#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCD1	215	genome.wustl.edu	37	X	153008476	153008476	+	Missense_Mutation	SNP	T	T	C	rs201774661		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chrX:153008476T>C	ENST00000218104.3	+	8	2215	c.1816T>C	c.(1816-1818)Tcg>Ccg	p.S606P	U52111.14_ENST00000434284.1_RNA	NM_000033.3	NP_000024.2	P33897	ABCD1_HUMAN	ATP-binding cassette, sub-family D (ALD), member 1	606	ABC transporter. {ECO:0000255|PROSITE- ProRule:PRU00434}.		S -> L (in ALD; decreased ATP-binding affinity). {ECO:0000269|PubMed:8040304}.|S -> P (in ALD; CALD, AMN and ALMD- types). {ECO:0000269|PubMed:21700483, ECO:0000269|PubMed:21889498}.		alpha-linolenic acid metabolic process (GO:0036109)|ATP catabolic process (GO:0006200)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|fatty acid beta-oxidation using acyl-CoA oxidase (GO:0033540)|linoleic acid metabolic process (GO:0043651)|long-chain fatty acid catabolic process (GO:0042758)|peroxisomal long-chain fatty acid import (GO:0015910)|peroxisomal membrane transport (GO:0015919)|peroxisome organization (GO:0007031)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|unsaturated fatty acid metabolic process (GO:0033559)|very long-chain fatty acid catabolic process (GO:0042760)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|mitochondrion (GO:0005739)|perinuclear region of cytoplasm (GO:0048471)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|peroxisomal fatty-acyl-CoA transporter activity (GO:0005325)|protein homodimerization activity (GO:0042803)|transporter activity (GO:0005215)	p.S606P(1)		breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(6)|urinary_tract(2)	18	all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					GGACGTCCTGTCGGGTGGCGA	0.657																																																	1	Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(1)	GRCh37	CM960043	ABCD1	M																																				SO:0001583	missense	215			Z21876	CCDS14728.1	Xq28	2012-03-14			ENSG00000101986	ENSG00000101986		"""ATP binding cassette transporters / subfamily D"""	61	protein-coding gene	gene with protein product		300371		ALD		8441467, 6795626	Standard	NM_000033		Approved	AMN, ALDP, adrenoleukodystrophy	uc004fif.2	P33897	OTTHUMG00000024215	ENST00000218104.3:c.1816T>C	X.37:g.153008476T>C	ENSP00000218104:p.Ser606Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GTZ2	Missense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1,tigrfam_FA_transporter	p.S606P	ENST00000218104.3	37	c.1816	CCDS14728.1	X	.	.	.	.	.	.	.	.	.	.	T	22.6	4.307005	0.81247	.	.	ENSG00000101986	ENST00000218104	D	0.99957	-8.99	5.46	5.46	0.80206	ABC transporter, conserved site (1);ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.64402	D	0.000009	D	0.99964	0.9986	H	0.99357	4.53	0.80722	D	1	D	0.56521	0.976	P	0.59546	0.859	D	0.96145	0.9103	10	0.87932	D	0	-5.1669	13.4857	0.61364	0.0:0.0:0.0:1.0	.	606	P33897	ABCD1_HUMAN	P	606	ENSP00000218104:S606P	ENSP00000218104:S606P	S	+	1	0	ABCD1	152661670	1.000000	0.71417	0.058000	0.19502	0.765000	0.43378	5.967000	0.70403	1.827000	0.53221	0.350000	0.21858	TCG	ABCD1	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like,tigrfam_FA_transporter		0.657	ABCD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD1	HGNC	protein_coding	OTTHUMT00000061041.1	T	NM_000033		153008476	+1	no_errors	ENST00000218104	ensembl	human	known	70_37	missense	SNP	1.000	C
ACLY	47	genome.wustl.edu	37	17	40069970	40069970	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:40069970G>T	ENST00000352035.2	-	2	287	c.157C>A	c.(157-159)Cag>Aag	p.Q53K	ACLY_ENST00000353196.1_Missense_Mutation_p.Q53K|ACLY_ENST00000393896.2_Missense_Mutation_p.Q53K|ACLY_ENST00000590151.1_Missense_Mutation_p.Q53K|ACLY_ENST00000537919.1_Missense_Mutation_p.Q53K	NM_001096.2	NP_001087.2	P53396	ACLY_HUMAN	ATP citrate lyase	53	ATP-grasp.				ATP catabolic process (GO:0006200)|cellular carbohydrate metabolic process (GO:0044262)|cellular lipid metabolic process (GO:0044255)|citrate metabolic process (GO:0006101)|coenzyme A metabolic process (GO:0015936)|energy reserve metabolic process (GO:0006112)|lipid biosynthetic process (GO:0008610)|long-chain fatty-acyl-CoA biosynthetic process (GO:0035338)|positive regulation of cellular metabolic process (GO:0031325)|small molecule metabolic process (GO:0044281)|triglyceride biosynthetic process (GO:0019432)	citrate lyase complex (GO:0009346)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP citrate synthase activity (GO:0003878)|cofactor binding (GO:0048037)|metal ion binding (GO:0046872)|succinate-CoA ligase (ADP-forming) activity (GO:0004775)		NTN1/ACLY(2)	breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(5)|lung(4)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	28		Breast(137;0.000143)				GGGCTCACCTGGCTGAGCAGC	0.592																																					Colon(64;807 1396 15971 30971)												0													70.0	63.0	65.0					17																	40069970		2203	4300	6503	SO:0001583	missense	47			X64330	CCDS11412.1, CCDS11413.1	17q21.2	2010-04-27			ENSG00000131473	ENSG00000131473	2.3.3.8		115	protein-coding gene	gene with protein product	"""ATP citrate synthase"""	108728				1371749, 8088842	Standard	NM_001096		Approved	ATPCL, CLATP, ACL	uc002hyg.3	P53396	OTTHUMG00000133507	ENST00000352035.2:c.157C>A	17.37:g.40069970G>T	ENSP00000253792:p.Gln53Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIM0|B4E3P0|Q13037|Q9BRL0	Missense_Mutation	SNP	pfam_Citrate_synthase-like,pfam_CoA_ligase,pfam_CoA-bd,pfam_ATP-grasp_succ-CoA_synth-type,superfamily_Citrate_synthase-like_core,superfamily_Succinyl-CoA_synth-like,smart_CoA-bd,pirsf_ATP-citrate_synthase	p.Q53K	ENST00000352035.2	37	c.157	CCDS11412.1	17	.	.	.	.	.	.	.	.	.	.	G	11.86	1.765860	0.31228	.	.	ENSG00000131473	ENST00000352035;ENST00000401700;ENST00000353196;ENST00000537919;ENST00000393896	T;T;T;T	0.68624	0.1;0.1;-0.34;0.1	5.49	4.46	0.54185	ATP-grasp fold, succinyl-CoA synthetase-type (1);	0.173246	0.50627	D	0.000103	T	0.42291	0.1196	N	0.04508	-0.205	0.42098	D	0.991328	B;B;B;B;B	0.13145	0.001;0.007;0.0;0.0;0.0	B;B;B;B;B	0.16289	0.002;0.015;0.001;0.0;0.001	T	0.35822	-0.9773	10	0.10377	T	0.69	.	15.4018	0.74845	0.0:0.2153:0.7847:0.0	.	53;107;107;53;53	B4E3P0;B4DIM0;E7ENH9;G3XAI4;P53396	.;.;.;.;ACLY_HUMAN	K	53;107;53;53;53	ENSP00000253792:Q53K;ENSP00000345398:Q53K;ENSP00000445349:Q53K;ENSP00000377474:Q53K	ENSP00000253792:Q53K	Q	-	1	0	ACLY	37323496	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	3.517000	0.53443	2.735000	0.93741	0.563000	0.77884	CAG	ACLY	-	pfam_ATP-grasp_succ-CoA_synth-type,pirsf_ATP-citrate_synthase		0.592	ACLY-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ACLY	HGNC	protein_coding	OTTHUMT00000257465.1	G	NM_001096		40069970	-1	no_errors	ENST00000352035	ensembl	human	known	70_37	missense	SNP	1.000	T
ACVR2B	93	genome.wustl.edu	37	3	38493045	38493045	+	5'Flank	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:38493045G>A	ENST00000352511.4	+	0	0				ACVR2B-AS1_ENST00000441531.1_RNA	NM_001106.3	NP_001097.2	Q13705	AVR2B_HUMAN	activin A receptor, type IIB						activation of protein kinase activity (GO:0032147)|activin receptor signaling pathway (GO:0032924)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|blood vessel remodeling (GO:0001974)|BMP signaling pathway (GO:0030509)|determination of left/right symmetry (GO:0007368)|embryonic foregut morphogenesis (GO:0048617)|gastrulation with mouth forming second (GO:0001702)|heart development (GO:0007507)|insulin secretion (GO:0030073)|kidney development (GO:0001822)|lung development (GO:0030324)|lymphangiogenesis (GO:0001946)|lymphatic endothelial cell differentiation (GO:0060836)|mesoderm development (GO:0007498)|odontogenesis of dentin-containing tooth (GO:0042475)|organ growth (GO:0035265)|palate development (GO:0060021)|pancreas development (GO:0031016)|positive regulation of activin receptor signaling pathway (GO:0032927)|positive regulation of bone mineralization (GO:0030501)|positive regulation of osteoblast differentiation (GO:0045669)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|response to glucose (GO:0009749)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|transmembrane receptor protein serine/threonine kinase signaling pathway (GO:0007178)|venous blood vessel development (GO:0060841)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	ATP binding (GO:0005524)|growth factor binding (GO:0019838)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|transforming growth factor beta-activated receptor activity (GO:0005024)			lung(1)	1	Medulloblastoma(35;0.163)			KIRC - Kidney renal clear cell carcinoma(284;0.0565)|Kidney(284;0.071)		tcaggaggtggaggtcgcagt	0.468																																																	0																																										SO:0001631	upstream_gene_variant	100128640			X77533	CCDS2679.1	3p22	2006-11-06			ENSG00000114739	ENSG00000114739			174	protein-coding gene	gene with protein product		602730				8161782, 9621519	Standard	NM_001106		Approved	ActR-IIB	uc003cif.3	Q13705	OTTHUMG00000131291		3.37:g.38493045G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VAV0	RNA	SNP	-	NULL	ENST00000352511.4	37	NULL	CCDS2679.1	3																																																																																			ACVR2B-AS1	-	-		0.468	ACVR2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACVR2B-AS1	HGNC	protein_coding	OTTHUMT00000254059.3	G	NM_001106		38493045	-1	no_errors	ENST00000441531	ensembl	human	putative	70_37	rna	SNP	0.048	A
ADAMTS20	80070	genome.wustl.edu	37	12	43826221	43826221	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:43826221C>G	ENST00000389420.3	-	21	2981	c.2982G>C	c.(2980-2982)atG>atC	p.M994I	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.M994I|ADAMTS20_ENST00000395541.2_Missense_Mutation_p.M148I	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	994	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAAAGTTATTCATACAATAAG	0.403																																																	0													117.0	117.0	117.0					12																	43826221		2203	4300	6503	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2982G>C	12.37:g.43826221C>G	ENSP00000374071:p.Met994Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.M994I	ENST00000389420.3	37	c.2982	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	12.15	1.853012	0.32699	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	4.89	-8.19	0.01049	.	0.846204	0.10296	N	0.691768	T	0.27559	0.0677	N	0.20845	0.615	0.35940	D	0.83318	B;B	0.13145	0.002;0.007	B;B	0.22152	0.006;0.038	T	0.08310	-1.0728	10	0.27082	T	0.32	.	12.6524	0.56768	0.0:0.5745:0.3142:0.1113	.	994;148	P59510;E9PBD5	ATS20_HUMAN;.	I	994;160;148;994;994	ENSP00000374071:M994I;ENSP00000447427:M160I;ENSP00000378911:M148I;ENSP00000448341:M994I	ENSP00000374068:M994I	M	-	3	0	ADAMTS20	42112488	0.577000	0.26708	0.025000	0.17156	0.939000	0.58152	-0.150000	0.10189	-1.669000	0.01470	-0.302000	0.09304	ATG	ADAMTS20	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.403	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	C	NM_025003		43826221	-1	no_errors	ENST00000389420	ensembl	human	known	70_37	missense	SNP	0.985	G
ADAMTS20	80070	genome.wustl.edu	37	12	43826221	43826221	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:43826221C>G	ENST00000389420.3	-	21	2981	c.2982G>C	c.(2980-2982)atG>atC	p.M994I	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.M994I|ADAMTS20_ENST00000395541.2_Missense_Mutation_p.M148I	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	994	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CAAAGTTATTCATACAATAAG	0.403																																																	0													117.0	117.0	117.0					12																	43826221		2203	4300	6503	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2982G>C	12.37:g.43826221C>G	ENSP00000374071:p.Met994Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.M994I	ENST00000389420.3	37	c.2982	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	12.15	1.853012	0.32699	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	T;T;T;T	0.52526	0.66;0.66;0.66;0.66	4.89	-8.19	0.01049	.	0.846204	0.10296	N	0.691768	T	0.27559	0.0677	N	0.20845	0.615	0.35940	D	0.83318	B;B	0.13145	0.002;0.007	B;B	0.22152	0.006;0.038	T	0.08310	-1.0728	10	0.27082	T	0.32	.	12.6524	0.56768	0.0:0.5745:0.3142:0.1113	.	994;148	P59510;E9PBD5	ATS20_HUMAN;.	I	994;160;148;994;994	ENSP00000374071:M994I;ENSP00000447427:M160I;ENSP00000378911:M148I;ENSP00000448341:M994I	ENSP00000374068:M994I	M	-	3	0	ADAMTS20	42112488	0.577000	0.26708	0.025000	0.17156	0.939000	0.58152	-0.150000	0.10189	-1.669000	0.01470	-0.302000	0.09304	ATG	ADAMTS20	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.403	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	C	NM_025003		43826221	-1	no_errors	ENST00000389420	ensembl	human	known	70_37	missense	SNP	0.985	G
ADAR	103	genome.wustl.edu	37	1	154558839	154558839	+	Splice_Site	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:154558839C>G	ENST00000368474.4	-	12	3219	c.3020G>C	c.(3019-3021)gGa>gCa	p.G1007A	ADAR_ENST00000292205.5_Splice_Site_p.G1050A|ADAR_ENST00000368471.3_Splice_Site_p.G712A	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	1007	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.		G -> R (in AGS6). {ECO:0000269|PubMed:23001123}.		adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TGTGCCTTCTCCTGTGTGAGA	0.547																																																	0													66.0	61.0	63.0					1																	154558839		2203	4300	6503	SO:0001630	splice_region_variant	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.3020-1G>C	1.37:g.154558839C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_Ds-RNA-bd,smart_dsRNA_A_deaminase,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.G1050A	ENST00000368474.4	37	c.3149	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872059	0.91587	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42	5.58	5.58	0.84498	Adenosine deaminase/editase (3);	0.000000	0.85682	D	0.000000	D	0.97476	0.9174	M	0.85542	2.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.97596	1.0120	10	0.66056	D	0.02	.	19.5736	0.95432	0.0:1.0:0.0:0.0	.	962;981;1007	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	A	1050;1007;712;976	ENSP00000292205:G1050A;ENSP00000357459:G1007A;ENSP00000357456:G712A;ENSP00000431794:G976A	ENSP00000292205:G1050A	G	-	2	0	ADAR	152825463	1.000000	0.71417	0.993000	0.49108	0.702000	0.40608	7.487000	0.81328	2.636000	0.89361	0.655000	0.94253	GGA	ADAR	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.547	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	C	NM_001111	Missense_Mutation	154558839	-1	no_errors	ENST00000292205	ensembl	human	known	70_37	missense	SNP	1.000	G
ADAR	103	genome.wustl.edu	37	1	154558839	154558839	+	Splice_Site	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:154558839C>G	ENST00000368474.4	-	12	3219	c.3020G>C	c.(3019-3021)gGa>gCa	p.G1007A	ADAR_ENST00000292205.5_Splice_Site_p.G1050A|ADAR_ENST00000368471.3_Splice_Site_p.G712A	NM_001111.4|NM_015840.3|NM_015841.3	NP_001102|NP_056655.2|NP_056656.2	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	1007	A to I editase. {ECO:0000255|PROSITE- ProRule:PRU00240}.		G -> R (in AGS6). {ECO:0000269|PubMed:23001123}.		adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		TGTGCCTTCTCCTGTGTGAGA	0.547																																																	0													66.0	61.0	63.0					1																	154558839		2203	4300	6503	SO:0001630	splice_region_variant	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000368474.4:c.3020-1G>C	1.37:g.154558839C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_Ds-RNA-bd,smart_dsRNA_A_deaminase,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.G1050A	ENST00000368474.4	37	c.3149	CCDS1071.1	1	.	.	.	.	.	.	.	.	.	.	C	27.9	4.872059	0.91587	.	.	ENSG00000160710	ENST00000292205;ENST00000368474;ENST00000368471;ENST00000529168	D;D;D;D	0.94417	-3.42;-3.42;-3.42;-3.42	5.58	5.58	0.84498	Adenosine deaminase/editase (3);	0.000000	0.85682	D	0.000000	D	0.97476	0.9174	M	0.85542	2.76	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;0.999	D	0.97596	1.0120	10	0.66056	D	0.02	.	19.5736	0.95432	0.0:1.0:0.0:0.0	.	962;981;1007	P55265-3;P55265-2;P55265	.;.;DSRAD_HUMAN	A	1050;1007;712;976	ENSP00000292205:G1050A;ENSP00000357459:G1007A;ENSP00000357456:G712A;ENSP00000431794:G976A	ENSP00000292205:G1050A	G	-	2	0	ADAR	152825463	1.000000	0.71417	0.993000	0.49108	0.702000	0.40608	7.487000	0.81328	2.636000	0.89361	0.655000	0.94253	GGA	ADAR	-	pfam_A_deamin,smart_A_deamin,pfscan_A_deamin		0.547	ADAR-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAR	HGNC	protein_coding	OTTHUMT00000090691.2	C	NM_001111	Missense_Mutation	154558839	-1	no_errors	ENST00000292205	ensembl	human	known	70_37	missense	SNP	1.000	G
AGBL5	60509	genome.wustl.edu	37	2	27275933	27275933	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27275933G>C	ENST00000360131.4	+	2	266	c.107G>C	c.(106-108)gGa>gCa	p.G36A	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.G36A|AGBL5-AS1_ENST00000444217.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	36					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGGGGTAGGAGGTGGGGCG	0.542																																																	0													100.0	96.0	98.0					2																	27275933		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.107G>C	2.37:g.27275933G>C	ENSP00000353249:p.Gly36Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.G36A	ENST00000360131.4	37	c.107	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	0.045	-1.270785	0.01421	.	.	ENSG00000084693	ENST00000421915;ENST00000453161;ENST00000451003;ENST00000323064;ENST00000360131	D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4	4.53	0.586	0.17434	.	0.582682	0.18085	N	0.152179	T	0.79759	0.4501	L	0.54323	1.7	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.002;0.002;0.004	T	0.59526	-0.7438	10	0.05833	T	0.94	-3.2484	4.0867	0.09950	0.0852:0.4587:0.2201:0.236	.	36;36;36	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	A	36	ENSP00000395266:G36A;ENSP00000394730:G36A;ENSP00000407584:G36A;ENSP00000323681:G36A;ENSP00000353249:G36A	ENSP00000323681:G36A	G	+	2	0	AGBL5	27129437	0.000000	0.05858	0.117000	0.21633	0.757000	0.42996	-0.844000	0.04345	-0.078000	0.12730	-0.268000	0.10319	GGA	AGBL5	-	NULL		0.542	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27275933	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	0.022	C
AGBL5	60509	genome.wustl.edu	37	2	27275933	27275933	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27275933G>C	ENST00000360131.4	+	2	266	c.107G>C	c.(106-108)gGa>gCa	p.G36A	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.G36A|AGBL5-AS1_ENST00000444217.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	36					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGGGGTAGGAGGTGGGGCG	0.542																																																	0													100.0	96.0	98.0					2																	27275933		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.107G>C	2.37:g.27275933G>C	ENSP00000353249:p.Gly36Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.G36A	ENST00000360131.4	37	c.107	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	0.045	-1.270785	0.01421	.	.	ENSG00000084693	ENST00000421915;ENST00000453161;ENST00000451003;ENST00000323064;ENST00000360131	D;D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4;-2.4	4.53	0.586	0.17434	.	0.582682	0.18085	N	0.152179	T	0.79759	0.4501	L	0.54323	1.7	0.09310	N	1	B;B;B	0.06786	0.0;0.0;0.001	B;B;B	0.09377	0.002;0.002;0.004	T	0.59526	-0.7438	10	0.05833	T	0.94	-3.2484	4.0867	0.09950	0.0852:0.4587:0.2201:0.236	.	36;36;36	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	A	36	ENSP00000395266:G36A;ENSP00000394730:G36A;ENSP00000407584:G36A;ENSP00000323681:G36A;ENSP00000353249:G36A	ENSP00000323681:G36A	G	+	2	0	AGBL5	27129437	0.000000	0.05858	0.117000	0.21633	0.757000	0.42996	-0.844000	0.04345	-0.078000	0.12730	-0.268000	0.10319	GGA	AGBL5	-	NULL		0.542	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27275933	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	0.022	C
AGBL5	60509	genome.wustl.edu	37	2	27276028	27276028	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27276028G>A	ENST00000360131.4	+	2	361	c.202G>A	c.(202-204)Gag>Aag	p.E68K	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.E68K|AGBL5-AS1_ENST00000444217.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	68					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACGGAATTTGAGAATGGGAA	0.512																																																	0													83.0	84.0	84.0					2																	27276028		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.202G>A	2.37:g.27276028G>A	ENSP00000353249:p.Glu68Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.E68K	ENST00000360131.4	37	c.202	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020160	0.93462	.	.	ENSG00000084693	ENST00000453161;ENST00000323064;ENST00000360131	D;D;D	0.90197	-2.63;-2.63;-2.63	4.44	4.44	0.53790	.	0.108055	0.64402	D	0.000007	D	0.92519	0.7624	M	0.81341	2.54	0.58432	D	0.999997	D;P;P	0.54964	0.969;0.95;0.95	P;P;P	0.48654	0.585;0.574;0.574	D	0.93129	0.6531	9	.	.	.	-7.4725	16.8612	0.86019	0.0:0.0:1.0:0.0	.	68;68;68	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	K	68	ENSP00000394730:E68K;ENSP00000323681:E68K;ENSP00000353249:E68K	.	E	+	1	0	AGBL5	27129532	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.747000	0.91610	2.294000	0.77228	0.561000	0.74099	GAG	AGBL5	-	NULL		0.512	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27276028	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27276028	27276028	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27276028G>A	ENST00000360131.4	+	2	361	c.202G>A	c.(202-204)Gag>Aag	p.E68K	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.E68K|AGBL5-AS1_ENST00000444217.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	68					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AACGGAATTTGAGAATGGGAA	0.512																																																	0													83.0	84.0	84.0					2																	27276028		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.202G>A	2.37:g.27276028G>A	ENSP00000353249:p.Glu68Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.E68K	ENST00000360131.4	37	c.202	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	29.6	5.020160	0.93462	.	.	ENSG00000084693	ENST00000453161;ENST00000323064;ENST00000360131	D;D;D	0.90197	-2.63;-2.63;-2.63	4.44	4.44	0.53790	.	0.108055	0.64402	D	0.000007	D	0.92519	0.7624	M	0.81341	2.54	0.58432	D	0.999997	D;P;P	0.54964	0.969;0.95;0.95	P;P;P	0.48654	0.585;0.574;0.574	D	0.93129	0.6531	9	.	.	.	-7.4725	16.8612	0.86019	0.0:0.0:1.0:0.0	.	68;68;68	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	K	68	ENSP00000394730:E68K;ENSP00000323681:E68K;ENSP00000353249:E68K	.	E	+	1	0	AGBL5	27129532	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.747000	0.91610	2.294000	0.77228	0.561000	0.74099	GAG	AGBL5	-	NULL		0.512	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27276028	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27276036	27276036	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27276036G>A	ENST00000360131.4	+	2	369	c.210G>A	c.(208-210)ggG>ggA	p.G70G	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Silent_p.G70G|AGBL5-AS1_ENST00000444217.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	70					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGAATGGGAACAGGTATA	0.512																																																	0													79.0	81.0	80.0					2																	27276036		2203	4300	6503	SO:0001819	synonymous_variant	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.210G>A	2.37:g.27276036G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	pfam_Peptidase_M14	p.G70	ENST00000360131.4	37	c.210	CCDS1732.3	2																																																																																			AGBL5	-	NULL		0.512	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27276036	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	silent	SNP	0.985	A
AGBL5	60509	genome.wustl.edu	37	2	27276036	27276036	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27276036G>A	ENST00000360131.4	+	2	369	c.210G>A	c.(208-210)ggG>ggA	p.G70G	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Silent_p.G70G|AGBL5-AS1_ENST00000444217.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	70					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTGAGAATGGGAACAGGTATA	0.512																																																	0													79.0	81.0	80.0					2																	27276036		2203	4300	6503	SO:0001819	synonymous_variant	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.210G>A	2.37:g.27276036G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	pfam_Peptidase_M14	p.G70	ENST00000360131.4	37	c.210	CCDS1732.3	2																																																																																			AGBL5	-	NULL		0.512	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27276036	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	silent	SNP	0.985	A
AGBL5	60509	genome.wustl.edu	37	2	27276872	27276872	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27276872G>T	ENST00000360131.4	+	4	655	c.496G>T	c.(496-498)Gaa>Taa	p.E166*	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Nonsense_Mutation_p.E166*	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	166					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGACTGCCAGGAACTGCTAAA	0.562																																																	0													182.0	176.0	178.0					2																	27276872		2203	4300	6503	SO:0001587	stop_gained	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.496G>T	2.37:g.27276872G>T	ENSP00000353249:p.Glu166*	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Nonsense_Mutation	SNP	pfam_Peptidase_M14	p.E166*	ENST00000360131.4	37	c.496	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	35	5.567593	0.96540	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	.	.	.	5.78	5.78	0.91487	.	0.315479	0.39341	N	0.001382	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.8022	18.7765	0.91913	0.0:0.0:1.0:0.0	.	.	.	.	X	166	.	.	E	+	1	0	AGBL5	27130376	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	9.249000	0.95470	2.739000	0.93911	0.561000	0.74099	GAA	AGBL5	-	NULL		0.562	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27276872	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	nonsense	SNP	1.000	T
AGBL5	60509	genome.wustl.edu	37	2	27276872	27276872	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27276872G>T	ENST00000360131.4	+	4	655	c.496G>T	c.(496-498)Gaa>Taa	p.E166*	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Nonsense_Mutation_p.E166*	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	166					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGACTGCCAGGAACTGCTAAA	0.562																																																	0													182.0	176.0	178.0					2																	27276872		2203	4300	6503	SO:0001587	stop_gained	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.496G>T	2.37:g.27276872G>T	ENSP00000353249:p.Glu166*	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Nonsense_Mutation	SNP	pfam_Peptidase_M14	p.E166*	ENST00000360131.4	37	c.496	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	35	5.567593	0.96540	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	.	.	.	5.78	5.78	0.91487	.	0.315479	0.39341	N	0.001382	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	-2.8022	18.7765	0.91913	0.0:0.0:1.0:0.0	.	.	.	.	X	166	.	.	E	+	1	0	AGBL5	27130376	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	9.249000	0.95470	2.739000	0.93911	0.561000	0.74099	GAA	AGBL5	-	NULL		0.562	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27276872	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	nonsense	SNP	1.000	T
AGBL5	60509	genome.wustl.edu	37	2	27278030	27278030	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278030G>A	ENST00000360131.4	+	6	976	c.817G>A	c.(817-819)Gat>Aat	p.D273N	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.D273N	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	273					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCCGACCTGATGATCCCCG	0.532																																																	0													142.0	138.0	139.0					2																	27278030		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.817G>A	2.37:g.27278030G>A	ENSP00000353249:p.Asp273Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.D273N	ENST00000360131.4	37	c.817	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607393	0.87157	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.10477	2.87;2.87	6.11	6.11	0.99139	Peptidase M14, carboxypeptidase A (1);	0.169713	0.64402	D	0.000006	T	0.25531	0.0621	L	0.43152	1.355	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.77557	0.99;0.957;0.983	T	0.01702	-1.1292	10	0.10111	T	0.7	-11.9379	20.3293	0.98710	0.0:0.0:1.0:0.0	.	273;273;273	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	N	273	ENSP00000323681:D273N;ENSP00000353249:D273N	ENSP00000323681:D273N	D	+	1	0	AGBL5	27131534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.412000	0.66392	2.906000	0.99361	0.655000	0.94253	GAT	AGBL5	-	pfam_Peptidase_M14		0.532	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278030	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27278030	27278030	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278030G>A	ENST00000360131.4	+	6	976	c.817G>A	c.(817-819)Gat>Aat	p.D273N	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.D273N	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	273					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCCGACCTGATGATCCCCG	0.532																																																	0													142.0	138.0	139.0					2																	27278030		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.817G>A	2.37:g.27278030G>A	ENSP00000353249:p.Asp273Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.D273N	ENST00000360131.4	37	c.817	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	25.1	4.607393	0.87157	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.10477	2.87;2.87	6.11	6.11	0.99139	Peptidase M14, carboxypeptidase A (1);	0.169713	0.64402	D	0.000006	T	0.25531	0.0621	L	0.43152	1.355	0.58432	D	0.999997	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.77557	0.99;0.957;0.983	T	0.01702	-1.1292	10	0.10111	T	0.7	-11.9379	20.3293	0.98710	0.0:0.0:1.0:0.0	.	273;273;273	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	N	273	ENSP00000323681:D273N;ENSP00000353249:D273N	ENSP00000323681:D273N	D	+	1	0	AGBL5	27131534	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.412000	0.66392	2.906000	0.99361	0.655000	0.94253	GAT	AGBL5	-	pfam_Peptidase_M14		0.532	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278030	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27278089	27278089	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278089G>A	ENST00000360131.4	+	6	1035	c.876G>A	c.(874-876)ttG>ttA	p.L292L	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Silent_p.L292L	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	292					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCCATGTTGAACCCCGATG	0.552																																																	0													152.0	148.0	149.0					2																	27278089		2203	4300	6503	SO:0001819	synonymous_variant	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.876G>A	2.37:g.27278089G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	pfam_Peptidase_M14	p.L292	ENST00000360131.4	37	c.876	CCDS1732.3	2																																																																																			AGBL5	-	pfam_Peptidase_M14		0.552	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278089	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	silent	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27278089	27278089	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278089G>A	ENST00000360131.4	+	6	1035	c.876G>A	c.(874-876)ttG>ttA	p.L292L	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Silent_p.L292L	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	292					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TTCCCATGTTGAACCCCGATG	0.552																																																	0													152.0	148.0	149.0					2																	27278089		2203	4300	6503	SO:0001819	synonymous_variant	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.876G>A	2.37:g.27278089G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	pfam_Peptidase_M14	p.L292	ENST00000360131.4	37	c.876	CCDS1732.3	2																																																																																			AGBL5	-	pfam_Peptidase_M14		0.552	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278089	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	silent	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27278589	27278589	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278589G>A	ENST00000360131.4	+	7	1107	c.948G>A	c.(946-948)ctG>ctA	p.L316L	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Silent_p.L316L	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	316					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GTCAGTACCTGAAGCCTGATG	0.547																																																	0													102.0	91.0	95.0					2																	27278589		2203	4300	6503	SO:0001819	synonymous_variant	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.948G>A	2.37:g.27278589G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	pfam_Peptidase_M14	p.L316	ENST00000360131.4	37	c.948	CCDS1732.3	2																																																																																			AGBL5	-	pfam_Peptidase_M14		0.547	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278589	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	silent	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27278878	27278878	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278878G>T	ENST00000360131.4	+	7	1396	c.1237G>T	c.(1237-1239)Gaa>Taa	p.E413*	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Nonsense_Mutation_p.E413*	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	413					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCGGGGCTTGAAGAGTCAGC	0.532																																																	0													167.0	166.0	167.0					2																	27278878		2203	4300	6503	SO:0001587	stop_gained	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1237G>T	2.37:g.27278878G>T	ENSP00000353249:p.Glu413*	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Nonsense_Mutation	SNP	pfam_Peptidase_M14	p.E413*	ENST00000360131.4	37	c.1237	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744873	0.49151	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	.	.	.	5.16	0.866	0.19079	.	0.759512	0.13624	N	0.374222	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-7.356	9.4328	0.38620	0.0809:0.4057:0.5134:0.0	.	.	.	.	X	413	.	ENSP00000323681:E413X	E	+	1	0	AGBL5	27132382	0.130000	0.22417	0.124000	0.21820	0.105000	0.19272	1.071000	0.30666	0.358000	0.24211	0.491000	0.48974	GAA	AGBL5	-	NULL		0.532	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278878	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	nonsense	SNP	0.004	T
AGBL5	60509	genome.wustl.edu	37	2	27278878	27278878	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278878G>T	ENST00000360131.4	+	7	1396	c.1237G>T	c.(1237-1239)Gaa>Taa	p.E413*	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Nonsense_Mutation_p.E413*	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	413					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TGCGGGGCTTGAAGAGTCAGC	0.532																																																	0													167.0	166.0	167.0					2																	27278878		2203	4300	6503	SO:0001587	stop_gained	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1237G>T	2.37:g.27278878G>T	ENSP00000353249:p.Glu413*	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Nonsense_Mutation	SNP	pfam_Peptidase_M14	p.E413*	ENST00000360131.4	37	c.1237	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	15.14	2.744873	0.49151	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	.	.	.	5.16	0.866	0.19079	.	0.759512	0.13624	N	0.374222	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.08837	T	0.75	-7.356	9.4328	0.38620	0.0809:0.4057:0.5134:0.0	.	.	.	.	X	413	.	ENSP00000323681:E413X	E	+	1	0	AGBL5	27132382	0.130000	0.22417	0.124000	0.21820	0.105000	0.19272	1.071000	0.30666	0.358000	0.24211	0.491000	0.48974	GAA	AGBL5	-	NULL		0.532	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278878	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	nonsense	SNP	0.004	T
AGBL5	60509	genome.wustl.edu	37	2	27278963	27278963	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278963G>A	ENST00000360131.4	+	7	1481	c.1322G>A	c.(1321-1323)gGc>gAc	p.G441D	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.G441D	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	441					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAAAAGGGGCTGCTTCATG	0.517																																																	0													150.0	148.0	149.0					2																	27278963		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1322G>A	2.37:g.27278963G>A	ENSP00000353249:p.Gly441Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.G441D	ENST00000360131.4	37	c.1322	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	33	5.268273	0.95429	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.34859	1.34;1.34	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.62882	-0.6760	10	0.59425	D	0.04	-18.5097	20.0291	0.97531	0.0:0.0:1.0:0.0	.	441;441;441	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	D	441	ENSP00000323681:G441D;ENSP00000353249:G441D	ENSP00000323681:G441D	G	+	2	0	AGBL5	27132467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.359000	0.97115	2.838000	0.97847	0.561000	0.74099	GGC	AGBL5	-	NULL		0.517	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278963	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27278963	27278963	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:27278963G>A	ENST00000360131.4	+	7	1481	c.1322G>A	c.(1321-1323)gGc>gAc	p.G441D	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.G441D	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	441					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TCCAAAAGGGGCTGCTTCATG	0.517																																																	0													150.0	148.0	149.0					2																	27278963		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1322G>A	2.37:g.27278963G>A	ENSP00000353249:p.Gly441Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.G441D	ENST00000360131.4	37	c.1322	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	33	5.268273	0.95429	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.34859	1.34;1.34	5.97	5.97	0.96955	.	0.000000	0.85682	D	0.000000	T	0.63733	0.2536	M	0.75777	2.31	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	T	0.62882	-0.6760	10	0.59425	D	0.04	-18.5097	20.0291	0.97531	0.0:0.0:1.0:0.0	.	441;441;441	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	D	441	ENSP00000323681:G441D;ENSP00000353249:G441D	ENSP00000323681:G441D	G	+	2	0	AGBL5	27132467	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.359000	0.97115	2.838000	0.97847	0.561000	0.74099	GGC	AGBL5	-	NULL		0.517	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278963	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	1.000	A
