#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCB10	23456	genome.wustl.edu	37	1	229667459	229667459	+	Silent	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:229667459C>T	ENST00000344517.4	-	7	1401	c.1359G>A	c.(1357-1359)tcG>tcA	p.S453S		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	453	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.S453S(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TCATCAGCTCCGAGTAGAAAG	0.547																																																	1	Substitution - coding silent(1)	lung(1)											56.0	62.0	60.0					1																	229667459		2203	4300	6503	SO:0001819	synonymous_variant	23456			U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1359G>A	1.37:g.229667459C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13040|Q6P1Q8|Q9H3V0	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S453	ENST00000344517.4	37	c.1359	CCDS1580.1	1																																																																																			ABCB10	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1		0.547	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	HGNC	protein_coding	OTTHUMT00000095240.1	C	NM_012089		229667459	-1	no_errors	ENST00000344517	ensembl	human	known	70_37	silent	SNP	0.021	T
ABCB10	23456	genome.wustl.edu	37	1	229667459	229667459	+	Silent	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:229667459C>T	ENST00000344517.4	-	7	1401	c.1359G>A	c.(1357-1359)tcG>tcA	p.S453S		NM_012089.2	NP_036221.2	Q9NRK6	ABCBA_HUMAN	ATP-binding cassette, sub-family B (MDR/TAP), member 10	453	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of mitochondrial membrane (GO:0032592)|mitochondrial inner membrane (GO:0005743)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|transporter activity (GO:0005215)	p.S453S(1)		breast(3)|endometrium(2)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)	31	Breast(184;0.143)|Ovarian(103;0.249)	Prostate(94;0.167)				TCATCAGCTCCGAGTAGAAAG	0.547																																																	1	Substitution - coding silent(1)	lung(1)											56.0	62.0	60.0					1																	229667459		2203	4300	6503	SO:0001819	synonymous_variant	23456			U18237	CCDS1580.1	1q32	2012-03-14			ENSG00000135776	ENSG00000135776		"""ATP binding cassette transporters / subfamily B"""	41	protein-coding gene	gene with protein product	"""ATP-binding cassette sub-family B member 10, mitochondrial"", ""ATP-binding cassette transporter 10"", ""ABC transporter 10 protein"", ""mitochondrial ATP-binding cassette 2"""	605454				7766993	Standard	NM_012089		Approved	EST20237, M-ABC2, MTABC2	uc001htp.4	Q9NRK6	OTTHUMG00000039471	ENST00000344517.4:c.1359G>A	1.37:g.229667459C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13040|Q6P1Q8|Q9H3V0	Silent	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.S453	ENST00000344517.4	37	c.1359	CCDS1580.1	1																																																																																			ABCB10	-	superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1		0.547	ABCB10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCB10	HGNC	protein_coding	OTTHUMT00000095240.1	C	NM_012089		229667459	-1	no_errors	ENST00000344517	ensembl	human	known	70_37	silent	SNP	0.021	T
AKAP4	8852	genome.wustl.edu	37	X	49955455	49955455	+	3'UTR	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:49955455G>A	ENST00000376056.2	-	0	2836				AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_3'UTR|AKAP4_ENST00000358526.2_3'UTR|AKAP4_ENST00000376064.3_3'UTR					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CCAGTTTGTTGACACCTCTTA	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	8852			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.*148C>T	X.37:g.49955455G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000376056.2	37	NULL	CCDS14330.1	X																																																																																			AKAP4	-	-		0.393	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	G	NM_003886		49955455	-1	no_errors	ENST00000481402	ensembl	human	known	70_37	rna	SNP	0.013	A
AKAP4	8852	genome.wustl.edu	37	X	49955455	49955455	+	3'UTR	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:49955455G>A	ENST00000376056.2	-	0	2836				AKAP4_ENST00000481402.1_5'UTR|AKAP4_ENST00000376058.2_3'UTR|AKAP4_ENST00000358526.2_3'UTR|AKAP4_ENST00000376064.3_3'UTR					A kinase (PRKA) anchor protein 4											NS(2)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(6)|lung(14)|ovary(1)|skin(4)	41	Ovarian(276;0.236)					CCAGTTTGTTGACACCTCTTA	0.393																																																	0																																										SO:0001624	3_prime_UTR_variant	8852			AF072756	CCDS14329.1, CCDS14330.1	Xp11.2	2009-03-12			ENSG00000147081	ENSG00000147081		"""A-kinase anchor proteins"""	374	protein-coding gene	gene with protein product	"""A-kinase anchor protein 82 kDa"", ""testis-specific gene HI"", ""protein kinase A anchoring protein 4"", ""cancer/testis antigen 99"""	300185				9822690, 9514854	Standard	NM_003886		Approved	p82, hAKAP82, AKAP82, Fsc1, HI, CT99	uc004dow.1	Q5JQC9	OTTHUMG00000021517	ENST00000376056.2:c.*148C>T	X.37:g.49955455G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000376056.2	37	NULL	CCDS14330.1	X																																																																																			AKAP4	-	-		0.393	AKAP4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP4	HGNC	protein_coding	OTTHUMT00000056552.1	G	NM_003886		49955455	-1	no_errors	ENST00000481402	ensembl	human	known	70_37	rna	SNP	0.013	A
AMY2B	280	genome.wustl.edu	37	1	104122043	104122043	+	Missense_Mutation	SNP	A	A	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:104122043A>T	ENST00000361355.4	+	12	2073	c.1457A>T	c.(1456-1458)gAc>gTc	p.D486V	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	486					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TACGTTTCTGACGATGGCAAA	0.328																																																	0													232.0	240.0	237.0					1																	104122043		2203	4300	6503	SO:0001583	missense	280			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1457A>T	1.37:g.104122043A>T	ENSP00000354610:p.Asp486Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.D486V	ENST00000361355.4	37	c.1457	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	A	4.118	0.020127	0.08006	.	.	ENSG00000240038	ENST00000361355	T	0.76316	-1.01	4.14	-3.22	0.05125	Alpha-amylase, C-terminal all beta (2);Glycosyl hydrolase, family 13, all-beta (1);	1.333080	0.05584	N	0.573391	T	0.53384	0.1793	L	0.57536	1.79	0.09310	N	1	B	0.06786	0.001	B	0.16289	0.015	T	0.55579	-0.8119	10	0.72032	D	0.01	.	6.1207	0.20151	0.4972:0.2384:0.2644:0.0	.	486	P19961	AMY2B_HUMAN	V	486	ENSP00000354610:D486V	ENSP00000354610:D486V	D	+	2	0	AMY2B	103923566	0.000000	0.05858	0.003000	0.11579	0.037000	0.13140	-1.612000	0.02061	-0.387000	0.07809	0.477000	0.44152	GAC	AMY2B	-	pfam_A-amylase_b_C,smart_A-amylase_b_C		0.328	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	A	NM_020978		104122043	+1	no_errors	ENST00000361355	ensembl	human	known	70_37	missense	SNP	0.000	T
AMY2B	280	genome.wustl.edu	37	1	104122043	104122043	+	Missense_Mutation	SNP	A	A	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:104122043A>T	ENST00000361355.4	+	12	2073	c.1457A>T	c.(1456-1458)gAc>gTc	p.D486V	AMY2B_ENST00000491397.1_3'UTR	NM_020978.3	NP_066188.1	P19961	AMY2B_HUMAN	amylase, alpha 2B (pancreatic)	486					carbohydrate metabolic process (GO:0005975)|digestion (GO:0007586)	extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(4)|large_intestine(1)|lung(30)|prostate(1)|skin(1)|urinary_tract(1)	46		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0669)|all cancers(265;0.083)|Epithelial(280;0.094)|Lung(183;0.112)		TACGTTTCTGACGATGGCAAA	0.328																																																	0													232.0	240.0	237.0					1																	104122043		2203	4300	6503	SO:0001583	missense	280			M24895	CCDS782.1	1p21	2010-08-02	2006-04-27		ENSG00000240038	ENSG00000240038	3.2.1.1		478	protein-coding gene	gene with protein product		104660	"""amylase, alpha 2B; pancreatic"""	AMY2		8268204	Standard	NM_020978		Approved		uc001duq.3	P19961	OTTHUMG00000011024	ENST00000361355.4:c.1457A>T	1.37:g.104122043A>T	ENSP00000354610:p.Asp486Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTI1|B3KXB7|D3DT76|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.D486V	ENST00000361355.4	37	c.1457	CCDS782.1	1	.	.	.	.	.	.	.	.	.	.	A	4.118	0.020127	0.08006	.	.	ENSG00000240038	ENST00000361355	T	0.76316	-1.01	4.14	-3.22	0.05125	Alpha-amylase, C-terminal all beta (2);Glycosyl hydrolase, family 13, all-beta (1);	1.333080	0.05584	N	0.573391	T	0.53384	0.1793	L	0.57536	1.79	0.09310	N	1	B	0.06786	0.001	B	0.16289	0.015	T	0.55579	-0.8119	10	0.72032	D	0.01	.	6.1207	0.20151	0.4972:0.2384:0.2644:0.0	.	486	P19961	AMY2B_HUMAN	V	486	ENSP00000354610:D486V	ENSP00000354610:D486V	D	+	2	0	AMY2B	103923566	0.000000	0.05858	0.003000	0.11579	0.037000	0.13140	-1.612000	0.02061	-0.387000	0.07809	0.477000	0.44152	GAC	AMY2B	-	pfam_A-amylase_b_C,smart_A-amylase_b_C		0.328	AMY2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2B	HGNC	protein_coding	OTTHUMT00000030318.1	A	NM_020978		104122043	+1	no_errors	ENST00000361355	ensembl	human	known	70_37	missense	SNP	0.000	T
ANKRD20A4	728747	genome.wustl.edu	37	9	69420382	69420382	+	Silent	SNP	G	G	A	rs367900024		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr9:69420382G>A	ENST00000357336.3	+	13	1553	c.1272G>A	c.(1270-1272)acG>acA	p.T424T		NM_001098805.1	NP_001092275.1	Q4UJ75	A20A4_HUMAN	ankyrin repeat domain 20 family, member A4	424										breast(1)|large_intestine(1)|liver(1)|lung(9)|pancreas(2)|skin(2)	16						TTGGGAAAACGTATCCTCAGC	0.348																																																	0													97.0	146.0	128.0					9																	69420382		1331	2288	3619	SO:0001819	synonymous_variant	728747				CCDS43828.1	9q21.11	2013-01-10			ENSG00000172014	ENSG00000172014		"""Ankyrin repeat domain containing"""	31982	protein-coding gene	gene with protein product							Standard	NM_001098805		Approved	OTTHUMG00000066855	uc004afn.3	Q4UJ75	OTTHUMG00000066855	ENST00000357336.3:c.1272G>A	9.37:g.69420382G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.T424	ENST00000357336.3	37	c.1272	CCDS43828.1	9																																																																																			ANKRD20A4	-	NULL		0.348	ANKRD20A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A4	HGNC	protein_coding	OTTHUMT00000143287.3	G	NM_001098805		69420382	+1	no_errors	ENST00000357336	ensembl	human	known	70_37	silent	SNP	0.000	A
ANKRD49	54851	genome.wustl.edu	37	11	94230225	94230225	+	Intron	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:94230225G>A	ENST00000544612.1	+	2	755				ANKRD49_ENST00000302755.4_Intron|ANKRD49_ENST00000544253.1_Silent_p.V122V|ANKRD49_ENST00000540349.1_Silent_p.V122V	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49						positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				tcttgattgtgaggaccaaat	0.383																																					Melanoma(113;823 1621 4352 9582 22033)												0																																										SO:0001627	intron_variant	54851			AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.258+108G>A	11.37:g.94230225G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NDF2|Q96JE5|Q9NXK7	Silent	SNP	NULL	p.V122	ENST00000544612.1	37	c.366	CCDS8300.1	11																																																																																			ANKRD49	-	NULL		0.383	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD49	HGNC	protein_coding	OTTHUMT00000396314.2	G	NM_017704		94230225	+1	no_errors	ENST00000534911	ensembl	human	known	70_37	silent	SNP	0.001	A
ANKRD49	54851	genome.wustl.edu	37	11	94230225	94230225	+	Intron	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:94230225G>A	ENST00000544612.1	+	2	755				ANKRD49_ENST00000302755.4_Intron|ANKRD49_ENST00000544253.1_Silent_p.V122V|ANKRD49_ENST00000540349.1_Silent_p.V122V	NM_017704.2	NP_060174.2	Q8WVL7	ANR49_HUMAN	ankyrin repeat domain 49						positive regulation of transcription, DNA-templated (GO:0045893)	nucleus (GO:0005634)				autonomic_ganglia(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|liver(1)|lung(4)|urinary_tract(1)	12		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				tcttgattgtgaggaccaaat	0.383																																					Melanoma(113;823 1621 4352 9582 22033)												0																																										SO:0001627	intron_variant	54851			AF025354	CCDS8300.1	11q21	2013-01-10				ENSG00000168876		"""Ankyrin repeat domain containing"""	25970	protein-coding gene	gene with protein product						11162141	Standard	NM_017704		Approved	FLJ20189, FGIF, GBIF	uc001pew.3	Q8WVL7		ENST00000544612.1:c.258+108G>A	11.37:g.94230225G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NDF2|Q96JE5|Q9NXK7	Silent	SNP	NULL	p.V122	ENST00000544612.1	37	c.366	CCDS8300.1	11																																																																																			ANKRD49	-	NULL		0.383	ANKRD49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD49	HGNC	protein_coding	OTTHUMT00000396314.2	G	NM_017704		94230225	+1	no_errors	ENST00000534911	ensembl	human	known	70_37	silent	SNP	0.001	A
APAF1	317	genome.wustl.edu	37	12	99042620	99042620	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:99042620C>T	ENST00000551964.1	+	3	1064				APAF1_ENST00000339433.3_Intron|APAF1_ENST00000357310.1_Intron|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000549007.1_Intron|APAF1_ENST00000547743.1_Missense_Mutation_p.L119F|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000359972.2_Intron|APAF1_ENST00000550527.1_Intron|APAF1_ENST00000547045.1_Intron	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CCTTCTATCACTTTGCTATCA	0.358																																																	0													106.0	105.0	106.0					12																	99042620		2203	4300	6503	SO:0001627	intron_variant	317			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.328+27C>T	12.37:g.99042620C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.L119F	ENST00000551964.1	37	c.355	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	C	5.673	0.308844	0.10733	.	.	ENSG00000120868	ENST00000547743	.	.	.	3.19	-2.37	0.06643	.	.	.	.	.	T	0.22205	0.0535	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30851	-0.9964	4	.	.	.	.	5.047	0.14488	0.1482:0.5908:0.0:0.2611	.	.	.	.	F	119	.	.	L	+	1	0	APAF1	97566751	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.061000	0.11693	-0.349000	0.08274	0.563000	0.77884	CTT	APAF1	-	NULL		0.358	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	C	NM_181861.1		99042620	+1	no_errors	ENST00000547743	ensembl	human	putative	70_37	missense	SNP	0.000	T
APAF1	317	genome.wustl.edu	37	12	99042620	99042620	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:99042620C>T	ENST00000551964.1	+	3	1064				APAF1_ENST00000339433.3_Intron|APAF1_ENST00000357310.1_Intron|APAF1_ENST00000552268.1_Intron|APAF1_ENST00000549007.1_Intron|APAF1_ENST00000547743.1_Missense_Mutation_p.L119F|APAF1_ENST00000333991.1_Intron|APAF1_ENST00000359972.2_Intron|APAF1_ENST00000550527.1_Intron|APAF1_ENST00000547045.1_Intron	NM_181861.1	NP_863651.1	O14727	APAF_HUMAN	apoptotic peptidase activating factor 1						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|apoptotic process (GO:0006915)|forebrain development (GO:0030900)|intrinsic apoptotic signaling pathway (GO:0097193)|nervous system development (GO:0007399)|neural tube closure (GO:0001843)|neuron apoptotic process (GO:0051402)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|regulation of apoptotic DNA fragmentation (GO:1902510)|regulation of apoptotic process (GO:0042981)|response to G1 DNA damage checkpoint signaling (GO:0072432)	apoptosome (GO:0043293)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|nucleotide binding (GO:0000166)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(13)|liver(1)|lung(15)|ovary(2)|prostate(2)|skin(1)	42					Adenosine triphosphate(DB00171)	CCTTCTATCACTTTGCTATCA	0.358																																																	0													106.0	105.0	106.0					12																	99042620		2203	4300	6503	SO:0001627	intron_variant	317			AF013263	CCDS9069.1, CCDS9070.1, CCDS9071.1, CCDS55862.1, CCDS55863.1	12q23	2013-01-10	2006-10-23			ENSG00000120868		"""WD repeat domain containing"""	576	protein-coding gene	gene with protein product		602233	"""apoptotic protease activating factor"", ""apoptotic peptidase activating factor"""			9267021, 10702682	Standard	NM_181861		Approved	CED4, APAF-1	uc001tfz.3	O14727	OTTHUMG00000170214	ENST00000551964.1:c.328+27C>T	12.37:g.99042620C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RMX8|O43297|Q7Z438|Q9BXZ6|Q9UBZ5|Q9UGN8|Q9UGN9|Q9UGP0|Q9UJ58|Q9UJ59|Q9UJ60|Q9UJ61|Q9UJ62|Q9UJ63|Q9UJ64|Q9UJ65|Q9UJ66|Q9UJ67|Q9UNC9	Missense_Mutation	SNP	pfam_CARD,superfamily_DEATH-like,pfscan_CARD	p.L119F	ENST00000551964.1	37	c.355	CCDS9069.1	12	.	.	.	.	.	.	.	.	.	.	C	5.673	0.308844	0.10733	.	.	ENSG00000120868	ENST00000547743	.	.	.	3.19	-2.37	0.06643	.	.	.	.	.	T	0.22205	0.0535	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.30851	-0.9964	4	.	.	.	.	5.047	0.14488	0.1482:0.5908:0.0:0.2611	.	.	.	.	F	119	.	.	L	+	1	0	APAF1	97566751	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-0.061000	0.11693	-0.349000	0.08274	0.563000	0.77884	CTT	APAF1	-	NULL		0.358	APAF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	APAF1	HGNC	protein_coding	OTTHUMT00000408006.1	C	NM_181861.1		99042620	+1	no_errors	ENST00000547743	ensembl	human	putative	70_37	missense	SNP	0.000	T
ARHGAP18	93663	genome.wustl.edu	37	6	129920086	129920087	+	5'UTR	INS	-	-	GTGT	rs71028166|rs527670245|rs139994403|rs376498570	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr6:129920086_129920087insGTGT	ENST00000463225.1	-	0	19_20				ARHGAP18_ENST00000368149.2_Intron					Rho GTPase activating protein 18											NS(2)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(2)|skin(3)	18				OV - Ovarian serous cystadenocarcinoma(136;0.0621)|GBM - Glioblastoma multiforme(226;0.0638)|all cancers(137;0.074)		GGGGTGTAGGGgtgtgtgtgtg	0.446																																																	0																																										SO:0001623	5_prime_UTR_variant	93663			AB053293	CCDS34535.1	6q23.1	2011-06-29			ENSG00000146376	ENSG00000146376		"""Rho GTPase activating proteins"""	21035	protein-coding gene	gene with protein product		613351					Standard	NM_033515		Approved	MacGAP, bA307O14.2	uc003qbr.3	Q8N392	OTTHUMG00000015547	ENST00000463225.1:c.-445->ACAC	6.37:g.129920091_129920094dupGTGT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000463225.1	37	NULL		6																																																																																			ARHGAP18	-	-		0.446	ARHGAP18-003	KNOWN	basic	processed_transcript	ARHGAP18	HGNC	protein_coding	OTTHUMT00000042187.1	-	NM_033515		129920087	-1	no_errors	ENST00000463225	ensembl	human	known	70_37	rna	INS	0.000:0.001	GTGT
ATP10A	57194	genome.wustl.edu	37	15	25972339	25972339	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:25972339G>A	ENST00000356865.6	-	4	926	c.815C>T	c.(814-816)aCg>aTg	p.T272M		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	272					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GACTGCGTCCGTGTTCCTAAG	0.582																																																	0													158.0	121.0	134.0					15																	25972339		2203	4300	6503	SO:0001583	missense	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.815C>T	15.37:g.25972339G>A	ENSP00000349325:p.Thr272Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.T272M	ENST00000356865.6	37	c.815	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054750	0.75960	.	.	ENSG00000206190	ENST00000356865	D	0.90732	-2.72	5.34	5.34	0.76211	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.97892	0.9307	H	0.99668	4.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99804	1.1037	10	0.87932	D	0	-22.8785	19.0349	0.92972	0.0:0.0:1.0:0.0	.	272	O60312	AT10A_HUMAN	M	272	ENSP00000349325:T272M	ENSP00000349325:T272M	T	-	2	0	ATP10A	23523432	1.000000	0.71417	0.954000	0.39281	0.329000	0.28539	9.091000	0.94151	2.513000	0.84729	0.563000	0.77884	ACG	ATP10A	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl		0.582	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	G	NM_024490		25972339	-1	no_errors	ENST00000356865	ensembl	human	known	70_37	missense	SNP	1.000	A
ATP10A	57194	genome.wustl.edu	37	15	25972339	25972339	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:25972339G>A	ENST00000356865.6	-	4	926	c.815C>T	c.(814-816)aCg>aTg	p.T272M		NM_024490.3	NP_077816.1	O60312	AT10A_HUMAN	ATPase, class V, type 10A	272					ion transmembrane transport (GO:0034220)|phospholipid translocation (GO:0045332)|regulation of cell shape (GO:0008360)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			NS(1)|breast(2)|endometrium(8)|kidney(2)|large_intestine(33)|liver(1)|lung(41)|ovary(3)|pancreas(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	103		all_cancers(20;5.16e-25)|all_lung(180;1.51e-14)|Acute lymphoblastic leukemia(1;2.53e-05)|all_hematologic(1;0.000267)|Breast(32;0.00125)		all cancers(64;9.48e-07)|Epithelial(43;1.69e-06)|BRCA - Breast invasive adenocarcinoma(123;0.0252)|Lung(196;0.244)		GACTGCGTCCGTGTTCCTAAG	0.582																																																	0													158.0	121.0	134.0					15																	25972339		2203	4300	6503	SO:0001583	missense	57194			AB011138	CCDS32178.1	15q12	2010-04-20	2007-09-19		ENSG00000206190	ENSG00000206190		"""ATPases / P-type"""	13542	protein-coding gene	gene with protein product		605855	"""ATPase, Class V, type 10C"", ""ATPase, Class V, type 10A"""	ATP10C		11015572, 9628581	Standard	NM_024490		Approved	ATPVA, ATPVC, KIAA0566	uc010ayu.3	O60312		ENST00000356865.6:c.815C>T	15.37:g.25972339G>A	ENSP00000349325:p.Thr272Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0S9|Q969I4	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.T272M	ENST00000356865.6	37	c.815	CCDS32178.1	15	.	.	.	.	.	.	.	.	.	.	G	20.8	4.054750	0.75960	.	.	ENSG00000206190	ENST00000356865	D	0.90732	-2.72	5.34	5.34	0.76211	ATPase, P-type, ATPase-associated domain (1);ATPase,  P-type, cytoplasmic transduction domain A (1);	0.000000	0.85682	D	0.000000	D	0.97892	0.9307	H	0.99668	4.69	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.99804	1.1037	10	0.87932	D	0	-22.8785	19.0349	0.92972	0.0:0.0:1.0:0.0	.	272	O60312	AT10A_HUMAN	M	272	ENSP00000349325:T272M	ENSP00000349325:T272M	T	-	2	0	ATP10A	23523432	1.000000	0.71417	0.954000	0.39281	0.329000	0.28539	9.091000	0.94151	2.513000	0.84729	0.563000	0.77884	ACG	ATP10A	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl		0.582	ATP10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP10A	HGNC	protein_coding	OTTHUMT00000414830.1	G	NM_024490		25972339	-1	no_errors	ENST00000356865	ensembl	human	known	70_37	missense	SNP	1.000	A
AXIN2	8313	genome.wustl.edu	37	17	63554353	63554353	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:63554353C>T	ENST00000375702.5	-	1	494	c.386G>A	c.(385-387)cGa>cAa	p.R129Q	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Missense_Mutation_p.R129Q			Q9Y2T1	AXIN2_HUMAN	axin 2	129	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.R129L(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TTTGGCTACTCGTAAAGTTTT	0.463									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								1	Substitution - Missense(1)	endometrium(1)											306.0	266.0	280.0					17																	63554353		2203	4300	6503	SO:0001583	missense	8313	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.386G>A	17.37:g.63554353C>T	ENSP00000364854:p.Arg129Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.R129Q	ENST00000375702.5	37	c.386		17	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486049	0.44147	.	.	ENSG00000168646	ENST00000307078;ENST00000544103;ENST00000375702	T;T;T	0.01821	4.62;4.62;4.62	4.59	4.59	0.56863	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.03564	0.0102	N	0.17082	0.46	0.80722	D	1	D;B;D	0.71674	0.998;0.029;0.998	P;B;P	0.55713	0.782;0.018;0.782	T	0.62148	-0.6915	10	0.66056	D	0.02	-5.2596	17.4003	0.87458	0.0:1.0:0.0:0.0	.	129;129;129	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	Q	129	ENSP00000302625:R129Q;ENSP00000441151:R129Q;ENSP00000364854:R129Q	ENSP00000302625:R129Q	R	-	2	0	AXIN2	60984815	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.880000	0.63107	2.084000	0.62774	0.455000	0.32223	CGA	AXIN2	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal		0.463	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	HGNC	protein_coding	OTTHUMT00000445901.1	C	NM_004655		63554353	-1	no_errors	ENST00000307078	ensembl	human	known	70_37	missense	SNP	1.000	T
AXIN2	8313	genome.wustl.edu	37	17	63554353	63554353	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:63554353C>T	ENST00000375702.5	-	1	494	c.386G>A	c.(385-387)cGa>cAa	p.R129Q	CTD-2535L24.2_ENST00000577662.1_3'UTR|AXIN2_ENST00000307078.5_Missense_Mutation_p.R129Q			Q9Y2T1	AXIN2_HUMAN	axin 2	129	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				bone mineralization (GO:0030282)|cell proliferation (GO:0008283)|cellular protein localization (GO:0034613)|cellular response to organic cyclic compound (GO:0071407)|chondrocyte differentiation involved in endochondral bone morphogenesis (GO:0003413)|dorsal/ventral axis specification (GO:0009950)|intramembranous ossification (GO:0001957)|maintenance of DNA repeat elements (GO:0043570)|mRNA stabilization (GO:0048255)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell proliferation (GO:0008285)|negative regulation of osteoblast differentiation (GO:0045668)|odontogenesis (GO:0042476)|positive regulation of cell death (GO:0010942)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein phosphorylation (GO:0001934)|regulation of centromeric sister chromatid cohesion (GO:0070602)|regulation of chondrocyte development (GO:0061181)|regulation of mismatch repair (GO:0032423)|secondary heart field specification (GO:0003139)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway involved in somitogenesis (GO:0090244)	beta-catenin destruction complex (GO:0030877)|cell cortex (GO:0005938)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoplasmic microtubule (GO:0005881)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|enzyme binding (GO:0019899)|GTPase activator activity (GO:0005096)|protein kinase binding (GO:0019901)|ubiquitin protein ligase binding (GO:0031625)	p.R129L(1)		NS(1)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	34						TTTGGCTACTCGTAAAGTTTT	0.463									Oligodontia, Ectodermal Dysplasia and Colorectal Polyp syndrome																																								1	Substitution - Missense(1)	endometrium(1)											306.0	266.0	280.0					17																	63554353		2203	4300	6503	SO:0001583	missense	8313	Familial Cancer Database	Oligodontia-Colorectal Cancer syndrome, Tooth Agenesis-Colorectal Cancer Syndrome	AF078165	CCDS11662.1	17q24.1	2014-09-17	2008-08-01		ENSG00000168646				904	protein-coding gene	gene with protein product	"""conductin"", ""axil"""	604025				10049590	Standard	NM_004655		Approved	MGC126582, DKFZp781B0869	uc002jfi.3	Q9Y2T1	OTTHUMG00000179353	ENST00000375702.5:c.386G>A	17.37:g.63554353C>T	ENSP00000364854:p.Arg129Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MJ88|Q9H3M6|Q9UH84	Missense_Mutation	SNP	pfam_DIX,pfam_Regulat_G_prot_signal,pfam_Axin_b-cat-bd,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_DIX,pfscan_DIX,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.R129Q	ENST00000375702.5	37	c.386		17	.	.	.	.	.	.	.	.	.	.	C	14.27	2.486049	0.44147	.	.	ENSG00000168646	ENST00000307078;ENST00000544103;ENST00000375702	T;T;T	0.01821	4.62;4.62;4.62	4.59	4.59	0.56863	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.000000	0.85682	D	0.000000	T	0.03564	0.0102	N	0.17082	0.46	0.80722	D	1	D;B;D	0.71674	0.998;0.029;0.998	P;B;P	0.55713	0.782;0.018;0.782	T	0.62148	-0.6915	10	0.66056	D	0.02	-5.2596	17.4003	0.87458	0.0:1.0:0.0:0.0	.	129;129;129	B7ZKL5;Q9Y2T1;E7ES00	.;AXIN2_HUMAN;.	Q	129	ENSP00000302625:R129Q;ENSP00000441151:R129Q;ENSP00000364854:R129Q	ENSP00000302625:R129Q	R	-	2	0	AXIN2	60984815	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.880000	0.63107	2.084000	0.62774	0.455000	0.32223	CGA	AXIN2	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal		0.463	AXIN2-004	NOVEL	basic|exp_conf	protein_coding	AXIN2	HGNC	protein_coding	OTTHUMT00000445901.1	C	NM_004655		63554353	-1	no_errors	ENST00000307078	ensembl	human	known	70_37	missense	SNP	1.000	T
CMC1	152100	genome.wustl.edu	37	3	28364161	28364161	+	3'UTR	SNP	T	T	A	rs577141541	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr3:28364161T>A	ENST00000466830.1	+	0	3561				AZI2_ENST00000479665.1_3'UTR|AZI2_ENST00000295748.3_5'UTR	NM_182523.1	NP_872329.1	Q7Z7K0	COXM1_HUMAN	C-x(9)-C motif containing 1							mitochondrion (GO:0005739)	metal ion binding (GO:0046872)			central_nervous_system(1)|kidney(1)|large_intestine(3)	5						TGTACTCCCCTGAGTCAGCTG	0.373																																																	0																																										SO:0001624	3_prime_UTR_variant	64343			BC052644	CCDS33722.1	3p24.1	2013-10-18	2013-10-18	2008-06-20	ENSG00000187118	ENSG00000187118			28783	protein-coding gene	gene with protein product		615166	"""chromosome 3 open reading frame 68"", ""COX assembly mitochondrial protein 1 homolog (S. cerevisiae)"""	C3orf68		18443040	Standard	NM_182523		Approved	MGC61571	uc003cea.3	Q7Z7K0	OTTHUMG00000155660	ENST00000466830.1:c.*3041T>A	3.37:g.28364161T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DJ7	RNA	SNP	-	NULL	ENST00000466830.1	37	NULL	CCDS33722.1	3																																																																																			AZI2	-	-		0.373	CMC1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AZI2	HGNC	protein_coding	OTTHUMT00000341087.1	T	NM_182523		28364161	-1	no_errors	ENST00000295748	ensembl	human	known	70_37	rna	SNP	0.992	A
BBOX1	8424	genome.wustl.edu	37	11	27136998	27136998	+	Splice_Site	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:27136998G>C	ENST00000529202.1	+	5	872		c.e5-1		BBOX1_ENST00000263182.3_Splice_Site|BBOX1_ENST00000527505.1_Splice_Site|RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000528583.1_Splice_Site|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Splice_Site			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1						carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	GCATTTTACAGACATACTTGG	0.393																																																	0													110.0	94.0	99.0					11																	27136998		2202	4298	6500	SO:0001630	splice_region_variant	8424			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.534-1G>C	11.37:g.27136998G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Splice_Site	SNP	-	e4-1	ENST00000529202.1	37	c.534-1	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230405	0.79688	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4422	0.87568	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BBOX1	27093574	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.064000	0.93933	2.457000	0.83068	0.655000	0.94253	.	BBOX1	-	-		0.393	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	G	NM_003986	Intron	27136998	+1	no_errors	ENST00000263182	ensembl	human	known	70_37	splice_site	SNP	1.000	C
BBOX1	8424	genome.wustl.edu	37	11	27136998	27136998	+	Splice_Site	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:27136998G>C	ENST00000529202.1	+	5	872		c.e5-1		BBOX1_ENST00000263182.3_Splice_Site|BBOX1_ENST00000527505.1_Splice_Site|RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000528583.1_Splice_Site|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Splice_Site			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1						carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	GCATTTTACAGACATACTTGG	0.393																																																	0													110.0	94.0	99.0					11																	27136998		2202	4298	6500	SO:0001630	splice_region_variant	8424			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.534-1G>C	11.37:g.27136998G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Splice_Site	SNP	-	e4-1	ENST00000529202.1	37	c.534-1	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230405	0.79688	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	.	.	.	5.27	5.27	0.74061	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4422	0.87568	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BBOX1	27093574	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	9.064000	0.93933	2.457000	0.83068	0.655000	0.94253	.	BBOX1	-	-		0.393	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	G	NM_003986	Intron	27136998	+1	no_errors	ENST00000263182	ensembl	human	known	70_37	splice_site	SNP	1.000	C
BBOX1	8424	genome.wustl.edu	37	11	27137027	27137027	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:27137027G>C	ENST00000529202.1	+	5	901	c.562G>C	c.(562-564)Gat>Cat	p.D188H	BBOX1_ENST00000263182.3_Missense_Mutation_p.D188H|BBOX1_ENST00000527505.1_3'UTR|RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000528583.1_Missense_Mutation_p.D188H|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.D188H			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	188					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	AGACAAAATCGATGCAAACAA	0.403																																																	0													139.0	120.0	127.0					11																	27137027		2202	4298	6500	SO:0001583	missense	8424			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.562G>C	11.37:g.27137027G>C	ENSP00000435781:p.Asp188His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.D188H	ENST00000529202.1	37	c.562	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336635	0.41398	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	5.27	3.41	0.39046	.	0.108343	0.64402	D	0.000001	T	0.79678	0.4487	L	0.59436	1.845	0.48135	D	0.999599	B	0.31435	0.323	B	0.34093	0.175	T	0.76716	-0.2857	10	0.66056	D	0.02	.	10.3078	0.43691	0.1614:0.0:0.8386:0.0	.	188	O75936	BODG_HUMAN	H	188	ENSP00000435781:D188H;ENSP00000263182:D188H;ENSP00000434918:D188H;ENSP00000433772:D188H	ENSP00000263182:D188H	D	+	1	0	BBOX1	27093603	1.000000	0.71417	0.679000	0.29978	0.982000	0.71751	4.066000	0.57520	0.614000	0.30107	0.655000	0.94253	GAT	BBOX1	-	pfam_Taurine_dOase,tigrfam_2-oxoglut_dOase		0.403	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	G	NM_003986		27137027	+1	no_errors	ENST00000263182	ensembl	human	known	70_37	missense	SNP	0.920	C
BBOX1	8424	genome.wustl.edu	37	11	27137027	27137027	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:27137027G>C	ENST00000529202.1	+	5	901	c.562G>C	c.(562-564)Gat>Cat	p.D188H	BBOX1_ENST00000263182.3_Missense_Mutation_p.D188H|BBOX1_ENST00000527505.1_3'UTR|RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000528583.1_Missense_Mutation_p.D188H|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.D188H			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	188					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	AGACAAAATCGATGCAAACAA	0.403																																																	0													139.0	120.0	127.0					11																	27137027		2202	4298	6500	SO:0001583	missense	8424			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.562G>C	11.37:g.27137027G>C	ENSP00000435781:p.Asp188His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.D188H	ENST00000529202.1	37	c.562	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	G	13.77	2.336635	0.41398	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.83837	-1.77;-1.77;-1.77;-1.77	5.27	3.41	0.39046	.	0.108343	0.64402	D	0.000001	T	0.79678	0.4487	L	0.59436	1.845	0.48135	D	0.999599	B	0.31435	0.323	B	0.34093	0.175	T	0.76716	-0.2857	10	0.66056	D	0.02	.	10.3078	0.43691	0.1614:0.0:0.8386:0.0	.	188	O75936	BODG_HUMAN	H	188	ENSP00000435781:D188H;ENSP00000263182:D188H;ENSP00000434918:D188H;ENSP00000433772:D188H	ENSP00000263182:D188H	D	+	1	0	BBOX1	27093603	1.000000	0.71417	0.679000	0.29978	0.982000	0.71751	4.066000	0.57520	0.614000	0.30107	0.655000	0.94253	GAT	BBOX1	-	pfam_Taurine_dOase,tigrfam_2-oxoglut_dOase		0.403	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	G	NM_003986		27137027	+1	no_errors	ENST00000263182	ensembl	human	known	70_37	missense	SNP	0.920	C
BBOX1	8424	genome.wustl.edu	37	11	27137075	27137075	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:27137075G>A	ENST00000529202.1	+	5	949	c.610G>A	c.(610-612)Gat>Aat	p.D204N	BBOX1_ENST00000263182.3_Missense_Mutation_p.D204N|BBOX1_ENST00000527505.1_3'UTR|RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000528583.1_Missense_Mutation_p.D204N|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.D204N			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	204					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	CTTTCACACTGATTATCCAGC	0.408																																																	0													133.0	118.0	123.0					11																	27137075		2202	4299	6501	SO:0001583	missense	8424			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.610G>A	11.37:g.27137075G>A	ENSP00000435781:p.Asp204Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.D204N	ENST00000529202.1	37	c.610	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634204	0.87660	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46	5.37	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.97726	0.9254	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98442	1.0587	10	0.87932	D	0	.	14.0747	0.64882	0.0:0.0:0.848:0.152	.	204	O75936	BODG_HUMAN	N	204	ENSP00000435781:D204N;ENSP00000263182:D204N;ENSP00000434918:D204N;ENSP00000433772:D204N	ENSP00000263182:D204N	D	+	1	0	BBOX1	27093651	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	9.064000	0.93933	1.230000	0.43646	0.655000	0.94253	GAT	BBOX1	-	pfam_Taurine_dOase,tigrfam_2-oxoglut_dOase		0.408	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	G	NM_003986		27137075	+1	no_errors	ENST00000263182	ensembl	human	known	70_37	missense	SNP	1.000	A
BBOX1	8424	genome.wustl.edu	37	11	27137075	27137075	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:27137075G>A	ENST00000529202.1	+	5	949	c.610G>A	c.(610-612)Gat>Aat	p.D204N	BBOX1_ENST00000263182.3_Missense_Mutation_p.D204N|BBOX1_ENST00000527505.1_3'UTR|RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000528583.1_Missense_Mutation_p.D204N|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.D204N			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	204					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	CTTTCACACTGATTATCCAGC	0.408																																																	0													133.0	118.0	123.0					11																	27137075		2202	4299	6501	SO:0001583	missense	8424			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.610G>A	11.37:g.27137075G>A	ENSP00000435781:p.Asp204Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.D204N	ENST00000529202.1	37	c.610	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	G	25.4	4.634204	0.87660	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46	5.37	4.44	0.53790	.	0.000000	0.85682	D	0.000000	D	0.97726	0.9254	M	0.92649	3.33	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98442	1.0587	10	0.87932	D	0	.	14.0747	0.64882	0.0:0.0:0.848:0.152	.	204	O75936	BODG_HUMAN	N	204	ENSP00000435781:D204N;ENSP00000263182:D204N;ENSP00000434918:D204N;ENSP00000433772:D204N	ENSP00000263182:D204N	D	+	1	0	BBOX1	27093651	1.000000	0.71417	0.997000	0.53966	0.989000	0.77384	9.064000	0.93933	1.230000	0.43646	0.655000	0.94253	GAT	BBOX1	-	pfam_Taurine_dOase,tigrfam_2-oxoglut_dOase		0.408	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	G	NM_003986		27137075	+1	no_errors	ENST00000263182	ensembl	human	known	70_37	missense	SNP	1.000	A
BBOX1	8424	genome.wustl.edu	37	11	27147341	27147341	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:27147341C>G	ENST00000529202.1	+	7	1316	c.977C>G	c.(976-978)tCc>tGc	p.S326C	BBOX1_ENST00000263182.3_Missense_Mutation_p.S326C|RP11-1L12.3_ENST00000526061.1_RNA|RP11-1L12.3_ENST00000530430.1_RNA|BBOX1_ENST00000528583.1_Missense_Mutation_p.S326C|RP11-1L12.3_ENST00000525302.1_RNA|BBOX1_ENST00000525090.1_Missense_Mutation_p.S326C			O75936	BODG_HUMAN	butyrobetaine (gamma), 2-oxoglutarate dioxygenase (gamma-butyrobetaine hydroxylase) 1	326					carnitine biosynthetic process (GO:0045329)|cellular nitrogen compound metabolic process (GO:0034641)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)	gamma-butyrobetaine dioxygenase activity (GO:0008336)|iron ion binding (GO:0005506)|zinc ion binding (GO:0008270)			breast(1)|kidney(3)|large_intestine(3)|lung(10)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	23					Succinic acid(DB00139)|Vitamin C(DB00126)	AGCAAAGAATCCAAGTTTACC	0.378																																																	0													102.0	89.0	94.0					11																	27147341		2202	4299	6501	SO:0001583	missense	8424			AF082868	CCDS7862.1	11p	2008-02-01			ENSG00000129151	ENSG00000129151	1.14.11.1		964	protein-coding gene	gene with protein product		603312		BBOX		9753662	Standard	XM_005253159		Approved	gamma-BBH, G-BBH, BBH	uc001mre.1	O75936	OTTHUMG00000166121	ENST00000529202.1:c.977C>G	11.37:g.27147341C>G	ENSP00000435781:p.Ser326Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8L7|D3DQZ1|Q6IBJ2	Missense_Mutation	SNP	pfam_Taurine_dOase,pfam_DUF971,tigrfam_2-oxoglut_dOase	p.S326C	ENST00000529202.1	37	c.977	CCDS7862.1	11	.	.	.	.	.	.	.	.	.	.	C	18.14	3.557682	0.65425	.	.	ENSG00000129151	ENST00000529202;ENST00000263182;ENST00000528583;ENST00000525090	D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59	6.03	-9.24	0.00669	.	0.945817	0.08903	N	0.876913	T	0.74527	0.3728	N	0.14661	0.345	0.22571	N	0.99898	D	0.64830	0.994	P	0.60682	0.878	T	0.68557	-0.5377	10	0.40728	T	0.16	.	7.8315	0.29344	0.6133:0.2308:0.0:0.1559	.	326	O75936	BODG_HUMAN	C	326	ENSP00000435781:S326C;ENSP00000263182:S326C;ENSP00000434918:S326C;ENSP00000433772:S326C	ENSP00000263182:S326C	S	+	2	0	BBOX1	27103917	0.038000	0.19896	0.861000	0.33841	0.979000	0.70002	0.072000	0.14617	-0.972000	0.03559	-0.345000	0.07892	TCC	BBOX1	-	pfam_Taurine_dOase,tigrfam_2-oxoglut_dOase		0.378	BBOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BBOX1	HGNC	protein_coding	OTTHUMT00000387946.1	C	NM_003986		27147341	+1	no_errors	ENST00000263182	ensembl	human	known	70_37	missense	SNP	0.575	G
BFAR	51283	genome.wustl.edu	37	16	14749014	14749014	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:14749014G>C	ENST00000261658.2	+	5	1007	c.730G>C	c.(730-732)Gaa>Caa	p.E244Q	BFAR_ENST00000563971.1_Missense_Mutation_p.E119Q|BFAR_ENST00000426842.2_Missense_Mutation_p.E116Q	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	244	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CATGGAGCTAGAACGTGTCAA	0.388																																																	0													74.0	82.0	79.0					16																	14749014		2197	4300	6497	SO:0001583	missense	51283			AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.730G>C	16.37:g.14749014G>C	ENSP00000261658:p.Glu244Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_Znf_C3HC4_RING-type,pfam_SAM_2,superfamily_SAM/pointed,smart_Znf_RING,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.E244Q	ENST00000261658.2	37	c.730	CCDS10554.1	16	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845940	0.51164	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.45276	0.9;0.9	5.31	5.31	0.75309	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.193526	0.47852	D	0.000202	T	0.57140	0.2033	L	0.52364	1.645	0.43756	D	0.996269	P;D;D	0.60160	0.761;0.987;0.984	B;P;P	0.61592	0.243;0.891;0.855	T	0.55903	-0.8067	10	0.48119	T	0.1	.	17.9483	0.89045	0.0:0.0:1.0:0.0	.	116;244;244	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	Q	244;116	ENSP00000261658:E244Q;ENSP00000400634:E116Q	ENSP00000261658:E244Q	E	+	1	0	BFAR	14656515	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	5.291000	0.65667	2.480000	0.83734	0.313000	0.20887	GAA	BFAR	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.388	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	HGNC	protein_coding	OTTHUMT00000252088.1	G	NM_016561		14749014	+1	no_errors	ENST00000261658	ensembl	human	known	70_37	missense	SNP	1.000	C
BFAR	51283	genome.wustl.edu	37	16	14749014	14749014	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:14749014G>C	ENST00000261658.2	+	5	1007	c.730G>C	c.(730-732)Gaa>Caa	p.E244Q	BFAR_ENST00000563971.1_Missense_Mutation_p.E119Q|BFAR_ENST00000426842.2_Missense_Mutation_p.E116Q	NM_016561.2	NP_057645.1	Q9NZS9	BFAR_HUMAN	bifunctional apoptosis regulator	244	SAM. {ECO:0000255|PROSITE- ProRule:PRU00184}.				apoptotic process (GO:0006915)|negative regulation of apoptotic process (GO:0043066)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	structural molecule activity (GO:0005198)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(1)|large_intestine(2)|lung(1)|ovary(2)|skin(1)	11						CATGGAGCTAGAACGTGTCAA	0.388																																																	0													74.0	82.0	79.0					16																	14749014		2197	4300	6497	SO:0001583	missense	51283			AF173003	CCDS10554.1	16p13.2	2013-01-10			ENSG00000103429	ENSG00000103429		"""RING-type (C3HC4) zinc fingers"", ""Sterile alpha motif (SAM) domain containing"""	17613	protein-coding gene	gene with protein product						10716992	Standard	NM_016561		Approved	BAR, RNF47	uc002dco.3	Q9NZS9	OTTHUMG00000129848	ENST00000261658.2:c.730G>C	16.37:g.14749014G>C	ENSP00000261658:p.Glu244Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4Z9|B4DUT0|D3DUG8	Missense_Mutation	SNP	pfam_SAM_type1,pfam_Znf_C3HC4_RING-type,pfam_SAM_2,superfamily_SAM/pointed,smart_Znf_RING,smart_SAM,pfscan_SAM,pfscan_Znf_RING	p.E244Q	ENST00000261658.2	37	c.730	CCDS10554.1	16	.	.	.	.	.	.	.	.	.	.	G	15.48	2.845940	0.51164	.	.	ENSG00000103429	ENST00000261658;ENST00000426842	T;T	0.45276	0.9;0.9	5.31	5.31	0.75309	Sterile alpha motif domain (2);Sterile alpha motif/pointed domain (2);Sterile alpha motif, type 1 (1);	0.193526	0.47852	D	0.000202	T	0.57140	0.2033	L	0.52364	1.645	0.43756	D	0.996269	P;D;D	0.60160	0.761;0.987;0.984	B;P;P	0.61592	0.243;0.891;0.855	T	0.55903	-0.8067	10	0.48119	T	0.1	.	17.9483	0.89045	0.0:0.0:1.0:0.0	.	116;244;244	B4DUT0;B2R9R6;Q9NZS9	.;.;BFAR_HUMAN	Q	244;116	ENSP00000261658:E244Q;ENSP00000400634:E116Q	ENSP00000261658:E244Q	E	+	1	0	BFAR	14656515	1.000000	0.71417	1.000000	0.80357	0.243000	0.25628	5.291000	0.65667	2.480000	0.83734	0.313000	0.20887	GAA	BFAR	-	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.388	BFAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFAR	HGNC	protein_coding	OTTHUMT00000252088.1	G	NM_016561		14749014	+1	no_errors	ENST00000261658	ensembl	human	known	70_37	missense	SNP	1.000	C
