#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AADACL2	344752	genome.wustl.edu	37	3	151458487	151458487	+	Missense_Mutation	SNP	G	G	A	rs367686762		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:151458487G>A	ENST00000356517.3	+	2	301	c.192G>A	c.(190-192)atG>atA	p.M64I		NM_207365.3	NP_997248.2	Q6P093	ADCL2_HUMAN	arylacetamide deacetylase-like 2	64						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	carboxylic ester hydrolase activity (GO:0052689)			NS(1)|breast(1)|endometrium(2)|large_intestine(4)|liver(1)|lung(13)|skin(2)	24			LUSC - Lung squamous cell carcinoma(72;0.0394)|Lung(72;0.0813)			TTATATCCATGATATTCAGGC	0.299																																																	0													84.0	84.0	84.0					3																	151458487		2203	4300	6503	SO:0001583	missense	344752			BC065724	CCDS3161.2	3q25.1	2010-12-14			ENSG00000197953	ENSG00000197953			24427	protein-coding gene	gene with protein product							Standard	NM_207365		Approved	MGC72001	uc003ezc.3	Q6P093	OTTHUMG00000155914	ENST00000356517.3:c.192G>A	3.37:g.151458487G>A	ENSP00000348911:p.Met64Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5HYJ4	Missense_Mutation	SNP	pfam_AB_hydrolase_3,pfam_CarbesteraseB,pfam_Steryl_acetyl_hydrolase,pirsf_Arylacetamide_deacetylase	p.M64I	ENST00000356517.3	37	c.192	CCDS3161.2	3	.	.	.	.	.	.	.	.	.	.	G	0.323	-0.960621	0.02249	.	.	ENSG00000197953	ENST00000356517	T	0.04119	3.7	5.49	1.77	0.24775	.	0.411997	0.29205	N	0.012839	T	0.01730	0.0055	N	0.03608	-0.345	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.45498	-0.9257	10	0.18710	T	0.47	-3.0295	2.2366	0.04010	0.2206:0.132:0.5113:0.1361	.	64	Q6P093	ADCL2_HUMAN	I	64	ENSP00000348911:M64I	ENSP00000348911:M64I	M	+	3	0	AADACL2	152941177	0.168000	0.22989	0.001000	0.08648	0.073000	0.16967	0.389000	0.20751	0.154000	0.19237	0.591000	0.81541	ATG	AADACL2	-	pirsf_Arylacetamide_deacetylase		0.299	AADACL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AADACL2	HGNC	protein_coding	OTTHUMT00000342288.3	G	NM_207365		151458487	+1	no_errors	ENST00000356517	ensembl	human	known	70_37	missense	SNP	0.014	A
ABCC3	8714	genome.wustl.edu	37	17	48735556	48735556	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:48735556G>C	ENST00000285238.8	+	5	680	c.600G>C	c.(598-600)aaG>aaC	p.K200N	ABCC3_ENST00000427699.1_Missense_Mutation_p.K200N	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	200					bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	TCTCCGCAAAGAATGTCGACC	0.572																																																	0													149.0	137.0	141.0					17																	48735556		2203	4300	6503	SO:0001583	missense	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.600G>C	17.37:g.48735556G>C	ENSP00000285238:p.Lys200Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	pfam_ABC_transptr_TM_dom,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_Multidrug-R_assoc	p.K200N	ENST00000285238.8	37	c.600	CCDS32681.1	17	.	.	.	.	.	.	.	.	.	.	G	7.882	0.730412	0.15507	.	.	ENSG00000108846	ENST00000427699;ENST00000285238	D;D	0.87103	-2.21;-2.21	6.04	2.91	0.33838	.	0.652062	0.15150	N	0.277777	T	0.80476	0.4630	L	0.41573	1.285	0.09310	N	1	B;B	0.29341	0.242;0.206	B;B	0.34536	0.054;0.185	T	0.64744	-0.6335	10	0.16420	T	0.52	-9.8882	8.2677	0.31824	0.1622:0.1806:0.6572:0.0	.	200;200	O15438;O15438-5	MRP3_HUMAN;.	N	200	ENSP00000395160:K200N;ENSP00000285238:K200N	ENSP00000285238:K200N	K	+	3	2	ABCC3	46090555	0.113000	0.22115	0.003000	0.11579	0.090000	0.18270	0.372000	0.20467	0.906000	0.36621	0.561000	0.74099	AAG	ABCC3	-	tigrfam_Multidrug-R_assoc		0.572	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	G	NM_020038		48735556	+1	no_errors	ENST00000285238	ensembl	human	known	70_37	missense	SNP	0.001	C
ACSBG2	81616	genome.wustl.edu	37	19	6183146	6183146	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:6183146C>T	ENST00000586696.1	+	10	1461	c.1185C>T	c.(1183-1185)atC>atT	p.I395I	ACSBG2_ENST00000588485.1_Silent_p.I208I|ACSBG2_ENST00000252669.5_Silent_p.I395I|ACSBG2_ENST00000588304.1_Silent_p.I345I|ACSBG2_ENST00000591741.1_3'UTR|ACSBG2_ENST00000591403.1_Silent_p.I395I			Q5FVE4	ACBG2_HUMAN	acyl-CoA synthetase bubblegum family member 2	395					cell differentiation (GO:0030154)|fatty acid metabolic process (GO:0006631)|long-chain fatty acid metabolic process (GO:0001676)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrion (GO:0005739)	acyl-CoA hydrolase activity (GO:0047617)|ATP binding (GO:0005524)|long-chain fatty acid-CoA ligase activity (GO:0004467)			breast(1)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(12)|lung(3)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ACTCTTTTATCAGTGGGACTG	0.502																																																	0													107.0	100.0	102.0					19																	6183146		2203	4300	6503	SO:0001819	synonymous_variant	81616				CCDS12159.1, CCDS74269.1	19p13.3	2012-10-02			ENSG00000130377	ENSG00000130377		"""Acyl-CoA synthetase family"""	24174	protein-coding gene	gene with protein product	"""bubblegum related protein"""	614363				11230166	Standard	XM_005259653		Approved	BGR, PRTD-NY3, DKFZp434K1635	uc002meh.1	Q5FVE4	OTTHUMG00000180754	ENST00000586696.1:c.1185C>T	19.37:g.6183146C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSF2|Q6UWJ3|Q7Z5A0|Q8WW03|Q96M36|Q9BYZ3|Q9H0C4	Silent	SNP	pfam_AMP-dep_Synth/Lig	p.I395	ENST00000586696.1	37	c.1185	CCDS12159.1	19																																																																																			ACSBG2	-	pfam_AMP-dep_Synth/Lig		0.502	ACSBG2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ACSBG2	HGNC	protein_coding	OTTHUMT00000452898.1	C	NM_030924		6183146	+1	no_errors	ENST00000252669	ensembl	human	known	70_37	silent	SNP	0.955	T
ADCK1	57143	genome.wustl.edu	37	14	78399610	78399610	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:78399610C>G	ENST00000238561.5	+	11	1547	c.1448C>G	c.(1447-1449)tCt>tGt	p.S483C	ADCK1_ENST00000341211.5_Missense_Mutation_p.S415C|ADCK1_ENST00000556560.1_3'UTR	NM_020421.3	NP_065154.2	Q86TW2	ADCK1_HUMAN	aarF domain containing kinase 1	490						extracellular region (GO:0005576)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)|stomach(2)	25			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0376)		ACCCAGATCTCTTTCAGCGAG	0.468																																																	0													93.0	90.0	91.0					14																	78399610		2203	4300	6503	SO:0001583	missense	57143			AK096919	CCDS9869.1, CCDS45144.1	14q24	2005-10-30							19038	protein-coding gene	gene with protein product						12471243	Standard	NM_020421		Approved	FLJ39600	uc001xui.3	Q86TW2		ENST00000238561.5:c.1448C>G	14.37:g.78399610C>G	ENSP00000238561:p.Ser483Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUD5|Q6PD65|Q9UIE6	Missense_Mutation	SNP	pfam_UbiB_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom	p.S483C	ENST00000238561.5	37	c.1448	CCDS9869.1	14	.	.	.	.	.	.	.	.	.	.	C	8.886	0.952842	0.18431	.	.	ENSG00000063761	ENST00000238561;ENST00000341211	T;T	0.67865	-0.29;1.11	5.75	5.75	0.90469	.	0.164448	0.56097	D	0.000030	T	0.66237	0.2769	M	0.64997	1.995	0.49299	D	0.999774	B;B;B	0.14805	0.007;0.002;0.011	B;B;B	0.12156	0.005;0.003;0.007	T	0.60485	-0.7254	10	0.35671	T	0.21	-27.5244	18.1223	0.89576	0.0:1.0:0.0:0.0	.	490;415;483	Q86TW2;Q9UIE6;Q86TW2-2	ADCK1_HUMAN;.;.	C	483;415	ENSP00000238561:S483C;ENSP00000339663:S415C	ENSP00000238561:S483C	S	+	2	0	ADCK1	77469363	0.997000	0.39634	0.956000	0.39512	0.018000	0.09664	3.621000	0.54210	2.720000	0.93068	0.655000	0.94253	TCT	ADCK1	-	NULL		0.468	ADCK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK1	HGNC	protein_coding	OTTHUMT00000413864.1	C	NM_020421		78399610	+1	no_errors	ENST00000238561	ensembl	human	known	70_37	missense	SNP	0.995	G
AKAP3	10566	genome.wustl.edu	37	12	4737262	4737262	+	Missense_Mutation	SNP	C	C	T	rs545087055		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:4737262C>T	ENST00000545990.2	-	5	1330	c.806G>A	c.(805-807)cGa>cAa	p.R269Q	RP11-500M8.7_ENST00000536588.1_Intron|AKAP3_ENST00000228850.1_Missense_Mutation_p.R269Q	NM_001278309.1	NP_001265238.1	O75969	AKAP3_HUMAN	A kinase (PRKA) anchor protein 3	269					acrosome reaction (GO:0007340)|cellular component movement (GO:0006928)|protein localization (GO:0008104)|single fertilization (GO:0007338)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)	acrosomal vesicle (GO:0001669)|nucleus (GO:0005634)|sperm fibrous sheath (GO:0035686)|sperm principal piece (GO:0097228)	protein kinase A binding (GO:0051018)	p.R269L(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|liver(1)|lung(17)|ovary(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	51						TTCCTGCCCTCGAAACCTCTT	0.443													C|||	1	0.000199681	0.0	0.0	5008	,	,		24020	0.001		0.0	False		,,,				2504	0.0																2	Substitution - Missense(2)	lung(2)											85.0	79.0	81.0					12																	4737262		2203	4300	6503	SO:0001583	missense	10566			U85715	CCDS8531.1	12p13.3	2009-03-12				ENSG00000111254		"""A-kinase anchor proteins"""	373	protein-coding gene	gene with protein product	"""Fibrous Sheath Protein of 95 kDa"", ""cancer/testis antigen 82"""	604689				10334916, 10319321	Standard	NM_001278309		Approved	FSP95, SOB1, AKAP110, CT82	uc001qnb.4	O75969		ENST00000545990.2:c.806G>A	12.37:g.4737262C>T	ENSP00000440994:p.Arg269Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O75945|Q86X01|Q9UM61	Missense_Mutation	SNP	pfam_AKAP_110_C,pfam_RII_binding_1,smart_AKAP_110	p.R269Q	ENST00000545990.2	37	c.806	CCDS8531.1	12	.	.	.	.	.	.	.	.	.	.	C	4.842	0.156495	0.09236	.	.	ENSG00000111254	ENST00000228850;ENST00000545990	T;T	0.11063	2.81;2.81	4.98	0.782	0.18567	A-kinase anchor 110kDa, C-terminal (1);	0.521329	0.17868	N	0.159295	T	0.10078	0.0247	M	0.63428	1.95	0.09310	N	1	B	0.24675	0.109	B	0.16289	0.015	T	0.20974	-1.0259	10	0.45353	T	0.12	-4.3144	5.2547	0.15540	0.0:0.5817:0.1461:0.2722	.	269	O75969	AKAP3_HUMAN	Q	269	ENSP00000228850:R269Q;ENSP00000440994:R269Q	ENSP00000228850:R269Q	R	-	2	0	AKAP3	4607523	0.000000	0.05858	0.000000	0.03702	0.387000	0.30353	0.173000	0.16724	0.020000	0.15106	-0.345000	0.07892	CGA	AKAP3	-	pfam_AKAP_110_C,smart_AKAP_110		0.443	AKAP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP3	HGNC	protein_coding	OTTHUMT00000398911.2	C	NM_006422		4737262	-1	no_errors	ENST00000228850	ensembl	human	known	70_37	missense	SNP	0.001	T
AKAP6	9472	genome.wustl.edu	37	14	33014856	33014856	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:33014856C>G	ENST00000280979.4	+	4	1167	c.997C>G	c.(997-999)Ctg>Gtg	p.L333V	AKAP6_ENST00000557354.1_Missense_Mutation_p.L333V|AKAP6_ENST00000557272.1_Missense_Mutation_p.L333V	NM_004274.4	NP_004265.3	Q13023	AKAP6_HUMAN	A kinase (PRKA) anchor protein 6	333					action potential (GO:0001508)|cAMP-mediated signaling (GO:0019933)|cellular response to cAMP (GO:0071320)|cellular response to cytokine stimulus (GO:0071345)|negative regulation of cAMP biosynthetic process (GO:0030818)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell growth (GO:0030307)|positive regulation of cell growth involved in cardiac muscle cell development (GO:0061051)|positive regulation of delayed rectifier potassium channel activity (GO:1902261)|positive regulation of NFAT protein import into nucleus (GO:0051533)|positive regulation of potassium ion transmembrane transport (GO:1901381)|positive regulation of protein phosphatase type 2B activity (GO:0032514)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|positive regulation of ryanodine-sensitive calcium-release channel activity (GO:0060316)|protein targeting (GO:0006605)|regulation of membrane repolarization (GO:0060306)|regulation of protein kinase A signaling (GO:0010738)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)	calcium channel complex (GO:0034704)|caveola (GO:0005901)|cytoplasm (GO:0005737)|intercalated disc (GO:0014704)|junctional sarcoplasmic reticulum membrane (GO:0014701)|nuclear envelope (GO:0005635)|perinuclear region of cytoplasm (GO:0048471)|sarcoplasmic reticulum (GO:0016529)|T-tubule (GO:0030315)	adenylate cyclase binding (GO:0008179)|ion channel binding (GO:0044325)|protein anchor (GO:0043495)|protein complex scaffold (GO:0032947)|protein kinase A binding (GO:0051018)|protein kinase A regulatory subunit binding (GO:0034237)			NS(2)|breast(10)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(8)|large_intestine(25)|lung(42)|ovary(5)|pancreas(2)|prostate(3)|skin(9)|urinary_tract(2)	122	Breast(36;0.0388)|Prostate(35;0.15)		LUAD - Lung adenocarcinoma(48;0.00107)|Lung(238;0.00677)|STAD - Stomach adenocarcinoma(7;0.116)	GBM - Glioblastoma multiforme(265;0.019)		AGGAGAAGCTCTGACAAATGC	0.493																																					Melanoma(49;821 1200 7288 13647 42351)												0													76.0	67.0	70.0					14																	33014856		2203	4300	6503	SO:0001583	missense	9472			AB002309	CCDS9644.1	14q12	2008-08-11			ENSG00000151320	ENSG00000151320		"""A-kinase anchor proteins"""	376	protein-coding gene	gene with protein product	"""protein kinase A anchoring protein 6"""	604691				7721854, 9205841	Standard	NM_004274		Approved	KIAA0311, mAKAP, AKAP100, PRKA6, ADAP6	uc001wrq.3	Q13023	OTTHUMG00000140207	ENST00000280979.4:c.997C>G	14.37:g.33014856C>G	ENSP00000280979:p.Leu333Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E242|A7E2D4|O15028	Missense_Mutation	SNP	smart_Spectrin/alpha-actinin	p.L333V	ENST00000280979.4	37	c.997	CCDS9644.1	14	.	.	.	.	.	.	.	.	.	.	C	0.010	-1.744845	0.00675	.	.	ENSG00000151320	ENST00000280979;ENST00000557354;ENST00000557272;ENST00000553547	T;T;T;T	0.27557	1.66;1.66;1.66;1.66	5.58	2.6	0.31112	.	1.625990	0.03230	N	0.178774	T	0.24928	0.0605	L	0.44542	1.39	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.30707	-0.9969	10	0.02654	T	1	7.0015	7.9219	0.29850	0.0:0.449:0.4387:0.1123	.	333;333	A7E242;Q13023	.;AKAP6_HUMAN	V	333;333;333;91	ENSP00000280979:L333V;ENSP00000450531:L333V;ENSP00000451247:L333V;ENSP00000451239:L91V	ENSP00000280979:L333V	L	+	1	2	AKAP6	32084607	0.002000	0.14202	0.001000	0.08648	0.285000	0.27093	1.372000	0.34261	0.778000	0.33520	0.655000	0.94253	CTG	AKAP6	-	NULL		0.493	AKAP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AKAP6	HGNC	protein_coding	OTTHUMT00000276617.2	C	NM_004274		33014856	+1	no_errors	ENST00000280979	ensembl	human	known	70_37	missense	SNP	0.000	G
ALK	238	genome.wustl.edu	37	2	29419650	29419650	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:29419650C>T	ENST00000389048.3	-	28	5056	c.4150G>A	c.(4150-4152)Gaa>Aaa	p.E1384K	ALK_ENST00000431873.1_Intron	NM_004304.4	NP_004295.2	Q9UM73	ALK_HUMAN	anaplastic lymphoma receptor tyrosine kinase	1384	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cell proliferation (GO:0008283)|neuron development (GO:0048666)|NIK/NF-kappaB signaling (GO:0038061)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphorylation (GO:0016310)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein autophosphorylation (GO:0046777)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|protein complex (GO:0043234)	ATP binding (GO:0005524)|NF-kappaB-inducing kinase activity (GO:0004704)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)		ATIC/ALK(24)|FN1/ALK(2)|C2orf44/ALK(2)|TPM3/ALK(33)|KLC1/ALK(2)|VCL/ALK(4)|TPM4/ALK(12)|KIF5B/ALK(8)|RANBP2/ALK(34)|SQSTM1/ALK(2)|EML4/ALK(543)|PPFIBP1/ALK(3)|SEC31A/ALK(3)|NPM1/ALK(632)|CLTC/ALK(44)|CARS/ALK(5)|MSN/ALK(6)|TFG/ALK(9)	NS(2)|autonomic_ganglia(198)|breast(8)|central_nervous_system(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(4)|large_intestine(25)|lung(61)|ovary(6)|pancreas(1)|prostate(2)|skin(5)|soft_tissue(3)|stomach(2)|thyroid(2)	340	Acute lymphoblastic leukemia(172;0.155)				Adenosine triphosphate(DB00171)|Crizotinib(DB08865)	GTGCAGTATTCAATCCTCTCC	0.383			"""T, Mis, A"""	"""NPM1, TPM3, TFG, TPM4, ATIC, CLTC, MSN, ALO17, CARS, EML4, KIF5B, C2orf22"""	"""ALCL, NSCLC, Neuroblastoma"""	neuroblastoma			Neuroblastoma, Familial Clustering of;Congenital Central Hypoventilation Syndrome		OREG0014526	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																											yes	Dom	yes	Familial neuroblastoma	2	2p23	238	anaplastic lymphoma kinase (Ki-1)		"""L, E, M"""	0													125.0	123.0	123.0					2																	29419650		2203	4300	6503	SO:0001583	missense	238	Familial Cancer Database	Familial Neuroblastoma;CCHS, Ondine Curse, incl. Ondine-Hirschsprung Disease	D45915	CCDS33172.1	2p23	2014-09-17	2008-01-23		ENSG00000171094	ENSG00000171094		"""CD molecules"""	427	protein-coding gene	gene with protein product		105590	"""anaplastic lymphoma kinase (Ki-1)"""			8122112	Standard	NM_004304		Approved	CD246	uc002rmy.3	Q9UM73	OTTHUMG00000152034	ENST00000389048.3:c.4150G>A	2.37:g.29419650C>T	ENSP00000373700:p.Glu1384Lys	Somatic	809	WXS	Illumina HiSeq	Phase_IV	Q4ZFX9|Q53QQ6|Q53RZ4|Q59FI3|Q9Y4K6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_MAM_dom,superfamily_Kinase-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_MAM_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E1384K	ENST00000389048.3	37	c.4150	CCDS33172.1	2	.	.	.	.	.	.	.	.	.	.	C	12.23	1.876288	0.33162	.	.	ENSG00000171094	ENST00000389048	T	0.78816	-1.21	5.79	5.79	0.91817	Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.47852	U	0.000218	T	0.69655	0.3135	L	0.41961	1.31	0.80722	D	1	B	0.06786	0.001	B	0.04013	0.001	T	0.62723	-0.6794	9	.	.	.	.	13.2642	0.60125	0.0:0.9276:0.0:0.0723	.	1384	Q9UM73	ALK_HUMAN	K	1384	ENSP00000373700:E1384K	.	E	-	1	0	ALK	29273154	1.000000	0.71417	1.000000	0.80357	0.809000	0.45718	2.726000	0.47302	2.740000	0.93945	0.563000	0.77884	GAA	ALK	-	superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom		0.383	ALK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALK	HGNC	protein_coding	OTTHUMT00000324994.1	C	NM_004304		29419650	-1	no_errors	ENST00000389048	ensembl	human	known	70_37	missense	SNP	1.000	T
ALPI	248	genome.wustl.edu	37	2	233322739	233322739	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:233322739G>C	ENST00000295463.3	+	8	965	c.888G>C	c.(886-888)gaG>gaC	p.E296D		NM_001631.3	NP_001622.2	P09923	PPBI_HUMAN	alkaline phosphatase, intestinal	296					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|magnesium ion binding (GO:0000287)|protease binding (GO:0002020)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(2)|lung(10)|prostate(2)|upper_aerodigestive_tract(1)	24		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;1.64e-16)|Kidney(3;9.71e-08)|KIRC - Kidney renal clear cell carcinoma(3;2.74e-06)|BRCA - Breast invasive adenocarcinoma(100;0.000763)|Lung(119;0.00564)|LUSC - Lung squamous cell carcinoma(224;0.00746)		CGAAATATGAGATCCACCGAG	0.612																																																	0													89.0	95.0	93.0					2																	233322739		2203	4300	6503	SO:0001583	missense	248			M15694	CCDS2492.1	2q37.1	2008-02-05			ENSG00000163295	ENSG00000163295	3.1.3.1		437	protein-coding gene	gene with protein product		171740				3468508, 3469665	Standard	NM_001631		Approved		uc002vst.4	P09923	OTTHUMG00000133258	ENST00000295463.3:c.888G>C	2.37:g.233322739G>C	ENSP00000295463:p.Glu296Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7Y4|Q53S80|Q9UBV5|Q9UCL2	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.E296D	ENST00000295463.3	37	c.888	CCDS2492.1	2	.	.	.	.	.	.	.	.	.	.	G	8.104	0.777296	0.16120	.	.	ENSG00000163295	ENST00000295463	D	0.97041	-4.22	4.46	-8.92	0.00774	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.463440	0.25261	N	0.031952	D	0.88540	0.6464	N	0.21097	0.63	0.19300	N	0.999977	B	0.16802	0.019	B	0.26969	0.075	T	0.79550	-0.1757	10	0.25751	T	0.34	.	1.5432	0.02559	0.1847:0.1969:0.1832:0.4352	.	296	P09923	PPBI_HUMAN	D	296	ENSP00000295463:E296D	ENSP00000295463:E296D	E	+	3	2	ALPI	233030983	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	-4.011000	0.00314	-1.985000	0.00984	-0.291000	0.09656	GAG	ALPI	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase		0.612	ALPI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPI	HGNC	protein_coding	OTTHUMT00000257035.2	G	NM_001631		233322739	+1	no_errors	ENST00000295463	ensembl	human	known	70_37	missense	SNP	0.000	C
ALS2CL	259173	genome.wustl.edu	37	3	46716160	46716160	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:46716160G>A	ENST00000318962.4	-	21	2408	c.2325C>T	c.(2323-2325)ctC>ctT	p.L775L	ALS2CL_ENST00000415953.1_Silent_p.L775L|ALS2CL_ENST00000383742.3_Silent_p.L122L	NM_147129.3	NP_667340.2	Q60I27	AL2CL_HUMAN	ALS2 C-terminal like	775					endosome organization (GO:0007032)|protein localization (GO:0008104)	cytoplasmic membrane-bounded vesicle (GO:0016023)	GTPase activator activity (GO:0005096)|identical protein binding (GO:0042802)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(7)|skin(3)|stomach(2)	29				BRCA - Breast invasive adenocarcinoma(193;0.000726)|KIRC - Kidney renal clear cell carcinoma(197;0.0171)|Kidney(197;0.0202)		GCAGCAGGTAGAGCGTGAAGA	0.572																																																	0													119.0	106.0	110.0					3																	46716160		2203	4300	6503	SO:0001819	synonymous_variant	259173			AK074118	CCDS2743.1, CCDS43080.1	3p21.31	2008-01-30			ENSG00000178038	ENSG00000178038			20605	protein-coding gene	gene with protein product		612402				15388334, 8889548, 17239822	Standard	NM_147129		Approved	FLJ36525, RN49018, DKFZp686I0110	uc003cqb.2	Q60I27	OTTHUMG00000128673	ENST00000318962.4:c.2325C>T	3.37:g.46716160G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q32MA1|Q6AI56|Q6ZNC5|Q6ZNC7|Q6ZTL4|Q86YD2|Q8N9U1|Q8NAL7	Silent	SNP	pfam_MORN,pfam_VPS9,superfamily_DH-domain,smart_MORN,pfscan_VPS9	p.L775	ENST00000318962.4	37	c.2325	CCDS2743.1	3																																																																																			ALS2CL	-	NULL		0.572	ALS2CL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALS2CL	HGNC	protein_coding	OTTHUMT00000250567.3	G	NM_147129		46716160	-1	no_errors	ENST00000318962	ensembl	human	known	70_37	silent	SNP	1.000	A
ANK1	286	genome.wustl.edu	37	8	41554223	41554223	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:41554223G>C	ENST00000347528.4	-	25	2789	c.2706C>G	c.(2704-2706)atC>atG	p.I902M	ANK1_ENST00000265709.8_Missense_Mutation_p.I943M|ANK1_ENST00000379758.2_Missense_Mutation_p.I902M|ANK1_ENST00000289734.7_Missense_Mutation_p.I902M|ANK1_ENST00000396945.1_Missense_Mutation_p.I902M|ANK1_ENST00000352337.4_Missense_Mutation_p.I902M|ANK1_ENST00000396942.1_Missense_Mutation_p.I902M	NM_020475.2|NM_020476.2|NM_020477.2	NP_065208.2|NP_065209.2|NP_065210.2	P16157	ANK1_HUMAN	ankyrin 1, erythrocytic	902				I -> T (in Ref. 3; AAB47805). {ECO:0000305}.	axon guidance (GO:0007411)|cytoskeleton organization (GO:0007010)|ER to Golgi vesicle-mediated transport (GO:0006888)|erythrocyte development (GO:0048821)|exocytosis (GO:0006887)|maintenance of epithelial cell apical/basal polarity (GO:0045199)|monovalent inorganic cation transport (GO:0015672)|porphyrin-containing compound biosynthetic process (GO:0006779)|positive regulation of organelle organization (GO:0010638)|protein targeting to plasma membrane (GO:0072661)|signal transduction (GO:0007165)	axolemma (GO:0030673)|basolateral plasma membrane (GO:0016323)|cortical cytoskeleton (GO:0030863)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|M band (GO:0031430)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)|spectrin-associated cytoskeleton (GO:0014731)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|cytoskeletal adaptor activity (GO:0008093)|enzyme binding (GO:0019899)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)|structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(4)|endometrium(9)|kidney(1)|large_intestine(26)|lung(62)|ovary(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(3)	122	Ovarian(28;0.00541)|Colorectal(14;0.0398)|Lung SC(25;0.211)	all_lung(54;0.000626)|Lung NSC(58;0.00245)|Esophageal squamous(32;0.0559)|Hepatocellular(245;0.0663)|Renal(179;0.188)	OV - Ovarian serous cystadenocarcinoma(14;0.000984)|Lung(22;0.00108)|Colorectal(10;0.00245)|LUSC - Lung squamous cell carcinoma(45;0.00392)|COAD - Colon adenocarcinoma(11;0.0264)			CCACCGGGCTGATGTTGTCTG	0.632																																																	0													42.0	47.0	45.0					8																	41554223		2203	4300	6503	SO:0001583	missense	286			M28880	CCDS6119.1, CCDS6121.1, CCDS6122.1, CCDS47849.1, CCDS55227.1	8p11.21	2013-01-10			ENSG00000029534	ENSG00000029534		"""Ankyrin repeat domain containing"""	492	protein-coding gene	gene with protein product		612641		ANK		1689849	Standard	NM_001142445		Approved	SPH1	uc003xom.3	P16157	OTTHUMG00000150281	ENST00000347528.4:c.2706C>G	8.37:g.41554223G>C	ENSP00000339620:p.Ile902Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJN8|A6NJ23|E5RFL7|O43400|Q13768|Q53ER1|Q59FP2|Q8N604|Q99407	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.I902M	ENST00000347528.4	37	c.2706	CCDS6119.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.19|14.19	2.461504|2.461504	0.43736|0.43736	.|.	.|.	ENSG00000029534|ENSG00000029534	ENST00000347528;ENST00000289734;ENST00000379758;ENST00000396945;ENST00000396942;ENST00000352337;ENST00000265709;ENST00000358820|ENST00000520299	T;T;T;T;T;T;T|.	0.66280|.	-0.2;-0.2;-0.18;-0.16;-0.18;-0.17;-0.18|.	5.67|5.67	3.6|3.6	0.41247|0.41247	.|.	0.055185|.	0.64402|.	D|.	0.000001|.	T|T	0.55497|0.55497	0.1924|0.1924	L|L	0.39898|0.39898	1.24|1.24	0.45806|0.45806	D|D	0.99868|0.99868	B;B;P;B;B;P|.	0.41080|.	0.029;0.088;0.524;0.09;0.029;0.737|.	B;B;B;B;B;B|.	0.42882|.	0.09;0.043;0.289;0.112;0.09;0.401|.	T|T	0.51733|0.51733	-0.8668|-0.8668	10|5	0.62326|.	D|.	0.03|.	.|.	11.9038|11.9038	0.52699|0.52699	0.1882:0.0:0.8118:0.0|0.1882:0.0:0.8118:0.0	.|.	943;902;902;902;902;218|.	P16157-21;P16157-4;P16157;P16157-5;P16157-3;B3KX39|.	.;.;ANK1_HUMAN;.;.;.|.	M|E	902;902;902;902;902;902;943;902|224	ENSP00000339620:I902M;ENSP00000289734:I902M;ENSP00000369082:I902M;ENSP00000380149:I902M;ENSP00000380147:I902M;ENSP00000309131:I902M;ENSP00000265709:I943M|.	ENSP00000265709:I943M|.	I|Q	-|-	3|1	3|0	ANK1|ANK1	41673380|41673380	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	2.133000|2.133000	0.42093|0.42093	1.378000|1.378000	0.46305|0.46305	0.561000|0.561000	0.74099|0.74099	ATC|CAG	ANK1	-	NULL		0.632	ANK1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANK1	HGNC	protein_coding	OTTHUMT00000317297.1	G	NM_020475		41554223	-1	no_errors	ENST00000396942	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD12	23253	genome.wustl.edu	37	18	9258686	9258686	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:9258686G>A	ENST00000262126.4	+	9	5661	c.5421G>A	c.(5419-5421)gaG>gaA	p.E1807E	ANKRD12_ENST00000383440.2_Silent_p.E1784E|RP11-888D10.4_ENST00000609701.1_RNA|ANKRD12_ENST00000400020.3_Silent_p.E1784E	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	1807						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AAGCAAAAGAGAAAACTCAGC	0.423																																																	0													71.0	72.0	72.0					18																	9258686		2203	4300	6503	SO:0001819	synonymous_variant	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.5421G>A	18.37:g.9258686G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E1807	ENST00000262126.4	37	c.5421	CCDS11843.1	18																																																																																			ANKRD12	-	NULL		0.423	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9258686	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	silent	SNP	1.000	A
ANKRD13B	124930	genome.wustl.edu	37	17	27938969	27938969	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:27938969G>C	ENST00000394859.3	+	10	1199	c.1045G>C	c.(1045-1047)Gag>Cag	p.E349Q	RP11-68I3.2_ENST00000581474.1_RNA	NM_152345.4	NP_689558.4	Q86YJ7	AN13B_HUMAN	ankyrin repeat domain 13B	349						endosome (GO:0005768)|plasma membrane (GO:0005886)				cervix(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|skin(2)	16						CCCCAACTTTGAGCTGGGCAA	0.612																																																	0													72.0	68.0	69.0					17																	27938969		2203	4300	6503	SO:0001583	missense	124930			AK092673	CCDS11251.1	17q11.2	2013-01-10			ENSG00000198720	ENSG00000198720		"""Ankyrin repeat domain containing"""	26363	protein-coding gene	gene with protein product		615124					Standard	NM_152345		Approved	FLJ25555	uc002hei.3	Q86YJ7	OTTHUMG00000132731	ENST00000394859.3:c.1045G>C	17.37:g.27938969G>C	ENSP00000378328:p.Glu349Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7S9	Missense_Mutation	SNP	pfam_ANKRD13,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Ubiquitin-int_motif,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif	p.E349Q	ENST00000394859.3	37	c.1045	CCDS11251.1	17	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997845	0.54147	.	.	ENSG00000198720	ENST00000394859	T	0.44083	0.93	5.97	5.97	0.96955	.	0.276856	0.43747	D	0.000536	T	0.38799	0.1054	L	0.33485	1.01	0.47547	D	0.999459	B	0.21071	0.051	B	0.23018	0.043	T	0.08868	-1.0701	10	0.46703	T	0.11	-31.9063	20.0384	0.97572	0.0:0.0:1.0:0.0	.	349	Q86YJ7	AN13B_HUMAN	Q	349	ENSP00000378328:E349Q	ENSP00000378328:E349Q	E	+	1	0	ANKRD13B	24963095	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	6.086000	0.71352	2.837000	0.97791	0.655000	0.94253	GAG	ANKRD13B	-	pfam_ANKRD13		0.612	ANKRD13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD13B	HGNC	protein_coding	OTTHUMT00000256077.1	G	NM_152345		27938969	+1	no_errors	ENST00000394859	ensembl	human	known	70_37	missense	SNP	0.999	C
ANO2	57101	genome.wustl.edu	37	12	5687152	5687152	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:5687152G>C	ENST00000356134.5	-	24	2482	c.2411C>G	c.(2410-2412)tCt>tGt	p.S804C	ANO2_ENST00000546188.1_Missense_Mutation_p.S804C|ANO2_ENST00000327087.8_Missense_Mutation_p.S803C	NM_001278596.1	NP_001265525.1	Q9NQ90	ANO2_HUMAN	anoctamin 2, calcium activated chloride channel	808					chloride transmembrane transport (GO:1902476)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	chloride channel complex (GO:0034707)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(5)|stomach(3)|upper_aerodigestive_tract(1)	58						GCCAATTCCAGAGAGAATGTC	0.502																																																	0													132.0	130.0	131.0					12																	5687152		2008	4182	6190	SO:0001583	missense	57101			AJ272204	CCDS44807.1, CCDS44807.2	12p13.3	2014-04-09	2014-04-09	2008-08-28		ENSG00000047617		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	1183	protein-coding gene	gene with protein product	"""transmembrane protein 16B (eight membrane-spanning domains)"""	610109	"""chromosome 12 open reading frame 3"", ""transmembrane protein 16B"", ""anoctamin 2"""	C12orf3, TMEM16B		12739008, 15067359, 24692353	Standard	NM_001278596		Approved		uc001qnm.2	Q9NQ90		ENST00000356134.5:c.2411C>G	12.37:g.5687152G>C	ENSP00000348453:p.Ser804Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	C4N787|Q9H847	Missense_Mutation	SNP	pfam_Anoctamin	p.S804C	ENST00000356134.5	37	c.2411		12	.	.	.	.	.	.	.	.	.	.	G	15.02	2.710199	0.48517	.	.	ENSG00000047617	ENST00000327087;ENST00000356134;ENST00000546188;ENST00000541277	T;T;T	0.64260	-0.09;-0.09;-0.09	5.52	5.52	0.82312	.	0.108340	0.64402	D	0.000016	T	0.58694	0.2140	L	0.46157	1.445	0.54753	D	0.999987	B	0.23591	0.088	B	0.31245	0.126	T	0.58177	-0.7682	10	0.54805	T	0.06	.	13.1298	0.59375	0.0:0.2634:0.7365:0.0	.	803	Q9NQ90-3	.	C	803;804;804;808	ENSP00000314048:S803C;ENSP00000348453:S804C;ENSP00000440981:S804C	ENSP00000314048:S803C	S	-	2	0	ANO2	5557413	1.000000	0.71417	0.968000	0.41197	0.984000	0.73092	5.561000	0.67339	2.598000	0.87819	0.655000	0.94253	TCT	ANO2	-	pfam_Anoctamin		0.502	ANO2-001	KNOWN	basic	protein_coding	ANO2	HGNC	protein_coding	OTTHUMT00000399019.4	G	NM_020373		5687152	-1	no_errors	ENST00000356134	ensembl	human	known	70_37	missense	SNP	0.997	C
ANP32E	81611	genome.wustl.edu	37	1	150203003	150203003	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:150203003G>A	ENST00000314136.8	-	3	599	c.230C>T	c.(229-231)tCt>tTt	p.S77F	ANP32E_ENST00000369115.2_Intron|ANP32E_ENST00000436748.2_Intron|ANP32E_ENST00000533654.1_Missense_Mutation_p.S77F|ANP32E_ENST00000369119.3_Missense_Mutation_p.S29F|ANP32E_ENST00000369116.4_Intron|ANP32E_ENST00000369114.5_Missense_Mutation_p.S77F	NM_001136478.2|NM_001280559.1|NM_030920.3	NP_001129950.1|NP_001267488.1|NP_112182.1	Q9BTT0	AN32E_HUMAN	acidic (leucine-rich) nuclear phosphoprotein 32 family, member E	77					histone exchange (GO:0043486)|negative regulation of catalytic activity (GO:0043086)	cytoplasmic membrane-bounded vesicle (GO:0016023)|nucleus (GO:0005634)|Swr1 complex (GO:0000812)	histone binding (GO:0042393)|phosphatase inhibitor activity (GO:0019212)			breast(3)|endometrium(3)|lung(7)|skin(1)|urinary_tract(1)	15	Lung NSC(24;7.29e-29)|Breast(34;0.00211)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.161)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)			CAAGCCTCCAGAAATTATATT	0.328																																																	0													93.0	95.0	94.0					1																	150203003		2203	4300	6503	SO:0001583	missense	81611			AK092672	CCDS946.1, CCDS44214.1, CCDS44215.1, CCDS60245.1	1q22	2008-02-05			ENSG00000143401	ENSG00000143401		"""ANP32 acidic nuclear phosphoproteins"""	16673	protein-coding gene	gene with protein product		609611				12438741	Standard	NM_030920		Approved	LANPL, MGC5350, LANP-L	uc001etw.3	Q9BTT0	OTTHUMG00000012547	ENST00000314136.8:c.230C>T	1.37:g.150203003G>A	ENSP00000324074:p.Ser77Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E0I6|E9PEA6|Q5TB18|Q5TB20|Q8N1S4|Q8WWW9	Missense_Mutation	SNP	pfam_Leu-rich_rpt	p.S77F	ENST00000314136.8	37	c.230	CCDS946.1	1	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189948	0.78789	.	.	ENSG00000143401	ENST00000314136;ENST00000369119;ENST00000369114;ENST00000533654;ENST00000532744	T;T;T;T;T	0.26373	1.74;1.74;2.8;2.8;8.06	6.02	6.02	0.97574	.	0.108661	0.64402	D	0.000004	T	0.40322	0.1112	L	0.53671	1.685	0.80722	D	1	D;P;D	0.89917	0.999;0.716;1.0	D;P;D	0.70716	0.965;0.724;0.97	T	0.02378	-1.1168	10	0.45353	T	0.12	.	19.5267	0.95209	0.0:0.0:1.0:0.0	.	77;77;29	E9PLC4;Q9BTT0;Q5TB20	.;AN32E_HUMAN;.	F	77;29;77;77;27	ENSP00000324074:S77F;ENSP00000358115:S29F;ENSP00000358110:S77F;ENSP00000435215:S77F;ENSP00000432684:S27F	ENSP00000324074:S77F	S	-	2	0	ANP32E	148469627	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.501000	0.73691	2.863000	0.98299	0.549000	0.68633	TCT	ANP32E	-	NULL		0.328	ANP32E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANP32E	HGNC	protein_coding	OTTHUMT00000035056.1	G	NM_030920		150203003	-1	no_errors	ENST00000314136	ensembl	human	known	70_37	missense	SNP	1.000	A
APBA2	321	genome.wustl.edu	37	15	29346279	29346279	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:29346279C>G	ENST00000558402.1	+	5	791	c.192C>G	c.(190-192)caC>caG	p.H64Q	APBA2_ENST00000561069.1_Missense_Mutation_p.H64Q|APBA2_ENST00000558330.1_Missense_Mutation_p.H64Q|APBA2_ENST00000558259.1_Missense_Mutation_p.H64Q|APBA2_ENST00000411764.1_Missense_Mutation_p.H64Q			Q99767	APBA2_HUMAN	amyloid beta (A4) precursor protein-binding, family A, member 2	64					in utero embryonic development (GO:0001701)|locomotory behavior (GO:0007626)|multicellular organism growth (GO:0035264)|nervous system development (GO:0007399)|protein transport (GO:0015031)|regulation of gene expression (GO:0010468)|synaptic transmission (GO:0007268)	plasma membrane (GO:0005886)	beta-amyloid binding (GO:0001540)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|liver(2)|lung(33)|stomach(1)|urinary_tract(1)	59		all_lung(180;1.73e-12)|Breast(32;2.89e-05)|Colorectal(260;0.234)		all cancers(64;7.44e-11)|Epithelial(43;5.74e-10)|GBM - Glioblastoma multiforme(186;0.026)|BRCA - Breast invasive adenocarcinoma(123;0.0286)|Lung(196;0.24)		AGGAGTGCCACAACCACAGCC	0.652																																																	0													78.0	88.0	84.0					15																	29346279		2203	4300	6503	SO:0001583	missense	321			AB014719	CCDS10022.1, CCDS45197.1	15q11-q12	2008-07-18	2008-07-18		ENSG00000034053	ENSG00000034053			579	protein-coding gene	gene with protein product		602712	"""X11-like"", ""amyloid beta (A4) precursor protein-binding, family A, member 2 (X11-like)"""	X11L, MINT2		8955346	Standard	NM_005503		Approved	D15S1518E, LIN-10, MGC:14091, HsT16821	uc001zck.3	Q99767	OTTHUMG00000129255	ENST00000558402.1:c.192C>G	15.37:g.29346279C>G	ENSP00000453293:p.His64Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PGI4|O60571|Q5XKC0	Missense_Mutation	SNP	pfam_PTyr_interaction_dom,pfam_PDZ,superfamily_PDZ,smart_PTyr_interaction_dom,smart_PDZ,pfscan_PDZ,pfscan_PTyr_interaction_dom	p.H64Q	ENST00000558402.1	37	c.192	CCDS10022.1	15	.	.	.	.	.	.	.	.	.	.	C	11.80	1.746361	0.30955	.	.	ENSG00000034053	ENST00000411764;ENST00000219865	T	0.44881	0.91	5.25	-3.09	0.05331	.	0.547997	0.19434	N	0.114343	T	0.31544	0.0800	L	0.44542	1.39	0.29892	N	0.825139	B;B;B	0.24823	0.112;0.112;0.112	B;B;B	0.23018	0.043;0.04;0.04	T	0.27331	-1.0077	10	0.72032	D	0.01	.	12.3346	0.55060	0.0:0.3012:0.0:0.6988	.	64;64;64	Q5XKC0;E9PGI4;Q99767	.;.;APBA2_HUMAN	Q	64	ENSP00000409312:H64Q	ENSP00000219865:H64Q	H	+	3	2	APBA2	27133571	0.244000	0.23889	0.087000	0.20705	0.942000	0.58702	-0.681000	0.05191	-0.520000	0.06435	-0.142000	0.14014	CAC	APBA2	-	NULL		0.652	APBA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APBA2	HGNC	protein_coding	OTTHUMT00000251362.3	C	NM_005503		29346279	+1	no_errors	ENST00000558259	ensembl	human	known	70_37	missense	SNP	0.905	G
ARFGEF2	10564	genome.wustl.edu	37	20	47587889	47587889	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:47587889G>C	ENST00000371917.4	+	10	1423	c.1423G>C	c.(1423-1425)Gag>Cag	p.E475Q		NM_006420.2	NP_006411.2	Q9Y6D5	BIG2_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 2 (brefeldin A-inhibited)	475					endomembrane system organization (GO:0010256)|endosome organization (GO:0007032)|exocytosis (GO:0006887)|Golgi to plasma membrane transport (GO:0006893)|intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of tumor necrosis factor production (GO:0032760)|protein transport (GO:0015031)|receptor recycling (GO:0001881)|regulation of ARF protein signal transduction (GO:0032012)|vesicle-mediated transport (GO:0016192)	asymmetric synapse (GO:0032279)|axonemal microtubule (GO:0005879)|cell junction (GO:0030054)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|recycling endosome (GO:0055037)|symmetric synapse (GO:0032280)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|GABA receptor binding (GO:0050811)|guanyl-nucleotide exchange factor activity (GO:0005085)|protein kinase A regulatory subunit binding (GO:0034237)			breast(7)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(11)|lung(19)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	63			BRCA - Breast invasive adenocarcinoma(12;0.00148)|Colorectal(8;0.198)			AATGCAGATAGAGGTACGGAT	0.313																																					Esophageal Squamous(176;1738 1974 26285 33069 35354)												0													83.0	76.0	78.0					20																	47587889		2203	4300	6503	SO:0001583	missense	10564			AF084521	CCDS13411.1	20q13.13	2010-08-20			ENSG00000124198	ENSG00000124198		"""A-kinase anchor proteins"""	15853	protein-coding gene	gene with protein product	"""Brefeldin A-inhibited guanine nucleotide-exchange protein 2"""	605371				10212200	Standard	NM_006420		Approved	BIG2	uc002xtx.4	Q9Y6D5	OTTHUMG00000032687	ENST00000371917.4:c.1423G>C	20.37:g.47587889G>C	ENSP00000360985:p.Glu475Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TFT9|Q9NTS1	Missense_Mutation	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.E475Q	ENST00000371917.4	37	c.1423	CCDS13411.1	20	.	.	.	.	.	.	.	.	.	.	G	24.7	4.558089	0.86231	.	.	ENSG00000124198	ENST00000538445;ENST00000371917	T	0.59083	0.29	5.91	5.91	0.95273	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.75989	0.3925	M	0.86178	2.8	0.80722	D	1	D	0.53462	0.96	P	0.54924	0.764	T	0.78486	-0.2185	10	0.62326	D	0.03	.	20.2985	0.98592	0.0:0.0:1.0:0.0	.	475	Q9Y6D5	BIG2_HUMAN	Q	475	ENSP00000360985:E475Q	ENSP00000360985:E475Q	E	+	1	0	ARFGEF2	47021296	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	9.476000	0.97823	2.793000	0.96121	0.655000	0.94253	GAG	ARFGEF2	-	superfamily_ARM-type_fold		0.313	ARFGEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF2	HGNC	protein_coding	OTTHUMT00000079627.1	G	NM_006420		47587889	+1	no_errors	ENST00000371917	ensembl	human	known	70_37	missense	SNP	1.000	C
ARHGAP31	57514	genome.wustl.edu	37	3	119120821	119120821	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:119120821G>A	ENST00000264245.4	+	10	1754	c.1222G>A	c.(1222-1224)Gag>Aag	p.E408K		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	408					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TCCCGGGGCTGAGGGTGGCTT	0.637																																					Pancreas(7;176 297 5394 51128 51241)												0													41.0	51.0	48.0					3																	119120821		2007	4180	6187	SO:0001583	missense	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.1222G>A	3.37:g.119120821G>A	ENSP00000264245:p.Glu408Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULL6	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.E408K	ENST00000264245.4	37	c.1222	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	G	13.46	2.243754	0.39697	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	T	0.06528	3.29	5.48	4.61	0.57282	.	0.093814	0.46442	D	0.000289	T	0.05823	0.0152	L	0.48362	1.52	0.25271	N	0.989517	B	0.16396	0.017	B	0.14023	0.01	T	0.34725	-0.9817	10	0.22109	T	0.4	.	5.3997	0.16288	0.1544:0.1838:0.6618:0.0	.	408	Q2M1Z3	RHG31_HUMAN	K	408	ENSP00000264245:E408K	ENSP00000264245:E408K	E	+	1	0	ARHGAP31	120603511	0.964000	0.33143	0.899000	0.35326	0.951000	0.60555	1.994000	0.40757	1.540000	0.49301	0.655000	0.94253	GAG	ARHGAP31	-	NULL		0.637	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	G			119120821	+1	no_errors	ENST00000264245	ensembl	human	known	70_37	missense	SNP	0.456	A
ARHGAP35	2909	genome.wustl.edu	37	19	47422775	47422775	+	Silent	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:47422775G>C	ENST00000404338.3	+	1	843	c.843G>C	c.(841-843)gtG>gtC	p.V281V		NM_004491.4	NP_004482.4	Q9NRY4	RHG35_HUMAN	Rho GTPase activating protein 35	281	FF 1.				axon guidance (GO:0007411)|camera-type eye development (GO:0043010)|forebrain development (GO:0030900)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular permeability (GO:0043116)|neural tube closure (GO:0001843)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)|GTP binding (GO:0005525)|Rho GTPase activator activity (GO:0005100)|transcription corepressor activity (GO:0003714)										AGTGGCTGGTGAGTCGCATTG	0.458																																																	0													49.0	50.0	49.0					19																	47422775		2026	4211	6237	SO:0001819	synonymous_variant	2909			M73077	CCDS46127.1	19q13.32	2011-06-29	2011-06-07	2011-06-07	ENSG00000160007	ENSG00000160007		"""Rho GTPase activating proteins"""	4591	protein-coding gene	gene with protein product		605277	"""glucocorticoid receptor DNA binding factor 1"""	GRLF1		1894621, 20675588	Standard	NM_004491		Approved	GRF-1, p190ARhoGAP, P190A, KIAA1722, p190RhoGAP	uc010ekv.3	Q9NRY4		ENST00000404338.3:c.843G>C	19.37:g.47422775G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2A4|Q14452|Q9C0E1	Silent	SNP	pfam_RhoGAP_dom,pfam_Small_GTPase,pfam_FF_domain,superfamily_Rho_GTPase_activation_prot,superfamily_FF_domain,smart_FF_domain,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.V281	ENST00000404338.3	37	c.843	CCDS46127.1	19																																																																																			ARHGAP35	-	smart_FF_domain		0.458	ARHGAP35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP35	HGNC	protein_coding	OTTHUMT00000466652.1	G	NM_004491		47422775	+1	no_errors	ENST00000404338	ensembl	human	known	70_37	silent	SNP	1.000	C
ARHGEF9	23229	genome.wustl.edu	37	X	62863882	62863882	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:62863882C>T	ENST00000253401.6	-	9	2147	c.1347G>A	c.(1345-1347)gtG>gtA	p.V449V	ARHGEF9_ENST00000374872.1_Silent_p.V428V|ARHGEF9_ENST00000433323.2_Silent_p.V176V|ARHGEF9_ENST00000437457.2_Silent_p.V396V|ARHGEF9_ENST00000495564.1_5'UTR|ARHGEF9_ENST00000374878.1_Silent_p.V447V|ARHGEF9_ENST00000374870.4_Silent_p.V347V	NM_015185.2	NP_056000.1	O43307	ARHG9_HUMAN	Cdc42 guanine nucleotide exchange factor (GEF) 9	449					apoptotic signaling pathway (GO:0097190)|ion transmembrane transport (GO:0034220)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(6)|lung(14)|ovary(5)|pancreas(1)|skin(1)	35						GGACTTTTCTCACAGTCATTG	0.373																																																	0													154.0	131.0	139.0					X																	62863882		2203	4300	6503	SO:0001819	synonymous_variant	23229			AB007884	CCDS35315.1, CCDS55429.1, CCDS55430.1	Xq11.1	2013-01-10			ENSG00000131089	ENSG00000131089		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	14561	protein-coding gene	gene with protein product	"""collybistin"""	300429				10559246, 9455477	Standard	NM_015185		Approved	KIAA0424, PEM-2	uc011mot.2	O43307	OTTHUMG00000021700	ENST00000253401.6:c.1347G>A	X.37:g.62863882C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1S8|B4DHC7|F8W7P8|Q5JSL6	Silent	SNP	pfam_DH-domain,pfam_SH3_2,pfam_SH3_domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.V449	ENST00000253401.6	37	c.1347	CCDS35315.1	X																																																																																			ARHGEF9	-	NULL		0.373	ARHGEF9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF9	HGNC	protein_coding	OTTHUMT00000056937.1	C			62863882	-1	no_errors	ENST00000253401	ensembl	human	known	70_37	silent	SNP	1.000	T
ASPHD2	57168	genome.wustl.edu	37	22	26830049	26830049	+	Silent	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:26830049C>G	ENST00000215906.5	+	2	906	c.468C>G	c.(466-468)ctC>ctG	p.L156L		NM_020437.4	NP_065170.2	Q6ICH7	ASPH2_HUMAN	aspartate beta-hydroxylase domain containing 2	156					peptidyl-amino acid modification (GO:0018193)	integral component of membrane (GO:0016021)|membrane (GO:0016020)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			endometrium(3)|large_intestine(3)|lung(4)|ovary(1)|prostate(4)|urinary_tract(1)	16						GCCGGTACCTCAACAGCCGGC	0.627																																																	0													31.0	31.0	31.0					22																	26830049		2203	4300	6503	SO:0001819	synonymous_variant	57168			AK097157	CCDS13834.2	22q12.1	2006-02-02			ENSG00000128203	ENSG00000128203			30437	protein-coding gene	gene with protein product							Standard	NM_020437		Approved	FLJ39838	uc003acg.2	Q6ICH7	OTTHUMG00000150884	ENST00000215906.5:c.468C>G	22.37:g.26830049C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCH3|Q7L0W3|Q9NSN3	Silent	SNP	pfam_Asp_Arg_b-Hydrxlase	p.L156	ENST00000215906.5	37	c.468	CCDS13834.2	22																																																																																			ASPHD2	-	NULL		0.627	ASPHD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPHD2	HGNC	protein_coding	OTTHUMT00000320422.1	C	NM_020437		26830049	+1	no_errors	ENST00000215906	ensembl	human	known	70_37	silent	SNP	1.000	G
ASTL	431705	genome.wustl.edu	37	2	96803339	96803339	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:96803339G>C	ENST00000342380.2	-	2	155	c.156C>G	c.(154-156)gaC>gaG	p.D52E		NM_001002036.3	NP_001002036.3			astacin-like metallo-endopeptidase (M12 family)											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|prostate(1)|skin(2)	30						GAATGTCCTTGTCCCCGGAGG	0.597																																																	0													172.0	148.0	156.0					2																	96803339		2203	4300	6503	SO:0001583	missense	431705			AJ537600	CCDS33249.1	2q11.1	2014-07-23	2006-10-10		ENSG00000188886	ENSG00000188886	3.4.24.21		31704	protein-coding gene	gene with protein product	"""sperm acrosomal SLLP1 binding"""	608860	"""astacin-like metalloendopeptidase (M12 family)"""			15087446	Standard	NM_001002036		Approved	ovastacin, SAS1B	uc010yui.2	Q6HA08	OTTHUMG00000155212	ENST00000342380.2:c.156C>G	2.37:g.96803339G>C	ENSP00000343674:p.Asp52Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_M12A,smart_Peptidase_Metallo,prints_Peptidase_M12A	p.D52E	ENST00000342380.2	37	c.156	CCDS33249.1	2	.	.	.	.	.	.	.	.	.	.	G	18.35	3.604603	0.66445	.	.	ENSG00000188886	ENST00000342380	T	0.66995	-0.24	4.46	2.58	0.30949	.	0.000000	0.37219	N	0.002194	T	0.67599	0.2910	L	0.34521	1.04	0.23506	N	0.997538	D	0.76494	0.999	D	0.73708	0.981	T	0.55114	-0.8191	10	0.33940	T	0.23	-22.898	7.9167	0.29822	0.2107:0.0:0.7893:0.0	.	52	Q6HA08	ASTL_HUMAN	E	52	ENSP00000343674:D52E	ENSP00000343674:D52E	D	-	3	2	ASTL	96167066	0.998000	0.40836	1.000000	0.80357	0.883000	0.51084	0.217000	0.17603	1.023000	0.39654	0.650000	0.86243	GAC	ASTL	-	NULL		0.597	ASTL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASTL	HGNC	protein_coding	OTTHUMT00000338801.1	G			96803339	-1	no_errors	ENST00000342380	ensembl	human	known	70_37	missense	SNP	0.997	C
ATM	472	genome.wustl.edu	37	11	108123635	108123635	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:108123635G>A	ENST00000452508.2	+	13	2083	c.1894G>A	c.(1894-1896)Gaa>Aaa	p.E632K	ATM_ENST00000278616.4_Missense_Mutation_p.E632K			Q13315	ATM_HUMAN	ATM serine/threonine kinase	632					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to gamma radiation (GO:0071480)|DNA damage induced protein phosphorylation (GO:0006975)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|heart development (GO:0007507)|histone mRNA catabolic process (GO:0071044)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|lipoprotein catabolic process (GO:0042159)|mitotic spindle assembly checkpoint (GO:0007094)|negative regulation of B cell proliferation (GO:0030889)|neuron apoptotic process (GO:0051402)|oocyte development (GO:0048599)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron apoptotic process (GO:0043525)|pre-B cell allelic exclusion (GO:0002331)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|reciprocal meiotic recombination (GO:0007131)|replicative senescence (GO:0090399)|response to hypoxia (GO:0001666)|response to ionizing radiation (GO:0010212)|signal transduction (GO:0007165)|signal transduction involved in mitotic G2 DNA damage checkpoint (GO:0072434)|somitogenesis (GO:0001756)|telomere maintenance (GO:0000723)	cytoplasmic vesicle (GO:0031410)|nucleoplasm (GO:0005654)|spindle (GO:0005819)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|histone serine kinase activity (GO:0035174)|protein complex binding (GO:0032403)|protein dimerization activity (GO:0046983)|protein N-terminus binding (GO:0047485)|protein serine/threonine kinase activity (GO:0004674)			NS(4)|breast(23)|central_nervous_system(11)|endometrium(10)|haematopoietic_and_lymphoid_tissue(227)|kidney(19)|large_intestine(53)|liver(5)|lung(62)|ovary(6)|pancreas(4)|prostate(13)|skin(4)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	448		all_cancers(61;9.64e-12)|all_epithelial(67;9.97e-08)|Melanoma(852;2.55e-06)|Acute lymphoblastic leukemia(157;3.95e-05)|all_hematologic(158;0.00014)|Breast(348;0.0258)|all_neural(303;0.072)		Epithelial(105;9.05e-06)|BRCA - Breast invasive adenocarcinoma(274;1.06e-05)|all cancers(92;0.000208)|Colorectal(284;0.116)|OV - Ovarian serous cystadenocarcinoma(223;0.147)	Caffeine(DB00201)	AAGCGTGCCAGAATGGTATGT	0.313			"""D, Mis, N, F, S"""		T-PLL	"""leukemia, lymphoma, medulloblastoma, glioma"""		Genes defective in diseases associated with sensitivity to DNA damaging agents	Ataxia Telangiectasia	TSP Lung(14;0.12)																													yes	Rec	yes	Ataxia-telangiectasia	11	11q22.3	472	ataxia telangiectasia mutated		"""L, O"""	0													82.0	76.0	78.0					11																	108123635		2201	4295	6496	SO:0001583	missense	472	Familial Cancer Database	AT, Louis-Bar syndrome	AB209133	CCDS31669.1	11q22-q23	2014-09-17	2014-06-17		ENSG00000149311	ENSG00000149311			795	protein-coding gene	gene with protein product	"""TEL1, telomere maintenance 1, homolog (S. cerevisiae)"""	607585	"""ataxia telangiectasia mutated (includes complementation groups A, C and D)"", ""ataxia telangiectasia mutated"""	ATA, ATDC, ATC, ATD			Standard	XM_005271561		Approved	TEL1, TELO1	uc001pkb.1	Q13315	OTTHUMG00000166480	ENST00000452508.2:c.1894G>A	11.37:g.108123635G>A	ENSP00000388058:p.Glu632Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNX5|O15429|Q12758|Q16551|Q93007|Q9NP02|Q9UCX7	Missense_Mutation	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_TAN,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E632K	ENST00000452508.2	37	c.1894	CCDS31669.1	11	.	.	.	.	.	.	.	.	.	.	G	13.94	2.387704	0.42308	.	.	ENSG00000149311	ENST00000527805;ENST00000278616;ENST00000452508	T;T;T	0.01918	4.56;4.86;4.86	5.75	4.82	0.62117	Armadillo-type fold (1);	0.563208	0.18784	N	0.131252	T	0.03348	0.0097	L	0.53249	1.67	0.29179	N	0.876636	B	0.10296	0.003	B	0.10450	0.005	T	0.13818	-1.0495	10	0.34782	T	0.22	.	10.2404	0.43308	0.0691:0.255:0.6759:0.0	.	632	Q13315	ATM_HUMAN	K	632	ENSP00000435747:E632K;ENSP00000278616:E632K;ENSP00000388058:E632K	ENSP00000278616:E632K	E	+	1	0	ATM	107628845	0.999000	0.42202	1.000000	0.80357	0.854000	0.48673	1.050000	0.30404	1.396000	0.46663	0.460000	0.39030	GAA	ATM	-	superfamily_ARM-type_fold		0.313	ATM-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATM	HGNC	protein_coding	OTTHUMT00000389938.1	G	NM_000051		108123635	+1	no_errors	ENST00000278616	ensembl	human	known	70_37	missense	SNP	0.998	A
ATN1	1822	genome.wustl.edu	37	12	7043362	7043362	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:7043362G>C	ENST00000356654.4	+	3	288	c.51G>C	c.(49-51)aaG>aaC	p.K17N	ATN1_ENST00000396684.2_Missense_Mutation_p.K17N	NM_001007026.1	NP_001007027.1	P54259	ATN1_HUMAN	atrophin 1	17					cell migration (GO:0016477)|central nervous system development (GO:0007417)|maintenance of cell polarity (GO:0030011)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron apoptotic process (GO:0051402)|toxin metabolic process (GO:0009404)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)	protein domain specific binding (GO:0019904)|transcription corepressor activity (GO:0003714)			breast(5)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	40						GTGGACGGAAGAAAGAGGCCC	0.537																																																	0													43.0	46.0	45.0					12																	7043362		2203	4300	6503	SO:0001583	missense	1822			U23851	CCDS31734.1	12p	2007-08-01	2005-03-15	2005-03-17		ENSG00000111676			3033	protein-coding gene	gene with protein product		607462	"""dentatorubral-pallidoluysian atrophy (atrophin-1)"""	D12S755E, DRPLA		8136826	Standard	NM_001940		Approved	B37	uc001qrw.1	P54259		ENST00000356654.4:c.51G>C	12.37:g.7043362G>C	ENSP00000349076:p.Lys17Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q99495|Q99621|Q9UEK7	Missense_Mutation	SNP	pfam_Atrophin-like,prints_Atrophin-1	p.K17N	ENST00000356654.4	37	c.51	CCDS31734.1	12	.	.	.	.	.	.	.	.	.	.	G	23.1	4.373210	0.82573	.	.	ENSG00000111676	ENST00000356654;ENST00000396684;ENST00000544325	T;T;T	0.62788	0.0;0.0;0.0	4.71	4.71	0.59529	.	0.000000	0.32836	U	0.005586	T	0.65903	0.2736	N	0.20986	0.625	0.49299	D	0.999773	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.68606	-0.5364	10	0.72032	D	0.01	.	11.7426	0.51801	0.0809:0.0:0.9191:0.0	.	17;17	Q86V38;P54259	.;ATN1_HUMAN	N	17	ENSP00000349076:K17N;ENSP00000379915:K17N;ENSP00000441744:K17N	ENSP00000349076:K17N	K	+	3	2	ATN1	6913623	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.074000	0.71253	2.625000	0.88918	0.551000	0.68910	AAG	ATN1	-	pfam_Atrophin-like		0.537	ATN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ATN1	HGNC	protein_coding	OTTHUMT00000401948.2	G	NM_001940		7043362	+1	no_errors	ENST00000356654	ensembl	human	known	70_37	missense	SNP	1.000	C
ATP6V1B2	526	genome.wustl.edu	37	8	20055039	20055039	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:20055039C>G	ENST00000276390.2	+	1	162	c.122C>G	c.(121-123)tCc>tGc	p.S41C		NM_001693.3	NP_001684.2	P21281	VATB2_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B2	41					ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|ruffle (GO:0001726)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)			endometrium(1)|kidney(2)|lung(5)|prostate(1)	9				Colorectal(74;0.0535)|COAD - Colon adenocarcinoma(73;0.211)	Gallium nitrate(DB05260)	AACTACCTCTCCCAGCCTCGC	0.647																																					Pancreas(119;1230 1726 3901 4036 31644)												0													23.0	29.0	27.0					8																	20055039		2202	4299	6501	SO:0001583	missense	526			L35249	CCDS6014.1	8p21.3	2010-04-21	2006-01-13	2002-05-10	ENSG00000147416	ENSG00000147416	3.6.3.14	"""ATPases / V-type"""	854	protein-coding gene	gene with protein product		606939	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), beta polypeptide, 56/58kD, isoform 2"", ""ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B, isoform 2"""	VPP3, ATP6B2		2145275, 14580332	Standard	NM_001693		Approved	VATB, Vma2, HO57	uc003wzp.3	P21281	OTTHUMG00000131073	ENST00000276390.2:c.122C>G	8.37:g.20055039C>G	ENSP00000276390:p.Ser41Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5Z3|D3DSQ5|Q14544|Q15859|Q96IR0	Missense_Mutation	SNP	pfam_ATPase_F1/V1/A1_a/bsu_nucl-bd,pfam_ATPase_F1/V1/A1-cplx_a/bsu_C,pfam_ATPase_a/bsu_N,superfamily_ATPase_F1/V1/A1-cplx_a/bsu_C,tigrfam_ATPase_V1-cplx_bsu	p.S41C	ENST00000276390.2	37	c.122	CCDS6014.1	8	.	.	.	.	.	.	.	.	.	.	C	14.67	2.604340	0.46423	.	.	ENSG00000147416	ENST00000276390	D	0.83419	-1.72	4.82	3.94	0.45596	.	0.055812	0.85682	D	0.000000	T	0.75162	0.3812	N	0.19112	0.55	0.80722	D	1	B	0.34241	0.444	B	0.42882	0.401	T	0.73603	-0.3930	10	0.48119	T	0.1	-29.89	8.8934	0.35449	0.0:0.8991:0.0:0.1009	.	41	P21281	VATB2_HUMAN	C	41	ENSP00000276390:S41C	ENSP00000276390:S41C	S	+	2	0	ATP6V1B2	20099319	1.000000	0.71417	1.000000	0.80357	0.466000	0.32739	3.708000	0.54845	1.241000	0.43820	-0.140000	0.14226	TCC	ATP6V1B2	-	NULL		0.647	ATP6V1B2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6V1B2	HGNC	protein_coding	OTTHUMT00000253732.1	C	NM_001693		20055039	+1	no_errors	ENST00000276390	ensembl	human	known	70_37	missense	SNP	1.000	G
B3GALT4	8705	genome.wustl.edu	37	6	33246092	33246092	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:33246092G>A	ENST00000451237.1	+	1	1176	c.896G>A	c.(895-897)cGa>cAa	p.R299Q		NM_003782.3	NP_003773.1	O96024	B3GT4_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 4	299					protein glycosylation (GO:0006486)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	ganglioside galactosyltransferase activity (GO:0047915)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(2)|endometrium(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(2)|pancreas(1)|prostate(1)|soft_tissue(1)|urinary_tract(2)	13						GTAAGTGCCCGACGAGGAGGC	0.607																																																	0													67.0	68.0	68.0					6																	33246092		2203	4300	6503	SO:0001583	missense	8705			Y15061	CCDS34425.1	6p21.3	2013-02-19			ENSG00000235863	ENSG00000235863		"""Beta 3-glycosyltransferases"""	919	protein-coding gene	gene with protein product		603095				9582303	Standard	NM_003782		Approved	beta3Gal-T4, GalT4	uc003odr.3	O96024	OTTHUMG00000031100	ENST00000451237.1:c.896G>A	6.37:g.33246092G>A	ENSP00000390784:p.Arg299Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Glyco_trans_31	p.R299Q	ENST00000451237.1	37	c.896	CCDS34425.1	6	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363840	0.41902	.	.	ENSG00000235863	ENST00000451237	T	0.42900	0.96	4.55	1.49	0.22878	.	0.330908	0.25004	N	0.033888	T	0.08358	0.0208	L	0.27975	0.815	0.09310	N	1	P	0.47962	0.903	B	0.41135	0.348	T	0.21793	-1.0235	10	0.08179	T	0.78	.	5.4271	0.16431	0.1875:0.0:0.6445:0.168	.	299	O96024	B3GT4_HUMAN	Q	299	ENSP00000390784:R299Q	ENSP00000390784:R299Q	R	+	2	0	B3GALT4	33354070	0.013000	0.17824	0.152000	0.22495	0.962000	0.63368	1.086000	0.30853	0.522000	0.28464	0.643000	0.83706	CGA	B3GALT4	-	pfam_Glyco_trans_31		0.607	B3GALT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GALT4	HGNC	protein_coding	OTTHUMT00000076162.2	G			33246092	+1	no_errors	ENST00000451237	ensembl	human	known	70_37	missense	SNP	0.184	A
B3GNT3	10331	genome.wustl.edu	37	19	17919158	17919158	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:17919158C>G	ENST00000318683.6	+	2	689	c.542C>G	c.(541-543)tCc>tGc	p.S181C	B3GNT3_ENST00000595387.1_Missense_Mutation_p.S181C	NM_014256.3	NP_055071.2	Q9Y2A9	B3GN3_HUMAN	UDP-GlcNAc:betaGal beta-1,3-N-acetylglucosaminyltransferase 3	181					carbohydrate metabolic process (GO:0005975)|cellular protein metabolic process (GO:0044267)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	beta-1,3-galactosyl-O-glycosyl-glycoprotein beta-1,3-N-acetylglucosaminyltransferase activity (GO:0047223)|galactosyltransferase activity (GO:0008378)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(7)|prostate(2)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(1)	21						TTCCACGACTCCTTCTTCAAC	0.622																																																	0													38.0	37.0	37.0					19																	17919158		2202	4298	6500	SO:0001583	missense	10331			AB015630	CCDS12364.1	19p13.1	2013-02-19				ENSG00000179913		"""Beta 3-glycosyltransferases"""	13528	protein-coding gene	gene with protein product	"""putative type II membrane protein"", ""beta-1,3-N-acetylglucosaminyltransferase bGnT-3"", ""transmembrane protein 3"""	605863		TMEM3		10072769, 11042166	Standard	NM_014256		Approved	B3GN-T3, beta3Gn-T3, HP10328, B3GNT-3	uc002nhl.1	Q9Y2A9		ENST00000318683.6:c.542C>G	19.37:g.17919158C>G	ENSP00000321874:p.Ser181Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAS4|Q6NWU9|Q6NXU9|Q8WWR6|Q9C0J2	Missense_Mutation	SNP	pfam_Glyco_trans_31	p.S181C	ENST00000318683.6	37	c.542	CCDS12364.1	19	.	.	.	.	.	.	.	.	.	.	C	13.61	2.288385	0.40494	.	.	ENSG00000179913	ENST00000318683	T	0.48522	0.81	3.92	2.78	0.32641	.	0.555807	0.16857	U	0.196709	T	0.69187	0.3083	M	0.88241	2.94	0.23669	N	0.997159	D	0.65815	0.995	D	0.66979	0.948	T	0.59289	-0.7482	10	0.72032	D	0.01	.	10.5298	0.44971	0.0:0.801:0.199:0.0	.	181	Q9Y2A9	B3GN3_HUMAN	C	181	ENSP00000321874:S181C	ENSP00000321874:S181C	S	+	2	0	B3GNT3	17780158	0.002000	0.14202	0.987000	0.45799	0.482000	0.33219	1.522000	0.35921	1.733000	0.51620	0.297000	0.19635	TCC	B3GNT3	-	pfam_Glyco_trans_31		0.622	B3GNT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT3	HGNC	protein_coding	OTTHUMT00000466877.1	C	NM_014256		17919158	+1	no_errors	ENST00000318683	ensembl	human	known	70_37	missense	SNP	0.410	G
BDP1	55814	genome.wustl.edu	37	5	70800496	70800496	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:70800496G>T	ENST00000358731.4	+	16	2553	c.2290G>T	c.(2290-2292)Gat>Tat	p.D764Y	BDP1_ENST00000380675.2_5'UTR	NM_018429.2	NP_060899.2	A6H8Y1	BDP1_HUMAN	B double prime 1, subunit of RNA polymerase III transcription initiation factor IIIB	764					gene expression (GO:0010467)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(3)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(34)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	72		Lung NSC(167;0.000422)|Prostate(74;0.00815)|Ovarian(174;0.0176)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;5.28e-56)|Epithelial(20;2.31e-50)		TGAAGAGGAAGATGTCATATT	0.343																																																	0													96.0	88.0	90.0					5																	70800496		1840	4090	5930	SO:0001583	missense	55814			AF298151	CCDS43328.1	5q12-q13	2008-02-05	2001-11-29	2001-11-30	ENSG00000145734	ENSG00000145734			13652	protein-coding gene	gene with protein product		607012	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 1"""	TFNR, TAF3B1		11214970, 11040218	Standard	NM_018429		Approved	TFIIIB150, TFC5, TFIIIB90, KIAA1689, HSA238520, KIAA1241	uc003kbp.1	A6H8Y1	OTTHUMG00000162506	ENST00000358731.4:c.2290G>T	5.37:g.70800496G>T	ENSP00000351575:p.Asp764Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DS6|Q68DY5|Q6MZL9|Q6PIM7|Q86W98|Q96LR8|Q9C0H4|Q9H197|Q9H1A1|Q9HAW1|Q9HAW2|Q9HCY0|Q9ULH9	Missense_Mutation	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.D764Y	ENST00000358731.4	37	c.2290	CCDS43328.1	5	.	.	.	.	.	.	.	.	.	.	G	9.879	1.201024	0.22121	.	.	ENSG00000145734	ENST00000358731;ENST00000437938;ENST00000451951;ENST00000444711	T	0.14266	2.52	4.92	2.13	0.27403	.	0.397130	0.24048	N	0.042036	T	0.27731	0.0682	L	0.60455	1.87	0.18873	N	0.999985	D;D;D	0.89917	1.0;1.0;0.999	D;D;D	0.87578	0.982;0.998;0.964	T	0.02020	-1.1228	10	0.72032	D	0.01	.	6.8838	0.24189	0.2936:0.0:0.7064:0.0	.	764;764;764	A6H8Y1;A6H8Y1-2;A6H8Y1-4	BDP1_HUMAN;.;.	Y	764;764;344;764	ENSP00000351575:D764Y	ENSP00000351575:D764Y	D	+	1	0	BDP1	70836252	0.986000	0.35501	0.083000	0.20561	0.052000	0.14988	1.113000	0.31184	0.693000	0.31634	0.650000	0.86243	GAT	BDP1	-	NULL		0.343	BDP1-016	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BDP1	HGNC	protein_coding	OTTHUMT00000374681.2	G	NM_018429		70800496	+1	no_errors	ENST00000358731	ensembl	human	known	70_37	missense	SNP	0.037	T
BRSK2	9024	genome.wustl.edu	37	11	1464750	1464750	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:1464750G>A	ENST00000528841.1	+	8	1049	c.665G>A	c.(664-666)cGa>cAa	p.R222Q	BRSK2_ENST00000308219.9_Missense_Mutation_p.R222Q|BRSK2_ENST00000528710.1_Missense_Mutation_p.R162Q|BRSK2_ENST00000308230.5_Missense_Mutation_p.R222Q|BRSK2_ENST00000544817.1_5'UTR|BRSK2_ENST00000526678.1_Missense_Mutation_p.R222Q|BRSK2_ENST00000531197.1_Missense_Mutation_p.R222Q|BRSK2_ENST00000382179.1_Missense_Mutation_p.R268Q			Q8IWQ3	BRSK2_HUMAN	BR serine/threonine kinase 2	222	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|axonogenesis (GO:0007409)|establishment of cell polarity (GO:0030010)|exocytosis (GO:0006887)|G2/M transition of mitotic cell cycle (GO:0000086)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|mitotic nuclear division (GO:0007067)|neuron differentiation (GO:0030182)|peptidyl-serine phosphorylation (GO:0018105)|protein phosphorylation (GO:0006468)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein serine/threonine kinase activity (GO:0004674)|tau-protein kinase activity (GO:0050321)			endometrium(4)|large_intestine(1)|lung(5)	10		all_epithelial(84;4.17e-05)|Breast(177;0.000307)|Ovarian(85;0.0014)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00144)|Lung(200;0.0713)|LUSC - Lung squamous cell carcinoma(625;0.0842)		GACAACTTGCGACAGCTGCTG	0.672																																																	0													23.0	28.0	26.0					11																	1464750		2171	4286	6457	SO:0001583	missense	9024			AF020089	CCDS41590.1, CCDS58106.1, CCDS58107.1, CCDS58108.1, CCDS60696.1	11p15.5	2008-02-05	2003-09-11	2005-01-27	ENSG00000174672	ENSG00000174672			11405	protein-coding gene	gene with protein product	"""serine/threonine kinase 29"""	609236	"""chromsosome 11 open reading frame 7"""	C11orf7, STK29		9852686, 9929968	Standard	NM_001256629		Approved	PEN11B	uc001ltm.4	Q8IWQ3	OTTHUMG00000167089	ENST00000528841.1:c.665G>A	11.37:g.1464750G>A	ENSP00000432000:p.Arg222Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVE9|E9PLM7|O60843|O95099|Q5J5B4|Q6ZMQ4|Q8TB60	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R268Q	ENST00000528841.1	37	c.803	CCDS58107.1	11	.	.	.	.	.	.	.	.	.	.	G	29.4	5.002035	0.93227	.	.	ENSG00000174672	ENST00000308219;ENST00000531197;ENST00000308230;ENST00000528841;ENST00000526678;ENST00000528710;ENST00000382179	T;T;T;T;T;T;T	0.65178	-0.14;-0.14;-0.14;-0.14;-0.14;-0.14;-0.14	3.27	3.27	0.37495	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	U	0.000000	T	0.55721	0.1938	N	0.02296	-0.605	0.80722	D	1	P;D;P;D;D	0.76494	0.936;0.998;0.886;0.999;0.999	P;P;P;D;D	0.71184	0.574;0.852;0.574;0.972;0.933	T	0.71144	-0.4678	10	0.72032	D	0.01	.	15.0629	0.71970	0.0:0.0:1.0:0.0	.	222;268;222;222;222	Q8IWQ3-4;Q8IWQ3-5;Q8IWQ3-3;Q8IWQ3;Q8IWQ3-2	.;.;.;BRSK2_HUMAN;.	Q	222;222;222;222;222;162;268	ENSP00000310697:R222Q;ENSP00000431152:R222Q;ENSP00000310805:R222Q;ENSP00000432000:R222Q;ENSP00000433370:R222Q;ENSP00000433235:R162Q;ENSP00000371614:R268Q	ENSP00000310697:R222Q	R	+	2	0	BRSK2	1421326	1.000000	0.71417	1.000000	0.80357	0.778000	0.44026	9.087000	0.94110	1.839000	0.53478	0.313000	0.20887	CGA	BRSK2	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.672	BRSK2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BRSK2	HGNC	protein_coding	OTTHUMT00000393033.1	G	NM_003957		1464750	+1	no_errors	ENST00000382179	ensembl	human	known	70_37	missense	SNP	1.000	A
BRWD1	54014	genome.wustl.edu	37	21	40570985	40570985	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr21:40570985C>T	ENST00000333229.2	-	40	5684	c.5357G>A	c.(5356-5358)aGc>aAc	p.S1786N	BRWD1_ENST00000380800.3_Missense_Mutation_p.S1786N|BRWD1_ENST00000342449.3_Missense_Mutation_p.S1786N	NM_018963.4	NP_061836.2	Q9NSI6	BRWD1_HUMAN	bromodomain and WD repeat domain containing 1	1786					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				cervix(2)|endometrium(6)|kidney(8)|large_intestine(14)|liver(2)|lung(13)|ovary(1)|pancreas(1)|prostate(2)|skin(7)|urinary_tract(2)	58		Prostate(19;8.44e-08)|all_epithelial(19;0.223)				CTCTGAGATGCTCTCTGCCTT	0.408																																					Melanoma(170;988 1986 4794 16843 39731)												0													110.0	110.0	110.0					21																	40570985		2203	4300	6503	SO:0001583	missense	54014			AJ002572	CCDS13662.1, CCDS13663.1, CCDS33557.1	21q22.2	2013-05-21	2005-05-13	2005-05-13	ENSG00000185658	ENSG00000185658		"""WD repeat domain containing"""	12760	protein-coding gene	gene with protein product			"""chromosome 21 open reading frame 107"", ""WD repeat domain 9"""	C21orf107, WDR9			Standard	NM_033656		Approved	FLJ11315, N143	uc002yxk.2	Q9NSI6	OTTHUMG00000066030	ENST00000333229.2:c.5357G>A	21.37:g.40570985C>T	ENSP00000330753:p.Ser1786Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JK25|O43721|Q5R2V0|Q5R2V1|Q6P2D1|Q8TCV3|Q96QG9|Q96QH0|Q9NUK1	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_WD40_repeat_dom,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.S1786N	ENST00000333229.2	37	c.5357	CCDS13662.1	21	.	.	.	.	.	.	.	.	.	.	C	8.130	0.782932	0.16189	.	.	ENSG00000185658	ENST00000333229;ENST00000342449;ENST00000380800	T;T;T	0.55052	0.54;0.56;0.64	5.35	-0.256	0.12984	.	1.121610	0.06431	N	0.724108	T	0.34774	0.0909	N	0.19112	0.55	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.20438	-1.0275	10	0.18276	T	0.48	0.0382	8.6043	0.33764	0.0:0.5458:0.0:0.4542	.	1786;1786	Q9NSI6-2;Q9NSI6	.;BRWD1_HUMAN	N	1786	ENSP00000330753:S1786N;ENSP00000344333:S1786N;ENSP00000370178:S1786N	ENSP00000330753:S1786N	S	-	2	0	BRWD1	39492855	0.000000	0.05858	0.000000	0.03702	0.956000	0.61745	0.059000	0.14322	-0.025000	0.13918	-0.251000	0.11542	AGC	BRWD1	-	NULL		0.408	BRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD1	HGNC	protein_coding	OTTHUMT00000141398.3	C	NM_033656		40570985	-1	no_errors	ENST00000333229	ensembl	human	known	70_37	missense	SNP	0.000	T
BRWD3	254065	genome.wustl.edu	37	X	79999553	79999553	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:79999553G>A	ENST00000373275.4	-	8	1007	c.791C>T	c.(790-792)tCa>tTa	p.S264L		NM_153252.4	NP_694984	Q6RI45	BRWD3_HUMAN	bromodomain and WD repeat domain containing 3	264					cytoskeleton organization (GO:0007010)|regulation of cell shape (GO:0008360)					breast(4)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(18)|lung(39)|ovary(4)|prostate(2)|skin(3)	87						AATAGAAGCTGAATGGCCCTG	0.378																																																	0													104.0	91.0	95.0					X																	79999553		2203	4300	6503	SO:0001583	missense	254065				CCDS14447.1	Xq21.1	2013-01-09			ENSG00000165288	ENSG00000165288		"""WD repeat domain containing"""	17342	protein-coding gene	gene with protein product		300553				15543602, 16094372	Standard	NM_153252		Approved	FLJ38568, MRX93	uc004edt.3	Q6RI45	OTTHUMG00000021908	ENST00000373275.4:c.791C>T	X.37:g.79999553G>A	ENSP00000362372:p.Ser264Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	C9IZ39|C9J3F3|Q2T9J6|Q5JRN1|Q6RI37|Q6RI42|Q6RI44|Q8N916	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Bromodomain,superfamily_Quino_amine_DH_bsu,superfamily_Bromodomain,smart_WD40_repeat,smart_Bromodomain,pfscan_Bromodomain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_Bromodomain	p.S264L	ENST00000373275.4	37	c.791	CCDS14447.1	X	.	.	.	.	.	.	.	.	.	.	G	16.70	3.195477	0.58126	.	.	ENSG00000165288	ENST00000373275	T	0.61510	0.1	4.42	4.42	0.53409	WD40/YVTN repeat-like-containing domain (1);Quinoprotein amine dehydrogenase, beta chain-like (1);WD40-repeat-containing domain (1);	0.562926	0.16371	N	0.217301	T	0.48822	0.1521	L	0.33485	1.01	0.40019	D	0.975381	B	0.17038	0.02	B	0.23852	0.049	T	0.41752	-0.9491	9	.	.	.	-8.2318	16.6563	0.85229	0.0:0.0:1.0:0.0	.	264	Q6RI45	BRWD3_HUMAN	L	264	ENSP00000362372:S264L	.	S	-	2	0	BRWD3	79886209	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.535000	0.73838	2.193000	0.70182	0.415000	0.27848	TCA	BRWD3	-	pfam_WD40_repeat,superfamily_Quino_amine_DH_bsu,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.378	BRWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRWD3	HGNC	protein_coding	OTTHUMT00000057344.1	G	NM_153252		79999553	-1	no_errors	ENST00000373275	ensembl	human	known	70_37	missense	SNP	1.000	A
BSPRY	54836	genome.wustl.edu	37	9	116132318	116132318	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:116132318G>A	ENST00000374183.4	+	6	1144	c.1105G>A	c.(1105-1107)Gag>Aag	p.E369K	BSPRY_ENST00000462085.1_3'UTR	NM_017688.2	NP_060158.2	Q5W0U4	BSPRY_HUMAN	B-box and SPRY domain containing	369	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				calcium ion transport (GO:0006816)	cell leading edge (GO:0031252)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)	zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|lung(4)|urinary_tract(1)	8						GCTCTTCTATGAGCCAGCCTC	0.617																																																	0													41.0	44.0	43.0					9																	116132318		1956	4147	6103	SO:0001583	missense	54836			AJ276691	CCDS43868.1	9q33.1	2008-02-05			ENSG00000119411	ENSG00000119411			18232	protein-coding gene	gene with protein product						10978534, 11099500	Standard	NM_017688		Approved	FLJ20150	uc004bhg.4	Q5W0U4	OTTHUMG00000021006	ENST00000374183.4:c.1105G>A	9.37:g.116132318G>A	ENSP00000363298:p.Glu369Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KS19|Q96DJ2|Q9H4E4|Q9NXN0	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin	p.E369K	ENST00000374183.4	37	c.1105	CCDS43868.1	9	.	.	.	.	.	.	.	.	.	.	G	32	5.157899	0.94686	.	.	ENSG00000119411	ENST00000374183	T	0.14144	2.53	5.69	5.69	0.88448	Concanavalin A-like lectin/glucanase (1);Butyrophylin-like (1);B30.2/SPRY domain (1);SPla/RYanodine receptor SPRY (1);	0.299257	0.41605	D	0.000842	T	0.26702	0.0653	M	0.72894	2.215	0.54753	D	0.999983	P	0.48998	0.918	P	0.46940	0.532	T	0.01093	-1.1454	10	0.62326	D	0.03	-10.7137	18.7934	0.91983	0.0:0.0:1.0:0.0	.	369	Q5W0U4	BSPRY_HUMAN	K	369	ENSP00000363298:E369K	ENSP00000363298:E369K	E	+	1	0	BSPRY	115172139	1.000000	0.71417	0.925000	0.36789	0.938000	0.57974	9.098000	0.94202	2.688000	0.91661	0.561000	0.74099	GAG	BSPRY	-	pfam_SPRY_rcpt,superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,prints_Butyrophylin		0.617	BSPRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BSPRY	HGNC	protein_coding	OTTHUMT00000055399.1	G	NM_017688		116132318	+1	no_errors	ENST00000374183	ensembl	human	known	70_37	missense	SNP	1.000	A
BTAF1	9044	genome.wustl.edu	37	10	93757460	93757460	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:93757460C>T	ENST00000265990.6	+	25	3920	c.3612C>T	c.(3610-3612)ttC>ttT	p.F1204F	BTAF1_ENST00000544642.1_Silent_p.F32F	NM_003972.2	NP_003963.1	O14981	BTAF1_HUMAN	BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170kDa	1204					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription, DNA-templated (GO:0045892)	nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(6)	59		Colorectal(252;0.0846)				GTGTGAGATTCATGGCCACGC	0.378																																																	0													170.0	143.0	152.0					10																	93757460		2203	4300	6503	SO:0001819	synonymous_variant	9044			AJ001017	CCDS7419.1	10q22-q23	2013-05-01	2013-05-01		ENSG00000095564	ENSG00000095564			17307	protein-coding gene	gene with protein product	"""Mot1 homolog (S. cerevisiae)"""	605191	"""BTAF1 RNA polymerase II, B-TFIID transcription factor-associated, 170 kD (Mot1 homolog, S. cerevisiae)"""			9342322, 9488487	Standard	NM_003972		Approved	TAFII170, TAF172, MOT1, TAF-172, TAF(II)170	uc001khr.3	O14981	OTTHUMG00000018752	ENST00000265990.6:c.3612C>T	10.37:g.93757460C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E0W6|O43578	Silent	SNP	pfam_DUF3535,pfam_SNF2_N,pfam_HEAT,pfam_Helicase_C,superfamily_ARM-type_fold,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.F1204	ENST00000265990.6	37	c.3612	CCDS7419.1	10																																																																																			BTAF1	-	superfamily_ARM-type_fold		0.378	BTAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BTAF1	HGNC	protein_coding	OTTHUMT00000049380.4	C	NM_003972		93757460	+1	no_errors	ENST00000265990	ensembl	human	known	70_37	silent	SNP	1.000	T
C11orf80	79703	genome.wustl.edu	37	11	66605850	66605850	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:66605850G>C	ENST00000360962.4	+	15	1688	c.1681G>C	c.(1681-1683)Gaa>Caa	p.E561Q	C11orf80_ENST00000527634.1_Missense_Mutation_p.E344Q|C11orf80_ENST00000525449.2_Missense_Mutation_p.E369Q|C11orf80_ENST00000540737.1_Missense_Mutation_p.E395Q|C11orf80_ENST00000346672.4_Missense_Mutation_p.E370Q|C11orf80_ENST00000532565.2_Missense_Mutation_p.E343Q	NM_024650.3	NP_078926.3	Q8N6T0	CK080_HUMAN	chromosome 11 open reading frame 80	561										autonomic_ganglia(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	14						GCTAACCCTAGAAAAAAAGGA	0.478																																																	0													77.0	74.0	75.0					11																	66605850		1850	4102	5952	SO:0001583	missense	79703					11q13.2	2012-05-30			ENSG00000173715	ENSG00000173715			26197	protein-coding gene	gene with protein product						18160775	Standard	NM_024650		Approved	FLJ22531	uc021qmd.1	Q8N6T0	OTTHUMG00000167164	ENST00000360962.4:c.1681G>C	11.37:g.66605850G>C	ENSP00000354227:p.Glu561Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H677	Missense_Mutation	SNP	NULL	p.E561Q	ENST00000360962.4	37	c.1681	CCDS53664.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.24|18.24	3.581119|3.581119	0.65992|0.65992	.|.	.|.	ENSG00000173715|ENSG00000173715	ENST00000360962;ENST00000346672;ENST00000527634;ENST00000528340;ENST00000540737;ENST00000525449|ENST00000531415	T|.	0.54279|.	0.58|.	3.84|3.84	2.9|2.9	0.33743|0.33743	.|.	1.332800|.	0.05291|.	N|.	0.521095|.	T|.	0.25232|.	0.0613|.	N|N	0.19112|0.19112	0.55|0.55	0.21386|0.21386	N|N	0.999709|0.999709	P;P;P;P;P|.	0.50943|.	0.94;0.94;0.873;0.873;0.873|.	P;P;B;B;B|.	0.47015|.	0.534;0.534;0.412;0.412;0.412|.	T|.	0.18967|.	-1.0320|.	10|.	0.46703|.	T|.	0.11|.	-6.4029|-6.4029	9.3366|9.3366	0.38054|0.38054	0.0:0.2191:0.7809:0.0|0.0:0.2191:0.7809:0.0	.|.	395;370;344;406;396|.	B4DXL1;C9JZP8;E9PKM2;Q8N6T0;E9PKZ8|.	.;.;.;CK080_HUMAN;.|.	Q|Y	561;370;344;396;395;370|114	ENSP00000354227:E561Q|.	ENSP00000317408:E370Q|.	E|X	+|+	1|3	0|2	C11orf80|C11orf80	66362426|66362426	0.733000|0.733000	0.28132|0.28132	0.257000|0.257000	0.24404|0.24404	0.634000|0.634000	0.38068|0.38068	0.739000|0.739000	0.26173|0.26173	1.154000|1.154000	0.42482|0.42482	0.655000|0.655000	0.94253|0.94253	GAA|TAG	C11orf80	-	NULL		0.478	C11orf80-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	C11orf80	HGNC	protein_coding		G	NM_024650		66605850	+1	no_errors	ENST00000360962	ensembl	human	known	70_37	missense	SNP	0.439	C
C1orf110	339512	genome.wustl.edu	37	1	162824639	162824639	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:162824639C>G	ENST00000367910.1	-	4	945	c.825G>C	c.(823-825)gaG>gaC	p.E275D	C1orf110_ENST00000367912.2_Intron|C1orf110_ENST00000524691.1_Intron|C1orf110_ENST00000367911.2_Intron	NM_178550.4	NP_848645.3	Q86UF4	CA110_HUMAN	chromosome 1 open reading frame 110	275										endometrium(2)|kidney(1)|lung(6)|prostate(1)|skin(2)	12						GCCCAAATATCTCTCCAATGC	0.488																																																	0													102.0	98.0	99.0					1																	162824639		1896	4115	6011	SO:0001583	missense	339512			BC040018	CCDS44269.1	1q23.3	2012-06-26			ENSG00000185860	ENSG00000185860			28736	protein-coding gene	gene with protein product						12477932	Standard	NM_178550		Approved	MGC48998	uc001gck.2	Q86UF4	OTTHUMG00000034421	ENST00000367910.1:c.825G>C	1.37:g.162824639C>G	ENSP00000356886:p.Glu275Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JSG1|Q6ZW57	Missense_Mutation	SNP	NULL	p.E275D	ENST00000367910.1	37	c.825	CCDS44269.1	1	.	.	.	.	.	.	.	.	.	.	C	11.78	1.739737	0.30865	.	.	ENSG00000185860	ENST00000367910	.	.	.	4.41	0.132	0.14762	.	0.121505	0.37219	N	0.002181	T	0.36248	0.0960	L	0.36672	1.1	0.29578	N	0.849404	D	0.76494	0.999	D	0.69307	0.963	T	0.32375	-0.9909	8	0.87932	D	0	-16.2229	6.1054	0.20071	0.0:0.5203:0.0:0.4797	.	275	Q86UF4	CA110_HUMAN	D	275	.	ENSP00000356886:E275D	E	-	3	2	C1orf110	161091263	1.000000	0.71417	0.106000	0.21319	0.016000	0.09150	0.655000	0.24933	0.135000	0.18707	-0.150000	0.13652	GAG	C1orf110	-	NULL		0.488	C1orf110-002	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf110	HGNC	protein_coding	OTTHUMT00000083211.2	C	NM_178550		162824639	-1	no_errors	ENST00000367910	ensembl	human	known	70_37	missense	SNP	0.659	G
TLDC2	140711	genome.wustl.edu	37	20	35515883	35515883	+	Missense_Mutation	SNP	C	C	G	rs544561249		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:35515883C>G	ENST00000217320.3	+	5	508	c.464C>G	c.(463-465)tCt>tGt	p.S155C	TLDC2_ENST00000602922.1_Missense_Mutation_p.S155C	NM_080628.1	NP_542195.1	A0PJX2	TLDC2_HUMAN	TBC/LysM-associated domain containing 2	155	TLD.																GGAAGCAACTCTTTCTTTGTG	0.532											OREG0025911	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													167.0	153.0	157.0					20																	35515883		2203	4300	6503	SO:0001583	missense	140711			AL079335	CCDS33465.1	20q11.23	2013-03-14	2013-03-14	2013-03-14	ENSG00000101342	ENSG00000101342			16112	protein-coding gene	gene with protein product	"""hypothetical protein LOC140711"", ""TLD domain containing 2"""		"""chromosome 20 open reading frame 118"""	C20orf118			Standard	NM_080628		Approved	dJ132F21.2	uc002xgg.1	A0PJX2	OTTHUMG00000032400	ENST00000217320.3:c.464C>G	20.37:g.35515883C>G	ENSP00000217320:p.Ser155Cys	Somatic	855	WXS	Illumina HiSeq	Phase_IV	B3KVU8	Missense_Mutation	SNP	pfam_TLDc,smart_TLDc	p.S155C	ENST00000217320.3	37	c.464	CCDS33465.1	20	.	.	.	.	.	.	.	.	.	.	C	14.93	2.682043	0.47991	.	.	ENSG00000101342	ENST00000217320;ENST00000436941	T	0.46063	0.88	5.25	5.25	0.73442	TLDc (2);	0.171248	0.52532	D	0.000061	T	0.59348	0.2187	M	0.64170	1.965	0.34621	D	0.718605	D	0.76494	0.999	D	0.69142	0.962	T	0.70999	-0.4719	10	0.62326	D	0.03	-9.1378	12.8391	0.57790	0.1629:0.8371:0.0:0.0	.	155	A0PJX2	CT118_HUMAN	C	155;9	ENSP00000217320:S155C	ENSP00000217320:S155C	S	+	2	0	C20orf118	34949297	0.965000	0.33210	1.000000	0.80357	0.977000	0.68977	2.288000	0.43514	2.452000	0.82932	0.561000	0.74099	TCT	C20orf118	-	pfam_TLDc,smart_TLDc		0.532	TLDC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C20orf118	HGNC	protein_coding	OTTHUMT00000079060.2	C	NM_080628		35515883	+1	no_errors	ENST00000217320	ensembl	human	known	70_37	missense	SNP	0.908	G
C2orf16	84226	genome.wustl.edu	37	2	27804955	27804955	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:27804955G>A	ENST00000408964.2	+	1	5567	c.5516G>A	c.(5515-5517)cGt>cAt	p.R1839H	ZNF512_ENST00000413371.2_5'Flank|ZNF512_ENST00000355467.4_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000556601.1_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1839	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					AGGAGCCATCGTAGGATTTCT	0.557																																																	0													81.0	85.0	84.0					2																	27804955		1906	4126	6032	SO:0001583	missense	84226			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.5516G>A	2.37:g.27804955G>A	ENSP00000386190:p.Arg1839His	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.R1839H	ENST00000408964.2	37	c.5516	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	g	10.66	1.413082	0.25465	.	.	ENSG00000221843	ENST00000408964	T	0.05855	3.38	1.6	-3.15	0.05233	.	.	.	.	.	T	0.03263	0.0095	L	0.36672	1.1	0.09310	N	1	D	0.53151	0.958	B	0.32724	0.151	T	0.41288	-0.9517	9	0.29301	T	0.29	.	5.2344	0.15439	0.0:0.4041:0.3914:0.2045	.	1839	Q68DN1	CB016_HUMAN	H	1839	ENSP00000386190:R1839H	ENSP00000386190:R1839H	R	+	2	0	C2orf16	27658459	0.001000	0.12720	0.000000	0.03702	0.140000	0.21249	-0.362000	0.07602	-0.834000	0.04239	0.306000	0.20318	CGT	C2orf16	-	NULL		0.557	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	G	NM_032266		27804955	+1	no_errors	ENST00000408964	ensembl	human	known	70_37	missense	SNP	0.000	A
CABP4	57010	genome.wustl.edu	37	11	67225845	67225845	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:67225845G>C	ENST00000325656.5	+	5	732	c.655G>C	c.(655-657)Gac>Cac	p.D219H	CTC-1337H24.1_ENST00000602912.1_lincRNA|CABP4_ENST00000438189.2_Missense_Mutation_p.D114H	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	219	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)			central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			ACCTTAGTTTGACAGGGACAG	0.552																																																	0													61.0	63.0	62.0					11																	67225845		2200	4295	6495	SO:0001583	missense	57010			AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.655G>C	11.37:g.67225845G>C	ENSP00000324960:p.Asp219His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N4Z2|Q8WWY5	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D219H	ENST00000325656.5	37	c.655	CCDS8166.1	11	.	.	.	.	.	.	.	.	.	.	G	24.9	4.586677	0.86851	.	.	ENSG00000175544	ENST00000438189;ENST00000325656	D;D	0.95885	-3.84;-3.84	4.52	4.52	0.55395	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.98108	0.9376	M	0.91920	3.255	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.99066	1.0832	10	0.87932	D	0	-33.5195	16.5228	0.84321	0.0:0.0:1.0:0.0	.	219;114	P57796;P57796-2	CABP4_HUMAN;.	H	114;219	ENSP00000401555:D114H;ENSP00000324960:D219H	ENSP00000324960:D219H	D	+	1	0	CABP4	66982421	1.000000	0.71417	1.000000	0.80357	0.850000	0.48378	8.497000	0.90488	2.504000	0.84457	0.655000	0.94253	GAC	CABP4	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.552	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABP4	HGNC	protein_coding	OTTHUMT00000397624.2	G			67225845	+1	no_errors	ENST00000325656	ensembl	human	known	70_37	missense	SNP	1.000	C
CACNA1B	774	genome.wustl.edu	37	9	140997167	140997167	+	Missense_Mutation	SNP	C	C	T	rs370345897		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:140997167C>T	ENST00000371372.1	+	38	5372	c.5227C>T	c.(5227-5229)Cgc>Tgc	p.R1743C	CACNA1B_ENST00000277551.2_Missense_Mutation_p.R1743C|CACNA1B_ENST00000371357.1_Missense_Mutation_p.R1742C|CACNA1B_ENST00000277549.5_Missense_Mutation_p.R937C|CACNA1B_ENST00000371363.1_Missense_Mutation_p.R1741C|CACNA1B_ENST00000371355.4_Missense_Mutation_p.R1744C|CACNA1B_ENST00000371365.2_Intron	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1743	EF-hand. {ECO:0000255|PROSITE- ProRule:PRU00448}.				calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)	p.R1743C(1)		NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TTCCAGTGGGCGCATCAGTTA	0.627																																																	1	Substitution - Missense(1)	large_intestine(1)						C	CYS/ARG	1,3877		0,1,1938	49.0	54.0	52.0		5227	4.7	1.0	9		52	0,8240		0,0,4120	no	missense	CACNA1B	NM_000718.3	180	0,1,6058	TT,TC,CC		0.0,0.0258,0.0083	probably-damaging	1743/2340	140997167	1,12117	1939	4120	6059	SO:0001583	missense	774			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5227C>T	9.37:g.140997167C>T	ENSP00000360423:p.Arg1743Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQK5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.R1744C	ENST00000371372.1	37	c.5230	CCDS59522.1	9	.	.	.	.	.	.	.	.	.	.	C	18.03	3.533162	0.64972	2.58E-4	0.0	ENSG00000148408	ENST00000371372;ENST00000277551;ENST00000277549;ENST00000371363;ENST00000371357;ENST00000371355	D;D;D;D;D;D	0.97598	-4.2;-4.2;-4.45;-4.19;-4.17;-4.19	4.71	4.71	0.59529	.	0.000000	0.85682	D	0.000000	D	0.98463	0.9488	M	0.85945	2.785	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.71184	0.972;0.972	D	0.99719	1.1009	10	0.72032	D	0.01	.	17.6591	0.88187	0.0:1.0:0.0:0.0	.	1742;1741	B1AQK7;B1AQK6	.;.	C	1743;1743;937;1741;1742;1744	ENSP00000360423:R1743C;ENSP00000277551:R1743C;ENSP00000277549:R937C;ENSP00000360414:R1741C;ENSP00000360408:R1742C;ENSP00000360406:R1744C	ENSP00000277549:R937C	R	+	1	0	CACNA1B	140116988	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.943000	0.70211	2.159000	0.67721	0.555000	0.69702	CGC	CACNA1B	-	pfscan_EF_HAND_2		0.627	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	C	NM_000718		140997167	+1	no_errors	ENST00000371355	ensembl	human	known	70_37	missense	SNP	1.000	T