ALCAM	214	genome.wustl.edu	37	3	105290745	105290745	+	Missense_Mutation	SNP	A	A	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:105290745A>C	ENST00000306107.5	+	15	2214	c.1714A>C	c.(1714-1716)Aaa>Caa	p.K572Q	ALCAM_ENST00000486979.2_Missense_Mutation_p.K521Q|ALCAM_ENST00000389927.4_Missense_Mutation_p.K294Q|ALCAM_ENST00000472644.2_Missense_Mutation_p.K559Q	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	572					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GGAAGAAAACAAAAAGTTAGA	0.353																																																	0													72.0	69.0	70.0					3																	105290745		2203	4300	6503	SO:0001583	missense	214			AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.1714A>C	3.37:g.105290745A>C	ENSP00000305988:p.Lys572Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like	p.K572Q	ENST00000306107.5	37	c.1714	CCDS33810.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.01|18.01	3.528387|3.528387	0.64860|0.64860	.|.	.|.	ENSG00000170017|ENSG00000170017	ENST00000306107;ENST00000472644;ENST00000486979;ENST00000389927|ENST00000465413	T;T;T;T|.	0.59638|.	0.34;0.58;0.25;1.03|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.044685|.	0.85682|.	N|.	0.000000|.	T|T	0.58481|0.58481	0.2125|0.2125	L|L	0.36672|0.36672	1.1|1.1	0.53005|0.53005	D|D	0.99996|0.99996	D;D;D|.	0.71674|.	0.998;0.998;0.998|.	D;D;D|.	0.76071|.	0.981;0.981;0.987|.	T|T	0.55134|0.55134	-0.8188|-0.8188	10|5	0.54805|.	T|.	0.06|.	-24.8136|-24.8136	15.7464|15.7464	0.77949|0.77949	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	294;559;572|.	Q6ZS95;B4DTU0;Q13740|.	.;.;CD166_HUMAN|.	Q|P	572;559;521;294|332	ENSP00000305988:K572Q;ENSP00000419236:K559Q;ENSP00000418213:K521Q;ENSP00000374577:K294Q|.	ENSP00000305988:K572Q|.	K|Q	+|+	1|2	0|0	ALCAM|ALCAM	106773435|106773435	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.000000|6.000000	0.70678|0.70678	2.176000|2.176000	0.68965|0.68965	0.455000|0.455000	0.32223|0.32223	AAA|CAA	ALCAM	-	NULL		0.353	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALCAM	HGNC	protein_coding	OTTHUMT00000353764.1	A	NM_001627		105290745	+1	no_errors	ENST00000306107	ensembl	human	known	70_37	missense	SNP	1.000	C
ALCAM	214	genome.wustl.edu	37	3	105290745	105290745	+	Missense_Mutation	SNP	A	A	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:105290745A>C	ENST00000306107.5	+	15	2214	c.1714A>C	c.(1714-1716)Aaa>Caa	p.K572Q	ALCAM_ENST00000486979.2_Missense_Mutation_p.K521Q|ALCAM_ENST00000389927.4_Missense_Mutation_p.K294Q|ALCAM_ENST00000472644.2_Missense_Mutation_p.K559Q	NM_001627.3	NP_001618.2	Q13740	CD166_HUMAN	activated leukocyte cell adhesion molecule	572					axon guidance (GO:0007411)|cell adhesion (GO:0007155)|motor neuron axon guidance (GO:0008045)|signal transduction (GO:0007165)	axon (GO:0030424)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)	receptor binding (GO:0005102)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(14)|ovary(2)|prostate(1)|skin(2)|urinary_tract(1)	28						GGAAGAAAACAAAAAGTTAGA	0.353																																																	0													72.0	69.0	70.0					3																	105290745		2203	4300	6503	SO:0001583	missense	214			AK054632	CCDS33810.1, CCDS58841.1	3q13.1	2013-01-29	2002-08-08		ENSG00000170017	ENSG00000170017		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	400	protein-coding gene	gene with protein product		601662	"""activated leucocyte cell adhesion molecule"""			7760007	Standard	NM_001627		Approved	CD166, MEMD	uc003dvx.3	Q13740	OTTHUMG00000159192	ENST00000306107.5:c.1714A>C	3.37:g.105290745A>C	ENSP00000305988:p.Lys572Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNS3|B4DTU0|O60892|Q1HGM8|Q1HGM9|Q6PEY4|Q6ZS95	Missense_Mutation	SNP	pfam_CD80_C2-set,pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,smart_Ig_sub2,pfscan_Ig-like	p.K572Q	ENST00000306107.5	37	c.1714	CCDS33810.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.01|18.01	3.528387|3.528387	0.64860|0.64860	.|.	.|.	ENSG00000170017|ENSG00000170017	ENST00000306107;ENST00000472644;ENST00000486979;ENST00000389927|ENST00000465413	T;T;T;T|.	0.59638|.	0.34;0.58;0.25;1.03|.	5.42|5.42	5.42|5.42	0.78866|0.78866	.|.	0.044685|.	0.85682|.	N|.	0.000000|.	T|T	0.58481|0.58481	0.2125|0.2125	L|L	0.36672|0.36672	1.1|1.1	0.53005|0.53005	D|D	0.99996|0.99996	D;D;D|.	0.71674|.	0.998;0.998;0.998|.	D;D;D|.	0.76071|.	0.981;0.981;0.987|.	T|T	0.55134|0.55134	-0.8188|-0.8188	10|5	0.54805|.	T|.	0.06|.	-24.8136|-24.8136	15.7464|15.7464	0.77949|0.77949	1.0:0.0:0.0:0.0|1.0:0.0:0.0:0.0	.|.	294;559;572|.	Q6ZS95;B4DTU0;Q13740|.	.;.;CD166_HUMAN|.	Q|P	572;559;521;294|332	ENSP00000305988:K572Q;ENSP00000419236:K559Q;ENSP00000418213:K521Q;ENSP00000374577:K294Q|.	ENSP00000305988:K572Q|.	K|Q	+|+	1|2	0|0	ALCAM|ALCAM	106773435|106773435	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	6.000000|6.000000	0.70678|0.70678	2.176000|2.176000	0.68965|0.68965	0.455000|0.455000	0.32223|0.32223	AAA|CAA	ALCAM	-	NULL		0.353	ALCAM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALCAM	HGNC	protein_coding	OTTHUMT00000353764.1	A	NM_001627		105290745	+1	no_errors	ENST00000306107	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD36	375248	genome.wustl.edu	37	2	97877440	97877440	+	Missense_Mutation	SNP	T	T	C	rs35711845	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:97877440T>C	ENST00000461153.2	+	58	3675	c.3431T>C	c.(3430-3432)aTg>aCg	p.M1144T	ANKRD36_ENST00000420699.2_Missense_Mutation_p.M1144T			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1144										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GTTCCGAATATGGCCACGGAA	0.338													.|||	1324	0.264377	0.0885	0.3602	5008	,	,		25668	0.1964		0.5129	False		,,,				2504	0.2485																0								T	THR/MET	250,1134		3,244,445	149.0	140.0	143.0		3431	-2.3	0.0	2	dbSNP_126	143	1583,1599		99,1385,107	yes	missense	ANKRD36	NM_001164315.1	81	102,1629,552	CC,CT,TT		49.7486,18.0636,40.1445	benign	1144/1942	97877440	1833,2733	692	1591	2283	SO:0001583	missense	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.3431T>C	2.37:g.97877440T>C	ENSP00000419530:p.Met1144Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M1144T	ENST00000461153.2	37	c.3431	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	1.894	-0.454824	0.04540	0.180636	0.497486	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.77229	-1.08;-1.08	1.17	-2.3	0.06785	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39941	-0.9589	8	0.23891	T	0.37	.	1.5487	0.02570	0.4242:0.0:0.2415:0.3342	rs35711845;rs62156172	1144	A6QL64	AN36A_HUMAN	T	1144;1144;404	ENSP00000419530:M1144T;ENSP00000391950:M1144T	ENSP00000391950:M1144T	M	+	2	0	ANKRD36	97241167	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.779000	0.26746	-0.591000	0.05859	-0.727000	0.03589	ATG	ANKRD36	-	NULL		0.338	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	T			97877440	+1	no_errors	ENST00000420699	ensembl	human	known	70_37	missense	SNP	0.000	C
ANO3	63982	genome.wustl.edu	37	11	26681913	26681913	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:26681913G>T	ENST00000256737.3	+	27	3720	c.2868G>T	c.(2866-2868)atG>atT	p.M956I	ANO3_ENST00000531568.1_Missense_Mutation_p.M810I|ANO3_ENST00000537978.1_Missense_Mutation_p.M940I|ANO3_ENST00000525139.1_Missense_Mutation_p.M940I	NM_031418.2	NP_113606.2	Q9BYT9	ANO3_HUMAN	anoctamin 3	956					calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	phospholipid scramblase activity (GO:0017128)			breast(2)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(33)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	68						TTCAAGAAATGATGTATGAGG	0.428																																																	0													146.0	136.0	139.0					11																	26681913		2203	4299	6502	SO:0001583	missense	63982			AJ300461	CCDS31447.1	11p14.2	2014-04-09	2008-08-28	2008-08-28	ENSG00000134343	ENSG00000134343		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	14004	protein-coding gene	gene with protein product	"""transmembrane protein 16C (eight membrane-spanning domains)"""	610110	"""chromosome 11 open reading frame 25"", ""transmembrane protein 16C"""	C11orf25, TMEM16C		12739008, 15067359, 23200863, 24692353	Standard	NM_031418		Approved	GENX-3947, DYT23	uc001mqt.4	Q9BYT9	OTTHUMG00000166096	ENST00000256737.3:c.2868G>T	11.37:g.26681913G>T	ENSP00000256737:p.Met956Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z3F5	Missense_Mutation	SNP	pfam_Anoctamin	p.M956I	ENST00000256737.3	37	c.2868	CCDS31447.1	11	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503986	0.44558	.	.	ENSG00000134343	ENST00000537978;ENST00000525139;ENST00000256737;ENST00000538001;ENST00000531568	T;T;T;T	0.70399	-0.47;-0.47;-0.48;-0.36	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	T	0.73273	0.3566	L	0.29908	0.895	0.80722	D	1	D;D	0.62365	0.983;0.991	P;P	0.58130	0.833;0.833	T	0.67971	-0.5532	10	0.21540	T	0.41	.	19.717	0.96124	0.0:0.0:1.0:0.0	.	858;956	B7Z7Y6;Q9BYT9	.;ANO3_HUMAN	I	940;940;956;858;810	ENSP00000440737:M940I;ENSP00000432576:M940I;ENSP00000256737:M956I;ENSP00000432394:M810I	ENSP00000256737:M956I	M	+	3	0	ANO3	26638489	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.869000	0.99810	2.667000	0.90743	0.650000	0.86243	ATG	ANO3	-	NULL		0.428	ANO3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANO3	HGNC	protein_coding	OTTHUMT00000387806.1	G	NM_031418		26681913	+1	no_errors	ENST00000256737	ensembl	human	known	70_37	missense	SNP	1.000	T
ANO4	121601	genome.wustl.edu	37	12	101520733	101520733	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:101520733G>A	ENST00000392977.3	+	27	2963	c.2753G>A	c.(2752-2754)aGa>aAa	p.R918K	ANO4_ENST00000299222.9_Missense_Mutation_p.R438K|ANO4_ENST00000392979.3_Missense_Mutation_p.R883K|ANO4_ENST00000550015.1_Missense_Mutation_p.R438K			Q32M45	ANO4_HUMAN	anoctamin 4	918					chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|intracellular (GO:0005622)|plasma membrane (GO:0005886)	intracellular calcium activated chloride channel activity (GO:0005229)			NS(1)|biliary_tract(1)|breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(4)|prostate(5)|skin(7)|stomach(2)|urinary_tract(1)	78						GATCGAATGAGAAGAGAGAAG	0.433										HNSCC(74;0.22)																																							0													117.0	100.0	106.0					12																	101520733		2203	4300	6503	SO:0001583	missense	121601			AK091540	CCDS31884.1, CCDS66445.1	12q23.3	2014-04-09	2008-08-28	2008-08-28	ENSG00000151572	ENSG00000151572		"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	23837	protein-coding gene	gene with protein product		610111	"""transmembrane protein 16D"""	TMEM16D		12739008, 15067359, 24692353	Standard	NM_178826		Approved	FLJ34221, FLJ34272, FLJ35277	uc001thw.2	Q32M45		ENST00000392977.3:c.2753G>A	12.37:g.101520733G>A	ENSP00000376703:p.Arg918Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NAJ0|Q8NB39|Q8NB53	Missense_Mutation	SNP	pfam_Anoctamin	p.R918K	ENST00000392977.3	37	c.2753		12	.	.	.	.	.	.	.	.	.	.	G	10.74	1.435648	0.25813	.	.	ENSG00000151572	ENST00000392979;ENST00000299222;ENST00000392977;ENST00000550015	T;T;T;T	0.61859	0.07;0.07;0.07;0.07	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.55481	0.1923	N	0.10645	0.015	0.50813	D	0.999892	D;P;D	0.63880	0.993;0.855;0.982	D;P;D	0.77557	0.99;0.826;0.916	T	0.47959	-0.9076	10	0.02654	T	1	.	19.9299	0.97115	0.0:0.0:1.0:0.0	.	438;918;883	Q32M45-3;Q32M45;Q32M45-2	.;ANO4_HUMAN;.	K	883;438;918;438	ENSP00000376705:R883K;ENSP00000299222:R438K;ENSP00000376703:R918K;ENSP00000450192:R438K	ENSP00000299222:R438K	R	+	2	0	ANO4	100044864	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	8.005000	0.88553	2.769000	0.95229	0.655000	0.94253	AGA	ANO4	-	pfam_Anoctamin		0.433	ANO4-002	KNOWN	basic	protein_coding	ANO4	HGNC	protein_coding	OTTHUMT00000409295.1	G	NM_178826		101520733	+1	no_errors	ENST00000392977	ensembl	human	known	70_37	missense	SNP	1.000	A
ARHGEF12	23365	genome.wustl.edu	37	11	120312840	120312840	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:120312840A>T	ENST00000397843.2	+	15	1397	c.1231A>T	c.(1231-1233)Aaa>Taa	p.K411*	ARHGEF12_ENST00000532993.1_Nonsense_Mutation_p.K308*|ARHGEF12_ENST00000356641.3_Nonsense_Mutation_p.K392*	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	411	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		AGACCTGTATAAACATACCAA	0.363			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													139.0	118.0	124.0					11																	120312840		1847	4089	5936	SO:0001587	stop_gained	23365			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1231A>T	11.37:g.120312840A>T	ENSP00000380942:p.Lys411*	Somatic		WXS	Illumina HiSeq	Phase_IV	O15086|Q6P526	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K392*	ENST00000397843.2	37	c.1174	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	A	43	9.858657	0.99281	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	.	.	.	5.45	5.45	0.79879	.	0.000000	0.52532	D	0.000073	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9678	14.3801	0.66905	1.0:0.0:0.0:0.0	.	.	.	.	X	411;392;308	.	ENSP00000349056:K392X	K	+	1	0	ARHGEF12	119818050	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.365000	0.90108	2.185000	0.69588	0.528000	0.53228	AAA	ARHGEF12	-	pfam_Regulat_G_prot_signal-like,superfamily_Regulat_G_prot_signal_superfam		0.363	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	A	NM_015313		120312840	+1	no_errors	ENST00000356641	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ARHGEF12	23365	genome.wustl.edu	37	11	120312840	120312840	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:120312840A>T	ENST00000397843.2	+	15	1397	c.1231A>T	c.(1231-1233)Aaa>Taa	p.K411*	ARHGEF12_ENST00000532993.1_Nonsense_Mutation_p.K308*|ARHGEF12_ENST00000356641.3_Nonsense_Mutation_p.K392*	NM_015313.2	NP_056128.1	Q9NZN5	ARHGC_HUMAN	Rho guanine nucleotide exchange factor (GEF) 12	411	RGSL.				apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			NS(1)|breast(5)|endometrium(6)|kidney(5)|large_intestine(13)|lung(23)|ovary(4)|pancreas(1)|prostate(1)|skin(2)	61		Breast(109;0.000813)|Medulloblastoma(222;0.0425)|Hepatocellular(160;0.0831)|all_hematologic(192;0.107)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(223;0.231)		AGACCTGTATAAACATACCAA	0.363			T	MLL	AML																																			Dom	yes		11	11q23.3	23365	RHO guanine nucleotide exchange factor (GEF) 12 (LARG)		L	0													139.0	118.0	124.0					11																	120312840		1847	4089	5936	SO:0001587	stop_gained	23365			AF180681	CCDS41727.1, CCDS55794.1	11q23.3	2011-11-16			ENSG00000196914	ENSG00000196914		"""Rho guanine nucleotide exchange factors"""	14193	protein-coding gene	gene with protein product		604763				10681437, 9205841	Standard	NM_001198665		Approved	KIAA0382, LARG	uc001pxl.2	Q9NZN5	OTTHUMG00000166143	ENST00000397843.2:c.1231A>T	11.37:g.120312840A>T	ENSP00000380942:p.Lys411*	Somatic		WXS	Illumina HiSeq	Phase_IV	O15086|Q6P526	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,superfamily_Regulat_G_prot_signal_superfam,superfamily_DH-domain,superfamily_PDZ,smart_PDZ,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.K392*	ENST00000397843.2	37	c.1174	CCDS41727.1	11	.	.	.	.	.	.	.	.	.	.	A	43	9.858657	0.99281	.	.	ENSG00000196914	ENST00000397843;ENST00000356641;ENST00000532993	.	.	.	5.45	5.45	0.79879	.	0.000000	0.52532	D	0.000073	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9678	14.3801	0.66905	1.0:0.0:0.0:0.0	.	.	.	.	X	411;392;308	.	ENSP00000349056:K392X	K	+	1	0	ARHGEF12	119818050	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.365000	0.90108	2.185000	0.69588	0.528000	0.53228	AAA	ARHGEF12	-	pfam_Regulat_G_prot_signal-like,superfamily_Regulat_G_prot_signal_superfam		0.363	ARHGEF12-001	PUTATIVE	basic|appris_principal|CCDS	protein_coding	ARHGEF12	HGNC	protein_coding	OTTHUMT00000388052.1	A	NM_015313		120312840	+1	no_errors	ENST00000356641	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ARHGEF37	389337	genome.wustl.edu	37	5	149008510	149008510	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr5:149008510C>G	ENST00000333677.6	+	12	1962	c.1799C>G	c.(1798-1800)tCt>tGt	p.S600C		NM_001001669.2	NP_001001669.2	A1IGU5	ARH37_HUMAN	Rho guanine nucleotide exchange factor (GEF) 37	600						cytoplasm (GO:0005737)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			large_intestine(5)|lung(6)|ovary(1)|prostate(2)|stomach(3)	17						CTAGTGCCCTCTATTCCCACC	0.587																																																	0													38.0	42.0	41.0					5																	149008510		1947	4135	6082	SO:0001583	missense	389337			BC041325	CCDS43385.1	5q33.1	2012-07-24			ENSG00000183111	ENSG00000183111		"""Rho guanine nucleotide exchange factors"""	34430	protein-coding gene	gene with protein product							Standard	XM_005268448		Approved	FLJ41603	uc003lra.1	A1IGU5	OTTHUMG00000163491	ENST00000333677.6:c.1799C>G	5.37:g.149008510C>G	ENSP00000328083:p.Ser600Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZW51	Missense_Mutation	SNP	pfam_DH-domain,pfam_BAR_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_BAR_dom,smart_SH3_domain,pfscan_BAR_dom,pfscan_SH3_domain,pfscan_DH-domain	p.S600C	ENST00000333677.6	37	c.1799	CCDS43385.1	5	.	.	.	.	.	.	.	.	.	.	C	12.75	2.032260	0.35893	.	.	ENSG00000183111	ENST00000333677	T	0.69561	-0.41	5.1	2.84	0.33178	Src homology-3 domain (1);	0.637190	0.16226	N	0.223839	T	0.49813	0.1579	N	0.24115	0.695	0.09310	N	1	P	0.48162	0.906	B	0.43754	0.43	T	0.44221	-0.9342	10	0.66056	D	0.02	-2.052	4.4435	0.11586	0.0:0.6251:0.2262:0.1487	.	600	A1IGU5	ARH37_HUMAN	C	600	ENSP00000328083:S600C	ENSP00000328083:S600C	S	+	2	0	ARHGEF37	148988703	0.003000	0.15002	0.110000	0.21437	0.041000	0.13682	1.633000	0.37113	1.245000	0.43885	0.491000	0.48974	TCT	ARHGEF37	-	superfamily_SH3_domain		0.587	ARHGEF37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF37	HGNC	protein_coding	OTTHUMT00000373763.1	C	NM_001001669		149008510	+1	no_errors	ENST00000333677	ensembl	human	known	70_37	missense	SNP	0.008	G
ARIH2	10425	genome.wustl.edu	37	3	49002355	49002355	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:49002355C>G	ENST00000356401.4	+	5	666	c.327C>G	c.(325-327)taC>taG	p.Y109*	ARIH2_ENST00000449376.1_Nonsense_Mutation_p.Y109*|ARIH2_ENST00000490095.1_3'UTR	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	109					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TTTGTAGATACAAGTCCAATT	0.383																																																	0													187.0	157.0	167.0					3																	49002355		2203	4300	6503	SO:0001587	stop_gained	10425			AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.327C>G	3.37:g.49002355C>G	ENSP00000348769:p.Tyr109*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HBZ6|Q9UEM9	Nonsense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.Y109*	ENST00000356401.4	37	c.327	CCDS2780.1	3	.	.	.	.	.	.	.	.	.	.	C	38	6.781341	0.97833	.	.	ENSG00000177479	ENST00000430423;ENST00000356401;ENST00000449376;ENST00000444790	.	.	.	4.88	4.88	0.63580	.	0.274708	0.41396	D	0.000884	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8584	0.52451	0.0:0.919:0.0:0.081	.	.	.	.	X	109;109;109;108	.	ENSP00000348769:Y109X	Y	+	3	2	ARIH2	48977359	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.048000	0.41278	2.411000	0.81874	0.557000	0.71058	TAC	ARIH2	-	NULL		0.383	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH2	HGNC	protein_coding	OTTHUMT00000257525.1	C	NM_006321		49002355	+1	no_errors	ENST00000356401	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ARIH2	10425	genome.wustl.edu	37	3	49002355	49002355	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:49002355C>G	ENST00000356401.4	+	5	666	c.327C>G	c.(325-327)taC>taG	p.Y109*	ARIH2_ENST00000449376.1_Nonsense_Mutation_p.Y109*|ARIH2_ENST00000490095.1_3'UTR	NM_006321.2	NP_006312.1	O95376	ARI2_HUMAN	ariadne RBR E3 ubiquitin protein ligase 2	109					developmental cell growth (GO:0048588)|hematopoietic stem cell proliferation (GO:0071425)|multicellular organismal development (GO:0007275)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|nucleic acid binding (GO:0003676)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|skin(1)	13				BRCA - Breast invasive adenocarcinoma(193;9.42e-05)|Kidney(197;0.00258)|KIRC - Kidney renal clear cell carcinoma(197;0.00269)		TTTGTAGATACAAGTCCAATT	0.383																																																	0													187.0	157.0	167.0					3																	49002355		2203	4300	6503	SO:0001587	stop_gained	10425			AF099149	CCDS2780.1	3p21	2013-10-03	2013-10-03		ENSG00000177479	ENSG00000177479			690	protein-coding gene	gene with protein product	"""all-trans retinoic acid inducible RING finger"""	605615	"""ariadne (Drosophila) homolog 2"", ""ariadne homolog 2 (Drosophila)"""			10422847, 24058416	Standard	XM_005264798		Approved	TRIAD1	uc003cvb.3	O95376	OTTHUMG00000133547	ENST00000356401.4:c.327C>G	3.37:g.49002355C>G	ENSP00000348769:p.Tyr109*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HBZ6|Q9UEM9	Nonsense_Mutation	SNP	pfam_Znf_C6HC,smart_Znf_RING,smart_Znf_C6HC,pfscan_Znf_RING	p.Y109*	ENST00000356401.4	37	c.327	CCDS2780.1	3	.	.	.	.	.	.	.	.	.	.	C	38	6.781341	0.97833	.	.	ENSG00000177479	ENST00000430423;ENST00000356401;ENST00000449376;ENST00000444790	.	.	.	4.88	4.88	0.63580	.	0.274708	0.41396	D	0.000884	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	11.8584	0.52451	0.0:0.919:0.0:0.081	.	.	.	.	X	109;109;109;108	.	ENSP00000348769:Y109X	Y	+	3	2	ARIH2	48977359	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	2.048000	0.41278	2.411000	0.81874	0.557000	0.71058	TAC	ARIH2	-	NULL		0.383	ARIH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARIH2	HGNC	protein_coding	OTTHUMT00000257525.1	C	NM_006321		49002355	+1	no_errors	ENST00000356401	ensembl	human	known	70_37	nonsense	SNP	1.000	G
BAIAP3	8938	genome.wustl.edu	37	16	1392980	1392980	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:1392980G>A	ENST00000324385.5	+	14	1491	c.1333G>A	c.(1333-1335)Gcc>Acc	p.A445T	BAIAP3_ENST00000397488.2_Missense_Mutation_p.A427T|BAIAP3_ENST00000568887.1_Missense_Mutation_p.A382T|BAIAP3_ENST00000421665.2_Missense_Mutation_p.A374T|BAIAP3_ENST00000562208.1_Missense_Mutation_p.A387T|BAIAP3_ENST00000426824.3_Missense_Mutation_p.A410T|BAIAP3_ENST00000397489.1_Missense_Mutation_p.A427T	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	445					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CCTGCACGGAGCCCAGAGCAA	0.687																																																	0													40.0	37.0	38.0					16																	1392980		2199	4297	6496	SO:0001583	missense	8938			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1333G>A	16.37:g.1392980G>A	ENSP00000324510:p.Ala445Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Munc13_subgr_dom-2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A445T	ENST00000324385.5	37	c.1333	CCDS10434.1	16	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475603	0.26511	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000440627;ENST00000421665	T;T;T;T;T	0.71341	-0.55;-0.56;-0.56;-0.56;-0.55	4.74	0.499	0.16914	.	0.591362	0.17409	N	0.175244	T	0.46600	0.1401	N	0.11064	0.09	0.25621	N	0.986408	B;B;B;B	0.15473	0.013;0.006;0.013;0.006	B;B;B;B	0.14023	0.01;0.006;0.006;0.005	T	0.34054	-0.9844	10	0.34782	T	0.22	-15.722	8.3323	0.32193	0.3496:0.0:0.6504:0.0	.	374;387;445;427	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	T	410;427;445;427;51;374	ENSP00000407242:A410T;ENSP00000380625:A427T;ENSP00000324510:A445T;ENSP00000380626:A427T;ENSP00000409533:A374T	ENSP00000324510:A445T	A	+	1	0	BAIAP3	1332981	0.127000	0.22367	0.793000	0.32043	0.661000	0.39034	1.002000	0.29796	0.429000	0.26202	0.591000	0.81541	GCC	BAIAP3	-	NULL		0.687	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	G			1392980	+1	no_errors	ENST00000324385	ensembl	human	known	70_37	missense	SNP	0.758	A
BAIAP3	8938	genome.wustl.edu	37	16	1392980	1392980	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:1392980G>A	ENST00000324385.5	+	14	1491	c.1333G>A	c.(1333-1335)Gcc>Acc	p.A445T	BAIAP3_ENST00000397488.2_Missense_Mutation_p.A427T|BAIAP3_ENST00000568887.1_Missense_Mutation_p.A382T|BAIAP3_ENST00000421665.2_Missense_Mutation_p.A374T|BAIAP3_ENST00000562208.1_Missense_Mutation_p.A387T|BAIAP3_ENST00000426824.3_Missense_Mutation_p.A410T|BAIAP3_ENST00000397489.1_Missense_Mutation_p.A427T	NM_003933.4	NP_003924.2	O94812	BAIP3_HUMAN	BAI1-associated protein 3	445					G-protein coupled receptor signaling pathway (GO:0007186)|neurotransmitter secretion (GO:0007269)		protein C-terminus binding (GO:0008022)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(1)|lung(25)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	42		Hepatocellular(780;0.0893)				CCTGCACGGAGCCCAGAGCAA	0.687																																																	0													40.0	37.0	38.0					16																	1392980		2199	4297	6496	SO:0001583	missense	8938			AB017111	CCDS10434.1, CCDS55978.1, CCDS55979.1, CCDS58402.1, CCDS58403.1, CCDS66894.1	16p13.3	2008-07-04			ENSG00000007516	ENSG00000007516			948	protein-coding gene	gene with protein product		604009				9790924	Standard	NM_003933		Approved	BAP3, KIAA0734	uc002clk.2	O94812	OTTHUMG00000047833	ENST00000324385.5:c.1333G>A	16.37:g.1392980G>A	ENSP00000324510:p.Ala445Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2B2|B2RCD7|B4DGS5|B4DIK3|B4DRK9|B4DRP1|E7EUB9|H3BUH8|H3BVI3|H7C2Q1|O94839|Q2M226|Q658J2|Q76N05|Q96RZ3|Q9UJK1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Munc13_subgr_dom-2,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.A445T	ENST00000324385.5	37	c.1333	CCDS10434.1	16	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475603	0.26511	.	.	ENSG00000007516	ENST00000426824;ENST00000397488;ENST00000324385;ENST00000397489;ENST00000440627;ENST00000421665	T;T;T;T;T	0.71341	-0.55;-0.56;-0.56;-0.56;-0.55	4.74	0.499	0.16914	.	0.591362	0.17409	N	0.175244	T	0.46600	0.1401	N	0.11064	0.09	0.25621	N	0.986408	B;B;B;B	0.15473	0.013;0.006;0.013;0.006	B;B;B;B	0.14023	0.01;0.006;0.006;0.005	T	0.34054	-0.9844	10	0.34782	T	0.22	-15.722	8.3323	0.32193	0.3496:0.0:0.6504:0.0	.	374;387;445;427	E7EUB9;B4DIK3;O94812;A2A2B2	.;.;BAIP3_HUMAN;.	T	410;427;445;427;51;374	ENSP00000407242:A410T;ENSP00000380625:A427T;ENSP00000324510:A445T;ENSP00000380626:A427T;ENSP00000409533:A374T	ENSP00000324510:A445T	A	+	1	0	BAIAP3	1332981	0.127000	0.22367	0.793000	0.32043	0.661000	0.39034	1.002000	0.29796	0.429000	0.26202	0.591000	0.81541	GCC	BAIAP3	-	NULL		0.687	BAIAP3-001	KNOWN	basic|CCDS	protein_coding	BAIAP3	HGNC	protein_coding	OTTHUMT00000109056.3	G			1392980	+1	no_errors	ENST00000324385	ensembl	human	known	70_37	missense	SNP	0.758	A
C16orf70	80262	genome.wustl.edu	37	16	67183555	67183555	+	IGR	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:67183555G>A	ENST00000219139.3	+	0	2865				B3GNT9_ENST00000449549.3_Silent_p.Y278Y	NM_025187.3	NP_079463.2	Q9BSU1	CP070_HUMAN	chromosome 16 open reading frame 70											cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|skin(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0017)|Epithelial(162;0.00655)|all cancers(182;0.0579)		CGGGCAGGCCGTACACGGCCT	0.697																																																	0													7.0	9.0	8.0					16																	67183555		1978	4104	6082	SO:0001628	intergenic_variant	84752			AK022138	CCDS10828.1	16q22.1	2011-01-25	2006-04-12	2006-04-12	ENSG00000125149	ENSG00000125149			29564	protein-coding gene	gene with protein product			"""chromosome 16 open reading frame 6"""	C16orf6, LIN10		12477932	Standard	NM_025187		Approved	lin-10, FLJ12076	uc002erd.3	Q9BSU1	OTTHUMG00000137510		16.37:g.67183555G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HA86	Silent	SNP	pfam_Glyco_trans_31,pfam_Fringe-like	p.Y278	ENST00000219139.3	37	c.834	CCDS10828.1	16																																																																																			B3GNT9	-	pfam_Glyco_trans_31,pfam_Fringe-like		0.697	C16orf70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B3GNT9	HGNC	protein_coding	OTTHUMT00000268829.2	G	NM_025187		67183555	-1	no_errors	ENST00000449549	ensembl	human	known	70_37	silent	SNP	0.873	A
BCL3	602	genome.wustl.edu	37	19	45261992	45261992	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:45261992C>G	ENST00000164227.5	+	8	1315	c.1071C>G	c.(1069-1071)atC>atG	p.I357M		NM_005178.4	NP_005169.2	P20749	BCL3_HUMAN	B-cell CLL/lymphoma 3	357					antimicrobial humoral response (GO:0019730)|cellular response to DNA damage stimulus (GO:0006974)|defense response to bacterium (GO:0042742)|defense response to protozoan (GO:0042832)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|extracellular matrix organization (GO:0030198)|follicular dendritic cell differentiation (GO:0002268)|germinal center formation (GO:0002467)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|maintenance of protein location in nucleus (GO:0051457)|marginal zone B cell differentiation (GO:0002315)|negative regulation of apoptotic process (GO:0043066)|negative regulation of interleukin-8 biosynthetic process (GO:0045415)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of tumor necrosis factor biosynthetic process (GO:0042536)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-10 biosynthetic process (GO:0045082)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|protein import into nucleus, translocation (GO:0000060)|regulation of apoptotic process (GO:0042981)|regulation of DNA binding (GO:0051101)|regulation of NF-kappaB import into nucleus (GO:0042345)|response to UV-C (GO:0010225)|response to virus (GO:0009615)|spleen development (GO:0048536)|T-helper 1 type immune response (GO:0042088)|T-helper 2 cell differentiation (GO:0045064)|transcription, DNA-templated (GO:0006351)	Bcl3-Bcl10 complex (GO:0032996)|Bcl3/NF-kappaB2 complex (GO:0033257)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			kidney(1)|large_intestine(2)|lung(2)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	10	Lung NSC(12;0.000698)|all_lung(12;0.002)	Ovarian(192;0.0728)				TCATCGACATCCTGAGGGGGA	0.652			T	IGH@	CLL																																			Dom	yes		19	19q13	602	B-cell CLL/lymphoma 3		L	0													40.0	36.0	38.0					19																	45261992		2198	4297	6495	SO:0001583	missense	602			M31732	CCDS12642.2	19q13.1-q13.2	2013-01-10			ENSG00000069399	ENSG00000069399		"""Ankyrin repeat domain containing"""	998	protein-coding gene	gene with protein product	"""B-cell lymphoma 3-encoded protein"", ""B-cell leukemia/lymphoma 3"", ""chronic lymphatic leukemia protein"""	109560		D19S37, BCL4		1501714, 2180580	Standard	NM_005178		Approved		uc010xxe.2	P20749	OTTHUMG00000151517	ENST00000164227.5:c.1071C>G	19.37:g.45261992C>G	ENSP00000164227:p.Ile357Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.I357M	ENST00000164227.5	37	c.1071	CCDS12642.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.93|15.93	2.977854|2.977854	0.53720|0.53720	.|.	.|.	ENSG00000069399|ENSG00000069399	ENST00000164227|ENST00000444487	T|.	0.40756|.	1.02|.	4.15|4.15	1.9|1.9	0.25705|0.25705	Ankyrin repeat-containing domain (3);|.	0.296137|.	0.23608|.	N|.	0.046375|.	T|T	0.38161|0.38161	0.1030|0.1030	L|L	0.51853|0.51853	1.615|1.615	0.26611|0.26611	N|N	0.972849|0.972849	D|.	0.56035|.	0.974|.	P|.	0.51974|.	0.686|.	T|T	0.29336|0.29336	-1.0015|-1.0015	10|5	0.44086|.	T|.	0.13|.	-0.7938|-0.7938	4.876|4.876	0.13656|0.13656	0.2097:0.6748:0.0:0.1155|0.2097:0.6748:0.0:0.1155	.|.	357|.	P20749|.	BCL3_HUMAN|.	M|A	357|261	ENSP00000164227:I357M|.	ENSP00000164227:I357M|.	I|P	+|+	3|1	3|0	BCL3|BCL3	49953832|49953832	0.999000|0.999000	0.42202|0.42202	0.883000|0.883000	0.34634|0.34634	0.961000|0.961000	0.63080|0.63080	1.123000|1.123000	0.31308|0.31308	0.200000|0.200000	0.20447|0.20447	0.491000|0.491000	0.48974|0.48974	ATC|CCT	BCL3	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.652	BCL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL3	HGNC	protein_coding	OTTHUMT00000322976.1	C	NM_005178		45261992	+1	no_errors	ENST00000164227	ensembl	human	known	70_37	missense	SNP	0.972	G
BHLHE40-AS1	100507582	genome.wustl.edu	37	3	4940482	4940482	+	RNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:4940482C>A	ENST00000420832.1	-	0	464				BHLHE40-AS1_ENST00000441386.2_RNA|BHLHE40-AS1_ENST00000434530.1_RNA|BHLHE40-AS1_ENST00000438479.1_RNA					BHLHE40 antisense RNA 1																		AGAGAAGATTCAATCTGATAA	0.433																																																	0																																												100507582			AK056892, AK311646		3p26.1	2012-11-01			ENSG00000235831	ENSG00000235831		"""Long non-coding RNAs"""	44471	non-coding RNA	RNA, long non-coding							Standard	NR_125916		Approved		uc010hce.2		OTTHUMG00000155242		3.37:g.4940482C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000420832.1	37	NULL		3																																																																																			BHLHE40-AS1	-	-		0.433	BHLHE40-AS1-001	KNOWN	basic	antisense	BHLHE40-AS1	HGNC	antisense	OTTHUMT00000338958.1	C			4940482	-1	no_errors	ENST00000438479	ensembl	human	known	70_37	rna	SNP	0.504	A
BMP8A	353500	genome.wustl.edu	37	1	39988084	39988084	+	Missense_Mutation	SNP	G	G	A	rs6525	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:39988084G>A	ENST00000331593.5	+	5	1224	c.878G>A	c.(877-879)cGc>cAc	p.R293H	RP11-69E11.4_ENST00000331856.2_RNA|RP11-69E11.4_ENST00000440190.1_RNA|RP11-69E11.4_ENST00000431553.1_RNA|RP11-69E11.4_ENST00000417869.1_RNA|RP11-69E11.4_ENST00000450157.1_RNA|RP11-69E11.4_ENST00000441741.1_RNA|RP11-69E11.4_ENST00000458207.1_RNA	NM_181809.3	NP_861525.2	Q7Z5Y6	BMP8A_HUMAN	bone morphogenetic protein 8a	293			R -> H (in dbSNP:rs6525). {ECO:0000269|Ref.1}.		cartilage development (GO:0051216)|cell differentiation (GO:0030154)|diet induced thermogenesis (GO:0002024)|growth (GO:0040007)|negative regulation of insulin secretion (GO:0046676)|ossification (GO:0001503)|regulation of energy homeostasis (GO:2000505)	extracellular space (GO:0005615)				kidney(1)|large_intestine(2)|lung(1)|skin(1)	5	Lung NSC(20;2.08e-06)|Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;9.69e-19)|Epithelial(16;9.34e-17)|all cancers(16;1.73e-15)|LUSC - Lung squamous cell carcinoma(16;0.00146)|Lung(16;0.00204)			GATGACGTCCGCGGCTCCCAC	0.597																																																	0													74.0	59.0	64.0					1																	39988084		2202	4296	6498	SO:0001583	missense	353500			AY303954	CCDS437.1	1p35-p32	2014-01-30			ENSG00000183682	ENSG00000183682		"""Bone morphogenetic proteins"", ""Endogenous ligands"""	21650	protein-coding gene	gene with protein product							Standard	NM_181809		Approved		uc001cdi.3	Q7Z5Y6	OTTHUMG00000008394	ENST00000331593.5:c.878G>A	1.37:g.39988084G>A	ENSP00000327440:p.Arg293His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3A5	Missense_Mutation	SNP	pfam_TGF-b_N,pfam_TGF-b_C,smart_TGF-b_C,prints_Inhibin_asu	p.R293H	ENST00000331593.5	37	c.878	CCDS437.1	1	723	0.33104395604395603	64	0.13008130081300814	145	0.4005524861878453	229	0.40034965034965037	285	0.3759894459102902	N	5.501	0.277466	0.10403	.	.	ENSG00000183682	ENST00000331593	T	0.75704	-0.96	4.4	3.27	0.37495	Transforming growth factor-beta, C-terminal (1);	0.398039	0.24841	N	0.035176	T	0.00012	0.0000	N	0.00112	-2.095	0.80722	P	0.0	B	0.06786	0.001	B	0.01281	0.0	T	0.34004	-0.9846	8	.	.	.	.	8.0955	0.30826	0.8251:0.0:0.1749:0.0	rs6525;rs15525;rs2073023;rs2695323;rs3186975;rs6657903;rs36033681;rs60841611	293	Q7Z5Y6	BMP8A_HUMAN	H	293	ENSP00000327440:R293H	.	R	+	2	0	BMP8A	39760671	0.004000	0.15560	0.905000	0.35620	0.071000	0.16799	0.457000	0.21875	0.192000	0.20272	-0.524000	0.04348	CGC	BMP8A	-	NULL		0.597	BMP8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP8A	HGNC	protein_coding	OTTHUMT00000023079.1	G	NM_181809		39988084	+1	no_errors	ENST00000331593	ensembl	human	known	70_37	missense	SNP	0.490	A
BPIFB1	92747	genome.wustl.edu	37	20	31895716	31895717	+	Intron	INS	-	-	C	rs60786625		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr20:31895716_31895717insC	ENST00000253354.1	+	15	1556				BPIFB1_ENST00000464032.1_3'UTR	NM_033197.2	NP_149974.2	Q8TDL5	BPIB1_HUMAN	BPI fold containing family B, member 1						innate immune response in mucosa (GO:0002227)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	lipid binding (GO:0008289)										gtgaaatccatcccccccccaa	0.48																																																	0																																										SO:0001627	intron_variant	92747			BC008429	CCDS13218.1	20q11.21	2011-08-04	2011-07-29	2011-07-29	ENSG00000125999	ENSG00000125999		"""BPI fold containing"""	16108	protein-coding gene	gene with protein product	"""von Ebner minor salivary gland protein"""		"""chromosome 20 open reading frame 114"""	C20orf114		11971875, 21787333	Standard	NM_033197		Approved	dJ1187J4.1, MGC14597, bA49G10.6, LPLUNC1, VEMSGP	uc002wyw.1	Q8TDL5	OTTHUMG00000032252	ENST00000253354.1:c.1395+923->C	20.37:g.31895725_31895725dupC		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2H8|Q5QP43|Q6UWY1|Q6ZRU7|Q96HK6|Q9BQP8|Q9BWZ6|Q9H4V6	RNA	INS	-	NULL	ENST00000253354.1	37	NULL	CCDS13218.1	20																																																																																			BPIFB1	-	-		0.480	BPIFB1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	BPIFB1	HGNC	protein_coding	OTTHUMT00000106499.2	-	NM_033197		31895717	+1	no_errors	ENST00000464032	ensembl	human	known	70_37	rna	INS	0.011:0.009	C
BRF1	2972	genome.wustl.edu	37	14	105684015	105684015	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr14:105684015G>A	ENST00000546474.1	-	15	16597	c.1638C>T	c.(1636-1638)ctC>ctT	p.L546L	BRF1_ENST00000446501.2_Silent_p.L308L|BRF1_ENST00000547530.1_Silent_p.L72L|BRF1_ENST00000379932.4_Intron|BRF1_ENST00000440513.3_Silent_p.L453L|BRF1_ENST00000551787.1_Intron|BRF1_ENST00000549044.1_5'UTR|BRF1_ENST00000327359.3_Silent_p.L431L|BRF1_ENST00000379937.2_Silent_p.L519L|BRF1_ENST00000392557.4_Silent_p.L342L	NM_001242787.1|NM_001519.3	NP_001229716.1|NP_001510.2	Q92994	TF3B_HUMAN	BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit	546					gene expression (GO:0010467)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription initiation from RNA polymerase III promoter (GO:0006384)|tRNA transcription (GO:0009304)	nucleoplasm (GO:0005654)|transcription factor TFIIIB complex (GO:0000126)	zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(5)|ovary(3)|prostate(1)|skin(2)|urinary_tract(2)	24		all_cancers(154;0.0231)|all_epithelial(191;0.0694)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00753)|all cancers(16;0.00925)|Epithelial(46;0.0221)	Epithelial(152;0.14)		CGGCGCTGCTGAGGCCCCGGA	0.632																																																	0													44.0	41.0	42.0					14																	105684015		2203	4300	6503	SO:0001819	synonymous_variant	2972			U28838	CCDS10001.1, CCDS42001.1, CCDS55949.1, CCDS55950.1, CCDS55951.1, CCDS55952.1, CCDS55953.1	14q32.33	2014-04-02	2013-05-29	2001-12-07	ENSG00000185024	ENSG00000185024		"""General transcription factors"""	11551	protein-coding gene	gene with protein product		604902	"""TATA box binding protein (TBP)-associated factor, RNA polymerase III, GTF3B subunit 2"", ""BRF1 homolog, subunit of RNA polymerase III transcription initiation factor IIIB (S. cerevisiae)"""	TAF3B2, TAF3C, GTF3B		7624363, 8943358	Standard	NM_145685		Approved	TFIIIB90, BRF, hBRF	uc001yqp.2	Q92994	OTTHUMG00000029884	ENST00000546474.1:c.1638C>T	14.37:g.105684015G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU36|B4DIG5|B7Z2N3|F5H5Z7|F8WA46|Q13223|Q3SYD9|Q5PR24|Q6IQ02|Q96KX3|Q9HCW6|Q9HCW7|Q9HCW8	Silent	SNP	pfam_TFIIB_cyclin,pfam_BRF1_TBP-bd,pfam_Znf_TFIIB,superfamily_Cyclin-like,smart_Cyclin-like,pfscan_Znf_TFIIB,prints_TFIIB	p.L546	ENST00000546474.1	37	c.1638	CCDS10001.1	14																																																																																			BRF1	-	pfam_BRF1_TBP-bd		0.632	BRF1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BRF1	HGNC	protein_coding	OTTHUMT00000074548.4	G	NM_001519		105684015	-1	no_errors	ENST00000546474	ensembl	human	known	70_37	silent	SNP	0.126	A
BSN-AS2	100132677	genome.wustl.edu	37	3	49586969	49586970	+	lincRNA	INS	-	-	T	rs367712376		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:49586969_49586970insT	ENST00000421598.1	-	0	2371_2372					NR_038866.1				BSN antisense RNA 2 (head to head)																		ATGtttttttcttttttttttg	0.51																																																	0																																												100132677					3p21.31	2012-10-15	2012-10-15		ENSG00000226913	ENSG00000226913		"""Long non-coding RNAs"""	42445	non-coding RNA	RNA, long non-coding			"""BSN antisense RNA 2 (non-protein coding)"""				Standard	NR_038866		Approved		uc003cxd.1		OTTHUMG00000156881		3.37:g.49586979_49586979dupT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000421598.1	37	NULL		3																																																																																			BSN-AS2	-	-		0.510	BSN-AS2-001	KNOWN	basic|exp_conf	lincRNA	BSN-AS2	HGNC	lincRNA	OTTHUMT00000346412.1	-	NR_038866		49586970	-1	no_errors	ENST00000421598	ensembl	human	known	70_37	rna	INS	0.165:0.174	T