BPTF	2186	genome.wustl.edu	37	17	65914901	65914901	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:65914901G>A	ENST00000321892.4	+	14	5814	c.5753G>A	c.(5752-5754)aGa>aAa	p.R1918K	BPTF_ENST00000335221.5_Missense_Mutation_p.R1918K|BPTF_ENST00000306378.6_Missense_Mutation_p.R1792K|BPTF_ENST00000424123.3_Missense_Mutation_p.R1779K			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1918					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCAAGTTTGAGATGGGATGAT	0.438																																																	0													154.0	150.0	151.0					17																	65914901		2203	4300	6503	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.5753G>A	17.37:g.65914901G>A	ENSP00000315454:p.Arg1918Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.R1918K	ENST00000321892.4	37	c.5753		17	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592909	0.46214	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.74632	-0.86;-0.86;-0.86	5.53	5.53	0.82687	.	.	.	.	.	T	0.71813	0.3384	L	0.48174	1.505	0.46317	D	0.998984	P;B	0.37636	0.603;0.183	B;B	0.43478	0.421;0.12	T	0.73490	-0.3966	9	0.59425	D	0.04	-9.5782	10.6186	0.45465	0.1169:0.0:0.8831:0.0	.	1792;1918	Q12830-2;Q12830-4	.;.	K	1792;1918;1918	ENSP00000307208:R1792K;ENSP00000334351:R1918K;ENSP00000315454:R1918K	ENSP00000307208:R1792K	R	+	2	0	BPTF	63345363	1.000000	0.71417	0.821000	0.32701	0.064000	0.16182	6.718000	0.74713	2.610000	0.88304	0.650000	0.86243	AGA	BPTF	-	NULL		0.438	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		G	NM_182641, NM_004459		65914901	+1	no_errors	ENST00000321892	ensembl	human	known	70_37	missense	SNP	1.000	A
BPTF	2186	genome.wustl.edu	37	17	65914901	65914901	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:65914901G>A	ENST00000321892.4	+	14	5814	c.5753G>A	c.(5752-5754)aGa>aAa	p.R1918K	BPTF_ENST00000335221.5_Missense_Mutation_p.R1918K|BPTF_ENST00000306378.6_Missense_Mutation_p.R1792K|BPTF_ENST00000424123.3_Missense_Mutation_p.R1779K			Q12830	BPTF_HUMAN	bromodomain PHD finger transcription factor	1918					anterior/posterior pattern specification (GO:0009952)|ATP catabolic process (GO:0006200)|brain development (GO:0007420)|chromatin remodeling (GO:0006338)|embryonic placenta development (GO:0001892)|endoderm development (GO:0007492)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NURF complex (GO:0016589)	sequence-specific DNA binding (GO:0043565)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(16)|lung(23)|ovary(3)|pancreas(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	78	all_cancers(12;6e-11)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0984)|LUSC - Lung squamous cell carcinoma(166;0.24)			GCAAGTTTGAGATGGGATGAT	0.438																																																	0													154.0	150.0	151.0					17																	65914901		2203	4300	6503	SO:0001583	missense	2186			AY282495	CCDS11673.1	17q24	2013-01-28	2006-12-01	2006-12-01	ENSG00000171634	ENSG00000171634		"""Zinc fingers, PHD-type"""	3581	protein-coding gene	gene with protein product		601819	"""fetal Alzheimer antigen"""	FALZ		8975731, 10662542, 16728976	Standard	NM_182641		Approved	FAC1, NURF301	uc002jgf.3	Q12830	OTTHUMG00000132254	ENST00000321892.4:c.5753G>A	17.37:g.65914901G>A	ENSP00000315454:p.Arg1918Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NX67|Q7Z7D6|Q9UIG2	Missense_Mutation	SNP	pfam_Bromodomain,pfam_DDT_dom,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_Znf_PHD-finger,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.R1918K	ENST00000321892.4	37	c.5753		17	.	.	.	.	.	.	.	.	.	.	G	14.63	2.592909	0.46214	.	.	ENSG00000171634	ENST00000306378;ENST00000335221;ENST00000321892	T;T;T	0.74632	-0.86;-0.86;-0.86	5.53	5.53	0.82687	.	.	.	.	.	T	0.71813	0.3384	L	0.48174	1.505	0.46317	D	0.998984	P;B	0.37636	0.603;0.183	B;B	0.43478	0.421;0.12	T	0.73490	-0.3966	9	0.59425	D	0.04	-9.5782	10.6186	0.45465	0.1169:0.0:0.8831:0.0	.	1792;1918	Q12830-2;Q12830-4	.;.	K	1792;1918;1918	ENSP00000307208:R1792K;ENSP00000334351:R1918K;ENSP00000315454:R1918K	ENSP00000307208:R1792K	R	+	2	0	BPTF	63345363	1.000000	0.71417	0.821000	0.32701	0.064000	0.16182	6.718000	0.74713	2.610000	0.88304	0.650000	0.86243	AGA	BPTF	-	NULL		0.438	BPTF-201	KNOWN	basic	protein_coding	BPTF	HGNC	protein_coding		G	NM_182641, NM_004459		65914901	+1	no_errors	ENST00000321892	ensembl	human	known	70_37	missense	SNP	1.000	A
LRRC74A	145497	genome.wustl.edu	37	14	77319573	77319573	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:77319573G>A	ENST00000393774.3	+	9	952	c.828G>A	c.(826-828)ctG>ctA	p.L276L	C14orf166B_ENST00000450042.2_3'UTR	NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		ATGTGACCCTGACAAAGCTGG	0.552																																					Ovarian(165;1056 1958 32571 36789 48728)												0													153.0	139.0	144.0					14																	77319573		2203	4300	6503	SO:0001819	synonymous_variant	145497																														ENST00000393774.3:c.828G>A	14.37:g.77319573G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L276	ENST00000393774.3	37	c.828	CCDS9853.2	14																																																																																			C14orf166B	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.552	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166B	HGNC	protein_coding	OTTHUMT00000316592.1	G			77319573	+1	no_errors	ENST00000393774	ensembl	human	known	70_37	silent	SNP	1.000	A
LRRC74A	145497	genome.wustl.edu	37	14	77319573	77319573	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:77319573G>A	ENST00000393774.3	+	9	952	c.828G>A	c.(826-828)ctG>ctA	p.L276L	C14orf166B_ENST00000450042.2_3'UTR	NM_194287.2	NP_919263.2														breast(1)|kidney(2)|large_intestine(3)|lung(9)|prostate(2)|skin(1)	18			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0306)		ATGTGACCCTGACAAAGCTGG	0.552																																					Ovarian(165;1056 1958 32571 36789 48728)												0													153.0	139.0	144.0					14																	77319573		2203	4300	6503	SO:0001819	synonymous_variant	145497																														ENST00000393774.3:c.828G>A	14.37:g.77319573G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L276	ENST00000393774.3	37	c.828	CCDS9853.2	14																																																																																			C14orf166B	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.552	C14orf166B-004	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf166B	HGNC	protein_coding	OTTHUMT00000316592.1	G			77319573	+1	no_errors	ENST00000393774	ensembl	human	known	70_37	silent	SNP	1.000	A
C18orf54	162681	genome.wustl.edu	37	18	51892104	51892104	+	Silent	SNP	C	C	T	rs374556847		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr18:51892104C>T	ENST00000300091.5	+	5	1088	c.756C>T	c.(754-756)ccC>ccT	p.P252P	C18orf54_ENST00000382911.4_Silent_p.P413P|C18orf54_ENST00000578138.1_Silent_p.P31P|C18orf54_ENST00000582188.1_3'UTR	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	252						extracellular region (GO:0005576)		p.P252P(2)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		CTCCTGTTCCCGTTAACTCTG	0.333																																																	2	Substitution - coding silent(2)	lung(2)						C		1,4405	2.1+/-5.4	0,1,2202	145.0	149.0	148.0		756	0.9	1.0	18		148	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C18orf54	NM_173529.4		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		252/373	51892104	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	162681			AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.756C>T	18.37:g.51892104C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	I7HFJ6|Q6MZU3|Q6ZTL6	Silent	SNP	NULL	p.P252	ENST00000300091.5	37	c.756	CCDS11956.1	18																																																																																			C18orf54	-	NULL		0.333	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf54	HGNC	protein_coding	OTTHUMT00000256001.1	C	NM_173529		51892104	+1	no_errors	ENST00000300091	ensembl	human	known	70_37	silent	SNP	0.996	T
C18orf54	162681	genome.wustl.edu	37	18	51892104	51892104	+	Silent	SNP	C	C	T	rs374556847		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr18:51892104C>T	ENST00000300091.5	+	5	1088	c.756C>T	c.(754-756)ccC>ccT	p.P252P	C18orf54_ENST00000382911.4_Silent_p.P413P|C18orf54_ENST00000578138.1_Silent_p.P31P|C18orf54_ENST00000582188.1_3'UTR	NM_173529.4	NP_775800.3	Q8IYD9	LAS2_HUMAN	chromosome 18 open reading frame 54	252						extracellular region (GO:0005576)		p.P252P(2)		breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(3)|lung(5)|ovary(1)|skin(1)	15				Colorectal(16;0.0206)|READ - Rectum adenocarcinoma(59;0.186)		CTCCTGTTCCCGTTAACTCTG	0.333																																																	2	Substitution - coding silent(2)	lung(2)						C		1,4405	2.1+/-5.4	0,1,2202	145.0	149.0	148.0		756	0.9	1.0	18		148	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	C18orf54	NM_173529.4		0,2,6501	TT,TC,CC		0.0116,0.0227,0.0154		252/373	51892104	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	162681			AK126503	CCDS11956.1, CCDS74223.1	18q21	2012-10-24			ENSG00000166845	ENSG00000166845			13796	protein-coding gene	gene with protein product	"""lung adenoma susceptibility protein 2"""	613258					Standard	XM_005258201		Approved	MGC33382, LAS2	uc031rij.1	Q8IYD9	OTTHUMG00000132703	ENST00000300091.5:c.756C>T	18.37:g.51892104C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	I7HFJ6|Q6MZU3|Q6ZTL6	Silent	SNP	NULL	p.P252	ENST00000300091.5	37	c.756	CCDS11956.1	18																																																																																			C18orf54	-	NULL		0.333	C18orf54-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C18orf54	HGNC	protein_coding	OTTHUMT00000256001.1	C	NM_173529		51892104	+1	no_errors	ENST00000300091	ensembl	human	known	70_37	silent	SNP	0.996	T
C1orf94	84970	genome.wustl.edu	37	1	34662959	34662959	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:34662959G>A	ENST00000488417.1	+	2	574	c.454G>A	c.(454-456)Gag>Aag	p.E152K	C1orf94_ENST00000373374.3_5'UTR	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	152										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				CAGCTCTCCCGAGGGGACCAG	0.587																																																	0													29.0	32.0	31.0					1																	34662959		692	1591	2283	SO:0001583	missense	84970			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.454G>A	1.37:g.34662959G>A	ENSP00000435634:p.Glu152Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	NULL	p.E152K	ENST00000488417.1	37	c.454	CCDS44108.1	1	.	.	.	.	.	.	.	.	.	.	G	7.278	0.608441	0.14002	.	.	ENSG00000142698	ENST00000488417	T	0.22539	1.95	5.17	-1.84	0.07809	.	.	.	.	.	T	0.11281	0.0275	N	0.22421	0.69	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.27739	-1.0065	9	0.34782	T	0.22	-17.2939	5.1154	0.14831	0.4416:0.1976:0.3608:0.0	.	152	Q6P1W5	CA094_HUMAN	K	152	ENSP00000435634:E152K	ENSP00000435634:E152K	E	+	1	0	C1orf94	34435546	0.012000	0.17670	0.001000	0.08648	0.004000	0.04260	0.472000	0.22116	-0.758000	0.04690	-0.136000	0.14681	GAG	C1orf94	-	NULL		0.587	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf94	HGNC	protein_coding	OTTHUMT00000036845.2	G	NM_032884		34662959	+1	no_errors	ENST00000488417	ensembl	human	known	70_37	missense	SNP	0.000	A
C1orf94	84970	genome.wustl.edu	37	1	34662959	34662959	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:34662959G>A	ENST00000488417.1	+	2	574	c.454G>A	c.(454-456)Gag>Aag	p.E152K	C1orf94_ENST00000373374.3_5'UTR	NM_001134734.1	NP_001128206.1	Q6P1W5	CA094_HUMAN	chromosome 1 open reading frame 94	152										central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(15)|skin(4)|upper_aerodigestive_tract(2)	32		Myeloproliferative disorder(586;0.0393)				CAGCTCTCCCGAGGGGACCAG	0.587																																																	0													29.0	32.0	31.0					1																	34662959		692	1591	2283	SO:0001583	missense	84970			AK123355	CCDS381.1, CCDS44108.1	1p34.3	2012-06-26			ENSG00000142698	ENSG00000142698			28250	protein-coding gene	gene with protein product						12477932	Standard	NM_001134734		Approved	MGC15882	uc001bxt.3	Q6P1W5	OTTHUMG00000004012	ENST00000488417.1:c.454G>A	1.37:g.34662959G>A	ENSP00000435634:p.Glu152Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVT1|D3DPR3|E9PJ76|Q96IC8	Missense_Mutation	SNP	NULL	p.E152K	ENST00000488417.1	37	c.454	CCDS44108.1	1	.	.	.	.	.	.	.	.	.	.	G	7.278	0.608441	0.14002	.	.	ENSG00000142698	ENST00000488417	T	0.22539	1.95	5.17	-1.84	0.07809	.	.	.	.	.	T	0.11281	0.0275	N	0.22421	0.69	0.09310	N	1	B	0.17465	0.022	B	0.08055	0.003	T	0.27739	-1.0065	9	0.34782	T	0.22	-17.2939	5.1154	0.14831	0.4416:0.1976:0.3608:0.0	.	152	Q6P1W5	CA094_HUMAN	K	152	ENSP00000435634:E152K	ENSP00000435634:E152K	E	+	1	0	C1orf94	34435546	0.012000	0.17670	0.001000	0.08648	0.004000	0.04260	0.472000	0.22116	-0.758000	0.04690	-0.136000	0.14681	GAG	C1orf94	-	NULL		0.587	C1orf94-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf94	HGNC	protein_coding	OTTHUMT00000036845.2	G	NM_032884		34662959	+1	no_errors	ENST00000488417	ensembl	human	known	70_37	missense	SNP	0.000	A
CECR2	27443	genome.wustl.edu	37	22	18022027	18022027	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr22:18022027G>T	ENST00000400585.2	+	16	2144	c.1706G>T	c.(1705-1707)gGa>gTa	p.G569V	CECR2_ENST00000400573.5_Missense_Mutation_p.G710V|CECR2_ENST00000262608.8_Missense_Mutation_p.G711V			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	752					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		TTCCAGCCAGGATTCATTCCT	0.552																																																	0													22.0	24.0	23.0					22																	18022027		1922	4126	6048	SO:0001583	missense	27443			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1706G>T	22.37:g.18022027G>T	ENSP00000383428:p.Gly569Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.G710V	ENST00000400585.2	37	c.2129		22	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400346	0.62177	.	.	ENSG00000099954	ENST00000400585;ENST00000400573;ENST00000262608	T;T;T	0.39229	1.21;1.22;1.09	5.43	4.39	0.52855	.	0.123056	0.36482	N	0.002565	T	0.52964	0.1767	M	0.67953	2.075	0.80722	D	1	D;D;D	0.64830	0.994;0.989;0.989	P;P;P	0.54856	0.762;0.762;0.762	T	0.57481	-0.7804	10	0.66056	D	0.02	-16.8234	11.0059	0.47633	0.0:0.2604:0.605:0.1346	.	752;569;710	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	V	569;710;711	ENSP00000383428:G569V;ENSP00000383417:G710V;ENSP00000262608:G711V	ENSP00000262608:G711V	G	+	2	0	CECR2	16402027	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	2.879000	0.48522	1.487000	0.48415	0.655000	0.94253	GGA	CECR2	-	NULL		0.552	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	G	NM_031413		18022027	+1	no_errors	ENST00000400573	ensembl	human	novel	70_37	missense	SNP	1.000	T
CECR2	27443	genome.wustl.edu	37	22	18022027	18022027	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr22:18022027G>T	ENST00000400585.2	+	16	2144	c.1706G>T	c.(1705-1707)gGa>gTa	p.G569V	CECR2_ENST00000400573.5_Missense_Mutation_p.G710V|CECR2_ENST00000262608.8_Missense_Mutation_p.G711V			Q9BXF3	CECR2_HUMAN	cat eye syndrome chromosome region, candidate 2	752					apoptotic DNA fragmentation (GO:0006309)|ATP-dependent chromatin remodeling (GO:0043044)|cytokinesis (GO:0000910)|cytoskeleton organization (GO:0007010)|execution phase of apoptosis (GO:0097194)|neural tube development (GO:0021915)|vesicle-mediated transport (GO:0016192)	CERF complex (GO:0090537)|nucleus (GO:0005634)				NS(1)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(22)|ovary(1)|pancreas(1)|prostate(2)|skin(5)|stomach(1)|urinary_tract(1)	59		all_epithelial(15;0.139)		Lung(27;0.146)		TTCCAGCCAGGATTCATTCCT	0.552																																																	0													22.0	24.0	23.0					22																	18022027		1922	4126	6048	SO:0001583	missense	27443			AF336133		22q11.2	2012-04-19			ENSG00000099954	ENSG00000099954			1840	protein-coding gene	gene with protein product		607576				11381032	Standard	XM_006724077		Approved	KIAA1740	uc002zml.2	Q9BXF3	OTTHUMG00000150072	ENST00000400585.2:c.1706G>T	22.37:g.18022027G>T	ENSP00000383428:p.Gly569Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MS90|A8MX16|Q658Z4|Q96P58|Q9C0C3	Missense_Mutation	SNP	pfam_Bromodomain,superfamily_Bromodomain,smart_Bromodomain,pfscan_Bromodomain,prints_Bromodomain	p.G710V	ENST00000400585.2	37	c.2129		22	.	.	.	.	.	.	.	.	.	.	G	17.48	3.400346	0.62177	.	.	ENSG00000099954	ENST00000400585;ENST00000400573;ENST00000262608	T;T;T	0.39229	1.21;1.22;1.09	5.43	4.39	0.52855	.	0.123056	0.36482	N	0.002565	T	0.52964	0.1767	M	0.67953	2.075	0.80722	D	1	D;D;D	0.64830	0.994;0.989;0.989	P;P;P	0.54856	0.762;0.762;0.762	T	0.57481	-0.7804	10	0.66056	D	0.02	-16.8234	11.0059	0.47633	0.0:0.2604:0.605:0.1346	.	752;569;710	Q9BXF3;B7WPH3;E2QRE6	CECR2_HUMAN;.;.	V	569;710;711	ENSP00000383428:G569V;ENSP00000383417:G710V;ENSP00000262608:G711V	ENSP00000262608:G711V	G	+	2	0	CECR2	16402027	1.000000	0.71417	0.999000	0.59377	0.967000	0.64934	2.879000	0.48522	1.487000	0.48415	0.655000	0.94253	GGA	CECR2	-	NULL		0.552	CECR2-002	NOVEL	basic|appris_candidate|exp_conf	protein_coding	CECR2	HGNC	protein_coding	OTTHUMT00000316226.2	G	NM_031413		18022027	+1	no_errors	ENST00000400573	ensembl	human	novel	70_37	missense	SNP	1.000	T
CEP95	90799	genome.wustl.edu	37	17	62529078	62529078	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:62529078G>A	ENST00000556440.2	+	15	2304	c.1794G>A	c.(1792-1794)aaG>aaA	p.K598K	CEP95_ENST00000553412.1_Silent_p.K434K|AC009994.2_ENST00000579926.1_RNA	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	598						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AACAGCTTAAGAAAGAAGCAT	0.393																																																	0													83.0	74.0	76.0					17																	62529078		1848	4097	5945	SO:0001819	synonymous_variant	90799			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1794G>A	17.37:g.62529078G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMD2|Q96M81	Silent	SNP	superfamily_CH-domain	p.K598	ENST00000556440.2	37	c.1794	CCDS45763.1	17																																																																																			CEP95	-	NULL		0.393	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	G	NM_138363		62529078	+1	no_errors	ENST00000556440	ensembl	human	known	70_37	silent	SNP	0.004	A
CEP95	90799	genome.wustl.edu	37	17	62529078	62529078	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:62529078G>A	ENST00000556440.2	+	15	2304	c.1794G>A	c.(1792-1794)aaG>aaA	p.K598K	CEP95_ENST00000553412.1_Silent_p.K434K|AC009994.2_ENST00000579926.1_RNA	NM_138363.1	NP_612372.1	Q96GE4	CEP95_HUMAN	centrosomal protein 95kDa	598						centrosome (GO:0005813)|cytoplasm (GO:0005737)|spindle pole (GO:0000922)				endometrium(1)|kidney(3)|large_intestine(5)|lung(3)|ovary(1)	13						AACAGCTTAAGAAAGAAGCAT	0.393																																																	0													83.0	74.0	76.0					17																	62529078		1848	4097	5945	SO:0001819	synonymous_variant	90799			AL832822	CCDS45763.1	17q24.1	2014-02-20	2011-05-06	2011-05-06	ENSG00000258890	ENSG00000258890			25141	protein-coding gene	gene with protein product			"""coiled-coil domain containing 45"""	CCDC45		21399614	Standard	NM_138363		Approved	DKFZp667E1824	uc002jem.3	Q96GE4	OTTHUMG00000179174	ENST00000556440.2:c.1794G>A	17.37:g.62529078G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMD2|Q96M81	Silent	SNP	superfamily_CH-domain	p.K598	ENST00000556440.2	37	c.1794	CCDS45763.1	17																																																																																			CEP95	-	NULL		0.393	CEP95-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP95	HGNC	protein_coding	OTTHUMT00000445100.2	G	NM_138363		62529078	+1	no_errors	ENST00000556440	ensembl	human	known	70_37	silent	SNP	0.004	A
CHD8	57680	genome.wustl.edu	37	14	21884050	21884050	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:21884050C>T	ENST00000557364.1	-	6	1996	c.1733G>A	c.(1732-1734)cGc>cAc	p.R578H	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.R299H|CHD8_ENST00000399982.2_Missense_Mutation_p.R578H			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	578					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.R578H(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CTTAACTTGGCGGTTTGAGCG	0.378																																																	1	Substitution - Missense(1)	kidney(1)											189.0	178.0	182.0					14																	21884050		1836	4082	5918	SO:0001583	missense	57680			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1733G>A	14.37:g.21884050C>T	ENSP00000451601:p.Arg578His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R578H	ENST00000557364.1	37	c.1733	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928726	0.92389	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	T;T;T	0.67698	-0.28;-0.28;-0.28	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.80844	0.4701	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82623	-0.0366	10	0.87932	D	0	-8.1484	17.3917	0.87434	0.0:1.0:0.0:0.0	.	299	Q9HCK8-2	.	H	299;578;298;578	ENSP00000406288:R299H;ENSP00000382863:R578H;ENSP00000451601:R578H	ENSP00000262707:R298H	R	-	2	0	CHD8	20953890	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.260000	0.78391	2.636000	0.89361	0.655000	0.94253	CGC	CHD8	-	NULL		0.378	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	C	NM_020920		21884050	-1	no_errors	ENST00000399982	ensembl	human	known	70_37	missense	SNP	1.000	T
CHD8	57680	genome.wustl.edu	37	14	21884050	21884050	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:21884050C>T	ENST00000557364.1	-	6	1996	c.1733G>A	c.(1732-1734)cGc>cAc	p.R578H	CHD8_ENST00000555962.1_Intron|CHD8_ENST00000430710.3_Missense_Mutation_p.R299H|CHD8_ENST00000399982.2_Missense_Mutation_p.R578H			Q9HCK8	CHD8_HUMAN	chromodomain helicase DNA binding protein 8	578					ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|canonical Wnt signaling pathway (GO:0060070)|DNA duplex unwinding (GO:0032508)|in utero embryonic development (GO:0001701)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of Wnt signaling pathway (GO:0030178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	MLL1 complex (GO:0071339)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|beta-catenin binding (GO:0008013)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA-dependent ATPase activity (GO:0008094)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|p53 binding (GO:0002039)	p.R578H(1)		NS(2)|breast(1)|central_nervous_system(1)|cervix(4)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(8)|lung(33)|ovary(6)|prostate(7)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	85	all_cancers(95;0.00121)		Epithelial(56;2.55e-06)|all cancers(55;1.73e-05)	GBM - Glioblastoma multiforme(265;0.00424)		CTTAACTTGGCGGTTTGAGCG	0.378																																																	1	Substitution - Missense(1)	kidney(1)											189.0	178.0	182.0					14																	21884050		1836	4082	5918	SO:0001583	missense	57680			AB046784	CCDS45081.1, CCDS53885.1	14q11.2	2008-02-05	2004-06-22	2004-06-23		ENSG00000100888			20153	protein-coding gene	gene with protein product		610528	"""helicase with SNF2 domain 1"""	HELSNF1		10997877	Standard	NM_020920		Approved	KIAA1564, DUPLIN	uc001war.2	Q9HCK8		ENST00000557364.1:c.1733G>A	14.37:g.21884050C>T	ENSP00000451601:p.Arg578His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0D8|Q68DQ0|Q6DKH9|Q6P440|Q6ZNL7|Q8N3Z9|Q8NCY4|Q8TBR9|Q96F26	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Chromo_domain,pfam_BRK_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.R578H	ENST00000557364.1	37	c.1733	CCDS53885.1	14	.	.	.	.	.	.	.	.	.	.	C	28.5	4.928726	0.92389	.	.	ENSG00000100888	ENST00000430710;ENST00000399982;ENST00000262707;ENST00000557364	T;T;T	0.67698	-0.28;-0.28;-0.28	5.07	5.07	0.68467	.	0.000000	0.85682	D	0.000000	T	0.80844	0.4701	M	0.68952	2.095	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.82623	-0.0366	10	0.87932	D	0	-8.1484	17.3917	0.87434	0.0:1.0:0.0:0.0	.	299	Q9HCK8-2	.	H	299;578;298;578	ENSP00000406288:R299H;ENSP00000382863:R578H;ENSP00000451601:R578H	ENSP00000262707:R298H	R	-	2	0	CHD8	20953890	1.000000	0.71417	0.999000	0.59377	0.999000	0.98932	7.260000	0.78391	2.636000	0.89361	0.655000	0.94253	CGC	CHD8	-	NULL		0.378	CHD8-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD8	HGNC	protein_coding	OTTHUMT00000410436.1	C	NM_020920		21884050	-1	no_errors	ENST00000399982	ensembl	human	known	70_37	missense	SNP	1.000	T
CMSS1	84319	genome.wustl.edu	37	3	99897391	99897391	+	3'UTR	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr3:99897391G>A	ENST00000421999.2	+	0	1145				CMSS1_ENST00000489081.1_3'UTR|RP11-15N24.4_ENST00000569034.1_RNA	NM_032359.3	NP_115735.2	Q9BQ75	CMS1_HUMAN	cms1 ribosomal small subunit homolog (yeast)								poly(A) RNA binding (GO:0044822)										AAACAGAAATGAAACTGTCCT	0.388																																																	0																																										SO:0001624	3_prime_UTR_variant	84319				CCDS2935.1, CCDS54618.1	3q12.1	2012-09-20	2012-09-20	2012-09-20	ENSG00000184220	ENSG00000184220			28666	protein-coding gene	gene with protein product			"""chromosome 3 open reading frame 26"""	C3orf26		12477932	Standard	NM_032359		Approved	MGC4308	uc003dtl.3	Q9BQ75	OTTHUMG00000159054	ENST00000421999.2:c.*159G>A	3.37:g.99897391G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5S7|B4DUM1|E9PHS3	RNA	SNP	-	NULL	ENST00000421999.2	37	NULL	CCDS2935.1	3																																																																																			CMSS1	-	-		0.388	CMSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CMSS1	HGNC	protein_coding	OTTHUMT00000353060.1	G	NM_032359		99897391	+1	no_errors	ENST00000494412	ensembl	human	known	70_37	rna	SNP	0.002	A
CNNM2	54805	genome.wustl.edu	37	10	104679252	104679252	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:104679252G>A	ENST00000369878.4	+	1	1203	c.1015G>A	c.(1015-1017)Ggc>Agc	p.G339S	CNNM2_ENST00000433628.2_Missense_Mutation_p.G339S|CNNM2_ENST00000369875.3_Missense_Mutation_p.G339S	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	339	DUF21.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CGACATCGCCGGCTCGGGCCT	0.657																																																	0													66.0	59.0	62.0					10																	104679252		2203	4299	6502	SO:0001583	missense	54805			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1015G>A	10.37:g.104679252G>A	ENSP00000358894:p.Gly339Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.G339S	ENST00000369878.4	37	c.1015	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927473	0.73327	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	D;D;D	0.87809	-2.3;-2.3;-2.3	4.32	4.32	0.51571	Domain of unknown function DUF21 (1);	0.000000	0.85682	D	0.000000	D	0.91382	0.7281	L	0.49699	1.58	0.80722	D	1	P;P;D	0.89917	0.709;0.9;1.0	B;P;D	0.76575	0.159;0.678;0.988	D	0.92575	0.6069	10	0.72032	D	0.01	.	16.7981	0.85607	0.0:0.0:1.0:0.0	.	339;339;339	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	S	339	ENSP00000392875:G339S;ENSP00000358891:G339S;ENSP00000358894:G339S	ENSP00000286899:G339S	G	+	1	0	CNNM2	104669242	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	1.935000	0.56089	0.561000	0.74099	GGC	CNNM2	-	pfam_DUF21		0.657	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	G	NM_017649		104679252	+1	no_errors	ENST00000457502	ensembl	human	known	70_37	missense	SNP	1.000	A
CNNM2	54805	genome.wustl.edu	37	10	104679252	104679252	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:104679252G>A	ENST00000369878.4	+	1	1203	c.1015G>A	c.(1015-1017)Ggc>Agc	p.G339S	CNNM2_ENST00000433628.2_Missense_Mutation_p.G339S|CNNM2_ENST00000369875.3_Missense_Mutation_p.G339S	NM_017649.4	NP_060119.3	Q9H8M5	CNNM2_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 2	339	DUF21.				magnesium ion homeostasis (GO:0010960)|magnesium ion transport (GO:0015693)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	adenyl nucleotide binding (GO:0030554)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(7)|ovary(1)|prostate(2)|urinary_tract(1)	19		Colorectal(252;0.103)|all_hematologic(284;0.152)|Breast(234;0.198)		Epithelial(162;7.89e-09)|all cancers(201;1.82e-07)|BRCA - Breast invasive adenocarcinoma(275;0.215)		CGACATCGCCGGCTCGGGCCT	0.657																																																	0													66.0	59.0	62.0					10																	104679252		2203	4299	6502	SO:0001583	missense	54805			AF216962	CCDS7543.1, CCDS44474.1, CCDS44475.1	10q24.32	2014-08-08	2014-08-07		ENSG00000148842	ENSG00000148842			103	protein-coding gene	gene with protein product		607803	"""cyclin M2"""	ACDP2		21393841, 24699222	Standard	NM_017649		Approved		uc001kwm.3	Q9H8M5	OTTHUMG00000018976	ENST00000369878.4:c.1015G>A	10.37:g.104679252G>A	ENSP00000358894:p.Gly339Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T569|Q5T570|Q8WU59|Q9H952|Q9NRK5|Q9NXT4	Missense_Mutation	SNP	pfam_DUF21,superfamily_cNMP-bd-like	p.G339S	ENST00000369878.4	37	c.1015	CCDS44474.1	10	.	.	.	.	.	.	.	.	.	.	G	19.98	3.927473	0.73327	.	.	ENSG00000148842	ENST00000457502;ENST00000433628;ENST00000369875;ENST00000369878;ENST00000345419;ENST00000541201	D;D;D	0.87809	-2.3;-2.3;-2.3	4.32	4.32	0.51571	Domain of unknown function DUF21 (1);	0.000000	0.85682	D	0.000000	D	0.91382	0.7281	L	0.49699	1.58	0.80722	D	1	P;P;D	0.89917	0.709;0.9;1.0	B;P;D	0.76575	0.159;0.678;0.988	D	0.92575	0.6069	10	0.72032	D	0.01	.	16.7981	0.85607	0.0:0.0:1.0:0.0	.	339;339;339	Q9H8M5-2;Q9H8M5;F5H1I3	.;CNNM2_HUMAN;.	S	339	ENSP00000392875:G339S;ENSP00000358891:G339S;ENSP00000358894:G339S	ENSP00000286899:G339S	G	+	1	0	CNNM2	104669242	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.807000	0.99171	1.935000	0.56089	0.561000	0.74099	GGC	CNNM2	-	pfam_DUF21		0.657	CNNM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNNM2	HGNC	protein_coding	OTTHUMT00000050113.3	G	NM_017649		104679252	+1	no_errors	ENST00000457502	ensembl	human	known	70_37	missense	SNP	1.000	A
COG3	83548	genome.wustl.edu	37	13	46070407	46070407	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:46070407C>T	ENST00000349995.5	+	13	1560	c.1448C>T	c.(1447-1449)cCt>cTt	p.P483L	COG3_ENST00000465942.1_3'UTR	NM_031431.3	NP_113619	Q96JB2	COG3_HUMAN	component of oligomeric golgi complex 3	483					ER to Golgi vesicle-mediated transport (GO:0006888)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|protein glycosylation (GO:0006486)|protein localization to organelle (GO:0033365)|protein stabilization (GO:0050821)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	cis-Golgi network (GO:0005801)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein transporter activity (GO:0008565)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|stomach(1)	24		Lung NSC(96;0.000145)|Breast(56;0.000596)|Prostate(109;0.00438)|Hepatocellular(98;0.0207)|Lung SC(185;0.0262)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000124)		AAACCAGCTCCTGGAGATCTG	0.478																																					Ovarian(150;1048 1859 18083 21577 42700)												0													62.0	57.0	59.0					13																	46070407		2203	4300	6503	SO:0001583	missense	83548			AF131829	CCDS9398.1	13q14.11	2008-02-05			ENSG00000136152	ENSG00000136152		"""Components of oligomeric golgi complex"""	18619	protein-coding gene	gene with protein product		606975				11980916	Standard	NM_031431		Approved	SEC34	uc001vak.3	Q96JB2	OTTHUMG00000016855	ENST00000349995.5:c.1448C>T	13.37:g.46070407C>T	ENSP00000258654:p.Pro483Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAW5|Q5VT70|Q8IXX4|Q9BZ92	Missense_Mutation	SNP	pfam_COG_su3,superfamily_Cullin_repeat-like_dom	p.P483L	ENST00000349995.5	37	c.1448	CCDS9398.1	13	.	.	.	.	.	.	.	.	.	.	C	23.0	4.362517	0.82353	.	.	ENSG00000136152	ENST00000349995	T	0.50548	0.74	5.98	5.98	0.97165	.	0.000000	0.85682	D	0.000000	T	0.71609	0.3360	M	0.77486	2.375	0.80722	D	1	B;D	0.89917	0.194;1.0	B;D	0.83275	0.157;0.996	T	0.71347	-0.4620	10	0.54805	T	0.06	-13.2366	19.4443	0.94840	0.0:1.0:0.0:0.0	.	320;483	B4E2F3;Q96JB2	.;COG3_HUMAN	L	483	ENSP00000258654:P483L	ENSP00000258654:P483L	P	+	2	0	COG3	44968408	1.000000	0.71417	1.000000	0.80357	0.729000	0.41735	6.096000	0.71446	2.847000	0.97988	0.591000	0.81541	CCT	COG3	-	NULL		0.478	COG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG3	HGNC	protein_coding	OTTHUMT00000044777.2	C			46070407	+1	no_errors	ENST00000349995	ensembl	human	known	70_37	missense	SNP	1.000	T
COL22A1	169044	genome.wustl.edu	37	8	139749795	139749795	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:139749795G>T	ENST00000303045.6	-	23	2557	c.2111C>A	c.(2110-2112)cCt>cAt	p.P704H	COL22A1_ENST00000435777.1_Missense_Mutation_p.P704H	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	704	Collagen-like 4.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGGGATTCCAGGTGGTCCCAT	0.453										HNSCC(7;0.00092)																																							0													95.0	93.0	94.0					8																	139749795		2203	4300	6503	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2111C>A	8.37:g.139749795G>T	ENSP00000303153:p.Pro704His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P704H	ENST00000303045.6	37	c.2111	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579890	0.46006	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.97772	-4.53;-4.53	3.16	3.16	0.36331	.	0.156761	0.29551	U	0.011837	D	0.98112	0.9377	M	0.94142	3.5	0.09310	N	0.999999	P;P	0.44344	0.8;0.833	B;P	0.47891	0.424;0.56	D	0.94718	0.7898	10	0.72032	D	0.01	.	10.0758	0.42360	0.0:0.0:1.0:0.0	.	704;704	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	H	704;704;417	ENSP00000303153:P704H;ENSP00000387655:P704H	ENSP00000303153:P704H	P	-	2	0	COL22A1	139818977	0.967000	0.33354	0.060000	0.19600	0.889000	0.51656	3.661000	0.54503	2.074000	0.62210	0.561000	0.74099	CCT	COL22A1	-	NULL		0.453	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	G	XM_291257		139749795	-1	no_errors	ENST00000303045	ensembl	human	known	70_37	missense	SNP	0.065	T
COL22A1	169044	genome.wustl.edu	37	8	139749795	139749795	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:139749795G>T	ENST00000303045.6	-	23	2557	c.2111C>A	c.(2110-2112)cCt>cAt	p.P704H	COL22A1_ENST00000435777.1_Missense_Mutation_p.P704H	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	704	Collagen-like 4.|Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGGGATTCCAGGTGGTCCCAT	0.453										HNSCC(7;0.00092)																																							0													95.0	93.0	94.0					8																	139749795		2203	4300	6503	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.2111C>A	8.37:g.139749795G>T	ENSP00000303153:p.Pro704His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.P704H	ENST00000303045.6	37	c.2111	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	G	14.59	2.579890	0.46006	.	.	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.97772	-4.53;-4.53	3.16	3.16	0.36331	.	0.156761	0.29551	U	0.011837	D	0.98112	0.9377	M	0.94142	3.5	0.09310	N	0.999999	P;P	0.44344	0.8;0.833	B;P	0.47891	0.424;0.56	D	0.94718	0.7898	10	0.72032	D	0.01	.	10.0758	0.42360	0.0:0.0:1.0:0.0	.	704;704	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	H	704;704;417	ENSP00000303153:P704H;ENSP00000387655:P704H	ENSP00000303153:P704H	P	-	2	0	COL22A1	139818977	0.967000	0.33354	0.060000	0.19600	0.889000	0.51656	3.661000	0.54503	2.074000	0.62210	0.561000	0.74099	CCT	COL22A1	-	NULL		0.453	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	G	XM_291257		139749795	-1	no_errors	ENST00000303045	ensembl	human	known	70_37	missense	SNP	0.065	T
CREM	1390	genome.wustl.edu	37	10	35460216	35460216	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:35460216C>T	ENST00000395895.2	+	4	330				CREM_ENST00000439705.1_Intron|CREM_ENST00000374734.3_Intron|CREM_ENST00000345491.3_Intron|CREM_ENST00000374728.3_Intron|CREM_ENST00000489388.1_Intron|CREM_ENST00000484283.1_Intron|CREM_ENST00000429130.3_Intron|CREM_ENST00000348787.2_Intron|CREM_ENST00000361599.4_Intron|CREM_ENST00000374726.3_Intron|CREM_ENST00000395887.3_Intron|CREM_ENST00000354759.3_Intron|CREM_ENST00000374721.3_Intron|CREM_ENST00000489321.1_Intron|CREM_ENST00000333809.8_Intron|CREM_ENST00000460270.1_Intron|CREM_ENST00000479070.1_Intron|CREM_ENST00000474362.1_Intron|CREM_ENST00000337656.4_Intron			Q03060	CREM_HUMAN	cAMP responsive element modulator						cell differentiation (GO:0030154)|glycosphingolipid metabolic process (GO:0006687)|multicellular organismal development (GO:0007275)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	cAMP response element binding protein binding (GO:0008140)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(1)	14						tctcatgcctcagcctcatga	0.507																																																	0																																										SO:0001627	intron_variant	1390				CCDS7180.1, CCDS7181.1, CCDS7182.1, CCDS7183.1, CCDS7184.1, CCDS7185.1, CCDS7186.1, CCDS7187.1, CCDS7188.1, CCDS31181.1, CCDS53519.1, CCDS53520.1, CCDS53517.1, CCDS53518.1, CCDS53521.1, CCDS58074.1, CCDS58075.1, CCDS58076.1	10p12.1-p11.1	2013-01-10			ENSG00000095794	ENSG00000095794		"""basic leucine zipper proteins"""	2352	protein-coding gene	gene with protein product		123812				1461747, 7916662	Standard	NM_182717		Approved	hCREM-2	uc001iyb.3	Q03060	OTTHUMG00000017953	ENST00000395895.2:c.169-4565C>T	10.37:g.35460216C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K014|A8K3J7|A8K6A1|A8MPQ2|B4DXC1|C9J785|C9JZ10|E9PAR4|E9PHM1|O75519|Q14501|Q14503|Q14504|Q14505|Q14506|Q15731|Q16114|Q16116|Q5T9H7|Q5W1A6|Q5W1A7|Q5W1A8|Q5W1A9|Q5W1B0|Q5W1B2|Q7Z2Q6|Q8IVD4|Q96AG7|Q9NZ98|Q9NZ99|Q9NZB9	RNA	SNP	-	NULL	ENST00000395895.2	37	NULL		10																																																																																			CREM	-	-		0.507	CREM-203	KNOWN	basic|appris_principal	protein_coding	CREM	HGNC	protein_coding		C	NM_001881		35460216	+1	no_errors	ENST00000497686	ensembl	human	known	70_37	rna	SNP	0.005	T
CTIF	9811	genome.wustl.edu	37	18	46343613	46343613	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr18:46343613G>A	ENST00000256413.3	+	10	1688	c.1393G>A	c.(1393-1395)Gag>Aag	p.E465K	CTIF_ENST00000382998.4_Missense_Mutation_p.E467K	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	465	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GGTGCGCGAGGAGCTGCAGCA	0.667																																																	0													75.0	54.0	61.0					18																	46343613		2203	4300	6503	SO:0001583	missense	9811			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.1393G>A	18.37:g.46343613G>A	ENSP00000256413:p.Glu465Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTR8|Q8IVD5	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.E467K	ENST00000256413.3	37	c.1399	CCDS11935.1	18	.	.	.	.	.	.	.	.	.	.	g	16.90	3.249963	0.59212	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.21031	2.03;2.03	5.1	5.1	0.69264	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.328565	0.30920	N	0.008618	T	0.22551	0.0544	L	0.45137	1.4	0.37175	D	0.903219	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.003	T	0.06625	-1.0816	10	0.44086	T	0.13	-12.9078	18.6154	0.91300	0.0:0.0:1.0:0.0	.	467;465	O43310-2;O43310	.;CTIF_HUMAN	K	465;467;417	ENSP00000256413:E465K;ENSP00000372459:E467K	ENSP00000256413:E465K	E	+	1	0	CTIF	44597611	1.000000	0.71417	1.000000	0.80357	0.563000	0.35712	7.522000	0.81844	2.400000	0.81607	0.574000	0.79327	GAG	CTIF	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3		0.667	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTIF	HGNC	protein_coding	OTTHUMT00000255907.1	G	NM_014772		46343613	+1	no_errors	ENST00000382998	ensembl	human	known	70_37	missense	SNP	1.000	A
CTIF	9811	genome.wustl.edu	37	18	46343613	46343613	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr18:46343613G>A	ENST00000256413.3	+	10	1688	c.1393G>A	c.(1393-1395)Gag>Aag	p.E465K	CTIF_ENST00000382998.4_Missense_Mutation_p.E467K	NM_014772.2	NP_055587.1	O43310	CTIF_HUMAN	CBP80/20-dependent translation initiation factor	465	MIF4G.				nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of translational initiation (GO:0006446)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(14)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	31						GGTGCGCGAGGAGCTGCAGCA	0.667																																																	0													75.0	54.0	61.0					18																	46343613		2203	4300	6503	SO:0001583	missense	9811			AB007887	CCDS11935.1, CCDS45864.1	18q21.1	2011-01-20	2011-01-20	2011-01-20	ENSG00000134030	ENSG00000134030			23925	protein-coding gene	gene with protein product		613178	"""KIAA0427"""	KIAA0427		9455477, 19648179	Standard	NM_014772		Approved		uc002ldd.3	O43310	OTTHUMG00000132656	ENST00000256413.3:c.1393G>A	18.37:g.46343613G>A	ENSP00000256413:p.Glu465Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTR8|Q8IVD5	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.E467K	ENST00000256413.3	37	c.1399	CCDS11935.1	18	.	.	.	.	.	.	.	.	.	.	g	16.90	3.249963	0.59212	.	.	ENSG00000134030	ENST00000256413;ENST00000382998;ENST00000420275	T;T	0.21031	2.03;2.03	5.1	5.1	0.69264	MIF4G-like, type 3 (2);Armadillo-type fold (1);MIF4-like, type 1/2/3 (1);	0.328565	0.30920	N	0.008618	T	0.22551	0.0544	L	0.45137	1.4	0.37175	D	0.903219	B;B	0.06786	0.0;0.001	B;B	0.09377	0.004;0.003	T	0.06625	-1.0816	10	0.44086	T	0.13	-12.9078	18.6154	0.91300	0.0:0.0:1.0:0.0	.	467;465	O43310-2;O43310	.;CTIF_HUMAN	K	465;467;417	ENSP00000256413:E465K;ENSP00000372459:E467K	ENSP00000256413:E465K	E	+	1	0	CTIF	44597611	1.000000	0.71417	1.000000	0.80357	0.563000	0.35712	7.522000	0.81844	2.400000	0.81607	0.574000	0.79327	GAG	CTIF	-	pfam_MIF4G-like_typ-3,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3		0.667	CTIF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CTIF	HGNC	protein_coding	OTTHUMT00000255907.1	G	NM_014772		46343613	+1	no_errors	ENST00000382998	ensembl	human	known	70_37	missense	SNP	1.000	A
DEDD2	162989	genome.wustl.edu	37	19	42720852	42720852	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:42720852G>A	ENST00000595337.1	-	2	395	c.308C>T	c.(307-309)gCg>gTg	p.A103V	DEDD2_ENST00000596251.1_Missense_Mutation_p.A103V|DEDD2_ENST00000593804.1_Intron|DEDD2_ENST00000336034.4_Missense_Mutation_p.A103V|DEDD2_ENST00000598727.1_Missense_Mutation_p.A103V	NM_001270614.1	NP_001257543.1	Q8WXF8	DEDD2_HUMAN	death effector domain containing 2	103	DED. {ECO:0000255|PROSITE- ProRule:PRU00065}.				apoptotic nuclear changes (GO:0030262)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|RNA processing (GO:0006396)|rRNA catabolic process (GO:0016075)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)	DNA binding (GO:0003677)|receptor signaling complex scaffold activity (GO:0030159)			endometrium(1)|large_intestine(1)|ovary(1)|prostate(2)	5		Prostate(69;0.0704)				CCGCTTGCGCGCCAGGTGCGG	0.711																																																	0													5.0	6.0	6.0					19																	42720852		1748	3623	5371	SO:0001583	missense	162989			AY125488	CCDS12597.1, CCDS59391.1	19q13.31	2008-02-05				ENSG00000160570			24450	protein-coding gene	gene with protein product						11965497, 12235123	Standard	NM_133328		Approved	FLAME-3	uc031rkv.1	Q8WXF8		ENST00000595337.1:c.308C>T	19.37:g.42720852G>A	ENSP00000470082:p.Ala103Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NBR2|Q8NES1|Q8TAA8|Q96D35	Missense_Mutation	SNP	pfam_DED,superfamily_DEATH-like,smart_DED,pfscan_DED	p.A103V	ENST00000595337.1	37	c.308	CCDS12597.1	19	.	.	.	.	.	.	.	.	.	.	G	24.6	4.552608	0.86127	.	.	ENSG00000160570	ENST00000336034	.	.	.	4.26	4.26	0.50523	DEATH-like (2);Death effector (3);	0.063724	0.64402	D	0.000004	T	0.30070	0.0753	N	0.14661	0.345	0.37716	D	0.924753	P;P	0.48589	0.893;0.912	B;B	0.36719	0.148;0.231	T	0.47923	-0.9079	9	0.72032	D	0.01	-25.232	15.9755	0.80060	0.0:0.0:1.0:0.0	.	103;103	Q8WXF8-2;Q8WXF8	.;DEDD2_HUMAN	V	103	.	ENSP00000336972:A103V	A	-	2	0	DEDD2	47412692	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	5.046000	0.64226	2.376000	0.81061	0.655000	0.94253	GCG	DEDD2	-	pfam_DED,superfamily_DEATH-like,smart_DED,pfscan_DED		0.711	DEDD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DEDD2	HGNC	protein_coding	OTTHUMT00000463508.1	G	NM_133328		42720852	-1	no_errors	ENST00000595337	ensembl	human	known	70_37	missense	SNP	0.980	A
DNAH9	1770	genome.wustl.edu	37	17	11511460	11511460	+	Silent	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:11511460C>T	ENST00000262442.4	+	2	500	c.432C>T	c.(430-432)gtC>gtT	p.V144V	DNAH9_ENST00000579828.1_Silent_p.V144V|DNAH9_ENST00000454412.2_Silent_p.V144V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	144	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTCTACCCGTCCTGGCCAATG	0.483																																																	0													140.0	138.0	139.0					17																	11511460		2203	4300	6503	SO:0001819	synonymous_variant	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.432C>T	17.37:g.11511460C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.V144	ENST00000262442.4	37	c.432	CCDS11160.1	17																																																																																			DNAH9	-	NULL		0.483	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	C	NM_001372		11511460	+1	no_errors	ENST00000262442	ensembl	human	known	70_37	silent	SNP	0.940	T
DNAH9	1770	genome.wustl.edu	37	17	11511460	11511460	+	Silent	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:11511460C>T	ENST00000262442.4	+	2	500	c.432C>T	c.(430-432)gtC>gtT	p.V144V	DNAH9_ENST00000579828.1_Silent_p.V144V|DNAH9_ENST00000454412.2_Silent_p.V144V	NM_001372.3	NP_001363.2	Q9NYC9	DYH9_HUMAN	dynein, axonemal, heavy chain 9	144	Stem. {ECO:0000250}.				cell projection organization (GO:0030030)|cellular component movement (GO:0006928)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|spermatogenesis (GO:0007283)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|motor activity (GO:0003774)			NS(2)|autonomic_ganglia(1)|breast(15)|central_nervous_system(5)|endometrium(17)|haematopoietic_and_lymphoid_tissue(6)|kidney(17)|large_intestine(49)|liver(2)|lung(123)|ovary(6)|pancreas(1)|prostate(6)|skin(21)|stomach(2)|upper_aerodigestive_tract(13)|urinary_tract(4)	290		Breast(5;0.0122)|all_epithelial(5;0.131)		Colorectal(4;6.88e-05)|COAD - Colon adenocarcinoma(4;0.000813)|READ - Rectum adenocarcinoma(10;0.157)		TTCTACCCGTCCTGGCCAATG	0.483																																																	0													140.0	138.0	139.0					17																	11511460		2203	4300	6503	SO:0001819	synonymous_variant	1770			U61740	CCDS11160.1, CCDS11161.1	17p12	2009-05-07	2006-09-04		ENSG00000007174	ENSG00000007174		"""Axonemal dyneins"""	2953	protein-coding gene	gene with protein product		603330	"""dynein, axonemal, heavy polypeptide 17-like"", ""dynein, axonemal, heavy polypeptide 9"""	DNAH17L		8812413, 11247663	Standard	NM_001372		Approved	Dnahc9, KIAA0357, HL20, HL-20, DNAL1, DYH9	uc002gne.3	Q9NYC9	OTTHUMG00000130383	ENST00000262442.4:c.432C>T	17.37:g.11511460C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCQ8|O15064|O95494|Q9NQ28	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.V144	ENST00000262442.4	37	c.432	CCDS11160.1	17																																																																																			DNAH9	-	NULL		0.483	DNAH9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH9	HGNC	protein_coding	OTTHUMT00000252756.2	C	NM_001372		11511460	+1	no_errors	ENST00000262442	ensembl	human	known	70_37	silent	SNP	0.940	T
