#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCA12	26154	genome.wustl.edu	37	2	215876718	215876718	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:215876718G>A	ENST00000272895.7	-	16	2317	c.2098C>T	c.(2098-2100)Ccc>Tcc	p.P700S	ABCA12_ENST00000389661.4_Missense_Mutation_p.P382S	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	700					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACACTTCTGGGCAGATGCATT	0.408																																					Ovarian(66;664 1488 5121 34295)												0													244.0	234.0	238.0					2																	215876718		2203	4300	6503	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2098C>T	2.37:g.215876718G>A	ENSP00000272895:p.Pro700Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P700S	ENST00000272895.7	37	c.2098	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580698	0.28180	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.87256	-2.22;-2.23	5.73	0.291	0.15732	.	0.239374	0.30011	N	0.010625	T	0.62282	0.2415	N	0.04508	-0.205	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.53528	-0.8426	10	0.05721	T	0.95	.	4.0818	0.09929	0.3873:0.1705:0.4422:0.0	.	700;382	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	S	700;382	ENSP00000272895:P700S;ENSP00000374312:P382S	ENSP00000272895:P700S	P	-	1	0	ABCA12	215584963	0.998000	0.40836	0.974000	0.42286	0.978000	0.69477	0.408000	0.21065	0.372000	0.24591	0.655000	0.94253	CCC	ABCA12	-	NULL		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	G	NM_173076		215876718	-1	no_errors	ENST00000272895	ensembl	human	known	70_37	missense	SNP	0.952	A
ABCA12	26154	genome.wustl.edu	37	2	215876718	215876718	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:215876718G>A	ENST00000272895.7	-	16	2317	c.2098C>T	c.(2098-2100)Ccc>Tcc	p.P700S	ABCA12_ENST00000389661.4_Missense_Mutation_p.P382S	NM_173076.2	NP_775099.2	Q86UK0	ABCAC_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 12	700					cellular homeostasis (GO:0019725)|ceramide transport (GO:0035627)|establishment of skin barrier (GO:0061436)|keratinization (GO:0031424)|lipid homeostasis (GO:0055088)|lipid transport (GO:0006869)|lung alveolus development (GO:0048286)|phospholipid efflux (GO:0033700)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of protein localization to cell surface (GO:2000010)|protein localization to plasma membrane (GO:0072659)|regulated secretory pathway (GO:0045055)|secretion by cell (GO:0032940)|surfactant homeostasis (GO:0043129)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|epidermal lamellar body (GO:0097209)|integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|plasma membrane (GO:0005886)	apolipoprotein A-I receptor binding (GO:0034191)|ATP binding (GO:0005524)|lipid transporter activity (GO:0005319)|lipid-transporting ATPase activity (GO:0034040)|receptor binding (GO:0005102)			NS(3)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(45)|lung(44)|ovary(8)|pancreas(2)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	139		Renal(323;0.127)		Epithelial(149;1.01e-05)|all cancers(144;0.00112)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.011)		ACACTTCTGGGCAGATGCATT	0.408																																					Ovarian(66;664 1488 5121 34295)												0													244.0	234.0	238.0					2																	215876718		2203	4300	6503	SO:0001583	missense	26154			AF418105	CCDS33372.1, CCDS33373.1	2q34	2012-03-14			ENSG00000144452	ENSG00000144452		"""ATP binding cassette transporters / subfamily A"""	14637	protein-coding gene	gene with protein product		607800	"""ichthyosis congenita II, lamellar ichthyosis B"""	ICR2B		11435397, 12915478, 8845852, 10094194	Standard	NM_015657		Approved	DKFZP434G232, LI2	uc002vew.3	Q86UK0	OTTHUMG00000154801	ENST00000272895.7:c.2098C>T	2.37:g.215876718G>A	ENSP00000272895:p.Pro700Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53QE2|Q53S55|Q8IZW6|Q96JT3|Q9Y4M5	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.P700S	ENST00000272895.7	37	c.2098	CCDS33372.1	2	.	.	.	.	.	.	.	.	.	.	G	11.24	1.580698	0.28180	.	.	ENSG00000144452	ENST00000272895;ENST00000389661	D;D	0.87256	-2.22;-2.23	5.73	0.291	0.15732	.	0.239374	0.30011	N	0.010625	T	0.62282	0.2415	N	0.04508	-0.205	0.80722	D	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.53528	-0.8426	10	0.05721	T	0.95	.	4.0818	0.09929	0.3873:0.1705:0.4422:0.0	.	700;382	Q86UK0;Q86UK0-2	ABCAC_HUMAN;.	S	700;382	ENSP00000272895:P700S;ENSP00000374312:P382S	ENSP00000272895:P700S	P	-	1	0	ABCA12	215584963	0.998000	0.40836	0.974000	0.42286	0.978000	0.69477	0.408000	0.21065	0.372000	0.24591	0.655000	0.94253	CCC	ABCA12	-	NULL		0.408	ABCA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA12	HGNC	protein_coding	OTTHUMT00000337111.1	G	NM_173076		215876718	-1	no_errors	ENST00000272895	ensembl	human	known	70_37	missense	SNP	0.952	A
ABHD14B	84836	genome.wustl.edu	37	3	52003448	52003448	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:52003448G>A	ENST00000483233.1	-	5	1133	c.627C>T	c.(625-627)ctC>ctT	p.L209L	RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000428823.2_5'Flank|ABHD14B_ENST00000487005.1_5'UTR|ABHD14B_ENST00000395008.2_Silent_p.L209L|ABHD14B_ENST00000361143.5_Silent_p.L209L|RP11-155D18.14_ENST00000489595.2_Intron|ABHD14B_ENST00000525795.1_Silent_p.L209L|PCBP4_ENST00000355852.2_5'Flank|PCBP4_ENST00000484633.1_5'Flank|PCBP4_ENST00000395013.3_5'Flank|ABHD14B_ENST00000461108.1_3'UTR|ABHD14B_ENST00000315877.10_Silent_p.L207L|PCBP4_ENST00000461554.1_5'Flank			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	209					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GGCTTCACTGGAGCCCCTGCA	0.627																																																	0													56.0	58.0	57.0					3																	52003448		2203	4299	6502	SO:0001819	synonymous_variant	84836			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.627C>T	3.37:g.52003448G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VK8|Q8N8W5	Silent	SNP	NULL	p.L209	ENST00000483233.1	37	c.627	CCDS2842.1	3																																																																																			ABHD14B	-	NULL		0.627	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABHD14B	HGNC	protein_coding	OTTHUMT00000349673.1	G	NM_032750		52003448	-1	no_errors	ENST00000361143	ensembl	human	known	70_37	silent	SNP	0.071	A
ABHD14B	84836	genome.wustl.edu	37	3	52003448	52003448	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:52003448G>A	ENST00000483233.1	-	5	1133	c.627C>T	c.(625-627)ctC>ctT	p.L209L	RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000428823.2_5'Flank|ABHD14B_ENST00000487005.1_5'UTR|ABHD14B_ENST00000395008.2_Silent_p.L209L|ABHD14B_ENST00000361143.5_Silent_p.L209L|RP11-155D18.14_ENST00000489595.2_Intron|ABHD14B_ENST00000525795.1_Silent_p.L209L|PCBP4_ENST00000355852.2_5'Flank|PCBP4_ENST00000484633.1_5'Flank|PCBP4_ENST00000395013.3_5'Flank|ABHD14B_ENST00000461108.1_3'UTR|ABHD14B_ENST00000315877.10_Silent_p.L207L|PCBP4_ENST00000461554.1_5'Flank			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B	209					metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GGCTTCACTGGAGCCCCTGCA	0.627																																																	0													56.0	58.0	57.0					3																	52003448		2203	4299	6502	SO:0001819	synonymous_variant	84836			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.627C>T	3.37:g.52003448G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VK8|Q8N8W5	Silent	SNP	NULL	p.L209	ENST00000483233.1	37	c.627	CCDS2842.1	3																																																																																			ABHD14B	-	NULL		0.627	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABHD14B	HGNC	protein_coding	OTTHUMT00000349673.1	G	NM_032750		52003448	-1	no_errors	ENST00000361143	ensembl	human	known	70_37	silent	SNP	0.071	A
ABHD14B	84836	genome.wustl.edu	37	3	52003871	52003871	+	Intron	SNP	G	G	A	rs201128395		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:52003871G>A	ENST00000483233.1	-	4	960				RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000428823.2_5'Flank|ABHD14B_ENST00000487005.1_Intron|ABHD14B_ENST00000395008.2_Intron|ABHD14B_ENST00000361143.5_Intron|RP11-155D18.14_ENST00000489595.2_Intron|ABHD14B_ENST00000525795.1_Intron|PCBP4_ENST00000355852.2_5'Flank|PCBP4_ENST00000484633.1_5'Flank|PCBP4_ENST00000395013.3_5'Flank|ABHD14B_ENST00000461108.1_Nonsense_Mutation_p.Q181*|ABHD14B_ENST00000315877.10_Intron|PCBP4_ENST00000461554.1_5'Flank			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B						metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GACACCCCTTGATTATCCAGC	0.572																																																	0																																										SO:0001627	intron_variant	84836			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.453+87C>T	3.37:g.52003871G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VK8|Q8N8W5	Nonsense_Mutation	SNP	NULL	p.Q181*	ENST00000483233.1	37	c.541	CCDS2842.1	3	.	.	.	.	.	.	.	.	.	.	G	11.89	1.774410	0.31411	.	.	ENSG00000114779	ENST00000461108	.	.	.	3.82	1.87	0.25490	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.3812	0.11295	0.1396:0.2302:0.6302:0.0	.	.	.	.	X	181	.	ENSP00000417564:Q181X	Q	-	1	0	ABHD14B	51978911	0.000000	0.05858	0.001000	0.08648	0.125000	0.20455	-0.069000	0.11542	0.500000	0.27991	0.462000	0.41574	CAA	ABHD14B	-	NULL		0.572	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABHD14B	HGNC	protein_coding	OTTHUMT00000349673.1	G	NM_032750		52003871	-1	no_errors	ENST00000461108	ensembl	human	putative	70_37	nonsense	SNP	0.002	A
ABHD14B	84836	genome.wustl.edu	37	3	52003871	52003871	+	Intron	SNP	G	G	A	rs201128395		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:52003871G>A	ENST00000483233.1	-	4	960				RP11-155D18.12_ENST00000488257.1_RNA|PCBP4_ENST00000428823.2_5'Flank|ABHD14B_ENST00000487005.1_Intron|ABHD14B_ENST00000395008.2_Intron|ABHD14B_ENST00000361143.5_Intron|RP11-155D18.14_ENST00000489595.2_Intron|ABHD14B_ENST00000525795.1_Intron|PCBP4_ENST00000355852.2_5'Flank|PCBP4_ENST00000484633.1_5'Flank|PCBP4_ENST00000395013.3_5'Flank|ABHD14B_ENST00000461108.1_Nonsense_Mutation_p.Q181*|ABHD14B_ENST00000315877.10_Intron|PCBP4_ENST00000461554.1_5'Flank			Q96IU4	ABHEB_HUMAN	abhydrolase domain containing 14B						metabolic process (GO:0008152)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	hydrolase activity (GO:0016787)			large_intestine(2)|lung(1)	3				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000548)|KIRC - Kidney renal clear cell carcinoma(197;0.00072)		GACACCCCTTGATTATCCAGC	0.572																																																	0																																										SO:0001627	intron_variant	84836			AK075112	CCDS2842.1	3p21.2	2009-01-12			ENSG00000114779	ENSG00000114779		"""Abhydrolase domain containing"""	28235	protein-coding gene	gene with protein product							Standard	NM_032750		Approved	MGC15429, CIB	uc011bdy.2	Q96IU4	OTTHUMG00000157816	ENST00000483233.1:c.453+87C>T	3.37:g.52003871G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VK8|Q8N8W5	Nonsense_Mutation	SNP	NULL	p.Q181*	ENST00000483233.1	37	c.541	CCDS2842.1	3	.	.	.	.	.	.	.	.	.	.	G	11.89	1.774410	0.31411	.	.	ENSG00000114779	ENST00000461108	.	.	.	3.82	1.87	0.25490	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	4.3812	0.11295	0.1396:0.2302:0.6302:0.0	.	.	.	.	X	181	.	ENSP00000417564:Q181X	Q	-	1	0	ABHD14B	51978911	0.000000	0.05858	0.001000	0.08648	0.125000	0.20455	-0.069000	0.11542	0.500000	0.27991	0.462000	0.41574	CAA	ABHD14B	-	NULL		0.572	ABHD14B-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ABHD14B	HGNC	protein_coding	OTTHUMT00000349673.1	G	NM_032750		52003871	-1	no_errors	ENST00000461108	ensembl	human	putative	70_37	nonsense	SNP	0.002	A
ACO1	48	genome.wustl.edu	37	9	32419137	32419137	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:32419137C>G	ENST00000309951.6	+	7	898	c.760C>G	c.(760-762)Ctg>Gtg	p.L254V	ACO1_ENST00000379923.1_Missense_Mutation_p.L254V|ACO1_ENST00000541043.1_Missense_Mutation_p.L155V	NM_002197.2	NP_002188.1	P21399	ACOC_HUMAN	aconitase 1, soluble	254					cellular iron ion homeostasis (GO:0006879)|citrate metabolic process (GO:0006101)|intestinal absorption (GO:0050892)|post-embryonic development (GO:0009791)|regulation of translation (GO:0006417)|response to iron(II) ion (GO:0010040)|tricarboxylic acid cycle (GO:0006099)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|aconitate hydratase activity (GO:0003994)|iron-responsive element binding (GO:0030350)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)			breast(1)|endometrium(7)|kidney(5)|large_intestine(6)|lung(6)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	30			LUSC - Lung squamous cell carcinoma(29;0.00813)	GBM - Glioblastoma multiforme(74;3.94e-06)		GCCCCACCCTCTGGTAACATC	0.507																																																	0													174.0	132.0	146.0					9																	32419137		2203	4300	6503	SO:0001583	missense	48			M58510	CCDS6525.1	9p21.1	2013-05-21			ENSG00000122729	ENSG00000122729	4.2.1.3		117	protein-coding gene	gene with protein product	"""aconitate hydratase, cytoplasmic"""	100880		IREB1		2172968, 2771641	Standard	NM_002197		Approved	IRP1, IREBP	uc003zqw.4	P21399	OTTHUMG00000019740	ENST00000309951.6:c.760C>G	9.37:g.32419137C>G	ENSP00000309477:p.Leu254Val	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRK7|Q14652|Q5VZA7	Missense_Mutation	SNP	pfam_Acoase/IPM_deHydtase_lsu_aba,pfam_AconitaseA/IPMdHydase_ssu_swvl,superfamily_Acoase/IPM_deHydtase_lsu_aba,superfamily_Aconitase/3IPM_dehydase_swvl,prints_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2	p.L254V	ENST00000309951.6	37	c.760	CCDS6525.1	9	.	.	.	.	.	.	.	.	.	.	C	10.95	1.497080	0.26861	.	.	ENSG00000122729	ENST00000432017;ENST00000309951;ENST00000379923;ENST00000379921;ENST00000541043	T;T;T	0.41758	0.99;0.99;0.99	5.64	5.64	0.86602	Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha (2);Aconitase/3-isopropylmalate dehydratase large subunit, alpha/beta/alpha, subdomain 2 (1);	0.181581	0.49305	D	0.000145	T	0.47544	0.1451	M	0.64997	1.995	0.54753	D	0.999985	B;B	0.29627	0.252;0.021	B;B	0.33454	0.164;0.055	T	0.47394	-0.9121	10	0.62326	D	0.03	-4.5375	18.4726	0.90779	0.0:1.0:0.0:0.0	.	290;254	Q59FI0;P21399	.;ACOC_HUMAN	V	290;254;254;254;155	ENSP00000309477:L254V;ENSP00000369255:L254V;ENSP00000438733:L155V	ENSP00000309477:L254V	L	+	1	2	ACO1	32409137	0.938000	0.31826	1.000000	0.80357	0.977000	0.68977	1.847000	0.39299	2.637000	0.89404	0.563000	0.77884	CTG	ACO1	-	pfam_Acoase/IPM_deHydtase_lsu_aba,superfamily_Acoase/IPM_deHydtase_lsu_aba,tigrfam_Aconitase/Fe_reg_prot_2		0.507	ACO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACO1	HGNC	protein_coding	OTTHUMT00000051998.3	C	NM_002197		32419137	+1	no_errors	ENST00000309951	ensembl	human	known	70_37	missense	SNP	1.000	G
ADCY5	111	genome.wustl.edu	37	3	123046604	123046604	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:123046604C>T	ENST00000462833.1	-	7	3020	c.1808G>A	c.(1807-1809)cGc>cAc	p.R603H	ADCY5_ENST00000491190.1_Missense_Mutation_p.R236H|ADCY5_ENST00000309879.5_Missense_Mutation_p.R253H	NM_183357.2	NP_899200.1	O95622	ADCY5_HUMAN	adenylate cyclase 5	603					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenosine receptor signaling pathway (GO:0001973)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|locomotory behavior (GO:0007626)|neuromuscular process controlling balance (GO:0050885)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|primary cilium (GO:0072372)	adenylate cyclase activity (GO:0004016)|adenylate cyclase binding (GO:0008179)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)			breast(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(22)|ovary(5)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(114;0.0342)		GATGTGGATGCGTCTACAGGG	0.557																																																	0													70.0	58.0	62.0					3																	123046604		2203	4300	6503	SO:0001583	missense	111			U65473	CCDS3022.1, CCDS56274.1	3q21.1	2013-02-04			ENSG00000173175	ENSG00000173175	4.6.1.1	"""Adenylate cyclases"""	236	protein-coding gene	gene with protein product		600293				10481931	Standard	NM_183357		Approved	AC5	uc003egh.2	O95622	OTTHUMG00000159517	ENST00000462833.1:c.1808G>A	3.37:g.123046604C>T	ENSP00000419361:p.Arg603His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z8A6|Q7RTV7|Q8NFM3	Missense_Mutation	SNP	pfam_A/G_cyclase,pfam_Adenylate_cyclase-like,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R603H	ENST00000462833.1	37	c.1808	CCDS3022.1	3	.	.	.	.	.	.	.	.	.	.	C	34	5.327237	0.95708	.	.	ENSG00000173175	ENST00000462833;ENST00000491190;ENST00000309879;ENST00000466617	D;D;D;D	0.81579	-1.51;-1.51;-1.51;-1.51	5.52	5.52	0.82312	Adenylyl cyclase class-3/4/guanylyl cyclase (4);	0.000000	0.64402	D	0.000001	D	0.90800	0.7111	M	0.83953	2.67	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.85130	0.749;0.997	D	0.91134	0.4940	10	0.56958	D	0.05	.	19.4472	0.94852	0.0:1.0:0.0:0.0	.	603;236	O95622;B3KWA8	ADCY5_HUMAN;.	H	603;236;253;162	ENSP00000419361:R603H;ENSP00000418537:R236H;ENSP00000308685:R253H;ENSP00000420082:R162H	ENSP00000308685:R253H	R	-	2	0	ADCY5	124529294	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.747000	0.85070	2.578000	0.87016	0.655000	0.94253	CGC	ADCY5	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase		0.557	ADCY5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY5	HGNC	protein_coding	OTTHUMT00000355889.4	C	XM_171048		123046604	-1	no_errors	ENST00000462833	ensembl	human	known	70_37	missense	SNP	1.000	T
PHYKPL	85007	genome.wustl.edu	37	5	177641849	177641849	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:177641849C>G	ENST00000308158.5	-	10	1354	c.1120G>C	c.(1120-1122)Gat>Cat	p.D374H	PHYKPL_ENST00000481811.1_5'UTR	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	374						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	GTGGCCTCATCTTTGATCAGA	0.537																																																	0													97.0	88.0	91.0					5																	177641849		2203	4300	6503	SO:0001583	missense	85007			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1120G>C	5.37:g.177641849C>G	ENSP00000310978:p.Asp374His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.D374H	ENST00000308158.5	37	c.1120	CCDS4434.1	5	.	.	.	.	.	.	.	.	.	.	C	26.8	4.769477	0.90020	.	.	ENSG00000175309	ENST00000308158	T	0.22743	1.94	5.45	5.45	0.79879	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.51500	0.1678	M	0.85099	2.735	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71184	0.972;0.953	T	0.58103	-0.7695	10	0.87932	D	0	-15.1341	16.778	0.85556	0.0:1.0:0.0:0.0	.	374;374	A8K7P6;Q8IUZ5	.;AT2L2_HUMAN	H	374	ENSP00000310978:D374H	ENSP00000310978:D374H	D	-	1	0	AGXT2L2	177574455	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	4.577000	0.60922	2.550000	0.86006	0.561000	0.74099	GAT	AGXT2L2	-	superfamily_PyrdxlP-dep_Trfase_major_dom		0.537	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2L2	HGNC	protein_coding	OTTHUMT00000253477.1	C	NM_032921		177641849	-1	no_errors	ENST00000308158	ensembl	human	known	70_37	missense	SNP	1.000	G
PHYKPL	85007	genome.wustl.edu	37	5	177641849	177641849	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:177641849C>G	ENST00000308158.5	-	10	1354	c.1120G>C	c.(1120-1122)Gat>Cat	p.D374H	PHYKPL_ENST00000481811.1_5'UTR	NM_153373.2	NP_699204.1	Q8IUZ5	AT2L2_HUMAN	5-phosphohydroxy-L-lysine phospho-lyase	374						mitochondrion (GO:0005739)	lyase activity (GO:0016829)|pyridoxal phosphate binding (GO:0030170)|transaminase activity (GO:0008483)									L-Alanine(DB00160)	GTGGCCTCATCTTTGATCAGA	0.537																																																	0													97.0	88.0	91.0					5																	177641849		2203	4300	6503	SO:0001583	missense	85007			BC037567	CCDS4434.1	5q35.3	2013-06-12	2013-06-12	2013-06-12	ENSG00000175309	ENSG00000175309	4.2.3.134		28249	protein-coding gene	gene with protein product	"""5-phosphonooxy-L-lysine phospho-lyase"""	614683	"""alanine-glyoxylate aminotransferase 2-like 2"""	AGXT2L2		22241472	Standard	NM_153373		Approved	MGC15875	uc003miz.3	Q8IUZ5	OTTHUMG00000130892	ENST00000308158.5:c.1120G>C	5.37:g.177641849C>G	ENSP00000310978:p.Asp374His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7P6|B3KN36|D3DWP9|Q8WYS6|Q96HW8	Missense_Mutation	SNP	pfam_Aminotrans_3,superfamily_PyrdxlP-dep_Trfase_major_dom	p.D374H	ENST00000308158.5	37	c.1120	CCDS4434.1	5	.	.	.	.	.	.	.	.	.	.	C	26.8	4.769477	0.90020	.	.	ENSG00000175309	ENST00000308158	T	0.22743	1.94	5.45	5.45	0.79879	Pyridoxal phosphate-dependent transferase, major region, subdomain 2 (1);Pyridoxal phosphate-dependent transferase, major domain (1);	0.000000	0.85682	D	0.000000	T	0.51500	0.1678	M	0.85099	2.735	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.71184	0.972;0.953	T	0.58103	-0.7695	10	0.87932	D	0	-15.1341	16.778	0.85556	0.0:1.0:0.0:0.0	.	374;374	A8K7P6;Q8IUZ5	.;AT2L2_HUMAN	H	374	ENSP00000310978:D374H	ENSP00000310978:D374H	D	-	1	0	AGXT2L2	177574455	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	4.577000	0.60922	2.550000	0.86006	0.561000	0.74099	GAT	AGXT2L2	-	superfamily_PyrdxlP-dep_Trfase_major_dom		0.537	PHYKPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGXT2L2	HGNC	protein_coding	OTTHUMT00000253477.1	C	NM_032921		177641849	-1	no_errors	ENST00000308158	ensembl	human	known	70_37	missense	SNP	1.000	G
AHCTF1	25909	genome.wustl.edu	37	1	247028619	247028619	+	Intron	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:247028619G>T	ENST00000391829.2	-	27	3471				AHCTF1_ENST00000366508.1_Intron|AHCTF1_ENST00000470300.1_5'UTR|AHCTF1_ENST00000326225.3_Intron			Q8WYP5	ELYS_HUMAN	AT hook containing transcription factor 1						cytokinesis (GO:0000910)|mitotic cell cycle (GO:0000278)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|kinetochore (GO:0000776)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(6)|cervix(3)|endometrium(8)|kidney(6)|large_intestine(12)|liver(2)|lung(21)|ovary(5)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	74	all_cancers(71;3.05e-05)|all_epithelial(71;6.72e-06)|Ovarian(71;0.0173)|Breast(184;0.0318)|all_lung(81;0.0458)|Lung NSC(105;0.0518)	all_cancers(173;0.0266)	OV - Ovarian serous cystadenocarcinoma(106;0.00271)			TGTAGTTGCAGTACCTTCCTT	0.403																																					Colon(145;197 1800 4745 15099 26333)												0																																										SO:0001627	intron_variant	25909				CCDS1629.1, CCDS1629.2	1q44	2008-09-09			ENSG00000153207	ENSG00000153207			24618	protein-coding gene	gene with protein product	"""ELYS transcription factor like protein TMBS62"""	610853				11952839	Standard	NM_015446		Approved	ELYS	uc001ibv.2	Q8WYP5	OTTHUMG00000040706	ENST00000391829.2:c.3348-1201C>A	1.37:g.247028619G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGM0|A8MSG9|A8MZ86|Q7Z4E3|Q8IZA4|Q96EH9|Q9Y4Q6	RNA	SNP	-	NULL	ENST00000391829.2	37	NULL		1																																																																																			AHCTF1	-	-		0.403	AHCTF1-201	KNOWN	basic|appris_candidate	protein_coding	AHCTF1	HGNC	protein_coding		G	NM_015446		247028619	-1	no_errors	ENST00000470300	ensembl	human	known	70_37	rna	SNP	0.000	T
AKAP13	11214	genome.wustl.edu	37	15	86076934	86076934	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:86076934C>G	ENST00000394518.2	+	4	396	c.301C>G	c.(301-303)Caa>Gaa	p.Q101E	AKAP13_ENST00000361243.2_Missense_Mutation_p.Q101E|AKAP13_ENST00000560302.1_Missense_Mutation_p.Q101E	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	101					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TGATGCAGCTCAATTCCTAGC	0.493																																					Melanoma(94;603 1453 3280 32295 32951)												0													147.0	136.0	139.0					15																	86076934		2202	4299	6501	SO:0001583	missense	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.301C>G	15.37:g.86076934C>G	ENSP00000378026:p.Gln101Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.Q101E	ENST00000394518.2	37	c.301	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905370	0.72868	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.62498	0.02;0.02	5.67	5.67	0.87782	.	.	.	.	.	T	0.72407	0.3456	L	0.34521	1.04	0.80722	D	1	P;D;D	0.67145	0.952;0.971;0.996	B;P;D	0.77557	0.265;0.453;0.99	T	0.74169	-0.3752	9	0.87932	D	0	.	19.115	0.93334	0.0:1.0:0.0:0.0	.	101;101;101	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	E	101;101;100;100	ENSP00000354718:Q101E;ENSP00000378026:Q101E	ENSP00000354718:Q101E	Q	+	1	0	AKAP13	83877938	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	5.317000	0.65822	2.828000	0.97474	0.655000	0.94253	CAA	AKAP13	-	NULL		0.493	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	C	NM_007200		86076934	+1	no_errors	ENST00000361243	ensembl	human	known	70_37	missense	SNP	1.000	G
AKAP13	11214	genome.wustl.edu	37	15	86076934	86076934	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:86076934C>G	ENST00000394518.2	+	4	396	c.301C>G	c.(301-303)Caa>Gaa	p.Q101E	AKAP13_ENST00000361243.2_Missense_Mutation_p.Q101E|AKAP13_ENST00000560302.1_Missense_Mutation_p.Q101E	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	101					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TGATGCAGCTCAATTCCTAGC	0.493																																					Melanoma(94;603 1453 3280 32295 32951)												0													147.0	136.0	139.0					15																	86076934		2202	4299	6501	SO:0001583	missense	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.301C>G	15.37:g.86076934C>G	ENSP00000378026:p.Gln101Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.Q101E	ENST00000394518.2	37	c.301	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905370	0.72868	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	T;T	0.62498	0.02;0.02	5.67	5.67	0.87782	.	.	.	.	.	T	0.72407	0.3456	L	0.34521	1.04	0.80722	D	1	P;D;D	0.67145	0.952;0.971;0.996	B;P;D	0.77557	0.265;0.453;0.99	T	0.74169	-0.3752	9	0.87932	D	0	.	19.115	0.93334	0.0:1.0:0.0:0.0	.	101;101;101	Q12802;Q12802-2;Q12802-5	AKP13_HUMAN;.;.	E	101;101;100;100	ENSP00000354718:Q101E;ENSP00000378026:Q101E	ENSP00000354718:Q101E	Q	+	1	0	AKAP13	83877938	1.000000	0.71417	0.996000	0.52242	0.955000	0.61496	5.317000	0.65822	2.828000	0.97474	0.655000	0.94253	CAA	AKAP13	-	NULL		0.493	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	C	NM_007200		86076934	+1	no_errors	ENST00000361243	ensembl	human	known	70_37	missense	SNP	1.000	G
AKAP17A	8227	genome.wustl.edu	37	X	1719891	1719891	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:1719891G>C	ENST00000313871.3	+	5	1688	c.1492G>C	c.(1492-1494)Gag>Cag	p.E498Q		NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	498					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						TGCCCCCAAGGAGAGCCCGGC	0.716																																																	0									,GLN/GLU	0,4378		0,0,2189	13.0	15.0	14.0		,1492	0.6	0.0	X		14	2,8528		0,2,4263	no	intron,missense	ASMT,AKAP17A	NM_004043.2,NM_005088.2	,29	0,2,6452	CC,CG,GG		0.0234,0.0,0.0155	,probably-damaging	,498/696	1719891	2,12906	2189	4265	6454	SO:0001583	missense	8227			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1492G>C	X.37:g.1719891G>C	ENSP00000324827:p.Glu498Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	NULL	p.E498Q	ENST00000313871.3	37	c.1492	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	g	12.06	1.825807	0.32237	0.0	2.34E-4	ENSG00000197976	ENST00000313871	T	0.52754	0.65	1.56	0.551	0.17225	.	0.000000	0.36234	U	0.002705	T	0.53206	0.1782	.	.	.	0.09310	N	0.999998	D	0.65815	0.995	D	0.71184	0.972	T	0.38308	-0.9667	9	0.26408	T	0.33	.	6.1515	0.20314	0.2962:0.0:0.7038:0.0	.	498	Q02040	AK17A_HUMAN	Q	498	ENSP00000324827:E498Q	ENSP00000324827:E498Q	E	+	1	0	AKAP17A	1679891	0.082000	0.21442	0.043000	0.18650	0.200000	0.23975	2.775000	0.47702	0.533000	0.28675	0.367000	0.22151	GAG	AKAP17A	-	NULL		0.716	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	G	NM_005088		1719891	+1	no_errors	ENST00000313871	ensembl	human	known	70_37	missense	SNP	0.001	C
AKAP17A	8227	genome.wustl.edu	37	X	1719891	1719891	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:1719891G>C	ENST00000313871.3	+	5	1688	c.1492G>C	c.(1492-1494)Gag>Cag	p.E498Q		NM_005088.2	NP_005079.2	Q02040	AK17A_HUMAN	A kinase (PRKA) anchor protein 17A	498					B cell activation (GO:0042113)|mRNA processing (GO:0006397)|regulation of RNA splicing (GO:0043484)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)	nuclear speck (GO:0016607)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein kinase A binding (GO:0051018)			breast(2)|endometrium(5)|kidney(3)|large_intestine(1)|lung(12)|prostate(3)	26						TGCCCCCAAGGAGAGCCCGGC	0.716																																																	0									,GLN/GLU	0,4378		0,0,2189	13.0	15.0	14.0		,1492	0.6	0.0	X		14	2,8528		0,2,4263	no	intron,missense	ASMT,AKAP17A	NM_004043.2,NM_005088.2	,29	0,2,6452	CC,CG,GG		0.0234,0.0,0.0155	,probably-damaging	,498/696	1719891	2,12906	2189	4265	6454	SO:0001583	missense	8227			L03426	CCDS14116.1	Xp22.33 and Yp11.32	2010-09-08	2010-09-08	2010-09-08	ENSG00000197976	ENSG00000197976		"""Pseudoautosomal regions / PAR1"", ""A-kinase anchor proteins"""	18783	protein-coding gene	gene with protein product		312095, 465000	"""chromosome X and Y open reading frame 3"", ""splicing factor, arginine/serine-rich 17A"""	CXYorf3, SFRS17A		9736779, 1438229, 19840947	Standard	NR_027383		Approved	XE7, XE7Y, DXYS155E, MGC39904, 721P, CCDC133	uc004cqa.3	Q02040	OTTHUMG00000021063	ENST00000313871.3:c.1492G>C	X.37:g.1719891G>C	ENSP00000324827:p.Glu498Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q02832|Q2TB98|Q5JQ74|Q5JQ76|Q8N6U9	Missense_Mutation	SNP	NULL	p.E498Q	ENST00000313871.3	37	c.1492	CCDS14116.1	X	.	.	.	.	.	.	.	.	.	.	g	12.06	1.825807	0.32237	0.0	2.34E-4	ENSG00000197976	ENST00000313871	T	0.52754	0.65	1.56	0.551	0.17225	.	0.000000	0.36234	U	0.002705	T	0.53206	0.1782	.	.	.	0.09310	N	0.999998	D	0.65815	0.995	D	0.71184	0.972	T	0.38308	-0.9667	9	0.26408	T	0.33	.	6.1515	0.20314	0.2962:0.0:0.7038:0.0	.	498	Q02040	AK17A_HUMAN	Q	498	ENSP00000324827:E498Q	ENSP00000324827:E498Q	E	+	1	0	AKAP17A	1679891	0.082000	0.21442	0.043000	0.18650	0.200000	0.23975	2.775000	0.47702	0.533000	0.28675	0.367000	0.22151	GAG	AKAP17A	-	NULL		0.716	AKAP17A-003	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP17A	HGNC	protein_coding	OTTHUMT00000055609.2	G	NM_005088		1719891	+1	no_errors	ENST00000313871	ensembl	human	known	70_37	missense	SNP	0.001	C
AKAP6	9472	genome.wustl.edu	37	14	33290861	33290861	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:33290861C>G	ENST00000280979.4	+	13	4012	c.3842C>G	c.(3841-3843)tCt>tGt	p.S1281C	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1281					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ACTGCCCCCTCTAGTCCACAC	0.468																																					Melanoma(49;821 1200 7288 13647 42351)												0													77.0	64.0	68.0					14																	33290861		2203	4300	6503	SO:0001583	missense	9472			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3842C>G	14.37:g.33290861C>G	ENSP00000280979:p.Ser1281Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.S1281C	ENST00000280979.4	37	c.3842	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	10.36	1.328898	0.24167	.	.	ENSG00000151320	ENST00000280979	T	0.05996	3.36	6.03	5.12	0.69794	.	0.150830	0.45606	D	0.000344	T	0.10380	0.0254	L	0.57536	1.79	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.02484	-1.1152	10	0.87932	D	0	-3.2379	15.5203	0.75859	0.0:0.8625:0.1375:0.0	.	1281	Q13023	AKAP6_HUMAN	C	1281	ENSP00000280979:S1281C	ENSP00000280979:S1281C	S	+	2	0	AKAP6	32360612	0.941000	0.31946	0.998000	0.56505	0.631000	0.37964	5.350000	0.66016	1.518000	0.48934	0.655000	0.94253	TCT	AKAP6	-	NULL		0.468	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	C	NM_004274		33290861	+1	no_errors	ENST00000280979	ensembl	human	known	70_37	missense	SNP	0.993	G
AKAP6	9472	genome.wustl.edu	37	14	33290861	33290861	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:33290861C>G	ENST00000280979.4	+	13	4012	c.3842C>G	c.(3841-3843)tCt>tGt	p.S1281C	AKAP6_ENST00000557272.1_Intron	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	1281					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		ACTGCCCCCTCTAGTCCACAC	0.468																																					Melanoma(49;821 1200 7288 13647 42351)												0													77.0	64.0	68.0					14																	33290861		2203	4300	6503	SO:0001583	missense	9472			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.3842C>G	14.37:g.33290861C>G	ENSP00000280979:p.Ser1281Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.S1281C	ENST00000280979.4	37	c.3842	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	10.36	1.328898	0.24167	.	.	ENSG00000151320	ENST00000280979	T	0.05996	3.36	6.03	5.12	0.69794	.	0.150830	0.45606	D	0.000344	T	0.10380	0.0254	L	0.57536	1.79	0.80722	D	1	B	0.11235	0.004	B	0.12156	0.007	T	0.02484	-1.1152	10	0.87932	D	0	-3.2379	15.5203	0.75859	0.0:0.8625:0.1375:0.0	.	1281	Q13023	AKAP6_HUMAN	C	1281	ENSP00000280979:S1281C	ENSP00000280979:S1281C	S	+	2	0	AKAP6	32360612	0.941000	0.31946	0.998000	0.56505	0.631000	0.37964	5.350000	0.66016	1.518000	0.48934	0.655000	0.94253	TCT	AKAP6	-	NULL		0.468	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	C	NM_004274		33290861	+1	no_errors	ENST00000280979	ensembl	human	known	70_37	missense	SNP	0.993	G
AKT3	10000	genome.wustl.edu	37	1	243952039	243952039	+	Intron	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:243952039T>C	ENST00000366539.1	-	2	247				AKT3_ENST00000366540.1_Intron|AKT3_ENST00000263826.5_Intron|AKT3_ENST00000336199.5_Intron			Q9Y243	AKT3_HUMAN	v-akt murine thymoma viral oncogene homolog 3						mitochondrial genome maintenance (GO:0000002)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(12)|prostate(1)|skin(3)|stomach(1)	26	all_cancers(71;0.000307)|all_epithelial(71;0.000374)|all_lung(81;0.0323)|Ovarian(71;0.0619)|all_neural(11;0.101)|Lung NSC(105;0.168)	all_cancers(173;0.0274)	all cancers(7;4.3e-08)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00196)			cagcaagtcataaactttttg	0.393																																																	0																																										SO:0001627	intron_variant	10000			AF124141	CCDS31076.1, CCDS31077.1	1q44	2013-07-09	2013-07-09		ENSG00000117020	ENSG00000117020	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	393	protein-coding gene	gene with protein product	"""protein kinase B, gamma"""	611223				10092583, 10208883	Standard	NM_005465		Approved	PKBG, RAC-gamma, PRKBG	uc001iab.2	Q9Y243	OTTHUMG00000039994	ENST00000366539.1:c.46+54387A>G	1.37:g.243952039T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VAA6|Q5VTI1|Q5VTI2|Q96QV3|Q9UFP5	RNA	SNP	-	NULL	ENST00000366539.1	37	NULL	CCDS31077.1	1																																																																																			AKT3	-	-		0.393	AKT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKT3	HGNC	protein_coding	OTTHUMT00000096479.1	T	NM_181690		243952039	-1	no_errors	ENST00000550388	ensembl	human	known	70_37	rna	SNP	0.020	C
AMPH	273	genome.wustl.edu	37	7	38432237	38432237	+	Intron	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:38432237G>A	ENST00000356264.2	-	19	1824				AMPH_ENST00000325590.5_Intron|AMPH_ENST00000471913.1_Intron|AMPH_ENST00000428293.2_Intron	NM_001635.3	NP_001626.1	P49418	AMPH_HUMAN	amphiphysin						endocytosis (GO:0006897)|learning (GO:0007612)|synaptic transmission (GO:0007268)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|leading edge membrane (GO:0031256)|synaptic vesicle (GO:0008021)	phospholipid binding (GO:0005543)			breast(1)|endometrium(3)|kidney(3)|large_intestine(12)|liver(3)|lung(27)|ovary(3)|prostate(1)|skin(7)|upper_aerodigestive_tract(2)	62						cgcccacctcggcctcccaaa	0.577																																																	0																																										SO:0001627	intron_variant	273				CCDS5456.1, CCDS47574.1	7p14-p13	2007-06-19	2007-06-19		ENSG00000078053	ENSG00000078053			471	protein-coding gene	gene with protein product		600418	"""amphiphysin (Stiff-Mann syndrome with breast cancer 128kD autoantigen)"", ""amphiphysin (Stiff-Man syndrome with breast cancer 128kDa autoantigen)"""			8245793	Standard	NM_139316		Approved		uc003tgu.3	P49418	OTTHUMG00000023725	ENST00000356264.2:c.1609-619C>T	7.37:g.38432237G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1X8|A4D1X9|O43538|Q75MJ8|Q75MK5|Q75MM3|Q8N4G0	RNA	SNP	-	NULL	ENST00000356264.2	37	NULL	CCDS5456.1	7																																																																																			AMPH	-	-		0.577	AMPH-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AMPH	HGNC	protein_coding	OTTHUMT00000226953.2	G	NM_001635		38432237	-1	no_errors	ENST00000460887	ensembl	human	known	70_37	rna	SNP	0.019	A
ANKRD26	22852	genome.wustl.edu	37	10	27335121	27335121	+	Intron	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:27335121G>A	ENST00000376087.4	-	18	2151				ANKRD26_ENST00000436985.2_Intron|ANKRD26_ENST00000376070.3_Intron	NM_001256053.1|NM_014915.2	NP_001242982.1|NP_055730.2	Q9UPS8	ANR26_HUMAN	ankyrin repeat domain 26						glucose homeostasis (GO:0042593)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of multicellular organism growth (GO:0040015)|negative regulation of organ growth (GO:0046621)|regulation of fatty acid metabolic process (GO:0019217)|regulation of feeding behavior (GO:0060259)	actin filament (GO:0005884)|centrosome (GO:0005813)				breast(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|lung(30)|ovary(1)|pancreas(1)|prostate(3)|skin(2)|urinary_tract(2)	70						accatttattgaaatggctgc	0.438																																																	0																																										SO:0001627	intron_variant	22852			AB028997	CCDS41499.1	10p12.1	2014-09-17			ENSG00000107890	ENSG00000107890		"""Ankyrin repeat domain containing"""	29186	protein-coding gene	gene with protein product		610855	"""thrombocytopenia 2 (autosomal dominant)"""	THC2		10470851, 21211618	Standard	NM_014915		Approved	KIAA1074	uc009xku.1	Q9UPS8	OTTHUMG00000017851	ENST00000376087.4:c.1985+160C>T	10.37:g.27335121G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NH29|Q2TAZ3|Q6ZR14|Q9H1Q1|Q9NSK9|Q9NTD5|Q9NW69	RNA	SNP	-	NULL	ENST00000376087.4	37	NULL	CCDS41499.1	10																																																																																			ANKRD26	-	-		0.438	ANKRD26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD26	HGNC	protein_coding	OTTHUMT00000047296.1	G			27335121	-1	no_errors	ENST00000490015	ensembl	human	known	70_37	rna	SNP	0.001	A
ARFGEF2	10564	genome.wustl.edu	37	20	47592587	47592587	+	Silent	SNP	T	T	C	rs142912624		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:47592587T>C	ENST00000371917.4	+	14	1809	c.1809T>C	c.(1807-1809)gaT>gaC	p.D603D		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	603					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AAATAGGGGATGGGAAAGGCC	0.532																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0								T		3,4403	6.2+/-15.9	0,3,2200	100.0	79.0	86.0		1809	-7.6	0.9	20	dbSNP_134	86	0,8600		0,0,4300	no	coding-synonymous	ARFGEF2	NM_006420.2		0,3,6500	CC,CT,TT		0.0,0.0681,0.0231		603/1786	47592587	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	10564			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1809T>C	20.37:g.47592587T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TFT9|Q9NTS1	Silent	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.D603	ENST00000371917.4	37	c.1809	CCDS13411.1	20																																																																																			ARFGEF2	-	superfamily_ARM-type_fold		0.532	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	T	NM_006420		47592587	+1	no_errors	ENST00000371917	ensembl	human	known	70_37	silent	SNP	0.002	C
ARFGEF2	10564	genome.wustl.edu	37	20	47592587	47592587	+	Silent	SNP	T	T	C	rs142912624		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:47592587T>C	ENST00000371917.4	+	14	1809	c.1809T>C	c.(1807-1809)gaT>gaC	p.D603D		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	603					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AAATAGGGGATGGGAAAGGCC	0.532																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0								T		3,4403	6.2+/-15.9	0,3,2200	100.0	79.0	86.0		1809	-7.6	0.9	20	dbSNP_134	86	0,8600		0,0,4300	no	coding-synonymous	ARFGEF2	NM_006420.2		0,3,6500	CC,CT,TT		0.0,0.0681,0.0231		603/1786	47592587	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	10564			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1809T>C	20.37:g.47592587T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TFT9|Q9NTS1	Silent	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.D603	ENST00000371917.4	37	c.1809	CCDS13411.1	20																																																																																			ARFGEF2	-	superfamily_ARM-type_fold		0.532	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	T	NM_006420		47592587	+1	no_errors	ENST00000371917	ensembl	human	known	70_37	silent	SNP	0.002	C
ARHGAP21	57584	genome.wustl.edu	37	10	24909044	24909044	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:24909044G>A	ENST00000396432.2	-	9	2266	c.1780C>T	c.(1780-1782)Cag>Tag	p.Q594*	ARHGAP21_ENST00000320481.6_Nonsense_Mutation_p.Q381*	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	593					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CTGTTTGACTGCAATGTTTTT	0.423																																																	0													80.0	78.0	79.0					10																	24909044		2203	4300	6503	SO:0001587	stop_gained	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1780C>T	10.37:g.24909044G>A	ENSP00000379709:p.Gln594*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.Q594*	ENST00000396432.2	37	c.1780	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	G	37	5.990646	0.97179	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	.	.	.	5.5	5.5	0.81552	.	0.361215	0.26951	N	0.021679	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	19.7622	0.96325	0.0:0.0:1.0:0.0	.	.	.	.	X	594;381;584;594;429	.	ENSP00000365604:Q381X	Q	-	1	0	ARHGAP21	24949050	0.971000	0.33674	0.009000	0.14445	0.008000	0.06430	5.054000	0.64275	2.732000	0.93576	0.650000	0.86243	CAG	ARHGAP21	-	NULL		0.423	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	G	NM_020824		24909044	-1	no_errors	ENST00000396432	ensembl	human	known	70_37	nonsense	SNP	0.051	A
ARHGAP21	57584	genome.wustl.edu	37	10	24909044	24909044	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:24909044G>A	ENST00000396432.2	-	9	2266	c.1780C>T	c.(1780-1782)Cag>Tag	p.Q594*	ARHGAP21_ENST00000320481.6_Nonsense_Mutation_p.Q381*	NM_020824.3	NP_065875.3	Q5T5U3	RHG21_HUMAN	Rho GTPase activating protein 21	593					establishment of Golgi localization (GO:0051683)|Golgi organization (GO:0007030)|maintenance of Golgi location (GO:0051684)|organelle transport along microtubule (GO:0072384)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(11)|kidney(4)|large_intestine(17)|lung(21)|ovary(7)|pancreas(1)|prostate(5)|skin(2)|stomach(2)|urinary_tract(1)	78						CTGTTTGACTGCAATGTTTTT	0.423																																																	0													80.0	78.0	79.0					10																	24909044		2203	4300	6503	SO:0001587	stop_gained	57584			AF480466	CCDS7144.2	10p12.31	2013-01-10			ENSG00000107863	ENSG00000107863		"""Rho GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"""	23725	protein-coding gene	gene with protein product		609870				12056806	Standard	NM_020824		Approved	KIAA1424, ARHGAP10	uc001isb.2	Q5T5U3	OTTHUMG00000017825	ENST00000396432.2:c.1780C>T	10.37:g.24909044G>A	ENSP00000379709:p.Gln594*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VF98|Q7Z3P7|Q8N3A2|Q8NI19|Q8TBV5|Q9P2C3	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,pfam_Pleckstrin_homology,pfam_PDZ,superfamily_Rho_GTPase_activation_prot,superfamily_PDZ,smart_PDZ,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.Q594*	ENST00000396432.2	37	c.1780	CCDS7144.2	10	.	.	.	.	.	.	.	.	.	.	G	37	5.990646	0.97179	.	.	ENSG00000107863	ENST00000396432;ENST00000320481;ENST00000376410;ENST00000446003;ENST00000445703	.	.	.	5.5	5.5	0.81552	.	0.361215	0.26951	N	0.021679	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	19.7622	0.96325	0.0:0.0:1.0:0.0	.	.	.	.	X	594;381;584;594;429	.	ENSP00000365604:Q381X	Q	-	1	0	ARHGAP21	24949050	0.971000	0.33674	0.009000	0.14445	0.008000	0.06430	5.054000	0.64275	2.732000	0.93576	0.650000	0.86243	CAG	ARHGAP21	-	NULL		0.423	ARHGAP21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP21	HGNC	protein_coding	OTTHUMT00000047229.4	G	NM_020824		24909044	-1	no_errors	ENST00000396432	ensembl	human	known	70_37	nonsense	SNP	0.051	A
ARHGAP5	394	genome.wustl.edu	37	14	32615493	32615493	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:32615493G>T	ENST00000345122.3	+	4	4205	c.3890G>T	c.(3889-3891)cGt>cTt	p.R1297L	ARHGAP5_ENST00000539826.2_Missense_Mutation_p.R1297L|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.R1296L|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.R1296L|ARHGAP5_ENST00000433497.1_Missense_Mutation_p.R36L|ARHGAP5_ENST00000396582.2_Missense_Mutation_p.R32L	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1297	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GGACTCTACCGTGTCAGCGGG	0.353																																					NSCLC(9;77 350 3443 29227 41353)												0													104.0	103.0	104.0					14																	32615493		2203	4300	6503	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3890G>T	14.37:g.32615493G>T	ENSP00000371897:p.Arg1297Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.R1297L	ENST00000345122.3	37	c.3890	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.167049	0.94768	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497;ENST00000554090	T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.28	5.28	0.74379	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	D	0.83064	0.5173	H	0.99312	4.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.90420	0.4416	10	0.87932	D	0	.	19.2809	0.94052	0.0:0.0:1.0:0.0	.	32;1296;1297	Q13017-3;Q13017-2;Q13017	.;.;RHG05_HUMAN	L	1296;1297;32;1297;1296;36;36	ENSP00000452222:R1296L;ENSP00000441692:R1297L;ENSP00000379827:R32L;ENSP00000371897:R1297L;ENSP00000393307:R1296L;ENSP00000407395:R36L;ENSP00000451061:R36L	ENSP00000371897:R1297L	R	+	2	0	ARHGAP5	31685244	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.230000	0.95299	2.624000	0.88883	0.585000	0.79938	CGT	ARHGAP5	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.353	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	G	NM_001030055		32615493	+1	no_errors	ENST00000345122	ensembl	human	known	70_37	missense	SNP	1.000	T
ARHGAP5	394	genome.wustl.edu	37	14	32615493	32615493	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:32615493G>T	ENST00000345122.3	+	4	4205	c.3890G>T	c.(3889-3891)cGt>cTt	p.R1297L	ARHGAP5_ENST00000539826.2_Missense_Mutation_p.R1297L|ARHGAP5_ENST00000432921.1_Missense_Mutation_p.R1296L|ARHGAP5_ENST00000556611.1_Missense_Mutation_p.R1296L|ARHGAP5_ENST00000433497.1_Missense_Mutation_p.R36L|ARHGAP5_ENST00000396582.2_Missense_Mutation_p.R32L	NM_001030055.1	NP_001025226.1	Q13017	RHG05_HUMAN	Rho GTPase activating protein 5	1297	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				cell adhesion (GO:0007155)|GTP catabolic process (GO:0006184)|mammary gland development (GO:0030879)|positive regulation of cell migration (GO:0030335)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell size (GO:0008361)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(10)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(12)|ovary(4)|skin(1)|stomach(1)|urinary_tract(4)	55	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.186)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0952)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00566)		GGACTCTACCGTGTCAGCGGG	0.353																																					NSCLC(9;77 350 3443 29227 41353)												0													104.0	103.0	104.0					14																	32615493		2203	4300	6503	SO:0001583	missense	394			U17032	CCDS32062.1, CCDS45095.1	14q12	2010-02-05						"""Rho GTPase activating proteins"""	675	protein-coding gene	gene with protein product		602680	"""growth factor independent 2"""	GFI2		8537347	Standard	XM_005267635		Approved	RhoGAP5, p190-B, p190BRhoGAP	uc001wrn.3	Q13017		ENST00000345122.3:c.3890G>T	14.37:g.32615493G>T	ENSP00000371897:p.Arg1297Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L375|A1L376|A8KAA1|D3DS89|D3DS90|Q05BE8|Q05BU8|Q59ER0|Q6DHZ3	Missense_Mutation	SNP	pfam_RhoGAP_dom,pfam_FF_domain,pfam_Small_GTPase,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom,prints_Small_GTPase	p.R1297L	ENST00000345122.3	37	c.3890	CCDS32062.1	14	.	.	.	.	.	.	.	.	.	.	G	32	5.167049	0.94768	.	.	ENSG00000100852	ENST00000556611;ENST00000539826;ENST00000396582;ENST00000345122;ENST00000432921;ENST00000433497;ENST00000554090	T;T;T;T;T;T;T	0.52526	0.66;0.66;0.66;0.66;0.66;0.66;0.66	5.28	5.28	0.74379	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.85682	D	0.000000	D	0.83064	0.5173	H	0.99312	4.51	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	D	0.90420	0.4416	10	0.87932	D	0	.	19.2809	0.94052	0.0:0.0:1.0:0.0	.	32;1296;1297	Q13017-3;Q13017-2;Q13017	.;.;RHG05_HUMAN	L	1296;1297;32;1297;1296;36;36	ENSP00000452222:R1296L;ENSP00000441692:R1297L;ENSP00000379827:R32L;ENSP00000371897:R1297L;ENSP00000393307:R1296L;ENSP00000407395:R36L;ENSP00000451061:R36L	ENSP00000371897:R1297L	R	+	2	0	ARHGAP5	31685244	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.230000	0.95299	2.624000	0.88883	0.585000	0.79938	CGT	ARHGAP5	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.353	ARHGAP5-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP5	HGNC	protein_coding	OTTHUMT00000409735.1	G	NM_001030055		32615493	+1	no_errors	ENST00000345122	ensembl	human	known	70_37	missense	SNP	1.000	T
ARHGEF5	7984	genome.wustl.edu	37	7	144060156	144060156	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:144060156G>C	ENST00000056217.5	+	2	568	c.394G>C	c.(394-396)Gag>Cag	p.E132Q		NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	132					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					CATTCAGAGTGAGCATCTAGA	0.557																																																	0													5.0	5.0	5.0					7																	144060156		1026	2268	3294	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.394G>C	7.37:g.144060156G>C	ENSP00000056217:p.Glu132Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.E132Q	ENST00000056217.5	37	c.394	CCDS34771.1	7	.	.	.	.	.	.	.	.	.	.	G	10.58	1.388715	0.25118	.	.	ENSG00000050327	ENST00000056217	T	0.78816	-1.21	3.99	0.985	0.19779	.	0.878260	0.09189	U	0.836395	T	0.62853	0.2462	L	0.29908	0.895	0.09310	N	1	B	0.26512	0.151	B	0.28139	0.086	T	0.49153	-0.8969	9	.	.	.	.	4.3261	0.11041	0.2233:0.1897:0.5871:0.0	.	132	Q12774	ARHG5_HUMAN	Q	132	ENSP00000056217:E132Q	.	E	+	1	0	ARHGEF5	143691089	0.000000	0.05858	0.002000	0.10522	0.004000	0.04260	-0.106000	0.10890	0.338000	0.23692	0.650000	0.86243	GAG	ARHGEF5	-	NULL		0.557	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	G	NM_005435		144060156	+1	no_errors	ENST00000056217	ensembl	human	known	70_37	missense	SNP	0.001	C
ASB16	92591	genome.wustl.edu	37	17	42253983	42253983	+	Intron	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:42253983C>T	ENST00000293414.1	+	3	653				ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000592897.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		gtatgattcTCATGGAGGACA	0.502																																																	0																																										SO:0001627	intron_variant	339201			AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.570-123C>T	17.37:g.42253983C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBC0|Q8WXK0	RNA	SNP	-	NULL	ENST00000293414.1	37	NULL	CCDS11478.1	17																																																																																			CTB-175E5.4	-	-		0.502	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB16-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000457703.1	C			42253983	-1	no_errors	ENST00000585457	ensembl	human	known	70_37	rna	SNP	0.003	T
ASB16	92591	genome.wustl.edu	37	17	42253983	42253983	+	Intron	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:42253983C>T	ENST00000293414.1	+	3	653				ASB16-AS1_ENST00000585457.1_RNA|ASB16-AS1_ENST00000588785.1_RNA|ASB16-AS1_ENST00000591166.1_RNA|ASB16-AS1_ENST00000592897.1_RNA	NM_080863.4	NP_543139.4	Q96NS5	ASB16_HUMAN	ankyrin repeat and SOCS box containing 16						intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)					central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(2)|liver(2)|lung(2)|prostate(1)	14		Breast(137;0.00765)|Prostate(33;0.0313)		BRCA - Breast invasive adenocarcinoma(366;0.114)		gtatgattcTCATGGAGGACA	0.502																																																	0																																										SO:0001627	intron_variant	339201			AK054727	CCDS11478.1	17q21.31	2013-01-10	2011-01-25		ENSG00000161664	ENSG00000161664		"""Ankyrin repeat domain containing"""	19768	protein-coding gene	gene with protein product		615056	"""ankyrin repeat and SOCS box-containing 16"""			12076535	Standard	NM_080863		Approved	FLJ30165	uc002ifl.1	Q96NS5	OTTHUMG00000181809	ENST00000293414.1:c.570-123C>T	17.37:g.42253983C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBC0|Q8WXK0	RNA	SNP	-	NULL	ENST00000293414.1	37	NULL	CCDS11478.1	17																																																																																			CTB-175E5.4	-	-		0.502	ASB16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASB16-AS1	Clone_based_vega_gene	protein_coding	OTTHUMT00000457703.1	C			42253983	-1	no_errors	ENST00000585457	ensembl	human	known	70_37	rna	SNP	0.003	T
ASH1L	55870	genome.wustl.edu	37	1	155533434	155533434	+	5'Flank	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:155533434G>A	ENST00000368346.3	-	0	0				ASH1L-AS1_ENST00000452809.1_RNA|ASH1L_ENST00000548830.1_5'Flank|ASH1L_ENST00000392403.3_5'Flank			Q9NR48	ASH1L_HUMAN	ash1 (absent, small, or homeotic)-like (Drosophila)						cell-cell signaling (GO:0007267)|DNA packaging (GO:0006323)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|tight junction (GO:0005923)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(4)|central_nervous_system(1)|endometrium(12)|kidney(13)|large_intestine(28)|lung(39)|ovary(2)|pancreas(1)|prostate(6)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(4)	124	Hepatocellular(266;0.0997)|all_neural(408;0.129)|all_hematologic(923;0.145)		Epithelial(20;1.74e-08)|all cancers(21;3.29e-08)|BRCA - Breast invasive adenocarcinoma(34;0.021)			GGAGGATGAAGAAACCATGTG	0.403																																																	0																																										SO:0001631	upstream_gene_variant	645676			AB037841	CCDS1113.2	1q22	2013-01-28			ENSG00000116539	ENSG00000116539		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	19088	protein-coding gene	gene with protein product		607999				10860993, 16545939	Standard	NM_018489		Approved	huASH1, ASH1, ASH1L1, KMT2H	uc001fkt.3	Q9NR48	OTTHUMG00000014011		1.37:g.155533434G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59GP1|Q5T714|Q5T715|Q9P2C7	RNA	SNP	-	NULL	ENST00000368346.3	37	NULL		1																																																																																			ASH1L-AS1	-	-		0.403	ASH1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	ASH1L-AS1	HGNC	protein_coding	OTTHUMT00000039400.1	G	NM_018489		155533434	+1	no_errors	ENST00000452809	ensembl	human	known	70_37	rna	SNP	0.000	A
ATP6V0E2	155066	genome.wustl.edu	37	7	149571220	149571220	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:149571220C>T	ENST00000425642.2	+	1	89	c.66C>T	c.(64-66)atC>atT	p.I22I	ATP6V0E2-AS1_ENST00000488315.1_RNA|ATP6V0E2_ENST00000479613.1_Silent_p.I22I|ATP6V0E2_ENST00000606024.1_Silent_p.I22I|ATP6V0E2_ENST00000456496.2_Silent_p.I71I|ATP6V0E2-AS1_ENST00000461019.1_RNA|ATP6V0E2_ENST00000464662.1_Silent_p.I22I|ATP6V0E2_ENST00000421974.2_Silent_p.I71I|ATP6V0E2-AS1_ENST00000464939.1_RNA			Q8NHE4	VA0E2_HUMAN	ATPase, H+ transporting V0 subunit e2	22					ATP hydrolysis coupled proton transport (GO:0015991)|cell growth (GO:0016049)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)|vacuolar acidification (GO:0007035)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|phagocytic vesicle membrane (GO:0030670)|proton-transporting V-type ATPase, V0 domain (GO:0033179)	ATPase activity, coupled to transmembrane movement of ions (GO:0042625)|hydrogen ion transmembrane transporter activity (GO:0015078)			lung(1)	1			OV - Ovarian serous cystadenocarcinoma(82;0.00256)			TCGTCGGCATCGCCGGGCCCT	0.716																																																	0													5.0	8.0	7.0					7																	149571220		1543	3134	4677	SO:0001819	synonymous_variant	155066			AK057700	CCDS47742.1, CCDS55181.1	7q36.1	2010-04-21	2006-10-12	2006-10-12	ENSG00000171130	ENSG00000171130		"""ATPases / V-type"""	21723	protein-coding gene	gene with protein product		611019	"""chromosome 7 open reading frame 32"", ""ATPase, H+ transporting V0 subunit E isoform 2-like (rat)"""	C7orf32, ATP6V0E2L			Standard	XM_005249958		Approved		uc003wgs.3	Q8NHE4	OTTHUMG00000158094	ENST00000425642.2:c.66C>T	7.37:g.149571220C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2T863|A2T8L7|B5MDP5|J3KQW7|Q6MZW1|Q75L47|Q7Z4R7|Q8N7I8	Silent	SNP	pfam_ATPase_V0-cplx_esu	p.I71	ENST00000425642.2	37	c.213		7																																																																																			ATP6V0E2	-	pfam_ATPase_V0-cplx_esu		0.716	ATP6V0E2-010	KNOWN	basic|appris_principal	protein_coding	ATP6V0E2	HGNC	protein_coding	OTTHUMT00000470874.1	C	NM_145230		149571220	+1	no_errors	ENST00000421974	ensembl	human	known	70_37	silent	SNP	1.000	T
AURKB	9212	genome.wustl.edu	37	17	8109913	8109913	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:8109913C>T	ENST00000585124.1	-	7	675	c.582G>A	c.(580-582)aaG>aaA	p.K194K	AURKB_ENST00000578549.1_Silent_p.K162K|AURKB_ENST00000534871.1_Silent_p.K153K|AURKB_ENST00000316199.6_Silent_p.K195K|AURKB_ENST00000535053.1_3'UTR	NM_004217.3	NP_004208.2	Q96GD4	AURKB_HUMAN	aurora kinase B	194	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				abscission (GO:0009838)|aging (GO:0007568)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|cleavage furrow formation (GO:0036089)|cytokinesis checkpoint (GO:0031565)|histone H3-S28 phosphorylation (GO:0043988)|histone modification (GO:0016570)|mitotic cell cycle (GO:0000278)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytokinesis (GO:0032467)|protein autophosphorylation (GO:0046777)|protein localization to kinetochore (GO:0034501)|protein phosphorylation (GO:0006468)|regulation of chromosome segregation (GO:0051983)|spindle checkpoint (GO:0031577)|spindle midzone assembly involved in mitosis (GO:0051256)|spindle stabilization (GO:0043146)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|central_nervous_system(1)|lung(2)	4						GAATCACCTTCTTCCCATGGC	0.532																																					NSCLC(134;1161 2470 43664 51568)												0													141.0	115.0	124.0					17																	8109913		2203	4300	6503	SO:0001819	synonymous_variant	9212			AF004022	CCDS11134.1, CCDS58514.1, CCDS67162.1	17p13.1	2013-01-17	2003-07-21	2003-07-23	ENSG00000178999	ENSG00000178999		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11390	protein-coding gene	gene with protein product	"""aurora-B"", ""aurora-1"", ""protein phosphatase 1, regulatory subunit 48"""	604970	"""serine/threonine kinase 12"""	STK12		9858806	Standard	NM_001256834		Approved	Aik2, IPL1, AurB, AIM-1, ARK2, STK5, PPP1R48	uc002gkm.4	Q96GD4	OTTHUMG00000108189	ENST00000585124.1:c.582G>A	17.37:g.8109913C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DNM4|C7G533|C7G534|C7G535|D3DTR4|J9JID1|O14630|O60446|O95083|Q96DV5|Q9UQ46	Missense_Mutation	SNP	NULL	p.E101K	ENST00000585124.1	37	c.301	CCDS11134.1	17																																																																																			AURKB	-	NULL		0.532	AURKB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AURKB	HGNC	protein_coding	OTTHUMT00000226995.2	C	NM_004217		8109913	-1	no_errors	ENST00000580998	ensembl	human	known	70_37	missense	SNP	1.000	T
AURKB	9212	genome.wustl.edu	37	17	8109913	8109913	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:8109913C>T	ENST00000585124.1	-	7	675	c.582G>A	c.(580-582)aaG>aaA	p.K194K	AURKB_ENST00000578549.1_Silent_p.K162K|AURKB_ENST00000534871.1_Silent_p.K153K|AURKB_ENST00000316199.6_Silent_p.K195K|AURKB_ENST00000535053.1_3'UTR	NM_004217.3	NP_004208.2	Q96GD4	AURKB_HUMAN	aurora kinase B	194	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				abscission (GO:0009838)|aging (GO:0007568)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|attachment of spindle microtubules to kinetochore (GO:0008608)|cell proliferation (GO:0008283)|cellular response to UV (GO:0034644)|cleavage furrow formation (GO:0036089)|cytokinesis checkpoint (GO:0031565)|histone H3-S28 phosphorylation (GO:0043988)|histone modification (GO:0016570)|mitotic cell cycle (GO:0000278)|negative regulation of B cell apoptotic process (GO:0002903)|negative regulation of cytokinesis (GO:0032466)|negative regulation of protein binding (GO:0032091)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cytokinesis (GO:0032467)|protein autophosphorylation (GO:0046777)|protein localization to kinetochore (GO:0034501)|protein phosphorylation (GO:0006468)|regulation of chromosome segregation (GO:0051983)|spindle checkpoint (GO:0031577)|spindle midzone assembly involved in mitosis (GO:0051256)|spindle stabilization (GO:0043146)	chromocenter (GO:0010369)|chromosome passenger complex (GO:0032133)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytosol (GO:0005829)|intercellular bridge (GO:0045171)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|histone serine kinase activity (GO:0035174)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)			breast(1)|central_nervous_system(1)|lung(2)	4						GAATCACCTTCTTCCCATGGC	0.532																																					NSCLC(134;1161 2470 43664 51568)												0													141.0	115.0	124.0					17																	8109913		2203	4300	6503	SO:0001819	synonymous_variant	9212			AF004022	CCDS11134.1, CCDS58514.1, CCDS67162.1	17p13.1	2013-01-17	2003-07-21	2003-07-23	ENSG00000178999	ENSG00000178999		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	11390	protein-coding gene	gene with protein product	"""aurora-B"", ""aurora-1"", ""protein phosphatase 1, regulatory subunit 48"""	604970	"""serine/threonine kinase 12"""	STK12		9858806	Standard	NM_001256834		Approved	Aik2, IPL1, AurB, AIM-1, ARK2, STK5, PPP1R48	uc002gkm.4	Q96GD4	OTTHUMG00000108189	ENST00000585124.1:c.582G>A	17.37:g.8109913C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DNM4|C7G533|C7G534|C7G535|D3DTR4|J9JID1|O14630|O60446|O95083|Q96DV5|Q9UQ46	Missense_Mutation	SNP	NULL	p.E101K	ENST00000585124.1	37	c.301	CCDS11134.1	17																																																																																			AURKB	-	NULL		0.532	AURKB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	AURKB	HGNC	protein_coding	OTTHUMT00000226995.2	C	NM_004217		8109913	-1	no_errors	ENST00000580998	ensembl	human	known	70_37	missense	SNP	1.000	T
B4GALT5	9334	genome.wustl.edu	37	20	48252850	48252850	+	Nonstop_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:48252850C>G	ENST00000371711.4	-	9	1353	c.1166G>C	c.(1165-1167)tGa>tCa	p.*389S		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	0					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			TCTCTCCTCTCAGTACTCGTT	0.473																																																	0													206.0	175.0	186.0					20																	48252850		2203	4300	6503	SO:0001578	stop_lost	9334			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.1166G>C	20.37:g.48252850C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	E1P625|Q2M394|Q9UJQ8	Nonstop_Mutation	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.*389S	ENST00000371711.4	37	c.1166	CCDS13420.1	20	.	.	.	.	.	.	.	.	.	.	C	13.63	2.295205	0.40594	.	.	ENSG00000158470	ENST00000371711	.	.	.	5.51	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6877	0.12765	0.0:0.4902:0.0:0.5098	.	.	.	.	S	389	.	.	X	-	2	2	B4GALT5	47686257	1.000000	0.71417	0.995000	0.50966	0.846000	0.48090	1.829000	0.39121	1.160000	0.42584	0.557000	0.71058	TGA	B4GALT5	-	NULL		0.473	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT5	HGNC	protein_coding	OTTHUMT00000080543.3	C	NM_004776		48252850	-1	no_errors	ENST00000371711	ensembl	human	known	70_37	nonstop	SNP	1.000	G
B4GALT5	9334	genome.wustl.edu	37	20	48252850	48252850	+	Nonstop_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:48252850C>G	ENST00000371711.4	-	9	1353	c.1166G>C	c.(1165-1167)tGa>tCa	p.*389S		NM_004776.3	NP_004767.1	O43286	B4GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 5	0					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosyltransferase activity (GO:0008378)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	20			BRCA - Breast invasive adenocarcinoma(9;2.51e-06)			TCTCTCCTCTCAGTACTCGTT	0.473																																																	0													206.0	175.0	186.0					20																	48252850		2203	4300	6503	SO:0001578	stop_lost	9334			AB004550	CCDS13420.1	20q13.1-q13.2	2013-02-19			ENSG00000158470	ENSG00000158470		"""Beta 4-glycosyltransferases"""	928	protein-coding gene	gene with protein product	"""beta4-GalT IV"""	604016				9597550, 9435216	Standard	NM_004776		Approved	beta4GalT-V	uc002xuu.4	O43286	OTTHUMG00000033086	ENST00000371711.4:c.1166G>C	20.37:g.48252850C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	E1P625|Q2M394|Q9UJQ8	Nonstop_Mutation	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.*389S	ENST00000371711.4	37	c.1166	CCDS13420.1	20	.	.	.	.	.	.	.	.	.	.	C	13.63	2.295205	0.40594	.	.	ENSG00000158470	ENST00000371711	.	.	.	5.51	3.11	0.35812	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.6877	0.12765	0.0:0.4902:0.0:0.5098	.	.	.	.	S	389	.	.	X	-	2	2	B4GALT5	47686257	1.000000	0.71417	0.995000	0.50966	0.846000	0.48090	1.829000	0.39121	1.160000	0.42584	0.557000	0.71058	TGA	B4GALT5	-	NULL		0.473	B4GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT5	HGNC	protein_coding	OTTHUMT00000080543.3	C	NM_004776		48252850	-1	no_errors	ENST00000371711	ensembl	human	known	70_37	nonstop	SNP	1.000	G
BCR	613	genome.wustl.edu	37	22	23658361	23658361	+	3'UTR	SNP	T	T	C	rs200271725		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:23658361T>C	ENST00000305877.8	+	0	5219				BCR_ENST00000436990.2_3'UTR	NM_004327.3	NP_004318.3	P11274	BCR_HUMAN	breakpoint cluster region						actin cytoskeleton organization (GO:0030036)|brain development (GO:0007420)|inner ear morphogenesis (GO:0042472)|negative regulation of cell migration (GO:0030336)|negative regulation of inflammatory response (GO:0050728)|negative regulation of neutrophil degranulation (GO:0043314)|neuromuscular process controlling balance (GO:0050885)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of phagocytosis (GO:0050766)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell cycle (GO:0051726)|regulation of small GTPase mediated signal transduction (GO:0051056)|response to lipopolysaccharide (GO:0032496)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|kinase activity (GO:0016301)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)|Rac GTPase activator activity (GO:0030675)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)		BCR/JAK2(6)	central_nervous_system(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(9)|ovary(1)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	35					Bosutinib(DB06616)|Ponatinib(DB08901)	TCAGAAGGCCTGTGAAATGTC	0.537			T	"""ABL1,  FGFR1, JAK2 """	"""CML, ALL, AML"""																																			Dom	yes		22	22q11.21	613	breakpoint cluster region		L	0																																										SO:0001624	3_prime_UTR_variant	613				CCDS13806.1, CCDS13807.1	22q11	2013-01-10			ENSG00000186716	ENSG00000186716		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	1014	protein-coding gene	gene with protein product		151410		D22S11, BCR1		1657398, 18070886	Standard	NM_004327		Approved	D22S662, CML, PHL, ALL	uc002zww.3	P11274	OTTHUMG00000150655	ENST00000305877.8:c.*652T>C	22.37:g.23658361T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	P78501|Q12842|Q4LE80|Q6NZI3	RNA	SNP	-	NULL	ENST00000305877.8	37	NULL	CCDS13806.1	22																																																																																			BCR	-	-		0.537	BCR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCR	HGNC	protein_coding	OTTHUMT00000075819.1	T	NM_004327		23658361	+1	no_errors	ENST00000436990	ensembl	human	known	70_37	rna	SNP	0.000	C
C19orf54	284325	genome.wustl.edu	37	19	41248441	41248441	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:41248441G>A	ENST00000378313.2	-	6	1072	c.953C>T	c.(952-954)tCa>tTa	p.S318L	C19orf54_ENST00000594163.1_5'Flank|C19orf54_ENST00000598729.1_Missense_Mutation_p.S146L|C19orf54_ENST00000470681.1_3'UTR|C19orf54_ENST00000339153.3_Intron|C19orf54_ENST00000598485.2_Intron	NM_198476.3	NP_940878.3	Q5BKX5	CS054_HUMAN	chromosome 19 open reading frame 54	318										breast(1)|lung(1)|urinary_tract(2)	4			LUSC - Lung squamous cell carcinoma(20;0.000219)|Lung(22;0.000959)			AGTGGCCCGTGAGGGCGAGAA	0.652																																																	0													37.0	33.0	35.0					19																	41248441		2202	4300	6502	SO:0001583	missense	284325			AK123126	CCDS12564.2	19q13.2	2012-10-26			ENSG00000188493	ENSG00000188493			24758	protein-coding gene	gene with protein product							Standard	NM_198476		Approved	FLJ41131	uc002oou.1	Q5BKX5	OTTHUMG00000150174	ENST00000378313.2:c.953C>T	19.37:g.41248441G>A	ENSP00000367564:p.Ser318Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MSZ5|B4DNU7	Missense_Mutation	SNP	NULL	p.S318L	ENST00000378313.2	37	c.953	CCDS12564.2	19	.	.	.	.	.	.	.	.	.	.	G	6.271	0.418175	0.11870	.	.	ENSG00000188493	ENST00000378313	.	.	.	5.48	2.15	0.27550	.	0.942748	0.09025	N	0.859625	T	0.25158	0.0611	N	0.19112	0.55	0.09310	N	0.999997	B;B	0.09022	0.002;0.002	B;B	0.09377	0.004;0.003	T	0.20338	-1.0278	9	0.31617	T	0.26	-2.9401	4.5718	0.12214	0.24:0.0:0.5247:0.2352	.	146;318	Q5BKX5-3;Q5BKX5	.;CS054_HUMAN	L	318	.	ENSP00000367564:S318L	S	-	2	0	C19orf54	45940281	0.000000	0.05858	0.013000	0.15412	0.013000	0.08279	0.699000	0.25586	0.797000	0.33971	-0.251000	0.11542	TCA	C19orf54	-	NULL		0.652	C19orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C19orf54	HGNC	protein_coding	OTTHUMT00000316701.1	G	NM_198476		41248441	-1	no_errors	ENST00000378313	ensembl	human	known	70_37	missense	SNP	0.000	A
C2orf40	84417	genome.wustl.edu	37	2	106694362	106694362	+	Missense_Mutation	SNP	G	G	A	rs376920426		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:106694362G>A	ENST00000238044.3	+	4	536	c.427G>A	c.(427-429)Gtc>Atc	p.V143I	C2orf40_ENST00000409944.1_Missense_Mutation_p.V107I	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	143					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						TGGAGCCAGCGTCAACTACGA	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		19116	0.001		0.0	False		,,,				2504	0.0																0													93.0	72.0	79.0					2																	106694362		2203	4300	6503	SO:0001583	missense	84417			BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.427G>A	2.37:g.106694362G>A	ENSP00000238044:p.Val143Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVK2	Missense_Mutation	SNP	NULL	p.V143I	ENST00000238044.3	37	c.427	CCDS2072.1	2	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767937	0.69878	.	.	ENSG00000119147	ENST00000409944;ENST00000238044	T;T	0.52295	0.67;0.67	5.31	5.31	0.75309	.	0.140114	0.46442	D	0.000297	T	0.70325	0.3211	M	0.75264	2.295	0.53688	D	0.999975	D	0.71674	0.998	D	0.75484	0.986	T	0.74012	-0.3801	10	0.87932	D	0	-35.9597	18.9754	0.92733	0.0:0.0:1.0:0.0	.	143	Q9H1Z8	AUGN_HUMAN	I	107;143	ENSP00000386421:V107I;ENSP00000238044:V143I	ENSP00000238044:V143I	V	+	1	0	C2orf40	106060794	1.000000	0.71417	0.997000	0.53966	0.106000	0.19336	7.984000	0.88150	2.469000	0.83416	0.591000	0.81541	GTC	C2orf40	-	NULL		0.458	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf40	HGNC	protein_coding	OTTHUMT00000253515.2	G	NM_032411		106694362	+1	no_errors	ENST00000238044	ensembl	human	known	70_37	missense	SNP	0.999	A
C2orf40	84417	genome.wustl.edu	37	2	106694362	106694362	+	Missense_Mutation	SNP	G	G	A	rs376920426		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:106694362G>A	ENST00000238044.3	+	4	536	c.427G>A	c.(427-429)Gtc>Atc	p.V143I	C2orf40_ENST00000409944.1_Missense_Mutation_p.V107I	NM_032411.2	NP_115787.1	Q9H1Z8	AUGN_HUMAN	chromosome 2 open reading frame 40	143					cellular senescence (GO:0090398)|cyclin catabolic process (GO:0008054)|G1 to G0 transition (GO:0070314)	cytoplasmic vesicle (GO:0031410)|extracellular space (GO:0005615)				lung(7)|urinary_tract(1)	8						TGGAGCCAGCGTCAACTACGA	0.458													G|||	1	0.000199681	0.0	0.0	5008	,	,		19116	0.001		0.0	False		,,,				2504	0.0																0													93.0	72.0	79.0					2																	106694362		2203	4300	6503	SO:0001583	missense	84417			BC021742	CCDS2072.1	2q12.2	2014-01-28			ENSG00000119147	ENSG00000119147			24642	protein-coding gene	gene with protein product	"""esophageal cancer related gene 4 protein"""	611752				12800218	Standard	NM_032411		Approved	ECRG4, augurin	uc010fjf.3	Q9H1Z8	OTTHUMG00000130921	ENST00000238044.3:c.427G>A	2.37:g.106694362G>A	ENSP00000238044:p.Val143Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVK2	Missense_Mutation	SNP	NULL	p.V143I	ENST00000238044.3	37	c.427	CCDS2072.1	2	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767937	0.69878	.	.	ENSG00000119147	ENST00000409944;ENST00000238044	T;T	0.52295	0.67;0.67	5.31	5.31	0.75309	.	0.140114	0.46442	D	0.000297	T	0.70325	0.3211	M	0.75264	2.295	0.53688	D	0.999975	D	0.71674	0.998	D	0.75484	0.986	T	0.74012	-0.3801	10	0.87932	D	0	-35.9597	18.9754	0.92733	0.0:0.0:1.0:0.0	.	143	Q9H1Z8	AUGN_HUMAN	I	107;143	ENSP00000386421:V107I;ENSP00000238044:V143I	ENSP00000238044:V143I	V	+	1	0	C2orf40	106060794	1.000000	0.71417	0.997000	0.53966	0.106000	0.19336	7.984000	0.88150	2.469000	0.83416	0.591000	0.81541	GTC	C2orf40	-	NULL		0.458	C2orf40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf40	HGNC	protein_coding	OTTHUMT00000253515.2	G	NM_032411		106694362	+1	no_errors	ENST00000238044	ensembl	human	known	70_37	missense	SNP	0.999	A
C6orf136	221545	genome.wustl.edu	37	6	30615247	30615247	+	Intron	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:30615247C>A	ENST00000376473.5	+	1	231				C6orf136_ENST00000493705.1_Intron|C6orf136_ENST00000528347.2_5'Flank|AL662800.2_ENST00000583820.1_RNA|C6orf136_ENST00000293604.6_Missense_Mutation_p.A80E|C6orf136_ENST00000376471.4_Intron	NM_001109938.2	NP_001103408.1	Q5SQH8	CF136_HUMAN	chromosome 6 open reading frame 136							mitochondrion (GO:0005739)				endometrium(1)|large_intestine(2)|lung(6)|ovary(1)	10						GTCGCGGGAGCGGGAGGGAGG	0.761																																																	0													2.0	3.0	3.0					6																	30615247		468	1215	1683	SO:0001627	intron_variant	221545			BC016167	CCDS4684.1, CCDS43443.1, CCDS4684.2, CCDS54979.1	6p21.32	2012-02-06			ENSG00000204564	ENSG00000204564			21301	protein-coding gene	gene with protein product							Standard	NM_001109938		Approved	Em:AB023049.8	uc003nqx.4	Q5SQH8	OTTHUMG00000031221	ENST00000376473.5:c.72+167C>A	6.37:g.30615247C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A9R9P9|F8VX15|Q5SU01|Q6ZSB7|Q8TB84	Missense_Mutation	SNP	pfam_DUF2358	p.A80E	ENST00000376473.5	37	c.239	CCDS43443.1	6	.	.	.	.	.	.	.	.	.	.	C	14.62	2.590586	0.46214	.	.	ENSG00000204564	ENST00000293604;ENST00000446773	.	.	.	3.87	1.01	0.19927	.	.	.	.	.	T	0.04770	0.0129	N	0.08118	0	0.18873	N	0.999986	P	0.41748	0.761	B	0.35240	0.198	T	0.18493	-1.0335	8	0.72032	D	0.01	.	5.6539	0.17633	0.0:0.6377:0.0:0.3623	.	80	F8VX15	.	E	80;17	.	ENSP00000293604:A80E	A	+	2	0	C6orf136	30723226	0.000000	0.05858	0.000000	0.03702	0.020000	0.10135	-1.640000	0.02009	0.377000	0.24735	0.655000	0.94253	GCG	C6orf136	-	NULL		0.761	C6orf136-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf136	HGNC	protein_coding	OTTHUMT00000076457.4	C	NM_145029		30615247	+1	no_errors	ENST00000293604	ensembl	human	known	70_37	missense	SNP	0.000	A