BUB1	699	genome.wustl.edu	37	2	111419251	111419251	+	Silent	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:111419251G>T	ENST00000302759.6	-	10	1243	c.1125C>A	c.(1123-1125)tcC>tcA	p.S375S	BUB1_ENST00000535254.1_Silent_p.S355S|BUB1_ENST00000409311.1_Silent_p.S375S	NM_004336.3	NP_004327.1	O43683	BUB1_HUMAN	BUB1 mitotic checkpoint serine/threonine kinase	375					apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|chromosome segregation (GO:0007059)|mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|mitotic spindle assembly checkpoint (GO:0007094)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|regulation of chromosome segregation (GO:0051983)|regulation of sister chromatid cohesion (GO:0007063)|spindle assembly checkpoint (GO:0071173)|viral process (GO:0016032)	condensed chromosome kinetochore (GO:0000777)|condensed nuclear chromosome, centromeric region (GO:0000780)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(3)|endometrium(8)|kidney(4)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|stomach(1)	45		Ovarian(717;0.0822)		BRCA - Breast invasive adenocarcinoma(221;0.0556)		TGGTGGCTGGGGACACCAAAG	0.507																																																	0													122.0	116.0	118.0					2																	111419251		2203	4300	6503	SO:0001819	synonymous_variant	699			AF046078	CCDS33273.1, CCDS62984.1, CCDS62985.1	2q13	2013-01-17	2013-01-17		ENSG00000169679	ENSG00000169679			1148	protein-coding gene	gene with protein product		602452	"""budding uninhibited by benzimidazoles 1 (yeast homolog)"", ""budding uninhibited by benzimidazoles 1 homolog (yeast)"""	BUB1L			Standard	NM_004336		Approved	hBUB1, BUB1A	uc002tgc.3	O43683	OTTHUMG00000153638	ENST00000302759.6:c.1125C>A	2.37:g.111419251G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PC26|F5GXI5|O43430|O43643|O60626|Q53QE4	Silent	SNP	pfam_Mad3_BUB1_I,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Mad3_BUB1_I,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom	p.S375	ENST00000302759.6	37	c.1125	CCDS33273.1	2																																																																																			BUB1	-	NULL		0.507	BUB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BUB1	HGNC	protein_coding	OTTHUMT00000331925.1	G	NM_004336		111419251	-1	no_errors	ENST00000302759	ensembl	human	known	70_37	silent	SNP	0.573	T
C17orf51	339263	genome.wustl.edu	37	17	21437478	21437478	+	3'UTR	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:21437478G>T	ENST00000391411.5	-	0	2006				C17orf51_ENST00000535846.1_5'Flank|RP11-822E23.8_ENST00000426261.2_RNA|RP11-822E23.2_ENST00000579239.1_RNA	NM_001113434.3	NP_001106905.1	A8MQB3	CQ051_HUMAN	chromosome 17 open reading frame 51											endometrium(1)	1						CTAACCCCAAGAGTCCTGGCA	0.537																																																	0																																										SO:0001624	3_prime_UTR_variant	339263			BC010612	CCDS45629.1	17p11.2	2012-10-11			ENSG00000212719	ENSG00000212719			27904	protein-coding gene	gene with protein product							Standard	XM_005256621		Approved	FLJ12977, FLJ31874, FLJ33618	uc002gyw.4	A8MQB3	OTTHUMG00000132832	ENST00000391411.5:c.*1083C>A	17.37:g.21437478G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RN29|B5MCL4	RNA	SNP	-	NULL	ENST00000391411.5	37	NULL	CCDS45629.1	17																																																																																			C17orf51	-	-		0.537	C17orf51-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf51	HGNC	protein_coding	OTTHUMT00000256298.3	G	NM_001113434		21437478	-1	no_errors	ENST00000426261	ensembl	human	known	70_37	rna	SNP	0.001	T
C2orf49	79074	genome.wustl.edu	37	2	105953938	105953939	+	5'UTR	INS	-	-	C	rs3217439|rs33924571	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:105953938_105953939insC	ENST00000258457.2	+	0	123_124				RP11-332H14.2_ENST00000610036.1_lincRNA|C2orf49_ENST00000437250.2_Frame_Shift_Ins_p.L4fs|C2orf49_ENST00000410049.1_5'Flank			Q9BVC5	ASHWN_HUMAN	chromosome 2 open reading frame 49						embryonic morphogenesis (GO:0048598)	tRNA-splicing ligase complex (GO:0072669)				endometrium(1)|kidney(1)|large_intestine(3)|lung(1)	6						GGCATGCGGCGACTCAGAGTGA	0.634													C|-|C|deletion	3860	0.770767	0.7247	0.8357	5008	,	,		11882	0.8254		0.7247	False		,,,				2504	0.7781																0																																										SO:0001623	5_prime_UTR_variant	79074			BC001310	CCDS2068.1, CCDS74550.1	2q12.2	2009-04-22			ENSG00000135974	ENSG00000135974			28772	protein-coding gene	gene with protein product	"""ashwin"""					12477932	Standard	NM_001286537		Approved	MGC5509, asw	uc002tcs.1	Q9BVC5	OTTHUMG00000130808	ENST00000258457.2:c.-106->C	2.37:g.105953938_105953939insC		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXN3|B4E2G9	Frame_Shift_Ins	INS	NULL	p.L4fs	ENST00000258457.2	37	c.8_9	CCDS2068.1	2																																																																																			C2orf49	-	NULL		0.634	C2orf49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf49	HGNC	protein_coding	OTTHUMT00000253353.2	-	NM_024093		105953939	+1	no_errors	ENST00000437250	ensembl	human	known	70_37	frame_shift_ins	INS	0.881:0.072	C
C3orf20	84077	genome.wustl.edu	37	3	14798948	14798948	+	Missense_Mutation	SNP	C	C	T	rs199803083		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:14798948C>T	ENST00000253697.3	+	13	2463	c.2011C>T	c.(2011-2013)Cgg>Tgg	p.R671W	C3orf20_ENST00000435614.1_Missense_Mutation_p.R549W|C3orf20_ENST00000412910.1_Missense_Mutation_p.R549W	NM_032137.4	NP_115513.4	Q8ND61	CC020_HUMAN	chromosome 3 open reading frame 20	671						cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R671W(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(13)|lung(11)|ovary(4)|skin(2)	40						GCTGGTGCTGCGGAAGCTCAT	0.682													C|||	1	0.000199681	0.0	0.0	5008	,	,		18903	0.001		0.0	False		,,,				2504	0.0																1	Substitution - Missense(1)	large_intestine(1)											48.0	48.0	48.0					3																	14798948		2203	4300	6503	SO:0001583	missense	84077			AL136781	CCDS33706.1, CCDS54555.1	3p25.1	2011-01-25			ENSG00000131379	ENSG00000131379			25320	protein-coding gene	gene with protein product						11230166	Standard	NM_032137		Approved	DKFZP434N1817	uc003byy.3	Q8ND61	OTTHUMG00000155545	ENST00000253697.3:c.2011C>T	3.37:g.14798948C>T	ENSP00000253697:p.Arg671Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7L0U6|Q8NCP2|Q9H0I7	Missense_Mutation	SNP	NULL	p.R671W	ENST00000253697.3	37	c.2011	CCDS33706.1	3	0	0.0	0	0.0	0	0.0	0	0.0	0	0.0	C	14.86	2.662677	0.47572	.	.	ENSG00000131379	ENST00000253697;ENST00000435614;ENST00000412910	T;T;T	0.26223	2.04;1.75;1.75	4.95	4.05	0.47172	.	0.000000	0.46442	D	0.000294	T	0.48519	0.1504	M	0.76574	2.34	0.38457	D	0.94711	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.54735	-0.8249	10	0.87932	D	0	-26.1088	10.4301	0.44403	0.1953:0.8047:0.0:0.0	.	549;671	Q8ND61-2;Q8ND61	.;CC020_HUMAN	W	671;549;549	ENSP00000253697:R671W;ENSP00000402933:R549W;ENSP00000396081:R549W	ENSP00000253697:R671W	R	+	1	2	C3orf20	14773952	1.000000	0.71417	1.000000	0.80357	0.227000	0.25037	0.582000	0.23834	1.041000	0.40125	0.297000	0.19635	CGG	C3orf20	-	NULL		0.682	C3orf20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C3orf20	HGNC	protein_coding	OTTHUMT00000340586.1	C	NM_032137		14798948	+1	no_errors	ENST00000253697	ensembl	human	known	70_37	missense	SNP	1.000	T
CARD11	84433	genome.wustl.edu	37	7	2952970	2952970	+	Silent	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:2952970C>T	ENST00000396946.4	-	22	3373	c.2970G>A	c.(2968-2970)caG>caA	p.Q990Q		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	990	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGAGCAGCCTCTGCACCAGCG	0.667			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													63.0	64.0	64.0					7																	2952970		2203	4299	6502	SO:0001819	synonymous_variant	84433			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2970G>A	7.37:g.2952970C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.Q990	ENST00000396946.4	37	c.2970	CCDS5336.2	7																																																																																			CARD11	-	NULL		0.667	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	C	NM_032415		2952970	-1	no_errors	ENST00000396946	ensembl	human	known	70_37	silent	SNP	1.000	T
CARD11	84433	genome.wustl.edu	37	7	2952970	2952970	+	Silent	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:2952970C>T	ENST00000396946.4	-	22	3373	c.2970G>A	c.(2968-2970)caG>caA	p.Q990Q		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	990	Guanylate kinase-like.				Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)			NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		TGAGCAGCCTCTGCACCAGCG	0.667			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	0													63.0	64.0	64.0					7																	2952970		2203	4299	6502	SO:0001819	synonymous_variant	84433			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.2970G>A	7.37:g.2952970C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.Q990	ENST00000396946.4	37	c.2970	CCDS5336.2	7																																																																																			CARD11	-	NULL		0.667	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	C	NM_032415		2952970	-1	no_errors	ENST00000396946	ensembl	human	known	70_37	silent	SNP	1.000	T
CASP9	842	genome.wustl.edu	37	1	15833504	15833504	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:15833504C>A	ENST00000333868.5	-	4	614	c.520G>T	c.(520-522)Gag>Tag	p.E174*	CASP9_ENST00000375890.4_Nonsense_Mutation_p.E91*|CASP9_ENST00000546424.1_Nonsense_Mutation_p.E174*|CASP9_ENST00000348549.5_Intron	NM_001229.3	NP_001220.2	P55211	CASP9_HUMAN	caspase 9, apoptosis-related cysteine peptidase	174					activation of cysteine-type endopeptidase activity involved in apoptotic process by cytochrome c (GO:0008635)|aging (GO:0007568)|apoptotic process (GO:0006915)|cellular response to dexamethasone stimulus (GO:0071549)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glial cell apoptotic process (GO:0034349)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet formation (GO:0030220)|positive regulation of apoptotic process (GO:0043065)|positive regulation of neuron apoptotic process (GO:0043525)|regulation of apoptotic process (GO:0042981)|regulation of response to DNA damage stimulus (GO:2001020)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to estradiol (GO:0032355)|response to lipopolysaccharide (GO:0032496)|signal transduction in response to DNA damage (GO:0042770)	apoptosome (GO:0043293)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|enzyme activator activity (GO:0008047)|peptidase activity (GO:0008233)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(9)|ovary(1)|prostate(1)|stomach(1)	18		Breast(348;0.000207)|all_lung(284;0.000211)|Colorectal(325;0.000259)|Lung NSC(340;0.000269)|Renal(390;0.000518)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;8.49e-07)|COAD - Colon adenocarcinoma(227;4.36e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00013)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00763)|READ - Rectum adenocarcinoma(331;0.0655)		AGCCCGGACTCACGGCAGAAG	0.597																																																	0													108.0	109.0	109.0					1																	15833504		2203	4300	6503	SO:0001587	stop_gained	842			U60521	CCDS158.1, CCDS159.1, CCDS159.2, CCDS59995.1	1p36.21	2012-04-17	2005-08-17		ENSG00000132906	ENSG00000132906		"""Caspases"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1511	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 56"""	602234	"""caspase 9, apoptosis-related cysteine protease"""			8663294, 9390557	Standard	NM_001229		Approved	MCH6, ICE-LAP6, APAF-3, PPP1R56	uc001awn.4	P55211	OTTHUMG00000002256	ENST00000333868.5:c.520G>T	1.37:g.15833504C>A	ENSP00000330237:p.Glu174*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1A3|O95348|Q53Y70|Q5JRU9|Q5UGI1|Q92852|Q9BQ62|Q9UEQ3|Q9UIJ8	Nonsense_Mutation	SNP	pfam_Pept_C14_cat,pfam_CARD,superfamily_DEATH-like,smart_CARD,smart_Pept_C14_p45_core,pirsf_Caspase_IL-1_beta,pfscan_CARD,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.E174*	ENST00000333868.5	37	c.520	CCDS158.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	19.50|19.50	3.838783|3.838783	0.71373|0.71373	.|.	.|.	ENSG00000132906|ENSG00000132906	ENST00000546424;ENST00000333868;ENST00000375874;ENST00000375890;ENST00000447522;ENST00000440484|ENST00000424908	.|.	.|.	.|.	5.92|5.92	-3.14|-3.14	0.05250|0.05250	.|.	1.627630|.	0.02655|.	N|.	0.106933|.	.|.	.|.	.|.	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	0.07030|.	T|.	0.85|.	.|.	1.055|1.055	0.01588|0.01588	0.2491:0.3469:0.1072:0.2969|0.2491:0.3469:0.1072:0.2969	.|.	.|.	.|.	.|.	X|L	174;174;18;91;91;174|15	.|.	ENSP00000330237:E174X|.	E|X	-|-	1|2	0|2	CASP9|CASP9	15706091|15706091	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.003000|0.003000	0.03518|0.03518	-0.645000|-0.645000	0.05409|0.05409	-0.311000|-0.311000	0.08754|0.08754	0.561000|0.561000	0.74099|0.74099	GAG|TGA	CASP9	-	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pirsf_Caspase_IL-1_beta,pfscan_Pept_C14_ICE_p20		0.597	CASP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASP9	HGNC	protein_coding	OTTHUMT00000006438.1	C	NM_032996		15833504	-1	no_errors	ENST00000333868	ensembl	human	known	70_37	nonsense	SNP	0.000	A
CASQ1	844	genome.wustl.edu	37	1	160171086	160171086	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:160171086G>T	ENST00000368078.3	+	11	1307	c.1111G>T	c.(1111-1113)Gag>Tag	p.E371*	CASQ1_ENST00000467691.1_Nonsense_Mutation_p.E92*|CASQ1_ENST00000368079.3_Nonsense_Mutation_p.E365*|RP11-536C5.7_ENST00000418602.1_RNA			P31415	CASQ1_HUMAN	calsequestrin 1 (fast-twitch, skeletal muscle)	371	Asp-rich.				endoplasmic reticulum organization (GO:0007029)|ion transmembrane transport (GO:0034220)|protein polymerization (GO:0051258)|regulation of sequestering of calcium ion (GO:0051282)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|response to heat (GO:0009408)|response to organic substance (GO:0010033)|sarcomere organization (GO:0045214)|skeletal muscle tissue development (GO:0007519)|transmembrane transport (GO:0055085)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum lumen (GO:0033018)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna lumen (GO:0014804)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(9)|ovary(1)|skin(1)	21	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCCTTCTGCTGAGGAGCTGGA	0.547																																																	0													203.0	146.0	165.0					1																	160171086		2203	4300	6503	SO:0001587	stop_gained	844			S73775	CCDS1198.1, CCDS1198.2	1q21	2011-10-19			ENSG00000143318	ENSG00000143318		"""Protein disulfide isomerases"""	1512	protein-coding gene	gene with protein product	"""calsequestrin 1, fast-twitch, skeletal muscle"", ""calmitine"""	114250		CASQ		8406504, 2321095	Standard	NM_001231		Approved	PDIB1	uc010pja.2	P31415	OTTHUMG00000031607	ENST00000368078.3:c.1111G>T	1.37:g.160171086G>T	ENSP00000357057:p.Glu371*	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKZ2|B2R863|Q8TBW7	Nonsense_Mutation	SNP	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin	p.E371*	ENST00000368078.3	37	c.1111	CCDS1198.2	1	.	.	.	.	.	.	.	.	.	.	G	37	6.422447	0.97555	.	.	ENSG00000143318	ENST00000368079;ENST00000368078;ENST00000441151;ENST00000467691	.	.	.	4.77	4.77	0.60923	.	0.107311	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	.	16.7443	0.85468	0.0:0.0:1.0:0.0	.	.	.	.	X	365;371;286;92	.	ENSP00000357057:E371X	E	+	1	0	CASQ1	158437710	0.996000	0.38824	0.997000	0.53966	0.972000	0.66771	2.670000	0.46833	2.473000	0.83533	0.655000	0.94253	GAG	CASQ1	-	pfam_Calsequestrin,superfamily_Thioredoxin-like_fold,prints_Calsequestrin		0.547	CASQ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CASQ1	HGNC	protein_coding	OTTHUMT00000077412.1	G	NM_001231		160171086	+1	no_errors	ENST00000368078	ensembl	human	known	70_37	nonsense	SNP	0.981	T
CCDC39	339829	genome.wustl.edu	37	3	180426572	180426572	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:180426572C>A	ENST00000273654.4	-	5	661	c.42G>T	c.(40-42)tgG>tgT	p.W14C	CCDC39_ENST00000485055.1_5'UTR			Q9UFE4	CCD39_HUMAN	coiled-coil domain containing 39	0					axonemal dynein complex assembly (GO:0070286)|cilium-dependent cell motility (GO:0060285)|determination of digestive tract left/right asymmetry (GO:0071907)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|heart looping (GO:0001947)|lung development (GO:0030324)	axoneme (GO:0005930)|cytoskeleton (GO:0005856)				NS(1)|breast(1)|endometrium(4)|large_intestine(9)|lung(22)|ovary(6)|prostate(2)	45	all_cancers(143;9.31e-15)|Ovarian(172;0.0212)		OV - Ovarian serous cystadenocarcinoma(80;5.62e-23)|GBM - Glioblastoma multiforme(14;0.000558)			TGTTGATAAGCCAACTCCAGA	0.373																																																	0																																										SO:0001583	missense	339829			BC047103	CCDS46964.1	3q26.33	2012-07-27			ENSG00000145075	ENSG00000145075			25244	protein-coding gene	gene with protein product		613798				21131972	Standard	NM_181426		Approved	DKFZp434A128, CILD14, FAP59	uc010hxe.3	Q9UFE4	OTTHUMG00000157857	ENST00000273654.4:c.42G>T	3.37:g.180426572C>A	ENSP00000273654:p.Trp14Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E2H1	Missense_Mutation	SNP	superfamily_tRNA-bd_arm	p.W14C	ENST00000273654.4	37	c.42		3	.	.	.	.	.	.	.	.	.	.	C	4.898	0.166847	0.09339	.	.	ENSG00000145075	ENST00000273654	.	.	.	5.63	3.81	0.43845	.	3.236710	0.00777	N	0.001258	T	0.41880	0.1178	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.32134	-0.9918	6	0.49607	T	0.09	.	7.1237	0.25458	0.1694:0.7435:0.0:0.0871	.	.	.	.	C	14	.	ENSP00000273654:W14C	W	-	3	0	CCDC39	181909266	0.000000	0.05858	0.002000	0.10522	0.035000	0.12851	-0.233000	0.09041	0.709000	0.31976	-0.384000	0.06662	TGG	CCDC39	-	NULL		0.373	CCDC39-201	KNOWN	basic	protein_coding	CCDC39	HGNC	protein_coding		C	XM_291028		180426572	-1	no_errors	ENST00000273654	ensembl	human	known	70_37	missense	SNP	0.001	A
CD84	8832	genome.wustl.edu	37	1	160535532	160535532	+	Missense_Mutation	SNP	G	G	A	rs544642873	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:160535532G>A	ENST00000311224.4	-	2	116	c.50C>T	c.(49-51)cCg>cTg	p.P17L	CD84_ENST00000368048.3_Missense_Mutation_p.P17L|CD84_ENST00000368047.3_5'UTR|RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000534968.1_Intron|CD84_ENST00000368054.3_Missense_Mutation_p.P17L|CD84_ENST00000368051.3_Missense_Mutation_p.P17L	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	17					blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			AGCTGCTTCCGGCCCTGAGAA	0.453													G|||	2	0.000399361	0.0	0.0	5008	,	,		17615	0.0		0.0	False		,,,				2504	0.002																0													22.0	21.0	21.0					1																	160535532		2202	4297	6499	SO:0001583	missense	8832			AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.50C>T	1.37:g.160535532G>A	ENSP00000312367:p.Pro17Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.P17L	ENST00000311224.4	37	c.50	CCDS53396.1	1	.	.	.	.	.	.	.	.	.	.	G	8.489	0.861634	0.17178	.	.	ENSG00000066294	ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	T;T;T;T;T;T	0.63255	0.35;0.32;0.32;0.11;0.08;-0.03	5.11	0.522	0.17053	.	2.906790	0.01315	N	0.010755	T	0.15219	0.0367	N	0.05031	-0.125	0.09310	N	1	B;B;B;B;B;B	0.22080	0.064;0.01;0.023;0.005;0.008;0.008	B;B;B;B;B;B	0.14023	0.01;0.003;0.01;0.001;0.003;0.003	T	0.08806	-1.0704	10	0.11182	T	0.66	-0.1095	6.8581	0.24052	0.6218:0.0:0.3782:0.0	.	17;17;17;17;17;17	Q9UIB8-5;Q9UIB8-6;Q9UIB8-4;Q9UIB8;Q9UIB8-2;Q9UIB8-3	.;.;.;SLAF5_HUMAN;.;.	L	17	ENSP00000357033:P17L;ENSP00000357027:P17L;ENSP00000312367:P17L;ENSP00000357030:P17L;ENSP00000353163:P17L;ENSP00000357026:P17L	ENSP00000312367:P17L	P	-	2	0	CD84	158802156	0.002000	0.14202	0.063000	0.19743	0.036000	0.12997	0.273000	0.18662	0.026000	0.15269	-0.218000	0.12543	CCG	CD84	-	NULL		0.453	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	HGNC	protein_coding	OTTHUMT00000059092.1	G	NM_003874		160535532	-1	no_errors	ENST00000311224	ensembl	human	known	70_37	missense	SNP	0.039	A
CD84	8832	genome.wustl.edu	37	1	160535532	160535532	+	Missense_Mutation	SNP	G	G	A	rs544642873	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:160535532G>A	ENST00000311224.4	-	2	116	c.50C>T	c.(49-51)cCg>cTg	p.P17L	CD84_ENST00000368048.3_Missense_Mutation_p.P17L|CD84_ENST00000368047.3_5'UTR|RP11-528G1.2_ENST00000446952.1_RNA|CD84_ENST00000534968.1_Intron|CD84_ENST00000368054.3_Missense_Mutation_p.P17L|CD84_ENST00000368051.3_Missense_Mutation_p.P17L	NM_001184879.1	NP_001171808.1	Q9UIB8	SLAF5_HUMAN	CD84 molecule	17					blood coagulation (GO:0007596)|defense response (GO:0006952)|homophilic cell adhesion (GO:0007156)|leukocyte migration (GO:0050900)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(12)|ovary(2)|prostate(1)|skin(1)	24	all_cancers(52;3.62e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			AGCTGCTTCCGGCCCTGAGAA	0.453													G|||	2	0.000399361	0.0	0.0	5008	,	,		17615	0.0		0.0	False		,,,				2504	0.002																0													22.0	21.0	21.0					1																	160535532		2202	4297	6499	SO:0001583	missense	8832			AF054816	CCDS1206.1, CCDS53395.1, CCDS53396.1, CCDS53397.1	1q24	2013-01-11	2006-03-31		ENSG00000066294	ENSG00000066294		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1704	protein-coding gene	gene with protein product		604513	"""CD84 antigen (leukocyte antigen)"", ""CD84 molecule """			9310491	Standard	NM_003874		Approved	SLAMF5, hCD84, mCD84	uc001fwh.4	Q9UIB8	OTTHUMG00000022788	ENST00000311224.4:c.50C>T	1.37:g.160535532G>A	ENSP00000312367:p.Pro17Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8T1|B7Z3R8|O15430|O95266|O95660|Q5H9R1|Q6FHA8|Q8WLP1|Q8WWI8|Q9UF04|Q9UIB6|Q9UIB7|Q9UIT7	Missense_Mutation	SNP	smart_Ig_sub,pfscan_Ig-like	p.P17L	ENST00000311224.4	37	c.50	CCDS53396.1	1	.	.	.	.	.	.	.	.	.	.	G	8.489	0.861634	0.17178	.	.	ENSG00000066294	ENST00000368054;ENST00000368048;ENST00000311224;ENST00000368051;ENST00000360056;ENST00000368047	T;T;T;T;T;T	0.63255	0.35;0.32;0.32;0.11;0.08;-0.03	5.11	0.522	0.17053	.	2.906790	0.01315	N	0.010755	T	0.15219	0.0367	N	0.05031	-0.125	0.09310	N	1	B;B;B;B;B;B	0.22080	0.064;0.01;0.023;0.005;0.008;0.008	B;B;B;B;B;B	0.14023	0.01;0.003;0.01;0.001;0.003;0.003	T	0.08806	-1.0704	10	0.11182	T	0.66	-0.1095	6.8581	0.24052	0.6218:0.0:0.3782:0.0	.	17;17;17;17;17;17	Q9UIB8-5;Q9UIB8-6;Q9UIB8-4;Q9UIB8;Q9UIB8-2;Q9UIB8-3	.;.;.;SLAF5_HUMAN;.;.	L	17	ENSP00000357033:P17L;ENSP00000357027:P17L;ENSP00000312367:P17L;ENSP00000357030:P17L;ENSP00000353163:P17L;ENSP00000357026:P17L	ENSP00000312367:P17L	P	-	2	0	CD84	158802156	0.002000	0.14202	0.063000	0.19743	0.036000	0.12997	0.273000	0.18662	0.026000	0.15269	-0.218000	0.12543	CCG	CD84	-	NULL		0.453	CD84-003	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CD84	HGNC	protein_coding	OTTHUMT00000059092.1	G	NM_003874		160535532	-1	no_errors	ENST00000311224	ensembl	human	known	70_37	missense	SNP	0.039	A
CHD3	1107	genome.wustl.edu	37	17	7793747	7793748	+	Intron	INS	-	-	A	rs554325814		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:7793747_7793748insA	ENST00000330494.7	+	3	363				CHD3_ENST00000570758.1_Intron|CHD3_ENST00000358181.4_Intron|CHD3_ENST00000380358.4_Intron	NM_001005273.2	NP_001005273.1	Q12873	CHD3_HUMAN	chromodomain helicase DNA binding protein 3						centrosome organization (GO:0051297)|chromatin assembly or disassembly (GO:0006333)|chromatin modification (GO:0016568)|DNA duplex unwinding (GO:0032508)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|regulation of transcription, DNA-templated (GO:0006355)|spindle organization (GO:0007051)|transcription, DNA-templated (GO:0006351)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|nucleolus (GO:0005730)|nucleus (GO:0005634)|NuRD complex (GO:0016581)	ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(11)|kidney(6)|large_intestine(13)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(7)|skin(3)|urinary_tract(2)	65		Prostate(122;0.202)				actccatctccaaaaaaaaaaa	0.446																																																	0																																										SO:0001627	intron_variant	1107			U08379	CCDS32553.2, CCDS32554.1, CCDS32555.1	17p13	2013-01-28			ENSG00000170004	ENSG00000170004		"""Zinc fingers, PHD-type"""	1918	protein-coding gene	gene with protein product		602120				9326634, 7560064	Standard	NM_001005271		Approved	Mi-2a, ZFH, Mi2-ALPHA	uc002gjd.2	Q12873	OTTHUMG00000150427	ENST00000330494.7:c.214-141->A	17.37:g.7793758_7793758dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTQ9|E9PG89|Q9Y4I0	RNA	INS	-	NULL	ENST00000330494.7	37	NULL	CCDS32554.1	17																																																																																			CHD3	-	-		0.446	CHD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHD3	HGNC	protein_coding	OTTHUMT00000318050.1	-	NM_001005273		7793748	+1	no_errors	ENST00000574022	ensembl	human	known	70_37	rna	INS	0.217:0.454	A
CDC42EP4	23580	genome.wustl.edu	37	17	71302939	71302939	+	Intron	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:71302939G>A	ENST00000335793.3	-	1	283				CDC42EP4_ENST00000439510.2_Intron|CDC42EP4_ENST00000582303.1_5'UTR|CDC42EP4_ENST00000581014.1_Intron			Q9H3Q1	BORG4_HUMAN	CDC42 effector protein (Rho GTPase binding) 4						positive regulation of pseudopodium assembly (GO:0031274)|regulation of cell shape (GO:0008360)|Rho protein signal transduction (GO:0007266)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	GTP-Rho binding (GO:0017049)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(3)|large_intestine(1)|lung(7)|urinary_tract(1)	14			LUSC - Lung squamous cell carcinoma(166;0.0352)|Lung(188;0.0711)			GGAAGGACAGGCAGGAAAGAG	0.517																																																	0																																										SO:0001627	intron_variant	23580			AB042237	CCDS11695.1	17q24-q25	2008-07-18				ENSG00000179604			17147	protein-coding gene	gene with protein product	"""Cdc42 effector protein 4"", ""binder of Rho GTPases 4"""	605468				11035016, 10490598	Standard	NM_012121		Approved	CEP4, KAIA1777, BORG4, MGC3740, MGC17125	uc002jjo.3	Q9H3Q1		ENST00000335793.3:c.111+5092C>T	17.37:g.71302939G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUS7|O95828|Q96FT3	RNA	SNP	-	NULL	ENST00000335793.3	37	NULL	CCDS11695.1	17																																																																																			CDC42EP4	-	-		0.517	CDC42EP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42EP4	HGNC	protein_coding	OTTHUMT00000441898.1	G	NM_012121		71302939	-1	no_errors	ENST00000582303	ensembl	human	putative	70_37	rna	SNP	0.000	A
CLEC7A	64581	genome.wustl.edu	37	12	10279189	10279189	+	Silent	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:10279189G>T	ENST00000304084.8	-	3	475	c.321C>A	c.(319-321)acC>acA	p.T107T	CLEC7A_ENST00000298523.5_Intron|CLEC7A_ENST00000533022.1_Silent_p.T107T|CLEC7A_ENST00000353231.5_Intron|CLEC7A_ENST00000396484.2_Intron	NM_197947.2	NP_922938.1	Q9BXN2	CLC7A_HUMAN	C-type lectin domain family 7, member A	107					carbohydrate mediated signaling (GO:0009756)|cell recognition (GO:0008037)|defense response to protozoan (GO:0042832)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|pattern recognition receptor signaling pathway (GO:0002221)|phagocytosis, recognition (GO:0006910)|T cell activation (GO:0042110)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|metal ion binding (GO:0046872)|MHC protein binding (GO:0042287)|signaling pattern recognition receptor activity (GO:0008329)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	7						TGACAGCTTTGGTAGGAGTCA	0.448																																																	0													209.0	191.0	196.0					12																	10279189		1879	4112	5991	SO:0001819	synonymous_variant	64581			AY009090	CCDS8613.1, CCDS8614.1, CCDS8617.1, CCDS41753.1, CCDS41754.1, CCDS53744.1	12p13.2-p12.3	2014-09-17		2005-02-09	ENSG00000172243	ENSG00000172243		"""C-type lectin domain containing"""	14558	protein-coding gene	gene with protein product		606264	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 12"""	CLECSF12			Standard	XM_005253468		Approved	dectin-1, hDectin-1	uc001qxg.2	Q9BXN2	OTTHUMG00000133597	ENST00000304084.8:c.321C>A	12.37:g.10279189G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R861|B7Z494|B7Z5A9|B7Z5B9|Q6IPS7|Q96D32|Q96DR9|Q96LD3|Q96PA4|Q96PA5|Q96PA6|Q96PA7|Q96PA8|Q9H1K3	Silent	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.T107	ENST00000304084.8	37	c.321	CCDS41753.1	12																																																																																			CLEC7A	-	NULL		0.448	CLEC7A-013	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC7A	HGNC	protein_coding	OTTHUMT00000390772.1	G	NM_197954		10279189	-1	no_errors	ENST00000304084	ensembl	human	known	70_37	silent	SNP	0.828	T
CNKSR1	10256	genome.wustl.edu	37	1	26513674	26513674	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:26513674G>T	ENST00000374253.5	+	15	1384	c.1345G>T	c.(1345-1347)Ggc>Tgc	p.G449C	CNKSR1_ENST00000531191.1_Missense_Mutation_p.G184C|CNKSR1_ENST00000361530.6_Missense_Mutation_p.G442C	NM_006314.2	NP_006305.2	Q969H4	CNKR1_HUMAN	connector enhancer of kinase suppressor of Ras 1	449	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				Ras protein signal transduction (GO:0007265)|Rho protein signal transduction (GO:0007266)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|plasma membrane (GO:0005886)	protein binding, bridging (GO:0030674)			breast(4)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(8)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	28		Colorectal(325;3.46e-05)|all_lung(284;0.000116)|Lung NSC(340;0.000154)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;2.72e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.00072)|BRCA - Breast invasive adenocarcinoma(304;0.000959)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00823)|READ - Rectum adenocarcinoma(331;0.0649)		GAAGGCTGAGGGCCTCATCAA	0.532																																					NSCLC(180;1396 2109 28270 30756 34275)												0													90.0	96.0	94.0					1																	26513674		2203	4300	6503	SO:0001583	missense	10256			AF100153	CCDS276.1, CCDS72732.1	1p35.3	2013-01-10			ENSG00000142675	ENSG00000142675		"""Sterile alpha motif (SAM) domain containing"", ""Pleckstrin homology (PH) domain containing"""	19700	protein-coding gene	gene with protein product		603272				9814705	Standard	NM_006314		Approved	CNK1, KSR, CNK	uc001blm.4	Q969H4	OTTHUMG00000007541	ENST00000374253.5:c.1345G>T	1.37:g.26513674G>T	ENSP00000363371:p.Gly449Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AMW9|O95381	Missense_Mutation	SNP	pfam_CRIC_domain_Chordata,pfam_Pleckstrin_homology,pfam_SAM_type1,superfamily_SAM/pointed,superfamily_PDZ,smart_SAM,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_SAM	p.G449C	ENST00000374253.5	37	c.1345		1	.	.	.	.	.	.	.	.	.	.	G	19.69	3.875118	0.72180	.	.	ENSG00000142675	ENST00000361530;ENST00000374253;ENST00000531191	T;T;T	0.21543	2.0;2.0;2.0	5.56	5.56	0.83823	Pleckstrin homology-type (1);Pleckstrin homology domain (3);	0.000000	0.85682	D	0.000000	T	0.28699	0.0711	M	0.68593	2.085	0.80722	D	1	P;P	0.47350	0.894;0.894	B;B	0.39706	0.307;0.307	T	0.14309	-1.0477	10	0.87932	D	0	-26.1337	19.5245	0.95199	0.0:0.0:1.0:0.0	.	449;442	Q969H4;Q53GM7	CNKR1_HUMAN;.	C	442;449;184	ENSP00000354609:G442C;ENSP00000363371:G449C;ENSP00000431817:G184C	ENSP00000354609:G442C	G	+	1	0	CNKSR1	26386261	1.000000	0.71417	0.989000	0.46669	0.979000	0.70002	8.595000	0.90840	2.608000	0.88229	0.655000	0.94253	GGC	CNKSR1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.532	CNKSR1-007	KNOWN	basic	protein_coding	CNKSR1	HGNC	protein_coding	OTTHUMT00000089943.2	G	NM_006314		26513674	+1	no_errors	ENST00000374253	ensembl	human	known	70_37	missense	SNP	1.000	T
COQ9	57017	genome.wustl.edu	37	16	57486731	57486731	+	Silent	SNP	C	C	T	rs376613524		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:57486731C>T	ENST00000262507.6	+	3	330	c.261C>T	c.(259-261)ggC>ggT	p.G87G	COQ9_ENST00000567933.1_Silent_p.G87G|COQ9_ENST00000567384.1_3'UTR|COQ9_ENST00000567072.1_Silent_p.G87G	NM_020312.3	NP_064708.1	O75208	COQ9_HUMAN	coenzyme Q9	87					mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|ubiquinone biosynthetic process (GO:0006744)	mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(6)|prostate(1)	16						ACCAGGGCGGCGAGGAGGAGG	0.582																																																	0								C		2,4394	4.2+/-10.8	0,2,2196	124.0	107.0	113.0		261	-10.4	0.0	16		113	0,8600		0,0,4300	no	coding-synonymous	COQ9	NM_020312.3		0,2,6496	TT,TC,CC		0.0,0.0455,0.0154		87/319	57486731	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	57017			BC064946	CCDS32459.1	16q13	2013-10-18	2013-10-18	2006-01-13	ENSG00000088682	ENSG00000088682			25302	protein-coding gene	gene with protein product		612837	"""chromosome 16 open reading frame 49"", ""coenzyme Q9 homolog (yeast)"", ""coenzyme Q9 homolog (S. cerevisiae)"""	C16orf49		19375058	Standard	NM_020312		Approved	DKFZP434K046	uc002elq.3	O75208		ENST00000262507.6:c.261C>T	16.37:g.57486731C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3L2|Q7L5V7|Q7Z5T6|Q8NBL4|Q9NTJ2|Q9P056	Silent	SNP	pfam_COQ9,superfamily_Homeodomain-like,tigrfam_Ubiq_biosynth_COQ9	p.G87	ENST00000262507.6	37	c.261	CCDS32459.1	16																																																																																			COQ9	-	NULL		0.582	COQ9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COQ9	HGNC	protein_coding	OTTHUMT00000432598.3	C	NM_020312		57486731	+1	no_errors	ENST00000262507	ensembl	human	known	70_37	silent	SNP	0.002	T
CR1L	1379	genome.wustl.edu	37	1	207890923	207890923	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:207890923G>C	ENST00000508064.2	+	11	1589	c.1529G>C	c.(1528-1530)aGa>aCa	p.R510T		NM_175710.1	NP_783641.1	Q2VPA4	CR1L_HUMAN	complement component (3b/4b) receptor 1-like	510	Sushi 8. {ECO:0000255|PROSITE- ProRule:PRU00302}.					cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)|receptor complex (GO:0043235)				endometrium(1)|kidney(1)|large_intestine(2)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22						CACCCAGACAGAGGGATGACC	0.527																																																	0													141.0	135.0	137.0					1																	207890923		1920	4120	6040	SO:0001583	missense	1379			AY114160	CCDS44310.1	1q32.1	2008-02-05			ENSG00000197721	ENSG00000197721		"""Complement system"""	2335	protein-coding gene	gene with protein product		605886				2295627	Standard	NM_175710		Approved		uc001hga.4	Q2VPA4	OTTHUMG00000036354	ENST00000508064.2:c.1529G>C	1.37:g.207890923G>C	ENSP00000421736:p.Arg510Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32MC9|Q8NEU7	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP	p.R510T	ENST00000508064.2	37	c.1529	CCDS44310.1	1	.	.	.	.	.	.	.	.	.	.	G	9.690	1.151636	0.21371	.	.	ENSG00000197721	ENST00000508064	T	0.63417	-0.04	3.01	0.803	0.18691	Complement control module (2);Sushi/SCR/CCP (3);	.	.	.	.	T	0.70141	0.3190	M	0.81682	2.555	0.09310	N	1	D	0.59767	0.986	P	0.62089	0.898	T	0.57642	-0.7776	9	0.19590	T	0.45	.	3.9432	0.09336	0.1642:0.2505:0.5854:0.0	.	510	Q2VPA4	CR1L_HUMAN	T	510	ENSP00000421736:R510T	ENSP00000421736:R510T	R	+	2	0	CR1L	205957546	0.004000	0.15560	0.001000	0.08648	0.256000	0.26092	0.133000	0.15912	0.045000	0.15804	0.305000	0.20034	AGA	CR1L	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.527	CR1L-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CR1L	HGNC	protein_coding	OTTHUMT00000390247.1	G	XM_114735		207890923	+1	no_errors	ENST00000508064	ensembl	human	known	70_37	missense	SNP	0.001	C
CRTC3	64784	genome.wustl.edu	37	15	91083312	91083312	+	Silent	SNP	C	C	T	rs374582569		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr15:91083312C>T	ENST00000268184.6	+	2	178	c.174C>T	c.(172-174)taC>taT	p.Y58Y	CRTC3_ENST00000420329.2_Silent_p.Y58Y|CRTC3_ENST00000560098.1_Silent_p.Y58Y|CRTC3_ENST00000558619.1_3'UTR			Q6UUV7	CRTC3_HUMAN	CREB regulated transcription coactivator 3	58	Required for interaction with HTLV-1 TAX.				energy homeostasis (GO:0097009)|negative regulation of cAMP-mediated signaling (GO:0043951)|negative regulation of lipid catabolic process (GO:0050995)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein homotetramerization (GO:0051289)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cAMP response element binding protein binding (GO:0008140)		CRTC3/MAML2(26)	breast(1)|endometrium(4)|large_intestine(3)|lung(8)|ovary(1)|prostate(2)|urinary_tract(1)	20	Melanoma(11;0.00551)|Lung NSC(78;0.0931)|all_lung(78;0.163)		BRCA - Breast invasive adenocarcinoma(143;0.0745)			TTACACAGTACCATGGAGGAT	0.448			T	MAML2	salivary gland mucoepidermoid																																			Dom	yes		15	15q26.1	64784	CREB regulated transcription coactivator 3		E	0													112.0	103.0	106.0					15																	91083312		2198	4298	6496	SO:0001819	synonymous_variant	64784				CCDS32331.1, CCDS45348.1	15q26.1	2005-11-24				ENSG00000140577			26148	protein-coding gene	gene with protein product		608986				14536081, 14506290	Standard	NM_022769		Approved	FLJ21868	uc002bpp.4	Q6UUV7		ENST00000268184.6:c.174C>T	15.37:g.91083312C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6DK61|Q6DK62|Q8NF38|Q9H6U2	Silent	SNP	NULL	p.Y58	ENST00000268184.6	37	c.174	CCDS32331.1	15																																																																																			CRTC3	-	NULL		0.448	CRTC3-001	KNOWN	NAGNAG_splice_site|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	CRTC3	HGNC	protein_coding	OTTHUMT00000417716.2	C	NM_022769		91083312	+1	no_errors	ENST00000268184	ensembl	human	known	70_37	silent	SNP	1.000	T
CYP2B7P	1556	genome.wustl.edu	37	19	41450146	41450146	+	RNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:41450146C>A	ENST00000597260.1	+	0	0				CYP2B7P1_ENST00000599198.1_RNA																							cctcagtctcccaaaatgctg	0.453																																																	0																																												1556																															19.37:g.41450146C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000597260.1	37	NULL		19																																																																																			CYP2B7P1	-	-		0.453	AC092071.1-001	KNOWN	basic	sense_intronic	CYP2B7P1	HGNC	sense_intronic	OTTHUMT00000463563.1	C			41450146	+1	no_errors	ENST00000600518	ensembl	human	known	70_37	rna	SNP	0.014	A
DALRD3	55152	genome.wustl.edu	37	3	49055216	49055216	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:49055216G>A	ENST00000341949.4	-	3	554	c.548C>T	c.(547-549)tCg>tTg	p.S183L	NDUFAF3_ENST00000326912.4_5'Flank|DALRD3_ENST00000313778.5_Missense_Mutation_p.S16L|MIR425_ENST00000362162.1_RNA|MIR191_ENST00000384873.1_RNA|DALRD3_ENST00000395462.4_Missense_Mutation_p.S16L|DALRD3_ENST00000496568.1_5'UTR|DALRD3_ENST00000441576.2_Missense_Mutation_p.S183L|DALRD3_ENST00000440857.1_Missense_Mutation_p.S16L	NM_001009996.1	NP_001009996.1	Q5D0E6	DALD3_HUMAN	DALR anticodon binding domain containing 3	183					arginyl-tRNA aminoacylation (GO:0006420)		arginine-tRNA ligase activity (GO:0004814)|ATP binding (GO:0005524)			breast(2)|endometrium(2)|large_intestine(2)|lung(5)|skin(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00218)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		AGCTCTCTCCGAGGCAGCGGG	0.637																																																	0													44.0	35.0	38.0					3																	49055216		2203	4300	6503	SO:0001583	missense	55152			BC014099	CCDS2783.1, CCDS33754.1, CCDS63632.1	3p21.31	2005-01-10			ENSG00000178149	ENSG00000178149			25536	protein-coding gene	gene with protein product						12477932	Standard	NM_001009996		Approved	FLJ10496	uc003cvk.2	Q5D0E6	OTTHUMG00000156748	ENST00000341949.4:c.548C>T	3.37:g.49055216G>A	ENSP00000344989:p.Ser183Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z5S7|Q86WY1|Q8N105|Q8NA89|Q9NVU8	Missense_Mutation	SNP	pfam_DALR_anticod-bd,superfamily_tRNAsynth_1a_anticodon-bd,smart_DALR_anticod-bd	p.S183L	ENST00000341949.4	37	c.548	CCDS33754.1	3	.	.	.	.	.	.	.	.	.	.	g	15.47	2.844338	0.51164	.	.	ENSG00000178149	ENST00000441576;ENST00000341949;ENST00000395462;ENST00000440857;ENST00000313778;ENST00000420952	T;T;T;T;T;T	0.54071	0.72;0.78;0.67;0.59;0.67;0.77	5.06	3.28	0.37604	.	0.311089	0.30473	N	0.009548	T	0.45915	0.1366	M	0.64997	1.995	0.09310	N	1	B;P;B;P	0.47604	0.017;0.898;0.007;0.837	B;B;B;B	0.39379	0.004;0.298;0.004;0.074	T	0.36915	-0.9728	10	0.39692	T	0.17	-2.405	9.7901	0.40699	0.2225:0.0:0.7775:0.0	.	183;16;183;183	B7Z727;C9JJG6;Q5D0E6-2;Q5D0E6	.;.;.;DALD3_HUMAN	L	183;183;16;16;16;148	ENSP00000410623:S183L;ENSP00000344989:S183L;ENSP00000378846:S16L;ENSP00000403770:S16L;ENSP00000323265:S16L;ENSP00000397385:S148L	ENSP00000323265:S16L	S	-	2	0	DALRD3	49030220	0.059000	0.20769	0.012000	0.15200	0.147000	0.21601	1.860000	0.39428	0.545000	0.28902	-0.126000	0.14955	TCG	DALRD3	-	NULL		0.637	DALRD3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DALRD3	HGNC	protein_coding	OTTHUMT00000345581.1	G	NM_018114		49055216	-1	no_errors	ENST00000341949	ensembl	human	known	70_37	missense	SNP	0.001	A
