#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
A1BG	1	genome.wustl.edu	37	19	58864353	58864353	+	Missense_Mutation	SNP	C	C	T	rs533605370		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:58864353C>T	ENST00000263100.3	-	3	342	c.281G>A	c.(280-282)cGc>cAc	p.R94H	A1BG-AS1_ENST00000593960.1_RNA|CTD-2619J13.8_ENST00000599109.1_RNA|A1BG-AS1_ENST00000595302.1_RNA|A1BG-AS1_ENST00000599728.1_RNA|A1BG-AS1_ENST00000593374.1_RNA|A1BG-AS1_ENST00000600686.1_RNA|A1BG-AS1_ENST00000594950.1_RNA|A1BG-AS1_ENST00000600379.1_RNA	NM_130786.3	NP_570602.2	P04217	A1BG_HUMAN	alpha-1-B glycoprotein	94	Ig-like V-type 1.					blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)		p.R94H(1)		NS(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|prostate(2)	15		all_cancers(17;3.04e-16)|all_epithelial(17;7.77e-12)|Lung NSC(17;3.25e-05)|Colorectal(82;5.46e-05)|all_lung(17;0.000129)|all_neural(62;0.0182)|Ovarian(87;0.0443)|Breast(46;0.0889)|Renal(17;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0269)		CAAGCCCGAGCGGCAGCGGTA	0.637													C|||	1	0.000199681	0.0008	0.0	5008	,	,		15020	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	cervix(1)											46.0	53.0	51.0					19																	58864353		2203	4300	6503	SO:0001583	missense	1				CCDS12976.1	19q13.43	2013-10-15			ENSG00000121410	ENSG00000121410		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5	protein-coding gene	gene with protein product		138670				2591067	Standard	NM_130786		Approved		uc002qsd.4	P04217	OTTHUMG00000183507	ENST00000263100.3:c.281G>A	19.37:g.58864353C>T	ENSP00000263100:p.Arg94His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K052|Q68CK0|Q8IYJ6|Q96P39	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.R94H	ENST00000263100.3	37	c.281	CCDS12976.1	19	.	.	.	.	.	.	.	.	.	.	C	12.61	1.989526	0.35131	.	.	ENSG00000121410	ENST00000263100	T	0.14766	2.48	3.52	1.34	0.21922	Immunoglobulin-like fold (1);	0.547744	0.15170	N	0.276722	T	0.17450	0.0419	L	0.47716	1.5	0.23972	N	0.996302	D	0.62365	0.991	P	0.56163	0.793	T	0.14783	-1.0460	10	0.17832	T	0.49	.	6.0556	0.19809	0.0:0.7583:0.0:0.2417	.	94	P04217	A1BG_HUMAN	H	94	ENSP00000263100:R94H	ENSP00000263100:R94H	R	-	2	0	A1BG	63556165	0.025000	0.19082	0.314000	0.25224	0.022000	0.10575	-0.148000	0.10219	0.473000	0.27368	0.563000	0.77884	CGC	A1BG	-	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt		0.637	A1BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	A1BG	HGNC	protein_coding	OTTHUMT00000466930.1	C	NM_130786		58864353	-1	no_errors	ENST00000263100	ensembl	human	known	70_37	missense	SNP	0.503	T
AAK1	22848	genome.wustl.edu	37	2	69754432	69754432	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:69754432G>A	ENST00000409085.4	-	9	1267	c.891C>T	c.(889-891)gaC>gaT	p.D297D	AAK1_ENST00000406297.3_Silent_p.D297D|AAK1_ENST00000409068.1_Silent_p.D297D	NM_014911.3	NP_055726	Q2M2I8	AAK1_HUMAN	AP2 associated kinase 1	297	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				endocytosis (GO:0006897)|positive regulation of Notch signaling pathway (GO:0045747)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|protein stabilization (GO:0050821)|regulation of clathrin-mediated endocytosis (GO:2000369)|regulation of protein localization (GO:0032880)	cell leading edge (GO:0031252)|clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|extrinsic component of plasma membrane (GO:0019897)|terminal bouton (GO:0043195)	AP-2 adaptor complex binding (GO:0035612)|ATP binding (GO:0005524)|Notch binding (GO:0005112)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)	17						TTTTGTCAGGGTCTGGTTCCA	0.398																																																	0													70.0	64.0	66.0					2																	69754432		1845	4091	5936	SO:0001819	synonymous_variant	22848			AB028971	CCDS1893.2	2p13.3	2012-07-10			ENSG00000115977	ENSG00000115977			19679	protein-coding gene	gene with protein product						11877461, 12471243	Standard	NM_014911		Approved	KIAA1048, DKFZp686K16132	uc002sfp.2	Q2M2I8	OTTHUMG00000129648	ENST00000409085.4:c.891C>T	2.37:g.69754432G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZFZ3|Q53RX6|Q9UPV4	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D297	ENST00000409085.4	37	c.891	CCDS1893.2	2																																																																																			AAK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.398	AAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AAK1	HGNC	protein_coding	OTTHUMT00000251847.4	G	NM_014911		69754432	-1	no_errors	ENST00000409085	ensembl	human	known	70_37	silent	SNP	1.000	A
ABR	29	genome.wustl.edu	37	17	953339	953339	+	Missense_Mutation	SNP	T	T	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:953339T>G	ENST00000302538.5	-	16	1888	c.1742A>C	c.(1741-1743)aAg>aCg	p.K581T	ABR_ENST00000536794.2_Missense_Mutation_p.K363T|ABR_ENST00000544583.2_Missense_Mutation_p.K535T|ABR_ENST00000291107.2_Missense_Mutation_p.K544T|ABR_ENST00000574437.1_Missense_Mutation_p.K535T	NM_001282149.1|NM_021962.3	NP_001269078.1|NP_068781.2	Q12979	ABR_HUMAN	active BCR-related	581	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of phagocytosis (GO:0050766)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|membrane (GO:0016020)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.K581T(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39				UCEC - Uterine corpus endometrioid carcinoma (25;0.0228)		ATTGTTGTCCTTGTTGACCTT	0.572																																					Esophageal Squamous(197;2016 2115 4129 29033 46447)												1	Substitution - Missense(1)	cervix(1)											362.0	296.0	319.0					17																	953339		2203	4300	6503	SO:0001583	missense	29			L19704	CCDS10999.1, CCDS11000.1, CCDS54060.1, CCDS58497.1, CCDS73936.1	17p13	2013-01-10	2012-02-27		ENSG00000159842	ENSG00000159842		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	81	protein-coding gene	gene with protein product		600365	"""active BCR-related gene"""			2587217, 7479768	Standard	NM_001092		Approved	MDB	uc002fsd.4	Q12979	OTTHUMG00000090313	ENST00000302538.5:c.1742A>C	17.37:g.953339T>G	ENSP00000303909:p.Lys581Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KW89|B7Z6H7|D3DTH3|D3DTH4|F5H3S2|F5H8B3|Q13693|Q13694	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_DH-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DH-domain,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RhoGAP_dom,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom,pfscan_DH-domain	p.K581T	ENST00000302538.5	37	c.1742	CCDS10999.1	17	.	.	.	.	.	.	.	.	.	.	T	23.4	4.406429	0.83230	.	.	ENSG00000159842	ENST00000302538;ENST00000544583;ENST00000291107;ENST00000536794	T;T;T;T	0.22539	1.98;1.99;1.95;3.21	5.8	5.8	0.92144	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.36799	0.0980	L	0.57536	1.79	0.43808	D	0.996365	P;P;P	0.48294	0.775;0.9;0.908	P;P;P	0.54590	0.756;0.506;0.719	T	0.04029	-1.0983	10	0.48119	T	0.1	.	14.9742	0.71257	0.0:0.0:0.0:1.0	.	363;544;581	B7Z683;Q12979-2;Q12979	.;.;ABR_HUMAN	T	581;535;544;363	ENSP00000303909:K581T;ENSP00000442048:K535T;ENSP00000291107:K544T;ENSP00000437429:K363T	ENSP00000291107:K544T	K	-	2	0	ABR	900089	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.219000	0.72231	2.224000	0.72417	0.533000	0.62120	AAG	ABR	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting		0.572	ABR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABR	HGNC	protein_coding	OTTHUMT00000206675.4	T			953339	-1	no_errors	ENST00000302538	ensembl	human	known	70_37	missense	SNP	1.000	G
ACP6	51205	genome.wustl.edu	37	1	147120085	147120085	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:147120085G>A	ENST00000369238.6	-	9	1553	c.1106C>T	c.(1105-1107)tCt>tTt	p.S369F	ACP6_ENST00000460583.1_5'UTR	NM_016361.3	NP_057445.4	Q9NPH0	PPA6_HUMAN	acid phosphatase 6, lysophosphatidic	369					dephosphorylation (GO:0016311)|lysobisphosphatidic acid metabolic process (GO:2001311)|phospholipid metabolic process (GO:0006644)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	acid phosphatase activity (GO:0003993)|lysophosphatidic acid phosphatase activity (GO:0052642)	p.S369F(1)		breast(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(4)|prostate(1)	16	all_hematologic(923;0.0276)					CCACTCCTTAGATTCCAGGTG	0.527																																																	1	Substitution - Missense(1)	cervix(1)											132.0	117.0	122.0					1																	147120085		2203	4300	6503	SO:0001583	missense	51205			BC009965	CCDS928.1	1q21	2008-02-05			ENSG00000162836	ENSG00000162836			29609	protein-coding gene	gene with protein product		611471				12010880, 10506173	Standard	NM_016361		Approved	LPAP, ACPL1	uc001epr.2	Q9NPH0	OTTHUMG00000014019	ENST00000369238.6:c.1106C>T	1.37:g.147120085G>A	ENSP00000358241:p.Ser369Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59G61|Q5T490|Q6IAQ3|Q7LG81|Q9UIG6	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-2	p.S369F	ENST00000369238.6	37	c.1106	CCDS928.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.279999	0.80692	.	.	ENSG00000162836	ENST00000369238	T	0.46451	0.87	4.84	4.84	0.62591	.	0.107471	0.64402	D	0.000004	T	0.57888	0.2084	M	0.78637	2.42	0.80722	D	1	D	0.58970	0.984	P	0.62649	0.905	T	0.65030	-0.6267	10	0.72032	D	0.01	.	17.938	0.89018	0.0:0.0:1.0:0.0	.	369	Q9NPH0	PPA6_HUMAN	F	369	ENSP00000358241:S369F	ENSP00000358241:S369F	S	-	2	0	ACP6	145586709	1.000000	0.71417	0.371000	0.25978	0.978000	0.69477	8.326000	0.90010	2.226000	0.72624	0.514000	0.50259	TCT	ACP6	-	pfam_His_Pase_superF_clade-2		0.527	ACP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACP6	HGNC	protein_coding	OTTHUMT00000039420.2	G	NM_016361		147120085	-1	no_errors	ENST00000369238	ensembl	human	known	70_37	missense	SNP	0.997	A
ACVR1C	130399	genome.wustl.edu	37	2	158412762	158412762	+	Silent	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:158412762C>G	ENST00000243349.8	-	3	747	c.387G>C	c.(385-387)gcG>gcC	p.A129A	ACVR1C_ENST00000409680.3_Silent_p.A79A|ACVR1C_ENST00000348328.5_Intron|ACVR1C_ENST00000335450.7_Intron	NM_001111032.1|NM_145259.2	NP_001104502.1|NP_660302.2			activin A receptor, type IC									p.A129A(1)		NS(1)|breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(6)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	42						CTGTCAGCATCGCAGCTATGG	0.483																																																	1	Substitution - coding silent(1)	cervix(1)											104.0	84.0	91.0					2																	158412762		2203	4300	6503	SO:0001819	synonymous_variant	130399			BC022530	CCDS2205.1, CCDS46432.1, CCDS46433.1, CCDS46434.1	2q24.2	2008-02-05			ENSG00000123612	ENSG00000123612			18123	protein-coding gene	gene with protein product		608981					Standard	NM_145259		Approved	ALK7, ACVRLK7	uc002tzk.4	Q8NER5	OTTHUMG00000131964	ENST00000243349.8:c.387G>C	2.37:g.158412762C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_TGF_beta_rcpt_GS,pfam_Activin_rcpt,superfamily_Kinase-like_dom,smart_TGF_beta_rcpt_GS,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A129	ENST00000243349.8	37	c.387	CCDS2205.1	2																																																																																			ACVR1C	-	NULL		0.483	ACVR1C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR1C	HGNC	protein_coding	OTTHUMT00000254924.2	C	NM_145259		158412762	-1	no_errors	ENST00000243349	ensembl	human	known	70_37	silent	SNP	0.519	G
ADAM29	11086	genome.wustl.edu	37	4	175896932	175896932	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:175896932C>T	ENST00000359240.3	+	5	926	c.256C>T	c.(256-258)Cag>Tag	p.Q86*	ADAM29_ENST00000404450.4_Nonsense_Mutation_p.Q86*|ADAM29_ENST00000514159.1_Nonsense_Mutation_p.Q86*|RP13-577H12.2_ENST00000507525.1_RNA|ADAM29_ENST00000445694.1_Nonsense_Mutation_p.Q86*	NM_001278125.1|NM_014269.4	NP_001265054.1|NP_055084.3	Q9UKF5	ADA29_HUMAN	ADAM metallopeptidase domain 29	86					spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)	p.Q86*(1)		NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(25)|ovary(3)|pancreas(1)|prostate(7)|skin(24)|urinary_tract(2)	93		Breast(14;0.00908)|Melanoma(52;0.00951)|Prostate(90;0.00996)|Renal(120;0.0183)|all_hematologic(60;0.107)|all_neural(102;0.164)		all cancers(43;3.08e-19)|Epithelial(43;6.24e-18)|OV - Ovarian serous cystadenocarcinoma(60;1.78e-09)|STAD - Stomach adenocarcinoma(60;0.00303)|GBM - Glioblastoma multiforme(59;0.0106)|LUSC - Lung squamous cell carcinoma(193;0.0286)		CTACACAGACCAGGGTGCTAT	0.478																																					Ovarian(140;1727 1835 21805 25838 41440)												1	Substitution - Nonsense(1)	cervix(1)											47.0	48.0	48.0					4																	175896932		2203	4300	6503	SO:0001587	stop_gained	11086			AF171929	CCDS3823.1	4q34.1	2012-05-16	2005-08-18		ENSG00000168594	ENSG00000168594		"""ADAM metallopeptidase domain containing"""	207	protein-coding gene	gene with protein product	"""cancer/testis antigen 73"""	604778	"""a disintegrin and metalloproteinase domain 29"""			10644455	Standard	NM_014269		Approved	svph1, CT73	uc031shw.1	Q9UKF5	OTTHUMG00000160764	ENST00000359240.3:c.256C>T	4.37:g.175896932C>T	ENSP00000352177:p.Gln86*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4W5F3|Q9UHP1|Q9UKF3|Q9UKF4	Nonsense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.Q86*	ENST00000359240.3	37	c.256	CCDS3823.1	4	.	.	.	.	.	.	.	.	.	.	C	28.4	4.916188	0.92249	.	.	ENSG00000168594	ENST00000359240;ENST00000445694;ENST00000502940;ENST00000404450;ENST00000514159	.	.	.	3.77	2.9	0.33743	.	0.606157	0.12714	U	0.445253	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	8.5573	0.33489	0.2303:0.7697:0.0:0.0	.	.	.	.	X	86	.	.	Q	+	1	0	ADAM29	176133507	0.000000	0.05858	0.968000	0.41197	0.640000	0.38277	-0.598000	0.05706	1.128000	0.42052	0.637000	0.83480	CAG	ADAM29	-	pfam_Peptidase_M12B_N		0.478	ADAM29-201	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ADAM29	HGNC	protein_coding		C			175896932	+1	no_errors	ENST00000359240	ensembl	human	known	70_37	nonsense	SNP	0.975	T
ADAMTSL1	92949	genome.wustl.edu	37	9	18777507	18777507	+	Missense_Mutation	SNP	G	G	A	rs3004643		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr9:18777507G>A	ENST00000380548.4	+	19	3619	c.3280G>A	c.(3280-3282)Gac>Aac	p.D1094N		NM_001040272.5	NP_001035362.3	Q8N6G6	ATL1_HUMAN	ADAMTS-like 1	1094						proteinaceous extracellular matrix (GO:0005578)	metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|liver(2)|lung(17)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(50;1.29e-17)		GGAGCTGCGCGACCTCTACAG	0.667																																																	0													15.0	19.0	18.0					9																	18777507		2073	4184	6257	SO:0001583	missense	92949			AF176313	CCDS6485.1, CCDS47954.1	9p21.3	2013-01-11			ENSG00000178031	ENSG00000178031		"""Immunoglobulin superfamily / I-set domain containing"""	14632	protein-coding gene	gene with protein product	"""punctin"""	609198	"""chromosome 9 open reading frame 94"""	C9orf94		9628581, 11805097	Standard	NM_001040272		Approved	ADAMTSR1, FLJ35283	uc003zne.4	Q8N6G6	OTTHUMG00000019604	ENST00000380548.4:c.3280G>A	9.37:g.18777507G>A	ENSP00000369921:p.Asp1094Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6PVN1|A8K7E1|Q496M6|Q496M8|Q5T708|Q5VZT8|Q8NAI9|Q96RW4|Q9BXY3	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Immunoglobulin,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Ig-like,prints_Peptidase_M12B_ADAM-TS	p.D1094N	ENST00000380548.4	37	c.3280	CCDS47954.1	9	.	.	.	.	.	.	.	.	.	.	G	35	5.511842	0.96402	.	.	ENSG00000178031	ENST00000380548	T	0.64260	-0.09	5.88	5.88	0.94601	.	0.063246	0.08080	U	1.000000	T	0.51652	0.1687	N	0.19112	0.55	0.80722	D	1	P	0.46020	0.871	B	0.33521	0.165	T	0.61811	-0.6986	10	0.72032	D	0.01	.	20.2366	0.98359	0.0:0.0:1.0:0.0	rs3004643;rs3004643	1094	Q8N6G6	ATL1_HUMAN	N	1094	ENSP00000369921:D1094N	ENSP00000369921:D1094N	D	+	1	0	ADAMTSL1	18767507	1.000000	0.71417	0.949000	0.38748	0.992000	0.81027	7.183000	0.77697	2.792000	0.96026	0.557000	0.71058	GAC	ADAMTSL1	-	NULL		0.667	ADAMTSL1-012	NOVEL	basic|appris_principal|CCDS	protein_coding	ADAMTSL1	HGNC	protein_coding	OTTHUMT00000401206.1	G			18777507	+1	no_errors	ENST00000380548	ensembl	human	novel	70_37	missense	SNP	0.989	A
ADAMTSL4	54507	genome.wustl.edu	37	1	150525407	150525407	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:150525407G>A	ENST00000369038.2	+	3	313	c.112G>A	c.(112-114)Gag>Aag	p.E38K	ADAMTSL4_ENST00000271643.4_Missense_Mutation_p.E38K|MIR4257_ENST00000581735.1_RNA|ADAMTSL4_ENST00000369041.5_Missense_Mutation_p.E38K|ADAMTSL4_ENST00000369039.5_Missense_Mutation_p.E38K|RP11-54A4.2_ENST00000442435.2_RNA			Q6UY14	ATL4_HUMAN	ADAMTS-like 4	38					apoptotic process (GO:0006915)|extracellular matrix organization (GO:0030198)|positive regulation of apoptotic process (GO:0043065)	interstitial matrix (GO:0005614)	metalloendopeptidase activity (GO:0004222)|protease binding (GO:0002020)	p.E38K(1)		breast(1)|cervix(1)|endometrium(6)|large_intestine(3)|lung(13)|ovary(2)|prostate(3)|skin(3)	32	all_cancers(9;3.13e-53)|all_epithelial(9;3.74e-43)|all_lung(15;2.43e-34)|Lung NSC(24;8.86e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			GACACCTACAGAGGAGGGCCA	0.587																																																	1	Substitution - Missense(1)	cervix(1)											37.0	46.0	43.0					1																	150525407		2180	4263	6443	SO:0001583	missense	54507			BC027478	CCDS955.1, CCDS30852.1, CCDS72908.1	1q21.2	2008-02-05	2005-12-01	2005-12-01	ENSG00000143382	ENSG00000143382			19706	protein-coding gene	gene with protein product		610113	"""thrombospondin repeat containing 1"""	TSRC1		12706885	Standard	NM_019032		Approved	DKFZP434K1772	uc001eux.3	Q6UY14	OTTHUMG00000034863	ENST00000369038.2:c.112G>A	1.37:g.150525407G>A	ENSP00000358034:p.Glu38Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTT0|F8WAD0|Q5T5F7|Q6IPM6|Q8N643|Q9HBS6	Missense_Mutation	SNP	pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt	p.E38K	ENST00000369038.2	37	c.112	CCDS955.1	1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.720958	0.68959	.	.	ENSG00000143382	ENST00000369041;ENST00000271643;ENST00000369039;ENST00000369038	T;T;T;T	0.63417	0.06;-0.04;0.24;-0.04	4.63	4.63	0.57726	.	.	.	.	.	T	0.55000	0.1893	L	0.27053	0.805	0.09310	N	1	D;D;D;D	0.71674	0.996;0.998;0.996;0.997	P;D;P;D	0.64042	0.836;0.915;0.824;0.921	T	0.53401	-0.8444	9	0.72032	D	0.01	.	12.9585	0.58444	0.0:0.0:1.0:0.0	.	38;38;38;38	B7ZMJ3;F8WAD0;Q6UY14;Q6UY14-2	.;.;ATL4_HUMAN;.	K	38	ENSP00000358037:E38K;ENSP00000271643:E38K;ENSP00000358035:E38K;ENSP00000358034:E38K	ENSP00000271643:E38K	E	+	1	0	ADAMTSL4	148792031	1.000000	0.71417	0.655000	0.29622	0.400000	0.30750	4.741000	0.62095	2.115000	0.64714	0.561000	0.74099	GAG	ADAMTSL4	-	NULL		0.587	ADAMTSL4-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ADAMTSL4	HGNC	protein_coding	OTTHUMT00000084395.4	G	NM_019032		150525407	+1	no_errors	ENST00000369039	ensembl	human	known	70_37	missense	SNP	0.107	A
ASPM	259266	genome.wustl.edu	37	1	197059457	197059457	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:197059457C>T	ENST00000367409.4	-	24	9954	c.9698G>A	c.(9697-9699)cGa>cAa	p.R3233Q	ASPM_ENST00000294732.7_Missense_Mutation_p.R1648Q|ASPM_ENST00000367408.1_Missense_Mutation_p.R898Q	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	3233	IQ 39. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)		p.R3233Q(1)		breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AAGACTTAGTCGTATAGCTTT	0.328																																																	1	Substitution - Missense(1)	cervix(1)											86.0	82.0	83.0					1																	197059457		2202	4300	6502	SO:0001583	missense	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.9698G>A	1.37:g.197059457C>T	ENSP00000356379:p.Arg3233Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.R3233Q	ENST00000367409.4	37	c.9698	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	C	33	5.277075	0.95459	.	.	ENSG00000066279	ENST00000367409;ENST00000294732;ENST00000367408;ENST00000367406	T;T;T	0.66099	-0.19;1.19;0.88	5.53	5.53	0.82687	.	0.000000	0.64402	D	0.000006	T	0.76335	0.3973	M	0.68593	2.085	0.29594	N	0.848187	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.71870	0.972;0.921;0.975	T	0.69950	-0.5006	10	0.15499	T	0.54	.	19.4428	0.94827	0.0:1.0:0.0:0.0	.	1219;1648;3233	E7EQ84;Q4G1H1;Q8IZT6	.;.;ASPM_HUMAN	Q	3233;1648;898;1219	ENSP00000356379:R3233Q;ENSP00000294732:R1648Q;ENSP00000356378:R898Q	ENSP00000294732:R1648Q	R	-	2	0	ASPM	195326080	1.000000	0.71417	0.110000	0.21437	0.985000	0.73830	5.613000	0.67688	2.588000	0.87417	0.655000	0.94253	CGA	ASPM	-	superfamily_ARM-type_fold		0.328	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	C	NM_018136		197059457	-1	no_errors	ENST00000367409	ensembl	human	known	70_37	missense	SNP	0.912	T
ATG7	10533	genome.wustl.edu	37	3	11372813	11372813	+	Splice_Site	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr3:11372813G>A	ENST00000354449.3	+	8	703		c.e8-1		ATG7_ENST00000446450.2_Splice_Site|ATG7_ENST00000354956.5_Splice_Site	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7						adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)	p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						TTTGTTCACAGATAACAATTG	0.398																																																	1	Unknown(1)	cervix(1)											256.0	251.0	253.0					3																	11372813		2203	4300	6503	SO:0001630	splice_region_variant	10533			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.679-1G>A	3.37:g.11372813G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Splice_Site	SNP	-	e7-1	ENST00000354449.3	37	c.679-1	CCDS2605.1	3	.	.	.	.	.	.	.	.	.	.	G	19.83	3.900724	0.72754	.	.	ENSG00000197548	ENST00000446450;ENST00000354956;ENST00000354449	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5143	0.90930	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	ATG7	11347813	1.000000	0.71417	0.999000	0.59377	0.980000	0.70556	8.179000	0.89692	2.475000	0.83589	0.591000	0.81541	.	ATG7	-	-		0.398	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	G	NM_006395	Intron	11372813	+1	no_errors	ENST00000354449	ensembl	human	known	70_37	splice_site	SNP	1.000	A
ATP2B4	493	genome.wustl.edu	37	1	203672793	203672793	+	Silent	SNP	C	C	T	rs145839216		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:203672793C>T	ENST00000357681.5	+	8	2074	c.951C>T	c.(949-951)gaC>gaT	p.D317D	ATP2B4_ENST00000391954.2_Silent_p.D317D|ATP2B4_ENST00000341360.2_Silent_p.D317D|ATP2B4_ENST00000367218.3_Silent_p.D317D|ATP2B4_ENST00000367219.3_Silent_p.D305D	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	317					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.D317D(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			AGACCCAAGACGGAGTGGCCC	0.522													C|||	1	0.000199681	0.0	0.0014	5008	,	,		19400	0.0		0.0	False		,,,				2504	0.0																2	Substitution - coding silent(2)	cervix(2)						C	,	3,4403	6.2+/-15.9	0,3,2200	105.0	102.0	103.0		951,951	-0.5	1.0	1	dbSNP_134	103	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	ATP2B4	NM_001001396.2,NM_001684.4	,	0,3,6500	TT,TC,CC		0.0,0.0681,0.0231	,	317/1171,317/1206	203672793	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	493			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.951C>T	1.37:g.203672793C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.D317	ENST00000357681.5	37	c.951	CCDS1440.1	1																																																																																			ATP2B4	-	pfam_ATPase_P-typ_ATPase-assoc-dom		0.522	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	C	NM_001001396		203672793	+1	no_errors	ENST00000357681	ensembl	human	known	70_37	silent	SNP	0.997	T
BRCA2	675	genome.wustl.edu	37	13	32912060	32912060	+	Missense_Mutation	SNP	C	C	T	rs80359390|rs80358604		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr13:32912060C>T	ENST00000380152.3	+	11	3801	c.3568C>T	c.(3568-3570)Cgg>Tgg	p.R1190W	BRCA2_ENST00000544455.1_Missense_Mutation_p.R1190W			P51587	BRCA2_HUMAN	breast cancer 2, early onset	1190					brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.R1190W(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TGAAATTAAACGGAAGTTTGC	0.403			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	2	Substitution - Missense(2)	cervix(2)											86.0	89.0	88.0					13																	32912060		2203	4300	6503	SO:0001583	missense	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.3568C>T	13.37:g.32912060C>T	ENSP00000369497:p.Arg1190Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	O00183|O15008|Q13879|Q5TBJ7	Missense_Mutation	SNP	pfam_DNA_recomb/repair_BRCA2_hlx,pfam_BRCA2_repeat,pfam_BRCA2_OB_3,pfam_BRCA2_OB_1,pfam_Tower,superfamily_DNA_recomb/repair_BRCA2_hlx,superfamily_NA-bd_OB-fold-like,pirsf_BRCA2,pfscan_BRCA2_repeat	p.R1190W	ENST00000380152.3	37	c.3568	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	C	10.76	1.442413	0.25987	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	T;T	0.00730	5.77;5.77	5.99	5.99	0.97316	.	0.282561	0.30830	N	0.008790	T	0.00496	0.0016	N	0.08118	0	0.09310	N	0.999995	P	0.46327	0.876	B	0.32805	0.153	T	0.60757	-0.7200	10	0.87932	D	0	.	9.4215	0.38555	0.0:0.7354:0.1877:0.0768	.	1190	P51587	BRCA2_HUMAN	W	1190	ENSP00000369497:R1190W;ENSP00000439902:R1190W	ENSP00000369497:R1190W	R	+	1	2	BRCA2	31810060	1.000000	0.71417	0.029000	0.17559	0.027000	0.11550	2.284000	0.43478	2.840000	0.97914	0.655000	0.94253	CGG	BRCA2	-	pirsf_BRCA2		0.403	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	C	NM_000059		32912060	+1	no_errors	ENST00000380152	ensembl	human	known	70_37	missense	SNP	0.293	T
C17orf53	78995	genome.wustl.edu	37	17	42222620	42222620	+	Splice_Site	SNP	A	A	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:42222620A>C	ENST00000319977.4	+	2	290	c.53A>C	c.(52-54)gAg>gCg	p.E18A	C17orf53_ENST00000245382.6_Splice_Site_p.E18A|C17orf53_ENST00000585683.1_Splice_Site_p.E18A	NM_001171251.1|NM_024032.3	NP_001164722.1|NP_076937.2	Q8N3J3	CQ053_HUMAN	chromosome 17 open reading frame 53	18								p.E18A(1)		NS(1)|breast(3)|cervix(1)|kidney(3)|large_intestine(3)|lung(8)|ovary(1)|skin(1)|urinary_tract(1)	22		Breast(137;0.0364)|Prostate(33;0.0376)		BRCA - Breast invasive adenocarcinoma(366;0.114)		TTTGAAGATGAGGTAGGGAAG	0.433																																																	1	Substitution - Missense(1)	cervix(1)											224.0	206.0	212.0					17																	42222620		2203	4300	6503	SO:0001630	splice_region_variant	78995			AK021656	CCDS11477.1, CCDS59293.1	17q21.31	2012-10-11			ENSG00000125319	ENSG00000125319			28460	protein-coding gene	gene with protein product							Standard	NM_001171251		Approved	MGC3130	uc002ifi.2	Q8N3J3	OTTHUMG00000181808	ENST00000319977.4:c.54+1A>C	17.37:g.42222620A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7A9|Q9BWM9|Q9HAI1	Missense_Mutation	SNP	NULL	p.E18A	ENST00000319977.4	37	c.53	CCDS11477.1	17	.	.	.	.	.	.	.	.	.	.	A	23.6	4.432186	0.83776	.	.	ENSG00000125319	ENST00000319977;ENST00000245382;ENST00000253405	T;T	0.62364	0.03;0.03	5.02	5.02	0.67125	.	0.119962	0.38111	N	0.001805	T	0.74635	0.3742	L	0.53249	1.67	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	T	0.77327	-0.2629	10	0.87932	D	0	-22.8116	14.1559	0.65417	1.0:0.0:0.0:0.0	.	18;18;18	A8K7A9;Q8N3J3-3;Q8N3J3	.;.;CQ053_HUMAN	A	18	ENSP00000313500:E18A;ENSP00000245382:E18A	ENSP00000245382:E18A	E	+	2	0	C17orf53	39578146	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	6.340000	0.72973	2.244000	0.73946	0.533000	0.62120	GAG	C17orf53	-	NULL		0.433	C17orf53-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C17orf53	HGNC	protein_coding	OTTHUMT00000457697.1	A	NM_024032	Missense_Mutation	42222620	+1	no_errors	ENST00000319977	ensembl	human	known	70_37	missense	SNP	1.000	C
CFAP69	79846	genome.wustl.edu	37	7	89917563	89917563	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr7:89917563G>A	ENST00000389297.4	+	15	1923	c.1672G>A	c.(1672-1674)Gaa>Aaa	p.E558K	C7orf63_ENST00000497910.1_Missense_Mutation_p.E540K|C7orf63_ENST00000316089.8_Missense_Mutation_p.E558K	NM_001039706.2|NM_001160138.1	NP_001034795.2|NP_001153610.1	A5D8W1	CG063_HUMAN		558								p.E558K(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(12)|lung(14)|ovary(1)|prostate(3)	37						TTTCGGAACTGAAGGAGTAGA	0.338																																																	2	Substitution - Missense(2)	cervix(2)											101.0	93.0	95.0					7																	89917563		1816	4079	5895	SO:0001583	missense	79846																														ENST00000389297.4:c.1672G>A	7.37:g.89917563G>A	ENSP00000373948:p.Glu558Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KMP9|B4DYW6|B4DZP7|B9EIM7|Q6V705|Q8IY89|Q9H7C2	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.E558K	ENST00000389297.4	37	c.1672	CCDS43613.2	7	.	.	.	.	.	.	.	.	.	.	G	24.6	4.546598	0.86022	.	.	ENSG00000105792	ENST00000389297;ENST00000316089;ENST00000497910;ENST00000457170;ENST00000449577	T;T;T;T;T	0.33438	1.41;1.41;1.41;1.41;1.41	5.62	5.62	0.85841	Armadillo-type fold (1);	0.210244	0.48767	D	0.000180	T	0.41719	0.1171	M	0.64404	1.975	0.51482	D	0.999923	B;P;P	0.49559	0.415;0.925;0.925	B;P;P	0.47162	0.219;0.54;0.54	T	0.12400	-1.0549	10	0.32370	T	0.25	-16.9972	19.6473	0.95784	0.0:0.0:1.0:0.0	.	540;558;558	A5D8W1-5;A5D8W1;A5D8W1-2	.;CG063_HUMAN;.	K	558;558;540;441;141	ENSP00000373948:E558K;ENSP00000321753:E558K;ENSP00000419549:E540K;ENSP00000392365:E441K;ENSP00000391571:E141K	ENSP00000321753:E558K	E	+	1	0	C7orf63	89755499	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.515000	0.81761	2.650000	0.89964	0.591000	0.81541	GAA	C7orf63	-	superfamily_ARM-type_fold		0.338	C7orf63-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C7orf63	HGNC	protein_coding	OTTHUMT00000139891.4	G			89917563	+1	no_errors	ENST00000389297	ensembl	human	known	70_37	missense	SNP	1.000	A
CACNA1H	8912	genome.wustl.edu	37	16	1254308	1254309	+	Frame_Shift_Ins	INS	-	-	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr16:1254308_1254309insG	ENST00000348261.5	+	10	2549_2550	c.2301_2302insG	c.(2302-2304)gccfs	p.A768fs	CACNA1H_ENST00000358590.4_Frame_Shift_Ins_p.A768fs|CACNA1H_ENST00000565831.1_Frame_Shift_Ins_p.A768fs|RP11-616M22.3_ENST00000564700.1_RNA	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	768					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	AGCAGAGGGCAGCCCCGGGCGA	0.708																																																	0																																										SO:0001589	frameshift_variant	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.2302dupG	16.37:g.1254309_1254309dupG	ENSP00000334198:p.Ala768fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Frame_Shift_Ins	INS	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.A767fs	ENST00000348261.5	37	c.2301_2302	CCDS45375.1	16																																																																																			CACNA1H	-	NULL		0.708	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	-	NM_001005407		1254309	+1	no_errors	ENST00000348261	ensembl	human	known	70_37	frame_shift_ins	INS	0.000:0.004	G
CARNS1	57571	genome.wustl.edu	37	11	67186395	67186395	+	Missense_Mutation	SNP	G	G	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr11:67186395G>T	ENST00000307823.3	+	4	616	c.164G>T	c.(163-165)gGc>gTc	p.G55V	CARNS1_ENST00000423745.2_Missense_Mutation_p.G55V|CARNS1_ENST00000531040.1_Missense_Mutation_p.G178V|CARNS1_ENST00000445895.2_Missense_Mutation_p.G178V	NM_020811.1	NP_065862.1	A5YM72	CRNS1_HUMAN	carnosine synthase 1	55					ATP catabolic process (GO:0006200)|carnosine biosynthetic process (GO:0035499)		ATP binding (GO:0005524)|ATPase activity (GO:0016887)|carnosine synthase activity (GO:0047730)|metal ion binding (GO:0046872)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(7)	11						TTTTTGGCAGGCCTGGGCCTG	0.682																																																	0																																										SO:0001583	missense	57571				CCDS44658.1, CCDS53667.1	11q13.1	2010-03-25	2010-03-25	2010-03-25	ENSG00000172508	ENSG00000172508			29268	protein-coding gene	gene with protein product		613368	"""ATP-grasp domain containing 1"""	ATPGD1		20097752	Standard	NM_020811		Approved	KIAA1394	uc010rpr.2	A5YM72		ENST00000307823.3:c.164G>T	11.37:g.67186395G>T	ENSP00000308268:p.Gly55Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1M3|B4DFC6|E9PK38|F5H427|Q8N467|Q9P2F3	Missense_Mutation	SNP	superfamily_PreATP-grasp_fold,superfamily_TIL_dom,pfscan_ATP-grasp	p.G178V	ENST00000307823.3	37	c.533	CCDS44658.1	11	.	.	.	.	.	.	.	.	.	.	G	7.762	0.705543	0.15172	.	.	ENSG00000172508	ENST00000531040;ENST00000307823;ENST00000542831;ENST00000539452;ENST00000423745;ENST00000445895	T;T;T;T	0.33865	1.39;1.51;1.51;1.4	4.06	2.91	0.33838	.	.	.	.	.	T	0.15912	0.0383	N	0.14661	0.345	0.49483	D	0.999799	P;B;P	0.36535	0.557;0.421;0.557	B;B;B	0.31101	0.124;0.086;0.124	T	0.05435	-1.0885	9	0.32370	T	0.25	.	3.9752	0.09472	0.3853:0.0:0.6147:0.0	.	178;55;194	F5H427;A5YM72;A5YM72-3	.;CRNS1_HUMAN;.	V	178;55;178;194;55;178	ENSP00000431670:G178V;ENSP00000308268:G55V;ENSP00000401519:G55V;ENSP00000389009:G178V	ENSP00000308268:G55V	G	+	2	0	CARNS1	66942971	0.999000	0.42202	0.992000	0.48379	0.133000	0.20885	2.232000	0.43018	0.878000	0.35920	0.561000	0.74099	GGC	CARNS1	-	NULL		0.682	CARNS1-001	KNOWN	basic|CCDS	protein_coding	CARNS1	HGNC	protein_coding	OTTHUMT00000395501.1	G	NM_020811		67186395	+1	no_errors	ENST00000445895	ensembl	human	known	70_37	missense	SNP	0.904	T
CCDC114	93233	genome.wustl.edu	37	19	48800516	48800516	+	Missense_Mutation	SNP	G	G	A	rs372889077		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:48800516G>A	ENST00000315396.7	-	14	2412	c.1730C>T	c.(1729-1731)aCg>aTg	p.T577M		NM_144577.3	NP_653178.3	Q96M63	CC114_HUMAN	coiled-coil domain containing 114	577					outer dynein arm assembly (GO:0036158)	cilium (GO:0005929)|outer dynein arm (GO:0036157)		p.T577M(1)|p.T370M(1)		cervix(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|stomach(1)	24		all_epithelial(76;9.64e-05)|all_lung(116;0.000147)|Lung NSC(112;0.000251)|Prostate(7;0.0187)|all_neural(266;0.0228)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000162)|Epithelial(262;0.0134)|GBM - Glioblastoma multiforme(486;0.0143)		GTCACCGTGCGTGATGTGGCT	0.622																																																	2	Substitution - Missense(2)	cervix(2)											55.0	51.0	53.0					19																	48800516		2203	4300	6503	SO:0001583	missense	93233			BC025752	CCDS12714.2	19q13.32	2013-02-22			ENSG00000105479	ENSG00000105479			26560	protein-coding gene	gene with protein product		615038				23261302, 23261303	Standard	NM_144577		Approved	FLJ32926, CILD20	uc002pir.2	Q96M63	OTTHUMG00000156161	ENST00000315396.7:c.1730C>T	19.37:g.48800516G>A	ENSP00000318429:p.Thr577Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRL4|Q96M06|Q9UFG8	Missense_Mutation	SNP	NULL	p.T577M	ENST00000315396.7	37	c.1730	CCDS12714.2	19	.	.	.	.	.	.	.	.	.	.	G	8.611	0.889042	0.17540	.	.	ENSG00000105479	ENST00000315396	T	0.32988	1.43	2.2	1.01	0.19927	.	.	.	.	.	T	0.17152	0.0412	L	0.29908	0.895	0.09310	N	1	B	0.34290	0.447	B	0.17433	0.018	T	0.12760	-1.0535	9	0.87932	D	0	-4.7199	6.1144	0.20117	0.0:0.0:0.6969:0.303	.	577	Q96M63	CC114_HUMAN	M	577	ENSP00000318429:T577M	ENSP00000318429:T577M	T	-	2	0	CCDC114	53492328	0.003000	0.15002	0.002000	0.10522	0.003000	0.03518	0.881000	0.28173	0.152000	0.19188	0.561000	0.74099	ACG	CCDC114	-	NULL		0.622	CCDC114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC114	HGNC	protein_coding	OTTHUMT00000343207.1	G	NM_144577		48800516	-1	no_errors	ENST00000315396	ensembl	human	known	70_37	missense	SNP	0.004	A
CCDC73	493860	genome.wustl.edu	37	11	32636423	32636423	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr11:32636423G>C	ENST00000335185.5	-	16	1484	c.1441C>G	c.(1441-1443)Caa>Gaa	p.Q481E	CCDC73_ENST00000534415.1_5'Flank	NM_001008391.2	NP_001008392.2	Q6ZRK6	CCD73_HUMAN	coiled-coil domain containing 73	481								p.Q481E(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	51	Breast(20;0.112)					ATTTCACTTTGATTTTCATCC	0.323																																																	1	Substitution - Missense(1)	cervix(1)											82.0	78.0	79.0					11																	32636423		1817	4068	5885	SO:0001583	missense	493860			AK128159	CCDS41630.1	11p13	2006-02-11			ENSG00000186714	ENSG00000186714			23261	protein-coding gene	gene with protein product		612328					Standard	NM_001008391		Approved	NY-SAR-79	uc001mtv.4	Q6ZRK6	OTTHUMG00000166279	ENST00000335185.5:c.1441C>G	11.37:g.32636423G>C	ENSP00000335325:p.Gln481Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P5Q7|Q6ZMW0|Q86WE7	Missense_Mutation	SNP	NULL	p.Q481E	ENST00000335185.5	37	c.1441	CCDS41630.1	11	.	.	.	.	.	.	.	.	.	.	G	12.28	1.890602	0.33348	.	.	ENSG00000186714	ENST00000335185	.	.	.	5.55	5.55	0.83447	.	0.345611	0.24727	N	0.036099	T	0.46983	0.1421	L	0.43152	1.355	0.80722	D	1	B	0.32753	0.383	B	0.31442	0.13	T	0.38628	-0.9652	9	0.08381	T	0.77	.	14.9028	0.70692	0.0:0.1422:0.8577:0.0	.	481	Q6ZRK6	CCD73_HUMAN	E	481	.	ENSP00000335325:Q481E	Q	-	1	0	CCDC73	32592999	0.966000	0.33281	0.996000	0.52242	0.934000	0.57294	3.364000	0.52328	2.602000	0.87976	0.591000	0.81541	CAA	CCDC73	-	NULL		0.323	CCDC73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC73	HGNC	protein_coding	OTTHUMT00000388874.2	G	NM_001008391		32636423	-1	no_errors	ENST00000335185	ensembl	human	known	70_37	missense	SNP	0.822	C