DNMBP	23268	genome.wustl.edu	37	10	101715391	101715391	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:101715391G>A	ENST00000324109.4	-	4	1931	c.1840C>T	c.(1840-1842)Cgt>Tgt	p.R614C	DNMBP_ENST00000342239.3_Missense_Mutation_p.R614C|DNMBP-AS1_ENST00000434409.1_RNA	NM_015221.2	NP_056036.1	Q6XZF7	DNMBP_HUMAN	dynamin binding protein	614	Pro-rich.				intracellular signal transduction (GO:0035556)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|synapse (GO:0045202)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(1)|cervix(4)|endometrium(9)|large_intestine(14)|lung(19)|ovary(5)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	61		Colorectal(252;0.234)		Epithelial(162;2.94e-10)|all cancers(201;3.15e-08)		GTACAGGGACGAGGTGGCGGT	0.562																																																	0													59.0	54.0	56.0					10																	101715391		2203	4300	6503	SO:0001583	missense	23268			AL833283	CCDS7485.1	10q24.31	2012-07-24			ENSG00000107554	ENSG00000107554		"""Rho guanine nucleotide exchange factors"""	30373	protein-coding gene	gene with protein product	"""scaffold protein TUBA"""	611282				10231032, 14506234	Standard	NM_015221		Approved	KIAA1010, Tuba, ARHGEF36	uc001kqj.2	Q6XZF7	OTTHUMG00000018897	ENST00000324109.4:c.1840C>T	10.37:g.101715391G>A	ENSP00000315659:p.Arg614Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IVY3|Q9Y2L3	Missense_Mutation	SNP	pfam_BAR_dom,pfam_SH3_domain,pfam_SH3_2,pfam_DH-domain,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_BAR_dom,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain,prints_p67phox,prints_Spectrin_alpha_SH3	p.R614C	ENST00000324109.4	37	c.1840	CCDS7485.1	10	.	.	.	.	.	.	.	.	.	.	G	19.41	3.821977	0.71028	.	.	ENSG00000107554	ENST00000342239;ENST00000324109	T;T	0.20881	2.11;2.04	6.04	3.92	0.45320	.	0.000000	0.48767	D	0.000178	T	0.46386	0.1390	M	0.75264	2.295	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.52193	-0.8608	10	0.72032	D	0.01	-12.826	14.5409	0.67995	0.0:0.0:0.6749:0.3251	.	614	Q6XZF7	DNMBP_HUMAN	C	614	ENSP00000344914:R614C;ENSP00000315659:R614C	ENSP00000315659:R614C	R	-	1	0	DNMBP	101705381	1.000000	0.71417	0.990000	0.47175	0.514000	0.34195	3.916000	0.56416	1.347000	0.45714	0.561000	0.74099	CGT	DNMBP	-	NULL		0.562	DNMBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNMBP	HGNC	protein_coding	OTTHUMT00000049832.2	G	NM_015221		101715391	-1	no_errors	ENST00000342239	ensembl	human	known	70_37	missense	SNP	1.000	A
DSCAML1	57453	genome.wustl.edu	37	11	117351190	117351190	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:117351190G>A	ENST00000321322.6	-	14	2934	c.2933C>T	c.(2932-2934)aCg>aTg	p.T978M	DSCAML1_ENST00000527706.1_Missense_Mutation_p.T708M	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	918	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GTCGAAGCCCGTGATGATGCT	0.627																																																	0													75.0	78.0	77.0					11																	117351190		2201	4296	6497	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2933C>T	11.37:g.117351190G>A	ENSP00000315465:p.Thr978Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T978M	ENST00000321322.6	37	c.2933	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624792	0.87560	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.60171	0.21;0.21	4.27	4.27	0.50696	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80644	0.4662	M	0.92459	3.31	0.58432	D	0.999999	D	0.89917	1.0	D	0.68353	0.957	D	0.85897	0.1432	9	0.59425	D	0.04	.	16.5365	0.84373	0.0:0.0:1.0:0.0	.	918	Q8TD84	DSCL1_HUMAN	M	708;978;685	ENSP00000434335:T708M;ENSP00000315465:T978M	ENSP00000315465:T978M	T	-	2	0	DSCAML1	116856400	1.000000	0.71417	0.985000	0.45067	0.863000	0.49368	9.517000	0.98020	2.231000	0.72958	0.485000	0.47835	ACG	DSCAML1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	G	NM_020693		117351190	-1	no_errors	ENST00000321322	ensembl	human	known	70_37	missense	SNP	1.000	A
DSCAML1	57453	genome.wustl.edu	37	11	117351190	117351190	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:117351190G>A	ENST00000321322.6	-	14	2934	c.2933C>T	c.(2932-2934)aCg>aTg	p.T978M	DSCAML1_ENST00000527706.1_Missense_Mutation_p.T708M	NM_020693.2	NP_065744.2	Q8TD84	DSCL1_HUMAN	Down syndrome cell adhesion molecule like 1	918	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axonogenesis (GO:0007409)|brain development (GO:0007420)|cell fate determination (GO:0001709)|central nervous system development (GO:0007417)|dendrite self-avoidance (GO:0070593)|dorsal/ventral pattern formation (GO:0009953)|embryonic skeletal system morphogenesis (GO:0048704)|homophilic cell adhesion (GO:0007156)|negative regulation of cell adhesion (GO:0007162)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|large_intestine(24)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	110	all_hematologic(175;0.0487)	Breast(348;0.0424)|Medulloblastoma(222;0.0523)|all_hematologic(192;0.232)		BRCA - Breast invasive adenocarcinoma(274;9.12e-06)|Epithelial(105;0.00172)		GTCGAAGCCCGTGATGATGCT	0.627																																																	0													75.0	78.0	77.0					11																	117351190		2201	4296	6497	SO:0001583	missense	57453				CCDS8384.1	11q22.2-q22.3	2013-02-11			ENSG00000177103	ENSG00000177103		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	14656	protein-coding gene	gene with protein product		611782				11453658	Standard	NM_020693		Approved	KIAA1132	uc001prh.1	Q8TD84	OTTHUMG00000167071	ENST00000321322.6:c.2933C>T	11.37:g.117351190G>A	ENSP00000315465:p.Thr978Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q76MU9|Q8IZY3|Q8IZY4|Q8WXU7|Q9ULT7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T978M	ENST00000321322.6	37	c.2933	CCDS8384.1	11	.	.	.	.	.	.	.	.	.	.	G	25.3	4.624792	0.87560	.	.	ENSG00000177103	ENST00000527706;ENST00000321322;ENST00000446508	T;T	0.60171	0.21;0.21	4.27	4.27	0.50696	Fibronectin, type III (4);Immunoglobulin-like fold (1);	.	.	.	.	T	0.80644	0.4662	M	0.92459	3.31	0.58432	D	0.999999	D	0.89917	1.0	D	0.68353	0.957	D	0.85897	0.1432	9	0.59425	D	0.04	.	16.5365	0.84373	0.0:0.0:1.0:0.0	.	918	Q8TD84	DSCL1_HUMAN	M	708;978;685	ENSP00000434335:T708M;ENSP00000315465:T978M	ENSP00000315465:T978M	T	-	2	0	DSCAML1	116856400	1.000000	0.71417	0.985000	0.45067	0.863000	0.49368	9.517000	0.98020	2.231000	0.72958	0.485000	0.47835	ACG	DSCAML1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.627	DSCAML1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSCAML1	HGNC	protein_coding	OTTHUMT00000392907.2	G	NM_020693		117351190	-1	no_errors	ENST00000321322	ensembl	human	known	70_37	missense	SNP	1.000	A
DUSP9	1852	genome.wustl.edu	37	X	152913687	152913687	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:152913687G>T	ENST00000342782.3	+	2	545	c.280G>T	c.(280-282)Gag>Tag	p.E94*	DUSP9_ENST00000370167.4_Nonsense_Mutation_p.E94*			Q99956	DUS9_HUMAN	dual specificity phosphatase 9	94	Rhodanese. {ECO:0000255|PROSITE- ProRule:PRU00173}.				inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(2)|prostate(1)	16	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					cggggAGGCCGAGGCCGAGGC	0.761																																																	0													4.0	2.0	3.0					X																	152913687		1219	2160	3379	SO:0001587	stop_gained	1852			Y08302	CCDS14724.1	Xq28	2011-06-09			ENSG00000130829	ENSG00000130829		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3076	protein-coding gene	gene with protein product	"""map kinase phosphatase 4"""	300134				9030581, 9286695	Standard	NM_001395		Approved	MKP-4, MKP4	uc004fhx.4	Q99956	OTTHUMG00000024211	ENST00000342782.3:c.280G>T	X.37:g.152913687G>T	ENSP00000345853:p.Glu94*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWU5	Nonsense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP	p.E94*	ENST00000342782.3	37	c.280	CCDS14724.1	X	.	.	.	.	.	.	.	.	.	.	g	13.74	2.325997	0.41197	.	.	ENSG00000130829	ENST00000370167;ENST00000342782	.	.	.	4.12	3.24	0.37175	.	1.391760	0.04986	N	0.466535	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	5.1738	0.15124	0.3686:0.0:0.6314:0.0	.	.	.	.	X	94	.	ENSP00000345853:E94X	E	+	1	0	DUSP9	152566881	1.000000	0.71417	0.001000	0.08648	0.001000	0.01503	5.010000	0.64004	0.750000	0.32877	0.525000	0.51046	GAG	DUSP9	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pirsf_MKP,pfscan_Rhodanese-like_dom		0.761	DUSP9-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DUSP9	HGNC	protein_coding	OTTHUMT00000061022.3	G	NM_001395		152913687	+1	no_errors	ENST00000342782	ensembl	human	known	70_37	nonsense	SNP	0.001	T
DYRK1A	1859	genome.wustl.edu	37	21	38739647	38739647	+	3'UTR	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr21:38739647C>T	ENST00000462274.1	+	0	412				DYRK1A_ENST00000338785.3_5'Flank|AP001437.1_ENST00000608783.1_RNA			Q13627	DYR1A_HUMAN	dual-specificity tyrosine-(Y)-phosphorylation regulated kinase 1A						circadian rhythm (GO:0007623)|mitotic cell cycle (GO:0000278)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|nervous system development (GO:0007399)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of protein deacetylation (GO:0090312)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|tau protein binding (GO:0048156)			breast(4)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(5)|lung(10)|ovary(3)|pancreas(1)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	42						acgccgccctctgcgccgggc	0.761																																					Melanoma(114;464 1602 31203 43785 45765)												0																																										SO:0001624	3_prime_UTR_variant	1859			U52373	CCDS13653.1, CCDS13654.1, CCDS42925.1, CCDS42926.1	21q22.13	2010-04-21			ENSG00000157540	ENSG00000157540			3091	protein-coding gene	gene with protein product		600855		DYRK1, DYRK, MNBH		9284911	Standard	NM_130436		Approved		uc002ywk.3	Q13627	OTTHUMG00000086657	ENST00000462274.1:c.*409C>T	21.37:g.38739647C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60769|Q92582|Q92810|Q9UNM5	RNA	SNP	-	NULL	ENST00000462274.1	37	NULL		21																																																																																			DYRK1A	-	-		0.761	DYRK1A-002	KNOWN	basic	processed_transcript	DYRK1A	HGNC	protein_coding	OTTHUMT00000194800.1	C	NM_001396		38739647	+1	no_errors	ENST00000462274	ensembl	human	known	70_37	rna	SNP	0.598	T
EIF3E	3646	genome.wustl.edu	37	8	109260902	109260902	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:109260902G>C	ENST00000519030.1	-	0	25				EIF3E_ENST00000220849.5_Missense_Mutation_p.I10M					eukaryotic translation initiation factor 3, subunit E									p.I10I(2)	EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			AAAAGTGCGCGATGCGAGTAG	0.512																																					GBM(15;360 410 8460 34179 52246)												2	Substitution - coding silent(2)	NS(1)|breast(1)											94.0	85.0	88.0					8																	109260902		2203	4300	6503			3646			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000519030.1:c.-135C>G	8.37:g.109260902G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_eIF3_su6_N,pfam_PCI_dom,smart_PCI_dom,pirsf_Transl_init_fac_3_su6_euk	p.I10M	ENST00000519030.1	37	c.30		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.44|17.44	3.390334|3.390334	0.62066|0.62066	.|.	.|.	ENSG00000104408|ENSG00000104408	ENST00000220849;ENST00000519627|ENST00000521440	T;T|.	0.50277|.	0.75;0.81|.	5.28|5.28	3.5|3.5	0.40072|0.40072	Eukaryotic translation initiation factor 3 (eIF3), subunit 6, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.38558|0.38558	0.1045|0.1045	N|N	0.13043|0.13043	0.29|0.29	0.80722|0.80722	D|D	1|1	B;B;B|.	0.32893|.	0.217;0.285;0.389|.	B;B;B|.	0.36030|.	0.12;0.06;0.216|.	T|T	0.10337|0.10337	-1.0634|-1.0634	10|5	0.18276|.	T|.	0.48|.	-12.5321|-12.5321	11.1886|11.1886	0.48671|0.48671	0.1486:0.0:0.8514:0.0|0.1486:0.0:0.8514:0.0	.|.	10;10;10|.	Q6IAX5;B2R806;P60228|.	.;.;EIF3E_HUMAN|.	M|W	10|9	ENSP00000220849:I10M;ENSP00000430839:I10M|.	ENSP00000220849:I10M|.	I|S	-|-	3|2	3|0	EIF3E|EIF3E	109330078|109330078	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.784000|1.784000	0.38674|0.38674	0.809000|0.809000	0.34255|0.34255	0.655000|0.655000	0.94253|0.94253	ATC|TCG	EIF3E	-	pfam_eIF3_su6_N,pirsf_Transl_init_fac_3_su6_euk		0.512	EIF3E-002	PUTATIVE	basic	protein_coding	EIF3E	HGNC	protein_coding	OTTHUMT00000380613.1	G	NM_001568		109260902	-1	no_errors	ENST00000220849	ensembl	human	known	70_37	missense	SNP	1.000	C
EIF3E	3646	genome.wustl.edu	37	8	109260902	109260902	+	De_novo_Start_OutOfFrame	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:109260902G>C	ENST00000519030.1	-	0	25				EIF3E_ENST00000220849.5_Missense_Mutation_p.I10M					eukaryotic translation initiation factor 3, subunit E									p.I10I(2)	EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			AAAAGTGCGCGATGCGAGTAG	0.512																																					GBM(15;360 410 8460 34179 52246)												2	Substitution - coding silent(2)	NS(1)|breast(1)											94.0	85.0	88.0					8																	109260902		2203	4300	6503			3646			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000519030.1:c.-135C>G	8.37:g.109260902G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_eIF3_su6_N,pfam_PCI_dom,smart_PCI_dom,pirsf_Transl_init_fac_3_su6_euk	p.I10M	ENST00000519030.1	37	c.30		8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.44|17.44	3.390334|3.390334	0.62066|0.62066	.|.	.|.	ENSG00000104408|ENSG00000104408	ENST00000220849;ENST00000519627|ENST00000521440	T;T|.	0.50277|.	0.75;0.81|.	5.28|5.28	3.5|3.5	0.40072|0.40072	Eukaryotic translation initiation factor 3 (eIF3), subunit 6, N-terminal (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.38558|0.38558	0.1045|0.1045	N|N	0.13043|0.13043	0.29|0.29	0.80722|0.80722	D|D	1|1	B;B;B|.	0.32893|.	0.217;0.285;0.389|.	B;B;B|.	0.36030|.	0.12;0.06;0.216|.	T|T	0.10337|0.10337	-1.0634|-1.0634	10|5	0.18276|.	T|.	0.48|.	-12.5321|-12.5321	11.1886|11.1886	0.48671|0.48671	0.1486:0.0:0.8514:0.0|0.1486:0.0:0.8514:0.0	.|.	10;10;10|.	Q6IAX5;B2R806;P60228|.	.;.;EIF3E_HUMAN|.	M|W	10|9	ENSP00000220849:I10M;ENSP00000430839:I10M|.	ENSP00000220849:I10M|.	I|S	-|-	3|2	3|0	EIF3E|EIF3E	109330078|109330078	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.784000|1.784000	0.38674|0.38674	0.809000|0.809000	0.34255|0.34255	0.655000|0.655000	0.94253|0.94253	ATC|TCG	EIF3E	-	pfam_eIF3_su6_N,pirsf_Transl_init_fac_3_su6_euk		0.512	EIF3E-002	PUTATIVE	basic	protein_coding	EIF3E	HGNC	protein_coding	OTTHUMT00000380613.1	G	NM_001568		109260902	-1	no_errors	ENST00000220849	ensembl	human	known	70_37	missense	SNP	1.000	C
CTD-2144E22.5	0	genome.wustl.edu	37	16	34256794	34256794	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:34256794C>A	ENST00000319817.2	+	1	288	c.38C>A	c.(37-39)gCg>gAg	p.A13E	CTD-2144E22.6_ENST00000567803.1_RNA																							GAGGCCCAAGCGCCCAGCACC	0.701																																																	0																																										SO:0001583	missense	0																														ENST00000319817.2:c.38C>A	16.37:g.34256794C>A	ENSP00000318279:p.Ala13Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.A13E	ENST00000319817.2	37	c.38		16	.	.	.	.	.	.	.	.	.	.	C	4.292	0.053469	0.08291	.	.	ENSG00000179755	ENST00000319817	.	.	.	0.149	-0.298	0.12814	.	.	.	.	.	T	0.30448	0.0765	.	.	.	.	.	.	.	.	.	.	.	.	T	0.33929	-0.9849	3	.	.	.	.	4.5984	0.12341	0.0:0.6867:0.0:0.3133	.	.	.	.	E	13	.	.	A	+	2	0	AC135776.1	34114295	1.000000	0.71417	0.012000	0.15200	0.012000	0.07955	1.003000	0.29809	-1.149000	0.02843	-1.152000	0.01820	GCG	CTD-2144E22.5	-	NULL		0.701	CTD-2144E22.5-001	KNOWN	basic|appris_principal	protein_coding	ENSG00000179755	Clone_based_vega_gene	protein_coding	OTTHUMT00000431648.2	C			34256794	+1	no_errors	ENST00000319817	ensembl	human	known	70_37	missense	SNP	0.878	A
MRC2	9902	genome.wustl.edu	37	17	60761284	60761284	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:60761284C>T	ENST00000303375.5	+	20	3348				RNU6-446P_ENST00000362827.1_RNA|MRC2_ENST00000446119.2_Intron	NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						tttggcagcacatgtacaaaa	0.373																																																	0																																										SO:0001627	intron_variant	0			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.2946+1546C>T	17.37:g.60761284C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	RNA	SNP	-	NULL	ENST00000303375.5	37	NULL	CCDS11634.1	17																																																																																			U6	-	-		0.373	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000199697	RFAM	protein_coding	OTTHUMT00000445152.1	C			60761284	+1	no_errors	ENST00000362827	ensembl	human	novel	70_37	rna	SNP	0.089	T
LINC01602	100505477	genome.wustl.edu	37	8	58894939	58894939	+	lincRNA	SNP	A	A	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:58894939A>T	ENST00000522992.1	+	0	363																											gaaaaaaaaaaatttgctgca	0.493																																																	0																																												0																															8.37:g.58894939A>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000522992.1	37	NULL		8																																																																																			RP11-1112C15.1	-	-		0.493	RP11-1112C15.1-001	KNOWN	basic	lincRNA	ENSG00000205293	Clone_based_vega_gene	lincRNA	OTTHUMT00000378087.1	A			58894939	+1	no_errors	ENST00000522992	ensembl	human	known	70_37	rna	SNP	0.047	T
HAPLN1	1404	genome.wustl.edu	37	5	82999311	82999311	+	Intron	SNP	A	A	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:82999311A>G	ENST00000274341.4	-	1	825				RNU6-620P_ENST00000384017.1_RNA	NM_001884.3	NP_001875.1	P10915	HPLN1_HUMAN	hyaluronan and proteoglycan link protein 1						cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	hyaluronic acid binding (GO:0005540)			breast(1)|endometrium(1)|kidney(1)|large_intestine(12)|liver(1)|lung(15)|ovary(1)|prostate(1)|skin(1)	34		Lung NSC(167;0.0484)|all_lung(232;0.0522)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;7.82e-42)|Epithelial(54;5.88e-35)|all cancers(79;1.14e-29)	Hyaluronan(DB08818)	aatgattagcatggcccctgc	0.343																																																	0																																										SO:0001627	intron_variant	0				CCDS4061.1	5q14.3	2013-01-11	2004-03-16	2004-03-17	ENSG00000145681	ENSG00000145681		"""Immunoglobulin superfamily / V-set domain containing"""	2380	protein-coding gene	gene with protein product	"""Cartilage link protein"", ""hyaluronan and proteoglycan link protein 1"""	115435	"""cartilage linking protein 1"""	CRTL1		2286376, 2320422	Standard	NM_001884		Approved		uc003kin.3	P10915	OTTHUMG00000119045	ENST00000274341.4:c.25+17296T>C	5.37:g.82999311A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9A9	RNA	SNP	-	NULL	ENST00000274341.4	37	NULL	CCDS4061.1	5																																																																																			U6	-	-		0.343	HAPLN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000206744	RFAM	protein_coding	OTTHUMT00000239256.2	A	NM_001884		82999311	+1	no_errors	ENST00000384017	ensembl	human	novel	70_37	rna	SNP	0.277	G
IGLV2-28	28812	genome.wustl.edu	37	22	23006961	23006961	+	RNA	SNP	C	C	T	rs200228350	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr22:23006961C>T	ENST00000385099.1	+	0	64																											GGCTCTGCTCCTCCTCACCCT	0.627																																																	0																																												0																															22.37:g.23006961C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000385099.1	37	NULL		22																																																																																			D86994.2	-	-		0.627	D86994.2-201	NOVEL	basic	miRNA	ENSG00000207834	Clone_based_ensembl_gene	miRNA		C			23006961	+1	no_errors	ENST00000385099	ensembl	human	novel	70_37	rna	SNP	0.759	T
AC016575.1	0	genome.wustl.edu	37	5	14910690	14910691	+	RNA	INS	-	-	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:14910690_14910691insT	ENST00000390747.2	-	0	58_59																											aagtaattgtgttttttgccat	0.342																																																	0																																												0																															5.37:g.14910696_14910696dupT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000390747.2	37	NULL		5																																																																																			AC016575.1	-	-		0.342	AC016575.1-201	NOVEL	basic	miRNA	ENSG00000212036	Clone_based_ensembl_gene	miRNA		-			14910691	-1	no_errors	ENST00000390747	ensembl	human	novel	70_37	rna	INS	0.092:0.075	T
LYN	4067	genome.wustl.edu	37	8	56821610	56821610	+	Intron	SNP	A	A	C	rs538395553|rs13279909	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:56821610A>C	ENST00000519728.1	+	1	291				AC018607.1_ENST00000401385.1_RNA|LYN_ENST00000520220.2_Intron	NM_002350.3	NP_002341.1	P07948	LYN_HUMAN	LYN proto-oncogene, Src family tyrosine kinase						B cell homeostasis (GO:0001782)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to extracellular stimulus (GO:0031668)|cellular response to heat (GO:0034605)|cellular response to retinoic acid (GO:0071300)|cytokine secretion (GO:0050663)|dendritic cell differentiation (GO:0097028)|erythrocyte differentiation (GO:0030218)|Fc receptor mediated inhibitory signaling pathway (GO:0002774)|Fc receptor mediated stimulatory signaling pathway (GO:0002431)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|histamine secretion by mast cell (GO:0002553)|immune response-regulating cell surface receptor signaling pathway (GO:0002768)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|leukocyte migration (GO:0050900)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of B cell proliferation (GO:0030889)|negative regulation of cell proliferation (GO:0008285)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of immune response (GO:0050777)|negative regulation of intracellular signal transduction (GO:1902532)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of mast cell proliferation (GO:0070667)|negative regulation of myeloid leukocyte differentiation (GO:0002762)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of toll-like receptor 2 signaling pathway (GO:0034136)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|neuron projection development (GO:0031175)|oligodendrocyte development (GO:0014003)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of B cell receptor signaling pathway (GO:0050861)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cellular component movement (GO:0051272)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of Fc receptor mediated stimulatory signaling pathway (GO:0060369)|positive regulation of glial cell proliferation (GO:0060252)|positive regulation of mast cell proliferation (GO:0070668)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oligodendrocyte progenitor proliferation (GO:0070447)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of stress-activated protein kinase signaling cascade (GO:0070304)|positive regulation of tyrosine phosphorylation of STAT protein (GO:0042531)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of B cell apoptotic process (GO:0002902)|regulation of B cell receptor signaling pathway (GO:0050855)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cytokine production (GO:0001817)|regulation of cytokine secretion (GO:0050707)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of erythrocyte differentiation (GO:0045646)|regulation of inflammatory response (GO:0050727)|regulation of mast cell activation (GO:0033003)|regulation of mast cell degranulation (GO:0043304)|regulation of monocyte chemotaxis (GO:0090025)|regulation of platelet aggregation (GO:0090330)|regulation of protein phosphorylation (GO:0001932)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to carbohydrate (GO:0009743)|response to drug (GO:0042493)|response to hormone (GO:0009725)|response to insulin (GO:0032868)|response to organic cyclic compound (GO:0014070)|response to sterol depletion (GO:0006991)|response to toxic substance (GO:0009636)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|T cell costimulation (GO:0031295)|tolerance induction to self antigen (GO:0002513)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integrin alpha2-beta1 complex (GO:0034666)|mast cell granule (GO:0042629)|membrane raft (GO:0045121)|mitochondrial crista (GO:0030061)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|glycosphingolipid binding (GO:0043208)|ion channel binding (GO:0044325)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	22		all_lung(136;0.0555)|Lung NSC(129;0.0726)|all_epithelial(80;0.0772)	Epithelial(17;0.000834)|all cancers(17;0.00598)		Bosutinib(DB06616)|Ponatinib(DB08901)	acacacacacaccccacattt	0.333													A|||	3191	0.637181	0.4054	0.6412	5008	,	,		6858	0.9226		0.6431	False		,,,				2504	0.6472																0																																										SO:0001627	intron_variant	0			M16038	CCDS6162.1, CCDS47859.1	8q13	2014-06-25	2014-06-25		ENSG00000254087	ENSG00000254087		"""SH2 domain containing"""	6735	protein-coding gene	gene with protein product		165120	"""v-yes-1 Yamaguchi sarcoma viral related oncogene homolog"""			3561390	Standard	NM_002350		Approved	JTK8	uc003xsk.4	P07948	OTTHUMG00000044345	ENST00000519728.1:c.-6+28948A>C	8.37:g.56821610A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVQ5	RNA	SNP	-	NULL	ENST00000519728.1	37	NULL	CCDS6162.1	8																																																																																			AC018607.1	-	-		0.333	LYN-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000216204	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000378155.1	A	NM_002350		56821610	+1	no_errors	ENST00000401385	ensembl	human	novel	70_37	rna	SNP	0.020	C
Unknown	0	genome.wustl.edu	37	1	143237000	143237000	+	IGR	SNP	A	A	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:143237000A>G								RP11-782C8.1 (3583 upstream) : RP11-435B5.3 (110969 downstream)																							TTCATAGCACACAGACACTAA	0.458																																																	0																																										SO:0001628	intergenic_variant	0																															1.37:g.143237000A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		1																																																																																			BX571672.5	-	-	0	0.458					ENSG00000225278	Clone_based_vega_gene			A			143237000	-1	no_errors	ENST00000412196	ensembl	human	known	70_37	rna	SNP	0.960	G
PDXDC2P	283970	genome.wustl.edu	37	16	70011737	70011737	+	RNA	SNP	T	T	C	rs199849939	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:70011737T>C	ENST00000531894.1	-	0	2724				RP11-419C5.2_ENST00000525562.1_RNA	NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										CAGGGCCCATTTGCTATTACA	0.438													t|||	927	0.185104	0.0227	0.3228	5008	,	,		20508	0.0833		0.4046	False		,,,				2504	0.1861																0																																												0					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70011737T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			RP11-419C5.2	-	-		0.438	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	ENSG00000226232	Clone_based_vega_gene	processed_transcript	OTTHUMT00000395258.1	T			70011737	-1	no_errors	ENST00000525562	ensembl	human	known	70_37	rna	SNP	0.002	C
TAL1	6886	genome.wustl.edu	37	1	47694308	47694308	+	Intron	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:47694308G>T	ENST00000294339.3	-	1	576				TAL1_ENST00000371883.3_Intron|TAL1_ENST00000371884.2_Intron|RP1-18D14.7_ENST00000422216.1_RNA	NM_003189.2	NP_003180.1	P17542	TAL1_HUMAN	T-cell acute lymphocytic leukemia 1						angiogenesis (GO:0001525)|astrocyte fate commitment (GO:0060018)|basophil differentiation (GO:0030221)|cell fate commitment (GO:0045165)|definitive hemopoiesis (GO:0060216)|embryonic hemopoiesis (GO:0035162)|erythrocyte differentiation (GO:0030218)|erythrocyte maturation (GO:0043249)|hemangioblast cell differentiation (GO:0060217)|hematopoietic stem cell differentiation (GO:0060218)|hemopoiesis (GO:0030097)|locomotory behavior (GO:0007626)|megakaryocyte development (GO:0035855)|megakaryocyte differentiation (GO:0030219)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|platelet formation (GO:0030220)|positive regulation of cell division (GO:0051781)|positive regulation of chromatin assembly or disassembly (GO:0045799)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of protein complex assembly (GO:0031334)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell proliferation (GO:0042127)|regulation of mast cell differentiation (GO:0060375)|regulation of stem cell maintenance (GO:2000036)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|spinal cord association neuron differentiation (GO:0021527)	nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|E-box binding (GO:0070888)|enzyme binding (GO:0019899)|histone deacetylase binding (GO:0042826)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription factor binding (GO:0001085)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			haematopoietic_and_lymphoid_tissue(1)|lung(12)|prostate(1)|upper_aerodigestive_tract(1)	15						CAGGCCCTTAGACCCAGCCTC	0.557			T	"""TRD@, SIL"""	lymphoblastic leukemia/biphasic																																			Dom	yes		1	1p32	6886	T-cell acute lymphocytic leukemia 1 (SCL)		L	0																																										SO:0001627	intron_variant	0			M29038	CCDS547.1	1p32	2013-05-21	2001-12-04		ENSG00000162367	ENSG00000162367		"""Basic helix-loop-helix proteins"""	11556	protein-coding gene	gene with protein product		187040		TCL5		2740341	Standard	NM_001287347		Approved	SCL, bHLHa17	uc009vyq.2	P17542	OTTHUMG00000007847	ENST00000294339.3:c.0+559C>A	1.37:g.47694308G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQ24	RNA	SNP	-	NULL	ENST00000294339.3	37	NULL	CCDS547.1	1																																																																																			RP1-18D14.7	-	-		0.557	TAL1-002	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ENSG00000226252	Clone_based_vega_gene	protein_coding	OTTHUMT00000021640.1	G	NM_003189		47694308	+1	no_errors	ENST00000422216	ensembl	human	known	70_37	rna	SNP	0.084	T
RP11-417J8.1	0	genome.wustl.edu	37	1	142557366	142557366	+	lincRNA	SNP	T	T	C	rs372460967		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:142557366T>C	ENST00000445662.1	+	0	238																											acttcagctattgaggtatct	0.358																																																	0																																												0																															1.37:g.142557366T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445662.1	37	NULL		1																																																																																			AL583842.1	-	-		0.358	RP11-417J8.1-001	KNOWN	basic	lincRNA	ENSG00000227552	Clone_based_vega_gene	lincRNA	OTTHUMT00000036736.1	T			142557366	+1	no_errors	ENST00000445662	ensembl	human	known	70_37	rna	SNP	0.001	C
AC004485.3	0	genome.wustl.edu	37	7	24295302	24295302	+	RNA	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:24295302G>C	ENST00000439839.1	-	0	36																											CTTGATGCTGGAGGTACATCA	0.443																																																	0																																												0																															7.37:g.24295302G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000439839.1	37	NULL		7																																																																																			AC004485.3	-	-		0.443	AC004485.3-001	KNOWN	basic	antisense	ENSG00000228944	Clone_based_vega_gene	antisense	OTTHUMT00000326774.1	G			24295302	-1	no_errors	ENST00000439839	ensembl	human	known	70_37	rna	SNP	0.000	C
AP001604.3	0	genome.wustl.edu	37	21	28732862	28732862	+	lincRNA	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr21:28732862G>T	ENST00000420186.2	-	0	944				AP001605.4_ENST00000447384.1_lincRNA																							tggcccctctggGTAGAGAGA	0.468																																																	0																																												0																															21.37:g.28732862G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000420186.2	37	NULL		21																																																																																			AP001604.3	-	-		0.468	AP001604.3-001	KNOWN	basic	lincRNA	ENSG00000231236	Clone_based_vega_gene	lincRNA	OTTHUMT00000171665.2	G			28732862	-1	no_errors	ENST00000420186	ensembl	human	known	70_37	rna	SNP	0.003	T
LOC101929631	101929631	genome.wustl.edu	37	1	218217116	218217116	+	lincRNA	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:218217116C>G	ENST00000456026.1	+	0	270																											AGGGCAGACTCTGAATTATGA	0.343																																																	0																																												0																															1.37:g.218217116C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000456026.1	37	NULL		1																																																																																			RP11-152L7.2	-	-		0.343	RP11-152L7.2-001	KNOWN	basic	lincRNA	ENSG00000232100	Clone_based_vega_gene	lincRNA	OTTHUMT00000095286.1	C			218217116	+1	no_errors	ENST00000456026	ensembl	human	known	70_37	rna	SNP	0.382	G
LOC440390	440390	genome.wustl.edu	37	16	87097120	87097121	+	RNA	INS	-	-	T	rs549966801|rs71389838|rs386385331|rs5818616|rs386385332|rs376524971	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:87097120_87097121insT	ENST00000430050.2	+	0	3606_3607																											TAAGAAAACTGTTTTTTTTTCA	0.376																																																	0																																												0																															16.37:g.87097129_87097129dupT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000430050.2	37	NULL		16																																																																																			RP11-134D3.1	-	-		0.376	RP11-134D3.1-001	KNOWN	basic	processed_transcript	ENSG00000232190	Clone_based_vega_gene	processed_transcript	OTTHUMT00000430784.1	-			87097121	+1	no_errors	ENST00000430050	ensembl	human	known	70_37	rna	INS	0.000:0.000	T
LINC01047	105616982	genome.wustl.edu	37	13	89868280	89868280	+	lincRNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:89868280C>T	ENST00000415193.1	-	0	297									long intergenic non-protein coding RNA 1047																		tacctttaatcccagctgtcc	0.567																																																	0																																												0			BG183515		13q31.2	2013-08-15			ENSG00000232225	ENSG00000232225		"""Long non-coding RNAs"""	49041	non-coding RNA	RNA, long non-coding							Standard			Approved				OTTHUMG00000017173		13.37:g.89868280C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000415193.1	37	NULL		13																																																																																			RP11-143O10.1	-	-		0.567	LINC01047-001	KNOWN	basic	lincRNA	ENSG00000232225	Clone_based_vega_gene	lincRNA	OTTHUMT00000045423.2	C			89868280	-1	no_errors	ENST00000445027	ensembl	human	known	70_37	rna	SNP	0.077	T
RP11-13J8.1	0	genome.wustl.edu	37	2	201966480	201966481	+	lincRNA	INS	-	-	T	rs368976854		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:201966480_201966481insT	ENST00000448256.1	+	0	376_377																											caaATGCAAACttttttttttt	0.46																																																	0																																												0																															2.37:g.201966491_201966491dupT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000448256.1	37	NULL		2																																																																																			RP11-13J8.1	-	-		0.460	RP11-13J8.1-001	KNOWN	basic	lincRNA	ENSG00000232719	Clone_based_vega_gene	lincRNA	OTTHUMT00000347397.1	-			201966481	+1	no_errors	ENST00000448256	ensembl	human	known	70_37	rna	INS	0.080:0.072	T
LOC100128317	100128317	genome.wustl.edu	37	7	81205930	81205930	+	lincRNA	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:81205930C>G	ENST00000413944.2	-	0	4343																											TTCCAGACTTCAAAAATAATC	0.279																																																	0																																												0																															7.37:g.81205930C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000413944.2	37	NULL		7																																																																																			AC010091.1	-	-		0.279	AC010091.1-002	KNOWN	basic	lincRNA	ENSG00000233491	Clone_based_vega_gene	lincRNA	OTTHUMT00000339912.2	C			81205930	-1	no_errors	ENST00000413944	ensembl	human	known	70_37	rna	SNP	1.000	G
LINC01360	101927295	genome.wustl.edu	37	1	73802932	73802932	+	lincRNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:73802932C>T	ENST00000440762.1	+	0	2243																											tacgagtgatctccagtggac	0.463																																																	0																																												0																															1.37:g.73802932C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000440762.1	37	NULL		1																																																																																			RP4-598G3.1	-	-		0.463	RP4-598G3.1-001	KNOWN	basic	lincRNA	ENSG00000233973	Clone_based_vega_gene	lincRNA	OTTHUMT00000026413.1	C			73802932	+1	no_errors	ENST00000440762	ensembl	human	known	70_37	rna	SNP	0.000	T
RP11-446F3.2	0	genome.wustl.edu	37	10	2488474	2488474	+	lincRNA	SNP	A	A	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:2488474A>T	ENST00000441907.1	-	0	736																											TTTATTTTTTATATCTTTGGG	0.343																																																	0																																												0																															10.37:g.2488474A>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000441907.1	37	NULL		10																																																																																			RP11-446F3.2	-	-		0.343	RP11-446F3.2-003	KNOWN	basic|exp_conf	lincRNA	ENSG00000234170	Clone_based_vega_gene	lincRNA	OTTHUMT00000046444.1	A			2488474	-1	no_errors	ENST00000414107	ensembl	human	known	70_37	rna	SNP	0.000	T
PSME4	23198	genome.wustl.edu	37	2	54198225	54198225	+	5'Flank	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:54198225G>A	ENST00000404125.1	-	0	0				ACYP2_ENST00000458030.3_3'UTR|ACYP2_ENST00000607452.1_5'Flank|ACYP2_ENST00000606082.1_5'UTR|ACYP2_ENST00000422521.2_5'Flank	NM_014614.2	NP_055429.2	Q14997	PSME4_HUMAN	proteasome (prosome, macropain) activator subunit 4						anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cellular response to DNA damage stimulus (GO:0006974)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|spermatogenesis, exchange of chromosomal proteins (GO:0035093)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleus (GO:0005634)|spermatoproteasome complex (GO:1990111)	lysine-acetylated histone binding (GO:0070577)|peptidase activator activity (GO:0016504)			breast(5)|endometrium(8)|kidney(1)|large_intestine(11)|lung(26)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|urinary_tract(2)	60			Lung(47;0.125)|LUSC - Lung squamous cell carcinoma(58;0.181)			gggcggggcggagcgacggcg	0.781																																																	0																																										SO:0001631	upstream_gene_variant	0			D38521	CCDS33197.2	2p16.1	2003-04-14			ENSG00000068878	ENSG00000068878		"""Proteasome (prosome, macropain) subunits"""	20635	protein-coding gene	gene with protein product		607705				7584044, 12093752	Standard	NM_014614		Approved	PA200, KIAA0077	uc002rxp.2	Q14997	OTTHUMG00000151852		2.37:g.54198225G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q1XBG4|Q1XBG5|Q1XBG6|Q2M1Z0|Q6IPR2|Q86XF8	RNA	SNP	-	NULL	ENST00000404125.1	37	NULL	CCDS33197.2	2																																																																																			AC008280.5	-	-		0.781	PSME4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000239235	Clone_based_vega_gene	protein_coding	OTTHUMT00000324163.1	G	XM_040158		54198225	+1	no_errors	ENST00000458030	ensembl	human	known	70_37	rna	SNP	0.001	A
LRRTM4	80059	genome.wustl.edu	37	2	77236215	77236215	+	Intron	SNP	A	A	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:77236215A>T	ENST00000409093.1	-	4	1888				AC079117.1_ENST00000445178.1_RNA|LRRTM4_ENST00000409884.1_Intron|LRRTM4_ENST00000409911.1_Intron			Q86VH4	LRRT4_HUMAN	leucine rich repeat transmembrane neuronal 4						alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor clustering (GO:0097113)|regulation of presynaptic membrane organization (GO:1901629)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|postsynaptic membrane (GO:0045211)				autonomic_ganglia(1)|endometrium(1)|large_intestine(6)|lung(49)|ovary(2)|pancreas(3)|prostate(1)|upper_aerodigestive_tract(1)	64				Colorectal(11;0.059)		GCACACCATCATGAGAATTGG	0.378																																																	0																																										SO:0001627	intron_variant	0			AK122612	CCDS46346.1, CCDS46347.1, CCDS74530.1	2p12	2008-02-05			ENSG00000176204	ENSG00000176204			19411	protein-coding gene	gene with protein product		610870				12676565	Standard	NM_024993		Approved	FLJ12568	uc002snr.3	Q86VH4	OTTHUMG00000152842	ENST00000409093.1:c.1552-260173T>A	2.37:g.77236215A>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4FZ98|Q6UXJ7	RNA	SNP	-	NULL	ENST00000409093.1	37	NULL	CCDS46346.1	2																																																																																			AC079117.1	-	-		0.378	LRRTM4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000234653	Clone_based_vega_gene	protein_coding	OTTHUMT00000328225.1	A	NM_024993		77236215	+1	no_errors	ENST00000445178	ensembl	human	known	70_37	rna	SNP	0.650	T
ELF3	1999	genome.wustl.edu	37	1	201984068	201984068	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:201984068C>T	ENST00000359651.3	+	8	4193				ELF3_ENST00000367284.5_Intron|ELF3_ENST00000367283.3_Intron|RP11-510N19.5_ENST00000504773.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						ATTTAATGATCAGACCCCAGT	0.532																																																	0																																										SO:0001627	intron_variant	0			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.1002-269C>T	1.37:g.201984068C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000359651.3	37	NULL	CCDS1419.1	1																																																																																			RP11-510N19.5	-	-		0.532	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ENSG00000249007	Clone_based_vega_gene	protein_coding	OTTHUMT00000087360.1	C	NM_004433		201984068	+1	no_errors	ENST00000504773	ensembl	human	putative	70_37	rna	SNP	0.000	T
ITGA1	3672	genome.wustl.edu	37	5	52228251	52228251	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:52228251C>T	ENST00000282588.6	+	22	3319				CTD-2175A23.1_ENST00000503559.1_RNA|CTD-2175A23.1_ENST00000505701.1_RNA	NM_181501.1	NP_852478.1	P56199	ITA1_HUMAN	integrin, alpha 1						activation of MAPK activity (GO:0000187)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell-matrix adhesion (GO:0007160)|cellular extravasation (GO:0045123)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle contraction (GO:0006936)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|neutrophil chemotaxis (GO:0030593)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|vasodilation (GO:0042311)	acrosomal vesicle (GO:0001669)|basal part of cell (GO:0045178)|cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integrin alpha1-beta1 complex (GO:0034665)|integrin complex (GO:0008305)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|metal ion binding (GO:0046872)|protein phosphatase binding (GO:0019903)			NS(1)|breast(3)|central_nervous_system(4)|endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(19)|ovary(2)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(810;5.05e-05)|Breast(144;0.0851)				TCTTAATTCCCGAATGCAAGT	0.418																																																	0																																										SO:0001627	intron_variant	0			X68742	CCDS3955.1	5q11.1	2010-03-23			ENSG00000213949	ENSG00000213949		"""CD molecules"", ""Integrins"""	6134	protein-coding gene	gene with protein product		192968				8428973, 11937138	Standard	NM_181501		Approved	VLA1, CD49a	uc003jou.3	P56199	OTTHUMG00000131163	ENST00000282588.6:c.2861+285C>T	5.37:g.52228251C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNU0	RNA	SNP	-	NULL	ENST00000282588.6	37	NULL	CCDS3955.1	5																																																																																			CTD-2175A23.1	-	-		0.418	ITGA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000249899	Clone_based_vega_gene	protein_coding	OTTHUMT00000253855.3	C	NM_181501		52228251	-1	no_errors	ENST00000505701	ensembl	human	known	70_37	rna	SNP	0.000	T
LRP2BP	55805	genome.wustl.edu	37	4	186311904	186311904	+	Intron	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr4:186311904G>C	ENST00000505916.1	-	1	1121				RP11-714G18.1_ENST00000514884.1_RNA			Q9P2M1	LR2BP_HUMAN	LRP2 binding protein							cytoplasm (GO:0005737)				breast(1)|endometrium(2)|large_intestine(6)|lung(3)|prostate(1)|skin(2)	15		all_lung(41;1.3e-11)|Lung NSC(41;2.25e-11)|Melanoma(20;0.00109)|Colorectal(36;0.0215)|Renal(120;0.0246)|Hepatocellular(41;0.0268)|Prostate(90;0.0283)|all_hematologic(60;0.0749)		all cancers(43;2.14e-25)|Epithelial(43;1.55e-22)|OV - Ovarian serous cystadenocarcinoma(60;1.34e-11)|BRCA - Breast invasive adenocarcinoma(30;8.01e-05)|GBM - Glioblastoma multiforme(59;0.000132)|STAD - Stomach adenocarcinoma(60;0.000766)|Colorectal(24;0.00116)|LUSC - Lung squamous cell carcinoma(40;0.00904)|COAD - Colon adenocarcinoma(29;0.0101)|READ - Rectum adenocarcinoma(43;0.161)		ACAGCTGTGAGAACGCTGCCA	0.448																																																	0																																										SO:0001627	intron_variant	0			AB037746	CCDS3840.1	4q35.1	2011-05-03			ENSG00000109771	ENSG00000109771			25434	protein-coding gene	gene with protein product						10718198, 12508107	Standard	NM_018409		Approved	DKFZp761O0113	uc003ixj.2	Q9P2M1	OTTHUMG00000160460	ENST00000505916.1:c.20+4028C>G	4.37:g.186311904G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJR7|A7E219|B3KX83|Q9NSN6	RNA	SNP	-	NULL	ENST00000505916.1	37	NULL	CCDS3840.1	4																																																																																			RP11-714G18.1	-	-		0.448	LRP2BP-004	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ENSG00000250410	Clone_based_vega_gene	protein_coding	OTTHUMT00000360684.1	G	NM_018409		186311904	+1	no_errors	ENST00000514884	ensembl	human	known	70_37	rna	SNP	0.049	C
RP11-124N3.2	0	genome.wustl.edu	37	5	19035868	19035868	+	lincRNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:19035868C>T	ENST00000513955.1	-	0	335				RP11-124N3.3_ENST00000504827.1_lincRNA																							tgatcagagtcttcaaaaatg	0.343																																																	0																																												0																															5.37:g.19035868C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000513955.1	37	NULL		5																																																																																			RP11-124N3.2	-	-		0.343	RP11-124N3.2-002	KNOWN	basic	lincRNA	ENSG00000251487	Clone_based_vega_gene	lincRNA	OTTHUMT00000366085.1	C			19035868	-1	no_errors	ENST00000513955	ensembl	human	known	70_37	rna	SNP	0.001	T
MIR143HG	728264	genome.wustl.edu	37	5	148793052	148793052	+	lincRNA	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:148793052C>G	ENST00000602964.1	+	0	200				AC131025.8_ENST00000518014.1_lincRNA					MIR143 host gene (non-protein coding)																		GGGTGCCTTTCTTTAGCCTAT	0.522																																																	0																																												0					5q32	2013-02-13			ENSG00000249669	ENSG00000249669		"""Long non-coding RNAs"""	42872	non-coding RNA	RNA, long non-coding							Standard	NR_105059		Approved				OTTHUMG00000163464		5.37:g.148793052C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000602964.1	37	NULL		5																																																																																			AC131025.8	-	-		0.522	MIR143HG-009	KNOWN	basic	lincRNA	ENSG00000253864	Clone_based_vega_gene	lincRNA	OTTHUMT00000468028.1	C			148793052	+1	no_errors	ENST00000518014	ensembl	human	known	70_37	rna	SNP	0.014	G