DDX19A	55308	genome.wustl.edu	37	16	70390092	70390092	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:70390092C>A	ENST00000302243.7	+	4	398	c.235C>A	c.(235-237)Ctg>Atg	p.L79M	DDX19A_ENST00000562509.1_3'UTR|RP11-529K1.3_ENST00000567706.1_Intron|DDX19A_ENST00000443119.2_5'Flank|DDX19A_ENST00000417604.2_Missense_Mutation_p.L79M	NM_018332.3	NP_060802.1	Q9NUU7	DD19A_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 19A	79	N-terminal lobe. {ECO:0000250}.				mRNA transport (GO:0051028)|positive regulation of apoptotic process (GO:0043065)|protein transport (GO:0015031)|response to zinc ion (GO:0010043)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear pore (GO:0005643)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(1)|endometrium(1)|large_intestine(5)|lung(3)|urinary_tract(1)	11		Ovarian(137;0.221)				AGTGGAAGTCCTGCAACGGGA	0.493																																																	0													246.0	225.0	232.0					16																	70390092		2198	4300	6498	SO:0001583	missense	55308			AF183422	CCDS10889.1	16q22.1	2012-02-23	2012-02-23	2005-07-13	ENSG00000168872	ENSG00000168872		"""DEAD-boxes"""	25628	protein-coding gene	gene with protein product			"""DEAD (Asp-Glu-Ala-As) box polypeptide 19-like"""	DDX19L		12477932	Standard	NM_018332		Approved	FLJ11126		Q9NUU7	OTTHUMG00000137579	ENST00000302243.7:c.235C>A	16.37:g.70390092C>A	ENSP00000306117:p.Leu79Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPL0|B4DRZ7|Q53FM0	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.L79M	ENST00000302243.7	37	c.235	CCDS10889.1	16	.	.	.	.	.	.	.	.	.	.	C	23.8	4.458017	0.84317	.	.	ENSG00000168872	ENST00000302243;ENST00000417604	T;T	0.03982	3.96;3.74	5.51	4.56	0.56223	.	0.141869	0.49305	D	0.000157	T	0.14874	0.0359	M	0.63208	1.945	0.80722	D	1	B;P	0.48764	0.116;0.915	B;P	0.58928	0.101;0.848	T	0.00374	-1.1780	10	0.52906	T	0.07	.	12.2012	0.54326	0.0:0.9168:0.0:0.0832	.	79;79	B4DS24;Q9NUU7	.;DD19A_HUMAN	M	79	ENSP00000306117:L79M;ENSP00000410243:L79M	ENSP00000306117:L79M	L	+	1	2	DDX19A	68947593	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.741000	0.55090	1.470000	0.48102	0.655000	0.94253	CTG	DDX19A	-	NULL		0.493	DDX19A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX19A	HGNC	protein_coding	OTTHUMT00000268967.2	C	NM_018332		70390092	+1	no_errors	ENST00000302243	ensembl	human	known	70_37	missense	SNP	1.000	A
DDX60L	91351	genome.wustl.edu	37	4	169411576	169411576	+	IGR	SNP	T	T	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:169411576T>A								DDX60L (9911 upstream) : PALLD (6640 downstream)																							GATAGCTTATTTCTGTATCAC	0.284																																																	0																																										SO:0001628	intergenic_variant	91351																															4.37:g.169411576T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		4																																																																																			DDX60L	-	-	0	0.284					DDX60L	HGNC			T			169411576	-1	no_errors	ENST00000505150	ensembl	human	known	70_37	rna	SNP	0.015	A
DHX34	9704	genome.wustl.edu	37	19	47865903	47865903	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:47865903C>A	ENST00000328771.4	+	6	1895	c.1546C>A	c.(1546-1548)Ccc>Acc	p.P516T	DHX34_ENST00000471451.1_Intron	NM_014681.5	NP_055496.2	Q14147	DHX34_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 34	516	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	membrane (GO:0016020)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(2)|lung(8)|ovary(5)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36		all_cancers(25;1.65e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;7.16e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000489)|GBM - Glioblastoma multiforme(486;0.00413)|Epithelial(262;0.0132)		CGCCCCCTACCCCGTCCCAGA	0.652																																																	0													22.0	22.0	22.0					19																	47865903		2195	4293	6488	SO:0001583	missense	9704			D50924	CCDS12700.1	19q13.3	2003-06-13	2003-06-13	2003-06-13	ENSG00000134815	ENSG00000134815		"""DEAH-boxes"""	16719	protein-coding gene	gene with protein product		615475	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 34"""	DDX34		10708517, 8590280	Standard	NM_014681		Approved	KIAA0134	uc010xyn.2	Q14147	OTTHUMG00000149959	ENST00000328771.4:c.1546C>A	19.37:g.47865903C>A	ENSP00000331907:p.Pro516Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMY8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.P516T	ENST00000328771.4	37	c.1546	CCDS12700.1	19	.	.	.	.	.	.	.	.	.	.	C	0.997	-0.692228	0.03303	.	.	ENSG00000134815	ENST00000328771;ENST00000257252	T	0.02236	4.38	5.6	4.55	0.56014	Helicase, C-terminal (1);	0.090110	0.47093	D	0.000248	T	0.01029	0.0034	N	0.00972	-1.085	0.58432	D	0.999999	B	0.24576	0.106	B	0.23150	0.044	T	0.55276	-0.8166	10	0.08381	T	0.77	-13.2604	15.1593	0.72771	0.0:0.8424:0.1576:0.0	.	516	Q14147	DHX34_HUMAN	T	516;431	ENSP00000331907:P516T	ENSP00000257252:P431T	P	+	1	0	DHX34	52557747	0.997000	0.39634	0.954000	0.39281	0.067000	0.16453	3.004000	0.49513	1.327000	0.45338	0.561000	0.74099	CCC	DHX34	-	pfscan_Helicase_C		0.652	DHX34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX34	HGNC	protein_coding	OTTHUMT00000314313.3	C	NM_014681		47865903	+1	no_errors	ENST00000328771	ensembl	human	known	70_37	missense	SNP	1.000	A
EMC1	23065	genome.wustl.edu	37	1	19545176	19545176	+	3'UTR	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:19545176C>A	ENST00000477853.1	-	0	3645				EMC1_ENST00000375199.3_3'UTR|EMC1_ENST00000480380.1_5'UTR|RP1-43E13.2_ENST00000437898.1_RNA|EMC1_ENST00000375208.3_3'UTR	NM_001271427.1|NM_001271428.1|NM_015047.2	NP_001258356.1|NP_001258357.1|NP_055862.1	Q8N766	EMC1_HUMAN	ER membrane protein complex subunit 1							ER membrane protein complex (GO:0072546)|integral component of membrane (GO:0016021)											AATGACAGCACGAAACTAGAG	0.418																																																	0																																										SO:0001624	3_prime_UTR_variant	23065				CCDS190.1, CCDS59190.1, CCDS59191.1	1p36.13	2012-05-23	2012-05-23	2012-05-23	ENSG00000127463	ENSG00000127463			28957	protein-coding gene	gene with protein product			"""KIAA0090"""	KIAA0090		22119785	Standard	NM_015047		Approved		uc001bbo.4	Q8N766	OTTHUMG00000002497	ENST00000477853.1:c.*621G>T	1.37:g.19545176C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6F3|Q14700|Q5TG62|Q63HL0|Q63HL3|Q8NBH8	RNA	SNP	-	NULL	ENST00000477853.1	37	NULL	CCDS190.1	1																																																																																			EMC1	-	-		0.418	EMC1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EMC1	HGNC	protein_coding	OTTHUMT00000007076.2	C	NM_015047		19545176	-1	no_errors	ENST00000480380	ensembl	human	known	70_37	rna	SNP	0.001	A
LINC01562	104054213	genome.wustl.edu	37	1	51662701	51662702	+	lincRNA	INS	-	-	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:51662701_51662702insA	ENST00000366181.2	-	0	430_431																		p.0?(2)									ctgtctctactaaaaaaaaaac	0.525																																																	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)																																										0																															1.37:g.51662711_51662711dupA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000366181.2	37	NULL		1																																																																																			RP11-296A18.3	-	-		0.525	RP11-296A18.3-001	KNOWN	basic	lincRNA	ENSG00000203356	Clone_based_vega_gene	lincRNA	OTTHUMT00000022441.1	-			51662702	-1	no_errors	ENST00000366181	ensembl	human	putative	70_37	rna	INS	0.000:0.001	A
EFCAB7	84455	genome.wustl.edu	37	1	63998408	63998408	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:63998408G>A	ENST00000371088.4	+	4	713	c.467G>A	c.(466-468)gGc>gAc	p.G156D	RN7SL488P_ENST00000585186.1_RNA	NM_032437.2	NP_115813.2	A8K855	EFCB7_HUMAN	EF-hand calcium binding domain 7	156	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.						calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|large_intestine(4)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	19						AATGCTGATGGCAAATTTGAC	0.308																																																	0													107.0	112.0	110.0					1																	63998408		2203	4297	6500	SO:0001583	missense	84455			BC015814	CCDS30737.1	1p31.3	2013-01-10			ENSG00000203965	ENSG00000203965		"""EF-hand domain containing"""	29379	protein-coding gene	gene with protein product						11347906	Standard	NM_032437		Approved	KIAA1799, RP4-534K7.1	uc001dbf.3	A8K855	OTTHUMG00000008983	ENST00000371088.4:c.467G>A	1.37:g.63998408G>A	ENSP00000360129:p.Gly156Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q658P0|Q96B95|Q96JM6	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.G156D	ENST00000371088.4	37	c.467	CCDS30737.1	1	.	.	.	.	.	.	.	.	.	.	G	23.4	4.407012	0.83230	.	.	ENSG00000203965	ENST00000371088	D	0.83837	-1.77	4.49	4.49	0.54785	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93851	0.8033	H	0.96996	3.92	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.95706	0.8753	9	.	.	.	-11.3376	17.7288	0.88371	0.0:0.0:1.0:0.0	.	156	A8K855	EFCB7_HUMAN	D	156	ENSP00000360129:G156D	.	G	+	2	0	EFCAB7	63770996	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.403000	0.90208	2.494000	0.84150	0.591000	0.81541	GGC	EFCAB7	-	smart_EF_hand_Ca-bd		0.308	EFCAB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB7	HGNC	protein_coding	OTTHUMT00000024910.1	G	NM_032437		63998408	+1	no_errors	ENST00000371088	ensembl	human	known	70_37	missense	SNP	1.000	A
LOC101927209	101927209	genome.wustl.edu	37	1	142634916	142634916	+	lincRNA	SNP	G	G	T	rs4127951	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:142634916G>T	ENST00000610091.1	-	0	5618				RP11-417J8.3_ENST00000426408.1_lincRNA																							gctctcagcagctgagagaga	0.577																																																	0																																												0																															1.37:g.142634916G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			AL583842.6	-	-		0.577	RP11-417J8.6-001	KNOWN	basic	lincRNA	ENSG00000203849	Clone_based_vega_gene	lincRNA	OTTHUMT00000037265.2	G			142634916	-1	no_errors	ENST00000369381	ensembl	human	known	70_37	rna	SNP	0.079	T
SNORA75	654321	genome.wustl.edu	37	4	17322423	17322423	+	RNA	SNP	C	C	T	rs572406570		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:17322423C>T	ENST00000384053.1	-	0	82									small nucleolar RNA, H/ACA box 75																		AGTAAAATAACGCTAGTTCTG	0.393													T|||	1	0.000199681	0.0	0.0	5008	,	,		19761	0.001		0.0	False		,,,				2504	0.0																0																																												0			AJ007015		2q37.1	2013-09-05			ENSG00000206885	ENSG00000206885		"""ncRNAs / Small nucleolar RNAs : H/ACA box containing"""	32661	non-coding RNA	RNA, small nucleolar						15199136, 16381836	Standard	NR_002921		Approved	U23	uc021quo.1				4.37:g.17322423C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000384053.1	37	NULL		4																																																																																			SNORA75	-	-		0.393	SNORA75.1-201	NOVEL	basic	snoRNA	ENSG00000206780	RFAM	snoRNA		C	NR_002921		17322423	-1	no_errors	ENST00000384053	ensembl	human	novel	70_37	rna	SNP	0.006	T
LOC284930	284930	genome.wustl.edu	37	22	48100490	48100490	+	lincRNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr22:48100490C>A	ENST00000423737.1	+	0	976																											AACCAAAAATCTGAAAGGTAT	0.448																																																	0																																												0																															22.37:g.48100490C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000423737.1	37	NULL		22																																																																																			RP11-191L9.4	-	-		0.448	RP11-191L9.4-001	KNOWN	basic	lincRNA	ENSG00000224271	Clone_based_vega_gene	lincRNA	OTTHUMT00000317556.1	C			48100490	+1	no_errors	ENST00000423737	ensembl	human	known	70_37	rna	SNP	0.000	A
RP11-165J3.6	0	genome.wustl.edu	37	9	96197732	96197732	+	RNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr9:96197732C>A	ENST00000445280.1	-	0	572																											tcttcttccccacctcctttt	0.567																																																	0																																												0																															9.37:g.96197732C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445280.1	37	NULL		9																																																																																			RP11-165J3.6	-	-		0.567	RP11-165J3.6-001	KNOWN	basic|exp_conf	antisense	ENSG00000227603	Clone_based_vega_gene	antisense	OTTHUMT00000053139.1	C			96197732	-1	no_errors	ENST00000445280	ensembl	human	known	70_37	rna	SNP	0.002	A
RALY	22913	genome.wustl.edu	37	20	32605249	32605249	+	Intron	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr20:32605249C>A	ENST00000246194.3	+	2	410				RP5-1125A11.4_ENST00000451556.2_lincRNA|RALY_ENST00000375114.3_Intron	NM_016732.2	NP_057951.1	Q9UKM9	RALY_HUMAN	RALY heterogeneous nuclear ribonucleoprotein						mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	12						ACAGACTGAACGGGAGCTCAG	0.478																																																	0																																										SO:0001627	intron_variant	0			AF148457	CCDS13229.1, CCDS13230.1	20q11.21-q11.23	2013-08-06	2013-08-06		ENSG00000125970	ENSG00000125970		"""RNA binding motif (RRM) containing"""	15921	protein-coding gene	gene with protein product		614663	"""RNA-binding protein (autoantigenic, hnRNP-associated with lethal yellow)"", ""RNA binding protein, autoantigenic (hnRNP-associated with lethal yellow homolog (mouse))"""			10500250, 23614458	Standard	NM_016732		Approved	P542, HNRPCL2	uc002xab.3	Q9UKM9	OTTHUMG00000032283	ENST00000246194.3:c.-92-14079C>A	20.37:g.32605249C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14621|Q2M365|Q5QPL8|Q9BQX6|Q9UJE3	RNA	SNP	-	NULL	ENST00000246194.3	37	NULL	CCDS13230.1	20																																																																																			RP5-1125A11.4	-	-		0.478	RALY-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000228386	Clone_based_vega_gene	protein_coding	OTTHUMT00000078753.1	C			32605249	-1	no_errors	ENST00000451556	ensembl	human	known	70_37	rna	SNP	0.004	A
AC009495.3	0	genome.wustl.edu	37	2	166695403	166695403	+	lincRNA	SNP	G	G	T	rs142274921|rs60500381|rs111419384	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:166695403G>T	ENST00000457108.1	-	0	205				AC009495.4_ENST00000428888.1_lincRNA																							agcttcctgaggctgctattc	0.473																																																	0																																												0																															2.37:g.166695403G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000457108.1	37	NULL		2																																																																																			AC009495.3	-	-		0.473	AC009495.3-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000232411	Clone_based_vega_gene	lincRNA	OTTHUMT00000333594.1	G			166695403	-1	no_errors	ENST00000457108	ensembl	human	known	70_37	rna	SNP	0.006	T
LOC101928797	101928797	genome.wustl.edu	37	9	120413195	120413195	+	lincRNA	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr9:120413195G>A	ENST00000450938.1	+	0	156																											caagtccatcgttttcccaaa	0.398																																																	0																																												0																															9.37:g.120413195G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000450938.1	37	NULL		9																																																																																			RP11-500B12.1	-	-		0.398	RP11-500B12.1-001	KNOWN	basic	lincRNA	ENSG00000233569	Clone_based_vega_gene	lincRNA	OTTHUMT00000053807.1	G			120413195	+1	no_errors	ENST00000450938	ensembl	human	known	70_37	rna	SNP	0.000	A
AC010982.2	0	genome.wustl.edu	37	2	114880821	114880821	+	lincRNA	SNP	G	G	A	rs536404076		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:114880821G>A	ENST00000450325.1	-	0	49																											CCCATTCAGCGGTTGCAACTC	0.453													G|||	1	0.000199681	0.0	0.0	5008	,	,		20646	0.0		0.001	False		,,,				2504	0.0																0																																												0																															2.37:g.114880821G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000450325.1	37	NULL		2																																																																																			AC010982.2	-	-		0.453	AC010982.2-001	KNOWN	basic	lincRNA	ENSG00000235242	Clone_based_vega_gene	lincRNA	OTTHUMT00000331498.1	G			114880821	-1	no_errors	ENST00000450325	ensembl	human	known	70_37	rna	SNP	0.000	A
ANKRD30A	91074	genome.wustl.edu	37	10	37598245	37598245	+	Intron	SNP	T	T	A	rs10827767	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr10:37598245T>A	ENST00000602533.1	+	37	4405				LINC00993_ENST00000426471.1_lincRNA			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A						regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GATTATTTTTTAAAAAAAAAA	0.348																																																	0																																										SO:0001627	intron_variant	0			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.4024-74742T>A	10.37:g.37598245T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W025	RNA	SNP	-	NULL	ENST00000602533.1	37	NULL		10																																																																																			RP11-20F24.4	-	-		0.348	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ENSG00000235687	Clone_based_vega_gene	protein_coding	OTTHUMT00000047588.2	T	NM_052997		37598245	+1	no_errors	ENST00000426471	ensembl	human	known	70_37	rna	SNP	0.000	A
AC016903.1	0	genome.wustl.edu	37	2	205334846	205334846	+	lincRNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:205334846C>A	ENST00000444017.1	-	0	540																											TAAAAAAAAACCCCAAGTTTC	0.353																																																	0																																												0																															2.37:g.205334846C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000444017.1	37	NULL		2																																																																																			AC016903.1	-	-		0.353	AC016903.1-001	KNOWN	basic	lincRNA	ENSG00000236634	Clone_based_vega_gene	lincRNA	OTTHUMT00000335869.1	C			205334846	-1	no_errors	ENST00000444017	ensembl	human	known	70_37	rna	SNP	0.221	A
PRPF31	26121	genome.wustl.edu	37	19	54626824	54626824	+	Intron	SNP	C	C	T	rs201443830		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:54626824C>T	ENST00000321030.4	+	6	769				PRPF31_ENST00000391755.1_Intron|PRPF31_ENST00000419967.1_Intron|PRPF31_ENST00000498612.1_Intron|AC012314.8_ENST00000452097.1_RNA	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31						mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTTCTCTGCTCGCCCCCAGGA	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		18136	0.001		0.0	False		,,,				2504	0.0																0													113.0	107.0	109.0					19																	54626824		2203	4300	6503	SO:0001627	intron_variant	0			AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.421-9C>T	19.37:g.54626824C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RB4|Q8N7F9|Q9H271|Q9Y439	RNA	SNP	-	NULL	ENST00000321030.4	37	NULL	CCDS12879.1	19																																																																																			AC012314.8	-	-		0.577	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237017	Clone_based_vega_gene	protein_coding	OTTHUMT00000141417.2	C			54626824	-1	no_errors	ENST00000452097	ensembl	human	known	70_37	rna	SNP	0.000	T
PRPF31	26121	genome.wustl.edu	37	19	54626824	54626824	+	Intron	SNP	C	C	T	rs201443830		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:54626824C>T	ENST00000321030.4	+	6	769				PRPF31_ENST00000391755.1_Intron|PRPF31_ENST00000419967.1_Intron|PRPF31_ENST00000498612.1_Intron|AC012314.8_ENST00000452097.1_RNA	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31						mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CTTCTCTGCTCGCCCCCAGGA	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		18136	0.001		0.0	False		,,,				2504	0.0																0													113.0	107.0	109.0					19																	54626824		2203	4300	6503	SO:0001627	intron_variant	0			AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.421-9C>T	19.37:g.54626824C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RB4|Q8N7F9|Q9H271|Q9Y439	RNA	SNP	-	NULL	ENST00000321030.4	37	NULL	CCDS12879.1	19																																																																																			AC012314.8	-	-		0.577	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000237017	Clone_based_vega_gene	protein_coding	OTTHUMT00000141417.2	C			54626824	-1	no_errors	ENST00000452097	ensembl	human	known	70_37	rna	SNP	0.000	T
AL590867.1	0	genome.wustl.edu	37	6	153625896	153625896	+	Intron	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr6:153625896G>T	ENST00000392385.2	+	2	169				RP11-475C16.2_ENST00000436953.1_lincRNA																							AGGAGGACTTGAACTTTCTGA	0.423																																																	0																																										SO:0001627	intron_variant	0																														ENST00000392385.2:c.-125+36477G>T	6.37:g.153625896G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000392385.2	37	NULL		6																																																																																			RP11-475C16.2	-	-		0.423	AL590867.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000237312	Clone_based_vega_gene	protein_coding		G			153625896	-1	no_errors	ENST00000436953	ensembl	human	known	70_37	rna	SNP	0.003	T
RP11-501O2.4	0	genome.wustl.edu	37	3	147913586	147913587	+	lincRNA	INS	-	-	A	rs548986209		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:147913586_147913587insA	ENST00000460324.1	-	0	607_608				RP11-501O2.3_ENST00000477153.1_lincRNA																							GCTCAGAGATGAAAAAAAAAAA	0.361																																																	0																																												0																															3.37:g.147913597_147913597dupA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000460324.1	37	NULL		3																																																																																			RP11-501O2.4	-	-		0.361	RP11-501O2.4-001	KNOWN	basic	lincRNA	ENSG00000243347	Clone_based_vega_gene	lincRNA	OTTHUMT00000355815.1	-			147913587	-1	no_errors	ENST00000460324	ensembl	human	known	70_37	rna	INS	0.000:0.000	A
RP11-167H9.4	0	genome.wustl.edu	37	3	149795466	149795466	+	RNA	SNP	A	A	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:149795466A>C	ENST00000487840.1	+	0	46				snoU13_ENST00000459123.1_lincRNA																							AGGACAAGTGAGTTTTAGCCT	0.463																																																	0																																												0																															3.37:g.149795466A>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000487840.1	37	NULL		3																																																																																			RP11-167H9.3	-	-		0.463	RP11-167H9.4-003	KNOWN	basic	antisense	ENSG00000243321	Clone_based_vega_gene	antisense	OTTHUMT00000357120.1	A			149795466	-1	no_errors	ENST00000464673	ensembl	human	known	70_37	rna	SNP	0.000	C
RP11-521D12.2	0	genome.wustl.edu	37	2	9814184	9814184	+	lincRNA	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:9814184G>A	ENST00000483023.1	+	0	33																											agaaggataagaggtggtcct	0.522																																																	0																																												0																															2.37:g.9814184G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000483023.1	37	NULL		2																																																																																			RP11-521D12.2	-	-		0.522	RP11-521D12.2-001	KNOWN	basic	lincRNA	ENSG00000244260	Clone_based_vega_gene	lincRNA	OTTHUMT00000353415.1	G			9814184	+1	no_errors	ENST00000483023	ensembl	human	known	70_37	rna	SNP	0.000	A
RP11-281P23.2	0	genome.wustl.edu	37	4	11791462	11791462	+	lincRNA	SNP	G	G	A	rs572452770		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:11791462G>A	ENST00000509244.1	+	0	719																											CTGAAGATTCGGATGCAATAA	0.308																																																	0																																												0																															4.37:g.11791462G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000509244.1	37	NULL		4																																																																																			RP11-281P23.2	-	-		0.308	RP11-281P23.2-009	KNOWN	basic|exp_conf	lincRNA	ENSG00000249631	Clone_based_vega_gene	lincRNA	OTTHUMT00000359058.2	G			11791462	+1	no_errors	ENST00000509244	ensembl	human	known	70_37	rna	SNP	0.000	A
MAPK10	5602	genome.wustl.edu	37	4	87048808	87048808	+	Intron	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:87048808C>A	ENST00000359221.3	-	5	763				MAPK10_ENST00000449047.2_Intron|MAPK10_ENST00000395161.2_Intron|RP11-778J15.1_ENST00000511917.1_RNA|MAPK10_ENST00000513839.1_Intron|RP11-778J15.1_ENST00000509322.1_RNA|MAPK10_ENST00000395166.1_Intron|MAPK10_ENST00000395169.3_Intron|MAPK10_ENST00000361569.2_Intron			P53779	MK10_HUMAN	mitogen-activated protein kinase 10						activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|JUN phosphorylation (GO:0007258)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|JUN kinase activity (GO:0004705)|MAP kinase kinase activity (GO:0004708)			breast(1)|central_nervous_system(1)|stomach(1)	3		Hepatocellular(203;0.114)|all_hematologic(202;0.21)|Acute lymphoblastic leukemia(40;0.243)		OV - Ovarian serous cystadenocarcinoma(123;0.002)		tgcaacttccctgcctggccc	0.403																																																	0																																										SO:0001627	intron_variant	0			U07620	CCDS3612.1, CCDS3613.1, CCDS34026.1, CCDS43247.1	4q22-q23	2011-06-09			ENSG00000109339	ENSG00000109339	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6872	protein-coding gene	gene with protein product		602897		PRKM10		8654373, 12436199	Standard	NM_002753		Approved	JNK3, p493F12, p54bSAPK	uc003hpt.3	P53779	OTTHUMG00000130604	ENST00000359221.3:c.237-20303G>T	4.37:g.87048808C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFS3|A6NG28|B3KQ94|Q15707|Q49AP1	RNA	SNP	-	NULL	ENST00000359221.3	37	NULL	CCDS34026.1	4																																																																																			RP11-778J15.1	-	-		0.403	MAPK10-012	KNOWN	basic|CCDS	protein_coding	ENSG00000250062	Clone_based_vega_gene	protein_coding	OTTHUMT00000361363.2	C			87048808	+1	no_errors	ENST00000509322	ensembl	human	known	70_37	rna	SNP	0.001	A
LINC00937	389634	genome.wustl.edu	37	12	8449406	8449407	+	lincRNA	INS	-	-	G	rs369087098|rs554243900		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:8449406_8449407insG	ENST00000544461.1	-	0	2207_2208									long intergenic non-protein coding RNA 937																		tacaatgccccgacaactccca	0.495													|||unknown(NO_COVERAGE)	2962	0.591454	0.3918	0.5749	5008	,	,		7772	0.5843		0.7813	False		,,,				2504	0.6851																0																																												0			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8449407_8449407dupG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			RP11-90D4.1	-	-		0.495	LINC00937-001	KNOWN	basic	lincRNA	ENSG00000250937	Clone_based_vega_gene	lincRNA	OTTHUMT00000400511.1	-			8449407	+1	no_errors	ENST00000509919	ensembl	human	known	70_37	rna	INS	0.003:0.005	G
CHCHD3	54927	genome.wustl.edu	37	7	132767687	132767688	+	5'Flank	INS	-	-	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:132767687_132767688insA	ENST00000262570.5	-	0	0				CHCHD3_ENST00000448878.1_5'Flank|U6_ENST00000605893.1_RNA|CHCHD3_ENST00000476546.1_5'Flank|CHCHD3_ENST00000542753.1_5'Flank	NM_017812.2	NP_060282.1	Q9NX63	MIC19_HUMAN	coiled-coil-helix-coiled-coil-helix domain containing 3						inner mitochondrial membrane organization (GO:0007007)|mitochondrial fusion (GO:0008053)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	phosphatase binding (GO:0019902)|protein complex scaffold (GO:0032947)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	7						agcattccattaaaaaaaaaat	0.401																																																	0																																										SO:0001631	upstream_gene_variant	0			BC011596	CCDS5828.1	7q33	2012-10-02			ENSG00000106554	ENSG00000106554		"""Coiled-coil-helix-coiled-coil-helix domain containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	21906	protein-coding gene	gene with protein product	"""mitochondrial inner membrane organizing system 3"", ""protein phosphatase 1, regulatory subunit 22"""	613748				22252321, 23019327, 21081504, 17624330	Standard	NM_017812		Approved	FLJ20420, MINOS3, PPP1R22	uc003vre.3	Q9NX63	OTTHUMG00000155231		7.37:g.132767697_132767697dupA	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000262570.5	37	NULL	CCDS5828.1	7																																																																																			U6	-	-		0.401	CHCHD3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000251736	RFAM	protein_coding	OTTHUMT00000338899.1	-	NM_017812		132767688	+1	no_errors	ENST00000515927	ensembl	human	novel	70_37	rna	INS	0.001:0.013	A
LINC01419	103352670	genome.wustl.edu	37	8	84321053	84321053	+	lincRNA	SNP	A	A	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr8:84321053A>G	ENST00000522365.1	+	0	1439																											ataaatctgcacttgttaact	0.328																																																	0																																												0																															8.37:g.84321053A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000522365.1	37	NULL		8																																																																																			RP11-51M18.1	-	-		0.328	RP11-51M18.1-001	KNOWN	basic	lincRNA	ENSG00000253898	Clone_based_vega_gene	lincRNA	OTTHUMT00000379379.1	A			84321053	+1	no_errors	ENST00000522365	ensembl	human	known	70_37	rna	SNP	0.000	G
LOC101928989	101928989	genome.wustl.edu	37	11	82314838	82314838	+	lincRNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:82314838C>A	ENST00000527364.1	-	0	686																											TGGATTTCTTCCCTCAGCACC	0.328																																																	0																																												0																															11.37:g.82314838C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000527364.1	37	NULL		11																																																																																			RP11-179A16.2	-	-		0.328	RP11-179A16.2-001	KNOWN	basic	lincRNA	ENSG00000255246	Clone_based_vega_gene	lincRNA	OTTHUMT00000391625.1	C			82314838	-1	no_errors	ENST00000527364	ensembl	human	known	70_37	rna	SNP	0.000	A
MRGPRF	116535	genome.wustl.edu	37	11	68779822	68779822	+	Intron	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:68779822G>T	ENST00000309099.6	-	1	327				MRGPRF_ENST00000320913.6_Intron|RP11-554A11.6_ENST00000569428.1_RNA|RP11-554A11.6_ENST00000569432.1_RNA|MRGPRF_ENST00000441623.1_Intron|RP11-554A11.6_ENST00000538407.2_RNA	NM_145015.4	NP_659452.3	Q96AM1	MRGRF_HUMAN	MAS-related GPR, member F							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(3)|lung(4)	7			STAD - Stomach adenocarcinoma(18;0.0208)|LUAD - Lung adenocarcinoma(13;0.0713)			TTAGCCGCTTGTGCCGCCATC	0.637																																																	0																																										SO:0001627	intron_variant	0			AK075492	CCDS8188.1	11q13.1	2014-03-13	2004-03-25		ENSG00000172935	ENSG00000172935		"""GPCR / Class A : Orphans"""	24828	protein-coding gene	gene with protein product		607233	"""G protein-coupled receptor 168"", ""G protein-coupled receptor 140"""	GPR168, GPR140		12477932	Standard	NM_001098515		Approved	MGC21621, mrgF	uc001oop.4	Q96AM1	OTTHUMG00000167897	ENST00000309099.6:c.55+728C>A	11.37:g.68779822G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KV43|Q8NBK8	RNA	SNP	-	NULL	ENST00000309099.6	37	NULL	CCDS8188.1	11																																																																																			RP11-554A11.6	-	-		0.637	MRGPRF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000256508	Clone_based_vega_gene	protein_coding	OTTHUMT00000396875.1	G	NM_145015		68779822	+1	no_errors	ENST00000569428	ensembl	human	known	70_37	rna	SNP	0.000	T
LOC646522	646522	genome.wustl.edu	37	11	133670193	133670193	+	lincRNA	SNP	A	A	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:133670193A>T	ENST00000526254.1	-	0	121																											gagcaggcccaccgctgctgt	0.517																																																	0																																												0																															11.37:g.133670193A>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000526254.1	37	NULL		11																																																																																			RP11-448P19.1	-	-		0.517	RP11-448P19.1-001	KNOWN	basic	lincRNA	ENSG00000255258	Clone_based_vega_gene	lincRNA	OTTHUMT00000393279.1	A			133670193	-1	no_errors	ENST00000530621	ensembl	human	known	70_37	rna	SNP	0.000	T
RP11-116N8.2	0	genome.wustl.edu	37	14	36417045	36417045	+	lincRNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr14:36417045C>A	ENST00000548199.1	-	0	265				RP11-116N8.1_ENST00000550089.1_RNA																							gtttcagaacctagaccacaa	0.378																																																	0																																												0																															14.37:g.36417045C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000548199.1	37	NULL		14																																																																																			RP11-116N8.2	-	-		0.378	RP11-116N8.2-001	KNOWN	basic	lincRNA	ENSG00000257614	Clone_based_vega_gene	lincRNA	OTTHUMT00000409616.1	C			36417045	-1	no_errors	ENST00000548199	ensembl	human	known	70_37	rna	SNP	0.000	A
CRAT37	101926928	genome.wustl.edu	37	15	92037034	92037034	+	lincRNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr15:92037034C>A	ENST00000554333.1	+	0	1094																											aatgatagtgcaaaagatgag	0.294																																																	0																																												0																															15.37:g.92037034C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000554333.1	37	NULL		15																																																																																			RP11-661P17.1	-	-		0.294	RP11-661P17.1-001	KNOWN	basic	lincRNA	ENSG00000258551	Clone_based_vega_gene	lincRNA	OTTHUMT00000414799.1	C			92037034	+1	no_errors	ENST00000554333	ensembl	human	known	70_37	rna	SNP	0.013	A
DNM1P47	100216544	genome.wustl.edu	37	15	102304296	102304296	+	RNA	SNP	A	A	C	rs201468051	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr15:102304296A>C	ENST00000561463.1	+	0	12342									DNM1 pseudogene 47																		TGGGAACGAGAAGACACTCGT	0.587																																																	0																																												0			AJ576276		15q26.3	2013-04-25			ENSG00000259660	ENSG00000259660			35200	pseudogene	pseudogene				DNM1DN14@			Standard	NG_009149		Approved	DNM1DN14-3			OTTHUMG00000172265		15.37:g.102304296A>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000561463.1	37	NULL		15	.	.	.	.	.	.	.	.	.	.	.	0.118	-1.128831	0.01756	.	.	ENSG00000223778	ENST00000455423	.	.	.	1.39	1.39	0.22231	.	.	.	.	.	T	0.39835	0.1093	.	.	.	.	.	.	.	.	.	.	.	.	T	0.47182	-0.9137	4	0.38643	T	0.18	.	5.0323	0.14417	1.0:0.0:0.0:0.0	.	.	.	.	A	115	.	ENSP00000387556:E115A	E	+	2	0	AC107977.1	100121819	1.000000	0.71417	0.998000	0.56505	0.081000	0.17604	2.068000	0.41471	0.919000	0.36945	0.055000	0.15244	GAA	CTD-2611K5.6	-	-		0.587	DNM1P47-001	KNOWN	basic	processed_transcript	ENSG00000259660	Clone_based_vega_gene	pseudogene	OTTHUMT00000417589.1	A	NG_009149		102304296	+1	no_errors	ENST00000561463	ensembl	human	known	70_37	rna	SNP	0.999	C
RP11-467J12.4	0	genome.wustl.edu	37	16	53069821	53069821	+	RNA	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:53069821G>A	ENST00000562178.1	-	0	244																											gagctgcagtgagctgtgatc	0.473																																																	0																																												0																															16.37:g.53069821G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000562178.1	37	NULL		16																																																																																			RP11-467J12.4	-	-		0.473	RP11-467J12.4-001	KNOWN	basic	antisense	ENSG00000261550	Clone_based_vega_gene	antisense	OTTHUMT00000422336.1	G			53069821	-1	no_errors	ENST00000562178	ensembl	human	known	70_37	rna	SNP	0.031	A
RP11-283I3.6	0	genome.wustl.edu	37	12	385707	385707	+	RNA	SNP	G	G	A	rs370265433		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:385707G>A	ENST00000570140.1	-	0	582																											tgagcgagctgAGACTGTTGA	0.468																																																	0																																												0																															12.37:g.385707G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000570140.1	37	NULL		12																																																																																			RP11-283I3.6	-	-		0.468	RP11-283I3.6-001	KNOWN	basic	sense_overlapping	ENSG00000261799	Clone_based_vega_gene	sense_overlapping	OTTHUMT00000421260.1	G			385707	-1	no_errors	ENST00000570140	ensembl	human	known	70_37	rna	SNP	0.000	A
LOC100130950	100130950	genome.wustl.edu	37	17	5144336	5144337	+	lincRNA	INS	-	-	A	rs55645980|rs55819905		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:5144336_5144337insA	ENST00000575056.1	-	0	338				RP11-333E1.1_ENST00000573772.1_RNA																							atccatccaccttgtgacatgt	0.49																																																	0																																												0																															17.37:g.5144336_5144337insA		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	INS	-	NULL	ENST00000575056.1	37	c.NULL		17																																																																																			RP11-333E1.2	-	-		0.490	RP11-333E1.2-001	KNOWN	basic	lincRNA	ENSG00000263164	Clone_based_vega_gene	lincRNA	OTTHUMT00000439347.1	-			5144337	-1	no_errors	ENST00000575056	ensembl	human	known	70_37	splice_site_ins	INS	0.000:0.000	A
LOC100130950	100130950	genome.wustl.edu	37	17	5144337	5144337	+	lincRNA	SNP	T	T	C	rs55645980		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:5144337T>C	ENST00000575056.1	-	0	338				RP11-333E1.1_ENST00000573772.1_RNA																							tccatccaccttgtgacatgt	0.488																																																	0																																												0																															17.37:g.5144337T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	SNP	-	NULL	ENST00000575056.1	37	c.NULL		17																																																																																			RP11-333E1.2	-	-		0.488	RP11-333E1.2-001	KNOWN	basic	lincRNA	ENSG00000263164	Clone_based_vega_gene	lincRNA	OTTHUMT00000439347.1	T			5144337	-1	no_errors	ENST00000575056	ensembl	human	known	70_37	splice_site	SNP	0.000	C
RP11-642M2.1	0	genome.wustl.edu	37	17	33185972	33185972	+	lincRNA	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:33185972G>T	ENST00000579327.1	-	0	93																											ctgtcggtctgaccagtgggg	0.572																																																	0																																												0																															17.37:g.33185972G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000579327.1	37	NULL		17																																																																																			RP11-642M2.1	-	-		0.572	RP11-642M2.1-001	KNOWN	basic	lincRNA	ENSG00000264622	Clone_based_vega_gene	lincRNA	OTTHUMT00000448012.1	G			33185972	-1	no_errors	ENST00000579327	ensembl	human	known	70_37	rna	SNP	0.005	T
TBC1D29	26083	genome.wustl.edu	37	17	28885217	28885217	+	5'UTR	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:28885217C>A	ENST00000580161.1	+	0	1088				RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_5'Flank|TBC1D29_ENST00000584297.1_5'Flank			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29								Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				ATCTGCACAACACAAACCAAA	0.453																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.-1410C>A	17.37:g.28885217C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000580161.1	37	NULL	CCDS32606.1	17																																																																																			RP11-218M11.6	-	-		0.453	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000266775	Clone_based_vega_gene	protein_coding	OTTHUMT00000443632.1	C	NM_015594		28885217	-1	no_errors	ENST00000582125	ensembl	human	known	70_37	rna	SNP	0.006	A