CAMKMT	79823	genome.wustl.edu	37	2	44776705	44776705	+	Intron	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:44776705C>T	ENST00000378494.3	+	4	420				CAMKMT_ENST00000407131.1_Intron|CAMKMT_ENST00000402247.1_Missense_Mutation_p.H130Y	NM_024766.4	NP_079042.1	Q7Z624	CMKMT_HUMAN	calmodulin-lysine N-methyltransferase							Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	calmodulin-lysine N-methyltransferase activity (GO:0018025)			breast(2)|large_intestine(3)|lung(5)	10						cacagggtctcactctgttgc	0.393																																																	0																																										SO:0001627	intron_variant	79823				CCDS1820.1	2p21	2011-06-22	2011-03-10	2011-03-10	ENSG00000143919	ENSG00000143919	2.1.1.60		26276	protein-coding gene	gene with protein product	"""CaM KMT"""	609559	"""chromosome 2 open reading frame 34"""	C2orf34		20975703	Standard	NM_024766		Approved	CLNMT	uc002rum.3	Q7Z624	OTTHUMG00000128761	ENST00000378494.3:c.377-154717C>T	2.37:g.44776705C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZG15|Q53SS6|Q8N6P5|Q9H5G8	Missense_Mutation	SNP	NULL	p.H130Y	ENST00000378494.3	37	c.388	CCDS1820.1	2	.	.	.	.	.	.	.	.	.	.	C	3.121	-0.180486	0.06380	.	.	ENSG00000143919	ENST00000402247	.	.	.	0.225	0.225	0.15325	.	.	.	.	.	T	0.33235	0.0856	.	.	.	0.09310	N	0.999997	.	.	.	.	.	.	T	0.28713	-1.0035	4	0.35671	T	0.21	.	.	.	.	.	.	.	.	Y	130	.	ENSP00000385587:H130Y	H	+	1	0	CAMKMT	44630209	0.053000	0.20554	0.120000	0.21714	0.146000	0.21551	0.305000	0.19254	0.300000	0.22699	0.305000	0.20034	CAC	CAMKMT	-	NULL		0.393	CAMKMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMKMT	HGNC	protein_coding	OTTHUMT00000250678.2	C	NM_024766		44776705	+1	no_errors	ENST00000402247	ensembl	human	putative	70_37	missense	SNP	0.113	T
CCDC105	126402	genome.wustl.edu	37	19	15132520	15132520	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:15132520C>G	ENST00000292574.3	+	5	1216	c.1134C>G	c.(1132-1134)atC>atG	p.I378M		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	378						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						ACGGTCTCATCAAGGTACGGT	0.572																																																	0													70.0	69.0	69.0					19																	15132520		2203	4300	6503	SO:0001583	missense	126402			AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1134C>G	19.37:g.15132520C>G	ENSP00000292574:p.Ile378Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	pfam_Tektin	p.I378M	ENST00000292574.3	37	c.1134	CCDS12322.1	19	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357827	0.24598	.	.	ENSG00000160994	ENST00000292574	T	0.02345	4.33	3.67	1.46	0.22682	.	0.344395	0.23396	N	0.048633	T	0.04497	0.0123	L	0.57536	1.79	0.24611	N	0.993728	P	0.47191	0.891	P	0.46144	0.505	T	0.29671	-1.0004	10	0.45353	T	0.12	-16.9275	6.2614	0.20901	0.0:0.7563:0.0:0.2437	.	378	Q8IYK2	CC105_HUMAN	M	378	ENSP00000292574:I378M	ENSP00000292574:I378M	I	+	3	3	CCDC105	14993520	0.999000	0.42202	1.000000	0.80357	0.327000	0.28475	1.107000	0.31110	0.783000	0.33636	-0.242000	0.12053	ATC	CCDC105	-	pfam_Tektin		0.572	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC105	HGNC	protein_coding	OTTHUMT00000466293.1	C	NM_173482		15132520	+1	no_errors	ENST00000292574	ensembl	human	known	70_37	missense	SNP	0.996	G
CCDC105	126402	genome.wustl.edu	37	19	15132520	15132520	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:15132520C>G	ENST00000292574.3	+	5	1216	c.1134C>G	c.(1132-1134)atC>atG	p.I378M		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	378						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						ACGGTCTCATCAAGGTACGGT	0.572																																																	0													70.0	69.0	69.0					19																	15132520		2203	4300	6503	SO:0001583	missense	126402			AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1134C>G	19.37:g.15132520C>G	ENSP00000292574:p.Ile378Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	pfam_Tektin	p.I378M	ENST00000292574.3	37	c.1134	CCDS12322.1	19	.	.	.	.	.	.	.	.	.	.	C	10.46	1.357827	0.24598	.	.	ENSG00000160994	ENST00000292574	T	0.02345	4.33	3.67	1.46	0.22682	.	0.344395	0.23396	N	0.048633	T	0.04497	0.0123	L	0.57536	1.79	0.24611	N	0.993728	P	0.47191	0.891	P	0.46144	0.505	T	0.29671	-1.0004	10	0.45353	T	0.12	-16.9275	6.2614	0.20901	0.0:0.7563:0.0:0.2437	.	378	Q8IYK2	CC105_HUMAN	M	378	ENSP00000292574:I378M	ENSP00000292574:I378M	I	+	3	3	CCDC105	14993520	0.999000	0.42202	1.000000	0.80357	0.327000	0.28475	1.107000	0.31110	0.783000	0.33636	-0.242000	0.12053	ATC	CCDC105	-	pfam_Tektin		0.572	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC105	HGNC	protein_coding	OTTHUMT00000466293.1	C	NM_173482		15132520	+1	no_errors	ENST00000292574	ensembl	human	known	70_37	missense	SNP	0.996	G
CCDC88A	55704	genome.wustl.edu	37	2	55561412	55561412	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:55561412C>G	ENST00000436346.1	-	15	3386	c.2545G>C	c.(2545-2547)Gat>Cat	p.D849H	AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000599475.1_RNA|CCDC88A_ENST00000263630.8_Missense_Mutation_p.D849H|CCDC88A_ENST00000413716.2_Missense_Mutation_p.D849H|AC012358.8_ENST00000594078.1_RNA|CCDC88A_ENST00000336838.6_Missense_Mutation_p.D849H|AC012358.8_ENST00000608103.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	849					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						AATGTGGTATCTTTAATTTCT	0.313																																																	0													126.0	123.0	124.0					2																	55561412		2203	4297	6500	SO:0001583	missense	55704			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.2545G>C	2.37:g.55561412C>G	ENSP00000410608:p.Asp849His	Somatic		WXS	Illumina HiSeq	Phase_IV	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_t-SNARE	p.D849H	ENST00000436346.1	37	c.2545		2	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546300	0.65198	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716;ENST00000426576	T;T;T;T;T	0.38887	2.24;2.48;2.46;2.26;1.11	5.43	5.43	0.79202	.	0.000000	0.49305	U	0.000147	T	0.66317	0.2777	M	0.72353	2.195	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.99;0.999;0.99;0.995;0.999	T	0.67309	-0.5703	10	0.62326	D	0.03	-21.8341	19.678	0.95945	0.0:1.0:0.0:0.0	.	849;849;849;849;849	B7ZM78;Q3V6T2-2;Q3V6T2;Q3V6T2-3;Q3V6T2-4	.;.;GRDN_HUMAN;.;.	H	849;849;849;849;24	ENSP00000338728:D849H;ENSP00000263630:D849H;ENSP00000410608:D849H;ENSP00000404431:D849H;ENSP00000405080:D24H	ENSP00000263630:D849H	D	-	1	0	CCDC88A	55414916	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.543000	0.82106	2.725000	0.93324	0.552000	0.68991	GAT	CCDC88A	-	superfamily_Prefoldin		0.313	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		C	NM_017571		55561412	-1	no_errors	ENST00000436346	ensembl	human	known	70_37	missense	SNP	1.000	G
CCDC88A	55704	genome.wustl.edu	37	2	55561454	55561454	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:55561454C>T	ENST00000436346.1	-	15	3344	c.2503G>A	c.(2503-2505)Gag>Aag	p.E835K	AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000599475.1_RNA|CCDC88A_ENST00000263630.8_Missense_Mutation_p.E835K|CCDC88A_ENST00000413716.2_Missense_Mutation_p.E835K|AC012358.8_ENST00000594078.1_RNA|CCDC88A_ENST00000336838.6_Missense_Mutation_p.E835K|AC012358.8_ENST00000608103.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A	835					activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TTTTCCTTCTCCAATTGTTTC	0.308																																																	0													135.0	130.0	132.0					2																	55561454		2203	4297	6500	SO:0001583	missense	55704			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.2503G>A	2.37:g.55561454C>T	ENSP00000410608:p.Glu835Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	Missense_Mutation	SNP	pfam_HOOK,superfamily_Prefoldin,superfamily_t-SNARE	p.E835K	ENST00000436346.1	37	c.2503		2	.	.	.	.	.	.	.	.	.	.	C	17.68	3.450382	0.63290	.	.	ENSG00000115355	ENST00000336838;ENST00000263630;ENST00000436346;ENST00000413716;ENST00000426576	T;T;T;T;T	0.39229	2.12;2.32;2.35;2.14;1.09	5.43	5.43	0.79202	.	0.000000	0.48286	U	0.000196	T	0.56630	0.1998	L	0.34521	1.04	0.80722	D	1	D;D;D;D;D	0.76494	0.998;0.998;0.995;0.999;0.998	D;D;P;D;D	0.85130	0.945;0.991;0.883;0.997;0.994	T	0.55927	-0.8063	10	0.52906	T	0.07	-13.5231	19.678	0.95945	0.0:1.0:0.0:0.0	.	835;835;835;835;835	B7ZM78;Q3V6T2-2;Q3V6T2;Q3V6T2-3;Q3V6T2-4	.;.;GRDN_HUMAN;.;.	K	835;835;835;835;10	ENSP00000338728:E835K;ENSP00000263630:E835K;ENSP00000410608:E835K;ENSP00000404431:E835K;ENSP00000405080:E10K	ENSP00000263630:E835K	E	-	1	0	CCDC88A	55414958	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.931000	0.70113	2.725000	0.93324	0.552000	0.68991	GAG	CCDC88A	-	superfamily_Prefoldin		0.308	CCDC88A-203	KNOWN	basic	protein_coding	CCDC88A	HGNC	protein_coding		C	NM_017571		55561454	-1	no_errors	ENST00000436346	ensembl	human	known	70_37	missense	SNP	1.000	T
CD99	4267	genome.wustl.edu	37	X	2609849	2609849	+	Intron	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:2609849C>T	ENST00000381192.3	+	1	249				CD99_ENST00000482405.2_Intron|CD99_ENST00000381184.1_Intron|CD99_ENST00000381180.3_Nonsense_Mutation_p.Q30*|CD99_ENST00000381187.3_Intron	NM_001277710.1|NM_002414.3	NP_001264639.1|NP_002405.1	P14209	CD99_HUMAN	CD99 molecule						cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(6)|skin(1)	11						CCTGCGTCTTCAGGCCGCGCG	0.627																																																	0													12.0	13.0	13.0					X																	2609849		874	1989	2863	SO:0001627	intron_variant	4267			M16279	CCDS14119.1, CCDS48071.1, CCDS75947.1	Xp22.32 and Yp11.3	2012-10-02	2006-03-28	2003-02-14	ENSG00000002586	ENSG00000002586		"""Pseudoautosomal regions / PAR1"", ""CD molecules"""	7082	protein-coding gene	gene with protein product		313470, 450000	"""antigen identified by monoclonal antibodies 12E7, F21 and O13"", ""CD99 antigen"""	MIC2			Standard	NM_001122898		Approved		uc004cqm.3	P14209	OTTHUMG00000021073	ENST00000381192.3:c.67+381C>T	X.37:g.2609849C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NIW1|O00518|Q6ICV7	Nonsense_Mutation	SNP	NULL	p.Q30*	ENST00000381192.3	37	c.88	CCDS14119.1	X	.	.	.	.	.	.	.	.	.	.	N	9.807	1.182107	0.21787	.	.	ENSG00000002586	ENST00000381180	.	.	.	0.788	-0.523	0.11924	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	30	.	ENSP00000370573:Q30X	Q	+	1	0	CD99	2619849	0.017000	0.18338	0.000000	0.03702	0.001000	0.01503	0.097000	0.15168	-0.982000	0.03515	-0.751000	0.03497	CAG	CD99	-	NULL		0.627	CD99-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD99	HGNC	protein_coding	OTTHUMT00000055624.1	C	NM_001122898		2609849	+1	no_errors	ENST00000381180	ensembl	human	known	70_37	nonsense	SNP	0.000	T
CDCA2	157313	genome.wustl.edu	37	8	25325882	25325882	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:25325882G>C	ENST00000330560.3	+	6	1165	c.688G>C	c.(688-690)Gat>Cat	p.D230H	CDCA2_ENST00000380665.3_Missense_Mutation_p.D215H	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	230					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		ATTCAATATTGATACAGACAG	0.388																																																	0													119.0	122.0	121.0					8																	25325882		2203	4300	6503	SO:0001583	missense	157313			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.688G>C	8.37:g.25325882G>C	ENSP00000328228:p.Asp230His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.D230H	ENST00000330560.3	37	c.688	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689545	0.29962	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.35048	1.34;1.33	5.33	1.5	0.22942	.	1.524520	0.03560	N	0.226873	T	0.29190	0.0726	N	0.12182	0.205	0.09310	N	1	P;D;D	0.55385	0.799;0.971;0.971	P;P;P	0.50378	0.639;0.639;0.639	T	0.11179	-1.0598	10	0.46703	T	0.11	-0.0449	3.6197	0.08090	0.2739:0.0:0.5516:0.1745	.	230;215;230	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	H	230;215	ENSP00000328228:D230H;ENSP00000370040:D215H	ENSP00000328228:D230H	D	+	1	0	CDCA2	25381799	0.001000	0.12720	0.001000	0.08648	0.092000	0.18411	0.967000	0.29344	0.098000	0.17522	0.650000	0.86243	GAT	CDCA2	-	NULL		0.388	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	G	NM_152562		25325882	+1	no_errors	ENST00000330560	ensembl	human	known	70_37	missense	SNP	0.001	C
CDCA2	157313	genome.wustl.edu	37	8	25325882	25325882	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:25325882G>C	ENST00000330560.3	+	6	1165	c.688G>C	c.(688-690)Gat>Cat	p.D230H	CDCA2_ENST00000380665.3_Missense_Mutation_p.D215H	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	230					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		ATTCAATATTGATACAGACAG	0.388																																																	0													119.0	122.0	121.0					8																	25325882		2203	4300	6503	SO:0001583	missense	157313			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.688G>C	8.37:g.25325882G>C	ENSP00000328228:p.Asp230His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.D230H	ENST00000330560.3	37	c.688	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	G	11.61	1.689545	0.29962	.	.	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.35048	1.34;1.33	5.33	1.5	0.22942	.	1.524520	0.03560	N	0.226873	T	0.29190	0.0726	N	0.12182	0.205	0.09310	N	1	P;D;D	0.55385	0.799;0.971;0.971	P;P;P	0.50378	0.639;0.639;0.639	T	0.11179	-1.0598	10	0.46703	T	0.11	-0.0449	3.6197	0.08090	0.2739:0.0:0.5516:0.1745	.	230;215;230	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	H	230;215	ENSP00000328228:D230H;ENSP00000370040:D215H	ENSP00000328228:D230H	D	+	1	0	CDCA2	25381799	0.001000	0.12720	0.001000	0.08648	0.092000	0.18411	0.967000	0.29344	0.098000	0.17522	0.650000	0.86243	GAT	CDCA2	-	NULL		0.388	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	G	NM_152562		25325882	+1	no_errors	ENST00000330560	ensembl	human	known	70_37	missense	SNP	0.001	C
CDHR3	222256	genome.wustl.edu	37	7	105564466	105564466	+	Intron	SNP	A	A	G	rs6962976|rs386716521		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:105564466A>G	ENST00000470188.1	+	3	818							Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3						homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						AAGACTGAGGACTGGGCTGAG	0.473																																																	0																																										SO:0001627	intron_variant	222256			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000470188.1:c.818+11382A>G	7.37:g.105564466A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCI7	RNA	SNP	-	NULL	ENST00000470188.1	37	NULL		7																																																																																			CDHR3	-	-		0.473	CDHR3-002	KNOWN	basic	processed_transcript	CDHR3	HGNC	protein_coding	OTTHUMT00000349023.1	A	NM_152750		105564466	+1	no_errors	ENST00000472116	ensembl	human	known	70_37	rna	SNP	0.000	G
CDK18	5129	genome.wustl.edu	37	1	205501636	205501636	+	3'UTR	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:205501636G>A	ENST00000360066.2	+	0	2856				CDK18_ENST00000509056.1_3'UTR	NM_002596.3|NM_212502.2|NM_212503.2	NP_002587.2|NP_997667.1|NP_997668.1	Q07002	CDK18_HUMAN	cyclin-dependent kinase 18								ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)			breast(2)|endometrium(2)|large_intestine(2)|lung(10)|stomach(2)|urinary_tract(1)	19						GGAGAGGAACGTGGAACAGGA	0.657																																					Pancreas(180;489 2072 28461 40831 44265)												0																																										SO:0001624	3_prime_UTR_variant	5129			X66362	CCDS1454.1, CCDS44300.1	1q31-q32	2011-11-08	2009-12-16	2009-12-16	ENSG00000117266	ENSG00000117266		"""Cyclin-dependent kinases"""	8751	protein-coding gene	gene with protein product		169190	"""PCTAIRE protein kinase 3"""	PCTK3		1437147, 19884882	Standard	NM_002596		Approved	PCTAIRE3	uc010pri.2	Q07002	OTTHUMG00000037203	ENST00000360066.2:c.*1130G>A	1.37:g.205501636G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VXQ2|Q6V3A2|Q6V3A3|Q96F90	RNA	SNP	-	NULL	ENST00000360066.2	37	NULL	CCDS44300.1	1																																																																																			CDK18	-	-		0.657	CDK18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK18	HGNC	protein_coding	OTTHUMT00000090407.2	G	NM_002596		205501636	+1	no_errors	ENST00000509056	ensembl	human	known	70_37	rna	SNP	0.000	A
CEP192	55125	genome.wustl.edu	37	18	13114219	13114219	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr18:13114219G>C	ENST00000325971.8	+	40	7063	c.5470G>C	c.(5470-5472)Gct>Cct	p.A1824P	CEP192_ENST00000506447.1_Missense_Mutation_p.A2420P|CEP192_ENST00000430049.2_Missense_Mutation_p.A1945P|CEP192_ENST00000540847.2_3'UTR			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1824					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CCGAAGACAAGCTGTGTCAGA	0.398																																																	0													158.0	155.0	156.0					18																	13114219		2203	4300	6503	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.5470G>C	18.37:g.13114219G>C	ENSP00000317156:p.Ala1824Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.A2420P	ENST00000325971.8	37	c.7258		18	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288905	0.59976	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.06528	3.29;3.29;3.29	5.38	2.11	0.27256	.	0.403279	0.25909	N	0.027507	T	0.13200	0.0320	L	0.53249	1.67	0.09310	N	1	D;P;D;B	0.71674	0.998;0.681;0.963;0.003	P;B;P;B	0.60541	0.876;0.274;0.735;0.005	T	0.03933	-1.0991	10	0.66056	D	0.02	-6.999	5.7575	0.18180	0.0803:0.2488:0.5438:0.1271	.	1945;2420;424;1022	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	P	2420;1824;1824;1945;424	ENSP00000427550:A2420P;ENSP00000317156:A1824P;ENSP00000389190:A1945P	ENSP00000317156:A1824P	A	+	1	0	CEP192	13104219	0.023000	0.18921	0.001000	0.08648	0.754000	0.42855	1.028000	0.30128	0.644000	0.30656	0.455000	0.32223	GCT	CEP192	-	NULL		0.398	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		G	NM_032142		13114219	+1	no_errors	ENST00000506447	ensembl	human	known	70_37	missense	SNP	0.000	C
CEP192	55125	genome.wustl.edu	37	18	13114219	13114219	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr18:13114219G>C	ENST00000325971.8	+	40	7063	c.5470G>C	c.(5470-5472)Gct>Cct	p.A1824P	CEP192_ENST00000506447.1_Missense_Mutation_p.A2420P|CEP192_ENST00000430049.2_Missense_Mutation_p.A1945P|CEP192_ENST00000540847.2_3'UTR			Q8TEP8	CE192_HUMAN	centrosomal protein 192kDa	1824					centrosome duplication (GO:0051298)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|negative regulation of phosphatase activity (GO:0010923)|spindle assembly (GO:0051225)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phosphatase binding (GO:0019902)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(12)|lung(36)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	71						CCGAAGACAAGCTGTGTCAGA	0.398																																																	0													158.0	155.0	156.0					18																	13114219		2203	4300	6503	SO:0001583	missense	55125			AK074074	CCDS32792.1, CCDS32792.2	18p11.21	2014-02-20				ENSG00000101639		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	25515	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 62"""					11230166, 14654843	Standard	NM_032142		Approved	KIAA1569, FLJ10352, PPP1R62	uc010xac.2	Q8TEP8		ENST00000325971.8:c.5470G>C	18.37:g.13114219G>C	ENSP00000317156:p.Ala1824Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A060A9S4|E9PF99|Q8WYT8|Q9H0F4|Q9NW27	Missense_Mutation	SNP	NULL	p.A2420P	ENST00000325971.8	37	c.7258		18	.	.	.	.	.	.	.	.	.	.	G	17.05	3.288905	0.59976	.	.	ENSG00000101639	ENST00000506447;ENST00000325971;ENST00000399863;ENST00000430049;ENST00000540847	T;T;T	0.06528	3.29;3.29;3.29	5.38	2.11	0.27256	.	0.403279	0.25909	N	0.027507	T	0.13200	0.0320	L	0.53249	1.67	0.09310	N	1	D;P;D;B	0.71674	0.998;0.681;0.963;0.003	P;B;P;B	0.60541	0.876;0.274;0.735;0.005	T	0.03933	-1.0991	10	0.66056	D	0.02	-6.999	5.7575	0.18180	0.0803:0.2488:0.5438:0.1271	.	1945;2420;424;1022	C9JT09;E9PF99;F5GZ47;Q9HCK3	.;.;.;.	P	2420;1824;1824;1945;424	ENSP00000427550:A2420P;ENSP00000317156:A1824P;ENSP00000389190:A1945P	ENSP00000317156:A1824P	A	+	1	0	CEP192	13104219	0.023000	0.18921	0.001000	0.08648	0.754000	0.42855	1.028000	0.30128	0.644000	0.30656	0.455000	0.32223	GCT	CEP192	-	NULL		0.398	CEP192-201	KNOWN	basic	protein_coding	CEP192	HGNC	protein_coding		G	NM_032142		13114219	+1	no_errors	ENST00000506447	ensembl	human	known	70_37	missense	SNP	0.000	C
CHAF1A	10036	genome.wustl.edu	37	19	4430573	4430573	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:4430573G>A	ENST00000301280.5	+	11	1983	c.1882G>A	c.(1882-1884)Gaa>Aaa	p.E628K	CTB-50L17.5_ENST00000590159.1_RNA	NM_005483.2	NP_005474	Q13111	CAF1A_HUMAN	chromatin assembly factor 1, subunit A (p150)	628					cell cycle (GO:0007049)|chromatin assembly (GO:0031497)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA replication-dependent nucleosome assembly (GO:0006335)|protein complex assembly (GO:0006461)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	CAF-1 complex (GO:0033186)|nuclear chromatin (GO:0000790)|protein complex (GO:0043234)	chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|identical protein binding (GO:0042802)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|urinary_tract(1)	27		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		GGGAGAGGATGAAGATGAGGA	0.473								Chromatin Structure																																									0													155.0	123.0	134.0					19																	4430573		2203	4300	6503	SO:0001583	missense	10036			U20979	CCDS32875.1	19p13.3	2008-07-16				ENSG00000167670			1910	protein-coding gene	gene with protein product	"""chromatin assembly factor I (150 kDa)"""	601246				7600578	Standard	NM_005483		Approved	CAF1P150, CAF1B, CAF-1, CAF1, P150, MGC71229	uc002mal.3	Q13111		ENST00000301280.5:c.1882G>A	19.37:g.4430573G>A	ENSP00000301280:p.Glu628Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NXG5|Q7Z7K3|Q9UJY8	Missense_Mutation	SNP	pfam_CAF1A,pfam_CAF-1_p150	p.E628K	ENST00000301280.5	37	c.1882	CCDS32875.1	19	.	.	.	.	.	.	.	.	.	.	G	19.14	3.769820	0.69992	.	.	ENSG00000167670	ENST00000344143;ENST00000535117;ENST00000301280	T	0.08984	3.03	4.25	4.25	0.50352	.	.	.	.	.	T	0.24431	0.0592	M	0.84326	2.69	0.80722	D	1	D	0.59357	0.985	P	0.53102	0.718	T	0.10706	-1.0618	9	0.87932	D	0	-18.4349	15.7998	0.78443	0.0:0.0:1.0:0.0	.	628	Q13111	CAF1A_HUMAN	K	628	ENSP00000301280:E628K	ENSP00000301280:E628K	E	+	1	0	CHAF1A	4381573	1.000000	0.71417	0.993000	0.49108	0.157000	0.22087	8.655000	0.91098	2.200000	0.70718	0.313000	0.20887	GAA	CHAF1A	-	pfam_CAF1A		0.473	CHAF1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHAF1A	HGNC	protein_coding	OTTHUMT00000458310.2	G	NM_005483		4430573	+1	no_errors	ENST00000301280	ensembl	human	known	70_37	missense	SNP	1.000	A
CHCHD4	131474	genome.wustl.edu	37	3	14154462	14154462	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:14154462C>T	ENST00000396914.3	-	3	535	c.354G>A	c.(352-354)aaG>aaA	p.K118K	CHCHD4_ENST00000295767.5_Silent_p.K131K	NM_001098502.1	NP_001091972.1	Q8N4Q1	MIA40_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 4	118					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|protein import into mitochondrial intermembrane space (GO:0045041)|protein maturation by protein folding (GO:0022417)|protein targeting to mitochondrion (GO:0006626)	mitochondrial intermembrane space (GO:0005758)	protein disulfide oxidoreductase activity (GO:0015035)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)	5						ctgctggcttcttctctcttt	0.517																																																	0													106.0	94.0	98.0					3																	14154462		2203	4300	6503	SO:0001819	synonymous_variant	131474			BC017082	CCDS2617.1, CCDS43054.1	3p25.1	2012-10-15			ENSG00000163528	ENSG00000163528		"""Coiled-coil-helix-coiled-coil-helix domain containing"""	26467	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 40 homolog (S. cerevisiae)"", ""mitochondrial intermembrane space import and assembly 40 homolog (S. cerevisiae)"""	611077				22214851	Standard	NM_001098502		Approved	FLJ31709, TIMM40, MIA40	uc003byj.4	Q8N4Q1	OTTHUMG00000129805	ENST00000396914.3:c.354G>A	3.37:g.14154462C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3Z9|Q96AI2|Q96MY6	Silent	SNP	pfam_CHCH	p.K131	ENST00000396914.3	37	c.393	CCDS43054.1	3																																																																																			CHCHD4	-	NULL		0.517	CHCHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHCHD4	HGNC	protein_coding	OTTHUMT00000340423.1	C	NM_144636		14154462	-1	no_errors	ENST00000295767	ensembl	human	known	70_37	silent	SNP	0.001	T
CHFR	55743	genome.wustl.edu	37	12	133485606	133485606	+	lincRNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:133485606C>G	ENST00000503695.3	+	0	0																											GACTTTTACTCTTTTCTTGGG	0.632																																																	0																																												55743																															12.37:g.133485606C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000503695.3	37	NULL		12																																																																																			CHFR	-	-		0.632	RP11-46H11.3-001	KNOWN	basic	lincRNA	CHFR	HGNC	lincRNA	OTTHUMT00000397133.1	C			133485606	-1	no_errors	ENST00000499045	ensembl	human	putative	70_37	rna	SNP	0.020	G
CLN3	1201	genome.wustl.edu	37	16	28502380	28502380	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:28502380G>C	ENST00000569430.1	-	4	945				CLN3_ENST00000360019.2_Intron|CLN3_ENST00000395653.4_Intron|CLN3_ENST00000354630.5_Intron|CLN3_ENST00000357806.7_Intron|CLN3_ENST00000535392.1_Intron|CLN3_ENST00000357076.5_Intron|CLN3_ENST00000355477.5_Intron|CLN3_ENST00000568224.1_Intron|CLN3_ENST00000357857.9_Intron|CLN3_ENST00000567160.1_5'Flank|CLN3_ENST00000565316.1_Intron|CLN3_ENST00000333496.9_Intron|CLN3_ENST00000359984.7_Intron|CLN3_ENST00000567963.1_Intron			Q13286	CLN3_HUMAN	ceroid-lipofuscinosis, neuronal 3						action potential (GO:0001508)|amyloid precursor protein catabolic process (GO:0042987)|arginine transport (GO:0015809)|associative learning (GO:0008306)|autophagic vacuole fusion (GO:0000046)|cell death (GO:0008219)|cellular amino acid metabolic process (GO:0006520)|ceramide metabolic process (GO:0006672)|cytosolic calcium ion homeostasis (GO:0051480)|galactosylceramide metabolic process (GO:0006681)|globoside metabolic process (GO:0001575)|glucosylceramide metabolic process (GO:0006678)|ionotropic glutamate receptor signaling pathway (GO:0035235)|lysosomal lumen acidification (GO:0007042)|lysosomal lumen pH elevation (GO:0035752)|lysosome organization (GO:0007040)|macroautophagy (GO:0016236)|membrane organization (GO:0061024)|negative regulation of apoptotic process (GO:0043066)|negative regulation of catalytic activity (GO:0043086)|negative regulation of macroautophagy (GO:0016242)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of proteolysis (GO:0045861)|neuromuscular process controlling balance (GO:0050885)|neurotransmitter metabolic process (GO:0042133)|protein catabolic process (GO:0030163)|protein processing (GO:0016485)|receptor-mediated endocytosis (GO:0006898)|sphingomyelin metabolic process (GO:0006684)|vacuolar transport (GO:0007034)|vesicle transport along microtubule (GO:0047496)	autophagic vacuole (GO:0005776)|caveola (GO:0005901)|cytoplasm (GO:0005737)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|membrane raft (GO:0045121)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)|trans-Golgi network (GO:0005802)	unfolded protein binding (GO:0051082)			breast(1)|large_intestine(2)|lung(11)|upper_aerodigestive_tract(1)	15						aacagagcaagaccctgtctc	0.373																																																	0																																										SO:0001627	intron_variant	1201			U32680	CCDS10632.1, CCDS73852.1, CCDS73853.1, CCDS73854.1, CCDS73855.1	16p12	2014-09-17	2008-07-29		ENSG00000188603	ENSG00000188603			2074	protein-coding gene	gene with protein product	"""juvenile neuronal ceroid lipofuscinosis"""	607042	"""Batten, Spielmeyer-Vogt disease"""	BTS		18317235	Standard	NM_001042432		Approved	JNCL	uc002dpp.3	Q13286	OTTHUMG00000097024	ENST00000569430.1:c.125+422C>G	16.37:g.28502380G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7J1|O00668|O95089|Q549S9|Q9UP09|Q9UP11|Q9UP12|Q9UP13|Q9UP14	RNA	SNP	-	NULL	ENST00000569430.1	37	NULL	CCDS10632.1	16																																																																																			CLN3	-	-		0.373	CLN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLN3	HGNC	protein_coding	OTTHUMT00000214115.2	G			28502380	-1	no_errors	ENST00000565236	ensembl	human	known	70_37	rna	SNP	0.003	C
CLSTN3	9746	genome.wustl.edu	37	12	7301578	7301578	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:7301578G>A	ENST00000266546.6	+	13	2308	c.1858G>A	c.(1858-1860)Gaa>Aaa	p.E620K	CLSTN3_ENST00000537408.1_Missense_Mutation_p.E632K	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	620					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GTGCTTCAGCGAAGAGTCCTG	0.577																																																	0													78.0	60.0	66.0					12																	7301578		2203	4300	6503	SO:0001583	missense	9746			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1858G>A	12.37:g.7301578G>A	ENSP00000266546:p.Glu620Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E620K	ENST00000266546.6	37	c.1858	CCDS8575.1	12	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324301	0.60634	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.33654	1.4;1.4	5.56	5.56	0.83823	.	0.107864	0.64402	D	0.000009	T	0.42854	0.1221	M	0.72353	2.195	0.80722	D	1	P;P	0.40476	0.569;0.718	B;B	0.37480	0.054;0.251	T	0.46911	-0.9157	10	0.54805	T	0.06	-16.4427	19.5349	0.95247	0.0:0.0:1.0:0.0	.	632;620	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	K	620;632	ENSP00000266546:E620K;ENSP00000440679:E632K	ENSP00000266546:E620K	E	+	1	0	CLSTN3	7192845	1.000000	0.71417	0.940000	0.37924	0.216000	0.24613	9.869000	0.99810	2.618000	0.88619	0.561000	0.74099	GAA	CLSTN3	-	NULL		0.577	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	HGNC	protein_coding	OTTHUMT00000398560.2	G	NM_014718		7301578	+1	no_errors	ENST00000266546	ensembl	human	known	70_37	missense	SNP	1.000	A
CLSTN3	9746	genome.wustl.edu	37	12	7301578	7301578	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:7301578G>A	ENST00000266546.6	+	13	2308	c.1858G>A	c.(1858-1860)Gaa>Aaa	p.E620K	CLSTN3_ENST00000537408.1_Missense_Mutation_p.E632K	NM_014718.3	NP_055533.2	Q9BQT9	CSTN3_HUMAN	calsyntenin 3	620					homophilic cell adhesion (GO:0007156)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|postsynaptic membrane (GO:0045211)	calcium ion binding (GO:0005509)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(12)|lung(7)|prostate(1)|skin(1)	33						GTGCTTCAGCGAAGAGTCCTG	0.577																																																	0													78.0	60.0	66.0					12																	7301578		2203	4300	6503	SO:0001583	missense	9746			AB018269	CCDS8575.1	12p13.31	2011-07-01			ENSG00000139182	ENSG00000139182		"""Cadherins / Cadherin-related"""	18371	protein-coding gene	gene with protein product	"""cadherin-related family member 14"""	611324				12498782	Standard	NM_014718		Approved	CSTN3, KIAA0726, CDHR14	uc001qsr.3	Q9BQT9	OTTHUMG00000168167	ENST00000266546.6:c.1858G>A	12.37:g.7301578G>A	ENSP00000266546:p.Glu620Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUT6|O94831|Q2T9J5|Q5UE57	Missense_Mutation	SNP	pfam_Cadherin,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E620K	ENST00000266546.6	37	c.1858	CCDS8575.1	12	.	.	.	.	.	.	.	.	.	.	G	17.18	3.324301	0.60634	.	.	ENSG00000139182	ENST00000266546;ENST00000537408	T;T	0.33654	1.4;1.4	5.56	5.56	0.83823	.	0.107864	0.64402	D	0.000009	T	0.42854	0.1221	M	0.72353	2.195	0.80722	D	1	P;P	0.40476	0.569;0.718	B;B	0.37480	0.054;0.251	T	0.46911	-0.9157	10	0.54805	T	0.06	-16.4427	19.5349	0.95247	0.0:0.0:1.0:0.0	.	632;620	Q5UE57;Q9BQT9	.;CSTN3_HUMAN	K	620;632	ENSP00000266546:E620K;ENSP00000440679:E632K	ENSP00000266546:E620K	E	+	1	0	CLSTN3	7192845	1.000000	0.71417	0.940000	0.37924	0.216000	0.24613	9.869000	0.99810	2.618000	0.88619	0.561000	0.74099	GAA	CLSTN3	-	NULL		0.577	CLSTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLSTN3	HGNC	protein_coding	OTTHUMT00000398560.2	G	NM_014718		7301578	+1	no_errors	ENST00000266546	ensembl	human	known	70_37	missense	SNP	1.000	A
COL11A2	1302	genome.wustl.edu	37	6	33141825	33141825	+	Missense_Mutation	SNP	G	G	A	rs121912949		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:33141825G>A	ENST00000374708.4	-	31	2492	c.2234C>T	c.(2233-2235)tCg>tTg	p.S745L	COL11A2_ENST00000374712.1_Missense_Mutation_p.S750L|COL11A2_ENST00000361917.1_Missense_Mutation_p.S724L|COL11A2_ENST00000374714.1_Missense_Mutation_p.S805L|COL11A2_ENST00000477772.1_Intron|COL11A2_ENST00000374713.1_Missense_Mutation_p.S784L|COL11A2_ENST00000357486.1_Missense_Mutation_p.S810L|COL11A2_ENST00000395197.1_Missense_Mutation_p.S771L|COL11A2_ENST00000341947.2_Missense_Mutation_p.S831L	NM_080681.2	NP_542412.2	P13942	COBA2_HUMAN	collagen, type XI, alpha 2	831	Triple-helical region.				cartilage development (GO:0051216)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|palate development (GO:0060021)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|soft palate development (GO:0060023)	collagen type XI trimer (GO:0005592)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)			biliary_tract(1)|breast(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|liver(1)|lung(27)|ovary(5)|prostate(5)|skin(6)	68						TGACTTCCCCGACAGGCCCTG	0.622																																					Melanoma(1;90 116 3946 5341 17093)												0			GRCh37	CM000672	COL11A2	M	rs121912949	G	LEU/SER,LEU/SER,LEU/SER	0,3022		0,0,1511	49.0	51.0	50.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	2171,2492,2234	3.7	0.8	6	dbSNP_133	50	1,5417		0,1,2708	yes	missense,missense,missense	COL11A2	NM_080679.2,NM_080680.2,NM_080681.2	145,145,145	0,1,4219	AA,AG,GG		0.0185,0.0,0.0118	possibly-damaging,possibly-damaging,possibly-damaging	724/1630,831/1737,745/1651	33141825	1,8439	1511	2709	4220	SO:0001583	missense	1302			U32169	CCDS43452.1, CCDS54992.1	6p21.3	2013-01-16			ENSG00000204248	ENSG00000204248		"""Collagens"""	2187	protein-coding gene	gene with protein product		120290		DFNA13, DFNB53		7559422, 10581026	Standard	NM_080679		Approved	HKE5	uc003ocx.1	P13942	OTTHUMG00000031036	ENST00000374708.4:c.2234C>T	6.37:g.33141825G>A	ENSP00000363840:p.Ser745Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLX2|E7ER90|Q07751|Q13271|Q13272|Q13273|Q5JP94|Q5SUI8|Q7Z6C3|Q99866|Q9UIP9	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibrinogen_a/b/g_C,smart_Laminin_G,smart_Fib_collagen_C	p.S831L	ENST00000374708.4	37	c.2492	CCDS43452.1	6	.	.	.	.	.	.	.	.	.	.	G	15.45	2.837328	0.50951	0.0	1.85E-4	ENSG00000204248	ENST00000374708;ENST00000341947;ENST00000357486;ENST00000374714;ENST00000374713;ENST00000395197;ENST00000374712;ENST00000361917	T;T;T;T;T;T;T;T	0.54675	0.56;0.56;0.56;0.56;0.56;0.56;0.56;0.56	4.55	3.68	0.42216	.	0.475051	0.20093	N	0.099382	T	0.28665	0.0710	N	0.24115	0.695	0.30483	N	0.772147	P;P;D	0.55800	0.946;0.946;0.973	P;P;B	0.49012	0.598;0.519;0.394	T	0.06006	-1.0851	10	0.31617	T	0.26	.	12.4632	0.55743	0.0:0.1698:0.8302:0.0	.	724;745;831	P13942-8;P13942-6;P13942	.;.;COBA2_HUMAN	L	745;831;810;805;784;771;750;724	ENSP00000363840:S745L;ENSP00000339915:S831L;ENSP00000350079:S810L;ENSP00000363846:S805L;ENSP00000363845:S784L;ENSP00000378623:S771L;ENSP00000363844:S750L;ENSP00000355123:S724L	ENSP00000339915:S831L	S	-	2	0	COL11A2	33249803	0.639000	0.27234	0.810000	0.32431	0.826000	0.46750	3.933000	0.56545	1.135000	0.42183	0.448000	0.29417	TCG	COL11A2	-	NULL		0.622	COL11A2-001	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	COL11A2	HGNC	protein_coding	OTTHUMT00000076032.2	G			33141825	-1	no_errors	ENST00000341947	ensembl	human	known	70_37	missense	SNP	0.663	A
COL4A4	1286	genome.wustl.edu	37	2	227919323	227919323	+	Silent	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:227919323C>A	ENST00000396625.3	-	31	3054	c.2847G>T	c.(2845-2847)ctG>ctT	p.L949L	COL4A4_ENST00000329662.7_Silent_p.L949L	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	949	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGGCCCCTCTCAGTCCCCGGT	0.478																																																	0													104.0	110.0	109.0					2																	227919323		1905	4121	6026	SO:0001819	synonymous_variant	1286				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2847G>T	2.37:g.227919323C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.L949	ENST00000396625.3	37	c.2847	CCDS42828.1	2																																																																																			COL4A4	-	pfam_Collagen		0.478	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	C	NM_000092		227919323	-1	no_errors	ENST00000396625	ensembl	human	known	70_37	silent	SNP	0.000	A
COL4A4	1286	genome.wustl.edu	37	2	227919323	227919323	+	Silent	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:227919323C>A	ENST00000396625.3	-	31	3054	c.2847G>T	c.(2845-2847)ctG>ctT	p.L949L	COL4A4_ENST00000329662.7_Silent_p.L949L	NM_000092.4	NP_000083.3	P53420	CO4A4_HUMAN	collagen, type IV, alpha 4	949	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glomerular basement membrane development (GO:0032836)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(15)|lung(35)|ovary(5)|pancreas(3)|prostate(2)|skin(12)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(3)	98		Renal(207;0.00844)|all_lung(227;0.0187)|Lung NSC(271;0.0879)|all_hematologic(139;0.21)|Esophageal squamous(248;0.242)		Epithelial(121;6.7e-11)|all cancers(144;5.39e-08)|Lung(261;0.0132)|LUSC - Lung squamous cell carcinoma(224;0.0181)		TGGCCCCTCTCAGTCCCCGGT	0.478																																																	0													104.0	110.0	109.0					2																	227919323		1905	4121	6026	SO:0001819	synonymous_variant	1286				CCDS42828.1	2q35-q37	2014-09-17			ENSG00000081052	ENSG00000081052		"""Collagens"""	2206	protein-coding gene	gene with protein product	"""collagen of basement membrane, alpha-4 chain"""	120131				1639407	Standard	NM_000092		Approved	CA44	uc021vxs.1	P53420	OTTHUMG00000149892	ENST00000396625.3:c.2847G>T	2.37:g.227919323C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTZ1|Q53RW9|Q53S42|Q53WR1	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.L949	ENST00000396625.3	37	c.2847	CCDS42828.1	2																																																																																			COL4A4	-	pfam_Collagen		0.478	COL4A4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL4A4	HGNC	protein_coding	OTTHUMT00000313770.1	C	NM_000092		227919323	-1	no_errors	ENST00000396625	ensembl	human	known	70_37	silent	SNP	0.000	A
COPG1	22820	genome.wustl.edu	37	3	128971139	128971139	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:128971139G>A	ENST00000314797.6	+	3	210	c.106G>A	c.(106-108)Gaa>Aaa	p.E36K		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	36					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										TGTATTTAATGAAACTCCCAT	0.433																																																	0													104.0	105.0	105.0					3																	128971139		2203	4300	6503	SO:0001583	missense	22820			AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.106G>A	3.37:g.128971139G>A	ENSP00000325002:p.Glu36Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_gsu_app,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_Coatomer/calthrin_app_sub_C,pirsf_Coatomer_gsu	p.E36K	ENST00000314797.6	37	c.106	CCDS33851.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.254719	0.95336	.	.	ENSG00000181789	ENST00000314797	T	0.24723	1.84	5.03	5.03	0.67393	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.48114	0.1482	M	0.65498	2.005	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.34925	-0.9809	10	0.33940	T	0.23	-5.3276	15.8781	0.79182	0.0:0.0:1.0:0.0	.	36	Q9Y678	COPG_HUMAN	K	36	ENSP00000325002:E36K	ENSP00000325002:E36K	E	+	1	0	COPG	130453829	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	9.481000	0.97933	2.351000	0.79841	0.460000	0.39030	GAA	COPG1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Coatomer_gsu		0.433	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPG1	HGNC	protein_coding	OTTHUMT00000355456.1	G	NM_016128		128971139	+1	no_errors	ENST00000314797	ensembl	human	known	70_37	missense	SNP	1.000	A
COPG1	22820	genome.wustl.edu	37	3	128971139	128971139	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:128971139G>A	ENST00000314797.6	+	3	210	c.106G>A	c.(106-108)Gaa>Aaa	p.E36K		NM_016128.3	NP_057212.1	Q9Y678	COPG1_HUMAN	coatomer protein complex, subunit gamma 1	36					COPI coating of Golgi vesicle (GO:0048205)|establishment of Golgi localization (GO:0051683)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|organelle transport along microtubule (GO:0072384)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)	structural molecule activity (GO:0005198)										TGTATTTAATGAAACTCCCAT	0.433																																																	0													104.0	105.0	105.0					3																	128971139		2203	4300	6503	SO:0001583	missense	22820			AB047846	CCDS33851.1	3q21.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000181789	ENSG00000181789			2236	protein-coding gene	gene with protein product	"""coat protein gamma-cop"""	615525	"""coatomer protein complex, subunit gamma"""	COPG		11056392	Standard	NM_016128		Approved		uc003els.3	Q9Y678	OTTHUMG00000159451	ENST00000314797.6:c.106G>A	3.37:g.128971139G>A	ENSP00000325002:p.Glu36Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6M8|B3KMF6|Q54AC4	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Coatomer_gsu_app,superfamily_ARM-type_fold,superfamily_Coatomer/clathrin_app_Ig-like,superfamily_Coatomer/calthrin_app_sub_C,pirsf_Coatomer_gsu	p.E36K	ENST00000314797.6	37	c.106	CCDS33851.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.254719	0.95336	.	.	ENSG00000181789	ENST00000314797	T	0.24723	1.84	5.03	5.03	0.67393	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.64402	D	0.000001	T	0.48114	0.1482	M	0.65498	2.005	0.80722	D	1	D	0.57257	0.979	D	0.71414	0.973	T	0.34925	-0.9809	10	0.33940	T	0.23	-5.3276	15.8781	0.79182	0.0:0.0:1.0:0.0	.	36	Q9Y678	COPG_HUMAN	K	36	ENSP00000325002:E36K	ENSP00000325002:E36K	E	+	1	0	COPG	130453829	1.000000	0.71417	0.990000	0.47175	0.982000	0.71751	9.481000	0.97933	2.351000	0.79841	0.460000	0.39030	GAA	COPG1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_Coatomer_gsu		0.433	COPG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPG1	HGNC	protein_coding	OTTHUMT00000355456.1	G	NM_016128		128971139	+1	no_errors	ENST00000314797	ensembl	human	known	70_37	missense	SNP	1.000	A
CPSF3L	54973	genome.wustl.edu	37	1	1252786	1252786	+	Intron	SNP	G	G	A	rs558231595		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:1252786G>A	ENST00000435064.1	-	5	512				CPSF3L_ENST00000421495.2_Intron|CPSF3L_ENST00000540437.1_Intron|RP5-890O3.9_ENST00000444968.1_RNA|CPSF3L_ENST00000411962.1_Intron|CPSF3L_ENST00000450926.2_Intron|CPSF3L_ENST00000462432.1_5'UTR|CPSF3L_ENST00000545578.1_Intron|CPSF3L_ENST00000419704.1_Intron	NM_001256460.1|NM_017871.5	NP_001243389.1|NP_060341.2	Q5TA45	INT11_HUMAN	cleavage and polyadenylation specific factor 3-like						snRNA processing (GO:0016180)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|integrator complex (GO:0032039)	hydrolase activity (GO:0016787)			endometrium(4)|kidney(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(3)	13	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		Epithelial(90;6.71e-35)|OV - Ovarian serous cystadenocarcinoma(86;4.35e-21)|Colorectal(212;0.000166)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.00235)|BRCA - Breast invasive adenocarcinoma(365;0.00255)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0349)|Lung(427;0.201)		aaaaaaaaaagaaaaaaaaaa	0.423																																																	0																																										SO:0001627	intron_variant	54973			AL136813	CCDS21.1, CCDS57959.1, CCDS57960.1, CCDS57961.1, CCDS72678.1	1p36.33	2008-02-05			ENSG00000127054	ENSG00000127054			26052	protein-coding gene	gene with protein product	"""integrator complex subunit 11"""	611354				15684398, 16239144	Standard	NM_001256456		Approved	FLJ20542, RC-68, CPSF73L, INT11, INTS11	uc001aee.2	Q5TA45	OTTHUMG00000003330	ENST00000435064.1:c.430-1788C>T	1.37:g.1252786G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5S2|B3KPR3|B4DM87|G3V1S5|Q5TA46|Q5TA48|Q5TA52|Q5TA53|Q5TA54|Q7L3D7|Q96HY1|Q9BW36|Q9H0F9|Q9H8R5|Q9HAA6|Q9NWX9	RNA	SNP	-	NULL	ENST00000435064.1	37	NULL	CCDS21.1	1																																																																																			CPSF3L	-	-		0.423	CPSF3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF3L	HGNC	protein_coding	OTTHUMT00000009360.2	G	NM_017871		1252786	-1	no_errors	ENST00000462432	ensembl	human	known	70_37	rna	SNP	0.047	A
CREBBP	1387	genome.wustl.edu	37	16	3900422	3900422	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:3900422G>A	ENST00000262367.5	-	2	1483	c.674C>T	c.(673-675)cCg>cTg	p.P225L	CREBBP_ENST00000382070.3_Missense_Mutation_p.P225L	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	225					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGTAGGGTACGGCATTCCAGC	0.582			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													94.0	85.0	88.0					16																	3900422		2197	4300	6497	SO:0001583	missense	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.674C>T	16.37:g.3900422G>A	ENSP00000262367:p.Pro225Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.P225L	ENST00000262367.5	37	c.674	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784196	0.49997	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.83419	-1.72;-1.63	6.01	5.01	0.66863	.	0.072010	0.64402	D	0.000018	T	0.66655	0.2811	N	0.24115	0.695	0.51767	D	0.999931	B;P	0.42584	0.216;0.784	B;B	0.28991	0.015;0.097	T	0.68565	-0.5375	10	0.33940	T	0.23	-14.7972	11.7987	0.52114	0.0:0.0:0.6272:0.3728	.	293;225	Q4LE28;Q92793	.;CBP_HUMAN	L	225;293;225	ENSP00000262367:P225L;ENSP00000371502:P225L	ENSP00000262367:P225L	P	-	2	0	CREBBP	3840423	1.000000	0.71417	0.973000	0.42090	0.987000	0.75469	6.020000	0.70826	2.861000	0.98227	0.650000	0.86243	CCG	CREBBP	-	NULL		0.582	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	G	NM_004380		3900422	-1	no_errors	ENST00000262367	ensembl	human	known	70_37	missense	SNP	0.999	A
CREBBP	1387	genome.wustl.edu	37	16	3900422	3900422	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:3900422G>A	ENST00000262367.5	-	2	1483	c.674C>T	c.(673-675)cCg>cTg	p.P225L	CREBBP_ENST00000382070.3_Missense_Mutation_p.P225L	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	225					cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		AGTAGGGTACGGCATTCCAGC	0.582			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													94.0	85.0	88.0					16																	3900422		2197	4300	6497	SO:0001583	missense	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.674C>T	16.37:g.3900422G>A	ENSP00000262367:p.Pro225Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUC9|O00147|Q16376|Q4LE28	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.P225L	ENST00000262367.5	37	c.674	CCDS10509.1	16	.	.	.	.	.	.	.	.	.	.	G	15.27	2.784196	0.49997	.	.	ENSG00000005339	ENST00000262367;ENST00000543883;ENST00000382070	D;D	0.83419	-1.72;-1.63	6.01	5.01	0.66863	.	0.072010	0.64402	D	0.000018	T	0.66655	0.2811	N	0.24115	0.695	0.51767	D	0.999931	B;P	0.42584	0.216;0.784	B;B	0.28991	0.015;0.097	T	0.68565	-0.5375	10	0.33940	T	0.23	-14.7972	11.7987	0.52114	0.0:0.0:0.6272:0.3728	.	293;225	Q4LE28;Q92793	.;CBP_HUMAN	L	225;293;225	ENSP00000262367:P225L;ENSP00000371502:P225L	ENSP00000262367:P225L	P	-	2	0	CREBBP	3840423	1.000000	0.71417	0.973000	0.42090	0.987000	0.75469	6.020000	0.70826	2.861000	0.98227	0.650000	0.86243	CCG	CREBBP	-	NULL		0.582	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	G	NM_004380		3900422	-1	no_errors	ENST00000262367	ensembl	human	known	70_37	missense	SNP	0.999	A
CRHR1	1394	genome.wustl.edu	37	17	43725080	43725080	+	Intron	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:43725080C>G	ENST00000293493.7	+	2	396				CRHR1_ENST00000339069.5_Intron|RP11-105N13.4_ENST00000587305.1_RNA	NM_001256299.1	NP_001243228.1	P34998	CRFR1_HUMAN	corticotropin releasing hormone receptor 1						activation of adenylate cyclase activity (GO:0007190)|adrenal gland development (GO:0030325)|behavioral response to cocaine (GO:0048148)|behavioral response to ethanol (GO:0048149)|behavioral response to pain (GO:0048266)|cellular response to corticotropin-releasing hormone stimulus (GO:0071376)|corticotropin secretion (GO:0051458)|epithelial cell differentiation (GO:0030855)|fear response (GO:0042596)|female pregnancy (GO:0007565)|general adaptation syndrome, behavioral process (GO:0051867)|hypothalamus development (GO:0021854)|immune response (GO:0006955)|locomotory exploration behavior (GO:0035641)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|negative regulation of epinephrine secretion (GO:0032811)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neuron death (GO:1901215)|negative regulation of voltage-gated calcium channel activity (GO:1901386)|neuropeptide signaling pathway (GO:0007218)|parturition (GO:0007567)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010579)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of mast cell degranulation (GO:0043306)|regulation of adenylate cyclase activity involved in G-protein coupled receptor signaling pathway (GO:0010578)|regulation of corticosterone secretion (GO:2000852)|response to hypoxia (GO:0001666)|response to immobilization stress (GO:0035902)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|multivesicular body (GO:0005771)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)|vesicle (GO:0031982)	corticotrophin-releasing factor receptor activity (GO:0015056)|corticotropin-releasing hormone binding (GO:0051424)|corticotropin-releasing hormone receptor activity (GO:0043404)			NS(1)|breast(1)|endometrium(1)|large_intestine(4)|lung(15)|pancreas(1)|skin(1)	24	Colorectal(2;0.0416)			BRCA - Breast invasive adenocarcinoma(366;0.161)		TGTAGATAATCAAATAACAAA	0.398																																					Ovarian(110;57 1568 10207 38216 49865)												0																																										SO:0001627	intron_variant	147081			L23332	CCDS42350.1, CCDS45712.1, CCDS45713.1, CCDS45714.1	17q12-q22	2012-08-14			ENSG00000120088	ENSG00000120088		"""GPCR / Class B : Corticotropin-releasing factor receptors"""	2357	protein-coding gene	gene with protein product	"""corticotropin-releasing factor receptor"""	122561		CRHR		7590738	Standard	NM_004382		Approved	CRF-R, CRF1	uc010dap.3	P34998		ENST00000293493.7:c.-493+17556C>G	17.37:g.43725080C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIE9|Q13008|Q4QRJ1|Q9UK64	RNA	SNP	-	NULL	ENST00000293493.7	37	NULL	CCDS58556.1	17																																																																																			CRHR1-IT1	-	-		0.398	CRHR1-201	KNOWN	basic|CCDS	protein_coding	CRHR1-IT1	HGNC	protein_coding		C			43725080	+1	no_errors	ENST00000589868	ensembl	human	known	70_37	rna	SNP	0.000	G
CUBN	8029	genome.wustl.edu	37	10	16967746	16967746	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:16967746C>G	ENST00000377833.4	-	42	6364	c.6299G>C	c.(6298-6300)aGa>aCa	p.R2100T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2100	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GATGATCCCTCTGTCTGCATG	0.463																																																	0													85.0	71.0	76.0					10																	16967746		2203	4300	6503	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6299G>C	10.37:g.16967746C>G	ENSP00000367064:p.Arg2100Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.R2100T	ENST00000377833.4	37	c.6299	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004897	0.54254	.	.	ENSG00000107611	ENST00000377833	T	0.16743	2.32	5.65	4.75	0.60458	CUB (5);	0.000000	0.44688	D	0.000423	T	0.18002	0.0432	N	0.25957	0.775	0.80722	D	1	P	0.49635	0.926	P	0.51895	0.683	T	0.02728	-1.1118	10	0.08837	T	0.75	.	14.4857	0.67616	0.0:0.9296:0.0:0.0704	.	2100	O60494	CUBN_HUMAN	T	2100	ENSP00000367064:R2100T	ENSP00000367064:R2100T	R	-	2	0	CUBN	17007752	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	5.748000	0.68697	1.400000	0.46741	0.655000	0.94253	AGA	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.463	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	C	NM_001081		16967746	-1	no_errors	ENST00000377833	ensembl	human	known	70_37	missense	SNP	1.000	G
CUBN	8029	genome.wustl.edu	37	10	16967746	16967746	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:16967746C>G	ENST00000377833.4	-	42	6364	c.6299G>C	c.(6298-6300)aGa>aCa	p.R2100T		NM_001081.3	NP_001072.2	O60494	CUBN_HUMAN	cubilin (intrinsic factor-cobalamin receptor)	2100	CUB 15. {ECO:0000255|PROSITE- ProRule:PRU00059}.				cholesterol metabolic process (GO:0008203)|cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|receptor-mediated endocytosis (GO:0006898)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|tissue homeostasis (GO:0001894)|vitamin D metabolic process (GO:0042359)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|cytosol (GO:0005829)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|extrinsic component of external side of plasma membrane (GO:0031232)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|cobalamin binding (GO:0031419)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)|transporter activity (GO:0005215)			breast(8)|central_nervous_system(4)|cervix(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(3)|kidney(12)|large_intestine(42)|liver(1)|lung(107)|ovary(9)|pancreas(2)|prostate(3)|skin(9)|stomach(3)|upper_aerodigestive_tract(11)|urinary_tract(8)	241					Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	GATGATCCCTCTGTCTGCATG	0.463																																																	0													85.0	71.0	76.0					10																	16967746		2203	4300	6503	SO:0001583	missense	8029			AF034611	CCDS7113.1	10p12	2014-09-17			ENSG00000107611	ENSG00000107611			2548	protein-coding gene	gene with protein product		602997		MGA1		9572993, 9478979	Standard	NM_001081		Approved	IFCR, gp280	uc001ioo.3	O60494	OTTHUMG00000017741	ENST00000377833.4:c.6299G>C	10.37:g.16967746C>G	ENSP00000367064:p.Arg2100Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YIZ4|Q5VTA6|Q96RU9	Missense_Mutation	SNP	pfam_CUB,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.R2100T	ENST00000377833.4	37	c.6299	CCDS7113.1	10	.	.	.	.	.	.	.	.	.	.	C	16.02	3.004897	0.54254	.	.	ENSG00000107611	ENST00000377833	T	0.16743	2.32	5.65	4.75	0.60458	CUB (5);	0.000000	0.44688	D	0.000423	T	0.18002	0.0432	N	0.25957	0.775	0.80722	D	1	P	0.49635	0.926	P	0.51895	0.683	T	0.02728	-1.1118	10	0.08837	T	0.75	.	14.4857	0.67616	0.0:0.9296:0.0:0.0704	.	2100	O60494	CUBN_HUMAN	T	2100	ENSP00000367064:R2100T	ENSP00000367064:R2100T	R	-	2	0	CUBN	17007752	1.000000	0.71417	0.998000	0.56505	0.960000	0.62799	5.748000	0.68697	1.400000	0.46741	0.655000	0.94253	AGA	CUBN	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.463	CUBN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUBN	HGNC	protein_coding	OTTHUMT00000047009.1	C	NM_001081		16967746	-1	no_errors	ENST00000377833	ensembl	human	known	70_37	missense	SNP	1.000	G
CUL9	23113	genome.wustl.edu	37	6	43163948	43163948	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:43163948G>C	ENST00000252050.4	+	10	2614	c.2530G>C	c.(2530-2532)Gag>Cag	p.E844Q	CUL9_ENST00000354495.3_Missense_Mutation_p.E734Q|CUL9_ENST00000372647.2_Missense_Mutation_p.E844Q	NM_015089.2	NP_055904.1	Q8IWT3	CUL9_HUMAN	cullin 9	844					microtubule cytoskeleton organization (GO:0000226)|protein ubiquitination (GO:0016567)|regulation of mitosis (GO:0007088)|ubiquitin-dependent protein catabolic process (GO:0006511)	cullin-RING ubiquitin ligase complex (GO:0031461)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|liver(1)|lung(30)|ovary(5)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(4)	92						CCCGGGCTCTGAGAGCCTGCT	0.547																																																	0													69.0	63.0	65.0					6																	43163948		2203	4300	6503	SO:0001583	missense	23113			AB014608	CCDS4890.1	6p21.1	2011-05-24			ENSG00000112659	ENSG00000112659			15982	protein-coding gene	gene with protein product	"""parkin-like cytoplasmic p53 binding protein"", ""p53-associated parkin-like cytoplasmic protein"""	607489				17332328, 10521492, 12526791	Standard	NM_015089		Approved	H7AP1, KIAA0708, PARC	uc003ouk.3	Q8IWT3	OTTHUMG00000014723	ENST00000252050.4:c.2530G>C	6.37:g.43163948G>C	ENSP00000252050:p.Glu844Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O75188|Q5TCY3|Q68CP2|Q68D92|Q8N3W9|Q9BU56	Missense_Mutation	SNP	pfam_Cullin_N,pfam_CPH_domain,pfam_Znf_C6HC,pfam_APC_su10/DOC_dom,superfamily_Galactose-bd-like,superfamily_Cullin_homology,superfamily_ARM-type_fold,superfamily_UBA-like,smart_Cullin_neddylation_domain,smart_Znf_C6HC,pfscan_Znf_RING,pfscan_Cullin_homology	p.E844Q	ENST00000252050.4	37	c.2530	CCDS4890.1	6	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305341	0.60305	.	.	ENSG00000112659	ENST00000252050;ENST00000354495;ENST00000372647	T;T;T	0.73575	-0.76;-0.76;-0.66	4.97	4.97	0.65823	Armadillo-type fold (1);	0.718594	0.13696	N	0.369206	T	0.52629	0.1746	L	0.29908	0.895	0.09310	N	1	P;P	0.47106	0.89;0.89	B;B	0.43413	0.419;0.419	T	0.52230	-0.8603	10	0.62326	D	0.03	-8.406	11.3907	0.49813	0.0847:0.0:0.9153:0.0	.	844;844	E9PEZ1;Q8IWT3	.;CUL9_HUMAN	Q	844;734;844	ENSP00000252050:E844Q;ENSP00000346490:E734Q;ENSP00000361730:E844Q	ENSP00000252050:E844Q	E	+	1	0	CUL9	43271926	0.971000	0.33674	0.971000	0.41717	0.991000	0.79684	3.977000	0.56874	2.308000	0.77769	0.563000	0.77884	GAG	CUL9	-	superfamily_ARM-type_fold		0.547	CUL9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL9	HGNC	protein_coding	OTTHUMT00000040582.2	G	NM_015089		43163948	+1	no_errors	ENST00000252050	ensembl	human	known	70_37	missense	SNP	0.019	C
CYB5R3	1727	genome.wustl.edu	37	22	43027454	43027454	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:43027454G>C	ENST00000352397.5	-	3	408	c.156C>G	c.(154-156)atC>atG	p.I52M	CYB5R3_ENST00000407623.3_Missense_Mutation_p.I29M|CYB5R3_ENST00000402438.1_Missense_Mutation_p.I29M|CYB5R3_ENST00000407332.1_Missense_Mutation_p.I29M|CYB5R3_ENST00000396303.3_Missense_Mutation_p.I29M|CYB5R3_ENST00000361740.4_Missense_Mutation_p.I85M	NM_000398.6	NP_000389.1	P00387	NB5R3_HUMAN	cytochrome b5 reductase 3	52	FAD-binding FR-type. {ECO:0000255|PROSITE-ProRule:PRU00716}.				blood circulation (GO:0008015)|cholesterol biosynthetic process (GO:0006695)|L-ascorbic acid metabolic process (GO:0019852)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|hemoglobin complex (GO:0005833)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|cytochrome-b5 reductase activity, acting on NAD(P)H (GO:0004128)|FAD binding (GO:0071949)|flavin adenine dinucleotide binding (GO:0050660)|NAD binding (GO:0051287)			kidney(2)|large_intestine(1)|lung(2)|skin(1)	6					Flavin adenine dinucleotide(DB03147)	CATGGCTGATGATCTGGAGAG	0.672																																																	0													79.0	87.0	85.0					22																	43027454		1807	3377	5184	SO:0001583	missense	1727			M16461	CCDS14040.1, CCDS33658.1, CCDS54535.1	22q13.2	2012-10-02		2005-07-13	ENSG00000100243	ENSG00000100243	1.6.2.2		2873	protein-coding gene	gene with protein product		613213	"""diaphorase (NADH) (cytochrome b-5 reductase)"""	DIA1		2479590, 3268037	Standard	NM_001129819		Approved		uc011aps.2	P00387	OTTHUMG00000150745	ENST00000352397.5:c.156C>G	22.37:g.43027454G>C	ENSP00000338461:p.Ile52Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHF2|B7Z7L3|O75675|Q8TDL8|Q8WTS8|Q9UEN4|Q9UEN5|Q9UL55|Q9UL56	Missense_Mutation	SNP	pfam_OxRdtase_FAD-bd_dom,pfam_OxRdtase_FAD/NAD-bd,superfamily_Riboflavin_synthase-like_b-brl,prints_NADH-Cyt_B5_reductase,prints_Flavoprot_Pyr_Nucl_cyt_Rdtase	p.I85M	ENST00000352397.5	37	c.255	CCDS33658.1	22	.	.	.	.	.	.	.	.	.	.	G	13.39	2.223381	0.39300	.	.	ENSG00000100243	ENST00000361740;ENST00000396303;ENST00000352397;ENST00000407623;ENST00000407332;ENST00000402438;ENST00000438270	D;D;D;D;D;D;D	0.84589	-1.87;-1.87;-1.87;-1.87;-1.87;-1.87;-1.87	3.23	-0.48	0.12085	Riboflavin synthase-like beta-barrel (1);Ferredoxin reductase-type FAD-binding domain (1);Oxidoreductase, FAD-binding domain (1);	0.960400	0.08572	N	0.925963	D	0.85414	0.5691	M	0.71296	2.17	0.27111	N	0.962372	P;B	0.42375	0.778;0.017	P;B	0.50791	0.65;0.267	T	0.74331	-0.3700	10	0.52906	T	0.07	-5.2231	1.2597	0.01999	0.2298:0.3389:0.2809:0.1504	.	85;52	B7Z7L3;P00387	.;NB5R3_HUMAN	M	85;29;52;29;29;29;29	ENSP00000354468:I85M;ENSP00000379597:I29M;ENSP00000338461:I52M;ENSP00000384834:I29M;ENSP00000384457:I29M;ENSP00000385679:I29M;ENSP00000403439:I29M	ENSP00000338461:I52M	I	-	3	3	CYB5R3	41357398	0.042000	0.20092	0.671000	0.29857	0.880000	0.50808	-0.067000	0.11579	-0.006000	0.14370	0.455000	0.32223	ATC	CYB5R3	-	pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl		0.672	CYB5R3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYB5R3	HGNC	protein_coding	OTTHUMT00000320439.1	G			43027454	-1	no_errors	ENST00000361740	ensembl	human	known	70_37	missense	SNP	0.772	C
CYB561A3	220002	genome.wustl.edu	37	11	61129412	61129412	+	5'UTR	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:61129412G>C	ENST00000294072.4	-	0	359				CYB561A3_ENST00000546151.1_5'Flank|CYB561A3_ENST00000544118.1_5'Flank|CYB561A3_ENST00000426130.2_5'UTR|TMEM138_ENST00000278826.6_5'Flank|CYB561A3_ENST00000447532.2_5'Flank|TMEM138_ENST00000542946.1_5'Flank|CYB561A3_ENST00000540317.1_5'Flank	NM_001161452.1|NM_153611.4	NP_001154924.1|NP_705839.3	Q8NBI2	CYAC3_HUMAN	cytochrome b561 family, member A3							integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)										AGTCGCGCGCGAGGCCTCCTG	0.667																																																	0																																										SO:0001623	5_prime_UTR_variant	220002			AK024953	CCDS8004.1, CCDS53639.1, CCDS73296.1	11q12.2	2013-03-14	2013-03-14	2013-03-14		ENSG00000162144		"""Cytochrome b genes"""	23014	protein-coding gene	gene with protein product			"""cytochrome b, ascorbate dependent 3"""	CYBASC3		23249217	Standard	NM_153611		Approved		uc001nrf.4	Q8NBI2		ENST00000294072.4:c.-319C>G	11.37:g.61129412G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPU2|B4DLN9|J3KQH4|Q6PK96	RNA	SNP	-	NULL	ENST00000294072.4	37	NULL	CCDS8004.1	11																																																																																			CYBASC3	-	-		0.667	CYB561A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBASC3	HGNC	protein_coding	OTTHUMT00000398714.2	G	NM_153611		61129412	-1	no_errors	ENST00000535152	ensembl	human	known	70_37	rna	SNP	0.006	C
CYB561A3	220002	genome.wustl.edu	37	11	61129606	61129606	+	5'UTR	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:61129606G>C	ENST00000294072.4	-	0	165				CYB561A3_ENST00000546151.1_5'Flank|CYB561A3_ENST00000544118.1_5'Flank|CYB561A3_ENST00000426130.2_5'UTR|TMEM138_ENST00000278826.6_5'UTR|CYB561A3_ENST00000447532.2_5'Flank|TMEM138_ENST00000542946.1_5'Flank|CYB561A3_ENST00000540317.1_5'Flank	NM_001161452.1|NM_153611.4	NP_001154924.1|NP_705839.3	Q8NBI2	CYAC3_HUMAN	cytochrome b561 family, member A3							integral component of membrane (GO:0016021)|late endosome membrane (GO:0031902)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)|oxidoreductase activity (GO:0016491)										AGGTGAACGCGAAGCCTCCCA	0.657																																																	0																																										SO:0001623	5_prime_UTR_variant	220002			AK024953	CCDS8004.1, CCDS53639.1, CCDS73296.1	11q12.2	2013-03-14	2013-03-14	2013-03-14		ENSG00000162144		"""Cytochrome b genes"""	23014	protein-coding gene	gene with protein product			"""cytochrome b, ascorbate dependent 3"""	CYBASC3		23249217	Standard	NM_153611		Approved		uc001nrf.4	Q8NBI2		ENST00000294072.4:c.-513C>G	11.37:g.61129606G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPU2|B4DLN9|J3KQH4|Q6PK96	RNA	SNP	-	NULL	ENST00000294072.4	37	NULL	CCDS8004.1	11																																																																																			CYBASC3	-	-		0.657	CYB561A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYBASC3	HGNC	protein_coding	OTTHUMT00000398714.2	G	NM_153611		61129606	-1	no_errors	ENST00000535152	ensembl	human	known	70_37	rna	SNP	0.000	C
CYLC1	1538	genome.wustl.edu	37	X	83127936	83127936	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:83127936C>A	ENST00000329312.4	+	4	257	c.220C>A	c.(220-222)Cat>Aat	p.H74N		NM_021118.1	NP_066941.1	P35663	CYLC1_HUMAN	cylicin, basic protein of sperm head cytoskeleton 1	74					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	acrosomal matrix (GO:0043159)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			NS(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(11)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	58						GAAACCAGCTCATAAATGGAT	0.358																																																	0													27.0	26.0	26.0					X																	83127936		2193	4293	6486	SO:0001583	missense	1538			Z22780	CCDS35341.1, CCDS75998.1	Xq21.1	2008-07-31			ENSG00000183035	ENSG00000183035			2582	protein-coding gene	gene with protein product	"""cylicin 1"""	300768				7737358, 8354692	Standard	NM_021118		Approved		uc004eei.2	P35663	OTTHUMG00000021922	ENST00000329312.4:c.220C>A	X.37:g.83127936C>A	ENSP00000331556:p.His74Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVQ8|Q5JQQ9	Missense_Mutation	SNP	NULL	p.H74N	ENST00000329312.4	37	c.220	CCDS35341.1	X	.	.	.	.	.	.	.	.	.	.	c	0.693	-0.793852	0.02862	.	.	ENSG00000183035	ENST00000329312;ENST00000544771	T	0.50277	0.75	4.58	-0.231	0.13086	.	.	.	.	.	T	0.34366	0.0895	L	0.34521	1.04	0.09310	N	1	P;P	0.40476	0.718;0.718	P;P	0.44359	0.447;0.447	T	0.20638	-1.0269	9	0.18710	T	0.47	-0.0291	4.4042	0.11400	0.0:0.4559:0.1589:0.3852	.	74;74	P35663;F5H4V5	CYLC1_HUMAN;.	N	74	ENSP00000331556:H74N	ENSP00000331556:H74N	H	+	1	0	CYLC1	83014592	0.000000	0.05858	0.035000	0.18076	0.012000	0.07955	-0.741000	0.04855	-0.334000	0.08463	-1.817000	0.00601	CAT	CYLC1	-	NULL		0.358	CYLC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYLC1	HGNC	protein_coding	OTTHUMT00000057371.1	C	NM_021118		83127936	+1	no_errors	ENST00000329312	ensembl	human	known	70_37	missense	SNP	0.018	A
CYP2W1	54905	genome.wustl.edu	37	7	1022953	1022953	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:1022953C>T	ENST00000308919.7	+	1	119	c.106C>T	c.(106-108)Cgc>Tgc	p.R36C	CYP2W1_ENST00000340150.6_5'Flank	NM_017781.2	NP_060251.2	Q8TAV3	CP2W1_HUMAN	cytochrome P450, family 2, subfamily W, polypeptide 1	36					small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			breast(1)|large_intestine(1)|lung(4)|urinary_tract(1)	7		Ovarian(82;0.0112)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;1.74e-15)		CCCGGGGCCTCGCCCGCTGCC	0.716																																																	0													9.0	9.0	9.0					7																	1022953		1956	3832	5788	SO:0001583	missense	54905			AK000366	CCDS5319.2	7p22.3	2004-07-05			ENSG00000073067	ENSG00000073067		"""Cytochrome P450s"""	20243	protein-coding gene	gene with protein product		615967					Standard	XM_005249792		Approved	FLJ20359, MGC34287	uc003sjq.1	Q8TAV3	OTTHUMG00000074071	ENST00000308919.7:c.106C>T	7.37:g.1022953C>T	ENSP00000310149:p.Arg36Cys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.R36C	ENST00000308919.7	37	c.106	CCDS5319.2	7	.	.	.	.	.	.	.	.	.	.	C	6.155	0.396849	0.11638	.	.	ENSG00000073067	ENST00000308919	T	0.80033	-1.33	4.52	-3.17	0.05202	.	0.702565	0.13949	N	0.351671	T	0.71230	0.3315	M	0.68728	2.09	0.09310	N	0.999995	B	0.25390	0.125	B	0.27608	0.081	T	0.62501	-0.6841	10	0.59425	D	0.04	.	1.7784	0.03026	0.2868:0.3859:0.0909:0.2364	.	36	Q8TAV3	CP2W1_HUMAN	C	36	ENSP00000310149:R36C	ENSP00000310149:R36C	R	+	1	0	CYP2W1	989479	0.000000	0.05858	0.154000	0.22540	0.269000	0.26545	-0.567000	0.05916	-0.328000	0.08539	-0.813000	0.03139	CGC	CYP2W1	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.716	CYP2W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP2W1	HGNC	protein_coding	OTTHUMT00000157249.1	C	NM_017781		1022953	+1	no_errors	ENST00000308919	ensembl	human	known	70_37	missense	SNP	0.000	T
DAO	1610	genome.wustl.edu	37	12	109293228	109293228	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:109293228C>T	ENST00000228476.3	+	10	1093	c.889C>T	c.(889-891)Cgc>Tgc	p.R297C	DAO_ENST00000551281.1_Missense_Mutation_p.R231C	NM_001917.4	NP_001908.3	P14920	OXDA_HUMAN	D-amino-acid oxidase	297					cellular nitrogen compound metabolic process (GO:0034641)|D-alanine catabolic process (GO:0055130)|D-serine catabolic process (GO:0036088)|D-serine metabolic process (GO:0070178)|dopamine biosynthetic process (GO:0042416)|glyoxylate metabolic process (GO:0046487)|leucine metabolic process (GO:0006551)|proline catabolic process (GO:0006562)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	cofactor binding (GO:0048037)|D-amino-acid oxidase activity (GO:0003884)|FAD binding (GO:0071949)|protein dimerization activity (GO:0046983)|receptor binding (GO:0005102)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|prostate(2)|skin(1)	26					Flavin adenine dinucleotide(DB03147)	AGAACAGCTTCGCACTGGACC	0.498																																																	0													52.0	43.0	46.0					12																	109293228		2203	4300	6503	SO:0001583	missense	1610			D11370	CCDS9122.1	12q24.11	2013-09-20			ENSG00000110887	ENSG00000110887	1.4.3.3		2671	protein-coding gene	gene with protein product		124050				1356107, 8182053	Standard	NM_001917		Approved	DAMOX	uc001tnr.4	P14920	OTTHUMG00000169360	ENST00000228476.3:c.889C>T	12.37:g.109293228C>T	ENSP00000228476:p.Arg297Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7I5|Q16758|Q8N6R2	Missense_Mutation	SNP	pfam_FAD-dep_OxRdtase	p.R297C	ENST00000228476.3	37	c.889	CCDS9122.1	12	.	.	.	.	.	.	.	.	.	.	c	11.20	1.569733	0.28003	.	.	ENSG00000110887	ENST00000551281;ENST00000228476	T;T	0.44482	0.92;0.92	5.03	-0.582	0.11709	FAD dependent oxidoreductase (1);NAD(P)-binding domain (1);	1.153850	0.05914	N	0.632335	T	0.37865	0.1019	M	0.71581	2.175	0.09310	N	1	B;B	0.18310	0.004;0.027	B;B	0.10450	0.003;0.005	T	0.42548	-0.9445	10	0.56958	D	0.05	-18.4822	1.1976	0.01878	0.1362:0.3563:0.2451:0.2624	.	297;280	P14920;Q7Z312	OXDA_HUMAN;.	C	231;297	ENSP00000446853:R231C;ENSP00000228476:R297C	ENSP00000228476:R297C	R	+	1	0	DAO	107817357	0.000000	0.05858	0.024000	0.17045	0.047000	0.14425	-0.339000	0.07832	0.149000	0.19098	-0.321000	0.08615	CGC	DAO	-	pfam_FAD-dep_OxRdtase		0.498	DAO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAO	HGNC	protein_coding	OTTHUMT00000403682.1	C			109293228	+1	no_errors	ENST00000228476	ensembl	human	known	70_37	missense	SNP	0.001	T
DBH	1621	genome.wustl.edu	37	9	136523568	136523568	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:136523568G>A	ENST00000393056.2	+	12	1865	c.1853G>A	c.(1852-1854)tGa>tAa	p.*618*	DBH-AS1_ENST00000425189.1_RNA	NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	0					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GGCAAAGGCTGAGGGGGGACC	0.652																																																	0													26.0	27.0	27.0					9																	136523568		2203	4299	6502	SO:0001819	synonymous_variant	1621			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.1853G>A	9.37:g.136523568G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T381|Q96AG2	Silent	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.*618	ENST00000393056.2	37	c.1853	CCDS6977.2	9																																																																																			DBH	-	NULL		0.652	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	HGNC	protein_coding	OTTHUMT00000054929.2	G	NM_000787		136523568	+1	no_errors	ENST00000393056	ensembl	human	known	70_37	silent	SNP	0.000	A
DBH	1621	genome.wustl.edu	37	9	136523568	136523568	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:136523568G>A	ENST00000393056.2	+	12	1865	c.1853G>A	c.(1852-1854)tGa>tAa	p.*618*	DBH-AS1_ENST00000425189.1_RNA	NM_000787.3	NP_000778.3	P09172	DOPO_HUMAN	dopamine beta-hydroxylase (dopamine beta-monooxygenase)	0					behavioral response to ethanol (GO:0048149)|blood vessel remodeling (GO:0001974)|catecholamine biosynthetic process (GO:0042423)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine production (GO:0001816)|dopamine catabolic process (GO:0042420)|fear response (GO:0042596)|glucose homeostasis (GO:0042593)|homoiothermy (GO:0042309)|leukocyte mediated immunity (GO:0002443)|leukocyte migration (GO:0050900)|locomotory behavior (GO:0007626)|maternal behavior (GO:0042711)|memory (GO:0007613)|norepinephrine biosynthetic process (GO:0042421)|positive regulation of vasoconstriction (GO:0045907)|regulation of cell proliferation (GO:0042127)|regulation of extrinsic apoptotic signaling pathway (GO:2001236)|response to amphetamine (GO:0001975)|response to pain (GO:0048265)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	catalytic activity (GO:0003824)|copper ion binding (GO:0005507)|dopamine beta-monooxygenase activity (GO:0004500)|L-ascorbic acid binding (GO:0031418)			central_nervous_system(3)|endometrium(7)|kidney(2)|large_intestine(9)|liver(1)|lung(6)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	36				OV - Ovarian serous cystadenocarcinoma(145;2.33e-07)|Epithelial(140;1.5e-06)|all cancers(34;1.66e-05)	Disulfiram(DB00822)|Dopamine(DB00988)|Propylthiouracil(DB00550)|Vitamin C(DB00126)	GGCAAAGGCTGAGGGGGGACC	0.652																																																	0													26.0	27.0	27.0					9																	136523568		2203	4299	6502	SO:0001819	synonymous_variant	1621			X13256	CCDS6977.2	9q34	2013-06-03			ENSG00000123454	ENSG00000123454	1.14.17.1		2689	protein-coding gene	gene with protein product		609312					Standard	NM_000787		Approved	DBM	uc004cel.3	P09172	OTTHUMG00000020878	ENST00000393056.2:c.1853G>A	9.37:g.136523568G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T381|Q96AG2	Silent	SNP	pfam_Cu2_ascorb_mOase_N,pfam_DOMON_domain,superfamily_PHM/PNGase_F_dom,smart_DOMON_domain,pfscan_DOMON_domain,prints_Dopamine_b_mOase	p.*618	ENST00000393056.2	37	c.1853	CCDS6977.2	9																																																																																			DBH	-	NULL		0.652	DBH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DBH	HGNC	protein_coding	OTTHUMT00000054929.2	G	NM_000787		136523568	+1	no_errors	ENST00000393056	ensembl	human	known	70_37	silent	SNP	0.000	A
DCP2	167227	genome.wustl.edu	37	5	112320221	112320221	+	Intron	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:112320221C>T	ENST00000389063.2	+	2	251				DCP2_ENST00000543319.1_Intron|DCP2_ENST00000504961.1_3'UTR|DCP2_ENST00000515408.1_Intron	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		CTTCCAGATACGTAAATTTAC	0.408																																																	0																																										SO:0001627	intron_variant	167227			AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.54-1311C>T	5.37:g.112320221C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	RNA	SNP	-	NULL	ENST00000389063.2	37	NULL	CCDS34210.1	5																																																																																			DCP2	-	-		0.408	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCP2	HGNC	protein_coding	OTTHUMT00000370765.3	C	NM_152624		112320221	+1	no_errors	ENST00000504961	ensembl	human	putative	70_37	rna	SNP	0.016	T
DIRC3	729582	genome.wustl.edu	37	2	218465283	218465283	+	5'Flank	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:218465283G>C	ENST00000474063.1	-	0	0									disrupted in renal carcinoma 3																		CTGGCCACCTGAGTTGTCCAT	0.458																																																	0																																										SO:0001631	upstream_gene_variant	729582			AK024261		2q35	2013-01-16			ENSG00000231672	ENSG00000231672			17805	other	unknown		608262				12939738	Standard	NR_026597		Approved	FLJ14199	uc002vgo.3		OTTHUMG00000155287		2.37:g.218465283G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000474063.1	37	NULL		2																																																																																			DIRC3	-	-		0.458	DIRC3-003	KNOWN	basic	processed_transcript	DIRC3	HGNC	protein_coding	OTTHUMT00000339331.1	G	NR_026597		218465283	-1	no_errors	ENST00000486365	ensembl	human	known	70_37	rna	SNP	0.000	C