AL589743.1	0	genome.wustl.edu	37	14	19687776	19687776	+	lincRNA	SNP	G	G	A	rs556391500	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:19687776G>A	ENST00000418499.3	+	0	9352																											CTCTGGAGGAGACGCCTGACC	0.473																																																	0																																												0																															14.37:g.19687776G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000418499.3	37	NULL		14																																																																																			RP11-496I2.3	-	-		0.473	AL589743.1-003	KNOWN	basic	lincRNA	ENSG00000257898	Clone_based_vega_gene	lincRNA	OTTHUMT00000317887.3	G			19687776	-1	no_errors	ENST00000550717	ensembl	human	known	70_37	rna	SNP	0.294	A
RP11-433J8.1	0	genome.wustl.edu	37	14	97059158	97059158	+	lincRNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:97059158C>T	ENST00000553378.1	+	0	89																											AGCGAGTAAGCGAGCCCTGGA	0.672																																																	0																																												0																															14.37:g.97059158C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000553378.1	37	NULL		14																																																																																			RP11-433J8.1	-	-		0.672	RP11-433J8.1-002	KNOWN	basic	lincRNA	ENSG00000258702	Clone_based_vega_gene	lincRNA	OTTHUMT00000413497.1	C			97059158	+1	no_errors	ENST00000553378	ensembl	human	known	70_37	rna	SNP	0.001	T
RP11-293M10.1	0	genome.wustl.edu	37	14	75738350	75738350	+	5'Flank	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:75738350G>A	ENST00000553510.1	-	0	0				RP11-293M10.2_ENST00000555106.1_RNA|RP11-293M10.2_ENST00000555909.1_RNA																							ggccaggcacggtggctcacg	0.507																																																	0																																										SO:0001631	upstream_gene_variant	0																															14.37:g.75738350G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000553510.1	37	NULL		14																																																																																			RP11-293M10.2	-	-		0.507	RP11-293M10.1-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ENSG00000258820	Clone_based_vega_gene	protein_coding	OTTHUMT00000415041.1	G			75738350	+1	no_errors	ENST00000555106	ensembl	human	known	70_37	rna	SNP	0.000	A
RP11-433J8.1	0	genome.wustl.edu	37	14	97059916	97059916	+	lincRNA	SNP	T	T	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:97059916T>A	ENST00000553378.1	+	0	847																											AGCCCCTCCATGTGAGGAAGC	0.587																																																	0																																												0																															14.37:g.97059916T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000553378.1	37	NULL		14																																																																																			RP11-433J8.1	-	-		0.587	RP11-433J8.1-002	KNOWN	basic	lincRNA	ENSG00000258702	Clone_based_vega_gene	lincRNA	OTTHUMT00000413497.1	T			97059916	+1	no_errors	ENST00000553378	ensembl	human	known	70_37	rna	SNP	0.000	A
PBX4	80714	genome.wustl.edu	37	19	19719158	19719159	+	Intron	INS	-	-	A	rs113078814		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:19719158_19719159insA	ENST00000251203.9	-	2	406				AC002306.1_ENST00000559614.2_RNA	NM_025245.2	NP_079521.1	Q9BYU1	PBX4_HUMAN	pre-B-cell leukemia homeobox 4						positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)|XY body (GO:0001741)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			large_intestine(1)|lung(4)|ovary(1)|prostate(3)	9						gaccctgtctcaaaaaaaaaaa	0.47																																																	0																																										SO:0001627	intron_variant	0			AJ300182	CCDS12406.1	19p13.11	2014-09-11	2007-01-30		ENSG00000105717			"""Homeoboxes / TALE class"""	13403	protein-coding gene	gene with protein product		608127	"""pre-B-cell leukemia transcription factor 4"""				Standard	NM_025245		Approved		uc002nmy.3	Q9BYU1	OTTHUMG00000172310	ENST00000251203.9:c.120-8984->T	19.37:g.19719169_19719169dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A5D8Y0|B3KUK9	RNA	INS	-	NULL	ENST00000251203.9	37	NULL	CCDS12406.1	19																																																																																			AC002306.1	-	-		0.470	PBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259242	Clone_based_vega_gene	protein_coding	OTTHUMT00000417784.6	-			19719159	+1	no_errors	ENST00000559614	ensembl	human	known	70_37	rna	INS	0.213:0.211	A
LOC101927286	101927286	genome.wustl.edu	37	15	97914087	97914087	+	lincRNA	SNP	A	A	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:97914087A>G	ENST00000558621.1	-	0	870				CTD-2147F2.1_ENST00000560314.1_lincRNA																							aaaaaaaaaaaaaagaaagaa	0.363																																																	0																																												0																															15.37:g.97914087A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000558621.1	37	NULL		15																																																																																			CTD-2147F2.2	-	-		0.363	CTD-2147F2.2-001	KNOWN	basic	lincRNA	ENSG00000259664	Clone_based_vega_gene	lincRNA	OTTHUMT00000416577.1	A			97914087	-1	no_errors	ENST00000558621	ensembl	human	known	70_37	rna	SNP	0.000	G
DNM1P47	100216544	genome.wustl.edu	37	15	102294715	102294715	+	RNA	SNP	C	C	T	rs377395363		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:102294715C>T	ENST00000561463.1	+	0	2761									DNM1 pseudogene 47																		AGCAGGCAGACCAAGGAGTTC	0.587																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102294715C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15																																																																																			CTD-2611K5.6	-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	ENSG00000259660	Clone_based_vega_gene	pseudogene	OTTHUMT00000417589.1	C	NG_009149		102294715	+1	no_errors	ENST00000561463	ensembl	human	known	70_37	rna	SNP	1.000	T
RP11-510M2.4	0	genome.wustl.edu	37	16	71466050	71466050	+	RNA	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:71466050G>A	ENST00000561754.1	-	0	18																											CTTCTCCCCCGCATGCAGCGC	0.612																																																	0																																												0																															16.37:g.71466050G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000561754.1	37	NULL		16																																																																																			RP11-510M2.4	-	-		0.612	RP11-510M2.4-001	KNOWN	basic	processed_transcript	ENSG00000260734	Clone_based_vega_gene	pseudogene	OTTHUMT00000433793.1	G			71466050	-1	no_errors	ENST00000561754	ensembl	human	known	70_37	rna	SNP	0.029	A
LINC00554	100861542	genome.wustl.edu	37	13	100649282	100649283	+	RNA	INS	-	-	TGTG	rs71114654|rs55639817|rs143774417|rs374671232		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:100649282_100649283insTGTG	ENST00000564841.1	-	0	880_881					NR_047483.1				long intergenic non-protein coding RNA 554																		AGGAGGCAAGTtgtgtgtgtgt	0.525																																																	0																																												0			BC068276		13q32.3	2012-10-12				ENSG00000260738		"""Long non-coding RNAs"""	43697	non-coding RNA	RNA, long non-coding							Standard	NR_047483		Approved				OTTHUMG00000176067		13.37:g.100649287_100649290dupTGTG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000564841.1	37	NULL		13																																																																																			RP11-12G12.6	-	-		0.525	LINC00554-001	KNOWN	basic	antisense	ENSG00000260738	Clone_based_vega_gene	antisense	OTTHUMT00000431449.1	-			100649283	-1	no_errors	ENST00000564841	ensembl	human	known	70_37	rna	INS	0.643:0.748	TGTG
PIGM	93183	genome.wustl.edu	37	1	159996007	159996007	+	IGR	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:159996007C>T	ENST00000368090.2	-	0	4322				RP11-226L15.5_ENST00000562313.1_RNA	NM_145167.2	NP_660150.1	Q9H3S5	PIGM_HUMAN	phosphatidylinositol glycan anchor biosynthesis, class M						C-terminal protein lipidation (GO:0006501)|cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|preassembly of GPI anchor in ER membrane (GO:0016254)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)	mannosyltransferase activity (GO:0000030)			kidney(1)|large_intestine(4)|lung(9)|ovary(2)|skin(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			ATTCAAACTTCTTAATTATGG	0.323																																																	0																																										SO:0001628	intergenic_variant	0			AB028127	CCDS1192.1	1q23.2	2013-02-26	2006-06-28		ENSG00000143315	ENSG00000143315		"""Dolichyl D-mannosyl phosphate dependent mannosyltransferases"", ""Phosphatidylinositol glycan anchor biosynthesis"""	18858	protein-coding gene	gene with protein product	"""GPI mannosyltransferase 1"", ""DPM:GlcN-(acyl-)PI mannosyltransferase"", ""dol-P-Man dependent GPI mannosyltransferase"""	610273	"""phosphatidylinositol glycan, class M"""			11226175	Standard	NM_145167		Approved	GPI-MT-I	uc001fuv.1	Q9H3S5	OTTHUMG00000024081		1.37:g.159996007C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000368090.2	37	NULL	CCDS1192.1	1																																																																																			RP11-226L15.5	-	-		0.323	PIGM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260766	Clone_based_vega_gene	protein_coding	OTTHUMT00000060643.2	C	NM_145167		159996007	-1	no_errors	ENST00000562313	ensembl	human	known	70_37	rna	SNP	0.046	T
CDH13	1012	genome.wustl.edu	37	16	82858525	82858525	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:82858525C>T	ENST00000566620.1	+	2	335				RP11-22H5.2_ENST00000567359.1_RNA|CDH13_ENST00000567445.1_Intron|CDH13_ENST00000268613.10_Intron|CDH13_ENST00000446376.2_Intron|CDH13_ENST00000565636.1_Intron|CDH13_ENST00000428848.3_Intron|CDH13_ENST00000431540.3_Intron	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13						adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		catgctgcttctgttaaaaaa	0.259																																																	0																																										SO:0001627	intron_variant	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.46-33442C>T	16.37:g.82858525C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	RNA	SNP	-	NULL	ENST00000566620.1	37	NULL	CCDS58486.1	16																																																																																			RP11-22H5.2	-	-		0.259	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260862	Clone_based_vega_gene	protein_coding	OTTHUMT00000432917.1	C	NM_001257		82858525	+1	no_errors	ENST00000567359	ensembl	human	known	70_37	rna	SNP	0.000	T
CDH13	1012	genome.wustl.edu	37	16	82858773	82858773	+	Intron	SNP	A	A	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:82858773A>G	ENST00000566620.1	+	2	335				RP11-22H5.2_ENST00000567359.1_RNA|CDH13_ENST00000567445.1_Intron|CDH13_ENST00000268613.10_Intron|CDH13_ENST00000446376.2_Intron|CDH13_ENST00000565636.1_Intron|CDH13_ENST00000428848.3_Intron|CDH13_ENST00000431540.3_Intron	NM_001220488.1|NM_001220489.1|NM_001220490.1|NM_001257.4	NP_001207417.1|NP_001207418.1|NP_001207419.1|NP_001248.1	P55290	CAD13_HUMAN	cadherin 13						adherens junction organization (GO:0034332)|calcium-dependent cell-cell adhesion (GO:0016339)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|endothelial cell migration (GO:0043542)|homophilic cell adhesion (GO:0007156)|keratinocyte proliferation (GO:0043616)|lamellipodium assembly (GO:0030032)|localization within membrane (GO:0051668)|low-density lipoprotein particle mediated signaling (GO:0055096)|mitotic cell cycle (GO:0000278)|negative regulation of cell adhesion (GO:0007162)|negative regulation of cell proliferation (GO:0008285)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of positive chemotaxis (GO:0050927)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|Rac protein signal transduction (GO:0016601)|regulation of cell growth (GO:0001558)|regulation of endocytosis (GO:0030100)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|Rho protein signal transduction (GO:0007266)|sprouting angiogenesis (GO:0002040)	anchored component of membrane (GO:0031225)|caveola (GO:0005901)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	adiponectin binding (GO:0055100)|cadherin binding (GO:0045296)|calcium ion binding (GO:0005509)|lipoprotein particle binding (GO:0071813)|low-density lipoprotein particle binding (GO:0030169)			large_intestine(1)	1		all_cancers(2;1.34e-11)|all_epithelial(2;4.3e-09)		COAD - Colon adenocarcinoma(5;0.0268)		AGCCAAAAAAATTAACAGGGG	0.373																																																	0																																										SO:0001627	intron_variant	0			U59288	CCDS56009.1, CCDS56010.1, CCDS58485.1, CCDS58486.1, CCDS58487.1	16q23.3	2013-08-27	2013-08-27			ENSG00000140945		"""Cadherins / Major cadherins"""	1753	protein-coding gene	gene with protein product	"""T-cadherin"", ""H-cadherin (heart)"""	601364				8673923, 9468307	Standard	NM_001257		Approved	CDHH	uc010vns.2	P55290		ENST00000566620.1:c.46-33194A>G	16.37:g.82858773A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8W476|A8W477|B7Z590|C9JRI6|J3KN62|Q6GTW4|Q8TBX3	RNA	SNP	-	NULL	ENST00000566620.1	37	NULL	CCDS58486.1	16																																																																																			RP11-22H5.2	-	-		0.373	CDH13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260862	Clone_based_vega_gene	protein_coding	OTTHUMT00000432917.1	A	NM_001257		82858773	+1	no_errors	ENST00000567359	ensembl	human	known	70_37	rna	SNP	0.000	G
RP13-122B23.8	0	genome.wustl.edu	37	9	140189552	140189552	+	RNA	SNP	C	C	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr9:140189552C>A	ENST00000566954.1	-	0	621																											TCCACGTGGTCCTGCTGACTA	0.637											OREG0019631	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																												0																															9.37:g.140189552C>A		Somatic	1654	WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000566954.1	37	NULL		9																																																																																			RP13-122B23.8	-	-		0.637	RP13-122B23.8-001	KNOWN	basic	sense_overlapping	ENSG00000260996	Clone_based_vega_gene	sense_overlapping	OTTHUMT00000430680.1	C			140189552	-1	no_errors	ENST00000566954	ensembl	human	known	70_37	rna	SNP	0.082	A
LOC101927277	101927277	genome.wustl.edu	37	19	32081070	32081070	+	lincRNA	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:32081070G>A	ENST00000562167.1	-	0	3551				AC011525.4_ENST00000590611.2_lincRNA																							GCAGAGAAGAGCTGGGGCACC	0.478																																																	0																																												0																															19.37:g.32081070G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000562167.1	37	NULL		19																																																																																			AC011525.2	-	-		0.478	AC011525.2-001	KNOWN	basic	lincRNA	ENSG00000261400	Clone_based_vega_gene	lincRNA	OTTHUMT00000431043.3	G			32081070	-1	no_errors	ENST00000562167	ensembl	human	known	70_37	rna	SNP	0.000	A
LINC01477	101927900	genome.wustl.edu	37	18	37650343	37650343	+	lincRNA	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr18:37650343G>A	ENST00000566101.1	+	0	843																											tcctgccaccgcgtgaagaag	0.453																																																	0																																												0																															18.37:g.37650343G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000566101.1	37	NULL		18																																																																																			RP11-653G8.2	-	-		0.453	RP11-653G8.2-001	KNOWN	basic	lincRNA	ENSG00000261715	Clone_based_vega_gene	lincRNA	OTTHUMT00000431600.1	G			37650343	+1	no_errors	ENST00000566101	ensembl	human	known	70_37	rna	SNP	0.017	A
LOC400685	400685	genome.wustl.edu	37	19	35304114	35304114	+	lincRNA	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:35304114G>C	ENST00000561778.2	-	0	1135				CTC-523E23.4_ENST00000590963.1_lincRNA																							ACATATGATGgggaggcacca	0.453																																																	0																																												0																															19.37:g.35304114G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000561778.2	37	NULL		19																																																																																			CTC-523E23.1	-	-		0.453	CTC-523E23.1-001	KNOWN	basic	lincRNA	ENSG00000261754	Clone_based_vega_gene	lincRNA	OTTHUMT00000431047.2	G			35304114	-1	no_errors	ENST00000561778	ensembl	human	known	70_37	rna	SNP	0.000	C
SUZ12P1	440423	genome.wustl.edu	37	17	29085344	29085344	+	RNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:29085344C>T	ENST00000582557.1	+	0	1015																											agagcgaaacctcatctcaaa	0.468																																																	0																																												0																															17.37:g.29085344C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000582557.1	37	NULL		17																																																																																			SUZ12P	-	-		0.468	SUZ12P-003	KNOWN	basic	processed_transcript	ENSG00000264538	Clone_based_vega_gene	pseudogene	OTTHUMT00000444260.1	C			29085344	+1	no_errors	ENST00000497969	ensembl	human	known	70_37	rna	SNP	0.001	T
ERCC6	2074	genome.wustl.edu	37	10	50732789	50732789	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:50732789C>T	ENST00000355832.5	-	5	765	c.687G>A	c.(685-687)atG>atA	p.M229I	PGBD3_ENST00000374127.3_5'Flank|PGBD3_ENST00000603152.1_Missense_Mutation_p.M229I|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.M229I|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.M229I	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	229					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CCTGGACAGGCATGAGCATGC	0.507								Direct reversal of damage;Nucleotide excision repair (NER)																																									0													46.0	48.0	48.0					10																	50732789		2200	4293	6493	SO:0001583	missense	2074			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.687G>A	10.37:g.50732789C>T	ENSP00000348089:p.Met229Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M229I	ENST00000355832.5	37	c.687	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.590470	0.96590	.	.	ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000515869;ENST00000447839	D;T;T	0.83591	-1.74;3.12;3.12	6.03	6.03	0.97812	.	.	.	.	.	D	0.90662	0.7071	M	0.71581	2.175	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.73380	0.98;0.98	D	0.89845	0.4005	9	0.51188	T	0.08	-39.3577	18.7472	0.91797	0.0:1.0:0.0:0.0	.	229;229	E7EV46;Q03468	.;ERCC6_HUMAN	I	229	ENSP00000348089:M229I;ENSP00000423550:M229I;ENSP00000387966:M229I	ENSP00000348089:M229I	M	-	3	0	ERCC6;RP11-123B3.6	50402795	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.461000	0.80834	2.854000	0.98071	0.655000	0.94253	ATG	ERCC6	-	NULL		0.507	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	C	NM_000124		50732789	-1	no_errors	ENST00000355832	ensembl	human	known	70_37	missense	SNP	1.000	T
ERCC6	2074	genome.wustl.edu	37	10	50732789	50732789	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:50732789C>T	ENST00000355832.5	-	5	765	c.687G>A	c.(685-687)atG>atA	p.M229I	PGBD3_ENST00000374127.3_5'Flank|PGBD3_ENST00000603152.1_Missense_Mutation_p.M229I|ERCC6-PGBD3_ENST00000515869.1_Missense_Mutation_p.M229I|ERCC6-PGBD3_ENST00000447839.2_Missense_Mutation_p.M229I	NM_000124.2	NP_000115.1	Q03468	ERCC6_HUMAN	excision repair cross-complementation group 6	229					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|ATP catabolic process (GO:0006200)|base-excision repair (GO:0006284)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organism growth (GO:0035264)|nucleotide-excision repair (GO:0006289)|photoreceptor cell maintenance (GO:0045494)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of protein tyrosine kinase activity (GO:0061098)|pyrimidine dimer repair (GO:0006290)|regulation of DNA-templated transcription, elongation (GO:0032784)|response to gamma radiation (GO:0010332)|response to oxidative stress (GO:0006979)|response to superoxide (GO:0000303)|response to toxic substance (GO:0009636)|response to UV (GO:0009411)|response to UV-B (GO:0010224)|response to X-ray (GO:0010165)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase II promoter (GO:0006366)|transcription-coupled nucleotide-excision repair (GO:0006283)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|protein N-terminus binding (GO:0047485)|protein tyrosine kinase activator activity (GO:0030296)			breast(5)|central_nervous_system(1)|endometrium(6)|kidney(5)|large_intestine(15)|lung(19)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	64						CCTGGACAGGCATGAGCATGC	0.507								Direct reversal of damage;Nucleotide excision repair (NER)																																									0													46.0	48.0	48.0					10																	50732789		2200	4293	6493	SO:0001583	missense	2074			L04791	CCDS7229.1	10q11	2014-09-17	2014-03-07		ENSG00000225830	ENSG00000225830			3438	protein-coding gene	gene with protein product	"""Cockayne syndrome B protein"""	609413	"""excision repair cross-complementing rodent repair deficiency, complementation group 6"""	CKN2		1339317, 19179336	Standard	NM_000124		Approved	CSB, RAD26, ARMD5	uc001jhs.5	Q03468	OTTHUMG00000018195	ENST00000355832.5:c.687G>A	10.37:g.50732789C>T	ENSP00000348089:p.Met229Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX94|Q5W0L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M229I	ENST00000355832.5	37	c.687	CCDS7229.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.590470	0.96590	.	.	ENSG00000225830;ENSG00000258838;ENSG00000258838	ENST00000355832;ENST00000515869;ENST00000447839	D;T;T	0.83591	-1.74;3.12;3.12	6.03	6.03	0.97812	.	.	.	.	.	D	0.90662	0.7071	M	0.71581	2.175	0.80722	D	1	D;D	0.69078	0.997;0.997	D;D	0.73380	0.98;0.98	D	0.89845	0.4005	9	0.51188	T	0.08	-39.3577	18.7472	0.91797	0.0:1.0:0.0:0.0	.	229;229	E7EV46;Q03468	.;ERCC6_HUMAN	I	229	ENSP00000348089:M229I;ENSP00000423550:M229I;ENSP00000387966:M229I	ENSP00000348089:M229I	M	-	3	0	ERCC6;RP11-123B3.6	50402795	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.461000	0.80834	2.854000	0.98071	0.655000	0.94253	ATG	ERCC6	-	NULL		0.507	ERCC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERCC6	HGNC	protein_coding	OTTHUMT00000047990.1	C	NM_000124		50732789	-1	no_errors	ENST00000355832	ensembl	human	known	70_37	missense	SNP	1.000	T
EVPL	2125	genome.wustl.edu	37	17	74018012	74018012	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:74018012C>T	ENST00000301607.3	-	7	996	c.743G>A	c.(742-744)cGc>cAc	p.R248H	EVPL_ENST00000586740.1_Missense_Mutation_p.R248H	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	248	Globular 1.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						CTGCAGGATGCGGCGCTGCTG	0.741																																																	0													5.0	6.0	6.0					17																	74018012		2059	4079	6138	SO:0001583	missense	2125			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.743G>A	17.37:g.74018012C>T	ENSP00000301607:p.Arg248His	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin/RNR-like,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R248H	ENST00000301607.3	37	c.743	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	C	19.36	3.813473	0.70912	.	.	ENSG00000167880	ENST00000301607	T	0.37235	1.21	4.35	4.35	0.52113	.	0.291116	0.30949	N	0.008545	T	0.42653	0.1212	L	0.57536	1.79	0.30088	N	0.808576	D;D	0.76494	0.999;0.986	P;P	0.53360	0.724;0.549	T	0.45352	-0.9267	10	0.46703	T	0.11	-12.7767	8.1185	0.30957	0.0:0.7633:0.0:0.2367	.	248;248	B7ZLH8;Q92817	.;EVPL_HUMAN	H	248	ENSP00000301607:R248H	ENSP00000301607:R248H	R	-	2	0	EVPL	71529607	0.245000	0.23899	1.000000	0.80357	0.962000	0.63368	0.180000	0.16860	2.140000	0.66376	0.462000	0.41574	CGC	EVPL	-	smart_Spectrin/alpha-actinin		0.741	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	C	NM_001988		74018012	-1	no_errors	ENST00000301607	ensembl	human	known	70_37	missense	SNP	0.814	T
MVB12B	89853	genome.wustl.edu	37	9	129267933	129267934	+	3'UTR	INS	-	-	TG	rs113188622|rs376226305|rs61527683|rs59351216	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr9:129267933_129267934insTG	ENST00000361171.3	+	0	3432_3433				MVB12B_ENST00000485886.1_3'UTR	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B						protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										AAGCATGTGCCtgtgtgtgtgt	0.52														773	0.154353	0.2269	0.1398	5008	,	,		25560	0.0823		0.1173	False		,,,				2504	0.1789																0																																										SO:0001624	3_prime_UTR_variant	89853			AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.*2392->TG	9.37:g.129267942_129267943dupTG		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N6S7	RNA	INS	-	NULL	ENST00000361171.3	37	NULL	CCDS35142.1	9																																																																																			FAM125B	-	-		0.520	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM125B	HGNC	protein_coding	OTTHUMT00000054110.1	-	XM_088525		129267934	+1	no_errors	ENST00000485886	ensembl	human	known	70_37	rna	INS	0.067:0.094	TG
FAM47C	442444	genome.wustl.edu	37	X	37026576	37026576	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:37026576G>A	ENST00000358047.3	+	1	145	c.93G>A	c.(91-93)gcG>gcA	p.A31A		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	31										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGTACTTCGCGAAGCGCAAGC	0.642																																																	0													27.0	26.0	26.0					X																	37026576		2202	4297	6499	SO:0001819	synonymous_variant	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.93G>A	X.37:g.37026576G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZU46	Silent	SNP	NULL	p.A31	ENST00000358047.3	37	c.93	CCDS35227.1	X																																																																																			FAM47C	-	NULL		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	G	NM_001013736		37026576	+1	no_errors	ENST00000358047	ensembl	human	known	70_37	silent	SNP	0.009	A
FAM47C	442444	genome.wustl.edu	37	X	37026576	37026576	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:37026576G>A	ENST00000358047.3	+	1	145	c.93G>A	c.(91-93)gcG>gcA	p.A31A		NM_001013736.2	NP_001013758.1	Q5HY64	FA47C_HUMAN	family with sequence similarity 47, member C	31										breast(4)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(15)|lung(63)|ovary(6)|pancreas(1)|prostate(6)|skin(8)|upper_aerodigestive_tract(4)|urinary_tract(1)	120						AGTACTTCGCGAAGCGCAAGC	0.642																																																	0													27.0	26.0	26.0					X																	37026576		2202	4297	6499	SO:0001819	synonymous_variant	442444			AK125992	CCDS35227.1	Xp21.1	2006-07-04			ENSG00000198173	ENSG00000198173			25301	protein-coding gene	gene with protein product							Standard	NM_001013736		Approved		uc004ddl.2	Q5HY64	OTTHUMG00000024025	ENST00000358047.3:c.93G>A	X.37:g.37026576G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZU46	Silent	SNP	NULL	p.A31	ENST00000358047.3	37	c.93	CCDS35227.1	X																																																																																			FAM47C	-	NULL		0.642	FAM47C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM47C	HGNC	protein_coding	OTTHUMT00000060508.1	G	NM_001013736		37026576	+1	no_errors	ENST00000358047	ensembl	human	known	70_37	silent	SNP	0.009	A
FBXO25	26260	genome.wustl.edu	37	8	382894	382894	+	Missense_Mutation	SNP	C	C	T	rs142717048	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:382894C>T	ENST00000276326.5	+	4	366	c.247C>T	c.(247-249)Cgt>Tgt	p.R83C	FBXO25_ENST00000382824.1_Intron|FBXO25_ENST00000352684.2_Intron|FBXO25_ENST00000350302.3_Missense_Mutation_p.R83C	NM_183421.1	NP_904357.1	Q8TCJ0	FBX25_HUMAN	F-box protein 25	83	Interaction with beta-actin.				protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		AGGTTTTTATCGTGAAAAATG	0.259													C|||	3	0.000599042	0.0	0.0	5008	,	,		16996	0.0		0.002	False		,,,				2504	0.001																0								C	,CYS/ARG,CYS/ARG	0,4366		0,0,2183	30.0	30.0	30.0		,247,247	4.4	1.0	8	dbSNP_134	30	5,8523		0,5,4259	yes	intron,missense,missense	FBXO25	NM_012173.3,NM_183420.1,NM_183421.1	,180,180	0,5,6442	TT,TC,CC		0.0586,0.0,0.0388	,benign,benign	,83/359,83/368	382894	5,12889	2183	4264	6447	SO:0001583	missense	26260			AF174605	CCDS5952.1, CCDS5953.1, CCDS5954.1	8p23.3	2007-03-30	2004-06-15		ENSG00000147364	ENSG00000147364		"""F-boxes /  ""other"""""	13596	protein-coding gene	gene with protein product		609098	"""F-box only protein 25"""			10531035, 10531037	Standard	NM_012173		Approved	FBX25	uc003wox.3	Q8TCJ0	OTTHUMG00000090341	ENST00000276326.5:c.247C>T	8.37:g.382894C>T	ENSP00000276326:p.Arg83Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PJ83|Q7Z4V4|Q9UKB8	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.R83C	ENST00000276326.5	37	c.247	CCDS5953.1	8	.	.	.	.	.	.	.	.	.	.	.	18.09	3.545700	0.65198	0.0	5.86E-4	ENSG00000147364	ENST00000518240;ENST00000350302;ENST00000276326;ENST00000447233	T;T;T	0.22336	1.96;1.96;1.96	4.36	4.36	0.52297	.	0.227432	0.44097	D	0.000487	T	0.32285	0.0824	L	0.47716	1.5	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.55824	0.785;0.785	T	0.02632	-1.1131	10	0.41790	T	0.15	-19.681	14.7746	0.69713	0.0:1.0:0.0:0.0	.	83;83	Q8TCJ0-2;Q8TCJ0	.;FBX25_HUMAN	C	83	ENSP00000428872:R83C;ENSP00000342077:R83C;ENSP00000276326:R83C	ENSP00000276326:R83C	R	+	1	0	FBXO25	372894	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.084000	0.50143	2.158000	0.67659	0.449000	0.29647	CGT	FBXO25	-	NULL		0.259	FBXO25-001	KNOWN	basic|CCDS	protein_coding	FBXO25	HGNC	protein_coding	OTTHUMT00000206710.2	C	NM_012173		382894	+1	no_errors	ENST00000276326	ensembl	human	known	70_37	missense	SNP	1.000	T
FBXO25	26260	genome.wustl.edu	37	8	382894	382894	+	Missense_Mutation	SNP	C	C	T	rs142717048	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:382894C>T	ENST00000276326.5	+	4	366	c.247C>T	c.(247-249)Cgt>Tgt	p.R83C	FBXO25_ENST00000382824.1_Intron|FBXO25_ENST00000352684.2_Intron|FBXO25_ENST00000350302.3_Missense_Mutation_p.R83C	NM_183421.1	NP_904357.1	Q8TCJ0	FBX25_HUMAN	F-box protein 25	83	Interaction with beta-actin.				protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		AGGTTTTTATCGTGAAAAATG	0.259													C|||	3	0.000599042	0.0	0.0	5008	,	,		16996	0.0		0.002	False		,,,				2504	0.001																0								C	,CYS/ARG,CYS/ARG	0,4366		0,0,2183	30.0	30.0	30.0		,247,247	4.4	1.0	8	dbSNP_134	30	5,8523		0,5,4259	yes	intron,missense,missense	FBXO25	NM_012173.3,NM_183420.1,NM_183421.1	,180,180	0,5,6442	TT,TC,CC		0.0586,0.0,0.0388	,benign,benign	,83/359,83/368	382894	5,12889	2183	4264	6447	SO:0001583	missense	26260			AF174605	CCDS5952.1, CCDS5953.1, CCDS5954.1	8p23.3	2007-03-30	2004-06-15		ENSG00000147364	ENSG00000147364		"""F-boxes /  ""other"""""	13596	protein-coding gene	gene with protein product		609098	"""F-box only protein 25"""			10531035, 10531037	Standard	NM_012173		Approved	FBX25	uc003wox.3	Q8TCJ0	OTTHUMG00000090341	ENST00000276326.5:c.247C>T	8.37:g.382894C>T	ENSP00000276326:p.Arg83Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PJ83|Q7Z4V4|Q9UKB8	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.R83C	ENST00000276326.5	37	c.247	CCDS5953.1	8	.	.	.	.	.	.	.	.	.	.	.	18.09	3.545700	0.65198	0.0	5.86E-4	ENSG00000147364	ENST00000518240;ENST00000350302;ENST00000276326;ENST00000447233	T;T;T	0.22336	1.96;1.96;1.96	4.36	4.36	0.52297	.	0.227432	0.44097	D	0.000487	T	0.32285	0.0824	L	0.47716	1.5	0.80722	D	1	D;D	0.63046	0.992;0.992	P;P	0.55824	0.785;0.785	T	0.02632	-1.1131	10	0.41790	T	0.15	-19.681	14.7746	0.69713	0.0:1.0:0.0:0.0	.	83;83	Q8TCJ0-2;Q8TCJ0	.;FBX25_HUMAN	C	83	ENSP00000428872:R83C;ENSP00000342077:R83C;ENSP00000276326:R83C	ENSP00000276326:R83C	R	+	1	0	FBXO25	372894	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.084000	0.50143	2.158000	0.67659	0.449000	0.29647	CGT	FBXO25	-	NULL		0.259	FBXO25-001	KNOWN	basic|CCDS	protein_coding	FBXO25	HGNC	protein_coding	OTTHUMT00000206710.2	C	NM_012173		382894	+1	no_errors	ENST00000276326	ensembl	human	known	70_37	missense	SNP	1.000	T
FCGBP	8857	genome.wustl.edu	37	19	40380155	40380155	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:40380155G>A	ENST00000221347.6	-	23	11167	c.11160C>T	c.(11158-11160)ttC>ttT	p.F3720F	FCGBP_ENST00000595713.1_5'Flank	NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	3720	VWFD 9. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCCGCAGGGTGAAGTTTGCCA	0.652																																																	0													4.0	5.0	5.0					19																	40380155		489	2394	2883	SO:0001819	synonymous_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.11160C>T	19.37:g.40380155G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.F3720	ENST00000221347.6	37	c.11160	CCDS12546.1	19																																																																																			FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D		0.652	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	G	NM_003890		40380155	-1	no_errors	ENST00000221347	ensembl	human	known	70_37	silent	SNP	0.991	A
LINC00898	400932	genome.wustl.edu	37	22	48026582	48026582	+	lincRNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr22:48026582C>T	ENST00000380990.1	-	0	736				RP11-191L9.4_ENST00000423737.1_lincRNA	NR_033377.1				long intergenic non-protein coding RNA 898																		ACAGGACCACCGGGAGGTGGA	0.557																																																	0																																												0					22q13.31	2013-05-17			ENSG00000205634	ENSG00000205634		"""Long non-coding RNAs"""	48581	non-coding RNA	RNA, long non-coding							Standard	NR_033377		Approved				OTTHUMG00000150323		22.37:g.48026582C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000380990.1	37	NULL		22																																																																																			RP11-191L9.6	-	-		0.557	LINC00898-001	KNOWN	basic	lincRNA	FLJ46257	Clone_based_vega_gene	lincRNA	OTTHUMT00000317560.1	C			48026582	-1	no_errors	ENST00000380990	ensembl	human	known	70_37	rna	SNP	0.000	T
GABRA1	2554	genome.wustl.edu	37	5	161281255	161281255	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:161281255C>T	ENST00000428797.2	+	4	521	c.166C>T	c.(166-168)Cgc>Tgc	p.R56C	GABRA1_ENST00000023897.6_Missense_Mutation_p.R56C|GABRA1_ENST00000437025.2_Missense_Mutation_p.R56C|GABRA1_ENST00000393943.4_Missense_Mutation_p.R56C|GABRA1_ENST00000444819.1_Missense_Mutation_p.R56C|GABRA1_ENST00000420560.1_Missense_Mutation_p.R56C	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	56					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTATGACAATCGCCTGAGACC	0.373																																																	0													98.0	101.0	100.0					5																	161281255		2203	4300	6503	SO:0001583	missense	2554				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.166C>T	5.37:g.161281255C>T	ENSP00000393097:p.Arg56Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQK6|Q8N629	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R56C	ENST00000428797.2	37	c.166	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876861	0.91664	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000521339;ENST00000420560;ENST00000522651;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.21;-1.38;-1.21;-1.38;-1.38	5.51	5.51	0.81932	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.93038	0.7784	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94345	0.7574	10	0.87932	D	0	.	19.7945	0.96474	0.0:1.0:0.0:0.0	.	56	P14867	GBRA1_HUMAN	C	56;56;56;56;62;56;56;56;56	ENSP00000023897:R56C;ENSP00000393097:R56C;ENSP00000377517:R56C;ENSP00000415441:R56C;ENSP00000430895:R62C;ENSP00000408041:R56C;ENSP00000430507:R56C;ENSP00000414232:R56C;ENSP00000430435:R56C	ENSP00000023897:R56C	R	+	1	0	GABRA1	161213833	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	5.539000	0.67199	2.746000	0.94184	0.591000	0.81541	CGC	GABRA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABBAg_rcpt,tigrfam_Neur_channel		0.373	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	C	NM_000806.5		161281255	+1	no_errors	ENST00000023897	ensembl	human	known	70_37	missense	SNP	1.000	T
GABRA1	2554	genome.wustl.edu	37	5	161281255	161281255	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:161281255C>T	ENST00000428797.2	+	4	521	c.166C>T	c.(166-168)Cgc>Tgc	p.R56C	GABRA1_ENST00000023897.6_Missense_Mutation_p.R56C|GABRA1_ENST00000437025.2_Missense_Mutation_p.R56C|GABRA1_ENST00000393943.4_Missense_Mutation_p.R56C|GABRA1_ENST00000444819.1_Missense_Mutation_p.R56C|GABRA1_ENST00000420560.1_Missense_Mutation_p.R56C	NM_001127643.1	NP_001121115.1	P14867	GBRA1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, alpha 1	56					gamma-aminobutyric acid signaling pathway (GO:0007214)|ion transmembrane transport (GO:0034220)|synaptic transmission (GO:0007268)|synaptic transmission, GABAergic (GO:0051932)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|drug binding (GO:0008144)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)			NS(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(1)|lung(22)|ovary(2)|pancreas(2)|prostate(1)|skin(3)|urinary_tract(1)	42	Renal(175;0.00259)	Medulloblastoma(196;0.0208)|all_neural(177;0.0672)	Kidney(164;7.83e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000525)	all cancers(165;0.228)	Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amobarbital(DB01351)|Amoxapine(DB00543)|Aprobarbital(DB01352)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethanol(DB00898)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Ginkgo biloba(DB01381)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methohexital(DB00474)|Methoxyflurane(DB01028)|Methylphenobarbital(DB00849)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Prazepam(DB01588)|Primidone(DB00794)|Progabide(DB00837)|Propofol(DB00818)|Quazepam(DB01589)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Thiamylal(DB01154)|Thiopental(DB00599)|Topiramate(DB00273)|Triazolam(DB00897)|Zaleplon(DB00962)|Zolpidem(DB00425)|Zopiclone(DB01198)	TTATGACAATCGCCTGAGACC	0.373																																																	0													98.0	101.0	100.0					5																	161281255		2203	4300	6503	SO:0001583	missense	2554				CCDS4357.1	5q34	2012-06-22			ENSG00000022355	ENSG00000022355		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4075	protein-coding gene	gene with protein product	"""GABA(A) receptor, alpha 1"""	137160				1330891	Standard	NM_000806		Approved	EJM5	uc003lyx.4	P14867	OTTHUMG00000163586	ENST00000428797.2:c.166C>T	5.37:g.161281255C>T	ENSP00000393097:p.Arg56Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQK6|Q8N629	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAAa_rcpt,prints_GABAA_rcpt,prints_GABBAa1_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.R56C	ENST00000428797.2	37	c.166	CCDS4357.1	5	.	.	.	.	.	.	.	.	.	.	C	27.9	4.876861	0.91664	.	.	ENSG00000022355	ENST00000023897;ENST00000428797;ENST00000393943;ENST00000437025;ENST00000521339;ENST00000420560;ENST00000522651;ENST00000444819;ENST00000519621	T;T;T;T;T;T;T;T;T	0.80480	-1.38;-1.38;-1.38;-1.38;-1.21;-1.38;-1.21;-1.38;-1.38	5.51	5.51	0.81932	Neurotransmitter-gated ion-channel ligand-binding (3);	0.000000	0.85682	D	0.000000	D	0.93038	0.7784	H	0.95004	3.61	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.94345	0.7574	10	0.87932	D	0	.	19.7945	0.96474	0.0:1.0:0.0:0.0	.	56	P14867	GBRA1_HUMAN	C	56;56;56;56;62;56;56;56;56	ENSP00000023897:R56C;ENSP00000393097:R56C;ENSP00000377517:R56C;ENSP00000415441:R56C;ENSP00000430895:R62C;ENSP00000408041:R56C;ENSP00000430507:R56C;ENSP00000414232:R56C;ENSP00000430435:R56C	ENSP00000023897:R56C	R	+	1	0	GABRA1	161213833	1.000000	0.71417	1.000000	0.80357	0.897000	0.52465	5.539000	0.67199	2.746000	0.94184	0.591000	0.81541	CGC	GABRA1	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_GABBAg_rcpt,tigrfam_Neur_channel		0.373	GABRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRA1	HGNC	protein_coding	OTTHUMT00000252702.2	C	NM_000806.5		161281255	+1	no_errors	ENST00000023897	ensembl	human	known	70_37	missense	SNP	1.000	T
GHRL	51738	genome.wustl.edu	37	3	10326899	10326899	+	IGR	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr3:10326899C>T	ENST00000335542.8	-	0	1425				LINC00852_ENST00000475197.1_RNA|GHRLOS_ENST00000603771.1_RNA|GHRL_ENST00000476283.1_5'Flank|GHRLOS_ENST00000605014.1_RNA|RP11-438J1.1_ENST00000450534.1_Intron|LINC00852_ENST00000538717.1_RNA|GHRLOS_ENST00000605105.1_RNA|GHRLOS_ENST00000439539.3_RNA			Q9UBU3	GHRL_HUMAN	ghrelin/obestatin prepropeptide						actin polymerization or depolymerization (GO:0008154)|activation of MAPK activity (GO:0000187)|adult feeding behavior (GO:0008343)|cartilage development (GO:0051216)|cellular protein metabolic process (GO:0044267)|cortisol secretion (GO:0043400)|decidualization (GO:0046697)|dendrite development (GO:0016358)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric acid secretion (GO:0001696)|glucose metabolic process (GO:0006006)|growth hormone secretion (GO:0030252)|hormone-mediated signaling pathway (GO:0009755)|negative regulation of angiogenesis (GO:0016525)|negative regulation of apoptotic process (GO:0043066)|negative regulation of circadian sleep/wake cycle, REM sleep (GO:0042322)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin secretion (GO:0046676)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|negative regulation of locomotion (GO:0040013)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of appetite (GO:0032100)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of corticotropin secretion (GO:0051461)|positive regulation of cortisol secretion (GO:0051464)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of growth hormone receptor signaling pathway (GO:0060399)|positive regulation of growth hormone secretion (GO:0060124)|positive regulation of insulin secretion (GO:0032024)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of synapse assembly (GO:0051965)|regulation of cell proliferation (GO:0042127)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|response to estrogen (GO:0043627)|response to hormone (GO:0009725)	axon (GO:0030424)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|secretory granule lumen (GO:0034774)	G-protein coupled receptor binding (GO:0001664)|ghrelin receptor binding (GO:0031768)|growth hormone-releasing hormone activity (GO:0016608)|protein tyrosine kinase activator activity (GO:0030296)			breast(2)|large_intestine(1)|lung(1)|ovary(1)	5						TTGGGCACCTCACTTAACGTC	0.473																																																	0													158.0	128.0	137.0					3																	10326899		692	1591	2283	SO:0001628	intergenic_variant	84657			AF296558	CCDS33700.1, CCDS46747.1, CCDS46748.1, CCDS46749.1, CCDS46750.1	3p26-p25	2013-02-26	2008-07-02		ENSG00000157017	ENSG00000157017		"""Endogenous ligands"""	18129	protein-coding gene	gene with protein product	"""prepro-appetite regulatory hormone"""	605353	"""ghrelin, growth hormone secretagogue receptor ligand"""			10930375, 10604470, 16284174	Standard	NR_024133		Approved	MTLRP, ghrelin, obestatin	uc010hdj.2	Q9UBU3	OTTHUMG00000155360		3.37:g.10326899C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8CF34|A8CF38|A8CF42|A8DN29|A8DN30|Q86YP8|Q8TAT9|Q9H3R3	RNA	SNP	-	NULL	ENST00000335542.8	37	NULL	CCDS33700.1	3																																																																																			GHRLOS2	-	-		0.473	GHRL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GHRLOS2	HGNC	protein_coding	OTTHUMT00000339625.1	C	NM_016362		10326899	+1	no_errors	ENST00000475197	ensembl	human	known	70_37	rna	SNP	0.000	T
GTPBP6	8225	genome.wustl.edu	37	X	229380	229380	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:229380C>T	ENST00000326153.4	-	2	229							O43824	GTPB6_HUMAN	GTP binding protein 6 (putative)								GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CGGGCGAGTCCTCACCGGTGA	0.706																																																	0																																										SO:0001627	intron_variant	8225			Y14391	CCDS75943.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000178605	ENSG00000178605		"""Pseudoautosomal regions / PAR1"""	30189	protein-coding gene	gene with protein product	"""pseudoautosomal GTP binding protein-like"""	300124				9466997	Standard	XM_006724447		Approved	PGPL, FLJ20977	uc004cpe.1	O43824	OTTHUMG00000022694	ENST00000326153.4:c.229+52G>A	X.37:g.229380C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53F77|Q5HYX8	RNA	SNP	-	NULL	ENST00000326153.4	37	NULL		X																																																																																			GTPBP6	-	-		0.706	GTPBP6-201	KNOWN	basic|appris_candidate_longest	protein_coding	GTPBP6	HGNC	protein_coding		C	NM_012227		229380	-1	no_errors	ENST00000485332	ensembl	human	known	70_37	rna	SNP	0.033	T
GTPBP6	8225	genome.wustl.edu	37	X	229380	229380	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:229380C>T	ENST00000326153.4	-	2	229							O43824	GTPB6_HUMAN	GTP binding protein 6 (putative)								GTP binding (GO:0005525)|metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|lung(3)	7		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				CGGGCGAGTCCTCACCGGTGA	0.706																																																	0																																										SO:0001627	intron_variant	8225			Y14391	CCDS75943.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000178605	ENSG00000178605		"""Pseudoautosomal regions / PAR1"""	30189	protein-coding gene	gene with protein product	"""pseudoautosomal GTP binding protein-like"""	300124				9466997	Standard	XM_006724447		Approved	PGPL, FLJ20977	uc004cpe.1	O43824	OTTHUMG00000022694	ENST00000326153.4:c.229+52G>A	X.37:g.229380C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53F77|Q5HYX8	RNA	SNP	-	NULL	ENST00000326153.4	37	NULL		X																																																																																			GTPBP6	-	-		0.706	GTPBP6-201	KNOWN	basic|appris_candidate_longest	protein_coding	GTPBP6	HGNC	protein_coding		C	NM_012227		229380	-1	no_errors	ENST00000485332	ensembl	human	known	70_37	rna	SNP	0.033	T
GXYLT1	283464	genome.wustl.edu	37	12	42499642	42499642	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:42499642C>T	ENST00000398675.3	-	5	1074	c.842G>A	c.(841-843)cGa>cAa	p.R281Q	GXYLT1_ENST00000280876.6_Missense_Mutation_p.R250Q	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	281					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						CCTTCTCATTCGAGTCATGTT	0.323																																																	0													71.0	66.0	67.0					12																	42499642		1834	4090	5924	SO:0001583	missense	283464			BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.842G>A	12.37:g.42499642C>T	ENSP00000381666:p.Arg281Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.R281Q	ENST00000398675.3	37	c.842	CCDS41772.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.773694	0.96922	.	.	ENSG00000151233	ENST00000398675;ENST00000280876	T;T	0.23754	1.89;1.89	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.63379	0.2506	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.68762	-0.5323	10	0.66056	D	0.02	-16.1546	20.6397	0.99537	0.0:1.0:0.0:0.0	.	250;281	Q4G148-2;Q4G148	.;GXLT1_HUMAN	Q	281;250	ENSP00000381666:R281Q;ENSP00000280876:R250Q	ENSP00000280876:R250Q	R	-	2	0	GXYLT1	40785909	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	7.770000	0.85390	2.880000	0.98712	0.650000	0.86243	CGA	GXYLT1	-	pfam_Glyco_trans_8		0.323	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GXYLT1	HGNC	protein_coding	OTTHUMT00000403778.1	C	XM_290597		42499642	-1	no_errors	ENST00000398675	ensembl	human	known	70_37	missense	SNP	1.000	T
