRDN	10345	genome.wustl.edu	37	6	123580807	123580807	+	Splice_Site	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:123580807C>A	ENST00000398178.3	-	35	1853	c.1832G>T	c.(1831-1833)gGa>gTa	p.G611V	TRDN_ENST00000334268.4_Splice_Site_p.G611V	NM_006073.3	NP_006064.2	Q13061	TRDN_HUMAN	triadin	611					cellular calcium ion homeostasis (GO:0006874)|cytoplasmic microtubule organization (GO:0031122)|endoplasmic reticulum membrane organization (GO:0090158)|heart contraction (GO:0060047)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|myotube differentiation (GO:0014902)|negative regulation of ryanodine-sensitive calcium-release channel activity (GO:0060315)|positive regulation of cell communication by electrical coupling involved in cardiac conduction (GO:1901846)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cell communication by electrical coupling (GO:0010649)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to organic cyclic compound (GO:0014070)|transmembrane transport (GO:0055085)	calcium channel complex (GO:0034704)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)	ion channel binding (GO:0044325)|protein binding, bridging (GO:0030674)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(1)|kidney(1)|large_intestine(8)|liver(1)|lung(22)|ovary(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)	41				GBM - Glioblastoma multiforme(226;0.184)		TTTCTTCTTTCCTAGGGGAAA	0.294																																						dbGAP											0													67.0	57.0	60.0					6																	123580807		1606	3642	5248	-	-	-	SO:0001630	splice_region_variant	0			U18985	CCDS59035.1, CCDS75511.1	6q22.31	2008-05-15			ENSG00000186439	ENSG00000186439			12261	protein-coding gene	gene with protein product		603283				7588753	Standard	NM_001251987		Approved		uc003pzj.2	Q13061	OTTHUMG00000015497	ENST00000398178.3:c.1832-1G>T	6.37:g.123580807C>A		Somatic		WXS	Illumina GAIIx	Phase_IV	A5D6W5|F5H2W7|Q6NSB8	Missense_Mutation	SNP	pfam_Asp-B-hydro/Triadin_dom	p.G611V	ENST00000398178.3	37	c.1832	CCDS55053.1	6	.	.	.	.	.	.	.	.	.	.	C	9.562	1.118845	0.20877	.	.	ENSG00000186439	ENST00000398178;ENST00000398161;ENST00000334268	T;T	0.21734	2.07;1.99	4.16	-0.936	0.10419	.	0.716506	0.12452	N	0.467627	T	0.02970	0.0088	L	0.27053	0.805	0.20403	N	0.999909	B	0.10296	0.003	B	0.09377	0.004	T	0.42982	-0.9419	10	0.27082	T	0.32	.	0.6746	0.00864	0.3428:0.307:0.1529:0.1973	.	611	Q13061	TRDN_HUMAN	V	611;613;611	ENSP00000381240:G611V;ENSP00000333984:G611V	ENSP00000333984:G611V	G	-	2	0	TRDN	123622506	0.022000	0.18835	0.183000	0.23137	0.126000	0.20510	-0.525000	0.06214	-0.099000	0.12263	0.650000	0.86243	GGA	TRDN	-	NULL	ENSG00000186439		0.294	TRDN-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRDN	HGNC	protein_coding		60	0.00	0	C		Missense_Mutation	123580807	123580807	-1	no_errors	ENST00000398178	ensembl	human	known	69_37n	missense	39	27.78	15	SNP	0.080	A
TRIM5	85363	genome.wustl.edu	37	11	5686709	5686709	+	Intron	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:5686709G>A	ENST00000380034.3	-	8	1152				TRIM5_ENST00000396855.3_Intron|TRIM5_ENST00000305836.5_Intron|TRIM5_ENST00000396847.3_3'UTR|TRIM5_ENST00000483835.1_Intron|TRIM5_ENST00000380027.1_Intron|TRIM5_ENST00000396853.4_Intron	NM_033034.2|NM_033092.2	NP_149023.2|NP_149083.2	Q9C035	TRIM5_HUMAN	tripartite motif containing 5						activation of innate immune response (GO:0002218)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein K63-linked ubiquitination (GO:0070534)|protein trimerization (GO:0070206)|regulation of lipopolysaccharide-mediated signaling pathway (GO:0031664)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|signaling pattern recognition receptor activity (GO:0008329)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	21		Medulloblastoma(188;0.00225)|Breast(177;0.0204)|all_neural(188;0.0212)|Lung NSC(207;0.138)|all_lung(207;0.221)		Epithelial(150;7.21e-09)|BRCA - Breast invasive adenocarcinoma(625;0.139)		AGACTTGAGAGAAAACTGGGA	0.348											OREG0003727	type=REGULATORY REGION|Gene=AK074363|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																										dbGAP											0													63.0	68.0	66.0					11																	5686709		2158	4289	6447	-	-	-	SO:0001627	intron_variant	0			AF220025	CCDS31392.1, CCDS31393.1, CCDS31394.1	11p15	2014-06-03	2011-01-25		ENSG00000132256	ENSG00000132256		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	16276	protein-coding gene	gene with protein product	"""tripartite motif protein TRIM5"", ""tripartite motif protein TRIM"""	608487	"""tripartite motif-containing 5"""			11331580	Standard	NM_033034		Approved	RNF88, TRIM5alpha	uc001mbm.2	Q9C035	OTTHUMG00000066893	ENST00000380034.3:c.896-84C>T	11.37:g.5686709G>A		Somatic	628	WXS	Illumina GAIIx	Phase_IV	A6NGQ1|A8WFA8|D3DQS8|D3DQS9|G3GJY1|Q2MLV4|Q2MLV8|Q2MLV9|Q2MLW1|Q2MLW3|Q2MLW4|Q2MLW6|Q2MLW7|Q2MLX1|Q2MLX2|Q2MLX3|Q2MLX5|Q2MLY3|Q2MLY4|Q2V6Q6|Q6GX26|Q8WU46|Q96SR5|Q9C031|Q9C032|Q9C033|Q9C034	RNA	SNP	-	NULL	ENST00000380034.3	37	NULL	CCDS31393.1	11																																																																																			TRIM5	-	-	ENSG00000132256		0.348	TRIM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM5	HGNC	protein_coding	OTTHUMT00000143360.3	40	0.00	0	G	NM_033034		5686709	5686709	-1	no_errors	ENST00000492086	ensembl	human	known	69_37n	rna	38	13.64	6	SNP	0.000	A
TRIM73	375593	genome.wustl.edu	37	7	75028334	75028334	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:75028334C>T	ENST00000437796.1	+	1	136	c.117C>T	c.(115-117)tgC>tgT	p.C39C	TRIM73_ENST00000323819.3_Silent_p.C39C|TRIM73_ENST00000450434.1_Intron|TRIM73_ENST00000430211.1_Silent_p.C39C|TRIM73_ENST00000447409.2_Silent_p.C39C			Q86UV7	TRI73_HUMAN	tripartite motif containing 73	39						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(1)|lung(1)|pancreas(1)	4						GCAAGGGCTGCCTGGTTTCCC	0.632																																						dbGAP											0													42.0	38.0	40.0					7																	75028334		2200	4272	6472	-	-	-	SO:0001819	synonymous_variant	0			AF498998	CCDS34665.1	7q11.23	2013-01-09	2011-01-25	2006-03-31		ENSG00000178809		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	18162	protein-coding gene	gene with protein product		612549	"""tripartite motif-containing 50B"", ""tripartite motif-containing 73"""	TRIM50B			Standard	NM_198924		Approved		uc003udc.1	Q86UV7		ENST00000437796.1:c.117C>T	7.37:g.75028334C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q8N0S3	Silent	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.C39	ENST00000437796.1	37	c.117	CCDS34665.1	7																																																																																			TRIM73	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	ENSG00000178809		0.632	TRIM73-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIM73	HGNC	protein_coding	OTTHUMT00000342950.1	54	0.00	0	C			75028334	75028334	+1	no_errors	ENST00000323819	ensembl	human	known	69_37n	silent	50	13.79	8	SNP	0.996	T
TRPA1	8989	genome.wustl.edu	37	8	72948630	72948630	+	Silent	SNP	G	G	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:72948630G>T	ENST00000262209.4	-	21	2655	c.2448C>A	c.(2446-2448)atC>atA	p.I816I	RP11-383H13.1_ENST00000457356.4_Intron|RP11-383H13.1_ENST00000537896.1_Intron|RP11-383H13.1_ENST00000524152.1_Intron|TRPA1_ENST00000519720.1_5'UTR	NM_007332.2	NP_015628.2	O75762	TRPA1_HUMAN	transient receptor potential cation channel, subfamily A, member 1	816					calcium ion transmembrane transport (GO:0070588)|detection of chemical stimulus involved in sensory perception of pain (GO:0050968)|detection of mechanical stimulus involved in sensory perception of pain (GO:0050966)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to pain (GO:0048265)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|stereocilium bundle (GO:0032421)	calcium channel activity (GO:0005262)|channel activity (GO:0015267)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(26)|lung(44)|ovary(4)|prostate(6)|stomach(1)	98			Epithelial(68;0.223)		Menthol(DB00825)	GCACAAAAATGATGCCCGTCG	0.348																																						dbGAP											0													66.0	66.0	66.0					8																	72948630		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			Y10601	CCDS34908.1	8q13	2013-01-10	2003-11-20	2003-11-20	ENSG00000104321	ENSG00000104321		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	497	protein-coding gene	gene with protein product		604775	"""ankyrin-like with transmembrane domains 1"""	ANKTM1		16382100	Standard	NM_007332		Approved		uc003xza.3	O75762	OTTHUMG00000164516	ENST00000262209.4:c.2448C>A	8.37:g.72948630G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NIN6	Silent	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I816	ENST00000262209.4	37	c.2448	CCDS34908.1	8																																																																																			TRPA1	-	pfam_Ion_trans_dom	ENSG00000104321		0.348	TRPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPA1	HGNC	protein_coding	OTTHUMT00000379079.2	27	0.00	0	G	NM_007332		72948630	72948630	-1	no_errors	ENST00000262209	ensembl	human	known	69_37n	silent	19	34.48	10	SNP	0.782	T
TRPC4	7223	genome.wustl.edu	37	13	38320505	38320505	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:38320505C>T	ENST00000379705.3	-	3	1323	c.466G>A	c.(466-468)Gag>Aag	p.E156K	TRPC4_ENST00000426868.2_Missense_Mutation_p.E156K|TRPC4_ENST00000447043.1_Missense_Mutation_p.E156K|TRPC4_ENST00000355779.2_Missense_Mutation_p.E156K|TRPC4_ENST00000379681.3_Missense_Mutation_p.E156K|TRPC4_ENST00000379673.2_Missense_Mutation_p.E156K|TRPC4_ENST00000358477.2_Missense_Mutation_p.E156K|TRPC4_ENST00000379679.1_Intron|TRPC4_ENST00000338947.5_Intron			Q9UBN4	TRPC4_HUMAN	transient receptor potential cation channel, subfamily C, member 4	156	Multimerization domain. {ECO:0000250}.				axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|gamma-aminobutyric acid secretion (GO:0014051)|ion transmembrane transport (GO:0034220)|oligodendrocyte differentiation (GO:0048709)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|calcium channel complex (GO:0034704)|caveola (GO:0005901)|cell surface (GO:0009986)|cortical cytoskeleton (GO:0030863)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|cadherin binding (GO:0045296)|inositol 1,4,5 trisphosphate binding (GO:0070679)|store-operated calcium channel activity (GO:0015279)			NS(2)|breast(4)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(26)|lung(30)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	83				all cancers(112;1.92e-08)|Epithelial(112;5.04e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.000677)|GBM - Glioblastoma multiforme(144;0.00623)|BRCA - Breast invasive adenocarcinoma(63;0.0126)		TTTATTATCTCATAATTATTT	0.428																																						dbGAP											0													84.0	98.0	93.0					13																	38320505		2203	4300	6503	-	-	-	SO:0001583	missense	0			U40983	CCDS9365.1, CCDS45035.1, CCDS45036.1, CCDS45038.1, CCDS45039.1	13q13.3	2013-01-10			ENSG00000133107	ENSG00000133107		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12336	protein-coding gene	gene with protein product		603651				8646775, 16382100	Standard	NM_016179		Approved	HTRP4, TRP4	uc010abx.3	Q9UBN4	OTTHUMG00000016752	ENST00000379705.3:c.466G>A	13.37:g.38320505C>T	ENSP00000369027:p.Glu156Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B1ALE0|B1ALE1|B1ALE2|Q15721|Q3SWS6|Q96P03|Q96P04|Q96P05|Q9UIB0|Q9UIB1|Q9UIB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_TRP_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_TRPC4_channel,prints_TRPC_channel,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	p.E156K	ENST00000379705.3	37	c.466	CCDS9365.1	13	.	.	.	.	.	.	.	.	.	.	C	35	5.577984	0.96565	.	.	ENSG00000133107	ENST00000379705;ENST00000379681;ENST00000426868;ENST00000355779;ENST00000358477;ENST00000379673;ENST00000447043	T;T;T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;-0.33;-0.33;-0.33	5.82	5.82	0.92795	Ankyrin repeat-containing domain (3);	0.000000	0.85682	D	0.000000	D	0.83275	0.5219	M	0.77616	2.38	0.80722	D	1	P;D;D;D;D	0.67145	0.936;0.987;0.996;0.976;0.981	P;P;D;P;D	0.76071	0.839;0.903;0.987;0.901;0.974	D	0.84290	0.0499	10	0.87932	D	0	-27.9582	20.0951	0.97834	0.0:1.0:0.0:0.0	.	156;156;156;156;156	Q9UBN4-3;Q9UBN4-4;Q9UBN4-5;Q9UBN4-2;Q9UBN4	.;.;.;.;TRPC4_HUMAN	K	156	ENSP00000369027:E156K;ENSP00000369003:E156K;ENSP00000410133:E156K;ENSP00000348025:E156K;ENSP00000351264:E156K;ENSP00000368995:E156K;ENSP00000414316:E156K	ENSP00000348025:E156K	E	-	1	0	TRPC4	37218505	1.000000	0.71417	0.997000	0.53966	0.945000	0.59286	6.092000	0.71414	2.753000	0.94483	0.467000	0.42956	GAG	TRPC4	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,tigrfam_TRP_channel	ENSG00000133107		0.428	TRPC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4	HGNC	protein_coding	OTTHUMT00000044574.2	65	0.00	0	C	NM_003306		38320505	38320505	-1	no_errors	ENST00000379681	ensembl	human	known	69_37n	missense	54	11.48	7	SNP	1.000	T
TRPV2	51393	genome.wustl.edu	37	17	16326933	16326933	+	Nonsense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:16326933C>G	ENST00000338560.7	+	5	1175	c.776C>G	c.(775-777)tCa>tGa	p.S259*	TRPV2_ENST00000577397.1_Intron	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	259	Required for interaction with SLC50A1. {ECO:0000250}.				calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		TCGGACAACTCAGCTGAGAAC	0.607																																						dbGAP											0													85.0	75.0	78.0					17																	16326933		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.776C>G	17.37:g.16326933C>G	ENSP00000342222:p.Ser259*	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NML2|A8K0Z0|Q9Y670	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	p.S259*	ENST00000338560.7	37	c.776	CCDS32576.1	17	.	.	.	.	.	.	.	.	.	.	C	36	5.801587	0.96960	.	.	ENSG00000187688	ENST00000338560	.	.	.	6.17	6.17	0.99709	.	0.344418	0.30649	N	0.009179	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-29.7315	19.8676	0.96824	0.0:1.0:0.0:0.0	.	.	.	.	X	259	.	ENSP00000342222:S259X	S	+	2	0	TRPV2	16267658	1.000000	0.71417	0.973000	0.42090	0.041000	0.13682	4.368000	0.59505	2.941000	0.99782	0.655000	0.94253	TCA	TRPV2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	ENSG00000187688		0.607	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	HGNC	protein_coding	OTTHUMT00000130464.2	75	0.00	0	C	NM_016113		16326933	16326933	+1	no_errors	ENST00000338560	ensembl	human	known	69_37n	nonsense	68	16.05	13	SNP	0.998	G