CDC42EP4	23580	genome.wustl.edu	37	17	71282208	71282208	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:71282208C>T	ENST00000335793.3	-	2	826	c.432G>A	c.(430-432)gtG>gtA	p.V144V	CDC42EP4_ENST00000439510.2_Silent_p.V74V|CDC42EP4_ENST00000581014.1_Intron			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4	144					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)	p.V144V(1)		cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			TGGCCTTCTTCACGGGGCTGG	0.652																																																	1	Substitution - coding silent(1)	cervix(1)											48.0	48.0	48.0					17																	71282208		2203	4300	6503	SO:0001819	synonymous_variant	23580			AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.432G>A	17.37:g.71282208C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUS7|O95828|Q96FT3	Silent	SNP	pfam_PAK_box_Rho-bd,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd	p.V144	ENST00000335793.3	37	c.432	CCDS11695.1	17																																																																																			CDC42EP4	-	NULL		0.652	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP4	HGNC	protein_coding	OTTHUMT00000441898.1	C	NM_012121		71282208	-1	no_errors	ENST00000335793	ensembl	human	known	70_37	silent	SNP	0.883	T
CDC42EP4	23580	genome.wustl.edu	37	17	71282253	71282253	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:71282253C>G	ENST00000335793.3	-	2	781	c.387G>C	c.(385-387)gaG>gaC	p.E129D	CDC42EP4_ENST00000439510.2_Missense_Mutation_p.E59D|CDC42EP4_ENST00000581014.1_Intron			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4	129					positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)	p.E129D(1)		cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			TGGTGCCCTTCTCCGCGGCCT	0.652																																																	1	Substitution - Missense(1)	cervix(1)											50.0	50.0	50.0					17																	71282253		2203	4300	6503	SO:0001583	missense	23580			AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.387G>C	17.37:g.71282253C>G	ENSP00000338258:p.Glu129Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUS7|O95828|Q96FT3	Missense_Mutation	SNP	pfam_PAK_box_Rho-bd,smart_PAK_box_Rho-bd,pfscan_PAK_box_Rho-bd	p.E129D	ENST00000335793.3	37	c.387	CCDS11695.1	17	.	.	.	.	.	.	.	.	.	.	C	3.995	-0.003743	0.07773	.	.	ENSG00000179604	ENST00000335793;ENST00000439510	T;D	0.85955	1.52;-2.05	4.88	2.5	0.30297	.	0.481200	0.20455	N	0.092013	T	0.75722	0.3888	L	0.51422	1.61	0.58432	D	0.999999	B;B	0.15141	0.012;0.003	B;B	0.18871	0.023;0.003	T	0.63382	-0.6650	10	0.16896	T	0.51	-28.9253	4.0492	0.09786	0.1308:0.5676:0.1282:0.1734	.	59;129	B3KUS7;Q9H3Q1	.;BORG4_HUMAN	D	129;59	ENSP00000338258:E129D;ENSP00000404270:E59D	ENSP00000338258:E129D	E	-	3	2	CDC42EP4	68793848	0.995000	0.38212	0.994000	0.49952	0.113000	0.19764	0.587000	0.23909	1.065000	0.40693	0.484000	0.47621	GAG	CDC42EP4	-	NULL		0.652	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP4	HGNC	protein_coding	OTTHUMT00000441898.1	C	NM_012121		71282253	-1	no_errors	ENST00000335793	ensembl	human	known	70_37	missense	SNP	0.724	G
CDH12	1010	genome.wustl.edu	37	5	21975288	21975288	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:21975288G>C	ENST00000382254.1	-	6	1524	c.438C>G	c.(436-438)ttC>ttG	p.F146L	CDH12_ENST00000522262.1_Missense_Mutation_p.F146L|CDH12_ENST00000504376.2_Missense_Mutation_p.F146L	NM_004061.3	NP_004052.2	P55289	CAD12_HUMAN	cadherin 12, type 2 (N-cadherin 2)	146	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.F146L(1)		NS(2)|breast(2)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(19)|lung(75)|ovary(2)|prostate(3)|skin(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	120						CTTTGATGATGAATTCTGATT	0.433										HNSCC(59;0.17)																																							1	Substitution - Missense(1)	cervix(1)											44.0	47.0	46.0					5																	21975288		2033	3869	5902	SO:0001583	missense	1010			L33477	CCDS3890.1	5p14.3	2010-01-26			ENSG00000154162	ENSG00000154162		"""Cadherins / Major cadherins"""	1751	protein-coding gene	gene with protein product		600562				7731968	Standard	NM_004061		Approved	Br-cadherin, CDHB	uc003jgk.2	P55289	OTTHUMG00000090591	ENST00000382254.1:c.438C>G	5.37:g.21975288G>C	ENSP00000371689:p.Phe146Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBT1|B7Z2U6|Q86UD2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.F146L	ENST00000382254.1	37	c.438	CCDS3890.1	5	.	.	.	.	.	.	.	.	.	.	G	19.87	3.907257	0.72868	.	.	ENSG00000154162	ENST00000504376;ENST00000382254;ENST00000522262	T;T;T	0.55930	0.49;0.49;0.49	5.16	4.29	0.51040	Cadherin (4);Cadherin-like (1);	0.000000	0.85682	D	0.000000	T	0.59032	0.2164	L	0.33753	1.03	0.46631	D	0.999132	D;D	0.61080	0.975;0.989	P;D	0.73708	0.836;0.981	T	0.61277	-0.7095	10	0.87932	D	0	.	9.7417	0.40422	0.1578:0.0:0.8422:0.0	.	146;146	B7Z2U6;P55289	.;CAD12_HUMAN	L	146	ENSP00000423577:F146L;ENSP00000371689:F146L;ENSP00000428786:F146L	ENSP00000371689:F146L	F	-	3	2	CDH12	22011045	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.201000	0.42734	1.183000	0.42943	0.484000	0.47621	TTC	CDH12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.433	CDH12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH12	HGNC	protein_coding	OTTHUMT00000207139.1	G	NM_004061		21975288	-1	no_errors	ENST00000382254	ensembl	human	known	70_37	missense	SNP	1.000	C
CDK10	8558	genome.wustl.edu	37	16	89757024	89757026	+	In_Frame_Del	DEL	AGA	AGA	-			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	AGA	AGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr16:89757024_89757026delAGA	ENST00000353379.7	+	3	267_269	c.224_226delAGA	c.(223-228)gagaag>gag	p.K76del	CDK10_ENST00000505473.1_In_Frame_Del_p.K5del|CDK10_ENST00000514965.1_3'UTR|CDK10_ENST00000331006.8_In_Frame_Del_p.K29del	NM_001098533.2|NM_001160367.1|NM_052988.4	NP_001092003.2|NP_001153839.1|NP_443714.3	Q15131	CDK10_HUMAN	cyclin-dependent kinase 10	76	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				negative regulation of cell proliferation (GO:0008285)|traversing start control point of mitotic cell cycle (GO:0007089)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			ovary(1)	1		Lung NSC(15;2.19e-05)|all_lung(18;3.07e-05)|all_hematologic(23;0.0256)		BRCA - Breast invasive adenocarcinoma(80;0.0276)		ATGGACAAGGAGAAGGATGGTGA	0.542																																																	0																																										SO:0001651	inframe_deletion	8558			L33264	CCDS10984.2, CCDS32514.1, CCDS32514.2	16q24.3	2011-11-08	2007-11-21		ENSG00000185324	ENSG00000185324		"""Cyclin-dependent kinases"""	1770	protein-coding gene	gene with protein product		603464	"""cyclin-dependent kinase (CDC2-like) 10"""			8208557, 8084611	Standard	NM_052988		Approved	PISSLRE	uc010cio.3	Q15131	OTTHUMG00000138049	ENST00000353379.7:c.224_226delAGA	16.37:g.89757024_89757026delAGA	ENSP00000338673:p.Lys76del	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K370|A8K8I6|A8MXU6|B3KQJ3|B7Z420|D3DX82|D3DX83|Q0VGZ7|Q15130|Q6PJC0	In_Frame_Del	DEL	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.K76in_frame_del	ENST00000353379.7	37	c.224_226	CCDS10984.2	16																																																																																			CDK10	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.542	CDK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK10	HGNC	protein_coding	OTTHUMT00000269925.2	AGA			89757026	+1	no_errors	ENST00000353379	ensembl	human	known	70_37	in_frame_del	DEL	1.000:1.000:1.000	-
CELSR2	1952	genome.wustl.edu	37	1	109801411	109801411	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:109801411G>A	ENST00000271332.3	+	2	3729	c.3668G>A	c.(3667-3669)cGc>cAc	p.R1223H		NM_001408.2	NP_001399.1	Q9HCU4	CELR2_HUMAN	cadherin, EGF LAG seven-pass G-type receptor 2	1223					cerebrospinal fluid secretion (GO:0033326)|cilium assembly (GO:0042384)|cilium movement (GO:0003341)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|homophilic cell adhesion (GO:0007156)|neural plate anterior/posterior regionalization (GO:0021999)|neuron migration (GO:0001764)|neuropeptide signaling pathway (GO:0007218)|regulation of cell-cell adhesion (GO:0022407)|regulation of protein localization (GO:0032880)|regulation of transcription, DNA-templated (GO:0006355)|ventricular system development (GO:0021591)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|G-protein coupled receptor activity (GO:0004930)	p.R1223H(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(14)|lung(27)|ovary(5)|prostate(1)|skin(3)|urinary_tract(2)	82		all_epithelial(167;0.000114)|all_lung(203;0.000321)|Lung NSC(277;0.000626)|Breast(1374;0.244)		Colorectal(144;0.0296)|Lung(183;0.067)|COAD - Colon adenocarcinoma(174;0.114)|Epithelial(280;0.193)|all cancers(265;0.219)		TCGGCACAGCGCGTGCTGCCC	0.692																																					NSCLC(158;1285 2011 34800 34852 42084)												1	Substitution - Missense(1)	cervix(1)											30.0	26.0	27.0					1																	109801411		2203	4299	6502	SO:0001583	missense	1952			D87469	CCDS796.1	1p13.3	2014-08-08	2013-02-18		ENSG00000143126	ENSG00000143126		"""Cadherins / Major cadherins"", ""-"", ""GPCR / Class B : Orphans"""	3231	protein-coding gene	gene with protein product		604265	"""cadherin, EGF LAG seven-pass G-type receptor 2, flamingo (Drosophila) homolog"""	EGFL2		9693030, 10907856	Standard	NM_001408		Approved	KIAA0279, MEGF3, Flamingo1, CDHF10	uc001dxa.4	Q9HCU4	OTTHUMG00000012003	ENST00000271332.3:c.3668G>A	1.37:g.109801411G>A	ENSP00000271332:p.Arg1223His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T2Y7|Q92566	Missense_Mutation	SNP	pfam_Cadherin,pfam_DUF3497,pfam_Laminin_G,pfam_GPCR_2_secretin-like,pfam_GPS_dom,pfam_EG-like_dom,pfam_EGF_laminin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,smart_EGF_laminin,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_GPS_dom,pfscan_Laminin_G,pfscan_Cadherin,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_Cadherin,prints_GPCR_2_secretin-like	p.R1223H	ENST00000271332.3	37	c.3668	CCDS796.1	1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.883305	0.51908	.	.	ENSG00000143126	ENST00000271332	T	0.68479	-0.33	4.43	4.43	0.53597	.	.	.	.	.	T	0.44540	0.1298	N	0.11560	0.145	0.37837	D	0.92891	D	0.63046	0.992	P	0.51135	0.66	T	0.53034	-0.8495	9	0.48119	T	0.1	.	12.1261	0.53917	0.087:0.0:0.913:0.0	.	1223	Q9HCU4	CELR2_HUMAN	H	1223	ENSP00000271332:R1223H	ENSP00000271332:R1223H	R	+	2	0	CELSR2	109602934	0.958000	0.32768	1.000000	0.80357	0.982000	0.71751	2.112000	0.41892	2.450000	0.82876	0.462000	0.41574	CGC	CELSR2	-	NULL		0.692	CELSR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CELSR2	HGNC	protein_coding	OTTHUMT00000033200.1	G	NM_001408		109801411	+1	no_errors	ENST00000271332	ensembl	human	known	70_37	missense	SNP	1.000	A
CHD6	84181	genome.wustl.edu	37	20	40192757	40192757	+	Intron	SNP	T	T	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr20:40192757T>C	ENST00000373233.3	-	2	155				CHD6_ENST00000373222.3_Missense_Mutation_p.T11A|CHD6_ENST00000309279.7_Intron	NM_032221.3	NP_115597.3	Q8TD26	CHD6_HUMAN	chromodomain helicase DNA binding protein 6						ATP catabolic process (GO:0006200)|chromatin modification (GO:0016568)|positive regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0036091)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|transcription cofactor binding (GO:0001221)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(24)|lung(53)|ovary(8)|prostate(5)|skin(8)|stomach(1)|urinary_tract(9)	129		Myeloproliferative disorder(115;0.00425)				acagaaCTGGTACAAAAGCCA	0.388																																																	0													27.0	26.0	26.0					20																	40192757		876	1991	2867	SO:0001627	intron_variant	84181			AF525085	CCDS13317.1	20q12	2003-03-07			ENSG00000124177	ENSG00000124177			19057	protein-coding gene	gene with protein product						11889561	Standard	NM_032221		Approved	KIAA1335, FLJ22369, dJ620E11.1, CHD5, RIGB	uc002xka.1	Q8TD26	OTTHUMG00000032487	ENST00000373233.3:c.23-12758A>G	20.37:g.40192757T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JYQ0|Q5TGZ9|Q5TH00|Q5TH01|Q8IZR2|Q8WTY0|Q9H4H6|Q9H6D4|Q9NTT7|Q9P2L1	Missense_Mutation	SNP	NULL	p.T11A	ENST00000373233.3	37	c.31	CCDS13317.1	20	.	.	.	.	.	.	.	.	.	.	T	11.69	1.713276	0.30413	.	.	ENSG00000124177	ENST00000373222	T	0.80123	-1.34	3.33	-5.05	0.02955	.	.	.	.	.	T	0.64271	0.2583	.	.	.	0.09310	N	0.999995	B	0.02656	0.0	B	0.01281	0.0	T	0.51180	-0.8738	8	0.87932	D	0	.	2.7739	0.05342	0.1421:0.4588:0.1654:0.2337	.	11	Q8TD26-2	.	A	11	ENSP00000362319:T11A	ENSP00000362319:T11A	T	-	1	0	CHD6	39626171	0.035000	0.19736	0.002000	0.10522	0.113000	0.19764	-0.392000	0.07314	-1.179000	0.02737	0.533000	0.62120	ACC	CHD6	-	NULL		0.388	CHD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD6	HGNC	protein_coding	OTTHUMT00000079270.1	T			40192757	-1	no_errors	ENST00000373222	ensembl	human	known	70_37	missense	SNP	0.003	C
CKMT2	1160	genome.wustl.edu	37	5	80554979	80554979	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:80554979G>A	ENST00000424301.2	+	9	1158	c.920G>A	c.(919-921)tGg>tAg	p.W307*	CKMT2_ENST00000437669.1_Nonsense_Mutation_p.W307*|CKMT2-AS1_ENST00000501927.2_RNA|CKMT2-AS1_ENST00000512287.1_RNA|CKMT2-AS1_ENST00000511495.1_RNA|CKMT2-AS1_ENST00000505295.1_RNA|CKMT2-AS1_ENST00000502041.2_RNA|CKMT2-AS1_ENST00000503483.2_RNA|CKMT2_ENST00000254035.4_Nonsense_Mutation_p.W307*|CKMT2-AS1_ENST00000500148.2_RNA	NM_001825.2	NP_001816.2	P17540	KCRS_HUMAN	creatine kinase, mitochondrial 2 (sarcomeric)	307	Phosphagen kinase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00843}.				cellular nitrogen compound metabolic process (GO:0034641)|creatine metabolic process (GO:0006600)|muscle contraction (GO:0006936)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|creatine kinase activity (GO:0004111)	p.W307*(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(7)|lung(4)|urinary_tract(1)	17		Lung NSC(167;0.00475)|all_lung(232;0.00502)|Ovarian(174;0.0336)		OV - Ovarian serous cystadenocarcinoma(54;2.29e-44)|Epithelial(54;1.05e-38)|all cancers(79;4.15e-34)	Creatine(DB00148)	GAGTTCATGTGGAATGAGCGC	0.473																																																	1	Substitution - Nonsense(1)	cervix(1)											251.0	224.0	233.0					5																	80554979		2203	4300	6503	SO:0001587	stop_gained	1160				CCDS4053.1	5q14.1	2013-09-20			ENSG00000131730	ENSG00000131730	2.7.3.2		1996	protein-coding gene	gene with protein product		123295				2324105	Standard	NM_001825		Approved	SMTCK	uc003khd.4	P17540	OTTHUMG00000119013	ENST00000424301.2:c.920G>A	5.37:g.80554979G>A	ENSP00000404203:p.Trp307*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ICS8|Q8N1E1	Nonsense_Mutation	SNP	pfam_ATP-guanido_PTrfase_cat,pfam_ATP-guanido_PTrfase_N,superfamily_ATP-guanido_PTrfase_N	p.W307*	ENST00000424301.2	37	c.920	CCDS4053.1	5	.	.	.	.	.	.	.	.	.	.	G	37	6.475787	0.97598	.	.	ENSG00000131730	ENST00000254035;ENST00000437669;ENST00000424301	.	.	.	5.29	5.29	0.74685	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.0718	18.9113	0.92487	0.0:0.0:1.0:0.0	.	.	.	.	X	307	.	ENSP00000254035:W307X	W	+	2	0	CKMT2	80590735	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.813000	0.99286	2.483000	0.83821	0.591000	0.81541	TGG	CKMT2	-	pfam_ATP-guanido_PTrfase_cat		0.473	CKMT2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CKMT2	HGNC	protein_coding	OTTHUMT00000369600.1	G	NM_001825		80554979	+1	no_errors	ENST00000254035	ensembl	human	known	70_37	nonsense	SNP	1.000	A
CNTN1	1272	genome.wustl.edu	37	12	41337930	41337930	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr12:41337930C>T	ENST00000551295.2	+	14	1758	c.1641C>T	c.(1639-1641)atC>atT	p.I547I	CNTN1_ENST00000360099.3_Silent_p.I547I|CNTN1_ENST00000348761.2_Silent_p.I536I|CNTN1_ENST00000547849.1_Silent_p.I547I|CNTN1_ENST00000347616.1_Silent_p.I547I|CNTN1_ENST00000547702.1_Silent_p.I547I	NM_001843.3	NP_001834.2	Q12860	CNTN1_HUMAN	contactin 1	547	Ig-like C2-type 6.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|Notch signaling pathway (GO:0007219)|positive regulation of gene expression (GO:0010628)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transport (GO:0010765)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)	p.I547I(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(21)|lung(49)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	90	all_cancers(12;2.07e-06)|all_epithelial(1;4.26e-06)|Breast(8;0.0716)	Lung NSC(34;0.0211)|all_lung(34;0.0294)				GCTATGTGATCGATTTTAACA	0.408																																																	1	Substitution - coding silent(1)	cervix(1)											127.0	105.0	112.0					12																	41337930		2203	4299	6502	SO:0001819	synonymous_variant	1272			Z21488	CCDS8737.1, CCDS8738.1, CCDS58225.1	12q11-q12	2014-01-30				ENSG00000018236		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"", ""Endogenous ligands"""	2171	protein-coding gene	gene with protein product	"""glycoprotein gP135"""	600016				7959734, 8586965	Standard	NM_001843		Approved	F3, GP135	uc031qgz.1	Q12860		ENST00000551295.2:c.1641C>T	12.37:g.41337930C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0H9|A8K0Y3|Q12861|Q14030|Q7M4P0|Q8N466	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.I547	ENST00000551295.2	37	c.1641	CCDS8737.1	12																																																																																			CNTN1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.408	CNTN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN1	HGNC	protein_coding	OTTHUMT00000403692.2	C	NM_001843		41337930	+1	no_errors	ENST00000347616	ensembl	human	known	70_37	silent	SNP	0.296	T
COQ3	51805	genome.wustl.edu	37	6	99817559	99817559	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr6:99817559C>T	ENST00000254759.3	-	7	1051	c.1027G>A	c.(1027-1029)Gag>Aag	p.E343K	COQ3_ENST00000369242.1_Missense_Mutation_p.E115K|COQ3_ENST00000369240.1_Missense_Mutation_p.E115K	NM_017421.3	NP_059117.3	Q9NZJ6	COQ3_HUMAN	coenzyme Q3 methyltransferase	343					glycerol metabolic process (GO:0006071)|small molecule metabolic process (GO:0044281)|ubiquinone biosynthetic process (GO:0006744)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	2-polyprenyl-6-methoxy-1,4-benzoquinone methyltransferase activity (GO:0008425)|3-demethylubiquinone-9 3-O-methyltransferase activity (GO:0008689)|hexaprenyldihydroxybenzoate methyltransferase activity (GO:0004395)|O-methyltransferase activity (GO:0008171)	p.E343K(1)		cervix(1)|lung(5)|upper_aerodigestive_tract(2)	8		all_cancers(76;1.24e-06)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.00716)|Colorectal(196;0.0691)|Lung NSC(302;0.186)		BRCA - Breast invasive adenocarcinoma(108;0.0625)		AAAACAAACTCAGCAGAGGCT	0.448																																																	1	Substitution - Missense(1)	cervix(1)											153.0	156.0	155.0					6																	99817559		2203	4300	6503	SO:0001583	missense	51805			AF193016	CCDS5042.1	6q21	2013-05-01	2013-05-01		ENSG00000132423	ENSG00000132423	2.1.1.114		18175	protein-coding gene	gene with protein product	"""polyprenyldihydroxybenzoate methyltransferase"""	605196	"""coenzyme Q3 homolog, methyltransferase (yeast)"", ""coenzyme Q3 homolog, methyltransferase (S. cerevisiae)"""			10777520	Standard	NM_017421		Approved	bA9819.1	uc003ppk.3	Q9NZJ6	OTTHUMG00000015264	ENST00000254759.3:c.1027G>A	6.37:g.99817559C>T	ENSP00000254759:p.Glu343Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPX0|Q5T061|Q6P4F0|Q8IXG6|Q96BG1|Q9H0N1	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Methyltransf_12,pfam_Mycolic_cyclopropane_synthase,pfam_UbiE/COQ5_MeTrFase,pfam_Small_mtfrase_dom,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_SAM-MeTfrase_NodS-related,tigrfam_UbiG_MeTrfase	p.E343K	ENST00000254759.3	37	c.1027	CCDS5042.1	6	.	.	.	.	.	.	.	.	.	.	C	20.4	3.983682	0.74474	.	.	ENSG00000132423	ENST00000254759;ENST00000369242;ENST00000369240	T;T;T	0.38887	1.63;1.11;1.11	4.66	3.76	0.43208	.	0.339996	0.29579	N	0.011749	T	0.24044	0.0582	L	0.57536	1.79	0.22656	N	0.998889	P	0.44429	0.835	B	0.38500	0.275	T	0.05852	-1.0860	10	0.72032	D	0.01	-20.9302	13.696	0.62580	0.0:0.845:0.155:0.0	.	343	Q9NZJ6	COQ3_HUMAN	K	343;115;115	ENSP00000254759:E343K;ENSP00000358245:E115K;ENSP00000358243:E115K	ENSP00000254759:E343K	E	-	1	0	COQ3	99924280	0.434000	0.25570	0.159000	0.22649	0.041000	0.13682	2.605000	0.46283	1.227000	0.43598	0.650000	0.86243	GAG	COQ3	-	NULL		0.448	COQ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ3	HGNC	protein_coding	OTTHUMT00000041602.1	C	NM_017421		99817559	-1	no_errors	ENST00000254759	ensembl	human	known	70_37	missense	SNP	0.407	T
CPSF7	79869	genome.wustl.edu	37	11	61178432	61178432	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr11:61178432G>A	ENST00000394888.4	-	9	1571	c.1399C>T	c.(1399-1401)Cgg>Tgg	p.R467W	CPSF7_ENST00000448745.1_Missense_Mutation_p.R458W|CPSF7_ENST00000340437.4_Missense_Mutation_p.R510W|CPSF7_ENST00000439958.3_Missense_Mutation_p.R458W	NM_001136040.2	NP_001129512.1	Q8N684	CPSF7_HUMAN	cleavage and polyadenylation specific factor 7, 59kDa	467	Arg-rich.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA splicing, via spliceosome (GO:0000398)|protein tetramerization (GO:0051262)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	membrane (GO:0016020)|mRNA cleavage factor complex (GO:0005849)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.R467W(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|skin(2)|upper_aerodigestive_tract(1)	22						TGCCGGTCCCGTTCTCTATCC	0.483																																																	1	Substitution - Missense(1)	cervix(1)											110.0	118.0	115.0					11																	61178432		2202	4299	6501	SO:0001583	missense	79869				CCDS8006.2, CCDS44619.1, CCDS44620.1	11q12.2	2013-06-18			ENSG00000149532	ENSG00000149532		"""RNA binding motif (RRM) containing"""	30098	protein-coding gene	gene with protein product	"""pre mRNA cleavage factor I, 59 kDa subunit"", ""cleavage factor Im complex 59 kDa subunit"""					12477932	Standard	NM_024811		Approved	FLJ12529	uc001nrp.3	Q8N684	OTTHUMG00000168198	ENST00000394888.4:c.1399C>T	11.37:g.61178432G>A	ENSP00000378352:p.Arg467Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU04|C9K0Q4|Q7Z3H9|Q9H025|Q9H9V1	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.R510W	ENST00000394888.4	37	c.1528	CCDS44619.1	11	.	.	.	.	.	.	.	.	.	.	G	18.69	3.677259	0.68042	.	.	ENSG00000149532	ENST00000340437;ENST00000394888;ENST00000439958;ENST00000448745;ENST00000544147	T;T;T;T	0.16196	2.36;2.36;2.36;2.36	5.42	4.45	0.53987	.	0.069700	0.53938	D	0.000046	T	0.33000	0.0848	L	0.46157	1.445	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.985;0.996;0.994	T	0.00939	-1.1507	10	0.40728	T	0.16	-3.4289	13.3185	0.60421	0.0:0.0:0.7671:0.2329	.	467;510;458	Q8N684;Q8N684-3;Q8N684-2	CPSF7_HUMAN;.;.	W	510;467;458;458;233	ENSP00000345412:R510W;ENSP00000378352:R467W;ENSP00000397203:R458W;ENSP00000407394:R458W	ENSP00000345412:R510W	R	-	1	2	CPSF7	60935008	0.996000	0.38824	0.998000	0.56505	0.999000	0.98932	2.316000	0.43761	2.542000	0.85734	0.655000	0.94253	CGG	CPSF7	-	NULL		0.483	CPSF7-006	KNOWN	basic|CCDS	protein_coding	CPSF7	HGNC	protein_coding	OTTHUMT00000347835.2	G	NM_024811		61178432	-1	no_errors	ENST00000340437	ensembl	human	known	70_37	missense	SNP	0.968	A
CPXCR1	53336	genome.wustl.edu	37	X	88008861	88008861	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:88008861G>A	ENST00000276127.4	+	3	705	c.446G>A	c.(445-447)aGa>aAa	p.R149K	CPXCR1_ENST00000373111.1_Missense_Mutation_p.R149K	NM_033048.5	NP_149037	Q8N123	CPXCR_HUMAN	CPX chromosome region, candidate 1	149							metal ion binding (GO:0046872)	p.R149K(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(11)|liver(1)|lung(20)|ovary(3)|upper_aerodigestive_tract(2)	40						CATGAGATAAGAAGTATGATT	0.368																																																	1	Substitution - Missense(1)	cervix(1)											55.0	48.0	51.0					X																	88008861		2203	4300	6503	SO:0001583	missense	53336			AL031116	CCDS14458.1	Xq21.3	2009-08-06			ENSG00000147183	ENSG00000147183			2332	protein-coding gene	gene with protein product	"""cancer/testis antigen 77"""					11499681	Standard	NM_033048		Approved	CT77	uc004efc.4	Q8N123	OTTHUMG00000021950	ENST00000276127.4:c.446G>A	X.37:g.88008861G>A	ENSP00000276127:p.Arg149Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9F9|D3DTE7|Q96RS3	Missense_Mutation	SNP	pfscan_Znf_C2H2	p.R149K	ENST00000276127.4	37	c.446	CCDS14458.1	X	.	.	.	.	.	.	.	.	.	.	G	11.10	1.540434	0.27563	.	.	ENSG00000147183	ENST00000276127;ENST00000373111	T;T	0.42513	0.97;0.97	2.97	2.1	0.27182	.	0.390779	0.18882	N	0.128555	T	0.20373	0.0490	L	0.27053	0.805	0.09310	N	1	P	0.46142	0.873	B	0.33339	0.162	T	0.10428	-1.0630	9	.	.	.	-8.603	5.2008	0.15262	0.1679:0.0:0.8321:0.0	.	149	Q8N123	CPXCR_HUMAN	K	149	ENSP00000276127:R149K;ENSP00000362203:R149K	.	R	+	2	0	CPXCR1	87895517	0.008000	0.16893	0.068000	0.19968	0.340000	0.28889	0.018000	0.13422	0.663000	0.31027	0.594000	0.82650	AGA	CPXCR1	-	NULL		0.368	CPXCR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPXCR1	HGNC	protein_coding	OTTHUMT00000057418.1	G	NM_033048		88008861	+1	no_errors	ENST00000276127	ensembl	human	known	70_37	missense	SNP	0.072	A
CUX1	1523	genome.wustl.edu	37	7	101844947	101844947	+	Silent	SNP	C	C	T	rs145408393		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr7:101844947C>T	ENST00000292535.7	+	18	2408	c.2370C>T	c.(2368-2370)gaC>gaT	p.D790D	CUX1_ENST00000550008.2_Silent_p.D734D|CUX1_ENST00000560541.1_Intron|CUX1_ENST00000546411.2_Silent_p.D688D|CUX1_ENST00000549414.2_Silent_p.D768D|CUX1_ENST00000292538.4_Intron|CUX1_ENST00000393824.3_Intron|CUX1_ENST00000437600.4_Intron|CUX1_ENST00000360264.3_Silent_p.D801D|CUX1_ENST00000547394.2_Intron|CUX1_ENST00000425244.2_Intron|CUX1_ENST00000556210.1_Silent_p.D632D	NM_181552.3	NP_853530.2	P39880	CUX1_HUMAN	cut-like homeobox 1	790					auditory receptor cell differentiation (GO:0042491)|kidney development (GO:0001822)|lung development (GO:0030324)|multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of dendrite morphogenesis (GO:0050775)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|retrograde transport, vesicle recycling within Golgi (GO:0000301)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding (GO:0043565)	p.D790D(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(8)|lung(26)|ovary(7)|pancreas(1)|prostate(6)|skin(2)|stomach(1)|urinary_tract(5)	70						AGGCCCAGGACGCCCCCGGGC	0.667																																																	1	Substitution - coding silent(1)	cervix(1)						C	,,,,,,	1,4401	2.1+/-5.4	0,1,2200	28.0	35.0	32.0		2403,,,,,,2370	-10.9	0.0	7	dbSNP_134	32	0,8596		0,0,4298	no	coding-synonymous,intron,intron,intron,intron,intron,coding-synonymous	CUX1	NM_001202543.1,NM_001202544.1,NM_001202545.1,NM_001202546.1,NM_001913.3,NM_181500.2,NM_181552.3	,,,,,,	0,1,6498	TT,TC,CC		0.0,0.0227,0.0077	,,,,,,	801/1517,,,,,,790/1506	101844947	1,12997	2201	4298	6499	SO:0001819	synonymous_variant	1523			M74099	CCDS5720.1, CCDS5721.1, CCDS47672.1, CCDS56498.1, CCDS56499.1, CCDS56500.1, CCDS59071.1	7q22.1	2012-10-03	2007-11-07	2007-11-07	ENSG00000257923	ENSG00000257923		"""Homeoboxes / CUT class"""	2557	protein-coding gene	gene with protein product	"""golgi integral membrane protein 6"""	116896	"""cut (Drosophila)-like 1 (CCAAT displacement protein)"", ""cut-like 1, CCAAT displacement protein (Drosophila)"""	CUTL1		8468066, 9799793, 15004235	Standard	NM_001202543		Approved	CDP, CDP1, CUX, CUT, Clox, CDP/Cut, CDP/Cux, Cux/CDP, CASP, GOLIM6	uc003uyx.4	P39880	OTTHUMG00000157129	ENST00000292535.7:c.2370C>T	7.37:g.101844947C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KV79|J3KQV9|Q6NYH4|Q75LE5|Q75MT2|Q75MT3|Q86UJ7|Q9UEV5	Silent	SNP	pfam_Hmoeo_CUT,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,superfamily_LemA-like_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Hmoeo_CUT	p.D801	ENST00000292535.7	37	c.2403	CCDS5721.1	7																																																																																			CUX1	-	NULL		0.667	CUX1-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	CUX1	HGNC	protein_coding	OTTHUMT00000347535.1	C	NM_001913		101844947	+1	no_errors	ENST00000360264	ensembl	human	known	70_37	silent	SNP	0.000	T
CWF19L1	55280	genome.wustl.edu	37	10	101996654	101996654	+	Missense_Mutation	SNP	G	G	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr10:101996654G>T	ENST00000354105.4	-	12	1413	c.1327C>A	c.(1327-1329)Cag>Aag	p.Q443K	RP11-316M21.6_ENST00000444359.1_RNA|CWF19L1_ENST00000370379.1_Intron|CWF19L1_ENST00000478047.1_5'UTR|SNORA12_ENST00000391162.1_RNA	NM_018294.4	NP_060764.3	Q69YN2	C19L1_HUMAN	CWF19-like 1, cell cycle control (S. pombe)	443							catalytic activity (GO:0003824)	p.Q443K(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(4)|pancreas(1)|prostate(1)|stomach(2)	17		Colorectal(252;0.117)		Epithelial(162;3.78e-10)|all cancers(201;3.1e-08)		TCTATCTGCTGCTCCTGTGCC	0.463																																																	1	Substitution - Missense(1)	cervix(1)											205.0	191.0	196.0					10																	101996654		2203	4300	6503	SO:0001583	missense	55280			AK001860	CCDS7489.1	10q24.31	2008-11-24			ENSG00000095485	ENSG00000095485			25613	protein-coding gene	gene with protein product						14702039	Standard	NM_018294		Approved	FLJ10998	uc001kqq.1	Q69YN2	OTTHUMG00000018901	ENST00000354105.4:c.1327C>A	10.37:g.101996654G>T	ENSP00000326411:p.Gln443Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DHX1|D3DR66|Q5W0I3|Q96HC3|Q9H865|Q9NV13	Missense_Mutation	SNP	pfam_Cwf19-like_C_dom-1,pfam_Cwf19-like_C_dom-2,superfamily_HIT-like	p.Q443K	ENST00000354105.4	37	c.1327	CCDS7489.1	10	.	.	.	.	.	.	.	.	.	.	G	12.68	2.010875	0.35511	.	.	ENSG00000095485	ENST00000354105	T	0.17691	2.26	5.28	5.28	0.74379	.	0.000000	0.85682	D	0.000000	T	0.16514	0.0397	L	0.38838	1.175	0.58432	D	0.999999	B;B	0.24882	0.094;0.113	B;B	0.26517	0.07;0.051	T	0.04140	-1.0974	10	0.29301	T	0.29	-9.8246	16.4131	0.83725	0.0:0.0:1.0:0.0	.	147;443	Q69YN2-2;Q69YN2	.;C19L1_HUMAN	K	443	ENSP00000326411:Q443K	ENSP00000326411:Q443K	Q	-	1	0	CWF19L1	101986644	1.000000	0.71417	0.995000	0.50966	0.924000	0.55760	9.471000	0.97696	2.471000	0.83476	0.655000	0.94253	CAG	CWF19L1	-	NULL		0.463	CWF19L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CWF19L1	HGNC	protein_coding		G	NM_018294		101996654	-1	no_errors	ENST00000354105	ensembl	human	known	70_37	missense	SNP	1.000	T
CWH43	80157	genome.wustl.edu	37	4	49040097	49040097	+	Missense_Mutation	SNP	T	T	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:49040097T>G	ENST00000226432.4	+	13	1886	c.1703T>G	c.(1702-1704)cTa>cGa	p.L568R	CWH43_ENST00000513409.1_Missense_Mutation_p.L541R	NM_025087.2	NP_079363.2	Q9H720	PG2IP_HUMAN	cell wall biogenesis 43 C-terminal homolog (S. cerevisiae)	568					GPI anchor biosynthetic process (GO:0006506)	integral component of membrane (GO:0016021)		p.L568R(1)		cervix(1)|endometrium(4)|kidney(1)|large_intestine(4)|lung(26)|ovary(1)|prostate(1)|skin(4)|urinary_tract(1)	43						GTTTCAAAACTACTGAAAAGT	0.358																																																	1	Substitution - Missense(1)	cervix(1)											141.0	148.0	146.0					4																	49040097		2203	4300	6503	SO:0001583	missense	80157				CCDS3486.1, CCDS68697.1	4p12-p11	2010-09-21			ENSG00000109182	ENSG00000109182			26133	protein-coding gene	gene with protein product						17714445, 17761529	Standard	NM_025087		Approved	FLJ21511, CWH43-C	uc003gyv.3	Q9H720	OTTHUMG00000128627	ENST00000226432.4:c.1703T>G	4.37:g.49040097T>G	ENSP00000226432:p.Leu568Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPD7	Missense_Mutation	SNP	superfamily_Endo/exonuclease/phosphatase	p.L568R	ENST00000226432.4	37	c.1703	CCDS3486.1	4	.	.	.	.	.	.	.	.	.	.	T	16.16	3.044856	0.55110	.	.	ENSG00000109182	ENST00000226432;ENST00000513409	T;T	0.29655	1.56;1.56	3.72	3.72	0.42706	Endonuclease/exonuclease/phosphatase (1);	0.000000	0.43919	D	0.000506	T	0.46927	0.1418	L	0.53561	1.675	0.45035	D	0.998054	D	0.89917	1.0	D	0.76575	0.988	T	0.36986	-0.9725	9	.	.	.	.	11.6604	0.51343	0.0:0.0:0.0:1.0	.	568	Q9H720	PG2IP_HUMAN	R	568;541	ENSP00000226432:L568R;ENSP00000422802:L541R	.	L	+	2	0	CWH43	48734854	0.786000	0.28738	0.998000	0.56505	0.956000	0.61745	4.714000	0.61902	1.926000	0.55796	0.454000	0.30748	CTA	CWH43	-	superfamily_Endo/exonuclease/phosphatase		0.358	CWH43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CWH43	HGNC	protein_coding	OTTHUMT00000250496.2	T	NM_025087		49040097	+1	no_errors	ENST00000226432	ensembl	human	known	70_37	missense	SNP	1.000	G
DDX42	11325	genome.wustl.edu	37	17	61888467	61888467	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:61888467G>C	ENST00000578681.1	+	14	1933	c.1332G>C	c.(1330-1332)aaG>aaC	p.K444N	DDX42_ENST00000359353.5_Missense_Mutation_p.K325N|DDX42_ENST00000457800.2_Missense_Mutation_p.K444N|DDX42_ENST00000389924.2_Missense_Mutation_p.K444N|DDX42_ENST00000583590.1_Missense_Mutation_p.K444N	NM_007372.2	NP_031398.2	Q86XP3	DDX42_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 42	444	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				protein localization (GO:0008104)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|poly(A) RNA binding (GO:0044822)	p.K444N(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(6)|lung(12)|ovary(2)|prostate(2)|skin(3)	46						TTCGGAAGAAGATTGAAAAGT	0.403																																																	1	Substitution - Missense(1)	cervix(1)											81.0	75.0	77.0					17																	61888467		2203	4300	6503	SO:0001583	missense	11325			BC015505	CCDS32704.1	17q23	2014-02-14	2013-05-13			ENSG00000198231		"""DEAD-boxes"""	18676	protein-coding gene	gene with protein product	"""splicing factor 3b, subunit 8"""	613369	"""DEAD (Asp-Glu-Ala-Asp) box polypeptide 42"""			10727850, 16397294	Standard	NM_007372		Approved	RNAHP, RHELP, SF3b125, SF3B8	uc002jbv.3	Q86XP3		ENST00000578681.1:c.1332G>C	17.37:g.61888467G>C	ENSP00000464050:p.Lys444Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NML1|A8KA43|O75619|Q68G51|Q96BK1|Q96HR7|Q9Y3V8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.K444N	ENST00000578681.1	37	c.1332	CCDS32704.1	17	.	.	.	.	.	.	.	.	.	.	G	17.59	3.427332	0.62733	.	.	ENSG00000198231	ENST00000389924;ENST00000457800;ENST00000359353	T;T	0.14391	2.51;2.51	5.09	1.99	0.26369	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.105388	0.64402	D	0.000001	T	0.20861	0.0502	L	0.35487	1.065	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	T	0.01416	-1.1360	10	0.29301	T	0.29	-16.8781	9.6908	0.40127	0.2291:0.0:0.7709:0.0	.	444	Q86XP3	DDX42_HUMAN	N	444;444;180	ENSP00000374574:K444N;ENSP00000390121:K444N	ENSP00000352308:K180N	K	+	3	2	DDX42	59242199	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	2.797000	0.47877	0.744000	0.32741	-0.140000	0.14226	AAG	DDX42	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.403	DDX42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX42	HGNC	protein_coding	OTTHUMT00000444368.1	G	NM_007372		61888467	+1	no_errors	ENST00000389924	ensembl	human	known	70_37	missense	SNP	1.000	C
DNAJC5	80331	genome.wustl.edu	37	20	62559804	62559804	+	Splice_Site	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr20:62559804C>T	ENST00000360864.4	+	2	259	c.106C>T	c.(106-108)Cgg>Tgg	p.R36W	DNAJC5_ENST00000369911.2_Splice_Site_p.R36W	NM_025219.2	NP_079495.1	Q9H3Z4	DNJC5_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 5	36	J. {ECO:0000255|PROSITE- ProRule:PRU00286}.				cell death (GO:0008219)|exocytosis (GO:0006887)|negative regulation of neuron apoptotic process (GO:0043524)|neurotransmitter secretion (GO:0007269)|regulated secretory pathway (GO:0045055)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)	clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)		p.R36W(1)		cervix(1)|endometrium(1)|lung(1)|pancreas(1)|upper_aerodigestive_tract(1)	5	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					AAAGTCCTATCGGTAAGTGGA	0.498																																																	1	Substitution - Missense(1)	cervix(1)											103.0	96.0	98.0					20																	62559804		2203	4300	6503	SO:0001630	splice_region_variant	80331				CCDS13546.1	20q13.33	2014-09-17			ENSG00000101152	ENSG00000101152		"""Heat shock proteins / DNAJ (HSP40)"""	16235	protein-coding gene	gene with protein product		611203	"""ceroid-lipofuscinosis, neuronal 4 (Kufs disease)"""	CLN4			Standard	NM_025219		Approved	FLJ00118, FLJ13070, DNAJC5A	uc002yhf.3	Q9H3Z4	OTTHUMG00000033007	ENST00000360864.4:c.107+1C>T	20.37:g.62559804C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0M0|B3KY68|E1P5G8|Q9H3Z5|Q9H7H2	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.R36W	ENST00000360864.4	37	c.106	CCDS13546.1	20	.	.	.	.	.	.	.	.	.	.	C	23.5	4.422940	0.83559	.	.	ENSG00000101152	ENST00000369911;ENST00000360864	T;T	0.42900	0.96;0.96	5.58	3.46	0.39613	Heat shock protein DnaJ, N-terminal (5);	0.000000	0.85682	D	0.000000	T	0.70692	0.3253	M	0.94063	3.49	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	0.998;1.0	T	0.78362	-0.2233	10	0.87932	D	0	.	11.9316	0.52849	0.593:0.407:0.0:0.0	.	36;36	Q9H3Z4-2;Q9H3Z4	.;DNJC5_HUMAN	W	36	ENSP00000358927:R36W;ENSP00000354111:R36W	ENSP00000354111:R36W	R	+	1	2	DNAJC5	62030248	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	3.900000	0.56295	1.323000	0.45263	0.655000	0.94253	CGG	DNAJC5	-	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ		0.498	DNAJC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC5	HGNC	protein_coding	OTTHUMT00000080244.1	C	NM_025219	Missense_Mutation	62559804	+1	no_errors	ENST00000360864	ensembl	human	known	70_37	missense	SNP	1.000	T