DIS3L2	129563	genome.wustl.edu	37	2	232952241	232952241	+	Silent	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:232952241T>C	ENST00000409307.1	+	5	411	c.411T>C	c.(409-411)taT>taC	p.Y137Y	DIS3L2_ENST00000325385.7_Silent_p.Y137Y|DIS3L2_ENST00000273009.6_Silent_p.Y137Y|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000360410.4_Silent_p.Y137Y|DIS3L2_ENST00000409401.3_Silent_p.Y137Y					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		AAGCTGCGTATGAATCAGATA	0.413																																																	0													64.0	66.0	66.0					2																	232952241		1906	4134	6040	SO:0001819	synonymous_variant	129563			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.411T>C	2.37:g.232952241T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.Y137	ENST00000409307.1	37	c.411	CCDS42834.1	2																																																																																			DIS3L2	-	NULL		0.413	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330988.1	T	NM_152383		232952241	+1	no_errors	ENST00000325385	ensembl	human	known	70_37	silent	SNP	0.552	C
DIS3L2	129563	genome.wustl.edu	37	2	232952241	232952241	+	Silent	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:232952241T>C	ENST00000409307.1	+	5	411	c.411T>C	c.(409-411)taT>taC	p.Y137Y	DIS3L2_ENST00000325385.7_Silent_p.Y137Y|DIS3L2_ENST00000273009.6_Silent_p.Y137Y|DIS3L2_ENST00000470087.1_3'UTR|DIS3L2_ENST00000360410.4_Silent_p.Y137Y|DIS3L2_ENST00000409401.3_Silent_p.Y137Y					DIS3 like 3'-5' exoribonuclease 2											breast(2)|central_nervous_system(1)|endometrium(5)|kidney(3)|large_intestine(7)|lung(18)|ovary(1)|prostate(2)|urinary_tract(1)	40		all_hematologic(139;0.00809)|Renal(207;0.0113)|Acute lymphoblastic leukemia(138;0.0195)|all_lung(227;0.0465)|Lung NSC(271;0.136)		Epithelial(121;1.6e-13)|BRCA - Breast invasive adenocarcinoma(100;0.00104)|LUSC - Lung squamous cell carcinoma(224;0.0109)|Lung(119;0.0149)		AAGCTGCGTATGAATCAGATA	0.413																																																	0													64.0	66.0	66.0					2																	232952241		1906	4134	6040	SO:0001819	synonymous_variant	129563			BC026166	CCDS42834.1, CCDS58752.1, CCDS58753.1	2q37.1	2014-09-17	2014-03-05		ENSG00000144535	ENSG00000144535			28648	protein-coding gene	gene with protein product		614184	"""family with sequence similarity 6, member A"", ""DIS3 mitotic control homolog (S. cerevisiae)-like 2"""	FAM6A		22306653, 23503588	Standard	NM_152383		Approved	FLJ36974, MGC42174	uc010fxz.3	Q8IYB7	OTTHUMG00000153385	ENST00000409307.1:c.411T>C	2.37:g.232952241T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.Y137	ENST00000409307.1	37	c.411	CCDS42834.1	2																																																																																			DIS3L2	-	NULL		0.413	DIS3L2-015	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3L2	HGNC	protein_coding	OTTHUMT00000330988.1	T	NM_152383		232952241	+1	no_errors	ENST00000325385	ensembl	human	known	70_37	silent	SNP	0.552	C
DKC1	1736	genome.wustl.edu	37	X	154004501	154004501	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:154004501C>T	ENST00000369550.5	+	14	1588	c.1378C>T	c.(1378-1380)Cca>Tca	p.P460S	DKC1_ENST00000475966.1_3'UTR|SNORA56_ENST00000383966.1_RNA	NM_001142463.1|NM_001363.3	NP_001135935.1|NP_001354.1	O60832	DKC1_HUMAN	dyskeratosis congenita 1, dyskerin	460	Nuclear and nucleolar localization.				cell proliferation (GO:0008283)|pseudouridine synthesis (GO:0001522)|RNA processing (GO:0006396)|rRNA processing (GO:0006364)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|telomerase holoenzyme complex (GO:0005697)	poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)|RNA binding (GO:0003723)|telomerase activity (GO:0003720)			breast(2)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(3)|prostate(1)	15	all_cancers(53;8.15e-17)|all_epithelial(53;1.1e-10)|all_lung(58;6.63e-07)|Lung NSC(58;2.08e-06)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)|Renal(33;0.214)					CGAGACTCCTCCAGCAGCTCC	0.493									Congenital Dyskeratosis																																								0													69.0	62.0	64.0					X																	154004501		2203	4300	6503	SO:0001583	missense	1736	Familial Cancer Database	Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AJ224481	CCDS14761.1, CCDS76062.1	Xq28	2014-09-17			ENSG00000130826	ENSG00000130826			2890	protein-coding gene	gene with protein product		300126		DKC		9590285, 9888995	Standard	NM_001142463		Approved	XAP101, dyskerin, NAP57, NOLA4	uc004fmm.3	O60832	OTTHUMG00000024242	ENST00000369550.5:c.1378C>T	X.37:g.154004501C>T	ENSP00000358563:p.Pro460Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	F5BSB3|O43845|Q96G67|Q9Y505	Missense_Mutation	SNP	pfam_Dyskerin-like,pfam_PsdUridine_synth,pfam_PUA,superfamily_PsdUridine_synth_cat_dom,superfamily_PUA-like_domain,smart_PUA,pfscan_PUA,tigrfam_tRNA_PsdUridine_synth_B_fam,tigrfam_Uncharacterised_CHP00451	p.P460S	ENST00000369550.5	37	c.1378	CCDS14761.1	X	.	.	.	.	.	.	.	.	.	.	C	10.07	1.248980	0.22880	.	.	ENSG00000130826	ENST00000369550	D	0.96967	-4.19	4.63	2.78	0.32641	.	2.268440	0.01842	N	0.035412	D	0.90930	0.7149	N	0.11560	0.145	0.22851	N	0.998653	B;B	0.12630	0.006;0.0	B;B	0.08055	0.003;0.001	T	0.82368	-0.0492	10	0.23891	T	0.37	-0.9114	7.2962	0.26395	0.0:0.7349:0.1661:0.099	.	460;460	A8MUT5;O60832	.;DKC1_HUMAN	S	460	ENSP00000358563:P460S	ENSP00000358563:P460S	P	+	1	0	DKC1	153657695	0.073000	0.21202	0.006000	0.13384	0.121000	0.20230	1.134000	0.31442	0.432000	0.26286	0.600000	0.82982	CCA	DKC1	-	NULL		0.493	DKC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DKC1	HGNC	protein_coding	OTTHUMT00000061180.5	C	NM_001363		154004501	+1	no_errors	ENST00000369550	ensembl	human	known	70_37	missense	SNP	0.169	T
DMBT1	1755	genome.wustl.edu	37	10	124377810	124377810	+	Silent	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:124377810C>G	ENST00000338354.3	+	38	4888	c.4782C>G	c.(4780-4782)ctC>ctG	p.L1594L	DMBT1_ENST00000330163.4_Silent_p.L966L|DMBT1_ENST00000359586.6_Silent_p.L445L|DMBT1_ENST00000368955.3_Silent_p.L1584L|DMBT1_ENST00000368909.3_Silent_p.L1594L|DMBT1_ENST00000344338.3_Silent_p.L1584L|DMBT1_ENST00000368956.2_Silent_p.L966L			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	1594	SRCR 12. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)	p.L1723L(1)		breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				ATGGCTGGCTCTCCCACAACT	0.557																																					Ovarian(182;93 2026 18125 22222 38972)												1	Substitution - coding silent(1)	ovary(1)											82.0	81.0	81.0					10																	124377810		1922	4144	6066	SO:0001819	synonymous_variant	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.4782C>G	10.37:g.124377810C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Silent	SNP	pfam_Srcr_rcpt,pfam_CUB,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB,smart_Srcr_rcpt-rel,smart_CUB,smart_ZP_dom,pfscan_CUB,pfscan_Srcr_rcpt,pfscan_ZP_dom,prints_Srcr_rcpt	p.L1723	ENST00000338354.3	37	c.5169		10																																																																																			DMBT1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt		0.557	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	C	NM_004406		124377810	+1	no_errors	ENST00000368915	ensembl	human	known	70_37	silent	SNP	0.002	G
DNAJB11	51726	genome.wustl.edu	37	3	186300510	186300510	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:186300510C>T	ENST00000439351.1	+	8	1617	c.688C>T	c.(688-690)Cct>Tct	p.P230S	DNAJB11_ENST00000265028.3_Missense_Mutation_p.P230S			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	230					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		ACTAGGTGAGCCTCACGTGGA	0.368																																																	0													114.0	103.0	106.0					3																	186300510		2202	4300	6502	SO:0001583	missense	51726			AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.688C>T	3.37:g.186300510C>T	ENSP00000414398:p.Pro230Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.P230S	ENST00000439351.1	37	c.688	CCDS3277.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	31|31	5.102328|5.102328	0.94245|0.94245	.|.	.|.	ENSG00000090520|ENSG00000090520	ENST00000418776|ENST00000439351;ENST00000265028	.|T;T	.|0.51071	.|0.72;0.72	5.93|5.93	5.93|5.93	0.95920|0.95920	.|HSP40/DnaJ peptide-binding (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72906|0.72906	0.3519|0.3519	M|M	0.84433|0.84433	2.695|2.695	0.80722|0.80722	D|D	1|1	.|D	.|0.89917	.|1.0	.|D	.|0.74674	.|0.984	T|T	0.76000|0.76000	-0.3119|-0.3119	5|10	.|0.72032	.|D	.|0.01	-7.6718|-7.6718	17.8375|17.8375	0.88704|0.88704	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|230	.|Q9UBS4	.|DJB11_HUMAN	V|S	30|230	.|ENSP00000414398:P230S;ENSP00000265028:P230S	.|ENSP00000265028:P230S	A|P	+|+	2|1	0|0	DNAJB11|DNAJB11	187783204|187783204	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.966000|0.966000	0.64601|0.64601	7.800000|7.800000	0.85949|0.85949	2.821000|2.821000	0.97095|0.97095	0.555000|0.555000	0.69702|0.69702	GCC|CCT	DNAJB11	-	superfamily_HSP40/DnaJ_pept-bd		0.368	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB11	HGNC	protein_coding	OTTHUMT00000344779.1	C			186300510	+1	no_errors	ENST00000265028	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAJC16	23341	genome.wustl.edu	37	1	15896204	15896204	+	3'UTR	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:15896204C>T	ENST00000375847.3	+	0	4045				DNAJC16_ENST00000375849.1_Intron|DNAJC16_ENST00000483270.1_Intron	NM_015291.2	NP_056106.1	Q9Y2G8	DJC16_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 16						cell redox homeostasis (GO:0045454)	integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(7)|urinary_tract(1)	18		Colorectal(325;0.00108)|Renal(390;0.00145)|Breast(348;0.00173)|all_lung(284;0.00459)|Lung NSC(340;0.00499)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0798)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;9.18e-07)|COAD - Colon adenocarcinoma(227;4.5e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000133)|KIRC - Kidney renal clear cell carcinoma(229;0.00262)|STAD - Stomach adenocarcinoma(313;0.00774)|READ - Rectum adenocarcinoma(331;0.0657)		ggtgcgatctcggttcaccgc	0.448																																																	0																																										SO:0001624	3_prime_UTR_variant	23341			AB023179	CCDS30606.1, CCDS72710.1	1p36.1	2011-09-02			ENSG00000116138	ENSG00000116138		"""Heat shock proteins / DNAJ (HSP40)"""	29157	protein-coding gene	gene with protein product							Standard	NM_015291		Approved	KIAA0962	uc001aws.3	Q9Y2G8	OTTHUMG00000002358	ENST00000375847.3:c.*1532C>T	1.37:g.15896204C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68D57|Q86X32|Q8N5P4	RNA	SNP	-	NULL	ENST00000375847.3	37	NULL	CCDS30606.1	1																																																																																			DNAJC16	-	-		0.448	DNAJC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC16	HGNC	protein_coding	OTTHUMT00000006764.1	C	NM_015291		15896204	+1	no_errors	ENST00000495523	ensembl	human	known	70_37	rna	SNP	0.011	T
DNAJC4	3338	genome.wustl.edu	37	11	64000216	64000216	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:64000216C>T	ENST00000321685.3	+	5	871	c.406C>T	c.(406-408)Cac>Tac	p.H136Y	DNAJC4_ENST00000321460.5_Missense_Mutation_p.H137Y|VEGFB_ENST00000426086.2_5'Flank|DNAJC4_ENST00000355040.4_Intron|RP11-783K16.14_ENST00000534988.1_RNA|VEGFB_ENST00000309422.2_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	136					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)			endometrium(1)|lung(1)|prostate(1)	3						GTCCCAGTTTCACAGCGTGAG	0.592																																																	0													46.0	50.0	49.0					11																	64000216		2039	4200	6239	SO:0001583	missense	3338			AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.406C>T	11.37:g.64000216C>T	ENSP00000396896:p.His136Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	O14716	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.H136Y	ENST00000321685.3	37	c.406	CCDS41666.1	11	.	.	.	.	.	.	.	.	.	.	C	16.25	3.070530	0.55539	.	.	ENSG00000110011	ENST00000321685;ENST00000321460	T;T	0.23552	1.91;1.9	5.09	5.09	0.68999	.	0.283269	0.33040	N	0.005348	T	0.32793	0.0841	L	0.46157	1.445	0.38107	D	0.937455	D;D	0.61697	0.99;0.985	P;P	0.55508	0.731;0.777	T	0.05886	-1.0858	10	0.08179	T	0.78	-4.9934	14.3632	0.66787	0.0:1.0:0.0:0.0	.	137;136	Q6PIN0;Q9NNZ3	.;DNJC4_HUMAN	Y	136;137	ENSP00000396896:H136Y;ENSP00000320548:H137Y	ENSP00000320548:H137Y	H	+	1	0	DNAJC4	63756792	0.980000	0.34600	0.891000	0.34965	0.060000	0.15804	2.885000	0.48570	2.515000	0.84797	0.563000	0.77884	CAC	DNAJC4	-	NULL		0.592	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC4	HGNC	protein_coding	OTTHUMT00000396305.1	C			64000216	+1	no_errors	ENST00000321685	ensembl	human	known	70_37	missense	SNP	0.984	T
DNAJC4	3338	genome.wustl.edu	37	11	64000216	64000216	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:64000216C>T	ENST00000321685.3	+	5	871	c.406C>T	c.(406-408)Cac>Tac	p.H136Y	DNAJC4_ENST00000321460.5_Missense_Mutation_p.H137Y|VEGFB_ENST00000426086.2_5'Flank|DNAJC4_ENST00000355040.4_Intron|RP11-783K16.14_ENST00000534988.1_RNA|VEGFB_ENST00000309422.2_5'Flank|RP11-783K16.14_ENST00000539963.1_RNA	NM_005528.3	NP_005519.2	Q9NNZ3	DNJC4_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 4	136					protein folding (GO:0006457)|response to unfolded protein (GO:0006986)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	unfolded protein binding (GO:0051082)			endometrium(1)|lung(1)|prostate(1)	3						GTCCCAGTTTCACAGCGTGAG	0.592																																																	0													46.0	50.0	49.0					11																	64000216		2039	4200	6239	SO:0001583	missense	3338			AF012106	CCDS41666.1	11q13	2011-09-02			ENSG00000110011	ENSG00000110011		"""Heat shock proteins / DNAJ (HSP40)"""	5271	protein-coding gene	gene with protein product		604189		HSPF2		9473517, 11147971	Standard	NM_005528		Approved	MCG18	uc001nys.3	Q9NNZ3	OTTHUMG00000167792	ENST00000321685.3:c.406C>T	11.37:g.64000216C>T	ENSP00000396896:p.His136Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	O14716	Missense_Mutation	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.H136Y	ENST00000321685.3	37	c.406	CCDS41666.1	11	.	.	.	.	.	.	.	.	.	.	C	16.25	3.070530	0.55539	.	.	ENSG00000110011	ENST00000321685;ENST00000321460	T;T	0.23552	1.91;1.9	5.09	5.09	0.68999	.	0.283269	0.33040	N	0.005348	T	0.32793	0.0841	L	0.46157	1.445	0.38107	D	0.937455	D;D	0.61697	0.99;0.985	P;P	0.55508	0.731;0.777	T	0.05886	-1.0858	10	0.08179	T	0.78	-4.9934	14.3632	0.66787	0.0:1.0:0.0:0.0	.	137;136	Q6PIN0;Q9NNZ3	.;DNJC4_HUMAN	Y	136;137	ENSP00000396896:H136Y;ENSP00000320548:H137Y	ENSP00000320548:H137Y	H	+	1	0	DNAJC4	63756792	0.980000	0.34600	0.891000	0.34965	0.060000	0.15804	2.885000	0.48570	2.515000	0.84797	0.563000	0.77884	CAC	DNAJC4	-	NULL		0.592	DNAJC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC4	HGNC	protein_coding	OTTHUMT00000396305.1	C			64000216	+1	no_errors	ENST00000321685	ensembl	human	known	70_37	missense	SNP	0.984	T
DNM1P46	196968	genome.wustl.edu	37	15	100345136	100345137	+	5'Flank	INS	-	-	A	rs202231117	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:100345136_100345137insA	ENST00000560059.1	+	0	0				CTD-2054N24.2_ENST00000559714.1_5'Flank|DNM1P46_ENST00000341853.1_RNA																							TGGTCGGTGCTAAAAAAAAAAT	0.436																																																	0																																										SO:0001631	upstream_gene_variant	196968																															15.37:g.100345146_100345146dupA	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	INS	-	NULL	ENST00000560059.1	37	c.NULL		15																																																																																			DNM1P46	-	-		0.436	CTD-2054N24.2-002	PUTATIVE	basic|appris_principal	protein_coding	DNM1P46	HGNC	protein_coding	OTTHUMT00000416905.2	-			100345137	-1	no_errors	ENST00000341853	ensembl	human	known	70_37	splice_site_ins	INS	0.074:0.098	A
DZIP1	22873	genome.wustl.edu	37	13	96274674	96274674	+	Missense_Mutation	SNP	C	C	G	rs200658829		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr13:96274674C>G	ENST00000376829.2	-	9	1884	c.1033G>C	c.(1033-1035)Gat>Cat	p.D345H	DZIP1_ENST00000361396.2_Missense_Mutation_p.D345H|DZIP1_ENST00000347108.3_Missense_Mutation_p.D345H|DZIP1_ENST00000361156.3_Missense_Mutation_p.D345H	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	345					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TCGTGTGCATCTTTTAATGTG	0.408																																																	0													297.0	260.0	272.0					13																	96274674		2203	4300	6503	SO:0001583	missense	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.1033G>C	13.37:g.96274674C>G	ENSP00000366025:p.Asp345His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D345H	ENST00000376829.2	37	c.1033	CCDS9478.1	13	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832231	0.71258	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.01	5.01	0.66863	.	0.297364	0.34750	N	0.003707	T	0.69993	0.3173	M	0.77103	2.36	0.42806	D	0.99394	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.74097	-0.3775	10	0.62326	D	0.03	-24.4374	16.9002	0.86110	0.0:1.0:0.0:0.0	.	345;345	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	H	345	ENSP00000257312:D345H;ENSP00000355018:D345H;ENSP00000355175:D345H;ENSP00000366025:D345H	ENSP00000257312:D345H	D	-	1	0	DZIP1	95072675	1.000000	0.71417	0.238000	0.24106	0.956000	0.61745	5.270000	0.65547	2.484000	0.83849	0.655000	0.94253	GAT	DZIP1	-	NULL		0.408	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	C	NM_014934		96274674	-1	no_errors	ENST00000347108	ensembl	human	known	70_37	missense	SNP	0.981	G
DZIP1	22873	genome.wustl.edu	37	13	96274674	96274674	+	Missense_Mutation	SNP	C	C	G	rs200658829		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr13:96274674C>G	ENST00000376829.2	-	9	1884	c.1033G>C	c.(1033-1035)Gat>Cat	p.D345H	DZIP1_ENST00000361396.2_Missense_Mutation_p.D345H|DZIP1_ENST00000347108.3_Missense_Mutation_p.D345H|DZIP1_ENST00000361156.3_Missense_Mutation_p.D345H	NM_198968.3	NP_945319.1	Q86YF9	DZIP1_HUMAN	DAZ interacting zinc finger protein 1	345					cilium assembly (GO:0042384)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|large_intestine(20)|lung(11)|ovary(2)|pancreas(1)|skin(1)|stomach(1)	38	all_neural(89;0.0878)|Breast(111;0.148)|Medulloblastoma(90;0.163)		BRCA - Breast invasive adenocarcinoma(86;0.141)			TCGTGTGCATCTTTTAATGTG	0.408																																																	0													297.0	260.0	272.0					13																	96274674		2203	4300	6503	SO:0001583	missense	22873			AB023213	CCDS9477.1, CCDS9478.1	13q32.1	2013-05-22	2013-05-22		ENSG00000134874	ENSG00000134874		"""Zinc fingers, C2H2-type"""	20908	protein-coding gene	gene with protein product		608671	"""DAZ interacting protein 1"""				Standard	NM_014934		Approved	KIAA0996, DZIP	uc001vmk.4	Q86YF9	OTTHUMG00000017224	ENST00000376829.2:c.1033G>C	13.37:g.96274674C>G	ENSP00000366025:p.Asp345His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W078|Q5W079|Q8WY45|Q8WY46|Q9UGA5|Q9Y2K0	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D345H	ENST00000376829.2	37	c.1033	CCDS9478.1	13	.	.	.	.	.	.	.	.	.	.	C	19.46	3.832231	0.71258	.	.	ENSG00000134874	ENST00000347108;ENST00000361156;ENST00000361396;ENST00000376829	T;T;T;T	0.47869	0.83;0.83;0.83;0.83	5.01	5.01	0.66863	.	0.297364	0.34750	N	0.003707	T	0.69993	0.3173	M	0.77103	2.36	0.42806	D	0.99394	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.74097	-0.3775	10	0.62326	D	0.03	-24.4374	16.9002	0.86110	0.0:1.0:0.0:0.0	.	345;345	Q86YF9-2;Q86YF9	.;DZIP1_HUMAN	H	345	ENSP00000257312:D345H;ENSP00000355018:D345H;ENSP00000355175:D345H;ENSP00000366025:D345H	ENSP00000257312:D345H	D	-	1	0	DZIP1	95072675	1.000000	0.71417	0.238000	0.24106	0.956000	0.61745	5.270000	0.65547	2.484000	0.83849	0.655000	0.94253	GAT	DZIP1	-	NULL		0.408	DZIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DZIP1	HGNC	protein_coding	OTTHUMT00000045496.3	C	NM_014934		96274674	-1	no_errors	ENST00000347108	ensembl	human	known	70_37	missense	SNP	0.981	G
EFTUD1	79631	genome.wustl.edu	37	15	82512459	82512459	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:82512459C>T	ENST00000268206.7	-	13	1572	c.1404G>A	c.(1402-1404)ggG>ggA	p.G468G	EFTUD1_ENST00000359445.3_Silent_p.G417G	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	468					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						CAATGGCACTCCCATCTTGGG	0.493																																																	0													155.0	150.0	152.0					15																	82512459		1942	4139	6081	SO:0001819	synonymous_variant	79631			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1404G>A	15.37:g.82512459C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKY5|B7Z6I0|Q9H8Z6	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,smart_Transl_elong_EFG/EF2_C,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.G468	ENST00000268206.7	37	c.1404	CCDS42071.1	15																																																																																			EFTUD1	-	superfamily_Transl_elong_init/rib_B-barrel		0.493	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	HGNC	protein_coding	OTTHUMT00000419252.1	C	NM_024580		82512459	-1	no_errors	ENST00000268206	ensembl	human	known	70_37	silent	SNP	0.000	T
EFTUD1	79631	genome.wustl.edu	37	15	82512459	82512459	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:82512459C>T	ENST00000268206.7	-	13	1572	c.1404G>A	c.(1402-1404)ggG>ggA	p.G468G	EFTUD1_ENST00000359445.3_Silent_p.G417G	NM_024580.5	NP_078856.4	Q7Z2Z2	ETUD1_HUMAN	elongation factor Tu GTP binding domain containing 1	468					GTP catabolic process (GO:0006184)|mature ribosome assembly (GO:0042256)		GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ribosome binding (GO:0043022)|translation elongation factor activity (GO:0003746)			cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(14)|ovary(1)|pancreas(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	32						CAATGGCACTCCCATCTTGGG	0.493																																																	0													155.0	150.0	152.0					15																	82512459		1942	4139	6081	SO:0001819	synonymous_variant	79631			AK056656	CCDS42070.1, CCDS42071.1	15q25.2	2012-07-04			ENSG00000140598	ENSG00000140598			25789	protein-coding gene	gene with protein product	"""ribosome assembly 1 homolog (yeast)"""					14702039	Standard	NM_024580		Approved	FLJ13119, FAM42A, HsT19294, RIA1	uc002bgt.1	Q7Z2Z2	OTTHUMG00000172573	ENST00000268206.7:c.1404G>A	15.37:g.82512459C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKY5|B7Z6I0|Q9H8Z6	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,smart_Transl_elong_EFG/EF2_C,prints_EF_GTP-bd_dom,tigrfam_Small_GTP-bd_dom	p.G468	ENST00000268206.7	37	c.1404	CCDS42071.1	15																																																																																			EFTUD1	-	superfamily_Transl_elong_init/rib_B-barrel		0.493	EFTUD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EFTUD1	HGNC	protein_coding	OTTHUMT00000419252.1	C	NM_024580		82512459	-1	no_errors	ENST00000268206	ensembl	human	known	70_37	silent	SNP	0.000	T
ELK4	2005	genome.wustl.edu	37	1	205589548	205589548	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:205589548G>C	ENST00000357992.4	-	3	965	c.626C>G	c.(625-627)tCa>tGa	p.S209*	ELK4_ENST00000468523.1_5'Flank|ELK4_ENST00000289703.4_Nonsense_Mutation_p.S209*	NM_001973.3	NP_001964.2	P28324	ELK4_HUMAN	ELK4, ETS-domain protein (SRF accessory protein 1)	209					cell differentiation (GO:0030154)|histone H3 deacetylation (GO:0070932)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription cofactor activity (GO:0003712)		SLC45A3/ELK4(18)	breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|skin(1)	12	Breast(84;0.07)		BRCA - Breast invasive adenocarcinoma(75;0.0908)			TGGGCCAATTGAAATGGTGGC	0.483			T	SLC45A3	prostate																																			Dom	yes		1	1q32	2005	"""ELK4, ETS-domain protein (SRF accessory protein 1)"""		E	0													79.0	82.0	81.0					1																	205589548		2203	4300	6503	SO:0001587	stop_gained	2005			M85165	CCDS1456.1, CCDS1457.1	1q32	2008-02-05			ENSG00000158711	ENSG00000158711			3326	protein-coding gene	gene with protein product		600246				7851904, 8575773	Standard	NM_001973		Approved	SAP1		P28324	OTTHUMG00000037221	ENST00000357992.4:c.626C>G	1.37:g.205589548G>C	ENSP00000350681:p.Ser209*	Somatic		WXS	Illumina HiSeq	Phase_IV	P28323|Q6GSJ2	Nonsense_Mutation	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.S209*	ENST00000357992.4	37	c.626	CCDS1456.1	1	.	.	.	.	.	.	.	.	.	.	G	18.82	3.704966	0.68615	.	.	ENSG00000158711	ENST00000539916;ENST00000357992;ENST00000289703	.	.	.	5.81	4.9	0.64082	.	0.369547	0.31188	N	0.008092	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	13.2875	0.60251	0.076:0.0:0.924:0.0	.	.	.	.	X	299;209;209	.	ENSP00000289703:S209X	S	-	2	0	ELK4	203856171	.	.	0.003000	0.11579	0.033000	0.12548	.	.	1.462000	0.47948	0.655000	0.94253	TCA	ELK4	-	NULL		0.483	ELK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ELK4	HGNC	protein_coding	OTTHUMT00000090615.1	G	NM_021795		205589548	-1	no_errors	ENST00000357992	ensembl	human	known	70_37	nonsense	SNP	0.014	C
AC008132.13	0	genome.wustl.edu	37	22	18846228	18846228	+	3'UTR	SNP	G	G	C	rs571750	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:18846228G>C	ENST00000412938.1	+	0	3586																											TGCTCCCTATGTGCACACCCG	0.597																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*3583G>C	22.37:g.18846228G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000412938.1	37	NULL		22																																																																																			AC008103.5	-	-		0.597	AC008132.13-002	KNOWN	basic	processed_transcript	ENSG00000161103	Clone_based_vega_gene	protein_coding	OTTHUMT00000471615.1	G			18846228	+1	no_errors	ENST00000412938	ensembl	human	known	70_37	rna	SNP	0.001	C
U1	0	genome.wustl.edu	37	1	17198357	17198357	+	lincRNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:17198357C>T	ENST00000362684.1	+	0	0																											CCGAAGTAGCCATTCCGCAGA	0.552																																																	0																																												0																															1.37:g.17198357C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	NULL	p.W96*	ENST00000362684.1	37	c.287		1	.	.	.	.	.	.	.	.	.	.	.	11.65	1.701996	0.30232	.	.	ENSG00000196690	ENST00000356370	.	.	.	0.646	0.646	0.17789	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	.	.	.	.	.	.	.	X	96	.	ENSP00000348731:W96X	W	-	2	0	BX284668.1	17070944	0.005000	0.15991	0.004000	0.12327	0.069000	0.16628	-0.677000	0.05215	0.642000	0.30620	0.194000	0.17425	TGG	BX284668.1	-	NULL		0.552	U1.1-201	KNOWN	basic	snRNA	ENSG00000196690	Clone_based_ensembl_gene	lincRNA		C			17198357	-1	no_errors	ENST00000356370	ensembl	human	known	70_37	nonsense	SNP	0.004	T
SH2D7	646892	genome.wustl.edu	37	15	78383588	78383588	+	5'Flank	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:78383588G>C	ENST00000328828.5	+	0	0				SNORA63_ENST00000362763.1_RNA|SH2D7_ENST00000409568.2_Intron	NM_001101404.1	NP_001094874.1	A6NKC9	SH2D7_HUMAN	SH2 domain containing 7											endometrium(2)|kidney(2)|lung(3)	7						AGGGCTTTAAGCAGGGGAAAT	0.378																																																	0																																										SO:0001631	upstream_gene_variant	0				CCDS45315.1	15q25.1	2013-02-14			ENSG00000183476	ENSG00000183476		"""SH2 domain containing"""	34549	protein-coding gene	gene with protein product							Standard	NM_001101404		Approved	LOC646892	uc010blb.1	A6NKC9	OTTHUMG00000154271		15.37:g.78383588G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000328828.5	37	NULL	CCDS45315.1	15																																																																																			SNORA63	-	-		0.378	SH2D7-002	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000199633	RFAM	protein_coding	OTTHUMT00000334660.2	G	NM_001101404		78383588	-1	no_errors	ENST00000362763	ensembl	human	novel	70_37	rna	SNP	0.543	C
LOC101927209	101927209	genome.wustl.edu	37	1	142634897	142634897	+	lincRNA	SNP	G	G	A	rs1832084	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:142634897G>A	ENST00000610091.1	-	0	5637				RP11-417J8.3_ENST00000426408.1_lincRNA																							tcatcccaacgtctgttcagc	0.557																																																	0																																												0																															1.37:g.142634897G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			AL583842.6	-	-		0.557	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	G			142634897	-1	no_errors	ENST00000369381	ensembl	human	known	70_37	rna	SNP	0.028	A
POT1-AS1	401398	genome.wustl.edu	37	7	124758705	124758705	+	RNA	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:124758705G>T	ENST00000453342.1	+	0	792				RP11-3B12.1_ENST00000449642.1_RNA|RP11-3B12.1_ENST00000429134.1_RNA|RP11-3B12.1_ENST00000435452.2_RNA																							cttcaaccatgagtaacagct	0.493																																																	0																																												0																															7.37:g.124758705G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000453342.1	37	NULL		7																																																																																			RP11-3B12.1	-	-		0.493	RP11-3B12.1-002	KNOWN	basic	antisense	ENSG00000224897	Clone_based_vega_gene	antisense	OTTHUMT00000347736.1	G			124758705	+1	no_errors	ENST00000453342	ensembl	human	known	70_37	rna	SNP	0.017	T
AP001347.6	0	genome.wustl.edu	37	21	15399745	15399745	+	RNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr21:15399745C>G	ENST00000428809.1	+	0	4				AP001347.6_ENST00000432621.1_RNA|AP001347.6_ENST00000448463.1_RNA																							CTTCCGGAATCTGGCGCGGCC	0.632																																																	0																																												0																															21.37:g.15399745C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000428809.1	37	NULL		21																																																																																			AP001347.6	-	-		0.632	AP001347.6-001	KNOWN	basic	antisense	ENSG00000224905	Clone_based_vega_gene	antisense	OTTHUMT00000157812.1	C			15399745	+1	no_errors	ENST00000428809	ensembl	human	known	70_37	rna	SNP	0.002	G
RP1-153P14.5	0	genome.wustl.edu	37	6	37513097	37513097	+	lincRNA	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:37513097G>C	ENST00000414875.2	+	0	177				RP1-153P14.3_ENST00000445172.1_RNA																							TGAATGCAATGAGGGGACAGA	0.597																																																	0																																												0																															6.37:g.37513097G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000414875.2	37	NULL		6																																																																																			RP1-153P14.5	-	-		0.597	RP1-153P14.5-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000227920	Clone_based_vega_gene	lincRNA	OTTHUMT00000040407.2	G			37513097	+1	no_errors	ENST00000414875	ensembl	human	known	70_37	rna	SNP	0.000	C
RP1-153P14.5	0	genome.wustl.edu	37	6	37513187	37513187	+	lincRNA	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:37513187G>C	ENST00000414875.2	+	0	267				RP1-153P14.3_ENST00000445172.1_RNA																							GAGGCTGGCAGAGGTGAGTGG	0.562																																																	0																																												0																															6.37:g.37513187G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000414875.2	37	NULL		6																																																																																			RP1-153P14.5	-	-		0.562	RP1-153P14.5-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000227920	Clone_based_vega_gene	lincRNA	OTTHUMT00000040407.2	G			37513187	+1	no_errors	ENST00000414875	ensembl	human	known	70_37	rna	SNP	0.004	C
CELF2	10659	genome.wustl.edu	37	10	11072470	11072470	+	Intron	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:11072470C>A	ENST00000379261.4	+	1	145				CELF2_ENST00000542579.1_Intron|RP11-397O4.1_ENST00000428853.2_RNA|CELF2_ENST00000399850.3_Intron|CELF2_ENST00000417956.2_Intron|CELF2_ENST00000450189.1_Intron|CELF2_ENST00000416382.2_Intron	NM_001025077.2	NP_001020248.1	O95319	CELF2_HUMAN	CUGBP, Elav-like family member 2						mRNA processing (GO:0006397)|regulation of heart contraction (GO:0008016)|RNA processing (GO:0006396)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			breast(2)|central_nervous_system(1)|endometrium(4)|large_intestine(2)|lung(5)|prostate(1)|skin(1)	16						CCTGAGGTTGCACCTCTGTTT	0.532																																																	0																																										SO:0001627	intron_variant	0			U69546	CCDS41488.1, CCDS44354.1, CCDS44355.1, CCDS44356.1	10p13	2013-02-12	2010-02-19	2010-02-19	ENSG00000048740	ENSG00000048740		"""RNA binding motif (RRM) containing"""	2550	protein-coding gene	gene with protein product		602538	"""CUG triplet repeat, RNA-binding protein 2"", ""CUG triplet repeat, RNA binding protein 2"""	CUGBP2		7869393, 9887331	Standard	NM_006561		Approved	Etr-3, NAPOR-2, BRUNOL3	uc001ikl.4	O95319	OTTHUMG00000017668	ENST00000379261.4:c.53+25067C>A	10.37:g.11072470C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZAN9|Q7KYU4|Q8N499|Q92950|Q96NW9|Q96RQ5|Q96RQ6|Q9UL67	RNA	SNP	-	NULL	ENST00000379261.4	37	NULL	CCDS44354.1	10																																																																																			RP11-397O4.1	-	-		0.532	CELF2-201	KNOWN	basic|CCDS	protein_coding	ENSG00000229206	Clone_based_vega_gene	protein_coding		C			11072470	+1	no_errors	ENST00000428853	ensembl	human	known	70_37	rna	SNP	0.000	A
RP11-95M15.1	0	genome.wustl.edu	37	6	137995196	137995196	+	lincRNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:137995196G>A	ENST00000440397.1	+	0	291																											GTTCACACCTGAGACTGGAGA	0.418																																																	0																																												0																															6.37:g.137995196G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000440397.1	37	NULL		6																																																																																			RP11-95M15.1	-	-		0.418	RP11-95M15.1-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000230533	Clone_based_vega_gene	lincRNA	OTTHUMT00000042407.1	G			137995196	+1	no_errors	ENST00000440397	ensembl	human	known	70_37	rna	SNP	0.004	A
CSNK1A1	1452	genome.wustl.edu	37	5	148874567	148874567	+	IGR	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:148874567G>A	ENST00000377843.2	-	0	3065				CSNK1A1_ENST00000261798.5_3'UTR|CTB-89H12.4_ENST00000412431.2_RNA	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1						cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		ATAGCTTTATGAGACTGATTT	0.343																																					Colon(5;64 69 1309 10383)												0																																										SO:0001628	intergenic_variant	0			AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463		5.37:g.148874567G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	RNA	SNP	-	NULL	ENST00000377843.2	37	NULL	CCDS47303.1	5																																																																																			CTB-89H12.4	-	-		0.343	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	ENSG00000230551	Clone_based_vega_gene	protein_coding		G	NM_001892		148874567	-1	no_errors	ENST00000412431	ensembl	human	known	70_37	rna	SNP	1.000	A
CSNK1A1	1452	genome.wustl.edu	37	5	148875134	148875134	+	3'UTR	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:148875134G>A	ENST00000377843.2	-	0	2775				CSNK1A1_ENST00000261798.5_3'UTR|CTB-89H12.4_ENST00000412431.2_RNA	NM_001025105.1|NM_001892.4	NP_001020276.1|NP_001883.4	P48729	KC1A_HUMAN	casein kinase 1, alpha 1						cell surface receptor signaling pathway (GO:0007166)|mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|Wnt signaling pathway (GO:0016055)	centrosome (GO:0005813)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear speck (GO:0016607)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(2)|lung(4)	14			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)	GBM - Glioblastoma multiforme(465;0.0407)		CTCCAAGGGTGAAAGTCAACT	0.413																																					Colon(5;64 69 1309 10383)												0																																										SO:0001624	3_prime_UTR_variant	0			AF119911	CCDS47303.1, CCDS47304.1, CCDS64291.1	5q32	2013-01-17			ENSG00000113712	ENSG00000113712			2451	protein-coding gene	gene with protein product	"""clock regulator kinase"""	600505				8050587	Standard	NM_001025105		Approved	CK1, CK1a, CK1alpha, CKIa, CKIalpha	uc003lqw.2	P48729	OTTHUMG00000163463	ENST00000377843.2:c.*1282C>T	5.37:g.148875134G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQG0|D3DQG1|Q4JJA0|Q5U046|Q5U047|Q6FGA2|Q71TU5|Q96HD2|Q9UDK3	RNA	SNP	-	NULL	ENST00000377843.2	37	NULL	CCDS47303.1	5																																																																																			CTB-89H12.4	-	-		0.413	CSNK1A1-201	KNOWN	basic|CCDS	protein_coding	ENSG00000230551	Clone_based_vega_gene	protein_coding		G	NM_001892		148875134	-1	no_errors	ENST00000499521	ensembl	human	known	70_37	rna	SNP	0.000	A
ZNF286A	57335	genome.wustl.edu	37	17	15644038	15644038	+	Intron	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:15644038G>A	ENST00000413242.2	+	12	3195				TBC1D26_ENST00000437605.2_Intron|AC005324.6_ENST00000580194.1_RNA|TBC1D26_ENST00000579428.1_3'UTR|AC005324.6_ENST00000433873.1_RNA|AC005324.6_ENST00000434017.1_RNA			Q9HBT8	Z286A_HUMAN	zinc finger protein 286A						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(7)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.0781)		CAGCCCTTGGGCTGTTGCAGG	0.647																																																	0																																										SO:0001627	intron_variant	0			AF217226	CCDS11172.1, CCDS73997.1	17p11.2	2013-02-14	2007-01-05	2007-01-05		ENSG00000187607		"""Zinc fingers, C2H2-type"", ""-"""	13501	protein-coding gene	gene with protein product			"""zinc finger protein 286"""	ZNF286		11347906	Standard	NM_020652		Approved	KIAA1874	uc010cot.3	Q9HBT8	OTTHUMG00000166448	ENST00000413242.2:c.1564-398G>A	17.37:g.15644038G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKF9|Q96JF3	RNA	SNP	-	NULL	ENST00000413242.2	37	NULL	CCDS11172.1	17																																																																																			AC005324.6	-	-		0.647	ZNF286A-001	KNOWN	basic|appris_candidate_longest|readthrough_transcript|CCDS	nonsense_mediated_decay	ENSG00000233002	Clone_based_vega_gene	protein_coding	OTTHUMT00000130697.4	G	NM_020652		15644038	-1	no_errors	ENST00000580194	ensembl	human	known	70_37	rna	SNP	0.004	A
BZW2	28969	genome.wustl.edu	37	7	16737888	16737888	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:16737888G>C	ENST00000433922.2	+	10	1286				AC073333.8_ENST00000418907.1_RNA|BZW2_ENST00000405202.1_Intron|BZW2_ENST00000258761.3_Intron|BZW2_ENST00000407633.1_Intron	NM_001159767.1	NP_001153239.1	Q9Y6E2	BZW2_HUMAN	basic leucine zipper and W2 domains 2						cell differentiation (GO:0030154)|nervous system development (GO:0007399)	membrane (GO:0016020)				cervix(1)|endometrium(1)|kidney(4)|large_intestine(3)|lung(2)|ovary(2)|skin(1)|urinary_tract(1)	15	Lung NSC(10;0.0367)|all_lung(11;0.0837)			UCEC - Uterine corpus endometrioid carcinoma (126;0.199)		CAATGAGGCAGAGGAGGTCAT	0.468																																																	0																																										SO:0001627	intron_variant	0			AF083246	CCDS5362.1	7p21.3	2008-07-18			ENSG00000136261	ENSG00000136261			18808	protein-coding gene	gene with protein product						11042152	Standard	NM_001159767		Approved	HSPC028, MST017, MSTP017	uc003stj.2	Q9Y6E2	OTTHUMG00000130755	ENST00000433922.2:c.1108+77G>C	7.37:g.16737888G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D123|Q3B779|Q96JW5|Q9H3F7	RNA	SNP	-	NULL	ENST00000433922.2	37	NULL	CCDS5362.1	7																																																																																			AC073333.8	-	-		0.468	BZW2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000235837	Clone_based_vega_gene	protein_coding	OTTHUMT00000253256.2	G	NM_014038		16737888	-1	no_errors	ENST00000418907	ensembl	human	known	70_37	rna	SNP	0.001	C
AC016831.7	0	genome.wustl.edu	37	7	130546907	130546907	+	lincRNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:130546907G>A	ENST00000447430.1	+	0	102																											tgccgtgtaagaagtgccttt	0.408																																																	0																																												0																															7.37:g.130546907G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000447430.1	37	NULL		7																																																																																			AC016831.7	-	-		0.408	AC016831.7-001	KNOWN	basic	lincRNA	ENSG00000233559	Clone_based_vega_gene	lincRNA	OTTHUMT00000338093.1	G			130546907	+1	no_errors	ENST00000447430	ensembl	human	known	70_37	rna	SNP	0.052	A
AC009404.2	0	genome.wustl.edu	37	2	118594091	118594091	+	lincRNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:118594091G>A	ENST00000420330.1	+	0	613																											AGTCTTACCCGGACGCCACGG	0.701																																																	0																																												0																															2.37:g.118594091G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000420330.1	37	NULL		2																																																																																			AC009404.2	-	-		0.701	AC009404.2-003	KNOWN	basic	lincRNA	ENSG00000236255	Clone_based_vega_gene	lincRNA	OTTHUMT00000129613.1	G			118594091	+1	no_errors	ENST00000439955	ensembl	human	known	70_37	rna	SNP	0.000	A
LOC101929011	101929011	genome.wustl.edu	37	11	116510247	116510247	+	lincRNA	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:116510247G>C	ENST00000444123.1	+	0	109																											GCCAGGCACTGAATGCAGGTG	0.507																																																	0																																												0																															11.37:g.116510247G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000444123.1	37	NULL		11																																																																																			AP000770.1	-	-		0.507	AP000770.1-001	KNOWN	basic	lincRNA	ENSG00000237937	Clone_based_vega_gene	lincRNA	OTTHUMT00000104867.1	G			116510247	+1	no_errors	ENST00000439483	ensembl	human	known	70_37	rna	SNP	0.002	C
SPEN	23013	genome.wustl.edu	37	1	16237454	16237454	+	Intron	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:16237454C>G	ENST00000375759.3	+	5	1246				snoU13_ENST00000459258.1_RNA	NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor						negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)			NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		gtgcctccctcagaccttgtt	0.328																																																	0																																										SO:0001627	intron_variant	0				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.1043-142C>G	1.37:g.16237454C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	RNA	SNP	-	NULL	ENST00000375759.3	37	NULL	CCDS164.1	1																																																																																			snoU13	-	-		0.328	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000238818	RFAM	protein_coding	OTTHUMT00000025993.1	C	NM_015001		16237454	+1	no_errors	ENST00000459258	ensembl	human	novel	70_37	rna	SNP	0.007	G
CCDC88A	55704	genome.wustl.edu	37	2	55556696	55556696	+	Intron	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:55556696C>T	ENST00000436346.1	-	17	3697				AC012358.8_ENST00000600219.1_RNA|AC012358.8_ENST00000599352.1_RNA|AC012358.8_ENST00000599475.1_RNA|CCDC88A_ENST00000263630.8_Intron|CCDC88A_ENST00000413716.2_Intron|AC012358.8_ENST00000594078.1_RNA|CCDC88A_ENST00000336838.6_Intron|AC012358.8_ENST00000608103.1_RNA	NM_001135597.1|NM_001254943.1	NP_001129069.1|NP_001241872.1	Q3V6T2	GRDN_HUMAN	coiled-coil domain containing 88A						activation of protein kinase B activity (GO:0032148)|cell migration (GO:0016477)|DNA replication (GO:0006260)|lamellipodium assembly (GO:0030032)|membrane organization (GO:0061024)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell proliferation (GO:0042127)|regulation of DNA replication (GO:0006275)|regulation of neuron projection development (GO:0010975)|regulation of protein phosphorylation (GO:0001932)|TOR signaling (GO:0031929)	cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|membrane (GO:0016020)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|microtubule binding (GO:0008017)|phosphatidylinositol binding (GO:0035091)|protein homodimerization activity (GO:0042803)|protein kinase B binding (GO:0043422)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(22)|lung(23)|ovary(3)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	69						TCTGGTCTATCCTGATAGAAA	0.388																																																	0																																										SO:0001627	intron_variant	0			AB033038, AF112218	CCDS33203.1, CCDS46288.1, CCDS58710.1	2p16.3	2013-03-13	2007-05-31	2007-05-31	ENSG00000115355	ENSG00000115355			25523	protein-coding gene	gene with protein product	"""Galpha-interacting vesicle-associated protein"", ""Akt-phosphorylation enhancer"", ""girdin"", ""girders of actin filaments"""	609736	"""KIAA1212"""	KIAA1212		15749703, 15753085	Standard	NM_001135597		Approved	FLJ10392, APE, GIV, HkRP1, GRDN	uc002ryv.2	Q3V6T2	OTTHUMG00000151915	ENST00000436346.1:c.2856-1125G>A	2.37:g.55556696C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1IGE7|B7ZM78|C9JG83|Q53SF1|Q581G3|Q5HYD0|Q7Z339|Q7Z3C5	RNA	SNP	-	NULL	ENST00000436346.1	37	NULL		2																																																																																			AC012358.8	-	-		0.388	CCDC88A-203	KNOWN	basic	protein_coding	ENSG00000240401	Clone_based_vega_gene	protein_coding		C	NM_017571		55556696	+1	no_errors	ENST00000599352	ensembl	human	known	70_37	rna	SNP	0.012	T
SUCLG2-AS1	101927111	genome.wustl.edu	37	3	67800324	67800324	+	lincRNA	SNP	A	A	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:67800324A>C	ENST00000482677.1	+	0	615																											tgatctcggtacactgcaagc	0.418																																																	0																																												0																															3.37:g.67800324A>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000482677.1	37	NULL		3																																																																																			RP11-81N13.1	-	-		0.418	RP11-81N13.1-001	KNOWN	basic	lincRNA	ENSG00000241316	Clone_based_vega_gene	lincRNA	OTTHUMT00000351990.1	A			67800324	+1	no_errors	ENST00000496640	ensembl	human	known	70_37	rna	SNP	0.000	C
CBLL1	79872	genome.wustl.edu	37	7	107384958	107384958	+	Intron	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:107384958G>A	ENST00000440859.3	+	1	480				AC002467.7_ENST00000609979.1_RNA|CBLL1_ENST00000222597.2_Intron|CBLL1_ENST00000415884.2_Intron|AC002467.7_ENST00000440971.2_RNA|AC002467.7_ENST00000457510.2_RNA	NM_001284291.1|NM_024814.2	NP_001271220.1|NP_079090.2	Q75N03	HAKAI_HUMAN	Cbl proto-oncogene-like 1, E3 ubiquitin protein ligase						negative regulation of cell adhesion (GO:0007162)|positive regulation of cell migration (GO:0030335)|positive regulation of endocytosis (GO:0045807)|protein ubiquitination (GO:0016567)|single organismal cell-cell adhesion (GO:0016337)	ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(2)|lung(9)|ovary(2)|prostate(3)|skin(3)	21						ACGTTATGGAGACTGGCGGGT	0.602																																																	0																																										SO:0001627	intron_variant	0			AK026762	CCDS5747.1, CCDS64754.1	7q22.3	2013-07-09	2013-07-09		ENSG00000105879	ENSG00000105879		"""RING-type (C3HC4) zinc fingers"""	21225	protein-coding gene	gene with protein product	"""Casitas B-lineage lymphoma-like"""	606872	"""Cas-Br-M (murine) ecotropic retroviral transforming sequence-like 1"""			11836526, 11944035	Standard	NM_001284291		Approved	HAKAI, FLJ23109, RNF188	uc003veq.3	Q75N03	OTTHUMG00000154809	ENST00000440859.3:c.13+337G>A	7.37:g.107384958G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZM03|Q8TAJ4|Q9H5S6	RNA	SNP	-	NULL	ENST00000440859.3	37	NULL	CCDS5747.1	7																																																																																			AC002467.7	-	-		0.602	CBLL1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000241764	Clone_based_vega_gene	protein_coding	OTTHUMT00000337156.2	G	NM_024814		107384958	+1	no_errors	ENST00000423845	ensembl	human	known	70_37	rna	SNP	0.000	A
RN7SL304P	106479333	genome.wustl.edu	37	1	20297702	20297702	+	RNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:20297702G>A	ENST00000488028.2	+	0	241									RNA, 7SL, cytoplasmic 304, pseudogene																		tcagtagtgggatcacacctg	0.478																																																	0																																												0					1p36.13	2013-04-02			ENSG00000242688	ENSG00000242688		"""ncRNAs / Small cytoplasmic RNAs"""	46320	pseudogene	RNA, pseudogene							Standard			Approved						1.37:g.20297702G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000488028.2	37	NULL		1																																																																																			Metazoa_SRP	-	-		0.478	RN7SL304P-201	KNOWN	basic	misc_RNA	ENSG00000242688	RFAM	misc_RNA		G			20297702	+1	no_errors	ENST00000488028	ensembl	human	novel	70_37	rna	SNP	0.073	A
LOC101929241	101929241	genome.wustl.edu	37	14	97932873	97932873	+	lincRNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:97932873C>T	ENST00000499910.2	+	0	2230																											tcttccacctcctcatctact	0.418																																																	0																																												0																															14.37:g.97932873C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000499910.2	37	NULL		14																																																																																			CTD-2506J14.1	-	-		0.418	CTD-2506J14.1-001	KNOWN	basic	lincRNA	ENSG00000246084	Clone_based_vega_gene	lincRNA	OTTHUMT00000413542.1	C			97932873	+1	no_errors	ENST00000554260	ensembl	human	known	70_37	rna	SNP	0.138	T
LOC645485	645485	genome.wustl.edu	37	12	30932397	30932397	+	lincRNA	SNP	C	C	G	rs539404676	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:30932397C>G	ENST00000500076.2	+	0	276																											TCAAGAAAAACAGGACTGTGA	0.413																																																	0																																												0																															12.37:g.30932397C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000500076.2	37	NULL		12																																																																																			RP11-77I22.2	-	-		0.413	RP11-77I22.2-001	KNOWN	basic	lincRNA	ENSG00000246331	Clone_based_vega_gene	lincRNA	OTTHUMT00000403385.1	C			30932397	+1	no_errors	ENST00000500076	ensembl	human	known	70_37	rna	SNP	0.038	G
RP11-184M15.1	0	genome.wustl.edu	37	4	129490319	129490319	+	lincRNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:129490319C>T	ENST00000514265.1	-	0	430																											tcattatcctcatttacagtc	0.403																																																	0																																												0																															4.37:g.129490319C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000514265.1	37	NULL		4																																																																																			RP11-184M15.1	-	-		0.403	RP11-184M15.1-001	KNOWN	basic	lincRNA	ENSG00000248187	Clone_based_vega_gene	lincRNA	OTTHUMT00000364059.1	C			129490319	-1	no_errors	ENST00000514265	ensembl	human	known	70_37	rna	SNP	0.000	T
LOC101927780	101927780	genome.wustl.edu	37	14	62023243	62023243	+	Intron	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:62023243G>A	ENST00000556347.1	+	3	419				RP11-47I22.2_ENST00000508827.1_lincRNA																							tttccttatggccaagctggA	0.453																																																	0																																										SO:0001627	intron_variant	0																														ENST00000556347.1:c.419+8639G>A	14.37:g.62023243G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000556347.1	37	NULL		14																																																																																			RP11-47I22.2	-	-		0.453	RP11-47I22.4-001	PUTATIVE	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript	protein_coding	ENSG00000250548	Clone_based_vega_gene	protein_coding	OTTHUMT00000413996.1	G			62023243	-1	no_errors	ENST00000508827	ensembl	human	known	70_37	rna	SNP	0.141	A
DDB2	1643	genome.wustl.edu	37	11	47242214	47242214	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:47242214G>C	ENST00000256996.4	+	3	651				RP11-17G12.2_ENST00000540410.1_RNA|DDB2_ENST00000378600.3_Intron|DDB2_ENST00000378601.3_Intron|DDB2_ENST00000378603.3_Intron	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa						DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						CAGTCTGGAAGAGACCTGTCT	0.458			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	0																																										SO:0001627	intron_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.456+3614G>C	11.37:g.47242214G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R875|Q76E54|Q76E55|Q76E56|Q76E57	RNA	SNP	-	NULL	ENST00000256996.4	37	NULL	CCDS7927.1	11																																																																																			RP11-17G12.2	-	-		0.458	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256897	Clone_based_vega_gene	protein_coding		G	NM_000107		47242214	-1	no_errors	ENST00000540410	ensembl	human	known	70_37	rna	SNP	0.000	C
DDB2	1643	genome.wustl.edu	37	11	47242251	47242251	+	Intron	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:47242251G>T	ENST00000256996.4	+	3	651				RP11-17G12.2_ENST00000540410.1_RNA|DDB2_ENST00000378600.3_Intron|DDB2_ENST00000378601.3_Intron|DDB2_ENST00000378603.3_Intron	NM_000107.2	NP_000098.1	Q92466	DDB2_HUMAN	damage-specific DNA binding protein 2, 48kDa						DNA repair (GO:0006281)|histone H2A monoubiquitination (GO:0035518)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA damage removal (GO:0000718)|protein autoubiquitination (GO:0051865)|protein polyubiquitination (GO:0000209)|pyrimidine dimer repair (GO:0006290)|response to UV (GO:0009411)|UV-damage excision repair (GO:0070914)	Cul4B-RING E3 ubiquitin ligase complex (GO:0031465)|nucleoplasm (GO:0005654)|protein complex (GO:0043234)	damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(1)	17						GCTGACAGCAGAATGCTGATT	0.483			"""Mis, N"""			"""skin basal cell, skin squamous cell, melanoma"""		Direct reversal of damage;Nucleotide excision repair (NER)	Xeroderma Pigmentosum																														yes	Rec		Xeroderma pigmentosum (E)	11	11p12	1643	damage-specific DNA binding protein 2		E	0																																										SO:0001627	intron_variant	0	Familial Cancer Database	incl. XPA, XPB, XPC, XPD, XPE, XPF, XPG, XP Variant, XPV		CCDS7927.1, CCDS73284.1	11p12-p11	2014-09-17	2002-08-29			ENSG00000134574		"""WD repeat domain containing"""	2718	protein-coding gene	gene with protein product	"""xeroderma pigmentosum group E protein"", ""UV-damaged DNA-binding protein 2"", ""DDB p48 subunit"""	600811	"""damage-specific DNA binding protein 2 (48kD)"""			8407967, 8530102	Standard	NM_000107		Approved	DDBB, UV-DDB2, FLJ34321	uc001neb.2	Q92466		ENST00000256996.4:c.456+3651G>T	11.37:g.47242251G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R875|Q76E54|Q76E55|Q76E56|Q76E57	RNA	SNP	-	NULL	ENST00000256996.4	37	NULL	CCDS7927.1	11																																																																																			RP11-17G12.2	-	-		0.483	DDB2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256897	Clone_based_vega_gene	protein_coding		G	NM_000107		47242251	-1	no_errors	ENST00000540410	ensembl	human	known	70_37	rna	SNP	0.003	T
SYT1	6857	genome.wustl.edu	37	12	79354194	79354194	+	Intron	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:79354194G>A	ENST00000261205.4	+	2	441				RP11-390N6.1_ENST00000548384.1_RNA|SYT1_ENST00000457153.2_Intron|SYT1_ENST00000549454.1_Intron|SYT1_ENST00000393240.3_Intron	NM_005639.2	NP_005630.1	P21579	SYT1_HUMAN	synaptotagmin I						calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|detection of calcium ion (GO:0005513)|glutamate secretion (GO:0014047)|neurotransmitter secretion (GO:0007269)|positive regulation of calcium ion-dependent exocytosis (GO:0045956)|positive regulation of synaptic transmission (GO:0050806)|positive regulation of vesicle fusion (GO:0031340)|protein homooligomerization (GO:0051260)|regulation of exocytosis (GO:0017157)|regulation of regulated secretory pathway (GO:1903305)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic vesicle exocytosis (GO:0016079)|vesicle docking (GO:0048278)	cell junction (GO:0030054)|clathrin-sculpted acetylcholine transport vesicle membrane (GO:0060201)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|clathrin-sculpted glutamate transport vesicle membrane (GO:0060203)|clathrin-sculpted monoamine transport vesicle membrane (GO:0070083)|dense core granule (GO:0031045)|endocytic vesicle membrane (GO:0030666)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)|synaptic vesicle membrane (GO:0030672)	1-phosphatidylinositol binding (GO:0005545)|calcium ion binding (GO:0005509)|calcium-dependent phospholipid binding (GO:0005544)|low-density lipoprotein particle receptor binding (GO:0050750)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)|SNARE binding (GO:0000149)|syntaxin-1 binding (GO:0017075)|transporter activity (GO:0005215)			NS(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|pancreas(2)|skin(6)	25						ACACTTTTCTGACTCAATCTT	0.328																																																	0																																										SO:0001627	intron_variant	0				CCDS9017.1	12q21.2	2013-09-20			ENSG00000067715	ENSG00000067715		"""Synaptotagmins"""	11509	protein-coding gene	gene with protein product		185605		SYT, SVP65		1840599	Standard	NM_001135805		Approved	P65	uc001syv.3	P21579	OTTHUMG00000134326	ENST00000261205.4:c.-216-17385G>A	12.37:g.79354194G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6AI31	RNA	SNP	-	NULL	ENST00000261205.4	37	NULL	CCDS9017.1	12																																																																																			RP11-390N6.1	-	-		0.328	SYT1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000257191	Clone_based_vega_gene	protein_coding	OTTHUMT00000259415.1	G	NM_005639		79354194	-1	no_errors	ENST00000548384	ensembl	human	known	70_37	rna	SNP	0.005	A
POTEM	641455	genome.wustl.edu	37	14	20009244	20009244	+	Intron	SNP	A	A	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:20009244A>G	ENST00000551509.1	-	5	1107				RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						GACCCTTTAGAACAAGCCTAC	0.453																																																	0																																										SO:0001627	intron_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.1055+858T>C	14.37:g.20009244A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			RP11-244H18.1	-	-		0.453	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ENSG00000258276	Clone_based_vega_gene	protein_coding	OTTHUMT00000409490.3	A	NM_001145442		20009244	+1	no_errors	ENST00000547584	ensembl	human	known	70_37	rna	SNP	0.002	G
POTEM	641455	genome.wustl.edu	37	14	20010310	20010310	+	Intron	SNP	A	A	G	rs199892710		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:20010310A>G	ENST00000551509.1	-	5	969				RNU6-1268P_ENST00000391214.1_RNA|RP11-244H18.1_ENST00000547584.1_lincRNA	NM_001145442.1	NP_001138914.1	A6NI47	POTEM_HUMAN	POTE ankyrin domain family, member M											endometrium(4)|kidney(1)|lung(4)	9						TTACCAATTTAACATCTTGCC	0.333																																																	0																																										SO:0001627	intron_variant	0				CCDS73609.1	14q11.2	2013-01-10			ENSG00000187537	ENSG00000187537		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	37096	protein-coding gene	gene with protein product	"""prostate-specific P704P"""					16364570	Standard	NM_001145442		Approved	POTE14beta, P704P, ACT	uc001vwc.3	A6NI47		ENST00000551509.1:c.918-70T>C	14.37:g.20010310A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000551509.1	37	NULL	CCDS45076.1	14																																																																																			RP11-244H18.1	-	-		0.333	POTEM-001	NOVEL	basic|appris_principal|CCDS	protein_coding	ENSG00000258276	Clone_based_vega_gene	protein_coding	OTTHUMT00000409490.3	A	NM_001145442		20010310	+1	no_errors	ENST00000547584	ensembl	human	known	70_37	rna	SNP	0.005	G
SNX29	92017	genome.wustl.edu	37	16	12654821	12654821	+	Intron	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:12654821C>A	ENST00000566228.1	+	21	2387				SNX29_ENST00000306030.3_Intron|CTD-3037G24.3_ENST00000564505.1_RNA	NM_032167.3	NP_115543.3	Q8TEQ0	SNX29_HUMAN	sorting nexin 29							extracellular vesicular exosome (GO:0070062)	phosphatidylinositol binding (GO:0035091)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	7						CCAGACCTGCCTTCAAGGAAC	0.463																																																	0																																										SO:0001627	intron_variant	0			AK074072	CCDS10553.2	16p13.13-p13.12	2011-08-16			ENSG00000048471	ENSG00000048471		"""Sorting nexins"""	30542	protein-coding gene	gene with protein product			"""RUN domain containing 2A"""	RUNDC2A		16782399	Standard	XM_005255682		Approved	FLJ12363	uc002dby.5	Q8TEQ0		ENST00000566228.1:c.2319-7542C>A	16.37:g.12654821C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDW2|Q8N2X2|Q9HA26	RNA	SNP	-	NULL	ENST00000566228.1	37	NULL	CCDS10553.2	16																																																																																			CTD-3037G24.3	-	-		0.463	SNX29-005	PUTATIVE	not_organism_supported|basic|appris_principal|CCDS	protein_coding	ENSG00000259899	Clone_based_vega_gene	protein_coding	OTTHUMT00000422622.1	C			12654821	-1	no_errors	ENST00000564505	ensembl	human	known	70_37	rna	SNP	0.011	A
RP11-480A16.1	0	genome.wustl.edu	37	3	195677012	195677012	+	lincRNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:195677012C>G	ENST00000570130.1	-	0	2554																											GGCAGAAGCTCAGAGCCCAAA	0.537																																																	0																																												0																															3.37:g.195677012C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000570130.1	37	NULL		3																																																																																			RP11-480A16.1	-	-		0.537	RP11-480A16.1-001	KNOWN	basic	lincRNA	ENSG00000260261	Clone_based_vega_gene	lincRNA	OTTHUMT00000431190.1	C			195677012	-1	no_errors	ENST00000570130	ensembl	human	known	70_37	rna	SNP	0.003	G
RP11-339A11.2	0	genome.wustl.edu	37	1	80580803	80580803	+	lincRNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:80580803C>G	ENST00000567886.1	+	0	176																											CAGATGTTATCTATGGAAGAC	0.378																																																	0																																												0																															1.37:g.80580803C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000567886.1	37	NULL		1																																																																																			RP11-339A11.2	-	-		0.378	RP11-339A11.2-001	KNOWN	basic	lincRNA	ENSG00000260322	Clone_based_vega_gene	lincRNA	OTTHUMT00000431185.1	C			80580803	+1	no_errors	ENST00000567886	ensembl	human	known	70_37	rna	SNP	0.000	G
NUCB1	4924	genome.wustl.edu	37	19	49429444	49429445	+	IGR	INS	-	-	A	rs576255701|rs111577605	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:49429444_49429445insA	ENST00000405315.4	+	0	2668				CTD-2639E6.4_ENST00000569130.1_RNA	NM_006184.5	NP_006175.2	Q02818	NUCB1_HUMAN	nucleobindin 1							endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)			cervix(1)|endometrium(4)|large_intestine(4)|lung(8)	17		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;8.64e-05)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.000171)|all cancers(93;0.000333)|Epithelial(262;0.0174)|GBM - Glioblastoma multiforme(486;0.0244)		tccatctcaagaaaaaaaaaaa	0.515																																																	0																																										SO:0001628	intergenic_variant	0			BC002356	CCDS12740.1	19q13.33	2013-01-10			ENSG00000104805	ENSG00000104805		"""EF-hand domain containing"""	8043	protein-coding gene	gene with protein product		601323				8661046	Standard	NM_006184		Approved	NUC, Calnuc	uc002plb.4	Q02818	OTTHUMG00000152514		19.37:g.49429455_49429455dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD64|Q15838|Q7Z4J7|Q9BUR1	RNA	INS	-	NULL	ENST00000405315.4	37	NULL	CCDS12740.1	19																																																																																			CTD-2639E6.4	-	-		0.515	NUCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260366	Clone_based_vega_gene	protein_coding	OTTHUMT00000326545.2	-	NM_006184		49429445	+1	no_errors	ENST00000569130	ensembl	human	known	70_37	rna	INS	0.003:0.005	A
RP13-379O24.2	0	genome.wustl.edu	37	20	61089644	61089644	+	lincRNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:61089644G>A	ENST00000569373.1	-	0	1508																											CCAGGGCTGAGAGGGAGACTC	0.488																																																	0																																												0																															20.37:g.61089644G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000569373.1	37	NULL		20																																																																																			RP13-379O24.2	-	-		0.488	RP13-379O24.2-001	KNOWN	basic	lincRNA	ENSG00000260542	Clone_based_vega_gene	lincRNA	OTTHUMT00000430675.1	G			61089644	-1	no_errors	ENST00000569373	ensembl	human	known	70_37	rna	SNP	0.001	A
ABCC6	368	genome.wustl.edu	37	16	16317897	16317897	+	5'Flank	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:16317897C>T	ENST00000205557.7	-	0	0				ABCC6_ENST00000575728.1_5'Flank|ABCC6_ENST00000574094.1_5'Flank|RP11-517A5.7_ENST00000574883.1_RNA	NM_001171.5	NP_001162	O95255	MRP6_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 6						response to drug (GO:0042493)|transmembrane transport (GO:0055085)|transport (GO:0006810)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(6)|kidney(3)|large_intestine(10)|lung(10)|ovary(1)|skin(6)|urinary_tract(1)	43				UCEC - Uterine corpus endometrioid carcinoma (3;0.123)	Cisplatin(DB00515)|Dactinomycin(DB00970)|Daunorubicin(DB00694)|Doxorubicin(DB00997)|Etoposide(DB00773)|Indomethacin(DB00328)|Probenecid(DB01032)|Sulfinpyrazone(DB01138)|Teniposide(DB00444)|Vinblastine(DB00570)	CTCAAGAAACCTCTAGGGTCC	0.577																																																	0																																										SO:0001631	upstream_gene_variant	0			AF076622	CCDS10568.1, CCDS58430.1	16p13.11	2013-01-08			ENSG00000091262	ENSG00000091262		"""ATP binding cassette transporters / subfamily C"""	57	protein-coding gene	gene with protein product		603234	"""pseudoxanthoma elasticum"""	ARA, PXE		9721217, 11439001	Standard	NM_001079528		Approved	MRP6, EST349056, MLP1, URG7	uc002den.4	O95255	OTTHUMG00000129967		16.37:g.16317897C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRN8|A8KIG6|A8Y988|E7ESW8|P78420|Q8TCY8|Q9UMZ7	RNA	SNP	-	NULL	ENST00000205557.7	37	NULL	CCDS10568.1	16																																																																																			RP11-517A5.7	-	-		0.577	ABCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262332	Clone_based_vega_gene	protein_coding	OTTHUMT00000252232.2	C			16317897	+1	no_errors	ENST00000574883	ensembl	human	known	70_37	rna	SNP	0.227	T
HSD11B2	3291	genome.wustl.edu	37	16	67467632	67467632	+	Intron	SNP	T	T	C	rs74026405|rs148254142|rs34076422|rs369920292|rs58877700	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:67467632T>C	ENST00000326152.5	+	2	397				HSD11B2_ENST00000567684.2_Intron|RP11-297D21.2_ENST00000567261.1_lincRNA	NM_000196.3	NP_000187.3	P80365	DHI2_HUMAN	hydroxysteroid (11-beta) dehydrogenase 2						female pregnancy (GO:0007565)|glucocorticoid biosynthetic process (GO:0006704)|regulation of blood volume by renal aldosterone (GO:0002017)|response to drug (GO:0042493)|response to food (GO:0032094)|response to glucocorticoid (GO:0051384)|response to hypoxia (GO:0001666)|response to insulin (GO:0032868)	endoplasmic reticulum (GO:0005783)	11-beta-hydroxysteroid dehydrogenase [NAD(P)] activity (GO:0003845)|NAD binding (GO:0051287)|steroid binding (GO:0005496)			breast(1)|endometrium(1)|liver(2)|lung(3)|upper_aerodigestive_tract(1)	8		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0401)|Epithelial(162;0.0891)		cacacacacaTATGCTTGCCT	0.562													C|||	1391	0.277756	0.7587	0.1167	5008	,	,		17438	0.0228		0.1024	False		,,,				2504	0.1851																0																																										SO:0001627	intron_variant	0			U14631	CCDS10837.1	16q22	2011-09-14			ENSG00000176387	ENSG00000176387	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5209	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 9C, member 3"""	614232				7859916, 8611140, 19027726	Standard	NM_000196		Approved	SDR9C3	uc002etd.3	P80365	OTTHUMG00000137507	ENST00000326152.5:c.266-1899T>C	16.37:g.67467632T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A7LB28|C5HTY7|Q13194|Q6P2G9|Q8N439|Q96QN8|Q9UC50|Q9UC51|Q9UCW5|Q9UCW6|Q9UCW7|Q9UCW8	RNA	SNP	-	NULL	ENST00000326152.5	37	NULL	CCDS10837.1	16																																																																																			RP11-297D21.3	-	-		0.562	HSD11B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000262839	Clone_based_vega_gene	protein_coding	OTTHUMT00000268826.3	T	NM_000196		67467632	+1	no_errors	ENST00000571772	ensembl	human	known	70_37	rna	SNP	0.002	C
PIEZO1	9780	genome.wustl.edu	37	16	88808325	88808325	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:88808325G>C	ENST00000301015.9	-	4	573				RP5-1142A6.2_ENST00000567968.1_RNA|RP5-1142A6.8_ENST00000567588.1_RNA|RP5-1142A6.8_ENST00000333666.1_RNA|RP5-1142A6.2_ENST00000440406.2_RNA|RP5-1142A6.7_ENST00000566114.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1						cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						tgggagcgtggatgggtctcc	0.647																																																	0																																										SO:0001627	intron_variant	0			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.326+135C>G	16.37:g.88808325G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	RNA	SNP	-	NULL	ENST00000301015.9	37	NULL	CCDS54058.1	16																																																																																			RP5-1142A6.7	-	-		0.647	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ENSG00000260617	Clone_based_vega_gene	protein_coding	OTTHUMT00000345699.4	G	NM_014745		88808325	+1	no_errors	ENST00000566114	ensembl	human	known	70_37	rna	SNP	0.017	C
SCPEP1	59342	genome.wustl.edu	37	17	55061697	55061697	+	Intron	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:55061697C>G	ENST00000262288.3	+	3	280				SCPEP1_ENST00000571898.1_Intron|RP5-1107A17.4_ENST00000572877.1_RNA	NM_021626.2	NP_067639.1	Q9HB40	RISC_HUMAN	serine carboxypeptidase 1						negative regulation of blood pressure (GO:0045776)|positive regulation of vasodilation (GO:0045909)|retinoic acid metabolic process (GO:0042573)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|kidney(1)|large_intestine(3)|lung(5)|skin(2)	14	Breast(9;2.86e-08)					GGGCCCTTCTCATAGACTCCC	0.522																																																	0																																										SO:0001627	intron_variant	0			AF282618	CCDS11593.1	17q22	2012-09-20			ENSG00000121064	ENSG00000121064			29507	protein-coding gene	gene with protein product	"""retinoid inducible serine carboxypeptidase"""					11447226, 12975309	Standard	NM_021626		Approved	RISC	uc002iuv.4	Q9HB40	OTTHUMG00000178129	ENST00000262288.3:c.226-1042C>G	17.37:g.55061697C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96A94|Q9H3F0	RNA	SNP	-	NULL	ENST00000262288.3	37	NULL	CCDS11593.1	17																																																																																			RP5-1107A17.4	-	-		0.522	SCPEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263120	Clone_based_vega_gene	protein_coding	OTTHUMT00000440622.1	C	NM_021626		55061697	+1	no_errors	ENST00000572877	ensembl	human	known	70_37	rna	SNP	0.092	G
RCAN3	11123	genome.wustl.edu	37	1	24865892	24865892	+	3'UTR	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:24865892C>T	ENST00000374395.4	+	0	5164				RP4-594I10.3_ENST00000577528.1_lincRNA	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3						anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		GGGCTGGAATCTGCCTAAATA	0.328																																																	0																																										SO:0001624	3_prime_UTR_variant	0				CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.*4125C>T	1.37:g.24865892C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	RNA	SNP	-	NULL	ENST00000374395.4	37	NULL	CCDS254.1	1																																																																																			RP4-594I10.3	-	-		0.328	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000264443	Clone_based_vega_gene	protein_coding	OTTHUMT00000009176.2	C			24865892	-1	no_errors	ENST00000577528	ensembl	human	known	70_37	rna	SNP	0.030	T
RP11-285M22.1	0	genome.wustl.edu	37	17	22192227	22192227	+	lincRNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:22192227C>T	ENST00000577879.1	+	0	67				RP11-285M22.3_ENST00000582507.1_lincRNA																							TCTAGTGAAGCTTCAGGTATA	0.527																																																	0																																												0																															17.37:g.22192227C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000577879.1	37	NULL		17																																																																																			RP11-285M22.1	-	-		0.527	RP11-285M22.1-001	KNOWN	basic	lincRNA	ENSG00000265114	Clone_based_vega_gene	lincRNA	OTTHUMT00000444747.1	C			22192227	+1	no_errors	ENST00000577879	ensembl	human	known	70_37	rna	SNP	0.004	T
RP11-879F14.3	0	genome.wustl.edu	37	18	59238604	59238604	+	lincRNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr18:59238604C>T	ENST00000585706.1	-	0	580																											TGTTTCTTCTCTTTTTATTCC	0.388																																																	0																																												0																															18.37:g.59238604C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000585706.1	37	NULL		18																																																																																			RP11-879F14.3	-	-		0.388	RP11-879F14.3-001	KNOWN	basic	lincRNA	ENSG00000267316	Clone_based_vega_gene	lincRNA	OTTHUMT00000449439.1	C			59238604	-1	no_errors	ENST00000585706	ensembl	human	known	70_37	rna	SNP	0.202	T
CTC-444N24.11	0	genome.wustl.edu	37	19	57818159	57818159	+	lincRNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:57818159C>G	ENST00000593427.1	+	0	2487																											CCTAATTTGTCAGAAGACTGC	0.348																																																	0																																												0																															19.37:g.57818159C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000593427.1	37	NULL		19																																																																																			CTC-444N24.11	-	-		0.348	CTC-444N24.11-001	KNOWN	basic	lincRNA	ENSG00000268205	Clone_based_vega_gene	lincRNA	OTTHUMT00000465778.1	C			57818159	+1	no_errors	ENST00000593427	ensembl	human	known	70_37	rna	SNP	0.028	G
CTC-444N24.11	0	genome.wustl.edu	37	19	57818699	57818699	+	lincRNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:57818699C>G	ENST00000593427.1	+	0	3027																											tctttactctcattatactaa	0.323																																																	0																																												0																															19.37:g.57818699C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000593427.1	37	NULL		19																																																																																			CTC-444N24.11	-	-		0.323	CTC-444N24.11-001	KNOWN	basic	lincRNA	ENSG00000268205	Clone_based_vega_gene	lincRNA	OTTHUMT00000465778.1	C			57818699	+1	no_errors	ENST00000593427	ensembl	human	known	70_37	rna	SNP	0.006	G