TRPV4	59341	genome.wustl.edu	37	12	110224578	110224578	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:110224578G>A	ENST00000418703.2	-	13	2367	c.2273C>T	c.(2272-2274)tCt>tTt	p.S758F	TRPV4_ENST00000541794.1_Missense_Mutation_p.S711F|TRPV4_ENST00000392719.2_Missense_Mutation_p.S711F|TRPV4_ENST00000261740.2_Missense_Mutation_p.S758F|TRPV4_ENST00000537083.1_Missense_Mutation_p.S698F|TRPV4_ENST00000536838.1_Missense_Mutation_p.S724F|TRPV4_ENST00000346520.2_Missense_Mutation_p.S698F|TRPV4_ENST00000544971.1_Missense_Mutation_p.S651F	NM_001177431.1	NP_001170902.1	Q9HBA0	TRPV4_HUMAN	transient receptor potential cation channel, subfamily V, member 4	758					actin cytoskeleton reorganization (GO:0031532)|actin filament organization (GO:0007015)|calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|cell death (GO:0008219)|cell volume homeostasis (GO:0006884)|cell-cell junction assembly (GO:0007043)|cellular calcium ion homeostasis (GO:0006874)|cellular hypotonic response (GO:0071476)|cellular response to heat (GO:0034605)|cellular response to osmotic stress (GO:0071470)|cortical microtubule organization (GO:0043622)|hyperosmotic salinity response (GO:0042538)|ion transmembrane transport (GO:0034220)|microtubule polymerization (GO:0046785)|negative regulation of neuron projection development (GO:0010977)|osmosensory signaling pathway (GO:0007231)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of microtubule depolymerization (GO:0031117)|regulation of response to osmotic stress (GO:0047484)|response to mechanical stimulus (GO:0009612)|transmembrane transport (GO:0055085)|vasopressin secretion (GO:0030103)	adherens junction (GO:0005912)|cell surface (GO:0009986)|cilium (GO:0005929)|cortical actin cytoskeleton (GO:0030864)|cytoplasmic microtubule (GO:0005881)|cytoplasmic vesicle (GO:0031410)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|beta-tubulin binding (GO:0048487)|calcium channel activity (GO:0005262)|calmodulin binding (GO:0005516)|cation channel activity (GO:0005261)|microtubule binding (GO:0008017)|osmosensor activity (GO:0005034)|protein kinase binding (GO:0019901)|protein kinase C binding (GO:0005080)|SH2 domain binding (GO:0042169)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(7)|lung(7)|ovary(3)|prostate(2)|skin(4)|stomach(1)	35						CATCTCCCCAGAGCGGAAGGC	0.667																																						dbGAP											0													90.0	66.0	74.0					12																	110224578		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF263523	CCDS9134.1, CCDS9135.1, CCDS53827.1, CCDS53828.1, CCDS53829.1	12q24.1	2014-09-17				ENSG00000111199		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18083	protein-coding gene	gene with protein product	"""osmosensitive transient receptor potential channel 4"""	605427				11025659, 11081638, 16382100, 20037587	Standard	NM_147204		Approved	OTRPC4, TRP12, VROAC, VRL-2, VR-OAC, CMT2C	uc001tpk.2	Q9HBA0		ENST00000418703.2:c.2273C>T	12.37:g.110224578G>A	ENSP00000406191:p.Ser758Phe	Somatic		WXS	Illumina GAIIx	Phase_IV	B7ZKQ6|Q17R79|Q2Y122|Q2Y123|Q2Y124|Q86YZ6|Q8NDY7|Q8NG64|Q96Q92|Q96RS7|Q9HBC0	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_Ion_trans_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,prints_TRPV4_channel,tigrfam_TRP_channel	p.S758F	ENST00000418703.2	37	c.2273	CCDS9134.1	12	.	.	.	.	.	.	.	.	.	.	G	18.46	3.629242	0.67015	.	.	ENSG00000111199	ENST00000418703;ENST00000261740;ENST00000392719;ENST00000346520;ENST00000544971;ENST00000537083;ENST00000541794;ENST00000536838	D;D;D;D;D;D;D;D	0.90197	-2.53;-2.53;-2.4;-2.53;-2.42;-2.53;-2.4;-2.63	4.77	4.77	0.60923	.	0.174212	0.51477	D	0.000084	D	0.94082	0.8103	M	0.70595	2.14	0.45216	D	0.998229	P;D;D;P;D	0.60160	0.951;0.987;0.973;0.946;0.973	P;P;P;P;P	0.61800	0.822;0.736;0.668;0.8;0.894	D	0.94437	0.7655	10	0.66056	D	0.02	-46.8826	16.8762	0.86052	0.0:0.0:1.0:0.0	.	698;758;651;711;724	Q9HBA0-2;Q9HBA0;Q9HBA0-6;Q9HBA0-4;Q9HBA0-5	.;TRPV4_HUMAN;.;.;.	F	758;758;711;698;651;698;711;724	ENSP00000406191:S758F;ENSP00000261740:S758F;ENSP00000376480:S711F;ENSP00000319003:S698F;ENSP00000443611:S651F;ENSP00000442738:S698F;ENSP00000442167:S711F;ENSP00000444336:S724F	ENSP00000261740:S758F	S	-	2	0	TRPV4	108708961	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.738000	0.62073	2.645000	0.89757	0.655000	0.94253	TCT	TRPV4	-	tigrfam_TRP_channel	ENSG00000111199		0.667	TRPV4-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	TRPV4	HGNC	protein_coding	OTTHUMT00000403270.1	88	0.00	0	G	NM_021625		110224578	110224578	-1	no_errors	ENST00000261740	ensembl	human	known	69_37n	missense	86	18.69	20	SNP	0.996	A
TSPAN14	81619	genome.wustl.edu	37	10	82275795	82275795	+	Intron	SNP	G	G	T	rs36113069	byFrequency	TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:82275795G>T	ENST00000429989.3	+	8	844				TSPAN14_ENST00000372156.1_Intron|TSPAN14_ENST00000341863.6_Intron|TSPAN14_ENST00000372164.3_Intron|TSPAN14_ENST00000265450.5_3'UTR|TSPAN14_ENST00000372158.1_Intron|TSPAN14_ENST00000481124.1_Intron	NM_030927.2	NP_112189.2	Q8NG11	TSN14_HUMAN	tetraspanin 14						establishment of protein localization to plasma membrane (GO:0090002)|positive regulation of Notch signaling pathway (GO:0045747)|protein maturation (GO:0051604)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|tetraspanin-enriched microdomain (GO:0097197)	enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|ovary(1)|skin(1)	7			Colorectal(32;0.229)			AGGGGCAGAGGCTGAGAGGAG	0.587													G|||	1100	0.219649	0.1868	0.2435	5008	,	,		17814	0.0317		0.2416	False		,,,				2504	0.4182					dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF311903	CCDS7369.1, CCDS44448.1	10q23.1	2013-02-14	2005-03-21	2005-03-21	ENSG00000108219	ENSG00000108219		"""Tetraspanins"""	23303	protein-coding gene	gene with protein product			"""transmembrane 4 superfamily member 14"""	TM4SF14		11230166	Standard	NM_030927		Approved	DC-TM4F2, MGC11352	uc001kcj.4	Q8NG11	OTTHUMG00000018615	ENST00000429989.3:c.622-165G>T	10.37:g.82275795G>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NHE1|B4DHY6|D3DWD7|D3DWD8|Q567U7|Q9BU34|Q9H0U1	RNA	SNP	-	NULL	ENST00000429989.3	37	NULL	CCDS7369.1	10																																																																																			TSPAN14	-	-	ENSG00000108219		0.587	TSPAN14-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TSPAN14	HGNC	protein_coding	OTTHUMT00000049081.2	8	0.00	0	G	NM_030927		82275795	82275795	+1	no_errors	ENST00000265450	ensembl	human	known	69_37n	rna	2	87.50	14	SNP	0.000	T
TTN	7273	genome.wustl.edu	37	2	179442805	179442805	+	Missense_Mutation	SNP	C	C	G	rs200797552		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:179442805C>G	ENST00000591111.1	-	272	63738	c.63514G>C	c.(63514-63516)Gaa>Caa	p.E21172Q	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E13873Q|TTN_ENST00000460472.2_Missense_Mutation_p.E13748Q|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E22813Q|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E13940Q|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E20245Q|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21172	Fibronectin type-III 53. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AATTCATATTCAAGACCTTCA	0.438																																						dbGAP											0													127.0	118.0	121.0					2																	179442805		1889	4125	6014	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63514G>C	2.37:g.179442805C>G	ENSP00000465570:p.Glu21172Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E20245Q	ENST00000591111.1	37	c.60733		2	.	.	.	.	.	.	.	.	.	.	C	15.81	2.942979	0.53079	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.58060	0.36;0.36;0.36;0.36	5.83	5.83	0.93111	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74030	0.3663	M	0.70787	2.145	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.998;0.998;0.998	T	0.75102	-0.3436	9	0.87932	D	0	.	20.1197	0.97955	0.0:1.0:0.0:0.0	.	13748;13873;13940;21172	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	Q	20245;13748;13940;13873;13746	ENSP00000343764:E20245Q;ENSP00000434586:E13748Q;ENSP00000340554:E13940Q;ENSP00000352154:E13873Q	ENSP00000340554:E13940Q	E	-	1	0	TTN	179151051	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.818000	0.86416	2.770000	0.95276	0.650000	0.86243	GAA	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.438	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	37	0.00	0	C	NM_133378		179442805	179442805	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	40	13.04	6	SNP	1.000	G
TTN	7273	genome.wustl.edu	37	2	179442814	179442814	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:179442814C>T	ENST00000591111.1	-	272	63729	c.63505G>A	c.(63505-63507)Gaa>Aaa	p.E21169K	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.E13870K|TTN_ENST00000460472.2_Missense_Mutation_p.E13745K|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E22810K|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000342175.6_Missense_Mutation_p.E13937K|RP11-171I2.2_ENST00000603521.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.E20242K|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000419746.1_RNA|RP11-171I2.5_ENST00000604215.1_RNA			Q8WZ42	TITIN_HUMAN	titin	21169	Fibronectin type-III 53. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TCAAGACCTTCAGTTAATCCT	0.448																																						dbGAP											0													134.0	125.0	128.0					2																	179442814		1889	4119	6008	-	-	-	SO:0001583	missense	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.63505G>A	2.37:g.179442814C>T	ENSP00000465570:p.Glu21169Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E20242K	ENST00000591111.1	37	c.60724		2	.	.	.	.	.	.	.	.	.	.	C	17.80	3.479139	0.63849	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.57907	0.37;0.37;0.37;0.37	5.92	5.92	0.95590	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.75657	0.3879	M	0.78916	2.43	0.80722	D	1	D;D;D;D	0.76494	0.999;0.999;0.999;0.999	D;D;D;D	0.83275	0.996;0.996;0.996;0.996	T	0.76806	-0.2823	9	0.87932	D	0	.	20.3343	0.98733	0.0:1.0:0.0:0.0	.	13745;13870;13937;21169	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	20242;13745;13937;13870;13743	ENSP00000343764:E20242K;ENSP00000434586:E13745K;ENSP00000340554:E13937K;ENSP00000352154:E13870K	ENSP00000340554:E13937K	E	-	1	0	TTN	179151060	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.818000	0.86416	2.822000	0.97130	0.650000	0.86243	GAA	TTN	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3	ENSG00000155657		0.448	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	31	0.00	0	C	NM_133378		179442814	179442814	-1	no_errors	ENST00000342992	ensembl	human	known	69_37n	missense	38	11.63	5	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179531966	179531966	+	Intron	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:179531966C>T	ENST00000591111.1	-	153	34489				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.E11932K|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000592630.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTATACCTTCAGTTGGAGGA	0.348																																						dbGAP											0													17.0	16.0	16.0					2																	179531966		874	1991	2865	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.34264+2978G>A	2.37:g.179531966C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_PPAK_motif,pfam_Titin_Z,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,superfamily_ARM-type_fold,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.E11932K	ENST00000591111.1	37	c.35794		2	.	.	.	.	.	.	.	.	.	.	C	10.80	1.453884	0.26161	.	.	ENSG00000155657	ENST00000541862;ENST00000392423	.	.	.	5.32	0.211	0.15236	.	.	.	.	.	T	0.24661	0.0598	.	.	.	0.50313	D	0.999867	B	0.21606	0.058	B	0.20384	0.029	T	0.18935	-1.0321	7	0.06236	T	0.91	.	5.6616	0.17672	0.0:0.4784:0.1296:0.392	.	234	Q71S18	.	K	234;86	.	ENSP00000376219:E86K	E	-	1	0	TTN	179240211	0.003000	0.15002	0.052000	0.19188	0.956000	0.61745	-0.297000	0.08276	-0.139000	0.11414	-0.345000	0.07892	GAA	TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom	ENSG00000155657		0.348	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	47	0.00	0	C	NM_133378		179531966	179531966	-1	no_errors	ENST00000589042	ensembl	human	putative	69_37n	missense	53	15.87	10	SNP	0.053	T
TTN	7273	genome.wustl.edu	37	2	179611025	179611025	+	Intron	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:179611025C>G	ENST00000591111.1	-	46	10585				TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Intron|TTN_ENST00000342175.6_Intron|TTN-AS1_ENST00000590773.1_RNA|TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.E5368Q			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATTTTTAGTTCTTTGTCTTCT	0.318																																						dbGAP											0													51.0	47.0	49.0					2																	179611025		2203	4299	6502	-	-	-	SO:0001627	intron_variant	0			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10361-4377G>C	2.37:g.179611025C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.E5368Q	ENST00000591111.1	37	c.16102		2	.	.	.	.	.	.	.	.	.	.	C	8.211	0.800354	0.16397	.	.	ENSG00000155657	ENST00000360870;ENST00000306136	T	0.58797	0.31	5.88	5.88	0.94601	.	.	.	.	.	T	0.51941	0.1704	L	0.36672	1.1	0.80722	D	1	B	0.15930	0.015	B	0.15870	0.014	T	0.38112	-0.9676	9	0.32370	T	0.25	.	20.2422	0.98381	0.0:1.0:0.0:0.0	.	5368	Q8WZ42-6	.	Q	5368;649	ENSP00000354117:E5368Q	ENSP00000304714:E649Q	E	-	1	0	TTN	179319270	1.000000	0.71417	0.993000	0.49108	0.140000	0.21249	5.999000	0.70665	2.782000	0.95742	0.655000	0.94253	GAA	TTN	-	NULL	ENSG00000155657		0.318	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	17	0.00	0	C	NM_133378		179611025	179611025	-1	no_errors	ENST00000360870	ensembl	human	known	69_37n	missense	11	26.67	4	SNP	1.000	G
