#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AACS	65985	genome.wustl.edu	37	12	125561151	125561151	+	Missense_Mutation	SNP	A	A	G	rs11549081	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:125561151A>G	ENST00000316519.6	+	3	558	c.352A>G	c.(352-354)Att>Gtt	p.I118V	AACS_ENST00000261686.6_Missense_Mutation_p.I118V	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	118			I -> V (in dbSNP:rs12831803). {ECO:0000269|PubMed:15489334}.		adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TGCCCTTTACATTGCAAGTAA	0.493													G|||	1105	0.220647	0.3548	0.1888	5008	,	,		20430	0.1171		0.1441	False		,,,				2504	0.2474																0								A	VAL/ILE	1292,3114	439.6+/-345.7	198,896,1109	111.0	107.0	109.0		352	3.4	0.0	12	dbSNP_121	109	1229,7371	245.7+/-274.4	102,1025,3173	yes	missense	AACS	NM_023928.3	29	300,1921,4282	GG,GA,AA		14.2907,29.3236,19.3834	benign	118/673	125561151	2521,10485	2203	4300	6503	SO:0001583	missense	65985			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.352A>G	12.37:g.125561151A>G	ENSP00000324842:p.Ile118Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Acac_CoA_synth	p.I118V	ENST00000316519.6	37	c.352	CCDS9263.1	12	406	0.1858974358974359	167	0.3394308943089431	65	0.17955801104972377	78	0.13636363636363635	96	0.1266490765171504	a	0.149	-1.093357	0.01858	0.293236	0.142907	ENSG00000081760	ENST00000316519;ENST00000536752;ENST00000261686	T;T;T	0.10192	2.9;2.91;2.9	5.27	3.44	0.39384	.	0.251297	0.38548	N	0.001649	T	0.00012	0.0000	N	0.02539	-0.55	0.58432	P	1.0000000000287557E-6	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.47328	-0.9126	9	0.10636	T	0.68	.	6.2699	0.20949	0.1585:0.0:0.6938:0.1477	rs12831803;rs17854015;rs61595606;rs12831803	118;118	Q86V21-2;Q86V21	.;AACS_HUMAN	V	118	ENSP00000324842:I118V;ENSP00000442691:I118V;ENSP00000261686:I118V	ENSP00000261686:I118V	I	+	1	0	AACS	124127104	1.000000	0.71417	0.003000	0.11579	0.009000	0.06853	5.025000	0.64097	0.720000	0.32209	-0.221000	0.12465	ATT	AACS	-	tigrfam_Acac_CoA_synth		0.493	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AACS	HGNC	protein_coding	OTTHUMT00000400202.1	A	NM_023928		125561151	+1	no_errors	ENST00000316519	ensembl	human	known	70_37	missense	SNP	0.784	G
AACS	65985	genome.wustl.edu	37	12	125603260	125603260	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:125603260C>G	ENST00000316519.6	+	10	1276	c.1070C>G	c.(1069-1071)tCc>tGc	p.S357C	AACS_ENST00000261686.6_Missense_Mutation_p.S357C|AACS_ENST00000545511.1_5'Flank|AACS_ENST00000316543.10_5'UTR	NM_023928.3	NP_076417.2	Q86V21	AACS_HUMAN	acetoacetyl-CoA synthetase	357					adipose tissue development (GO:0060612)|cellular response to cholesterol (GO:0071397)|cellular response to glucose stimulus (GO:0071333)|cellular response to testosterone stimulus (GO:0071394)|fatty acid metabolic process (GO:0006631)|liver development (GO:0001889)|positive regulation of insulin secretion (GO:0032024)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to nutrient (GO:0007584)|response to oleic acid (GO:0034201)|response to purine-containing compound (GO:0014074)|response to starvation (GO:0042594)|white fat cell differentiation (GO:0050872)	cytoplasm (GO:0005737)	acetoacetate-CoA ligase activity (GO:0030729)|ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)			breast(1)|central_nervous_system(1)|cervix(1)|large_intestine(4)|liver(1)|lung(16)|ovary(1)|stomach(1)	26	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;9.82e-05)|Epithelial(86;0.000642)|all cancers(50;0.00843)		TACGATGGCTCCCCCCTGGTG	0.597																																																	0													78.0	67.0	71.0					12																	125603260		2203	4300	6503	SO:0001583	missense	65985			AK022451	CCDS9263.1	12q24.31	2010-09-29			ENSG00000081760	ENSG00000081760	6.2.1.16	"""Acyl-CoA synthetase family"""	21298	protein-coding gene	gene with protein product	"""acyl-CoA synthetase family member 1"""	614364				12623130, 17762044	Standard	NM_023928		Approved	FLJ12389, SUR-5, ACSF1	uc001uhc.3	Q86V21	OTTHUMG00000168550	ENST00000316519.6:c.1070C>G	12.37:g.125603260C>G	ENSP00000324842:p.Ser357Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AB9|Q49AC3|Q658Q8|Q8IWD2|Q8NEW5|Q9BSJ9|Q9H829|Q9HA19	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig,pfam_Acyl-CoA_synth_DUF3448,tigrfam_Acac_CoA_synth	p.S357C	ENST00000316519.6	37	c.1070	CCDS9263.1	12	.	.	.	.	.	.	.	.	.	.	C	21.2	4.112754	0.77210	.	.	ENSG00000081760	ENST00000316519;ENST00000261686;ENST00000535001;ENST00000441247;ENST00000538851	T;T;T;T	0.45276	0.9;0.9;0.9;0.9	4.72	4.72	0.59763	AMP-dependent synthetase/ligase (1);	0.000000	0.85682	D	0.000000	T	0.64505	0.2604	M	0.87547	2.89	0.80722	D	1	D;D	0.59357	0.981;0.985	P;P	0.55345	0.664;0.774	T	0.74297	-0.3711	10	0.87932	D	0	.	17.7744	0.88503	0.0:1.0:0.0:0.0	.	357;357	Q86V21-2;Q86V21	.;AACS_HUMAN	C	357;357;213;176;22	ENSP00000324842:S357C;ENSP00000261686:S357C;ENSP00000392967:S176C;ENSP00000441686:S22C	ENSP00000261686:S357C	S	+	2	0	AACS	124169213	1.000000	0.71417	1.000000	0.80357	0.638000	0.38207	7.171000	0.77595	2.181000	0.69327	0.461000	0.40582	TCC	AACS	-	pfam_AMP-dep_Synth/Lig,tigrfam_Acac_CoA_synth		0.597	AACS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AACS	HGNC	protein_coding	OTTHUMT00000400202.1	C	NM_023928		125603260	+1	no_errors	ENST00000316519	ensembl	human	known	70_37	missense	SNP	1.000	G
ABCA13	154664	genome.wustl.edu	37	7	48311467	48311467	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:48311467C>T	ENST00000435803.1	+	17	2228	c.2204C>T	c.(2203-2205)tCa>tTa	p.S735L		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	735					transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TTTCTTTTATCATTTGTGGAA	0.358																																																	0													52.0	49.0	50.0					7																	48311467		1806	4070	5876	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.2204C>T	7.37:g.48311467C>T	ENSP00000411096:p.Ser735Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.S735L	ENST00000435803.1	37	c.2204	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	14.67	2.603254	0.46423	.	.	ENSG00000179869	ENST00000435803	D	0.86497	-2.13	5.71	1.63	0.23807	.	0.696627	0.12127	N	0.497127	T	0.80607	0.4655	L	0.55481	1.735	0.09310	N	1	B	0.15473	0.013	B	0.10450	0.005	T	0.70799	-0.4774	10	0.72032	D	0.01	.	1.4587	0.02391	0.1563:0.46:0.1347:0.249	.	735	Q86UQ4	ABCAD_HUMAN	L	735	ENSP00000411096:S735L	ENSP00000411096:S735L	S	+	2	0	ABCA13	48282013	0.000000	0.05858	0.001000	0.08648	0.950000	0.60333	0.352000	0.20113	0.770000	0.33336	0.585000	0.79938	TCA	ABCA13	-	NULL		0.358	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	C	NM_152701		48311467	+1	no_errors	ENST00000435803	ensembl	human	known	70_37	missense	SNP	0.000	T
ACAT2	39	genome.wustl.edu	37	6	160196400	160196400	+	Intron	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:160196400C>G	ENST00000367048.4	+	5	2394				ACAT2_ENST00000472052.1_3'UTR|ACAT2_ENST00000541436.1_Intron	NM_005891.2	NP_005882.2	Q9BWD1	THIC_HUMAN	acetyl-CoA acetyltransferase 2						lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)	acetyl-CoA C-acetyltransferase activity (GO:0003985)			breast(1)|central_nervous_system(1)|large_intestine(2)|lung(3)|ovary(1)|urinary_tract(1)	9		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.51e-18)|BRCA - Breast invasive adenocarcinoma(81;5.87e-06)		AGAGTAACATCTAAAAGAGTA	0.323																																																	0																																										SO:0001627	intron_variant	39			AF356877	CCDS5268.1	6q25.3	2014-05-19	2010-04-30		ENSG00000120437	ENSG00000120437	2.3.1.9		94	protein-coding gene	gene with protein product	"""acetoacetyl Coenzyme A thiolase"""	100678	"""acetyl-Coenzyme A acetyltransferase 2 (acetoacetyl Coenzyme A thiolase)"", ""acetyl-Coenzyme A acetyltransferase 2"""			2475872	Standard	NM_005891		Approved		uc010kjy.3	Q9BWD1	OTTHUMG00000015935	ENST00000367048.4:c.634+55C>G	6.37:g.160196400C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z233|E1P5B1|Q16146|Q5TCL7|Q8TDM4	RNA	SNP	-	NULL	ENST00000367048.4	37	NULL	CCDS5268.1	6																																																																																			ACAT2	-	-		0.323	ACAT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAT2	HGNC	protein_coding	OTTHUMT00000042912.1	C	NM_005891		160196400	+1	no_errors	ENST00000472052	ensembl	human	known	70_37	rna	SNP	0.000	G
ADAMTS20	80070	genome.wustl.edu	37	12	43896176	43896176	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:43896176G>C	ENST00000389420.3	-	4	645	c.646C>G	c.(646-648)Cat>Gat	p.H216D	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.H216D	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	216					extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		CTGTAGGTATGAAAGGGTAAA	0.313																																																	0													145.0	161.0	156.0					12																	43896176		2203	4299	6502	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.646C>G	12.37:g.43896176G>C	ENSP00000374071:p.His216Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.H216D	ENST00000389420.3	37	c.646	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	0.071	-1.202069	0.01581	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.61392	0.29;0.11	4.66	2.79	0.32731	.	0.667620	0.13709	N	0.368207	T	0.39036	0.1063	N	0.24115	0.695	0.09310	N	0.999999	B	0.02656	0.0	B	0.10450	0.005	T	0.20840	-1.0263	10	0.12430	T	0.62	.	9.6377	0.39819	0.075:0.0:0.7833:0.1418	.	216	P59510	ATS20_HUMAN	D	216	ENSP00000374071:H216D;ENSP00000448341:H216D	ENSP00000374068:H216D	H	-	1	0	ADAMTS20	42182443	1.000000	0.71417	0.015000	0.15790	0.172000	0.22775	2.576000	0.46033	0.638000	0.30545	0.655000	0.94253	CAT	ADAMTS20	-	NULL		0.313	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	G	NM_025003		43896176	-1	no_errors	ENST00000389420	ensembl	human	known	70_37	missense	SNP	0.376	C
ADAR	103	genome.wustl.edu	37	1	154600399	154600399	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:154600399C>T	ENST00000292205.5	-	1	75	c.76G>A	c.(76-78)Ggg>Agg	p.G26R	ADAR_ENST00000368471.3_5'UTR|ADAR_ENST00000471068.1_Intron	NM_001025107.2|NM_001193495.1	NP_001020278.1|NP_001180424.1	P55265	DSRAD_HUMAN	adenosine deaminase, RNA-specific	0					adenosine to inosine editing (GO:0006382)|base conversion or substitution editing (GO:0016553)|cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|miRNA loading onto RISC involved in gene silencing by miRNA (GO:0035280)|mRNA modification (GO:0016556)|mRNA processing (GO:0006397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of viral genome replication (GO:0045071)|positive regulation of viral genome replication (GO:0045070)|pre-miRNA processing (GO:0031054)|protein export from nucleus (GO:0006611)|protein import into nucleus (GO:0006606)|response to interferon-alpha (GO:0035455)|response to virus (GO:0009615)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|supraspliceosomal complex (GO:0044530)	DNA binding (GO:0003677)|double-stranded RNA adenosine deaminase activity (GO:0003726)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(9)|lung(20)|ovary(4)|prostate(2)|skin(2)	51	all_lung(78;2.22e-29)|Lung NSC(65;3.66e-27)|all_hematologic(923;0.088)|Hepatocellular(266;0.0997)		LUSC - Lung squamous cell carcinoma(543;0.185)	Colorectal(1306;0.115)		GACCCTCCCCCCACCCTCCCC	0.642																																																	0													40.0	44.0	42.0					1																	154600399		876	1991	2867	SO:0001583	missense	103			BC038227	CCDS1071.1, CCDS30879.1	1q21.3	2012-03-22			ENSG00000160710	ENSG00000160710	3.5.4.-		225	protein-coding gene	gene with protein product		146920	"""interferon-induced protein 4"""	IFI4, G1P1		7972084	Standard	NM_001111		Approved	ADAR1	uc001ffh.3	P55265	OTTHUMG00000037261	ENST00000292205.5:c.76G>A	1.37:g.154600399C>T	ENSP00000292205:p.Gly26Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQQ9|B1AQR0|D3DV76|O15223|O43859|O43860|Q9BYM3|Q9BYM4	Missense_Mutation	SNP	pfam_A_deamin,pfam_dsRNA_A_deaminase,pfam_Ds-RNA-bd,smart_dsRNA_A_deaminase,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_dsRNA_A_deaminase,pfscan_A_deamin	p.G26R	ENST00000292205.5	37	c.76		1	.	.	.	.	.	.	.	.	.	.	C	19.64	3.866101	0.71949	.	.	ENSG00000160710	ENST00000292205	T	0.13538	2.58	3.44	2.42	0.29668	.	1.972580	0.03360	U	0.197427	T	0.07773	0.0195	.	.	.	0.24665	N	0.993447	.	.	.	.	.	.	T	0.33979	-0.9847	7	0.87932	D	0	-11.1786	7.3795	0.26847	0.2601:0.7399:0.0:0.0	.	.	.	.	R	26	ENSP00000292205:G26R	ENSP00000292205:G26R	G	-	1	0	ADAR	152867023	0.771000	0.28555	0.997000	0.53966	0.831000	0.47069	0.395000	0.20850	1.911000	0.55334	0.460000	0.39030	GGG	ADAR	-	NULL		0.642	ADAR-201	KNOWN	basic|appris_candidate_longest	protein_coding	ADAR	HGNC	protein_coding		C	NM_001111		154600399	-1	no_errors	ENST00000292205	ensembl	human	known	70_37	missense	SNP	0.989	T
AKAP9	10142	genome.wustl.edu	37	7	91652178	91652179	+	In_Frame_Ins	INS	-	-	AAC	rs111673064|rs10644111|rs397825978|rs34756483	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:91652178_91652179insAAC	ENST00000359028.2	+	15	4264_4265	c.4039_4040insAAC	c.(4039-4041)aaa>aAACaa	p.1347_1348insQ	AKAP9_ENST00000356239.3_In_Frame_Ins_p.1335_1336insQ|AKAP9_ENST00000358100.2_In_Frame_Ins_p.1347_1348insQ			Q99996	AKAP9_HUMAN	A kinase (PRKA) anchor protein 9	1347			K -> KQ. {ECO:0000269|PubMed:10202149}.		G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|Sertoli cell development (GO:0060009)|signal transduction (GO:0007165)|spermatogenesis (GO:0007283)|synaptic transmission (GO:0007268)|transport (GO:0006810)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|pericentriolar material (GO:0000242)|voltage-gated potassium channel complex (GO:0008076)	ion channel binding (GO:0044325)|protein complex scaffold (GO:0032947)|receptor binding (GO:0005102)	p.K1335_L1336insQ(1)|p.K1347_L1348insQ(1)		NS(1)|autonomic_ganglia(2)|breast(14)|central_nervous_system(3)|cervix(1)|endometrium(13)|kidney(12)|large_intestine(35)|lung(49)|ovary(8)|prostate(6)|skin(8)|stomach(1)|urinary_tract(2)	155	all_cancers(62;2.46e-09)|all_epithelial(64;4.42e-08)|Breast(17;0.00206)|all_lung(186;0.185)|all_hematologic(106;0.215)|Lung NSC(181;0.249)		STAD - Stomach adenocarcinoma(171;6.16e-05)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			TGAAAAAACTAAACTTGAAGAA	0.312			T	BRAF	papillary thyroid									2127	0.42472	0.6657	0.3689	5008	,	,		15358	0.1825		0.3867	False		,,,				2504	0.4274							Dom	yes		7	7q21-q22	10142	A kinase (PRKA) anchor protein (yotiao) 9		E	2	Insertion - In frame(2)	ovary(2)							,	2670,1594		824,1022,286					,	2.2	0.0		dbSNP_119	46	3327,4927		650,2027,1450	no	coding,coding	AKAP9	NM_147185.2,NM_005751.4	,	1474,3049,1736	A1A1,A1R,RR		40.3077,37.3827,47.907	,	,		5997,6521				SO:0001652	inframe_insertion	10142			AF091711	CCDS5622.1	7q21-q22	2014-09-17	2013-09-25		ENSG00000127914	ENSG00000127914		"""A-kinase anchor proteins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	379	protein-coding gene	gene with protein product	"""A-kinase anchoring protein 450"", ""AKAP9-BRAF fusion protein"", ""AKAP120-like protein"", ""centrosome- and golgi-localized protein kinase N-associated protein"", ""protein kinase A anchoring protein 9"", ""A-kinase anchor protein, 350kDa"", ""protein phosphatase 1, regulatory subunit 45"", ""yotiao"""	604001				9482789, 10390370, 24475373	Standard	NM_147185		Approved	KIAA0803, AKAP350, AKAP450, CG-NAP, YOTIAO, HYPERION, PRKA9, MU-RMS-40.16A, PPP1R45, LQT11	uc003ulg.3	Q99996	OTTHUMG00000131127	ENST00000359028.2:c.4040_4042dupAAC	7.37:g.91652179_91652181dupAAC	ENSP00000351922:p.Lys1347_Leu1348insGln	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1F0|A4D1F2|A4D1F4|O14869|O43355|O94895|Q75N20|Q9UQH3|Q9UQQ4|Q9Y6B8|Q9Y6Y2	In_Frame_Ins	INS	pfam_PACT_domain,superfamily_Prefoldin,superfamily_YbaB-like	p.1348in_frame_insQ	ENST00000359028.2	37	c.4039_4040		7																																																																																			AKAP9	-	NULL		0.312	AKAP9-202	KNOWN	basic	protein_coding	AKAP9	HGNC	protein_coding		-	NM_005751		91652179	+1	no_errors	ENST00000359028	ensembl	human	known	70_37	in_frame_ins	INS	0.123:0.267	AAC
ALMS1	7840	genome.wustl.edu	37	2	73613101	73613101	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:73613101G>A	ENST00000264448.6	+	1	216	c.105G>A	c.(103-105)gcG>gcA	p.A35A	ALMS1_ENST00000409009.1_Silent_p.A35A|ALMS1_ENST00000377715.1_Silent_p.A35A	NM_015120.4	NP_055935	Q8TCU4	ALMS1_HUMAN	Alstrom syndrome 1	35	Glu-rich.				endosomal transport (GO:0016197)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of stress fiber assembly (GO:0051492)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)				breast(4)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(31)|lung(68)|ovary(4)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(1)|urinary_tract(2)	147						CGGCGGCGGCGAACGTGGACG	0.667																																																	0													7.0	11.0	10.0					2																	73613101		1910	3991	5901	SO:0001819	synonymous_variant	7840			AB002326	CCDS42697.1	2p13.1	2014-09-17			ENSG00000116127	ENSG00000116127			428	protein-coding gene	gene with protein product		606844				9063741	Standard	NM_015120		Approved	KIAA0328	uc002sje.1	Q8TCU4	OTTHUMG00000152812	ENST00000264448.6:c.105G>A	2.37:g.73613101G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53S05|Q580Q8|Q86VP9|Q9Y4G4	Silent	SNP	NULL	p.A35	ENST00000264448.6	37	c.105	CCDS42697.1	2																																																																																			ALMS1	-	NULL		0.667	ALMS1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ALMS1	HGNC	protein_coding	OTTHUMT00000327776.1	G	NM_015120		73613101	+1	no_errors	ENST00000264448	ensembl	human	known	70_37	silent	SNP	0.000	A
ALOX12P2	245	genome.wustl.edu	37	17	6799927	6799927	+	RNA	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:6799927C>T	ENST00000574727.1	+	0	1278									arachidonate 12-lipoxygenase pseudogene 2											endometrium(1)	1						GCCCTCGCATCCCCCCATGGC	0.577																																																	0																																												245			AF020774		17p13.1	2014-03-18			ENSG00000262943	ENSG00000262943			432	pseudogene	pseudogene						9691181	Standard	NR_002710		Approved		uc002gdv.3		OTTHUMG00000177324		17.37:g.6799927C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000574727.1	37	NULL		17																																																																																			ALOX12P2	-	-		0.577	ALOX12P2-003	KNOWN	basic	processed_transcript	ALOX12P2	HGNC	pseudogene	OTTHUMT00000436284.1	C			6799927	+1	no_errors	ENST00000570890	ensembl	human	known	70_37	rna	SNP	0.011	T
ALPK2	115701	genome.wustl.edu	37	18	56203891	56203891	+	Silent	SNP	G	G	T	rs3809978	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:56203891G>T	ENST00000361673.3	-	5	3741	c.3528C>A	c.(3526-3528)ccC>ccA	p.P1176P	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1176						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TAGAGCTTGCGGGTGAGTGGG	0.577													T|||	3364	0.671725	0.4675	0.6772	5008	,	,		19124	0.7966		0.7674	False		,,,				2504	0.7168																0								T		2276,2130	578.0+/-384.6	597,1082,524	89.0	79.0	82.0		3528	-6.0	0.0	18	dbSNP_107	82	6606,1994	347.7+/-326.7	2550,1506,244	no	coding-synonymous	ALPK2	NM_052947.3		3147,2588,768	TT,TG,GG		23.186,48.3432,31.7084		1176/2171	56203891	8882,4124	2203	4300	6503	SO:0001819	synonymous_variant	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.3528C>A	18.37:g.56203891G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZUX0|Q8NAT5|Q96L95	Silent	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.P1176	ENST00000361673.3	37	c.3528	CCDS11966.2	18																																																																																			ALPK2	-	NULL		0.577	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	G	NM_052947		56203891	-1	no_errors	ENST00000361673	ensembl	human	known	70_37	silent	SNP	0.000	T
ALPPL2	251	genome.wustl.edu	37	2	233272600	233272600	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:233272600C>T	ENST00000295453.3	+	5	573	c.521C>T	c.(520-522)tCg>tTg	p.S174L		NM_031313.2	NP_112603.2	P10696	PPBN_HUMAN	alkaline phosphatase, placental-like 2	174					dephosphorylation (GO:0016311)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	alkaline phosphatase activity (GO:0004035)|metal ion binding (GO:0046872)			breast(2)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(1)	13		all_hematologic(139;0.00793)|Renal(207;0.0112)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0449)|Lung NSC(271;0.132)		Epithelial(121;4.45e-22)|Kidney(3;4.42e-11)|KIRC - Kidney renal clear cell carcinoma(3;1.9e-09)|BRCA - Breast invasive adenocarcinoma(100;0.000767)|Lung(119;0.00566)|LUSC - Lung squamous cell carcinoma(224;0.00746)|STAD - Stomach adenocarcinoma(3;0.0181)|GBM - Glioblastoma multiforme(43;0.196)	Amifostine(DB01143)	CAGCATGCCTCGCCAGCCGGC	0.647																																																	0													61.0	64.0	63.0					2																	233272600		2203	4300	6503	SO:0001583	missense	251			J04948	CCDS2491.1	2q37	2008-05-20			ENSG00000163286	ENSG00000163286			441	protein-coding gene	gene with protein product		171810					Standard	NM_031313		Approved		uc002vss.4	P10696	OTTHUMG00000133257	ENST00000295453.3:c.521C>T	2.37:g.233272600C>T	ENSP00000295453:p.Ser174Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAF2|Q16727|Q53S81|Q96CM1	Missense_Mutation	SNP	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase	p.S174L	ENST00000295453.3	37	c.521	CCDS2491.1	2	.	.	.	.	.	.	.	.	.	.	c	15.41	2.826270	0.50739	.	.	ENSG00000163286	ENST00000295453	D	0.96685	-4.09	2.71	2.71	0.32032	Alkaline phosphatase-like, alpha/beta/alpha (1);Alkaline-phosphatase-like, core domain (1);	0.000000	0.85682	D	0.000000	D	0.98520	0.9506	H	0.96208	3.785	0.58432	D	0.999998	D	0.76494	0.999	D	0.69824	0.966	D	0.99323	1.0907	10	0.87932	D	0	.	13.8099	0.63256	0.0:1.0:0.0:0.0	.	174	P10696	PPBN_HUMAN	L	174	ENSP00000295453:S174L	ENSP00000295453:S174L	S	+	2	0	ALPPL2	232980844	0.997000	0.39634	0.221000	0.23827	0.012000	0.07955	7.137000	0.77295	1.499000	0.48617	0.205000	0.17691	TCG	ALPPL2	-	pfam_Alkaline_phosphatase,superfamily_Alkaline_phosphatase_core,smart_Alkaline_phosphatase,prints_Alkaline_phosphatase		0.647	ALPPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPPL2	HGNC	protein_coding	OTTHUMT00000257034.2	C	NM_031313		233272600	+1	no_errors	ENST00000295453	ensembl	human	known	70_37	missense	SNP	0.994	T