EPS15	2060	genome.wustl.edu	37	1	51912653	51912653	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:51912653G>C	ENST00000371733.3	-	10	872	c.776C>G	c.(775-777)tCt>tGt	p.S259C	EPS15_ENST00000371730.2_Missense_Mutation_p.S259C	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	259	EH 3. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						TAGTAAGGTAGAAGGTAAACC	0.313			T	MLL	ALL																																			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	1	Whole gene deletion(1)	central_nervous_system(1)											112.0	115.0	114.0					1																	51912653		2203	4300	6503	SO:0001583	missense	2060			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.776C>G	1.37:g.51912653G>C	ENSP00000360798:p.Ser259Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.S259C	ENST00000371733.3	37	c.776	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220565	0.58560	.	.	ENSG00000085832	ENST00000371730;ENST00000371733	T;T	0.32753	1.44;1.44	5.75	5.75	0.90469	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.32041	N	0.006669	T	0.63343	0.2503	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.986;0.999	T	0.67608	-0.5627	10	0.87932	D	0	.	19.9312	0.97120	0.0:0.0:1.0:0.0	.	259;259	B1AUU8;P42566	.;EPS15_HUMAN	C	259	ENSP00000360795:S259C;ENSP00000360798:S259C	ENSP00000360795:S259C	S	-	2	0	EPS15	51685241	1.000000	0.71417	0.999000	0.59377	0.505000	0.33919	4.450000	0.60041	2.720000	0.93068	0.491000	0.48974	TCT	EPS15	-	smart_EPS15_homology,pfscan_EPS15_homology		0.313	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	G	NM_001981		51912653	-1	no_errors	ENST00000371733	ensembl	human	known	70_37	missense	SNP	0.963	C
EPS15	2060	genome.wustl.edu	37	1	51912653	51912653	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:51912653G>C	ENST00000371733.3	-	10	872	c.776C>G	c.(775-777)tCt>tGt	p.S259C	EPS15_ENST00000371730.2_Missense_Mutation_p.S259C	NM_001981.2	NP_001972.1	P42566	EPS15_HUMAN	epidermal growth factor receptor pathway substrate 15	259	EH 3. {ECO:0000255|PROSITE- ProRule:PRU00077}.|Interaction with DAB2. {ECO:0000250}.				cell proliferation (GO:0008283)|clathrin coat assembly (GO:0048268)|endocytic recycling (GO:0032456)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|protein transport (GO:0015031)|vesicle organization (GO:0016050)	AP-2 adaptor complex (GO:0030122)|ciliary membrane (GO:0060170)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|polyubiquitin binding (GO:0031593)	p.0?(1)		endometrium(3)|kidney(5)|large_intestine(8)|lung(13)|prostate(2)|skin(1)|stomach(1)|urinary_tract(2)	35						TAGTAAGGTAGAAGGTAAACC	0.313			T	MLL	ALL																																			Dom	yes		1	1p32	2060	epidermal growth factor receptor pathway substrate 15 (AF1p)		L	1	Whole gene deletion(1)	central_nervous_system(1)											112.0	115.0	114.0					1																	51912653		2203	4300	6503	SO:0001583	missense	2060			BC054006	CCDS557.1	1p32	2013-01-10			ENSG00000085832	ENSG00000085832		"""EF-hand domain containing"""	3419	protein-coding gene	gene with protein product		600051				8183552	Standard	NM_001159969		Approved	AF-1P, MLLT5	uc001csq.1	P42566	OTTHUMG00000008192	ENST00000371733.3:c.776C>G	1.37:g.51912653G>C	ENSP00000360798:p.Ser259Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8J7|D3DPJ2|Q5SRH4	Missense_Mutation	SNP	smart_EPS15_homology,smart_EF_hand_Ca-bd,smart_Ubiquitin-int_motif,pfscan_EF_HAND_2,pfscan_EPS15_homology,pfscan_Ubiquitin-int_motif	p.S259C	ENST00000371733.3	37	c.776	CCDS557.1	1	.	.	.	.	.	.	.	.	.	.	G	16.79	3.220565	0.58560	.	.	ENSG00000085832	ENST00000371730;ENST00000371733	T;T	0.32753	1.44;1.44	5.75	5.75	0.90469	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.000000	0.32041	N	0.006669	T	0.63343	0.2503	M	0.84948	2.725	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.91635	0.986;0.999	T	0.67608	-0.5627	10	0.87932	D	0	.	19.9312	0.97120	0.0:0.0:1.0:0.0	.	259;259	B1AUU8;P42566	.;EPS15_HUMAN	C	259	ENSP00000360795:S259C;ENSP00000360798:S259C	ENSP00000360795:S259C	S	-	2	0	EPS15	51685241	1.000000	0.71417	0.999000	0.59377	0.505000	0.33919	4.450000	0.60041	2.720000	0.93068	0.491000	0.48974	TCT	EPS15	-	smart_EPS15_homology,pfscan_EPS15_homology		0.313	EPS15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPS15	HGNC	protein_coding	OTTHUMT00000022422.1	G	NM_001981		51912653	-1	no_errors	ENST00000371733	ensembl	human	known	70_37	missense	SNP	0.963	C
ESYT1	23344	genome.wustl.edu	37	12	56524184	56524184	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:56524184G>C	ENST00000394048.5	+	2	654				RP11-603J24.5_ENST00000549438.1_RNA|ESYT1_ENST00000541590.1_Intron|RP11-603J24.5_ENST00000550947.1_RNA|ESYT1_ENST00000267113.4_Intron	NM_001184796.1|NM_015292.2	NP_001171725.1|NP_056107.1	Q9BSJ8	ESYT1_HUMAN	extended synaptotagmin-like protein 1						lipid transport (GO:0006869)	integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(4)|lung(10)|ovary(5)|prostate(1)|skin(3)|urinary_tract(1)	28						CCTTATTAGAGAGACATCAGC	0.572																																																	0																																										SO:0001627	intron_variant	23344			AK074368	CCDS8904.1, CCDS53801.1	12q13.2	2014-07-02	2009-06-23	2009-06-23		ENSG00000139641		"""Synaptotagmins"""	29534	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member A"""	FAM62A		9872452, 10350628, 17672888	Standard	NM_015292		Approved	MBC2, KIAA0747	uc001sjr.3	Q9BSJ8		ENST00000394048.5:c.391-182G>C	12.37:g.56524184G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A0FGR7|A8K2S2|O94848|Q6PJN4|Q9H6J1|Q9H6W2|Q9Y416	RNA	SNP	-	NULL	ENST00000394048.5	37	NULL	CCDS8904.1	12																																																																																			ESYT1	-	-		0.572	ESYT1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ESYT1	HGNC	protein_coding	OTTHUMT00000407906.1	G	NM_015292		56524184	+1	no_errors	ENST00000550986	ensembl	human	known	70_37	rna	SNP	0.023	C
EVC	2121	genome.wustl.edu	37	4	5800331	5800331	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:5800331G>C	ENST00000264956.6	+	15	2300	c.2116G>C	c.(2116-2118)Gag>Cag	p.E706Q	EVC_ENST00000515113.1_3'UTR|EVC_ENST00000382674.2_Missense_Mutation_p.E706Q	NM_153717.2	NP_714928.1	P57679	EVC_HUMAN	Ellis van Creveld syndrome	706					cartilage development (GO:0051216)|endochondral bone growth (GO:0003416)|muscle organ development (GO:0007517)|positive regulation of smoothened signaling pathway (GO:0045880)|skeletal system development (GO:0001501)|smoothened signaling pathway (GO:0007224)	ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|breast(1)|endometrium(2)|large_intestine(10)|lung(11)|ovary(1)|skin(1)|stomach(1)	28		Myeloproliferative disorder(84;0.117)				TGTGCTGGAGGAGGCCAGCCG	0.672																																																	0													8.0	9.0	9.0					4																	5800331		2182	4282	6464	SO:0001583	missense	2121			AF216184	CCDS3383.1	4p16	2008-07-03			ENSG00000072840	ENSG00000072840			3497	protein-coding gene	gene with protein product		604831				10700184	Standard	NM_153717		Approved	DWF-1	uc003gil.1	P57679	OTTHUMG00000090427	ENST00000264956.6:c.2116G>C	4.37:g.5800331G>C	ENSP00000264956:p.Glu706Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E706Q	ENST00000264956.6	37	c.2116	CCDS3383.1	4	.	.	.	.	.	.	.	.	.	.	G	14.13	2.442832	0.43326	.	.	ENSG00000072840	ENST00000264956;ENST00000382674	T;T	0.58797	0.31;0.31	4.93	4.93	0.64822	.	0.159515	0.40222	N	0.001155	T	0.70211	0.3198	M	0.68952	2.095	0.80722	D	1	D	0.69078	0.997	P	0.61658	0.892	T	0.68334	-0.5436	10	0.29301	T	0.29	.	15.6427	0.77020	0.0:0.0:1.0:0.0	.	706	P57679	EVC_HUMAN	Q	706	ENSP00000264956:E706Q;ENSP00000372120:E706Q	ENSP00000264956:E706Q	E	+	1	0	EVC	5851232	1.000000	0.71417	0.972000	0.41901	0.090000	0.18270	3.557000	0.53741	2.274000	0.75844	0.561000	0.74099	GAG	EVC	-	NULL		0.672	EVC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVC	HGNC	protein_coding	OTTHUMT00000206859.1	G			5800331	+1	no_errors	ENST00000264956	ensembl	human	known	70_37	missense	SNP	0.998	C
FAAH2	158584	genome.wustl.edu	37	X	57515412	57515413	+	3'UTR	INS	-	-	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:57515412_57515413insT	ENST00000374900.4	+	0	1766_1767				FAAH2_ENST00000491179.1_3'UTR	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						GTGTTCGTGTGGTGGTGTTTCT	0.416										HNSCC(52;0.14)																																							0																																										SO:0001624	3_prime_UTR_variant	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.*48->T	X.37:g.57515412_57515413insT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VT2|Q96N98	RNA	INS	-	NULL	ENST00000374900.4	37	NULL	CCDS14375.1	X																																																																																			FAAH2	-	-		0.416	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	-	NM_174912		57515413	+1	no_errors	ENST00000491179	ensembl	human	known	70_37	rna	INS	0.018:0.011	T
FAAH2	158584	genome.wustl.edu	37	X	57515415	57515416	+	3'UTR	INS	-	-	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:57515415_57515416insT	ENST00000374900.4	+	0	1769_1770				FAAH2_ENST00000491179.1_3'UTR	NM_174912.3	NP_777572.2	Q6GMR7	FAAH2_HUMAN	fatty acid amide hydrolase 2							integral component of membrane (GO:0016021)	carbon-nitrogen ligase activity, with glutamine as amido-N-donor (GO:0016884)|hydrolase activity (GO:0016787)			endometrium(2)|large_intestine(4)|lung(10)|ovary(3)|upper_aerodigestive_tract(3)	22						TTCGTGTGGTGGTGTTTCTATT	0.411										HNSCC(52;0.14)																																							0																																										SO:0001624	3_prime_UTR_variant	158584			AK055766	CCDS14375.1	Xp11.1	2008-02-05	2006-11-24	2006-11-24	ENSG00000165591	ENSG00000165591			26440	protein-coding gene	gene with protein product		300654	"""amidase domain containing"""	AMDD		17015445	Standard	NM_174912		Approved	RP11-479E16.1, FLJ31204, FAAH-2	uc004dvc.3	Q6GMR7	OTTHUMG00000021684	ENST00000374900.4:c.*51->T	X.37:g.57515415_57515416insT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VT2|Q96N98	RNA	INS	-	NULL	ENST00000374900.4	37	NULL	CCDS14375.1	X																																																																																			FAAH2	-	-		0.411	FAAH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAAH2	HGNC	protein_coding	OTTHUMT00000056919.1	-	NM_174912		57515416	+1	no_errors	ENST00000491179	ensembl	human	known	70_37	rna	INS	0.004:0.003	T
FAM92B	339145	genome.wustl.edu	37	16	85143960	85143960	+	Missense_Mutation	SNP	G	G	A	rs202030185		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:85143960G>A	ENST00000539556.1	-	2	282	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	43										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						GCCTTGTCCCGCAGCCGGGCC	0.642																																																	0													50.0	53.0	52.0					16																	85143960		2198	4300	6498	SO:0001583	missense	339145				CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.127C>T	16.37:g.85143960G>A	ENSP00000443411:p.Arg43Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FAM92	p.R43W	ENST00000539556.1	37	c.127	CCDS32500.1	16	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788491	0.49997	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.60171	0.21	5.38	0.845	0.18950	.	0.000000	0.64402	D	0.000016	T	0.76793	0.4037	M	0.86740	2.835	0.40094	D	0.97628	D	0.89917	1.0	D	0.97110	1.0	T	0.81272	-0.1008	10	0.87932	D	0	-32.6762	13.9565	0.64152	0.0:0.0:0.3457:0.6543	.	43	Q6ZTR7	FA92B_HUMAN	W	43	ENSP00000443411:R43W	ENSP00000376937:R43W	R	-	1	2	FAM92B	83701461	0.987000	0.35691	0.947000	0.38551	0.194000	0.23727	1.631000	0.37092	0.223000	0.20920	-0.314000	0.08810	CGG	FAM92B	-	pfam_FAM92		0.642	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92B	HGNC	protein_coding		G	NM_198491		85143960	-1	no_errors	ENST00000539556	ensembl	human	known	70_37	missense	SNP	0.996	A
FAM92B	339145	genome.wustl.edu	37	16	85143960	85143960	+	Missense_Mutation	SNP	G	G	A	rs202030185		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:85143960G>A	ENST00000539556.1	-	2	282	c.127C>T	c.(127-129)Cgg>Tgg	p.R43W		NM_198491.1	NP_940893.1	Q6ZTR7	FA92B_HUMAN	family with sequence similarity 92, member B	43										breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	16						GCCTTGTCCCGCAGCCGGGCC	0.642																																																	0													50.0	53.0	52.0					16																	85143960		2198	4300	6498	SO:0001583	missense	339145				CCDS32500.1	16q24.1	2005-09-22				ENSG00000153789			24781	protein-coding gene	gene with protein product						12477932	Standard	NM_198491		Approved	FLJ44299	uc021tlz.1	Q6ZTR7		ENST00000539556.1:c.127C>T	16.37:g.85143960G>A	ENSP00000443411:p.Arg43Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FAM92	p.R43W	ENST00000539556.1	37	c.127	CCDS32500.1	16	.	.	.	.	.	.	.	.	.	.	G	15.29	2.788491	0.49997	.	.	ENSG00000153789	ENST00000393246;ENST00000539556	T	0.60171	0.21	5.38	0.845	0.18950	.	0.000000	0.64402	D	0.000016	T	0.76793	0.4037	M	0.86740	2.835	0.40094	D	0.97628	D	0.89917	1.0	D	0.97110	1.0	T	0.81272	-0.1008	10	0.87932	D	0	-32.6762	13.9565	0.64152	0.0:0.0:0.3457:0.6543	.	43	Q6ZTR7	FA92B_HUMAN	W	43	ENSP00000443411:R43W	ENSP00000376937:R43W	R	-	1	2	FAM92B	83701461	0.987000	0.35691	0.947000	0.38551	0.194000	0.23727	1.631000	0.37092	0.223000	0.20920	-0.314000	0.08810	CGG	FAM92B	-	pfam_FAM92		0.642	FAM92B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM92B	HGNC	protein_coding		G	NM_198491		85143960	-1	no_errors	ENST00000539556	ensembl	human	known	70_37	missense	SNP	0.996	A
FATE1	89885	genome.wustl.edu	37	X	150884628	150884628	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:150884628G>A	ENST00000370350.3	+	1	122	c.37G>A	c.(37-39)Gaa>Aaa	p.E13K		NM_033085.2	NP_149076.1	Q969F0	FATE1_HUMAN	fetal and adult testis expressed 1	13						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				NS(1)|breast(1)|cervix(1)|endometrium(3)|large_intestine(2)|lung(6)|ovary(1)	15	Acute lymphoblastic leukemia(192;6.56e-05)					GGCGGAGATGGAAATGTCCCT	0.537																																																	0													85.0	64.0	72.0					X																	150884628		2030	3766	5796	SO:0001583	missense	89885			AF249872	CCDS14700.1	Xq28	2009-03-25			ENSG00000147378	ENSG00000147378			24683	protein-coding gene	gene with protein product	"""cancer/testis antigen 43"""	300450				11694338	Standard	NM_033085		Approved	FATE, CT43	uc004fex.3	Q969F0	OTTHUMG00000024172	ENST00000370350.3:c.37G>A	X.37:g.150884628G>A	ENSP00000359375:p.Glu13Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FATE/Miff/Tango-11	p.E13K	ENST00000370350.3	37	c.37	CCDS14700.1	X	.	.	.	.	.	.	.	.	.	.	G	15.99	2.996801	0.54147	.	.	ENSG00000147378	ENST00000370350;ENST00000417321	T;T	0.64260	0.31;-0.09	4.18	2.39	0.29439	.	0.777035	0.11327	N	0.575438	T	0.60637	0.2284	L	0.27053	0.805	0.09310	N	1	D	0.61697	0.99	P	0.60609	0.877	T	0.48080	-0.9066	10	0.66056	D	0.02	.	4.8205	0.13389	0.1215:0.2161:0.6624:0.0	.	13	Q969F0	FATE1_HUMAN	K	13;5	ENSP00000359375:E13K;ENSP00000400493:E5K	ENSP00000359375:E13K	E	+	1	0	FATE1	150635284	0.012000	0.17670	0.001000	0.08648	0.012000	0.07955	0.949000	0.29109	0.521000	0.28445	0.600000	0.82982	GAA	FATE1	-	NULL		0.537	FATE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FATE1	HGNC	protein_coding	OTTHUMT00000060885.1	G	NM_033085		150884628	+1	no_errors	ENST00000370350	ensembl	human	known	70_37	missense	SNP	0.001	A
FBXO34	55030	genome.wustl.edu	37	14	55738158	55738158	+	5'UTR	SNP	T	T	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:55738158T>A	ENST00000313833.4	+	0	138				FBXO34_ENST00000440021.1_5'Flank|RP11-665C16.6_ENST00000554650.1_lincRNA	NM_017943.3	NP_060413.2	Q9NWN3	FBX34_HUMAN	F-box protein 34											breast(2)|kidney(2)|large_intestine(4)|lung(5)|ovary(3)|pancreas(1)|skin(2)|stomach(3)	22						GACTCAGCGGTGGGGAGTGAG	0.746																																																	0																																										SO:0001623	5_prime_UTR_variant	55030			AK000732	CCDS32086.1	14q22.1	2004-08-24	2004-06-15			ENSG00000178974		"""F-boxes /  ""other"""""	20201	protein-coding gene	gene with protein product		609104	"""F-box only protein 34"""				Standard	NM_017943		Approved	FLJ20725, Fbx34	uc010aoo.3	Q9NWN3		ENST00000313833.4:c.-108T>A	14.37:g.55738158T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2VPB5|Q4VBP5|Q86TY4	RNA	SNP	-	NULL	ENST00000313833.4	37	NULL	CCDS32086.1	14																																																																																			FBXO34	-	-		0.746	FBXO34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXO34	HGNC	protein_coding	OTTHUMT00000411322.1	T			55738158	+1	no_errors	ENST00000554940	ensembl	human	putative	70_37	rna	SNP	0.005	A
FBXW7	55294	genome.wustl.edu	37	4	153247366	153247366	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:153247366C>G	ENST00000281708.4	-	10	2665	c.1436G>C	c.(1435-1437)cGa>cCa	p.R479P	FBXW7_ENST00000296555.5_Missense_Mutation_p.R361P|FBXW7_ENST00000603548.1_Missense_Mutation_p.R479P|FBXW7_ENST00000603841.1_Missense_Mutation_p.R479P|FBXW7_ENST00000263981.5_Missense_Mutation_p.R399P|FBXW7_ENST00000393956.3_Missense_Mutation_p.R303P	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	479					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R479Q(29)|p.R479L(5)|p.R399Q(3)|p.R479P(2)|p.R240L(1)|p.R361P(1)|p.R399P(1)|p.?(1)|p.R361Q(1)|p.R399L(1)|p.R240Q(1)|p.R240P(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AGTGGCATCTCGAGAACCGCT	0.403			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	47	Substitution - Missense(46)|Unknown(1)	haematopoietic_and_lymphoid_tissue(16)|large_intestine(9)|endometrium(7)|urinary_tract(5)|upper_aerodigestive_tract(4)|lung(4)|stomach(1)|kidney(1)											85.0	80.0	82.0					4																	153247366		2203	4299	6502	SO:0001583	missense	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1436G>C	4.37:g.153247366C>G	ENSP00000281708:p.Arg479Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R479P	ENST00000281708.4	37	c.1436	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787466	0.90367	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58581	0.2132	L	0.38692	1.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.58819	-0.7569	10	0.87932	D	0	-12.7081	20.2406	0.98372	0.0:1.0:0.0:0.0	.	303;479;361;399	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	P	479;361;399;303	ENSP00000281708:R479P;ENSP00000296555:R361P;ENSP00000263981:R399P;ENSP00000377528:R303P	ENSP00000263981:R399P	R	-	2	0	FBXW7	153466816	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.715000	0.84713	2.857000	0.98124	0.650000	0.86243	CGA	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep		0.403	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	C			153247366	-1	no_errors	ENST00000281708	ensembl	human	known	70_37	missense	SNP	1.000	G
FBXW7	55294	genome.wustl.edu	37	4	153247366	153247366	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:153247366C>G	ENST00000281708.4	-	10	2665	c.1436G>C	c.(1435-1437)cGa>cCa	p.R479P	FBXW7_ENST00000296555.5_Missense_Mutation_p.R361P|FBXW7_ENST00000603548.1_Missense_Mutation_p.R479P|FBXW7_ENST00000603841.1_Missense_Mutation_p.R479P|FBXW7_ENST00000263981.5_Missense_Mutation_p.R399P|FBXW7_ENST00000393956.3_Missense_Mutation_p.R303P	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	479					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.R479Q(29)|p.R479L(5)|p.R399Q(3)|p.R479P(2)|p.R240L(1)|p.R361P(1)|p.R399P(1)|p.?(1)|p.R361Q(1)|p.R399L(1)|p.R240Q(1)|p.R240P(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				AGTGGCATCTCGAGAACCGCT	0.403			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	47	Substitution - Missense(46)|Unknown(1)	haematopoietic_and_lymphoid_tissue(16)|large_intestine(9)|endometrium(7)|urinary_tract(5)|upper_aerodigestive_tract(4)|lung(4)|stomach(1)|kidney(1)											85.0	80.0	82.0					4																	153247366		2203	4299	6502	SO:0001583	missense	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1436G>C	4.37:g.153247366C>G	ENSP00000281708:p.Arg479Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.R479P	ENST00000281708.4	37	c.1436	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	C	27.0	4.787466	0.90367	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	T;T;T;T	0.42131	0.98;0.98;0.98;0.98	5.72	5.72	0.89469	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40 repeat, conserved site (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.58581	0.2132	L	0.38692	1.165	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	T	0.58819	-0.7569	10	0.87932	D	0	-12.7081	20.2406	0.98372	0.0:1.0:0.0:0.0	.	303;479;361;399	B7Z2C8;Q969H0;Q969H0-4;Q969H0-2	.;FBXW7_HUMAN;.;.	P	479;361;399;303	ENSP00000281708:R479P;ENSP00000296555:R361P;ENSP00000263981:R399P;ENSP00000377528:R303P	ENSP00000263981:R399P	R	-	2	0	FBXW7	153466816	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	7.715000	0.84713	2.857000	0.98124	0.650000	0.86243	CGA	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep		0.403	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	C			153247366	-1	no_errors	ENST00000281708	ensembl	human	known	70_37	missense	SNP	1.000	G
FCER1G	2207	genome.wustl.edu	37	1	161189038	161189038	+	3'UTR	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:161189038C>G	ENST00000289902.1	+	0	591				FCER1G_ENST00000367992.3_Intron|FCER1G_ENST00000490414.1_3'UTR|AL590714.1_ENST00000594609.1_5'Flank	NM_004106.1	NP_004097.1	P30273	FCERG_HUMAN	Fc fragment of IgE, high affinity I, receptor for; gamma polypeptide						antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|immunoglobulin mediated immune response (GO:0016064)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|mast cell activation (GO:0045576)|negative regulation of mast cell apoptotic process (GO:0033026)|neutrophil activation involved in immune response (GO:0002283)|neutrophil chemotaxis (GO:0030593)|phagocytosis, engulfment (GO:0006911)|platelet activation (GO:0030168)|positive regulation of interleukin-10 production (GO:0032733)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of mast cell cytokine production (GO:0032765)|positive regulation of mast cell degranulation (GO:0043306)|positive regulation of phagocytosis (GO:0050766)|positive regulation of tumor necrosis factor production (GO:0032760)|positive regulation of type I hypersensitivity (GO:0001812)|positive regulation of type IIa hypersensitivity (GO:0001798)|positive regulation of type III hypersensitivity (GO:0001805)|protein localization to plasma membrane (GO:0072659)|regulation of platelet activation (GO:0010543)|serotonin secretion by platelet (GO:0002554)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|Fc-epsilon receptor I complex (GO:0032998)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	IgE receptor activity (GO:0019767)			endometrium(1)|lung(5)	6	all_cancers(52;1.35e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Benzylpenicilloyl Polylysine(DB00895)	GGACTGGACTCTattcattca	0.423																																																	0																																										SO:0001624	3_prime_UTR_variant	2207				CCDS1225.1	1q23	2008-02-05			ENSG00000158869	ENSG00000158869			3611	protein-coding gene	gene with protein product		147139				2138619	Standard	NM_004106		Approved		uc001fyz.1	P30273	OTTHUMG00000034343	ENST00000289902.1:c.*305C>G	1.37:g.161189038C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VTW4	RNA	SNP	-	NULL	ENST00000289902.1	37	NULL	CCDS1225.1	1																																																																																			FCER1G	-	-		0.423	FCER1G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCER1G	HGNC	protein_coding	OTTHUMT00000083012.1	C	NM_004106		161189038	+1	no_errors	ENST00000490414	ensembl	human	known	70_37	rna	SNP	0.000	G
GALNT5	11227	genome.wustl.edu	37	2	158167780	158167780	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:158167780C>G	ENST00000259056.4	+	10	3228	c.2743C>G	c.(2743-2745)Caa>Gaa	p.Q915E		NM_014568.1	NP_055383.1	Q7Z7M9	GALT5_HUMAN	polypeptide N-acetylgalactosaminyltransferase 5	915	Ricin B-type lectin. {ECO:0000255|PROSITE-ProRule:PRU00174}.				cellular protein metabolic process (GO:0044267)|glycosaminoglycan biosynthetic process (GO:0006024)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|polypeptide N-acetylgalactosaminyltransferase activity (GO:0004653)			breast(4)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(12)|lung(20)|prostate(1)|skin(4)|stomach(1)|urinary_tract(2)	56						AAATTTTTCTCAAAAGATCCT	0.368																																																	0													65.0	73.0	70.0					2																	158167780		2203	4300	6503	SO:0001583	missense	11227			AJ245539	CCDS2203.1	2q24.1	2014-03-13	2014-03-13		ENSG00000136542	ENSG00000136542	2.4.1.41	"""Glycosyltransferase family 2 domain containing"""	4127	protein-coding gene	gene with protein product	"""polypeptide GalNAc transferase 5"""	615129	"""UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 5 (GalNAc-T5)"""			10545594	Standard	NM_014568		Approved	GalNAc-T5	uc002tzg.3	Q7Z7M9	OTTHUMG00000131965	ENST00000259056.4:c.2743C>G	2.37:g.158167780C>G	ENSP00000259056:p.Gln915Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKZ1|Q9UGK7|Q9UHL6	Missense_Mutation	SNP	pfam_Glyco_trans_2,pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin	p.Q915E	ENST00000259056.4	37	c.2743	CCDS2203.1	2	.	.	.	.	.	.	.	.	.	.	C	8.848	0.943841	0.18281	.	.	ENSG00000136542	ENST00000259056	T	0.26223	1.75	5.93	2.94	0.34122	Ricin B-related lectin (1);Ricin B lectin (3);	0.546112	0.17985	N	0.155386	T	0.23492	0.0568	L	0.41236	1.265	0.25540	N	0.987187	B	0.10296	0.003	B	0.10450	0.005	T	0.13629	-1.0502	10	0.29301	T	0.29	.	16.7264	0.85423	0.0:0.6225:0.3775:0.0	.	915	Q7Z7M9	GALT5_HUMAN	E	915	ENSP00000259056:Q915E	ENSP00000259056:Q915E	Q	+	1	0	GALNT5	157876026	0.996000	0.38824	1.000000	0.80357	0.567000	0.35839	0.466000	0.22019	0.833000	0.34828	-0.176000	0.13171	CAA	GALNT5	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin		0.368	GALNT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GALNT5	HGNC	protein_coding	OTTHUMT00000254925.2	C	NM_014568		158167780	+1	no_errors	ENST00000259056	ensembl	human	known	70_37	missense	SNP	0.988	G
GAS2L1	10634	genome.wustl.edu	37	22	29704119	29704119	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:29704119C>T	ENST00000406549.3	+	2	174	c.24C>T	c.(22-24)atC>atT	p.I8I	GAS2L1_ENST00000407854.1_Silent_p.I8I|GAS2L1_ENST00000407647.2_Silent_p.I8I|GAS2L1_ENST00000471961.1_Silent_p.I8I|GAS2L1_ENST00000360113.2_Silent_p.I8I|GAS2L1_ENST00000341313.6_Silent_p.I8I|GAS2L1_ENST00000403764.1_Silent_p.I8I	NM_001278730.1	NP_001265659.1	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1	8					cell cycle arrest (GO:0007050)|cellular response to starvation (GO:0009267)|cellular response to thyroid hormone stimulus (GO:0097067)|microtubule bundle formation (GO:0001578)|negative regulation of cell growth (GO:0030308)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of gene expression (GO:0010629)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)|thyroid hormone receptor binding (GO:0046966)			endometrium(2)|lung(2)|prostate(1)	5						TGGCGGGCATCGCGGGCTCGG	0.647																																																	0													14.0	15.0	15.0					22																	29704119		2185	4283	6468	SO:0001819	synonymous_variant	10634			BC001782	CCDS63438.1, CCDS74840.1	22q12.2	2008-06-11			ENSG00000185340	ENSG00000185340			16955	protein-coding gene	gene with protein product		602128				8975699, 12584248, 1607387	Standard	NM_001278730		Approved	GAR22	uc003afc.1	Q99501	OTTHUMG00000151108	ENST00000406549.3:c.24C>T	22.37:g.29704119C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MCR7|Q53EN7|Q92640|Q9BUY9	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.I8	ENST00000406549.3	37	c.24		22																																																																																			GAS2L1	-	NULL		0.647	GAS2L1-002	PUTATIVE	basic|exp_conf	protein_coding	GAS2L1	HGNC	protein_coding	OTTHUMT00000321365.1	C	NM_006478		29704119	+1	no_errors	ENST00000403764	ensembl	human	known	70_37	silent	SNP	0.990	T
GAS2L1	10634	genome.wustl.edu	37	22	29704119	29704119	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:29704119C>T	ENST00000406549.3	+	2	174	c.24C>T	c.(22-24)atC>atT	p.I8I	GAS2L1_ENST00000407854.1_Silent_p.I8I|GAS2L1_ENST00000407647.2_Silent_p.I8I|GAS2L1_ENST00000471961.1_Silent_p.I8I|GAS2L1_ENST00000360113.2_Silent_p.I8I|GAS2L1_ENST00000341313.6_Silent_p.I8I|GAS2L1_ENST00000403764.1_Silent_p.I8I	NM_001278730.1	NP_001265659.1	Q99501	GA2L1_HUMAN	growth arrest-specific 2 like 1	8					cell cycle arrest (GO:0007050)|cellular response to starvation (GO:0009267)|cellular response to thyroid hormone stimulus (GO:0097067)|microtubule bundle formation (GO:0001578)|negative regulation of cell growth (GO:0030308)|negative regulation of erythrocyte differentiation (GO:0045647)|negative regulation of gene expression (GO:0010629)|negative regulation of microtubule depolymerization (GO:0007026)|regulation of cell cycle (GO:0051726)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	cytoskeletal adaptor activity (GO:0008093)|microtubule binding (GO:0008017)|thyroid hormone receptor binding (GO:0046966)			endometrium(2)|lung(2)|prostate(1)	5						TGGCGGGCATCGCGGGCTCGG	0.647																																																	0													14.0	15.0	15.0					22																	29704119		2185	4283	6468	SO:0001819	synonymous_variant	10634			BC001782	CCDS63438.1, CCDS74840.1	22q12.2	2008-06-11			ENSG00000185340	ENSG00000185340			16955	protein-coding gene	gene with protein product		602128				8975699, 12584248, 1607387	Standard	NM_001278730		Approved	GAR22	uc003afc.1	Q99501	OTTHUMG00000151108	ENST00000406549.3:c.24C>T	22.37:g.29704119C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MCR7|Q53EN7|Q92640|Q9BUY9	Silent	SNP	pfam_GAS2_dom,pfam_CH-domain,superfamily_CH-domain,superfamily_GAS2_dom,smart_CH-domain,smart_GAS2_dom,pfscan_CH-domain	p.I8	ENST00000406549.3	37	c.24		22																																																																																			GAS2L1	-	NULL		0.647	GAS2L1-002	PUTATIVE	basic|exp_conf	protein_coding	GAS2L1	HGNC	protein_coding	OTTHUMT00000321365.1	C	NM_006478		29704119	+1	no_errors	ENST00000403764	ensembl	human	known	70_37	silent	SNP	0.990	T
GCSAML	148823	genome.wustl.edu	37	1	247688952	247688952	+	Intron	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:247688952C>A	ENST00000366491.2	+	2	119				GCSAML_ENST00000527084.1_Intron|GCSAML_ENST00000531662.1_Intron|GCSAML_ENST00000463359.1_Intron|GCSAML_ENST00000527541.1_Intron|GCSAML-AS1_ENST00000420469.1_RNA|GCSAML_ENST00000366489.1_Intron|GCSAML_ENST00000366490.3_Intron	NM_001281834.1	NP_001268763.1	Q5JQS6	GSAML_HUMAN	germinal center-associated, signaling and motility-like																		tctggaagccctctgaaccca	0.493																																																	0																																										SO:0001627	intron_variant	148824			AK126682	CCDS1635.1, CCDS60470.1, CCDS73058.1	1q44	2012-08-23	2012-08-23	2012-08-23	ENSG00000169224	ENSG00000169224			29583	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 150"""	C1orf150			Standard	NM_001281834		Approved	FLJ44728	uc001idf.3	Q5JQS6	OTTHUMG00000040648	ENST00000366491.2:c.-378-1290C>A	1.37:g.247688952C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4Y5|B3KX46|Q5JQT3	RNA	SNP	-	NULL	ENST00000366491.2	37	NULL		1																																																																																			GCSAML-AS1	-	-		0.493	GCSAML-003	KNOWN	alternative_5_UTR|basic	protein_coding	GCSAML-AS1	HGNC	protein_coding	OTTHUMT00000097747.2	C	NM_145278		247688952	-1	no_errors	ENST00000420469	ensembl	human	known	70_37	rna	SNP	0.269	A
GGT1	2678	genome.wustl.edu	37	22	25007114	25007114	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:25007114C>T	ENST00000400382.1	+	5	821	c.66C>T	c.(64-66)ctC>ctT	p.L22L	GGT1_ENST00000400383.1_Silent_p.L22L|GGT1_ENST00000400380.1_Silent_p.L22L|GGT1_ENST00000248923.4_Silent_p.L22L|GGT1_ENST00000406383.2_Silent_p.L22L			P19440	GGT1_HUMAN	gamma-glutamyltransferase 1	22					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|cysteine biosynthetic process (GO:0019344)|glutamate metabolic process (GO:0006536)|glutathione biosynthetic process (GO:0006750)|glutathione catabolic process (GO:0006751)|glutathione derivative biosynthetic process (GO:1901687)|glutathione metabolic process (GO:0006749)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|regulation of immune system process (GO:0002682)|regulation of inflammatory response (GO:0050727)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|xenobiotic metabolic process (GO:0006805)|zymogen activation (GO:0031638)	anchored component of external side of plasma membrane (GO:0031362)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(14)|large_intestine(2)|lung(6)|pancreas(1)|prostate(6)|skin(7)|upper_aerodigestive_tract(1)	40					Glutathione(DB00143)	TTGTCGGCCTCTGTCTCTGGC	0.612																																																	0													13.0	13.0	13.0					22																	25007114		1976	4135	6111	SO:0001819	synonymous_variant	2678			M24903	CCDS42992.1	22q11.23	2008-08-15			ENSG00000100031	ENSG00000100031	2.3.2.2	"""CD molecules"", ""Gamma-glutamyltransferases"""	4250	protein-coding gene	gene with protein product		612346		GGT		8104871, 18357469	Standard	NM_001288833		Approved	D22S672, D22S732, CD224	uc003aan.1	P19440	OTTHUMG00000030859	ENST00000400382.1:c.66C>T	22.37:g.25007114C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08247|Q14404|Q8TBS1|Q9UMK1	Silent	SNP	pfam_GGT_peptidase,prints_GGT_peptidase,tigrfam_GGT_peptidase	p.L22	ENST00000400382.1	37	c.66	CCDS42992.1	22																																																																																			GGT1	-	NULL		0.612	GGT1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	GGT1	HGNC	protein_coding	OTTHUMT00000250797.1	C	NM_013430		25007114	+1	no_errors	ENST00000248923	ensembl	human	known	70_37	silent	SNP	0.171	T
GLE1	2733	genome.wustl.edu	37	9	131271285	131271285	+	Nonsense_Mutation	SNP	C	C	G	rs201042972		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:131271285C>G	ENST00000309971.4	+	2	336	c.230C>G	c.(229-231)tCa>tGa	p.S77*	GLE1_ENST00000539582.1_5'UTR|GLE1_ENST00000372770.4_Nonsense_Mutation_p.S77*	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	77					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						ACGTCAGCTTCAGCCCTAGAT	0.512																																																	0													211.0	172.0	185.0					9																	131271285		2203	4300	6503	SO:0001587	stop_gained	2733			AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.230C>G	9.37:g.131271285C>G	ENSP00000308622:p.Ser77*	Somatic		WXS	Illumina HiSeq	Phase_IV	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Nonsense_Mutation	SNP	pfam_GLE1	p.S77*	ENST00000309971.4	37	c.230	CCDS35154.1	9	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108848	0.77096	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	.	.	.	5.48	3.65	0.41850	.	0.593113	0.17664	N	0.166213	.	.	.	.	.	.	0.24698	N	0.993272	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-4.2368	9.4857	0.38928	0.0:0.8348:0.0:0.1652	.	.	.	.	X	77	.	ENSP00000308622:S77X	S	+	2	0	GLE1	130311106	0.021000	0.18746	0.009000	0.14445	0.152000	0.21847	2.131000	0.42074	0.696000	0.31696	0.462000	0.41574	TCA	GLE1	-	NULL		0.512	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLE1	HGNC	protein_coding	OTTHUMT00000054456.1	C	NM_001003722		131271285	+1	no_errors	ENST00000309971	ensembl	human	known	70_37	nonsense	SNP	0.021	G
GLE1	2733	genome.wustl.edu	37	9	131271285	131271285	+	Nonsense_Mutation	SNP	C	C	G	rs201042972		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:131271285C>G	ENST00000309971.4	+	2	336	c.230C>G	c.(229-231)tCa>tGa	p.S77*	GLE1_ENST00000539582.1_5'UTR|GLE1_ENST00000372770.4_Nonsense_Mutation_p.S77*	NM_001003722.1	NP_001003722.1	Q53GS7	GLE1_HUMAN	GLE1 RNA export mediator	77					mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|membrane (GO:0016020)|nuclear pore (GO:0005643)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(3)|skin(2)|upper_aerodigestive_tract(1)	16						ACGTCAGCTTCAGCCCTAGAT	0.512																																																	0													211.0	172.0	185.0					9																	131271285		2203	4300	6503	SO:0001587	stop_gained	2733			AF058922	CCDS6904.1, CCDS35154.1	9q34.13	2014-09-17	2013-06-18	2007-10-04	ENSG00000119392	ENSG00000119392			4315	protein-coding gene	gene with protein product		603371	"""GLE1 (yeast homolog)-like, RNA export mediator"", ""GLE1 RNA export mediator-like (yeast)"", ""GLE1 RNA export mediator (yeast)"", ""lethal congenital contracture syndrome 1"", ""GLE1 RNA export mediator homolog (yeast)"""	GLE1L, LCCS1		9618489, 18204449	Standard	NM_001499		Approved	hGLE1	uc004bvj.3	Q53GS7	OTTHUMG00000020749	ENST00000309971.4:c.230C>G	9.37:g.131271285C>G	ENSP00000308622:p.Ser77*	Somatic		WXS	Illumina HiSeq	Phase_IV	O75458|Q53GT9|Q5VVU1|Q8NCP6|Q9UFL6	Nonsense_Mutation	SNP	pfam_GLE1	p.S77*	ENST00000309971.4	37	c.230	CCDS35154.1	9	.	.	.	.	.	.	.	.	.	.	C	21.2	4.108848	0.77096	.	.	ENSG00000119392	ENST00000309971;ENST00000372770	.	.	.	5.48	3.65	0.41850	.	0.593113	0.17664	N	0.166213	.	.	.	.	.	.	0.24698	N	0.993272	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-4.2368	9.4857	0.38928	0.0:0.8348:0.0:0.1652	.	.	.	.	X	77	.	ENSP00000308622:S77X	S	+	2	0	GLE1	130311106	0.021000	0.18746	0.009000	0.14445	0.152000	0.21847	2.131000	0.42074	0.696000	0.31696	0.462000	0.41574	TCA	GLE1	-	NULL		0.512	GLE1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GLE1	HGNC	protein_coding	OTTHUMT00000054456.1	C	NM_001003722		131271285	+1	no_errors	ENST00000309971	ensembl	human	known	70_37	nonsense	SNP	0.021	G
GPATCH3	63906	genome.wustl.edu	37	1	27216479	27216479	+	IGR	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:27216479C>G	ENST00000361720.5	-	0	2123				GPN2_ENST00000374135.4_Missense_Mutation_p.G37R|GPN2_ENST00000461282.1_5'Flank	NM_022078.2	NP_071361.2	Q96I76	GPTC3_HUMAN	G patch domain containing 3								nucleic acid binding (GO:0003676)			endometrium(2)|large_intestine(1)|lung(11)|skin(1)	15		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;3.97e-51)|OV - Ovarian serous cystadenocarcinoma(117;9.55e-30)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000513)|STAD - Stomach adenocarcinoma(196;0.000595)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|READ - Rectum adenocarcinoma(331;0.0419)		ACGCGCCGGCCCAGCGCGCGC	0.726																																																	0													15.0	17.0	16.0					1																	27216479		2188	4282	6470	SO:0001628	intergenic_variant	54707			BC007767	CCDS290.1	1p35.3-p35.1	2013-01-28		2006-12-13	ENSG00000198746	ENSG00000198746		"""G patch domain containing"""	25720	protein-coding gene	gene with protein product				GPATC3			Standard	NM_022078		Approved	FLJ12455	uc001bne.3	Q96I76	OTTHUMG00000004229		1.37:g.27216479C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JYH2|Q8NDJ2|Q9H9Z3	Missense_Mutation	SNP	pfam_Uncharacterised_ATP-bd	p.G37R	ENST00000361720.5	37	c.109	CCDS290.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.785279	0.96937	.	.	ENSG00000142751	ENST00000374135;ENST00000374131;ENST00000431781	T	0.31247	1.5	4.8	4.8	0.61643	.	0.113317	0.64402	D	0.000013	T	0.49270	0.1547	M	0.73962	2.25	0.80722	D	1	P	0.36587	0.559	P	0.49047	0.599	T	0.45175	-0.9279	10	0.37606	T	0.19	-36.014	17.6553	0.88176	0.0:1.0:0.0:0.0	.	37	Q9H9Y4	GPN2_HUMAN	R	37	ENSP00000363250:G37R	ENSP00000363246:G37R	G	-	1	0	GPN2	27089066	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	7.563000	0.82314	2.495000	0.84180	0.655000	0.94253	GGC	GPN2	-	pfam_Uncharacterised_ATP-bd		0.726	GPATCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPN2	HGNC	protein_coding	OTTHUMT00000012181.1	C	NM_022078		27216479	-1	no_errors	ENST00000374135	ensembl	human	known	70_37	missense	SNP	1.000	G
HLA-B	3106	genome.wustl.edu	37	6	31324496	31324496	+	Missense_Mutation	SNP	G	G	T	rs2308559|rs540530530|rs66473235	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:31324496G>T	ENST00000412585.2	-	2	340	c.312C>A	c.(310-312)aaC>aaA	p.N104K		NM_005514.6	NP_005505.2	P30486	1B48_HUMAN	major histocompatibility complex, class I, B	104	Alpha-1.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|immune response (GO:0006955)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|viral process (GO:0016032)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|MHC class I protein complex (GO:0042612)	peptide antigen binding (GO:0042605)	p.N104K(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(4)|lung(4)|prostate(1)|upper_aerodigestive_tract(2)	27						AGCCGCGCAGGTTCCGCAGGC	0.692									Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of																																								1	Substitution - Missense(1)	prostate(1)						G	LYS/ASN	14,4158		0,14,2072	44.0	46.0	46.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	312	1.4	0.0	6	dbSNP_123	46	57,8235		0,57,4089	no	missense	HLA-B	NM_005514.6	94	0,71,6161	TT,TG,GG		0.6874,0.3356,0.5696		104/363	31324496	71,12393	2086	4146	6232	SO:0001583	missense	3106	Familial Cancer Database	;Lichen Sclerosis, Familial	M15470	CCDS34394.1	6p21.3	2013-01-11			ENSG00000234745	ENSG00000234745		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4932	protein-coding gene	gene with protein product		142830	"""ankylosing spondylitis"""	AS		3459708	Standard	NM_005514		Approved		uc011imz.2	P01889	OTTHUMG00000031153	ENST00000412585.2:c.312C>A	6.37:g.31324496G>T	ENSP00000399168:p.Asn104Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q29764	Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.N104K	ENST00000412585.2	37	c.312	CCDS34394.1	6	.	.	.	.	.	.	.	.	.	.	N	11.01	1.513634	0.27123	0.003356	0.006874	ENSG00000234745	ENST00000412585;ENST00000434333	T;T	0.00686	5.85;5.85	3.2	1.36	0.22044	MHC class I, alpha chain, alpha1/alpha2 (4);MHC classes I/II-like antigen recognition protein (2);MHC class I-like antigen recognition (2);	0.720518	0.10376	U	0.682146	T	0.00695	0.0023	M	0.73430	2.235	0.09310	N	1	P;P;P	0.44816	0.662;0.525;0.844	B;P;P	0.49332	0.222;0.474;0.607	T	0.47535	-0.9110	10	0.46703	T	0.11	.	4.6229	0.12463	0.1304:0.226:0.6436:0.0	rs2308559;rs3180129;rs3206801;rs9264667;rs11547354	104;104;79	P30480;P01889;Q92671	1B42_HUMAN;1B07_HUMAN;.	K	104;115	ENSP00000399168:N104K;ENSP00000405931:N115K	ENSP00000399168:N104K	N	-	3	2	HLA-B	31432475	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.387000	0.07361	0.201000	0.20466	0.448000	0.29417	AAC	HLA-B	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2		0.692	HLA-B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-B	HGNC	protein_coding	OTTHUMT00000076280.4	G	NM_005514		31324496	-1	no_errors	ENST00000412585	ensembl	human	known	70_37	missense	SNP	0.000	T
HNF4A	3172	genome.wustl.edu	37	20	43034754	43034754	+	Missense_Mutation	SNP	G	G	A	rs376906221		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:43034754G>A	ENST00000316099.4	+	2	261	c.172G>A	c.(172-174)Gcc>Acc	p.A58T	HNF4A_ENST00000316673.4_Missense_Mutation_p.A36T|HNF4A_ENST00000415691.2_Missense_Mutation_p.A58T|HNF4A_ENST00000457232.1_Missense_Mutation_p.A36T|MIR3646_ENST00000578301.1_RNA|HNF4A_ENST00000609795.1_Missense_Mutation_p.A36T|HNF4A_ENST00000443598.2_Missense_Mutation_p.A58T	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	58					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGGTGTCAGCGCCCTGTGTGC	0.627																																					Colon(79;2 1269 8820 14841 52347)												0									THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	109.0	109.0	109.0		172,106,106,106,172,172	4.2	1.0	20		109	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	HNF4A	NM_000457.3,NM_001030003.1,NM_001030004.1,NM_175914.3,NM_178849.1,NM_178850.1	58,58,58,58,58,58	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,benign,benign,benign,benign,benign	58/475,36/443,36/396,36/453,58/465,58/418	43034754	2,13004	2203	4300	6503	SO:0001583	missense	3172			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.172G>A	20.37:g.43034754G>A	ENSP00000312987:p.Ala58Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.A58T	ENST00000316099.4	37	c.172	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	g	11.32	1.603231	0.28534	2.27E-4	1.16E-4	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95	5.17	4.16	0.48862	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (2);	0.284775	0.39210	N	0.001423	D	0.89774	0.6812	N	0.13098	0.295	0.33681	D	0.612156	B;B;B;B;B;B;B	0.14438	0.006;0.001;0.0;0.005;0.003;0.002;0.01	B;B;B;B;B;B;B	0.19391	0.025;0.003;0.003;0.004;0.009;0.005;0.013	D	0.86719	0.1941	10	0.18276	T	0.48	.	9.1934	0.37213	0.1461:0.1378:0.716:0.0	.	51;58;58;58;36;36;36	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	T	36;36;58;58;88;58	ENSP00000315180:A36T;ENSP00000396216:A36T;ENSP00000312987:A58T;ENSP00000410911:A58T;ENSP00000412111:A58T	ENSP00000312987:A58T	A	+	1	0	HNF4A	42468168	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	4.220000	0.58567	2.414000	0.81942	0.645000	0.84053	GCC	HNF4A	-	smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt		0.627	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	G			43034754	+1	no_errors	ENST00000316099	ensembl	human	known	70_37	missense	SNP	0.922	A
HNF4A	3172	genome.wustl.edu	37	20	43034754	43034754	+	Missense_Mutation	SNP	G	G	A	rs376906221		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:43034754G>A	ENST00000316099.4	+	2	261	c.172G>A	c.(172-174)Gcc>Acc	p.A58T	HNF4A_ENST00000316673.4_Missense_Mutation_p.A36T|HNF4A_ENST00000415691.2_Missense_Mutation_p.A58T|HNF4A_ENST00000457232.1_Missense_Mutation_p.A36T|MIR3646_ENST00000578301.1_RNA|HNF4A_ENST00000609795.1_Missense_Mutation_p.A36T|HNF4A_ENST00000443598.2_Missense_Mutation_p.A58T	NM_000457.4|NM_001258355.1|NM_178849.2	NP_000448.3|NP_001245284.1|NP_849180.1	P41235	HNF4A_HUMAN	hepatocyte nuclear factor 4, alpha	58					blood coagulation (GO:0007596)|endocrine pancreas development (GO:0031018)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|ornithine metabolic process (GO:0006591)|phospholipid homeostasis (GO:0055091)|positive regulation of cholesterol homeostasis (GO:2000189)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of gastrulation (GO:0010470)|regulation of growth hormone receptor signaling pathway (GO:0060398)|regulation of insulin secretion (GO:0050796)|regulation of lipid metabolic process (GO:0019216)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to glucose (GO:0009749)|sex differentiation (GO:0007548)|signal transduction involved in regulation of gene expression (GO:0023019)|SMAD protein signal transduction (GO:0060395)|transcription initiation from RNA polymerase II promoter (GO:0006367)|triglyceride homeostasis (GO:0070328)|xenobiotic metabolic process (GO:0006805)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|fatty acid binding (GO:0005504)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(4)|large_intestine(7)|lung(17)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(2)	34		Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)			GGGTGTCAGCGCCCTGTGTGC	0.627																																					Colon(79;2 1269 8820 14841 52347)												0									THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA,THR/ALA	1,4405	2.1+/-5.4	0,1,2202	109.0	109.0	109.0		172,106,106,106,172,172	4.2	1.0	20		109	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense,missense,missense,missense,missense	HNF4A	NM_000457.3,NM_001030003.1,NM_001030004.1,NM_175914.3,NM_178849.1,NM_178850.1	58,58,58,58,58,58	0,2,6501	AA,AG,GG		0.0116,0.0227,0.0154	benign,benign,benign,benign,benign,benign	58/475,36/443,36/396,36/453,58/465,58/418	43034754	2,13004	2203	4300	6503	SO:0001583	missense	3172			X76930	CCDS13330.1, CCDS13331.1, CCDS42876.1, CCDS46604.1, CCDS46605.1, CCDS68131.1, CCDS74728.1	20q13.12	2014-09-17			ENSG00000101076	ENSG00000101076		"""Nuclear hormone receptors"""	5024	protein-coding gene	gene with protein product		600281		TCF14, MODY, MODY1		7926813, 9048927	Standard	NM_001030003		Approved	NR2A1, HNF4	uc010zwo.1	P41235	OTTHUMG00000032531	ENST00000316099.4:c.172G>A	20.37:g.43034754G>A	ENSP00000312987:p.Ala58Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A5JW41|B2RPP8|O00659|O00723|Q14540|Q5QPB8|Q6B4V5|Q6B4V6|Q6B4V7|Q92653|Q92654|Q92655|Q99864|Q9NQH0	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_COUP_TF,prints_Retinoid-X_rcpt/HNF4	p.A58T	ENST00000316099.4	37	c.172	CCDS13330.1	20	.	.	.	.	.	.	.	.	.	.	g	11.32	1.603231	0.28534	2.27E-4	1.16E-4	ENSG00000101076	ENST00000316673;ENST00000457232;ENST00000316099;ENST00000443598;ENST00000338692;ENST00000415691	D;D;D;D;D	0.96232	-3.95;-3.95;-3.95;-3.95;-3.95	5.17	4.16	0.48862	Zinc finger, NHR/GATA-type (1);Zinc finger, nuclear hormone receptor-type (2);	0.284775	0.39210	N	0.001423	D	0.89774	0.6812	N	0.13098	0.295	0.33681	D	0.612156	B;B;B;B;B;B;B	0.14438	0.006;0.001;0.0;0.005;0.003;0.002;0.01	B;B;B;B;B;B;B	0.19391	0.025;0.003;0.003;0.004;0.009;0.005;0.013	D	0.86719	0.1941	10	0.18276	T	0.48	.	9.1934	0.37213	0.1461:0.1378:0.716:0.0	.	51;58;58;58;36;36;36	Q5QPB7;P41235;F1D8S2;P41235-3;F1D8T0;P41235-6;P41235-7	.;HNF4A_HUMAN;.;.;.;.;.	T	36;36;58;58;88;58	ENSP00000315180:A36T;ENSP00000396216:A36T;ENSP00000312987:A58T;ENSP00000410911:A58T;ENSP00000412111:A58T	ENSP00000312987:A58T	A	+	1	0	HNF4A	42468168	1.000000	0.71417	0.994000	0.49952	0.977000	0.68977	4.220000	0.58567	2.414000	0.81942	0.645000	0.84053	GCC	HNF4A	-	smart_Znf_hrmn_rcpt,pfscan_Znf_hrmn_rcpt		0.627	HNF4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	HNF4A	HGNC	protein_coding	OTTHUMT00000079363.3	G			43034754	+1	no_errors	ENST00000316099	ensembl	human	known	70_37	missense	SNP	0.922	A
HNRNPCL1	343069	genome.wustl.edu	37	1	12907428	12907428	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:12907428C>T	ENST00000317869.6	-	2	940	c.715G>A	c.(715-717)Gag>Aag	p.E239K		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	239						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CCCTCAGACTCCATCTTCACA	0.488																																																	0													118.0	118.0	118.0					1																	12907428		2203	4298	6501	SO:0001583	missense	343069			BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.715G>A	1.37:g.12907428C>T	ENSP00000365370:p.Glu239Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP44	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.E239K	ENST00000317869.6	37	c.715	CCDS30591.1	1	.	.	.	.	.	.	.	.	.	.	.	10.11	1.259927	0.23051	.	.	ENSG00000179172	ENST00000317869	T	0.10382	2.88	1.09	1.09	0.20402	.	0.799415	0.11251	U	0.583620	T	0.22003	0.0530	M	0.61703	1.905	0.27240	N	0.959174	D	0.64830	0.994	D	0.72338	0.977	T	0.14868	-1.0457	10	0.32370	T	0.25	.	3.4306	0.07426	0.0:0.7251:0.0:0.2749	.	239	O60812	HNRCL_HUMAN	K	239	ENSP00000365370:E239K	ENSP00000365370:E239K	E	-	1	0	HNRNPCL1	12830015	1.000000	0.71417	0.649000	0.29536	0.047000	0.14425	1.720000	0.38022	0.916000	0.36871	0.416000	0.27883	GAG	HNRNPCL1	-	pirsf_hnRNP_C_Raly		0.488	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPCL1	HGNC	protein_coding	OTTHUMT00000005462.1	C	NM_001013631		12907428	-1	no_errors	ENST00000317869	ensembl	human	known	70_37	missense	SNP	0.998	T
HNRNPCL1	343069	genome.wustl.edu	37	1	12907428	12907428	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:12907428C>T	ENST00000317869.6	-	2	940	c.715G>A	c.(715-717)Gag>Aag	p.E239K		NM_001013631.1|NM_001136561.2|NM_001146181.1	NP_001013653.1|NP_001130033.2|NP_001139653.1	O60812	HNRC1_HUMAN	heterogeneous nuclear ribonucleoprotein C-like 1	239						nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|stomach(2)	29						CCCTCAGACTCCATCTTCACA	0.488																																																	0													118.0	118.0	118.0					1																	12907428		2203	4298	6501	SO:0001583	missense	343069			BC002696	CCDS30591.1	1p36.21	2013-02-12		2008-04-18	ENSG00000179172	ENSG00000179172		"""RNA binding motif (RRM) containing"""	29295	protein-coding gene	gene with protein product				HNRPCL1			Standard	NM_001013631		Approved			O60812	OTTHUMG00000001931	ENST00000317869.6:c.715G>A	1.37:g.12907428C>T	ENSP00000365370:p.Glu239Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP44	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pirsf_hnRNP_C_Raly,pfscan_RRM_dom	p.E239K	ENST00000317869.6	37	c.715	CCDS30591.1	1	.	.	.	.	.	.	.	.	.	.	.	10.11	1.259927	0.23051	.	.	ENSG00000179172	ENST00000317869	T	0.10382	2.88	1.09	1.09	0.20402	.	0.799415	0.11251	U	0.583620	T	0.22003	0.0530	M	0.61703	1.905	0.27240	N	0.959174	D	0.64830	0.994	D	0.72338	0.977	T	0.14868	-1.0457	10	0.32370	T	0.25	.	3.4306	0.07426	0.0:0.7251:0.0:0.2749	.	239	O60812	HNRCL_HUMAN	K	239	ENSP00000365370:E239K	ENSP00000365370:E239K	E	-	1	0	HNRNPCL1	12830015	1.000000	0.71417	0.649000	0.29536	0.047000	0.14425	1.720000	0.38022	0.916000	0.36871	0.416000	0.27883	GAG	HNRNPCL1	-	pirsf_hnRNP_C_Raly		0.488	HNRNPCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPCL1	HGNC	protein_coding	OTTHUMT00000005462.1	C	NM_001013631		12907428	-1	no_errors	ENST00000317869	ensembl	human	known	70_37	missense	SNP	0.998	T
RP11-377D9.3	0	genome.wustl.edu	37	12	13157419	13157419	+	lincRNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:13157419C>T	ENST00000543321.1	+	0	31																											TATTATTTTTCTACAATAAAG	0.378																																																	0																																												93164																															12.37:g.13157419C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000543321.1	37	NULL		12																																																																																			HTR7P1	-	-		0.378	RP11-377D9.3-001	KNOWN	basic	lincRNA	HTR7P1	HGNC	lincRNA	OTTHUMT00000401005.1	C			13157419	+1	no_errors	ENST00000535469	ensembl	human	known	70_37	rna	SNP	0.336	T
ICOSLG	23308	genome.wustl.edu	37	21	45649487	45649487	+	Intron	SNP	C	C	T	rs59551340		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr21:45649487C>T	ENST00000407780.3	-	6	1026				ICOSLG_ENST00000400379.3_Missense_Mutation_p.G450R|ICOSLG_ENST00000400377.3_Intron|ICOSLG_ENST00000344330.4_Intron	NM_001283052.1	NP_001269981.1	O75144	ICOSL_HUMAN	inducible T-cell co-stimulator ligand						B cell activation (GO:0042113)|defense response (GO:0006952)|hyperosmotic response (GO:0006972)|positive regulation of activated T cell proliferation (GO:0042104)|signal transduction (GO:0007165)|T cell activation (GO:0042110)|T cell costimulation (GO:0031295)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			endometrium(2)|lung(1)|stomach(1)|urinary_tract(1)	5				Colorectal(79;0.0163)|READ - Rectum adenocarcinoma(84;0.0772)		TGGCGGTGCCCGGACCCACTC	0.672																																																	0																																										SO:0001627	intron_variant	23308			AB014553	CCDS42952.1, CCDS63377.1, CCDS63379.1	21q22.3	2014-01-30		2005-01-12	ENSG00000160223	ENSG00000160223		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Endogenous ligands"""	17087	protein-coding gene	gene with protein product	"""B7-related protein 1"", ""B7 homologue 2"", ""B7 homolog 2"""	605717		ICOSL		9734811, 11007762	Standard	NM_001283050		Approved	KIAA0653, GL50, B7-H2, B7RP-1, B7H2, B7RP1, ICOS-L, CD275	uc002zee.3	O75144	OTTHUMG00000086920	ENST00000407780.3:c.898+449G>A	21.37:g.45649487C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MUZ1|Q9HD18|Q9NRQ1	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_CD80_C2-set,smart_Ig_sub,pfscan_Ig-like	p.G450R	ENST00000407780.3	37	c.1348	CCDS42952.1	21	.	.	.	.	.	.	.	.	.	.	C	5.007	0.186989	0.09547	.	.	ENSG00000160223	ENST00000400379	T	0.02369	4.32	1.25	-2.49	0.06403	.	.	.	.	.	T	0.01695	0.0054	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.44817	-0.9303	6	0.21014	T	0.42	.	2.6782	0.05086	0.2819:0.4074:0.0:0.3107	rs59551340	.	.	.	R	450	ENSP00000383230:G450R	ENSP00000383230:G450R	G	-	1	0	ICOSLG	44473915	0.001000	0.12720	0.000000	0.03702	0.005000	0.04900	-0.826000	0.04429	-2.095000	0.00853	-1.328000	0.01277	GGG	ICOSLG	-	NULL		0.672	ICOSLG-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ICOSLG	HGNC	protein_coding	OTTHUMT00000195838.1	C	NM_015259		45649487	-1	no_errors	ENST00000400379	ensembl	human	putative	70_37	missense	SNP	0.000	T
INHBB	3625	genome.wustl.edu	37	2	121107168	121107168	+	Silent	SNP	C	C	G	rs531791724	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:121107168C>G	ENST00000295228.3	+	2	988	c.942C>G	c.(940-942)ctC>ctG	p.L314L		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	314					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				ACTTCCGCCTCATCGGCTGGA	0.632																																																	0													89.0	85.0	87.0					2																	121107168		2203	4300	6503	SO:0001819	synonymous_variant	3625				CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.942C>G	2.37:g.121107168C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53T31|Q8N1D3	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaB,prints_Inhibin_asu	p.L314	ENST00000295228.3	37	c.942	CCDS2132.1	2																																																																																			INHBB	-	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu		0.632	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBB	HGNC	protein_coding	OTTHUMT00000254234.1	C			121107168	+1	no_errors	ENST00000295228	ensembl	human	known	70_37	silent	SNP	1.000	G
INHBB	3625	genome.wustl.edu	37	2	121107168	121107168	+	Silent	SNP	C	C	G	rs531791724	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:121107168C>G	ENST00000295228.3	+	2	988	c.942C>G	c.(940-942)ctC>ctG	p.L314L		NM_002193.2	NP_002184.2	P09529	INHBB_HUMAN	inhibin, beta B	314					activin receptor signaling pathway (GO:0032924)|cell differentiation (GO:0030154)|cellular response to insulin stimulus (GO:0032869)|cellular response to leptin stimulus (GO:0044320)|cellular response to starvation (GO:0009267)|defense response (GO:0006952)|fat cell differentiation (GO:0045444)|growth (GO:0040007)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of hepatocyte growth factor biosynthetic process (GO:0048178)|negative regulation of insulin secretion (GO:0046676)|oocyte development (GO:0048599)|ovarian follicle development (GO:0001541)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|response to mechanical stimulus (GO:0009612)	extracellular region (GO:0005576)|perinuclear region of cytoplasm (GO:0048471)	cytokine activity (GO:0005125)|hormone activity (GO:0005179)|host cell surface receptor binding (GO:0046789)|protein homodimerization activity (GO:0042803)			NS(1)|breast(1)|endometrium(2)|large_intestine(3)|lung(4)|pancreas(2)|skin(2)	15		Prostate(154;0.122)				ACTTCCGCCTCATCGGCTGGA	0.632																																																	0													89.0	85.0	87.0					2																	121107168		2203	4300	6503	SO:0001819	synonymous_variant	3625				CCDS2132.1	2q14.2	2014-01-30	2007-07-30		ENSG00000163083	ENSG00000163083		"""Endogenous ligands"""	6067	protein-coding gene	gene with protein product		147390	"""inhibin, beta B (activin AB beta polypeptide)"""			3345731	Standard	NM_002193		Approved		uc002tmn.2	P09529	OTTHUMG00000131437	ENST00000295228.3:c.942C>G	2.37:g.121107168C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53T31|Q8N1D3	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaB,prints_Inhibin_asu	p.L314	ENST00000295228.3	37	c.942	CCDS2132.1	2																																																																																			INHBB	-	pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu		0.632	INHBB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBB	HGNC	protein_coding	OTTHUMT00000254234.1	C			121107168	+1	no_errors	ENST00000295228	ensembl	human	known	70_37	silent	SNP	1.000	G
IRX2	153572	genome.wustl.edu	37	5	2749029	2749029	+	Missense_Mutation	SNP	C	C	T	rs531740600		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:2749029C>T	ENST00000382611.6	-	3	1041	c.793G>A	c.(793-795)Gac>Aac	p.D265N	IRX2_ENST00000502957.1_5'UTR|IRX2_ENST00000302057.5_Missense_Mutation_p.D265N	NM_001134222.1	NP_001127694.1	Q9BZI1	IRX2_HUMAN	iroquois homeobox 2	265					proximal/distal pattern formation involved in metanephric nephron development (GO:0072272)|regulation of transcription, DNA-templated (GO:0006355)|specification of loop of Henle identity (GO:0072086)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			breast(1)|central_nervous_system(3)|endometrium(4)|kidney(1)|large_intestine(2)|lung(12)|prostate(1)|skin(2)	26				GBM - Glioblastoma multiforme(108;0.204)		TCCTCGTCGTCCTCCAGGTCG	0.716													C|||	1	0.000199681	0.0	0.0	5008	,	,		8960	0.0		0.001	False		,,,				2504	0.0																0													18.0	18.0	18.0					5																	2749029		2193	4281	6474	SO:0001583	missense	153572			AF319967	CCDS3868.1	5p15.33	2011-06-20	2007-07-13		ENSG00000170561	ENSG00000170561		"""Homeoboxes / TALE class"""	14359	protein-coding gene	gene with protein product		606198				11435706	Standard	NM_033267		Approved		uc003jdb.3	Q9BZI1	OTTHUMG00000090377	ENST00000382611.6:c.793G>A	5.37:g.2749029C>T	ENSP00000372056:p.Asp265Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68A19|Q7Z2I7	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,smart_Iroquois_homeo,pfscan_Homeodomain	p.D265N	ENST00000382611.6	37	c.793	CCDS3868.1	5	.	.	.	.	.	.	.	.	.	.	C	12.90	2.077092	0.36662	.	.	ENSG00000170561	ENST00000382611;ENST00000302057;ENST00000502957	T;T;T	0.66638	-0.22;-0.22;-0.13	4.81	4.81	0.61882	.	0.837151	0.11073	N	0.602676	T	0.57858	0.2082	L	0.40543	1.245	0.43559	D	0.995874	P	0.34462	0.454	B	0.29663	0.105	T	0.53380	-0.8447	10	0.15499	T	0.54	-18.1295	17.511	0.87760	0.0:1.0:0.0:0.0	.	265	Q9BZI1	IRX2_HUMAN	N	265;265;172	ENSP00000372056:D265N;ENSP00000307006:D265N;ENSP00000426151:D172N	ENSP00000307006:D265N	D	-	1	0	IRX2	2802029	1.000000	0.71417	0.998000	0.56505	0.939000	0.58152	3.897000	0.56273	2.218000	0.71995	0.563000	0.77884	GAC	IRX2	-	NULL		0.716	IRX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRX2	HGNC	protein_coding	OTTHUMT00000206749.2	C			2749029	-1	no_errors	ENST00000302057	ensembl	human	known	70_37	missense	SNP	1.000	T
ITGAM	3684	genome.wustl.edu	37	16	31282368	31282368	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:31282368C>G	ENST00000287497.8	+	6	596	c.521C>G	c.(520-522)tCa>tGa	p.S174*	ITGAM_ENST00000544665.3_Nonsense_Mutation_p.S174*			P11215	ITAM_HUMAN	integrin, alpha M (complement component 3 receptor 3 subunit)	174	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				activated T cell proliferation (GO:0050798)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cellular extravasation (GO:0045123)|ectodermal cell differentiation (GO:0010668)|extracellular matrix organization (GO:0030198)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|leukocyte migration involved in inflammatory response (GO:0002523)|microglia development (GO:0014005)|neutrophil chemotaxis (GO:0030593)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|integrin complex (GO:0008305)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	glycoprotein binding (GO:0001948)|heparin binding (GO:0008201)|metal ion binding (GO:0046872)			endometrium(7)|kidney(1)|large_intestine(10)|lung(32)|ovary(1)|prostate(4)|skin(1)	56						GAGTTTGTCTCAACTGTGATG	0.517																																																	0													155.0	143.0	147.0					16																	31282368		1941	4135	6076	SO:0001587	stop_gained	3684			J03925	CCDS45470.1, CCDS54004.1	16p11.2	2010-03-23	2006-02-10			ENSG00000169896		"""CD molecules"", ""Complement system"", ""Integrins"""	6149	protein-coding gene	gene with protein product		120980	"""integrin, alpha M (complement component receptor 3, alpha; also known as CD11b (p170), macrophage antigen alpha polypeptide)"""	CR3A, CD11B			Standard	NM_001145808		Approved	MAC-1, CD11b	uc002ebr.3	P11215		ENST00000287497.8:c.521C>G	16.37:g.31282368C>G	ENSP00000287497:p.Ser174*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VAK0|Q4VAK1|Q4VAK2	Nonsense_Mutation	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,pfam_Integrin_alpha_C_CS,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.S174*	ENST00000287497.8	37	c.521	CCDS45470.1	16	.	.	.	.	.	.	.	.	.	.	C	12.52	1.964035	0.34659	.	.	ENSG00000169896	ENST00000544665;ENST00000287497	.	.	.	5.5	-0.362	0.12560	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	6.9143	0.24352	0.1168:0.472:0.3419:0.0692	.	.	.	.	X	174	.	ENSP00000287497:S174X	S	+	2	0	ITGAM	31189869	0.036000	0.19791	0.168000	0.22838	0.018000	0.09664	0.267000	0.18552	0.336000	0.23639	0.561000	0.74099	TCA	ITGAM	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.517	ITGAM-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGAM	HGNC	protein_coding	OTTHUMT00000432816.1	C	NM_000632		31282368	+1	no_errors	ENST00000544665	ensembl	human	known	70_37	nonsense	SNP	0.003	G
ITPKB	3707	genome.wustl.edu	37	1	226924884	226924885	+	In_Frame_Ins	INS	-	-	CCA	rs147889095	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:226924884_226924885insCCA	ENST00000272117.3	-	1	274_275	c.275_276insTGG	c.(274-276)agc>agTGGc	p.92_93insG	ITPKB_ENST00000366784.1_In_Frame_Ins_p.92_93insG|ITPKB_ENST00000429204.1_In_Frame_Ins_p.92_93insG			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	92					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				tactgccgctgctgccgctgcc	0.752																																					Colon(84;110 1851 5306 33547)												0										569,2567		147,275,1146						0.9	1.0		dbSNP_120	5	1387,5285		295,797,2244	no	coding	ITPKB	NM_002221.3		442,1072,3390	A1A1,A1R,RR		20.7884,18.1441,19.9429				1956,7852				SO:0001652	inframe_insertion	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.275_276insTGG	1.37:g.226924884_226924885insCCA	ENSP00000272117:p.Ser92_Ser93insGly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	In_Frame_Ins	INS	pfam_IPK	p.93in_frame_insG	ENST00000272117.3	37	c.276_275	CCDS1555.1	1																																																																																			ITPKB	-	NULL		0.752	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	-	NM_002221		226924885	-1	no_errors	ENST00000272117	ensembl	human	known	70_37	in_frame_ins	INS	0.091:0.097	CCA
KALRN	8997	genome.wustl.edu	37	3	123881188	123881188	+	3'UTR	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:123881188G>C	ENST00000477496.1	+	0	985				KALRN_ENST00000240874.3_Intron|KALRN_ENST00000360013.3_Intron|KALRN_ENST00000460856.1_Intron	NR_028136.1		O60229	KALRN_HUMAN	kalirin, RhoGEF kinase						apoptotic signaling pathway (GO:0097190)|intracellular signal transduction (GO:0035556)|nervous system development (GO:0007399)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|protein phosphorylation (GO:0006468)|regulation of small GTPase mediated signal transduction (GO:0051056)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|vesicle-mediated transport (GO:0016192)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(21)|lung(28)|ovary(4)|prostate(5)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	83						GCAGGAGTGAGAGCCAGTGTG	0.463																																																	0																																										SO:0001624	3_prime_UTR_variant	8997			U94190	CCDS3027.1, CCDS3028.1	3q21.2	2013-02-11	2005-03-11	2005-03-12	ENSG00000160145	ENSG00000160145		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	4814	protein-coding gene	gene with protein product	"""serine/threonine kinase with Dbl and pleckstrin homology domains"""	604605	"""huntingtin-associated protein interacting protein (duo)"""	HAPIP		9285789, 10023074	Standard	NM_001024660		Approved	duo, Hs.8004, TRAD, DUET, Kalirin, ARHGEF24	uc003ehd.3	O60229	OTTHUMG00000125545	ENST00000477496.1:c.*982G>C	3.37:g.123881188G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MSI4|C9JQ37|Q6ZN45|Q8TBQ5|Q9NSZ4|Q9Y2A5	RNA	SNP	-	NULL	ENST00000477496.1	37	NULL		3																																																																																			KALRN	-	-		0.463	KALRN-006	KNOWN	basic	processed_transcript	KALRN	HGNC	protein_coding	OTTHUMT00000259126.1	G	NM_003947		123881188	+1	no_errors	ENST00000477496	ensembl	human	known	70_37	rna	SNP	0.158	C
KCNQ1	3784	genome.wustl.edu	37	11	2657771	2657771	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:2657771G>C	ENST00000155840.5	+	11	1501				KCNQ1OT1_ENST00000597346.1_RNA|KCNQ1_ENST00000335475.5_Intron	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1						atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	aagcccacttgatcatggtgg	0.383																																																	0																																										SO:0001627	intron_variant	10984			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1394-25420G>C	11.37:g.2657771G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	RNA	SNP	-	NULL	ENST00000155840.5	37	NULL	CCDS7736.1	11																																																																																			KCNQ1OT1	-	-		0.383	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1OT1	HGNC	protein_coding	OTTHUMT00000027382.2	G	NM_000218		2657771	-1	no_errors	ENST00000597346	ensembl	human	known	70_37	rna	SNP	0.063	C
KIAA1211	57482	genome.wustl.edu	37	4	57180239	57180239	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:57180239C>T	ENST00000504228.1	+	6	676	c.571C>T	c.(571-573)Cgg>Tgg	p.R191W	KIAA1211_ENST00000264229.6_Missense_Mutation_p.R191W|KIAA1211_ENST00000541073.1_Missense_Mutation_p.R184W			Q6ZU35	K1211_HUMAN	KIAA1211	191										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCTTGAGAGTCGGCCCTGCCT	0.537																																																	0													53.0	64.0	60.0					4																	57180239		2041	4193	6234	SO:0001583	missense	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.571C>T	4.37:g.57180239C>T	ENSP00000423366:p.Arg191Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	NULL	p.R191W	ENST00000504228.1	37	c.571	CCDS43230.1	4	.	.	.	.	.	.	.	.	.	.	C	9.720	1.159480	0.21454	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.12465	2.68;2.68;2.68	4.85	3.98	0.46160	.	.	.	.	.	T	0.10423	0.0255	N	0.08118	0	0.19575	N	0.999963	D;D;D	0.56521	0.976;0.976;0.976	P;P;P	0.46975	0.533;0.533;0.533	T	0.15694	-1.0428	9	0.72032	D	0.01	-17.786	11.8335	0.52309	0.0:0.6599:0.3401:0.0	.	184;184;191	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	W	191;191;184;101	ENSP00000264229:R191W;ENSP00000423366:R191W;ENSP00000444006:R184W	ENSP00000264229:R191W	R	+	1	2	KIAA1211	56874996	0.004000	0.15560	0.013000	0.15412	0.016000	0.09150	0.900000	0.28431	1.130000	0.42092	0.561000	0.74099	CGG	KIAA1211	-	NULL		0.537	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	C	NM_020722		57180239	+1	no_errors	ENST00000504228	ensembl	human	known	70_37	missense	SNP	0.490	T
KIAA1211	57482	genome.wustl.edu	37	4	57180239	57180239	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:57180239C>T	ENST00000504228.1	+	6	676	c.571C>T	c.(571-573)Cgg>Tgg	p.R191W	KIAA1211_ENST00000264229.6_Missense_Mutation_p.R191W|KIAA1211_ENST00000541073.1_Missense_Mutation_p.R184W			Q6ZU35	K1211_HUMAN	KIAA1211	191										endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CCTTGAGAGTCGGCCCTGCCT	0.537																																																	0													53.0	64.0	60.0					4																	57180239		2041	4193	6234	SO:0001583	missense	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.571C>T	4.37:g.57180239C>T	ENSP00000423366:p.Arg191Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NTE2|Q9NTP8|Q9ULK9	Missense_Mutation	SNP	NULL	p.R191W	ENST00000504228.1	37	c.571	CCDS43230.1	4	.	.	.	.	.	.	.	.	.	.	C	9.720	1.159480	0.21454	.	.	ENSG00000109265	ENST00000264229;ENST00000504228;ENST00000541073;ENST00000546221	T;T;T	0.12465	2.68;2.68;2.68	4.85	3.98	0.46160	.	.	.	.	.	T	0.10423	0.0255	N	0.08118	0	0.19575	N	0.999963	D;D;D	0.56521	0.976;0.976;0.976	P;P;P	0.46975	0.533;0.533;0.533	T	0.15694	-1.0428	9	0.72032	D	0.01	-17.786	11.8335	0.52309	0.0:0.6599:0.3401:0.0	.	184;184;191	B7ZVZ4;F5H1N7;Q6ZU35	.;.;K1211_HUMAN	W	191;191;184;101	ENSP00000264229:R191W;ENSP00000423366:R191W;ENSP00000444006:R184W	ENSP00000264229:R191W	R	+	1	2	KIAA1211	56874996	0.004000	0.15560	0.013000	0.15412	0.016000	0.09150	0.900000	0.28431	1.130000	0.42092	0.561000	0.74099	CGG	KIAA1211	-	NULL		0.537	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	C	NM_020722		57180239	+1	no_errors	ENST00000504228	ensembl	human	known	70_37	missense	SNP	0.490	T
KIAA1211	57482	genome.wustl.edu	37	4	57182677	57182677	+	Silent	SNP	G	G	A	rs369933689		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:57182677G>A	ENST00000504228.1	+	6	3114	c.3009G>A	c.(3007-3009)ccG>ccA	p.P1003P	KIAA1211_ENST00000264229.6_Silent_p.P1003P|KIAA1211_ENST00000541073.1_Silent_p.P996P			Q6ZU35	K1211_HUMAN	KIAA1211	1003	Pro-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CAAGTGAGCCGTCCAAGGAGG	0.657																																																	0								G		0,4048		0,0,2024	30.0	38.0	35.0		3009	-4.3	0.0	4		35	1,8335		0,1,4167	no	coding-synonymous	KIAA1211	NM_020722.1		0,1,6191	AA,AG,GG		0.012,0.0,0.0081		1003/1234	57182677	1,12383	2024	4168	6192	SO:0001819	synonymous_variant	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3009G>A	4.37:g.57182677G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	NULL	p.P1003	ENST00000504228.1	37	c.3009	CCDS43230.1	4																																																																																			KIAA1211	-	NULL		0.657	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	G	NM_020722		57182677	+1	no_errors	ENST00000504228	ensembl	human	known	70_37	silent	SNP	0.000	A
KIAA1211	57482	genome.wustl.edu	37	4	57182677	57182677	+	Silent	SNP	G	G	A	rs369933689		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:57182677G>A	ENST00000504228.1	+	6	3114	c.3009G>A	c.(3007-3009)ccG>ccA	p.P1003P	KIAA1211_ENST00000264229.6_Silent_p.P1003P|KIAA1211_ENST00000541073.1_Silent_p.P996P			Q6ZU35	K1211_HUMAN	KIAA1211	1003	Pro-rich.									endometrium(7)|large_intestine(10)|lung(39)|ovary(2)|prostate(3)|skin(3)|stomach(1)	65	Glioma(25;0.08)|all_neural(26;0.101)					CAAGTGAGCCGTCCAAGGAGG	0.657																																																	0								G		0,4048		0,0,2024	30.0	38.0	35.0		3009	-4.3	0.0	4		35	1,8335		0,1,4167	no	coding-synonymous	KIAA1211	NM_020722.1		0,1,6191	AA,AG,GG		0.012,0.0,0.0081		1003/1234	57182677	1,12383	2024	4168	6192	SO:0001819	synonymous_variant	57482			AB033037	CCDS43230.1	4q12	2012-08-03			ENSG00000109265	ENSG00000109265			29219	protein-coding gene	gene with protein product						10574462, 11230166	Standard	NM_020722		Approved		uc003hbk.2	Q6ZU35	OTTHUMG00000160749	ENST00000504228.1:c.3009G>A	4.37:g.57182677G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NTE2|Q9NTP8|Q9ULK9	Silent	SNP	NULL	p.P1003	ENST00000504228.1	37	c.3009	CCDS43230.1	4																																																																																			KIAA1211	-	NULL		0.657	KIAA1211-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1211	HGNC	protein_coding	OTTHUMT00000362097.2	G	NM_020722		57182677	+1	no_errors	ENST00000504228	ensembl	human	known	70_37	silent	SNP	0.000	A
KIAA1586	57691	genome.wustl.edu	37	6	56918108	56918108	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:56918108G>A	ENST00000370733.4	+	4	1018	c.811G>A	c.(811-813)Gaa>Aaa	p.E271K	KIAA1586_ENST00000545356.1_Missense_Mutation_p.E244K	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	271							nucleic acid binding (GO:0003676)	p.E271*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GGGGGCAAGAGAATTACAGGA	0.289																																																	1	Substitution - Nonsense(1)	large_intestine(1)											29.0	32.0	31.0					6																	56918108		2190	4286	6476	SO:0001583	missense	57691			AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.811G>A	6.37:g.56918108G>A	ENSP00000359768:p.Glu271Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4M3|Q8IW25	Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.E271K	ENST00000370733.4	37	c.811	CCDS34480.1	6	.	.	.	.	.	.	.	.	.	.	g	11.45	1.643208	0.29246	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.29397	1.57;1.57	4.25	4.25	0.50352	.	.	.	.	.	T	0.13670	0.0331	N	0.08118	0	0.25614	N	0.986464	D;D	0.61697	0.99;0.99	P;P	0.54889	0.763;0.763	T	0.09314	-1.0680	9	0.27082	T	0.32	-9.8264	12.3552	0.55171	0.0:0.0:1.0:0.0	.	244;271	F5H2N6;Q9HCI6	.;K1586_HUMAN	K	271;244	ENSP00000359768:E271K;ENSP00000445507:E244K	ENSP00000359768:E271K	E	+	1	0	KIAA1586	57026067	1.000000	0.71417	0.905000	0.35620	0.497000	0.33675	2.908000	0.48750	2.359000	0.80004	0.467000	0.42956	GAA	KIAA1586	-	NULL		0.289	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1586	HGNC	protein_coding	OTTHUMT00000041033.1	G	NM_020931		56918108	+1	no_errors	ENST00000370733	ensembl	human	known	70_37	missense	SNP	0.974	A