TBC1D29	26083	genome.wustl.edu	37	17	28885247	28885247	+	5'UTR	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:28885247C>T	ENST00000580161.1	+	0	1118				RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_5'Flank|TBC1D29_ENST00000584297.1_5'Flank			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29								Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				CTCTGTTTCCCAGGCAGCAGG	0.448																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.-1380C>T	17.37:g.28885247C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000580161.1	37	NULL	CCDS32606.1	17																																																																																			RP11-218M11.6	-	-		0.448	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000266775	Clone_based_vega_gene	protein_coding	OTTHUMT00000443632.1	C	NM_015594		28885247	-1	no_errors	ENST00000582125	ensembl	human	known	70_37	rna	SNP	0.792	T
TBC1D29	26083	genome.wustl.edu	37	17	28885255	28885255	+	5'UTR	SNP	A	A	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:28885255A>G	ENST00000580161.1	+	0	1126				RP11-218M11.6_ENST00000582125.1_RNA|TBC1D29_ENST00000579181.1_5'Flank|TBC1D29_ENST00000584297.1_5'Flank			Q9UFV1	TBC29_HUMAN	TBC1 domain family, member 29								Rab GTPase activator activity (GO:0005097)			breast(1)|kidney(1)|lung(3)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	9		Myeloproliferative disorder(56;0.0255)				CCCAGGCAGCAGGAACTATTC	0.463																																																	0																																										SO:0001623	5_prime_UTR_variant	0			BC096718	CCDS32606.1	17q11.2	2014-09-04			ENSG00000266733	ENSG00000266733			24509	protein-coding gene	gene with protein product						12618308	Standard	XM_006721805		Approved	DKFZP434O047	uc002hfh.3	Q9UFV1	OTTHUMG00000178857	ENST00000580161.1:c.-1372A>G	17.37:g.28885255A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000580161.1	37	NULL	CCDS32606.1	17																																																																																			RP11-218M11.6	-	-		0.463	TBC1D29-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000266775	Clone_based_vega_gene	protein_coding	OTTHUMT00000443632.1	A	NM_015594		28885255	-1	no_errors	ENST00000582125	ensembl	human	known	70_37	rna	SNP	1.000	G
DYNLL2	140735	genome.wustl.edu	37	17	56157804	56157804	+	5'Flank	SNP	A	A	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:56157804A>G	ENST00000579991.2	+	0	0				RP11-159D12.10_ENST00000584805.1_lincRNA	NM_080677.2	NP_542408.1	Q96FJ2	DYL2_HUMAN	dynein, light chain, LC8-type 2						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|apoptotic process (GO:0006915)|intrinsic apoptotic signaling pathway (GO:0097193)|microtubule-based process (GO:0007017)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|synaptic target recognition (GO:0008039)|transport (GO:0006810)	centrosome (GO:0005813)|cytosol (GO:0005829)|dynein complex (GO:0030286)|membrane (GO:0016020)|microtubule (GO:0005874)|myosin complex (GO:0016459)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	motor activity (GO:0003774)			lung(3)	3						aaaggtcagaatccatgcatt	0.443																																																	0																																										SO:0001631	upstream_gene_variant	0			AF112997	CCDS11601.1	17q23.2	2009-11-18				ENSG00000264364		"""Cytoplasmic dyneins"""	24596	protein-coding gene	gene with protein product	"""radial spoke 22 homolog (Chlamydomonas)"""	608942				16260502	Standard	NM_080677		Approved	MGC17810, Dlc2, DNCL1B, RSPH22	uc010wnn.1	Q96FJ2			17.37:g.56157804A>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5B4	RNA	SNP	-	NULL	ENST00000579991.2	37	NULL	CCDS11601.1	17																																																																																			RP11-159D12.10	-	-		0.443	DYNLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266290	Clone_based_vega_gene	protein_coding	OTTHUMT00000443338.2	A	NM_080677		56157804	-1	no_errors	ENST00000584805	ensembl	human	known	70_37	rna	SNP	0.635	G
CTC-360P9.1	0	genome.wustl.edu	37	19	32377616	32377616	+	lincRNA	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:32377616G>A	ENST00000592270.1	-	0	529																											TCATGGTTTTGAGCGAACACG	0.403																																																	0																																												0																															19.37:g.32377616G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000592270.1	37	NULL		19																																																																																			CTC-360P9.1	-	-		0.403	CTC-360P9.1-001	KNOWN	basic	lincRNA	ENSG00000267012	Clone_based_vega_gene	lincRNA	OTTHUMT00000450342.1	G			32377616	-1	no_errors	ENST00000592270	ensembl	human	known	70_37	rna	SNP	0.036	A
ATP6V0A1	535	genome.wustl.edu	37	17	40648558	40648559	+	Intron	INS	-	-	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:40648558_40648559insA	ENST00000343619.4	+	14	1683				ATP6V0A1_ENST00000585525.1_Intron|ATP6V0A1_ENST00000546249.1_Intron|MIR548AT_ENST00000578714.1_RNA|ATP6V0A1_ENST00000393829.2_Intron|ATP6V0A1_ENST00000264649.6_Intron|RP11-194N12.2_ENST00000591343.1_RNA|ATP6V0A1_ENST00000537728.1_Intron|ATP6V0A1_ENST00000544137.1_Intron	NM_001130021.1	NP_001123493.1	Q93050	VPP1_HUMAN	ATPase, H+ transporting, lysosomal V0 subunit a1						ATP hydrolysis coupled proton transport (GO:0015991)|cellular iron ion homeostasis (GO:0006879)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|phagosome maturation (GO:0090382)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)|vacuolar proton-transporting V-type ATPase, V0 domain (GO:0000220)	ATPase binding (GO:0051117)|hydrogen ion transmembrane transporter activity (GO:0015078)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(8)|pancreas(1)|prostate(1)|urinary_tract(3)	26		all_cancers(22;1.18e-05)|Breast(137;0.000105)|all_epithelial(22;0.000254)		BRCA - Breast invasive adenocarcinoma(366;0.137)		GACTGCTGAGGAAAAAAAAAAA	0.446																																																	0																																										SO:0001627	intron_variant	0			U73006	CCDS11426.1, CCDS45683.1, CCDS45684.1	17q21	2010-04-21	2006-01-20	2002-05-10	ENSG00000033627	ENSG00000033627		"""ATPases / V-type"""	865	protein-coding gene	gene with protein product		192130	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump) non-catalytic accessory protein 1A (110/116kD)"", ""ATPase, H+ transporting, lysosomal V0 subunit a isoform 1"", ""ATPase, H+ transporting, lysosomal V0 subunit A1"""	VPP1, ATP6N1, ATP6N1A		7774924	Standard	NM_001130020		Approved	a1, Vph1, Stv1	uc002hzs.3	Q93050		ENST00000343619.4:c.1560+824->A	17.37:g.40648569_40648569dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z3B7|Q8N5G7|Q9NSX0	RNA	INS	-	NULL	ENST00000343619.4	37	NULL	CCDS45684.1	17																																																																																			RP11-194N12.2	-	-		0.446	ATP6V0A1-006	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000267222	Clone_based_vega_gene	protein_coding	OTTHUMT00000450364.1	-	NM_001130020		40648559	+1	no_errors	ENST00000591343	ensembl	human	known	70_37	rna	INS	0.001:0.001	A
EVC2	132884	genome.wustl.edu	37	4	5620291	5620291	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:5620291G>A	ENST00000344408.5	-	15	2673	c.2620C>T	c.(2620-2622)Cga>Tga	p.R874*	EVC2_ENST00000310917.2_Nonsense_Mutation_p.R794*|EVC2_ENST00000344938.1_Nonsense_Mutation_p.R874*	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	874					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						AGCAGAACTCGGGCCCGGATC	0.607																																																	0													45.0	43.0	44.0					4																	5620291		2203	4300	6503	SO:0001587	stop_gained	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2620C>T	4.37:g.5620291G>A	ENSP00000342144:p.Arg874*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86YT3|Q86YT4|Q8NG49	Nonsense_Mutation	SNP	pfam_Limbin	p.R874*	ENST00000344408.5	37	c.2620	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	G	47	13.422608	0.99741	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	.	.	.	5.3	4.4	0.53042	.	0.162902	0.42420	D	0.000714	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9061	12.4056	0.55439	0.0:0.0:0.8311:0.1689	.	.	.	.	X	874;794;874	.	ENSP00000311683:R794X	R	-	1	2	EVC2	5671192	0.987000	0.35691	0.998000	0.56505	0.966000	0.64601	2.503000	0.45407	2.488000	0.83962	0.655000	0.94253	CGA	EVC2	-	NULL		0.607	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	G	NM_147127		5620291	-1	no_errors	ENST00000344408	ensembl	human	known	70_37	nonsense	SNP	0.988	A
EVC2	132884	genome.wustl.edu	37	4	5620291	5620291	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:5620291G>A	ENST00000344408.5	-	15	2673	c.2620C>T	c.(2620-2622)Cga>Tga	p.R874*	EVC2_ENST00000310917.2_Nonsense_Mutation_p.R794*|EVC2_ENST00000344938.1_Nonsense_Mutation_p.R874*	NM_147127.4	NP_667338.3	Q86UK5	LBN_HUMAN	Ellis van Creveld syndrome 2	874					smoothened signaling pathway (GO:0007224)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				NS(2)|breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(32)|lung(28)|ovary(4)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(2)	81						AGCAGAACTCGGGCCCGGATC	0.607																																																	0													45.0	43.0	44.0					4																	5620291		2203	4300	6503	SO:0001587	stop_gained	132884			AB083067	CCDS3382.2, CCDS54718.1	4p16.2-p16.1	2008-08-01	2008-08-01		ENSG00000173040	ENSG00000173040			19747	protein-coding gene	gene with protein product		607261				12136126, 12571802	Standard	NM_147127		Approved	LBN	uc003gij.3	Q86UK5	OTTHUMG00000125493	ENST00000344408.5:c.2620C>T	4.37:g.5620291G>A	ENSP00000342144:p.Arg874*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86YT3|Q86YT4|Q8NG49	Nonsense_Mutation	SNP	pfam_Limbin	p.R874*	ENST00000344408.5	37	c.2620	CCDS3382.2	4	.	.	.	.	.	.	.	.	.	.	G	47	13.422608	0.99741	.	.	ENSG00000173040	ENST00000344938;ENST00000310917;ENST00000344408	.	.	.	5.3	4.4	0.53042	.	0.162902	0.42420	D	0.000714	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-18.9061	12.4056	0.55439	0.0:0.0:0.8311:0.1689	.	.	.	.	X	874;794;874	.	ENSP00000311683:R794X	R	-	1	2	EVC2	5671192	0.987000	0.35691	0.998000	0.56505	0.966000	0.64601	2.503000	0.45407	2.488000	0.83962	0.655000	0.94253	CGA	EVC2	-	NULL		0.607	EVC2-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EVC2	HGNC	protein_coding	OTTHUMT00000289822.2	G	NM_147127		5620291	-1	no_errors	ENST00000344408	ensembl	human	known	70_37	nonsense	SNP	0.988	A
FADS1	3992	genome.wustl.edu	37	11	61574164	61574164	+	Nonsense_Mutation	SNP	G	G	T	rs76232633		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:61574164G>T	ENST00000350997.7	-	6	1180	c.948C>A	c.(946-948)taC>taA	p.Y316*	FADS1_ENST00000433932.1_Nonsense_Mutation_p.Y175*|FADS1_ENST00000536991.1_5'Flank|FADS1_ENST00000542506.1_Nonsense_Mutation_p.Y175*|FADS1_ENST00000460649.1_5'Flank|FADS2_ENST00000574708.1_Intron	NM_013402.4	NP_037534.3	O60427	FADS1_HUMAN	fatty acid desaturase 1	259					alpha-linolenic acid metabolic process (GO:0036109)|cell-cell signaling (GO:0007267)|cellular lipid metabolic process (GO:0044255)|cellular response to starvation (GO:0009267)|icosanoid biosynthetic process (GO:0046456)|linoleic acid metabolic process (GO:0043651)|phospholipid biosynthetic process (GO:0008654)|regulation of cell differentiation (GO:0045595)|regulation of transcription, DNA-templated (GO:0006355)|small molecule metabolic process (GO:0044281)|unsaturated fatty acid biosynthetic process (GO:0006636)|unsaturated fatty acid metabolic process (GO:0033559)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)	C-5 sterol desaturase activity (GO:0000248)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxidoreductase activity (GO:0016491)			central_nervous_system(1)|endometrium(1)|lung(1)|urinary_tract(1)	4					Alpha-Linolenic Acid(DB00132)|Icosapent(DB00159)	GCTGGTGGTTGTACGGCATAT	0.488																																																	0													259.0	253.0	255.0					11																	61574164		2018	4185	6203	SO:0001587	stop_gained	3992				CCDS8011.2	11q12-q13.1	2013-01-25			ENSG00000149485	ENSG00000149485	1.14.19.3	"""Fatty acid desaturases"""	3574	protein-coding gene	gene with protein product	"""delta-5 desaturase"""	606148		LLCDL1			Standard	NM_013402		Approved	D5D, FADSD5, TU12, FADS6	uc010rlm.2	O60427	OTTHUMG00000157155	ENST00000350997.7:c.948C>A	11.37:g.61574164G>T	ENSP00000322229:p.Tyr316*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0I7|B2RAI0|Q53GM5|Q8N3A6|Q8NCC7|Q8NCG0|Q96I39|Q96SV3|Q96T10|Q9NRP8|Q9NYX1	Nonsense_Mutation	SNP	pfam_Fatty_acid_desaturase-1,pfam_Cyt_B5,superfamily_Cyt_B5,pirsf_Fatty_acid/sphinglp_desaturase,pfscan_Cyt_B5,prints_Cyt_B5	p.Y316*	ENST00000350997.7	37	c.948	CCDS8011.2	11	.	.	.	.	.	.	.	.	.	.	G	21.4	4.148794	0.78001	.	.	ENSG00000149485	ENST00000543488;ENST00000350997;ENST00000412725;ENST00000433932;ENST00000542506;ENST00000539999	.	.	.	4.75	2.83	0.33086	.	0.429492	0.17571	U	0.169466	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-25.0361	9.3959	0.38401	0.2402:0.0:0.7598:0.0	.	.	.	.	X	192;316;175;175;175;45	.	ENSP00000322229:Y316X	Y	-	3	2	FADS1	61330740	1.000000	0.71417	0.983000	0.44433	0.016000	0.09150	1.214000	0.32419	1.141000	0.42275	-0.150000	0.13652	TAC	FADS1	-	pfam_Fatty_acid_desaturase-1,pirsf_Fatty_acid/sphinglp_desaturase		0.488	FADS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FADS1	HGNC	protein_coding	OTTHUMT00000347648.2	G	NM_013402		61574164	-1	no_errors	ENST00000350997	ensembl	human	known	70_37	nonsense	SNP	1.000	T
FAM83G	644815	genome.wustl.edu	37	17	18882969	18882969	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:18882969G>T	ENST00000388995.6	-	4	931	c.708C>A	c.(706-708)agC>agA	p.S236R	SLC5A10_ENST00000395645.3_Intron|FAM83G_ENST00000585154.2_Missense_Mutation_p.S236R|SLC5A10_ENST00000395643.2_Intron|SLC5A10_ENST00000395647.2_Intron|FAM83G_ENST00000345041.4_Missense_Mutation_p.S236R|SLC5A10_ENST00000417251.2_Intron|SLC5A10_ENST00000395642.1_Intron|SLC5A10_ENST00000317977.6_Intron			A6ND36	FA83G_HUMAN	family with sequence similarity 83, member G	236					BMP signaling pathway (GO:0030509)	cytosol (GO:0005829)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(3)|lung(7)|ovary(2)|prostate(3)|stomach(1)	22						TTCCCCCGCTGCTCCGCACTC	0.597																																																	0													79.0	92.0	88.0					17																	18882969		2017	4174	6191	SO:0001583	missense	644815			AK123558	CCDS42276.1	17p11.2	2014-05-01	2006-03-22		ENSG00000188522	ENSG00000188522			32554	protein-coding gene	gene with protein product	"""protein associated with SMAD1"""	615886				24554596	Standard	NM_001039999		Approved	FLJ41564, PAWS1	uc002guw.3	A6ND36	OTTHUMG00000059411	ENST00000388995.6:c.708C>A	17.37:g.18882969G>T	ENSP00000373647:p.Ser236Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KQZ4|Q6ZW60	Missense_Mutation	SNP	pfam_DUF1669	p.S236R	ENST00000388995.6	37	c.708	CCDS42276.1	17	.	.	.	.	.	.	.	.	.	.	G	14.05	2.420375	0.42918	.	.	ENSG00000188522	ENST00000388995;ENST00000345041;ENST00000399096	T;T	0.13657	2.57;2.57	5.54	4.57	0.56435	.	0.137010	0.64402	D	0.000003	T	0.34948	0.0915	M	0.77486	2.375	0.43230	D	0.995123	D	0.76494	0.999	D	0.72982	0.979	T	0.05550	-1.0878	10	0.72032	D	0.01	-30.7527	10.2471	0.43347	0.0736:0.1376:0.7888:0.0	.	236	A6ND36	FA83G_HUMAN	R	236	ENSP00000373647:S236R;ENSP00000343279:S236R	ENSP00000343279:S236R	S	-	3	2	FAM83G	18823694	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	4.093000	0.57714	2.606000	0.88127	0.655000	0.94253	AGC	FAM83G	-	pfam_DUF1669		0.597	FAM83G-002	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM83G	HGNC	protein_coding	OTTHUMT00000253108.4	G			18882969	-1	no_errors	ENST00000345041	ensembl	human	known	70_37	missense	SNP	1.000	T
FGF21	26291	genome.wustl.edu	37	19	49261353	49261353	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:49261353G>T	ENST00000593756.1	+	4	1078	c.506G>T	c.(505-507)gGc>gTc	p.G169V	FUT1_ENST00000310160.3_5'Flank|FGF21_ENST00000222157.3_Missense_Mutation_p.G169V			Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21	169					cell-cell signaling (GO:0007267)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|regulation of low-density lipoprotein particle clearance (GO:0010988)|signal transduction (GO:0007165)	extracellular region (GO:0005576)				breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCACTACCAGGCCTGCCCCCC	0.716																																																	0													15.0	21.0	19.0					19																	49261353		2177	4276	6453	SO:0001583	missense	26291			AB021975	CCDS12734.1	19q13.33	2012-09-20			ENSG00000105550	ENSG00000105550			3678	protein-coding gene	gene with protein product		609436				10858549	Standard	XM_005258731		Approved		uc002pko.1	Q9NSA1		ENST00000593756.1:c.506G>T	19.37:g.49261353G>T	ENSP00000471477:p.Gly169Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N683	Missense_Mutation	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,pirsf_Fibroblast_GF_15/19/21,prints_GF_heparin-bd,prints_IL1_HBGF	p.G169V	ENST00000593756.1	37	c.506	CCDS12734.1	19	.	.	.	.	.	.	.	.	.	.	G	13.63	2.295922	0.40594	.	.	ENSG00000105550	ENST00000222157	D	0.84800	-1.9	4.44	4.44	0.53790	.	0.312361	0.30723	N	0.009005	D	0.84293	0.5440	N	0.24115	0.695	0.58432	D	0.999998	D	0.89917	1.0	D	0.69654	0.965	T	0.79607	-0.1733	10	0.15499	T	0.54	-38.8259	12.7558	0.57335	0.0:0.0:1.0:0.0	.	169	Q9NSA1	FGF21_HUMAN	V	169	ENSP00000222157:G169V	ENSP00000222157:G169V	G	+	2	0	FGF21	53953165	0.939000	0.31865	0.859000	0.33776	0.137000	0.21094	2.261000	0.43276	2.464000	0.83262	0.511000	0.50034	GGC	FGF21	-	pirsf_Fibroblast_GF_15/19/21		0.716	FGF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF21	HGNC	protein_coding	OTTHUMT00000466200.1	G			49261353	+1	no_errors	ENST00000222157	ensembl	human	known	70_37	missense	SNP	0.962	T
FHAD1	114827	genome.wustl.edu	37	1	15679414	15679414	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:15679414G>T	ENST00000375998.4	+	18	2430	c.2430G>T	c.(2428-2430)aaG>aaT	p.K810N	FHAD1_ENST00000417793.1_Missense_Mutation_p.K774N|FHAD1_ENST00000314740.8_Missense_Mutation_p.K63N|FHAD1_ENST00000471347.1_3'UTR|FHAD1_ENST00000358897.4_Missense_Mutation_p.K810N|FHAD1_ENST00000375999.3_Missense_Mutation_p.K810N			B1AJZ9	FHAD1_HUMAN	forkhead-associated (FHA) phosphopeptide binding domain 1	810										skin(1)|stomach(1)	2						GCAAAGCAAAGGAGGCCATGG	0.507																																																	0													139.0	138.0	139.0					1																	15679414		692	1591	2283	SO:0001583	missense	114827			AK093300		1p36.21	2012-04-19			ENSG00000142621	ENSG00000142621			29408	protein-coding gene	gene with protein product						11572484	Standard	NM_052929		Approved	KIAA1937	uc001awb.2	B1AJZ9	OTTHUMG00000002088	ENST00000375998.4:c.2430G>T	1.37:g.15679414G>T	ENSP00000365166:p.Lys810Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0P6F5|Q8N8D3|Q8N9T6|Q8NA05	Missense_Mutation	SNP	pfam_FHA_dom,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.K810N	ENST00000375998.4	37	c.2430		1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.79|12.79	2.042305|2.042305	0.35989|0.35989	.|.	.|.	ENSG00000142621|ENSG00000142621	ENST00000358897;ENST00000417793;ENST00000375999;ENST00000375998;ENST00000529606;ENST00000314740;ENST00000314668|ENST00000444385	T;T;T;T;T;T;T|.	0.49432|.	0.78;0.78;0.78;0.78;0.78;0.78;0.78|.	5.1|5.1	2.14|2.14	0.27477|0.27477	.|.	.|.	.|.	.|.	.|.	T|T	0.36880|0.36880	0.0983|0.0983	L|L	0.47190|0.47190	1.495|1.495	0.23325|0.23325	N|N	0.997908|0.997908	D;D|.	0.57571|.	0.98;0.969|.	P;B|.	0.49047|.	0.599;0.436|.	T|T	0.25537|0.25537	-1.0129|-1.0129	9|5	0.45353|.	T|.	0.12|.	.|.	5.217|5.217	0.15348|0.15348	0.1905:0.1688:0.6407:0.0|0.1905:0.1688:0.6407:0.0	.|.	63;810|.	B7WPP2;B1AJZ9|.	.;FHAD1_HUMAN|.	N|M	810;774;810;810;81;63;45|129	ENSP00000351770:K810N;ENSP00000407615:K774N;ENSP00000365167:K810N;ENSP00000365166:K810N;ENSP00000434909:K81N;ENSP00000322979:K63N;ENSP00000318812:K45N|.	ENSP00000318812:K45N|.	K|R	+|+	3|2	2|0	FHAD1|FHAD1	15552001|15552001	0.991000|0.991000	0.36638|0.36638	0.444000|0.444000	0.26895|0.26895	0.162000|0.162000	0.22319|0.22319	0.715000|0.715000	0.25822|0.25822	0.247000|0.247000	0.21414|0.21414	-0.304000|-0.304000	0.09214|0.09214	AAG|AGG	FHAD1	-	NULL		0.507	FHAD1-026	PUTATIVE	basic|appris_candidate_longest	protein_coding	FHAD1	HGNC	protein_coding	OTTHUMT00000393400.2	G	NM_052929		15679414	+1	no_errors	ENST00000375999	ensembl	human	known	70_37	missense	SNP	0.809	T
FMR1	2332	genome.wustl.edu	37	X	147025129	147025129	+	Intron	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chrX:147025129G>T	ENST00000370475.4	+	14	1599				FMR1_ENST00000370470.1_Intron|FMR1_ENST00000370477.1_Intron|FMR1_ENST00000218200.8_Intron|FMR1_ENST00000370471.3_Intron|FMR1_ENST00000492846.1_3'UTR|FMR1_ENST00000440235.2_Intron|FMR1_ENST00000439526.2_Intron	NM_002024.5	NP_002015.1	Q06787	FMR1_HUMAN	fragile X mental retardation 1						central nervous system development (GO:0007417)|mRNA transport (GO:0051028)|negative regulation of translational initiation (GO:0045947)	cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|cytoplasmic stress granule (GO:0010494)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|membrane (GO:0016020)|mRNA cap binding complex (GO:0005845)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|synapse (GO:0045202)	mRNA binding (GO:0003729)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(1)|endometrium(7)|kidney(1)|large_intestine(8)|lung(13)|ovary(2)|pancreas(1)|upper_aerodigestive_tract(1)	35	Acute lymphoblastic leukemia(192;6.56e-05)					TTTTATAACTGTATAGTCAAA	0.418									Fragile X syndrome																																								0																																										SO:0001627	intron_variant	2332	Familial Cancer Database	Martin-Bell syndrome, FRAXA syndrome	X69962	CCDS14682.1, CCDS55518.1, CCDS55519.1, CCDS76039.1	Xq27.3	2014-09-17			ENSG00000102081	ENSG00000102081			3775	protein-coding gene	gene with protein product		309550	"""premature ovarian failure 1"""	POF1, POF		1572655	Standard	NM_002024		Approved	FMRP, FRAXA, MGC87458	uc010nst.3	Q06787	OTTHUMG00000022606	ENST00000370475.4:c.1471+283G>T	X.37:g.147025129G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNH4|D3DWT0|D3DWT1|D3DWT2|G8JL90|Q16578|Q5PQZ6|Q99054	RNA	SNP	-	NULL	ENST00000370475.4	37	NULL	CCDS14682.1	X																																																																																			FMR1	-	-		0.418	FMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMR1	HGNC	protein_coding	OTTHUMT00000058655.1	G	NM_002024		147025129	+1	no_errors	ENST00000492846	ensembl	human	known	70_37	rna	SNP	0.998	T
FNDC9	408263	genome.wustl.edu	37	5	156770011	156770011	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr5:156770011G>A	ENST00000312349.4	-	2	721	c.534C>T	c.(532-534)ctC>ctT	p.L178L	CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000541131.1_Intron|CYFIP2_ENST00000347377.6_Intron|CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000318218.6_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	178						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						CCACCAGGGGGAGCCCCTGCA	0.622											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													78.0	82.0	80.0					5																	156770011		2203	4300	6503	SO:0001819	synonymous_variant	408263			BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.534C>T	5.37:g.156770011G>A		Somatic	1781	WXS	Illumina HiSeq	Phase_IV	A8K0Y6	Silent	SNP	superfamily_Fibronectin_type3	p.L178	ENST00000312349.4	37	c.534	CCDS4337.1	5																																																																																			FNDC9	-	NULL		0.622	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC9	HGNC	protein_coding	OTTHUMT00000252573.2	G	NM_001001343		156770011	-1	no_errors	ENST00000312349	ensembl	human	known	70_37	silent	SNP	1.000	A
GATA2	2624	genome.wustl.edu	37	3	128200907	128200907	+	Intron	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:128200907G>T	ENST00000341105.2	-	5	1349				GATA2_ENST00000430265.2_Intron|GATA2_ENST00000489987.1_5'UTR|GATA2_ENST00000487848.1_Intron	NM_032638.4	NP_116027.2	P23769	GATA2_HUMAN	GATA binding protein 2						blood coagulation (GO:0007596)|cell differentiation in hindbrain (GO:0021533)|cell fate determination (GO:0001709)|cell maturation (GO:0048469)|central nervous system neuron development (GO:0021954)|commitment of neuronal cell to specific neuron type in forebrain (GO:0021902)|definitive hemopoiesis (GO:0060216)|embryonic placenta development (GO:0001892)|eosinophil fate commitment (GO:0035854)|GABAergic neuron differentiation (GO:0097154)|homeostasis of number of cells within a tissue (GO:0048873)|inner ear morphogenesis (GO:0042472)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of fat cell proliferation (GO:0070345)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of neural precursor cell proliferation (GO:2000178)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|phagocytosis (GO:0006909)|pituitary gland development (GO:0021983)|positive regulation of angiogenesis (GO:0045766)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of megakaryocyte differentiation (GO:0045654)|positive regulation of phagocytosis (GO:0050766)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of forebrain neuron differentiation (GO:2000977)|regulation of histone acetylation (GO:0035065)|semicircular canal development (GO:0060872)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)|ventral spinal cord interneuron differentiation (GO:0021514)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)	C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|enhancer sequence-specific DNA binding (GO:0001158)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(58)|kidney(2)|large_intestine(3)|lung(9)|prostate(3)|skin(1)|urinary_tract(1)	79				GBM - Glioblastoma multiforme(114;0.173)		AATCTCACATGGGAATCAAAG	0.512			Mis		AML(CML blast transformation)																																			Dom	yes		3	3q21.3	2624	GATA binding protein 2		L	0																																										SO:0001627	intron_variant	2624			AF169253	CCDS3049.1, CCDS46903.1	3q21	2014-09-17	2001-11-28		ENSG00000179348	ENSG00000179348		"""GATA zinc finger domain containing"""	4171	protein-coding gene	gene with protein product		137295	"""GATA-binding protein 2"""			1714909	Standard	NM_032638		Approved	NFE1B	uc003eko.2	P23769	OTTHUMG00000159689	ENST00000341105.2:c.1018-120C>A	3.37:g.128200907G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNB3|Q53YE0|Q96BH0|Q96BH8|Q9BUJ6	RNA	SNP	-	NULL	ENST00000341105.2	37	NULL	CCDS3049.1	3																																																																																			GATA2	-	-		0.512	GATA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GATA2	HGNC	protein_coding	OTTHUMT00000356925.1	G	NM_032638		128200907	-1	no_errors	ENST00000489987	ensembl	human	known	70_37	rna	SNP	0.022	T
GBA2	57704	genome.wustl.edu	37	9	35741458	35741459	+	Intron	INS	-	-	T	rs74748138		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr9:35741458_35741459insT	ENST00000378103.3	-	4	1310				GBA2_ENST00000378094.4_Intron|GBA2_ENST00000467252.1_Intron|GBA2_ENST00000378088.1_5'Flank|GBA2_ENST00000545786.1_Intron	NM_020944.2	NP_065995.1	Q9HCG7	GBA2_HUMAN	glucosidase, beta (bile acid) 2						bile acid metabolic process (GO:0008206)|cell death (GO:0008219)|central nervous system neuron development (GO:0021954)|glucosylceramide catabolic process (GO:0006680)|glycoside catabolic process (GO:0016139)|glycosphingolipid metabolic process (GO:0006687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|smooth endoplasmic reticulum (GO:0005790)	beta-glucosidase activity (GO:0008422)|glucosylceramidase activity (GO:0004348)			NS(1)|kidney(3)|large_intestine(5)|lung(5)|ovary(4)|skin(3)	21	all_epithelial(49;0.167)		Lung(28;0.00416)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			cgcccagctaattttttttttt	0.53																																																	0																																										SO:0001627	intron_variant	57704			AJ309567	CCDS6589.1	9p13.2	2013-09-11			ENSG00000070610	ENSG00000070610			18986	protein-coding gene	gene with protein product	"""bile acid beta-glucosidase"", ""non-lysosomal glucosylceramidase"""	609471	"""spastic paraplegia 46 (autosomal recessive)"""	SPG46		11489889, 23332916, 23332917	Standard	NM_020944		Approved	KIAA1605, AD035, DKFZp762K054	uc003zxw.3	Q9HCG7	OTTHUMG00000021024	ENST00000378103.3:c.786+209->A	9.37:g.35741469_35741469dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRP2|Q5TCV6|Q96A51|Q96LY1|Q96SJ2|Q9H2L8	RNA	INS	-	NULL	ENST00000378103.3	37	NULL	CCDS6589.1	9																																																																																			GBA2	-	-		0.530	GBA2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GBA2	HGNC	protein_coding	OTTHUMT00000055456.1	-	NM_020944		35741459	-1	no_errors	ENST00000485259	ensembl	human	known	70_37	rna	INS	0.119:0.125	T
GOLGA8R	101059918	genome.wustl.edu	37	15	30700159	30700159	+	Missense_Mutation	SNP	A	A	G	rs62016504	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr15:30700159A>G	ENST00000327271.10	-	11	822	c.823T>C	c.(823-825)Tgg>Cgg	p.W275R	RN7SL196P_ENST00000478496.2_RNA|GOLGA8R_ENST00000544495.1_Missense_Mutation_p.W116R					golgin A8 family, member R																		TGCTCTACCCAACGCATATCC	0.572																																																	0																																										SO:0001583	missense	101059918				CCDS61578.1, CCDS61575.1	15q13.2	2014-01-02			ENSG00000186399	ENSG00000186399			44407	protein-coding gene	gene with protein product							Standard	NM_001282484		Approved			I6L899	OTTHUMG00000175646	ENST00000327271.10:c.823T>C	15.37:g.30700159A>G	ENSP00000323217:p.Trp275Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.W116R	ENST00000327271.10	37	c.346		15	.	.	.	.	.	.	.	.	.	.	.	0	-2.703193	0.00096	.	.	ENSG00000186399	ENST00000327271;ENST00000544495	T;T	0.19250	2.16;2.16	0.842	0.842	0.18927	.	.	.	.	.	T	0.04092	0.0114	N	0.00677	-1.265	.	.	.	.	.	.	.	.	.	T	0.41179	-0.9523	6	0.02654	T	1	.	3.435	0.07442	0.3056:0.0:0.6944:0.0	rs62016504	.	.	.	R	275;116	ENSP00000323217:W275R;ENSP00000440596:W116R	ENSP00000323217:W275R	W	-	1	0	AC019322.1	28487451	0.033000	0.19621	0.002000	0.10522	0.003000	0.03518	1.977000	0.40589	-0.057000	0.13199	-1.352000	0.01234	TGG	GOLGA8R	-	NULL		0.572	GOLGA8R-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8R	HGNC	protein_coding	OTTHUMT00000430706.1	A	NM_001282484		30700159	-1	no_errors	ENST00000544495	ensembl	human	known	70_37	missense	SNP	0.002	G
GOLGA8R	101059918	genome.wustl.edu	37	15	30700168	30700169	+	In_Frame_Ins	INS	-	-	TTG	rs377444665|rs372647671		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr15:30700168_30700169insTTG	ENST00000327271.10	-	11	812_813	c.813_814insCAA	c.(811-816)caggat>cagCAAgat	p.271_272insQ	RN7SL196P_ENST00000478496.2_RNA|GOLGA8R_ENST00000544495.1_In_Frame_Ins_p.112_113insQ					golgin A8 family, member R																		CAACGCATATCCTGCTTCTCTT	0.564																																																	0																																										SO:0001652	inframe_insertion	101059918				CCDS61578.1, CCDS61575.1	15q13.2	2014-01-02			ENSG00000186399	ENSG00000186399			44407	protein-coding gene	gene with protein product							Standard	NM_001282484		Approved			I6L899	OTTHUMG00000175646	ENST00000327271.10:c.813_814insCAA	15.37:g.30700168_30700169insTTG	ENSP00000323217:p.Gln271_Gln271dup	Somatic		WXS	Illumina HiSeq	Phase_IV		In_Frame_Ins	INS	NULL	p.112in_frame_insQ	ENST00000327271.10	37	c.337_336		15																																																																																			GOLGA8R	-	NULL		0.564	GOLGA8R-001	NOVEL	basic|appris_candidate_longest	protein_coding	GOLGA8R	HGNC	protein_coding	OTTHUMT00000430706.1	-	NM_001282484		30700169	-1	no_errors	ENST00000544495	ensembl	human	known	70_37	in_frame_ins	INS	0.000:0.000	TTG
GRID2	2895	genome.wustl.edu	37	4	93225752	93225753	+	5'UTR	INS	-	-	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:93225752_93225753insA	ENST00000282020.4	+	0	203_204				RP11-9B6.1_ENST00000504213.1_5'Flank|GRID2_ENST00000505687.1_3'UTR|GRID2_ENST00000510992.1_5'Flank	NM_001510.2	NP_001501.2	O43424	GRID2_HUMAN	glutamate receptor, ionotropic, delta 2						cellular protein localization (GO:0034613)|cerebellar granule cell differentiation (GO:0021707)|glutamate receptor signaling pathway (GO:0007215)|heterophilic cell-cell adhesion (GO:0007157)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|prepulse inhibition (GO:0060134)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of neuron apoptotic process (GO:0043523)|regulation of neuron projection development (GO:0010975)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|integral component of plasma membrane (GO:0005887)|ionotropic glutamate receptor complex (GO:0008328)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|ionotropic glutamate receptor activity (GO:0004970)|PDZ domain binding (GO:0030165)|scaffold protein binding (GO:0097110)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(6)|kidney(4)|large_intestine(18)|lung(45)|ovary(3)|prostate(6)|skin(9)|upper_aerodigestive_tract(3)|urinary_tract(1)	100		Hepatocellular(203;0.114)|all_hematologic(202;0.177)		OV - Ovarian serous cystadenocarcinoma(123;3.22e-06)|LUSC - Lung squamous cell carcinoma(81;0.185)|Lung(65;0.191)		TGGACTGTTTGAAAAAAAAAAA	0.426																																																	0																																										SO:0001623	5_prime_UTR_variant	2895			AF009014	CCDS3637.1, CCDS68758.1	4q22	2012-08-29			ENSG00000152208	ENSG00000152208		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4576	protein-coding gene	gene with protein product		602368				9465309	Standard	NM_001510		Approved	GluD2, GluR-delta-2	uc011cdt.2	O43424	OTTHUMG00000130975	ENST00000282020.4:c.-55->A	4.37:g.93225763_93225763dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PH24|Q4KKU8|Q4KKU9|Q4KKV0|Q59FZ1	RNA	INS	-	NULL	ENST00000282020.4	37	NULL	CCDS3637.1	4																																																																																			GRID2	-	-		0.426	GRID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRID2	HGNC	protein_coding	OTTHUMT00000253588.2	-			93225753	+1	no_errors	ENST00000505687	ensembl	human	known	70_37	rna	INS	0.001:0.000	A
SLC6A6	6533	genome.wustl.edu	37	3	14530730	14530730	+	3'UTR	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:14530730G>T	ENST00000454876.2	+	0	6407				SLC6A6_ENST00000360861.3_3'UTR|GRIP2_ENST00000273083.3_RNA			P31641	SC6A6_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 6						amino acid transport (GO:0006865)|cellular amino acid metabolic process (GO:0006520)|ion transport (GO:0006811)|taurine transport (GO:0015734)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	neurotransmitter:sodium symporter activity (GO:0005328)|taurine binding (GO:0030977)|taurine:sodium symporter activity (GO:0005369)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)|prostate(1)|skin(2)	28						TATTTTGCAGGGGTTTTTTTC	0.284																																																	0																																										SO:0001624	3_prime_UTR_variant	80852				CCDS33705.1, CCDS46765.1	3p25.1	2013-07-19	2013-07-19		ENSG00000131389	ENSG00000131389		"""Solute carriers"""	11052	protein-coding gene	gene with protein product	"""taurine transporter"""	186854	"""solute carrier family 6 (neurotransmitter transporter, taurine), member 6"""			8010975, 8382624	Standard	XM_006713307		Approved	TAUT	uc010heg.4	P31641	OTTHUMG00000155525	ENST00000454876.2:c.*4215G>T	3.37:g.14530730G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNU7|Q9BRI2|Q9BXB0	RNA	SNP	-	NULL	ENST00000454876.2	37	NULL	CCDS33705.1	3																																																																																			GRIP2	-	-		0.284	SLC6A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIP2	HGNC	protein_coding	OTTHUMT00000340507.1	G	NM_003043		14530730	-1	no_errors	ENST00000273083	ensembl	human	known	70_37	rna	SNP	0.971	T
HIST1H3E	8353	genome.wustl.edu	37	6	26225698	26225698	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr6:26225698G>C	ENST00000360408.1	+	1	316	c.316G>C	c.(316-318)Gag>Cag	p.E106Q		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	106					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				GGGGCTTTTCGAGGACACCAA	0.587											OREG0017240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													92.0	92.0	92.0					6																	26225698		2203	4300	6503	SO:0001583	missense	8353			M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.316G>C	6.37:g.26225698G>C	ENSP00000353581:p.Glu106Gln	Somatic	785	WXS	Illumina HiSeq	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E106Q	ENST00000360408.1	37	c.316	CCDS4596.1	6	.	.	.	.	.	.	.	.	.	.	.	15.72	2.916047	0.52546	.	.	ENSG00000196966	ENST00000360408	T	0.71698	-0.59	4.45	3.55	0.40652	.	.	.	.	.	T	0.72228	0.3434	.	.	.	0.36041	D	0.84006	.	.	.	.	.	.	T	0.77680	-0.2497	6	0.87932	D	0	.	13.6571	0.62344	0.0:0.1564:0.8436:0.0	.	.	.	.	Q	106	ENSP00000353581:E106Q	ENSP00000353581:E106Q	E	+	1	0	HIST1H3E	26333677	1.000000	0.71417	0.938000	0.37757	0.701000	0.40568	7.788000	0.85771	1.206000	0.43276	0.491000	0.48974	GAG	HIST1H3E	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.587	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3E	HGNC	protein_coding	OTTHUMT00000040097.1	G	NM_003532		26225698	+1	no_errors	ENST00000360408	ensembl	human	known	70_37	missense	SNP	1.000	C
HIST1H3E	8353	genome.wustl.edu	37	6	26225698	26225698	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr6:26225698G>C	ENST00000360408.1	+	1	316	c.316G>C	c.(316-318)Gag>Cag	p.E106Q		NM_003532.2	NP_003523.1	P68431	H31_HUMAN	histone cluster 1, H3e	106					blood coagulation (GO:0007596)|chromatin organization (GO:0006325)|DNA replication-dependent nucleosome assembly (GO:0006335)|regulation of gene silencing (GO:0060968)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear chromosome (GO:0000228)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)|protein complex (GO:0043234)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(5)|skin(1)	8		all_hematologic(11;0.0223)|Acute lymphoblastic leukemia(11;0.0351)				GGGGCTTTTCGAGGACACCAA	0.587											OREG0017240	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													92.0	92.0	92.0					6																	26225698		2203	4300	6503	SO:0001583	missense	8353			M60746	CCDS4596.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000196966	ENSG00000274750		"""Histones / Replication-dependent"""	4769	protein-coding gene	gene with protein product		602813	"""H3 histone family, member D"", ""histone 1, H3e"""	H3FD		1916825, 12408966	Standard	NM_003532		Approved	H3/d, H3.1	uc003nhc.4	P68431	OTTHUMG00000014434	ENST00000360408.1:c.316G>C	6.37:g.26225698G>C	ENSP00000353581:p.Glu106Gln	Somatic	785	WXS	Illumina HiSeq	Phase_IV	A0PJT7|A5PLR1|P02295|P02296|P16106|Q6ISV8|Q6NWP8|Q6NWP9|Q6NXU4|Q71DJ3|Q93081	Missense_Mutation	SNP	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3	p.E106Q	ENST00000360408.1	37	c.316	CCDS4596.1	6	.	.	.	.	.	.	.	.	.	.	.	15.72	2.916047	0.52546	.	.	ENSG00000196966	ENST00000360408	T	0.71698	-0.59	4.45	3.55	0.40652	.	.	.	.	.	T	0.72228	0.3434	.	.	.	0.36041	D	0.84006	.	.	.	.	.	.	T	0.77680	-0.2497	6	0.87932	D	0	.	13.6571	0.62344	0.0:0.1564:0.8436:0.0	.	.	.	.	Q	106	ENSP00000353581:E106Q	ENSP00000353581:E106Q	E	+	1	0	HIST1H3E	26333677	1.000000	0.71417	0.938000	0.37757	0.701000	0.40568	7.788000	0.85771	1.206000	0.43276	0.491000	0.48974	GAG	HIST1H3E	-	pfam_Histone_core_D,superfamily_Histone-fold,smart_Histone_H3,prints_Histone_H3		0.587	HIST1H3E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H3E	HGNC	protein_coding	OTTHUMT00000040097.1	G	NM_003532		26225698	+1	no_errors	ENST00000360408	ensembl	human	known	70_37	missense	SNP	1.000	C