EIF2B4	8890	genome.wustl.edu	37	2	27592363	27592363	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:27592363C>G	ENST00000347454.4	-	3	300	c.129G>C	c.(127-129)aaG>aaC	p.K43N	AC074117.10_ENST00000412749.1_RNA|SNX17_ENST00000537606.1_5'Flank|EIF2B4_ENST00000445933.2_Missense_Mutation_p.K43N|SNX17_ENST00000543024.1_5'Flank|EIF2B4_ENST00000451130.2_Missense_Mutation_p.K64N|SNX17_ENST00000233575.2_5'Flank|SNX17_ENST00000542478.1_5'Flank|EIF2B4_ENST00000493344.2_Missense_Mutation_p.K64N	NM_001034116.1|NM_015636.3	NP_001029288.1|NP_056451.3	Q9UI10	EI2BD_HUMAN	eukaryotic translation initiation factor 2B, subunit 4 delta, 67kDa	43					cellular protein metabolic process (GO:0044267)|cellular response to stimulus (GO:0051716)|gene expression (GO:0010467)|myelination (GO:0042552)|negative regulation of translational initiation (GO:0045947)|negative regulation of translational initiation in response to stress (GO:0032057)|oligodendrocyte development (GO:0014003)|ovarian follicle development (GO:0001541)|positive regulation of GTPase activity (GO:0043547)|regulation of translation (GO:0006417)|regulation of translational initiation (GO:0006446)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to peptide hormone (GO:0043434)|translation (GO:0006412)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|eukaryotic translation initiation factor 2B complex (GO:0005851)	translation initiation factor activity (GO:0003743)|translation initiation factor binding (GO:0031369)	p.K64N(1)|p.K43N(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(5)|skin(1)	10	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCTGCTGTTTCTTTTCCTTCC	0.498																																																	2	Substitution - Missense(2)	cervix(2)											232.0	194.0	207.0					2																	27592363		2203	4300	6503	SO:0001583	missense	8890			AJ011306	CCDS33164.1, CCDS46244.1, CCDS46245.1	2p23.3	2008-02-05	2002-08-29		ENSG00000115211	ENSG00000115211			3260	protein-coding gene	gene with protein product		606687	"""eukaryotic translation initiation factor 2B, subunit 4 (delta, 67kD)"""			8929216, 7982969	Standard	NM_172195		Approved	EIF2Bdelta, EIF-2B, DKFZP586J0119, EIF2B	uc002rjz.3	Q9UI10	OTTHUMG00000151927	ENST00000347454.4:c.129G>C	2.37:g.27592363C>G	ENSP00000233552:p.Lys43Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53RY7|Q5BJF4|Q9BUV9|Q9UBG4|Q9UIQ9|Q9UJ95	Missense_Mutation	SNP	pfam_IF-2B-related	p.K43N	ENST00000347454.4	37	c.129	CCDS33164.1	2	.	.	.	.	.	.	.	.	.	.	C	16.84	3.233644	0.58886	.	.	ENSG00000115211	ENST00000347454;ENST00000414437;ENST00000445933;ENST00000451130;ENST00000493344	T;T;T;T	0.80566	-1.39;-1.39;-1.39;-1.39	4.87	1.88	0.25563	.	0.136806	0.64402	D	0.000004	D	0.84933	0.5582	M	0.61703	1.905	0.58432	D	0.999994	D;P;P;P;P	0.89917	1.0;0.857;0.857;0.777;0.915	D;B;B;B;P	0.87578	0.998;0.421;0.329;0.176;0.544	T	0.81835	-0.0750	10	0.40728	T	0.16	-2.7613	8.0727	0.30699	0.0:0.7029:0.0:0.2971	.	37;41;43;43;64	Q59FC8;F5H6W1;Q9UI10-3;Q9UI10;Q9UI10-2	.;.;.;EI2BD_HUMAN;.	N	43;41;43;64;64	ENSP00000233552:K43N;ENSP00000394397:K43N;ENSP00000394869:K64N;ENSP00000429323:K64N	ENSP00000233552:K43N	K	-	3	2	EIF2B4	27445867	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.228000	0.32588	0.659000	0.30945	0.561000	0.74099	AAG	EIF2B4	-	NULL		0.498	EIF2B4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EIF2B4	HGNC	protein_coding	OTTHUMT00000324448.1	C			27592363	-1	no_errors	ENST00000347454	ensembl	human	known	70_37	missense	SNP	1.000	G
EIF3D	8664	genome.wustl.edu	37	22	36915583	36915583	+	Splice_Site	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr22:36915583C>G	ENST00000216190.8	-	8	950	c.580G>C	c.(580-582)Gag>Cag	p.E194Q	EIF3D_ENST00000541106.1_Splice_Site_p.E145Q|EIF3D_ENST00000405442.1_Splice_Site_p.E194Q	NM_003753.3	NP_003744.1			eukaryotic translation initiation factor 3, subunit D									p.E194Q(1)		cervix(1)|endometrium(2)|large_intestine(6)|lung(1)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	15						CCACAACACTCACTGTGGGAA	0.468																																																	1	Substitution - Missense(1)	cervix(1)											163.0	144.0	151.0					22																	36915583		2203	4300	6503	SO:0001630	splice_region_variant	8664			U54558	CCDS13930.1	22q13.1	2007-07-27	2007-07-27	2007-07-27	ENSG00000100353	ENSG00000100353			3278	protein-coding gene	gene with protein product		603915	"""eukaryotic translation initiation factor 3, subunit 7 zeta, 66/67kDa"""	EIF3S7		9341143	Standard	NM_003753		Approved	eIF3-p66, eIF3-zeta, eIF3d	uc003apr.3	O15371	OTTHUMG00000150599	ENST00000216190.8:c.579-1G>C	22.37:g.36915583C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_EIF-3_zeta,pirsf_EIF-3_zeta	p.E194Q	ENST00000216190.8	37	c.580	CCDS13930.1	22	.	.	.	.	.	.	.	.	.	.	C	11.09	1.536278	0.27475	.	.	ENSG00000100353	ENST00000216190;ENST00000397177;ENST00000541106;ENST00000405442;ENST00000455547	.	.	.	6.04	6.04	0.98038	.	0.092954	0.64402	D	0.000001	T	0.52853	0.1760	N	0.25890	0.77	0.80722	D	1	B;B	0.14012	0.009;0.005	B;B	0.23150	0.033;0.044	T	0.45279	-0.9272	9	0.15499	T	0.54	-0.9641	20.5792	0.99380	0.0:1.0:0.0:0.0	.	145;194	B4DVY1;O15371	.;EIF3D_HUMAN	Q	194;179;145;194;194	.	ENSP00000216190:E194Q	E	-	1	0	EIF3D	35245529	1.000000	0.71417	0.975000	0.42487	0.002000	0.02628	7.419000	0.80179	2.873000	0.98535	0.561000	0.74099	GAG	EIF3D	-	pfam_EIF-3_zeta,pirsf_EIF-3_zeta		0.468	EIF3D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3D	HGNC	protein_coding	OTTHUMT00000319026.1	C		Missense_Mutation	36915583	-1	no_errors	ENST00000216190	ensembl	human	known	70_37	missense	SNP	0.366	G
ALG10	84920	genome.wustl.edu	37	12	34176752	34176752	+	Intron	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr12:34176752C>G	ENST00000266483.2	+	2	490				ALG10_ENST00000538927.1_Intron|RP11-847H18.2_ENST00000501954.2_RNA	NM_032834.3	NP_116223.3	Q5BKT4	AG10A_HUMAN	ALG10, alpha-1,2-glucosyltransferase						cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	transferase activity, transferring hexosyl groups (GO:0016758)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	26	Lung NSC(5;3.82e-05)|Acute lymphoblastic leukemia(23;0.0142)|all_hematologic(23;0.0429)	Lung NSC(34;0.204)|all_lung(34;0.235)				GAATCCTGTTCTGCCAAGGAC	0.378																																																	0																																										SO:0001627	intron_variant	0			AJ312278	CCDS41769.1	12p11.21	2013-03-04	2013-03-04		ENSG00000139133	ENSG00000139133	2.4.1.256		23162	protein-coding gene	gene with protein product	"""derepression of ITR1 expression 2 homolog (S. cerevisiae)"", ""dolichyl-P-Glc:Glc(2)Man(9)GlcNAc(2)-PP-dolichol alpha-1,2- glucosyltransferase"""	603313	"""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (yeast)"", ""asparagine-linked glycosylation 10, alpha-1,2-glucosyltransferase homolog (S. pombe)"""				Standard	NM_032834		Approved	FLJ14751, DIE2, ALG10A	uc001rlm.3	Q5BKT4	OTTHUMG00000169285	ENST00000266483.2:c.172-145C>G	12.37:g.34176752C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NS98|Q96DU0|Q96SM6	RNA	SNP	-	NULL	ENST00000266483.2	37	NULL	CCDS41769.1	12																																																																																			RP11-847H18.2	-	-		0.378	ALG10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000245482	Clone_based_vega_gene	protein_coding	OTTHUMT00000403309.1	C	NM_032834		34176752	-1	no_errors	ENST00000501954	ensembl	human	known	70_37	rna	SNP	0.002	G
ELK3	2004	genome.wustl.edu	37	12	96641178	96641178	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr12:96641178C>G	ENST00000228741.3	+	3	994	c.668C>G	c.(667-669)tCc>tGc	p.S223C	ELK3_ENST00000552142.1_Intron	NM_005230.2	NP_005221.2	P41970	ELK3_HUMAN	ELK3, ETS-domain protein (SRF accessory protein 2)	223					angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|wound healing (GO:0042060)	intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	purine-rich negative regulatory element binding (GO:0032422)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.S223C(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|liver(1)|lung(5)|ovary(2)|prostate(1)|stomach(2)	20	all_cancers(2;0.00173)					GCCAAGATCTCCTCTTTAATG	0.622																																																	1	Substitution - Missense(1)	cervix(1)											67.0	75.0	73.0					12																	96641178		2203	4300	6503	SO:0001583	missense	2004			BC017371	CCDS9060.1	12q23	2006-12-30				ENSG00000111145			3325	protein-coding gene	gene with protein product		600247				7851904	Standard	NM_005230		Approved	ERP, NET, SAP2	uc001teo.1	P41970		ENST00000228741.3:c.668C>G	12.37:g.96641178C>G	ENSP00000228741:p.Ser223Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6S6|Q6FG57|Q6GU29|Q9UD17	Missense_Mutation	SNP	pfam_Ets,smart_Ets,prints_Ets,pfscan_Ets	p.S223C	ENST00000228741.3	37	c.668	CCDS9060.1	12	.	.	.	.	.	.	.	.	.	.	C	23.3	4.405325	0.83230	.	.	ENSG00000111145	ENST00000228741	T	0.32753	1.44	5.55	5.55	0.83447	.	0.052693	0.85682	D	0.000000	T	0.53514	0.1801	L	0.54323	1.7	0.80722	D	1	D	0.76494	0.999	D	0.77557	0.99	T	0.51505	-0.8697	10	0.59425	D	0.04	.	19.5045	0.95110	0.0:1.0:0.0:0.0	.	223	P41970	ELK3_HUMAN	C	223	ENSP00000228741:S223C	ENSP00000228741:S223C	S	+	2	0	ELK3	95165309	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	5.197000	0.65141	2.623000	0.88846	0.462000	0.41574	TCC	ELK3	-	NULL		0.622	ELK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELK3	HGNC	protein_coding	OTTHUMT00000408694.1	C	NM_005230		96641178	+1	no_errors	ENST00000228741	ensembl	human	known	70_37	missense	SNP	1.000	G
EPAS1	2034	genome.wustl.edu	37	2	46597010	46597010	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:46597010G>A	ENST00000263734.3	+	7	1334	c.824G>A	c.(823-825)cGc>cAc	p.R275H		NM_001430.4	NP_001421.2	Q99814	EPAS1_HUMAN	endothelial PAS domain protein 1	275	PAS 2. {ECO:0000255|PROSITE- ProRule:PRU00140}.				angiogenesis (GO:0001525)|blood vessel remodeling (GO:0001974)|cell maturation (GO:0048469)|cellular response to hypoxia (GO:0071456)|embryonic placenta development (GO:0001892)|erythrocyte differentiation (GO:0030218)|lung development (GO:0030324)|mitochondrion organization (GO:0007005)|myoblast fate commitment (GO:0048625)|norepinephrine metabolic process (GO:0042415)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart rate (GO:0002027)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription from RNA polymerase II promoter in response to oxidative stress (GO:0043619)|response to hypoxia (GO:0001666)|signal transduction (GO:0007165)|surfactant homeostasis (GO:0043129)|transcription from RNA polymerase II promoter (GO:0006366)|visual perception (GO:0007601)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone acetyltransferase binding (GO:0035035)|protein heterodimerization activity (GO:0046982)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|signal transducer activity (GO:0004871)|transcription factor binding (GO:0008134)	p.R275H(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|liver(2)|lung(11)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39		all_hematologic(82;0.152)|Acute lymphoblastic leukemia(82;0.18)	LUSC - Lung squamous cell carcinoma(58;0.151)			CTGCTTGGCCGCTCAGCCTAT	0.478																																																	1	Substitution - Missense(1)	cervix(1)											59.0	52.0	54.0					2																	46597010		2203	4300	6503	SO:0001583	missense	2034			U81984	CCDS1825.1	2p21-p16	2013-05-21			ENSG00000116016	ENSG00000116016		"""Basic helix-loop-helix proteins"""	3374	protein-coding gene	gene with protein product	"""HIF-1 alpha-like factor"""	603349				9000051, 9079689, 18378852	Standard	NM_001430		Approved	MOP2, PASD2, HIF2A, HLF, bHLHe73	uc002ruv.3	Q99814	OTTHUMG00000128818	ENST00000263734.3:c.824G>A	2.37:g.46597010G>A	ENSP00000263734:p.Arg275His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VA2|Q99630	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_HIF-1_TAD_C,pfam_HIF_alpha_subunit,pfam_PAS_fold,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,smart_PAC,pfscan_PAS,pfscan_HLH_dom,prints_Nuc_translocat,tigrfam_PAS	p.R275H	ENST00000263734.3	37	c.824	CCDS1825.1	2	.	.	.	.	.	.	.	.	.	.	G	28.7	4.946965	0.92593	.	.	ENSG00000116016	ENST00000263734	T	0.30714	1.52	5.65	5.65	0.86999	PAS fold-3 (1);PAS (3);	0.000000	0.85682	D	0.000000	T	0.55065	0.1897	L	0.56396	1.775	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.53056	-0.8492	10	0.59425	D	0.04	.	19.7244	0.96157	0.0:0.0:1.0:0.0	.	275	Q99814	EPAS1_HUMAN	H	275	ENSP00000263734:R275H	ENSP00000263734:R275H	R	+	2	0	EPAS1	46450514	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.736000	0.68597	2.659000	0.90383	0.655000	0.94253	CGC	EPAS1	-	pfam_PAS_fold_3,pfam_PAS_fold,smart_PAS,pfscan_PAS,tigrfam_PAS		0.478	EPAS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPAS1	HGNC	protein_coding	OTTHUMT00000250752.2	G	NM_001430		46597010	+1	no_errors	ENST00000263734	ensembl	human	known	70_37	missense	SNP	1.000	A
ERP27	121506	genome.wustl.edu	37	12	15090933	15090933	+	Missense_Mutation	SNP	T	T	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr12:15090933T>C	ENST00000266397.2	-	2	721	c.148A>G	c.(148-150)Atg>Gtg	p.M50V		NM_152321.2	NP_689534.1	Q96DN0	ERP27_HUMAN	endoplasmic reticulum protein 27	50	Thioredoxin.					endoplasmic reticulum (GO:0005783)		p.M50V(1)		breast(2)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(3)|prostate(2)|skin(1)	19						ATGAATTCCATGGCAGCTGGG	0.522																																																	1	Substitution - Missense(1)	cervix(1)											101.0	104.0	103.0					12																	15090933		2203	4300	6503	SO:0001583	missense	121506			AK056677	CCDS8670.1, CCDS73450.1	12p12.3	2011-10-19	2009-02-23	2007-03-26	ENSG00000139055	ENSG00000139055		"""Protein disulfide isomerases"""	26495	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 8"""	610642	"""chromosome 12 open reading frame 46"", ""endoplasmic reticulum protein 27 kDa"""	C12orf46		12975309, 16940051	Standard	XM_005253303		Approved	FLJ32115, ERp27, PDIA8	uc001rco.3	Q96DN0	OTTHUMG00000168741	ENST00000266397.2:c.148A>G	12.37:g.15090933T>C	ENSP00000266397:p.Met50Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold	p.M50V	ENST00000266397.2	37	c.148	CCDS8670.1	12	.	.	.	.	.	.	.	.	.	.	T	9.481	1.098270	0.20552	.	.	ENSG00000139055	ENST00000266397	T	0.21191	2.02	4.87	0.555	0.17247	Thioredoxin-like fold (2);	0.485095	0.22680	N	0.056946	T	0.09202	0.0227	N	0.08118	0	0.43803	D	0.996354	B	0.02656	0.0	B	0.01281	0.0	T	0.16276	-1.0408	10	0.40728	T	0.16	-2.2427	7.4795	0.27395	0.0:0.3663:0.0:0.6337	.	50	Q96DN0	ERP27_HUMAN	V	50	ENSP00000266397:M50V	ENSP00000266397:M50V	M	-	1	0	ERP27	14982200	0.000000	0.05858	0.968000	0.41197	0.689000	0.40095	-0.322000	0.08007	0.056000	0.16144	-0.441000	0.05720	ATG	ERP27	-	superfamily_Thioredoxin-like_fold		0.522	ERP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERP27	HGNC	protein_coding	OTTHUMT00000400868.1	T	NM_152321		15090933	-1	no_errors	ENST00000266397	ensembl	human	known	70_37	missense	SNP	0.701	C
FAM154B	283726	genome.wustl.edu	37	15	82564165	82564165	+	Intron	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr15:82564165G>A	ENST00000339465.5	+	2	322				FAM154B_ENST00000565432.1_Silent_p.*105*|FAM154B_ENST00000427381.2_Intron|FAM154B_ENST00000565501.1_Intron	NM_001008226.1	NP_001008227.1	Q658L1	F154B_HUMAN	family with sequence similarity 154, member B											autonomic_ganglia(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(9)|skin(2)	19						TTTCATACATGAAGGAGCCAA	0.403																																																	0													35.0	33.0	34.0					15																	82564165		2203	4300	6503	SO:0001627	intron_variant	283726			AL833762	CCDS32310.1	15q25.2	2008-02-21				ENSG00000188659			33727	protein-coding gene	gene with protein product							Standard	XM_005254317		Approved	DKFZp666G057	uc002bgv.3	Q658L1		ENST00000339465.5:c.253+22G>A	15.37:g.82564165G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E2M2	Silent	SNP	NULL	p.*105	ENST00000339465.5	37	c.314	CCDS32310.1	15																																																																																			FAM154B	-	NULL		0.403	FAM154B-001	KNOWN	basic|CCDS	protein_coding	FAM154B	HGNC	protein_coding	OTTHUMT00000419644.1	G	NM_001008226		82564165	+1	no_errors	ENST00000565432	ensembl	human	putative	70_37	silent	SNP	0.000	A
FAM71B	153745	genome.wustl.edu	37	5	156590578	156590578	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:156590578C>G	ENST00000302938.4	-	2	793	c.698G>C	c.(697-699)gGg>gCg	p.G233A		NM_130899.2	NP_570969.2	Q8TC56	FA71B_HUMAN	family with sequence similarity 71, member B	233	Ala-rich.					nucleus (GO:0005634)		p.G233A(1)		NS(3)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(2)|kidney(5)|large_intestine(10)|lung(32)|ovary(4)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68	Renal(175;0.00212)	Medulloblastoma(196;0.0523)|all_neural(177;0.21)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			TCCCTCTCCCCCAGCATAAGC	0.572																																																	1	Substitution - Missense(1)	cervix(1)											106.0	102.0	104.0					5																	156590578		2203	4300	6503	SO:0001583	missense	153745				CCDS4335.1	5q33.3	2005-08-09			ENSG00000170613	ENSG00000170613			28397	protein-coding gene	gene with protein product						12477932	Standard	NM_130899		Approved	MGC26988	uc003lwn.3	Q8TC56	OTTHUMG00000130246	ENST00000302938.4:c.698G>C	5.37:g.156590578C>G	ENSP00000305596:p.Gly233Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q1EDD9|Q8TC64|Q96LY8	Missense_Mutation	SNP	pfam_DUF3699	p.G233A	ENST00000302938.4	37	c.698	CCDS4335.1	5	.	.	.	.	.	.	.	.	.	.	C	26.8	4.771071	0.90108	.	.	ENSG00000170613	ENST00000302938	T	0.05139	3.49	3.96	3.96	0.45880	.	0.000000	0.43416	D	0.000576	T	0.14570	0.0352	L	0.60455	1.87	0.32457	N	0.544564	D	0.69078	0.997	P	0.55965	0.788	T	0.02144	-1.1206	10	0.51188	T	0.08	-26.0202	11.8315	0.52299	0.0:1.0:0.0:0.0	.	233	Q8TC56	FA71B_HUMAN	A	233	ENSP00000305596:G233A	ENSP00000305596:G233A	G	-	2	0	FAM71B	156523156	0.847000	0.29606	0.942000	0.38095	0.813000	0.45954	2.859000	0.48364	2.488000	0.83962	0.655000	0.94253	GGG	FAM71B	-	NULL		0.572	FAM71B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM71B	HGNC	protein_coding	OTTHUMT00000252570.2	C	NM_130899		156590578	-1	no_errors	ENST00000302938	ensembl	human	known	70_37	missense	SNP	0.955	G
FAM86B1	85002	genome.wustl.edu	37	8	12041095	12041095	+	3'UTR	SNP	T	T	G	rs202141510		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr8:12041095T>G	ENST00000448228.2	-	0	960				FAM86B1_ENST00000321602.8_3'UTR|AC145124.1_ENST00000579282.1_RNA|FAM86B1_ENST00000533852.2_3'UTR	NM_001083537.1	NP_001077006.1	Q8N7N1	F86B1_HUMAN	family with sequence similarity 86, member B1											kidney(1)|prostate(1)|stomach(1)	3			STAD - Stomach adenocarcinoma(15;0.033)	COAD - Colon adenocarcinoma(149;0.0965)		TCACAATCCCTTTGGAGTCAT	0.428																																																	0													2.0	2.0	2.0					8																	12041095		1132	2414	3546	SO:0001624	3_prime_UTR_variant	85002			BC007983	CCDS59512.1	8p23.1	2014-02-12	2005-08-19		ENSG00000186523	ENSG00000186523			28268	protein-coding gene	gene with protein product						12477932	Standard	NM_001083537		Approved	MGC16279	uc010lse.3	Q8N7N1	OTTHUMG00000165298	ENST00000448228.2:c.*20A>C	8.37:g.12041095T>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000448228.2	37	NULL	CCDS59512.1	8																																																																																			FAM86B1	-	-		0.428	FAM86B1-016	KNOWN	basic|CCDS	protein_coding	FAM86B1	HGNC	protein_coding	OTTHUMT00000383317.1	T	NM_032916		12041095	-1	no_errors	ENST00000524484	ensembl	human	known	70_37	rna	SNP	0.000	G
FBN1	2200	genome.wustl.edu	37	15	48736764	48736764	+	Missense_Mutation	SNP	T	T	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr15:48736764T>C	ENST00000316623.5	-	49	6466	c.6011A>G	c.(6010-6012)tAc>tGc	p.Y2004C		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	2004	EGF-like 34; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.Y2004C(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		TTGAAGACTGTATCCAGGTGG	0.428																																																	1	Substitution - Missense(1)	cervix(1)											155.0	142.0	147.0					15																	48736764		2198	4296	6494	SO:0001583	missense	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.6011A>G	15.37:g.48736764T>C	ENSP00000325527:p.Tyr2004Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_FBN,pfscan_EG-like_dom	p.Y2004C	ENST00000316623.5	37	c.6011	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	T	26.4	4.735630	0.89482	.	.	ENSG00000166147	ENST00000316623;ENST00000389087;ENST00000544030	D	0.95656	-3.77	6.07	6.07	0.98685	EGF-like region, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98425	0.9476	H	0.97186	3.955	0.80722	D	1	D	0.69078	0.997	D	0.63113	0.911	D	0.99541	1.0963	10	0.87932	D	0	.	16.3021	0.82825	0.0:0.0:0.0:1.0	.	2004	P35555	FBN1_HUMAN	C	2004;572;894	ENSP00000325527:Y2004C	ENSP00000325527:Y2004C	Y	-	2	0	FBN1	46524056	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.555000	0.82223	2.326000	0.78906	0.533000	0.62120	TAC	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.428	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	T			48736764	-1	no_errors	ENST00000316623	ensembl	human	known	70_37	missense	SNP	1.000	C
FBN1	2200	genome.wustl.edu	37	15	48826336	48826336	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr15:48826336G>A	ENST00000316623.5	-	8	1258	c.803C>T	c.(802-804)tCt>tTt	p.S268F		NM_000138.4	NP_000129	P35555	FBN1_HUMAN	fibrillin 1	268	EGF-like 4; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|kidney development (GO:0001822)|sequestering of BMP in extracellular matrix (GO:0035582)|sequestering of TGFbeta in extracellular matrix (GO:0035583)|skeletal system development (GO:0001501)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|microfibril (GO:0001527)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|extracellular matrix structural constituent (GO:0005201)	p.S268F(1)		NS(1)|breast(5)|cervix(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|liver(1)|lung(49)|ovary(4)|pancreas(1)|prostate(9)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	139		all_lung(180;0.00279)		all cancers(107;4.24e-07)|GBM - Glioblastoma multiforme(94;1.41e-05)		GCACTCAAAAGACCCAACAGT	0.443																																																	1	Substitution - Missense(1)	cervix(1)											243.0	252.0	249.0					15																	48826336		2197	4296	6493	SO:0001583	missense	2200			X63556	CCDS32232.1	15q21.1	2014-09-17	2006-04-25			ENSG00000166147			3603	protein-coding gene	gene with protein product	"""Marfan syndrome"""	134797	"""fibrillin 1 (Marfan syndrome)"""	FBN, MFS1, WMS		10036187, 12525539	Standard	NM_000138		Approved	MASS, OCTD, SGS	uc001zwx.2	P35555		ENST00000316623.5:c.803C>T	15.37:g.48826336G>A	ENSP00000325527:p.Ser268Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUU0|D2JYH6|Q15972|Q75N87	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_TB_dom,superfamily_TB_dom,superfamily_Growth_fac_rcpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_FBN,pfscan_EG-like_dom	p.S268F	ENST00000316623.5	37	c.803	CCDS32232.1	15	.	.	.	.	.	.	.	.	.	.	G	28.7	4.941440	0.92526	.	.	ENSG00000166147	ENST00000316623	D	0.95412	-3.7	5.4	5.4	0.78164	EGF-like calcium-binding, conserved site (1);EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.85682	D	0.000000	D	0.98365	0.9457	M	0.92317	3.295	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	D	0.99110	1.0846	10	0.87932	D	0	.	19.5281	0.95214	0.0:0.0:1.0:0.0	.	268	P35555	FBN1_HUMAN	F	268	ENSP00000325527:S268F	ENSP00000325527:S268F	S	-	2	0	FBN1	46613628	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.813000	0.99286	2.696000	0.92011	0.655000	0.94253	TCT	FBN1	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_FBN,pfscan_EG-like_dom		0.443	FBN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBN1	HGNC	protein_coding	OTTHUMT00000417355.1	G			48826336	-1	no_errors	ENST00000316623	ensembl	human	known	70_37	missense	SNP	1.000	A
FOSL2	2355	genome.wustl.edu	37	2	28635065	28635065	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:28635065C>G	ENST00000264716.4	+	4	1594	c.731C>G	c.(730-732)tCt>tGt	p.S244C	FOSL2_ENST00000379619.1_Missense_Mutation_p.S236C|FOSL2_ENST00000545753.1_Missense_Mutation_p.S205C	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	244					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.S244C(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					GCCCAGCGCTCTGTCATCAAG	0.662																																																	1	Substitution - Missense(1)	cervix(1)											36.0	34.0	35.0					2																	28635065		2203	4300	6503	SO:0001583	missense	2355				CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.731C>G	2.37:g.28635065C>G	ENSP00000264716:p.Ser244Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD58|B3KP27|B4DYV4|Q6FG46	Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.S244C	ENST00000264716.4	37	c.731	CCDS1766.1	2	.	.	.	.	.	.	.	.	.	.	C	20.3	3.958819	0.74016	.	.	ENSG00000075426	ENST00000379619;ENST00000264716;ENST00000545753	T;T;T	0.78707	-1.2;-0.21;-1.2	5.05	5.05	0.67936	.	0.053149	0.85682	D	0.000000	D	0.86564	0.5963	M	0.78456	2.415	0.80722	D	1	D	0.69078	0.997	P	0.58577	0.841	D	0.87970	0.2736	10	0.62326	D	0.03	-18.6372	18.5671	0.91120	0.0:1.0:0.0:0.0	.	244	P15408	FOSL2_HUMAN	C	236;244;205	ENSP00000368939:S236C;ENSP00000264716:S244C;ENSP00000439303:S205C	ENSP00000264716:S244C	S	+	2	0	FOSL2	28488569	0.998000	0.40836	0.987000	0.45799	0.995000	0.86356	3.680000	0.54641	2.611000	0.88343	0.561000	0.74099	TCT	FOSL2	-	NULL		0.662	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSL2	HGNC	protein_coding	OTTHUMT00000215116.2	C	NM_005253		28635065	+1	no_errors	ENST00000264716	ensembl	human	known	70_37	missense	SNP	0.999	G
FOSL2	2355	genome.wustl.edu	37	2	28635081	28635081	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:28635081C>T	ENST00000264716.4	+	4	1610	c.747C>T	c.(745-747)atC>atT	p.I249I	FOSL2_ENST00000379619.1_Silent_p.I241I|FOSL2_ENST00000545753.1_Silent_p.I210I	NM_005253.3	NP_005244.1	P15408	FOSL2_HUMAN	FOS-like antigen 2	249					cell death (GO:0008219)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.I249I(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(1)|large_intestine(3)|lung(1)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	14	Acute lymphoblastic leukemia(172;0.155)					TCAAGCCCATCAGCATTGCTG	0.642																																																	1	Substitution - coding silent(1)	cervix(1)											41.0	38.0	39.0					2																	28635081		2203	4300	6503	SO:0001819	synonymous_variant	2355				CCDS1766.1	2p23.3	2013-01-10			ENSG00000075426	ENSG00000075426		"""basic leucine zipper proteins"""	3798	protein-coding gene	gene with protein product		601575					Standard	NM_005253		Approved	FRA2, FLJ23306	uc002rma.3	P15408	OTTHUMG00000097832	ENST00000264716.4:c.747C>T	2.37:g.28635081C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD58|B3KP27|B4DYV4|Q6FG46	Silent	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.I249	ENST00000264716.4	37	c.747	CCDS1766.1	2																																																																																			FOSL2	-	NULL		0.642	FOSL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSL2	HGNC	protein_coding	OTTHUMT00000215116.2	C	NM_005253		28635081	+1	no_errors	ENST00000264716	ensembl	human	known	70_37	silent	SNP	1.000	T
FREM1	158326	genome.wustl.edu	37	9	14750127	14750127	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr9:14750127C>G	ENST00000380880.3	-	30	6338	c.5555G>C	c.(5554-5556)gGa>gCa	p.G1852A	FREM1_ENST00000380894.1_Missense_Mutation_p.G388A|FREM1_ENST00000422223.2_Missense_Mutation_p.G1852A|FREM1_ENST00000380881.4_Missense_Mutation_p.G1853A|FREM1_ENST00000486223.1_5'Flank			Q5H8C1	FREM1_HUMAN	FRAS1 related extracellular matrix 1	1852					cell communication (GO:0007154)|cell-matrix adhesion (GO:0007160)|craniofacial suture morphogenesis (GO:0097094)	basement membrane (GO:0005604)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)	p.G1853A(1)		breast(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(40)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	100				GBM - Glioblastoma multiforme(50;3.53e-06)		AAGAATACCTCCTTTTGAGTC	0.433																																																	1	Substitution - Missense(1)	cervix(1)											134.0	127.0	129.0					9																	14750127		1869	4102	5971	SO:0001583	missense	158326			AK058190	CCDS47952.1, CCDS55293.1	9p22.3	2010-06-04	2004-12-15	2004-12-15	ENSG00000164946	ENSG00000164946			23399	protein-coding gene	gene with protein product		608944	"""chromosome 9 open reading frame 154"""	C9orf154		12838346, 15345741	Standard	NM_144966		Approved	FLJ25461, C9orf145, C9orf143, DKFZp686M16108, TILRR	uc003zlm.3	Q5H8C1	OTTHUMG00000019575	ENST00000380880.3:c.5555G>C	9.37:g.14750127C>G	ENSP00000370262:p.Gly1852Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZBX4|Q5VV00|Q5VV01|Q6MZI4|Q8NEG9|Q96LI3	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Calx_beta,superfamily_C-type_lectin_fold,superfamily_Cadherin-like,smart_C-type_lectin,pfscan_C-type_lectin	p.G1853A	ENST00000380880.3	37	c.5558	CCDS47952.1	9	.	.	.	.	.	.	.	.	.	.	C	15.26	2.780632	0.49891	.	.	ENSG00000164946	ENST00000380881;ENST00000422223;ENST00000380894;ENST00000380880	T;T;T;T	0.26810	1.71;1.71;1.71;1.71	5.51	5.51	0.81932	.	0.342533	0.32736	N	0.005716	T	0.25975	0.0633	L	0.38175	1.15	0.54753	D	0.999984	P;P	0.48503	0.741;0.911	B;B	0.42112	0.178;0.376	T	0.01162	-1.1432	10	0.36615	T	0.2	-8.4473	19.4167	0.94704	0.0:1.0:0.0:0.0	.	1852;388	Q5H8C1;B7ZBX4	FREM1_HUMAN;.	A	1853;1852;388;1852	ENSP00000370263:G1853A;ENSP00000412940:G1852A;ENSP00000370278:G388A;ENSP00000370262:G1852A	ENSP00000370262:G1852A	G	-	2	0	FREM1	14740127	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.552000	0.53705	2.588000	0.87417	0.563000	0.77884	GGA	FREM1	-	NULL		0.433	FREM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FREM1	HGNC	protein_coding	OTTHUMT00000339474.2	C	NM_144966		14750127	-1	no_errors	ENST00000380881	ensembl	human	known	70_37	missense	SNP	1.000	G
GBP1	2633	genome.wustl.edu	37	1	89521614	89521614	+	Intron	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:89521614C>T	ENST00000370473.4	-	8	1588				GBP1_ENST00000484970.1_5'Flank	NM_002053.2	NP_002044.2	P32455	GBP1_HUMAN	guanylate binding protein 1, interferon-inducible						cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)	cytosol (GO:0005829)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|identical protein binding (GO:0042802)			endometrium(7)|kidney(4)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	30		Lung NSC(277;0.123)		all cancers(265;0.0156)|Epithelial(280;0.0291)		AAAAGCACATCTGTATGCAGT	0.408																																																	0																																										SO:0001627	intron_variant	2633			BC002666	CCDS718.1	1p22.2	2011-03-09	2011-03-09		ENSG00000117228	ENSG00000117228			4182	protein-coding gene	gene with protein product		600411	"""guanylate binding protein 1, interferon-inducible, 67kDa"""			7518790	Standard	NM_002053		Approved		uc001dmx.2	P32455	OTTHUMG00000010614	ENST00000370473.4:c.1368+84G>A	1.37:g.89521614C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DT26|Q5T8M1	RNA	SNP	-	NULL	ENST00000370473.4	37	NULL	CCDS718.1	1																																																																																			GBP1	-	-		0.408	GBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBP1	HGNC	protein_coding	OTTHUMT00000029289.3	C	NM_002053		89521614	-1	no_errors	ENST00000495131	ensembl	human	known	70_37	rna	SNP	0.000	T
GLIS2	84662	genome.wustl.edu	37	16	4385082	4385082	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr16:4385082C>T	ENST00000262366.3	+	6	1365	c.544C>T	c.(544-546)Ctg>Ttg	p.L182L	RP11-295D4.1_ENST00000574705.1_RNA|GLIS2_ENST00000433375.1_Silent_p.L182L|PAM16_ENST00000577031.1_Intron			Q9BZE0	GLIS2_HUMAN	GLIS family zinc finger 2	182					cell differentiation (GO:0030154)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|transcription regulatory region DNA binding (GO:0044212)	p.L182L(1)		breast(1)|cervix(4)|endometrium(1)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	11						CTTTGAGCTCCTGCAAGACCT	0.617																																																	1	Substitution - coding silent(1)	cervix(1)											69.0	75.0	73.0					16																	4385082		2197	4299	6496	SO:0001819	synonymous_variant	84662			AF325914	CCDS10511.1	16p13.3	2013-01-08			ENSG00000126603	ENSG00000126603		"""Zinc fingers, C2H2-type"""	29450	protein-coding gene	gene with protein product	"""nephrocystin-7"""	608539				11741991, 14500813, 17618285	Standard	NM_032575		Approved	NPHP7	uc002cwc.1	Q9BZE0	OTTHUMG00000129467	ENST00000262366.3:c.544C>T	16.37:g.4385082C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KX84	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L182	ENST00000262366.3	37	c.544	CCDS10511.1	16																																																																																			GLIS2	-	smart_Znf_C2H2-like		0.617	GLIS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLIS2	HGNC	protein_coding	OTTHUMT00000251630.1	C	NM_032575		4385082	+1	no_errors	ENST00000262366	ensembl	human	known	70_37	silent	SNP	1.000	T
GLRA2	2742	genome.wustl.edu	37	X	14748344	14748344	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:14748344C>T	ENST00000218075.4	+	9	1626	c.1096C>T	c.(1096-1098)Cgt>Tgt	p.R366C	GLRA2_ENST00000443437.2_Missense_Mutation_p.R277C|GLRA2_ENST00000355020.4_Missense_Mutation_p.R366C	NM_002063.3	NP_002054.1	P23416	GLRA2_HUMAN	glycine receptor, alpha 2	366					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|neuropeptide signaling pathway (GO:0007218)|synapse assembly (GO:0007416)|transmembrane transport (GO:0055085)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	extracellular-glycine-gated chloride channel activity (GO:0016934)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.R366S(2)|p.R366C(2)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(22)|ovary(1)|prostate(1)|skin(2)	37	Hepatocellular(33;0.128)				Ethanol(DB00898)|Glycine(DB00145)|Lindane(DB00431)	AGACGTTACTCGTGAAAGTCG	0.443																																																	4	Substitution - Missense(4)	cervix(2)|lung(2)											256.0	259.0	258.0					X																	14748344		2203	4300	6503	SO:0001583	missense	2742				CCDS14160.1, CCDS48085.1, CCDS55371.1	Xp22.2	2012-02-07			ENSG00000101958	ENSG00000101958		"""Ligand-gated ion channels / Glycine receptors"""	4327	protein-coding gene	gene with protein product		305990		GLR			Standard	NM_002063		Approved		uc010nep.3	P23416	OTTHUMG00000021166	ENST00000218075.4:c.1096C>T	X.37:g.14748344C>T	ENSP00000218075:p.Arg366Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0J6|B2R6I8|B7Z4F5|J3KQ59|Q53YX7|Q6ICQ0|Q99862	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Glycine_rcpt_A2,prints_Neur_channel,tigrfam_Neur_channel	p.R366C	ENST00000218075.4	37	c.1096	CCDS14160.1	X	.	.	.	.	.	.	.	.	.	.	C	20.6	4.023209	0.75275	.	.	ENSG00000101958	ENST00000443437;ENST00000218075;ENST00000355020	D;D;D	0.82167	-1.58;-1.58;-1.58	5.2	4.33	0.51752	Neurotransmitter-gated ion-channel transmembrane domain (1);	0.351880	0.29884	N	0.010944	D	0.86698	0.5995	L	0.43152	1.355	0.80722	D	1	D;D;D	0.76494	0.997;0.997;0.999	D;P;P	0.65140	0.932;0.684;0.764	D	0.87281	0.2292	10	0.62326	D	0.03	.	14.6167	0.68556	0.1467:0.8533:0.0:0.0	.	350;366;366	B7Z4E9;P23416;P23416-2	.;GLRA2_HUMAN;.	C	277;366;366	ENSP00000387756:R277C;ENSP00000218075:R366C;ENSP00000347123:R366C	ENSP00000218075:R366C	R	+	1	0	GLRA2	14658265	1.000000	0.71417	0.816000	0.32577	0.976000	0.68499	5.630000	0.67805	1.075000	0.40932	0.544000	0.68410	CGT	GLRA2	-	superfamily_Neurotrans-gated_channel_TM,prints_Glycine_rcpt_A2,tigrfam_Neur_channel		0.443	GLRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GLRA2	HGNC	protein_coding	OTTHUMT00000055829.1	C			14748344	+1	no_errors	ENST00000218075	ensembl	human	known	70_37	missense	SNP	1.000	T