KIAA1586	57691	genome.wustl.edu	37	6	56918108	56918108	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:56918108G>A	ENST00000370733.4	+	4	1018	c.811G>A	c.(811-813)Gaa>Aaa	p.E271K	KIAA1586_ENST00000545356.1_Missense_Mutation_p.E244K	NM_020931.2	NP_065982.1	Q9HCI6	K1586_HUMAN	KIAA1586	271							nucleic acid binding (GO:0003676)	p.E271*(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(9)|skin(1)	18	Lung NSC(77;0.0969)		LUSC - Lung squamous cell carcinoma(124;0.0785)|Lung(124;0.13)			GGGGGCAAGAGAATTACAGGA	0.289																																																	1	Substitution - Nonsense(1)	large_intestine(1)											29.0	32.0	31.0					6																	56918108		2190	4286	6476	SO:0001583	missense	57691			AB046806	CCDS34480.1, CCDS69138.1	6p12.1	2014-03-27			ENSG00000168116	ENSG00000168116			21360	protein-coding gene	gene with protein product						10997877	Standard	NM_001286274		Approved		uc003pdj.3	Q9HCI6	OTTHUMG00000014915	ENST00000370733.4:c.811G>A	6.37:g.56918108G>A	ENSP00000359768:p.Glu271Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4M3|Q8IW25	Missense_Mutation	SNP	superfamily_RNaseH-like_dom	p.E271K	ENST00000370733.4	37	c.811	CCDS34480.1	6	.	.	.	.	.	.	.	.	.	.	g	11.45	1.643208	0.29246	.	.	ENSG00000168116	ENST00000370733;ENST00000545356	T;T	0.29397	1.57;1.57	4.25	4.25	0.50352	.	.	.	.	.	T	0.13670	0.0331	N	0.08118	0	0.25614	N	0.986464	D;D	0.61697	0.99;0.99	P;P	0.54889	0.763;0.763	T	0.09314	-1.0680	9	0.27082	T	0.32	-9.8264	12.3552	0.55171	0.0:0.0:1.0:0.0	.	244;271	F5H2N6;Q9HCI6	.;K1586_HUMAN	K	271;244	ENSP00000359768:E271K;ENSP00000445507:E244K	ENSP00000359768:E271K	E	+	1	0	KIAA1586	57026067	1.000000	0.71417	0.905000	0.35620	0.497000	0.33675	2.908000	0.48750	2.359000	0.80004	0.467000	0.42956	GAA	KIAA1586	-	NULL		0.289	KIAA1586-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1586	HGNC	protein_coding	OTTHUMT00000041033.1	G	NM_020931		56918108	+1	no_errors	ENST00000370733	ensembl	human	known	70_37	missense	SNP	0.974	A
KLHL14	57565	genome.wustl.edu	37	18	30350010	30350010	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr18:30350010G>A	ENST00000359358.4	-	2	983	c.545C>T	c.(544-546)tCg>tTg	p.S182L	KLHL14_ENST00000358095.4_Missense_Mutation_p.S182L|AC012123.1_ENST00000426194.1_Intron	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	182						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GTTCTGCACCGAGATCTGGTC	0.602																																																	0													133.0	113.0	120.0					18																	30350010		2203	4300	6503	SO:0001583	missense	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.545C>T	18.37:g.30350010G>A	ENSP00000352314:p.Ser182Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S182L	ENST00000359358.4	37	c.545	CCDS32813.1	18	.	.	.	.	.	.	.	.	.	.	G	11.09	1.535603	0.27475	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	T;T	0.77877	-0.87;-1.13	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	L	0.27053	0.805	0.58432	D	0.999992	B	0.30439	0.279	B	0.23852	0.049	T	0.69540	-0.5118	10	0.59425	D	0.04	.	16.2279	0.82311	0.0:0.0:1.0:0.0	.	182	Q9P2G3	KLH14_HUMAN	L	182	ENSP00000352314:S182L;ENSP00000350808:S182L	ENSP00000350808:S182L	S	-	2	0	KLHL14	28604008	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.682000	0.74528	2.160000	0.67779	0.305000	0.20034	TCG	KLHL14	-	pirsf_Kelch-like_gigaxonin		0.602	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	G			30350010	-1	no_errors	ENST00000359358	ensembl	human	known	70_37	missense	SNP	1.000	A
KLHL14	57565	genome.wustl.edu	37	18	30350010	30350010	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr18:30350010G>A	ENST00000359358.4	-	2	983	c.545C>T	c.(544-546)tCg>tTg	p.S182L	KLHL14_ENST00000358095.4_Missense_Mutation_p.S182L|AC012123.1_ENST00000426194.1_Intron	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	182						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						GTTCTGCACCGAGATCTGGTC	0.602																																																	0													133.0	113.0	120.0					18																	30350010		2203	4300	6503	SO:0001583	missense	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.545C>T	18.37:g.30350010G>A	ENSP00000352314:p.Ser182Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNW1|B4DHA0|Q8WU41	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.S182L	ENST00000359358.4	37	c.545	CCDS32813.1	18	.	.	.	.	.	.	.	.	.	.	G	11.09	1.535603	0.27475	.	.	ENSG00000197705	ENST00000359358;ENST00000358095	T;T	0.77877	-0.87;-1.13	4.35	4.35	0.52113	.	0.000000	0.85682	D	0.000000	T	0.66636	0.2809	L	0.27053	0.805	0.58432	D	0.999992	B	0.30439	0.279	B	0.23852	0.049	T	0.69540	-0.5118	10	0.59425	D	0.04	.	16.2279	0.82311	0.0:0.0:1.0:0.0	.	182	Q9P2G3	KLH14_HUMAN	L	182	ENSP00000352314:S182L;ENSP00000350808:S182L	ENSP00000350808:S182L	S	-	2	0	KLHL14	28604008	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	6.682000	0.74528	2.160000	0.67779	0.305000	0.20034	TCG	KLHL14	-	pirsf_Kelch-like_gigaxonin		0.602	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	G			30350010	-1	no_errors	ENST00000359358	ensembl	human	known	70_37	missense	SNP	1.000	A
KRT17P1	147228	genome.wustl.edu	37	17	16746889	16746889	+	RNA	SNP	C	C	G	rs1673791	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:16746889C>G	ENST00000580363.1	-	0	620									keratin 17 pseudogene 1											lung(4)	4						TGCGCCTGCTCTGCTCTCTCC	0.627													t|||	2561	0.511382	0.413	0.4553	5008	,	,		13177	0.8333		0.4264	False		,,,				2504	0.4397																0																																												147228					17p11.2	2013-06-25			ENSG00000131885	ENSG00000131885			6428	pseudogene	pseudogene						1281771	Standard	NG_002775		Approved				OTTHUMG00000059175		17.37:g.16746889C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000580363.1	37	NULL		17																																																																																			KRT17P1	-	-		0.627	KRT17P1-003	KNOWN	basic	processed_transcript	KRT17P1	HGNC	pseudogene	OTTHUMT00000444292.1	C			16746889	-1	no_errors	ENST00000577449	ensembl	human	putative	70_37	rna	SNP	0.003	G
KRTAP4-12	83755	genome.wustl.edu	37	17	39280341	39280341	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:39280341C>G	ENST00000394014.1	-	1	78	c.34G>C	c.(34-36)Gac>Cac	p.D12H		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	12	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCCCTGGTCAGAGCACACA	0.612																																																	0													56.0	63.0	61.0					17																	39280341		2203	4297	6500	SO:0001583	missense	83755			AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.34G>C	17.37:g.39280341C>G	ENSP00000377582:p.Asp12His	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KMC5|Q495I0	Missense_Mutation	SNP	pfam_Keratin-assoc	p.D12H	ENST00000394014.1	37	c.34	CCDS32649.1	17	.	.	.	.	.	.	.	.	.	.	.	10.96	1.499585	0.26861	.	.	ENSG00000213416	ENST00000394014;ENST00000455597	T	0.00585	6.39	4.49	4.49	0.54785	.	1.446790	0.05191	U	0.503197	T	0.02119	0.0066	M	0.73753	2.245	0.28764	N	0.900762	P	0.48998	0.918	P	0.55455	0.776	T	0.45308	-0.9270	10	0.46703	T	0.11	.	8.5984	0.33729	0.0:0.8966:0.0:0.1033	.	12	Q9BQ66	KR412_HUMAN	H	12	ENSP00000377582:D12H	ENSP00000377582:D12H	D	-	1	0	KRTAP4-12	36533867	0.002000	0.14202	0.987000	0.45799	0.352000	0.29268	1.024000	0.30077	2.491000	0.84063	0.455000	0.32223	GAC	KRTAP4-12	-	NULL		0.612	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-12	HGNC	protein_coding	OTTHUMT00000257777.1	C			39280341	-1	no_errors	ENST00000394014	ensembl	human	known	70_37	missense	SNP	0.970	G
KRTAP4-12	83755	genome.wustl.edu	37	17	39280341	39280341	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:39280341C>G	ENST00000394014.1	-	1	78	c.34G>C	c.(34-36)Gac>Cac	p.D12H		NM_031854.2	NP_114060.1	Q9BQ66	KR412_HUMAN	keratin associated protein 4-12	12	31 X 5 AA repeats of C-C-[GRQVIL]-[SPTR]- [VSTQPC].					keratin filament (GO:0045095)				endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(1)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(137;0.000496)	STAD - Stomach adenocarcinoma(17;0.000371)			CAGCCCTGGTCAGAGCACACA	0.612																																																	0													56.0	63.0	61.0					17																	39280341		2203	4297	6500	SO:0001583	missense	83755			AJ406943	CCDS32649.1	17q21.2	2013-06-25			ENSG00000213416	ENSG00000213416		"""Keratin associated proteins"""	16776	protein-coding gene	gene with protein product						11279113	Standard	NM_031854		Approved	KAP4.12	uc002hwa.3	Q9BQ66	OTTHUMG00000133632	ENST00000394014.1:c.34G>C	17.37:g.39280341C>G	ENSP00000377582:p.Asp12His	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KMC5|Q495I0	Missense_Mutation	SNP	pfam_Keratin-assoc	p.D12H	ENST00000394014.1	37	c.34	CCDS32649.1	17	.	.	.	.	.	.	.	.	.	.	.	10.96	1.499585	0.26861	.	.	ENSG00000213416	ENST00000394014;ENST00000455597	T	0.00585	6.39	4.49	4.49	0.54785	.	1.446790	0.05191	U	0.503197	T	0.02119	0.0066	M	0.73753	2.245	0.28764	N	0.900762	P	0.48998	0.918	P	0.55455	0.776	T	0.45308	-0.9270	10	0.46703	T	0.11	.	8.5984	0.33729	0.0:0.8966:0.0:0.1033	.	12	Q9BQ66	KR412_HUMAN	H	12	ENSP00000377582:D12H	ENSP00000377582:D12H	D	-	1	0	KRTAP4-12	36533867	0.002000	0.14202	0.987000	0.45799	0.352000	0.29268	1.024000	0.30077	2.491000	0.84063	0.455000	0.32223	GAC	KRTAP4-12	-	NULL		0.612	KRTAP4-12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-12	HGNC	protein_coding	OTTHUMT00000257777.1	C			39280341	-1	no_errors	ENST00000394014	ensembl	human	known	70_37	missense	SNP	0.970	G
LILRB3	11025	genome.wustl.edu	37	19	54725798	54725798	+	Missense_Mutation	SNP	G	G	T	rs75069054	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:54725798G>T	ENST00000391750.1	-	5	696	c.560C>A	c.(559-561)aCc>aAc	p.T187N	LILRA6_ENST00000391735.3_Intron|CTB-83J4.1_ENST00000601161.1_lincRNA|LILRB3_ENST00000469273.1_5'Flank|LILRB3_ENST00000245620.9_Missense_Mutation_p.T187N|LILRA6_ENST00000440558.2_Intron|LILRA6_ENST00000419410.2_Intron|LILRB3_ENST00000424807.1_Missense_Mutation_p.T187N|LILRB3_ENST00000346401.6_Missense_Mutation_p.T187N|LILRB3_ENST00000407860.2_Missense_Mutation_p.T187N|LILRA6_ENST00000270464.5_Intron			O75022	LIRB3_HUMAN	leukocyte immunoglobulin-like receptor, subfamily B (with TM and ITIM domains), member 3	187	Ig-like C2-type 2.			T -> N (in Ref. 1; AAB68668, 2; AAB87667 and 3; AAP30716). {ECO:0000305}.	cell surface receptor signaling pathway (GO:0007166)|defense response (GO:0006952)|immune system process (GO:0002376)|negative regulation of osteoclast differentiation (GO:0045671)	integral component of plasma membrane (GO:0005887)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			endometrium(3)|kidney(13)|large_intestine(1)|lung(6)|ovary(2)|prostate(5)|skin(2)|stomach(1)|urinary_tract(1)	34	all_cancers(19;0.00723)|all_epithelial(19;0.00389)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.105)		GTGGCTGGGGGTCACGGGGCC	0.607													.|||	2652	0.529553	0.4879	0.6513	5008	,	,		6917	0.6359		0.5537	False		,,,				2504	0.365																0													7.0	13.0	11.0					19																	54725798		1486	3166	4652	SO:0001583	missense	11025			U91928	CCDS33105.1, CCDS46175.1	19q13.4	2013-01-11			ENSG00000204577	ENSG00000204577		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6607	protein-coding gene	gene with protein product		604820				9278324, 9382880	Standard	NM_006864		Approved	LIR-3, HL9, ILT5, LIR3, CD85a	uc002qee.1	O75022	OTTHUMG00000066626	ENST00000391750.1:c.560C>A	19.37:g.54725798G>T	ENSP00000375630:p.Thr187Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J1P3|C9JIP1|O15471|Q86U49	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T187N	ENST00000391750.1	37	c.560	CCDS33105.1	19	.	.	.	.	.	.	.	.	.	.	G	10.73	1.433732	0.25813	.	.	ENSG00000204577	ENST00000391750;ENST00000424807;ENST00000346401;ENST00000245620;ENST00000407860	T;T;T;T;T	0.14516	2.5;2.5;2.5;2.5;2.5	2.87	-2.62	0.06152	Immunoglobulin-like fold (1);	0.947785	0.08786	N	0.894018	T	0.26231	0.0640	M	0.89785	3.06	0.58432	P	1.0000000000287557E-6	B;P;P;B;B	0.50443	0.017;0.484;0.935;0.188;0.427	B;B;P;B;B	0.52856	0.04;0.264;0.711;0.161;0.223	T	0.24835	-1.0149	9	0.36615	T	0.2	.	1.3588	0.02187	0.1229:0.1852:0.3149:0.3769	.	187;187;187;187;187	B5MCX0;F8WD89;O75022-2;O75022;O75022-3	.;.;.;LIRB3_HUMAN;.	N	187	ENSP00000375630:T187N;ENSP00000412771:T187N;ENSP00000345184:T187N;ENSP00000245620:T187N;ENSP00000384274:T187N	ENSP00000245620:T187N	T	-	2	0	LILRB3	59417610	0.000000	0.05858	0.000000	0.03702	0.410000	0.31052	-1.324000	0.02690	-0.367000	0.08052	0.573000	0.79308	ACC	LILRB3	-	NULL		0.607	LILRB3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LILRB3	HGNC	protein_coding	OTTHUMT00000142844.5	G	NM_006864		54725798	-1	no_errors	ENST00000407860	ensembl	human	known	70_37	missense	SNP	0.001	T
LINC00649	100506334	genome.wustl.edu	37	21	35348506	35348506	+	RNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr21:35348506C>G	ENST00000427447.1	+	0	7638				LINC00649_ENST00000609132.1_RNA	NR_038883.1				long intergenic non-protein coding RNA 649																		GGGTCCACCTCTCCCTCTGCC	0.532																																																	0																																												100506334			DA374118		21q22.11	2012-10-12			ENSG00000237945	ENSG00000237945		"""Long non-coding RNAs"""	44305	non-coding RNA	RNA, long non-coding							Standard	NR_038883		Approved		uc002ytn.3		OTTHUMG00000065819		21.37:g.35348506C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000427447.1	37	NULL		21																																																																																			LINC00649	-	-		0.532	LINC00649-001	KNOWN	basic|exp_conf	antisense	LINC00649	HGNC	antisense	OTTHUMT00000141032.5	C	NR_038883		35348506	+1	no_errors	ENST00000427447	ensembl	human	known	70_37	rna	SNP	0.000	G
LINC00661	126536	genome.wustl.edu	37	19	16136156	16136156	+	RNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:16136156G>A	ENST00000549354.2	+	0	1226					NR_026828.1				long intergenic non-protein coding RNA 661																		GAGCCCAGGGGAGCAGGCTGT	0.622																																																	0																																												126536			AI184190, CR749400		19p13.12	2012-10-12			ENSG00000205396	ENSG00000205396		"""Long non-coding RNAs"""	27002	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_026828		Approved		uc002nbw.2		OTTHUMG00000169715		19.37:g.16136156G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000549354.2	37	NULL		19																																																																																			LINC00661	-	-		0.622	LINC00661-001	KNOWN	basic	lincRNA	LINC00661	HGNC	processed_transcript	OTTHUMT00000405577.4	G	NR_026828		16136156	+1	no_errors	ENST00000379899	ensembl	human	known	70_37	rna	SNP	0.009	A
LOC100128002	100128002	genome.wustl.edu	37	12	132147531	132147531	+	lincRNA	SNP	A	A	G	rs568235801	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:132147531A>G	ENST00000508145.2	+	0	391				RNA5SP377_ENST00000390852.1_RNA																							TGCAGGGGCCAGGGTGGGGGT	0.647													a|||	2	0.000399361	0.0	0.0	5008	,	,		21108	0.0		0.002	False		,,,				2504	0.0																0																																												100128002																															12.37:g.132147531A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000508145.2	37	NULL		12																																																																																			RP11-495K9.6	-	-		0.647	RP11-495K9.6-001	KNOWN	basic	lincRNA	LOC100128002	Clone_based_vega_gene	lincRNA	OTTHUMT00000399235.1	A			132147531	+1	no_errors	ENST00000508145	ensembl	human	known	70_37	rna	SNP	0.002	G
LINC00894	100272228	genome.wustl.edu	37	X	149391768	149391768	+	RNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:149391768C>T	ENST00000449111.1	+	0	2977									long intergenic non-protein coding RNA 894																		GAGTGCACCGCGTGAGAGAAA	0.498																																																	0																																												100272228					Xq28	2013-05-17			ENSG00000235703	ENSG00000235703		"""Long non-coding RNAs"""	48579	non-coding RNA	RNA, long non-coding							Standard	NR_027456		Approved				OTTHUMG00000022638		X.37:g.149391768C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000449111.1	37	NULL		X																																																																																			RP13-507I23.1	-	-		0.498	LINC00894-001	KNOWN	basic	antisense	LOC100272228	Clone_based_vega_gene	antisense	OTTHUMT00000058733.2	C			149391768	+1	no_errors	ENST00000449111	ensembl	human	known	70_37	rna	SNP	0.000	T
ATP13A3	79572	genome.wustl.edu	37	3	194217567	194217567	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:194217567G>C	ENST00000439040.1	-	1	515				LINC00884_ENST00000437597.1_RNA|LINC00884_ENST00000448892.1_RNA|AC108676.1_ENST00000455557.2_RNA			Q9H7F0	AT133_HUMAN	ATPase type 13A3							integral component of membrane (GO:0016021)|membrane (GO:0016020)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			NS(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	24	all_cancers(143;6.01e-09)|Ovarian(172;0.0634)	Melanoma(1037;0.211)	OV - Ovarian serous cystadenocarcinoma(49;3.83e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;5.98e-05)		TGTTTGGAGTGAGACATTGGT	0.438																																																	0																																										SO:0001627	intron_variant	100507033			AJ306929	CCDS43187.1	3q29	2010-04-20			ENSG00000133657	ENSG00000133657		"""ATPases / P-type"""	24113	protein-coding gene	gene with protein product	"""ATPase family homolog up regulated in senescence cells"""	610232				11867234	Standard	NM_024524		Approved	AFURS1	uc003fty.4	Q9H7F0	OTTHUMG00000156034	ENST00000439040.1:c.276+1011C>G	3.37:g.194217567G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NC11|Q96KS1	RNA	SNP	-	NULL	ENST00000439040.1	37	NULL	CCDS43187.1	3																																																																																			AC108676.1	-	-		0.438	ATP13A3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	LOC100507033	Clone_based_vega_gene	protein_coding	OTTHUMT00000342799.2	G	NM_024524		194217567	-1	no_errors	ENST00000455557	ensembl	human	putative	70_37	rna	SNP	0.008	C
LINC01104	150577	genome.wustl.edu	37	2	100863599	100863599	+	lincRNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:100863599G>A	ENST00000452354.1	+	0	593					NR_103730.1																						GTGGGATGCCGAGGGCACTTG	0.527																																																	0																																												150577																															2.37:g.100863599G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000452354.1	37	NULL		2																																																																																			AC104782.3	-	-		0.527	AC104782.3-001	KNOWN	basic	lincRNA	LOC150577	Clone_based_vega_gene	lincRNA	OTTHUMT00000329691.1	G			100863599	+1	no_errors	ENST00000441036	ensembl	human	known	70_37	rna	SNP	0.000	A
LINC01018	255167	genome.wustl.edu	37	5	6587641	6587641	+	lincRNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:6587641G>A	ENST00000505626.1	+	0	2065					NR_024423.1				long intergenic non-protein coding RNA 1018																		CACCTCTCTGGATCAGAAGCA	0.488																																																	0																																												255167					5p15.31	2013-07-26			ENSG00000250056	ENSG00000250056		"""Long non-coding RNAs"""	27394	non-coding RNA	RNA, long non-coding						12477932	Standard	NR_024423		Approved				OTTHUMG00000161680		5.37:g.6587641G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000505626.1	37	NULL		5																																																																																			CTD-2195M18.1	-	-		0.488	LINC01018-001	KNOWN	basic	lincRNA	LOC255167	Clone_based_vega_gene	lincRNA	OTTHUMT00000365709.1	G			6587641	+1	no_errors	ENST00000505626	ensembl	human	known	70_37	rna	SNP	0.000	A
LOC339529	339529	genome.wustl.edu	37	1	244210228	244210228	+	lincRNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:244210228G>A	ENST00000440494.1	+	0	1408					NR_033883.1																						CCACTAGACTGAAAAGACCTA	0.373																																																	0																																												339529																															1.37:g.244210228G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000440494.1	37	NULL		1																																																																																			RP11-278H7.1	-	-		0.373	RP11-278H7.1-001	KNOWN	basic	lincRNA	LOC339529	Clone_based_vega_gene	lincRNA	OTTHUMT00000096514.1	G			244210228	+1	no_errors	ENST00000440494	ensembl	human	known	70_37	rna	SNP	0.864	A
LINC00298	339788	genome.wustl.edu	37	2	8064132	8064132	+	lincRNA	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:8064132C>T	ENST00000426969.1	-	0	659					NR_015405.1																						aaagtgtggtcactggaccaa	0.378																																																	0																																												339788																															2.37:g.8064132C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000426969.1	37	NULL		2																																																																																			AC007464.1	-	-		0.378	AC007464.1-001	KNOWN	basic	lincRNA	LOC339788	Clone_based_vega_gene	lincRNA	OTTHUMT00000323254.1	C			8064132	-1	no_errors	ENST00000426969	ensembl	human	known	70_37	rna	SNP	0.000	T
LRRC15	131578	genome.wustl.edu	37	3	194080433	194080433	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:194080433G>A	ENST00000347624.3	-	2	1425	c.1340C>T	c.(1339-1341)aCg>aTg	p.T447M	LRRC15_ENST00000428839.1_Missense_Mutation_p.T453M|LRRC15_ENST00000439944.2_Missense_Mutation_p.T453M	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	447	LRRCT.				negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		TACAGTGTCCGTCCCTAACCT	0.552																																																	0													90.0	77.0	82.0					3																	194080433		2203	4300	6503	SO:0001583	missense	131578			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1340C>T	3.37:g.194080433G>A	ENSP00000306276:p.Thr447Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q495Q6|Q7RTN7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T453M	ENST00000347624.3	37	c.1358	CCDS3306.1	3	.	.	.	.	.	.	.	.	.	.	G	2.903	-0.227160	0.06022	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.24723	1.84;1.84;1.84	5.13	4.26	0.50523	Cysteine-rich flanking region, C-terminal (1);	0.495944	0.18443	N	0.141065	T	0.39784	0.1091	L	0.55481	1.735	0.24143	N	0.995722	D;D	0.89917	0.979;1.0	B;D	0.67231	0.431;0.95	T	0.13495	-1.0507	10	0.45353	T	0.12	.	7.165	0.25685	0.0875:0.0:0.7447:0.1678	.	447;453	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	M	447;453;453	ENSP00000306276:T447M;ENSP00000389128:T453M;ENSP00000413707:T453M	ENSP00000306276:T447M	T	-	2	0	LRRC15	195561728	0.549000	0.26481	0.466000	0.27168	0.012000	0.07955	1.933000	0.40153	1.317000	0.45149	-0.126000	0.14955	ACG	LRRC15	-	smart_Cys-rich_flank_reg_C		0.552	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC15	HGNC	protein_coding	OTTHUMT00000342858.2	G			194080433	-1	no_errors	ENST00000439944	ensembl	human	known	70_37	missense	SNP	0.418	A
LRRC15	131578	genome.wustl.edu	37	3	194080433	194080433	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:194080433G>A	ENST00000347624.3	-	2	1425	c.1340C>T	c.(1339-1341)aCg>aTg	p.T447M	LRRC15_ENST00000428839.1_Missense_Mutation_p.T453M|LRRC15_ENST00000439944.2_Missense_Mutation_p.T453M	NM_130830.4	NP_570843.2	Q8TF66	LRC15_HUMAN	leucine rich repeat containing 15	447	LRRCT.				negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|positive regulation of cell migration (GO:0030335)|receptor-mediated virion attachment to host cell (GO:0046813)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	collagen binding (GO:0005518)|fibronectin binding (GO:0001968)|laminin binding (GO:0043236)			biliary_tract(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(20)|ovary(4)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	42	all_cancers(143;5.31e-09)|Ovarian(172;0.0634)		OV - Ovarian serous cystadenocarcinoma(49;2.2e-17)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;4.94e-05)		TACAGTGTCCGTCCCTAACCT	0.552																																																	0													90.0	77.0	82.0					3																	194080433		2203	4300	6503	SO:0001583	missense	131578			AB071037	CCDS3306.1, CCDS46984.1	3q29	2008-02-05			ENSG00000172061	ENSG00000172061			20818	protein-coding gene	gene with protein product						12923058	Standard	NM_001135057		Approved	LIB	uc003ftu.3	Q8TF66	OTTHUMG00000156048	ENST00000347624.3:c.1340C>T	3.37:g.194080433G>A	ENSP00000306276:p.Thr447Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q495Q6|Q7RTN7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C	p.T453M	ENST00000347624.3	37	c.1358	CCDS3306.1	3	.	.	.	.	.	.	.	.	.	.	G	2.903	-0.227160	0.06022	.	.	ENSG00000172061	ENST00000347624;ENST00000439944;ENST00000428839	T;T;T	0.24723	1.84;1.84;1.84	5.13	4.26	0.50523	Cysteine-rich flanking region, C-terminal (1);	0.495944	0.18443	N	0.141065	T	0.39784	0.1091	L	0.55481	1.735	0.24143	N	0.995722	D;D	0.89917	0.979;1.0	B;D	0.67231	0.431;0.95	T	0.13495	-1.0507	10	0.45353	T	0.12	.	7.165	0.25685	0.0875:0.0:0.7447:0.1678	.	447;453	Q8TF66;Q8TF66-2	LRC15_HUMAN;.	M	447;453;453	ENSP00000306276:T447M;ENSP00000389128:T453M;ENSP00000413707:T453M	ENSP00000306276:T447M	T	-	2	0	LRRC15	195561728	0.549000	0.26481	0.466000	0.27168	0.012000	0.07955	1.933000	0.40153	1.317000	0.45149	-0.126000	0.14955	ACG	LRRC15	-	smart_Cys-rich_flank_reg_C		0.552	LRRC15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC15	HGNC	protein_coding	OTTHUMT00000342858.2	G			194080433	-1	no_errors	ENST00000439944	ensembl	human	known	70_37	missense	SNP	0.418	A
LRRC37A	9884	genome.wustl.edu	37	17	44409004	44409004	+	Missense_Mutation	SNP	T	T	C	rs62073248	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:44409004T>C	ENST00000320254.5	+	9	4364	c.4361T>C	c.(4360-4362)cTg>cCg	p.L1454P	ARL17B_ENST00000570618.1_Intron|ARL17B_ENST00000434041.2_Intron|ARL17B_ENST00000575698.1_Intron|ARL17B_ENST00000575960.1_Intron|LRRC37A_ENST00000393465.3_Missense_Mutation_p.L1454P|LRRC37A_ENST00000496930.1_Missense_Mutation_p.L492P	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	1454						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		GGCACTGACCTGTCCCCCGAG	0.502																																																	0																																										SO:0001583	missense	9884			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.4361T>C	17.37:g.44409004T>C	ENSP00000326324:p.Leu1454Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DY2|Q8IWC7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L1454P	ENST00000320254.5	37	c.4361	CCDS11504.2	17	.	.	.	.	.	.	.	.	.	.	t	6.227	0.410104	0.11812	.	.	ENSG00000176681	ENST00000496930;ENST00000393466;ENST00000393465;ENST00000320254	T;T;T	0.59638	1.45;0.25;0.26	2.49	1.29	0.21616	.	.	.	.	.	T	0.65238	0.2672	L	0.59436	1.845	0.09310	N	1	D;D;D	0.76494	0.999;0.969;0.995	D;P;D	0.75484	0.931;0.651;0.986	T	0.50890	-0.8774	9	0.45353	T	0.12	.	3.2767	0.06901	0.0:0.503:0.0:0.497	.	492;574;1454	E9PP10;Q5YKG5;A6NMS7	.;.;L37A1_HUMAN	P	492;1454;1454;1454	ENSP00000437021:L492P;ENSP00000377108:L1454P;ENSP00000326324:L1454P	ENSP00000326324:L1454P	L	+	2	0	LRRC37A	41764765	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.093000	0.15086	0.349000	0.23975	0.347000	0.21830	CTG	LRRC37A	-	NULL		0.502	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	HGNC	protein_coding	OTTHUMT00000313519.3	T	NM_014834		44409004	+1	no_errors	ENST00000320254	ensembl	human	known	70_37	missense	SNP	0.000	C
MAGI1	9223	genome.wustl.edu	37	3	65342183	65342183	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:65342183C>G	ENST00000402939.2	-	23	4258	c.4259G>C	c.(4258-4260)aGa>aCa	p.R1420T	MAGI1_ENST00000330909.8_3'UTR|RP11-88H12.2_ENST00000602316.1_RNA	NM_001033057.1	NP_001028229.1	Q96QZ7	MAGI1_HUMAN	membrane associated guanylate kinase, WW and PDZ domain containing 1	1449					cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|neuron death (GO:0070997)|protein complex assembly (GO:0006461)	cell junction (GO:0030054)|cell projection (GO:0042995)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	alpha-actinin binding (GO:0051393)|ATP binding (GO:0005524)|protein C-terminus binding (GO:0008022)			breast(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|liver(1)|lung(21)|pancreas(1)|skin(5)	51		Lung NSC(201;0.0016)		BRCA - Breast invasive adenocarcinoma(55;0.00138)|KIRC - Kidney renal clear cell carcinoma(15;0.0988)|Kidney(15;0.133)		TCTGTCCTCTCTGTTCCTTTT	0.647																																																	0													123.0	119.0	120.0					3																	65342183		2203	4300	6503	SO:0001583	missense	9223			AB010894	CCDS33780.1, CCDS33781.1, CCDS2904.1	3p14.1	2009-10-06	2005-05-10	2005-05-10	ENSG00000151276	ENSG00000151276			946	protein-coding gene	gene with protein product		602625	"""BAI1-associated protein 1"""	BAIAP1		9647739, 9225980	Standard	XM_005265563		Approved	BAP1, MAGI-1, TNRC19, AIP3, WWP3	uc003dmn.3	Q96QZ7	OTTHUMG00000157554	ENST00000402939.2:c.4259G>C	3.37:g.65342183C>G	ENSP00000385450:p.Arg1420Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K188|O00309|O43863|O75085|Q96QZ8|Q96QZ9	Missense_Mutation	SNP	pfam_PDZ,pfam_WW_Rsp5_WWP,pfam_Guanylate_kin,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP,pfscan_Guanylate_kin	p.R1420T	ENST00000402939.2	37	c.4259	CCDS33780.1	3	.	.	.	.	.	.	.	.	.	.	C	0.348	-0.946317	0.02304	.	.	ENSG00000151276	ENST00000402939	T	0.12039	2.72	5.55	3.72	0.42706	.	0.369405	0.26711	N	0.022882	T	0.08268	0.0206	N	0.24115	0.695	0.09310	N	0.999996	B	0.19200	0.034	B	0.21708	0.036	T	0.36986	-0.9725	10	0.12766	T	0.61	-5.9254	8.4887	0.33086	0.0:0.7622:0.0:0.2378	.	1420	Q96QZ7-2	.	T	1420	ENSP00000385450:R1420T	ENSP00000385450:R1420T	R	-	2	0	MAGI1	65317223	0.166000	0.22962	0.006000	0.13384	0.090000	0.18270	0.728000	0.26013	1.304000	0.44892	0.655000	0.94253	AGA	MAGI1	-	NULL		0.647	MAGI1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAGI1	HGNC	protein_coding	OTTHUMT00000349126.1	C	NM_004742		65342183	-1	no_errors	ENST00000402939	ensembl	human	known	70_37	missense	SNP	0.002	G
MAP3K4	4216	genome.wustl.edu	37	6	161512528	161512528	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:161512528T>C	ENST00000392142.4	+	12	3239	c.3091T>C	c.(3091-3093)Tac>Cac	p.Y1031H	MAP3K4_ENST00000348824.7_Missense_Mutation_p.Y1031H|MAP3K4_ENST00000366919.2_Missense_Mutation_p.Y1031H|MAP3K4_ENST00000366920.2_Missense_Mutation_p.Y1031H	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1031					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CTTGCAACAGTACTACCGAGA	0.403																																																	0													224.0	207.0	213.0					6																	161512528		2203	4300	6503	SO:0001583	missense	4216			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3091T>C	6.37:g.161512528T>C	ENSP00000375986:p.Tyr1031His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y1031H	ENST00000392142.4	37	c.3091	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243992	0.79912	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.71341	-0.56;-0.55;-0.54;-0.56	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	T	0.75932	0.3917	L	0.57536	1.79	0.58432	D	0.999999	D;D;D;D	0.89917	0.997;0.993;1.0;1.0	D;P;D;D	0.91635	0.996;0.791;0.999;0.998	T	0.73839	-0.3856	10	0.29301	T	0.29	-24.3539	15.8087	0.78538	0.0:0.0:0.0:1.0	.	1031;21;1031;1031	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	H	1031	ENSP00000355886:Y1031H;ENSP00000375986:Y1031H;ENSP00000355887:Y1031H;ENSP00000297332:Y1031H	ENSP00000297332:Y1031H	Y	+	1	0	MAP3K4	161432518	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.578000	0.82498	2.191000	0.70037	0.528000	0.53228	TAC	MAP3K4	-	NULL		0.403	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	T			161512528	+1	no_errors	ENST00000392142	ensembl	human	known	70_37	missense	SNP	1.000	C
MAP3K4	4216	genome.wustl.edu	37	6	161512528	161512528	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:161512528T>C	ENST00000392142.4	+	12	3239	c.3091T>C	c.(3091-3093)Tac>Cac	p.Y1031H	MAP3K4_ENST00000348824.7_Missense_Mutation_p.Y1031H|MAP3K4_ENST00000366919.2_Missense_Mutation_p.Y1031H|MAP3K4_ENST00000366920.2_Missense_Mutation_p.Y1031H	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1031					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		CTTGCAACAGTACTACCGAGA	0.403																																																	0													224.0	207.0	213.0					6																	161512528		2203	4300	6503	SO:0001583	missense	4216			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3091T>C	6.37:g.161512528T>C	ENSP00000375986:p.Tyr1031His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.Y1031H	ENST00000392142.4	37	c.3091	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	T	22.1	4.243992	0.79912	.	.	ENSG00000085511	ENST00000366919;ENST00000392142;ENST00000540111;ENST00000366920;ENST00000348824	T;T;T;T	0.71341	-0.56;-0.55;-0.54;-0.56	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000001	T	0.75932	0.3917	L	0.57536	1.79	0.58432	D	0.999999	D;D;D;D	0.89917	0.997;0.993;1.0;1.0	D;P;D;D	0.91635	0.996;0.791;0.999;0.998	T	0.73839	-0.3856	10	0.29301	T	0.29	-24.3539	15.8087	0.78538	0.0:0.0:0.0:1.0	.	1031;21;1031;1031	F5H538;Q9P1M2;Q9Y6R4-2;Q9Y6R4	.;.;.;M3K4_HUMAN	H	1031	ENSP00000355886:Y1031H;ENSP00000375986:Y1031H;ENSP00000355887:Y1031H;ENSP00000297332:Y1031H	ENSP00000297332:Y1031H	Y	+	1	0	MAP3K4	161432518	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	7.578000	0.82498	2.191000	0.70037	0.528000	0.53228	TAC	MAP3K4	-	NULL		0.403	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	T			161512528	+1	no_errors	ENST00000392142	ensembl	human	known	70_37	missense	SNP	1.000	C
MARK1	4139	genome.wustl.edu	37	1	220809274	220809274	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:220809274G>A	ENST00000366917.4	+	13	1642	c.1376G>A	c.(1375-1377)cGa>cAa	p.R459Q	MARK1_ENST00000402574.1_Missense_Mutation_p.R324Q|MARK1_ENST00000366918.4_Missense_Mutation_p.R437Q					MAP/microtubule affinity-regulating kinase 1											central_nervous_system(2)|endometrium(9)|kidney(6)|large_intestine(12)|lung(22)|ovary(4)|pancreas(1)|skin(3)|stomach(3)|urinary_tract(1)	63				GBM - Glioblastoma multiforme(131;0.0407)		GATGTGGCTCGAAAACTTGGC	0.463																																																	0													104.0	101.0	102.0					1																	220809274		2203	4300	6503	SO:0001583	missense	4139			AF154845	CCDS31029.2, CCDS65789.1, CCDS73033.1, CCDS73034.1	1q41	2013-06-27			ENSG00000116141	ENSG00000116141			6896	protein-coding gene	gene with protein product		606511				9108484	Standard	NM_018650		Approved	MARK, PAR-1C	uc001hmn.4	Q9P0L2	OTTHUMG00000037351	ENST00000366917.4:c.1376G>A	1.37:g.220809274G>A	ENSP00000355884:p.Arg459Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase-assoc_KA1,superfamily_Kinase-like_dom,superfamily_Kinase-assoc_KA1,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_UBA/transl_elong_EF1B_N_euk,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R459Q	ENST00000366917.4	37	c.1376	CCDS31029.2	1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230843	0.58777	.	.	ENSG00000116141	ENST00000402574;ENST00000366918;ENST00000366917	T;T;T	0.32753	1.44;1.44;1.44	6.03	4.94	0.65067	.	0.062452	0.64402	D	0.000005	T	0.30696	0.0773	L	0.60957	1.885	0.41585	D	0.988766	P;B;P;B	0.39094	0.659;0.121;0.48;0.047	B;B;B;B	0.34385	0.181;0.024;0.181;0.056	T	0.11591	-1.0581	10	0.42905	T	0.14	.	16.1889	0.81972	0.0733:0.0:0.9267:0.0	.	459;324;459;437	B4DIB3;Q9P0L2-2;Q9P0L2;Q9P0L2-3	.;.;MARK1_HUMAN;.	Q	324;437;459	ENSP00000386017:R324Q;ENSP00000355885:R437Q;ENSP00000355884:R459Q	ENSP00000355884:R459Q	R	+	2	0	MARK1	218875897	1.000000	0.71417	0.201000	0.23476	0.996000	0.88848	6.138000	0.71717	2.861000	0.98227	0.655000	0.94253	CGA	MARK1	-	NULL		0.463	MARK1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MARK1	HGNC	protein_coding	OTTHUMT00000090899.1	G			220809274	+1	no_errors	ENST00000366917	ensembl	human	known	70_37	missense	SNP	0.985	A
MC2R	4158	genome.wustl.edu	37	18	13884966	13884966	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr18:13884966C>T	ENST00000327606.3	-	2	732	c.552G>A	c.(550-552)ctG>ctA	p.L184L		NM_000529.2	NP_000520.1	Q01718	ACTHR_HUMAN	melanocortin 2 receptor (adrenocorticotropic hormone)	184					G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|neuropeptide signaling pathway (GO:0007218)|placenta development (GO:0001890)|positive regulation of cAMP biosynthetic process (GO:0030819)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	corticotropin receptor activity (GO:0004978)|melanocortin receptor activity (GO:0004977)			breast(1)|endometrium(1)|kidney(2)|large_intestine(10)|lung(8)|ovary(4)|pancreas(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	30					Corticotropin(DB01285)|Cosyntropin(DB01284)	AGACCAGCATCAGCGGGAACA	0.562																																					Colon(141;1584 1782 35999 48227 48692)												0													154.0	126.0	136.0					18																	13884966		2203	4300	6503	SO:0001819	synonymous_variant	4158				CCDS11869.1	18p11.2	2012-08-10			ENSG00000185231	ENSG00000185231		"""GPCR / Class A : Melanocortin receptors"""	6930	protein-coding gene	gene with protein product		607397				8390157	Standard	NM_001291911		Approved	ACTHR	uc002ksp.1	Q01718	OTTHUMG00000131721	ENST00000327606.3:c.552G>A	18.37:g.13884966C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K016|Q3MI45|Q504X6	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_ACTH_rcpt,prints_Melcrt_ACTH_rcpt,prints_GPCR_Rhodpsn	p.L184	ENST00000327606.3	37	c.552	CCDS11869.1	18																																																																																			MC2R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.562	MC2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MC2R	HGNC	protein_coding	OTTHUMT00000254639.2	C			13884966	-1	no_errors	ENST00000327606	ensembl	human	known	70_37	silent	SNP	0.257	T
MCOLN1	57192	genome.wustl.edu	37	19	7593569	7593569	+	Nonsense_Mutation	SNP	C	C	T	rs121908371		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:7593569C>T	ENST00000264079.6	+	8	1089	c.964C>T	c.(964-966)Cga>Tga	p.R322*		NM_020533.2	NP_065394.1	Q9GZU1	MCLN1_HUMAN	mucolipin 1	322					calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|cellular iron ion homeostasis (GO:0006879)|ion transmembrane transport (GO:0034220)|release of sequestered calcium ion into cytosol (GO:0051209)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cation channel activity (GO:0005261)|NAADP-sensitive calcium-release channel activity (GO:0072345)			breast(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18						CTCACTCCTTCGAGGCTTCCT	0.632																																																	0			GRCh37	CM002428	MCOLN1	M	rs121908371						135.0	85.0	102.0					19																	7593569		2203	4300	6503	SO:0001587	stop_gained	57192			AF249319	CCDS12180.1	19p13.2	2011-12-16				ENSG00000090674		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	13356	protein-coding gene	gene with protein product		605248				16382100	Standard	NM_020533		Approved	TRPML1, ML4, MLIV, MST080, MSTP080, TRPM-L1	uc002mgo.3	Q9GZU1		ENST00000264079.6:c.964C>T	19.37:g.7593569C>T	ENSP00000264079:p.Arg322*	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W647|Q7Z4F7|Q9H292|Q9H4B3|Q9H4B5	Nonsense_Mutation	SNP	pfam_PKD1_2_channel,superfamily_Glycoside_hydrolase_SF	p.R322*	ENST00000264079.6	37	c.964	CCDS12180.1	19	.	.	.	.	.	.	.	.	.	.	C	36	5.732158	0.96856	.	.	ENSG00000090674	ENST00000264079;ENST00000394321	.	.	.	5.32	5.32	0.75619	.	0.056050	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.4854	0.84183	0.0:1.0:0.0:0.0	.	.	.	.	X	322;287	.	ENSP00000264079:R322X	R	+	1	2	MCOLN1	7499569	0.156000	0.22821	0.916000	0.36221	0.394000	0.30568	0.831000	0.27476	2.492000	0.84095	0.563000	0.77884	CGA	MCOLN1	-	NULL		0.632	MCOLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCOLN1	HGNC	protein_coding	OTTHUMT00000458974.2	C	NM_020533		7593569	+1	no_errors	ENST00000264079	ensembl	human	known	70_37	nonsense	SNP	0.882	T
MED1	5469	genome.wustl.edu	37	17	37566919	37566919	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:37566919G>A	ENST00000394287.3	-	17	1760	c.1555C>T	c.(1555-1557)Caa>Taa	p.Q519*	MED1_ENST00000300651.6_Nonsense_Mutation_p.Q519*			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GTGTCGGCTTGAATGGTTTCA	0.488										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													92.0	85.0	87.0					17																	37566919		2203	4300	6503	SO:0001587	stop_gained	5469			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.1555C>T	17.37:g.37566919G>A	ENSP00000377828:p.Gln519*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Nonsense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.Q519*	ENST00000394287.3	37	c.1555		17	.	.	.	.	.	.	.	.	.	.	G	37	6.049823	0.97236	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-6.0264	20.0505	0.97625	0.0:0.0:1.0:0.0	.	.	.	.	X	519	.	ENSP00000300651:Q519X	Q	-	1	0	MED1	34820445	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.434000	0.97515	2.739000	0.93911	0.561000	0.74099	CAA	MED1	-	NULL		0.488	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256944.1	G	NM_004774		37566919	-1	no_errors	ENST00000300651	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MED1	5469	genome.wustl.edu	37	17	37566919	37566919	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:37566919G>A	ENST00000394287.3	-	17	1760	c.1555C>T	c.(1555-1557)Caa>Taa	p.Q519*	MED1_ENST00000300651.6_Nonsense_Mutation_p.Q519*			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		GTGTCGGCTTGAATGGTTTCA	0.488										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													92.0	85.0	87.0					17																	37566919		2203	4300	6503	SO:0001587	stop_gained	5469			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.1555C>T	17.37:g.37566919G>A	ENSP00000377828:p.Gln519*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Nonsense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.Q519*	ENST00000394287.3	37	c.1555		17	.	.	.	.	.	.	.	.	.	.	G	37	6.049823	0.97236	.	.	ENSG00000125686	ENST00000394287;ENST00000300651	.	.	.	5.8	5.8	0.92144	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-6.0264	20.0505	0.97625	0.0:0.0:1.0:0.0	.	.	.	.	X	519	.	ENSP00000300651:Q519X	Q	-	1	0	MED1	34820445	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.434000	0.97515	2.739000	0.93911	0.561000	0.74099	CAA	MED1	-	NULL		0.488	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256944.1	G	NM_004774		37566919	-1	no_errors	ENST00000300651	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MERTK	10461	genome.wustl.edu	37	2	112766024	112766024	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:112766024C>G	ENST00000295408.4	+	14	2189	c.1932C>G	c.(1930-1932)ttC>ttG	p.F644L	MERTK_ENST00000409780.1_Missense_Mutation_p.F468L|MERTK_ENST00000421804.2_Missense_Mutation_p.F644L			Q12866	MERTK_HUMAN	MER proto-oncogene, tyrosine kinase	644	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic cell clearance (GO:0043277)|blood coagulation (GO:0007596)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|leukocyte migration (GO:0050900)|natural killer cell differentiation (GO:0001779)|negative regulation of lymphocyte activation (GO:0051250)|peptidyl-tyrosine phosphorylation (GO:0018108)|phagocytosis (GO:0006909)|platelet activation (GO:0030168)|positive regulation of phagocytosis (GO:0050766)|protein kinase B signaling (GO:0043491)|protein phosphorylation (GO:0006468)|retina development in camera-type eye (GO:0060041)|secretion by cell (GO:0032940)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|integral component of plasma membrane (GO:0005887)|photoreceptor outer segment (GO:0001750)|plasma membrane (GO:0005886)|rhabdomere (GO:0016028)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			breast(1)|endometrium(3)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|pancreas(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(10)	46						TGAAAGACTTCAGCCACCCAA	0.473																																																	0													112.0	100.0	104.0					2																	112766024		2203	4300	6503	SO:0001583	missense	10461			U08023	CCDS2094.1	2q14.1	2014-06-26	2014-06-26		ENSG00000153208	ENSG00000153208		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	7027	protein-coding gene	gene with protein product		604705	"""c-mer proto-oncogene tyrosine kinase"""			8086340, 10343112	Standard	XM_005263565		Approved	mer, RP38	uc002thk.1	Q12866	OTTHUMG00000131278	ENST00000295408.4:c.1932C>G	2.37:g.112766024C>G	ENSP00000295408:p.Phe644Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HBB4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Rhodanese-like_dom,smart_Ig_sub,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F644L	ENST00000295408.4	37	c.1932	CCDS2094.1	2	.	.	.	.	.	.	.	.	.	.	T	20.7	4.041165	0.75732	.	.	ENSG00000153208	ENST00000295408;ENST00000421804;ENST00000393237;ENST00000409780	T;T;T	0.55234	0.53;0.53;0.53	5.96	2.82	0.32997	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.33005	U	0.005391	T	0.51415	0.1673	N	0.04959	-0.14	0.48901	D	0.999727	D	0.89917	1.0	D	0.97110	1.0	T	0.60910	-0.7169	10	0.87932	D	0	-34.6704	14.282	0.66219	0.0:0.7858:0.0:0.2142	.	644	Q12866	MERTK_HUMAN	L	644;644;286;468	ENSP00000295408:F644L;ENSP00000389152:F644L;ENSP00000387277:F468L	ENSP00000295408:F644L	F	+	3	2	MERTK	112482495	0.955000	0.32602	0.951000	0.38953	0.829000	0.46940	0.997000	0.29731	0.454000	0.26884	-0.895000	0.02911	TTC	MERTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.473	MERTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MERTK	HGNC	protein_coding	OTTHUMT00000254046.2	C			112766024	+1	no_errors	ENST00000295408	ensembl	human	known	70_37	missense	SNP	0.968	G
STRBP	55342	genome.wustl.edu	37	9	125873767	125873767	+	Intron	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:125873767C>G	ENST00000530364.1	-	2	31				MIR600HG_ENST00000385007.1_RNA			Q96SI9	STRBP_HUMAN	spermatid perinuclear RNA binding protein						cellular component movement (GO:0006928)|mechanosensory behavior (GO:0007638)|multicellular organismal development (GO:0007275)|spermatid development (GO:0007286)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(6)|prostate(1)|skin(2)	26						TTCTGACCATCTTGGTTCCCT	0.478																																																	0													20.0	26.0	24.0					9																	125873767		692	1591	2283	SO:0001627	intron_variant	81571			AK002169	CCDS6851.1, CCDS55337.1	9q33.1-q33.3	2008-08-29	2001-11-28		ENSG00000165209	ENSG00000165209			16462	protein-coding gene	gene with protein product		611138	"""spermatid perinuclear RNA-binding protein"", ""interleukin enhancer binding factor 3-like"""	ILF3L			Standard	NM_018387		Approved	FLJ11307, SPNR	uc004bns.3	Q96SI9	OTTHUMG00000020636	ENST00000530364.1:c.255-1735G>C	9.37:g.125873767C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q32NB9|Q9BUE1|Q9BXG4|Q9H0B4|Q9H7V1|Q9NUK4	RNA	SNP	-	NULL	ENST00000530364.1	37	NULL		9																																																																																			MIR600HG	-	-		0.478	STRBP-009	PUTATIVE	basic	processed_transcript	MIR600HG	HGNC	protein_coding	OTTHUMT00000392598.1	C			125873767	-1	no_errors	ENST00000449175	ensembl	human	known	70_37	rna	SNP	0.071	G
KMT2C	58508	genome.wustl.edu	37	7	151856085	151856085	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:151856085C>T	ENST00000262189.6	-	44	11751	c.11533G>A	c.(11533-11535)Gaa>Aaa	p.E3845K	KMT2C_ENST00000355193.2_Missense_Mutation_p.E3845K	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3845					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCTTGGTTTCACTTCCTCCA	0.443																																																	0													216.0	193.0	201.0					7																	151856085		2203	4300	6503	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11533G>A	7.37:g.151856085C>T	ENSP00000262189:p.Glu3845Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E3845K	ENST00000262189.6	37	c.11533	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252293	0.80135	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.89196	-1.75;-1.76;-2.48	5.56	5.56	0.83823	.	0.000000	0.44483	U	0.000450	D	0.92548	0.7633	L	0.46157	1.445	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.80764	0.985;0.994;0.994	D	0.90256	0.4297	10	0.30078	T	0.28	.	19.8892	0.96923	0.0:1.0:0.0:0.0	.	3845;2906;3845	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	K	3845;3845;431	ENSP00000262189:E3845K;ENSP00000347325:E3845K;ENSP00000410411:E431K	ENSP00000262189:E3845K	E	-	1	0	MLL3	151487018	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.072000	0.64389	2.777000	0.95525	0.591000	0.81541	GAA	MLL3	-	NULL		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	C			151856085	-1	no_errors	ENST00000355193	ensembl	human	known	70_37	missense	SNP	1.000	T
KMT2C	58508	genome.wustl.edu	37	7	151856085	151856085	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:151856085C>T	ENST00000262189.6	-	44	11751	c.11533G>A	c.(11533-11535)Gaa>Aaa	p.E3845K	KMT2C_ENST00000355193.2_Missense_Mutation_p.E3845K	NM_170606.2	NP_733751.2	Q8NEZ4	KMT2C_HUMAN	lysine (K)-specific methyltransferase 2C	3845					histone H3-K4 methylation (GO:0051568)|intracellular signal transduction (GO:0035556)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)										TTCTTGGTTTCACTTCCTCCA	0.443																																																	0													216.0	193.0	201.0					7																	151856085		2203	4300	6503	SO:0001583	missense	58508			AF264750	CCDS5931.1	7q36	2013-05-09	2013-05-09	2013-05-09	ENSG00000055609	ENSG00000055609		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	13726	protein-coding gene	gene with protein product		606833	"""myeloid/lymphoid or mixed-lineage leukemia 3"""	MLL3		10819331	Standard	XM_005250026		Approved	KIAA1506, HALR		Q8NEZ4	OTTHUMG00000150553	ENST00000262189.6:c.11533G>A	7.37:g.151856085C>T	ENSP00000262189:p.Glu3845Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NC02|Q8NDF6|Q9H9P4|Q9NR13|Q9P222|Q9UDR7	Missense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_DHHC_palmitoyltrfase,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.E3845K	ENST00000262189.6	37	c.11533	CCDS5931.1	7	.	.	.	.	.	.	.	.	.	.	C	22.2	4.252293	0.80135	.	.	ENSG00000055609	ENST00000262189;ENST00000355193;ENST00000424877	D;D;D	0.89196	-1.75;-1.76;-2.48	5.56	5.56	0.83823	.	0.000000	0.44483	U	0.000450	D	0.92548	0.7633	L	0.46157	1.445	0.80722	D	1	D;D;D	0.71674	0.997;0.998;0.998	D;D;D	0.80764	0.985;0.994;0.994	D	0.90256	0.4297	10	0.30078	T	0.28	.	19.8892	0.96923	0.0:1.0:0.0:0.0	.	3845;2906;3845	Q8NEZ4;Q8NEZ4-2;Q8NEZ4-3	MLL3_HUMAN;.;.	K	3845;3845;431	ENSP00000262189:E3845K;ENSP00000347325:E3845K;ENSP00000410411:E431K	ENSP00000262189:E3845K	E	-	1	0	MLL3	151487018	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.072000	0.64389	2.777000	0.95525	0.591000	0.81541	GAA	MLL3	-	NULL		0.443	KMT2C-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MLL3	HGNC	protein_coding	OTTHUMT00000318887.3	C			151856085	-1	no_errors	ENST00000355193	ensembl	human	known	70_37	missense	SNP	1.000	T
MMP27	64066	genome.wustl.edu	37	11	102563730	102563730	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:102563730C>T	ENST00000260229.4	-	9	1327	c.1236G>A	c.(1234-1236)caG>caA	p.Q412Q		NM_022122.2	NP_071405.2	Q9H306	MMP27_HUMAN	matrix metallopeptidase 27	412					collagen catabolic process (GO:0030574)	proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(12)|ovary(2)|prostate(2)|skin(11)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	45	all_cancers(8;0.000843)|all_epithelial(12;0.00362)|Lung NSC(15;0.21)	all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.0509)|Lung(13;0.0696)|LUSC - Lung squamous cell carcinoma(19;0.13)|all cancers(10;0.176)	BRCA - Breast invasive adenocarcinoma(274;0.0151)	Marimastat(DB00786)	TTACCACTCTCTGCGGGAACC	0.433																																																	0													206.0	193.0	197.0					11																	102563730		2203	4299	6502	SO:0001819	synonymous_variant	64066			AF195192	CCDS8319.1	11q24	2008-07-18	2005-08-08		ENSG00000137675	ENSG00000137675			14250	protein-coding gene	gene with protein product	"""matrix metalloprotease 27"""		"""matrix metalloproteinase 27"""			10419448	Standard	NM_022122		Approved		uc001phd.1	Q9H306	OTTHUMG00000168099	ENST00000260229.4:c.1236G>A	11.37:g.102563730C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UWK6	Silent	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.Q412	ENST00000260229.4	37	c.1236	CCDS8319.1	11																																																																																			MMP27	-	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom		0.433	MMP27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP27	HGNC	protein_coding	OTTHUMT00000398128.1	C	NM_022122		102563730	-1	no_errors	ENST00000260229	ensembl	human	known	70_37	silent	SNP	0.003	T
MON2	23041	genome.wustl.edu	37	12	62974171	62974171	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:62974171C>T	ENST00000393632.2	+	32	5061	c.4670C>T	c.(4669-4671)tCa>tTa	p.S1557L	MON2_ENST00000393630.3_Missense_Mutation_p.S1558L|MON2_ENST00000393629.2_Missense_Mutation_p.S1551L|MON2_ENST00000280379.6_Missense_Mutation_p.S1558L|MON2_ENST00000546600.1_Missense_Mutation_p.S1557L|MON2_ENST00000552738.1_Missense_Mutation_p.S1528L	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1557					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		AACAAGGGCTCAATACATTCT	0.289																																																	0													90.0	89.0	89.0					12																	62974171		2203	4297	6500	SO:0001583	missense	23041				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.4670C>T	12.37:g.62974171C>T	ENSP00000377252:p.Ser1557Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	p.S1558L	ENST00000393632.2	37	c.4673	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	C	35	5.476837	0.96291	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000552738;ENST00000393629	T;T;T;T;T;T	0.69806	0.37;0.37;-0.42;-0.43;0.37;0.37	6.07	6.07	0.98685	.	0.000000	0.85682	D	0.000000	T	0.81823	0.4904	M	0.69358	2.11	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.995;0.998;0.998;0.989;0.999	T	0.79045	-0.1964	9	.	.	.	-14.0522	20.6593	0.99626	0.0:1.0:0.0:0.0	.	1551;1528;1557;426;1557	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-3;Q7Z3U7-4	.;.;.;.;.	L	1557;1558;1558;1557;1528;1551	ENSP00000377252:S1557L;ENSP00000377250:S1558L;ENSP00000280379:S1558L;ENSP00000447407:S1557L;ENSP00000449215:S1528L;ENSP00000377249:S1551L	.	S	+	2	0	MON2	61260438	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.776000	0.85560	2.885000	0.99019	0.655000	0.94253	TCA	MON2	-	NULL		0.289	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	C	NM_015026		62974171	+1	no_errors	ENST00000393630	ensembl	human	known	70_37	missense	SNP	1.000	T
MT-CO1	4512	genome.wustl.edu	37	M	6999	6999	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrM:6999G>A	ENST00000361624.2	+	1	1096	c.1096G>A	c.(1096-1098)Gta>Ata	p.V366I	MT-TD_ENST00000387419.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TC_ENST00000387405.1_RNA|MT-CO3_ENST00000362079.2_5'Flank|MT-TW_ENST00000387382.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-TY_ENST00000387409.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-TN_ENST00000387400.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I	366					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						CACTAGACATCGTACTACACG	0.453																																																	0																																										SO:0001583	missense	4512					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395		ENST00000361624.2:c.1096G>A	M.37:g.6999G>A	ENSP00000354499:p.Val366Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34770	Missense_Mutation	SNP	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom,prints_Cyt_c_Oxase_su1	p.V366M	ENST00000361624.2	37	c.1096		MT																																																																																			MT-CO1	-	pfam_Cyt_c_Oxase_su1,superfamily_Cyt_c_Oxase_su1_dom,pfscan_Cyt_c_Oxase_su1_dom		0.453	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MT-CO1	HGNC	protein_coding		G	YP_003024028		6999	+1	no_errors	ENST00000361624	ensembl	human	known	70_37	missense	SNP	NULL	A
MYBPC1	4604	genome.wustl.edu	37	12	102079532	102079532	+	3'UTR	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:102079532C>T	ENST00000360610.2	+	0	3730				MYBPC1_ENST00000361685.2_3'UTR|MYBPC1_ENST00000547405.1_3'UTR|MYBPC1_ENST00000547509.1_3'UTR|MYBPC1_ENST00000551300.1_3'UTR|MYBPC1_ENST00000549145.1_3'UTR|MYBPC1_ENST00000392934.3_3'UTR|MYBPC1_ENST00000553190.1_3'UTR|MYBPC1_ENST00000452455.2_3'UTR|MYBPC1_ENST00000550501.1_3'UTR|MYBPC1_ENST00000361466.2_3'UTR|MYBPC1_ENST00000441232.1_3'UTR	NM_206820.2	NP_996556.1	Q00872	MYPC1_HUMAN	myosin binding protein C, slow type						cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						AAAGCATTTTCTGTTTTCCCA	0.403																																																	0																																										SO:0001624	3_prime_UTR_variant	4604				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000360610.2:c.*202C>T	12.37:g.102079532C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	RNA	SNP	-	NULL	ENST00000360610.2	37	NULL	CCDS9085.1	12																																																																																			MYBPC1	-	-		0.403	MYBPC1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding		C			102079532	+1	no_errors	ENST00000550501	ensembl	human	known	70_37	rna	SNP	0.560	T
MYH6	4624	genome.wustl.edu	37	14	23871733	23871733	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:23871733C>T	ENST00000356287.3	-	11	1110	c.1081G>A	c.(1081-1083)Ggg>Agg	p.G361R	MYH6_ENST00000405093.3_Missense_Mutation_p.G361R			P13533	MYH6_HUMAN	myosin, heavy chain 6, cardiac muscle, alpha	361	Myosin motor.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|atrial cardiac muscle tissue morphogenesis (GO:0055009)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle fiber development (GO:0048739)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|myofibril assembly (GO:0030239)|regulation of ATPase activity (GO:0043462)|regulation of blood pressure (GO:0008217)|regulation of heart contraction (GO:0008016)|regulation of heart growth (GO:0060420)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|sarcomere organization (GO:0045214)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)|visceral muscle development (GO:0007522)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|protein kinase binding (GO:0019901)			breast(4)|cervix(2)|endometrium(8)|kidney(2)|large_intestine(16)|liver(1)|lung(60)|ovary(2)|pancreas(3)|prostate(6)|skin(6)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	119	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00764)|READ - Rectum adenocarcinoma(4;0.0289)|Colorectal(4;0.0441)		TTCATGTTCCCGTAGTGCATG	0.607																																																	0													119.0	110.0	113.0					14																	23871733		2203	4300	6503	SO:0001583	missense	4624			D00943	CCDS9600.1	14q11.2-q13	2014-09-17	2008-08-01		ENSG00000197616	ENSG00000197616		"""Myosins / Myosin superfamily : Class II"""	7576	protein-coding gene	gene with protein product	"""cardiomyopathy, hypertrophic 1"""	160710	"""myosin, heavy polypeptide 6, cardiac muscle, alpha (cardiomyopathy, hypertrophic 1)"""			2144212	Standard	NM_002471		Approved		uc001wjv.3	P13533	OTTHUMG00000028753	ENST00000356287.3:c.1081G>A	14.37:g.23871733C>T	ENSP00000348634:p.Gly361Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RTX1|D9YZU2|Q13943|Q14906|Q14907	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G361R	ENST00000356287.3	37	c.1081	CCDS9600.1	14	.	.	.	.	.	.	.	.	.	.	.	25.1	4.602208	0.87055	.	.	ENSG00000197616	ENST00000405093;ENST00000356287	D;D	0.98701	-5.08;-5.08	3.82	3.82	0.43975	Myosin head, motor domain (2);	.	.	.	.	D	0.99612	0.9859	H	0.99980	5.19	0.80722	D	1	D;D	0.59767	0.986;0.986	D;D	0.65443	0.935;0.935	D	0.96931	0.9681	9	0.87932	D	0	.	15.063	0.71970	0.0:1.0:0.0:0.0	.	361;361	D9YZU2;P13533	.;MYH6_HUMAN	R	361	ENSP00000386041:G361R;ENSP00000348634:G361R	ENSP00000348634:G361R	G	-	1	0	MYH6	22941573	1.000000	0.71417	0.562000	0.28370	0.955000	0.61496	7.490000	0.81461	1.864000	0.54056	0.305000	0.20034	GGG	MYH6	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.607	MYH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH6	HGNC	protein_coding	OTTHUMT00000071796.3	C			23871733	-1	no_errors	ENST00000356287	ensembl	human	known	70_37	missense	SNP	0.998	T
MYO7B	4648	genome.wustl.edu	37	2	128380923	128380923	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:128380923C>T	ENST00000409816.2	+	27	3746	c.3714C>T	c.(3712-3714)ttC>ttT	p.F1238F	RP11-286H15.1_ENST00000609697.1_RNA|MYO7B_ENST00000409090.1_Silent_p.F91F|MYO7B_ENST00000389524.4_Silent_p.F1238F|MYO7B_ENST00000428314.1_Silent_p.F1238F			Q6PIF6	MYO7B_HUMAN	myosin VIIB	1238	FERM 1. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		ACCTGGGCTTCTCCCTCCAGG	0.642																																																	0													47.0	56.0	53.0					2																	128380923		2147	4235	6382	SO:0001819	synonymous_variant	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.3714C>T	2.37:g.128380923C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14786|Q8TEE1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.F1238	ENST00000409816.2	37	c.3714	CCDS46405.1	2																																																																																			MYO7B	-	smart_Band_41_domain,pfscan_FERM_domain		0.642	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	C	XM_291001		128380923	+1	no_errors	ENST00000389524	ensembl	human	known	70_37	silent	SNP	0.996	T
MYRIP	25924	genome.wustl.edu	37	3	40192620	40192620	+	Silent	SNP	G	G	A	rs376295541		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:40192620G>A	ENST00000302541.6	+	4	756	c.414G>A	c.(412-414)ctG>ctA	p.L138L	MYRIP_ENST00000396217.3_Intron|MYRIP_ENST00000539167.1_5'UTR|MYRIP_ENST00000425621.1_Silent_p.L138L|MYRIP_ENST00000444716.1_Silent_p.L138L|MYRIP_ENST00000459828.1_3'UTR	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	138					intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CCAAGGTTCTGAAGAACCTGT	0.532																																																	0													35.0	36.0	36.0					3																	40192620		2203	4300	6503	SO:0001819	synonymous_variant	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.414G>A	3.37:g.40192620G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Silent	SNP	pfam_Myrip/Melanophilin,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.L138	ENST00000302541.6	37	c.414	CCDS2689.1	3																																																																																			MYRIP	-	NULL		0.532	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	G	NM_015460		40192620	+1	no_errors	ENST00000302541	ensembl	human	known	70_37	silent	SNP	1.000	A
MYRIP	25924	genome.wustl.edu	37	3	40192620	40192620	+	Silent	SNP	G	G	A	rs376295541		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:40192620G>A	ENST00000302541.6	+	4	756	c.414G>A	c.(412-414)ctG>ctA	p.L138L	MYRIP_ENST00000396217.3_Intron|MYRIP_ENST00000539167.1_5'UTR|MYRIP_ENST00000425621.1_Silent_p.L138L|MYRIP_ENST00000444716.1_Silent_p.L138L|MYRIP_ENST00000459828.1_3'UTR	NM_001284423.1|NM_001284426.1|NM_015460.2	NP_001271352.1|NP_001271355.1|NP_056275.2	Q8NFW9	MYRIP_HUMAN	myosin VIIA and Rab interacting protein	138					intracellular protein transport (GO:0006886)|positive regulation of insulin secretion (GO:0032024)	actin cytoskeleton (GO:0015629)|dense core granule (GO:0031045)|exocyst (GO:0000145)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)|photoreceptor outer segment (GO:0001750)|synapse (GO:0045202)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|liver(2)|lung(10)|ovary(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34				KIRC - Kidney renal clear cell carcinoma(284;0.174)|Kidney(284;0.206)		CCAAGGTTCTGAAGAACCTGT	0.532																																																	0													35.0	36.0	36.0					3																	40192620		2203	4300	6503	SO:0001819	synonymous_variant	25924			AF396687	CCDS2689.1, CCDS68390.1, CCDS68391.1, CCDS68392.1	3p21.33	2010-08-20			ENSG00000170011	ENSG00000170011		"""A-kinase anchor proteins"""	19156	protein-coding gene	gene with protein product	"""synaptotagmin-like protein homologue lacking C2 domains-c"", ""rab effector MYRIP"", ""Slp homologue lacking C2 domains"""	611790				11964381, 12221080	Standard	NM_001284425		Approved	DKFZp586F1018, exophilin-8, MyRIP, SLAC2-C, SLAC2C	uc003cka.3	Q8NFW9	OTTHUMG00000131392	ENST00000302541.6:c.414G>A	3.37:g.40192620G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWM3|B3KWW4|B7Z2H1|B7Z9V3|G3XAI8|Q32M41|Q32M42|Q569F7|Q8IUF5|Q9Y3V4	Silent	SNP	pfam_Myrip/Melanophilin,superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.L138	ENST00000302541.6	37	c.414	CCDS2689.1	3																																																																																			MYRIP	-	NULL		0.532	MYRIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYRIP	HGNC	protein_coding	OTTHUMT00000254181.2	G	NM_015460		40192620	+1	no_errors	ENST00000302541	ensembl	human	known	70_37	silent	SNP	1.000	A
N4BP3	23138	genome.wustl.edu	37	5	177547344	177547344	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:177547344C>G	ENST00000274605.5	+	3	855	c.496C>G	c.(496-498)Cag>Gag	p.Q166E		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	166						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGGGCCAGCCAGGCCCGGGC	0.706																																																	0													15.0	19.0	18.0					5																	177547344		2192	4278	6470	SO:0001583	missense	23138			AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.496C>G	5.37:g.177547344C>G	ENSP00000274605:p.Gln166Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	pfam_Fez1	p.Q166E	ENST00000274605.5	37	c.496	CCDS34307.1	5	.	.	.	.	.	.	.	.	.	.	C	6.020	0.372111	0.11409	.	.	ENSG00000145911	ENST00000274605	T	0.00572	6.49	5.13	5.13	0.70059	.	0.779066	0.12764	N	0.441091	T	0.00468	0.0015	N	0.08118	0	0.36063	D	0.841596	B	0.02656	0.0	B	0.04013	0.001	T	0.64462	-0.6402	10	0.12766	T	0.61	-46.7787	16.1073	0.81234	0.0:1.0:0.0:0.0	.	166	O15049	N4BP3_HUMAN	E	166	ENSP00000274605:Q166E	ENSP00000274605:Q166E	Q	+	1	0	N4BP3	177479950	0.993000	0.37304	1.000000	0.80357	0.798000	0.45092	2.799000	0.47892	2.668000	0.90789	0.655000	0.94253	CAG	N4BP3	-	NULL		0.706	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP3	HGNC	protein_coding	OTTHUMT00000373552.2	C	NM_015111		177547344	+1	no_errors	ENST00000274605	ensembl	human	known	70_37	missense	SNP	1.000	G
N4BP3	23138	genome.wustl.edu	37	5	177547344	177547344	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:177547344C>G	ENST00000274605.5	+	3	855	c.496C>G	c.(496-498)Cag>Gag	p.Q166E		NM_015111.1	NP_055926.1	O15049	N4BP3_HUMAN	NEDD4 binding protein 3	166						cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)				breast(2)|endometrium(3)|kidney(1)|large_intestine(1)|lung(1)|skin(1)	9	all_cancers(89;0.00294)|Renal(175;0.000269)|Lung NSC(126;0.00858)|all_lung(126;0.0139)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			CCGGGCCAGCCAGGCCCGGGC	0.706																																																	0													15.0	19.0	18.0					5																	177547344		2192	4278	6470	SO:0001583	missense	23138			AB002339	CCDS34307.1	5q35.3	2012-05-17				ENSG00000145911			29852	protein-coding gene	gene with protein product						9205841, 11717310	Standard	XM_006714834		Approved	LZTS4	uc003mik.1	O15049		ENST00000274605.5:c.496C>G	5.37:g.177547344C>G	ENSP00000274605:p.Gln166Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIL3|D3DWP3|Q6ZSQ6|Q7Z6I3	Missense_Mutation	SNP	pfam_Fez1	p.Q166E	ENST00000274605.5	37	c.496	CCDS34307.1	5	.	.	.	.	.	.	.	.	.	.	C	6.020	0.372111	0.11409	.	.	ENSG00000145911	ENST00000274605	T	0.00572	6.49	5.13	5.13	0.70059	.	0.779066	0.12764	N	0.441091	T	0.00468	0.0015	N	0.08118	0	0.36063	D	0.841596	B	0.02656	0.0	B	0.04013	0.001	T	0.64462	-0.6402	10	0.12766	T	0.61	-46.7787	16.1073	0.81234	0.0:1.0:0.0:0.0	.	166	O15049	N4BP3_HUMAN	E	166	ENSP00000274605:Q166E	ENSP00000274605:Q166E	Q	+	1	0	N4BP3	177479950	0.993000	0.37304	1.000000	0.80357	0.798000	0.45092	2.799000	0.47892	2.668000	0.90789	0.655000	0.94253	CAG	N4BP3	-	NULL		0.706	N4BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	N4BP3	HGNC	protein_coding	OTTHUMT00000373552.2	C	NM_015111		177547344	+1	no_errors	ENST00000274605	ensembl	human	known	70_37	missense	SNP	1.000	G
NCAM2	4685	genome.wustl.edu	37	21	22710717	22710717	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr21:22710717C>T	ENST00000400546.1	+	8	1156	c.907C>T	c.(907-909)Cac>Tac	p.H303Y	NCAM2_ENST00000535285.1_Missense_Mutation_p.H328Y|NCAM2_ENST00000284894.7_Missense_Mutation_p.H161Y	NM_004540.3	NP_004531.2	O15394	NCAM2_HUMAN	neural cell adhesion molecule 2	303	Ig-like C2-type 4.				axonal fasciculation (GO:0007413)|neuron cell-cell adhesion (GO:0007158)|sensory perception of smell (GO:0007608)	axon (GO:0030424)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(4)|cervix(2)|endometrium(8)|kidney(6)|large_intestine(22)|liver(4)|lung(49)|ovary(4)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	108		Lung NSC(9;0.195)		all cancers(11;0.00102)|OV - Ovarian serous cystadenocarcinoma(11;0.00121)|Epithelial(23;0.00147)|Colorectal(24;0.174)		AGTACAGCCTCACATAATACA	0.363																																																	0													53.0	52.0	53.0					21																	22710717		1840	4081	5921	SO:0001583	missense	4685				CCDS42910.1	21q21	2013-02-11			ENSG00000154654	ENSG00000154654		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7657	protein-coding gene	gene with protein product		602040				9226371	Standard	NM_004540		Approved	NCAM21, MGC51008	uc002yld.2	O15394	OTTHUMG00000078121	ENST00000400546.1:c.907C>T	21.37:g.22710717C>T	ENSP00000383392:p.His303Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MQ06|B7Z841|Q7Z7F2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like,prints_Neural_cell_adh	p.H303Y	ENST00000400546.1	37	c.907	CCDS42910.1	21	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106725	0.77096	.	.	ENSG00000154654	ENST00000400546;ENST00000284894;ENST00000535285	T;T;T	0.60040	0.22;0.32;1.34	5.8	5.8	0.92144	Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.042474	0.85682	D	0.000000	T	0.66317	0.2777	L	0.38692	1.165	0.54753	D	0.999987	D;P;P	0.59767	0.986;0.796;0.647	P;P;B	0.59357	0.856;0.674;0.322	T	0.67738	-0.5593	10	0.72032	D	0.01	-16.9086	18.6141	0.91296	0.0:1.0:0.0:0.0	.	328;161;303	B7Z841;B7Z5K2;O15394	.;.;NCAM2_HUMAN	Y	303;161;328	ENSP00000383392:H303Y;ENSP00000284894:H161Y;ENSP00000441887:H328Y	ENSP00000284894:H161Y	H	+	1	0	NCAM2	21632588	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.141000	0.58038	2.736000	0.93811	0.591000	0.81541	CAC	NCAM2	-	pfscan_Ig-like,prints_Neural_cell_adh		0.363	NCAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCAM2	HGNC	protein_coding	OTTHUMT00000170915.1	C	NM_004540		22710717	+1	no_errors	ENST00000400546	ensembl	human	known	70_37	missense	SNP	1.000	T
NHEJ1	79840	genome.wustl.edu	37	2	220025455	220025455	+	5'UTR	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:220025455G>C	ENST00000356853.5	-	0	120				NHEJ1_ENST00000409720.1_5'Flank	NM_024782.2	NP_079058.1	Q9H9Q4	NHEJ1_HUMAN	nonhomologous end-joining factor 1						B cell differentiation (GO:0030183)|central nervous system development (GO:0007417)|DNA recombination (GO:0006310)|double-strand break repair via nonhomologous end joining (GO:0006303)|positive regulation of ligase activity (GO:0051351)|response to ionizing radiation (GO:0010212)|T cell differentiation (GO:0030217)	nonhomologous end joining complex (GO:0070419)|nucleus (GO:0005634)	DNA binding (GO:0003677)			kidney(1)|large_intestine(3)|lung(5)|prostate(1)|skin(2)	12		Renal(207;0.0915)		Epithelial(149;2.15e-06)|all cancers(144;0.000339)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(261;0.0112)		CAGCGGCCGCGAGAGCGCCCA	0.672								Non-homologous end-joining																																									0																																										SO:0001623	5_prime_UTR_variant	79840			AJ972687	CCDS2432.1	2q35	2014-09-17			ENSG00000187736	ENSG00000187736			25737	protein-coding gene	gene with protein product		611290				16439204, 16439205	Standard	NM_024782		Approved	Cernunnos, XLF, FLJ12610	uc002vjp.4	Q9H9Q4	OTTHUMG00000133127	ENST00000356853.5:c.-14C>G	2.37:g.220025455G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZA4|Q4ZFW7|Q6IA64|Q96JS9	RNA	SNP	-	NULL	ENST00000356853.5	37	NULL	CCDS2432.1	2																																																																																			NHEJ1	-	-		0.672	NHEJ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NHEJ1	HGNC	protein_coding	OTTHUMT00000256817.2	G	NM_024782		220025455	-1	no_errors	ENST00000481764	ensembl	human	putative	70_37	rna	SNP	0.000	C
NKAPP1	158801	genome.wustl.edu	37	X	119370494	119370494	+	IGR	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:119370494G>C								RHOXF2 (72549 upstream) : NKAPP1 (3641 downstream)																							ctgtatttttgatctgcattt	0.413																																																	0																																										SO:0001628	intergenic_variant	158801																															X.37:g.119370494G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		X																																																																																			NKAPP1	-	-	0	0.413					NKAPP1	HGNC			G			119370494	-1	no_errors	ENST00000452254	ensembl	human	known	70_37	rna	SNP	0.001	C
NLGN2	57555	genome.wustl.edu	37	17	7318956	7318956	+	Silent	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:7318956C>G	ENST00000302926.2	+	6	1237	c.1164C>G	c.(1162-1164)ctC>ctG	p.L388L	NLGN2_ENST00000575301.1_Silent_p.L388L	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	388					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GAGAGGGCCTCAAGTTCGTGG	0.577																																																	0													212.0	167.0	182.0					17																	7318956		2203	4300	6503	SO:0001819	synonymous_variant	57555			AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1164C>G	17.37:g.7318956C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9P2I1	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L388	ENST00000302926.2	37	c.1164	CCDS11103.1	17																																																																																			NLGN2	-	pfam_CarbesteraseB		0.577	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN2	HGNC	protein_coding	OTTHUMT00000226941.2	C	NM_020795		7318956	+1	no_errors	ENST00000302926	ensembl	human	known	70_37	silent	SNP	1.000	G
NLGN2	57555	genome.wustl.edu	37	17	7318956	7318956	+	Silent	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:7318956C>G	ENST00000302926.2	+	6	1237	c.1164C>G	c.(1162-1164)ctC>ctG	p.L388L	NLGN2_ENST00000575301.1_Silent_p.L388L	NM_020795.2	NP_065846.1	Q8NFZ4	NLGN2_HUMAN	neuroligin 2	388					cell-cell junction maintenance (GO:0045217)|gephyrin clustering (GO:0097116)|locomotory exploration behavior (GO:0035641)|neuromuscular process controlling balance (GO:0050885)|neuron cell-cell adhesion (GO:0007158)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic density protein 95 clustering (GO:0097119)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|sensory perception of pain (GO:0019233)|single organismal cell-cell adhesion (GO:0016337)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|terminal button organization (GO:0072553)	cell junction (GO:0030054)|cell surface (GO:0009986)|inhibitory synapse (GO:0060077)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(3)|lung(7)|prostate(2)|skin(3)	22		Prostate(122;0.157)				GAGAGGGCCTCAAGTTCGTGG	0.577																																																	0													212.0	167.0	182.0					17																	7318956		2203	4300	6503	SO:0001819	synonymous_variant	57555			AB037787	CCDS11103.1	17p13.2	2008-07-18			ENSG00000169992	ENSG00000169992			14290	protein-coding gene	gene with protein product		606479				10767552, 10819331	Standard	NM_020795		Approved	KIAA1366	uc002ggt.1	Q8NFZ4	OTTHUMG00000108138	ENST00000302926.2:c.1164C>G	17.37:g.7318956C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9P2I1	Silent	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.L388	ENST00000302926.2	37	c.1164	CCDS11103.1	17																																																																																			NLGN2	-	pfam_CarbesteraseB		0.577	NLGN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN2	HGNC	protein_coding	OTTHUMT00000226941.2	C	NM_020795		7318956	+1	no_errors	ENST00000302926	ensembl	human	known	70_37	silent	SNP	1.000	G