HLA-A	3105	genome.wustl.edu	37	6	29911899	29911900	+	Splice_Site	INS	-	-	C	rs199474608|rs199474609|rs386698554|rs377011235|rs41544717		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr6:29911899_29911900insC	ENST00000396634.1	+	6	961_962	c.620_621insC	c.(619-624)gacccc>gaCcccc	p.DP207fs	HLA-A_ENST00000376802.2_Splice_Site_p.DP207fs|HLA-A_ENST00000376806.5_Splice_Site_p.DP207fs|HLA-A_ENST00000376809.5_Splice_Site_p.DP207fs			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	207	Alpha-3.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TTCCCGTCAGACCCCCCCAAGA	0.574									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																																							0																																										SO:0001630	splice_region_variant	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.620-1->C	6.37:g.29911906_29911906dupC		Somatic		WXS	Illumina HiSeq	Phase_IV	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Frame_Shift_Ins	INS	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.K210fs	ENST00000396634.1	37	c.620_621	CCDS34373.1	6																																																																																			HLA-A	-	pfscan_Ig-like		0.574	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	-	NM_002116	Frame_Shift_Ins	29911900	+1	no_errors	ENST00000376806	ensembl	human	known	70_37	frame_shift_ins	INS	0.903:0.000	C
HLA-A	3105	genome.wustl.edu	37	6	29911899	29911900	+	Splice_Site	INS	-	-	C	rs199474608|rs199474609|rs386698554|rs377011235|rs41544717		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr6:29911899_29911900insC	ENST00000396634.1	+	6	961_962	c.620_621insC	c.(619-624)gacccc>gaCcccc	p.DP207fs	HLA-A_ENST00000376802.2_Splice_Site_p.DP207fs|HLA-A_ENST00000376806.5_Splice_Site_p.DP207fs|HLA-A_ENST00000376809.5_Splice_Site_p.DP207fs			P16189	1A31_HUMAN	major histocompatibility complex, class I, A	207	Alpha-3.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	beta-2-microglobulin binding (GO:0030881)|peptide antigen binding (GO:0042605)|TAP binding (GO:0046977)			central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	30						TTCCCGTCAGACCCCCCCAAGA	0.574									Osteosarcoma, Familial Clustering of;Naso-/Oropharyngeal/Laryngeal Cancer, Familial Clustering of;Melanoma, Familial Clustering of;Lichen Sclerosis et Atrophicus, Familial Clustering of	Multiple Myeloma(9;0.094)																																							0																																										SO:0001630	splice_region_variant	3105	Familial Cancer Database	Familial Osteogenic Sarcoma;incl.: Familial Head and Neck Cancer; ;Lichen Sclerosis, Familial	D32129	CCDS34373.1	6p21.3	2013-01-11			ENSG00000206503	ENSG00000206503		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4931	protein-coding gene	gene with protein product		142800				8838351	Standard	NM_001242758		Approved		uc003nol.3	P01891	OTTHUMG00000130501	ENST00000396634.1:c.620-1->C	6.37:g.29911906_29911906dupC		Somatic		WXS	Illumina HiSeq	Phase_IV	O62924|O98009|O98137|Q8MHM1|Q9TPQ3|Q9TQ24|Q9UQU6|Q9UQU7	Frame_Shift_Ins	INS	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.K210fs	ENST00000396634.1	37	c.620_621	CCDS34373.1	6																																																																																			HLA-A	-	pfscan_Ig-like		0.574	HLA-A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-A	HGNC	protein_coding	OTTHUMT00000252909.1	-	NM_002116	Frame_Shift_Ins	29911900	+1	no_errors	ENST00000376806	ensembl	human	known	70_37	frame_shift_ins	INS	0.903:0.000	C
IGSF22	283284	genome.wustl.edu	37	11	18729451	18729451	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:18729451G>T	ENST00000513874.1	-	20	3319	c.3180C>A	c.(3178-3180)ttC>ttA	p.F1060L	RP11-1081L13.4_ENST00000527285.1_RNA|IGSF22_ENST00000510673.1_5'Flank	NM_173588.3	NP_775859	Q8N9C0	IGS22_HUMAN	immunoglobulin superfamily, member 22	663										NS(2)|autonomic_ganglia(1)|breast(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(20)|ovary(4)|prostate(4)|skin(3)	56						TATTAATGAGGAACTGGGAGT	0.527																																																	0													247.0	202.0	215.0					11																	18729451		692	1591	2283	SO:0001583	missense	283284			AK095113	CCDS41625.1, CCDS41625.2	11p15.1	2014-06-06			ENSG00000179057	ENSG00000179057		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	26750	protein-coding gene	gene with protein product							Standard	NM_173588		Approved	FLJ37794	uc009yht.2	Q8N9C0	OTTHUMG00000160502	ENST00000513874.1:c.3180C>A	11.37:g.18729451G>T	ENSP00000421191:p.Phe1060Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNA0|D6RGV7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.F1060L	ENST00000513874.1	37	c.3180	CCDS41625.2	11	.	.	.	.	.	.	.	.	.	.	G	10.22	1.291445	0.23564	.	.	ENSG00000179057	ENST00000513874	T	0.11821	2.74	4.77	4.77	0.60923	.	.	.	.	.	T	0.02727	0.0082	N	0.00077	-2.24	0.22354	N	0.999176	B	0.25563	0.129	B	0.23852	0.049	T	0.13522	-1.0506	9	0.02654	T	1	.	15.0499	0.71858	0.0:0.0:1.0:0.0	.	1060	D6RGV7	.	L	1060	ENSP00000421191:F1060L	ENSP00000421191:F1060L	F	-	3	2	IGSF22	18686027	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.585000	0.36600	2.336000	0.79503	0.655000	0.94253	TTC	IGSF22	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.527	IGSF22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IGSF22	HGNC	protein_coding	OTTHUMT00000360850.2	G	NM_173588		18729451	-1	no_errors	ENST00000513874	ensembl	human	known	70_37	missense	SNP	1.000	T
IGSF9B	22997	genome.wustl.edu	37	11	133791101	133791101	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:133791101T>C	ENST00000321016.8	-	18	2749	c.2519A>G	c.(2518-2520)gAg>gGg	p.E840G	IGSF9B_ENST00000533871.2_Missense_Mutation_p.E840G			Q9UPX0	TUTLB_HUMAN	immunoglobulin superfamily, member 9B	840					homophilic cell adhesion (GO:0007156)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)	dendrite (GO:0030425)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)				breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(18)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	44	all_hematologic(175;0.127)	all_cancers(12;1.58e-21)|all_epithelial(12;5.17e-16)|all_lung(97;1.6e-05)|Lung NSC(97;3.86e-05)|Breast(109;0.000126)|Medulloblastoma(222;0.0245)|all_neural(223;0.0505)|Esophageal squamous(93;0.0559)		Epithelial(10;7.19e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|all cancers(11;1.23e-08)|OV - Ovarian serous cystadenocarcinoma(99;0.00328)|Lung(977;0.221)		GGCCTCTGCCTCGGCCTCTGC	0.642																																																	0													70.0	74.0	73.0					11																	133791101		2162	4255	6417	SO:0001583	missense	22997			AK097578	CCDS61010.1	11q25	2013-02-11	2005-10-12	2005-11-20				"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	32326	protein-coding gene	gene with protein product		613773					Standard	NM_001277285		Approved	KIAA1030	uc031qfh.1	Q9UPX0		ENST00000321016.8:c.2519A>G	11.37:g.133791101T>C	ENSP00000317980:p.Glu840Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	G5EA26	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E840G	ENST00000321016.8	37	c.2519		11	.	.	.	.	.	.	.	.	.	.	T	14.19	2.460592	0.43736	.	.	ENSG00000080854	ENST00000321016;ENST00000533871	T;T	0.66280	0.14;-0.2	4.47	4.47	0.54385	.	0.150077	0.30752	N	0.008954	T	0.45276	0.1334	N	0.08118	0	0.51482	D	0.999922	P	0.48998	0.918	B	0.44278	0.445	T	0.51980	-0.8636	10	0.44086	T	0.13	.	13.5869	0.61937	0.0:0.0:0.0:1.0	.	840	Q9UPX0	TUTLB_HUMAN	G	840;682	ENSP00000317980:E840G;ENSP00000436552:E682G	ENSP00000317980:E840G	E	-	2	0	IGSF9B	133296311	1.000000	0.71417	0.762000	0.31397	0.228000	0.25075	5.791000	0.69045	1.881000	0.54492	0.459000	0.35465	GAG	IGSF9B	-	NULL		0.642	IGSF9B-201	KNOWN	basic|appris_candidate	protein_coding	IGSF9B	HGNC	protein_coding		T	XM_290502		133791101	-1	no_errors	ENST00000321016	ensembl	human	known	70_37	missense	SNP	1.000	C
IVL	3713	genome.wustl.edu	37	1	152883203	152883203	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:152883203G>T	ENST00000368764.3	+	2	994	c.930G>T	c.(928-930)atG>atT	p.M310I	IVL_ENST00000392667.2_Missense_Mutation_p.M164I			P07476	INVO_HUMAN	involucrin	310	39 X 10 AA approximate tandem repeats of [LP]-[EKG]-[LHVYQEK]-[PLSQE]-[EQDV]- [QHEKRGA]-Q-[EMVQLP]-[GKLE]-[QHVNLD].				isopeptide cross-linking via N6-(L-isoglutamyl)-L-lysine (GO:0018153)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)|response to UV-B (GO:0010224)	cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(1)|endometrium(6)|kidney(1)|large_intestine(5)|lung(11)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)	29	Lung NSC(65;3.97e-29)|Hepatocellular(266;0.0877)|all_hematologic(923;0.127)|Melanoma(130;0.242)		LUSC - Lung squamous cell carcinoma(543;0.171)			agcagcagatggggcagctga	0.632																																																	0													18.0	18.0	18.0					1																	152883203		2095	4123	6218	SO:0001583	missense	3713			BC046391	CCDS1030.1	1q21	2008-02-05			ENSG00000163207	ENSG00000163207			6187	protein-coding gene	gene with protein product		147360				2873896	Standard	NM_005547		Approved		uc001fau.3	P07476	OTTHUMG00000012451	ENST00000368764.3:c.930G>T	1.37:g.152883203G>T	ENSP00000357753:p.Met310Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T7P4	Missense_Mutation	SNP	pfam_Involucrin_N,pfam_Involucrin_rpt	p.M310I	ENST00000368764.3	37	c.930	CCDS1030.1	1	.	.	.	.	.	.	.	.	.	.	G	2.205	-0.382171	0.04966	.	.	ENSG00000163207	ENST00000368764;ENST00000392667	T;T	0.08984	3.21;3.03	1.22	1.22	0.21188	.	.	.	.	.	T	0.01254	0.0041	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47935	-0.9078	9	0.41790	T	0.15	.	5.8538	0.18708	0.0:0.0:1.0:0.0	.	310	P07476	INVO_HUMAN	I	310;164	ENSP00000357753:M310I;ENSP00000376435:M164I	ENSP00000357753:M310I	M	+	3	0	IVL	151149827	0.002000	0.14202	0.009000	0.14445	0.003000	0.03518	0.015000	0.13355	0.982000	0.38575	0.461000	0.40582	ATG	IVL	-	pfam_Involucrin_rpt		0.632	IVL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IVL	HGNC	protein_coding	OTTHUMT00000034664.1	G	NM_005547		152883203	+1	no_errors	ENST00000368764	ensembl	human	known	70_37	missense	SNP	0.047	T
KCTD12	115207	genome.wustl.edu	37	13	77460014	77460014	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr13:77460014G>A	ENST00000377474.2	-	1	511	c.270C>T	c.(268-270)cgC>cgT	p.R90R	AC000403.1_ENST00000579275.1_RNA|KCTD12_ENST00000317765.2_Silent_p.R90R	NM_138444.3	NP_612453.1	Q96CX2	KCD12_HUMAN	potassium channel tetramerization domain containing 12	90					protein homooligomerization (GO:0051260)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(1)|lung(1)|ovary(1)	4		Breast(118;0.212)		GBM - Glioblastoma multiforme(99;0.0499)		CCAGGATGTAGCGGAAGAGGA	0.657																																																	0													21.0	18.0	19.0					13																	77460014		2147	4204	6351	SO:0001819	synonymous_variant	115207			AF359381	CCDS9455.1	13q21	2013-06-20	2013-06-20	2003-11-26	ENSG00000178695	ENSG00000178695			14678	protein-coding gene	gene with protein product	"""predominantly fetal expressed T1 domain"""	610521	"""chromosome 13 open reading frame 2"", ""potassium channel tetramerisation domain containing 12"""	C13orf2		15357420	Standard	NM_138444		Approved	KIAA1778, PFET1	uc010aeu.1	Q96CX2	OTTHUMG00000017096	ENST00000377474.2:c.270C>T	13.37:g.77460014G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like	p.R90	ENST00000377474.2	37	c.270	CCDS9455.1	13																																																																																			KCTD12	-	pfam_T1-type_BTB,superfamily_BTB/POZ_fold,smart_BTB/POZ-like		0.657	KCTD12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCTD12	HGNC	protein_coding	OTTHUMT00000045309.2	G	NM_138444		77460014	-1	no_errors	ENST00000317765	ensembl	human	known	70_37	silent	SNP	1.000	A
KIAA2022	340533	genome.wustl.edu	37	X	73962692	73962692	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chrX:73962692G>A	ENST00000055682.6	-	3	2311	c.1700C>T	c.(1699-1701)aCa>aTa	p.T567I		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	567					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CAAATTCACTGTTGTCTCACT	0.433																																																	0													141.0	117.0	125.0					X																	73962692		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1700C>T	X.37:g.73962692G>A	ENSP00000055682:p.Thr567Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.T567I	ENST00000055682.6	37	c.1700	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466819	0.63625	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.34072	1.38;1.38	5.83	5.83	0.93111	.	0.049838	0.85682	D	0.000000	T	0.56587	0.1995	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56986	-0.7888	10	0.72032	D	0.01	-10.1494	19.1122	0.93321	0.0:0.0:1.0:0.0	.	567	Q5QGS0	K2022_HUMAN	I	567	ENSP00000362567:T567I;ENSP00000055682:T567I	ENSP00000055682:T567I	T	-	2	0	KIAA2022	73879417	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.540000	0.82074	2.463000	0.83235	0.600000	0.82982	ACA	KIAA2022	-	NULL		0.433	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	G	NM_001008537		73962692	-1	no_errors	ENST00000055682	ensembl	human	known	70_37	missense	SNP	1.000	A
KIAA2022	340533	genome.wustl.edu	37	X	73962692	73962692	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chrX:73962692G>A	ENST00000055682.6	-	3	2311	c.1700C>T	c.(1699-1701)aCa>aTa	p.T567I		NM_001008537.2	NP_001008537.1	Q5QGS0	K2022_HUMAN	KIAA2022	567					base-excision repair, gap-filling (GO:0006287)|DNA replication proofreading (GO:0045004)|DNA replication, removal of RNA primer (GO:0043137)|nervous system development (GO:0007399)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair, DNA gap filling (GO:0006297)|regulation of mitotic cell cycle (GO:0007346)	delta DNA polymerase complex (GO:0043625)|nucleus (GO:0005634)	3'-5' exonuclease activity (GO:0008408)|DNA-directed DNA polymerase activity (GO:0003887)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(23)|liver(1)|lung(41)|ovary(7)|pancreas(2)|prostate(4)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	109						CAAATTCACTGTTGTCTCACT	0.433																																																	0													141.0	117.0	125.0					X																	73962692		2203	4300	6503	SO:0001583	missense	340533				CCDS35337.1	Xq13.3	2014-02-19			ENSG00000050030	ENSG00000050030			29433	protein-coding gene	gene with protein product	"""XLMR-related protein, neurite extension"""	300524				15466006, 23615299	Standard	NM_001008537		Approved	XPN, MRX98	uc004eby.3	Q5QGS0	OTTHUMG00000021860	ENST00000055682.6:c.1700C>T	X.37:g.73962692G>A	ENSP00000055682:p.Thr567Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A7YY87|Q5JUX9|Q8IVE9	Missense_Mutation	SNP	NULL	p.T567I	ENST00000055682.6	37	c.1700	CCDS35337.1	X	.	.	.	.	.	.	.	.	.	.	G	17.75	3.466819	0.63625	.	.	ENSG00000050030	ENST00000373468;ENST00000055682	T;T	0.34072	1.38;1.38	5.83	5.83	0.93111	.	0.049838	0.85682	D	0.000000	T	0.56587	0.1995	L	0.47716	1.5	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.56986	-0.7888	10	0.72032	D	0.01	-10.1494	19.1122	0.93321	0.0:0.0:1.0:0.0	.	567	Q5QGS0	K2022_HUMAN	I	567	ENSP00000362567:T567I;ENSP00000055682:T567I	ENSP00000055682:T567I	T	-	2	0	KIAA2022	73879417	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.540000	0.82074	2.463000	0.83235	0.600000	0.82982	ACA	KIAA2022	-	NULL		0.433	KIAA2022-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA2022	HGNC	protein_coding	OTTHUMT00000057270.2	G	NM_001008537		73962692	-1	no_errors	ENST00000055682	ensembl	human	known	70_37	missense	SNP	1.000	A
KRTAP5-5	439915	genome.wustl.edu	37	11	1651625	1651625	+	Silent	SNP	G	G	A	rs576867883|rs200756510|rs71025765	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:1651625G>A	ENST00000399676.2	+	1	593	c.555G>A	c.(553-555)caG>caA	p.Q185Q		NM_001001480.2	NP_001001480.2	Q701N2	KRA55_HUMAN	keratin associated protein 5-5	185	8 X 4 AA repeats of C-C-X-P.					keratin filament (GO:0045095)		p.Y182_P191delYCCQSSCCKP(1)		endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(17)|ovary(2)|prostate(5)|urinary_tract(1)	33		all_epithelial(84;0.00018)|Ovarian(85;0.0014)|Breast(177;0.00147)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.000614)|Lung(200;0.0681)|LUSC - Lung squamous cell carcinoma(625;0.082)		ACTGCTGCCAGTCCAGCTGCT	0.597																																																	1	Deletion - In frame(1)	urinary_tract(1)											67.0	73.0	71.0					11																	1651625		2200	4292	6492	SO:0001819	synonymous_variant	439915			AB125074	CCDS41592.1	11p15.5	2008-10-30			ENSG00000185940	ENSG00000185940		"""Keratin associated proteins"""	23601	protein-coding gene	gene with protein product						15144888	Standard	NM_001001480		Approved	KRTAP5.5, KRTAP5-11	uc001lty.3	Q701N2	OTTHUMG00000057554	ENST00000399676.2:c.555G>A	11.37:g.1651625G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWN2	Silent	SNP	NULL	p.Q185	ENST00000399676.2	37	c.555	CCDS41592.1	11																																																																																			KRTAP5-5	-	NULL		0.597	KRTAP5-5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP5-5	HGNC	protein_coding	OTTHUMT00000127919.1	G			1651625	+1	no_errors	ENST00000399676	ensembl	human	known	70_37	silent	SNP	0.483	A
LARGE	9215	genome.wustl.edu	37	22	33712207	33712207	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr22:33712207C>A	ENST00000354992.2	-	12	1886	c.1315G>T	c.(1315-1317)Gag>Tag	p.E439*	LARGE_ENST00000452586.2_Nonsense_Mutation_p.E238*|LARGE_ENST00000437602.2_Nonsense_Mutation_p.E439*|LARGE_ENST00000337431.2_Nonsense_Mutation_p.E387*|LARGE_ENST00000397394.2_Nonsense_Mutation_p.E439*|LARGE_ENST00000402320.1_Nonsense_Mutation_p.E387*	NM_004737.4	NP_004728.1	O95461	LARGE_HUMAN	like-glycosyltransferase	439					glycoprotein biosynthetic process (GO:0009101)|glycosphingolipid biosynthetic process (GO:0006688)|muscle cell cellular homeostasis (GO:0046716)|N-acetylglucosamine metabolic process (GO:0006044)|protein glycosylation (GO:0006486)	integral component of Golgi membrane (GO:0030173)	acetylglucosaminyltransferase activity (GO:0008375)|transferase activity, transferring glycosyl groups (GO:0016757)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(23)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	51		Lung NSC(1;0.219)				AGGTCGTCCTCGTCCAGCTCA	0.612																																					Colon(70;397 1175 4573 19089 45288)												0													114.0	89.0	98.0					22																	33712207		2203	4300	6503	SO:0001587	stop_gained	9215			AJ007583	CCDS13912.1	22q12.3	2013-02-22			ENSG00000133424	ENSG00000133424		"""Glycosyltransferase family 8 domain containing"""	6511	protein-coding gene	gene with protein product		603590				9892679, 10591208, 12966029	Standard	NM_004737		Approved	KIAA0609	uc003ane.4	O95461	OTTHUMG00000150914	ENST00000354992.2:c.1315G>T	22.37:g.33712207C>A	ENSP00000347088:p.Glu439*	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QXZ7|O60348|Q17R80|Q9UGD1|Q9UGE7|Q9UGG3|Q9UGZ8|Q9UH22	Nonsense_Mutation	SNP	pfam_Glyco_trans_8	p.E439*	ENST00000354992.2	37	c.1315	CCDS13912.1	22	.	.	.	.	.	.	.	.	.	.	C	38	7.152640	0.98099	.	.	ENSG00000133424	ENST00000443693;ENST00000429788;ENST00000445431;ENST00000354992;ENST00000337431;ENST00000397394;ENST00000402320;ENST00000452586;ENST00000437602	.	.	.	5.11	5.11	0.69529	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-3.4835	18.5547	0.91080	0.0:1.0:0.0:0.0	.	.	.	.	X	116;116;116;439;387;439;387;238;439	.	ENSP00000336636:E387X	E	-	1	0	LARGE	32042207	1.000000	0.71417	0.992000	0.48379	0.969000	0.65631	7.292000	0.78731	2.376000	0.81061	0.655000	0.94253	GAG	LARGE	-	NULL		0.612	LARGE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARGE	HGNC	protein_coding	OTTHUMT00000320515.2	C	NM_133642		33712207	-1	no_errors	ENST00000354992	ensembl	human	known	70_37	nonsense	SNP	1.000	A
LOC100130502	100130502	genome.wustl.edu	37	2	45148627	45148627	+	lincRNA	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:45148627G>T	ENST00000437916.2	-	0	2468																											AACATCGATTGCAGAATCAAT	0.473																																																	0																																												100130502																															2.37:g.45148627G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000437916.2	37	NULL		2																																																																																			RP11-89K21.1	-	-		0.473	RP11-89K21.1-001	KNOWN	basic	lincRNA	LOC100130502	Clone_based_vega_gene	lincRNA	OTTHUMT00000417295.1	G			45148627	-1	no_errors	ENST00000354756	ensembl	human	known	70_37	rna	SNP	0.074	T
LOC100133669	100133669	genome.wustl.edu	37	8	144089674	144089674	+	lincRNA	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr8:144089674C>A	ENST00000502167.2	-	0	1276																											ccggcaggcccaggcctgtgg	0.642																																																	0																																												100133669																															8.37:g.144089674C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000502167.2	37	NULL		8																																																																																			RP11-273G15.2	-	-		0.642	RP11-273G15.2-001	KNOWN	basic	lincRNA	LOC100133669	Clone_based_vega_gene	lincRNA	OTTHUMT00000380066.1	C			144089674	-1	no_errors	ENST00000502167	ensembl	human	known	70_37	rna	SNP	0.474	A
LOC401177	401177	genome.wustl.edu	37	5	17380184	17380184	+	lincRNA	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr5:17380184G>T	ENST00000505158.1	-	0	1142					NR_033975.1																						GAAAAAAAATGGCCGTTAGGA	0.358																																																	0																																												401177																															5.37:g.17380184G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000505158.1	37	NULL		5																																																																																			CTD-2139B15.4	-	-		0.358	CTD-2139B15.4-001	KNOWN	basic	lincRNA	LOC401177	Clone_based_vega_gene	lincRNA	OTTHUMT00000366276.1	G			17380184	-1	no_errors	ENST00000505158	ensembl	human	known	70_37	rna	SNP	0.000	T
CDIPT	10423	genome.wustl.edu	37	16	29875656	29875656	+	5'Flank	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:29875656G>A	ENST00000219789.6	-	0	0				CDIPT_ENST00000570016.1_5'Flank|CDIPT_ENST00000563415.1_5'Flank|CDIPT_ENST00000569956.1_5'Flank|CDIPT_ENST00000566113.1_5'Flank|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT-AS1_ENST00000398859.3_RNA|CDIPT_ENST00000561555.1_5'Flank	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase						CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						GGGGAATGAGGGGGAGAAGAA	0.592																																																	0																																										SO:0001631	upstream_gene_variant	440356			AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144		16.37:g.29875656G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	RNA	SNP	-	NULL	ENST00000219789.6	37	NULL	CCDS10657.1	16	.	.	.	.	.	.	.	.	.	.	G	1.286	-0.608869	0.03717	.	.	ENSG00000214725	ENST00000398859	.	.	.	0.199	-0.397	0.12423	.	.	.	.	.	T	0.43875	0.1267	.	.	.	.	.	.	.	.	.	.	.	.	T	0.50808	-0.8784	3	0.87932	D	0	.	.	.	.	.	.	.	.	R	10	.	ENSP00000381835:G10R	G	+	1	0	AC120114.1	29783157	0.222000	0.23652	0.057000	0.19452	0.074000	0.17049	-0.507000	0.06352	-0.706000	0.05028	-0.700000	0.03674	GGG	CTD-2574D22.5	-	-		0.592	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC440356	Clone_based_vega_gene	protein_coding	OTTHUMT00000255147.3	G	NM_006319		29875656	+1	no_errors	ENST00000398859	ensembl	human	known	70_37	rna	SNP	0.042	A
CDIPT	10423	genome.wustl.edu	37	16	29875700	29875700	+	5'Flank	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr16:29875700G>C	ENST00000219789.6	-	0	0				CDIPT_ENST00000570016.1_5'Flank|CDIPT_ENST00000563415.1_5'Flank|CDIPT_ENST00000569956.1_5'Flank|CDIPT_ENST00000566113.1_5'Flank|CDIPT-AS1_ENST00000565014.1_RNA|CDIPT-AS1_ENST00000398859.3_RNA|CDIPT_ENST00000561555.1_5'Flank	NM_006319.3	NP_006310.1	O14735	CDIPT_HUMAN	CDP-diacylglycerol--inositol 3-phosphatidyltransferase						CDP-diacylglycerol metabolic process (GO:0046341)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alcohol binding (GO:0043178)|carbohydrate binding (GO:0030246)|CDP-diacylglycerol-inositol 3-phosphatidyltransferase activity (GO:0003881)|diacylglycerol binding (GO:0019992)|manganese ion binding (GO:0030145)			endometrium(1)|lung(3)	4						CACCCTCCTTGAGAGGAGGTC	0.607																																																	0																																										SO:0001631	upstream_gene_variant	440356			AF014807	CCDS10657.1, CCDS67002.1	16p11.2	2012-11-19	2010-04-29		ENSG00000103502	ENSG00000103502	2.7.8.11		1769	protein-coding gene	gene with protein product	"""phosphatidylinositol synthase"""	605893	"""CDP-diacylglycerol--inositol 3-phosphatidyltransferase (phosphatidylinositol synthase)"""			9407135	Standard	NM_006319		Approved	PIS1, PIS	uc002dum.3	O14735	OTTHUMG00000177144		16.37:g.29875700G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUV0|H3BTV1|Q6FGU1|Q6ZN70	RNA	SNP	-	NULL	ENST00000219789.6	37	NULL	CCDS10657.1	16	.	.	.	.	.	.	.	.	.	.	G	6.734	0.504238	0.12822	.	.	ENSG00000214725	ENST00000398859	.	.	.	4.37	2.35	0.29111	.	.	.	.	.	T	0.43986	0.1272	.	.	.	.	.	.	.	.	.	.	.	.	T	0.52305	-0.8593	4	0.46703	T	0.11	.	5.4952	0.16799	0.113:0.205:0.682:0.0	.	.	.	.	F	24	.	ENSP00000381835:L24F	L	+	3	2	AC120114.1	29783201	0.001000	0.12720	0.005000	0.12908	0.110000	0.19582	0.354000	0.20146	0.561000	0.29186	-0.178000	0.13098	TTG	CTD-2574D22.5	-	-		0.607	CDIPT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC440356	Clone_based_vega_gene	protein_coding	OTTHUMT00000255147.3	G	NM_006319		29875700	+1	no_errors	ENST00000398859	ensembl	human	known	70_37	rna	SNP	0.003	C
LRIG2	9860	genome.wustl.edu	37	1	113667275	113667275	+	3'UTR	SNP	C	C	G			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:113667275C>G	ENST00000361127.5	+	0	3948				LRIG2_ENST00000492207.1_3'UTR	NM_014813.1	NP_055628.1	O94898	LRIG2_HUMAN	leucine-rich repeats and immunoglobulin-like domains 2						innervation (GO:0060384)|regulation of platelet-derived growth factor receptor signaling pathway (GO:0010640)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(2)|kidney(7)|large_intestine(3)|lung(10)|ovary(4)|prostate(2)|stomach(1)|urinary_tract(1)	31	Lung SC(450;0.246)	all_cancers(81;1.56e-05)|all_epithelial(167;2.62e-05)|all_lung(203;0.000665)|Lung NSC(69;0.000986)		Lung(183;0.0279)|Colorectal(144;0.0885)|COAD - Colon adenocarcinoma(174;0.134)|all cancers(265;0.139)|Epithelial(280;0.143)|LUSC - Lung squamous cell carcinoma(189;0.15)		TTTTTGTATTCTTGTGAATTT	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	9860			AB018349	CCDS30808.1	1p13.1	2013-01-11			ENSG00000198799	ENSG00000198799		"""Immunoglobulin superfamily / I-set domain containing"""	20889	protein-coding gene	gene with protein product		608869					Standard	XM_005271369		Approved	KIAA0806	uc001edf.1	O94898	OTTHUMG00000012133	ENST00000361127.5:c.*552C>G	1.37:g.113667275C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NSN2	RNA	SNP	-	NULL	ENST00000361127.5	37	NULL	CCDS30808.1	1																																																																																			LRIG2	-	-		0.368	LRIG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIG2	HGNC	protein_coding	OTTHUMT00000033549.2	C	NM_014813		113667275	+1	no_errors	ENST00000466161	ensembl	human	known	70_37	rna	SNP	0.998	G
LTBP3	4054	genome.wustl.edu	37	11	65320673	65320673	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:65320673G>T	ENST00000301873.5	-	5	1293	c.1025C>A	c.(1024-1026)cCc>cAc	p.P342H	LTBP3_ENST00000322147.4_Missense_Mutation_p.P342H|LTBP3_ENST00000536982.1_Intron	NM_001130144.2	NP_001123616.1	Q9NS15	LTBP3_HUMAN	latent transforming growth factor beta binding protein 3	342					bone morphogenesis (GO:0060349)|bone remodeling (GO:0046849)|extracellular matrix organization (GO:0030198)|lung saccule development (GO:0060430)|negative regulation of bone mineralization (GO:0030502)|negative regulation of chondrocyte differentiation (GO:0032331)|positive regulation of bone resorption (GO:0045780)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of mesenchymal stem cell proliferation (GO:1902462)|transforming growth factor beta activation (GO:0036363)|transforming growth factor beta receptor signaling pathway (GO:0007179)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|transforming growth factor beta binding (GO:0050431)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|prostate(2)|upper_aerodigestive_tract(3)	23						GTAGCCCTGGGGACAGTCAGC	0.632																																																	0													84.0	78.0	80.0					11																	65320673		2201	4297	6498	SO:0001583	missense	4054			AF135960	CCDS8103.1, CCDS44647.1	11q12	2011-10-20			ENSG00000168056	ENSG00000168056		"""Latent transforming growth factor, beta binding proteins"""	6716	protein-coding gene	gene with protein product		602090		LTBP2		7719025	Standard	NM_001164266		Approved		uc001oej.3	Q9NS15	OTTHUMG00000166575	ENST00000301873.5:c.1025C>A	11.37:g.65320673G>T	ENSP00000301873:p.Pro342His	Somatic		WXS	Illumina HiSeq	Phase_IV	O15107|Q96HB9|Q9H7K2|Q9UFN4	Missense_Mutation	SNP	pfam_EGF-like_Ca-bd,pfam_TB_dom,superfamily_TB_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom	p.P342H	ENST00000301873.5	37	c.1025	CCDS44647.1	11	.	.	.	.	.	.	.	.	.	.	G	21.6	4.179315	0.78564	.	.	ENSG00000168056	ENST00000322147;ENST00000301873;ENST00000530866;ENST00000530426	D;D;D;D	0.93547	-3.24;-3.24;-2.52;-3.24	4.51	4.51	0.55191	Matrix fibril-associated (2);	0.000000	0.85682	D	0.000000	D	0.95146	0.8427	L	0.49640	1.575	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.998;0.999	D	0.94963	0.8110	10	0.51188	T	0.08	.	14.7349	0.69409	0.0:0.0:1.0:0.0	.	253;225;342;342	E9PKW1;B9EG76;Q9NS15;Q9NS15-2	.;.;LTBP3_HUMAN;.	H	342;342;253;63	ENSP00000326647:P342H;ENSP00000301873:P342H;ENSP00000435276:P253H;ENSP00000432476:P63H	ENSP00000301873:P342H	P	-	2	0	LTBP3	65077249	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	8.899000	0.92544	2.336000	0.79503	0.505000	0.49811	CCC	LTBP3	-	superfamily_TB_dom		0.632	LTBP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LTBP3	HGNC	protein_coding	OTTHUMT00000390538.1	G	NM_021070		65320673	-1	no_errors	ENST00000301873	ensembl	human	known	70_37	missense	SNP	1.000	T
MCM7	4176	genome.wustl.edu	37	7	99695255	99695255	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:99695255G>A	ENST00000303887.5	-	9	1744	c.1099C>T	c.(1099-1101)Cga>Tga	p.R367*	MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Nonsense_Mutation_p.R191*	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	367	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCATGCCTCGAGGAGACTGG	0.517																																																	0													283.0	289.0	287.0					7																	99695255		2203	4300	6503	SO:0001587	stop_gained	4176				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1099C>T	7.37:g.99695255G>A	ENSP00000307288:p.Arg367*	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.R367*	ENST00000303887.5	37	c.1099	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	G	45	11.830953	0.99607	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	.	.	.	4.99	4.1	0.47936	.	0.134260	0.47455	D	0.000221	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-12.0391	12.4655	0.55755	0.0:0.0:0.8313:0.1687	.	.	.	.	X	367;304;260;191	.	ENSP00000307288:R367X	R	-	1	2	MCM7	99533191	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.409000	0.44583	1.312000	0.45043	-0.311000	0.09066	CGA	MCM7	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase		0.517	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	G			99695255	-1	no_errors	ENST00000303887	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MCM7	4176	genome.wustl.edu	37	7	99695255	99695255	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:99695255G>A	ENST00000303887.5	-	9	1744	c.1099C>T	c.(1099-1101)Cga>Tga	p.R367*	MCM7_ENST00000343023.6_Intron|MCM7_ENST00000354230.3_Nonsense_Mutation_p.R191*	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	367	MCM.				cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)			endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					TTCATGCCTCGAGGAGACTGG	0.517																																																	0													283.0	289.0	287.0					7																	99695255		2203	4300	6503	SO:0001587	stop_gained	4176				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.1099C>T	7.37:g.99695255G>A	ENSP00000307288:p.Arg367*	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.R367*	ENST00000303887.5	37	c.1099	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	G	45	11.830953	0.99607	.	.	ENSG00000166508	ENST00000303887;ENST00000542483;ENST00000362082;ENST00000354230	.	.	.	4.99	4.1	0.47936	.	0.134260	0.47455	D	0.000221	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-12.0391	12.4655	0.55755	0.0:0.0:0.8313:0.1687	.	.	.	.	X	367;304;260;191	.	ENSP00000307288:R367X	R	-	1	2	MCM7	99533191	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.409000	0.44583	1.312000	0.45043	-0.311000	0.09066	CGA	MCM7	-	pfam_MCM_DNA-dep_ATPase,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase		0.517	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	G			99695255	-1	no_errors	ENST00000303887	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MEPCE	56257	genome.wustl.edu	37	7	100028535	100028535	+	Silent	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:100028535C>A	ENST00000310512.2	+	1	1282	c.894C>A	c.(892-894)ggC>ggA	p.G298G	ZCWPW1_ENST00000324725.6_5'Flank|MEPCE_ENST00000414441.1_5'UTR|ZCWPW1_ENST00000398027.2_5'Flank|ZCWPW1_ENST00000360951.4_5'Flank	NM_019606.5	NP_062552.2	Q7L2J0	MEPCE_HUMAN	methylphosphate capping enzyme	298					negative regulation of chromatin binding (GO:0035562)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|RNA methylation (GO:0001510)|snRNA metabolic process (GO:0016073)|snRNA modification (GO:0040031)		poly(A) RNA binding (GO:0044822)|RNA methyltransferase activity (GO:0008173)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)			breast(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(2)|lung(9)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)	24	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					ACGGGGAGGGCGCCTCACAGC	0.672																																																	0													67.0	65.0	66.0					7																	100028535		2203	4300	6503	SO:0001819	synonymous_variant	56257			AF264752	CCDS5693.1, CCDS55136.1	7q22.1	2008-02-04	2007-07-26	2007-07-26	ENSG00000146834	ENSG00000146834			20247	protein-coding gene	gene with protein product		611478	"""bin3, bicoid-interacting 3, homolog (Drosophila)"""	BCDIN3		12358911, 17643375	Standard	NM_019606		Approved	FLJ20257, MePCE	uc003uuw.3	Q7L2J0	OTTHUMG00000155255	ENST00000310512.2:c.894C>A	7.37:g.100028535C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KP86|D6W5V7|Q9NPD4	Silent	SNP	pfam_Bin3	p.G298	ENST00000310512.2	37	c.894	CCDS5693.1	7																																																																																			MEPCE	-	NULL		0.672	MEPCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEPCE	HGNC	protein_coding	OTTHUMT00000339135.1	C			100028535	+1	no_errors	ENST00000310512	ensembl	human	known	70_37	silent	SNP	0.693	A
MRGPRX4	117196	genome.wustl.edu	37	11	18195401	18195401	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:18195401G>T	ENST00000314254.3	+	1	1018	c.598G>T	c.(598-600)Gtc>Ttc	p.V200F	RP11-113D6.6_ENST00000527671.1_Intron	NM_054032.3	NP_473373.2	Q96LA9	MRGX4_HUMAN	MAS-related GPR, member X4	200						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						GGTCCTGCTGGTCAGGATCCT	0.552																																																	0													118.0	112.0	114.0					11																	18195401		2199	4293	6492	SO:0001583	missense	117196			AY042216	CCDS7831.1	11p15.1	2013-10-10			ENSG00000179817	ENSG00000179817		"""GPCR / Class A : Orphans"""	17617	protein-coding gene	gene with protein product		607230				11551509	Standard	NM_054032		Approved	MRGX4	uc001mnv.1	Q96LA9	OTTHUMG00000166442	ENST00000314254.3:c.598G>T	11.37:g.18195401G>T	ENSP00000314042:p.Val200Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KNU3|Q3KNU4|Q502W0|Q8TDD6|Q8TDD7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.V200F	ENST00000314254.3	37	c.598	CCDS7831.1	11	.	.	.	.	.	.	.	.	.	.	G	6.061	0.379531	0.11466	.	.	ENSG00000179817	ENST00000314254	T	0.37411	1.2	2.85	-5.7	0.02421	GPCR, rhodopsin-like superfamily (1);	3.884170	0.01358	N	0.012151	T	0.37489	0.1005	M	0.75884	2.315	0.09310	N	1	B	0.24092	0.097	B	0.27262	0.078	T	0.28459	-1.0043	10	0.45353	T	0.12	.	6.0579	0.19822	0.3786:0.3532:0.2683:0.0	.	200	Q96LA9	MRGX4_HUMAN	F	200	ENSP00000314042:V200F	ENSP00000314042:V200F	V	+	1	0	MRGPRX4	18151977	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.567000	0.00916	-1.804000	0.01241	-1.179000	0.01719	GTC	MRGPRX4	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.552	MRGPRX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRGPRX4	HGNC	protein_coding	OTTHUMT00000389788.1	G	NM_054032		18195401	+1	no_errors	ENST00000314254	ensembl	human	known	70_37	missense	SNP	0.000	T
MUC4	4585	genome.wustl.edu	37	3	195507323	195507324	+	Missense_Mutation	DNP	TG	TG	CC	rs201618076		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	T|G	T|G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:195507323_195507324TG>CC	ENST00000463781.3	-	2	11586_11587	c.11127_11128CA>GG	c.(11125-11130)caCAcc>caGGcc	p.3709_3710HT>QA	MUC4_ENST00000349607.4_Intron|MUC4_ENST00000475231.1_Missense_Mutation_p.3709_3710HT>QA|MUC4_ENST00000346145.4_Intron	NM_018406.6	NP_060876.5	Q99102	MUC4_HUMAN	mucin 4, cell surface associated	0					cell-matrix adhesion (GO:0007160)|cellular protein metabolic process (GO:0044267)|maintenance of gastrointestinal epithelium (GO:0030277)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)|vesicle (GO:0031982)	ErbB-2 class receptor binding (GO:0005176)|extracellular matrix constituent, lubricant activity (GO:0030197)	p.H3709Q(1)		NS(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(5)|lung(23)|ovary(3)|prostate(8)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	51	all_cancers(143;1.11e-08)|Ovarian(172;0.0634)|Breast(254;0.206)	Lung NSC(153;0.191)	Epithelial(36;3.72e-24)|all cancers(36;6.22e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|Lung(62;4.65e-05)|LUSC - Lung squamous cell carcinoma(58;5.31e-05)	GBM - Glioblastoma multiforme(46;2.37e-05)		AGAGGGGTGGTGTGACCTGAGG	0.574																																																	1	Substitution - Missense(1)	kidney(1)																																								SO:0001583	missense	4585			AJ276359	CCDS3310.1, CCDS3311.1, CCDS54700.1	3q29	2007-01-19	2006-03-14		ENSG00000145113	ENSG00000145113		"""Mucins"""	7514	protein-coding gene	gene with protein product		158372	"""mucin 4, tracheobronchial"""			1673336	Standard	NM_004532		Approved		uc021xjp.1	Q99102	OTTHUMG00000151827	ENST00000463781.3:c.11127_11128delinsCC	3.37:g.195507323_195507324delinsCC	ENSP00000417498:p.H3709_T3710delinsQA	Somatic		WXS	Illumina HiSeq	Phase_IV	O95938|Q9GZM2|Q9GZV6|Q9H481|Q9H482|Q9H483|Q9H484|Q9H485|Q9H486|Q9H487|Q9H4D6|Q9H4D8|Q9NPJ0|Q9NY09|Q9NY75|Q9NY76|Q9NY77|Q9NY78|Q9NY79|Q9NY80|Q9NY81	Missense_Mutation	SNP	pfam_Nidogen_extracell_dom,pfam_AMOP,pfam_VWF_type-D,smart_Nidogen_extracell_dom,smart_AMOP,smart_VWF_type-D,smart_EG-like_dom,pfscan_AMOP,pfscan_EG-like_dom	p.T3710A|p.H3709Q	ENST00000463781.3	37	c.11128|c.11127	CCDS54700.1	3																																																																																			MUC4	-	NULL		0.574	MUC4-001	KNOWN	basic|CCDS	protein_coding	MUC4	HGNC	protein_coding	OTTHUMT00000324081.6	T|G	NM_018406		195507323|195507324	-1	no_errors	ENST00000463781	ensembl	human	known	70_37	missense	SNP	0.019|0.278	C