TUBA1B	10376	genome.wustl.edu	37	12	49523124	49523124	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:49523124G>A	ENST00000336023.5	-	3	370	c.276C>T	c.(274-276)ctC>ctT	p.L92L	RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547712.1_RNA|RP11-386G11.10_ENST00000551496.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	92					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						TGCCTGTGATGAGCTGCTCAG	0.552																																						dbGAP											0													110.0	106.0	108.0					12																	49523124		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.276C>T	12.37:g.49523124G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	P04687|P05209|Q27I68|Q8WU19	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.L92	ENST00000336023.5	37	c.276	CCDS31792.1	12																																																																																			TUBA1B	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Beta_tubulin	ENSG00000123416		0.552	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1B	HGNC	protein_coding	OTTHUMT00000409005.1	90	0.00	0	G	NM_006082		49523124	49523124	-1	no_errors	ENST00000336023	ensembl	human	known	69_37n	silent	97	19.83	24	SNP	1.000	A
TUBA1B	10376	genome.wustl.edu	37	12	49523127	49523127	+	Silent	SNP	C	C	T	rs3175477		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:49523127C>T	ENST00000336023.5	-	3	367	c.273G>A	c.(271-273)caG>caA	p.Q91Q	RP11-386G11.10_ENST00000548149.1_RNA|RP11-386G11.10_ENST00000552893.1_RNA|RP11-386G11.10_ENST00000547712.1_RNA|RP11-386G11.10_ENST00000551496.1_RNA|RP11-386G11.10_ENST00000547387.1_RNA	NM_006082.2	NP_006073.2	P68363	TBA1B_HUMAN	tubulin, alpha 1b	91					'de novo' posttranslational protein folding (GO:0051084)|cell division (GO:0051301)|cellular protein metabolic process (GO:0044267)|cellular response to interleukin-4 (GO:0071353)|cytoskeleton-dependent intracellular transport (GO:0030705)|microtubule cytoskeleton organization (GO:0000226)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasmic microtubule (GO:0005881)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	double-stranded RNA binding (GO:0003725)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(2)|cervix(1)|endometrium(3)|large_intestine(2)|lung(4)	12						CTGTGATGAGCTGCTCAGGGT	0.552																																						dbGAP											0													109.0	106.0	107.0					12																	49523127		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AF081484	CCDS31792.1	12q13.12	2007-02-12				ENSG00000123416		"""Tubulins"""	18809	protein-coding gene	gene with protein product	"""tubulin, alpha, ubiquitous"""	602530				12054644, 6646120	Standard	NM_006082		Approved	K-ALPHA-1	uc001rtm.3	P68363	OTTHUMG00000170410	ENST00000336023.5:c.273G>A	12.37:g.49523127C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	P04687|P05209|Q27I68|Q8WU19	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Alpha_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Beta_tubulin,prints_Delta_tubulin	p.Q91	ENST00000336023.5	37	c.273	CCDS31792.1	12																																																																																			TUBA1B	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Alpha_tubulin,prints_Beta_tubulin	ENSG00000123416		0.552	TUBA1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBA1B	HGNC	protein_coding	OTTHUMT00000409005.1	89	0.00	0	C	NM_006082		49523127	49523127	-1	no_errors	ENST00000336023	ensembl	human	known	69_37n	silent	92	20.00	23	SNP	1.000	T
TULP1	7287	genome.wustl.edu	37	6	35480457	35480457	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:35480457C>T	ENST00000229771.6	-	2	137	c.58G>A	c.(58-60)Gaa>Aaa	p.E20K	TULP1_ENST00000322263.4_Missense_Mutation_p.E20K	NM_003322.3	NP_003313.3	O00294	TULP1_HUMAN	tubby like protein 1	20					dendrite development (GO:0016358)|detection of light stimulus involved in visual perception (GO:0050908)|eye photoreceptor cell development (GO:0042462)|phagocytosis (GO:0006909)|photoreceptor cell maintenance (GO:0045494)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|retina development in camera-type eye (GO:0060041)|retina homeostasis (GO:0001895)|visual perception (GO:0007601)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|synapse (GO:0045202)	actin filament binding (GO:0051015)|G-protein coupled photoreceptor activity (GO:0008020)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(5)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	19						AGGCTTTCTTCTTCATGCCCA	0.627																																					GBM(55;1027 1091 11115 23439)	dbGAP											0													73.0	79.0	77.0					6																	35480457		2203	4300	6503	-	-	-	SO:0001583	missense	0			U82468	CCDS4807.1, CCDS75436.1	6p21.3	2014-01-28			ENSG00000112041	ENSG00000112041			12423	protein-coding gene	gene with protein product		602280		RP14		9096357, 9521870	Standard	NM_003322		Approved	TUBL1, LCA15	uc003okv.4	O00294	OTTHUMG00000014575	ENST00000229771.6:c.58G>A	6.37:g.35480457C>T	ENSP00000229771:p.Glu20Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	O43536|Q5TGM5|Q8N571	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_C	p.E20K	ENST00000229771.6	37	c.58	CCDS4807.1	6	.	.	.	.	.	.	.	.	.	.	C	12.97	2.097288	0.37048	.	.	ENSG00000112041	ENST00000229771;ENST00000322263;ENST00000545327;ENST00000428978	D;D;T	0.85702	-1.51;-2.02;0.1	4.2	4.2	0.49525	.	0.567662	0.17388	N	0.176021	T	0.80287	0.4595	L	0.53249	1.67	0.34959	D	0.752022	P;P	0.50156	0.932;0.919	P;B	0.47827	0.558;0.272	T	0.82705	-0.0325	10	0.66056	D	0.02	-8.8889	11.9782	0.53105	0.0:1.0:0.0:0.0	.	20;20	O00294-2;O00294	.;TULP1_HUMAN	K	20	ENSP00000229771:E20K;ENSP00000319414:E20K;ENSP00000406765:E20K	ENSP00000229771:E20K	E	-	1	0	TULP1	35588435	1.000000	0.71417	0.999000	0.59377	0.079000	0.17450	3.116000	0.50399	2.173000	0.68751	0.558000	0.71614	GAA	TULP1	-	NULL	ENSG00000112041		0.627	TULP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP1	HGNC	protein_coding	OTTHUMT00000040307.2	25	0.00	0	C			35480457	35480457	-1	no_errors	ENST00000229771	ensembl	human	known	69_37n	missense	22	33.33	11	SNP	1.000	T
TUSC3	7991	genome.wustl.edu	37	8	15531278	15531278	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:15531278C>G	ENST00000503731.1	+	6	879	c.731C>G	c.(730-732)tCt>tGt	p.S244C	TUSC3_ENST00000506802.1_Missense_Mutation_p.S244C|TUSC3_ENST00000509380.1_Missense_Mutation_p.S244C|TUSC3_ENST00000382020.4_Missense_Mutation_p.S244C|TUSC3_ENST00000503191.1_3'UTR	NM_006765.3	NP_006756.2	Q13454	TUSC3_HUMAN	tumor suppressor candidate 3	244					cell redox homeostasis (GO:0045454)|cellular protein metabolic process (GO:0044267)|cognition (GO:0050890)|magnesium ion transport (GO:0015693)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|mitochondrion (GO:0005739)|oligosaccharyltransferase complex (GO:0008250)	magnesium ion transmembrane transporter activity (GO:0015095)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(10)|lung(10)|ovary(2)	28				Colorectal(111;0.113)		GCTATGACTTCTGGCCAGATG	0.378																																						dbGAP											0													161.0	134.0	143.0					8																	15531278		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK026149	CCDS5993.1, CCDS5994.1	8p22	2010-10-22			ENSG00000104723	ENSG00000104723			30242	protein-coding gene	gene with protein product	"""oligosaccharyltransferase 3 homolog A (S. cerevisiae)"""	601385				8661104, 10097140	Standard	NM_178234		Approved	MGC13453, N33, OST3A, MRT7	uc003wwt.3	Q13454	OTTHUMG00000094803	ENST00000503731.1:c.731C>G	8.37:g.15531278C>G	ENSP00000424544:p.Ser244Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MSM0|D3DSP2|Q14911|Q14912|Q96FW0	Missense_Mutation	SNP	pfam_OligosaccharylTrfase_OST3/OST6,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold	p.S244C	ENST00000503731.1	37	c.731	CCDS5994.1	8	.	.	.	.	.	.	.	.	.	.	C	26.2	4.715652	0.89112	.	.	ENSG00000104723	ENST00000382020;ENST00000506802;ENST00000509380;ENST00000503731	D;D;D;D	0.82526	-1.62;-1.62;-1.62;-1.62	5.13	5.13	0.70059	.	0.000000	0.85682	D	0.000000	D	0.92107	0.7498	M	0.87097	2.86	0.80722	D	1	D;D;D;D;D;D	0.89917	0.992;1.0;0.999;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.991;0.997;0.992;1.0;1.0;0.998	D	0.92866	0.6310	10	0.66056	D	0.02	-24.9312	16.8849	0.86073	0.0:1.0:0.0:0.0	.	244;244;244;244;244;244	D6RDV0;D6RIY7;Q13454-2;Q13454;D6RA37;A8MSM0	.;.;.;TUSC3_HUMAN;.;.	C	244	ENSP00000371450:S244C;ENSP00000425777:S244C;ENSP00000423426:S244C;ENSP00000424544:S244C	ENSP00000221167:S244C	S	+	2	0	TUSC3	15575649	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.095000	0.76952	2.768000	0.95171	0.655000	0.94253	TCT	TUSC3	-	pfam_OligosaccharylTrfase_OST3/OST6	ENSG00000104723		0.378	TUSC3-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TUSC3	HGNC	protein_coding	OTTHUMT00000365367.1	68	0.00	0	C	NM_006765		15531278	15531278	+1	no_errors	ENST00000351598	ensembl	human	known	69_37n	missense	32	15.79	6	SNP	1.000	G
UBR4	23352	genome.wustl.edu	37	1	19525367	19525367	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:19525367C>T	ENST00000375254.3	-	4	461	c.434G>A	c.(433-435)aGa>aAa	p.R145K	UBR4_ENST00000375217.2_Missense_Mutation_p.R145K|UBR4_ENST00000375226.2_Missense_Mutation_p.R145K|UBR4_ENST00000375267.2_Missense_Mutation_p.R145K	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	145					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		AATTTCAGTTCTATCTAGTCG	0.403																																						dbGAP											0													124.0	121.0	122.0					1																	19525367		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.434G>A	1.37:g.19525367C>T	ENSP00000364403:p.Arg145Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.R145K	ENST00000375254.3	37	c.434	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	14.85	2.658571	0.47467	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.21932	1.99;1.99;1.98;1.98	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.24392	0.0591	N	0.14661	0.345	0.80722	D	1	P	0.44690	0.841	P	0.54210	0.745	T	0.04454	-1.0950	10	0.25106	T	0.35	.	17.7729	0.88499	0.0:1.0:0.0:0.0	.	145	Q5T4S7	UBR4_HUMAN	K	145	ENSP00000364403:R145K;ENSP00000364416:R145K;ENSP00000364365:R145K;ENSP00000364374:R145K	ENSP00000364365:R145K	R	-	2	0	UBR4	19397954	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.770000	0.85390	2.536000	0.85505	0.563000	0.77884	AGA	UBR4	-	NULL	ENSG00000127481		0.403	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	44	0.00	0	C	NM_020765		19525367	19525367	-1	no_errors	ENST00000375267	ensembl	human	known	69_37n	missense	53	11.67	7	SNP	1.000	T
USP15	9958	genome.wustl.edu	37	12	62784666	62784666	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:62784666G>A	ENST00000280377.5	+	15	1925	c.1867G>A	c.(1867-1869)Gaa>Aaa	p.E623K	USP15_ENST00000353364.3_Missense_Mutation_p.E594K|USP15_ENST00000393654.3_Missense_Mutation_p.E598K	NM_001252078.1	NP_001239007.1	Q9Y4E8	UBP15_HUMAN	ubiquitin specific peptidase 15	623	USP.				BMP signaling pathway (GO:0030509)|monoubiquitinated protein deubiquitination (GO:0035520)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|protein deubiquitination (GO:0016579)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|identical protein binding (GO:0042802)|SMAD binding (GO:0046332)|transforming growth factor beta receptor binding (GO:0005160)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(15)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	37			GBM - Glioblastoma multiforme(1;0.000276)	GBM - Glioblastoma multiforme(28;0.0622)		AATATCTACTGAAACTGAAGA	0.338																																					Melanoma(181;615 2041 39364 49691 50001)	dbGAP											0													63.0	60.0	61.0					12																	62784666		2203	4300	6503	-	-	-	SO:0001583	missense	0			AB011101	CCDS8963.1, CCDS58250.1, CCDS58251.1	12q14	2006-07-18	2005-08-08					"""Ubiquitin-specific peptidases"""	12613	protein-coding gene	gene with protein product		604731	"""ubiquitin specific protease 15"""			12838346	Standard	NM_001252078		Approved	KIAA0529, UNPH4	uc001src.2	Q9Y4E8	OTTHUMG00000170186	ENST00000280377.5:c.1867G>A	12.37:g.62784666G>A	ENSP00000280377:p.Glu623Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q08AL5|Q9H8G9|Q9HCA6|Q9UNP0|Q9Y5B5	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,superfamily_RNA3'P_cycl/enolpyr_Trfase_a/b,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.E623K	ENST00000280377.5	37	c.1867	CCDS58251.1	12	.	.	.	.	.	.	.	.	.	.	G	14.68	2.607830	0.46527	.	.	ENSG00000135655	ENST00000353364;ENST00000280377;ENST00000393654	T;T;T	0.18810	2.19;2.19;2.19	5.7	5.7	0.88788	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.340841	0.30401	N	0.009702	T	0.16599	0.0399	N	0.19112	0.55	0.58432	D	0.999998	B;B	0.06786	0.001;0.0	B;B	0.12156	0.007;0.003	T	0.09574	-1.0668	9	.	.	.	-7.6463	19.8278	0.96624	0.0:0.0:1.0:0.0	.	623;594	Q9Y4E8;Q9Y4E8-2	UBP15_HUMAN;.	K	594;623;598	ENSP00000258123:E594K;ENSP00000280377:E623K;ENSP00000377264:E598K	.	E	+	1	0	USP15	61070933	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.334000	0.90028	2.690000	0.91761	0.460000	0.39030	GAA	USP15	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000135655		0.338	USP15-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP15	HGNC	protein_coding	OTTHUMT00000407831.2	34	0.00	0	G	NM_006313		62784666	62784666	+1	no_errors	ENST00000280377	ensembl	human	known	69_37n	missense	36	18.18	8	SNP	1.000	A