GXYLT1	283464	genome.wustl.edu	37	12	42499642	42499642	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:42499642C>T	ENST00000398675.3	-	5	1074	c.842G>A	c.(841-843)cGa>cAa	p.R281Q	GXYLT1_ENST00000280876.6_Missense_Mutation_p.R250Q	NM_001099650.1|NM_173601.1	NP_001093120.1|NP_775872.1	Q4G148	GXLT1_HUMAN	glucoside xylosyltransferase 1	281					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|O-glycan processing (GO:0016266)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	UDP-xylosyltransferase activity (GO:0035252)			kidney(2)|large_intestine(4)|liver(3)|lung(8)	17						CCTTCTCATTCGAGTCATGTT	0.323																																																	0													71.0	66.0	67.0					12																	42499642		1834	4090	5924	SO:0001583	missense	283464			BC015597	CCDS41771.1, CCDS41772.1	12q12	2013-10-11	2009-11-17	2009-11-17	ENSG00000151233	ENSG00000151233		"""Glycosyltransferase family 8 domain containing"""	27482	protein-coding gene	gene with protein product		613321	"""glycosyltransferase 8 domain containing 3"""	GLT8D3		19940119	Standard	NM_001099650		Approved	FLJ43151	uc001rms.4	Q4G148	OTTHUMG00000169379	ENST00000398675.3:c.842G>A	12.37:g.42499642C>T	ENSP00000381666:p.Arg281Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWJ2|Q8IXV1|Q96BH4	Missense_Mutation	SNP	pfam_Glyco_trans_8	p.R281Q	ENST00000398675.3	37	c.842	CCDS41772.1	12	.	.	.	.	.	.	.	.	.	.	C	36	5.773694	0.96922	.	.	ENSG00000151233	ENST00000398675;ENST00000280876	T;T	0.23754	1.89;1.89	6.06	6.06	0.98353	.	0.000000	0.85682	D	0.000000	T	0.63379	0.2506	M	0.92026	3.265	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	T	0.68762	-0.5323	10	0.66056	D	0.02	-16.1546	20.6397	0.99537	0.0:1.0:0.0:0.0	.	250;281	Q4G148-2;Q4G148	.;GXLT1_HUMAN	Q	281;250	ENSP00000381666:R281Q;ENSP00000280876:R250Q	ENSP00000280876:R250Q	R	-	2	0	GXYLT1	40785909	1.000000	0.71417	0.997000	0.53966	0.981000	0.71138	7.770000	0.85390	2.880000	0.98712	0.650000	0.86243	CGA	GXYLT1	-	pfam_Glyco_trans_8		0.323	GXYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GXYLT1	HGNC	protein_coding	OTTHUMT00000403778.1	C	XM_290597		42499642	-1	no_errors	ENST00000398675	ensembl	human	known	70_37	missense	SNP	1.000	T
HECTD2	143279	genome.wustl.edu	37	10	93249462	93249462	+	Intron	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:93249462G>C	ENST00000298068.5	+	12	1285				HECTD2_ENST00000498446.1_3'UTR|HECTD2_ENST00000371667.1_Intron|HECTD2_ENST00000536715.1_Intron|HECTD2_ENST00000446394.1_Intron	NM_182765.3	NP_877497	Q5U5R9	HECD2_HUMAN	HECT domain containing E3 ubiquitin protein ligase 2						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|endometrium(2)|kidney(4)|large_intestine(10)|lung(7)|skin(1)|urinary_tract(1)	27						AGACTTCCTTGATAAGTGAGG	0.388																																					NSCLC(12;376 469 1699 39910 41417)												0																																										SO:0001627	intron_variant	143279			AK094625	CCDS7414.1, CCDS7415.1, CCDS60591.1	10q23.32	2013-09-20	2012-02-23		ENSG00000165338	ENSG00000165338			26736	protein-coding gene	gene with protein product			"""HECT domain containing 2"""			8619474, 9110174	Standard	NM_001284274		Approved	FLJ37306	uc001khl.2	Q5U5R9	OTTHUMG00000018742	ENST00000298068.5:c.1192-1495G>C	10.37:g.93249462G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VZ97|Q5VZ98|Q5VZ99|Q8N1X7|Q8TCP5	RNA	SNP	-	NULL	ENST00000298068.5	37	NULL	CCDS7414.1	10																																																																																			HECTD2	-	-		0.388	HECTD2-005	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD2	HGNC	protein_coding	OTTHUMT00000098620.1	G			93249462	+1	no_errors	ENST00000498446	ensembl	human	known	70_37	rna	SNP	0.000	C
IGDCC3	9543	genome.wustl.edu	37	15	65628166	65628166	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:65628166C>G	ENST00000327987.4	-	3	789	c.538G>C	c.(538-540)Gac>Cac	p.D180H	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	180	Ig-like C2-type 2.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTGTCCGTGTCAATTGGGACT	0.597																																																	0													176.0	163.0	168.0					15																	65628166		2201	4299	6500	SO:0001583	missense	9543			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.538G>C	15.37:g.65628166C>G	ENSP00000332773:p.Asp180His	Somatic		WXS	Illumina HiSeq	Phase_IV	O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D180H	ENST00000327987.4	37	c.538	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473527	0.63737	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.66995	-0.24	5.06	5.06	0.68205	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.199260	0.44097	D	0.000488	T	0.71693	0.3370	L	0.37897	1.145	0.49582	D	0.999801	D	0.59767	0.986	D	0.69307	0.963	T	0.72187	-0.4366	10	0.49607	T	0.09	-29.5445	11.4889	0.50369	0.0:0.9127:0.0:0.0873	.	180	Q8IVU1	IGDC3_HUMAN	H	180;43	ENSP00000332773:D180H	ENSP00000332773:D180H	D	-	1	0	IGDCC3	63415219	0.991000	0.36638	0.993000	0.49108	0.925000	0.55904	2.335000	0.43929	2.340000	0.79590	0.655000	0.94253	GAC	IGDCC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.597	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	C	NM_004884		65628166	-1	no_errors	ENST00000327987	ensembl	human	known	70_37	missense	SNP	1.000	G
IGDCC3	9543	genome.wustl.edu	37	15	65628166	65628166	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:65628166C>G	ENST00000327987.4	-	3	789	c.538G>C	c.(538-540)Gac>Cac	p.D180H	IGDCC3_ENST00000559231.1_5'Flank	NM_004884.3	NP_004875.2	Q8IVU1	IGDC3_HUMAN	immunoglobulin superfamily, DCC subclass, member 3	180	Ig-like C2-type 2.				neuromuscular process controlling balance (GO:0050885)	integral component of plasma membrane (GO:0005887)				breast(1)|endometrium(3)|kidney(3)|large_intestine(7)|lung(9)|ovary(4)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TTGTCCGTGTCAATTGGGACT	0.597																																																	0													176.0	163.0	168.0					15																	65628166		2201	4299	6500	SO:0001583	missense	9543			AF063936	CCDS10205.1	15q22.3-q23	2013-02-11	2009-01-08	2009-01-08	ENSG00000174498	ENSG00000174498		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9700	protein-coding gene	gene with protein product		604184	"""putative neuronal cell adhesion molecule"""	PUNC		9922388	Standard	NM_004884		Approved	HsT18880	uc002aos.2	Q8IVU1	OTTHUMG00000133137	ENST00000327987.4:c.538G>C	15.37:g.65628166C>G	ENSP00000332773:p.Asp180His	Somatic		WXS	Illumina HiSeq	Phase_IV	O95215	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Fibronectin_type3,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.D180H	ENST00000327987.4	37	c.538	CCDS10205.1	15	.	.	.	.	.	.	.	.	.	.	C	17.78	3.473527	0.63737	.	.	ENSG00000174498	ENST00000327987;ENST00000443278	T	0.66995	-0.24	5.06	5.06	0.68205	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.199260	0.44097	D	0.000488	T	0.71693	0.3370	L	0.37897	1.145	0.49582	D	0.999801	D	0.59767	0.986	D	0.69307	0.963	T	0.72187	-0.4366	10	0.49607	T	0.09	-29.5445	11.4889	0.50369	0.0:0.9127:0.0:0.0873	.	180	Q8IVU1	IGDC3_HUMAN	H	180;43	ENSP00000332773:D180H	ENSP00000332773:D180H	D	-	1	0	IGDCC3	63415219	0.991000	0.36638	0.993000	0.49108	0.925000	0.55904	2.335000	0.43929	2.340000	0.79590	0.655000	0.94253	GAC	IGDCC3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.597	IGDCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGDCC3	HGNC	protein_coding	OTTHUMT00000256826.1	C	NM_004884		65628166	-1	no_errors	ENST00000327987	ensembl	human	known	70_37	missense	SNP	1.000	G
KCNQ1	3784	genome.wustl.edu	37	11	2714892	2714892	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:2714892C>T	ENST00000155840.5	+	11	1622				KCNQ1OT1_ENST00000597346.1_RNA|KCNQ1_ENST00000335475.5_Intron	NM_000218.2	NP_000209.2	P51787	KCNQ1_HUMAN	potassium voltage-gated channel, KQT-like subfamily, member 1						atrial cardiac muscle cell action potential (GO:0086014)|cardiac muscle contraction (GO:0060048)|cardiovascular system development (GO:0072358)|cellular response to cAMP (GO:0071320)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|gene silencing (GO:0016458)|male gonad development (GO:0008584)|membrane repolarization during action potential (GO:0086011)|membrane repolarization during cardiac muscle cell action potential (GO:0086013)|negative regulation of insulin secretion (GO:0046676)|positive regulation of gastric acid secretion (GO:0060454)|positive regulation of potassium ion transmembrane transport (GO:1901381)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|regulation of atrial cardiac muscle cell membrane repolarization (GO:0060372)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of heart contraction (GO:0008016)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of membrane repolarization (GO:0060306)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|sensory perception of sound (GO:0007605)|synaptic transmission (GO:0007268)|ventricular cardiac muscle cell action potential (GO:0086005)	basolateral plasma membrane (GO:0016323)|early endosome (GO:0005769)|late endosome (GO:0005770)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated potassium channel complex (GO:0008076)|zymogen granule membrane (GO:0042589)	calmodulin binding (GO:0005516)|delayed rectifier potassium channel activity (GO:0005251)|ion channel binding (GO:0044325)|outward rectifier potassium channel activity (GO:0015271)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|protein phosphatase 1 binding (GO:0008157)|scaffold protein binding (GO:0097110)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated potassium channel activity involved in atrial cardiac muscle cell action potential repolarization (GO:0086089)|voltage-gated potassium channel activity involved in cardiac muscle cell action potential repolarization (GO:0086008)|voltage-gated potassium channel activity involved in ventricular cardiac muscle cell action potential repolarization (GO:1902282)			endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)	21		all_epithelial(84;3.26e-05)|Breast(177;0.001)|Medulloblastoma(188;0.00111)|Ovarian(85;0.00158)|all_neural(188;0.00725)|all_lung(207;0.11)|Lung NSC(207;0.159)		BRCA - Breast invasive adenocarcinoma(625;0.00251)|Lung(200;0.131)	Bepridil(DB01244)|Indapamide(DB00808)	CTTTTAGTTCCGCAGACAGAG	0.547																																																	0																																										SO:0001627	intron_variant	10984			AF000571	CCDS7736.1	11p15.5	2014-09-17			ENSG00000053918	ENSG00000053918		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6294	protein-coding gene	gene with protein product	"""Jervell and Lange-Nielsen syndrome 1"""	607542		LQT, KCNA9		8528244, 16382104	Standard	NM_181798		Approved	Kv7.1, KCNA8, KVLQT1, JLNS1, LQT1	uc001lwn.3	P51787	OTTHUMG00000009900	ENST00000155840.5:c.1514+31581C>T	11.37:g.2714892C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00347|O60607|O94787|Q14D14|Q7Z6G9|Q92960|Q9UMN8|Q9UMN9	RNA	SNP	-	NULL	ENST00000155840.5	37	NULL	CCDS7736.1	11																																																																																			KCNQ1OT1	-	-		0.547	KCNQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNQ1OT1	HGNC	protein_coding	OTTHUMT00000027382.2	C	NM_000218		2714892	-1	no_errors	ENST00000597346	ensembl	human	known	70_37	rna	SNP	0.000	T
KRT7	3855	genome.wustl.edu	37	12	52641573	52641573	+	Intron	SNP	C	C	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:52641573C>A	ENST00000331817.5	+	8	1388				KRT121P_ENST00000529785.1_RNA|KRT86_ENST00000544024.1_5'Flank|RP3-416H24.1_ENST00000546686.1_RNA|KRT7_ENST00000552322.1_Intron	NM_005556.3	NP_005547.3	P08729	K2C7_HUMAN	keratin 7						viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|keratin filament (GO:0045095)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|prostate(2)|stomach(1)|urinary_tract(1)	14				BRCA - Breast invasive adenocarcinoma(357;0.105)	Primaquine(DB01087)	TTTTATGATACGGTGAGGAAA	0.408																																																	0																																										SO:0001627	intron_variant	3855				CCDS8822.1	12q13.13	2013-01-16			ENSG00000135480	ENSG00000135480		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6445	protein-coding gene	gene with protein product	"""keratin, type II cytoskeletal 7"", ""cytokeratin 7"", ""sarcolectin"", ""keratin, 55K type II cytoskeletal"""	148059				1713141, 16831889	Standard	XR_245927		Approved	K7, CK7, K2C7, SCL	uc001saa.1	P08729	OTTHUMG00000169580	ENST00000331817.5:c.1206-388C>A	12.37:g.52641573C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q92676|Q9BUD8|Q9Y3R7	RNA	SNP	-	NULL	ENST00000331817.5	37	NULL	CCDS8822.1	12																																																																																			KRT7	-	-		0.408	KRT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT7	HGNC	protein_coding	OTTHUMT00000404897.1	C	NM_005556		52641573	+1	no_errors	ENST00000550153	ensembl	human	putative	70_37	rna	SNP	0.016	A
LAMA5	3911	genome.wustl.edu	37	20	60901971	60901971	+	Missense_Mutation	SNP	G	G	A	rs375141745		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr20:60901971G>A	ENST00000252999.3	-	39	5230	c.5164C>T	c.(5164-5166)Cgg>Tgg	p.R1722W		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1722	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ACATCTCCCCGCTGGGTCTCT	0.627																																																	0								G	TRP/ARG	0,4406		0,0,2203	134.0	116.0	122.0		5164	4.2	1.0	20		122	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMA5	NM_005560.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1722/3696	60901971	1,13005	2203	4300	6503	SO:0001583	missense	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5164C>T	20.37:g.60901971G>A	ENSP00000252999:p.Arg1722Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.R1722W	ENST00000252999.3	37	c.5164	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794695	0.31777	0.0	1.16E-4	ENSG00000130702	ENST00000252999	T	0.22336	1.96	5.12	4.16	0.48862	Laminin B type IV (2);Laminin B, subgroup (1);	0.054041	0.64402	D	0.000001	T	0.47985	0.1475	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.51332	-0.8719	10	0.72032	D	0.01	.	8.7148	0.34405	0.0:0.1225:0.5793:0.2982	.	1722	O15230	LAMA5_HUMAN	W	1722	ENSP00000252999:R1722W	ENSP00000252999:R1722W	R	-	1	2	LAMA5	60335366	1.000000	0.71417	0.969000	0.41365	0.003000	0.03518	1.831000	0.39141	1.142000	0.42291	-0.315000	0.08773	CGG	LAMA5	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV		0.627	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	G	NM_005560		60901971	-1	no_errors	ENST00000252999	ensembl	human	known	70_37	missense	SNP	0.995	A
LAMA5	3911	genome.wustl.edu	37	20	60901971	60901971	+	Missense_Mutation	SNP	G	G	A	rs375141745		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr20:60901971G>A	ENST00000252999.3	-	39	5230	c.5164C>T	c.(5164-5166)Cgg>Tgg	p.R1722W		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5	1722	Laminin IV type A. {ECO:0000255|PROSITE- ProRule:PRU00458}.				angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			ACATCTCCCCGCTGGGTCTCT	0.627																																																	0								G	TRP/ARG	0,4406		0,0,2203	134.0	116.0	122.0		5164	4.2	1.0	20		122	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMA5	NM_005560.3	101	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	1722/3696	60901971	1,13005	2203	4300	6503	SO:0001583	missense	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.5164C>T	20.37:g.60901971G>A	ENSP00000252999:p.Arg1722Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.R1722W	ENST00000252999.3	37	c.5164	CCDS33502.1	20	.	.	.	.	.	.	.	.	.	.	G	11.96	1.794695	0.31777	0.0	1.16E-4	ENSG00000130702	ENST00000252999	T	0.22336	1.96	5.12	4.16	0.48862	Laminin B type IV (2);Laminin B, subgroup (1);	0.054041	0.64402	D	0.000001	T	0.47985	0.1475	M	0.86953	2.85	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.51332	-0.8719	10	0.72032	D	0.01	.	8.7148	0.34405	0.0:0.1225:0.5793:0.2982	.	1722	O15230	LAMA5_HUMAN	W	1722	ENSP00000252999:R1722W	ENSP00000252999:R1722W	R	-	1	2	LAMA5	60335366	1.000000	0.71417	0.969000	0.41365	0.003000	0.03518	1.831000	0.39141	1.142000	0.42291	-0.315000	0.08773	CGG	LAMA5	-	pfam_Laminin_B_type_IV,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV		0.627	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	G	NM_005560		60901971	-1	no_errors	ENST00000252999	ensembl	human	known	70_37	missense	SNP	0.995	A
LINC00521	256369	genome.wustl.edu	37	14	94477664	94477664	+	IGR	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:94477664G>T								LINC00521 (3766 upstream) : OTUB2 (15010 downstream)																							CACCTGTCGTGCTTGATCTAG	0.552																																																	0																																										SO:0001628	intergenic_variant	256369																															14.37:g.94477664G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		14																																																																																			LINC00521	-	-	0	0.552					LINC00521	HGNC			G			94477664	+1	no_errors	ENST00000314629	ensembl	human	known	70_37	rna	SNP	0.010	T
LINC00669	647946	genome.wustl.edu	37	18	37380143	37380143	+	lincRNA	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr18:37380143G>C	ENST00000591629.1	-	0	139					NR_024391.1				long intergenic non-protein coding RNA 669																		caggctcgcagatgatttaaa	0.483																																																	0																																												647946			AK090603, BG220862, DB038664		18q12.2-q12.3	2012-10-12				ENSG00000267374		"""Long non-coding RNAs"""	44332	non-coding RNA	RNA, long non-coding							Standard	NR_024391		Approved		uc002lak.1				18.37:g.37380143G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000591629.1	37	NULL		18																																																																																			LINC00669	-	-		0.483	LINC00669-001	KNOWN	basic	lincRNA	LINC00669	HGNC	lincRNA	OTTHUMT00000441462.1	G	NR_024391		37380143	-1	no_errors	ENST00000591629	ensembl	human	known	70_37	rna	SNP	0.009	C
RP11-12M5.1	0	genome.wustl.edu	37	1	179699400	179699400	+	lincRNA	SNP	G	G	C	rs577446359		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:179699400G>C	ENST00000423879.1	+	0	49																											TGAAGGCTAAGAAATGATTTC	0.507													G|||	1	0.000199681	0.0008	0.0	5008	,	,		22049	0.0		0.0	False		,,,				2504	0.0																0																																												100506206																															1.37:g.179699400G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000423879.1	37	NULL		1																																																																																			RP11-12M5.1	-	-		0.507	RP11-12M5.1-001	KNOWN	basic	lincRNA	LOC100506206	Clone_based_vega_gene	lincRNA	OTTHUMT00000085298.1	G			179699400	+1	no_errors	ENST00000423879	ensembl	human	known	70_37	rna	SNP	0.004	C
LOC100506272	100506272	genome.wustl.edu	37	4	188476232	188476232	+	lincRNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr4:188476232C>T	ENST00000515660.1	-	0	240																											TGGTGACATGCGTGAGTTGGT	0.498																																																	0																																												100506272																															4.37:g.188476232C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000515660.1	37	NULL		4																																																																																			RP11-565A3.2	-	-		0.498	RP11-565A3.2-002	KNOWN	basic|exp_conf	lincRNA	LOC100506272	Clone_based_vega_gene	lincRNA	OTTHUMT00000360139.1	C			188476232	-1	no_errors	ENST00000515660	ensembl	human	known	70_37	rna	SNP	0.001	T
SNHG23	100507242	genome.wustl.edu	37	14	101426340	101426340	+	lincRNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr14:101426340C>T	ENST00000556637.1	+	0	748				AL132709.8_ENST00000423708.3_lincRNA|SNORD114-6_ENST00000364393.1_RNA																							ggagaaaccccgtctctacta	0.532																																																	0																																												100507242																															14.37:g.101426340C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000556637.1	37	NULL		14																																																																																			AL132709.5	-	-		0.532	AL132709.5-004	KNOWN	basic	lincRNA	LOC100507242	Clone_based_vega_gene	lincRNA	OTTHUMT00000414510.1	C			101426340	+1	no_errors	ENST00000443252	ensembl	human	known	70_37	rna	SNP	0.998	T
LINC00937	389634	genome.wustl.edu	37	12	8539755	8539756	+	lincRNA	INS	-	-	TGG	rs140048493|rs563335344		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:8539755_8539756insTGG	ENST00000544461.1	-	0	1081									long intergenic non-protein coding RNA 937																		GCCAAGATGCCTGGTCTTGGGG	0.52																																																	0																																												389634			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8539756_8539758dupTGG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			RP11-90D4.2	-	-		0.520	LINC00937-001	KNOWN	basic	lincRNA	LOC389634	Clone_based_vega_gene	lincRNA	OTTHUMT00000400511.1	-			8539756	-1	no_errors	ENST00000538304	ensembl	human	known	70_37	rna	INS	0.141:0.141	TGG
LRRC74B	400891	genome.wustl.edu	37	22	21416350	21416350	+	3'UTR	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr22:21416350C>T	ENST00000497328.1	+	0	2696				AC002472.13_ENST00000342608.4_3'UTR|AC002472.13_ENST00000543388.1_3'UTR																lung(2)	2						atgctgaaaacgggtgaaact	0.423																																																	0																																										SO:0001624	3_prime_UTR_variant	400891																														ENST00000497328.1:c.*2693C>T	22.37:g.21416350C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000497328.1	37	NULL		22																																																																																			AC002472.13	-	-		0.423	AC002472.13-001	KNOWN	basic	processed_transcript	LOC400891	Clone_based_vega_gene	protein_coding	OTTHUMT00000320470.1	C			21416350	+1	no_errors	ENST00000473769	ensembl	human	known	70_37	rna	SNP	0.002	T
LRP1B	53353	genome.wustl.edu	37	2	141032110	141032110	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:141032110C>T	ENST00000389484.3	-	85	13996	c.13025G>A	c.(13024-13026)aGt>aAt	p.S4342N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4342	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.S4342N(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACATTCAACACTTCCATCATC	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	lung(1)											155.0	125.0	135.0					2																	141032110		2203	4300	6503	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13025G>A	2.37:g.141032110C>T	ENSP00000374135:p.Ser4342Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S4342N	ENST00000389484.3	37	c.13025	CCDS2182.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.03|15.03	2.712859|2.712859	0.48517|0.48517	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977;ENST00000442974	D|.	0.90732|.	-2.72|.	5.36|5.36	3.38|3.38	0.38709|0.38709	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);|.	0.379661|.	0.27275|.	U|.	0.020110|.	T|T	0.22126|0.22126	0.0533|0.0533	N|N	0.14661|0.14661	0.345|0.345	0.22446|0.22446	N|N	0.999099|0.999099	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.18681|0.18681	-1.0329|-1.0329	10|5	0.13853|.	T|.	0.58|.	.|.	8.2943|8.2943	0.31976|0.31976	0.0:0.6191:0.3005:0.0805|0.0:0.6191:0.3005:0.0805	.|.	4342|.	Q9NZR2|.	LRP1B_HUMAN|.	N|M	4342;4280|574;74	ENSP00000374135:S4342N|.	ENSP00000374135:S4342N|.	S|V	-|-	2|1	0|0	LRP1B|LRP1B	140748580|140748580	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.256000|1.256000	0.32921|0.32921	1.189000|1.189000	0.43028|0.43028	0.655000|0.655000	0.94253|0.94253	AGT|GTG	LRP1B	-	smart_EG-like_dom,pfscan_EG-like_dom		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	C	NM_018557		141032110	-1	no_errors	ENST00000389484	ensembl	human	known	70_37	missense	SNP	0.863	T
LRP1B	53353	genome.wustl.edu	37	2	141032110	141032110	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:141032110C>T	ENST00000389484.3	-	85	13996	c.13025G>A	c.(13024-13026)aGt>aAt	p.S4342N		NM_018557.2	NP_061027.2	Q9NZR2	LRP1B_HUMAN	low density lipoprotein receptor-related protein 1B	4342	EGF-like 20. {ECO:0000255|PROSITE- ProRule:PRU00076}.				protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)	integral component of membrane (GO:0016021)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)|low-density lipoprotein receptor activity (GO:0005041)	p.S4342N(1)		NS(5)|autonomic_ganglia(1)|biliary_tract(1)|breast(3)|central_nervous_system(7)|endometrium(25)|haematopoietic_and_lymphoid_tissue(10)|kidney(27)|large_intestine(98)|liver(4)|lung(337)|ovary(15)|pancreas(6)|prostate(11)|skin(30)|stomach(2)|upper_aerodigestive_tract(19)|urinary_tract(5)	606		all_cancers(3;1.1e-60)|all_epithelial(3;1.94e-59)|all_lung(3;1.09e-24)|Lung NSC(3;5.65e-24)|Esophageal squamous(3;5.41e-13)|Renal(3;0.000147)|Breast(3;0.000527)|Hepatocellular(3;0.011)|all_neural(3;0.014)|Colorectal(150;0.101)		UCEC - Uterine corpus endometrioid carcinoma (2;0.00139)|Epithelial(1;1.25e-24)|all cancers(1;8.86e-24)|OV - Ovarian serous cystadenocarcinoma(1;2.45e-12)|LUSC - Lung squamous cell carcinoma(1;2.97e-10)|Lung(1;6.05e-09)|BRCA - Breast invasive adenocarcinoma(221;0.0103)		ACATTCAACACTTCCATCATC	0.408										TSP Lung(27;0.18)																											Colon(99;50 2074 2507 20106)												1	Substitution - Missense(1)	lung(1)											155.0	125.0	135.0					2																	141032110		2203	4300	6503	SO:0001583	missense	53353			AF176832	CCDS2182.1	2q21.2	2013-05-29	2010-01-26		ENSG00000168702	ENSG00000168702		"""Low density lipoprotein receptors"""	6693	protein-coding gene	gene with protein product	"""LRP-deleted in tumors"""	608766				10766186	Standard	NM_018557		Approved	LRP-DIT, LRPDIT	uc002tvj.1	Q9NZR2	OTTHUMG00000131799	ENST00000389484.3:c.13025G>A	2.37:g.141032110C>T	ENSP00000374135:p.Ser4342Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WY29|Q8WY30|Q8WY31	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,pfam_EG-like_dom,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S4342N	ENST00000389484.3	37	c.13025	CCDS2182.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.03|15.03	2.712859|2.712859	0.48517|0.48517	.|.	.|.	ENSG00000168702|ENSG00000168702	ENST00000389484;ENST00000544579|ENST00000437977;ENST00000442974	D|.	0.90732|.	-2.72|.	5.36|5.36	3.38|3.38	0.38709|0.38709	Epidermal growth factor-like (1);Epidermal growth factor-like, type 3 (1);|.	0.379661|.	0.27275|.	U|.	0.020110|.	T|T	0.22126|0.22126	0.0533|0.0533	N|N	0.14661|0.14661	0.345|0.345	0.22446|0.22446	N|N	0.999099|0.999099	B|.	0.02656|.	0.0|.	B|.	0.04013|.	0.001|.	T|T	0.18681|0.18681	-1.0329|-1.0329	10|5	0.13853|.	T|.	0.58|.	.|.	8.2943|8.2943	0.31976|0.31976	0.0:0.6191:0.3005:0.0805|0.0:0.6191:0.3005:0.0805	.|.	4342|.	Q9NZR2|.	LRP1B_HUMAN|.	N|M	4342;4280|574;74	ENSP00000374135:S4342N|.	ENSP00000374135:S4342N|.	S|V	-|-	2|1	0|0	LRP1B|LRP1B	140748580|140748580	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	1.256000|1.256000	0.32921|0.32921	1.189000|1.189000	0.43028|0.43028	0.655000|0.655000	0.94253|0.94253	AGT|GTG	LRP1B	-	smart_EG-like_dom,pfscan_EG-like_dom		0.408	LRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1B	HGNC	protein_coding	OTTHUMT00000254736.2	C	NM_018557		141032110	-1	no_errors	ENST00000389484	ensembl	human	known	70_37	missense	SNP	0.863	T
MAP2K2	5605	genome.wustl.edu	37	19	4099776	4099776	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:4099776C>T	ENST00000262948.5	-	7	959				MAP2K2_ENST00000394867.4_Intron|MAP2K2_ENST00000599345.1_5'Flank	NM_030662.3	NP_109587.1	P36507	MP2K2_HUMAN	mitogen-activated protein kinase kinase 2						activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|axon guidance (GO:0007411)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|MAPK cascade (GO:0000165)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine autophosphorylation (GO:0036289)|positive regulation of cell motility (GO:2000147)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|Ras protein signal transduction (GO:0007265)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of stress-activated MAPK cascade (GO:0032872)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|PDZ domain binding (GO:0030165)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)|scaffold protein binding (GO:0097110)						Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0149)|STAD - Stomach adenocarcinoma(1328;0.18)	Bosutinib(DB06616)|Trametinib(DB08911)	AATCCCCAGTCGTTTCCTGAA	0.547																																																	0																																										SO:0001627	intron_variant	5605			L11285	CCDS12120.1	19p13.3	2014-09-17			ENSG00000126934	ENSG00000126934	2.7.12.2	"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6842	protein-coding gene	gene with protein product		601263		PRKMK2		8388392	Standard	NM_030662		Approved	MEK2	uc002lzk.3	P36507	OTTHUMG00000134286	ENST00000262948.5:c.706-364G>A	19.37:g.4099776C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000262948.5	37	NULL	CCDS12120.1	19																																																																																			MAP2K2	-	-		0.547	MAP2K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K2	HGNC	protein_coding	OTTHUMT00000258957.2	C			4099776	-1	no_errors	ENST00000595715	ensembl	human	known	70_37	rna	SNP	0.000	T
MAPKAPK2	9261	genome.wustl.edu	37	1	206902307	206902307	+	Intron	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:206902307G>C	ENST00000367103.3	+	3	612				MAPKAPK2_ENST00000294981.4_Intron	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2						3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GTAAACACTTGATTTTTTGGG	0.557																																																	0																																										SO:0001627	intron_variant	9261			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.420-73G>C	1.37:g.206902307G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SY30|Q5SY41|Q8IYD6	RNA	SNP	-	NULL	ENST00000367103.3	37	NULL	CCDS31001.1	1																																																																																			MAPKAPK2	-	-		0.557	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPKAPK2	HGNC	protein_coding	OTTHUMT00000088465.1	G	NM_004759		206902307	+1	no_errors	ENST00000493447	ensembl	human	putative	70_37	rna	SNP	0.000	C
MAPKAPK2	9261	genome.wustl.edu	37	1	206902307	206902307	+	Intron	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:206902307G>C	ENST00000367103.3	+	3	612				MAPKAPK2_ENST00000294981.4_Intron	NM_004759.4|NM_032960.3	NP_004750.1|NP_116584.2	P49137	MAPK2_HUMAN	mitogen-activated protein kinase-activated protein kinase 2						3'-UTR-mediated mRNA stabilization (GO:0070935)|activation of MAPK activity (GO:0000187)|arachidonic acid metabolic process (GO:0019369)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|G2 DNA damage checkpoint (GO:0031572)|gene expression (GO:0010467)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|leukotriene metabolic process (GO:0006691)|macropinocytosis (GO:0044351)|MAPK cascade (GO:0000165)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|Ras protein signal transduction (GO:0007265)|regulation of interleukin-6 production (GO:0032675)|regulation of tumor necrosis factor production (GO:0032680)|response to cytokine (GO:0034097)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(8)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	19	Breast(84;0.183)		BRCA - Breast invasive adenocarcinoma(75;0.211)			GTAAACACTTGATTTTTTGGG	0.557																																																	0																																										SO:0001627	intron_variant	9261			U12779	CCDS1466.1, CCDS31001.1	1q32	2008-02-05			ENSG00000162889	ENSG00000162889			6887	protein-coding gene	gene with protein product		602006				8179591, 8280084	Standard	NM_004759		Approved		uc001hem.2	P49137	OTTHUMG00000036342	ENST00000367103.3:c.420-73G>C	1.37:g.206902307G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SY30|Q5SY41|Q8IYD6	RNA	SNP	-	NULL	ENST00000367103.3	37	NULL	CCDS31001.1	1																																																																																			MAPKAPK2	-	-		0.557	MAPKAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAPKAPK2	HGNC	protein_coding	OTTHUMT00000088465.1	G	NM_004759		206902307	+1	no_errors	ENST00000493447	ensembl	human	putative	70_37	rna	SNP	0.000	C
MIOX	55586	genome.wustl.edu	37	22	50928004	50928004	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr22:50928004C>T	ENST00000216075.6	+	9	754	c.680C>T	c.(679-681)aCg>aTg	p.T227M	MIOX_ENST00000395732.3_Missense_Mutation_p.T227M|MIOX_ENST00000395733.3_Intron	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	227					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCTGGCACACGGGCCGCGAC	0.672																																																	0													27.0	27.0	27.0					22																	50928004		2201	4298	6499	SO:0001583	missense	55586			AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.680C>T	22.37:g.50928004C>T	ENSP00000216075:p.Thr227Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Missense_Mutation	SNP	pfam_Inositol_oxygenase	p.T227M	ENST00000216075.6	37	c.680	CCDS14092.1	22	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972160	0.53614	.	.	ENSG00000100253	ENST00000216075;ENST00000395732;ENST00000451761	.	.	.	5.22	3.03	0.35002	.	0.385387	0.28933	N	0.013667	T	0.50222	0.1603	M	0.76838	2.35	0.31793	N	0.629443	P;D	0.54772	0.935;0.968	P;P	0.45276	0.475;0.454	T	0.61992	-0.6948	9	0.51188	T	0.08	-21.3394	9.9461	0.41609	0.1567:0.6922:0.1511:0.0	.	227;227	A6PVH2;Q9UGB7	.;MIOX_HUMAN	M	227;227;207	.	ENSP00000216075:T227M	T	+	2	0	MIOX	49274870	1.000000	0.71417	0.859000	0.33776	0.423000	0.31445	4.455000	0.60075	0.527000	0.28560	0.655000	0.94253	ACG	MIOX	-	pfam_Inositol_oxygenase		0.672	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOX	HGNC	protein_coding	OTTHUMT00000316835.1	C	NM_017584		50928004	+1	no_errors	ENST00000216075	ensembl	human	known	70_37	missense	SNP	0.990	T
MIOX	55586	genome.wustl.edu	37	22	50928004	50928004	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr22:50928004C>T	ENST00000216075.6	+	9	754	c.680C>T	c.(679-681)aCg>aTg	p.T227M	MIOX_ENST00000395732.3_Missense_Mutation_p.T227M|MIOX_ENST00000395733.3_Intron	NM_017584.5	NP_060054.4	Q9UGB7	MIOX_HUMAN	myo-inositol oxygenase	227					inositol catabolic process (GO:0019310)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|inclusion body (GO:0016234)	aldo-keto reductase (NADP) activity (GO:0004033)|ferric iron binding (GO:0008199)|inositol oxygenase activity (GO:0050113)|NADP binding (GO:0050661)|oxidoreductase activity, acting on NAD(P)H (GO:0016651)|oxidoreductase activity, acting on single donors with incorporation of molecular oxygen (GO:0016701)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	13		all_cancers(38;4.58e-14)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		CCCTGGCACACGGGCCGCGAC	0.672																																																	0													27.0	27.0	27.0					22																	50928004		2201	4298	6499	SO:0001583	missense	55586			AF197129	CCDS14092.1	22q13.3	2008-06-11	2005-06-15	2005-06-15	ENSG00000100253	ENSG00000100253			14522	protein-coding gene	gene with protein product	"""kidney-specific protein 32"""	606774	"""aldehyde reductase (aldose reductase) like 6"""	ALDRL6		10944187, 11716759	Standard	NM_017584		Approved		uc003bll.1	Q9UGB7	OTTHUMG00000150207	ENST00000216075.6:c.680C>T	22.37:g.50928004C>T	ENSP00000216075:p.Thr227Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05DJ6|Q5S8C9|Q9BZZ1|Q9UHB8	Missense_Mutation	SNP	pfam_Inositol_oxygenase	p.T227M	ENST00000216075.6	37	c.680	CCDS14092.1	22	.	.	.	.	.	.	.	.	.	.	C	15.91	2.972160	0.53614	.	.	ENSG00000100253	ENST00000216075;ENST00000395732;ENST00000451761	.	.	.	5.22	3.03	0.35002	.	0.385387	0.28933	N	0.013667	T	0.50222	0.1603	M	0.76838	2.35	0.31793	N	0.629443	P;D	0.54772	0.935;0.968	P;P	0.45276	0.475;0.454	T	0.61992	-0.6948	9	0.51188	T	0.08	-21.3394	9.9461	0.41609	0.1567:0.6922:0.1511:0.0	.	227;227	A6PVH2;Q9UGB7	.;MIOX_HUMAN	M	227;227;207	.	ENSP00000216075:T227M	T	+	2	0	MIOX	49274870	1.000000	0.71417	0.859000	0.33776	0.423000	0.31445	4.455000	0.60075	0.527000	0.28560	0.655000	0.94253	ACG	MIOX	-	pfam_Inositol_oxygenase		0.672	MIOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIOX	HGNC	protein_coding	OTTHUMT00000316835.1	C	NM_017584		50928004	+1	no_errors	ENST00000216075	ensembl	human	known	70_37	missense	SNP	0.990	T
MSRB2	22921	genome.wustl.edu	37	10	23384576	23384576	+	Silent	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr10:23384576C>T	ENST00000376510.3	+	1	142	c.39C>T	c.(37-39)ctC>ctT	p.L13L		NM_012228.3	NP_036360.3	Q9Y3D2	MSRB2_HUMAN	methionine sulfoxide reductase B2	13					actin filament polymerization (GO:0030041)|protein repair (GO:0030091)|regulation of transcription, DNA-templated (GO:0006355)|response to oxidative stress (GO:0006979)	mitochondrion (GO:0005739)	actin binding (GO:0003779)|peptide-methionine (R)-S-oxide reductase activity (GO:0033743)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	9					L-Methionine(DB00134)	GCCTGACCCTCGGAACTGCGC	0.791																																					Esophageal Squamous(89;1240 1363 4973 30188 42299)												0													2.0	4.0	3.0					10																	23384576		1171	2786	3957	SO:0001819	synonymous_variant	22921			AF122004	CCDS41495.1	10p12	2004-12-07	2004-12-06	2004-12-07	ENSG00000148450	ENSG00000148450			17061	protein-coding gene	gene with protein product		613782	"""methionine sulfoxide reductase B"""	MSRB		8749308, 10375640	Standard	NM_012228		Approved	PILB, CGI-131, CBS1, CBS-1	uc001iro.3	Q9Y3D2	OTTHUMG00000017812	ENST00000376510.3:c.39C>T	10.37:g.23384576C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q17R44|Q4G1C7|Q9Y5W6	Silent	SNP	pfam_Met_Sox_Rdtase_MsrB,superfamily_Mss4-like,tigrfam_Met_Sox_Rdtase_MsrB	p.L13	ENST00000376510.3	37	c.39	CCDS41495.1	10																																																																																			MSRB2	-	NULL		0.791	MSRB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSRB2	HGNC	protein_coding	OTTHUMT00000047205.1	C	NM_012228		23384576	+1	no_errors	ENST00000376510	ensembl	human	known	70_37	silent	SNP	0.001	T
SNTB1	6641	genome.wustl.edu	37	8	121553455	121553455	+	Intron	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:121553455G>A	ENST00000395601.3	-	7	1939				SNTB1_ENST00000517992.1_Intron|MTBP_ENST00000519841.1_3'UTR	NM_021021.3	NP_066301.1	Q13884	SNTB1_HUMAN	syntrophin, beta 1 (dystrophin-associated protein A1, 59kDa, basic component 1)						muscle contraction (GO:0006936)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|focal adhesion (GO:0005925)|protein complex (GO:0043234)|synapse (GO:0045202)				NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(10)|prostate(2)|skin(6)	24	Lung NSC(37;4.46e-09)|Ovarian(258;0.0254)|Hepatocellular(40;0.0997)		STAD - Stomach adenocarcinoma(47;0.00503)			GCATTGAGACGAGACGTATGT	0.413																																																	0																																										SO:0001627	intron_variant	27085			AF028828	CCDS6334.1	8q23-q24	2013-01-10	2002-08-29		ENSG00000172164	ENSG00000172164		"""Pleckstrin homology (PH) domain containing"""	11168	protein-coding gene	gene with protein product	"""tax interaction protein 43"""	600026	"""syntrophin, beta 1 (dystrophin-associated protein A1, 59kD, basic component 1)"""	SNT2B1		8183929, 9482110	Standard	NM_021021		Approved	59-DAP, A1B, BSYN2, TIP-43, SNT2	uc010mdg.3	Q13884	OTTHUMG00000165041	ENST00000395601.3:c.1524+594C>T	8.37:g.121553455G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9E0|O14912|Q4KMG8	RNA	SNP	-	NULL	ENST00000395601.3	37	NULL	CCDS6334.1	8																																																																																			MTBP	-	-		0.413	SNTB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTBP	HGNC	protein_coding	OTTHUMT00000381535.1	G	NM_021021		121553455	+1	no_errors	ENST00000519841	ensembl	human	known	70_37	rna	SNP	0.000	A
MUC12	10071	genome.wustl.edu	37	7	100641744	100641744	+	Missense_Mutation	SNP	C	C	T	rs200229903	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:100641744C>T	ENST00000379442.3	+	5	8329	c.8329C>T	c.(8329-8331)Cgc>Tgc	p.R2777C	MUC12_ENST00000536621.1_Missense_Mutation_p.R2634C			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	2777	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TACAACCTCACGCATCAGTCC	0.512																																																	0													1.0	1.0	1.0					7																	100641744		260	658	918	SO:0001583	missense	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.8329C>T	7.37:g.100641744C>T	ENSP00000368755:p.Arg2777Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.R2777C	ENST00000379442.3	37	c.8329		7	.	.	.	.	.	.	.	.	.	.	c	4.609	0.113111	0.08831	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.13901	2.55;2.55	0.704	-1.11	0.09840	.	.	.	.	.	T	0.06416	0.0165	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.36792	-0.9733	6	0.49607	T	0.09	.	.	.	.	.	.	.	.	C	2777;2634	ENSP00000368755:R2777C;ENSP00000441929:R2634C	ENSP00000368755:R2777C	R	+	1	0	MUC12	100428464	0.001000	0.12720	0.000000	0.03702	0.010000	0.07245	1.334000	0.33827	-0.301000	0.08882	0.173000	0.16961	CGC	MUC12	-	NULL		0.512	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	C	XM_379904		100641744	+1	no_errors	ENST00000379442	ensembl	human	known	70_37	missense	SNP	0.000	T
MUC17	140453	genome.wustl.edu	37	7	100683521	100683521	+	Missense_Mutation	SNP	G	G	A	rs150470478		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:100683521G>A	ENST00000306151.4	+	3	8888	c.8824G>A	c.(8824-8826)Ggt>Agt	p.G2942S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2942	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.G2942S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCCAGTGGCCGGTTCTGAGGC	0.488																																																	1	Substitution - Missense(1)	lung(1)											218.0	226.0	223.0					7																	100683521		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8824G>A	7.37:g.100683521G>A	ENSP00000302716:p.Gly2942Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.G2942S	ENST00000306151.4	37	c.8824	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	A	2.038	-0.420813	0.04734	.	.	ENSG00000169876	ENST00000306151	T	0.01821	4.62	0.743	-1.49	0.08718	.	.	.	.	.	T	0.00552	0.0018	N	0.03608	-0.345	0.09310	N	1	P	0.36199	0.543	B	0.19666	0.026	T	0.43163	-0.9408	9	0.02654	T	1	.	2.2067	0.03937	0.4066:0.3167:0.2767:0.0	.	2942	Q685J3	MUC17_HUMAN	S	2942	ENSP00000302716:G2942S	ENSP00000302716:G2942S	G	+	1	0	MUC17	100470241	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.209000	0.09358	-2.236000	0.00713	-1.958000	0.00481	GGT	MUC17	-	NULL		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	G	NM_001040105		100683521	+1	no_errors	ENST00000306151	ensembl	human	known	70_37	missense	SNP	0.000	A
MUC17	140453	genome.wustl.edu	37	7	100683521	100683521	+	Missense_Mutation	SNP	G	G	A	rs150470478		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:100683521G>A	ENST00000306151.4	+	3	8888	c.8824G>A	c.(8824-8826)Ggt>Agt	p.G2942S		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2942	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.G2942S(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					GCCAGTGGCCGGTTCTGAGGC	0.488																																																	1	Substitution - Missense(1)	lung(1)											218.0	226.0	223.0					7																	100683521		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.8824G>A	7.37:g.100683521G>A	ENSP00000302716:p.Gly2942Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.G2942S	ENST00000306151.4	37	c.8824	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	A	2.038	-0.420813	0.04734	.	.	ENSG00000169876	ENST00000306151	T	0.01821	4.62	0.743	-1.49	0.08718	.	.	.	.	.	T	0.00552	0.0018	N	0.03608	-0.345	0.09310	N	1	P	0.36199	0.543	B	0.19666	0.026	T	0.43163	-0.9408	9	0.02654	T	1	.	2.2067	0.03937	0.4066:0.3167:0.2767:0.0	.	2942	Q685J3	MUC17_HUMAN	S	2942	ENSP00000302716:G2942S	ENSP00000302716:G2942S	G	+	1	0	MUC17	100470241	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.209000	0.09358	-2.236000	0.00713	-1.958000	0.00481	GGT	MUC17	-	NULL		0.488	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	G	NM_001040105		100683521	+1	no_errors	ENST00000306151	ensembl	human	known	70_37	missense	SNP	0.000	A
MUC4	4585	genome.wustl.edu	37	3	195512882	195512882	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr3:195512882G>C	ENST00000463781.3	-	2	6028	c.5569C>G	c.(5569-5571)Ctt>Gtt	p.L1857V	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000346145.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.L1857V	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)			NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		GTGACAGGAAGAGAGGTGGTG	0.577																																																	0													65.0	53.0	56.0					3																	195512882		691	1591	2282	SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.5569C>G	3.37:g.195512882G>C	ENSP00000417498:p.Leu1857Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.L1857V	ENST00000463781.3	37	c.5569	CCDS54700.1	3	.	.	.	.	.	.	.	.	.	.	-	2.374	-0.343765	0.05208	.	.	ENSG00000145113	ENST00000463781;ENST00000475231	T;T	0.54866	0.7;0.55	0.423	-0.846	0.10734	.	0.000000	0.23012	U	0.052950	T	0.23806	0.0576	N	0.19112	0.55	0.09310	N	1	P	0.38110	0.618	B	0.25759	0.063	T	0.18935	-1.0321	9	.	.	.	.	4.7243	0.12933	1.0E-4:0.0:0.647:0.3529	.	1857	E7ESK3	.	V	1857	ENSP00000417498:L1857V;ENSP00000420243:L1857V	.	L	-	1	0	MUC4	196997277	0.003000	0.15002	0.000000	0.03702	0.009000	0.06853	0.192000	0.17096	-0.784000	0.04528	0.089000	0.15464	CTT	MUC4	-	NULL		0.577	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	G	NM_018406		195512882	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.000	C
MYCBP2	23077	genome.wustl.edu	37	13	77834572	77834572	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:77834572C>T	ENST00000544440.2	-	13	1911	c.1894G>A	c.(1894-1896)Gat>Aat	p.D632N	MYCBP2_ENST00000407578.2_Missense_Mutation_p.D670N|MYCBP2_ENST00000357337.6_Missense_Mutation_p.D632N|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTTGAACTATCAGAGTAAATG	0.303																																																	0													80.0	79.0	79.0					13																	77834572		2202	4295	6497	SO:0001583	missense	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1894G>A	13.37:g.77834572C>T	ENSP00000444596:p.Asp632Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.D670N	ENST00000544440.2	37	c.2008		13	.	.	.	.	.	.	.	.	.	.	C	32	5.159599	0.94686	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.80214	-1.35;-1.35;-1.35	5.7	5.7	0.88788	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.87325	0.6149	L	0.47716	1.5	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	D	0.87504	0.2435	10	0.66056	D	0.02	.	19.8407	0.96681	0.0:1.0:0.0:0.0	.	632	O75592	MYCB2_HUMAN	N	632;670;632	ENSP00000349892:D632N;ENSP00000384288:D670N;ENSP00000444596:D632N	ENSP00000349892:D632N	D	-	1	0	MYCBP2	76732573	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.677000	0.91161	0.650000	0.86243	GAT	MYCBP2	-	superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_ARM-type_fold		0.303	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	C	NM_015057		77834572	-1	no_errors	ENST00000407578	ensembl	human	known	70_37	missense	SNP	1.000	T