NOL8	55035	genome.wustl.edu	37	9	95082610	95082610	+	5'UTR	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:95082610C>G	ENST00000543985.1	-	0	428				NOL8_ENST00000535387.1_Intron|NOL8_ENST00000442668.2_Intron|NOL8_ENST00000545558.1_Intron|NOL8_ENST00000358855.4_Intron|NOL8_ENST00000542053.1_Intron					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						ACTGTGTGCTCAACCTGCTCA	0.512																																																	0																																										SO:0001623	5_prime_UTR_variant	55035			AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000543985.1:c.-341G>C	9.37:g.95082610C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000543985.1	37	NULL		9																																																																																			NOL8	-	-		0.512	NOL8-024	KNOWN	NAGNAG_splice_site|basic	processed_transcript	NOL8	HGNC	protein_coding	OTTHUMT00000402695.1	C	NM_017948		95082610	-1	no_errors	ENST00000538215	ensembl	human	known	70_37	rna	SNP	0.000	G
NPIPA1	9284	genome.wustl.edu	37	16	15027080	15027080	+	3'UTR	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:15027080C>G	ENST00000472413.1	+	0	3746							Q9UND3	NPIA1_HUMAN	nuclear pore complex interacting protein family, member A1						mRNA transport (GO:0051028)|protein transport (GO:0015031)	nuclear pore (GO:0005643)											TCATCTGTCTCTTCCTGGGCG	0.612																																																	0																																										SO:0001624	3_prime_UTR_variant	9284			AC002045	CCDS10557.1	16p13.11	2013-06-11	2013-06-11	2013-06-11	ENSG00000183426	ENSG00000183426			7909	protein-coding gene	gene with protein product		606406	"""nuclear pore complex interacting protein"""	NPIP		11586358, 18055785	Standard	NM_006985		Approved	morpheus	uc002dcy.4	Q9UND3	OTTHUMG00000090663	ENST00000472413.1:c.*3743C>G	16.37:g.15027080C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O15102	RNA	SNP	-	NULL	ENST00000472413.1	37	NULL		16																																																																																			NPIP	-	-		0.612	NPIPA1-002	KNOWN	basic|readthrough_transcript	processed_transcript	NPIP	HGNC	protein_coding	OTTHUMT00000207327.1	C	NM_006985		15027080	+1	no_errors	ENST00000472413	ensembl	human	known	70_37	rna	SNP	1.000	G
NTNG1	22854	genome.wustl.edu	37	1	107973459	107973459	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:107973459G>C	ENST00000370068.1	+	6	2021	c.1175G>C	c.(1174-1176)aGa>aCa	p.R392T	NTNG1_ENST00000370074.4_Intron|NTNG1_ENST00000370071.2_Intron|NTNG1_ENST00000370066.1_Intron|NTNG1_ENST00000370072.3_Missense_Mutation_p.R392T|NTNG1_ENST00000370067.1_Intron|NTNG1_ENST00000370065.1_Missense_Mutation_p.R392T|NTNG1_ENST00000370073.2_Missense_Mutation_p.R392T|NTNG1_ENST00000370061.3_Intron|NTNG1_ENST00000370070.2_Intron|NTNG1_ENST00000542803.1_Missense_Mutation_p.R392T			Q9Y2I2	NTNG1_HUMAN	netrin G1	392	Laminin EGF-like 2. {ECO:0000255|PROSITE- ProRule:PRU00460}.				axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(8)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(3)|soft_tissue(1)|urinary_tract(1)	37		all_epithelial(167;1.39e-05)|all_lung(203;0.000115)|Lung NSC(277;0.000238)|Breast(1374;0.243)		Lung(183;0.0946)|BRCA - Breast invasive adenocarcinoma(282;0.237)|Epithelial(280;0.245)		CACAACACTAGAGGGCAGCAC	0.448																																																	0													121.0	105.0	110.0					1																	107973459		1568	3582	5150	SO:0001583	missense	22854			AB023193	CCDS30785.1, CCDS44179.1, CCDS44180.1	1p13.2-p13.1	2013-03-01			ENSG00000162631	ENSG00000162631		"""Netrins"""	23319	protein-coding gene	gene with protein product	"""netrin G1f"", ""Netrin-G1"""	608818				10964959	Standard	NM_001113226		Approved	KIAA0976, Lmnt1	uc001dvh.4	Q9Y2I2	OTTHUMG00000010965	ENST00000370068.1:c.1175G>C	1.37:g.107973459G>C	ENSP00000359085:p.Arg392Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VU86|Q5VU87|Q5VU89|Q5VU90|Q5VU91|Q7Z2Y3|Q8N633	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.R392T	ENST00000370068.1	37	c.1175	CCDS44180.1	1	.	.	.	.	.	.	.	.	.	.	G	16.88	3.243552	0.58995	.	.	ENSG00000162631	ENST00000370073;ENST00000542803;ENST00000370072;ENST00000370064;ENST00000370068;ENST00000370065	T;T;T;T;T	0.60299	0.2;0.2;0.2;0.2;0.2	5.58	5.58	0.84498	EGF-like, laminin (4);	0.000000	0.64402	D	0.000004	T	0.30070	0.0753	N	0.11870	0.19	0.80722	D	1	P	0.49185	0.92	P	0.47603	0.551	T	0.28933	-1.0028	10	0.05620	T	0.96	.	19.5721	0.95425	0.0:0.0:1.0:0.0	.	392	Q9Y2I2	NTNG1_HUMAN	T	392;392;392;195;392;392	ENSP00000359090:R392T;ENSP00000440561:R392T;ENSP00000359089:R392T;ENSP00000359085:R392T;ENSP00000359082:R392T	ENSP00000359081:R195T	R	+	2	0	NTNG1	107774982	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.860000	0.99555	2.630000	0.89119	0.655000	0.94253	AGA	NTNG1	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom		0.448	NTNG1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NTNG1	HGNC	protein_coding	OTTHUMT00000030340.1	G	NM_014917		107973459	+1	no_errors	ENST00000370068	ensembl	human	known	70_37	missense	SNP	1.000	C
OIP5-AS1	729082	genome.wustl.edu	37	15	41578239	41578239	+	RNA	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:41578239G>C	ENST00000500949.2	+	0	276					NR_026757.1				OIP5 antisense RNA 1																		AATTTTCCTTGACCTTTAGGT	0.333																																																	0																																												729082					15q15.1	2012-10-19	2012-08-15		ENSG00000247556	ENSG00000247556		"""Long non-coding RNAs"", ""-"""	43563	non-coding RNA	RNA, long non-coding			"""OIP5 antisense RNA 1 (non-protein coding)"""			22196729	Standard	NR_026757		Approved	cyrano	uc001znm.4		OTTHUMG00000172547		15.37:g.41578239G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000500949.2	37	NULL		15																																																																																			OIP5-AS1	-	-		0.333	OIP5-AS1-001	KNOWN	basic	lincRNA	OIP5-AS1	HGNC	processed_transcript	OTTHUMT00000419058.1	G	NR_026757		41578239	+1	no_errors	ENST00000500949	ensembl	human	known	70_37	rna	SNP	0.562	C
OPN1SW	611	genome.wustl.edu	37	7	128414648	128414648	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:128414648G>A	ENST00000249389.2	-	3	590	c.591C>T	c.(589-591)agC>agT	p.S197S		NM_001708.2	NP_001699.1	P03999	OPSB_HUMAN	opsin 1 (cone pigments), short-wave-sensitive	197					phototransduction (GO:0007602)|phototransduction, visible light (GO:0007603)|protein-chromophore linkage (GO:0018298)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|photoreceptor outer segment membrane (GO:0042622)	G-protein coupled receptor activity (GO:0004930)|photoreceptor activity (GO:0009881)|receptor activity (GO:0004872)			NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(10)|stomach(1)	19						TATAGGACTCGCTGCGGTATT	0.552																																																	0													141.0	115.0	124.0					7																	128414648		2203	4300	6503	SO:0001819	synonymous_variant	611			U53874	CCDS5806.1	7q31.3-q32	2013-01-08	2008-04-16		ENSG00000128617	ENSG00000128617		"""GPCR / Class A : Opsin receptors"""	1012	protein-coding gene	gene with protein product	"""color blindness, tritan"", ""blue-sensitive opsin"""	613522	"""blue cone photoreceptor pigment"""	BCP		2937147, 8270261	Standard	NM_001708		Approved	BOP, CBT	uc003vnt.4	P03999	OTTHUMG00000158311	ENST00000249389.2:c.591C>T	7.37:g.128414648G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13877	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_blue,prints_GPCR_Rhodpsn,prints_Opsin	p.S197	ENST00000249389.2	37	c.591	CCDS5806.1	7																																																																																			OPN1SW	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srw,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_Opsin_blue		0.552	OPN1SW-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPN1SW	HGNC	protein_coding	OTTHUMT00000350655.1	G	NM_001708		128414648	-1	no_errors	ENST00000249389	ensembl	human	known	70_37	silent	SNP	1.000	A
OR5L2	26338	genome.wustl.edu	37	11	55595315	55595315	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:55595315G>C	ENST00000378397.1	+	1	621	c.621G>C	c.(619-621)gaG>gaC	p.E207D		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E207D(1)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				CTTTGAATGAGAGTGTTACCA	0.473										HNSCC(27;0.073)																																							1	Substitution - Missense(1)	lung(1)											241.0	200.0	214.0					11																	55595315		2200	4294	6494	SO:0001583	missense	26338			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.621G>C	11.37:g.55595315G>C	ENSP00000367650:p.Glu207Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IF66|Q96RB2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E207D	ENST00000378397.1	37	c.621	CCDS31511.1	11	.	.	.	.	.	.	.	.	.	.	.	4.273	0.049739	0.08243	.	.	ENSG00000205030	ENST00000378397	T	0.36699	1.24	5.24	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000063	T	0.30572	0.0769	L	0.58583	1.82	0.09310	N	1	B	0.12630	0.006	B	0.26416	0.069	T	0.28364	-1.0046	10	0.13108	T	0.6	-23.005	7.3218	0.26531	0.1582:0.1398:0.7021:0.0	.	207	Q8NGL0	OR5L2_HUMAN	D	207	ENSP00000367650:E207D	ENSP00000367650:E207D	E	+	3	2	OR5L2	55351891	0.000000	0.05858	0.606000	0.28943	0.019000	0.09904	-0.413000	0.07123	0.718000	0.32166	0.632000	0.83419	GAG	OR5L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.473	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	G	NM_001004739		55595315	+1	no_errors	ENST00000378397	ensembl	human	known	70_37	missense	SNP	0.000	C
OR5L2	26338	genome.wustl.edu	37	11	55595315	55595315	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:55595315G>C	ENST00000378397.1	+	1	621	c.621G>C	c.(619-621)gaG>gaC	p.E207D		NM_001004739.1	NP_001004739.1	Q8NGL0	OR5L2_HUMAN	olfactory receptor, family 5, subfamily L, member 2	207						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E207D(1)		breast(2)|kidney(1)|large_intestine(1)|lung(42)|ovary(1)|prostate(3)|skin(1)|stomach(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	59		all_epithelial(135;0.208)				CTTTGAATGAGAGTGTTACCA	0.473										HNSCC(27;0.073)																																							1	Substitution - Missense(1)	lung(1)											241.0	200.0	214.0					11																	55595315		2200	4294	6494	SO:0001583	missense	26338			AB065782	CCDS31511.1	11q11	2012-08-09			ENSG00000205030	ENSG00000205030		"""GPCR / Class A : Olfactory receptors"""	8351	protein-coding gene	gene with protein product						1370859	Standard	NM_001004739		Approved	HTPCRX16, HSHTPCRX16	uc001nhy.1	Q8NGL0	OTTHUMG00000166812	ENST00000378397.1:c.621G>C	11.37:g.55595315G>C	ENSP00000367650:p.Glu207Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IF66|Q96RB2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E207D	ENST00000378397.1	37	c.621	CCDS31511.1	11	.	.	.	.	.	.	.	.	.	.	.	4.273	0.049739	0.08243	.	.	ENSG00000205030	ENST00000378397	T	0.36699	1.24	5.24	3.37	0.38596	GPCR, rhodopsin-like superfamily (1);	0.000000	0.52532	D	0.000063	T	0.30572	0.0769	L	0.58583	1.82	0.09310	N	1	B	0.12630	0.006	B	0.26416	0.069	T	0.28364	-1.0046	10	0.13108	T	0.6	-23.005	7.3218	0.26531	0.1582:0.1398:0.7021:0.0	.	207	Q8NGL0	OR5L2_HUMAN	D	207	ENSP00000367650:E207D	ENSP00000367650:E207D	E	+	3	2	OR5L2	55351891	0.000000	0.05858	0.606000	0.28943	0.019000	0.09904	-0.413000	0.07123	0.718000	0.32166	0.632000	0.83419	GAG	OR5L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.473	OR5L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5L2	HGNC	protein_coding	OTTHUMT00000391516.1	G	NM_001004739		55595315	+1	no_errors	ENST00000378397	ensembl	human	known	70_37	missense	SNP	0.000	C
OTOG	340990	genome.wustl.edu	37	11	17653749	17653749	+	Missense_Mutation	SNP	G	G	C	rs375080152		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:17653749G>C	ENST00000399391.2	+	41	7084	c.7084G>C	c.(7084-7086)Gag>Cag	p.E2362Q	OTOG_ENST00000342528.2_Missense_Mutation_p.E1368Q|OTOG_ENST00000399397.1_Missense_Mutation_p.E2289Q	NM_001277269.1	NP_001264198.1	Q6ZRI0	OTOG_HUMAN	otogelin	2362					adult locomotory behavior (GO:0008344)|L-arabinose metabolic process (GO:0046373)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	alpha-L-arabinofuranosidase activity (GO:0046556)|structural molecule activity (GO:0005198)			breast(3)|central_nervous_system(1)|lung(1)|skin(1)	6						TGTGTGCATCGAGTGGCGGCG	0.577																																																	0																																										SO:0001583	missense	340990			AK128214	CCDS59225.1	11p14.3	2014-07-17			ENSG00000188162	ENSG00000188162			8516	protein-coding gene	gene with protein product		604487				9405633	Standard	NM_001277269		Approved	mlemp, OTGN, FLJ46346	uc031pzc.1	Q6ZRI0	OTTHUMG00000149905	ENST00000399391.2:c.7084G>C	11.37:g.17653749G>C	ENSP00000382323:p.Glu2362Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTX6|A8MUJ0|B7WPC4	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_AbfB,pfam_TIL_dom,superfamily_AbfB,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_EG-like_dom	p.E2362Q	ENST00000399391.2	37	c.7084	CCDS59225.1	11	.	.	.	.	.	.	.	.	.	.	G	14.46	2.542503	0.45280	.	.	ENSG00000188162	ENST00000399391;ENST00000399397;ENST00000342528	D;D;D	0.86097	-2.07;-2.07;-2.07	5.81	3.96	0.45880	.	0.172251	0.39759	N	0.001263	D	0.82545	0.5060	N	0.25992	0.78	0.42714	D	0.993653	D	0.64830	0.994	P	0.56278	0.795	T	0.78846	-0.2043	10	0.27785	T	0.31	.	10.3072	0.43687	0.1544:0.0:0.8456:0.0	.	1368	Q6ZRI0-2	.	Q	2362;2289;1368	ENSP00000382323:E2362Q;ENSP00000382329:E2289Q;ENSP00000341666:E1368Q	ENSP00000341666:E1368Q	E	+	1	0	OTOG	17610325	0.997000	0.39634	0.991000	0.47740	0.967000	0.64934	2.433000	0.44793	0.817000	0.34445	0.591000	0.81541	GAG	OTOG	-	pfam_Unchr_dom_Cys-rich,smart_Unchr_dom_Cys-rich		0.577	OTOG-201	KNOWN	basic|appris_principal|CCDS	protein_coding	OTOG	HGNC	protein_coding		G			17653749	+1	no_errors	ENST00000399391	ensembl	human	known	70_37	missense	SNP	0.960	C
OR8D1	283159	genome.wustl.edu	37	11	124180213	124180213	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:124180213G>C	ENST00000357821.2	-	1	520	c.450C>G	c.(448-450)ttC>ttG	p.F150L		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GAAAGCCCAAGAAGAAGGCAG	0.468																																																	0													73.0	64.0	67.0					11																	124180213		2201	4299	6500	SO:0001583	missense	283159			AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.450C>G	11.37:g.124180213G>C	ENSP00000350474:p.Phe150Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F150L	ENST00000357821.2	37	c.450	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	g	4.551	0.102251	0.08731	.	.	ENSG00000196341	ENST00000357821	T	0.32023	1.47	4.29	-4.97	0.03029	GPCR, rhodopsin-like superfamily (1);	2.930740	0.03520	U	0.220828	T	0.07683	0.0193	N	0.00510	-1.415	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35351	-0.9792	10	0.08179	T	0.78	.	8.0261	0.30438	0.2154:0.4226:0.362:0.0	.	150	Q8WZ84	OR8D1_HUMAN	L	150	ENSP00000350474:F150L	ENSP00000350474:F150L	F	-	3	2	OR8D1	123685423	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.599000	0.02085	-0.502000	0.06596	-0.429000	0.05907	TTC	OR8D1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.468	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	HGNC	protein_coding	OTTHUMT00000387285.1	G	NM_001002917		124180213	-1	no_errors	ENST00000357821	ensembl	human	known	70_37	missense	SNP	0.000	C
OR8D1	283159	genome.wustl.edu	37	11	124180213	124180213	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:124180213G>C	ENST00000357821.2	-	1	520	c.450C>G	c.(448-450)ttC>ttG	p.F150L		NM_001002917.1	NP_001002917.1	Q8WZ84	OR8D1_HUMAN	olfactory receptor, family 8, subfamily D, member 1	150						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(1)|lung(7)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		Breast(109;0.0115)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;1.49e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0528)		GAAAGCCCAAGAAGAAGGCAG	0.468																																																	0													73.0	64.0	67.0					11																	124180213		2201	4299	6500	SO:0001583	missense	283159			AF238489	CCDS31706.1	11q25	2012-08-09			ENSG00000196341	ENSG00000196341		"""GPCR / Class A : Olfactory receptors"""	8481	protein-coding gene	gene with protein product				OR8D3			Standard	NM_001002917		Approved	OST004	uc010sag.2	Q8WZ84	OTTHUMG00000165977	ENST00000357821.2:c.450C>G	11.37:g.124180213G>C	ENSP00000350474:p.Phe150Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNL4|Q6IEW1|Q8NGH0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F150L	ENST00000357821.2	37	c.450	CCDS31706.1	11	.	.	.	.	.	.	.	.	.	.	g	4.551	0.102251	0.08731	.	.	ENSG00000196341	ENST00000357821	T	0.32023	1.47	4.29	-4.97	0.03029	GPCR, rhodopsin-like superfamily (1);	2.930740	0.03520	U	0.220828	T	0.07683	0.0193	N	0.00510	-1.415	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.35351	-0.9792	10	0.08179	T	0.78	.	8.0261	0.30438	0.2154:0.4226:0.362:0.0	.	150	Q8WZ84	OR8D1_HUMAN	L	150	ENSP00000350474:F150L	ENSP00000350474:F150L	F	-	3	2	OR8D1	123685423	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.599000	0.02085	-0.502000	0.06596	-0.429000	0.05907	TTC	OR8D1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.468	OR8D1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8D1	HGNC	protein_coding	OTTHUMT00000387285.1	G	NM_001002917		124180213	-1	no_errors	ENST00000357821	ensembl	human	known	70_37	missense	SNP	0.000	C
PCDHA8	56140	genome.wustl.edu	37	5	140221089	140221089	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:140221089G>A	ENST00000531613.1	+	1	183	c.183G>A	c.(181-183)ccG>ccA	p.P61P	PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA8_ENST00000378123.3_Silent_p.P61P|PCDHA7_ENST00000525929.1_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	61	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGCTGGTGCCGCGCCTGTTCC	0.642																																																	0													38.0	51.0	47.0					5																	140221089		2203	4296	6499	SO:0001819	synonymous_variant	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.183G>A	5.37:g.140221089G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGT7|O75281	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.P61	ENST00000531613.1	37	c.183	CCDS54919.1	5																																																																																			PCDHA8	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.642	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	G	NM_018911		140221089	+1	no_errors	ENST00000531613	ensembl	human	known	70_37	silent	SNP	0.088	A
PCP2	126006	genome.wustl.edu	37	19	7696640	7696640	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:7696640G>C	ENST00000311069.5	-	4	636	c.346C>G	c.(346-348)Cag>Gag	p.Q116E	CTD-3214H19.4_ENST00000595866.1_Intron|PET100_ENST00000594797.1_3'UTR|XAB2_ENST00000358368.4_5'Flank|CTD-3214H19.6_ENST00000601797.1_RNA|PCP2_ENST00000598935.1_Missense_Mutation_p.Q100E|XAB2_ENST00000534844.1_5'Flank	NM_174895.1	NP_777555.1	Q8IVA1	PCP2_HUMAN	Purkinje cell protein 2	116					rhodopsin mediated signaling pathway (GO:0016056)	neuronal cell body (GO:0043025)	GTPase regulator activity (GO:0030695)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|urinary_tract(1)	2						GTCGGGTCCTGAGGGGTGAGC	0.682																																																	0													50.0	49.0	49.0					19																	7696640		2202	4295	6497	SO:0001583	missense	126006			BC025387	CCDS32893.1, CCDS62521.1	19p13.3	2008-02-05				ENSG00000174788			30209	protein-coding gene	gene with protein product						12477932	Standard	NM_174895		Approved	MGC41903, GPSM4	uc031rjd.1	Q8IVA1		ENST00000311069.5:c.346C>G	19.37:g.7696640G>C	ENSP00000310585:p.Gln116Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	M0R2R7|Q3KRG7	Missense_Mutation	SNP	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif	p.Q116E	ENST00000311069.5	37	c.346	CCDS32893.1	19	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480167	0.63849	.	.	ENSG00000174788	ENST00000311069	.	.	.	4.63	3.51	0.40186	.	0.555420	0.15193	N	0.275462	T	0.21267	0.0512	N	0.24115	0.695	0.27690	N	0.946159	P	0.42409	0.779	B	0.34873	0.191	T	0.08391	-1.0724	9	0.51188	T	0.08	-5.5542	9.1759	0.37112	0.0:0.0:0.7833:0.2167	.	116	Q8IVA1	PCP2_HUMAN	E	116	.	ENSP00000310585:Q116E	Q	-	1	0	PCP2	7602640	0.996000	0.38824	0.992000	0.48379	0.902000	0.53008	3.621000	0.54210	2.127000	0.65507	0.561000	0.74099	CAG	PCP2	-	NULL		0.682	PCP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCP2	HGNC	protein_coding	OTTHUMT00000461026.2	G	XM_058956		7696640	-1	no_errors	ENST00000311069	ensembl	human	known	70_37	missense	SNP	0.959	C
PCP2	126006	genome.wustl.edu	37	19	7696640	7696640	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:7696640G>C	ENST00000311069.5	-	4	636	c.346C>G	c.(346-348)Cag>Gag	p.Q116E	CTD-3214H19.4_ENST00000595866.1_Intron|PET100_ENST00000594797.1_3'UTR|XAB2_ENST00000358368.4_5'Flank|CTD-3214H19.6_ENST00000601797.1_RNA|PCP2_ENST00000598935.1_Missense_Mutation_p.Q100E|XAB2_ENST00000534844.1_5'Flank	NM_174895.1	NP_777555.1	Q8IVA1	PCP2_HUMAN	Purkinje cell protein 2	116					rhodopsin mediated signaling pathway (GO:0016056)	neuronal cell body (GO:0043025)	GTPase regulator activity (GO:0030695)|guanyl-nucleotide exchange factor activity (GO:0005085)			endometrium(1)|urinary_tract(1)	2						GTCGGGTCCTGAGGGGTGAGC	0.682																																																	0													50.0	49.0	49.0					19																	7696640		2202	4295	6497	SO:0001583	missense	126006			BC025387	CCDS32893.1, CCDS62521.1	19p13.3	2008-02-05				ENSG00000174788			30209	protein-coding gene	gene with protein product						12477932	Standard	NM_174895		Approved	MGC41903, GPSM4	uc031rjd.1	Q8IVA1		ENST00000311069.5:c.346C>G	19.37:g.7696640G>C	ENSP00000310585:p.Gln116Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	M0R2R7|Q3KRG7	Missense_Mutation	SNP	pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif	p.Q116E	ENST00000311069.5	37	c.346	CCDS32893.1	19	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480167	0.63849	.	.	ENSG00000174788	ENST00000311069	.	.	.	4.63	3.51	0.40186	.	0.555420	0.15193	N	0.275462	T	0.21267	0.0512	N	0.24115	0.695	0.27690	N	0.946159	P	0.42409	0.779	B	0.34873	0.191	T	0.08391	-1.0724	9	0.51188	T	0.08	-5.5542	9.1759	0.37112	0.0:0.0:0.7833:0.2167	.	116	Q8IVA1	PCP2_HUMAN	E	116	.	ENSP00000310585:Q116E	Q	-	1	0	PCP2	7602640	0.996000	0.38824	0.992000	0.48379	0.902000	0.53008	3.621000	0.54210	2.127000	0.65507	0.561000	0.74099	CAG	PCP2	-	NULL		0.682	PCP2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCP2	HGNC	protein_coding	OTTHUMT00000461026.2	G	XM_058956		7696640	-1	no_errors	ENST00000311069	ensembl	human	known	70_37	missense	SNP	0.959	C
PDE5A	8654	genome.wustl.edu	37	4	120446713	120446713	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:120446713C>G	ENST00000354960.3	-	12	2089	c.1770G>C	c.(1768-1770)atG>atC	p.M590I	PDE5A_ENST00000264805.5_Missense_Mutation_p.M548I|PDE5A_ENST00000512739.1_5'UTR|RP11-33B1.1_ENST00000498873.1_RNA|PDE5A_ENST00000394439.1_Missense_Mutation_p.M538I	NM_001083.3	NP_001074.2	O76074	PDE5A_HUMAN	phosphodiesterase 5A, cGMP-specific	590	Catalytic. {ECO:0000250}.				blood coagulation (GO:0007596)|cGMP catabolic process (GO:0046069)|negative regulation of cardiac muscle contraction (GO:0055118)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of cardiac muscle hypertrophy (GO:0010613)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of oocyte development (GO:0060282)|relaxation of cardiac muscle (GO:0055119)|signal transduction (GO:0007165)	cytosol (GO:0005829)	3',5'-cyclic-GMP phosphodiesterase activity (GO:0047555)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cGMP binding (GO:0030553)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|kidney(3)|large_intestine(8)|lung(7)|prostate(1)|skin(1)|urinary_tract(1)	27					Avanafil(DB06237)|Caffeine(DB00201)|Dipyridamole(DB00975)|Pentoxifylline(DB00806)|Sildenafil(DB00203)|Tadalafil(DB00820)|Theophylline(DB00277)|Udenafil(DB06267)|Vardenafil(DB00862)	CCTCATGTTTCATCTGGAAGT	0.403																																																	0													101.0	95.0	97.0					4																	120446713		2203	4300	6503	SO:0001583	missense	8654			D89094	CCDS3713.1, CCDS34055.1	4q27	2008-05-15			ENSG00000138735	ENSG00000138735	3.1.4.17	"""Phosphodiesterases"""	8784	protein-coding gene	gene with protein product		603310				9714779, 9642111	Standard	NM_033437		Approved		uc003idh.3	O76074	OTTHUMG00000132971	ENST00000354960.3:c.1770G>C	4.37:g.120446713C>G	ENSP00000347046:p.Met590Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV69|A8K2C4|O75026|O75887|Q86UI0|Q86V66|Q9Y6Z6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_GAF,smart_GAF,smart_HD/PDEase_dom,prints_PDEase	p.M590I	ENST00000354960.3	37	c.1770	CCDS3713.1	4	.	.	.	.	.	.	.	.	.	.	C	4.261	0.047554	0.08243	.	.	ENSG00000138735	ENST00000354960;ENST00000394439;ENST00000264805	T;T;T	0.40225	1.04;1.04;1.04	5.06	5.06	0.68205	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.075391	0.85682	D	0.000000	T	0.16769	0.0403	N	0.01202	-0.96	0.54753	D	0.999987	B;B	0.10296	0.001;0.003	B;B	0.08055	0.002;0.003	T	0.26883	-1.0090	10	0.02654	T	1	.	18.4311	0.90625	0.0:1.0:0.0:0.0	.	590;548	O76074;O76074-2	PDE5A_HUMAN;.	I	590;538;548	ENSP00000347046:M590I;ENSP00000377957:M538I;ENSP00000264805:M548I	ENSP00000264805:M548I	M	-	3	0	PDE5A	120666161	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.943000	0.63554	2.352000	0.79861	0.655000	0.94253	ATG	PDE5A	-	NULL		0.403	PDE5A-001	KNOWN	basic|CCDS	protein_coding	PDE5A	HGNC	protein_coding	OTTHUMT00000256529.1	C	NM_001083		120446713	-1	no_errors	ENST00000354960	ensembl	human	known	70_37	missense	SNP	1.000	G
PDK1	5163	genome.wustl.edu	37	2	173429744	173429744	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:173429744C>G	ENST00000282077.3	+	5	816	c.634C>G	c.(634-636)Cat>Gat	p.H212D	PDK1_ENST00000544863.1_Missense_Mutation_p.H57D|PDK1_ENST00000410055.1_Missense_Mutation_p.H212D|PDK1_ENST00000543905.1_Missense_Mutation_p.H136D|PDK1_ENST00000392571.2_Missense_Mutation_p.H232D			Q15118	PDK1_HUMAN	pyruvate dehydrogenase kinase, isozyme 1	212	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cell proliferation (GO:0008283)|cellular metabolic process (GO:0044237)|glucose metabolic process (GO:0006006)|hypoxia-inducible factor-1alpha signaling pathway (GO:0097411)|intrinsic apoptotic signaling pathway in response to oxidative stress (GO:0008631)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of glucose metabolic process (GO:0010906)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(2)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|prostate(1)	16			OV - Ovarian serous cystadenocarcinoma(117;0.12)			AAGTCCATCTCATCGAAAACA	0.328									Autosomal Dominant Polycystic Kidney Disease																																								0													169.0	151.0	158.0					2																	173429744		2203	4300	6503	SO:0001583	missense	5163	Familial Cancer Database	ADPKD	L42450	CCDS2250.1, CCDS63059.1	2q31.1	2008-05-23	2005-11-16		ENSG00000152256	ENSG00000152256			8809	protein-coding gene	gene with protein product		602524	"""pyruvate dehydrogenase kinase, isoenzyme 1"""			7499431	Standard	NR_103731		Approved		uc002uhs.3	Q15118	OTTHUMG00000132285	ENST00000282077.3:c.634C>G	2.37:g.173429744C>G	ENSP00000282077:p.His212Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6T1|B7Z937|D3DPD8|E9PD65|Q308M4	Nonsense_Mutation	SNP	pfam_BCDHK/PDK_N,superfamily_BCDHK/PDK_N	p.S150*	ENST00000282077.3	37	c.449	CCDS2250.1	2	.	.	.	.	.	.	.	.	.	.	C	26.4	4.730186	0.89390	.	.	ENSG00000152256	ENST00000443353;ENST00000543905;ENST00000544863;ENST00000282077;ENST00000392571;ENST00000410055;ENST00000416991;ENST00000439519	T;T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53;1.53	6.07	6.07	0.98685	Branched-chain alpha-ketoacid dehydrogenase kinase/Pyruvate dehydrogenase kinase, N-terminal (2);	0.083830	0.85682	D	0.000000	T	0.52158	0.1717	M	0.64567	1.98	0.80722	D	1	B;P	0.39157	0.095;0.662	P;P	0.53035	0.451;0.716	T	0.36261	-0.9755	10	0.54805	T	0.06	-15.5893	20.6439	0.99570	0.0:1.0:0.0:0.0	.	212;232	Q15118;E9PD65	PDK1_HUMAN;.	D	136;136;57;212;232;212;130;136	ENSP00000399558:H136D;ENSP00000438567:H136D;ENSP00000437502:H57D;ENSP00000282077:H212D;ENSP00000376352:H232D;ENSP00000386985:H212D;ENSP00000399160:H130D;ENSP00000388366:H136D	ENSP00000282077:H212D	H	+	1	0	PDK1	173137990	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	6.050000	0.71063	2.890000	0.99128	0.650000	0.86243	CAT	PDK1	-	NULL		0.328	PDK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK1	HGNC	protein_coding	OTTHUMT00000255380.3	C	NM_002610		173429744	+1	no_errors	ENST00000431718	ensembl	human	known	70_37	nonsense	SNP	1.000	G
PGAM1	5223	genome.wustl.edu	37	10	99190814	99190814	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:99190814C>T	ENST00000334828.5	+	3	665	c.517C>T	c.(517-519)Ccc>Tcc	p.P173S	PGAM1_ENST00000467867.1_3'UTR	NM_002629.2	NP_002620.1	P18669	PGAM1_HUMAN	phosphoglycerate mutase 1 (brain)	173					carbohydrate metabolic process (GO:0005975)|gluconeogenesis (GO:0006094)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|regulation of glycolytic process (GO:0006110)|regulation of pentose-phosphate shunt (GO:0043456)|respiratory burst (GO:0045730)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	bisphosphoglycerate 2-phosphatase activity (GO:0004083)|bisphosphoglycerate mutase activity (GO:0004082)|phosphoglycerate mutase activity (GO:0004619)|protein kinase binding (GO:0019901)			endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6		Colorectal(252;0.162)		Epithelial(162;8.36e-10)|all cancers(201;5.62e-08)		AGAAATAGTTCCCCAGATCAA	0.507																																																	0													56.0	57.0	56.0					10																	99190814		2202	4281	6483	SO:0001583	missense	5223			BC010038	CCDS7458.1	10q25.3	2012-10-02			ENSG00000171314	ENSG00000171314	5.4.2.1		8888	protein-coding gene	gene with protein product	"""Phosphoglycerate mutase A, nonmuscle form"""	172250		PGAMA		2846553	Standard	NM_002629		Approved	PGAM-B	uc001knh.3	P18669	OTTHUMG00000018846	ENST00000334828.5:c.517C>T	10.37:g.99190814C>T	ENSP00000359991:p.Pro173Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BWC0	Missense_Mutation	SNP	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1	p.P173S	ENST00000334828.5	37	c.517	CCDS7458.1	10	.	.	.	.	.	.	.	.	.	.	C	33	5.234333	0.95207	.	.	ENSG00000171314	ENST00000334828;ENST00000425387	T	0.80304	-1.36	4.92	4.92	0.64577	Histidine phosphatase superfamily, clade-1 (2);	0.000000	0.85682	D	0.000000	D	0.91543	0.7329	M	0.91090	3.175	0.80722	D	1	D;D	0.60160	0.987;0.987	P;D	0.66196	0.888;0.942	D	0.93493	0.6837	10	0.87932	D	0	-28.0927	18.4685	0.90765	0.0:1.0:0.0:0.0	.	158;173	B4DKL5;P18669	.;PGAM1_HUMAN	S	173;63	ENSP00000359991:P173S	ENSP00000359991:P173S	P	+	1	0	PGAM1	99180804	1.000000	0.71417	0.999000	0.59377	0.995000	0.86356	7.713000	0.84693	2.438000	0.82558	0.561000	0.74099	CCC	PGAM1	-	pfam_His_Pase_superF_clade-1,smart_His_Pase_superF_clade-1,tigrfam_Phosphogly_mut1		0.507	PGAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PGAM1	HGNC	protein_coding	OTTHUMT00000049652.1	C	NM_002629		99190814	+1	no_errors	ENST00000334828	ensembl	human	known	70_37	missense	SNP	1.000	T
LZTS2	84445	genome.wustl.edu	37	10	102770465	102770465	+	IGR	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:102770465G>T	ENST00000370220.1	+	0	5741									leucine zipper, putative tumor suppressor 2											breast(1)|large_intestine(6)|lung(7)|ovary(4)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22				Epithelial(162;7.3e-09)|all cancers(201;3.72e-07)		CAATTCGGAGGGGGGTGAAGG	0.677																																					Esophageal Squamous(8;38 437 13604 19902 37640)												0																																										SO:0001628	intergenic_variant	79955			AB058716	CCDS7507.1	10q24	2004-03-18			ENSG00000107816	ENSG00000107816			29381	protein-coding gene	gene with protein product		610454				11347906, 11709705	Standard	NM_032429		Approved	KIAA1813, LAPSER1	uc001ksj.3	Q9BRK4	OTTHUMG00000018914		10.37:g.102770465G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000370220.1	37	NULL	CCDS7507.1	10																																																																																			PDZD7	-	-		0.677	LZTS2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PDZD7	HGNC	protein_coding	OTTHUMT00000049872.1	G	XM_046743		102770465	-1	no_errors	ENST00000474125	ensembl	human	known	70_37	rna	SNP	0.000	T
PGBD1	84547	genome.wustl.edu	37	6	28269414	28269414	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:28269414G>C	ENST00000405948.2	+	7	2203	c.1783G>C	c.(1783-1785)Gat>Cat	p.D595H	PGBD1_ENST00000259883.3_Missense_Mutation_p.D595H	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	595						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						TATGAAGGTAGATGAGGATCC	0.398																																																	0													128.0	126.0	127.0					6																	28269414		2203	4300	6503	SO:0001583	missense	84547			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1783G>C	6.37:g.28269414G>C	ENSP00000385213:p.Asp595His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,pfscan_Srcr_rcpt,pfscan_Tscrpt_reg_SCAN	p.D595H	ENST00000405948.2	37	c.1783	CCDS4648.1	6	.	.	.	.	.	.	.	.	.	.	G	8.170	0.791465	0.16258	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.17854	2.25;2.25	4.66	2.78	0.32641	.	1.188200	0.06432	N	0.724309	T	0.04907	0.0132	N	0.21448	0.665	0.09310	N	1	B	0.26318	0.146	B	0.32762	0.152	T	0.46735	-0.9170	10	0.40728	T	0.16	-7.4637	7.4177	0.27055	0.0:0.1748:0.6147:0.2106	.	595	Q96JS3	PGBD1_HUMAN	H	595	ENSP00000385213:D595H;ENSP00000259883:D595H	ENSP00000259883:D595H	D	+	1	0	PGBD1	28377393	0.008000	0.16893	0.239000	0.24122	0.141000	0.21300	0.794000	0.26958	0.619000	0.30197	-0.274000	0.10170	GAT	PGBD1	-	NULL		0.398	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PGBD1	HGNC	protein_coding	OTTHUMT00000040188.2	G			28269414	+1	no_errors	ENST00000259883	ensembl	human	known	70_37	missense	SNP	0.177	C
PGBD1	84547	genome.wustl.edu	37	6	28269414	28269414	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:28269414G>C	ENST00000405948.2	+	7	2203	c.1783G>C	c.(1783-1785)Gat>Cat	p.D595H	PGBD1_ENST00000259883.3_Missense_Mutation_p.D595H	NM_001184743.1|NM_032507.3	NP_001171672.1|NP_115896.1	Q96JS3	PGBD1_HUMAN	piggyBac transposable element derived 1	595						membrane (GO:0016020)|nucleus (GO:0005634)	scavenger receptor activity (GO:0005044)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(2)|kidney(2)|large_intestine(7)|lung(16)|ovary(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	41						TATGAAGGTAGATGAGGATCC	0.398																																																	0													128.0	126.0	127.0					6																	28269414		2203	4300	6503	SO:0001583	missense	84547			D88259	CCDS4648.1	6p22.1	2013-01-09			ENSG00000137338	ENSG00000137338		"""-"""	19398	protein-coding gene	gene with protein product							Standard	NM_001184743		Approved	HUCEP-4, dJ874C20.4, SCAND4	uc003nkz.3	Q96JS3	OTTHUMG00000014520	ENST00000405948.2:c.1783G>C	6.37:g.28269414G>C	ENSP00000385213:p.Asp595His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53F43|Q6NTF5|Q8WWS4	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,pfscan_Srcr_rcpt,pfscan_Tscrpt_reg_SCAN	p.D595H	ENST00000405948.2	37	c.1783	CCDS4648.1	6	.	.	.	.	.	.	.	.	.	.	G	8.170	0.791465	0.16258	.	.	ENSG00000137338	ENST00000405948;ENST00000259883	T;T	0.17854	2.25;2.25	4.66	2.78	0.32641	.	1.188200	0.06432	N	0.724309	T	0.04907	0.0132	N	0.21448	0.665	0.09310	N	1	B	0.26318	0.146	B	0.32762	0.152	T	0.46735	-0.9170	10	0.40728	T	0.16	-7.4637	7.4177	0.27055	0.0:0.1748:0.6147:0.2106	.	595	Q96JS3	PGBD1_HUMAN	H	595	ENSP00000385213:D595H;ENSP00000259883:D595H	ENSP00000259883:D595H	D	+	1	0	PGBD1	28377393	0.008000	0.16893	0.239000	0.24122	0.141000	0.21300	0.794000	0.26958	0.619000	0.30197	-0.274000	0.10170	GAT	PGBD1	-	NULL		0.398	PGBD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PGBD1	HGNC	protein_coding	OTTHUMT00000040188.2	G			28269414	+1	no_errors	ENST00000259883	ensembl	human	known	70_37	missense	SNP	0.177	C
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	C	rs104886003		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:178936091G>C	ENST00000263967.3	+	10	1790	c.1633G>C	c.(1633-1635)Gag>Cag	p.E545Q		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>C	3.37:g.178936091G>C	ENSP00000263967:p.Glu545Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545Q	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	26.9	4.784998	0.90282	.	.	ENSG00000121879	ENST00000263967	T	0.63913	-0.07	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.71247	0.3317	L	0.55990	1.75	0.80722	D	1	D	0.53312	0.959	P	0.53760	0.734	T	0.69709	-0.5072	10	0.45353	T	0.12	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	Q	545	ENSP00000263967:E545Q	ENSP00000263967:E545Q	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	C
PIK3CA	5290	genome.wustl.edu	37	3	178937410	178937410	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:178937410G>A	ENST00000263967.3	+	12	1955	c.1798G>A	c.(1798-1800)Gaa>Aaa	p.E600K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	600	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)			NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	ACAGGCTATGGAACTTCTGGA	0.363		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	0													53.0	50.0	51.0					3																	178937410		1812	4065	5877	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1798G>A	3.37:g.178937410G>A	ENSP00000263967:p.Glu600Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E600K	ENST00000263967.3	37	c.1798	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	35	5.595217	0.96602	.	.	ENSG00000121879	ENST00000263967	T	0.70399	-0.48	5.97	5.97	0.96955	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.80623	0.4658	M	0.84773	2.715	0.80722	D	1	P	0.48834	0.916	P	0.46825	0.528	D	0.83422	0.0033	10	0.72032	D	0.01	6.8752	20.4324	0.99085	0.0:0.0:1.0:0.0	.	600	P42336	PK3CA_HUMAN	K	600	ENSP00000263967:E600K	ENSP00000263967:E600K	E	+	1	0	PIK3CA	180420104	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.476000	0.97823	2.833000	0.97629	0.585000	0.79938	GAA	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.363	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178937410	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PIKFYVE	200576	genome.wustl.edu	37	2	209192951	209192951	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:209192951C>T	ENST00000264380.4	+	21	3824	c.3666C>T	c.(3664-3666)ttC>ttT	p.F1222F		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1222					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GTGTGCTCTTCAGCAGCTCTT	0.473																																																	0													235.0	196.0	209.0					2																	209192951		2203	4300	6503	SO:0001819	synonymous_variant	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.3666C>T	2.37:g.209192951C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.F1222	ENST00000264380.4	37	c.3666	CCDS2382.1	2																																																																																			PIKFYVE	-	NULL		0.473	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	C	NM_015040		209192951	+1	no_errors	ENST00000264380	ensembl	human	known	70_37	silent	SNP	1.000	T
PIKFYVE	200576	genome.wustl.edu	37	2	209192951	209192951	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:209192951C>T	ENST00000264380.4	+	21	3824	c.3666C>T	c.(3664-3666)ttC>ttT	p.F1222F		NM_015040.3	NP_055855.2	Q9Y2I7	FYV1_HUMAN	phosphoinositide kinase, FYVE finger containing	1222					cellular protein metabolic process (GO:0044267)|intracellular signal transduction (GO:0035556)|myelin assembly (GO:0032288)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|protein localization to nucleus (GO:0034504)|retrograde transport, endosome to Golgi (GO:0042147)|small molecule metabolic process (GO:0044281)	cell-cell junction (GO:0005911)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)|membrane raft (GO:0045121)|perinuclear region of cytoplasm (GO:0048471)|vesicle membrane (GO:0012506)	1-phosphatidylinositol-3-phosphate 5-kinase activity (GO:0000285)|1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|ATP binding (GO:0005524)|phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(14)|kidney(6)|large_intestine(25)|lung(40)|ovary(7)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	107						GTGTGCTCTTCAGCAGCTCTT	0.473																																																	0													235.0	196.0	209.0					2																	209192951		2203	4300	6503	SO:0001819	synonymous_variant	200576			AB023198	CCDS2382.1, CCDS33368.1, CCDS54431.1	2q34	2014-01-15	2009-04-17	2009-04-17	ENSG00000115020	ENSG00000115020		"""Zinc fingers, FYVE domain containing"""	23785	protein-coding gene	gene with protein product	"""zinc finger, FYVE domain containing 29"""	609414	"""phosphatidylinositol-3-phosphate/phosphatidylinositol 5-kinase, type III"""	PIP5K3		9858586, 12270933	Standard	NM_015040		Approved	MGC40423, KIAA0981, PIKfyve, PIP5K, p235, ZFYVE29, FAB1	uc002vcz.3	Q9Y2I7	OTTHUMG00000132945	ENST00000264380.4:c.3666C>T	2.37:g.209192951C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AR7|Q08AR8|Q53ST3|Q53T36|Q8N5H0|Q8NB67	Silent	SNP	pfam_PInositol-4-P-5-kinase_core,pfam_Cpn60/TCP-1,pfam_DEP_dom,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,smart_DEP_dom,smart_PInositol-4P-5-kinase_core_sub,pfscan_DEP_dom,pfscan_Znf_FYVE-rel	p.F1222	ENST00000264380.4	37	c.3666	CCDS2382.1	2																																																																																			PIKFYVE	-	NULL		0.473	PIKFYVE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIKFYVE	HGNC	protein_coding	OTTHUMT00000256477.2	C	NM_015040		209192951	+1	no_errors	ENST00000264380	ensembl	human	known	70_37	silent	SNP	1.000	T
PKP2	5318	genome.wustl.edu	37	12	32975436	32975436	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:32975436C>G	ENST00000070846.6	-	9	1960	c.1936G>C	c.(1936-1938)Gga>Cga	p.G646R	PKP2_ENST00000340811.4_Missense_Mutation_p.G602R	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	646					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CCAAAACATCCAATACTTTTG	0.403																																																	0													130.0	122.0	125.0					12																	32975436		2203	4300	6503	SO:0001583	missense	5318			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1936G>C	12.37:g.32975436C>G	ENSP00000070846:p.Gly646Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.G646R	ENST00000070846.6	37	c.1936	CCDS8731.1	12	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107215	0.77096	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	T;T	0.47177	0.85;0.85	5.05	5.05	0.67936	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72463	0.3463	M	0.85777	2.775	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.78086	-0.2341	10	0.87932	D	0	-0.1402	16.6153	0.84909	0.0:1.0:0.0:0.0	.	602;602;646	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	R	602;646;646	ENSP00000342800:G602R;ENSP00000070846:G646R	ENSP00000070846:G646R	G	-	1	0	PKP2	32866703	0.998000	0.40836	0.996000	0.52242	0.835000	0.47333	4.233000	0.58651	2.328000	0.79073	0.563000	0.77884	GGA	PKP2	-	superfamily_ARM-type_fold		0.403	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1	C	NM_004572		32975436	-1	no_errors	ENST00000070846	ensembl	human	known	70_37	missense	SNP	1.000	G
PKP2	5318	genome.wustl.edu	37	12	32975436	32975436	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:32975436C>G	ENST00000070846.6	-	9	1960	c.1936G>C	c.(1936-1938)Gga>Cga	p.G646R	PKP2_ENST00000340811.4_Missense_Mutation_p.G602R	NM_004572.3	NP_004563.2	Q99959	PKP2_HUMAN	plakophilin 2	646					adherens junction maintenance (GO:0034334)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cardiac muscle cell action potential (GO:0086001)|cardiac muscle cell action potential involved in contraction (GO:0086002)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cell-cell signaling involved in cardiac conduction (GO:0086019)|desmosome assembly (GO:0002159)|gap junction assembly (GO:0016264)|heart development (GO:0007507)|intermediate filament bundle assembly (GO:0045110)|lipid homeostasis (GO:0055088)|maintenance of organ identity (GO:0048496)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|positive regulation of sodium ion transport (GO:0010765)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of tight junction assembly (GO:2000810)|single organismal cell-cell adhesion (GO:0016337)|ventricular cardiac muscle cell action potential (GO:0086005)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	adherens junction (GO:0005912)|cell junction (GO:0030054)|cell-cell junction (GO:0005911)|desmosome (GO:0030057)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|protein kinase C binding (GO:0005080)|sodium channel regulator activity (GO:0017080)			NS(1)|breast(2)|endometrium(1)|kidney(9)|large_intestine(8)|lung(21)|ovary(1)|pancreas(2)|prostate(2)|skin(2)|urinary_tract(1)	50	Lung NSC(5;9.35e-07)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.239)					CCAAAACATCCAATACTTTTG	0.403																																																	0													130.0	122.0	125.0					12																	32975436		2203	4300	6503	SO:0001583	missense	5318			X97675	CCDS8731.1, CCDS31771.1	12p11	2014-09-17				ENSG00000057294		"""Armadillo repeat containing"""	9024	protein-coding gene	gene with protein product		602861				8922383	Standard	NM_001005242		Approved		uc001rlj.4	Q99959	OTTHUMG00000169500	ENST00000070846.6:c.1936G>C	12.37:g.32975436C>G	ENSP00000070846:p.Gly646Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AV37|B8QFA1|B8QGS6|B8QGS7|D3DUW9|Q4VC01|Q99960	Missense_Mutation	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.G646R	ENST00000070846.6	37	c.1936	CCDS8731.1	12	.	.	.	.	.	.	.	.	.	.	C	21.2	4.107215	0.77096	.	.	ENSG00000057294	ENST00000340811;ENST00000070846;ENST00000537278	T;T	0.47177	0.85;0.85	5.05	5.05	0.67936	Armadillo-like helical (1);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.72463	0.3463	M	0.85777	2.775	0.58432	D	0.999993	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.998;0.997	T	0.78086	-0.2341	10	0.87932	D	0	-0.1402	16.6153	0.84909	0.0:1.0:0.0:0.0	.	602;602;646	Q99959-2;A0AV37;Q99959	.;.;PKP2_HUMAN	R	602;646;646	ENSP00000342800:G602R;ENSP00000070846:G646R	ENSP00000070846:G646R	G	-	1	0	PKP2	32866703	0.998000	0.40836	0.996000	0.52242	0.835000	0.47333	4.233000	0.58651	2.328000	0.79073	0.563000	0.77884	GGA	PKP2	-	superfamily_ARM-type_fold		0.403	PKP2-002	KNOWN	basic|CCDS	protein_coding	PKP2	HGNC	protein_coding	OTTHUMT00000404449.1	C	NM_004572		32975436	-1	no_errors	ENST00000070846	ensembl	human	known	70_37	missense	SNP	1.000	G
PLCG2	5336	genome.wustl.edu	37	16	81892744	81892744	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:81892744C>G	ENST00000359376.3	+	5	669	c.455C>G	c.(454-456)tCt>tGt	p.S152C	PLCG2_ENST00000565400.1_3'UTR	NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	152					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						CAGATATATTCTGTGGATCAA	0.373																																																	0													98.0	102.0	100.0					16																	81892744		1825	4087	5912	SO:0001583	missense	5336				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.455C>G	16.37:g.81892744C>G	ENSP00000352336:p.Ser152Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_Ca-dep,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pirsf_PLC-gamma,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain	p.S152C	ENST00000359376.3	37	c.455	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935215	0.92458	.	.	ENSG00000197943	ENST00000359376	T	0.68025	-0.3	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.78033	0.4220	M	0.66939	2.045	0.80722	D	1	D;D	0.64830	0.97;0.994	P;P	0.57371	0.664;0.819	T	0.80256	-0.1458	10	0.72032	D	0.01	.	18.1102	0.89533	0.0:1.0:0.0:0.0	.	19;152	B4E3H3;P16885	.;PLCG2_HUMAN	C	152	ENSP00000352336:S152C	ENSP00000352336:S152C	S	+	2	0	PLCG2	80450245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.752000	0.74898	2.559000	0.86315	0.650000	0.86243	TCT	PLCG2	-	pirsf_PLC-gamma		0.373	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	C			81892744	+1	no_errors	ENST00000359376	ensembl	human	known	70_37	missense	SNP	1.000	G
PLCG2	5336	genome.wustl.edu	37	16	81892744	81892744	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:81892744C>G	ENST00000359376.3	+	5	669	c.455C>G	c.(454-456)tCt>tGt	p.S152C	PLCG2_ENST00000565400.1_3'UTR	NM_002661.3	NP_002652.2	P16885	PLCG2_HUMAN	phospholipase C, gamma 2 (phosphatidylinositol-specific)	152					B cell differentiation (GO:0030183)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid catabolic process (GO:0009395)|platelet activation (GO:0030168)|release of sequestered calcium ion into cytosol (GO:0051209)|small molecule metabolic process (GO:0044281)|T cell receptor signaling pathway (GO:0050852)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	phosphatidylinositol phospholipase C activity (GO:0004435)|phospholipase C activity (GO:0004629)|signal transducer activity (GO:0004871)			NS(1)|breast(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(18)|lung(21)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	58						CAGATATATTCTGTGGATCAA	0.373																																																	0													98.0	102.0	100.0					16																	81892744		1825	4087	5912	SO:0001583	missense	5336				CCDS42204.1	16q24.1	2014-09-17				ENSG00000197943	3.1.4.11	"""SH2 domain containing"""	9066	protein-coding gene	gene with protein product		600220				7835906	Standard	XR_248240		Approved		uc002fgt.3	P16885		ENST00000359376.3:c.455C>G	16.37:g.81892744C>G	ENSP00000352336:p.Ser152Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUL3|Q3ZTS2|Q59H45|Q969T5	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_SH2,pfam_PLipase_C_Pinositol-sp_Y,pfam_SH3_domain,pfam_C2_Ca-dep,pfam_PLipase_C_EF-hand-like,pfam_SH3_2,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_PLipase_C_PInositol-sp_X_dom,smart_SH2,smart_SH3_domain,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pirsf_PLC-gamma,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_SH2,pfscan_SH3_domain,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C,prints_SH2,prints_SH3_domain	p.S152C	ENST00000359376.3	37	c.455	CCDS42204.1	16	.	.	.	.	.	.	.	.	.	.	C	28.6	4.935215	0.92458	.	.	ENSG00000197943	ENST00000359376	T	0.68025	-0.3	5.47	5.47	0.80525	.	0.000000	0.85682	D	0.000000	T	0.78033	0.4220	M	0.66939	2.045	0.80722	D	1	D;D	0.64830	0.97;0.994	P;P	0.57371	0.664;0.819	T	0.80256	-0.1458	10	0.72032	D	0.01	.	18.1102	0.89533	0.0:1.0:0.0:0.0	.	19;152	B4E3H3;P16885	.;PLCG2_HUMAN	C	152	ENSP00000352336:S152C	ENSP00000352336:S152C	S	+	2	0	PLCG2	80450245	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.752000	0.74898	2.559000	0.86315	0.650000	0.86243	TCT	PLCG2	-	pirsf_PLC-gamma		0.373	PLCG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLCG2	HGNC	protein_coding	OTTHUMT00000432429.1	C			81892744	+1	no_errors	ENST00000359376	ensembl	human	known	70_37	missense	SNP	1.000	G
PLEKHD1	400224	genome.wustl.edu	37	14	69968456	69968456	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:69968456G>T	ENST00000322564.7	+	5	628	c.416G>T	c.(415-417)tGg>tTg	p.W139L		NM_001161498.1	NP_001154970.1	A6NEE1	PLHD1_HUMAN	pleckstrin homology domain containing, family D (with coiled-coil domains) member 1	139										breast(1)|endometrium(1)|kidney(2)	4						CCCAGGACCTGGAAGAATGCC	0.527																																																	0													103.0	99.0	100.0					14																	69968456		692	1591	2283	SO:0001583	missense	400224			AK126770	CCDS53903.1	14q24.1	2013-01-10	2011-05-04		ENSG00000175985	ENSG00000175985		"""Pleckstrin homology (PH) domain containing"""	20148	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family D (with M protein repeats) member 1"""				Standard	NM_001161498		Approved	UPF0639	uc010ttf.1	A6NEE1		ENST00000322564.7:c.416G>T	14.37:g.69968456G>T	ENSP00000317175:p.Trp139Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EJC2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.W139L	ENST00000322564.7	37	c.416	CCDS53903.1	14	.	.	.	.	.	.	.	.	.	.	G	18.62	3.662780	0.67700	.	.	ENSG00000175985	ENST00000322564	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	T	0.76499	0.3996	L	0.59436	1.845	0.54753	D	0.999988	D	0.63880	0.993	D	0.72982	0.979	T	0.74179	-0.3749	7	.	.	.	.	18.483	0.90819	0.0:0.0:1.0:0.0	.	139	B9EJC2	.	L	139	.	.	W	+	2	0	PLEKHD1	69038209	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.570000	0.90748	2.675000	0.91044	0.462000	0.41574	TGG	PLEKHD1	-	NULL		0.527	PLEKHD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHD1	HGNC	protein_coding	OTTHUMT00000412451.2	G	NM_001161498		69968456	+1	no_errors	ENST00000322564	ensembl	human	known	70_37	missense	SNP	1.000	T
PLEKHH2	130271	genome.wustl.edu	37	2	43919764	43919764	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:43919764G>A	ENST00000282406.4	+	4	408	c.298G>A	c.(298-300)Gac>Aac	p.D100N		NM_172069.3	NP_742066.2	Q8IVE3	PKHH2_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 2	100					negative regulation of actin filament depolymerization (GO:0030835)	cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)	actin binding (GO:0003779)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(12)|lung(24)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	56		all_hematologic(82;0.166)|Acute lymphoblastic leukemia(82;0.17)				GGAAAAAGATGACGTCATTCA	0.343																																																	0													91.0	95.0	93.0					2																	43919764		2203	4300	6503	SO:0001583	missense	130271			AB095948	CCDS1812.1	2p22	2013-01-10			ENSG00000152527	ENSG00000152527		"""Pleckstrin homology (PH) domain containing"""	30506	protein-coding gene	gene with protein product		612723					Standard	NM_172069		Approved	KIAA2028, PLEKHH1L	uc010yny.2	Q8IVE3	OTTHUMG00000128657	ENST00000282406.4:c.298G>A	2.37:g.43919764G>A	ENSP00000282406:p.Asp100Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JPJ6|Q6P4Q1|Q8N3Q3	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_MyTH4_dom,pfam_FERM_central,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.D100N	ENST00000282406.4	37	c.298	CCDS1812.1	2	.	.	.	.	.	.	.	.	.	.	G	19.12	3.765443	0.69878	.	.	ENSG00000152527	ENST00000282406	T	0.28895	1.59	5.24	5.24	0.73138	.	0.116972	0.56097	D	0.000037	T	0.48132	0.1483	L	0.50333	1.59	0.42369	D	0.992446	B;P	0.52316	0.321;0.952	B;P	0.58454	0.136;0.839	T	0.46735	-0.9170	10	0.62326	D	0.03	-21.3664	18.8153	0.92075	0.0:0.0:1.0:0.0	.	100;100	Q8IVE3;Q8IVE3-3	PKHH2_HUMAN;.	N	100	ENSP00000282406:D100N	ENSP00000282406:D100N	D	+	1	0	PLEKHH2	43773268	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.147000	0.77382	2.453000	0.82957	0.563000	0.77884	GAC	PLEKHH2	-	NULL		0.343	PLEKHH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHH2	HGNC	protein_coding	OTTHUMT00000250537.1	G	NM_172069		43919764	+1	no_errors	ENST00000282406	ensembl	human	known	70_37	missense	SNP	1.000	A
PLXNA1	5361	genome.wustl.edu	37	3	126707774	126707774	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:126707774A>G	ENST00000393409.2	+	1	338	c.338A>G	c.(337-339)aAc>aGc	p.N113S	PLXNA1_ENST00000251772.4_Missense_Mutation_p.N90S	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	113	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		AGTACTGACAACGTCAACAAG	0.667																																																	0													51.0	48.0	49.0					3																	126707774		2203	4300	6503	SO:0001583	missense	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.338A>G	3.37:g.126707774A>G	ENSP00000377061:p.Asn113Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.N113S	ENST00000393409.2	37	c.338	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	A	12.43	1.936430	0.34189	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.23552	1.9;1.9	3.56	2.34	0.29019	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.062774	0.64402	D	0.000020	T	0.53384	0.1793	M	0.90145	3.09	0.53688	D	0.999974	D	0.89917	1.0	D	0.91635	0.999	T	0.56312	-0.8000	10	0.87932	D	0	.	8.9266	0.35643	0.8334:0.0:0.0:0.1666	.	113	Q9UIW2	PLXA1_HUMAN	S	113;90	ENSP00000377061:N113S;ENSP00000251772:N90S	ENSP00000251772:N90S	N	+	2	0	PLXNA1	128190464	1.000000	0.71417	0.985000	0.45067	0.076000	0.17211	9.023000	0.93683	0.419000	0.25927	0.260000	0.18958	AAC	PLXNA1	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.667	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	A	NM_032242		126707774	+1	no_errors	ENST00000393409	ensembl	human	known	70_37	missense	SNP	0.999	G
PLXNA1	5361	genome.wustl.edu	37	3	126707774	126707774	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr3:126707774A>G	ENST00000393409.2	+	1	338	c.338A>G	c.(337-339)aAc>aGc	p.N113S	PLXNA1_ENST00000251772.4_Missense_Mutation_p.N90S	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	113	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		AGTACTGACAACGTCAACAAG	0.667																																																	0													51.0	48.0	49.0					3																	126707774		2203	4300	6503	SO:0001583	missense	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.338A>G	3.37:g.126707774A>G	ENSP00000377061:p.Asn113Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.N113S	ENST00000393409.2	37	c.338	CCDS33847.2	3	.	.	.	.	.	.	.	.	.	.	A	12.43	1.936430	0.34189	.	.	ENSG00000114554	ENST00000393409;ENST00000251772	T;T	0.23552	1.9;1.9	3.56	2.34	0.29019	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.062774	0.64402	D	0.000020	T	0.53384	0.1793	M	0.90145	3.09	0.53688	D	0.999974	D	0.89917	1.0	D	0.91635	0.999	T	0.56312	-0.8000	10	0.87932	D	0	.	8.9266	0.35643	0.8334:0.0:0.0:0.1666	.	113	Q9UIW2	PLXA1_HUMAN	S	113;90	ENSP00000377061:N113S;ENSP00000251772:N90S	ENSP00000251772:N90S	N	+	2	0	PLXNA1	128190464	1.000000	0.71417	0.985000	0.45067	0.076000	0.17211	9.023000	0.93683	0.419000	0.25927	0.260000	0.18958	AAC	PLXNA1	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.667	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	A	NM_032242		126707774	+1	no_errors	ENST00000393409	ensembl	human	known	70_37	missense	SNP	0.999	G
POU2F1	5451	genome.wustl.edu	37	1	167190159	167190159	+	5'UTR	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:167190159C>T	ENST00000541643.3	+	0	17				POU2F1_ENST00000452019.1_5'UTR|POU2F1_ENST00000429375.2_Nonsense_Mutation_p.Q9*|POU2F1_ENST00000367865.1_3'UTR|POU2F1_ENST00000420254.3_5'UTR|POU2F1_ENST00000367866.2_Nonsense_Mutation_p.Q9*|RP11-277B15.3_ENST00000606967.1_RNA			P14859	PO2F1_HUMAN	POU class 2 homeobox 1						gene expression (GO:0010467)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(4)|kidney(2)|large_intestine(3)|liver(2)|lung(7)|ovary(2)|prostate(2)|skin(3)|urinary_tract(1)	30						AGCAGCGAGTCAAGATGAGAG	0.572																																																	0																																										SO:0001623	5_prime_UTR_variant	5451			BC001664	CCDS1259.1, CCDS1259.2, CCDS55655.1, CCDS55656.1	1q24.2	2011-06-20	2007-07-13		ENSG00000143190	ENSG00000143190		"""Homeoboxes / POU class"""	9212	protein-coding gene	gene with protein product		164175	"""POU domain class 2, transcription factor 1"""	OTF1		1887216	Standard	NM_002697		Approved	OCT1	uc001gee.3	P14859	OTTHUMG00000034436	ENST00000541643.3:c.-146C>T	1.37:g.167190159C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL91|B1AL93|B4E029|J3KP77|Q5TBT7|Q6PK46|Q8NEU9|Q9BPV1	Nonsense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU,prints_TF_octamer	p.Q9*	ENST00000541643.3	37	c.25		1	.	.	.	.	.	.	.	.	.	.	c	38	6.870459	0.97901	.	.	ENSG00000143190	ENST00000367866;ENST00000429375	.	.	.	4.16	4.16	0.48862	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	16.0697	0.80914	0.0:1.0:0.0:0.0	.	.	.	.	X	9	.	ENSP00000271411:Q9X	Q	+	1	0	POU2F1	165456783	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	6.275000	0.72594	1.866000	0.54105	0.443000	0.29094	CAA	POU2F1	-	NULL		0.572	POU2F1-203	KNOWN	basic|appris_candidate	protein_coding	POU2F1	HGNC	protein_coding		C	NM_002697		167190159	+1	no_errors	ENST00000367866	ensembl	human	known	70_37	nonsense	SNP	1.000	T
PPAPDC1B	84513	genome.wustl.edu	37	8	38124784	38124784	+	Splice_Site	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:38124784C>T	ENST00000424479.2	-	5	484		c.e5+1		PPAPDC1B_ENST00000422581.2_Splice_Site|PPAPDC1B_ENST00000531823.1_Splice_Site|PPAPDC1B_ENST00000529359.1_Splice_Site|PPAPDC1B_ENST00000419686.2_Missense_Mutation_p.C155Y|PPAPDC1B_ENST00000530588.1_5'Flank	NM_001102559.1	NP_001096029.1	Q8NEB5	PPC1B_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1B						phospholipid dephosphorylation (GO:0046839)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			kidney(1)|lung(1)	2	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)	BRCA - Breast invasive adenocarcinoma(5;3.04e-26)|COAD - Colon adenocarcinoma(9;0.188)			GATATTCATACAGGAAGAATG	0.443																																																	0													99.0	94.0	96.0					8																	38124784		1914	4118	6032	SO:0001630	splice_region_variant	84513			AF212238	CCDS47841.1, CCDS47842.1, CCDS47843.1	8p12	2005-08-09			ENSG00000147535	ENSG00000147535			25026	protein-coding gene	gene with protein product		610626					Standard	NM_032483		Approved	HTPAP	uc003xlf.4	Q8NEB5	OTTHUMG00000165104	ENST00000424479.2:c.463+1G>A	8.37:g.38124784C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JKF5|Q3KQX6|Q9BY45	Splice_Site	SNP	-	e5+1	ENST00000424479.2	37	c.463+1	CCDS47841.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.28|18.28	3.589351|3.589351	0.66105|0.66105	.|.	.|.	ENSG00000147535|ENSG00000147535	ENST00000529359;ENST00000424479;ENST00000524616;ENST00000531823;ENST00000534339;ENST00000422581|ENST00000419686	.|T	.|0.74315	.|-0.83	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72120	.|0.3421	N|N	0.04260|0.04260	-0.245|-0.245	0.43321|0.43321	D|D	0.995341|0.995341	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|T	.|0.75814	.|-0.3185	.|9	.|0.32370	.|T	.|0.25	.|.	17.2215|17.2215	0.86958|0.86958	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|155	.|C9JKF5	.|.	.|Y	-1|155	.|ENSP00000414522:C155Y	.|ENSP00000414522:C155Y	.|C	-|-	.|2	.|0	PPAPDC1B|PPAPDC1B	38243941|38243941	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.728000|0.728000	0.41692|0.41692	7.597000|7.597000	0.82733|0.82733	2.475000|2.475000	0.83589|0.83589	0.557000|0.557000	0.71058|0.71058	.|TGT	PPAPDC1B	-	-		0.443	PPAPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC1B	HGNC	protein_coding	OTTHUMT00000381832.2	C	NM_032483	Intron	38124784	-1	no_errors	ENST00000424479	ensembl	human	known	70_37	splice_site	SNP	1.000	T
PPAPDC1B	84513	genome.wustl.edu	37	8	38124784	38124784	+	Splice_Site	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:38124784C>T	ENST00000424479.2	-	5	484		c.e5+1		PPAPDC1B_ENST00000422581.2_Splice_Site|PPAPDC1B_ENST00000531823.1_Splice_Site|PPAPDC1B_ENST00000529359.1_Splice_Site|PPAPDC1B_ENST00000419686.2_Missense_Mutation_p.C155Y|PPAPDC1B_ENST00000530588.1_5'Flank	NM_001102559.1	NP_001096029.1	Q8NEB5	PPC1B_HUMAN	phosphatidic acid phosphatase type 2 domain containing 1B						phospholipid dephosphorylation (GO:0046839)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phosphatidate phosphatase activity (GO:0008195)			kidney(1)|lung(1)	2	Colorectal(12;0.000442)|Esophageal squamous(3;0.0725)	all_lung(54;0.00787)|Lung NSC(58;0.0295)|Hepatocellular(245;0.121)	BRCA - Breast invasive adenocarcinoma(5;3.04e-26)|COAD - Colon adenocarcinoma(9;0.188)			GATATTCATACAGGAAGAATG	0.443																																																	0													99.0	94.0	96.0					8																	38124784		1914	4118	6032	SO:0001630	splice_region_variant	84513			AF212238	CCDS47841.1, CCDS47842.1, CCDS47843.1	8p12	2005-08-09			ENSG00000147535	ENSG00000147535			25026	protein-coding gene	gene with protein product		610626					Standard	NM_032483		Approved	HTPAP	uc003xlf.4	Q8NEB5	OTTHUMG00000165104	ENST00000424479.2:c.463+1G>A	8.37:g.38124784C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JKF5|Q3KQX6|Q9BY45	Splice_Site	SNP	-	e5+1	ENST00000424479.2	37	c.463+1	CCDS47841.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.28|18.28	3.589351|3.589351	0.66105|0.66105	.|.	.|.	ENSG00000147535|ENSG00000147535	ENST00000529359;ENST00000424479;ENST00000524616;ENST00000531823;ENST00000534339;ENST00000422581|ENST00000419686	.|T	.|0.74315	.|-0.83	5.01|5.01	5.01|5.01	0.66863|0.66863	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72120	.|0.3421	N|N	0.04260|0.04260	-0.245|-0.245	0.43321|0.43321	D|D	0.995341|0.995341	.|D	.|0.89917	.|1.0	.|D	.|0.91635	.|0.999	.|T	.|0.75814	.|-0.3185	.|9	.|0.32370	.|T	.|0.25	.|.	17.2215|17.2215	0.86958|0.86958	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|155	.|C9JKF5	.|.	.|Y	-1|155	.|ENSP00000414522:C155Y	.|ENSP00000414522:C155Y	.|C	-|-	.|2	.|0	PPAPDC1B|PPAPDC1B	38243941|38243941	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.728000|0.728000	0.41692|0.41692	7.597000|7.597000	0.82733|0.82733	2.475000|2.475000	0.83589|0.83589	0.557000|0.557000	0.71058|0.71058	.|TGT	PPAPDC1B	-	-		0.443	PPAPDC1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAPDC1B	HGNC	protein_coding	OTTHUMT00000381832.2	C	NM_032483	Intron	38124784	-1	no_errors	ENST00000424479	ensembl	human	known	70_37	splice_site	SNP	1.000	T
POU5F1B	5462	genome.wustl.edu	37	8	128429025	128429025	+	Missense_Mutation	SNP	C	C	T	rs533552619	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:128429025C>T	ENST00000465342.2	+	2	2071	c.914C>T	c.(913-915)tCa>tTa	p.S305L	CASC8_ENST00000523825.1_RNA|CASC8_ENST00000501396.1_RNA|POU5F1B_ENST00000391675.1_Missense_Mutation_p.S305L|CASC8_ENST00000502082.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						TCTCCTTTCTCAGGGGGACCA	0.587																																																	0													10.0	10.0	10.0					8																	128429025		692	1589	2281	SO:0001583	missense	5462			AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.914C>T	8.37:g.128429025C>T	ENSP00000419298:p.Ser305Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.S305L	ENST00000465342.2	37	c.914	CCDS55274.1	8	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535102	0.27475	.	.	ENSG00000212993	ENST00000465342;ENST00000391675	T;T	0.79454	-1.27;-1.27	0.935	0.935	0.19483	.	1.072340	0.07295	N	0.873150	T	0.68091	0.2963	L	0.36672	1.1	0.30720	N	0.748306	B	0.20671	0.047	B	0.19148	0.024	T	0.64550	-0.6381	10	0.66056	D	0.02	.	7.8741	0.29584	0.0:1.0:0.0:0.0	.	305	Q06416	P5F1B_HUMAN	L	305	ENSP00000419298:S305L;ENSP00000375557:S305L	ENSP00000375557:S305L	S	+	2	0	POU5F1B	128498207	0.981000	0.34729	0.513000	0.27749	0.360000	0.29518	0.690000	0.25451	0.852000	0.35287	0.121000	0.15741	TCA	POU5F1B	-	NULL		0.587	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU5F1B	HGNC	protein_coding	OTTHUMT00000349649.2	C	NM_001159542		128429025	+1	no_errors	ENST00000391675	ensembl	human	known	70_37	missense	SNP	0.966	T
POU5F1B	5462	genome.wustl.edu	37	8	128429025	128429025	+	Missense_Mutation	SNP	C	C	T	rs533552619	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:128429025C>T	ENST00000465342.2	+	2	2071	c.914C>T	c.(913-915)tCa>tTa	p.S305L	CASC8_ENST00000523825.1_RNA|CASC8_ENST00000501396.1_RNA|POU5F1B_ENST00000391675.1_Missense_Mutation_p.S305L|CASC8_ENST00000502082.1_RNA			Q06416	P5F1B_HUMAN	POU class 5 homeobox 1B	305					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			lung(1)|prostate(1)|urinary_tract(1)	3						TCTCCTTTCTCAGGGGGACCA	0.587																																																	0													10.0	10.0	10.0					8																	128429025		692	1589	2281	SO:0001583	missense	5462			AF268615	CCDS55274.1	8q24.21	2011-06-20	2009-04-15	2009-04-15	ENSG00000212993	ENSG00000212993		"""Homeoboxes / POU class"""	9223	protein-coding gene	gene with protein product		615739	"""POU domain class 5, transcription factor 1 pseudogene 1"", ""POU class 5 homeobox 1 pseudogene 1"""	OTF3P1, POU5F1P1		1408763	Standard	NM_001159542		Approved	OTF3C	uc003ysf.3	Q06416	OTTHUMG00000157807	ENST00000465342.2:c.914C>T	8.37:g.128429025C>T	ENSP00000419298:p.Ser305Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D5K9S4|D5K9S9|D5K9T0|D5K9T1|D5K9T3|D5K9U3|D5K9U6|D5K9V4|D5K9V6|D5K9W0|D5K9W2|D5K9W7|D5K9X2|D5K9X3|D5K9X5|D5K9X8|D5K9X9|E9LRB1|E9LRB2|E9LRH5|E9LRH6|E9LRH7|E9LRK4|E9LRK5|E9LRK7|E9LRK8|E9LRM7|E9LRM9|E9LRN2|E9LRN4|E9LRN5|E9LRP8|E9LRQ0|E9LRQ2|E9LRQ3|E9LRQ4|E9LRQ5|E9LRS3|Q2VIK6|Q9BZV7|Q9BZV9	Missense_Mutation	SNP	pfam_POU_specific,pfam_Homeodomain,superfamily_Lambda_DNA-bd_dom,superfamily_Homeodomain-like,smart_POU_specific,smart_Homeodomain,pfscan_Homeodomain,pfscan_POU_specific,prints_POU	p.S305L	ENST00000465342.2	37	c.914	CCDS55274.1	8	.	.	.	.	.	.	.	.	.	.	C	11.09	1.535102	0.27475	.	.	ENSG00000212993	ENST00000465342;ENST00000391675	T;T	0.79454	-1.27;-1.27	0.935	0.935	0.19483	.	1.072340	0.07295	N	0.873150	T	0.68091	0.2963	L	0.36672	1.1	0.30720	N	0.748306	B	0.20671	0.047	B	0.19148	0.024	T	0.64550	-0.6381	10	0.66056	D	0.02	.	7.8741	0.29584	0.0:1.0:0.0:0.0	.	305	Q06416	P5F1B_HUMAN	L	305	ENSP00000419298:S305L;ENSP00000375557:S305L	ENSP00000375557:S305L	S	+	2	0	POU5F1B	128498207	0.981000	0.34729	0.513000	0.27749	0.360000	0.29518	0.690000	0.25451	0.852000	0.35287	0.121000	0.15741	TCA	POU5F1B	-	NULL		0.587	POU5F1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POU5F1B	HGNC	protein_coding	OTTHUMT00000349649.2	C	NM_001159542		128429025	+1	no_errors	ENST00000391675	ensembl	human	known	70_37	missense	SNP	0.966	T
PRCD	768206	genome.wustl.edu	37	17	74542943	74542943	+	3'UTR	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:74542943G>T	ENST00000592432.1	+	0	2391				CYGB_ENST00000589145.1_Intron|RP11-666A8.8_ENST00000589963.1_RNA			Q00LT1	PRCD_HUMAN	progressive rod-cone degeneration						response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											atccaataaggaaagtgaggt	0.483																																																	0																																										SO:0001624	3_prime_UTR_variant	768206			DQ390338	CCDS42382.1	17q25.1	2008-10-24			ENSG00000214140	ENSG00000214140			32528	protein-coding gene	gene with protein product		610598				16938425	Standard	NM_001077620		Approved	RP36	uc002jrw.1	Q00LT1	OTTHUMG00000132200	ENST00000592432.1:c.*2388G>T	17.37:g.74542943G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EJD4	RNA	SNP	-	NULL	ENST00000592432.1	37	NULL		17																																																																																			PRCD	-	-		0.483	PRCD-005	KNOWN	basic	processed_transcript	PRCD	HGNC	protein_coding	OTTHUMT00000450595.1	G			74542943	+1	no_errors	ENST00000592432	ensembl	human	known	70_37	rna	SNP	0.024	T
PRPF40A	55660	genome.wustl.edu	37	2	153515691	153515691	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:153515691C>T	ENST00000410080.1	-	23	2963	c.2422G>A	c.(2422-2424)Gat>Aat	p.D808N		NM_017892.3	NP_060362.3	O75400	PR40A_HUMAN	PRP40 pre-mRNA processing factor 40 homolog A (S. cerevisiae)	835					cell cycle (GO:0007049)|cell division (GO:0051301)|cell migration (GO:0016477)|cytoskeleton organization (GO:0007010)|mRNA processing (GO:0006397)|regulation of cell shape (GO:0008360)|regulation of cytokinesis (GO:0032465)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(9)|prostate(1)|urinary_tract(1)	21						TCATCATCATCTGAATCTGAC	0.353																																																	0													94.0	86.0	89.0					2																	153515691		1846	4094	5940	SO:0001583	missense	55660			AF049523	CCDS46430.1	2q23.3	2010-01-25	2007-01-12	2006-01-13	ENSG00000196504	ENSG00000196504			16463	protein-coding gene	gene with protein product		612941	"""formin-binding protein 3"", ""formin binding protein 3"", ""PRP40 pre-mRNA processing factor 40 homolog A (yeast)"""	FNBP3		9724750, 12460579	Standard	NM_017892		Approved	FLJ20585, FBP11, HYPA, NY-REN-6, HIP10, FBP-11, FLAF1, Prp40	uc002tyh.4	O75400	OTTHUMG00000154031	ENST00000410080.1:c.2422G>A	2.37:g.153515691C>T	ENSP00000386458:p.Asp808Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O43856|O75404|Q8TBQ1|Q9H782|Q9NWU9|Q9P0Q2|Q9Y5A8	Missense_Mutation	SNP	pfam_FF_domain,pfam_WW_Rsp5_WWP,superfamily_FF_domain,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_FF_domain,prints_Antifreeze_1,pfscan_WW_Rsp5_WWP	p.D808N	ENST00000410080.1	37	c.2422	CCDS46430.1	2	.	.	.	.	.	.	.	.	.	.	C	24.5	4.540493	0.85917	.	.	ENSG00000196504	ENST00000410080;ENST00000356402;ENST00000440252;ENST00000359961	T	0.33865	1.39	5.38	5.38	0.77491	.	0.044496	0.85682	D	0.000000	T	0.31544	0.0800	L	0.34521	1.04	0.58432	D	0.999998	P;P	0.37781	0.608;0.608	B;B	0.35413	0.202;0.202	T	0.05225	-1.0898	10	0.38643	T	0.18	-26.7113	19.5019	0.95098	0.0:1.0:0.0:0.0	.	835;808	O75400;E9PFS0	PR40A_HUMAN;.	N	808;817;704;759	ENSP00000386458:D808N	ENSP00000348770:D817N	D	-	1	0	PRPF40A	153223937	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	7.776000	0.85560	2.697000	0.92050	0.563000	0.77884	GAT	PRPF40A	-	NULL		0.353	PRPF40A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF40A	HGNC	protein_coding	OTTHUMT00000333559.2	C	XM_371575		153515691	-1	no_errors	ENST00000410080	ensembl	human	known	70_37	missense	SNP	1.000	T
PRR14L	253143	genome.wustl.edu	37	22	32109761	32109761	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:32109761G>C	ENST00000327423.6	-	4	4253	c.4064C>G	c.(4063-4065)tCt>tGt	p.S1355C	PRR14L_ENST00000434485.1_Missense_Mutation_p.S1355C|PRR14L_ENST00000461722.1_5'Flank|PRR14L_ENST00000397493.2_Missense_Mutation_p.S1355C	NM_173566.2	NP_775837.2	Q5THK1	PR14L_HUMAN	proline rich 14-like	1355										endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(5)|skin(1)|urinary_tract(2)	14						CAACTCCTCAGATTGCTCCCC	0.453																																																	0													110.0	94.0	99.0					22																	32109761		692	1591	2283	SO:0001583	missense	253143			BC040859	CCDS13900.2	22q12.2	2011-01-25	2011-01-25	2011-01-25	ENSG00000183530	ENSG00000183530			28738	protein-coding gene	gene with protein product			"""chromosome 22 open reading frame 30"""	C22orf30		12477932	Standard	NM_173566		Approved	MGC50372	uc003alp.4	Q5THK1	OTTHUMG00000030139	ENST00000327423.6:c.4064C>G	22.37:g.32109761G>C	ENSP00000331845:p.Ser1355Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5THK4|Q6ZNN1|Q6ZWH0|Q8IW74|Q9H5T4	Missense_Mutation	SNP	NULL	p.S1355C	ENST00000327423.6	37	c.4064	CCDS13900.2	22	.	.	.	.	.	.	.	.	.	.	G	17.97	3.519271	0.64634	.	.	ENSG00000183530	ENST00000397493;ENST00000327423;ENST00000434485	T;T;T	0.08193	3.12;3.14;3.12	5.36	5.36	0.76844	.	1.196100	0.06216	N	0.685918	T	0.24470	0.0593	L	0.53249	1.67	0.09310	N	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.66847	0.947;0.935;0.947	T	0.16719	-1.0393	9	.	.	.	-2.2412	9.5148	0.39098	0.1001:0.0:0.8999:0.0	.	1355;1355;1355	Q5THK1-2;Q5THK1;Q5THK1-4	.;PR14L_HUMAN;.	C	1355	ENSP00000380630:S1355C;ENSP00000331845:S1355C;ENSP00000388314:S1355C	.	S	-	2	0	PRR14L	30439761	0.036000	0.19791	0.008000	0.14137	0.358000	0.29455	2.715000	0.47210	2.511000	0.84671	0.650000	0.86243	TCT	PRR14L	-	NULL		0.453	PRR14L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	PRR14L	HGNC	protein_coding	OTTHUMT00000074993.2	G	NM_173566		32109761	-1	no_errors	ENST00000397493	ensembl	human	known	70_37	missense	SNP	0.011	C
PRRG2	5639	genome.wustl.edu	37	19	50093638	50093638	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:50093638C>G	ENST00000246794.5	+	7	770	c.601C>G	c.(601-603)Cct>Gct	p.P201A	PRR12_ENST00000418929.2_5'Flank|PRRG2_ENST00000596700.1_3'UTR	NM_000951.2	NP_000942.1	O14669	TMG2_HUMAN	proline rich Gla (G-carboxyglutamic acid) 2	201						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			lung(1)|skin(1)|soft_tissue(1)	3		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)		CCTCAGGAGGCCTCACTGAAG	0.592																																																	0													156.0	149.0	151.0					19																	50093638		2203	4300	6503	SO:0001583	missense	5639				CCDS12773.1	19q13.33	2008-02-05	2004-05-27						9470	protein-coding gene	gene with protein product		604429	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 2"""			9256434	Standard	NM_000951		Approved	PRGP2	uc002pon.3	O14669		ENST00000246794.5:c.601C>G	19.37:g.50093638C>G	ENSP00000246794:p.Pro201Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IBF8	Missense_Mutation	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	p.P201A	ENST00000246794.5	37	c.601	CCDS12773.1	19	.	.	.	.	.	.	.	.	.	.	C	15.23	2.770939	0.49680	.	.	ENSG00000126460	ENST00000246794;ENST00000543867	D	0.96913	-4.17	3.47	-0.398	0.12418	.	0.396100	0.19374	U	0.115821	D	0.88097	0.6345	N	0.08118	0	0.09310	N	1	B;B	0.22683	0.073;0.043	B;B	0.22601	0.04;0.018	T	0.80995	-0.1133	10	0.87932	D	0	-2.6829	5.6054	0.17377	0.0:0.529:0.0:0.471	.	178;201	F5GZ13;O14669	.;TMG2_HUMAN	A	201;178	ENSP00000246794:P201A	ENSP00000246794:P201A	P	+	1	0	PRRG2	54785450	0.007000	0.16637	0.010000	0.14722	0.841000	0.47740	0.087000	0.14958	0.013000	0.14918	0.313000	0.20887	CCT	PRRG2	-	NULL		0.592	PRRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG2	HGNC	protein_coding	OTTHUMT00000465257.1	C	NM_000951		50093638	+1	no_errors	ENST00000246794	ensembl	human	known	70_37	missense	SNP	0.010	G