CACNA1B	774	genome.wustl.edu	37	9	141010114	141010114	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:141010114C>T	ENST00000371372.1	+	42	5905	c.5760C>T	c.(5758-5760)ctC>ctT	p.L1920L	CACNA1B_ENST00000277551.2_Silent_p.L1920L|CACNA1B_ENST00000371357.1_Silent_p.L1919L|CACNA1B_ENST00000277549.5_Silent_p.L1114L|CACNA1B_ENST00000371363.1_Silent_p.L1918L|CACNA1B_ENST00000371355.4_Silent_p.L1921L	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	1920					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	CCACCTCCCTCAGCAATGGCG	0.577																																																	0													64.0	67.0	66.0					9																	141010114		1967	4148	6115	SO:0001819	synonymous_variant	774			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.5760C>T	9.37:g.141010114C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQK5	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.L1921	ENST00000371372.1	37	c.5763	CCDS59522.1	9																																																																																			CACNA1B	-	NULL		0.577	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	C	NM_000718		141010114	+1	no_errors	ENST00000371355	ensembl	human	known	70_37	silent	SNP	0.996	T
CACNA1E	777	genome.wustl.edu	37	1	181708285	181708285	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:181708285G>T	ENST00000367573.2	+	25	3615	c.3615G>T	c.(3613-3615)atG>atT	p.M1205I	CACNA1E_ENST00000360108.3_Missense_Mutation_p.M1186I|CACNA1E_ENST00000367567.4_Missense_Mutation_p.M812I|CACNA1E_ENST00000357570.5_Missense_Mutation_p.M1156I|CACNA1E_ENST00000526775.1_Missense_Mutation_p.M1186I|CACNA1E_ENST00000358338.5_Missense_Mutation_p.M1137I|CACNA1E_ENST00000367570.1_Missense_Mutation_p.M1205I	NM_001205293.1	NP_001192222.1	Q15878	CAC1E_HUMAN	calcium channel, voltage-dependent, R type, alpha 1E subunit	1205					calcium ion import (GO:0070509)|energy reserve metabolic process (GO:0006112)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transport (GO:0006810)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|voltage-gated calcium channel activity (GO:0005245)			NS(2)|breast(9)|central_nervous_system(3)|cervix(1)|endometrium(22)|haematopoietic_and_lymphoid_tissue(6)|kidney(4)|large_intestine(34)|lung(99)|ovary(6)|pancreas(1)|prostate(9)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	204						TTCTGCAGATGATAGACCAAG	0.537																																																	0													222.0	226.0	225.0					1																	181708285		2101	4228	6329	SO:0001583	missense	777			AK096563	CCDS53443.1, CCDS55664.1, CCDS55665.1	1q25.3	2013-01-10	2007-02-16		ENSG00000198216	ENSG00000198216		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1392	protein-coding gene	gene with protein product		601013		CACNL1A6		8388125, 16382099	Standard	NM_001205293		Approved	Cav2.3, BII, CACH6	uc009wxt.3	Q15878	OTTHUMG00000037301	ENST00000367573.2:c.3615G>T	1.37:g.181708285G>T	ENSP00000356545:p.Met1205Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AM12|B1AM13|B1AM14|Q14580|Q14581	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_R_a1su	p.M1205I	ENST00000367573.2	37	c.3615	CCDS55664.1	1	.	.	.	.	.	.	.	.	.	.	G	22.2	4.254231	0.80135	.	.	ENSG00000198216	ENST00000367570;ENST00000526775;ENST00000357570;ENST00000358338;ENST00000367567;ENST00000360108;ENST00000367573	D;D;D;D;D;D;D	0.98044	-4.68;-4.68;-4.68;-4.68;-4.68;-4.68;-4.68	5.01	5.01	0.66863	Ion transport (1);	0.000000	0.85682	D	0.000000	D	0.95427	0.8515	N	0.01742	-0.745	0.80722	D	1	B;B;P	0.48294	0.282;0.374;0.908	B;B;D	0.64144	0.225;0.444;0.922	D	0.95040	0.8177	10	0.22706	T	0.39	.	18.2808	0.90097	0.0:0.0:1.0:0.0	.	1186;1205;1205	Q15878-2;Q15878;Q15878-3	.;CAC1E_HUMAN;.	I	1205;1186;1156;1137;812;1186;1205	ENSP00000356542:M1205I;ENSP00000434814:M1186I;ENSP00000350183:M1156I;ENSP00000351101:M1137I;ENSP00000356539:M812I;ENSP00000353222:M1186I;ENSP00000356545:M1205I	ENSP00000350183:M1156I	M	+	3	0	CACNA1E	179974908	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.675000	0.98638	2.475000	0.83589	0.561000	0.74099	ATG	CACNA1E	-	pfam_Ion_trans_dom		0.537	CACNA1E-003	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	CACNA1E	HGNC	protein_coding	OTTHUMT00000090793.2	G	NM_000721		181708285	+1	no_errors	ENST00000367573	ensembl	human	known	70_37	missense	SNP	1.000	T
CAMK2N2	94032	genome.wustl.edu	37	3	183977945	183977945	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:183977945C>T	ENST00000296238.3	-	2	417	c.240G>A	c.(238-240)taG>taA	p.*80*	EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000402825.3_Intron	NM_033259.2	NP_150284.1	Q96S95	CK2N2_HUMAN	calcium/calmodulin-dependent protein kinase II inhibitor 2	0						cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium-dependent protein kinase inhibitor activity (GO:0008427)					all_cancers(143;1.09e-10)|Ovarian(172;0.0339)		Epithelial(37;2.51e-33)|OV - Ovarian serous cystadenocarcinoma(80;5.69e-22)			gccggcgcgTCTACACTCCGG	0.766																																																	0													15.0	15.0	15.0					3																	183977945		2192	4294	6486	SO:0001819	synonymous_variant	94032			AY037149	CCDS3257.1	3q27.1	2006-03-27			ENSG00000163888	ENSG00000163888			24197	protein-coding gene	gene with protein product		608721				11444830, 9724800	Standard	NM_033259		Approved	CaM-KIIN	uc003fnj.1	Q96S95	OTTHUMG00000156821	ENST00000296238.3:c.240G>A	3.37:g.183977945C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.*80	ENST00000296238.3	37	c.240	CCDS3257.1	3																																																																																			CAMK2N2	-	NULL		0.766	CAMK2N2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAMK2N2	HGNC	protein_coding	OTTHUMT00000346010.1	C	NM_033259		183977945	-1	no_errors	ENST00000296238	ensembl	human	known	70_37	silent	SNP	1.000	T
CC2D1B	200014	genome.wustl.edu	37	1	52825770	52825770	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:52825770G>C	ENST00000371586.2	-	7	877	c.739C>G	c.(739-741)Cca>Gca	p.P247A	CC2D1B_ENST00000284376.3_Missense_Mutation_p.P247A|CC2D1B_ENST00000438831.1_5'UTR|CC2D1B_ENST00000460261.1_5'UTR	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B	247	Pro-rich.					nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						GGGGGAGCTGGAGGGTCTGTC	0.602																																																	0													28.0	33.0	31.0					1																	52825770		2203	4300	6503	SO:0001583	missense	200014			AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.739C>G	1.37:g.52825770G>C	ENSP00000360642:p.Pro247Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_DM14,smart_C2_Ca-dep	p.P247A	ENST00000371586.2	37	c.739	CCDS30714.1	1	.	.	.	.	.	.	.	.	.	.	G	0.680	-0.798537	0.02841	.	.	ENSG00000154222	ENST00000371586;ENST00000284376;ENST00000371573	T;T	0.21543	2.0;2.0	5.05	0.835	0.18886	.	0.623111	0.16921	N	0.194081	T	0.14313	0.0346	L	0.50333	1.59	0.41823	D	0.990039	B	0.13145	0.007	B	0.11329	0.006	T	0.14615	-1.0466	10	0.10636	T	0.68	0.1836	4.9523	0.14021	0.0787:0.2714:0.51:0.1399	.	247	Q5T0F9	C2D1B_HUMAN	A	247;247;161	ENSP00000360642:P247A;ENSP00000284376:P247A	ENSP00000284376:P247A	P	-	1	0	CC2D1B	52598358	0.001000	0.12720	0.001000	0.08648	0.041000	0.13682	-0.057000	0.11768	0.000000	0.14550	0.491000	0.48974	CCA	CC2D1B	-	NULL		0.602	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CC2D1B	HGNC	protein_coding	OTTHUMT00000022189.1	G	NM_032449		52825770	-1	no_errors	ENST00000371586	ensembl	human	known	70_37	missense	SNP	0.106	C
CCDC148	130940	genome.wustl.edu	37	2	159166127	159166127	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:159166127G>A	ENST00000283233.5	-	9	1241	c.928C>T	c.(928-930)Caa>Taa	p.Q310*	CCDC148_ENST00000536771.1_Nonsense_Mutation_p.Q224*|CCDC148_ENST00000409187.1_Nonsense_Mutation_p.Q319*	NM_138803.3	NP_620158.3	Q8NFR7	CC148_HUMAN	coiled-coil domain containing 148	310										endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23						AAGCGATATTGGTCACAATAT	0.338																																																	0													79.0	80.0	79.0					2																	159166127		2201	4299	6500	SO:0001587	stop_gained	130940				CCDS33304.1	2q24.1	2007-12-07			ENSG00000153237	ENSG00000153237			25191	protein-coding gene	gene with protein product							Standard	NM_138803		Approved	MGC125588	uc002tzq.3	Q8NFR7	OTTHUMG00000153973	ENST00000283233.5:c.928C>T	2.37:g.159166127G>A	ENSP00000283233:p.Gln310*	Somatic		WXS	Illumina HiSeq	Phase_IV	F5H839|Q3B7I3|Q3B7I4|Q3KR41|Q4ZG12|Q4ZG23|Q53TM6|Q96BN5|Q96LM2	Nonsense_Mutation	SNP	NULL	p.Q310*	ENST00000283233.5	37	c.928	CCDS33304.1	2	.	.	.	.	.	.	.	.	.	.	G	37	6.058800	0.97246	.	.	ENSG00000153237	ENST00000283233;ENST00000375617;ENST00000409187;ENST00000536771	.	.	.	5.95	4.04	0.47022	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.8243	9.1011	0.36669	0.0:0.1422:0.5644:0.2935	.	.	.	.	X	310;158;319;224	.	ENSP00000283233:Q310X	Q	-	1	0	CCDC148	158874373	0.270000	0.24152	0.937000	0.37676	0.993000	0.82548	1.441000	0.35035	1.454000	0.47793	0.655000	0.94253	CAA	CCDC148	-	NULL		0.338	CCDC148-001	KNOWN	basic|CCDS	protein_coding	CCDC148	HGNC	protein_coding	OTTHUMT00000333270.1	G	NM_138803		159166127	-1	no_errors	ENST00000283233	ensembl	human	known	70_37	nonsense	SNP	0.540	A
CCDC108	255101	genome.wustl.edu	37	2	219894307	219894307	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:219894307C>G	ENST00000341552.5	-	11	1551	c.1468G>C	c.(1468-1470)Gag>Cag	p.E490Q	CCDC108_ENST00000453220.1_Missense_Mutation_p.E490Q|CCDC108_ENST00000409865.3_Missense_Mutation_p.E479Q|CCDC108_ENST00000410037.1_Missense_Mutation_p.E425Q|CCDC108_ENST00000441968.1_Missense_Mutation_p.E490Q	NM_194302.2	NP_919278.2	Q6ZU64	CC108_HUMAN	coiled-coil domain containing 108	490						integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(18)|liver(1)|lung(34)|ovary(2)|pancreas(1)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	80		Renal(207;0.0915)		Epithelial(149;1.12e-06)|all cancers(144;0.000196)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		GATTGGTTCTCAATCCACAGG	0.597											OREG0015211	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													136.0	114.0	122.0					2																	219894307		2203	4300	6503	SO:0001583	missense	255101			NM_194302, AL833882, AK127189	CCDS2430.2, CCDS2431.2, CCDS63125.1, CCDS63126.1	2q35	2008-02-05			ENSG00000181378	ENSG00000181378			25325	protein-coding gene	gene with protein product		614270				12477932	Standard	NM_194302		Approved	DKFZp434O0527, MGC35338	uc002vjl.2	Q6ZU64	OTTHUMG00000133013	ENST00000341552.5:c.1468G>C	2.37:g.219894307C>G	ENSP00000340776:p.Glu490Gln	Somatic	2262	WXS	Illumina HiSeq	Phase_IV	A2BDD8|E9PCR1|E9PG25|E9PG72|Q6ZSR8|Q8N0T4|Q8NDJ3	Missense_Mutation	SNP	superfamily_PapD-like,pfscan_Major_sperm	p.E490Q	ENST00000341552.5	37	c.1468	CCDS2430.2	2	.	.	.	.	.	.	.	.	.	.	C	10.11	1.259522	0.23051	.	.	ENSG00000181378	ENST00000341552;ENST00000441968;ENST00000453220;ENST00000409865;ENST00000410037;ENST00000441164	T;T;T;T;T	0.07327	3.49;3.49;3.49;3.2;3.22	5.18	4.27	0.50696	.	0.298301	0.24217	N	0.040474	T	0.06872	0.0175	L	0.61036	1.89	0.80722	D	1	B;P	0.34864	0.344;0.473	B;B	0.28232	0.087;0.087	T	0.16837	-1.0389	10	0.14656	T	0.56	-33.2017	3.9435	0.09338	0.0:0.5462:0.2518:0.202	.	479;490	E9PG25;Q6ZU64	.;CC108_HUMAN	Q	490;490;490;479;425;424	ENSP00000340776:E490Q;ENSP00000413377:E490Q;ENSP00000409117:E490Q;ENSP00000386945:E479Q;ENSP00000386258:E425Q	ENSP00000340776:E490Q	E	-	1	0	CCDC108	219602551	0.996000	0.38824	0.988000	0.46212	0.758000	0.43043	3.002000	0.49496	2.688000	0.91661	0.655000	0.94253	GAG	CCDC108	-	NULL		0.597	CCDC108-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC108	HGNC	protein_coding	OTTHUMT00000256598.4	C	NM_194302		219894307	-1	no_errors	ENST00000341552	ensembl	human	known	70_37	missense	SNP	0.881	G
CCNT1	904	genome.wustl.edu	37	12	49088062	49088062	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:49088062G>C	ENST00000261900.3	-	9	1157	c.935C>G	c.(934-936)tCc>tGc	p.S312C		NM_001240.3	NP_001231.2	O60563	CCNT1_HUMAN	cyclin T1	312					cell cycle (GO:0007049)|cell division (GO:0051301)|gene expression (GO:0010467)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of viral transcription (GO:0050434)|protein phosphorylation (GO:0006468)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral process (GO:0016032)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|positive transcription elongation factor complex b (GO:0008024)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|snRNA binding (GO:0017069)|transcription regulatory region DNA binding (GO:0044212)			breast(3)|endometrium(1)|kidney(1)|large_intestine(4)|lung(13)|ovary(3)|skin(2)	27						GACTGGCAGGGAAGGCACTGC	0.488																																																	0													118.0	106.0	110.0					12																	49088062		2203	4300	6503	SO:0001583	missense	904			AF048730	CCDS8766.1, CCDS61109.1	12q13.11	2010-11-15			ENSG00000129315	ENSG00000129315			1599	protein-coding gene	gene with protein product		143055	"""human immunodeficiency virus type 1 (HIV-1) expression (elevated) 1"""	HIVE1		9491887, 9499409	Standard	NM_001240		Approved	CCNT, CYCT1	uc001rsd.4	O60563	OTTHUMG00000170393	ENST00000261900.3:c.935C>G	12.37:g.49088062G>C	ENSP00000261900:p.Ser312Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A9XU13|E7EX76|O60581	Missense_Mutation	SNP	pfam_Cyclin_N,superfamily_Cyclin-like,smart_Cyclin-like	p.S312C	ENST00000261900.3	37	c.935	CCDS8766.1	12	.	.	.	.	.	.	.	.	.	.	G	13.14	2.148912	0.37923	.	.	ENSG00000129315	ENST00000261900	T	0.50548	0.74	5.49	5.49	0.81192	.	0.241802	0.35838	N	0.002960	T	0.30230	0.0758	N	0.08118	0	0.37901	D	0.931056	B	0.31318	0.319	B	0.22601	0.04	T	0.34650	-0.9820	10	0.66056	D	0.02	-8.5301	18.1209	0.89571	0.0:0.0:1.0:0.0	.	312	O60563	CCNT1_HUMAN	C	312	ENSP00000261900:S312C	ENSP00000261900:S312C	S	-	2	0	CCNT1	47374329	1.000000	0.71417	0.993000	0.49108	0.253000	0.25986	3.538000	0.53597	2.587000	0.87381	0.491000	0.48974	TCC	CCNT1	-	NULL		0.488	CCNT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCNT1	HGNC	protein_coding	OTTHUMT00000408853.1	G	NM_001240		49088062	-1	no_errors	ENST00000261900	ensembl	human	known	70_37	missense	SNP	0.967	C
CCR7	1236	genome.wustl.edu	37	17	38711879	38711879	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:38711879G>C	ENST00000246657.2	-	3	314	c.252C>G	c.(250-252)atC>atG	p.I84M	CCR7_ENST00000579344.1_Missense_Mutation_p.I78M	NM_001838.3	NP_001829.1	P32248	CCR7_HUMAN	chemokine (C-C motif) receptor 7	84					activation of Rho GTPase activity (GO:0032862)|cellular response to cytokine stimulus (GO:0071345)|chemokine (C-C motif) ligand 19 signaling pathway (GO:0038115)|chemokine (C-C motif) ligand 21 signaling pathway (GO:0038116)|chemokine-mediated signaling pathway (GO:0070098)|dendritic cell chemotaxis (GO:0002407)|establishment of T cell polarity (GO:0001768)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interleukin-12 secretion (GO:0072610)|lymphocyte migration into lymph node (GO:0097022)|mature dendritic cell differentiation (GO:0097029)|myeloid dendritic cell chemotaxis (GO:0002408)|negative regulation of leukocyte apoptotic process (GO:2000107)|negative thymic T cell selection (GO:0045060)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell adhesion (GO:0045785)|positive regulation of cell motility (GO:2000147)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dendritic cell antigen processing and presentation (GO:0002606)|positive regulation of dendritic cell chemotaxis (GO:2000510)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of glycoprotein biosynthetic process involved in immunological synapse formation (GO:2000526)|positive regulation of humoral immune response (GO:0002922)|positive regulation of hypersensitivity (GO:0002885)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of immunological synapse formation (GO:2000522)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of JNK cascade (GO:0046330)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of T cell costimulation (GO:2000525)|positive regulation of T cell receptor signaling pathway (GO:0050862)|regulation of dendritic cell dendrite assembly (GO:2000547)|regulation of interferon-gamma production (GO:0032649)|regulation of interleukin-1 beta secretion (GO:0050706)|release of sequestered calcium ion into cytosol (GO:0051209)|response to lipopolysaccharide (GO:0032496)|response to nitric oxide (GO:0071731)|response to prostaglandin E (GO:0034695)|ruffle organization (GO:0031529)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	C-C chemokine receptor activity (GO:0016493)|C-C motif chemokine 19 receptor activity (GO:0038117)|C-C motif chemokine 21 receptor activity (GO:0038121)|chemokine (C-C motif) ligand 19 binding (GO:0035757)|chemokine (C-C motif) ligand 21 binding (GO:0035758)|G-protein coupled receptor activity (GO:0004930)			breast(1)|large_intestine(4)|lung(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	8		Breast(137;0.000496)				TCTTGAAATAGATATAGGTCA	0.532																																																	0													102.0	97.0	99.0					17																	38711879		2203	4300	6503	SO:0001583	missense	1236				CCDS11369.1	17q12-q21.2	2012-08-08			ENSG00000126353	ENSG00000126353		"""GPCR / Class A : Chemokine receptors : C-C motif"", ""CD molecules"""	1608	protein-coding gene	gene with protein product		600242		CMKBR7, EBI1		8383238	Standard	NM_001838		Approved	BLR2, CDw197, CD197	uc002huw.3	P32248	OTTHUMG00000133375	ENST00000246657.2:c.252C>G	17.37:g.38711879G>C	ENSP00000246657:p.Ile84Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Chemokine_CCR7,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4,prints_Chemokine_CCR11	p.I84M	ENST00000246657.2	37	c.252	CCDS11369.1	17	.	.	.	.	.	.	.	.	.	.	G	14.19	2.461320	0.43736	.	.	ENSG00000126353	ENST00000246657	T	0.38560	1.13	5.04	4.02	0.46733	GPCR, rhodopsin-like superfamily (1);	0.319150	0.32314	N	0.006272	T	0.45637	0.1352	L	0.45051	1.395	0.36789	D	0.884733	P	0.34629	0.46	P	0.51055	0.657	T	0.52808	-0.8526	10	0.45353	T	0.12	.	5.7915	0.18363	0.0803:0.129:0.6428:0.1478	.	84	P32248	CCR7_HUMAN	M	84	ENSP00000246657:I84M	ENSP00000246657:I84M	I	-	3	3	CCR7	35965405	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	3.097000	0.50251	2.619000	0.88677	0.561000	0.74099	ATC	CCR7	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_Chemokine_rcpt,prints_Chemokine_CXCR4		0.532	CCR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCR7	HGNC	protein_coding	OTTHUMT00000257222.1	G			38711879	-1	no_errors	ENST00000246657	ensembl	human	known	70_37	missense	SNP	1.000	C
CHIAP2	149620	genome.wustl.edu	37	1	111824231	111824231	+	RNA	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:111824231G>A	ENST00000369743.4	+	0	115					NR_003928.1				chitinase, acidic pseudogene 2																		AGCCAGGCCTGGGGTGCTTCA	0.547																																																	0																																												149620					1p13.2	2012-10-11			ENSG00000203878	ENSG00000203878			44463	pseudogene	pseudogene							Standard	NR_003928		Approved		uc009wgb.3		OTTHUMG00000012173		1.37:g.111824231G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000369743.4	37	NULL		1																																																																																			CHIAP2	-	-		0.547	CHIAP2-001	KNOWN	basic	processed_transcript	CHIAP2	HGNC	pseudogene	OTTHUMT00000033667.3	G			111824231	+1	no_errors	ENST00000369743	ensembl	human	known	70_37	rna	SNP	0.928	A
CENPF	1063	genome.wustl.edu	37	1	214816097	214816097	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:214816097C>T	ENST00000366955.3	+	12	4584	c.4416C>T	c.(4414-4416)ctC>ctT	p.L1472L		NM_016343.3	NP_057427.3	P49454	CENPF_HUMAN	centromere protein F, 350/400kDa	1568	2 X 96 AA approximate tandem repeats.				cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|kinetochore assembly (GO:0051382)|metaphase plate congression (GO:0051310)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|muscle organ development (GO:0007517)|negative regulation of transcription, DNA-templated (GO:0045892)|protein transport (GO:0015031)|regulation of cell cycle (GO:0051726)|regulation of G2/M transition of mitotic cell cycle (GO:0010389)|regulation of striated muscle tissue development (GO:0016202)|response to drug (GO:0042493)	chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|midbody (GO:0030496)|nuclear envelope (GO:0005635)|nuclear matrix (GO:0016363)|nucleus (GO:0005634)|pronucleus (GO:0045120)|spindle (GO:0005819)|spindle pole (GO:0000922)	chromatin binding (GO:0003682)|dynein binding (GO:0045502)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			NS(2)|breast(2)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(37)|lung(47)|ovary(7)|prostate(3)|skin(6)|stomach(1)|urinary_tract(1)	126				all cancers(67;0.00836)|OV - Ovarian serous cystadenocarcinoma(81;0.00855)|GBM - Glioblastoma multiforme(131;0.0694)|Epithelial(68;0.0833)		AGGAGGGGCTCGTTCCATCCC	0.473																																					Colon(80;575 1284 11000 14801 43496)												0													70.0	69.0	69.0					1																	214816097		2203	4300	6503	SO:0001819	synonymous_variant	1063			U30872	CCDS31023.1	1q41	2013-11-05	2013-01-17		ENSG00000117724	ENSG00000117724			1857	protein-coding gene	gene with protein product	"""mitosin"""	600236	"""centromere protein F, 350/400kDa (mitosin)"""			7904902, 7851898	Standard	NM_016343		Approved	hcp-1	uc001hkm.3	P49454	OTTHUMG00000036955	ENST00000366955.3:c.4416C>T	1.37:g.214816097C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13171|Q13246|Q5VVM7	Silent	SNP	pfam_Centromere_CenpF_N,pfam_Centromere_CenpF_leu-rich_rpt,pfam_Centromere_CenpF_Rb-prot-bd	p.L1472	ENST00000366955.3	37	c.4416	CCDS31023.1	1																																																																																			CENPF	-	NULL		0.473	CENPF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPF	HGNC	protein_coding	OTTHUMT00000089749.1	C	NM_016343		214816097	+1	no_errors	ENST00000366955	ensembl	human	known	70_37	silent	SNP	0.000	T
CLEC4D	338339	genome.wustl.edu	37	12	8673805	8673805	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:8673805G>A	ENST00000299665.2	+	6	779	c.586G>A	c.(586-588)Gat>Aat	p.D196N		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	196	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					GGCCTGGAATGATGTTCCTTG	0.378																																																	0													131.0	125.0	127.0					12																	8673805		2203	4300	6503	SO:0001583	missense	338339			AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.586G>A	12.37:g.8673805G>A	ENSP00000299665:p.Asp196Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N5J5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.D196N	ENST00000299665.2	37	c.586	CCDS8593.1	12	.	.	.	.	.	.	.	.	.	.	G	5.590	0.293671	0.10567	.	.	ENSG00000166527	ENST00000299665	T	0.22743	1.94	4.22	-0.806	0.10875	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.25827	0.0629	M	0.89414	3.03	0.09310	N	1	B	0.21520	0.057	B	0.15052	0.012	T	0.39187	-0.9626	9	0.87932	D	0	.	3.5417	0.07814	0.3882:0.0:0.4402:0.1716	.	196	Q8WXI8	CLC4D_HUMAN	N	196	ENSP00000299665:D196N	ENSP00000299665:D196N	D	+	1	0	CLEC4D	8565072	0.020000	0.18652	0.001000	0.08648	0.098000	0.18820	-0.114000	0.10757	-0.155000	0.11098	-1.000000	0.02509	GAT	CLEC4D	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII		0.378	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4D	HGNC	protein_coding	OTTHUMT00000400565.1	G	NM_080387		8673805	+1	no_errors	ENST00000299665	ensembl	human	known	70_37	missense	SNP	0.001	A
COL4A6	1288	genome.wustl.edu	37	X	107408146	107408146	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:107408146G>A	ENST00000372216.4	-	39	4034	c.3934C>T	c.(3934-3936)Cca>Tca	p.P1312S	COL4A6_ENST00000538570.1_Missense_Mutation_p.P1287S|COL4A6_ENST00000545689.1_Missense_Mutation_p.P1287S|COL4A6_ENST00000334504.7_Missense_Mutation_p.P1311S|COL4A6_ENST00000394872.2_Missense_Mutation_p.P1312S	NM_001847.2	NP_001838.2	Q14031	CO4A6_HUMAN	collagen, type IV, alpha 6	1312	Triple-helical region.			Missing (in Ref. 1; BAA04809). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(41)|ovary(7)|prostate(1)|skin(1)|stomach(1)|urinary_tract(2)	92						GAAAAACCTGGAATTCCTTGG	0.622									Alport syndrome with Diffuse Leiomyomatosis																												Melanoma(87;1895 1945 2589 7165)												0													47.0	45.0	46.0					X																	107408146		2203	4300	6503	SO:0001583	missense	1288	Familial Cancer Database		U04845	CCDS14541.1, CCDS14542.1, CCDS76008.1, CCDS76009.1, CCDS76010.1	Xq22	2014-09-17			ENSG00000197565	ENSG00000197565		"""Collagens"""	2208	protein-coding gene	gene with protein product		303631				8356449	Standard	NM_033641		Approved		uc004env.4	Q14031	OTTHUMG00000022179	ENST00000372216.4:c.3934C>T	X.37:g.107408146G>A	ENSP00000361290:p.Pro1312Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q12823|Q14053|Q5JYH6|Q5JYH8|Q9NQM5|Q9NTX3|Q9UJ76|Q9UMG6|Q9Y4L4	Missense_Mutation	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P1312S	ENST00000372216.4	37	c.3934	CCDS14541.1	X	.	.	.	.	.	.	.	.	.	.	G	13.65	2.299458	0.40694	.	.	ENSG00000197565	ENST00000372216;ENST00000334504;ENST00000394872;ENST00000541389;ENST00000545689;ENST00000538570	D;D;D;D;D	0.98649	-5.05;-5.05;-5.05;-5.05;-3.32	4.46	3.59	0.41128	.	0.000000	0.37437	N	0.002081	D	0.98099	0.9373	M	0.71581	2.175	0.28778	N	0.899981	D;B;D;P	0.56287	0.975;0.041;0.959;0.949	P;B;P;P	0.53861	0.736;0.018;0.626;0.492	D	0.95241	0.8351	10	0.48119	T	0.1	.	8.3459	0.32272	0.0897:0.0:0.7471:0.1632	.	1287;1287;1312;1311	F5H851;F5H3Q5;Q14031;Q14031-2	.;.;CO4A6_HUMAN;.	S	1312;1311;1312;1299;1287;1287	ENSP00000361290:P1312S;ENSP00000334733:P1311S;ENSP00000378340:P1312S;ENSP00000443707:P1287S;ENSP00000445236:P1287S	ENSP00000334733:P1311S	P	-	1	0	COL4A6	107294802	0.988000	0.35896	0.999000	0.59377	0.987000	0.75469	1.998000	0.40796	0.962000	0.38057	0.544000	0.68410	CCA	COL4A6	-	pfam_Collagen		0.622	COL4A6-001	KNOWN	basic|CCDS	protein_coding	COL4A6	HGNC	protein_coding	OTTHUMT00000057875.2	G			107408146	-1	no_errors	ENST00000372216	ensembl	human	known	70_37	missense	SNP	0.607	A
COL5A3	50509	genome.wustl.edu	37	19	10112470	10112470	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:10112470T>C	ENST00000264828.3	-	7	1022	c.937A>G	c.(937-939)Act>Gct	p.T313A		NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	313	Nonhelical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TTGAGTCCAGTAGTCACAGTG	0.567											OREG0025228	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													140.0	126.0	131.0					19																	10112470		2203	4300	6503	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.937A>G	19.37:g.10112470T>C	ENSP00000264828:p.Thr313Ala	Somatic	662	WXS	Illumina HiSeq	Phase_IV	Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.T313A	ENST00000264828.3	37	c.937	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	T	4.475	0.088017	0.08583	.	.	ENSG00000080573	ENST00000264828	D	0.88896	-2.44	4.95	-7.74	0.01241	.	3.532380	0.01351	U	0.011919	T	0.77003	0.4067	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.68573	-0.5373	10	0.08837	T	0.75	.	6.3045	0.21131	0.1123:0.5285:0.1147:0.2445	.	313	P25940	CO5A3_HUMAN	A	313	ENSP00000264828:T313A	ENSP00000264828:T313A	T	-	1	0	COL5A3	9973470	0.000000	0.05858	0.000000	0.03702	0.057000	0.15508	-1.984000	0.01487	-1.876000	0.01131	-0.464000	0.05259	ACT	COL5A3	-	NULL		0.567	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	T	NM_015719		10112470	-1	no_errors	ENST00000264828	ensembl	human	known	70_37	missense	SNP	0.000	C
COL6A2	1292	genome.wustl.edu	37	21	47545731	47545731	+	Missense_Mutation	SNP	G	G	C	rs138948335	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr21:47545731G>C	ENST00000300527.4	+	26	2106	c.2002G>C	c.(2002-2004)Gag>Cag	p.E668Q	COL6A2_ENST00000357838.4_Missense_Mutation_p.E668Q|COL6A2_ENST00000409416.1_Missense_Mutation_p.E668Q|COL6A2_ENST00000310645.5_Missense_Mutation_p.E668Q|COL6A2_ENST00000397763.1_Missense_Mutation_p.E668Q	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	668	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GTACAGCCACGAGGGCACCTT	0.647																																																	0													62.0	52.0	55.0					21																	47545731		2203	4300	6503	SO:0001583	missense	1292			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.2002G>C	21.37:g.47545731G>C	ENSP00000300527:p.Glu668Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.E668Q	ENST00000300527.4	37	c.2002	CCDS13728.1	21	.	.	.	.	.	.	.	.	.	.	G	18.98	3.738816	0.69304	.	.	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763;ENST00000413758	D;D;D;D;D;D	0.83914	-1.78;-1.78;-1.78;-1.78;-1.78;-1.78	4.4	4.4	0.53042	von Willebrand factor, type A (3);	0.273439	0.41712	D	0.000833	D	0.86493	0.5946	L	0.38531	1.155	0.46609	D	0.99912	D;P;P	0.76494	0.999;0.866;0.866	D;B;P	0.67103	0.949;0.416;0.496	D	0.87817	0.2635	10	0.54805	T	0.06	-26.5487	16.9942	0.86362	0.0:0.0:1.0:0.0	.	668;668;668	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	Q	668;668;668;668;668;225	ENSP00000300527:E668Q;ENSP00000350497:E668Q;ENSP00000312529:E668Q;ENSP00000387115:E668Q;ENSP00000380870:E668Q;ENSP00000395751:E225Q	ENSP00000300527:E668Q	E	+	1	0	COL6A2	46370159	1.000000	0.71417	1.000000	0.80357	0.895000	0.52256	7.291000	0.78721	1.998000	0.58463	0.491000	0.48974	GAG	COL6A2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.647	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	G			47545731	+1	no_errors	ENST00000300527	ensembl	human	known	70_37	missense	SNP	1.000	C
COL6A6	131873	genome.wustl.edu	37	3	130284200	130284200	+	Nonsense_Mutation	SNP	C	C	T	rs375636488		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:130284200C>T	ENST00000358511.6	+	3	1055	c.1024C>T	c.(1024-1026)Cga>Tga	p.R342*	COL6A6_ENST00000453409.2_Nonsense_Mutation_p.R342*	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	342	Nonhelical region.|VWFA 2. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						GGTGACCCACCGAGATTCAGA	0.557																																																	0								C	stop/ARG	2,3950		0,2,1974	158.0	166.0	163.0		1024	-0.4	0.1	3		163	1,8297		0,1,4148	no	stop-gained	COL6A6	NM_001102608.1		0,3,6122	TT,TC,CC		0.0121,0.0506,0.0245		342/2264	130284200	3,12247	1976	4149	6125	SO:0001587	stop_gained	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.1024C>T	3.37:g.130284200C>T	ENSP00000351310:p.Arg342*	Somatic		WXS	Illumina HiSeq	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Nonsense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.R342*	ENST00000358511.6	37	c.1024	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	C	18.09	3.546356	0.65198	5.06E-4	1.21E-4	ENSG00000206384	ENST00000358511;ENST00000453409	.	.	.	5.01	-0.405	0.12392	.	0.273852	0.31648	N	0.007296	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15952	T	0.53	.	8.1466	0.31115	0.2514:0.5444:0.2041:0.0	.	.	.	.	X	342	.	ENSP00000351310:R342X	R	+	1	2	COL6A6	131766890	0.212000	0.23540	0.125000	0.21846	0.001000	0.01503	0.719000	0.25881	-0.234000	0.09782	-1.086000	0.02197	CGA	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.557	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	C	NM_001102608		130284200	+1	no_errors	ENST00000358511	ensembl	human	known	70_37	nonsense	SNP	0.606	T
COX4I2	84701	genome.wustl.edu	37	20	30232672	30232672	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:30232672C>T	ENST00000376075.3	+	5	556	c.481C>T	c.(481-483)Cgc>Tgc	p.R161C		NM_032609.2	NP_115998.2	Q96KJ9	COX42_HUMAN	cytochrome c oxidase subunit IV isoform 2 (lung)	161			R -> H (in dbSNP:rs11907253). {ECO:0000269|PubMed:11311561}.		cellular respiration (GO:0045333)|generation of precursor metabolites and energy (GO:0006091)|hydrogen ion transmembrane transport (GO:1902600)|oxidation-reduction process (GO:0055114)	mitochondrial respiratory chain complex IV (GO:0005751)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(1)|large_intestine(4)|liver(1)|lung(3)|ovary(1)	11	all_cancers(5;7.12e-06)|Lung NSC(7;3.95e-06)|all_epithelial(3;4.36e-06)|all_lung(7;6.68e-06)|all_hematologic(12;0.158)|Ovarian(7;0.198)		Epithelial(4;1.01e-05)|all cancers(5;9.46e-05)|OV - Ovarian serous cystadenocarcinoma(3;0.00121)|Colorectal(19;0.0055)|COAD - Colon adenocarcinoma(19;0.0264)			CCTGGCCTCCCGCTGGGACTA	0.622																																																	0													75.0	65.0	69.0					20																	30232672		2203	4300	6503	SO:0001583	missense	84701			AF257180	CCDS13187.1	20q11.21	2011-07-04	2004-08-11		ENSG00000131055	ENSG00000131055		"""Mitochondrial respiratory chain complex / Complex IV"""	16232	protein-coding gene	gene with protein product	"""cytochrome c oxidase subunit IV-like 2"""	607976	"""cytochrome c oxidase subunit IV isoform 2"""	COX4L2		11311561, 17937768	Standard	NM_032609		Approved	COXIV-2, COX4B, dJ857M17.2, COX4-2	uc002wwj.1	Q96KJ9	OTTHUMG00000032180	ENST00000376075.3:c.481C>T	20.37:g.30232672C>T	ENSP00000365243:p.Arg161Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GTF4|Q9H0Z4	Missense_Mutation	SNP	pfam_Cyt_c_oxidase_su4_fam,superfamily_Cyt_c_oxidase_su4_fam,prints_Cyt_c_oxidase_su4	p.R161C	ENST00000376075.3	37	c.481	CCDS13187.1	20	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628535	0.67015	.	.	ENSG00000131055	ENST00000376075	T	0.56275	0.47	4.38	3.4	0.38934	.	0.324544	0.28442	N	0.015337	T	0.44540	0.1298	L	0.39898	1.24	0.38682	D	0.952566	D	0.56035	0.974	B	0.43990	0.438	T	0.51631	-0.8681	10	0.87932	D	0	-17.387	9.8792	0.41222	0.0:0.7917:0.2083:0.0	.	161	Q96KJ9	COX42_HUMAN	C	161	ENSP00000365243:R161C	ENSP00000365243:R161C	R	+	1	0	COX4I2	29696333	1.000000	0.71417	0.641000	0.29422	0.847000	0.48162	2.807000	0.47955	0.999000	0.39023	0.313000	0.20887	CGC	COX4I2	-	pfam_Cyt_c_oxidase_su4_fam,superfamily_Cyt_c_oxidase_su4_fam,prints_Cyt_c_oxidase_su4		0.622	COX4I2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX4I2	HGNC	protein_coding	OTTHUMT00000078548.1	C	NM_032609		30232672	+1	no_errors	ENST00000376075	ensembl	human	known	70_37	missense	SNP	0.984	T
CPEB4	80315	genome.wustl.edu	37	5	173317425	173317425	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:173317425C>G	ENST00000265085.5	+	1	2143	c.689C>G	c.(688-690)tCa>tGa	p.S230*	CPEB4_ENST00000522336.1_5'Flank|CPEB4_ENST00000334035.5_Nonsense_Mutation_p.S230*|CPEB4_ENST00000517880.1_5'Flank|CPEB4_ENST00000520867.1_Nonsense_Mutation_p.S230*|CPEB4_ENST00000519835.1_Nonsense_Mutation_p.S230*	NM_030627.2	NP_085130.2	Q17RY0	CPEB4_HUMAN	cytoplasmic polyadenylation element binding protein 4	230					cellular response to amino acid stimulus (GO:0071230)|cellular response to decreased oxygen levels (GO:0036294)|cellular response to glucose starvation (GO:0042149)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of neuron apoptotic process (GO:0043524)|response to ischemia (GO:0002931)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|postsynaptic density (GO:0014069)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|prostate(1)|stomach(1)|upper_aerodigestive_tract(2)	20	Renal(175;0.000159)|Lung NSC(126;0.0128)|all_lung(126;0.0202)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)			GGGCCTCTCTCACAGCACCAC	0.552																																																	0													119.0	127.0	124.0					5																	173317425		2203	4300	6503	SO:0001587	stop_gained	80315			BX538213	CCDS4390.1	5q21	2013-02-12			ENSG00000113742	ENSG00000113742		"""RNA binding motif (RRM) containing"""	21747	protein-coding gene	gene with protein product		610607				11214970, 12672660	Standard	NM_030627		Approved	KIAA1673	uc003mcs.4	Q17RY0	OTTHUMG00000130541	ENST00000265085.5:c.689C>G	5.37:g.173317425C>G	ENSP00000265085:p.Ser230*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLQ7|Q7Z310|Q8N405|Q9C0J0	Nonsense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S230*	ENST00000265085.5	37	c.689	CCDS4390.1	5	.	.	.	.	.	.	.	.	.	.	C	38	6.846430	0.97881	.	.	ENSG00000113742	ENST00000265085;ENST00000520867;ENST00000334035;ENST00000519835	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.62326	D	0.03	-7.9914	18.6455	0.91409	0.0:1.0:0.0:0.0	.	.	.	.	X	230	.	ENSP00000265085:S230X	S	+	2	0	CPEB4	173250031	1.000000	0.71417	0.498000	0.27564	0.888000	0.51559	7.818000	0.86416	2.500000	0.84329	0.563000	0.77884	TCA	CPEB4	-	NULL		0.552	CPEB4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPEB4	HGNC	protein_coding	OTTHUMT00000252964.2	C	NM_030627		173317425	+1	no_errors	ENST00000265085	ensembl	human	known	70_37	nonsense	SNP	0.956	G
CPED1	79974	genome.wustl.edu	37	7	120764400	120764400	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:120764400G>C	ENST00000310396.5	+	8	1401	c.934G>C	c.(934-936)Gag>Cag	p.E312Q	CPED1_ENST00000450913.2_Missense_Mutation_p.E312Q|CPED1_ENST00000423795.1_Missense_Mutation_p.E92Q	NM_024913.4	NP_079189.4	A4D0V7	CPED1_HUMAN	cadherin-like and PC-esterase domain containing 1	312						endoplasmic reticulum (GO:0005783)											AACATTTTTTGAGACATTCCT	0.393																																																	0													117.0	115.0	115.0					7																	120764400		2203	4300	6503	SO:0001583	missense	79974				CCDS34739.1, CCDS47690.1	7q31.31	2012-06-12	2012-06-12	2012-06-12	ENSG00000106034	ENSG00000106034			26159	protein-coding gene	gene with protein product			"""chromosome 7 open reading frame 58"""	C7orf58		20056006	Standard	NM_024913		Approved	FLJ21986	uc003vjq.4	A4D0V7	OTTHUMG00000156982	ENST00000310396.5:c.934G>C	7.37:g.120764400G>C	ENSP00000309772:p.Glu312Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1R3|Q6UXT1|Q86T76|Q86T84|Q8N2T5|Q96NC9	Missense_Mutation	SNP	NULL	p.E312Q	ENST00000310396.5	37	c.934	CCDS34739.1	7	.	.	.	.	.	.	.	.	.	.	G	20.7	4.036950	0.75617	.	.	ENSG00000106034	ENST00000310396;ENST00000428526;ENST00000450913;ENST00000423795;ENST00000443817	T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87	5.08	5.08	0.68730	.	0.319279	0.34200	N	0.004179	T	0.59662	0.2210	M	0.62723	1.935	0.80722	D	1	D;D;D	0.67145	0.996;0.981;0.994	P;P;P	0.59357	0.856;0.789;0.783	T	0.62609	-0.6818	10	0.62326	D	0.03	.	18.4275	0.90614	0.0:0.0:1.0:0.0	.	92;312;312	G5E9U2;A4D0V7-2;A4D0V7	.;.;CG058_HUMAN	Q	312;312;312;92;92	ENSP00000309772:E312Q;ENSP00000398082:E312Q;ENSP00000406122:E312Q;ENSP00000415573:E92Q;ENSP00000391952:E92Q	ENSP00000309772:E312Q	E	+	1	0	C7orf58	120551636	1.000000	0.71417	1.000000	0.80357	0.837000	0.47467	6.316000	0.72857	2.519000	0.84933	0.591000	0.81541	GAG	CPED1	-	NULL		0.393	CPED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPED1	HGNC	protein_coding	OTTHUMT00000346959.1	G	NM_024913		120764400	+1	no_errors	ENST00000310396	ensembl	human	known	70_37	missense	SNP	1.000	C
CPNE7	27132	genome.wustl.edu	37	16	89650455	89650455	+	Missense_Mutation	SNP	C	C	T	rs529101968		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:89650455C>T	ENST00000268720.5	+	6	807	c.677C>T	c.(676-678)tCg>tTg	p.S226L	CPNE7_ENST00000319518.8_Missense_Mutation_p.S151L	NM_014427.4	NP_055242.1	Q9UBL6	CPNE7_HUMAN	copine VII	226					lipid metabolic process (GO:0006629)|transport (GO:0006810)	extracellular vesicular exosome (GO:0070062)	transporter activity (GO:0005215)	p.S226L(1)		breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(8)|ovary(2)	17		all_hematologic(23;0.0748)		all cancers(4;3.63e-08)|OV - Ovarian serous cystadenocarcinoma(4;1.7e-06)|BRCA - Breast invasive adenocarcinoma(80;0.0147)		GAGGACATCTCGGGGAACAAC	0.711																																																	1	Substitution - Missense(1)	lung(1)											54.0	50.0	51.0					16																	89650455		2196	4300	6496	SO:0001583	missense	27132			AJ133798	CCDS10980.1, CCDS10981.1	16q24.3	2008-07-03			ENSG00000178773	ENSG00000178773			2320	protein-coding gene	gene with protein product		605689					Standard	NM_014427		Approved		uc002fnq.3	Q9UBL6	OTTHUMG00000138051	ENST00000268720.5:c.677C>T	16.37:g.89650455C>T	ENSP00000268720:p.Ser226Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting,pfscan_VWF_A	p.S226L	ENST00000268720.5	37	c.677	CCDS10980.1	16	.	.	.	.	.	.	.	.	.	.	C	26.8	4.772890	0.90108	.	.	ENSG00000178773	ENST00000319518;ENST00000268720	T;T	0.15718	2.4;2.42	3.32	3.32	0.38043	C2 calcium-dependent membrane targeting (1);	0.388553	0.26563	N	0.023673	T	0.20088	0.0483	L	0.49350	1.555	0.46564	D	0.999109	P;D	0.56287	0.941;0.975	B;P	0.44673	0.387;0.457	T	0.08106	-1.0738	10	0.72032	D	0.01	-4.4637	13.9128	0.63878	0.0:1.0:0.0:0.0	.	151;226	Q9UBL6-2;Q9UBL6	.;CPNE7_HUMAN	L	151;226	ENSP00000317374:S151L;ENSP00000268720:S226L	ENSP00000268720:S226L	S	+	2	0	CPNE7	88177956	1.000000	0.71417	0.928000	0.36995	0.916000	0.54674	5.041000	0.64196	1.851000	0.53745	0.491000	0.48974	TCG	CPNE7	-	smart_C2_Ca-dep		0.711	CPNE7-002	KNOWN	basic|CCDS	protein_coding	CPNE7	HGNC	protein_coding	OTTHUMT00000269929.2	C			89650455	+1	no_errors	ENST00000268720	ensembl	human	known	70_37	missense	SNP	1.000	T
CRLF3	51379	genome.wustl.edu	37	17	29111235	29111235	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:29111235G>C	ENST00000324238.6	-	8	1423	c.1299C>G	c.(1297-1299)ttC>ttG	p.F433L	CTD-2349P21.10_ENST00000585212.1_RNA|CRLF3_ENST00000544695.1_Missense_Mutation_p.F317L|CRLF3_ENST00000577725.1_5'Flank	NM_015986.3	NP_057070.3	Q8IUI8	CRLF3_HUMAN	cytokine receptor-like factor 3	433					G1/S transition of mitotic cell cycle (GO:0000082)|negative regulation of cell growth (GO:0030308)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)	cytoplasm (GO:0005737)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|prostate(1)|upper_aerodigestive_tract(1)	17		all_hematologic(16;0.014)|Acute lymphoblastic leukemia(14;0.0236)|Myeloproliferative disorder(56;0.0255)				ATCCAGGATAGAAAAATGAGC	0.398																																					Pancreas(30;346 881 29244 33464 41299)												0													93.0	85.0	87.0					17																	29111235		2203	4300	6503	SO:0001583	missense	51379			AF120151	CCDS32607.1	17q11.2	2008-05-02				ENSG00000176390			17177	protein-coding gene	gene with protein product		614853					Standard	NM_015986		Approved	CREME9, CYTOR4	uc002hfr.4	Q8IUI8		ENST00000324238.6:c.1299C>G	17.37:g.29111235G>C	ENSP00000318804:p.Phe433Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJF3|B2R8C3|Q2MLY7|Q9UNI3|Q9Y6M8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.F433L	ENST00000324238.6	37	c.1299	CCDS32607.1	17	.	.	.	.	.	.	.	.	.	.	g	9.079	0.998776	0.19121	.	.	ENSG00000176390	ENST00000324238;ENST00000544695	T;T	0.62639	0.01;0.01	5.17	2.05	0.26809	.	0.266297	0.40222	N	0.001144	T	0.37019	0.0988	N	0.22421	0.69	0.28127	N	0.930341	B	0.14438	0.01	B	0.16289	0.015	T	0.15492	-1.0435	10	0.07813	T	0.8	-17.8661	4.4938	0.11826	0.3756:0.0:0.4674:0.157	.	433	Q8IUI8	CRLF3_HUMAN	L	433;317	ENSP00000318804:F433L;ENSP00000444188:F317L	ENSP00000318804:F433L	F	-	3	2	CRLF3	26135361	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	0.638000	0.24674	0.686000	0.31488	-0.251000	0.11542	TTC	CRLF3	-	NULL		0.398	CRLF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRLF3	HGNC	protein_coding	OTTHUMT00000444354.1	G			29111235	-1	no_errors	ENST00000324238	ensembl	human	known	70_37	missense	SNP	0.992	C
CRYZL1	9946	genome.wustl.edu	37	21	34969645	34969645	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr21:34969645C>T	ENST00000381554.3	-	10	824	c.739G>A	c.(739-741)Gat>Aat	p.D247N	CRYZL1_ENST00000381540.3_Missense_Mutation_p.D247N|AP000304.12_ENST00000429238.1_Intron|CRYZL1_ENST00000445393.1_Intron|CRYZL1_ENST00000480893.1_5'UTR|CRYZL1_ENST00000361534.2_Missense_Mutation_p.D271N|CRYZL1_ENST00000290244.5_Missense_Mutation_p.D232N	NM_145858.2	NP_665857.2	O95825	QORL1_HUMAN	crystallin, zeta (quinone reductase)-like 1	247					quinone metabolic process (GO:1901661)	cytosol (GO:0005829)	NADP binding (GO:0050661)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			lung(1)|prostate(1)|urinary_tract(1)	3						GTGATGATATCATGTTTATGT	0.373																																																	0													229.0	214.0	219.0					21																	34969645		2203	4300	6503	SO:0001583	missense	9946			AF029689	CCDS13633.2	21q22.1	2008-07-31			ENSG00000205758	ENSG00000205758			2420	protein-coding gene	gene with protein product	"""quinone reductase-like 1"""	603920				10191096	Standard	NM_145858		Approved	QOH-1, 4P11	uc021wio.1	O95825	OTTHUMG00000065954	ENST00000381554.3:c.739G>A	21.37:g.34969645C>T	ENSP00000370966:p.Asp247Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDX1|B3KQ77|Q96DY0|Q9NVY7	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.D247N	ENST00000381554.3	37	c.739	CCDS13633.2	21	.	.	.	.	.	.	.	.	.	.	C	32	5.126671	0.94429	.	.	ENSG00000205758	ENST00000381554;ENST00000290244;ENST00000381540;ENST00000361534	T;T;T;T	0.15952	2.42;2.38;2.41;2.43	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	T	0.39989	0.1099	M	0.80183	2.485	0.80722	D	1	D;D	0.69078	0.987;0.997	P;D	0.64042	0.906;0.921	T	0.34477	-0.9827	10	0.07990	T	0.79	-17.9061	18.807	0.92041	0.0:1.0:0.0:0.0	.	247;271	O95825;A6NHJ8	QORL1_HUMAN;.	N	247;232;247;271	ENSP00000370966:D247N;ENSP00000290244:D232N;ENSP00000370951:D247N;ENSP00000355075:D271N	ENSP00000290244:D232N	D	-	1	0	CRYZL1	33891515	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	6.104000	0.71498	2.591000	0.87537	0.650000	0.86243	GAT	CRYZL1	-	smart_PKS_ER		0.373	CRYZL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZL1	HGNC	protein_coding	OTTHUMT00000141282.2	C	NM_145858		34969645	-1	no_errors	ENST00000381554	ensembl	human	known	70_37	missense	SNP	1.000	T
CTAGE1	64693	genome.wustl.edu	37	18	19995686	19995686	+	5'Flank	SNP	A	A	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:19995686A>G	ENST00000525417.1	-	0	0				CTAGE1_ENST00000391403.2_Missense_Mutation_p.F697L			Q9HC47	CTGE1_HUMAN	cutaneous T-cell lymphoma-associated antigen 1							integral component of membrane (GO:0016021)				cervix(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(19)|ovary(1)	27	all_cancers(21;0.000361)|all_epithelial(16;9.61e-06)|Colorectal(14;0.0533)|Lung NSC(20;0.0605)|Ovarian(2;0.116)|all_lung(20;0.135)					GAAGCTCCAAACACGGTTCCT	0.483																																																	0													62.0	69.0	67.0					18																	19995686		2138	4249	6387	SO:0001631	upstream_gene_variant	64693			AF177229	CCDS45837.1	18q11.2	2010-05-26			ENSG00000212710	ENSG00000212710			24346	protein-coding gene	gene with protein product	"""cutaneous T-cell lymphoma-associated antigen 1"", ""cutaneous T-cell lymphoma-associated antigen 2"", ""cancer/testis antigen family 21, member 1"", ""cancer/testis antigen family 21, member 2"""	608856				11149944, 12839582	Standard	NM_172241		Approved	cTAGE-1, cTAGE-2, CTAGE, CT21.1, CT21.2	uc002ktv.1	Q96RT6			18.37:g.19995686A>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YIZ3	Missense_Mutation	SNP	NULL	p.F697L	ENST00000525417.1	37	c.2089		18	.	.	.	.	.	.	.	.	.	.	A	7.358	0.624267	0.14193	.	.	ENSG00000212710	ENST00000391403	T	0.39406	1.08	0.614	0.614	0.17603	.	.	.	.	.	T	0.29652	0.0740	L	0.41027	1.25	0.09310	N	1	B	0.12013	0.005	B	0.15052	0.012	T	0.22312	-1.0220	7	.	.	.	.	.	.	.	.	697	Q96RT6	CTGE2_HUMAN	L	697	ENSP00000375220:F697L	.	F	-	1	0	CTAGE1	18249684	0.989000	0.36119	0.166000	0.22797	0.083000	0.17756	2.550000	0.45811	0.486000	0.27676	0.248000	0.18094	TTT	CTAGE1	-	NULL		0.483	CTAGE1-002	KNOWN	basic|appris_candidate	protein_coding	CTAGE1	HGNC	protein_coding	OTTHUMT00000386767.1	A	NM_022663, NM_172241		19995686	-1	no_errors	ENST00000391403	ensembl	human	known	70_37	missense	SNP	0.402	G
CTAGE5	4253	genome.wustl.edu	37	14	39771449	39771449	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:39771449C>G	ENST00000280083.3	+	10	1226	c.912C>G	c.(910-912)taC>taG	p.Y304*	RP11-407N17.3_ENST00000553728.1_Nonsense_Mutation_p.Y839*|CTAGE5_ENST00000341749.3_Nonsense_Mutation_p.Y292*|CTAGE5_ENST00000557038.1_Nonsense_Mutation_p.Y224*|CTAGE5_ENST00000341502.5_Nonsense_Mutation_p.Y304*|CTAGE5_ENST00000556148.1_Nonsense_Mutation_p.Y229*|RP11-407N17.3_ENST00000603904.1_Nonsense_Mutation_p.Y275*|CTAGE5_ENST00000396165.4_Nonsense_Mutation_p.Y275*|CTAGE5_ENST00000348007.3_Nonsense_Mutation_p.Y304*|CTAGE5_ENST00000553352.1_Nonsense_Mutation_p.Y275*|CTAGE5_ENST00000396158.2_Nonsense_Mutation_p.Y309*			O15320	CTGE5_HUMAN	CTAGE family, member 5	304					positive regulation of catalytic activity (GO:0043085)	membrane (GO:0016020)	enzyme activator activity (GO:0008047)		CTAGE5/SIP1(2)	breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(11)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Hepatocellular(127;0.213)		LUAD - Lung adenocarcinoma(48;0.000565)|Lung(238;0.000711)	GBM - Glioblastoma multiforme(112;0.0475)		ATGGTGCTTACTTAGGTATTA	0.373																																																	0													166.0	161.0	163.0					14																	39771449		2203	4300	6503	SO:0001587	stop_gained	4253			U94780	CCDS9673.1, CCDS9674.1, CCDS9675.1, CCDS9676.1, CCDS58316.1, CCDS58317.1	14q21.1	2009-09-11	2004-08-24	2004-08-26	ENSG00000150527	ENSG00000150527			7057	protein-coding gene	gene with protein product		602132	"""meningioma expressed antigen 6 (coiled-coil proline-rich)"""	MGEA, MGEA6		9356211, 11149944	Standard	NM_203355		Approved	MEA6, cTAGE-5A, cTAGE-5B, cTAGE-5C, cTAGE-5D, MGEA11	uc001wvi.4	O15320	OTTHUMG00000140258	ENST00000280083.3:c.912C>G	14.37:g.39771449C>G	ENSP00000280083:p.Tyr304*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRA6|B4DQS6|D3DSA6|G3XAC5|O00169|Q6MZN2|Q6P2R8|Q86TF6|Q8IX92|Q8IX93	Nonsense_Mutation	SNP	NULL	p.Y309*	ENST00000280083.3	37	c.927	CCDS9674.1	14	.	.	.	.	.	.	.	.	.	.	C	41	8.767893	0.98945	.	.	ENSG00000258941;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527;ENSG00000150527	ENST00000553728;ENST00000341749;ENST00000557038;ENST00000382245;ENST00000396165;ENST00000341502;ENST00000396158;ENST00000280083;ENST00000556148;ENST00000348007;ENST00000553352	.	.	.	5.78	0.00908	0.14077	.	1.807140	0.03748	N	0.256044	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.8264	0.18556	0.0:0.4723:0.1368:0.391	.	.	.	.	X	839;292;224;266;275;304;309;304;229;304;275	.	.	Y	+	3	2	CTAGE5;RP11-407N17.3	38841200	0.000000	0.05858	0.036000	0.18154	0.997000	0.91878	-0.594000	0.05733	0.072000	0.16694	0.650000	0.86243	TAC	CTAGE5	-	NULL		0.373	CTAGE5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	CTAGE5	HGNC	protein_coding	OTTHUMT00000276771.2	C	NM_005930		39771449	+1	no_errors	ENST00000396158	ensembl	human	known	70_37	nonsense	SNP	0.046	G
CUZD1	50624	genome.wustl.edu	37	10	124596954	124596954	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:124596954C>G	ENST00000368904.1	-	6	1514	c.565G>C	c.(565-567)Gat>Cat	p.D189H	CUZD1_ENST00000545804.1_Missense_Mutation_p.D189H|CUZD1_ENST00000392790.1_Missense_Mutation_p.D189H					CUB and zona pellucida-like domains 1											NS(1)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(13)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|stomach(1)	39		all_neural(114;0.169)|Glioma(114;0.222)		Colorectal(40;0.126)|COAD - Colon adenocarcinoma(40;0.141)		ATCTTGTAATCTTTCTCCACT	0.453																																																	0													118.0	113.0	114.0					10																	124596954		2203	4300	6503	SO:0001583	missense	50624			AF305835	CCDS7631.1	10q26.13	2003-11-18			ENSG00000138161	ENSG00000138161			17937	protein-coding gene	gene with protein product						10542259	Standard	NM_022034		Approved	ERG-1, UO-44		Q86UP6	OTTHUMG00000019195	ENST00000368904.1:c.565G>C	10.37:g.124596954C>G	ENSP00000357900:p.Asp189His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_ZP_dom,pfam_CUB,superfamily_CUB,smart_CUB,smart_ZP_dom,pfscan_CUB,pfscan_ZP_dom,prints_ZP_dom	p.D189H	ENST00000368904.1	37	c.565	CCDS7631.1	10	.	.	.	.	.	.	.	.	.	.	C	13.09	2.133883	0.37630	.	.	ENSG00000138161	ENST00000368904;ENST00000545804;ENST00000392790	T;T;T	0.35973	1.28;1.28;1.28	4.75	2.88	0.33553	CUB (5);	0.461691	0.23656	N	0.045864	T	0.19685	0.0473	N	0.17312	0.475	0.22541	N	0.999004	B	0.20550	0.046	B	0.17098	0.017	T	0.14008	-1.0488	10	0.62326	D	0.03	-8.1077	5.119	0.14851	0.0:0.5692:0.0:0.4308	.	189	Q86UP6	CUZD1_HUMAN	H	189	ENSP00000357900:D189H;ENSP00000441590:D189H;ENSP00000376540:D189H	ENSP00000357900:D189H	D	-	1	0	CUZD1	124586944	0.008000	0.16893	0.998000	0.56505	0.991000	0.79684	1.518000	0.35877	0.997000	0.38969	0.563000	0.77884	GAT	CUZD1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.453	CUZD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CUZD1	HGNC	protein_coding	OTTHUMT00000050829.2	C	NM_022034		124596954	-1	no_errors	ENST00000368904	ensembl	human	known	70_37	missense	SNP	0.927	G
CXorf65	158830	genome.wustl.edu	37	X	70326096	70326096	+	Intron	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:70326096G>A	ENST00000374251.5	-	2	161					NM_001025265.2	NP_001020436.1	A6NEN9	CX065_HUMAN	chromosome X open reading frame 65											breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(3)	10						AGGATATGAGGAACTCCCTTC	0.507																																																	0																																										SO:0001627	intron_variant	158830			BC144434	CCDS35324.1	Xq13.1	2009-03-06			ENSG00000204165	ENSG00000204165			33713	protein-coding gene	gene with protein product							Standard	NM_001025265		Approved		uc011mpo.2	A6NEN9	OTTHUMG00000021785	ENST00000374251.5:c.112+93C>T	X.37:g.70326096G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000374251.5	37	NULL	CCDS35324.1	X																																																																																			CXorf65	-	-		0.507	CXorf65-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf65	HGNC	protein_coding	OTTHUMT00000057089.2	G	NM_001025265		70326096	-1	no_errors	ENST00000483257	ensembl	human	known	70_37	rna	SNP	0.000	A
CYP20A1	57404	genome.wustl.edu	37	2	204161618	204161618	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:204161618C>G	ENST00000356079.4	+	13	1499	c.1376C>G	c.(1375-1377)tCa>tGa	p.S459*	CYP20A1_ENST00000461371.1_3'UTR|CYP20A1_ENST00000429815.2_Nonsense_Mutation_p.S467*	NM_177538.2	NP_803882.1	Q6UW02	CP20A_HUMAN	cytochrome P450, family 20, subfamily A, polypeptide 1	459						integral component of membrane (GO:0016021)|membrane (GO:0016020)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|monooxygenase activity (GO:0004497)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen (GO:0016705)			cervix(1)|large_intestine(2)|lung(6)|ovary(1)|skin(1)	11						ATCACTGTCTCAAAGAGATAT	0.318																																																	0													66.0	68.0	67.0					2																	204161618		2203	4300	6503	SO:0001587	stop_gained	57404			AK021770	CCDS2357.1	2q33	2008-02-05			ENSG00000119004	ENSG00000119004		"""Cytochrome P450s"""	20576	protein-coding gene	gene with protein product							Standard	NM_177538		Approved	CYP-M	uc002uzv.4	Q6UW02	OTTHUMG00000132854	ENST00000356079.4:c.1376C>G	2.37:g.204161618C>G	ENSP00000348380:p.Ser459*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZG61|Q8N4Q8|Q8WWA9|Q9HC04	Nonsense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_E_grp-IV	p.S459*	ENST00000356079.4	37	c.1376	CCDS2357.1	2	.	.	.	.	.	.	.	.	.	.	C	25.3	4.622470	0.87460	.	.	ENSG00000119004	ENST00000356079;ENST00000421618;ENST00000429815	.	.	.	5.93	5.93	0.95920	.	0.269516	0.37761	N	0.001955	.	.	.	.	.	.	0.45015	D	0.998036	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-7.2043	20.3465	0.98790	0.0:1.0:0.0:0.0	.	.	.	.	X	459;432;467	.	ENSP00000348380:S459X	S	+	2	0	CYP20A1	203869863	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	4.715000	0.61909	2.798000	0.96311	0.655000	0.94253	TCA	CYP20A1	-	superfamily_Cyt_P450		0.318	CYP20A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP20A1	HGNC	protein_coding	OTTHUMT00000256328.3	C	NM_020674		204161618	+1	no_errors	ENST00000356079	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ACKR1	2532	genome.wustl.edu	37	1	159175724	159175724	+	Silent	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:159175724C>A	ENST00000368122.2	+	2	1174	c.495C>A	c.(493-495)ctC>ctA	p.L165L	DARC_ENST00000368121.2_Silent_p.L167L|DARC_ENST00000537147.1_Silent_p.L165L|CTA-134P22.2_ENST00000609696.1_RNA	NM_002036.3	NP_002027.2	Q16570	ACKR1_HUMAN		165					chemokine-mediated signaling pathway (GO:0070098)|defense response (GO:0006952)|inflammatory response (GO:0006954)|regulation of chemokine production (GO:0032642)	endosome (GO:0005768)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	C-C chemokine binding (GO:0019957)|G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(2)|lung(1)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	8	all_hematologic(112;0.0429)					TCCCAGGCCTCACCCTGGGGC	0.622																																																	0													39.0	32.0	34.0					1																	159175724		2203	4300	6503	SO:0001819	synonymous_variant	2532																														ENST00000368122.2:c.495C>A	1.37:g.159175724C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8YPG5|O75898|Q16300|Q8WWE3|Q9UJP0|Q9UKZ5|Q9UKZ6|Q9UQE1	Silent	SNP	prints_Duffy_chemokine_rcpt	p.L167	ENST00000368122.2	37	c.501	CCDS1183.1	1																																																																																			DARC	-	prints_Duffy_chemokine_rcpt		0.622	DARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DARC	HGNC	protein_coding	OTTHUMT00000090338.2	C			159175724	+1	no_errors	ENST00000368121	ensembl	human	known	70_37	silent	SNP	0.077	A
DCAF12L2	340578	genome.wustl.edu	37	X	125299852	125299852	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:125299852C>T	ENST00000360028.2	-	1	82	c.56G>A	c.(55-57)gGa>gAa	p.G19E	DCAF12L2_ENST00000538699.1_Missense_Mutation_p.G19E			Q5VW00	DC122_HUMAN	DDB1 and CUL4 associated factor 12-like 2	19										NS(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(36)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(3)	64						GCTCCCGGCTCCCGCCTCGAC	0.731																																																	0													11.0	13.0	12.0					X																	125299852		1878	3755	5633	SO:0001583	missense	340578			AL445072	CCDS43991.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198354	ENSG00000198354		"""WD repeat domain containing"""	32950	protein-coding gene	gene with protein product			"""WD repeat domain 40C"""	WDR40C			Standard	NM_001013628		Approved		uc004euk.2	Q5VW00	OTTHUMG00000022348	ENST00000360028.2:c.56G>A	X.37:g.125299852C>T	ENSP00000353128:p.Gly19Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RN42	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G19E	ENST00000360028.2	37	c.56	CCDS43991.1	X	.	.	.	.	.	.	.	.	.	.	c	11.41	1.630345	0.28978	.	.	ENSG00000198354	ENST00000538699;ENST00000360028	T;T	0.19394	2.15;2.15	2.77	-0.463	0.12164	.	.	.	.	.	T	0.21103	0.0508	L	0.53249	1.67	0.09310	N	1	B	0.20052	0.041	B	0.26517	0.07	T	0.30357	-0.9981	9	0.48119	T	0.1	.	10.0715	0.42337	0.0:0.3339:0.6661:0.0	.	19	Q5VW00	DC122_HUMAN	E	19	ENSP00000441489:G19E;ENSP00000353128:G19E	ENSP00000353128:G19E	G	-	2	0	DCAF12L2	125127533	0.000000	0.05858	0.000000	0.03702	0.128000	0.20619	0.518000	0.22847	-0.211000	0.10124	0.287000	0.19450	GGA	DCAF12L2	-	NULL		0.731	DCAF12L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L2	HGNC	protein_coding	OTTHUMT00000058181.1	C	NM_001013628		125299852	-1	no_errors	ENST00000360028	ensembl	human	known	70_37	missense	SNP	0.000	T
DCLRE1C	64421	genome.wustl.edu	37	10	14995991	14995991	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:14995991G>A	ENST00000378278.2	-	1	56	c.19C>T	c.(19-21)Cag>Tag	p.Q7*	DCLRE1C_ENST00000378254.1_5'UTR|DCLRE1C_ENST00000357717.2_5'UTR|DCLRE1C_ENST00000453695.2_5'UTR|DCLRE1C_ENST00000378246.2_5'UTR|DCLRE1C_ENST00000396817.2_5'UTR|DCLRE1C_ENST00000378258.1_5'UTR|DCLRE1C_ENST00000378255.1_5'UTR|DCLRE1C_ENST00000378249.1_5'UTR|DCLRE1C_ENST00000378289.4_Nonsense_Mutation_p.Q7*			Q96SD1	DCR1C_HUMAN	DNA cross-link repair 1C	7					B cell differentiation (GO:0030183)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|response to ionizing radiation (GO:0010212)|telomere maintenance (GO:0000723)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|single-stranded DNA endodeoxyribonuclease activity (GO:0000014)			breast(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(1)	17						TCGGCCATCTGCCCCTCGAAA	0.622								Non-homologous end-joining																																									0													58.0	62.0	60.0					10																	14995991		2203	4300	6503	SO:0001587	stop_gained	64421			BC022254	CCDS7105.1, CCDS31149.1, CCDS31150.1	10p13	2014-09-17	2010-06-24		ENSG00000152457	ENSG00000152457			17642	protein-coding gene	gene with protein product	"""PSO2 homolog (S. cerevisiae)"""	605988	"""severe combined immunodeficiency, type a (Athabascan)"", ""DNA cross-link repair 1C (PSO2 homolog, S. cerevisiae)"""	SCIDA		11336668, 9443881	Standard	XM_005252558		Approved	ARTEMIS, FLJ11360, SNM1C, A-SCID	uc001inn.3	Q96SD1	OTTHUMG00000017716	ENST00000378278.2:c.19C>T	10.37:g.14995991G>A	ENSP00000367527:p.Gln7*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRT6|Q1HCL2|Q5JSR4|Q5JSR5|Q5JSR7|Q5JSR8|Q5JSR9|Q5JSS0|Q5JSS7|Q6PK14|Q8N101|Q8N132|Q8TBW9|Q9BVW9|Q9HAM4	Nonsense_Mutation	SNP	pfam_DRMBL	p.Q7*	ENST00000378278.2	37	c.19	CCDS31149.1	10	.	.	.	.	.	.	.	.	.	.	G	39	7.315623	0.98207	.	.	ENSG00000152457	ENST00000378289;ENST00000378278	.	.	.	5.74	5.74	0.90152	.	0.052797	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	16.1814	0.81903	0.0:0.1333:0.8667:0.0	.	.	.	.	X	7	.	ENSP00000367527:Q7X	Q	-	1	0	DCLRE1C	15035997	1.000000	0.71417	0.971000	0.41717	0.950000	0.60333	5.327000	0.65881	2.873000	0.98535	0.561000	0.74099	CAG	DCLRE1C	-	NULL		0.622	DCLRE1C-009	KNOWN	basic|appris_principal|CCDS	protein_coding	DCLRE1C	HGNC	protein_coding	OTTHUMT00000046934.1	G	NM_022487		14995991	-1	no_errors	ENST00000378278	ensembl	human	known	70_37	nonsense	SNP	0.993	A
DENND5A	23258	genome.wustl.edu	37	11	9199895	9199895	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:9199895G>C	ENST00000328194.3	-	8	2010	c.1690C>G	c.(1690-1692)Cag>Gag	p.Q564E	DENND5A_ENST00000530044.1_Missense_Mutation_p.Q564E|DENND5A_ENST00000526523.1_5'Flank	NM_001243254.1|NM_015213.3	NP_001230183.1|NP_056028.2	Q6IQ26	DEN5A_HUMAN	DENN/MADD domain containing 5A	564	dDENN. {ECO:0000255|PROSITE- ProRule:PRU00306}.				positive regulation of Rab GTPase activity (GO:0032851)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)			breast(1)|endometrium(7)|kidney(2)|large_intestine(8)|liver(1)|lung(16)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39						GGCTCAGGCTGATCTGACAGA	0.428																																																	0													60.0	56.0	57.0					11																	9199895		2201	4296	6497	SO:0001583	missense	23258			AB029014	CCDS31423.1, CCDS58119.1	11p15.3	2012-10-03	2008-08-14	2008-08-14	ENSG00000184014	ENSG00000184014		"""DENN/MADD domain containing"""	19344	protein-coding gene	gene with protein product			"""RAB6 interacting protein 1"""	RAB6IP1		10470851	Standard	NM_015213		Approved	KIAA1091, FLJ22354, FLJ33829, FLJ43455	uc001mhl.3	Q6IQ26	OTTHUMG00000165716	ENST00000328194.3:c.1690C>G	11.37:g.9199895G>C	ENSP00000328524:p.Gln564Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DJ15|E9PS91|Q96GN3|Q9H6U7|Q9UFV0|Q9UPR1	Missense_Mutation	SNP	pfam_DENN_dom,pfam_Run,pfam_uDENN_dom,pfam_dDENN_dom,pfam_LipOase_LH2,superfamily_Lipase_LipOase,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,smart_Run,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom,pfscan_LipOase_LH2,pfscan_Run	p.Q564E	ENST00000328194.3	37	c.1690	CCDS31423.1	11	.	.	.	.	.	.	.	.	.	.	G	26.4	4.735708	0.89482	.	.	ENSG00000184014	ENST00000328194;ENST00000530044	T;T	0.44881	0.91;0.91	5.31	5.31	0.75309	dDENN (3);	0.000000	0.85682	D	0.000000	T	0.67646	0.2915	M	0.78049	2.395	0.80722	D	1	D;D	0.76494	0.999;0.969	D;D	0.77557	0.99;0.925	T	0.71262	-0.4645	10	0.87932	D	0	.	19.3465	0.94365	0.0:0.0:1.0:0.0	.	564;564	E9PS91;Q6IQ26	.;DEN5A_HUMAN	E	564	ENSP00000328524:Q564E;ENSP00000435866:Q564E	ENSP00000328524:Q564E	Q	-	1	0	DENND5A	9156471	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.852000	0.99516	2.647000	0.89833	0.561000	0.74099	CAG	DENND5A	-	pfam_dDENN_dom,smart_dDENN_dom,pfscan_dDENN_dom		0.428	DENND5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND5A	HGNC	protein_coding	OTTHUMT00000385910.2	G	NM_015213		9199895	-1	no_errors	ENST00000328194	ensembl	human	known	70_37	missense	SNP	1.000	C
DICER1	23405	genome.wustl.edu	37	14	95574809	95574809	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:95574809C>T	ENST00000526495.1	-	17	2579	c.2288G>A	c.(2287-2289)aGa>aAa	p.R763K	DICER1_ENST00000556045.1_5'Flank|DICER1_ENST00000393063.1_Missense_Mutation_p.R763K|DICER1_ENST00000541352.1_Missense_Mutation_p.R763K|DICER1_ENST00000527414.1_Missense_Mutation_p.R763K|DICER1_ENST00000343455.3_Missense_Mutation_p.R763K			Q9UPY3	DICER_HUMAN	dicer 1, ribonuclease type III	763					angiogenesis (GO:0001525)|branching morphogenesis of an epithelial tube (GO:0048754)|cardiac muscle cell development (GO:0055013)|cerebral cortex development (GO:0021987)|defense response to virus (GO:0051607)|embryonic hindlimb morphogenesis (GO:0035116)|gene expression (GO:0010467)|hair follicle cell proliferation (GO:0071335)|hair follicle morphogenesis (GO:0031069)|inner ear receptor cell development (GO:0060119)|intestinal epithelial cell development (GO:0060576)|lung development (GO:0030324)|mRNA stabilization (GO:0048255)|multicellular organism growth (GO:0035264)|negative regulation of Schwann cell proliferation (GO:0010626)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nerve development (GO:0021675)|neuron projection morphogenesis (GO:0048812)|olfactory bulb interneuron differentiation (GO:0021889)|peripheral nervous system myelin formation (GO:0032290)|positive regulation of gene expression (GO:0010628)|positive regulation of miRNA metabolic process (GO:2000630)|positive regulation of myelination (GO:0031643)|positive regulation of Schwann cell differentiation (GO:0014040)|post-embryonic development (GO:0009791)|pre-miRNA processing (GO:0031054)|production of miRNAs involved in gene silencing by miRNA (GO:0035196)|production of siRNA involved in RNA interference (GO:0030422)|regulation of cell cycle (GO:0051726)|regulation of enamel mineralization (GO:0070173)|regulation of neuron differentiation (GO:0045664)|regulation of oligodendrocyte differentiation (GO:0048713)|regulation of viral genome replication (GO:0045069)|reproductive structure development (GO:0048608)|RNA phosphodiester bond hydrolysis (GO:0090501)|RNA phosphodiester bond hydrolysis, endonucleolytic (GO:0090502)|spinal cord motor neuron differentiation (GO:0021522)|spindle assembly (GO:0051225)|spleen development (GO:0048536)|stem cell maintenance (GO:0019827)|targeting of mRNA for destruction involved in RNA interference (GO:0030423)|zygote asymmetric cell division (GO:0010070)	axon (GO:0030424)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|growth cone (GO:0030426)|RISC complex (GO:0016442)	ATP binding (GO:0005524)|double-stranded RNA binding (GO:0003725)|helicase activity (GO:0004386)|metal ion binding (GO:0046872)|miRNA binding (GO:0035198)|ribonuclease III activity (GO:0004525)			NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(1)|central_nervous_system(1)|endometrium(13)|kidney(3)|large_intestine(10)|lung(33)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|upper_aerodigestive_tract(3)	75		all_cancers(154;0.0621)|all_epithelial(191;0.223)		Epithelial(152;0.211)|COAD - Colon adenocarcinoma(157;0.215)		CTGATCAGGTCTGGGATAACT	0.423			"""Mis F, N"""		"""sex cord-stromal tumour, TGCT, embryonal rhadomyosarcoma"""	pleuropulmonary blastoma			Familial Multinodular Goiter ;DICER 1 syndrome																														yes	Rec	yes	Familial Pleuropulmonary Blastoma	14	14q32.13	23405	"""dicer 1, ribonuclease type III """		"""E, M, O"""	0													115.0	104.0	107.0					14																	95574809		2203	4300	6503	SO:0001583	missense	23405	Familial Cancer Database	Adolescent Multinodular Goiter, incl. Multinodular Euthyroid Goiter & Non-Medullary Thyroid Cancer;incl. Pleuropulmonary Blastoma, Familial ; Cystic Nephroma, Familial	AB028449	CCDS9931.1, CCDS55941.1	14q32.13	2014-09-17	2008-02-20		ENSG00000100697	ENSG00000100697			17098	protein-coding gene	gene with protein product	"""dicer 1, double-stranded RNA-specific endoribonuclease"""	606241	"""Dicer1, Dcr-1 homolog (Drosophila)"", ""multinodular goitre 1"""	MNG1		10051563, 10786632, 21205968	Standard	NM_177438		Approved	Dicer, KIAA0928, K12H4.8-LIKE, HERNA	uc001ydw.2	Q9UPY3	OTTHUMG00000166134	ENST00000526495.1:c.2288G>A	14.37:g.95574809C>T	ENSP00000437256:p.Arg763Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2D3|B3KRG4|E0AD28|O95943|Q9UQ02	Missense_Mutation	SNP	pfam_RNase_III_dom,pfam_PAZ,pfam_Dicer_dsRNA_binding_fold,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase/UvrB_dom,superfamily_RNase_III_dom,superfamily_PAZ,smart_Helicase_ATP-bd,smart_Helicase_C,smart_PAZ,smart_RNase_III_dom,smart_Ds-RNA-bd,pfscan_PAZ,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Ds-RNA-bd,pfscan_RNase_III_dom	p.R763K	ENST00000526495.1	37	c.2288	CCDS9931.1	14	.	.	.	.	.	.	.	.	.	.	C	4.754	0.140132	0.09083	.	.	ENSG00000100697	ENST00000343455;ENST00000526495;ENST00000393063;ENST00000527414;ENST00000541352	T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.83	5.65	-0.885	0.10593	.	0.383424	0.32640	N	0.005824	T	0.25082	0.0609	N	0.12746	0.255	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.29579	-1.0007	10	0.05525	T	0.97	-7.3547	10.2639	0.43443	0.0:0.3196:0.0:0.6804	.	763	Q9UPY3	DICER_HUMAN	K	763	ENSP00000343745:R763K;ENSP00000437256:R763K;ENSP00000376783:R763K;ENSP00000435681:R763K;ENSP00000444719:R763K	ENSP00000343745:R763K	R	-	2	0	DICER1	94644562	0.261000	0.24063	0.170000	0.22879	0.978000	0.69477	0.980000	0.29513	-0.289000	0.09038	-0.937000	0.02696	AGA	DICER1	-	NULL		0.423	DICER1-004	KNOWN	alternative_5_UTR|basic|appris_principal|exp_conf|CCDS	protein_coding	DICER1	HGNC	protein_coding	OTTHUMT00000387997.1	C			95574809	-1	no_errors	ENST00000343455	ensembl	human	known	70_37	missense	SNP	0.969	T
DNAAF3	352909	genome.wustl.edu	37	19	55677762	55677762	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:55677762G>C	ENST00000524407.2	-	2	53	c.20C>G	c.(19-21)tCc>tGc	p.S7C	DNAAF3_ENST00000455045.1_5'Flank|DNAAF3_ENST00000527223.2_Missense_Mutation_p.S54C|CTD-2587H24.5_ENST00000591665.1_RNA|DNAAF3_ENST00000391720.4_Missense_Mutation_p.S54C|snoU13_ENST00000459370.1_RNA			Q8N9W5	DAAF3_HUMAN	dynein, axonemal, assembly factor 3	7					axonemal dynein complex assembly (GO:0070286)|motile cilium assembly (GO:0044458)	cytoplasm (GO:0005737)											GCCGCTGCCGGAGCCGGCAGG	0.657											OREG0025679	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													35.0	48.0	44.0					19																	55677762		2015	4162	6177	SO:0001583	missense	352909			AK097388	CCDS12918.2, CCDS58679.1, CCDS58680.1, CCDS59422.1	19q13.42	2012-10-05	2012-03-09	2012-03-09	ENSG00000167646	ENSG00000167646			30492	protein-coding gene	gene with protein product		614566	"""chromosome 19 open reading frame 51"", ""ciliary dyskinesia, primary 2"""	C19orf51, CILD2		22387996	Standard	NM_001256714		Approved	FLJ40069, FLJ36139, PF22, PCD	uc002qjl.2	Q8N9W5	OTTHUMG00000128547	ENST00000524407.2:c.20C>G	19.37:g.55677762G>C	ENSP00000432046:p.Ser7Cys	Somatic	1009	WXS	Illumina HiSeq	Phase_IV	A8MUY0|E3W9A1|E9PAX5|Q6P4F6|Q8N9W0|Q96AR2	Missense_Mutation	SNP	NULL	p.S54C	ENST00000524407.2	37	c.161	CCDS59422.1	19	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875491	0.72180	.	.	ENSG00000167646	ENST00000301249;ENST00000391720;ENST00000528476	T	0.21734	1.99	4.68	3.6	0.41247	.	0.987781	0.08255	N	0.973969	T	0.23572	0.0570	L	0.47716	1.5	0.44417	D	0.997333	B;B;B	0.22683	0.073;0.073;0.073	B;B;B	0.25884	0.064;0.064;0.064	T	0.04373	-1.0956	10	0.66056	D	0.02	-17.1679	11.2675	0.49118	0.0:0.3585:0.6415:0.0	.	54;7;7	E9PAX5;Q8N9W5-3;Q8N9W5	.;.;CS051_HUMAN	C	54	ENSP00000375600:S54C	ENSP00000301249:S54C	S	-	2	0	C19orf51	60369574	0.708000	0.27876	0.551000	0.28230	0.238000	0.25445	1.818000	0.39012	1.273000	0.44346	0.655000	0.94253	TCC	DNAAF3	-	NULL		0.657	DNAAF3-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	DNAAF3	HGNC	protein_coding	OTTHUMT00000250388.5	G	NM_178837		55677762	-1	no_errors	ENST00000527223	ensembl	human	known	70_37	missense	SNP	0.582	C
DNAI1	27019	genome.wustl.edu	37	9	34500823	34500823	+	Silent	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:34500823C>G	ENST00000242317.4	+	11	1176	c.1005C>G	c.(1003-1005)gtC>gtG	p.V335V		NM_001281428.1|NM_012144.2	NP_001268357.1|NP_036276.1	Q9UI46	DNAI1_HUMAN	dynein, axonemal, intermediate chain 1	335			V -> I (in dbSNP:rs11793196).		cell projection organization (GO:0030030)|epithelial cilium movement (GO:0003351)|metabolic process (GO:0008152)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dynein complex (GO:0030286)|microtubule (GO:0005874)	motor activity (GO:0003774)			autonomic_ganglia(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|prostate(1)|skin(2)|urinary_tract(1)	34	all_epithelial(49;0.244)		LUSC - Lung squamous cell carcinoma(29;0.0107)|STAD - Stomach adenocarcinoma(86;0.212)	GBM - Glioblastoma multiforme(74;0.0222)		GCCTGTCCGTCACTGCCCTCT	0.542									Kartagener syndrome		OREG0019152	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													62.0	62.0	62.0					9																	34500823		2203	4300	6503	SO:0001819	synonymous_variant	27019	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF091619	CCDS6557.1, CCDS75829.1	9p13.3	2013-02-19	2006-09-04		ENSG00000122735	ENSG00000122735		"""Axonemal dyneins"", ""WD repeat domain containing"""	2954	protein-coding gene	gene with protein product		604366	"""dynein, axonemal, intermediate polypeptide 1"""			10577904, 21953912	Standard	NM_012144		Approved	DIC1, PCD, CILD1	uc003zum.3	Q9UI46	OTTHUMG00000019825	ENST00000242317.4:c.1005C>G	9.37:g.34500823C>G		Somatic	848	WXS	Illumina HiSeq	Phase_IV	B7Z7U1|Q5T8G7|Q8NHQ7|Q9UEZ8	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V335	ENST00000242317.4	37	c.1005	CCDS6557.1	9																																																																																			DNAI1	-	superfamily_WD40_repeat_dom		0.542	DNAI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAI1	HGNC	protein_coding	OTTHUMT00000052192.1	C			34500823	+1	no_errors	ENST00000242317	ensembl	human	known	70_37	silent	SNP	1.000	G
DNAI2	64446	genome.wustl.edu	37	17	72285751	72285751	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:72285751G>C	ENST00000311014.6	+	5	553	c.486G>C	c.(484-486)aaG>aaC	p.K162N	DNAI2_ENST00000446837.2_Missense_Mutation_p.K162N|DNAI2_ENST00000307504.5_Missense_Mutation_p.K19N|DNAI2_ENST00000579490.1_Missense_Mutation_p.K219N|DNAI2_ENST00000582036.1_Missense_Mutation_p.K162N			Q9GZS0	DNAI2_HUMAN	dynein, axonemal, intermediate chain 2	162					cilium assembly (GO:0042384)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|axoneme (GO:0005930)|microtubule (GO:0005874)	microtubule motor activity (GO:0003777)			breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(6)|liver(2)|lung(19)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	39						AGGAAATCAAGAGGGCTGCCA	0.552									Kartagener syndrome																																								0													46.0	47.0	46.0					17																	72285751		2203	4300	6503	SO:0001583	missense	64446	Familial Cancer Database	Ciliary Dyskinesia, Primary (CILD1 - CILD13), Immotile Cilia Syndrome	AF250288	CCDS11697.1, CCDS58589.1	17q25	2013-02-19	2006-09-04			ENSG00000171595		"""Axonemal dyneins"", ""WD repeat domain containing"""	18744	protein-coding gene	gene with protein product	"""dynein intermediate chain 2"""	605483	"""dynein, axonemal, intermediate polypeptide 2"""			11153919, 21953912	Standard	NM_023036		Approved	CILD9, DIC2	uc002jkf.3	Q9GZS0		ENST00000311014.6:c.486G>C	17.37:g.72285751G>C	ENSP00000308312:p.Lys162Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J0S6|Q8IUW4|Q9H179|Q9NT53	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.K162N	ENST00000311014.6	37	c.486	CCDS11697.1	17	.	.	.	.	.	.	.	.	.	.	G	16.45	3.127934	0.56721	.	.	ENSG00000171595	ENST00000311014;ENST00000307504;ENST00000446837	T;T;T	0.15834	2.39;2.39;2.39	5.14	1.68	0.24146	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.089346	0.85682	D	0.000000	T	0.41190	0.1148	M	0.92833	3.35	0.46823	D	0.999216	P	0.51653	0.947	P	0.58820	0.846	T	0.39482	-0.9612	10	0.66056	D	0.02	-36.2084	7.6797	0.28507	0.4555:0.0:0.5445:0.0	.	162	Q9GZS0	DNAI2_HUMAN	N	162;19;162	ENSP00000308312:K162N;ENSP00000302929:K19N;ENSP00000400252:K162N	ENSP00000302929:K19N	K	+	3	2	DNAI2	69797346	1.000000	0.71417	0.986000	0.45419	0.672000	0.39443	1.307000	0.33516	0.569000	0.29329	0.313000	0.20887	AAG	DNAI2	-	superfamily_WD40_repeat_dom		0.552	DNAI2-001	KNOWN	NMD_exception|basic|appris_candidate_longest|CCDS	protein_coding	DNAI2	HGNC	protein_coding	OTTHUMT00000442537.1	G	NM_023036		72285751	+1	no_errors	ENST00000311014	ensembl	human	known	70_37	missense	SNP	0.999	C
ECE2	9718	genome.wustl.edu	37	3	183996310	183996310	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:183996310C>T	ENST00000402825.3	+	7	1135	c.1135C>T	c.(1135-1137)Cgg>Tgg	p.R379W	ECE2_ENST00000357474.5_Missense_Mutation_p.R307W|EIF2B5_ENST00000444495.1_Intron|ECE2_ENST00000404464.3_Missense_Mutation_p.R261W|ECE2_ENST00000359140.4_Missense_Mutation_p.R232W	NM_014693.3	NP_055508.3	O60344	ECE2_HUMAN	endothelin converting enzyme 2	379	Endothelin-converting enzyme 2 region.				brain development (GO:0007420)|cardioblast differentiation (GO:0010002)|cell-cell signaling (GO:0007267)|heart development (GO:0007507)|peptide hormone processing (GO:0016486)	cytoplasmic vesicle membrane (GO:0030659)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|methyltransferase activity (GO:0008168)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|lung(13)|ovary(3)|prostate(1)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(4)	49	all_cancers(143;1.39e-10)|Ovarian(172;0.0339)		Epithelial(37;8.28e-34)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			TCTGCCCTCTCGGGATTACTA	0.552																																																	0													90.0	86.0	88.0					3																	183996310		2203	4300	6503	SO:0001583	missense	9718			AF428263	CCDS3255.1, CCDS33899.1, CCDS3256.2, CCDS43179.1, CCDS46969.1	3q27.1	2007-07-26			ENSG00000145194	ENSG00000145194			13275	protein-coding gene	gene with protein product		610145				11718899	Standard	NM_032331		Approved	KIAA0604, MGC2408	uc003fni.4	O60344	OTTHUMG00000150551	ENST00000402825.3:c.1135C>T	3.37:g.183996310C>T	ENSP00000384223:p.Arg379Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PLK8|Q6NTG7|Q6UW36|Q8NFD7|Q96NX3|Q96NX4|Q9BRZ8	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,pfam_Methyltransf_11,prints_Peptidase_M13_C	p.R379W	ENST00000402825.3	37	c.1135	CCDS3256.2	3	.	.	.	.	.	.	.	.	.	.	C	19.21	3.783872	0.70222	.	.	ENSG00000145194	ENST00000402825;ENST00000359140;ENST00000404464;ENST00000357474;ENST00000430587	D;D;D;D;D	0.84516	-1.86;-1.86;-1.86;-1.86;-1.86	4.97	4.03	0.46877	Peptidase M13 (1);	0.000000	0.85682	D	0.000000	D	0.93766	0.8007	H	0.94542	3.55	0.58432	D	0.999993	D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D	0.97110	0.999;1.0;0.994;0.998;0.991;0.999	D	0.94537	0.7741	10	0.87932	D	0	-10.0304	12.3041	0.54891	0.2464:0.7536:0.0:0.0	.	232;307;261;307;232;379	B4DKF3;B7Z1P1;O60344-2;O60344-5;O60344-3;O60344	.;.;.;.;.;ECE2_HUMAN	W	379;232;261;307;253	ENSP00000384223:R379W;ENSP00000352052:R232W;ENSP00000385846:R261W;ENSP00000350066:R307W;ENSP00000398444:R253W	ENSP00000350066:R307W	R	+	1	2	ECE2	185479004	0.075000	0.21258	1.000000	0.80357	0.995000	0.86356	0.341000	0.19909	2.596000	0.87737	0.561000	0.74099	CGG	ECE2	-	pfam_Peptidase_M13_N		0.552	ECE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECE2	HGNC	protein_coding	OTTHUMT00000318874.3	C	NM_014693		183996310	+1	no_errors	ENST00000402825	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAJB11	51726	genome.wustl.edu	37	3	186303135	186303135	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:186303135A>G	ENST00000439351.1	+	11	1944	c.1015A>G	c.(1015-1017)Atc>Gtc	p.I339V	DNAJB11_ENST00000265028.3_Missense_Mutation_p.I339V			Q9UBS4	DJB11_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 11	339					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|mRNA modification (GO:0016556)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|urinary_tract(2)	15	all_cancers(143;2.84e-12)|Ovarian(172;0.0339)		OV - Ovarian serous cystadenocarcinoma(80;1.44e-20)	GBM - Glioblastoma multiforme(93;0.0476)		TTCTTCAGGTATCAAACAGCT	0.328																																																	0													145.0	136.0	139.0					3																	186303135		2203	4300	6503	SO:0001583	missense	51726			AB028859	CCDS3277.1	3q27	2011-09-02			ENSG00000090520	ENSG00000090520		"""Heat shock proteins / DNAJ (HSP40)"""	14889	protein-coding gene	gene with protein product		611341				10827079, 11147971	Standard	NM_016306		Approved	EDJ, HEDJ, ERdj3	uc003fqi.3	Q9UBS4	OTTHUMG00000156614	ENST00000439351.1:c.1015A>G	3.37:g.186303135A>G	ENSP00000414398:p.Ile339Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q542Y5|Q542Y9|Q6IAQ8|Q96JC6	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.I339V	ENST00000439351.1	37	c.1015	CCDS3277.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	2.717|2.717	-0.267375|-0.267375	0.05754|0.05754	.|.	.|.	ENSG00000090520|ENSG00000090520	ENST00000439351;ENST00000265028|ENST00000418776	T;T|.	0.68479|.	-0.33;-0.33|.	6.07|6.07	2.39|2.39	0.29439|0.29439	HSP40/DnaJ peptide-binding (1);|.	0.147481|.	0.64402|.	N|.	0.000010|.	T|T	0.37156|0.37156	0.0993|0.0993	N|N	0.25060|0.25060	0.705|0.705	0.80722|0.80722	D|D	1|1	B|.	0.02656|.	0.0|.	B|.	0.08055|.	0.003|.	T|T	0.06092|0.06092	-1.0846|-1.0846	10|5	0.62326|.	D|.	0.03|.	-6.5854|-6.5854	5.1429|5.1429	0.14969|0.14969	0.6904:0.1526:0.157:0.0|0.6904:0.1526:0.157:0.0	.|.	339|.	Q9UBS4|.	DJB11_HUMAN|.	V|C	339|139	ENSP00000414398:I339V;ENSP00000265028:I339V|.	ENSP00000265028:I339V|.	I|Y	+|+	1|2	0|0	DNAJB11|DNAJB11	187785829|187785829	1.000000|1.000000	0.71417|0.71417	0.997000|0.997000	0.53966|0.53966	0.151000|0.151000	0.21798|0.21798	1.180000|1.180000	0.32005|0.32005	0.176000|0.176000	0.19873|0.19873	-0.250000|-0.250000	0.11733|0.11733	ATC|TAT	DNAJB11	-	superfamily_HSP40/DnaJ_pept-bd		0.328	DNAJB11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB11	HGNC	protein_coding	OTTHUMT00000344779.1	A			186303135	+1	no_errors	ENST00000265028	ensembl	human	known	70_37	missense	SNP	1.000	G
EHMT2	10919	genome.wustl.edu	37	6	31848475	31848475	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:31848475C>G	ENST00000375537.4	-	27	3433	c.3427G>C	c.(3427-3429)Gac>Cac	p.D1143H	SLC44A4_ENST00000465707.1_5'Flank|EHMT2_ENST00000395728.3_Missense_Mutation_p.D1200H|EHMT2_ENST00000480912.1_5'UTR|EHMT2_ENST00000375528.4_Missense_Mutation_p.D1166H|SLC44A4_ENST00000375562.4_5'Flank|EHMT2_ENST00000375530.4_Missense_Mutation_p.D1109H|SLC44A4_ENST00000229729.6_5'Flank	NM_006709.3	NP_006700.3	Q96KQ7	EHMT2_HUMAN	euchromatic histone-lysine N-methyltransferase 2	1143	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				DNA methylation (GO:0006306)|DNA methylation on cytosine within a CG sequence (GO:0010424)|fertilization (GO:0009566)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|organ growth (GO:0035265)|peptidyl-lysine dimethylation (GO:0018027)|regulation of DNA replication (GO:0006275)|spermatid development (GO:0007286)|synaptonemal complex assembly (GO:0007130)	chromosome (GO:0005694)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(2)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)	21						GTCCGGATGTCTCGGGAACTG	0.592																																																	0													86.0	83.0	84.0					6																	31848475		2203	4300	6503	SO:0001583	missense	10919			AF134726	CCDS4725.1, CCDS4726.1, CCDS75425.1	6p21.3	2013-01-10	2004-03-22	2005-06-09	ENSG00000204371	ENSG00000204371	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	14129	protein-coding gene	gene with protein product		604599	"""chromosome 6 open reading frame 30"", ""HLA-B associated transcript 8"""	C6orf30, BAT8		8457211, 11316813	Standard	XM_005274833		Approved	G9A, Em:AF134726.3, NG36/G9a, KMT1C	uc003nxz.1	Q96KQ7	OTTHUMG00000031180	ENST00000375537.4:c.3427G>C	6.37:g.31848475C>G	ENSP00000364687:p.Asp1143His	Somatic		WXS	Illumina HiSeq	Phase_IV	B0UZY2|Q14349|Q5JP83|Q5JQ92|Q5JQA1|Q5JQG3|Q6PK06|Q96MH5|Q96QD0|Q9UQL8|Q9Y331	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.D1200H	ENST00000375537.4	37	c.3598	CCDS4725.1	6	.	.	.	.	.	.	.	.	.	.	C	20.3	3.965908	0.74131	.	.	ENSG00000204371	ENST00000395728;ENST00000375528;ENST00000375530;ENST00000375537;ENST00000442298	D;D;D;D	0.92446	-3.04;-3.04;-3.04;-3.04	4.21	4.21	0.49690	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.87853	0.6282	L	0.58810	1.83	0.80722	D	1	B;B;B;P	0.36495	0.057;0.078;0.127;0.556	B;B;B;B	0.39419	0.049;0.068;0.173;0.299	D	0.87812	0.2632	10	0.35671	T	0.21	.	15.8428	0.78864	0.0:1.0:0.0:0.0	.	1166;1109;1143;964	A2ABF8;Q96KQ7-2;Q96KQ7;Q59FM7	.;.;EHMT2_HUMAN;.	H	1200;1166;1109;1143;964	ENSP00000379078:D1200H;ENSP00000364678:D1166H;ENSP00000364680:D1109H;ENSP00000364687:D1143H	ENSP00000364678:D1166H	D	-	1	0	EHMT2	31956454	0.998000	0.40836	1.000000	0.80357	0.997000	0.91878	3.718000	0.54919	2.355000	0.79922	0.561000	0.74099	GAC	EHMT2	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom		0.592	EHMT2-001	KNOWN	basic|CCDS	protein_coding	EHMT2	HGNC	protein_coding	OTTHUMT00000076355.5	C	NM_006709		31848475	-1	no_errors	ENST00000395728	ensembl	human	known	70_37	missense	SNP	1.000	G
NANOS1	340719	genome.wustl.edu	37	10	120796821	120796821	+	IGR	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:120796821C>T	ENST00000425699.1	+	0	4627				EIF3A_ENST00000541549.1_Splice_Site_p.R1209R|EIF3A_ENST00000369144.3_Splice_Site_p.R1243R	NM_199461.2	NP_955631.1	Q8WY41	NANO1_HUMAN	nanos homolog 1 (Drosophila)						cell migration (GO:0016477)|epithelial cell migration (GO:0010631)|negative regulation of translation (GO:0017148)	cytoplasm (GO:0005737)|perinuclear region of cytoplasm (GO:0048471)	RNA binding (GO:0003723)|translation repressor activity (GO:0030371)|zinc ion binding (GO:0008270)			lung(1)	1		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0193)		CACCTTCATCCCTGTAGCCAT	0.478																																																	0													59.0	55.0	56.0					10																	120796821		2203	4300	6503	SO:0001628	intergenic_variant	8661			AF275269	CCDS7607.1	10q26.13	2003-12-01			ENSG00000188613	ENSG00000188613			23044	protein-coding gene	gene with protein product		608226				12690449	Standard	NM_199461		Approved	NOS1	uc009xzf.1	Q8WY41	OTTHUMG00000019141		10.37:g.120796821C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_PCI_dom,smart_PCI_dom	p.R1243	ENST00000425699.1	37	c.3729	CCDS7607.1	10																																																																																			EIF3A	-	NULL		0.478	NANOS1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3A	HGNC	protein_coding	OTTHUMT00000110794.1	C			120796821	-1	no_errors	ENST00000369144	ensembl	human	known	70_37	silent	SNP	1.000	T
EIF3B	8662	genome.wustl.edu	37	7	2412417	2412417	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:2412417G>A	ENST00000360876.4	+	12	1853	c.1797G>A	c.(1795-1797)aaG>aaA	p.K599K	EIF3B_ENST00000397011.2_Silent_p.K599K	NM_001037283.1	NP_001032360.1			eukaryotic translation initiation factor 3, subunit B											breast(2)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|skin(1)	24		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0833)|OV - Ovarian serous cystadenocarcinoma(56;7.76e-14)		ACAACGGGAAGATTGAACTCA	0.502																																																	0													97.0	86.0	89.0					7																	2412417		2203	4300	6503	SO:0001819	synonymous_variant	8662			U62583	CCDS5332.1	7p22	2013-02-12	2007-07-27	2007-07-27	ENSG00000106263	ENSG00000106263		"""RNA binding motif (RRM) containing"""	3280	protein-coding gene	gene with protein product		603917	"""eukaryotic translation initiation factor 3, subunit 9 eta, 116kDa"""	EIF3S9		8995410	Standard	NM_001037283		Approved	PRT1, eIF3b	uc003sly.3	P55884	OTTHUMG00000022839	ENST00000360876.4:c.1797G>A	7.37:g.2412417G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_TIF2A_beta_prop-like,pfam_RRM_dom,smart_RRM_dom,pirsf_eIF3b,pfscan_RRM_dom	p.K599	ENST00000360876.4	37	c.1797	CCDS5332.1	7																																																																																			EIF3B	-	pfam_TIF2A_beta_prop-like,pirsf_eIF3b		0.502	EIF3B-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	EIF3B	HGNC	protein_coding	OTTHUMT00000207006.1	G			2412417	+1	no_errors	ENST00000360876	ensembl	human	known	70_37	silent	SNP	0.999	A
EIF3E	3646	genome.wustl.edu	37	8	109226922	109226922	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:109226922C>T	ENST00000220849.5	-	10	1037	c.975G>A	c.(973-975)ttG>ttA	p.L325L	EIF3E_ENST00000519030.1_Silent_p.L232L|EIF3E_ENST00000519517.1_5'UTR	NM_001568.2	NP_001559.1			eukaryotic translation initiation factor 3, subunit E										EIF3E/RSPO2(6)	NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(2)|lung(10)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	30			OV - Ovarian serous cystadenocarcinoma(57;6.84e-10)			GACAAGCCACCAAGAAGAAGT	0.383																																					GBM(15;360 410 8460 34179 52246)												0													91.0	85.0	87.0					8																	109226922		2203	4300	6503	SO:0001819	synonymous_variant	3646			U94175	CCDS6308.1	8q22-q23	2010-03-10	2007-07-27	2007-07-27	ENSG00000104408	ENSG00000104408			3277	protein-coding gene	gene with protein product		602210	"""eukaryotic translation initiation factor 3, subunit 6 48kDa"""	INT6, EIF3S6		9403073, 9295280	Standard	NM_001568		Approved	eIF3-p48, eIF3e	uc003ymu.3	P60228	OTTHUMG00000164858	ENST00000220849.5:c.975G>A	8.37:g.109226922C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_eIF3_su6_N,pfam_PCI_dom,smart_PCI_dom,pirsf_Transl_init_fac_3_su6_euk	p.L325	ENST00000220849.5	37	c.975	CCDS6308.1	8																																																																																			EIF3E	-	pfam_PCI_dom,pirsf_Transl_init_fac_3_su6_euk		0.383	EIF3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3E	HGNC	protein_coding	OTTHUMT00000380612.2	C	NM_001568		109226922	-1	no_errors	ENST00000220849	ensembl	human	known	70_37	silent	SNP	1.000	T