MYCBP2	23077	genome.wustl.edu	37	13	77834572	77834572	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:77834572C>T	ENST00000544440.2	-	13	1911	c.1894G>A	c.(1894-1896)Gat>Aat	p.D632N	MYCBP2_ENST00000407578.2_Missense_Mutation_p.D670N|MYCBP2_ENST00000357337.6_Missense_Mutation_p.D632N|MYCBP2_ENST00000360084.5_5'UTR					MYC binding protein 2, E3 ubiquitin protein ligase											NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(51)|ovary(5)|pancreas(2)|prostate(5)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	118		Breast(118;0.212)|Acute lymphoblastic leukemia(28;0.22)		GBM - Glioblastoma multiforme(99;0.109)		CTTGAACTATCAGAGTAAATG	0.303																																																	0													80.0	79.0	79.0					13																	77834572		2202	4295	6497	SO:0001583	missense	23077			AB020723		13q22	2012-02-23	2012-02-23		ENSG00000005810	ENSG00000005810			23386	protein-coding gene	gene with protein product		610392	"""MYC binding protein 2"""			9689053, 15057823	Standard	NM_015057		Approved	PAM, KIAA0916, FLJ10106	uc021rks.1	O75592	OTTHUMG00000017105	ENST00000544440.2:c.1894G>A	13.37:g.77834572C>T	ENSP00000444596:p.Asp632Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_PHR,pfam_Reg_chr_condens,pfam_Filamin/ABP280_repeat-like,superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_Galactose-bd-like,superfamily_Ig_E-set,superfamily_ARM-type_fold,smart_Znf_RING,pfscan_Filamin/ABP280_repeat-like,pfscan_Znf_RING,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.D670N	ENST00000544440.2	37	c.2008		13	.	.	.	.	.	.	.	.	.	.	C	32	5.159599	0.94686	.	.	ENSG00000005810	ENST00000357337;ENST00000407578;ENST00000544440	T;T;T	0.80214	-1.35;-1.35;-1.35	5.7	5.7	0.88788	Regulator of chromosome condensation/beta-lactamase-inhibitor protein II (2);	0.000000	0.85682	D	0.000000	D	0.87325	0.6149	L	0.47716	1.5	0.80722	D	1	D	0.63880	0.993	D	0.70935	0.971	D	0.87504	0.2435	10	0.66056	D	0.02	.	19.8407	0.96681	0.0:1.0:0.0:0.0	.	632	O75592	MYCB2_HUMAN	N	632;670;632	ENSP00000349892:D632N;ENSP00000384288:D670N;ENSP00000444596:D632N	ENSP00000349892:D632N	D	-	1	0	MYCBP2	76732573	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.677000	0.91161	0.650000	0.86243	GAT	MYCBP2	-	superfamily_Reg_csome_cond/b-lactamase_inh,superfamily_ARM-type_fold		0.303	MYCBP2-001	KNOWN	basic	protein_coding	MYCBP2	HGNC	protein_coding	OTTHUMT00000045326.1	C	NM_015057		77834572	-1	no_errors	ENST00000407578	ensembl	human	known	70_37	missense	SNP	1.000	T
MYH8	4626	genome.wustl.edu	37	17	10304411	10304411	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:10304411G>T	ENST00000403437.2	-	25	3300	c.3206C>A	c.(3205-3207)aCa>aAa	p.T1069K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1069					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CATATCCATTGTGGATTCTTG	0.388									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0													141.0	130.0	134.0					17																	10304411		2203	4299	6502	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3206C>A	17.37:g.10304411G>T	ENSP00000384330:p.Thr1069Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T1069K	ENST00000403437.2	37	c.3206	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141311	0.37825	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.89196	-2.48	5.49	3.41	0.39046	.	0.380247	0.19148	U	0.121526	T	0.81064	0.4745	N	0.19112	0.55	0.27004	N	0.964852	B	0.17852	0.024	B	0.20955	0.032	T	0.73506	-0.3961	10	0.87932	D	0	.	10.9979	0.47587	0.2155:0.0:0.7845:0.0	.	1069	P13535	MYH8_HUMAN	K	1069	ENSP00000384330:T1069K	ENSP00000252173:T1069K	T	-	2	0	MYH8	10245136	0.243000	0.23878	1.000000	0.80357	0.998000	0.95712	1.271000	0.33098	0.798000	0.33994	0.655000	0.94253	ACA	MYH8	-	NULL		0.388	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	G	NM_002472		10304411	-1	no_errors	ENST00000403437	ensembl	human	known	70_37	missense	SNP	1.000	T
MYH8	4626	genome.wustl.edu	37	17	10304411	10304411	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:10304411G>T	ENST00000403437.2	-	25	3300	c.3206C>A	c.(3205-3207)aCa>aAa	p.T1069K	CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA|RP11-799N11.1_ENST00000581304.1_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1069					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						CATATCCATTGTGGATTCTTG	0.388									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0													141.0	130.0	134.0					17																	10304411		2203	4299	6502	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3206C>A	17.37:g.10304411G>T	ENSP00000384330:p.Thr1069Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T1069K	ENST00000403437.2	37	c.3206	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	G	13.12	2.141311	0.37825	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.89196	-2.48	5.49	3.41	0.39046	.	0.380247	0.19148	U	0.121526	T	0.81064	0.4745	N	0.19112	0.55	0.27004	N	0.964852	B	0.17852	0.024	B	0.20955	0.032	T	0.73506	-0.3961	10	0.87932	D	0	.	10.9979	0.47587	0.2155:0.0:0.7845:0.0	.	1069	P13535	MYH8_HUMAN	K	1069	ENSP00000384330:T1069K	ENSP00000252173:T1069K	T	-	2	0	MYH8	10245136	0.243000	0.23878	1.000000	0.80357	0.998000	0.95712	1.271000	0.33098	0.798000	0.33994	0.655000	0.94253	ACA	MYH8	-	NULL		0.388	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	G	NM_002472		10304411	-1	no_errors	ENST00000403437	ensembl	human	known	70_37	missense	SNP	1.000	T
MYOM3	127294	genome.wustl.edu	37	1	24434550	24434550	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:24434550C>T	ENST00000374434.3	-	3	337	c.175G>A	c.(175-177)Gag>Aag	p.E59K	MYOM3_ENST00000475306.1_5'UTR|MYOM3_ENST00000329601.7_Missense_Mutation_p.E59K|MYOM3_ENST00000330966.7_Missense_Mutation_p.E60K	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	59						M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GCGCTGAACTCATGCTCTTCT	0.632																																																	0													44.0	51.0	49.0					1																	24434550		2039	4161	6200	SO:0001583	missense	127294			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.175G>A	1.37:g.24434550C>T	ENSP00000363557:p.Glu59Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E60K	ENST00000374434.3	37	c.178	CCDS41281.1	1	.	.	.	.	.	.	.	.	.	.	C	0.082	-1.181591	0.01633	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.53640	0.65;0.63;0.61	5.29	1.06	0.20224	.	0.753395	0.11407	N	0.567181	T	0.28200	0.0696	N	0.14661	0.345	0.09310	N	1	B;B	0.19200	0.034;0.009	B;B	0.25291	0.059;0.004	T	0.29549	-1.0008	10	0.12430	T	0.62	.	9.7244	0.40322	0.0:0.4566:0.3986:0.1448	.	59;59	Q5VTT5-2;Q5VTT5	.;MYOM3_HUMAN	K	59;60;59	ENSP00000363557:E59K;ENSP00000332670:E60K;ENSP00000328415:E59K	ENSP00000328415:E59K	E	-	1	0	MYOM3	24307137	0.268000	0.24133	0.036000	0.18154	0.002000	0.02628	0.664000	0.25068	-0.055000	0.13244	-0.311000	0.09066	GAG	MYOM3	-	NULL		0.632	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	HGNC	protein_coding	OTTHUMT00000008272.2	C	NM_152372		24434550	-1	no_errors	ENST00000330966	ensembl	human	known	70_37	missense	SNP	0.126	T
MYOM3	127294	genome.wustl.edu	37	1	24434550	24434550	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:24434550C>T	ENST00000374434.3	-	3	337	c.175G>A	c.(175-177)Gag>Aag	p.E59K	MYOM3_ENST00000475306.1_5'UTR|MYOM3_ENST00000329601.7_Missense_Mutation_p.E59K|MYOM3_ENST00000330966.7_Missense_Mutation_p.E60K	NM_152372.3	NP_689585.3	Q5VTT5	MYOM3_HUMAN	myomesin 3	59						M band (GO:0031430)	protein homodimerization activity (GO:0042803)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(6)|large_intestine(3)|lung(40)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	68		Colorectal(325;3.55e-05)|Renal(390;0.000703)|Lung NSC(340;0.001)|all_lung(284;0.0014)|Ovarian(437;0.00351)|Breast(348;0.0126)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;5.31e-24)|Colorectal(126;7.52e-08)|COAD - Colon adenocarcinoma(152;4.01e-06)|GBM - Glioblastoma multiforme(114;4.36e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00108)|KIRC - Kidney renal clear cell carcinoma(1967;0.00404)|STAD - Stomach adenocarcinoma(196;0.00966)|READ - Rectum adenocarcinoma(331;0.0678)|Lung(427;0.153)		GCGCTGAACTCATGCTCTTCT	0.632																																																	0													44.0	51.0	49.0					1																	24434550		2039	4161	6200	SO:0001583	missense	127294			AK093280	CCDS41281.1	1p36	2013-02-11	2012-10-17		ENSG00000142661	ENSG00000142661		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	26679	protein-coding gene	gene with protein product			"""myomesin family, member 3"""			18177667	Standard	NM_152372		Approved	FLJ35961	uc001bin.4	Q5VTT5	OTTHUMG00000002969	ENST00000374434.3:c.175G>A	1.37:g.24434550C>T	ENSP00000363557:p.Glu59Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF75|Q5VTT6|Q6AWC0|Q6AWC1|Q6NXF9|Q6ZRG7|Q7Z3G9|Q8NA11|Q96C54	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E60K	ENST00000374434.3	37	c.178	CCDS41281.1	1	.	.	.	.	.	.	.	.	.	.	C	0.082	-1.181591	0.01633	.	.	ENSG00000142661	ENST00000374434;ENST00000330966;ENST00000329601	T;T;T	0.53640	0.65;0.63;0.61	5.29	1.06	0.20224	.	0.753395	0.11407	N	0.567181	T	0.28200	0.0696	N	0.14661	0.345	0.09310	N	1	B;B	0.19200	0.034;0.009	B;B	0.25291	0.059;0.004	T	0.29549	-1.0008	10	0.12430	T	0.62	.	9.7244	0.40322	0.0:0.4566:0.3986:0.1448	.	59;59	Q5VTT5-2;Q5VTT5	.;MYOM3_HUMAN	K	59;60;59	ENSP00000363557:E59K;ENSP00000332670:E60K;ENSP00000328415:E59K	ENSP00000328415:E59K	E	-	1	0	MYOM3	24307137	0.268000	0.24133	0.036000	0.18154	0.002000	0.02628	0.664000	0.25068	-0.055000	0.13244	-0.311000	0.09066	GAG	MYOM3	-	NULL		0.632	MYOM3-001	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYOM3	HGNC	protein_coding	OTTHUMT00000008272.2	C	NM_152372		24434550	-1	no_errors	ENST00000330966	ensembl	human	known	70_37	missense	SNP	0.126	T
HAND2	9464	genome.wustl.edu	37	4	174448614	174448614	+	Intron	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr4:174448614G>A	ENST00000359562.4	-	2	1495				HAND2-AS1_ENST00000505032.1_RNA|HAND2-AS1_ENST00000502941.1_RNA|HAND2-AS1_ENST00000512099.1_RNA|HAND2-AS1_ENST00000509866.1_RNA|HAND2-AS1_ENST00000511728.1_RNA|HAND2-AS1_ENST00000512943.1_RNA|HAND2_ENST00000505300.1_5'Flank|HAND2-AS1_ENST00000510221.1_RNA|HAND2-AS1_ENST00000507062.1_RNA|HAND2-AS1_ENST00000512929.1_RNA|HAND2-AS1_ENST00000515376.1_RNA|HAND2-AS1_ENST00000503198.1_RNA|HAND2-AS1_ENST00000502896.1_RNA|HAND2-AS1_ENST00000515350.1_RNA|HAND2-AS1_ENST00000508534.1_RNA|HAND2-AS1_ENST00000502334.1_RNA|HAND2-AS1_ENST00000507636.1_RNA|HAND2-AS1_ENST00000507571.1_RNA|HAND2-AS1_ENST00000515310.1_RNA|HAND2-AS1_ENST00000511196.1_RNA|HAND2-AS1_ENST00000505621.1_RNA|HAND2-AS1_ENST00000509640.1_RNA|HAND2-AS1_ENST00000514673.1_RNA|HAND2-AS1_ENST00000512246.1_RNA|HAND2-AS1_ENST00000510339.1_RNA|HAND2-AS1_ENST00000503474.1_RNA|HAND2-AS1_ENST00000507322.1_RNA|HAND2-AS1_ENST00000515741.1_RNA	NM_021973.2	NP_068808.1	P61296	HAND2_HUMAN	heart and neural crest derivatives expressed 2						adult heart development (GO:0007512)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic process involved in heart morphogenesis (GO:0003278)|cardiac neural crest cell development involved in outflow tract morphogenesis (GO:0061309)|cardiac neural crest cell migration involved in outflow tract morphogenesis (GO:0003253)|cardiac right ventricle formation (GO:0003219)|cartilage morphogenesis (GO:0060536)|cell proliferation involved in outflow tract morphogenesis (GO:0061325)|coronary artery morphogenesis (GO:0060982)|embryonic digit morphogenesis (GO:0042733)|heart development (GO:0007507)|heart looping (GO:0001947)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|mesenchymal cell proliferation (GO:0010463)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of DNA binding (GO:0043392)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural crest cell development (GO:0014032)|noradrenergic neuron differentiation (GO:0003357)|odontogenesis of dentin-containing tooth (GO:0042475)|palate development (GO:0060021)|peripheral nervous system neuron development (GO:0048935)|positive regulation of semaphorin-plexin signaling pathway involved in outflow tract morphogenesis (GO:2000764)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in norepinephrine biosynthetic process (GO:2000763)|positive regulation of transcription regulatory region DNA binding (GO:2000679)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of secondary heart field cardioblast proliferation (GO:0003266)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|sympathetic nervous system development (GO:0048485)|thymus development (GO:0048538)|tongue development (GO:0043586)|visceral serous pericardium development (GO:0061032)	nuclear chromatin (GO:0000790)|protein complex (GO:0043234)|transcription factor complex (GO:0005667)	activating transcription factor binding (GO:0033613)|AT DNA binding (GO:0003680)|E-box binding (GO:0070888)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			endometrium(1)|large_intestine(4)|lung(6)|prostate(1)|skin(1)	13		Prostate(90;0.00601)|Renal(120;0.0183)|Melanoma(52;0.0749)|all_neural(102;0.0837)|all_hematologic(60;0.107)		all cancers(43;1.37e-18)|Epithelial(43;5.5e-17)|OV - Ovarian serous cystadenocarcinoma(60;3.3e-10)|STAD - Stomach adenocarcinoma(60;0.00273)|GBM - Glioblastoma multiforme(59;0.0064)|LUSC - Lung squamous cell carcinoma(193;0.0903)|Kidney(143;0.249)		AGCTTCCTGCGCCGGAGGAGA	0.567																																																	0																																										SO:0001627	intron_variant	79804			AF087941	CCDS3819.1	4q34.1	2014-08-12			ENSG00000164107	ENSG00000164107		"""Basic helix-loop-helix proteins"""	4808	protein-coding gene	gene with protein product		602407				9878849	Standard	NM_021973		Approved	dHand, Thing2, Hed, bHLHa26	uc003ith.1	P61296	OTTHUMG00000160775	ENST00000359562.4:c.556-88C>T	4.37:g.174448614G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B6ECG9|O95300|O95301|P97833|Q494T1	RNA	SNP	-	NULL	ENST00000359562.4	37	NULL	CCDS3819.1	4																																																																																			RP11-471J12.1	-	-		0.567	HAND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBLA00301	Clone_based_vega_gene	protein_coding	OTTHUMT00000362241.3	G			174448614	+1	no_errors	ENST00000512099	ensembl	human	known	70_37	rna	SNP	0.000	A
NCAPG2	54892	genome.wustl.edu	37	7	158458073	158458073	+	Intron	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:158458073G>A	ENST00000409423.1	-	15	1652				NCAPG2_ENST00000275830.10_Intron|NCAPG2_ENST00000356309.3_Intron|NCAPG2_ENST00000541468.1_Intron|NCAPG2_ENST00000409339.3_Intron|NCAPG2_ENST00000449727.2_Intron	NM_001281932.1	NP_001268861.1	Q86XI2	CNDG2_HUMAN	non-SMC condensin II complex, subunit G2						chromosome condensation (GO:0030261)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)	membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	methylated histone binding (GO:0035064)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(7)|liver(1)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	39	Ovarian(565;0.152)	all_cancers(7;3.44e-11)|all_epithelial(9;3.05e-05)|all_hematologic(28;0.014)	OV - Ovarian serous cystadenocarcinoma(82;0.00174)	UCEC - Uterine corpus endometrioid carcinoma (81;0.187)|STAD - Stomach adenocarcinoma(7;0.18)		ACTACCTACAGAAAGCAAGCA	0.453																																																	0																																										SO:0001627	intron_variant	54892			BC043404	CCDS43686.1, CCDS64816.1	7q36.3	2006-09-04	2006-09-04	2006-09-04	ENSG00000146918	ENSG00000146918			21904	protein-coding gene	gene with protein product		608532	"""leucine zipper protein 5"""	LUZP5		14532007	Standard	NM_001281933		Approved	FLJ20311, MTB, CAP-G2, hCAP-G2	uc003wnv.1	Q86XI2	OTTHUMG00000151438	ENST00000409423.1:c.1480-631C>T	7.37:g.158458073G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D228|Q7Z3J9|Q8WUG8|Q9BRX6|Q9H8S2|Q9H9K6	RNA	SNP	-	NULL	ENST00000409423.1	37	NULL	CCDS43686.1	7																																																																																			NCAPG2	-	-		0.453	NCAPG2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCAPG2	HGNC	protein_coding	OTTHUMT00000327111.1	G	NM_017760		158458073	-1	no_errors	ENST00000474940	ensembl	human	known	70_37	rna	SNP	0.042	A
NPM2	10361	genome.wustl.edu	37	8	21882273	21882273	+	5'UTR	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:21882273G>C	ENST00000397940.1	+	0	529				NPM2_ENST00000521157.1_5'UTR|NPM2_ENST00000289820.6_5'Flank|NPM2_ENST00000518119.1_5'UTR|NPM2_ENST00000520180.1_3'UTR|NPM2_ENST00000381530.5_5'Flank			Q86SE8	NPM2_HUMAN	nucleophosmin/nucleoplasmin 2						chromatin remodeling (GO:0006338)|embryo development (GO:0009790)|oocyte differentiation (GO:0009994)|positive regulation of catalytic activity (GO:0043085)|positive regulation of DNA replication (GO:0045740)|positive regulation of meiosis (GO:0045836)|protein homooligomerization (GO:0051260)|regulation of exit from mitosis (GO:0007096)|single fertilization (GO:0007338)	cytoplasmic chromatin (GO:0000789)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleic acid binding (GO:0003676)			large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	4				Colorectal(74;8.48e-05)|READ - Rectum adenocarcinoma(5;0.0276)|COAD - Colon adenocarcinoma(73;0.0618)		CTTCCGGCCAGAGGGGATGAG	0.672																																																	0																																										SO:0001623	5_prime_UTR_variant	10361			AY262113	CCDS6018.1, CCDS75703.1	8p21.3	2009-08-27	2009-08-27		ENSG00000158806	ENSG00000158806			7930	protein-coding gene	gene with protein product		608073				12714744	Standard	NM_182795		Approved		uc003xae.3	Q86SE8	OTTHUMG00000131129	ENST00000397940.1:c.-487G>C	8.37:g.21882273G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSU0|D3DSQ8|Q6NVH6	RNA	SNP	-	NULL	ENST00000397940.1	37	NULL	CCDS6018.1	8																																																																																			NPM2	-	-		0.672	NPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPM2	HGNC	protein_coding	OTTHUMT00000253810.2	G	NM_182795		21882273	+1	no_errors	ENST00000520180	ensembl	human	known	70_37	rna	SNP	0.001	C
OBSL1	23363	genome.wustl.edu	37	2	220432984	220432984	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:220432984C>T	ENST00000404537.1	-	2	1131	c.1075G>A	c.(1075-1077)Gtg>Atg	p.V359M	OBSL1_ENST00000373876.1_Missense_Mutation_p.V359M|OBSL1_ENST00000289656.3_De_novo_Start_InFrame|OBSL1_ENST00000603926.1_Missense_Mutation_p.V359M|OBSL1_ENST00000265318.4_Missense_Mutation_p.V359M|OBSL1_ENST00000373873.4_Missense_Mutation_p.V359M|OBSL1_ENST00000491370.1_5'Flank	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	359	Ig-like 4.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CATTCCAGCACGGCAATCCCG	0.652											OREG0003988	type=REGULATORY REGION|Gene=OBSL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													23.0	27.0	26.0					2																	220432984		1950	4130	6080	SO:0001583	missense	23363			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1075G>A	2.37:g.220432984C>T	ENSP00000385636:p.Val359Met	Somatic	2266	WXS	Illumina HiSeq	Phase_IV	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V359M	ENST00000404537.1	37	c.1075	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995401	0.74703	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873	T;T;T;T	0.05580	3.42;3.42;3.42;3.42	5.17	5.17	0.71159	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.20292	0.0488	L	0.56396	1.775	0.50171	D	0.999857	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	T	0.00036	-1.2258	9	0.49607	T	0.09	.	13.1804	0.59651	0.0:0.9237:0.0:0.0763	.	359;359	O75147;O75147-2	OBSL1_HUMAN;.	M	359	ENSP00000265318:V359M;ENSP00000385636:V359M;ENSP00000362983:V359M;ENSP00000362980:V359M	ENSP00000265318:V359M	V	-	1	0	OBSL1	220141228	0.998000	0.40836	0.961000	0.40146	0.991000	0.79684	3.741000	0.55090	2.694000	0.91930	0.650000	0.86243	GTG	OBSL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.652	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	C			220432984	-1	no_errors	ENST00000404537	ensembl	human	known	70_37	missense	SNP	0.996	T
OBSL1	23363	genome.wustl.edu	37	2	220432984	220432984	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:220432984C>T	ENST00000404537.1	-	2	1131	c.1075G>A	c.(1075-1077)Gtg>Atg	p.V359M	OBSL1_ENST00000373876.1_Missense_Mutation_p.V359M|OBSL1_ENST00000289656.3_De_novo_Start_InFrame|OBSL1_ENST00000603926.1_Missense_Mutation_p.V359M|OBSL1_ENST00000265318.4_Missense_Mutation_p.V359M|OBSL1_ENST00000373873.4_Missense_Mutation_p.V359M|OBSL1_ENST00000491370.1_5'Flank	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	359	Ig-like 4.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CATTCCAGCACGGCAATCCCG	0.652											OREG0003988	type=REGULATORY REGION|Gene=OBSL1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													23.0	27.0	26.0					2																	220432984		1950	4130	6080	SO:0001583	missense	23363			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.1075G>A	2.37:g.220432984C>T	ENSP00000385636:p.Val359Met	Somatic	2266	WXS	Illumina HiSeq	Phase_IV	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.V359M	ENST00000404537.1	37	c.1075	CCDS46520.1	2	.	.	.	.	.	.	.	.	.	.	C	20.5	3.995401	0.74703	.	.	ENSG00000124006	ENST00000265318;ENST00000404537;ENST00000373876;ENST00000373873	T;T;T;T	0.05580	3.42;3.42;3.42;3.42	5.17	5.17	0.71159	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.20292	0.0488	L	0.56396	1.775	0.50171	D	0.999857	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.994	T	0.00036	-1.2258	9	0.49607	T	0.09	.	13.1804	0.59651	0.0:0.9237:0.0:0.0763	.	359;359	O75147;O75147-2	OBSL1_HUMAN;.	M	359	ENSP00000265318:V359M;ENSP00000385636:V359M;ENSP00000362983:V359M;ENSP00000362980:V359M	ENSP00000265318:V359M	V	-	1	0	OBSL1	220141228	0.998000	0.40836	0.961000	0.40146	0.991000	0.79684	3.741000	0.55090	2.694000	0.91930	0.650000	0.86243	GTG	OBSL1	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.652	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	C			220432984	-1	no_errors	ENST00000404537	ensembl	human	known	70_37	missense	SNP	0.996	T
OR10AB1P	390091	genome.wustl.edu	37	11	7750751	7750751	+	lincRNA	SNP	A	A	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr11:7750751A>G	ENST00000527565.1	-	0	542																											TTCGATGAAGACATGCTGACG	0.438																																																	0																																												390091																															11.37:g.7750751A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt	p.D279G	ENST00000527565.1	37	c.836		11	.	.	.	.	.	.	.	.	.	.	A	16.19	3.052844	0.55218	.	.	ENSG00000176716	ENST00000317359	T	0.00245	8.45	5.09	-1.8	0.07907	.	0.000000	0.49305	D	0.000159	T	0.00144	0.0004	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.33033	-0.9884	7	0.29301	T	0.29	.	7.1727	0.25726	0.4187:0.1218:0.0:0.4595	.	.	.	.	G	279	ENSP00000322295:D279G	ENSP00000322295:D279G	D	+	2	0	OR10AB1P	7707327	0.000000	0.05858	0.000000	0.03702	0.257000	0.26127	0.441000	0.21611	-0.397000	0.07691	-0.299000	0.09455	GAC	OR10AB1P	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.438	RP11-35J10.5-001	KNOWN	basic|readthrough_transcript	lincRNA	OR10AB1P	HGNC	lincRNA	OTTHUMT00000385692.1	A			7750751	+1	no_errors	ENST00000317359	ensembl	human	known	70_37	missense	SNP	0.000	G
OR2M7	391196	genome.wustl.edu	37	1	248487506	248487506	+	Missense_Mutation	SNP	C	C	T	rs543782719		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:248487506C>T	ENST00000317965.2	-	1	393	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGCAGTGTAGCGGTCATAAGA	0.448													c|||	1	0.000199681	0.0	0.0	5008	,	,		21517	0.0		0.001	False		,,,				2504	0.0																0													232.0	232.0	232.0					1																	248487506		2203	4300	6503	SO:0001583	missense	391196			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.365G>A	1.37:g.248487506C>T	ENSP00000324557:p.Arg122His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNL0|Q6IEX6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R122H	ENST00000317965.2	37	c.365	CCDS31111.1	1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.403260	0.25291	.	.	ENSG00000177186	ENST00000317965	T	0.77489	-1.1	1.54	0.559	0.17272	GPCR, rhodopsin-like superfamily (1);	0.527939	0.14190	N	0.335397	T	0.79263	0.4416	M	0.91717	3.235	0.24688	N	0.993326	B	0.15473	0.013	B	0.12156	0.007	T	0.71919	-0.4447	10	0.62326	D	0.03	.	7.6446	0.28312	0.0:0.8554:0.0:0.1446	.	122	Q8NG81	OR2M7_HUMAN	H	122	ENSP00000324557:R122H	ENSP00000324557:R122H	R	-	2	0	OR2M7	246554129	0.774000	0.28592	0.064000	0.19789	0.030000	0.12068	1.439000	0.35013	0.008000	0.14787	-1.206000	0.01644	CGC	OR2M7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.448	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M7	HGNC	protein_coding	OTTHUMT00000097357.1	C	NM_001004691		248487506	-1	no_errors	ENST00000317965	ensembl	human	known	70_37	missense	SNP	1.000	T
OR2M7	391196	genome.wustl.edu	37	1	248487506	248487506	+	Missense_Mutation	SNP	C	C	T	rs543782719		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:248487506C>T	ENST00000317965.2	-	1	393	c.365G>A	c.(364-366)cGc>cAc	p.R122H		NM_001004691.1	NP_001004691.1	Q8NG81	OR2M7_HUMAN	olfactory receptor, family 2, subfamily M, member 7	122						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(6)|large_intestine(3)|lung(29)|skin(3)	42	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			GGCAGTGTAGCGGTCATAAGA	0.448													c|||	1	0.000199681	0.0	0.0	5008	,	,		21517	0.0		0.001	False		,,,				2504	0.0																0													232.0	232.0	232.0					1																	248487506		2203	4300	6503	SO:0001583	missense	391196			BK004486	CCDS31111.1	1q44	2012-08-09			ENSG00000177186	ENSG00000177186		"""GPCR / Class A : Olfactory receptors"""	19594	protein-coding gene	gene with protein product							Standard	NM_001004691		Approved		uc010pzk.2	Q8NG81	OTTHUMG00000040461	ENST00000317965.2:c.365G>A	1.37:g.248487506C>T	ENSP00000324557:p.Arg122His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNL0|Q6IEX6	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.R122H	ENST00000317965.2	37	c.365	CCDS31111.1	1	.	.	.	.	.	.	.	.	.	.	C	10.63	1.403260	0.25291	.	.	ENSG00000177186	ENST00000317965	T	0.77489	-1.1	1.54	0.559	0.17272	GPCR, rhodopsin-like superfamily (1);	0.527939	0.14190	N	0.335397	T	0.79263	0.4416	M	0.91717	3.235	0.24688	N	0.993326	B	0.15473	0.013	B	0.12156	0.007	T	0.71919	-0.4447	10	0.62326	D	0.03	.	7.6446	0.28312	0.0:0.8554:0.0:0.1446	.	122	Q8NG81	OR2M7_HUMAN	H	122	ENSP00000324557:R122H	ENSP00000324557:R122H	R	-	2	0	OR2M7	246554129	0.774000	0.28592	0.064000	0.19789	0.030000	0.12068	1.439000	0.35013	0.008000	0.14787	-1.206000	0.01644	CGC	OR2M7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.448	OR2M7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M7	HGNC	protein_coding	OTTHUMT00000097357.1	C	NM_001004691		248487506	-1	no_errors	ENST00000317965	ensembl	human	known	70_37	missense	SNP	1.000	T
ASPRV1	151516	genome.wustl.edu	37	2	70191501	70191501	+	5'Flank	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:70191501C>T	ENST00000320256.4	-	0	0				PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						TCATGGTTACCGTGAGAGCTG	0.572																																																	0																																										SO:0001631	upstream_gene_variant	400960			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647		2.37:g.70191501C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000320256.4	37	NULL	CCDS1897.1	2																																																																																			PCBP1-AS1	-	-		0.572	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCBP1-AS1	HGNC	protein_coding	OTTHUMT00000334161.1	C	NM_152792		70191501	-1	no_errors	ENST00000435880	ensembl	human	known	70_37	rna	SNP	0.000	T
PCBP3	54039	genome.wustl.edu	37	21	47320525	47320525	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr21:47320525G>T	ENST00000400314.1	+	6	548	c.210G>T	c.(208-210)aaG>aaT	p.K70N	PCBP3_ENST00000400304.1_Missense_Mutation_p.K38N|PCBP3_ENST00000400310.1_Missense_Mutation_p.K70N|PCBP3_ENST00000400309.1_Missense_Mutation_p.K70N|PCBP3_ENST00000400308.1_Missense_Mutation_p.K70N|PCBP3_ENST00000449640.1_Missense_Mutation_p.K70N			P57721	PCBP3_HUMAN	poly(rC) binding protein 3	70	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				mRNA metabolic process (GO:0016071)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			biliary_tract(1)|endometrium(3)|large_intestine(2)|lung(7)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	17	all_hematologic(128;0.24)			Colorectal(79;0.0411)|READ - Rectum adenocarcinoma(84;0.0649)		CTGTGAAGAAGATGCGTGAGG	0.607																																																	0													50.0	58.0	56.0					21																	47320525		1963	4144	6107	SO:0001583	missense	54039			AF176329	CCDS42974.2, CCDS46652.1	21q22.3	2013-07-16	2001-11-28		ENSG00000183570	ENSG00000183570			8651	protein-coding gene	gene with protein product		608502	"""poly(rC)-binding protein 3"""			10936052	Standard	NM_020528		Approved		uc002zhq.2	P57721	OTTHUMG00000090399	ENST00000400314.1:c.210G>T	21.37:g.47320525G>T	ENSP00000383168:p.Lys70Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MPS2|A8MQ26|B7WNN9|B7WPC1|Q8N9K6|Q96EP6	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.K70N	ENST00000400314.1	37	c.210	CCDS42974.2	21	.	.	.	.	.	.	.	.	.	.	G	17.81	3.480261	0.63849	.	.	ENSG00000183570	ENST00000400314;ENST00000400310;ENST00000400309;ENST00000400308;ENST00000449640;ENST00000346743;ENST00000400305;ENST00000400304	T;T;T;T;T;T;T	0.30448	1.53;1.53;1.53;1.53;1.53;1.53;1.53	5.26	4.37	0.52481	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.135938	0.64402	D	0.000005	T	0.45094	0.1325	L	0.45470	1.425	0.53688	D	0.999973	P;B;D;D;B;D;B	0.76494	0.911;0.327;0.984;0.999;0.191;0.999;0.055	D;B;D;D;B;D;B	0.91635	0.955;0.229;0.97;0.998;0.229;0.999;0.145	T	0.31861	-0.9928	10	0.46703	T	0.11	-22.9872	9.75	0.40470	0.1587:0.0:0.8413:0.0	.	38;70;38;70;70;70;70	Q5MJP6;P57721-3;E9PFP8;P57721-2;P57721-4;P57721;P57721-5	.;.;.;.;.;PCBP3_HUMAN;.	N	70;70;70;70;70;70;46;38	ENSP00000383168:K70N;ENSP00000383165:K70N;ENSP00000383164:K70N;ENSP00000383163:K70N;ENSP00000401198:K70N;ENSP00000383160:K46N;ENSP00000383159:K38N	ENSP00000330225:K70N	K	+	3	2	PCBP3	46144953	1.000000	0.71417	1.000000	0.80357	0.815000	0.46073	3.082000	0.50128	1.367000	0.46095	0.655000	0.94253	AAG	PCBP3	-	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1		0.607	PCBP3-001	KNOWN	basic|CCDS	protein_coding	PCBP3	HGNC	protein_coding	OTTHUMT00000206808.2	G			47320525	+1	no_errors	ENST00000400314	ensembl	human	known	70_37	missense	SNP	1.000	T
PEAK1	79834	genome.wustl.edu	37	15	77472802	77472802	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:77472802G>A	ENST00000560626.2	-	4	1942	c.1467C>T	c.(1465-1467)ctC>ctT	p.L489L	PEAK1_ENST00000312493.4_Silent_p.L489L|PEAK1_ENST00000558305.1_Silent_p.L489L			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	489					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.L489L(2)									CAGGGCCCTCGAGGTGCTCAC	0.488																																																	2	Substitution - coding silent(2)	large_intestine(2)											137.0	129.0	132.0					15																	77472802		2007	4171	6178	SO:0001819	synonymous_variant	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.1467C>T	15.37:g.77472802G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.L489	ENST00000560626.2	37	c.1467	CCDS42062.1	15																																																																																			PEAK1	-	NULL		0.488	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Uniprot_genename	protein_coding	OTTHUMT00000419483.3	G			77472802	-1	no_errors	ENST00000312493	ensembl	human	known	70_37	silent	SNP	0.003	A
PEAK1	79834	genome.wustl.edu	37	15	77472802	77472802	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr15:77472802G>A	ENST00000560626.2	-	4	1942	c.1467C>T	c.(1465-1467)ctC>ctT	p.L489L	PEAK1_ENST00000312493.4_Silent_p.L489L|PEAK1_ENST00000558305.1_Silent_p.L489L			Q9H792	PEAK1_HUMAN	pseudopodium-enriched atypical kinase 1	489					cell migration (GO:0016477)|peptidyl-tyrosine phosphorylation (GO:0018108)|protein autophosphorylation (GO:0046777)|substrate adhesion-dependent cell spreading (GO:0034446)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)	p.L489L(2)									CAGGGCCCTCGAGGTGCTCAC	0.488																																																	2	Substitution - coding silent(2)	large_intestine(2)											137.0	129.0	132.0					15																	77472802		2007	4171	6178	SO:0001819	synonymous_variant	79834				CCDS42062.1	15q24.3	2013-09-27			ENSG00000173517	ENSG00000173517			29431	protein-coding gene	gene with protein product		614248				16879967, 20534451	Standard	NM_024776		Approved	KIAA2002, sgk269		Q9H792	OTTHUMG00000172618	ENST00000560626.2:c.1467C>T	15.37:g.77472802G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZS78|Q8NAZ4|Q8NCM3|Q8TEG7	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.L489	ENST00000560626.2	37	c.1467	CCDS42062.1	15																																																																																			PEAK1	-	NULL		0.488	PEAK1-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PEAK1	Uniprot_genename	protein_coding	OTTHUMT00000419483.3	G			77472802	-1	no_errors	ENST00000312493	ensembl	human	known	70_37	silent	SNP	0.003	A
PHKA1	5255	genome.wustl.edu	37	X	71932674	71932674	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:71932674G>A	ENST00000373542.4	-	2	343	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	PHKA1_ENST00000373539.3_Missense_Mutation_p.R62W|PHKA1-AS1_ENST00000420998.1_RNA|PHKA1_ENST00000339490.3_Missense_Mutation_p.R62W|PHKA1_ENST00000541944.1_Missense_Mutation_p.R62W|PHKA1_ENST00000373545.3_Missense_Mutation_p.R62W	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	62					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GCATTCTTCCGATAGGCCAGG	0.478																																																	0													58.0	50.0	53.0					X																	71932674		2203	4297	6500	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.184C>T	X.37:g.71932674G>A	ENSP00000362643:p.Arg62Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.R62W	ENST00000373542.4	37	c.184	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617432	0.66787	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9	4.52	3.64	0.41730	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.103672	0.64402	D	0.000006	D	0.96445	0.8840	M	0.92833	3.35	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96273	0.9200	10	0.87932	D	0	-17.3194	10.7051	0.45950	0.0:0.0:0.808:0.192	.	62;62;62	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	W	62	ENSP00000362646:R62W;ENSP00000362643:R62W;ENSP00000441251:R62W;ENSP00000342469:R62W;ENSP00000362640:R62W	ENSP00000342469:R62W	R	-	1	2	PHKA1	71849399	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.626000	0.24492	0.990000	0.38787	0.600000	0.82982	CGG	PHKA1	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.478	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	G			71932674	-1	no_errors	ENST00000373539	ensembl	human	known	70_37	missense	SNP	1.000	A
PHKA1	5255	genome.wustl.edu	37	X	71932674	71932674	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:71932674G>A	ENST00000373542.4	-	2	343	c.184C>T	c.(184-186)Cgg>Tgg	p.R62W	PHKA1_ENST00000373539.3_Missense_Mutation_p.R62W|PHKA1-AS1_ENST00000420998.1_RNA|PHKA1_ENST00000339490.3_Missense_Mutation_p.R62W|PHKA1_ENST00000541944.1_Missense_Mutation_p.R62W|PHKA1_ENST00000373545.3_Missense_Mutation_p.R62W	NM_002637.3	NP_002628.2	P46020	KPB1_HUMAN	phosphorylase kinase, alpha 1 (muscle)	62					carbohydrate metabolic process (GO:0005975)|generation of precursor metabolites and energy (GO:0006091)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|glycogen metabolic process (GO:0005977)|protein phosphorylation (GO:0006468)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	hydrolase activity, hydrolyzing O-glycosyl compounds (GO:0004553)|phosphorylase kinase activity (GO:0004689)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(9)|liver(2)|lung(18)|ovary(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	52	Renal(35;0.156)					GCATTCTTCCGATAGGCCAGG	0.478																																																	0													58.0	50.0	53.0					X																	71932674		2203	4297	6500	SO:0001583	missense	5255				CCDS14421.1, CCDS48137.1, CCDS55453.1	Xq12-q13	2009-07-10			ENSG00000067177	ENSG00000067177	2.7.11.19		8925	protein-coding gene	gene with protein product		311870		PHKA			Standard	NM_002637		Approved		uc004eax.4	P46020	OTTHUMG00000022696	ENST00000373542.4:c.184C>T	X.37:g.71932674G>A	ENSP00000362643:p.Arg62Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZL05|B7ZL07|Q2M3D7	Missense_Mutation	SNP	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like	p.R62W	ENST00000373542.4	37	c.184	CCDS14421.1	X	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617432	0.66787	.	.	ENSG00000067177	ENST00000373545;ENST00000373542;ENST00000541944;ENST00000339490;ENST00000373539	D;D;D;D;D	0.91740	-2.9;-2.9;-2.9;-2.9;-2.9	4.52	3.64	0.41730	Six-hairpin glycosidase (1);Six-hairpin glycosidase-like (1);Glycoside hydrolase 15-related (1);	0.103672	0.64402	D	0.000006	D	0.96445	0.8840	M	0.92833	3.35	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96273	0.9200	10	0.87932	D	0	-17.3194	10.7051	0.45950	0.0:0.0:0.808:0.192	.	62;62;62	B7ZL07;P46020-2;P46020	.;.;KPB1_HUMAN	W	62	ENSP00000362646:R62W;ENSP00000362643:R62W;ENSP00000441251:R62W;ENSP00000342469:R62W;ENSP00000362640:R62W	ENSP00000342469:R62W	R	-	1	2	PHKA1	71849399	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	0.626000	0.24492	0.990000	0.38787	0.600000	0.82982	CGG	PHKA1	-	pfam_Glyco_hydro_15,superfamily_6-hairpin_glycosidase-like		0.478	PHKA1-001	KNOWN	basic|CCDS	protein_coding	PHKA1	HGNC	protein_coding	OTTHUMT00000058896.1	G			71932674	-1	no_errors	ENST00000373539	ensembl	human	known	70_37	missense	SNP	1.000	A
PHLDB3	653583	genome.wustl.edu	37	19	43979673	43979673	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:43979673G>C	ENST00000292140.5	-	16	2172	c.1812C>G	c.(1810-1812)ttC>ttG	p.F604L		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	604	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				TTTTGACGCAGAAGGTCAGGC	0.567																																																	0													47.0	54.0	52.0					19																	43979673		1902	4121	6023	SO:0001583	missense	653583				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1812C>G	19.37:g.43979673G>C	ENSP00000292140:p.Phe604Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7Z4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.F604L	ENST00000292140.5	37	c.1812	CCDS12621.2	19	.	.	.	.	.	.	.	.	.	.	G	36	5.837276	0.97009	.	.	ENSG00000176531	ENST00000292140	D	0.82081	-1.57	4.35	4.35	0.52113	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.082106	0.47455	D	0.000223	D	0.91061	0.7187	M	0.83483	2.645	0.80722	D	1	D;D	0.76494	0.992;0.999	D;D	0.79108	0.987;0.992	D	0.92097	0.5685	10	0.87932	D	0	.	15.236	0.73432	0.0:0.0:1.0:0.0	.	274;604	B2RXH3;Q6NSJ2	.;PHLB3_HUMAN	L	604	ENSP00000292140:F604L	ENSP00000292140:F604L	F	-	3	2	PHLDB3	48671513	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.001000	0.93568	2.713000	0.92767	0.456000	0.33151	TTC	PHLDB3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.567	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	G			43979673	-1	no_errors	ENST00000292140	ensembl	human	known	70_37	missense	SNP	1.000	C
PHLDB3	653583	genome.wustl.edu	37	19	43979673	43979673	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:43979673G>C	ENST00000292140.5	-	16	2172	c.1812C>G	c.(1810-1812)ttC>ttG	p.F604L		NM_198850.3	NP_942147.3	Q6NSJ2	PHLB3_HUMAN	pleckstrin homology-like domain, family B, member 3	604	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.						enzyme binding (GO:0019899)			breast(1)|central_nervous_system(1)|lung(5)	7		Prostate(69;0.0153)				TTTTGACGCAGAAGGTCAGGC	0.567																																																	0													47.0	54.0	52.0					19																	43979673		1902	4121	6023	SO:0001583	missense	653583				CCDS12621.2	19q13.31	2013-01-10			ENSG00000176531	ENSG00000176531		"""Pleckstrin homology (PH) domain containing"""	30499	protein-coding gene	gene with protein product							Standard	NM_198850		Approved	FLJ40193	uc002own.4	Q6NSJ2	OTTHUMG00000150693	ENST00000292140.5:c.1812C>G	19.37:g.43979673G>C	ENSP00000292140:p.Phe604Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7Z4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.F604L	ENST00000292140.5	37	c.1812	CCDS12621.2	19	.	.	.	.	.	.	.	.	.	.	G	36	5.837276	0.97009	.	.	ENSG00000176531	ENST00000292140	D	0.82081	-1.57	4.35	4.35	0.52113	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.082106	0.47455	D	0.000223	D	0.91061	0.7187	M	0.83483	2.645	0.80722	D	1	D;D	0.76494	0.992;0.999	D;D	0.79108	0.987;0.992	D	0.92097	0.5685	10	0.87932	D	0	.	15.236	0.73432	0.0:0.0:1.0:0.0	.	274;604	B2RXH3;Q6NSJ2	.;PHLB3_HUMAN	L	604	ENSP00000292140:F604L	ENSP00000292140:F604L	F	-	3	2	PHLDB3	48671513	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	9.001000	0.93568	2.713000	0.92767	0.456000	0.33151	TTC	PHLDB3	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.567	PHLDB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB3	HGNC	protein_coding	OTTHUMT00000319643.2	G			43979673	-1	no_errors	ENST00000292140	ensembl	human	known	70_37	missense	SNP	1.000	C
POLR2A	5430	genome.wustl.edu	37	17	7406712	7406712	+	Silent	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:7406712C>G	ENST00000322644.6	+	18	3336	c.2937C>G	c.(2935-2937)ctC>ctG	p.L979L		NM_000937.4	NP_000928	P24928	RPB1_HUMAN	polymerase (RNA) II (DNA directed) polypeptide A, 220kDa	979					7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|RNA-directed RNA polymerase activity (GO:0003968)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(8)|lung(17)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	50		Prostate(122;0.173)				AGGTCGTCCTCCCCTGTAACC	0.582																																																	0													97.0	85.0	89.0					17																	7406712		2203	4300	6503	SO:0001819	synonymous_variant	5430					17p13.1	2013-01-21	2002-08-29		ENSG00000181222	ENSG00000181222	2.7.7.6	"""RNA polymerase subunits"""	9187	protein-coding gene	gene with protein product	"""DNA-directed RNA polymerase II largest subunit, RNA polymerase II 220 kd subunit"", ""RNA polymerase II subunit B1"""	180660	"""polymerase (RNA) II (DNA directed) polypeptide A (220kD)"""	POLR2			Standard	NM_000937		Approved	POLRA, RPB1	uc002ghf.4	P24928	OTTHUMG00000177594	ENST00000322644.6:c.2937C>G	17.37:g.7406712C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NN93|B9EH88|Q6NX41	Silent	SNP	pfam_RNA_pol_Rpb1_1,pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_7,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_II_repeat_euk,smart_RNA_pol_N	p.L979	ENST00000322644.6	37	c.2937	CCDS32548.1	17																																																																																			POLR2A	-	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_Rpb1_6		0.582	POLR2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2A	HGNC	protein_coding	OTTHUMT00000437967.1	C	NM_000937		7406712	+1	no_errors	ENST00000322644	ensembl	human	known	70_37	silent	SNP	0.667	G
PPTC7	160760	genome.wustl.edu	37	12	110983707	110983707	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:110983707C>T	ENST00000354300.3	-	3	868	c.580G>A	c.(580-582)Gag>Aag	p.E194K		NM_139283.1	NP_644812.1	Q8NI37	PPTC7_HUMAN	PTC7 protein phosphatase homolog (S. cerevisiae)	194	PP2C-like.					mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|large_intestine(2)|lung(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	9						ACGACTCCCTCGGCTTCAGGG	0.557																																																	0													110.0	100.0	103.0					12																	110983707		2203	4300	6503	SO:0001583	missense	160760			AF385435	CCDS9149.1	12q24.11	2009-11-05				ENSG00000196850			30695	protein-coding gene	gene with protein product	"""T cell activation protein phosphatase 2C"""	609668				15177553	Standard	NM_139283		Approved	TA-PP2C	uc001trh.1	Q8NI37	OTTHUMG00000169529	ENST00000354300.3:c.580G>A	12.37:g.110983707C>T	ENSP00000346255:p.Glu194Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWC5|Q68DZ7|Q6UY82	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.E194K	ENST00000354300.3	37	c.580	CCDS9149.1	12	.	.	.	.	.	.	.	.	.	.	C	14.10	2.433612	0.43224	.	.	ENSG00000196850	ENST00000354300	.	.	.	5.98	5.98	0.97165	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.45418	0.1341	L	0.33245	0.995	0.80722	D	1	B	0.32203	0.36	B	0.26416	0.069	T	0.43180	-0.9407	9	0.06891	T	0.86	-21.1128	20.452	0.99131	0.0:1.0:0.0:0.0	.	194	Q8NI37	PPTC7_HUMAN	K	194	.	ENSP00000346255:E194K	E	-	1	0	PPTC7	109468090	1.000000	0.71417	0.929000	0.37066	0.797000	0.45037	7.810000	0.86072	2.838000	0.97847	0.591000	0.81541	GAG	PPTC7	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like		0.557	PPTC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPTC7	HGNC	protein_coding	OTTHUMT00000404635.1	C	NM_139283		110983707	-1	no_errors	ENST00000354300	ensembl	human	known	70_37	missense	SNP	1.000	T
PPTC7	160760	genome.wustl.edu	37	12	110983707	110983707	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr12:110983707C>T	ENST00000354300.3	-	3	868	c.580G>A	c.(580-582)Gag>Aag	p.E194K		NM_139283.1	NP_644812.1	Q8NI37	PPTC7_HUMAN	PTC7 protein phosphatase homolog (S. cerevisiae)	194	PP2C-like.					mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			endometrium(1)|large_intestine(2)|lung(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	9						ACGACTCCCTCGGCTTCAGGG	0.557																																																	0													110.0	100.0	103.0					12																	110983707		2203	4300	6503	SO:0001583	missense	160760			AF385435	CCDS9149.1	12q24.11	2009-11-05				ENSG00000196850			30695	protein-coding gene	gene with protein product	"""T cell activation protein phosphatase 2C"""	609668				15177553	Standard	NM_139283		Approved	TA-PP2C	uc001trh.1	Q8NI37	OTTHUMG00000169529	ENST00000354300.3:c.580G>A	12.37:g.110983707C>T	ENSP00000346255:p.Glu194Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWC5|Q68DZ7|Q6UY82	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.E194K	ENST00000354300.3	37	c.580	CCDS9149.1	12	.	.	.	.	.	.	.	.	.	.	C	14.10	2.433612	0.43224	.	.	ENSG00000196850	ENST00000354300	.	.	.	5.98	5.98	0.97165	Protein phosphatase 2C-like (5);	0.000000	0.85682	D	0.000000	T	0.45418	0.1341	L	0.33245	0.995	0.80722	D	1	B	0.32203	0.36	B	0.26416	0.069	T	0.43180	-0.9407	9	0.06891	T	0.86	-21.1128	20.452	0.99131	0.0:1.0:0.0:0.0	.	194	Q8NI37	PPTC7_HUMAN	K	194	.	ENSP00000346255:E194K	E	-	1	0	PPTC7	109468090	1.000000	0.71417	0.929000	0.37066	0.797000	0.45037	7.810000	0.86072	2.838000	0.97847	0.591000	0.81541	GAG	PPTC7	-	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like		0.557	PPTC7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPTC7	HGNC	protein_coding	OTTHUMT00000404635.1	C	NM_139283		110983707	-1	no_errors	ENST00000354300	ensembl	human	known	70_37	missense	SNP	1.000	T