AMY2A	279	genome.wustl.edu	37	1	104163266	104163266	+	Missense_Mutation	SNP	G	G	A	rs61814453	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:104163266G>A	ENST00000414303.2	+	5	902	c.838G>A	c.(838-840)Gtt>Att	p.V280I		NM_000699.2	NP_000690.1	P04746	AMYP_HUMAN	amylase, alpha 2A (pancreatic)	280					carbohydrate catabolic process (GO:0016052)|carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	alpha-amylase activity (GO:0004556)|calcium ion binding (GO:0005509)|chloride ion binding (GO:0031404)			endometrium(3)|kidney(1)|large_intestine(5)|liver(3)|lung(5)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_epithelial(167;3.05e-05)|all_lung(203;0.000199)|Lung NSC(277;0.000451)		Colorectal(144;0.0654)|all cancers(265;0.0808)|Epithelial(280;0.0921)|Lung(183;0.111)	Acarbose(DB00284)|Icodextrin(DB00702)|Miglitol(DB00491)	ACTCGGCACAGTTATTCGCAA	0.393													.|||	622	0.124201	0.0514	0.111	5008	,	,		16567	0.1081		0.1551	False		,,,				2504	0.2168																0													18.0	17.0	17.0					1																	104163266		2120	4184	6304	SO:0001583	missense	279			BC007060	CCDS783.1	1p21.1	2012-10-02	2007-05-03		ENSG00000243480	ENSG00000243480	3.2.1.1		477	protein-coding gene	gene with protein product		104650	"""amylase, alpha 2A; pancreatic"""	AMY2		3260028	Standard	NM_000699		Approved		uc001dut.3	P04746	OTTHUMG00000011023	ENST00000414303.2:c.838G>A	1.37:g.104163266G>A	ENSP00000397582:p.Val280Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EJG1|Q9UBH3	Missense_Mutation	SNP	pfam_Glyco_hydro_13_cat_dom,pfam_A-amylase_b_C,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom,smart_A-amylase_b_C,prints_Alpha_amylase	p.V280I	ENST00000414303.2	37	c.838	CCDS783.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	g|g	11.52|11.52	1.661728|1.661728	0.29515|0.29515	.|.	.|.	ENSG00000243480|ENSG00000243480	ENST00000423678|ENST00000414303;ENST00000393932	.|D	.|0.98455	.|-4.94	3.13|3.13	3.13|3.13	0.36017|0.36017	.|Glycoside hydrolase, subgroup, catalytic domain (1);Glycosyl hydrolase, family 13, catalytic domain (1);Glycoside hydrolase, superfamily (1);Glycosyl hydrolase, family 13, subfamily, catalytic domain (1);	.|0.201916	.|0.42548	.|D	.|0.000684	D|D	0.95768|0.95768	0.8623|0.8623	M|M	0.67700|0.67700	2.07|2.07	0.20196|0.20196	P|P	0.9999271308|0.9999271308	.|B	.|0.19331	.|0.035	.|B	.|0.23419	.|0.046	D|D	0.96042|0.96042	0.9025|0.9025	4|9	.|0.56958	.|D	.|0.05	.|.	14.3403|14.3403	0.66622|0.66622	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|280	.|P04746	.|AMYP_HUMAN	N|I	201|280	.|ENSP00000397582:V280I	.|ENSP00000377509:V280I	S|V	+|+	2|1	0|0	AMY2A|AMY2A	103964789|103964789	1.000000|1.000000	0.71417|0.71417	0.989000|0.989000	0.46669|0.46669	0.977000|0.977000	0.68977|0.68977	4.248000|4.248000	0.58760|0.58760	1.723000|1.723000	0.51488|0.51488	0.305000|0.305000	0.20034|0.20034	AGT|GTT	AMY2A	-	pfam_Glyco_hydro_13_cat_dom,superfamily_Glycoside_hydrolase_SF,smart_Glyco_hydro_13_sub_cat_dom		0.393	AMY2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AMY2A	HGNC	protein_coding	OTTHUMT00000030315.1	G	NM_000699		104163266	+1	no_errors	ENST00000414303	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKMY1	51281	genome.wustl.edu	37	2	241492376	241492376	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:241492376G>C	ENST00000272972.3	-	3	382	c.168C>G	c.(166-168)caC>caG	p.H56Q	ANKMY1_ENST00000373318.2_Missense_Mutation_p.H145Q|ANKMY1_ENST00000361678.4_Missense_Mutation_p.H145Q|ANKMY1_ENST00000403283.1_Missense_Mutation_p.H224Q|ANKMY1_ENST00000401804.1_Missense_Mutation_p.H145Q|ANKMY1_ENST00000391987.1_Missense_Mutation_p.H56Q|ANKMY1_ENST00000405523.3_Missense_Mutation_p.H145Q|ANKMY1_ENST00000405002.1_Missense_Mutation_p.H56Q|ANKMY1_ENST00000406958.1_Missense_Mutation_p.H145Q|ANKMY1_ENST00000462004.1_5'UTR|ANKMY1_ENST00000373320.4_Missense_Mutation_p.H56Q|ANKMY1_ENST00000536462.1_Missense_Mutation_p.H98Q	NM_016552.2	NP_057636.2	Q9P2S6	ANKY1_HUMAN	ankyrin repeat and MYND domain containing 1	56							metal ion binding (GO:0046872)	p.H56Q(1)		central_nervous_system(1)|endometrium(5)|large_intestine(4)|lung(14)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	30		all_epithelial(40;2.79e-15)|Breast(86;2.41e-05)|Renal(207;0.00183)|Ovarian(221;0.0228)|all_lung(227;0.0335)|Lung NSC(271;0.106)|all_hematologic(139;0.158)|Melanoma(123;0.16)|Hepatocellular(293;0.244)		Epithelial(32;1.03e-30)|all cancers(36;4.78e-28)|OV - Ovarian serous cystadenocarcinoma(60;1.45e-14)|Kidney(56;3.04e-09)|KIRC - Kidney renal clear cell carcinoma(57;3.23e-08)|BRCA - Breast invasive adenocarcinoma(100;7.8e-06)|Lung(119;0.00271)|LUSC - Lung squamous cell carcinoma(224;0.01)|Colorectal(34;0.0101)|COAD - Colon adenocarcinoma(134;0.0476)		AGCCTTCTCGGTGGCTGAGGT	0.562																																																	1	Substitution - Missense(1)	ovary(1)											127.0	107.0	114.0					2																	241492376		2203	4300	6503	SO:0001583	missense	51281			AB034636	CCDS2535.1, CCDS2536.1, CCDS63184.1, CCDS63185.1, CCDS74681.1	2q37.3	2013-01-10			ENSG00000144504	ENSG00000144504		"""Zinc fingers, MYND-type"", ""Ankyrin repeat domain containing"""	20987	protein-coding gene	gene with protein product							Standard	XM_005247020		Approved	FLJ20499, ZMYND13	uc002vyz.1	Q9P2S6	OTTHUMG00000133355	ENST00000272972.3:c.168C>G	2.37:g.241492376G>C	ENSP00000272972:p.His56Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB78|Q4ZFV3|Q8IYX5|Q8NDK5|Q9H0V8|Q9NX10	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_MORN,pfam_Znf_MYND,superfamily_Ankyrin_rpt-contain_dom,smart_MORN,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Znf_MYND	p.H56Q	ENST00000272972.3	37	c.168	CCDS2536.1	2	.	.	.	.	.	.	.	.	.	.	G	0.101	-1.152363	0.01700	.	.	ENSG00000144504	ENST00000373318;ENST00000406958;ENST00000272972;ENST00000361678;ENST00000391987;ENST00000373320;ENST00000403283;ENST00000401804;ENST00000536462;ENST00000405523;ENST00000405002;ENST00000539830;ENST00000441168;ENST00000418708;ENST00000418505	T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.39997	1.05;1.05;1.05;1.05;1.05;1.05;1.05;1.07;1.05;1.05;1.05;1.05;1.05;1.05	4.87	0.495	0.16890	.	1.773340	0.03442	N	0.209386	T	0.16685	0.0401	N	0.02225	-0.63	0.09310	N	1	B;B;B;B;B;B;B;B	0.13145	0.003;0.001;0.005;0.005;0.007;0.002;0.005;0.003	B;B;B;B;B;B;B;B	0.13407	0.005;0.004;0.005;0.005;0.009;0.009;0.005;0.005	T	0.12451	-1.0547	10	0.19147	T	0.46	.	1.1453	0.01774	0.1825:0.2818:0.3289:0.2069	.	56;56;98;56;145;145;145;56	Q4ZFV3;C9J176;F5H558;Q9P2S6-4;Q6GPI0;B5MBY4;Q9P2S6-2;Q9P2S6	.;.;.;.;.;.;.;ANKY1_HUMAN	Q	145;145;56;145;56;56;224;145;98;145;56;56;98;56;56	ENSP00000362415:H145Q;ENSP00000384555:H145Q;ENSP00000272972:H56Q;ENSP00000355097:H145Q;ENSP00000375847:H56Q;ENSP00000362417:H56Q;ENSP00000383968:H224Q;ENSP00000385887:H145Q;ENSP00000444707:H98Q;ENSP00000385635:H145Q;ENSP00000385145:H56Q;ENSP00000405938:H98Q;ENSP00000407015:H56Q;ENSP00000412094:H56Q	ENSP00000272972:H56Q	H	-	3	2	ANKMY1	241141049	0.009000	0.17119	0.002000	0.10522	0.056000	0.15407	-0.125000	0.10579	0.095000	0.17434	0.655000	0.94253	CAC	ANKMY1	-	NULL		0.562	ANKMY1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKMY1	HGNC	protein_coding	OTTHUMT00000257187.2	G	NM_017844		241492376	-1	no_errors	ENST00000272972	ensembl	human	known	70_37	missense	SNP	0.001	C
LOC101927209	101927209	genome.wustl.edu	37	1	142716663	142716663	+	lincRNA	SNP	T	T	C	rs9328986		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:142716663T>C	ENST00000610091.1	-	0	381																											GGGAAATTGCTGAGGATACGT	0.358																																																	0																																												100874392																															1.37:g.142716663T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000610091.1	37	NULL		1																																																																																			ANKRD20A12P	-	-		0.358	RP11-417J8.6-001	KNOWN	basic	lincRNA	ANKRD20A12P	HGNC	lincRNA	OTTHUMT00000037265.2	T			142716663	-1	no_errors	ENST00000595144	ensembl	human	known	70_37	rna	SNP	0.006	C
ANKRD20A2	441430	genome.wustl.edu	37	9	42368549	42368549	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:42368549C>T	ENST00000377601.2	+	1	247	c.135C>T	c.(133-135)gaC>gaT	p.D45D	RP11-216M21.7_ENST00000450520.1_RNA	NM_001012421.1	NP_001012421.1	Q5SQ80	A20A2_HUMAN	ankyrin repeat domain 20 family, member A2	45										large_intestine(1)|lung(1)|ovary(1)|urinary_tract(1)	4						TCAAAGGCGACGCCGCGGAGG	0.677																																																	0													8.0	7.0	8.0					9																	42368549		2144	4122	6266	SO:0001819	synonymous_variant	441430				CCDS35028.1	9p12	2013-01-10			ENSG00000183148	ENSG00000183148		"""Ankyrin repeat domain containing"""	31979	protein-coding gene	gene with protein product							Standard	XM_005272519		Approved			Q5SQ80	OTTHUMG00000058641	ENST00000377601.2:c.135C>T	9.37:g.42368549C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D45	ENST00000377601.2	37	c.135	CCDS35028.1	9																																																																																			ANKRD20A2	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt-contain_dom		0.677	ANKRD20A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD20A2	HGNC	protein_coding	OTTHUMT00000129794.1	C	NM_001012421		42368549	+1	no_errors	ENST00000377601	ensembl	human	known	70_37	silent	SNP	0.000	T
ANKRD31	256006	genome.wustl.edu	37	5	74491716	74491718	+	In_Frame_Del	DEL	TCA	TCA	-	rs10563854	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	TCA	TCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:74491716_74491718delTCA	ENST00000274361.3	-	7	946_948	c.755_757delTGA	c.(754-759)atgaac>aac	p.M252del	ANKRD31_ENST00000506364.2_In_Frame_Del_p.M252del	NM_001164443.1	NP_001157915.1	Q8N7Z5	ANR31_HUMAN	ankyrin repeat domain 31	252										endometrium(1)|kidney(4)	5						CTCAATGGGTTCATCAATTCTTT	0.379														2912	0.58147	0.8858	0.4193	5008	,	,		21049	0.4752		0.3857	False		,,,				2504	0.5961																0										1685,409		708,269,70						-2.5	0.0		dbSNP_119	88	1573,2789		351,871,959	no	coding	ANKRD31	NM_001164443.1		1059,1140,1029	A1A1,A1R,RR		36.0614,19.532,49.5353				3258,3198				SO:0001651	inframe_deletion	256006			AK097510	CCDS47233.1	5q13.3	2013-01-10			ENSG00000145700	ENSG00000145700		"""Ankyrin repeat domain containing"""	26853	protein-coding gene	gene with protein product							Standard	NM_001164443		Approved	FLJ40191	uc003kdo.2	Q8N7Z5	OTTHUMG00000162649	ENST00000274361.3:c.755_757delTGA	5.37:g.74491719_74491721delTCA	ENSP00000274361:p.Met252del	Somatic		WXS	Illumina HiSeq	Phase_IV		In_Frame_Del	DEL	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.M252in_frame_del	ENST00000274361.3	37	c.757_755		5																																																																																			ANKRD31	-	NULL		0.379	ANKRD31-201	KNOWN	basic|appris_principal	protein_coding	ANKRD31	HGNC	protein_coding		TCA	NM_001164443		74491718	-1	no_errors	ENST00000274361	ensembl	human	known	70_37	in_frame_del	DEL	0.000:0.000:0.000	-
ANKRD36	375248	genome.wustl.edu	37	2	97877440	97877440	+	Missense_Mutation	SNP	T	T	C	rs35711845	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:97877440T>C	ENST00000461153.2	+	58	3675	c.3431T>C	c.(3430-3432)aTg>aCg	p.M1144T	ANKRD36_ENST00000420699.2_Missense_Mutation_p.M1144T			A6QL64	AN36A_HUMAN	ankyrin repeat domain 36	1144										endometrium(9)|kidney(5)|liver(1)|lung(3)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	23						GTTCCGAATATGGCCACGGAA	0.338													.|||	1324	0.264377	0.0885	0.3602	5008	,	,		25668	0.1964		0.5129	False		,,,				2504	0.2485																0								T	THR/MET	250,1134		3,244,445	149.0	140.0	143.0		3431	-2.3	0.0	2	dbSNP_126	143	1583,1599		99,1385,107	yes	missense	ANKRD36	NM_001164315.1	81	102,1629,552	CC,CT,TT		49.7486,18.0636,40.1445	benign	1144/1942	97877440	1833,2733	692	1591	2283	SO:0001583	missense	375248			BC046186	CCDS54379.1	2q11.2	2013-09-24			ENSG00000135976	ENSG00000135976		"""Ankyrin repeat domain containing"""	24079	protein-coding gene	gene with protein product						12975309	Standard	NM_001164315		Approved	UNQ2430	uc010yva.2	A6QL64	OTTHUMG00000155256	ENST00000461153.2:c.3431T>C	2.37:g.97877440T>C	ENSP00000419530:p.Met1144Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3I8|Q6UX02|Q86X62|Q9HCD1	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.M1144T	ENST00000461153.2	37	c.3431	CCDS54379.1	2	.	.	.	.	.	.	.	.	.	.	.	1.894	-0.454824	0.04540	0.180636	0.497486	ENSG00000135976	ENST00000461153;ENST00000420699;ENST00000461694	T;T	0.77229	-1.08;-1.08	1.17	-2.3	0.06785	.	.	.	.	.	T	0.00012	0.0000	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.39941	-0.9589	8	0.23891	T	0.37	.	1.5487	0.02570	0.4242:0.0:0.2415:0.3342	rs35711845;rs62156172	1144	A6QL64	AN36A_HUMAN	T	1144;1144;404	ENSP00000419530:M1144T;ENSP00000391950:M1144T	ENSP00000391950:M1144T	M	+	2	0	ANKRD36	97241167	0.002000	0.14202	0.000000	0.03702	0.000000	0.00434	0.779000	0.26746	-0.591000	0.05859	-0.727000	0.03589	ATG	ANKRD36	-	NULL		0.338	ANKRD36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD36	HGNC	protein_coding	OTTHUMT00000339154.5	T			97877440	+1	no_errors	ENST00000420699	ensembl	human	known	70_37	missense	SNP	0.000	C
AP5B1	91056	genome.wustl.edu	37	11	65546763	65546763	+	Missense_Mutation	SNP	G	G	A	rs201041158	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:65546763G>A	ENST00000532090.2	-	2	1411	c.1201C>T	c.(1201-1203)Ctc>Ttc	p.L401F		NM_138368.4	NP_612377.4	Q2VPB7	AP5B1_HUMAN	adaptor-related protein complex 5, beta 1 subunit	401	Leu-rich.				endosomal transport (GO:0016197)|protein transport (GO:0015031)	AP-type membrane coat adaptor complex (GO:0030119)|lysosomal membrane (GO:0005765)				lung(1)	1						CTGGGCAGGAGACCACGGCAT	0.627													G|||	7	0.00139776	0.0	0.0029	5008	,	,		18040	0.0		0.003	False		,,,				2504	0.002																0								G	PHE/LEU	4,4180		0,4,2088	19.0	23.0	22.0		1030	5.0	0.9	11		22	42,8380		0,42,4169	yes	missense	DKFZp761E198	NM_138368.3	22	0,46,6257	AA,AG,GG		0.4987,0.0956,0.3649	probably-damaging	344/822	65546763	46,12560	2092	4211	6303	SO:0001583	missense	91056			JQ313135	CCDS58146.1	11q13.1	2012-02-29			ENSG00000254470	ENSG00000254470			25104	protein-coding gene	gene with protein product		614367				22022230	Standard	NM_138368		Approved	PP1030, AP-5, DKFZp761E198	uc031qbm.1	Q2VPB7	OTTHUMG00000166593	ENST00000532090.2:c.1201C>T	11.37:g.65546763G>A	ENSP00000454303:p.Leu401Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L0S6|H6WUK2|Q0D2Q2|Q8N3J7|Q8WYH6	Missense_Mutation	SNP	NULL	p.L401F	ENST00000532090.2	37	c.1201	CCDS58146.1	11																																																																																			AP5B1	-	NULL		0.627	AP5B1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	AP5B1	HGNC	protein_coding	OTTHUMT00000390636.2	G	NM_138368		65546763	-1	no_errors	ENST00000532090	ensembl	human	novel	70_37	missense	SNP	0.939	A
APOB	338	genome.wustl.edu	37	2	21252878	21252878	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:21252878C>T	ENST00000233242.1	-	11	1489	c.1362G>A	c.(1360-1362)aaG>aaA	p.K454K	APOB_ENST00000399256.4_Silent_p.K454K	NM_000384.2	NP_000375	P04114	APOB_HUMAN	apolipoprotein B	454	Vitellogenin. {ECO:0000255|PROSITE- ProRule:PRU00557}.				artery morphogenesis (GO:0048844)|blood coagulation (GO:0007596)|cellular response to prostaglandin stimulus (GO:0071379)|cellular response to tumor necrosis factor (GO:0071356)|cholesterol efflux (GO:0033344)|cholesterol homeostasis (GO:0042632)|cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|fertilization (GO:0009566)|in utero embryonic development (GO:0001701)|leukocyte migration (GO:0050900)|lipoprotein biosynthetic process (GO:0042158)|lipoprotein catabolic process (GO:0042159)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|low-density lipoprotein particle clearance (GO:0034383)|low-density lipoprotein particle remodeling (GO:0034374)|nervous system development (GO:0007399)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol storage (GO:0010886)|positive regulation of lipid storage (GO:0010884)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|post-embryonic development (GO:0009791)|receptor-mediated endocytosis (GO:0006898)|regulation of cholesterol biosynthetic process (GO:0045540)|response to carbohydrate (GO:0009743)|response to lipopolysaccharide (GO:0032496)|response to selenium ion (GO:0010269)|response to virus (GO:0009615)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|triglyceride catabolic process (GO:0019433)|triglyceride mobilization (GO:0006642)|very-low-density lipoprotein particle assembly (GO:0034379)	actin cytoskeleton (GO:0015629)|chylomicron (GO:0042627)|chylomicron remnant (GO:0034360)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|early endosome (GO:0005769)|endocytic vesicle lumen (GO:0071682)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endosome lumen (GO:0031904)|endosome membrane (GO:0010008)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intermediate-density lipoprotein particle (GO:0034363)|intracellular membrane-bounded organelle (GO:0043231)|low-density lipoprotein particle (GO:0034362)|mature chylomicron (GO:0034359)|plasma membrane (GO:0005886)|very-low-density lipoprotein particle (GO:0034361)	cholesterol transporter activity (GO:0017127)|heparin binding (GO:0008201)|lipase binding (GO:0035473)|low-density lipoprotein particle receptor binding (GO:0050750)|phospholipid binding (GO:0005543)			NS(5)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(19)|kidney(10)|large_intestine(63)|liver(5)|lung(125)|ovary(16)|pancreas(1)|prostate(5)|skin(31)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(6)	305	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					TAGGGTTTGTCTTATGATAGC	0.393																																																	0													105.0	104.0	104.0					2																	21252878		2203	4300	6503	SO:0001819	synonymous_variant	338			M14162	CCDS1703.1	2p24-p23	2013-05-29	2013-05-29		ENSG00000084674	ENSG00000084674		"""Apolipoproteins"""	603	protein-coding gene	gene with protein product		107730	"""apolipoprotein B (including Ag(x) antigen)"""				Standard	NM_000384		Approved		uc002red.3	P04114	OTTHUMG00000090785	ENST00000233242.1:c.1362G>A	2.37:g.21252878C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00502|P78479|P78480|P78481|Q13779|Q13785|Q13786|Q13787|Q13788|Q4ZG63|Q53QC8|Q7Z600|Q9UMN0	Silent	SNP	pfam_Lipid_transpt_N,pfam_Vitellinogen_open_b-sht,pfam_ApoB100_C,pfam_Lipid_transpt_open_b-sht,superfamily_Lipid_transp_b-sht_shell,superfamily_Vitellinogen_superhlx,superfamily_ARM-type_fold,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N	p.K454	ENST00000233242.1	37	c.1362	CCDS1703.1	2																																																																																			APOB	-	pfam_Lipid_transpt_N,superfamily_Vitellinogen_superhlx,smart_Lipid_transpt_N,pfscan_Lipid_transpt_N		0.393	APOB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOB	HGNC	protein_coding	OTTHUMT00000207571.1	C			21252878	-1	no_errors	ENST00000233242	ensembl	human	known	70_37	silent	SNP	0.000	T
APOBEC3G	60489	genome.wustl.edu	37	22	39477102	39477102	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:39477102G>A	ENST00000407997.3	+	3	693	c.336G>A	c.(334-336)ccG>ccA	p.P112P	APOBEC3G_ENST00000461827.1_3'UTR|APOBEC3G_ENST00000452957.2_Silent_p.P112P	NM_021822.3	NP_068594.1	Q9HC16	ABC3G_HUMAN	apolipoprotein B mRNA editing enzyme, catalytic polypeptide-like 3G	112					base conversion or substitution editing (GO:0016553)|cytidine deamination (GO:0009972)|defense response to virus (GO:0051607)|DNA cytosine deamination (GO:0070383)|innate immune response (GO:0045087)|negative regulation of single stranded viral RNA replication via double stranded DNA intermediate (GO:0045869)|negative regulation of transposition (GO:0010529)|negative regulation of viral genome replication (GO:0045071)|negative regulation of viral process (GO:0048525)|positive regulation of defense response to virus by host (GO:0002230)|viral process (GO:0016032)	apolipoprotein B mRNA editing enzyme complex (GO:0030895)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|ribonucleoprotein complex (GO:0030529)	cytidine deaminase activity (GO:0004126)|deoxycytidine deaminase activity (GO:0047844)|protein homodimerization activity (GO:0042803)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			central_nervous_system(1)|large_intestine(4)|lung(5)|skin(1)|stomach(1)	12	Melanoma(58;0.04)					CCGAGGACCCGAAGGTTACCC	0.567																																																	0													112.0	96.0	102.0					22																	39477102		2203	4300	6503	SO:0001819	synonymous_variant	60489			AF182420	CCDS13984.1	22q13.1-q13.2	2008-05-15			ENSG00000239713	ENSG00000239713		"""Apolipoprotein B mRNA editing enzymes"""	17357	protein-coding gene	gene with protein product		607113				11863358	Standard	NM_021822		Approved	CEM15, MDS019, dJ494G10.1, FLJ12740, bK150C2.7		Q9HC16	OTTHUMG00000151081	ENST00000407997.3:c.336G>A	22.37:g.39477102G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDR9|Q45F02|Q5TF77|Q7Z2N1|Q7Z2N4|Q9H9H8	Silent	SNP	pfam_APOBEC_N,pfam_APOBEC_C,superfamily_Cytidine_deaminase-like	p.P112	ENST00000407997.3	37	c.336	CCDS13984.1	22																																																																																			APOBEC3G	-	pfam_APOBEC_N,superfamily_Cytidine_deaminase-like		0.567	APOBEC3G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APOBEC3G	HGNC	protein_coding	OTTHUMT00000321219.1	G	NM_021822		39477102	+1	no_errors	ENST00000407997	ensembl	human	known	70_37	silent	SNP	0.000	A
AQR	9716	genome.wustl.edu	37	15	35226813	35226813	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:35226813G>T	ENST00000156471.5	-	10	967	c.742C>A	c.(742-744)Cat>Aat	p.H248N		NM_014691.2	NP_055506.1	O60306	AQR_HUMAN	aquarius intron-binding spliceosomal factor	248					mRNA splicing, via spliceosome (GO:0000398)	catalytic step 2 spliceosome (GO:0071013)|membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(10)|lung(18)|ovary(1)|prostate(6)|skin(4)|upper_aerodigestive_tract(2)	57		Lung NSC(122;8.7e-10)|all_lung(180;1.47e-08)		all cancers(64;4.34e-18)|GBM - Glioblastoma multiforme(113;4.59e-07)|BRCA - Breast invasive adenocarcinoma(123;0.0283)		TCACAGTAATGAACTTTGTCC	0.353																																																	0													56.0	55.0	55.0					15																	35226813		1812	4079	5891	SO:0001583	missense	9716			AB011132	CCDS42013.1	15q13	2013-09-12	2013-09-12			ENSG00000021776			29513	protein-coding gene	gene with protein product	"""functional spliceosome-associated protein 164"""	610548	"""aquarius homolog (mouse)"""			9626505, 16949364	Standard	NM_014691		Approved	KIAA0560, fSAP164, IBP160	uc001ziv.3	O60306		ENST00000156471.5:c.742C>A	15.37:g.35226813G>T	ENSP00000156471:p.His248Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A0JP17|A5YKK3|Q2YDX9|Q6IRU8|Q6PIC8	Missense_Mutation	SNP	NULL	p.H248N	ENST00000156471.5	37	c.742	CCDS42013.1	15	.	.	.	.	.	.	.	.	.	.	G	18.37	3.608579	0.66558	.	.	ENSG00000021776	ENST00000156471;ENST00000543879	D	0.93076	-3.16	5.54	5.54	0.83059	.	0.048011	0.85682	D	0.000000	D	0.92001	0.7466	M	0.65498	2.005	0.80722	D	1	B	0.20671	0.047	B	0.15052	0.012	D	0.88093	0.2814	10	0.15499	T	0.54	-25.569	19.6745	0.95926	0.0:0.0:1.0:0.0	.	248	O60306	AQR_HUMAN	N	248	ENSP00000156471:H248N	ENSP00000156471:H248N	H	-	1	0	AQR	33014105	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.545000	0.98095	2.880000	0.98712	0.650000	0.86243	CAT	AQR	-	NULL		0.353	AQR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AQR	HGNC	protein_coding	OTTHUMT00000417526.2	G	NM_014691		35226813	-1	no_errors	ENST00000156471	ensembl	human	known	70_37	missense	SNP	1.000	T
ARHGAP31	57514	genome.wustl.edu	37	3	119133738	119133738	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:119133738C>T	ENST00000264245.4	+	12	3494	c.2962C>T	c.(2962-2964)Cag>Tag	p.Q988*		NM_020754.2	NP_065805.2	Q2M1Z3	RHG31_HUMAN	Rho GTPase activating protein 31	988					regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell junction (GO:0030054)|cytosol (GO:0005829)|lamellipodium (GO:0030027)	GTPase activator activity (GO:0005096)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(10)|kidney(3)|large_intestine(11)|lung(29)|ovary(2)|pancreas(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	67						TGACCCTCTTCAGCCCCAGGC	0.537																																					Pancreas(7;176 297 5394 51128 51241)												0													67.0	68.0	68.0					3																	119133738		1898	4133	6031	SO:0001587	stop_gained	57514				CCDS43135.1	3q13.33	2011-06-29			ENSG00000031081	ENSG00000031081		"""Rho GTPase activating proteins"""	29216	protein-coding gene	gene with protein product		610911				9786927, 12819203, 16519628	Standard	NM_020754		Approved	CDGAP	uc003ecj.4	Q2M1Z3	OTTHUMG00000159362	ENST00000264245.4:c.2962C>T	3.37:g.119133738C>T	ENSP00000264245:p.Gln988*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULL6	Nonsense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.Q988*	ENST00000264245.4	37	c.2962	CCDS43135.1	3	.	.	.	.	.	.	.	.	.	.	C	40	8.467947	0.98825	.	.	ENSG00000031081	ENST00000264245;ENST00000543280	.	.	.	5.05	4.15	0.48705	.	0.591514	0.15446	N	0.261954	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.51188	T	0.08	.	12.4571	0.55710	0.1686:0.8314:0.0:0.0	.	.	.	.	X	988	.	ENSP00000264245:Q988X	Q	+	1	0	ARHGAP31	120616428	0.998000	0.40836	0.721000	0.30653	0.378000	0.30076	1.444000	0.35068	1.298000	0.44778	0.561000	0.74099	CAG	ARHGAP31	-	NULL		0.537	ARHGAP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGAP31	HGNC	protein_coding	OTTHUMT00000354942.2	C			119133738	+1	no_errors	ENST00000264245	ensembl	human	known	70_37	nonsense	SNP	0.481	T