GPR158	57512	genome.wustl.edu	37	10	25464455	25464455	+	Nonsense_Mutation	SNP	C	C	T	rs368107656		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr10:25464455C>T	ENST00000376351.3	+	1	465	c.106C>T	c.(106-108)Cga>Tga	p.R36*	GPR158-AS1_ENST00000449643.1_RNA	NM_020752.2	NP_065803.2	Q5T848	GP158_HUMAN	G protein-coupled receptor 158	36					protein localization to plasma membrane (GO:0072659)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.R36*(1)		breast(5)|cervix(1)|endometrium(9)|kidney(10)|large_intestine(20)|lung(56)|ovary(4)|pancreas(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	119						GGATTCCCCTCGAGAGAGGAC	0.682																																																	1	Substitution - Nonsense(1)	cervix(1)											23.0	29.0	27.0					10																	25464455		2191	4278	6469	SO:0001587	stop_gained	57512			AB032962	CCDS31166.1	10p12.31	2012-08-21			ENSG00000151025	ENSG00000151025		"""GPCR / Class C : Orphans"""	23689	protein-coding gene	gene with protein product		614573					Standard	NM_020752		Approved	KIAA1136	uc001isj.3	Q5T848	OTTHUMG00000017832	ENST00000376351.3:c.106C>T	10.37:g.25464455C>T	ENSP00000365529:p.Arg36*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6QR81|Q9ULT3	Nonsense_Mutation	SNP	pfam_GPCR_3_C,pfscan_GPCR_3_C	p.R36*	ENST00000376351.3	37	c.106	CCDS31166.1	10	.	.	.	.	.	.	.	.	.	.	C	38	7.027365	0.98013	.	.	ENSG00000151025	ENST00000376351	.	.	.	4.72	0.0352	0.14187	.	0.628351	0.13060	N	0.416937	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05959	T	0.93	.	8.589	0.33674	0.4222:0.4509:0.1269:0.0	.	.	.	.	X	36	.	ENSP00000365529:R36X	R	+	1	2	GPR158	25504461	0.011000	0.17503	0.889000	0.34880	0.928000	0.56348	0.185000	0.16958	0.166000	0.19597	0.467000	0.42956	CGA	GPR158	-	NULL		0.682	GPR158-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR158	HGNC	protein_coding	OTTHUMT00000047248.2	C	XM_166110		25464455	+1	no_errors	ENST00000376351	ensembl	human	known	70_37	nonsense	SNP	0.042	T
GRIA3	2892	genome.wustl.edu	37	X	122551678	122551678	+	Intron	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:122551678C>G	ENST00000371251.1	+	11	1929				GRIA3_ENST00000541091.1_Nonsense_Mutation_p.Y626*|GRIA3_ENST00000264357.5_Intron|GRIA3_ENST00000371256.5_Intron|GRIA3_ENST00000542149.1_Intron			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3						glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	TATGGTCATACTCCATTCATG	0.363																																																	0													42.0	43.0	43.0					X																	122551678		2194	4278	6472	SO:0001627	intron_variant	2892			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.1877+49C>G	X.37:g.122551678C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Nonsense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd	p.Y626*	ENST00000371251.1	37	c.1878	CCDS14604.1	X	.	.	.	.	.	.	.	.	.	.	C	11.15	1.553629	0.27739	.	.	ENSG00000125675	ENST00000541091	.	.	.	5.65	2.74	0.32292	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	2.0977	0.03672	0.1929:0.4963:0.1196:0.1912	.	.	.	.	X	626	.	.	Y	+	3	2	GRIA3	122379359	0.355000	0.24921	0.012000	0.15200	0.059000	0.15707	0.543000	0.23237	0.180000	0.19960	-0.202000	0.12741	TAC	GRIA3	-	smart_Iontro_glu_rcpt		0.363	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	C	NM_000828		122551678	+1	no_errors	ENST00000541091	ensembl	human	known	70_37	nonsense	SNP	0.049	G
GRN	2896	genome.wustl.edu	37	17	42429607	42429607	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:42429607G>C	ENST00000053867.3	+	11	1466	c.1404G>C	c.(1402-1404)caG>caC	p.Q468H	GRN_ENST00000589265.1_Missense_Mutation_p.Q311H	NM_002087.2	NP_002078.1	P28799	GRN_HUMAN	granulin	468					blastocyst hatching (GO:0001835)|cell death (GO:0008219)|embryo implantation (GO:0007566)|positive regulation of epithelial cell proliferation (GO:0050679)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrion (GO:0005739)	growth factor activity (GO:0008083)|poly(A) RNA binding (GO:0044822)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Prostate(33;0.0181)		BRCA - Breast invasive adenocarcinoma(366;0.189)		CCTGCTGCCAGTTGCCCCATG	0.652																																																	0													31.0	33.0	32.0					17																	42429607		2202	4300	6502	SO:0001583	missense	2896			M75161	CCDS11483.1	17q21.32	2014-09-17				ENSG00000030582			4601	protein-coding gene	gene with protein product	"""progranulin"""	138945				1417868, 9826678	Standard	XM_005257253		Approved	PCDGF, PGRN, CLN11	uc002igp.1	P28799		ENST00000053867.3:c.1404G>C	17.37:g.42429607G>C	ENSP00000053867:p.Gln468His	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX55|P23781|P23782|P23783|P23784|Q53HQ8|Q53Y88|Q540U8|Q9BWE7|Q9H8S1|Q9UCH0	Missense_Mutation	SNP	pfam_Granulin,smart_Granulin	p.Q468H	ENST00000053867.3	37	c.1404	CCDS11483.1	17	.	.	.	.	.	.	.	.	.	.	G	17.60	3.431058	0.62844	.	.	ENSG00000030582	ENST00000053867;ENST00000393566	D	0.82619	-1.63	5.3	5.3	0.74995	Granulin (2);	0.314038	0.27856	N	0.017568	D	0.85164	0.5634	L	0.38175	1.15	0.27403	N	0.954796	D;D	0.56968	0.971;0.978	D;D	0.64410	0.925;0.909	T	0.79188	-0.1906	10	0.66056	D	0.02	-7.4414	11.5336	0.50624	0.0:0.0:0.8211:0.1789	.	405;468	B4DJI2;P28799	.;GRN_HUMAN	H	468;288	ENSP00000053867:Q468H	ENSP00000053867:Q468H	Q	+	3	2	GRN	39785133	0.773000	0.28580	0.998000	0.56505	0.976000	0.68499	0.951000	0.29135	2.477000	0.83638	0.561000	0.74099	CAG	GRN	-	pfam_Granulin,smart_Granulin		0.652	GRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRN	HGNC	protein_coding	OTTHUMT00000457766.1	G	NM_002087		42429607	+1	no_errors	ENST00000053867	ensembl	human	known	70_37	missense	SNP	0.977	C
HERC6	55008	genome.wustl.edu	37	4	89326036	89326036	+	Silent	SNP	T	T	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:89326036T>C	ENST00000264346.7	+	9	1160	c.1101T>C	c.(1099-1101)agT>agC	p.S367S	HERC6_ENST00000380265.5_Silent_p.S367S	NM_017912.3	NP_060382.3	Q8IVU3	HERC6_HUMAN	HECT and RLD domain containing E3 ubiquitin protein ligase family member 6	367					hematopoietic progenitor cell differentiation (GO:0002244)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.S367S(1)		endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	11		Hepatocellular(203;0.114)		OV - Ovarian serous cystadenocarcinoma(123;0.000222)		AGGATACTAGTTCCACACGTG	0.433																																																	1	Substitution - coding silent(1)	cervix(1)											119.0	108.0	111.0					4																	89326036		1886	4115	6001	SO:0001819	synonymous_variant	55008			AF336798	CCDS47098.1, CCDS54777.1	4q22	2012-02-23	2012-02-23		ENSG00000138642	ENSG00000138642			26072	protein-coding gene	gene with protein product		609249	"""hect domain and RLD 6"""				Standard	NM_001165136		Approved	FLJ20637	uc011cdi.2	Q8IVU3	OTTHUMG00000160983	ENST00000264346.7:c.1101T>C	4.37:g.89326036T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIY5|Q5GC90|Q5GRH3|Q5HYM6|Q5JPB6|Q6PIF4|Q8NAN3|Q9NWS4	Silent	SNP	pfam_HECT,pfam_Reg_chr_condens,superfamily_HECT,superfamily_Reg_csome_cond/b-lactamase_inh,smart_HECT,pfscan_HECT,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.S367	ENST00000264346.7	37	c.1101	CCDS47098.1	4																																																																																			HERC6	-	superfamily_Reg_csome_cond/b-lactamase_inh		0.433	HERC6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HERC6	HGNC	protein_coding	OTTHUMT00000363259.2	T			89326036	+1	no_errors	ENST00000264346	ensembl	human	known	70_37	silent	SNP	0.000	C
HSPB8	26353	genome.wustl.edu	37	12	119617367	119617367	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr12:119617367G>A	ENST00000281938.2	+	1	921	c.250G>A	c.(250-252)Gag>Aag	p.E84K	RP11-64B16.4_ENST00000535921.1_RNA	NM_014365.2	NP_055180.1	Q9UJY1	HSPB8_HUMAN	heat shock 22kDa protein 8	84					cell death (GO:0008219)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)	identical protein binding (GO:0042802)	p.E84K(2)|p.E84*(2)|p.E84Q(2)		central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(9)|skin(1)	14	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GGTGCCTGCCGAGGGCAGGAC	0.657																																																	6	Substitution - Missense(4)|Substitution - Nonsense(2)	lung(4)|cervix(2)											28.0	33.0	31.0					12																	119617367		2203	4300	6503	SO:0001583	missense	26353			AF191017	CCDS9189.1	12q24.23	2014-09-17	2004-04-23					"""Heat shock proteins / HSPB"""	30171	protein-coding gene	gene with protein product		608014	"""heat shock 27kDa protein 8"""			10833516, 11085516	Standard	NM_014365		Approved	H11, E2IG1, HSP22, HspB8	uc001txb.3	Q9UJY1		ENST00000281938.2:c.250G>A	12.37:g.119617367G>A	ENSP00000281938:p.Glu84Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6A6|Q6FIH3|Q9UKS3	Missense_Mutation	SNP	pfam_a-crystallin/Hsp20_dom,superfamily_HSP20-like_chaperone,prints_Alpha-crystallin/HSP,pfscan_a-crystallin/Hsp20_dom	p.E84K	ENST00000281938.2	37	c.250	CCDS9189.1	12	.	.	.	.	.	.	.	.	.	.	G	4.458	0.084805	0.08583	.	.	ENSG00000152137	ENST00000281938	D	0.86497	-2.13	4.42	3.52	0.40303	Heat shock protein Hsp20 (1);HSP20-like chaperone (1);	0.883630	0.10103	N	0.715698	D	0.83723	0.5316	L	0.47716	1.5	0.35476	D	0.797745	B	0.20261	0.043	B	0.17098	0.017	T	0.77943	-0.2398	9	.	.	.	.	14.4682	0.67497	0.0:0.1479:0.8521:0.0	.	84	Q9UJY1	HSPB8_HUMAN	K	84	ENSP00000281938:E84K	.	E	+	1	0	HSPB8	118101750	1.000000	0.71417	0.575000	0.28536	0.126000	0.20510	4.967000	0.63722	1.066000	0.40716	0.563000	0.77884	GAG	HSPB8	-	superfamily_HSP20-like_chaperone,pfscan_a-crystallin/Hsp20_dom		0.657	HSPB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPB8	HGNC	protein_coding	OTTHUMT00000401647.1	G	NM_014365		119617367	+1	no_errors	ENST00000281938	ensembl	human	known	70_37	missense	SNP	0.944	A
HTR3A	3359	genome.wustl.edu	37	11	113848497	113848497	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr11:113848497G>A	ENST00000504030.2	+	2	517	c.72G>A	c.(70-72)agG>agA	p.R24R	HTR3A_ENST00000355556.2_Silent_p.R30R|HTR3A_ENST00000375498.2_Silent_p.R30R|HTR3A_ENST00000299961.5_Silent_p.R9R|HTR3A_ENST00000506841.2_Silent_p.R24R|HTR3A_ENST00000535865.1_5'UTR			P46098	5HT3A_HUMAN	5-hydroxytryptamine (serotonin) receptor 3A, ionotropic	24					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|cellular response to growth factor stimulus (GO:0071363)|digestion (GO:0007586)|ion transmembrane transport (GO:0034220)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|serotonin receptor signaling pathway (GO:0007210)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	receptor activity (GO:0004872)|serotonin binding (GO:0051378)|serotonin receptor activity (GO:0004993)|serotonin-activated cation-selective channel activity (GO:0005232)|voltage-gated potassium channel activity (GO:0005249)	p.R24R(1)		central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	36		all_cancers(61;2.31e-17)|all_epithelial(67;2.1e-10)|all_hematologic(158;4.64e-05)|Melanoma(852;0.000312)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0294)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.71e-06)|Epithelial(105;2.58e-05)|all cancers(92;0.000238)|OV - Ovarian serous cystadenocarcinoma(223;0.191)	Alosetron(DB00969)|Amoxapine(DB00543)|Aripiprazole(DB01238)|Chloroprocaine(DB01161)|Cisapride(DB00604)|Clozapine(DB00363)|Dolasetron(DB00757)|Ergoloid mesylate(DB01049)|Granisetron(DB00889)|Loxapine(DB00408)|Memantine(DB01043)|Methadone(DB00333)|Metoclopramide(DB01233)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Ondansetron(DB00904)|Palonosetron(DB00377)|Procaine(DB00721)|Quetiapine(DB01224)|Rocuronium(DB00728)|Tapentadol(DB06204)|Trimipramine(DB00726)|Tubocurarine(DB01199)|Ziprasidone(DB00246)	TCCCAGCCAGGAGGAGCCGAA	0.567																																																	1	Substitution - coding silent(1)	cervix(1)											52.0	44.0	47.0					11																	113848497		2201	4296	6497	SO:0001819	synonymous_variant	3359			D49394	CCDS8365.1, CCDS8366.1, CCDS8365.2, CCDS8366.2, CCDS53710.1	11q23.1-q23.2	2012-05-22	2012-02-03					"""5-HT (serotonin) receptors"", ""Ligand-gated ion channels / 5-HT (serotonin) receptors, ionotropic"""	5297	protein-coding gene	gene with protein product		182139	"""5-hydroxytryptamine (serotonin) receptor 3A"""	HTR3		8530095, 12867984	Standard	NM_000869		Approved	5-HT3R, 5-HT3A	uc010rxb.2	P46098		ENST00000504030.2:c.72G>A	11.37:g.113848497G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DSY6|G5E986|O60854|Q7KZM7|Q99918|Q9BSZ9	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_5HT3_rcpt_A,prints_5HT3_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R30	ENST00000504030.2	37	c.90		11																																																																																			HTR3A	-	tigrfam_Neur_channel		0.567	HTR3A-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	HTR3A	HGNC	protein_coding	OTTHUMT00000360822.2	G	NM_000869		113848497	+1	no_errors	ENST00000355556	ensembl	human	known	70_37	silent	SNP	0.001	A
IFNGR2	3460	genome.wustl.edu	37	21	34804527	34804528	+	Frame_Shift_Ins	INS	-	-	AA			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr21:34804527_34804528insAA	ENST00000290219.6	+	5	1253_1254	c.605_606insAA	c.(604-609)ttaaaafs	p.LK202fs	IFNGR2_ENST00000405436.1_Frame_Shift_Ins_p.LK123fs|IFNGR2_ENST00000381995.1_Frame_Shift_Ins_p.LK221fs	NM_005534.3	NP_005525.2	P38484	INGR2_HUMAN	interferon gamma receptor 2 (interferon gamma transducer 1)	202	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell surface receptor signaling pathway (GO:0007166)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|response to virus (GO:0009615)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	interferon-gamma receptor activity (GO:0004906)			NS(1)|breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|urinary_tract(1)	13					Interferon gamma-1b(DB00033)	TTGGATAACTTAAAACCCTCCA	0.406																																																	0																																										SO:0001589	frameshift_variant	3460				CCDS33544.1	21q22.1	2014-09-17			ENSG00000159128	ENSG00000159128		"""Interferons"", ""Fibronectin type III domain containing"""	5440	protein-coding gene	gene with protein product		147569		IFNGT1		3136170	Standard	NM_005534		Approved	AF-1	uc002yrp.4	P38484	OTTHUMG00000065188	ENST00000290219.6:c.608_609dupAA	21.37:g.34804530_34804531dupAA	ENSP00000290219:p.Leu202fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BTL5	Frame_Shift_Ins	INS	pfam_Interferon_alpha/beta_rcpt_bsu,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.P204fs	ENST00000290219.6	37	c.605_606	CCDS33544.1	21																																																																																			IFNGR2	-	pfam_Interferon_alpha/beta_rcpt_bsu,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.406	IFNGR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFNGR2	HGNC	protein_coding	OTTHUMT00000139916.1	-			34804528	+1	no_errors	ENST00000290219	ensembl	human	known	70_37	frame_shift_ins	INS	0.004:0.000	AA
IL9R	3581	genome.wustl.edu	37	X	155231085	155231085	+	Intron	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:155231085G>A	ENST00000244174.5	+	2	207				IL9R_ENST00000424344.3_5'UTR|IL9R_ENST00000540897.1_Silent_p.K9K|IL9R_ENST00000369423.2_Silent_p.K19K	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor						cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)			NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					ACTGCTGCAAGAACGGACAGA	0.572																																																	0													291.0	282.0	285.0					X																	155231085		2102	4203	6305	SO:0001627	intron_variant	3581			M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.29-1486G>A	X.37:g.155231085G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Silent	SNP	superfamily_Fibronectin_type3	p.K19	ENST00000244174.5	37	c.57	CCDS14771.4	X																																																																																			IL9R	-	NULL		0.572	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL9R	HGNC	protein_coding	OTTHUMT00000058981.1	G	NM_002186		155231085	+1	no_errors	ENST00000369423	ensembl	human	known	70_37	silent	SNP	0.004	A
IL9R	3581	genome.wustl.edu	37	X	155239720	155239720	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:155239720G>A	ENST00000244174.5	+	9	1391	c.1212G>A	c.(1210-1212)acG>acA	p.T404T	IL9R_ENST00000424344.3_Silent_p.T383T|IL9R_ENST00000540897.1_3'UTR|IL9R_ENST00000369423.2_3'UTR	NM_002186.2	NP_002177.2	Q01113	IL9R_HUMAN	interleukin 9 receptor	404					cell proliferation (GO:0008283)|positive regulation of cell growth (GO:0030307)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)	interleukin-9 receptor activity (GO:0004919)	p.T404T(1)		NS(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|kidney(3)|large_intestine(1)|lung(12)|upper_aerodigestive_tract(1)	23	all_cancers(53;1.86e-17)|all_epithelial(53;2.71e-11)|all_lung(58;1.84e-07)|Lung NSC(58;5.62e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					GGGTACAGACGCTTGCCTATC	0.667																																																	1	Substitution - coding silent(1)	cervix(1)											11.0	21.0	18.0					X																	155239720		2060	4212	6272	SO:0001819	synonymous_variant	3581			M84747	CCDS14771.4, CCDS59180.1	Xq28 and Yq12	2008-02-05			ENSG00000124334	ENSG00000124334		"""Pseudoautosomal regions / PAR2"", ""Interleukins and interleukin receptors"", ""CD molecules"""	6030	protein-coding gene	gene with protein product		300007				1376929, 8666384	Standard	NM_002186		Approved	CD129	uc004fnv.1	Q01113	OTTHUMG00000022720	ENST00000244174.5:c.1212G>A	X.37:g.155239720G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9ZVT0|Q14634|Q8WWU1|Q96TF0	Silent	SNP	superfamily_Fibronectin_type3	p.T404	ENST00000244174.5	37	c.1212	CCDS14771.4	X																																																																																			IL9R	-	NULL		0.667	IL9R-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL9R	HGNC	protein_coding	OTTHUMT00000058981.1	G	NM_002186		155239720	+1	no_errors	ENST00000244174	ensembl	human	known	70_37	silent	SNP	0.000	A
SLC27A3	11000	genome.wustl.edu	37	1	153745111	153745111	+	5'Flank	SNP	C	C	T	rs371311464		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:153745111C>T	ENST00000368661.3	+	0	0				SLC27A3_ENST00000271857.2_5'Flank|INTS3_ENST00000435409.2_Intron|INTS3_ENST00000512605.1_Silent_p.L800L|INTS3_ENST00000456435.1_Silent_p.L800L|INTS3_ENST00000476843.1_Intron|INTS3_ENST00000318967.2_Intron	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3						fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)	p.?(1)		NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			TTTTCTTCCTCTAGTTTTTAG	0.522																																																	1	Unknown(1)	cervix(1)											44.0	47.0	46.0					1																	153745111		2203	4300	6503	SO:0001631	upstream_gene_variant	65123			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155		1.37:g.153745111C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Silent	SNP	pfam_Int_cplx_su3	p.L800	ENST00000368661.3	37	c.2398	CCDS1053.1	1																																																																																			INTS3	-	NULL		0.522	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS3	HGNC	protein_coding		C	NM_024330		153745111	+1	no_errors	ENST00000456435	ensembl	human	known	70_37	silent	SNP	0.343	T
INTU	27152	genome.wustl.edu	37	4	128626914	128626914	+	Missense_Mutation	SNP	A	A	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:128626914A>G	ENST00000335251.6	+	11	1838	c.1735A>G	c.(1735-1737)Act>Gct	p.T579A	INTU_ENST00000512995.1_3'UTR	NM_015693.3	NP_056508.2	Q9ULD6	INTU_HUMAN	inturned planar cell polarity protein	579					cilium assembly (GO:0042384)|hair follicle morphogenesis (GO:0031069)|keratinocyte differentiation (GO:0030216)|limb development (GO:0060173)|negative regulation of cell division (GO:0051782)|negative regulation of keratinocyte proliferation (GO:0010839)|nervous system development (GO:0007399)|positive regulation of smoothened signaling pathway (GO:0045880)|regulation of smoothened signaling pathway (GO:0008589)|spinal cord dorsal/ventral patterning (GO:0021513)	cytoplasm (GO:0005737)		p.T579A(1)		breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	43						AGACTCAAGCACTGAAGTCTT	0.413																																																	1	Substitution - Missense(1)	cervix(1)											136.0	129.0	131.0					4																	128626914		2203	4300	6503	SO:0001583	missense	27152			BC051698	CCDS34061.1	4q28.2	2013-03-05	2013-03-05	2006-10-24	ENSG00000164066	ENSG00000164066			29239	protein-coding gene	gene with protein product		610621	"""PDZ domain containing 6"", ""inturned planar cell polarity effector homolog (Drosophila)"""	PDZK6, PDZD6		10574462, 21761479	Standard	NM_015693		Approved	KIAA1284	uc003ifk.2	Q9ULD6	OTTHUMG00000161202	ENST00000335251.6:c.1735A>G	4.37:g.128626914A>G	ENSP00000334003:p.Thr579Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4N5|D6RAE6|D6RBT4|Q4W5I8|Q86V55	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.T579A	ENST00000335251.6	37	c.1735	CCDS34061.1	4	.	.	.	.	.	.	.	.	.	.	A	1.236	-0.622724	0.03636	.	.	ENSG00000164066	ENST00000335251;ENST00000506283	T;T	0.29655	1.56;1.56	5.36	-6.15	0.02105	.	0.610574	0.16145	N	0.227534	T	0.09730	0.0239	N	0.16478	0.41	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.34378	-0.9831	10	0.07644	T	0.81	-0.0935	1.8132	0.03095	0.3658:0.0802:0.2953:0.2586	.	579	Q9ULD6	PDZD6_HUMAN	A	579;93	ENSP00000334003:T579A;ENSP00000426171:T93A	ENSP00000334003:T579A	T	+	1	0	INTU	128846364	0.000000	0.05858	0.014000	0.15608	0.045000	0.14185	-0.261000	0.08694	-1.082000	0.03101	-1.773000	0.00660	ACT	INTU	-	NULL		0.413	INTU-003	KNOWN	basic|appris_principal|CCDS	protein_coding	INTU	HGNC	protein_coding	OTTHUMT00000364147.2	A	XM_371707		128626914	+1	no_errors	ENST00000335251	ensembl	human	known	70_37	missense	SNP	0.000	G
KCNC4	3749	genome.wustl.edu	37	1	110766382	110766382	+	Missense_Mutation	SNP	G	G	A	rs140378578		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:110766382G>A	ENST00000369787.3	+	2	1502	c.1475G>A	c.(1474-1476)cGg>cAg	p.R492Q	KCNC4_ENST00000412512.2_Intron|KCNC4_ENST00000438661.2_Missense_Mutation_p.R492Q|KCNC4_ENST00000413138.3_Missense_Mutation_p.R492Q	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	492					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)	p.R492Q(2)		central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CCCAAGAAACGGAAGAAGCAC	0.617																																																	2	Substitution - Missense(2)	cervix(2)						G	GLN/ARG,GLN/ARG	0,4406		0,0,2203	94.0	94.0	94.0		1475,1475	4.9	0.2	1	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	KCNC4	NM_001039574.2,NM_004978.4	43,43	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	492/627,492/636	110766382	1,13005	2203	4300	6503	SO:0001583	missense	3749			BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1475G>A	1.37:g.110766382G>A	ENSP00000358802:p.Arg492Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MIM4|Q5TBI6	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_K_chnl_volt-dep_Kv3_ID,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.4,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.R492Q	ENST00000369787.3	37	c.1475	CCDS821.1	1	.	.	.	.	.	.	.	.	.	.	G	15.82	2.947415	0.53186	0.0	1.16E-4	ENSG00000116396	ENST00000369787;ENST00000413138;ENST00000438661	D;D;D	0.97731	-4.51;-4.51;-4.5	4.89	4.89	0.63831	.	0.050155	0.85682	D	0.000000	D	0.95207	0.8446	L	0.55990	1.75	0.46631	D	0.999131	B;B;P	0.50272	0.146;0.136;0.933	B;B;P	0.48334	0.03;0.04;0.574	D	0.94680	0.7864	10	0.56958	D	0.05	.	6.6964	0.23201	0.2275:0.0:0.7725:0.0	.	492;492;492	Q03721;Q03721-3;Q03721-2	KCNC4_HUMAN;.;.	Q	492	ENSP00000358802:R492Q;ENSP00000388029:R492Q;ENSP00000393655:R492Q	ENSP00000358802:R492Q	R	+	2	0	KCNC4	110567905	1.000000	0.71417	0.212000	0.23672	0.948000	0.59901	7.329000	0.79170	2.422000	0.82143	0.462000	0.41574	CGG	KCNC4	-	prints_K_chnl_volt-dep_Kv3		0.617	KCNC4-004	KNOWN	basic|CCDS	protein_coding	KCNC4	HGNC	protein_coding	OTTHUMT00000052146.2	G	NM_001039574		110766382	+1	no_errors	ENST00000369787	ensembl	human	known	70_37	missense	SNP	0.993	A
KLHL4	56062	genome.wustl.edu	37	X	86868950	86868950	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:86868950G>A	ENST00000373119.4	+	2	638	c.493G>A	c.(493-495)Gca>Aca	p.A165T	KLHL4_ENST00000373114.4_Missense_Mutation_p.A165T	NM_019117.4	NP_061990.2	Q9C0H6	KLHL4_HUMAN	kelch-like family member 4	165						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.A165T(2)		NS(1)|biliary_tract(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(19)|lung(29)|ovary(2)|prostate(1)|skin(1)	67						TATAAACCACGCAGAGCAAAC	0.423																																																	2	Substitution - Missense(2)	cervix(2)											107.0	90.0	96.0					X																	86868950		2203	4299	6502	SO:0001583	missense	56062			AF284765	CCDS14456.1, CCDS14457.1	Xq21.3	2013-01-30	2013-01-30		ENSG00000102271	ENSG00000102271		"""Kelch-like"", ""BTB/POZ domain containing"""	6355	protein-coding gene	gene with protein product		300348	"""kelch (Drosophila)-like 4"", ""kelch-like 4 (Drosophila)"""			11401425	Standard	NM_019117		Approved	KIAA1687, DKELCHL, KHL4	uc004efa.2	Q9C0H6	OTTHUMG00000021946	ENST00000373119.4:c.493G>A	X.37:g.86868950G>A	ENSP00000362211:p.Ala165Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTW2|Q9Y3J5	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.A165T	ENST00000373119.4	37	c.493	CCDS14457.1	X	.	.	.	.	.	.	.	.	.	.	G	19.71	3.878347	0.72294	.	.	ENSG00000102271	ENST00000373119;ENST00000373114	T;T	0.71103	-0.54;-0.54	5.16	5.16	0.70880	BTB/POZ fold (2);	0.242984	0.41500	D	0.000879	T	0.82070	0.4957	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.93;0.983	T	0.80226	-0.1470	10	0.27082	T	0.32	.	16.1544	0.81646	0.0:0.0:1.0:0.0	.	165;165	Q9C0H6;Q9C0H6-2	KLHL4_HUMAN;.	T	165	ENSP00000362211:A165T;ENSP00000362206:A165T	ENSP00000362206:A165T	A	+	1	0	KLHL4	86755606	1.000000	0.71417	0.925000	0.36789	0.347000	0.29111	9.239000	0.95389	2.122000	0.65172	0.506000	0.49869	GCA	KLHL4	-	superfamily_BTB/POZ_fold		0.423	KLHL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL4	HGNC	protein_coding	OTTHUMT00000057413.1	G			86868950	+1	no_errors	ENST00000373114	ensembl	human	known	70_37	missense	SNP	1.000	A
KRT35	3886	genome.wustl.edu	37	17	39633831	39633831	+	Missense_Mutation	SNP	G	G	A	rs371011501		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:39633831G>A	ENST00000393989.1	-	6	1201	c.1159C>T	c.(1159-1161)Cgg>Tgg	p.R387W	KRT35_ENST00000246639.2_Missense_Mutation_p.R357W	NM_002280.4	NP_002271.3	Q92764	KRT35_HUMAN	keratin 35	387	Coil 2.|Rod.				anatomical structure morphogenesis (GO:0009653)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)	structural molecule activity (GO:0005198)	p.R387W(1)		NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	29		Breast(137;0.000286)				AGCCGGGCCCGGACGTCCAGC	0.607																																																	1	Substitution - Missense(1)	cervix(1)						G	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	68.0	68.0	68.0		1159	0.2	0.2	17		68	1,8599	1.2+/-3.3	0,1,4299	no	missense	KRT35	NM_002280.4	101	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	probably-damaging	387/456	39633831	2,13004	2203	4300	6503	SO:0001583	missense	3886			X90762	CCDS11394.2	17q21.2	2013-01-16	2006-07-17	2006-07-17	ENSG00000197079	ENSG00000197079		"""-"", ""Intermediate filaments type I, keratins (acidic)"""	6453	protein-coding gene	gene with protein product	"""hard keratin type I 5"""	602764	"""keratin, hair, acidic, 5"""	KRTHA5		8823373, 16831889	Standard	NM_002280		Approved	Ha-5	uc002hws.3	Q92764	OTTHUMG00000133425	ENST00000393989.1:c.1159C>T	17.37:g.39633831G>A	ENSP00000377558:p.Arg387Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	O76012|Q92651	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_I	p.R387W	ENST00000393989.1	37	c.1159	CCDS11394.2	17	.	.	.	.	.	.	.	.	.	.	G	16.38	3.108106	0.56291	2.27E-4	1.16E-4	ENSG00000197079	ENST00000246639;ENST00000393989	D;D	0.89746	-2.56;-2.56	4.95	0.153	0.14897	Filament (1);	0.302795	0.24381	N	0.039007	D	0.92525	0.7626	M	0.71581	2.175	0.35581	D	0.806298	D	0.69078	0.997	D	0.69654	0.965	D	0.93976	0.7254	10	0.87932	D	0	.	13.8089	0.63250	0.0:0.0:0.2661:0.7338	.	387	Q92764	KRT35_HUMAN	W	357;387	ENSP00000246639:R357W;ENSP00000377558:R387W	ENSP00000246639:R357W	R	-	1	2	KRT35	36887357	1.000000	0.71417	0.182000	0.23118	0.426000	0.31534	4.267000	0.58877	0.243000	0.21327	0.563000	0.77884	CGG	KRT35	-	pfam_F		0.607	KRT35-201	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT35	HGNC	protein_coding		G	NM_002280		39633831	-1	no_errors	ENST00000393989	ensembl	human	known	70_37	missense	SNP	0.880	A
KPNA2	3838	genome.wustl.edu	37	17	66039427	66039427	+	Missense_Mutation	SNP	G	G	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:66039427G>T	ENST00000537025.2	+	7	1498	c.878G>T	c.(877-879)gGa>gTa	p.G293V	KPNA2_ENST00000330459.3_Missense_Mutation_p.G293V			P52292	IMA1_HUMAN	karyopherin alpha 2 (RAG cohort 1, importin alpha 1)	293					cytokine-mediated signaling pathway (GO:0019221)|DNA metabolic process (GO:0006259)|NLS-bearing protein import into nucleus (GO:0006607)|regulation of DNA recombination (GO:0000018)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone deacetylase binding (GO:0042826)|nuclear localization sequence binding (GO:0008139)|poly(A) RNA binding (GO:0044822)|protein transporter activity (GO:0008565)	p.G293V(1)		breast(1)|central_nervous_system(2)|cervix(3)|endometrium(2)|kidney(2)|lung(9)|prostate(1)|urinary_tract(2)	22	all_cancers(12;1.18e-09)		BRCA - Breast invasive adenocarcinoma(8;1.03e-07)|LUSC - Lung squamous cell carcinoma(166;0.24)			GTGAAAACAGGAGTTGTGCCC	0.413																																																	1	Substitution - Missense(1)	cervix(1)											211.0	224.0	220.0					17																	66039427		2203	4300	6503	SO:0001583	missense	3838			U09559	CCDS32713.1	17q24.2	2013-02-14						"""Importins"", ""Armadillo repeat containing"""	6395	protein-coding gene	gene with protein product		600685		RCH1		8016130, 7754385	Standard	NM_002266		Approved	SRP1alpha, IPOA1, QIP2	uc002jgk.3	P52292		ENST00000537025.2:c.878G>T	17.37:g.66039427G>T	ENSP00000438483:p.Gly293Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EJD6|Q53YE3|Q9BRU5	Missense_Mutation	SNP	pfam_Armadillo,pfam_Importin-a_IBB,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,pfscan_Importin-a_IBB	p.G293V	ENST00000537025.2	37	c.878	CCDS32713.1	17	.	.	.	.	.	.	.	.	.	.	G	27.7	4.856084	0.91355	.	.	ENSG00000182481	ENST00000330459;ENST00000537025	D;D	0.83914	-1.78;-1.78	5.56	5.56	0.83823	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	U	0.000000	D	0.92580	0.7643	M	0.86502	2.82	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.93388	0.6749	10	0.87932	D	0	.	19.5266	0.95209	0.0:0.0:1.0:0.0	.	293	P52292	IMA2_HUMAN	V	293	ENSP00000332455:G293V;ENSP00000438483:G293V	ENSP00000332455:G293V	G	+	2	0	KPNA2	63469889	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	9.715000	0.98748	2.604000	0.88044	0.557000	0.71058	GGA	KPNA2	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo		0.413	KPNA2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	KPNA2	HGNC	protein_coding	OTTHUMT00000448111.1	G	NM_002266		66039427	+1	no_errors	ENST00000330459	ensembl	human	known	70_37	missense	SNP	1.000	T
LAIR1	3903	genome.wustl.edu	37	19	54872754	54872754	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:54872754C>G	ENST00000391742.2	-	3	285	c.133G>C	c.(133-135)Gtg>Ctg	p.V45L	LAIR1_ENST00000391743.3_Missense_Mutation_p.V27L|LAIR1_ENST00000434277.2_Missense_Mutation_p.V44L|LAIR1_ENST00000313038.6_Missense_Mutation_p.V38L|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000474878.1_Missense_Mutation_p.V44L|LAIR1_ENST00000348231.4_Missense_Mutation_p.V45L			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	45	Ig-like C2-type.				immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)		p.V45L(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		ACGAAAGTCACATGGCTCCCC	0.572																																																	1	Substitution - Missense(1)	cervix(1)											103.0	109.0	107.0					19																	54872754		2203	4300	6503	SO:0001583	missense	3903			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.133G>C	19.37:g.54872754C>G	ENSP00000375622:p.Val45Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	smart_Ig_sub	p.V45L	ENST00000391742.2	37	c.133	CCDS12891.1	19	.	.	.	.	.	.	.	.	.	.	.	15.43	2.832210	0.50845	.	.	ENSG00000167613	ENST00000391743;ENST00000391742;ENST00000434277;ENST00000348231;ENST00000313038;ENST00000474878;ENST00000438193	T;T;T;T;T;T;T	0.15139	2.45;2.45;2.45;2.45;2.45;2.45;5.34	3.16	0.932	0.19466	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	0.388726	0.18806	N	0.130641	T	0.34571	0.0902	M	0.75884	2.315	0.09310	N	1	D;D;D;D;P;D	0.89917	0.997;0.972;0.994;1.0;0.94;0.999	D;P;D;D;P;D	0.97110	0.966;0.9;0.957;1.0;0.638;0.974	T	0.05533	-1.0879	10	0.72032	D	0.01	.	5.4762	0.16697	0.0:0.7312:0.0:0.2688	.	45;27;44;44;45;45	Q6GTX8-4;A8MZ84;Q6GTX8-3;D3YTC8;Q6GTX8-2;Q6GTX8	.;.;.;.;.;LAIR1_HUMAN	L	27;45;44;45;38;44;39	ENSP00000375623:V27L;ENSP00000375622:V45L;ENSP00000391003:V44L;ENSP00000301193:V45L;ENSP00000319204:V38L;ENSP00000418998:V44L;ENSP00000392058:V39L	ENSP00000319204:V38L	V	-	1	0	LAIR1	59564566	0.736000	0.28164	0.041000	0.18516	0.014000	0.08584	1.078000	0.30754	0.340000	0.23745	0.580000	0.79431	GTG	LAIR1	-	smart_Ig_sub		0.572	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR1	HGNC	protein_coding	OTTHUMT00000140506.1	C			54872754	-1	no_errors	ENST00000391742	ensembl	human	known	70_37	missense	SNP	0.053	G
LENG9	94059	genome.wustl.edu	37	19	54974291	54974291	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:54974291G>C	ENST00000333834.4	-	1	603	c.485C>G	c.(484-486)tCg>tGg	p.S162W		NM_198988.1	NP_945339.2	Q96B70	LENG9_HUMAN	leukocyte receptor cluster (LRC) member 9	162							catalytic activity (GO:0003824)|metal ion binding (GO:0046872)	p.S140W(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(5)	11	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.134)		GTCGGTGCGCGAGGCGCGGTC	0.751																																																	1	Substitution - Missense(1)	cervix(1)											8.0	10.0	9.0					19																	54974291		2071	4140	6211	SO:0001583	missense	94059			AF211976		19q13.4	2014-05-06			ENSG00000182909	ENSG00000275183			16306	protein-coding gene	gene with protein product						10941842	Standard	NM_198988		Approved		uc010yez.2	Q96B70	OTTHUMG00000188273	ENST00000333834.4:c.485C>G	19.37:g.54974291G>C	ENSP00000331647:p.Ser162Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2VAM3	Missense_Mutation	SNP	superfamily_RNA_ligase/cNuc_Pdiesterase,smart_Znf_CCCH	p.S162W	ENST00000333834.4	37	c.485	CCDS12895.2	19	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347711	0.41599	.	.	ENSG00000182909	ENST00000333834	T	0.35973	1.28	3.59	3.59	0.41128	.	0.594650	0.16160	U	0.226804	T	0.56992	0.2023	M	0.67700	2.07	0.58432	D	0.999998	D	0.76494	0.999	D	0.77557	0.99	T	0.61128	-0.7125	10	0.87932	D	0	-21.2461	13.0983	0.59206	0.0:0.0:1.0:0.0	.	162	Q96B70	LENG9_HUMAN	W	162	ENSP00000331647:S162W	ENSP00000331647:S162W	S	-	2	0	LENG9	59666103	1.000000	0.71417	0.976000	0.42696	0.103000	0.19146	3.568000	0.53820	1.743000	0.51761	0.305000	0.20034	TCG	LENG9	-	NULL		0.751	LENG9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG9	HGNC	protein_coding	OTTHUMT00000140806.3	G	NM_198988		54974291	-1	no_errors	ENST00000333834	ensembl	human	known	70_37	missense	SNP	1.000	C