USP2	9099	genome.wustl.edu	37	11	119228759	119228759	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:119228759C>T	ENST00000260187.2	-	9	1648	c.1354G>A	c.(1354-1356)Gag>Aag	p.E452K	USP2_ENST00000525735.1_Missense_Mutation_p.E243K|USP2_ENST00000455332.2_Missense_Mutation_p.E209K	NM_004205.4	NP_004196.4	O75604	UBP2_HUMAN	ubiquitin specific peptidase 2	452	Necessary for interaction with MDM4.|USP.				cell cycle (GO:0007049)|muscle organ development (GO:0007517)|negative regulation of skeletal muscle tissue development (GO:0048642)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of skeletal muscle tissue development (GO:0048643)|protein deubiquitination (GO:0016579)|protein stabilization (GO:0050821)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell cortex (GO:0005938)|centrosome (GO:0005813)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cyclin binding (GO:0030332)|cysteine-type endopeptidase activity (GO:0004197)|metal ion binding (GO:0046872)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|endometrium(2)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	24		all_hematologic(192;4.65e-05)|Breast(348;0.0101)|all_neural(223;0.0218)|Medulloblastoma(222;0.0425)|Renal(330;0.157)		BRCA - Breast invasive adenocarcinoma(274;3.93e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.000513)|Colorectal(284;0.0116)|Lung(307;0.0853)|LUSC - Lung squamous cell carcinoma(976;0.0889)		AATGTCACCTCAGGATAACCT	0.488																																						dbGAP											0													142.0	140.0	141.0					11																	119228759		2199	4295	6494	-	-	-	SO:0001583	missense	0			AF079564	CCDS8422.1, CCDS8423.1, CCDS58189.1	11q23.3	2008-02-05	2005-08-08			ENSG00000036672		"""Ubiquitin-specific peptidases"""	12618	protein-coding gene	gene with protein product		604725	"""ubiquitin specific protease 2"""			12838346	Standard	NM_004205		Approved	UBP41	uc001pwm.4	O75604		ENST00000260187.2:c.1354G>A	11.37:g.119228759C>T	ENSP00000260187:p.Glu452Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	B0YJB8|E9PPM2|Q8IUM2|Q8IW04|Q96MB9|Q9BQ21	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.E452K	ENST00000260187.2	37	c.1354	CCDS8422.1	11	.	.	.	.	.	.	.	.	.	.	C	13.49	2.252311	0.39797	.	.	ENSG00000036672	ENST00000455332;ENST00000260187;ENST00000392808;ENST00000525735	T;T;T	0.02837	4.14;4.14;4.14	5.75	5.75	0.90469	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.152601	0.56097	D	0.000025	T	0.03011	0.0089	N	0.21448	0.665	0.80722	D	1	B;B;B	0.17667	0.023;0.012;0.002	B;B;B	0.18263	0.009;0.021;0.002	T	0.54275	-0.8318	10	0.10902	T	0.67	-7.2183	18.9404	0.92602	0.0:1.0:0.0:0.0	.	209;452;243	E9PPM2;O75604;O75604-4	.;UBP2_HUMAN;.	K	209;452;199;243	ENSP00000407842:E209K;ENSP00000260187:E452K;ENSP00000436952:E243K	ENSP00000260187:E452K	E	-	1	0	USP2	118733969	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.587000	0.67510	2.725000	0.93324	0.655000	0.94253	GAG	USP2	-	pfam_Peptidase_C19,pfscan_Peptidase_C19	ENSG00000036672		0.488	USP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP2	HGNC	protein_coding	OTTHUMT00000388361.2	73	0.00	0	C	NM_171997		119228759	119228759	-1	no_errors	ENST00000260187	ensembl	human	known	69_37n	missense	84	19.23	20	SNP	1.000	T
USP24	23358	genome.wustl.edu	37	1	55572941	55572941	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:55572941G>A	ENST00000294383.6	-	40	4732	c.4733C>T	c.(4732-4734)tCa>tTa	p.S1578L	USP24_ENST00000407756.1_Missense_Mutation_p.S1418L	NM_015306.2	NP_056121.2	Q9UPU5	UBP24_HUMAN	ubiquitin specific peptidase 24	1578					ubiquitin-dependent protein catabolic process (GO:0006511)		cysteine-type peptidase activity (GO:0008234)|ubiquitinyl hydrolase activity (GO:0036459)			breast(4)|cervix(1)|endometrium(8)|kidney(13)|large_intestine(7)|lung(16)|ovary(6)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	60						CCCACAGAGTGAAAGAAGGGT	0.453																																						dbGAP											0													133.0	131.0	132.0					1																	55572941		1987	4156	6143	-	-	-	SO:0001583	missense	0			AB028980	CCDS44154.1, CCDS44154.2	1p32.3	2008-04-11	2005-08-08		ENSG00000162402	ENSG00000162402		"""Ubiquitin-specific peptidases"""	12623	protein-coding gene	gene with protein product		610569	"""ubiquitin specific protease 24"""			12838346	Standard	NM_015306		Approved	KIAA1057	uc021onw.1	Q9UPU5	OTTHUMG00000008135	ENST00000294383.6:c.4733C>T	1.37:g.55572941G>A	ENSP00000294383:p.Ser1578Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q6ZSY2|Q8N2Y4|Q9NXD1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_UBA-like,superfamily_ARM-type_fold,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Peptidase_C19	p.S1578L	ENST00000294383.6	37	c.4733	CCDS44154.2	1	.	.	.	.	.	.	.	.	.	.	G	29.8	5.041193	0.93685	.	.	ENSG00000162402	ENST00000294383;ENST00000407756	T;T	0.66995	-0.24;-0.24	5.92	5.92	0.95590	.	0.000000	0.85682	D	0.000000	T	0.64778	0.2629	L	0.46157	1.445	0.80722	D	1	P	0.48764	0.915	B	0.41764	0.366	T	0.65323	-0.6196	10	0.42905	T	0.14	.	20.3081	0.98638	0.0:0.0:1.0:0.0	.	1418	B7WPF4	.	L	1578;1418	ENSP00000294383:S1578L;ENSP00000385700:S1418L	ENSP00000294383:S1578L	S	-	2	0	USP24	55345529	1.000000	0.71417	0.996000	0.52242	0.986000	0.74619	9.476000	0.97823	2.795000	0.96236	0.655000	0.94253	TCA	USP24	-	superfamily_ARM-type_fold	ENSG00000162402		0.453	USP24-001	NOVEL	basic|appris_principal|CCDS	protein_coding	USP24	HGNC	protein_coding	OTTHUMT00000022275.2	100	0.00	0	G			55572941	55572941	-1	no_errors	ENST00000294383	ensembl	human	known	69_37n	missense	85	11.46	11	SNP	1.000	A
USPL1	10208	genome.wustl.edu	37	13	31232835	31232835	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:31232835C>T	ENST00000255304.4	+	9	2963	c.2621C>T	c.(2620-2622)tCa>tTa	p.S874L		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	874					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		GGTATTTCTTCAGCAAACCAT	0.413																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													75.0	71.0	72.0					13																	31232835		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.2621C>T	13.37:g.31232835C>T	ENSP00000255304:p.Ser874Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.S874L	ENST00000255304.4	37	c.2621	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	C	10.28	1.306625	0.23736	.	.	ENSG00000132952	ENST00000255304	T	0.18960	2.18	5.76	5.76	0.90799	.	0.700136	0.14259	N	0.330956	T	0.25382	0.0617	L	0.56769	1.78	0.09310	N	1	B	0.29037	0.231	B	0.30646	0.118	T	0.11324	-1.0592	10	0.42905	T	0.14	-1.5888	13.1961	0.59738	0.0:0.9273:0.0:0.0726	.	874	Q5W0Q7	USPL1_HUMAN	L	874	ENSP00000255304:S874L	ENSP00000255304:S874L	S	+	2	0	USPL1	30130835	0.006000	0.16342	0.021000	0.16686	0.006000	0.05464	0.664000	0.25068	2.726000	0.93360	0.655000	0.94253	TCA	USPL1	-	NULL	ENSG00000132952		0.413	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	28	0.00	0	C	NM_005800		31232835	31232835	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	missense	51	16.39	10	SNP	0.023	T
USPL1	10208	genome.wustl.edu	37	13	31233336	31233336	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr13:31233336C>G	ENST00000255304.4	+	9	3464	c.3122C>G	c.(3121-3123)tCt>tGt	p.S1041C		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	1041					Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		CAGCCAGACTCTCTGACAAAT	0.393																																					Ovarian(60;318 1180 1554 28110 31601)	dbGAP											0													114.0	113.0	113.0					13																	31233336		2203	4300	6503	-	-	-	SO:0001583	missense	0			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.3122C>G	13.37:g.31233336C>G	ENSP00000255304:p.Ser1041Cys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.S1041C	ENST00000255304.4	37	c.3122	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	C	8.574	0.880782	0.17467	.	.	ENSG00000132952	ENST00000255304	T	0.18810	2.19	5.32	4.44	0.53790	.	0.511670	0.18668	N	0.134540	T	0.36771	0.0979	M	0.64997	1.995	0.09310	N	1	D	0.69078	0.997	D	0.63192	0.912	T	0.14559	-1.0468	10	0.56958	D	0.05	-0.8566	7.5726	0.27918	0.0:0.7933:0.0:0.2067	.	1041	Q5W0Q7	USPL1_HUMAN	C	1041	ENSP00000255304:S1041C	ENSP00000255304:S1041C	S	+	2	0	USPL1	30131336	0.001000	0.12720	0.002000	0.10522	0.006000	0.05464	0.451000	0.21779	1.297000	0.44761	0.557000	0.71058	TCT	USPL1	-	NULL	ENSG00000132952		0.393	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	25	0.00	0	C	NM_005800		31233336	31233336	+1	no_errors	ENST00000255304	ensembl	human	known	69_37n	missense	21	36.36	12	SNP	0.006	G
UTP15	84135	genome.wustl.edu	37	5	72875844	72875844	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:72875844G>A	ENST00000296792.4	+	13	1737	c.1482G>A	c.(1480-1482)atG>atA	p.M494I	UTP15_ENST00000508491.1_Missense_Mutation_p.M475I|UTP15_ENST00000543251.1_Missense_Mutation_p.M304I	NM_001284431.1|NM_032175.2	NP_001271360.1|NP_115551.2	Q8TED0	UTP15_HUMAN	UTP15, U3 small nucleolar ribonucleoprotein, homolog (S. cerevisiae)	494					rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|skin(2)	15		Lung NSC(167;0.00405)|Ovarian(174;0.0129)		OV - Ovarian serous cystadenocarcinoma(47;7.76e-55)		TTGCCACCATGAGAAGGAAGG	0.358																																						dbGAP											0													128.0	123.0	125.0					5																	72875844		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL831972	CCDS34186.1, CCDS68893.1, CCDS68894.1	5q13.2	2013-01-10	2006-04-20		ENSG00000164338	ENSG00000164338		"""WD repeat domain containing"""	25758	protein-coding gene	gene with protein product			"""UTP15, U3 small nucleolar ribonucleoprotein, homolog (yeast)"""			12477932	Standard	NM_032175		Approved	FLJ12787, NET21, FLJ23637	uc003kcw.1	Q8TED0	OTTHUMG00000162453	ENST00000296792.4:c.1482G>A	5.37:g.72875844G>A	ENSP00000296792:p.Met494Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DU75|B4DXK8|Q6IA60|Q96E08|Q9H9F8	Missense_Mutation	SNP	pfam_U3_snoRNA-assocProt_15_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M494I	ENST00000296792.4	37	c.1482	CCDS34186.1	5	.	.	.	.	.	.	.	.	.	.	G	13.81	2.346821	0.41599	.	.	ENSG00000164338	ENST00000296792;ENST00000543251;ENST00000508491	T;T;T	0.54866	0.58;1.08;0.55	6.07	4.28	0.50868	.	0.318917	0.38837	N	0.001547	T	0.40619	0.1124	L	0.48642	1.525	0.49915	D	0.999833	B;B	0.17038	0.02;0.02	B;B	0.11329	0.006;0.006	T	0.16129	-1.0413	10	0.13853	T	0.58	.	8.3419	0.32249	0.0629:0.1154:0.7018:0.1199	.	475;494	B4DXK8;Q8TED0	.;UTP15_HUMAN	I	494;304;475	ENSP00000296792:M494I;ENSP00000440796:M304I;ENSP00000424609:M475I	ENSP00000296792:M494I	M	+	3	0	UTP15	72911600	1.000000	0.71417	1.000000	0.80357	0.898000	0.52572	1.314000	0.33597	0.886000	0.36113	0.585000	0.79938	ATG	UTP15	-	NULL	ENSG00000164338		0.358	UTP15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP15	HGNC	protein_coding	OTTHUMT00000368965.1	57	0.00	0	G	NM_032175		72875844	72875844	+1	no_errors	ENST00000296792	ensembl	human	known	69_37n	missense	58	15.94	11	SNP	1.000	A
UTP20	27340	genome.wustl.edu	37	12	101738384	101738384	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:101738384G>C	ENST00000261637.4	+	36	4635	c.4461G>C	c.(4459-4461)atG>atC	p.M1487I		NM_014503.2	NP_055318.2	O75691	UTP20_HUMAN	UTP20, small subunit (SSU) processome component, homolog (yeast)	1487					endonucleolytic cleavage in 5'-ETS of tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000480)|endonucleolytic cleavage in ITS1 to separate SSU-rRNA from 5.8S rRNA and LSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000447)|endonucleolytic cleavage to generate mature 5'-end of SSU-rRNA from (SSU-rRNA, 5.8S rRNA, LSU-rRNA) (GO:0000472)|negative regulation of cell proliferation (GO:0008285)|rRNA processing (GO:0006364)	90S preribosome (GO:0030686)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|preribosome, small subunit precursor (GO:0030688)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			NS(3)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(26)|lung(30)|ovary(2)|prostate(3)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	88						TAGGAGATATGAGTTTAAGTG	0.343																																						dbGAP											0													90.0	93.0	92.0					12																	101738384		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ006778	CCDS9081.1	12q23	2006-02-11				ENSG00000120800			17897	protein-coding gene	gene with protein product	"""down regulated in metastasis"""	612822				9673349, 15590835, 12837249	Standard	NM_014503		Approved	DRIM	uc001tia.1	O75691	OTTHUMG00000170270	ENST00000261637.4:c.4461G>C	12.37:g.101738384G>C	ENSP00000261637:p.Met1487Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	Q9H3H4	Missense_Mutation	SNP	pfam_DRIM,superfamily_ARM-type_fold	p.M1487I	ENST00000261637.4	37	c.4461	CCDS9081.1	12	.	.	.	.	.	.	.	.	.	.	G	19.13	3.768140	0.69878	.	.	ENSG00000120800	ENST00000261637	T	0.64085	-0.08	5.95	5.95	0.96441	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.58524	0.2128	L	0.48642	1.525	0.80722	D	1	P	0.36144	0.539	B	0.31751	0.135	T	0.59794	-0.7387	10	0.52906	T	0.07	-31.3587	20.3931	0.98965	0.0:0.0:1.0:0.0	.	1487	O75691	UTP20_HUMAN	I	1487	ENSP00000261637:M1487I	ENSP00000261637:M1487I	M	+	3	0	UTP20	100262515	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.227000	0.95236	2.824000	0.97209	0.655000	0.94253	ATG	UTP20	-	superfamily_ARM-type_fold	ENSG00000120800		0.343	UTP20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP20	HGNC	protein_coding	OTTHUMT00000408242.1	26	0.00	0	G	NM_014503		101738384	101738384	+1	no_errors	ENST00000261637	ensembl	human	known	69_37n	missense	24	14.29	4	SNP	1.000	C