ASAP1	50807	genome.wustl.edu	37	8	131128932	131128932	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:131128932C>T	ENST00000518721.1	-	22	2283	c.2056G>A	c.(2056-2058)Gaa>Aaa	p.E686K	ASAP1_ENST00000357668.1_Missense_Mutation_p.E686K	NM_001247996.1|NM_018482.3	NP_001234925.1|NP_060952.2	Q9ULH1	ASAP1_HUMAN	ArfGAP with SH3 domain, ankyrin repeat and PH domain 1	686					cilium morphogenesis (GO:0060271)|regulation of ARF GTPase activity (GO:0032312)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|zinc ion binding (GO:0008270)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(22)|ovary(6)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	68						ACCAGATCTTCACACTGGGTA	0.358																																																	0													166.0	159.0	161.0					8																	131128932		2203	4300	6503	SO:0001583	missense	50807			AB033075	CCDS6362.1, CCDS75788.1	8q24.1-q24.2	2013-01-11	2008-09-22	2008-09-22	ENSG00000153317	ENSG00000153317		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	2720	protein-coding gene	gene with protein product	"""centaurin, beta 4"""	605953	"""development and differentiation enhancing factor 1"""	DDEF1		9819391	Standard	NM_018482		Approved	PAP, KIAA1249, ZG14P, CENTB4	uc003yta.2	Q9ULH1	OTTHUMG00000164772	ENST00000518721.1:c.2056G>A	8.37:g.131128932C>T	ENSP00000429900:p.Glu686Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNV3	Missense_Mutation	SNP	pfam_ArfGAP,pfam_SH3_domain,pfam_Pleckstrin_homology,pfam_SH3_2,superfamily_Ankyrin_rpt-contain_dom,superfamily_SH3_domain,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,smart_SH3_domain,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_ArfGAP,prints_ArfGAP,prints_p67phox	p.E686K	ENST00000518721.1	37	c.2056	CCDS6362.1	8	.	.	.	.	.	.	.	.	.	.	C	24.6	4.554244	0.86231	.	.	ENSG00000153317	ENST00000343135;ENST00000357668;ENST00000518721	T;T	0.07021	3.23;3.23	5.65	5.65	0.86999	Ankyrin repeat-containing domain (2);	0.113720	0.56097	D	0.000024	T	0.10594	0.0259	L	0.51422	1.61	0.80722	D	1	P;P;P	0.49358	0.923;0.923;0.844	B;B;B	0.38616	0.277;0.277;0.182	T	0.10337	-1.0634	10	0.32370	T	0.25	.	18.7079	0.91645	0.0:1.0:0.0:0.0	.	686;686;689	B2RNV3;Q9ULH1;Q9ULH1-2	.;ASAP1_HUMAN;.	K	689;686;686	ENSP00000350297:E686K;ENSP00000429900:E686K	ENSP00000344591:E689K	E	-	1	0	ASAP1	131198114	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.230000	0.78097	2.668000	0.90789	0.655000	0.94253	GAA	ASAP1	-	superfamily_Ankyrin_rpt-contain_dom		0.358	ASAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASAP1	HGNC	protein_coding	OTTHUMT00000380170.1	C	NM_018482		131128932	-1	no_errors	ENST00000357668	ensembl	human	known	70_37	missense	SNP	1.000	T
ASCL4	121549	genome.wustl.edu	37	12	108169152	108169152	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:108169152G>A	ENST00000342331.4	+	1	991	c.160G>A	c.(160-162)Ggc>Agc	p.G54S		NM_203436.2	NP_982260.2	Q6XD76	ASCL4_HUMAN	achaete-scute family bHLH transcription factor 4	53					regulation of transcription from RNA polymerase II promoter (GO:0006357)|skin development (GO:0043588)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(1)|large_intestine(3)|lung(6)|upper_aerodigestive_tract(1)	13						GGCGCGCAGCGGCTGCGCACG	0.761																																					GBM(170;776 3695 11650)												0													7.0	10.0	9.0					12																	108169152		2069	4040	6109	SO:0001583	missense	121549			AY238895	CCDS31894.2	12q24.11	2013-10-17	2013-10-17		ENSG00000187855	ENSG00000187855		"""Basic helix-loop-helix proteins"""	24311	protein-coding gene	gene with protein product		609155	"""achaete-scute complex-like 4 (Drosophila)"", ""achaete-scute complex homolog 4 (Drosophila)"""				Standard	NM_203436		Approved	HASH4, bHLHa44	uc001tmr.3	Q6XD76	OTTHUMG00000156964	ENST00000342331.4:c.160G>A	12.37:g.108169152G>A	ENSP00000345420:p.Gly54Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7RTS2	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.G54S	ENST00000342331.4	37	c.160	CCDS31894.2	12	.	.	.	.	.	.	.	.	.	.	G	9.567	1.120020	0.20877	.	.	ENSG00000187855	ENST00000342331	D	0.97186	-4.28	3.71	1.82	0.25136	.	0.516920	0.18061	N	0.152938	D	0.91392	0.7284	L	0.29908	0.895	0.09310	N	1	P	0.35872	0.525	B	0.28638	0.092	D	0.83467	0.0057	10	0.30854	T	0.27	-22.8226	7.954	0.30031	0.1982:0.0:0.8018:0.0	.	53	Q6XD76	ASCL4_HUMAN	S	54	ENSP00000345420:G54S	ENSP00000345420:G54S	G	+	1	0	ASCL4	106693282	0.000000	0.05858	0.000000	0.03702	0.089000	0.18198	0.080000	0.14802	0.176000	0.19873	0.484000	0.47621	GGC	ASCL4	-	NULL		0.761	ASCL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASCL4	HGNC	protein_coding	OTTHUMT00000346845.1	G	NM_203436		108169152	+1	no_errors	ENST00000342331	ensembl	human	known	70_37	missense	SNP	0.001	A
ASPA	443	genome.wustl.edu	37	17	3397702	3397702	+	Silent	SNP	C	C	T	rs12948217	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:3397702C>T	ENST00000263080.2	+	5	851	c.693C>T	c.(691-693)taC>taT	p.Y231Y	ASPA_ENST00000456349.2_Silent_p.Y231Y|SPATA22_ENST00000541913.1_Intron	NM_000049.2	NP_000040.1	P45381	ACY2_HUMAN	aspartoacylase	231			Y -> C (in CAND). {ECO:0000269|PubMed:10564886}.		aspartate catabolic process (GO:0006533)|central nervous system myelination (GO:0022010)|positive regulation of oligodendrocyte differentiation (GO:0048714)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	aminoacylase activity (GO:0004046)|aspartoacylase activity (GO:0019807)|hydrolase activity, acting on ester bonds (GO:0016788)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|large_intestine(6)|lung(5)|stomach(1)|urinary_tract(1)	17					L-Aspartic Acid(DB00128)	AAGTTGATTACCCCCGGGATG	0.343													t|||	1020	0.203674	0.2345	0.1844	5008	,	,		20080	0.0496		0.3101	False		,,,				2504	0.2249																0			GRCh37	CM940123	ASPA	M	rs12948217	T	,	1075,3331	722.2+/-409.3	127,821,1255	179.0	200.0	192.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	693,693	3.5	1.0	17	dbSNP_121	192	2687,5913	683.3+/-403.9	446,1795,2059	no	coding-synonymous,coding-synonymous	ASPA	NM_000049.2,NM_001128085.1	,	573,2616,3314	TT,TC,CC		31.2442,24.3985,28.9251	,	231/314,231/314	3397702	3762,9244	2203	4300	6503	SO:0001819	synonymous_variant	443			S67156	CCDS11028.1	17p13.3	2010-06-24	2010-06-24		ENSG00000108381	ENSG00000108381	3.5.1.15		756	protein-coding gene	gene with protein product	"""aminoacylase 2"", ""Canavan disease"""	608034	"""aspartoacylase (aminoacylase 2, Canavan disease)"""			8252036	Standard	NM_001128085		Approved	ASP, ACY2	uc002fvq.3	P45381	OTTHUMG00000090655	ENST00000263080.2:c.693C>T	17.37:g.3397702C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Aste_AspA,pirsf_Aspartoacylase	p.Y231	ENST00000263080.2	37	c.693	CCDS11028.1	17																																																																																			ASPA	-	pfam_Aste_AspA,pirsf_Aspartoacylase		0.343	ASPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASPA	HGNC	protein_coding	OTTHUMT00000207315.1	C	NM_000049		3397702	+1	no_errors	ENST00000263080	ensembl	human	known	70_37	silent	SNP	1.000	T
ASXL3	80816	genome.wustl.edu	37	18	31319867	31319867	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:31319867G>A	ENST00000269197.5	+	11	2499	c.2499G>A	c.(2497-2499)ctG>ctA	p.L833L		NM_030632.1	NP_085135.1	Q9C0F0	ASXL3_HUMAN	additional sex combs like transcriptional regulator 3	833					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|kidney(3)|large_intestine(6)|lung(22)|ovary(2)|pancreas(1)|skin(2)|urinary_tract(1)	43						ATAAGACCCTGAGTCAGCAAA	0.398																																																	0													68.0	66.0	67.0					18																	31319867		1897	4124	6021	SO:0001819	synonymous_variant	80816			AB051500	CCDS45847.1	18q11	2014-06-17	2014-06-17	2007-02-01		ENSG00000141431			29357	protein-coding gene	gene with protein product		615115	"""KIAA1713"", ""additional sex combs like 3 (Drosophila)"""	KIAA1713		11214970	Standard	NM_030632		Approved		uc010dmg.1	Q9C0F0		ENST00000269197.5:c.2499G>A	18.37:g.31319867G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZMX6|Q96MU3|Q9UFC5	Silent	SNP	superfamily_Znf_FYVE_PHD	p.L833	ENST00000269197.5	37	c.2499	CCDS45847.1	18																																																																																			ASXL3	-	NULL		0.398	ASXL3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ASXL3	HGNC	protein_coding	OTTHUMT00000441865.2	G			31319867	+1	no_errors	ENST00000269197	ensembl	human	known	70_37	silent	SNP	0.000	A
ATG2B	55102	genome.wustl.edu	37	14	96788973	96788973	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:96788973C>A	ENST00000359933.4	-	17	3533	c.2640G>T	c.(2638-2640)gaG>gaT	p.E880D	snoU13_ENST00000458931.1_RNA	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	880					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CACCTCCTTCCTCTTCCTCCT	0.413																																																	0													111.0	105.0	107.0					14																	96788973		1911	4133	6044	SO:0001583	missense	55102			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2640G>T	14.37:g.96788973C>A	ENSP00000353010:p.Glu880Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.E880D	ENST00000359933.4	37	c.2640	CCDS9944.2	14	.	.	.	.	.	.	.	.	.	.	C	13.80	2.345877	0.41599	.	.	ENSG00000066739	ENST00000359933	T	0.10668	2.85	5.67	2.77	0.32553	.	0.221498	0.19507	U	0.112590	T	0.05090	0.0136	N	0.17474	0.49	0.41372	D	0.987497	B	0.17465	0.022	B	0.14578	0.011	T	0.33574	-0.9863	10	0.15952	T	0.53	.	3.6862	0.08329	0.1485:0.57:0.1457:0.1358	.	880	Q96BY7	ATG2B_HUMAN	D	880	ENSP00000353010:E880D	ENSP00000353010:E880D	E	-	3	2	ATG2B	95858726	0.995000	0.38212	1.000000	0.80357	0.997000	0.91878	0.414000	0.21164	1.354000	0.45846	0.655000	0.94253	GAG	ATG2B	-	NULL		0.413	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	HGNC	protein_coding	OTTHUMT00000314037.1	C	NM_018036		96788973	-1	no_errors	ENST00000359933	ensembl	human	known	70_37	missense	SNP	1.000	A
ATG2B	55102	genome.wustl.edu	37	14	96788975	96788975	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:96788975C>T	ENST00000359933.4	-	17	3531	c.2638G>A	c.(2638-2640)Gag>Aag	p.E880K	snoU13_ENST00000458931.1_RNA	NM_018036.5	NP_060506	Q96BY7	ATG2B_HUMAN	autophagy related 2B	880					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|cervix(2)|endometrium(7)|kidney(4)|large_intestine(11)|liver(1)|lung(26)|ovary(1)|prostate(1)|skin(1)|urinary_tract(7)	64		all_cancers(154;0.0462)|all_epithelial(191;0.123)|Melanoma(154;0.155)		Epithelial(152;0.21)|COAD - Colon adenocarcinoma(157;0.244)		CCTCCTTCCTCTTCCTCCTGG	0.418																																																	0													111.0	105.0	107.0					14																	96788975		1915	4133	6048	SO:0001583	missense	55102			AK001104	CCDS9944.2	14q32.31	2014-02-12	2012-06-06	2007-07-31	ENSG00000066739	ENSG00000066739			20187	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 103"", ""ATG2 autophagy related 2 homolog B (S. cerevisiae)"""	C14orf103		22350415	Standard	NM_018036		Approved	FLJ10242	uc001yfi.3	Q96BY7	OTTHUMG00000149933	ENST00000359933.4:c.2638G>A	14.37:g.96788975C>T	ENSP00000353010:p.Glu880Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRE7|Q96DQ3|Q9NW80	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.E880K	ENST00000359933.4	37	c.2638	CCDS9944.2	14	.	.	.	.	.	.	.	.	.	.	C	28.1	4.887943	0.91814	.	.	ENSG00000066739	ENST00000359933	T	0.10005	2.92	5.67	5.67	0.87782	.	0.221498	0.19507	U	0.112590	T	0.12050	0.0293	L	0.44542	1.39	0.58432	D	0.999999	P	0.46395	0.877	B	0.40741	0.339	T	0.17930	-1.0353	10	0.09338	T	0.73	.	19.7654	0.96337	0.0:1.0:0.0:0.0	.	880	Q96BY7	ATG2B_HUMAN	K	880	ENSP00000353010:E880K	ENSP00000353010:E880K	E	-	1	0	ATG2B	95858728	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.171000	0.77595	2.679000	0.91253	0.655000	0.94253	GAG	ATG2B	-	NULL		0.418	ATG2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG2B	HGNC	protein_coding	OTTHUMT00000314037.1	C	NM_018036		96788975	-1	no_errors	ENST00000359933	ensembl	human	known	70_37	missense	SNP	1.000	T
ATG7	10533	genome.wustl.edu	37	3	11596302	11596302	+	Silent	SNP	T	T	C	rs8154	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:11596302T>C	ENST00000354449.3	+	19	2122	c.2097T>C	c.(2095-2097)gaT>gaC	p.D699D	ATG7_ENST00000354956.5_Silent_p.D672D|ATG7_ENST00000446450.2_Silent_p.D619D	NM_006395.2	NP_006386.1	O95352	ATG7_HUMAN	autophagy related 7	699					adult walking behavior (GO:0007628)|C-terminal protein lipidation (GO:0006501)|cardiac muscle cell development (GO:0055013)|cellular amino acid metabolic process (GO:0006520)|cellular protein modification process (GO:0006464)|cellular response to hyperoxia (GO:0071455)|cellular response to nitrogen starvation (GO:0006995)|cellular response to starvation (GO:0009267)|central nervous system neuron axonogenesis (GO:0021955)|cerebellar Purkinje cell layer development (GO:0021680)|cerebral cortex development (GO:0021987)|late nucleophagy (GO:0044805)|liver development (GO:0001889)|membrane fusion (GO:0061025)|mitochondrion degradation (GO:0000422)|mitochondrion organization (GO:0007005)|negative regulation of apoptotic process (GO:0043066)|negative stranded viral RNA replication (GO:0039689)|neurological system process (GO:0050877)|piecemeal microautophagy of nucleus (GO:0034727)|positive regulation of apoptotic process (GO:0043065)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein modification process (GO:0031401)|post-embryonic development (GO:0009791)|protein catabolic process (GO:0030163)|protein lipidation (GO:0006497)|protein modification by small protein conjugation (GO:0032446)|protein transport (GO:0015031)|pyramidal neuron development (GO:0021860)|regulation of protein ubiquitination (GO:0031396)	axoneme (GO:0005930)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|pre-autophagosomal structure (GO:0000407)	Atg12 activating enzyme activity (GO:0019778)|Atg8 activating enzyme (GO:0019779)|protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)|ubiquitin activating enzyme activity (GO:0004839)	p.D699D(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(4)|lung(14)|prostate(1)|skin(2)|urinary_tract(1)	34						ACATGAGCGATGATGAGACCA	0.637													C|||	1275	0.254593	0.3419	0.2277	5008	,	,		17980	0.1389		0.3201	False		,,,				2504	0.2076																1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)						C	,,	1417,2989	685.6+/-404.6	218,981,1004	89.0	79.0	82.0		2016,1857,2097	1.4	0.9	3	dbSNP_100	82	2776,5824	678.6+/-403.5	459,1858,1983	no	coding-synonymous,coding-synonymous,coding-synonymous	ATG7	NM_001136031.2,NM_001144912.1,NM_006395.2	,,	677,2839,2987	CC,CT,TT		32.2791,32.1607,32.239	,,	672/677,619/624,699/704	11596302	4193,8813	2203	4300	6503	SO:0001819	synonymous_variant	10533			AF094516	CCDS2605.1, CCDS46752.1, CCDS46753.1	3p25.3-p25.2	2014-02-18	2012-06-06	2005-09-11	ENSG00000197548	ENSG00000197548		"""Ubiquitin-like modifier activating enzymes"""	16935	protein-coding gene	gene with protein product	"""ubiquitin-activating enzyme E1-like protein"""	608760	"""APG7 autophagy 7-like (S. cerevisiae)"", ""ATG7 autophagy related 7 homolog (S. cerevisiae)"""	APG7L		10233149	Standard	NM_006395		Approved	GSA7, DKFZp434N0735	uc003bwc.3	O95352	OTTHUMG00000129740	ENST00000354449.3:c.2097T>C	3.37:g.11596302T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E170|E9PB95|Q7L8L0|Q9BWP2|Q9UFH4	Silent	SNP	pfam_ThiF_NAD_FAD-bd,superfamily_Molybdenum_cofac_synth_MoeB,tigrfam_E1-like_Apg7	p.D699	ENST00000354449.3	37	c.2097	CCDS2605.1	3																																																																																			ATG7	-	tigrfam_E1-like_Apg7		0.637	ATG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATG7	HGNC	protein_coding	OTTHUMT00000251951.3	T	NM_006395		11596302	+1	no_errors	ENST00000354449	ensembl	human	known	70_37	silent	SNP	1.000	C
ATP13A2	23400	genome.wustl.edu	37	1	17312811	17312811	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:17312811G>A	ENST00000326735.8	-	29	3481	c.3448C>T	c.(3448-3450)Cgg>Tgg	p.R1150W	ATP13A2_ENST00000341676.5_Missense_Mutation_p.P1049L|ATP13A2_ENST00000452699.1_Missense_Mutation_p.R1145W|RP1-37C10.3_ENST00000446261.1_RNA			Q9NQ11	AT132_HUMAN	ATPase type 13A2	1150					cell death (GO:0008219)|cellular response to manganese ion (GO:0071287)	integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(11)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	32		Colorectal(325;0.000147)|Breast(348;0.00104)|Renal(390;0.00145)|Lung NSC(340;0.00566)|all_lung(284;0.00797)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0646)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00462)|COAD - Colon adenocarcinoma(227;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;1.99e-05)|Kidney(64;0.000171)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00645)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.182)		CGCTTGGGCCGGAGGCGGCGC	0.716																																																	0													7.0	10.0	9.0					1																	17312811		2121	4195	6316	SO:0001583	missense	23400			AL354615	CCDS175.1, CCDS44072.1, CCDS44073.1	1p36	2014-09-17			ENSG00000159363	ENSG00000159363		"""ATPases / P-type"", ""Parkinson disease"""	30213	protein-coding gene	gene with protein product		610513	"""Parkinson disease (autosomal recessive) 9 (Kufor-Rakeb syndrome)"""	PARK9		15381061, 16964263	Standard	XM_005245809		Approved	HSA9947, CLN12	uc001baa.2	Q9NQ11	OTTHUMG00000002293	ENST00000326735.8:c.3448C>T	1.37:g.17312811G>A	ENSP00000327214:p.Arg1150Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	O75700|Q5JXY1|Q5JXY2|Q6S9Z9	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_Dehalogen-like_hydro,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_unknown-pump-sp,tigrfam_ATPase_P-typ_ion-transptr	p.R1150W	ENST00000326735.8	37	c.3448	CCDS175.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.09|15.09	2.729150|2.729150	0.48833|0.48833	.|.	.|.	ENSG00000159363|ENSG00000159363	ENST00000341676;ENST00000502418|ENST00000326735;ENST00000452699	D;D|T;T	0.97209|0.41758	-3.28;-4.29|0.99;0.99	4.61|4.61	2.52|2.52	0.30459|0.30459	.|.	.|0.383885	.|0.21743	.|N	.|0.069797	T|T	0.42040|0.42040	0.1185|0.1185	L|L	0.29908|0.29908	0.895|0.895	0.36256|0.36256	D|D	0.854257|0.854257	B|D;D	0.10296|0.76494	0.003|0.999;0.998	B|P;P	0.06405|0.58970	0.002|0.849;0.696	T|T	0.46456|0.46456	-0.9190|-0.9190	9|10	0.09084|0.38643	T|T	0.74|0.18	-31.8286|-31.8286	8.3183|8.3183	0.32113|0.32113	0.0972:0.0:0.7417:0.1611|0.0972:0.0:0.7417:0.1611	.|.	1049|1145;1150	Q5JXY1|Q6S9Z9;Q9NQ11	.|.;AT132_HUMAN	L|W	1049;289|1150;1145	ENSP00000341115:P1049L;ENSP00000423065:P289L|ENSP00000327214:R1150W;ENSP00000413307:R1145W	ENSP00000341115:P1049L|ENSP00000327214:R1150W	P|R	-|-	2|1	0|2	ATP13A2|ATP13A2	17185398|17185398	0.967000|0.967000	0.33354|0.33354	0.986000|0.986000	0.45419|0.45419	0.849000|0.849000	0.48306|0.48306	1.873000|1.873000	0.39558|0.39558	1.113000|1.113000	0.41760|0.41760	0.591000|0.591000	0.81541|0.81541	CCG|CGG	ATP13A2	-	NULL		0.716	ATP13A2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATP13A2	HGNC	protein_coding	OTTHUMT00000006617.1	G	NM_022089		17312811	-1	no_errors	ENST00000326735	ensembl	human	known	70_37	missense	SNP	0.924	A
ATXN1L	342371	genome.wustl.edu	37	16	71885490	71885490	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:71885490G>A	ENST00000427980.2	+	3	2140	c.1847G>A	c.(1846-1848)aGa>aAa	p.R616K	ATXN1L_ENST00000569119.1_Intron	NM_001137675.3	NP_001131147.1	P0C7T5	ATX1L_HUMAN	ataxin 1-like	616					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)	4						TTGGGATCCAGAGAGCTATGT	0.627																																																	0													25.0	30.0	29.0					16																	71885490		692	1591	2283	SO:0001583	missense	342371				CCDS45523.1	16q22.2	2014-09-04			ENSG00000224470	ENSG00000224470			33279	protein-coding gene	gene with protein product	"""brother of ataxin 1"""	614301				16121196, 17322884, 21475249	Standard	NM_001137675		Approved	BOAT1	uc002fbd.3	P0C7T5	OTTHUMG00000176872	ENST00000427980.2:c.1847G>A	16.37:g.71885490G>A	ENSP00000415822:p.Arg616Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ataxin-1_HBP1,superfamily_Ataxin-1_HBP1,smart_Ataxin_AXH_dom,pfscan_Ataxin-1_HBP1	p.R616K	ENST00000427980.2	37	c.1847	CCDS45523.1	16	.	.	.	.	.	.	.	.	.	.	G	18.74	3.688060	0.68271	.	.	ENSG00000224470	ENST00000427980	T	0.29655	1.56	5.61	5.61	0.85477	.	.	.	.	.	T	0.31544	0.0800	N	0.22421	0.69	0.34959	D	0.752015	P	0.51791	0.948	P	0.46975	0.533	T	0.31779	-0.9931	9	0.54805	T	0.06	-1.3225	20.0114	0.97452	0.0:0.0:1.0:0.0	.	616	P0C7T5	ATX1L_HUMAN	K	616	ENSP00000415822:R616K	ENSP00000415822:R616K	R	+	2	0	ATXN1L	70442991	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.227000	0.58612	2.821000	0.97095	0.555000	0.69702	AGA	ATXN1L	-	NULL		0.627	ATXN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATXN1L	HGNC	protein_coding	OTTHUMT00000434171.1	G	NM_001137675.2		71885490	+1	no_errors	ENST00000427980	ensembl	human	known	70_37	missense	SNP	1.000	A
ATXN3	4287	genome.wustl.edu	37	14	92555077	92555077	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:92555077C>T	ENST00000532032.1	-	6	481	c.472G>A	c.(472-474)Gaa>Aaa	p.E158K	ATXN3_ENST00000429774.2_Missense_Mutation_p.E143K|ATXN3_ENST00000554491.1_5'UTR|ATXN3_ENST00000393287.5_Missense_Mutation_p.E158K|ATXN3_ENST00000340660.6_Missense_Mutation_p.E103K|ATXN3_ENST00000502250.1_5'UTR|ATXN3_ENST00000503767.1_Missense_Mutation_p.E143K|ATXN3_ENST00000545170.1_Missense_Mutation_p.E158K			P54252	ATX3_HUMAN	ataxin 3	158	Josephin. {ECO:0000255|PROSITE- ProRule:PRU00331}.				actin cytoskeleton organization (GO:0030036)|cell death (GO:0008219)|cellular response to misfolded protein (GO:0071218)|intermediate filament cytoskeleton organization (GO:0045104)|microtubule cytoskeleton organization (GO:0000226)|misfolded or incompletely synthesized protein catabolic process (GO:0006515)|monoubiquitinated protein deubiquitination (GO:0035520)|nervous system development (GO:0007399)|nucleotide-excision repair (GO:0006289)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of cell-substrate adhesion (GO:0010810)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATPase binding (GO:0051117)|identical protein binding (GO:0042802)|Lys48-specific deubiquitinase activity (GO:1990380)|Lys63-specific deubiquitinase activity (GO:0061578)|omega peptidase activity (GO:0008242)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(1)|lung(7)|prostate(1)|stomach(1)	12		all_cancers(154;0.0768)		COAD - Colon adenocarcinoma(157;0.224)		TACTTACCTTCCTGTTGTAAT	0.358																																					Esophageal Squamous(190;752 2094 29897 44875 49530)												0													200.0	216.0	211.0					14																	92555077		2203	4300	6503	SO:0001583	missense	4287			U64820	CCDS9900.1, CCDS32143.1, CCDS45154.1, CCDS53908.1, CCDS73680.1	14q21	2014-09-17	2004-08-12	2004-08-13	ENSG00000066427	ENSG00000066427		"""Ataxins"""	7106	protein-coding gene	gene with protein product		607047	"""Machado-Joseph disease (spinocerebellar ataxia 3, olivopontocerebellar ataxia 3, autosomal dominant, ataxin 3)"""	SCA3, MJD		8358439	Standard	NM_004993		Approved	ATX3, JOS	uc001yac.4	P54252	OTTHUMG00000162212	ENST00000532032.1:c.472G>A	14.37:g.92555077C>T	ENSP00000437157:p.Glu158Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7LFZ5|D6RDL9|E9PB63|O15284|O15285|O15286|Q8N189|Q96TC3|Q96TC4|Q9H3N0	Missense_Mutation	SNP	pfam_Josephin,pfam_Ubiquitin-int_motif,smart_Ubiquitin-int_motif,pfscan_Josephin,pfscan_Ubiquitin-int_motif,prints_Josephin	p.E158K	ENST00000532032.1	37	c.472		14	.	.	.	.	.	.	.	.	.	.	C	35	5.450765	0.96205	.	.	ENSG00000066427	ENST00000545278;ENST00000539555;ENST00000537884;ENST00000545170;ENST00000447800;ENST00000359819;ENST00000393289;ENST00000429774;ENST00000539454;ENST00000393287;ENST00000503767;ENST00000340660;ENST00000532032;ENST00000555381;ENST00000554592;ENST00000554672;ENST00000553491;ENST00000556220;ENST00000506466	T;T;T;T;T;T;T;T;T;T;T;T	0.46451	0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87;0.87	5.51	5.51	0.81932	.	0.047963	0.85682	D	0.000000	T	0.60011	0.2236	L	0.56280	1.765	0.80722	D	1	P;P;P;P;P	0.41313	0.584;0.745;0.528;0.701;0.458	P;P;P;P;P	0.58172	0.834;0.75;0.745;0.745;0.519	T	0.55848	-0.8076	10	0.48119	T	0.1	.	19.0675	0.93117	0.0:1.0:0.0:0.0	.	158;143;158;103;158	P54252;E9PB63;F5H096;P54252-3;P54252-2	ATX3_HUMAN;.;.;.;.	K	158;158;158;158;158;158;158;143;157;158;143;103;158;88;157;60;107;52;92	ENSP00000445618:E158K;ENSP00000389376:E143K;ENSP00000376965:E158K;ENSP00000426697:E143K;ENSP00000339110:E103K;ENSP00000437157:E158K;ENSP00000451001:E88K;ENSP00000451385:E157K;ENSP00000451417:E60K;ENSP00000451996:E107K;ENSP00000450641:E52K;ENSP00000435571:E92K	ENSP00000339110:E103K	E	-	1	0	ATXN3	91624830	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.494000	0.81503	2.620000	0.88729	0.555000	0.69702	GAA	ATXN3	-	pfam_Josephin,pfscan_Josephin,prints_Josephin		0.358	ATXN3-015	KNOWN	basic	protein_coding	ATXN3	HGNC	protein_coding	OTTHUMT00000388065.1	C	NM_004993		92555077	-1	no_errors	ENST00000545170	ensembl	human	known	70_37	missense	SNP	1.000	T