LLPH	84298	genome.wustl.edu	37	12	66517664	66517664	+	Missense_Mutation	SNP	T	T	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr12:66517664T>G	ENST00000266604.2	-	3	416	c.346A>C	c.(346-348)Agc>Cgc	p.S116R	LLPH_ENST00000446587.2_Missense_Mutation_p.S116R	NM_032338.3	NP_115714.1	Q9BRT6	LLPH_HUMAN	LLP homolog, long-term synaptic facilitation (Aplysia)	116	Lys-rich.						poly(A) RNA binding (GO:0044822)	p.S116G(1)|p.S116R(1)		central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(1)|skin(1)	5						TTTGCTTTGCTTTTCCCCTTT	0.428																																																	2	Substitution - Missense(2)	cervix(1)|kidney(1)											271.0	237.0	248.0					12																	66517664		2203	4300	6503	SO:0001583	missense	84298			AK057947	CCDS8974.1	12q14.3	2014-05-09	2008-10-02	2008-10-02	ENSG00000139233	ENSG00000139233			28229	protein-coding gene	gene with protein product	"""human LAPS18-like protein"""		"""chromosome 12 open reading frame 31"""	C12orf31		12477932	Standard	NM_032338		Approved	MGC14817, hLLP	uc010ssw.2	Q9BRT6	OTTHUMG00000168959	ENST00000266604.2:c.346A>C	12.37:g.66517664T>G	ENSP00000266604:p.Ser116Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3B766	Missense_Mutation	SNP	pfam_LAPS18-like	p.S116R	ENST00000266604.2	37	c.346	CCDS8974.1	12	.	.	.	.	.	.	.	.	.	.	T	11.00	1.509475	0.27036	.	.	ENSG00000139233	ENST00000266604;ENST00000446587	.	.	.	4.56	3.39	0.38822	.	0.558072	0.20800	N	0.085444	T	0.42494	0.1205	M	0.63428	1.95	0.29387	N	0.862887	B	0.19935	0.04	B	0.22601	0.04	T	0.36841	-0.9731	8	.	.	.	-19.2668	8.8298	0.35076	0.0:0.0966:0.0:0.9034	.	116	Q9BRT6	LLPH_HUMAN	R	116	.	.	S	-	1	0	LLPH	64803931	1.000000	0.71417	0.991000	0.47740	0.438000	0.31896	1.824000	0.39072	0.859000	0.35456	0.528000	0.53228	AGC	LLPH	-	pfam_LAPS18-like		0.428	LLPH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LLPH	HGNC	protein_coding	OTTHUMT00000401752.1	T	NM_032338		66517664	-1	no_errors	ENST00000266604	ensembl	human	known	70_37	missense	SNP	0.785	G
LPIN3	64900	genome.wustl.edu	37	20	39987182	39987182	+	Splice_Site	SNP	C	C	T	rs201841413		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr20:39987182C>T	ENST00000373257.3	+	19	2502	c.2411C>T	c.(2410-2412)aCg>aTg	p.T804M	LPIN3_ENST00000491528.1_3'UTR	NM_022896.1	NP_075047.1	Q9BQK8	LPIN3_HUMAN	lipin 3	804					fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)	p.T804M(1)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|liver(2)|lung(7)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		Myeloproliferative disorder(115;0.000739)				CACAAATCCACGTGAGGCTAA	0.597																																																	1	Substitution - Missense(1)	cervix(1)						C	MET/THR	0,4406		0,0,2203	69.0	78.0	75.0		2411	5.4	1.0	20		75	1,8599	1.2+/-3.3	0,1,4299	yes	missense-near-splice	LPIN3	NM_022896.1	81	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	804/852	39987182	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	64900			AL132654	CCDS33469.1	20q11.2-q12	2006-04-04	2002-05-23		ENSG00000132793	ENSG00000132793			14451	protein-coding gene	gene with protein product		605520	"""lipin 3-like"""	LIPN3L		11138012	Standard	XM_005260515		Approved	SMP2	uc002xjx.3	Q9BQK8	OTTHUMG00000033056	ENST00000373257.3:c.2411+1C>T	20.37:g.39987182C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTT5|Q5TDB9|Q9NPY8|Q9UJE5	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.T804M	ENST00000373257.3	37	c.2411	CCDS33469.1	20	.	.	.	.	.	.	.	.	.	.	C	32	5.188157	0.94923	0.0	1.16E-4	ENSG00000132793	ENST00000373257	D	0.81821	-1.54	5.38	5.38	0.77491	.	0.078901	0.53938	D	0.000055	D	0.89753	0.6806	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.74348	0.983;0.974	D	0.89605	0.3837	9	.	.	.	-10.8892	18.7482	0.91802	0.0:1.0:0.0:0.0	.	805;804	Q9BQK8-2;Q9BQK8	.;LPIN3_HUMAN	M	804	ENSP00000362354:T804M	.	T	+	2	0	LPIN3	39420596	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	5.682000	0.68182	2.521000	0.84997	0.650000	0.86243	ACG	LPIN3	-	NULL		0.597	LPIN3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LPIN3	HGNC	protein_coding	OTTHUMT00000080393.1	C	NM_022896	Missense_Mutation	39987182	+1	no_errors	ENST00000373257	ensembl	human	known	70_37	missense	SNP	1.000	T
LRIT3	345193	genome.wustl.edu	37	4	110791137	110791137	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:110791137C>T	ENST00000594814.1	+	4	1232	c.1232C>T	c.(1231-1233)tCt>tTt	p.S411F	LRIT3_ENST00000327908.3_Missense_Mutation_p.S228F|LRIT3_ENST00000379920.3_Missense_Mutation_p.S366F|LRIT3_ENST00000409621.2_Missense_Mutation_p.S228F	NM_198506.3	NP_940908.3	Q3SXY7	LRIT3_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 3	411	Ser-rich.				regulation of fibroblast growth factor receptor signaling pathway (GO:0040036)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.S228F(1)|p.S366F(1)		cervix(1)|kidney(1)|large_intestine(3)|lung(8)|prostate(2)|skin(1)	16				OV - Ovarian serous cystadenocarcinoma(123;0.0011)		gcttccttctctttatctcct	0.468																																																	2	Substitution - Missense(2)	cervix(2)											165.0	142.0	150.0					4																	110791137		2203	4300	6503	SO:0001583	missense	345193			AK126648	CCDS3688.2, CCDS3688.3	4q25	2014-01-28	2007-06-19		ENSG00000183423	ENSG00000183423		"""Immunoglobulin superfamily / I-set domain containing"""	24783	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 4"""	615004					Standard	NM_198506		Approved	FLJ44691, FIGLER4, CSNB1F	uc031sgv.1	Q3SXY7	OTTHUMG00000132043	ENST00000594814.1:c.1232C>T	4.37:g.110791137C>T	ENSP00000469759:p.Ser411Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J1C2|Q6ZTG1	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.S411F	ENST00000594814.1	37	c.1232	CCDS3688.3	4	.	.	.	.	.	.	.	.	.	.	C	15.56	2.869859	0.51588	.	.	ENSG00000183423	ENST00000327908;ENST00000379920;ENST00000409621	T;T;T	0.59906	0.23;0.46;0.23	4.54	4.54	0.55810	.	1.064100	0.07227	N	0.861784	T	0.64294	0.2585	L	0.36672	1.1	0.19945	N	0.999947	P;D	0.54207	0.94;0.965	P;P	0.54312	0.564;0.748	T	0.57602	-0.7783	10	0.59425	D	0.04	.	14.2005	0.65699	0.0:1.0:0.0:0.0	.	366;228	Q3SXY7;Q3SXY7-2	LRIT3_HUMAN;.	F	228;366;228	ENSP00000328222:S228F;ENSP00000369252:S366F;ENSP00000386734:S228F	ENSP00000328222:S228F	S	+	2	0	LRIT3	111010586	0.006000	0.16342	0.153000	0.22517	0.927000	0.56198	1.964000	0.40462	2.067000	0.61834	0.655000	0.94253	TCT	LRIT3	-	NULL		0.468	LRIT3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT3	HGNC	protein_coding	OTTHUMT00000335270.2	C	NM_198506		110791137	+1	no_errors	ENST00000594814	ensembl	human	known	70_37	missense	SNP	0.324	T
MAP3K15	389840	genome.wustl.edu	37	X	19482436	19482436	+	Missense_Mutation	SNP	G	G	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:19482436G>T	ENST00000338883.4	-	4	613	c.614C>A	c.(613-615)gCc>gAc	p.A205D	MAP3K15_ENST00000469203.2_Missense_Mutation_p.A37D|MAP3K15_ENST00000518578.1_5'UTR	NM_001001671.3	NP_001001671.3	Q6ZN16	M3K15_HUMAN	mitogen-activated protein kinase kinase kinase 15	205							ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)	p.A252D(1)		NS(2)|cervix(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(8)|lung(13)|ovary(3)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	42	Hepatocellular(33;0.183)					GTACTCGGAGGCTCGTCTCTG	0.512																																																	1	Substitution - Missense(1)	cervix(1)											114.0	89.0	96.0					X																	19482436		1568	3582	5150	SO:0001583	missense	389840			AK131412		Xp22.12	2011-06-09			ENSG00000180815	ENSG00000180815		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	31689	protein-coding gene	gene with protein product		300820					Standard	NM_001001671		Approved	bA723P2.3, FLJ16518	uc022btq.1	Q6ZN16	OTTHUMG00000022724	ENST00000338883.4:c.614C>A	X.37:g.19482436G>T	ENSP00000345629:p.Ala205Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2AI49|A2AI50|A6NJ61|Q5JPR4|Q6ZMV3	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.A205D	ENST00000338883.4	37	c.614		X	.	.	.	.	.	.	.	.	.	.	g	21.7	4.194312	0.78902	.	.	ENSG00000180815	ENST00000338883;ENST00000469203	T;T	0.09538	2.97;2.97	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.16342	0.0393	L	0.40543	1.245	0.80722	D	1	.	.	.	.	.	.	T	0.06391	-1.0829	8	0.12103	T	0.63	.	18.5344	0.91004	0.0:0.0:1.0:0.0	.	.	.	.	D	205;37	ENSP00000345629:A205D;ENSP00000428356:A37D	ENSP00000345629:A205D	A	-	2	0	MAP3K15	19392357	1.000000	0.71417	0.092000	0.20876	0.720000	0.41350	5.307000	0.65762	2.406000	0.81754	0.594000	0.82650	GCC	MAP3K15	-	NULL		0.512	MAP3K15-201	KNOWN	basic|appris_principal	protein_coding	MAP3K15	HGNC	protein_coding		G	NM_001001671		19482436	-1	no_errors	ENST00000338883	ensembl	human	known	70_37	missense	SNP	1.000	T
MAP7D3	79649	genome.wustl.edu	37	X	135326895	135326895	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:135326895G>C	ENST00000316077.9	-	4	533	c.313C>G	c.(313-315)Cag>Gag	p.Q105E	MAP7D3_ENST00000370661.1_Missense_Mutation_p.Q105E|MAP7D3_ENST00000370663.5_Missense_Mutation_p.Q87E	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	105					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.Q402E(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					TCCTCCATCTGTTTTTCATAT	0.378																																																	1	Substitution - Missense(1)	cervix(1)											175.0	152.0	159.0					X																	135326895		1832	4078	5910	SO:0001583	missense	79649			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.313C>G	X.37:g.135326895G>C	ENSP00000318086:p.Gln105Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	pfam_E-MAP-115	p.Q87E	ENST00000316077.9	37	c.259	CCDS44004.1	X	.	.	.	.	.	.	.	.	.	.	G	12.72	2.021540	0.35701	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.05717	3.4;3.4;3.4;3.4	5.02	4.15	0.48705	.	.	.	.	.	T	0.18341	0.0440	L	0.52364	1.645	0.30363	N	0.783635	D;D;D;D	0.76494	0.996;0.999;0.996;0.998	P;D;P;D	0.68483	0.831;0.958;0.831;0.919	T	0.01988	-1.1234	9	0.72032	D	0.01	-8.0266	12.5243	0.56077	0.0842:0.0:0.9158:0.0	.	87;105;105;105	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	E	105;105;87;105	ENSP00000359695:Q105E;ENSP00000318086:Q105E;ENSP00000359697:Q87E;ENSP00000359694:Q105E	ENSP00000318086:Q105E	Q	-	1	0	MAP7D3	135154561	0.999000	0.42202	0.003000	0.11579	0.017000	0.09413	3.454000	0.52986	1.024000	0.39682	0.506000	0.49869	CAG	MAP7D3	-	NULL		0.378	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	HGNC	protein_coding	OTTHUMT00000058487.2	G			135326895	-1	no_errors	ENST00000370663	ensembl	human	known	70_37	missense	SNP	0.821	C
MFSD6	54842	genome.wustl.edu	37	2	191301315	191301315	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:191301315C>G	ENST00000392328.1	+	3	884	c.560C>G	c.(559-561)tCt>tGt	p.S187C	MFSD6_ENST00000281416.7_Missense_Mutation_p.S187C	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	187					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)		p.S187C(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						TCCTTTACCTCTTTCCTCACC	0.443																																																	1	Substitution - Missense(1)	cervix(1)											83.0	92.0	89.0					2																	191301315		2203	4300	6503	SO:0001583	missense	54842				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.560C>G	2.37:g.191301315C>G	ENSP00000376141:p.Ser187Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3KSZ4|Q86TH2|Q9NXM3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.S187C	ENST00000392328.1	37	c.560	CCDS2306.1	2	.	.	.	.	.	.	.	.	.	.	C	5.079	0.200204	0.09652	.	.	ENSG00000151690	ENST00000392328;ENST00000281416	T;T	0.33216	1.42;1.42	5.06	4.18	0.49190	Major facilitator superfamily domain, general substrate transporter (1);	1.116950	0.06563	N	0.746983	T	0.30916	0.0780	L	0.40543	1.245	0.32349	N	0.558693	B	0.33448	0.412	B	0.33295	0.161	T	0.30851	-0.9964	10	0.44086	T	0.13	-0.9926	13.0859	0.59140	0.0:0.9223:0.0:0.0777	.	187	Q6ZSS7	MFSD6_HUMAN	C	187	ENSP00000376141:S187C;ENSP00000281416:S187C	ENSP00000281416:S187C	S	+	2	0	MFSD6	191009560	0.848000	0.29623	0.023000	0.16930	0.234000	0.25298	2.791000	0.47829	1.360000	0.45960	0.650000	0.86243	TCT	MFSD6	-	superfamily_MFS_dom_general_subst_transpt		0.443	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	HGNC	protein_coding	OTTHUMT00000255931.1	C			191301315	+1	no_errors	ENST00000281416	ensembl	human	known	70_37	missense	SNP	0.107	G
KMT2C	58508	genome.wustl.edu	37	7	151970952	151970952	+	Splice_Site	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr7:151970952G>A	ENST00000262189.6	-	7	1068	c.850C>T	c.(850-852)Cga>Tga	p.R284*	KMT2C_ENST00000355193.2_Splice_Site_p.R284*	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	284					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.R284*(2)									AATGCACATCGCTGAAAGGGG	0.393																																																	2	Substitution - Nonsense(2)	cervix(2)											52.0	50.0	51.0					7																	151970952		2202	4298	6500	SO:0001630	splice_region_variant	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.850-1C>T	7.37:g.151970952G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.R284*	ENST00000262189.6	37	c.850	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	G	38	7.161137	0.98103	.	.	ENSG00000055609	ENST00000262189;ENST00000355193	.	.	.	4.87	3.99	0.46301	.	0.258206	0.20689	N	0.087494	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.728	0.34480	0.0767:0.0:0.7747:0.1486	.	.	.	.	X	284	.	ENSP00000262189:R284X	R	-	1	2	MLL3	151601885	1.000000	0.71417	1.000000	0.80357	0.943000	0.58893	4.406000	0.59748	1.203000	0.43233	-0.127000	0.14921	CGA	MLL3	-	smart_Znf_PHD		0.393	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	G		Nonsense_Mutation	151970952	-1	no_errors	ENST00000355193	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MST1R	4486	genome.wustl.edu	37	3	49933981	49933981	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr3:49933981C>T	ENST00000296474.3	-	9	2458	c.2431G>A	c.(2431-2433)Gaa>Aaa	p.E811K	CTD-2330K9.2_ENST00000435478.1_RNA|MST1R_ENST00000344206.4_Missense_Mutation_p.E811K	NM_002447.2	NP_002438	Q04912	RON_HUMAN	macrophage stimulating 1 receptor (c-met-related tyrosine kinase)	811	IPT/TIG 3.				cellular component movement (GO:0006928)|defense response (GO:0006952)|innate immune response (GO:0045087)|macrophage colony-stimulating factor signaling pathway (GO:0038145)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of protein kinase B signaling (GO:0051897)|response to virus (GO:0009615)|signal transduction (GO:0007165)|single fertilization (GO:0007338)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|macrophage colony-stimulating factor receptor activity (GO:0005011)	p.E811K(2)		cervix(1)|endometrium(5)|large_intestine(3)|lung(17)|ovary(5)|prostate(2)|skin(1)|urinary_tract(3)	37				BRCA - Breast invasive adenocarcinoma(193;4.65e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00553)|Kidney(197;0.00625)		ACCCTGCTTTCCACTGCCCTA	0.577																																																	2	Substitution - Missense(2)	cervix(2)											116.0	100.0	106.0					3																	49933981		2203	4300	6503	SO:0001583	missense	4486			X70040	CCDS2807.1, CCDS58833.1	3p21	2008-08-18			ENSG00000164078	ENSG00000164078		"""CD molecules"""	7381	protein-coding gene	gene with protein product		600168	"""PTK8 protein tyrosine kinase 8"""	RON, PTK8		8386824	Standard	NM_002447		Approved	CDw136, CD136	uc003cxy.4	Q04912	OTTHUMG00000156709	ENST00000296474.3:c.2431G>A	3.37:g.49933981C>T	ENSP00000296474:p.Glu811Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B5A944|B5A945|B5A946|B5A947	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_IPT_TIG_rcpt,superfamily_Semaphorin/CD100_Ag,superfamily_Kinase-like_dom,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_HGF/MSP_rcpt,pfscan_Semaphorin/CD100_Ag,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E811K	ENST00000296474.3	37	c.2431	CCDS2807.1	3	.	.	.	.	.	.	.	.	.	.	C	5.522	0.281168	0.10458	.	.	ENSG00000164078	ENST00000296474;ENST00000344206	T;T	0.59083	0.29;0.29	5.69	3.57	0.40892	Cell surface receptor IPT/TIG (1);Immunoglobulin E-set (1);	0.340491	0.38778	N	0.001572	T	0.43322	0.1242	L	0.45137	1.4	0.09310	N	0.99999	B;B	0.09022	0.002;0.002	B;B	0.13407	0.009;0.003	T	0.24905	-1.0147	10	0.06757	T	0.87	-17.726	10.8729	0.46894	0.0:0.8244:0.0:0.1756	.	811;811	Q04912-5;Q04912	.;RON_HUMAN	K	811	ENSP00000296474:E811K;ENSP00000341325:E811K	ENSP00000296474:E811K	E	-	1	0	MST1R	49908985	0.002000	0.14202	0.989000	0.46669	0.357000	0.29423	0.061000	0.14366	1.409000	0.46915	0.462000	0.41574	GAA	MST1R	-	superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pirsf_Tyr_kinase_HGF/MSP_rcpt		0.577	MST1R-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MST1R	HGNC	protein_coding	OTTHUMT00000345403.1	C			49933981	-1	no_errors	ENST00000296474	ensembl	human	known	70_37	missense	SNP	0.350	T
LINC01317	104355287	genome.wustl.edu	37	2	33952630	33952630	+	lincRNA	SNP	A	A	G	rs200229926		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:33952630A>G	ENST00000366209.2	+	0	68				MYADML_ENST00000474610.1_RNA																							CGTAAGCCACACAGGCGATGC	0.652																																																	0																																												151325																															2.37:g.33952630A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000366209.2	37	NULL		2																																																																																			MYADML	-	-		0.652	AC009499.1-002	KNOWN	non_canonical_polymorphism|basic	lincRNA	MYADML	HGNC	lincRNA	OTTHUMT00000325406.1	A			33952630	-1	no_errors	ENST00000474610	ensembl	human	known	70_37	rna	SNP	0.002	G
MYF5	4617	genome.wustl.edu	37	12	81112734	81112734	+	Silent	SNP	C	C	T	rs533956404	byFrequency	TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr12:81112734C>T	ENST00000228644.3	+	3	824	c.672C>T	c.(670-672)ctC>ctT	p.L224L		NM_005593.2	NP_005584.2	P13349	MYF5_HUMAN	myogenic factor 5	224					camera-type eye development (GO:0043010)|cartilage condensation (GO:0001502)|embryonic skeletal system morphogenesis (GO:0048704)|extracellular matrix organization (GO:0030198)|muscle cell differentiation (GO:0042692)|muscle cell fate commitment (GO:0042693)|muscle organ development (GO:0007517)|muscle tissue morphogenesis (GO:0060415)|ossification (GO:0001503)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell-matrix adhesion (GO:0001952)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|skeletal muscle cell differentiation (GO:0035914)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription from RNA polymerase II promoter (GO:0006366)	nucleoplasm (GO:0005654)	protein heterodimerization activity (GO:0046982)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)	p.L224L(2)		central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(8)|lung(15)|ovary(2)|pancreas(1)	30						GGTTGCCTCTCCAGGATCTGG	0.493																																																	2	Substitution - coding silent(2)	cervix(1)|lung(1)											105.0	100.0	102.0					12																	81112734		2203	4300	6503	SO:0001819	synonymous_variant	4617				CCDS9020.1	12q21	2013-05-21			ENSG00000111049	ENSG00000111049		"""Basic helix-loop-helix proteins"""	7565	protein-coding gene	gene with protein product		159990				8978788, 12105204	Standard	NM_005593		Approved	bHLHc2	uc001szg.2	P13349	OTTHUMG00000170166	ENST00000228644.3:c.672C>T	12.37:g.81112734C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ISR9	Silent	SNP	pfam_Basic,pfam_Myf5,pfam_HLH_dom,superfamily_HLH_dom,smart_Basic,smart_HLH_dom,pfscan_HLH_dom	p.L224	ENST00000228644.3	37	c.672	CCDS9020.1	12																																																																																			MYF5	-	NULL		0.493	MYF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYF5	HGNC	protein_coding	OTTHUMT00000407757.1	C	NM_005593		81112734	+1	no_errors	ENST00000228644	ensembl	human	known	70_37	silent	SNP	0.989	T
MYH15	22989	genome.wustl.edu	37	3	108195277	108195277	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr3:108195277G>A	ENST00000273353.3	-	13	1316	c.1260C>T	c.(1258-1260)aaC>aaT	p.N420N		NM_014981.1	NP_055796.1	Q9Y2K3	MYH15_HUMAN	myosin, heavy chain 15	420	Myosin motor.					cytoplasm (GO:0005737)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)	p.N420N(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(4)|endometrium(10)|kidney(4)|large_intestine(14)|lung(47)|ovary(5)|pancreas(2)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	105						TAACATATTCGTTACCAACTT	0.358																																																	1	Substitution - coding silent(1)	cervix(1)											82.0	77.0	79.0					3																	108195277		1863	4110	5973	SO:0001819	synonymous_variant	22989			AB023217	CCDS43127.1	3q13	2011-09-27	2006-09-29		ENSG00000144821	ENSG00000144821		"""Myosins / Myosin superfamily : Class II"""	31073	protein-coding gene	gene with protein product		609929	"""myosin, heavy polypeptide 15"""			15014174, 15042088	Standard	NM_014981		Approved	KIAA1000	uc003dxa.1	Q9Y2K3	OTTHUMG00000159226	ENST00000273353.3:c.1260C>T	3.37:g.108195277G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Lambda_DNA-bd_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom	p.N420	ENST00000273353.3	37	c.1260	CCDS43127.1	3																																																																																			MYH15	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.358	MYH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH15	HGNC	protein_coding	OTTHUMT00000353935.1	G	XM_036988		108195277	-1	no_errors	ENST00000273353	ensembl	human	known	70_37	silent	SNP	1.000	A
NEB	4703	genome.wustl.edu	37	2	152476025	152476025	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:152476025G>A	ENST00000172853.10	-	69	10230	c.10083C>T	c.(10081-10083)atC>atT	p.I3361I	NEB_ENST00000409198.1_Silent_p.I3361I|NEB_ENST00000397345.3_Silent_p.I3604I|NEB_ENST00000603639.1_Silent_p.I3604I|NEB_ENST00000604864.1_Silent_p.I3604I|NEB_ENST00000427231.2_Silent_p.I3604I			P20929	NEBU_HUMAN	nebulin	3361					muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)	p.I3604I(1)|p.I3361I(1)		NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		CGGGCAGGCAGATCCATTCAT	0.488																																																	2	Substitution - coding silent(2)	cervix(2)											158.0	151.0	153.0					2																	152476025		2029	4202	6231	SO:0001819	synonymous_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.10083C>T	2.37:g.152476025G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Silent	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.I3604	ENST00000172853.10	37	c.10812		2																																																																																			NEB	-	smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif		0.488	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		G	NM_004543		152476025	-1	no_errors	ENST00000397345	ensembl	human	known	70_37	silent	SNP	0.839	A
NLRP5	126206	genome.wustl.edu	37	19	56538828	56538828	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:56538828G>C	ENST00000390649.3	+	7	1229	c.1229G>C	c.(1228-1230)aGa>aCa	p.R410T		NM_153447.4	NP_703148.4	P59047	NALP5_HUMAN	NLR family, pyrin domain containing 5	410	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.				cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|embryo implantation (GO:0007566)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|neuron death (GO:0070997)|organ morphogenesis (GO:0009887)|regulation of protein stability (GO:0031647)|regulation of RNA stability (GO:0043487)	apical cortex (GO:0045179)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|protein complex (GO:0043234)	ATP binding (GO:0005524)	p.R410T(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|ovary(5)|skin(2)|stomach(4)|upper_aerodigestive_tract(2)	25		Colorectal(82;3.46e-05)|Ovarian(87;0.0481)|Renal(1328;0.157)		GBM - Glioblastoma multiforme(193;0.0326)		GTCACCGTCAGAGACGTGGGC	0.552																																																	1	Substitution - Missense(1)	cervix(1)											45.0	47.0	46.0					19																	56538828		2099	4215	6314	SO:0001583	missense	126206			AY154460	CCDS12938.1	19q13.43	2008-10-30	2006-12-08	2006-12-08	ENSG00000171487	ENSG00000171487		"""Nucleotide-binding domain and leucine rich repeat containing"""	21269	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 5"""	609658	"""NACHT, leucine rich repeat and PYD containing 5"""	NALP5		12563287, 11925379	Standard	NM_153447		Approved	PYPAF8, MATER, PAN11, CLR19.8	uc002qmj.3	P59047	OTTHUMG00000149887	ENST00000390649.3:c.1229G>C	19.37:g.56538828G>C	ENSP00000375063:p.Arg410Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTY4|Q86W29	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.R410T	ENST00000390649.3	37	c.1229	CCDS12938.1	19	.	.	.	.	.	.	.	.	.	.	G	10.05	1.243645	0.22796	.	.	ENSG00000171487	ENST00000390649	D	0.86627	-2.15	3.35	-3.47	0.04753	NACHT nucleoside triphosphatase (1);	0.844986	0.09643	N	0.774681	D	0.88288	0.6396	L	0.60455	1.87	0.09310	N	1	P	0.44776	0.843	P	0.58391	0.838	T	0.80200	-0.1481	10	0.87932	D	0	.	5.6162	0.17432	0.2104:0.4545:0.3351:0.0	.	410	P59047	NALP5_HUMAN	T	410	ENSP00000375063:R410T	ENSP00000375063:R410T	R	+	2	0	NLRP5	61230640	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.694000	0.25512	-0.515000	0.06479	-0.136000	0.14681	AGA	NLRP5	-	pfscan_NACHT_NTPase		0.552	NLRP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP5	HGNC	protein_coding	OTTHUMT00000313735.1	G	NM_153447		56538828	+1	no_errors	ENST00000390649	ensembl	human	known	70_37	missense	SNP	0.000	C
NPVF	64111	genome.wustl.edu	37	7	25266507	25266507	+	Missense_Mutation	SNP	C	C	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr7:25266507C>A	ENST00000222674.2	-	2	323	c.277G>T	c.(277-279)Ggg>Tgg	p.G93W		NM_022150.3	NP_071433	Q9HCQ7	NPVF_HUMAN	neuropeptide VF precursor	93					negative regulation of gonadotropin secretion (GO:0032277)|neuropeptide signaling pathway (GO:0007218)	extracellular region (GO:0005576)		p.G93W(2)		cervix(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|urinary_tract(1)	15						ACGTTCCTCCCAAATCTCAAT	0.443																																																	2	Substitution - Missense(2)	cervix(1)|lung(1)											183.0	179.0	181.0					7																	25266507		2203	4300	6503	SO:0001583	missense	64111			AB040290	CCDS5395.1	7p21-p15	2013-02-28	2006-10-06	2006-10-06	ENSG00000105954	ENSG00000105954		"""Endogenous ligands"""	13782	protein-coding gene	gene with protein product	"""RFamide-related peptide precursor"", ""FMRFamide-related peptide precursor"""		"""chromosome 7 open reading frame 9"""	C7orf9		11951088, 11173868	Standard	NM_022150		Approved	RFRP	uc003sxo.3	Q9HCQ7	OTTHUMG00000128509	ENST00000222674.2:c.277G>T	7.37:g.25266507C>A	ENSP00000222674:p.Gly93Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D164|Q7LE27|Q96PI9	Missense_Mutation	SNP	NULL	p.G93W	ENST00000222674.2	37	c.277	CCDS5395.1	7	.	.	.	.	.	.	.	.	.	.	C	19.20	3.781267	0.70222	.	.	ENSG00000105954	ENST00000222674	T	0.49139	0.79	5.67	5.67	0.87782	.	0.089878	0.48767	D	0.000163	T	0.71945	0.3400	M	0.81942	2.565	0.52099	D	0.999948	D	0.89917	1.0	D	0.97110	1.0	T	0.74553	-0.3627	10	0.87932	D	0	-10.2727	18.3222	0.90242	0.0:1.0:0.0:0.0	.	93	Q9HCQ7	RFRP_HUMAN	W	93	ENSP00000222674:G93W	ENSP00000222674:G93W	G	-	1	0	NPVF	25233032	1.000000	0.71417	1.000000	0.80357	0.825000	0.46686	5.013000	0.64023	2.836000	0.97738	0.655000	0.94253	GGG	NPVF	-	NULL		0.443	NPVF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPVF	HGNC	protein_coding	OTTHUMT00000250315.1	C	NM_022150		25266507	-1	no_errors	ENST00000222674	ensembl	human	known	70_37	missense	SNP	1.000	A
NRIP1	8204	genome.wustl.edu	37	21	16338529	16338529	+	Missense_Mutation	SNP	G	G	A	rs543344464		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr21:16338529G>A	ENST00000400202.1	-	3	2697	c.1985C>T	c.(1984-1986)cCg>cTg	p.P662L	AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000318948.4_Missense_Mutation_p.P662L|NRIP1_ENST00000400199.1_Missense_Mutation_p.P662L			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	662	Repression domain 2.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.P662L(1)		cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		CATACCTATCGGTTTATCTGT	0.378													G|||	1	0.000199681	0.0	0.0	5008	,	,		21031	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	cervix(1)											122.0	125.0	124.0					21																	16338529		2203	4299	6502	SO:0001583	missense	8204			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.1985C>T	21.37:g.16338529G>A	ENSP00000383063:p.Pro662Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWE8	Missense_Mutation	SNP	NULL	p.P662L	ENST00000400202.1	37	c.1985	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	16.71	3.198541	0.58126	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.28069	1.63;1.63;1.63	5.69	2.86	0.33363	.	0.214760	0.39274	N	0.001402	T	0.29945	0.0749	L	0.50333	1.59	0.47905	D	0.999541	D	0.55800	0.973	P	0.44623	0.455	T	0.04178	-1.0971	10	0.62326	D	0.03	-20.7392	10.1933	0.43039	0.0634:0.0:0.6925:0.2441	.	662	P48552	NRIP1_HUMAN	L	662	ENSP00000383060:P662L;ENSP00000383063:P662L;ENSP00000327213:P662L	ENSP00000327213:P662L	P	-	2	0	NRIP1	15260400	1.000000	0.71417	0.002000	0.10522	0.759000	0.43091	5.754000	0.68743	0.423000	0.26033	-0.122000	0.15005	CCG	NRIP1	-	NULL		0.378	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	G	NM_003489		16338529	-1	no_errors	ENST00000318948	ensembl	human	known	70_37	missense	SNP	0.963	A
NSUN7	79730	genome.wustl.edu	37	4	40752791	40752791	+	Silent	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:40752791G>C	ENST00000381782.2	+	2	576	c.81G>C	c.(79-81)ctG>ctC	p.L27L	NSUN7_ENST00000316607.5_Silent_p.L27L	NM_024677.4	NP_078953	Q8NE18	NSUN7_HUMAN	NOP2/Sun domain family, member 7	27							methyltransferase activity (GO:0008168)|RNA binding (GO:0003723)	p.L27L(2)		NS(1)|autonomic_ganglia(1)|cervix(1)|large_intestine(1)|lung(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	12						CCCTGCCTCTGTCCGGTGGGA	0.527																																																	2	Substitution - coding silent(2)	cervix(2)											81.0	77.0	79.0					4																	40752791		2203	4300	6503	SO:0001819	synonymous_variant	79730			BC036568	CCDS3461.2	4p14	2013-10-11	2009-11-23		ENSG00000179299	ENSG00000179299		"""NOP2/Sun domain containing"""	25857	protein-coding gene	gene with protein product			"""NOL1/NOP2/Sun domain family, member 7"""			17442852	Standard	NM_024677		Approved	FLJ14001	uc003gvj.4	Q8NE18	OTTHUMG00000128597	ENST00000381782.2:c.81G>C	4.37:g.40752791G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JI19|Q8N9K8|Q9H815	Silent	SNP	pfam_Fmu/NOL1/Nop2p	p.L27	ENST00000381782.2	37	c.81	CCDS3461.2	4																																																																																			NSUN7	-	NULL		0.527	NSUN7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSUN7	HGNC	protein_coding	OTTHUMT00000250454.2	G	NM_024677		40752791	+1	no_errors	ENST00000381782	ensembl	human	known	70_37	silent	SNP	0.010	C
NXNL1	115861	genome.wustl.edu	37	19	17566593	17566593	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:17566593C>T	ENST00000301944.2	-	2	586	c.502G>A	c.(502-504)Gac>Aac	p.D168N	CTD-2521M24.11_ENST00000598950.1_lincRNA|CTD-2521M24.10_ENST00000594663.1_Missense_Mutation_p.D75N|AC010319.1_ENST00000410873.1_RNA	NM_138454.1	NP_612463.1	Q96CM4	NXNL1_HUMAN	nucleoredoxin-like 1	168					photoreceptor cell maintenance (GO:0045494)	membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)		p.D168N(1)		central_nervous_system(1)|cervix(1)|large_intestine(1)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	6						TCCTCCAGGTCCTCTGGCAGC	0.726																																																	1	Substitution - Missense(1)	cervix(1)											14.0	9.0	11.0					19																	17566593		2141	4221	6362	SO:0001583	missense	115861			BC014127	CCDS12360.1	19p13.11	2014-05-21	2007-08-16	2007-08-16	ENSG00000171773	ENSG00000171773			25179	protein-coding gene	gene with protein product		608791	"""thioredoxin-like 6"""	TXNL6		12477932	Standard	NM_138454		Approved	RDCVF	uc002ngs.3	Q96CM4	OTTHUMG00000182798	ENST00000301944.2:c.502G>A	19.37:g.17566593C>T	ENSP00000305631:p.Asp168Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0QD37	Missense_Mutation	SNP	superfamily_Thioredoxin-like_fold	p.D168N	ENST00000301944.2	37	c.502	CCDS12360.1	19	.	.	.	.	.	.	.	.	.	.	c	19.20	3.781851	0.70222	.	.	ENSG00000171773	ENST00000301944	D	0.84944	-1.92	3.49	3.49	0.39957	.	0.446753	0.24039	U	0.042105	T	0.81460	0.4827	N	0.24115	0.695	0.41707	D	0.989434	D	0.59357	0.985	P	0.55055	0.767	T	0.81614	-0.0853	10	0.56958	D	0.05	-27.7191	8.0893	0.30790	0.2414:0.7586:0.0:0.0	.	168	Q96CM4	NXNL1_HUMAN	N	168	ENSP00000305631:D168N	ENSP00000305631:D168N	D	-	1	0	NXNL1	17427593	1.000000	0.71417	1.000000	0.80357	0.503000	0.33858	4.089000	0.57685	1.807000	0.52817	0.282000	0.19409	GAC	NXNL1	-	NULL		0.726	NXNL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXNL1	HGNC	protein_coding	OTTHUMT00000463803.1	C	NM_138454		17566593	-1	no_errors	ENST00000301944	ensembl	human	known	70_37	missense	SNP	1.000	T
OR11A1	26531	genome.wustl.edu	37	6	29395167	29395167	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr6:29395167C>T	ENST00000377149.1	-	5	724	c.252G>A	c.(250-252)ctG>ctA	p.L84L	OR11A1_ENST00000377148.1_Silent_p.L84L|OR5V1_ENST00000377154.1_Intron|OR11A1_ENST00000377147.2_Silent_p.L84L			Q9GZK7	O11A1_HUMAN	olfactory receptor, family 11, subfamily A, member 1	84						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.L84L(1)		cervix(1)|large_intestine(1)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(1)	19						GGAAGCCCTCCAGCATTTTTG	0.498																																																	1	Substitution - coding silent(1)	cervix(1)											66.0	60.0	62.0					6																	29395167		1511	2709	4220	SO:0001819	synonymous_variant	26531				CCDS34363.1	6p22.2-p21.31	2014-02-19	2002-02-28		ENSG00000204694	ENSG00000204694		"""GPCR / Class A : Olfactory receptors"""	8176	protein-coding gene	gene with protein product			"""olfactory receptor, family 11, subfamily A, member 2"""	OR11A2			Standard	XM_005249001		Approved	hs6M1-18	uc003nmg.3	Q9GZK7	OTTHUMG00000031225	ENST00000377149.1:c.252G>A	6.37:g.29395167C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2BF33|A6NFQ3|B0S7T2|Q5ST16|Q9GZK8	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Olfact_rcpt	p.L84	ENST00000377149.1	37	c.252	CCDS34363.1	6																																																																																			OR11A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.498	OR11A1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	OR11A1	HGNC	protein_coding	OTTHUMT00000193778.1	C			29395167	-1	no_errors	ENST00000377147	ensembl	human	known	70_37	silent	SNP	0.023	T
OR6K3	391114	genome.wustl.edu	37	1	158687406	158687406	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:158687406G>A	ENST00000368146.1	-	1	547	c.548C>T	c.(547-549)cCt>cTt	p.P183L	OR6K3_ENST00000368145.1_Missense_Mutation_p.P167L			Q8NGY3	OR6K3_HUMAN	olfactory receptor, family 6, subfamily K, member 3	183						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.P183L(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(21)|ovary(1)|prostate(1)|skin(2)|stomach(1)	41	all_hematologic(112;0.0378)					CCCACAGAAAGGCAGTGTGGA	0.517																																																	1	Substitution - Missense(1)	cervix(1)											130.0	126.0	127.0					1																	158687406		2203	4300	6503	SO:0001583	missense	391114			AB065633	CCDS30903.1, CCDS30903.2	1q23.1	2012-08-09			ENSG00000203757	ENSG00000203757		"""GPCR / Class A : Olfactory receptors"""	15030	protein-coding gene	gene with protein product							Standard	NM_001005327		Approved		uc021pbn.1	Q8NGY3	OTTHUMG00000022770	ENST00000368146.1:c.548C>T	1.37:g.158687406G>A	ENSP00000357128:p.Pro183Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUV0|Q6IFR5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.P183L	ENST00000368146.1	37	c.548		1	.	.	.	.	.	.	.	.	.	.	G	16.96	3.266473	0.59540	.	.	ENSG00000203757	ENST00000368145;ENST00000368146	T;T	0.00158	8.65;8.65	4.04	3.12	0.35913	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.00210	0.0006	M	0.78049	2.395	0.09310	N	0.999992	D	0.89917	1.0	D	0.97110	1.0	T	0.20840	-1.0263	9	0.66056	D	0.02	.	11.1112	0.48235	0.0947:0.0:0.9053:0.0	.	183	Q8NGY3	OR6K3_HUMAN	L	167;183	ENSP00000357127:P167L;ENSP00000357128:P183L	ENSP00000357127:P167L	P	-	2	0	OR6K3	156954030	0.015000	0.18098	0.007000	0.13788	0.937000	0.57800	1.136000	0.31467	1.022000	0.39626	0.411000	0.27672	CCT	OR6K3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.517	OR6K3-201	KNOWN	basic	protein_coding	OR6K3	HGNC	protein_coding		G			158687406	-1	no_errors	ENST00000368146	ensembl	human	known	70_37	missense	SNP	0.043	A
OR8U1	219417	genome.wustl.edu	37	11	56143745	56143745	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr11:56143745G>A	ENST00000302270.1	+	1	646	c.646G>A	c.(646-648)Gtc>Atc	p.V216I		NM_001005204.1	NP_001005204.1	Q8NH10	OR8U1_HUMAN	olfactory receptor, family 8, subfamily U, member 1	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.V216I(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(1)|lung(23)|ovary(4)|skin(1)|stomach(1)	39	Esophageal squamous(21;0.00448)					GATTGTCTTTGTCTCCTACAT	0.498																																																	1	Substitution - Missense(1)	cervix(1)											176.0	174.0	175.0					11																	56143745		2048	4210	6258	SO:0001583	missense	219417			AB065603	CCDS41647.1	11q11	2012-08-09			ENSG00000172199	ENSG00000172199		"""GPCR / Class A : Olfactory receptors"""	19611	protein-coding gene	gene with protein product							Standard	NM_001005204		Approved			Q8NH10	OTTHUMG00000166860	ENST00000302270.1:c.646G>A	11.37:g.56143745G>A	ENSP00000304188:p.Val216Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V216I	ENST00000302270.1	37	c.646	CCDS41647.1	11	.	.	.	.	.	.	.	.	.	.	G	0.006	-2.030932	0.00410	.	.	ENSG00000172199	ENST00000302270	T	0.37235	1.21	5.78	1.7	0.24286	GPCR, rhodopsin-like superfamily (1);	0.484183	0.17459	N	0.173512	T	0.14700	0.0355	N	0.13003	0.285	0.09310	N	1	B	0.06786	0.001	B	0.12837	0.008	T	0.31503	-0.9941	10	0.02654	T	1	.	4.7563	0.13086	0.2899:0.0:0.5688:0.1412	.	216	Q8NH10	OR8U1_HUMAN	I	216	ENSP00000304188:V216I	ENSP00000304188:V216I	V	+	1	0	OR8U1	55900321	0.000000	0.05858	0.979000	0.43373	0.018000	0.09664	-2.705000	0.00821	0.812000	0.34326	-0.148000	0.13756	GTC	OR8U1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.498	OR8U1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8U1	HGNC	protein_coding	OTTHUMT00000391607.1	G	NM_001005204		56143745	+1	no_errors	ENST00000302270	ensembl	human	known	70_37	missense	SNP	0.004	A