VIPAS39	63894	genome.wustl.edu	37	14	77920443	77920443	+	Start_Codon_SNP	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:77920443C>T	ENST00000553888.1	-	2	513	c.3G>A	c.(1-3)atG>atA	p.M1I	VIPAS39_ENST00000343765.2_Start_Codon_SNP_p.M1I|VIPAS39_ENST00000557658.1_Start_Codon_SNP_p.M1I|VIPAS39_ENST00000327028.4_Start_Codon_SNP_p.M1I|VIPAS39_ENST00000448935.2_Start_Codon_SNP_p.M1I|VIPAS39_ENST00000556412.1_Missense_Mutation_p.M27I	NM_001193314.1|NM_001193317.1|NM_022067.3	NP_001180243.1|NP_001180246.1|NP_071350.2	Q9H9C1	SPE39_HUMAN	VPS33B interacting protein, apical-basolateral polarity regulator, spe-39 homolog	1					cell differentiation (GO:0030154)|endosome to lysosome transport (GO:0008333)|intracellular protein transport (GO:0006886)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|late endosome (GO:0005770)|recycling endosome (GO:0055037)											TTGTCCGATTCATCTACAGTG	0.443																																						dbGAP											0													140.0	112.0	121.0					14																	77920443		2203	4300	6503	-	-	-	SO:0001582	initiator_codon_variant	0			AK022925	CCDS9862.1, CCDS53905.1	14q24.3-q31	2013-08-14	2012-07-24	2012-07-24	ENSG00000151445	ENSG00000151445			20347	protein-coding gene	gene with protein product	"""VPS33B interacting protein, apical-basolateral polarity regulator"""	613401	"""chromosome 14 open reading frame 133"""	C14orf133		20190753, 19109425, 22753090, 23002115, 23918659	Standard	NM_022067		Approved	VIPAR, VPS16B, SPE-39, SPE39, hSPE-39	uc001xtu.2	Q9H9C1		ENST00000553888.1:c.3G>A	14.37:g.77920443C>T	ENSP00000452181:p.Met1Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DPI6|O95434|Q9H7E1|Q9H9I9	Missense_Mutation	SNP	pfam_Golgin_subfamily_A_member_5	p.M1I	ENST00000553888.1	37	c.3	CCDS9862.1	14	.	.	.	.	.	.	.	.	.	.	C	29.2	4.981803	0.93044	.	.	ENSG00000151445	ENST00000343765;ENST00000553888;ENST00000327028;ENST00000557658;ENST00000448935;ENST00000556412;ENST00000557466	T;T;T;T;T;T;D	0.82619	-1.23;-1.23;-1.33;-1.23;-1.37;-1.32;-1.63	5.21	5.21	0.72293	.	0.123931	0.64402	D	0.000001	D	0.89469	0.6724	.	.	.	0.80722	D	1	P;D	0.59357	0.851;0.985	P;P	0.59221	0.838;0.854	D	0.90525	0.4491	9	0.87932	D	0	-23.0618	17.0945	0.86631	0.0:1.0:0.0:0.0	.	1;1	B4DPI6;Q9H9C1	.;VIPAR_HUMAN	I	1;1;1;1;1;27;1	ENSP00000339122:M1I;ENSP00000452181:M1I;ENSP00000313098:M1I;ENSP00000452191:M1I;ENSP00000404815:M1I;ENSP00000451857:M27I;ENSP00000452176:M1I	ENSP00000313098:M1I	M	-	3	0	VIPAR	76990196	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	6.587000	0.74071	2.706000	0.92434	0.655000	0.94253	ATG	VIPAS39	-	NULL	ENSG00000151445		0.443	VIPAS39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VIPAS39	HGNC	protein_coding	OTTHUMT00000414008.1	54	0.00	0	C	NM_022067	Missense_Mutation	77920443	77920443	-1	no_errors	ENST00000343765	ensembl	human	known	69_37n	missense	42	19.23	10	SNP	1.000	T
VIT	5212	genome.wustl.edu	37	2	37014283	37014283	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:37014283G>A	ENST00000389975.3	+	11	1179	c.877G>A	c.(877-879)Gac>Aac	p.D293N	VIT_ENST00000379241.3_Missense_Mutation_p.D271N|VIT_ENST00000379242.3_Missense_Mutation_p.D308N|VIT_ENST00000401530.1_Missense_Mutation_p.D272N|VIT_ENST00000404084.1_Missense_Mutation_p.D245N|VIT_ENST00000497382.1_5'UTR	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin	293	VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				CTGCAAAATTGACTTGTCGTT	0.473																																						dbGAP											0													116.0	120.0	118.0					2																	37014283		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.877G>A	2.37:g.37014283G>A	ENSP00000374625:p.Asp293Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	pfam_VWF_A,pfam_LCCL,superfamily_LCCL,smart_LCCL,smart_VWF_A,pfscan_LCCL,pfscan_VWF_A	p.D308N	ENST00000389975.3	37	c.922	CCDS54347.1	2	.	.	.	.	.	.	.	.	.	.	G	27.7	4.858635	0.91433	.	.	ENSG00000205221	ENST00000379242;ENST00000389975;ENST00000404084;ENST00000379241;ENST00000401530	T;T;T;T;T	0.75367	-0.93;-0.93;-0.93;-0.93;-0.54	5.68	5.68	0.88126	von Willebrand factor, type A (3);	0.000000	0.85682	D	0.000000	D	0.89203	0.6648	M	0.91406	3.205	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;0.999;1.0;0.999	D	0.90667	0.4595	10	0.59425	D	0.04	-32.7866	17.2927	0.87162	0.0:0.0:1.0:0.0	.	272;271;293;308	E9PF47;Q6UXI7-2;Q6UXI7;Q6UXI7-4	.;.;VITRN_HUMAN;.	N	308;293;245;271;272	ENSP00000368544:D308N;ENSP00000374625:D293N;ENSP00000384154:D245N;ENSP00000368543:D271N;ENSP00000385658:D272N	ENSP00000368543:D271N	D	+	1	0	VIT	36867787	1.000000	0.71417	0.833000	0.33012	0.701000	0.40568	8.705000	0.91357	2.683000	0.91414	0.561000	0.74099	GAC	VIT	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	ENSG00000205221		0.473	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		47	0.00	0	G			37014283	37014283	+1	no_errors	ENST00000379242	ensembl	human	known	69_37n	missense	44	18.52	10	SNP	1.000	A
VPS13B	157680	genome.wustl.edu	37	8	100155253	100155253	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:100155253C>T	ENST00000358544.2	+	13	1814	c.1703C>T	c.(1702-1704)aCa>aTa	p.T568I	VPS13B_ENST00000357162.2_Missense_Mutation_p.T568I|VPS13B_ENST00000355155.1_Missense_Mutation_p.T568I|VPS13B_ENST00000395996.1_Missense_Mutation_p.T568I	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	568					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GATTTGGGAACAGTTCAGGAG	0.373																																					Colon(161;2205 2542 7338 31318)	dbGAP											0													90.0	87.0	88.0					8																	100155253		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1703C>T	8.37:g.100155253C>T	ENSP00000351346:p.Thr568Ile	Somatic		WXS	Illumina GAIIx	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.T568I	ENST00000358544.2	37	c.1703	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	C	9.425	1.084103	0.20309	.	.	ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996	T;T;T;T	0.76968	-1.06;-0.34;-0.34;-0.06	5.43	-2.11	0.07187	.	1.042200	0.07510	N	0.908715	T	0.55593	0.1930	N	0.08118	0	0.09310	N	1	B;B;B;B;B	0.06786	0.0;0.0;0.0;0.0;0.001	B;B;B;B;B	0.06405	0.001;0.002;0.001;0.001;0.001	T	0.40924	-0.9537	10	0.42905	T	0.14	.	6.8413	0.23965	0.1514:0.3279:0.0:0.5208	.	568;568;568;568;568	Q7Z7G8-6;Q7Z7G8-2;Q7Z7G8;Q7Z7G8-3;Q7Z7G8-4	.;.;VP13B_HUMAN;.;.	I	568	ENSP00000347281:T568I;ENSP00000349685:T568I;ENSP00000351346:T568I;ENSP00000379318:T568I	ENSP00000347281:T568I	T	+	2	0	VPS13B	100224429	0.002000	0.14202	0.028000	0.17463	0.952000	0.60782	0.070000	0.14573	-0.260000	0.09418	0.591000	0.81541	ACA	VPS13B	-	NULL	ENSG00000132549		0.373	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	63	0.00	0	C	NM_184042		100155253	100155253	+1	no_errors	ENST00000358544	ensembl	human	known	69_37n	missense	43	21.82	12	SNP	0.002	T
VPS13C	54832	genome.wustl.edu	37	15	62274718	62274718	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr15:62274718C>G	ENST00000261517.5	-	21	2042	c.1969G>C	c.(1969-1971)Gag>Cag	p.E657Q	VPS13C_ENST00000249837.3_Missense_Mutation_p.E614Q|VPS13C_ENST00000395898.3_Missense_Mutation_p.E614Q|VPS13C_ENST00000395896.4_Missense_Mutation_p.E657Q	NM_020821.2	NP_065872.1			vacuolar protein sorting 13 homolog C (S. cerevisiae)											NS(3)|breast(4)|endometrium(4)|kidney(9)|large_intestine(26)|lung(46)|ovary(5)|prostate(6)|skin(6)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	117						GTTATTTGCTCAAGATCCAAT	0.338																																						dbGAP											0													193.0	177.0	183.0					15																	62274718		2202	4300	6502	-	-	-	SO:0001583	missense	0			AJ608770	CCDS10180.1, CCDS32257.1, CCDS45272.1, CCDS58367.1	15q21.3	2009-07-09	2006-04-04		ENSG00000129003	ENSG00000129003			23594	protein-coding gene	gene with protein product		608879	"""vacuolar protein sorting 13C (yeast)"""				Standard	NM_018080		Approved	FLJ20136, FLJ10381, KIAA1421	uc002agz.3	Q709C8	OTTHUMG00000132801	ENST00000261517.5:c.1969G>C	15.37:g.62274718C>G	ENSP00000261517:p.Glu657Gln	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.E657Q	ENST00000261517.5	37	c.1969	CCDS32257.1	15	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054420	0.75960	.	.	ENSG00000129003	ENST00000249837;ENST00000261517;ENST00000395896;ENST00000395898	T;T;T	0.48201	0.82;0.82;0.82	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.56411	0.1983	L	0.42245	1.32	0.58432	D	0.999997	P;P;P;P	0.49559	0.925;0.925;0.705;0.877	P;P;P;P	0.56042	0.712;0.79;0.598;0.709	T	0.56763	-0.7925	10	0.72032	D	0.01	.	15.2163	0.73270	0.0:0.9312:0.0:0.0688	.	614;657;614;657	Q709C8-4;Q709C8-2;Q709C8-3;Q709C8	.;.;.;VP13C_HUMAN	Q	614;657;657;657	ENSP00000249837:E614Q;ENSP00000261517:E657Q;ENSP00000379233:E657Q	ENSP00000249837:E614Q	E	-	1	0	VPS13C	60062010	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	5.052000	0.64263	2.756000	0.94617	0.563000	0.77884	GAG	VPS13C	-	NULL	ENSG00000129003		0.338	VPS13C-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13C	HGNC	protein_coding	OTTHUMT00000415997.1	90	0.00	0	C	NM_017684		62274718	62274718	-1	no_errors	ENST00000261517	ensembl	human	known	69_37n	missense	94	10.48	11	SNP	1.000	G
VPS13D	55187	genome.wustl.edu	37	1	12428617	12428617	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr1:12428617C>T	ENST00000358136.3	+	53	10673	c.10543C>T	c.(10543-10545)Cct>Tct	p.P3515S	VPS13D_ENST00000356315.4_Missense_Mutation_p.P3490S|VPS13D_ENST00000496628.1_3'UTR	NM_015378.2	NP_056193.2			vacuolar protein sorting 13 homolog D (S. cerevisiae)											NS(1)|breast(6)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(13)|large_intestine(28)|lung(44)|ovary(5)|pancreas(1)|prostate(8)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(4)	130	Ovarian(185;0.249)	Lung NSC(185;4.08e-05)|all_lung(284;4.55e-05)|Renal(390;0.000147)|Colorectal(325;0.00058)|Breast(348;0.00093)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0327)|Colorectal(212;4.63e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000289)|COAD - Colon adenocarcinoma(227;0.000801)|Kidney(185;0.00216)|KIRC - Kidney renal clear cell carcinoma(229;0.00544)|STAD - Stomach adenocarcinoma(313;0.012)|READ - Rectum adenocarcinoma(331;0.0476)|Lung(427;0.209)		TCAGTTACCTCCTCCTTTCCG	0.468																																						dbGAP											0													182.0	161.0	168.0					1																	12428617		2203	4300	6503	-	-	-	SO:0001583	missense	0			AJ608774	CCDS30588.1, CCDS30589.1	1p36.21	2008-02-05	2006-04-04		ENSG00000048707	ENSG00000048707			23595	protein-coding gene	gene with protein product		608877	"""vacuolar protein sorting 13D (yeast)"""				Standard	NM_015378		Approved	FLJ10619, KIAA0453	uc001atv.3	Q5THJ4	OTTHUMG00000013155	ENST00000358136.3:c.10543C>T	1.37:g.12428617C>T	ENSP00000350854:p.Pro3515Ser	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_VPSAP,pfam_UBA/transl_elong_EF1B_N,superfamily_UBA-like,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk	p.P3515S	ENST00000358136.3	37	c.10543	CCDS30588.1	1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.850888	0.91277	.	.	ENSG00000048707	ENST00000356315;ENST00000358136	T;T	0.32988	1.43;1.43	6.04	4.15	0.48705	Vacuolar protein sorting-associated protein (1);	0.170405	0.53938	D	0.000055	T	0.48223	0.1488	M	0.72576	2.205	0.80722	D	1	D;P	0.54772	0.968;0.933	P;P	0.62740	0.906;0.866	T	0.42932	-0.9422	10	0.15066	T	0.55	.	13.276	0.60188	0.1274:0.7503:0.1222:0.0	.	3490;3514	Q5THJ4-2;Q5THJ4	.;VP13D_HUMAN	S	3490;3515	ENSP00000348666:P3490S;ENSP00000350854:P3515S	ENSP00000348666:P3490S	P	+	1	0	VPS13D	12351204	1.000000	0.71417	0.981000	0.43875	0.996000	0.88848	4.664000	0.61540	0.867000	0.35654	0.650000	0.86243	CCT	VPS13D	-	pfam_VPSAP	ENSG00000048707		0.468	VPS13D-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13D	HGNC	protein_coding	OTTHUMT00000036897.2	90	0.00	0	C	NM_015378		12428617	12428617	+1	no_errors	ENST00000358136	ensembl	human	known	69_37n	missense	82	10.87	10	SNP	0.996	T
VPS52	6293	genome.wustl.edu	37	6	33235986	33235986	+	Splice_Site	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:33235986C>G	ENST00000445902.2	-	8	918		c.e8-1		VPS52_ENST00000478934.1_Splice_Site|VPS52_ENST00000436044.2_Splice_Site|VPS52_ENST00000482399.1_Splice_Site	NM_022553.4	NP_072047.4	Q8N1B4	VPS52_HUMAN	vacuolar protein sorting 52 homolog (S. cerevisiae)						ectodermal cell differentiation (GO:0010668)|embryonic ectodermal digestive tract development (GO:0048611)|protein transport (GO:0015031)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(1)|lung(8)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28						TCGTCACTGCCTAGATGTGGG	0.493																																						dbGAP											0													107.0	121.0	116.0					6																	33235986		1510	2709	4219	-	-	-	SO:0001630	splice_region_variant	0			AJ223319	CCDS4770.2	6p21.3	2010-02-17	2006-12-19	2003-09-05	ENSG00000223501	ENSG00000223501			10518	protein-coding gene	gene with protein product		603443	"""SAC2 suppressor of actin mutations 2-like (yeast)"", ""vacuolar protein sorting 52 (yeast)"""	SACM2L		9790748	Standard	NM_022553		Approved	ARE1	uc003odm.1	Q8N1B4	OTTHUMG00000031276	ENST00000445902.2:c.700-1G>C	6.37:g.33235986C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	A2BF38|B0UZZ4|B4DNI9|Q53GR4|Q5JPA0|Q5SQW1|Q8IUN6|Q9NPT5	Splice_Site	SNP	-	e8-1	ENST00000445902.2	37	c.700-1	CCDS4770.2	6	.	.	.	.	.	.	.	.	.	.	C	13.72	2.322612	0.41096	.	.	ENSG00000223501	ENST00000445902;ENST00000418054;ENST00000436044	.	.	.	4.87	4.87	0.63330	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.9168	0.79524	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	VPS52	33343964	1.000000	0.71417	0.999000	0.59377	0.435000	0.31806	6.673000	0.74482	2.723000	0.93209	0.579000	0.79373	.	VPS52	-	-	ENSG00000223501		0.493	VPS52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS52	HGNC	protein_coding	OTTHUMT00000076598.2	27	0.00	0	C	NM_022553	Intron	33235986	33235986	-1	no_errors	ENST00000445902	ensembl	human	known	69_37n	splice_site	44	10.20	5	SNP	1.000	G