B4GALNT4	338707	genome.wustl.edu	37	11	373249	373249	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:373249C>T	ENST00000329962.6	+	6	594	c.594C>T	c.(592-594)gaC>gaT	p.D198D		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	198					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		TGAGTCTGGACGAGAGCCCTG	0.637																																																	0													60.0	59.0	59.0					11																	373249		2200	4291	6491	SO:0001819	synonymous_variant	338707			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.594C>T	11.37:g.373249C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LV2	Silent	SNP	pfam_Chond_GalNAc,pfam_PA14,smart_PA14	p.D198	ENST00000329962.6	37	c.594	CCDS7694.1	11																																																																																			B4GALNT4	-	pfam_PA14,smart_PA14		0.637	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT4	HGNC	protein_coding	OTTHUMT00000239289.2	C	NM_178537		373249	+1	no_errors	ENST00000329962	ensembl	human	known	70_37	silent	SNP	0.410	T
B4GALNT4	338707	genome.wustl.edu	37	11	376300	376300	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:376300G>A	ENST00000329962.6	+	13	1246	c.1246G>A	c.(1246-1248)Gat>Aat	p.D416N		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	416					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGGGGATGAGGATGAAGAAGA	0.662																																																	0													73.0	74.0	74.0					11																	376300		2197	4298	6495	SO:0001583	missense	338707			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.1246G>A	11.37:g.376300G>A	ENSP00000328277:p.Asp416Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LV2	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_PA14,smart_PA14	p.D416N	ENST00000329962.6	37	c.1246	CCDS7694.1	11	.	.	.	.	.	.	.	.	.	.	g	10.89	1.478361	0.26511	.	.	ENSG00000182272	ENST00000329962	T	0.04917	3.53	2.7	2.7	0.31948	.	0.733168	0.11737	N	0.534368	T	0.06962	0.0177	L	0.44542	1.39	0.39056	D	0.960429	P	0.34522	0.455	B	0.34301	0.179	T	0.41052	-0.9530	10	0.17832	T	0.49	-5.0047	12.6865	0.56949	0.0:0.0:1.0:0.0	.	416	Q76KP1	B4GN4_HUMAN	N	416	ENSP00000328277:D416N	ENSP00000328277:D416N	D	+	1	0	B4GALNT4	366300	0.225000	0.23685	0.010000	0.14722	0.058000	0.15608	2.107000	0.41844	1.808000	0.52836	0.430000	0.28490	GAT	B4GALNT4	-	NULL		0.662	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT4	HGNC	protein_coding	OTTHUMT00000239289.2	G	NM_178537		376300	+1	no_errors	ENST00000329962	ensembl	human	known	70_37	missense	SNP	0.989	A
B4GALNT4	338707	genome.wustl.edu	37	11	376309	376309	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:376309G>A	ENST00000329962.6	+	13	1255	c.1255G>A	c.(1255-1257)Gac>Aac	p.D419N		NM_178537.4	NP_848632.2	Q76KP1	B4GN4_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 4	419					metabolic process (GO:0008152)	Golgi cisterna membrane (GO:0032580)|integral component of membrane (GO:0016021)	acetylgalactosaminyltransferase activity (GO:0008376)|N-acetyl-beta-glucosaminyl-glycoprotein 4-beta-N-acetylgalactosaminyltransferase activity (GO:0033842)			endometrium(2)|kidney(4)|large_intestine(1)|liver(2)|lung(7)|ovary(2)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	24		all_cancers(49;1.59e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;1.56e-27)|Epithelial(43;9.31e-27)|OV - Ovarian serous cystadenocarcinoma(40;1.11e-20)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0182)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GGATGAAGAAGACGAGGTGCA	0.652																																																	0													73.0	73.0	73.0					11																	376309		2198	4298	6496	SO:0001583	missense	338707			AB089939	CCDS7694.1	11p15.5	2013-02-19			ENSG00000182272	ENSG00000182272	2.4.1.-	"""Beta 4-glycosyltransferases"""	26315	protein-coding gene	gene with protein product						15044014	Standard	NM_178537		Approved	FLJ25045, NGalNAc-T1	uc001lpb.3	Q76KP1	OTTHUMG00000119075	ENST00000329962.6:c.1255G>A	11.37:g.376309G>A	ENSP00000328277:p.Asp419Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LV2	Missense_Mutation	SNP	pfam_Chond_GalNAc,pfam_PA14,smart_PA14	p.D419N	ENST00000329962.6	37	c.1255	CCDS7694.1	11	.	.	.	.	.	.	.	.	.	.	g	8.085	0.773317	0.16051	.	.	ENSG00000182272	ENST00000329962	T	0.05025	3.51	2.4	2.4	0.29515	.	1.230140	0.05900	N	0.629812	T	0.04407	0.0121	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.12156	0.007	T	0.30822	-0.9965	10	0.19590	T	0.45	-6.0865	12.049	0.53495	0.0:0.0:1.0:0.0	.	419	Q76KP1	B4GN4_HUMAN	N	419	ENSP00000328277:D419N	ENSP00000328277:D419N	D	+	1	0	B4GALNT4	366309	0.492000	0.26027	0.020000	0.16555	0.160000	0.22226	2.697000	0.47060	1.651000	0.50673	0.430000	0.28490	GAC	B4GALNT4	-	NULL		0.652	B4GALNT4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT4	HGNC	protein_coding	OTTHUMT00000239289.2	G	NM_178537		376309	+1	no_errors	ENST00000329962	ensembl	human	known	70_37	missense	SNP	0.427	A
B4GALT1	2683	genome.wustl.edu	37	9	33135202	33135202	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:33135202G>A	ENST00000379731.4	-	2	819	c.633C>T	c.(631-633)atC>atT	p.I211I	B4GALT1_ENST00000535206.1_Silent_p.I211I	NM_001497.3	NP_001488.2	P15291	B4GT1_HUMAN	UDP-Gal:betaGlcNAc beta 1,4- galactosyltransferase, polypeptide 1	211					acute inflammatory response (GO:0002526)|angiogenesis involved in wound healing (GO:0060055)|binding of sperm to zona pellucida (GO:0007339)|branching morphogenesis of an epithelial tube (GO:0048754)|carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|development of secondary sexual characteristics (GO:0045136)|epithelial cell development (GO:0002064)|extracellular matrix organization (GO:0030198)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|lactose biosynthetic process (GO:0005989)|leukocyte migration (GO:0050900)|mammary gland development (GO:0030879)|multicellular organism reproduction (GO:0032504)|negative regulation of cell proliferation (GO:0008285)|Notch signaling pathway (GO:0007219)|oligosaccharide biosynthetic process (GO:0009312)|penetration of zona pellucida (GO:0007341)|positive regulation of apoptotic process involved in mammary gland involution (GO:0060058)|positive regulation of epithelial cell proliferation involved in wound healing (GO:0060054)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)|regulation of acrosome reaction (GO:0060046)|regulation of cellular component movement (GO:0051270)|single fertilization (GO:0007338)|small molecule metabolic process (GO:0044281)	basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|desmosome (GO:0030057)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|glycocalyx (GO:0030112)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi trans cisterna (GO:0000138)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	alpha-tubulin binding (GO:0043014)|beta-N-acetylglucosaminylglycopeptide beta-1,4-galactosyltransferase activity (GO:0003831)|beta-tubulin binding (GO:0048487)|galactosyltransferase activity (GO:0008378)|lactose synthase activity (GO:0004461)|manganese ion binding (GO:0030145)|N-acetyllactosamine synthase activity (GO:0003945)|protein homodimerization activity (GO:0042803)|UDP-galactosyltransferase activity (GO:0035250)			endometrium(1)|large_intestine(7)|lung(4)|prostate(1)|skin(1)	14			LUSC - Lung squamous cell carcinoma(29;0.0084)	GBM - Glioblastoma multiforme(74;0.121)	N-Acetyl-D-glucosamine(DB00141)	TGATAACATAGATGCCATAGT	0.527																																																	0													62.0	58.0	59.0					9																	33135202		2203	4300	6503	SO:0001819	synonymous_variant	2683			X14085	CCDS6535.1	9p13	2013-02-19			ENSG00000086062	ENSG00000086062	2.4.1.22	"""Beta 4-glycosyltransferases"""	924	protein-coding gene	gene with protein product		137060		GGTB2		9597550	Standard	NM_001497		Approved	beta4Gal-T1	uc003zsg.2	P15291	OTTHUMG00000019764	ENST00000379731.4:c.633C>T	9.37:g.33135202G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R710|D3DRL2|Q12909|Q12910|Q12911|Q14456|Q14509|Q14523	Silent	SNP	pfam_Galactosyl_T_2_met,prints_Galactosyl_T_2_met	p.I211	ENST00000379731.4	37	c.633	CCDS6535.1	9																																																																																			B4GALT1	-	pfam_Galactosyl_T_2_met		0.527	B4GALT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALT1	HGNC	protein_coding	OTTHUMT00000052039.1	G	NM_001497		33135202	-1	no_errors	ENST00000379731	ensembl	human	known	70_37	silent	SNP	1.000	A
BFSP1	631	genome.wustl.edu	37	20	17474751	17474751	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:17474751C>G	ENST00000377873.3	-	8	2005	c.1966G>C	c.(1966-1968)Gac>Cac	p.D656H	BFSP1_ENST00000544874.1_Missense_Mutation_p.D517H|BFSP1_ENST00000536626.1_Missense_Mutation_p.D517H|BFSP1_ENST00000377868.2_Missense_Mutation_p.D531H	NM_001195.3	NP_001186.1	Q12934	BFSP1_HUMAN	beaded filament structural protein 1, filensin	656	Tail.		D -> E (in dbSNP:rs16999317).		cell maturation (GO:0048469)|lens fiber cell development (GO:0070307)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|intermediate filament (GO:0005882)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	structural constituent of cytoskeleton (GO:0005200)|structural constituent of eye lens (GO:0005212)			central_nervous_system(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)|stomach(1)	18						TTCTTCTTGTCTGACTTTGTC	0.428																																																	0													115.0	119.0	118.0					20																	17474751		2203	4300	6503	SO:0001583	missense	631			Y16717	CCDS13126.1, CCDS54448.1, CCDS63229.1	20p12.1	2014-06-05			ENSG00000125864	ENSG00000125864		"""Intermediate filaments type VI, eye lens intermediate filaments"""	1040	protein-coding gene	gene with protein product		603307				9787085	Standard	NM_001161705		Approved	CP94, CP115, LIFL-H, filensin	uc002wpo.3	Q12934	OTTHUMG00000031940	ENST00000377873.3:c.1966G>C	20.37:g.17474751C>G	ENSP00000367104:p.Asp656His	Somatic		WXS	Illumina HiSeq	Phase_IV	F5H0G1|O43595|O76034|O95676|Q8IVZ6|Q9HBX4	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin	p.D656H	ENST00000377873.3	37	c.1966	CCDS13126.1	20	.	.	.	.	.	.	.	.	.	.	C	9.975	1.226560	0.22542	.	.	ENSG00000125864	ENST00000377873;ENST00000377868;ENST00000536626;ENST00000544874	T;T;T;T	0.49720	0.77;0.77;0.77;0.77	3.66	2.56	0.30785	.	0.218162	0.46442	D	0.000299	T	0.22975	0.0555	N	0.08118	0	0.26197	N	0.979509	P;P	0.43094	0.799;0.697	B;B	0.39258	0.295;0.154	T	0.08371	-1.0725	10	0.52906	T	0.07	-20.1887	5.2188	0.15358	0.0:0.1379:0.0:0.8621	.	531;656	Q12934-2;Q12934	.;BFSP1_HUMAN	H	656;531;517;517	ENSP00000367104:D656H;ENSP00000367099:D531H;ENSP00000442522:D517H;ENSP00000439870:D517H	ENSP00000367099:D531H	D	-	1	0	BFSP1	17422751	0.990000	0.36364	0.917000	0.36280	0.561000	0.35649	1.999000	0.40806	0.767000	0.33267	-0.302000	0.09304	GAC	BFSP1	-	NULL		0.428	BFSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BFSP1	HGNC	protein_coding	OTTHUMT00000078119.6	C	NM_001195		17474751	-1	no_errors	ENST00000377873	ensembl	human	known	70_37	missense	SNP	0.995	G
BIN2	51411	genome.wustl.edu	37	12	51690891	51690891	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:51690891G>C	ENST00000267012.4	-	8	721	c.660C>G	c.(658-660)ttC>ttG	p.F220L	BIN2_ENST00000544402.1_Missense_Mutation_p.F194L|BIN2_ENST00000452142.2_Missense_Mutation_p.F188L|BIN2_ENST00000604560.1_Missense_Mutation_p.F193L	NM_016293.2	NP_057377.2	Q9UBW5	BIN2_HUMAN	bridging integrator 2	220	BAR. {ECO:0000255|PROSITE- ProRule:PRU00361}.				cell chemotaxis (GO:0060326)|membrane tubulation (GO:0097320)|phagocytosis, engulfment (GO:0006911)|podosome assembly (GO:0071800)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|plasma membrane (GO:0005886)|podosome (GO:0002102)	phospholipid binding (GO:0005543)			NS(2)|breast(1)|endometrium(1)|kidney(4)|large_intestine(4)|lung(12)|ovary(1)|prostate(3)|skin(3)	31						TTTCCCTGTAGAAGACATCCC	0.423																																																	0													119.0	102.0	108.0					12																	51690891		2203	4300	6503	SO:0001583	missense	51411			AF146531	CCDS8811.1	12q13.13	2012-01-23			ENSG00000110934	ENSG00000110934			1053	protein-coding gene	gene with protein product		605936				10903846	Standard	XM_005268957		Approved	BRAP-1	uc001ryg.3	Q9UBW5		ENST00000267012.4:c.660C>G	12.37:g.51690891G>C	ENSP00000267012:p.Phe220Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VV0|Q9NWK4|Q9UKN4	Missense_Mutation	SNP	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom,prints_Amphiphysin	p.F220L	ENST00000267012.4	37	c.660	CCDS8811.1	12	.	.	.	.	.	.	.	.	.	.	G	21.6	4.171047	0.78452	.	.	ENSG00000110934	ENST00000452142;ENST00000267012;ENST00000544402	T;T;T	0.68765	-0.35;-0.35;-0.35	4.78	4.78	0.61160	BAR (3);	0.000000	0.85682	D	0.000000	D	0.83459	0.5259	M	0.85462	2.755	0.45791	D	0.998676	D;D;D	0.89917	1.0;0.999;1.0	D;D;D	0.91635	0.999;0.996;0.999	D	0.85462	0.1167	10	0.56958	D	0.05	-8.7803	17.1221	0.86705	0.0:0.0:1.0:0.0	.	194;188;220	F5H0W4;Q9UBW5-2;Q9UBW5	.;.;BIN2_HUMAN	L	188;220;194	ENSP00000410217:F188L;ENSP00000267012:F220L;ENSP00000445874:F194L	ENSP00000267012:F220L	F	-	3	2	BIN2	49977158	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	4.046000	0.57376	2.650000	0.89964	0.557000	0.71058	TTC	BIN2	-	pfam_BAR_dom,smart_BAR_dom,pfscan_BAR_dom		0.423	BIN2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BIN2	HGNC	protein_coding	OTTHUMT00000469800.1	G			51690891	-1	no_errors	ENST00000267012	ensembl	human	known	70_37	missense	SNP	1.000	C
BNC2	54796	genome.wustl.edu	37	9	16727949	16727952	+	Frame_Shift_Del	DEL	TCTC	TCTC	-			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	TCTC	TCTC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:16727949_16727952delTCTC	ENST00000380672.4	-	3	230_233	c.173_176delGAGA	c.(172-177)agagacfs	p.RD58fs	BNC2_ENST00000380667.2_Intron|BNC2_ENST00000545497.1_Intron|RP11-62F24.2_ENST00000450445.1_RNA|BNC2_ENST00000380666.2_Frame_Shift_Del_p.RD58fs	NM_017637.5	NP_060107.3			basonuclin 2											NS(2)|breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(16)|liver(1)|lung(22)|ovary(2)|prostate(1)|skin(1)|urinary_tract(2)	60				GBM - Glioblastoma multiforme(50;9.01e-08)		tggctctctgtctctctgtgtctc	0.49																																																	0																																										SO:0001589	frameshift_variant	54796			AK092247	CCDS6482.2	9p22.2	2013-05-20			ENSG00000173068	ENSG00000173068		"""Zinc fingers, C2H2-type"""	30988	protein-coding gene	gene with protein product		608669				14702039	Standard	XM_006716784		Approved	BSN2, FLJ20043	uc003zml.3	Q6ZN30	OTTHUMG00000019593	ENST00000380672.4:c.173_176delGAGA	9.37:g.16727949_16727952delTCTC	ENSP00000370047:p.Arg58fs	Somatic		WXS	Illumina HiSeq	Phase_IV		Frame_Shift_Del	DEL	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R58fs	ENST00000380672.4	37	c.176_173	CCDS6482.2	9																																																																																			BNC2	-	NULL		0.490	BNC2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BNC2	HGNC	protein_coding	OTTHUMT00000216901.5	TCTC	NM_017637		16727952	-1	no_errors	ENST00000380672	ensembl	human	known	70_37	frame_shift_del	DEL	1.000:1.000:1.000:1.000	-
BRAT1	221927	genome.wustl.edu	37	7	2583486	2583486	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:2583486C>T	ENST00000340611.4	-	5	797	c.541G>A	c.(541-543)Gag>Aag	p.E181K	BRAT1_ENST00000473879.1_5'Flank	NM_152743.3	NP_689956.2	Q6PJG6	BRAT1_HUMAN	BRCA1-associated ATM activator 1	181					response to ionizing radiation (GO:0010212)	membrane (GO:0016020)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|pancreas(1)|skin(2)|urinary_tract(1)	23						GGCTGCCCCTCGGCTCCACCT	0.657																																																	0													39.0	46.0	44.0					7																	2583486		2203	4300	6503	SO:0001583	missense	221927			BC015632	CCDS5334.1	7p22.3	2011-03-22	2011-02-28	2011-03-22	ENSG00000106009	ENSG00000106009			21701	protein-coding gene	gene with protein product	"""BRCA1-associated protein required for ATM activation protein 1"""	614506	"""chromosome 7 open reading frame 27"""	C7orf27, BAAT1		16452482	Standard	NM_152743		Approved	MGC22916	uc003smi.3	Q6PJG6	OTTHUMG00000119091	ENST00000340611.4:c.541G>A	7.37:g.2583486C>T	ENSP00000339637:p.Glu181Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D200|C9JY24|Q8IW85|Q8IZ43|Q8WVR8|Q96IV9|Q9H7J8|Q9UFA3	Missense_Mutation	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.E181K	ENST00000340611.4	37	c.541	CCDS5334.1	7	.	.	.	.	.	.	.	.	.	.	C	4.919	0.170687	0.09391	.	.	ENSG00000106009	ENST00000340611	D	0.90676	-2.71	5.71	-2.71	0.05986	Armadillo-type fold (1);	3.044690	0.00807	N	0.001462	D	0.83403	0.5247	L	0.47716	1.5	0.09310	N	1	B;B	0.21688	0.003;0.059	B;B	0.06405	0.001;0.002	T	0.67492	-0.5657	10	0.08381	T	0.77	-1.2507	3.4159	0.07376	0.0967:0.151:0.3829:0.3695	.	181;181	Q6PJG6-2;Q6PJG6	.;BRAT1_HUMAN	K	181	ENSP00000339637:E181K	ENSP00000339637:E181K	E	-	1	0	BRAT1	2550012	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	-2.120000	0.01323	-0.503000	0.06586	-0.126000	0.14955	GAG	BRAT1	-	superfamily_ARM-type_fold		0.657	BRAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRAT1	HGNC	protein_coding	OTTHUMT00000239305.2	C	NM_152743		2583486	-1	no_errors	ENST00000340611	ensembl	human	known	70_37	missense	SNP	0.000	T
BSN	8927	genome.wustl.edu	37	3	49698953	49698953	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:49698953G>A	ENST00000296452.4	+	6	9789	c.9675G>A	c.(9673-9675)caG>caA	p.Q3225Q		NM_003458.3	NP_003449.2	Q9UPA5	BSN_HUMAN	bassoon presynaptic cytomatrix protein	3225					synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|dendrite (GO:0030425)|neuron projection terminus (GO:0044306)|nucleus (GO:0005634)|presynaptic cytoskeletal matrix assembled at active zones (GO:0048788)	metal ion binding (GO:0046872)			breast(8)|central_nervous_system(2)|cervix(2)|endometrium(16)|kidney(3)|large_intestine(17)|lung(37)|ovary(7)|pancreas(1)|prostate(4)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(1)	106				BRCA - Breast invasive adenocarcinoma(193;6.66e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.0032)|Kidney(197;0.00336)		GTCTGGAGCAGAACGTTCCTC	0.592																																																	0													108.0	105.0	106.0					3																	49698953		2203	4300	6503	SO:0001819	synonymous_variant	8927			AF052224	CCDS2800.1	3p21	2013-01-07	2013-01-07		ENSG00000164061	ENSG00000164061			1117	protein-coding gene	gene with protein product	"""zinc finger protein 231"", ""neuronal double zinc finger protein"""	604020	"""bassoon (presynaptic cytomatrix protein)"""	ZNF231		9806829, 10329005	Standard	NM_003458		Approved		uc003cxe.4	Q9UPA5	OTTHUMG00000133750	ENST00000296452.4:c.9675G>A	3.37:g.49698953G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O43161|Q7LGH3	Silent	SNP	pfam_Znf_piccolo,superfamily_Znf_FYVE_PHD	p.Q3225	ENST00000296452.4	37	c.9675	CCDS2800.1	3																																																																																			BSN	-	NULL		0.592	BSN-001	KNOWN	NMD_exception|basic|appris_principal|exp_conf|CCDS	protein_coding	BSN	HGNC	protein_coding	OTTHUMT00000258164.1	G	NM_003458		49698953	+1	no_errors	ENST00000296452	ensembl	human	known	70_37	silent	SNP	1.000	A
CCDC186	55088	genome.wustl.edu	37	10	115922445	115922445	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:115922445C>G	ENST00000369287.3	-	2	849	c.583G>C	c.(583-585)Gaa>Caa	p.E195Q	C10orf118_ENST00000369285.3_Missense_Mutation_p.E195Q|C10orf118_ENST00000369286.1_Missense_Mutation_p.E195Q	NM_018017.2	NP_060487.2	Q7Z3E2	CC186_HUMAN		195										NS(1)|autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(5)|lung(9)|ovary(2)	24		Colorectal(252;0.172)|Breast(234;0.188)		Epithelial(162;0.0161)|all cancers(201;0.0397)		ACACACTTTTCAAACAGAACT	0.348																																																	0													61.0	57.0	58.0					10																	115922445		2202	4300	6502	SO:0001583	missense	55088																														ENST00000369287.3:c.583G>C	10.37:g.115922445C>G	ENSP00000358293:p.Glu195Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M2V6|Q3ZB81|Q6NS91|Q7RTP1|Q8N117|Q8N3G3|Q8N6C2|Q9NWA3	Missense_Mutation	SNP	superfamily_Prefoldin	p.E195Q	ENST00000369287.3	37	c.583	CCDS7587.1	10	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756890	0.89843	.	.	ENSG00000165813	ENST00000369287;ENST00000430353;ENST00000369286;ENST00000369285	T;T;T	0.34859	1.34;1.34;1.34	5.48	5.48	0.80851	.	0.157290	0.56097	D	0.000031	T	0.49609	0.1567	L	0.59436	1.845	0.80722	D	1	D	0.61080	0.989	P	0.52957	0.714	T	0.51568	-0.8689	10	0.72032	D	0.01	.	17.5741	0.87943	0.0:1.0:0.0:0.0	.	195	Q7Z3E2	CJ118_HUMAN	Q	195;301;195;195	ENSP00000358293:E195Q;ENSP00000358292:E195Q;ENSP00000358291:E195Q	ENSP00000358291:E195Q	E	-	1	0	C10orf118	115912435	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.000000	0.76290	2.579000	0.87056	0.650000	0.86243	GAA	C10orf118	-	NULL		0.348	C10orf118-006	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf118	HGNC	protein_coding	OTTHUMT00000050455.1	C			115922445	-1	no_errors	ENST00000369287	ensembl	human	known	70_37	missense	SNP	1.000	G
LMNTD2	256329	genome.wustl.edu	37	11	558613	558613	+	Splice_Site	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:558613C>T	ENST00000329451.3	-	3	374		c.e3+1		RP11-496I9.1_ENST00000527113.1_RNA|RP11-496I9.1_ENST00000527620.1_RNA|RASSF7_ENST00000397583.3_5'Flank|RASSF7_ENST00000454668.2_5'Flank|RASSF7_ENST00000431809.1_5'Flank|RASSF7_ENST00000397582.3_5'Flank|RASSF7_ENST00000344375.4_5'Flank	NM_173573.2	NP_775844.2	Q8IXW0	LMTD2_HUMAN												NS(1)|breast(1)|central_nervous_system(1)|lung(4)|pancreas(1)	8		all_cancers(49;2.16e-06)|all_epithelial(84;0.000256)|Breast(177;0.00122)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		all cancers(45;7.18e-28)|Epithelial(43;6.93e-27)|OV - Ovarian serous cystadenocarcinoma(40;6.97e-21)|BRCA - Breast invasive adenocarcinoma(625;3.56e-05)|Lung(200;0.0375)|LUSC - Lung squamous cell carcinoma(625;0.0703)		GTGCTGCAGACCTCTTGGGCG	0.652																																																	0													16.0	17.0	17.0					11																	558613		2193	4296	6489	SO:0001630	splice_region_variant	256329																														ENST00000329451.3:c.311+1G>A	11.37:g.558613C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	SNP	-	e3+1	ENST00000329451.3	37	c.311+1	CCDS7701.1	11	.	.	.	.	.	.	.	.	.	.	C	11.37	1.617793	0.28801	.	.	ENSG00000185522	ENST00000329451;ENST00000441853;ENST00000486629	.	.	.	3.99	3.07	0.35406	.	.	.	.	.	.	.	.	.	.	.	0.32984	D	0.524045	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.4351	0.27150	0.0:0.8794:0.0:0.1206	.	.	.	.	.	-1	.	.	.	-	.	.	C11orf35	548613	0.998000	0.40836	0.817000	0.32601	0.040000	0.13550	1.686000	0.37669	0.902000	0.36520	0.462000	0.41574	.	C11orf35	-	-		0.652	C11orf35-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C11orf35	HGNC	protein_coding	OTTHUMT00000254973.2	C		Intron	558613	-1	no_errors	ENST00000329451	ensembl	human	known	70_37	splice_site	SNP	0.308	T