PRRG2	5639	genome.wustl.edu	37	19	50093638	50093638	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:50093638C>G	ENST00000246794.5	+	7	770	c.601C>G	c.(601-603)Cct>Gct	p.P201A	PRR12_ENST00000418929.2_5'Flank|PRRG2_ENST00000596700.1_3'UTR	NM_000951.2	NP_000942.1	O14669	TMG2_HUMAN	proline rich Gla (G-carboxyglutamic acid) 2	201						extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			lung(1)|skin(1)|soft_tissue(1)	3		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.196)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00295)|GBM - Glioblastoma multiforme(134;0.0121)		CCTCAGGAGGCCTCACTGAAG	0.592																																																	0													156.0	149.0	151.0					19																	50093638		2203	4300	6503	SO:0001583	missense	5639				CCDS12773.1	19q13.33	2008-02-05	2004-05-27						9470	protein-coding gene	gene with protein product		604429	"""proline-rich Gla (G-carboxyglutamic acid) polypeptide 2"""			9256434	Standard	NM_000951		Approved	PRGP2	uc002pon.3	O14669		ENST00000246794.5:c.601C>G	19.37:g.50093638C>G	ENSP00000246794:p.Pro201Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IBF8	Missense_Mutation	SNP	pfam_GLA_domain,superfamily_GLA_domain,smart_GLA_domain,pfscan_GLA_domain,prints_GLA_domain	p.P201A	ENST00000246794.5	37	c.601	CCDS12773.1	19	.	.	.	.	.	.	.	.	.	.	C	15.23	2.770939	0.49680	.	.	ENSG00000126460	ENST00000246794;ENST00000543867	D	0.96913	-4.17	3.47	-0.398	0.12418	.	0.396100	0.19374	U	0.115821	D	0.88097	0.6345	N	0.08118	0	0.09310	N	1	B;B	0.22683	0.073;0.043	B;B	0.22601	0.04;0.018	T	0.80995	-0.1133	10	0.87932	D	0	-2.6829	5.6054	0.17377	0.0:0.529:0.0:0.471	.	178;201	F5GZ13;O14669	.;TMG2_HUMAN	A	201;178	ENSP00000246794:P201A	ENSP00000246794:P201A	P	+	1	0	PRRG2	54785450	0.007000	0.16637	0.010000	0.14722	0.841000	0.47740	0.087000	0.14958	0.013000	0.14918	0.313000	0.20887	CCT	PRRG2	-	NULL		0.592	PRRG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRG2	HGNC	protein_coding	OTTHUMT00000465257.1	C	NM_000951		50093638	+1	no_errors	ENST00000246794	ensembl	human	known	70_37	missense	SNP	0.010	G
RAP1GAP	5909	genome.wustl.edu	37	1	21934836	21934836	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:21934836G>A	ENST00000374765.4	-	17	1366	c.1166C>T	c.(1165-1167)aCg>aTg	p.T389M	RAP1GAP_ENST00000374761.2_Missense_Mutation_p.T420M|RAP1GAP_ENST00000542643.2_Missense_Mutation_p.T389M|RAP1GAP_ENST00000374763.2_Missense_Mutation_p.T389M|RAP1GAP_ENST00000290101.4_Missense_Mutation_p.T453M	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	389	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GGCGGCCCGCGTCCGCTCCTG	0.647																																																	0													41.0	40.0	40.0					1																	21934836		2203	4300	6503	SO:0001583	missense	5909			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.1166C>T	1.37:g.21934836G>A	ENSP00000363897:p.Thr389Met	Somatic		WXS	Illumina HiSeq	Phase_IV	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	pfam_Rap_GAP,pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_Rap_GAP	p.T453M	ENST00000374765.4	37	c.1358	CCDS218.1	1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294882	0.81025	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758	D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72	4.9	4.9	0.64082	Rap/ran-GAP (2);	0.053522	0.85682	N	0.000000	D	0.98385	0.9463	H	0.95611	3.695	0.80722	D	1	P;D;D;D	0.89917	0.907;1.0;1.0;1.0	B;D;D;D	0.83275	0.401;0.98;0.996;0.982	D	0.99671	1.0996	10	0.87932	D	0	-22.3892	15.5443	0.76081	0.0:0.0:1.0:0.0	.	389;389;419;389	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	M	453;420;389;389;419;389	ENSP00000290101:T453M;ENSP00000363893:T420M;ENSP00000441661:T389M;ENSP00000363897:T389M	ENSP00000290101:T453M	T	-	2	0	RAP1GAP	21807423	1.000000	0.71417	0.946000	0.38457	0.739000	0.42172	9.445000	0.97587	2.267000	0.75376	0.407000	0.27541	ACG	RAP1GAP	-	pfam_Rap_GAP,pfscan_Rap_GAP		0.647	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GAP	HGNC	protein_coding	OTTHUMT00000019759.2	G	NM_002885		21934836	-1	no_errors	ENST00000290101	ensembl	human	known	70_37	missense	SNP	0.999	A
RAP1GAP	5909	genome.wustl.edu	37	1	21934836	21934836	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:21934836G>A	ENST00000374765.4	-	17	1366	c.1166C>T	c.(1165-1167)aCg>aTg	p.T389M	RAP1GAP_ENST00000374761.2_Missense_Mutation_p.T420M|RAP1GAP_ENST00000542643.2_Missense_Mutation_p.T389M|RAP1GAP_ENST00000374763.2_Missense_Mutation_p.T389M|RAP1GAP_ENST00000290101.4_Missense_Mutation_p.T453M	NM_002885.2	NP_002876.2	P47736	RPGP1_HUMAN	RAP1 GTPase activating protein	389	Rap-GAP. {ECO:0000255|PROSITE- ProRule:PRU00165}.				GTP catabolic process (GO:0006184)|positive regulation of Rap GTPase activity (GO:0032854)|regulation of Ras GTPase activity (GO:0032318)|signal transduction (GO:0007165)	cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|GTPase activity (GO:0003924)|protein homodimerization activity (GO:0042803)|Rap GTPase activator activity (GO:0046582)|Ras GTPase binding (GO:0017016)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	17		Colorectal(325;0.000147)|Renal(390;0.000734)|Lung NSC(340;0.000861)|all_lung(284;0.000901)|Breast(348;0.012)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0192)|OV - Ovarian serous cystadenocarcinoma(117;2.3e-26)|COAD - Colon adenocarcinoma(152;1.59e-05)|GBM - Glioblastoma multiforme(114;2.7e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000354)|STAD - Stomach adenocarcinoma(196;0.00645)|KIRC - Kidney renal clear cell carcinoma(1967;0.00862)|READ - Rectum adenocarcinoma(331;0.0625)|Lung(427;0.146)		GGCGGCCCGCGTCCGCTCCTG	0.647																																																	0													41.0	40.0	40.0					1																	21934836		2203	4300	6503	SO:0001583	missense	5909			BC054490	CCDS218.1, CCDS53276.1, CCDS53277.1	1p36.1-p35	2009-09-14	2006-04-12	2006-04-12	ENSG00000076864	ENSG00000076864			9858	protein-coding gene	gene with protein product		600278	"""RAP1, GTPase activating protein 1"""	RAP1GA1		1904317	Standard	NM_001145657		Approved	KIAA0474, RAP1GAP1, RAP1GAPII	uc001bew.3	P47736	OTTHUMG00000007513	ENST00000374765.4:c.1166C>T	1.37:g.21934836G>A	ENSP00000363897:p.Thr389Met	Somatic		WXS	Illumina HiSeq	Phase_IV	J3QSS6|O75062|Q5T3S9|Q5T3T4|Q7Z5S8|Q9UQ51	Missense_Mutation	SNP	pfam_Rap_GAP,pfam_GoLoco_motif,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_Rap_GAP	p.T453M	ENST00000374765.4	37	c.1358	CCDS218.1	1	.	.	.	.	.	.	.	.	.	.	G	22.5	4.294882	0.81025	.	.	ENSG00000076864	ENST00000290101;ENST00000374761;ENST00000542643;ENST00000374765;ENST00000374763;ENST00000374758	D;D;D;D	0.95482	-3.72;-3.72;-3.72;-3.72	4.9	4.9	0.64082	Rap/ran-GAP (2);	0.053522	0.85682	N	0.000000	D	0.98385	0.9463	H	0.95611	3.695	0.80722	D	1	P;D;D;D	0.89917	0.907;1.0;1.0;1.0	B;D;D;D	0.83275	0.401;0.98;0.996;0.982	D	0.99671	1.0996	10	0.87932	D	0	-22.3892	15.5443	0.76081	0.0:0.0:1.0:0.0	.	389;389;419;389	P47736-2;P47736;P47736-3;Q7Z5S8	.;RPGP1_HUMAN;.;.	M	453;420;389;389;419;389	ENSP00000290101:T453M;ENSP00000363893:T420M;ENSP00000441661:T389M;ENSP00000363897:T389M	ENSP00000290101:T453M	T	-	2	0	RAP1GAP	21807423	1.000000	0.71417	0.946000	0.38457	0.739000	0.42172	9.445000	0.97587	2.267000	0.75376	0.407000	0.27541	ACG	RAP1GAP	-	pfam_Rap_GAP,pfscan_Rap_GAP		0.647	RAP1GAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	RAP1GAP	HGNC	protein_coding	OTTHUMT00000019759.2	G	NM_002885		21934836	-1	no_errors	ENST00000290101	ensembl	human	known	70_37	missense	SNP	0.999	A
RASGRF2	5924	genome.wustl.edu	37	5	80383974	80383974	+	Intron	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr5:80383974G>C	ENST00000265080.4	+	9	1457				RASGRF2_ENST00000502677.1_3'UTR	NM_006909.2	NP_008840.1	O14827	RGRF2_HUMAN	Ras protein-specific guanine nucleotide-releasing factor 2						apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			biliary_tract(1)|breast(5)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(28)|ovary(5)|prostate(3)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75		Lung NSC(167;0.00498)|all_lung(232;0.00531)|Ovarian(174;0.0357)		OV - Ovarian serous cystadenocarcinoma(54;4.22e-42)|Epithelial(54;4.04e-35)|all cancers(79;2.52e-29)		cctctgcacagactgtgtccc	0.468																																																	0																																										SO:0001627	intron_variant	5924			AF023130	CCDS4052.1	5q13	2013-01-10			ENSG00000113319	ENSG00000113319		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	9876	protein-coding gene	gene with protein product		606614					Standard	NM_006909		Approved	GRF2, Ras-GRF2	uc003kha.2	O14827	OTTHUMG00000119015	ENST00000265080.4:c.1390+1202G>C	5.37:g.80383974G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EG89|Q9UK56	RNA	SNP	-	NULL	ENST00000265080.4	37	NULL	CCDS4052.1	5																																																																																			RASGRF2	-	-		0.468	RASGRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASGRF2	HGNC	protein_coding	OTTHUMT00000239215.2	G	NM_006909		80383974	+1	no_errors	ENST00000502677	ensembl	human	known	70_37	rna	SNP	0.000	C
REM1	28954	genome.wustl.edu	37	20	30064251	30064251	+	Start_Codon_SNP	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:30064251G>A	ENST00000201979.2	+	2	296	c.3G>A	c.(1-3)atG>atA	p.M1I	DEFB124_ENST00000481595.1_Intron	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	1					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TACCAAAGATGACACTCAACA	0.577																																																	0													100.0	116.0	111.0					20																	30064251		2203	4300	6503	SO:0001582	initiator_codon_variant	28954			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.3G>A	20.37:g.30064251G>A	ENSP00000201979:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.M1I	ENST00000201979.2	37	c.3	CCDS13181.1	20	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281631	0.59758	.	.	ENSG00000088320	ENST00000201979	T	0.67865	-0.29	4.44	4.44	0.53790	.	0.056259	0.64402	D	0.000003	T	0.67325	0.2881	.	.	.	0.80722	D	1	D	0.53151	0.958	P	0.47528	0.549	T	0.72747	-0.4200	9	0.87932	D	0	.	12.4533	0.55688	0.0:0.0:1.0:0.0	.	1	O75628	REM1_HUMAN	I	1	ENSP00000201979:M1I	ENSP00000201979:M1I	M	+	3	0	REM1	29527912	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	6.245000	0.72398	2.278000	0.76064	0.655000	0.94253	ATG	REM1	-	pirsf_Small_GTPase_GEM/REM/Rad		0.577	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REM1	HGNC	protein_coding	OTTHUMT00000078508.2	G	NM_014012	Missense_Mutation	30064251	+1	no_errors	ENST00000201979	ensembl	human	known	70_37	missense	SNP	1.000	A
REM1	28954	genome.wustl.edu	37	20	30064251	30064251	+	Start_Codon_SNP	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:30064251G>A	ENST00000201979.2	+	2	296	c.3G>A	c.(1-3)atG>atA	p.M1I	DEFB124_ENST00000481595.1_Intron	NM_014012.4	NP_054731.2	O75628	REM1_HUMAN	RAS (RAD and GEM)-like GTP-binding 1	1					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	membrane (GO:0016020)	GTP binding (GO:0005525)			kidney(3)|large_intestine(3)|lung(14)|pancreas(2)|upper_aerodigestive_tract(1)	23	all_cancers(5;0.000119)|Lung NSC(7;1.32e-05)|all_lung(7;2.14e-05)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Colorectal(19;0.00254)|COAD - Colon adenocarcinoma(19;0.0347)			TACCAAAGATGACACTCAACA	0.577																																																	0													100.0	116.0	111.0					20																	30064251		2203	4300	6503	SO:0001582	initiator_codon_variant	28954			AF152863	CCDS13181.1	20q11.21	2014-05-09	2004-04-14	2004-04-16	ENSG00000088320	ENSG00000088320			15922	protein-coding gene	gene with protein product	"""GTPase GES"""	610388	"""RAS (RAD and GEM)-like GTP-binding"""	REM		10831614, 14623965	Standard	NM_014012		Approved	GES	uc002wwa.3	O75628	OTTHUMG00000032168	ENST00000201979.2:c.3G>A	20.37:g.30064251G>A	ENSP00000201979:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5L1|Q5TZR7|Q5TZR8|Q9NP57	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Fe2_transport_prot_B_N,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,pirsf_Small_GTPase_GEM/REM/Rad,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.M1I	ENST00000201979.2	37	c.3	CCDS13181.1	20	.	.	.	.	.	.	.	.	.	.	G	17.02	3.281631	0.59758	.	.	ENSG00000088320	ENST00000201979	T	0.67865	-0.29	4.44	4.44	0.53790	.	0.056259	0.64402	D	0.000003	T	0.67325	0.2881	.	.	.	0.80722	D	1	D	0.53151	0.958	P	0.47528	0.549	T	0.72747	-0.4200	9	0.87932	D	0	.	12.4533	0.55688	0.0:0.0:1.0:0.0	.	1	O75628	REM1_HUMAN	I	1	ENSP00000201979:M1I	ENSP00000201979:M1I	M	+	3	0	REM1	29527912	1.000000	0.71417	1.000000	0.80357	0.348000	0.29142	6.245000	0.72398	2.278000	0.76064	0.655000	0.94253	ATG	REM1	-	pirsf_Small_GTPase_GEM/REM/Rad		0.577	REM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REM1	HGNC	protein_coding	OTTHUMT00000078508.2	G	NM_014012	Missense_Mutation	30064251	+1	no_errors	ENST00000201979	ensembl	human	known	70_37	missense	SNP	1.000	A
RHOXF1	158800	genome.wustl.edu	37	X	119249758	119249759	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G|A	G|A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:119249758_119249759GA>TG	ENST00000217999.2	-	1	88_89	c.14_15TC>CA	c.(13-15)cTC>cCA	p.L5P	GS1-421I3.4_ENST00000422226.1_lincRNA|RP4-755D9.1_ENST00000553843.1_RNA	NM_139282.1	NP_644811.1	Q8NHV9	RHXF1_HUMAN	Rhox homeobox family, member 1	5					gamete generation (GO:0007276)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|sexual reproduction (GO:0019953)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)	10						TGTCGTGGACGAGCGAACGCGC	0.599																																																	0																																										SO:0001583	missense	158800				CCDS14593.1	Xq24	2011-06-20			ENSG00000101883	ENSG00000101883		"""Homeoboxes / PRD class"""	29993	protein-coding gene	gene with protein product		300446				11980563, 12490318	Standard	NM_139282		Approved	OTEX, PEPP1	uc004esk.2	Q8NHV9	OTTHUMG00000022290	ENST00000217999.2:c.14_15delinsTG	X.37:g.119249758_119249759delinsTG	ENSP00000217999:p.Leu5Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	O95030|Q3SYE0	Silent|Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_HTH_motif	p.L5|p.L5P	ENST00000217999.2	37	c.15|c.14	CCDS14593.1	X																																																																																			RHOXF1	-	NULL		0.599	RHOXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOXF1	HGNC	protein_coding	OTTHUMT00000058083.2	G|A	NM_139282		119249758|119249759	-1	no_errors	ENST00000217999	ensembl	human	known	70_37	silent|missense	SNP	0.000	T|G
RPL13A	23521	genome.wustl.edu	37	19	49993803	49993803	+	Missense_Mutation	SNP	C	C	T	rs11539139		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:49993803C>T	ENST00000391857.4	+	4	302	c.226C>T	c.(226-228)Ccc>Tcc	p.P76S	SNORD33_ENST00000362761.1_RNA|CTD-3148I10.15_ENST00000595815.1_RNA|RPL13A_ENST00000477613.2_3'UTR|SNORD32A_ENST00000364805.1_RNA|SNORD35A_ENST00000363389.1_RNA|SNORD34_ENST00000365633.1_RNA	NM_001270491.1|NM_012423.3	NP_001257420.1|NP_036555.1	P40429	RL13A_HUMAN	ribosomal protein L13a	76					cellular protein metabolic process (GO:0044267)|cellular response to interferon-gamma (GO:0071346)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|negative regulation of formation of translation preinitiation complex (GO:1901194)|negative regulation of translation (GO:0017148)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|focal adhesion (GO:0005925)|GAIT complex (GO:0097452)|large ribosomal subunit (GO:0015934)|membrane (GO:0016020)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(1)	2		all_lung(116;1.62e-07)|Lung NSC(112;8.47e-07)|all_neural(266;0.0381)|Ovarian(192;0.0392)		OV - Ovarian serous cystadenocarcinoma(262;0.00154)|GBM - Glioblastoma multiforme(486;0.0246)		CTTCCGGGCCCCCAGCCGCAT	0.647																																																	0													29.0	34.0	32.0					19																	49993803		2202	4299	6501	SO:0001583	missense	23521			X56932	CCDS12768.1, CCDS74421.1	19q13.3	2011-04-06			ENSG00000142541	ENSG00000142541		"""L ribosomal proteins"""	10304	protein-coding gene	gene with protein product			"""tissue specific transplantation antigen 1"""	TSTA1			Standard	NM_012423		Approved	L13A	uc031rlt.1	P40429	OTTHUMG00000134289	ENST00000391857.4:c.226C>T	19.37:g.49993803C>T	ENSP00000375730:p.Pro76Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K505	Missense_Mutation	SNP	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc	p.P76S	ENST00000391857.4	37	c.226	CCDS12768.1	19	.	.	.	.	.	.	.	.	.	.	C	31	5.084149	0.94100	.	.	ENSG00000142541	ENST00000391857;ENST00000396949	.	.	.	5.46	4.41	0.53225	Ribosomal protein L13 domain (2);	0.000000	0.64402	U	0.000001	D	0.85031	0.5604	M	0.92317	3.295	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.994	D	0.88413	0.3023	9	0.87932	D	0	.	13.508	0.61495	0.1569:0.8431:0.0:0.0	rs11539139	76;76	Q5QTS3;P40429	.;RL13A_HUMAN	S	76	.	ENSP00000375730:P76S	P	+	1	0	RPL13A	54685615	1.000000	0.71417	0.993000	0.49108	0.994000	0.84299	5.562000	0.67346	1.272000	0.44329	0.655000	0.94253	CCC	RPL13A	-	pfam_Ribosomal_L13,superfamily_Ribosomal_L13_dom,tigrfam_Ribosomal_L13_euk/arc		0.647	RPL13A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPL13A	HGNC	protein_coding	OTTHUMT00000258989.1	C			49993803	+1	no_errors	ENST00000391857	ensembl	human	known	70_37	missense	SNP	1.000	T
RPL34-AS1	285456	genome.wustl.edu	37	4	109519750	109519750	+	lincRNA	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:109519750C>G	ENST00000507248.1	-	0	90					NR_026968.1				RPL34 antisense RNA 1 (head to head)																		CTCCAACTTTCTTACTCTTCT	0.413																																																	0																																												285456					4q25	2014-06-09	2012-10-15		ENSG00000234492	ENSG00000234492		"""Long non-coding RNAs"""	26749	non-coding RNA	RNA, long non-coding			"""RPL34 antisense RNA 1 (non-protein coding)"", ""RPL34 antisense RNA 1"""			24908062	Standard	NR_026968		Approved	FLJ37673, RP11-462C24.1	uc011cfl.1		OTTHUMG00000161030		4.37:g.109519750C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000507248.1	37	NULL		4																																																																																			RPL34-AS1	-	-		0.413	RPL34-AS1-001	KNOWN	basic	lincRNA	RPL34-AS1	HGNC	lincRNA	OTTHUMT00000363481.1	C			109519750	-1	no_errors	ENST00000510212	ensembl	human	known	70_37	rna	SNP	0.001	G
RSPH10B2	728194	genome.wustl.edu	37	7	6825630	6825630	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:6825630C>T	ENST00000403107.1	+	15	2196	c.1809C>T	c.(1807-1809)gtC>gtT	p.V603V	RSPH10B2_ENST00000433859.2_Silent_p.V603V|RSPH10B2_ENST00000297186.3_Silent_p.V603V|RSPH10B2_ENST00000463354.2_3'UTR|RSPH10B2_ENST00000404077.1_Silent_p.V603V|RSPH10B2_ENST00000359718.3_3'UTR			B2RC85	R10B2_HUMAN	radial spoke head 10 homolog B2 (Chlamydomonas)	603										breast(3)|endometrium(1)|large_intestine(4)|lung(2)|ovary(2)|pancreas(1)|skin(2)	15						TTATGGAGGTCATAGCAGAGG	0.338																																																	0													23.0	25.0	25.0					7																	6825630		2138	4222	6360	SO:0001819	synonymous_variant	728194				CCDS43552.1	7p22.1	2008-07-04			ENSG00000169402	ENSG00000169402			34385	protein-coding gene	gene with protein product							Standard	NM_001099697		Approved		uc003sqw.1	B2RC85	OTTHUMG00000151856	ENST00000403107.1:c.1809C>T	7.37:g.6825630C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMW7|B2RXI4|B2RXJ0|Q86ST9|Q8NE68	Silent	SNP	pfam_MORN,smart_MORN	p.V603	ENST00000403107.1	37	c.1809	CCDS43552.1	7																																																																																			RSPH10B2	-	NULL		0.338	RSPH10B2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH10B2	HGNC	protein_coding	OTTHUMT00000324184.4	C	NM_001099697		6825630	+1	no_errors	ENST00000297186	ensembl	human	known	70_37	silent	SNP	0.950	T
RUNX1T1	862	genome.wustl.edu	37	8	93004062	93004062	+	Nonsense_Mutation	SNP	G	G	A	rs200629809		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:93004062G>A	ENST00000523629.1	-	7	1250	c.796C>T	c.(796-798)Cga>Tga	p.R266*	RUNX1T1_ENST00000518844.1_Nonsense_Mutation_p.R239*|RUNX1T1_ENST00000265814.3_Nonsense_Mutation_p.R266*|RUNX1T1_ENST00000520724.1_Nonsense_Mutation_p.R229*|RUNX1T1_ENST00000360348.2_Nonsense_Mutation_p.R229*|RUNX1T1_ENST00000436581.2_Nonsense_Mutation_p.R277*|RUNX1T1_ENST00000396218.1_Nonsense_Mutation_p.R239*|RUNX1T1_ENST00000422361.2_Nonsense_Mutation_p.R229*	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	266					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GTGCATGGTCGCTTGCTTGGA	0.488																																																	0													168.0	140.0	150.0					8																	93004062		2203	4300	6503	SO:0001587	stop_gained	862			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.796C>T	8.37:g.93004062G>A	ENSP00000428543:p.Arg266*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Nonsense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.R277*	ENST00000523629.1	37	c.829	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.505842	0.96371	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7919	20.2159	0.98296	0.0:0.0:1.0:0.0	.	.	.	.	X	266;239;266;229;229;229;277;239	.	ENSP00000265814:R266X	R	-	1	2	RUNX1T1	93073238	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.256000	0.58810	2.882000	0.98803	0.655000	0.94253	CGA	RUNX1T1	-	NULL		0.488	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	G	NM_004349, NM_175635		93004062	-1	no_errors	ENST00000436581	ensembl	human	known	70_37	nonsense	SNP	1.000	A
RUNX1T1	862	genome.wustl.edu	37	8	93004062	93004062	+	Nonsense_Mutation	SNP	G	G	A	rs200629809		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:93004062G>A	ENST00000523629.1	-	7	1250	c.796C>T	c.(796-798)Cga>Tga	p.R266*	RUNX1T1_ENST00000518844.1_Nonsense_Mutation_p.R239*|RUNX1T1_ENST00000265814.3_Nonsense_Mutation_p.R266*|RUNX1T1_ENST00000520724.1_Nonsense_Mutation_p.R229*|RUNX1T1_ENST00000360348.2_Nonsense_Mutation_p.R229*|RUNX1T1_ENST00000436581.2_Nonsense_Mutation_p.R277*|RUNX1T1_ENST00000396218.1_Nonsense_Mutation_p.R239*|RUNX1T1_ENST00000422361.2_Nonsense_Mutation_p.R229*	NM_001198626.1|NM_001198630.1|NM_001198633.1|NM_175634.2	NP_001185555.1|NP_001185559.1|NP_001185562.1|NP_783552.1	Q06455	MTG8_HUMAN	runt-related transcription factor 1; translocated to, 1 (cyclin D-related)	266					fat cell differentiation (GO:0045444)|generation of precursor metabolites and energy (GO:0006091)|regulation of DNA binding (GO:0051101)|transcription, DNA-templated (GO:0006351)	nuclear matrix (GO:0016363)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(17)|lung(54)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)	86			BRCA - Breast invasive adenocarcinoma(11;0.0141)			GTGCATGGTCGCTTGCTTGGA	0.488																																																	0													168.0	140.0	150.0					8																	93004062		2203	4300	6503	SO:0001587	stop_gained	862			D43638	CCDS6256.1, CCDS6257.1, CCDS47891.1, CCDS56544.1, CCDS75766.1, CCDS75767.1	8q22	2007-01-29	2005-01-20	2005-01-22	ENSG00000079102	ENSG00000079102		"""Zinc fingers, MYND-type"""	1535	protein-coding gene	gene with protein product		133435	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 1; cyclin D-related"""	AML1T1, CBFA2T1		1391946, 9790752	Standard	NM_004349		Approved	CDR, ETO, MTG8, ZMYND2	uc011lgi.2	Q06455	OTTHUMG00000164066	ENST00000523629.1:c.796C>T	8.37:g.93004062G>A	ENSP00000428543:p.Arg266*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z4P4|E7EPN4|O14784|Q06456|Q14873|Q16239|Q16346|Q16347|Q6IBL1|Q6NXH1|Q7Z4J5|Q92479|Q9BRZ0	Nonsense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG8	p.R277*	ENST00000523629.1	37	c.829	CCDS6256.1	8	.	.	.	.	.	.	.	.	.	.	G	35	5.505842	0.96371	.	.	ENSG00000079102	ENST00000523629;ENST00000396218;ENST00000265814;ENST00000360348;ENST00000422361;ENST00000520724;ENST00000436581;ENST00000518844	.	.	.	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.7919	20.2159	0.98296	0.0:0.0:1.0:0.0	.	.	.	.	X	266;239;266;229;229;229;277;239	.	ENSP00000265814:R266X	R	-	1	2	RUNX1T1	93073238	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.256000	0.58810	2.882000	0.98803	0.655000	0.94253	CGA	RUNX1T1	-	NULL		0.488	RUNX1T1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUNX1T1	HGNC	protein_coding	OTTHUMT00000377045.3	G	NM_004349, NM_175635		93004062	-1	no_errors	ENST00000436581	ensembl	human	known	70_37	nonsense	SNP	1.000	A
SCN8A	6334	genome.wustl.edu	37	12	52180553	52180553	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:52180553G>A	ENST00000354534.6	+	22	4348	c.4170G>A	c.(4168-4170)aaG>aaA	p.K1390K	SCN8A_ENST00000545061.1_Silent_p.K1349K	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	1390					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.K1390N(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TCAGATGGAAGAACGTGAAGA	0.358																																																	2	Substitution - Missense(2)	lung(2)											80.0	81.0	81.0					12																	52180553		1888	4107	5995	SO:0001819	synonymous_variant	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.4170G>A	12.37:g.52180553G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9VWG8|O95788|Q9NYX2|Q9UPB2	Silent	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.K1390	ENST00000354534.6	37	c.4170	CCDS44891.1	12																																																																																			SCN8A	-	pfam_Ion_trans_dom		0.358	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	G	NM_014191		52180553	+1	no_errors	ENST00000354534	ensembl	human	known	70_37	silent	SNP	1.000	A
SEC24B-AS1	100533182	genome.wustl.edu	37	4	110268728	110268728	+	RNA	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:110268728G>C	ENST00000499713.2	-	0	1335									SEC24B antisense RNA 1																		TGCCGGGTCTGAGGACCAAAC	0.512																																																	0																																												100533182			BC009800		4q25	2012-10-12	2012-08-15		ENSG00000247950	ENSG00000247950		"""Long non-coding RNAs"""	44003	non-coding RNA	RNA, long non-coding			"""SEC24B antisense RNA 1 (non-protein coding)"""			21307942	Standard	NR_039978		Approved	1/2-SBSRNA4	uc003hzj.4		OTTHUMG00000161048		4.37:g.110268728G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000499713.2	37	NULL		4																																																																																			SEC24B-AS1	-	-		0.512	SEC24B-AS1-001	KNOWN	basic	antisense	SEC24B-AS1	HGNC	antisense	OTTHUMT00000363574.2	G	NR_039978		110268728	-1	no_errors	ENST00000499713	ensembl	human	known	70_37	rna	SNP	0.002	C
SEC24C	9632	genome.wustl.edu	37	10	75511672	75511672	+	Intron	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:75511672C>G	ENST00000339365.2	+	4	470				SEC24C_ENST00000411652.2_Intron|SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000345254.4_Intron|SEC24C_ENST00000546025.1_Intron	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					ATTTGCATCTCTTTTGACTTG	0.413																																																	0																																										SO:0001627	intron_variant	9632			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.308+671C>G	10.37:g.75511672C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZT4|Q8WV25	RNA	SNP	-	NULL	ENST00000339365.2	37	NULL	CCDS7332.1	10																																																																																			SEC24C	-	-		0.413	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	C			75511672	+1	no_errors	ENST00000477008	ensembl	human	known	70_37	rna	SNP	0.001	G
SGSM1	129049	genome.wustl.edu	37	22	25294203	25294203	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:25294203G>A	ENST00000400359.4	+	20	2459	c.2452G>A	c.(2452-2454)Gag>Aag	p.E818K	SNORD56_ENST00000362913.1_RNA|SGSM1_ENST00000400358.4_Missense_Mutation_p.E763K	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	818	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GCAGAGCAGCGAGGCCACCAC	0.637																																																	0													33.0	41.0	38.0					22																	25294203		2188	4289	6477	SO:0001583	missense	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2452G>A	22.37:g.25294203G>A	ENSP00000383212:p.Glu818Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.E818K	ENST00000400359.4	37	c.2452	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806429	0.31961	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.06849	3.26;3.25	5.24	1.93	0.25924	Rab-GAP/TBC domain (2);	0.855129	0.10273	U	0.694579	T	0.02571	0.0078	N	0.04636	-0.2	0.29536	N	0.85245	P;P;B;P	0.44429	0.693;0.835;0.236;0.802	B;B;B;B	0.31016	0.057;0.123;0.017;0.084	T	0.29212	-1.0019	10	0.13853	T	0.58	-21.048	6.601	0.22701	0.1663:0.3015:0.5322:0.0	.	763;818;835;818	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	K	818;763;818	ENSP00000383211:E763K;ENSP00000383212:E818K	ENSP00000383211:E763K	E	+	1	0	SGSM1	23624203	0.000000	0.05858	0.989000	0.46669	0.928000	0.56348	0.064000	0.14437	0.706000	0.31912	-0.274000	0.10170	GAG	SGSM1	-	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.637	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	G	XM_059318		25294203	+1	no_errors	ENST00000400359	ensembl	human	known	70_37	missense	SNP	0.823	A
SGSM1	129049	genome.wustl.edu	37	22	25294203	25294203	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:25294203G>A	ENST00000400359.4	+	20	2459	c.2452G>A	c.(2452-2454)Gag>Aag	p.E818K	SNORD56_ENST00000362913.1_RNA|SGSM1_ENST00000400358.4_Missense_Mutation_p.E763K	NM_001039948.2|NM_133454.2	NP_001035037.1|NP_597711.1	Q2NKQ1	SGSM1_HUMAN	small G protein signaling modulator 1	818	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.					Golgi apparatus (GO:0005794)	Rab GTPase activator activity (GO:0005097)			NS(2)|breast(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(14)|lung(10)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	41						GCAGAGCAGCGAGGCCACCAC	0.637																																																	0													33.0	41.0	38.0					22																	25294203		2188	4289	6477	SO:0001583	missense	129049			AB075821	CCDS46674.1, CCDS46675.1, CCDS74834.1	22q11.23	2013-07-09	2007-08-14	2007-08-14	ENSG00000167037	ENSG00000167037		"""Small G protein signaling modulators"""	29410	protein-coding gene	gene with protein product		611417	"""RUN and TBC1 domain containing 2"""	RUTBC2		11853319, 17509819, 22637480	Standard	NM_133454		Approved	KIAA1941	uc003abg.2	Q2NKQ1	OTTHUMG00000150837	ENST00000400359.4:c.2452G>A	22.37:g.25294203G>A	ENSP00000383212:p.Glu818Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A5LGW1|A8MUT4|B0QYW0|B0QYW1|B5MEG1|B9A6J4|Q5TFL3|Q8TF60	Missense_Mutation	SNP	pfam_Run,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Run,smart_Rab-GTPase-TBC_dom,pfscan_Run,pfscan_Rab-GTPase-TBC_dom	p.E818K	ENST00000400359.4	37	c.2452	CCDS46674.1	22	.	.	.	.	.	.	.	.	.	.	G	12.00	1.806429	0.31961	.	.	ENSG00000167037	ENST00000403206;ENST00000400358;ENST00000400359	T;T	0.06849	3.26;3.25	5.24	1.93	0.25924	Rab-GAP/TBC domain (2);	0.855129	0.10273	U	0.694579	T	0.02571	0.0078	N	0.04636	-0.2	0.29536	N	0.85245	P;P;B;P	0.44429	0.693;0.835;0.236;0.802	B;B;B;B	0.31016	0.057;0.123;0.017;0.084	T	0.29212	-1.0019	10	0.13853	T	0.58	-21.048	6.601	0.22701	0.1663:0.3015:0.5322:0.0	.	763;818;835;818	Q2NKQ1-4;C9J7S8;Q2NKQ1-3;Q2NKQ1	.;.;.;SGSM1_HUMAN	K	818;763;818	ENSP00000383211:E763K;ENSP00000383212:E818K	ENSP00000383211:E763K	E	+	1	0	SGSM1	23624203	0.000000	0.05858	0.989000	0.46669	0.928000	0.56348	0.064000	0.14437	0.706000	0.31912	-0.274000	0.10170	GAG	SGSM1	-	superfamily_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.637	SGSM1-004	KNOWN	basic|CCDS	protein_coding	SGSM1	HGNC	protein_coding	OTTHUMT00000320282.1	G	XM_059318		25294203	+1	no_errors	ENST00000400359	ensembl	human	known	70_37	missense	SNP	0.823	A
SHCBP1L	81626	genome.wustl.edu	37	1	182908672	182908672	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:182908672G>C	ENST00000367547.3	-	4	1023	c.787C>G	c.(787-789)Ctt>Gtt	p.L263V	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_Missense_Mutation_p.L144V	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	335										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TCTCTCCAAAGAAAGTCATAA	0.308																																																	0													25.0	23.0	24.0					1																	182908672		2187	4279	6466	SO:0001583	missense	81626			AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.787C>G	1.37:g.182908672G>C	ENSP00000356518:p.Leu263Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	superfamily_Pectin_lyase_fold/virulence,smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	p.L263V	ENST00000367547.3	37	c.787	CCDS30955.1	1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010467	0.54361	.	.	ENSG00000157060	ENST00000367547;ENST00000287709;ENST00000423786	T;T	0.55234	0.53;0.57	4.87	4.87	0.63330	.	0.000000	0.49305	D	0.000152	T	0.68247	0.2980	L	0.59436	1.845	0.36527	D	0.870516	D;D	0.71674	0.998;0.996	D;D	0.83275	0.996;0.986	T	0.74487	-0.3649	10	0.49607	T	0.09	-14.3604	14.9335	0.70935	0.0:0.0:1.0:0.0	.	144;263	Q9BZQ2-2;Q9BZQ2-3	.;.	V	263;332;144	ENSP00000356518:L263V;ENSP00000397308:L144V	ENSP00000287709:L332V	L	-	1	0	SHCBP1L	181175295	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.360000	0.66086	2.253000	0.74438	0.563000	0.77884	CTT	SHCBP1L	-	NULL		0.308	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1L	HGNC	protein_coding	OTTHUMT00000085956.1	G	NM_030933		182908672	-1	no_errors	ENST00000367547	ensembl	human	known	70_37	missense	SNP	1.000	C
SHCBP1L	81626	genome.wustl.edu	37	1	182908672	182908672	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:182908672G>C	ENST00000367547.3	-	4	1023	c.787C>G	c.(787-789)Ctt>Gtt	p.L263V	SHCBP1L_ENST00000488956.1_5'UTR|SHCBP1L_ENST00000423786.1_Missense_Mutation_p.L144V	NM_030933.2	NP_112195.2	Q9BZQ2	SHP1L_HUMAN	SHC SH2-domain binding protein 1-like	335										breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(1)|lung(2)|pancreas(1)|prostate(1)|skin(2)	15						TCTCTCCAAAGAAAGTCATAA	0.308																																																	0													25.0	23.0	24.0					1																	182908672		2187	4279	6466	SO:0001583	missense	81626			AF288397	CCDS30955.1	1q25	2011-01-24	2011-01-24	2011-01-24	ENSG00000157060	ENSG00000157060			16788	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 14"""	C1orf14		11318611	Standard	NM_030933		Approved		uc001gpu.3	Q9BZQ2	OTTHUMG00000035419	ENST00000367547.3:c.787C>G	1.37:g.182908672G>C	ENSP00000356518:p.Leu263Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G195|Q9BZQ3|Q9H2B6	Missense_Mutation	SNP	superfamily_Pectin_lyase_fold/virulence,smart_Carb-bd_sugar_hydrolysis-dom,smart_PbH1	p.L263V	ENST00000367547.3	37	c.787	CCDS30955.1	1	.	.	.	.	.	.	.	.	.	.	G	16.04	3.010467	0.54361	.	.	ENSG00000157060	ENST00000367547;ENST00000287709;ENST00000423786	T;T	0.55234	0.53;0.57	4.87	4.87	0.63330	.	0.000000	0.49305	D	0.000152	T	0.68247	0.2980	L	0.59436	1.845	0.36527	D	0.870516	D;D	0.71674	0.998;0.996	D;D	0.83275	0.996;0.986	T	0.74487	-0.3649	10	0.49607	T	0.09	-14.3604	14.9335	0.70935	0.0:0.0:1.0:0.0	.	144;263	Q9BZQ2-2;Q9BZQ2-3	.;.	V	263;332;144	ENSP00000356518:L263V;ENSP00000397308:L144V	ENSP00000287709:L332V	L	-	1	0	SHCBP1L	181175295	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.360000	0.66086	2.253000	0.74438	0.563000	0.77884	CTT	SHCBP1L	-	NULL		0.308	SHCBP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHCBP1L	HGNC	protein_coding	OTTHUMT00000085956.1	G	NM_030933		182908672	-1	no_errors	ENST00000367547	ensembl	human	known	70_37	missense	SNP	1.000	C
SHROOM4	57477	genome.wustl.edu	37	X	50341494	50341494	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:50341494C>T	ENST00000289292.7	-	8	4267	c.3984G>A	c.(3982-3984)ttG>ttA	p.L1328L	SHROOM4_ENST00000376020.2_Silent_p.L1328L|SHROOM4_ENST00000483955.1_5'Flank|SHROOM4_ENST00000460112.3_Silent_p.L1212L			Q9ULL8	SHRM4_HUMAN	shroom family member 4	1328	ASD2. {ECO:0000255|PROSITE- ProRule:PRU00638}.				actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|brain development (GO:0007420)|cognition (GO:0050890)	apical plasma membrane (GO:0016324)|basal plasma membrane (GO:0009925)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|myosin II complex (GO:0016460)|stress fiber (GO:0001725)	actin filament binding (GO:0051015)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(5)|large_intestine(6)|liver(1)|lung(20)|ovary(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	52	Ovarian(276;0.236)					GGGCCTCCCGCAAGACAGAAA	0.478																																																	0													29.0	23.0	25.0					X																	50341494		2203	4300	6503	SO:0001819	synonymous_variant	57477			AB033028	CCDS35277.1	Xp11.22	2008-02-05			ENSG00000158352	ENSG00000158352			29215	protein-coding gene	gene with protein product		300579				10574462, 16615870	Standard	NR_027121		Approved	KIAA1202	uc004dpe.2	Q9ULL8	OTTHUMG00000021521	ENST00000289292.7:c.3984G>A	X.37:g.50341494C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2X9|D6RFW0|Q96LA0	Silent	SNP	pfam_ASD2,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L1328	ENST00000289292.7	37	c.3984	CCDS35277.1	X																																																																																			SHROOM4	-	pfam_ASD2		0.478	SHROOM4-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	SHROOM4	HGNC	protein_coding	OTTHUMT00000056564.4	C	NM_020717		50341494	-1	no_errors	ENST00000289292	ensembl	human	known	70_37	silent	SNP	1.000	T
SKAP1	8631	genome.wustl.edu	37	17	46239875	46239875	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:46239875C>T	ENST00000336915.6	-	11	1003	c.934G>A	c.(934-936)Gaa>Aaa	p.E312K	SKAP1_ENST00000584924.1_Missense_Mutation_p.E312K	NM_001075099.1|NM_003726.3	NP_001068567.1|NP_003717.3	Q86WV1	SKAP1_HUMAN	src kinase associated phosphoprotein 1	312	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				positive regulation of signal transduction (GO:0009967)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|SH2 domain binding (GO:0042169)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			large_intestine(1)|lung(10)|prostate(2)|skin(4)|urinary_tract(1)	18						AAGGACAGTTCATCTGGCTGG	0.423																																																	0													110.0	92.0	98.0					17																	46239875		2203	4300	6503	SO:0001583	missense	8631			Y11215	CCDS32674.1	17q21.32	2013-01-10	2006-09-28	2006-09-28		ENSG00000141293		"""Pleckstrin homology (PH) domain containing"""	15605	protein-coding gene	gene with protein product		604969	"""src family associated phosphoprotein 1"""	SCAP1		9195899	Standard	NM_003726		Approved	SKAP55	uc002ini.1	Q86WV1		ENST00000336915.6:c.934G>A	17.37:g.46239875C>T	ENSP00000338171:p.Glu312Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTV1|O15268	Missense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,prints_SH3_domain	p.E312K	ENST00000336915.6	37	c.934	CCDS32674.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.071620	0.93950	.	.	ENSG00000141293	ENST00000336915	T	0.63255	-0.03	5.84	5.84	0.93424	Src homology-3 domain (5);	0.000000	0.85682	D	0.000000	D	0.83811	0.5335	M	0.90483	3.12	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.998	D	0.86358	0.1715	10	0.87932	D	0	.	18.9061	0.92462	0.0:1.0:0.0:0.0	.	311;312	Q86WV1-2;Q86WV1	.;SKAP1_HUMAN	K	312	ENSP00000338171:E312K	ENSP00000338171:E312K	E	-	1	0	SKAP1	43594874	1.000000	0.71417	0.992000	0.48379	0.997000	0.91878	7.317000	0.79018	2.765000	0.95021	0.655000	0.94253	GAA	SKAP1	-	pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain		0.423	SKAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SKAP1	HGNC	protein_coding	OTTHUMT00000443432.1	C	NM_003726		46239875	-1	no_errors	ENST00000336915	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC1A2	6506	genome.wustl.edu	37	11	35308464	35308464	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:35308464C>G	ENST00000278379.3	-	8	1408	c.1126G>C	c.(1126-1128)Gaa>Caa	p.E376Q	RP1-68D18.3_ENST00000532760.1_RNA|SLC1A2_ENST00000395750.1_Missense_Mutation_p.E367Q|SLC1A2_ENST00000395753.1_Missense_Mutation_p.E367Q|SLC1A2_ENST00000479543.1_5'Flank|SLC1A2_ENST00000606205.1_Missense_Mutation_p.E376Q	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	376					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			AGATTTTCTTCCAGGCAACGA	0.463																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)												0													155.0	149.0	151.0					11																	35308464		2202	4298	6500	SO:0001583	missense	6506			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1126G>C	11.37:g.35308464C>G	ENSP00000278379:p.Glu376Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.E376Q	ENST00000278379.3	37	c.1126	CCDS31459.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.889942|4.889942	0.91889|0.91889	.|.	.|.	ENSG00000110436|ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753|ENST00000531628	T;T;T|.	0.61980|.	0.06;0.06;0.06|.	5.62|5.62	4.71|4.71	0.59529|0.59529	.|.	0.086454|.	0.85682|.	D|.	0.000000|.	T|T	0.72669|0.72669	0.3489|0.3489	M|M	0.70842|0.70842	2.15|2.15	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.995;0.999|.	T|T	0.73269|0.73269	-0.4036|-0.4036	10|5	0.72032|.	D|.	0.01|.	-18.6683|-18.6683	14.8568|14.8568	0.70344|0.70344	0.0:0.9308:0.0:0.0692|0.0:0.9308:0.0:0.0692	.|.	376;376|.	B4DQE9;P43004|.	.;EAA2_HUMAN|.	Q|C	376;367;367|93	ENSP00000278379:E376Q;ENSP00000379099:E367Q;ENSP00000379102:E367Q|.	ENSP00000278379:E376Q|.	E|W	-|-	1|3	0|0	SLC1A2|SLC1A2	35265040|35265040	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.776000|7.776000	0.85560|0.85560	1.517000|1.517000	0.48917|0.48917	0.561000|0.561000	0.74099|0.74099	GAA|TGG	SLC1A2	-	pfam_Na-dicarboxylate_symporter		0.463	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	SLC1A2	HGNC	protein_coding	OTTHUMT00000258181.1	C	NM_004171		35308464	-1	no_errors	ENST00000278379	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC1A2	6506	genome.wustl.edu	37	11	35308464	35308464	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr11:35308464C>G	ENST00000278379.3	-	8	1408	c.1126G>C	c.(1126-1128)Gaa>Caa	p.E376Q	RP1-68D18.3_ENST00000532760.1_RNA|SLC1A2_ENST00000395750.1_Missense_Mutation_p.E367Q|SLC1A2_ENST00000395753.1_Missense_Mutation_p.E367Q|SLC1A2_ENST00000479543.1_5'Flank|SLC1A2_ENST00000606205.1_Missense_Mutation_p.E376Q	NM_004171.3	NP_004162.2	P43004	EAA2_HUMAN	solute carrier family 1 (glial high affinity glutamate transporter), member 2	376					adult behavior (GO:0030534)|cellular response to extracellular stimulus (GO:0031668)|D-aspartate import (GO:0070779)|ion transport (GO:0006811)|L-glutamate import (GO:0051938)|multicellular organism growth (GO:0035264)|multicellular organismal aging (GO:0010259)|positive regulation of glucose import (GO:0046326)|response to amino acid (GO:0043200)|response to drug (GO:0042493)|response to wounding (GO:0009611)|synaptic transmission (GO:0007268)|telencephalon development (GO:0021537)|transmembrane transport (GO:0055085)|visual behavior (GO:0007632)	axolemma (GO:0030673)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	glutamate:sodium symporter activity (GO:0015501)|L-glutamate transmembrane transporter activity (GO:0005313)|sodium:dicarboxylate symporter activity (GO:0017153)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(11)|ovary(2)|prostate(1)|urinary_tract(1)	24	all_lung(20;0.211)|all_epithelial(35;0.234)	all_hematologic(20;0.109)	STAD - Stomach adenocarcinoma(6;0.00731)			AGATTTTCTTCCAGGCAACGA	0.463																																					NSCLC(100;1273 1575 12993 16869 47409)|Ovarian(164;45 1946 8965 30452 48454)												0													155.0	149.0	151.0					11																	35308464		2202	4298	6500	SO:0001583	missense	6506			AB209444	CCDS31459.1, CCDS55756.1	11p13-p12	2013-05-22			ENSG00000110436	ENSG00000110436		"""Solute carriers"""	10940	protein-coding gene	gene with protein product		600300				1448170	Standard	NM_004171		Approved	GLT-1, EAAT2	uc001mwd.3	P43004	OTTHUMG00000044391	ENST00000278379.3:c.1126G>C	11.37:g.35308464C>G	ENSP00000278379:p.Glu376Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQE9|Q14417|Q541G6|U3KQQ4	Missense_Mutation	SNP	pfam_Na-dicarboxylate_symporter,prints_Na-dicarboxylate_symporter	p.E376Q	ENST00000278379.3	37	c.1126	CCDS31459.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.1|28.1	4.889942|4.889942	0.91889|0.91889	.|.	.|.	ENSG00000110436|ENSG00000110436	ENST00000278379;ENST00000395750;ENST00000395753|ENST00000531628	T;T;T|.	0.61980|.	0.06;0.06;0.06|.	5.62|5.62	4.71|4.71	0.59529|0.59529	.|.	0.086454|.	0.85682|.	D|.	0.000000|.	T|T	0.72669|0.72669	0.3489|0.3489	M|M	0.70842|0.70842	2.15|2.15	0.80722|0.80722	D|D	1|1	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.995;0.999|.	T|T	0.73269|0.73269	-0.4036|-0.4036	10|5	0.72032|.	D|.	0.01|.	-18.6683|-18.6683	14.8568|14.8568	0.70344|0.70344	0.0:0.9308:0.0:0.0692|0.0:0.9308:0.0:0.0692	.|.	376;376|.	B4DQE9;P43004|.	.;EAA2_HUMAN|.	Q|C	376;367;367|93	ENSP00000278379:E376Q;ENSP00000379099:E367Q;ENSP00000379102:E367Q|.	ENSP00000278379:E376Q|.	E|W	-|-	1|3	0|0	SLC1A2|SLC1A2	35265040|35265040	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.991000|0.991000	0.79684|0.79684	7.776000|7.776000	0.85560|0.85560	1.517000|1.517000	0.48917|0.48917	0.561000|0.561000	0.74099|0.74099	GAA|TGG	SLC1A2	-	pfam_Na-dicarboxylate_symporter		0.463	SLC1A2-001	KNOWN	basic|CCDS	protein_coding	SLC1A2	HGNC	protein_coding	OTTHUMT00000258181.1	C	NM_004171		35308464	-1	no_errors	ENST00000278379	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC4A1AP	22950	genome.wustl.edu	37	2	27892132	27892132	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:27892132C>G	ENST00000326019.6	+	5	1505	c.1223C>G	c.(1222-1224)tCa>tGa	p.S408*		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	408						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					GTGGACGATTCAACTGGAAAA	0.398																																																	0													188.0	187.0	188.0					2																	27892132		2203	4300	6503	SO:0001587	stop_gained	22950				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1223C>G	2.37:g.27892132C>G	ENSP00000323837:p.Ser408*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Nonsense_Mutation	SNP	pfam_FHA_dom,pfam_Ds-RNA-bd,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S408*	ENST00000326019.6	37	c.1223	CCDS33166.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.441291	0.98813	.	.	ENSG00000163798	ENST00000326019	.	.	.	5.65	5.65	0.86999	.	0.052606	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-12.8024	19.7408	0.96230	0.0:1.0:0.0:0.0	.	.	.	.	X	408	.	ENSP00000323837:S408X	S	+	2	0	SLC4A1AP	27745636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.757000	0.68766	2.671000	0.90904	0.650000	0.86243	TCA	SLC4A1AP	-	pfam_Ds-RNA-bd		0.398	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	C	NM_018158		27892132	+1	no_errors	ENST00000326019	ensembl	human	known	70_37	nonsense	SNP	1.000	G
SLC4A1AP	22950	genome.wustl.edu	37	2	27892132	27892132	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:27892132C>G	ENST00000326019.6	+	5	1505	c.1223C>G	c.(1222-1224)tCa>tGa	p.S408*		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	408						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					GTGGACGATTCAACTGGAAAA	0.398																																																	0													188.0	187.0	188.0					2																	27892132		2203	4300	6503	SO:0001587	stop_gained	22950				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1223C>G	2.37:g.27892132C>G	ENSP00000323837:p.Ser408*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Nonsense_Mutation	SNP	pfam_FHA_dom,pfam_Ds-RNA-bd,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.S408*	ENST00000326019.6	37	c.1223	CCDS33166.1	2	.	.	.	.	.	.	.	.	.	.	C	40	8.441291	0.98813	.	.	ENSG00000163798	ENST00000326019	.	.	.	5.65	5.65	0.86999	.	0.052606	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-12.8024	19.7408	0.96230	0.0:1.0:0.0:0.0	.	.	.	.	X	408	.	ENSP00000323837:S408X	S	+	2	0	SLC4A1AP	27745636	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.757000	0.68766	2.671000	0.90904	0.650000	0.86243	TCA	SLC4A1AP	-	pfam_Ds-RNA-bd		0.398	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	C	NM_018158		27892132	+1	no_errors	ENST00000326019	ensembl	human	known	70_37	nonsense	SNP	1.000	G
SLC4A4	8671	genome.wustl.edu	37	4	72432749	72432749	+	Frame_Shift_Del	DEL	C	C	-			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:72432749delC	ENST00000264485.5	+	25	3342	c.3225delC	c.(3223-3225)cgcfs	p.R1075fs	SLC4A4_ENST00000425175.1_Frame_Shift_Del_p.A1043fs|SLC4A4_ENST00000340595.3_Frame_Shift_Del_p.R1031fs|SLC4A4_ENST00000351898.6_Frame_Shift_Del_p.R991fs	NM_001098484.2	NP_001091954.1	Q9Y6R1	S4A4_HUMAN	solute carrier family 4 (sodium bicarbonate cotransporter), member 4	1075					bicarbonate transport (GO:0015701)|ion transport (GO:0006811)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|transport (GO:0006810)	basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	inorganic anion exchanger activity (GO:0005452)|sodium:bicarbonate symporter activity (GO:0008510)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(1)|lung(21)|ovary(3)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	58			Lung(101;0.0739)|LUSC - Lung squamous cell carcinoma(112;0.225)		Sodium bicarbonate(DB01390)	TCCTTGAACGCCACACATCAT	0.353																																																	0													143.0	131.0	135.0					4																	72432749		2203	4300	6503	SO:0001589	frameshift_variant	8671			AF007216	CCDS3549.1, CCDS43236.1, CCDS47071.1	4q13.3	2013-07-19	2013-07-19		ENSG00000080493	ENSG00000080493		"""Solute carriers"""	11030	protein-coding gene	gene with protein product		603345	"""solute carrier family 4, sodium bicarbonate cotransporter, member 4"""	SLC4A5		9235899, 9651366	Standard	NM_001098484		Approved	NBC1, HNBC1, NBC2, pNBC, hhNMC	uc010iic.3	Q9Y6R1	OTTHUMG00000129907	ENST00000264485.5:c.3225delC	4.37:g.72432749delC	ENSP00000264485:p.Arg1075fs	Somatic		WXS	Illumina HiSeq	Phase_IV	C4B714|O15153|Q8NEJ2|Q9H262|Q9NRZ1|Q9UIC0|Q9UIC1|Q9UP50	Frame_Shift_Del	DEL	pfam_HCO3_transpt_C,pfam_HCO3_transpt_cyt,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk,prints_Na/HCO3_transpt,tigrfam_HCO3_transpt_euk	p.T1044fs	ENST00000264485.5	37	c.3128	CCDS43236.1	4																																																																																			SLC4A4	-	NULL		0.353	SLC4A4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A4	HGNC	protein_coding	OTTHUMT00000362090.1	C	NM_003759		72432749	+1	no_errors	ENST00000425175	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
SLC7A9	11136	genome.wustl.edu	37	19	33355545	33355545	+	Silent	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:33355545G>C	ENST00000023064.4	-	3	416	c.225C>G	c.(223-225)ctC>ctG	p.L75L	SLC7A9_ENST00000587772.1_Silent_p.L75L|SLC7A9_ENST00000590341.1_Silent_p.L75L|RN7SKP22_ENST00000365097.1_RNA	NM_001126335.1|NM_001243036.1|NM_014270.4	NP_001119807.1|NP_001229965.1|NP_055085.1	P82251	BAT1_HUMAN	solute carrier family 7 (amino acid transporter light chain, bo,+ system), member 9	75					amino acid transport (GO:0006865)|blood coagulation (GO:0007596)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|L-cystine transport (GO:0015811)|leukocyte migration (GO:0050900)|neutral amino acid transport (GO:0015804)|protein complex assembly (GO:0006461)|transmembrane transport (GO:0055085)|transport (GO:0006810)	brush border membrane (GO:0031526)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|L-cystine transmembrane transporter activity (GO:0015184)|neutral amino acid transmembrane transporter activity (GO:0015175)|peptide antigen binding (GO:0042605)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(12)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	32	Esophageal squamous(110;0.137)				L-Cystine(DB00138)	CCAGCGTCGCGAGGACCCCGC	0.632																																					GBM(181;1335 2108 9644 44178 46689)												0													71.0	70.0	71.0					19																	33355545		2203	4300	6503	SO:0001819	synonymous_variant	11136			AF141289	CCDS12425.1	19q13.11	2013-07-19	2013-07-19		ENSG00000021488	ENSG00000021488		"""Solute carriers"""	11067	protein-coding gene	gene with protein product		604144		CSNU3		10471498	Standard	NM_014270		Approved		uc021usa.1	P82251	OTTHUMG00000180287	ENST00000023064.4:c.225C>G	19.37:g.33355545G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9A6	Silent	SNP	pfam_AA-permease_dom,pirsf_AA/rel_permease1	p.L75	ENST00000023064.4	37	c.225	CCDS12425.1	19																																																																																			SLC7A9	-	pfam_AA-permease_dom,pirsf_AA/rel_permease1		0.632	SLC7A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC7A9	HGNC	protein_coding	OTTHUMT00000450585.1	G			33355545	-1	no_errors	ENST00000023064	ensembl	human	known	70_37	silent	SNP	0.023	C
SMG1	23049	genome.wustl.edu	37	16	18840660	18840660	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:18840660G>T	ENST00000446231.2	-	54	9963	c.9551C>A	c.(9550-9552)tCt>tAt	p.S3184Y	SMG1_ENST00000389467.3_Missense_Mutation_p.S3184Y			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3184					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTTACAAGAAGAAATACTGGT	0.433																																																	0													55.0	52.0	53.0					16																	18840660		1902	4121	6023	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9551C>A	16.37:g.18840660G>T	ENSP00000402515:p.Ser3184Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S3184Y	ENST00000446231.2	37	c.9551	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782329	0.49891	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01092	5.35;5.35	5.85	4.9	0.64082	.	0.374831	0.26321	N	0.025054	T	0.01029	0.0034	N	0.08118	0	0.33373	D	0.57386	B	0.20671	0.047	B	0.17098	0.017	T	0.48340	-0.9044	10	0.72032	D	0.01	.	15.0276	0.71682	0.068:0.0:0.932:0.0	.	3184	Q96Q15	SMG1_HUMAN	Y	3184	ENSP00000402515:S3184Y;ENSP00000374118:S3184Y	ENSP00000374118:S3184Y	S	-	2	0	SMG1	18748161	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.043000	0.76572	1.492000	0.48499	0.579000	0.79373	TCT	SMG1	-	NULL		0.433	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	G	NM_015092		18840660	-1	no_errors	ENST00000389467	ensembl	human	known	70_37	missense	SNP	1.000	T
SMG1	23049	genome.wustl.edu	37	16	18840660	18840660	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:18840660G>T	ENST00000446231.2	-	54	9963	c.9551C>A	c.(9550-9552)tCt>tAt	p.S3184Y	SMG1_ENST00000389467.3_Missense_Mutation_p.S3184Y			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3184					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CTTACAAGAAGAAATACTGGT	0.433																																																	0													55.0	52.0	53.0					16																	18840660		1902	4121	6023	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9551C>A	16.37:g.18840660G>T	ENSP00000402515:p.Ser3184Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.S3184Y	ENST00000446231.2	37	c.9551	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	15.27	2.782329	0.49891	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01092	5.35;5.35	5.85	4.9	0.64082	.	0.374831	0.26321	N	0.025054	T	0.01029	0.0034	N	0.08118	0	0.33373	D	0.57386	B	0.20671	0.047	B	0.17098	0.017	T	0.48340	-0.9044	10	0.72032	D	0.01	.	15.0276	0.71682	0.068:0.0:0.932:0.0	.	3184	Q96Q15	SMG1_HUMAN	Y	3184	ENSP00000402515:S3184Y;ENSP00000374118:S3184Y	ENSP00000374118:S3184Y	S	-	2	0	SMG1	18748161	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.043000	0.76572	1.492000	0.48499	0.579000	0.79373	TCT	SMG1	-	NULL		0.433	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	G	NM_015092		18840660	-1	no_errors	ENST00000389467	ensembl	human	known	70_37	missense	SNP	1.000	T
SNORA71D	677840	genome.wustl.edu	37	20	37062622	37062622	+	RNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:37062622G>A	ENST00000363484.1	-	0	19					NR_003018.2				small nucleolar RNA, H/ACA box 71D																		GGCAGCCCACGATCACTTTCG	0.562																																																	0													152.0	144.0	147.0					20																	37062622		876	1991	2867			677840					20q11.23	2013-09-05			ENSG00000200354	ENSG00000200354		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32657	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_003018		Approved	U71d	uc002xio.1				20.37:g.37062622G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000363484.1	37	NULL		20																																																																																			SNORA71D	-	-		0.562	SNORA71D-201	KNOWN	basic	snoRNA	SNORA71D	HGNC	snoRNA		G	NR_003018		37062622	-1	no_errors	ENST00000363484	ensembl	human	known	70_37	rna	SNP	0.041	A
SNORA71D	677840	genome.wustl.edu	37	20	37062622	37062622	+	RNA	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:37062622G>A	ENST00000363484.1	-	0	19					NR_003018.2				small nucleolar RNA, H/ACA box 71D																		GGCAGCCCACGATCACTTTCG	0.562																																																	0													152.0	144.0	147.0					20																	37062622		876	1991	2867			677840					20q11.23	2013-09-05			ENSG00000200354	ENSG00000200354		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32657	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_003018		Approved	U71d	uc002xio.1				20.37:g.37062622G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000363484.1	37	NULL		20																																																																																			SNORA71D	-	-		0.562	SNORA71D-201	KNOWN	basic	snoRNA	SNORA71D	HGNC	snoRNA		G	NR_003018		37062622	-1	no_errors	ENST00000363484	ensembl	human	known	70_37	rna	SNP	0.041	A
NCL	4691	genome.wustl.edu	37	2	232325126	232325126	+	Intron	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:232325126T>C	ENST00000322723.4	-	5	1139				SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin						angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CAGTATTAAGTCCCTTTGTTA	0.388																																																	0													167.0	150.0	155.0					2																	232325126		876	1991	2867	SO:0001627	intron_variant	25826				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.898+62A>G	2.37:g.232325126T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	RNA	SNP	-	NULL	ENST00000322723.4	37	NULL	CCDS33397.1	2																																																																																			SNORD82	-	-		0.388	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD82	HGNC	protein_coding	OTTHUMT00000332731.1	T	NM_005381		232325126	-1	no_errors	ENST00000365530	ensembl	human	known	70_37	rna	SNP	1.000	C
NCL	4691	genome.wustl.edu	37	2	232325126	232325126	+	Intron	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:232325126T>C	ENST00000322723.4	-	5	1139				SNORD82_ENST00000365530.1_RNA	NM_005381.2	NP_005372.2	P19338	NUCL_HUMAN	nucleolin						angiogenesis (GO:0001525)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)	cell cortex (GO:0005938)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	identical protein binding (GO:0042802)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|RNA binding (GO:0003723)|telomeric DNA binding (GO:0042162)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(8)|lung(7)|ovary(2)|pancreas(2)|prostate(2)|skin(3)	35		Ovarian(221;1.34e-05)|Renal(207;0.0112)|Lung NSC(271;0.0339)|all_lung(227;0.0616)|all_hematologic(139;0.0748)|Hepatocellular(293;0.137)|Acute lymphoblastic leukemia(138;0.167)		Epithelial(121;1.65e-111)|LUSC - Lung squamous cell carcinoma(224;0.0115)|Lung(119;0.014)|COAD - Colon adenocarcinoma(134;0.141)|STAD - Stomach adenocarcinoma(1183;0.18)		CAGTATTAAGTCCCTTTGTTA	0.388																																																	0													167.0	150.0	155.0					2																	232325126		876	1991	2867	SO:0001627	intron_variant	25826				CCDS33397.1	2q37.1	2013-09-19			ENSG00000115053	ENSG00000115053		"""RNA binding motif (RRM) containing"""	7667	protein-coding gene	gene with protein product		164035				2394707, 3409881	Standard	NM_005381		Approved	C23	uc002vru.3	P19338	OTTHUMG00000153866	ENST00000322723.4:c.898+62A>G	2.37:g.232325126T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53SK1|Q8NB06|Q9UCF0|Q9UDG1	RNA	SNP	-	NULL	ENST00000322723.4	37	NULL	CCDS33397.1	2																																																																																			SNORD82	-	-		0.388	NCL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNORD82	HGNC	protein_coding	OTTHUMT00000332731.1	T	NM_005381		232325126	-1	no_errors	ENST00000365530	ensembl	human	known	70_37	rna	SNP	1.000	C
SNURF	8926	genome.wustl.edu	37	15	25213164	25213164	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr15:25213164G>A	ENST00000577949.1	+	3	259	c.196G>A	c.(196-198)Gag>Aag	p.E66K	SNRPN_ENST00000400098.1_5'UTR|SNURF_ENST00000551312.2_Missense_Mutation_p.E66K|SNRPN_ENST00000553597.1_3'UTR|SNRPN_ENST00000400097.1_5'UTR|SNRPN_ENST00000390687.4_5'UTR|SNRPN_ENST00000346403.6_5'UTR|SNURF_ENST00000338094.6_Missense_Mutation_p.E66K|SNRPN_ENST00000400100.1_5'UTR|SNRPN_ENST00000577565.1_5'UTR|SNRPN_ENST00000554227.2_5'UTR|SNURF_ENST00000338327.4_Missense_Mutation_p.E66K			Q9Y675	SNURF_HUMAN	SNRPN upstream reading frame	66						nucleus (GO:0005634)				breast(2)|large_intestine(2)|lung(1)	5		all_cancers(20;1.4e-21)|Breast(32;0.000625)		all cancers(64;3.48e-07)|Epithelial(43;1.83e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0142)		ATTCTTAGCTGAGACACCAAG	0.473																																																	0													114.0	102.0	106.0					15																	25213164		2203	4300	6503	SO:0001583	missense	8926				CCDS10016.1	15q11.2	2013-08-27			ENSG00000214265	ENSG00000214265			11171	protein-coding gene	gene with protein product						10318933	Standard	NM_022804		Approved		uc001ywu.3	Q9Y675	OTTHUMG00000129181	ENST00000577949.1:c.196G>A	15.37:g.25213164G>A	ENSP00000463201:p.Glu66Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCW2	Missense_Mutation	SNP	pfam_SNURF	p.E66K	ENST00000577949.1	37	c.196	CCDS10016.1	15	.	.	.	.	.	.	.	.	.	.	G	15.66	2.899828	0.52227	.	.	ENSG00000214265	ENST00000338094;ENST00000338327	.	.	.	3.52	2.59	0.31030	.	.	.	.	.	T	0.60392	0.2265	.	.	.	0.27524	N	0.951314	P	0.51057	0.941	P	0.60415	0.874	T	0.51426	-0.8707	7	0.87932	D	0	-10.0321	8.9311	0.35670	0.0:0.2281:0.7719:0.0	.	66	Q9Y675	SNURF_HUMAN	K	66	.	ENSP00000336543:E66K	E	+	1	0	SNURF	22764257	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	2.955000	0.49121	1.028000	0.39785	-0.176000	0.13171	GAG	SNURF	-	pfam_SNURF		0.473	SNURF-005	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	SNURF	HGNC	protein_coding	OTTHUMT00000446300.1	G	NM_005678		25213164	+1	no_errors	ENST00000338094	ensembl	human	known	70_37	missense	SNP	0.999	A
SPNS3	201305	genome.wustl.edu	37	17	4388365	4388365	+	Intron	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr17:4388365G>A	ENST00000355530.2	+	10	1459				RP13-580F15.2_ENST00000577064.1_RNA|RP13-580F15.2_ENST00000577176.1_RNA|RP13-580F15.2_ENST00000576086.1_RNA|SPNS3_ENST00000333476.2_Intron	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)						lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						ggagatgaccgaaacgtaagt	0.542																																																	0																																										SO:0001627	intron_variant	201305				CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.1180-1158G>A	17.37:g.4388365G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IZ31	RNA	SNP	-	NULL	ENST00000355530.2	37	NULL	CCDS11045.1	17																																																																																			SPNS3	-	-		0.542	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS3	HGNC	protein_coding	OTTHUMT00000438793.1	G	NM_182538		4388365	+1	no_errors	ENST00000575796	ensembl	human	known	70_37	rna	SNP	0.000	A
SRRM2	23524	genome.wustl.edu	37	16	2820872	2820872	+	3'UTR	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:2820872G>A	ENST00000301740.8	+	0	8812				AC092117.2_ENST00000581119.1_RNA	NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2						mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						TCCATAAATTGTCTTTGGGGG	0.572																																																	0													52.0	51.0	51.0					16																	2820872		2198	4300	6498	SO:0001624	3_prime_UTR_variant	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.*4G>A	16.37:g.2820872G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	RNA	SNP	-	NULL	ENST00000301740.8	37	NULL	CCDS32373.1	16																																																																																			SRRM2	-	-		0.572	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	G			2820872	+1	no_errors	ENST00000574866	ensembl	human	known	70_37	rna	SNP	0.000	A
STIL	6491	genome.wustl.edu	37	1	47748081	47748081	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:47748081G>C	ENST00000360380.3	-	12	1547	c.1184C>G	c.(1183-1185)tCt>tGt	p.S395C	STIL_ENST00000371877.3_Missense_Mutation_p.S395C|STIL_ENST00000337817.5_Missense_Mutation_p.S395C|STIL_ENST00000396221.2_Missense_Mutation_p.S395C|STIL_ENST00000243182.6_Missense_Mutation_p.S395C	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	395					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TTCAACACCAGAGTCGTGATC	0.398																																																	0													132.0	134.0	134.0					1																	47748081		2203	4300	6503	SO:0001583	missense	6491			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1184C>G	1.37:g.47748081G>C	ENSP00000353544:p.Ser395Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T0C5|Q68CN9	Missense_Mutation	SNP	NULL	p.S395C	ENST00000360380.3	37	c.1184	CCDS548.1	1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722299	0.68959	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22;0.22	5.74	5.74	0.90152	.	0.048497	0.85682	D	0.000000	T	0.76601	0.4010	M	0.75447	2.3	0.58432	D	0.999991	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	P;D;P;P;P	0.65443	0.867;0.935;0.867;0.877;0.877	T	0.78283	-0.2264	10	0.87932	D	0	-14.9145	19.9277	0.97108	0.0:0.0:1.0:0.0	.	395;348;395;395;395	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	C	395;395;395;395;395;348	ENSP00000353544:S395C;ENSP00000337367:S395C;ENSP00000360944:S395C;ENSP00000379523:S395C;ENSP00000243182:S395C;ENSP00000411664:S348C	ENSP00000243182:S395C	S	-	2	0	STIL	47520668	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	7.477000	0.81069	2.710000	0.92621	0.561000	0.74099	TCT	STIL	-	NULL		0.398	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STIL	HGNC	protein_coding	OTTHUMT00000021649.2	G	NM_003035		47748081	-1	no_errors	ENST00000371877	ensembl	human	known	70_37	missense	SNP	1.000	C
STIL	6491	genome.wustl.edu	37	1	47748081	47748081	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:47748081G>C	ENST00000360380.3	-	12	1547	c.1184C>G	c.(1183-1185)tCt>tGt	p.S395C	STIL_ENST00000371877.3_Missense_Mutation_p.S395C|STIL_ENST00000337817.5_Missense_Mutation_p.S395C|STIL_ENST00000396221.2_Missense_Mutation_p.S395C|STIL_ENST00000243182.6_Missense_Mutation_p.S395C	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	395					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				TTCAACACCAGAGTCGTGATC	0.398																																																	0													132.0	134.0	134.0					1																	47748081		2203	4300	6503	SO:0001583	missense	6491			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.1184C>G	1.37:g.47748081G>C	ENSP00000353544:p.Ser395Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T0C5|Q68CN9	Missense_Mutation	SNP	NULL	p.S395C	ENST00000360380.3	37	c.1184	CCDS548.1	1	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722299	0.68959	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182;ENST00000447475	T;T;T;T;T;T	0.60040	0.22;0.22;0.22;0.22;0.22;0.22	5.74	5.74	0.90152	.	0.048497	0.85682	D	0.000000	T	0.76601	0.4010	M	0.75447	2.3	0.58432	D	0.999991	D;D;D;D;D	0.76494	0.999;0.999;0.999;0.999;0.999	P;D;P;P;P	0.65443	0.867;0.935;0.867;0.877;0.877	T	0.78283	-0.2264	10	0.87932	D	0	-14.9145	19.9277	0.97108	0.0:0.0:1.0:0.0	.	395;348;395;395;395	E9PSF2;Q5T0C7;B7ZLW5;Q15468-2;Q15468	.;.;.;.;STIL_HUMAN	C	395;395;395;395;395;348	ENSP00000353544:S395C;ENSP00000337367:S395C;ENSP00000360944:S395C;ENSP00000379523:S395C;ENSP00000243182:S395C;ENSP00000411664:S348C	ENSP00000243182:S395C	S	-	2	0	STIL	47520668	1.000000	0.71417	1.000000	0.80357	0.571000	0.35966	7.477000	0.81069	2.710000	0.92621	0.561000	0.74099	TCT	STIL	-	NULL		0.398	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STIL	HGNC	protein_coding	OTTHUMT00000021649.2	G	NM_003035		47748081	-1	no_errors	ENST00000371877	ensembl	human	known	70_37	missense	SNP	1.000	C
SUSD3	203328	genome.wustl.edu	37	9	95847264	95847264	+	3'UTR	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:95847264G>A	ENST00000375472.3	+	0	1039				SUSD3_ENST00000375469.1_3'UTR	NM_145006.2	NP_659443.1	Q96L08	SUSD3_HUMAN	sushi domain containing 3							integral component of membrane (GO:0016021)				NS(1)|autonomic_ganglia(1)|breast(2)|large_intestine(2)|lung(3)|ovary(1)|prostate(1)|skin(2)	13						TTATAGTTATGGACTACTTGA	0.478																																																	0																																										SO:0001624	3_prime_UTR_variant	203328			AK128289	CCDS6701.1, CCDS69620.1, CCDS75857.1	9q22.32	2004-01-29			ENSG00000157303	ENSG00000157303			28391	protein-coding gene	gene with protein product						12975309	Standard	NM_001287007		Approved	MGC26847	uc004atb.3	Q96L08	OTTHUMG00000020241	ENST00000375472.3:c.*235G>A	9.37:g.95847264G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AA6|Q6UXV7	RNA	SNP	-	NULL	ENST00000375472.3	37	NULL	CCDS6701.1	9																																																																																			SUSD3	-	-		0.478	SUSD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUSD3	HGNC	protein_coding	OTTHUMT00000053120.1	G	NM_145006		95847264	+1	no_errors	ENST00000471462	ensembl	human	known	70_37	rna	SNP	0.001	A
SYDE1	85360	genome.wustl.edu	37	19	15220632	15220632	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:15220632G>C	ENST00000342784.2	+	3	579	c.548G>C	c.(547-549)cGa>cCa	p.R183P	SYDE1_ENST00000600252.1_5'UTR|SYDE1_ENST00000600440.1_Missense_Mutation_p.R116P	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	183					activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						CTGAGCCTGCGAGGCCCCCGG	0.736																																																	0													1.0	2.0	2.0					19																	15220632		1409	2873	4282	SO:0001583	missense	85360			BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.548G>C	19.37:g.15220632G>C	ENSP00000341489:p.Arg183Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.R183P	ENST00000342784.2	37	c.548	CCDS12324.1	19	.	.	.	.	.	.	.	.	.	.	G	18.97	3.736150	0.69189	.	.	ENSG00000105137	ENST00000342784	T	0.16457	2.34	3.7	3.7	0.42460	.	0.000000	0.64402	D	0.000010	T	0.31888	0.0811	L	0.53249	1.67	0.29577	N	0.849483	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.988	T	0.05937	-1.0855	10	0.66056	D	0.02	.	7.4911	0.27462	0.1232:0.0:0.8767:0.0	.	116;183	Q6ZW31-2;Q6ZW31	.;SYDE1_HUMAN	P	183	ENSP00000341489:R183P	ENSP00000341489:R183P	R	+	2	0	SYDE1	15081632	0.990000	0.36364	0.337000	0.25536	0.983000	0.72400	5.692000	0.68256	1.812000	0.52913	0.573000	0.79308	CGA	SYDE1	-	NULL		0.736	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE1	HGNC	protein_coding	OTTHUMT00000465666.1	G	NM_033025		15220632	+1	no_errors	ENST00000342784	ensembl	human	known	70_37	missense	SNP	0.458	C
TADA2B	93624	genome.wustl.edu	37	4	7056573	7056573	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:7056573C>G	ENST00000310074.7	+	2	1244	c.1055C>G	c.(1054-1056)tCa>tGa	p.S352*	TADA2B_ENST00000512388.1_Nonsense_Mutation_p.S277*|TADA2B_ENST00000515646.1_Nonsense_Mutation_p.S260*	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	352					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						GAGCTCCTGTCAGATCGCGAG	0.522																																																	0													67.0	73.0	71.0					4																	7056573		1961	4145	6106	SO:0001587	stop_gained	93624			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.1055C>G	4.37:g.7056573C>G	ENSP00000308022:p.Ser352*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Nonsense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_Znf_ZZ,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.S352*	ENST00000310074.7	37	c.1055	CCDS47007.1	4	.	.	.	.	.	.	.	.	.	.	C	46	12.863921	0.99702	.	.	ENSG00000173011	ENST00000310074;ENST00000512388;ENST00000515646	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.0973	18.2471	0.89989	0.0:1.0:0.0:0.0	.	.	.	.	X	352;277;260	.	ENSP00000308022:S352X	S	+	2	0	TADA2B	7107474	1.000000	0.71417	0.727000	0.30756	0.335000	0.28730	7.305000	0.78891	2.307000	0.77673	0.561000	0.74099	TCA	TADA2B	-	superfamily_Homeodomain-like,pirsf_Transcriptional_adaptor_2		0.522	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	HGNC	protein_coding	OTTHUMT00000358687.2	C	NM_152293		7056573	+1	no_errors	ENST00000310074	ensembl	human	known	70_37	nonsense	SNP	1.000	G
TADA2B	93624	genome.wustl.edu	37	4	7056573	7056573	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:7056573C>G	ENST00000310074.7	+	2	1244	c.1055C>G	c.(1054-1056)tCa>tGa	p.S352*	TADA2B_ENST00000512388.1_Nonsense_Mutation_p.S277*|TADA2B_ENST00000515646.1_Nonsense_Mutation_p.S260*	NM_152293.2	NP_689506.2	Q86TJ2	TAD2B_HUMAN	transcriptional adaptor 2B	352					chromatin organization (GO:0006325)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	SAGA-type complex (GO:0070461)|STAGA complex (GO:0030914)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)	18						GAGCTCCTGTCAGATCGCGAG	0.522																																																	0													67.0	73.0	71.0					4																	7056573		1961	4145	6106	SO:0001587	stop_gained	93624			AK026299	CCDS47007.1	4p16.1	2009-10-02			ENSG00000173011	ENSG00000173011			30781	protein-coding gene	gene with protein product		608790				12972612, 18936164	Standard	NM_152293		Approved	MGC21874	uc003gjw.4	Q86TJ2	OTTHUMG00000159983	ENST00000310074.7:c.1055C>G	4.37:g.7056573C>G	ENSP00000308022:p.Ser352*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUJ8|A4QMR7|B3KSN0|B3KU86|Q6MZG9	Nonsense_Mutation	SNP	pfam_SANT/Myb,pfam_Znf_ZZ,superfamily_Homeodomain-like,smart_Znf_ZZ,smart_SANT/Myb,pirsf_Transcriptional_adaptor_2,pfscan_Znf_ZZ,pfscan_Myb-like_dom	p.S352*	ENST00000310074.7	37	c.1055	CCDS47007.1	4	.	.	.	.	.	.	.	.	.	.	C	46	12.863921	0.99702	.	.	ENSG00000173011	ENST00000310074;ENST00000512388;ENST00000515646	.	.	.	4.96	4.96	0.65561	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-16.0973	18.2471	0.89989	0.0:1.0:0.0:0.0	.	.	.	.	X	352;277;260	.	ENSP00000308022:S352X	S	+	2	0	TADA2B	7107474	1.000000	0.71417	0.727000	0.30756	0.335000	0.28730	7.305000	0.78891	2.307000	0.77673	0.561000	0.74099	TCA	TADA2B	-	superfamily_Homeodomain-like,pirsf_Transcriptional_adaptor_2		0.522	TADA2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TADA2B	HGNC	protein_coding	OTTHUMT00000358687.2	C	NM_152293		7056573	+1	no_errors	ENST00000310074	ensembl	human	known	70_37	nonsense	SNP	1.000	G
TG	7038	genome.wustl.edu	37	8	134030178	134030178	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:134030178G>C	ENST00000220616.4	+	38	6758	c.6718G>C	c.(6718-6720)Gag>Cag	p.E2240Q	TG_ENST00000522523.1_3'UTR|TG_ENST00000519543.1_Missense_Mutation_p.E373Q|TG_ENST00000542445.1_Missense_Mutation_p.E610Q|TG_ENST00000377869.1_Missense_Mutation_p.E2183Q	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2240					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCCCCTGGCAGAGAGGCGCTT	0.607																																																	0													47.0	45.0	46.0					8																	134030178		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6718G>C	8.37:g.134030178G>C	ENSP00000220616:p.Glu2240Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.E2240Q	ENST00000220616.4	37	c.6718	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.00|13.00	2.105562|2.105562	0.37145|0.37145	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543|ENST00000519178	T;T;T;T|.	0.69561|.	-0.41;-0.41;-0.41;-0.41|.	5.38|5.38	4.48|4.48	0.54585|0.54585	Carboxylesterase, type B (1);|.	0.359217|.	0.28042|.	N|.	0.016828|.	T|T	0.45377|0.45377	0.1339|0.1339	L|L	0.49350|0.49350	1.555|1.555	0.09310|0.09310	N|N	1|1	B;B;B|.	0.26935|.	0.134;0.164;0.164|.	B;B;B|.	0.30029|.	0.11;0.067;0.11|.	T|T	0.28650|0.28650	-1.0037|-1.0037	10|5	0.45353|.	T|.	0.12|.	.|.	11.1629|11.1629	0.48526|0.48526	0.0:0.2:0.8:0.0|0.0:0.2:0.8:0.0	.|.	373;610;2240|.	E7EVM0;F5GWW5;P01266|.	.;.;THYG_HUMAN|.	Q|T	2183;1046;2240;610;373|695	ENSP00000367100:E2183Q;ENSP00000220616:E2240Q;ENSP00000441693:E610Q;ENSP00000430430:E373Q|.	ENSP00000220616:E2240Q|.	E|R	+|+	1|2	0|0	TG|TG	134099360|134099360	1.000000|1.000000	0.71417|0.71417	0.151000|0.151000	0.22473|0.22473	0.948000|0.948000	0.59901|0.59901	2.474000|2.474000	0.45154|0.45154	2.802000|2.802000	0.96397|0.96397	0.655000|0.655000	0.94253|0.94253	GAG|AGA	TG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin		0.607	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	G	NM_003235		134030178	+1	no_errors	ENST00000220616	ensembl	human	known	70_37	missense	SNP	0.214	C