WDR6	11180	genome.wustl.edu	37	3	49050837	49050837	+	Missense_Mutation	SNP	G	G	A	rs542788663		TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:49050837G>A	ENST00000608424.1	+	2	1909	c.1870G>A	c.(1870-1872)Gat>Aat	p.D624N	WDR6_ENST00000415265.2_Missense_Mutation_p.D72N|WDR6_ENST00000448293.1_Missense_Mutation_p.D573N|WDR6_ENST00000395474.3_Missense_Mutation_p.D654N			Q9NNW5	WDR6_HUMAN	WD repeat domain 6	624					cell cycle arrest (GO:0007050)|negative regulation of autophagy (GO:0010507)|negative regulation of cell proliferation (GO:0008285)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|prostate(2)|skin(1)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	26				Kidney(197;9.12e-07)|KIRC - Kidney renal clear cell carcinoma(197;1.32e-05)|BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|OV - Ovarian serous cystadenocarcinoma(275;0.000155)		TATAGTGCCCGATGGGAGCAT	0.562																																						dbGAP											0													112.0	86.0	95.0					3																	49050837		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF099100	CCDS2782.2	3p21.31	2013-01-09			ENSG00000178252	ENSG00000178252		"""WD repeat domain containing"""	12758	protein-coding gene	gene with protein product		606031					Standard	NM_018031		Approved		uc003cvj.2	Q9NNW5	OTTHUMG00000133546	ENST00000608424.1:c.1870G>A	3.37:g.49050837G>A	ENSP00000477389:p.Asp624Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B4DHK2|Q3MIT1|Q9UF63	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.D654N	ENST00000608424.1	37	c.1960		3	.	.	.	.	.	.	.	.	.	.	G	20.2	3.956095	0.73902	.	.	ENSG00000178252	ENST00000395474;ENST00000415265;ENST00000448293	T;T;D	0.92397	2.41;-0.72;-3.03	5.35	5.35	0.76521	WD40 repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);Six-bladed beta-propeller, TolB-like (1);	0.388404	0.29369	N	0.012347	D	0.94255	0.8155	L	0.49126	1.545	0.40115	D	0.976537	D;P;D	0.89917	0.979;0.921;1.0	P;B;D	0.63957	0.452;0.212;0.92	D	0.93198	0.6589	10	0.32370	T	0.25	-25.5726	19.0531	0.93053	0.0:0.0:1.0:0.0	.	72;624;573	E9PBK6;Q9NNW5;E9PDU5	.;WDR6_HUMAN;.	N	654;72;573	ENSP00000378857:D654N;ENSP00000412195:D72N;ENSP00000413432:D573N	ENSP00000378857:D654N	D	+	1	0	WDR6	49025841	1.000000	0.71417	0.875000	0.34327	0.881000	0.50899	8.986000	0.93492	2.503000	0.84419	0.561000	0.74099	GAT	WDR6	-	superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom	ENSG00000178252		0.562	WDR6-024	NOVEL	basic|appris_principal	protein_coding	WDR6	HGNC	protein_coding	OTTHUMT00000471652.1	30	0.00	0	G			49050837	49050837	+1	no_errors	ENST00000395474	ensembl	human	known	69_37n	missense	47	12.96	7	SNP	0.975	A
WDR66	144406	genome.wustl.edu	37	12	122395061	122395061	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:122395061G>A	ENST00000288912.4	+	11	2471	c.1617G>A	c.(1615-1617)ttG>ttA	p.L539L	WDR66_ENST00000397454.2_Silent_p.L539L	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	539							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		ACAGTCACTTGAAACTGGGCG	0.418																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													123.0	116.0	118.0					12																	122395061		1852	4113	5965	-	-	-	SO:0001819	synonymous_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.1617G>A	12.37:g.122395061G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.L539	ENST00000288912.4	37	c.1617	CCDS41853.1	12																																																																																			WDR66	-	superfamily_WD40_repeat_dom	ENSG00000158023		0.418	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	49	0.00	0	G	NM_144668		122395061	122395061	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	silent	62	16.22	12	SNP	0.986	A
WDR66	144406	genome.wustl.edu	37	12	122396244	122396244	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr12:122396244G>A	ENST00000288912.4	+	12	2651	c.1797G>A	c.(1795-1797)gaG>gaA	p.E599E	WDR66_ENST00000397454.2_Silent_p.E599E	NM_144668.5	NP_653269.3	Q8TBY9	WDR66_HUMAN	WD repeat domain 66	599							calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(13)|ovary(2)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	all_neural(191;0.0496)|Medulloblastoma(191;0.0922)			OV - Ovarian serous cystadenocarcinoma(86;0.000155)|Epithelial(86;0.000634)|BRCA - Breast invasive adenocarcinoma(302;0.248)		CCAAACTTGAGAAGTTATTTG	0.463																																					Esophageal Squamous(85;849 1794 49757 52143)	dbGAP											0													149.0	149.0	149.0					12																	122396244		1932	4129	6061	-	-	-	SO:0001819	synonymous_variant	0			AL833930	CCDS41853.1, CCDS53840.1	12q24.31	2014-07-31			ENSG00000158023	ENSG00000158023		"""WD repeat domain containing"""	28506	protein-coding gene	gene with protein product						17967944	Standard	NM_001178003		Approved	MGC33630, CaM-IP4	uc009zxk.3	Q8TBY9	OTTHUMG00000168948	ENST00000288912.4:c.1797G>A	12.37:g.122396244G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	C9J1W2|Q8IYA3|Q8N898|Q8NDE7	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E599	ENST00000288912.4	37	c.1797	CCDS41853.1	12																																																																																			WDR66	-	superfamily_WD40_repeat_dom,smart_WD40_repeat	ENSG00000158023		0.463	WDR66-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR66	HGNC	protein_coding	OTTHUMT00000401700.1	48	0.00	0	G	NM_144668		122396244	122396244	+1	no_errors	ENST00000288912	ensembl	human	known	69_37n	silent	67	11.84	9	SNP	0.986	A
XPNPEP1	7511	genome.wustl.edu	37	10	111667567	111667567	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr10:111667567C>T	ENST00000502935.1	-	3	247	c.128G>A	c.(127-129)aGa>aAa	p.R43K	XPNPEP1_ENST00000369680.4_5'UTR|XPNPEP1_ENST00000369683.1_5'UTR|XPNPEP1_ENST00000430337.1_5'UTR|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.R43K					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		TGGAGGCATTCTGCCGTCTGC	0.532																																						dbGAP											0													165.0	150.0	155.0					10																	111667567		2203	4300	6503	-	-	-	SO:0001583	missense	0				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.128G>A	10.37:g.111667567C>T	ENSP00000421566:p.Arg43Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.R43K	ENST00000502935.1	37	c.128	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	C	7.793	0.711977	0.15306	.	.	ENSG00000108039	ENST00000502935;ENST00000322238	.	.	.	5.06	3.12	0.35913	.	.	.	.	.	T	0.15003	0.0362	N	0.08118	0	0.20563	N	0.999881	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.32508	-0.9904	8	0.06099	T	0.92	.	6.7323	0.23390	0.0:0.6873:0.0:0.3127	.	43;43	B4E2P4;G5E9Y2	.;.	K	43	.	ENSP00000324011:R43K	R	-	2	0	XPNPEP1	111657557	0.585000	0.26774	0.409000	0.26459	0.956000	0.61745	1.868000	0.39509	0.473000	0.27368	-0.345000	0.07892	AGA	XPNPEP1	-	NULL	ENSG00000108039		0.532	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2	57	0.00	0	C			111667567	111667567	-1	no_errors	ENST00000502935	ensembl	human	known	69_37n	missense	28	26.32	10	SNP	0.189	T
YLPM1	56252	genome.wustl.edu	37	14	75265994	75265994	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr14:75265994C>T	ENST00000325680.7	+	5	4118	c.3994C>T	c.(3994-3996)Cca>Tca	p.P1332S	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Missense_Mutation_p.P1137S	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1137					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		TCCATCTCTTCCACCTTTACC	0.438																																						dbGAP											0													127.0	127.0	127.0					14																	75265994		1903	4129	6032	-	-	-	SO:0001583	missense	0			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.3994C>T	14.37:g.75265994C>T	ENSP00000324463:p.Pro1332Ser	Somatic		WXS	Illumina GAIIx	Phase_IV	P49752|Q96I64|Q9P1V7	Missense_Mutation	SNP	superfamily_FH2_actin-bd	p.P1332S	ENST00000325680.7	37	c.3994	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	C	14.05	2.420890	0.42918	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.97	3.16	0.36331	.	0.086706	0.50627	N	0.000103	T	0.44787	0.1310	L	0.43923	1.385	0.40663	D	0.982142	B	0.19583	0.037	B	0.18561	0.022	T	0.40850	-0.9541	9	0.52906	T	0.07	-6.1951	5.7734	0.18265	0.1392:0.6565:0.0:0.2042	.	1332	P49750-4	.	S	1332;1137;1045	.	ENSP00000238571:P1137S	P	+	1	0	YLPM1	74335747	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.109000	0.50345	0.865000	0.35603	0.537000	0.68136	CCA	YLPM1	-	NULL	ENSG00000119596		0.438	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	HGNC	protein_coding	OTTHUMT00000404451.1	23	0.00	0	C	NM_019589		75265994	75265994	+1	no_errors	ENST00000325680	ensembl	human	known	69_37n	missense	36	15.91	7	SNP	1.000	T
YPEL5	51646	genome.wustl.edu	37	2	30381839	30381839	+	3'UTR	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr2:30381839G>C	ENST00000379520.3	+	0	1000				YPEL5_ENST00000495673.1_3'UTR|YPEL5_ENST00000261353.4_3'UTR|YPEL5_ENST00000402003.3_3'UTR|YPEL5_ENST00000402708.1_3'UTR|YPEL5_ENST00000379519.3_3'UTR	NM_001127401.1	NP_001120873.1	P62699	YPEL5_HUMAN	yippee-like 5 (Drosophila)											NS(1)|endometrium(1)|kidney(1)|lung(3)|prostate(1)	7	Acute lymphoblastic leukemia(172;0.155)					GAGAATCTAAGATGGAACctt	0.348																																						dbGAP											0																																										-	-	-	SO:0001624	3_prime_UTR_variant	0			AF135161	CCDS1771.1	2p23	2004-06-28			ENSG00000119801	ENSG00000119801			18329	protein-coding gene	gene with protein product		609726					Standard	NM_016061		Approved	CGI-127	uc002rmz.4	P62699	OTTHUMG00000097839	ENST00000379520.3:c.*130G>C	2.37:g.30381839G>C		Somatic		WXS	Illumina GAIIx	Phase_IV	D6W568|Q65Z97|Q8R174|Q9D6M1|Q9UMX7|Q9Y3C9	RNA	SNP	-	NULL	ENST00000379520.3	37	NULL	CCDS1771.1	2																																																																																			YPEL5	-	-	ENSG00000119801		0.348	YPEL5-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	YPEL5	HGNC	protein_coding	OTTHUMT00000215128.1	19	0.00	0	G	NM_016061		30381839	30381839	+1	no_errors	ENST00000495673	ensembl	human	known	69_37n	rna	20	16.67	4	SNP	1.000	C
ZBTB26	57684	genome.wustl.edu	37	9	125680889	125680889	+	Nonstop_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:125680889C>G	ENST00000373656.3	-	2	1398	c.1325G>C	c.(1324-1326)tGa>tCa	p.*442S	ZBTB26_ENST00000373654.1_Nonstop_Mutation_p.*442S	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	0					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						AGCCCCTACTCAATTCACACA	0.453																																						dbGAP											0													147.0	138.0	141.0					9																	125680889		2203	4300	6503	-	-	-	SO:0001578	stop_lost	0			AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.1325G>C	9.37:g.125680889C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ53|Q8WTR1	Nonstop_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.*442S	ENST00000373656.3	37	c.1325	CCDS6847.1	9	.	.	.	.	.	.	.	.	.	.	C	10.57	1.386683	0.25031	.	.	ENSG00000171448	ENST00000373656;ENST00000373654	.	.	.	5.7	3.64	0.41730	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.063	0.25137	0.0:0.7138:0.0:0.2862	.	.	.	.	S	442	.	.	X	-	2	2	ZBTB26	124720710	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.224000	0.32539	1.413000	0.46997	0.655000	0.94253	TGA	ZBTB26	-	NULL	ENSG00000171448		0.453	ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB26	HGNC	protein_coding	OTTHUMT00000053960.1	27	0.00	0	C	NM_020924		125680889	125680889	-1	no_errors	ENST00000373654	ensembl	human	known	69_37n	nonstop	32	27.27	12	SNP	0.997	G
ZBTB26	57684	genome.wustl.edu	37	9	125681055	125681055	+	Nonsense_Mutation	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr9:125681055C>A	ENST00000373656.3	-	2	1232	c.1159G>T	c.(1159-1161)Gag>Tag	p.E387*	ZBTB26_ENST00000373654.1_Nonsense_Mutation_p.E387*	NM_020924.2	NP_065975.1	Q9HCK0	ZBT26_HUMAN	zinc finger and BTB domain containing 26	387					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)	11						ACATTTCTCTCATTGGCATTA	0.398																																						dbGAP											0													173.0	171.0	172.0					9																	125681055		2203	4300	6503	-	-	-	SO:0001587	stop_gained	0			AB046792	CCDS6847.1	9q34.11	2013-01-08	2004-04-15	2004-04-16	ENSG00000171448	ENSG00000171448		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	23383	protein-coding gene	gene with protein product			"""zinc finger protein 481"""	ZNF481			Standard	NM_020924		Approved		uc004bnk.3	Q9HCK0	OTTHUMG00000020627	ENST00000373656.3:c.1159G>T	9.37:g.125681055C>A	ENSP00000362760:p.Glu387*	Somatic		WXS	Illumina GAIIx	Phase_IV	B3KQ53|Q8WTR1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.E387*	ENST00000373656.3	37	c.1159	CCDS6847.1	9	.	.	.	.	.	.	.	.	.	.	C	28.1	4.886399	0.91814	.	.	ENSG00000171448	ENST00000373656;ENST00000373654	.	.	.	5.7	5.7	0.88788	.	0.115748	0.56097	D	0.000027	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	19.8351	0.96655	0.0:1.0:0.0:0.0	.	.	.	.	X	387	.	ENSP00000362758:E387X	E	-	1	0	ZBTB26	124720876	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.845000	0.69437	2.687000	0.91594	0.655000	0.94253	GAG	ZBTB26	-	NULL	ENSG00000171448		0.398	ZBTB26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB26	HGNC	protein_coding	OTTHUMT00000053960.1	28	0.00	0	C	NM_020924		125681055	125681055	-1	no_errors	ENST00000373654	ensembl	human	known	69_37n	nonsense	52	11.86	7	SNP	1.000	A