PSMB8	5696	genome.wustl.edu	37	6	32810842	32810842	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr6:32810842C>T	ENST00000374882.3	-	2	222	c.172G>A	c.(172-174)Ggt>Agt	p.G58S	PSMB8_ENST00000395339.3_Missense_Mutation_p.G58S|PSMB9_ENST00000395330.1_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000374881.2_Missense_Mutation_p.G54S	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8	58					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.G54C(1)|p.G58C(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	CCGTCCCCACCCAGGGACTGG	0.498																																					NSCLC(48;53 1172 10859 13624 22883)												2	Substitution - Missense(2)	large_intestine(2)											76.0	73.0	74.0					6																	32810842		1511	2709	4220	SO:0001583	missense	5696				CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285	ENST00000374882.3:c.172G>A	6.37:g.32810842C>T	ENSP00000364016:p.Gly58Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	Missense_Mutation	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.G58S	ENST00000374882.3	37	c.172	CCDS4757.1	6	.	.	.	.	.	.	.	.	.	.	C	10.38	1.335346	0.24253	.	.	ENSG00000204264	ENST00000395339;ENST00000374882;ENST00000374881	T;T;T	0.37235	1.21;1.86;1.85	5.91	-1.26	0.09376	.	0.797554	0.11795	N	0.528734	T	0.07548	0.0190	L	0.54323	1.7	0.09310	N	1	B;B;B	0.19583	0.037;0.001;0.0	B;B;B	0.14023	0.01;0.006;0.001	T	0.39440	-0.9614	10	0.07644	T	0.81	-2.3013	2.4636	0.04547	0.1135:0.4458:0.1104:0.3303	.	58;54;58	B7Z6U7;P28062-2;P28062	.;.;PSB8_HUMAN	S	58;58;54	ENSP00000378748:G58S;ENSP00000364016:G58S;ENSP00000364015:G54S	ENSP00000364015:G54S	G	-	1	0	PSMB8	32918820	0.001000	0.12720	0.000000	0.03702	0.113000	0.19764	0.156000	0.16382	-0.624000	0.05611	-0.917000	0.02746	GGT	PSMB8	-	NULL		0.498	PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB8	HGNC	protein_coding	OTTHUMT00000076617.3	C	NM_148919		32810842	-1	no_errors	ENST00000374882	ensembl	human	known	70_37	missense	SNP	0.003	T
PSMB8	5696	genome.wustl.edu	37	6	32810842	32810842	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr6:32810842C>T	ENST00000374882.3	-	2	222	c.172G>A	c.(172-174)Ggt>Agt	p.G58S	PSMB8_ENST00000395339.3_Missense_Mutation_p.G58S|PSMB9_ENST00000395330.1_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000374881.2_Missense_Mutation_p.G54S	NM_148919.3	NP_683720.2	P28062	PSB8_HUMAN	proteasome (prosome, macropain) subunit, beta type, 8	58					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|fat cell differentiation (GO:0045444)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)|spermatoproteasome complex (GO:1990111)	threonine-type endopeptidase activity (GO:0004298)	p.G54C(1)|p.G58C(1)		NS(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(4)|skin(1)|urinary_tract(1)	11					Carfilzomib(DB08889)	CCGTCCCCACCCAGGGACTGG	0.498																																					NSCLC(48;53 1172 10859 13624 22883)												2	Substitution - Missense(2)	large_intestine(2)											76.0	73.0	74.0					6																	32810842		1511	2709	4220	SO:0001583	missense	5696				CCDS4756.1, CCDS4757.1	6p21.3	2013-03-27	2013-03-27		ENSG00000204264	ENSG00000204264		"""Proteasome (prosome, macropain) subunits"""	9545	protein-coding gene	gene with protein product		177046	"""proteasome (prosome, macropain) subunit, beta type, 8 (large multifunctional protease 7)"", ""large multifunctional peptidase 7"""	LMP7		1529427, 10329130	Standard	XM_005275000		Approved	RING10, D6S216E, PSMB5i, beta5i	uc003oce.3	P28062	OTTHUMG00000031285	ENST00000374882.3:c.172G>A	6.37:g.32810842C>T	ENSP00000364016:p.Gly58Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B0UZC0|Q29824|Q5JNW6|Q5QNR8|Q96J48	Missense_Mutation	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.G58S	ENST00000374882.3	37	c.172	CCDS4757.1	6	.	.	.	.	.	.	.	.	.	.	C	10.38	1.335346	0.24253	.	.	ENSG00000204264	ENST00000395339;ENST00000374882;ENST00000374881	T;T;T	0.37235	1.21;1.86;1.85	5.91	-1.26	0.09376	.	0.797554	0.11795	N	0.528734	T	0.07548	0.0190	L	0.54323	1.7	0.09310	N	1	B;B;B	0.19583	0.037;0.001;0.0	B;B;B	0.14023	0.01;0.006;0.001	T	0.39440	-0.9614	10	0.07644	T	0.81	-2.3013	2.4636	0.04547	0.1135:0.4458:0.1104:0.3303	.	58;54;58	B7Z6U7;P28062-2;P28062	.;.;PSB8_HUMAN	S	58;58;54	ENSP00000378748:G58S;ENSP00000364016:G58S;ENSP00000364015:G54S	ENSP00000364015:G54S	G	-	1	0	PSMB8	32918820	0.001000	0.12720	0.000000	0.03702	0.113000	0.19764	0.156000	0.16382	-0.624000	0.05611	-0.917000	0.02746	GGT	PSMB8	-	NULL		0.498	PSMB8-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB8	HGNC	protein_coding	OTTHUMT00000076617.3	C	NM_148919		32810842	-1	no_errors	ENST00000374882	ensembl	human	known	70_37	missense	SNP	0.003	T
PTDSS1	9791	genome.wustl.edu	37	8	97295861	97295861	+	Intron	SNP	A	A	C	rs533824067	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr8:97295861A>C	ENST00000517309.1	+	3	597				PTDSS1_ENST00000455950.2_Intron|PTDSS1_ENST00000518776.1_3'UTR	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1						glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	acacacacacacccacacatg	0.478													a|||	10	0.00199681	0.0053	0.0	5008	,	,		19395	0.0		0.0	False		,,,				2504	0.0031																0																																										SO:0001627	intron_variant	9791			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.272-476A>C	8.37:g.97295861A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	E5RFC5|Q9BUQ5	RNA	SNP	-	NULL	ENST00000517309.1	37	NULL	CCDS6271.1	8																																																																																			PTDSS1	-	-		0.478	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTDSS1	HGNC	protein_coding	OTTHUMT00000379743.2	A			97295861	+1	no_errors	ENST00000518776	ensembl	human	known	70_37	rna	SNP	0.000	C
PTPN13	5783	genome.wustl.edu	37	4	87693987	87693987	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr4:87693987C>T	ENST00000411767.2	+	32	5288	c.5225C>T	c.(5224-5226)tCa>tTa	p.S1742L	PTPN13_ENST00000427191.2_Missense_Mutation_p.S1723L|PTPN13_ENST00000436978.1_Missense_Mutation_p.S1747L|PTPN13_ENST00000511467.1_Missense_Mutation_p.S1747L|PTPN13_ENST00000316707.6_Missense_Mutation_p.S1551L			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1742	Poly-Ser.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CAACCCCAATCAGAATCTGCT	0.383																																																	0													136.0	130.0	132.0					4																	87693987		1839	4085	5924	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5225C>T	4.37:g.87693987C>T	ENSP00000407249:p.Ser1742Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S1747L	ENST00000411767.2	37	c.5240	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	C	8.409	0.843757	0.16963	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.52526	0.67;0.68;0.76;0.66;0.68	5.78	1.64	0.23874	.	0.771697	0.10908	N	0.620869	T	0.31796	0.0808	N	0.25647	0.755	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.001;0.004;0.002;0.004	T	0.21109	-1.0255	10	0.27082	T	0.32	.	8.1421	0.31089	0.0:0.5986:0.0:0.4014	.	1551;1723;1742;1747	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	L	1723;1747;1551;1742;1747;1691	ENSP00000408368:S1723L;ENSP00000394794:S1747L;ENSP00000322675:S1551L;ENSP00000407249:S1742L;ENSP00000426626:S1747L	ENSP00000322675:S1551L	S	+	2	0	PTPN13	87913011	0.002000	0.14202	0.052000	0.19188	0.495000	0.33615	0.151000	0.16283	0.382000	0.24878	0.563000	0.77884	TCA	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13		0.383	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	C			87693987	+1	no_errors	ENST00000436978	ensembl	human	known	70_37	missense	SNP	0.011	T
PTPN13	5783	genome.wustl.edu	37	4	87693987	87693987	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr4:87693987C>T	ENST00000411767.2	+	32	5288	c.5225C>T	c.(5224-5226)tCa>tTa	p.S1742L	PTPN13_ENST00000427191.2_Missense_Mutation_p.S1723L|PTPN13_ENST00000436978.1_Missense_Mutation_p.S1747L|PTPN13_ENST00000511467.1_Missense_Mutation_p.S1747L|PTPN13_ENST00000316707.6_Missense_Mutation_p.S1551L			Q12923	PTN13_HUMAN	protein tyrosine phosphatase, non-receptor type 13 (APO-1/CD95 (Fas)-associated phosphatase)	1742	Poly-Ser.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein tyrosine phosphatase activity (GO:0004725)			NS(4)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(12)|large_intestine(23)|lung(24)|ovary(4)|prostate(3)|skin(7)|upper_aerodigestive_tract(1)|urinary_tract(2)	93		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.242)		OV - Ovarian serous cystadenocarcinoma(123;0.00082)		CAACCCCAATCAGAATCTGCT	0.383																																																	0													136.0	130.0	132.0					4																	87693987		1839	4085	5924	SO:0001583	missense	5783				CCDS47093.1, CCDS47094.1, CCDS47095.1, CCDS47096.1	4q21.3	2011-06-09			ENSG00000163629	ENSG00000163629		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9646	protein-coding gene	gene with protein product		600267				8287977	Standard	NM_006264		Approved	PTP1E, PTP-BAS, PTPL1, PTP-BL	uc003hpy.3	Q12923	OTTHUMG00000160968	ENST00000411767.2:c.5225C>T	4.37:g.87693987C>T	ENSP00000407249:p.Ser1742Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTR0|Q15159|Q15263|Q15264|Q15265|Q15674|Q16826|Q8IWH7|Q9NYN9|Q9UDA8	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-13,pfam_Tyr_Pase_rcpt/non-rcpt,pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,superfamily_PDZ,superfamily_PAZ,smart_KIND,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.S1747L	ENST00000411767.2	37	c.5240	CCDS47094.1	4	.	.	.	.	.	.	.	.	.	.	C	8.409	0.843757	0.16963	.	.	ENSG00000163629	ENST00000427191;ENST00000436978;ENST00000316707;ENST00000411767;ENST00000511467;ENST00000357349	T;T;T;T;T	0.52526	0.67;0.68;0.76;0.66;0.68	5.78	1.64	0.23874	.	0.771697	0.10908	N	0.620869	T	0.31796	0.0808	N	0.25647	0.755	0.09310	N	1	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.09377	0.001;0.004;0.002;0.004	T	0.21109	-1.0255	10	0.27082	T	0.32	.	8.1421	0.31089	0.0:0.5986:0.0:0.4014	.	1551;1723;1742;1747	Q12923-2;Q12923-3;Q12923;Q12923-4	.;.;PTN13_HUMAN;.	L	1723;1747;1551;1742;1747;1691	ENSP00000408368:S1723L;ENSP00000394794:S1747L;ENSP00000322675:S1551L;ENSP00000407249:S1742L;ENSP00000426626:S1747L	ENSP00000322675:S1551L	S	+	2	0	PTPN13	87913011	0.002000	0.14202	0.052000	0.19188	0.495000	0.33615	0.151000	0.16283	0.382000	0.24878	0.563000	0.77884	TCA	PTPN13	-	pirsf_Tyr_Pase_non-rcpt_typ-13		0.383	PTPN13-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPN13	HGNC	protein_coding	OTTHUMT00000363191.1	C			87693987	+1	no_errors	ENST00000436978	ensembl	human	known	70_37	missense	SNP	0.011	T
RABGAP1L	9910	genome.wustl.edu	37	1	174274226	174274226	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:174274226G>C	ENST00000251507.4	+	11	1600	c.1426G>C	c.(1426-1428)Ggg>Cgg	p.G476R	RABGAP1L_ENST00000357444.6_Missense_Mutation_p.G439R|RABGAP1L_ENST00000367689.3_Missense_Mutation_p.G123R	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						TACTAGTGGAGGGGGTCCAAT	0.463																																																	0													86.0	73.0	78.0					1																	174274226		2203	4300	6503	SO:0001583	missense	9910			AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.1426G>C	1.37:g.174274226G>C	ENSP00000251507:p.Gly476Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZAA4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.G476R	ENST00000251507.4	37	c.1426	CCDS1314.1	1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687553	0.48097	.	.	ENSG00000152061	ENST00000357444;ENST00000367689;ENST00000251507;ENST00000457696;ENST00000367692	T;T;T	0.43688	0.94;3.53;0.96	5.33	5.33	0.75918	.	0.259162	0.37261	N	0.002175	T	0.34716	0.0907	L	0.40543	1.245	0.80722	D	1	B;B;B;B;B	0.32653	0.31;0.076;0.005;0.005;0.379	B;B;B;B;B	0.30105	0.07;0.052;0.008;0.008;0.111	T	0.09862	-1.0655	10	0.27082	T	0.32	.	15.7623	0.78096	0.0:0.0:1.0:0.0	.	488;123;476;476;439	B7WPG6;Q5JZA9;F1LJ00;Q5R372;Q5R372-2	.;.;.;RBG1L_HUMAN;.	R	439;123;476;488;488	ENSP00000350027:G439R;ENSP00000251507:G476R;ENSP00000403136:G488R	ENSP00000251507:G476R	G	+	1	0	RABGAP1L	172540849	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.759000	0.68785	2.480000	0.83734	0.655000	0.94253	GGG	RABGAP1L	-	NULL		0.463	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1L	HGNC	protein_coding	OTTHUMT00000084497.1	G	NM_001243765		174274226	+1	no_errors	ENST00000251507	ensembl	human	known	70_37	missense	SNP	1.000	C
RABGAP1L	9910	genome.wustl.edu	37	1	174274226	174274226	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:174274226G>C	ENST00000251507.4	+	11	1600	c.1426G>C	c.(1426-1428)Ggg>Cgg	p.G476R	RABGAP1L_ENST00000357444.6_Missense_Mutation_p.G439R|RABGAP1L_ENST00000367689.3_Missense_Mutation_p.G123R	NM_014857.4	NP_055672.3	B7ZAP0	RBG10_HUMAN	RAB GTPase activating protein 1-like	0										NS(1)|breast(2)|endometrium(4)|kidney(5)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(2)	45						TACTAGTGGAGGGGGTCCAAT	0.463																																																	0													86.0	73.0	78.0					1																	174274226		2203	4300	6503	SO:0001583	missense	9910			AF279778	CCDS1314.1, CCDS41437.1, CCDS55662.1, CCDS58046.1	1q24	2011-11-21			ENSG00000152061	ENSG00000152061			24663	protein-coding gene	gene with protein product		609238				10585558	Standard	NM_014857		Approved	HHL, TBC1D18, KIAA0471, FLJ38519	uc001gjx.3	B7ZAP0	OTTHUMG00000034899	ENST00000251507.4:c.1426G>C	1.37:g.174274226G>C	ENSP00000251507:p.Gly476Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZAA4	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Kinesin-like,pfam_PTyr_interaction_dom,superfamily_Rab-GTPase-TBC_dom,smart_PTyr_interaction_dom,smart_Rab-GTPase-TBC_dom,pfscan_PTyr_interaction_dom,pfscan_Rab-GTPase-TBC_dom	p.G476R	ENST00000251507.4	37	c.1426	CCDS1314.1	1	.	.	.	.	.	.	.	.	.	.	G	14.95	2.687553	0.48097	.	.	ENSG00000152061	ENST00000357444;ENST00000367689;ENST00000251507;ENST00000457696;ENST00000367692	T;T;T	0.43688	0.94;3.53;0.96	5.33	5.33	0.75918	.	0.259162	0.37261	N	0.002175	T	0.34716	0.0907	L	0.40543	1.245	0.80722	D	1	B;B;B;B;B	0.32653	0.31;0.076;0.005;0.005;0.379	B;B;B;B;B	0.30105	0.07;0.052;0.008;0.008;0.111	T	0.09862	-1.0655	10	0.27082	T	0.32	.	15.7623	0.78096	0.0:0.0:1.0:0.0	.	488;123;476;476;439	B7WPG6;Q5JZA9;F1LJ00;Q5R372;Q5R372-2	.;.;.;RBG1L_HUMAN;.	R	439;123;476;488;488	ENSP00000350027:G439R;ENSP00000251507:G476R;ENSP00000403136:G488R	ENSP00000251507:G476R	G	+	1	0	RABGAP1L	172540849	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.759000	0.68785	2.480000	0.83734	0.655000	0.94253	GGG	RABGAP1L	-	NULL		0.463	RABGAP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGAP1L	HGNC	protein_coding	OTTHUMT00000084497.1	G	NM_001243765		174274226	+1	no_errors	ENST00000251507	ensembl	human	known	70_37	missense	SNP	1.000	C
PTPN14	5784	genome.wustl.edu	37	1	214549657	214549657	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:214549657G>A	ENST00000366956.5	-	15	3006	c.2812C>T	c.(2812-2814)Cga>Tga	p.R938*	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	938	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TCACGGATTCGGCTGCGCTCG	0.458																																					Colon(92;557 1424 24372 34121 40073)												0													170.0	165.0	167.0					1																	214549657		2203	4300	6503	SO:0001587	stop_gained	5784			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2812C>T	1.37:g.214549657G>A	ENSP00000355923:p.Arg938*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VSI0	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.R938*	ENST00000366956.5	37	c.2812	CCDS1514.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.415788	0.99401	.	.	ENSG00000152104	ENST00000366956	.	.	.	5.12	4.2	0.49525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0834	0.72133	0.0:0.0:0.8571:0.1429	.	.	.	.	X	938	.	ENSP00000355923:R938X	R	-	1	2	PTPN14	212616280	1.000000	0.71417	0.987000	0.45799	0.739000	0.42172	6.508000	0.73721	1.153000	0.42468	-0.152000	0.13540	CGA	PTPN14	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_Tyr_Pase_rcpt/non-rcpt		0.458	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	G	NM_005401		214549657	-1	no_errors	ENST00000366956	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PTPN14	5784	genome.wustl.edu	37	1	214549657	214549657	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:214549657G>A	ENST00000366956.5	-	15	3006	c.2812C>T	c.(2812-2814)Cga>Tga	p.R938*	PTPN14_ENST00000543945.1_3'UTR	NM_005401.4	NP_005392.2	Q15678	PTN14_HUMAN	protein tyrosine phosphatase, non-receptor type 14	938	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				lymphangiogenesis (GO:0001946)|negative regulation of cell proliferation (GO:0008285)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|regulation of protein export from nucleus (GO:0046825)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|transcription cofactor activity (GO:0003712)			NS(2)|breast(3)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(9)|liver(3)|lung(21)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	58				OV - Ovarian serous cystadenocarcinoma(81;0.00181)|all cancers(67;0.00194)|Epithelial(68;0.0157)|GBM - Glioblastoma multiforme(131;0.155)		TCACGGATTCGGCTGCGCTCG	0.458																																					Colon(92;557 1424 24372 34121 40073)												0													170.0	165.0	167.0					1																	214549657		2203	4300	6503	SO:0001587	stop_gained	5784			X82676	CCDS1514.1	1q32.2	2011-06-09			ENSG00000152104	ENSG00000152104		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9647	protein-coding gene	gene with protein product		603155				7733990	Standard	NM_005401		Approved	PEZ	uc001hkk.2	Q15678	OTTHUMG00000037039	ENST00000366956.5:c.2812C>T	1.37:g.214549657G>A	ENSP00000355923:p.Arg938*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VSI0	Nonsense_Mutation	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_central,pfam_FERM_N,pfam_FERM_PH-like_C,pfam_Dual-sp_phosphatase_cat-dom,superfamily_FERM_central,smart_Band_41_domain,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_FERM_domain,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam	p.R938*	ENST00000366956.5	37	c.2812	CCDS1514.1	1	.	.	.	.	.	.	.	.	.	.	G	43	10.415788	0.99401	.	.	ENSG00000152104	ENST00000366956	.	.	.	5.12	4.2	0.49525	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	15.0834	0.72133	0.0:0.0:0.8571:0.1429	.	.	.	.	X	938	.	ENSP00000355923:R938X	R	-	1	2	PTPN14	212616280	1.000000	0.71417	0.987000	0.45799	0.739000	0.42172	6.508000	0.73721	1.153000	0.42468	-0.152000	0.13540	CGA	PTPN14	-	pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pirsf_Tyr_Pase_non-rcpt_typ-14/21,pfscan_Tyr_Pase_rcpt/non-rcpt		0.458	PTPN14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN14	HGNC	protein_coding	OTTHUMT00000089918.2	G	NM_005401		214549657	-1	no_errors	ENST00000366956	ensembl	human	known	70_37	nonsense	SNP	1.000	A
RASA3	22821	genome.wustl.edu	37	13	114806481	114806481	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:114806481C>T	ENST00000334062.7	-	4	488	c.367G>A	c.(367-369)Gtg>Atg	p.V123M	RASA3_ENST00000389544.4_Missense_Mutation_p.V91M|RASA3_ENST00000542651.1_Intron	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	123					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CTCACCTGCACTTCCGAGTCA	0.612																																																	0													206.0	168.0	181.0					13																	114806481		2203	4300	6503	SO:0001583	missense	22821				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.367G>A	13.37:g.114806481C>T	ENSP00000335029:p.Val123Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.V123M	ENST00000334062.7	37	c.367	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823578	0.71143	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.72615	-0.67;-0.67	5.12	5.12	0.69794	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.83977	0.5371	M	0.77486	2.375	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.84814	0.0792	9	.	.	.	.	17.347	0.87312	0.0:1.0:0.0:0.0	.	123	Q14644	RASA3_HUMAN	M	123;91	ENSP00000335029:V123M;ENSP00000374195:V91M	.	V	-	1	0	RASA3	113824583	1.000000	0.71417	0.943000	0.38184	0.302000	0.27658	6.377000	0.73145	2.388000	0.81334	0.563000	0.77884	GTG	RASA3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB		0.612	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	C	NM_007368		114806481	-1	no_errors	ENST00000334062	ensembl	human	known	70_37	missense	SNP	1.000	T
RASA3	22821	genome.wustl.edu	37	13	114806481	114806481	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:114806481C>T	ENST00000334062.7	-	4	488	c.367G>A	c.(367-369)Gtg>Atg	p.V123M	RASA3_ENST00000389544.4_Missense_Mutation_p.V91M|RASA3_ENST00000542651.1_Intron	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	123					calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			CTCACCTGCACTTCCGAGTCA	0.612																																																	0													206.0	168.0	181.0					13																	114806481		2203	4300	6503	SO:0001583	missense	22821				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.367G>A	13.37:g.114806481C>T	ENSP00000335029:p.Val123Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL15|F8W6X8|Q8IUY2	Missense_Mutation	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.V123M	ENST00000334062.7	37	c.367	CCDS32016.1	13	.	.	.	.	.	.	.	.	.	.	C	19.42	3.823578	0.71143	.	.	ENSG00000185989	ENST00000334062;ENST00000389544	T;T	0.72615	-0.67;-0.67	5.12	5.12	0.69794	C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	D	0.83977	0.5371	M	0.77486	2.375	0.80722	D	1	D	0.76494	0.999	D	0.72982	0.979	D	0.84814	0.0792	9	.	.	.	.	17.347	0.87312	0.0:1.0:0.0:0.0	.	123	Q14644	RASA3_HUMAN	M	123;91	ENSP00000335029:V123M;ENSP00000374195:V91M	.	V	-	1	0	RASA3	113824583	1.000000	0.71417	0.943000	0.38184	0.302000	0.27658	6.377000	0.73145	2.388000	0.81334	0.563000	0.77884	GTG	RASA3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB		0.612	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	C	NM_007368		114806481	-1	no_errors	ENST00000334062	ensembl	human	known	70_37	missense	SNP	1.000	T
REL	5966	genome.wustl.edu	37	2	61144086	61144086	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:61144086C>G	ENST00000295025.8	+	5	789	c.469C>G	c.(469-471)Cct>Gct	p.P157A	REL_ENST00000394479.3_Missense_Mutation_p.P157A	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	157	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			AGTTTTTCTCCCTGATGAACA	0.343			A		Hodgkin Lymphoma																																			Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	0													182.0	171.0	174.0					2																	61144086		2203	4300	6503	SO:0001583	missense	5966			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.469C>G	2.37:g.61144086C>G	ENSP00000295025:p.Pro157Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NF_Rel_dor	p.P157A	ENST00000295025.8	37	c.469	CCDS1864.1	2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703752	0.48412	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.43688	0.94;0.94	5.82	4.95	0.65309	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.184057	0.49305	D	0.000150	T	0.35653	0.0939	L	0.53249	1.67	0.45662	D	0.998582	B;B	0.31625	0.106;0.332	B;B	0.27887	0.029;0.084	T	0.12116	-1.0560	10	0.22706	T	0.39	-0.0115	11.8774	0.52554	0.0:0.8602:0.0:0.1398	.	157;157	Q17RU2;Q04864	.;REL_HUMAN	A	157	ENSP00000295025:P157A;ENSP00000377989:P157A	ENSP00000295025:P157A	P	+	1	0	REL	60997590	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	4.550000	0.60733	1.468000	0.48064	0.591000	0.81541	CCT	REL	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD		0.343	REL-001	KNOWN	basic|CCDS	protein_coding	REL	HGNC	protein_coding	OTTHUMT00000251576.3	C	NM_002908		61144086	+1	no_errors	ENST00000295025	ensembl	human	known	70_37	missense	SNP	1.000	G
REL	5966	genome.wustl.edu	37	2	61144086	61144086	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:61144086C>G	ENST00000295025.8	+	5	789	c.469C>G	c.(469-471)Cct>Gct	p.P157A	REL_ENST00000394479.3_Missense_Mutation_p.P157A	NM_002908.2	NP_002899.1	Q04864	REL_HUMAN	v-rel avian reticuloendotheliosis viral oncogene homolog	157	RHD. {ECO:0000255|PROSITE- ProRule:PRU00265}.				cytokine production (GO:0001816)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of neuron death (GO:1901215)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-12 biosynthetic process (GO:0045084)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|transcription factor complex (GO:0005667)	RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	16	all_hematologic(2;0.0797)	Ovarian(717;0.0728)	LUSC - Lung squamous cell carcinoma(5;6.2e-08)|Lung(5;1.65e-06)|Epithelial(17;0.064)|all cancers(80;0.221)			AGTTTTTCTCCCTGATGAACA	0.343			A		Hodgkin Lymphoma																																			Dom	yes		2	2p13-p12	5966	v-rel reticuloendotheliosis viral oncogene homolog (avian)		L	0													182.0	171.0	174.0					2																	61144086		2203	4300	6503	SO:0001583	missense	5966			M11595	CCDS1864.1, CCDS74515.1	2p13-p12	2013-07-09	2013-07-09		ENSG00000162924	ENSG00000162924			9954	protein-coding gene	gene with protein product		164910				1577270	Standard	XM_005264470		Approved	I-Rel, c-Rel	uc002sam.1	Q04864	OTTHUMG00000129418	ENST00000295025.8:c.469C>G	2.37:g.61144086C>G	ENSP00000295025:p.Pro157Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RU2|Q2PNZ7|Q6LDY0	Missense_Mutation	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NF_Rel_dor	p.P157A	ENST00000295025.8	37	c.469	CCDS1864.1	2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703752	0.48412	.	.	ENSG00000162924	ENST00000295025;ENST00000394479	T;T	0.43688	0.94;0.94	5.82	4.95	0.65309	Rel homology (3);p53-like transcription factor, DNA-binding (1);	0.184057	0.49305	D	0.000150	T	0.35653	0.0939	L	0.53249	1.67	0.45662	D	0.998582	B;B	0.31625	0.106;0.332	B;B	0.27887	0.029;0.084	T	0.12116	-1.0560	10	0.22706	T	0.39	-0.0115	11.8774	0.52554	0.0:0.8602:0.0:0.1398	.	157;157	Q17RU2;Q04864	.;REL_HUMAN	A	157	ENSP00000295025:P157A;ENSP00000377989:P157A	ENSP00000295025:P157A	P	+	1	0	REL	60997590	0.997000	0.39634	1.000000	0.80357	0.996000	0.88848	4.550000	0.60733	1.468000	0.48064	0.591000	0.81541	CCT	REL	-	pfam_RHD,superfamily_p53-like_TF_DNA-bd,pfscan_RHD		0.343	REL-001	KNOWN	basic|CCDS	protein_coding	REL	HGNC	protein_coding	OTTHUMT00000251576.3	C	NM_002908		61144086	+1	no_errors	ENST00000295025	ensembl	human	known	70_37	missense	SNP	1.000	G
RGS13	6003	genome.wustl.edu	37	1	192614607	192614607	+	Intron	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:192614607G>A	ENST00000391995.2	+	4	353				RGS13_ENST00000543215.1_Intron|RGS13_ENST00000482095.1_3'UTR	NM_002927.4	NP_002918.1	O14921	RGS13_HUMAN	regulator of G-protein signaling 13						G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)			endometrium(1)|kidney(1)|large_intestine(4)|lung(12)|skin(1)	19						ggggtttgaagattttaagta	0.338																																																	0																																										SO:0001627	intron_variant	6003			AF030107	CCDS1376.1	1q31.2	2008-02-05	2007-08-14		ENSG00000127074	ENSG00000127074		"""Regulators of G-protein signaling"""	9995	protein-coding gene	gene with protein product		607190	"""regulator of G-protein signalling 13"""			11875076	Standard	NM_144766		Approved		uc001gsk.3	O14921	OTTHUMG00000035601	ENST00000391995.2:c.65+1078G>A	1.37:g.192614607G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PGR2|Q8TD63|Q9BX45	RNA	SNP	-	NULL	ENST00000391995.2	37	NULL	CCDS1376.1	1																																																																																			RGS13	-	-		0.338	RGS13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS13	HGNC	protein_coding	OTTHUMT00000086400.1	G	NM_002927		192614607	+1	no_errors	ENST00000482095	ensembl	human	known	70_37	rna	SNP	0.009	A
RNF165	494470	genome.wustl.edu	37	18	43914264	43914264	+	Silent	SNP	C	C	T	rs79121450	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr18:43914264C>T	ENST00000269439.7	+	1	78	c.27C>T	c.(25-27)ctC>ctT	p.L9L	RNF165_ENST00000543885.1_5'UTR|RNF165_ENST00000587853.1_Silent_p.L9L|RNF165_ENST00000590330.1_Silent_p.L9L|RNF165_ENST00000588679.1_Silent_p.L9L	NM_152470.2	NP_689683.2	Q6ZSG1	RN165_HUMAN	ring finger protein 165	9							zinc ion binding (GO:0008270)			NS(1)|large_intestine(4)|lung(6)	11				READ - Rectum adenocarcinoma(1;0.0873)		TCGGCTATCTCGTGCTTCCAG	0.716																																																	0													101.0	77.0	85.0					18																	43914264		2203	4300	6503	SO:0001819	synonymous_variant	494470			BC012190	CCDS32823.1, CCDS58621.1	18q21.1	2014-01-03			ENSG00000141622	ENSG00000141622		"""RING-type (C3HC4) zinc fingers"""	31696	protein-coding gene	gene with protein product							Standard	NR_046357		Approved	ARKL2, RNF111L2	uc002lcb.1	Q6ZSG1		ENST00000269439.7:c.27C>T	18.37:g.43914264C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVD1	Silent	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING-CH,smart_Znf_RING,pfscan_Znf_RING	p.L9	ENST00000269439.7	37	c.27	CCDS32823.1	18																																																																																			RNF165	-	NULL		0.716	RNF165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF165	HGNC	protein_coding	OTTHUMT00000445358.1	C	NM_152470		43914264	+1	no_errors	ENST00000269439	ensembl	human	known	70_37	silent	SNP	1.000	T
RNF19B	127544	genome.wustl.edu	37	1	33409700	33409700	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:33409700C>T	ENST00000373456.7	-	6	1324	c.1325G>A	c.(1324-1326)cGt>cAt	p.R442H	RNF19B_ENST00000356990.5_Missense_Mutation_p.R441H|RNF19B_ENST00000235150.4_Missense_Mutation_p.R441H	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	442					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GCCGCCTCCACGACAAAGAGA	0.453																																																	0													65.0	59.0	61.0					1																	33409700		2203	4300	6503	SO:0001583	missense	127544			AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.1325G>A	1.37:g.33409700C>T	ENSP00000362555:p.Arg442His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.R442H	ENST00000373456.7	37	c.1325	CCDS372.2	1	.	.	.	.	.	.	.	.	.	.	C	34	5.321485	0.95682	.	.	ENSG00000116514	ENST00000373456;ENST00000356990;ENST00000235150;ENST00000405457	T;T;T	0.58506	0.35;0.54;0.33	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.76083	0.3938	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;0.999	T	0.76358	-0.2988	10	0.59425	D	0.04	.	19.7769	0.96398	0.0:1.0:0.0:0.0	.	441;442;441	G3XA82;Q6ZMZ0;E9PAW6	.;RN19B_HUMAN;.	H	442;441;441;340	ENSP00000362555:R442H;ENSP00000349482:R441H;ENSP00000235150:R441H	ENSP00000235150:R441H	R	-	2	0	RNF19B	33182287	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.745000	0.94114	0.655000	0.94253	CGT	RNF19B	-	NULL		0.453	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF19B	HGNC	protein_coding	OTTHUMT00000011465.3	C	NM_153341		33409700	-1	no_errors	ENST00000373456	ensembl	human	known	70_37	missense	SNP	1.000	T
RNF19B	127544	genome.wustl.edu	37	1	33409700	33409700	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:33409700C>T	ENST00000373456.7	-	6	1324	c.1325G>A	c.(1324-1326)cGt>cAt	p.R442H	RNF19B_ENST00000356990.5_Missense_Mutation_p.R441H|RNF19B_ENST00000235150.4_Missense_Mutation_p.R441H	NM_153341.2	NP_699172.2	Q6ZMZ0	RN19B_HUMAN	ring finger protein 19B	442					interferon-gamma secretion (GO:0072643)|natural killer cell mediated cytotoxicity (GO:0042267)|protein ubiquitination (GO:0016567)	cytolytic granule (GO:0044194)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(4)|kidney(2)|large_intestine(3)|lung(4)	13		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				GCCGCCTCCACGACAAAGAGA	0.453																																																	0													65.0	59.0	61.0					1																	33409700		2203	4300	6503	SO:0001583	missense	127544			AK074486	CCDS372.2, CCDS44107.1, CCDS72754.1	1p35.1	2010-05-11	2007-08-20	2007-08-20	ENSG00000116514	ENSG00000116514		"""RING-type (C3HC4) zinc fingers"""	26886	protein-coding gene	gene with protein product		610872	"""IBR domain containing 3"""	IBRDC3		12477932	Standard	XM_006710356		Approved	FLJ90005	uc010oho.2	Q6ZMZ0	OTTHUMG00000004013	ENST00000373456.7:c.1325G>A	1.37:g.33409700C>T	ENSP00000362555:p.Arg442His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLB2|E9PAW6|G3XA82|Q0VG77|Q5TH44|Q5TH45|Q6P6A4|Q8N2S8|Q8WUF3	Missense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.R442H	ENST00000373456.7	37	c.1325	CCDS372.2	1	.	.	.	.	.	.	.	.	.	.	C	34	5.321485	0.95682	.	.	ENSG00000116514	ENST00000373456;ENST00000356990;ENST00000235150;ENST00000405457	T;T;T	0.58506	0.35;0.54;0.33	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.76083	0.3938	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.996;0.999	T	0.76358	-0.2988	10	0.59425	D	0.04	.	19.7769	0.96398	0.0:1.0:0.0:0.0	.	441;442;441	G3XA82;Q6ZMZ0;E9PAW6	.;RN19B_HUMAN;.	H	442;441;441;340	ENSP00000362555:R442H;ENSP00000349482:R441H;ENSP00000235150:R441H	ENSP00000235150:R441H	R	-	2	0	RNF19B	33182287	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.745000	0.94114	0.655000	0.94253	CGT	RNF19B	-	NULL		0.453	RNF19B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNF19B	HGNC	protein_coding	OTTHUMT00000011465.3	C	NM_153341		33409700	-1	no_errors	ENST00000373456	ensembl	human	known	70_37	missense	SNP	1.000	T
RPS6KA2	6196	genome.wustl.edu	37	6	166876574	166876574	+	Intron	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr6:166876574G>C	ENST00000265678.4	-	12	1196				RPS6KA2_ENST00000481261.2_Intron|RPS6KA2-IT1_ENST00000416770.1_RNA|RPS6KA2_ENST00000405189.3_Intron|RPS6KA2_ENST00000510118.1_Intron|RPS6KA2_ENST00000503859.1_Intron	NM_021135.4	NP_066958.2	Q15349	KS6A2_HUMAN	ribosomal protein S6 kinase, 90kDa, polypeptide 2						axon guidance (GO:0007411)|brain renin-angiotensin system (GO:0002035)|cardiac muscle cell apoptotic process (GO:0010659)|cellular response to carbohydrate stimulus (GO:0071322)|heart contraction (GO:0060047)|heart development (GO:0007507)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell proliferation (GO:0008285)|negative regulation of meiosis (GO:0045835)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oocyte maturation (GO:0001556)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of gene expression (GO:0010628)|regulation of protein processing (GO:0070613)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle (GO:0005819)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|ribosomal protein S6 kinase activity (GO:0004711)			central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(15)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(1)	45		Breast(66;2.04e-05)|Ovarian(120;0.0652)|Prostate(117;0.105)		OV - Ovarian serous cystadenocarcinoma(33;2.76e-18)|GBM - Glioblastoma multiforme(31;9.94e-06)|BRCA - Breast invasive adenocarcinoma(81;1.36e-05)		TGGCCCTTTGGACGGCTTCCT	0.562																																																	0																																										SO:0001627	intron_variant	100874353			L07598	CCDS5294.1, CCDS34570.1	6q27	2011-04-05	2002-08-29		ENSG00000071242	ENSG00000071242			10431	protein-coding gene	gene with protein product		601685	"""ribosomal protein S6 kinase, 90kD, polypeptide 2"""			8141249	Standard	NM_001006932		Approved	RSK, RSK3, HU-2	uc003qvc.1	Q15349	OTTHUMG00000016007	ENST00000265678.4:c.973-3535C>G	6.37:g.166876574G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTK9|Q15419|Q59GJ3|Q5TI68|Q96J38|Q9UJN5	RNA	SNP	-	NULL	ENST00000265678.4	37	NULL	CCDS5294.1	6																																																																																			RPS6KA2-IT1	-	-		0.562	RPS6KA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS6KA2-IT1	HGNC	protein_coding	OTTHUMT00000043075.3	G	NM_021135		166876574	-1	no_errors	ENST00000416770	ensembl	human	known	70_37	rna	SNP	0.000	C
SARM1	23098	genome.wustl.edu	37	17	26715280	26715280	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:26715280G>C	ENST00000457710.3	+	6	2087	c.1616G>C	c.(1615-1617)gGt>gCt	p.G539A	SARM1_ENST00000379061.4_3'UTR	NM_015077.2	NP_055892.2	Q6SZW1	SARM1_HUMAN	sterile alpha and TIR motif containing 1	573	SAM 2. {ECO:0000255|PROSITE- ProRule:PRU00184}.				innate immune response (GO:0045087)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of apoptotic process (GO:0042981)|regulation of dendrite morphogenesis (GO:0048814)|regulation of neuron death (GO:1901214)|response to glucose (GO:0009749)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|extrinsic component of mitochondrial outer membrane (GO:0031315)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|synapse (GO:0045202)				cervix(1)|endometrium(1)|large_intestine(3)|lung(5)|skin(1)|upper_aerodigestive_tract(1)	12	all_lung(13;0.000533)|Lung NSC(42;0.00171)			UCEC - Uterine corpus endometrioid carcinoma (53;0.154)		CGGAACTCAGGTTCCCAGCTG	0.617																																																	0													29.0	24.0	26.0					17																	26715280		2174	4234	6408	SO:0001583	missense	23098			AB011096		17q11	2013-01-10			ENSG00000004139	ENSG00000004139		"""Sterile alpha motif (SAM) domain containing"""	17074	protein-coding gene	gene with protein product		607732				9628581	Standard	NM_015077		Approved	SARM, SAMD2, KIAA0524	uc010crl.1	Q6SZW1	OTTHUMG00000132499	ENST00000457710.3:c.1616G>C	17.37:g.26715280G>C	ENSP00000406738:p.Gly539Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	O60277|Q7LGG3|Q9NXY5	Missense_Mutation	SNP	pfam_SAM_2,pfam_SAM_type1,superfamily_ARM-type_fold,superfamily_TIR_dom,superfamily_SAM/pointed,smart_SAM,smart_TIR_dom,pfscan_SAM	p.G539A	ENST00000457710.3	37	c.1616		17	.	.	.	.	.	.	.	.	.	.	G	29.3	4.996748	0.93167	.	.	ENSG00000004139	ENST00000457710;ENST00000003834	.	.	.	5.24	5.24	0.73138	Toll/interleukin-1 receptor homology (TIR) domain (2);	0.000000	0.85682	D	0.000000	T	0.79851	0.4517	.	.	.	0.80722	D	1	D	0.76494	0.999	D	0.91635	0.999	T	0.81967	-0.0690	8	0.87932	D	0	-29.7548	16.7747	0.85548	0.0:0.0:1.0:0.0	.	573	Q6SZW1	SARM1_HUMAN	A	571;539	.	ENSP00000003834:G539A	G	+	2	0	SARM1	23739407	1.000000	0.71417	0.999000	0.59377	0.994000	0.84299	9.625000	0.98406	2.726000	0.93360	0.655000	0.94253	GGT	SARM1	-	superfamily_TIR_dom,smart_TIR_dom		0.617	SARM1-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	SARM1	HGNC	protein_coding	OTTHUMT00000255679.3	G	NM_015077		26715280	+1	no_errors	ENST00000457710	ensembl	human	novel	70_37	missense	SNP	1.000	C
SEPT9	10801	genome.wustl.edu	37	17	75370193	75370193	+	Intron	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:75370193C>T	ENST00000427177.1	+	3	202				SEPT9_ENST00000449803.2_Intron|SEPT9_ENST00000431235.2_Intron|SEPT9_ENST00000591198.1_Intron|SEPT9_ENST00000427674.2_5'Flank|SEPT9_ENST00000590294.1_Intron|SEPT9_ENST00000588690.1_Intron|RP11-936I5.1_ENST00000588701.1_RNA|SEPT9_ENST00000423034.2_Intron|SEPT9_ENST00000329047.8_Intron	NM_001113491.1	NP_001106963.1	Q9UHD8	SEPT9_HUMAN	septin 9						cell cycle (GO:0007049)|cell division (GO:0051301)|GTP catabolic process (GO:0006184)|protein heterooligomerization (GO:0051291)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|perinuclear region of cytoplasm (GO:0048471)|stress fiber (GO:0001725)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)			autonomic_ganglia(1)|breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)|ovary(1)|pancreas(1)|prostate(2)	16			BRCA - Breast invasive adenocarcinoma(99;0.153)			GCCCGTGGGCCGGGAGCACCG	0.687																																																	0																																										SO:0001627	intron_variant	10801			AB023208	CCDS45790.1, CCDS45791.1, CCDS45792.1, CCDS45793.1, CCDS45794.1, CCDS45795.1, CCDS74166.1	17q25.3	2014-09-17	2005-01-11	2005-01-12	ENSG00000184640	ENSG00000184640		"""Septins"""	7323	protein-coding gene	gene with protein product	"""Ov/Br septin"""	604061	"""MLL septin-like fusion"""	MSF		10339604, 10485469	Standard	NM_006640		Approved	MSF1, KIAA0991, PNUTL4, AF17q25, SeptD1	uc002jts.4	Q9UHD8		ENST00000427177.1:c.77-27948C>T	17.37:g.75370193C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2V3|B3KPM0|B4DTL9|B4E0N2|B4E274|B7Z654|Q96QF3|Q96QF4|Q96QF5|Q9HA04|Q9UG40|Q9Y5W4	RNA	SNP	-	NULL	ENST00000427177.1	37	NULL	CCDS45790.1	17																																																																																			SEPT9	-	-		0.687	SEPT9-001	KNOWN	basic|CCDS	protein_coding	SEPT9	HGNC	protein_coding	OTTHUMT00000436304.2	C	NM_006640		75370193	+1	no_errors	ENST00000587514	ensembl	human	known	70_37	rna	SNP	0.000	T
SNAI3	333929	genome.wustl.edu	37	16	88741249	88741249	+	IGR	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr16:88741249G>A	ENST00000332281.5	-	0	1732				SNAI3-AS1_ENST00000569786.1_RNA|SNAI3-AS1_ENST00000568633.1_RNA|SNAI3-AS1_ENST00000563475.1_RNA|SNAI3-AS1_ENST00000563261.1_RNA|SNAI3-AS1_ENST00000565633.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		CCAGACCTGCGTTAAGTGGAG	0.662																																					Colon(27;366 710 19748 23199 27567)												0																																										SO:0001628	intergenic_variant	197187			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1			16.37:g.88741249G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SU5	RNA	SNP	-	NULL	ENST00000332281.5	37	NULL	CCDS32505.1	16																																																																																			SNAI3-AS1	-	-		0.662	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3-AS1	HGNC	protein_coding	OTTHUMT00000422582.1	G			88741249	+1	no_errors	ENST00000563475	ensembl	human	known	70_37	rna	SNP	0.000	A
SPANXN5	494197	genome.wustl.edu	37	X	52826382	52826382	+	Nonsense_Mutation	SNP	T	T	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:52826382T>A	ENST00000375511.3	-	1	759	c.7A>T	c.(7-9)Aag>Tag	p.K3*		NM_001009616.3	NP_001009616.1	Q5MJ07	SPXN5_HUMAN	SPANX family, member N5	3										large_intestine(1)|lung(5)|skin(2)	8	Ovarian(276;0.236)					GAAGTGGGCTTTTCCATGATT	0.473																																																	0													275.0	229.0	244.0					X																	52826382		2203	4300	6503	SO:0001587	stop_gained	494197				CCDS35295.1	Xp11.22	2009-03-25				ENSG00000204363			33178	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 10"""	300668				14973187, 17012309	Standard	NM_001009616		Approved	SPANX-N5, CT11.10	uc004drc.1	Q5MJ07		ENST00000375511.3:c.7A>T	X.37:g.52826382T>A	ENSP00000364661:p.Lys3*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_SPANX_prot	p.K3*	ENST00000375511.3	37	c.7	CCDS35295.1	X	.	.	.	.	.	.	.	.	.	.	t	36	5.863909	0.97043	.	.	ENSG00000204363	ENST00000375511	.	.	.	0.137	-0.274	0.12910	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999995	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	.	.	.	.	.	.	.	X	3	.	ENSP00000364661:K3X	K	-	1	0	SPANXN5	52843107	0.290000	0.24343	0.005000	0.12908	0.005000	0.04900	0.665000	0.25083	-0.837000	0.04223	-0.828000	0.03084	AAG	SPANXN5	-	pfam_SPANX_prot		0.473	SPANXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN5	HGNC	protein_coding	OTTHUMT00000056690.2	T	NM_001009616		52826382	-1	no_errors	ENST00000375511	ensembl	human	known	70_37	nonsense	SNP	0.005	A
SPANXN5	494197	genome.wustl.edu	37	X	52826382	52826382	+	Nonsense_Mutation	SNP	T	T	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chrX:52826382T>A	ENST00000375511.3	-	1	759	c.7A>T	c.(7-9)Aag>Tag	p.K3*		NM_001009616.3	NP_001009616.1	Q5MJ07	SPXN5_HUMAN	SPANX family, member N5	3										large_intestine(1)|lung(5)|skin(2)	8	Ovarian(276;0.236)					GAAGTGGGCTTTTCCATGATT	0.473																																																	0													275.0	229.0	244.0					X																	52826382		2203	4300	6503	SO:0001587	stop_gained	494197				CCDS35295.1	Xp11.22	2009-03-25				ENSG00000204363			33178	protein-coding gene	gene with protein product	"""cancer/testis antigen family 11, member 10"""	300668				14973187, 17012309	Standard	NM_001009616		Approved	SPANX-N5, CT11.10	uc004drc.1	Q5MJ07		ENST00000375511.3:c.7A>T	X.37:g.52826382T>A	ENSP00000364661:p.Lys3*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_SPANX_prot	p.K3*	ENST00000375511.3	37	c.7	CCDS35295.1	X	.	.	.	.	.	.	.	.	.	.	t	36	5.863909	0.97043	.	.	ENSG00000204363	ENST00000375511	.	.	.	0.137	-0.274	0.12910	.	.	.	.	.	.	.	.	.	.	.	0.58432	A	0.999995	.	.	.	.	.	.	.	.	.	.	0.23302	T	0.38	.	.	.	.	.	.	.	.	X	3	.	ENSP00000364661:K3X	K	-	1	0	SPANXN5	52843107	0.290000	0.24343	0.005000	0.12908	0.005000	0.04900	0.665000	0.25083	-0.837000	0.04223	-0.828000	0.03084	AAG	SPANXN5	-	pfam_SPANX_prot		0.473	SPANXN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPANXN5	HGNC	protein_coding	OTTHUMT00000056690.2	T	NM_001009616		52826382	-1	no_errors	ENST00000375511	ensembl	human	known	70_37	nonsense	SNP	0.005	A
SPEF2	79925	genome.wustl.edu	37	5	35695837	35695837	+	Splice_Site	SNP	G	G	T	rs372421308		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:35695837G>T	ENST00000356031.3	+	14	2130	c.1976G>T	c.(1975-1977)aGt>aTt	p.S659I	SPEF2_ENST00000440995.2_Splice_Site_p.G654V|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Splice_Site_p.G654V	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	659					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTATTGCTAGGTGCTAATGCT	0.318																																																	0													126.0	115.0	118.0					5																	35695837		1841	4089	5930	SO:0001630	splice_region_variant	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1976-1G>T	5.37:g.35695837G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.S659I	ENST00000356031.3	37	c.1976	CCDS43309.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.454|5.454	0.268921|0.268921	0.10349|0.10349	.|.	.|.	ENSG00000152582|ENSG00000152582	ENST00000509059;ENST00000440995;ENST00000504054|ENST00000356031	T;T;T|T	0.31510|0.06687	3.26;3.35;1.49|3.27	4.79|4.79	1.03|1.03	0.20045|0.20045	.|.	.|0.643829	.|0.16148	.|N	.|0.227419	T|T	0.05960|0.05960	0.0155|0.0155	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	P;P|B	0.50710|0.28512	0.938;0.61|0.214	B;B|B	0.43508|0.22386	0.422;0.277|0.039	T|T	0.41142|0.41142	-0.9525|-0.9525	8|9	.|.	.|.	.|.	.|.	7.5463|7.5463	0.27768|0.27768	0.361:0.0:0.639:0.0|0.361:0.0:0.639:0.0	.|.	654;654|659	D6REZ4;Q9C093-2|Q9C093	.;.|SPEF2_HUMAN	V|I	654;654;165|659	ENSP00000421593:G654V;ENSP00000412125:G654V;ENSP00000421744:G165V|ENSP00000348314:S659I	.|.	G|S	+|+	2|2	0|0	SPEF2|SPEF2	35731594|35731594	0.373000|0.373000	0.25073|0.25073	0.621000|0.621000	0.29145|0.29145	0.018000|0.018000	0.09664|0.09664	-0.386000|-0.386000	0.07370|0.07370	0.056000|0.056000	0.16144|0.16144	-0.964000|-0.964000	0.02622|0.02622	GGT|AGT	SPEF2	-	NULL		0.318	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	G	NM_144722	Missense_Mutation	35695837	+1	no_errors	ENST00000356031	ensembl	human	known	70_37	missense	SNP	0.862	T