MYADM	91663	genome.wustl.edu	37	19	54376790	54376790	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:54376790G>A	ENST00000391769.2	+	3	287	c.7G>A	c.(7-9)Gtg>Atg	p.V3M	MYADM_ENST00000391771.1_Missense_Mutation_p.V3M|AC008440.5_ENST00000413496.2_RNA|MYADM_ENST00000336967.3_Missense_Mutation_p.V3M|MYADM_ENST00000391770.4_Missense_Mutation_p.V3M|MYADM_ENST00000391768.2_Missense_Mutation_p.V3M	NM_001020821.1	NP_001018657.1	Q96S97	MYADM_HUMAN	myeloid-associated differentiation marker	3					establishment of endothelial barrier (GO:0061028)|membrane raft organization (GO:0031579)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of gene expression (GO:0010629)|negative regulation of heterotypic cell-cell adhesion (GO:0034115)|negative regulation of protein kinase C signaling (GO:0090038)|negative regulation of protein phosphorylation (GO:0001933)|positive regulation of cell migration (GO:0030335)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|protein targeting to plasma membrane (GO:0072661)	cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|ruffle (GO:0001726)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	12	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(134;0.0488)		AGCCATGCCAGTGACGGTAAC	0.557											OREG0003650	type=REGULATORY REGION|Gene=MYADM|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													68.0	57.0	61.0					19																	54376790		2203	4299	6502	SO:0001583	missense	91663			AF087882	CCDS12866.1	19q13.33-q13.4	2004-07-23			ENSG00000179820	ENSG00000179820			7544	protein-coding gene	gene with protein product		609959				10733104, 12075932	Standard	NM_001020818		Approved		uc002qcl.3	Q96S97	OTTHUMG00000060775	ENST00000391769.2:c.7G>A	19.37:g.54376790G>A	ENSP00000375649:p.Val3Met	Somatic	999	WXS	Illumina HiSeq	Phase_IV	B2RE58|Q542Z1|Q7Z507|Q8N9R4|Q96CS6|Q96SK9	Missense_Mutation	SNP	pfam_MARVEL-like_dom	p.V3M	ENST00000391769.2	37	c.7	CCDS12866.1	19	.	.	.	.	.	.	.	.	.	.	G	9.771	1.172772	0.21704	.	.	ENSG00000179820	ENST00000421337;ENST00000336967;ENST00000391770;ENST00000448420;ENST00000439000;ENST00000391771;ENST00000415619;ENST00000391769;ENST00000391768;ENST00000414489	.	.	.	3.9	2.85	0.33270	.	0.676215	0.11544	U	0.553443	T	0.14270	0.0345	N	0.08118	0	0.09310	N	0.999999	P	0.50617	0.937	B	0.39258	0.295	T	0.04650	-1.0936	9	0.66056	D	0.02	-13.2712	6.7542	0.23503	0.1304:0.0:0.8696:0.0	.	3	Q96S97	MYADM_HUMAN	M	3	.	ENSP00000337222:V3M	V	+	1	0	MYADM	59068602	1.000000	0.71417	0.236000	0.24074	0.131000	0.20780	3.027000	0.49697	1.916000	0.55485	0.313000	0.20887	GTG	MYADM	-	NULL		0.557	MYADM-002	KNOWN	basic|appris_principal|CCDS	protein_coding	MYADM	HGNC	protein_coding	OTTHUMT00000134337.1	G	NM_138373		54376790	+1	no_errors	ENST00000336967	ensembl	human	known	70_37	missense	SNP	0.258	A
MYCNOS	10408	genome.wustl.edu	37	2	16076490	16076491	+	RNA	INS	-	-	T	rs397983948|rs79296832|rs79258870|rs70961437|rs537965330	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:16076490_16076491insT	ENST00000420452.1	-	0	1208_1209				MYCNOS_ENST00000453400.1_RNA|MYCNUN_ENST00000433810.1_lincRNA			P40205	NCYM_HUMAN	MYCN opposite strand						multicellular organismal development (GO:0007275)												CTCAGTAGATCttttttttttt	0.431													|||unknown(HR)	1958	0.390974	0.3086	0.3199	5008	,	,		17929	0.246		0.5467	False		,,,				2504	0.5419																0																																												10408			S49953		2p24.1	2014-07-18	2014-01-07	2011-08-30	ENSG00000233718	ENSG00000233718		"""-"""	16911	non-coding RNA	RNA, long non-coding	"""MYCN antisense RNA 1"", ""DNA binding transcriptional activator"""	605374	"""v-myc myelocytomatosis viral related oncogene, neuroblastoma derived (avian) opposite strand"", ""MYCN opposite strand/antisense RNA (non-protein coding)"", ""MYCN opposite strand/antisense RNA"""			1419902, 12880964, 19615087, 24391509	Standard	NR_026766		Approved	NCYM, N-CYM, MYCN-AS1	uc002rch.2	P40205	OTTHUMG00000151741		2.37:g.16076501_16076501dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TD4	RNA	INS	-	NULL	ENST00000420452.1	37	NULL		2																																																																																			MYCNOS	-	-		0.431	MYCNOS-001	KNOWN	basic	antisense	MYCNOS	HGNC	antisense	OTTHUMT00000095467.1	-			16076491	-1	no_errors	ENST00000420452	ensembl	human	known	70_37	rna	INS	0.001:0.002	T
MYH3	4621	genome.wustl.edu	37	17	10541420	10541420	+	Silent	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:10541420G>A	ENST00000583535.1	-	27	3756	c.3669C>T	c.(3667-3669)agC>agT	p.S1223S	MYH3_ENST00000226209.7_Silent_p.S1223S	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1223					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						GCTTGAACTCGCTCTTCTCCT	0.582																																																	0													111.0	97.0	101.0					17																	10541420		2203	4300	6503	SO:0001819	synonymous_variant	4621				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.3669C>T	17.37:g.10541420G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15492	Silent	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1223	ENST00000583535.1	37	c.3669	CCDS11157.1	17																																																																																			MYH3	-	pfam_Myosin_tail,superfamily_Prefoldin		0.582	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	G	NM_002470		10541420	-1	no_errors	ENST00000226209	ensembl	human	known	70_37	silent	SNP	0.998	A
MYO15A	51168	genome.wustl.edu	37	17	18023480	18023480	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr17:18023480G>A	ENST00000205890.5	+	2	1704	c.1366G>A	c.(1366-1368)Gcc>Acc	p.A456T		NM_016239.3	NP_057323.3	Q9UKN7	MYO15_HUMAN	myosin XVA	456					inner ear morphogenesis (GO:0042472)|locomotory behavior (GO:0007626)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|stereocilium (GO:0032420)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(5)|central_nervous_system(2)|endometrium(17)|kidney(3)|large_intestine(16)|lung(27)|ovary(3)|pancreas(1)|prostate(6)|skin(13)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	99	all_neural(463;0.228)					GCCCAGCGCCGCCTTCTTCGA	0.647																																																	0													34.0	41.0	39.0					17																	18023480		2128	4225	6353	SO:0001583	missense	51168			AF144094	CCDS42271.1	17p11.2	2011-09-27			ENSG00000091536	ENSG00000091536		"""Myosins / Myosin superfamily : Class XV"""	7594	protein-coding gene	gene with protein product		602666		DFNB3, MYO15		9603736	Standard	NM_016239		Approved		uc021trl.1	Q9UKN7	OTTHUMG00000059390	ENST00000205890.5:c.1366G>A	17.37:g.18023480G>A	ENSP00000205890:p.Ala456Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFC7	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_MyTH4_dom,pfam_SH3_2,pfam_FERM_central,pfam_IQ_motif_EF-hand-BS,superfamily_FERM_central,superfamily_SH3_domain,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_MyTH4_dom,smart_SH3_domain,smart_Band_41_domain,pfscan_FERM_domain,pfscan_IQ_motif_EF-hand-BS,pfscan_MyTH4_dom,prints_Myosin_head_motor_dom	p.A456T	ENST00000205890.5	37	c.1366	CCDS42271.1	17	.	.	.	.	.	.	.	.	.	.	G	16.63	3.176966	0.57692	.	.	ENSG00000091536	ENST00000205890	T	0.32515	1.45	5.4	2.12	0.27331	.	.	.	.	.	T	0.17746	0.0426	N	0.24115	0.695	0.39996	D	0.975108	B	0.13594	0.008	B	0.04013	0.001	T	0.08086	-1.0739	9	0.66056	D	0.02	.	4.4772	0.11750	0.194:0.0:0.5273:0.2786	.	456	Q9UKN7	MYO15_HUMAN	T	456	ENSP00000205890:A456T	ENSP00000205890:A456T	A	+	1	0	MYO15A	17964205	0.922000	0.31269	0.534000	0.28014	0.849000	0.48306	1.407000	0.34657	0.665000	0.31066	-0.254000	0.11334	GCC	MYO15A	-	NULL		0.647	MYO15A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO15A	HGNC	protein_coding	OTTHUMT00000132048.1	G	NM_016239		18023480	+1	no_errors	ENST00000205890	ensembl	human	known	70_37	missense	SNP	0.293	A
NICN1	84276	genome.wustl.edu	37	3	49460631	49460631	+	3'UTR	SNP	G	G	T	rs556214894		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:49460631G>T	ENST00000273598.3	-	0	2363				AMT_ENST00000395338.2_5'Flank|NICN1-AS1_ENST00000424915.1_RNA|AMT_ENST00000273588.3_5'Flank|AMT_ENST00000476226.1_5'Flank|AMT_ENST00000538581.1_5'Flank|NICN1_ENST00000422593.1_5'Flank|AMT_ENST00000458307.2_5'Flank|AMT_ENST00000546031.1_5'Flank	NM_032316.3	NP_115692.1	Q9BSH3	NICN1_HUMAN	nicolin 1							microtubule (GO:0005874)|nucleus (GO:0005634)				kidney(1)|large_intestine(3)|lung(1)	5				BRCA - Breast invasive adenocarcinoma(193;4.52e-05)|Kidney(197;0.00217)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)		GAACTCCCCCGAGAAAACTGT	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	100874017			AJ299740	CCDS2798.1	3p21.31	2008-07-18			ENSG00000145029	ENSG00000145029			18317	protein-coding gene	gene with protein product		611516				12392556	Standard	NM_032316		Approved	MGC12936	uc003cwz.1	Q9BSH3	OTTHUMG00000156848	ENST00000273598.3:c.*1635C>A	3.37:g.49460631G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IZQ2	RNA	SNP	-	NULL	ENST00000273598.3	37	NULL	CCDS2798.1	3																																																																																			NICN1-AS1	-	-		0.512	NICN1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NICN1-AS1	HGNC	protein_coding	OTTHUMT00000346224.3	G	NM_032316		49460631	+1	no_errors	ENST00000424915	ensembl	human	known	70_37	rna	SNP	0.000	T
NISCH	11188	genome.wustl.edu	37	3	52513765	52513765	+	Splice_Site	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:52513765G>T	ENST00000479054.1	+	13	1375	c.1303G>T	c.(1303-1305)Gtc>Ttc	p.V435F	NISCH_ENST00000420808.2_Splice_Site_p.V435F|NISCH_ENST00000488380.1_Splice_Site_p.V435F|NISCH_ENST00000345716.4_Splice_Site_p.V435F			Q9Y2I1	NISCH_HUMAN	nischarin	435	Interaction with PAK1. {ECO:0000250}.|Necessary for homooligomerization and targeting to endosomes.				actin cytoskeleton organization (GO:0030036)|apoptotic process (GO:0006915)|glucose metabolic process (GO:0006006)|negative regulation of cell migration (GO:0030336)|norepinephrine secretion (GO:0048243)|Rac protein signal transduction (GO:0016601)|regulation of blood pressure (GO:0008217)|regulation of synaptic transmission, GABAergic (GO:0032228)	cytosol (GO:0005829)|endosome (GO:0005768)|membrane (GO:0016020)|plasma membrane (GO:0005886)	G-protein coupled amine receptor activity (GO:0008227)|identical protein binding (GO:0042802)|phosphatidylinositol binding (GO:0035091)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(9)|ovary(4)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(4)	33				BRCA - Breast invasive adenocarcinoma(193;1.93e-05)|Kidney(197;0.00216)|KIRC - Kidney renal clear cell carcinoma(197;0.00244)|OV - Ovarian serous cystadenocarcinoma(275;0.0577)	Tizanidine(DB00697)	GATGCTCTAGGTCTGTCTGGA	0.522																																																	0													75.0	61.0	66.0					3																	52513765		2203	4300	6503	SO:0001630	splice_region_variant	11188			AF082516	CCDS33767.1, CCDS63651.1, CCDS63652.1	3p21.1	2008-07-18			ENSG00000010322	ENSG00000010322			18006	protein-coding gene	gene with protein product	"""imidazoline receptor candidate"", ""I-1 receptor candidate protein"", ""imidazoline receptor antisera selected"""	615507				11912194, 10882231	Standard	NM_007184		Approved	KIAA0975, I-1, IRAS	uc003ded.4	Q9Y2I1	OTTHUMG00000158571	ENST00000479054.1:c.1303-1G>T	3.37:g.52513765G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9J245|Q6PGP3|Q6PIB4|Q7L8M3|Q7Z2X6|Q9UES6|Q9UEU4|Q9UFW3	Missense_Mutation	SNP	pfam_Phox,pfam_Leu-rich_rpt,superfamily_Phox,smart_Phox,pfscan_Phox	p.V435F	ENST00000479054.1	37	c.1303	CCDS33767.1	3	.	.	.	.	.	.	.	.	.	.	G	18.05	3.537001	0.65085	.	.	ENSG00000010322	ENST00000479054;ENST00000345716;ENST00000488380;ENST00000420808	T;T;T;T	0.09817	2.94;2.94;3.12;3.04	5.79	3.98	0.46160	.	0.056806	0.64402	D	0.000001	T	0.21186	0.0510	L	0.50333	1.59	0.53688	D	0.999976	D;D	0.65815	0.958;0.995	P;P	0.59056	0.642;0.851	T	0.00440	-1.1738	9	.	.	.	-37.0529	12.0673	0.53596	0.1287:0.0:0.8713:0.0	.	435;435	Q9Y2I1;C9J715	NISCH_HUMAN;.	F	435	ENSP00000418232:V435F;ENSP00000339958:V435F;ENSP00000417812:V435F;ENSP00000392484:V435F	.	V	+	1	0	NISCH	52488805	1.000000	0.71417	0.999000	0.59377	0.957000	0.61999	5.936000	0.70153	0.786000	0.33708	0.655000	0.94253	GTC	NISCH	-	NULL		0.522	NISCH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NISCH	HGNC	protein_coding	OTTHUMT00000351357.1	G	NM_007184	Missense_Mutation	52513765	+1	no_errors	ENST00000345716	ensembl	human	known	70_37	missense	SNP	1.000	T
P2RX6	9127	genome.wustl.edu	37	22	21380313	21380313	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr22:21380313G>C	ENST00000413302.2	+	10	1146	c.998G>C	c.(997-999)gGg>gCg	p.G333A	P2RX6_ENST00000443995.3_Missense_Mutation_p.G280A|P2RX6_ENST00000402329.3_3'UTR|P2RX6_ENST00000401443.1_Missense_Mutation_p.G307A|P2RX6_ENST00000336296.2_Missense_Mutation_p.G323A			O15547	P2RX6_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 6	333					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|muscle contraction (GO:0006936)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)	ATP binding (GO:0005524)|channel activity (GO:0015267)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|purinergic nucleotide receptor activity (GO:0001614)|transmembrane signaling receptor activity (GO:0004888)										GGGAAGTTCGGGCTCATCCCC	0.657																																																	0													81.0	58.0	66.0					22																	21380313		2203	4299	6502	SO:0001583	missense	9127				CCDS13788.2, CCDS54504.1	22q11.21	2012-01-17	2008-03-28	2008-03-28	ENSG00000099957	ENSG00000099957		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	8538	protein-coding gene	gene with protein product		608077	"""purinergic receptor P2X-like 1, orphan receptor"""	P2RXL1		9242461, 10591208, 8786426	Standard	NM_005446		Approved	P2XM, MGC129625, P2X6	uc010gsu.1	O15547	OTTHUMG00000150689	ENST00000413302.2:c.998G>C	22.37:g.21380313G>C	ENSP00000416193:p.Gly333Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	F6V3D7|Q32MB6|Q58F04|Q6IC33|Q9UL50	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X6_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.G333A	ENST00000413302.2	37	c.998	CCDS13788.2	22	.	.	.	.	.	.	.	.	.	.	G	11.46	1.643969	0.29246	.	.	ENSG00000099957	ENST00000413302;ENST00000336296;ENST00000401443;ENST00000443995	T;T;T;T	0.04049	3.72;3.72;3.72;3.72	5.07	4.03	0.46877	.	0.110360	0.40222	N	0.001143	T	0.05547	0.0146	L	0.38838	1.175	0.27400	N	0.95487	B;B	0.27997	0.117;0.197	B;B	0.30716	0.103;0.119	T	0.19257	-1.0311	10	0.52906	T	0.07	-28.6049	11.3651	0.49666	0.0:0.1914:0.8086:0.0	.	333;307	O15547;F6V3D7	P2RX6_HUMAN;.	A	333;323;307;280	ENSP00000416193:G333A;ENSP00000338797:G323A;ENSP00000385309:G307A;ENSP00000408088:G280A	ENSP00000338797:G323A	G	+	2	0	P2RX6	19710313	0.124000	0.22315	0.979000	0.43373	0.248000	0.25809	1.464000	0.35288	1.462000	0.47948	0.655000	0.94253	GGG	P2RX6	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor		0.657	P2RX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	P2RX6	HGNC	protein_coding	OTTHUMT00000319625.2	G	NM_005446		21380313	+1	no_errors	ENST00000413302	ensembl	human	known	70_37	missense	SNP	0.909	C
PAN2	9924	genome.wustl.edu	37	12	56720435	56720435	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:56720435C>A	ENST00000425394.2	-	7	1604	c.1228G>T	c.(1228-1230)Gat>Tat	p.D410Y	PAN2_ENST00000440411.3_Missense_Mutation_p.D410Y|PAN2_ENST00000548043.1_Missense_Mutation_p.D410Y|PAN2_ENST00000257931.5_Missense_Mutation_p.D410Y	NM_001127460.2	NP_001120932	Q9HBH5	RDH14_HUMAN	PAN2 poly(A) specific ribonuclease subunit	0					osteoblast differentiation (GO:0001649)	endoplasmic reticulum (GO:0005783)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	oxidoreductase activity (GO:0016491)			NS(1)|breast(2)|endometrium(2)|kidney(2)|large_intestine(6)|liver(1)|lung(18)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	41					Vitamin A(DB00162)	GCAGGCCAATCAGAGAGAAGT	0.592																																																	0													53.0	47.0	49.0					12																	56720435		2203	4299	6502	SO:0001583	missense	9924			AB014610	CCDS8915.1, CCDS44922.1, CCDS53802.1	12q13.2	2014-03-27	2014-03-27	2008-01-08		ENSG00000135473		"""Ubiquitin-specific peptidases"""	20074	protein-coding gene	gene with protein product	"""PAN2 homolog, PABP1 dependent poly A specific ribonuclease subunit (S. cerevisiae)"""		"""ubiquitin specific protease 52"", ""ubiquitin specific peptidase 52"", ""PAN2 poly(A) specific ribonuclease subunit homolog (S. cerevisiae)"""	USP52		12838346, 14583602	Standard	NM_014871		Approved	KIAA0710, hPAN2	uc001skx.3	Q504Q3	OTTHUMG00000170412	ENST00000425394.2:c.1228G>T	12.37:g.56720435C>A	ENSP00000401721:p.Asp410Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Exonuclease_RNaseT/DNA_pol3,pfam_Peptidase_C19,superfamily_RNaseH-like_dom,superfamily_WD40_repeat_dom,smart_Exonuclease,pfscan_Peptidase_C19	p.D410Y	ENST00000425394.2	37	c.1228	CCDS44922.1	12	.	.	.	.	.	.	.	.	.	.	C	19.47	3.834456	0.71373	.	.	ENSG00000135473	ENST00000425394;ENST00000440411;ENST00000257931;ENST00000548043	T;T;T;T	0.05447	3.44;3.44;3.44;3.44	5.08	5.08	0.68730	.	0.051850	0.64402	D	0.000001	T	0.20659	0.0497	M	0.76574	2.34	0.80722	D	1	P;P;D	0.60160	0.843;0.716;0.987	P;B;P	0.55999	0.544;0.407;0.789	T	0.00119	-1.2032	10	0.48119	T	0.1	-21.3208	17.7745	0.88503	0.0:1.0:0.0:0.0	.	410;410;410	Q504Q3-3;Q504Q3-2;Q504Q3	.;.;PAN2_HUMAN	Y	410	ENSP00000401721:D410Y;ENSP00000388231:D410Y;ENSP00000257931:D410Y;ENSP00000449861:D410Y	ENSP00000257931:D410Y	D	-	1	0	PAN2	55006702	1.000000	0.71417	0.848000	0.33437	0.990000	0.78478	7.193000	0.77780	2.803000	0.96430	0.585000	0.79938	GAT	PAN2	-	NULL		0.592	PAN2-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAN2	HGNC	protein_coding	OTTHUMT00000409024.1	C	NM_014871		56720435	-1	no_errors	ENST00000425394	ensembl	human	known	70_37	missense	SNP	1.000	A
PKHD1	5314	genome.wustl.edu	37	6	51701256	51701256	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr6:51701256C>A	ENST00000371117.3	-	51	8394	c.8119G>T	c.(8119-8121)Ggc>Tgc	p.G2707C	PKHD1_ENST00000340994.4_Missense_Mutation_p.G2707C	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2707					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGAACTTGGCCTTCACCTGAA	0.393																																																	0													139.0	117.0	124.0					6																	51701256		2203	4300	6503	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8119G>T	6.37:g.51701256C>A	ENSP00000360158:p.Gly2707Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.G2707C	ENST00000371117.3	37	c.8119	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220879	0.79464	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88509	-2.19;-2.39	6.17	6.17	0.99709	.	0.135138	0.51477	D	0.000085	D	0.92779	0.7704	L	0.59436	1.845	0.43010	D	0.994543	D;D;D	0.76494	0.999;0.996;0.999	D;P;D	0.71656	0.974;0.794;0.974	D	0.92445	0.5965	10	0.72032	D	0.01	.	19.4432	0.94831	0.0:1.0:0.0:0.0	.	2707;2707;2707	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	C	2707	ENSP00000360158:G2707C;ENSP00000341097:G2707C	ENSP00000341097:G2707C	G	-	1	0	PKHD1	51809215	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	4.285000	0.58989	2.941000	0.99782	0.655000	0.94253	GGC	PKHD1	-	NULL		0.393	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	C	NM_138694		51701256	-1	no_errors	ENST00000371117	ensembl	human	known	70_37	missense	SNP	1.000	A
PKHD1	5314	genome.wustl.edu	37	6	51701256	51701256	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr6:51701256C>A	ENST00000371117.3	-	51	8394	c.8119G>T	c.(8119-8121)Ggc>Tgc	p.G2707C	PKHD1_ENST00000340994.4_Missense_Mutation_p.G2707C	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	2707					cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					TGAACTTGGCCTTCACCTGAA	0.393																																																	0													139.0	117.0	124.0					6																	51701256		2203	4300	6503	SO:0001583	missense	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.8119G>T	6.37:g.51701256C>A	ENSP00000360158:p.Gly2707Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.G2707C	ENST00000371117.3	37	c.8119	CCDS4935.1	6	.	.	.	.	.	.	.	.	.	.	C	21.9	4.220879	0.79464	.	.	ENSG00000170927	ENST00000371117;ENST00000340994;ENST00000393616	D;D	0.88509	-2.19;-2.39	6.17	6.17	0.99709	.	0.135138	0.51477	D	0.000085	D	0.92779	0.7704	L	0.59436	1.845	0.43010	D	0.994543	D;D;D	0.76494	0.999;0.996;0.999	D;P;D	0.71656	0.974;0.794;0.974	D	0.92445	0.5965	10	0.72032	D	0.01	.	19.4432	0.94831	0.0:1.0:0.0:0.0	.	2707;2707;2707	A8MVM9;P08F94-2;P08F94	.;.;PKHD1_HUMAN	C	2707	ENSP00000360158:G2707C;ENSP00000341097:G2707C	ENSP00000341097:G2707C	G	-	1	0	PKHD1	51809215	1.000000	0.71417	1.000000	0.80357	0.844000	0.47949	4.285000	0.58989	2.941000	0.99782	0.655000	0.94253	GGC	PKHD1	-	NULL		0.393	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	C	NM_138694		51701256	-1	no_errors	ENST00000371117	ensembl	human	known	70_37	missense	SNP	1.000	A
PLXNA1	5361	genome.wustl.edu	37	3	126736417	126736417	+	Silent	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:126736417C>T	ENST00000393409.2	+	17	3426	c.3426C>T	c.(3424-3426)acC>acT	p.T1142T	PLXNA1_ENST00000251772.4_Silent_p.T1119T	NM_032242.3	NP_115618.3	Q9UIW2	PLXA1_HUMAN	plexin A1	1142	IPT/TIG 3.				axon guidance (GO:0007411)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|multicellular organismal development (GO:0007275)|regulation of smooth muscle cell migration (GO:0014910)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|semaphorin receptor complex (GO:0002116)	receptor activity (GO:0004872)|semaphorin receptor activity (GO:0017154)			breast(3)|central_nervous_system(5)|endometrium(10)|kidney(5)|large_intestine(4)|lung(32)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	67				GBM - Glioblastoma multiforme(114;0.155)		TCAACTCCACCTCCTTCCTCT	0.647																																																	0													162.0	159.0	160.0					3																	126736417		2203	4300	6503	SO:0001819	synonymous_variant	5361			X87832	CCDS33847.1, CCDS33847.2	3q21.2	2006-12-19				ENSG00000114554		"""Plexins"""	9099	protein-coding gene	gene with protein product		601055		PLXN1		8570614	Standard	NM_032242		Approved	NOV	uc003ejg.3	Q9UIW2		ENST00000393409.2:c.3426C>T	3.37:g.126736417C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_Semaphorin/CD100_Ag,pfam_IPT_TIG_rcpt,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.T1142	ENST00000393409.2	37	c.3426	CCDS33847.2	3																																																																																			PLXNA1	-	superfamily_Ig_E-set,smart_IPT_TIG_rcpt		0.647	PLXNA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNA1	HGNC	protein_coding	OTTHUMT00000356451.1	C	NM_032242		126736417	+1	no_errors	ENST00000393409	ensembl	human	known	70_37	silent	SNP	0.873	T
POLL	27343	genome.wustl.edu	37	10	103341567	103341568	+	Intron	INS	-	-	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr10:103341567_103341568insT	ENST00000370162.3	-	7	1689				POLL_ENST00000463515.1_5'UTR|POLL_ENST00000456836.2_Intron|POLL_ENST00000370172.1_Intron|POLL_ENST00000370168.3_Intron|POLL_ENST00000370169.1_Intron|DPCD_ENST00000416979.2_Intron|POLL_ENST00000370158.3_Intron|DPCD_ENST00000470165.1_Intron|POLL_ENST00000299206.4_Intron|POLL_ENST00000339310.3_Intron	NM_001174084.1|NM_001174085.1|NM_013274.3	NP_001167555.1|NP_001167556.1|NP_037406.1	Q9UGP5	DPOLL_HUMAN	polymerase (DNA directed), lambda						DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|nucleotide-excision repair (GO:0006289)|somatic hypermutation of immunoglobulin genes (GO:0016446)	nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|lyase activity (GO:0016829)|metal ion binding (GO:0046872)			biliary_tract(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(2)	19		Colorectal(252;0.234)		Epithelial(162;1.55e-08)|all cancers(201;6.64e-07)		TTAACTCAAtcttttttttttt	0.401								DNA polymerases (catalytic subunits)																																									0																																										SO:0001627	intron_variant	27343			AF161019	CCDS7513.1	10q23	2012-05-18			ENSG00000166169	ENSG00000166169		"""DNA polymerases"""	9184	protein-coding gene	gene with protein product		606343				17686665	Standard	NM_001174084		Approved		uc001kti.2	Q9UGP5	OTTHUMG00000018933	ENST00000370162.3:c.1194+951->A	10.37:g.103341578_103341578dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DR76|Q5JQP5|Q6NUM2|Q9BTN8|Q9HA10|Q9HB35	RNA	INS	-	NULL	ENST00000370162.3	37	NULL	CCDS7513.1	10																																																																																			POLL	-	-		0.401	POLL-202	KNOWN	basic|appris_principal|CCDS	protein_coding	POLL	HGNC	protein_coding	OTTHUMT00000049946.1	-	NM_013274		103341568	-1	no_errors	ENST00000463515	ensembl	human	known	70_37	rna	INS	0.001:0.002	T
POMZP3	22932	genome.wustl.edu	37	7	76239524	76239524	+	3'UTR	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:76239524C>A	ENST00000310842.4	-	0	1268				POMZP3_ENST00000275569.4_3'UTR|UPK3B_ENST00000419923.2_Intron|UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion											kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				ACATCTGCTTCTTCTGTCACT	0.522																																																	0													91.0	87.0	88.0					7																	76239524		2203	4300	6503	SO:0001624	3_prime_UTR_variant	22932			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.*20G>T	7.37:g.76239524C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	F6STJ3|Q12903|Q9BWB4	RNA	SNP	-	NULL	ENST00000310842.4	37	NULL	CCDS43606.1	7																																																																																			POMZP3	-	-		0.522	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMZP3	HGNC	protein_coding	OTTHUMT00000341775.1	C	NM_012230		76239524	-1	no_errors	ENST00000454656	ensembl	human	known	70_37	rna	SNP	0.587	A
PRB4	5545	genome.wustl.edu	37	12	11461706	11461706	+	Missense_Mutation	SNP	G	G	T	rs12308381		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:11461706G>T	ENST00000535904.1	-	3	244	c.211C>A	c.(211-213)Ccc>Acc	p.P71T	PRB4_ENST00000445719.2_Missense_Mutation_p.P71T|PRB4_ENST00000279575.1_Missense_Mutation_p.P71T			P10163	PRB4_HUMAN	proline-rich protein BstNI subfamily 4	92	9.5 X 21 AA tandem repeats of K-P-[EQ]- [GR]-[PR]-[PR]-P-Q-G-G-N-Q-[PS]-[QH]- [RG]-[PT]-P-P-[PH]-P-G.					extracellular region (GO:0005576)				breast(2)|endometrium(2)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|skin(4)|upper_aerodigestive_tract(3)	30						GGAGGTGGGGGACCTTGGGAC	0.627										HNSCC(22;0.051)																																							0													263.0	287.0	279.0					12																	11461706		2203	4300	6503	SO:0001583	missense	5545				CCDS8641.1, CCDS58208.1	12p13.2	2012-10-02			ENSG00000230657	ENSG00000230657			9340	protein-coding gene	gene with protein product		180990					Standard	NM_002723		Approved		uc001qzt.4	P10163	OTTHUMG00000169116	ENST00000535904.1:c.211C>A	12.37:g.11461706G>T	ENSP00000442834:p.Pro71Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L439|O00600|P02813|P10161|P10162|P81489	Missense_Mutation	SNP	NULL	p.P71T	ENST00000535904.1	37	c.211	CCDS8641.1	12	.	.	.	.	.	.	.	.	.	.	.	3.718	-0.058126	0.07317	.	.	ENSG00000230657	ENST00000279575;ENST00000535904;ENST00000445719	T;T;T	0.04083	3.71;3.71;3.71	0.956	-0.137	0.13469	.	.	.	.	.	T	0.06600	0.0169	L	0.57536	1.79	0.09310	N	1	D	0.55172	0.97	P	0.46275	0.51	T	0.29488	-1.0010	9	0.46703	T	0.11	.	3.9433	0.09338	0.0:0.0:0.5853:0.4147	rs12308381	71	E9PAL0	.	T	71	ENSP00000279575:P71T;ENSP00000442834:P71T;ENSP00000412740:P71T	ENSP00000279575:P71T	P	-	1	0	PRB4	11352973	0.000000	0.05858	0.000000	0.03702	0.073000	0.16967	-0.059000	0.11731	-0.054000	0.13266	0.196000	0.17591	CCC	PRB4	-	NULL		0.627	PRB4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRB4	HGNC	protein_coding	OTTHUMT00000402308.1	G	NM_002723		11461706	-1	no_errors	ENST00000279575	ensembl	human	known	70_37	missense	SNP	0.001	T
RNASEH1	246243	genome.wustl.edu	37	2	3595526	3595526	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:3595526G>A	ENST00000315212.3	-	7	1124	c.769C>T	c.(769-771)Cag>Tag	p.Q257*	RP13-512J5.1_ENST00000438485.1_Nonsense_Mutation_p.Q8*	NM_002936.3	NP_002927.2	O60930	RNH1_HUMAN	ribonuclease H1	257	RNase H. {ECO:0000255|PROSITE- ProRule:PRU00408}.				mitochondrial DNA replication (GO:0006264)|RNA catabolic process (GO:0006401)|RNA phosphodiester bond hydrolysis (GO:0090501)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	magnesium ion binding (GO:0000287)|nucleic acid binding (GO:0003676)|ribonuclease activity (GO:0004540)|RNA binding (GO:0003723)|RNA-DNA hybrid ribonuclease activity (GO:0004523)			endometrium(1)|kidney(1)|lung(7)|ovary(1)|prostate(2)|skin(1)	13	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)			OV - Ovarian serous cystadenocarcinoma(76;0.0713)|Epithelial(75;0.167)|all cancers(51;0.22)		CTCACCCACTGAATGTCCATC	0.413																																																	0													167.0	143.0	151.0					2																	3595526		2203	4300	6503	SO:0001587	stop_gained	246243			AF039652	CCDS1647.1	2p25	2008-03-11			ENSG00000171865	ENSG00000171865	3.1.26.-		18466	protein-coding gene	gene with protein product	"""RNase H1"""	604123				12036296, 17964265	Standard	XR_244873		Approved		uc002qxt.3	O60930	OTTHUMG00000090279	ENST00000315212.3:c.769C>T	2.37:g.3595526G>A	ENSP00000313350:p.Gln257*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQU4|O60523|O60857|Q57Z93|Q5U0C1|Q6FHD4	Nonsense_Mutation	SNP	pfam_RNaseH_domain,pfam_RNase_H1_N,superfamily_RNaseH-like_dom,superfamily_Ribosomal_L9/RNase_H1_N,pirsf_RNase_H1_euk,pfscan_RNaseH_domain	p.Q257*	ENST00000315212.3	37	c.769	CCDS1647.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.487103	0.98316	.	.	ENSG00000255767;ENSG00000171865	ENST00000438485;ENST00000315212	.	.	.	5.39	4.47	0.54385	.	0.618268	0.16594	N	0.207637	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-3.6372	11.954	0.52970	0.0:0.0:0.7372:0.2628	.	.	.	.	X	8;257	.	ENSP00000313350:Q257X	Q	-	1	0	RNASEH1;RP13-512J5.1	3573401	0.997000	0.39634	0.997000	0.53966	0.524000	0.34500	1.920000	0.40025	2.679000	0.91253	0.591000	0.81541	CAG	RNASEH1	-	pfam_RNaseH_domain,superfamily_RNaseH-like_dom,pirsf_RNase_H1_euk,pfscan_RNaseH_domain		0.413	RNASEH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEH1	HGNC	protein_coding	OTTHUMT00000206605.2	G			3595526	-1	no_errors	ENST00000315212	ensembl	human	known	70_37	nonsense	SNP	0.992	A
TMEM259	91304	genome.wustl.edu	37	19	1021614	1021614	+	5'Flank	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:1021614C>T	ENST00000356663.3	-	0	0				RNU6-2_ENST00000384627.1_RNA|TMEM259_ENST00000333175.5_5'Flank	NM_001033026.1	NP_001028198.1	Q4ZIN3	MBRL_HUMAN	transmembrane protein 259							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)											attcgtgaagcgttccatatt	0.498																																																	0																																										SO:0001631	upstream_gene_variant	100873741			BC008957	CCDS12052.1, CCDS32862.1	19p13.3	2013-02-06	2013-02-06	2013-02-06	ENSG00000182087	ENSG00000182087			17039	protein-coding gene	gene with protein product	"""membralin"", ""aspecific BCL2 ARE-binding protein 1"""	611011	"""chromosome 19 open reading frame 6"""	C19orf6		12638133, 16084606	Standard	XM_005259675		Approved	MGC4022, ASBABP1, MBRL	uc002lqr.1	Q4ZIN3			19.37:g.1021614C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	O60392|Q8NF79|Q96H30	RNA	SNP	-	NULL	ENST00000356663.3	37	NULL	CCDS32862.1	19																																																																																			RNU6-26	-	-		0.498	TMEM259-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RNU6-26	HGNC	protein_coding	OTTHUMT00000458236.1	C	NM_033420		1021614	+1	no_errors	ENST00000384627	ensembl	human	known	70_37	rna	SNP	1.000	T
RNU7-22P	100147770	genome.wustl.edu	37	10	32462672	32462673	+	RNA	INS	-	-	AAAT	rs372023245|rs145096600|rs34358408|rs397722553	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr10:32462672_32462673insAAAT	ENST00000516673.1	+	0	61									RNA, U7 small nuclear 22 pseudogene																		ggaaagccccCaaataaataaa	0.322														2177	0.434704	0.2526	0.4582	5008	,	,		11422	0.6131		0.504	False		,,,				2504	0.409																0																																												100147770					10p11.22	2012-09-27			ENSG00000252482	ENSG00000252482			34118	pseudogene	RNA, pseudogene						18267300	Standard	NG_007609		Approved	U7.22					10.37:g.32462677_32462680dupAAAT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000516673.1	37	NULL		10																																																																																			RNU7-22P	-	-		0.322	RNU7-22P-201	KNOWN	basic	snRNA	RNU7-22P	HGNC	snRNA		-	NG_007609		32462673	+1	no_errors	ENST00000516673	ensembl	human	known	70_37	rna	INS	0.025:0.047	AAAT
RYR2	6262	genome.wustl.edu	37	1	237841392	237841392	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:237841392G>C	ENST00000366574.2	+	61	9192	c.8875G>C	c.(8875-8877)Gaa>Caa	p.E2959Q	RYR2_ENST00000609119.1_Intron|RYR2_ENST00000360064.6_Missense_Mutation_p.E2957Q|RYR2_ENST00000542537.1_Missense_Mutation_p.E2943Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2959					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTATGAACAAGAAATCAAGTT	0.358																																																	0													108.0	105.0	106.0					1																	237841392		1888	4107	5995	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8875G>C	1.37:g.237841392G>C	ENSP00000355533:p.Glu2959Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E2957Q	ENST00000366574.2	37	c.8869	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230383	0.58777	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;D;D	0.97016	-0.19;-4.18;-4.21	5.67	5.67	0.87782	.	0.088982	0.45126	D	0.000398	D	0.94155	0.8125	L	0.55481	1.735	0.80722	D	1	P	0.38395	0.629	B	0.28553	0.091	D	0.93827	0.7124	10	0.51188	T	0.08	.	19.774	0.96385	0.0:0.0:1.0:0.0	.	2959	Q92736	RYR2_HUMAN	Q	2959;2957;2943	ENSP00000355533:E2959Q;ENSP00000353174:E2957Q;ENSP00000443798:E2943Q	ENSP00000353174:E2957Q	E	+	1	0	RYR2	235908015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.485000	0.53208	2.679000	0.91253	0.591000	0.81541	GAA	RYR2	-	NULL		0.358	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	G	NM_001035		237841392	+1	no_errors	ENST00000360064	ensembl	human	known	70_37	missense	SNP	1.000	C
RYR2	6262	genome.wustl.edu	37	1	237841392	237841392	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:237841392G>C	ENST00000366574.2	+	61	9192	c.8875G>C	c.(8875-8877)Gaa>Caa	p.E2959Q	RYR2_ENST00000609119.1_Intron|RYR2_ENST00000360064.6_Missense_Mutation_p.E2957Q|RYR2_ENST00000542537.1_Missense_Mutation_p.E2943Q	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	2959					BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			TTATGAACAAGAAATCAAGTT	0.358																																																	0													108.0	105.0	106.0					1																	237841392		1888	4107	5995	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.8875G>C	1.37:g.237841392G>C	ENSP00000355533:p.Glu2959Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.E2957Q	ENST00000366574.2	37	c.8869	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	G	16.83	3.230383	0.58777	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	T;D;D	0.97016	-0.19;-4.18;-4.21	5.67	5.67	0.87782	.	0.088982	0.45126	D	0.000398	D	0.94155	0.8125	L	0.55481	1.735	0.80722	D	1	P	0.38395	0.629	B	0.28553	0.091	D	0.93827	0.7124	10	0.51188	T	0.08	.	19.774	0.96385	0.0:0.0:1.0:0.0	.	2959	Q92736	RYR2_HUMAN	Q	2959;2957;2943	ENSP00000355533:E2959Q;ENSP00000353174:E2957Q;ENSP00000443798:E2943Q	ENSP00000353174:E2957Q	E	+	1	0	RYR2	235908015	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.485000	0.53208	2.679000	0.91253	0.591000	0.81541	GAA	RYR2	-	NULL		0.358	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	G	NM_001035		237841392	+1	no_errors	ENST00000360064	ensembl	human	known	70_37	missense	SNP	1.000	C
SETD9	133383	genome.wustl.edu	37	5	56205485	56205485	+	Silent	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr5:56205485C>T	ENST00000285947.2	+	1	399	c.13C>T	c.(13-15)Ctg>Ttg	p.L5L	SETD9_ENST00000541720.1_Silent_p.L5L|SETD9_ENST00000475908.1_Intron|AC008937.3_ENST00000453721.1_RNA	NM_153706.3	NP_714917.2	Q8NE22	SETD9_HUMAN	SET domain containing 9	5							methyltransferase activity (GO:0008168)										GCCTGGCCGTCTGCTGCGGGG	0.731																																																	0													23.0	18.0	20.0					5																	56205485		2192	4282	6474	SO:0001819	synonymous_variant	133383			BC036528	CCDS3972.1	5q11.2	2012-02-23	2012-02-23	2012-02-23	ENSG00000155542	ENSG00000155542			28508	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 35"""	C5orf35		20930037	Standard	NM_153706		Approved	MGC33648	uc003jqx.3	Q8NE22	OTTHUMG00000059485	ENST00000285947.2:c.13C>T	5.37:g.56205485C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	F5H713	Silent	SNP	NULL	p.L5	ENST00000285947.2	37	c.13	CCDS3972.1	5																																																																																			SETD9	-	NULL		0.731	SETD9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD9	HGNC	protein_coding	OTTHUMT00000132304.2	C	NM_153706		56205485	+1	no_errors	ENST00000285947	ensembl	human	known	70_37	silent	SNP	0.924	T
SLC16A7	9194	genome.wustl.edu	37	12	60168711	60168711	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:60168711G>T	ENST00000261187.4	+	4	799	c.635G>T	c.(634-636)gGc>gTc	p.G212V	SLC16A7_ENST00000552432.1_Missense_Mutation_p.G212V|SLC16A7_ENST00000547379.1_Missense_Mutation_p.G212V|SLC16A7_ENST00000552024.1_Missense_Mutation_p.G212V|SLC16A7_ENST00000543448.1_Missense_Mutation_p.G113V	NM_004731.4	NP_004722.2	O60669	MOT2_HUMAN	solute carrier family 16 (monocarboxylate transporter), member 7	212					lactate transmembrane transport (GO:0035873)|pyruvate transmembrane transport (GO:1901475)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	lactate transmembrane transporter activity (GO:0015129)|pyruvate secondary active transmembrane transporter activity (GO:0005477)|pyruvate transmembrane transporter activity (GO:0050833)|secondary active monocarboxylate transmembrane transporter activity (GO:0015355)|symporter activity (GO:0015293)			endometrium(1)|large_intestine(14)|liver(2)|lung(11)|ovary(1)|skin(1)	30				GBM - Glioblastoma multiforme(3;0.0303)	Gamma Hydroxybutyric Acid(DB01440)|Niflumic Acid(DB04552)|Probenecid(DB01032)|Pyruvic acid(DB00119)	AATAAGACTGGCAAAACAGAA	0.373																																																	0													37.0	37.0	37.0					12																	60168711		2203	4300	6503	SO:0001583	missense	9194			AF049608	CCDS8961.1	12q14.1	2013-07-18	2013-07-18		ENSG00000118596	ENSG00000118596		"""Solute carriers"""	10928	protein-coding gene	gene with protein product		603654	"""solute carrier family 16 (monocarboxylic acid transporters), member 7"""			9786900	Standard	NM_004731		Approved	MCT2	uc001sqt.4	O60669	OTTHUMG00000169923	ENST00000261187.4:c.635G>T	12.37:g.60168711G>T	ENSP00000261187:p.Gly212Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NEM3|Q9UPB3	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt	p.G212V	ENST00000261187.4	37	c.635	CCDS8961.1	12	.	.	.	.	.	.	.	.	.	.	G	0.583	-0.836054	0.02713	.	.	ENSG00000118596	ENST00000552432;ENST00000547379;ENST00000552024;ENST00000548610;ENST00000261187;ENST00000543448;ENST00000548444	T;T;T;T;T;T;T	0.58060	0.36;0.36;0.36;0.36;0.36;0.36;0.36	5.76	-4.94	0.03057	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	2.676040	0.00735	N	0.000973	T	0.30947	0.0781	N	0.19112	0.55	0.09310	N	1	B	0.19583	0.037	B	0.22152	0.038	T	0.05289	-1.0894	9	.	.	.	.	0.7758	0.01032	0.4018:0.1946:0.2062:0.1974	.	212	O60669	MOT2_HUMAN	V	212;212;212;212;212;113;97	ENSP00000449547:G212V;ENSP00000448071:G212V;ENSP00000448742:G212V;ENSP00000446722:G212V;ENSP00000261187:G212V;ENSP00000443731:G113V;ENSP00000447814:G97V	.	G	+	2	0	SLC16A7	58454978	0.420000	0.25457	0.000000	0.03702	0.000000	0.00434	1.465000	0.35299	-1.128000	0.02922	-4.482000	0.00005	GGC	SLC16A7	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Monocarb_transpt		0.373	SLC16A7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC16A7	HGNC	protein_coding	OTTHUMT00000406587.1	G	NM_004731		60168711	+1	no_errors	ENST00000261187	ensembl	human	known	70_37	missense	SNP	0.000	T
SLC25A3P1	163742	genome.wustl.edu	37	1	53903859	53903859	+	RNA	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:53903859G>A	ENST00000566100.1	-	0	1379									solute carrier family 25 (mitochondrial carrier; phosphate carrier), member 3 pseudogene 1																		ACCCCCAAACGAAATGTTTGC	0.363																																																	0																																												163742					1p32.3	2013-05-22	2012-03-29		ENSG00000236253	ENSG00000236253		"""Solute carriers"""	26869	pseudogene	pseudogene			"""solute carrier family 24 (sodium/potassium/calcium exchanger), member 3 pseudogene 1"""				Standard	NR_002314		Approved	FLJ40434	uc009vzj.3		OTTHUMG00000008078		1.37:g.53903859G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000566100.1	37	NULL		1																																																																																			SLC25A3P1	-	-		0.363	SLC25A3P1-002	KNOWN	basic	processed_transcript	SLC25A3P1	HGNC	pseudogene	OTTHUMT00000422839.1	G	NM_178501		53903859	-1	no_errors	ENST00000566100	ensembl	human	known	70_37	rna	SNP	0.017	A