PAK3	5063	genome.wustl.edu	37	X	110406215	110406215	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:110406215G>C	ENST00000372010.1	+	10	1028	c.586G>C	c.(586-588)Gaa>Caa	p.E196Q	PAK3_ENST00000417227.1_Missense_Mutation_p.E202Q|PAK3_ENST00000360648.4_Missense_Mutation_p.E217Q|PAK3_ENST00000262836.4_Missense_Mutation_p.E196Q|PAK3_ENST00000446737.1_Missense_Mutation_p.E181Q|PAK3_ENST00000519681.1_Missense_Mutation_p.E202Q|PAK3_ENST00000372007.5_Missense_Mutation_p.E181Q|PAK3_ENST00000518291.1_Missense_Mutation_p.E217Q|PAK3_ENST00000425146.1_Missense_Mutation_p.E181Q			O75914	PAK3_HUMAN	p21 protein (Cdc42/Rac)-activated kinase 3	196	Linker.|Poly-Glu.				activation of MAPK activity (GO:0000187)|axonogenesis (GO:0007409)|dendrite development (GO:0016358)|dendritic spine morphogenesis (GO:0060997)|MAPK cascade (GO:0000165)|regulation of actin filament polymerization (GO:0030833)|synapse organization (GO:0050808)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)	p.E181Q(1)|p.E217Q(1)		breast(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(15)|ovary(3)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	41						ggaagaagaagaagaagatga	0.403										TSP Lung(19;0.15)																																							2	Substitution - Missense(2)	cervix(2)											151.0	132.0	139.0					X																	110406215		2203	4300	6503	SO:0001583	missense	5063			AF068864	CCDS14554.1, CCDS48151.1, CCDS48152.1, CCDS48153.1	Xq22.3	2008-06-17	2008-06-17		ENSG00000077264	ENSG00000077264			8592	protein-coding gene	gene with protein product		300142	"""mental retardation, X-linked 47"", ""p21 (CDKN1A)-activated kinase 3"""	MRX30, MRX47		8826460, 9731525	Standard	NM_002578		Approved	hPAK3, bPAK	uc010npv.1	O75914	OTTHUMG00000022202	ENST00000372010.1:c.586G>C	X.37:g.110406215G>C	ENSP00000361080:p.Glu196Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K389|B1GX77|B1GX78|B1GX79|Q5JWX1|Q5JWX2|Q7Z2D6|Q7Z2E4|Q7Z3Z8|Q8WWK5|Q8WX23|Q9P0J8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PAK_box_Rho-bd,superfamily_Kinase-like_dom,smart_PAK_box_Rho-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_PAK_box_Rho-bd,pfscan_Prot_kinase_cat_dom	p.E217Q	ENST00000372010.1	37	c.649	CCDS48153.1	X	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121410	0.37436	.	.	ENSG00000077264	ENST00000446737;ENST00000425146;ENST00000372010;ENST00000519681;ENST00000372007;ENST00000518291;ENST00000360648;ENST00000417227;ENST00000262836	T;T;T;T;T;T;T;T;T	0.70986	-0.53;-0.53;-0.52;-0.53;-0.53;-0.53;-0.53;-0.53;-0.52	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.60327	0.2260	N	0.14661	0.345	0.45883	D	0.998731	P;P;B;B	0.35821	0.523;0.523;0.389;0.371	B;B;B;B	0.41466	0.283;0.358;0.266;0.211	T	0.57556	-0.7791	10	0.17369	T	0.5	.	17.909	0.88928	0.0:0.0:1.0:0.0	.	202;217;196;181	O75914-4;O75914-3;O75914;O75914-2	.;.;PAK3_HUMAN;.	Q	181;181;196;202;181;217;217;202;196	ENSP00000410853:E181Q;ENSP00000401982:E181Q;ENSP00000361080:E196Q;ENSP00000429113:E202Q;ENSP00000361077:E181Q;ENSP00000428921:E217Q;ENSP00000353864:E217Q;ENSP00000389172:E202Q;ENSP00000262836:E196Q	ENSP00000262836:E196Q	E	+	1	0	PAK3	110292871	1.000000	0.71417	0.994000	0.49952	0.963000	0.63663	8.414000	0.90238	2.504000	0.84457	0.600000	0.82982	GAA	PAK3	-	NULL		0.403	PAK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAK3	HGNC	protein_coding	OTTHUMT00000057918.1	G	NM_002578		110406215	+1	no_errors	ENST00000360648	ensembl	human	known	70_37	missense	SNP	1.000	C
PCDH15	65217	genome.wustl.edu	37	10	56138561	56138561	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr10:56138561C>T	ENST00000320301.6	-	4	693	c.299G>A	c.(298-300)gGa>gAa	p.G100E	PCDH15_ENST00000395433.1_Missense_Mutation_p.G78E|PCDH15_ENST00000373965.2_Missense_Mutation_p.G100E|PCDH15_ENST00000395430.1_Missense_Mutation_p.G100E|PCDH15_ENST00000414778.1_Missense_Mutation_p.G105E|PCDH15_ENST00000437009.1_Missense_Mutation_p.G100E|PCDH15_ENST00000373957.3_Missense_Mutation_p.G78E|PCDH15_ENST00000361849.3_Missense_Mutation_p.G100E|PCDH15_ENST00000373955.1_Missense_Mutation_p.G100E|PCDH15_ENST00000395445.1_Missense_Mutation_p.G100E|PCDH15_ENST00000395432.2_Missense_Mutation_p.G100E|PCDH15_ENST00000395440.1_Missense_Mutation_p.G100E|PCDH15_ENST00000395442.1_Missense_Mutation_p.G100E|PCDH15_ENST00000395438.1_Missense_Mutation_p.G100E|PCDH15_ENST00000409834.1_Intron|PCDH15_ENST00000395446.1_Missense_Mutation_p.G100E	NM_033056.3	NP_149045.3	Q96QU1	PCD15_HUMAN	protocadherin-related 15	100	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				equilibrioception (GO:0050957)|homophilic cell adhesion (GO:0007156)|photoreceptor cell maintenance (GO:0045494)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|stereocilium (GO:0032420)|synapse (GO:0045202)	calcium ion binding (GO:0005509)	p.G100E(2)|p.G105E(2)		NS(3)|breast(6)|central_nervous_system(1)|cervix(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(39)|lung(108)|ovary(5)|pancreas(6)|prostate(6)|skin(12)|upper_aerodigestive_tract(12)|urinary_tract(1)	237		Melanoma(3;0.117)|Lung SC(717;0.238)				CAGAACTCTTCCGGTGCTGTT	0.358										HNSCC(58;0.16)																																							4	Substitution - Missense(4)	cervix(4)											101.0	108.0	105.0					10																	56138561		2203	4300	6503	SO:0001583	missense	65217			AY029205	CCDS7248.1, CCDS44400.1, CCDS44401.1, CCDS44403.1, CCDS44404.1, CCDS73134.1, CCDS73135.1, CCDS73136.1, CCDS73137.1, CCDS73138.1	10q21.1	2013-01-08	2010-01-25		ENSG00000150275	ENSG00000150275		"""Cadherins / Cadherin-related"""	14674	protein-coding gene	gene with protein product	"""cadherin-related family member 15"""	605514	"""deafness, autosomal recessive 23"", ""protocadherin 15"""	USH1F, DFNB23		11398101, 14570705	Standard	NM_033056		Approved	CDHR15	uc010qhy.1	Q96QU1	OTTHUMG00000018259	ENST00000320301.6:c.299G>A	10.37:g.56138561C>T	ENSP00000322604:p.Gly100Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL19|C6ZEF5|C6ZEF6|C6ZEF7|Q5VY38|Q5VY39|Q6TRH8|Q8NDB9|Q96QT8	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.G100E	ENST00000320301.6	37	c.299	CCDS7248.1	10	.	.	.	.	.	.	.	.	.	.	C	26.0	4.691863	0.88735	.	.	ENSG00000150275	ENST00000373965;ENST00000414778;ENST00000455746;ENST00000395438;ENST00000395445;ENST00000395446;ENST00000395442;ENST00000395440;ENST00000395432;ENST00000361849;ENST00000395433;ENST00000373957;ENST00000320301;ENST00000395430;ENST00000417177;ENST00000437009;ENST00000373955	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.58652	0.56;0.61;0.54;0.53;0.57;0.76;0.64;0.32;0.43;0.51;0.45;0.44;0.44;0.51;0.64	5.5	5.5	0.81552	Cadherin (1);	.	.	.	.	T	0.69735	0.3144	L	0.36672	1.1	0.58432	D	0.999993	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;0.99;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97110	1.0;0.998;1.0;1.0;1.0;0.998;1.0;1.0;1.0;1.0;0.925;1.0;1.0;1.0;0.998	T	0.71862	-0.4464	9	0.72032	D	0.01	.	18.9828	0.92761	0.0:1.0:0.0:0.0	.	78;100;100;105;100;100;100;100;100;100;100;105;100;78;100	A2A3E8;E7EMG4;A2A3E7;C9JIG1;E7EM53;E7EMG0;A2A3E6;A2A3E3;C6ZEF5;A2A3E2;C6ZEF7;C9J4F3;Q96QU1-3;A2A3D8;Q96QU1	.;.;.;.;.;.;.;.;.;.;.;.;.;.;PCD15_HUMAN	E	100;105;100;100;100;100;100;100;100;100;78;78;100;100;105;100;100	ENSP00000363076:G100E;ENSP00000410304:G105E;ENSP00000378826:G100E;ENSP00000378832:G100E;ENSP00000378833:G100E;ENSP00000378829:G100E;ENSP00000378827:G100E;ENSP00000378820:G100E;ENSP00000354950:G100E;ENSP00000378821:G78E;ENSP00000363068:G78E;ENSP00000322604:G100E;ENSP00000378818:G100E;ENSP00000412628:G100E;ENSP00000363066:G100E	ENSP00000322604:G100E	G	-	2	0	PCDH15	55808567	1.000000	0.71417	0.949000	0.38748	0.867000	0.49689	7.805000	0.86005	2.611000	0.88343	0.643000	0.83706	GGA	PCDH15	-	smart_Cadherin		0.358	PCDH15-001	KNOWN	basic|CCDS	protein_coding	PCDH15	HGNC	protein_coding	OTTHUMT00000048121.2	C	NM_033056		56138561	-1	no_errors	ENST00000320301	ensembl	human	known	70_37	missense	SNP	1.000	T
PCDHGB2	56103	genome.wustl.edu	37	5	140741175	140741175	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:140741175C>G	ENST00000522605.1	+	1	1473	c.1473C>G	c.(1471-1473)atC>atG	p.I491M	PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	491	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I491M(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCTACTCCATCGTAGCGAGCG	0.602																																																	1	Substitution - Missense(1)	cervix(1)											43.0	45.0	44.0					5																	140741175		1940	4123	6063	SO:0001583	missense	56103			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1473C>G	5.37:g.140741175C>G	ENSP00000429018:p.Ile491Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.I491M	ENST00000522605.1	37	c.1473	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	10.31	1.313802	0.23908	.	.	ENSG00000253910	ENST00000522605	T	0.02682	4.2	5.18	2.16	0.27623	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.11110	0.0271	M	0.79123	2.44	0.24625	N	0.993658	D;D	0.89917	0.999;1.0	D;D	0.78314	0.968;0.991	T	0.16482	-1.0401	9	0.87932	D	0	.	3.0908	0.06293	0.1283:0.491:0.2276:0.1531	.	491;491	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	M	491	ENSP00000429018:I491M	ENSP00000429018:I491M	I	+	3	3	PCDHGB2	140721359	0.000000	0.05858	0.999000	0.59377	0.136000	0.21042	-2.165000	0.01274	0.647000	0.30713	-0.444000	0.05651	ATC	PCDHGB2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.602	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1	C	NM_018923		140741175	+1	no_errors	ENST00000522605	ensembl	human	known	70_37	missense	SNP	0.998	G
PCDHGB2	56103	genome.wustl.edu	37	5	140741440	140741440	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:140741440C>G	ENST00000522605.1	+	1	1738	c.1738C>G	c.(1738-1740)Cgc>Ggc	p.R580G	PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	580	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TATGGTGCCACGCGCCGCAGA	0.662																																																	0													15.0	19.0	18.0					5																	140741440		1870	4018	5888	SO:0001583	missense	56103			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.1738C>G	5.37:g.140741440C>G	ENSP00000429018:p.Arg580Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R580G	ENST00000522605.1	37	c.1738	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	16.37	3.104398	0.56291	.	.	ENSG00000253910	ENST00000522605	T	0.59224	0.28	4.95	4.95	0.65309	Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.77184	0.4093	M	0.84948	2.725	0.27851	N	0.940761	D;D	0.89917	1.0;0.999	D;D	0.76575	0.988;0.971	T	0.71104	-0.4689	9	0.87932	D	0	.	11.7265	0.51712	0.0:0.9172:0.0:0.0828	.	580;580	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	G	580	ENSP00000429018:R580G	ENSP00000429018:R580G	R	+	1	0	PCDHGB2	140721624	0.000000	0.05858	1.000000	0.80357	0.852000	0.48524	0.751000	0.26348	2.452000	0.82932	0.454000	0.30748	CGC	PCDHGB2	-	superfamily_Cadherin-like,pfscan_Cadherin		0.662	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1	C	NM_018923		140741440	+1	no_errors	ENST00000522605	ensembl	human	known	70_37	missense	SNP	1.000	G
PCDHGB2	56103	genome.wustl.edu	37	5	140741819	140741819	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:140741819C>T	ENST00000522605.1	+	1	2117	c.2117C>T	c.(2116-2118)gCg>gTg	p.A706V	PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	706					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.A706V(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTTCCTCGCGGTGATTCTG	0.592																																																	1	Substitution - Missense(1)	cervix(1)											93.0	97.0	96.0					5																	140741819		2040	4192	6232	SO:0001583	missense	56103			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2117C>T	5.37:g.140741819C>T	ENSP00000429018:p.Ala706Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MIJ3|Q9UN65	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A706V	ENST00000522605.1	37	c.2117	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	0.234	-1.018856	0.02078	.	.	ENSG00000253910	ENST00000522605	T	0.16457	2.34	4.96	4.96	0.65561	.	.	.	.	.	T	0.15435	0.0372	L	0.58428	1.81	0.09310	N	1	P;P	0.39424	0.673;0.527	B;B	0.30105	0.111;0.048	T	0.22836	-1.0205	9	0.10377	T	0.69	.	14.986	0.71348	0.0:0.8567:0.1433:0.0	.	706;706	Q9Y5G2-2;Q9Y5G2	.;PCDGE_HUMAN	V	706	ENSP00000429018:A706V	ENSP00000429018:A706V	A	+	2	0	PCDHGB2	140722003	0.000000	0.05858	0.027000	0.17364	0.390000	0.30446	0.162000	0.16501	2.467000	0.83353	0.461000	0.40582	GCG	PCDHGB2	-	NULL		0.592	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1	C	NM_018923		140741819	+1	no_errors	ENST00000522605	ensembl	human	known	70_37	missense	SNP	0.034	T
PCDHGB2	56103	genome.wustl.edu	37	5	140741884	140741884	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:140741884C>T	ENST00000522605.1	+	1	2182	c.2182C>T	c.(2182-2184)Cag>Tag	p.Q728*	PCDHGA3_ENST00000253812.6_Intron|PCDHGA5_ENST00000518069.1_5'Flank|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron	NM_018923.2|NM_032096.1	NP_061746.1|NP_115267.1	Q9Y5G2	PCDGE_HUMAN	protocadherin gamma subfamily B, 2	728					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.Q728*(1)		endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGACTGTTTTCAGCCTGGTCT	0.552																																																	1	Substitution - Nonsense(1)	cervix(1)											106.0	111.0	110.0					5																	140741884		1989	4166	6155	SO:0001587	stop_gained	56103			AF152331	CCDS54924.1, CCDS75332.1	5q31	2010-01-26				ENSG00000253910		"""Cadherins / Protocadherins : Clustered"""	8709	other	protocadherin		606300				10380929	Standard	NM_018923		Approved	PCDH-GAMMA-B2		Q9Y5G2		ENST00000522605.1:c.2182C>T	5.37:g.140741884C>T	ENSP00000429018:p.Gln728*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MIJ3|Q9UN65	Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.Q728*	ENST00000522605.1	37	c.2182	CCDS54924.1	5	.	.	.	.	.	.	.	.	.	.	.	18.92	3.726681	0.69074	.	.	ENSG00000253910	ENST00000522605	.	.	.	5.18	-0.183	0.13284	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.05721	T	0.95	.	4.3499	0.11150	0.3824:0.3478:0.1999:0.0699	.	.	.	.	X	728	.	ENSP00000429018:Q728X	Q	+	1	0	PCDHGB2	140722068	0.015000	0.18098	0.801000	0.32222	0.070000	0.16714	0.053000	0.14184	0.261000	0.21753	0.461000	0.40582	CAG	PCDHGB2	-	NULL		0.552	PCDHGB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGB2	HGNC	protein_coding	OTTHUMT00000374741.1	C	NM_018923		140741884	+1	no_errors	ENST00000522605	ensembl	human	known	70_37	nonsense	SNP	0.000	T
PDE4DIP	9659	genome.wustl.edu	37	1	144864276	144864276	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:144864276C>T	ENST00000369354.3	-	36	6008	c.5819G>A	c.(5818-5820)cGa>cAa	p.R1940Q	PDE4DIP_ENST00000369359.4_Missense_Mutation_p.R2076Q|PDE4DIP_ENST00000530740.1_Missense_Mutation_p.R2025Q|PDE4DIP_ENST00000369356.4_Missense_Mutation_p.R1940Q|PDE4DIP_ENST00000313382.9_Missense_Mutation_p.R1834Q|RP4-791M13.4_ENST00000532137.1_RNA|PDE4DIP_ENST00000524974.1_5'UTR			Q5VU43	MYOME_HUMAN	phosphodiesterase 4D interacting protein	1940					cellular protein complex assembly (GO:0043623)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|myofibril (GO:0030016)|nucleus (GO:0005634)	enzyme binding (GO:0019899)	p.R1940Q(2)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(12)|lung(106)|ovary(8)|prostate(7)|skin(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	176				Colorectal(2;0.0829)|COAD - Colon adenocarcinoma(2;0.126)		AAGGTGGGATCGAGAGGACAG	0.527			T	PDGFRB	MPD																																			Dom	yes		1	1q12	9659	phosphodiesterase 4D interacting protein (myomegalin)		L	2	Substitution - Missense(2)	cervix(2)											122.0	131.0	128.0					1																	144864276		2203	4298	6501	SO:0001583	missense	9659			AB007923, AB007946	CCDS72887.1, CCDS72888.1, CCDS72889.1, CCDS72890.1, CCDS72891.1, CCDS72892.1, CCDS72893.1, CCDS72894.1	1q21.1	2008-07-31	2008-07-31		ENSG00000178104	ENSG00000178104			15580	protein-coding gene	gene with protein product	"""myomegalin"""	608117	"""cardiomyopathy associated 2"""	CMYA2		9455484, 11134006	Standard	NM_022359		Approved	KIAA0477, KIAA0454, MMGL	uc021ouh.1	Q5VU43	OTTHUMG00000013846	ENST00000369354.3:c.5819G>A	1.37:g.144864276C>T	ENSP00000358360:p.Arg1940Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU15|O75042|O75065|Q2YDC1|Q5VU42|Q5VU44|Q5VU45|Q5VU46|Q5VU47|Q5VU48|Q5VU49|Q68DU2|Q6AZ93|Q6PK88|Q86T40|Q86TB2|Q8N3W0|Q8TAY9|Q9HCP2|Q9HCP3|Q9HCP4|Q9HCP5	Missense_Mutation	SNP	pfam_Spindle_assoc,superfamily_ARM-type_fold	p.R1940Q	ENST00000369354.3	37	c.5819	CCDS30824.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.985|7.985	0.752107|0.752107	0.15778|0.15778	.|.	.|.	ENSG00000178104|ENSG00000178104	ENST00000530130|ENST00000313382;ENST00000369354;ENST00000369356;ENST00000530740;ENST00000369359	.|T;T;T;T;T	.|0.01725	.|4.67;4.74;4.74;4.75;4.75	4.52|4.52	-5.6|-5.6	0.02497|0.02497	.|.	.|.	.|.	.|.	.|.	T|T	0.00784|0.00784	0.0026|0.0026	M|M	0.61703|0.61703	1.905|1.905	0.09310|0.09310	N|N	1|1	.|B;B	.|0.17465	.|0.012;0.022	.|B;B	.|0.10450	.|0.005;0.005	T|T	0.33854|0.33854	-0.9852|-0.9852	5|9	.|0.26408	.|T	.|0.33	.|.	12.3919|12.3919	0.55362|0.55362	0.0:0.4016:0.0:0.5984|0.0:0.4016:0.0:0.5984	.|.	.|1834;1940	.|Q5VU43-3;Q5VU43	.|.;MYOME_HUMAN	N|Q	97|1834;1940;1940;2025;2076	.|ENSP00000327209:R1834Q;ENSP00000358360:R1940Q;ENSP00000358363:R1940Q;ENSP00000435654:R2025Q;ENSP00000358366:R2076Q	.|ENSP00000327209:R1834Q	D|R	-|-	1|2	0|0	PDE4DIP|PDE4DIP	143575633|143575633	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.320000|0.320000	0.28249|0.28249	-0.343000|-0.343000	0.07791|0.07791	-1.184000|-1.184000	0.02720|0.02720	-0.142000|-0.142000	0.14014|0.14014	GAT|CGA	PDE4DIP	-	NULL		0.527	PDE4DIP-003	KNOWN	basic|CCDS	protein_coding	PDE4DIP	HGNC	protein_coding	OTTHUMT00000038858.2	C	NM_022359		144864276	-1	no_errors	ENST00000369356	ensembl	human	known	70_37	missense	SNP	0.000	T
PDGFC	56034	genome.wustl.edu	37	4	157688963	157688963	+	Nonsense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:157688963G>A	ENST00000502773.1	-	5	1373	c.883C>T	c.(883-885)Caa>Taa	p.Q295*	PDGFC_ENST00000422544.2_Intron|PDGFC_ENST00000541126.1_Nonsense_Mutation_p.Q132*|PDGFC_ENST00000504672.1_5'UTR|PDGFC_ENST00000542208.1_Nonsense_Mutation_p.Q140*	NM_016205.2	NP_057289.1	Q9NRA1	PDGFC_HUMAN	platelet derived growth factor C	295					activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|cellular response to amino acid stimulus (GO:0071230)|central nervous system development (GO:0007417)|organ morphogenesis (GO:0009887)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell division (GO:0051781)|positive regulation of DNA replication (GO:0045740)|positive regulation of fibroblast proliferation (GO:0048146)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	platelet-derived growth factor receptor binding (GO:0005161)|protein homodimerization activity (GO:0042803)	p.Q295*(1)		central_nervous_system(1)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(180;0.24)	Renal(120;0.0458)		KIRC - Kidney renal clear cell carcinoma(143;0.08)|Kidney(143;0.0977)|COAD - Colon adenocarcinoma(41;0.212)		GGGACACATTGACATTCATTG	0.403																																																	1	Substitution - Nonsense(1)	cervix(1)											135.0	125.0	128.0					4																	157688963		2203	4300	6503	SO:0001587	stop_gained	56034			AF091434	CCDS3795.1	4q32	2008-02-05			ENSG00000145431	ENSG00000145431			8801	protein-coding gene	gene with protein product		608452				10858496, 10858548	Standard	NM_016205		Approved	SCDGF, fallotein	uc003iph.2	Q9NRA1	OTTHUMG00000161803	ENST00000502773.1:c.883C>T	4.37:g.157688963G>A	ENSP00000422464:p.Gln295*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DU34|B9EGR8|Q4W5M9|Q9UL22	Nonsense_Mutation	SNP	pfam_CUB,pfam_PD_growth_factor,superfamily_CUB,smart_CUB,smart_PD_growth_factor,pfscan_CUB,pfscan_PD_growth_factor	p.Q295*	ENST00000502773.1	37	c.883	CCDS3795.1	4	.	.	.	.	.	.	.	.	.	.	G	39	7.660505	0.98419	.	.	ENSG00000145431	ENST00000502773;ENST00000541126;ENST00000542208	.	.	.	5.56	5.56	0.83823	.	0.115412	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	-4.7334	19.5347	0.95244	0.0:0.0:1.0:0.0	.	.	.	.	X	295;132;140	.	ENSP00000422464:Q295X	Q	-	1	0	PDGFC	157908413	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.854000	0.86942	2.617000	0.88574	0.650000	0.86243	CAA	PDGFC	-	pfam_PD_growth_factor,smart_PD_growth_factor,pfscan_PD_growth_factor		0.403	PDGFC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFC	HGNC	protein_coding	OTTHUMT00000366123.1	G			157688963	-1	no_errors	ENST00000502773	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PHF3	23469	genome.wustl.edu	37	6	64422276	64422276	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr6:64422276C>T	ENST00000262043.3	+	16	5132	c.4792C>T	c.(4792-4794)Cag>Tag	p.Q1598*	PHF3_ENST00000393387.1_Nonsense_Mutation_p.Q1598*			Q92576	PHF3_HUMAN	PHD finger protein 3	1598					multicellular organismal development (GO:0007275)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)	p.Q1598*(1)		breast(7)|cervix(2)|endometrium(8)|kidney(7)|large_intestine(18)|lung(21)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(6)	75	all_cancers(3;0.0241)|all_epithelial(2;0.00306)|Lung NSC(77;0.121)		LUSC - Lung squamous cell carcinoma(74;0.0644)|Lung(124;0.148)			AAGACAGCTTCAGGAAGATCA	0.338																																					GBM(135;136 1820 29512 34071 46235)												1	Substitution - Nonsense(1)	cervix(1)											59.0	56.0	57.0					6																	64422276		2203	4300	6503	SO:0001587	stop_gained	23469			AF091622	CCDS4966.1	6q12	2013-09-24			ENSG00000118482	ENSG00000118482		"""Zinc fingers, PHD-type"""	8921	protein-coding gene	gene with protein product		607789				11856869	Standard	XM_005248701		Approved		uc003pep.1	Q92576	OTTHUMG00000014952	ENST00000262043.3:c.4792C>T	6.37:g.64422276C>T	ENSP00000262043:p.Gln1598*	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KFI8|Q14CR5|Q5CZI1|Q5T1T6|Q9NQ16|Q9UI45	Nonsense_Mutation	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.Q1598*	ENST00000262043.3	37	c.4792	CCDS4966.1	6	.	.	.	.	.	.	.	.	.	.	C	37	6.389272	0.97529	.	.	ENSG00000118482	ENST00000262043;ENST00000393387	.	.	.	5.25	3.28	0.37604	.	0.542942	0.13868	N	0.357214	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	1.3127	13.3619	0.60661	0.0:0.6987:0.3013:0.0	.	.	.	.	X	1598	.	.	Q	+	1	0	PHF3	64480235	0.000000	0.05858	0.067000	0.19924	0.386000	0.30323	-0.048000	0.11944	1.497000	0.48584	0.591000	0.81541	CAG	PHF3	-	NULL		0.338	PHF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHF3	HGNC	protein_coding	OTTHUMT00000041086.2	C			64422276	+1	no_errors	ENST00000262043	ensembl	human	known	70_37	nonsense	SNP	0.054	T
PHKA1	5255	genome.wustl.edu	37	X	71825423	71825423	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chrX:71825423C>T	ENST00000373542.4	-	24	2812	c.2653G>A	c.(2653-2655)Gaa>Aaa	p.E885K	PHKA1_ENST00000373539.3_Missense_Mutation_p.E885K|PHKA1_ENST00000541944.1_Missense_Mutation_p.E826K|PHKA1_ENST00000339490.3_Missense_Mutation_p.E885K|PHKA1_ENST00000373545.3_Missense_Mutation_p.E826K	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	885					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)	p.E885K(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					ATATCCCCTTCACTGGCTTCA	0.378																																																	1	Substitution - Missense(1)	cervix(1)											77.0	68.0	71.0					X																	71825423		2203	4300	6503	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.2653G>A	X.37:g.71825423C>T	ENSP00000362643:p.Glu885Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.E885K	ENST00000373542.4	37	c.2653	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	C	19.16	3.774364	0.70107	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.89196	-2.48;-2.48;-2.48;-2.48;-2.48	6.01	6.01	0.97437	Glycoside hydrolase 15-related (1);	0.046842	0.85682	D	0.000000	D	0.86723	0.6001	M	0.63428	1.95	0.53005	D	0.999963	P;B;B	0.35050	0.482;0.009;0.1	B;B;B	0.31686	0.134;0.022;0.06	D	0.84507	0.0620	10	0.24483	T	0.36	-24.3668	16.6646	0.85249	0.0:1.0:0.0:0.0	.	826;885;885	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	K	826;885;826;885;885	ENSP00000362646:E826K;ENSP00000362643:E885K;ENSP00000441251:E826K;ENSP00000342469:E885K;ENSP00000362640:E885K	ENSP00000342469:E885K	E	-	1	0	PHKA1	71742148	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.655000	0.67981	2.544000	0.85801	0.594000	0.82650	GAA	PHKA1	-	pfam_Glyco_hydro_15		0.378	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	C			71825423	-1	no_errors	ENST00000373539	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC25A22	79751	genome.wustl.edu	37	11	800182	800182	+	5'Flank	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr11:800182C>T	ENST00000531214.1	-	0	0				PIDD_ENST00000411829.2_Silent_p.Q724Q|PIDD_ENST00000347755.5_Silent_p.Q741Q	NM_001191060.1	NP_001177989.1	Q9H936	GHC1_HUMAN	solute carrier family 25 (mitochondrial carrier: glutamate), member 22						L-glutamate transport (GO:0015813)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	L-glutamate transmembrane transporter activity (GO:0005313)|symporter activity (GO:0015293)	p.Q741Q(1)		endometrium(1)|kidney(1)|lung(2)|urinary_tract(1)	5		all_cancers(49;4.75e-06)|all_epithelial(84;0.00204)|Breast(177;0.00234)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;6.27e-26)|Epithelial(43;4.84e-25)|OV - Ovarian serous cystadenocarcinoma(40;2.72e-19)|BRCA - Breast invasive adenocarcinoma(625;4.23e-05)|Lung(200;0.0576)|LUSC - Lung squamous cell carcinoma(625;0.0703)		CGCCCTTCCTCTGCCGGGCAG	0.697																																					Colon(93;848 1468 3270 23355 49636)												1	Substitution - coding silent(1)	cervix(1)											15.0	17.0	16.0					11																	800182		2190	4290	6480	SO:0001631	upstream_gene_variant	55367			AJ428202	CCDS7715.1	11p15.5	2013-05-22			ENSG00000177542	ENSG00000177542		"""Solute carriers"""	19954	protein-coding gene	gene with protein product		609302				11897791	Standard	NM_024698		Approved	GC1, FLJ13044, NET44, EIEE3	uc001lrj.3	Q9H936	OTTHUMG00000133310		11.37:g.800182C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K366|C9J1H6|E9PJD3|E9PKB2|E9PL68|E9PN26|E9PNQ3|E9PP01|E9PR97|Q8TBU8	Silent	SNP	pfam_Peptidase_S68_pidd,pfam_Death,pfam_Leu-rich_rpt,pfam_ZU5,superfamily_DEATH-like,smart_Leu-rich_rpt_typical-subtyp,smart_Death,pfscan_Death,pfscan_ZU5	p.Q741	ENST00000531214.1	37	c.2223	CCDS7715.1	11																																																																																			PIDD	-	NULL		0.697	SLC25A22-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PIDD	HGNC	protein_coding	OTTHUMT00000384124.1	C			800182	-1	no_errors	ENST00000347755	ensembl	human	known	70_37	silent	SNP	1.000	T
PIK3C2B	5287	genome.wustl.edu	37	1	204403616	204403616	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:204403616C>G	ENST00000367187.3	-	25	4193	c.3637G>C	c.(3637-3639)Gat>Cat	p.D1213H	RP11-739N20.2_ENST00000443515.1_RNA|PIK3C2B_ENST00000424712.2_Missense_Mutation_p.D1185H	NM_002646.3	NP_002637.3	O00750	P3C2B_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 beta	1213	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein kinase B signaling (GO:0043491)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|lipid kinase activity (GO:0001727)|phosphatidylinositol binding (GO:0035091)	p.D1213H(1)		breast(3)|central_nervous_system(1)|cervix(2)|endometrium(4)|large_intestine(11)|lung(24)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	52	all_cancers(21;0.00347)|all_neural(3;0.0218)|Glioma(3;0.0382)|all_epithelial(62;0.171)|Breast(84;0.179)|Prostate(682;0.227)		GBM - Glioblastoma multiforme(2;2.69e-45)|all cancers(3;1.66e-30)|KIRC - Kidney renal clear cell carcinoma(13;0.0584)|Kidney(21;0.0934)|BRCA - Breast invasive adenocarcinoma(75;0.143)|Epithelial(59;0.193)			CGGCCAAAATCAATGTGGAAC	0.537																																																	1	Substitution - Missense(1)	cervix(1)											85.0	65.0	72.0					1																	204403616		2203	4300	6503	SO:0001583	missense	5287			Y11312	CCDS1446.1	1q32	2012-07-13	2012-07-13		ENSG00000133056	ENSG00000133056	2.7.1.154		8972	protein-coding gene	gene with protein product		602838	"""phosphoinositide-3-kinase, class 2, beta polypeptide"""			9144573, 9830063	Standard	NM_002646		Approved	C2-PI3K, PI3K-C2beta	uc001haw.3	O00750	OTTHUMG00000036101	ENST00000367187.3:c.3637G>C	1.37:g.204403616C>G	ENSP00000356155:p.Asp1213His	Somatic		WXS	Illumina HiSeq	Phase_IV	O95666|Q5SW99	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_PI3K_Ras-bd_dom,pfam_Phox,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.D1213H	ENST00000367187.3	37	c.3637	CCDS1446.1	1	.	.	.	.	.	.	.	.	.	.	C	25.8	4.674865	0.88445	.	.	ENSG00000133056	ENST00000367187;ENST00000424712	D;D	0.95238	-3.65;-3.65	5.69	4.78	0.61160	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.048741	0.85682	D	0.000000	D	0.98451	0.9484	H	0.98833	4.345	0.58432	D	0.99999	D;D	0.89917	1.0;0.997	D;D	0.97110	1.0;0.934	D	0.99236	1.0883	10	0.87932	D	0	.	14.3184	0.66468	0.0:0.9278:0.0:0.0722	.	1185;1213	F5GWN5;O00750	.;P3C2B_HUMAN	H	1213;1185	ENSP00000356155:D1213H;ENSP00000400561:D1185H	ENSP00000356155:D1213H	D	-	1	0	PIK3C2B	202670239	1.000000	0.71417	0.998000	0.56505	0.994000	0.84299	7.718000	0.84743	1.414000	0.47017	0.563000	0.77884	GAT	PIK3C2B	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.537	PIK3C2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C2B	HGNC	protein_coding	OTTHUMT00000087965.1	C	NM_002646		204403616	-1	no_errors	ENST00000367187	ensembl	human	known	70_37	missense	SNP	1.000	G
PIK3C3	5289	genome.wustl.edu	37	18	39550410	39550410	+	Missense_Mutation	SNP	G	G	A	rs376188539		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr18:39550410G>A	ENST00000262039.4	+	4	607	c.521G>A	c.(520-522)cGt>cAt	p.R174H	PIK3C3_ENST00000398870.3_Missense_Mutation_p.R111H|PIK3C3_ENST00000586545.1_Missense_Mutation_p.R174H	NM_002647.2	NP_002638.2	Q8NEB9	PK3C3_HUMAN	phosphatidylinositol 3-kinase, catalytic subunit type 3	174	C2 PI3K-type. {ECO:0000255|PROSITE- ProRule:PRU00880}.				autophagic vacuole assembly (GO:0000045)|cytokinesis (GO:0000910)|early endosome to late endosome transport (GO:0045022)|endosome organization (GO:0007032)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|protein processing (GO:0016485)|regulation of protein secretion (GO:0050708)|response to leucine (GO:0043201)|small molecule metabolic process (GO:0044281)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	axoneme (GO:0005930)|cytosol (GO:0005829)|late endosome (GO:0005770)|membrane (GO:0016020)|midbody (GO:0030496)|phagocytic vesicle (GO:0045335)|phosphatidylinositol 3-kinase complex (GO:0005942)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|protein kinase activity (GO:0004672)	p.R174H(1)		breast(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(10)|liver(1)|lung(25)|ovary(1)|skin(2)|urinary_tract(1)	49						CAGATGAGCCGTCTTGCCAAG	0.408										TSP Lung(28;0.18)			G|||	1	0.000199681	0.0008	0.0	5008	,	,		15988	0.0		0.0	False		,,,				2504	0.0				NSCLC(37;552 1060 2683 16430 37914)												1	Substitution - Missense(1)	cervix(1)						G	HIS/ARG	0,4406		0,0,2203	77.0	70.0	72.0		521	4.6	1.0	18		72	1,8599	1.2+/-3.3	0,1,4299	no	missense	PIK3C3	NM_002647.2	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	174/888	39550410	1,13005	2203	4300	6503	SO:0001583	missense	5289			Z46973	CCDS11920.1	18q12.3	2012-07-13	2012-07-13		ENSG00000078142	ENSG00000078142	2.7.1.137		8974	protein-coding gene	gene with protein product		602609	"""phosphoinositide-3-kinase, class 3"""			7628435	Standard	NM_002647		Approved	Vps34	uc002lap.3	Q8NEB9	OTTHUMG00000132593	ENST00000262039.4:c.521G>A	18.37:g.39550410G>A	ENSP00000262039:p.Arg174His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15134	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_C2_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pirsf_PI3K_Vps34,pfscan_PI3/4_kinase_cat_dom	p.R174H	ENST00000262039.4	37	c.521	CCDS11920.1	18	.	.	.	.	.	.	.	.	.	.	G	27.5	4.834693	0.91036	0.0	1.16E-4	ENSG00000078142	ENST00000262039;ENST00000398870	T;T	0.79352	-1.26;-1.26	4.61	4.61	0.57282	Phosphoinositide 3-kinase, C2 (1);	0.000000	0.85682	D	0.000000	D	0.90349	0.6980	M	0.91818	3.245	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.969	D	0.92663	0.6143	9	.	.	.	.	17.8031	0.88593	0.0:0.0:1.0:0.0	.	111;174	A8MYT4;Q8NEB9	.;PK3C3_HUMAN	H	174;111	ENSP00000262039:R174H;ENSP00000381845:R111H	.	R	+	2	0	PIK3C3	37804408	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.775000	0.98995	2.257000	0.74773	0.557000	0.71058	CGT	PIK3C3	-	pfam_PI3K_C2_dom,pirsf_PI3K_Vps34		0.408	PIK3C3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIK3C3	HGNC	protein_coding	OTTHUMT00000255804.1	G	NM_002647		39550410	+1	no_errors	ENST00000262039	ensembl	human	known	70_37	missense	SNP	1.000	A
PMM2	5373	genome.wustl.edu	37	16	8906893	8906893	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr16:8906893G>A	ENST00000268261.4	+	7	635	c.569G>A	c.(568-570)aGa>aAa	p.R190K	PMM2_ENST00000539622.1_Missense_Mutation_p.R107K|PMM2_ENST00000537352.1_Missense_Mutation_p.R65K|PMM2_ENST00000566983.1_Missense_Mutation_p.R163K|PMM2_ENST00000569958.1_Missense_Mutation_p.R99K	NM_000303.2	NP_000294.1	O15305	PMM2_HUMAN	phosphomannomutase 2	190					cellular protein metabolic process (GO:0044267)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|GDP-mannose biosynthetic process (GO:0009298)|mannose biosynthetic process (GO:0019307)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|neuronal cell body (GO:0043025)	phosphomannomutase activity (GO:0004615)	p.R190K(1)		breast(3)|cervix(1)|endometrium(2)|large_intestine(1)|ovary(1)|skin(1)	9						TGGGACAAGAGATACTGTCTG	0.458																																					Esophageal Squamous(154;1308 1842 2827 29799 42829)												1	Substitution - Missense(1)	cervix(1)											149.0	130.0	136.0					16																	8906893		2197	4300	6497	SO:0001583	missense	5373			BC008310	CCDS10536.1	16p13	2012-09-06			ENSG00000140650	ENSG00000140650	5.3.1.8		9115	protein-coding gene	gene with protein product	"""phosphomannose isomerase 1"""	601785		CDG1		9140401	Standard	NM_000303		Approved	CDGS, CDG1a, PMI, PMI1	uc002czf.4	O15305	OTTHUMG00000129697	ENST00000268261.4:c.569G>A	16.37:g.8906893G>A	ENSP00000268261:p.Arg190Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K672|B7Z6R0|D3DUF3	Missense_Mutation	SNP	pfam_PMM,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB	p.R190K	ENST00000268261.4	37	c.569	CCDS10536.1	16	.	.	.	.	.	.	.	.	.	.	G	19.04	3.750921	0.69533	.	.	ENSG00000140650	ENST00000268261;ENST00000539622;ENST00000537352	D;D;D	0.98400	-4.91;-4.91;-4.91	4.8	4.8	0.61643	HAD-like domain (2);	0.047044	0.85682	D	0.000000	D	0.98460	0.9487	M	0.79258	2.445	0.49213	D	0.999766	P;P;D	0.55605	0.89;0.845;0.972	P;P;P	0.60286	0.649;0.636;0.872	D	0.98905	1.0778	10	0.72032	D	0.01	.	12.3599	0.55197	0.0:0.17:0.83:0.0	.	43;107;190	B7Z922;F5H0W0;O15305	.;.;PMM2_HUMAN	K	190;107;65	ENSP00000268261:R190K;ENSP00000445879:R107K;ENSP00000438359:R65K	ENSP00000268261:R190K	R	+	2	0	PMM2	8814394	1.000000	0.71417	0.892000	0.35008	0.355000	0.29361	5.756000	0.68757	2.216000	0.71823	0.591000	0.81541	AGA	PMM2	-	pfam_PMM,pfam_HAD-SF_hydro-like_3,superfamily_HAD-like_dom,tigrfam_HAD-SF_hydro_IIB		0.458	PMM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PMM2	HGNC	protein_coding	OTTHUMT00000251904.1	G	NM_000303		8906893	+1	no_errors	ENST00000268261	ensembl	human	known	70_37	missense	SNP	0.992	A