C11orf54	28970	genome.wustl.edu	37	11	93487201	93487201	+	Missense_Mutation	SNP	G	G	C	rs552682489	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:93487201G>C	ENST00000331239.4	+	5	507	c.328G>C	c.(328-330)Gag>Cag	p.E110Q	C11orf54_ENST00000354421.3_Missense_Mutation_p.E110Q|C11orf54_ENST00000528099.1_Missense_Mutation_p.E110Q|C11orf54_ENST00000540113.1_Missense_Mutation_p.E91Q|C11orf54_ENST00000528288.1_Missense_Mutation_p.E110Q			Q9H0W9	CK054_HUMAN	chromosome 11 open reading frame 54	110					metabolic process (GO:0008152)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	hydrolase activity, acting on ester bonds (GO:0016788)|zinc ion binding (GO:0008270)			NS(1)|endometrium(1)|large_intestine(1)|lung(5)	8		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				GTTCAATTCTGAGGTCAGCAT	0.358																																																	0													70.0	80.0	76.0					11																	93487201		2199	4297	6496	SO:0001583	missense	28970			AF092133	CCDS8294.1, CCDS66204.1, CCDS73365.1, CCDS73366.1	11q21	2012-08-09			ENSG00000182919	ENSG00000182919			30204	protein-coding gene	gene with protein product		615810				16522806	Standard	NM_014039		Approved	PTD012	uc001pef.3	Q9H0W9	OTTHUMG00000167452	ENST00000331239.4:c.328G>C	11.37:g.93487201G>C	ENSP00000331209:p.Glu110Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K850|Q6FI88|Q6XYB0|Q96EI3|Q96IX1|Q9Y6B4	Missense_Mutation	SNP	pfam_DUF1907	p.E110Q	ENST00000331239.4	37	c.328		11	.	.	.	.	.	.	.	.	.	.	G	18.90	3.722281	0.68959	.	.	ENSG00000182919	ENST00000528288;ENST00000331239;ENST00000528099;ENST00000354421;ENST00000540113;ENST00000530620;ENST00000531650;ENST00000524485;ENST00000527363;ENST00000526335	.	.	.	4.68	3.77	0.43336	Domain of unknown function DUF1907 (1);	0.000000	0.85682	D	0.000000	T	0.80412	0.4618	M	0.87547	2.89	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.997;0.999	D	0.83784	0.0227	9	0.87932	D	0	-19.6741	12.7807	0.57474	0.0792:0.0:0.9208:0.0	.	110;110;110	Q9H0W9;Q9H0W9-3;A8K718	CK054_HUMAN;.;.	Q	110;110;110;110;91;91;110;91;110;110	.	ENSP00000331209:E110Q	E	+	1	0	C11orf54	93126849	1.000000	0.71417	1.000000	0.80357	0.751000	0.42716	8.574000	0.90763	1.205000	0.43262	-0.218000	0.12543	GAG	C11orf54	-	pfam_DUF1907		0.358	C11orf54-002	KNOWN	basic|appris_principal	protein_coding	C11orf54	HGNC	protein_coding	OTTHUMT00000394671.1	G	NM_014039		93487201	+1	no_errors	ENST00000331239	ensembl	human	known	70_37	missense	SNP	1.000	C
CCDC184	387856	genome.wustl.edu	37	12	48578442	48578442	+	Silent	SNP	C	C	T	rs73304926	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:48578442C>T	ENST00000316554.3	+	1	1077	c.537C>T	c.(535-537)gaC>gaT	p.D179D		NM_001013635.3	NP_001013657.3	Q52MB2	CC184_HUMAN		179						cytoplasm (GO:0005737)				central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(1)	4						AGCCCCTCGACATGCCCGACA	0.667													C|||	839	0.167532	0.2519	0.1081	5008	,	,		15948	0.1399		0.16	False		,,,				2504	0.1319																0								C		1027,3335		123,781,1277	10.0	9.0	10.0		537	-4.2	0.4	12	dbSNP_130	10	1163,7373		66,1031,3171	no	coding-synonymous	C12orf68	NM_001013635.3		189,1812,4448	TT,TC,CC		13.6246,23.5442,16.9794		179/195	48578442	2190,10708	2181	4268	6449	SO:0001819	synonymous_variant	387856																														ENST00000316554.3:c.537C>T	12.37:g.48578442C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96MK5|Q96N39	Silent	SNP	NULL	p.D179	ENST00000316554.3	37	c.537	CCDS31785.1	12																																																																																			C12orf68	-	NULL		0.667	C12orf68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf68	HGNC	protein_coding	OTTHUMT00000406514.1	C			48578442	+1	no_errors	ENST00000316554	ensembl	human	known	70_37	silent	SNP	0.794	T
C14orf93	60686	genome.wustl.edu	37	14	23467813	23467813	+	Silent	SNP	G	G	A	rs113664500	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:23467813G>A	ENST00000299088.6	-	2	849	c.420C>T	c.(418-420)gcC>gcT	p.A140A	C14orf93_ENST00000557513.1_5'Flank|C14orf93_ENST00000397379.3_Silent_p.A140A|C14orf93_ENST00000406429.2_Silent_p.A140A|C14orf93_ENST00000341470.4_Silent_p.A140A|RP11-298I3.4_ENST00000555294.1_RNA|C14orf93_ENST00000397382.4_Silent_p.A140A|RP11-298I3.4_ENST00000556503.1_RNA|C14orf93_ENST00000397377.1_5'UTR	NM_001130708.1|NM_021944.2	NP_001124180.1|NP_068763.2	Q9H972	CN093_HUMAN	chromosome 14 open reading frame 93	140						extracellular region (GO:0005576)	poly(A) RNA binding (GO:0044822)			kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	17	all_cancers(95;3.3e-05)			GBM - Glioblastoma multiforme(265;0.0127)		CCTCTTCCACGGCAGACAGAG	0.632																																																	0								G	,,	0,4406		0,0,2203	45.0	46.0	45.0		420,420,420	-7.6	0.0	14	dbSNP_132	45	6,8594	5.0+/-18.6	0,6,4294	no	coding-synonymous,coding-synonymous,coding-synonymous	C14orf93	NM_001130706.1,NM_001130708.1,NM_021944.2	,,	0,6,6497	AA,AG,GG		0.0698,0.0,0.0461	,,	140/539,140/539,140/539	23467813	6,13000	2203	4300	6503	SO:0001819	synonymous_variant	60686			AK023026	CCDS9583.1, CCDS61399.1, CCDS61400.1	14q11.1	2012-09-25			ENSG00000100802	ENSG00000100802			20162	protein-coding gene	gene with protein product							Standard	XM_005267971		Approved	FLJ12154	uc001wih.3	Q9H972	OTTHUMG00000028712	ENST00000299088.6:c.420C>T	14.37:g.23467813G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7WP03|D3DS38|D3DS39|Q86SE6|Q96CF7|Q9HA68	Silent	SNP	NULL	p.A140	ENST00000299088.6	37	c.420	CCDS9583.1	14																																																																																			C14orf93	-	NULL		0.632	C14orf93-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C14orf93	HGNC	protein_coding	OTTHUMT00000071688.5	G	NM_021944		23467813	-1	no_errors	ENST00000299088	ensembl	human	known	70_37	silent	SNP	0.002	A
C14orf132	56967	genome.wustl.edu	37	14	96553071	96553071	+	5'UTR	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:96553071G>A	ENST00000555004.1	+	0	428				C14orf132_ENST00000556728.1_3'UTR	NM_001252507.1	NP_001239436.1	Q9NPU4	CN132_HUMAN	chromosome 14 open reading frame 132							integral component of membrane (GO:0016021)											TTCACCTTCTGAGGACGGCAC	0.577																																																	0																																										SO:0001623	5_prime_UTR_variant	56967			AL390130		14q32.2	2012-04-19			ENSG00000227051	ENSG00000227051			20346	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 88"""	C14orf88			Standard	NM_001252507		Approved		uc001yff.4	Q9NPU4	OTTHUMG00000171393	ENST00000555004.1:c.-3811G>A	14.37:g.96553071G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7K5	RNA	SNP	-	NULL	ENST00000555004.1	37	NULL		14																																																																																			C14orf132	-	-		0.577	C14orf132-001	KNOWN	basic|appris_principal	protein_coding	C14orf132	HGNC	protein_coding	OTTHUMT00000413259.1	G	NM_001252507		96553071	+1	no_errors	ENST00000553764	ensembl	human	putative	70_37	rna	SNP	1.000	A
C16orf62	57020	genome.wustl.edu	37	16	19644446	19644446	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:19644446C>T	ENST00000251143.5	+	19	1599	c.1587C>T	c.(1585-1587)gtC>gtT	p.V529V	C16orf62_ENST00000542263.1_Silent_p.V551V|C16orf62_ENST00000543152.1_Silent_p.V278V|C16orf62_ENST00000438132.3_Silent_p.V618V|C16orf62_ENST00000417362.2_Silent_p.V462V|C16orf62_ENST00000448695.1_Silent_p.V379V			Q7Z3J2	CP062_HUMAN	chromosome 16 open reading frame 62	529						integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(3)|kidney(5)|large_intestine(7)|liver(1)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	36						TGGCAGATGTCATCAAGCACA	0.428																																																	0													247.0	215.0	226.0					16																	19644446		2197	4300	6497	SO:0001819	synonymous_variant	57020				CCDS32397.1, CCDS32397.2, CCDS73840.1	16p12.3	2012-05-30			ENSG00000103544	ENSG00000103544			24641	protein-coding gene	gene with protein product						10493829	Standard	NM_020314		Approved	MGC16824	uc002dgn.3	Q7Z3J2	OTTHUMG00000167925	ENST00000251143.5:c.1587C>T	16.37:g.19644446C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2M1|O43329|Q69YI1|Q6PDA0|Q7L371|Q86W66|Q8WXA5|Q9H0L7|Q9H7C8	Silent	SNP	NULL	p.V618	ENST00000251143.5	37	c.1854		16																																																																																			C16orf62	-	NULL		0.428	C16orf62-201	KNOWN	basic|appris_principal	protein_coding	C16orf62	HGNC	protein_coding		C	NM_020314		19644446	+1	no_errors	ENST00000438132	ensembl	human	known	70_37	silent	SNP	1.000	T
ERICH3	127254	genome.wustl.edu	37	1	75108728	75108728	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:75108728G>A	ENST00000326665.5	-	4	516	c.298C>T	c.(298-300)Cga>Tga	p.R100*		NM_001002912.4	NP_001002912.4	Q5RHP9	ERIC3_HUMAN		100										NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(23)|lung(123)|ovary(3)|prostate(10)|skin(10)|stomach(1)|upper_aerodigestive_tract(5)	184						CTCTGGATTCGCTCCTTCCTA	0.323																																																	0													100.0	90.0	93.0					1																	75108728		2203	4299	6502	SO:0001587	stop_gained	127254																														ENST00000326665.5:c.298C>T	1.37:g.75108728G>A	ENSP00000322609:p.Arg100*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DL8|Q6GMR8|Q6ZSF9|Q8ND41	Nonsense_Mutation	SNP	NULL	p.R100*	ENST00000326665.5	37	c.298	CCDS30755.1	1	.	.	.	.	.	.	.	.	.	.	G	34	5.362314	0.95877	.	.	ENSG00000178965	ENST00000326665	.	.	.	5.4	3.5	0.40072	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-0.6466	13.8601	0.63554	0.0:0.0:0.721:0.279	.	.	.	.	X	100	.	ENSP00000322609:R100X	R	-	1	2	C1orf173	74881316	0.957000	0.32711	0.455000	0.27031	0.394000	0.30568	1.805000	0.38883	0.742000	0.32697	-0.319000	0.08680	CGA	C1orf173	-	NULL		0.323	C1orf173-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf173	HGNC	protein_coding	OTTHUMT00000026516.1	G			75108728	-1	no_errors	ENST00000326665	ensembl	human	known	70_37	nonsense	SNP	0.946	A
C6orf120	387263	genome.wustl.edu	37	6	170102991	170102991	+	Missense_Mutation	SNP	G	G	A	rs144632729	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:170102991G>A	ENST00000332290.2	+	1	735	c.436G>A	c.(436-438)Gag>Aag	p.E146K	WDR27_ENST00000448612.1_5'Flank|WDR27_ENST00000420344.2_5'Flank|WDR27_ENST00000423258.1_5'Flank|C6orf120_ENST00000439249.1_Missense_Mutation_p.E165K|WDR27_ENST00000333572.6_5'Flank	NM_001029863.1	NP_001025034.1	Q7Z4R8	CF120_HUMAN	chromosome 6 open reading frame 120	146					apoptotic process (GO:0006915)	extracellular vesicular exosome (GO:0070062)				endometrium(1)|lung(2)	3		Breast(66;0.000338)		OV - Ovarian serous cystadenocarcinoma(33;9.65e-22)|BRCA - Breast invasive adenocarcinoma(81;1.29e-07)|GBM - Glioblastoma multiforme(31;0.0015)		CCCGTTCGGCGAGGCCGCCTA	0.647																																																	0													17.0	18.0	18.0					6																	170102991		2194	4284	6478	SO:0001583	missense	387263			AF055030	CCDS34575.1	6q27	2012-06-21			ENSG00000185127	ENSG00000185127			21247	protein-coding gene	gene with protein product						8619474, 9110174, 22340178	Standard	NM_001029863		Approved	bA160E12.4	uc003qxb.3	Q7Z4R8	OTTHUMG00000016057	ENST00000332290.2:c.436G>A	6.37:g.170102991G>A	ENSP00000346931:p.Glu146Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DHE9|E1P5C9	Missense_Mutation	SNP	NULL	p.E165K	ENST00000332290.2	37	c.493	CCDS34575.1	6	.	.	.	.	.	.	.	.	.	.	G	16.76	3.213330	0.58452	.	.	ENSG00000185127	ENST00000439249;ENST00000332290	.	.	.	5.34	4.46	0.54185	.	0.132959	0.49916	U	0.000132	T	0.18467	0.0443	L	0.43923	1.385	0.25581	N	0.986796	B;B	0.28880	0.226;0.093	B;B	0.17098	0.017;0.017	T	0.04178	-1.0971	9	0.44086	T	0.13	-18.1969	12.9277	0.58270	0.0783:0.0:0.9217:0.0	.	165;146	B4DJ79;Q7Z4R8	.;CF120_HUMAN	K	165;146	.	ENSP00000346931:E146K	E	+	1	0	C6orf120	169844916	1.000000	0.71417	0.011000	0.14972	0.003000	0.03518	4.862000	0.62976	2.676000	0.91093	0.650000	0.86243	GAG	C6orf120	-	NULL		0.647	C6orf120-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C6orf120	HGNC	protein_coding	OTTHUMT00000043214.1	G	NM_001029863		170102991	+1	no_errors	ENST00000439249	ensembl	human	known	70_37	missense	SNP	0.420	A
C8orf46	254778	genome.wustl.edu	37	8	67428153	67428153	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:67428153G>A	ENST00000305454.3	+	6	907	c.466G>A	c.(466-468)Gaa>Aaa	p.E156K	C8orf46_ENST00000521495.1_Silent_p.*123*|C8orf46_ENST00000522977.1_Silent_p.*135*	NM_152765.3	NP_689978.2	Q8TAG6	CH046_HUMAN	chromosome 8 open reading frame 46	156										endometrium(1)|large_intestine(1)|lung(1)|prostate(1)|skin(2)	6			Epithelial(68;0.0224)|BRCA - Breast invasive adenocarcinoma(89;0.0508)|all cancers(69;0.0558)|OV - Ovarian serous cystadenocarcinoma(28;0.226)			GAAGATGACTGAAGAGTATCC	0.532																																																	0													84.0	78.0	80.0					8																	67428153		2203	4300	6503	SO:0001583	missense	254778			BC028400	CCDS6191.2	8q13.1	2005-08-09			ENSG00000169085	ENSG00000169085			28498	protein-coding gene	gene with protein product						12477932	Standard	NM_152765		Approved	MGC33510	uc003xwg.3	Q8TAG6	OTTHUMG00000156998	ENST00000305454.3:c.466G>A	8.37:g.67428153G>A	ENSP00000302260:p.Glu156Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDC3|B4DFU4|C9J814|C9JCS3	Missense_Mutation	SNP	NULL	p.E156K	ENST00000305454.3	37	c.466	CCDS6191.2	8	.	.	.	.	.	.	.	.	.	.	G	31	5.058609	0.93846	.	.	ENSG00000169085	ENST00000305454	.	.	.	5.13	5.13	0.70059	.	0.103317	0.42420	D	0.000717	T	0.59059	0.2166	L	0.27053	0.805	0.80722	D	1	D	0.56035	0.974	P	0.54499	0.754	T	0.64529	-0.6386	9	0.87932	D	0	-1.0253	16.3656	0.83319	0.0:0.0:1.0:0.0	.	156	Q8TAG6	CH046_HUMAN	K	156	.	ENSP00000302260:E156K	E	+	1	0	C8orf46	67590707	1.000000	0.71417	0.914000	0.36105	0.943000	0.58893	5.833000	0.69349	2.385000	0.81259	0.563000	0.77884	GAA	C8orf46	-	NULL		0.532	C8orf46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C8orf46	HGNC	protein_coding	OTTHUMT00000347010.1	G	NM_152765		67428153	+1	no_errors	ENST00000305454	ensembl	human	known	70_37	missense	SNP	0.988	A
C9orf152	401546	genome.wustl.edu	37	9	112969745	112969745	+	Frame_Shift_Del	DEL	T	T	-	rs201081105	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:112969745delT	ENST00000400613.4	-	1	724	c.115delA	c.(115-117)atcfs	p.I39fs	C9orf152_ENST00000473442.1_5'UTR	NM_001012993.2	NP_001013011.2	Q5JTZ5	CI152_HUMAN	chromosome 9 open reading frame 152	39										NS(1)|endometrium(1)|large_intestine(1)|lung(1)|skin(1)|stomach(1)	6						AGGAACTGGATGCTGAGTGGG	0.622													T|T|-|deletion	48	0.00958466	0.0	0.0086	5008	,	,		16371	0.0		0.0149	False		,,,				2504	0.0276																0										12,4252		0,12,2120	62.0	65.0	64.0			2.1	0.7	9		65	158,8096		2,154,3971	no	frameshift	C9orf152	NM_001012993.2		2,166,6091	A1A1,A1R,RR		1.9142,0.2814,1.358			112969745	170,12348	2203	4298	6501	SO:0001589	frameshift_variant	401546			BX648620	CCDS35102.2	9q31.3	2012-04-03			ENSG00000188959	ENSG00000188959			31455	protein-coding gene	gene with protein product							Standard	NM_001012993		Approved	bA470J20.2	uc011lwk.2	Q5JTZ5	OTTHUMG00000020478	ENST00000400613.4:c.115delA	9.37:g.112969745delT	ENSP00000383456:p.Ile39fs	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWT6	Frame_Shift_Del	DEL	NULL	p.I39fs	ENST00000400613.4	37	c.115	CCDS35102.2	9																																																																																			C9orf152	-	NULL		0.622	C9orf152-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf152	HGNC	protein_coding	OTTHUMT00000053602.2	T	NM_001012993		112969745	-1	no_errors	ENST00000400613	ensembl	human	known	70_37	frame_shift_del	DEL	0.868	-
CCDC180	100499483	genome.wustl.edu	37	9	100070052	100070052	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:100070052G>A	ENST00000357054.1	+	15	1367	c.432G>A	c.(430-432)gaG>gaA	p.E144E	RP11-23J9.4_ENST00000534123.1_RNA|CCDC180_ENST00000375202.2_Silent_p.E5E|CCDC180_ENST00000395220.1_Silent_p.E144E|CCDC180_ENST00000411667.2_Silent_p.E5E|CCDC180_ENST00000529487.1_Silent_p.E5E|CCDC180_ENST00000460482.2_3'UTR			Q9P1Z9	CC180_HUMAN	coiled-coil domain containing 180	144						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											GCGGCGGGGAGAACCGGCCTC	0.537																																																	0													110.0	110.0	110.0					9																	100070052		2203	4300	6503	SO:0001819	synonymous_variant	100499483			AK123391	CCDS35077.1, CCDS35077.2	9q22.33	2013-03-08	2013-03-08	2013-03-08		ENSG00000197816			29303	protein-coding gene	gene with protein product	"""Behcet's Disease Associated Gene 1"""		"""KIAA1529"", ""chromosome 9 open reading frame 174"""	KIAA1529, C9orf174		10819331	Standard	NM_020893		Approved	DKFZp434I2420, BDAG1	uc004axg.2	Q9P1Z9	OTTHUMG00000167001	ENST00000357054.1:c.432G>A	9.37:g.100070052G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2KHR6|Q5VV25|Q68DP5|Q69YV9|Q6AHY0	Silent	SNP	NULL	p.E5	ENST00000357054.1	37	c.15		9																																																																																			C9orf174	-	NULL		0.537	CCDC180-201	KNOWN	basic	protein_coding	C9orf174	HGNC	protein_coding		G	NM_020893		100070052	+1	no_errors	ENST00000375202	ensembl	human	known	70_37	silent	SNP	0.000	A
CAT	847	genome.wustl.edu	37	11	34492396	34492396	+	Intron	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:34492396G>T	ENST00000241052.4	+	12	1523				CAT_ENST00000534710.1_3'UTR	NM_001752.3	NP_001743.1	P04040	CATA_HUMAN	catalase						aerobic respiration (GO:0009060)|cellular response to growth factor stimulus (GO:0071363)|cholesterol metabolic process (GO:0008203)|hemoglobin metabolic process (GO:0020027)|hydrogen peroxide catabolic process (GO:0042744)|menopause (GO:0042697)|negative regulation of apoptotic process (GO:0043066)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|nucleobase-containing small molecule metabolic process (GO:0055086)|osteoblast differentiation (GO:0001649)|positive regulation of cell division (GO:0051781)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|protein homotetramerization (GO:0051289)|protein tetramerization (GO:0051262)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|response to hyperoxia (GO:0055093)|response to hypoxia (GO:0001666)|response to reactive oxygen species (GO:0000302)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|triglyceride metabolic process (GO:0006641)|ureteric bud development (GO:0001657)|UV protection (GO:0009650)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|membrane (GO:0016020)|mitochondrial intermembrane space (GO:0005758)|peroxisomal matrix (GO:0005782)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|plasma membrane (GO:0005886)	aminoacylase activity (GO:0004046)|antioxidant activity (GO:0016209)|catalase activity (GO:0004096)|enzyme binding (GO:0019899)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|NADP binding (GO:0050661)|oxidoreductase activity, acting on peroxide as acceptor (GO:0016684)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			breast(1)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(6)|lung(5)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(3)	26		Lung NSC(402;2.76e-08)|Acute lymphoblastic leukemia(5;0.00143)|all_hematologic(20;0.0116)|Melanoma(852;0.027)		BRCA - Breast invasive adenocarcinoma(625;0.000995)	Fomepizole(DB01213)	GCCTCCTGCTGAAACGTCTTT	0.458																																																	0																																										SO:0001627	intron_variant	847			AY028632	CCDS7891.1	11p13	2012-10-02			ENSG00000121691	ENSG00000121691	1.11.1.6		1516	protein-coding gene	gene with protein product		115500					Standard	NM_001752		Approved		uc001mvm.3	P04040	OTTHUMG00000044353	ENST00000241052.4:c.1435-109G>T	11.37:g.34492396G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6C0|B2RCZ9|D3DR07|Q2M1U4|Q4VXX5|Q9BWT9|Q9UC85	RNA	SNP	-	NULL	ENST00000241052.4	37	NULL	CCDS7891.1	11																																																																																			CAT	-	-		0.458	CAT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAT	HGNC	protein_coding	OTTHUMT00000103197.2	G	NM_001752		34492396	+1	no_errors	ENST00000534710	ensembl	human	putative	70_37	rna	SNP	0.002	T
CCDC170	80129	genome.wustl.edu	37	6	151936652	151936652	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:151936652G>A	ENST00000239374.7	+	10	1884	c.1785G>A	c.(1783-1785)gaG>gaA	p.E595E	CCDC170_ENST00000367290.5_Silent_p.E602E|RNU6-813P_ENST00000384691.1_RNA	NM_025059.3	NP_079335.2	Q8IYT3	CC170_HUMAN	coiled-coil domain containing 170	595								p.E595D(1)									AGATGAAGGAGAAAGCTGAGA	0.393																																																	1	Substitution - Missense(1)	large_intestine(1)											145.0	141.0	142.0					6																	151936652		1855	4096	5951	SO:0001819	synonymous_variant	80129			AK026958	CCDS43515.1	6q25.1	2012-03-26	2012-03-26	2012-03-26	ENSG00000120262	ENSG00000120262			21177	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 97"""	C6orf97			Standard	NM_025059		Approved	FLJ23305, bA282P11.1	uc003qol.3	Q8IYT3	OTTHUMG00000015839	ENST00000239374.7:c.1785G>A	6.37:g.151936652G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VXB7|Q6P9E4|Q96KA9|Q9H5M3	Silent	SNP	superfamily_Prefoldin,superfamily_Smac_DIABLO-like	p.E602	ENST00000239374.7	37	c.1806	CCDS43515.1	6																																																																																			CCDC170	-	superfamily_Prefoldin		0.393	CCDC170-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CCDC170	HGNC	protein_coding	OTTHUMT00000042727.2	G	NM_025059		151936652	+1	no_errors	ENST00000367290	ensembl	human	known	70_37	silent	SNP	1.000	A
CCDC178	374864	genome.wustl.edu	37	18	30926288	30926288	+	Missense_Mutation	SNP	G	G	T	rs373863286		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:30926288G>T	ENST00000383096.3	-	9	727	c.545C>A	c.(544-546)gCa>gAa	p.A182E	CCDC178_ENST00000406524.2_Missense_Mutation_p.A182E|CCDC178_ENST00000583930.1_Missense_Mutation_p.A182E|CCDC178_ENST00000402325.1_Missense_Mutation_p.A182E|CCDC178_ENST00000403303.1_Missense_Mutation_p.A182E|CCDC178_ENST00000300227.8_Missense_Mutation_p.A182E|CCDC178_ENST00000579947.1_Missense_Mutation_p.A182E|CCDC178_ENST00000579916.1_Intron			Q5BJE1	CC178_HUMAN	coiled-coil domain containing 178	182																	TTCAGCGTCTGCCCGGTCAGT	0.383																																																	0													107.0	102.0	104.0					18																	30926288		2203	4300	6503	SO:0001583	missense	374864			AK126038	CCDS11906.1, CCDS42424.1	18q12.1	2012-10-15	2012-10-15	2012-10-15	ENSG00000166960	ENSG00000166960			29588	protein-coding gene	gene with protein product			"""chromosome 18 open reading frame 34"""	C18orf34			Standard	NM_198995		Approved	FLJ44050	uc002kxn.2	Q5BJE1	OTTHUMG00000132279	ENST00000383096.3:c.545C>A	18.37:g.30926288G>T	ENSP00000372576:p.Ala182Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDC6|J3KS92|Q6ZP67|Q6ZU20	Missense_Mutation	SNP	NULL	p.A182E	ENST00000383096.3	37	c.545	CCDS42424.1	18	.	.	.	.	.	.	.	.	.	.	G	10.81	1.456428	0.26161	.	.	ENSG00000166960	ENST00000403303;ENST00000383096;ENST00000300227;ENST00000406524;ENST00000402325;ENST00000399177	T;T;T;T;T;T	0.45668	2.48;2.48;2.48;2.48;2.48;0.89	5.59	3.66	0.41972	.	.	.	.	.	T	0.51432	0.1674	L	0.52573	1.65	0.27438	N	0.953813	D;D;D;D	0.76494	0.999;0.991;0.991;0.991	D;P;P;P	0.76575	0.988;0.889;0.889;0.889	T	0.34428	-0.9829	9	0.19590	T	0.45	-20.9434	7.4853	0.27429	0.0:0.1467:0.5948:0.2586	.	182;182;182;182	F8W7A7;B5MD75;Q5BJE1-2;Q5BJE1	.;.;.;CR034_HUMAN	E	182	ENSP00000385591:A182E;ENSP00000372576:A182E;ENSP00000300227:A182E;ENSP00000385867:A182E;ENSP00000385234:A182E;ENSP00000382130:A182E	ENSP00000300227:A182E	A	-	2	0	C18orf34	29180286	1.000000	0.71417	1.000000	0.80357	0.717000	0.41224	2.887000	0.48586	2.636000	0.89361	0.557000	0.71058	GCA	CCDC178	-	NULL		0.383	CCDC178-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CCDC178	HGNC	protein_coding	OTTHUMT00000255373.2	G	NM_198995		30926288	-1	no_errors	ENST00000406524	ensembl	human	known	70_37	missense	SNP	0.996	T