ZFP57	346171	genome.wustl.edu	37	6	29644742	29644742	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr6:29644742C>G	ENST00000488757.1	-	1	189	c.39G>C	c.(37-39)aaG>aaC	p.K13N	ZFP57_ENST00000376883.1_Intron|ZFP57_ENST00000376881.3_Intron	NM_001109809.2	NP_001103279.2	Q9NU63	ZFP57_HUMAN	ZFP57 zinc finger protein	0					DNA methylation involved in embryo development (GO:0043045)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peripheral nervous system development (GO:0007422)|regulation of gene expression by genetic imprinting (GO:0006349)|transcription, DNA-templated (GO:0006351)	nuclear heterochromatin (GO:0005720)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|large_intestine(5)|liver(1)|lung(16)|ovary(4)|skin(4)|urinary_tract(5)	44						ATGGGAGCGTCTTCTGTACAG	0.552																																						dbGAP											0													204.0	197.0	199.0					6																	29644742		1929	4120	6049	-	-	-	SO:0001583	missense	0			AL050328	CCDS43436.1, CCDS43436.2	6p22.1	2013-01-08	2012-11-27	2005-07-20	ENSG00000204644	ENSG00000204644		"""Zinc fingers, C2H2-type"", ""-"""	18791	protein-coding gene	gene with protein product		612192	"""chromosome 6 open reading frame 40"", ""zinc finger protein 57 homolog (mouse)"""	C6orf40			Standard	NM_001109809		Approved	ZNF698, bA145L22, bA145L22.2	uc011dlw.2	Q9NU63	OTTHUMG00000031158	ENST00000488757.1:c.39G>C	6.37:g.29644742C>G	ENSP00000418259:p.Lys13Asn	Somatic		WXS	Illumina GAIIx	Phase_IV	B0S894|B0V254|B2RXJ7|Q5SSB1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.K13N	ENST00000488757.1	37	c.39	CCDS43436.2	6	.	.	.	.	.	.	.	.	.	.	C	13.91	2.379124	0.42207	.	.	ENSG00000204644	ENST00000488757	T	0.05855	3.38	4.03	1.3	0.21679	.	.	.	.	.	T	0.02047	0.0064	N	0.08118	0	0.09310	N	1	D	0.57899	0.981	P	0.54140	0.743	T	0.43669	-0.9377	9	0.49607	T	0.09	.	6.062	0.19842	0.0:0.6743:0.0:0.3257	.	13	Q9NU63-3	.	N	13	ENSP00000418259:K13N	ENSP00000418259:K13N	K	-	3	2	ZFP57	29752721	0.000000	0.05858	0.000000	0.03702	0.078000	0.17371	-0.206000	0.09398	0.284000	0.22305	0.655000	0.94253	AAG	ZFP57	-	NULL	ENSG00000204644		0.552	ZFP57-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP57	HGNC	protein_coding	OTTHUMT00000355773.1	65	0.00	0	C	XM_294093		29644742	29644742	-1	no_errors	ENST00000488757	ensembl	human	known	69_37n	missense	88	18.52	20	SNP	0.000	G
ZNF16	7564	genome.wustl.edu	37	8	146156997	146156997	+	Silent	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr8:146156997C>G	ENST00000276816.4	-	4	1362	c.1176G>C	c.(1174-1176)ctG>ctC	p.L392L	ZNF16_ENST00000394909.2_Silent_p.L392L	NM_001029976.2	NP_001025147.2	P17020	ZNF16_HUMAN	zinc finger protein 16	392	Required for nuclear localization.				cell cycle (GO:0007049)|cell division (GO:0051301)|cellular response to sodium dodecyl sulfate (GO:0072707)|negative regulation of apoptotic process (GO:0043066)|positive regulation of cell cycle phase transition (GO:1901989)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of kinase activity (GO:0033674)|positive regulation of megakaryocyte differentiation (GO:0045654)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(1)|kidney(4)|large_intestine(5)|lung(9)|ovary(5)|prostate(1)|skin(1)|urinary_tract(1)	29	all_cancers(97;8.72e-12)|all_epithelial(106;1.07e-10)|Lung NSC(106;7.18e-05)|all_lung(105;0.00021)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)	Acute lymphoblastic leukemia(644;0.136)	Epithelial(56;3.45e-38)|all cancers(56;3.04e-33)|BRCA - Breast invasive adenocarcinoma(115;0.0424)|Colorectal(110;0.055)	GBM - Glioblastoma multiforme(99;0.02)|KIRC - Kidney renal clear cell carcinoma(644;0.0486)		GGTGCTTCCTCAGGTGTGCAC	0.537																																						dbGAP											0													92.0	90.0	91.0					8																	146156997		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			X52340	CCDS6437.1	8q24	2013-01-08	2006-05-10		ENSG00000170631	ENSG00000170631		"""Zinc fingers, C2H2-type"""	12947	protein-coding gene	gene with protein product		601262	"""zinc finger protein 16 (KOX 9)"""				Standard	NM_006958		Approved	KOX9	uc003zeu.3	P17020	OTTHUMG00000165253	ENST00000276816.4:c.1176G>C	8.37:g.146156997C>G		Somatic		WXS	Illumina GAIIx	Phase_IV	B3KXM4|D3DWP2|Q45SH7|Q96FG0|Q9NRA4	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L392	ENST00000276816.4	37	c.1176	CCDS6437.1	8																																																																																			ZNF16	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000170631		0.537	ZNF16-002	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF16	HGNC	protein_coding	OTTHUMT00000382978.1	41	0.00	0	C	NM_006958		146156997	146156997	-1	no_errors	ENST00000276816	ensembl	human	known	69_37n	silent	40	13.04	6	SNP	0.240	G
ZNF232	7775	genome.wustl.edu	37	17	5012814	5012814	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr17:5012814C>T	ENST00000250076.3	-	3	1027	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	ZNF232_ENST00000575538.1_Intron|AC012146.7_ENST00000571138.1_RNA|ZNF232_ENST00000416429.2_Missense_Mutation_p.E98K|ZNF232_ENST00000575898.1_Missense_Mutation_p.E125K|AC012146.7_ENST00000413077.1_RNA	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	98	SCAN box. {ECO:0000255|PROSITE- ProRule:PRU00187}.				transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						AAGAATTGTTCCAGCACCAGG	0.567																																						dbGAP											0													97.0	95.0	96.0					17																	5012814		2203	4300	6503	-	-	-	SO:0001583	missense	0			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.373G>A	17.37:g.5012814C>T	ENSP00000250076:p.Glu125Lys	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E125K	ENST00000250076.3	37	c.373	CCDS11068.1	17	.	.	.	.	.	.	.	.	.	.	C	14.69	2.609293	0.46527	.	.	ENSG00000167840	ENST00000250076;ENST00000416429	T;T	0.16457	2.34;2.34	3.02	3.02	0.34903	Retrovirus capsid, C-terminal (1);Transcription regulator SCAN (3);	0.000000	0.33180	N	0.005183	T	0.57902	0.2085	H	0.99464	4.58	0.25466	N	0.987878	D;D;D;D	0.89917	1.0;1.0;0.998;0.998	D;D;D;P	0.97110	0.999;1.0;0.925;0.877	T	0.60637	-0.7224	10	0.87932	D	0	.	9.7858	0.40675	0.0:1.0:0.0:0.0	.	125;98;98;98	B4DNA7;B4DP49;Q9UNY5;Q9UNY5-2	.;.;ZN232_HUMAN;.	K	125;98	ENSP00000250076:E125K;ENSP00000416430:E98K	ENSP00000250076:E125K	E	-	1	0	ZNF232	4953538	1.000000	0.71417	0.999000	0.59377	0.105000	0.19272	0.975000	0.29449	1.985000	0.57927	0.655000	0.94253	GAA	ZNF232	-	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,pfscan_Tscrpt_reg_SCAN	ENSG00000167840		0.567	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF232	HGNC	protein_coding	OTTHUMT00000216915.1	48	0.00	0	C	NM_014519		5012814	5012814	-1	no_errors	ENST00000250076	ensembl	human	known	69_37n	missense	46	19.30	11	SNP	1.000	T
ZPR1	8882	genome.wustl.edu	37	11	116656232	116656232	+	Nonsense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr11:116656232G>A	ENST00000227322.3	-	6	762	c.703C>T	c.(703-705)Caa>Taa	p.Q235*		NM_003904.3	NP_003895.1	O75312	ZPR1_HUMAN		235					apoptotic process involved in development (GO:1902742)|axon development (GO:0061564)|Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA endoreduplication (GO:0042023)|inner cell mass cell proliferation (GO:0001833)|microtubule cytoskeleton organization (GO:0000226)|mRNA processing (GO:0006397)|negative regulation of motor neuron apoptotic process (GO:2000672)|positive regulation of gene expression (GO:0010628)|positive regulation of growth (GO:0045927)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of RNA splicing (GO:0033120)|positive regulation of transcription involved in G1/S transition of mitotic cell cycle (GO:0071931)|pre-mRNA catabolic process (GO:1990261)|regulation of myelination (GO:0031641)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|spinal cord development (GO:0021510)|trophectodermal cell proliferation (GO:0001834)	axon (GO:0030424)|Cajal body (GO:0015030)|cytoplasm (GO:0005737)|Gemini of coiled bodies (GO:0097504)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|SMN complex (GO:0032797)	translation initiation factor binding (GO:0031369)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	9	all_hematologic(175;0.0487)	all_cancers(61;1.72e-06)|all_epithelial(67;0.000735)|Melanoma(852;0.022)|Acute lymphoblastic leukemia(157;0.0255)|Medulloblastoma(222;0.0523)|Breast(348;0.056)|all_hematologic(158;0.0588)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|Epithelial(105;5.61e-06)|all cancers(92;0.000139)|OV - Ovarian serous cystadenocarcinoma(223;0.153)		CCACTTACTTGAAGCCCCAGC	0.498																																						dbGAP											0													127.0	112.0	117.0					11																	116656232		2201	4296	6497	-	-	-	SO:0001587	stop_gained	0																														ENST00000227322.3:c.703C>T	11.37:g.116656232G>A	ENSP00000227322:p.Gln235*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q2TAA0	Nonsense_Mutation	SNP	pfam_Znf_ZPR1,smart_Znf_ZPR1,tigrfam_Znf_ZPR1	p.Q235*	ENST00000227322.3	37	c.703	CCDS8375.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.93|13.93	2.385057|2.385057	0.42308|0.42308	.|.	.|.	ENSG00000109917|ENSG00000109917	ENST00000227322|ENST00000429220	.|.	.|.	.|.	5.65|5.65	4.66|4.66	0.58398|0.58398	.|.	0.348417|.	0.34362|.	N|.	0.004029|.	.|T	.|0.62429	.|0.2427	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.68458	.|-0.5403	.|3	0.06099|.	T|.	0.92|.	-10.6358|-10.6358	12.5444|12.5444	0.56190|0.56190	0.0:0.2039:0.6878:0.1083|0.0:0.2039:0.6878:0.1083	.|.	.|.	.|.	.|.	X|L	235|177	.|.	ENSP00000227322:Q235X|.	Q|S	-|-	1|2	0|0	ZNF259|ZNF259	116161442|116161442	0.996000|0.996000	0.38824|0.38824	1.000000|1.000000	0.80357|0.80357	0.229000|0.229000	0.25112|0.25112	1.150000|1.150000	0.31639|0.31639	2.679000|2.679000	0.91253|0.91253	0.655000|0.655000	0.94253|0.94253	CAA|TCA	ZNF259	-	tigrfam_Znf_ZPR1	ENSG00000109917		0.498	ZNF259-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF259	HGNC	protein_coding	OTTHUMT00000106283.2	87	0.00	0	G			116656232	116656232	-1	no_errors	ENST00000227322	ensembl	human	known	69_37n	nonsense	97	11.82	13	SNP	0.470	A
ZNF366	167465	genome.wustl.edu	37	5	71757044	71757044	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:71757044C>G	ENST00000318442.5	-	2	770	c.280G>C	c.(280-282)Gaa>Caa	p.E94Q		NM_152625.1	NP_689838.1	Q8N895	ZN366_HUMAN	zinc finger protein 366	94					negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|estrogen receptor binding (GO:0030331)|metal ion binding (GO:0046872)|transcription corepressor activity (GO:0003714)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(9)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	35		Lung NSC(167;0.0247)|Ovarian(174;0.0908)|Prostate(461;0.155)		OV - Ovarian serous cystadenocarcinoma(47;2.51e-53)		AGGGTGACTTCTTCTGCAGGG	0.587																																						dbGAP											0													218.0	235.0	229.0					5																	71757044		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK097115	CCDS4015.1	5q13.1	2013-01-08			ENSG00000178175	ENSG00000178175		"""Zinc fingers, C2H2-type"""	18316	protein-coding gene	gene with protein product		610159					Standard	NM_152625		Approved	FLJ39796	uc003kce.1	Q8N895	OTTHUMG00000100965	ENST00000318442.5:c.280G>C	5.37:g.71757044C>G	ENSP00000313158:p.Glu94Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	Q5HYI9|Q7RTV4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E94Q	ENST00000318442.5	37	c.280	CCDS4015.1	5	.	.	.	.	.	.	.	.	.	.	C	8.564	0.878507	0.17395	.	.	ENSG00000178175	ENST00000318442	T	0.37411	1.2	5.92	5.92	0.95590	.	0.305128	0.29715	N	0.011385	T	0.24509	0.0594	N	0.24115	0.695	0.09310	N	1	P	0.35433	0.501	B	0.32289	0.143	T	0.18808	-1.0325	10	0.29301	T	0.29	-14.9951	13.5098	0.61504	0.0:0.929:0.0:0.071	.	94	Q8N895	ZN366_HUMAN	Q	94	ENSP00000313158:E94Q	ENSP00000313158:E94Q	E	-	1	0	ZNF366	71792800	0.024000	0.19004	0.051000	0.19133	0.079000	0.17450	2.674000	0.46867	2.813000	0.96785	0.561000	0.74099	GAA	ZNF366	-	NULL	ENSG00000178175		0.587	ZNF366-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF366	HGNC	protein_coding	OTTHUMT00000218574.3	89	0.00	0	C			71757044	71757044	-1	no_errors	ENST00000318442	ensembl	human	known	69_37n	missense	107	10.83	13	SNP	0.139	G
ZNF300	91975	genome.wustl.edu	37	5	150275144	150275144	+	Missense_Mutation	SNP	C	C	G			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr5:150275144C>G	ENST00000274599.5	-	6	2077	c.1657G>C	c.(1657-1659)Gaa>Caa	p.E553Q	ZNF300_ENST00000446148.2_Missense_Mutation_p.E569Q|ZNF300_ENST00000427179.1_3'UTR|ZNF300_ENST00000394226.2_Missense_Mutation_p.E553Q|ZNF300_ENST00000418587.2_Missense_Mutation_p.E517Q	NM_052860.2	NP_443092.1	Q96RE9	ZN300_HUMAN	zinc finger protein 300	553					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(3)|large_intestine(3)|lung(13)|ovary(1)|prostate(1)|skin(2)	27		Medulloblastoma(196;0.109)|all_hematologic(541;0.131)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			TTTCCACATTCAGCACATATG	0.443																																						dbGAP											0													68.0	69.0	69.0					5																	150275144		2203	4299	6502	-	-	-	SO:0001583	missense	0			AF395541	CCDS4311.2, CCDS54939.1, CCDS54940.1	5q33.1	2013-01-08			ENSG00000145908	ENSG00000145908		"""Zinc fingers, C2H2-type"", ""-"""	13091	protein-coding gene	gene with protein product		612429				14746915	Standard	NM_052860		Approved		uc021yfx.1	Q96RE9	OTTHUMG00000130076	ENST00000274599.5:c.1657G>C	5.37:g.150275144C>G	ENSP00000274599:p.Glu553Gln	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MY91|B3KU35|B4DU78|F5GWS1|Q06DQ3|Q17RP3|Q5H9N5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E569Q	ENST00000274599.5	37	c.1705	CCDS4311.2	5	.	.	.	.	.	.	.	.	.	.	C	10.27	1.303176	0.23736	.	.	ENSG00000145908	ENST00000446148;ENST00000274599;ENST00000418587;ENST00000394226	T;T;T;T	0.07444	3.19;3.19;3.19;3.19	3.75	2.84	0.33178	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04861	0.0131	N	0.04746	-0.17	0.09310	N	1	B	0.29432	0.244	B	0.28709	0.093	T	0.39663	-0.9603	9	0.54805	T	0.06	.	10.932	0.47224	0.0:0.8074:0.1925:0.0	.	553	Q96RE9	ZN300_HUMAN	Q	569;553;517;553	ENSP00000397178:E569Q;ENSP00000274599:E553Q;ENSP00000392593:E517Q;ENSP00000377773:E553Q	ENSP00000274599:E553Q	E	-	1	0	ZNF300	150255337	0.000000	0.05858	0.977000	0.42913	0.850000	0.48378	0.372000	0.20467	0.894000	0.36317	0.591000	0.81541	GAA	ZNF300	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000145908		0.443	ZNF300-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF300	HGNC	protein_coding		64	0.00	0	C	NM_052860		150275144	150275144	-1	no_errors	ENST00000446148	ensembl	human	known	69_37n	missense	60	34.78	32	SNP	0.308	G