ELAVL3	1995	genome.wustl.edu	37	19	11565683	11565683	+	Silent	SNP	C	C	T	rs567829899		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:11565683C>T	ENST00000359227.3	-	7	1186	c.762G>A	c.(760-762)tcG>tcA	p.S254S	ELAVL3_ENST00000438662.2_Intron	NM_001420.3|NM_032281.2	NP_001411.2|NP_115657.2	Q14576	ELAV3_HUMAN	ELAV like neuron-specific RNA binding protein 3	254					cell differentiation (GO:0030154)|nervous system development (GO:0007399)		AU-rich element binding (GO:0017091)|nucleotide binding (GO:0000166)			breast(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	15						TGGCGATGAGCGACAGGGGAC	0.677																																																	0													120.0	135.0	130.0					19																	11565683		2201	4289	6490	SO:0001819	synonymous_variant	1995				CCDS32912.1, CCDS45978.1	19p13.2	2013-10-03	2013-10-03			ENSG00000196361		"""RNA binding motif (RRM) containing"""	3314	protein-coding gene	gene with protein product	"""Hu antigen C"", ""paraneoplastic limbic encephalitis antigen 21"", ""paraneoplastic cerebellar degeneration-associated antigen"", ""ELAV-like protein 3"""	603458	"""ELAV (embryonic lethal, abnormal vision, Drosophila)-like 3 (Hu antigen C)"""			9799595	Standard	NM_001420		Approved	HUC, PLE21, DKFZp547J036, HUCL, MGC20653	uc002mry.1	Q14576		ENST00000359227.3:c.762G>A	19.37:g.11565683C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16135|Q96CL8|Q96QS9	Silent	SNP	pfam_RRM_dom,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom,prints_Hud_Sxl_RNA,tigrfam_ELAD_HUD_SF	p.S254	ENST00000359227.3	37	c.762	CCDS32912.1	19																																																																																			ELAVL3	-	tigrfam_ELAD_HUD_SF		0.677	ELAVL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELAVL3	HGNC	protein_coding	OTTHUMT00000458827.2	C	NM_001420		11565683	-1	no_errors	ENST00000359227	ensembl	human	known	70_37	silent	SNP	1.000	T
RP11-213G2.2	0	genome.wustl.edu	37	9	88401416	88401416	+	lincRNA	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:88401416C>G	ENST00000443630.1	-	0	253																											TTGCGACGTTCCAGTCTTGGA	0.408																																																	0																																												0																															9.37:g.88401416C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000443630.1	37	NULL		9																																																																																			RP11-213G2.2	-	-		0.408	RP11-213G2.2-003	KNOWN	basic	lincRNA	ENSG00000230303	Clone_based_vega_gene	lincRNA	OTTHUMT00000052899.1	C			88401416	-1	no_errors	ENST00000418478	ensembl	human	known	70_37	rna	SNP	0.013	G
AC015849.16	0	genome.wustl.edu	37	17	34233677	34233677	+	lincRNA	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:34233677C>G	ENST00000587132.1	-	0	4350																											AAGGTCCAGTCTCTTCCGATG	0.522																																																	0																																												0																															17.37:g.34233677C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000587132.1	37	NULL		17																																																																																			AC015849.16	-	-		0.522	AC015849.16-001	KNOWN	basic	lincRNA	ENSG00000266999	Clone_based_vega_gene	lincRNA	OTTHUMT00000449325.1	C			34233677	-1	no_errors	ENST00000587132	ensembl	human	known	70_37	rna	SNP	0.001	G
HSD17B1	3292	genome.wustl.edu	37	17	40705355	40705355	+	Intron	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:40705355C>T	ENST00000585807.1	+	2	3985				HSD17B1_ENST00000225929.5_Intron|RP11-400F19.8_ENST00000585572.1_RNA|RP11-400F19.6_ENST00000590513.1_RNA	NM_000413.2	NP_000404.2	P14061	DHB1_HUMAN	hydroxysteroid (17-beta) dehydrogenase 1						bone development (GO:0060348)|cellular response to metal ion (GO:0071248)|estrogen biosynthetic process (GO:0006703)|estrogen metabolic process (GO:0008210)|small molecule metabolic process (GO:0044281)|steroid biosynthetic process (GO:0006694)|steroid metabolic process (GO:0008202)|testosterone biosynthetic process (GO:0061370)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|estradiol 17-beta-dehydrogenase activity (GO:0004303)			NS(1)|endometrium(1)|kidney(1)|lung(2)	5		all_cancers(22;5.59e-08)|all_epithelial(22;7e-07)|Ovarian(249;0.0261)		BRCA - Breast invasive adenocarcinoma(366;0.129)	Equilin(DB02187)	CTTCTCCGCCCTGCGTTGAAA	0.662																																																	0													16.0	19.0	18.0					17																	40705355		2200	4298	6498	SO:0001627	intron_variant	0				CCDS11428.1	17q11-q21	2011-09-14					1.1.1.62	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	5210	protein-coding gene	gene with protein product	"""Estradiol 17-beta-dehydrogenase-1"", ""short chain dehydrogenase/reductase family 28CE, member 1"""	109684		EDHB17, EDH17B2		2330005, 19027726	Standard	NM_000413		Approved	HSD17, MGC138140, SDR28C1	uc002hzw.3	P14061		ENST00000585807.1:c.265+46C>T	17.37:g.40705355C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXS1|Q2M2L8	RNA	SNP	-	NULL	ENST00000585807.1	37	NULL	CCDS11428.1	17																																																																																			RP11-400F19.6	-	-		0.662	HSD17B1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000266962	Clone_based_vega_gene	protein_coding	OTTHUMT00000450392.1	C	NM_000413		40705355	-1	no_errors	ENST00000590513	ensembl	human	known	70_37	rna	SNP	0.002	T
EP300	2033	genome.wustl.edu	37	22	41525927	41525927	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:41525927C>G	ENST00000263253.7	+	5	2421	c.1202C>G	c.(1201-1203)tCa>tGa	p.S401*		NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	401					apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						CAAATCATTTCACACTGGAAG	0.358			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													125.0	113.0	117.0					22																	41525927		2203	4300	6503	SO:0001587	stop_gained	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.1202C>G	22.37:g.41525927C>G	ENSP00000263253:p.Ser401*	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKC2	Nonsense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.S401*	ENST00000263253.7	37	c.1202	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	C	49	15.345542	0.99831	.	.	ENSG00000100393	ENST00000263253	.	.	.	5.6	5.6	0.85130	.	0.000000	0.41938	D	0.000790	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.1837	19.9823	0.97331	0.0:1.0:0.0:0.0	.	.	.	.	X	401	.	ENSP00000263253:S401X	S	+	2	0	EP300	39855873	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.818000	0.86416	2.788000	0.95919	0.650000	0.86243	TCA	EP300	-	pfam_Znf_TAZ,superfamily_Znf_TAZ,smart_Znf_TAZ,pfscan_Znf_TAZ		0.358	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	C	NM_001429		41525927	+1	no_errors	ENST00000263253	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ERVW-1	30816	genome.wustl.edu	37	7	92098668	92098668	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:92098668G>A	ENST00000493463.2	-	1	1951	c.1028C>T	c.(1027-1029)tCt>tTt	p.S343F	AC007566.10_ENST00000427458.1_RNA|ERVW-1_ENST00000604270.1_Intron|ERVW-1_ENST00000603053.1_Missense_Mutation_p.S343F	NM_014590.3	NP_055405.3	Q9UQF0	SYCY1_HUMAN	endogenous retrovirus group W, member 1	343					anatomical structure morphogenesis (GO:0009653)|syncytium formation (GO:0006949)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|viral envelope (GO:0019031)				endometrium(1)|large_intestine(1)|lung(15)	17						gaactgagtagaggttgtgat	0.473																																																	0													109.0	112.0	111.0					7																	92098668		2203	4300	6503	SO:0001583	missense	30816			AF208161	CCDS5626.1	7q21.2	2011-06-16	2011-05-05	2011-05-05	ENSG00000242950	ENSG00000242950			13525	other	endogenous retrovirus	"""envelope protein"", ""HERV-W Env glycoprotein"", ""enverin"", ""syncytin-1"", ""HERV-tryptophan envelope protein"", ""HERV-W{7q21.1} provirus ancestral Env polyprotein"", ""HERV-7q envelope protein"", ""envelope glycoprotein"", ""syncytin"""	604659	"""endogenous retroviral family W, env(C7), member 1"""	ERVWE1		9835022, 9882319, 21542922	Standard	NM_001130925		Approved	HERV-W, HERV-W-ENV, HERVW, HERV-7q	uc022ahe.1	Q9UQF0	OTTHUMG00000131249	ENST00000493463.2:c.1028C>T	7.37:g.92098668G>A	ENSP00000419945:p.Ser343Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPD4|O95244|O95245|Q8NHY7|Q9NRZ2|Q9NZG3	Missense_Mutation	SNP	pfam_TLV/ENV_coat_polyprotein	p.S343F	ENST00000493463.2	37	c.1028	CCDS5626.1	7	.	.	.	.	.	.	.	.	.	.	G	10.34	1.322507	0.23994	.	.	ENSG00000242950	ENST00000493463	T	0.20332	2.08	0.0465	0.0465	0.14256	.	1.345460	0.06467	U	0.730514	T	0.27489	0.0675	L	0.60957	1.885	0.20196	N	0.999923	.	.	.	.	.	.	T	0.39881	-0.9592	7	0.87932	D	0	.	.	.	.	.	.	.	.	F	343	ENSP00000419945:S343F	ENSP00000419945:S343F	S	-	2	0	ERVW-1	91936604	0.419000	0.25449	0.502000	0.27614	0.504000	0.33889	0.170000	0.16663	0.132000	0.18615	0.134000	0.15878	TCT	ERVW-1	-	pfam_TLV/ENV_coat_polyprotein		0.473	ERVW-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERVW-1	HGNC	protein_coding	OTTHUMT00000254009.2	G	NM_014590		92098668	-1	no_errors	ENST00000493463	ensembl	human	known	70_37	missense	SNP	0.535	A
ESPN	83715	genome.wustl.edu	37	1	6504554	6504554	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:6504554G>A	ENST00000377828.1	+	6	1172	c.1004G>A	c.(1003-1005)cGc>cAc	p.R335H	RP1-202O8.2_ENST00000419034.1_RNA	NM_031475.2	NP_113663.2	B1AK53	ESPN_HUMAN	espin	335					locomotory behavior (GO:0007626)|negative regulation of cytoskeleton organization (GO:0051494)|parallel actin filament bundle assembly (GO:0030046)|positive regulation of filopodium assembly (GO:0051491)|sensory perception of sound (GO:0007605)	brush border (GO:0005903)|cytoplasm (GO:0005737)|filamentous actin (GO:0031941)|microvillus (GO:0005902)|stereocilium bundle tip (GO:0032426)	actin filament binding (GO:0051015)|SH3 domain binding (GO:0017124)			NS(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)	17	Ovarian(185;0.0386)|all_lung(157;0.154)	all_cancers(23;3.6e-37)|all_epithelial(116;2.56e-22)|all_lung(118;7.57e-07)|Lung NSC(185;4.26e-06)|all_hematologic(16;6.92e-06)|Colorectal(325;4.47e-05)|Acute lymphoblastic leukemia(12;4.92e-05)|Breast(487;7.61e-05)|Renal(390;0.0007)|Hepatocellular(190;0.00308)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0392)		Epithelial(90;1.82e-35)|GBM - Glioblastoma multiforme(13;3e-28)|Kidney(185;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(229;5.63e-08)|Colorectal(212;7e-08)|COAD - Colon adenocarcinoma(227;1.41e-05)|BRCA - Breast invasive adenocarcinoma(365;0.000109)|STAD - Stomach adenocarcinoma(132;0.00167)|Lung(427;0.0108)|LUSC - Lung squamous cell carcinoma(448;0.0253)|READ - Rectum adenocarcinoma(331;0.0419)		GTGGAGCACCGCGTGCTTTCC	0.602																																																	0													70.0	54.0	60.0					1																	6504554		2203	4300	6503	SO:0001583	missense	83715			AF134401	CCDS70.1	1p36.31	2013-01-10			ENSG00000187017	ENSG00000187017		"""Ankyrin repeat domain containing"""	13281	protein-coding gene	gene with protein product		606351	"""deafness, autosomal recessive 36"""	DFNB36		10975527, 15286153	Standard	NM_031475		Approved		uc001amy.3	B1AK53	OTTHUMG00000000753	ENST00000377828.1:c.1004G>A	1.37:g.6504554G>A	ENSP00000367059:p.Arg335His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6XYB2|Q9H0A2|Q9Y329	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_WH2_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_WH2_dom	p.R335H	ENST00000377828.1	37	c.1004	CCDS70.1	1	.	.	.	.	.	.	.	.	.	.	g	25.8	4.673980	0.88445	.	.	ENSG00000187017	ENST00000377828;ENST00000418286	D;D	0.93366	-3.21;-3.21	3.62	3.62	0.41486	Ankyrin repeat-containing domain (1);	0.000000	0.53938	U	0.000045	D	0.93828	0.8026	L	0.36672	1.1	0.80722	D	1	D	0.89917	1.0	D	0.65874	0.939	D	0.94190	0.7440	10	0.59425	D	0.04	-7.6877	14.0147	0.64517	0.0:0.0:1.0:0.0	.	335	B1AK53	ESPN_HUMAN	H	335;120	ENSP00000367059:R335H;ENSP00000401793:R120H	ENSP00000367059:R335H	R	+	2	0	ESPN	6427141	1.000000	0.71417	0.957000	0.39632	0.771000	0.43674	6.956000	0.76013	1.866000	0.54105	0.486000	0.48141	CGC	ESPN	-	superfamily_Ankyrin_rpt-contain_dom		0.602	ESPN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESPN	HGNC	protein_coding	OTTHUMT00000001887.3	G	NM_031475		6504554	+1	no_errors	ENST00000377828	ensembl	human	known	70_37	missense	SNP	0.997	A
EXPH5	23086	genome.wustl.edu	37	11	108384244	108384244	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:108384244G>A	ENST00000265843.4	-	6	2100	c.1990C>T	c.(1990-1992)Cat>Tat	p.H664Y	EXPH5_ENST00000525344.1_Missense_Mutation_p.H657Y|EXPH5_ENST00000524840.1_5'UTR|EXPH5_ENST00000443411.1_Missense_Mutation_p.H476Y|EXPH5_ENST00000428840.1_Missense_Mutation_p.H588Y	NM_015065.2	NP_055880	Q8NEV8	EXPH5_HUMAN	exophilin 5	664					intracellular protein transport (GO:0006886)|keratinocyte development (GO:0003334)|multivesicular body sorting pathway (GO:0071985)|positive regulation of exocytosis (GO:0045921)|positive regulation of protein secretion (GO:0050714)	endosome (GO:0005768)	Rab GTPase binding (GO:0017137)			breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(13)|liver(1)|lung(34)|ovary(3)|pancreas(2)|prostate(2)|skin(11)|stomach(3)|upper_aerodigestive_tract(1)	91		all_cancers(61;3.99e-08)|Acute lymphoblastic leukemia(157;3.97e-05)|Melanoma(852;4.04e-05)|all_epithelial(67;0.000116)|all_hematologic(158;0.000315)|Breast(348;0.104)|all_neural(303;0.16)		Epithelial(105;8.1e-06)|BRCA - Breast invasive adenocarcinoma(274;1.22e-05)|all cancers(92;0.000129)|OV - Ovarian serous cystadenocarcinoma(223;0.11)|Colorectal(284;0.184)		CTCATTGGATGAGAGGCAGGC	0.453																																																	0													99.0	95.0	97.0					11																	108384244		2201	4298	6499	SO:0001583	missense	23086				CCDS8341.1	11q22.3	2008-02-05			ENSG00000110723	ENSG00000110723			30578	protein-coding gene	gene with protein product	"""synaptotagmin-like homologue lacking C2 domains b"""	612878				9734811, 11773082	Standard	NM_015065		Approved	SLAC2-B	uc001pkk.3	Q8NEV8	OTTHUMG00000166536	ENST00000265843.4:c.1990C>T	11.37:g.108384244G>A	ENSP00000265843:p.His664Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2KHM1|Q9Y4D6	Missense_Mutation	SNP	superfamily_Znf_FYVE_PHD,pfscan_Rab-bd_domain	p.H664Y	ENST00000265843.4	37	c.1990	CCDS8341.1	11	.	.	.	.	.	.	.	.	.	.	G	6.827	0.521771	0.13005	.	.	ENSG00000110723	ENST00000265843;ENST00000428840;ENST00000443411;ENST00000525344;ENST00000439956;ENST00000526312;ENST00000533052	T;T;T;T;T;T	0.03831	4.38;4.31;4.16;4.38;4.24;3.79	6.03	0.548	0.17208	.	1.012140	0.07915	N	0.974955	T	0.03827	0.0108	N	0.22421	0.69	0.09310	N	1	B	0.19200	0.034	B	0.21151	0.033	T	0.46261	-0.9204	10	0.39692	T	0.17	-0.3365	5.393	0.16253	0.2409:0.2636:0.4956:0.0	.	664	Q8NEV8	EXPH5_HUMAN	Y	664;588;476;657;508;588;476	ENSP00000265843:H664Y;ENSP00000391966:H588Y;ENSP00000411390:H476Y;ENSP00000432546:H657Y;ENSP00000432683:H588Y;ENSP00000446434:H476Y	ENSP00000265843:H664Y	H	-	1	0	EXPH5	107889454	0.002000	0.14202	0.000000	0.03702	0.011000	0.07611	1.093000	0.30939	0.073000	0.16731	-0.262000	0.10625	CAT	EXPH5	-	NULL		0.453	EXPH5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXPH5	HGNC	protein_coding	OTTHUMT00000390279.1	G	NM_015065		108384244	-1	no_errors	ENST00000265843	ensembl	human	known	70_37	missense	SNP	0.000	A
FAF2	23197	genome.wustl.edu	37	5	175906255	175906255	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:175906255G>C	ENST00000261942.6	+	2	183	c.130G>C	c.(130-132)Gag>Cag	p.E44Q	FAF2_ENST00000510446.1_3'UTR	NM_014613.2	NP_055428.1	Q96CS3	FAF2_HUMAN	Fas associated factor family member 2	44	UBA.				lipid particle organization (GO:0034389)|negative regulation of catalytic activity (GO:0043086)|response to unfolded protein (GO:0006986)	Cdc48p-Npl4p-Ufd1p AAA ATPase complex (GO:0034098)|endoplasmic reticulum (GO:0005783)|intracellular membrane-bounded organelle (GO:0043231)|lipid particle (GO:0005811)	lipase binding (GO:0035473)|lipase inhibitor activity (GO:0055102)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)			breast(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	10						CTGGAACATAGAGGTATAATA	0.378																																																	0													183.0	161.0	169.0					5																	175906255		2203	4300	6503	SO:0001583	missense	23197			BC015791	CCDS34296.1	5q35.2	2011-06-28	2008-07-25	2008-07-25	ENSG00000113194	ENSG00000113194		"""UBX domain containing"""	24666	protein-coding gene	gene with protein product	"""expressed in T cells and eosinophils in atopic dermatitis"", ""UBX domain protein 3B"""		"""UBX domain containing 8"""	UBXD8		10048485, 12372427	Standard	NM_014613		Approved	ETEA, KIAA0887, UBXN3B	uc003mej.4	Q96CS3	OTTHUMG00000163228	ENST00000261942.6:c.130G>C	5.37:g.175906255G>C	ENSP00000261942:p.Glu44Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O94963|Q8IUF2|Q9BRP2|Q9BVM7	Missense_Mutation	SNP	pfam_UBX,superfamily_UBA-like,smart_UAS,pfscan_UBX	p.E44Q	ENST00000261942.6	37	c.130	CCDS34296.1	5	.	.	.	.	.	.	.	.	.	.	G	29.2	4.987117	0.93106	.	.	ENSG00000113194	ENST00000510730;ENST00000261942;ENST00000540174	.	.	.	5.11	5.11	0.69529	UBA-like (1);	0.000000	0.85682	D	0.000000	T	0.72179	0.3428	L	0.39397	1.21	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.67213	-0.5727	9	0.24483	T	0.36	-15.7766	18.9221	0.92529	0.0:0.0:1.0:0.0	.	44	Q96CS3	FAF2_HUMAN	Q	24;44;44	.	ENSP00000261942:E44Q	E	+	1	0	FAF2	175838861	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.776000	0.91776	2.520000	0.84964	0.650000	0.86243	GAG	FAF2	-	superfamily_UBA-like		0.378	FAF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAF2	HGNC	protein_coding	OTTHUMT00000372194.1	G	NM_014613		175906255	+1	no_errors	ENST00000261942	ensembl	human	known	70_37	missense	SNP	1.000	C
FAM111A	63901	genome.wustl.edu	37	11	58920959	58920959	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:58920959G>A	ENST00000528737.1	+	5	4636	c.1818G>A	c.(1816-1818)atG>atA	p.M606I	FAM111A_ENST00000533703.1_Missense_Mutation_p.M606I|FAM111A_ENST00000361723.3_Missense_Mutation_p.M606I|FAM111A_ENST00000420244.1_Missense_Mutation_p.M606I|FAM111A_ENST00000531147.1_Missense_Mutation_p.M606I			Q96PZ2	F111A_HUMAN	family with sequence similarity 111, member A	606	Interaction with SV40 large T antigen.				defense response to virus (GO:0051607)|DNA replication (GO:0006260)|negative regulation of viral genome replication (GO:0045071)|viral process (GO:0016032)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	catalytic activity (GO:0003824)			breast(2)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	22		all_epithelial(135;0.139)				TAGAAATGATGAGTGATGAGG	0.363																																																	0													78.0	81.0	80.0					11																	58920959		2201	4295	6496	SO:0001583	missense	63901			AK092953	CCDS7973.1	11q12.1	2014-03-13				ENSG00000166801			24725	protein-coding gene	gene with protein product		615292				11572484, 23996431, 23684011	Standard	NM_022074		Approved	FLJ22794, KIAA1895	uc001nnq.3	Q96PZ2		ENST00000528737.1:c.1818G>A	11.37:g.58920959G>A	ENSP00000434435:p.Met606Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5Y8|Q5RKS9|Q5XKM2|Q68DK9|Q6IPR7|Q9H5Y1	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like	p.M606I	ENST00000528737.1	37	c.1818	CCDS7973.1	11	.	.	.	.	.	.	.	.	.	.	G	9.511	1.105772	0.20632	.	.	ENSG00000166801	ENST00000528737;ENST00000420244;ENST00000361723;ENST00000533703;ENST00000531147	T;T;T;T;T	0.40756	1.02;1.02;1.02;1.02;1.02	5.87	-1.72	0.08107	.	2.170290	0.01829	N	0.034575	T	0.24661	0.0598	N	0.21448	0.665	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.03566	-1.1024	10	0.16896	T	0.51	-6.0039	1.3666	0.02202	0.2633:0.113:0.3954:0.2283	.	606	Q96PZ2	F111A_HUMAN	I	606	ENSP00000434435:M606I;ENSP00000406683:M606I;ENSP00000355264:M606I;ENSP00000433154:M606I;ENSP00000431631:M606I	ENSP00000355264:M606I	M	+	3	0	FAM111A	58677535	0.000000	0.05858	0.000000	0.03702	0.345000	0.29048	-0.299000	0.08254	-1.001000	0.03434	-0.797000	0.03246	ATG	FAM111A	-	NULL		0.363	FAM111A-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FAM111A	HGNC	protein_coding	OTTHUMT00000393975.1	G	NM_022074		58920959	+1	no_errors	ENST00000361723	ensembl	human	known	70_37	missense	SNP	0.000	A
MVB12B	89853	genome.wustl.edu	37	9	129102821	129102821	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:129102821C>G	ENST00000361171.3	+	2	197	c.116C>G	c.(115-117)tCa>tGa	p.S39*	MVB12B_ENST00000545391.1_Nonsense_Mutation_p.S39*|MVB12B_ENST00000436593.3_Nonsense_Mutation_p.S24*	NM_033446.2	NP_258257.1	Q9H7P6	MB12B_HUMAN	multivesicular body subunit 12B	39					protein transport (GO:0015031)|regulation of epidermal growth factor receptor signaling pathway (GO:0042058)|ubiquitin-dependent protein catabolic process via the multivesicular body sorting pathway (GO:0043162)	cytosol (GO:0005829)|early endosome (GO:0005769)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	lipid binding (GO:0008289)										AAAGACCTCTCAGAAGCCTTG	0.463																																																	0													113.0	106.0	108.0					9																	129102821		2203	4300	6503	SO:0001587	stop_gained	89853			AK000001	CCDS35142.1	9q34.12	2012-12-03	2012-12-03	2012-12-03	ENSG00000196814	ENSG00000196814			23368	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 28"", ""family with sequence similarity 125, member B"""	C9orf28, FAM125B		18005716, 20654576, 22232651	Standard	NM_033446		Approved	FLJ00001	uc004bqh.2	Q9H7P6	OTTHUMG00000020687	ENST00000361171.3:c.116C>G	9.37:g.129102821C>G	ENSP00000354772:p.Ser39*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N6S7	Nonsense_Mutation	SNP	pfam_FAM125	p.S39*	ENST00000361171.3	37	c.116	CCDS35142.1	9	.	.	.	.	.	.	.	.	.	.	C	39	7.297080	0.98192	.	.	ENSG00000196814	ENST00000361171;ENST00000545391;ENST00000402437;ENST00000436593	.	.	.	5.33	5.33	0.75918	.	0.475467	0.24094	N	0.041611	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-11.9072	17.7946	0.88566	0.0:1.0:0.0:0.0	.	.	.	.	X	39;39;24;24	.	ENSP00000354772:S39X	S	+	2	0	FAM125B	128142642	1.000000	0.71417	0.995000	0.50966	0.991000	0.79684	7.043000	0.76572	2.500000	0.84329	0.637000	0.83480	TCA	FAM125B	-	NULL		0.463	MVB12B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM125B	HGNC	protein_coding	OTTHUMT00000054110.1	C	XM_088525		129102821	+1	no_errors	ENST00000361171	ensembl	human	known	70_37	nonsense	SNP	0.995	G
FAM179A	165186	genome.wustl.edu	37	2	29245120	29245120	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:29245120C>G	ENST00000379558.4	+	11	1808	c.1457C>G	c.(1456-1458)tCg>tGg	p.S486W	FAM179A_ENST00000403861.2_Missense_Mutation_p.S431W|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	486										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						AGGCCTTTCTCGAACCCGGAG	0.572																																																	0													81.0	85.0	83.0					2																	29245120		2033	4189	6222	SO:0001583	missense	165186			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.1457C>G	2.37:g.29245120C>G	ENSP00000368876:p.Ser486Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZUF5	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.S486W	ENST00000379558.4	37	c.1457	CCDS1769.2	2	.	.	.	.	.	.	.	.	.	.	C	18.46	3.628587	0.67015	.	.	ENSG00000189350	ENST00000379558;ENST00000403861	T;T	0.69926	-0.37;-0.44	4.99	4.99	0.66335	Armadillo-type fold (1);	0.000000	0.52532	D	0.000067	T	0.74419	0.3714	L	0.29908	0.895	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.78293	-0.2260	10	0.87932	D	0	.	17.8613	0.88781	0.0:1.0:0.0:0.0	.	431;486	F8W8E4;Q6ZUX3	.;F179A_HUMAN	W	486;431	ENSP00000368876:S486W;ENSP00000384699:S431W	ENSP00000368876:S486W	S	+	2	0	FAM179A	29098624	0.995000	0.38212	0.996000	0.52242	0.707000	0.40811	3.650000	0.54424	2.303000	0.77524	0.549000	0.68633	TCG	FAM179A	-	superfamily_ARM-type_fold		0.572	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	C	NM_199280		29245120	+1	no_errors	ENST00000379558	ensembl	human	known	70_37	missense	SNP	0.997	G
FAM209A	200232	genome.wustl.edu	37	20	55099992	55099992	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:55099992G>T	ENST00000371328.3	+	1	451	c.128G>T	c.(127-129)cGg>cTg	p.R43L	GCNT7_ENST00000243913.4_Intron|FAM209A_ENST00000481560.1_3'UTR	NM_001012971.3	NP_001012989.2	Q5JX71	F209A_HUMAN	family with sequence similarity 209, member A	43						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)											GAGCACTTTCGGATTCGGCAG	0.507																																																	0													154.0	139.0	144.0					20																	55099992		2203	4300	6503	SO:0001583	missense	200232			AL109806	CCDS33493.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000124103	ENSG00000124103			16100	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 106"""	C20orf106			Standard	NM_001012971		Approved	dJ1153D9.3		Q5JX71	OTTHUMG00000032799	ENST00000371328.3:c.128G>T	20.37:g.55099992G>T	ENSP00000360379:p.Arg43Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05C43	Missense_Mutation	SNP	NULL	p.R43L	ENST00000371328.3	37	c.128	CCDS33493.1	20	.	.	.	.	.	.	.	.	.	.	G	13.80	2.344872	0.41498	.	.	ENSG00000124103	ENST00000371328	T	0.14266	2.52	5.51	5.51	0.81932	.	0.000000	0.45126	D	0.000383	T	0.33818	0.0876	M	0.64404	1.975	0.39081	D	0.960908	D	0.89917	1.0	D	0.91635	0.999	T	0.02391	-1.1166	10	0.33141	T	0.24	-31.6093	14.8926	0.70620	0.0:0.0:1.0:0.0	.	43	Q5JX71	CT106_HUMAN	L	43	ENSP00000360379:R43L	ENSP00000360379:R43L	R	+	2	0	C20orf106	54533399	0.928000	0.31464	0.898000	0.35279	0.022000	0.10575	4.302000	0.59092	2.577000	0.86979	0.467000	0.42956	CGG	FAM209A	-	NULL		0.507	FAM209A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM209A	HGNC	protein_coding	OTTHUMT00000079815.2	G			55099992	+1	no_errors	ENST00000371328	ensembl	human	known	70_37	missense	SNP	0.966	T
FAM46B	115572	genome.wustl.edu	37	1	27332842	27332842	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:27332842G>A	ENST00000289166.5	-	2	1036	c.871C>T	c.(871-873)Cgg>Tgg	p.R291W		NM_052943.3	NP_443175.2	Q96A09	FA46B_HUMAN	family with sequence similarity 46, member B	291										breast(1)|central_nervous_system(1)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)	10		all_cancers(24;1.29e-21)|all_epithelial(13;2.35e-19)|Colorectal(325;0.000147)|all_lung(284;0.00122)|Lung NSC(340;0.00128)|Breast(348;0.00131)|Renal(390;0.00211)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|Epithelial(14;7.71e-51)|OV - Ovarian serous cystadenocarcinoma(117;1.11e-29)|Colorectal(126;5.31e-09)|COAD - Colon adenocarcinoma(152;9.31e-07)|BRCA - Breast invasive adenocarcinoma(304;0.000272)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|STAD - Stomach adenocarcinoma(196;0.00114)|READ - Rectum adenocarcinoma(331;0.0419)		GGCCGGGGCCGGAAGCCCCGC	0.677																																																	0													17.0	20.0	19.0					1																	27332842		2196	4292	6488	SO:0001583	missense	115572			AK122816	CCDS294.2	1p35.3	2008-02-05			ENSG00000158246	ENSG00000158246			28273	protein-coding gene	gene with protein product						12477932	Standard	NM_052943		Approved	MGC16491	uc010ofj.2	Q96A09	OTTHUMG00000004278	ENST00000289166.5:c.871C>T	1.37:g.27332842G>A	ENSP00000289166:p.Arg291Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DUF1693	p.R291W	ENST00000289166.5	37	c.871	CCDS294.2	1	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221595	0.79464	.	.	ENSG00000158246	ENST00000289166	T	0.29917	1.55	5.31	4.39	0.52855	Domain of unknown function DUF1693 (1);	0.236488	0.42682	D	0.000668	T	0.57577	0.2063	M	0.83953	2.67	0.58432	D	0.999999	D	0.89917	1.0	D	0.79108	0.992	T	0.64888	-0.6301	10	0.87932	D	0	0.0197	13.3575	0.60635	0.0:0.0:0.6382:0.3618	.	291	Q96A09	FA46B_HUMAN	W	291	ENSP00000289166:R291W	ENSP00000289166:R291W	R	-	1	2	FAM46B	27205429	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	1.337000	0.33862	1.435000	0.47434	0.561000	0.74099	CGG	FAM46B	-	pfam_DUF1693		0.677	FAM46B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM46B	HGNC	protein_coding	OTTHUMT00000012347.2	G	NM_052943		27332842	-1	no_errors	ENST00000289166	ensembl	human	known	70_37	missense	SNP	1.000	A
FAN1	22909	genome.wustl.edu	37	15	31197287	31197287	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:31197287G>A	ENST00000362065.4	+	2	712	c.421G>A	c.(421-423)Gag>Aag	p.E141K	FAN1_ENST00000565466.1_Missense_Mutation_p.E141K|FAN1_ENST00000561594.1_Missense_Mutation_p.E141K|FAN1_ENST00000561607.1_Missense_Mutation_p.E141K	NM_014967.4	NP_055782.3	Q9Y2M0	FAN1_HUMAN	FANCD2/FANCI-associated nuclease 1	141					DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|double-strand break repair via homologous recombination (GO:0000724)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA incision (GO:0033683)	nucleus (GO:0005634)	5'-3' exonuclease activity (GO:0008409)|5'-flap endonuclease activity (GO:0017108)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|phosphodiesterase I activity (GO:0004528)|ubiquitin binding (GO:0043130)			autonomic_ganglia(2)|breast(2)|cervix(2)|endometrium(7)|kidney(1)|large_intestine(6)|lung(8)|skin(1)	29						AAATCAAGATGAGCTGAGAAA	0.363								Direct reversal of damage																																									0													68.0	64.0	66.0					15																	31197287		2202	4300	6502	SO:0001583	missense	22909				CCDS32186.1, CCDS58344.1	15q13.2-q13.3	2010-08-04	2010-08-04	2010-08-04		ENSG00000198690			29170	protein-coding gene	gene with protein product		613534	"""KIAA1018"", ""myotubularin related protein 15"""	KIAA1018, MTMR15		20603015, 20603016, 20603073	Standard	NM_014967		Approved		uc001zff.3	Q9Y2M0		ENST00000362065.4:c.421G>A	15.37:g.31197287G>A	ENSP00000354497:p.Glu141Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4M2|Q86WU8	Missense_Mutation	SNP	pfam_VRR_NUC,smart_Znf_Rad18_put	p.E141K	ENST00000362065.4	37	c.421	CCDS32186.1	15	.	.	.	.	.	.	.	.	.	.	G	10.91	1.483441	0.26598	.	.	ENSG00000198690	ENST00000362065	D	0.83992	-1.79	5.46	2.42	0.29668	.	0.483471	0.24328	N	0.039482	T	0.69061	0.3069	N	0.19112	0.55	0.09310	N	1	B;B	0.15141	0.012;0.008	B;B	0.20184	0.012;0.028	T	0.55341	-0.8156	10	0.35671	T	0.21	-11.0833	8.4789	0.33030	0.2747:0.1052:0.6201:0.0	.	141;141	Q9Y2M0;Q9Y2M0-2	FAN1_HUMAN;.	K	141	ENSP00000354497:E141K	ENSP00000354497:E141K	E	+	1	0	FAN1	28984579	0.102000	0.21896	0.000000	0.03702	0.030000	0.12068	2.571000	0.45990	0.054000	0.16065	-1.134000	0.01955	GAG	FAN1	-	NULL		0.363	FAN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAN1	HGNC	protein_coding	OTTHUMT00000430740.1	G	NM_014967		31197287	+1	no_errors	ENST00000362065	ensembl	human	known	70_37	missense	SNP	0.000	A
FANCA	2175	genome.wustl.edu	37	16	89882319	89882319	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:89882319C>G	ENST00000389301.3	-	2	185	c.155G>C	c.(154-156)cGa>cCa	p.R52P	FANCA_ENST00000563673.1_Missense_Mutation_p.R52P|FANCA_ENST00000568369.1_Missense_Mutation_p.R52P|FANCA_ENST00000389302.3_Missense_Mutation_p.R52P|FANCA_ENST00000543736.1_Missense_Mutation_p.R52P|FANCA_ENST00000534992.1_Missense_Mutation_p.R52P	NM_000135.2	NP_000126.2	O15360	FANCA_HUMAN	Fanconi anemia, complementation group A	52					DNA repair (GO:0006281)|female gonad development (GO:0008585)|male gonad development (GO:0008584)|male meiosis (GO:0007140)|protein complex assembly (GO:0006461)|regulation of cell proliferation (GO:0042127)	cytoplasm (GO:0005737)|Fanconi anaemia nuclear complex (GO:0043240)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				breast(5)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|urinary_tract(3)	47		Lung NSC(15;8.48e-06)|all_lung(18;1.31e-05)|all_hematologic(23;0.0194)		BRCA - Breast invasive adenocarcinoma(80;0.028)		CTGATGGCTTCGCAGGAGGCG	0.522			"""D, Mis, N, F, S"""			"""AML, leukemia"""		Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																														yes	Rec		Fanconi anaemia A	16	16q24.3	2175	"""Fanconi anemia, complementation group A"""		L	0													135.0	127.0	129.0					16																	89882319		2198	4300	6498	SO:0001583	missense	2175	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	Z83067	CCDS32515.1, CCDS42221.1, CCDS67099.1	16q24.3	2014-09-17			ENSG00000187741	ENSG00000187741		"""Fanconi anemia, complementation groups"""	3582	protein-coding gene	gene with protein product		607139		FACA, FANCH		7581462, 9382107	Standard	NM_001286167		Approved	FAA, FA-H, FAH	uc002fou.1	O15360		ENST00000389301.3:c.155G>C	16.37:g.89882319C>G	ENSP00000373952:p.Arg52Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D923|B4DRI7|H3BSR5|O75266|Q6PL10|Q92497|Q96H18|Q9UEA5|Q9UEL8|Q9UEL9|Q9UPK3|Q9Y6M2	Missense_Mutation	SNP	pfam_Fanconia,prints_Fanconia	p.R52P	ENST00000389301.3	37	c.155	CCDS32515.1	16	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582457	0.46006	.	.	ENSG00000187741	ENST00000389301;ENST00000389302;ENST00000534992;ENST00000543736	T;T;T;T	0.44881	0.91;0.91;0.91;0.91	5.47	2.09	0.27110	.	0.378804	0.22832	N	0.055097	T	0.49847	0.1581	L	0.57536	1.79	0.26216	N	0.979238	D;D;D;D;D;D	0.76494	0.99;0.999;0.999;0.999;0.999;0.99	P;D;D;D;D;P	0.70487	0.737;0.955;0.969;0.969;0.955;0.737	T	0.28038	-1.0056	10	0.30078	T	0.28	-5.197	4.1274	0.10133	0.0:0.5921:0.1949:0.213	.	52;52;52;52;52;52	B4DRI7;Q0VAP4;A0PJU8;F5H8D5;O15360-2;O15360	.;.;.;.;.;FANCA_HUMAN	P	52	ENSP00000373952:R52P;ENSP00000373953:R52P;ENSP00000443675:R52P;ENSP00000443409:R52P	ENSP00000373952:R52P	R	-	2	0	FANCA	88409820	0.707000	0.27866	0.837000	0.33122	0.026000	0.11368	1.146000	0.31589	1.318000	0.45170	0.645000	0.84053	CGA	FANCA	-	NULL		0.522	FANCA-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FANCA	HGNC	protein_coding	OTTHUMT00000421927.1	C			89882319	-1	no_errors	ENST00000389301	ensembl	human	known	70_37	missense	SNP	0.488	G
FANCI	55215	genome.wustl.edu	37	15	89825022	89825022	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:89825022G>C	ENST00000310775.7	+	16	1625	c.1539G>C	c.(1537-1539)atG>atC	p.M513I	FANCI_ENST00000300027.8_Missense_Mutation_p.M513I	NM_001113378.1	NP_001106849.1	Q9NVI1	FANCI_HUMAN	Fanconi anemia, complementation group I	513					cell cycle (GO:0007049)|DNA repair (GO:0006281)|positive regulation of protein ubiquitination (GO:0031398)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA polymerase binding (GO:0070182)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	Lung NSC(78;0.0472)|all_lung(78;0.089)					GCATGTCAATGAGAGACTGCT	0.388								Involved in tolerance or repair of DNA crosslinks	Fanconi Anemia																																								0													227.0	200.0	209.0					15																	89825022		2200	4299	6499	SO:0001583	missense	55215	Familial Cancer Database	Pancytopenia Dysmelia, FA (several complementation groups)	BC004277	CCDS10349.2, CCDS45346.1	15q26.1	2014-09-17	2007-05-03	2007-05-03	ENSG00000140525	ENSG00000140525		"""Fanconi anemia, complementation groups"""	25568	protein-coding gene	gene with protein product		611360	"""KIAA1794"""	KIAA1794		14630800, 17460694, 17412408	Standard	NM_001113378		Approved	FLJ10719	uc010bnp.1	Q9NVI1	OTTHUMG00000132993	ENST00000310775.7:c.1539G>C	15.37:g.89825022G>C	ENSP00000310842:p.Met513Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A4ZVE4|A5YMH4|A6NJZ0|Q96JN1|Q96ST0|Q9BT96	Missense_Mutation	SNP	NULL	p.M513I	ENST00000310775.7	37	c.1539	CCDS45346.1	15	.	.	.	.	.	.	.	.	.	.	G	12.12	1.842454	0.32513	.	.	ENSG00000140525	ENST00000300027;ENST00000310775;ENST00000447611	T;T;T	0.74421	-0.84;-0.84;-0.84	5.81	4.85	0.62838	.	0.224757	0.50627	N	0.000116	T	0.63827	0.2544	L	0.38838	1.175	0.80722	D	1	B;B;B	0.09022	0.0;0.001;0.002	B;B;B	0.08055	0.002;0.002;0.003	T	0.57631	-0.7778	10	0.23891	T	0.37	-5.6285	12.7493	0.57300	0.0798:0.0:0.9202:0.0	.	513;513;513	Q9NVI1;Q9NVI1-2;Q9NVI1-1	FANCI_HUMAN;.;.	I	513	ENSP00000300027:M513I;ENSP00000310842:M513I;ENSP00000413249:M513I	ENSP00000300027:M513I	M	+	3	0	FANCI	87626026	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.443000	0.35057	1.348000	0.45733	0.655000	0.94253	ATG	FANCI	-	NULL		0.388	FANCI-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FANCI	HGNC	protein_coding	OTTHUMT00000421140.1	G	NM_018193		89825022	+1	no_errors	ENST00000310775	ensembl	human	known	70_37	missense	SNP	1.000	C
FAS	355	genome.wustl.edu	37	10	90773980	90773980	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:90773980G>A	ENST00000355740.2	+	9	1001	c.781G>A	c.(781-783)Gag>Aag	p.E261K	FAS_ENST00000352159.4_3'UTR|RP11-399O19.9_ENST00000562983.1_RNA|FAS_ENST00000357339.2_Missense_Mutation_p.E240K|FAS_ENST00000355279.2_3'UTR	NM_000043.4|NM_152871.2|NM_152872.2	NP_000034.1|NP_690610.1|NP_690611.1	P49327	FAS_HUMAN	Fas cell surface death receptor	0	Beta-ketoacyl synthase. {ECO:0000250}.				acetyl-CoA metabolic process (GO:0006084)|cellular lipid metabolic process (GO:0044255)|cellular response to interleukin-4 (GO:0071353)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|fatty acid metabolic process (GO:0006631)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|osteoblast differentiation (GO:0001649)|pantothenate metabolic process (GO:0015939)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|glycogen granule (GO:0042587)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	3-hydroxyoctanoyl-[acyl-carrier-protein] dehydratase activity (GO:0047451)|3-hydroxypalmitoyl-[acyl-carrier-protein] dehydratase activity (GO:0004317)|3-oxoacyl-[acyl-carrier-protein] reductase (NADPH) activity (GO:0004316)|3-oxoacyl-[acyl-carrier-protein] synthase activity (GO:0004315)|[acyl-carrier-protein] S-acetyltransferase activity (GO:0004313)|[acyl-carrier-protein] S-malonyltransferase activity (GO:0004314)|drug binding (GO:0008144)|enoyl-[acyl-carrier-protein] reductase (NADPH, A-specific) activity (GO:0047117)|enoyl-[acyl-carrier-protein] reductase (NADPH, B-specific) activity (GO:0004319)|fatty acid synthase activity (GO:0004312)|myristoyl-[acyl-carrier-protein] hydrolase activity (GO:0016295)|NADPH binding (GO:0070402)|oleoyl-[acyl-carrier-protein] hydrolase activity (GO:0004320)|palmitoyl-[acyl-carrier-protein] hydrolase activity (GO:0016296)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(3)|lung(5)|upper_aerodigestive_tract(2)	18		Colorectal(252;0.0161)		Colorectal(12;0.000136)|COAD - Colon adenocarcinoma(12;0.000193)	Cerulenin(DB01034)|Orlistat(DB01083)	CAAAATAGATGAGATCAAGAA	0.378																																																	0													125.0	116.0	119.0					10																	90773980		2203	4300	6503	SO:0001583	missense	355			M67454	CCDS7393.1, CCDS7394.1, CCDS7395.1	10q24.1	2014-09-17	2013-05-22	2005-01-07	ENSG00000026103	ENSG00000026103		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11920	protein-coding gene	gene with protein product	"""TNF receptor superfamily member 6"""	134637	"""tumor necrosis factor receptor superfamily, member 6"", ""Fas (TNF receptor superfamily, member 6)"""	FAS1, APT1, TNFRSF6		1385299, 1385309	Standard	NM_000043		Approved	CD95, APO-1	uc001kfr.3	P25445	OTTHUMG00000018701	ENST00000355740.2:c.781G>A	10.37:g.90773980G>A	ENSP00000347979:p.Glu261Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13479|Q16702|Q4LE83|Q6P4U5|Q6SS02|Q969R1|Q96C68|Q96IT0	Missense_Mutation	SNP	pfam_Death,pfam_TNFR/NGFR_Cys_rich_reg,superfamily_DEATH-like,smart_TNFR/NGFR_Cys_rich_reg,smart_Death,pfscan_Death,pfscan_TNFR/NGFR_Cys_rich_reg,prints_Fas_rcpt	p.E261K	ENST00000355740.2	37	c.781	CCDS7393.1	10	.	.	.	.	.	.	.	.	.	.	G	23.1	4.369578	0.82463	.	.	ENSG00000026103	ENST00000540197;ENST00000355740;ENST00000357339	D;D	0.94184	-3.37;-3.37	4.65	3.66	0.41972	Death (3);DEATH-like (2);	0.795670	0.11554	N	0.552457	D	0.95452	0.8523	M	0.79926	2.475	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.59056	0.851;0.845	D	0.93684	0.7001	10	0.46703	T	0.11	-22.8945	10.006	0.41957	0.0:0.2055:0.7944:0.0	.	240;261	P25445-6;P25445	.;TNR6_HUMAN	K	288;261;240	ENSP00000347979:E261K;ENSP00000349896:E240K	ENSP00000347979:E261K	E	+	1	0	FAS	90763960	0.868000	0.29978	1.000000	0.80357	0.993000	0.82548	2.005000	0.40864	2.523000	0.85059	0.650000	0.86243	GAG	FAS	-	pfam_Death,superfamily_DEATH-like,smart_Death,pfscan_Death		0.378	FAS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	FAS	HGNC	protein_coding	OTTHUMT00000049274.3	G			90773980	+1	no_errors	ENST00000355740	ensembl	human	known	70_37	missense	SNP	1.000	A
FGFR3	2261	genome.wustl.edu	37	4	1807849	1807849	+	Silent	SNP	C	C	T	rs104886005		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr4:1807849C>T	ENST00000260795.2	+	13	2010	c.1908C>T	c.(1906-1908)ttC>ttT	p.F636F	FGFR3_ENST00000340107.4_Silent_p.F638F|FGFR3_ENST00000481110.2_Silent_p.F637F|FGFR3_ENST00000352904.1_Silent_p.F524F|FGFR3_ENST00000440486.2_Silent_p.F636F|FGFR3_ENST00000412135.2_Silent_p.F524F			P22607	FGFR3_HUMAN	fibroblast growth factor receptor 3	636	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				alveolar secondary septum development (GO:0061144)|axonogenesis involved in innervation (GO:0060385)|bone maturation (GO:0070977)|bone mineralization (GO:0030282)|bone morphogenesis (GO:0060349)|cell-cell signaling (GO:0007267)|central nervous system myelination (GO:0022010)|chondrocyte differentiation (GO:0002062)|chondrocyte proliferation (GO:0035988)|cochlea development (GO:0090102)|digestive tract morphogenesis (GO:0048546)|endochondral bone growth (GO:0003416)|endochondral ossification (GO:0001958)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell fate commitment (GO:0072148)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor apoptotic signaling pathway (GO:1902178)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|inner ear receptor cell differentiation (GO:0060113)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade (GO:0007259)|lens fiber cell development (GO:0070307)|lens morphogenesis in camera-type eye (GO:0002089)|MAPK cascade (GO:0000165)|morphogenesis of an epithelium (GO:0002009)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of developmental growth (GO:0048640)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of mitosis (GO:0045839)|negative regulation of smoothened signaling pathway (GO:0045879)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell differentiation (GO:0045597)|positive regulation of cell proliferation (GO:0008284)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|protein autophosphorylation (GO:0046777)|response to axon injury (GO:0048678)|skeletal system development (GO:0001501)|somatic stem cell maintenance (GO:0035019)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|cytoplasmic side of plasma membrane (GO:0009898)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|lysosome (GO:0005764)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|fibroblast growth factor binding (GO:0017134)|fibroblast growth factor-activated receptor activity (GO:0005007)|protein tyrosine kinase activity (GO:0004713)	p.F636L(1)		NS(1)|central_nervous_system(5)|cervix(6)|endometrium(2)|haematopoietic_and_lymphoid_tissue(40)|kidney(1)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(9)|skin(339)|soft_tissue(4)|testis(2)|upper_aerodigestive_tract(58)|urinary_tract(2607)	3091		Breast(71;0.212)|all_epithelial(65;0.241)	all cancers(2;0.000145)|OV - Ovarian serous cystadenocarcinoma(23;0.0019)|Epithelial(3;0.00221)|GBM - Glioblastoma multiforme(2;0.234)		Palifermin(DB00039)|Pazopanib(DB06589)|Ponatinib(DB08901)	TCGCAGACTTCGGGCTGGCCC	0.647		1	"""Mis, T"""	"""IGH@, ETV6"""	"""bladder, MM, T-cell lymphoma"""		"""Hypochondroplasia, Thanatophoric dysplasia"""		Saethre-Chotzen syndrome;Muenke syndrome																															Dom	yes		4	4p16.3	2261	fibroblast growth factor receptor 3	yes	"""L, E"""	1	Substitution - Missense(1)	soft_tissue(1)											42.0	42.0	42.0					4																	1807849		2202	4300	6502	SO:0001819	synonymous_variant	2261	Familial Cancer Database	Acrocephalosyndactyly type III;Muenke Nonsyndromic Coronal Craniosynostosis, FGFR3-related Craniosynostosis	M64347	CCDS3353.1, CCDS3354.1, CCDS54706.1	4p16.3	2013-01-11	2008-08-01		ENSG00000068078	ENSG00000068078		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"""	3690	protein-coding gene	gene with protein product		134934	"""achondroplasia, thanatophoric dwarfism"""	ACH		1847508	Standard	NM_000142		Approved	CEK2, JTK4, CD333	uc003gdu.2	P22607	OTTHUMG00000121148	ENST00000260795.2:c.1908C>T	4.37:g.1807849C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVP9|D3DVQ0|Q14308|Q16294|Q16608|Q59FL9	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.F638	ENST00000260795.2	37	c.1914	CCDS3353.1	4																																																																																			FGFR3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_fibroblast_GF_rcpt,pfscan_Prot_kinase_cat_dom		0.647	FGFR3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	FGFR3	HGNC	protein_coding	OTTHUMT00000241632.2	C	NM_000142		1807849	+1	no_errors	ENST00000340107	ensembl	human	known	70_37	silent	SNP	0.992	T
FKBP9	11328	genome.wustl.edu	37	7	33014871	33014871	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:33014871C>T	ENST00000242209.4	+	3	614	c.445C>T	c.(445-447)Cag>Tag	p.Q149*	FKBP9_ENST00000538336.1_Nonsense_Mutation_p.Q202*|FKBP9_ENST00000538443.1_Nonsense_Mutation_p.Q11*|AVL9_ENST00000404479.1_Intron	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	149					chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)	p.Q149E(1)		central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			AGACCAGGTTCAGATTCACAC	0.463																																																	1	Substitution - Missense(1)	lung(1)											116.0	107.0	110.0					7																	33014871		2203	4300	6503	SO:0001587	stop_gained	11328			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.445C>T	7.37:g.33014871C>T	ENSP00000242209:p.Gln149*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Nonsense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.Q202*	ENST00000242209.4	37	c.604	CCDS5439.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.102775	0.98066	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443	.	.	.	5.32	4.42	0.53409	.	0.062940	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.13108	T	0.6	-3.1609	15.8238	0.78683	0.0:0.8636:0.1364:0.0	.	.	.	.	X	149;202;11	.	ENSP00000242209:Q149X	Q	+	1	0	FKBP9	32981396	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	4.736000	0.62059	1.224000	0.43551	0.644000	0.83932	CAG	FKBP9	-	NULL		0.463	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP9	HGNC	protein_coding	OTTHUMT00000215137.1	C	NM_007270		33014871	+1	no_errors	ENST00000538336	ensembl	human	known	70_37	nonsense	SNP	1.000	T
FNDC1	84624	genome.wustl.edu	37	6	159654069	159654069	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:159654069G>A	ENST00000297267.9	+	11	2725	c.2525G>A	c.(2524-2526)cGg>cAg	p.R842Q	FNDC1_ENST00000340366.6_Missense_Mutation_p.R779Q	NM_032532.2	NP_115921.2	Q4ZHG4	FNDC1_HUMAN	fibronectin type III domain containing 1	842					cellular response to hypoxia (GO:0071456)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of protein phosphorylation (GO:0001934)|regulation of protein transport (GO:0051223)	cell-cell junction (GO:0005911)|extracellular region (GO:0005576)|mitochondrial membrane (GO:0031966)|nucleus (GO:0005634)|plasma membrane (GO:0005886)		p.R842Q(1)		NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(29)|liver(2)|lung(23)|ovary(3)|pancreas(1)|prostate(5)|skin(1)|upper_aerodigestive_tract(3)	93		Breast(66;0.000781)|Ovarian(120;0.0308)|Prostate(117;0.195)		OV - Ovarian serous cystadenocarcinoma(65;2.6e-16)|BRCA - Breast invasive adenocarcinoma(81;1.06e-05)		CGGGGACCTCGGCTGCAGCCC	0.627																																																	1	Substitution - Missense(1)	prostate(1)											22.0	27.0	25.0					6																	159654069		2012	4169	6181	SO:0001583	missense	84624			AB058769	CCDS47512.1	6q25	2013-02-11			ENSG00000164694	ENSG00000164694		"""Fibronectin type III domain containing"""	21184	protein-coding gene	gene with protein product		609991	"""fibronectin type III domain containing 2"""	FNDC2		11347906	Standard	NM_032532		Approved	bA243O10.1, KIAA1866, dJ322A24.1	uc010kjv.3	Q4ZHG4	OTTHUMG00000015927	ENST00000297267.9:c.2525G>A	6.37:g.159654069G>A	ENSP00000297267:p.Arg842Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8X2|B7ZBR4|B7ZBR5|B9EK49|Q5JPI0|Q5VU31|Q5VU32|Q5VXX4|Q70CQ6|Q96JG1	Missense_Mutation	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R842Q	ENST00000297267.9	37	c.2525	CCDS47512.1	6	.	.	.	.	.	.	.	.	.	.	G	16.42	3.118775	0.56505	.	.	ENSG00000164694	ENST00000297267;ENST00000340366	T;T	0.12255	2.7;2.81	5.06	4.17	0.49024	.	1.003210	0.08028	N	0.993063	T	0.04952	0.0133	L	0.34521	1.04	0.09310	N	1	P;P	0.51057	0.941;0.692	B;B	0.39027	0.288;0.055	T	0.14448	-1.0472	10	0.40728	T	0.16	-20.6247	11.2813	0.49197	0.0889:0.0:0.9111:0.0	.	779;842	Q4ZHG4-2;Q4ZHG4	.;FNDC1_HUMAN	Q	842;779	ENSP00000297267:R842Q;ENSP00000342460:R779Q	ENSP00000297267:R842Q	R	+	2	0	FNDC1	159574059	0.624000	0.27102	0.011000	0.14972	0.060000	0.15804	0.933000	0.28897	2.639000	0.89480	0.655000	0.94253	CGG	FNDC1	-	NULL		0.627	FNDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC1	HGNC	protein_coding	OTTHUMT00000042897.3	G	NM_032532		159654069	+1	no_errors	ENST00000297267	ensembl	human	known	70_37	missense	SNP	0.022	A
FNDC3B	64778	genome.wustl.edu	37	3	171969135	171969135	+	Silent	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:171969135C>A	ENST00000336824.4	+	6	693	c.594C>A	c.(592-594)cgC>cgA	p.R198R	FNDC3B_ENST00000416957.1_Silent_p.R198R|FNDC3B_ENST00000415807.2_Silent_p.R198R	NM_001135095.1	NP_001128567.1	Q53EP0	FND3B_HUMAN	fibronectin type III domain containing 3B	198					cell migration (GO:0016477)|negative regulation of osteoblast differentiation (GO:0045668)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fibroblast proliferation (GO:0048146)|substrate adhesion-dependent cell spreading (GO:0034446)|Type II pneumocyte differentiation (GO:0060510)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(26)|ovary(3)|prostate(2)|skin(3)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	69	all_cancers(22;1.01e-18)|Ovarian(172;0.00167)|Breast(254;0.165)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)	GBM - Glioblastoma multiforme(1;0.0494)		TGAAAGACCGCCAGATCGATC	0.458																																																	0													65.0	67.0	66.0					3																	171969135		2203	4300	6503	SO:0001819	synonymous_variant	64778			AF543840	CCDS3217.1	3q26.31	2013-11-06			ENSG00000075420	ENSG00000075420		"""Fibronectin type III domain containing"""	24670	protein-coding gene	gene with protein product		611909				15527760	Standard	NM_022763		Approved	FAD104, DKFZp762K137, FLJ23399, PRO4979, YVTM2421	uc003fhy.3	Q53EP0	OTTHUMG00000156761	ENST00000336824.4:c.594C>A	3.37:g.171969135C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB36|B3KXR8|D3DNQ7|Q5U5T8|Q6PIJ3|Q6UXG1|Q6UXZ5|Q8IXB2|Q8NBU7|Q96D78|Q9H5I7|Q9NSQ8	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.R198	ENST00000336824.4	37	c.594	CCDS3217.1	3																																																																																			FNDC3B	-	NULL		0.458	FNDC3B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC3B	HGNC	protein_coding	OTTHUMT00000345618.2	C	NM_022763		171969135	+1	no_errors	ENST00000336824	ensembl	human	known	70_37	silent	SNP	1.000	A
FRAS1	80144	genome.wustl.edu	37	4	79420968	79420968	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr4:79420968G>C	ENST00000264895.6	+	61	9649	c.9209G>C	c.(9208-9210)aGa>aCa	p.R3070T		NM_025074.6	NP_079350.5	Q86XX4	FRAS1_HUMAN	Fraser extracellular matrix complex subunit 1	3066	Calx-beta 5.				cell communication (GO:0007154)|embryonic limb morphogenesis (GO:0030326)|metanephros morphogenesis (GO:0003338)|morphogenesis of an epithelium (GO:0002009)|palate development (GO:0060021)|protein transport (GO:0015031)|skin development (GO:0043588)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sublamina densa (GO:0061618)	metal ion binding (GO:0046872)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(5)|lung(54)|prostate(7)|skin(2)|urinary_tract(4)	103						GTGATCCGCAGAGGGGATCAG	0.552																																																	0													128.0	126.0	126.0					4																	79420968		1980	4173	6153	SO:0001583	missense	80144			AB040933	CCDS54772.1	4q21.21	2014-06-25	2014-06-25		ENSG00000138759	ENSG00000138759			19185	protein-coding gene	gene with protein product		607830	"""Fraser syndrome 1"""			12766769, 3118036	Standard	NM_025074		Approved	FLJ22031, FLJ14927, KIAA1500	uc003hlb.2	Q86XX4	OTTHUMG00000160856	ENST00000264895.6:c.9209G>C	4.37:g.79420968G>C	ENSP00000264895:p.Arg3070Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRR8|Q86UZ4|Q8N3U9|Q8NAU7|Q96JW7|Q9H6N9|Q9P228	Missense_Mutation	SNP	pfam_Calx_beta,pfam_VWF_C,superfamily_Growth_fac_rcpt,superfamily_Cadherin-like,smart_VWC_out,smart_VWF_C,smart_Furin_repeat,smart_EG-like_dom,smart_Calx_beta,pfscan_VWF_C	p.R3070T	ENST00000264895.6	37	c.9209	CCDS54771.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	10.04|10.04	1.240225|1.240225	0.22711|0.22711	.|.	.|.	ENSG00000138759|ENSG00000138759	ENST00000512123|ENST00000264895	.|T	.|0.29397	.|1.57	5.91|5.91	5.06|5.06	0.68205|0.68205	.|.	.|0.150455	.|0.56097	.|D	.|0.000029	T|T	0.15565|0.15565	0.0375|0.0375	N|N	0.04043|0.04043	-0.29|-0.29	0.80722|0.80722	D|D	1|1	.|B;B	.|0.31879	.|0.095;0.344	.|B;B	.|0.34301	.|0.112;0.179	T|T	0.13255|0.13255	-1.0516|-1.0516	5|10	.|0.26408	.|T	.|0.33	.|.	11.619|11.619	0.51106|0.51106	0.1364:0.0:0.8636:0.0|0.1364:0.0:0.8636:0.0	.|.	.|3069;3070	.|Q86XX4-2;E9PHH6	.|.;.	H|T	1298|3070	.|ENSP00000264895:R3070T	.|ENSP00000264895:R3070T	Q|R	+|+	3|2	2|0	FRAS1|FRAS1	79639992|79639992	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.978000|0.978000	0.69477|0.69477	2.900000|2.900000	0.48687|0.48687	2.802000|2.802000	0.96397|0.96397	0.655000|0.655000	0.94253|0.94253	CAG|AGA	FRAS1	-	pfam_Calx_beta,smart_Calx_beta		0.552	FRAS1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FRAS1	HGNC	protein_coding		G			79420968	+1	no_errors	ENST00000264895	ensembl	human	known	70_37	missense	SNP	1.000	C
FTMT	94033	genome.wustl.edu	37	5	121187814	121187814	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:121187814C>T	ENST00000321339.1	+	1	165	c.156C>T	c.(154-156)gcC>gcT	p.A52A		NM_177478.1	NP_803431.1	Q8N4E7	FTMT_HUMAN	ferritin mitochondrial	52					cellular iron ion homeostasis (GO:0006879)|iron ion transport (GO:0006826)|positive regulation of cell proliferation (GO:0008284)|positive regulation of lyase activity (GO:0051349)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of transferase activity (GO:0051347)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	ferric iron binding (GO:0008199)|ferroxidase activity (GO:0004322)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)	33		all_cancers(142;0.0124)|Prostate(80;0.0322)	KIRC - Kidney renal clear cell carcinoma(527;0.206)	Epithelial(69;0.000171)|OV - Ovarian serous cystadenocarcinoma(64;0.000188)|all cancers(49;0.0027)		TGGCCGCAGCCGCCTCCTCCC	0.771																																																	0													6.0	8.0	8.0					5																	121187814		2092	4126	6218	SO:0001819	synonymous_variant	94033			BC034419	CCDS4128.1	5q23.1	2008-02-05			ENSG00000181867	ENSG00000181867			17345	protein-coding gene	gene with protein product		608847				11323407	Standard	NM_177478		Approved	MtF	uc003kss.3	Q8N4E7	OTTHUMG00000128912	ENST00000321339.1:c.156C>T	5.37:g.121187814C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ferritin_DPS_dom,superfamily_Ferritin/RNR-like,pfscan_Ferritin-like_diiron	p.A52	ENST00000321339.1	37	c.156	CCDS4128.1	5																																																																																			FTMT	-	NULL		0.771	FTMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTMT	HGNC	protein_coding	OTTHUMT00000250884.1	C	NM_177478		121187814	+1	no_errors	ENST00000321339	ensembl	human	known	70_37	silent	SNP	0.000	T
G6PD	2539	genome.wustl.edu	37	X	153763457	153763457	+	Silent	SNP	G	G	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:153763457G>T	ENST00000393564.2	-	5	523	c.411C>A	c.(409-411)ctC>ctA	p.L137L	G6PD_ENST00000369620.2_Silent_p.L137L|G6PD_ENST00000497281.1_5'UTR|G6PD_ENST00000393562.2_Silent_p.L167L	NM_001042351.1	NP_001035810.1	P11413	G6PD_HUMAN	glucose-6-phosphate dehydrogenase	137					carbohydrate metabolic process (GO:0005975)|cellular response to oxidative stress (GO:0034599)|cholesterol biosynthetic process (GO:0006695)|cytokine production (GO:0001816)|erythrocyte maturation (GO:0043249)|glucose 6-phosphate metabolic process (GO:0051156)|glutathione metabolic process (GO:0006749)|lipid metabolic process (GO:0006629)|NADP metabolic process (GO:0006739)|NADPH regeneration (GO:0006740)|negative regulation of protein glutathionylation (GO:0010734)|oxidation-reduction process (GO:0055114)|pentose biosynthetic process (GO:0019322)|pentose-phosphate shunt (GO:0006098)|pentose-phosphate shunt, oxidative branch (GO:0009051)|regulation of neuron apoptotic process (GO:0043523)|response to ethanol (GO:0045471)|response to food (GO:0032094)|response to organic cyclic compound (GO:0014070)|ribose phosphate biosynthetic process (GO:0046390)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	glucose binding (GO:0005536)|glucose-6-phosphate dehydrogenase activity (GO:0004345)|NADP binding (GO:0050661)|protein homodimerization activity (GO:0042803)			breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(3)|ovary(4)	18	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCAGGTAGAAGAGGCGGTTGG	0.602																																																	0													126.0	98.0	108.0					X																	153763457		2203	4300	6503	SO:0001819	synonymous_variant	2539			X03674	CCDS14756.2, CCDS44023.1	Xq28	2014-09-17			ENSG00000160211	ENSG00000160211	1.1.1.49		4057	protein-coding gene	gene with protein product		305900				3012556, 2428611	Standard	NM_000402		Approved	G6PD1	uc004flx.1	P11413	OTTHUMG00000024237	ENST00000393564.2:c.411C>A	X.37:g.153763457G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWX9|Q16000|Q16765|Q8IU70|Q8IU88|Q8IUA6|Q96PQ2	Silent	SNP	pfam_G6P_DH_C,pfam_G6P_DH_NAD-bd,pirsf_G6P_DH,prints_G6P_DH	p.L137	ENST00000393564.2	37	c.411	CCDS44023.1	X																																																																																			G6PD	-	pfam_G6P_DH_NAD-bd,pirsf_G6P_DH		0.602	G6PD-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	G6PD	HGNC	protein_coding	OTTHUMT00000061170.3	G	NM_000402		153763457	-1	no_errors	ENST00000369620	ensembl	human	known	70_37	silent	SNP	1.000	T
GCNT2	2651	genome.wustl.edu	37	6	10621627	10621627	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:10621627C>T	ENST00000379597.3	+	2	1525	c.969C>T	c.(967-969)ctC>ctT	p.L323L	GCNT2_ENST00000265012.4_Silent_p.L323L|GCNT2_ENST00000410107.1_Silent_p.L37L|GCNT2_ENST00000397423.2_3'UTR|GCNT2_ENST00000316170.3_Silent_p.L321L|GCNT2_ENST00000495262.1_Silent_p.L323L			Q8N0V5	GNT2A_HUMAN	glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (I blood group)	323					maintenance of lens transparency (GO:0036438)|negative regulation of cell-substrate adhesion (GO:0010812)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of protein kinase B signaling (GO:0051897)|posttranscriptional regulation of gene expression (GO:0010608)|protein glycosylation (GO:0006486)|transforming growth factor beta receptor signaling pathway (GO:0007179)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	N-acetyllactosaminide beta-1,6-N-acetylglucosaminyltransferase activity (GO:0008109)			endometrium(2)|kidney(1)|large_intestine(5)|lung(2)|ovary(2)	12	Ovarian(93;0.107)|Breast(50;0.148)	all_hematologic(90;0.107)		KIRC - Kidney renal clear cell carcinoma(1;0.099)|Kidney(1;0.119)		CTGGAAACCTCAGAGCTATAA	0.507																																																	0													95.0	82.0	86.0					6																	10621627		2203	4300	6503	SO:0001819	synonymous_variant	2651			L41605	CCDS4512.1, CCDS4513.1, CCDS34338.1	6p24.2	2014-07-18	2006-02-23		ENSG00000111846	ENSG00000111846	2.4.1.150	"""Blood group antigens"", ""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	4204	protein-coding gene	gene with protein product	"""Ii blood group"", ""unassigned linkage group 3"""	600429	"""glucosaminyl (N-acetyl) transferase 5"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme"", ""glucosaminyl (N-acetyl) transferase 2, I-branching enzyme (Ii blood group)"", ""cataract, congenital"""	NACGT1, II, GCNT5, CCAT		8449405, 9915862	Standard	NM_145649		Approved	IGNT, NAGCT1, bA421M1.1, bA360O19.2, ULG3	uc003mze.3	Q06430	OTTHUMG00000014244	ENST00000379597.3:c.969C>T	6.37:g.10621627C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Glyco_trans_14	p.L323	ENST00000379597.3	37	c.969	CCDS34338.1	6																																																																																			GCNT2	-	pfam_Glyco_trans_14		0.507	GCNT2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GCNT2	HGNC	protein_coding	OTTHUMT00000327912.3	C	NM_145649		10621627	+1	no_errors	ENST00000265012	ensembl	human	known	70_37	silent	SNP	0.871	T
GIGYF2	26058	genome.wustl.edu	37	2	233709239	233709239	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:233709239G>A	ENST00000409547.1	+	27	3571	c.3260G>A	c.(3259-3261)gGa>gAa	p.G1087E	GIGYF2_ENST00000373563.4_Missense_Mutation_p.G1087E|GIGYF2_ENST00000409196.3_Missense_Mutation_p.G1081E|GIGYF2_ENST00000409480.1_Missense_Mutation_p.G1109E|GIGYF2_ENST00000409451.3_Missense_Mutation_p.G1108E|GIGYF2_ENST00000452341.2_3'UTR|GIGYF2_ENST00000373566.3_Missense_Mutation_p.G1109E	NM_015575.3	NP_056390.2	Q6Y7W6	PERQ2_HUMAN	GRB10 interacting GYF protein 2	1087					adult locomotory behavior (GO:0008344)|cell death (GO:0008219)|cellular protein metabolic process (GO:0044267)|feeding behavior (GO:0007631)|homeostasis of number of cells within a tissue (GO:0048873)|insulin-like growth factor receptor signaling pathway (GO:0048009)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organism growth (GO:0035264)|musculoskeletal movement (GO:0050881)|negative regulation of translation (GO:0017148)|neuromuscular process controlling balance (GO:0050885)|post-embryonic development (GO:0009791)|spinal cord motor neuron differentiation (GO:0021522)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(4)|cervix(1)|endometrium(11)|kidney(2)|large_intestine(17)|lung(11)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	63		Breast(86;0.00279)|all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;7.37e-16)|BRCA - Breast invasive adenocarcinoma(100;0.000472)|LUSC - Lung squamous cell carcinoma(224;0.00902)|Lung(119;0.0118)|GBM - Glioblastoma multiforme(43;0.0145)		AAAGAGGTGGGACCTAGGAAT	0.458																																																	0													69.0	68.0	69.0					2																	233709239		2203	4300	6503	SO:0001583	missense	26058			U80751	CCDS33401.1, CCDS46542.1, CCDS46543.1	2q37.1	2011-07-06	2008-02-11	2008-02-11	ENSG00000204120	ENSG00000204120		"""Trinucleotide (CAG) repeat containing"""	11960	protein-coding gene	gene with protein product	"""GYF domain containing 2"""	612003	"""PERQ amino acid rich, with GYF domain 2"", ""PERQ amino acid rich, with GYF domain 3"", ""trinucleotide repeat containing 15"", ""Parkinson disease (autosomal recessive, early onset) 11"""	PERQ2, PERQ3, TNRC15, PARK11		9225980, 9734811, 12771153, 18358451, 19279319	Standard	NM_015575		Approved	KIAA0642, GYF2	uc002vtk.4	Q6Y7W6	OTTHUMG00000153237	ENST00000409547.1:c.3260G>A	2.37:g.233709239G>A	ENSP00000386537:p.Gly1087Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8W4|B9EG55|E9PBB0|O75137|Q7Z2Z8|Q7Z3I2|Q96HU4|Q9NV82	Missense_Mutation	SNP	pfam_GYF,superfamily_GYF,smart_GYF,pfscan_GYF	p.G1109E	ENST00000409547.1	37	c.3326	CCDS33401.1	2	.	.	.	.	.	.	.	.	.	.	G	15.42	2.826953	0.50739	.	.	ENSG00000204120	ENST00000373566;ENST00000373563;ENST00000409480;ENST00000409547;ENST00000409196;ENST00000409451;ENST00000426102	T;T;T;T;T;T	0.72505	-0.66;-0.66;-0.66;-0.66;-0.65;-0.66	5.82	5.82	0.92795	.	0.222310	0.48286	D	0.000192	T	0.64821	0.2633	L	0.48642	1.525	0.80722	D	1	B;B;B	0.24721	0.11;0.11;0.11	B;B;B	0.16722	0.016;0.016;0.016	T	0.60419	-0.7267	10	0.40728	T	0.16	-17.3643	15.5604	0.76240	0.0:0.1372:0.8628:0.0	.	1108;1087;1081	A6H8W4;Q6Y7W6;E9PBB0	.;PERQ2_HUMAN;.	E	1109;1087;1109;1087;1081;1108;116	ENSP00000362667:G1109E;ENSP00000362664:G1087E;ENSP00000386765:G1109E;ENSP00000386537:G1087E;ENSP00000387070:G1081E;ENSP00000387170:G1108E	ENSP00000362664:G1087E	G	+	2	0	GIGYF2	233417483	1.000000	0.71417	1.000000	0.80357	0.342000	0.28953	5.102000	0.64572	2.756000	0.94617	0.561000	0.74099	GGA	GIGYF2	-	NULL		0.458	GIGYF2-001	KNOWN	basic|CCDS	protein_coding	GIGYF2	HGNC	protein_coding	OTTHUMT00000330316.2	G	NM_001103146		233709239	+1	no_errors	ENST00000373566	ensembl	human	known	70_37	missense	SNP	1.000	A
GNA13	10672	genome.wustl.edu	37	17	63010459	63010459	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:63010459G>C	ENST00000439174.2	-	4	1295	c.1050C>G	c.(1048-1050)atC>atG	p.I350M	GNA13_ENST00000541118.1_Missense_Mutation_p.I255M	NM_006572.4	NP_006563.2	Q14344	GNA13_HUMAN	guanine nucleotide binding protein (G protein), alpha 13	350					activation of phospholipase D activity (GO:0031584)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|blood coagulation (GO:0007596)|cell differentiation (GO:0030154)|cellular component movement (GO:0006928)|in utero embryonic development (GO:0001701)|patterning of blood vessels (GO:0001569)|platelet activation (GO:0030168)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of cell migration (GO:0030334)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)|signal transduction (GO:0007165)	brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|heterotrimeric G-protein complex (GO:0005834)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	D5 dopamine receptor binding (GO:0031752)|G-protein beta/gamma-subunit complex binding (GO:0031683)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|metal ion binding (GO:0046872)|signal transducer activity (GO:0004871)|type 1 angiotensin receptor binding (GO:0031702)			breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(14)|kidney(2)|large_intestine(4)|lung(6)|urinary_tract(1)	34						TCTCCGTGTTGATAGCAGTGG	0.473																																																	0													142.0	107.0	119.0					17																	63010459		2203	4300	6503	SO:0001583	missense	10672			L22075	CCDS11661.1, CCDS62302.1	17q24.1	2014-09-04			ENSG00000120063	ENSG00000120063			4381	protein-coding gene	gene with protein product		604406				7791744	Standard	NM_006572		Approved	G13, MGC46138	uc002jfc.3	Q14344	OTTHUMG00000179316	ENST00000439174.2:c.1050C>G	17.37:g.63010459G>C	ENSP00000400717:p.Ile350Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R977|B7Z7R0|F5H1G8|Q8TD70	Missense_Mutation	SNP	pfam_Gprotein_alpha_su,pfam_Small_GTPase_ARF/SAR,superfamily_GproteinA_insert,smart_Gprotein_alpha_su,prints_Gprotein_alpha_su,prints_Gprotein_alpha12	p.I350M	ENST00000439174.2	37	c.1050	CCDS11661.1	17	.	.	.	.	.	.	.	.	.	.	G	15.95	2.983395	0.53827	.	.	ENSG00000120063	ENST00000439174;ENST00000541118;ENST00000239138	D;D	0.88741	-2.42;-2.42	5.93	2.55	0.30701	.	0.000000	0.85682	D	0.000000	D	0.91043	0.7182	M	0.67569	2.06	0.53005	D	0.999961	D	0.71674	0.998	D	0.81914	0.995	D	0.88575	0.3132	10	0.87932	D	0	.	2.7106	0.05174	0.4155:0.0:0.3788:0.2057	.	350	Q14344	GNA13_HUMAN	M	350;255;325	ENSP00000400717:I350M;ENSP00000439647:I255M	ENSP00000239138:I325M	I	-	3	3	GNA13	60440921	1.000000	0.71417	0.998000	0.56505	0.899000	0.52679	1.699000	0.37804	0.807000	0.34208	0.655000	0.94253	ATC	GNA13	-	pfam_Gprotein_alpha_su,smart_Gprotein_alpha_su,prints_Gprotein_alpha12		0.473	GNA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNA13	HGNC	protein_coding	OTTHUMT00000445720.1	G	NM_006572		63010459	-1	no_errors	ENST00000439174	ensembl	human	known	70_37	missense	SNP	1.000	C
GPR137C	283554	genome.wustl.edu	37	14	53098933	53098933	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:53098933C>G	ENST00000321662.6	+	4	773	c.773C>G	c.(772-774)tCt>tGt	p.S258C		NM_001099652.1	NP_001093122.1	Q8N3F9	G137C_HUMAN	G protein-coupled receptor 137C	258						integral component of membrane (GO:0016021)				NS(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	8	Breast(41;0.0716)					CTTCTGTACTCTTCCAGAGCT	0.368																																																	0													159.0	159.0	159.0					14																	53098933		1889	4107	5996	SO:0001583	missense	283554			BX647179	CCDS45106.1	14q22.1	2012-08-10				ENSG00000180998			25445	protein-coding gene	gene with protein product							Standard	NM_001099652		Approved	DKFZp762F0713, TM7SF1L2	uc001wzu.4	Q8N3F9		ENST00000321662.6:c.773C>G	14.37:g.53098933C>G	ENSP00000315106:p.Ser258Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SM2	Missense_Mutation	SNP	NULL	p.S258C	ENST00000321662.6	37	c.773	CCDS45106.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.22|18.22	3.575558|3.575558	0.65878|0.65878	.|.	.|.	ENSG00000180998|ENSG00000180998	ENST00000555622|ENST00000321662	.|T	.|0.48522	.|0.81	5.58|5.58	5.58|5.58	0.84498|0.84498	.|.	.|0.099954	.|0.64402	.|D	.|0.000002	T|T	0.60547|0.60547	0.2277|0.2277	L|L	0.52573|0.52573	1.65|1.65	0.49798|0.49798	D|D	0.99982|0.99982	.|D;D	.|0.76494	.|0.999;0.999	.|D;D	.|0.67382	.|0.951;0.951	T|T	0.58967|0.58967	-0.7542|-0.7542	5|10	.|0.51188	.|T	.|0.08	-14.5438|-14.5438	13.1872|13.1872	0.59688|0.59688	0.0:0.9269:0.0:0.0731|0.0:0.9269:0.0:0.0731	.|.	.|258;87	.|Q8N3F9;B3KW22	.|G137C_HUMAN;.	V|C	190|258	.|ENSP00000315106:S258C	.|ENSP00000315106:S258C	L|S	+|+	1|2	0|0	GPR137C|GPR137C	52168683|52168683	0.975000|0.975000	0.34042|0.34042	1.000000|1.000000	0.80357|0.80357	0.743000|0.743000	0.42351|0.42351	2.385000|2.385000	0.44371|0.44371	2.789000|2.789000	0.95967|0.95967	0.591000|0.591000	0.81541|0.81541	CTT|TCT	GPR137C	-	NULL		0.368	GPR137C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR137C	HGNC	protein_coding	OTTHUMT00000411685.1	C	XM_290615		53098933	+1	no_errors	ENST00000321662	ensembl	human	known	70_37	missense	SNP	1.000	G
GRIA1	2890	genome.wustl.edu	37	5	153144153	153144153	+	Silent	SNP	C	C	T	rs149931571		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:153144153C>T	ENST00000285900.5	+	12	2326	c.1983C>T	c.(1981-1983)taC>taT	p.Y661Y	GRIA1_ENST00000518142.1_Silent_p.Y581Y|GRIA1_ENST00000448073.4_Silent_p.Y671Y|GRIA1_ENST00000521843.2_Silent_p.Y592Y|GRIA1_ENST00000340592.5_Silent_p.Y661Y|GRIA1_ENST00000518783.1_Silent_p.Y671Y	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	661					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	AAATTGCCTACGGGACGCTGG	0.502													C|||	1	0.000199681	0.0008	0.0	5008	,	,		21138	0.0		0.0	False		,,,				2504	0.0																0								C	,	4,4402	8.1+/-20.4	0,4,2199	103.0	86.0	92.0		1983,1983	-10.5	0.1	5	dbSNP_134	92	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	GRIA1	NM_000827.3,NM_001114183.1	,	0,4,6499	TT,TC,CC		0.0,0.0908,0.0308	,	661/907,661/907	153144153	4,13002	2203	4300	6503	SO:0001819	synonymous_variant	2890				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.1983C>T	5.37:g.153144153C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.Y671	ENST00000285900.5	37	c.2013	CCDS4322.1	5																																																																																			GRIA1	-	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,smart_Iontro_glu_rcpt		0.502	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	C			153144153	+1	no_errors	ENST00000448073	ensembl	human	known	70_37	silent	SNP	0.528	T
GRIN3A	116443	genome.wustl.edu	37	9	104499904	104499904	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:104499904C>T	ENST00000361820.3	-	1	958	c.358G>A	c.(358-360)Gag>Aag	p.E120K		NM_133445.2	NP_597702.2	Q8TCU5	NMD3A_HUMAN	glutamate receptor, ionotropic, N-methyl-D-aspartate 3A	120					calcium ion transport (GO:0006816)|dendrite development (GO:0016358)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|response to ethanol (GO:0045471)|rhythmic process (GO:0048511)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glycine binding (GO:0016594)|identical protein binding (GO:0042802)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|neurotransmitter binding (GO:0042165)|protein phosphatase 2A binding (GO:0051721)	p.E120K(1)		breast(2)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(12)|lung(44)|ovary(4)|pancreas(1)|skin(7)|upper_aerodigestive_tract(1)	80		Acute lymphoblastic leukemia(62;0.0568)			Acamprosate(DB00659)|Acetylcysteine(DB06151)|Amantadine(DB00915)|Atomoxetine(DB00289)|Chloroprocaine(DB01161)|Dextromethorphan(DB00514)|Ethanol(DB00898)|Ethopropazine(DB00392)|Felbamate(DB00949)|Gabapentin(DB00996)|Halothane(DB01159)|Ketamine(DB01221)|Ketobemidone(DB06738)|Memantine(DB01043)|Methadone(DB00333)|Milnacipran(DB04896)|Orphenadrine(DB01173)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Procaine(DB00721)|Secobarbital(DB00418)|Tramadol(DB00193)	CACAGGGCCTCCGCCCTGGCG	0.716																																																	1	Substitution - Missense(1)	skin(1)																																								SO:0001583	missense	116443				CCDS6758.1	9q31.1	2012-08-29			ENSG00000198785	ENSG00000198785		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	16767	protein-coding gene	gene with protein product		606650					Standard	NM_133445		Approved	GluN3A	uc004bbp.2	Q8TCU5	OTTHUMG00000020387	ENST00000361820.3:c.358G>A	9.37:g.104499904C>T	ENSP00000355155:p.Glu120Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3DLF9|Q5VTR3|Q8TF29|Q8WXI6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,smart_Glu_rcpt_Glu/Gly-bd,smart_Iontro_glu_rcpt,prints_NMDA_rcpt	p.E120K	ENST00000361820.3	37	c.358	CCDS6758.1	9	.	.	.	.	.	.	.	.	.	.	C	12.29	1.894644	0.33442	.	.	ENSG00000198785	ENST00000361820	T	0.10192	2.9	4.8	4.8	0.61643	.	0.923285	0.09046	N	0.856539	T	0.10551	0.0258	N	0.22421	0.69	0.33827	D	0.629806	B	0.20887	0.049	B	0.19666	0.026	T	0.12578	-1.0542	10	0.36615	T	0.2	.	15.4078	0.74893	0.0:0.8608:0.1392:0.0	.	120	Q8TCU5	NMD3A_HUMAN	K	120	ENSP00000355155:E120K	ENSP00000355155:E120K	E	-	1	0	GRIN3A	103539725	0.959000	0.32827	0.979000	0.43373	0.189000	0.23516	2.466000	0.45084	2.392000	0.81423	0.655000	0.94253	GAG	GRIN3A	-	NULL		0.716	GRIN3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN3A	HGNC	protein_coding	OTTHUMT00000053453.1	C			104499904	-1	no_errors	ENST00000361820	ensembl	human	known	70_37	missense	SNP	0.995	T
GRTP1	79774	genome.wustl.edu	37	13	113980315	113980315	+	Silent	SNP	C	C	T	rs367749619		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr13:113980315C>T	ENST00000375431.4	-	6	728	c.654G>A	c.(652-654)ctG>ctA	p.L218L	GRTP1_ENST00000375430.4_Silent_p.L218L|GRTP1_ENST00000326039.3_Silent_p.L140L	NM_024719.2	NP_078995.2	Q5TC63	GRTP1_HUMAN	growth hormone regulated TBC protein 1	218	Rab-GAP TBC. {ECO:0000255|PROSITE- ProRule:PRU00163}.						Rab GTPase activator activity (GO:0005097)			cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)	14	Lung NSC(43;0.0161)|all_neural(89;0.0337)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0314)|all_epithelial(44;0.011)|all_lung(25;0.0271)|Lung NSC(25;0.0978)|Breast(118;0.188)	all cancers(43;0.025)|GBM - Glioblastoma multiforme(44;0.206)|Epithelial(84;0.246)			GACGCTCCATCAGGGCCCCCA	0.667																																																	0								C		0,4406		0,0,2203	56.0	66.0	62.0		654	2.7	0.6	13		62	1,8597	1.2+/-3.3	0,1,4298	no	coding-synonymous	GRTP1	NM_024719.2		0,1,6501	TT,TC,CC		0.0116,0.0,0.0077		218/337	113980315	1,13003	2203	4299	6502	SO:0001819	synonymous_variant	79774			AK026127	CCDS9534.2, CCDS66591.1, CCDS73606.1	13q34	2011-11-30			ENSG00000139835	ENSG00000139835			20310	protein-coding gene	gene with protein product						11564724	Standard	NM_001286732		Approved	FLJ22474, TBC1D6	uc001vtn.3	Q5TC63	OTTHUMG00000017381	ENST00000375431.4:c.654G>A	13.37:g.113980315C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B9A6K2|Q2M232|Q5TC64|Q66K26|Q6P659|Q8N528|Q9H695	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.L218	ENST00000375431.4	37	c.654	CCDS9534.2	13																																																																																			GRTP1	-	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom		0.667	GRTP1-002	PUTATIVE	basic|appris_principal|exp_conf|CCDS	protein_coding	GRTP1	HGNC	protein_coding	OTTHUMT00000045882.5	C	NM_024719		113980315	-1	no_errors	ENST00000375430	ensembl	human	known	70_37	silent	SNP	0.981	T
HAO1	54363	genome.wustl.edu	37	20	7920973	7920973	+	Missense_Mutation	SNP	C	C	T	rs375310753		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:7920973C>T	ENST00000378789.3	-	1	148	c.97G>A	c.(97-99)Gat>Aat	p.D33N		NM_017545.2	NP_060015.1	Q9UJM8	HAOX1_HUMAN	hydroxyacid oxidase (glycolate oxidase) 1	33	FMN hydroxy acid dehydrogenase. {ECO:0000255|PROSITE-ProRule:PRU00683}.				cellular nitrogen compound metabolic process (GO:0034641)|fatty acid alpha-oxidation (GO:0001561)|glycolate catabolic process (GO:0046296)|glyoxylate metabolic process (GO:0046487)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	(S)-2-hydroxy-acid oxidase activity (GO:0003973)|FMN binding (GO:0010181)|glycolate oxidase activity (GO:0008891)|glyoxylate oxidase activity (GO:0047969)|long-chain-(S)-2-hydroxy-long-chain-acid oxidase activity (GO:0052853)|medium-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052854)|receptor binding (GO:0005102)|very-long-chain-(S)-2-hydroxy-acid oxidase activity (GO:0052852)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(19)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	36						GTTTCTTCATCATTTGCCCCA	0.318																																																	0								C	ASN/ASP	1,4405	2.1+/-5.4	0,1,2202	68.0	67.0	67.0		97	5.2	1.0	20		67	0,8600		0,0,4300	no	missense	HAO1	NM_017545.2	23	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	benign	33/371	7920973	1,13005	2203	4300	6503	SO:0001583	missense	54363			AL021879	CCDS13100.1	20p12	2005-01-10			ENSG00000101323	ENSG00000101323	1.1.3.15		4809	protein-coding gene	gene with protein product		605023		GOX1		9891009	Standard	NM_017545		Approved	GOX	uc002wmw.1	Q9UJM8	OTTHUMG00000031841	ENST00000378789.3:c.97G>A	20.37:g.7920973C>T	ENSP00000368066:p.Asp33Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CQ0|Q9UPZ0|Q9Y3I7	Missense_Mutation	SNP	pfam_FMN-dep_DH,pfam_Glu_synth_centr_C,pirsf_Alpha-hydoxy_acid_DH_FMN	p.D33N	ENST00000378789.3	37	c.97	CCDS13100.1	20	.	.	.	.	.	.	.	.	.	.	C	16.98	3.272158	0.59649	2.27E-4	0.0	ENSG00000101323	ENST00000378789	T	0.34667	1.35	5.16	5.16	0.70880	Aldolase-type TIM barrel (1);FMN-dependent dehydrogenase (1);	0.220504	0.51477	D	0.000094	T	0.41213	0.1149	L	0.58810	1.83	0.58432	D	0.999991	B;B	0.16802	0.019;0.019	B;B	0.25987	0.065;0.065	T	0.32640	-0.9899	10	0.59425	D	0.04	-3.493	17.7728	0.88497	0.0:1.0:0.0:0.0	.	33;33	A8K058;Q9UJM8	.;HAOX1_HUMAN	N	33	ENSP00000368066:D33N	ENSP00000368066:D33N	D	-	1	0	HAO1	7868973	1.000000	0.71417	1.000000	0.80357	0.786000	0.44442	4.501000	0.60393	2.548000	0.85928	0.561000	0.74099	GAT	HAO1	-	pfam_FMN-dep_DH,pirsf_Alpha-hydoxy_acid_DH_FMN		0.318	HAO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAO1	HGNC	protein_coding	OTTHUMT00000077926.2	C			7920973	-1	no_errors	ENST00000378789	ensembl	human	known	70_37	missense	SNP	1.000	T
HECTD1	25831	genome.wustl.edu	37	14	31578721	31578721	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:31578721C>T	ENST00000399332.1	-	36	6850	c.6362G>A	c.(6361-6363)gGa>gAa	p.G2121E	HECTD1_ENST00000553700.1_Missense_Mutation_p.G2121E	NM_015382.2	NP_056197.2	Q9ULT8	HECD1_HUMAN	HECT domain containing E3 ubiquitin protein ligase 1	2121					neural tube closure (GO:0001843)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)|ubiquitin-protein transferase activity (GO:0004842)			breast(10)|endometrium(7)|kidney(5)|large_intestine(12)|lung(23)|ovary(4)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	70	Hepatocellular(127;0.0877)|Breast(36;0.176)		LUAD - Lung adenocarcinoma(48;0.00292)|Lung(238;0.0164)|BRCA - Breast invasive adenocarcinoma(188;0.111)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.00617)		TCGAAACTCTCCAGGGTCATC	0.458																																																	0													106.0	107.0	107.0					14																	31578721		2049	4205	6254	SO:0001583	missense	25831			AB032957	CCDS41939.1	14q12	2013-01-10	2012-02-23		ENSG00000092148	ENSG00000092148		"""Ankyrin repeat domain containing"""	20157	protein-coding gene	gene with protein product			"""HECT domain containing 1"""			10574461	Standard	XM_005267502		Approved	KIAA1131	uc001wrc.1	Q9ULT8	OTTHUMG00000170670	ENST00000399332.1:c.6362G>A	14.37:g.31578721C>T	ENSP00000382269:p.Gly2121Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DS86|Q6P445|Q86VJ1|Q96F34|Q9UFZ7	Missense_Mutation	SNP	pfam_HECT,pfam_Sad1_UNC_C,pfam_Mib_Herc2,pfam_Ankyrin_rpt,superfamily_HECT,superfamily_Ankyrin_rpt-contain_dom,superfamily_ARM-type_fold,superfamily_Galactose-bd-like,smart_Ankyrin_rpt,smart_HECT,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_HECT	p.G2121E	ENST00000399332.1	37	c.6362	CCDS41939.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	17.00|17.00	3.277003|3.277003	0.59758|0.59758	.|.	.|.	ENSG00000092148|ENSG00000092148	ENST00000554882|ENST00000553700;ENST00000261312;ENST00000399332	.|T;T	.|0.08720	.|3.06;3.06	5.73|5.73	5.73|5.73	0.89815|0.89815	.|.	.|0.000000	.|0.64402	.|U	.|0.000001	T|T	0.12732|0.12732	0.0309|0.0309	M|M	0.64404|0.64404	1.975|1.975	0.80722|0.80722	D|D	1|1	.|D	.|0.54047	.|0.964	.|P	.|0.44811	.|0.461	T|T	0.10965|0.10965	-1.0607|-1.0607	5|10	.|0.02654	.|T	.|1	-14.1036|-14.1036	19.8893|19.8893	0.96923|0.96923	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|2121	.|Q9ULT8	.|HECD1_HUMAN	K|E	487|2121;2123;2121	.|ENSP00000450697:G2121E;ENSP00000382269:G2121E	.|ENSP00000261312:G2123E	E|G	-|-	1|2	0|0	HECTD1|HECTD1	30648472|30648472	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.252000|7.252000	0.78309|0.78309	2.704000|2.704000	0.92352|0.92352	0.585000|0.585000	0.79938|0.79938	GAG|GGA	HECTD1	-	NULL		0.458	HECTD1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	HECTD1	HGNC	protein_coding	OTTHUMT00000409942.1	C			31578721	-1	no_errors	ENST00000399332	ensembl	human	known	70_37	missense	SNP	1.000	T
HESX1	8820	genome.wustl.edu	37	3	57232436	57232436	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:57232436C>G	ENST00000295934.3	-	3	478	c.442G>C	c.(442-444)Gag>Cag	p.E148Q	HESX1_ENST00000473921.1_Intron	NM_003865.2	NP_003856.1	Q9UBX0	HESX1_HUMAN	HESX homeobox 1	148					brain development (GO:0007420)|forebrain morphogenesis (GO:0048853)|negative regulation of transcription, DNA-templated (GO:0045892)|nose development (GO:0043584)|otic vesicle formation (GO:0030916)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)	p.E148K(1)		large_intestine(2)|lung(1)|ovary(1)|prostate(1)|skin(2)	7				KIRC - Kidney renal clear cell carcinoma(284;0.0109)|Kidney(284;0.0126)		CTGTCTTCCTCTAGATTCAAT	0.269																																					Esophageal Squamous(84;267 1272 9034 48993 52677)												1	Substitution - Missense(1)	skin(1)											47.0	50.0	49.0					3																	57232436		2199	4289	6488	SO:0001583	missense	8820			AF059734	CCDS2881.1	3p14.3	2014-06-16	2007-02-16		ENSG00000163666	ENSG00000163666		"""Homeoboxes / PRD class"""	4877	protein-coding gene	gene with protein product		601802	"""homeobox, ES cell expressed 1"""			9373136, 9620767, 7876132	Standard	NM_003865		Approved	RPX, ANF	uc003din.4	Q9UBX0	OTTHUMG00000158597	ENST00000295934.3:c.442G>C	3.37:g.57232436C>G	ENSP00000295934:p.Glu148Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LC5|Q99667	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.E148Q	ENST00000295934.3	37	c.442	CCDS2881.1	3	.	.	.	.	.	.	.	.	.	.	C	16.75	3.208927	0.58343	.	.	ENSG00000163666	ENST00000295934	D	0.95518	-3.73	5.83	5.83	0.93111	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.065581	0.64402	D	0.000007	D	0.92586	0.7645	N	0.02830	-0.485	0.80722	D	1	D	0.59357	0.985	P	0.58266	0.836	D	0.91461	0.5189	10	0.18276	T	0.48	-18.0631	20.1197	0.97955	0.0:1.0:0.0:0.0	.	148	Q9UBX0	HESX1_HUMAN	Q	148	ENSP00000295934:E148Q	ENSP00000295934:E148Q	E	-	1	0	HESX1	57207476	1.000000	0.71417	0.999000	0.59377	0.993000	0.82548	6.193000	0.72075	2.747000	0.94245	0.585000	0.79938	GAG	HESX1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.269	HESX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HESX1	HGNC	protein_coding	OTTHUMT00000351430.2	C			57232436	-1	no_errors	ENST00000295934	ensembl	human	known	70_37	missense	SNP	1.000	G
HOXC5	3222	genome.wustl.edu	37	12	54428255	54428255	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:54428255G>A	ENST00000312492.2	+	2	918	c.648G>A	c.(646-648)atG>atA	p.M216I	RP11-834C11.12_ENST00000513209.1_Missense_Mutation_p.M120I|MIR615_ENST00000384839.1_RNA|HOXC4_ENST00000303406.4_Intron|RP11-834C11.14_ENST00000512206.1_RNA	NM_018953.2	NP_061826.1	Q00444	HXC5_HUMAN	homeobox C5	216					anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system development (GO:0048706)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			cervix(1)|large_intestine(1)|lung(6)|pancreas(1)|prostate(2)|urinary_tract(1)	12						ATTCCAAAATGAAAAGCAAAG	0.537																																																	0													38.0	42.0	40.0					12																	54428255		2203	4300	6503	SO:0001583	missense	3222				CCDS8872.1	12q13.13	2011-06-20	2005-12-22		ENSG00000172789	ENSG00000172789		"""Homeoboxes / ANTP class : HOXL subclass"""	5127	protein-coding gene	gene with protein product		142973	"""homeo box C5"""	HOX3D, HOX3		1973146, 1358459	Standard	NM_018953		Approved		uc001sew.3	Q00444	OTTHUMG00000160028	ENST00000312492.2:c.648G>A	12.37:g.54428255G>A	ENSP00000309336:p.Met216Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.M216I	ENST00000312492.2	37	c.648	CCDS8872.1	12	.	.	.	.	.	.	.	.	.	.	G	10.65	1.408699	0.25378	.	.	ENSG00000172789	ENST00000312492	D	0.89746	-2.56	4.3	2.45	0.29901	Homeodomain-related (1);Homeobox (1);Homeodomain-like (1);	0.000000	0.51477	D	0.000087	T	0.68568	0.3015	N	0.01493	-0.835	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.63642	-0.6591	10	0.56958	D	0.05	.	5.7646	0.18219	0.191:0.1658:0.6432:0.0	.	216	Q00444	HXC5_HUMAN	I	216	ENSP00000309336:M216I	ENSP00000309336:M216I	M	+	3	0	HOXC5	52714522	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.292000	0.43549	1.150000	0.42419	0.561000	0.74099	ATG	HOXC5	-	superfamily_Homeodomain-like,smart_Homeodomain		0.537	HOXC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC5	HGNC	protein_coding	OTTHUMT00000358947.1	G			54428255	+1	no_errors	ENST00000312492	ensembl	human	known	70_37	missense	SNP	1.000	A
HSPG2	3339	genome.wustl.edu	37	1	22168565	22168565	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:22168565G>A	ENST00000374695.3	-	69	9202	c.9123C>T	c.(9121-9123)ttC>ttT	p.F3041F		NM_005529.5	NP_005520.4	P98160	PGBM_HUMAN	heparan sulfate proteoglycan 2	3041	Ig-like C2-type 16.				angiogenesis (GO:0001525)|brain development (GO:0007420)|carbohydrate metabolic process (GO:0005975)|cardiac muscle tissue development (GO:0048738)|cartilage development involved in endochondral bone morphogenesis (GO:0060351)|chondrocyte differentiation (GO:0002062)|chondroitin sulfate metabolic process (GO:0030204)|embryonic skeletal system morphogenesis (GO:0048704)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|lipoprotein metabolic process (GO:0042157)|phototransduction, visible light (GO:0007603)|protein localization (GO:0008104)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	basal lamina (GO:0005605)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi lumen (GO:0005796)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|protein C-terminus binding (GO:0008022)			breast(6)|central_nervous_system(1)|cervix(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(15)|liver(1)|lung(44)|ovary(10)|pancreas(1)|prostate(10)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(3)	127		Colorectal(325;3.46e-05)|all_lung(284;7.93e-05)|Lung NSC(340;8.71e-05)|Renal(390;0.000219)|Breast(348;0.00222)|Ovarian(437;0.00308)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0498)|OV - Ovarian serous cystadenocarcinoma(117;1.14e-26)|Colorectal(126;4.18e-07)|COAD - Colon adenocarcinoma(152;1.82e-05)|GBM - Glioblastoma multiforme(114;3.13e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000756)|STAD - Stomach adenocarcinoma(196;0.00656)|KIRC - Kidney renal clear cell carcinoma(1967;0.00942)|READ - Rectum adenocarcinoma(331;0.0721)|Lung(427;0.223)	Palifermin(DB00039)	TGAGGCACTTGAAGCTGGCAT	0.677																																																	0													37.0	36.0	37.0					1																	22168565		2203	4300	6503	SO:0001819	synonymous_variant	3339			M85289	CCDS30625.1	1p36.1-p35	2013-01-29	2007-02-16	2007-02-16	ENSG00000142798	ENSG00000142798		"""Proteoglycans / Extracellular Matrix : Other"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5273	protein-coding gene	gene with protein product	"""perlecan proteoglycan"""	142461	"""Schwartz-Jampel syndrome 1 (chondrodystrophic myotonia)"""	SJS1		1685141, 11941538	Standard	XM_005245863		Approved	perlecan, PRCAN	uc001bfj.3	P98160	OTTHUMG00000002674	ENST00000374695.3:c.9123C>T	1.37:g.22168565G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16287|Q5SZI3|Q9H3V5	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Laminin_G,pfam_Laminin_B_type_IV,pfam_EGF_laminin,pfam_LDrepeatLR_classA_rpt,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_LDrepeatLR_classA_rpt,smart_SEA,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Laminin_B_subgr,smart_EGF_laminin,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_LDrepeatLR_classA_rpt,pfscan_SEA,pfscan_Ig-like	p.F3041	ENST00000374695.3	37	c.9123	CCDS30625.1	1																																																																																			HSPG2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.677	HSPG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPG2	HGNC	protein_coding	OTTHUMT00000007598.1	G	NM_005529		22168565	-1	no_errors	ENST00000374695	ensembl	human	known	70_37	silent	SNP	1.000	A