PNPLA6	10908	genome.wustl.edu	37	19	7619550	7619550	+	Nonsense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:7619550C>T	ENST00000221249.6	+	24	2892	c.2461C>T	c.(2461-2463)Cga>Tga	p.R821*	PNPLA6_ENST00000450331.3_Nonsense_Mutation_p.R821*|PNPLA6_ENST00000414982.3_Nonsense_Mutation_p.R869*|PNPLA6_ENST00000600737.1_Nonsense_Mutation_p.R859*|PNPLA6_ENST00000545201.2_Nonsense_Mutation_p.R794*	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	860					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)	p.R821*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						GCGCTGCCTGCGACAGGCCGA	0.682																																																	1	Substitution - Nonsense(1)	cervix(1)											69.0	64.0	66.0					19																	7619550		2203	4298	6501	SO:0001587	stop_gained	10908			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.2461C>T	19.37:g.7619550C>T	ENSP00000221249:p.Arg821*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Nonsense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.R869*	ENST00000221249.6	37	c.2605	CCDS32891.1	19	.	.	.	.	.	.	.	.	.	.	c	40	8.515295	0.98845	.	.	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	.	.	.	4.98	4.98	0.66077	.	0.058685	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.8384	0.78818	0.0:1.0:0.0:0.0	.	.	.	.	X	821;794;869;821	.	ENSP00000221249:R821X	R	+	1	2	PNPLA6	7525550	1.000000	0.71417	0.988000	0.46212	0.024000	0.10985	7.508000	0.81686	2.591000	0.87537	0.555000	0.69702	CGA	PNPLA6	-	NULL		0.682	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000459275.1	C	NM_006702		7619550	+1	no_errors	ENST00000414982	ensembl	human	known	70_37	nonsense	SNP	1.000	T
PPP4R1	9989	genome.wustl.edu	37	18	9570273	9570273	+	Silent	SNP	T	T	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr18:9570273T>C	ENST00000400556.3	-	11	1528	c.1455A>G	c.(1453-1455)ccA>ccG	p.P485P	PPP4R1_ENST00000400555.3_Silent_p.P468P	NM_001042388.2	NP_001035847.1	Q8TF05	PP4R1_HUMAN	protein phosphatase 4, regulatory subunit 1	485					dephosphorylation (GO:0016311)|protein phosphorylation (GO:0006468)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	protein phosphatase 4 complex (GO:0030289)	protein phosphatase type 4 regulator activity (GO:0030362)	p.P485P(1)		large_intestine(1)|skin(2)	3						ATTCTTCCTCTGGTCCCTCTG	0.483																																					Melanoma(188;1232 2082 5061 11948 35994)												1	Substitution - coding silent(1)	cervix(1)											85.0	79.0	81.0					18																	9570273		1829	4092	5921	SO:0001819	synonymous_variant	9989			AF111106	CCDS42412.1, CCDS42413.1	18p11.22	2010-06-18			ENSG00000154845	ENSG00000154845		"""Serine/threonine phosphatases / Protein phosphatase 4, regulatory subunits"""	9320	protein-coding gene	gene with protein product		604908				10026142	Standard	NM_001042388		Approved	PP4R1	uc002koe.2	Q8TF05	OTTHUMG00000137466	ENST00000400556.3:c.1455A>G	18.37:g.9570273T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q99774|Q9UNQ7	Silent	SNP	pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.P485	ENST00000400556.3	37	c.1455	CCDS42412.1	18																																																																																			PPP4R1	-	superfamily_ARM-type_fold		0.483	PPP4R1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP4R1	HGNC	protein_coding	OTTHUMT00000268571.1	T	NM_005134		9570273	-1	no_errors	ENST00000400556	ensembl	human	known	70_37	silent	SNP	0.143	C
PRRC2B	84726	genome.wustl.edu	37	9	134362661	134362661	+	Silent	SNP	C	C	T	rs368857240		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr9:134362661C>T	ENST00000357304.4	+	26	6019	c.5964C>T	c.(5962-5964)ttC>ttT	p.F1988F	PRRC2B_ENST00000405995.1_Silent_p.F1294F|SNORD62A_ENST00000428514.1_RNA|PRRC2B_ENST00000372249.1_Silent_p.F85F|PRRC2B_ENST00000458550.1_Silent_p.F1294F	NM_013318.3	NP_037450.2	Q5JSZ5	PRC2B_HUMAN	proline-rich coiled-coil 2B	1988							poly(A) RNA binding (GO:0044822)	p.F1988F(2)		cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(20)|ovary(2)	44						AGGAGATCTTCAGCTCCTTGC	0.612																																																	2	Substitution - coding silent(2)	cervix(2)						C		0,4054		0,0,2027	44.0	49.0	47.0		5964	4.3	1.0	9		47	2,8374		0,2,4186	no	coding-synonymous	PRRC2B	NM_013318.3		0,2,6213	TT,TC,CC		0.0239,0.0,0.0161		1988/2230	134362661	2,12428	2027	4188	6215	SO:0001819	synonymous_variant	84726			AB011087	CCDS48044.1	9q34.13	2010-12-09	2010-12-09	2010-12-09	ENSG00000130723	ENSG00000130723			28121	protein-coding gene	gene with protein product			"""KIAA0515"", ""HLA-B associated transcript 2-like"", ""HLA-B associated transcript 2-like 1"""	KIAA0515, BAT2L, BAT2L1		9628581	Standard	NM_013318		Approved	MGC10526, LQFBS-1	uc004can.4	Q5JSZ5	OTTHUMG00000020827	ENST00000357304.4:c.5964C>T	9.37:g.134362661C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60270|Q5JSZ7|Q66VZ2|Q68CR0|Q96EI9|Q9H683	Silent	SNP	pfam_BAT2_N	p.F1988	ENST00000357304.4	37	c.5964	CCDS48044.1	9																																																																																			PRRC2B	-	NULL		0.612	PRRC2B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2B	HGNC	protein_coding		C			134362661	+1	no_errors	ENST00000357304	ensembl	human	known	70_37	silent	SNP	1.000	T
PSMA8	143471	genome.wustl.edu	37	18	23758844	23758844	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr18:23758844G>C	ENST00000308268.6	+	5	635	c.546G>C	c.(544-546)aaG>aaC	p.K182N	PSMA8_ENST00000343848.6_Missense_Mutation_p.K138N|PSMA8_ENST00000415576.2_Missense_Mutation_p.K176N	NM_001025096.1|NM_144662.2	NP_001020267.1|NP_653263.2	Q8TAA3	PSA7L_HUMAN	proteasome (prosome, macropain) subunit, alpha type, 8	182					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|proteasome core complex, alpha-subunit complex (GO:0019773)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.K182N(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|skin(2)	16	all_cancers(21;0.000585)|Lung NSC(5;0.00148)|all_lung(6;0.0038)|Ovarian(20;0.124)		OV - Ovarian serous cystadenocarcinoma(3;0.000324)|all cancers(3;0.000954)|LUSC - Lung squamous cell carcinoma(2;0.181)			TTCTAGAAAAGAATTACACAG	0.318																																																	1	Substitution - Missense(1)	cervix(1)											43.0	45.0	44.0					18																	23758844		2203	4297	6500	SO:0001583	missense	143471			BC047355	CCDS32808.1, CCDS45842.1, CCDS45843.1	18q11.2	2006-12-18				ENSG00000154611		"""Proteasome (prosome, macropain) subunits"""	22985	protein-coding gene	gene with protein product							Standard	XM_005258199		Approved	MGC26605, PSMA7L	uc002kvq.3	Q8TAA3		ENST00000308268.6:c.546G>C	18.37:g.23758844G>C	ENSP00000311121:p.Lys182Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ75|Q8IVP4|Q8TA98|Q8TAA2	Missense_Mutation	SNP	pfam_Proteasome_sua/b,pfam_Proteasome_asu_N,smart_Proteasome_asu_N	p.K182N	ENST00000308268.6	37	c.546	CCDS32808.1	18	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932287	0.52866	.	.	ENSG00000154611	ENST00000308268;ENST00000415576;ENST00000343848;ENST00000538664;ENST00000536423	T;T;T	0.49139	0.79;0.79;0.79	5.67	0.111	0.14619	.	0.000000	0.85682	D	0.000000	T	0.63236	0.2494	M	0.80982	2.52	0.53688	D	0.999976	P;D;P;B	0.61697	0.589;0.99;0.799;0.14	B;D;B;B	0.64776	0.221;0.929;0.411;0.23	T	0.64939	-0.6289	10	0.72032	D	0.01	-17.6661	10.1191	0.42609	0.4298:0.0:0.5702:0.0	.	150;182;176;138	F5GY34;Q8TAA3;Q8TAA3-5;Q8TAA3-2	.;PSA7L_HUMAN;.;.	N	182;176;138;150;138	ENSP00000311121:K182N;ENSP00000409284:K176N;ENSP00000345584:K138N	ENSP00000311121:K182N	K	+	3	2	PSMA8	22012842	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	1.920000	0.40025	0.062000	0.16340	0.650000	0.86243	AAG	PSMA8	-	pfam_Proteasome_sua/b		0.318	PSMA8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PSMA8	HGNC	protein_coding	OTTHUMT00000446255.1	G	NM_144662		23758844	+1	no_errors	ENST00000308268	ensembl	human	known	70_37	missense	SNP	1.000	C
REPIN1	29803	genome.wustl.edu	37	7	150069177	150069177	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr7:150069177C>T	ENST00000425389.2	+	1	925	c.847C>T	c.(847-849)Cgg>Tgg	p.R283W	RP4-584D14.5_ENST00000488310.1_RNA|REPIN1_ENST00000466559.1_3'UTR|REPIN1_ENST00000444957.1_Missense_Mutation_p.R283W|REPIN1_ENST00000479668.1_3'UTR|REPIN1_ENST00000540729.1_Missense_Mutation_p.R283W|REPIN1_ENST00000489432.2_Missense_Mutation_p.R340W|REPIN1_ENST00000397281.2_Missense_Mutation_p.R283W	NM_014374.3	NP_055189.2	Q9BWE0	REPI1_HUMAN	replication initiator 1	283					DNA replication (GO:0006260)|regulation of fatty acid transport (GO:2000191)|regulation of glucose import in response to insulin stimulus (GO:2001273)	cytosolic ribosome (GO:0022626)|lipid particle (GO:0005811)|nuclear membrane (GO:0031965)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.R283W(1)|p.R340W(1)		cervix(2)|lung(7)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	14	Ovarian(565;0.183)|Melanoma(164;0.226)		OV - Ovarian serous cystadenocarcinoma(82;0.011)			GACTTCGCACCGGCGCATCCA	0.637																																																	2	Substitution - Missense(2)	cervix(2)											18.0	23.0	21.0					7																	150069177		2166	4279	6445	SO:0001583	missense	29803			AF201303	CCDS43677.1, CCDS47745.1	7q36.1	2013-01-08	2003-08-07	2003-08-08				"""Zinc fingers, C2H2-type"""	17922	protein-coding gene	gene with protein product	"""replication initiation region protein (60kD)"", ""zinc finger protein AP4"", ""zinc finger protein 464 (RIP60)"""		"""zinc finger protein 464 (RIP60)"""	ZNF464		10606657	Standard	NM_013400		Approved	RIP60, AP4, H_DJ0584D14.12, Zfp464	uc010lpr.1	Q9BWE0		ENST00000425389.2:c.847C>T	7.37:g.150069177C>T	ENSP00000388287:p.Arg283Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J3L7|D3DWZ1|Q7LE03|Q9BUZ6|Q9NZH2|Q9UMP5	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R340W	ENST00000425389.2	37	c.1018	CCDS43677.1	7	.	.	.	.	.	.	.	.	.	.	C	16.78	3.216783	0.58452	.	.	ENSG00000214022	ENST00000540729;ENST00000397281;ENST00000444957;ENST00000489432;ENST00000475514;ENST00000488943;ENST00000425389	T;T;T;T;T;T;T	0.18810	2.19;2.19;2.19;2.19;2.19;2.19;2.19	4.7	4.7	0.59300	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.45013	0.1321	M	0.67569	2.06	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.991;0.999	T	0.42310	-0.9459	9	0.72032	D	0.01	-14.2937	15.1881	0.73020	0.0:1.0:0.0:0.0	.	340;283	C9J3L7;Q9BWE0	.;REPI1_HUMAN	W	283;283;283;340;342;343;283	ENSP00000445016:R283W;ENSP00000380451:R283W;ENSP00000407714:R283W;ENSP00000417291:R340W;ENSP00000419789:R342W;ENSP00000419872:R343W;ENSP00000388287:R283W	ENSP00000380451:R283W	R	+	1	2	REPIN1	149700110	0.114000	0.22134	1.000000	0.80357	0.915000	0.54546	0.490000	0.22403	2.440000	0.82611	0.462000	0.41574	CGG	REPIN1	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.637	REPIN1-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	REPIN1	HGNC	protein_coding	OTTHUMT00000376940.1	C	NM_014374		150069177	+1	no_errors	ENST00000489432	ensembl	human	known	70_37	missense	SNP	0.994	T
RNF149	284996	genome.wustl.edu	37	2	101905451	101905453	+	In_Frame_Del	DEL	TAA	TAA	-			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	TAA	TAA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:101905451_101905453delTAA	ENST00000295317.3	-	4	952_954	c.845_847delTTA	c.(844-849)attaga>aga	p.I282del		NM_173647.3	NP_775918.2	Q8NC42	RN149_HUMAN	ring finger protein 149	282					cellular response to drug (GO:0035690)|negative regulation of MAPK cascade (GO:0043409)|regulation of protein stability (GO:0031647)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	12						GGCAGAATTCTAATAATATCCTT	0.281																																					Colon(25;331 612 6521 7355 31028)												0																																										SO:0001651	inframe_deletion	284996			AK074985	CCDS2051.1	2q12.1	2013-01-09			ENSG00000163162	ENSG00000163162		"""RING-type (C3HC4) zinc fingers"""	23137	protein-coding gene	gene with protein product							Standard	NM_173647		Approved	FLJ90504	uc002taz.2	Q8NC42	OTTHUMG00000130685	ENST00000295317.3:c.845_847delTTA	2.37:g.101905454_101905456delTAA	ENSP00000295317:p.Ile282del	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53S14|Q8N5I8|Q8NBY5|Q8WUU3	In_Frame_Del	DEL	pfam_Protease-assoc_domain,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.I282in_frame_del	ENST00000295317.3	37	c.847_845	CCDS2051.1	2																																																																																			RNF149	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.281	RNF149-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF149	HGNC	protein_coding	OTTHUMT00000253180.2	TAA	NM_173647		101905453	-1	no_errors	ENST00000295317	ensembl	human	known	70_37	in_frame_del	DEL	0.999:0.991:1.000	-
ROBO1	6091	genome.wustl.edu	37	3	78734954	78734954	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr3:78734954G>A	ENST00000464233.1	-	10	1397	c.1284C>T	c.(1282-1284)tgC>tgT	p.C428C	ROBO1_ENST00000467549.1_Silent_p.C392C|ROBO1_ENST00000436010.2_Silent_p.C389C|ROBO1_ENST00000495273.1_Silent_p.C392C	NM_002941.3	NP_002932.1	Q9Y6N7	ROBO1_HUMAN	roundabout, axon guidance receptor, homolog 1 (Drosophila)	428	Ig-like C2-type 4.				activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|axon guidance (GO:0007411)|axon midline choice point recognition (GO:0016199)|cell adhesion (GO:0007155)|cell migration involved in sprouting angiogenesis (GO:0002042)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|homophilic cell adhesion (GO:0007156)|mammary duct terminal end bud growth (GO:0060763)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|negative regulation of negative chemotaxis (GO:0050925)|nervous system development (GO:0007399)|positive regulation of axonogenesis (GO:0050772)|Roundabout signaling pathway (GO:0035385)	axolemma (GO:0030673)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|identical protein binding (GO:0042802)|LRR domain binding (GO:0030275)	p.C428C(2)|p.C405C(1)|p.C392C(1)		breast(1)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(2)|lung(25)|urinary_tract(1)	44		Lung SC(41;0.0257)|Lung NSC(201;0.0439)		LUSC - Lung squamous cell carcinoma(21;0.008)|Epithelial(33;0.00999)|Lung(72;0.0177)|BRCA - Breast invasive adenocarcinoma(55;0.0274)		TTAAAGTCTGGCAGATGTAAT	0.398																																																	4	Substitution - coding silent(4)	cervix(4)											65.0	64.0	64.0					3																	78734954		1907	4110	6017	SO:0001819	synonymous_variant	6091			AF040990	CCDS46872.1, CCDS46872.2, CCDS54610.1, CCDS54611.1	3p12.3	2013-02-11	2001-11-28		ENSG00000169855	ENSG00000169855		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	10249	protein-coding gene	gene with protein product		602430	"""roundabout (axon guidance receptor, Drosophila) homolog 1"""			9458045, 9608531	Standard	NM_002941		Approved	DUTT1, FLJ21882, SAX3	uc003dqe.2	Q9Y6N7	OTTHUMG00000158843	ENST00000464233.1:c.1284C>T	3.37:g.78734954G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RXI1|D3DU36|E9PD49|Q1RMC7|Q7Z300|Q9BUS7	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.C428	ENST00000464233.1	37	c.1284	CCDS54611.1	3																																																																																			ROBO1	-	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like		0.398	ROBO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ROBO1	HGNC	protein_coding	OTTHUMT00000352610.1	G	NM_002941		78734954	-1	no_errors	ENST00000464233	ensembl	human	known	70_37	silent	SNP	1.000	A
RP1L1	94137	genome.wustl.edu	37	8	10480214	10480214	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr8:10480214C>T	ENST00000382483.3	-	2	721	c.498G>A	c.(496-498)caG>caA	p.Q166Q	RP1L1_ENST00000329335.3_5'UTR	NM_178857.5	NP_849188.4	Q8IWN7	RP1L1_HUMAN	retinitis pigmentosa 1-like 1	166	Doublecortin 2. {ECO:0000255|PROSITE- ProRule:PRU00072}.				cell projection organization (GO:0030030)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|visual perception (GO:0007601)	axoneme (GO:0005930)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)		p.Q166Q(1)		breast(5)|central_nervous_system(2)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(16)|lung(82)|ovary(8)|prostate(5)|skin(6)|upper_aerodigestive_tract(4)|urinary_tract(3)	148				COAD - Colon adenocarcinoma(149;0.0811)		GAACCACTGTCTGCTGGAGGC	0.562																																																	1	Substitution - coding silent(1)	cervix(1)											106.0	102.0	103.0					8																	10480214		1962	4149	6111	SO:0001819	synonymous_variant	94137			AY168346	CCDS43708.1	8p23.1	2011-12-06			ENSG00000183638	ENSG00000183638			15946	protein-coding gene	gene with protein product		608581				12634863	Standard	NM_178857		Approved	DCDC4B	uc003wtc.3	Q8IWN7	OTTHUMG00000163806	ENST00000382483.3:c.498G>A	8.37:g.10480214C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SQ1|Q8IWN8|Q8IWN9|Q8IWP0|Q8IWP1|Q8IWP2	Silent	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.Q166	ENST00000382483.3	37	c.498	CCDS43708.1	8																																																																																			RP1L1	-	superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom		0.562	RP1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1L1	HGNC	protein_coding	OTTHUMT00000375673.1	C			10480214	-1	no_errors	ENST00000382483	ensembl	human	known	70_37	silent	SNP	0.180	T
RRH	10692	genome.wustl.edu	37	4	110765315	110765315	+	Missense_Mutation	SNP	G	G	C	rs144856430	byFrequency	TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:110765315G>C	ENST00000317735.4	+	7	1010	c.976G>C	c.(976-978)Gat>Cat	p.D326H		NM_006583.2	NP_006574.1	O14718	OPSX_HUMAN	retinal pigment epithelium-derived rhodopsin homolog	326					G-protein coupled receptor signaling pathway (GO:0007186)|phototransduction (GO:0007602)|protein-chromophore linkage (GO:0018298)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	12		Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00109)		TTTACCCATGGATGTATCTCA	0.358																																																	0													147.0	141.0	143.0					4																	110765315		2203	4300	6503	SO:0001583	missense	10692			AF012270	CCDS3687.1	4q25	2012-08-08			ENSG00000180245	ENSG00000180245		"""GPCR / Class A : Opsin receptors"""	10450	protein-coding gene	gene with protein product	"""peropsin"""	605224				9275222	Standard	NM_006583		Approved	peropsin	uc003hzv.3	O14718	OTTHUMG00000132045	ENST00000317735.4:c.976G>C	4.37:g.110765315G>C	ENSP00000314992:p.Asp326His	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4V2|Q7RTS4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Peropsin,prints_GPCR_Rhodpsn	p.D326H	ENST00000317735.4	37	c.976	CCDS3687.1	4	.	.	.	.	.	.	.	.	.	.	G	9.800	1.180382	0.21787	.	.	ENSG00000180245	ENST00000317735	T	0.37915	1.17	5.9	3.96	0.45880	.	2.486670	0.01820	N	0.033981	T	0.39708	0.1088	L	0.51422	1.61	0.36845	D	0.887583	B	0.29805	0.257	B	0.35353	0.201	T	0.37267	-0.9713	10	0.72032	D	0.01	.	4.6823	0.12741	0.6596:0.0:0.3404:0.0	.	326	O14718	OPSX_HUMAN	H	326	ENSP00000314992:D326H	ENSP00000314992:D326H	D	+	1	0	RRH	110984764	1.000000	0.71417	0.997000	0.53966	0.091000	0.18340	5.019000	0.64060	0.759000	0.33084	-0.136000	0.14681	GAT	RRH	-	prints_Peropsin		0.358	RRH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRH	HGNC	protein_coding	OTTHUMT00000255066.1	G	NM_006583		110765315	+1	no_errors	ENST00000317735	ensembl	human	known	70_37	missense	SNP	0.970	C
SCCPDH	51097	genome.wustl.edu	37	1	246927547	246927547	+	Splice_Site	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:246927547G>A	ENST00000366510.3	+	10	1366		c.e10-1			NM_016002.2	NP_057086.2	Q8NBX0	SCPDL_HUMAN	saccharopine dehydrogenase (putative)							lipid particle (GO:0005811)|membrane (GO:0016020)|midbody (GO:0030496)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)	p.?(1)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|lung(9)|ovary(1)	17	all_cancers(71;6.8e-05)|all_epithelial(71;7.93e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0545)|Lung NSC(105;0.0618)	all_cancers(173;0.0343)	OV - Ovarian serous cystadenocarcinoma(106;0.00323)	GBM - Glioblastoma multiforme(49;0.0896)		CTCCTTCACAGATTGATGCTG	0.403																																																	1	Unknown(1)	cervix(1)											121.0	109.0	113.0					1																	246927547		2203	4300	6503	SO:0001630	splice_region_variant	51097				CCDS31084.1	1q44	2009-11-06			ENSG00000143653	ENSG00000143653			24275	protein-coding gene	gene with protein product						10810093	Standard	NM_016002		Approved	CGI-49, NET11	uc001ibr.3	Q8NBX0	OTTHUMG00000040221	ENST00000366510.3:c.991-1G>A	1.37:g.246927547G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TAR0|Q9Y363	Splice_Site	SNP	-	e10-1	ENST00000366510.3	37	c.991-1	CCDS31084.1	1	.	.	.	.	.	.	.	.	.	.	G	12.94	2.088001	0.36855	.	.	ENSG00000143653	ENST00000366510;ENST00000366509	.	.	.	5.79	5.79	0.91817	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.6515	0.95815	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SCCPDH	244994170	1.000000	0.71417	0.944000	0.38274	0.006000	0.05464	8.052000	0.89448	2.739000	0.93911	0.655000	0.94253	.	SCCPDH	-	-		0.403	SCCPDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCCPDH	HGNC	protein_coding	OTTHUMT00000096902.2	G	NM_016002	Intron	246927547	+1	no_errors	ENST00000366510	ensembl	human	known	70_37	splice_site	SNP	1.000	A
SLC16A5	9121	genome.wustl.edu	37	17	73096514	73096514	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:73096514C>G	ENST00000450736.2	+	4	1171	c.756C>G	c.(754-756)ttC>ttG	p.F252L	SLC16A5_ENST00000329783.4_Missense_Mutation_p.F252L|SLC16A5_ENST00000580123.1_Missense_Mutation_p.F252L|SLC16A5_ENST00000538213.2_Missense_Mutation_p.F292L			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	252					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.F252L(2)		central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TCCTGGGCTTCCCACTGCCAC	0.607																																																	2	Substitution - Missense(2)	cervix(2)											304.0	246.0	266.0					17																	73096514		2203	4300	6503	SO:0001583	missense	9121			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.756C>G	17.37:g.73096514C>G	ENSP00000390564:p.Phe252Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E288	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.F252L	ENST00000450736.2	37	c.756	CCDS11713.1	17	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.520739	0.00967	.	.	ENSG00000170190	ENST00000329783;ENST00000450736;ENST00000538213	T;T;T	0.57907	0.37;0.37;0.37	4.64	0.32	0.15878	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.047591	0.85682	N	0.000000	T	0.33556	0.0867	L	0.27975	0.815	0.26072	N	0.981201	B;P	0.34800	0.288;0.469	B;B	0.38954	0.221;0.286	T	0.35176	-0.9799	10	0.06757	T	0.87	.	8.9905	0.36022	0.0:0.5126:0.0:0.4874	.	292;252	B4E288;O15375	.;MOT6_HUMAN	L	252;252;292	ENSP00000330141:F252L;ENSP00000390564:F252L;ENSP00000440212:F292L	ENSP00000330141:F252L	F	+	3	2	SLC16A5	70608109	0.007000	0.16637	0.002000	0.10522	0.084000	0.17831	0.105000	0.15333	-0.075000	0.12798	-0.993000	0.02533	TTC	SLC16A5	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt		0.607	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	C	NM_004695		73096514	+1	no_errors	ENST00000329783	ensembl	human	known	70_37	missense	SNP	0.333	G
SLC16A5	9121	genome.wustl.edu	37	17	73096595	73096595	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:73096595C>G	ENST00000450736.2	+	4	1252	c.837C>G	c.(835-837)atC>atG	p.I279M	SLC16A5_ENST00000329783.4_Missense_Mutation_p.I279M|SLC16A5_ENST00000580123.1_Missense_Mutation_p.I279M|SLC16A5_ENST00000538213.2_Missense_Mutation_p.I319M			O15375	MOT6_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 5	279					monocarboxylic acid transport (GO:0015718)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	monocarboxylic acid transmembrane transporter activity (GO:0008028)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)	p.I279M(2)		central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	22	all_lung(278;0.226)		LUSC - Lung squamous cell carcinoma(166;0.162)|Lung(188;0.235)		Pyruvic acid(DB00119)	TCATCTCCATCATCGGCTTCA	0.622																																																	2	Substitution - Missense(2)	cervix(2)											487.0	419.0	442.0					17																	73096595		2203	4300	6503	SO:0001583	missense	9121			U59299	CCDS11713.1	17q25.1	2013-07-18	2013-07-18		ENSG00000170190	ENSG00000170190		"""Solute carriers"""	10926	protein-coding gene	gene with protein product		603879	"""solute carrier family 16 (monocarboxylic acid transporters), member 5"", ""solute carrier family 16, member 5 (monocarboxylic acid transporter 6)"""			9425115	Standard	NM_004695		Approved	MCT5, MCT6	uc002jmr.4	O15375	OTTHUMG00000179277	ENST00000450736.2:c.837C>G	17.37:g.73096595C>G	ENSP00000390564:p.Ile279Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E288	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.I279M	ENST00000450736.2	37	c.837	CCDS11713.1	17	.	.	.	.	.	.	.	.	.	.	C	14.29	2.490161	0.44249	.	.	ENSG00000170190	ENST00000329783;ENST00000450736;ENST00000538213	T;T;T	0.61040	0.14;0.14;0.14	4.64	0.828	0.18841	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.154096	0.56097	D	0.000023	T	0.57125	0.2032	M	0.79258	2.445	0.36733	D	0.881812	P;P	0.44309	0.693;0.832	B;B	0.42495	0.311;0.389	T	0.65837	-0.6071	10	0.62326	D	0.03	.	10.0912	0.42447	0.0:0.6423:0.0:0.3577	.	319;279	B4E288;O15375	.;MOT6_HUMAN	M	279;279;319	ENSP00000330141:I279M;ENSP00000390564:I279M;ENSP00000440212:I319M	ENSP00000330141:I279M	I	+	3	3	SLC16A5	70608190	0.968000	0.33430	0.820000	0.32676	0.947000	0.59692	0.794000	0.26958	0.274000	0.22072	0.561000	0.74099	ATC	SLC16A5	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt		0.622	SLC16A5-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	SLC16A5	HGNC	protein_coding	OTTHUMT00000445547.1	C	NM_004695		73096595	+1	no_errors	ENST00000329783	ensembl	human	known	70_37	missense	SNP	0.999	G
SLC9A1	6548	genome.wustl.edu	37	1	27426904	27426904	+	Missense_Mutation	SNP	G	G	A	rs556347900		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr1:27426904G>A	ENST00000263980.3	-	12	2917	c.2342C>T	c.(2341-2343)gCg>gTg	p.A781V	SLC9A1_ENST00000490329.1_5'Flank|SLC9A1_ENST00000545949.1_Missense_Mutation_p.A442V	NM_003047.4	NP_003038.2	P19634	SL9A1_HUMAN	solute carrier family 9, subfamily A (NHE1, cation proton antiporter 1), member 1	781					carbohydrate metabolic process (GO:0005975)|cardiac muscle cell differentiation (GO:0055007)|cell growth (GO:0016049)|cellular response to acidic pH (GO:0071468)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|hydrogen ion transmembrane transport (GO:1902600)|ion transport (GO:0006811)|negative regulation of apoptotic process (GO:0043066)|neuron death (GO:0070997)|positive regulation of action potential (GO:0045760)|positive regulation of cell growth (GO:0030307)|positive regulation of mitochondrial membrane permeability (GO:0035794)|protein oligomerization (GO:0051259)|regulation of intracellular pH (GO:0051453)|regulation of pH (GO:0006885)|regulation of sensory perception of pain (GO:0051930)|regulation of the force of heart contraction (GO:0002026)|response to acidic pH (GO:0010447)|response to drug (GO:0042493)|response to organic cyclic compound (GO:0014070)|small molecule metabolic process (GO:0044281)|sodium ion export (GO:0071436)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	calcium-dependent protein binding (GO:0048306)|sodium:proton antiporter activity (GO:0015385)|solute:proton antiporter activity (GO:0015299)	p.A781V(1)		central_nervous_system(1)|cervix(3)|endometrium(3)|kidney(2)|large_intestine(4)|liver(1)|lung(7)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27				UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;2.19e-50)|OV - Ovarian serous cystadenocarcinoma(117;1.8e-29)|Colorectal(126;7.61e-09)|COAD - Colon adenocarcinoma(152;9.32e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000521)|KIRC - Kidney renal clear cell carcinoma(1967;0.00079)|STAD - Stomach adenocarcinoma(196;0.00125)|READ - Rectum adenocarcinoma(331;0.046)	Amiloride(DB00594)	GTCACTGGGCGCGGGGGTGAA	0.647													g|||	1	0.000199681	0.0008	0.0	5008	,	,		14169	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	cervix(1)											82.0	84.0	83.0					1																	27426904		2203	4300	6503	SO:0001583	missense	6548			M81768	CCDS295.1	1p36.1-p35	2014-06-13	2012-03-22		ENSG00000090020	ENSG00000090020		"""Solute carriers"""	11071	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 143"""	107310	"""solute carrier family 9 (sodium/hydrogen exchanger), isoform 1 (antiporter, Na+/H+, amiloride sensitive)"", ""solute carrier family 9 (sodium/hydrogen exchanger), member 1"""	APNH, NHE1		8283968	Standard	NM_003047		Approved	PPP1R143	uc001bnm.4	P19634	OTTHUMG00000004271	ENST00000263980.3:c.2342C>T	1.37:g.27426904G>A	ENSP00000263980:p.Ala781Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALD6|D3DPL4|Q96EM2	Missense_Mutation	SNP	pfam_Cation/H_exchanger,prints_Na/H_exchanger_1,prints_NaH_exchanger,tigrfam_NaH_exchanger	p.A781V	ENST00000263980.3	37	c.2342	CCDS295.1	1	.	.	.	.	.	.	.	.	.	.	g	8.032	0.761969	0.15914	.	.	ENSG00000090020	ENST00000263980;ENST00000374089;ENST00000545949;ENST00000447808	T;T	0.46819	0.86;1.44	4.06	-0.609	0.11608	.	0.788243	0.11751	N	0.533006	T	0.19846	0.0477	N	0.08118	0	0.09310	N	1	P	0.35944	0.529	B	0.20577	0.03	T	0.09357	-1.0678	10	0.30078	T	0.28	.	8.9778	0.35946	0.0:0.4652:0.4393:0.0954	.	781	P19634	SL9A1_HUMAN	V	781;285;442;202	ENSP00000263980:A781V;ENSP00000445520:A442V	ENSP00000263980:A781V	A	-	2	0	SLC9A1	27299491	0.000000	0.05858	0.038000	0.18304	0.245000	0.25701	-0.100000	0.10990	0.039000	0.15632	-0.241000	0.12123	GCG	SLC9A1	-	NULL		0.647	SLC9A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9A1	HGNC	protein_coding	OTTHUMT00000012336.2	G	NM_003047		27426904	-1	no_errors	ENST00000263980	ensembl	human	known	70_37	missense	SNP	0.002	A
SMG6	23293	genome.wustl.edu	37	17	1964759	1964760	+	3'UTR	INS	-	-	G	rs36097261|rs397730291|rs145926620	byFrequency	TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:1964759_1964760insG	ENST00000263073.6	-	0	4336_4337				SMG6_ENST00000544865.1_3'UTR|SMG6_ENST00000536871.2_3'UTR|SMG6_ENST00000573166.1_5'UTR|SMG6_ENST00000354901.4_3'UTR	NM_017575.4	NP_060045.4	Q86US8	EST1A_HUMAN	SMG6 nonsense mediated mRNA decay factor						gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of dephosphorylation (GO:0035303)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|telomere maintenance (GO:0000723)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	endoribonuclease activity (GO:0004521)|metal ion binding (GO:0046872)|telomeric DNA binding (GO:0042162)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(7)|lung(10)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	45						AACGGTTCCACGGGGGGGGGGC	0.629													|||unknown(HR)	2696	0.538339	0.5234	0.5821	5008	,	,		16576	0.5923		0.5258	False		,,,				2504	0.4847				Melanoma(59;28 1088 11621 25887 46638 50814)												0																																										SO:0001624	3_prime_UTR_variant	23293			AB018275	CCDS11016.1, CCDS58498.1	17p13.3	2013-07-02	2013-07-02	2006-02-16	ENSG00000070366	ENSG00000070366			17809	protein-coding gene	gene with protein product	"""EST1 telomerase component homolog A (S. cerevisiae)"""	610963	"""chromosome 17 open reading frame 31"", ""smg-6 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf31		12676087, 12699629	Standard	NM_017575		Approved	KIAA0732, SMG-6, EST1A	uc002fub.1	Q86US8	OTTHUMG00000177578	ENST00000263073.6:c.*27->C	17.37:g.1964769_1964769dupG		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z874|O94837|Q86VH6|Q9UF60	RNA	INS	-	NULL	ENST00000263073.6	37	NULL	CCDS11016.1	17																																																																																			SMG6	-	-		0.629	SMG6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG6	HGNC	protein_coding	OTTHUMT00000437826.3	-			1964760	-1	no_errors	ENST00000570756	ensembl	human	known	70_37	rna	INS	0.024:0.027	G
SRSF1	6426	genome.wustl.edu	37	17	56084341	56084341	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:56084341C>T	ENST00000258962.4	-	1	366	c.158G>A	c.(157-159)gGa>gAa	p.G53E	RP11-159D12.5_ENST00000578794.1_5'Flank|SRSF1_ENST00000585096.1_Missense_Mutation_p.G53E|SRSF1_ENST00000581497.1_5'Flank|SRSF1_ENST00000584773.1_Missense_Mutation_p.G53E|SRSF1_ENST00000582730.2_Missense_Mutation_p.G53E	NM_006924.4	NP_008855.1	Q07955	SRSF1_HUMAN	serine/arginine-rich splicing factor 1	53	RRM 1. {ECO:0000255|PROSITE- ProRule:PRU00176}.				cardiac muscle contraction (GO:0060048)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|mRNA 3'-end processing (GO:0031124)|mRNA 5'-splice site recognition (GO:0000395)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|mRNA splicing, via spliceosome (GO:0000398)|regulation of mRNA splicing, via spliceosome (GO:0048024)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.G53E(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(1)|lung(7)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	24						GAAGGGCGGTCCCCCGCGGCG	0.587																																																	1	Substitution - Missense(1)	cervix(1)											119.0	108.0	112.0					17																	56084341		2203	4300	6503	SO:0001583	missense	6426				CCDS11600.1, CCDS58580.1	17q22	2013-02-12	2010-06-22	2010-06-22	ENSG00000136450	ENSG00000136450		"""Serine/arginine-rich splicing factors"", ""RNA binding motif (RRM) containing"""	10780	protein-coding gene	gene with protein product	"""splicing factor 2"", ""pre-mRNA-splicing factor SF2, P33 subunit"", ""alternate splicing factor"", ""SR splicing factor 1"""	600812	"""splicing factor, arginine/serine-rich 1"""	SFRS1		8530103, 20516191	Standard	NM_006924		Approved	ASF, SF2, SRp30a, SF2p33, MGC5228	uc002ivi.3	Q07955		ENST00000258962.4:c.158G>A	17.37:g.56084341C>T	ENSP00000258962:p.Gly53Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6Z7|D3DTZ3|Q13809	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.G53E	ENST00000258962.4	37	c.158	CCDS11600.1	17	.	.	.	.	.	.	.	.	.	.	C	15.46	2.841505	0.51057	.	.	ENSG00000136450	ENST00000258962	T	0.06068	3.35	6.11	6.11	0.99139	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.18467	0.0443	L	0.45352	1.415	0.80722	D	1	P;D	0.65815	0.567;0.995	P;P	0.61722	0.516;0.893	T	0.00007	-1.2502	10	0.56958	D	0.05	.	19.5057	0.95114	0.0:1.0:0.0:0.0	.	85;53	Q59FA2;Q07955	.;SRSF1_HUMAN	E	53	ENSP00000258962:G53E	ENSP00000258962:G53E	G	-	2	0	SRSF1	53439340	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	6.941000	0.75922	2.906000	0.99361	0.655000	0.94253	GGA	SRSF1	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.587	SRSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRSF1	HGNC	protein_coding	OTTHUMT00000443335.1	C	NM_006924		56084341	-1	no_errors	ENST00000258962	ensembl	human	known	70_37	missense	SNP	1.000	T
SSBP2	23635	genome.wustl.edu	37	5	80736439	80736439	+	Missense_Mutation	SNP	C	C	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr5:80736439C>A	ENST00000320672.4	-	14	1076	c.866G>T	c.(865-867)gGg>gTg	p.G289V	SSBP2_ENST00000515395.1_Missense_Mutation_p.G267V|SSBP2_ENST00000510060.1_5'UTR|SSBP2_ENST00000509053.1_Missense_Mutation_p.G259V|SSBP2_ENST00000514493.1_Missense_Mutation_p.G259V|SSBP2_ENST00000505980.1_Missense_Mutation_p.G269V	NM_001256732.1|NM_001256733.1|NM_012446.3	NP_001243661.1|NP_001243662.1|NP_036578.2	P81877	SSBP2_HUMAN	single-stranded DNA binding protein 2	289	Gly-rich.|Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	single-stranded DNA binding (GO:0003697)	p.G289V(1)	SSBP2/JAK2(4)	central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	10		Lung NSC(167;0.00154)|all_lung(232;0.00179)|Ovarian(174;0.0338)		OV - Ovarian serous cystadenocarcinoma(54;1.07e-41)|Epithelial(54;2.79e-35)|all cancers(79;1.18e-29)		ACCATCTGACCCAGGACCCAT	0.333																																																	1	Substitution - Missense(1)	cervix(1)											70.0	74.0	73.0					5																	80736439		2203	4300	6503	SO:0001583	missense	23635			AF077048	CCDS4056.1, CCDS58960.1, CCDS58961.1, CCDS58962.1, CCDS58963.1, CCDS75268.1	5q14.1	2012-05-25	2001-11-28		ENSG00000145687	ENSG00000145687			15831	protein-coding gene	gene with protein product		607389	"""single-stranded DNA-binding protein 2"""			11230166, 11042152	Standard	NM_001256732		Approved	HSPC116	uc003khp.4	P81877	OTTHUMG00000119039	ENST00000320672.4:c.866G>T	5.37:g.80736439C>A	ENSP00000322977:p.Gly289Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5W1|B7Z1J2|B7Z2L9|B7Z665|D6RH18|E9PB74|E9PDA8|Q8N2Q2|Q9BWW6|Q9Y4T7	Missense_Mutation	SNP	pfam_SSDP_ss-bd,smart_LisH_dimerisation,pfscan_LisH_dimerisation,prints_SSDP_DNA-bd	p.G289V	ENST00000320672.4	37	c.866	CCDS4056.1	5	.	.	.	.	.	.	.	.	.	.	C	19.13	3.767115	0.69878	.	.	ENSG00000145687	ENST00000320672;ENST00000509053;ENST00000514493;ENST00000380182;ENST00000504985;ENST00000512923;ENST00000505980;ENST00000515395	.	.	.	5.49	4.62	0.57501	.	0.000000	0.85682	D	0.000000	T	0.77922	0.4203	M	0.74881	2.28	0.80722	D	1	D;D;D;D;P;P	0.76494	0.999;0.996;0.999;0.999;0.78;0.78	D;D;D;D;B;P	0.77557	0.99;0.979;0.99;0.987;0.386;0.509	T	0.80703	-0.1264	9	0.72032	D	0.01	-5.315	13.9924	0.64374	0.0:0.926:0.0:0.074	.	259;267;269;242;267;289	E9PDA8;E9PB74;B7Z1J2;A6ND70;B7Z665;P81877	.;.;.;.;.;SSBP2_HUMAN	V	289;259;259;242;203;195;269;267	.	ENSP00000322977:G289V	G	-	2	0	SSBP2	80772195	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.804000	0.62554	1.317000	0.45149	0.585000	0.79938	GGG	SSBP2	-	pfam_SSDP_ss-bd		0.333	SSBP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSBP2	HGNC	protein_coding	OTTHUMT00000239249.1	C	NM_012446		80736439	-1	no_errors	ENST00000320672	ensembl	human	known	70_37	missense	SNP	1.000	A