CCSAP	126731	genome.wustl.edu	37	1	229460177	229460177	+	3'UTR	DEL	A	A	-			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:229460177delA	ENST00000366687.1	-	0	1669				CCSAP_ENST00000366686.1_3'UTR|CCSAP_ENST00000483092.1_5'UTR|RP4-803J11.2_ENST00000418348.1_RNA|CCSAP_ENST00000284617.2_3'UTR			Q6IQ19	CCSAP_HUMAN	centriole, cilia and spindle-associated protein						multicellular organismal development (GO:0007275)|regulation of cilium beat frequency involved in ciliary motility (GO:0060296)|regulation of embryonic development (GO:0045995)	axon (GO:0030424)|axoneme (GO:0005930)|centriole (GO:0005814)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|ciliary transition zone (GO:0035869)|cilium (GO:0005929)|spindle (GO:0005819)											TGTATTCTTTAAAAAAAAAAA	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	126731			BC071609	CCDS1577.1	1q42.13	2012-06-19	2012-06-19	2012-06-19	ENSG00000154429	ENSG00000154429			29578	protein-coding gene	gene with protein product	"""centriole and spindle-associated protein"""		"""chromosome 1 open reading frame 96"""	C1orf96		22493317	Standard	NM_145257		Approved	FLJ41471, CSAP	uc001htl.4	Q6IQ19	OTTHUMG00000037663	ENST00000366687.1:c.*805T>-	1.37:g.229460177delA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5X2|Q6P9G2|Q6ZW85|Q8IXU1|Q96BM2	RNA	DEL	-	NULL	ENST00000366687.1	37	NULL	CCDS1577.1	1																																																																																			CCSAP	-	-		0.368	CCSAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCSAP	HGNC	protein_coding	OTTHUMT00000091839.1	A	NM_145257		229460177	-1	no_errors	ENST00000483092	ensembl	human	known	70_37	rna	DEL	0.004	-
CD27	939	genome.wustl.edu	37	12	6554686	6554686	+	Missense_Mutation	SNP	G	G	A	rs145433356		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:6554686G>A	ENST00000266557.3	+	2	462	c.233G>A	c.(232-234)cGg>cAg	p.R78Q	CD27_ENST00000541233.1_3'UTR|CD27-AS1_ENST00000399492.2_RNA|CD27-AS1_ENST00000545339.1_RNA	NM_001242.4	NP_001233	P26842	CD27_HUMAN	CD27 molecule	78					cell surface receptor signaling pathway (GO:0007166)|extrinsic apoptotic signaling pathway (GO:0097191)|immunoglobulin mediated immune response (GO:0016064)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of T cell apoptotic process (GO:0070233)|positive regulation of B cell differentiation (GO:0045579)|positive regulation of JNK cascade (GO:0046330)|release of cytoplasmic sequestered NF-kappaB (GO:0008588)|response to ethanol (GO:0045471)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|transmembrane signaling receptor activity (GO:0004888)			kidney(1)|large_intestine(5)|lung(1)|urinary_tract(3)	10						CACCACACCCGGCCCCACTGT	0.587																																																	0								G	GLN/ARG	0,4406		0,0,2203	58.0	50.0	53.0		233	3.5	1.0	12	dbSNP_134	53	3,8597	3.0+/-9.4	0,3,4297	no	missense	CD27	NM_001242.4	43	0,3,6500	AA,AG,GG		0.0349,0.0,0.0231	possibly-damaging	78/261	6554686	3,13003	2203	4300	6503	SO:0001583	missense	939			M63928	CCDS8545.1	12p13	2014-09-17	2006-10-27	2006-10-27	ENSG00000139193	ENSG00000139193		"""Tumor necrosis factor receptor superfamily"", ""CD molecules"""	11922	protein-coding gene	gene with protein product		186711	"""tumor necrosis factor receptor superfamily, member 7"""	TNFRSF7		2442250, 8530100	Standard	NM_001242		Approved	S152, Tp55	uc001qod.3	P26842	OTTHUMG00000168316	ENST00000266557.3:c.233G>A	12.37:g.6554686G>A	ENSP00000266557:p.Arg78Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDZ0	Missense_Mutation	SNP	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg,prints_TNFR_7,prints_Fas_rcpt	p.R78Q	ENST00000266557.3	37	c.233	CCDS8545.1	12	.	.	.	.	.	.	.	.	.	.	G	13.33	2.204377	0.38905	0.0	3.49E-4	ENSG00000139193	ENST00000266557	D	0.94046	-3.34	4.54	3.55	0.40652	TNFR/CD27/30/40/95 cysteine-rich region (3);	0.869937	0.09808	N	0.753189	D	0.83275	0.5219	N	0.20986	0.625	0.34962	D	0.752324	P	0.44478	0.836	B	0.29716	0.106	T	0.82026	-0.0661	10	0.23891	T	0.37	-17.2499	6.686	0.23146	0.1311:0.0:0.8689:0.0	.	78	P26842	CD27_HUMAN	Q	78	ENSP00000266557:R78Q	ENSP00000266557:R78Q	R	+	2	0	CD27	6424947	0.998000	0.40836	1.000000	0.80357	0.703000	0.40648	2.768000	0.47645	2.359000	0.80004	0.563000	0.77884	CGG	CD27	-	pfam_TNFR/NGFR_Cys_rich_reg,smart_TNFR/NGFR_Cys_rich_reg,pfscan_TNFR/NGFR_Cys_rich_reg		0.587	CD27-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD27	HGNC	protein_coding	OTTHUMT00000399258.1	G			6554686	+1	no_errors	ENST00000266557	ensembl	human	known	70_37	missense	SNP	1.000	A
CD44	960	genome.wustl.edu	37	11	35160833	35160833	+	5'UTR	SNP	C	C	G	rs55707108	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:35160833C>G	ENST00000428726.2	+	0	106				CD44_ENST00000526669.2_5'UTR|CD44_ENST00000278386.6_5'UTR|CD44_ENST00000360158.4_5'UTR|CD44_ENST00000437706.2_5'UTR|CD44_ENST00000526025.1_5'UTR|CD44_ENST00000433354.2_5'UTR|CD44_ENST00000415148.2_5'UTR|CD44_ENST00000433892.2_5'UTR|RP4-607I7.1_ENST00000530263.1_RNA|CD44_ENST00000434472.2_5'Flank|CD44_ENST00000352818.4_5'Flank|RP4-607I7.1_ENST00000528366.1_RNA|CD44_ENST00000449691.2_5'UTR|CD44_ENST00000263398.6_5'UTR	NM_000610.3	NP_000601.3	P16070	CD44_HUMAN	CD44 molecule (Indian blood group)						blood coagulation (GO:0007596)|branching involved in prostate gland morphogenesis (GO:0060442)|branching involved in ureteric bud morphogenesis (GO:0001658)|carbohydrate metabolic process (GO:0005975)|cartilage development (GO:0051216)|cell-matrix adhesion (GO:0007160)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cytokine-mediated signaling pathway (GO:0019221)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|glycosaminoglycan metabolic process (GO:0030203)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte migration (GO:0050900)|monocyte aggregation (GO:0070487)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043518)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:1902166)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of gene expression (GO:0010628)|positive regulation of heterotypic cell-cell adhesion (GO:0034116)|positive regulation of monocyte aggregation (GO:1900625)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|single organismal cell-cell adhesion (GO:0016337)|small molecule metabolic process (GO:0044281)|Wnt signaling pathway (GO:0016055)|wound healing involved in inflammatory response (GO:0002246)	basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			cervix(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(13)|pancreas(1)|skin(1)	23	all_cancers(35;0.212)|all_lung(20;0.0874)|all_epithelial(35;0.112)	all_hematologic(20;0.107)	STAD - Stomach adenocarcinoma(6;0.00731)		Hyaluronan(DB08818)	CCCGCGCCCTCCGTTCGCTCC	0.711													C|||	6	0.00119808	0.0008	0.0029	5008	,	,		13698	0.0		0.003	False		,,,				2504	0.0																0								C	,,,,,,,	0,4342		0,0,2171	28.0	25.0	26.0		,,,,,,,	-3.4	0.0	11	dbSNP_129	26	10,8460		0,10,4225	no	utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5,utr-5	CD44	NM_000610.3,NM_001001389.1,NM_001001390.1,NM_001001391.1,NM_001001392.1,NM_001202555.1,NM_001202556.1,NM_001202557.1	,,,,,,,	0,10,6396	GG,GC,CC		0.1181,0.0,0.0781	,,,,,,,	,,,,,,,	35160833	10,12802	2171	4235	6406	SO:0001623	5_prime_UTR_variant	960			M59040	CCDS7897.1, CCDS31455.1, CCDS31456.1, CCDS31457.1, CCDS31458.1, CCDS55754.1, CCDS55755.1	11p13	2014-07-18	2006-03-28		ENSG00000026508	ENSG00000026508		"""CD molecules"", ""Blood group antigens"", ""Proteoglycans / Cell surface : Other"""	1681	protein-coding gene	gene with protein product	"""hematopoietic cell E- and L-selectin ligand"", ""chondroitin sulfate proteoglycan 8"""	107269	"""CD44 antigen (homing function and Indian blood group system)"""	MIC4, MDU2, MDU3		2454887	Standard	NM_001202555		Approved	IN, MC56, Pgp1, CD44R, HCELL, CSPG8	uc001mvu.3	P16070	OTTHUMG00000044388	ENST00000428726.2:c.-18C>G	11.37:g.35160833C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A5YRN9|B6EAT9|D3DR12|D3DR13|O95370|P22511|Q04858|Q13419|Q13957|Q13958|Q13959|Q13960|Q13961|Q13967|Q13968|Q13980|Q15861|Q16064|Q16065|Q16066|Q16208|Q16522|Q86T72|Q86Z27|Q8N694|Q92493|Q96J24|Q9H5A5|Q9UC28|Q9UC29|Q9UC30|Q9UCB0|Q9UJ36	RNA	SNP	-	NULL	ENST00000428726.2	37	NULL	CCDS7897.1	11																																																																																			CD44	-	-		0.711	CD44-001	KNOWN	basic|CCDS	protein_coding	CD44	HGNC	protein_coding	OTTHUMT00000388927.1	C	NM_000610		35160833	+1	no_errors	ENST00000528086	ensembl	human	known	70_37	rna	SNP	0.000	G
CDC25C	995	genome.wustl.edu	37	5	137666710	137666710	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:137666710G>C	ENST00000323760.6	-	2	438	c.160C>G	c.(160-162)Ctt>Gtt	p.L54V	CDC25C_ENST00000513970.1_Missense_Mutation_p.L54V|CDC25C_ENST00000356505.3_Missense_Mutation_p.L54V|CDC25C_ENST00000514555.1_Missense_Mutation_p.L54V|CDC25C_ENST00000357274.3_Missense_Mutation_p.L54V|CDC25C_ENST00000348983.3_Missense_Mutation_p.L54V|CDC25C_ENST00000415130.2_Missense_Mutation_p.L54V	NM_001790.3	NP_001781.2	P30307	MPIP3_HUMAN	cell division cycle 25C	54					cell proliferation (GO:0008283)|DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|peptidyl-tyrosine dephosphorylation (GO:0035335)|regulation of cell cycle (GO:0051726)|regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0000079)|regulation of mitosis (GO:0007088)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	protein kinase binding (GO:0019901)|protein tyrosine phosphatase activity (GO:0004725)|WW domain binding (GO:0050699)	p.L54V(1)		endometrium(2)|kidney(3)|large_intestine(5)|lung(5)|skin(1)	16			KIRC - Kidney renal clear cell carcinoma(527;0.004)|Kidney(363;0.00592)			GAATCACCAAGAAATTTGCCC	0.383																																																	1	Substitution - Missense(1)	lung(1)											94.0	97.0	96.0					5																	137666710		2203	4300	6503	SO:0001583	missense	995			M34065	CCDS4202.1, CCDS4203.1	5q31	2013-01-17	2013-01-17		ENSG00000158402	ENSG00000158402		"""Protein tyrosine phosphatases / Class III Cys-based PTPs"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1727	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 60"""	157680	"""cell division cycle 25C"", ""cell division cycle 25 homolog C (S. cerevisiae)"", ""cell division cycle 25 homolog C (S. pombe)"""	CDC25		1703321	Standard	XM_005272145		Approved	PPP1R60	uc003lcp.1	P30307	OTTHUMG00000129203	ENST00000323760.6:c.160C>G	5.37:g.137666710G>C	ENSP00000321656:p.Leu54Val	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQB8|Q96PL3|Q9H168|Q9H2E8|Q9H2E9|Q9H2F1	Missense_Mutation	SNP	pfam_MPI_Phosphatase,pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom,prints_MPI_Phosphatase	p.L54V	ENST00000323760.6	37	c.160	CCDS4202.1	5	.	.	.	.	.	.	.	.	.	.	G	3.997	-0.003391	0.07773	.	.	ENSG00000158402	ENST00000323760;ENST00000356505;ENST00000357274;ENST00000348983;ENST00000415130;ENST00000513970;ENST00000534892;ENST00000514555;ENST00000503022;ENST00000510119	T;T;T;T;T;T;T;T;T	0.34275	1.37;1.37;1.81;1.37;1.37;1.37;1.37;1.37;1.37	4.49	1.59	0.23543	.	0.564498	0.15632	N	0.252339	T	0.16981	0.0408	N	0.24115	0.695	0.09310	N	1	P;P;P;P;B;P	0.46142	0.873;0.873;0.799;0.787;0.288;0.682	B;B;B;B;B;B	0.36464	0.225;0.164;0.112;0.164;0.051;0.079	T	0.10543	-1.0625	10	0.35671	T	0.21	-0.2367	2.4681	0.04558	0.2779:0.0:0.4847:0.2375	.	71;54;71;54;54;54	G3V1P6;P30307-3;B4DX61;P30307-2;P30307-4;P30307	.;.;.;.;.;MPIP3_HUMAN	V	54;54;54;54;54;54;71;54;54;71	ENSP00000321656:L54V;ENSP00000348898:L54V;ENSP00000349821:L54V;ENSP00000345205:L54V;ENSP00000392631:L54V;ENSP00000424795:L54V;ENSP00000425470:L54V;ENSP00000427251:L54V;ENSP00000427105:L71V	ENSP00000321656:L54V	L	-	1	0	CDC25C	137694609	0.000000	0.05858	0.032000	0.17829	0.005000	0.04900	0.087000	0.14958	0.205000	0.20568	-0.122000	0.15005	CTT	CDC25C	-	NULL		0.383	CDC25C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC25C	HGNC	protein_coding	OTTHUMT00000251280.1	G			137666710	-1	no_errors	ENST00000323760	ensembl	human	known	70_37	missense	SNP	0.028	C
CDH15	1013	genome.wustl.edu	37	16	89245823	89245823	+	Splice_Site	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:89245823G>C	ENST00000289746.2	+	2	107		c.e2-1		CDH15_ENST00000521087.1_Splice_Site	NM_004933.2	NP_004924.1	P55291	CAD15_HUMAN	cadherin 15, type 1, M-cadherin (myotubule)						adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|positive regulation of muscle cell differentiation (GO:0051149)	caveola (GO:0005901)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(9)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	18				BRCA - Breast invasive adenocarcinoma(80;0.0261)		CTTTGTTGCAGAGCCTCTGCC	0.701																																																	0													133.0	114.0	121.0					16																	89245823		2198	4300	6498	SO:0001630	splice_region_variant	1013			D83542	CCDS10976.1	16q24.3	2010-01-26	2008-10-30		ENSG00000129910	ENSG00000129910		"""Cadherins / Major cadherins"""	1754	protein-coding gene	gene with protein product		114019	"""cadherin 15, M-cadherin (myotubule)"""	CDH3, CDH14		1427864	Standard	NM_004933		Approved		uc002fmt.3	P55291	OTTHUMG00000138045	ENST00000289746.2:c.43-1G>C	16.37:g.89245823G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	SNP	-	e2-1	ENST00000289746.2	37	c.43-1	CCDS10976.1	16	.	.	.	.	.	.	.	.	.	.	G	13.36	2.213642	0.39102	.	.	ENSG00000129910	ENST00000289746	.	.	.	4.05	4.05	0.47172	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	13.2246	0.59907	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	CDH15	87773324	0.871000	0.30034	0.933000	0.37362	0.159000	0.22180	2.390000	0.44416	2.104000	0.64026	0.407000	0.27541	.	CDH15	-	-		0.701	CDH15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH15	HGNC	protein_coding	OTTHUMT00000269920.1	G	NM_004933	Intron	89245823	+1	no_errors	ENST00000289746	ensembl	human	known	70_37	splice_site	SNP	0.744	C
CDH7	1005	genome.wustl.edu	37	18	63477135	63477135	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:63477135G>A	ENST00000397968.2	+	3	832	c.406G>A	c.(406-408)Gag>Aag	p.E136K	CDH7_ENST00000323011.3_Missense_Mutation_p.E136K|CDH7_ENST00000536984.2_Missense_Mutation_p.E136K	NM_004361.2	NP_004352.2	Q9ULB5	CADH7_HUMAN	cadherin 7, type 2	136	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(43)|ovary(3)|pancreas(1)|prostate(1)|skin(7)|stomach(1)|upper_aerodigestive_tract(2)	80		Esophageal squamous(42;0.129)				CGTGGAGCCCGAGTCGGAGTT	0.527																																																	0													72.0	71.0	71.0					18																	63477135		2203	4300	6503	SO:0001583	missense	1005			AB035301	CCDS11993.1	18q22.1	2010-01-26			ENSG00000081138	ENSG00000081138		"""Cadherins / Major cadherins"""	1766	protein-coding gene	gene with protein product		605806				9615235	Standard	NM_033646		Approved		uc002ljz.3	Q9ULB5	OTTHUMG00000132800	ENST00000397968.2:c.406G>A	18.37:g.63477135G>A	ENSP00000381058:p.Glu136Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H157	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E136K	ENST00000397968.2	37	c.406	CCDS11993.1	18	.	.	.	.	.	.	.	.	.	.	G	20.5	3.996440	0.74818	.	.	ENSG00000081138	ENST00000323011;ENST00000536984;ENST00000397966;ENST00000397968	T;T;T	0.53640	0.61;0.61;0.61	5.83	5.83	0.93111	Cadherin (4);Cadherin-like (1);	0.117108	0.56097	D	0.000022	T	0.50034	0.1592	L	0.58810	1.83	0.53005	D	0.999969	P;B	0.36171	0.541;0.096	B;B	0.35688	0.208;0.019	T	0.51148	-0.8742	10	0.54805	T	0.06	.	20.1416	0.98058	0.0:0.0:1.0:0.0	.	136;136	F5H5X9;Q9ULB5	.;CADH7_HUMAN	K	136	ENSP00000319166:E136K;ENSP00000443030:E136K;ENSP00000381058:E136K	ENSP00000319166:E136K	E	+	1	0	CDH7	61628115	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	4.979000	0.63806	2.767000	0.95098	0.650000	0.86243	GAG	CDH7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.527	CDH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH7	HGNC	protein_coding	OTTHUMT00000256217.2	G	NM_033646		63477135	+1	no_errors	ENST00000323011	ensembl	human	known	70_37	missense	SNP	1.000	A
CDHR3	222256	genome.wustl.edu	37	7	105672949	105672949	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:105672949C>T	ENST00000317716.9	+	19	2544	c.2464C>T	c.(2464-2466)Cgc>Tgc	p.R822C	CDHR3_ENST00000343407.5_3'UTR|CDHR3_ENST00000542731.1_Missense_Mutation_p.R822C|CDHR3_ENST00000478080.1_Missense_Mutation_p.R734C	NM_152750.4	NP_689963.2	Q6ZTQ4	CDHR3_HUMAN	cadherin-related family member 3	822					homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(1)	23						AGCTGCCCCACGCAGAGTCAC	0.527																																																	0													65.0	67.0	67.0					7																	105672949		2026	4195	6221	SO:0001583	missense	222256			AK126338	CCDS47684.1, CCDS75651.1	7q22.2	2011-07-01			ENSG00000128536	ENSG00000128536		"""Cadherins / Cadherin-related"""	26308	protein-coding gene	gene with protein product		615610					Standard	NM_152750		Approved	FLJ44366, FLJ23834, CDH28	uc003vdl.4	Q6ZTQ4	OTTHUMG00000157520	ENST00000317716.9:c.2464C>T	7.37:g.105672949C>T	ENSP00000325954:p.Arg822Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCI7	Missense_Mutation	SNP	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R822C	ENST00000317716.9	37	c.2464	CCDS47684.1	7	.	.	.	.	.	.	.	.	.	.	C	8.088	0.773982	0.16051	.	.	ENSG00000128536	ENST00000542731;ENST00000317716;ENST00000478080	T;T;T	0.57436	0.47;0.47;0.4	4.6	-1.21	0.09524	.	1.497470	0.04003	N	0.296753	T	0.28067	0.0692	N	0.08118	0	0.09310	N	1	B;B	0.09022	0.002;0.002	B;B	0.04013	0.001;0.001	T	0.09930	-1.0652	9	.	.	.	.	3.5266	0.07761	0.4233:0.3807:0.0978:0.0982	.	809;822	B3KYA0;Q6ZTQ4	.;CDHR3_HUMAN	C	822;822;734	ENSP00000439766:R822C;ENSP00000325954:R822C;ENSP00000417771:R734C	.	R	+	1	0	CDHR3	105460185	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.060000	0.11712	-0.042000	0.13535	-0.940000	0.02684	CGC	CDHR3	-	NULL		0.527	CDHR3-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CDHR3	HGNC	protein_coding	OTTHUMT00000349025.2	C	NM_152750		105672949	+1	no_errors	ENST00000317716	ensembl	human	known	70_37	missense	SNP	0.000	T
CEACAM5	1048	genome.wustl.edu	37	19	42225080	42225080	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:42225080G>C	ENST00000221992.6	+	8	2124	c.2010G>C	c.(2008-2010)aaG>aaC	p.K670N	CEACAM5_ENST00000405816.1_Missense_Mutation_p.K670N|CEA_ENST00000598976.1_Intron|CEACAM5_ENST00000398599.4_Missense_Mutation_p.K669N	NM_004363.2	NP_004354.2	P06731	CEAM5_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 5	670	Ig-like 7.				homotypic cell-cell adhesion (GO:0034109)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of myotube differentiation (GO:0010832)	anchored component of membrane (GO:0031225)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of external side of plasma membrane (GO:0071575)|integral component of plasma membrane (GO:0005887)	GPI anchor binding (GO:0034235)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)			breast(1)|endometrium(3)|kidney(5)|large_intestine(4)|lung(10)|ovary(2)|skin(7)|stomach(1)|urinary_tract(1)	34				OV - Ovarian serous cystadenocarcinoma(3;0.00278)|all cancers(3;0.00625)|Epithelial(262;0.0379)|GBM - Glioblastoma multiforme(1328;0.142)		CCATAGTCAAGAGCATCACAG	0.453																																																	0													113.0	100.0	104.0					19																	42225080		2203	4300	6503	SO:0001583	missense	1048			M17303	CCDS12584.1	19q13.1-q13.2	2013-01-29			ENSG00000105388	ENSG00000105388		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1817	protein-coding gene	gene with protein product		114890		CEA			Standard	XM_005258413		Approved	CD66e	uc002orl.3	P06731	OTTHUMG00000151061	ENST00000221992.6:c.2010G>C	19.37:g.42225080G>C	ENSP00000221992:p.Lys670Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	H9KVA7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.K670N	ENST00000221992.6	37	c.2010	CCDS12584.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	6.605|6.605	0.479990|0.479990	0.12581|0.12581	.|.	.|.	ENSG00000105388|ENSG00000105388	ENST00000398599|ENST00000221992;ENST00000405816;ENST00000378181	.|T;T	.|0.38887	.|1.11;1.11	2.44|2.44	1.38|1.38	0.22167|0.22167	.|Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.|.	.|.	.|.	.|.	T|T	0.52565|0.52565	0.1742|0.1742	M|M	0.83603|0.83603	2.65|2.65	0.09310|0.09310	N|N	1|1	.|B;D	.|0.53619	.|0.006;0.961	.|B;P	.|0.55508	.|0.023;0.777	T|T	0.41431|0.41431	-0.9509|-0.9509	5|9	.|0.21540	.|T	.|0.41	.|.	5.1484|5.1484	0.14996|0.14996	0.1725:0.0:0.8275:0.0|0.1725:0.0:0.8275:0.0	.|.	.|670;670	.|P06731;Q53G30	.|CEAM5_HUMAN;.	Q|N	666|670;670;388	.|ENSP00000221992:K670N;ENSP00000385072:K670N	.|ENSP00000221992:K670N	E|K	+|+	1|3	0|2	CEACAM5|CEACAM5	46916920|46916920	0.002000|0.002000	0.14202|0.14202	0.004000|0.004000	0.12327|0.12327	0.011000|0.011000	0.07611|0.07611	0.471000|0.471000	0.22100|0.22100	0.572000|0.572000	0.29383|0.29383	0.467000|0.467000	0.42956|0.42956	GAG|AAG	CEACAM5	-	smart_Ig_sub,pfscan_Ig-like		0.453	CEACAM5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CEACAM5	HGNC	protein_coding	OTTHUMT00000321132.2	G	NM_004363		42225080	+1	no_errors	ENST00000221992	ensembl	human	known	70_37	missense	SNP	0.005	C
CEACAM8	1088	genome.wustl.edu	37	19	43093155	43093155	+	Missense_Mutation	SNP	T	T	A	rs45591641	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:43093155T>A	ENST00000244336.5	-	4	840	c.739A>T	c.(739-741)Acc>Tcc	p.T247S	CEACAM8_ENST00000599005.1_Intron|LIPE-AS1_ENST00000594624.2_RNA|LIPE-AS1_ENST00000594688.1_RNA	NM_001816.3	NP_001807.2	P31997	CEAM8_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 8	247	Ig-like C2-type 2.				immune response (GO:0006955)	anchored component of membrane (GO:0031225)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)				endometrium(1)|large_intestine(5)|lung(5)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	16		Prostate(69;0.00899)				TGGTAATAGGTGTCTGAAGGG	0.507																																																	0													103.0	99.0	101.0					19																	43093155		2203	4300	6503	SO:0001583	missense	1088			D90064	CCDS12610.1	19q13.2	2013-01-29			ENSG00000124469	ENSG00000124469		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1820	protein-coding gene	gene with protein product		615747		CGM6		2208113, 2306228	Standard	NM_001816		Approved	CD66b	uc002oud.2	P31997	OTTHUMG00000151124	ENST00000244336.5:c.739A>T	19.37:g.43093155T>A	ENSP00000244336:p.Thr247Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O60399|Q16574	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.T247S	ENST00000244336.5	37	c.739	CCDS12610.1	19	.	.	.	.	.	.	.	.	.	.	t	2.651	-0.282013	0.05642	.	.	ENSG00000124469	ENST00000244336	T	0.12774	2.65	2.41	-2.31	0.06765	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.05456	0.0144	N	0.11724	0.165	0.09310	N	1	B	0.12630	0.006	B	0.20577	0.03	T	0.44937	-0.9295	9	0.12430	T	0.62	.	3.3708	0.07220	0.3266:0.4322:0.0:0.2412	.	247	P31997	CEAM8_HUMAN	S	247	ENSP00000244336:T247S	ENSP00000244336:T247S	T	-	1	0	CEACAM8	47784995	0.000000	0.05858	0.002000	0.10522	0.294000	0.27393	-2.028000	0.01431	-0.266000	0.09339	0.254000	0.18369	ACC	CEACAM8	-	pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like		0.507	CEACAM8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM8	HGNC	protein_coding	OTTHUMT00000321430.1	T			43093155	-1	no_errors	ENST00000244336	ensembl	human	known	70_37	missense	SNP	0.001	A