HSPH1	10808	genome.wustl.edu	37	13	31725797	31725797	+	Silent	SNP	T	T	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr13:31725797T>C	ENST00000320027.5	-	6	956	c.612A>G	c.(610-612)ggA>ggG	p.G204G	HSPH1_ENST00000380405.4_Silent_p.G204G|HSPH1_ENST00000380406.5_Silent_p.G163G|HSPH1_ENST00000429785.2_Intron|HSPH1_ENST00000445273.2_Silent_p.G206G	NM_006644.2	NP_006635.2	Q92598	HS105_HUMAN	heat shock 105kDa/110kDa protein 1	204					chaperone mediated protein folding requiring cofactor (GO:0051085)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of NK T cell activation (GO:0051135)|response to unfolded protein (GO:0006986)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)			breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	27		Lung SC(185;0.0257)		all cancers(112;0.00385)|Epithelial(112;0.0328)|OV - Ovarian serous cystadenocarcinoma(117;0.0375)|GBM - Glioblastoma multiforme(144;0.125)		AAGCTGAATGTCCCATATCAA	0.378																																																	0													84.0	76.0	79.0					13																	31725797		2203	4300	6503	SO:0001819	synonymous_variant	10808			AB003333	CCDS9340.1, CCDS66525.1, CCDS73559.1	13q12.2-q13.3	2011-09-02			ENSG00000120694	ENSG00000120694		"""Heat shock proteins / HSP70"""	16969	protein-coding gene	gene with protein product		610703				9610721, 9931472	Standard	XM_005266236		Approved	HSP105B, KIAA0201, HSP105A, NY-CO-25	uc001utj.3	Q92598	OTTHUMG00000016685	ENST00000320027.5:c.612A>G	13.37:g.31725797T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYH1|O95739|Q5TBM6|Q5TBM7|Q5TBM8|Q9UPC4	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.G206	ENST00000320027.5	37	c.618	CCDS9340.1	13																																																																																			HSPH1	-	pfam_Hsp_70_fam,pfam_MreB_Mrl		0.378	HSPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPH1	HGNC	protein_coding	OTTHUMT00000044384.1	T			31725797	-1	no_errors	ENST00000445273	ensembl	human	known	70_37	silent	SNP	0.997	C
HUWE1	10075	genome.wustl.edu	37	X	53589843	53589843	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:53589843C>T	ENST00000342160.3	-	52	7610	c.7153G>A	c.(7153-7155)Gaa>Aaa	p.E2385K	HUWE1_ENST00000262854.6_Missense_Mutation_p.E2385K			Q7Z6Z7	HUWE1_HUMAN	HECT, UBA and WWE domain containing 1, E3 ubiquitin protein ligase	2385	Glu-rich.				base-excision repair (GO:0006284)|cell differentiation (GO:0030154)|histone ubiquitination (GO:0016574)|protein monoubiquitination (GO:0006513)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(15)|central_nervous_system(1)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(29)|liver(2)|lung(52)|ovary(11)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(2)	153						GAAGGAGCTTCATCCATCAGC	0.547																																																	0													219.0	146.0	171.0					X																	53589843		2203	4300	6503	SO:0001583	missense	10075			AB071605	CCDS35301.1	Xp11.22	2014-06-09	2012-02-23		ENSG00000086758	ENSG00000086758			30892	protein-coding gene	gene with protein product		300697	"""HECT, UBA and WWE domain containing 1"""			9205841, 10998601	Standard	NM_031407		Approved	Ib772, KIAA0312, UREB1	uc004dsp.4	Q7Z6Z7	OTTHUMG00000021617	ENST00000342160.3:c.7153G>A	X.37:g.53589843C>T	ENSP00000340648:p.Glu2385Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O15029|Q4G2Z2|Q5H961|Q6P4D0|Q8NG67|Q9BUI0|Q9HCJ4|Q9NSL6|Q9P0A9	Missense_Mutation	SNP	pfam_E3_Ub_ligase_DUF913,pfam_HECT,pfam_E3_Ub_ligase_DUF908,pfam_WWE-dom,pfam_UBA/transl_elong_EF1B_N,superfamily_HECT,superfamily_UBA-like,superfamily_ARM-type_fold,smart_UBA/transl_elong_EF1B_N_euk,smart_HECT,pfscan_HECT,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_WWE-dom	p.E2385K	ENST00000342160.3	37	c.7153	CCDS35301.1	X	.	.	.	.	.	.	.	.	.	.	C	18.59	3.656278	0.67586	.	.	ENSG00000086758	ENST00000342160;ENST00000262854	T;T	0.44083	0.93;0.93	5.89	5.89	0.94794	.	0.055894	0.64402	D	0.000001	T	0.42765	0.1217	N	0.19112	0.55	0.58432	D	0.999995	D;D	0.56968	0.963;0.978	P;P	0.53062	0.525;0.717	T	0.22941	-1.0202	10	0.33940	T	0.23	.	17.7712	0.88493	0.0:1.0:0.0:0.0	.	2385;2385	Q7Z6Z7;Q7Z6Z7-2	HUWE1_HUMAN;.	K	2385	ENSP00000340648:E2385K;ENSP00000262854:E2385K	ENSP00000262854:E2385K	E	-	1	0	HUWE1	53606568	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.140000	0.77322	2.470000	0.83445	0.600000	0.82982	GAA	HUWE1	-	NULL		0.547	HUWE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HUWE1	HGNC	protein_coding	OTTHUMT00000056766.1	C	XM_497119		53589843	-1	no_errors	ENST00000262854	ensembl	human	known	70_37	missense	SNP	1.000	T
IDI2	91734	genome.wustl.edu	37	10	1070526	1070526	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:1070526C>T	ENST00000277517.1	-	2	202	c.138G>A	c.(136-138)gaG>gaA	p.E46E	IDI2-AS1_ENST00000428780.2_RNA|IDI2-AS1_ENST00000434470.1_RNA|IDI2-AS1_ENST00000437374.1_RNA|IDI2-AS1_ENST00000536039.1_RNA|IDI2-AS1_ENST00000420381.1_RNA	NM_033261.2	NP_150286.1	Q9BXS1	IDI2_HUMAN	isopentenyl-diphosphate delta isomerase 2	46					cholesterol biosynthetic process (GO:0006695)|dimethylallyl diphosphate biosynthetic process (GO:0050992)|isopentenyl diphosphate metabolic process (GO:0046490)|isoprenoid biosynthetic process (GO:0008299)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|peroxisome (GO:0005777)	hydrolase activity (GO:0016787)|isopentenyl-diphosphate delta-isomerase activity (GO:0004452)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(3)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	9		Colorectal(49;0.235)	OV - Ovarian serous cystadenocarcinoma(33;0.143)	Epithelial(11;0.067)|OV - Ovarian serous cystadenocarcinoma(14;0.169)|all cancers(11;0.192)		GGCTACCTTTCTCAATGTTTT	0.493																																																	0													105.0	94.0	98.0					10																	1070526		2203	4300	6503	SO:0001819	synonymous_variant	91734			AF271725	CCDS7055.1	10p15.3	2003-11-19			ENSG00000148377	ENSG00000148377			23487	protein-coding gene	gene with protein product		615389				12477932	Standard	NM_033261		Approved	IPPI2	uc001ifv.1	Q9BXS1	OTTHUMG00000017537	ENST00000277517.1:c.138G>A	10.37:g.1070526C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1	p.E46	ENST00000277517.1	37	c.138	CCDS7055.1	10																																																																																			IDI2	-	superfamily_NUDIX_hydrolase_dom-like,pirsf_IsopentenylPP_isomerase_typ1,tigrfam_IsopentenylPP_isomerase_typ1		0.493	IDI2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDI2	HGNC	protein_coding	OTTHUMT00000046411.1	C	NM_033261		1070526	-1	no_errors	ENST00000277517	ensembl	human	known	70_37	silent	SNP	0.381	T
IGF2BP3	10643	genome.wustl.edu	37	7	23353181	23353181	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:23353181G>C	ENST00000258729.3	-	13	1843	c.1487C>G	c.(1486-1488)tCc>tGc	p.S496C		NM_006547.2	NP_006538.2	O00425	IF2B3_HUMAN	insulin-like growth factor 2 mRNA binding protein 3	496	KH 4. {ECO:0000255|PROSITE- ProRule:PRU00117}.				anatomical structure morphogenesis (GO:0009653)|gene expression (GO:0010467)|mRNA transport (GO:0051028)|negative regulation of translation (GO:0017148)|regulation of cytokine biosynthetic process (GO:0042035)|translation (GO:0006412)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|translation regulator activity (GO:0045182)			breast(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(14)|ovary(2)|prostate(2)|skin(4)|stomach(1)	34						AGCAGCAAAGGATGGCACTCT	0.413																																																	0													146.0	141.0	143.0					7																	23353181		2203	4300	6503	SO:0001583	missense	10643			AF117108	CCDS5382.1	7p15.3	2014-02-19			ENSG00000136231	ENSG00000136231		"""RNA binding motif (RRM) containing"""	28868	protein-coding gene	gene with protein product	"""IGF II mRNA binding protein 3"", ""cancer/testis antigen 98"""	608259				9891060, 9178771	Standard	NM_006547		Approved	IMP-3, CT98, IMP3	uc003swg.3	O00425	OTTHUMG00000128445	ENST00000258729.3:c.1487C>G	7.37:g.23353181G>C	ENSP00000258729:p.Ser496Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A4Z5|Q63HM0|Q6MZZ2|Q86VB1	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_RRM_dom,smart_RRM_dom,smart_KH_dom,pfscan_KH_dom_type_1,pfscan_RRM_dom	p.S496C	ENST00000258729.3	37	c.1487	CCDS5382.1	7	.	.	.	.	.	.	.	.	.	.	G	27.8	4.865245	0.91511	.	.	ENSG00000136231	ENST00000258729	T	0.34072	1.38	5.55	5.55	0.83447	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.049590	0.85682	D	0.000000	T	0.66906	0.2837	M	0.86502	2.82	0.80722	D	1	D	0.76494	0.999	D	0.69479	0.964	T	0.72033	-0.4412	10	0.87932	D	0	-6.6644	19.8764	0.96873	0.0:0.0:1.0:0.0	.	496	O00425	IF2B3_HUMAN	C	496	ENSP00000258729:S496C	ENSP00000258729:S496C	S	-	2	0	IGF2BP3	23319706	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.807000	0.99171	2.768000	0.95171	0.655000	0.94253	TCC	IGF2BP3	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.413	IGF2BP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGF2BP3	HGNC	protein_coding	OTTHUMT00000250243.2	G	NM_006547		23353181	-1	no_errors	ENST00000258729	ensembl	human	known	70_37	missense	SNP	1.000	C
IGSF21	84966	genome.wustl.edu	37	1	18703404	18703404	+	Silent	SNP	C	C	T	rs145075430		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:18703404C>T	ENST00000251296.1	+	8	1595	c.1212C>T	c.(1210-1212)gcC>gcT	p.A404A	IGSF21_ENST00000473951.1_3'UTR	NM_032880.4	NP_116269.3	Q96ID5	IGS21_HUMAN	immunoglobin superfamily, member 21	404	Ig-like 2.					extracellular region (GO:0005576)				endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(16)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	40		Colorectal(325;0.000147)|Renal(390;0.00145)|all_lung(284;0.00366)|Lung NSC(340;0.00376)|Breast(348;0.00387)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0439)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0121)|BRCA - Breast invasive adenocarcinoma(304;5.52e-05)|Kidney(64;0.00103)|KIRC - Kidney renal clear cell carcinoma(64;0.0102)|STAD - Stomach adenocarcinoma(196;0.0118)|READ - Rectum adenocarcinoma(331;0.157)		GGGTTCCCGCCGAGCTCAATG	0.662																																																	0								C		1,4405	2.1+/-5.4	0,1,2202	43.0	42.0	43.0		1212	-5.9	0.5	1	dbSNP_134	43	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	IGSF21	NM_032880.4		0,3,6500	TT,TC,CC		0.0233,0.0227,0.0231		404/468	18703404	3,13003	2203	4300	6503	SO:0001819	synonymous_variant	84966			AK075316	CCDS184.1	1p36.13	2013-01-29			ENSG00000117154	ENSG00000117154		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	28246	protein-coding gene	gene with protein product						12477932	Standard	NM_032880		Approved	MGC15730, RP11-121A23.1	uc001bau.2	Q96ID5	OTTHUMG00000002432	ENST00000251296.1:c.1212C>T	1.37:g.18703404C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NBR8	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like	p.A404	ENST00000251296.1	37	c.1212	CCDS184.1	1																																																																																			IGSF21	-	smart_Ig_sub,pfscan_Ig-like		0.662	IGSF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF21	HGNC	protein_coding	OTTHUMT00000006924.1	C	NM_032880		18703404	+1	no_errors	ENST00000251296	ensembl	human	known	70_37	silent	SNP	0.171	T
IKZF2	22807	genome.wustl.edu	37	2	213872482	213872482	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:213872482C>A	ENST00000434687.1	-	9	1492	c.1183G>T	c.(1183-1185)Gaa>Taa	p.E395*	IKZF2_ENST00000374327.4_Nonsense_Mutation_p.E250*|IKZF2_ENST00000451136.2_Nonsense_Mutation_p.E323*|AC079610.1_ENST00000415387.1_RNA|IKZF2_ENST00000342002.2_Nonsense_Mutation_p.E401*|IKZF2_ENST00000421754.2_Nonsense_Mutation_p.E321*|IKZF2_ENST00000374319.4_Nonsense_Mutation_p.E369*|IKZF2_ENST00000457361.1_Nonsense_Mutation_p.E395*|IKZF2_ENST00000413091.3_3'UTR			Q9UKS7	IKZF2_HUMAN	IKAROS family zinc finger 2 (Helios)	395					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(7)|lung(7)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	23		Esophageal squamous(248;0.0559)|Renal(323;0.218)		UCEC - Uterine corpus endometrioid carcinoma (47;0.214)|Epithelial(149;2.97e-07)|all cancers(144;1.53e-05)|LUSC - Lung squamous cell carcinoma(224;0.00599)|Lung(261;0.00792)		GCCTCTCTTTCCTGGGGTCGA	0.498																																																	0													117.0	116.0	117.0					2																	213872482		2203	4300	6503	SO:0001587	stop_gained	22807			AF130863	CCDS2395.1, CCDS46507.1	2q13.1	2013-01-08	2006-08-25	2006-08-25	ENSG00000030419	ENSG00000030419		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13177	protein-coding gene	gene with protein product		606234	"""zinc finger protein, subfamily 1A, 2 (Helios)"""	ZNFN1A2		9512513, 9560339	Standard	NM_001079526		Approved	Helios	uc002vem.3	Q9UKS7	OTTHUMG00000133005	ENST00000434687.1:c.1183G>T	2.37:g.213872482C>A	ENSP00000412869:p.Glu395*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53YJ5|Q6PQC5|Q6PQC6|Q6PQC7|Q6PQC8|Q6PQD0|Q6PQD1|Q8N6S1	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E395*	ENST00000434687.1	37	c.1183	CCDS2395.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.783646	0.96937	.	.	ENSG00000030419	ENST00000457361;ENST00000342002;ENST00000434687;ENST00000374319;ENST00000451136;ENST00000421754;ENST00000374327;ENST00000542010	.	.	.	6.17	6.17	0.99709	.	0.065760	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-8.2416	20.8794	0.99867	0.0:1.0:0.0:0.0	.	.	.	.	X	395;401;395;369;323;321;250;99	.	ENSP00000342876:E401X	E	-	1	0	IKZF2	213580727	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	4.716000	0.61916	2.941000	0.99782	0.655000	0.94253	GAA	IKZF2	-	NULL		0.498	IKZF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IKZF2	HGNC	protein_coding	OTTHUMT00000256593.3	C	NM_016260		213872482	-1	no_errors	ENST00000434687	ensembl	human	known	70_37	nonsense	SNP	1.000	A
IL11RA	3590	genome.wustl.edu	37	9	34658549	34658549	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:34658549G>C	ENST00000555003.1	+	8	2035	c.679G>C	c.(679-681)Gag>Cag	p.E227Q	IL11RA_ENST00000441545.2_Missense_Mutation_p.E227Q|IL11RA_ENST00000318041.9_Missense_Mutation_p.E227Q|IL11RA_ENST00000378817.4_Missense_Mutation_p.E227Q|IL11RA_ENST00000602473.1_Missense_Mutation_p.E227Q			Q14626	I11RA_HUMAN	interleukin 11 receptor, alpha	227	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				developmental process (GO:0032502)|embryo implantation (GO:0007566)|head development (GO:0060322)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)	cytokine receptor activity (GO:0004896)|signal transducer activity (GO:0004871)|transmembrane signaling receptor activity (GO:0004888)			breast(1)|large_intestine(1)|ovary(1)|skin(1)	4	all_epithelial(49;0.102)		STAD - Stomach adenocarcinoma(86;0.178)	GBM - Glioblastoma multiforme(74;0.174)	Oprelvekin(DB00038)	CCTGCGGGTAGAGTCAGTACC	0.607																																																	0													69.0	64.0	65.0					9																	34658549		2203	4300	6503	SO:0001583	missense	3590			Z38102	CCDS6567.1	9p13	2014-05-22			ENSG00000137070	ENSG00000137070		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5967	protein-coding gene	gene with protein product		600939				7670098	Standard	NM_001142784		Approved		uc011loq.3	Q14626	OTTHUMG00000019837	ENST00000555003.1:c.679G>C	9.37:g.34658549G>C	ENSP00000450565:p.Glu227Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16542|Q5VZ80|Q7KYJ7	Missense_Mutation	SNP	superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E227Q	ENST00000555003.1	37	c.679	CCDS6567.1	9	.	.	.	.	.	.	.	.	.	.	G	21.9	4.221258	0.79464	.	.	ENSG00000137070	ENST00000555003;ENST00000441545;ENST00000553620;ENST00000378817;ENST00000318041;ENST00000555981	T;T;T;T;T;T	0.73681	1.33;1.33;0.7;1.16;1.33;-0.77	5.15	5.15	0.70609	Long hematopoietin receptor, soluble alpha chain, conserved site (1);Fibronectin, type III (3);Immunoglobulin-like fold (1);	0.245483	0.39544	N	0.001339	T	0.81583	0.4853	L	0.43152	1.355	0.42278	D	0.992086	D;D	0.89917	1.0;1.0	D;D	0.74023	0.982;0.982	T	0.83115	-0.0121	10	0.59425	D	0.04	-24.7713	16.1291	0.81414	0.0:0.0:1.0:0.0	.	227;227	Q5VZ79;Q14626	.;I11RA_HUMAN	Q	227;227;150;227;227;227	ENSP00000450565:E227Q;ENSP00000394391:E227Q;ENSP00000452207:E150Q;ENSP00000368094:E227Q;ENSP00000326500:E227Q;ENSP00000450640:E227Q	ENSP00000326500:E227Q	E	+	1	0	IL11RA	34648549	1.000000	0.71417	0.988000	0.46212	0.936000	0.57629	6.252000	0.72447	2.401000	0.81631	0.563000	0.77884	GAG	IL11RA	-	superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.607	IL11RA-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	IL11RA	HGNC	protein_coding	OTTHUMT00000410625.1	G	NM_001142784		34658549	+1	no_errors	ENST00000318041	ensembl	human	known	70_37	missense	SNP	1.000	C
CXCL8	3576	genome.wustl.edu	37	4	74607697	74607697	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr4:74607697C>A	ENST00000307407.3	+	3	385	c.232C>A	c.(232-234)Ctg>Atg	p.L78M	IL8_ENST00000401931.1_Missense_Mutation_p.L78M	NM_000584.3	NP_000575.1	P10145	IL8_HUMAN		78					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|angiogenesis (GO:0001525)|calcium-mediated signaling (GO:0019722)|cell cycle arrest (GO:0007050)|cellular component movement (GO:0006928)|cellular protein metabolic process (GO:0044267)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|chemotaxis (GO:0006935)|embryonic digestive tract development (GO:0048566)|endoplasmic reticulum unfolded protein response (GO:0030968)|G-protein coupled receptor signaling pathway (GO:0007186)|immune response (GO:0006955)|induction of positive chemotaxis (GO:0050930)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|negative regulation of cell proliferation (GO:0008285)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of neutrophil chemotaxis (GO:0090023)|receptor internalization (GO:0031623)|regulation of cell adhesion (GO:0030155)|regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045091)|response to endoplasmic reticulum stress (GO:0034976)|response to molecule of bacterial origin (GO:0002237)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	chemokine activity (GO:0008009)|interleukin-8 receptor binding (GO:0005153)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)|ovary(2)|urinary_tract(1)	6	Breast(15;0.00102)		all cancers(17;0.00169)|Lung(101;0.128)|LUSC - Lung squamous cell carcinoma(112;0.187)	LUSC - Lung squamous cell carcinoma(721;0.008)		AGAGCTCTGTCTGGACCCCAA	0.328																																																	0													58.0	68.0	65.0					4																	74607697		2198	4297	6495	SO:0001583	missense	3576																														ENST00000307407.3:c.232C>A	4.37:g.74607697C>A	ENSP00000306512:p.Leu78Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4L8|Q6FGF6|Q6LAE6|Q96RG6|Q9C077|Q9UCE1|Q9UCR8|Q9UCR9|Q9UCS0	Missense_Mutation	SNP	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXCL8/IL8,prints_Chemokine_CXC	p.L78M	ENST00000307407.3	37	c.232	CCDS34005.1	4	.	.	.	.	.	.	.	.	.	.	C	17.12	3.308595	0.60305	.	.	ENSG00000169429	ENST00000307407;ENST00000401931	T;T	0.06449	3.3;3.3	5.27	3.44	0.39384	CXC chemokine, conserved site (1);Chemokine interleukin-8-like domain (3);	0.000000	0.85682	D	0.000000	T	0.20659	0.0497	.	.	.	0.37227	D	0.905508	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.01982	-1.1235	9	0.87932	D	0	-14.5585	7.5334	0.27695	0.0:0.7182:0.0:0.2818	.	78;78	C9J4T6;P10145	.;IL8_HUMAN	M	78	ENSP00000306512:L78M;ENSP00000385908:L78M	ENSP00000306512:L78M	L	+	1	2	IL8	74826561	1.000000	0.71417	0.977000	0.42913	0.892000	0.51952	1.733000	0.38156	0.637000	0.30526	0.650000	0.86243	CTG	IL8	-	pfam_Chemokine_IL8-like_dom,superfamily_Chemokine_IL8-like_dom,smart_Chemokine_IL8-like_dom,prints_Chemokine_CXCL8/IL8,prints_Chemokine_CXC		0.328	IL8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IL8	HGNC	protein_coding	OTTHUMT00000322211.1	C			74607697	+1	no_errors	ENST00000307407	ensembl	human	known	70_37	missense	SNP	1.000	A
ILDR2	387597	genome.wustl.edu	37	1	166891971	166891971	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:166891971C>T	ENST00000271417.3	-	8	1125	c.1070G>A	c.(1069-1071)aGa>aAa	p.R357K	ILDR2_ENST00000529387.1_Intron|ILDR2_ENST00000529071.1_Missense_Mutation_p.R338K|ILDR2_ENST00000526687.1_Missense_Mutation_p.R249K|ILDR2_ENST00000469934.2_Missense_Mutation_p.R357K|ILDR2_ENST00000528703.1_Missense_Mutation_p.R298K|ILDR2_ENST00000525740.1_Missense_Mutation_p.R230K	NM_199351.2	NP_955383.1	Q71H61	ILDR2_HUMAN	immunoglobulin-like domain containing receptor 2	357					cell differentiation (GO:0030154)|homeostasis of number of cells within a tissue (GO:0048873)|insulin secretion (GO:0030073)|pancreas development (GO:0031016)|response to glucose (GO:0009749)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)		p.R357T(1)		NS(3)|breast(1)|kidney(2)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	22						CTGCTTGCTTCTCATCTGATG	0.542																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											166.0	158.0	160.0					1																	166891971		2203	4300	6503	SO:0001583	missense	387597			AF503509	CCDS1256.1	1q24.1	2008-12-18	2008-12-18	2008-12-18	ENSG00000143195	ENSG00000143195			18131	protein-coding gene	gene with protein product	"""LISCH-like"""		"""chromosome 1 open reading frame 32"""	C1orf32			Standard	NM_199351		Approved		uc001gdx.2	Q71H61	OTTHUMG00000034320	ENST00000271417.3:c.1070G>A	1.37:g.166891971C>T	ENSP00000271417:p.Arg357Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_LISCH7,smart_Ig_sub	p.R357K	ENST00000271417.3	37	c.1070	CCDS1256.1	1	.	.	.	.	.	.	.	.	.	.	C	26.4	4.737432	0.89482	.	.	ENSG00000143195	ENST00000271417;ENST00000525740;ENST00000469934;ENST00000529071;ENST00000526687;ENST00000528703	T;T;T;T;T;T	0.79749	0.4;-1.26;0.43;0.36;-1.3;-0.27	5.24	5.24	0.73138	.	0.064498	0.64402	D	0.000005	D	0.86151	0.5864	M	0.65975	2.015	0.35214	D	0.775407	D	0.64830	0.994	D	0.70716	0.97	D	0.87731	0.2579	10	0.59425	D	0.04	.	16.9991	0.86377	0.0:1.0:0.0:0.0	.	357	Q71H61	ILDR2_HUMAN	K	357;230;357;338;249;298	ENSP00000271417:R357K;ENSP00000436120:R230K;ENSP00000437008:R357K;ENSP00000436882:R338K;ENSP00000434273:R249K;ENSP00000432750:R298K	ENSP00000271417:R357K	R	-	2	0	ILDR2	165158595	0.997000	0.39634	0.996000	0.52242	0.902000	0.53008	3.880000	0.56145	2.427000	0.82271	0.561000	0.74099	AGA	ILDR2	-	NULL		0.542	ILDR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ILDR2	HGNC	protein_coding	OTTHUMT00000082880.2	C	NM_199351		166891971	-1	no_errors	ENST00000271417	ensembl	human	known	70_37	missense	SNP	1.000	T
IPMK	253430	genome.wustl.edu	37	10	59976022	59976022	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:59976022C>T	ENST00000373935.3	-	4	752	c.430G>A	c.(430-432)Gat>Aat	p.D144N		NM_152230.4	NP_689416.1	Q8NFU5	IPMK_HUMAN	inositol polyphosphate multikinase	144	Substrate binding. {ECO:0000250}.				inositol phosphate biosynthetic process (GO:0032958)|inositol phosphate metabolic process (GO:0043647)|neural tube formation (GO:0001841)|small molecule metabolic process (GO:0044281)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|inositol tetrakisphosphate 3-kinase activity (GO:0000824)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)|inositol-1,4,5-trisphosphate 6-kinase activity (GO:0000823)			NS(1)|breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)	22						ATCTTTACATCCATTATACAG	0.328																																																	0													84.0	76.0	79.0					10																	59976022		2203	4300	6503	SO:0001583	missense	253430			AF432853	CCDS7250.1	10q21.1	2010-11-29		2004-07-22	ENSG00000151151	ENSG00000151151			20739	protein-coding gene	gene with protein product		609851				12223481, 12027805	Standard	NM_152230		Approved		uc001jkb.3	Q8NFU5	OTTHUMG00000018268	ENST00000373935.3:c.430G>A	10.37:g.59976022C>T	ENSP00000363046:p.Asp144Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_IPK	p.D144N	ENST00000373935.3	37	c.430	CCDS7250.1	10	.	.	.	.	.	.	.	.	.	.	C	35	5.490889	0.96339	.	.	ENSG00000151151	ENST00000373935	T	0.73575	-0.76	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	D	0.88607	0.6482	M	0.93594	3.435	0.80722	D	1	P	0.49961	0.93	P	0.58391	0.838	D	0.90899	0.4767	9	.	.	.	-1.8043	17.4271	0.87529	0.0:1.0:0.0:0.0	.	144	Q8NFU5	IPMK_HUMAN	N	144	ENSP00000363046:D144N	.	D	-	1	0	IPMK	59646028	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.712000	0.84684	2.702000	0.92279	0.655000	0.94253	GAT	IPMK	-	pfam_IPK		0.328	IPMK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPMK	HGNC	protein_coding	OTTHUMT00000048142.1	C	NM_152230		59976022	-1	no_errors	ENST00000373935	ensembl	human	known	70_37	missense	SNP	1.000	T
IRF2BP1	26145	genome.wustl.edu	37	19	46388496	46388496	+	Silent	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:46388496C>G	ENST00000302165.3	-	1	880	c.537G>C	c.(535-537)ctG>ctC	p.L179L		NM_015649.1	NP_056464.1	Q8IU81	I2BP1_HUMAN	interferon regulatory factor 2 binding protein 1	179					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ligase activity (GO:0016874)|metal ion binding (GO:0046872)			cervix(1)|kidney(1)|lung(2)	4		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.00442)|GBM - Glioblastoma multiforme(486;0.0402)|Epithelial(262;0.231)		GTGCCAGCGTCAGGCCTCGGC	0.647																																																	0													29.0	36.0	34.0					19																	46388496		2199	4289	6488	SO:0001819	synonymous_variant	26145			AY278022	CCDS12678.1	19q13.32	2008-02-05							21728	protein-coding gene	gene with protein product		615331				12799427	Standard	NM_015649		Approved	DKFZP434M154, IRF-2BP1	uc002pds.1	Q8IU81		ENST00000302165.3:c.537G>C	19.37:g.46388496C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53EL7|Q6DC95|Q9BRZ9|Q9Y4P4	Silent	SNP	pfam_Interferon_reg_fac2-bd1_2_Znf	p.L179	ENST00000302165.3	37	c.537	CCDS12678.1	19																																																																																			IRF2BP1	-	pfam_Interferon_reg_fac2-bd1_2_Znf		0.647	IRF2BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF2BP1	HGNC	protein_coding	OTTHUMT00000461683.1	C	NM_015649		46388496	-1	no_errors	ENST00000302165	ensembl	human	known	70_37	silent	SNP	0.949	G
IWS1	55677	genome.wustl.edu	37	2	128262290	128262290	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:128262290G>A	ENST00000295321.4	-	3	1448	c.1189C>T	c.(1189-1191)Ctt>Ttt	p.L397F	IWS1_ENST00000486662.1_5'Flank|IWS1_ENST00000455721.2_Missense_Mutation_p.L404F|AC010976.2_ENST00000599001.1_RNA	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	397	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		CTATCAGAAAGCACAGCAGCT	0.398																																																	0													258.0	258.0	258.0					2																	128262290		2203	4300	6503	SO:0001583	missense	55677			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.1189C>T	2.37:g.128262290G>A	ENSP00000295321:p.Leu397Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.L397F	ENST00000295321.4	37	c.1189	CCDS2146.1	2	.	.	.	.	.	.	.	.	.	.	G	14.52	2.560997	0.45590	.	.	ENSG00000163166	ENST00000295321;ENST00000433551;ENST00000455721	T;T	0.64260	1.31;-0.09	5.79	5.79	0.91817	.	0.000000	0.85682	D	0.000000	T	0.78704	0.4325	M	0.63843	1.955	0.53688	D	0.999977	D	0.76494	0.999	D	0.87578	0.998	T	0.78104	-0.2334	10	0.56958	D	0.05	-18.9129	20.0235	0.97511	0.0:0.0:1.0:0.0	.	397	Q96ST2	IWS1_HUMAN	F	397;350;404	ENSP00000295321:L397F;ENSP00000399245:L404F	ENSP00000295321:L397F	L	-	1	0	IWS1	127978760	1.000000	0.71417	1.000000	0.80357	0.011000	0.07611	5.093000	0.64517	2.727000	0.93392	0.563000	0.77884	CTT	IWS1	-	NULL		0.398	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2	G	NM_017969		128262290	-1	no_errors	ENST00000295321	ensembl	human	known	70_37	missense	SNP	1.000	A
JPH1	56704	genome.wustl.edu	37	8	75157351	75157351	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:75157351C>T	ENST00000342232.4	-	4	1358	c.1318G>A	c.(1318-1320)Gaa>Aaa	p.E440K	JPH1_ENST00000518195.1_5'Flank	NM_020647.2	NP_065698.1	Q9HDC5	JPH1_HUMAN	junctophilin 1	440					calcium ion transport into cytosol (GO:0060402)|muscle organ development (GO:0007517)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)	integral component of membrane (GO:0016021)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			endometrium(4)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|skin(1)|upper_aerodigestive_tract(2)	24	Breast(64;0.00576)		BRCA - Breast invasive adenocarcinoma(89;0.0499)|Epithelial(68;0.0728)|all cancers(69;0.176)			GGTACCTTTTCTTCTGGATTT	0.428																																																	0													128.0	123.0	125.0					8																	75157351		2203	4300	6503	SO:0001583	missense	56704			AB042634	CCDS6217.1	8q21	2008-07-03			ENSG00000104369	ENSG00000104369			14201	protein-coding gene	gene with protein product		605266				10891348, 10949023	Standard	XM_005251273		Approved	JP-1	uc003yae.3	Q9HDC5	OTTHUMG00000164524	ENST00000342232.4:c.1318G>A	8.37:g.75157351C>T	ENSP00000344488:p.Glu440Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTZ0	Missense_Mutation	SNP	pfam_MORN,smart_MORN,pirsf_Junctophilin	p.E440K	ENST00000342232.4	37	c.1318	CCDS6217.1	8	.	.	.	.	.	.	.	.	.	.	C	17.83	3.485674	0.63962	.	.	ENSG00000104369	ENST00000342232	T	0.58940	0.3	5.34	5.34	0.76211	.	0.153255	0.64402	D	0.000019	T	0.53286	0.1787	L	0.43152	1.355	0.58432	D	0.999998	P	0.46395	0.877	B	0.40741	0.339	T	0.53982	-0.8361	10	0.38643	T	0.18	.	19.2408	0.93881	0.0:1.0:0.0:0.0	.	440	Q9HDC5	JPH1_HUMAN	K	440	ENSP00000344488:E440K	ENSP00000344488:E440K	E	-	1	0	JPH1	75319905	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	6.943000	0.75934	2.785000	0.95823	0.655000	0.94253	GAA	JPH1	-	pirsf_Junctophilin		0.428	JPH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JPH1	HGNC	protein_coding	OTTHUMT00000379102.1	C			75157351	-1	no_errors	ENST00000342232	ensembl	human	known	70_37	missense	SNP	1.000	T
KCND2	3751	genome.wustl.edu	37	7	119914774	119914774	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:119914774C>T	ENST00000331113.4	+	1	1053	c.88C>T	c.(88-90)Ccc>Tcc	p.P30S		NM_012281.2	NP_036413.1	Q9NZV8	KCND2_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 2	30					action potential (GO:0001508)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendritic spine (GO:0043197)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|metal ion binding (GO:0046872)|voltage-gated potassium channel activity (GO:0005249)			NS(2)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(35)|ovary(3)|pancreas(1)|prostate(4)|skin(3)|upper_aerodigestive_tract(1)	75	all_neural(327;0.117)				Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	TATGCCGGCTCCCCCGAGGCA	0.627																																																	0													99.0	116.0	110.0					7																	119914774		2203	4300	6503	SO:0001583	missense	3751			AJ010969	CCDS5776.1	7q31	2012-07-05			ENSG00000184408	ENSG00000184408		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6238	protein-coding gene	gene with protein product		605410				10551270, 16382104	Standard	NM_012281		Approved	Kv4.2, RK5, KIAA1044	uc003vjj.1	Q9NZV8	OTTHUMG00000156989	ENST00000331113.4:c.88C>T	7.37:g.119914774C>T	ENSP00000333496:p.Pro30Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O95012|O95021|Q2TBD3|Q9UBY7|Q9UN98|Q9UNH9	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.2,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv3	p.P30S	ENST00000331113.4	37	c.88	CCDS5776.1	7	.	.	.	.	.	.	.	.	.	.	C	13.30	2.195683	0.38806	.	.	ENSG00000184408	ENST00000331113	D	0.96885	-4.16	5.51	5.51	0.81932	Shal-type voltage-gated potassium channels (1);	0.000000	0.85682	D	0.000000	D	0.93719	0.7993	L	0.60455	1.87	0.37568	D	0.919316	B	0.16166	0.016	B	0.15870	0.014	D	0.90454	0.4441	9	.	.	.	.	9.9354	0.41548	0.131:0.6802:0.1889:0.0	.	30	Q9NZV8	KCND2_HUMAN	S	30	ENSP00000333496:P30S	.	P	+	1	0	KCND2	119702010	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.809000	0.55606	2.603000	0.88011	0.655000	0.94253	CCC	KCND2	-	pfam_Shal-type,prints_K_chnl_volt-dep_Kv4.2		0.627	KCND2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCND2	HGNC	protein_coding	OTTHUMT00000346996.1	C	NM_012281		119914774	+1	no_errors	ENST00000331113	ensembl	human	known	70_37	missense	SNP	0.999	T
KCND3	3752	genome.wustl.edu	37	1	112329586	112329586	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:112329586C>G	ENST00000315987.2	-	3	1728	c.1249G>C	c.(1249-1251)Gat>Cat	p.D417H	KCND3_ENST00000369697.1_Missense_Mutation_p.D417H|KCND3_ENST00000302127.4_Missense_Mutation_p.D417H	NM_004980.4	NP_004971.2	Q9UK17	KCND3_HUMAN	potassium voltage-gated channel, Shal-related subfamily, member 3	417					cell death (GO:0008219)|membrane repolarization (GO:0086009)|potassium ion export (GO:0071435)|potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|perinuclear endoplasmic reticulum (GO:0097038)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	A-type (transient outward) potassium channel activity (GO:0005250)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(3)|large_intestine(16)|lung(9)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(2)	49		all_cancers(81;8.52e-06)|all_epithelial(167;5.65e-06)|all_lung(203;2.72e-05)|Lung NSC(69;4.56e-05)		all cancers(265;0.056)|Lung(183;0.0576)|Colorectal(144;0.1)|Epithelial(280;0.104)|COAD - Colon adenocarcinoma(174;0.222)|LUSC - Lung squamous cell carcinoma(189;0.231)	Amitriptyline(DB00321)|Dalfampridine(DB06637)|Disopyramide(DB00280)|Imipramine(DB00458)	CTGCGTTTATCAGCTCTCTGA	0.572																																																	0													141.0	126.0	131.0					1																	112329586		2203	4300	6503	SO:0001583	missense	3752			AF048713	CCDS843.1, CCDS844.1	1p13.2	2014-09-17			ENSG00000171385	ENSG00000171385		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6239	protein-coding gene	gene with protein product		605411	"""spinocerebellar ataxia 22"", ""spinocerebellar ataxia 19"""	SCA22, SCA19		10942109, 16382104, 23280837	Standard	NM_172198		Approved	Kv4.3, KSHIVB	uc001ebu.1	Q9UK17	OTTHUMG00000011989	ENST00000315987.2:c.1249G>C	1.37:g.112329586C>G	ENSP00000319591:p.Asp417His	Somatic		WXS	Illumina HiSeq	Phase_IV	O60576|O60577|Q14D71|Q5T0M0|Q9UH85|Q9UH86|Q9UK16	Missense_Mutation	SNP	pfam_K_chnl_volt-dep_Kv4_C,pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_Shal-type,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv4,prints_K_chnl_volt-dep_Kv4.3,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3	p.D417H	ENST00000315987.2	37	c.1249	CCDS843.1	1	.	.	.	.	.	.	.	.	.	.	C	27.1	4.802295	0.90538	.	.	ENSG00000171385	ENST00000369697;ENST00000315987;ENST00000302127	D;D;D	0.97161	-4.26;-4.27;-4.26	4.84	4.84	0.62591	.	0.000000	0.85682	D	0.000000	D	0.97990	0.9338	M	0.71206	2.165	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.69824	0.966;0.966	D	0.99053	1.0828	10	0.87932	D	0	.	17.8944	0.88883	0.0:1.0:0.0:0.0	.	417;417	Q14D71;Q9UK17	.;KCND3_HUMAN	H	417	ENSP00000358711:D417H;ENSP00000319591:D417H;ENSP00000306923:D417H	ENSP00000306923:D417H	D	-	1	0	KCND3	112131109	1.000000	0.71417	0.947000	0.38551	0.988000	0.76386	7.818000	0.86416	2.398000	0.81561	0.561000	0.74099	GAT	KCND3	-	prints_K_chnl_volt-dep_Kv4		0.572	KCND3-001	KNOWN	basic|CCDS	protein_coding	KCND3	HGNC	protein_coding	OTTHUMT00000033144.1	C	NM_172198		112329586	-1	no_errors	ENST00000315987	ensembl	human	known	70_37	missense	SNP	1.000	G
KDM5A	5927	genome.wustl.edu	37	12	431665	431665	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:431665G>A	ENST00000399788.2	-	17	2706	c.2344C>T	c.(2344-2346)Cga>Tga	p.R782*	KDM5A_ENST00000382815.4_Nonsense_Mutation_p.R782*	NM_001042603.1	NP_001036068.1	P29375	KDM5A_HUMAN	lysine (K)-specific demethylase 5A	782					chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|multicellular organismal development (GO:0007275)|negative regulation of histone deacetylase activity (GO:1901726)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			NS(2)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(29)|ovary(1)|prostate(5)|skin(6)|stomach(1)|urinary_tract(2)	77						CTGAGTTTTCGAAAGAGATCA	0.393			T	NUP98	AML																																			Dom	yes		12	12p11	5927	"""lysine (K)-specific demethylase 5A, JARID1A"""		L	0													112.0	111.0	111.0					12																	431665		1832	4087	5919	SO:0001587	stop_gained	5927				CCDS41736.1	12p13.33	2013-01-28	2009-04-06	2009-04-06	ENSG00000073614	ENSG00000073614		"""Chromatin-modifying enzymes / K-demethylases"", ""Zinc fingers, PHD-type"""	9886	protein-coding gene	gene with protein product		180202	"""retinoblastoma-binding protein 2"", ""Jumonji, AT rich interactive domain 1A (RBBP2-like)"", ""jumonji, AT rich interactive domain 1A"""	RBBP2, JARID1A		1857421	Standard	NM_001042603		Approved		uc001qif.1	P29375	OTTHUMG00000168055	ENST00000399788.2:c.2344C>T	12.37:g.431665G>A	ENSP00000382688:p.Arg782*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MV76|Q4LE72|Q86XZ1	Nonsense_Mutation	SNP	pfam_Lys_sp_deMease_like_dom,pfam_JmjC_dom,pfam_Znf_PHD-finger,pfam_ARID/BRIGHT_DNA-bd,pfam_Znf_C5HC2,pfam_TF_JmjN,superfamily_ARID/BRIGHT_DNA-bd,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_ARID/BRIGHT_DNA-bd,smart_Znf_PHD,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_ARID/BRIGHT_DNA-bd	p.R782*	ENST00000399788.2	37	c.2344	CCDS41736.1	12	.	.	.	.	.	.	.	.	.	.	G	43	9.967360	0.99307	.	.	ENSG00000073614	ENST00000261253;ENST00000399787;ENST00000399788;ENST00000382815;ENST00000544760	.	.	.	5.82	1.32	0.21799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.6414	16.8739	0.86046	0.0:0.0:0.5479:0.4521	.	.	.	.	X	401;741;782;782;401	.	ENSP00000261253:R401X	R	-	1	2	KDM5A	301926	1.000000	0.71417	0.991000	0.47740	0.996000	0.88848	3.313000	0.51935	0.322000	0.23283	0.655000	0.94253	CGA	KDM5A	-	pfam_Lys_sp_deMease_like_dom		0.393	KDM5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM5A	HGNC	protein_coding	OTTHUMT00000397812.1	G	NM_005056		431665	-1	no_errors	ENST00000399788	ensembl	human	known	70_37	nonsense	SNP	1.000	A
KIAA0355	9710	genome.wustl.edu	37	19	34791603	34791603	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:34791603C>T	ENST00000299505.6	+	2	1098	c.225C>T	c.(223-225)gaC>gaT	p.D75D		NM_014686.3	NP_055501.2	O15063	K0355_HUMAN	KIAA0355	75										breast(1)|endometrium(7)|kidney(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	41	Esophageal squamous(110;0.162)					CTATCGCCGACATCCAGCAGG	0.602																																																	0													72.0	62.0	65.0					19																	34791603		2203	4300	6503	SO:0001819	synonymous_variant	9710				CCDS12436.1	19q13.12	2012-11-29			ENSG00000166398	ENSG00000166398			29016	protein-coding gene	gene with protein product						9205841	Standard	NM_014686		Approved		uc002nvd.4	O15063	OTTHUMG00000180505	ENST00000299505.6:c.225C>T	19.37:g.34791603C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M3W4	Silent	SNP	NULL	p.D75	ENST00000299505.6	37	c.225	CCDS12436.1	19																																																																																			KIAA0355	-	NULL		0.602	KIAA0355-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0355	HGNC	protein_coding	OTTHUMT00000451678.4	C	NM_014686		34791603	+1	no_errors	ENST00000299505	ensembl	human	known	70_37	silent	SNP	1.000	T
KIAA0922	23240	genome.wustl.edu	37	4	154513680	154513680	+	Silent	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr4:154513680C>G	ENST00000409663.3	+	18	1915	c.1863C>G	c.(1861-1863)ctC>ctG	p.L621L	KIAA0922_ENST00000440693.1_Intron|KIAA0922_ENST00000409959.3_Silent_p.L622L	NM_015196.3	NP_056011.3	A2VDJ0	T131L_HUMAN	KIAA0922	621						integral component of membrane (GO:0016021)				breast(2)|cervix(1)|endometrium(7)|kidney(4)|large_intestine(16)|lung(20)|ovary(1)|prostate(4)|skin(3)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	63	all_hematologic(180;0.093)	Renal(120;0.118)				CCTTGCAGCTCCTGCCTCTCT	0.507																																																	0													142.0	123.0	130.0					4																	154513680		2203	4300	6503	SO:0001819	synonymous_variant	23240			AK096538	CCDS3783.2, CCDS47148.1	4q31.3	2008-02-05			ENSG00000121210	ENSG00000121210			29146	protein-coding gene	gene with protein product						10231032, 11230166	Standard	NM_015196		Approved	DKFZp586H1322, TMEM131L	uc010ipp.3	A2VDJ0	OTTHUMG00000153244	ENST00000409663.3:c.1863C>G	4.37:g.154513680C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRV3|Q7LGA7|Q86Y92|Q8WU56|Q9H065|Q9Y2D7	Silent	SNP	pfam_DUF3651_TMEM131	p.L622	ENST00000409663.3	37	c.1866	CCDS3783.2	4																																																																																			KIAA0922	-	NULL		0.507	KIAA0922-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA0922	HGNC	protein_coding	OTTHUMT00000330370.1	C	NM_015196		154513680	+1	no_errors	ENST00000409959	ensembl	human	known	70_37	silent	SNP	0.978	G
KIF20B	9585	genome.wustl.edu	37	10	91497810	91497810	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:91497810C>T	ENST00000371728.3	+	20	3277	c.3212C>T	c.(3211-3213)tCt>tTt	p.S1071F	KIF20B_ENST00000394289.2_Missense_Mutation_p.S1071F|KIF20B_ENST00000416354.1_Missense_Mutation_p.S1101F|KIF20B_ENST00000478929.1_3'UTR|KIF20B_ENST00000260753.4_Missense_Mutation_p.S1031F	NM_001284259.1	NP_001271188.1	Q96Q89	KI20B_HUMAN	kinesin family member 20B	1071					ATP catabolic process (GO:0006200)|cell cycle arrest (GO:0007050)|microtubule-based movement (GO:0007018)|mitotic nuclear division (GO:0007067)|neural tube closure (GO:0001843)|regulation of establishment of cell polarity (GO:2000114)|regulation of establishment of protein localization (GO:0070201)|regulation of mitosis (GO:0007088)|regulation of neuron migration (GO:2001222)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|WW domain binding (GO:0050699)			endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(20)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	58						GTGAAGGCCTCTTCCAAAAAA	0.348																																																	0													52.0	60.0	58.0					10																	91497810		2192	4290	6482	SO:0001583	missense	9585			L16782	CCDS7407.1, CCDS60590.1	10q23.31	2009-08-06	2008-07-31	2008-07-31	ENSG00000138182	ENSG00000138182			7212	protein-coding gene	gene with protein product	"""cancer/testis antigen 90"""	605498	"""M-phase phosphoprotein 1"""	MPHOSPH1		8885239, 8290587, 11470801	Standard	NM_016195		Approved	MPP1, KRMP1, CT90	uc001kgr.1	Q96Q89	OTTHUMG00000018725	ENST00000371728.3:c.3212C>T	10.37:g.91497810C>T	ENSP00000360793:p.Ser1071Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MXM7|O43277|Q09471|Q2KQ73|Q32NE1|Q561V3|Q58EX8|Q5T9M8|Q5T9M9|Q5T9N0|Q5T9N1|Q7KZ68|Q7Z5E0|Q7Z5E1|Q7Z6M9|Q86X82|Q9H3R8|Q9H6Q9|Q9H755|Q9NTC1|Q9UFR5	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.S1101F	ENST00000371728.3	37	c.3302		10	.	.	.	.	.	.	.	.	.	.	C	16.47	3.131105	0.56828	.	.	ENSG00000138182	ENST00000260753;ENST00000416354;ENST00000394289;ENST00000371728	T;T;T;T	0.71461	-0.53;-0.57;-0.56;-0.49	5.57	5.57	0.84162	.	0.000000	0.51477	D	0.000100	D	0.83718	0.5315	M	0.67953	2.075	0.49389	D	0.999784	D;D	0.89917	1.0;1.0	D;D	0.78314	0.98;0.991	D	0.84685	0.0719	10	0.72032	D	0.01	-4.9995	19.5406	0.95272	0.0:1.0:0.0:0.0	.	1071;1031	Q96Q89;Q96Q89-3	KI20B_HUMAN;.	F	1031;1101;1071;1071	ENSP00000260753:S1031F;ENSP00000411545:S1101F;ENSP00000377830:S1071F;ENSP00000360793:S1071F	ENSP00000260753:S1031F	S	+	2	0	KIF20B	91487790	0.998000	0.40836	0.657000	0.29651	0.505000	0.33919	5.555000	0.67301	2.606000	0.88127	0.591000	0.81541	TCT	KIF20B	-	NULL		0.348	KIF20B-003	KNOWN	basic	protein_coding	KIF20B	HGNC	protein_coding	OTTHUMT00000049330.1	C	NM_016195		91497810	+1	no_errors	ENST00000416354	ensembl	human	known	70_37	missense	SNP	0.996	T
KIF2C	11004	genome.wustl.edu	37	1	45223226	45223226	+	Splice_Site	SNP	A	A	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:45223226A>C	ENST00000372224.4	+	11	1090		c.e11-1		KIF2C_ENST00000372218.4_Splice_Site|KIF2C_ENST00000372222.3_Splice_Site|RP11-269F19.2_ENST00000428791.1_RNA|KIF2C_ENST00000493027.1_Splice_Site|RP11-269F19.2_ENST00000440985.1_RNA|KIF2C_ENST00000372217.1_Splice_Site	NM_006845.3	NP_006836.2	Q99661	KIF2C_HUMAN	kinesin family member 2C						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|metabolic process (GO:0008152)|microtubule depolymerization (GO:0007019)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|regulation of chromosome segregation (GO:0051983)	chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|centromeric DNA binding (GO:0019237)|microtubule motor activity (GO:0003777)|microtubule plus-end binding (GO:0051010)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(16)|ovary(1)|skin(1)|urinary_tract(1)	34	Acute lymphoblastic leukemia(166;0.155)					CCCCTCTTCTAGGTTCACAGC	0.483																																																	0													100.0	96.0	98.0					1																	45223226		2203	4300	6503	SO:0001630	splice_region_variant	11004			U63743	CCDS512.1, CCDS72774.1	1p34.1	2014-01-21	2003-01-13	2003-01-17	ENSG00000142945	ENSG00000142945		"""Kinesins"""	6393	protein-coding gene	gene with protein product		604538	"""kinesin-like 6 (mitotic centromere-associated kinesin)"""	KNSL6		9434124	Standard	NM_006845		Approved	MCAK, CT139	uc001cmg.4	Q99661	OTTHUMG00000008416	ENST00000372224.4:c.978-1A>C	1.37:g.45223226A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3ITR9|Q5JR88|Q6ICU1|Q96C18|Q96HB8|Q9BWV8	Splice_Site	SNP	-	e11-2	ENST00000372224.4	37	c.978-2	CCDS512.1	1	.	.	.	.	.	.	.	.	.	.	A	22.6	4.308466	0.81247	.	.	ENSG00000142945	ENST00000452259;ENST00000372224;ENST00000372218;ENST00000372222;ENST00000372217	.	.	.	5.65	5.65	0.86999	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.0399	0.80667	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	KIF2C	44995813	1.000000	0.71417	0.995000	0.50966	0.860000	0.49131	9.139000	0.94554	2.371000	0.80710	0.533000	0.62120	.	KIF2C	-	-		0.483	KIF2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF2C	HGNC	protein_coding	OTTHUMT00000023180.1	A	NM_006845	Intron	45223226	+1	no_errors	ENST00000372224	ensembl	human	known	70_37	splice_site	SNP	1.000	C
KIF5A	3798	genome.wustl.edu	37	12	57975210	57975210	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:57975210G>A	ENST00000455537.2	+	25	3042	c.2768G>A	c.(2767-2769)cGg>cAg	p.R923Q	KIF5A_ENST00000286452.5_Missense_Mutation_p.R834Q	NM_004984.2	NP_004975.2	Q12840	KIF5A_HUMAN	kinesin family member 5A	923	Globular.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell death (GO:0008219)|cytoskeleton-dependent intracellular transport (GO:0030705)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|protein localization (GO:0008104)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|motor activity (GO:0003774)|plus-end-directed microtubule motor activity (GO:0008574)			breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(11)|liver(1)|lung(32)|ovary(2)|prostate(2)|skin(2)	62						AAACCCGTCCGGCCTGGCCAC	0.542																																																	0													76.0	76.0	76.0					12																	57975210		2203	4300	6503	SO:0001583	missense	3798			U06698	CCDS8945.1	12q13.13	2011-07-15	2004-02-13			ENSG00000155980		"""Kinesins"""	6323	protein-coding gene	gene with protein product		602821	"""spastic paraplegia 10 (autosomal dominant)"""	SPG10		9858832, 10441583, 16489470	Standard	NM_004984		Approved	D12S1889, NKHC, MY050	uc001sor.1	Q12840	OTTHUMG00000170143	ENST00000455537.2:c.2768G>A	12.37:g.57975210G>A	ENSP00000408979:p.Arg923Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8M5|Q4LE26	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_Prefoldin,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R923Q	ENST00000455537.2	37	c.2768	CCDS8945.1	12	.	.	.	.	.	.	.	.	.	.	G	34	5.352593	0.95830	.	.	ENSG00000155980	ENST00000455537;ENST00000286452;ENST00000547989	T;T	0.80480	-1.31;-1.38	4.52	4.52	0.55395	.	0.201593	0.32343	N	0.006224	D	0.85340	0.5674	M	0.64404	1.975	0.80722	D	1	D;D	0.69078	0.997;0.995	P;P	0.55785	0.784;0.784	D	0.87456	0.2404	10	0.87932	D	0	.	16.5482	0.84454	0.0:0.0:1.0:0.0	.	834;923	B7Z2M7;Q12840	.;KIF5A_HUMAN	Q	923;834;17	ENSP00000408979:R923Q;ENSP00000286452:R834Q	ENSP00000286452:R834Q	R	+	2	0	KIF5A	56261477	1.000000	0.71417	0.999000	0.59377	0.905000	0.53344	9.338000	0.96553	2.528000	0.85240	0.561000	0.74099	CGG	KIF5A	-	NULL		0.542	KIF5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF5A	HGNC	protein_coding	OTTHUMT00000407634.1	G	NM_004984		57975210	+1	no_errors	ENST00000455537	ensembl	human	known	70_37	missense	SNP	1.000	A
KLHL14	57565	genome.wustl.edu	37	18	30350039	30350039	+	Silent	SNP	G	G	A	rs373913345		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:30350039G>A	ENST00000359358.4	-	2	954	c.516C>T	c.(514-516)ctC>ctT	p.L172L	KLHL14_ENST00000358095.4_Silent_p.L172L|AC012123.1_ENST00000426194.1_Intron	NM_020805.1	NP_065856.1	Q9P2G3	KLH14_HUMAN	kelch-like family member 14	172						endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)				breast(3)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(20)|ovary(2)	31						ACTGCACGCAGAGCTTGGTGA	0.607																																																	0								G		0,4406		0,0,2203	119.0	104.0	109.0		516	2.5	1.0	18		109	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	KLHL14	NM_020805.1		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		172/629	30350039	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	57565			AB037805	CCDS32813.1	18q12.1	2013-10-15	2013-01-30		ENSG00000197705	ENSG00000197705		"""Kelch-like"", ""BTB/POZ domain containing"""	29266	protein-coding gene	gene with protein product	"""printor"""	613772	"""kelch-like 14 (Drosophila)"""			10718198, 19535332	Standard	NM_020805		Approved	KIAA1384	uc002kxm.1	Q9P2G3	OTTHUMG00000179819	ENST00000359358.4:c.516C>T	18.37:g.30350039G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNW1|B4DHA0|Q8WU41	Silent	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.L172	ENST00000359358.4	37	c.516	CCDS32813.1	18																																																																																			KLHL14	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin		0.607	KLHL14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL14	HGNC	protein_coding	OTTHUMT00000448376.1	G			30350039	-1	no_errors	ENST00000359358	ensembl	human	known	70_37	silent	SNP	1.000	A
LAMA2	3908	genome.wustl.edu	37	6	129762132	129762132	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:129762132C>G	ENST00000421865.2	+	43	6306	c.6257C>G	c.(6256-6258)cCt>cGt	p.P2086R		NM_000426.3|NM_001079823.1	NP_000417|NP_001073291.1	P24043	LAMA2_HUMAN	laminin, alpha 2	2086	Domain II and I.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|muscle organ development (GO:0007517)|myelination in peripheral nervous system (GO:0022011)|positive regulation of synaptic transmission, cholinergic (GO:0032224)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|dendritic spine (GO:0043197)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|sarcolemma (GO:0042383)	structural molecule activity (GO:0005198)			NS(2)|biliary_tract(2)|breast(10)|central_nervous_system(1)|endometrium(18)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(35)|lung(84)|ovary(10)|prostate(4)|skin(9)|stomach(1)|upper_aerodigestive_tract(7)|urinary_tract(2)	194				OV - Ovarian serous cystadenocarcinoma(136;0.178)|all cancers(137;0.245)		GTTAAAGATCCTTCCAAGAAC	0.418																																																	0													85.0	74.0	78.0					6																	129762132		2203	4300	6503	SO:0001583	missense	3908			Z26653	CCDS5138.1	6q22-q23	2014-09-17	2008-08-01		ENSG00000196569	ENSG00000196569		"""Laminins"""	6482	protein-coding gene	gene with protein product	"""merosin"", ""congenital muscular dystrophy"""	156225		LAMM		2185464, 8294519	Standard	NM_000426		Approved		uc003qbn.3	P24043	OTTHUMG00000015545	ENST00000421865.2:c.6257C>G	6.37:g.129762132C>G	ENSP00000400365:p.Pro2086Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14736|Q5VUM2|Q93022	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_B_type_IV,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_t-SNARE,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.P2086R	ENST00000421865.2	37	c.6257	CCDS5138.1	6	.	.	.	.	.	.	.	.	.	.	C	15.22	2.770113	0.49680	.	.	ENSG00000196569	ENST00000358023;ENST00000354729;ENST00000421865;ENST00000443169	T	0.31247	1.5	5.54	5.54	0.83059	Laminin II (1);	0.000000	0.85682	D	0.000000	T	0.36166	0.0957	L	0.44542	1.39	0.58432	D	0.999998	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.02852	-1.1102	10	0.16420	T	0.52	.	17.6589	0.88185	0.0:1.0:0.0:0.0	.	2086;2086	A6NF00;P24043	.;LAMA2_HUMAN	R	2086;2086;2086;105	ENSP00000400365:P2086R	ENSP00000346769:P2086R	P	+	2	0	LAMA2	129803825	1.000000	0.71417	0.997000	0.53966	0.277000	0.26821	5.441000	0.66569	2.601000	0.87937	0.655000	0.94253	CCT	LAMA2	-	pfam_Laminin_II		0.418	LAMA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA2	HGNC	protein_coding	OTTHUMT00000042180.1	C			129762132	+1	no_errors	ENST00000421865	ensembl	human	known	70_37	missense	SNP	0.999	G
L3MBTL3	84456	genome.wustl.edu	37	6	130392189	130392189	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:130392189C>A	ENST00000529410.1	+	15	1640	c.1161C>A	c.(1159-1161)ttC>ttA	p.F387L	L3MBTL3_ENST00000526019.1_Missense_Mutation_p.F362L|L3MBTL3_ENST00000368139.2_Missense_Mutation_p.F362L|L3MBTL3_ENST00000533560.1_Missense_Mutation_p.F362L|L3MBTL3_ENST00000361794.2_Missense_Mutation_p.F387L|L3MBTL3_ENST00000368136.2_Missense_Mutation_p.F387L			Q96JM7	LMBL3_HUMAN	l(3)mbt-like 3 (Drosophila)	387					chromatin modification (GO:0016568)|erythrocyte maturation (GO:0043249)|granulocyte differentiation (GO:0030851)|macrophage differentiation (GO:0030225)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(22)|ovary(5)|skin(4)|stomach(1)|urinary_tract(1)	43				GBM - Glioblastoma multiforme(226;0.0266)|OV - Ovarian serous cystadenocarcinoma(155;0.154)		ATCCCTCATTCATCTGTGTTG	0.408																																																	0													282.0	268.0	273.0					6																	130392189		2203	4300	6503	SO:0001583	missense	84456			AB058701	CCDS34537.1, CCDS34538.1	6q23	2013-01-10			ENSG00000198945	ENSG00000198945		"""Sterile alpha motif (SAM) domain containing"""	23035	protein-coding gene	gene with protein product							Standard	NM_032438		Approved	KIAA1798	uc003qbt.3	Q96JM7	OTTHUMG00000015554	ENST00000529410.1:c.1161C>A	6.37:g.130392189C>A	ENSP00000431962:p.Phe387Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VXE1|Q5VUM9|Q6P9B5	Missense_Mutation	SNP	pfam_Mbt,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt,pfscan_SAM	p.F387L	ENST00000529410.1	37	c.1161	CCDS34537.1	6	.	.	.	.	.	.	.	.	.	.	C	5.667	0.307717	0.10733	.	.	ENSG00000198945	ENST00000529410;ENST00000533560;ENST00000361794;ENST00000368139;ENST00000526019;ENST00000368136	D;D;D;D;D;D	0.83992	-1.79;-1.79;-1.79;-1.79;-1.79;-1.79	6.17	4.39	0.52855	.	0.267787	0.45361	D	0.000373	T	0.19604	0.0471	N	0.00123	-2.06	0.42644	D	0.993429	B;B	0.21147	0.052;0.002	B;B	0.14023	0.01;0.002	T	0.47032	-0.9148	10	0.02654	T	1	.	7.1816	0.25776	0.1206:0.6869:0.0:0.1925	.	362;387	Q96JM7-2;Q96JM7	.;LMBL3_HUMAN	L	387;362;387;362;362;387	ENSP00000431962:F387L;ENSP00000437185:F362L;ENSP00000354526:F387L;ENSP00000357121:F362L;ENSP00000436706:F362L;ENSP00000357118:F387L	ENSP00000354526:F387L	F	+	3	2	L3MBTL3	130433882	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	1.686000	0.37669	0.920000	0.36970	0.655000	0.94253	TTC	L3MBTL3	-	pfam_Mbt,smart_Mbt,pfscan_Mbt		0.408	L3MBTL3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	L3MBTL3	HGNC	protein_coding	OTTHUMT00000042195.2	C	XM_027074		130392189	+1	no_errors	ENST00000361794	ensembl	human	known	70_37	missense	SNP	0.999	A
LAMA3	3909	genome.wustl.edu	37	18	21492846	21492846	+	Splice_Site	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:21492846G>A	ENST00000313654.9	+	56	7570		c.e56+1		LAMA3_ENST00000399516.3_Splice_Site|LAMA3_ENST00000588770.1_Splice_Site|LAMA3_ENST00000587184.1_Splice_Site|LAMA3_ENST00000269217.6_Splice_Site	NM_198129.1	NP_937762.1	Q16787	LAMA3_HUMAN	laminin, alpha 3						cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-5 complex (GO:0005610)	structural molecule activity (GO:0005198)			NS(2)|breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(24)|lung(54)|ovary(8)|prostate(6)|skin(7)|urinary_tract(4)	128	all_cancers(21;7.81e-05)|all_epithelial(16;4.45e-07)|Lung NSC(20;0.00156)|all_lung(20;0.00508)|Colorectal(14;0.0202)|Ovarian(20;0.17)					AAATAAAGATGTAAGTATTGC	0.413																																																	0													116.0	106.0	110.0					18																	21492846		2203	4300	6503	SO:0001630	splice_region_variant	3909			L34155	CCDS11880.1, CCDS42419.1, CCDS45838.1, CCDS59307.1	18q11.2	2013-03-01	2002-08-29		ENSG00000053747	ENSG00000053747		"""Laminins"""	6483	protein-coding gene	gene with protein product		600805	"""laminin, alpha 3 (nicein (150kD), kalinin (165kD), BM600 (150kD), epilegrin)"""	LAMNA		8077230	Standard	NM_000227		Approved	nicein-150kDa, kalinin-165kDa, BM600-150kDa, epiligrin	uc002kuq.3	Q16787	OTTHUMG00000131874	ENST00000313654.9:c.7329+1G>A	18.37:g.21492846G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ33|Q13679|Q13680|Q6VU67|Q6VU68|Q6VU69|Q76E14|Q96TG0	Splice_Site	SNP	-	e56+1	ENST00000313654.9	37	c.7329+1	CCDS42419.1	18	.	.	.	.	.	.	.	.	.	.	G	26.7	4.759749	0.89932	.	.	ENSG00000053747	ENST00000313654;ENST00000399516;ENST00000269217	.	.	.	5.64	5.64	0.86602	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.7174	0.96129	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LAMA3	19746844	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	8.677000	0.91203	2.653000	0.90120	0.655000	0.94253	.	LAMA3	-	-		0.413	LAMA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA3	HGNC	protein_coding	OTTHUMT00000254824.3	G	NM_000227, NM_198129	Intron	21492846	+1	no_errors	ENST00000313654	ensembl	human	known	70_37	splice_site	SNP	1.000	A
LARP1B	55132	genome.wustl.edu	37	4	129100652	129100652	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr4:129100652G>C	ENST00000326639.6	+	15	2199	c.1988G>C	c.(1987-1989)gGa>gCa	p.G663A	LARP1B_ENST00000506199.1_3'UTR|LARP1B_ENST00000354456.3_Missense_Mutation_p.G82A|LARP1B_ENST00000264584.5_Missense_Mutation_p.G604A|LARP1B_ENST00000441387.1_Missense_Mutation_p.G663A	NM_018078.2	NP_060548.2	Q659C4	LAR1B_HUMAN	La ribonucleoprotein domain family, member 1B	663						nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(7)|lung(11)|ovary(1)|prostate(3)	34						CGTGGGCCAGGAACATCCTCT	0.363																																																	0													141.0	148.0	146.0					4																	129100652		2203	4300	6503	SO:0001583	missense	55132				CCDS3738.1, CCDS47133.1, CCDS64057.1	4q28.2	2009-06-09	2009-06-09	2009-06-09	ENSG00000138709	ENSG00000138709		"""La ribonucleoprotein domain containing"""	24704	protein-coding gene	gene with protein product			"""La ribonucleoprotein domain family, member 2"""	LARP2		12045101	Standard	NM_018078		Approved	FLJ10378, DKFZp434K245, DKFZp686E0316	uc003iga.3	Q659C4	OTTHUMG00000133343	ENST00000326639.6:c.1988G>C	4.37:g.129100652G>C	ENSP00000321997:p.Gly663Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2YDB6|Q4W599|Q4W5B2|Q659A0|Q6P5X2|Q7Z3F7|Q86VK7|Q8N6F4|Q8N7H4|Q8NAF2|Q9H5E7|Q9NW12	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.G663A	ENST00000326639.6	37	c.1988	CCDS3738.1	4	.	.	.	.	.	.	.	.	.	.	G	10.83	1.462173	0.26248	.	.	ENSG00000138709	ENST00000326639;ENST00000264584;ENST00000441387;ENST00000354456	T;T;T;T	0.39787	2.05;2.07;2.06;1.06	4.3	4.3	0.51218	.	0.000000	0.85682	U	0.000000	T	0.22126	0.0533	N	0.02539	-0.55	0.26720	N	0.970799	B;B	0.06786	0.001;0.0	B;B	0.04013	0.001;0.001	T	0.22591	-1.0212	10	0.51188	T	0.08	.	16.9725	0.86304	0.0:0.0:1.0:0.0	.	82;663	Q659C4-5;Q659C4	.;LAR1B_HUMAN	A	663;604;663;82	ENSP00000321997:G663A;ENSP00000264584:G604A;ENSP00000396521:G663A;ENSP00000346444:G82A	ENSP00000264584:G604A	G	+	2	0	LARP1B	129320102	1.000000	0.71417	0.955000	0.39395	0.003000	0.03518	6.651000	0.74372	2.217000	0.71921	0.467000	0.42956	GGA	LARP1B	-	NULL		0.363	LARP1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP1B	HGNC	protein_coding	OTTHUMT00000257173.2	G	NM_018078		129100652	+1	no_errors	ENST00000326639	ensembl	human	known	70_37	missense	SNP	1.000	C
LMBR1L	55716	genome.wustl.edu	37	12	49496668	49496668	+	Splice_Site	SNP	A	A	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:49496668A>G	ENST00000267102.8	-	8	1039		c.e8+1		LMBR1L_ENST00000395141.4_Splice_Site|LMBR1L_ENST00000553204.1_5'Flank|LMBR1L_ENST00000547382.1_Splice_Site	NM_018113.2	NP_060583.2	Q6UX01	LMBRL_HUMAN	limb development membrane protein 1-like						endocytosis (GO:0006897)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(2)|large_intestine(1)|lung(5)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15						AATACCACATACCCGGGGCTT	0.532																																																	0													95.0	81.0	86.0					12																	49496668		2203	4300	6503	SO:0001630	splice_region_variant	55716			AB033000	CCDS8780.2, CCDS73466.1	12q13.12	2013-08-05	2013-08-05		ENSG00000139636	ENSG00000139636			18268	protein-coding gene	gene with protein product		610007	"""limb region 1 homolog (mouse)-like"""			10574461, 11287427	Standard	XM_005269022		Approved	FLJ10494, KIAA1174	uc001rth.4	Q6UX01	OTTHUMG00000150511	ENST00000267102.8:c.696+1T>C	12.37:g.49496668A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q969J4|Q96BY8|Q96HN8|Q9NT09|Q9NVE1|Q9NVU9|Q9ULP6	Splice_Site	SNP	-	e8+2	ENST00000267102.8	37	c.696+2	CCDS8780.2	12	.	.	.	.	.	.	.	.	.	.	A	25.9	4.681275	0.88542	.	.	ENSG00000139636	ENST00000267102;ENST00000547382;ENST00000395141;ENST00000547675	.	.	.	5.75	5.75	0.90469	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	15.3282	0.74182	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	LMBR1L	47782935	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.147000	0.94646	2.320000	0.78422	0.528000	0.53228	.	LMBR1L	-	-		0.532	LMBR1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LMBR1L	HGNC	protein_coding	OTTHUMT00000318696.1	A	NM_018113	Intron	49496668	-1	no_errors	ENST00000267102	ensembl	human	known	70_37	splice_site	SNP	1.000	G
TMEM8A	58986	genome.wustl.edu	37	16	436837	436837	+	Intron	SNP	G	G	A	rs369360		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:436837G>A	ENST00000476735.1	-	1	217				Z97634.3_ENST00000412293.1_RNA			Q9HCN3	TMM8A_HUMAN	transmembrane protein 8A						cell adhesion (GO:0007155)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)				central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|pancreas(1)|prostate(1)	14						TAAAGGCCAAGAAGGCAGCGT	0.532																																																	0																																										SO:0001627	intron_variant	100134368			AB045292	CCDS10407.1	16p13.3	2009-06-12	2009-06-12	2009-06-12	ENSG00000129925	ENSG00000129925			17205	protein-coding gene	gene with protein product			"""transmembrane protein 6"", ""transmembrane protein 8 (five membrane-spanning domains)"""	TMEM6, TMEM8		11006113	Standard	NM_021259		Approved	M83	uc002cgu.4	Q9HCN3	OTTHUMG00000047996	ENST00000476735.1:c.584+59C>T	16.37:g.436837G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DU49|Q4TT35|Q8WU24|Q96S25|Q9BR03|Q9BT97|Q9H7B9	RNA	SNP	-	NULL	ENST00000476735.1	37	NULL		16																																																																																			Z97634.5	-	-		0.532	TMEM8A-007	KNOWN	basic	processed_transcript	LOC100134368	Clone_based_vega_gene	protein_coding	OTTHUMT00000313680.1	G	NM_021259		436837	+1	no_errors	ENST00000457760	ensembl	human	known	70_37	rna	SNP	1.000	A
LONRF2	164832	genome.wustl.edu	37	2	100915696	100915696	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:100915696G>A	ENST00000393437.3	-	6	1992	c.1353C>T	c.(1351-1353)ctC>ctT	p.L451L	LONRF2_ENST00000409647.1_Silent_p.L208L	NM_198461.3	NP_940863.3	Q1L5Z9	LONF2_HUMAN	LON peptidase N-terminal domain and ring finger 2	451							ATP-dependent peptidase activity (GO:0004176)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(11)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	34						ACCTCATGCAGAGGGCACACT	0.428																																																	0													85.0	82.0	83.0					2																	100915696		2203	4300	6503	SO:0001819	synonymous_variant	164832			AK127206	CCDS2046.2	2q11.2	2013-01-09			ENSG00000170500	ENSG00000170500		"""RING-type (C3HC4) zinc fingers"""	24788	protein-coding gene	gene with protein product							Standard	NM_198461		Approved	FLJ45273, RNF192	uc002tal.4	Q1L5Z9	OTTHUMG00000130668	ENST00000393437.3:c.1353C>T	2.37:g.100915696G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9A006|Q6ZSR4	Silent	SNP	pfam_Pept_S16_N,pfam_Znf_C3HC4_RING-type,superfamily_PUA-like_domain,smart_Znf_RING,smart_TPR_repeat,smart_Pept_S16_N,pfscan_TPR-contain_dom,pfscan_Znf_RING	p.L451	ENST00000393437.3	37	c.1353	CCDS2046.2	2																																																																																			LONRF2	-	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING		0.428	LONRF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LONRF2	HGNC	protein_coding	OTTHUMT00000253161.2	G	NM_198461		100915696	-1	no_errors	ENST00000393437	ensembl	human	known	70_37	silent	SNP	0.950	A
LRRC24	441381	genome.wustl.edu	37	8	145748083	145748083	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:145748083C>T	ENST00000529415.2	-	5	1435	c.1318G>A	c.(1318-1320)Ggg>Agg	p.G440R	LRRC14_ENST00000528528.1_3'UTR|LRRC14_ENST00000292524.1_3'UTR|LRRC24_ENST00000533758.1_Missense_Mutation_p.G437R			Q50LG9	LRC24_HUMAN	leucine rich repeat containing 24	440						integral component of membrane (GO:0016021)				breast(2)|endometrium(1)|kidney(1)|lung(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			GCTCCCTCCCCCGGAGGCCCC	0.682																																																	0													11.0	12.0	11.0					8																	145748083		2170	4279	6449	SO:0001583	missense	441381			AB178281	CCDS34969.1	8q24.3	2013-01-11			ENSG00000254402	ENSG00000254402		"""Immunoglobulin superfamily / I-set domain containing"""	28947	protein-coding gene	gene with protein product						7584026	Standard	NM_001024678		Approved	LRRC14OS	uc003zdm.3	Q50LG9	OTTHUMG00000165180	ENST00000529415.2:c.1318G>A	8.37:g.145748083C>T	ENSP00000434849:p.Gly440Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ig_I-set,smart_LRR-contain_N,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.G440R	ENST00000529415.2	37	c.1318	CCDS34969.1	8	.	.	.	.	.	.	.	.	.	.	C	19.35	3.811113	0.70797	.	.	ENSG00000254402	ENST00000529415;ENST00000533758	T;T	0.55234	0.67;0.53	4.92	4.92	0.64577	.	0.254621	0.38492	N	0.001673	T	0.53222	0.1783	N	0.19112	0.55	0.45250	D	0.998255	P;D	0.59767	0.773;0.986	B;P	0.56916	0.372;0.809	T	0.58306	-0.7659	10	0.62326	D	0.03	.	15.6382	0.76973	0.0:1.0:0.0:0.0	.	437;440	G3V1D8;Q50LG9	.;LRC24_HUMAN	R	440;437	ENSP00000434849:G440R;ENSP00000435653:G437R	ENSP00000434849:G440R	G	-	1	0	LRRC24	145718891	0.804000	0.28969	0.347000	0.25668	0.065000	0.16274	3.079000	0.50104	2.565000	0.86533	0.561000	0.74099	GGG	LRRC24	-	NULL		0.682	LRRC24-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC24	HGNC	protein_coding	OTTHUMT00000382501.2	C	NM_001024678		145748083	-1	no_errors	ENST00000529415	ensembl	human	known	70_37	missense	SNP	0.981	T
LRRC34	151827	genome.wustl.edu	37	3	169511578	169511578	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:169511578C>T	ENST00000316515.7	-	10	1381	c.1105G>A	c.(1105-1107)Gat>Aat	p.D369N	RP11-362K14.6_ENST00000602835.1_RNA|LRRC34_ENST00000522526.2_Missense_Mutation_p.D382N|RP11-362K14.7_ENST00000602913.1_RNA|LRRC34_ENST00000524327.1_5'Flank|LRRC34_ENST00000522830.1_Missense_Mutation_p.D353N|LRRC34_ENST00000446859.1_Missense_Mutation_p.D414N	NM_153353.4	NP_699184.2	Q8IZ02	LRC34_HUMAN	leucine rich repeat containing 34	369										breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)|upper_aerodigestive_tract(2)	10	all_cancers(22;4.12e-22)|all_epithelial(15;7.54e-27)|all_lung(20;1.63e-16)|Lung NSC(18;6.92e-16)|Ovarian(172;0.000223)|Breast(254;0.197)		Lung(28;2.71e-13)|STAD - Stomach adenocarcinoma(35;0.00676)			GGCTCCACATCTGTATTGTCT	0.323																																																	0													91.0	87.0	88.0					3																	169511578		2203	4300	6503	SO:0001583	missense	151827			AK095125	CCDS3208.1, CCDS3208.2, CCDS54672.1	3q26.2	2014-03-18			ENSG00000171757	ENSG00000171757			28408	protein-coding gene	gene with protein product						12477932	Standard	NM_153353		Approved	MGC27085	uc003ffy.3	Q8IZ02	OTTHUMG00000164419	ENST00000316515.7:c.1105G>A	3.37:g.169511578C>T	ENSP00000326150:p.Asp369Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DEJ7|E9PBH2|G5E9T7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ	p.D414N	ENST00000316515.7	37	c.1240		3	.	.	.	.	.	.	.	.	.	.	C	17.62	3.435381	0.62955	.	.	ENSG00000171757	ENST00000446859;ENST00000316515;ENST00000522830;ENST00000522526	T;T;T;T	0.53640	0.61;0.61;0.61;0.61	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.70055	0.3180	M	0.82823	2.61	0.58432	D	0.999999	D;D;P	0.63046	0.992;0.989;0.779	P;P;B	0.62382	0.901;0.766;0.251	T	0.68788	-0.5316	10	0.35671	T	0.21	-32.1053	19.4819	0.95013	0.0:1.0:0.0:0.0	.	353;414;369	G3V115;G5E9T7;Q8IZ02	.;.;LRC34_HUMAN	N	414;369;353;382	ENSP00000414635:D414N;ENSP00000326150:D369N;ENSP00000429593:D353N;ENSP00000429278:D382N	ENSP00000326150:D369N	D	-	1	0	LRRC34	170994272	1.000000	0.71417	1.000000	0.80357	0.033000	0.12548	6.070000	0.71220	2.689000	0.91719	0.650000	0.86243	GAT	LRRC34	-	NULL		0.323	LRRC34-201	KNOWN	basic	protein_coding	LRRC34	HGNC	protein_coding		C	NM_153353		169511578	-1	no_errors	ENST00000446859	ensembl	human	known	70_37	missense	SNP	1.000	T
LTBP4	8425	genome.wustl.edu	37	19	41133092	41133092	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:41133092G>C	ENST00000308370.7	+	32	4396	c.4396G>C	c.(4396-4398)Ggg>Cgg	p.G1466R	LTBP4_ENST00000204005.9_Missense_Mutation_p.G1429R|LTBP4_ENST00000243562.9_3'UTR|LTBP4_ENST00000396819.3_Missense_Mutation_p.G1399R|LTBP4_ENST00000602240.1_3'UTR|LTBP4_ENST00000545697.1_Missense_Mutation_p.G834R	NM_001042544.1	NP_001036009.1	Q8N2S1	LTBP4_HUMAN	latent transforming growth factor beta binding protein 4	1467	Pro-rich.				extracellular matrix organization (GO:0030198)|growth hormone secretion (GO:0030252)|multicellular organismal development (GO:0007275)|protein folding (GO:0006457)|regulation of cell differentiation (GO:0045595)|regulation of cell growth (GO:0001558)|regulation of proteolysis (GO:0030162)|regulation of transforming growth factor beta receptor signaling pathway (GO:0017015)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|glycosaminoglycan binding (GO:0005539)|integrin binding (GO:0005178)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta-activated receptor activity (GO:0005024)			central_nervous_system(1)	1			Lung(22;0.000158)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GGCTCCTTATGGGGCACCCCG	0.682																																																	0													17.0	23.0	21.0					19																	41133092		1927	4112	6039	SO:0001583	missense	8425			Y13622	CCDS74368.1, CCDS74369.1, CCDS74370.1	19q13.1-q13.2	2011-10-20				ENSG00000090006		"""Latent transforming growth factor, beta binding proteins"""	6717	protein-coding gene	gene with protein product		604710				9660815, 9271198	Standard	NM_003573		Approved	LTBP-4, LTBP-4L, FLJ46318, FLJ90018	uc002ooh.1	Q8N2S1		ENST00000308370.7:c.4396G>C	19.37:g.41133092G>C	ENSP00000311905:p.Gly1466Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	O00508|O75412|O75413	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.G1466R	ENST00000308370.7	37	c.4396		19	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744095	0.49151	.	.	ENSG00000090006	ENST00000204005;ENST00000545697;ENST00000308370;ENST00000396819;ENST00000318809	T;D;T;T	0.83591	-1.25;-1.74;-1.26;-1.24	4.84	3.79	0.43588	.	0.000000	0.37577	N	0.002030	T	0.77232	0.4100	.	.	.	0.28811	N	0.898227	B;P;P;P;P;P	0.42692	0.452;0.551;0.59;0.787;0.59;0.59	B;B;B;B;B;B	0.38842	0.126;0.283;0.243;0.219;0.159;0.159	T	0.74662	-0.3590	9	0.66056	D	0.02	.	12.5112	0.56007	0.0:0.1681:0.8319:0.0	.	227;479;687;1399;1467;1429	F5GYA5;Q8N2S1-4;B3KXY6;E7EUU1;Q8N2S1;E7ENG9	.;.;.;.;LTBP4_HUMAN;.	R	1429;834;1466;1399;227	ENSP00000204005:G1429R;ENSP00000441054:G834R;ENSP00000311905:G1466R;ENSP00000380031:G1399R	ENSP00000204005:G1429R	G	+	1	0	LTBP4	45824932	1.000000	0.71417	0.148000	0.22405	0.524000	0.34500	4.279000	0.58953	1.249000	0.43950	0.655000	0.94253	GGG	LTBP4	-	NULL		0.682	LTBP4-203	KNOWN	basic|appris_candidate_longest	protein_coding	LTBP4	HGNC	protein_coding		G	NM_003573		41133092	+1	no_errors	ENST00000308370	ensembl	human	known	70_37	missense	SNP	0.524	C
LYST	1130	genome.wustl.edu	37	1	235944340	235944340	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:235944340G>C	ENST00000389794.3	-	16	5213	c.5039C>G	c.(5038-5040)tCa>tGa	p.S1680*	LYST_ENST00000389793.2_Nonsense_Mutation_p.S1680*|LYST_ENST00000536965.1_3'UTR			Q99698	LYST_HUMAN	lysosomal trafficking regulator	1680					blood coagulation (GO:0007596)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endosome to lysosome transport via multivesicular body sorting pathway (GO:0032510)|leukocyte chemotaxis (GO:0030595)|lysosome organization (GO:0007040)|mast cell secretory granule organization (GO:0033364)|melanosome organization (GO:0032438)|microtubule-based process (GO:0007017)|natural killer cell mediated cytotoxicity (GO:0042267)|neutrophil mediated immunity (GO:0002446)|phospholipid homeostasis (GO:0055091)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of natural killer cell activation (GO:0032816)|response to drug (GO:0042493)|secretion of lysosomal enzymes (GO:0033299)|T cell mediated immunity (GO:0002456)	cytosol (GO:0005829)|microtubule cytoskeleton (GO:0015630)		p.S1680*(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(3)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(27)|lung(66)|ovary(7)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	162	Ovarian(103;0.0634)|Breast(184;0.23)	all_cancers(173;0.00246)|Prostate(94;0.0771)|Acute lymphoblastic leukemia(190;0.228)	OV - Ovarian serous cystadenocarcinoma(106;0.000674)			GGCCTCTTGTGAACCAACCTT	0.343																																																	1	Substitution - Nonsense(1)	lung(1)											34.0	33.0	34.0					1																	235944340		2203	4300	6503	SO:0001587	stop_gained	1130			U70064	CCDS31062.1	1q42.1-q42.2	2014-09-17	2004-12-09	2004-12-10	ENSG00000143669	ENSG00000143669		"""WD repeat domain containing"""	1968	protein-coding gene	gene with protein product		606897	"""Chediak-Higashi syndrome 1"""	CHS1		8717042, 8896560	Standard	NM_000081		Approved	CHS	uc001hxj.3	Q99698	OTTHUMG00000040527	ENST00000389794.3:c.5039C>G	1.37:g.235944340G>C	ENSP00000374444:p.Ser1680*	Somatic		WXS	Illumina HiSeq	Phase_IV	O43274|Q5T2U9|Q96TD7|Q96TD8|Q99709|Q9H133	Nonsense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1680*	ENST00000389794.3	37	c.5039	CCDS31062.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.114963	0.99637	.	.	ENSG00000143669	ENST00000389794;ENST00000389793	.	.	.	5.05	5.05	0.67936	.	0.609185	0.17169	N	0.184380	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.44086	T	0.13	.	18.769	0.91883	0.0:0.0:1.0:0.0	.	.	.	.	X	1680	.	ENSP00000374443:S1680X	S	-	2	0	LYST	234010963	0.998000	0.40836	0.994000	0.49952	0.957000	0.61999	6.204000	0.72143	2.506000	0.84524	0.467000	0.42956	TCA	LYST	-	superfamily_ARM-type_fold		0.343	LYST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LYST	HGNC	protein_coding	OTTHUMT00000097533.5	G			235944340	-1	no_errors	ENST00000389793	ensembl	human	known	70_37	nonsense	SNP	0.966	C
MAGEA3	4102	genome.wustl.edu	37	X	151935841	151935841	+	Missense_Mutation	SNP	A	A	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:151935841A>T	ENST00000393902.3	-	3	893	c.326T>A	c.(325-327)cTc>cAc	p.L109H	MAGEA3_ENST00000370278.3_Missense_Mutation_p.L109H			P43357	MAGA3_HUMAN	melanoma antigen family A, 3	109	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									endometrium(4)|kidney(1)|large_intestine(1)|lung(7)|ovary(2)	15	Acute lymphoblastic leukemia(192;6.56e-05)					CTTCCTACTGAGTGCTGCTTG	0.552																																																	0													146.0	132.0	137.0					X																	151935841		2202	4291	6493	SO:0001583	missense	4102				CCDS76045.1	Xq28	2009-03-13			ENSG00000221867	ENSG00000221867			6801	protein-coding gene	gene with protein product	"""melanoma-associated antigen 3"", ""antigen MZ2-D"", ""MAGE-3 antigen"", ""cancer/testis antigen family 1, member 3"""	300174		MAGE3		1840703, 8575766	Standard	NM_005362		Approved	HYPD, HIP8, MGC14613, CT1.3	uc004fgp.3	P43357	OTTHUMG00000022640	ENST00000393902.3:c.326T>A	X.37:g.151935841A>T	ENSP00000377480:p.Leu109His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6FHI6	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.L109H	ENST00000393902.3	37	c.326	CCDS14715.1	X	.	.	.	.	.	.	.	.	.	.	a	11.57	1.677557	0.29783	.	.	ENSG00000221867	ENST00000370278;ENST00000393902;ENST00000417212	T;T;T	0.04015	4.18;4.18;3.73	1.42	1.42	0.22433	.	0.695485	0.13118	N	0.412450	T	0.23054	0.0557	H	0.95780	3.72	0.09310	N	1	D	0.71674	0.998	D	0.63033	0.91	T	0.06716	-1.0811	10	0.87932	D	0	.	4.542	0.12061	1.0:0.0:0.0:0.0	.	109	P43357	MAGA3_HUMAN	H	109	ENSP00000359301:L109H;ENSP00000377480:L109H;ENSP00000392758:L109H	ENSP00000359301:L109H	L	-	2	0	MAGEA3	151686497	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.204000	0.17335	0.818000	0.34468	0.293000	0.19593	CTC	MAGEA3	-	pfscan_MAGE		0.552	MAGEA3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA3	HGNC	protein_coding	OTTHUMT00000058744.1	A	NM_005362		151935841	-1	no_errors	ENST00000370278	ensembl	human	known	70_37	missense	SNP	0.000	T
MAN1A2	10905	genome.wustl.edu	37	1	117911031	117911031	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:117911031C>T	ENST00000356554.3	+	1	961	c.226C>T	c.(226-228)Cca>Tca	p.P76S	MAN1A2_ENST00000482811.1_3'UTR|RP11-188D8.1_ENST00000604156.1_lincRNA	NM_006699.3	NP_006690.1	O60476	MA1A2_HUMAN	mannosidase, alpha, class 1A, member 2	76					cellular protein metabolic process (GO:0044267)|lung alveolus development (GO:0048286)|N-glycan processing (GO:0006491)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)	extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleolus (GO:0005730)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(17)|ovary(1)|skin(1)|urinary_tract(1)	27	Lung SC(450;0.225)	all_cancers(81;7.9e-06)|all_epithelial(167;7.39e-07)|all_lung(203;2.84e-06)|Lung NSC(69;1.99e-05)		Lung(183;0.0688)|Kidney(133;0.114)|LUSC - Lung squamous cell carcinoma(189;0.223)|KIRC - Kidney renal clear cell carcinoma(1967;0.237)|Colorectal(144;0.243)		TGTGTTAATTCCACATGTAGA	0.428																																					Ovarian(33;199 881 8228 13687 31538)												0													87.0	92.0	90.0					1																	117911031		2203	4300	6503	SO:0001583	missense	10905			AF027156	CCDS895.1	1p13	2008-02-05			ENSG00000198162	ENSG00000198162			6822	protein-coding gene	gene with protein product		604345				9592125	Standard	NM_006699		Approved	MAN1B	uc001ehd.1	O60476	OTTHUMG00000012149	ENST00000356554.3:c.226C>T	1.37:g.117911031C>T	ENSP00000348959:p.Pro76Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H510	Missense_Mutation	SNP	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.P76S	ENST00000356554.3	37	c.226	CCDS895.1	1	.	.	.	.	.	.	.	.	.	.	C	17.30	3.354295	0.61293	.	.	ENSG00000198162	ENST00000356554	D	0.82984	-1.67	4.36	4.36	0.52297	.	0.000000	0.85682	D	0.000000	T	0.73900	0.3646	M	0.68593	2.085	0.58432	D	0.999999	B	0.26935	0.164	B	0.24541	0.054	T	0.76777	-0.2834	10	0.49607	T	0.09	-15.5006	14.4414	0.67321	0.0:1.0:0.0:0.0	.	76	O60476	MA1A2_HUMAN	S	76	ENSP00000348959:P76S	ENSP00000348959:P76S	P	+	1	0	MAN1A2	117712554	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.223000	0.78033	2.255000	0.74692	0.561000	0.74099	CCA	MAN1A2	-	NULL		0.428	MAN1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1A2	HGNC	protein_coding	OTTHUMT00000033593.1	C	NM_006699		117911031	+1	no_errors	ENST00000356554	ensembl	human	known	70_37	missense	SNP	1.000	T
MAP3K19	80122	genome.wustl.edu	37	2	135756556	135756556	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:135756556G>A	ENST00000375845.3	-	5	356	c.326C>T	c.(325-327)tCa>tTa	p.S109L	MAP3K19_ENST00000392918.3_Missense_Mutation_p.S109L|MAP3K19_ENST00000315513.3_5'UTR|MAP3K19_ENST00000375844.3_Missense_Mutation_p.S109L|MAP3K19_ENST00000392917.3_Missense_Mutation_p.S109L|MAP3K19_ENST00000358371.4_Intron|MAP3K19_ENST00000392915.1_Missense_Mutation_p.S126L	NM_001018044.2|NM_025052.3	NP_001018054.1|NP_079328.3	Q56UN5	M3K19_HUMAN	mitogen-activated protein kinase kinase kinase 19	109							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)										TTGAAGCGATGAGTTTATCAG	0.443																																																	0													98.0	97.0	97.0					2																	135756556		2203	4300	6503	SO:0001583	missense	80122			AK026727	CCDS2176.2, CCDS33293.1, CCDS63021.1, CCDS63020.1, CCDS63022.1	2q21.3	2012-10-16	2012-10-16	2012-10-16	ENSG00000176601	ENSG00000176601		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	26249	protein-coding gene	gene with protein product			"""Yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""yeast Sps1/Ste20-related kinase 4 (S. cerevisiae)"", ""YSK4 Sps1/Ste20-related kinase homolog (S. cerevisiae)"""	YSK4		12477932	Standard	NM_001282883		Approved	FLJ23074	uc002tue.1	Q56UN5	OTTHUMG00000074083	ENST00000375845.3:c.326C>T	2.37:g.135756556G>A	ENSP00000365005:p.Ser109Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP57|B7ZMH9|E2QRE3|Q56UN1|Q56UN2|Q56UN3|Q56UN4|Q8N4E9|Q9H5T2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S109L	ENST00000375845.3	37	c.326	CCDS2176.2	2	.	.	.	.	.	.	.	.	.	.	G	12.20	1.866897	0.32977	.	.	ENSG00000176601	ENST00000375845;ENST00000375844;ENST00000392918;ENST00000392917;ENST00000392915;ENST00000425952	T;T;T;T;T	0.75821	-0.97;-0.66;-0.68;-0.53;1.38	5.25	2.52	0.30459	.	1.238010	0.06082	N	0.662056	T	0.68201	0.2975	L	0.56769	1.78	0.09310	N	0.999997	B;B;B;B;B;P	0.39282	0.0;0.021;0.0;0.021;0.0;0.666	B;B;B;B;B;B	0.33339	0.002;0.021;0.004;0.021;0.004;0.162	T	0.56312	-0.8000	10	0.56958	D	0.05	.	6.9828	0.24711	0.2755:0.0:0.7245:0.0	.	109;109;109;126;109;109	B7ZMH9;Q56UN5-2;Q56UN5-4;A8MWG7;Q56UN5-5;Q56UN5	.;.;.;.;.;YSK4_HUMAN	L	109;109;109;109;126;81	ENSP00000365005:S109L;ENSP00000365004:S109L;ENSP00000376650:S109L;ENSP00000376649:S109L;ENSP00000376647:S126L	ENSP00000365004:S109L	S	-	2	0	YSK4	135473026	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.789000	0.26886	0.387000	0.25024	-0.142000	0.14014	TCA	MAP3K19	-	NULL		0.443	MAP3K19-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K19	HGNC	protein_coding	OTTHUMT00000158244.1	G	NM_025052		135756556	-1	no_errors	ENST00000375845	ensembl	human	known	70_37	missense	SNP	0.000	A
MAP7D3	79649	genome.wustl.edu	37	X	135310928	135310928	+	Intron	SNP	T	T	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:135310928T>G	ENST00000316077.9	-	11	1971				MAP7D3_ENST00000370663.5_Intron|MAP7D3_ENST00000370661.1_Intron|MAP7D3_ENST00000495432.1_5'UTR	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3						microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)				central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					CTAGTTTAAATAAATATGTGC	0.373																																																	0													56.0	51.0	52.0					X																	135310928		1812	4066	5878	SO:0001627	intron_variant	79649			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1751-11A>C	X.37:g.135310928T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	RNA	SNP	-	NULL	ENST00000316077.9	37	NULL	CCDS44004.1	X																																																																																			MAP7D3	-	-		0.373	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	HGNC	protein_coding	OTTHUMT00000058487.2	T			135310928	-1	no_errors	ENST00000495432	ensembl	human	known	70_37	rna	SNP	0.268	G
MCHR2	84539	genome.wustl.edu	37	6	100390912	100390912	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:100390912G>A	ENST00000281806.2	-	4	814	c.500C>T	c.(499-501)cCt>cTt	p.P167L	MCHR2_ENST00000369212.2_Missense_Mutation_p.P167L	NM_001040179.1	NP_001035269.1	Q969V1	MCHR2_HUMAN	melanin-concentrating hormone receptor 2	167						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(19)|ovary(2)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	39		all_cancers(76;4.87e-05)|Acute lymphoblastic leukemia(125;4.99e-11)|all_hematologic(75;5.82e-08)|all_epithelial(107;0.0309)|Colorectal(196;0.069)		BRCA - Breast invasive adenocarcinoma(108;0.0429)		GACCCAGACAGGCAATGCCAG	0.473																																																	0													152.0	142.0	145.0					6																	100390912		2203	4300	6503	SO:0001583	missense	84539			AF347063	CCDS5044.1	6q16	2012-08-08	2006-02-15	2006-02-15	ENSG00000152034	ENSG00000152034		"""GPCR / Class A : MCH receptors"""	20867	protein-coding gene	gene with protein product		606111	"""G protein-coupled receptor 145"""	GPR145		11355873, 11274220	Standard	NM_032503		Approved	SLT, MCH2, MCH2R	uc003pqi.1	Q969V1	OTTHUMG00000015270	ENST00000281806.2:c.500C>T	6.37:g.100390912G>A	ENSP00000281806:p.Pro167Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVW4|E1P5D7|Q5VTV7|Q6Q377|Q9BXA8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_MCH2_receptor,prints_GPCR_Rhodpsn,prints_MCH_rcpt	p.P167L	ENST00000281806.2	37	c.500	CCDS5044.1	6	.	.	.	.	.	.	.	.	.	.	G	25.2	4.611009	0.87258	.	.	ENSG00000152034	ENST00000445970;ENST00000281806;ENST00000369212	T;T;T	0.44482	0.92;0.92;0.92	5.05	5.05	0.67936	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	T	0.66655	0.2811	M	0.90542	3.125	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75241	-0.3387	10	0.87932	D	0	.	16.9597	0.86269	0.0:0.0:1.0:0.0	.	167	Q969V1	MCHR2_HUMAN	L	167	ENSP00000403490:P167L;ENSP00000281806:P167L;ENSP00000358214:P167L	ENSP00000281806:P167L	P	-	2	0	MCHR2	100497633	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	8.152000	0.89638	2.358000	0.79984	0.655000	0.94253	CCT	MCHR2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_MCH_rcpt		0.473	MCHR2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	MCHR2	HGNC	protein_coding	OTTHUMT00000041620.2	G	NM_032503		100390912	-1	no_errors	ENST00000281806	ensembl	human	known	70_37	missense	SNP	1.000	A
MED18	54797	genome.wustl.edu	37	1	28661335	28661335	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:28661335G>A	ENST00000373842.4	+	3	690	c.481G>A	c.(481-483)Gag>Aag	p.E161K	MED18_ENST00000479574.1_3'UTR|MED18_ENST00000398997.2_Missense_Mutation_p.E161K	NM_001127350.1|NM_017638.2	NP_001120822.1|NP_060108.2	Q9BUE0	MED18_HUMAN	mediator complex subunit 18	161						mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)			endometrium(1)|kidney(2)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	7		Colorectal(325;0.000147)|Lung NSC(340;0.000818)|all_lung(284;0.000996)|Renal(390;0.00357)|Breast(348;0.0174)|Myeloproliferative disorder(586;0.0393)|all_neural(195;0.0557)|Ovarian(437;0.113)		OV - Ovarian serous cystadenocarcinoma(117;2.36e-22)|Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00269)|STAD - Stomach adenocarcinoma(196;0.00299)|BRCA - Breast invasive adenocarcinoma(304;0.0141)|READ - Rectum adenocarcinoma(331;0.0649)		AGACAGCACTGAGGCCTTGTC	0.483																																																	0													142.0	125.0	131.0					1																	28661335		2203	4300	6503	SO:0001583	missense	54797			BC002694	CCDS322.1	1p35.3	2007-07-30	2007-07-30		ENSG00000130772	ENSG00000130772			25944	protein-coding gene	gene with protein product		612384	"""mediator of RNA polymerase II transcription, subunit 18 homolog (S. cerevisiae)"""			15175163	Standard	NM_001127350		Approved	FLJ20045, p28b	uc009vtg.3	Q9BUE0	OTTHUMG00000003537	ENST00000373842.4:c.481G>A	1.37:g.28661335G>A	ENSP00000362948:p.Glu161Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPM1|Q9NXU9	Missense_Mutation	SNP	pfam_Mediator_Med18_met/fun	p.E161K	ENST00000373842.4	37	c.481	CCDS322.1	1	.	.	.	.	.	.	.	.	.	.	G	27.6	4.849906	0.91277	.	.	ENSG00000130772	ENST00000373842;ENST00000398997	.	.	.	5.84	5.84	0.93424	Mediator complex, subunit Med18, metazoa/fungi (1);	0.047897	0.85682	D	0.000000	T	0.73110	0.3545	M	0.71036	2.16	0.39270	D	0.96436	D	0.56287	0.975	P	0.54372	0.75	T	0.70263	-0.4920	9	0.24483	T	0.36	-23.6643	18.9075	0.92469	0.0:0.0:1.0:0.0	.	161	Q9BUE0	MED18_HUMAN	K	161	.	ENSP00000362948:E161K	E	+	1	0	MED18	28533922	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.731000	0.98807	2.756000	0.94617	0.655000	0.94253	GAG	MED18	-	pfam_Mediator_Med18_met/fun		0.483	MED18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED18	HGNC	protein_coding	OTTHUMT00000009856.1	G	NM_017638		28661335	+1	no_errors	ENST00000373842	ensembl	human	known	70_37	missense	SNP	1.000	A