ZNF479	90827	genome.wustl.edu	37	7	57187652	57187652	+	Silent	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr7:57187652C>T	ENST00000331162.4	-	5	1740	c.1470G>A	c.(1468-1470)gaG>gaA	p.E490E		NM_033273.1	NP_150376.1	Q96JC4	ZN479_HUMAN	zinc finger protein 479	490					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.E490E(1)		NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(14)|lung(53)|ovary(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	84			GBM - Glioblastoma multiforme(1;9.18e-12)			TGTAGGGTTTCTCTCCAGTAT	0.393																																						dbGAP											1	Substitution - coding silent(1)	lung(1)											33.0	33.0	33.0					7																	57187652		2046	4220	6266	-	-	-	SO:0001819	synonymous_variant	0			AF277624	CCDS43590.1	7p11.2	2013-01-08			ENSG00000185177	ENSG00000185177		"""Zinc fingers, C2H2-type"", ""-"""	23258	protein-coding gene	gene with protein product						11410164	Standard	NM_033273		Approved	KR19	uc010kzo.3	Q96JC4	OTTHUMG00000156682	ENST00000331162.4:c.1470G>A	7.37:g.57187652C>T		Somatic		WXS	Illumina GAIIx	Phase_IV		Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E490	ENST00000331162.4	37	c.1470	CCDS43590.1	7																																																																																			ZNF479	-	pfscan_Znf_C2H2	ENSG00000185177		0.393	ZNF479-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF479	HGNC	protein_coding	OTTHUMT00000345302.1	62	0.00	0	C	XM_291202		57187652	57187652	-1	no_errors	ENST00000331162	ensembl	human	known	69_37n	silent	52	10.34	6	SNP	1.000	T
ZNF543	125919	genome.wustl.edu	37	19	57835121	57835121	+	Silent	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:57835121G>A	ENST00000321545.4	+	2	435	c.90G>A	c.(88-90)caG>caA	p.Q30Q		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	30	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		ATGCAGCCCAGAGAACCTTGT	0.517																																						dbGAP											0													194.0	160.0	172.0					19																	57835121		2203	4300	6503	-	-	-	SO:0001819	synonymous_variant	0			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.90G>A	19.37:g.57835121G>A		Somatic		WXS	Illumina GAIIx	Phase_IV	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q30	ENST00000321545.4	37	c.90	CCDS33130.1	19																																																																																			ZNF543	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box	ENSG00000178229		0.517	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF543	HGNC	protein_coding	OTTHUMT00000465780.1	89	0.00	0	G	XM_064865		57835121	57835121	+1	no_errors	ENST00000321545	ensembl	human	known	69_37n	silent	104	14.05	17	SNP	0.732	A
ZNF543	125919	genome.wustl.edu	37	19	57840193	57840193	+	Missense_Mutation	SNP	G	G	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:57840193G>A	ENST00000321545.4	+	4	1708	c.1363G>A	c.(1363-1365)Gaa>Aaa	p.E455K		NM_213598.3	NP_998763.2	Q08ER8	ZN543_HUMAN	zinc finger protein 543	455					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|kidney(2)|large_intestine(8)|lung(11)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	28		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0257)		TGAATGCAAAGAATGTGGAAA	0.478																																						dbGAP											0													71.0	72.0	72.0					19																	57840193		2203	4300	6503	-	-	-	SO:0001583	missense	0			AL834534	CCDS33130.1	19q13.43	2013-01-08				ENSG00000178229		"""Zinc fingers, C2H2-type"", ""-"""	25281	protein-coding gene	gene with protein product							Standard	NM_213598		Approved	DKFZp434H055	uc002qoi.2	Q08ER8		ENST00000321545.4:c.1363G>A	19.37:g.57840193G>A	ENSP00000322545:p.Glu455Lys	Somatic		WXS	Illumina GAIIx	Phase_IV	Q495U9|Q495V0|Q6ZMP4|Q8NCX4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E455K	ENST00000321545.4	37	c.1363	CCDS33130.1	19	.	.	.	.	.	.	.	.	.	.	G	15.02	2.708606	0.48517	.	.	ENSG00000178229	ENST00000321545	T	0.35973	1.28	3.0	3.0	0.34707	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.56321	0.1977	L	0.61387	1.9	0.23271	N	0.998009	D	0.89917	1.0	D	0.91635	0.999	T	0.45454	-0.9260	9	0.72032	D	0.01	.	13.1928	0.59722	0.0:0.0:1.0:0.0	.	455	Q08ER8	ZN543_HUMAN	K	455	ENSP00000322545:E455K	ENSP00000322545:E455K	E	+	1	0	ZNF543	62532005	0.000000	0.05858	0.921000	0.36526	0.599000	0.36880	0.310000	0.19356	1.654000	0.50703	0.561000	0.74099	GAA	ZNF543	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000178229		0.478	ZNF543-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF543	HGNC	protein_coding	OTTHUMT00000465780.1	45	0.00	0	G	XM_064865		57840193	57840193	+1	no_errors	ENST00000321545	ensembl	human	known	69_37n	missense	49	18.33	11	SNP	0.969	A
ZNF589	51385	genome.wustl.edu	37	3	48299430	48299430	+	Intron	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr3:48299430C>T	ENST00000354698.3	+	3	168				ZNF589_ENST00000440261.2_Intron|ZNF589_ENST00000454212.1_3'UTR|ZNF589_ENST00000412564.1_Intron|ZNF589_ENST00000427617.2_Intron	NM_016089.2	NP_057173.2	Q86UQ0	ZN589_HUMAN	zinc finger protein 589						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)|lung(1)|ovary(1)|skin(1)	4				BRCA - Breast invasive adenocarcinoma(193;0.000649)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		taccctgtctcaagtattgtg	0.343																																					Colon(9;319 328 25374 27611 50948)	dbGAP											0																																										-	-	-	SO:0001627	intron_variant	0			AF114816	CCDS43085.1	3p21	2013-01-08			ENSG00000164048	ENSG00000164048		"""Zinc fingers, C2H2-type"", ""-"""	16747	protein-coding gene	gene with protein product						10029171	Standard	NM_016089		Approved	SZF1	uc003csl.4	Q86UQ0	OTTHUMG00000156833	ENST00000354698.3:c.97-2873C>T	3.37:g.48299430C>T		Somatic		WXS	Illumina GAIIx	Phase_IV	Q86UC9|Q9BRI6|Q9BRY3|Q9Y611|Q9Y612	RNA	SNP	-	NULL	ENST00000354698.3	37	NULL	CCDS43085.1	3																																																																																			ZNF589	-	-	ENSG00000164048		0.343	ZNF589-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF589	HGNC	protein_coding	OTTHUMT00000346124.1	81	0.00	0	C	NM_016089		48299430	48299430	+1	no_errors	ENST00000454212	ensembl	human	known	69_37n	rna	118	12.59	17	SNP	0.009	T
ZNF649	65251	genome.wustl.edu	37	19	52394623	52394623	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:52394623G>C	ENST00000354957.3	-	5	1050	c.766C>G	c.(766-768)Cac>Gac	p.H256D	ZNF649_ENST00000600738.1_Missense_Mutation_p.H228D|CTC-429C10.2_ENST00000600329.1_RNA	NM_023074.3	NP_075562.2	Q9BS31	ZN649_HUMAN	zinc finger protein 649	256					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	29		all_neural(266;0.0602)		GBM - Glioblastoma multiforme(134;0.00152)|OV - Ovarian serous cystadenocarcinoma(262;0.0185)		TCTCCTTTGTGAGCTCTCTCG	0.502																																						dbGAP											0													123.0	122.0	123.0					19																	52394623		2203	4300	6503	-	-	-	SO:0001583	missense	0			BC005368	CCDS12843.1	19q13.41	2013-01-08				ENSG00000198093		"""Zinc fingers, C2H2-type"", ""-"""	25741	protein-coding gene	gene with protein product		611903				15950191	Standard	NM_023074		Approved	FLJ12644	uc002pxy.3	Q9BS31		ENST00000354957.3:c.766C>G	19.37:g.52394623G>C	ENSP00000347043:p.His256Asp	Somatic		WXS	Illumina GAIIx	Phase_IV	A8MYJ5|B2RDC4|Q9H9N2	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H256D	ENST00000354957.3	37	c.766	CCDS12843.1	19	.	.	.	.	.	.	.	.	.	.	G	15.16	2.752362	0.49362	.	.	ENSG00000198093	ENST00000354957	T	0.67698	-0.28	2.63	2.63	0.31362	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.84714	0.5533	M	0.93638	3.44	0.27618	N	0.948451	D	0.69078	0.997	D	0.75020	0.985	T	0.76578	-0.2908	9	0.87932	D	0	.	12.0354	0.53423	0.0:0.0:1.0:0.0	.	256	Q9BS31	ZN649_HUMAN	D	256	ENSP00000347043:H256D	ENSP00000347043:H256D	H	-	1	0	ZNF649	57086435	1.000000	0.71417	0.005000	0.12908	0.009000	0.06853	8.061000	0.89467	1.309000	0.44985	0.404000	0.27445	CAC	ZNF649	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198093		0.502	ZNF649-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF649	HGNC	protein_coding	OTTHUMT00000461097.1	58	0.00	0	G	NM_023074		52394623	52394623	-1	no_errors	ENST00000354957	ensembl	human	known	69_37n	missense	88	12.00	12	SNP	0.944	C
ZNF768	79724	genome.wustl.edu	37	16	30537313	30537313	+	Nonsense_Mutation	SNP	C	C	A			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr16:30537313C>A	ENST00000380412.5	-	2	323	c.148G>T	c.(148-150)Gaa>Taa	p.E50*	ZNF747_ENST00000569360.1_3'UTR|ZNF768_ENST00000562803.1_Nonsense_Mutation_p.E19*|ZNF747_ENST00000535210.1_3'UTR	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	50					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TCTTCgacttcatagtcccca	0.507																																						dbGAP											0													132.0	128.0	130.0					16																	30537313		2197	4300	6497	-	-	-	SO:0001587	stop_gained	0			BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.148G>T	16.37:g.30537313C>A	ENSP00000369777:p.Glu50*	Somatic		WXS	Illumina GAIIx	Phase_IV	Q569L7|Q96CX4	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_RNA_pol_II_repeat_euk,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E50*	ENST00000380412.5	37	c.148	CCDS10681.2	16	.	.	.	.	.	.	.	.	.	.	C	17.55	3.418306	0.62622	.	.	ENSG00000169957	ENST00000380412;ENST00000538507	.	.	.	4.44	4.44	0.53790	.	0.000000	0.48286	D	0.000192	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	-10.2843	14.0862	0.64957	0.0:1.0:0.0:0.0	.	.	.	.	X	50;19	.	ENSP00000369777:E50X	E	-	1	0	ZNF768	30444814	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.287000	0.43505	2.287000	0.76781	0.561000	0.74099	GAA	ZNF768	-	NULL	ENSG00000169957		0.507	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF768	HGNC	protein_coding	OTTHUMT00000255522.2	30	0.00	0	C	NM_024671		30537313	30537313	-1	no_errors	ENST00000380412	ensembl	human	known	69_37n	nonsense	49	14.04	8	SNP	1.000	A
ZNF792	126375	genome.wustl.edu	37	19	35449130	35449130	+	Missense_Mutation	SNP	G	G	C			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:35449130G>C	ENST00000404801.1	-	4	2015	c.1629C>G	c.(1627-1629)ttC>ttG	p.F543L	ZNF792_ENST00000605484.1_Missense_Mutation_p.F476L	NM_175872.4	NP_787068.3	Q3KQV3	ZN792_HUMAN	zinc finger protein 792	543					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(1)|lung(5)	12	all_lung(56;4.18e-08)|Lung NSC(56;6.62e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0849)			ACCTCTGCCTGAAGGTTTTCC	0.517																																					GBM(1;7 183 21053 22581 22847)	dbGAP											0													84.0	69.0	74.0					19																	35449130		2203	4300	6503	-	-	-	SO:0001583	missense	0			AK095770	CCDS12440.2	19q13.11	2013-01-08			ENSG00000180884	ENSG00000180884		"""Zinc fingers, C2H2-type"", ""-"""	24751	protein-coding gene	gene with protein product						8889548	Standard	NM_175872		Approved	FLJ38451	uc002nxh.1	Q3KQV3	OTTHUMG00000150339	ENST00000404801.1:c.1629C>G	19.37:g.35449130G>C	ENSP00000385099:p.Phe543Leu	Somatic		WXS	Illumina GAIIx	Phase_IV	B4E333|Q495L1|Q495L3|Q8N932	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F543L	ENST00000404801.1	37	c.1629	CCDS12440.2	19	.	.	.	.	.	.	.	.	.	.	g	16.48	3.135772	0.56828	.	.	ENSG00000180884	ENST00000404801;ENST00000379189	T	0.46063	0.88	2.81	0.678	0.17969	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.60470	0.2271	M	0.83312	2.635	0.27393	N	0.955087	D	0.64830	0.994	D	0.67548	0.952	T	0.50127	-0.8864	9	0.72032	D	0.01	.	6.8456	0.23987	0.2489:0.0:0.7511:0.0	.	543	Q3KQV3	ZN792_HUMAN	L	543;303	ENSP00000385099:F543L	ENSP00000368487:F303L	F	-	3	2	ZNF792	40140970	0.759000	0.28416	0.960000	0.40013	0.908000	0.53690	0.945000	0.29056	0.263000	0.21812	-0.244000	0.11960	TTC	ZNF792	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000180884		0.517	ZNF792-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF792	HGNC	protein_coding	OTTHUMT00000317673.1	34	0.00	0	G	NM_175872		35449130	35449130	-1	no_errors	ENST00000404801	ensembl	human	known	69_37n	missense	32	13.51	5	SNP	0.960	C
ZNF813	126017	genome.wustl.edu	37	19	53994951	53994951	+	Missense_Mutation	SNP	C	C	T			TCGA-PE-A5DE-01A-11D-A27P-09	TCGA-PE-A5DE-10A-01D-A27P-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none	1		Illumina GAIIx	b59ec69e-e93a-4415-9c18-9d139b852919	7ff240ac-2b8f-4e5c-8184-980b3f9322a5	g.chr19:53994951C>T	ENST00000396403.4	+	4	1593	c.1465C>T	c.(1465-1467)Cat>Tat	p.H489Y	ZNF813_ENST00000396421.4_Intron	NM_001004301.3	NP_001004301.2	Q6ZN06	ZN813_HUMAN	zinc finger protein 813	489					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			large_intestine(1)	1				GBM - Glioblastoma multiforme(134;0.00619)		TACGGCAATTCATACTGGAGA	0.398																																						dbGAP											0													59.0	61.0	60.0					19																	53994951		2199	4297	6496	-	-	-	SO:0001583	missense	0			AK091460	CCDS46172.1	19q13.41	2013-01-08			ENSG00000198346	ENSG00000198346		"""Zinc fingers, C2H2-type"", ""-"""	33257	protein-coding gene	gene with protein product							Standard	NM_001004301		Approved	FLJ16542	uc002qbu.2	Q6ZN06	OTTHUMG00000158309	ENST00000396403.4:c.1465C>T	19.37:g.53994951C>T	ENSP00000379684:p.His489Tyr	Somatic		WXS	Illumina GAIIx	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H489Y	ENST00000396403.4	37	c.1465	CCDS46172.1	19	.	.	.	.	.	.	.	.	.	.	c	11.83	1.754658	0.31046	.	.	ENSG00000198346	ENST00000396403	T	0.67523	-0.27	1.15	1.15	0.20763	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.69869	0.3159	M	0.85777	2.775	0.80722	D	1	P	0.34934	0.476	B	0.40009	0.316	T	0.69573	-0.5109	9	0.87932	D	0	.	8.7303	0.34494	0.0:1.0:0.0:0.0	.	489	Q6ZN06	ZN813_HUMAN	Y	489	ENSP00000379684:H489Y	ENSP00000379684:H489Y	H	+	1	0	ZNF813	58686763	0.996000	0.38824	0.012000	0.15200	0.012000	0.07955	4.199000	0.58426	0.194000	0.20326	0.197000	0.17608	CAT	ZNF813	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	ENSG00000198346		0.398	ZNF813-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF813	HGNC	protein_coding	OTTHUMT00000350638.1	47	0.00	0	C	NM_001004301		53994951	53994951	+1	no_errors	ENST00000396403	ensembl	human	known	69_37n	missense	53	20.90	14	SNP	0.656	T