CEACAM18	729767	genome.wustl.edu	37	19	51981896	51981896	+	5'UTR	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:51981896C>G	ENST00000396477.4	+	0	21				CEACAM18_ENST00000451626.1_Silent_p.L61L	NM_001278392.1	NP_001265321.1	A8MTB9	CEA18_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 18											breast(1)|endometrium(4)|large_intestine(3)|lung(8)|skin(1)	17		all_neural(266;0.0529)		GBM - Glioblastoma multiforme(134;0.00148)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CCAGGCAGCTCATGGACCTTT	0.617																																																	0													31.0	35.0	34.0					19																	51981896		1963	4146	6109	SO:0001623	5_prime_UTR_variant	729767					19q13.41	2013-01-29				ENSG00000213822		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	31949	protein-coding gene	gene with protein product							Standard	NM_001278392		Approved		uc002pwv.1	A8MTB9		ENST00000396477.4:c.-1C>G	19.37:g.51981896C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JN24	Silent	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.L61	ENST00000396477.4	37	c.183		19																																																																																			CEACAM18	-	NULL		0.617	CEACAM18-001	PUTATIVE	not_organism_supported|basic|appris_candidate	protein_coding	CEACAM18	HGNC	protein_coding	OTTHUMT00000323114.2	C			51981896	+1	no_errors	ENST00000451626	ensembl	human	known	70_37	silent	SNP	0.022	G
CENPM	79019	genome.wustl.edu	37	22	42343076	42343076	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:42343076G>A	ENST00000215980.5	-	1	92	c.5C>T	c.(4-6)tCg>tTg	p.S2L	CENPM_ENST00000404067.1_5'Flank|CENPM_ENST00000407253.3_Missense_Mutation_p.S2L|CENPM_ENST00000402420.1_5'Flank|CENPM_ENST00000402338.1_5'Flank	NM_024053.3	NP_076958.1	Q9NSP4	CENPM_HUMAN	centromere protein M	2					mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|kinetochore (GO:0000776)|nucleus (GO:0005634)				kidney(1)|large_intestine(1)|prostate(1)	3						CCTCAACACCGACATCACAGC	0.682																																																	0													36.0	34.0	34.0					22																	42343076		2202	4300	6502	SO:0001583	missense	79019			BC000705	CCDS14025.1, CCDS46719.1, CCDS46720.1	22q13.2	2013-11-05	2006-06-15	2006-06-15	ENSG00000100162	ENSG00000100162			18352	protein-coding gene	gene with protein product		610152	"""chromosome 22 open reading frame 18"""	C22orf18		16622420, 16622419	Standard	NM_001110215		Approved	Pane1, CENP-M, MGC861	uc003bbn.3	Q9NSP4	OTTHUMG00000151277	ENST00000215980.5:c.5C>T	22.37:g.42343076G>A	ENSP00000215980:p.Ser2Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A7LM22|B1AHQ9|Q6I9W3	Missense_Mutation	SNP	pfam_Centromere_Cenp-M	p.S2L	ENST00000215980.5	37	c.5	CCDS14025.1	22	.	.	.	.	.	.	.	.	.	.	G	22.0	4.230033	0.79688	.	.	ENSG00000100162	ENST00000215980;ENST00000407253	.	.	.	4.6	4.6	0.57074	.	0.257639	0.37483	N	0.002076	T	0.68833	0.3044	M	0.62723	1.935	0.80722	D	1	D;D;D	0.64830	0.994;0.982;0.982	P;P;P	0.58520	0.84;0.631;0.577	T	0.72465	-0.4285	9	0.72032	D	0.01	-18.5897	14.6475	0.68772	0.0:0.0:1.0:0.0	.	2;2;2	Q9NSP4-2;B1AHQ9;Q9NSP4	.;.;CENPM_HUMAN	L	2	.	ENSP00000215980:S2L	S	-	2	0	CENPM	40673022	1.000000	0.71417	1.000000	0.80357	0.590000	0.36582	5.162000	0.64942	2.555000	0.86185	0.655000	0.94253	TCG	CENPM	-	pfam_Centromere_Cenp-M		0.682	CENPM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPM	HGNC	protein_coding	OTTHUMT00000322058.1	G	NM_024053		42343076	-1	no_errors	ENST00000215980	ensembl	human	known	70_37	missense	SNP	1.000	A
CEP350	9857	genome.wustl.edu	37	1	180013197	180013197	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:180013197C>G	ENST00000367607.3	+	21	4929	c.4511C>G	c.(4510-4512)tCt>tGt	p.S1504C		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	1504	Ser-rich.				microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AAAAGTCCATCTGTTTCACTC	0.303																																																	0													33.0	32.0	32.0					1																	180013197		2190	4259	6449	SO:0001583	missense	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.4511C>G	1.37:g.180013197C>G	ENSP00000356579:p.Ser1504Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.S1504C	ENST00000367607.3	37	c.4511	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.214|8.214	0.801042|0.801042	0.16397|0.16397	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000418229|ENST00000367607	.|T	.|0.59638	.|0.25	5.69|5.69	5.69|5.69	0.88448|0.88448	.|.	.|0.000000	.|0.43110	.|D	.|0.000613	T|T	0.62171|0.62171	0.2406|0.2406	L|L	0.27053|0.27053	0.805|0.805	0.29025|0.29025	N|N	0.886069|0.886069	.|D;D	.|0.76494	.|0.999;0.999	.|D;P	.|0.79784	.|0.993;0.887	T|T	0.57963|0.57963	-0.7720|-0.7720	5|9	.|.	.|.	.|.	.|.	11.9845|11.9845	0.53140|0.53140	0.0:0.9197:0.0:0.0803|0.0:0.9197:0.0:0.0803	.|.	.|1504;1504	.|E7EU22;Q5VT06	.|.;CE350_HUMAN	M|C	112|1504	.|ENSP00000356579:S1504C	.|.	I|S	+|+	3|2	3|0	CEP350|CEP350	178279820|178279820	0.871000|0.871000	0.30034|0.30034	0.803000|0.803000	0.32268|0.32268	0.026000|0.026000	0.11368|0.11368	3.487000|3.487000	0.53222|0.53222	2.692000|2.692000	0.91855|0.91855	0.555000|0.555000	0.69702|0.69702	ATC|TCT	CEP350	-	NULL		0.303	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	C	NM_014810		180013197	+1	no_errors	ENST00000367607	ensembl	human	known	70_37	missense	SNP	0.976	G
CEP57	9702	genome.wustl.edu	37	11	95564259	95564259	+	Missense_Mutation	SNP	A	A	G	rs644799	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:95564259A>G	ENST00000325542.5	+	11	1580	c.1342A>G	c.(1342-1344)Aga>Gga	p.R448G	CEP57_ENST00000325486.5_Missense_Mutation_p.R422G|CEP57_ENST00000537677.1_Missense_Mutation_p.R421G|CEP57_ENST00000541150.1_Missense_Mutation_p.R439G	NM_001243776.1|NM_014679.4	NP_001230705.1|NP_055494.2	Q86XR8	CEP57_HUMAN	centrosomal protein 57kDa	448	Mediates interaction with microtubules. {ECO:0000250}.		R -> G (in dbSNP:rs644799). {ECO:0000269|PubMed:12717444, ECO:0000269|PubMed:14702039}.		fibroblast growth factor receptor signaling pathway (GO:0008543)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule anchoring (GO:0034453)|mitotic cell cycle (GO:0000278)|protein homooligomerization (GO:0051260)|protein import into nucleus, translocation (GO:0000060)|spermatid development (GO:0007286)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)	fibroblast growth factor binding (GO:0017134)|protein homodimerization activity (GO:0042803)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(4)|ovary(1)|prostate(1)	13		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				TGATGAAGAAAGAAACAGCAG	0.373									Mosaic Variegated Aneuploidy Syndrome				G|||	1031	0.205871	0.0772	0.2363	5008	,	,		13719	0.253		0.3738	False		,,,				2504	0.137																0								G	GLY/ARG	546,3856	765.6+/-413.4	34,478,1689	56.0	58.0	58.0		1342	4.9	1.0	11	dbSNP_83	58	3286,5310	636.7+/-399.1	602,2082,1614	yes	missense	CEP57	NM_014679.4	125	636,2560,3303	GG,GA,AA		38.2271,12.4035,29.4815	benign	448/501	95564259	3832,9166	2201	4298	6499	SO:0001583	missense	9702	Familial Cancer Database	MVA, MVA syndrome, VMA syndrome, variegated mosaic aneuploidy syndrome, premature centromere division	D42054	CCDS8304.1, CCDS58166.1, CCDS58167.1	11q21	2014-09-17			ENSG00000166037	ENSG00000166037			30794	protein-coding gene	gene with protein product		607951				7788527	Standard	NM_014679		Approved	Translokin, TSP57, KIAA0092	uc001pfp.2	Q86XR8	OTTHUMG00000167740	ENST00000325542.5:c.1342A>G	11.37:g.95564259A>G	ENSP00000317902:p.Arg448Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJH1|A8K5D0|B4DDP5|F5H5F7|Q14704|Q5JB46|Q8IXP0|Q9BVF9	Missense_Mutation	SNP	pfam_Cep57_MT-bd_dom	p.R448G	ENST00000325542.5	37	c.1342	CCDS8304.1	11	590|590	0.27014652014652013|0.27014652014652013	44|44	0.08943089430894309|0.08943089430894309	102|102	0.281767955801105|0.281767955801105	163|163	0.28496503496503495|0.28496503496503495	281|281	0.370712401055409|0.370712401055409	G|G	4.527|4.527	0.097865|0.097865	0.08681|0.08681	0.124035|0.124035	0.382271|0.382271	ENSG00000166037|ENSG00000166037	ENST00000535224|ENST00000537677;ENST00000325542;ENST00000325486;ENST00000541150	.|T;T;T;T	.|0.30182	.|1.55;1.55;1.54;1.54	5.89|5.89	4.92|4.92	0.64577|0.64577	.|.	.|0.499946	.|0.20276	.|N	.|0.095553	T|T	0.00012|0.00012	0.0000|0.0000	N|N	0.01219|0.01219	-0.95|-0.95	0.80722|0.80722	P|P	0.0|0.0	.|B;B;B	.|0.02656	.|0.0;0.0;0.0	.|B;B;B	.|0.01281	.|0.0;0.0;0.0	T|T	0.35251|0.35251	-0.9796|-0.9796	4|9	.|0.87932	.|D	.|0	-4.9723|-4.9723	6.4242|6.4242	0.21760|0.21760	0.1897:0.1507:0.6596:0.0|0.1897:0.1507:0.6596:0.0	rs644799;rs1150354;rs16922608;rs17228646;rs52796376;rs644799|rs644799;rs1150354;rs16922608;rs17228646;rs52796376;rs644799	.|439;422;448	.|F5H5F7;Q86XR8-2;Q86XR8	.|.;.;CEP57_HUMAN	R|G	237|421;448;422;439	.|ENSP00000441392:R421G;ENSP00000317902:R448G;ENSP00000317487:R422G;ENSP00000443436:R439G	.|ENSP00000317487:R422G	K|R	+|+	2|1	0|2	CEP57|CEP57	95203907|95203907	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.664000|0.664000	0.39144|0.39144	1.006000|1.006000	0.29847|0.29847	1.511000|1.511000	0.48818|0.48818	-0.226000|-0.226000	0.12346|0.12346	AAG|AGA	CEP57	-	NULL		0.373	CEP57-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP57	HGNC	protein_coding	OTTHUMT00000395983.1	A	NM_014679		95564259	+1	no_errors	ENST00000325542	ensembl	human	known	70_37	missense	SNP	0.986	G
CEP85	64793	genome.wustl.edu	37	1	26603883	26603884	+	3'UTR	INS	-	-	AA	rs35371325|rs66751130	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:26603883_26603884insAA	ENST00000252992.4	+	0	2519_2520				SH3BGRL3_ENST00000319041.6_5'Flank|SH3BGRL3_ENST00000270792.5_5'Flank|CEP85_ENST00000469609.1_3'UTR|CEP85_ENST00000451429.2_3'UTR	NM_001281517.1|NM_022778.2	NP_001268446.1|NP_073615.2	Q6P2H3	CEP85_HUMAN	centrosomal protein 85kDa							centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleolus (GO:0005730)|spindle pole (GO:0000922)				breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(11)|skin(2)	25						TTCCCAGAGAGGTCTCAGAGGG	0.564														647	0.129193	0.202	0.1052	5008	,	,		19604	0.0228		0.1889	False		,,,				2504	0.0961																0																																										SO:0001624	3_prime_UTR_variant	64793			AK024038	CCDS277.1, CCDS60038.1	1p36.11	2014-02-20	2011-05-06	2011-05-06	ENSG00000130695	ENSG00000130695			25309	protein-coding gene	gene with protein product			"""coiled-coil domain containing 21"""	CCDC21		12477932	Standard	NM_022778		Approved	DKFZP434L0117	uc001bls.1	Q6P2H3	OTTHUMG00000003380	ENST00000252992.4:c.*100->AA	1.37:g.26603883_26603884insAA		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRL1|D3DPK4|F8W7K4|Q5VY68|Q5VY70|Q9H6Q1|Q9H828|Q9UF52	RNA	INS	-	NULL	ENST00000252992.4	37	NULL	CCDS277.1	1																																																																																			CEP85	-	-		0.564	CEP85-002	KNOWN	alternative_3_UTR|basic|appris_principal|CCDS	protein_coding	CEP85	HGNC	protein_coding	OTTHUMT00000009492.2	-	NM_022778		26603884	+1	no_errors	ENST00000469609	ensembl	human	known	70_37	rna	INS	0.002:0.004	AA
CETP	1071	genome.wustl.edu	37	16	57015564	57015564	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:57015564C>T	ENST00000566128.1	+	13	1292	c.1025C>T	c.(1024-1026)aCa>aTa	p.T342I	CETP_ENST00000200676.3_Missense_Mutation_p.T407I|CETP_ENST00000379780.2_Missense_Mutation_p.T347I					cholesteryl ester transfer protein, plasma											NS(1)|breast(3)|central_nervous_system(1)|endometrium(3)|large_intestine(8)|lung(4)|skin(3)	23						TTCAGGATTACACCAAAGACT	0.473																																																	0													113.0	118.0	116.0					16																	57015564		2198	4300	6498	SO:0001583	missense	1071			M30185	CCDS10772.1, CCDS67032.1	16q13	2012-10-02			ENSG00000087237	ENSG00000087237		"""BPI fold containing"""	1869	protein-coding gene	gene with protein product	"""BPI fold containing family F"""	118470				3600759, 2334701	Standard	NM_000078		Approved	BPIFF	uc002eki.2	P11597	OTTHUMG00000133279	ENST00000566128.1:c.1025C>T	16.37:g.57015564C>T	ENSP00000456276:p.Thr342Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Lipid-bd_serum_glycop_C,pfam_Lipid-bd_serum_glycop_N,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C,pirsf_Cholesteryl_ester_transfer	p.T407I	ENST00000566128.1	37	c.1220		16	.	.	.	.	.	.	.	.	.	.	C	9.262	1.043518	0.19748	.	.	ENSG00000087237	ENST00000200676;ENST00000379780	T;T	0.09445	2.98;2.98	2.78	-1.41	0.08941	Lipid-binding serum glycoprotein, C-terminal (2);Bactericidal permeability-increasing protein, alpha/beta domain (1);	2.967980	0.01653	U	0.024664	T	0.07908	0.0198	N	0.14661	0.345	0.09310	N	1	P;P	0.44195	0.828;0.539	B;B	0.41988	0.372;0.116	T	0.33111	-0.9881	10	0.20046	T	0.44	-16.7321	9.3798	0.38306	0.3165:0.6835:0.0:0.0	.	347;407	P11597-2;P11597	.;CETP_HUMAN	I	407;347	ENSP00000200676:T407I;ENSP00000369106:T347I	ENSP00000200676:T407I	T	+	2	0	CETP	55573065	0.000000	0.05858	0.000000	0.03702	0.390000	0.30446	0.114000	0.15520	-0.320000	0.08640	0.462000	0.41574	ACA	CETP	-	pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_C,pirsf_Cholesteryl_ester_transfer		0.473	CETP-003	PUTATIVE	not_organism_supported|basic|exp_conf	protein_coding	CETP	HGNC	protein_coding	OTTHUMT00000432305.1	C	NM_000078		57015564	+1	no_errors	ENST00000200676	ensembl	human	known	70_37	missense	SNP	0.000	T
CHAT	1103	genome.wustl.edu	37	10	50833673	50833673	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:50833673C>T	ENST00000337653.2	+	6	1060	c.907C>T	c.(907-909)Cac>Tac	p.H303Y	CHAT_ENST00000395559.2_Missense_Mutation_p.H185Y|CHAT_ENST00000351556.3_Missense_Mutation_p.H185Y|CHAT_ENST00000455728.2_Missense_Mutation_p.H185Y|CHAT_ENST00000395562.2_Missense_Mutation_p.H221Y|CHAT_ENST00000339797.1_Missense_Mutation_p.H185Y	NM_001142929.1|NM_020549.4	NP_001136401.1|NP_065574	P28329	CLAT_HUMAN	choline O-acetyltransferase	303					adult walking behavior (GO:0007628)|dendrite development (GO:0016358)|establishment of synaptic specificity at neuromuscular junction (GO:0007529)|glycerophospholipid biosynthetic process (GO:0046474)|muscle organ development (GO:0007517)|neuromuscular synaptic transmission (GO:0007274)|neurotransmitter biosynthetic process (GO:0042136)|neurotransmitter secretion (GO:0007269)|phosphatidylcholine biosynthetic process (GO:0006656)|phospholipid metabolic process (GO:0006644)|rhythmic behavior (GO:0007622)|rhythmic excitation (GO:0043179)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	choline O-acetyltransferase activity (GO:0004102)			central_nervous_system(3)|endometrium(2)|kidney(2)|large_intestine(11)|lung(34)|prostate(3)|urinary_tract(1)	56		all_neural(218;0.107)		GBM - Glioblastoma multiforme(2;0.000585)	Choline(DB00122)|Nicotine(DB00184)	GGAGCCTGAGCACGTCATCGT	0.572																																																	0													42.0	30.0	34.0					10																	50833673		2203	4300	6503	SO:0001583	missense	1103			AF305907	CCDS7232.1, CCDS7233.1, CCDS44389.1	10q11.2	2010-05-11	2010-05-11		ENSG00000070748	ENSG00000070748	2.3.1.6		1912	protein-coding gene	gene with protein product		118490	"""choline acetyltransferase"""			1840566	Standard	NM_020984		Approved		uc001jhz.2	P28329	OTTHUMG00000018198	ENST00000337653.2:c.907C>T	10.37:g.50833673C>T	ENSP00000337103:p.His303Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BDF4|A2BDF5|Q16488|Q9BQ23|Q9BQ35|Q9BQE1	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.H303Y	ENST00000337653.2	37	c.907	CCDS7232.1	10	.	.	.	.	.	.	.	.	.	.	C	22.2	4.257333	0.80246	.	.	ENSG00000070748	ENST00000339797;ENST00000351556;ENST00000395559;ENST00000337653;ENST00000395562;ENST00000455728	D;D;D;D;D;D	0.94000	-3.33;-3.33;-3.33;-3.33;-3.33;-3.33	5.33	5.33	0.75918	.	0.000000	0.85682	D	0.000000	D	0.96703	0.8924	M	0.77406	2.37	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.75484	0.978;0.986	D	0.97038	0.9755	10	0.72032	D	0.01	-26.8268	19.0201	0.92910	0.0:1.0:0.0:0.0	.	185;303	F8W8I2;P28329	.;CLAT_HUMAN	Y	185;185;185;303;221;185	ENSP00000343486:H185Y;ENSP00000345878:H185Y;ENSP00000378926:H185Y;ENSP00000337103:H303Y;ENSP00000378929:H221Y;ENSP00000390521:H185Y	ENSP00000337103:H303Y	H	+	1	0	CHAT	50503679	1.000000	0.71417	0.958000	0.39756	0.380000	0.30137	7.805000	0.86005	2.496000	0.84212	0.411000	0.27672	CAC	CHAT	-	pfam_Carn_acyl_trans		0.572	CHAT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CHAT	HGNC	protein_coding	OTTHUMT00000047997.1	C	NM_020549		50833673	+1	no_errors	ENST00000337653	ensembl	human	known	70_37	missense	SNP	1.000	T
CHRNA2	1135	genome.wustl.edu	37	8	27327357	27327357	+	Missense_Mutation	SNP	C	C	T	rs201922955		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:27327357C>T	ENST00000520933.2	-	2	368	c.215G>A	c.(214-216)cGc>cAc	p.R72H	CHRNA2_ENST00000407991.1_Missense_Mutation_p.R72H|CHRNA2_ENST00000240132.2_Missense_Mutation_p.R72H			Q15822	ACHA2_HUMAN	cholinergic receptor, nicotinic, alpha 2 (neuronal)	72					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transport (GO:0006811)|protein heterooligomerization (GO:0051291)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|drug binding (GO:0008144)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	23		Ovarian(32;2.61e-05)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0208)|Epithelial(17;2.77e-10)|Colorectal(74;0.136)	Atracurium(DB00732)|Biperiden(DB00810)|Carbachol(DB00411)|Cisatracurium Besylate(DB00565)|Decamethonium(DB01245)|Dextromethorphan(DB00514)|Doxacurium chloride(DB01135)|Galantamine(DB00674)|Gallamine Triethiodide(DB00483)|Mecamylamine(DB00657)|Metocurine(DB01336)|Mivacurium(DB01226)|Nicotine(DB00184)|Pancuronium(DB01337)|Pipecuronium(DB01338)|Procaine(DB00721)|Rocuronium(DB00728)|Tubocurarine(DB01199)|Vecuronium(DB01339)	GCGCGCCCAGCGGTTGTAGCC	0.632																																																	0													99.0	95.0	97.0					8																	27327357		2203	4300	6503	SO:0001583	missense	1135			U62431	CCDS6059.1, CCDS64856.1	8p21	2012-02-11	2006-02-01		ENSG00000120903	ENSG00000120903		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1956	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 2 (neuronal)"""	118502	"""cholinergic receptor, nicotinic, alpha polypeptide 2 (neuronal)"""			1505988	Standard	NM_000742		Approved		uc010lur.3	Q15822	OTTHUMG00000102083	ENST00000520933.2:c.215G>A	8.37:g.27327357C>T	ENSP00000429616:p.Arg72His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAX3|B4DK19|J3KMY9|Q9HAQ3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.R72H	ENST00000520933.2	37	c.215	CCDS6059.1	8	.	.	.	.	.	.	.	.	.	.	C	18.17	3.565005	0.65651	.	.	ENSG00000120903	ENST00000407991;ENST00000520933;ENST00000240132;ENST00000524096;ENST00000518712	T;T;T;T;T	0.62498	0.02;0.02;0.02;0.02;0.02	4.77	4.77	0.60923	Neurotransmitter-gated ion-channel ligand-binding (3);	0.108662	0.64402	D	0.000006	T	0.61274	0.2334	L	0.45744	1.44	0.43003	D	0.99452	P;P	0.51653	0.947;0.947	P;B	0.45881	0.496;0.393	T	0.67933	-0.5542	10	0.87932	D	0	.	15.6641	0.77213	0.0:1.0:0.0:0.0	.	72;72	B4DK19;Q15822	.;ACHA2_HUMAN	H	72	ENSP00000385026:R72H;ENSP00000429616:R72H;ENSP00000240132:R72H;ENSP00000430422:R72H;ENSP00000430856:R72H	ENSP00000240132:R72H	R	-	2	0	CHRNA2	27383274	0.982000	0.34865	1.000000	0.80357	0.996000	0.88848	1.445000	0.35079	2.653000	0.90120	0.561000	0.74099	CGC	CHRNA2	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.632	CHRNA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA2	HGNC	protein_coding	OTTHUMT00000376125.4	C			27327357	-1	no_errors	ENST00000407991	ensembl	human	known	70_37	missense	SNP	1.000	T
CHRNA7	1139	genome.wustl.edu	37	15	32460419	32460419	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:32460419C>T	ENST00000306901.3	+	10	1366	c.1269C>T	c.(1267-1269)ggC>ggT	p.G423G	CHRNA7_ENST00000455693.2_Silent_p.G242G|CHRNA7_ENST00000454250.3_Silent_p.G452G	NM_000746.5	NP_000737.1	P36544	ACHA7_HUMAN	cholinergic receptor, nicotinic, alpha 7 (neuronal)	423					activation of MAPK activity (GO:0000187)|associative learning (GO:0008306)|B cell activation (GO:0042113)|behavioral response to ethanol (GO:0048149)|behavioral response to nicotine (GO:0035095)|calcium ion transport (GO:0006816)|cation transmembrane transport (GO:0098655)|cellular calcium ion homeostasis (GO:0006874)|cognition (GO:0050890)|dopamine biosynthetic process (GO:0042416)|endocytosis (GO:0006897)|generation of ovulation cycle rhythm (GO:0060112)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|memory (GO:0007613)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta production (GO:0032691)|negative regulation of interleukin-6 production (GO:0032715)|negative regulation of tumor necrosis factor production (GO:0032720)|neuronal action potential (GO:0019228)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell proliferation (GO:0008284)|positive regulation of heart rate involved in baroreceptor response to decreased systemic arterial blood pressure (GO:0001988)|regulation of norepinephrine secretion (GO:0014061)|regulation of synaptic transmission, dopaminergic (GO:0032225)|response to food (GO:0032094)|response to hypoxia (GO:0001666)|response to nicotine (GO:0035094)|signal transduction (GO:0007165)|sperm motility (GO:0030317)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)|T cell activation (GO:0042110)	acetylcholine-gated channel complex (GO:0005892)|apical plasma membrane (GO:0016324)|asymmetric synapse (GO:0032279)|axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|external side of plasma membrane (GO:0009897)|growth cone (GO:0030426)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	acetylcholine binding (GO:0042166)|acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|acetylcholine-gated cation channel activity (GO:0022848)|beta-amyloid binding (GO:0001540)|chloride channel regulator activity (GO:0017081)|drug binding (GO:0008144)|protein homodimerization activity (GO:0042803)|toxic substance binding (GO:0015643)			endometrium(3)|large_intestine(1)|lung(6)|ovary(2)	12		all_lung(180;6.35e-11)		all cancers(64;3.34e-21)|Epithelial(43;2.64e-15)|GBM - Glioblastoma multiforme(186;5.17e-06)|BRCA - Breast invasive adenocarcinoma(123;0.00112)|Lung(196;0.227)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Dextromethorphan(DB00514)|Galantamine(DB00674)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Nicotine(DB00184)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)|Varenicline(DB01273)	TCCTGCACGGCGGGCAACCCC	0.692																																					Esophageal Squamous(193;529 2900 40232 43193)												0													2.0	3.0	3.0					15																	32460419		1370	3021	4391	SO:0001819	synonymous_variant	1139			Z23141	CCDS10027.1, CCDS53924.1	15q13.3	2012-02-11	2012-02-07		ENSG00000175344	ENSG00000175344		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1960	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 7 (neuronal)"""	118511	"""cholinergic receptor, nicotinic, alpha polypeptide 7"""			8188270	Standard	NM_001190455		Approved		uc021sic.2	P36544	OTTHUMG00000129285	ENST00000306901.3:c.1269C>T	15.37:g.32460419C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7Q4|B4DFS0|Q15826|Q8IUZ4|Q96RH2|Q99555|Q9BXH0	Silent	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.G452	ENST00000306901.3	37	c.1356	CCDS10027.1	15																																																																																			CHRNA7	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,tigrfam_Neur_channel		0.692	CHRNA7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CHRNA7	HGNC	protein_coding	OTTHUMT00000251410.2	C			32460419	+1	no_errors	ENST00000454250	ensembl	human	known	70_37	silent	SNP	0.001	T