MICALL2	79778	genome.wustl.edu	37	7	1479625	1479625	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:1479625G>A	ENST00000297508.7	-	9	2077	c.1902C>T	c.(1900-1902)atC>atT	p.I634I	MICALL2_ENST00000405088.4_Silent_p.I422I|MICALL2_ENST00000471899.1_5'Flank	NM_182924.3	NP_891554.1	Q8IY33	MILK2_HUMAN	MICAL-like 2	634	Mediates targeting to the cell plasma membrane. {ECO:0000250}.				actin cytoskeleton reorganization (GO:0031532)|actin filament polymerization (GO:0030041)|endocytic recycling (GO:0032456)|neuron projection development (GO:0031175)|substrate adhesion-dependent cell spreading (GO:0034446)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin filament binding (GO:0051015)|filamin binding (GO:0031005)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(1)|kidney(2)|lung(8)|ovary(2)|skin(2)	19		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0178)|OV - Ovarian serous cystadenocarcinoma(56;6.01e-15)		GGGTCAGGGTGATGTGGACAC	0.706																																																	0													35.0	37.0	36.0					7																	1479625		2195	4294	6489	SO:0001819	synonymous_variant	79778			BC037988	CCDS5324.1	7p22.3	2006-11-24			ENSG00000164877	ENSG00000164877			29672	protein-coding gene	gene with protein product	"""junctional Rab13-binding protein"""					12110185, 16525024	Standard	NM_182924		Approved	MGC46023, FLJ23471, MICAL-L2, JRAB	uc003skj.4	Q8IY33	OTTHUMG00000119021	ENST00000297508.7:c.1902C>T	7.37:g.1479625G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3YTD2|Q7RTP4|Q7Z655|Q8TEQ4|Q9H5F9	Silent	SNP	pfam_DUF3585,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Znf_LIM,superfamily_CH-domain,smart_CH-domain,smart_Znf_LIM,pfscan_CH-domain,pfscan_Znf_LIM	p.I634	ENST00000297508.7	37	c.1902	CCDS5324.1	7																																																																																			MICALL2	-	NULL		0.706	MICALL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MICALL2	HGNC	protein_coding	OTTHUMT00000239223.2	G	NM_182924		1479625	-1	no_errors	ENST00000297508	ensembl	human	known	70_37	silent	SNP	0.046	A
METTL2B	55798	genome.wustl.edu	37	7	128138114	128138114	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:128138114G>A	ENST00000262432.8	+	7	871	c.834G>A	c.(832-834)ctG>ctA	p.L278L	METTL2B_ENST00000480046.1_Silent_p.L213L	NM_018396.2	NP_060866.2	Q6P1Q9	MET2B_HUMAN	methyltransferase like 2B	278					tRNA methylation (GO:0030488)		tRNA (cytosine) methyltransferase activity (GO:0016427)			breast(1)|cervix(1)|large_intestine(2)|lung(10)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	17						TCAACAGGCTGAGCAGGCTTC	0.473																																																	0													102.0	100.0	101.0					7																	128138114		2203	4300	6503	SO:0001819	synonymous_variant	55798			AK002212	CCDS5803.2	7q32.2	2012-06-12	2006-02-09	2006-02-09	ENSG00000165055	ENSG00000165055			18272	protein-coding gene	gene with protein product		607846	"""methyltransferase like 2"""	METTL2		11738826	Standard	NM_018396		Approved	METL, FLJ11350	uc003vnf.3	Q6P1Q9	OTTHUMG00000143738	ENST00000262432.8:c.834G>A	7.37:g.128138114G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZ68|Q0IJ54|Q3B7J1	Silent	SNP	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd	p.L278	ENST00000262432.8	37	c.834	CCDS5803.2	7																																																																																			METTL2B	-	pfam_Methyltransf_12,pfam_Methyltransf_11,pfam_UbiE/COQ5_MeTrFase,pirsf_MeTrfase_METTL2_prd		0.473	METTL2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL2B	HGNC	protein_coding	OTTHUMT00000289817.1	G	NM_018396		128138114	+1	no_errors	ENST00000262432	ensembl	human	known	70_37	silent	SNP	0.962	A
MIER3	166968	genome.wustl.edu	37	5	56219369	56219369	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:56219369C>T	ENST00000381199.3	-	13	1249	c.1239G>A	c.(1237-1239)gtG>gtA	p.V413V	MIER3_ENST00000381226.3_Silent_p.V418V|MIER3_ENST00000381213.3_Silent_p.V412V|MIER3_ENST00000409421.1_Silent_p.V350V|SETD9_ENST00000541720.1_Intron			Q7Z3K6	MIER3_HUMAN	mesoderm induction early response 1, family member 3	413					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|liver(1)|lung(2)|urinary_tract(1)	19		Lung NSC(810;4.65e-05)|Prostate(74;0.0253)|Breast(144;0.0503)|Ovarian(174;0.223)		OV - Ovarian serous cystadenocarcinoma(10;1.24e-37)		CCAAACAATTCACATCTGTGG	0.458																																																	0													52.0	54.0	53.0					5																	56219369		2203	4300	6503	SO:0001819	synonymous_variant	166968			BX537798	CCDS3973.2, CCDS75248.1	5q11.2	2009-03-19			ENSG00000155545	ENSG00000155545			26678	protein-coding gene	gene with protein product						12477932	Standard	XM_005248448		Approved	FLJ35954, DKFZp686L09111, DKFZp781I1119	uc003jra.1	Q7Z3K6	OTTHUMG00000059589	ENST00000381199.3:c.1239G>A	5.37:g.56219369C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRI9|B8ZZQ0|Q5CZI0|Q68CS3|Q6MZS7|Q86YG8|Q8NA13	Silent	SNP	pfam_ELM2_dom,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_ELM2_dom	p.V413	ENST00000381199.3	37	c.1239		5																																																																																			MIER3	-	NULL		0.458	MIER3-004	KNOWN	basic|appris_candidate	protein_coding	MIER3	HGNC	protein_coding	OTTHUMT00000132523.2	C	NM_152622		56219369	-1	no_errors	ENST00000381199	ensembl	human	known	70_37	silent	SNP	1.000	T
MON2	23041	genome.wustl.edu	37	12	62949938	62949938	+	Silent	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:62949938C>A	ENST00000393632.2	+	25	3766	c.3375C>A	c.(3373-3375)atC>atA	p.I1125I	MON2_ENST00000546600.1_Silent_p.I1125I|MON2_ENST00000393629.2_Silent_p.I1125I|MON2_ENST00000552738.1_Silent_p.I1102I|MON2_ENST00000280379.6_Silent_p.I1126I|MON2_ENST00000393630.3_Silent_p.I1126I	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	1125					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TAGCAAGGATCTTCAACACTA	0.388																																																	0													79.0	74.0	76.0					12																	62949938		2203	4300	6503	SO:0001819	synonymous_variant	23041				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.3375C>A	12.37:g.62949938C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Silent	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	p.I1126	ENST00000393632.2	37	c.3378	CCDS31849.1	12																																																																																			MON2	-	superfamily_ARM-type_fold		0.388	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	C	NM_015026		62949938	+1	no_errors	ENST00000393630	ensembl	human	known	70_37	silent	SNP	1.000	A
MOV10L1	54456	genome.wustl.edu	37	22	50564699	50564699	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:50564699G>C	ENST00000262794.5	+	12	1899	c.1816G>C	c.(1816-1818)Gag>Cag	p.E606Q	MOV10L1_ENST00000545383.1_Missense_Mutation_p.E606Q|MOV10L1_ENST00000395858.3_Missense_Mutation_p.E606Q|MOV10L1_ENST00000540615.1_Missense_Mutation_p.E586Q|MOV10L1_ENST00000395843.1_5'UTR	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	606					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CTACGTGACTGAGGTGAGAGC	0.423																																																	0													113.0	93.0	100.0					22																	50564699		2203	4300	6503	SO:0001583	missense	54456			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.1816G>C	22.37:g.50564699G>C	ENSP00000262794:p.Glu606Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.E606Q	ENST00000262794.5	37	c.1816	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	G	17.94	3.510773	0.64522	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000540615	D;D;T;D	0.86164	-1.89;-1.89;-1.48;-2.08	5.64	5.64	0.86602	.	0.000000	0.85682	D	0.000000	D	0.91962	0.7454	M	0.78049	2.395	0.80722	D	1	D;P;P;P	0.69078	0.997;0.951;0.864;0.864	P;P;B;B	0.57468	0.821;0.604;0.327;0.327	D	0.92114	0.5698	10	0.52906	T	0.07	-39.0063	16.6126	0.84892	0.0:0.0:1.0:0.0	.	367;586;606;606	B7Z893;F5H403;A8MXC6;Q9BXT6	.;.;.;M10L1_HUMAN	Q	606;606;606;586	ENSP00000438978:E606Q;ENSP00000262794:E606Q;ENSP00000379199:E606Q;ENSP00000438542:E586Q	ENSP00000262794:E606Q	E	+	1	0	MOV10L1	48906826	1.000000	0.71417	0.963000	0.40424	0.747000	0.42532	4.278000	0.58946	2.644000	0.89710	0.655000	0.94253	GAG	MOV10L1	-	NULL		0.423	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	G	NM_018995		50564699	+1	no_errors	ENST00000262794	ensembl	human	known	70_37	missense	SNP	0.990	C
MPZL2	10205	genome.wustl.edu	37	11	118134829	118134829	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:118134829G>T	ENST00000278937.2	-	1	168	c.40C>A	c.(40-42)Ctt>Att	p.L14I	MPZL2_ENST00000525647.1_5'UTR|MPZL2_ENST00000438295.2_Missense_Mutation_p.L14I	NM_005797.3	NP_005788.1	O60487	MPZL2_HUMAN	myelin protein zero-like 2	14					anatomical structure morphogenesis (GO:0009653)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)|T cell differentiation in thymus (GO:0033077)	cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|kidney(2)|large_intestine(5)|lung(2)|skin(1)	11	all_hematologic(175;0.046)	Medulloblastoma(222;0.0425)|Breast(348;0.181)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;3.04e-05)		TGTATGCCAAGGAGAAGAAGC	0.542																																																	0													80.0	74.0	77.0					11																	118134829		2200	4296	6496	SO:0001583	missense	10205			AF275945	CCDS8393.1	11q24	2013-01-11	2007-08-01	2007-08-01		ENSG00000149573		"""Immunoglobulin superfamily / V-set domain containing"""	3496	protein-coding gene	gene with protein product		604873	"""epithelial V-like antigen 1"""	EVA1		9585423	Standard	NM_005797		Approved	EVA	uc001psn.3	O60487		ENST00000278937.2:c.40C>A	11.37:g.118134829G>T	ENSP00000278937:p.Leu14Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2R1	Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like,prints_Myelin_P0	p.L14I	ENST00000278937.2	37	c.40	CCDS8393.1	11	.	.	.	.	.	.	.	.	.	.	G	16.00	2.997513	0.54147	.	.	ENSG00000149573	ENST00000278937;ENST00000438295	D;D	0.97598	-4.45;-4.45	5.22	2.94	0.34122	.	1.814600	0.02376	N	0.078318	D	0.92407	0.7590	N	0.19112	0.55	0.09310	N	0.999999	P	0.35077	0.483	B	0.27887	0.084	D	0.87494	0.2429	10	0.27785	T	0.31	.	7.121	0.25444	0.1062:0.1799:0.7138:0.0	.	14	O60487	MPZL2_HUMAN	I	14	ENSP00000278937:L14I;ENSP00000408362:L14I	ENSP00000278937:L14I	L	-	1	0	MPZL2	117640039	1.000000	0.71417	0.148000	0.22405	0.978000	0.69477	2.601000	0.46249	1.165000	0.42670	0.579000	0.79373	CTT	MPZL2	-	NULL		0.542	MPZL2-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	MPZL2	HGNC	protein_coding	OTTHUMT00000392113.1	G	NM_005797		118134829	-1	no_errors	ENST00000438295	ensembl	human	known	70_37	missense	SNP	0.073	T
MRPS22	56945	genome.wustl.edu	37	3	139065764	139065764	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:139065764G>A	ENST00000495075.1	+	4	649	c.217G>A	c.(217-219)Gag>Aag	p.E73K	MRPS22_ENST00000478464.1_Missense_Mutation_p.E32K|MRPS22_ENST00000310776.4_Missense_Mutation_p.E73K|MRPS22_ENST00000465056.1_Missense_Mutation_p.E72K|RP11-219D15.3_ENST00000608472.1_RNA			P82650	RT22_HUMAN	mitochondrial ribosomal protein S22	73						mitochondrial ribosome (GO:0005761)|mitochondrial small ribosomal subunit (GO:0005763)|mitochondrion (GO:0005739)	structural constituent of ribosome (GO:0003735)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	12						ATTTATGGATGAGGAAGTTCA	0.388																																																	0													95.0	91.0	93.0					3																	139065764		2203	4300	6503	SO:0001583	missense	56945			AF226045	CCDS3107.1	3q23	2012-09-13			ENSG00000175110	ENSG00000175110		"""Mitochondrial ribosomal proteins / small subunits"""	14508	protein-coding gene	gene with protein product		605810				11175783	Standard	NM_020191		Approved	MRP-S22, GK002, C3orf5, GIBT	uc003etb.3	P82650	OTTHUMG00000159910	ENST00000495075.1:c.217G>A	3.37:g.139065764G>A	ENSP00000418008:p.Glu73Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H3I1	Missense_Mutation	SNP	pfam_Ribosomal_S22_mit	p.E73K	ENST00000495075.1	37	c.217	CCDS3107.1	3	.	.	.	.	.	.	.	.	.	.	G	14.10	2.435879	0.43224	.	.	ENSG00000175110	ENST00000495075;ENST00000495225;ENST00000310776;ENST00000465056;ENST00000465373;ENST00000478464	D;D;D;D;D	0.82711	-1.64;-1.64;-1.64;-1.64;-1.64	5.42	5.42	0.78866	.	0.227437	0.47093	D	0.000243	T	0.72358	0.3450	L	0.29908	0.895	0.41499	D	0.988277	B;B;B	0.14012	0.004;0.007;0.009	B;B;B	0.17098	0.01;0.01;0.017	T	0.66093	-0.6009	10	0.07175	T	0.84	-20.4665	14.7717	0.69684	0.0:0.1443:0.8557:0.0	.	32;72;73	G5E9W7;G5E9V5;P82650	.;.;RT22_HUMAN	K	73;43;73;72;78;32	ENSP00000418008:E73K;ENSP00000310785:E73K;ENSP00000418233:E72K;ENSP00000419920:E78K;ENSP00000419303:E32K	ENSP00000310785:E73K	E	+	1	0	MRPS22	140548454	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	2.084000	0.41625	2.537000	0.85549	0.591000	0.81541	GAG	MRPS22	-	pfam_Ribosomal_S22_mit		0.388	MRPS22-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MRPS22	HGNC	protein_coding	OTTHUMT00000358120.1	G	NM_020191		139065764	+1	no_errors	ENST00000310776	ensembl	human	known	70_37	missense	SNP	1.000	A
MTDH	92140	genome.wustl.edu	37	8	98711993	98711993	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:98711993G>A	ENST00000336273.3	+	7	1388	c.1060G>A	c.(1060-1062)Gag>Aag	p.E354K	MTDH_ENST00000519934.1_Intron	NM_178812.3	NP_848927.2	Q86UE4	LYRIC_HUMAN	metadherin	354					lipopolysaccharide-mediated signaling pathway (GO:0031663)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of angiogenesis (GO:0045766)|positive regulation of autophagy (GO:0010508)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein kinase B signaling (GO:0051897)|tight junction assembly (GO:0070830)	apical plasma membrane (GO:0016324)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intercellular canaliculus (GO:0046581)|nuclear body (GO:0016604)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|tight junction (GO:0005923)	double-stranded RNA binding (GO:0003725)|NF-kappaB binding (GO:0051059)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(6)|large_intestine(5)|liver(1)|lung(8)|ovary(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Breast(36;2.56e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.178)			GTCTACTGCTGAGCCAGTTTC	0.358																																																	0													138.0	130.0	132.0					8																	98711993		2203	4300	6503	SO:0001583	missense	92140			AF411226	CCDS6274.1	8q22.1	2014-07-14			ENSG00000147649	ENSG00000147649			29608	protein-coding gene	gene with protein product	"""astrocyte elevated gene 1"""	610323				15093543	Standard	NM_178812		Approved	LYRIC, 3D3, AEG-1	uc003yhz.3	Q86UE4	OTTHUMG00000164692	ENST00000336273.3:c.1060G>A	8.37:g.98711993G>A	ENSP00000338235:p.Glu354Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05DH2|Q52QU9|Q6PK07|Q8TCX3	Missense_Mutation	SNP	NULL	p.E354K	ENST00000336273.3	37	c.1060	CCDS6274.1	8	.	.	.	.	.	.	.	.	.	.	G	24.3	4.512959	0.85389	.	.	ENSG00000147649	ENST00000336273;ENST00000521933	T	0.52295	0.67	5.0	5.0	0.66597	.	0.379490	0.30293	N	0.009956	T	0.58991	0.2161	L	0.58101	1.795	0.80722	D	1	D	0.60160	0.987	P	0.54499	0.754	T	0.63462	-0.6632	10	0.72032	D	0.01	-6.9513	16.8437	0.85975	0.0:0.0:1.0:0.0	.	354	Q86UE4	LYRIC_HUMAN	K	354;24	ENSP00000338235:E354K	ENSP00000338235:E354K	E	+	1	0	MTDH	98781169	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.452000	0.73485	2.478000	0.83669	0.561000	0.74099	GAG	MTDH	-	NULL		0.358	MTDH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTDH	HGNC	protein_coding	OTTHUMT00000379772.2	G			98711993	+1	no_errors	ENST00000336273	ensembl	human	known	70_37	missense	SNP	1.000	A
MUC17	140453	genome.wustl.edu	37	7	100682189	100682189	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:100682189A>G	ENST00000306151.4	+	3	7556	c.7492A>G	c.(7492-7494)Aca>Gca	p.T2498A		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2498	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					TTCATCTCCTACAACTGCTGA	0.512																																																	0													277.0	281.0	280.0					7																	100682189		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7492A>G	7.37:g.100682189A>G	ENSP00000302716:p.Thr2498Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.T2498A	ENST00000306151.4	37	c.7492	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	a	6.549	0.469653	0.12461	.	.	ENSG00000169876	ENST00000306151	T	0.02258	4.37	0.953	0.953	0.19590	.	.	.	.	.	T	0.01320	0.0043	N	0.17082	0.46	0.09310	N	1	P	0.46912	0.886	B	0.41135	0.348	T	0.33085	-0.9882	9	0.08179	T	0.78	.	3.8649	0.09012	0.6063:0.3936:0.0:0.0	.	2498	Q685J3	MUC17_HUMAN	A	2498	ENSP00000302716:T2498A	ENSP00000302716:T2498A	T	+	1	0	MUC17	100468909	0.000000	0.05858	0.001000	0.08648	0.049000	0.14656	-0.929000	0.03976	0.700000	0.31782	0.113000	0.15668	ACA	MUC17	-	NULL		0.512	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	A	NM_001040105		100682189	+1	no_errors	ENST00000306151	ensembl	human	known	70_37	missense	SNP	0.014	G
MYH14	79784	genome.wustl.edu	37	19	50760689	50760689	+	Silent	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:50760689C>G	ENST00000596571.1	+	15	2055	c.2055C>G	c.(2053-2055)ctC>ctG	p.L685L	MYH14_ENST00000376970.2_Silent_p.L718L|MYH14_ENST00000440075.2_Silent_p.L726L|MYH14_ENST00000262269.8_Silent_p.L726L|MYH14_ENST00000425460.1_Silent_p.L693L|MYH14_ENST00000601313.1_Silent_p.L726L|MYH14_ENST00000598205.1_Silent_p.L693L			Q7Z406	MYH14_HUMAN	myosin, heavy chain 14, non-muscle	685	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|mitochondrion morphogenesis (GO:0070584)|neuronal action potential (GO:0019228)|regulation of cell shape (GO:0008360)|sensory perception of sound (GO:0007605)|skeletal muscle atrophy (GO:0014732)|skeletal muscle contraction (GO:0003009)|skeletal muscle tissue development (GO:0007519)|vocalization behavior (GO:0071625)	actomyosin (GO:0042641)|axon (GO:0030424)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|stress fiber (GO:0001725)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(10)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	46		all_neural(266;0.0571)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00389)|GBM - Glioblastoma multiforme(134;0.0195)		TGGCCACACTCAGCAACACCA	0.647																																																	0													31.0	35.0	34.0					19																	50760689		2130	4250	6380	SO:0001819	synonymous_variant	79784			AY165122	CCDS46151.1, CCDS54295.1, CCDS59411.1	19q13.33	2011-09-27	2009-11-19			ENSG00000105357		"""Myosins / Myosin superfamily : Class II"""	23212	protein-coding gene	gene with protein product		608568	"""myosin, heavy polypeptide 14"", ""myosin, heavy chain 14"""	DFNA4		12909352, 15015131, 17940200	Standard	NM_024729		Approved	FLJ13881, KIAA2034, MHC16, MYH17	uc010enu.1	Q7Z406		ENST00000596571.1:c.2055C>G	19.37:g.50760689C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1S2|C3TTN4|Q5CZ75|Q6XYE4|Q76B62|Q8WV23|Q96I22|Q9BT27|Q9BW35|Q9H882	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L726	ENST00000596571.1	37	c.2178	CCDS59411.1	19																																																																																			MYH14	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.647	MYH14-008	NOVEL	basic|appris_candidate|CCDS	protein_coding	MYH14	HGNC	protein_coding	OTTHUMT00000464710.2	C	NM_024729		50760689	+1	no_errors	ENST00000262269	ensembl	human	known	70_37	silent	SNP	1.000	G
MYH9	4627	genome.wustl.edu	37	22	36684327	36684327	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:36684327C>T	ENST00000216181.5	-	34	5133	c.4903G>A	c.(4903-4905)Gaa>Aaa	p.E1635K	MYH9_ENST00000475726.1_5'Flank	NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	1635					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						TTGATGGCTTCGTCCCGGTTC	0.637			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													117.0	103.0	108.0					22																	36684327		2203	4300	6503	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.4903G>A	22.37:g.36684327C>T	ENSP00000216181:p.Glu1635Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1635K	ENST00000216181.5	37	c.4903	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	25.7	4.663313	0.88251	.	.	ENSG00000100345	ENST00000337818;ENST00000397231;ENST00000216181	T	0.81247	-1.47	5.5	5.5	0.81552	Myosin tail (1);	0.050812	0.85682	D	0.000000	D	0.89319	0.6681	M	0.93197	3.39	0.80722	D	1	D	0.57257	0.979	P	0.48738	0.588	D	0.92052	0.5649	10	0.87932	D	0	.	19.7664	0.96346	0.0:1.0:0.0:0.0	.	1635	P35579	MYH9_HUMAN	K	1057;237;1635	ENSP00000216181:E1635K	ENSP00000216181:E1635K	E	-	1	0	MYH9	35014273	1.000000	0.71417	0.501000	0.27601	0.118000	0.20060	7.776000	0.85560	2.735000	0.93741	0.655000	0.94253	GAA	MYH9	-	pfam_Myosin_tail,superfamily_tRNA-bd_arm		0.637	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	C	NM_002473		36684327	-1	no_errors	ENST00000216181	ensembl	human	known	70_37	missense	SNP	0.998	T
MYO1F	4542	genome.wustl.edu	37	19	8620554	8620554	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:8620554C>T	ENST00000338257.8	-	2	397	c.130G>A	c.(130-132)Gac>Aac	p.D44N		NM_012335.3	NP_036467.2	O00160	MYO1F_HUMAN	myosin IF	44	Myosin motor.				defense response to Gram-positive bacterium (GO:0050830)|negative regulation of cell adhesion (GO:0007162)|neutrophil degranulation (GO:0043312)|positive regulation of cell migration (GO:0030335)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of innate immune response (GO:0045088)	cortical actin cytoskeleton (GO:0030864)|filamentous actin (GO:0031941)|unconventional myosin complex (GO:0016461)	actin binding (GO:0003779)|ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(7)|lung(13)|ovary(3)|prostate(3)|skin(3)|urinary_tract(1)	42						AAGATGTAGTCGTCCATGAAG	0.612																																																	0													89.0	95.0	93.0					19																	8620554		2047	4193	6240	SO:0001583	missense	4542			X98411	CCDS42494.1	19p13.3-p13.2	2011-09-27			ENSG00000142347	ENSG00000142347		"""Myosins / Myosin superfamily : Class I"""	7600	protein-coding gene	gene with protein product		601480				9119401, 8884266	Standard	NM_012335		Approved		uc002mkg.3	O00160	OTTHUMG00000156005	ENST00000338257.8:c.130G>A	19.37:g.8620554C>T	ENSP00000344871:p.Asp44Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WWN7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail_2,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_SH3_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_SH3_domain,prints_Myosin_head_motor_dom,prints_SH3_domain	p.D44N	ENST00000338257.8	37	c.130	CCDS42494.1	19	.	.	.	.	.	.	.	.	.	.	C	22.4	4.279182	0.80692	.	.	ENSG00000142347	ENST00000305795;ENST00000338257	D	0.95171	-3.63	3.92	3.92	0.45320	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.93831	0.8027	L	0.34521	1.04	0.80722	D	1	P;D;D	0.76494	0.533;0.994;0.999	B;D;D	0.63793	0.216;0.918;0.918	D	0.91135	0.4941	10	0.12766	T	0.61	.	14.6749	0.68972	0.0:1.0:0.0:0.0	.	44;44;44	B4DVP3;B0I1T1;O00160	.;.;MYO1F_HUMAN	N	89;44	ENSP00000344871:D44N	ENSP00000304899:D89N	D	-	1	0	MYO1F	8526554	1.000000	0.71417	0.998000	0.56505	0.904000	0.53231	7.440000	0.80464	2.032000	0.59987	0.462000	0.41574	GAC	MYO1F	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.612	MYO1F-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO1F	HGNC	protein_coding	OTTHUMT00000342716.2	C			8620554	-1	no_errors	ENST00000338257	ensembl	human	known	70_37	missense	SNP	1.000	T
MYO7B	4648	genome.wustl.edu	37	2	128394377	128394377	+	Silent	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:128394377C>G	ENST00000409816.2	+	45	6170	c.6138C>G	c.(6136-6138)ctC>ctG	p.L2046L	LIMS2_ENST00000494613.1_5'Flank|MYO7B_ENST00000409090.1_Silent_p.L899L|MYO7B_ENST00000428314.1_Silent_p.L2046L|MYO7B_ENST00000389524.4_Silent_p.L2047L			Q6PIF6	MYO7B_HUMAN	myosin VIIB	2046	FERM 2. {ECO:0000255|PROSITE- ProRule:PRU00084}.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(2)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(46)|ovary(3)|pancreas(1)|prostate(3)|urinary_tract(1)	75	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0753)		AGGACCTGCTCACCACCTATC	0.667																																																	0													59.0	68.0	65.0					2																	128394377		2065	4191	6256	SO:0001819	synonymous_variant	4648				CCDS46405.1	2q21.1	2011-09-27			ENSG00000169994	ENSG00000169994		"""Myosins / Myosin superfamily : Class VII"""	7607	protein-coding gene	gene with protein product		606541				8022818, 8884266	Standard	NM_001080527		Approved		uc002top.3	Q6PIF6	OTTHUMG00000153419	ENST00000409816.2:c.6138C>G	2.37:g.128394377C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14786|Q8TEE1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,pfam_SH3_2,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_Band_41_domain,smart_SH3_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,pfscan_SH3_domain,prints_Myosin_head_motor_dom	p.L2047	ENST00000409816.2	37	c.6141	CCDS46405.1	2																																																																																			MYO7B	-	pfscan_FERM_domain		0.667	MYO7B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYO7B	HGNC	protein_coding	OTTHUMT00000331124.3	C	XM_291001		128394377	+1	no_errors	ENST00000389524	ensembl	human	known	70_37	silent	SNP	0.980	G
MYOCD	93649	genome.wustl.edu	37	17	12666647	12666647	+	Missense_Mutation	SNP	T	T	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:12666647T>G	ENST00000343344.4	+	13	2503	c.2503T>G	c.(2503-2505)Ttt>Gtt	p.F835V	RP11-1090M7.1_ENST00000584772.1_RNA|MYOCD_ENST00000425538.1_Missense_Mutation_p.F883V			Q8IZQ8	MYCD_HUMAN	myocardin	835					cardiac muscle cell differentiation (GO:0055007)|cardiac ventricle development (GO:0003231)|cardiocyte differentiation (GO:0035051)|cell growth involved in cardiac muscle cell development (GO:0061049)|cellular component maintenance (GO:0043954)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hypoxia (GO:0071456)|digestive tract development (GO:0048565)|ductus arteriosus closure (GO:0097070)|hepatic stellate cell activation (GO:0035733)|lung alveolus development (GO:0048286)|negative regulation of beta-amyloid clearance (GO:1900222)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of myotube differentiation (GO:0010832)|negative regulation of skeletal muscle cell differentiation (GO:2001015)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cardiac muscle cell differentiation (GO:2000727)|positive regulation of cardiac vascular smooth muscle cell differentiation (GO:2000724)|positive regulation of cell proliferation (GO:0008284)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell differentiation (GO:0051152)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter involved in myocardial precursor cell differentiation (GO:0003257)|positive regulation of transcription from RNA polymerase II promoter involved in smooth muscle cell differentiation (GO:2000721)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|regulation of cell growth by extracellular stimulus (GO:0001560)|regulation of histone acetylation (GO:0035065)|regulation of myoblast differentiation (GO:0045661)|regulation of smooth muscle cell differentiation (GO:0051150)|response to hypoxia (GO:0001666)|smooth muscle cell differentiation (GO:0051145)|urinary bladder development (GO:0060157)|uterus development (GO:0060065)|vasculogenesis (GO:0001570)|ventricular cardiac muscle cell differentiation (GO:0055012)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II transcription factor binding transcription factor activity (GO:0001076)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(2)|large_intestine(11)|liver(2)|lung(33)|ovary(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	70				UCEC - Uterine corpus endometrioid carcinoma (92;0.0969)		AGAGCCTCACTTTGATGGGAT	0.478																																																	0													74.0	68.0	70.0					17																	12666647		2203	4300	6503	SO:0001583	missense	93649			AF532596	CCDS11163.1, CCDS54091.1	17p11.2	2004-03-01			ENSG00000141052	ENSG00000141052			16067	protein-coding gene	gene with protein product		606127				11439182, 12397177	Standard	XM_005256863		Approved	MYCD	uc002gno.2	Q8IZQ8	OTTHUMG00000058767	ENST00000343344.4:c.2503T>G	17.37:g.12666647T>G	ENSP00000341835:p.Phe835Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5UBU5|Q8N7Q1	Missense_Mutation	SNP	pfam_RPEL_repeat,pfam_SAP_DNA-bd,smart_RPEL_repeat,smart_SAP_DNA-bd,pfscan_RPEL_repeat,pfscan_SAP_DNA-bd	p.F883V	ENST00000343344.4	37	c.2647	CCDS11163.1	17	.	.	.	.	.	.	.	.	.	.	T	13.72	2.321342	0.41096	.	.	ENSG00000141052	ENST00000395982;ENST00000425538;ENST00000343344;ENST00000443061	T;T	0.42900	0.96;0.97	6.08	6.08	0.98989	.	0.363370	0.32687	N	0.005761	T	0.58750	0.2144	L	0.60455	1.87	0.80722	D	1	D;D;D	0.69078	0.995;0.997;0.965	P;D;P	0.64321	0.841;0.924;0.703	T	0.56202	-0.8018	10	0.39692	T	0.17	-31.5972	15.6264	0.76863	0.0:0.0:0.0:1.0	.	559;883;835	E9PEP9;Q8IZQ8-3;Q8IZQ8	.;.;MYCD_HUMAN	V	559;883;835;545	ENSP00000341835:F835V;ENSP00000400148:F545V	ENSP00000341835:F835V	F	+	1	0	MYOCD	12607372	1.000000	0.71417	0.590000	0.28732	0.003000	0.03518	5.194000	0.65125	2.333000	0.79357	0.533000	0.62120	TTT	MYOCD	-	NULL		0.478	MYOCD-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MYOCD	HGNC	protein_coding	OTTHUMT00000129950.1	T	NM_153604		12666647	+1	no_errors	ENST00000425538	ensembl	human	known	70_37	missense	SNP	1.000	G
MYOF	26509	genome.wustl.edu	37	10	95088619	95088619	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:95088619G>A	ENST00000359263.4	-	45	5031	c.5032C>T	c.(5032-5034)Caa>Taa	p.Q1678*	MYOF_ENST00000358334.5_Nonsense_Mutation_p.Q1665*|MYOF_ENST00000371502.4_Nonsense_Mutation_p.Q1697*|MYOF_ENST00000485212.1_5'UTR|MYOF_ENST00000371501.4_Nonsense_Mutation_p.Q1678*	NM_013451.3	NP_038479.1	Q9NZM1	MYOF_HUMAN	myoferlin	1678					blood circulation (GO:0008015)|cellular response to heat (GO:0034605)|muscle contraction (GO:0006936)|plasma membrane repair (GO:0001778)|regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030947)	caveola (GO:0005901)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nuclear envelope (GO:0005635)|plasma membrane (GO:0005886)	phospholipid binding (GO:0005543)			NS(2)|autonomic_ganglia(1)|breast(3)|endometrium(7)|kidney(7)|large_intestine(15)|lung(14)|ovary(4)|prostate(4)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	67						GCGACATTTTGAAGCAGCTGT	0.493																																																	0													330.0	310.0	317.0					10																	95088619		1959	4138	6097	SO:0001587	stop_gained	26509			AB033033	CCDS41550.1, CCDS41551.1	10q24	2014-06-27	2008-11-26	2008-11-26	ENSG00000138119	ENSG00000138119			3656	protein-coding gene	gene with protein product	"""fer-1-like family member 3"""	604603	"""fer-1 (C.elegans)-like 3 (myoferlin)"", ""fer-1-like 3, myoferlin (C. elegans)"""	FER1L3		10607832, 10995573, 17702744	Standard	NM_013451		Approved	KIAA1207	uc001kin.3	Q9NZM1	OTTHUMG00000018772	ENST00000359263.4:c.5032C>T	10.37:g.95088619G>A	ENSP00000352208:p.Gln1678*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQN5|Q5VWW2|Q5VWW3|Q5VWW4|Q5VWW5|Q7Z642|Q8IWH0|Q9HBU3|Q9NZM0|Q9ULL3|Q9Y4U4	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,pfam_Ferlin_A-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Peroxin/Ferlin,pfscan_C2_membr_targeting	p.Q1678*	ENST00000359263.4	37	c.5032	CCDS41551.1	10	.	.	.	.	.	.	.	.	.	.	G	45	12.023725	0.99628	.	.	ENSG00000138119	ENST00000358334;ENST00000359263;ENST00000371501;ENST00000371502	.	.	.	4.79	1.75	0.24633	.	0.850185	0.10948	N	0.616427	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	0.6305	9.0931	0.36623	0.0732:0.0:0.6644:0.2624	.	.	.	.	X	1665;1678;1678;1697	.	ENSP00000351094:Q1665X	Q	-	1	0	MYOF	95078609	0.998000	0.40836	1.000000	0.80357	0.981000	0.71138	2.055000	0.41345	1.216000	0.43427	0.561000	0.74099	CAA	MYOF	-	NULL		0.493	MYOF-005	KNOWN	basic|CCDS	protein_coding	MYOF	HGNC	protein_coding	OTTHUMT00000049423.2	G	NM_013451		95088619	-1	no_errors	ENST00000359263	ensembl	human	known	70_37	nonsense	SNP	0.998	A
NAA30	122830	genome.wustl.edu	37	14	57876233	57876233	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:57876233G>A	ENST00000556492.1	+	5	1242	c.1088G>A	c.(1087-1089)tGa>tAa	p.*363*	NAA30_ENST00000555166.1_Silent_p.*105*|NAA30_ENST00000554703.1_3'UTR	NM_001011713.2	NP_001011713.2	Q147X3	NAA30_HUMAN	N(alpha)-acetyltransferase 30, NatC catalytic subunit	0					metabolic process (GO:0008152)	cytoplasm (GO:0005737)|NatC complex (GO:0031417)	peptide alpha-N-acetyltransferase activity (GO:0004596)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(2)|skin(2)	13						TGGCTGCGTTGAGAAACTGAC	0.383																																																	0													116.0	104.0	108.0					14																	57876233		2203	4300	6503	SO:0001819	synonymous_variant	122830			AK092674	CCDS32088.1	14q22.2	2010-05-07	2010-01-14	2010-01-14		ENSG00000139977	2.3.1.88	"""N(alpha)-acetyltransferase subunits"""	19844	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 35"", ""N-acetyltransferase 12"", ""N-acetyltransferase 12 (GCN5-related, putative)"""	C14orf35, NAT12		19660095	Standard	NM_001011713		Approved	FLJ35355, MAK3, Mak3p	uc001xcx.4	Q147X3		ENST00000556492.1:c.1088G>A	14.37:g.57876233G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0IIN2	Silent	SNP	pfam_GNAT_dom,pfam_FR47,superfamily_Acyl_CoA_acyltransferase,pfscan_GNAT_dom	p.*363	ENST00000556492.1	37	c.1088	CCDS32088.1	14																																																																																			NAA30	-	NULL		0.383	NAA30-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA30	HGNC	protein_coding	OTTHUMT00000412925.1	G	NM_001011713		57876233	+1	no_errors	ENST00000556492	ensembl	human	known	70_37	silent	SNP	1.000	A
NDC80	10403	genome.wustl.edu	37	18	2616481	2616481	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:2616481G>C	ENST00000261597.4	+	17	2019	c.1837G>C	c.(1837-1839)Gaa>Caa	p.E613Q		NM_006101.2	NP_006092.1	O14777	NDC80_HUMAN	NDC80 kinetochore complex component	613	Interaction with NEK2 and ZWINT.|Interaction with the C-terminus of CDCA1 and the SPBC24-SPBC25 subcomplex.				attachment of spindle microtubules to kinetochore (GO:0008608)|chromosome segregation (GO:0007059)|establishment of mitotic spindle orientation (GO:0000132)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)	chromosome, centromeric region (GO:0000775)|condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome outer kinetochore (GO:0000942)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|Ndc80 complex (GO:0031262)|nucleus (GO:0005634)				NS(1)|biliary_tract(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(2)|urinary_tract(2)	22						AGAATATGAAGAATGCATGTC	0.274																																																	0													45.0	48.0	47.0					18																	2616481		2200	4282	6482	SO:0001583	missense	10403			AF017790	CCDS11827.1	18p11.31	2013-01-17	2013-01-17	2007-03-02	ENSG00000080986	ENSG00000080986			16909	protein-coding gene	gene with protein product		607272	"""highly expressed in cancer, rich in leucine heptad repeats (yeast)"", ""kinetochore associated 2"", ""NDC80 kinetochore complex component homolog (S. cerevisiae)"""	KNTC2		9315664, 12351790	Standard	NM_006101		Approved	HEC, HEC1, hsNDC80, TID3	uc002kli.3	O14777	OTTHUMG00000131483	ENST00000261597.4:c.1837G>C	18.37:g.2616481G>C	ENSP00000261597:p.Glu613Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PJX2	Missense_Mutation	SNP	pfam_Kinetochore_Ndc80,superfamily_t-SNARE	p.E613Q	ENST00000261597.4	37	c.1837	CCDS11827.1	18	.	.	.	.	.	.	.	.	.	.	G	15.46	2.840535	0.51057	.	.	ENSG00000080986	ENST00000261597	T	0.51817	0.69	5.47	5.47	0.80525	.	0.149539	0.64402	D	0.000013	T	0.50017	0.1591	M	0.62723	1.935	0.45528	D	0.998487	P	0.46706	0.883	B	0.42827	0.399	T	0.45745	-0.9240	10	0.27082	T	0.32	-10.3988	18.4596	0.90734	0.0:0.0:1.0:0.0	.	613	O14777	NDC80_HUMAN	Q	613	ENSP00000261597:E613Q	ENSP00000261597:E613Q	E	+	1	0	NDC80	2606481	1.000000	0.71417	0.939000	0.37840	0.482000	0.33219	5.693000	0.68264	2.717000	0.92951	0.555000	0.69702	GAA	NDC80	-	NULL		0.274	NDC80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDC80	HGNC	protein_coding	OTTHUMT00000254327.1	G	NM_006101		2616481	+1	no_errors	ENST00000261597	ensembl	human	known	70_37	missense	SNP	1.000	C
NDEL1	81565	genome.wustl.edu	37	17	8347562	8347562	+	Intron	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:8347562C>G	ENST00000334527.7	+	2	185				NDEL1_ENST00000583066.1_3'UTR|NDEL1_ENST00000402554.3_Intron|NDEL1_ENST00000299734.7_Intron|NDEL1_ENST00000380025.4_Intron|NDEL1_ENST00000585098.1_Intron	NM_030808.4	NP_110435.1	Q9GZM8	NDEL1_HUMAN	nudE neurodevelopment protein 1-like 1						activation of Cdc42 GTPase activity (GO:0032864)|central nervous system neuron axonogenesis (GO:0021955)|centrosome localization (GO:0051642)|cerebral cortex radially oriented cell migration (GO:0021799)|chromosome segregation (GO:0007059)|inner cell mass cell proliferation (GO:0001833)|mitotic cell cycle (GO:0000278)|mitotic centrosome separation (GO:0007100)|neurofilament cytoskeleton organization (GO:0060052)|neuron migration (GO:0001764)|neuron projection extension (GO:1990138)|nuclear envelope disassembly (GO:0051081)|positive regulation of axon extension (GO:0045773)|positive regulation of axon regeneration (GO:0048680)|retrograde axon cargo transport (GO:0008090)|vesicle transport along microtubule (GO:0047496)	axon hillock (GO:0043203)|cell leading edge (GO:0031252)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|microtubule (GO:0005874)|neurofilament cytoskeleton (GO:0060053)|nuclear envelope (GO:0005635)|nucleolus (GO:0005730)	oligopeptidase activity (GO:0070012)			large_intestine(6)|lung(4)|skin(3)	13						TTAAGTTTGTCTTTAATATTT	0.353																																																	0													59.0	59.0	59.0					17																	8347562		2203	4300	6503	SO:0001627	intron_variant	81565			AF182078	CCDS11143.1, CCDS32564.1	17p13.1	2013-08-06	2013-08-06	2003-04-16	ENSG00000166579	ENSG00000166579			17620	protein-coding gene	gene with protein product		607538	"""nudE nuclear distribution gene E homolog (A. nidulans)-like 1"", ""nudE nuclear distribution E homolog (A. nidulans)-like 1"""			11163260, 11163259	Standard	NM_001025579		Approved	NUDEL, MITAP1, NDE1L1, NDE2	uc002glj.4	Q9GZM8	OTTHUMG00000108193	ENST00000334527.7:c.-12-16C>G	17.37:g.8347562C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KP93|D3DTS0|J3QT32|Q86T80|Q8TAR7|Q9UH50	RNA	SNP	-	NULL	ENST00000334527.7	37	NULL	CCDS11143.1	17																																																																																			NDEL1	-	-		0.353	NDEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDEL1	HGNC	protein_coding	OTTHUMT00000226999.2	C	NM_030808		8347562	+1	no_errors	ENST00000583066	ensembl	human	known	70_37	rna	SNP	0.010	G
NDST2	8509	genome.wustl.edu	37	10	75567715	75567715	+	Silent	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:75567715G>C	ENST00000309979.6	-	3	988	c.432C>G	c.(430-432)ctC>ctG	p.L144L	RP11-574K11.31_ENST00000603027.1_Silent_p.L144L|NDST2_ENST00000299641.4_Silent_p.L21L|NDST2_ENST00000398701.2_5'Flank			P52849	NDST2_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 2	144	Heparan sulfate N-deacetylase 2.				carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|hydrolase activity (GO:0016787)			cervix(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(11)|ovary(2)|prostate(2)|skin(1)|urinary_tract(1)	30	Prostate(51;0.0112)					TGACATACTTGAGCAGGTTCT	0.527																																																	0													104.0	101.0	102.0					10																	75567715		2203	4300	6503	SO:0001819	synonymous_variant	8509			U36601	CCDS7335.1	10q22	2007-03-14			ENSG00000166507	ENSG00000166507		"""Sulfotransferases, membrane-bound"""	7681	protein-coding gene	gene with protein product		603268				9601056	Standard	NM_003635		Approved	NST2, HSST2	uc001jvk.2	P52849	OTTHUMG00000018489	ENST00000309979.6:c.432C>G	10.37:g.75567715G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TB32|Q59H89	Silent	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.L144	ENST00000309979.6	37	c.432	CCDS7335.1	10																																																																																			NDST2	-	pfam_Heparan_SO4_deacetylase		0.527	NDST2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST2	HGNC	protein_coding	OTTHUMT00000048710.1	G	NM_003635		75567715	-1	no_errors	ENST00000309979	ensembl	human	known	70_37	silent	SNP	0.821	C
NEUROD4	58158	genome.wustl.edu	37	12	55421139	55421139	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:55421139G>A	ENST00000242994.3	+	2	1294	c.916G>A	c.(916-918)Gat>Aat	p.D306N		NM_021191.2	NP_067014.2	Q9HD90	NDF4_HUMAN	neuronal differentiation 4	306					amacrine cell differentiation (GO:0035881)|cell fate commitment (GO:0045165)|glial cell differentiation (GO:0010001)|neuroblast proliferation (GO:0007405)|neuron development (GO:0048666)|neuron migration (GO:0001764)|Notch signaling pathway (GO:0007219)|positive regulation of cell differentiation (GO:0045597)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(3)|prostate(2)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)	41						CCCCCGTTATGATGTTCCTAT	0.448																																																	0													421.0	419.0	420.0					12																	55421139		2203	4300	6503	SO:0001583	missense	58158			AF203901	CCDS8886.1	12q13.13	2013-05-21	2012-02-22			ENSG00000123307		"""Basic helix-loop-helix proteins"""	13802	protein-coding gene	gene with protein product		611635	"""neurogenic differentiation 4"""				Standard	NM_021191		Approved	Atoh3, ATH-3, MATH-3, bHLHa4	uc001sgp.4	Q9HD90		ENST00000242994.3:c.916G>A	12.37:g.55421139G>A	ENSP00000242994:p.Asp306Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAC9	Missense_Mutation	SNP	pfam_Neurogenic_DUF,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pirsf_TF_bHLH_NeuroD,pfscan_HLH_dom	p.D306N	ENST00000242994.3	37	c.916	CCDS8886.1	12	.	.	.	.	.	.	.	.	.	.	G	15.70	2.910023	0.52439	.	.	ENSG00000123307	ENST00000242994	D	0.95272	-3.66	5.78	5.78	0.91487	.	0.095800	0.64402	D	0.000001	D	0.92319	0.7563	L	0.46157	1.445	0.53688	D	0.999978	B	0.17465	0.022	B	0.17979	0.02	D	0.87648	0.2526	10	0.36615	T	0.2	-1.6108	17.8912	0.88872	0.0:0.0:1.0:0.0	.	306	Q9HD90	NDF4_HUMAN	N	306	ENSP00000242994:D306N	ENSP00000242994:D306N	D	+	1	0	NEUROD4	53707406	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.766000	0.98957	2.906000	0.99361	0.655000	0.94253	GAT	NEUROD4	-	pirsf_TF_bHLH_NeuroD		0.448	NEUROD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NEUROD4	HGNC	protein_coding	OTTHUMT00000406104.1	G			55421139	+1	no_errors	ENST00000242994	ensembl	human	known	70_37	missense	SNP	1.000	A
NFE2L2	4780	genome.wustl.edu	37	2	178098900	178098900	+	Frame_Shift_Del	DEL	C	C	-			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:178098900delC	ENST00000397062.3	-	2	699	c.145delG	c.(145-147)gaafs	p.E49fs	NFE2L2_ENST00000464747.1_Frame_Shift_Del_p.E33fs|NFE2L2_ENST00000423513.1_Frame_Shift_Del_p.E33fs|NFE2L2_ENST00000446151.2_Frame_Shift_Del_p.E33fs|NFE2L2_ENST00000397063.4_Frame_Shift_Del_p.E33fs	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	49					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TTCTGTTTTTCCAGCTCATAC	0.398			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	0													119.0	111.0	114.0					2																	178098900		1852	4096	5948	SO:0001589	frameshift_variant	4780				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.145delG	2.37:g.178098900delC	ENSP00000380252:p.Glu49fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Frame_Shift_Del	DEL	pfam_bZIP,superfamily_Euk_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.E49fs	ENST00000397062.3	37	c.145	CCDS42782.1	2																																																																																			NFE2L2	-	NULL		0.398	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	C	NM_006164		178098900	-1	no_errors	ENST00000397062	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
NLN	57486	genome.wustl.edu	37	5	65077185	65077185	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:65077185G>A	ENST00000380985.5	+	6	937	c.759G>A	c.(757-759)aaG>aaA	p.K253K	NLN_ENST00000502464.1_Silent_p.K149K	NM_020726.4	NP_065777.1	Q9BYT8	NEUL_HUMAN	neurolysin (metallopeptidase M3 family)	253						mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(10)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	26		Lung NSC(167;7.21e-05)|Prostate(74;0.0174)|Ovarian(174;0.186)		UCEC - Uterine corpus endometrioid carcinoma (4;0.0743)|Lung(70;0.00616)		CTGTCATGAAGAAATGTTGTA	0.333																																																	0													105.0	105.0	105.0					5																	65077185		2203	4299	6502	SO:0001819	synonymous_variant	57486			AJ300837	CCDS3989.1	5q12.3	2008-02-05	2005-03-31		ENSG00000123213	ENSG00000123213	3.4.24.16		16058	protein-coding gene	gene with protein product		611530	"""angiotensin binding protein"""	AGTBP		10574462	Standard	NM_020726		Approved	KIAA1226	uc003juf.3	Q9BYT8	OTTHUMG00000097803	ENST00000380985.5:c.759G>A	5.37:g.65077185G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULJ4	Silent	SNP	pfam_Pept_M3A_M3B	p.K253	ENST00000380985.5	37	c.759	CCDS3989.1	5																																																																																			NLN	-	pfam_Pept_M3A_M3B		0.333	NLN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLN	HGNC	protein_coding	OTTHUMT00000215060.1	G			65077185	+1	no_errors	ENST00000380985	ensembl	human	known	70_37	silent	SNP	1.000	A
NLRP8	126205	genome.wustl.edu	37	19	56477742	56477742	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:56477742C>T	ENST00000291971.3	+	5	2448	c.2377C>T	c.(2377-2379)Ctc>Ttc	p.L793F	NLRP8_ENST00000590542.1_Missense_Mutation_p.L793F	NM_176811.2	NP_789781.2	Q86W28	NALP8_HUMAN	NLR family, pyrin domain containing 8	793					neuron death (GO:0070997)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)			breast(4)|central_nervous_system(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(14)|ovary(5)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)	35		Colorectal(82;0.000147)|Ovarian(87;0.17)		GBM - Glioblastoma multiforme(193;0.0695)		TCTGCAGTGTCTCAGGTGAGA	0.542																																																	0													65.0	66.0	66.0					19																	56477742		2203	4300	6503	SO:0001583	missense	126205			AY154463	CCDS12937.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179709		"""Nucleotide-binding domain and leucine rich repeat containing"""	22940	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 8"""	609659	"""NACHT, leucine rich repeat and PYD containing 8"""	NALP8		12563287	Standard	NM_176811		Approved	NOD16, PAN4, CLR19.2	uc002qmh.3	Q86W28		ENST00000291971.3:c.2377C>T	19.37:g.56477742C>T	ENSP00000291971:p.Leu793Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7RTR4	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L793F	ENST00000291971.3	37	c.2377	CCDS12937.1	19	.	.	.	.	.	.	.	.	.	.	C	13.17	2.157958	0.38119	.	.	ENSG00000179709	ENST00000291971	T	0.79554	-1.28	1.82	1.82	0.25136	.	.	.	.	.	D	0.89729	0.6799	M	0.92026	3.265	0.09310	N	1	D;D	0.89917	0.997;1.0	D;D	0.81914	0.975;0.995	T	0.77640	-0.2512	9	0.87932	D	0	.	7.1467	0.25587	0.0:1.0:0.0:0.0	.	793;793	Q86W28-2;Q86W28	.;NALP8_HUMAN	F	793	ENSP00000291971:L793F	ENSP00000291971:L793F	L	+	1	0	NLRP8	61169554	0.198000	0.23374	0.044000	0.18714	0.012000	0.07955	0.223000	0.17719	1.308000	0.44962	0.557000	0.71058	CTC	NLRP8	-	NULL		0.542	NLRP8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP8	HGNC	protein_coding	OTTHUMT00000457462.1	C	NM_176811		56477742	+1	no_errors	ENST00000291971	ensembl	human	known	70_37	missense	SNP	0.071	T
NMT1	4836	genome.wustl.edu	37	17	43163889	43163889	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:43163889C>T	ENST00000592782.1	+	4	385	c.254C>T	c.(253-255)cCa>cTa	p.P85L	NMT1_ENST00000258960.2_Missense_Mutation_p.P85L|NMT1_ENST00000590114.1_3'UTR			P30419	NMT1_HUMAN	N-myristoyltransferase 1	85					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				AACTCTTTGCCAGCAGAGAGG	0.463																																																	0													69.0	60.0	63.0					17																	43163889		2203	4300	6503	SO:0001583	missense	4836				CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.254C>T	17.37:g.43163889C>T	ENSP00000468424:p.Pro85Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7C1|Q9UE09	Missense_Mutation	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.P85L	ENST00000592782.1	37	c.254	CCDS11494.1	17	.	.	.	.	.	.	.	.	.	.	C	31	5.063469	0.93898	.	.	ENSG00000136448	ENST00000258960;ENST00000543908	T;T	0.42900	0.96;1.12	5.53	5.53	0.82687	.	0.000000	0.85682	D	0.000000	T	0.62380	0.2423	M	0.71206	2.165	0.80722	D	1	D	0.62365	0.991	P	0.59288	0.855	T	0.63589	-0.6603	10	0.66056	D	0.02	-1.4984	19.6556	0.95837	0.0:1.0:0.0:0.0	.	85	P30419	NMT1_HUMAN	L	85	ENSP00000258960:P85L;ENSP00000439263:P85L	ENSP00000258960:P85L	P	+	2	0	NMT1	40519415	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.564000	0.82326	2.882000	0.98803	0.655000	0.94253	CCA	NMT1	-	pirsf_MyristoylCoA_TrFase		0.463	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT1	HGNC	protein_coding	OTTHUMT00000449239.1	C	NM_021079		43163889	+1	no_errors	ENST00000258960	ensembl	human	known	70_37	missense	SNP	1.000	T
NOL11	25926	genome.wustl.edu	37	17	65717522	65717522	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:65717522C>G	ENST00000253247.4	+	4	456	c.341C>G	c.(340-342)tCa>tGa	p.S114*	NOL11_ENST00000581966.1_3'UTR|NOL11_ENST00000535137.1_5'UTR	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	114					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			AGGATACTTTCAGTGCAAGGG	0.368																																																	0													98.0	97.0	97.0					17																	65717522		2203	4300	6503	SO:0001587	stop_gained	25926			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.341C>G	17.37:g.65717522C>G	ENSP00000253247:p.Ser114*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z5V9|Q7L5S1|Q9UG18	Nonsense_Mutation	SNP	pfam_NUC205	p.S114*	ENST00000253247.4	37	c.341	CCDS11671.1	17	.	.	.	.	.	.	.	.	.	.	C	21.9	4.218308	0.79464	.	.	ENSG00000130935	ENST00000253247	.	.	.	5.28	5.28	0.74379	.	0.189591	0.46758	D	0.000275	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-15.862	16.1846	0.81942	0.0:1.0:0.0:0.0	.	.	.	.	X	114	.	ENSP00000253247:S114X	S	+	2	0	NOL11	63147984	1.000000	0.71417	0.975000	0.42487	0.769000	0.43574	5.195000	0.65131	2.640000	0.89533	0.561000	0.74099	TCA	NOL11	-	NULL		0.368	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL11	HGNC	protein_coding	OTTHUMT00000448074.1	C	NM_015462		65717522	+1	no_errors	ENST00000253247	ensembl	human	known	70_37	nonsense	SNP	0.980	G
NPAP1	23742	genome.wustl.edu	37	15	24922087	24922087	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:24922087C>A	ENST00000329468.2	+	1	1547	c.1073C>A	c.(1072-1074)cCc>cAc	p.P358H		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	358	Pro-rich.				cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GCTAAGCTCCCCTGCCTGTCT	0.522																																																	0													54.0	49.0	51.0					15																	24922087		2203	4300	6503	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.1073C>A	15.37:g.24922087C>A	ENSP00000333735:p.Pro358His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.P358H	ENST00000329468.2	37	c.1073	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	15.79	2.937322	0.52972	.	.	ENSG00000185823	ENST00000329468	T	0.12984	2.63	1.93	1.93	0.25924	.	0.688041	0.12068	N	0.502477	T	0.24661	0.0598	L	0.39898	1.24	0.09310	N	1	D	0.89917	1.0	D	0.85130	0.997	T	0.05115	-1.0905	10	0.72032	D	0.01	.	7.3461	0.26664	0.0:1.0:0.0:0.0	.	358	Q9NZP6	CO002_HUMAN	H	358	ENSP00000333735:P358H	ENSP00000333735:P358H	P	+	2	0	C15orf2	22473180	0.001000	0.12720	0.007000	0.13788	0.634000	0.38068	0.249000	0.18216	1.386000	0.46466	0.313000	0.20887	CCC	NPAP1	-	NULL		0.522	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	C	NM_018958		24922087	+1	no_errors	ENST00000329468	ensembl	human	known	70_37	missense	SNP	0.007	A
NTNG2	84628	genome.wustl.edu	37	9	135042303	135042303	+	Missense_Mutation	SNP	G	G	C	rs138493692		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:135042303G>C	ENST00000393229.3	+	2	861	c.85G>C	c.(85-87)Gat>Cat	p.D29H	NTNG2_ENST00000393228.4_Missense_Mutation_p.D29H|NTNG2_ENST00000372179.3_Missense_Mutation_p.D29H|NTNG2_ENST00000360670.3_Missense_Mutation_p.D29H	NM_032536.2	NP_115925.2	Q96CW9	NTNG2_HUMAN	netrin G2	29					axonogenesis (GO:0007409)	anchored component of plasma membrane (GO:0046658)|axon (GO:0030424)				central_nervous_system(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(10)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)	29				OV - Ovarian serous cystadenocarcinoma(145;1.23e-05)|Epithelial(140;0.000173)		GGTGACCACAGATGAGGGCCC	0.607																																																	0													101.0	104.0	103.0					9																	135042303		2203	4300	6503	SO:0001583	missense	84628			AB058760	CCDS6946.1	9q34	2013-03-01	2003-12-02	2003-12-03	ENSG00000196358	ENSG00000196358		"""Netrins"""	14288	protein-coding gene	gene with protein product	"""Netrin-G2"""		"""netrin G1"""	NTNG1			Standard	NM_032536		Approved	KIAA1857, Lmnt2	uc004cbh.2	Q96CW9	OTTHUMG00000020835	ENST00000393229.3:c.85G>C	9.37:g.135042303G>C	ENSP00000376921:p.Asp29His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JUJ2|Q6UXY0|Q96JH0	Missense_Mutation	SNP	pfam_Laminin_N,pfam_EGF_laminin,pfam_EGF_extracell,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_Laminin_N	p.D29H	ENST00000393229.3	37	c.85	CCDS6946.1	9	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524133	0.85600	.	.	ENSG00000196358	ENST00000393229;ENST00000393228;ENST00000360670;ENST00000372179	T;T;T;T	0.77229	-0.32;-1.08;-1.08;-0.32	5.23	5.23	0.72850	.	0.069925	0.52532	D	0.000064	T	0.80665	0.4666	L	0.29908	0.895	0.58432	D	0.999998	D	0.89917	1.0	P	0.61275	0.886	T	0.80883	-0.1183	10	0.42905	T	0.14	.	17.7839	0.88532	0.0:0.0:1.0:0.0	.	29	Q96CW9	NTNG2_HUMAN	H	29	ENSP00000376921:D29H;ENSP00000376920:D29H;ENSP00000353888:D29H;ENSP00000361252:D29H	ENSP00000353888:D29H	D	+	1	0	NTNG2	134032124	1.000000	0.71417	0.996000	0.52242	0.967000	0.64934	9.864000	0.99589	2.425000	0.82216	0.561000	0.74099	GAT	NTNG2	-	NULL		0.607	NTNG2-001	KNOWN	basic|CCDS	protein_coding	NTNG2	HGNC	protein_coding	OTTHUMT00000054779.1	G	NM_032536		135042303	+1	no_errors	ENST00000360670	ensembl	human	known	70_37	missense	SNP	1.000	C
NUMB	8650	genome.wustl.edu	37	14	73749139	73749139	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:73749139C>T	ENST00000355058.3	-	11	1302	c.1024G>A	c.(1024-1026)Gag>Aag	p.E342K	NUMB_ENST00000554546.1_Missense_Mutation_p.E331K|NUMB_ENST00000556772.1_Missense_Mutation_p.E198K|NUMB_ENST00000555738.2_Missense_Mutation_p.E233K|NUMB_ENST00000359560.3_Missense_Mutation_p.E331K|NUMB_ENST00000555238.1_Missense_Mutation_p.E342K|NUMB_ENST00000356296.4_Missense_Mutation_p.E342K|NUMB_ENST00000554521.2_Intron|NUMB_ENST00000557597.1_Missense_Mutation_p.E331K|NUMB_ENST00000560335.1_Missense_Mutation_p.E244K|NUMB_ENST00000555394.1_Missense_Mutation_p.E342K|NUMB_ENST00000535282.1_Missense_Mutation_p.E331K|NUMB_ENST00000544991.3_Intron|NUMB_ENST00000454166.4_Missense_Mutation_p.E244K|NUMB_ENST00000559312.1_Intron			P49757	NUMB_HUMAN	numb homolog (Drosophila)	342					adherens junction organization (GO:0034332)|axon guidance (GO:0007411)|lateral ventricle development (GO:0021670)|lung epithelial cell differentiation (GO:0060487)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of protein localization to plasma membrane (GO:1903077)|neuroblast division in subventricular zone (GO:0021849)|Notch signaling pathway (GO:0007219)|positive regulation of cell migration (GO:0030335)|positive regulation of neurogenesis (GO:0050769)|positive regulation of polarized epithelial cell differentiation (GO:0030862)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|clathrin-coated vesicle (GO:0030136)|early endosome (GO:0005769)|extrinsic component of plasma membrane (GO:0019897)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(3)|prostate(1)|skin(3)|urinary_tract(1)	28				BRCA - Breast invasive adenocarcinoma(234;0.00471)|OV - Ovarian serous cystadenocarcinoma(108;0.161)		AAGGGGTCCTCAGGTGTGCTG	0.552																																																	0													187.0	154.0	165.0					14																	73749139		2203	4300	6503	SO:0001583	missense	8650			L40393	CCDS9814.1, CCDS32115.1, CCDS32116.1, CCDS55927.1	14q24.3	2011-11-25	2001-11-28			ENSG00000133961			8060	protein-coding gene	gene with protein product		603728	"""numb (Drosophila) homolog"", ""chromosome 14 open reading frame 41"""	C14orf41			Standard	NM_003744		Approved		uc001xny.1	P49757		ENST00000355058.3:c.1024G>A	14.37:g.73749139C>T	ENSP00000347169:p.Glu342Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1P2N5|B1P2N6|B1P2N7|B1P2N8|B1P2N9|B4E2B1|Q6NUQ7|Q86SY1|Q8WW73|Q9UBG1|Q9UEQ4|Q9UKE8|Q9UKE9|Q9UKF0|Q9UQJ4	Missense_Mutation	SNP	pfam_Numb_domain,pfam_PTyr_interaction_dom,pfam_PTB,smart_PTyr_interaction_dom,pirsf_Numb/numb-like,pfscan_PTyr_interaction_dom	p.E342K	ENST00000355058.3	37	c.1024	CCDS32116.1	14	.	.	.	.	.	.	.	.	.	.	C	24.2	4.506680	0.85282	.	.	ENSG00000133961	ENST00000554546;ENST00000356296;ENST00000557597;ENST00000555238;ENST00000556772;ENST00000355058;ENST00000359560;ENST00000555394;ENST00000454166;ENST00000555738;ENST00000535282	T;T;T;T;T;T;T;T;T;T;T	0.56275	0.48;0.47;0.86;0.86;1.41;0.86;0.86;0.47;0.48;0.49;0.86	5.5	5.5	0.81552	.	0.047580	0.85682	N	0.000000	T	0.55194	0.1905	N	0.08118	0	0.80722	D	1	P;D;D;P;P;P;B	0.63880	0.872;0.993;0.993;0.821;0.721;0.716;0.278	P;D;D;P;P;P;B	0.72625	0.585;0.978;0.978;0.568;0.512;0.722;0.24	T	0.59674	-0.7410	10	0.36615	T	0.2	-15.5571	19.5916	0.95514	0.0:1.0:0.0:0.0	.	88;233;244;331;342;331;342	B1P2N9;B1P2N6;B1P2N5;P49757-4;P49757-2;P49757-3;P49757	.;.;.;.;.;.;NUMB_HUMAN	K	331;342;331;342;198;342;331;342;244;233;331	ENSP00000452416:E331K;ENSP00000348644:E342K;ENSP00000451117:E331K;ENSP00000451300:E342K;ENSP00000451513:E198K;ENSP00000347169:E342K;ENSP00000352563:E331K;ENSP00000451625:E342K;ENSP00000394025:E244K;ENSP00000452069:E233K;ENSP00000441258:E331K	ENSP00000347169:E342K	E	-	1	0	NUMB	72818892	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	7.475000	0.81041	2.861000	0.98227	0.655000	0.94253	GAG	NUMB	-	pirsf_Numb/numb-like		0.552	NUMB-201	KNOWN	basic|CCDS	protein_coding	NUMB	HGNC	protein_coding	OTTHUMT00000414416.1	C			73749139	-1	no_errors	ENST00000355058	ensembl	human	known	70_37	missense	SNP	1.000	T
NUP93	9688	genome.wustl.edu	37	16	56864512	56864512	+	Missense_Mutation	SNP	G	G	A	rs145578512		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:56864512G>A	ENST00000308159.5	+	10	1121	c.1000G>A	c.(1000-1002)Gct>Act	p.A334T	NUP93_ENST00000542526.1_Missense_Mutation_p.A211T|NUP93_ENST00000564887.1_Missense_Mutation_p.A211T|NUP93_ENST00000569842.1_Missense_Mutation_p.A334T	NM_014669.4	NP_055484.3	Q8N1F7	NUP93_HUMAN	nucleoporin 93kDa	334					carbohydrate metabolic process (GO:0005975)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|mitotic cell cycle (GO:0000278)|mitotic nuclear envelope disassembly (GO:0007077)|mRNA transport (GO:0051028)|nuclear pore complex assembly (GO:0051292)|protein transport (GO:0015031)|regulation of glucose transport (GO:0010827)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)	structural constituent of nuclear pore (GO:0017056)			breast(2)|endometrium(6)|kidney(1)|large_intestine(6)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27						CCTGCTTGCCGCTTCACAGGT	0.502													G|||	1	0.000199681	0.0	0.0	5008	,	,		19381	0.0		0.0	False		,,,				2504	0.001				Colon(33;610 796 1305 1705 38917)												0								G	THR/ALA,THR/ALA,THR/ALA	0,4396		0,0,2198	138.0	132.0	134.0		631,631,1000	5.1	0.9	16	dbSNP_134	134	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense,missense	NUP93	NM_001242795.1,NM_001242796.1,NM_014669.4	58,58,58	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging,possibly-damaging	211/697,211/697,334/820	56864512	1,12995	2198	4300	6498	SO:0001583	missense	9688			D42085	CCDS10769.1, CCDS55996.1	16q13	2008-02-05			ENSG00000102900	ENSG00000102900			28958	protein-coding gene	gene with protein product		614351				9348540, 9531546	Standard	NM_014669		Approved	KIAA0095	uc002eka.3	Q8N1F7	OTTHUMG00000133278	ENST00000308159.5:c.1000G>A	16.37:g.56864512G>A	ENSP00000310668:p.Ala334Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPQ8|Q14705	Missense_Mutation	SNP	pfam_Nucleoporin_int_Nup93/Nic96	p.A334T	ENST00000308159.5	37	c.1000	CCDS10769.1	16	.	.	.	.	.	.	.	.	.	.	G	36	5.696570	0.96802	0.0	1.16E-4	ENSG00000102900	ENST00000308159;ENST00000542526	T;T	0.73258	-0.73;-0.73	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	D	0.83073	0.5175	M	0.70275	2.135	0.80722	D	1	D	0.89917	1.0	D	0.65987	0.94	D	0.84599	0.0671	10	0.62326	D	0.03	-9.8507	18.9354	0.92583	0.0:0.0:1.0:0.0	.	334	Q8N1F7	NUP93_HUMAN	T	334;211	ENSP00000310668:A334T;ENSP00000440235:A211T	ENSP00000310668:A334T	A	+	1	0	NUP93	55422013	1.000000	0.71417	0.930000	0.37139	0.899000	0.52679	9.789000	0.99068	2.525000	0.85131	0.650000	0.86243	GCT	NUP93	-	pfam_Nucleoporin_int_Nup93/Nic96		0.502	NUP93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP93	HGNC	protein_coding	OTTHUMT00000257058.4	G	NM_014669		56864512	+1	no_errors	ENST00000308159	ensembl	human	known	70_37	missense	SNP	1.000	A
NUSAP1	51203	genome.wustl.edu	37	15	41625245	41625245	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:41625245G>A	ENST00000559596.1	+	1	177	c.90G>A	c.(88-90)ctG>ctA	p.L30L	NUSAP1_ENST00000560177.1_Silent_p.L30L|NUSAP1_ENST00000560747.1_Silent_p.L30L|OIP5_ENST00000220514.3_5'Flank|NUSAP1_ENST00000450318.1_Silent_p.L30L|NUSAP1_ENST00000450592.2_Silent_p.L30L|NUSAP1_ENST00000558123.1_Intron|NUSAP1_ENST00000414849.2_Silent_p.L30L|NUSAP1_ENST00000260359.6_Silent_p.L30L			Q9BXS6	NUSAP_HUMAN	nucleolar and spindle associated protein 1	30					establishment of mitotic spindle localization (GO:0040001)|mitotic chromosome condensation (GO:0007076)|mitotic cytokinesis (GO:0000281)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of mitosis (GO:0045840)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(3)|ovary(1)|prostate(2)|urinary_tract(2)	13		all_cancers(109;5.07e-19)|all_epithelial(112;2.43e-16)|Lung NSC(122;1.81e-11)|all_lung(180;4.81e-10)|Melanoma(134;0.0179)|Colorectal(260;0.0946)|Ovarian(310;0.143)		OV - Ovarian serous cystadenocarcinoma(18;9.63e-17)|GBM - Glioblastoma multiforme(113;1.59e-06)|BRCA - Breast invasive adenocarcinoma(123;0.168)		GGGCCAACCTGAGGGTACGGC	0.652																																																	0													25.0	26.0	26.0					15																	41625245		1883	4120	6003	SO:0001819	synonymous_variant	51203			AF290612	CCDS45234.1, CCDS45236.1, CCDS58356.1, CCDS58357.1, CCDS58358.1, CCDS73708.1	15q14	2008-02-05				ENSG00000137804			18538	protein-coding gene	gene with protein product		612818				12963707	Standard	NM_016359		Approved	FLJ13421, LNP, ANKT, NuSAP1, SAPL, BM037, PRO0310p1, Q0310	uc001zns.4	Q9BXS6		ENST00000559596.1:c.90G>A	15.37:g.41625245G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DDF1|E7ERR5|J3KN21|Q53GW2|Q8TBT4|Q96E58|Q96FJ1|Q9GZM9|Q9NZ85|Q9UI70	Silent	SNP	NULL	p.L30	ENST00000559596.1	37	c.90	CCDS45234.1	15																																																																																			NUSAP1	-	NULL		0.652	NUSAP1-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NUSAP1	HGNC	protein_coding	OTTHUMT00000419427.1	G	NM_016359		41625245	+1	no_errors	ENST00000559596	ensembl	human	known	70_37	silent	SNP	0.414	A
NXF3	56000	genome.wustl.edu	37	X	102337129	102337129	+	Intron	SNP	G	G	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:102337129G>T	ENST00000395065.3	-	9	992				NXF3_ENST00000425463.2_Missense_Mutation_p.P226H|NXF3_ENST00000425644.1_Intron	NM_022052.1	NP_071335.1	Q9H4D5	NXF3_HUMAN	nuclear RNA export factor 3						mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)	cytoplasm (GO:0005737)|nuclear RNA export factor complex (GO:0042272)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)			NS(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(2)|lung(15)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	26						CCTGCAGAAGGGCGCTATCAA	0.567																																																	0																																										SO:0001627	intron_variant	56000			AJ277527	CCDS14503.1	Xq22	2008-02-05			ENSG00000147206	ENSG00000147206			8073	protein-coding gene	gene with protein product		300316				11073998	Standard	NM_022052		Approved		uc004eju.3	Q9H4D5	OTTHUMG00000022088	ENST00000395065.3:c.890+53C>A	X.37:g.102337129G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYS7|Q5H9I1|Q9H1A9	Missense_Mutation	SNP	pfam_Tap_RNA-bd	p.P226H	ENST00000395065.3	37	c.677	CCDS14503.1	X	.	.	.	.	.	.	.	.	.	.	G	7.966	0.747960	0.15710	.	.	ENSG00000147206	ENST00000425463	T	0.49720	0.77	2.97	2.08	0.27032	.	.	.	.	.	T	0.34366	0.0895	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.06405	0.002	T	0.30179	-0.9987	8	0.72032	D	0.01	.	6.5411	0.22380	0.0:0.0:0.7141:0.2859	.	315	B4DYI1	.	H	226	ENSP00000404347:P226H	ENSP00000404347:P226H	P	-	2	0	NXF3	102223785	0.001000	0.12720	0.001000	0.08648	0.003000	0.03518	0.785000	0.26830	0.647000	0.30713	0.600000	0.82982	CCC	NXF3	-	NULL		0.567	NXF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF3	HGNC	protein_coding	OTTHUMT00000057684.1	G	NM_022052		102337129	-1	no_errors	ENST00000425463	ensembl	human	known	70_37	missense	SNP	0.001	T
OBSCN	84033	genome.wustl.edu	37	1	228487765	228487765	+	Intron	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:228487765C>G	ENST00000422127.1	+	43	11703				OBSCN_ENST00000284548.11_Intron|OBSCN_ENST00000570156.2_Missense_Mutation_p.R4553G|OBSCN_ENST00000366709.4_Intron|RP5-1139B12.4_ENST00000602778.1_RNA|OBSCN_ENST00000366707.4_Missense_Mutation_p.R1243G|OBSCN_ENST00000602685.1_3'UTR|OBSCN_ENST00000359599.6_3'UTR	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF						apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GCTGCAGATTCGTGGCCTGGT	0.577																																																	0													127.0	103.0	110.0					1																	228487765		876	1991	2867	SO:0001627	intron_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.11659+5021C>G	1.37:g.228487765C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_DH-domain,pfam_Fibronectin_type3,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.R1243G	ENST00000422127.1	37	c.3727	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773255	0.31411	.	.	ENSG00000154358	ENST00000366707	T	0.68025	-0.3	4.37	1.33	0.21861	.	.	.	.	.	T	0.49355	0.1552	.	.	.	0.09310	N	0.999991	.	.	.	.	.	.	T	0.34153	-0.9840	6	0.15499	T	0.54	.	9.0235	0.36215	0.0:0.6106:0.0:0.3894	.	.	.	.	G	1243	ENSP00000355668:R1243G	ENSP00000355668:R1243G	R	+	1	0	OBSCN	226554388	0.000000	0.05858	0.349000	0.25694	0.011000	0.07611	-0.085000	0.11250	0.440000	0.26502	0.561000	0.74099	CGT	OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,pfscan_Ig-like		0.577	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		C	NM_052843		228487765	+1	no_errors	ENST00000366707	ensembl	human	known	70_37	missense	SNP	0.022	G
OLIG3	167826	genome.wustl.edu	37	6	137814879	137814879	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:137814879C>G	ENST00000367734.2	-	1	652	c.429G>C	c.(427-429)gaG>gaC	p.E143D		NM_175747.2	NP_786923.1	Q7RTU3	OLIG3_HUMAN	oligodendrocyte transcription factor 3	143					spinal cord motor neuron cell fate specification (GO:0021520)|spinal cord motor neuron migration (GO:0097476)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II transcription corepressor activity (GO:0001106)			endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|upper_aerodigestive_tract(1)	11	Breast(32;0.165)|Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00161)|OV - Ovarian serous cystadenocarcinoma(155;0.00447)		GCCTCTTCATCTCCTCCAGGG	0.657																																																	0													63.0	58.0	60.0					6																	137814879		2203	4300	6503	SO:0001583	missense	167826			AK096362	CCDS5186.1	6q23.3	2013-05-21			ENSG00000177468	ENSG00000177468		"""Basic helix-loop-helix proteins"""	18003	protein-coding gene	gene with protein product		609323					Standard	NM_175747		Approved	Bhlhb7, bHLHe20	uc003qhp.1	Q7RTU3	OTTHUMG00000015657	ENST00000367734.2:c.429G>C	6.37:g.137814879C>G	ENSP00000356708:p.Glu143Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N8Q0	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.E143D	ENST00000367734.2	37	c.429	CCDS5186.1	6	.	.	.	.	.	.	.	.	.	.	C	13.55	2.269796	0.40095	.	.	ENSG00000177468	ENST00000367734	T	0.72615	-0.67	5.52	5.52	0.82312	Helix-loop-helix DNA-binding (3);	0.000000	0.85682	D	0.000000	T	0.58977	0.2160	L	0.55990	1.75	0.53005	D	0.999965	P	0.36683	0.565	B	0.40066	0.318	T	0.65047	-0.6263	10	0.51188	T	0.08	-1.777	12.7314	0.57201	0.0:0.9244:0.0:0.0756	.	143	Q7RTU3	OLIG3_HUMAN	D	143	ENSP00000356708:E143D	ENSP00000356708:E143D	E	-	3	2	OLIG3	137856572	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.031000	0.57267	2.576000	0.86940	0.591000	0.81541	GAG	OLIG3	-	superfamily_HLH_dom,smart_HLH_dom		0.657	OLIG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OLIG3	HGNC	protein_coding	OTTHUMT00000042405.1	C	NM_175747		137814879	-1	no_errors	ENST00000367734	ensembl	human	known	70_37	missense	SNP	1.000	G
OR2L2	26246	genome.wustl.edu	37	1	248202316	248202316	+	Silent	SNP	C	C	T	rs12134979		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:248202316C>T	ENST00000366479.2	+	1	843	c.747C>T	c.(745-747)ttC>ttT	p.F249F	OR2L13_ENST00000366478.2_Intron	NM_001004686.2	NP_001004686.1	Q8NH16	OR2L2_HUMAN	olfactory receptor, family 2, subfamily L, member 2	249			F -> L (in dbSNP:rs12134979).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(28)|ovary(1)|skin(4)|urinary_tract(1)	42	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			TAGTGTCCTTCTACTATGCAC	0.512													c|||	1	0.000199681	0.0	0.0	5008	,	,		22416	0.0		0.001	False		,,,				2504	0.0																0													197.0	174.0	182.0					1																	248202316		2203	4300	6503	SO:0001819	synonymous_variant	26246			X64978	CCDS31103.1	1q44	2012-08-09			ENSG00000203663	ENSG00000203663		"""GPCR / Class A : Olfactory receptors"""	8266	protein-coding gene	gene with protein product				OR2L4P, OR2L12		1370859	Standard	NM_001004686		Approved	HTPCRH07, HSHTPCRH07	uc001idw.3	Q8NH16	OTTHUMG00000040214	ENST00000366479.2:c.747C>T	1.37:g.248202316C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M3T5	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F249	ENST00000366479.2	37	c.747	CCDS31103.1	1																																																																																			OR2L2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.512	OR2L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L2	HGNC	protein_coding	OTTHUMT00000096871.1	C	NM_001004686		248202316	+1	no_errors	ENST00000366479	ensembl	human	known	70_37	silent	SNP	0.000	T
OR4C15	81309	genome.wustl.edu	37	11	55322251	55322251	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:55322251G>A	ENST00000314644.2	+	1	469	c.469G>A	c.(469-471)Gaa>Aaa	p.E157K		NM_001001920.1	NP_001001920.1	Q8NGM1	OR4CF_HUMAN	olfactory receptor, family 4, subfamily C, member 15	103						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(31)|ovary(1)|prostate(3)|skin(2)|upper_aerodigestive_tract(5)	56						GCTCTTTGCTGAACACTTCTT	0.463										HNSCC(20;0.049)																																							0													141.0	125.0	130.0					11																	55322251		2201	4296	6497	SO:0001583	missense	81309			BK004319	CCDS31501.1	11q11	2012-08-09			ENSG00000181939	ENSG00000181939		"""GPCR / Class A : Olfactory receptors"""	15171	protein-coding gene	gene with protein product							Standard	NM_001001920		Approved		uc010rig.2	Q8NGM1	OTTHUMG00000166714	ENST00000314644.2:c.469G>A	11.37:g.55322251G>A	ENSP00000324958:p.Glu157Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFE2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E157K	ENST00000314644.2	37	c.469	CCDS31501.1	11	.	.	.	.	.	.	.	.	.	.	G	13.50	2.256791	0.39896	.	.	ENSG00000181939	ENST00000314644	T	0.02944	4.1	5.12	3.17	0.36434	GPCR, rhodopsin-like superfamily (1);	.	.	.	.	T	0.03915	0.0110	M	0.73962	2.25	0.09310	N	1	B	0.33549	0.417	B	0.29598	0.104	T	0.34976	-0.9807	9	0.38643	T	0.18	.	3.3928	0.07295	0.0929:0.1698:0.5609:0.1763	.	103	Q8NGM1	OR4CF_HUMAN	K	157	ENSP00000324958:E157K	ENSP00000324958:E157K	E	+	1	0	OR4C15	55078827	0.000000	0.05858	0.995000	0.50966	0.723000	0.41478	-0.360000	0.07622	2.665000	0.90641	0.385000	0.25706	GAA	OR4C15	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.463	OR4C15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4C15	HGNC	protein_coding	OTTHUMT00000391164.1	G	NM_001001920		55322251	+1	no_errors	ENST00000314644	ensembl	human	known	70_37	missense	SNP	0.001	A
OR4K17	390436	genome.wustl.edu	37	14	20585871	20585871	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:20585871G>A	ENST00000315543.4	+	1	306	c.306G>A	c.(304-306)atG>atA	p.M102I		NM_001004715.1	NP_001004715.1	Q8NGC6	OR4KH_HUMAN	olfactory receptor, family 4, subfamily K, member 17	74						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(1)|large_intestine(4)|lung(12)|pancreas(1)|skin(3)	21	all_cancers(95;0.00108)		Epithelial(56;7.58e-07)|all cancers(55;3.77e-06)	GBM - Glioblastoma multiforme(265;0.0144)		TTGTAGATATGACCCTTGCTT	0.388																																																	0													190.0	198.0	195.0					14																	20585871		2203	4300	6503	SO:0001583	missense	390436				CCDS32030.1	14q11.2	2013-09-23			ENSG00000176230	ENSG00000176230		"""GPCR / Class A : Olfactory receptors"""	15355	protein-coding gene	gene with protein product							Standard	NM_001004715		Approved		uc001vwo.1	Q8NGC6	OTTHUMG00000170783	ENST00000315543.4:c.306G>A	14.37:g.20585871G>A	ENSP00000319197:p.Met102Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IF12	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.M102I	ENST00000315543.4	37	c.306	CCDS32030.1	14	.	.	.	.	.	.	.	.	.	.	.	0.017	-1.507120	0.00992	.	.	ENSG00000176230	ENST00000315543	T	0.01804	4.63	2.3	1.32	0.21799	GPCR, rhodopsin-like superfamily (1);	0.400889	0.17836	U	0.160367	T	0.00875	0.0029	N	0.02842	-0.48	0.09310	N	0.99999	B	0.17268	0.021	B	0.16289	0.015	T	0.49113	-0.8973	10	0.11485	T	0.65	.	9.9556	0.41663	0.0:0.2117:0.7883:0.0	.	74	Q8NGC6	OR4KH_HUMAN	I	102	ENSP00000319197:M102I	ENSP00000319197:M102I	M	+	3	0	OR4K17	19655711	0.000000	0.05858	0.919000	0.36401	0.107000	0.19398	-1.020000	0.03618	0.459000	0.27016	0.404000	0.27445	ATG	OR4K17	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.388	OR4K17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4K17	HGNC	protein_coding	OTTHUMT00000410346.1	G			20585871	+1	no_errors	ENST00000315543	ensembl	human	known	70_37	missense	SNP	0.301	A
OR6K6	128371	genome.wustl.edu	37	1	158724677	158724677	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:158724677G>A	ENST00000368144.2	+	1	168	c.72G>A	c.(70-72)caG>caA	p.Q24Q		NM_001005184.1	NP_001005184.1	Q8NGW6	OR6K6_HUMAN	olfactory receptor, family 6, subfamily K, member 6	24						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(1)|large_intestine(5)|lung(17)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_hematologic(112;0.0378)					TGTGTTCACAGATGACACAGT	0.428																																																	0													159.0	155.0	156.0					1																	158724677		2203	4300	6503	SO:0001819	synonymous_variant	128371			BK004198	CCDS30904.1	1q23.1	2012-08-09			ENSG00000180433	ENSG00000180433		"""GPCR / Class A : Olfactory receptors"""	15033	protein-coding gene	gene with protein product							Standard	NM_001005184		Approved		uc001fsw.1	Q8NGW6	OTTHUMG00000022772	ENST00000368144.2:c.72G>A	1.37:g.158724677G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIM8|Q5VUU9|Q6IFR4	Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.Q24	ENST00000368144.2	37	c.72	CCDS30904.1	1																																																																																			OR6K6	-	NULL		0.428	OR6K6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6K6	HGNC	protein_coding	OTTHUMT00000059065.2	G	NM_001005184		158724677	+1	no_errors	ENST00000368144	ensembl	human	known	70_37	silent	SNP	0.977	A
PATZ1	23598	genome.wustl.edu	37	22	31740573	31740573	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:31740573G>C	ENST00000266269.5	-	1	1645	c.1016C>G	c.(1015-1017)tCt>tGt	p.S339C	PATZ1_ENST00000215919.3_Missense_Mutation_p.S339C|PATZ1_ENST00000405309.3_Missense_Mutation_p.S339C|PATZ1_ENST00000351933.4_Missense_Mutation_p.S339C|AC005003.1_ENST00000504184.2_5'Flank	NM_014323.2	NP_055138.2	Q9HBE1	PATZ1_HUMAN	POZ (BTB) and AT hook containing zinc finger 1	339					male gonad development (GO:0008584)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription, DNA-templated (GO:0006355)|spermatogenesis (GO:0007283)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)		EWSR1/PATZ1(2)	NS(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(4)|skin(2)	12						GGGGTCTTCAGAGATGGGTAG	0.622																																																	0													48.0	49.0	49.0					22																	31740573		2203	4300	6503	SO:0001583	missense	23598			AL096880	CCDS13894.1, CCDS13895.1, CCDS13896.1, CCDS46691.1	22q12.2	2013-01-09	2006-09-19	2006-09-19	ENSG00000100105	ENSG00000100105		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	13071	protein-coding gene	gene with protein product		605165	"""zinc finger protein 278"""	ZNF278		10591208, 18241078, 18401526	Standard	NM_014323		Approved	MAZR, dJ400N23, ZBTB19, ZSG, RIAZ, PATZ	uc003akq.3	Q9HBE1	OTTHUMG00000151254	ENST00000266269.5:c.1016C>G	22.37:g.31740573G>C	ENSP00000266269:p.Ser339Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HBE2|Q9HBE3|Q9P1A9|Q9UDU0|Q9Y529	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.S339C	ENST00000266269.5	37	c.1016	CCDS13894.1	22	.	.	.	.	.	.	.	.	.	.	G	15.84	2.950573	0.53186	.	.	ENSG00000100105	ENST00000266269;ENST00000405309;ENST00000351933;ENST00000215919	T;T;T;T	0.11604	2.81;2.76;2.82;2.98	4.78	4.78	0.61160	.	0.610036	0.17176	N	0.184092	T	0.09113	0.0225	N	0.08118	0	0.29959	N	0.819609	B;P;P;P	0.42620	0.0;0.589;0.731;0.785	B;B;B;P	0.47162	0.001;0.416;0.39;0.54	T	0.04128	-1.0975	10	0.87932	D	0	-8.0989	10.8711	0.46883	0.0:0.0:0.6954:0.3046	.	339;339;339;339	Q9HBE1-4;Q9HBE1-3;Q9HBE1;Q9HBE1-2	.;.;PATZ1_HUMAN;.	C	339	ENSP00000266269:S339C;ENSP00000384173:S339C;ENSP00000337520:S339C;ENSP00000215919:S339C	ENSP00000215919:S339C	S	-	2	0	PATZ1	30070573	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.160000	0.64929	2.211000	0.71520	0.561000	0.74099	TCT	PATZ1	-	NULL		0.622	PATZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PATZ1	HGNC	protein_coding	OTTHUMT00000321932.1	G	NM_032052		31740573	-1	no_errors	ENST00000266269	ensembl	human	known	70_37	missense	SNP	0.996	C
PCDHGA8	9708	genome.wustl.edu	37	5	140774125	140774125	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:140774125C>A	ENST00000398604.2	+	1	1745	c.1745C>A	c.(1744-1746)gCa>gAa	p.A582E	PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron	NM_032088.1	NP_114477.1	Q9Y5G5	PCDG8_HUMAN	protocadherin gamma subfamily A, 8	582	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(6)|kidney(6)|large_intestine(6)|lung(30)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	51			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCCCGCTCCGCAGAGCGTGGC	0.677																																																	0													74.0	86.0	82.0					5																	140774125		2201	4299	6500	SO:0001583	missense	9708			AF152515	CCDS47291.1, CCDS75338.1	5q31	2010-01-26			ENSG00000253767	ENSG00000253767		"""Cadherins / Protocadherins : Clustered"""	8706	other	protocadherin		606295				10380929	Standard	NM_014004		Approved	KIAA0327, PCDH-GAMMA-A8		Q9Y5G5	OTTHUMG00000164053	ENST00000398604.2:c.1745C>A	5.37:g.140774125C>A	ENSP00000381605:p.Ala582Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MCZ4|O15039	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A582E	ENST00000398604.2	37	c.1745	CCDS47291.1	5	.	.	.	.	.	.	.	.	.	.	.	20.1	3.941059	0.73557	.	.	ENSG00000253767	ENST00000398604	T	0.17213	2.29	5.06	5.06	0.68205	Cadherin (2);Cadherin-like (1);	0.000000	0.30989	U	0.008464	T	0.51210	0.1661	M	0.89785	3.06	0.40674	D	0.982248	D;D	0.76494	0.999;0.995	D;D	0.76071	0.987;0.962	T	0.64084	-0.6490	10	0.87932	D	0	.	18.0785	0.89435	0.0:1.0:0.0:0.0	.	582;582	Q9Y5G5;Q9Y5G5-2	PCDG8_HUMAN;.	E	582	ENSP00000381605:A582E	ENSP00000381605:A582E	A	+	2	0	PCDHGA8	140754309	1.000000	0.71417	0.929000	0.37066	0.594000	0.36715	5.671000	0.68095	2.366000	0.80165	0.655000	0.94253	GCA	PCDHGA8	-	superfamily_Cadherin-like,pfscan_Cadherin		0.677	PCDHGA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA8	HGNC	protein_coding	OTTHUMT00000376972.1	C	NM_032088		140774125	+1	no_errors	ENST00000398604	ensembl	human	known	70_37	missense	SNP	0.998	A
PCDHGA12	26025	genome.wustl.edu	37	5	140811189	140811189	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:140811189C>T	ENST00000252085.3	+	1	1005	c.863C>T	c.(862-864)gCg>gTg	p.A288V	PCDHGA11_ENST00000518882.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGB3_ENST00000576222.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA8_ENST00000398604.2_Intron	NM_003735.2|NM_032094.1	NP_003726.1|NP_115265.1	O60330	PCDGC_HUMAN	protocadherin gamma subfamily A, 12	288	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|cervix(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(23)|ovary(5)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)	58			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GACGACAAGGCGGCCCAAGTT	0.512																																																	0													93.0	94.0	94.0					5																	140811189		2203	4300	6503	SO:0001583	missense	26025			AF152506	CCDS4260.1, CCDS75346.1	5q31	2010-01-26	2002-05-23		ENSG00000253159	ENSG00000253159		"""Cadherins / Protocadherins : Clustered"""	8699	other	protocadherin	"""fibroblast cadherin FIB3"""	603059	"""cadherin 21"""	CDH21		10380929	Standard	NM_003735		Approved	KIAA0588, FIB3, PCDH-GAMMA-A12		O60330	OTTHUMG00000129611	ENST00000252085.3:c.863C>T	5.37:g.140811189C>T	ENSP00000252085:p.Ala288Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O15100|Q6UW70|Q9Y5D7	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A288V	ENST00000252085.3	37	c.863	CCDS4260.1	5	.	.	.	.	.	.	.	.	.	.	c	0.368	-0.935396	0.02340	.	.	ENSG00000253159	ENST00000252085	T	0.01584	4.75	5.09	4.19	0.49359	Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.01124	0.0037	N	0.04686	-0.185	0.09310	N	1	B;B	0.19935	0.04;0.012	B;B	0.14023	0.006;0.01	T	0.41088	-0.9528	9	0.02654	T	1	.	14.3015	0.66355	0.1498:0.8502:0.0:0.0	.	288;288	O60330-2;O60330	.;PCDGC_HUMAN	V	288	ENSP00000252085:A288V	ENSP00000252085:A288V	A	+	2	0	PCDHGA12	140791373	0.007000	0.16637	0.193000	0.23327	0.894000	0.52154	1.171000	0.31896	1.303000	0.44873	0.655000	0.94253	GCG	PCDHGA12	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.512	PCDHGA12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA12	HGNC	protein_coding	OTTHUMT00000251806.2	C	NM_003735		140811189	+1	no_errors	ENST00000252085	ensembl	human	known	70_37	missense	SNP	0.001	T
PCYOX1	51449	genome.wustl.edu	37	2	70504273	70504273	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:70504273C>G	ENST00000433351.2	+	6	1295	c.1267C>G	c.(1267-1269)Ctg>Gtg	p.L423V	PCYOX1_ENST00000505044.2_Missense_Mutation_p.L346V|PCYOX1_ENST00000264441.5_3'UTR|PCYOX1_ENST00000545138.1_Missense_Mutation_p.L345V	NM_016297.3	NP_057381.3	Q9UHG3	PCYOX_HUMAN	prenylcysteine oxidase 1	423					prenylated protein catabolic process (GO:0030327)|prenylcysteine catabolic process (GO:0030328)|prenylcysteine metabolic process (GO:0030329)	extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	chloride-transporting ATPase activity (GO:0008555)|prenylcysteine oxidase activity (GO:0001735)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(3)|lung(6)	15						AAAGCTCTTTCTGTCCTATGA	0.403																																																	0													65.0	71.0	69.0					2																	70504273		2203	4300	6503	SO:0001583	missense	51449			AB020715	CCDS1902.1	2p13.3	2008-02-05			ENSG00000116005	ENSG00000116005	1.8.3.5		20588	protein-coding gene	gene with protein product		610995				10585463, 12186880	Standard	NM_016297		Approved	KIAA0908, PCL1	uc002sgn.4	Q9UHG3	OTTHUMG00000129671	ENST00000433351.2:c.1267C>G	2.37:g.70504273C>G	ENSP00000387654:p.Leu423Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB14|B7Z9P8|O94982|Q8N4N5|Q96QM8	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pfam_FAD-dep_OxRdtase,pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Amino_oxidase,pirsf_Prenylcysteine_Oxase	p.L423V	ENST00000433351.2	37	c.1267	CCDS1902.1	2	.	.	.	.	.	.	.	.	.	.	C	2.571	-0.299588	0.05532	.	.	ENSG00000116005	ENST00000505044;ENST00000433351;ENST00000545138	T;T;T	0.14516	2.5;2.5;2.5	5.23	-5.98	0.02220	Prenylcysteine lyase (1);	0.493793	0.19410	N	0.114946	T	0.03739	0.0106	N	0.04090	-0.28	0.22034	N	0.999403	B;B	0.10296	0.002;0.003	B;B	0.15052	0.012;0.011	T	0.25012	-1.0144	10	0.28530	T	0.3	-5.1664	3.7885	0.08710	0.0852:0.3576:0.1978:0.3593	.	405;423	B7Z8A2;Q9UHG3	.;PCYOX_HUMAN	V	346;423;345	ENSP00000441566:L346V;ENSP00000387654:L423V;ENSP00000439916:L345V	ENSP00000387654:L423V	L	+	1	2	PCYOX1	70357777	0.065000	0.20965	0.893000	0.35052	0.488000	0.33401	-0.157000	0.10085	-0.957000	0.03627	-1.099000	0.02127	CTG	PCYOX1	-	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase		0.403	PCYOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1	HGNC	protein_coding	OTTHUMT00000251872.3	C	NM_016297		70504273	+1	no_errors	ENST00000433351	ensembl	human	known	70_37	missense	SNP	0.052	G
PELI3	246330	genome.wustl.edu	37	11	66238754	66238754	+	Missense_Mutation	SNP	G	G	A	rs541571878		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:66238754G>A	ENST00000320740.7	+	4	426	c.266G>A	c.(265-267)cGa>cAa	p.R89Q	CTD-3074O7.5_ENST00000527092.1_RNA|CTD-3074O7.5_ENST00000602951.1_RNA|PELI3_ENST00000524466.1_Missense_Mutation_p.R89Q|PELI3_ENST00000531856.1_Intron|PELI3_ENST00000349459.6_Missense_Mutation_p.R65Q	NM_001243136.1|NM_145065.2	NP_001230065.1|NP_659502.2	Q8N2H9	PELI3_HUMAN	pellino E3 ubiquitin protein ligase family member 3	89					defense response to Gram-negative bacterium (GO:0050829)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of Toll signaling pathway (GO:0045751)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon production (GO:0032480)|positive regulation of nucleotide-binding oligomerization domain containing 2 signaling pathway (GO:0070434)|protein K63-linked ubiquitination (GO:0070534)|regulation of nucleotide-binding oligomerization domain containing 1 signaling pathway (GO:0070428)|Toll signaling pathway (GO:0008063)	cytosol (GO:0005829)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.R89Q(1)		breast(1)|endometrium(2)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)	15						GGCCGCCGGCGAAGCCGCCTG	0.597													G|||	1	0.000199681	0.0008	0.0	5008	,	,		12020	0.0		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	breast(1)											72.0	81.0	78.0					11																	66238754		2200	4295	6495	SO:0001583	missense	246330			AL834395	CCDS31615.1, CCDS41675.1, CCDS73328.1	11q13.2	2012-02-23	2012-02-23		ENSG00000174516	ENSG00000174516		"""Pellino homologs"""	30010	protein-coding gene	gene with protein product		609827	"""pellino homolog 3 (Drosophila)"""			12874243, 15917247	Standard	NM_145065		Approved	MGC35521	uc001oic.4	Q8N2H9	OTTHUMG00000167109	ENST00000320740.7:c.266G>A	11.37:g.66238754G>A	ENSP00000322532:p.Arg89Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3E1|Q8N9Q6|Q8TAW7|Q8TED5	Missense_Mutation	SNP	pfam_Pellino	p.R89Q	ENST00000320740.7	37	c.266	CCDS31615.1	11	.	.	.	.	.	.	.	.	.	.	G	29.8	5.038870	0.93630	.	.	ENSG00000174516	ENST00000349459;ENST00000320740;ENST00000524466;ENST00000527230	T;T;T;T	0.47177	0.85;0.85;0.85;0.85	5.27	5.27	0.74061	.	0.000000	0.64402	D	0.000002	T	0.56411	0.1983	L	0.55213	1.73	0.46149	D	0.998897	D;D;D	0.64830	0.967;0.99;0.994	B;P;P	0.58928	0.388;0.657;0.848	T	0.56547	-0.7961	10	0.54805	T	0.06	-9.5914	9.7476	0.40457	0.0907:0.0:0.9093:0.0	.	65;89;89	Q8N2H9-2;Q8N2H9;Q8N2H9-4	.;PELI3_HUMAN;.	Q	65;89;89;89	ENSP00000309848:R65Q;ENSP00000322532:R89Q;ENSP00000434677:R89Q;ENSP00000432449:R89Q	ENSP00000322532:R89Q	R	+	2	0	PELI3	65995330	0.986000	0.35501	1.000000	0.80357	0.995000	0.86356	1.231000	0.32624	2.735000	0.93741	0.655000	0.94253	CGA	PELI3	-	pfam_Pellino		0.597	PELI3-001	KNOWN	basic|CCDS	protein_coding	PELI3	HGNC	protein_coding	OTTHUMT00000393226.1	G	NM_145065		66238754	+1	no_errors	ENST00000320740	ensembl	human	known	70_37	missense	SNP	0.988	A