SPEF2	79925	genome.wustl.edu	37	5	35695837	35695837	+	Splice_Site	SNP	G	G	T	rs372421308		TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr5:35695837G>T	ENST00000356031.3	+	14	2130	c.1976G>T	c.(1975-1977)aGt>aTt	p.S659I	SPEF2_ENST00000440995.2_Splice_Site_p.G654V|CTD-2113L7.1_ENST00000510433.1_RNA|SPEF2_ENST00000509059.1_Splice_Site_p.G654V	NM_024867.3	NP_079143.3	Q9C093	SPEF2_HUMAN	sperm flagellar 2	659					axoneme assembly (GO:0035082)|brain morphogenesis (GO:0048854)|embryonic neurocranium morphogenesis (GO:0048702)|fertilization (GO:0009566)|immune system development (GO:0002520)|multicellular organismal aging (GO:0010259)|respiratory system development (GO:0060541)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)|manchette (GO:0002177)|sperm midpiece (GO:0097225)				breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(15)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	37	all_lung(31;7.56e-05)		Lung(74;0.111)|COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CTATTGCTAGGTGCTAATGCT	0.318																																																	0													126.0	115.0	118.0					5																	35695837		1841	4089	5930	SO:0001630	splice_region_variant	79925			AB051557	CCDS3910.1, CCDS43309.1	5p13.2	2010-05-04			ENSG00000152582	ENSG00000152582			26293	protein-coding gene	gene with protein product	"""cancer/testis antigen 122"""	610172				11214970, 16549801, 17610085	Standard	NM_024867		Approved	KPL2, FLJ23577, CT122	uc003jjo.3	Q9C093	OTTHUMG00000131111	ENST00000356031.3:c.1976-1G>T	5.37:g.35695837G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TAC9|Q96LL6|Q9H5C7|Q9H5Q7	Missense_Mutation	SNP	pfam_DUF1042,pfam_Adenylate_kin,pfam_HATC,superfamily_CH-domain,pfscan_CH-domain	p.S659I	ENST00000356031.3	37	c.1976	CCDS43309.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.454|5.454	0.268921|0.268921	0.10349|0.10349	.|.	.|.	ENSG00000152582|ENSG00000152582	ENST00000509059;ENST00000440995;ENST00000504054|ENST00000356031	T;T;T|T	0.31510|0.06687	3.26;3.35;1.49|3.27	4.79|4.79	1.03|1.03	0.20045|0.20045	.|.	.|0.643829	.|0.16148	.|N	.|0.227419	T|T	0.05960|0.05960	0.0155|0.0155	L|L	0.36672|0.36672	1.1|1.1	0.80722|0.80722	D|D	1|1	P;P|B	0.50710|0.28512	0.938;0.61|0.214	B;B|B	0.43508|0.22386	0.422;0.277|0.039	T|T	0.41142|0.41142	-0.9525|-0.9525	8|9	.|.	.|.	.|.	.|.	7.5463|7.5463	0.27768|0.27768	0.361:0.0:0.639:0.0|0.361:0.0:0.639:0.0	.|.	654;654|659	D6REZ4;Q9C093-2|Q9C093	.;.|SPEF2_HUMAN	V|I	654;654;165|659	ENSP00000421593:G654V;ENSP00000412125:G654V;ENSP00000421744:G165V|ENSP00000348314:S659I	.|.	G|S	+|+	2|2	0|0	SPEF2|SPEF2	35731594|35731594	0.373000|0.373000	0.25073|0.25073	0.621000|0.621000	0.29145|0.29145	0.018000|0.018000	0.09664|0.09664	-0.386000|-0.386000	0.07370|0.07370	0.056000|0.056000	0.16144|0.16144	-0.964000|-0.964000	0.02622|0.02622	GGT|AGT	SPEF2	-	NULL		0.318	SPEF2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SPEF2	HGNC	protein_coding	OTTHUMT00000367199.1	G	NM_144722	Missense_Mutation	35695837	+1	no_errors	ENST00000356031	ensembl	human	known	70_37	missense	SNP	0.862	T
STARD13	90627	genome.wustl.edu	37	13	33854108	33854109	+	Intron	INS	-	-	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr13:33854108_33854109insA	ENST00000336934.5	-	1	286				STARD13-AS_ENST00000608060.1_RNA|STARD13-AS_ENST00000609615.1_RNA|STARD13-AS_ENST00000609997.1_RNA|STARD13-AS_ENST00000609063.1_RNA|STARD13-AS_ENST00000589122.1_RNA|STARD13-AS_ENST00000609167.1_RNA|STARD13-AS_ENST00000592544.1_RNA|STARD13-AS_ENST00000590003.1_RNA|STARD13-AS_ENST00000609335.1_RNA|STARD13-AS_ENST00000609233.1_RNA|STARD13-AS_ENST00000588966.1_RNA|STARD13-AS_ENST00000608539.1_RNA|STARD13-AS_ENST00000590997.1_RNA|STARD13-AS_ENST00000608315.1_RNA|STARD13-AS_ENST00000609137.1_RNA|STARD13-AS_ENST00000609788.1_RNA|STARD13-AS_ENST00000589800.1_RNA|STARD13-AS_ENST00000608695.1_RNA|STARD13-AS_ENST00000610218.1_RNA|STARD13-AS_ENST00000588660.1_RNA|STARD13-AS_ENST00000609061.1_RNA|STARD13-AS_ENST00000609588.1_RNA|STARD13-AS_ENST00000589816.1_RNA|STARD13-AS_ENST00000589472.1_RNA|STARD13-AS_ENST00000608205.1_RNA|STARD13-AS_ENST00000590434.1_RNA|STARD13-AS_ENST00000591781.1_RNA|STARD13-AS_ENST00000586424.1_RNA|STARD13-AS_ENST00000609343.1_RNA|STARD13-AS_ENST00000608175.1_RNA|STARD13-AS_ENST00000609536.1_RNA|STARD13-AS_ENST00000609608.1_RNA|STARD13-AS_ENST00000609108.1_RNA|STARD13-AS_ENST00000607935.1_RNA|STARD13-AS_ENST00000608628.1_RNA|STARD13-AS_ENST00000587441.1_RNA|STARD13_ENST00000487412.1_Intron|STARD13-AS_ENST00000607944.1_RNA|STARD13-AS_ENST00000609790.1_RNA|STARD13-AS_ENST00000608197.1_RNA|STARD13-AS_ENST00000609351.1_RNA	NM_001243476.1|NM_178006.3	NP_001230405.1|NP_821074.1	Q9Y3M8	STA13_HUMAN	StAR-related lipid transfer (START) domain containing 13						regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|lipid particle (GO:0005811)|membrane (GO:0016020)|mitochondrion (GO:0005739)	GTPase activator activity (GO:0005096)|lipid binding (GO:0008289)			breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	40	all_epithelial(80;0.155)	Lung SC(185;0.0367)		all cancers(112;1.31e-05)|Epithelial(112;0.000142)|BRCA - Breast invasive adenocarcinoma(63;0.00936)|OV - Ovarian serous cystadenocarcinoma(117;0.0533)|Lung(94;0.143)|GBM - Glioblastoma multiforme(144;0.143)		TTGCCACTCTTAAAAAAAAAAA	0.421																																																	0																																										SO:0001627	intron_variant	100874241			AL049801	CCDS9348.1, CCDS9349.1, CCDS9350.1	13q13.1	2013-08-13	2007-08-16		ENSG00000133121	ENSG00000133121		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	19164	protein-coding gene	gene with protein product		609866	"""START domain containing 13"", ""long intergenic non-protein coding RNA 464"""	LINC00464		8812419	Standard	NM_178006		Approved	GT650, DLC2, ARHGAP37	uc001uuw.3	Q9Y3M8	OTTHUMG00000016708	ENST00000336934.5:c.169+5497->T	13.37:g.33854119_33854119dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A309|A2A310|Q5HYH1|Q5TAE3|Q6UN61|Q86TP6|Q86WQ3|Q86XT1	RNA	INS	-	NULL	ENST00000336934.5	37	NULL	CCDS9348.1	13																																																																																			STARD13-AS2	-	-		0.421	STARD13-006	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD13-AS2	HGNC	protein_coding	OTTHUMT00000276118.2	-	NM_001243466		33854109	+1	no_errors	ENST00000585861	ensembl	human	known	70_37	rna	INS	0.161:0.041	A
TBP	6908	genome.wustl.edu	37	6	170871052	170871052	+	Silent	SNP	G	G	A	rs112083427|rs369312237	byFrequency	TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr6:170871052G>A	ENST00000392092.2	+	3	507	c.228G>A	c.(226-228)caG>caA	p.Q76Q	TBP_ENST00000230354.6_Silent_p.Q76Q|TBP_ENST00000540980.1_Silent_p.Q56Q	NM_003194.4	NP_003185.1	P20226	TBP_HUMAN	TATA box binding protein	76	Poly-Gln.				cell death (GO:0008219)|gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|spermatogenesis (GO:0007283)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase I promoter (GO:0006360)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase I promoter (GO:0006361)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|female pronucleus (GO:0001939)|male pronucleus (GO:0001940)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|transcription factor TFIIA complex (GO:0005672)|transcription factor TFIID complex (GO:0005669)	repressing transcription factor binding (GO:0070491)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)	p.Q76Q(4)		breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(4)|urinary_tract(1)	26		Breast(66;5.08e-05)|Ovarian(120;0.125)|Esophageal squamous(34;0.246)		OV - Ovarian serous cystadenocarcinoma(33;1.07e-22)|BRCA - Breast invasive adenocarcinoma(81;5.01e-06)|GBM - Glioblastoma multiforme(31;0.00591)		agcaacagcagcagcagcagc	0.572																																																	4	Substitution - coding silent(4)	lung(3)|prostate(1)											14.0	19.0	17.0					6																	170871052		1952	3842	5794	SO:0001819	synonymous_variant	6908			M55654	CCDS5315.1, CCDS55077.1	6q27	2014-04-02			ENSG00000112592	ENSG00000112592		"""General transcription factors"""	11588	protein-coding gene	gene with protein product		600075		GTF2D1, SCA17		2194289, 11448935	Standard	NM_003194		Approved	TFIID	uc003qxu.3	P20226	OTTHUMG00000016084	ENST00000392092.2:c.228G>A	6.37:g.170871052G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3B3|F5H869|Q16845|Q6IBM6|Q9UC02	Silent	SNP	pfam_TBP,prints_TBP	p.Q76	ENST00000392092.2	37	c.228	CCDS5315.1	6																																																																																			TBP	-	NULL		0.572	TBP-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBP	HGNC	protein_coding	OTTHUMT00000043271.2	G	NM_003194		170871052	+1	no_errors	ENST00000230354	ensembl	human	known	70_37	silent	SNP	0.994	A
TSPAN10	83882	genome.wustl.edu	37	17	79613521	79613521	+	RNA	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:79613521C>T	ENST00000572675.1	+	0	674				TSPAN10_ENST00000328585.4_RNA			Q9H1Z9	TSN10_HUMAN	tetraspanin 10						establishment of protein localization to organelle (GO:0072594)	integral component of membrane (GO:0016021)	enzyme binding (GO:0019899)			ovary(1)	1	all_neural(118;0.0878)|all_lung(278;0.175)|Lung NSC(278;0.192)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			ctggctaacacgatgaaaccc	0.557																																																	0																																												83882			BC032802		17q25.3	2013-10-02			ENSG00000182612	ENSG00000182612		"""Tetraspanins"""	29942	protein-coding gene	gene with protein product	"""oculospanin"""					12107410	Standard	NM_031945		Approved	OCSP	uc010die.3	Q9H1Z9	OTTHUMG00000178037		17.37:g.79613521C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N548	RNA	SNP	-	NULL	ENST00000572675.1	37	NULL		17																																																																																			TSPAN10	-	-		0.557	TSPAN10-001	KNOWN	basic	polymorphic_pseudogene	TSPAN10	HGNC	polymorphic_pseudogene	OTTHUMT00000440313.1	C	NM_031945		79613521	+1	no_errors	ENST00000571707	ensembl	human	known	70_37	rna	SNP	0.001	T
VWA7	80737	genome.wustl.edu	37	6	31733527	31733527	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr6:31733527G>A	ENST00000375688.4	-	17	2720	c.2520C>T	c.(2518-2520)acC>acT	p.T840T	VWA7_ENST00000467576.1_5'Flank|SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000375686.3_Missense_Mutation_p.R850W			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	840						extracellular region (GO:0005576)											CAGATGAGCCGGTAGGGGTGG	0.617																																																	0													81.0	42.0	56.0					6																	31733527		1510	2707	4217	SO:0001819	synonymous_variant	80737				CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2520C>T	6.37:g.31733527G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	NULL	p.R850W	ENST00000375688.4	37	c.2548	CCDS4721.2	6	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950416	0.34377	.	.	ENSG00000204396	ENST00000375686	T	0.15603	2.41	4.87	2.51	0.30379	.	.	.	.	.	T	0.08358	0.0208	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.26018	-1.0115	6	0.62326	D	0.03	-0.7774	6.6044	0.22718	0.2882:0.0:0.7118:0.0	.	.	.	.	W	850	ENSP00000364838:R850W	ENSP00000364838:R850W	R	-	1	2	C6orf27	31841506	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.136000	0.15974	0.443000	0.26582	0.650000	0.86243	CGG	VWA7	-	NULL		0.617	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VWA7	HGNC	protein_coding	OTTHUMT00000076233.2	G	NM_025258		31733527	-1	no_errors	ENST00000375686	ensembl	human	known	70_37	missense	SNP	0.001	A
VWA7	80737	genome.wustl.edu	37	6	31733527	31733527	+	Silent	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr6:31733527G>A	ENST00000375688.4	-	17	2720	c.2520C>T	c.(2518-2520)acC>acT	p.T840T	VWA7_ENST00000467576.1_5'Flank|SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000375686.3_Missense_Mutation_p.R850W			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	840						extracellular region (GO:0005576)											CAGATGAGCCGGTAGGGGTGG	0.617																																																	0													81.0	42.0	56.0					6																	31733527		1510	2707	4217	SO:0001819	synonymous_variant	80737				CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2520C>T	6.37:g.31733527G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	NULL	p.R850W	ENST00000375688.4	37	c.2548	CCDS4721.2	6	.	.	.	.	.	.	.	.	.	.	G	12.48	1.950416	0.34377	.	.	ENSG00000204396	ENST00000375686	T	0.15603	2.41	4.87	2.51	0.30379	.	.	.	.	.	T	0.08358	0.0208	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.26018	-1.0115	6	0.62326	D	0.03	-0.7774	6.6044	0.22718	0.2882:0.0:0.7118:0.0	.	.	.	.	W	850	ENSP00000364838:R850W	ENSP00000364838:R850W	R	-	1	2	C6orf27	31841506	0.000000	0.05858	0.001000	0.08648	0.013000	0.08279	0.136000	0.15974	0.443000	0.26582	0.650000	0.86243	CGG	VWA7	-	NULL		0.617	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VWA7	HGNC	protein_coding	OTTHUMT00000076233.2	G	NM_025258		31733527	-1	no_errors	ENST00000375686	ensembl	human	known	70_37	missense	SNP	0.001	A
XRN2	22803	genome.wustl.edu	37	20	21367612	21367612	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr20:21367612C>G	ENST00000377191.3	+	29	2850	c.2755C>G	c.(2755-2757)Cca>Gca	p.P919A	XRN2_ENST00000430571.2_Missense_Mutation_p.P843A|XRN2_ENST00000539513.1_Missense_Mutation_p.P865A	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	919					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TGGTGGGTATCCACCCAGACG	0.522																																																	0													96.0	88.0	90.0					20																	21367612		2203	4300	6503	SO:0001583	missense	22803			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.2755C>G	20.37:g.21367612C>G	ENSP00000366396:p.Pro919Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	pfam_Put_53exo,superfamily_Znf_CCHC,pirsf_5_3_exoribonuclease_2	p.P919A	ENST00000377191.3	37	c.2755	CCDS13144.1	20	.	.	.	.	.	.	.	.	.	.	C	13.18	2.158738	0.38119	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.28069	1.63;1.63;1.63	5.95	5.01	0.66863	.	0.270344	0.38548	N	0.001654	T	0.18593	0.0446	N	0.14661	0.345	0.37709	D	0.924496	B	0.02656	0.0	B	0.04013	0.001	T	0.07233	-1.0783	10	0.48119	T	0.1	-4.7713	10.0355	0.42127	0.0:0.7901:0.1384:0.0715	.	919	Q9H0D6	XRN2_HUMAN	A	919;843;865	ENSP00000366396:P919A;ENSP00000413548:P843A;ENSP00000441113:P865A	ENSP00000366396:P919A	P	+	1	0	XRN2	21315612	1.000000	0.71417	0.997000	0.53966	0.872000	0.50106	2.657000	0.46724	1.523000	0.49018	0.655000	0.94253	CCA	XRN2	-	pirsf_5_3_exoribonuclease_2		0.522	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRN2	HGNC	protein_coding	OTTHUMT00000078273.2	C	NM_012255		21367612	+1	no_errors	ENST00000377191	ensembl	human	known	70_37	missense	SNP	1.000	G
XRN2	22803	genome.wustl.edu	37	20	21367612	21367612	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr20:21367612C>G	ENST00000377191.3	+	29	2850	c.2755C>G	c.(2755-2757)Cca>Gca	p.P919A	XRN2_ENST00000430571.2_Missense_Mutation_p.P843A|XRN2_ENST00000539513.1_Missense_Mutation_p.P865A	NM_012255.3	NP_036387.2	Q9H0D6	XRN2_HUMAN	5'-3' exoribonuclease 2	919					cell growth (GO:0016049)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA-templated transcription, termination (GO:0006353)|mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA catabolic process (GO:0006401)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|RNA processing (GO:0006396)|spermatogenesis (GO:0007283)	aggresome (GO:0016235)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-3' exoribonuclease activity (GO:0004534)|nuclease activity (GO:0004518)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			endometrium(5)|kidney(6)|large_intestine(10)|lung(12)|ovary(1)|skin(5)	39						TGGTGGGTATCCACCCAGACG	0.522																																																	0													96.0	88.0	90.0					20																	21367612		2203	4300	6503	SO:0001583	missense	22803			AF064257	CCDS13144.1	20p11.2-p11.1	2011-09-12			ENSG00000088930	ENSG00000088930	3.1.13.-		12836	protein-coding gene	gene with protein product		608851				10409438	Standard	NM_012255		Approved		uc002wsf.1	Q9H0D6	OTTHUMG00000032025	ENST00000377191.3:c.2755C>G	20.37:g.21367612C>G	ENSP00000366396:p.Pro919Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3L8N4|Q6KGZ9|Q9BQL1|Q9NTW0|Q9NXS6|Q9UL53	Missense_Mutation	SNP	pfam_Put_53exo,superfamily_Znf_CCHC,pirsf_5_3_exoribonuclease_2	p.P919A	ENST00000377191.3	37	c.2755	CCDS13144.1	20	.	.	.	.	.	.	.	.	.	.	C	13.18	2.158738	0.38119	.	.	ENSG00000088930	ENST00000377191;ENST00000430571;ENST00000539513	T;T;T	0.28069	1.63;1.63;1.63	5.95	5.01	0.66863	.	0.270344	0.38548	N	0.001654	T	0.18593	0.0446	N	0.14661	0.345	0.37709	D	0.924496	B	0.02656	0.0	B	0.04013	0.001	T	0.07233	-1.0783	10	0.48119	T	0.1	-4.7713	10.0355	0.42127	0.0:0.7901:0.1384:0.0715	.	919	Q9H0D6	XRN2_HUMAN	A	919;843;865	ENSP00000366396:P919A;ENSP00000413548:P843A;ENSP00000441113:P865A	ENSP00000366396:P919A	P	+	1	0	XRN2	21315612	1.000000	0.71417	0.997000	0.53966	0.872000	0.50106	2.657000	0.46724	1.523000	0.49018	0.655000	0.94253	CCA	XRN2	-	pirsf_5_3_exoribonuclease_2		0.522	XRN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRN2	HGNC	protein_coding	OTTHUMT00000078273.2	C	NM_012255		21367612	+1	no_errors	ENST00000377191	ensembl	human	known	70_37	missense	SNP	1.000	G
ZAN	7455	genome.wustl.edu	37	7	100349807	100349807	+	RNA	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:100349807G>A	ENST00000348028.3	+	0	2244				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCATCCCCACGGAAAAACCCA	0.532																																																	0													180.0	203.0	196.0					7																	100349807		1874	4108	5982			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349807G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.T693	ENST00000348028.3	37	c.2079		7																																																																																			ZAN	-	NULL		0.532	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	G	NM_003386		100349807	+1	no_errors	ENST00000546292	ensembl	human	known	70_37	silent	SNP	0.000	A
ZAN	7455	genome.wustl.edu	37	7	100349807	100349807	+	RNA	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr7:100349807G>A	ENST00000348028.3	+	0	2244				ZAN_ENST00000449052.1_RNA|ZAN_ENST00000542585.1_RNA|ZAN_ENST00000538115.1_RNA|ZAN_ENST00000546213.1_RNA|ZAN_ENST00000443370.1_RNA|ZAN_ENST00000427578.1_RNA|ZAN_ENST00000349350.6_RNA|ZAN_ENST00000546292.1_RNA|ZAN_ENST00000421100.1_RNA			Q9Y493	ZAN_HUMAN	zonadhesin (gene/pseudogene)						binding of sperm to zona pellucida (GO:0007339)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(2)|breast(3)|central_nervous_system(3)|endometrium(21)|kidney(6)|large_intestine(18)|lung(60)|ovary(4)|pancreas(3)|prostate(5)|skin(8)|stomach(3)|upper_aerodigestive_tract(3)	139	Lung NSC(181;0.041)|all_lung(186;0.0581)		STAD - Stomach adenocarcinoma(171;0.19)			GCATCCCCACGGAAAAACCCA	0.532																																																	0													180.0	203.0	196.0					7																	100349807		1874	4108	5982			7455			U83191		7q22.1	2013-10-10	2013-10-10		ENSG00000146839	ENSG00000146839			12857	protein-coding gene	gene with protein product		602372	"""zonadhesin"""			9799793, 17033959	Standard	NM_003386		Approved		uc003uwk.3	Q9Y493	OTTHUMG00000157037		7.37:g.100349807G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0FKC8|D6W5W4|O00218|Q96L85|Q96L86|Q96L87|Q96L88|Q96L89|Q96L90|Q9BXN9|Q9BZ83|Q9BZ84|Q9BZ85|Q9BZ86|Q9BZ87|Q9BZ88	Silent	SNP	pfam_VWF_type-D,pfam_MAM_dom,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_ConA-like_lec_gl_sf,superfamily_TIL_dom,smart_MAM_dom,smart_VWC_out,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_MAM_dom	p.T693	ENST00000348028.3	37	c.2079		7																																																																																			ZAN	-	NULL		0.532	ZAN-006	KNOWN	basic	polymorphic_pseudogene	ZAN	HGNC	polymorphic_pseudogene	OTTHUMT00000347214.1	G	NM_003386		100349807	+1	no_errors	ENST00000546292	ensembl	human	known	70_37	silent	SNP	0.000	A
ZNF232	7775	genome.wustl.edu	37	17	5009279	5009279	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:5009279C>A	ENST00000250076.3	-	5	1829	c.1175G>T	c.(1174-1176)tGt>tTt	p.C392F	ZNF232_ENST00000575538.1_5'Flank|ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575898.1_Missense_Mutation_p.C383F	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	365					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						GGCCTTCCCACACTCATTACA	0.433																																																	0													86.0	88.0	87.0					17																	5009279		2203	4300	6503	SO:0001583	missense	7775			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.1175G>T	17.37:g.5009279C>A	ENSP00000250076:p.Cys392Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.C392F	ENST00000250076.3	37	c.1175	CCDS11068.1	17	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754154	0.49362	.	.	ENSG00000167840	ENST00000250076	D	0.85861	-2.04	2.84	2.84	0.33178	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35124	N	0.003435	D	0.92870	0.7732	H	0.96015	3.755	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.68192	0.956;0.926	D	0.92147	0.5725	10	0.87932	D	0	.	5.8183	0.18514	0.0:0.8555:0.0:0.1445	.	365;356	Q9UNY5;Q9UNY5-2	ZN232_HUMAN;.	F	392	ENSP00000250076:C392F	ENSP00000250076:C392F	C	-	2	0	ZNF232	4950003	1.000000	0.71417	0.978000	0.43139	0.998000	0.95712	2.709000	0.47160	1.872000	0.54250	0.655000	0.94253	TGT	ZNF232	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF232	HGNC	protein_coding	OTTHUMT00000216915.1	C	NM_014519		5009279	-1	no_errors	ENST00000250076	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF232	7775	genome.wustl.edu	37	17	5009279	5009279	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr17:5009279C>A	ENST00000250076.3	-	5	1829	c.1175G>T	c.(1174-1176)tGt>tTt	p.C392F	ZNF232_ENST00000575538.1_5'Flank|ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575898.1_Missense_Mutation_p.C383F	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	365					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						GGCCTTCCCACACTCATTACA	0.433																																																	0													86.0	88.0	87.0					17																	5009279		2203	4300	6503	SO:0001583	missense	7775			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.1175G>T	17.37:g.5009279C>A	ENSP00000250076:p.Cys392Phe	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.C392F	ENST00000250076.3	37	c.1175	CCDS11068.1	17	.	.	.	.	.	.	.	.	.	.	C	15.17	2.754154	0.49362	.	.	ENSG00000167840	ENST00000250076	D	0.85861	-2.04	2.84	2.84	0.33178	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.35124	N	0.003435	D	0.92870	0.7732	H	0.96015	3.755	0.80722	D	1	D;D	0.71674	0.998;0.997	D;D	0.68192	0.956;0.926	D	0.92147	0.5725	10	0.87932	D	0	.	5.8183	0.18514	0.0:0.8555:0.0:0.1445	.	365;356	Q9UNY5;Q9UNY5-2	ZN232_HUMAN;.	F	392	ENSP00000250076:C392F	ENSP00000250076:C392F	C	-	2	0	ZNF232	4950003	1.000000	0.71417	0.978000	0.43139	0.998000	0.95712	2.709000	0.47160	1.872000	0.54250	0.655000	0.94253	TGT	ZNF232	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF232	HGNC	protein_coding	OTTHUMT00000216915.1	C	NM_014519		5009279	-1	no_errors	ENST00000250076	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF493	284443	genome.wustl.edu	37	19	21607218	21607218	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:21607218C>G	ENST00000355504.4	+	2	1639	c.1373C>G	c.(1372-1374)tCa>tGa	p.S458*	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Nonsense_Mutation_p.S586*	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	458					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						AGTGTATTCTCAACCCTTACT	0.353																																																	0													36.0	34.0	35.0					19																	21607218		2203	4298	6501	SO:0001587	stop_gained	284443			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1373C>G	19.37:g.21607218C>G	ENSP00000347691:p.Ser458*	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S458*	ENST00000355504.4	37	c.1373	CCDS12412.1	19	.	.	.	.	.	.	.	.	.	.	N	20.5	3.994150	0.74703	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	.	.	.	1.06	1.06	0.20224	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.9275	0.35650	0.0:1.0:0.0:0.0	.	.	.	.	X	586;458	.	ENSP00000347691:S458X	S	+	2	0	ZNF493	21399058	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.140000	0.10342	0.458000	0.26988	0.467000	0.42956	TCA	ZNF493	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.353	ZNF493-003	KNOWN	basic|CCDS	protein_coding	ZNF493	HGNC	protein_coding	OTTHUMT00000280563.1	C	NM_175910		21607218	+1	no_errors	ENST00000355504	ensembl	human	known	70_37	nonsense	SNP	0.000	G
ZNF493	284443	genome.wustl.edu	37	19	21607218	21607218	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:21607218C>G	ENST00000355504.4	+	2	1639	c.1373C>G	c.(1372-1374)tCa>tGa	p.S458*	CTD-2561J22.3_ENST00000600810.1_Intron|ZNF493_ENST00000392288.2_Nonsense_Mutation_p.S586*	NM_175910.6	NP_787106.4	Q6ZR52	ZN493_HUMAN	zinc finger protein 493	458					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	30						AGTGTATTCTCAACCCTTACT	0.353																																																	0													36.0	34.0	35.0					19																	21607218		2203	4298	6501	SO:0001587	stop_gained	284443			AK093823, BC006408, BC022394	CCDS12412.1, CCDS42536.1, CCDS12411.1	19p12	2013-01-08			ENSG00000196268	ENSG00000196268		"""Zinc fingers, C2H2-type"", ""-"""	23708	protein-coding gene	gene with protein product							Standard	NM_001076678		Approved	FLJ36504	uc002npw.3	Q6ZR52	OTTHUMG00000141297	ENST00000355504.4:c.1373C>G	19.37:g.21607218C>G	ENSP00000347691:p.Ser458*	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E974|Q59GM3|Q6ZSF6|Q8N1Z6|Q8N965|Q9BR99	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S458*	ENST00000355504.4	37	c.1373	CCDS12412.1	19	.	.	.	.	.	.	.	.	.	.	N	20.5	3.994150	0.74703	.	.	ENSG00000196268	ENST00000392288;ENST00000355504	.	.	.	1.06	1.06	0.20224	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	8.9275	0.35650	0.0:1.0:0.0:0.0	.	.	.	.	X	586;458	.	ENSP00000347691:S458X	S	+	2	0	ZNF493	21399058	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.140000	0.10342	0.458000	0.26988	0.467000	0.42956	TCA	ZNF493	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.353	ZNF493-003	KNOWN	basic|CCDS	protein_coding	ZNF493	HGNC	protein_coding	OTTHUMT00000280563.1	C	NM_175910		21607218	+1	no_errors	ENST00000355504	ensembl	human	known	70_37	nonsense	SNP	0.000	G
ZNF350	59348	genome.wustl.edu	37	19	52468256	52468256	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:52468256C>T	ENST00000243644.4	-	5	1677	c.1450G>A	c.(1450-1452)Gta>Ata	p.V484I	HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'Flank|HCCAT3_ENST00000595010.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	484					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		ACAAGGACTACGTTCCTGTTT	0.512																																																	0													98.0	83.0	88.0					19																	52468256		2203	4300	6503	SO:0001583	missense	59348			AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.1450G>A	19.37:g.52468256C>T	ENSP00000243644:p.Val484Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96G73|Q9HAQ4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V484I	ENST00000243644.4	37	c.1450	CCDS12845.1	19	.	.	.	.	.	.	.	.	.	.	C	3.920	-0.018264	0.07681	.	.	ENSG00000256683	ENST00000243644	T	0.05649	3.41	3.41	-0.00998	0.13998	.	0.814028	0.10033	N	0.724521	T	0.05868	0.0153	L	0.32530	0.975	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.36768	-0.9734	10	0.56958	D	0.05	.	9.2796	0.37720	0.0:0.7263:0.0:0.2737	.	484	Q9GZX5	ZN350_HUMAN	I	484	ENSP00000243644:V484I	ENSP00000243644:V484I	V	-	1	0	ZNF350	57160068	0.983000	0.35010	0.000000	0.03702	0.005000	0.04900	2.704000	0.47118	-0.258000	0.09446	-1.937000	0.00501	GTA	ZNF350	-	NULL		0.512	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF350	HGNC	protein_coding	OTTHUMT00000462278.1	C	NM_021632		52468256	-1	no_errors	ENST00000243644	ensembl	human	known	70_37	missense	SNP	0.000	T
ZNF350	59348	genome.wustl.edu	37	19	52468256	52468256	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:52468256C>T	ENST00000243644.4	-	5	1677	c.1450G>A	c.(1450-1452)Gta>Ata	p.V484I	HCCAT3_ENST00000600253.1_RNA|ZNF350_ENST00000600703.1_5'Flank|HCCAT3_ENST00000595010.1_RNA	NM_021632.3	NP_067645.3	Q9GZX5	ZN350_HUMAN	zinc finger protein 350	484					negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(3)|kidney(3)|large_intestine(7)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26		all_neural(266;0.0505)		GBM - Glioblastoma multiforme(134;0.00124)|OV - Ovarian serous cystadenocarcinoma(262;0.0179)		ACAAGGACTACGTTCCTGTTT	0.512																																																	0													98.0	83.0	88.0					19																	52468256		2203	4300	6503	SO:0001583	missense	59348			AF295096	CCDS12845.1	19q13.41	2013-05-23			ENSG00000256683	ENSG00000256683		"""Zinc fingers, C2H2-type"", ""-"""	16656	protein-coding gene	gene with protein product		605422				11090615, 11161714	Standard	NM_021632		Approved	ZBRK1, ZFQR	uc002pyd.3	Q9GZX5	OTTHUMG00000182538	ENST00000243644.4:c.1450G>A	19.37:g.52468256C>T	ENSP00000243644:p.Val484Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96G73|Q9HAQ4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V484I	ENST00000243644.4	37	c.1450	CCDS12845.1	19	.	.	.	.	.	.	.	.	.	.	C	3.920	-0.018264	0.07681	.	.	ENSG00000256683	ENST00000243644	T	0.05649	3.41	3.41	-0.00998	0.13998	.	0.814028	0.10033	N	0.724521	T	0.05868	0.0153	L	0.32530	0.975	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.36768	-0.9734	10	0.56958	D	0.05	.	9.2796	0.37720	0.0:0.7263:0.0:0.2737	.	484	Q9GZX5	ZN350_HUMAN	I	484	ENSP00000243644:V484I	ENSP00000243644:V484I	V	-	1	0	ZNF350	57160068	0.983000	0.35010	0.000000	0.03702	0.005000	0.04900	2.704000	0.47118	-0.258000	0.09446	-1.937000	0.00501	GTA	ZNF350	-	NULL		0.512	ZNF350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF350	HGNC	protein_coding	OTTHUMT00000462278.1	C	NM_021632		52468256	-1	no_errors	ENST00000243644	ensembl	human	known	70_37	missense	SNP	0.000	T
ZNF638	27332	genome.wustl.edu	37	2	71645629	71645629	+	Intron	DEL	T	T	-			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr2:71645629delT	ENST00000409544.1	+	21	3891				ZNF638_ENST00000409407.1_Intron|ZNF638_ENST00000264447.4_Intron|ZNF638_ENST00000355812.3_Intron	NM_001252612.1	NP_001239541.1	Q14966	ZN638_HUMAN	zinc finger protein 638						regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|lung(28)|ovary(2)|pancreas(2)|prostate(1)|skin(2)|urinary_tract(1)	63						ATTTTTAAGGTTTTTTTTTTT	0.269																																																	0																																										SO:0001627	intron_variant	27332			D83032	CCDS1917.1	2p13.1	2013-02-12	2004-07-29	2004-07-30	ENSG00000075292	ENSG00000075292		"""RNA binding motif (RRM) containing"""	17894	protein-coding gene	gene with protein product		614349	"""zinc finger, matrin-like"""	ZFML		8647861	Standard	NM_014497		Approved	NP220, MGC26130, Zfp638	uc002shy.3	Q14966	OTTHUMG00000129735	ENST00000409544.1:c.3262-103T>-	2.37:g.71645629delT		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDV1|B7ZLD1|Q53R34|Q5XJ05|Q68DP3|Q6P2H2|Q7Z3T7|Q8NF92|Q8TCA1|Q9H2G1|Q9NP37	RNA	DEL	-	NULL	ENST00000409544.1	37	NULL	CCDS1917.1	2																																																																																			ZNF638	-	-		0.269	ZNF638-002	NOVEL	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	ZNF638	HGNC	protein_coding	OTTHUMT00000327431.1	T	NM_014497		71645629	+1	no_errors	ENST00000483421	ensembl	human	known	70_37	rna	DEL	0.003	-
ZNF644	84146	genome.wustl.edu	37	1	91403562	91403562	+	Silent	SNP	A	A	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:91403562A>G	ENST00000370440.1	-	4	3385	c.3168T>C	c.(3166-3168)caT>caC	p.H1056H	ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Silent_p.H1056H			Q9H582	ZN644_HUMAN	zinc finger protein 644	1056					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGCCTCTAACATGATTTGATA	0.358																																																	0													89.0	88.0	88.0					1																	91403562		2203	4300	6503	SO:0001819	synonymous_variant	84146			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3168T>C	1.37:g.91403562A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1056	ENST00000370440.1	37	c.3168	CCDS731.1	1																																																																																			ZNF644	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	A	NM_032186		91403562	-1	no_errors	ENST00000337393	ensembl	human	known	70_37	silent	SNP	1.000	G
ZNF644	84146	genome.wustl.edu	37	1	91403562	91403562	+	Silent	SNP	A	A	G			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr1:91403562A>G	ENST00000370440.1	-	4	3385	c.3168T>C	c.(3166-3168)caT>caC	p.H1056H	ZNF644_ENST00000467231.1_Intron|ZNF644_ENST00000347275.5_Intron|ZNF644_ENST00000361321.5_Intron|ZNF644_ENST00000337393.5_Silent_p.H1056H			Q9H582	ZN644_HUMAN	zinc finger protein 644	1056					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(2)|large_intestine(10)|lung(21)|ovary(2)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	47		all_lung(203;0.00206)|Lung NSC(277;0.0519)|Lung SC(238;0.101)		all cancers(265;0.00102)|Epithelial(280;0.00766)|KIRC - Kidney renal clear cell carcinoma(1967;0.147)|OV - Ovarian serous cystadenocarcinoma(397;0.173)		GGCCTCTAACATGATTTGATA	0.358																																																	0													89.0	88.0	88.0					1																	91403562		2203	4300	6503	SO:0001819	synonymous_variant	84146			AB033047	CCDS731.1, CCDS732.1	1p22.2	2008-02-05			ENSG00000122482	ENSG00000122482			29222	protein-coding gene	gene with protein product		614159				10574462	Standard	NM_032186		Approved	KIAA1221, BM-005, MGC60165, MGC70410	uc001dnw.3	Q9H582	OTTHUMG00000010078	ENST00000370440.1:c.3168T>C	1.37:g.91403562A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU71|Q2TAM0|Q5TCC0|Q6BEP7|Q6P446|Q6PI06|Q7LG67|Q9ULJ9	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.H1056	ENST00000370440.1	37	c.3168	CCDS731.1	1																																																																																			ZNF644	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.358	ZNF644-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF644	HGNC	protein_coding	OTTHUMT00000027846.2	A	NM_032186		91403562	-1	no_errors	ENST00000337393	ensembl	human	known	70_37	silent	SNP	1.000	G
ZNF773	374928	genome.wustl.edu	37	19	58018106	58018107	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58018106_58018107GG>TC	ENST00000282292.4	+	4	783_784	c.643_644GG>TC	c.(643-645)GGg>TCg	p.G215S	ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.G214S|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		ACTGCACACTGGGGAAAAGCCT	0.426																																																	0																																										SO:0001583	missense	374928			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		Exception_encountered	19.37:g.58018106_58018107delinsTC	ENSP00000282292:p.Gly215Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96DL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G215W|p.G215A	ENST00000282292.4	37	c.643|c.644	CCDS33134.1	19																																																																																			ZNF773	-	pfscan_Znf_C2H2		0.426	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	G	NM_198542		58018106|58018107	+1	no_errors	ENST00000282292	ensembl	human	known	70_37	missense	SNP	0.960|0.961	T|C
ZNF773	374928	genome.wustl.edu	37	19	58018106	58018107	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58018106_58018107GG>TC	ENST00000282292.4	+	4	783_784	c.643_644GG>TC	c.(643-645)GGg>TCg	p.G215S	ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.G214S|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		ACTGCACACTGGGGAAAAGCCT	0.426																																																	0																																										SO:0001583	missense	374928			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		Exception_encountered	19.37:g.58018106_58018107delinsTC	ENSP00000282292:p.Gly215Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96DL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G215W|p.G215A	ENST00000282292.4	37	c.643|c.644	CCDS33134.1	19																																																																																			ZNF773	-	pfscan_Znf_C2H2		0.426	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	G	NM_198542		58018106|58018107	+1	no_errors	ENST00000282292	ensembl	human	known	70_37	missense	SNP	0.960|0.961	T|C
ZNF773	374928	genome.wustl.edu	37	19	58018106	58018107	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58018106_58018107GG>TC	ENST00000282292.4	+	4	783_784	c.643_644GG>TC	c.(643-645)GGg>TCg	p.G215S	ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.G214S|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		ACTGCACACTGGGGAAAAGCCT	0.426																																																	0																																										SO:0001583	missense	374928			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		Exception_encountered	19.37:g.58018106_58018107delinsTC	ENSP00000282292:p.Gly215Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96DL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G215W|p.G215A	ENST00000282292.4	37	c.643|c.644	CCDS33134.1	19																																																																																			ZNF773	-	pfscan_Znf_C2H2		0.426	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	G	NM_198542		58018106|58018107	+1	no_errors	ENST00000282292	ensembl	human	known	70_37	missense	SNP	0.960|0.961	T|C
ZNF773	374928	genome.wustl.edu	37	19	58018106	58018107	+	Missense_Mutation	DNP	GG	GG	TC			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58018106_58018107GG>TC	ENST00000282292.4	+	4	783_784	c.643_644GG>TC	c.(643-645)GGg>TCg	p.G215S	ZNF773_ENST00000593916.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.G214S|ZNF773_ENST00000599847.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	215					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		ACTGCACACTGGGGAAAAGCCT	0.426																																																	0																																										SO:0001583	missense	374928			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		Exception_encountered	19.37:g.58018106_58018107delinsTC	ENSP00000282292:p.Gly215Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96DL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G215W|p.G215A	ENST00000282292.4	37	c.643|c.644	CCDS33134.1	19																																																																																			ZNF773	-	pfscan_Znf_C2H2		0.426	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	G	NM_198542		58018106|58018107	+1	no_errors	ENST00000282292	ensembl	human	known	70_37	missense	SNP	0.960|0.961	T|C
ZNF814	730051	genome.wustl.edu	37	19	58384594	58384594	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58384594G>A	ENST00000435989.2	-	3	2398	c.2164C>T	c.(2164-2166)Cag>Tag	p.Q722*	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	722					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AAAAATTTCTGACAAGCTTCA	0.373																																																	0													71.0	59.0	63.0					19																	58384594		692	1591	2283	SO:0001587	stop_gained	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2164C>T	19.37:g.58384594G>A	ENSP00000410545:p.Gln722*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF35	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q722*	ENST00000435989.2	37	c.2164	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	37	6.100909	0.97281	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	.	.	.	1.81	0.615	0.17608	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	8.5638	0.33527	0.0:0.5084:0.4916:0.0	.	.	.	.	X	722;472	.	ENSP00000365378:Q472X	Q	-	1	0	ZNF814	63076406	0.071000	0.21146	0.007000	0.13788	0.032000	0.12392	0.956000	0.29202	0.084000	0.17077	0.305000	0.20034	CAG	ZNF814	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.373	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	G	XM_001725708		58384594	-1	no_errors	ENST00000435989	ensembl	human	known	70_37	nonsense	SNP	0.963	A
ZNF814	730051	genome.wustl.edu	37	19	58384594	58384594	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58384594G>A	ENST00000435989.2	-	3	2398	c.2164C>T	c.(2164-2166)Cag>Tag	p.Q722*	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	722					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						AAAAATTTCTGACAAGCTTCA	0.373																																																	0													71.0	59.0	63.0					19																	58384594		692	1591	2283	SO:0001587	stop_gained	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2164C>T	19.37:g.58384594G>A	ENSP00000410545:p.Gln722*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF35	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q722*	ENST00000435989.2	37	c.2164	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	37	6.100909	0.97281	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	.	.	.	1.81	0.615	0.17608	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	8.5638	0.33527	0.0:0.5084:0.4916:0.0	.	.	.	.	X	722;472	.	ENSP00000365378:Q472X	Q	-	1	0	ZNF814	63076406	0.071000	0.21146	0.007000	0.13788	0.032000	0.12392	0.956000	0.29202	0.084000	0.17077	0.305000	0.20034	CAG	ZNF814	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.373	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	G	XM_001725708		58384594	-1	no_errors	ENST00000435989	ensembl	human	known	70_37	nonsense	SNP	0.963	A
ZNF814	730051	genome.wustl.edu	37	19	58384729	58384729	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58384729G>C	ENST00000435989.2	-	3	2263	c.2029C>G	c.(2029-2031)Cta>Gta	p.L677V	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	677					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TGCTGGTGTAGAATGAGGTTA	0.408																																																	0													68.0	57.0	61.0					19																	58384729		692	1591	2283	SO:0001583	missense	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2029C>G	19.37:g.58384729G>C	ENSP00000410545:p.Leu677Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L677V	ENST00000435989.2	37	c.2029	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	1.391	-0.580802	0.03854	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.17370	2.28	2.08	-4.16	0.03869	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05593	0.0147	N	0.04746	-0.17	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.28618	-1.0038	9	0.22109	T	0.4	.	1.274	0.02027	0.139:0.3155:0.259:0.2866	.	677	B7Z6K7	ZN814_HUMAN	V	677;427	ENSP00000410545:L677V	ENSP00000365378:L427V	L	-	1	2	ZNF814	63076541	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-8.060000	0.00025	-2.622000	0.00439	0.305000	0.20034	CTA	ZNF814	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	G	XM_001725708		58384729	-1	no_errors	ENST00000435989	ensembl	human	known	70_37	missense	SNP	0.000	C
ZNF814	730051	genome.wustl.edu	37	19	58384729	58384729	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58384729G>C	ENST00000435989.2	-	3	2263	c.2029C>G	c.(2029-2031)Cta>Gta	p.L677V	ZNF814_ENST00000595295.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	677					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						TGCTGGTGTAGAATGAGGTTA	0.408																																																	0													68.0	57.0	61.0					19																	58384729		692	1591	2283	SO:0001583	missense	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.2029C>G	19.37:g.58384729G>C	ENSP00000410545:p.Leu677Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L677V	ENST00000435989.2	37	c.2029	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	1.391	-0.580802	0.03854	.	.	ENSG00000204514	ENST00000435989;ENST00000376205	T	0.17370	2.28	2.08	-4.16	0.03869	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05593	0.0147	N	0.04746	-0.17	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.28618	-1.0038	9	0.22109	T	0.4	.	1.274	0.02027	0.139:0.3155:0.259:0.2866	.	677	B7Z6K7	ZN814_HUMAN	V	677;427	ENSP00000410545:L677V	ENSP00000365378:L427V	L	-	1	2	ZNF814	63076541	0.000000	0.05858	0.000000	0.03702	0.008000	0.06430	-8.060000	0.00025	-2.622000	0.00439	0.305000	0.20034	CTA	ZNF814	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.408	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	G	XM_001725708		58384729	-1	no_errors	ENST00000435989	ensembl	human	known	70_37	missense	SNP	0.000	C
ZSCAN1	284312	genome.wustl.edu	37	19	58564883	58564883	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58564883G>T	ENST00000282326.1	+	6	938	c.691G>T	c.(691-693)Gaa>Taa	p.E231*		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	231					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCTGCGGGCAGAAGGGACTGT	0.642																																																	0													47.0	50.0	49.0					19																	58564883		2203	4300	6503	SO:0001587	stop_gained	284312			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.691G>T	19.37:g.58564883G>T	ENSP00000282326:p.Glu231*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3B798|Q6WLH8|Q86WS8	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E231*	ENST00000282326.1	37	c.691	CCDS12969.1	19	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744621	0.69418	.	.	ENSG00000152467	ENST00000282326	.	.	.	1.04	1.04	0.20106	.	.	.	.	.	.	.	.	.	.	.	0.41018	D	0.98505	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	7.9385	0.29944	0.0:0.0:1.0:0.0	.	.	.	.	X	231	.	ENSP00000282326:E231X	E	+	1	0	ZSCAN1	63256695	0.085000	0.21516	0.054000	0.19295	0.076000	0.17211	1.625000	0.37029	0.863000	0.35553	0.491000	0.48974	GAA	ZSCAN1	-	NULL		0.642	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	HGNC	protein_coding	OTTHUMT00000466427.1	G	NM_182572		58564883	+1	no_errors	ENST00000282326	ensembl	human	known	70_37	nonsense	SNP	0.528	T
ZSCAN1	284312	genome.wustl.edu	37	19	58564883	58564883	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1M8-01A-21D-A13W-08	TCGA-C5-A1M8-10A-01D-A13W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	24099828-5f1b-4004-b6ec-52eb184d7a54	358a6d54-df1e-4648-93eb-35175ae7c123	g.chr19:58564883G>T	ENST00000282326.1	+	6	938	c.691G>T	c.(691-693)Gaa>Taa	p.E231*		NM_182572.3	NP_872378.3	Q8NBB4	ZSCA1_HUMAN	zinc finger and SCAN domain containing 1	231					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CCTGCGGGCAGAAGGGACTGT	0.642																																																	0													47.0	50.0	49.0					19																	58564883		2203	4300	6503	SO:0001587	stop_gained	284312			AK091098	CCDS12969.1	19q13.43	2013-06-13	2004-04-21		ENSG00000152467	ENSG00000152467		"""-"", ""Zinc fingers, C2H2-type"""	23712	protein-coding gene	gene with protein product			"""zinc finger with SCAN domain 1"""			12477932	Standard	NM_182572		Approved	FLJ33779, ZNF915	uc002qrc.1	Q8NBB4	OTTHUMG00000183381	ENST00000282326.1:c.691G>T	19.37:g.58564883G>T	ENSP00000282326:p.Glu231*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3B798|Q6WLH8|Q86WS8	Nonsense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.E231*	ENST00000282326.1	37	c.691	CCDS12969.1	19	.	.	.	.	.	.	.	.	.	.	G	19.01	3.744621	0.69418	.	.	ENSG00000152467	ENST00000282326	.	.	.	1.04	1.04	0.20106	.	.	.	.	.	.	.	.	.	.	.	0.41018	D	0.98505	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	.	7.9385	0.29944	0.0:0.0:1.0:0.0	.	.	.	.	X	231	.	ENSP00000282326:E231X	E	+	1	0	ZSCAN1	63256695	0.085000	0.21516	0.054000	0.19295	0.076000	0.17211	1.625000	0.37029	0.863000	0.35553	0.491000	0.48974	GAA	ZSCAN1	-	NULL		0.642	ZSCAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSCAN1	HGNC	protein_coding	OTTHUMT00000466427.1	G	NM_182572		58564883	+1	no_errors	ENST00000282326	ensembl	human	known	70_37	nonsense	SNP	0.528	T