SLC27A3	11000	genome.wustl.edu	37	1	153752449	153752449	+	Missense_Mutation	SNP	G	G	A	rs35517522	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:153752449G>A	ENST00000368661.3	+	10	2229	c.2164G>A	c.(2164-2166)Gcc>Acc	p.A722T	SLC27A3_ENST00000484014.1_3'UTR|SLC27A3_ENST00000271857.2_Missense_Mutation_p.A803T	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	722					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCGGTACAGCGCCCTCCTGGC	0.612													G|||	4	0.000798722	0.0	0.0	5008	,	,		16361	0.0		0.001	False		,,,				2504	0.0031																0								G	THR/ALA	2,4404	4.2+/-10.8	0,2,2201	65.0	49.0	54.0		2164	2.3	0.3	1	dbSNP_126	54	11,8589	7.7+/-29.5	0,11,4289	yes	missense	SLC27A3	NM_024330.1	58	0,13,6490	AA,AG,GG		0.1279,0.0454,0.1	possibly-damaging	722/731	153752449	13,12993	2203	4300	6503	SO:0001583	missense	11000			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.2164G>A	1.37:g.153752449G>A	ENSP00000357650:p.Ala722Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.A722T	ENST00000368661.3	37	c.2164	CCDS1053.1	1	.	.	.	.	.	.	.	.	.	.	G	9.270	1.045440	0.19748	4.54E-4	0.001279	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.58060	0.36;0.39	4.36	2.34	0.29019	.	0.431406	0.23694	N	0.045485	T	0.18425	0.0442	L	0.56769	1.78	0.09310	N	0.999991	P	0.37061	0.58	B	0.30401	0.115	T	0.06716	-1.0811	10	0.15066	T	0.55	-8.528	5.003	0.14273	0.1078:0.0:0.6866:0.2057	rs35517522	722	Q5K4L6	S27A3_HUMAN	T	803;722	ENSP00000271857:A803T;ENSP00000357650:A722T	ENSP00000271857:A803T	A	+	1	0	SLC27A3	152019073	0.345000	0.24835	0.324000	0.25361	0.007000	0.05969	1.566000	0.36396	1.207000	0.43291	-0.224000	0.12420	GCC	SLC27A3	-	NULL		0.612	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A3	HGNC	protein_coding		G	NM_024330		153752449	+1	no_errors	ENST00000368661	ensembl	human	known	70_37	missense	SNP	0.384	A
SLC27A3	11000	genome.wustl.edu	37	1	153752449	153752449	+	Missense_Mutation	SNP	G	G	A	rs35517522	byFrequency	TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr1:153752449G>A	ENST00000368661.3	+	10	2229	c.2164G>A	c.(2164-2166)Gcc>Acc	p.A722T	SLC27A3_ENST00000484014.1_3'UTR|SLC27A3_ENST00000271857.2_Missense_Mutation_p.A803T	NM_024330.1	NP_077306.1	Q5K4L6	S27A3_HUMAN	solute carrier family 27 (fatty acid transporter), member 3	722					fatty acid metabolic process (GO:0006631)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)	fatty-acyl-CoA synthase activity (GO:0004321)|ligase activity (GO:0016874)|nucleotide binding (GO:0000166)			NS(1)|endometrium(1)|large_intestine(3)|lung(7)|ovary(1)|prostate(1)	14	all_lung(78;6.47e-32)|Lung NSC(65;2.52e-30)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.151)			CCGGTACAGCGCCCTCCTGGC	0.612													G|||	4	0.000798722	0.0	0.0	5008	,	,		16361	0.0		0.001	False		,,,				2504	0.0031																0								G	THR/ALA	2,4404	4.2+/-10.8	0,2,2201	65.0	49.0	54.0		2164	2.3	0.3	1	dbSNP_126	54	11,8589	7.7+/-29.5	0,11,4289	yes	missense	SLC27A3	NM_024330.1	58	0,13,6490	AA,AG,GG		0.1279,0.0454,0.1	possibly-damaging	722/731	153752449	13,12993	2203	4300	6503	SO:0001583	missense	11000			BC009916	CCDS1053.1	1q21.1	2013-05-22			ENSG00000143554	ENSG00000143554		"""Acyl-CoA synthetase family"", ""Solute carriers"""	10997	protein-coding gene	gene with protein product		604193				9671728	Standard	NM_024330		Approved	FATP3, MGC4365, ACSVL3	uc001fcz.3	Q5K4L6	OTTHUMG00000037155	ENST00000368661.3:c.2164G>A	1.37:g.153752449G>A	ENSP00000357650:p.Ala722Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUQ7|Q5VUQ8|Q5VUR3|Q6ZV16|Q8N2X7|Q8TEJ0|Q96SW5|Q9BTJ5|Q9BTY5	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.A722T	ENST00000368661.3	37	c.2164	CCDS1053.1	1	.	.	.	.	.	.	.	.	.	.	G	9.270	1.045440	0.19748	4.54E-4	0.001279	ENSG00000143554	ENST00000271857;ENST00000368661	T;T	0.58060	0.36;0.39	4.36	2.34	0.29019	.	0.431406	0.23694	N	0.045485	T	0.18425	0.0442	L	0.56769	1.78	0.09310	N	0.999991	P	0.37061	0.58	B	0.30401	0.115	T	0.06716	-1.0811	10	0.15066	T	0.55	-8.528	5.003	0.14273	0.1078:0.0:0.6866:0.2057	rs35517522	722	Q5K4L6	S27A3_HUMAN	T	803;722	ENSP00000271857:A803T;ENSP00000357650:A722T	ENSP00000271857:A803T	A	+	1	0	SLC27A3	152019073	0.345000	0.24835	0.324000	0.25361	0.007000	0.05969	1.566000	0.36396	1.207000	0.43291	-0.224000	0.12420	GCC	SLC27A3	-	NULL		0.612	SLC27A3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC27A3	HGNC	protein_coding		G	NM_024330		153752449	+1	no_errors	ENST00000368661	ensembl	human	known	70_37	missense	SNP	0.384	A
SPTBN5	51332	genome.wustl.edu	37	15	42167077	42167077	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr15:42167077G>T	ENST00000320955.6	-	23	4692	c.4465C>A	c.(4465-4467)Ccg>Acg	p.P1489T		NM_016642.2	NP_057726.4	Q9NRC6	SPTN5_HUMAN	spectrin, beta, non-erythrocytic 5	1489					actin cytoskeleton organization (GO:0030036)|actin filament capping (GO:0051693)|axon guidance (GO:0007411)|Golgi organization (GO:0007030)|lysosomal transport (GO:0007041)|protein homooligomerization (GO:0051260)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|photoreceptor connecting cilium (GO:0032391)|photoreceptor disc membrane (GO:0097381)|spectrin (GO:0008091)	actin binding (GO:0003779)|dynactin binding (GO:0034452)|dynein intermediate chain binding (GO:0045505)|kinesin binding (GO:0019894)|myosin tail binding (GO:0032029)|protein self-association (GO:0043621)|spectrin binding (GO:0030507)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(6)|lung(18)|ovary(5)|prostate(8)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	62		all_cancers(109;1.84e-17)|all_epithelial(112;1.12e-15)|Lung NSC(122;7.6e-10)|all_lung(180;4.15e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.173)		all cancers(2;4.33e-34)|Epithelial(2;1.72e-25)|OV - Ovarian serous cystadenocarcinoma(18;8.32e-20)|GBM - Glioblastoma multiforme(94;4.69e-07)|Colorectal(2;0.00104)|COAD - Colon adenocarcinoma(120;0.0405)|READ - Rectum adenocarcinoma(92;0.0908)		AGGATGGCCGGGGAGGCGGCC	0.632																																																	0													30.0	35.0	33.0					15																	42167077		1963	4124	6087	SO:0001583	missense	51332			AF233523	CCDS61599.1	15q21	2010-08-17			ENSG00000137877	ENSG00000137877			15680	protein-coding gene	gene with protein product	"""beta V spectrin"""	605916				10764729	Standard	NM_016642		Approved	HUSPECV, BSPECV, HUBSPECV	uc001zos.4	Q9NRC6		ENST00000320955.6:c.4465C>A	15.37:g.42167077G>T	ENSP00000317790:p.Pro1489Thr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.P1489T	ENST00000320955.6	37	c.4465		15	.	.	.	.	.	.	.	.	.	.	.	12.57	1.977348	0.34848	.	.	ENSG00000137877	ENST00000320955	T	0.34859	1.34	4.77	1.55	0.23275	.	0.350809	0.26328	N	0.025013	T	0.16599	0.0399	N	0.08118	0	0.19300	N	0.999977	B	0.15141	0.012	B	0.17722	0.019	T	0.16837	-1.0389	10	0.35671	T	0.21	.	7.1558	0.25637	0.0978:0.3302:0.572:0.0	.	1489	Q9NRC6	SPTN5_HUMAN	T	1489	ENSP00000317790:P1489T	ENSP00000317790:P1489T	P	-	1	0	SPTBN5	39954369	0.997000	0.39634	0.043000	0.18650	0.027000	0.11550	1.884000	0.39668	0.386000	0.24997	0.556000	0.70494	CCG	SPTBN5	-	smart_Spectrin/alpha-actinin		0.632	SPTBN5-001	KNOWN	basic|appris_principal	protein_coding	SPTBN5	HGNC	protein_coding	OTTHUMT00000420237.1	G	NM_016642		42167077	-1	no_errors	ENST00000320955	ensembl	human	known	70_37	missense	SNP	0.961	T
SRSF8	10929	genome.wustl.edu	37	11	94801103	94801103	+	RNA	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:94801103C>T	ENST00000529911.1	+	0	743					NM_032102.3	NP_115285.1	Q9BRL6	SRSF8_HUMAN	serine/arginine-rich splicing factor 8						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										CCTCGGTCTCCAGGTCTCGCT	0.597																																																	0													60.0	65.0	63.0					11																	94801103		2170	4287	6457			10929			AF031166	CCDS73370.1	11q21	2014-05-06	2010-06-22	2010-06-22	ENSG00000180771	ENSG00000263465		"""Serine/arginine-rich splicing factors"""	16988	protein-coding gene	gene with protein product	"""SR splicing factor 8"""	603269	"""splicing factor, arginine/serine-rich 2B"""	SFRS2B		9671500, 20516191	Standard	NM_032102		Approved	SRP46	uc001pff.3	Q9BRL6	OTTHUMG00000188534		11.37:g.94801103C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6B8|Q6PF01|Q96TA3	RNA	SNP	-	NULL	ENST00000529911.1	37	NULL		11																																																																																			SRSF8	-	-		0.597	SRSF8-002	KNOWN	basic	polymorphic_pseudogene	SRSF8	HGNC	polymorphic_pseudogene	OTTHUMT00000390962.3	C	NM_032102		94801103	+1	no_errors	ENST00000529911	ensembl	human	known	70_37	rna	SNP	1.000	T
SRSF8	10929	genome.wustl.edu	37	11	94801103	94801103	+	RNA	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr11:94801103C>T	ENST00000529911.1	+	0	743					NM_032102.3	NP_115285.1	Q9BRL6	SRSF8_HUMAN	serine/arginine-rich splicing factor 8						mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)										CCTCGGTCTCCAGGTCTCGCT	0.597																																																	0													60.0	65.0	63.0					11																	94801103		2170	4287	6457			10929			AF031166	CCDS73370.1	11q21	2014-05-06	2010-06-22	2010-06-22	ENSG00000180771	ENSG00000263465		"""Serine/arginine-rich splicing factors"""	16988	protein-coding gene	gene with protein product	"""SR splicing factor 8"""	603269	"""splicing factor, arginine/serine-rich 2B"""	SFRS2B		9671500, 20516191	Standard	NM_032102		Approved	SRP46	uc001pff.3	Q9BRL6	OTTHUMG00000188534		11.37:g.94801103C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6B8|Q6PF01|Q96TA3	RNA	SNP	-	NULL	ENST00000529911.1	37	NULL		11																																																																																			SRSF8	-	-		0.597	SRSF8-002	KNOWN	basic	polymorphic_pseudogene	SRSF8	HGNC	polymorphic_pseudogene	OTTHUMT00000390962.3	C	NM_032102		94801103	+1	no_errors	ENST00000529911	ensembl	human	known	70_37	rna	SNP	1.000	T
SVIL	6840	genome.wustl.edu	37	10	29783908	29783908	+	Missense_Mutation	SNP	A	A	G	rs78773460		TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr10:29783908A>G	ENST00000355867.4	-	20	4528	c.3776T>C	c.(3775-3777)aTg>aCg	p.M1259T	SVIL_ENST00000535393.1_Missense_Mutation_p.M173T|SVIL_ENST00000375400.3_Missense_Mutation_p.M833T|SVIL_ENST00000538146.1_Missense_Mutation_p.M51T|SVIL_ENST00000375398.2_Missense_Mutation_p.M1259T	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	1259					cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)	p.M1259T(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				TTCTAACTGCATATCTGGTCT	0.502																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											180.0	172.0	175.0					10																	29783908		2203	4300	6503	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.3776T>C	10.37:g.29783908A>G	ENSP00000348128:p.Met1259Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,prints_Gelsolin,pfscan_Villin_headpiece	p.M1259T	ENST00000355867.4	37	c.3776	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	A	17.38	3.374630	0.61735	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867;ENST00000535393;ENST00000535994;ENST00000538146	T;T;T;T;T	0.27557	2.68;2.67;2.67;2.59;1.66	4.41	4.41	0.53225	.	0.084190	0.85682	D	0.000000	T	0.39937	0.1097	M	0.71581	2.175	0.47476	D	0.999433	B;P;B;P	0.44429	0.336;0.835;0.104;0.774	B;B;B;P	0.45913	0.268;0.295;0.054;0.497	T	0.33497	-0.9866	10	0.40728	T	0.16	-28.221	13.8415	0.63441	1.0:0.0:0.0:0.0	.	173;51;833;1259	F5H2Q5;F5GXV0;O95425-2;O95425	.;.;.;SVIL_HUMAN	T	833;1259;1259;173;213;51	ENSP00000364549:M833T;ENSP00000364547:M1259T;ENSP00000348128:M1259T;ENSP00000445472:M173T;ENSP00000440343:M51T	ENSP00000348128:M1259T	M	-	2	0	SVIL	29823914	1.000000	0.71417	1.000000	0.80357	0.808000	0.45660	8.642000	0.91036	1.854000	0.53819	0.254000	0.18369	ATG	SVIL	-	NULL		0.502	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	A			29783908	-1	no_errors	ENST00000355867	ensembl	human	known	70_37	missense	SNP	1.000	G
TLR8-AS1	349408	genome.wustl.edu	37	X	12921627	12921627	+	RNA	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chrX:12921627C>T	ENST00000451564.1	-	0	657					NR_030727.1				TLR8 antisense RNA 1																		CCCGTGTCTTCCCTGGCCAGG	0.577																																																	0																																												349408					Xp22.2	2012-10-12	2012-08-15		ENSG00000233338	ENSG00000233338		"""Long non-coding RNAs"""	40720	non-coding RNA	RNA, long non-coding			"""TLR8 antisense RNA 1 (non-protein coding)"""				Standard	NR_030727		Approved		uc022btb.1		OTTHUMG00000021142		X.37:g.12921627C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000451564.1	37	NULL		X																																																																																			TLR8-AS1	-	-		0.577	TLR8-AS1-001	KNOWN	basic	antisense	TLR8-AS1	HGNC	antisense	OTTHUMT00000055776.1	C			12921627	-1	no_errors	ENST00000451564	ensembl	human	known	70_37	rna	SNP	0.000	T
TMEM202	338949	genome.wustl.edu	37	15	72698977	72698977	+	Silent	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr15:72698977C>A	ENST00000341689.3	+	3	426	c.372C>A	c.(370-372)atC>atA	p.I124I	TMEM202_ENST00000567679.1_Missense_Mutation_p.S39Y	NM_001080462.1	NP_001073931.1	A6NGA9	TM202_HUMAN	transmembrane protein 202	124						integral component of membrane (GO:0016021)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|lung(6)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	18						TCTTTCTCATCTCTGTCTTTA	0.473																																																	0													178.0	157.0	164.0					15																	72698977		2199	4297	6496	SO:0001819	synonymous_variant	338949				CCDS32287.1	15q24.1	2007-12-18				ENSG00000187806			33733	protein-coding gene	gene with protein product							Standard	NM_001080462		Approved	FLJ27523	uc002auq.3	A6NGA9		ENST00000341689.3:c.372C>A	15.37:g.72698977C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S39Y	ENST00000341689.3	37	c.116	CCDS32287.1	15																																																																																			TMEM202	-	NULL		0.473	TMEM202-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	TMEM202	HGNC	protein_coding	OTTHUMT00000435756.1	C	NM_001080462		72698977	+1	no_errors	ENST00000568167	ensembl	human	known	70_37	missense	SNP	1.000	A
TNIK	23043	genome.wustl.edu	37	3	171087431	171087431	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:171087431C>A	ENST00000436636.2	-	2	445	c.101G>T	c.(100-102)gGa>gTa	p.G34V	TNIK_ENST00000341852.6_Missense_Mutation_p.G34V|TNIK_ENST00000538048.1_Missense_Mutation_p.G34V|TNIK_ENST00000465393.1_Missense_Mutation_p.G34V|TNIK_ENST00000284483.8_Missense_Mutation_p.G34V|TNIK_ENST00000470834.1_Missense_Mutation_p.G34V|TNIK_ENST00000369326.5_Missense_Mutation_p.G34V|TNIK_ENST00000475336.1_Missense_Mutation_p.G34V|TNIK_ENST00000460047.1_Missense_Mutation_p.G34V|TNIK_ENST00000488470.1_Missense_Mutation_p.G34V|TNIK_ENST00000357327.5_Missense_Mutation_p.G34V	NM_015028.2	NP_055843.1	Q9UKE5	TNIK_HUMAN	TRAF2 and NCK interacting kinase	34	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of JNKK activity (GO:0007256)|cytoskeleton organization (GO:0007010)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of dendrite morphogenesis (GO:0048814)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(14)|lung(22)|ovary(5)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(2)	62	all_cancers(22;2.55e-19)|all_lung(20;2.22e-14)|Ovarian(172;0.00197)|Breast(254;0.122)		LUSC - Lung squamous cell carcinoma(14;3.57e-14)|Lung(28;9.39e-14)			CCCGTATGTTCCATTTCCAAC	0.383																																																	0													81.0	70.0	73.0					3																	171087431		1843	4087	5930	SO:0001583	missense	23043			AF172264	CCDS46956.1, CCDS54673.1, CCDS54674.1, CCDS54675.1, CCDS54676.1, CCDS54677.1, CCDS54678.1, CCDS54679.1	3q26.31	2008-01-23			ENSG00000154310	ENSG00000154310			30765	protein-coding gene	gene with protein product		610005				9628581, 10521462	Standard	NR_027767		Approved	KIAA0551	uc003fhh.2	Q9UKE5	OTTHUMG00000159036	ENST00000436636.2:c.101G>T	3.37:g.171087431C>A	ENSP00000399511:p.Gly34Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2A3|A8K4U1|D3DNQ6|O60298|Q8WUY7|Q9UKD8|Q9UKD9|Q9UKE0|Q9UKE1|Q9UKE2|Q9UKE3|Q9UKE4	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom	p.G34V	ENST00000436636.2	37	c.101	CCDS46956.1	3	.	.	.	.	.	.	.	.	.	.	C	23.7	4.447910	0.84101	.	.	ENSG00000154310	ENST00000436636;ENST00000369326;ENST00000538048;ENST00000341852;ENST00000284483;ENST00000475336;ENST00000357327;ENST00000460047;ENST00000488470;ENST00000470834;ENST00000465393	D;D;D;D;D;D;D;D;D;D;T	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.22	5.79	5.79	0.91817	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	D	0.96599	0.8890	H	0.99806	4.795	0.80722	D	1	D;D;D;D;D;D;D;D	0.89917	0.999;0.999;1.0;1.0;0.999;0.999;1.0;0.999	D;D;D;D;D;D;D;D	0.91635	0.985;0.994;0.999;0.994;0.994;0.994;0.999;0.996	D	0.98364	1.0550	10	0.87932	D	0	.	18.8126	0.92064	0.0:1.0:0.0:0.0	.	34;34;34;34;34;34;34;34	Q9UKE5-8;Q9UKE5-6;Q9UKE5-7;Q9UKE5-5;Q9UKE5-4;Q9UKE5-2;Q9UKE5-3;Q9UKE5	.;.;.;.;.;.;.;TNIK_HUMAN	V	34	ENSP00000399511:G34V;ENSP00000358332:G34V;ENSP00000443278:G34V;ENSP00000345352:G34V;ENSP00000284483:G34V;ENSP00000418156:G34V;ENSP00000349880:G34V;ENSP00000418916:G34V;ENSP00000418378:G34V;ENSP00000419990:G34V;ENSP00000419308:G34V	ENSP00000284483:G34V	G	-	2	0	TNIK	172570125	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.111000	0.71541	2.739000	0.93911	0.655000	0.94253	GGA	TNIK	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.383	TNIK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNIK	HGNC	protein_coding	OTTHUMT00000352973.2	C	XM_039796		171087431	-1	no_errors	ENST00000436636	ensembl	human	known	70_37	missense	SNP	1.000	A
TMEM207	131920	genome.wustl.edu	37	3	190147473	190147473	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:190147473G>T	ENST00000354905.2	-	5	418	c.352C>A	c.(352-354)Caa>Aaa	p.Q118K		NM_207316.1	NP_997199.1	Q6UWW9	TM207_HUMAN	transmembrane protein 207	118						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(4)	7	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		TCAGGGGTTTGAGTTTGAAGG	0.418																																																	0													149.0	141.0	143.0					3																	190147473		2203	4300	6503	SO:0001583	missense	131920			BC071780	CCDS3297.1	3q28	2008-02-18			ENSG00000198398	ENSG00000198398			33705	protein-coding gene	gene with protein product		614786					Standard	NM_207316		Approved		uc003fsj.2	Q6UWW9	OTTHUMG00000156213	ENST00000354905.2:c.352C>A	3.37:g.190147473G>T	ENSP00000346981:p.Gln118Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.Q118K	ENST00000354905.2	37	c.352	CCDS3297.1	3	.	.	.	.	.	.	.	.	.	.	G	5.431	0.264633	0.10294	.	.	ENSG00000198398	ENST00000354905	T	0.46451	0.87	5.72	4.84	0.62591	.	0.818222	0.10535	N	0.663336	T	0.41511	0.1162	L	0.44542	1.39	0.09310	N	1	P	0.52316	0.952	P	0.44811	0.461	T	0.19321	-1.0309	10	0.40728	T	0.16	-0.0702	12.6294	0.56649	0.0:0.1665:0.8335:0.0	.	118	Q6UWW9	TM207_HUMAN	K	118	ENSP00000346981:Q118K	ENSP00000346981:Q118K	Q	-	1	0	TMEM207	191630167	0.010000	0.17322	0.021000	0.16686	0.041000	0.13682	1.349000	0.33998	1.389000	0.46526	0.655000	0.94253	CAA	TMEM207	-	NULL		0.418	TMEM207-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM207	HGNC	protein_coding	OTTHUMT00000343515.1	G	NM_207316		190147473	-1	no_errors	ENST00000354905	ensembl	human	known	70_37	missense	SNP	0.014	T
TMEM207	131920	genome.wustl.edu	37	3	190147473	190147473	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr3:190147473G>T	ENST00000354905.2	-	5	418	c.352C>A	c.(352-354)Caa>Aaa	p.Q118K		NM_207316.1	NP_997199.1	Q6UWW9	TM207_HUMAN	transmembrane protein 207	118						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(2)|lung(4)	7	all_cancers(143;3.61e-10)|Ovarian(172;0.0991)		Lung(62;2.23e-05)|LUSC - Lung squamous cell carcinoma(58;3.15e-05)	GBM - Glioblastoma multiforme(93;0.0176)		TCAGGGGTTTGAGTTTGAAGG	0.418																																																	0													149.0	141.0	143.0					3																	190147473		2203	4300	6503	SO:0001583	missense	131920			BC071780	CCDS3297.1	3q28	2008-02-18			ENSG00000198398	ENSG00000198398			33705	protein-coding gene	gene with protein product		614786					Standard	NM_207316		Approved		uc003fsj.2	Q6UWW9	OTTHUMG00000156213	ENST00000354905.2:c.352C>A	3.37:g.190147473G>T	ENSP00000346981:p.Gln118Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.Q118K	ENST00000354905.2	37	c.352	CCDS3297.1	3	.	.	.	.	.	.	.	.	.	.	G	5.431	0.264633	0.10294	.	.	ENSG00000198398	ENST00000354905	T	0.46451	0.87	5.72	4.84	0.62591	.	0.818222	0.10535	N	0.663336	T	0.41511	0.1162	L	0.44542	1.39	0.09310	N	1	P	0.52316	0.952	P	0.44811	0.461	T	0.19321	-1.0309	10	0.40728	T	0.16	-0.0702	12.6294	0.56649	0.0:0.1665:0.8335:0.0	.	118	Q6UWW9	TM207_HUMAN	K	118	ENSP00000346981:Q118K	ENSP00000346981:Q118K	Q	-	1	0	TMEM207	191630167	0.010000	0.17322	0.021000	0.16686	0.041000	0.13682	1.349000	0.33998	1.389000	0.46526	0.655000	0.94253	CAA	TMEM207	-	NULL		0.418	TMEM207-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM207	HGNC	protein_coding	OTTHUMT00000343515.1	G	NM_207316		190147473	-1	no_errors	ENST00000354905	ensembl	human	known	70_37	missense	SNP	0.014	T
TRAF2	7186	genome.wustl.edu	37	9	139796834	139796834	+	Intron	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr9:139796834G>T	ENST00000247668.2	+	4	418				TRAF2_ENST00000359662.3_Intron|TRAF2_ENST00000536468.1_Intron|TRAF2_ENST00000482854.1_3'UTR	NM_021138.3	NP_066961.2	Q12933	TRAF2_HUMAN	TNF receptor-associated factor 2						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular protein complex assembly (GO:0043623)|cellular response to nitric oxide (GO:0071732)|innate immune response (GO:0045087)|negative regulation of glial cell apoptotic process (GO:0034351)|negative regulation of neuron death (GO:1901215)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of interleukin-2 production (GO:0032743)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein homodimerization activity (GO:0090073)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of T cell activation (GO:0050870)|positive regulation of T cell cytokine production (GO:0002726)|programmed necrotic cell death (GO:0097300)|protein autoubiquitination (GO:0051865)|protein catabolic process (GO:0030163)|protein complex assembly (GO:0006461)|protein heterooligomerization (GO:0051291)|protein homotrimerization (GO:0070207)|protein K63-linked ubiquitination (GO:0070534)|regulation of apoptotic process (GO:0042981)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of immunoglobulin secretion (GO:0051023)|signal transduction (GO:0007165)|tumor necrosis factor-mediated signaling pathway (GO:0033209)	CD40 receptor complex (GO:0035631)|cell cortex (GO:0005938)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)|membrane raft (GO:0045121)|ubiquitin ligase complex (GO:0000151)	CD40 receptor binding (GO:0005174)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|ligase activity (GO:0016874)|protein phosphatase binding (GO:0019903)|signal transducer activity (GO:0004871)|sphingolipid binding (GO:0046625)|thioesterase binding (GO:0031996)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.229)	OV - Ovarian serous cystadenocarcinoma(145;4.48e-06)|Epithelial(140;9.55e-06)		GGACTGAGGAGTGTCTGGGGG	0.617																																																	0																																										SO:0001627	intron_variant	7186			U12597	CCDS7013.1	9q34	2013-01-09			ENSG00000127191	ENSG00000127191		"""RING-type (C3HC4) zinc fingers"""	12032	protein-coding gene	gene with protein product		601895				7639698	Standard	NM_021138		Approved	TRAP3	uc004cjv.3	Q12933	OTTHUMG00000020952	ENST00000247668.2:c.366+1862G>T	9.37:g.139796834G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K107|B4DPJ7|Q7Z337|Q96NT2	RNA	SNP	-	NULL	ENST00000247668.2	37	NULL	CCDS7013.1	9																																																																																			TRAF2	-	-		0.617	TRAF2-007	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF2	HGNC	protein_coding	OTTHUMT00000055166.1	G	NM_021138		139796834	+1	no_errors	ENST00000482854	ensembl	human	known	70_37	rna	SNP	0.000	T
TRAPPC11	60684	genome.wustl.edu	37	4	184618885	184618885	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr4:184618885C>A	ENST00000334690.6	+	25	2950	c.2748C>A	c.(2746-2748)gaC>gaA	p.D916E	TRAPPC11_ENST00000512476.1_Missense_Mutation_p.D522E|TRAPPC11_ENST00000357207.4_Missense_Mutation_p.D916E	NM_021942.5	NP_068761.4	Q7Z392	TPC11_HUMAN	trafficking protein particle complex 11	916					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)											TGATGACGGACCTCTTAAGTG	0.488																																																	0													134.0	126.0	129.0					4																	184618885		2203	4300	6503	SO:0001583	missense	60684				CCDS34112.1, CCDS47166.1	4q35.1	2011-12-12	2011-12-12	2011-12-12	ENSG00000168538	ENSG00000168538		"""Trafficking protein particle complex"""	25751	protein-coding gene	gene with protein product	"""gryzun homolog (Drosophila)"", ""foie gras homolog (zebrafish)"""	614138	"""chromosome 4 open reading frame 41"""	C4orf41		19942856, 21525244	Standard	NM_021942		Approved	FLJ12716, gry, foigr	uc003ivx.3	Q7Z392	OTTHUMG00000160673	ENST00000334690.6:c.2748C>A	4.37:g.184618885C>A	ENSP00000335371:p.Asp916Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A4QPB8|B2RCD6|Q5U5I7|Q6FI73|Q86T25|Q9H0L1|Q9H5K9|Q9H8Q1|Q9H9I7	Missense_Mutation	SNP	pfam_Foie-gras_1,pfam_DUF1683_C	p.D916E	ENST00000334690.6	37	c.2748	CCDS34112.1	4	.	.	.	.	.	.	.	.	.	.	C	15.67	2.900796	0.52227	.	.	ENSG00000168538	ENST00000334690;ENST00000357207;ENST00000360109;ENST00000512476	.	.	.	5.54	0.835	0.18886	.	0.000000	0.85682	D	0.000000	T	0.63745	0.2537	L	0.60455	1.87	0.44918	D	0.997934	D;P;D;P	0.89917	1.0;0.767;0.999;0.565	D;P;D;B	0.77557	0.99;0.545;0.976;0.107	T	0.61734	-0.7002	9	0.08837	T	0.75	.	9.7126	0.40254	0.0:0.4935:0.0:0.5065	.	647;522;916;916	B3KR79;D6RHE5;Q7Z392;Q7Z392-3	.;.;TPC11_HUMAN;.	E	916;916;916;522	.	ENSP00000335371:D916E	D	+	3	2	C4orf41	184855879	0.994000	0.37717	0.007000	0.13788	0.968000	0.65278	0.839000	0.27586	-0.090000	0.12462	-0.136000	0.14681	GAC	TRAPPC11	-	NULL		0.488	TRAPPC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAPPC11	HGNC	protein_coding	OTTHUMT00000361654.2	C	NM_021942		184618885	+1	no_errors	ENST00000334690	ensembl	human	known	70_37	missense	SNP	0.440	A
TRRAP	8295	genome.wustl.edu	37	7	98609721	98609721	+	Silent	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr7:98609721C>A	ENST00000359863.4	+	72	11532	c.11323C>A	c.(11323-11325)Cgg>Agg	p.R3775R	TRRAP_ENST00000446306.3_Silent_p.R3764R|AC004893.11_ENST00000360902.1_RNA|TRRAP_ENST00000355540.3_Silent_p.R3746R	NM_001244580.1	NP_001231509.1	Q9Y4A5	TRRAP_HUMAN	transformation/transcription domain-associated protein	3775	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chromatin organization (GO:0006325)|histone acetylation (GO:0016573)|histone deubiquitination (GO:0016578)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|mitotic cell cycle checkpoint (GO:0007093)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|STAGA complex (GO:0030914)|Swr1 complex (GO:0000812)|transcription factor TFTC complex (GO:0033276)	phosphotransferase activity, alcohol group as acceptor (GO:0016773)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)			NS(3)|breast(1)|central_nervous_system(10)|endometrium(16)|kidney(7)|large_intestine(36)|liver(1)|lung(54)|ovary(10)|pancreas(1)|prostate(8)|skin(16)|stomach(5)|upper_aerodigestive_tract(6)|urinary_tract(2)	176	all_cancers(62;6.96e-09)|all_epithelial(64;4.86e-09)|Lung NSC(181;0.01)|all_lung(186;0.016)|Esophageal squamous(72;0.0274)		STAD - Stomach adenocarcinoma(171;0.215)			AACGGTTCTCCGGGACGAGAT	0.547																																																	0													86.0	78.0	81.0					7																	98609721		2203	4300	6503	SO:0001819	synonymous_variant	8295			AF076974	CCDS5659.1, CCDS59066.1	7q21.2-q22.1	2010-06-22			ENSG00000196367	ENSG00000196367			12347	protein-coding gene	gene with protein product		603015				9708738, 9885574	Standard	NM_003496		Approved	TR-AP, PAF400, Tra1	uc003upp.3	Q9Y4A5	OTTHUMG00000150403	ENST00000359863.4:c.11323C>A	7.37:g.98609721C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D265|O75218|Q9Y631|Q9Y6H4	Silent	SNP	pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R3775	ENST00000359863.4	37	c.11323	CCDS59066.1	7																																																																																			TRRAP	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom		0.547	TRRAP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRRAP	HGNC	protein_coding	OTTHUMT00000317978.1	C	NM_003496		98609721	+1	no_errors	ENST00000359863	ensembl	human	known	70_37	silent	SNP	1.000	A
TTN	7273	genome.wustl.edu	37	2	179614007	179614007	+	Intron	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr2:179614007G>T	ENST00000591111.1	-	45	10585				TTN_ENST00000342992.6_Intron|TTN-AS1_ENST00000585451.1_RNA|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN-AS1_ENST00000578746.1_RNA|TTN_ENST00000360870.5_Missense_Mutation_p.Q4374K|TTN_ENST00000342175.6_Intron|TTN_ENST00000589042.1_Intron|TTN-AS1_ENST00000590773.1_RNA			Q8WZ42	TITIN_HUMAN	titin						adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CCCTCTGCTTGGTGCAGCTTT	0.358																																																	0													72.0	77.0	75.0					2																	179614007		2203	4299	6502	SO:0001627	intron_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.10360+3843C>A	2.37:g.179614007G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Titin_Z,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.Q4374K	ENST00000591111.1	37	c.13120		2	.	.	.	.	.	.	.	.	.	.	G	13.97	2.396256	0.42512	.	.	ENSG00000155657	ENST00000360870	T	0.57107	0.42	5.95	2.88	0.33553	.	.	.	.	.	T	0.36054	0.0953	N	0.19112	0.55	0.09310	N	1	B	0.09022	0.002	B	0.10450	0.005	T	0.21895	-1.0232	9	0.35671	T	0.21	.	9.353	0.38149	0.0:0.2141:0.4994:0.2865	.	4374	Q8WZ42-6	.	K	4374	ENSP00000354117:Q4374K	ENSP00000354117:Q4374K	Q	-	1	0	TTN	179322252	0.001000	0.12720	0.176000	0.23000	0.491000	0.33493	0.796000	0.26986	0.836000	0.34901	0.563000	0.77884	CAA	TTN	-	NULL		0.358	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179614007	-1	no_errors	ENST00000360870	ensembl	human	known	70_37	missense	SNP	0.000	T
TUBGCP2	10844	genome.wustl.edu	37	10	135110841	135110841	+	Intron	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr10:135110841G>A	ENST00000252936.3	-	4	656				TUBGCP2_ENST00000470829.1_5'Flank|TUBGCP2_ENST00000417178.2_Intron|RP11-122K13.12_ENST00000424450.1_RNA|TUBGCP2_ENST00000543663.1_Silent_p.C228C|TUBGCP2_ENST00000368563.2_Intron			Q9BSJ2	GCP2_HUMAN	tubulin, gamma complex associated protein 2						G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)|protein complex assembly (GO:0006461)	centrosome (GO:0005813)|cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|membrane (GO:0016020)|microtubule organizing center (GO:0005815)|spindle pole (GO:0000922)				breast(2)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(16)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	35		all_cancers(35;1.14e-09)|all_epithelial(44;5.79e-08)|Lung NSC(174;0.00263)|all_lung(145;0.0039)|all_neural(114;0.0299)|Melanoma(40;0.123)|Colorectal(31;0.172)|Glioma(114;0.203)		OV - Ovarian serous cystadenocarcinoma(35;8.87e-06)|all cancers(32;8.98e-06)|Epithelial(32;1.15e-05)		ggtggaggttgcagtgtgccg	0.483																																																	0																																										SO:0001627	intron_variant	10844			AF042379	CCDS7676.1, CCDS58104.1, CCDS58105.1	10q26.3	2008-07-28			ENSG00000130640	ENSG00000130640			18599	protein-coding gene	gene with protein product						9566967	Standard	NM_001256617		Approved	GCP2, Spc97p, SPBC97	uc010qvc.2	Q9BSJ2	OTTHUMG00000019319	ENST00000252936.3:c.616+614C>T	10.37:g.135110841G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DM18|B7ZKL8|F5H4E0|F5H4L0|O43632|Q5VWX7	Silent	SNP	pfam_Spc97_Spc98,superfamily_Ocr	p.C228	ENST00000252936.3	37	c.684	CCDS7676.1	10																																																																																			TUBGCP2	-	NULL		0.483	TUBGCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP2	HGNC	protein_coding	OTTHUMT00000051148.1	G			135110841	-1	no_errors	ENST00000543663	ensembl	human	known	70_37	silent	SNP	0.020	A
TXLNG	55787	genome.wustl.edu	37	X	16859626	16859626	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chrX:16859626C>A	ENST00000380122.5	+	10	1385	c.1324C>A	c.(1324-1326)Cag>Aag	p.Q442K	TXLNG_ENST00000398155.4_Missense_Mutation_p.Q310K|TXLNG_ENST00000485153.1_3'UTR	NM_018360.2	NP_060830.2	Q9NUQ3	TXLNG_HUMAN	taxilin gamma	442					cell cycle (GO:0007049)|regulation of bone mineralization (GO:0030500)|regulation of cell cycle (GO:0051726)|regulation of cell cycle process (GO:0010564)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nuclear membrane (GO:0031965)	protein heterodimerization activity (GO:0046982)			breast(2)|large_intestine(5)|lung(6)|prostate(1)|skin(1)	15						CAGGGCTCTTCAGACAGAAAG	0.453																																																	0													67.0	60.0	63.0					X																	16859626		2203	4300	6503	SO:0001583	missense	55787			AK002071	CCDS14178.1, CCDS55373.1	Xp22.2	2014-05-07	2010-04-20	2010-04-20	ENSG00000086712	ENSG00000086712			18578	protein-coding gene	gene with protein product	"""lipopolysaccharide specific response-5 protein"", ""factor inhibiting activating transcription factor 4 (ATF4)-mediated transcription"""	300677	"""chromosome X open reading frame 15"""	CXorf15		15911876, 15184072, 16831913	Standard	NM_018360		Approved	FLJ11209, LSR5, FIAT, MGC126621, MGC126625, TXLNGX	uc004cxq.2	Q9NUQ3	OTTHUMG00000021196	ENST00000380122.5:c.1324C>A	X.37:g.16859626C>A	ENSP00000369465:p.Gln442Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2KQ75|Q5JNZ7|Q9P0X1	Missense_Mutation	SNP	pfam_Taxilin_fam	p.Q442K	ENST00000380122.5	37	c.1324	CCDS14178.1	X	.	.	.	.	.	.	.	.	.	.	C	23.0	4.368514	0.82463	.	.	ENSG00000086712	ENST00000380122;ENST00000398155	T;T	0.50548	0.74;0.74	5.54	4.66	0.58398	.	0.065457	0.64402	D	0.000006	T	0.61098	0.2320	M	0.65677	2.01	0.80722	D	1	P;P	0.46395	0.839;0.877	P;P	0.54270	0.747;0.53	T	0.62637	-0.6812	10	0.49607	T	0.09	-15.8951	15.3862	0.74703	0.0:0.864:0.136:0.0	.	310;442	Q9NUQ3-2;Q9NUQ3	.;TXLNG_HUMAN	K	442;310	ENSP00000369465:Q442K;ENSP00000381222:Q310K	ENSP00000369465:Q442K	Q	+	1	0	TXLNG	16769547	1.000000	0.71417	0.885000	0.34714	0.901000	0.52897	3.843000	0.55865	1.059000	0.40554	0.513000	0.50165	CAG	TXLNG	-	pfam_Taxilin_fam		0.453	TXLNG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXLNG	HGNC	protein_coding	OTTHUMT00000055912.1	C	NM_018360		16859626	+1	no_errors	ENST00000380122	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF331	55422	genome.wustl.edu	37	19	54040626	54040626	+	Intron	SNP	C	C	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:54040626C>A	ENST00000253144.9	+	3	1129				ZNF331_ENST00000511593.2_Intron|ZNF331_ENST00000411977.2_5'Flank|ZNF331_ENST00000449416.1_Intron|ZNF331_ENST00000513999.1_5'Flank|ZNF331_ENST00000511154.1_5'Flank	NM_001253801.1|NM_018555.5	NP_001240730.1|NP_061025.5	Q9NQX6	ZN331_HUMAN	zinc finger protein 331						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(1)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	10				GBM - Glioblastoma multiforme(134;0.00555)		TGCTAGCGGCCTGCAGAGAAT	0.592			T	?	follicular thyroid adenoma																																			Dom	yes		19	19q13.3-q13.4	55422	zinc finger protein 331		E	0																																										SO:0001627	intron_variant	55422			AF251515	CCDS33102.1	19q13	2013-12-10				ENSG00000130844		"""Zinc fingers, C2H2-type"", ""-"""	15489	protein-coding gene	gene with protein product	"""rearranged in thyroid adenomas"""	606043					Standard	NM_001079906		Approved	RITA, ZNF463, ZNF361	uc021uzh.1	Q9NQX6		ENST00000253144.9:c.-204-1844C>A	19.37:g.54040626C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96GJ4	RNA	SNP	-	NULL	ENST00000253144.9	37	NULL	CCDS33102.1	19																																																																																			ZNF331	-	-		0.592	ZNF331-008	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZNF331	HGNC	protein_coding	OTTHUMT00000371366.1	C	NM_018555		54040626	+1	no_errors	ENST00000504033	ensembl	human	known	70_37	rna	SNP	0.026	A
ZNF891	101060200	genome.wustl.edu	37	12	133698315	133698315	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr12:133698315G>T	ENST00000537226.1	-	2	542	c.190C>A	c.(190-192)Caa>Aaa	p.Q64K	ZNF891_ENST00000397313.2_Missense_Mutation_p.Q64K|CTD-2140B24.6_ENST00000606110.1_RNA	NM_001277291.1	NP_001264220.1	A8MT65	ZN891_HUMAN	zinc finger protein 891	64	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1						AGACTTCTTTGAGCAGAATCC	0.433																																																	0																																										SO:0001583	missense	101060200				CCDS59238.1	12q24.33	2014-01-23			ENSG00000214029	ENSG00000214029		"""Zinc fingers, C2H2-type"", ""-"""	38709	protein-coding gene	gene with protein product							Standard	NM_001277291		Approved		uc031qkm.1	A8MT65	OTTHUMG00000167943	ENST00000537226.1:c.190C>A	12.37:g.133698315G>T	ENSP00000437590:p.Gln64Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q64K	ENST00000537226.1	37	c.190	CCDS59238.1	12	.	.	.	.	.	.	.	.	.	.	G	12.45	1.940660	0.34283	.	.	ENSG00000214029	ENST00000537226;ENST00000397313	T;T	0.08896	3.04;3.04	3.81	2.92	0.33932	.	.	.	.	.	T	0.15349	0.0370	.	.	.	.	.	.	.	.	.	.	.	.	T	0.11324	-1.0592	5	0.87932	D	0	.	9.0602	0.36429	0.1102:0.0:0.8897:0.0	.	.	.	.	K	64	ENSP00000437590:Q64K;ENSP00000380480:Q64K	ENSP00000380480:Q64K	Q	-	1	0	ZNF891	132208388	0.074000	0.21230	0.713000	0.30519	0.267000	0.26476	1.453000	0.35167	0.806000	0.34183	0.650000	0.86243	CAA	ZNF891	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.433	ZNF891-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF891	HGNC	protein_coding	OTTHUMT00000397179.1	G			133698315	-1	no_errors	ENST00000397313	ensembl	human	known	70_37	missense	SNP	0.388	T
ZNF91	7644	genome.wustl.edu	37	19	23489882	23489882	+	5'UTR	SNP	C	C	T			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:23489882C>T	ENST00000596528.1	-	0	2133							Q05481	ZNF91_HUMAN	zinc finger protein 91						transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)						all_lung(12;0.0349)|Lung NSC(12;0.0538)|all_epithelial(12;0.0611)				ccaccgtgtccggccaacttt	0.473																																																	0																																										SO:0001623	5_prime_UTR_variant	7644			M61871	CCDS42541.1, CCDS74322.1	19p12	2014-02-04	2006-05-12		ENSG00000167232	ENSG00000167232		"""Zinc fingers, C2H2-type"", ""-"""	13166	protein-coding gene	gene with protein product		603971	"""zinc finger protein 91 (HPF7, HTF10)"""			2023909, 2505992	Standard	XR_430154		Approved	HPF7, HTF10	uc002nre.3	Q05481	OTTHUMG00000183268	ENST00000596528.1:c.-272G>A	19.37:g.23489882C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5E1|B7Z6G6	RNA	SNP	-	NULL	ENST00000596528.1	37	NULL		19																																																																																			ZNF91	-	-		0.473	ZNF91-005	KNOWN	basic	processed_transcript	ZNF91	HGNC	protein_coding	OTTHUMT00000465884.1	C	NM_003430		23489882	-1	no_errors	ENST00000596528	ensembl	human	known	70_37	rna	SNP	0.012	T
ZSCAN5A	79149	genome.wustl.edu	37	19	56778130	56778130	+	Intron	SNP	G	G	A			TCGA-C5-A1MQ-01A-11D-A14W-08	TCGA-C5-A1MQ-10A-01D-A14W-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5091f550-7ae6-45c2-bceb-725cbf51852c	0499fa6b-957b-4b13-8979-a30ba4dcf1c8	g.chr19:56778130G>A	ENST00000587340.1	-	4	694				ZSCAN5A_ENST00000587492.1_Intron|ZSCAN5A_ENST00000254165.3_Intron			Q9BUG6	ZSA5A_HUMAN	zinc finger and SCAN domain containing 5A						regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(5)|liver(1)|lung(12)|ovary(1)|skin(6)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	37						ttacaggcgtgagccacggtg	0.542																																																	0																																										SO:0001627	intron_variant	79149			AK098700	CCDS12941.1	19q13.43	2013-01-08	2008-06-10	2008-06-10	ENSG00000131848	ENSG00000131848		"""-"", ""Zinc fingers, C2H2-type"""	23710	protein-coding gene	gene with protein product			"""zinc finger protein 495"", ""zinc finger and SCAN domain containing 5"""	ZNF495, ZSCAN5			Standard	NM_024303		Approved	MGC4161	uc002qmq.3	Q9BUG6		ENST00000587340.1:c.2-41713C>T	19.37:g.56778130G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX98|Q49A73|Q53F04|Q8N7B3	RNA	SNP	-	NULL	ENST00000587340.1	37	NULL	CCDS12941.1	19																																																																																			ZSCAN5A	-	-		0.542	ZSCAN5A-004	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZSCAN5A	HGNC	protein_coding	OTTHUMT00000458110.1	G	NM_024303		56778130	-1	no_errors	ENST00000586031	ensembl	human	known	70_37	rna	SNP	0.051	A