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PIK3CA	5290	genome.wustl.edu	37	3	178938934	178938934	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:178938934G>A	ENST00000263967.3	+	14	2333	c.2176G>A	c.(2176-2178)Gaa>Aaa	p.E726K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	726			E -> K (in MCAP). {ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E726K(8)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	GAAGAAGGATGAAACACAAAA	0.428		57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	8	Substitution - Missense(8)	lung(4)|large_intestine(2)|breast(2)											89.0	78.0	82.0					3																	178938934		1917	4118	6035	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.2176G>A	3.37:g.178938934G>A	ENSP00000263967:p.Glu726Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E726K	ENST00000263967.3	37	c.2176	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	17.12	3.308869	0.60305	.	.	ENSG00000121879	ENST00000263967	T	0.80653	-1.4	5.67	5.67	0.87782	Protein kinase-like domain (1);	0.166180	0.38778	U	0.001568	T	0.73450	0.3588	L	0.36672	1.1	0.80722	D	1	P	0.46064	0.872	B	0.42738	0.396	T	0.71401	-0.4604	10	0.02654	T	1	-19.3819	19.7612	0.96319	0.0:0.0:1.0:0.0	.	726	P42336	PK3CA_HUMAN	K	726	ENSP00000263967:E726K	ENSP00000263967:E726K	E	+	1	0	PIK3CA	180421628	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.476000	0.97823	2.670000	0.90874	0.655000	0.94253	GAA	PIK3CA	-	superfamily_Kinase-like_dom		0.428	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178938934	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PLEC	5339	genome.wustl.edu	37	8	144998412	144998412	+	Silent	SNP	C	C	G	rs371105740		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:144998412C>G	ENST00000322810.4	-	31	6265	c.6096G>C	c.(6094-6096)ctG>ctC	p.L2032L	PLEC_ENST00000527096.1_Silent_p.L1918L|PLEC_ENST00000354589.3_Silent_p.L1895L|PLEC_ENST00000356346.3_Silent_p.L1881L|PLEC_ENST00000354958.2_Silent_p.L1873L|PLEC_ENST00000357649.2_Silent_p.L1899L|PLEC_ENST00000436759.2_Silent_p.L1922L|PLEC_ENST00000398774.2_Silent_p.L1863L|PLEC_ENST00000345136.3_Silent_p.L1895L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2032	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GCAGCTGGGCCAGGCGCTCCT	0.711																																																	0													13.0	16.0	15.0					8																	144998412		2157	4229	6386	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6096G>C	8.37:g.144998412C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.L2032	ENST00000322810.4	37	c.6096	CCDS43772.1	8																																																																																			PLEC	-	NULL		0.711	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	C	NM_000445		144998412	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	silent	SNP	0.917	G
PLEKHA1	59338	genome.wustl.edu	37	10	124184411	124184411	+	Splice_Site	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:124184411G>A	ENST00000368990.3	+	10	877		c.e10-1		PLEKHA1_ENST00000433307.1_Splice_Site|PLEKHA1_ENST00000538022.1_Splice_Site|PLEKHA1_ENST00000368989.2_Splice_Site|PLEKHA1_ENST00000368988.1_Splice_Site	NM_001001974.2	NP_001001974.1	Q9HB21	PKHA1_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 1						androgen metabolic process (GO:0008209)|B cell receptor signaling pathway (GO:0050853)|cellular response to hydrogen peroxide (GO:0070301)|establishment of protein localization (GO:0045184)|estrogen metabolic process (GO:0008210)|face morphogenesis (GO:0060325)|Leydig cell differentiation (GO:0033327)|luteinization (GO:0001553)|multicellular organism growth (GO:0035264)|negative regulation of protein kinase B signaling (GO:0051898)|palate development (GO:0060021)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|post-embryonic development (GO:0009791)|ruffle organization (GO:0031529)|skeletal system morphogenesis (GO:0048705)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ruffle membrane (GO:0032587)	PDZ domain binding (GO:0030165)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	13		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				TTTTCATACAGCGACATAATG	0.343																																																	0													90.0	91.0	91.0					10																	124184411		2203	4300	6503	SO:0001630	splice_region_variant	59338			AF286160	CCDS7629.1, CCDS55730.1	10q26.3	2013-01-10	2002-01-14		ENSG00000107679	ENSG00000107679		"""Pleckstrin homology (PH) domain containing"""	14335	protein-coding gene	gene with protein product	"""tandem PH domain containing protein-1"""	607772	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 1"""			11001876, 15485858	Standard	NM_001001974		Approved	TAPP1	uc001lge.2	Q9HB21	OTTHUMG00000019184	ENST00000368990.3:c.747-1G>A	10.37:g.124184411G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQ55|D3DRE2|Q9BVK0	Splice_Site	SNP	-	e9-1	ENST00000368990.3	37	c.747-1	CCDS7629.1	10	.	.	.	.	.	.	.	.	.	.	G	21.3	4.129966	0.77549	.	.	ENSG00000107679	ENST00000368990;ENST00000368989;ENST00000409427;ENST00000368988;ENST00000538022;ENST00000433307	.	.	.	5.29	5.29	0.74685	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.9084	0.92472	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	PLEKHA1	124174401	1.000000	0.71417	1.000000	0.80357	0.858000	0.48976	9.203000	0.95033	2.640000	0.89533	0.650000	0.86243	.	PLEKHA1	-	-		0.343	PLEKHA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA1	HGNC	protein_coding	OTTHUMT00000050783.1	G	NM_001001974	Intron	124184411	+1	no_errors	ENST00000368990	ensembl	human	known	70_37	splice_site	SNP	1.000	A
PLXNA4	91584	genome.wustl.edu	37	7	131883280	131883280	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:131883280C>T	ENST00000359827.3	-	13	3664	c.2702G>A	c.(2701-2703)tGc>tAc	p.C901Y	PLXNA4_ENST00000321063.4_Missense_Mutation_p.C901Y			Q9HCM2	PLXA4_HUMAN	plexin A4	901	IPT/TIG 1.				anterior commissure morphogenesis (GO:0021960)|axon guidance (GO:0007411)|chemorepulsion of branchiomotor axon (GO:0021793)|facial nerve structural organization (GO:0021612)|glossopharyngeal nerve morphogenesis (GO:0021615)|postganglionic parasympathetic nervous system development (GO:0021784)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of negative chemotaxis (GO:0050923)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|sympathetic nervous system development (GO:0048485)|trigeminal nerve structural organization (GO:0021637)|vagus nerve morphogenesis (GO:0021644)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	semaphorin receptor activity (GO:0017154)			NS(1)|breast(1)|endometrium(3)|kidney(4)|large_intestine(14)|lung(17)|ovary(1)|prostate(2)|skin(1)|stomach(1)	45						TAAAGGGCTGCACTCCACGCC	0.577																																																	0													70.0	71.0	71.0					7																	131883280		2015	4186	6201	SO:0001583	missense	91584			AB046770, AK123428	CCDS5826.1, CCDS43646.1, CCDS43647.1	7q32.3	2007-09-26	2007-09-26	2007-09-26	ENSG00000221866	ENSG00000221866		"""Plexins"""	9102	protein-coding gene	gene with protein product		604280	"""plexin A4, A"", ""plexin A4, B"""	PLXNA4A, PLXNA4B			Standard	NM_181775		Approved	KIAA1550, DKFZp434G0625PRO34003, FAYV2820	uc003vra.4	Q9HCM2	OTTHUMG00000155108	ENST00000359827.3:c.2702G>A	7.37:g.131883280C>T	ENSP00000352882:p.Cys901Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1N6|E9PAM2|Q6UWC6|Q6ZW89|Q8N969|Q8ND00|Q8NEN3|Q9NTD4	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.C901Y	ENST00000359827.3	37	c.2702	CCDS43646.1	7	.	.	.	.	.	.	.	.	.	.	C	28.5	4.924266	0.92319	.	.	ENSG00000221866	ENST00000321063;ENST00000359827	T;T	0.80214	-1.35;-1.35	5.94	5.94	0.96194	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.93331	0.7874	H	0.95294	3.65	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.94194	0.7444	10	0.66056	D	0.02	.	20.3658	0.98878	0.0:1.0:0.0:0.0	.	901	Q9HCM2	PLXA4_HUMAN	Y	901	ENSP00000323194:C901Y;ENSP00000352882:C901Y	ENSP00000323194:C901Y	C	-	2	0	PLXNA4	131533820	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	7.818000	0.86416	2.820000	0.97059	0.650000	0.86243	TGC	PLXNA4	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt		0.577	PLXNA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA4	HGNC	protein_coding	OTTHUMT00000338422.2	C	NM_181775		131883280	-1	no_errors	ENST00000321063	ensembl	human	known	70_37	missense	SNP	1.000	T
POLR3E	55718	genome.wustl.edu	37	16	22337138	22337138	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:22337138C>T	ENST00000299853.5	+	18	1572	c.1405C>T	c.(1405-1407)Cag>Tag	p.Q469*	POLR3E_ENST00000359210.4_Nonsense_Mutation_p.Q469*|POLR3E_ENST00000418581.2_Nonsense_Mutation_p.Q433*|POLR3E_ENST00000564209.1_Nonsense_Mutation_p.Q469*	NM_001258033.1|NM_001258035.1|NM_018119.3	NP_001244962.1|NP_001244964.1|NP_060589.1	Q9NVU0	RPC5_HUMAN	polymerase (RNA) III (DNA directed) polypeptide E (80kD)	469					defense response to virus (GO:0051607)|gene expression (GO:0010467)|innate immune response (GO:0045087)|positive regulation of type I interferon production (GO:0032481)|termination of RNA polymerase III transcription (GO:0006386)|transcription elongation from RNA polymerase III promoter (GO:0006385)|transcription from RNA polymerase III promoter (GO:0006383)	centrosome (GO:0005813)|cytosol (GO:0005829)|DNA-directed RNA polymerase III complex (GO:0005666)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27				GBM - Glioblastoma multiforme(48;0.012)		AACCAAGGCCCAGCAGAACCA	0.692																																																	0													27.0	26.0	27.0					16																	22337138		2196	4298	6494	SO:0001587	stop_gained	55718			AY092085	CCDS10605.1, CCDS58432.1, CCDS58433.1, CCDS58434.1, CCDS73845.1	16p12	2013-01-21			ENSG00000058600	ENSG00000058600		"""RNA polymerase subunits"""	30347	protein-coding gene	gene with protein product						10819331, 10521666	Standard	NM_018119		Approved	RPC5, SIN, FLJ10509	uc002dkk.4	Q9NVU0	OTTHUMG00000094779	ENST00000299853.5:c.1405C>T	16.37:g.22337138C>T	ENSP00000299853:p.Gln469*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DL24|B4DUP6|H3BT11|Q9BWF7|Q9H8W8|Q9H907|Q9P276	Nonsense_Mutation	SNP	pfam_RNA_pol_III_Rpc5	p.Q469*	ENST00000299853.5	37	c.1405	CCDS10605.1	16	.	.	.	.	.	.	.	.	.	.	C	36	5.866052	0.97043	.	.	ENSG00000058600	ENST00000299853;ENST00000359210;ENST00000418581	.	.	.	5.27	5.27	0.74061	.	0.348446	0.30437	N	0.009634	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-25.113	11.9346	0.52866	0.2922:0.7078:0.0:0.0	.	.	.	.	X	469;469;433	.	ENSP00000299853:Q469X	Q	+	1	0	POLR3E	22244639	0.884000	0.30299	1.000000	0.80357	0.946000	0.59487	2.762000	0.47597	2.484000	0.83849	0.462000	0.41574	CAG	POLR3E	-	NULL		0.692	POLR3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR3E	HGNC	protein_coding	OTTHUMT00000211590.1	C	NM_018119		22337138	+1	no_errors	ENST00000299853	ensembl	human	known	70_37	nonsense	SNP	0.996	T
PPAP2B	8613	genome.wustl.edu	37	1	56990047	56990047	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:56990047C>A	ENST00000371250.3	-	3	1028	c.477G>T	c.(475-477)ttG>ttT	p.L159F		NM_003713.4	NP_003704.3	O14495	LPP3_HUMAN	phosphatidic acid phosphatase type 2B	159					Bergmann glial cell differentiation (GO:0060020)|blood vessel development (GO:0001568)|canonical Wnt signaling pathway involved in positive regulation of cell-cell adhesion (GO:0044329)|canonical Wnt signaling pathway involved in positive regulation of endothelial cell migration (GO:0044328)|canonical Wnt signaling pathway involved in positive regulation of wound healing (GO:0044330)|dephosphorylation (GO:0016311)|gastrulation with mouth forming second (GO:0001702)|germ cell migration (GO:0008354)|homotypic cell-cell adhesion (GO:0034109)|lipid metabolic process (GO:0006629)|negative regulation of protein phosphorylation (GO:0001933)|phospholipid metabolic process (GO:0006644)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein stabilization (GO:0050821)|regulation of sphingolipid mediated signaling pathway (GO:1902068)|regulation of Wnt signaling pathway (GO:0030111)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)	adherens junction (GO:0005912)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	lipid phosphatase activity (GO:0042577)|phosphatidate phosphatase activity (GO:0008195)|phosphoprotein phosphatase activity (GO:0004721)|sphingosine-1-phosphate phosphatase activity (GO:0042392)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	17						TGCAGACACTCAAGAAGTGAG	0.507																																																	0													151.0	150.0	150.0					1																	56990047		2203	4300	6503	SO:0001583	missense	8613			AB000889	CCDS604.1	1p32.2	2009-05-27			ENSG00000162407	ENSG00000162407	3.1.3.4		9229	protein-coding gene	gene with protein product		607125				9305923	Standard	NM_003713		Approved	PAP-2b, LPP3	uc001cyj.2	O14495	OTTHUMG00000008160	ENST00000371250.3:c.477G>T	1.37:g.56990047C>A	ENSP00000360296:p.Leu159Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R651|D3DQ52|Q5U0F7|Q96GW0|Q99782	Missense_Mutation	SNP	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase	p.L159F	ENST00000371250.3	37	c.477	CCDS604.1	1	.	.	.	.	.	.	.	.	.	.	C	16.88	3.245192	0.59103	.	.	ENSG00000162407	ENST00000371250	T	0.75821	-0.97	5.7	3.8	0.43715	Phosphatidic acid phosphatase/chloroperoxidase, N-terminal (1);	0.143089	0.47852	D	0.000204	T	0.79015	0.4375	M	0.62016	1.91	0.58432	D	0.999995	D	0.60575	0.988	D	0.64595	0.927	T	0.78293	-0.2260	10	0.56958	D	0.05	.	4.1493	0.10230	0.1311:0.6037:0.1271:0.138	.	159	O14495	LPP3_HUMAN	F	159	ENSP00000360296:L159F	ENSP00000360296:L159F	L	-	3	2	PPAP2B	56762635	0.924000	0.31332	0.998000	0.56505	0.996000	0.88848	0.214000	0.17541	1.377000	0.46286	0.655000	0.94253	TTG	PPAP2B	-	pfam_P_Acid_Pase_2/haloperoxidase,superfamily_P_Acid_Pase_2/haloperoxidase,smart_P_Acid_Pase_2/haloperoxidase		0.507	PPAP2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPAP2B	HGNC	protein_coding	OTTHUMT00000022334.2	C	NM_003713		56990047	-1	no_errors	ENST00000371250	ensembl	human	known	70_37	missense	SNP	0.995	A
PPP1R12A	4659	genome.wustl.edu	37	12	80214673	80214673	+	Missense_Mutation	SNP	G	G	A	rs370303309		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:80214673G>A	ENST00000450142.2	-	8	1261	c.995C>T	c.(994-996)tCc>tTc	p.S332F	RP11-530C5.2_ENST00000548469.1_RNA|PPP1R12A_ENST00000546369.1_Missense_Mutation_p.S245F|PPP1R12A_ENST00000261207.5_Missense_Mutation_p.S332F|PPP1R12A_ENST00000437004.2_Missense_Mutation_p.S332F|PPP1R12A_ENST00000550107.1_Missense_Mutation_p.S332F	NM_002480.2	NP_002471.1	O14974	MYPT1_HUMAN	protein phosphatase 1, regulatory subunit 12A	332					centrosome organization (GO:0051297)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of catalytic activity (GO:0043086)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein dephosphorylation (GO:0006470)|regulation of cell adhesion (GO:0030155)|regulation of myosin-light-chain-phosphatase activity (GO:0035507)|regulation of nucleocytoplasmic transport (GO:0046822)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|centrosome (GO:0005813)|contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|kinetochore (GO:0000776)|nucleoplasm (GO:0005654)|PTW/PP1 phosphatase complex (GO:0072357)	14-3-3 protein binding (GO:0071889)|enzyme inhibitor activity (GO:0004857)|phosphatase regulator activity (GO:0019208)|protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(7)|liver(1)|lung(4)|ovary(2)|skin(1)	29						TTCAATACGGGATGCATTTTT	0.353																																																	0													115.0	105.0	108.0					12																	80214673		1855	4083	5938	SO:0001583	missense	4659			D87930	CCDS44947.1, CCDS44948.1, CCDS58259.1, CCDS58260.1	12q15-q21	2013-01-18	2011-10-04	2001-08-10	ENSG00000058272	ENSG00000058272		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7618	protein-coding gene	gene with protein product	"""myosin phosphatase-targeting subunit 1"", ""myosin binding subunit"""	602021	"""protein phosphatase 1, regulatory (inhibitor) subunit 12A"""	MYPT1		9286714	Standard	NM_002480		Approved	MBS, M130	uc001syz.3	O14974	OTTHUMG00000170100	ENST00000450142.2:c.995C>T	12.37:g.80214673G>A	ENSP00000389168:p.Ser332Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZ09|F8VWB4|Q2NKL4|Q569H0|Q86WU3|Q8NFR6|Q9BYH0	Missense_Mutation	SNP	pirsf_Pase-1_reg_su_12A/B/C_euk,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,prints_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.S332F	ENST00000450142.2	37	c.995	CCDS44947.1	12	.	.	.	.	.	.	.	.	.	.	G	16.73	3.204933	0.58234	.	.	ENSG00000058272	ENST00000261207;ENST00000546189;ENST00000360825;ENST00000341878;ENST00000312727;ENST00000450142;ENST00000437004;ENST00000546369;ENST00000550107;ENST00000547330;ENST00000547131	T;T;T;T;T;T;T	0.48201	1.15;1.15;1.18;1.16;1.09;1.11;0.82	5.7	4.8	0.61643	.	0.111229	0.64402	D	0.000005	T	0.64778	0.2629	M	0.65975	2.015	0.50632	D	0.99988	D;P;P;P	0.71674	0.998;0.547;0.514;0.612	P;B;B;B	0.62560	0.904;0.241;0.244;0.172	T	0.69117	-0.5230	10	0.66056	D	0.02	.	15.9602	0.79926	0.0:0.0:0.8639:0.1361	.	332;332;332;332	F8W8Q6;O14974-2;O14974-3;O14974	.;.;.;MYPT1_HUMAN	F	332;332;332;332;332;332;332;245;332;332;27	ENSP00000261207:S332F;ENSP00000389168:S332F;ENSP00000416769:S332F;ENSP00000449514:S245F;ENSP00000446855:S332F;ENSP00000446816:S332F;ENSP00000450061:S27F	ENSP00000261207:S332F	S	-	2	0	PPP1R12A	78738804	1.000000	0.71417	0.983000	0.44433	0.813000	0.45954	9.163000	0.94750	1.358000	0.45922	-0.293000	0.09583	TCC	PPP1R12A	-	pirsf_Pase-1_reg_su_12A/B/C_euk		0.353	PPP1R12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R12A	HGNC	protein_coding	OTTHUMT00000407254.2	G	NM_002480		80214673	-1	no_errors	ENST00000261207	ensembl	human	known	70_37	missense	SNP	0.988	A
PRDX3	10935	genome.wustl.edu	37	10	120928885	120928885	+	Intron	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:120928885C>G	ENST00000298510.2	-	6	594				PRDX3_ENST00000494433.1_5'UTR|PRDX3_ENST00000356951.3_Intron	NM_006793.2	NP_006784.1	P30048	PRDX3_HUMAN	peroxiredoxin 3						cellular response to oxidative stress (GO:0034599)|cellular response to reactive oxygen species (GO:0034614)|hydrogen peroxide catabolic process (GO:0042744)|maternal placenta development (GO:0001893)|mitochondrion organization (GO:0007005)|myeloid cell differentiation (GO:0030099)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of kinase activity (GO:0033673)|peptidyl-cysteine oxidation (GO:0018171)|positive regulation of cell proliferation (GO:0008284)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|regulation of mitochondrial membrane potential (GO:0051881)|response to hydrogen peroxide (GO:0042542)|response to lipopolysaccharide (GO:0032496)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	alkyl hydroperoxide reductase activity (GO:0008785)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|kinase binding (GO:0019900)|protein C-terminus binding (GO:0008022)|protein kinase binding (GO:0019901)|thioredoxin peroxidase activity (GO:0008379)			endometrium(1)|lung(2)	3		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0245)		ATCAGTGCCTCAACAGTACCA	0.393																																					Pancreas(36;562 1096 2447 42526)												0													57.0	45.0	49.0					10																	120928885		2203	4300	6503	SO:0001627	intron_variant	10935			D49396	CCDS7611.1	10q25-q26	2010-11-24			ENSG00000165672	ENSG00000165672			9354	protein-coding gene	gene with protein product		604769	"""antioxidant protein 1"""	AOP1		7733872, 9363753	Standard	NM_006793		Approved	MER5, AOP-1, SP-22	uc001lec.3	P30048	OTTHUMG00000019146	ENST00000298510.2:c.552-31G>C	10.37:g.120928885C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7Z0|D3DRC9|E9PH29|P35690|Q0D2H1|Q13776|Q5T5V2|Q96HK4	RNA	SNP	-	NULL	ENST00000298510.2	37	NULL	CCDS7611.1	10																																																																																			PRDX3	-	-		0.393	PRDX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDX3	HGNC	protein_coding	OTTHUMT00000050639.1	C	NM_006793		120928885	-1	no_errors	ENST00000494433	ensembl	human	known	70_37	rna	SNP	0.000	G
PREX1	57580	genome.wustl.edu	37	20	47274692	47274692	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:47274692C>G	ENST00000371941.3	-	17	1978	c.1956G>C	c.(1954-1956)caG>caC	p.Q652H	PREX1_ENST00000396220.1_Missense_Mutation_p.Q652H	NM_020820.3	NP_065871	Q8TCU6	PREX1_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 1	652	PDZ. {ECO:0000255|PROSITE- ProRule:PRU00143}.				actin filament polymerization (GO:0030041)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|neutrophil activation (GO:0042119)|neutrophil chemotaxis (GO:0030593)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of actin filament polymerization (GO:0030833)|regulation of dendrite development (GO:0050773)|superoxide metabolic process (GO:0006801)|T cell differentiation (GO:0030217)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|growth cone (GO:0030426)|intracellular membrane-bounded organelle (GO:0043231)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	enzyme binding (GO:0019899)|phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(6)|large_intestine(27)|lung(53)|ovary(3)|pancreas(1)|prostate(1)|skin(2)|stomach(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	110			BRCA - Breast invasive adenocarcinoma(12;0.0135)|Colorectal(8;0.198)			GCGAGCCCCTCTGGACGGACT	0.652											OREG0026010	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													280.0	263.0	269.0					20																	47274692		2203	4300	6503	SO:0001583	missense	57580			AB037836	CCDS13410.1	20q13.13	2013-01-10	2008-09-15		ENSG00000124126	ENSG00000124126		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	32594	protein-coding gene	gene with protein product		606905				11955434, 15545267, 16301320	Standard	NM_020820		Approved	KIAA1415, P-REX1	uc002xtw.1	Q8TCU6	OTTHUMG00000032685	ENST00000371941.3:c.1956G>C	20.37:g.47274692C>G	ENSP00000361009:p.Gln652His	Somatic	945	WXS	Illumina HiSeq	Phase_IV	E1P5X9|Q5JS95|Q5JS96|Q69YL2|Q7Z2L9|Q9BQH0|Q9BX55|Q9H4Q6|Q9P2D2|Q9UGQ4	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.Q652H	ENST00000371941.3	37	c.1956	CCDS13410.1	20	.	.	.	.	.	.	.	.	.	.	C	10.39	1.337994	0.24253	.	.	ENSG00000124126	ENST00000371941;ENST00000396220	T;T	0.17528	2.27;2.27	4.98	4.98	0.66077	PDZ/DHR/GLGF (3);	0.341990	0.21930	U	0.067025	T	0.08403	0.0209	N	0.08118	0	0.28367	N	0.92019	B	0.32425	0.371	B	0.28784	0.094	T	0.10177	-1.0641	10	0.87932	D	0	.	8.3996	0.32579	0.0:0.7508:0.1592:0.09	.	652	Q8TCU6	PREX1_HUMAN	H	652	ENSP00000361009:Q652H;ENSP00000379522:Q652H	ENSP00000361009:Q652H	Q	-	3	2	PREX1	46708099	1.000000	0.71417	0.985000	0.45067	0.104000	0.19210	2.210000	0.42816	2.284000	0.76573	0.655000	0.94253	CAG	PREX1	-	superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.652	PREX1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PREX1	HGNC	protein_coding	OTTHUMT00000079623.1	C	NM_020820		47274692	-1	no_errors	ENST00000371941	ensembl	human	known	70_37	missense	SNP	0.998	G
PRMT7	54496	genome.wustl.edu	37	16	68390620	68390620	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:68390620G>A	ENST00000339507.5	+	18	2658	c.1828G>A	c.(1828-1830)Gca>Aca	p.A610T	PRMT7_ENST00000449359.3_Missense_Mutation_p.A560T|PRMT7_ENST00000348497.4_Missense_Mutation_p.A462T|PRMT7_ENST00000441236.1_Missense_Mutation_p.A560T			Q9NVM4	ANM7_HUMAN	protein arginine methyltransferase 7	610	SAM-dependent MTase PRMT-type 2. {ECO:0000255|PROSITE-ProRule:PRU01015}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|histone arginine methylation (GO:0034969)|histone methylation (GO:0016571)|peptidyl-arginine methylation (GO:0018216)|peptidyl-arginine methylation, to asymmetrical-dimethyl arginine (GO:0019919)|peptidyl-arginine methylation, to symmetrical-dimethyl arginine (GO:0019918)|regulation of gene expression by genetic imprinting (GO:0006349)|regulation of protein binding (GO:0043393)|regulation of transcription, DNA-templated (GO:0006355)|spliceosomal snRNP assembly (GO:0000387)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleolus (GO:0005730)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	[myelin basic protein]-arginine N-methyltransferase activity (GO:0016277)|histone binding (GO:0042393)|histone methyltransferase activity (H4-R3 specific) (GO:0044020)|histone-arginine N-methyltransferase activity (GO:0008469)|protein-arginine omega-N asymmetric methyltransferase activity (GO:0035242)|protein-arginine omega-N monomethyltransferase activity (GO:0035241)|protein-arginine omega-N symmetric methyltransferase activity (GO:0035243)|ribonucleoprotein complex binding (GO:0043021)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			endometrium(3)|kidney(2)|large_intestine(3)|lung(10)|pancreas(1)|urinary_tract(1)	20		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0155)|Epithelial(162;0.0629)		GCAGAGCCACGCAGCGGTGCT	0.662																																																	0													29.0	30.0	30.0					16																	68390620		2196	4300	6496	SO:0001583	missense	54496			AK001502	CCDS10866.1, CCDS54033.1	16q22.1	2008-02-05			ENSG00000132600	ENSG00000132600		"""Protein arginine methyltransferases"""	25557	protein-coding gene	gene with protein product		610087				15044439	Standard	NM_001184824		Approved	FLJ10640, KIAA1933	uc002evy.2	Q9NVM4	OTTHUMG00000137556	ENST00000339507.5:c.1828G>A	16.37:g.68390620G>A	ENSP00000343103:p.Ala610Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPR0|B3KUG9|B4E379|Q96PV5|Q9H9L0	Missense_Mutation	SNP	pfam_Ribosomal-L11_MeTrfase_PrmA,pirsf_Arg_MeTrfase_PRMT7	p.A610T	ENST00000339507.5	37	c.1828	CCDS10866.1	16	.	.	.	.	.	.	.	.	.	.	g	15.16	2.750573	0.49257	.	.	ENSG00000132600	ENST00000449359;ENST00000441236;ENST00000348497;ENST00000339507	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	5.93	4.98	0.66077	.	0.043408	0.85682	D	0.000000	T	0.34221	0.0890	L	0.60455	1.87	0.22591	N	0.998951	P;P;P	0.50617	0.6;0.846;0.937	B;B;P	0.48304	0.276;0.151;0.573	T	0.24764	-1.0151	10	0.87932	D	0	-23.6093	13.2923	0.60278	0.0:0.1581:0.8419:0.0	.	560;462;610	Q9NVM4-3;Q9NVM4-2;Q9NVM4	.;.;ANM7_HUMAN	T	560;560;462;610	ENSP00000414716:A560T;ENSP00000409324:A560T;ENSP00000345775:A462T;ENSP00000343103:A610T	ENSP00000343103:A610T	A	+	1	0	PRMT7	66948121	1.000000	0.71417	0.037000	0.18230	0.002000	0.02628	8.190000	0.89714	1.516000	0.48900	0.556000	0.70494	GCA	PRMT7	-	pirsf_Arg_MeTrfase_PRMT7		0.662	PRMT7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRMT7	HGNC	protein_coding	OTTHUMT00000268892.3	G	NM_019023		68390620	+1	no_errors	ENST00000339507	ensembl	human	known	70_37	missense	SNP	0.833	A
PRRC2A	7916	genome.wustl.edu	37	6	31600193	31600193	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:31600193C>T	ENST00000376033.2	+	16	3977	c.3743C>T	c.(3742-3744)gCt>gTt	p.A1248V	PRRC2A_ENST00000376007.4_Missense_Mutation_p.A1248V	NM_004638.3	NP_004629.3	P48634	PRC2A_HUMAN	proline-rich coiled-coil 2A	1248	4 X 57 AA type A repeats.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(6)|central_nervous_system(1)|endometrium(7)|kidney(5)|large_intestine(14)|lung(19)|ovary(3)|pancreas(2)|prostate(4)|skin(5)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	70						CATGGGAGGGCTCAGCAGCAG	0.647																																																	0													74.0	77.0	76.0					6																	31600193		1511	2709	4220	SO:0001583	missense	7916			M31293	CCDS4708.1	6p21.3	2010-12-09	2010-12-09	2010-12-09	ENSG00000204469	ENSG00000204469			13918	protein-coding gene	gene with protein product		142580	"""HLA-B associated transcript 2"""	BAT2		2156268, 8499947	Standard	NM_080686		Approved	G2, D6S51E	uc003nvc.4	P48634	OTTHUMG00000031168	ENST00000376033.2:c.3743C>T	6.37:g.31600193C>T	ENSP00000365201:p.Ala1248Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B0UX77|B0UZE9|B0UZL3|O95875|Q05BK4|Q4LE37|Q5SQ29|Q5SQ30|Q5ST84|Q5STX6|Q5STX7|Q68DW9|Q6P9P7|Q6PIN1|Q8MGQ9|Q96QC6	Missense_Mutation	SNP	pfam_BAT2_N	p.A1248V	ENST00000376033.2	37	c.3743	CCDS4708.1	6	.	.	.	.	.	.	.	.	.	.	C	12.46	1.943978	0.34283	.	.	ENSG00000204469	ENST00000424184;ENST00000435052;ENST00000376007;ENST00000376033;ENST00000376010	T;T	0.01871	4.59;4.59	5.26	5.26	0.73747	.	0.000000	0.56097	D	0.000029	T	0.01320	0.0043	L	0.36672	1.1	0.35627	D	0.809875	P	0.35844	0.524	B	0.28849	0.095	T	0.56786	-0.7921	10	0.87932	D	0	-12.1398	17.8014	0.88589	0.0:1.0:0.0:0.0	.	1248	P48634	PRC2A_HUMAN	V	1242;1231;1248;1248;473	ENSP00000365175:A1248V;ENSP00000365201:A1248V	ENSP00000365175:A1248V	A	+	2	0	PRRC2A	31708172	0.997000	0.39634	1.000000	0.80357	0.992000	0.81027	4.118000	0.57884	2.735000	0.93741	0.655000	0.94253	GCT	PRRC2A	-	NULL		0.647	PRRC2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRC2A	HGNC	protein_coding	OTTHUMT00000259319.1	C	NM_080686		31600193	+1	no_errors	ENST00000376007	ensembl	human	known	70_37	missense	SNP	1.000	T
PRX	57716	genome.wustl.edu	37	19	40904465	40904465	+	Intron	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:40904465C>T	ENST00000324001.7	-	6	652				PRX_ENST00000291825.7_Silent_p.*148*	NM_181882.2	NP_870998.2	Q9BXM0	PRAX_HUMAN	periaxin						axon ensheathment (GO:0008366)|cell death (GO:0008219)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|ovary(2)|prostate(3)|skin(1)|urinary_tract(9)	47			Lung(22;6.24e-05)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GAATGGGGCTCACGGCGCAGA	0.652																																																	0													22.0	28.0	26.0					19																	40904465		2200	4294	6494	SO:0001627	intron_variant	57716			AB046840	CCDS12556.1, CCDS33028.1	19q13.2	2014-09-17				ENSG00000105227			13797	protein-coding gene	gene with protein product		605725				10839370, 9143514	Standard	NM_181882		Approved	KIAA1620	uc002onr.3	Q9BXM0		ENST00000324001.7:c.381+61G>A	19.37:g.40904465C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BXL9|Q9HCF2	Silent	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.*148	ENST00000324001.7	37	c.443	CCDS33028.1	19																																																																																			PRX	-	NULL		0.652	PRX-001	KNOWN	basic|CCDS	protein_coding	PRX	HGNC	protein_coding	OTTHUMT00000462582.1	C	NM_020956		40904465	-1	no_errors	ENST00000291825	ensembl	human	known	70_37	silent	SNP	0.010	T
PSMB6	5694	genome.wustl.edu	37	17	4701366	4701366	+	Silent	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:4701366G>C	ENST00000270586.3	+	5	546	c.495G>C	c.(493-495)ggG>ggC	p.G165G		NM_001270481.1|NM_002798.2	NP_001257410.1|NP_002789.1	P28072	PSB6_HUMAN	proteasome (prosome, macropain) subunit, beta type, 6	165					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome complex (GO:0000502)|proteasome core complex (GO:0005839)	endopeptidase activity (GO:0004175)|threonine-type endopeptidase activity (GO:0004298)			endometrium(3)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11						GAGGCTCCGGGAGCTCCTACA	0.522																																																	0													114.0	100.0	105.0					17																	4701366		2203	4300	6503	SO:0001819	synonymous_variant	5694			BC000835	CCDS11056.1, CCDS73944.1	17p13	2004-02-18			ENSG00000142507	ENSG00000142507		"""Proteasome (prosome, macropain) subunits"""	9543	protein-coding gene	gene with protein product		600307				8066462, 1888762	Standard	NM_002798		Approved	Y, DELTA	uc002fzb.4	P28072	OTTHUMG00000090777	ENST00000270586.3:c.495G>C	17.37:g.4701366G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96J55	Silent	SNP	pfam_Proteasome_sua/b,prints_Pept_T1A_subB	p.G165	ENST00000270586.3	37	c.495	CCDS11056.1	17																																																																																			PSMB6	-	pfam_Proteasome_sua/b,prints_Pept_T1A_subB		0.522	PSMB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSMB6	HGNC	protein_coding	OTTHUMT00000207559.2	G	NM_002798		4701366	+1	no_errors	ENST00000270586	ensembl	human	known	70_37	silent	SNP	1.000	C
PTCHD2	57540	genome.wustl.edu	37	1	11561451	11561451	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:11561451G>A	ENST00000294484.6	+	2	540	c.402G>A	c.(400-402)ggG>ggA	p.G134G	PTCHD2_ENST00000389575.3_Silent_p.G134G	NM_020780.1	NP_065831.1	Q9P2K9	PTHD2_HUMAN	patched domain containing 2	134					cholesterol homeostasis (GO:0042632)|regulation of lipid transport (GO:0032368)|smoothened signaling pathway (GO:0007224)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nuclear membrane (GO:0031965)	hedgehog receptor activity (GO:0008158)			NS(3)|breast(2)|endometrium(9)|kidney(4)|large_intestine(5)|lung(34)|ovary(3)|pancreas(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	76	Ovarian(185;0.249)	Lung NSC(185;4.16e-05)|all_lung(284;4.76e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Hepatocellular(190;0.00913)|Ovarian(437;0.00965)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;3.13e-07)|COAD - Colon adenocarcinoma(227;4.83e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000325)|Kidney(185;0.000877)|KIRC - Kidney renal clear cell carcinoma(229;0.00273)|STAD - Stomach adenocarcinoma(313;0.00766)|READ - Rectum adenocarcinoma(331;0.0549)		GATCCTGGGGGCGGAACCGGC	0.602																																																	0													38.0	40.0	39.0					1																	11561451		2040	4171	6211	SO:0001819	synonymous_variant	57540			AB037758	CCDS41247.1	1p36.22	2010-02-17			ENSG00000204624	ENSG00000204624			29251	protein-coding gene	gene with protein product		611251				15738394	Standard	NM_020780		Approved	KIAA1337, DISP3	uc001ash.4	Q9P2K9	OTTHUMG00000002074	ENST00000294484.6:c.402G>A	1.37:g.11561451G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VTU9|Q9UJD6	Silent	SNP	pfam_Patched,pfam_MMPL-typ,pfscan_SSD	p.G134	ENST00000294484.6	37	c.402	CCDS41247.1	1																																																																																			PTCHD2	-	NULL		0.602	PTCHD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PTCHD2	HGNC	protein_coding	OTTHUMT00000005770.2	G	XM_052561		11561451	+1	no_errors	ENST00000294484	ensembl	human	known	70_37	silent	SNP	0.995	A
PTK2	5747	genome.wustl.edu	37	8	141874446	141874446	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:141874446C>T	ENST00000522684.1	-	5	644	c.415G>A	c.(415-417)Gaa>Aaa	p.E139K	PTK2_ENST00000521059.1_Missense_Mutation_p.E139K|PTK2_ENST00000535192.1_Missense_Mutation_p.E139K|PTK2_ENST00000340930.3_Missense_Mutation_p.E139K|PTK2_ENST00000395218.2_Missense_Mutation_p.E139K|PTK2_ENST00000517887.1_Missense_Mutation_p.E183K|PTK2_ENST00000519419.1_Missense_Mutation_p.E183K	NM_153831.3	NP_722560.1	Q05397	FAK1_HUMAN	protein tyrosine kinase 2	139	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell motility (GO:0048870)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|central nervous system neuron axonogenesis (GO:0021955)|embryo development (GO:0009790)|endothelial cell migration (GO:0043542)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|establishment of nucleus localization (GO:0040023)|extracellular matrix organization (GO:0030198)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|growth hormone receptor signaling pathway (GO:0060396)|heart morphogenesis (GO:0003007)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|microtubule cytoskeleton organization (GO:0000226)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of axonogenesis (GO:0050771)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of organ growth (GO:0046621)|negative regulation of synapse assembly (GO:0051964)|netrin-activated signaling pathway (GO:0038007)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|placenta development (GO:0001890)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|protein autophosphorylation (GO:0046777)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of cytoskeleton organization (GO:0051493)|regulation of endothelial cell migration (GO:0010594)|regulation of focal adhesion assembly (GO:0051893)|regulation of osteoblast differentiation (GO:0045667)|regulation of Rho GTPase activity (GO:0032319)|signal complex assembly (GO:0007172)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)	apical plasma membrane (GO:0016324)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|stress fiber (GO:0001725)	actin binding (GO:0003779)|ATP binding (GO:0005524)|JUN kinase binding (GO:0008432)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein kinase binding (GO:0019901)|SH2 domain binding (GO:0042169)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(6)|lung(23)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	48	all_cancers(97;1.05e-15)|all_epithelial(106;2.09e-14)|Lung NSC(106;1.61e-06)|all_lung(105;2.5e-06)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)	Ovarian(118;2.72e-05)|Breast(495;0.159)	BRCA - Breast invasive adenocarcinoma(115;0.137)			GGCTTATCTTCAGTAAACTGG	0.274																																																	0													73.0	81.0	78.0					8																	141874446		2199	4293	6492	SO:0001583	missense	5747			L13616	CCDS6381.1, CCDS56557.1	8q24.3	2013-02-18	2013-02-18		ENSG00000169398	ENSG00000169398	2.7.10.1	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9611	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 71"""	600758	"""PTK2 protein tyrosine kinase 2"""			8422239	Standard	NM_153831		Approved	FAK, FADK, FAK1, PPP1R71	uc003yvt.3	Q05397	OTTHUMG00000067438	ENST00000522684.1:c.415G>A	8.37:g.141874446C>T	ENSP00000429911:p.Glu139Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E2N6|F5H4S4|Q14291|Q9UD85	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Focal_adhesion_kin_target_dom,pfam_Prot_kinase_cat_dom,pfam_FERM_central,superfamily_Kinase-like_dom,superfamily_Focal_adhesion_kin_target_dom,superfamily_FERM_central,smart_Band_41_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E139K	ENST00000522684.1	37	c.415	CCDS6381.1	8	.	.	.	.	.	.	.	.	.	.	C	14.60	2.584399	0.46110	.	.	ENSG00000169398	ENST00000522684;ENST00000535192;ENST00000517887;ENST00000521059;ENST00000395214;ENST00000395218;ENST00000354438;ENST00000340930;ENST00000519419;ENST00000520828;ENST00000520475	T;T;T;T;T;T;T;T;T	0.41758	0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99;0.99	5.27	5.27	0.74061	Band 4.1 domain (1);FERM central domain (2);FERM domain (1);FERM/acyl-CoA-binding protein, 3-helical bundle (1);	0.000000	0.85682	D	0.000000	T	0.30293	0.0760	N	0.17922	0.545	0.80722	D	1	B;B;B;B;B;B	0.26120	0.032;0.001;0.142;0.002;0.015;0.002	B;B;B;B;B;B	0.25614	0.024;0.004;0.062;0.017;0.015;0.012	T	0.07481	-1.0770	10	0.18276	T	0.48	.	17.6794	0.88238	0.0:1.0:0.0:0.0	.	139;46;139;161;139;50	B4E2N6;Q59GN8;Q05397;Q658W2;Q8IYN9;Q59GM6	.;.;FAK1_HUMAN;.;.;.	K	139;139;183;139;49;139;46;139;183;38;139	ENSP00000429911:E139K;ENSP00000438009:E139K;ENSP00000429082:E183K;ENSP00000429474:E139K;ENSP00000378644:E139K;ENSP00000341189:E139K;ENSP00000429129:E183K;ENSP00000427762:E38K;ENSP00000428792:E139K	ENSP00000341189:E139K	E	-	1	0	PTK2	141943628	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.187000	0.58344	2.475000	0.83589	0.313000	0.20887	GAA	PTK2	-	pfam_FERM_central,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain		0.274	PTK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK2	HGNC	protein_coding	OTTHUMT00000378054.5	C	NM_005607		141874446	-1	no_errors	ENST00000395218	ensembl	human	known	70_37	missense	SNP	1.000	T
PTPN2	5771	genome.wustl.edu	37	18	12830990	12830990	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:12830990C>G	ENST00000309660.5	-	4	405	c.312G>C	c.(310-312)caG>caC	p.Q104H	PTPN2_ENST00000591115.1_Missense_Mutation_p.Q104H|PTPN2_ENST00000353319.4_Missense_Mutation_p.Q104H|PTPN2_ENST00000591497.1_Missense_Mutation_p.Q75H|PTPN2_ENST00000327283.3_Missense_Mutation_p.Q104H	NM_002828.3	NP_002819.2	P17706	PTN2_HUMAN	protein tyrosine phosphatase, non-receptor type 2	104	Tyrosine-protein phosphatase. {ECO:0000255|PROSITE-ProRule:PRU00160}.				B cell differentiation (GO:0030183)|cytokine-mediated signaling pathway (GO:0019221)|erythrocyte differentiation (GO:0030218)|glucose homeostasis (GO:0042593)|insulin receptor signaling pathway (GO:0008286)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemotaxis (GO:0050922)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of inflammatory response (GO:0050728)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of interleukin-2-mediated signaling pathway (GO:1902206)|negative regulation of interleukin-4-mediated signaling pathway (GO:1902215)|negative regulation of interleukin-6-mediated signaling pathway (GO:0070104)|negative regulation of lipid storage (GO:0010888)|negative regulation of macrophage colony-stimulating factor signaling pathway (GO:1902227)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of positive thymic T cell selection (GO:1902233)|negative regulation of prolactin signaling pathway (GO:1902212)|negative regulation of T cell receptor signaling pathway (GO:0050860)|negative regulation of tumor necrosis factor-mediated signaling pathway (GO:0010804)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|negative regulation of tyrosine phosphorylation of Stat1 protein (GO:0042512)|negative regulation of tyrosine phosphorylation of Stat3 protein (GO:0042518)|negative regulation of tyrosine phosphorylation of Stat5 protein (GO:0042524)|negative regulation of tyrosine phosphorylation of Stat6 protein (GO:0042527)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of gluconeogenesis (GO:0045722)|regulation of hepatocyte growth factor receptor signaling pathway (GO:1902202)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|T cell differentiation (GO:0030217)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	integrin binding (GO:0005178)|protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|receptor tyrosine kinase binding (GO:0030971)|syntaxin binding (GO:0019905)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|prostate(1)|skin(3)	13		Lung NSC(161;8.94e-06)				CTTTGGTCTTCTGCTGCCAAA	0.433																																																	0													67.0	62.0	63.0					18																	12830990		2203	4300	6503	SO:0001583	missense	5771			M25393	CCDS11863.1, CCDS11864.1, CCDS11865.1, CCDS59306.1	18p11.3-p11.2	2011-06-09			ENSG00000175354	ENSG00000175354		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9650	protein-coding gene	gene with protein product		176887		PTPT		2164224	Standard	NM_002828		Approved	TCELLPTP, TC-PTP, TCPTP	uc002krp.3	P17706	OTTHUMG00000131702	ENST00000309660.5:c.312G>C	18.37:g.12830990C>G	ENSP00000311857:p.Gln104His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K955|A8MXU3|K7ENG3|Q96AU5|Q96HR2	Missense_Mutation	SNP	pirsf_Tyr_Pase_non-rcpt_typ-1/2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.Q104H	ENST00000309660.5	37	c.312	CCDS11865.1	18	.	.	.	.	.	.	.	.	.	.	C	17.64	3.438781	0.62955	.	.	ENSG00000175354	ENST00000327283;ENST00000353319;ENST00000341361;ENST00000309660	D;D;D	0.84442	-1.85;-1.85;-1.85	5.39	2.86	0.33363	Protein-tyrosine phosphatase, receptor/non-receptor type (3);	0.000000	0.50627	D	0.000106	D	0.90017	0.6883	M	0.71581	2.175	0.50632	D	0.999889	D;D;D;D;D	0.89917	0.999;0.996;0.997;1.0;0.997	D;P;D;D;D	0.97110	0.979;0.894;0.976;1.0;0.936	D	0.88278	0.2934	10	0.87932	D	0	.	8.7948	0.34872	0.0:0.1715:0.0:0.8285	.	104;104;81;104;104	P17706;P17706-2;Q59F91;Q96AU5;A8K3N4	PTN2_HUMAN;.;.;.;.	H	104;104;81;104	ENSP00000320298:Q104H;ENSP00000320546:Q104H;ENSP00000311857:Q104H	ENSP00000311857:Q104H	Q	-	3	2	PTPN2	12820990	0.998000	0.40836	1.000000	0.80357	0.992000	0.81027	0.556000	0.23438	0.281000	0.22233	-0.345000	0.07892	CAG	PTPN2	-	pirsf_Tyr_Pase_non-rcpt_typ-1/2,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_rcpt/non-rcpt,pfscan_Tyr_Pase_rcpt/non-rcpt		0.433	PTPN2-002	KNOWN	basic|CCDS	protein_coding	PTPN2	HGNC	protein_coding	OTTHUMT00000254613.3	C	NM_002828, NM_080422, NM_080423		12830990	-1	no_errors	ENST00000309660	ensembl	human	known	70_37	missense	SNP	1.000	G
PTPN4	5775	genome.wustl.edu	37	2	120658344	120658344	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:120658344G>A	ENST00000263708.2	+	10	1497	c.726G>A	c.(724-726)ctG>ctA	p.L242L		NM_002830.3	NP_002821.1	P29074	PTN4_HUMAN	protein tyrosine phosphatase, non-receptor type 4 (megakaryocyte)	242	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)	non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)			endometrium(3)|kidney(2)|large_intestine(7)|lung(15)|ovary(2)|urinary_tract(1)	30					Alendronate(DB00630)	GAGGAATTCTGATTTATAAGA	0.274																																																	0													90.0	97.0	95.0					2																	120658344		2203	4277	6480	SO:0001819	synonymous_variant	5775				CCDS2129.1	2q14.2	2011-06-09			ENSG00000088179	ENSG00000088179		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Non-receptor"""	9656	protein-coding gene	gene with protein product		176878				1648233	Standard	NM_002830		Approved	PTPMEG	uc002tmf.2	P29074	OTTHUMG00000131436	ENST00000263708.2:c.726G>A	2.37:g.120658344G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBV8|Q9UDA7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,pfam_PDZ,pfam_FERM-adjacent,superfamily_FERM_central,superfamily_PDZ,smart_Band_41_domain,smart_PDZ,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,pirsf_Tyr_Pase_non-rcpt_typ-3/4,prints_Tyr_Pase_rcpt/non-rcpt,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain,pfscan_PDZ,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt	p.L242	ENST00000263708.2	37	c.726	CCDS2129.1	2																																																																																			PTPN4	-	pfam_FERM_PH-like_C,pirsf_Tyr_Pase_non-rcpt_typ-3/4,prints_Ez/rad/moesin,pfscan_FERM_domain		0.274	PTPN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTPN4	HGNC	protein_coding	OTTHUMT00000254233.2	G			120658344	+1	no_errors	ENST00000263708	ensembl	human	known	70_37	silent	SNP	1.000	A
PUM1	9698	genome.wustl.edu	37	1	31409541	31409541	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:31409541C>G	ENST00000257075.5	-	21	3471	c.3378G>C	c.(3376-3378)caG>caC	p.Q1126H	PUM1_ENST00000373742.2_Missense_Mutation_p.Q1067H|PUM1_ENST00000423018.2_Missense_Mutation_p.Q984H|PUM1_ENST00000440538.2_Missense_Mutation_p.Q1102H|PUM1_ENST00000426105.2_Missense_Mutation_p.Q1128H|PUM1_ENST00000424085.2_Missense_Mutation_p.Q884H|SNORD103A_ENST00000363284.1_RNA|PUM1_ENST00000373747.3_Missense_Mutation_p.Q1129H|PUM1_ENST00000373741.4_Missense_Mutation_p.Q1164H	NM_014676.2	NP_055491.1	Q14671	PUM1_HUMAN	pumilio RNA-binding family member 1	1126	PUM-HD. {ECO:0000255|PROSITE- ProRule:PRU00318}.				membrane organization (GO:0061024)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of translation (GO:0006417)	cytosol (GO:0005829)	poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(4)|large_intestine(8)|lung(17)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	48		Colorectal(325;0.0211)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0381)|Breast(348;0.0848)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0232)|READ - Rectum adenocarcinoma(331;0.0681)		CAATCATCTTCTGGACCACGT	0.572																																																	0													120.0	90.0	100.0					1																	31409541		2203	4300	6503	SO:0001583	missense	9698			AF315592	CCDS338.1, CCDS44099.1	1p35.2	2013-09-02	2013-09-02		ENSG00000134644	ENSG00000134644			14957	protein-coding gene	gene with protein product		607204	"""pumilio (Drosophila) homolog 1"", ""pumilio homolog 1 (Drosophila)"""				Standard	NM_001020658		Approved	PUMH1, KIAA0099	uc001bsh.1	Q14671	OTTHUMG00000003795	ENST00000257075.5:c.3378G>C	1.37:g.31409541C>G	ENSP00000257075:p.Gln1126His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6W4|B4DG92|D3DPN3|E9PCJ0|Q53HH5|Q5VXY7|Q9HAN1	Missense_Mutation	SNP	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt	p.Q1128H	ENST00000257075.5	37	c.3384	CCDS338.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	23.8|23.8	4.463355|4.463355	0.84425|0.84425	.|.	.|.	ENSG00000134644|ENSG00000134644	ENST00000525843;ENST00000498419|ENST00000424085;ENST00000257075;ENST00000373747;ENST00000373749;ENST00000426105;ENST00000440538;ENST00000373741;ENST00000423018;ENST00000373742	.|T;T;T;T;T;T;T;T	.|0.18960	.|2.18;2.18;2.18;2.18;2.18;2.18;2.18;2.18	5.77|5.77	4.84|4.84	0.62591|0.62591	.|Armadillo-like helical (1);Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.63248|0.63248	0.2495|0.2495	H|H	0.97758|0.97758	4.07|4.07	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.997;1.0;1.0;0.992;1.0;1.0	.|D;D;D;D;D;D;D;D	.|0.97110	.|1.0;0.995;0.992;0.995;1.0;0.92;1.0;1.0	T|T	0.79325|0.79325	-0.1850|-0.1850	5|10	.|0.87932	.|D	.|0	-4.9177|-4.9177	16.7493|16.7493	0.85481|0.85481	0.0:0.8708:0.1292:0.0|0.0:0.8708:0.1292:0.0	.|.	.|1067;984;1164;1102;1126;1128;1129;1128	.|B4DG92;E7EWT3;Q5T1Z8;Q14671-2;Q14671;E9PCJ0;Q5T1Z4;Q53HH5	.|.;.;.;.;PUM1_HUMAN;.;.;.	Q|H	1065;840|884;1126;1129;866;1128;1102;1164;984;1067	.|ENSP00000400141:Q884H;ENSP00000257075:Q1126H;ENSP00000362852:Q1129H;ENSP00000391723:Q1128H;ENSP00000401777:Q1102H;ENSP00000362846:Q1164H;ENSP00000399440:Q984H;ENSP00000362847:Q1067H	.|ENSP00000257075:Q1126H	E|Q	-|-	1|3	0|2	PUM1|PUM1	31182128|31182128	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.995000|0.995000	0.86356|0.86356	7.818000|7.818000	0.86416|0.86416	1.404000|1.404000	0.46819|0.46819	0.557000|0.557000	0.71058|0.71058	GAA|CAG	PUM1	-	pfam_Pumilio_RNA-bd_rpt,superfamily_ARM-type_fold,smart_Pumilio_RNA-bd_rpt,pfscan_Pumilio_RNA-bd_rpt		0.572	PUM1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PUM1	HGNC	protein_coding	OTTHUMT00000010671.1	C			31409541	-1	no_errors	ENST00000426105	ensembl	human	known	70_37	missense	SNP	1.000	G
RAB3GAP2	25782	genome.wustl.edu	37	1	220363455	220363455	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:220363455G>A	ENST00000358951.2	-	16	1781	c.1665C>T	c.(1663-1665)caC>caT	p.H555H		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	555					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		TCTTCACTAGGTGCATATCCT	0.308																																																	0													124.0	122.0	122.0					1																	220363455		2203	4300	6503	SO:0001819	synonymous_variant	25782			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.1665C>T	1.37:g.220363455G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Silent	SNP	superfamily_WD40_repeat_dom	p.H555	ENST00000358951.2	37	c.1665	CCDS31028.1	1																																																																																			RAB3GAP2	-	NULL		0.308	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	G	NM_012414		220363455	-1	no_errors	ENST00000358951	ensembl	human	known	70_37	silent	SNP	1.000	A
RAB3GAP2	25782	genome.wustl.edu	37	1	220369645	220369645	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:220369645G>C	ENST00000358951.2	-	10	1023	c.907C>G	c.(907-909)Cag>Gag	p.Q303E		NM_012414.3	NP_036546.2	Q9H2M9	RBGPR_HUMAN	RAB3 GTPase activating protein subunit 2 (non-catalytic)	303					establishment of protein localization to endoplasmic reticulum membrane (GO:0097051)|intracellular protein transport (GO:0006886)|positive regulation of catalytic activity (GO:0043085)|positive regulation of endoplasmic reticulum tubular network organization (GO:1903373)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rab GTPase activity (GO:0032851)|regulation of GTPase activity (GO:0043087)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	enzyme activator activity (GO:0008047)|enzyme regulator activity (GO:0030234)|GTPase activator activity (GO:0005096)|protein heterodimerization activity (GO:0046982)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(13)|ovary(1)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(1)	39				GBM - Glioblastoma multiforme(131;0.0443)		GTGATATACTGAGACATGGCA	0.383																																																	0													119.0	118.0	118.0					1																	220369645		2203	4300	6503	SO:0001583	missense	25782			AB020646	CCDS31028.1	1q41	2014-03-03			ENSG00000118873	ENSG00000118873			17168	protein-coding gene	gene with protein product		609275				15696165, 16532399, 24482476	Standard	NM_012414		Approved	RAB3-GAP150, KIAA0839, DKFZP434D245, SPG69	uc010puk.1	Q9H2M9	OTTHUMG00000037139	ENST00000358951.2:c.907C>G	1.37:g.220369645G>C	ENSP00000351832:p.Gln303Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8V0|O75872|Q9HAB0|Q9UFJ7|Q9UQ15	Missense_Mutation	SNP	superfamily_WD40_repeat_dom	p.Q303E	ENST00000358951.2	37	c.907	CCDS31028.1	1	.	.	.	.	.	.	.	.	.	.	G	29.2	4.988941	0.93106	.	.	ENSG00000118873	ENST00000358951	T	0.31769	1.48	5.65	5.65	0.86999	.	0.161178	0.56097	D	0.000028	T	0.37210	0.0995	L	0.44542	1.39	0.80722	D	1	D	0.53619	0.961	P	0.53224	0.721	T	0.06409	-1.0828	10	0.02654	T	1	.	19.7233	0.96151	0.0:0.0:1.0:0.0	.	303	Q9H2M9	RBGPR_HUMAN	E	303	ENSP00000351832:Q303E	ENSP00000351832:Q303E	Q	-	1	0	RAB3GAP2	218436268	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	9.326000	0.96389	2.658000	0.90341	0.462000	0.41574	CAG	RAB3GAP2	-	NULL		0.383	RAB3GAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB3GAP2	HGNC	protein_coding	OTTHUMT00000090205.2	G	NM_012414		220369645	-1	no_errors	ENST00000358951	ensembl	human	known	70_37	missense	SNP	1.000	C
RASSF1	11186	genome.wustl.edu	37	3	50369054	50369054	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:50369054C>G	ENST00000357043.2	-	4	743	c.708G>C	c.(706-708)aaG>aaC	p.K236N	RASSF1_ENST00000359365.4_Missense_Mutation_p.K232N|RASSF1_ENST00000395126.3_Missense_Mutation_p.K81N|RASSF1_ENST00000327761.3_Missense_Mutation_p.K162N					Ras association (RalGDS/AF-6) domain family member 1											lung(2)|ovary(1)|skin(1)|urinary_tract(1)	5				BRCA - Breast invasive adenocarcinoma(193;0.000278)|OV - Ovarian serous cystadenocarcinoma(275;0.0015)|KIRC - Kidney renal clear cell carcinoma(197;0.00551)|Kidney(197;0.00621)		CCACCAAGAACTTTCGCAGCA	0.602																																																	0													79.0	86.0	84.0					3																	50369054		2203	4300	6503	SO:0001583	missense	11186			AF132675	CCDS2820.1, CCDS2821.1, CCDS2822.1, CCDS43096.1	3p21.3	2008-02-22	2008-02-22		ENSG00000068028	ENSG00000068028			9882	protein-coding gene	gene with protein product		605082					Standard	NM_170713		Approved	NORE2A, REH3P21, RDA32, 123F2	uc003dad.1	Q9NS23	OTTHUMG00000149958	ENST00000357043.2:c.708G>C	3.37:g.50369054C>G	ENSP00000349547:p.Lys236Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Prot_Kinase_C-like_PE/DAG-bd,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ras-assoc,pfscan_Ras-assoc,pfscan_SARAH,pfscan_Prot_Kinase_C-like_PE/DAG-bd	p.K236N	ENST00000357043.2	37	c.708	CCDS2820.1	3	.	.	.	.	.	.	.	.	.	.	C	18.50	3.636844	0.67130	.	.	ENSG00000068028	ENST00000327761;ENST00000395126;ENST00000357043;ENST00000359365	T;T;T;T	0.31769	1.48;1.48;1.48;1.48	5.47	0.333	0.15943	Ras-association (3);	0.000000	0.85682	D	0.000000	T	0.57519	0.2059	M	0.90198	3.095	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.997;1.0	T	0.62661	-0.6807	10	0.87932	D	0	-29.9348	10.5924	0.45316	0.0:0.6168:0.0:0.3832	.	232;236;162	Q9NS23-2;Q9NS23;Q5TZT2	.;RASF1_HUMAN;.	N	162;81;236;232	ENSP00000333327:K162N;ENSP00000378558:K81N;ENSP00000349547:K236N;ENSP00000352323:K232N	ENSP00000333327:K162N	K	-	3	2	RASSF1	50344058	0.979000	0.34478	0.999000	0.59377	0.983000	0.72400	0.273000	0.18662	0.111000	0.17947	0.462000	0.41574	AAG	RASSF1	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc		0.602	RASSF1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RASSF1	HGNC	protein_coding	OTTHUMT00000314304.1	C			50369054	-1	no_errors	ENST00000357043	ensembl	human	known	70_37	missense	SNP	1.000	G
RBFOX2	23543	genome.wustl.edu	37	22	36155971	36155971	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:36155971C>T	ENST00000438146.2	-	10	1072	c.1073G>A	c.(1072-1074)cGa>cAa	p.R358Q	RBFOX2_ENST00000405409.2_Missense_Mutation_p.R284Q|RBFOX2_ENST00000262829.7_Missense_Mutation_p.R265Q|RBFOX2_ENST00000449924.2_Missense_Mutation_p.R287Q|RBFOX2_ENST00000359369.4_Missense_Mutation_p.R263Q|RBFOX2_ENST00000397303.2_Missense_Mutation_p.R264Q|RBFOX2_ENST00000416721.2_Missense_Mutation_p.R283Q|RBFOX2_ENST00000414461.2_Missense_Mutation_p.R287Q	NM_001082578.1|NM_001082579.1	NP_001076047|NP_001076048.1	O43251	RFOX2_HUMAN	RNA binding protein, fox-1 homolog (C. elegans) 2	297	Ala-rich.				dendrite morphogenesis (GO:0048813)|intracellular estrogen receptor signaling pathway (GO:0030520)|mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|neuromuscular process controlling balance (GO:0050885)|radial glia guided migration of Purkinje cell (GO:0021942)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of cell proliferation (GO:0042127)|regulation of definitive erythrocyte differentiation (GO:0010724)|RNA metabolic process (GO:0016070)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|transcription corepressor activity (GO:0003714)|transcription factor binding (GO:0008134)			endometrium(4)|large_intestine(7)|lung(7)	18						AGGTACCGCTCGGACTGCACC	0.517																																																	0													78.0	76.0	77.0					22																	36155971		2203	4300	6503	SO:0001583	missense	23543			AL009266	CCDS13921.1, CCDS43013.1, CCDS46699.1, CCDS46700.1, CCDS46701.1	22q12-q13	2013-02-12	2010-09-10	2010-09-10	ENSG00000100320	ENSG00000100320		"""RNA binding motif (RRM) containing"""	9906	protein-coding gene	gene with protein product	"""hexaribonucleotide binding protein 2"""	612149	"""RNA binding motif protein 9"""	RBM9			Standard	NM_014309		Approved	HNRBP2, FOX-2, HRNBP2	uc003aon.4	O43251	OTTHUMG00000150585	ENST00000438146.2:c.1073G>A	22.37:g.36155971C>T	ENSP00000413035:p.Arg358Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A4F5G8|A8K5Z5|B0QYY8|B0QYY9|Q0PRL5|Q0VH35|Q5TF71|Q6IC09|Q8TD00|Q8WYB1|Q96DZ6|Q96NL7|Q9UGW4|Q9UH33	Missense_Mutation	SNP	pfam_Fox-1_C_dom,pfam_RRM_dom,smart_RRM_dom,pirsf_RNA-bd_Fox-1,pfscan_RRM_dom	p.R358Q	ENST00000438146.2	37	c.1073	CCDS43013.1	22	.	.	.	.	.	.	.	.	.	.	C	29.9	5.047516	0.93740	.	.	ENSG00000100320	ENST00000405409;ENST00000338644;ENST00000414461;ENST00000449924;ENST00000262829;ENST00000397303;ENST00000359369;ENST00000416721;ENST00000438146	T;T;T;T;T;T;T	0.55413	1.24;0.96;0.55;0.9;1.22;0.89;0.52	5.48	5.48	0.80851	.	0.000000	0.85682	D	0.000000	T	0.72763	0.3501	M	0.68952	2.095	0.51482	D	0.999921	D;D;D;D;D;D;D;D;D	0.89917	1.0;0.999;1.0;0.998;0.999;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D	0.83275	0.996;0.99;0.996;0.986;0.99;0.983;0.959;0.983;0.966	T	0.74982	-0.3478	10	0.87932	D	0	.	19.3581	0.94422	0.0:1.0:0.0:0.0	.	263;357;358;265;283;284;287;287;264	B0QYY4;O43251-6;O43251-8;O43251-3;O43251-5;O43251-9;O43251-10;O43251-4;B0QYV1	.;.;.;.;.;.;.;.;.	Q	284;293;287;287;265;264;263;283;358	ENSP00000384944:R284Q;ENSP00000407855:R287Q;ENSP00000391670:R287Q;ENSP00000380470:R264Q;ENSP00000352328:R263Q;ENSP00000405651:R283Q;ENSP00000413035:R358Q	ENSP00000262829:R265Q	R	-	2	0	RBFOX2	34485917	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.594000	0.82698	2.581000	0.87130	0.563000	0.77884	CGA	RBFOX2	-	pfam_Fox-1_C_dom,pirsf_RNA-bd_Fox-1		0.517	RBFOX2-005	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	RBFOX2	HGNC	protein_coding	OTTHUMT00000319299.3	C			36155971	-1	no_errors	ENST00000438146	ensembl	human	known	70_37	missense	SNP	1.000	T
RCAN3	11123	genome.wustl.edu	37	1	24857861	24857861	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:24857861C>G	ENST00000374395.4	+	3	662	c.349C>G	c.(349-351)Cta>Gta	p.L117V	RN7SL857P_ENST00000580228.1_RNA|RCAN3_ENST00000436717.2_Missense_Mutation_p.L117V|RCAN3_ENST00000538532.1_Intron|RCAN3_ENST00000412742.2_Missense_Mutation_p.L117V|RCAN3_ENST00000374393.2_Intron	NM_001251978.1|NM_001251979.1|NM_001251984.1	NP_001238907.1|NP_001238908.1|NP_001238913.1	Q9UKA8	RCAN3_HUMAN	RCAN family member 3	117					anatomical structure morphogenesis (GO:0009653)|calcium-mediated signaling (GO:0019722)		RNA binding (GO:0003723)|troponin I binding (GO:0031013)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(2)	7		Colorectal(325;3.46e-05)|Renal(390;0.0007)|Lung NSC(340;0.000946)|all_lung(284;0.00125)|Ovarian(437;0.00473)|Breast(348;0.0148)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.19)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0427)|OV - Ovarian serous cystadenocarcinoma(117;1.13e-24)|Colorectal(126;6.09e-08)|COAD - Colon adenocarcinoma(152;3.33e-06)|GBM - Glioblastoma multiforme(114;0.000923)|BRCA - Breast invasive adenocarcinoma(304;0.0018)|KIRC - Kidney renal clear cell carcinoma(1967;0.00359)|STAD - Stomach adenocarcinoma(196;0.00493)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.14)		TGGGCAGAAGCTAAAGCTATA	0.383																																																	0													52.0	54.0	53.0					1																	24857861		2203	4300	6503	SO:0001583	missense	11123				CCDS254.1, CCDS57980.1, CCDS57981.1, CCDS57982.1, CCDS72730.1	1p35.3-p33	2008-02-05	2007-06-26	2007-06-26	ENSG00000117602	ENSG00000117602			3042	protein-coding gene	gene with protein product		605860	"""Down syndrome critical region gene 1-like 2"""	DSCR1L2		10756093	Standard	NM_001251984		Approved		uc001bjj.3	Q9UKA8	OTTHUMG00000003298	ENST00000374395.4:c.349C>G	1.37:g.24857861C>G	ENSP00000363516:p.Leu117Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A4GU14|A4LA69|E3VWE2|E5L4P0|E5L4P7|E7ENV1|E7EWD8|G1FI66|G1FLF0|Q5ECL3|Q5TGC6|Q9NUC8|Q9UKA7	Missense_Mutation	SNP	pfam_Calcipressin	p.L117V	ENST00000374395.4	37	c.349	CCDS254.1	1	.	.	.	.	.	.	.	.	.	.	C	20.5	3.999540	0.74818	.	.	ENSG00000117602	ENST00000374395;ENST00000436717;ENST00000412742	T;T	0.50277	0.75;0.84	5.84	4.93	0.64822	Nucleotide-binding, alpha-beta plait (1);	0.073338	0.64402	D	0.000019	T	0.65647	0.2711	M	0.75447	2.3	0.80722	D	1	P;D;D	0.76494	0.711;0.998;0.999	P;D;D	0.91635	0.451;0.999;0.999	T	0.65257	-0.6212	10	0.35671	T	0.21	-26.7191	11.2097	0.48790	0.0:0.8598:0.0:0.1402	.	117;117;117	E7ENV1;Q9UKA8-2;Q9UKA8	.;.;RCAN3_HUMAN	V	117	ENSP00000363516:L117V;ENSP00000414447:L117V	ENSP00000363516:L117V	L	+	1	2	RCAN3	24730448	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.468000	0.60162	1.461000	0.47929	0.650000	0.86243	CTA	RCAN3	-	pfam_Calcipressin		0.383	RCAN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RCAN3	HGNC	protein_coding	OTTHUMT00000009176.2	C			24857861	+1	no_errors	ENST00000374395	ensembl	human	known	70_37	missense	SNP	1.000	G
RFC2	5982	genome.wustl.edu	37	7	73646450	73646450	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:73646450G>C	ENST00000055077.3	-	11	1111	c.1051C>G	c.(1051-1053)Ccg>Gcg	p.P351A	RFC2_ENST00000352131.3_Missense_Mutation_p.P317A	NM_181471.1	NP_852136.1	P35250	RFC2_HUMAN	replication factor C (activator 1) 2, 40kDa	351					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)|nucleotide-excision repair (GO:0006289)|nucleotide-excision repair, DNA gap filling (GO:0006297)|telomere maintenance (GO:0000723)|telomere maintenance via recombination (GO:0000722)|telomere maintenance via semi-conservative replication (GO:0032201)|transcription-coupled nucleotide-excision repair (GO:0006283)	DNA replication factor C complex (GO:0005663)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|liver(1)|lung(3)	8						CTGGCCACCGGGGCCATTGTC	0.522																																																	0													107.0	105.0	105.0					7																	73646450		2203	4300	6503	SO:0001583	missense	5982				CCDS5567.1, CCDS5568.1, CCDS75618.1	7q11.23	2010-04-21	2002-08-29		ENSG00000049541	ENSG00000049541		"""ATPases / AAA-type"""	9970	protein-coding gene	gene with protein product	"""activator 1"""	600404	"""replication factor C (activator 1) 2 (40kD)"""			1313560, 7774928	Standard	NM_181471		Approved	A1, RFC40	uc003uaj.3	P35250	OTTHUMG00000023239	ENST00000055077.3:c.1051C>G	7.37:g.73646450G>C	ENSP00000055077:p.Pro351Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU07|D3DXG3|P32846|Q9BU93	Missense_Mutation	SNP	pfam_Rep_factorC_C_dom,pfam_ATPase_AAA_core,pfam_Helicase_domain_viral-like,superfamily_DNA_pol3_clamp-load_cplx_C,smart_AAA+_ATPase	p.P351A	ENST00000055077.3	37	c.1051	CCDS5568.1	7	.	.	.	.	.	.	.	.	.	.	G	16.84	3.235233	0.58886	.	.	ENSG00000049541	ENST00000352131;ENST00000055077	T;T	0.16196	2.36;2.63	5.22	5.22	0.72569	.	0.167402	0.53938	D	0.000049	T	0.15739	0.0379	L	0.32530	0.975	0.80722	D	1	B;B;B	0.19583	0.037;0.022;0.012	B;B;B	0.22386	0.039;0.018;0.012	T	0.03739	-1.1008	10	0.33940	T	0.23	-14.3029	15.8666	0.79069	0.0:0.0:1.0:0.0	.	317;317;351	P35250-2;Q75MT5;P35250	.;.;RFC2_HUMAN	A	317;351	ENSP00000275627:P317A;ENSP00000055077:P351A	ENSP00000055077:P351A	P	-	1	0	RFC2	73284386	1.000000	0.71417	0.933000	0.37362	0.929000	0.56500	6.848000	0.75409	2.610000	0.88304	0.650000	0.86243	CCG	RFC2	-	NULL		0.522	RFC2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RFC2	HGNC	protein_coding	OTTHUMT00000252459.2	G	NM_181471		73646450	-1	no_errors	ENST00000055077	ensembl	human	known	70_37	missense	SNP	1.000	C
RFX1	5989	genome.wustl.edu	37	19	14073987	14073987	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:14073987C>T	ENST00000254325.4	-	19	2905	c.2671G>A	c.(2671-2673)Gag>Aag	p.E891K		NM_002918.4	NP_002909.4	P22670	RFX1_HUMAN	regulatory factor X, 1 (influences HLA class II expression)	891	Necessary for dimerization.				immune response (GO:0006955)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	21			OV - Ovarian serous cystadenocarcinoma(19;6.67e-23)			ACGCGGTGCTCGATCAGGTAG	0.706																																																	0													65.0	58.0	60.0					19																	14073987		2203	4300	6503	SO:0001583	missense	5989				CCDS12301.1	19p13.1	2008-07-17				ENSG00000132005			9982	protein-coding gene	gene with protein product	"""trans-acting regulatory factor 1"", ""enhancer factor C"", ""MHC class II regulatory factor RFX"""	600006				1505960, 8289803	Standard	NM_002918		Approved	EF-C	uc002mxv.3	P22670		ENST00000254325.4:c.2671G>A	19.37:g.14073987C>T	ENSP00000254325:p.Glu891Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_RFX1_trans_act,pfam_DNA-bd_RFX	p.E891K	ENST00000254325.4	37	c.2671	CCDS12301.1	19	.	.	.	.	.	.	.	.	.	.	c	36	5.696963	0.96802	.	.	ENSG00000132005	ENST00000254325	T	0.48836	0.8	5.03	5.03	0.67393	.	0.000000	0.85682	D	0.000000	T	0.75206	0.3818	M	0.91612	3.225	0.80722	D	1	D	0.89917	1.0	D	0.74348	0.983	T	0.81883	-0.0728	10	0.72032	D	0.01	-27.9178	17.1643	0.86811	0.0:1.0:0.0:0.0	.	891	P22670	RFX1_HUMAN	K	891	ENSP00000254325:E891K	ENSP00000254325:E891K	E	-	1	0	RFX1	13934987	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	7.667000	0.83888	2.360000	0.80028	0.430000	0.28490	GAG	RFX1	-	NULL		0.706	RFX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFX1	HGNC	protein_coding	OTTHUMT00000458510.1	C	NM_002918		14073987	-1	no_errors	ENST00000254325	ensembl	human	known	70_37	missense	SNP	1.000	T
RGPD4	285190	genome.wustl.edu	37	2	108487596	108487596	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:108487596G>C	ENST00000408999.3	+	20	3213	c.3136G>C	c.(3136-3138)Gaa>Caa	p.E1046Q	RGPD4_ENST00000354986.4_Missense_Mutation_p.E1046Q	NM_182588.2	NP_872394.2	Q7Z3J3	RGPD4_HUMAN	RANBP2-like and GRIP domain containing 4	1046	RanBD1 1. {ECO:0000255|PROSITE- ProRule:PRU00164}.				protein targeting to Golgi (GO:0000042)					breast(1)|endometrium(7)|kidney(4)|lung(23)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(3)	43						TCAAATGCCTGAAAAAGTAGA	0.388																																																	0													10.0	7.0	8.0					2																	108487596		685	1564	2249	SO:0001583	missense	285190			BX537861	CCDS46381.1	2q12.3	2013-01-10			ENSG00000196862	ENSG00000196862		"""Tetratricopeptide (TTC) repeat domain containing"""	32417	protein-coding gene	gene with protein product		612707				15710750, 15815621	Standard	NM_182588		Approved	RGP4, DKFZp686P0288	uc010ywk.2	Q7Z3J3	OTTHUMG00000153208	ENST00000408999.3:c.3136G>C	2.37:g.108487596G>C	ENSP00000386810:p.Glu1046Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B9A029	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.E1046Q	ENST00000408999.3	37	c.3136	CCDS46381.1	2	.	.	.	.	.	.	.	.	.	.	-	10.75	1.437443	0.25900	.	.	ENSG00000196862	ENST00000354986;ENST00000408999;ENST00000439322	T;T	0.46819	0.86;0.86	2.33	2.33	0.28932	Pleckstrin homology-type (1);Ran binding protein 1 (2);	.	.	.	.	T	0.53029	0.1771	L	0.45698	1.435	0.34459	D	0.701506	D	0.59357	0.985	P	0.55999	0.789	T	0.66917	-0.5802	9	0.66056	D	0.02	-38.6669	11.5771	0.50869	0.0:0.0:1.0:0.0	.	1046	Q7Z3J3	RGPD4_HUMAN	Q	1046;1046;804	ENSP00000347081:E1046Q;ENSP00000386810:E1046Q	ENSP00000347081:E1046Q	E	+	1	0	RGPD4	107854028	1.000000	0.71417	0.985000	0.45067	0.420000	0.31355	9.533000	0.98059	1.303000	0.44873	0.162000	0.16502	GAA	RGPD4	-	smart_Ran_bind_dom,pfscan_Ran_bind_dom		0.388	RGPD4-001	NOVEL	not_best_in_genome_evidence|basic|appris_candidate|CCDS	protein_coding	RGPD4	HGNC	protein_coding	OTTHUMT00000330096.2	G	XM_496581		108487596	+1	no_errors	ENST00000354986	ensembl	human	known	70_37	missense	SNP	1.000	C
RHOT2	89941	genome.wustl.edu	37	16	722267	722267	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:722267G>C	ENST00000315082.4	+	15	1323	c.1209G>C	c.(1207-1209)aaG>aaC	p.K403N		NM_138769.2	NP_620124.1	Q8IXI1	MIRO2_HUMAN	ras homolog family member T2	403					cellular homeostasis (GO:0019725)|mitochondrial outer membrane permeabilization (GO:0097345)|mitochondrion transport along microtubule (GO:0047497)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|integral component of mitochondrial outer membrane (GO:0031307)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)			endometrium(2)|kidney(3)|lung(4)|ovary(1)|pancreas(2)|prostate(1)	13		Hepatocellular(780;0.0218)				CTCGTGAGAAGAGGCTGGACC	0.637																																																	0													65.0	64.0	64.0					16																	722267		2200	4298	6498	SO:0001583	missense	89941			BC014942	CCDS10417.1	16p13.3	2013-01-10	2012-02-27	2004-03-24	ENSG00000140983	ENSG00000140983		"""EF-hand domain containing"""	21169	protein-coding gene	gene with protein product	"""mitochondrial Rho (MIRO) GTPase 2"""	613889	"""chromosome 16 open reading frame 39"", ""ras homolog gene family, member T2"""	C16orf39, ARHT2		12482879	Standard	NM_138769		Approved	MIRO-2	uc002cip.3	Q8IXI1	OTTHUMG00000121139	ENST00000315082.4:c.1209G>C	16.37:g.722267G>C	ENSP00000321971:p.Lys403Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2IDC2|Q8NF53|Q96C13|Q96S17|Q9BT60|Q9H7M8	Missense_Mutation	SNP	pirsf_Small_GTPase_Miro,pfam_EF_hand_assoc_2,pfam_MIRO-like,pfam_EF_hand_assoc_1,pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,pfscan_EF_HAND_2	p.K403N	ENST00000315082.4	37	c.1209	CCDS10417.1	16	.	.	.	.	.	.	.	.	.	.	G	14.13	2.442256	0.43326	.	.	ENSG00000140983	ENST00000315082	T	0.16743	2.32	5.1	4.12	0.48240	EF hand associated, type-1 (1);	0.119625	0.64402	D	0.000006	T	0.40719	0.1128	M	0.79258	2.445	0.58432	D	0.999998	D	0.67145	0.996	D	0.72625	0.978	T	0.34428	-0.9829	10	0.87932	D	0	-12.0277	11.4686	0.50254	0.0932:0.0:0.9068:0.0	.	403	Q8IXI1	MIRO2_HUMAN	N	403	ENSP00000321971:K403N	ENSP00000321971:K403N	K	+	3	2	RHOT2	662268	1.000000	0.71417	0.749000	0.31150	0.630000	0.37929	2.182000	0.42556	1.116000	0.41820	0.462000	0.41574	AAG	RHOT2	-	pirsf_Small_GTPase_Miro,pfam_EF_hand_assoc_1		0.637	RHOT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOT2	HGNC	protein_coding	OTTHUMT00000241617.1	G	NM_138769		722267	+1	no_errors	ENST00000315082	ensembl	human	known	70_37	missense	SNP	0.998	C
RNF40	9810	genome.wustl.edu	37	16	30779514	30779514	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:30779514G>C	ENST00000324685.6	+	13	2077	c.1642G>C	c.(1642-1644)Gag>Cag	p.E548Q	RNF40_ENST00000402121.3_Missense_Mutation_p.E240Q|RNF40_ENST00000563683.1_Missense_Mutation_p.E508Q|RNF40_ENST00000357890.5_Missense_Mutation_p.E448Q	NM_001207033.1|NM_014771.3	NP_001193962.1|NP_055586	O75150	BRE1B_HUMAN	ring finger protein 40, E3 ubiquitin protein ligase	548					histone H2B ubiquitination (GO:0033523)|histone monoubiquitination (GO:0010390)|ubiquitin-dependent protein catabolic process (GO:0006511)	HULC complex (GO:0033503)|membrane (GO:0016020)|neuron projection (GO:0043005)|nucleus (GO:0005634)|ubiquitin ligase complex (GO:0000151)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|lung(10)|prostate(2)	30			Colorectal(24;0.198)			CCCAGGGAAAGAGGAGGGTGG	0.642																																																	0													43.0	48.0	47.0					16																	30779514		2197	4300	6497	SO:0001583	missense	9810			AB014561	CCDS10691.1, CCDS55994.1	16p11.2-p11.1	2012-02-23	2012-02-23		ENSG00000103549	ENSG00000103549		"""RING-type (C3HC4) zinc fingers"""	16867	protein-coding gene	gene with protein product	"""BRE1 E3 ubiquitin ligase homolog B (S. cerevisiae)"""	607700	"""ring finger protein 40"""			9734811, 10944455, 12121982	Standard	NM_014771		Approved	KIAA0661, RBP95, BRE1B, STARING	uc002dzq.3	O75150	OTTHUMG00000132394	ENST00000324685.6:c.1642G>C	16.37:g.30779514G>C	ENSP00000325677:p.Glu548Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6AHZ6|Q6N005|Q7L3T6|Q8N615|Q96T18|Q9BSV9|Q9HC82	Missense_Mutation	SNP	smart_Znf_RING,pfscan_Znf_RING	p.E548Q	ENST00000324685.6	37	c.1642	CCDS10691.1	16	.	.	.	.	.	.	.	.	.	.	G	14.85	2.659413	0.47467	.	.	ENSG00000103549	ENST00000324685;ENST00000357890;ENST00000402121	T;T;T	0.32753	1.44;1.45;1.46	5.23	5.23	0.72850	.	0.293204	0.35349	N	0.003263	T	0.29684	0.0741	L	0.29908	0.895	0.47778	D	0.999514	D;P;B;B	0.54772	0.968;0.952;0.002;0.004	P;B;B;B	0.46758	0.526;0.446;0.004;0.004	T	0.01259	-1.1403	10	0.23891	T	0.37	-18.9748	17.7457	0.88420	0.0:0.0:1.0:0.0	.	240;448;548;548	F8W8Z4;O75150-4;A8K6K1;O75150	.;.;.;BRE1B_HUMAN	Q	548;448;240	ENSP00000325677:E548Q;ENSP00000350563:E448Q;ENSP00000384942:E240Q	ENSP00000325677:E548Q	E	+	1	0	RNF40	30687015	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.279000	0.51670	2.728000	0.93425	0.655000	0.94253	GAG	RNF40	-	NULL		0.642	RNF40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF40	HGNC	protein_coding	OTTHUMT00000255524.2	G	NM_014771		30779514	+1	no_errors	ENST00000324685	ensembl	human	known	70_37	missense	SNP	1.000	C
RORC	6097	genome.wustl.edu	37	1	151783893	151783893	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:151783893C>G	ENST00000318247.6	-	10	1410	c.1303G>C	c.(1303-1305)Gag>Cag	p.E435Q	RORC_ENST00000356728.6_Missense_Mutation_p.E414Q|RORC_ENST00000392697.3_Missense_Mutation_p.E489Q|RORC_ENST00000480719.1_5'UTR	NM_005060.3	NP_005051.2	P51449	RORG_HUMAN	RAR-related orphan receptor C	435	Ligand-binding.				adipose tissue development (GO:0060612)|cellular response to sterol (GO:0036315)|circadian regulation of gene expression (GO:0032922)|gene expression (GO:0010467)|intracellular receptor signaling pathway (GO:0030522)|lymph node development (GO:0048535)|negative regulation of thymocyte apoptotic process (GO:0070244)|Peyer's patch development (GO:0048541)|positive regulation of circadian rhythm (GO:0042753)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of fat cell differentiation (GO:0045598)|regulation of gamma-delta T cell differentiation (GO:0045586)|regulation of glucose metabolic process (GO:0010906)|regulation of steroid metabolic process (GO:0019218)|regulation of transcription involved in cell fate commitment (GO:0060850)|T cell differentiation in thymus (GO:0033077)|T-helper 17 cell differentiation (GO:0072539)|T-helper cell differentiation (GO:0042093)|transcription initiation from RNA polymerase II promoter (GO:0006367)|xenobiotic metabolic process (GO:0006805)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	direct ligand regulated sequence-specific DNA binding transcription factor activity (GO:0098531)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|oxysterol binding (GO:0008142)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(2)|endometrium(4)|large_intestine(1)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.14)		LUSC - Lung squamous cell carcinoma(543;0.181)			TTCCTTTTCTCTTGGAGCCCT	0.493																																																	0													113.0	97.0	102.0					1																	151783893		2203	4300	6503	SO:0001583	missense	6097			U16997	CCDS1004.1, CCDS30856.1	1q21	2013-01-16			ENSG00000143365	ENSG00000143365		"""Nuclear hormone receptors"""	10260	protein-coding gene	gene with protein product		602943				7811290	Standard	NM_005060		Approved	RZRG, RORG, NR1F3, TOR	uc001ezh.3	P51449	OTTHUMG00000013053	ENST00000318247.6:c.1303G>C	1.37:g.151783893C>G	ENSP00000327025:p.Glu435Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SZR9|Q8N5V7|Q8NCY8	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ROR_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_ThyrH_rcpt	p.E489Q	ENST00000318247.6	37	c.1465	CCDS1004.1	1	.	.	.	.	.	.	.	.	.	.	C	25.0	4.587548	0.86851	.	.	ENSG00000143365	ENST00000356728;ENST00000392697;ENST00000318247	D;D;D	0.95238	-3.65;-3.65;-3.65	4.61	4.61	0.57282	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (2);	0.106711	0.43919	U	0.000511	D	0.94640	0.8272	L	0.39467	1.215	0.52099	D	0.99994	D;D;D;D	0.71674	0.993;0.995;0.995;0.998	P;P;P;D	0.67231	0.87;0.862;0.887;0.95	D	0.95324	0.8423	10	0.66056	D	0.02	.	16.171	0.81817	0.0:1.0:0.0:0.0	.	423;489;435;414	B6ZGS6;B4DPR1;P51449;F1D8P6	.;.;RORG_HUMAN;.	Q	414;489;435	ENSP00000349164:E414Q;ENSP00000376461:E489Q;ENSP00000327025:E435Q	ENSP00000327025:E435Q	E	-	1	0	RORC	150050517	1.000000	0.71417	0.988000	0.46212	0.986000	0.74619	6.741000	0.74837	2.381000	0.81170	0.655000	0.94253	GAG	RORC	-	pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Nucl_hrmn_rcpt_lig-bd_core		0.493	RORC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RORC	HGNC	protein_coding	OTTHUMT00000036626.1	C			151783893	-1	no_errors	ENST00000392697	ensembl	human	known	70_37	missense	SNP	1.000	G
RYR1	6261	genome.wustl.edu	37	19	38991620	38991620	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:38991620C>A	ENST00000359596.3	+	47	7604	c.7604C>A	c.(7603-7605)tCg>tAg	p.S2535*	RYR1_ENST00000355481.4_Nonsense_Mutation_p.S2535*|RYR1_ENST00000360985.3_Nonsense_Mutation_p.S2535*			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	2535	6 X approximate repeats.				calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	GCAGCCGCCTCGCTGGACACG	0.622																																																	0																																										SO:0001587	stop_gained	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.7604C>A	19.37:g.38991620C>A	ENSP00000352608:p.Ser2535*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Nonsense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.S2535*	ENST00000359596.3	37	c.7604	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	50	16.690763	0.99869	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	.	.	.	4.41	4.41	0.53225	.	0.000000	0.64402	U	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	.	15.9284	0.79639	0.0:1.0:0.0:0.0	.	.	.	.	X	2535	.	ENSP00000347667:S2535X	S	+	2	0	RYR1	43683460	1.000000	0.71417	1.000000	0.80357	0.899000	0.52679	7.621000	0.83083	2.259000	0.74868	0.491000	0.48974	TCG	RYR1	-	NULL		0.622	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	C			38991620	+1	no_errors	ENST00000359596	ensembl	human	known	70_37	nonsense	SNP	1.000	A
SARS2	54938	genome.wustl.edu	37	19	39408622	39408622	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:39408622C>T	ENST00000221431.6	-	11	1148	c.989G>A	c.(988-990)cGg>cAg	p.R330Q	SARS2_ENST00000594171.1_Missense_Mutation_p.R140Q|SARS2_ENST00000598831.1_5'Flank|CTC-360G5.8_ENST00000599996.1_Silent_p.P399P|SARS2_ENST00000600042.1_Missense_Mutation_p.R332Q|SARS2_ENST00000430193.3_Missense_Mutation_p.R330Q|SARS2_ENST00000448145.2_Missense_Mutation_p.R330Q	NM_017827.3	NP_060297.1	Q9NP81	SYSM_HUMAN	seryl-tRNA synthetase 2, mitochondrial	330					gene expression (GO:0010467)|selenocysteinyl-tRNA(Sec) biosynthetic process (GO:0097056)|seryl-tRNA aminoacylation (GO:0006434)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|serine-tRNA ligase activity (GO:0004828)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(4)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	15	all_cancers(60;2.74e-06)|all_epithelial(25;4.36e-06)|Ovarian(47;0.0454)		Lung(45;0.000419)|LUSC - Lung squamous cell carcinoma(53;0.000554)			TGTCTCTGCCCGGTAGCAGGT	0.597																																																	0													95.0	74.0	81.0					19																	39408622		2203	4300	6503	SO:0001583	missense	54938			AB029948	CCDS33017.1, CCDS54265.1	19q13.2	2014-05-06	2007-02-23			ENSG00000104835	6.1.1.11	"""Aminoacyl tRNA synthetases / Class II"""	17697	protein-coding gene	gene with protein product	"""serine tRNA ligase 2, mitochondrial"""	612804	"""serine-tRNA ligase, mitochondrial"", ""seryl-tRNA synthetase 2"""	SARSM		10764807	Standard	NM_001145901		Approved	FLJ20450, mtSerRS, SerRSmt, SARS, SERS, SYS	uc010xup.1	Q9NP81	OTTHUMG00000182691	ENST00000221431.6:c.989G>A	19.37:g.39408622C>T	ENSP00000221431:p.Arg330Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHW7|B4DE10|Q9BVP3	Missense_Mutation	SNP	pirsf_Ser-tRNA-ligase_type_1,pfam_aa-tRNA-synt_IIb_cons-dom,superfamily_tRNA-bd_arm,prints_Ser-tRNA-ligase_type_1,pfscan_aa-tRNA-synth_II,tigrfam_Ser-tRNA-ligase_type_1	p.R332Q	ENST00000221431.6	37	c.995	CCDS33017.1	19	.	.	.	.	.	.	.	.	.	.	c	26.8	4.767829	0.90020	.	.	ENSG00000104835	ENST00000430193;ENST00000221431;ENST00000448145	D;D	0.96830	-4.14;-4.14	4.88	4.88	0.63580	Aminoacyl-tRNA synthetase, class II (1);Aminoacyl-tRNA synthetase, class II (G/ H/ P/ S), conserved domain (1);	0.000000	0.85682	D	0.000000	D	0.98820	0.9602	H	0.97291	3.975	.	.	.	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;P;D;D	0.83275	0.924;0.834;0.924;0.996	D	0.99581	1.0973	9	0.87932	D	0	.	15.5397	0.76031	0.0:1.0:0.0:0.0	.	330;332;330;330	E7EX87;B4DE10;B4DXB9;Q9NP81	.;.;.;SYSM_HUMAN	Q	332;330;330	ENSP00000221431:R330Q;ENSP00000399330:R330Q	ENSP00000221431:R330Q	R	-	2	0	FBXO17	44100462	1.000000	0.71417	0.991000	0.47740	0.519000	0.34347	7.079000	0.76829	2.263000	0.75096	0.424000	0.28305	CGG	SARS2	-	pirsf_Ser-tRNA-ligase_type_1,pfam_aa-tRNA-synt_IIb_cons-dom,pfscan_aa-tRNA-synth_II,tigrfam_Ser-tRNA-ligase_type_1		0.597	SARS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SARS2	HGNC	protein_coding	OTTHUMT00000463139.1	C	NM_017827		39408622	-1	no_errors	ENST00000600042	ensembl	human	known	70_37	missense	SNP	1.000	T
RSPH6A	81492	genome.wustl.edu	37	19	46307697	46307697	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:46307697G>C	ENST00000221538.3	-	3	1608	c.1466C>G	c.(1465-1467)tCg>tGg	p.S489W	RSPH6A_ENST00000597055.1_Missense_Mutation_p.S489W|RSPH6A_ENST00000600188.1_Missense_Mutation_p.S225W	NM_030785.3	NP_110412.1	Q9H0K4	RSH6A_HUMAN	radial spoke head 6 homolog A (Chlamydomonas)	489						intracellular (GO:0005622)				central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	32						CGTGGCGGCCGAGATGCGGGC	0.642																																																	0													45.0	45.0	45.0					19																	46307697		2203	4300	6503	SO:0001583	missense	81492			AL136761	CCDS12675.1	19q13.3	2010-02-17	2009-11-18	2009-11-18	ENSG00000104941	ENSG00000104941			14241	protein-coding gene	gene with protein product		607548	"""radial spokehead-like 1"""	RSHL1		11237735	Standard	NM_030785		Approved	RSP4, RSP6, RSPH4B	uc002pdm.3	Q9H0K4		ENST00000221538.3:c.1466C>G	19.37:g.46307697G>C	ENSP00000221538:p.Ser489Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53FE2|Q6PEZ9	Missense_Mutation	SNP	pfam_Radial_spoke	p.S489W	ENST00000221538.3	37	c.1466	CCDS12675.1	19	.	.	.	.	.	.	.	.	.	.	G	16.30	3.085656	0.55861	.	.	ENSG00000104941	ENST00000221538	T	0.27104	1.69	3.8	3.8	0.43715	.	0.000000	0.85682	D	0.000000	T	0.55970	0.1954	M	0.89095	3.005	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	T	0.65705	-0.6103	10	0.87932	D	0	-4.8867	14.008	0.64478	0.0:0.0:1.0:0.0	.	489	Q9H0K4	RSH6A_HUMAN	W	489	ENSP00000221538:S489W	ENSP00000221538:S489W	S	-	2	0	RSPH6A	50999537	1.000000	0.71417	1.000000	0.80357	0.363000	0.29612	8.993000	0.93524	2.428000	0.82296	0.456000	0.33151	TCG	RSPH6A	-	pfam_Radial_spoke		0.642	RSPH6A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSPH6A	HGNC	protein_coding	OTTHUMT00000461657.1	G			46307697	-1	no_errors	ENST00000221538	ensembl	human	known	70_37	missense	SNP	1.000	C
SCN2A	6326	genome.wustl.edu	37	2	166245843	166245843	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:166245843G>A	ENST00000375437.2	+	27	5817	c.5527G>A	c.(5527-5529)Gat>Aat	p.D1843N	SCN2A_ENST00000283256.6_Missense_Mutation_p.D1843N|SCN2A_ENST00000375427.2_Missense_Mutation_p.D1843N|SCN2A_ENST00000357398.3_Missense_Mutation_p.D1843N	NM_001040142.1	NP_001035232.1	Q99250	SCN2A_HUMAN	sodium channel, voltage-gated, type II, alpha subunit	1843					intrinsic apoptotic signaling pathway in response to osmotic stress (GO:0008627)|membrane depolarization during action potential (GO:0086010)|myelination (GO:0042552)|neuron apoptotic process (GO:0051402)|neuronal action potential (GO:0019228)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon (GO:0030424)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intrinsic component of plasma membrane (GO:0031226)|node of Ranvier (GO:0033268)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|sodium channel complex (GO:0034706)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(1)|breast(7)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(27)|liver(2)|lung(49)|ovary(6)|pancreas(1)|prostate(2)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	118					Lamotrigine(DB00555)|Propofol(DB00818)|Valproic Acid(DB00313)|Zonisamide(DB00909)	CATTGCCATGGATCTGCCCAT	0.473																																																	0													124.0	119.0	121.0					2																	166245843		2203	4300	6503	SO:0001583	missense	6326			AB208888	CCDS33313.1, CCDS33314.1	2q24.3	2012-02-26	2007-01-23	2007-01-23	ENSG00000136531	ENSG00000136531		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10588	protein-coding gene	gene with protein product		182390	"""sodium channel, voltage-gated, type II, alpha 2 polypeptide"", ""sodium channel, voltage-gated, type II, alpha 1 polypeptide"""	SCN2A1, SCN2A2		1317301, 16382098	Standard	XM_005246753		Approved	Nav1.2, HBSCII, HBSCI	uc002ude.3	Q99250	OTTHUMG00000044172	ENST00000375437.2:c.5527G>A	2.37:g.166245843G>A	ENSP00000364586:p.Asp1843Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NC14|A6NIQ5|Q14472|Q53T77|Q9BZC9|Q9BZD0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,pfam_DUF3451,pfam_PKD1_2_channel,smart_IQ_motif_EF-hand-BS,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.D1843N	ENST00000375437.2	37	c.5527	CCDS33314.1	2	.	.	.	.	.	.	.	.	.	.	G	21.5	4.161503	0.78226	.	.	ENSG00000136531	ENST00000375437;ENST00000357398;ENST00000283256;ENST00000375427	D;D;D;D	0.96587	-4.06;-4.06;-4.06;-4.06	5.53	5.53	0.82687	.	0.077324	0.56097	D	0.000033	D	0.97952	0.9326	M	0.72894	2.215	0.80722	D	1	D;D	0.61080	0.989;0.972	D;D	0.79784	0.977;0.993	D	0.98446	1.0589	10	0.87932	D	0	.	19.8849	0.96909	0.0:0.0:1.0:0.0	.	1843;1843	Q99250-2;Q99250	.;SCN2A_HUMAN	N	1843	ENSP00000364586:D1843N;ENSP00000349973:D1843N;ENSP00000283256:D1843N;ENSP00000364576:D1843N	ENSP00000283256:D1843N	D	+	1	0	SCN2A	165954089	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.781000	0.99029	2.781000	0.95711	0.580000	0.79431	GAT	SCN2A	-	NULL		0.473	SCN2A-202	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SCN2A	HGNC	protein_coding	OTTHUMT00000102659.2	G	NM_021007		166245843	+1	no_errors	ENST00000283256	ensembl	human	known	70_37	missense	SNP	1.000	A
SDCCAG8	10806	genome.wustl.edu	37	1	243579062	243579062	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:243579062C>T	ENST00000366541.3	+	14	1793	c.1675C>T	c.(1675-1677)Cag>Tag	p.Q559*	SDCCAG8_ENST00000355875.4_Nonsense_Mutation_p.Q516*|SDCCAG8_ENST00000343783.6_Nonsense_Mutation_p.Q414*	NM_006642.3	NP_006633.1	Q86SQ7	SDCG8_HUMAN	serologically defined colon cancer antigen 8	559	Gln-rich.|Mediates interaction with OFD1.|Sufficient for homodimerization. {ECO:0000250}.				establishment of cell polarity (GO:0030010)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|tube formation (GO:0035148)	cell-cell junction (GO:0005911)|centriole (GO:0005814)|centrosome (GO:0005813)|cytosol (GO:0005829)				breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29	all_cancers(71;0.000545)|all_epithelial(71;0.000509)|all_lung(81;0.0821)|Ovarian(71;0.0919)|all_neural(11;0.101)|Breast(184;0.218)	all_cancers(173;0.00395)	all cancers(7;1.58e-07)|GBM - Glioblastoma multiforme(7;5.12e-06)|OV - Ovarian serous cystadenocarcinoma(106;0.00392)	COAD - Colon adenocarcinoma(196;0.145)		CCAAGCCCTTCAGGCCCAGCA	0.483																																																	0													83.0	78.0	80.0					1																	243579062		2203	4300	6503	SO:0001587	stop_gained	10806			AF039690	CCDS31075.1	1q43	2011-08-02			ENSG00000054282	ENSG00000054282			10671	protein-coding gene	gene with protein product		613524				9610721, 20835237	Standard	NM_006642		Approved	NY-CO-8, CCCAP, SLSN7, NPHP10, BBS16	uc001hzw.3	Q86SQ7	OTTHUMG00000039996	ENST00000366541.3:c.1675C>T	1.37:g.243579062C>T	ENSP00000355499:p.Gln559*	Somatic		WXS	Illumina HiSeq	Phase_IV	O60527|Q3ZCR6|Q8N5F2|Q9P0F1	Nonsense_Mutation	SNP	NULL	p.Q559*	ENST00000366541.3	37	c.1675	CCDS31075.1	1	.	.	.	.	.	.	.	.	.	.	C	32	5.152360	0.94645	.	.	ENSG00000054282	ENST00000355875;ENST00000366541;ENST00000343783	.	.	.	5.6	5.6	0.85130	.	0.205062	0.42420	D	0.000718	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25106	T	0.35	-12.0525	19.9854	0.97342	0.0:1.0:0.0:0.0	.	.	.	.	X	516;559;414	.	ENSP00000341260:Q414X	Q	+	1	0	SDCCAG8	241645685	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.443000	0.59994	2.786000	0.95864	0.563000	0.77884	CAG	SDCCAG8	-	NULL		0.483	SDCCAG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDCCAG8	HGNC	protein_coding	OTTHUMT00000096485.1	C	NM_006642		243579062	+1	no_errors	ENST00000366541	ensembl	human	known	70_37	nonsense	SNP	1.000	T