TG	7038	genome.wustl.edu	37	8	134030178	134030178	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:134030178G>C	ENST00000220616.4	+	38	6758	c.6718G>C	c.(6718-6720)Gag>Cag	p.E2240Q	TG_ENST00000522523.1_3'UTR|TG_ENST00000519543.1_Missense_Mutation_p.E373Q|TG_ENST00000542445.1_Missense_Mutation_p.E610Q|TG_ENST00000377869.1_Missense_Mutation_p.E2183Q	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	2240					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		GCCCCTGGCAGAGAGGCGCTT	0.607																																																	0													47.0	45.0	46.0					8																	134030178		2203	4300	6503	SO:0001583	missense	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.6718G>C	8.37:g.134030178G>C	ENSP00000220616:p.Glu2240Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Missense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.E2240Q	ENST00000220616.4	37	c.6718	CCDS34944.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.00|13.00	2.105562|2.105562	0.37145|0.37145	.|.	.|.	ENSG00000042832|ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616;ENST00000542445;ENST00000519543|ENST00000519178	T;T;T;T|.	0.69561|.	-0.41;-0.41;-0.41;-0.41|.	5.38|5.38	4.48|4.48	0.54585|0.54585	Carboxylesterase, type B (1);|.	0.359217|.	0.28042|.	N|.	0.016828|.	T|T	0.45377|0.45377	0.1339|0.1339	L|L	0.49350|0.49350	1.555|1.555	0.09310|0.09310	N|N	1|1	B;B;B|.	0.26935|.	0.134;0.164;0.164|.	B;B;B|.	0.30029|.	0.11;0.067;0.11|.	T|T	0.28650|0.28650	-1.0037|-1.0037	10|5	0.45353|.	T|.	0.12|.	.|.	11.1629|11.1629	0.48526|0.48526	0.0:0.2:0.8:0.0|0.0:0.2:0.8:0.0	.|.	373;610;2240|.	E7EVM0;F5GWW5;P01266|.	.;.;THYG_HUMAN|.	Q|T	2183;1046;2240;610;373|695	ENSP00000367100:E2183Q;ENSP00000220616:E2240Q;ENSP00000441693:E610Q;ENSP00000430430:E373Q|.	ENSP00000220616:E2240Q|.	E|R	+|+	1|2	0|0	TG|TG	134099360|134099360	1.000000|1.000000	0.71417|0.71417	0.151000|0.151000	0.22473|0.22473	0.948000|0.948000	0.59901|0.59901	2.474000|2.474000	0.45154|0.45154	2.802000|2.802000	0.96397|0.96397	0.655000|0.655000	0.94253|0.94253	GAG|AGA	TG	-	pfam_CarbesteraseB,pirsf_Thyroglobulin		0.607	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	G	NM_003235		134030178	+1	no_errors	ENST00000220616	ensembl	human	known	70_37	missense	SNP	0.214	C
TGM6	343641	genome.wustl.edu	37	20	2411091	2411091	+	Splice_Site	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:2411091G>A	ENST00000202625.2	+	11	1739		c.e11-1		TGM6_ENST00000381423.1_Splice_Site	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6						cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TTCCCTTCCAGAGAAGAGAAT	0.453																																																	0													86.0	83.0	84.0					20																	2411091		2203	4300	6503	SO:0001630	splice_region_variant	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1679-1G>A	20.37:g.2411091G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Splice_Site	SNP	-	e11-1	ENST00000202625.2	37	c.1679-1	CCDS13025.1	20	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044445	0.75732	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.508	0.75757	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TGM6	2359091	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.552000	0.67281	2.722000	0.93159	0.655000	0.94253	.	TGM6	-	-		0.453	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	HGNC	protein_coding	OTTHUMT00000077581.2	G	NM_198994	Intron	2411091	+1	no_errors	ENST00000202625	ensembl	human	known	70_37	splice_site	SNP	1.000	A
TGM6	343641	genome.wustl.edu	37	20	2411091	2411091	+	Splice_Site	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr20:2411091G>A	ENST00000202625.2	+	11	1739		c.e11-1		TGM6_ENST00000381423.1_Splice_Site	NM_198994.2	NP_945345.2	O95932	TGM3L_HUMAN	transglutaminase 6						cell death (GO:0008219)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)			breast(1)|endometrium(6)|kidney(2)|large_intestine(2)|lung(32)|ovary(4)|prostate(1)|skin(4)	52					L-Glutamine(DB00130)	TTCCCTTCCAGAGAAGAGAAT	0.453																																																	0													86.0	83.0	84.0					20																	2411091		2203	4300	6503	SO:0001630	splice_region_variant	343641			AF540970	CCDS13025.1, CCDS58761.1	20p13	2010-12-19	2004-07-05	2004-07-07	ENSG00000166948	ENSG00000166948		"""Transglutaminases"""	16255	protein-coding gene	gene with protein product	"""spinocerebellar ataxia 35"""	613900	"""transglutaminase 3-like"""	TGM3L		11390390, 21106500	Standard	NM_198994		Approved	dJ734P14.3, TGY, SCA35	uc002wfy.1	O95932	OTTHUMG00000031692	ENST00000202625.2:c.1679-1G>A	20.37:g.2411091G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JXU4|Q5JXU5|Q719M2|Q719M3|Q9Y4U8	Splice_Site	SNP	-	e11-1	ENST00000202625.2	37	c.1679-1	CCDS13025.1	20	.	.	.	.	.	.	.	.	.	.	G	20.8	4.044445	0.75732	.	.	ENSG00000166948	ENST00000202625;ENST00000381423	.	.	.	5.78	5.78	0.91487	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.508	0.75757	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	TGM6	2359091	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	5.552000	0.67281	2.722000	0.93159	0.655000	0.94253	.	TGM6	-	-		0.453	TGM6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM6	HGNC	protein_coding	OTTHUMT00000077581.2	G	NM_198994	Intron	2411091	+1	no_errors	ENST00000202625	ensembl	human	known	70_37	splice_site	SNP	1.000	A
THAP5	168451	genome.wustl.edu	37	7	108205264	108205264	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:108205264C>T	ENST00000415914.3	-	3	712	c.559G>A	c.(559-561)Gat>Aat	p.D187N	THAP5_ENST00000493722.1_5'UTR|THAP5_ENST00000438865.1_3'UTR|THAP5_ENST00000313516.5_Missense_Mutation_p.D145N	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	187					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						CTACCTGTATCTTGGTTAACT	0.323																																																	0													58.0	56.0	56.0					7																	108205264		2202	4300	6502	SO:0001583	missense	168451			AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.559G>A	7.37:g.108205264C>T	ENSP00000400500:p.Asp187Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.D187N	ENST00000415914.3	37	c.559	CCDS47687.1	7	.	.	.	.	.	.	.	.	.	.	C	2.767	-0.256569	0.05829	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.96716	-4.1;-2.61	4.5	3.6	0.41247	.	1.016640	0.07920	N	0.975812	D	0.92001	0.7466	N	0.20986	0.625	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.81951	-0.0698	9	.	.	.	.	10.5353	0.45000	0.0:0.831:0.0:0.169	.	187	Q7Z6K1	THAP5_HUMAN	N	187;145	ENSP00000400500:D187N;ENSP00000322440:D145N	.	D	-	1	0	THAP5	107992500	0.007000	0.16637	0.919000	0.36401	0.316000	0.28119	-0.024000	0.12435	0.996000	0.38943	0.650000	0.86243	GAT	THAP5	-	NULL		0.323	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	HGNC	protein_coding	OTTHUMT00000337777.2	C	NM_182529		108205264	-1	no_errors	ENST00000415914	ensembl	human	known	70_37	missense	SNP	0.986	T
THAP5	168451	genome.wustl.edu	37	7	108205264	108205264	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:108205264C>T	ENST00000415914.3	-	3	712	c.559G>A	c.(559-561)Gat>Aat	p.D187N	THAP5_ENST00000493722.1_5'UTR|THAP5_ENST00000438865.1_3'UTR|THAP5_ENST00000313516.5_Missense_Mutation_p.D145N	NM_001130475.1	NP_001123947.1	Q7Z6K1	THAP5_HUMAN	THAP domain containing 5	187					cell cycle (GO:0007049)|negative regulation of cell cycle (GO:0045786)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protease binding (GO:0002020)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(2)|skin(1)	8						CTACCTGTATCTTGGTTAACT	0.323																																																	0													58.0	56.0	56.0					7																	108205264		2202	4300	6502	SO:0001583	missense	168451			AL833137	CCDS34734.2, CCDS47687.1	7q22.3	2013-01-25			ENSG00000177683	ENSG00000177683		"""THAP (C2CH-type zinc finger) domain containing"""	23188	protein-coding gene	gene with protein product		612534				12575992	Standard	NM_001287598		Approved	DKFZp313O1132	uc003vfm.3	Q7Z6K1	OTTHUMG00000154951	ENST00000415914.3:c.559G>A	7.37:g.108205264C>T	ENSP00000400500:p.Asp187Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.D187N	ENST00000415914.3	37	c.559	CCDS47687.1	7	.	.	.	.	.	.	.	.	.	.	C	2.767	-0.256569	0.05829	.	.	ENSG00000177683	ENST00000415914;ENST00000313516	D;D	0.96716	-4.1;-2.61	4.5	3.6	0.41247	.	1.016640	0.07920	N	0.975812	D	0.92001	0.7466	N	0.20986	0.625	0.80722	D	1	B	0.12013	0.005	B	0.10450	0.005	T	0.81951	-0.0698	9	.	.	.	.	10.5353	0.45000	0.0:0.831:0.0:0.169	.	187	Q7Z6K1	THAP5_HUMAN	N	187;145	ENSP00000400500:D187N;ENSP00000322440:D145N	.	D	-	1	0	THAP5	107992500	0.007000	0.16637	0.919000	0.36401	0.316000	0.28119	-0.024000	0.12435	0.996000	0.38943	0.650000	0.86243	GAT	THAP5	-	NULL		0.323	THAP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP5	HGNC	protein_coding	OTTHUMT00000337777.2	C	NM_182529		108205264	-1	no_errors	ENST00000415914	ensembl	human	known	70_37	missense	SNP	0.986	T
TMEM167B	56900	genome.wustl.edu	37	1	109637429	109637429	+	3'UTR	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr1:109637429C>A	ENST00000338272.8	+	0	1603					NM_020141.3	NP_064526.1	Q9NRX6	KISHB_HUMAN	transmembrane protein 167B							Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)				endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)	7						AAAAACCTGTCATCCTGTTTT	0.408																																																	0																																										SO:0001624	3_prime_UTR_variant	56900				CCDS30789.1	1p13.3	2008-06-06	2008-06-06	2008-06-06	ENSG00000215717	ENSG00000215717			30187	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 119"""	C1orf119		12477932	Standard	NM_020141		Approved	AD-020, FLJ90710	uc001dwn.3	Q9NRX6	OTTHUMG00000042364	ENST00000338272.8:c.*308C>A	1.37:g.109637429C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUU9	RNA	SNP	-	NULL	ENST00000338272.8	37	NULL	CCDS30789.1	1																																																																																			TMEM167B	-	-		0.408	TMEM167B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM167B	HGNC	protein_coding	OTTHUMT00000100611.2	C	NM_020141		109637429	+1	no_errors	ENST00000479160	ensembl	human	known	70_37	rna	SNP	0.008	A
TMEM254	80195	genome.wustl.edu	37	10	81850650	81850650	+	Missense_Mutation	SNP	C	C	T	rs144946848		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:81850650C>T	ENST00000372281.3	+	4	379	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	TMEM254_ENST00000372274.1_3'UTR|TMEM254_ENST00000467529.1_3'UTR|TMEM254_ENST00000372275.1_3'UTR	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254	117						integral component of membrane (GO:0016021)											TGCTTACAAACGGAAGCGCCA	0.443																																																	0								C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	144.0	132.0	136.0		349	1.1	0.1	10	dbSNP_134	136	0,8600		0,0,4300	no	missense	C10orf57	NM_025125.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	117/124	81850650	1,13005	2203	4300	6503	SO:0001583	missense	80195			BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.349C>T	10.37:g.81850650C>T	ENSP00000361355:p.Arg117Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	Missense_Mutation	SNP	NULL	p.R117W	ENST00000372281.3	37	c.349	CCDS7363.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.680|4.680	0.126374|0.126374	0.08931|0.08931	2.27E-4|2.27E-4	0.0|0.0	ENSG00000133678|ENSG00000133678	ENST00000372281|ENST00000450179	.|.	.|.	.|.	4.07|4.07	1.07|1.07	0.20283|0.20283	.|.	0.246618|.	0.48767|.	D|.	0.000162|.	T|T	0.30479|0.30479	0.0766|0.0766	L|L	0.34521|0.34521	1.04|1.04	0.23689|0.23689	N|N	0.997106|0.997106	D;D|.	0.62365|.	0.979;0.991|.	P;B|.	0.49226|.	0.603;0.409|.	T|T	0.23868|0.23868	-1.0176|-1.0176	9|5	0.87932|.	D|.	0|.	-24.1416|-24.1416	5.1222|5.1222	0.14865|0.14865	0.0:0.6262:0.1709:0.2029|0.0:0.6262:0.1709:0.2029	.|.	141;117|.	E7ERB9;Q8TBM7|.	.;CJ057_HUMAN|.	W|M	117|94	.|.	ENSP00000361355:R117W|.	R|T	+|+	1|2	2|0	C10orf57|C10orf57	81840630|81840630	0.023000|0.023000	0.18921|0.18921	0.086000|0.086000	0.20670|0.20670	0.012000|0.012000	0.07955|0.07955	0.636000|0.636000	0.24644|0.24644	0.107000|0.107000	0.17824|0.17824	-1.019000|-1.019000	0.02448|0.02448	CGG|ACG	TMEM254	-	NULL		0.443	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254	HGNC	protein_coding	OTTHUMT00000049030.1	C	NM_025125		81850650	+1	no_errors	ENST00000372281	ensembl	human	known	70_37	missense	SNP	0.354	T
TMEM254	80195	genome.wustl.edu	37	10	81850650	81850650	+	Missense_Mutation	SNP	C	C	T	rs144946848		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr10:81850650C>T	ENST00000372281.3	+	4	379	c.349C>T	c.(349-351)Cgg>Tgg	p.R117W	TMEM254_ENST00000372274.1_3'UTR|TMEM254_ENST00000467529.1_3'UTR|TMEM254_ENST00000372275.1_3'UTR	NM_001270372.1|NM_025125.3	NP_001257301.1|NP_079401.2	Q8TBM7	TM254_HUMAN	transmembrane protein 254	117						integral component of membrane (GO:0016021)											TGCTTACAAACGGAAGCGCCA	0.443																																																	0								C	TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	144.0	132.0	136.0		349	1.1	0.1	10	dbSNP_134	136	0,8600		0,0,4300	no	missense	C10orf57	NM_025125.2	101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging	117/124	81850650	1,13005	2203	4300	6503	SO:0001583	missense	80195			BC022252	CCDS7363.1, CCDS58086.1, CCDS58087.1, CCDS73157.1	10q23.1	2012-11-06	2012-11-06	2012-11-06	ENSG00000133678	ENSG00000133678			25804	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 57"""	C10orf57		14702039	Standard	NM_025125		Approved	FLJ13263, bA369J21.6	uc010qlw.3	Q8TBM7	OTTHUMG00000018602	ENST00000372281.3:c.349C>T	10.37:g.81850650C>T	ENSP00000361355:p.Arg117Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWC8|Q53HP4|Q5JTC0|Q5JTC1|Q6IA45|Q9H8S6	Missense_Mutation	SNP	NULL	p.R117W	ENST00000372281.3	37	c.349	CCDS7363.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	4.680|4.680	0.126374|0.126374	0.08931|0.08931	2.27E-4|2.27E-4	0.0|0.0	ENSG00000133678|ENSG00000133678	ENST00000372281|ENST00000450179	.|.	.|.	.|.	4.07|4.07	1.07|1.07	0.20283|0.20283	.|.	0.246618|.	0.48767|.	D|.	0.000162|.	T|T	0.30479|0.30479	0.0766|0.0766	L|L	0.34521|0.34521	1.04|1.04	0.23689|0.23689	N|N	0.997106|0.997106	D;D|.	0.62365|.	0.979;0.991|.	P;B|.	0.49226|.	0.603;0.409|.	T|T	0.23868|0.23868	-1.0176|-1.0176	9|5	0.87932|.	D|.	0|.	-24.1416|-24.1416	5.1222|5.1222	0.14865|0.14865	0.0:0.6262:0.1709:0.2029|0.0:0.6262:0.1709:0.2029	.|.	141;117|.	E7ERB9;Q8TBM7|.	.;CJ057_HUMAN|.	W|M	117|94	.|.	ENSP00000361355:R117W|.	R|T	+|+	1|2	2|0	C10orf57|C10orf57	81840630|81840630	0.023000|0.023000	0.18921|0.18921	0.086000|0.086000	0.20670|0.20670	0.012000|0.012000	0.07955|0.07955	0.636000|0.636000	0.24644|0.24644	0.107000|0.107000	0.17824|0.17824	-1.019000|-1.019000	0.02448|0.02448	CGG|ACG	TMEM254	-	NULL		0.443	TMEM254-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM254	HGNC	protein_coding	OTTHUMT00000049030.1	C	NM_025125		81850650	+1	no_errors	ENST00000372281	ensembl	human	known	70_37	missense	SNP	0.354	T
TMEM30A	55754	genome.wustl.edu	37	6	75974970	75974970	+	Missense_Mutation	SNP	T	T	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:75974970T>A	ENST00000230461.6	-	3	759	c.430A>T	c.(430-432)Aat>Tat	p.N144Y	TMEM30A_ENST00000475111.2_Missense_Mutation_p.N108Y|TMEM30A_ENST00000370050.5_Missense_Mutation_p.N25Y	NM_018247.3	NP_060717.1	Q9NV96	CC50A_HUMAN	transmembrane protein 30A	144					drug transmembrane transport (GO:0006855)|phospholipid translocation (GO:0045332)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein exit from endoplasmic reticulum (GO:0070863)|protein localization to endosome (GO:0036010)	cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				NS(1)|haematopoietic_and_lymphoid_tissue(8)|kidney(1)|large_intestine(4)|lung(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21						GAATCTCCATTTAGTTGACTA	0.313																																																	0													75.0	71.0	73.0					6																	75974970		2203	4300	6503	SO:0001583	missense	55754			AK001718	CCDS4983.1, CCDS47453.1	6q14.1	2014-01-28	2004-06-17	2004-06-18	ENSG00000112697	ENSG00000112697			16667	protein-coding gene	gene with protein product		611028	"""chromosome 6 open reading frame 67"""	C6orf67		15375526	Standard	NM_001143958		Approved	FLJ10856, CDC50A	uc003phw.2	Q9NV96	OTTHUMG00000015050	ENST00000230461.6:c.430A>T	6.37:g.75974970T>A	ENSP00000230461:p.Asn144Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9V8|E1P539|Q658Z3|Q96H09|Q9NSL9	Missense_Mutation	SNP	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk	p.N144Y	ENST00000230461.6	37	c.430	CCDS4983.1	6	.	.	.	.	.	.	.	.	.	.	T	10.90	1.481747	0.26598	.	.	ENSG00000112697	ENST00000230461;ENST00000545449;ENST00000370050;ENST00000475111;ENST00000518161	.	.	.	6.02	6.02	0.97574	.	0.000000	0.85682	D	0.000000	T	0.51210	0.1661	M	0.71581	2.175	0.80722	D	1	B;B	0.30793	0.295;0.044	B;B	0.32762	0.152;0.057	T	0.53330	-0.8454	9	0.27082	T	0.32	.	16.5494	0.84464	0.0:0.0:0.0:1.0	.	108;144	Q9NV96-2;Q9NV96	.;CC50A_HUMAN	Y	144;128;25;108;25	.	ENSP00000230461:N144Y	N	-	1	0	TMEM30A	76031690	1.000000	0.71417	0.999000	0.59377	0.817000	0.46193	6.043000	0.71004	2.299000	0.77371	0.528000	0.53228	AAT	TMEM30A	-	pfam_DUF284_TM_euk,pirsf_DUF284_TM_euk		0.313	TMEM30A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM30A	HGNC	protein_coding	OTTHUMT00000041248.2	T	NM_018247		75974970	-1	no_errors	ENST00000230461	ensembl	human	known	70_37	missense	SNP	1.000	A
TMTC1	83857	genome.wustl.edu	37	12	29936472	29936472	+	Nonsense_Mutation	SNP	C	C	T	rs112603144		TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:29936472C>T	ENST00000539277.1	-	1	271	c.213G>A	c.(211-213)tgG>tgA	p.W71*	TMTC1_ENST00000552618.1_Nonsense_Mutation_p.W71*|TMTC1_ENST00000381224.2_Intron|TMTC1_ENST00000256062.5_Intron|TMTC1_ENST00000551659.1_Nonsense_Mutation_p.W71*	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	71						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					TGAAGATGCCCCAGCGGAGCG	0.672																																																	0																																										SO:0001587	stop_gained	83857				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.213G>A	12.37:g.29936472C>T	ENSP00000442046:p.Trp71*	Somatic		WXS	Illumina HiSeq	Phase_IV	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Nonsense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.W71*	ENST00000539277.1	37	c.213	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	C	38	7.040735	0.98021	.	.	ENSG00000133687	ENST00000551659;ENST00000552618;ENST00000539277	.	.	.	3.16	3.16	0.36331	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.325	0.26549	0.0:0.8732:0.0:0.1268	.	.	.	.	X	71	.	.	W	-	3	0	TMTC1	29827739	0.928000	0.31464	0.988000	0.46212	0.951000	0.60555	0.341000	0.19909	1.599000	0.50093	0.484000	0.47621	TGG	TMTC1	-	NULL		0.672	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	C	NM_031920		29936472	-1	no_errors	ENST00000539277	ensembl	human	putative	70_37	nonsense	SNP	0.991	T
TMTC1	83857	genome.wustl.edu	37	12	29936515	29936515	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr12:29936515A>G	ENST00000539277.1	-	1	228	c.170T>C	c.(169-171)aTc>aCc	p.I57T	TMTC1_ENST00000552618.1_Missense_Mutation_p.I57T|TMTC1_ENST00000381224.2_Intron|TMTC1_ENST00000256062.5_Intron|TMTC1_ENST00000551659.1_Missense_Mutation_p.I57T	NM_001193451.1	NP_001180380.1	Q8IUR5	TMTC1_HUMAN	transmembrane and tetratricopeptide repeat containing 1	57						integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)				breast(1)|endometrium(4)|kidney(3)|large_intestine(17)|lung(45)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	75	Lung NSC(12;7.61e-10)|Acute lymphoblastic leukemia(23;0.0122)|all_hematologic(23;0.032)					GTTGTTCACGATCGCCCACAC	0.716																																																	0																																										SO:0001583	missense	83857				CCDS8718.1, CCDS53772.1	12p11.22	2014-06-09	2006-01-06			ENSG00000133687		"""Tetratricopeptide (TTC) repeat domain containing"""	24099	protein-coding gene	gene with protein product		615855				24764305	Standard	NM_001193451		Approved	ARG99, OLF, FLJ31400, FLJ41625	uc021qwi.1	Q8IUR5	OTTHUMG00000169324	ENST00000539277.1:c.170T>C	12.37:g.29936515A>G	ENSP00000442046:p.Ile57Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	D0EP37|F5H8B5|Q6PIU4|Q6ZSM5|Q96N52|Q9BXM2	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,pfam_DUF1736,pfam_PIK-rel_kinase_FAT,pfam_TPR-3,smart_HAT,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.I57T	ENST00000539277.1	37	c.170	CCDS53772.1	12	.	.	.	.	.	.	.	.	.	.	A	20.8	4.049086	0.75846	.	.	ENSG00000133687	ENST00000551659;ENST00000552618;ENST00000539277	D;D;D	0.93712	-3.27;-3.27;-3.27	3.12	3.12	0.35913	.	.	.	.	.	D	0.96169	0.8751	M	0.90650	3.135	0.80722	D	1	.	.	.	.	.	.	D	0.95955	0.8957	6	.	.	.	.	10.3706	0.44051	1.0:0.0:0.0:0.0	.	.	.	.	T	57	ENSP00000448112:I57T;ENSP00000449043:I57T;ENSP00000442046:I57T	.	I	-	2	0	TMTC1	29827782	1.000000	0.71417	0.998000	0.56505	0.986000	0.74619	6.127000	0.71642	1.306000	0.44926	0.392000	0.25879	ATC	TMTC1	-	NULL		0.716	TMTC1-002	PUTATIVE	basic|CCDS	protein_coding	TMTC1	HGNC	protein_coding	OTTHUMT00000403509.1	A	NM_031920		29936515	-1	no_errors	ENST00000539277	ensembl	human	putative	70_37	missense	SNP	1.000	G
TOX3	27324	genome.wustl.edu	37	16	52473494	52473494	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:52473494C>A	ENST00000219746.9	-	7	1658	c.1374G>T	c.(1372-1374)caG>caT	p.Q458H	TOX3_ENST00000407228.3_Missense_Mutation_p.Q453H	NM_001080430.2	NP_001073899.2	O15405	TOX3_HUMAN	TOX high mobility group box family member 3	458	Gln-rich.				apoptotic process (GO:0006915)|negative regulation of neuron apoptotic process (GO:0043524)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|estrogen response element binding (GO:0034056)|phosphoprotein binding (GO:0051219)|protein homodimerization activity (GO:0042803)			NS(2)|endometrium(6)|kidney(1)|lung(8)|prostate(3)|stomach(3)|upper_aerodigestive_tract(1)	24						gctgctgcatctgttgcatct	0.557																																																	0													53.0	49.0	50.0					16																	52473494		2196	4296	6492	SO:0001583	missense	27324			U80736	CCDS54008.1, CCDS54009.1	16q12.1	2008-02-05	2007-03-20	2007-03-20		ENSG00000103460		"""Trinucleotide (CAG) repeat containing"""	11972	protein-coding gene	gene with protein product		611416	"""trinucleotide repeat containing 9"""	TNRC9		9225980	Standard	NM_001080430		Approved	CAGF9	uc002egw.2	O15405		ENST00000219746.9:c.1374G>T	16.37:g.52473494C>A	ENSP00000219746:p.Gln458His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRD0|B5MCW4	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.Q458H	ENST00000219746.9	37	c.1374	CCDS54009.1	16	.	.	.	.	.	.	.	.	.	.	C	11.10	1.540660	0.27563	.	.	ENSG00000103460	ENST00000219746;ENST00000407228	T;T	0.09630	2.96;2.96	5.89	5.89	0.94794	.	0.000000	0.85682	D	0.000000	T	0.13500	0.0327	N	0.04508	-0.205	0.44227	D	0.997061	D;D	0.71674	0.998;0.996	D;D	0.79784	0.993;0.986	T	0.40117	-0.9580	10	0.31617	T	0.26	.	13.1296	0.59373	0.0:0.9265:0.0:0.0735	.	453;458	B4DRD0;O15405	.;TOX3_HUMAN	H	458;453	ENSP00000219746:Q458H;ENSP00000385705:Q453H	ENSP00000219746:Q458H	Q	-	3	2	TOX3	51030995	1.000000	0.71417	0.998000	0.56505	0.873000	0.50193	4.673000	0.61604	2.783000	0.95769	0.655000	0.94253	CAG	TOX3	-	NULL		0.557	TOX3-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	TOX3	HGNC	protein_coding	OTTHUMT00000422534.1	C	XM_049037		52473494	-1	no_errors	ENST00000219746	ensembl	human	known	70_37	missense	SNP	1.000	A
TRIM56	81844	genome.wustl.edu	37	7	100733756	100733756	+	3'UTR	SNP	T	T	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr7:100733756T>G	ENST00000306085.6	+	0	3460				TRIM56_ENST00000487252.1_3'UTR	NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56						defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					agattaaaaattagctgcgtg	0.517																																					Ovarian(89;1092 1379 22756 38989 39611)												0																																										SO:0001624	3_prime_UTR_variant	81844			BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.*895T>G	7.37:g.100733756T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	RNA	SNP	-	NULL	ENST00000306085.6	37	NULL	CCDS43625.1	7																																																																																			TRIM56	-	-		0.517	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM56	HGNC	protein_coding	OTTHUMT00000347185.1	T	NM_030961		100733756	+1	no_errors	ENST00000487252	ensembl	human	putative	70_37	rna	SNP	0.241	G
TTK	7272	genome.wustl.edu	37	6	80749569	80749569	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:80749569G>C	ENST00000369798.2	+	19	2398	c.2287G>C	c.(2287-2289)Gat>Cat	p.D763H	TTK_ENST00000230510.3_Missense_Mutation_p.D762H|TTK_ENST00000509894.1_Missense_Mutation_p.D762H	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	763	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TCCAGAGAAAGATCTTCAAGA	0.274																																																	0													49.0	50.0	49.0					6																	80749569		2200	4285	6485	SO:0001583	missense	7272				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2287G>C	6.37:g.80749569G>C	ENSP00000358813:p.Asp763His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D763H	ENST00000369798.2	37	c.2287	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480150	0.26598	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.66638	-0.22;-0.22;-0.22	5.66	4.79	0.61399	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042947	0.85682	D	0.000000	T	0.69314	0.3097	L	0.52011	1.625	0.80722	D	1	D;D	0.69078	0.966;0.997	P;D	0.67382	0.726;0.951	T	0.72090	-0.4395	10	0.48119	T	0.1	.	15.1139	0.72384	0.0:0.0:0.8574:0.1426	.	763;762	P33981;A8K8U5	TTK_HUMAN;.	H	762;762;763	ENSP00000422936:D762H;ENSP00000230510:D762H;ENSP00000358813:D763H	ENSP00000230510:D762H	D	+	1	0	TTK	80806288	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	9.467000	0.97671	1.366000	0.46076	0.585000	0.79938	GAT	TTK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.274	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2	G			80749569	+1	no_errors	ENST00000369798	ensembl	human	known	70_37	missense	SNP	1.000	C
TTK	7272	genome.wustl.edu	37	6	80749569	80749569	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr6:80749569G>C	ENST00000369798.2	+	19	2398	c.2287G>C	c.(2287-2289)Gat>Cat	p.D763H	TTK_ENST00000230510.3_Missense_Mutation_p.D762H|TTK_ENST00000509894.1_Missense_Mutation_p.D762H	NM_001166691.1|NM_003318.4	NP_001160163.1|NP_003309.2	P33981	TTK_HUMAN	TTK protein kinase	763	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				chromosome separation (GO:0051304)|mitotic spindle assembly checkpoint (GO:0007094)|mitotic spindle organization (GO:0007052)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell proliferation (GO:0008284)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|spindle organization (GO:0007051)	membrane (GO:0016020)|spindle (GO:0005819)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			endometrium(4)|kidney(2)|large_intestine(12)|lung(22)|ovary(7)|pancreas(1)|prostate(1)|stomach(3)|urinary_tract(1)	53		all_cancers(76;0.00177)|Acute lymphoblastic leukemia(125;1.24e-05)|all_hematologic(105;0.00223)|all_epithelial(107;0.2)		BRCA - Breast invasive adenocarcinoma(397;0.0321)		TCCAGAGAAAGATCTTCAAGA	0.274																																																	0													49.0	50.0	49.0					6																	80749569		2200	4285	6485	SO:0001583	missense	7272				CCDS4993.1, CCDS55040.1	6q14.1	2014-04-07			ENSG00000112742	ENSG00000112742			12401	protein-coding gene	gene with protein product	"""cancer/testis antigen 96"", ""monopolar spindle 1 kinase"""	604092				1639825	Standard	NM_003318		Approved	MPS1, MPS1L1, CT96, MPH1	uc003pjc.3	P33981	OTTHUMG00000015088	ENST00000369798.2:c.2287G>C	6.37:g.80749569G>C	ENSP00000358813:p.Asp763His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8U5|B2RDW2|E1P543|Q15272|Q5TCS0|Q9BW51|Q9NTM0	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D763H	ENST00000369798.2	37	c.2287	CCDS4993.1	6	.	.	.	.	.	.	.	.	.	.	G	10.90	1.480150	0.26598	.	.	ENSG00000112742	ENST00000509894;ENST00000230510;ENST00000369798	T;T;T	0.66638	-0.22;-0.22;-0.22	5.66	4.79	0.61399	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.042947	0.85682	D	0.000000	T	0.69314	0.3097	L	0.52011	1.625	0.80722	D	1	D;D	0.69078	0.966;0.997	P;D	0.67382	0.726;0.951	T	0.72090	-0.4395	10	0.48119	T	0.1	.	15.1139	0.72384	0.0:0.0:0.8574:0.1426	.	763;762	P33981;A8K8U5	TTK_HUMAN;.	H	762;762;763	ENSP00000422936:D762H;ENSP00000230510:D762H;ENSP00000358813:D763H	ENSP00000230510:D762H	D	+	1	0	TTK	80806288	1.000000	0.71417	1.000000	0.80357	0.067000	0.16453	9.467000	0.97671	1.366000	0.46076	0.585000	0.79938	GAT	TTK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.274	TTK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TTK	HGNC	protein_coding	OTTHUMT00000041316.2	G			80749569	+1	no_errors	ENST00000369798	ensembl	human	known	70_37	missense	SNP	1.000	C
TTN	7273	genome.wustl.edu	37	2	179638218	179638218	+	Missense_Mutation	SNP	A	A	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:179638218A>T	ENST00000591111.1	-	32	7789	c.7565T>A	c.(7564-7566)gTt>gAt	p.V2522D	TTN_ENST00000589042.1_Missense_Mutation_p.V2522D|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V2476D|TTN_ENST00000360870.5_Missense_Mutation_p.V2522D|TTN_ENST00000460472.2_Missense_Mutation_p.V2476D|TTN_ENST00000342175.6_Missense_Mutation_p.V2476D|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V2522D|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12843	Ig-like 14.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGGTTTCAACTCTGCCAAC	0.393																																																	0													131.0	124.0	127.0					2																	179638218		2203	4300	6503	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7565T>A	2.37:g.179638218A>T	ENSP00000465570:p.Val2522Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V2522D	ENST00000591111.1	37	c.7565		2	.	.	.	.	.	.	.	.	.	.	A	12.35	1.911790	0.33721	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.82	4.68	0.58851	Immunoglobulin subtype (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46229	0.1382	L	0.37800	1.135	0.48087	D	0.999585	P;P;P;P;D	0.59357	0.942;0.942;0.942;0.942;0.985	P;P;P;P;P	0.54664	0.599;0.599;0.599;0.599;0.758	T	0.45571	-0.9252	9	0.87932	D	0	.	11.7442	0.51811	0.9315:0.0:0.0685:0.0	.	2476;2476;2476;2522;2522	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	D	2522;2476;2476;2476;2476;2522	ENSP00000343764:V2522D;ENSP00000434586:V2476D;ENSP00000340554:V2476D;ENSP00000352154:V2476D;ENSP00000354117:V2522D	ENSP00000340554:V2476D	V	-	2	0	TTN	179346463	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.529000	0.60588	1.048000	0.40298	0.528000	0.53228	GTT	TTN	-	superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179638218	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179638218	179638218	+	Missense_Mutation	SNP	A	A	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:179638218A>T	ENST00000591111.1	-	32	7789	c.7565T>A	c.(7564-7566)gTt>gAt	p.V2522D	TTN_ENST00000589042.1_Missense_Mutation_p.V2522D|TTN-AS1_ENST00000610005.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.V2476D|TTN_ENST00000360870.5_Missense_Mutation_p.V2522D|TTN_ENST00000460472.2_Missense_Mutation_p.V2476D|TTN_ENST00000342175.6_Missense_Mutation_p.V2476D|TTN-AS1_ENST00000584485.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.V2522D|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12843	Ig-like 14.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GTTGGTTTCAACTCTGCCAAC	0.393																																																	0													131.0	124.0	127.0					2																	179638218		2203	4300	6503	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.7565T>A	2.37:g.179638218A>T	ENSP00000465570:p.Val2522Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.V2522D	ENST00000591111.1	37	c.7565		2	.	.	.	.	.	.	.	.	.	.	A	12.35	1.911790	0.33721	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127;ENST00000360870	T;T;T;T;T	0.40225	1.04;1.04;1.04;1.04;1.04	5.82	4.68	0.58851	Immunoglobulin subtype (1);Immunoglobulin-like (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.46229	0.1382	L	0.37800	1.135	0.48087	D	0.999585	P;P;P;P;D	0.59357	0.942;0.942;0.942;0.942;0.985	P;P;P;P;P	0.54664	0.599;0.599;0.599;0.599;0.758	T	0.45571	-0.9252	9	0.87932	D	0	.	11.7442	0.51811	0.9315:0.0:0.0685:0.0	.	2476;2476;2476;2522;2522	D3DPF9;E7EQE6;E7ET18;Q8WZ42;Q8WZ42-6	.;.;.;TITIN_HUMAN;.	D	2522;2476;2476;2476;2476;2522	ENSP00000343764:V2522D;ENSP00000434586:V2476D;ENSP00000340554:V2476D;ENSP00000352154:V2476D;ENSP00000354117:V2522D	ENSP00000340554:V2476D	V	-	2	0	TTN	179346463	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.529000	0.60588	1.048000	0.40298	0.528000	0.53228	GTT	TTN	-	superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.393	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179638218	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	T
TUBGCP6	85378	genome.wustl.edu	37	22	50657188	50657188	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:50657188C>T	ENST00000248846.5	-	21	4869	c.4765G>A	c.(4765-4767)Gag>Aag	p.E1589K	TUBGCP6_ENST00000491449.1_5'UTR|TUBGCP6_ENST00000439308.2_3'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1589					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GCAAACACCTCGGGCAGGTAC	0.672																																																	0													67.0	60.0	62.0					22																	50657188		2203	4300	6503	SO:0001583	missense	85378			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.4765G>A	22.37:g.50657188C>T	ENSP00000248846:p.Glu1589Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.E1589K	ENST00000248846.5	37	c.4765	CCDS14087.1	22	.	.	.	.	.	.	.	.	.	.	C	29.3	4.997818	0.93227	.	.	ENSG00000128159	ENST00000248846;ENST00000425018	T;T	0.07908	3.15;3.15	4.63	4.63	0.57726	.	0.154950	0.56097	D	0.000028	T	0.26011	0.0634	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.963;0.977;0.961	T	0.00697	-1.1605	10	0.38643	T	0.18	.	17.2705	0.87101	0.0:1.0:0.0:0.0	.	1581;1589;1589	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	K	1589;275	ENSP00000248846:E1589K;ENSP00000405979:E275K	ENSP00000248846:E1589K	E	-	1	0	TUBGCP6	48999315	1.000000	0.71417	0.976000	0.42696	0.900000	0.52787	7.430000	0.80321	2.403000	0.81681	0.591000	0.81541	GAG	TUBGCP6	-	pfam_Spc97_Spc98		0.672	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	HGNC	protein_coding	OTTHUMT00000075004.3	C	NM_020461		50657188	-1	no_errors	ENST00000248846	ensembl	human	known	70_37	missense	SNP	1.000	T
TUBGCP6	85378	genome.wustl.edu	37	22	50657188	50657188	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr22:50657188C>T	ENST00000248846.5	-	21	4869	c.4765G>A	c.(4765-4767)Gag>Aag	p.E1589K	TUBGCP6_ENST00000491449.1_5'UTR|TUBGCP6_ENST00000439308.2_3'UTR			Q96RT7	GCP6_HUMAN	tubulin, gamma complex associated protein 6	1589					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|gamma-tubulin ring complex (GO:0008274)|membrane (GO:0016020)|microtubule (GO:0005874)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)			breast(4)|central_nervous_system(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(13)|ovary(3)|prostate(2)|skin(2)	45		all_cancers(38;5.79e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		LUAD - Lung adenocarcinoma(64;0.109)|BRCA - Breast invasive adenocarcinoma(115;0.21)		GCAAACACCTCGGGCAGGTAC	0.672																																																	0													67.0	60.0	62.0					22																	50657188		2203	4300	6503	SO:0001583	missense	85378			AB051456	CCDS14087.1	22q13.31-q13.33	2008-07-01			ENSG00000128159	ENSG00000128159			18127	protein-coding gene	gene with protein product	"""gamma-tubulin complex component 6"""	610053				11694571, 11258795	Standard	XR_244458		Approved	GCP6, KIAA1669, DJ402G11.6	uc003bkb.1	Q96RT7	OTTHUMG00000030150	ENST00000248846.5:c.4765G>A	22.37:g.50657188C>T	ENSP00000248846:p.Glu1589Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JZ80|Q6PJ40|Q86YE9|Q9BY91|Q9UGX3|Q9UGX4	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.E1589K	ENST00000248846.5	37	c.4765	CCDS14087.1	22	.	.	.	.	.	.	.	.	.	.	C	29.3	4.997818	0.93227	.	.	ENSG00000128159	ENST00000248846;ENST00000425018	T;T	0.07908	3.15;3.15	4.63	4.63	0.57726	.	0.154950	0.56097	D	0.000028	T	0.26011	0.0634	L	0.61218	1.895	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.72338	0.963;0.977;0.961	T	0.00697	-1.1605	10	0.38643	T	0.18	.	17.2705	0.87101	0.0:1.0:0.0:0.0	.	1581;1589;1589	B2RWN4;Q96RT7;Q96RT7-3	.;GCP6_HUMAN;.	K	1589;275	ENSP00000248846:E1589K;ENSP00000405979:E275K	ENSP00000248846:E1589K	E	-	1	0	TUBGCP6	48999315	1.000000	0.71417	0.976000	0.42696	0.900000	0.52787	7.430000	0.80321	2.403000	0.81681	0.591000	0.81541	GAG	TUBGCP6	-	pfam_Spc97_Spc98		0.672	TUBGCP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP6	HGNC	protein_coding	OTTHUMT00000075004.3	C	NM_020461		50657188	-1	no_errors	ENST00000248846	ensembl	human	known	70_37	missense	SNP	1.000	T
TYK2	7297	genome.wustl.edu	37	19	10478851	10478851	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:10478851C>T	ENST00000525621.1	-	5	826	c.345G>A	c.(343-345)atG>atA	p.M115I	TYK2_ENST00000524462.1_Intron|TYK2_ENST00000264818.6_Missense_Mutation_p.M115I|TYK2_ENST00000529370.1_Missense_Mutation_p.M115I	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	115	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCCGAGGATTCATGCCATGCC	0.592																																																	0													92.0	76.0	82.0					19																	10478851		2203	4300	6503	SO:0001583	missense	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.345G>A	19.37:g.10478851C>T	ENSP00000431885:p.Met115Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6QB10|Q96CH0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.M115I	ENST00000525621.1	37	c.345	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324103	0.41096	.	.	ENSG00000105397	ENST00000525621;ENST00000264818;ENST00000529370;ENST00000531836	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.27	3.02	0.34903	Band 4.1 domain (1);FERM domain (1);	0.505869	0.16412	N	0.215543	T	0.57636	0.2067	L	0.44542	1.39	0.09310	N	1	P;B	0.35745	0.518;0.046	B;B	0.30316	0.114;0.045	T	0.44375	-0.9332	10	0.39692	T	0.17	-21.1204	9.2891	0.37775	0.0:0.8191:0.0:0.1809	.	115;115	E9PPF2;P29597	.;TYK2_HUMAN	I	115	ENSP00000431885:M115I;ENSP00000264818:M115I;ENSP00000432728:M115I;ENSP00000436175:M115I	ENSP00000264818:M115I	M	-	3	0	TYK2	10339851	0.001000	0.12720	0.196000	0.23383	0.925000	0.55904	-0.160000	0.10041	0.511000	0.28236	0.544000	0.68410	ATG	TYK2	-	smart_Band_41_domain,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain		0.592	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	C			10478851	-1	no_errors	ENST00000264818	ensembl	human	known	70_37	missense	SNP	0.011	T
TYK2	7297	genome.wustl.edu	37	19	10478851	10478851	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:10478851C>T	ENST00000525621.1	-	5	826	c.345G>A	c.(343-345)atG>atA	p.M115I	TYK2_ENST00000524462.1_Intron|TYK2_ENST00000264818.6_Missense_Mutation_p.M115I|TYK2_ENST00000529370.1_Missense_Mutation_p.M115I	NM_003331.4	NP_003322.3	P29597	TYK2_HUMAN	tyrosine kinase 2	115	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|intracellular signal transduction (GO:0035556)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein phosphorylation (GO:0006468)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(11)|kidney(6)|large_intestine(3)|lung(19)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	64			OV - Ovarian serous cystadenocarcinoma(20;1.77e-09)|Epithelial(33;3.92e-06)|all cancers(31;8.95e-06)			CCCGAGGATTCATGCCATGCC	0.592																																																	0													92.0	76.0	82.0					19																	10478851		2203	4300	6503	SO:0001583	missense	7297				CCDS12236.1	19p13.2	2014-09-17			ENSG00000105397	ENSG00000105397	2.7.10.1		12440	protein-coding gene	gene with protein product		176941				2156206	Standard	NM_003331		Approved	JTK1	uc002moc.4	P29597	OTTHUMG00000166373	ENST00000525621.1:c.345G>A	19.37:g.10478851C>T	ENSP00000431885:p.Met115Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6QB10|Q96CH0	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_TYK2_N	p.M115I	ENST00000525621.1	37	c.345	CCDS12236.1	19	.	.	.	.	.	.	.	.	.	.	C	13.73	2.324103	0.41096	.	.	ENSG00000105397	ENST00000525621;ENST00000264818;ENST00000529370;ENST00000531836	T;T;T;T	0.71461	-0.57;-0.57;-0.57;-0.57	5.27	3.02	0.34903	Band 4.1 domain (1);FERM domain (1);	0.505869	0.16412	N	0.215543	T	0.57636	0.2067	L	0.44542	1.39	0.09310	N	1	P;B	0.35745	0.518;0.046	B;B	0.30316	0.114;0.045	T	0.44375	-0.9332	10	0.39692	T	0.17	-21.1204	9.2891	0.37775	0.0:0.8191:0.0:0.1809	.	115;115	E9PPF2;P29597	.;TYK2_HUMAN	I	115	ENSP00000431885:M115I;ENSP00000264818:M115I;ENSP00000432728:M115I;ENSP00000436175:M115I	ENSP00000264818:M115I	M	-	3	0	TYK2	10339851	0.001000	0.12720	0.196000	0.23383	0.925000	0.55904	-0.160000	0.10041	0.511000	0.28236	0.544000	0.68410	ATG	TYK2	-	smart_Band_41_domain,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain		0.592	TYK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYK2	HGNC	protein_coding	OTTHUMT00000389443.1	C			10478851	-1	no_errors	ENST00000264818	ensembl	human	known	70_37	missense	SNP	0.011	T
UGT2A3	79799	genome.wustl.edu	37	4	69817035	69817035	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:69817035T>C	ENST00000251566.4	-	1	474	c.444A>G	c.(442-444)atA>atG	p.I148M	UGT2A3_ENST00000420231.2_De_novo_Start_OutOfFrame	NM_024743.3	NP_079019.3	Q6UWM9	UD2A3_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide A3	148					cellular glucuronidation (GO:0052695)	integral component of membrane (GO:0016021)	glucuronosyltransferase activity (GO:0015020)			NS(1)|breast(1)|central_nervous_system(1)|kidney(5)|large_intestine(7)|lung(16)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	36						TCACAGGGTCTATAAGCATTA	0.418																																																	0													74.0	74.0	74.0					4																	69817035		2203	4300	6503	SO:0001583	missense	79799				CCDS3525.1	4q13.2	2010-12-14			ENSG00000135220	ENSG00000135220		"""UDP glucuronosyltransferases"""	28528	protein-coding gene	gene with protein product							Standard	NM_024743		Approved	FLJ21934	uc003hef.2	Q6UWM9	OTTHUMG00000129408	ENST00000251566.4:c.444A>G	4.37:g.69817035T>C	ENSP00000251566:p.Ile148Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H6S4	Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.I148M	ENST00000251566.4	37	c.444	CCDS3525.1	4	.	.	.	.	.	.	.	.	.	.	T	13.76	2.333217	0.41297	.	.	ENSG00000135220	ENST00000251566	T	0.62232	0.04	4.74	-0.899	0.10547	.	0.540943	0.17787	N	0.162033	T	0.58380	0.2118	L	0.33339	1.005	0.44595	D	0.99756	P	0.44776	0.843	P	0.53062	0.717	T	0.57441	-0.7811	10	0.87932	D	0	.	8.8303	0.35080	0.1363:0.0:0.5616:0.3022	.	148	Q6UWM9	UD2A3_HUMAN	M	148	ENSP00000251566:I148M	ENSP00000251566:I148M	I	-	3	3	UGT2A3	69851624	0.002000	0.14202	0.000000	0.03702	0.030000	0.12068	-0.411000	0.07142	-0.257000	0.09459	-1.423000	0.01107	ATA	UGT2A3	-	pfam_UDP_glucos_trans		0.418	UGT2A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2A3	HGNC	protein_coding	OTTHUMT00000251564.1	T	NM_024743		69817035	-1	no_errors	ENST00000251566	ensembl	human	known	70_37	missense	SNP	0.022	C
USP11	8237	genome.wustl.edu	37	X	47101546	47101546	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:47101546C>T	ENST00000218348.3	+	10	1374	c.1374C>T	c.(1372-1374)ttC>ttT	p.F458F	USP11_ENST00000377107.2_Silent_p.F415F	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	458	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						TGGACACTTTCCACGGCCTCT	0.562																																																	0													114.0	82.0	93.0					X																	47101546		2203	4300	6503	SO:0001819	synonymous_variant	8237			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1374C>T	X.37:g.47101546C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTX1|Q8IUG6|Q9BWE1	Silent	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.F458	ENST00000218348.3	37	c.1374	CCDS14277.1	X																																																																																			USP11	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.562	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		C	NM_004651		47101546	+1	no_errors	ENST00000218348	ensembl	human	known	70_37	silent	SNP	1.000	T
USP11	8237	genome.wustl.edu	37	X	47101546	47101546	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:47101546C>T	ENST00000218348.3	+	10	1374	c.1374C>T	c.(1372-1374)ttC>ttT	p.F458F	USP11_ENST00000377107.2_Silent_p.F415F	NM_004651.3	NP_004642.2	P51784	UBP11_HUMAN	ubiquitin specific peptidase 11	458	USP.				protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(14)|ovary(3)|pancreas(1)|stomach(1)	40						TGGACACTTTCCACGGCCTCT	0.562																																																	0													114.0	82.0	93.0					X																	47101546		2203	4300	6503	SO:0001819	synonymous_variant	8237			U44839	CCDS14277.1	Xp11.23	2008-02-05	2005-08-08		ENSG00000102226	ENSG00000102226		"""Ubiquitin-specific peptidases"""	12609	protein-coding gene	gene with protein product		300050	"""ubiquitin specific protease 11"""			12838346	Standard	XM_005272674		Approved	UHX1	uc004dhp.3	P51784	OTTHUMG00000021437	ENST00000218348.3:c.1374C>T	X.37:g.47101546C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTX1|Q8IUG6|Q9BWE1	Silent	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,smart_Pept_C19_DUSP,pfscan_Peptidase_C19	p.F458	ENST00000218348.3	37	c.1374	CCDS14277.1	X																																																																																			USP11	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.562	USP11-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	USP11	HGNC	protein_coding		C	NM_004651		47101546	+1	no_errors	ENST00000218348	ensembl	human	known	70_37	silent	SNP	1.000	T
UTP3	57050	genome.wustl.edu	37	4	71554691	71554693	+	In_Frame_Del	DEL	GGA	GGA	-	rs146575538|rs61104402	byFrequency	TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	GGA	GGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr4:71554691_71554693delGGA	ENST00000254803.2	+	1	496_498	c.297_299delGGA	c.(295-300)ggggag>ggg	p.E105del		NM_020368.2	NP_065101.1	Q9NQZ2	SAS10_HUMAN	UTP3, small subunit (SSU) processome component, homolog (S. cerevisiae)	105	Glu-rich.				brain development (GO:0007420)|chromatin modification (GO:0016568)	nucleolus (GO:0005730)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(4)	18			Lung(101;0.235)			ggaatgcgggggaggaggaggag	0.576														35	0.00698882	0.0197	0.0043	5008	,	,		23033	0.002		0.001	False		,,,				2504	0.0031																0										0,251,4015		0,0,0,0,251,1882						-0.6	0.0		dbSNP_134	50	1,543,7710		0,0,1,6,531,3589	no	codingComplex	UTP3	NM_020368.2		0,0,1,6,782,5471	A1A1,A1A2,A1R,A2A2,A2R,RR		6.5907,5.8837,6.3498				1,794,11725				SO:0001651	inframe_deletion	57050			AL136590	CCDS3546.1	4q13.3	2008-02-05			ENSG00000132467	ENSG00000132467			24477	protein-coding gene	gene with protein product	"""disrupter of silencing 10"""	611614				12477932	Standard	NM_020368		Approved	FLJ23256, DKFZp761F222, SAS10, CRLZ1	uc003hfo.3	Q9NQZ2	OTTHUMG00000129911	ENST00000254803.2:c.297_299delGGA	4.37:g.71554700_71554702delGGA	ENSP00000254803:p.Glu105del	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6FI82	In_Frame_Del	DEL	pfam_Sas10_C_dom,pfam_Sas10/Utp3/C1D	p.E103in_frame_del	ENST00000254803.2	37	c.297_299	CCDS3546.1	4																																																																																			UTP3	-	NULL		0.576	UTP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UTP3	HGNC	protein_coding	OTTHUMT00000252163.2	GGA	NM_020368		71554693	+1	no_errors	ENST00000254803	ensembl	human	known	70_37	in_frame_del	DEL	0.002:0.002:0.002	-
WDPCP	51057	genome.wustl.edu	37	2	63401965	63401965	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:63401965G>A	ENST00000272321.7	-	15	2445	c.1918C>T	c.(1918-1920)Ctc>Ttc	p.L640F	WDPCP_ENST00000409120.1_Missense_Mutation_p.L448F|WDPCP_ENST00000398544.3_Missense_Mutation_p.L481F|WDPCP_ENST00000409199.1_Missense_Mutation_p.L448F	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	640					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GGTCCCAGGAGTTCTGTTGAA	0.398																																																	0													104.0	95.0	97.0					2																	63401965		1849	4095	5944	SO:0001583	missense	51057				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1918C>T	2.37:g.63401965G>A	ENSP00000272321:p.Leu640Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	pfam_DUF3312,superfamily_WD40_repeat_dom	p.L640F	ENST00000272321.7	37	c.1918	CCDS42688.1	2	.	.	.	.	.	.	.	.	.	.	G	6.151	0.396080	0.11638	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544	T;T;T;T	0.74315	-0.83;-0.25;-0.25;-0.25	5.58	3.77	0.43336	.	0.156839	0.27773	N	0.017907	T	0.64360	0.2591	L	0.34521	1.04	0.80722	D	1	B;B	0.28552	0.137;0.215	B;B	0.29663	0.049;0.105	T	0.57934	-0.7725	10	0.49607	T	0.09	-4.6198	12.1915	0.54275	0.1527:0.0:0.8473:0.0	.	640;481	O95876;O95876-3	FRITZ_HUMAN;.	F	640;448;448;481	ENSP00000272321:L640F;ENSP00000386592:L448F;ENSP00000386769:L448F;ENSP00000381552:L481F	ENSP00000272321:L640F	L	-	1	0	WDPCP	63255469	1.000000	0.71417	0.997000	0.53966	0.314000	0.28054	1.678000	0.37586	0.328000	0.23435	-1.151000	0.01829	CTC	WDPCP	-	NULL		0.398	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDPCP	HGNC	protein_coding	OTTHUMT00000326820.1	G	NM_015910		63401965	-1	no_errors	ENST00000272321	ensembl	human	known	70_37	missense	SNP	1.000	A
WDPCP	51057	genome.wustl.edu	37	2	63401965	63401965	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr2:63401965G>A	ENST00000272321.7	-	15	2445	c.1918C>T	c.(1918-1920)Ctc>Ttc	p.L640F	WDPCP_ENST00000409120.1_Missense_Mutation_p.L448F|WDPCP_ENST00000398544.3_Missense_Mutation_p.L481F|WDPCP_ENST00000409199.1_Missense_Mutation_p.L448F	NM_015910.5	NP_056994.3	O95876	FRITZ_HUMAN	WD repeat containing planar cell polarity effector	640					auditory receptor cell morphogenesis (GO:0002093)|camera-type eye development (GO:0043010)|cardiovascular system development (GO:0072358)|cilium assembly (GO:0042384)|cilium morphogenesis (GO:0060271)|digestive system development (GO:0055123)|embryonic digit morphogenesis (GO:0042733)|establishment of protein localization (GO:0045184)|glomerular visceral epithelial cell migration (GO:0090521)|kidney development (GO:0001822)|palate development (GO:0060021)|regulation of embryonic cell shape (GO:0016476)|regulation of establishment of cell polarity (GO:2000114)|regulation of fibroblast migration (GO:0010762)|regulation of focal adhesion assembly (GO:0051893)|regulation of protein localization (GO:0032880)|regulation of ruffle assembly (GO:1900027)|respiratory system development (GO:0060541)|septin cytoskeleton organization (GO:0032185)|smoothened signaling pathway (GO:0007224)	axonemal basal plate (GO:0097541)|axoneme (GO:0005930)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(9)|lung(19)|ovary(1)|skin(1)	35						GGTCCCAGGAGTTCTGTTGAA	0.398																																																	0													104.0	95.0	97.0					2																	63401965		1849	4095	5944	SO:0001583	missense	51057				CCDS42688.1, CCDS46301.1	2p15	2014-04-24	2011-02-01	2011-02-01	ENSG00000143951	ENSG00000143951			28027	protein-coding gene	gene with protein product		613580	"""chromosome 2 open reading frame 86"""	C2orf86		15654087, 20671153	Standard	NM_015910		Approved	hFrtz, fritz, BBS15	uc002sch.3	O95876	OTTHUMG00000152566	ENST00000272321.7:c.1918C>T	2.37:g.63401965G>A	ENSP00000272321:p.Leu640Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53RW4|Q7Z2Z3	Missense_Mutation	SNP	pfam_DUF3312,superfamily_WD40_repeat_dom	p.L640F	ENST00000272321.7	37	c.1918	CCDS42688.1	2	.	.	.	.	.	.	.	.	.	.	G	6.151	0.396080	0.11638	.	.	ENSG00000143951	ENST00000272321;ENST00000409199;ENST00000409120;ENST00000398544	T;T;T;T	0.74315	-0.83;-0.25;-0.25;-0.25	5.58	3.77	0.43336	.	0.156839	0.27773	N	0.017907	T	0.64360	0.2591	L	0.34521	1.04	0.80722	D	1	B;B	0.28552	0.137;0.215	B;B	0.29663	0.049;0.105	T	0.57934	-0.7725	10	0.49607	T	0.09	-4.6198	12.1915	0.54275	0.1527:0.0:0.8473:0.0	.	640;481	O95876;O95876-3	FRITZ_HUMAN;.	F	640;448;448;481	ENSP00000272321:L640F;ENSP00000386592:L448F;ENSP00000386769:L448F;ENSP00000381552:L481F	ENSP00000272321:L640F	L	-	1	0	WDPCP	63255469	1.000000	0.71417	0.997000	0.53966	0.314000	0.28054	1.678000	0.37586	0.328000	0.23435	-1.151000	0.01829	CTC	WDPCP	-	NULL		0.398	WDPCP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	WDPCP	HGNC	protein_coding	OTTHUMT00000326820.1	G	NM_015910		63401965	-1	no_errors	ENST00000272321	ensembl	human	known	70_37	missense	SNP	1.000	A
ZFHX2	85446	genome.wustl.edu	37	14	24004432	24004432	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:24004432C>T	ENST00000419474.3	-	2	458	c.103G>A	c.(103-105)Gat>Aat	p.D35N	RP11-66N24.4_ENST00000553985.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA|RP11-66N24.4_ENST00000556354.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	35					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						GTGACAGGATCAGAGGGGGTG	0.637																																																	0																																										SO:0001583	missense	85446			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.103G>A	14.37:g.24004432C>T	ENSP00000413418:p.Asp35Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UPU6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.D35N	ENST00000419474.3	37	c.103	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	C	12.53	1.966346	0.34659	.	.	ENSG00000136367	ENST00000419474;ENST00000382785;ENST00000543520;ENST00000555334;ENST00000412565	T	0.79653	-1.29	4.9	4.9	0.64082	.	.	.	.	.	T	0.76183	0.3952	L	0.29908	0.895	0.24800	N	0.99271	.	.	.	.	.	.	T	0.70324	-0.4903	7	0.72032	D	0.01	.	10.7967	0.46464	0.1892:0.8108:0.0:0.0	.	.	.	.	N	35	ENSP00000413418:D35N	ENSP00000372235:D35N	D	-	1	0	ZFHX2	23074272	0.934000	0.31675	1.000000	0.80357	0.804000	0.45430	0.896000	0.28377	2.267000	0.75376	0.462000	0.41574	GAT	ZFHX2	-	NULL		0.637	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	C	NM_014894		24004432	-1	no_errors	ENST00000419474	ensembl	human	known	70_37	missense	SNP	0.996	T
ZFP36L1	677	genome.wustl.edu	37	14	69256314	69256314	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:69256314G>A	ENST00000439696.2	-	2	1254	c.953C>T	c.(952-954)tCc>tTc	p.S318F	ZFP36L1_ENST00000336440.3_Missense_Mutation_p.S318F|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	318					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		CAAGGTCGGGGAGTCTGAGCC	0.597											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													91.0	95.0	94.0					14																	69256314		2203	4300	6503	SO:0001583	missense	677			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.953C>T	14.37:g.69256314G>A	ENSP00000388402:p.Ser318Phe	Somatic	1113	WXS	Illumina HiSeq	Phase_IV	Q13851	Missense_Mutation	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.S318F	ENST00000439696.2	37	c.953	CCDS9791.1	14	.	.	.	.	.	.	.	.	.	.	G	24.7	4.563932	0.86335	.	.	ENSG00000185650	ENST00000439696;ENST00000336440;ENST00000435246	T;T	0.49720	0.77;0.77	4.66	4.66	0.58398	.	0.000000	0.85682	D	0.000000	T	0.69557	0.3124	M	0.74647	2.275	0.80722	D	1	D	0.76494	0.999	D	0.83275	0.996	T	0.74444	-0.3663	10	0.87932	D	0	-1.3851	17.7433	0.88413	0.0:0.0:1.0:0.0	.	318	Q07352	TISB_HUMAN	F	318;318;301	ENSP00000388402:S318F;ENSP00000337386:S318F	ENSP00000337386:S318F	S	-	2	0	ZFP36L1	68326067	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.525000	0.98039	2.413000	0.81919	0.591000	0.81541	TCC	ZFP36L1	-	NULL		0.597	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L1	HGNC	protein_coding	OTTHUMT00000413227.1	G			69256314	-1	no_errors	ENST00000336440	ensembl	human	known	70_37	missense	SNP	1.000	A
ZFP36L1	677	genome.wustl.edu	37	14	69256775	69256775	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:69256775G>A	ENST00000439696.2	-	2	793	c.492C>T	c.(490-492)atC>atT	p.I164I	ZFP36L1_ENST00000336440.3_Silent_p.I164I|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	164					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GGCAAAAGCCGATGGTGTGGA	0.687											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	55.0	54.0					14																	69256775		2203	4300	6503	SO:0001819	synonymous_variant	677			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.492C>T	14.37:g.69256775G>A		Somatic	1113	WXS	Illumina HiSeq	Phase_IV	Q13851	Silent	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.I164	ENST00000439696.2	37	c.492	CCDS9791.1	14																																																																																			ZFP36L1	-	pfam_Znf_CCCH,smart_Znf_CCCH		0.687	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L1	HGNC	protein_coding	OTTHUMT00000413227.1	G			69256775	-1	no_errors	ENST00000336440	ensembl	human	known	70_37	silent	SNP	1.000	A
ZFP36L1	677	genome.wustl.edu	37	14	69256775	69256775	+	Silent	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr14:69256775G>A	ENST00000439696.2	-	2	793	c.492C>T	c.(490-492)atC>atT	p.I164I	ZFP36L1_ENST00000336440.3_Silent_p.I164I|ZFP36L1_ENST00000555997.1_3'UTR	NM_001244701.1|NM_004926.3	NP_001231630.1|NP_004917.2	Q07352	TISB_HUMAN	ZFP36 ring finger protein-like 1	164					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|T cell differentiation in thymus (GO:0033077)|vasculogenesis (GO:0001570)	cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(4)|kidney(1)|large_intestine(1)|liver(2)|lung(9)|ovary(1)|prostate(2)|urinary_tract(1)	21				all cancers(60;0.00203)|BRCA - Breast invasive adenocarcinoma(234;0.00205)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		GGCAAAAGCCGATGGTGTGGA	0.687											OREG0022753	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													52.0	55.0	54.0					14																	69256775		2203	4300	6503	SO:0001819	synonymous_variant	677			X79066	CCDS9791.1	14q22-q24	2012-11-27	2012-11-27	2001-11-23		ENSG00000185650		"""RING-type (C3HC4) zinc fingers"""	1107	protein-coding gene	gene with protein product		601064	"""zinc finger protein, C3H type, 36-like 1"", ""zinc finger protein 36, C3H type-like 1"""	BRF1		8024689	Standard	NM_004926		Approved	RNF162B, Berg36, ERF1, TIS11B, cMG1	uc021rve.1	Q07352		ENST00000439696.2:c.492C>T	14.37:g.69256775G>A		Somatic	1113	WXS	Illumina HiSeq	Phase_IV	Q13851	Silent	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.I164	ENST00000439696.2	37	c.492	CCDS9791.1	14																																																																																			ZFP36L1	-	pfam_Znf_CCCH,smart_Znf_CCCH		0.687	ZFP36L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L1	HGNC	protein_coding	OTTHUMT00000413227.1	G			69256775	-1	no_errors	ENST00000336440	ensembl	human	known	70_37	silent	SNP	1.000	A
ZMAT4	79698	genome.wustl.edu	37	8	40532227	40532227	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:40532227C>T	ENST00000297737.6	-	5	719	c.573G>A	c.(571-573)ctG>ctA	p.L191L	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	191						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CCTTACCTCTCAGTTCCCCCA	0.448																																																	0													116.0	109.0	111.0					8																	40532227		2203	4300	6503	SO:0001819	synonymous_variant	79698			AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.573G>A	8.37:g.40532227C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUT8	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.L191	ENST00000297737.6	37	c.573	CCDS34885.1	8																																																																																			ZMAT4	-	NULL		0.448	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT4	HGNC	protein_coding	OTTHUMT00000376950.1	C	NM_024645		40532227	-1	no_errors	ENST00000297737	ensembl	human	known	70_37	silent	SNP	0.885	T
ZMAT4	79698	genome.wustl.edu	37	8	40532227	40532227	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr8:40532227C>T	ENST00000297737.6	-	5	719	c.573G>A	c.(571-573)ctG>ctA	p.L191L	ZMAT4_ENST00000315769.7_Intron	NM_024645.2	NP_078921.1	Q9H898	ZMAT4_HUMAN	zinc finger, matrin-type 4	191						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(4)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	18	Ovarian(28;0.00724)|Colorectal(14;0.0468)	all_cancers(7;0.00936)|all_epithelial(6;3.53e-06)|all_lung(54;0.0318)|Lung NSC(58;0.0919)|Esophageal squamous(32;0.15)|Hepatocellular(245;0.152)	LUSC - Lung squamous cell carcinoma(45;0.00722)			CCTTACCTCTCAGTTCCCCCA	0.448																																																	0													116.0	109.0	111.0					8																	40532227		2203	4300	6503	SO:0001819	synonymous_variant	79698			AK023904	CCDS34885.1, CCDS47848.1	8p11.21	2012-10-05	2010-09-15		ENSG00000165061	ENSG00000165061		"""Zinc fingers, matrin-type"""	25844	protein-coding gene	gene with protein product						12477932	Standard	NM_024645		Approved	FLJ13842	uc003xnr.3	Q9H898	OTTHUMG00000164049	ENST00000297737.6:c.573G>A	8.37:g.40532227C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUT8	Silent	SNP	pfam_Znf_C2H2_jaz,smart_Znf_U1,smart_Znf_C2H2-like	p.L191	ENST00000297737.6	37	c.573	CCDS34885.1	8																																																																																			ZMAT4	-	NULL		0.448	ZMAT4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT4	HGNC	protein_coding	OTTHUMT00000376950.1	C	NM_024645		40532227	-1	no_errors	ENST00000297737	ensembl	human	known	70_37	silent	SNP	0.885	T
ZNF182	7569	genome.wustl.edu	37	X	47837064	47837064	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:47837064C>G	ENST00000396965.1	-	7	772	c.422G>C	c.(421-423)gGa>gCa	p.G141A	ZNF182_ENST00000305127.6_Missense_Mutation_p.G141A|ZNF182_ENST00000376943.3_Missense_Mutation_p.G122A	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	141					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						AAGTATGTTTCCAAACTCATG	0.353																																																	0													105.0	91.0	96.0					X																	47837064		2203	4300	6503	SO:0001583	missense	7569			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.422G>C	X.37:g.47837064C>G	ENSP00000380165:p.Gly141Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G141A	ENST00000396965.1	37	c.422	CCDS35236.1	X	.	.	.	.	.	.	.	.	.	.	C	0.697	-0.792121	0.02884	.	.	ENSG00000147118	ENST00000376943;ENST00000396965;ENST00000305127	T;T;T	0.07216	3.21;3.22;3.22	3.84	0.998	0.19857	.	.	.	.	.	T	0.10594	0.0259	M	0.64997	1.995	0.09310	N	1	P;P;B	0.42248	0.461;0.774;0.0	B;B;B	0.43155	0.311;0.41;0.001	T	0.18116	-1.0347	9	0.48119	T	0.1	.	4.7396	0.13007	0.0:0.5958:0.1795:0.2247	.	121;122;141	B4DRM0;Q96QH7;P17025	.;.;ZN182_HUMAN	A	122;141;141	ENSP00000366142:G122A;ENSP00000380165:G141A;ENSP00000306351:G141A	ENSP00000306351:G141A	G	-	2	0	ZNF182	47722008	0.206000	0.23470	0.017000	0.16124	0.556000	0.35491	1.062000	0.30555	0.077000	0.16863	0.523000	0.50628	GGA	ZNF182	-	NULL		0.353	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	HGNC	protein_coding	OTTHUMT00000277055.1	C	NM_006962		47837064	-1	no_errors	ENST00000305127	ensembl	human	known	70_37	missense	SNP	0.000	G
ZNF182	7569	genome.wustl.edu	37	X	47837064	47837064	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chrX:47837064C>G	ENST00000396965.1	-	7	772	c.422G>C	c.(421-423)gGa>gCa	p.G141A	ZNF182_ENST00000305127.6_Missense_Mutation_p.G141A|ZNF182_ENST00000376943.3_Missense_Mutation_p.G122A	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	141					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						AAGTATGTTTCCAAACTCATG	0.353																																																	0													105.0	91.0	96.0					X																	47837064		2203	4300	6503	SO:0001583	missense	7569			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.422G>C	X.37:g.47837064C>G	ENSP00000380165:p.Gly141Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A2IDD7|Q3KP67|Q96QH7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G141A	ENST00000396965.1	37	c.422	CCDS35236.1	X	.	.	.	.	.	.	.	.	.	.	C	0.697	-0.792121	0.02884	.	.	ENSG00000147118	ENST00000376943;ENST00000396965;ENST00000305127	T;T;T	0.07216	3.21;3.22;3.22	3.84	0.998	0.19857	.	.	.	.	.	T	0.10594	0.0259	M	0.64997	1.995	0.09310	N	1	P;P;B	0.42248	0.461;0.774;0.0	B;B;B	0.43155	0.311;0.41;0.001	T	0.18116	-1.0347	9	0.48119	T	0.1	.	4.7396	0.13007	0.0:0.5958:0.1795:0.2247	.	121;122;141	B4DRM0;Q96QH7;P17025	.;.;ZN182_HUMAN	A	122;141;141	ENSP00000366142:G122A;ENSP00000380165:G141A;ENSP00000306351:G141A	ENSP00000306351:G141A	G	-	2	0	ZNF182	47722008	0.206000	0.23470	0.017000	0.16124	0.556000	0.35491	1.062000	0.30555	0.077000	0.16863	0.523000	0.50628	GGA	ZNF182	-	NULL		0.353	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	HGNC	protein_coding	OTTHUMT00000277055.1	C	NM_006962		47837064	-1	no_errors	ENST00000305127	ensembl	human	known	70_37	missense	SNP	0.000	G
ZNF200	7752	genome.wustl.edu	37	16	3274470	3274470	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr16:3274470G>A	ENST00000431561.3	-	5	1222	c.610C>T	c.(610-612)Cga>Tga	p.R204*	ZNF200_ENST00000396868.3_Nonsense_Mutation_p.R203*|ZNF200_ENST00000575948.1_Nonsense_Mutation_p.R203*|ZNF200_ENST00000414144.2_Nonsense_Mutation_p.R204*|ZNF200_ENST00000396871.4_Nonsense_Mutation_p.R203*|ZNF200_ENST00000396870.4_Nonsense_Mutation_p.R203*|AJ003147.9_ENST00000576468.1_RNA	NM_001145447.1|NM_003454.3	NP_001138919.1|NP_003445.2	P98182	ZN200_HUMAN	zinc finger protein 200	204					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)	p.R204*(1)		breast(2)|kidney(2)|large_intestine(4)|lung(2)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	17						GTATTTAGTCGTTCCTTTTCC	0.368																																																	1	Substitution - Nonsense(1)	lung(1)											120.0	117.0	118.0					16																	3274470		2197	4300	6497	SO:0001587	stop_gained	7752			AF060866	CCDS10497.1, CCDS42112.1, CCDS45395.1	16p13.3	2013-01-08			ENSG00000010539	ENSG00000010539		"""Zinc fingers, C2H2-type"""	12993	protein-coding gene	gene with protein product		603231				9288094, 9787081	Standard	NM_003454		Approved		uc002cuk.2	P98182	OTTHUMG00000129317	ENST00000431561.3:c.610C>T	16.37:g.3274470G>A	ENSP00000395723:p.Arg204*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUB7|D3DUB8|O15361|Q5XKM5|Q7Z5V1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R204*	ENST00000431561.3	37	c.610	CCDS10497.1	16	.	.	.	.	.	.	.	.	.	.	G	27.1	4.797900	0.90538	.	.	ENSG00000010539	ENST00000396870;ENST00000396868;ENST00000396871;ENST00000414144;ENST00000431561	.	.	.	5.17	1.68	0.24146	.	1.039550	0.07632	N	0.928701	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.20519	T	0.43	-7.5933	4.3929	0.11350	0.0:0.178:0.1708:0.6512	.	.	.	.	X	204;203;203;203;204	.	ENSP00000380077:R203X	R	-	1	2	ZNF200	3214471	0.000000	0.05858	0.000000	0.03702	0.021000	0.10359	0.101000	0.15251	0.101000	0.17610	-0.545000	0.04230	CGA	ZNF200	-	NULL		0.368	ZNF200-005	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF200	HGNC	protein_coding	OTTHUMT00000437545.1	G			3274470	-1	no_errors	ENST00000414144	ensembl	human	known	70_37	nonsense	SNP	0.000	A
ZNF415	55786	genome.wustl.edu	37	19	53612640	53612640	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:53612640C>G	ENST00000500065.4	-	4	991	c.658G>C	c.(658-660)Gag>Cag	p.E220Q	ZNF415_ENST00000448501.1_Missense_Mutation_p.E268Q|ZNF415_ENST00000597748.1_3'UTR|ZNF415_ENST00000421033.1_Missense_Mutation_p.E232Q|ZNF415_ENST00000597503.1_3'UTR|ZNF415_ENST00000594011.1_3'UTR|ZNF415_ENST00000595193.1_3'UTR|ZNF415_ENST00000440291.1_Missense_Mutation_p.E207Q|ZNF415_ENST00000601493.1_5'UTR|ZNF415_ENST00000243643.4_Missense_Mutation_p.E220Q|ZNF415_ENST00000455735.2_Missense_Mutation_p.E268Q	NM_001136038.2	NP_001129510.2	Q09FC8	ZN415_HUMAN	zinc finger protein 415	268					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|kidney(3)|large_intestine(8)|lung(11)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31				GBM - Glioblastoma multiforme(134;0.0191)		TTGTCGCACTCAATATATCTG	0.383																																																	0													154.0	123.0	133.0					19																	53612640		2203	4300	6503	SO:0001583	missense	55786			AK002053	CCDS12860.1, CCDS54313.1	19q13.42	2014-03-18			ENSG00000170954	ENSG00000170954		"""Zinc fingers, C2H2-type"", ""-"""	20636	protein-coding gene	gene with protein product						14702039	Standard	NM_001136038		Approved		uc002qaw.3	Q09FC8	OTTHUMG00000182865	ENST00000500065.4:c.658G>C	19.37:g.53612640C>G	ENSP00000439435:p.Glu220Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	F5H287|Q09FC7|Q09FC9|Q09FD0|Q6NSZ2|Q6P3S0|Q9NUR2	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,smart_Znf_BED_prd,pfscan_Znf_C2H2	p.E268Q	ENST00000500065.4	37	c.802	CCDS54313.1	19	.	.	.	.	.	.	.	.	.	.	C	8.299	0.819519	0.16607	.	.	ENSG00000170954	ENST00000243643;ENST00000500065;ENST00000448501;ENST00000421033;ENST00000455735;ENST00000440291	T;T;T;T;T;T	0.16196	2.36;2.36;2.36;2.36;2.36;2.36	2.61	0.239	0.15484	Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.24774	0.0601	L	0.38953	1.18	0.09310	N	1	B;B;B;D;P;D	0.61080	0.352;0.007;0.36;0.981;0.537;0.989	B;B;B;D;B;P	0.69479	0.133;0.023;0.063;0.964;0.175;0.89	T	0.13602	-1.0503	9	0.39692	T	0.17	.	6.6806	0.23117	0.0:0.7081:0.1797:0.1122	.	220;268;268;220;207;232	F5H287;B3KTG1;Q09FC8;Q09FC8-5;Q09FC8-4;Q09FC8-2	.;.;ZN415_HUMAN;.;.;.	Q	220;220;268;232;268;207	ENSP00000243643:E220Q;ENSP00000439435:E220Q;ENSP00000396492:E268Q;ENSP00000395055:E232Q;ENSP00000388787:E268Q;ENSP00000414601:E207Q	ENSP00000243643:E220Q	E	-	1	0	ZNF415	58304452	0.000000	0.05858	0.000000	0.03702	0.007000	0.05969	0.261000	0.18442	0.021000	0.15133	-0.676000	0.03789	GAG	ZNF415	-	NULL		0.383	ZNF415-025	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF415	HGNC	protein_coding	OTTHUMT00000464043.1	C	NM_018355		53612640	-1	no_errors	ENST00000448501	ensembl	human	known	70_37	missense	SNP	0.000	G
ZNF79	7633	genome.wustl.edu	37	9	130207191	130207191	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:130207191C>T	ENST00000342483.5	+	5	1618	c.1212C>T	c.(1210-1212)ctC>ctT	p.L404L	ZNF79_ENST00000543471.1_Silent_p.L380L|RPL12_ENST00000497322.1_5'Flank	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						GTACCAATCTCATAATCCACC	0.488																																																	0													65.0	65.0	65.0					9																	130207191		2203	4300	6503	SO:0001819	synonymous_variant	7633			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.1212C>T	9.37:g.130207191C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VVW1|Q96NV1	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L404	ENST00000342483.5	37	c.1212	CCDS6871.1	9																																																																																			ZNF79	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.488	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF79	HGNC	protein_coding	OTTHUMT00000054188.1	C	NM_007135		130207191	+1	no_errors	ENST00000342483	ensembl	human	known	70_37	silent	SNP	0.288	T
ZNF79	7633	genome.wustl.edu	37	9	130207191	130207191	+	Silent	SNP	C	C	T			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr9:130207191C>T	ENST00000342483.5	+	5	1618	c.1212C>T	c.(1210-1212)ctC>ctT	p.L404L	ZNF79_ENST00000543471.1_Silent_p.L380L|RPL12_ENST00000497322.1_5'Flank	NM_007135.2	NP_009066.2	Q15937	ZNF79_HUMAN	zinc finger protein 79	404					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|stomach(2)	28						GTACCAATCTCATAATCCACC	0.488																																																	0													65.0	65.0	65.0					9																	130207191		2203	4300	6503	SO:0001819	synonymous_variant	7633			X65232	CCDS6871.1, CCDS69664.1, CCDS75904.1	9q34	2013-01-08	2006-05-12		ENSG00000196152	ENSG00000196152		"""Zinc fingers, C2H2-type"""	13153	protein-coding gene	gene with protein product		194552	"""zinc finger protein 79 (pT7)"""			8478004	Standard	NM_007135		Approved	pT7	uc004bqw.4	Q15937	OTTHUMG00000020703	ENST00000342483.5:c.1212C>T	9.37:g.130207191C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VVW1|Q96NV1	Silent	SNP	pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L404	ENST00000342483.5	37	c.1212	CCDS6871.1	9																																																																																			ZNF79	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.488	ZNF79-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF79	HGNC	protein_coding	OTTHUMT00000054188.1	C	NM_007135		130207191	+1	no_errors	ENST00000342483	ensembl	human	known	70_37	silent	SNP	0.288	T
ZNF808	388558	genome.wustl.edu	37	19	53057628	53057628	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:53057628G>C	ENST00000359798.4	+	5	1639	c.1459G>C	c.(1459-1461)Gag>Cag	p.E487Q		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CAAGTGTAATGAGTGTCGCAA	0.423																																																	0													80.0	85.0	84.0					19																	53057628		2203	4300	6503	SO:0001583	missense	388558			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1459G>C	19.37:g.53057628G>C	ENSP00000352846:p.Glu487Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CN7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E487Q	ENST00000359798.4	37	c.1459	CCDS46167.1	19	.	.	.	.	.	.	.	.	.	.	.	8.601	0.886963	0.17540	.	.	ENSG00000198482	ENST00000359798	T	0.07444	3.19	1.5	1.5	0.22942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11153	0.0272	N	0.20401	0.57	0.09310	N	1	D	0.56968	0.978	P	0.58780	0.845	T	0.33085	-0.9882	9	0.34782	T	0.22	.	9.9166	0.41439	0.0:0.0:1.0:0.0	.	487	Q8N4W9	ZN808_HUMAN	Q	487	ENSP00000352846:E487Q	ENSP00000352846:E487Q	E	+	1	0	ZNF808	57749440	0.000000	0.05858	0.002000	0.10522	0.078000	0.17371	-0.026000	0.12392	0.798000	0.33994	0.195000	0.17529	GAG	ZNF808	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF808	HGNC	protein_coding	OTTHUMT00000350447.3	G	NM_001039886		53057628	+1	no_errors	ENST00000359798	ensembl	human	known	70_37	missense	SNP	0.003	C
ZNF808	388558	genome.wustl.edu	37	19	53057628	53057628	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1BJ-01A-11D-A13W-08	TCGA-C5-A1BJ-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	fbd78148-6bfc-4713-b46d-3a4785e01590	029ff7f2-694b-410e-a81d-f5a32151b495	g.chr19:53057628G>C	ENST00000359798.4	+	5	1639	c.1459G>C	c.(1459-1461)Gag>Cag	p.E487Q		NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808	487					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		CAAGTGTAATGAGTGTCGCAA	0.423																																																	0													80.0	85.0	84.0					19																	53057628		2203	4300	6503	SO:0001583	missense	388558			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.1459G>C	19.37:g.53057628G>C	ENSP00000352846:p.Glu487Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CN7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E487Q	ENST00000359798.4	37	c.1459	CCDS46167.1	19	.	.	.	.	.	.	.	.	.	.	.	8.601	0.886963	0.17540	.	.	ENSG00000198482	ENST00000359798	T	0.07444	3.19	1.5	1.5	0.22942	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.11153	0.0272	N	0.20401	0.57	0.09310	N	1	D	0.56968	0.978	P	0.58780	0.845	T	0.33085	-0.9882	9	0.34782	T	0.22	.	9.9166	0.41439	0.0:0.0:1.0:0.0	.	487	Q8N4W9	ZN808_HUMAN	Q	487	ENSP00000352846:E487Q	ENSP00000352846:E487Q	E	+	1	0	ZNF808	57749440	0.000000	0.05858	0.002000	0.10522	0.078000	0.17371	-0.026000	0.12392	0.798000	0.33994	0.195000	0.17529	GAG	ZNF808	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF808	HGNC	protein_coding	OTTHUMT00000350447.3	G	NM_001039886		53057628	+1	no_errors	ENST00000359798	ensembl	human	known	70_37	missense	SNP	0.003	C