SUMO1	7341	genome.wustl.edu	37	2	203079157	203079157	+	Splice_Site	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:203079157C>G	ENST00000392246.2	-	3	244	c.88G>C	c.(88-90)Gat>Cat	p.D30H	SUMO1_ENST00000409205.1_Intron|SUMO1_ENST00000409368.1_Splice_Site_p.D30H|SUMO1_ENST00000409181.1_Splice_Site_p.D30H|SUMO1_ENST00000409498.2_5'UTR|SUMO1_ENST00000469034.1_5'UTR|SUMO1_ENST00000392244.3_Splice_Site_p.D5H|SUMO1_ENST00000392245.1_Splice_Site_p.D30H|SUMO1_ENST00000409712.1_Splice_Site_p.D30H	NM_003352.4	NP_003343.1	P63165	SUMO1_HUMAN	small ubiquitin-like modifier 1	30	Ubiquitin-like. {ECO:0000255|PROSITE- ProRule:PRU00214}.				cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|DNA repair (GO:0006281)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of DNA binding (GO:0043392)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|PML body organization (GO:0030578)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein complex assembly (GO:0031334)|post-translational protein modification (GO:0043687)|protein localization to nuclear pore (GO:0090204)|protein sumoylation (GO:0016925)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein localization (GO:0032880)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)	p.D30H(1)									TCACTGCTATCCTAAGGAGAT	0.303																																																	1	Substitution - Missense(1)	cervix(1)											77.0	66.0	70.0					2																	203079157		2202	4297	6499	SO:0001630	splice_region_variant	7341			U38784	CCDS2352.1, CCDS46493.1	2q33	2013-06-05	2013-06-05	2004-05-19	ENSG00000116030	ENSG00000116030			12502	protein-coding gene	gene with protein product		601912	"""ubiquitin-like 1 (sentrin)"", ""SMT3 suppressor of mif two 3 homolog 1 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)"""	UBL1		8812453, 8906799	Standard	NM_003352		Approved	PIC1, GMP1, SMT3C, SUMO-1, SMT3H3, OFC10	uc002uyz.1	P63165	OTTHUMG00000132839	ENST00000392246.2:c.88-1G>C	2.37:g.203079157C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MUS8|B2R4I5|P55856|Q6FGG0|Q6NZ62|Q93068	Missense_Mutation	SNP	pfam_SUMO,pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.D30H	ENST00000392246.2	37	c.88	CCDS2352.1	2	.	.	.	.	.	.	.	.	.	.	C	21.1	4.102169	0.76983	.	.	ENSG00000116030	ENST00000392246;ENST00000392245;ENST00000409368;ENST00000392244;ENST00000409712;ENST00000409181	T;T;T;T;T;T	0.37411	1.2;1.2;1.2;1.2;1.2;1.2	5.51	4.64	0.57946	Ubiquitin supergroup (1);Ubiquitin (2);	0.044333	0.85682	D	0.000000	T	0.67069	0.2854	M	0.91459	3.21	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.79784	0.993;0.982	T	0.75886	-0.3159	10	0.87932	D	0	-17.6409	14.1648	0.65469	0.0:0.9281:0.0:0.0719	.	5;30	A8MUS8;P63165	.;SUMO1_HUMAN	H	30;30;30;5;30;30	ENSP00000376077:D30H;ENSP00000376076:D30H;ENSP00000387204:D30H;ENSP00000376075:D5H;ENSP00000386296:D30H;ENSP00000386753:D30H	ENSP00000376075:D5H	D	-	1	0	SUMO1	202787402	1.000000	0.71417	1.000000	0.80357	0.878000	0.50629	7.433000	0.80362	1.336000	0.45506	0.467000	0.42956	GAT	SUMO1	-	pfam_SUMO,pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup		0.303	SUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUMO1	HGNC	protein_coding	OTTHUMT00000256312.2	C	NM_003352	Missense_Mutation	203079157	-1	no_errors	ENST00000392245	ensembl	human	known	70_37	missense	SNP	1.000	G
TADA2A	6871	genome.wustl.edu	37	17	35830526	35830526	+	Silent	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:35830526C>G	ENST00000394395.2	+	13	1091	c.918C>G	c.(916-918)ctC>ctG	p.L306L	TADA2A_ENST00000591992.1_3'UTR|TADA2A_ENST00000225396.6_Silent_p.L306L	NM_001166105.1	NP_001159577.1	O75478	TAD2A_HUMAN	transcriptional adaptor 2A	306					chromatin organization (GO:0006325)|histone H3 acetylation (GO:0043966)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|nucleus (GO:0005634)|PCAF complex (GO:0000125)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)	p.L306L(2)		breast(4)|cervix(1)|endometrium(1)|kidney(2)|lung(3)|prostate(1)|skin(1)	13						ACGATCACCTCAAGAAGACAC	0.522																																																	2	Substitution - coding silent(2)	cervix(2)											126.0	120.0	122.0					17																	35830526		2203	4300	6503	SO:0001819	synonymous_variant	6871			AK022767	CCDS11319.1, CCDS45656.1	17q12-q21	2014-04-10	2009-10-02	2009-10-02	ENSG00000108264	ENSG00000276234			11531	protein-coding gene	gene with protein product		602276	"""transcriptional adaptor 2 (ADA2 homolog, yeast)-like"""	TADA2L		8552087	Standard	XM_006722043		Approved	ADA2, hADA2, ADA2A	uc002hnt.3	O75478	OTTHUMG00000188469	ENST00000394395.2:c.918C>G	17.37:g.35830526C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MVD0|B3KMU9|Q9BVJ0|Q9UCW2|Q9UP49	Silent	SNP	pfam_SWIRM,pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_SWIRM,pfscan_Myb-like_dom	p.L306	ENST00000394395.2	37	c.918	CCDS11319.1	17																																																																																			TADA2A	-	pirsf_Transcriptional_adaptor_2		0.522	TADA2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2A	HGNC	protein_coding	OTTHUMT00000256677.3	C	NM_001488		35830526	+1	no_errors	ENST00000225396	ensembl	human	known	70_37	silent	SNP	0.811	G
TET3	200424	genome.wustl.edu	37	2	74320665	74320665	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:74320665G>A	ENST00000409262.3	+	7	2734	c.2734G>A	c.(2734-2736)Gag>Aag	p.E912K		NM_144993.1	NP_659430.1	O43151	TET3_HUMAN	tet methylcytosine dioxygenase 3	912					DNA demethylation (GO:0080111)|DNA demethylation of male pronucleus (GO:0044727)|histone H3-K4 trimethylation (GO:0080182)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein O-linked glycosylation (GO:0006493)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methylcytosine dioxygenase activity (GO:0070579)	p.E189K(1)|p.E912K(1)		NS(1)|breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34						GGTGACCAACGAGGAAATAGC	0.617																																																	2	Substitution - Missense(2)	cervix(2)											56.0	61.0	59.0					2																	74320665		2067	4196	6263	SO:0001583	missense	200424				CCDS46339.1, CCDS46339.2	2p13.1	2011-09-30	2011-09-30		ENSG00000187605	ENSG00000187605			28313	protein-coding gene	gene with protein product		613555	"""tet oncogene family member 3"""			9455477	Standard	XM_005264187		Approved	MGC22014, hCG_40738	uc031roi.1	O43151	OTTHUMG00000152823	ENST00000409262.3:c.2734G>A	2.37:g.74320665G>A	ENSP00000386869:p.Glu912Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEI3|Q86Z24|Q8TBM9	Missense_Mutation	SNP	NULL	p.E912K	ENST00000409262.3	37	c.2734	CCDS46339.1	2	.	.	.	.	.	.	.	.	.	.	G	27.2	4.807878	0.90623	.	.	ENSG00000187605	ENST00000409262;ENST00000233310	T	0.14022	2.54	5.21	4.33	0.51752	.	0.051366	0.85682	D	0.000000	T	0.39809	0.1092	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.41610	-0.9499	10	0.87932	D	0	.	13.0025	0.58683	0.0792:0.0:0.9208:0.0	.	912	O43151	TET3_HUMAN	K	912	ENSP00000386869:E912K	ENSP00000233310:E912K	E	+	1	0	TET3	74174173	1.000000	0.71417	0.957000	0.39632	0.783000	0.44284	7.536000	0.82023	1.420000	0.47138	0.655000	0.94253	GAG	TET3	-	NULL		0.617	TET3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TET3	HGNC	protein_coding	OTTHUMT00000328141.4	G			74320665	+1	no_errors	ENST00000409262	ensembl	human	known	70_37	missense	SNP	1.000	A
TEX2	55852	genome.wustl.edu	37	17	62291274	62291274	+	Missense_Mutation	SNP	G	G	C			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr17:62291274G>C	ENST00000583097.1	-	2	476	c.304C>G	c.(304-306)Cag>Gag	p.Q102E	TEX2_ENST00000258991.3_Missense_Mutation_p.Q102E|TEX2_ENST00000584379.1_Missense_Mutation_p.Q102E			Q8IWB9	TEX2_HUMAN	testis expressed 2	102					signal transduction (GO:0007165)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)		p.Q102E(1)		breast(3)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(15)|ovary(1)|pancreas(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(8;1.33e-10)	READ - Rectum adenocarcinoma(1115;0.0689)		GCAGGGGCCTGGGACACGGAC	0.577																																																	1	Substitution - Missense(1)	cervix(1)											105.0	110.0	108.0					17																	62291274		2203	4300	6503	SO:0001583	missense	55852			AB051525	CCDS11658.1, CCDS74131.1	17q23.3	2007-03-13	2007-03-13			ENSG00000136478			30884	protein-coding gene	gene with protein product	"""transmembrane protein 96"""		"""testis expressed sequence 2"""			11214970	Standard	XM_005257507		Approved	HT008, TMEM96, KIAA1738	uc002jee.3	Q8IWB9		ENST00000583097.1:c.304C>G	17.37:g.62291274G>C	ENSP00000462665:p.Gln102Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6AHZ5|Q8N3L0|Q9C0C5	Missense_Mutation	SNP	pfam_DUF2404	p.Q102E	ENST00000583097.1	37	c.304		17	.	.	.	.	.	.	.	.	.	.	G	8.192	0.796177	0.16327	.	.	ENSG00000136478	ENST00000258991	T	0.41065	1.01	3.95	1.48	0.22813	.	0.581986	0.16532	N	0.210311	T	0.12817	0.0311	N	0.03608	-0.345	0.20873	N	0.999837	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.29397	-1.0013	10	0.02654	T	1	-1.0279	2.3967	0.04392	0.4063:0.3293:0.2644:0.0	.	102;102	Q8IWB9-2;Q8IWB9	.;TEX2_HUMAN	E	102	ENSP00000258991:Q102E	ENSP00000258991:Q102E	Q	-	1	0	TEX2	59645006	0.838000	0.29461	0.953000	0.39169	0.933000	0.57130	0.514000	0.22786	0.579000	0.29504	0.313000	0.20887	CAG	TEX2	-	NULL		0.577	TEX2-003	KNOWN	alternative_5_UTR|basic|appris_candidate	protein_coding	TEX2	HGNC	protein_coding	OTTHUMT00000443745.1	G	NM_018469		62291274	-1	no_errors	ENST00000258991	ensembl	human	known	70_37	missense	SNP	0.908	C
TMEM131	23505	genome.wustl.edu	37	2	98409038	98409038	+	Missense_Mutation	SNP	C	C	G			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:98409038C>G	ENST00000186436.5	-	31	4183	c.3955G>C	c.(3955-3957)Gaa>Caa	p.E1319Q		NM_015348.1	NP_056163.1	Q92545	TM131_HUMAN	transmembrane protein 131	1319	Pro-rich.					integral component of membrane (GO:0016021)		p.E1206Q(1)|p.E1206*(1)|p.E1319Q(1)		NS(1)|autonomic_ganglia(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(23)|ovary(4)|prostate(1)|skin(1)|stomach(1)	57						GACAGCCTTTCAGGCTGCGGC	0.677																																																	3	Substitution - Missense(2)|Substitution - Nonsense(1)	cervix(2)|breast(1)											21.0	25.0	23.0					2																	98409038		2093	4223	6316	SO:0001583	missense	23505			AK025852	CCDS46368.1	2q11.2	2006-04-12			ENSG00000075568	ENSG00000075568			30366	protein-coding gene	gene with protein product		615659				9039502, 10996388	Standard	NM_015348		Approved	CC28, YR-23, RW1, KIAA0257, PRO1048	uc002syh.4	Q92545	OTTHUMG00000153061	ENST00000186436.5:c.3955G>C	2.37:g.98409038C>G	ENSP00000186436:p.Glu1319Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DUF3651_TMEM131	p.E1319Q	ENST00000186436.5	37	c.3955	CCDS46368.1	2	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288090	0.40494	.	.	ENSG00000075568	ENST00000186436	T	0.24151	1.87	5.91	5.91	0.95273	.	0.562624	0.18838	N	0.129774	T	0.24812	0.0602	L	0.36672	1.1	0.80722	D	1	B	0.17465	0.022	B	0.14023	0.01	T	0.05131	-1.0904	10	0.21014	T	0.42	-2.0572	19.8936	0.96942	0.0:1.0:0.0:0.0	.	1319	Q92545	TM131_HUMAN	Q	1319	ENSP00000186436:E1319Q	ENSP00000186436:E1319Q	E	-	1	0	TMEM131	97775470	0.161000	0.22892	0.008000	0.14137	0.651000	0.38670	3.599000	0.54045	2.793000	0.96121	0.655000	0.94253	GAA	TMEM131	-	NULL		0.677	TMEM131-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM131	HGNC	protein_coding	OTTHUMT00000329285.2	C	XM_371542		98409038	-1	no_errors	ENST00000186436	ensembl	human	known	70_37	missense	SNP	0.036	G
TMTC4	84899	genome.wustl.edu	37	13	101257341	101257341	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr13:101257341G>A	ENST00000376234.3	-	18	2322	c.2133C>T	c.(2131-2133)atC>atT	p.I711I	TMTC4_ENST00000342624.5_Silent_p.I730I|TMTC4_ENST00000328767.5_Silent_p.I600I	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	711						integral component of membrane (GO:0016021)		p.I730I(2)|p.I730M(1)		breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					GCTGCAAGGAGATTTCATAGT	0.433																																																	3	Substitution - coding silent(2)|Substitution - Missense(1)	cervix(1)|large_intestine(1)|lung(1)											273.0	241.0	252.0					13																	101257341		2203	4300	6503	SO:0001819	synonymous_variant	84899				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.2133C>T	13.37:g.101257341G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Silent	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I730	ENST00000376234.3	37	c.2190	CCDS41904.1	13																																																																																			TMTC4	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.433	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	G	NM_032813		101257341	-1	no_errors	ENST00000342624	ensembl	human	known	70_37	silent	SNP	1.000	A
TMX3	54495	genome.wustl.edu	37	18	66344338	66344338	+	Silent	SNP	G	G	A	rs151168037		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr18:66344338G>A	ENST00000299608.2	-	16	1513	c.1197C>T	c.(1195-1197)gcC>gcT	p.A399A		NM_019022.3	NP_061895.3	Q96JJ7	TMX3_HUMAN	thioredoxin-related transmembrane protein 3	399					cell redox homeostasis (GO:0045454)|protein folding (GO:0006457)|response to endoplasmic reticulum stress (GO:0034976)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	protein disulfide isomerase activity (GO:0003756)	p.A399A(1)		cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)|skin(1)|urinary_tract(1)	17						CATCTGTGTCGGCTGTGTAGA	0.438													G|||	1	0.000199681	0.0008	0.0	5008	,	,		17500	0.0		0.0	False		,,,				2504	0.0																1	Substitution - coding silent(1)	cervix(1)						G		4,4402	8.1+/-20.4	0,4,2199	160.0	148.0	152.0		1197	-11.0	0.0	18	dbSNP_134	152	0,8600		0,0,4300	no	coding-synonymous	TMX3	NM_019022.3		0,4,6499	AA,AG,GG		0.0,0.0908,0.0308		399/455	66344338	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	54495			BX647846	CCDS32840.1	18q22	2011-10-19	2009-02-23	2009-02-23		ENSG00000166479		"""Protein disulfide isomerases"""	24718	protein-coding gene	gene with protein product	"""protein disulfide isomerase family A, member 13"""		"""thioredoxin domain containing 10"""	TXNDC10		15623505	Standard	NM_019022		Approved	FLJ20793, KIAA1830, PDIA13	uc002lkf.3	Q96JJ7		ENST00000299608.2:c.1197C>T	18.37:g.66344338G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KV75|Q52LT7|Q8N5J0|Q9NWJ9	Silent	SNP	pfam_Thioredoxin_domain,pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Thioredoxin	p.A399	ENST00000299608.2	37	c.1197	CCDS32840.1	18																																																																																			TMX3	-	NULL		0.438	TMX3-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	TMX3	HGNC	protein_coding	OTTHUMT00000420155.1	G	NM_019022		66344338	-1	no_errors	ENST00000299608	ensembl	human	known	70_37	silent	SNP	0.132	A
TSGA10	80705	genome.wustl.edu	37	2	99688285	99688285	+	Missense_Mutation	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:99688285G>A	ENST00000393483.3	-	14	1835	c.991C>T	c.(991-993)Cgg>Tgg	p.R331W	TSGA10_ENST00000478090.1_5'UTR|TSGA10_ENST00000542655.1_3'UTR|TSGA10_ENST00000355053.4_Missense_Mutation_p.R331W|TSGA10_ENST00000410001.1_Missense_Mutation_p.R331W|TSGA10_ENST00000539964.1_Missense_Mutation_p.R331W	NM_025244.2	NP_079520.1	Q9BZW7	TSG10_HUMAN	testis specific, 10	331					cell projection assembly (GO:0030031)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|membrane (GO:0016020)|motile cilium (GO:0031514)|neuron projection (GO:0043005)|nucleus (GO:0005634)		p.R331W(1)		NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	34						TCCAATTGCCGACGCATTCTG	0.433																																																	1	Substitution - Missense(1)	cervix(1)											162.0	148.0	153.0					2																	99688285		2203	4300	6503	SO:0001583	missense	80705			AF254756	CCDS2037.1	2q11.2	2009-08-06			ENSG00000135951	ENSG00000135951			14927	protein-coding gene	gene with protein product	"""cancer/testis antigen 79"""	607166				11179690	Standard	NM_025244		Approved	CEP4L, CT79	uc002szi.4	Q9BZW7	OTTHUMG00000130637	ENST00000393483.3:c.991C>T	2.37:g.99688285G>A	ENSP00000377123:p.Arg331Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z925|D3DVH7|Q8NEP0|Q9BWX0	Missense_Mutation	SNP	NULL	p.R331W	ENST00000393483.3	37	c.991	CCDS2037.1	2	.	.	.	.	.	.	.	.	.	.	G	19.29	3.798635	0.70567	.	.	ENSG00000135951	ENST00000393483;ENST00000410001;ENST00000355053;ENST00000539964;ENST00000409564;ENST00000393482	D;D;D;D;T;T	0.83163	-1.69;-1.69;-1.69;-1.69;-1.26;-1.26	5.35	0.964	0.19655	.	0.125212	0.35615	N	0.003082	D	0.86826	0.6026	L	0.54323	1.7	0.80722	D	1	D	0.89917	1.0	D	0.65773	0.938	D	0.86836	0.2014	10	0.87932	D	0	-7.901	13.391	0.60825	0.0:0.0:0.4817:0.5183	.	331	Q9BZW7	TSG10_HUMAN	W	331	ENSP00000377123:R331W;ENSP00000386956:R331W;ENSP00000347161:R331W;ENSP00000444419:R331W;ENSP00000386508:R331W;ENSP00000377122:R331W	ENSP00000347161:R331W	R	-	1	2	TSGA10	99054717	0.244000	0.23889	0.833000	0.33012	0.999000	0.98932	0.585000	0.23879	0.342000	0.23796	0.650000	0.86243	CGG	TSGA10	-	NULL		0.433	TSGA10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA10	HGNC	protein_coding	OTTHUMT00000253125.1	G	NM_182911		99688285	-1	no_errors	ENST00000355053	ensembl	human	known	70_37	missense	SNP	0.669	A
TUBB8	347688	genome.wustl.edu	37	10	93876	93876	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr10:93876G>A	ENST00000309812.4	-	4	518	c.456C>T	c.(454-456)ctC>ctT	p.L152L	TUBB8_ENST00000332708.5_3'UTR|TUBB8_ENST00000413237.3_5'UTR|TUBB8_ENST00000447903.2_Silent_p.L80L	NM_177987.2	NP_817124.1	Q3ZCM7	TBB8_HUMAN	tubulin, beta 8 class VIII	152					microtubule-based process (GO:0007017)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)	p.L152L(1)		NS(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(12)|ovary(2)|prostate(3)|skin(3)|stomach(1)	32		all_cancers(4;0.00131)|all_lung(4;0.000777)|Lung NSC(4;0.0043)|all_epithelial(10;0.0154)|Colorectal(49;0.235)		Epithelial(11;0.00341)|all cancers(11;0.00922)|OV - Ovarian serous cystadenocarcinoma(14;0.0508)|Lung(33;0.132)		GGATCTTACTGAGCAGAAGGG	0.592																																					Pancreas(192;2041 3010 9013 18103)												1	Substitution - coding silent(1)	cervix(1)											106.0	94.0	98.0					10																	93876		2203	4300	6503	SO:0001819	synonymous_variant	347688			AF355127	CCDS7051.1	10p15.3	2014-05-06			ENSG00000173876			"""Tubulins"""	20773	protein-coding gene	gene with protein product	"""class VIII beta-tubulin"""						Standard	NM_177987		Approved	bA631M21.2	uc001ifi.2	Q3ZCM7	OTTHUMG00000174803	ENST00000309812.4:c.456C>T	10.37:g.93876G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SQX9|Q8WZ78	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.L152	ENST00000309812.4	37	c.456	CCDS7051.1	10																																																																																			TUBB8	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Beta_tubulin,prints_Tubulin,prints_Alpha_tubulin		0.592	TUBB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB8	HGNC	protein_coding	OTTHUMT00000467795.1	G	NM_177987		93876	-1	no_errors	ENST00000328974	ensembl	human	known	70_37	silent	SNP	1.000	A
TYR	7299	genome.wustl.edu	37	11	88911391	88911391	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr11:88911391G>A	ENST00000263321.5	+	1	772	c.270G>A	c.(268-270)caG>caA	p.Q90Q	TYR_ENST00000526139.1_3'UTR	NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	90					cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)	p.Q90Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	GGACCTGCCAGTGCTCTGGCA	0.498																																																	1	Substitution - coding silent(1)	cervix(1)											47.0	48.0	48.0					11																	88911391		2201	4299	6500	SO:0001819	synonymous_variant	7299			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.270G>A	11.37:g.88911391G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.Q90	ENST00000263321.5	37	c.270	CCDS8284.1	11																																																																																			TYR	-	superfamily_Unchr_di-copper_centre		0.498	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	G	NM_000372		88911391	+1	no_errors	ENST00000263321	ensembl	human	known	70_37	silent	SNP	0.968	A
VPS13B	157680	genome.wustl.edu	37	8	100155380	100155380	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr8:100155380C>T	ENST00000358544.2	+	13	1941	c.1830C>T	c.(1828-1830)agC>agT	p.S610S	VPS13B_ENST00000355155.1_Silent_p.S610S|VPS13B_ENST00000395996.1_Silent_p.S610S|VPS13B_ENST00000357162.2_Silent_p.S610S	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	610					protein transport (GO:0015031)			p.S610S(2)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AACCATATAGCAGGCTAAAAT	0.333																																					Colon(161;2205 2542 7338 31318)												2	Substitution - coding silent(2)	cervix(2)											146.0	148.0	147.0					8																	100155380		2203	4300	6503	SO:0001819	synonymous_variant	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.1830C>T	8.37:g.100155380C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Silent	SNP	pfam_Autophagy-rel_C	p.S610	ENST00000358544.2	37	c.1830	CCDS6280.1	8																																																																																			VPS13B	-	NULL		0.333	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	C	NM_184042		100155380	+1	no_errors	ENST00000358544	ensembl	human	known	70_37	silent	SNP	0.126	T
WDR12	55759	genome.wustl.edu	37	2	203748344	203748344	+	Missense_Mutation	SNP	C	C	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr2:203748344C>A	ENST00000261015.4	-	11	1858	c.1109G>T	c.(1108-1110)tGg>tTg	p.W370L		NM_018256.3	NP_060726.3			WD repeat domain 12											endometrium(3)|large_intestine(1)|liver(1)|lung(6)|prostate(1)|skin(1)	13						TCTTGTATCCCACAGCTTAAC	0.348																																																	0													71.0	64.0	66.0					2																	203748344		2203	4300	6503	SO:0001583	missense	55759			AF242546	CCDS2356.1	2q33.1	2013-01-09			ENSG00000138442	ENSG00000138442		"""WD repeat domain containing"""	14098	protein-coding gene	gene with protein product						16043514, 17353269	Standard	NM_018256		Approved	YTM1, FLJ10881	uc002uzl.3	Q9GZL7	OTTHUMG00000132855	ENST00000261015.4:c.1109G>T	2.37:g.203748344C>A	ENSP00000261015:p.Trp370Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,pfam_NLE,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.W370L	ENST00000261015.4	37	c.1109	CCDS2356.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.134293	0.94517	.	.	ENSG00000138442	ENST00000261015	D	0.83506	-1.73	5.57	5.57	0.84162	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.94042	0.8091	H	0.94658	3.565	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.95212	0.8326	10	0.87932	D	0	-4.7959	19.6054	0.95580	0.0:1.0:0.0:0.0	.	370;370	Q53T99;Q9GZL7	.;WDR12_HUMAN	L	370	ENSP00000261015:W370L	ENSP00000261015:W370L	W	-	2	0	WDR12	203456589	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	7.729000	0.84864	2.619000	0.88677	0.549000	0.68633	TGG	WDR12	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep		0.348	WDR12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR12	HGNC	protein_coding	OTTHUMT00000256329.4	C	NM_018256		203748344	-1	no_errors	ENST00000261015	ensembl	human	known	70_37	missense	SNP	1.000	A
WDR19	57728	genome.wustl.edu	37	4	39246134	39246134	+	Silent	SNP	C	C	T	rs371645967		TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr4:39246134C>T	ENST00000399820.3	+	23	2761	c.2607C>T	c.(2605-2607)taC>taT	p.Y869Y	WDR19_ENST00000288634.7_Silent_p.Y709Y	NM_025132.3	NP_079408.3	Q8NEZ3	WDR19_HUMAN	WD repeat domain 19	869					ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|cilium assembly (GO:0042384)|digestive system development (GO:0055123)|ear morphogenesis (GO:0042471)|embryonic camera-type eye development (GO:0031076)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic limb morphogenesis (GO:0030326)|in utero embryonic development (GO:0001701)|intraciliary retrograde transport (GO:0035721)|myotome development (GO:0061055)|neurological system process (GO:0050877)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|intraciliary transport particle A (GO:0030991)|motile cilium (GO:0031514)|nonmotile primary cilium (GO:0031513)|photoreceptor connecting cilium (GO:0032391)		p.Y869Y(1)		large_intestine(1)	1						GTCTCTACTACGATAAAGCAG	0.388																																																	1	Substitution - coding silent(1)	cervix(1)						C		1,3733		0,1,1866	119.0	114.0	115.0		2607	-1.5	1.0	4		115	0,8192		0,0,4096	no	coding-synonymous	WDR19	NM_025132.3		0,1,5962	TT,TC,CC		0.0,0.0268,0.0084		869/1343	39246134	1,11925	1867	4096	5963	SO:0001819	synonymous_variant	57728			AB046858, AY029257	CCDS47042.1	4p14	2014-02-21			ENSG00000157796	ENSG00000157796		"""WD repeat domain containing"", ""Intraflagellar transport homologs"""	18340	protein-coding gene	gene with protein product	"""intraflagellar transport 144 homolog (Chlamydomonas)"""	608151				12906858, 22019273	Standard	XM_005262658		Approved	Pwdmp, KIAA1638, FLJ23127, ORF26, DYF-2, Oseg6, IFT144, NPHP13	uc003gtv.3	Q8NEZ3	OTTHUMG00000160466	ENST00000399820.3:c.2607C>T	4.37:g.39246134C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MEF2|Q8N5B4|Q9H5S0|Q9HCD4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.Y869	ENST00000399820.3	37	c.2607	CCDS47042.1	4																																																																																			WDR19	-	NULL		0.388	WDR19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR19	HGNC	protein_coding	OTTHUMT00000360689.1	C			39246134	+1	no_errors	ENST00000399820	ensembl	human	known	70_37	silent	SNP	0.998	T
ZNF148	7707	genome.wustl.edu	37	3	124951901	124951901	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr3:124951901C>T	ENST00000360647.4	-	9	2154	c.1669G>A	c.(1669-1671)Gag>Aag	p.E557K	ZNF148_ENST00000544464.1_Intron|ZNF148_ENST00000484491.1_Missense_Mutation_p.E557K|ZNF148_ENST00000468369.1_Intron|ZNF148_ENST00000485866.1_Missense_Mutation_p.E557K|SLC12A8_ENST00000423114.2_Intron|ZNF148_ENST00000497929.1_5'UTR|ZNF148_ENST00000492394.1_Missense_Mutation_p.E557K	NM_021964.2	NP_068799.2	Q9UQR1	ZN148_HUMAN	zinc finger protein 148	557					cellular defense response (GO:0006968)|gamete generation (GO:0007276)|negative regulation of gene expression (GO:0010629)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein complex assembly (GO:0006461)|substantia nigra development (GO:0021762)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E557K(1)		breast(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(3)|liver(1)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)	28						AAGGATATCTCATGCTGTCCA	0.398																																																	1	Substitution - Missense(1)	cervix(1)											97.0	91.0	93.0					3																	124951901		2203	4300	6503	SO:0001583	missense	7707			U09851	CCDS3031.1	3q21.2	2013-01-08	2006-06-13		ENSG00000163848	ENSG00000163848		"""Zinc fingers, C2H2-type"""	12933	protein-coding gene	gene with protein product		601897	"""zinc finger protein 148 (pHZ-52)"""			7557990, 9925940	Standard	NM_021964		Approved	BERF-1, ZBP-89, BFCOL1, HT-BETA, ZFP148, pHZ-52	uc003ehx.4	Q9UQR1	OTTHUMG00000159448	ENST00000360647.4:c.1669G>A	3.37:g.124951901C>T	ENSP00000353863:p.Glu557Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DN27|O00389|O43591|Q58EY5|Q6PJ98	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E557K	ENST00000360647.4	37	c.1669	CCDS3031.1	3	.	.	.	.	.	.	.	.	.	.	C	24.8	4.569509	0.86439	.	.	ENSG00000163848	ENST00000360647;ENST00000484491;ENST00000492394;ENST00000485866	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.03	5.03	0.67393	.	0.050813	0.85682	D	0.000000	T	0.50000	0.1590	L	0.48642	1.525	0.80722	D	1	D	0.55172	0.97	P	0.46172	0.506	T	0.56547	-0.7961	10	0.87932	D	0	-12.4883	18.554	0.91077	0.0:1.0:0.0:0.0	.	557	Q9UQR1	ZN148_HUMAN	K	557	ENSP00000353863:E557K;ENSP00000420335:E557K;ENSP00000419322:E557K;ENSP00000420448:E557K	ENSP00000353863:E557K	E	-	1	0	ZNF148	126434591	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.320000	0.79064	2.611000	0.88343	0.655000	0.94253	GAG	ZNF148	-	NULL		0.398	ZNF148-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF148	HGNC	protein_coding	OTTHUMT00000355452.4	C	NM_021964		124951901	-1	no_errors	ENST00000360647	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF462	58499	genome.wustl.edu	37	9	109690314	109690314	+	Missense_Mutation	SNP	G	G	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr9:109690314G>T	ENST00000277225.5	+	3	4410	c.4121G>T	c.(4120-4122)tGt>tTt	p.C1374F	ZNF462_ENST00000441147.2_Missense_Mutation_p.C219F|ZNF462_ENST00000457913.1_Missense_Mutation_p.C1374F			Q96JM2	ZN462_HUMAN	zinc finger protein 462	1374					chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.C1374F(1)		NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						TGCAGGGACTGTGTTTTCGAA	0.517																																																	1	Substitution - Missense(1)	cervix(1)											141.0	113.0	122.0					9																	109690314		2203	4300	6503	SO:0001583	missense	58499			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.4121G>T	9.37:g.109690314G>T	ENSP00000277225:p.Cys1374Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T0T4|Q8N408	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.C1374F	ENST00000277225.5	37	c.4121	CCDS35096.1	9	.	.	.	.	.	.	.	.	.	.	G	15.89	2.967546	0.53507	.	.	ENSG00000148143	ENST00000277225;ENST00000457913;ENST00000374686;ENST00000441147	T;T;T;T	0.20332	2.08;2.48;2.58;2.56	5.36	5.36	0.76844	Zinc finger, C2H2-like (1);	0.000000	0.85682	D	0.000000	T	0.39911	0.1096	L	0.36672	1.1	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.991	T	0.21449	-1.0245	10	0.87932	D	0	.	19.0895	0.93221	0.0:0.0:1.0:0.0	.	1374;1374	Q96JM2-3;Q96JM2	.;ZN462_HUMAN	F	1374;1374;257;219	ENSP00000277225:C1374F;ENSP00000414570:C1374F;ENSP00000363818:C257F;ENSP00000397306:C219F	ENSP00000277225:C1374F	C	+	2	0	ZNF462	108730135	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.397000	0.97276	2.509000	0.84616	0.561000	0.74099	TGT	ZNF462	-	smart_Znf_C2H2-like		0.517	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ZNF462	HGNC	protein_coding	OTTHUMT00000053532.2	G	NM_021224		109690314	+1	no_errors	ENST00000457913	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF573	126231	genome.wustl.edu	37	19	38229812	38229812	+	Missense_Mutation	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr19:38229812C>T	ENST00000590414.2	-	4	1600	c.1579G>A	c.(1579-1581)Gaa>Aaa	p.E527K	ZNF573_ENST00000536220.1_Missense_Mutation_p.E439K|ZNF573_ENST00000339503.4_Missense_Mutation_p.E469K|ZNF573_ENST00000357309.3_Missense_Mutation_p.E439K|ZNF573_ENST00000392138.1_Missense_Mutation_p.E440K			Q86YE8	ZN573_HUMAN	zinc finger protein 573	527					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E469K(1)		NS(1)|cervix(3)|endometrium(2)|large_intestine(8)|liver(1)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	25			UCEC - Uterine corpus endometrioid carcinoma (49;0.0775)|Lung(45;0.0813)|LUSC - Lung squamous cell carcinoma(53;0.146)			ACCTTACATTCATAGGGTTTC	0.333																																																	1	Substitution - Missense(1)	cervix(1)											49.0	51.0	50.0					19																	38229812		2203	4299	6502	SO:0001583	missense	126231			AK074539	CCDS12508.1, CCDS54260.1, CCDS59381.1	19q13.12	2013-09-20			ENSG00000189144	ENSG00000189144		"""Zinc fingers, C2H2-type"", ""-"""	26420	protein-coding gene	gene with protein product						12477932	Standard	NM_152360		Approved	FLJ30921	uc002ohe.3	Q86YE8	OTTHUMG00000048183	ENST00000590414.2:c.1579G>A	19.37:g.38229812C>T	ENSP00000465020:p.Glu527Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WPE1|K7EJ45|Q6P1P1|Q7Z7Q3|Q8N2Q1|Q96BM3|Q96NH0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E527K	ENST00000590414.2	37	c.1579	CCDS59381.1	19	.	.	.	.	.	.	.	.	.	.	-	12.52	1.961397	0.34565	.	.	ENSG00000189144	ENST00000392138;ENST00000536220;ENST00000357309;ENST00000339503;ENST00000427026	T;T;T;T	0.19250	2.16;2.16;2.16;2.16	2.4	2.4	0.29515	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.06645	0.0170	N	0.02296	-0.605	0.09310	N	1	P;P;P;P	0.47841	0.879;0.879;0.901;0.879	B;B;B;B	0.40477	0.222;0.222;0.33;0.222	T	0.07616	-1.0763	9	0.13853	T	0.58	.	4.7259	0.12941	0.2451:0.5143:0.2405:0.0	.	440;469;507;439	Q86YE8-4;Q86YE8-3;Q86YE8;Q86YE8-2	.;.;ZN573_HUMAN;.	K	440;439;439;469;439	ENSP00000375983:E440K;ENSP00000440464:E439K;ENSP00000349861:E439K;ENSP00000340171:E469K	ENSP00000340171:E469K	E	-	1	0	ZNF573	42921652	0.000000	0.05858	0.917000	0.36280	0.923000	0.55619	-1.461000	0.02366	1.168000	0.42723	0.585000	0.79938	GAA	ZNF573	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.333	ZNF573-007	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF573	HGNC	protein_coding	OTTHUMT00000459773.2	C	NM_152360		38229812	-1	no_errors	ENST00000590414	ensembl	human	known	70_37	missense	SNP	0.339	T
ZNF770	54989	genome.wustl.edu	37	15	35274379	35274379	+	Silent	SNP	C	C	T			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr15:35274379C>T	ENST00000356321.4	-	3	1601	c.1257G>A	c.(1255-1257)ttG>ttA	p.L419L		NM_014106.3	NP_054825.2	Q6IQ21	ZN770_HUMAN	zinc finger protein 770	419					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.L419L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)	29		Lung NSC(122;4.59e-10)|all_lung(180;8.78e-09)		all cancers(64;1.97e-18)|GBM - Glioblastoma multiforme(113;2.11e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0643)		GGATGCCTTTCAAATTTTTTC	0.328																																																	1	Substitution - coding silent(1)	cervix(1)											63.0	67.0	66.0					15																	35274379		2201	4297	6498	SO:0001819	synonymous_variant	54989			BC071603	CCDS10042.1	15q14	2013-01-08			ENSG00000198146	ENSG00000198146		"""Zinc fingers, C2H2-type"""	26061	protein-coding gene	gene with protein product							Standard	NM_014106		Approved	FLJ20582, PRO1914	uc001ziw.3	Q6IQ21	OTTHUMG00000129689	ENST00000356321.4:c.1257G>A	15.37:g.35274379C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZMZ6|Q9NWV2	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L419	ENST00000356321.4	37	c.1257	CCDS10042.1	15																																																																																			ZNF770	-	NULL		0.328	ZNF770-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF770	HGNC	protein_coding	OTTHUMT00000251896.2	C	NM_014106		35274379	-1	no_errors	ENST00000356321	ensembl	human	known	70_37	silent	SNP	0.743	T
ZSCAN10	84891	genome.wustl.edu	37	16	3140073	3140073	+	Silent	SNP	G	G	A			TCGA-BI-A0VS-01A-11D-A10S-08	TCGA-BI-A0VS-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	cfd08e6d-ca7c-47ed-a7b1-b9affdaf1190	cc7fbc59-ea41-4bf9-931a-a84da881e22c	g.chr16:3140073G>A	ENST00000252463.2	-	5	1284	c.1197C>T	c.(1195-1197)caC>caT	p.H399H	ZSCAN10_ENST00000538082.2_Silent_p.H317H|ZSCAN10_ENST00000575108.1_Silent_p.H60H|RP11-473M20.9_ENST00000571404.1_lincRNA	NM_032805.1	NP_116194.1	Q96SZ4	ZSC10_HUMAN	zinc finger and SCAN domain containing 10	399					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.H399H(1)		breast(1)|cervix(3)|endometrium(3)|kidney(1)|lung(8)|ovary(2)|prostate(1)|skin(4)|urinary_tract(1)	24						GGTCCTGGGCGTGCGCCAGCA	0.701																																																	1	Substitution - coding silent(1)	cervix(1)											10.0	13.0	12.0					16																	3140073		2129	4143	6272	SO:0001819	synonymous_variant	84891			AA206569	CCDS10493.1, CCDS61813.1, CCDS61814.1	16p13.3	2013-01-08	2007-02-20	2007-02-20		ENSG00000130182		"""-"", ""Zinc fingers, C2H2-type"""	12997	protein-coding gene	gene with protein product			"""zinc finger protein 206"""	ZNF206		9653642	Standard	NM_032805		Approved		uc002ctv.1	Q96SZ4		ENST00000252463.2:c.1197C>T	16.37:g.3140073G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQD3|H0YFS6|Q1WWM2	Silent	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.H399	ENST00000252463.2	37	c.1197	CCDS10493.1	16																																																																																			ZSCAN10	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.701	ZSCAN10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN10	HGNC	protein_coding	OTTHUMT00000437124.2	G	NM_032805		3140073	-1	no_errors	ENST00000252463	ensembl	human	known	70_37	silent	SNP	0.181	A