SDHA	6389	genome.wustl.edu	37	5	224502	224502	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:224502C>T	ENST00000264932.6	+	3	293	c.178C>T	c.(178-180)Cat>Tat	p.H60Y	SDHA_ENST00000510361.1_Missense_Mutation_p.H60Y|SDHA_ENST00000504309.1_Missense_Mutation_p.H60Y	NM_004168.2	NP_004159.2	P31040	SDHA_HUMAN	succinate dehydrogenase complex, subunit A, flavoprotein (Fp)	60					cellular metabolic process (GO:0044237)|nervous system development (GO:0007399)|oxidation-reduction process (GO:0055114)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|succinate metabolic process (GO:0006105)|tricarboxylic acid cycle (GO:0006099)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex II (GO:0005749)|mitochondrion (GO:0005739)	flavin adenine dinucleotide binding (GO:0050660)|succinate dehydrogenase (ubiquinone) activity (GO:0008177)			NS(1)|breast(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(6)|liver(2)|lung(16)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	40			Epithelial(17;0.0159)|all cancers(22;0.0236)|OV - Ovarian serous cystadenocarcinoma(19;0.0674)|Lung(60;0.113)		Succinic acid(DB00139)	AGTAGTGGATCATGAATTTGA	0.453									Familial Paragangliomas																																								0													112.0	139.0	130.0					5																	224502		2203	4297	6500	SO:0001583	missense	6389	Familial Cancer Database	Hereditary Glomus Tumors, Familial Paragangliomas, Hereditary Paragangliomas, type 1-3: PGL1, PGL2, PGL3, incl. Familial Carotid Body Paraganglioma and Sensorineural Hearing Loss	BC001380	CCDS3853.1	5p15	2014-09-17			ENSG00000073578	ENSG00000073578		"""Mitochondrial respiratory chain complex / Complex II"""	10680	protein-coding gene	gene with protein product		600857		SDH2		7798181	Standard	XM_005248329		Approved	FP, SDHF	uc003jao.4	P31040	OTTHUMG00000090275	ENST00000264932.6:c.178C>T	5.37:g.224502C>T	ENSP00000264932:p.His60Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5J6|B4DJ60|E9PBJ5|Q16395|Q59GW8|Q8IW48|Q9UMY5	Missense_Mutation	SNP	pfam_FAD_bind_dom,pfam_Fum_Rdtase/Succ_DH_flav-like_C,superfamily_Fum_Rdtase/Succ_DH_flav-like_C,tigrfam_Succ_DH_flav_su_fwd,tigrfam_Succ_Dhase_FrdA_Gneg	p.H60Y	ENST00000264932.6	37	c.178	CCDS3853.1	5	.	.	.	.	.	.	.	.	.	.	c	26.9	4.782095	0.90282	.	.	ENSG00000073578	ENST00000264932;ENST00000327872;ENST00000504309;ENST00000510361	T;T;T	0.63255	-0.03;-0.03;-0.03	5.35	5.35	0.76521	.	0.000000	0.85682	U	0.000000	T	0.79387	0.4437	M	0.73962	2.25	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.989;0.989;0.989;0.989	T	0.81362	-0.0967	10	0.87932	D	0	.	16.979	0.86322	0.0:1.0:0.0:0.0	.	60;60;60;60;66	E9PBJ5;B4DYN5;D6RFM5;P31040;Q59GW8	.;.;.;DHSA_HUMAN;.	Y	60	ENSP00000264932:H60Y;ENSP00000426514:H60Y;ENSP00000427703:H60Y	ENSP00000264932:H60Y	H	+	1	0	SDHA	277502	1.000000	0.71417	0.998000	0.56505	0.981000	0.71138	7.447000	0.80620	2.684000	0.91462	0.539000	0.68188	CAT	SDHA	-	tigrfam_Succ_DH_flav_su_fwd		0.453	SDHA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SDHA	HGNC	protein_coding	OTTHUMT00000206599.1	C	NM_004168		224502	+1	no_errors	ENST00000264932	ensembl	human	known	70_37	missense	SNP	1.000	T
SEC24C	9632	genome.wustl.edu	37	10	75525312	75525312	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr10:75525312G>A	ENST00000339365.2	+	10	1493	c.1331G>A	c.(1330-1332)cGt>cAt	p.R444H	SEC24C_ENST00000540668.1_Intron|SEC24C_ENST00000345254.4_Missense_Mutation_p.R444H|SEC24C_ENST00000535742.1_Intron|SEC24C_ENST00000411652.2_Missense_Mutation_p.R325H|SEC24C_ENST00000546025.1_Missense_Mutation_p.R222H	NM_004922.3	NP_004913.2	P53992	SC24C_HUMAN	SEC24 family member C	444	Zinc finger-like.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|COPII vesicle coating (GO:0048208)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|small molecule metabolic process (GO:0044281)	COPII vesicle coat (GO:0030127)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(6)|kidney(2)|large_intestine(3)|lung(12)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	32	Prostate(51;0.0112)					GGAGGGAGGCGTTTCCAGTGC	0.473																																																	0													197.0	156.0	170.0					10																	75525312		2203	4300	6503	SO:0001583	missense	9632			D38555	CCDS7332.1	10q22	2013-10-21	2013-10-21		ENSG00000176986	ENSG00000176986			10705	protein-coding gene	gene with protein product		607185	"""SEC24 (S. cerevisiae) related gene family, member C"", ""SEC24 family, member C (S. cerevisiae)"""			10214955, 7584044	Standard	NM_004922		Approved	KIAA0079	uc001jux.3	P53992	OTTHUMG00000018476	ENST00000339365.2:c.1331G>A	10.37:g.75525312G>A	ENSP00000343405:p.Arg444His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZT4|Q8WV25	Missense_Mutation	SNP	pfam_Sec23/24_trunk_dom,pfam_Sec23/24_helical_dom,pfam_Sec23_24_beta_S,pfam_Znf_Sec23_Sec24,pfam_Gelsolin_dom,superfamily_Sec23/24_helical_dom,superfamily_Znf_Sec23_Sec24	p.R444H	ENST00000339365.2	37	c.1331	CCDS7332.1	10	.	.	.	.	.	.	.	.	.	.	G	21.4	4.137497	0.77775	.	.	ENSG00000176986	ENST00000546025;ENST00000345254;ENST00000339365;ENST00000411652	T;T;T;T	0.78924	-1.22;-1.22;-1.22;-1.22	5.86	5.86	0.93980	Zinc finger, Sec23/Sec24-type (2);	0.000000	0.85682	D	0.000000	T	0.76026	0.3930	M	0.66560	2.04	0.80722	D	1	P;P;P	0.40032	0.518;0.65;0.699	B;B;B	0.31337	0.036;0.078;0.128	T	0.78947	-0.2003	10	0.59425	D	0.04	-5.8653	20.1858	0.98214	0.0:0.0:1.0:0.0	.	325;444;444	E7EP00;G5EA31;P53992	.;.;SC24C_HUMAN	H	222;444;444;325	ENSP00000446333:R222H;ENSP00000321845:R444H;ENSP00000343405:R444H;ENSP00000402913:R325H	ENSP00000343405:R444H	R	+	2	0	SEC24C	75195318	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.018000	0.88722	2.777000	0.95525	0.591000	0.81541	CGT	SEC24C	-	pfam_Znf_Sec23_Sec24,superfamily_Znf_Sec23_Sec24		0.473	SEC24C-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC24C	HGNC	protein_coding	OTTHUMT00000048679.1	G			75525312	+1	no_errors	ENST00000339365	ensembl	human	known	70_37	missense	SNP	1.000	A
SEMA5B	54437	genome.wustl.edu	37	3	122645303	122645303	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:122645303C>T	ENST00000357599.3	-	9	1458	c.1072G>A	c.(1072-1074)Gag>Aag	p.E358K	AC078794.1_ENST00000408284.1_RNA|SEMA5B_ENST00000451055.2_Missense_Mutation_p.E412K|SEMA5B_ENST00000195173.4_Missense_Mutation_p.E358K	NM_001031702.3|NM_001256348.1	NP_001026872.2|NP_001243277.1	Q9P283	SEM5B_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5B	358	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(13)|lung(26)|ovary(2)|pancreas(3)|skin(2)|upper_aerodigestive_tract(3)	55				GBM - Glioblastoma multiforme(114;0.0367)		CTCTGCAGCTCGTTATAGTAG	0.597																																																	0													36.0	35.0	35.0					3																	122645303		2203	4300	6503	SO:0001583	missense	54437			AB040878	CCDS35491.1, CCDS58848.1, CCDS74995.1	3q21.1	2008-07-18			ENSG00000082684	ENSG00000082684		"""Semaphorins"""	10737	protein-coding gene	gene with protein product		609298		SEMAG		8817451	Standard	NM_001256346		Approved	SemG, KIAA1445, FLJ10372	uc031sbm.1	Q9P283	OTTHUMG00000140392	ENST00000357599.3:c.1072G>A	3.37:g.122645303C>T	ENSP00000350215:p.Glu358Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5U2|B7Z393|F8W9U8|Q6DD89|Q6UY12|Q9NW17	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.E412K	ENST00000357599.3	37	c.1234	CCDS35491.1	3	.	.	.	.	.	.	.	.	.	.	C	33	5.196668	0.94960	.	.	ENSG00000082684	ENST00000357599;ENST00000195173;ENST00000418793;ENST00000451055;ENST00000393583	T;T;T;T	0.13196	2.61;2.61;2.61;2.61	4.5	4.5	0.54988	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.39226	0.1070	M	0.83012	2.62	0.80722	D	1	D;D;D	0.64830	0.992;0.994;0.994	P;D;D	0.64321	0.875;0.924;0.924	T	0.42310	-0.9459	10	0.66056	D	0.02	.	16.4032	0.83649	0.0:1.0:0.0:0.0	.	300;358;358	D3YTI7;B5ME80;Q9P283	.;.;SEM5B_HUMAN	K	358;358;300;412;358	ENSP00000350215:E358K;ENSP00000195173:E358K;ENSP00000389588:E412K;ENSP00000377208:E358K	ENSP00000195173:E358K	E	-	1	0	SEMA5B	124127993	1.000000	0.71417	0.989000	0.46669	0.955000	0.61496	7.651000	0.83577	2.329000	0.79093	0.650000	0.86243	GAG	SEMA5B	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.597	SEMA5B-001	KNOWN	basic|CCDS	protein_coding	SEMA5B	HGNC	protein_coding	OTTHUMT00000277165.1	C	NM_001031702		122645303	-1	no_errors	ENST00000451055	ensembl	human	known	70_37	missense	SNP	1.000	T
SERPINB12	89777	genome.wustl.edu	37	18	61228375	61228376	+	Frame_Shift_Ins	INS	-	-	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:61228375_61228376insA	ENST00000269491.1	+	4	442_443	c.442_443insA	c.(442-444)caafs	p.Q148fs	SERPINB12_ENST00000382768.1_Frame_Shift_Ins_p.Q168fs	NM_080474.1	NP_536722.1	Q96P63	SPB12_HUMAN	serpin peptidase inhibitor, clade B (ovalbumin), member 12	148					hematopoietic progenitor cell differentiation (GO:0002244)|negative regulation of endopeptidase activity (GO:0010951)|negative regulation of protein catabolic process (GO:0042177)|regulation of proteolysis (GO:0030162)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	enzyme binding (GO:0019899)|serine-type endopeptidase inhibitor activity (GO:0004867)			kidney(1)|large_intestine(5)|lung(19)|skin(1)	26						TGTTGATTTCCAAAAAAACCCT	0.386																																																	0																																										SO:0001589	frameshift_variant	89777			AF411191	CCDS11984.1	18q21.33	2014-02-18	2005-08-18		ENSG00000166634	ENSG00000166634		"""Serine (or cysteine) peptidase inhibitors"""	14220	protein-coding gene	gene with protein product		615662	"""serine (or cysteine) proteinase inhibitor, clade B (ovalbumin), member 12"""			24172014	Standard	NM_080474		Approved	YUKOPIN	uc010xen.2	Q96P63	OTTHUMG00000132789	ENST00000269491.1:c.449dupA	18.37:g.61228382_61228382dupA	ENSP00000269491:p.Gln148fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SYB4	Frame_Shift_Ins	INS	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.N150fs	ENST00000269491.1	37	c.442_443	CCDS11984.1	18																																																																																			SERPINB12	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.386	SERPINB12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINB12	HGNC	protein_coding	OTTHUMT00000256197.1	-	NM_080474		61228376	+1	no_errors	ENST00000269491	ensembl	human	known	70_37	frame_shift_ins	INS	0.524:0.009	A
MKL1	57591	genome.wustl.edu	37	22	40804696	40804697	+	IGR	INS	-	-	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:40804696_40804697insT	ENST00000355630.3	-	0	4496				SGSM3_ENST00000454798.2_Frame_Shift_Ins_p.F550fs|SGSM3_ENST00000248929.9_Frame_Shift_Ins_p.F617fs	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						TCTGTAAGACCTTCAGGTAACT	0.649			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	0																																										SO:0001628	intergenic_variant	27352			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		22.37:g.40804698_40804698dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Frame_Shift_Ins	INS	pfam_Rab-GTPase-TBC_dom,pfam_Run,pfam_SH3_domain,pfam_SH3_2,superfamily_Rab-GTPase-TBC_dom,superfamily_SH3_domain,smart_Rab-GTPase-TBC_dom,smart_SH3_domain,smart_Run,pfscan_Run,pfscan_SH3_domain,pfscan_Rab-GTPase-TBC_dom	p.R617fs	ENST00000355630.3	37	c.1848_1849	CCDS14003.1	22																																																																																			SGSM3	-	pfam_Run,pfscan_Run		0.649	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM3	HGNC	protein_coding	OTTHUMT00000321522.1	-	NM_020831		40804697	+1	no_errors	ENST00000248929	ensembl	human	known	70_37	frame_shift_ins	INS	0.300:0.997	T
SLC22A1	6580	genome.wustl.edu	37	6	160557675	160557675	+	Missense_Mutation	SNP	T	T	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:160557675T>A	ENST00000366963.4	+	6	1201	c.1054T>A	c.(1054-1056)Tac>Aac	p.Y352N	SLC22A1_ENST00000324965.4_Missense_Mutation_p.Y352N|SLC22A1_ENST00000457470.2_Missense_Mutation_p.Y352N	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	352					dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	CATCCTGATGTACCTGTGGTG	0.567																																																	0													116.0	95.0	102.0					6																	160557675		2203	4300	6503	SO:0001583	missense	6580			U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1054T>A	6.37:g.160557675T>A	ENSP00000355930:p.Tyr352Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	Missense_Mutation	SNP	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.Y352N	ENST00000366963.4	37	c.1054	CCDS5274.1	6	.	.	.	.	.	.	.	.	.	.	T	21.9	4.211976	0.79240	.	.	ENSG00000175003	ENST00000366963;ENST00000324965;ENST00000457470	T;T;T	0.74002	-0.8;-0.8;-0.8	4.46	4.46	0.54185	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.238912	0.36101	N	0.002785	D	0.83362	0.5238	M	0.84326	2.69	0.53688	D	0.999978	D;D	0.76494	0.999;0.998	D;D	0.75484	0.986;0.981	D	0.86682	0.1917	10	0.87932	D	0	.	13.7576	0.62946	0.0:0.0:0.0:1.0	.	352;352	O15245-2;O15245	.;S22A1_HUMAN	N	352	ENSP00000355930:Y352N;ENSP00000318103:Y352N;ENSP00000409557:Y352N	ENSP00000318103:Y352N	Y	+	1	0	SLC22A1	160477665	1.000000	0.71417	1.000000	0.80357	0.891000	0.51852	7.215000	0.77966	1.650000	0.50662	0.459000	0.35465	TAC	SLC22A1	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.567	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A1	HGNC	protein_coding	OTTHUMT00000042938.2	T			160557675	+1	no_errors	ENST00000366963	ensembl	human	known	70_37	missense	SNP	0.998	A
SLC25A23	79085	genome.wustl.edu	37	19	6454376	6454376	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:6454376C>G	ENST00000301454.4	-	6	859	c.753G>C	c.(751-753)aaG>aaC	p.K251N	SLC25A23_ENST00000334510.5_Missense_Mutation_p.K251N|SLC25A23_ENST00000414491.2_Missense_Mutation_p.K68N	NM_024103.2	NP_077008.2	Q9BV35	SCMC3_HUMAN	solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 23	251					adenine nucleotide transport (GO:0051503)|cellular response to calcium ion (GO:0071277)|regulation of cellular respiration (GO:0043457)|regulation of oxidative phosphorylation (GO:0002082)|regulation of sequestering of calcium ion (GO:0051282)|transmembrane transport (GO:0055085)|urea homeostasis (GO:0097274)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)	calcium ion binding (GO:0005509)			endometrium(3)|kidney(1)|large_intestine(6)|lung(3)|ovary(2)|pancreas(1)|skin(1)	17						CGGGGGCAATCTTGAGTACAT	0.542																																																	0													120.0	119.0	119.0					19																	6454376		2203	4300	6503	SO:0001583	missense	79085			AJ619962	CCDS32882.1	19p13.1	2014-02-06			ENSG00000125648	ENSG00000125648		"""Solute carriers"", ""EF-hand domain containing"""	19375	protein-coding gene	gene with protein product		608746				15123600	Standard	NM_024103		Approved	FLJ30339, MGC2615, APC2	uc002mex.1	Q9BV35	OTTHUMG00000180852	ENST00000301454.4:c.753G>C	19.37:g.6454376C>G	ENSP00000301454:p.Lys251Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DGB6|Q4LBC2|Q705K3|Q86Y43|Q8N2N4|Q96NQ4	Missense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.K298N	ENST00000301454.4	37	c.894	CCDS32882.1	19	.	.	.	.	.	.	.	.	.	.	C	15.31	2.796436	0.50208	.	.	ENSG00000125648	ENST00000264088;ENST00000301454;ENST00000414491;ENST00000334510	T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33	5.79	3.69	0.42338	Mitochondrial carrier domain (2);	0.000000	0.85682	D	0.000000	D	0.89584	0.6757	M	0.92026	3.265	0.58432	D	0.999993	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.89269	0.3603	10	0.87932	D	0	-42.9491	6.1688	0.20406	0.0:0.6746:0.0:0.3254	.	68;251	E7ESZ5;Q9BV35	.;SCMC3_HUMAN	N	298;251;68;251	ENSP00000264088:K298N;ENSP00000301454:K251N;ENSP00000408814:K68N;ENSP00000334537:K251N	ENSP00000264088:K298N	K	-	3	2	SLC25A23	6405376	1.000000	0.71417	1.000000	0.80357	0.167000	0.22549	1.075000	0.30716	1.462000	0.47948	0.655000	0.94253	AAG	SLC25A23	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier		0.542	SLC25A23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A23	HGNC	protein_coding	OTTHUMT00000453325.1	C	NM_024103		6454376	-1	no_errors	ENST00000264088	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC44A2	57153	genome.wustl.edu	37	19	10741983	10741983	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:10741983C>T	ENST00000335757.5	+	6	739	c.363C>T	c.(361-363)ctC>ctT	p.L121L	SLC44A2_ENST00000407327.4_Silent_p.L119L|SLC44A2_ENST00000586078.1_Silent_p.L121L			Q8IWA5	CTL2_HUMAN	solute carrier family 44 (choline transporter), member 2	121					choline transport (GO:0015871)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)	choline transmembrane transporter activity (GO:0015220)|signal transducer activity (GO:0004871)			NS(1)|breast(3)|endometrium(5)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	27			Epithelial(33;8.7e-06)|all cancers(31;2.77e-05)		Choline(DB00122)	ACCGCTACCTCACGTACCTGA	0.542																																																	0													117.0	116.0	117.0					19																	10741983		2203	4300	6503	SO:0001819	synonymous_variant	57153			AF070636	CCDS12245.1, CCDS54216.1	19p13.2	2014-08-12	2013-07-17		ENSG00000129353	ENSG00000129353		"""Solute carriers"""	17292	protein-coding gene	gene with protein product		606106				10677542, 15715662	Standard	NM_001145056		Approved	CTL2	uc002mpf.3	Q8IWA5	OTTHUMG00000180585	ENST00000335757.5:c.363C>T	19.37:g.10741983C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBB1|B3KNH3|B4DFJ0|F2Q9D7|Q658V1|Q658Z2|Q6PJV7|Q8N2F0|Q9NY68	Silent	SNP	pfam_Choline_transptr-like	p.L121	ENST00000335757.5	37	c.363	CCDS12245.1	19																																																																																			SLC44A2	-	NULL		0.542	SLC44A2-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC44A2	HGNC	protein_coding	OTTHUMT00000452045.1	C			10741983	+1	no_errors	ENST00000335757	ensembl	human	known	70_37	silent	SNP	1.000	T
SLC45A4	57210	genome.wustl.edu	37	8	142225950	142225950	+	Missense_Mutation	SNP	C	C	T	rs200395774		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:142225950C>T	ENST00000024061.3	-	6	2003	c.1696G>A	c.(1696-1698)Gcc>Acc	p.A566T	SLC45A4_ENST00000519067.1_Missense_Mutation_p.A566T|SLC45A4_ENST00000517878.1_Missense_Mutation_p.A617T|SLC45A4_ENST00000433583.2_Missense_Mutation_p.A559T	NM_001080431.1	NP_001073900.1	Q5BKX6	S45A4_HUMAN	solute carrier family 45, member 4						transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(6)|lung(9)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	31	all_cancers(97;1.52e-15)|all_epithelial(106;2.92e-14)|Lung NSC(106;1.23e-05)|all_lung(105;1.75e-05)|Ovarian(258;0.01)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0493)			GTGACCATGGCGACGTAGACG	0.602																																																	0													203.0	140.0	161.0					8																	142225950		2203	4300	6503	SO:0001583	missense	57210			AB032952	CCDS34948.1, CCDS69550.1, CCDS75795.1	8q24.3	2013-05-22						"""Solute carriers"""	29196	protein-coding gene	gene with protein product							Standard	NM_001080431		Approved	KIAA1126	uc003ywd.1	Q5BKX6		ENST00000024061.3:c.1696G>A	8.37:g.142225950C>T	ENSP00000024061:p.Ala566Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRI2|Q9ULU3	Missense_Mutation	SNP	superfamily_MFS_dom_general_subst_transpt	p.A617T	ENST00000024061.3	37	c.1849	CCDS34948.1	8	.	.	.	.	.	.	.	.	.	.	C	12.01	1.810351	0.32053	.	.	ENSG00000022567	ENST00000519067;ENST00000517878;ENST00000433583;ENST00000024061	D;D;D;D	0.95656	-3.77;-3.77;-3.77;-3.77	5.41	5.41	0.78517	.	0.352654	0.33235	N	0.005127	D	0.86797	0.6019	N	0.11789	0.175	0.41943	D	0.990625	P;P;P	0.42078	0.66;0.653;0.77	B;B;B	0.35182	0.096;0.14;0.197	D	0.85088	0.0950	10	0.23302	T	0.38	-47.1591	8.0719	0.30693	0.1592:0.7551:0.0:0.0857	.	617;566;566	E7EV90;Q5BKX6-3;Q5BKX6-2	.;.;.	T	566;617;559;566	ENSP00000429059:A566T;ENSP00000428137:A617T;ENSP00000400799:A559T;ENSP00000024061:A566T	ENSP00000024061:A566T	A	-	1	0	SLC45A4	142295132	0.917000	0.31117	0.999000	0.59377	0.819000	0.46315	1.686000	0.37669	2.526000	0.85167	0.462000	0.41574	GCC	SLC45A4	-	superfamily_MFS_dom_general_subst_transpt		0.602	SLC45A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC45A4	HGNC	protein_coding	OTTHUMT00000378571.3	C	XM_050325		142225950	-1	no_errors	ENST00000517878	ensembl	human	known	70_37	missense	SNP	0.952	T
SLC4A11	83959	genome.wustl.edu	37	20	3210347	3210347	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:3210347G>C	ENST00000380056.3	-	13	1660	c.1613C>G	c.(1612-1614)tCa>tGa	p.S538*	SLC4A11_ENST00000539553.2_Nonsense_Mutation_p.S522*|SLC4A11_ENST00000488544.1_5'UTR|SLC4A11_ENST00000380059.3_Nonsense_Mutation_p.S565*	NM_032034.3	NP_114423.1	Q8NBS3	S4A11_HUMAN	solute carrier family 4, sodium borate transporter, member 11	538	Membrane (bicarbonate transporter).				bicarbonate transport (GO:0015701)|borate transmembrane transport (GO:0035445)|borate transport (GO:0046713)|cellular cation homeostasis (GO:0030003)|fluid transport (GO:0042044)|proton transport (GO:0015992)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	basolateral plasma membrane (GO:0016323)|integral component of membrane (GO:0016021)	bicarbonate transmembrane transporter activity (GO:0015106)|borate transmembrane transporter activity (GO:0046715)|hydrogen ion channel activity (GO:0015252)|inorganic anion exchanger activity (GO:0005452)|protein dimerization activity (GO:0046983)|sodium channel activity (GO:0005272)|symporter activity (GO:0015293)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|liver(1)|lung(16)|ovary(2)|prostate(4)|soft_tissue(1)|urinary_tract(1)	40						GCCGAGGCCTGACAGGCTGAC	0.602																																					NSCLC(190;922 2139 10266 10292 38692)												0													84.0	84.0	84.0					20																	3210347		2203	4300	6503	SO:0001587	stop_gained	83959			AF336127	CCDS13052.1, CCDS54445.1, CCDS54446.1	20p13	2014-02-14	2007-08-03		ENSG00000088836	ENSG00000088836		"""Solute carriers"""	16438	protein-coding gene	gene with protein product		610206	"""corneal endothelial dystrophy 2 (autosomal recessive)"", ""solute carrier family 4, sodium bicarbonate transporter-like, member 11"", ""corneal dystrophy and perceptive deafness 1"""	CHED2, CDPD1		10843999, 11302728, 16767101	Standard	NM_001174089		Approved	dJ794I6.2, BTR1, NaBC1, FECD4	uc010zqe.2	Q8NBS3	OTTHUMG00000031740	ENST00000380056.3:c.1613C>G	20.37:g.3210347G>C	ENSP00000369396:p.Ser538*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKC8|B4DKX9|G3V1M3|Q2TB62|Q2TB63|Q9BXF4|Q9NTW9	Nonsense_Mutation	SNP	pfam_HCO3_transpt_C,pfam_PTS_EIIA_2,superfamily_PTrfase/Anion_transptr,prints_HCO3_transpt_euk	p.S565*	ENST00000380056.3	37	c.1694	CCDS13052.1	20	.	.	.	.	.	.	.	.	.	.	G	23.6	4.437746	0.83885	.	.	ENSG00000088836	ENST00000380059;ENST00000380056;ENST00000539553	.	.	.	4.88	-0.22	0.13130	.	19.171700	0.00166	N	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.24483	T	0.36	.	2.3616	0.04308	0.3351:0.0:0.2767:0.3882	.	.	.	.	X	565;538;522	.	ENSP00000369396:S538X	S	-	2	0	SLC4A11	3158347	0.032000	0.19561	0.021000	0.16686	0.037000	0.13140	1.281000	0.33214	0.294000	0.22547	-0.521000	0.04368	TCA	SLC4A11	-	pfam_HCO3_transpt_C		0.602	SLC4A11-002	KNOWN	basic|CCDS	protein_coding	SLC4A11	HGNC	protein_coding	OTTHUMT00000077728.1	G			3210347	-1	no_errors	ENST00000380059	ensembl	human	known	70_37	nonsense	SNP	0.003	C
SLC9C1	285335	genome.wustl.edu	37	3	111886195	111886195	+	Splice_Site	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:111886195C>G	ENST00000305815.5	-	26	3490		c.e26-1		SLC9C1_ENST00000487372.1_Splice_Site	NM_183061.1	NP_898884.1	Q4G0N8	SL9C1_HUMAN	solute carrier family 9, subfamily C (Na+-transporting carboxylic acid decarboxylase), member 1						cell differentiation (GO:0030154)|ion transmembrane transport (GO:0034220)|multicellular organismal development (GO:0007275)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	solute:proton antiporter activity (GO:0015299)										TACTTTGTATCTGAAAGTTGA	0.308																																																	0													50.0	49.0	49.0					3																	111886195		2196	4284	6480	SO:0001630	splice_region_variant	285335			AK128084	CCDS33817.1	3q13	2013-05-22	2012-03-22	2012-03-22	ENSG00000172139	ENSG00000172139		"""Solute carriers"""	31401	protein-coding gene	gene with protein product	"""sperm-NHE"""	612738	"""solute carrier family 9, isoform 10"", ""solute carrier family 9, member 10"""	SLC9A10		12783626	Standard	NM_183061		Approved	NHE	uc003dyu.3	Q4G0N8	OTTHUMG00000159245	ENST00000305815.5:c.3238-1G>C	3.37:g.111886195C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRP4|Q7RTP2	Splice_Site	SNP	-	e25-1	ENST00000305815.5	37	c.3238-1	CCDS33817.1	3	.	.	.	.	.	.	.	.	.	.	C	16.11	3.031384	0.54790	.	.	ENSG00000172139	ENST00000305815;ENST00000487372	.	.	.	4.31	4.31	0.51392	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	12.5831	0.56401	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SLC9A10	113368885	1.000000	0.71417	0.994000	0.49952	0.850000	0.48378	3.231000	0.51294	2.698000	0.92095	0.643000	0.83706	.	SLC9C1	-	-		0.308	SLC9C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC9C1	HGNC	protein_coding	OTTHUMT00000354066.1	C	NM_183061	Intron	111886195	-1	no_errors	ENST00000305815	ensembl	human	known	70_37	splice_site	SNP	0.996	G
SMARCD3	6604	genome.wustl.edu	37	7	150937513	150937513	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:150937513G>C	ENST00000262188.8	-	9	1445	c.1035C>G	c.(1033-1035)atC>atG	p.I345M	SMARCD3_ENST00000477169.1_5'Flank|SMARCD3_ENST00000356800.2_Missense_Mutation_p.I332M|RP4-548D19.3_ENST00000607902.1_RNA|SMARCD3_ENST00000392811.2_Missense_Mutation_p.I332M|MIR671_ENST00000390183.1_RNA	NM_001003801.1	NP_001003801.1	Q6STE5	SMRD3_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 3	345					cardiac right ventricle formation (GO:0003219)|cellular lipid metabolic process (GO:0044255)|chromatin remodeling (GO:0006338)|muscle cell differentiation (GO:0042692)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of protein binding (GO:0043393)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|secondary heart field specification (GO:0003139)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	ligand-dependent nuclear receptor binding (GO:0016922)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nuclear hormone receptor binding (GO:0035257)|receptor binding (GO:0005102)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)			haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(6)|ovary(2)	15			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		CACCTCACCTGATGACATGGT	0.562																																																	0													64.0	67.0	66.0					7																	150937513		2203	4300	6503	SO:0001583	missense	6604			U66619	CCDS5924.1, CCDS34780.1	7q35-q36	2008-07-18			ENSG00000082014	ENSG00000082014			11108	protein-coding gene	gene with protein product	"""mammalian chromatin remodeling complex BRG1-associated factor 60C"", ""Swp73-like protein"", ""SWI/SNF complex 60 kDa subunit C"", ""60kDa BRG-1/Brm associated factor subunit c"""	601737				8804307, 9693044	Standard	NM_001003801		Approved	BAF60C, Rsc6p, CRACD3	uc003wjs.3	Q6STE5	OTTHUMG00000157431	ENST00000262188.8:c.1035C>G	7.37:g.150937513G>C	ENSP00000262188:p.Ile345Met	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX10|Q2YD86|Q75MJ2|Q75MR8|Q92926|Q9BUH1	Missense_Mutation	SNP	pfam_SWIB_MDM2_domain,superfamily_SWIB_MDM2_domain,smart_SWIB_domain	p.I345M	ENST00000262188.8	37	c.1035	CCDS34780.1	7	.	.	.	.	.	.	.	.	.	.	G	20.9	4.074235	0.76415	.	.	ENSG00000082014	ENST00000262188;ENST00000392811;ENST00000356800;ENST00000347683	T;T;T	0.62941	-0.01;-0.01;-0.01	5.39	4.52	0.55395	.	0.000000	0.85682	D	0.000000	D	0.83041	0.5168	H	0.94542	3.55	0.80722	D	1	D;D	0.69078	0.988;0.997	D;D	0.69654	0.965;0.929	D	0.87185	0.2230	10	0.87932	D	0	-17.5088	12.5996	0.56489	0.0801:0.0:0.9199:0.0	.	332;345	Q6STE5-2;Q6STE5	.;SMRD3_HUMAN	M	345;332;332;297	ENSP00000262188:I345M;ENSP00000376558:I332M;ENSP00000349254:I332M	ENSP00000262188:I345M	I	-	3	3	SMARCD3	150568446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.954000	0.87848	1.278000	0.44430	0.563000	0.77884	ATC	SMARCD3	-	NULL		0.562	SMARCD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCD3	HGNC	protein_coding	OTTHUMT00000348825.1	G	NM_001003801		150937513	-1	no_errors	ENST00000262188	ensembl	human	known	70_37	missense	SNP	1.000	C
SMARCE1	6605	genome.wustl.edu	37	17	38788620	38788620	+	Splice_Site	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:38788620C>G	ENST00000348513.6	-	8	1322		c.e8-1		KRT222_ENST00000476049.1_Splice_Site|SMARCE1_ENST00000580419.1_Splice_Site|SMARCE1_ENST00000400122.3_Splice_Site|SMARCE1_ENST00000377808.4_Splice_Site|SMARCE1_ENST00000431889.2_Splice_Site|SMARCE1_ENST00000578044.1_Splice_Site|SMARCE1_ENST00000544009.1_Splice_Site	NM_003079.4	NP_003070.3	Q969G3	SMCE1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily e, member 1						ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|metabolic process (GO:0008152)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear chromosome (GO:0000228)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|N-acetyltransferase activity (GO:0008080)|protein N-terminus binding (GO:0047485)|RNA binding (GO:0003723)|transcription coactivator activity (GO:0003713)			large_intestine(1)	1		Breast(137;0.000812)				TCATCATAATCTGGAGTGAAC	0.433																																																	0													54.0	55.0	55.0					17																	38788620		2203	4300	6503	SO:0001630	splice_region_variant	6605			AF035262	CCDS11370.1	17q21.2	2006-09-20			ENSG00000073584	ENSG00000073584			11109	protein-coding gene	gene with protein product		603111				9435219	Standard	NM_003079		Approved	BAF57	uc002hux.2	Q969G3	OTTHUMG00000133367	ENST00000348513.6:c.542-1G>C	17.37:g.38788620C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMC1|B4DFR4|C0IMW4|C0IMW5|C0IMW7|H7C3F6|O43539	Splice_Site	SNP	-	e7-1	ENST00000348513.6	37	c.542-1	CCDS11370.1	17	.	.	.	.	.	.	.	.	.	.	C	18.82	3.704674	0.68615	.	.	ENSG00000073584	ENST00000348513;ENST00000544009;ENST00000431889;ENST00000400122;ENST00000377808	.	.	.	5.53	5.53	0.82687	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.8372	0.96661	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	SMARCE1	36042146	1.000000	0.71417	1.000000	0.80357	0.787000	0.44495	7.511000	0.81718	2.770000	0.95276	0.655000	0.94253	.	SMARCE1	-	-		0.433	SMARCE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCE1	HGNC	protein_coding	OTTHUMT00000257203.1	C	NM_003079	Intron	38788620	-1	no_errors	ENST00000348513	ensembl	human	known	70_37	splice_site	SNP	1.000	G
SMC1A	8243	genome.wustl.edu	37	X	53430514	53430514	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:53430514C>T	ENST00000322213.4	-	15	2531	c.2404G>A	c.(2404-2406)Gaa>Aaa	p.E802K		NM_006306.2	NP_006297.2	Q14683	SMC1A_HUMAN	structural maintenance of chromosomes 1A	802					DNA repair (GO:0006281)|gene expression (GO:0010467)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic sister chromatid cohesion (GO:0007064)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle organization (GO:0007052)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of DNA endoreduplication (GO:0032876)|response to radiation (GO:0009314)|RNA splicing (GO:0008380)|signal transduction in response to DNA damage (GO:0042770)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin core heterodimer (GO:0008280)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|meiotic cohesin complex (GO:0030893)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)|protein heterodimerization activity (GO:0046982)			NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(8)|ovary(5)|upper_aerodigestive_tract(2)	49						TTGGCGATTTCATTCTGCCGT	0.493																																																	0													180.0	147.0	158.0					X																	53430514		2203	4300	6503	SO:0001583	missense	8243			S78271	CCDS14352.1, CCDS75985.1	Xp11.22-p11.21	2014-09-17	2006-07-06	2006-07-06	ENSG00000072501	ENSG00000072501		"""Structural maintenance of chromosomes proteins"""	11111	protein-coding gene	gene with protein product		300040	"""SMC1 (structural maintenance of chromosomes 1, yeast)-like 1"", ""SMC1 structural maintenance of chromosomes 1-like 1 (yeast)"""	SMC1L1		7757074	Standard	NM_006306		Approved	DXS423E, KIAA0178, SB1.8, Smcb	uc004dsg.3	Q14683	OTTHUMG00000021614	ENST00000322213.4:c.2404G>A	X.37:g.53430514C>T	ENSP00000323421:p.Glu802Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O14995|Q16351|Q2M228	Missense_Mutation	SNP	pfam_RecF/RecN/SMC,pfam_SMC_hinge,superfamily_SMC_hinge,smart_SMC_hinge,prints_Tropomyosin	p.E802K	ENST00000322213.4	37	c.2404	CCDS14352.1	X	.	.	.	.	.	.	.	.	.	.	C	29.6	5.023999	0.93462	.	.	ENSG00000072501	ENST00000322213	T	0.79554	-1.28	4.58	4.58	0.56647	RecF/RecN/SMC (1);	0.000000	0.85682	D	0.000000	D	0.88669	0.6499	M	0.72118	2.19	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.992;0.996	D	0.90120	0.4198	10	0.87932	D	0	.	15.6293	0.76888	0.0:1.0:0.0:0.0	.	780;802	Q6MZR8;Q14683	.;SMC1A_HUMAN	K	802	ENSP00000323421:E802K	ENSP00000323421:E802K	E	-	1	0	SMC1A	53447239	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	7.316000	0.79007	2.290000	0.77057	0.523000	0.50628	GAA	SMC1A	-	pfam_RecF/RecN/SMC		0.493	SMC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC1A	HGNC	protein_coding	OTTHUMT00000056756.2	C	NM_006306		53430514	-1	no_errors	ENST00000322213	ensembl	human	known	70_37	missense	SNP	1.000	T
SMYD4	114826	genome.wustl.edu	37	17	1703264	1703264	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:1703264G>A	ENST00000305513.7	-	5	1591	c.1424C>T	c.(1423-1425)gCa>gTa	p.A475V		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	475	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						TGTCACTGCTGCTTTAAGCTG	0.512																																																	0													103.0	79.0	87.0					17																	1703264		2203	4300	6503	SO:0001583	missense	114826			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1424C>T	17.37:g.1703264G>A	ENSP00000304360:p.Ala475Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.A475V	ENST00000305513.7	37	c.1424	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	G	19.19	3.779587	0.70107	.	.	ENSG00000186532	ENST00000305513	T	0.80480	-1.38	6.03	5.01	0.66863	SET domain (2);	0.503479	0.24048	N	0.042034	T	0.76870	0.4048	L	0.48362	1.52	0.09310	N	1	P	0.45044	0.849	B	0.43990	0.438	T	0.69401	-0.5155	10	0.30078	T	0.28	-3.1435	13.9257	0.63961	0.0:0.0:0.7341:0.2658	.	475	Q8IYR2	SMYD4_HUMAN	V	475	ENSP00000304360:A475V	ENSP00000304360:A475V	A	-	2	0	SMYD4	1650014	0.209000	0.23505	0.376000	0.26042	0.042000	0.13812	2.809000	0.47971	2.861000	0.98227	0.655000	0.94253	GCA	SMYD4	-	pfam_SET_dom		0.512	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	G	XM_056082		1703264	-1	no_errors	ENST00000305513	ensembl	human	known	70_37	missense	SNP	0.032	A
SMYD4	114826	genome.wustl.edu	37	17	1703353	1703353	+	Silent	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:1703353G>C	ENST00000305513.7	-	5	1502	c.1335C>G	c.(1333-1335)ctC>ctG	p.L445L		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	445	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						CAGAAACACAGAGAGCACAGA	0.453																																																	0													89.0	82.0	85.0					17																	1703353		2203	4300	6503	SO:0001819	synonymous_variant	114826			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1335C>G	17.37:g.1703353G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Silent	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.L445	ENST00000305513.7	37	c.1335	CCDS11013.1	17																																																																																			SMYD4	-	pfam_SET_dom		0.453	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	G	XM_056082		1703353	-1	no_errors	ENST00000305513	ensembl	human	known	70_37	silent	SNP	0.005	C
SMYD4	114826	genome.wustl.edu	37	17	1703679	1703679	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:1703679G>C	ENST00000305513.7	-	5	1176	c.1009C>G	c.(1009-1011)Ctg>Gtg	p.L337V		NM_052928.2	NP_443160.2	Q8IYR2	SMYD4_HUMAN	SET and MYND domain containing 4	337	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.						metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(4)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(5)|stomach(1)	21						AGCCCTCCCAGAGGACATTCT	0.517																																																	0													76.0	72.0	73.0					17																	1703679		2203	4300	6503	SO:0001583	missense	114826			AB067523	CCDS11013.1	17p13.3	2004-04-21			ENSG00000186532	ENSG00000186532		"""Zinc fingers, MYND-type"""	21067	protein-coding gene	gene with protein product						11572484	Standard	NM_052928		Approved	KIAA1936, ZMYND21	uc002ftm.4	Q8IYR2	OTTHUMG00000090570	ENST00000305513.7:c.1009C>G	17.37:g.1703679G>C	ENSP00000304360:p.Leu337Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N1P2|Q8NAT0|Q96LV4|Q96PV2	Missense_Mutation	SNP	pfam_SET_dom,pfam_Znf_MYND,pfscan_SET_dom,pfscan_Znf_MYND	p.L337V	ENST00000305513.7	37	c.1009	CCDS11013.1	17	.	.	.	.	.	.	.	.	.	.	G	8.506	0.865468	0.17250	.	.	ENSG00000186532	ENST00000305513	T	0.09817	2.94	6.17	3.09	0.35607	SET domain (2);	0.269110	0.37623	N	0.002011	T	0.13628	0.0330	L	0.52905	1.665	0.09310	N	1	P	0.50156	0.932	P	0.51324	0.666	T	0.10497	-1.0627	10	0.34782	T	0.22	-0.6691	2.5505	0.04748	0.2221:0.1313:0.5116:0.1349	.	337	Q8IYR2	SMYD4_HUMAN	V	337	ENSP00000304360:L337V	ENSP00000304360:L337V	L	-	1	2	SMYD4	1650429	0.093000	0.21703	0.002000	0.10522	0.029000	0.11900	0.230000	0.17852	0.906000	0.36621	-0.140000	0.14226	CTG	SMYD4	-	pfam_SET_dom		0.517	SMYD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMYD4	HGNC	protein_coding	OTTHUMT00000207108.4	G	XM_056082		1703679	-1	no_errors	ENST00000305513	ensembl	human	known	70_37	missense	SNP	0.001	C
SMG8	55181	genome.wustl.edu	37	17	57290613	57290613	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:57290613G>C	ENST00000543872.2	+	4	2693	c.2429G>C	c.(2428-2430)gGa>gCa	p.G810A	CTD-2510F5.6_ENST00000577660.1_Intron|SMG8_ENST00000300917.5_Missense_Mutation_p.G810A			Q8ND04	SMG8_HUMAN	SMG8 nonsense mediated mRNA decay factor	810					gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|regulation of protein kinase activity (GO:0045859)|RNA metabolic process (GO:0016070)	cytosol (GO:0005829)				NS(1)|breast(5)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(9)|ovary(3)|prostate(1)|skin(1)	33						GAAGATGAAGGAGACTTAGAC	0.433																																																	0													140.0	137.0	138.0					17																	57290613		2203	4300	6503	SO:0001583	missense	55181			AL834490	CCDS11615.1	17q23.2	2013-07-02	2013-07-02	2011-06-21					25551	protein-coding gene	gene with protein product		613175	"""chromosome 17 open reading frame 71"", ""smg-8 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	C17orf71		19417104	Standard	NM_018149		Approved	FLJ10587, FLJ23205	uc002ixi.3	Q8ND04		ENST00000543872.2:c.2429G>C	17.37:g.57290613G>C	ENSP00000438748:p.Gly810Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N5U5|Q8TDN0|Q9H5P5|Q9NVQ1	Missense_Mutation	SNP	pfam_Smg8/Smg9	p.G810A	ENST00000543872.2	37	c.2429	CCDS11615.1	17	.	.	.	.	.	.	.	.	.	.	G	12.29	1.892300	0.33442	.	.	ENSG00000167447	ENST00000300917;ENST00000543872	T;T	0.44482	0.92;0.92	6.07	6.07	0.98685	.	0.148304	0.64402	D	0.000008	T	0.34745	0.0908	N	0.21448	0.665	0.48762	D	0.999701	B	0.14012	0.009	B	0.11329	0.006	T	0.04440	-1.0951	10	0.40728	T	0.16	-16.0931	19.6475	0.95784	0.0:0.0:1.0:0.0	.	810	Q8ND04	SMG8_HUMAN	A	810	ENSP00000300917:G810A;ENSP00000438748:G810A	ENSP00000300917:G810A	G	+	2	0	SMG8	54645395	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.519000	0.81809	2.885000	0.99019	0.655000	0.94253	GGA	SMG8	-	pfam_Smg8/Smg9		0.433	SMG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMG8	HGNC	protein_coding	OTTHUMT00000445960.2	G	NM_018149		57290613	+1	no_errors	ENST00000300917	ensembl	human	known	70_37	missense	SNP	1.000	C
SNAI3	333929	genome.wustl.edu	37	16	88744857	88744857	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:88744857C>T	ENST00000332281.5	-	3	964	c.878G>A	c.(877-879)tGa>tAa	p.*293*	SNAI3-AS1_ENST00000568633.1_RNA|SNAI3-AS1_ENST00000563261.1_RNA	NM_178310.3	NP_840101.1	Q3KNW1	SNAI3_HUMAN	snail family zinc finger 3	0					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor complex (GO:0005667)	copper ion binding (GO:0005507)|DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(1)|kidney(1)|lung(1)|ovary(1)|skin(1)	6				BRCA - Breast invasive adenocarcinoma(80;0.048)		ACGTGCCTCTCAGGGGCCCGG	0.701																																					Colon(27;366 710 19748 23199 27567)												0													25.0	24.0	24.0					16																	88744857		2196	4297	6493	SO:0001819	synonymous_variant	333929			BC041461	CCDS32505.1	16q24.3	2013-05-23	2013-05-23			ENSG00000185669		"""Snail homologs"", ""Zinc fingers, C2H2-type"""	18411	protein-coding gene	gene with protein product		612741	"""zinc finger protein 293"", ""snail homolog 3 (Drosophila)"""	ZNF293		12579345	Standard	NM_178310		Approved	SMUC, Zfp293	uc002flj.3	Q3KNW1		ENST00000332281.5:c.878G>A	16.37:g.88744857C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SU5	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.*293	ENST00000332281.5	37	c.878	CCDS32505.1	16																																																																																			SNAI3	-	NULL		0.701	SNAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAI3	HGNC	protein_coding	OTTHUMT00000422582.1	C			88744857	-1	no_errors	ENST00000332281	ensembl	human	known	70_37	silent	SNP	1.000	T
SNX27	81609	genome.wustl.edu	37	1	151664974	151664974	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:151664974G>C	ENST00000458013.2	+	9	1423	c.1303G>C	c.(1303-1305)Gac>Cac	p.D435H	SNX27_ENST00000368843.3_Missense_Mutation_p.D435H|SNX27_ENST00000368838.1_Missense_Mutation_p.D342H			Q96L92	SNX27_HUMAN	sorting nexin family member 27	435	FERM-like region F3.				endosomal transport (GO:0016197)|endosome to lysosome transport (GO:0008333)|establishment of natural killer cell polarity (GO:0001770)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to plasma membrane (GO:1990126)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|immunological synapse (GO:0001772)|nucleus (GO:0005634)	phosphatidylinositol-3-phosphate binding (GO:0032266)			central_nervous_system(1)|large_intestine(2)|ovary(2)	5	Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		LUSC - Lung squamous cell carcinoma(543;0.181)			CTGTGCCTGTGACTCCAGGAG	0.438																																					Colon(46;291 966 40145 41237 41888)												0													125.0	106.0	113.0					1																	151664974		2203	4300	6503	SO:0001583	missense	81609			AB007957	CCDS1001.1	1q21.3	2008-03-11			ENSG00000143376	ENSG00000143376		"""Sorting nexins"""	20073	protein-coding gene	gene with protein product		611541				12461558	Standard	XM_005245509		Approved	MY014, KIAA0488, MGC20471	uc001eyn.1	Q96L92	OTTHUMG00000013052	ENST00000458013.2:c.1303G>C	1.37:g.151664974G>C	ENSP00000400333:p.Asp435His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32Q36|Q4AEJ5|Q5VWB0|Q5VWB1|Q5VWB2|Q6IPP6|Q86UB1|Q96D79|Q9H3K8	Missense_Mutation	SNP	pfam_Phox,pfam_PDZ,pfam_Ras-assoc,superfamily_Phox,superfamily_PDZ,smart_PDZ,smart_Phox,pfscan_PDZ,pfscan_Phox,pfscan_Ras-assoc	p.D435H	ENST00000458013.2	37	c.1303		1	.	.	.	.	.	.	.	.	.	.	G	29.0	4.969490	0.92855	.	.	ENSG00000143376	ENST00000458013;ENST00000368843;ENST00000368838	D;D;D	0.97114	-4.25;-4.25;-4.25	6.01	6.01	0.97437	.	0.000000	0.85682	D	0.000000	D	0.98185	0.9400	M	0.73962	2.25	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.78314	0.969;0.991	D	0.98832	1.0751	10	0.87932	D	0	.	17.2404	0.87011	0.0:0.0:1.0:0.0	.	435;435	Q96L92;Q96L92-3	SNX27_HUMAN;.	H	435;435;342	ENSP00000400333:D435H;ENSP00000357836:D435H;ENSP00000357831:D342H	ENSP00000357831:D342H	D	+	1	0	SNX27	149931598	1.000000	0.71417	0.995000	0.50966	0.999000	0.98932	8.736000	0.91554	2.861000	0.98227	0.650000	0.86243	GAC	SNX27	-	NULL		0.438	SNX27-003	NOVEL	basic	protein_coding	SNX27	HGNC	protein_coding	OTTHUMT00000036624.3	G	NM_030918		151664974	+1	no_errors	ENST00000368843	ensembl	human	known	70_37	missense	SNP	1.000	C
SPERT	220082	genome.wustl.edu	37	13	46288426	46288426	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr13:46288426G>A	ENST00000310521.1	+	3	1346	c.1266G>A	c.(1264-1266)gcG>gcA	p.A422A	SPERT_ENST00000378966.3_Silent_p.A386A	NM_152719.1	NP_689932.1	Q8NA61	SPERT_HUMAN	spermatid associated	422						cytoplasmic membrane-bounded vesicle (GO:0016023)				NS(1)|central_nervous_system(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(1)	15		Breast(56;0.000819)|Lung NSC(96;0.00227)|Prostate(109;0.00703)|Lung SC(185;0.0367)|Hepatocellular(98;0.0556)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;7.26e-05)		AGGTCACCGCGCGCATGGAAA	0.617																																																	0													26.0	23.0	24.0					13																	46288426		2203	4300	6503	SO:0001819	synonymous_variant	220082			AK093129	CCDS9399.1, CCDS66540.1	13q14.13	2010-03-23			ENSG00000174015	ENSG00000174015			30720	protein-coding gene	gene with protein product	"""spermatid flower-like structure protein"", ""testis specific leucine zipper protein nurit"", ""chibby homolog 2 (Drosophila)"""					12204287, 20096028	Standard	NM_001286341		Approved	NURIT, CBY2	uc001van.1	Q8NA61	OTTHUMG00000016861	ENST00000310521.1:c.1266G>A	13.37:g.46288426G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8I5|Q8NHV2	Silent	SNP	NULL	p.A422	ENST00000310521.1	37	c.1266	CCDS9399.1	13																																																																																			SPERT	-	NULL		0.617	SPERT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPERT	HGNC	protein_coding	OTTHUMT00000044786.2	G	NM_152719		46288426	+1	no_errors	ENST00000310521	ensembl	human	known	70_37	silent	SNP	0.995	A
SPOPL	339745	genome.wustl.edu	37	2	139326585	139326585	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:139326585C>T	ENST00000280098.4	+	11	1493	c.1114C>T	c.(1114-1116)Cga>Tga	p.R372*	AC092620.2_ENST00000458007.2_RNA	NM_001001664.2	NP_001001664.1	Q6IQ16	SPOPL_HUMAN	speckle-type POZ protein-like	372					negative regulation of protein ubiquitination (GO:0031397)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)	Cul3-RING ubiquitin ligase complex (GO:0031463)|nucleus (GO:0005634)				breast(2)|cervix(2)|endometrium(2)|large_intestine(2)|lung(11)|skin(2)	21				BRCA - Breast invasive adenocarcinoma(221;0.0296)		AGAAGCCTTTCGAGCACTAGC	0.423																																																	0													260.0	261.0	260.0					2																	139326585		2203	4300	6503	SO:0001587	stop_gained	339745				CCDS33298.1	2q22.1	2013-01-09			ENSG00000144228	ENSG00000144228		"""BTB/POZ domain containing"""	27934	protein-coding gene	gene with protein product	"""HIB homolog 2"", ""roadkill homolog 2"""						Standard	NM_001001664		Approved	BTBD33	uc002tvh.3	Q6IQ16	OTTHUMG00000153635	ENST00000280098.4:c.1114C>T	2.37:g.139326585C>T	ENSP00000280098:p.Arg372*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_BTB_POZ,pfam_MATH,superfamily_TRAF-like,superfamily_BTB/POZ_fold,smart_MATH,smart_BTB/POZ-like,pfscan_BTB/POZ-like,pfscan_MATH	p.R372*	ENST00000280098.4	37	c.1114	CCDS33298.1	2	.	.	.	.	.	.	.	.	.	.	C	41	8.596275	0.98879	.	.	ENSG00000144228	ENST00000280098	.	.	.	5.97	5.08	0.68730	.	0.058159	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-11.9914	16.3912	0.83541	0.1328:0.8671:0.0:0.0	.	.	.	.	X	372	.	.	R	+	1	2	SPOPL	139043055	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.053000	0.57427	1.494000	0.48533	0.655000	0.94253	CGA	SPOPL	-	NULL		0.423	SPOPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPOPL	HGNC	protein_coding	OTTHUMT00000331897.1	C			139326585	+1	no_errors	ENST00000280098	ensembl	human	known	70_37	nonsense	SNP	1.000	T
SRRM2	23524	genome.wustl.edu	37	16	2812010	2812010	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:2812010G>A	ENST00000301740.8	+	11	2030	c.1481G>A	c.(1480-1482)cGa>cAa	p.R494Q		NM_016333.3	NP_057417.3	Q9UQ35	SRRM2_HUMAN	serine/arginine repetitive matrix 2	494	Arg-rich.|Ser-rich.				mRNA splicing, via spliceosome (GO:0000398)	Cajal body (GO:0015030)|catalytic step 2 spliceosome (GO:0071013)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	C2H2 zinc finger domain binding (GO:0070742)|poly(A) RNA binding (GO:0044822)|protein N-terminus binding (GO:0047485)			breast(3)|central_nervous_system(1)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(20)|lung(34)|ovary(6)|pancreas(3)|prostate(2)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(7)	105						AAGAGAGGGCGATCTCGGTCT	0.577																																																	0													80.0	65.0	70.0					16																	2812010		2198	4300	6498	SO:0001583	missense	23524			AF201422	CCDS32373.1	16p13.3	2012-07-02			ENSG00000167978	ENSG00000167978			16639	protein-coding gene	gene with protein product		606032				10668804, 11004489	Standard	NM_016333		Approved	SRm300, SRL300, KIAA0324, Cwc21	uc002crk.3	Q9UQ35	OTTHUMG00000177358	ENST00000301740.8:c.1481G>A	16.37:g.2812010G>A	ENSP00000301740:p.Arg494Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB9|D3DU97|O15038|O94803|Q6NSL3|Q6PIM3|Q6PK40|Q8IW17|Q96GY7|Q9P0G1|Q9UHA8|Q9UQ36|Q9UQ37|Q9UQ38|Q9UQ40	Missense_Mutation	SNP	pfam_mRNA_splic_Cwf21	p.R494Q	ENST00000301740.8	37	c.1481	CCDS32373.1	16	.	.	.	.	.	.	.	.	.	.	G	9.718	1.158827	0.21454	.	.	ENSG00000167978	ENST00000301740;ENST00000382301;ENST00000426305	T	0.34275	1.37	5.87	4.91	0.64330	.	0.000000	0.50627	D	0.000104	T	0.33876	0.0878	N	0.24115	0.695	0.25857	N	0.983876	D	0.62365	0.991	P	0.49597	0.616	T	0.14839	-1.0458	10	0.35671	T	0.21	-7.9691	15.026	0.71669	0.0:0.1426:0.8574:0.0	.	494	Q9UQ35	SRRM2_HUMAN	Q	494;494;459	ENSP00000301740:R494Q	ENSP00000301740:R494Q	R	+	2	0	SRRM2	2752011	0.977000	0.34250	0.764000	0.31436	0.729000	0.41735	5.312000	0.65792	1.478000	0.48253	0.655000	0.94253	CGA	SRRM2	-	NULL		0.577	SRRM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM2	HGNC	protein_coding	OTTHUMT00000436411.1	G			2812010	+1	no_errors	ENST00000301740	ensembl	human	known	70_37	missense	SNP	0.898	A
SRCAP	10847	genome.wustl.edu	37	16	30724940	30724940	+	Missense_Mutation	SNP	C	C	G	rs573318039	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:30724940C>G	ENST00000262518.4	+	16	2786	c.2401C>G	c.(2401-2403)Cgc>Ggc	p.R801G	SNORA30_ENST00000384028.1_RNA|SRCAP_ENST00000344771.4_Missense_Mutation_p.R801G|SRCAP_ENST00000395059.2_Missense_Mutation_p.R801G	NM_006662.2	NP_006653.2	Q6ZRS2	SRCAP_HUMAN	Snf2-related CREBBP activator protein	801					histone acetylation (GO:0016573)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|protein complex (GO:0043234)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|histone acetyltransferase activity (GO:0004402)|transcription coactivator activity (GO:0003713)			NS(1)|breast(3)|cervix(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(22)|liver(3)|lung(62)|ovary(6)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	136			Colorectal(24;0.198)			CCAGTCTCATCGCGAGTTCAA	0.527																																																	0													194.0	171.0	179.0					16																	30724940		2197	4300	6497	SO:0001583	missense	10847			AB002307	CCDS10689.2	16p11.2	2009-08-06			ENSG00000080603	ENSG00000080603			16974	protein-coding gene	gene with protein product	"""Swi2/Snf2-related ATPase homolog (S. cerevisiae)"", ""domino homolog 1 (Drosophila)"""	611421				10347196, 9205841	Standard	NM_006662		Approved	KIAA0309, EAF1, SWR1, DOMO1	uc002dze.1	Q6ZRS2	OTTHUMG00000132393	ENST00000262518.4:c.2401C>G	16.37:g.30724940C>G	ENSP00000262518:p.Arg801Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B0JZA6|O15026|Q7Z744|Q9Y5L9	Missense_Mutation	SNP	pfam_SNF2_N,pfam_HSA,pfam_Helicase_C,smart_HAS_subgr,smart_Helicase_ATP-bd,smart_Helicase_C,smart_AT_hook_DNA-bd_motif,pfscan_Helicase/SANT-assoc_DNA-bd,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,prints_AT_hook-like	p.R801G	ENST00000262518.4	37	c.2401	CCDS10689.2	16	.	.	.	.	.	.	.	.	.	.	C	17.15	3.314972	0.60524	.	.	ENSG00000080603	ENST00000262518;ENST00000395059;ENST00000344771	D;D;D	0.93712	-3.27;-3.27;-3.27	5.54	5.54	0.83059	DEAD-like helicase (1);SNF2-related (1);	0.000000	0.56097	D	0.000025	D	0.94624	0.8267	L	0.31371	0.925	0.80722	D	1	P;D;D	0.89917	0.724;1.0;1.0	P;D;D	0.91635	0.575;0.998;0.999	D	0.94935	0.8086	10	0.66056	D	0.02	-8.1585	18.4191	0.90582	0.0:1.0:0.0:0.0	.	801;801;801	Q6ZRS2-3;Q6ZRS2-2;Q6ZRS2	.;.;SRCAP_HUMAN	G	801	ENSP00000262518:R801G;ENSP00000378499:R801G;ENSP00000343042:R801G	ENSP00000262518:R801G	R	+	1	0	SRCAP	30632441	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	4.748000	0.62148	2.884000	0.98904	0.655000	0.94253	CGC	SRCAP	-	pfam_SNF2_N,smart_Helicase_ATP-bd		0.527	SRCAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCAP	HGNC	protein_coding	OTTHUMT00000255523.1	C	NM_006662		30724940	+1	no_errors	ENST00000262518	ensembl	human	known	70_37	missense	SNP	1.000	G
SRRT	51593	genome.wustl.edu	37	7	100486133	100486133	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:100486133G>A	ENST00000347433.4	+	20	2752	c.2594G>A	c.(2593-2595)cGg>cAg	p.R865Q	SRRT_ENST00000457580.2_Missense_Mutation_p.R861Q|SRRT_ENST00000388793.4_Missense_Mutation_p.R864Q|SRRT_ENST00000432932.1_Missense_Mutation_p.R860Q			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	865					cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						GTGGAATATCGGGACCTGGAT	0.537																																																	0													117.0	109.0	111.0					7																	100486133		2203	4300	6503	SO:0001583	missense	51593				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.2594G>A	7.37:g.100486133G>A	ENSP00000314491:p.Arg865Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.R864Q	ENST00000347433.4	37	c.2591	CCDS34709.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	32|32	5.190424|5.190424	0.94923|0.94923	.|.	.|.	ENSG00000087087|ENSG00000087087	ENST00000445337|ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000448764	.|.	.|.	.|.	5.09|5.09	5.09|5.09	0.68999|0.68999	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.72661|0.72661	0.3488|0.3488	L|L	0.50333|0.50333	1.59|1.59	0.80722|0.80722	D|D	1|1	.|D;D;D;D	.|0.89917	.|1.0;0.998;0.998;0.997	.|D;D;D;D	.|0.79108	.|0.992;0.979;0.979;0.953	T|T	0.67891|0.67891	-0.5553|-0.5553	6|9	0.48119|0.21540	T|T	0.1|0.41	.|.	16.0149|16.0149	0.80430|0.80430	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|864;860;861;865	.|Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.|.;.;.;SRRT_HUMAN	R|Q	100|861;864;860;865;488	.|.	ENSP00000398618:G100R|ENSP00000314491:R865Q	G|R	+|+	1|2	0|0	SRRT|SRRT	100324069|100324069	1.000000|1.000000	0.71417|0.71417	0.974000|0.974000	0.42286|0.42286	0.738000|0.738000	0.42128|0.42128	7.386000|7.386000	0.79775|0.79775	2.363000|2.363000	0.80096|0.80096	0.478000|0.478000	0.44815|0.44815	GGG|CGG	SRRT	-	NULL		0.537	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	G	NM_015908		100486133	+1	no_errors	ENST00000388793	ensembl	human	known	70_37	missense	SNP	1.000	A
SSH2	85464	genome.wustl.edu	37	17	27958302	27958302	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:27958302C>T	ENST00000269033.3	-	15	3980	c.3829G>A	c.(3829-3831)Gag>Aag	p.E1277K	SSH2_ENST00000540801.1_Missense_Mutation_p.E1304K|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	1277					actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GAGGCAGGCTCCCTCTCTGGT	0.522																																																	0													98.0	94.0	95.0					17																	27958302		2203	4300	6503	SO:0001583	missense	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.3829G>A	17.37:g.27958302C>T	ENSP00000269033:p.Glu1277Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.E1277K	ENST00000269033.3	37	c.3829	CCDS11253.1	17	.	.	.	.	.	.	.	.	.	.	C	12.43	1.935727	0.34189	.	.	ENSG00000141298	ENST00000269033;ENST00000540801	T;T	0.44083	0.93;0.93	6.03	2.96	0.34315	.	0.125782	0.53938	D	0.000049	T	0.38719	0.1051	M	0.64997	1.995	0.22771	N	0.99876	B;B	0.06786	0.001;0.001	B;B	0.11329	0.006;0.003	T	0.35649	-0.9780	10	0.54805	T	0.06	-4.1134	9.4992	0.39006	0.0:0.7535:0.1186:0.128	.	1304;1277	F5H527;Q76I76	.;SSH2_HUMAN	K	1277;1304	ENSP00000269033:E1277K;ENSP00000444743:E1304K	ENSP00000269033:E1277K	E	-	1	0	SSH2	24982428	0.996000	0.38824	0.003000	0.11579	0.936000	0.57629	2.369000	0.44231	0.429000	0.26202	-0.137000	0.14449	GAG	SSH2	-	NULL		0.522	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	C	NM_033389		27958302	-1	no_errors	ENST00000269033	ensembl	human	known	70_37	missense	SNP	0.017	T
SSH2	85464	genome.wustl.edu	37	17	27977722	27977722	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:27977722C>T	ENST00000269033.3	-	12	1246	c.1095G>A	c.(1093-1095)acG>acA	p.T365T	SSH2_ENST00000540801.1_Silent_p.T392T|RP11-68I3.2_ENST00000581474.1_RNA	NM_001282129.1|NM_033389.2	NP_001269058.1|NP_203747.2	Q76I76	SSH2_HUMAN	slingshot protein phosphatase 2	365	Tyrosine-protein phosphatase.				actin cytoskeleton organization (GO:0030036)|protein dephosphorylation (GO:0006470)|regulation of actin polymerization or depolymerization (GO:0008064)|regulation of axonogenesis (GO:0050770)|regulation of lamellipodium assembly (GO:0010591)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)	actin binding (GO:0003779)|DNA binding (GO:0003677)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)		SSH2/SUZ12(2)	breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CCAGGAGATCCGTTGCCTCTT	0.433																																																	0													228.0	197.0	208.0					17																	27977722		2203	4300	6503	SO:0001819	synonymous_variant	85464			AB072359	CCDS11253.1, CCDS74024.1	17q11.2	2013-03-05	2013-03-05		ENSG00000141298	ENSG00000141298		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Slingshots"""	30580	protein-coding gene	gene with protein product		606779	"""slingshot homolog 2 (Drosophila)"""			11832213, 11214970	Standard	XM_005258059		Approved	KIAA1725	uc002heo.1	Q76I76	OTTHUMG00000132752	ENST00000269033.3:c.1095G>A	17.37:g.27977722C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDB5|Q8WYL1|Q8WYL2|Q96F40|Q96H36|Q9C0D8	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_DEK_C,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.T365	ENST00000269033.3	37	c.1095	CCDS11253.1	17																																																																																			SSH2	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Dual-sp_phosphatase_subgr_cat		0.433	SSH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SSH2	HGNC	protein_coding	OTTHUMT00000256116.1	C	NM_033389		27977722	-1	no_errors	ENST00000269033	ensembl	human	known	70_37	silent	SNP	0.053	T
STAT4	6775	genome.wustl.edu	37	2	191931242	191931242	+	Splice_Site	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:191931242C>T	ENST00000392320.2	-	7	859		c.e7-1		STAT4_ENST00000358470.4_Splice_Site	NM_003151.3	NP_003142.1	Q14765	STAT4_HUMAN	signal transducer and activator of transcription 4						cell proliferation (GO:0008283)|cytokine-mediated signaling pathway (GO:0019221)|JAK-STAT cascade (GO:0007259)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			breast(4)|endometrium(1)|kidney(2)|large_intestine(6)|lung(19)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	42			OV - Ovarian serous cystadenocarcinoma(117;0.00854)|Epithelial(96;0.0864)|all cancers(119;0.204)			TCACTCTGATCTGCAAAGGTA	0.423																																																	0													88.0	78.0	81.0					2																	191931242		2203	4300	6503	SO:0001630	splice_region_variant	6775				CCDS2310.1	2q32.2-q32.3	2013-02-14			ENSG00000138378	ENSG00000138378		"""SH2 domain containing"""	11365	protein-coding gene	gene with protein product		600558				8007943, 8700208	Standard	NM_003151		Approved		uc002usn.2	Q14765	OTTHUMG00000132700	ENST00000392320.2:c.545-1G>A	2.37:g.191931242C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96NZ6	Splice_Site	SNP	-	e6-1	ENST00000392320.2	37	c.545-1	CCDS2310.1	2	.	.	.	.	.	.	.	.	.	.	C	25.0	4.588792	0.86851	.	.	ENSG00000138378	ENST00000358470;ENST00000392320	.	.	.	5.6	5.6	0.85130	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.7897	0.88548	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	STAT4	191639487	1.000000	0.71417	0.999000	0.59377	0.977000	0.68977	6.364000	0.73086	2.648000	0.89879	0.557000	0.71058	.	STAT4	-	-		0.423	STAT4-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	STAT4	HGNC	protein_coding	OTTHUMT00000335586.1	C	NM_003151	Intron	191931242	-1	no_errors	ENST00000358470	ensembl	human	known	70_37	splice_site	SNP	1.000	T
STX11	8676	genome.wustl.edu	37	6	144508032	144508032	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:144508032G>A	ENST00000367568.4	+	2	451	c.268G>A	c.(268-270)Gcc>Acc	p.A90T		NM_003764.3	NP_003755.2	O75558	STX11_HUMAN	syntaxin 11	90					cytotoxic T cell degranulation (GO:0043316)|intracellular protein transport (GO:0006886)|membrane fusion (GO:0061025)|natural killer cell degranulation (GO:0043320)|neutrophil degranulation (GO:0043312)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)	SNAP receptor activity (GO:0005484)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	12				OV - Ovarian serous cystadenocarcinoma(155;2.17e-06)|GBM - Glioblastoma multiforme(68;0.0492)		CAACTCCATCGCCAAGGCCAT	0.682									Familial Hemophagocytic Lymphohistiocytosis																																								0													25.0	26.0	26.0					6																	144508032		2202	4299	6501	SO:0001583	missense	8676	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	AF044309	CCDS5205.1	6q24.1	2014-09-17			ENSG00000135604	ENSG00000135604			11429	protein-coding gene	gene with protein product		605014				9553086	Standard	NM_003764		Approved		uc003qks.4	O75558	OTTHUMG00000015739	ENST00000367568.4:c.268G>A	6.37:g.144508032G>A	ENSP00000356540:p.Ala90Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P598|O75378|O95148|Q5TCL6	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.A90T	ENST00000367568.4	37	c.268	CCDS5205.1	6	.	.	.	.	.	.	.	.	.	.	G	25.6	4.657422	0.88154	.	.	ENSG00000135604	ENST00000367568	T	0.14144	2.53	5.99	5.99	0.97316	t-SNARE (1);Syntaxin, N-terminal (2);	0.162621	0.52532	D	0.000071	T	0.09862	0.0242	L	0.59436	1.845	0.52099	D	0.999943	B	0.32507	0.373	B	0.29716	0.106	T	0.07539	-1.0767	10	0.27785	T	0.31	-25.1354	20.0881	0.97803	0.0:0.0:1.0:0.0	.	90	O75558	STX11_HUMAN	T	90	ENSP00000356540:A90T	ENSP00000356540:A90T	A	+	1	0	STX11	144549725	1.000000	0.71417	0.991000	0.47740	0.997000	0.91878	7.627000	0.83176	2.840000	0.97914	0.655000	0.94253	GCC	STX11	-	pfam_Syntaxin_N,superfamily_t-SNARE,smart_Syntaxin_N		0.682	STX11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STX11	HGNC	protein_coding	OTTHUMT00000042544.1	G			144508032	+1	no_errors	ENST00000367568	ensembl	human	known	70_37	missense	SNP	1.000	A
STYK1	55359	genome.wustl.edu	37	12	10777320	10777320	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:10777320G>C	ENST00000075503.3	-	8	1376	c.856C>G	c.(856-858)Caa>Gaa	p.Q286E		NM_018423.2	NP_060893.2	Q6J9G0	STYK1_HUMAN	serine/threonine/tyrosine kinase 1	286	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)			breast(1)|central_nervous_system(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|liver(1)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)	26						GGTATGGTTTGAGTAGAGGAG	0.502										HNSCC(73;0.22)																																							0													188.0	183.0	185.0					12																	10777320		2203	4300	6503	SO:0001583	missense	55359			AF251059	CCDS8629.1	12p13.2	2005-01-21							18889	protein-coding gene	gene with protein product		611433				12841579	Standard	NM_018423		Approved	SuRTK106, DKFZp761P1010, NOK	uc001qys.2	Q6J9G0		ENST00000075503.3:c.856C>G	12.37:g.10777320G>C	ENSP00000075503:p.Gln286Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9T2|Q52LR3|Q9BXY2|Q9NSH1	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q286E	ENST00000075503.3	37	c.856	CCDS8629.1	12	.	.	.	.	.	.	.	.	.	.	G	0.065	-1.215272	0.01542	.	.	ENSG00000060140	ENST00000075503	T	0.68903	-0.36	4.88	1.96	0.26148	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.719498	0.12700	N	0.446420	T	0.40347	0.1113	N	0.04260	-0.245	0.09310	N	1	B	0.02656	0.0	B	0.10450	0.005	T	0.27640	-1.0068	10	0.51188	T	0.08	0.0173	5.1949	0.15232	0.0823:0.1439:0.6248:0.1489	.	286	Q6J9G0	STYK1_HUMAN	E	286	ENSP00000075503:Q286E	ENSP00000075503:Q286E	Q	-	1	0	STYK1	10668587	0.000000	0.05858	0.002000	0.10522	0.817000	0.46193	-0.001000	0.12947	0.188000	0.20168	0.655000	0.94253	CAA	STYK1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.502	STYK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STYK1	HGNC	protein_coding	OTTHUMT00000399622.1	G	NM_018423		10777320	-1	no_errors	ENST00000075503	ensembl	human	known	70_37	missense	SNP	0.004	C
SUCO	51430	genome.wustl.edu	37	1	172557994	172557994	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:172557994G>T	ENST00000263688.3	+	18	1972	c.1753G>T	c.(1753-1755)Gaa>Taa	p.E585*	SUCO_ENST00000608151.1_Nonsense_Mutation_p.E737*|SUCO_ENST00000610051.1_Nonsense_Mutation_p.E548*|SUCO_ENST00000367723.4_Nonsense_Mutation_p.E736*	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	585					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											TCAAGAGGAGGAAGAGGAGGC	0.463																																																	0													79.0	69.0	72.0					1																	172557994		2203	4300	6503	SO:0001587	stop_gained	51430			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.1753G>T	1.37:g.172557994G>T	ENSP00000263688:p.Glu585*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Nonsense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.E737*	ENST00000263688.3	37	c.2209	CCDS1303.1	1	.	.	.	.	.	.	.	.	.	.	G	40	8.092119	0.98648	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.44	5.44	0.79542	.	0.046718	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.59425	D	0.04	-11.7013	17.8296	0.88677	0.0:0.0:1.0:0.0	.	.	.	.	X	737;585	.	ENSP00000263688:E585X	E	+	1	0	C1orf9	170824617	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.545000	0.82128	2.543000	0.85770	0.557000	0.71058	GAA	SUCO	-	NULL		0.463	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCO	HGNC	protein_coding	OTTHUMT00000084273.1	G	NM_016227		172557994	+1	no_errors	ENST00000367723	ensembl	human	known	70_37	nonsense	SNP	1.000	T
TBC1D14	57533	genome.wustl.edu	37	4	6995933	6995933	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr4:6995933G>A	ENST00000409757.4	+	4	990	c.866G>A	c.(865-867)aGa>aAa	p.R289K	TBC1D14_ENST00000448507.1_Missense_Mutation_p.R289K|AC097382.5_ENST00000441093.1_RNA|TBC1D14_ENST00000410031.1_Missense_Mutation_p.R61K|RN7SKP292_ENST00000365522.1_RNA|TBC1D14_ENST00000451522.2_Missense_Mutation_p.R9K	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	289					negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						aaggctggaagacctagCAAG	0.473																																																	0													135.0	123.0	127.0					4																	6995933		2203	4300	6503	SO:0001583	missense	57533			AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.866G>A	4.37:g.6995933G>A	ENSP00000386921:p.Arg289Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.R289K	ENST00000409757.4	37	c.866	CCDS3394.2	4	.	.	.	.	.	.	.	.	.	.	G	15.77	2.932514	0.52866	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522	T;T;T;T	0.56776	0.44;0.44;0.44;3.59	5.43	4.58	0.56647	.	0.277656	0.36002	N	0.002847	T	0.41789	0.1174	L	0.55834	1.745	0.80722	D	1	B;B	0.22683	0.004;0.073	B;B	0.16722	0.009;0.016	T	0.29549	-1.0008	10	0.02654	T	1	-4.9917	11.5323	0.50618	0.0849:0.0:0.9151:0.0	.	9;289	Q9P2M4-2;Q9P2M4	.;TBC14_HUMAN	K	289;289;61;9	ENSP00000404041:R289K;ENSP00000386921:R289K;ENSP00000386343:R61K;ENSP00000388886:R9K	ENSP00000386921:R289K	R	+	2	0	TBC1D14	7046834	1.000000	0.71417	0.997000	0.53966	0.997000	0.91878	2.799000	0.47892	1.527000	0.49086	0.655000	0.94253	AGA	TBC1D14	-	NULL		0.473	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D14	HGNC	protein_coding	OTTHUMT00000206981.3	G	NM_020773		6995933	+1	no_errors	ENST00000409757	ensembl	human	known	70_37	missense	SNP	0.999	A
TCF20	6942	genome.wustl.edu	37	22	42607402	42607402	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr22:42607402G>A	ENST00000359486.3	-	1	4046	c.3910C>T	c.(3910-3912)Cac>Tac	p.H1304Y	TCF20_ENST00000335626.4_Missense_Mutation_p.H1304Y|TCF20_ENST00000404876.1_5'Flank	NM_005650.1	NP_005641.1	Q9UGU0	TCF20_HUMAN	transcription factor 20 (AR1)	1304					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(13)|lung(22)|ovary(5)|prostate(1)|skin(2)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(5)	66						TCCTGACTGTGAGAAAGATGG	0.453																																																	0													199.0	186.0	190.0					22																	42607402		2203	4300	6503	SO:0001583	missense	6942			U19345	CCDS14032.1, CCDS14033.1	22q13.3	2011-02-08			ENSG00000100207	ENSG00000100207			11631	protein-coding gene	gene with protein product	"""stromelysin-1 platelet-derived growth factor-responsive element binding protein"""	603107				9730594, 10995766	Standard	NM_005650		Approved	AR1, SPBP	uc003bcj.1	Q9UGU0	OTTHUMG00000150920	ENST00000359486.3:c.3910C>T	22.37:g.42607402G>A	ENSP00000352463:p.His1304Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A9JX12|O14528|Q13078|Q4V353|Q9H4M0	Missense_Mutation	SNP	smart_Znf_PHD	p.H1304Y	ENST00000359486.3	37	c.3910	CCDS14033.1	22	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967288	0.34754	.	.	ENSG00000100207	ENST00000359486;ENST00000335626	T;T	0.58210	0.35;0.35	5.53	5.53	0.82687	.	0.174129	0.40818	N	0.001017	T	0.42337	0.1198	L	0.29908	0.895	0.80722	D	1	P;P	0.47604	0.898;0.837	B;B	0.41332	0.354;0.193	T	0.31364	-0.9946	10	0.40728	T	0.16	-19.3179	14.4883	0.67631	0.0:0.0:0.8533:0.1466	.	1304;1304	Q9UGU0-2;Q9UGU0	.;TCF20_HUMAN	Y	1304	ENSP00000352463:H1304Y;ENSP00000335561:H1304Y	ENSP00000335561:H1304Y	H	-	1	0	TCF20	40937346	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.438000	0.59961	2.882000	0.98803	0.655000	0.94253	CAC	TCF20	-	NULL		0.453	TCF20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCF20	HGNC	protein_coding	OTTHUMT00000320531.1	G	NM_181492		42607402	-1	no_errors	ENST00000359486	ensembl	human	known	70_37	missense	SNP	1.000	A
TDRD6	221400	genome.wustl.edu	37	6	46656958	46656958	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:46656958G>C	ENST00000316081.6	+	1	1093	c.1093G>C	c.(1093-1095)Gaa>Caa	p.E365Q	RP11-446F17.3_ENST00000422284.2_RNA|RP11-446F17.3_ENST00000434329.2_RNA|RP11-446F17.3_ENST00000571590.1_RNA|TDRD6_ENST00000544460.1_Missense_Mutation_p.E365Q	NM_001010870.2	NP_001010870.1	O60522	TDRD6_HUMAN	tudor domain containing 6	365	Tudor 2. {ECO:0000255|PROSITE- ProRule:PRU00211}.				germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|P granule (GO:0043186)				NS(1)|breast(9)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80			Lung(136;0.192)			CTTGCTGCCTGAATATTTTCG	0.557																																																	0													134.0	120.0	124.0					6																	46656958		2203	4300	6503	SO:0001583	missense	221400			AF039442	CCDS34470.1, CCDS55017.1	6p12.3	2013-01-23			ENSG00000180113	ENSG00000180113		"""Tudor domain containing"""	21339	protein-coding gene	gene with protein product	"""cancer/testis antigen 41.2"", ""spermatogenesis associated 36"""	611200				9610721	Standard	NM_001010870		Approved	NY-CO-45, bA446F17.4, CT41.2, SPATA36	uc003oyj.3	O60522	OTTHUMG00000014788	ENST00000316081.6:c.1093G>C	6.37:g.46656958G>C	ENSP00000346065:p.Glu365Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWU2|F5H5M3|Q5HYB1|Q5VTS4|Q6ZMX5	Missense_Mutation	SNP	pfam_Tudor,smart_Tudor,pfscan_Tudor	p.E365Q	ENST00000316081.6	37	c.1093	CCDS34470.1	6	.	.	.	.	.	.	.	.	.	.	G	17.11	3.305734	0.60305	.	.	ENSG00000180113	ENST00000544460;ENST00000316081	T;T	0.09911	2.93;2.93	5.65	5.65	0.86999	Tudor subgroup (1);Maternal tudor protein (1);Tudor domain (1);	0.272836	0.39146	N	0.001452	T	0.15955	0.0384	L	0.28458	0.855	0.40804	D	0.983365	D;D	0.89917	1.0;1.0	D;D	0.87578	0.997;0.998	T	0.03413	-1.1039	10	0.33940	T	0.23	-11.4	19.5221	0.95189	0.0:0.0:1.0:0.0	.	365;365	F5H5M3;O60522	.;TDRD6_HUMAN	Q	365	ENSP00000443299:E365Q;ENSP00000346065:E365Q	ENSP00000346065:E365Q	E	+	1	0	TDRD6	46764917	1.000000	0.71417	0.927000	0.36925	0.755000	0.42902	7.209000	0.77916	2.941000	0.99782	0.655000	0.94253	GAA	TDRD6	-	pfam_Tudor,smart_Tudor,pfscan_Tudor		0.557	TDRD6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD6	HGNC	protein_coding	OTTHUMT00000040800.1	G	XM_166443		46656958	+1	no_errors	ENST00000316081	ensembl	human	known	70_37	missense	SNP	0.998	C
TECPR2	9895	genome.wustl.edu	37	14	102900646	102900646	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr14:102900646C>T	ENST00000359520.7	+	9	1718	c.1492C>T	c.(1492-1494)Cag>Tag	p.Q498*	TECPR2_ENST00000558678.1_Nonsense_Mutation_p.Q498*	NM_014844.3	NP_055659.2	O15040	TCPR2_HUMAN	tectonin beta-propeller repeat containing 2	498					autophagy (GO:0006914)|cell death (GO:0008219)					breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(7)|lung(21)|ovary(2)|prostate(3)|skin(4)|stomach(1)|urinary_tract(1)	50						GGACAGTCCCCAGTCCTTGAA	0.507																																																	0													66.0	63.0	64.0					14																	102900646		2203	4300	6503	SO:0001587	stop_gained	9895			AB019441	CCDS32162.1, CCDS58337.1	14q32.33	2009-02-27	2009-02-27	2009-02-27		ENSG00000196663			19957	protein-coding gene	gene with protein product		615000	"""KIAA0329"""	KIAA0329		9205841	Standard	NM_014844		Approved		uc001ylw.2	O15040		ENST00000359520.7:c.1492C>T	14.37:g.102900646C>T	ENSP00000352510:p.Gln498*	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKY3|A6NFY9|A7E2X3|H0YMM9|Q9UEG6	Nonsense_Mutation	SNP	pfam_Beta-propeller_rpt_TECPR,superfamily_WD40_repeat_dom,superfamily_Reg_csome_cond/b-lactamase_inh,smart_WD40_repeat,smart_Beta-propeller_rpt_TECPR	p.Q498*	ENST00000359520.7	37	c.1492	CCDS32162.1	14	.	.	.	.	.	.	.	.	.	.	C	39	7.818647	0.98507	.	.	ENSG00000196663	ENST00000359520;ENST00000380088	.	.	.	5.4	4.45	0.53987	.	0.676351	0.14702	N	0.303527	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	9.3846	0.38336	0.145:0.7802:0.0:0.0747	.	.	.	.	X	498	.	ENSP00000352510:Q498X	Q	+	1	0	TECPR2	101970399	0.058000	0.20735	0.932000	0.37286	0.757000	0.42996	1.817000	0.39002	2.539000	0.85634	0.650000	0.86243	CAG	TECPR2	-	NULL		0.507	TECPR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TECPR2	HGNC	protein_coding	OTTHUMT00000415056.2	C	NM_014844		102900646	+1	no_errors	ENST00000359520	ensembl	human	known	70_37	nonsense	SNP	0.398	T
TENM4	26011	genome.wustl.edu	37	11	78437208	78437208	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:78437208T>C	ENST00000278550.7	-	23	3928	c.3466A>G	c.(3466-3468)Aca>Gca	p.T1156A		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1156					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										TGCAGCACTGTTGTTCTTTTT	0.438																																																	0													292.0	282.0	285.0					11																	78437208		1930	4129	6059	SO:0001583	missense	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.3466A>G	11.37:g.78437208T>C	ENSP00000278550:p.Thr1156Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.T1156A	ENST00000278550.7	37	c.3466	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	C	8.344	0.829443	0.16749	.	.	ENSG00000149256	ENST00000278550	D	0.88664	-2.41	5.32	4.41	0.53225	.	0.000000	0.85682	N	0.000000	T	0.65386	0.2686	N	0.00446	-1.495	0.24453	N	0.994479	B	0.02656	0.0	B	0.01281	0.0	T	0.54682	-0.8257	9	.	.	.	.	12.2474	0.54578	0.0:0.8629:0.0:0.1371	.	1156	Q6N022	TEN4_HUMAN	A	1156	ENSP00000278550:T1156A	.	T	-	1	0	ODZ4	78114856	1.000000	0.71417	0.725000	0.30721	0.982000	0.71751	4.836000	0.62789	0.832000	0.34804	-0.119000	0.15052	ACA	TENM4	-	NULL		0.438	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	T			78437208	-1	no_errors	ENST00000278550	ensembl	human	known	70_37	missense	SNP	0.997	C
THOP1	7064	genome.wustl.edu	37	19	2813158	2813158	+	Missense_Mutation	SNP	G	G	C	rs371442536		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:2813158G>C	ENST00000307741.6	+	13	2157	c.1954G>C	c.(1954-1956)Gag>Cag	p.E652Q	THOP1_ENST00000586677.1_Missense_Mutation_p.E531Q|THOP1_ENST00000395212.4_Missense_Mutation_p.E221Q	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	652					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGGCGGTTCCGAGGATGCCAG	0.677																																																	0													18.0	19.0	18.0					19																	2813158		2199	4298	6497	SO:0001583	missense	7064				CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.1954G>C	19.37:g.2813158G>C	ENSP00000304467:p.Glu652Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSE2|Q9UCB3	Missense_Mutation	SNP	pfam_Pept_M3A_M3B	p.E652Q	ENST00000307741.6	37	c.1954	CCDS12095.1	19	.	.	.	.	.	.	.	.	.	.	g	11.73	1.725510	0.30593	.	.	ENSG00000172009	ENST00000307741;ENST00000395212	T;T	0.11495	3.16;2.77	4.91	-8.84	0.00803	Neurolysin/Thimet oligopeptidase, domain 2 (1);	0.735128	0.12724	N	0.444430	T	0.06690	0.0171	N	0.19112	0.55	0.09310	N	1	B;B;B	0.19331	0.003;0.035;0.001	B;B;B	0.26416	0.009;0.069;0.009	T	0.41998	-0.9477	10	0.45353	T	0.12	-20.0077	16.0095	0.80391	0.0778:0.296:0.6262:0.0	.	531;221;652	B4DU96;B3KSE2;P52888	.;.;THOP1_HUMAN	Q	652;221	ENSP00000304467:E652Q;ENSP00000378638:E221Q	ENSP00000304467:E652Q	E	+	1	0	THOP1	2764158	0.000000	0.05858	0.568000	0.28447	0.696000	0.40369	-1.190000	0.03058	-0.517000	0.06461	0.556000	0.70494	GAG	THOP1	-	pfam_Pept_M3A_M3B		0.677	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOP1	HGNC	protein_coding	OTTHUMT00000451587.2	G			2813158	+1	no_errors	ENST00000307741	ensembl	human	known	70_37	missense	SNP	0.001	C
THPO	7066	genome.wustl.edu	37	3	184090793	184090793	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:184090793G>A	ENST00000204615.7	-	6	784	c.570C>T	c.(568-570)ctC>ctT	p.L190L	THPO_ENST00000445696.2_Silent_p.L186L|EIF2B5_ENST00000444495.1_Intron|THPO_ENST00000477594.1_Intron|THPO_ENST00000421442.2_Intron	NM_000460.2|NM_001177597.1|NM_001177598.1	NP_000451.1|NP_001171068.1|NP_001171069.1	P40225	TPO_HUMAN	thrombopoietin	190					blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|myeloid cell differentiation (GO:0030099)|platelet activation (GO:0030168)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|thrombopoietin-mediated signaling pathway (GO:0038163)	extracellular space (GO:0005615)	growth factor activity (GO:0008083)			NS(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(6)|ovary(1)|prostate(1)|skin(1)	16	all_cancers(143;6.33e-11)|Ovarian(172;0.0339)		Epithelial(37;4.96e-33)|OV - Ovarian serous cystadenocarcinoma(80;2.72e-22)			CGTTCAGTGTGAGGACTAGAG	0.577																																																	0													82.0	85.0	84.0					3																	184090793		2203	4300	6503	SO:0001819	synonymous_variant	7066				CCDS3265.1, CCDS54693.1	3q27	2014-01-30	2008-07-31		ENSG00000090534	ENSG00000090534		"""Endogenous ligands"""	11795	protein-coding gene	gene with protein product	"""prepro-thrombopoietin"", ""megakaryocyte stimulating factor"", ""myeloproliferative leukemia virus oncogene ligand"", ""megakaryocyte growth and development factor"", ""MPL ligand"", ""megakaryocyte colony-stimulating factor"", ""c-mpl ligand"", ""thrombopoietin nirs variant 1"""	600044		MGDF		8202154	Standard	XM_006713738		Approved	TPO, MPLLG	uc003fol.1	P40225	OTTHUMG00000156745	ENST00000204615.7:c.570C>T	3.37:g.184090793G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3Y0|B7ZLR8|B9EGA8|Q13020|Q15790|Q15791|Q15792	Silent	SNP	pfam_EPO_TPO,superfamily_4_helix_cytokine-like_core,prints_Thrombopoeitin	p.L190	ENST00000204615.7	37	c.570	CCDS3265.1	3																																																																																			THPO	-	NULL		0.577	THPO-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	THPO	HGNC	protein_coding	OTTHUMT00000345554.1	G	NM_000460		184090793	-1	no_errors	ENST00000204615	ensembl	human	known	70_37	silent	SNP	0.403	A
TIGD7	91151	genome.wustl.edu	37	16	3349121	3349121	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:3349121C>G	ENST00000396862.1	-	2	3322	c.1494G>C	c.(1492-1494)caG>caC	p.Q498H	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Missense_Mutation_p.Q498H	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	498						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						AGTGGAATCTCTGAAACTCAG	0.398																																																	0													122.0	117.0	119.0					16																	3349121		2197	4300	6497	SO:0001583	missense	91151			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1494G>C	16.37:g.3349121C>G	ENSP00000380071:p.Gln498His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BXZ0	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.Q498H	ENST00000396862.1	37	c.1494	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	C	6.879	0.531644	0.13127	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.28454	1.61;1.61	4.98	1.53	0.23141	.	0.224034	0.21998	U	0.066046	T	0.33469	0.0864	N	0.24115	0.695	0.23435	N	0.997682	D	0.65815	0.995	D	0.74674	0.984	T	0.06826	-1.0805	10	0.49607	T	0.09	.	5.9506	0.19245	0.0:0.341:0.0:0.659	.	498	Q6NT04	TIGD7_HUMAN	H	498	ENSP00000380071:Q498H;ENSP00000268674:Q498H	ENSP00000268674:Q498H	Q	-	3	2	TIGD7	3289122	0.989000	0.36119	0.998000	0.56505	0.967000	0.64934	-0.214000	0.09292	0.264000	0.21851	-0.302000	0.09304	CAG	TIGD7	-	NULL		0.398	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	C	NM_033208		3349121	-1	no_errors	ENST00000268674	ensembl	human	known	70_37	missense	SNP	0.998	G
TIGD7	91151	genome.wustl.edu	37	16	3349384	3349384	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:3349384C>T	ENST00000396862.1	-	2	3059	c.1231G>A	c.(1231-1233)Gat>Aat	p.D411N	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Missense_Mutation_p.D411N	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	411						nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						CCTTGAAAATCATATTCAGGT	0.348																																																	0													110.0	121.0	117.0					16																	3349384		2197	4298	6495	SO:0001583	missense	91151			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1231G>A	16.37:g.3349384C>T	ENSP00000380071:p.Asp411Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BXZ0	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.D411N	ENST00000396862.1	37	c.1231	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	C	4.263	0.047905	0.08243	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.35236	1.32;1.32	5.32	4.16	0.48862	.	0.594463	0.13634	U	0.373466	T	0.20941	0.0504	N	0.12182	0.205	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.06041	-1.0849	10	0.36615	T	0.2	.	9.7681	0.40574	0.0:0.8899:0.0:0.1101	.	411	Q6NT04	TIGD7_HUMAN	N	411	ENSP00000380071:D411N;ENSP00000268674:D411N	ENSP00000268674:D411N	D	-	1	0	TIGD7	3289385	0.266000	0.24112	0.241000	0.24154	0.882000	0.50991	0.537000	0.23144	2.479000	0.83701	0.655000	0.94253	GAT	TIGD7	-	NULL		0.348	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	C	NM_033208		3349384	-1	no_errors	ENST00000268674	ensembl	human	known	70_37	missense	SNP	0.144	T
TIGD7	91151	genome.wustl.edu	37	16	3349549	3349549	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:3349549C>T	ENST00000396862.1	-	2	2894	c.1066G>A	c.(1066-1068)Gaa>Aaa	p.E356K	TIGD7_ENST00000574598.1_5'Flank|TIGD7_ENST00000268674.2_Missense_Mutation_p.E356K	NM_033208.3	NP_149985.2	Q6NT04	TIGD7_HUMAN	tigger transposable element derived 7	356	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)|upper_aerodigestive_tract(1)	12						TCATCACTTTCTTCAAATATT	0.353																																																	0													59.0	62.0	61.0					16																	3349549		2197	4299	6496	SO:0001583	missense	91151			AF251050	CCDS10500.1	16p13.11	2008-02-05			ENSG00000140993	ENSG00000140993			18331	protein-coding gene	gene with protein product		612969					Standard	NM_033208		Approved	Sancho	uc002cus.3	Q6NT04	OTTHUMG00000129325	ENST00000396862.1:c.1066G>A	16.37:g.3349549C>T	ENSP00000380071:p.Glu356Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BXZ0	Missense_Mutation	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.E356K	ENST00000396862.1	37	c.1066	CCDS10500.1	16	.	.	.	.	.	.	.	.	.	.	C	14.92	2.677935	0.47886	.	.	ENSG00000140993	ENST00000426381;ENST00000396862;ENST00000268674	T;T	0.41400	1.0;1.0	4.85	4.85	0.62838	.	0.000000	0.40818	U	0.001004	T	0.51244	0.1663	L	0.47716	1.5	0.29872	N	0.826726	D	0.69078	0.997	D	0.79108	0.992	T	0.42766	-0.9432	10	0.06757	T	0.87	.	13.471	0.61281	0.0:1.0:0.0:0.0	.	356	Q6NT04	TIGD7_HUMAN	K	356	ENSP00000380071:E356K;ENSP00000268674:E356K	ENSP00000268674:E356K	E	-	1	0	TIGD7	3289550	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.364000	0.34171	2.249000	0.74217	0.655000	0.94253	GAA	TIGD7	-	pfam_DDE_SF_endonuclease_CENPB-like		0.353	TIGD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD7	HGNC	protein_coding	OTTHUMT00000251465.1	C	NM_033208		3349549	-1	no_errors	ENST00000268674	ensembl	human	known	70_37	missense	SNP	1.000	T
TMEM132D	121256	genome.wustl.edu	37	12	129566467	129566467	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:129566467G>A	ENST00000422113.2	-	7	2086	c.1760C>T	c.(1759-1761)gCg>gTg	p.A587V	TMEM132D_ENST00000389441.4_Missense_Mutation_p.A125V	NM_133448.2	NP_597705.2	Q14C87	T132D_HUMAN	transmembrane protein 132D	587					negative regulation of phosphatase activity (GO:0010923)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(33)|liver(1)|lung(69)|ovary(10)|pancreas(2)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(2)	152	all_neural(191;0.101)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0934)|Breast(359;0.133)		OV - Ovarian serous cystadenocarcinoma(86;0.000288)|Epithelial(86;0.0116)|all cancers(50;0.0246)		AGGGCCGGCCGCCTCAGCCAC	0.647																																																	0													38.0	41.0	40.0					12																	129566467		2202	4299	6501	SO:0001583	missense	121256			AB061814	CCDS9266.1	12q24.32-q24.33	2014-06-13			ENSG00000151952	ENSG00000151952			29411	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 153"""	611257				11853319, 12966072	Standard	NM_133448		Approved	KIAA1944, MOLT, PPP1R153	uc009zyl.1	Q14C87	OTTHUMG00000168400	ENST00000422113.2:c.1760C>T	12.37:g.129566467G>A	ENSP00000408581:p.Ala587Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14C96|Q76M59|Q8N1W9|Q8N3Q5|Q8TF57	Missense_Mutation	SNP	NULL	p.A587V	ENST00000422113.2	37	c.1760	CCDS9266.1	12	.	.	.	.	.	.	.	.	.	.	G	14.49	2.551787	0.45487	.	.	ENSG00000151952	ENST00000389441;ENST00000422113	T;T	0.15139	2.45;2.45	4.72	3.82	0.43975	.	0.509712	0.19288	N	0.117972	T	0.23727	0.0574	M	0.63843	1.955	0.24650	N	0.993527	P;D	0.54964	0.907;0.969	B;P	0.48304	0.29;0.573	T	0.06643	-1.0815	9	.	.	.	-29.7334	10.0099	0.41979	0.0:0.1502:0.6939:0.1559	.	587;125	Q14C87;Q14C87-2	T132D_HUMAN;.	V	125;587	ENSP00000374092:A125V;ENSP00000408581:A587V	.	A	-	2	0	TMEM132D	128132420	0.002000	0.14202	0.212000	0.23672	0.554000	0.35429	1.209000	0.32357	0.945000	0.37605	0.561000	0.74099	GCG	TMEM132D	-	NULL		0.647	TMEM132D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM132D	HGNC	protein_coding	OTTHUMT00000399592.1	G	NM_133448		129566467	-1	no_errors	ENST00000422113	ensembl	human	known	70_37	missense	SNP	0.577	A
TMEM63B	55362	genome.wustl.edu	37	6	44116376	44116376	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:44116376G>C	ENST00000259746.9	+	14	1431	c.1248G>C	c.(1246-1248)caG>caC	p.Q416H	TMEM63B_ENST00000323267.6_Missense_Mutation_p.Q416H			Q5T3F8	CSCL2_HUMAN	transmembrane protein 63B	416					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	nucleotide binding (GO:0000166)			breast(3)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|ovary(1)|pancreas(2)|prostate(2)|stomach(4)	35	all_cancers(18;1.66e-06)|Lung NSC(15;0.00108)|all_lung(25;0.00278)|Hepatocellular(11;0.00309)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0215)			CTGACCCTCAGAACATCTACT	0.617																																																	0													71.0	64.0	66.0					6																	44116376		2203	4300	6503	SO:0001583	missense	55362			BC022095	CCDS34461.1	6p21.1	2008-02-05	2005-07-25	2005-07-25	ENSG00000137216	ENSG00000137216			17735	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 110"""	C6orf110			Standard	XM_005249211		Approved	DKFZp434P0531, dJ421H19.2	uc003owr.3	Q5T3F8	OTTHUMG00000014757	ENST00000259746.9:c.1248G>C	6.37:g.44116376G>C	ENSP00000259746:p.Gln416His	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGU3|Q5T3F9|Q6AHX4|Q6P5A0|Q8N219|Q8NDE1|Q9NSG5	Missense_Mutation	SNP	pfam_DUF221	p.Q416H	ENST00000259746.9	37	c.1248	CCDS34461.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	11.95|11.95	1.790420|1.790420	0.31685|0.31685	.|.	.|.	ENSG00000137216|ENSG00000137216	ENST00000259746;ENST00000323267|ENST00000371893	T;T|.	0.28666|.	1.6;1.6|.	4.17|4.17	3.28|3.28	0.37604|0.37604	Domain of unknown function DUF221 (1);|.	0.063724|.	0.64402|.	D|.	0.000003|.	T|T	0.27027|0.27027	0.0662|0.0662	N|N	0.22421|0.22421	0.69|0.69	0.39687|0.39687	D|D	0.97099|0.97099	B;P|.	0.40875|.	0.002;0.731|.	B;B|.	0.44224|.	0.011;0.444|.	T|T	0.05146|0.05146	-1.0903|-1.0903	10|5	0.44086|.	T|.	0.13|.	.|.	8.52|8.52	0.33270|0.33270	0.1839:0.0:0.8161:0.0|0.1839:0.0:0.8161:0.0	.|.	416;416|.	Q5T3F8;Q5T3F8-2|.	TM63B_HUMAN;.|.	H|T	416|345	ENSP00000259746:Q416H;ENSP00000327154:Q416H|.	ENSP00000259746:Q416H|.	Q|R	+|+	3|2	2|0	TMEM63B|TMEM63B	44224354|44224354	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.880000|0.880000	0.50808|0.50808	3.181000|3.181000	0.50903|0.50903	2.172000|2.172000	0.68678|0.68678	0.467000|0.467000	0.42956|0.42956	CAG|AGA	TMEM63B	-	pfam_DUF221		0.617	TMEM63B-005	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63B	HGNC	protein_coding	OTTHUMT00000040712.2	G	XM_166410		44116376	+1	no_errors	ENST00000259746	ensembl	human	known	70_37	missense	SNP	1.000	C
TNFAIP8L1	126282	genome.wustl.edu	37	19	4651990	4651990	+	Missense_Mutation	SNP	G	G	C	rs536114490		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:4651990G>C	ENST00000536716.1	+	2	255	c.109G>C	c.(109-111)Gag>Cag	p.E37Q	AC005339.2_ENST00000598070.1_RNA|TNFAIP8L1_ENST00000327473.4_Missense_Mutation_p.E37Q	NM_001167942.1	NP_001161414.1	Q8WVP5	TP8L1_HUMAN	tumor necrosis factor, alpha-induced protein 8-like 1	37					negative regulation of TOR signaling (GO:0032007)	cytoplasm (GO:0005737)				endometrium(1)	1				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0148)|STAD - Stomach adenocarcinoma(1328;0.18)		CACCAGCAGTGAGGTGCTGGA	0.612																																																	0													64.0	55.0	58.0					19																	4651990		2203	4300	6503	SO:0001583	missense	126282			BC017672	CCDS12132.1	19p13.3	2008-02-05				ENSG00000185361			28279	protein-coding gene	gene with protein product		615869				12477932	Standard	NM_001167942		Approved	MGC17791	uc002max.3	Q8WVP5		ENST00000536716.1:c.109G>C	19.37:g.4651990G>C	ENSP00000444215:p.Glu37Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D6W627	Missense_Mutation	SNP	pfam_DUF758	p.E37Q	ENST00000536716.1	37	c.109	CCDS12132.1	19	.	.	.	.	.	.	.	.	.	.	G	14.13	2.444033	0.43429	.	.	ENSG00000185361	ENST00000327473;ENST00000536716	T;T	0.37411	1.2;1.2	4.43	2.16	0.27623	.	0.069380	0.56097	N	0.000025	T	0.43722	0.1260	M	0.85945	2.785	0.49213	D	0.999764	B	0.16802	0.019	B	0.18263	0.021	T	0.48468	-0.9033	10	0.62326	D	0.03	-11.4981	13.5829	0.61913	0.0:0.2552:0.7448:0.0	.	37	Q8WVP5	TP8L1_HUMAN	Q	37	ENSP00000331827:E37Q;ENSP00000444215:E37Q	ENSP00000331827:E37Q	E	+	1	0	TNFAIP8L1	4602990	1.000000	0.71417	0.498000	0.27564	0.082000	0.17680	6.386000	0.73186	0.279000	0.22186	0.455000	0.32223	GAG	TNFAIP8L1	-	pfam_DUF758		0.612	TNFAIP8L1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFAIP8L1	HGNC	protein_coding	OTTHUMT00000458662.1	G	NM_152362		4651990	+1	no_errors	ENST00000327473	ensembl	human	known	70_37	missense	SNP	1.000	C
TONSL	4796	genome.wustl.edu	37	8	145657729	145657729	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:145657729G>A	ENST00000409379.3	-	23	3703	c.3674C>T	c.(3673-3675)tCc>tTc	p.S1225F	AC084125.4_ENST00000544423.1_RNA	NM_013432.4	NP_038460.4	Q96HA7	TONSL_HUMAN	tonsoku-like, DNA repair protein	1225					cytoplasmic sequestering of transcription factor (GO:0042994)|double-strand break repair via homologous recombination (GO:0000724)|regulation of RNA biosynthetic process (GO:2001141)|replication fork processing (GO:0031297)	cytoplasm (GO:0005737)|nuclear replication fork (GO:0043596)|nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			biliary_tract(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(2)|lung(14)|ovary(3)|prostate(1)|skin(1)	26						GGCTGCCACGGAGCTGAGCTC	0.627																																																	0													71.0	75.0	74.0					8																	145657729		2203	4300	6503	SO:0001583	missense	4796				CCDS34968.2	8q24.3	2013-01-10	2010-12-02	2010-11-30	ENSG00000160949	ENSG00000160949		"""Ankyrin repeat domain containing"""	7801	protein-coding gene	gene with protein product		604546	"""nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor-like 2"""	NFKBIL2		7738005, 11246458	Standard	NM_013432		Approved	IKBR	uc011llg.2	Q96HA7	OTTHUMG00000153122	ENST00000409379.3:c.3674C>T	8.37:g.145657729G>A	ENSP00000386239:p.Ser1225Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDP0|C9JKB1|C9JNV8|Q13006|Q9UGJ2	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_TPR_repeat,smart_Ankyrin_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_TPR-contain_dom,prints_Ankyrin_rpt	p.S1225F	ENST00000409379.3	37	c.3674	CCDS34968.2	8	.	.	.	.	.	.	.	.	.	.	g	16.86	3.238953	0.58995	.	.	ENSG00000160949	ENST00000409379;ENST00000422691	T	0.53423	0.62	5.03	4.12	0.48240	.	0.219434	0.38005	N	0.001850	T	0.57755	0.2075	M	0.62088	1.915	0.09310	N	1	D	0.57899	0.981	P	0.55161	0.77	T	0.53627	-0.8412	10	0.54805	T	0.06	-9.9733	12.9388	0.58331	0.0:0.1646:0.8354:0.0	.	1225	Q96HA7	TONSL_HUMAN	F	1225;1224	ENSP00000386239:S1225F	ENSP00000386239:S1225F	S	-	2	0	TONSL	145628537	0.328000	0.24687	0.010000	0.14722	0.210000	0.24377	2.470000	0.45119	1.046000	0.40249	0.462000	0.41574	TCC	TONSL	-	NULL		0.627	TONSL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TONSL	HGNC	protein_coding	OTTHUMT00000329668.2	G	NM_013432		145657729	-1	no_errors	ENST00000409379	ensembl	human	known	70_37	missense	SNP	0.040	A
TP63	8626	genome.wustl.edu	37	3	189586422	189586422	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:189586422G>C	ENST00000264731.3	+	8	1135	c.1046G>C	c.(1045-1047)gGa>gCa	p.G349A	TP63_ENST00000382063.4_Missense_Mutation_p.G264A|TP63_ENST00000392461.3_Missense_Mutation_p.G255A|TP63_ENST00000437221.1_Missense_Mutation_p.G255A|TP63_ENST00000449992.1_Missense_Mutation_p.G170A|TP63_ENST00000418709.2_Missense_Mutation_p.G349A|TP63_ENST00000456148.1_Missense_Mutation_p.G255A|TP63_ENST00000392463.2_Missense_Mutation_p.G255A|TP63_ENST00000392460.3_Missense_Mutation_p.G349A|TP63_ENST00000354600.5_Missense_Mutation_p.G255A|TP63_ENST00000320472.5_Missense_Mutation_p.G349A|TP63_ENST00000440651.2_Missense_Mutation_p.G349A	NM_001114978.1|NM_003722.4	NP_001108450.1|NP_003713.3	Q9H3D4	P63_HUMAN	tumor protein p63	349					apoptotic process (GO:0006915)|cell aging (GO:0007569)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|cloacal septation (GO:0060197)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|ectoderm and mesoderm interaction (GO:0007499)|embryonic limb morphogenesis (GO:0030326)|epidermal cell division (GO:0010481)|epithelial cell development (GO:0002064)|establishment of planar polarity (GO:0001736)|establishment of skin barrier (GO:0061436)|female genitalia morphogenesis (GO:0048807)|hair follicle morphogenesis (GO:0031069)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|keratinocyte differentiation (GO:0030216)|keratinocyte proliferation (GO:0043616)|mitotic G1 DNA damage checkpoint (GO:0031571)|multicellular organismal aging (GO:0010259)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular senescence (GO:2000773)|negative regulation of keratinocyte differentiation (GO:0045617)|negative regulation of mesoderm development (GO:2000381)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neuron apoptotic process (GO:0051402)|Notch signaling pathway (GO:0007219)|odontogenesis of dentin-containing tooth (GO:0042475)|polarized epithelial cell differentiation (GO:0030859)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of fibroblast apoptotic process (GO:2000271)|positive regulation of keratinocyte proliferation (GO:0010838)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|post-anal tail morphogenesis (GO:0036342)|prostatic bud formation (GO:0060513)|protein homotetramerization (GO:0051289)|proximal/distal pattern formation (GO:0009954)|regulation of epidermal cell division (GO:0010482)|regulation of neuron apoptotic process (GO:0043523)|response to gamma radiation (GO:0010332)|response to X-ray (GO:0010165)|skeletal system development (GO:0001501)|smooth muscle tissue development (GO:0048745)|squamous basal epithelial stem cell differentiation involved in prostate gland acinus development (GO:0060529)|sympathetic nervous system development (GO:0048485)|urinary bladder development (GO:0060157)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|p53 binding (GO:0002039)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding transcription factor activity (GO:0000989)|transcription regulatory region DNA binding (GO:0044212)|WW domain binding (GO:0050699)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|kidney(5)|large_intestine(12)|lung(15)|ovary(2)|skin(9)|upper_aerodigestive_tract(6)	61	all_cancers(143;3.35e-10)|Ovarian(172;0.0925)		Lung(62;3.33e-05)	GBM - Glioblastoma multiforme(93;0.0227)		GCTTGCCCAGGAAGAGACAGG	0.488										HNSCC(45;0.13)																																							0			GRCh37	CM083196	TP63	M							81.0	80.0	80.0					3																	189586422		2203	4300	6503	SO:0001583	missense	8626			AB010153	CCDS3293.1, CCDS46976.1, CCDS46977.1, CCDS46978.1, CCDS46979.1, CCDS46980.1	3q27-q29	2014-09-17			ENSG00000073282	ENSG00000073282			15979	protein-coding gene	gene with protein product		603273	"""tumor protein p73-like"", ""tumor protein p53-like"", ""tumor protein p53-competing protein"""	TP73L, TP53L, TP53CP		9774969, 9662378, 11181441, 11181451	Standard	NM_003722		Approved	p51, SHFM4, EEC3, p63, p73L, OFC8, KET, p73H, NBP, p53CP	uc003fry.2	Q9H3D4	OTTHUMG00000156313	ENST00000264731.3:c.1046G>C	3.37:g.189586422G>C	ENSP00000264731:p.Gly349Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	O75080|O75195|O75922|O76078|Q6VEG2|Q6VEG3|Q6VEG4|Q6VFJ1|Q6VFJ2|Q6VFJ3|Q6VH20|Q7LDI3|Q7LDI4|Q7LDI5|Q96KR0|Q9H3D2|Q9H3D3|Q9H3P8|Q9NPH7|Q9P1B4|Q9P1B5|Q9P1B6|Q9P1B7|Q9UBV9|Q9UE10|Q9UP26|Q9UP27|Q9UP28|Q9UP74	Missense_Mutation	SNP	pfam_p53_DNA-bd,pfam_p53_tetrameristn,pfam_SAM_2,superfamily_p53-like_TF_DNA-bd,superfamily_SAM/pointed,superfamily_p53_tetrameristn,smart_SAM,prints_p53_tumour_suppressor	p.G349A	ENST00000264731.3	37	c.1046	CCDS3293.1	3	.	.	.	.	.	.	.	.	.	.	G	21.1	4.091013	0.76756	.	.	ENSG00000073282	ENST00000264731;ENST00000418709;ENST00000320472;ENST00000392460;ENST00000440651;ENST00000382063;ENST00000354600;ENST00000437221;ENST00000392463;ENST00000392461;ENST00000449992;ENST00000456148	D;D;D;D;D;D;D;D;D;D;D;D	0.99893	-7.57;-7.57;-7.57;-7.57;-7.57;-7.57;-7.57;-7.57;-7.57;-7.57;-7.57;-7.57	5.83	5.83	0.93111	p53, DNA-binding domain (1);p53-like transcription factor, DNA-binding (1);p53/RUNT-type transcription factor, DNA-binding domain (1);	0.000000	0.85682	D	0.000000	D	0.99862	0.9935	M	0.73372	2.23	0.80722	D	1	D;D;D;D;D;D;D;D;D;D	0.65815	0.994;0.967;0.994;0.988;0.994;0.988;0.991;0.988;0.995;0.988	D;P;D;D;D;D;D;D;D;D	0.73380	0.966;0.896;0.966;0.917;0.966;0.917;0.933;0.938;0.98;0.917	D	0.97092	0.9791	9	.	.	.	-6.1229	19.1141	0.93331	0.0:0.0:1.0:0.0	.	170;349;349;255;255;255;255;349;349;349	Q9H3D4-10;Q9H3D4-7;Q9H3D4-11;Q9H3D4-4;Q9H3D4-2;Q9H3D4-6;C9D7C9;Q9H3D4-3;Q9H3D4;Q9H3D4-5	.;.;.;.;.;.;.;.;P63_HUMAN;.	A	349;349;349;349;349;264;255;255;255;255;170;255	ENSP00000264731:G349A;ENSP00000407144:G349A;ENSP00000317510:G349A;ENSP00000376253:G349A;ENSP00000394337:G349A;ENSP00000371495:G264A;ENSP00000346614:G255A;ENSP00000392488:G255A;ENSP00000376256:G255A;ENSP00000376254:G255A;ENSP00000387839:G170A;ENSP00000389485:G255A	.	G	+	2	0	TP63	191069116	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.700000	0.98707	2.749000	0.94314	0.655000	0.94253	GGA	TP63	-	pfam_p53_DNA-bd,superfamily_p53-like_TF_DNA-bd,prints_p53_tumour_suppressor		0.488	TP63-001	KNOWN	basic|CCDS	protein_coding	TP63	HGNC	protein_coding	OTTHUMT00000343865.1	G	NM_003722		189586422	+1	no_errors	ENST00000264731	ensembl	human	known	70_37	missense	SNP	1.000	C
TPP2	7174	genome.wustl.edu	37	13	103279418	103279418	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr13:103279418G>A	ENST00000376065.4	+	7	877	c.841G>A	c.(841-843)Gaa>Aaa	p.E281K	TPP2_ENST00000376052.3_Missense_Mutation_p.E281K	NM_003291.2	NP_003282.2	P29144	TPP2_HUMAN	tripeptidyl peptidase II	281	Peptidase S8.				antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|protein polyubiquitination (GO:0000209)|proteolysis (GO:0006508)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	aminopeptidase activity (GO:0004177)|endopeptidase activity (GO:0004175)|serine-type endopeptidase activity (GO:0004252)|tripeptidyl-peptidase activity (GO:0008240)	p.E281K(1)		breast(2)|endometrium(5)|kidney(2)|large_intestine(12)|lung(21)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	52	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					AGAAGAACCTGAACGGAATGG	0.463																																																	1	Substitution - Missense(1)	lung(1)											140.0	135.0	136.0					13																	103279418		2203	4300	6503	SO:0001583	missense	7174			M55169	CCDS9502.1	13q32-q33	2008-02-05			ENSG00000134900	ENSG00000134900	3.4.14.10		12016	protein-coding gene	gene with protein product		190470				1670990	Standard	NM_003291		Approved		uc001vpi.4	P29144	OTTHUMG00000017305	ENST00000376065.4:c.841G>A	13.37:g.103279418G>A	ENSP00000365233:p.Glu281Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VZU8	Missense_Mutation	SNP	pfam_Peptidase_S8/S53,pfam_Peptidase_S8A_TPPII,superfamily_Peptidase_S8/S53,prints_Peptidase_S8_subtilisin-rel	p.E281K	ENST00000376065.4	37	c.841	CCDS9502.1	13	.	.	.	.	.	.	.	.	.	.	G	26.2	4.716172	0.89205	.	.	ENSG00000134900	ENST00000376065;ENST00000376052	T;T	0.46063	0.88;0.88	5.58	5.58	0.84498	Peptidase S8/S53, subtilisin/kexin/sedolisin (3);	0.000000	0.85682	D	0.000000	T	0.35970	0.0950	N	0.25144	0.715	0.80722	D	1	B	0.18968	0.032	B	0.23419	0.046	T	0.09574	-1.0668	10	0.48119	T	0.1	.	19.9474	0.97186	0.0:0.0:1.0:0.0	.	281	P29144	TPP2_HUMAN	K	281	ENSP00000365233:E281K;ENSP00000365220:E281K	ENSP00000365220:E281K	E	+	1	0	TPP2	102077419	1.000000	0.71417	0.964000	0.40570	0.978000	0.69477	7.538000	0.82048	2.774000	0.95407	0.655000	0.94253	GAA	TPP2	-	pfam_Peptidase_S8/S53,superfamily_Peptidase_S8/S53		0.463	TPP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPP2	HGNC	protein_coding	OTTHUMT00000045683.2	G			103279418	+1	no_errors	ENST00000376065	ensembl	human	known	70_37	missense	SNP	1.000	A
TRAM1	23471	genome.wustl.edu	37	8	71495505	71495505	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:71495505G>C	ENST00000262213.2	-	10	1114	c.945C>G	c.(943-945)ttC>ttG	p.F315L	TRAM1_ENST00000536748.1_Missense_Mutation_p.F284L|TRAM1_ENST00000521425.1_Missense_Mutation_p.F229L|TRAM1_ENST00000521049.1_5'Flank	NM_014294.5	NP_055109.1	Q15629	TRAM1_HUMAN	translocation associated membrane protein 1	315	TLC. {ECO:0000255|PROSITE- ProRule:PRU00205}.				cellular protein metabolic process (GO:0044267)|cotranslational protein targeting to membrane (GO:0006613)|gene expression (GO:0010467)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|viral process (GO:0016032)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)	17			Epithelial(68;0.00679)|all cancers(69;0.0324)|OV - Ovarian serous cystadenocarcinoma(28;0.0509)			GAAAATTAATGAACTTCCACA	0.368																																					Ovarian(85;984 1334 5116 12432 40638)												0													109.0	99.0	102.0					8																	71495505		2203	4300	6503	SO:0001583	missense	23471			X63679	CCDS6207.1	8q13.1	2004-01-22			ENSG00000067167	ENSG00000067167			20568	protein-coding gene	gene with protein product		605190				1315422	Standard	NM_014294		Approved	TRAM, TRAMP	uc003xyo.2	Q15629	OTTHUMG00000164428	ENST00000262213.2:c.945C>G	8.37:g.71495505G>C	ENSP00000262213:p.Phe315Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E0K2	Missense_Mutation	SNP	pfam_TRAM1,pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom	p.F315L	ENST00000262213.2	37	c.945	CCDS6207.1	8	.	.	.	.	.	.	.	.	.	.	G	14.17	2.454363	0.43634	.	.	ENSG00000067167	ENST00000521425;ENST00000262213;ENST00000536748	D;D;D	0.84223	-1.82;-1.82;-1.82	5.08	3.3	0.37823	TRAM/LAG1/CLN8 homology domain (3);	0.092545	0.85682	D	0.000000	T	0.78291	0.4260	L	0.41824	1.3	0.80722	D	1	B	0.10296	0.003	B	0.14023	0.01	T	0.71210	-0.4660	10	0.38643	T	0.18	.	11.293	0.49261	0.147:0.0:0.853:0.0	.	315	Q15629	TRAM1_HUMAN	L	229;315;284	ENSP00000428052:F229L;ENSP00000262213:F315L;ENSP00000439359:F284L	ENSP00000262213:F315L	F	-	3	2	TRAM1	71658059	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.338000	0.43957	0.743000	0.32719	0.563000	0.77884	TTC	TRAM1	-	pfam_TLC-dom,smart_TLC-dom,pirsf_Translocation_assoc_membrane,pfscan_TLC-dom		0.368	TRAM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAM1	HGNC	protein_coding	OTTHUMT00000378738.1	G	NM_014294		71495505	-1	no_errors	ENST00000262213	ensembl	human	known	70_37	missense	SNP	1.000	C
AC005013.5	0	genome.wustl.edu	37	7	28997039	28997039	+	lincRNA	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:28997039G>A	ENST00000436594.1	+	0	0				TRIL_ENST00000322982.3_RNA																							CAGAGAGGTTGAGGAAGCGCA	0.637																																																	0													48.0	59.0	56.0					7																	28997039		2174	4272	6446			9865																															7.37:g.28997039G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000436594.1	37	NULL		7																																																																																			TRIL	-	-		0.637	AC005013.5-001	KNOWN	basic|exp_conf	lincRNA	TRIL	HGNC	lincRNA	OTTHUMT00000327953.3	G			28997039	-1	no_errors	ENST00000322982	ensembl	human	known	70_37	rna	SNP	0.995	A
TRIP6	7205	genome.wustl.edu	37	7	100470816	100470816	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:100470816C>T	ENST00000200457.4	+	9	1682	c.1322C>T	c.(1321-1323)tCt>tTt	p.S441F	SRRT_ENST00000457580.2_5'Flank|SRRT_ENST00000388793.4_5'Flank|SRRT_ENST00000432932.1_5'Flank|SRRT_ENST00000347433.4_5'Flank	NM_003302.2	NP_003293.2	Q15654	TRIP6_HUMAN	thyroid hormone receptor interactor 6	441	LIM zinc-binding 3. {ECO:0000255|PROSITE- ProRule:PRU00125}.				focal adhesion assembly (GO:0048041)|positive regulation of cell migration (GO:0030335)|regulation of transcription, DNA-templated (GO:0006355)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	interleukin-1 receptor binding (GO:0005149)|kinase binding (GO:0019900)|poly(A) RNA binding (GO:0044822)|thyroid hormone receptor binding (GO:0046966)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(3)|endometrium(2)|large_intestine(2)|liver(1)|lung(5)	14	Lung NSC(181;0.041)|all_lung(186;0.0581)					CTGCTCTCCTCTGAGGGCGAG	0.612																																																	0													62.0	57.0	58.0					7																	100470816		2203	4300	6503	SO:0001583	missense	7205			L40374, AF000974	CCDS5708.1	7q22	2006-09-05			ENSG00000087077	ENSG00000087077			12311	protein-coding gene	gene with protein product		602933				9598321, 7776974	Standard	NM_003302		Approved	ZRP-1, OIP1, MGC10556, MGC10558, MGC29959, MGC3837, MGC4423	uc003uww.3	Q15654	OTTHUMG00000157029	ENST00000200457.4:c.1322C>T	7.37:g.100470816C>T	ENSP00000200457:p.Ser441Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2E7|F2ZC07|F2ZC08|O15170|O15275|Q9BTB2|Q9BUE5|Q9BXP3|Q9UNT4	Missense_Mutation	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.S441F	ENST00000200457.4	37	c.1322	CCDS5708.1	7	.	.	.	.	.	.	.	.	.	.	C	23.5	4.424256	0.83667	.	.	ENSG00000087077	ENST00000200457	D	0.88124	-2.34	4.42	4.42	0.53409	Zinc finger, LIM-type (4);	0.000000	0.64402	D	0.000001	D	0.94574	0.8252	M	0.93720	3.45	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.95249	0.8358	10	0.66056	D	0.02	.	12.3868	0.55336	0.0:1.0:0.0:0.0	.	441	Q15654	TRIP6_HUMAN	F	441	ENSP00000200457:S441F	ENSP00000200457:S441F	S	+	2	0	TRIP6	100308752	1.000000	0.71417	0.992000	0.48379	0.992000	0.81027	5.736000	0.68597	2.290000	0.77057	0.591000	0.81541	TCT	TRIP6	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.612	TRIP6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP6	HGNC	protein_coding	OTTHUMT00000347151.2	C	NM_003302		100470816	+1	no_errors	ENST00000200457	ensembl	human	known	70_37	missense	SNP	0.984	T
TRIM56	81844	genome.wustl.edu	37	7	100730884	100730884	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:100730884G>A	ENST00000306085.6	+	3	588	c.291G>A	c.(289-291)ggG>ggA	p.G97G		NM_030961.1	NP_112223.1	Q9BRZ2	TRI56_HUMAN	tripartite motif containing 56	97					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|interferon-beta production (GO:0032608)|negative regulation of viral entry into host cell (GO:0046597)|negative regulation of viral release from host cell (GO:1902187)|positive regulation of type I interferon production (GO:0032481)|protein K63-linked ubiquitination (GO:0070534)|regulation of type I interferon production (GO:0032479)|response to type I interferon (GO:0034340)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ligase activity (GO:0016874)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18	Lung NSC(181;0.136)|all_lung(186;0.182)					TGCGTGCCGGGAAGCCAGCCT	0.692																																					Ovarian(89;1092 1379 22756 38989 39611)												0													26.0	32.0	30.0					7																	100730884		2102	4211	6313	SO:0001819	synonymous_variant	81844			BK000511	CCDS43625.1	7q11.2	2013-01-09	2011-01-25		ENSG00000169871	ENSG00000169871		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	19028	protein-coding gene	gene with protein product			"""tripartite motif-containing 56"""				Standard	NM_030961		Approved	RNF109	uc003uxq.3	Q9BRZ2	OTTHUMG00000157032	ENST00000306085.6:c.291G>A	7.37:g.100730884G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PJS5|Q86VT6|Q8N2H8|Q8NAC0|Q9H031	Silent	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_CheY-like_superfamily,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.G97	ENST00000306085.6	37	c.291	CCDS43625.1	7																																																																																			TRIM56	-	NULL		0.692	TRIM56-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM56	HGNC	protein_coding	OTTHUMT00000347185.1	G	NM_030961		100730884	+1	no_errors	ENST00000306085	ensembl	human	known	70_37	silent	SNP	0.023	A
TRMT10C	54931	genome.wustl.edu	37	3	101283864	101283864	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:101283864C>T	ENST00000309922.6	+	2	393	c.239C>T	c.(238-240)tCa>tTa	p.S80L		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	80					mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										GAATGTGTTTCAACAATCTCA	0.418																																																	0													130.0	119.0	122.0					3																	101283864		1895	4121	6016	SO:0001583	missense	54931			AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.239C>T	3.37:g.101283864C>T	ENSP00000312356:p.Ser80Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	pfam_tRNA_m1G_MeTrfase	p.S80L	ENST00000309922.6	37	c.239	CCDS43122.1	3	.	.	.	.	.	.	.	.	.	.	C	5.477	0.273101	0.10349	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.52295	0.67;0.67	6.17	4.16	0.48862	.	2.419330	0.01248	N	0.008801	T	0.44973	0.1319	M	0.62723	1.935	0.09310	N	1	B	0.23442	0.085	B	0.16722	0.016	T	0.45789	-0.9237	10	0.41790	T	0.15	-3.9554	1.8303	0.03129	0.2255:0.4768:0.1384:0.1593	.	80	Q7L0Y3	MRRP1_HUMAN	L	80	ENSP00000312356:S80L;ENSP00000419389:S80L	ENSP00000312356:S80L	S	+	2	0	RG9MTD1	102766554	0.000000	0.05858	0.066000	0.19879	0.089000	0.18198	0.278000	0.18753	2.941000	0.99782	0.655000	0.94253	TCA	TRMT10C	-	NULL		0.418	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10C	HGNC	protein_coding	OTTHUMT00000353400.2	C	NM_017819		101283864	+1	no_errors	ENST00000309922	ensembl	human	known	70_37	missense	SNP	0.000	T
TRPM7	54822	genome.wustl.edu	37	15	50886709	50886709	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:50886709G>A	ENST00000313478.7	-	24	3673	c.3392C>T	c.(3391-3393)cCa>cTa	p.P1131L	TRPM7_ENST00000560955.1_Missense_Mutation_p.P1131L	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	1131					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		AATGATAAGTGGAGGAGGCAG	0.343																																																	0													122.0	117.0	118.0					15																	50886709		1848	4092	5940	SO:0001583	missense	54822			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.3392C>T	15.37:g.50886709G>A	ENSP00000320239:p.Pro1131Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.P1131L	ENST00000313478.7	37	c.3392	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	G	33	5.199992	0.94997	.	.	ENSG00000092439	ENST00000313478	D	0.83992	-1.79	5.43	5.43	0.79202	.	0.000000	0.85682	D	0.000000	D	0.87533	0.6201	M	0.79258	2.445	0.80722	D	1	D	0.61697	0.99	P	0.48738	0.588	D	0.89478	0.3748	10	0.87932	D	0	-10.8308	19.2325	0.93846	0.0:0.0:1.0:0.0	.	1131	Q96QT4	TRPM7_HUMAN	L	1131	ENSP00000320239:P1131L	ENSP00000320239:P1131L	P	-	2	0	TRPM7	48674001	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.535000	0.85469	0.655000	0.94253	CCA	TRPM7	-	NULL		0.343	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	G	NM_017672		50886709	-1	no_errors	ENST00000313478	ensembl	human	known	70_37	missense	SNP	1.000	A
TRPM7	54822	genome.wustl.edu	37	15	50903387	50903387	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:50903387G>C	ENST00000313478.7	-	17	2464	c.2183C>G	c.(2182-2184)tCa>tGa	p.S728*	TRPM7_ENST00000560955.1_Nonsense_Mutation_p.S728*	NM_017672.4	NP_060142.3	Q96QT4	TRPM7_HUMAN	transient receptor potential cation channel, subfamily M, member 7	728					actomyosin structure organization (GO:0031032)|calcium ion transmembrane transport (GO:0070588)|calcium-dependent cell-matrix adhesion (GO:0016340)|cellular magnesium ion homeostasis (GO:0010961)|ion transmembrane transport (GO:0034220)|necroptotic process (GO:0070266)|protein autophosphorylation (GO:0046777)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(17)|lung(13)|ovary(4)|pancreas(1)|skin(4)|stomach(3)	52				all cancers(107;0.000819)|GBM - Glioblastoma multiforme(94;0.0045)		TCTAAGTCTTGAAGAAACTGC	0.393																																																	0													158.0	141.0	146.0					15																	50903387		1847	4103	5950	SO:0001587	stop_gained	54822			AF346629	CCDS42035.1, CCDS73725.1	15q21	2011-12-14				ENSG00000092439		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17994	protein-coding gene	gene with protein product		605692				11161216, 11385574, 16382100	Standard	XM_005254486		Approved	CHAK1, LTRPC7, TRP-PLIK	uc001zyt.4	Q96QT4		ENST00000313478.7:c.2183C>G	15.37:g.50903387G>C	ENSP00000320239:p.Ser728*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZMF5|Q86VJ4|Q8NBW2|Q9BXB2|Q9NXQ2	Nonsense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ion_trans_dom,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.S728*	ENST00000313478.7	37	c.2183	CCDS42035.1	15	.	.	.	.	.	.	.	.	.	.	G	42	9.315415	0.99133	.	.	ENSG00000092439	ENST00000313478	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-12.6967	19.8961	0.96958	0.0:0.0:1.0:0.0	.	.	.	.	X	728	.	ENSP00000320239:S728X	S	-	2	0	TRPM7	48690679	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.869000	0.99810	2.699000	0.92147	0.655000	0.94253	TCA	TRPM7	-	NULL		0.393	TRPM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM7	HGNC	protein_coding	OTTHUMT00000418604.1	G	NM_017672		50903387	-1	no_errors	ENST00000313478	ensembl	human	known	70_37	nonsense	SNP	1.000	C
TRPT1	83707	genome.wustl.edu	37	11	63991404	63991404	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:63991404C>T	ENST00000317459.6	-	8	874	c.706G>A	c.(706-708)Gag>Aag	p.E236K	TRPT1_ENST00000540472.1_5'Flank|TRPT1_ENST00000546133.1_Missense_Mutation_p.E94K|TRPT1_ENST00000546089.1_Missense_Mutation_p.E150K|TRPT1_ENST00000541278.1_Missense_Mutation_p.E199K|TRPT1_ENST00000394547.3_Missense_Mutation_p.E187K|TRPT1_ENST00000394546.2_Missense_Mutation_p.E238K|NUDT22_ENST00000279206.3_5'Flank|NUDT22_ENST00000441250.2_5'Flank			Q86TN4	TRPT1_HUMAN	tRNA phosphotransferase 1	236					regulation of protein kinase activity (GO:0045859)|tRNA splicing, via endonucleolytic cleavage and ligation (GO:0006388)		tRNA 2'-phosphotransferase activity (GO:0000215)			lung(2)|skin(1)	3						CTCTGACACTCTGTCTCTTCA	0.403																																																	0													75.0	76.0	76.0					11																	63991404		2201	4297	6498	SO:0001583	missense	83707				CCDS31595.1, CCDS44639.1, CCDS53652.1, CCDS53653.1	11q13	2012-05-03			ENSG00000149743	ENSG00000149743			20316	protein-coding gene	gene with protein product	"""tRNA splicing 2' phosphotransferase 1"""	610470				14504659	Standard	NM_001160389		Approved	MGC11134	uc010rnc.2	Q86TN4	OTTHUMG00000167844	ENST00000317459.6:c.706G>A	11.37:g.63991404C>T	ENSP00000314073:p.Glu236Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MU17|A8MYC9|F5H2B2|Q9BSB9	Missense_Mutation	SNP	pfam_Ptrans_KptA/Tpt1	p.E238K	ENST00000317459.6	37	c.712	CCDS31595.1	11	.	.	.	.	.	.	.	.	.	.	C	12.77	2.038997	0.35989	.	.	ENSG00000149743	ENST00000394547;ENST00000394546;ENST00000541278;ENST00000546133;ENST00000317459;ENST00000546089	T;T;T;T;T;T	0.52057	1.53;1.95;1.23;1.42;1.95;0.68	4.62	3.71	0.42584	.	0.398408	0.21376	N	0.075550	T	0.35913	0.0948	L	0.32530	0.975	0.09310	N	0.999995	B;B;P;P	0.42692	0.025;0.361;0.787;0.546	B;B;B;B	0.41510	0.031;0.054;0.359;0.141	T	0.13282	-1.0515	10	0.37606	T	0.19	-11.7065	8.7709	0.34731	0.0:0.8967:0.0:0.1033	.	199;238;187;236	F5H2B2;A8MU17;Q86TN4-2;Q86TN4	.;.;.;TRPT1_HUMAN	K	187;238;199;94;236;150	ENSP00000378051:E187K;ENSP00000378050:E238K;ENSP00000438683:E199K;ENSP00000439586:E94K;ENSP00000314073:E236K;ENSP00000437741:E150K	ENSP00000314073:E236K	E	-	1	0	TRPT1	63747980	0.003000	0.15002	0.492000	0.27490	0.729000	0.41735	1.141000	0.31528	1.327000	0.45338	0.561000	0.74099	GAG	TRPT1	-	NULL		0.403	TRPT1-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPT1	HGNC	protein_coding	OTTHUMT00000396579.1	C	NM_031472		63991404	-1	no_errors	ENST00000394546	ensembl	human	known	70_37	missense	SNP	0.300	T
TTC23L	153657	genome.wustl.edu	37	5	34845686	34845686	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr5:34845686G>C	ENST00000505624.1	+	3	266	c.163G>C	c.(163-165)Gag>Cag	p.E55Q	TTC23L_ENST00000514080.1_3'UTR	NM_144725.3	NP_653326.3	Q6PF05	TT23L_HUMAN	tetratricopeptide repeat domain 23-like	55										breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(9)|prostate(2)|stomach(1)|urinary_tract(1)	22						TAAAGCTAAAGAGAAGGAGAA	0.448																																																	0													108.0	103.0	104.0					5																	34845686		1890	4109	5999	SO:0001583	missense	153657				CCDS54840.1	5p13.2	2008-07-14			ENSG00000205838	ENSG00000205838			26355	protein-coding gene	gene with protein product						12477932	Standard	NM_144725		Approved	FLJ25439	uc003jiu.3	Q6PF05	OTTHUMG00000162020	ENST00000505624.1:c.163G>C	5.37:g.34845686G>C	ENSP00000422188:p.Glu55Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6RGS4|Q8N7R3|Q96LJ2	Missense_Mutation	SNP	NULL	p.E55Q	ENST00000505624.1	37	c.163	CCDS54840.1	5	.	.	.	.	.	.	.	.	.	.	G	7.747	0.702450	0.15172	.	.	ENSG00000205838	ENST00000505624;ENST00000535797	T	0.12147	2.71	3.6	-0.531	0.11894	.	2.146490	0.02016	N	0.047363	T	0.07638	0.0192	N	0.08118	0	0.09310	N	1	B	0.29037	0.231	B	0.28232	0.087	T	0.27020	-1.0086	10	0.27785	T	0.31	-0.3493	6.1468	0.20291	0.59:0.0:0.41:0.0	.	55	Q6PF05	TT23L_HUMAN	Q	55	ENSP00000422188:E55Q	ENSP00000425242:E55Q	E	+	1	0	TTC23L	34881443	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-0.262000	0.08682	-0.026000	0.13895	0.650000	0.86243	GAG	TTC23L	-	NULL		0.448	TTC23L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC23L	HGNC	protein_coding	OTTHUMT00000366819.1	G	NM_144725		34845686	+1	no_errors	ENST00000505624	ensembl	human	known	70_37	missense	SNP	0.000	C
TTN	7273	genome.wustl.edu	37	2	179425302	179425302	+	Silent	SNP	A	A	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:179425302A>G	ENST00000591111.1	-	276	80858	c.80634T>C	c.(80632-80634)aaT>aaC	p.N26878N	TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000589042.1_Silent_p.N28519N|TTN-AS1_ENST00000592750.1_RNA|TTN_ENST00000342992.6_Silent_p.N25951N|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000438095.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN_ENST00000342175.6_Silent_p.N19646N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN-AS1_ENST00000586707.1_RNA|TTN-AS1_ENST00000586831.1_RNA|TTN-AS1_ENST00000592600.1_RNA|TTN_ENST00000460472.2_Silent_p.N19454N|TTN_ENST00000359218.5_Silent_p.N19579N			Q8WZ42	TITIN_HUMAN	titin	26878	Fibronectin type-III 95. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			ATATATATTCATTGCCTTTGA	0.383																																																	0													49.0	50.0	50.0					2																	179425302		1888	4105	5993	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.80634T>C	2.37:g.179425302A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.N25951	ENST00000591111.1	37	c.77853		2																																																																																			TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.383	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	A	NM_133378		179425302	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	0.999	G
TTN	7273	genome.wustl.edu	37	2	179501215	179501215	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:179501215C>T	ENST00000591111.1	-	175	36540	c.36316G>A	c.(36316-36318)Gat>Aat	p.D12106N	TTN_ENST00000589042.1_Missense_Mutation_p.D13747N|TTN-AS1_ENST00000589830.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000342992.6_Missense_Mutation_p.D11179N|TTN_ENST00000342175.6_Missense_Mutation_p.D4874N|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000460472.2_Missense_Mutation_p.D4682N|TTN_ENST00000359218.5_Missense_Mutation_p.D4807N			Q8WZ42	TITIN_HUMAN	titin	12106	Ig-like 80.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			AGTTGAACATCAATGATGTGC	0.418																																																	0													99.0	93.0	95.0					2																	179501215		1851	4114	5965	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.36316G>A	2.37:g.179501215C>T	ENSP00000465570:p.Asp12106Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.D11179N	ENST00000591111.1	37	c.33535		2	.	.	.	.	.	.	.	.	.	.	C	13.49	2.253602	0.39797	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.38560	1.13;1.13;1.13;1.13	5.72	5.72	0.89469	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.50394	0.1613	N	0.12422	0.21	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.999;0.999;0.999;0.999	T	0.59241	-0.7491	9	0.87932	D	0	.	19.9446	0.97177	0.0:1.0:0.0:0.0	.	4682;4807;4874;12106	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	N	11179;4682;4874;4807;4682	ENSP00000343764:D11179N;ENSP00000434586:D4682N;ENSP00000340554:D4874N;ENSP00000352154:D4807N	ENSP00000340554:D4874N	D	-	1	0	TTN	179209460	1.000000	0.71417	0.962000	0.40283	0.134000	0.20937	7.768000	0.85345	2.714000	0.92807	0.644000	0.83932	GAT	TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179501215	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	T
TWISTNB	221830	genome.wustl.edu	37	7	19739762	19739762	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:19739762C>A	ENST00000222567.5	-	3	608	c.538G>T	c.(538-540)Gaa>Taa	p.E180*		NM_001002926.1	NP_001002926.1	Q3B726	RPA43_HUMAN	TWIST neighbor	180					transcription from RNA polymerase I promoter (GO:0006360)	DNA-directed RNA polymerase I complex (GO:0005736)|microtubule cytoskeleton (GO:0015630)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA-directed RNA polymerase activity (GO:0003899)			kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	20						CGAAATACTTCAAATTCTAGT	0.398																																																	0													120.0	113.0	115.0					7																	19739762		2203	4300	6503	SO:0001587	stop_gained	221830			AK090846	CCDS34606.1	7p21.1	2010-08-05			ENSG00000105849	ENSG00000105849			18027	protein-coding gene	gene with protein product		608312				12438708	Standard	NM_001002926		Approved		uc003sup.1	Q3B726	OTTHUMG00000152497	ENST00000222567.5:c.538G>T	7.37:g.19739762C>A	ENSP00000222567:p.Glu180*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJ45|B7Z724	Nonsense_Mutation	SNP	pfam_RNA_pol_Rpb7_N	p.E180*	ENST00000222567.5	37	c.538	CCDS34606.1	7	.	.	.	.	.	.	.	.	.	.	C	38	6.661152	0.97743	.	.	ENSG00000105849	ENST00000222567	.	.	.	5.82	5.82	0.92795	.	0.133115	0.64402	D	0.000002	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-20.802	10.4946	0.44770	0.0:0.781:0.1453:0.0737	.	.	.	.	X	180	.	ENSP00000222567:E180X	E	-	1	0	TWISTNB	19706287	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.502000	0.60400	2.758000	0.94735	0.650000	0.86243	GAA	TWISTNB	-	NULL		0.398	TWISTNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TWISTNB	HGNC	protein_coding	OTTHUMT00000326463.1	C			19739762	-1	no_errors	ENST00000222567	ensembl	human	known	70_37	nonsense	SNP	1.000	A
UBE3C	9690	genome.wustl.edu	37	7	157023842	157023842	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr7:157023842G>C	ENST00000348165.5	+	18	2662	c.2302G>C	c.(2302-2304)Gat>Cat	p.D768H		NM_014671.2	NP_055486.2	Q15386	UBE3C_HUMAN	ubiquitin protein ligase E3C	768	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteasome complex (GO:0000502)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)			central_nervous_system(2)|endometrium(3)|kidney(16)|large_intestine(13)|lung(25)|ovary(2)|prostate(1)|urinary_tract(1)	63		all_hematologic(28;0.0185)|all_epithelial(9;0.0664)	OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.19)		AGCTGGCATTGATGGTGGTGG	0.438																																																	0													110.0	110.0	110.0					7																	157023842		2203	4300	6503	SO:0001583	missense	9690			AK127280	CCDS34789.1	7q36.3	2004-05-04			ENSG00000009335	ENSG00000009335			16803	protein-coding gene	gene with protein product		614454				7584026, 11278995	Standard	NM_014671		Approved	KIAA0010, KIAA10	uc010lqs.3	Q15386	OTTHUMG00000157239	ENST00000348165.5:c.2302G>C	7.37:g.157023842G>C	ENSP00000309198:p.Asp768His	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D235|A6NCP3|Q8TC15|Q96CR4|Q9UDU3	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_DHFR-like_dom,smart_IQ_motif_EF-hand-BS,smart_HECT,pfscan_HECT,pfscan_IQ_motif_EF-hand-BS	p.D768H	ENST00000348165.5	37	c.2302	CCDS34789.1	7	.	.	.	.	.	.	.	.	.	.	G	28.3	4.905741	0.92107	.	.	ENSG00000009335	ENST00000348165	T	0.65364	-0.15	5.45	5.45	0.79879	HECT (3);	0.103382	0.64402	D	0.000002	D	0.88651	0.6494	H	0.99286	4.5	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.74023	0.982;0.982	D	0.93367	0.6732	10	0.87932	D	0	.	19.3383	0.94329	0.0:0.0:1.0:0.0	.	768;621	Q15386;B4DHJ9	UBE3C_HUMAN;.	H	768	ENSP00000309198:D768H	ENSP00000309198:D768H	D	+	1	0	UBE3C	156716603	1.000000	0.71417	0.987000	0.45799	0.885000	0.51271	9.507000	0.97996	2.585000	0.87301	0.549000	0.68633	GAT	UBE3C	-	superfamily_HECT,smart_HECT,pfscan_HECT		0.438	UBE3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE3C	HGNC	protein_coding	OTTHUMT00000348108.1	G	NM_014671		157023842	+1	no_errors	ENST00000348165	ensembl	human	known	70_37	missense	SNP	1.000	C
UCKL1	54963	genome.wustl.edu	37	20	62577046	62577046	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr20:62577046G>C	ENST00000354216.6	-	5	654	c.612C>G	c.(610-612)atC>atG	p.I204M	UCKL1_ENST00000358711.3_Missense_Mutation_p.I204M|MIR647_ENST00000384823.1_RNA|UCKL1_ENST00000369892.3_Missense_Mutation_p.I204M|UCKL1_ENST00000492660.1_5'Flank|UCKL1_ENST00000369908.5_Missense_Mutation_p.I189M	NM_017859.3	NP_060329.2	Q9NWZ5	UCKL1_HUMAN	uridine-cytidine kinase 1-like 1	204					CTP salvage (GO:0044211)|UMP salvage (GO:0044206)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|uridine kinase activity (GO:0004849)			endometrium(3)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	8	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TGCCCTCAAAGATGATGACGT	0.602																																																	0													130.0	121.0	124.0					20																	62577046		2202	4299	6501	SO:0001583	missense	54963			AK000524	CCDS13547.1, CCDS54479.1	20q13.33	2012-09-20	2004-07-13	2004-07-13	ENSG00000198276	ENSG00000198276			15938	protein-coding gene	gene with protein product		610866	"""uridine kinase-like 1"""	URKL1			Standard	NM_017859		Approved	FLJ20517	uc010gkn.3	Q9NWZ5	OTTHUMG00000033003	ENST00000354216.6:c.612C>G	20.37:g.62577046G>C	ENSP00000346155:p.Ile204Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z8N2|Q5JWV0|Q70AQ5|Q8N524|Q9H3Z2	Missense_Mutation	SNP	pfam_PRK/URK,pfam_CPT,prints_Uridine_kinase,prints_PRK,tigrfam_Uridine_kinase	p.I204M	ENST00000354216.6	37	c.612	CCDS13547.1	20	.	.	.	.	.	.	.	.	.	.	G	19.63	3.863570	0.71949	.	.	ENSG00000198276	ENST00000354216;ENST00000369892;ENST00000358711;ENST00000369908	.	.	.	5.43	1.17	0.20885	Phosphoribulokinase/uridine kinase (1);	0.049303	0.85682	D	0.000000	T	0.80319	0.4601	H	0.95043	3.615	0.53688	D	0.999979	D;D	0.89917	1.0;0.999	D;D	0.80764	0.99;0.994	T	0.77851	-0.2434	9	0.87932	D	0	-37.6526	4.6325	0.12509	0.2509:0.0:0.4926:0.2565	.	189;204	B7Z8N2;Q9NWZ5	.;UCKL1_HUMAN	M	204;204;204;189	.	ENSP00000346155:I204M	I	-	3	3	UCKL1	62047490	1.000000	0.71417	0.999000	0.59377	0.988000	0.76386	0.873000	0.28052	0.633000	0.30452	0.491000	0.48974	ATC	UCKL1	-	pfam_PRK/URK,prints_PRK,tigrfam_Uridine_kinase		0.602	UCKL1-001	KNOWN	basic|CCDS	protein_coding	UCKL1	HGNC	protein_coding	OTTHUMT00000080236.1	G	NM_017859		62577046	-1	no_errors	ENST00000354216	ensembl	human	known	70_37	missense	SNP	0.998	C
UHRF1BP1	54887	genome.wustl.edu	37	6	34802148	34802148	+	Missense_Mutation	SNP	C	C	T	rs556278425	byFrequency	TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr6:34802148C>T	ENST00000192788.5	+	5	664	c.493C>T	c.(493-495)Cgc>Tgc	p.R165C	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.R165C	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	165							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)			breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						GAGTGACCTTCGCCTTACCCG	0.507													C|||	2	0.000399361	0.0	0.0	5008	,	,		17006	0.0		0.0	False		,,,				2504	0.002																0													63.0	61.0	62.0					6																	34802148		1984	4158	6142	SO:0001583	missense	54887			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.493C>T	6.37:g.34802148C>T	ENSP00000192788:p.Arg165Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NXE0	Missense_Mutation	SNP	NULL	p.R165C	ENST00000192788.5	37	c.493	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	C	29.1	4.979000	0.92982	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.12672	2.66;2.66	4.71	4.71	0.59529	.	0.059730	0.64402	D	0.000002	T	0.34890	0.0913	M	0.83953	2.67	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.33548	-0.9864	10	0.87932	D	0	-6.669	17.8472	0.88733	0.0:1.0:0.0:0.0	.	165	Q6BDS2	URFB1_HUMAN	C	165	ENSP00000192788:R165C;ENSP00000400628:R165C	ENSP00000192788:R165C	R	+	1	0	UHRF1BP1	34910126	1.000000	0.71417	0.988000	0.46212	0.980000	0.70556	5.876000	0.69667	2.450000	0.82876	0.655000	0.94253	CGC	UHRF1BP1	-	NULL		0.507	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	C	NM_017754		34802148	+1	no_errors	ENST00000192788	ensembl	human	known	70_37	missense	SNP	1.000	T
UNC13A	23025	genome.wustl.edu	37	19	17768894	17768894	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:17768894C>A	ENST00000519716.2	-	9	743	c.744G>T	c.(742-744)gaG>gaT	p.E248D	UNC13A_ENST00000428389.2_Missense_Mutation_p.E336D|UNC13A_ENST00000552293.1_Missense_Mutation_p.E248D|UNC13A_ENST00000551649.1_Missense_Mutation_p.E248D|UNC13A_ENST00000252773.7_Missense_Mutation_p.E248D|UNC13A_ENST00000550896.1_Missense_Mutation_p.E248D	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	248					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						GCTCAGAGAACTCCTCGTAAC	0.602																																																	0													74.0	75.0	75.0					19																	17768894		2056	4208	6264	SO:0001583	missense	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.744G>T	19.37:g.17768894C>A	ENSP00000429562:p.Glu248Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	E5RHY9	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.E336D	ENST00000519716.2	37	c.1008	CCDS46013.2	19	.	.	.	.	.	.	.	.	.	.	C	5.500	0.277204	0.10403	.	.	ENSG00000130477	ENST00000519716;ENST00000428389;ENST00000252773;ENST00000551649;ENST00000552293;ENST00000550896	T;T;T;T;T;T	0.78481	-1.17;-1.18;-1.17;-1.03;-1.04;-1.16	4.64	0.851	0.18989	.	2.309830	0.03043	U	0.153555	T	0.41743	0.1172	N	0.00446	-1.495	0.20764	N	0.999853	B	0.02656	0.0	B	0.01281	0.0	T	0.49380	-0.8946	10	0.10636	T	0.68	-20.7365	2.6129	0.04896	0.1481:0.3922:0.344:0.1157	.	248	Q9UPW8	UN13A_HUMAN	D	248;336;248;248;248;248	ENSP00000429562:E248D;ENSP00000400409:E336D;ENSP00000252773:E248D;ENSP00000447236:E248D;ENSP00000447572:E248D;ENSP00000446831:E248D	ENSP00000252773:E248D	E	-	3	2	UNC13A	17629894	0.998000	0.40836	1.000000	0.80357	0.904000	0.53231	0.676000	0.25247	0.349000	0.23975	0.491000	0.48974	GAG	UNC13A	-	NULL		0.602	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	C	XM_038604		17768894	-1	no_errors	ENST00000428389	ensembl	human	known	70_37	missense	SNP	1.000	A
UNC13B	10497	genome.wustl.edu	37	9	35377653	35377653	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:35377653G>C	ENST00000378495.3	+	15	1999	c.1777G>C	c.(1777-1779)Gat>Cat	p.D593H	UNC13B_ENST00000378496.4_Missense_Mutation_p.D593H|UNC13B_ENST00000396787.1_Missense_Mutation_p.D605H	NM_006377.3	NP_006368.3	O14795	UN13B_HUMAN	unc-13 homolog B (C. elegans)	593	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				apoptotic process (GO:0006915)|excretion (GO:0007588)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|positive regulation of synaptic vesicle priming (GO:0010808)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle priming (GO:0016082)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)|terminal bouton (GO:0043195)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|receptor activity (GO:0004872)|signal transducer activity (GO:0004871)			breast(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(16)|liver(2)|lung(17)|ovary(3)|pancreas(1)|prostate(3)|skin(6)|upper_aerodigestive_tract(3)|urinary_tract(1)	63	all_epithelial(49;0.212)		LUSC - Lung squamous cell carcinoma(32;0.00343)|Lung(28;0.00778)|STAD - Stomach adenocarcinoma(86;0.194)			GAGTGTACTGGATGGCACCTC	0.522																																																	0													54.0	46.0	49.0					9																	35377653		2203	4300	6503	SO:0001583	missense	10497			AF020202	CCDS6579.1	9p13.3	2008-05-15	2003-10-17	2003-10-17	ENSG00000198722	ENSG00000198722			12566	protein-coding gene	gene with protein product		605836	"""unc-13-like (C. elegans)"""	UNC13		9607201	Standard	NM_006377		Approved	hmunc13, Unc13h2	uc003zwq.3	O14795	OTTHUMG00000019856	ENST00000378495.3:c.1777G>C	9.37:g.35377653G>C	ENSP00000367756:p.Asp593His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYM8	Missense_Mutation	SNP	pfam_Munc13_subgr_dom-2,pfam_Ca-dep_secretion_activator,pfam_C2_Ca-dep,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.D605H	ENST00000378495.3	37	c.1813	CCDS6579.1	9	.	.	.	.	.	.	.	.	.	.	G	31	5.094717	0.94149	.	.	ENSG00000198722	ENST00000396787;ENST00000378495;ENST00000378496;ENST00000535471	T;T;T	0.63580	-0.05;-0.05;-0.05	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.72439	0.3460	L	0.29908	0.895	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.976	T	0.74009	-0.3802	10	0.87932	D	0	-18.8428	20.4135	0.99023	0.0:0.0:1.0:0.0	.	593;593	F8W8M9;O14795	.;UN13B_HUMAN	H	605;593;593;180	ENSP00000380006:D605H;ENSP00000367756:D593H;ENSP00000367757:D593H	ENSP00000367756:D593H	D	+	1	0	UNC13B	35367653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.858000	0.99539	2.835000	0.97688	0.591000	0.81541	GAT	UNC13B	-	NULL		0.522	UNC13B-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13B	HGNC	protein_coding	OTTHUMT00000052296.1	G	NM_006377		35377653	+1	no_errors	ENST00000396787	ensembl	human	known	70_37	missense	SNP	1.000	C
USP37	57695	genome.wustl.edu	37	2	219362850	219362850	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr2:219362850C>T	ENST00000258399.3	-	12	1468	c.1056G>A	c.(1054-1056)atG>atA	p.M352I	USP37_ENST00000454775.1_Missense_Mutation_p.M352I|RN7SKP38_ENST00000410782.1_RNA|USP37_ENST00000418019.1_Missense_Mutation_p.M352I|USP37_ENST00000415516.1_Missense_Mutation_p.M280I	NM_020935.2	NP_065986	Q86T82	UBP37_HUMAN	ubiquitin specific peptidase 37	352	USP.				G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|protein deubiquitination (GO:0016579)|protein K11-linked deubiquitination (GO:0035871)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|protein kinase binding (GO:0019901)|ubiquitin-specific protease activity (GO:0004843)			NS(2)|breast(3)|cervix(1)|endometrium(6)|kidney(4)|large_intestine(1)|lung(7)|ovary(2)|prostate(3)|skin(5)|stomach(1)	35		Renal(207;0.0915)		Epithelial(149;1.08e-06)|all cancers(144;0.000197)|LUSC - Lung squamous cell carcinoma(224;0.00375)|Lung(261;0.00487)		GAATAGCATTCATATAGCAGG	0.348																																																	0													69.0	72.0	71.0					2																	219362850		2203	4299	6502	SO:0001583	missense	57695			AB046814	CCDS2418.1	2q35	2008-02-05	2005-08-08		ENSG00000135913	ENSG00000135913		"""Ubiquitin-specific peptidases"""	20063	protein-coding gene	gene with protein product			"""ubiquitin specific protease 37"""			12838346	Standard	NM_020935		Approved	KIAA1594	uc010fvs.1	Q86T82	OTTHUMG00000133113	ENST00000258399.3:c.1056G>A	2.37:g.219362850C>T	ENSP00000258399:p.Met352Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUQ8|B7ZM38|B7ZM41|E9PHL3|Q2KHT2|Q53S10|Q7Z3A5|Q9HCH8	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Ubiquitin-int_motif,pfscan_Peptidase_C19	p.M352I	ENST00000258399.3	37	c.1056	CCDS2418.1	2	.	.	.	.	.	.	.	.	.	.	C	35	5.435190	0.96150	.	.	ENSG00000135913	ENST00000258399;ENST00000454775;ENST00000415516;ENST00000418019	T;T;T;T	0.37915	1.17;1.17;1.17;1.17	5.52	5.52	0.82312	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.85682	D	0.000000	T	0.60274	0.2256	M	0.64676	1.99	0.80722	D	1	D;D	0.76494	0.998;0.999	D;D	0.81914	0.991;0.995	T	0.60291	-0.7292	10	0.66056	D	0.02	-4.4601	19.7972	0.96491	0.0:1.0:0.0:0.0	.	280;352	Q86T82-2;Q86T82	.;UBP37_HUMAN	I	352;352;280;352	ENSP00000258399:M352I;ENSP00000393662:M352I;ENSP00000400902:M280I;ENSP00000396585:M352I	ENSP00000258399:M352I	M	-	3	0	USP37	219071094	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.722000	0.84778	2.756000	0.94617	0.643000	0.83706	ATG	USP37	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.348	USP37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP37	HGNC	protein_coding	OTTHUMT00000256779.3	C	NM_020935		219362850	-1	no_errors	ENST00000258399	ensembl	human	known	70_37	missense	SNP	1.000	T
VPS13A	23230	genome.wustl.edu	37	9	79936432	79936432	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:79936432C>T	ENST00000360280.3	+	44	5860	c.5600C>T	c.(5599-5601)tCt>tTt	p.S1867F	VPS13A_ENST00000376636.3_Missense_Mutation_p.S1828F|VPS13A_ENST00000357409.5_Missense_Mutation_p.S1867F|VPS13A_ENST00000376634.4_Missense_Mutation_p.S1867F	NM_033305.2	NP_150648.2	Q96RL7	VP13A_HUMAN	vacuolar protein sorting 13 homolog A (S. cerevisiae)	1867					cell death (GO:0008219)|Golgi to endosome transport (GO:0006895)|locomotory behavior (GO:0007626)|nervous system development (GO:0007399)|protein localization (GO:0008104)|protein transport (GO:0015031)|social behavior (GO:0035176)	dense core granule (GO:0031045)|intracellular (GO:0005622)				breast(4)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(28)|liver(1)|lung(42)|ovary(3)|pancreas(3)|prostate(3)|skin(9)|upper_aerodigestive_tract(1)|urinary_tract(1)	104						GCCACTGGATCTTCAGCTGAC	0.338																																																	0													64.0	68.0	67.0					9																	79936432		2203	4299	6502	SO:0001583	missense	23230			AB023203	CCDS6655.1, CCDS6656.1, CCDS47983.1, CCDS55321.1	9q21	2014-01-30	2006-04-04	2004-02-11	ENSG00000197969	ENSG00000197969			1908	protein-coding gene	gene with protein product	"""chorein"""	605978	"""chorea acanthocytosis"", ""vacuolar protein sorting 13A (yeast)"""	CHAC		9382101, 11381253	Standard	NM_001018038		Approved	KIAA0986	uc004akr.3	Q96RL7	OTTHUMG00000020055	ENST00000360280.3:c.5600C>T	9.37:g.79936432C>T	ENSP00000353422:p.Ser1867Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JSX9|Q5JSY0|Q5VYR5|Q702P4|Q709D0|Q86YF8|Q96S61|Q9H995|Q9Y2J1	Missense_Mutation	SNP	pfam_VPSAP,pfam_Autophagy-rel_C	p.S1867F	ENST00000360280.3	37	c.5600	CCDS6655.1	9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	9.290|9.290	1.050389|1.050389	0.19827|0.19827	.|.	.|.	ENSG00000197969|ENSG00000197969	ENST00000419472|ENST00000376634;ENST00000376636;ENST00000360280;ENST00000357409	.|T;T;T;T	.|0.45276	.|0.9;0.9;0.9;0.9	5.8|5.8	4.9|4.9	0.64082|0.64082	.|.	.|0.575639	.|0.18609	.|N	.|0.136216	T|T	0.34948|0.34948	0.0915|0.0915	L|L	0.44542|0.44542	1.39|1.39	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.19445	.|0.003;0.019;0.008;0.036;0.014	.|B;B;B;B;B	.|0.18263	.|0.006;0.021;0.005;0.01;0.01	T|T	0.16778|0.16778	-1.0391|-1.0391	5|10	.|0.54805	.|T	.|0.06	.|.	9.1377|9.1377	0.36883|0.36883	0.1446:0.782:0.0:0.0734|0.1446:0.782:0.0:0.0734	.|.	.|119;1828;1867;1867;1867	.|B1ALW4;Q96RL7-3;Q96RL7;Q96RL7-2;Q96RL7-4	.|.;.;VP13A_HUMAN;.;.	F|F	120|1867;1828;1867;1867	.|ENSP00000365821:S1867F;ENSP00000365823:S1828F;ENSP00000353422:S1867F;ENSP00000349985:S1867F	.|ENSP00000349985:S1867F	L|S	+|+	1|2	0|0	VPS13A|VPS13A	79126252|79126252	1.000000|1.000000	0.71417|0.71417	0.011000|0.011000	0.14972|0.14972	0.277000|0.277000	0.26821|0.26821	4.156000|4.156000	0.58138|0.58138	1.455000|1.455000	0.47813|0.47813	-0.459000|-0.459000	0.05422|0.05422	CTT|TCT	VPS13A	-	NULL		0.338	VPS13A-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13A	HGNC	protein_coding	OTTHUMT00000052753.2	C	NM_015186		79936432	+1	no_errors	ENST00000360280	ensembl	human	known	70_37	missense	SNP	0.699	T
VPS13B	157680	genome.wustl.edu	37	8	100133458	100133458	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr8:100133458C>T	ENST00000358544.2	+	8	1102	c.991C>T	c.(991-993)Caa>Taa	p.Q331*	CTD-2340D6.1_ENST00000523226.1_RNA|VPS13B_ENST00000395996.1_Nonsense_Mutation_p.Q331*|VPS13B_ENST00000441350.2_Nonsense_Mutation_p.Q331*|VPS13B_ENST00000357162.2_Nonsense_Mutation_p.Q331*|VPS13B_ENST00000355155.1_Nonsense_Mutation_p.Q331*	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	331					protein transport (GO:0015031)					NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			GCATAAAGGTCAAGAGTTATA	0.398																																					Colon(161;2205 2542 7338 31318)												0													88.0	82.0	84.0					8																	100133458		2203	4300	6503	SO:0001587	stop_gained	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.991C>T	8.37:g.100133458C>T	ENSP00000351346:p.Gln331*	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Nonsense_Mutation	SNP	pfam_Autophagy-rel_C	p.Q331*	ENST00000358544.2	37	c.991	CCDS6280.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	28.0|28.0	4.877732|4.877732	0.91664|0.91664	.|.	.|.	ENSG00000132549|ENSG00000132549	ENST00000355155;ENST00000357162;ENST00000358544;ENST00000395996;ENST00000441350|ENST00000524330	.|.	.|.	.|.	5.66|5.66	5.66|5.66	0.87406|0.87406	.|.	0.070135|.	0.64402|.	D|.	0.000019|.	.|T	.|0.74512	.|0.3726	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.72500	.|-0.4274	.|3	0.19147|.	T|.	0.46|.	.|.	17.929|17.929	0.88992|0.88992	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	X|L	331|39	.|.	ENSP00000347281:Q331X|.	Q|S	+|+	1|2	0|0	VPS13B|VPS13B	100202634|100202634	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.934000|0.934000	0.57294|0.57294	6.626000|6.626000	0.74253|0.74253	2.681000|2.681000	0.91329|0.91329	0.650000|0.650000	0.86243|0.86243	CAA|TCA	VPS13B	-	NULL		0.398	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	C	NM_184042		100133458	+1	no_errors	ENST00000358544	ensembl	human	known	70_37	nonsense	SNP	1.000	T
WDR48	57599	genome.wustl.edu	37	3	39125682	39125682	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:39125682G>A	ENST00000302313.5	+	12	1238	c.1210G>A	c.(1210-1212)Gaa>Aaa	p.E404K	WDR48_ENST00000544962.1_Missense_Mutation_p.E129K|WDR48_ENST00000396258.3_Missense_Mutation_p.E322K|WDR48_ENST00000418020.1_5'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48	404					double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		AGTGGATTTTGAAGATGAAAT	0.313																																																	0													105.0	113.0	110.0					3																	39125682		2203	4297	6500	SO:0001583	missense	57599			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.1210G>A	3.37:g.39125682G>A	ENSP00000307491:p.Glu404Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	Missense_Mutation	SNP	pfam_DUF3337,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E404K	ENST00000302313.5	37	c.1210	CCDS33738.1	3	.	.	.	.	.	.	.	.	.	.	G	33	5.272869	0.95429	.	.	ENSG00000114742	ENST00000302313;ENST00000544962;ENST00000396258	T;D;T	0.90444	0.8;-2.67;0.53	5.91	5.91	0.95273	.	0.045541	0.85682	D	0.000000	D	0.93959	0.8066	M	0.80616	2.505	0.80722	D	1	B;B;P;B	0.44816	0.058;0.239;0.844;0.411	B;B;P;P	0.49683	0.023;0.379;0.619;0.513	D	0.93819	0.7117	10	0.62326	D	0.03	-14.902	20.2985	0.98592	0.0:0.0:1.0:0.0	.	129;322;395;404	Q8TAF3-5;Q8TAF3-4;Q8TAF3-3;Q8TAF3	.;.;.;WDR48_HUMAN	K	404;129;322	ENSP00000307491:E404K;ENSP00000445187:E129K;ENSP00000379557:E322K	ENSP00000307491:E404K	E	+	1	0	WDR48	39100686	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.793000	0.96121	0.655000	0.94253	GAA	WDR48	-	pfam_DUF3337		0.313	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR48	HGNC	protein_coding	OTTHUMT00000342529.1	G	NM_020839		39125682	+1	no_errors	ENST00000302313	ensembl	human	known	70_37	missense	SNP	1.000	A
WNK1	65125	genome.wustl.edu	37	12	1017163	1017163	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr12:1017163C>T	ENST00000315939.6	+	27	7437	c.6794C>T	c.(6793-6795)tCa>tTa	p.S2265L	WNK1_ENST00000537687.1_Missense_Mutation_p.S2525L|WNK1_ENST00000340908.4_Missense_Mutation_p.S1858L|WNK1_ENST00000535572.1_Missense_Mutation_p.S2017L|WNK1_ENST00000530271.2_Missense_Mutation_p.S2763L	NM_018979.3	NP_061852.3	Q9H4A3	WNK1_HUMAN	WNK lysine deficient protein kinase 1	2265					intracellular signal transduction (GO:0035556)|ion transport (GO:0006811)|negative regulation of pancreatic juice secretion (GO:0090188)|negative regulation of phosphatase activity (GO:0010923)|neuron development (GO:0048666)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of systemic arterial blood pressure (GO:0003084)|protein phosphorylation (GO:0006468)|regulation of cellular process (GO:0050794)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|phosphatase binding (GO:0019902)|protein kinase inhibitor activity (GO:0004860)|protein serine/threonine kinase activity (GO:0004674)			breast(7)|central_nervous_system(1)|endometrium(3)|kidney(6)|large_intestine(15)|lung(43)|ovary(6)|prostate(3)|skin(7)|stomach(8)|upper_aerodigestive_tract(3)|urinary_tract(2)	104	all_cancers(10;0.00611)|all_epithelial(11;0.00825)|all_lung(10;0.0331)|Ovarian(42;0.0512)|Lung NSC(10;0.0632)		Epithelial(1;1.74e-08)|all cancers(1;7.04e-08)|OV - Ovarian serous cystadenocarcinoma(31;0.000423)|BRCA - Breast invasive adenocarcinoma(9;0.0149)|Colorectal(1;0.0197)			ATGAATCTCTCAGGCAGGAGA	0.498																																					Colon(19;451 567 6672 12618 28860)												0													96.0	82.0	87.0					12																	1017163		2203	4300	6503	SO:0001583	missense	65125			AJ296290	CCDS8506.1, CCDS53731.1, CCDS73419.1	12p13.3	2014-09-17	2005-01-19	2005-01-21	ENSG00000060237	ENSG00000060237			14540	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 167"""	605232	"""protein kinase, lysine deficient 1"", ""hereditary sensory neuropathy, type II"""	PRKWNK1, HSN2			Standard	NM_001184985		Approved	HSAN2, PPP1R167	uc031qfk.1	Q9H4A3	OTTHUMG00000090321	ENST00000315939.6:c.6794C>T	12.37:g.1017163C>T	ENSP00000313059:p.Ser2265Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4B0|C5HTZ5|C5HTZ6|C5HTZ7|H6WZW3|O15052|P54963|Q4VBX9|Q6IFS5|Q86WL5|Q8N673|Q96CZ6|Q9P1S9	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S2763L	ENST00000315939.6	37	c.8288	CCDS8506.1	12	.	.	.	.	.	.	.	.	.	.	C	25.6	4.651234	0.88056	.	.	ENSG00000060237	ENST00000535572;ENST00000315939;ENST00000537687;ENST00000252477;ENST00000530271;ENST00000537501;ENST00000340908	T;T;T;T;T	0.79247	-1.23;-1.2;-1.16;-1.25;0.44	5.55	5.55	0.83447	.	0.000000	0.52532	D	0.000076	D	0.85656	0.5747	L	0.53249	1.67	0.54753	D	0.999984	D;D;D	0.76494	0.999;0.997;0.997	D;P;P	0.65323	0.934;0.884;0.861	D	0.86061	0.1532	10	0.87932	D	0	-15.6406	19.6982	0.96039	0.0:1.0:0.0:0.0	.	2018;2017;2265	Q9H4A3-2;F5GWT4;Q9H4A3	.;.;WNK1_HUMAN	L	2017;2265;2525;1438;2763;207;1858	ENSP00000441972:S2017L;ENSP00000313059:S2265L;ENSP00000444465:S2525L;ENSP00000433548:S2763L;ENSP00000341292:S1858L	ENSP00000252477:S1438L	S	+	2	0	WNK1	887424	1.000000	0.71417	1.000000	0.80357	0.903000	0.53119	7.236000	0.78154	2.894000	0.99253	0.655000	0.94253	TCA	WNK1	-	NULL		0.498	WNK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNK1	HGNC	protein_coding	OTTHUMT00000206683.1	C	NM_018979		1017163	+1	no_errors	ENST00000530271	ensembl	human	known	70_37	missense	SNP	1.000	T
XYLT1	64131	genome.wustl.edu	37	16	17202795	17202795	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr16:17202795G>A	ENST00000261381.6	-	12	2721	c.2637C>T	c.(2635-2637)ctC>ctT	p.L879L		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	879					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						TGGGCAGGCTGAGGACGGGGT	0.627																																																	0													98.0	98.0	98.0					16																	17202795		2197	4300	6497	SO:0001819	synonymous_variant	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.2637C>T	16.37:g.17202795G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H1B6	Silent	SNP	pfam_XylT,pfam_Glyco_trans_14	p.L879	ENST00000261381.6	37	c.2637	CCDS10569.1	16																																																																																			XYLT1	-	NULL		0.627	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2	G	NM_022166		17202795	-1	no_errors	ENST00000261381	ensembl	human	known	70_37	silent	SNP	1.000	A
ZBTB37	84614	genome.wustl.edu	37	1	173842618	173842618	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr1:173842618G>A	ENST00000367701.5	+	3	1128	c.937G>A	c.(937-939)Ggc>Agc	p.G313S	ZBTB37_ENST00000367702.1_Missense_Mutation_p.G313S|ZBTB37_ENST00000432989.1_Missense_Mutation_p.G313S|ZBTB37_ENST00000367704.1_Intron|ZBTB37_ENST00000427304.1_Missense_Mutation_p.G313S			Q5TC79	ZBT37_HUMAN	zinc finger and BTB domain containing 37	313					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(1)|urinary_tract(4)	13						TAGCCCCTCCGGCAGTGTTGT	0.483																																																	0													68.0	66.0	67.0					1																	173842618		2203	4300	6503	SO:0001583	missense	84614			AK057310	CCDS1312.1, CCDS44278.1	1q24.2	2013-01-08			ENSG00000185278	ENSG00000185278		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	28365	protein-coding gene	gene with protein product						12477932	Standard	NM_032522		Approved	MGC2629, ZNF908	uc009wwp.1	Q5TC79	OTTHUMG00000037274	ENST00000367701.5:c.937G>A	1.37:g.173842618G>A	ENSP00000356674:p.Gly313Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TC80|Q96M87|Q9BQ88	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G313S	ENST00000367701.5	37	c.937	CCDS44278.1	1	.	.	.	.	.	.	.	.	.	.	G	16.70	3.194931	0.58017	.	.	ENSG00000185278	ENST00000427304;ENST00000432989;ENST00000367702;ENST00000367703;ENST00000367701	T;D;D;T	0.87491	2.6;-2.26;-2.26;2.6	5.9	5.9	0.94986	.	0.095521	0.64402	D	0.000001	D	0.85327	0.5671	L	0.27053	0.805	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.946	T	0.79860	-0.1625	10	0.07482	T	0.82	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	313;313	Q5TC79;Q5TC79-2	ZBT37_HUMAN;.	S	313;313;313;221;313	ENSP00000415293:G313S;ENSP00000409408:G313S;ENSP00000356675:G313S;ENSP00000356674:G313S	ENSP00000356674:G313S	G	+	1	0	ZBTB37	172109241	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.230000	0.95299	2.788000	0.95919	0.650000	0.86243	GGC	ZBTB37	-	NULL		0.483	ZBTB37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB37	HGNC	protein_coding	OTTHUMT00000090729.2	G	NM_032522		173842618	+1	no_errors	ENST00000367701	ensembl	human	known	70_37	missense	SNP	1.000	A
ZBTB38	253461	genome.wustl.edu	37	3	141162891	141162891	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr3:141162891G>A	ENST00000514251.1	+	4	1940	c.1661G>A	c.(1660-1662)gGa>gAa	p.G554E	ZBTB38_ENST00000441582.2_Missense_Mutation_p.G554E|ZBTB38_ENST00000321464.5_Missense_Mutation_p.G555E					zinc finger and BTB domain containing 38											breast(3)|cervix(4)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(3)|lung(14)|ovary(3)|prostate(2)|skin(3)|urinary_tract(1)	41						ACAGCAAATGGAGGCTTGAAG	0.378																																																	0													55.0	52.0	53.0					3																	141162891		1836	4090	5926	SO:0001583	missense	253461			BC015444	CCDS43157.1	3q23	2014-06-13			ENSG00000177311	ENSG00000177311		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	26636	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 171"""	612218				12477932	Standard	NM_001080412		Approved	FLJ35036, CIBZ, ZNF921, PPP1R171	uc003etw.3	Q8NAP3	OTTHUMG00000160128	ENST00000514251.1:c.1661G>A	3.37:g.141162891G>A	ENSP00000426387:p.Gly554Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.G555E	ENST00000514251.1	37	c.1664	CCDS43157.1	3	.	.	.	.	.	.	.	.	.	.	G	22.9	4.353351	0.82132	.	.	ENSG00000177311	ENST00000509883;ENST00000514251;ENST00000441582;ENST00000321464	T;T;T;T	0.10477	3.42;2.87;2.87;2.87	5.29	5.29	0.74685	.	0.068518	0.56097	D	0.000022	T	0.30262	0.0759	M	0.66939	2.045	0.58432	D	0.999993	D;D	0.63880	0.993;0.993	P;P	0.61722	0.858;0.893	T	0.00731	-1.1590	9	.	.	.	-23.4879	18.9347	0.92580	0.0:0.0:1.0:0.0	.	555;554	B4DYR8;Q8NAP3	.;ZBT38_HUMAN	E	554;554;554;555	ENSP00000424254:G554E;ENSP00000426387:G554E;ENSP00000406955:G554E;ENSP00000372635:G555E	.	G	+	2	0	ZBTB38	142645581	1.000000	0.71417	0.990000	0.47175	0.996000	0.88848	7.489000	0.81451	2.485000	0.83878	0.650000	0.86243	GGA	ZBTB38	-	NULL		0.378	ZBTB38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB38	HGNC	protein_coding	OTTHUMT00000359329.2	G			141162891	+1	no_errors	ENST00000321464	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF157	7712	genome.wustl.edu	37	X	47269681	47269681	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chrX:47269681G>A	ENST00000377073.3	+	2	165	c.79G>A	c.(79-81)Gtg>Atg	p.V27M		NM_003446.3	NP_003437.2	P51786	ZN157_HUMAN	zinc finger protein 157	27	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(5)|upper_aerodigestive_tract(1)	11						ACAGGGGTCCGTGTCATTCGA	0.483																																																	0													143.0	123.0	130.0					X																	47269681		2203	4300	6503	SO:0001583	missense	7712			U28687	CCDS14278.1	Xp11.2	2013-01-08	2006-08-22		ENSG00000147117	ENSG00000147117		"""Zinc fingers, C2H2-type"", ""-"""	12942	protein-coding gene	gene with protein product		300024	"""zinc finger protein 157 (HZF22)"""			8586441	Standard	NM_003446		Approved	HZF22	uc004dhr.1	P51786	OTTHUMG00000021443	ENST00000377073.3:c.79G>A	X.37:g.47269681G>A	ENSP00000366273:p.Val27Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LE9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.V27M	ENST00000377073.3	37	c.79	CCDS14278.1	X	.	.	.	.	.	.	.	.	.	.	G	10.25	1.297796	0.23650	.	.	ENSG00000147117	ENST00000377073	T	0.05925	3.37	3.27	2.37	0.29283	Krueppel-associated box (4);	.	.	.	.	T	0.14013	0.0339	L	0.54908	1.71	0.23940	N	0.996402	D	0.69078	0.997	P	0.61477	0.889	T	0.10870	-1.0611	9	0.56958	D	0.05	.	5.2176	0.15352	0.0:0.2286:0.5334:0.2381	.	27	P51786	ZN157_HUMAN	M	27	ENSP00000366273:V27M	ENSP00000366273:V27M	V	+	1	0	ZNF157	47154625	0.945000	0.32115	0.307000	0.25127	0.484000	0.33280	1.410000	0.34691	0.738000	0.32606	0.423000	0.28283	GTG	ZNF157	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.483	ZNF157-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF157	HGNC	protein_coding	OTTHUMT00000056415.1	G	NM_003446		47269681	+1	no_errors	ENST00000377073	ensembl	human	known	70_37	missense	SNP	0.377	A
ZNF189	7743	genome.wustl.edu	37	9	104171183	104171183	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr9:104171183G>A	ENST00000339664.2	+	3	1262	c.1133G>A	c.(1132-1134)gGg>gAg	p.G378E	ZNF189_ENST00000374861.3_Missense_Mutation_p.G364E|ZNF189_ENST00000259395.4_Missense_Mutation_p.G336E	NM_001278240.1	NP_001265169.1	O75820	ZN189_HUMAN	zinc finger protein 189	378					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(10)|ovary(2)|prostate(3)|skin(2)|urinary_tract(1)	26		Acute lymphoblastic leukemia(62;0.0559)				AAAGAGTGTGGGAAAAGTTTC	0.418																																																	0													86.0	90.0	89.0					9																	104171183		2203	4300	6503	SO:0001583	missense	7743			AF025770	CCDS6754.1, CCDS6755.1, CCDS65096.1, CCDS75867.1	9q22-q31	2013-01-08			ENSG00000136870	ENSG00000136870		"""Zinc fingers, C2H2-type"", ""-"""	12980	protein-coding gene	gene with protein product		603132				9653648	Standard	NM_003452		Approved		uc004bbh.2	O75820	OTTHUMG00000020383	ENST00000339664.2:c.1133G>A	9.37:g.104171183G>A	ENSP00000342019:p.Gly378Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	O75802|Q5T7D7|Q5T7D8|Q5T7D9|Q9UBL4|Q9UPE9|Q9UPF0|Q9UPF1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G378E	ENST00000339664.2	37	c.1133	CCDS6754.1	9	.	.	.	.	.	.	.	.	.	.	G	15.05	2.718632	0.48622	.	.	ENSG00000136870	ENST00000374861;ENST00000339664;ENST00000259395	T;T;T	0.21361	2.01;2.01;2.01	4.64	4.64	0.57946	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.47852	D	0.000208	T	0.36110	0.0955	L	0.35644	1.08	0.54753	D	0.999988	D;D;D	0.89917	0.999;0.999;1.0	D;D;D	0.76575	0.983;0.988;0.981	T	0.02042	-1.1224	10	0.48119	T	0.1	.	15.8307	0.78749	0.0:0.0:1.0:0.0	.	363;364;378	B7ZLK9;Q5T7D8;O75820	.;.;ZN189_HUMAN	E	364;378;336	ENSP00000363995:G364E;ENSP00000342019:G378E;ENSP00000259395:G336E	ENSP00000259395:G336E	G	+	2	0	ZNF189	103211004	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	2.845000	0.48254	2.861000	0.98227	0.655000	0.94253	GGG	ZNF189	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.418	ZNF189-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF189	HGNC	protein_coding	OTTHUMT00000053447.1	G	NM_003452		104171183	+1	no_errors	ENST00000339664	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF226	7769	genome.wustl.edu	37	19	44680964	44680964	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:44680964C>T	ENST00000590089.1	+	7	1916	c.1549C>T	c.(1549-1551)Cat>Tat	p.H517Y	ZNF226_ENST00000588883.1_3'UTR|ZNF226_ENST00000454662.2_Missense_Mutation_p.H517Y|ZNF226_ENST00000337433.5_Missense_Mutation_p.H517Y			Q9NYT6	ZN226_HUMAN	zinc finger protein 226	517					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)						Prostate(69;0.0352)|all_neural(266;0.202)				GAGGAATTCCCATTATCAAGT	0.433																																					Pancreas(115;581 1665 13228 19278 50070)												0													66.0	71.0	69.0					19																	44680964		2194	4298	6492	SO:0001583	missense	7769			AF024707	CCDS46102.1, CCDS46103.1	19q13.31	2013-01-08	2012-09-11	2012-09-11	ENSG00000167380	ENSG00000167380		"""Zinc fingers, C2H2-type"", ""-"""	13019	protein-coding gene	gene with protein product							Standard	NM_001146220		Approved		uc002oyp.3	Q9NYT6		ENST00000590089.1:c.1549C>T	19.37:g.44680964C>T	ENSP00000465121:p.His517Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WWE6|Q96TE6|Q9NS44	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H517Y	ENST00000590089.1	37	c.1549	CCDS46102.1	19	.	.	.	.	.	.	.	.	.	.	C	11.40	1.628841	0.28978	.	.	ENSG00000167380	ENST00000337433;ENST00000454662	T;T	0.13089	2.62;2.62	3.92	2.79	0.32731	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.523108	0.14358	N	0.324634	T	0.17152	0.0412	L	0.27053	0.805	0.09310	N	1	D	0.61080	0.989	P	0.61070	0.883	T	0.06734	-1.0810	10	0.41790	T	0.15	.	6.4252	0.21766	0.1838:0.7127:0.0:0.1035	.	517	Q9NYT6	ZN226_HUMAN	Y	517	ENSP00000336719:H517Y;ENSP00000393265:H517Y	ENSP00000336719:H517Y	H	+	1	0	ZNF226	49372804	0.000000	0.05858	0.154000	0.22540	0.993000	0.82548	-1.637000	0.02015	2.201000	0.70794	0.655000	0.94253	CAT	ZNF226	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.433	ZNF226-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF226	HGNC	protein_coding	OTTHUMT00000460712.1	C			44680964	+1	no_errors	ENST00000337433	ensembl	human	known	70_37	missense	SNP	0.000	T
ZNF227	7770	genome.wustl.edu	37	19	44740722	44740722	+	Silent	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:44740722G>A	ENST00000313040.7	+	6	2344	c.2139G>A	c.(2137-2139)gaG>gaA	p.E713E	ZNF227_ENST00000391961.2_Silent_p.E662E|ZNF227_ENST00000589005.1_Silent_p.E662E|ZNF235_ENST00000589799.1_3'UTR	NM_182490.1	NP_872296.1	Q86WZ6	ZN227_HUMAN	zinc finger protein 227	713					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|kidney(3)|large_intestine(4)|lung(12)|ovary(2)|stomach(1)|urinary_tract(1)	24		Prostate(69;0.0435)				ACACGGGAGAGAAACCCCATA	0.488																																																	0													94.0	97.0	96.0					19																	44740722		2203	4300	6503	SO:0001819	synonymous_variant	7770			AK092253	CCDS12636.1, CCDS74388.1	19q13.32	2013-01-08						"""Zinc fingers, C2H2-type"", ""-"""	13020	protein-coding gene	gene with protein product							Standard	XM_005259232		Approved		uc002oyu.3	Q86WZ6		ENST00000313040.7:c.2139G>A	19.37:g.44740722G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRU7|B7Z5P9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E713	ENST00000313040.7	37	c.2139	CCDS12636.1	19																																																																																			ZNF227	-	pfscan_Znf_C2H2		0.488	ZNF227-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF227	HGNC	protein_coding	OTTHUMT00000460720.1	G	NM_182490		44740722	+1	no_errors	ENST00000313040	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF347	84671	genome.wustl.edu	37	19	53644231	53644231	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:53644231C>T	ENST00000334197.7	-	5	1918	c.1850G>A	c.(1849-1851)cGa>cAa	p.R617Q	ZNF347_ENST00000452676.2_Missense_Mutation_p.R618Q|ZNF347_ENST00000601469.2_Missense_Mutation_p.R618Q|ZNF347_ENST00000601804.1_Intron	NM_032584.2	NP_115973.2	Q96SE7	ZN347_HUMAN	zinc finger protein 347	617					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|kidney(2)|large_intestine(6)|lung(8)|prostate(3)|skin(1)	23				GBM - Glioblastoma multiforme(134;0.0179)		AGTATGAATTCGCTGATGCCT	0.393																																					Melanoma(64;205 1597 17324 45721)												0													115.0	110.0	112.0					19																	53644231		2203	4300	6503	SO:0001583	missense	84671			AY029765	CCDS33097.1, CCDS54314.1	19q13.3	2013-01-08				ENSG00000197937		"""Zinc fingers, C2H2-type"", ""-"""	16447	protein-coding gene	gene with protein product							Standard	NM_032584		Approved	ZNF1111	uc010eql.2	Q96SE7		ENST00000334197.7:c.1850G>A	19.37:g.53644231C>T	ENSP00000334146:p.Arg617Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU77|B9EG59|G5E9N4|Q8TCN1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R618Q	ENST00000334197.7	37	c.1853	CCDS33097.1	19	.	.	.	.	.	.	.	.	.	.	C	14.14	2.445416	0.43429	.	.	ENSG00000197937	ENST00000334197;ENST00000452676	T;T	0.24723	1.84;1.84	3.01	-2.07	0.07276	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.34424	0.0897	L	0.53617	1.68	0.09310	N	1	D;P	0.89917	1.0;0.952	P;B	0.61658	0.892;0.361	T	0.19976	-1.0289	9	0.62326	D	0.03	.	4.7383	0.12999	0.0:0.4101:0.2947:0.2952	.	618;617	G5E9N4;Q96SE7	.;ZN347_HUMAN	Q	617;618	ENSP00000334146:R617Q;ENSP00000405218:R618Q	ENSP00000334146:R617Q	R	-	2	0	ZNF347	58336043	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.211000	0.09332	-0.453000	0.07076	-0.882000	0.02950	CGA	ZNF347	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF347-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF347	HGNC	protein_coding	OTTHUMT00000464170.1	C	NM_032584		53644231	-1	no_errors	ENST00000452676	ensembl	human	known	70_37	missense	SNP	0.001	T
ZNF329	79673	genome.wustl.edu	37	19	58640056	58640056	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:58640056G>A	ENST00000598312.1	-	4	1048	c.815C>T	c.(814-816)tCa>tTa	p.S272L	ZNF329_ENST00000358067.4_Missense_Mutation_p.S272L	NM_024620.3	NP_078896.3	Q86UD4	ZN329_HUMAN	zinc finger protein 329	272					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|large_intestine(10)|lung(5)|skin(3)|urinary_tract(1)	20		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.029)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.017)|Lung(386;0.216)		TGTCAGAGCTGAGCCATCACT	0.438																																																	0													131.0	123.0	126.0					19																	58640056		2203	4300	6503	SO:0001583	missense	79673			AK022648	CCDS12972.1	19q13.43	2013-01-08				ENSG00000181894		"""Zinc fingers, C2H2-type"""	14209	protein-coding gene	gene with protein product							Standard	XM_006723381		Approved	FLJ12586	uc002qrn.3	Q86UD4		ENST00000598312.1:c.815C>T	19.37:g.58640056G>A	ENSP00000470008:p.Ser272Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KR32|Q9H9R7	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S272L	ENST00000598312.1	37	c.815	CCDS12972.1	19	.	.	.	.	.	.	.	.	.	.	G	13.41	2.229201	0.39399	.	.	ENSG00000181894	ENST00000358067;ENST00000500161	T;T	0.17854	2.25;2.25	4.16	4.16	0.48862	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.38217	N	0.001766	T	0.35393	0.0930	M	0.79123	2.44	0.42723	D	0.993689	D	0.64830	0.994	P	0.57911	0.829	T	0.13202	-1.0518	10	0.62326	D	0.03	-7.5275	11.5727	0.50843	0.0:0.0:0.821:0.179	.	272	Q86UD4	ZN329_HUMAN	L	272	ENSP00000350773:S272L;ENSP00000439527:S272L	ENSP00000350773:S272L	S	-	2	0	ZNF329	63331868	0.001000	0.12720	1.000000	0.80357	0.944000	0.59088	0.814000	0.27239	2.617000	0.88574	0.655000	0.94253	TCA	ZNF329	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.438	ZNF329-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF329	HGNC	protein_coding	OTTHUMT00000466724.1	G	NM_024620		58640056	-1	no_errors	ENST00000358067	ensembl	human	known	70_37	missense	SNP	0.991	A
ZNF516	9658	genome.wustl.edu	37	18	74092249	74092249	+	Silent	SNP	C	C	T	rs533522002		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr18:74092249C>T	ENST00000443185.2	-	4	2138	c.1821G>A	c.(1819-1821)ccG>ccA	p.P607P	RP11-504I13.3_ENST00000583287.1_RNA|ZNF516_ENST00000524431.2_5'UTR	NM_014643.3	NP_055458.1	Q92618	ZN516_HUMAN	zinc finger protein 516	607					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Prostate(75;0.0869)|Esophageal squamous(42;0.129)		OV - Ovarian serous cystadenocarcinoma(15;7.64e-06)|BRCA - Breast invasive adenocarcinoma(31;0.238)		AGCAGCGGCGCGGCTGTCCCC	0.542													C|||	1	0.000199681	0.0	0.0014	5008	,	,		18517	0.0		0.0	False		,,,				2504	0.0																0													33.0	36.0	35.0					18																	74092249		1983	4147	6130	SO:0001819	synonymous_variant	9658			D86975	CCDS74234.1	18q23	2013-01-08				ENSG00000101493		"""Zinc fingers, C2H2-type"""	28990	protein-coding gene	gene with protein product		615114				9039502	Standard	NM_014643		Approved	HsT287, KIAA0222	uc021ulp.1	Q92618		ENST00000443185.2:c.1821G>A	18.37:g.74092249C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P607	ENST00000443185.2	37	c.1821		18																																																																																			ZNF516	-	NULL		0.542	ZNF516-201	KNOWN	basic|appris_principal|exp_conf	protein_coding	ZNF516	HGNC	protein_coding		C	NM_014643		74092249	-1	no_errors	ENST00000443185	ensembl	human	known	70_37	silent	SNP	0.062	T
ZNF609	23060	genome.wustl.edu	37	15	64791779	64791779	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr15:64791779C>G	ENST00000326648.3	+	1	289	c.161C>G	c.(160-162)tCa>tGa	p.S54*	ZNF609_ENST00000416172.1_Nonsense_Mutation_p.S54*	NM_015042.1	NP_055857.1	O15014	ZN609_HUMAN	zinc finger protein 609	54						nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(3)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(9)|lung(11)|ovary(1)|pancreas(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						ATGTCAGGCTCAAAGGAGGTG	0.527																																																	0													136.0	129.0	131.0					15																	64791779		2203	4300	6503	SO:0001587	stop_gained	23060			BC014251	CCDS32270.1	15q22.1	2008-05-02				ENSG00000180357		"""Zinc fingers, C2H2-type"""	29003	protein-coding gene	gene with protein product						9205841	Standard	NM_015042		Approved	KIAA0295	uc002ann.3	O15014		ENST00000326648.3:c.161C>G	15.37:g.64791779C>G	ENSP00000316527:p.Ser54*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0D2I2	Nonsense_Mutation	SNP	pfscan_Znf_C2H2	p.S54*	ENST00000326648.3	37	c.161	CCDS32270.1	15	.	.	.	.	.	.	.	.	.	.	.	37	6.147652	0.97324	.	.	ENSG00000180357	ENST00000416172;ENST00000326648	.	.	.	5.5	5.5	0.81552	.	0.296046	0.29246	N	0.012707	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	-9.9548	19.7614	0.96319	0.0:1.0:0.0:0.0	.	.	.	.	X	54	.	ENSP00000316527:S54X	S	+	2	0	ZNF609	62578832	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.765000	0.85310	2.747000	0.94245	0.651000	0.88453	TCA	ZNF609	-	NULL		0.527	ZNF609-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF609	HGNC	protein_coding	OTTHUMT00000418130.1	C	XM_042833		64791779	+1	no_errors	ENST00000326648	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ZNF71	58491	genome.wustl.edu	37	19	57133525	57133525	+	Silent	SNP	C	C	T			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:57133525C>T	ENST00000328070.6	+	3	1104	c.870C>T	c.(868-870)cgC>cgT	p.R290R		NM_021216.4	NP_067039.1	Q9NQZ8	ZNF71_HUMAN	zinc finger protein 71	290					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|large_intestine(5)|lung(13)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	26				GBM - Glioblastoma multiforme(193;0.062)|Lung(386;0.0681)|LUSC - Lung squamous cell carcinoma(496;0.18)		AGCACCAGCGCACGCACACCG	0.657																																																	0													61.0	62.0	62.0					19																	57133525		2203	4300	6503	SO:0001819	synonymous_variant	58491			X60074	CCDS12947.1	19q13.4	2013-01-08	2006-05-12			ENSG00000197951		"""Zinc fingers, C2H2-type"""	13141	protein-coding gene	gene with protein product		194545	"""zinc finger protein 71 (Cos26)"""			1639391	Standard	NM_021216		Approved	Cos26, EZFIT	uc002qnm.4	Q9NQZ8		ENST00000328070.6:c.870C>T	19.37:g.57133525C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15919|Q9UC09|Q9UQD3	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R290	ENST00000328070.6	37	c.870	CCDS12947.1	19																																																																																			ZNF71	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.657	ZNF71-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF71	HGNC	protein_coding	OTTHUMT00000459798.2	C	NM_021216		57133525	+1	no_errors	ENST00000328070	ensembl	human	known	70_37	silent	SNP	0.001	T
ZNF750	79755	genome.wustl.edu	37	17	80790328	80790328	+	Start_Codon_SNP	SNP	C	C	G	rs200826990		TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr17:80790328C>G	ENST00000269394.3	-	2	836	c.3G>C	c.(1-3)atG>atC	p.M1I	TBCD_ENST00000539345.2_Intron|TBCD_ENST00000355528.4_Intron|TBCD_ENST00000397466.2_Intron|ZNF750_ENST00000572562.1_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	1					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			TGAGGAGACTCATTTTCCTCC	0.512																																																	0													52.0	57.0	55.0					17																	80790328		2177	4281	6458	SO:0001582	initiator_codon_variant	79755			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.3G>C	17.37:g.80790328C>G	ENSP00000269394:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H899	Missense_Mutation	SNP	NULL	p.M1I	ENST00000269394.3	37	c.3	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	C	23.5	4.421011	0.83559	.	.	ENSG00000141579	ENST00000269394	T	0.32272	1.46	5.69	5.69	0.88448	.	0.000000	0.85682	D	0.000000	T	0.57814	0.2079	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.80764	0.994	T	0.55915	-0.8065	8	.	.	.	-33.7684	18.7814	0.91934	0.0:1.0:0.0:0.0	.	1	Q32MQ0	ZN750_HUMAN	I	1	ENSP00000269394:M1I	.	M	-	3	0	ZNF750	78383617	1.000000	0.71417	1.000000	0.80357	0.494000	0.33585	7.191000	0.77763	2.675000	0.91044	0.561000	0.74099	ATG	ZNF750	-	NULL		0.512	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	C	NM_024702	Missense_Mutation	80790328	-1	no_errors	ENST00000269394	ensembl	human	known	70_37	missense	SNP	1.000	G
ZSCAN18	65982	genome.wustl.edu	37	19	58596539	58596539	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr19:58596539G>A	ENST00000240727.6	-	7	1445	c.1046C>T	c.(1045-1047)tCg>tTg	p.S349L	ZSCAN18_ENST00000600404.1_Missense_Mutation_p.S405L|ZSCAN18_ENST00000421612.2_Missense_Mutation_p.S213L|ZSCAN18_ENST00000601144.1_Missense_Mutation_p.S349L	NM_023926.4	NP_076415.3	Q8TBC5	ZSC18_HUMAN	zinc finger and SCAN domain containing 18	349					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(8)|skin(3)	19		Colorectal(82;0.000256)|all_neural(62;0.0412)|Breast(46;0.114)|Ovarian(87;0.156)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0152)		CTGCCTCTGCGATCCGGTGGC	0.706																																																	0													17.0	21.0	20.0					19																	58596539		2200	4292	6492	SO:0001583	missense	65982			AY280799, AY279352	CCDS12971.1, CCDS46214.1, CCDS46215.1	19q13.43	2013-01-09	2007-02-20	2007-02-20		ENSG00000121413		"""-"", ""Zinc fingers, C2H2-type"""	21037	protein-coding gene	gene with protein product			"""zinc finger protein 447"""	ZNF447			Standard	NM_001145542		Approved	FLJ12895	uc010yht.1	Q8TBC5		ENST00000240727.6:c.1046C>T	19.37:g.58596539G>A	ENSP00000240727:p.Ser349Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DG23|E9PBI0|Q9BRK7|Q9H9A0	Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,superfamily_Krueppel-associated_box,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S405L	ENST00000240727.6	37	c.1214	CCDS12971.1	19	.	.	.	.	.	.	.	.	.	.	G	7.809	0.715325	0.15306	.	.	ENSG00000121413	ENST00000433686;ENST00000240727;ENST00000421612	T;T	0.02395	4.53;4.31	3.34	-2.62	0.06152	.	2.121080	0.02436	N	0.084036	T	0.01558	0.0050	N	0.08118	0	0.09310	N	0.999998	B;B;B;B	0.23058	0.047;0.028;0.079;0.011	B;B;B;B	0.12156	0.003;0.005;0.007;0.003	T	0.42999	-0.9418	10	0.31617	T	0.26	1.1628	0.301	0.00273	0.2656:0.1452:0.2949:0.2943	.	405;213;348;349	B4DG23;E9PBI0;Q8TBC5-2;Q8TBC5	.;.;.;ZSC18_HUMAN	L	405;349;213	ENSP00000240727:S349L;ENSP00000392653:S213L	ENSP00000240727:S349L	S	-	2	0	ZSCAN18	63288351	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.162000	0.16501	-0.438000	0.07232	-1.086000	0.02197	TCG	ZSCAN18	-	NULL		0.706	ZSCAN18-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	ZSCAN18	HGNC	protein_coding	OTTHUMT00000466706.1	G	NM_023926		58596539	-1	no_errors	ENST00000600404	ensembl	human	known	70_37	missense	SNP	0.001	A
ZW10	9183	genome.wustl.edu	37	11	113619050	113619050	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MH-01A-11D-A14W-08	TCGA-C5-A1MH-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	f26c7e5f-b991-454c-81c6-ceadfb6d0270	d41f3de8-9eab-4d20-b390-fd0bce1a1afd	g.chr11:113619050C>G	ENST00000200135.3	-	8	1162	c.1018G>C	c.(1018-1020)Gag>Cag	p.E340Q		NM_004724.3	NP_004715.1	O43264	ZW10_HUMAN	zw10 kinetochore protein	340					ER to Golgi vesicle-mediated transport (GO:0006888)|establishment of mitotic spindle orientation (GO:0000132)|meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic metaphase plate congression (GO:0007080)|mitotic sister chromatid segregation (GO:0000070)|protein complex assembly (GO:0006461)|protein localization to kinetochore (GO:0034501)|protein transport (GO:0015031)|regulation of exit from mitosis (GO:0007096)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|membrane (GO:0016020)|nucleus (GO:0005634)|spindle pole (GO:0000922)	centromeric DNA binding (GO:0019237)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|skin(1)	18		all_cancers(61;3.84e-16)|all_epithelial(67;1e-09)|Melanoma(852;1.46e-05)|all_hematologic(158;0.000237)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Prostate(24;0.0421)|Medulloblastoma(222;0.0425)		BRCA - Breast invasive adenocarcinoma(274;2.94e-06)|Epithelial(105;0.000103)|all cancers(92;0.000786)		ATGAGGCACTCAGACAAGTCC	0.413																																																	0													153.0	142.0	146.0					11																	113619050		2201	4296	6497	SO:0001583	missense	9183			U54996	CCDS8363.1	11q23	2013-01-17	2012-12-13		ENSG00000086827	ENSG00000086827			13194	protein-coding gene	gene with protein product		603954	"""ZW10 (Drosophila) homolog, centromere/kinetochore protein"", ""ZW10, kinetochore associated, homolog (Drosophila)"""			9298984	Standard	NM_004724		Approved	KNTC1AP	uc001poe.3	O43264	OTTHUMG00000168190	ENST00000200135.3:c.1018G>C	11.37:g.113619050C>G	ENSP00000200135:p.Glu340Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A528	Missense_Mutation	SNP	pfam_RZZ-complex_Zw10	p.E340Q	ENST00000200135.3	37	c.1018	CCDS8363.1	11	.	.	.	.	.	.	.	.	.	.	C	14.61	2.586870	0.46110	.	.	ENSG00000086827	ENST00000200135	T	0.50813	0.73	5.23	5.23	0.72850	.	0.317629	0.37955	N	0.001879	T	0.50939	0.1645	L	0.46741	1.465	0.41770	D	0.98976	B	0.27380	0.177	B	0.43194	0.411	T	0.45469	-0.9259	10	0.25106	T	0.35	-8.5482	13.4818	0.61340	0.0:0.925:0.0:0.075	.	340	O43264	ZW10_HUMAN	Q	340	ENSP00000200135:E340Q	ENSP00000200135:E340Q	E	-	1	0	ZW10	113124260	0.989000	0.36119	0.998000	0.56505	0.963000	0.63663	2.620000	0.46410	2.608000	0.88229	0.561000	0.74099	GAG	ZW10	-	pfam_RZZ-complex_Zw10		0.413	ZW10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZW10	HGNC	protein_coding	OTTHUMT00000398700.1	C	NM_004724		113619050	-1	no_errors	ENST00000200135	ensembl	human	known	70_37	missense	SNP	0.987	G