CIITA	4261	genome.wustl.edu	37	16	11001770	11001770	+	Silent	SNP	G	G	T	rs34654419	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:11001770G>T	ENST00000324288.8	+	11	2554	c.2421G>T	c.(2419-2421)ctG>ctT	p.L807L	CIITA_ENST00000537380.1_Intron|CIITA_ENST00000381835.5_Intron	NM_000246.3	NP_000237	P33076	C2TA_HUMAN	class II, major histocompatibility complex, transactivator	807					aging (GO:0007568)|cellular response to electrical stimulus (GO:0071257)|cellular response to exogenous dsRNA (GO:0071360)|cytokine-mediated signaling pathway (GO:0019221)|immune response (GO:0006955)|inflammatory response (GO:0006954)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of MHC class II biosynthetic process (GO:0045348)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to antibiotic (GO:0046677)|response to interferon-gamma (GO:0034341)|transcription, DNA-templated (GO:0006351)	cell surface (GO:0009986)|nucleoplasm (GO:0005654)|PML body (GO:0016605)	activating transcription factor binding (GO:0033613)|ATP binding (GO:0005524)|GTP binding (GO:0005525)|kinase activity (GO:0016301)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|transcription coactivator activity (GO:0003713)|transcription regulatory region DNA binding (GO:0044212)|transferase activity, transferring acyl groups (GO:0016746)	p.L807L(1)		central_nervous_system(1)|large_intestine(7)|ovary(1)|skin(1)|stomach(2)	12						GGCAGCTGCTGGAGCTGCTGC	0.687			T	"""FLJ27352, CD274, CD273, RALGDS, RUNDC2A, C16orf75, BCL6"""	"""PMBL, Hodgkin Lymphona, """								G|||	1081	0.215855	0.2057	0.3876	5008	,	,		12685	0.1329		0.1869	False		,,,				2504	0.2229							Dom	yes		16	16p13	4261	"""class II, major histocompatibility complex, transactivator"""		L	1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)						G		828,3494		88,652,1421	19.0	27.0	24.0		2421	2.8	1.0	16	dbSNP_126	24	1706,6752		189,1328,2712	no	coding-synonymous	CIITA	NM_000246.3		277,1980,4133	TT,TG,GG		20.1703,19.1578,19.8279		807/1131	11001770	2534,10246	2161	4229	6390	SO:0001819	synonymous_variant	4261			U18259	CCDS10544.1, CCDS66943.1, CCDS73826.1	16p13	2014-09-17	2005-08-12	2005-08-12	ENSG00000179583	ENSG00000179583		"""Nucleotide-binding domain and leucine rich repeat containing"""	7067	protein-coding gene	gene with protein product	"""NLR family, acid domain containing"", ""nucleotide-binding oligomerization domain, leucine rich repeat and acid domain containing"""	600005	"""MHC class II transactivator"""	MHC2TA		8402893	Standard	NM_000246		Approved	C2TA, NLRA	uc002dai.4	P33076	OTTHUMG00000129753	ENST00000324288.8:c.2421G>T	16.37:g.11001770G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0N0N9|D3DUG0|E9PFE0|Q29675|Q8SNB8|Q96KL4	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,prints_MHC_II_transact	p.L807	ENST00000324288.8	37	c.2421	CCDS10544.1	16																																																																																			CIITA	-	NULL		0.687	CIITA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIITA	HGNC	protein_coding	OTTHUMT00000251966.2	G	NM_000246		11001770	+1	no_errors	ENST00000324288	ensembl	human	known	70_37	silent	SNP	1.000	T
CKAP5	9793	genome.wustl.edu	37	11	46771944	46771944	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:46771944C>T	ENST00000529230.1	-	42	5630	c.5584G>A	c.(5584-5586)Gat>Aat	p.D1862N	CKAP5_ENST00000354558.3_Missense_Mutation_p.D1802N|CKAP5_ENST00000415402.1_Missense_Mutation_p.D1869N|CKAP5_ENST00000312055.5_Missense_Mutation_p.D1802N|MIR5582_ENST00000579697.1_RNA			Q14008	CKAP5_HUMAN	cytoskeleton associated protein 5	1862					centrosome organization (GO:0051297)|establishment or maintenance of microtubule cytoskeleton polarity (GO:0030951)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|RNA transport (GO:0050658)|spindle organization (GO:0007051)	centrosome (GO:0005813)|cytosol (GO:0005829)|membrane (GO:0016020)|protein complex (GO:0043234)|spindle pole (GO:0000922)				breast(1)|cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(13)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	43						ATGTCAGCATCTGAGTATTTC	0.438																																					Ovarian(4;85 273 2202 4844 13323)												0													116.0	112.0	113.0					11																	46771944		2201	4299	6500	SO:0001583	missense	9793				CCDS7924.1, CCDS31477.1	11p11.2	2006-09-20			ENSG00000175216	ENSG00000175216			28959	protein-coding gene	gene with protein product		611142				7788527, 8536682	Standard	NM_014756		Approved	ch-TOG, KIAA0097, TOG, TOGp	uc001ndi.2	Q14008	OTTHUMG00000166599	ENST00000529230.1:c.5584G>A	11.37:g.46771944C>T	ENSP00000432768:p.Asp1862Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05D70|Q0VAX7|Q0VAX8|Q14668|Q2TA89|Q6NSH4	Missense_Mutation	SNP	pfam_CLASP_N_dom,pfam_HEAT,superfamily_ARM-type_fold,pfscan_HEAT_type_2	p.D1869N	ENST00000529230.1	37	c.5605	CCDS31477.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	35|35	5.455797|5.455797	0.96223|0.96223	.|.	.|.	ENSG00000175216|ENSG00000175216	ENST00000529230;ENST00000415402;ENST00000312055;ENST00000354558|ENST00000525896	T;T;T;T|.	0.68765|.	-0.35;-0.35;0.83;0.83|.	5.58|5.58	5.58|5.58	0.84498|0.84498	Armadillo-like helical (1);Armadillo-type fold (1);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.73118|0.73118	0.3546|0.3546	L|L	0.58810|0.58810	1.83|1.83	0.80722|0.80722	D|D	1|1	D;D;D|.	0.67145|.	0.996;0.987;0.978|.	P;P;P|.	0.61874|.	0.895;0.811;0.651|.	T|T	0.69738|0.69738	-0.5064|-0.5064	10|5	0.46703|.	T|.	0.11|.	-33.382|-33.382	19.6419|19.6419	0.95762|0.95762	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1869;1802;1862|.	Q14008-3;Q14008-2;Q14008|.	.;.;CKAP5_HUMAN|.	N|K	1862;1869;1802;1802|100	ENSP00000432768:D1862N;ENSP00000395302:D1869N;ENSP00000310227:D1802N;ENSP00000346566:D1802N|.	ENSP00000310227:D1802N|.	D|R	-|-	1|2	0|0	CKAP5|CKAP5	46728520|46728520	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.993000|0.993000	0.82548|0.82548	7.487000|7.487000	0.81328|0.81328	2.649000|2.649000	0.89929|0.89929	0.549000|0.549000	0.68633|0.68633	GAT|AGA	CKAP5	-	superfamily_ARM-type_fold		0.438	CKAP5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP5	HGNC	protein_coding	OTTHUMT00000390679.1	C	NM_014756		46771944	-1	no_errors	ENST00000415402	ensembl	human	known	70_37	missense	SNP	1.000	T
CLEC4F	165530	genome.wustl.edu	37	2	71046981	71046981	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:71046981G>A	ENST00000272367.2	-	2	180	c.104C>T	c.(103-105)cCg>cTg	p.P35L	CLEC4F_ENST00000426626.1_Missense_Mutation_p.P35L	NM_001258027.1|NM_173535.2	NP_001244956.1|NP_775806.2	Q8N1N0	CLC4F_HUMAN	C-type lectin domain family 4, member F	35					endocytosis (GO:0006897)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)			endometrium(1)|large_intestine(5)|lung(18)|ovary(5)|prostate(5)|skin(1)|upper_aerodigestive_tract(2)	37						AACGAGCCTCGGTATCTTGGG	0.572																																					Colon(107;10 2157 6841 26035)												0													56.0	55.0	55.0					2																	71046981		2203	4300	6503	SO:0001583	missense	165530			AK096429	CCDS1910.1	2p13.3	2008-02-05	2005-02-09	2005-02-11	ENSG00000152672	ENSG00000152672		"""C-type lectin domain containing"""	25357	protein-coding gene	gene with protein product			"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 13"""	CLECSF13		8889548, 1846367	Standard	NM_001258027		Approved	FLJ39110, KCLR	uc002shf.3	Q8N1N0	OTTHUMG00000129713	ENST00000272367.2:c.104C>T	2.37:g.71046981G>A	ENSP00000272367:p.Pro35Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A4QPA5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,superfamily_Prefoldin,smart_C-type_lectin,prints_AntifreezeII,pfscan_C-type_lectin	p.P35L	ENST00000272367.2	37	c.104	CCDS1910.1	2	.	.	.	.	.	.	.	.	.	.	G	8.326	0.825405	0.16749	.	.	ENSG00000152672	ENST00000272367;ENST00000426626	T;T	0.01406	4.99;4.93	4.66	-4.46	0.03536	.	1.064270	0.07499	N	0.906908	T	0.00695	0.0023	N	0.14661	0.345	0.09310	N	1	B;B	0.10296	0.003;0.003	B;B	0.04013	0.001;0.001	T	0.48031	-0.9070	10	0.02654	T	1	.	0.2565	0.00212	0.2518:0.2464:0.2516:0.2503	.	35;35	B7ZMM1;Q8N1N0	.;CLC4F_HUMAN	L	35	ENSP00000272367:P35L;ENSP00000390581:P35L	ENSP00000272367:P35L	P	-	2	0	CLEC4F	70900489	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.033000	0.03571	-1.097000	0.03042	0.467000	0.42956	CCG	CLEC4F	-	NULL		0.572	CLEC4F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLEC4F	HGNC	protein_coding	OTTHUMT00000251922.1	G	NM_173535		71046981	-1	no_errors	ENST00000272367	ensembl	human	known	70_37	missense	SNP	0.000	A
CLIP2	7461	genome.wustl.edu	37	7	73815874	73815874	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:73815874C>G	ENST00000395060.1	+	15	3106	c.3106C>G	c.(3106-3108)Cag>Gag	p.Q1036E	CLIP2_ENST00000223398.6_Missense_Mutation_p.Q1036E|CLIP2_ENST00000361545.5_Missense_Mutation_p.Q1001E			Q9UDT6	CLIP2_HUMAN	CAP-GLY domain containing linker protein 2	1036						cytoplasmic microtubule (GO:0005881)|microtubule associated complex (GO:0005875)|microtubule plus-end (GO:0035371)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(13)|pancreas(1)|prostate(2)|skin(3)	30						CATCCACCAGCAGGACAAAGC	0.577											OREG0018117	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													67.0	51.0	56.0					7																	73815874		2203	4300	6503	SO:0001583	missense	7461			AB006629	CCDS5569.1, CCDS5570.1	7q11.23	2008-06-12	2007-01-04	2007-01-04	ENSG00000106665	ENSG00000106665			2586	protein-coding gene	gene with protein product		603432	"""cytoplasmic linker 2"", ""Williams-Beuren syndrome chromosome region 3"""	WBSCR4, CYLN2, WBSCR3		8812460, 9799601	Standard	NM_003388		Approved	CLIP-115, KIAA0291, WSCR4, CLIP, WSCR3	uc003uam.3	Q9UDT6	OTTHUMG00000022980	ENST00000395060.1:c.3106C>G	7.37:g.73815874C>G	ENSP00000378500:p.Gln1036Glu	Somatic	1148	WXS	Illumina HiSeq	Phase_IV	O14527|O43611	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_t-SNARE,pfscan_CAP-Gly_domain	p.Q1036E	ENST00000395060.1	37	c.3106	CCDS5569.1	7	.	.	.	.	.	.	.	.	.	.	C	9.605	1.129826	0.21041	.	.	ENSG00000106665	ENST00000539676;ENST00000223398;ENST00000361545;ENST00000395060	T;T;T	0.62788	0.0;-0.0;0.0	3.94	3.94	0.45596	.	0.291502	0.33382	N	0.004961	T	0.42787	0.1218	N	0.11560	0.145	0.24898	N	0.992123	B;B	0.09022	0.002;0.001	B;B	0.08055	0.003;0.001	T	0.28170	-1.0052	10	0.31617	T	0.26	-0.9363	15.0006	0.71469	0.0:1.0:0.0:0.0	.	1001;1036	Q9UDT6-2;Q9UDT6	.;CLIP2_HUMAN	E	1036;1036;1001;1036	ENSP00000223398:Q1036E;ENSP00000355151:Q1001E;ENSP00000378500:Q1036E	ENSP00000223398:Q1036E	Q	+	1	0	CLIP2	73453810	1.000000	0.71417	0.999000	0.59377	0.432000	0.31715	4.035000	0.57297	1.960000	0.56953	0.456000	0.33151	CAG	CLIP2	-	NULL		0.577	CLIP2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CLIP2	HGNC	protein_coding	OTTHUMT00000252556.1	C	NM_003388		73815874	+1	no_errors	ENST00000223398	ensembl	human	known	70_37	missense	SNP	1.000	G
COG1	9382	genome.wustl.edu	37	17	71193055	71193055	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:71193055G>A	ENST00000299886.4	+	3	657	c.577G>A	c.(577-579)Gaa>Aaa	p.E193K	RP11-143K11.5_ENST00000580671.1_RNA	NM_018714.2	NP_061184.1	Q8WTW3	COG1_HUMAN	component of oligomeric golgi complex 1	193					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|protein transport (GO:0015031)	Golgi apparatus (GO:0005794)|Golgi transport complex (GO:0017119)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	18			LUSC - Lung squamous cell carcinoma(166;0.197)			TATTCTGCATGAAAGCAAGAT	0.463																																																	0													71.0	72.0	72.0					17																	71193055		2203	4300	6503	SO:0001583	missense	9382				CCDS11692.1	17q25.1	2008-05-14	2002-05-28	2002-05-31		ENSG00000166685		"""Components of oligomeric golgi complex"""	6545	protein-coding gene	gene with protein product		606973	"""low density lipoprotein receptor defect B complementing"""	LDLB		9927668	Standard	NM_018714		Approved	KIAA1381	uc002jjg.3	Q8WTW3		ENST00000299886.4:c.577G>A	17.37:g.71193055G>A	ENSP00000299886:p.Glu193Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NPV9|Q9P2G6	Missense_Mutation	SNP	pfam_Vps51	p.E193K	ENST00000299886.4	37	c.577	CCDS11692.1	17	.	.	.	.	.	.	.	.	.	.	G	15.14	2.745488	0.49151	.	.	ENSG00000166685	ENST00000438720;ENST00000299886	T;T	0.21932	1.98;1.98	5.4	5.4	0.78164	.	0.108682	0.64402	D	0.000009	T	0.21347	0.0514	L	0.38175	1.15	0.80722	D	1	D;B;D	0.54601	0.967;0.224;0.967	P;B;P	0.45971	0.499;0.152;0.499	T	0.02477	-1.1153	10	0.08179	T	0.78	-11.3422	19.1592	0.93524	0.0:0.0:1.0:0.0	.	193;193;193	E9PBL8;Q8WTW3;Q4G0L8	.;COG1_HUMAN;.	K	193	ENSP00000400111:E193K;ENSP00000299886:E193K	ENSP00000299886:E193K	E	+	1	0	COG1	68704650	1.000000	0.71417	0.964000	0.40570	0.539000	0.34962	7.415000	0.80131	2.537000	0.85549	0.655000	0.94253	GAA	COG1	-	NULL		0.463	COG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COG1	HGNC	protein_coding	OTTHUMT00000441638.1	G			71193055	+1	no_errors	ENST00000299886	ensembl	human	known	70_37	missense	SNP	1.000	A
COL22A1	169044	genome.wustl.edu	37	8	139668160	139668160	+	Missense_Mutation	SNP	C	C	T	rs372159699		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:139668160C>T	ENST00000303045.6	-	45	3759	c.3313G>A	c.(3313-3315)Gac>Aac	p.D1105N	COL22A1_ENST00000435777.1_Missense_Mutation_p.D1085N|COL22A1_ENST00000341807.4_5'UTR	NM_152888.1	NP_690848.1	Q8NFW1	COMA1_HUMAN	collagen, type XXII, alpha 1	1105	Gly-rich.|Pro-rich.				extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(14)|large_intestine(29)|lung(107)|ovary(13)|pancreas(1)|prostate(3)|skin(12)|upper_aerodigestive_tract(15)|urinary_tract(4)	211	all_epithelial(106;1.55e-12)|Lung NSC(106;1.67e-05)|all_lung(105;3.39e-05)|Ovarian(258;0.00672)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0517)			AGATTTATGTCCCCTGGAGAC	0.388										HNSCC(7;0.00092)																																							0								C	ASN/ASP	0,4406		0,0,2203	205.0	209.0	207.0		3313	4.4	1.0	8		207	1,8599	1.2+/-3.3	0,1,4299	no	missense	COL22A1	NM_152888.1	23	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1105/1627	139668160	1,13005	2203	4300	6503	SO:0001583	missense	169044			AF406780	CCDS6376.1	8q24.3	2013-01-16			ENSG00000169436	ENSG00000169436		"""Collagens"""	22989	protein-coding gene	gene with protein product		610026					Standard	NM_152888		Approved		uc003yvd.3	Q8NFW1	OTTHUMG00000150035	ENST00000303045.6:c.3313G>A	8.37:g.139668160C>T	ENSP00000303153:p.Asp1105Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZMH0|C9K0G4|Q8IVT9	Missense_Mutation	SNP	pfam_Collagen,pfam_VWF_A,superfamily_ConA-like_lec_gl_sf,smart_VWF_A,smart_Laminin_G,pfscan_VWF_A	p.D1105N	ENST00000303045.6	37	c.3313	CCDS6376.1	8	.	.	.	.	.	.	.	.	.	.	C	13.75	2.329893	0.41297	0.0	1.16E-4	ENSG00000169436	ENST00000303045;ENST00000435777;ENST00000545577	D;D	0.96136	-3.38;-3.92	5.28	4.41	0.53225	.	0.000000	0.52532	D	0.000069	D	0.95598	0.8569	L	0.37561	1.115	0.42538	D	0.993064	D;D	0.71674	0.998;0.996	D;P	0.68765	0.96;0.877	D	0.95663	0.8717	10	0.62326	D	0.03	.	12.0488	0.53495	0.0:0.9153:0.0:0.0847	.	1085;1105	Q8NFW1-2;Q8NFW1	.;COMA1_HUMAN	N	1105;1085;798	ENSP00000303153:D1105N;ENSP00000387655:D1085N	ENSP00000303153:D1105N	D	-	1	0	COL22A1	139737342	0.999000	0.42202	1.000000	0.80357	0.696000	0.40369	4.700000	0.61803	1.376000	0.46267	-0.140000	0.14226	GAC	COL22A1	-	NULL		0.388	COL22A1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL22A1	HGNC	protein_coding	OTTHUMT00000315905.2	C	XM_291257		139668160	-1	no_errors	ENST00000303045	ensembl	human	known	70_37	missense	SNP	1.000	T
COL4A1	1282	genome.wustl.edu	37	13	110850842	110850842	+	Silent	SNP	A	A	G	rs995224	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr13:110850842A>G	ENST00000375820.4	-	21	1378	c.1257T>C	c.(1255-1257)ccT>ccC	p.P419P	COL4A1_ENST00000543140.1_Silent_p.P419P	NM_001845.4	NP_001836.2	P02462	CO4A1_HUMAN	collagen, type IV, alpha 1	419	Triple-helical region.				axon guidance (GO:0007411)|basement membrane organization (GO:0071711)|blood vessel morphogenesis (GO:0048514)|brain development (GO:0007420)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|epithelial cell differentiation (GO:0030855)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)|patterning of blood vessels (GO:0001569)|renal tubule morphogenesis (GO:0061333)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)	extracellular matrix constituent conferring elasticity (GO:0030023)|extracellular matrix structural constituent (GO:0005201)|platelet-derived growth factor binding (GO:0048407)			breast(2)|central_nervous_system(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(57)|ovary(4)|pancreas(1)|prostate(4)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	105	all_cancers(4;9.8e-13)|all_epithelial(4;9.66e-08)|all_lung(23;3.75e-06)|Lung NSC(43;0.000274)|Colorectal(4;0.00178)|all_neural(89;0.00459)|Medulloblastoma(90;0.00596)|Lung SC(71;0.0604)	Breast(118;0.2)	BRCA - Breast invasive adenocarcinoma(86;0.11)|all cancers(43;0.145)			CAGGGGGCCCAGGGGAACCAG	0.592													a|||	1034	0.20647	0.2073	0.3732	5008	,	,		16322	0.0546		0.2664	False		,,,				2504	0.182																0										950,3456	326.9+/-299.8	107,736,1360	45.0	53.0	50.0		1257	-6.4	0.0	13	dbSNP_86	50	2334,6266	360.6+/-332.0	332,1670,2298	no	coding-synonymous	COL4A1	NM_001845.4		439,2406,3658	GG,GA,AA		27.1395,21.5615,25.2499		419/1670	110850842	3284,9722	2203	4300	6503	SO:0001819	synonymous_variant	1282			J04217	CCDS9511.1	13q34	2013-09-05			ENSG00000187498	ENSG00000187498		"""Collagens"""	2202	protein-coding gene	gene with protein product		120130				3691802	Standard	NM_001845		Approved		uc001vqw.4	P02462	OTTHUMG00000017342	ENST00000375820.4:c.1257T>C	13.37:g.110850842A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2W4|B1AM70|Q1P9S9|Q5VWF6|Q86X41|Q8NF88|Q9NYC5	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.P419	ENST00000375820.4	37	c.1257	CCDS9511.1	13																																																																																			COL4A1	-	pfam_Collagen		0.592	COL4A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL4A1	HGNC	protein_coding	OTTHUMT00000045759.3	A			110850842	-1	no_errors	ENST00000375820	ensembl	human	known	70_37	silent	SNP	0.046	G
COL6A2	1292	genome.wustl.edu	37	21	47537804	47537804	+	Missense_Mutation	SNP	C	C	G	rs199929757	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr21:47537804C>G	ENST00000300527.4	+	12	1174	c.1070C>G	c.(1069-1071)cCg>cGg	p.P357R	COL6A2_ENST00000409416.1_Missense_Mutation_p.P357R|COL6A2_ENST00000310645.5_Missense_Mutation_p.P357R|COL6A2_ENST00000357838.4_Missense_Mutation_p.P357R|COL6A2_ENST00000397763.1_Missense_Mutation_p.P357R	NM_001849.3	NP_001840.3	P12110	CO6A2_HUMAN	collagen, type VI, alpha 2	357	Triple-helical region.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|protein heterotrimerization (GO:0070208)|response to glucose (GO:0009749)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)|vesicle (GO:0031982)				NS(1)|breast(1)|central_nervous_system(7)|endometrium(7)|kidney(5)|liver(1)|lung(15)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	43	Breast(49;0.245)			Colorectal(79;0.0303)|READ - Rectum adenocarcinoma(84;0.0649)		GACGGTTACCCGGGGGAAGCA	0.682													C|||	3	0.000599042	0.0	0.0014	5008	,	,		16264	0.0		0.002	False		,,,				2504	0.0																0								C	ARG/PRO,ARG/PRO,ARG/PRO	2,4388	2.1+/-5.4	0,2,2193	50.0	48.0	48.0		1070,1070,1070	2.6	0.1	21		48	14,8574	9.1+/-34.3	0,14,4280	yes	missense,missense,missense	COL6A2	NM_001849.3,NM_058174.2,NM_058175.2	103,103,103	0,16,6473	GG,GC,CC		0.163,0.0456,0.1233	benign,benign,benign	357/1020,357/919,357/829	47537804	16,12962	2195	4294	6489	SO:0001583	missense	1292			M20777	CCDS13728.1, CCDS13729.1, CCDS13730.1	21q22.3	2014-09-17			ENSG00000142173	ENSG00000142173		"""Collagens"""	2212	protein-coding gene	gene with protein product		120240					Standard	NM_001849		Approved		uc002zia.1	P12110	OTTHUMG00000090489	ENST00000300527.4:c.1070C>G	21.37:g.47537804C>G	ENSP00000300527:p.Pro357Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13909|Q13910|Q13911|Q14048|Q14049|Q16259|Q16597|Q6P0Q1|Q9UML3|Q9Y4S8	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.P357R	ENST00000300527.4	37	c.1070	CCDS13728.1	21	.	.	.	.	.	.	.	.	.	.	C	2.941	-0.218840	0.06101	4.56E-4	0.00163	ENSG00000142173	ENST00000300527;ENST00000357838;ENST00000310645;ENST00000409416;ENST00000397763	D;D;D;D;D	0.96885	-4.16;-4.16;-4.16;-4.16;-4.16	4.46	2.59	0.31030	.	0.302904	0.36303	N	0.002665	D	0.94463	0.8218	L	0.46741	1.465	0.49915	D	0.999832	P;P;B	0.44877	0.81;0.845;0.111	P;P;B	0.47626	0.552;0.504;0.103	D	0.91557	0.5261	10	0.44086	T	0.13	-0.2304	9.7478	0.40457	0.0:0.8421:0.0:0.1579	.	357;357;357	P12110;P12110-2;P12110-3	CO6A2_HUMAN;.;.	R	357	ENSP00000300527:P357R;ENSP00000350497:P357R;ENSP00000312529:P357R;ENSP00000387115:P357R;ENSP00000380870:P357R	ENSP00000300527:P357R	P	+	2	0	COL6A2	46362232	0.902000	0.30710	0.087000	0.20705	0.104000	0.19210	2.090000	0.41682	0.411000	0.25702	0.305000	0.20034	CCG	COL6A2	-	pfam_Collagen		0.682	COL6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A2	HGNC	protein_coding	OTTHUMT00000206971.1	C			47537804	+1	no_errors	ENST00000300527	ensembl	human	known	70_37	missense	SNP	0.966	G
COPE	11316	genome.wustl.edu	37	19	19021788	19021788	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:19021788C>A	ENST00000262812.4	-	3	330	c.282G>T	c.(280-282)gaG>gaT	p.E94D	AC002985.3_ENST00000596918.1_3'UTR|COPE_ENST00000349893.4_Missense_Mutation_p.E94D|COPE_ENST00000598969.1_5'UTR|COPE_ENST00000351079.4_Missense_Mutation_p.E94D|COPE_ENST00000600932.1_Missense_Mutation_p.E94D	NM_007263.3	NP_009194.2	O14579	COPE_HUMAN	coatomer protein complex, subunit epsilon	94					COPI coating of Golgi vesicle (GO:0048205)|intra-Golgi vesicle-mediated transport (GO:0006891)|membrane organization (GO:0061024)|protein transport (GO:0015031)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)	COPI vesicle coat (GO:0030126)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	structural molecule activity (GO:0005198)			breast(1)|central_nervous_system(2)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	11						ACCTCCGACTCTCGTGGGCGA	0.627																																																	0													92.0	80.0	84.0					19																	19021788		2203	4300	6503	SO:0001583	missense	11316			AJ131182	CCDS12387.1, CCDS12388.1, CCDS12389.1	19p13.11	2008-02-05				ENSG00000105669			2234	protein-coding gene	gene with protein product		606942				10469566	Standard	NM_007263		Approved	epsilon-COP	uc002nkk.3	O14579		ENST00000262812.4:c.282G>T	19.37:g.19021788C>A	ENSP00000262812:p.Glu94Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NE29|A6NKA3|O76097|Q6IBB8|Q9UGP6	Missense_Mutation	SNP	pfam_Coatomer_esu,pirsf_Coatomer_esu	p.E94D	ENST00000262812.4	37	c.282	CCDS12387.1	19	.	.	.	.	.	.	.	.	.	.	C	3.006	-0.205049	0.06180	.	.	ENSG00000105669	ENST00000262812;ENST00000351079;ENST00000349893;ENST00000538245	T;T;T	0.39229	1.09;1.09;1.09	4.8	1.01	0.19927	.	0.184840	0.48767	N	0.000178	T	0.18257	0.0438	N	0.16066	0.365	0.45307	D	0.998303	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.10450	0.005;0.005;0.005;0.005	T	0.06356	-1.0831	10	0.11485	T	0.65	-28.9307	4.0939	0.09982	0.1348:0.5553:0.18:0.13	.	94;94;94;94	Q53HJ6;A6NE29;A6NKA3;O14579	.;.;.;COPE_HUMAN	D	94;94;94;93	ENSP00000262812:E94D;ENSP00000345674:E94D;ENSP00000343134:E94D	ENSP00000262812:E94D	E	-	3	2	COPE	18882788	0.773000	0.28580	0.612000	0.29024	0.224000	0.24922	0.436000	0.21526	0.409000	0.25649	0.514000	0.50259	GAG	COPE	-	pfam_Coatomer_esu,pirsf_Coatomer_esu		0.627	COPE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COPE	HGNC	protein_coding	OTTHUMT00000464801.1	C	NM_007263		19021788	-1	no_errors	ENST00000262812	ensembl	human	known	70_37	missense	SNP	0.940	A
CORO6	84940	genome.wustl.edu	37	17	27943318	27943318	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:27943318G>A	ENST00000445145.2	-	8	1042	c.1041C>T	c.(1039-1041)atC>atT	p.I347I	RP11-68I3.2_ENST00000581474.1_RNA|CORO6_ENST00000577909.1_5'UTR|CORO6_ENST00000580212.1_Silent_p.I307I|CORO6_ENST00000388767.3_Silent_p.I347I|CORO6_ENST00000345068.5_Silent_p.I347I|CORO6_ENST00000456796.3_Silent_p.I113I|CORO6_ENST00000584969.1_Silent_p.I347I			Q6QEF8	CORO6_HUMAN	coronin 6	347					actin cytoskeleton organization (GO:0030036)	actin cytoskeleton (GO:0015629)	actin filament binding (GO:0051015)			breast(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(2)	14						CAGTCATGATGATAGGTTCAC	0.572																																																	0													72.0	61.0	65.0					17																	27943318		2201	4300	6501	SO:0001819	synonymous_variant	84940			AF193039	CCDS11252.2	17q11.2	2013-01-10			ENSG00000167549	ENSG00000167549		"""Coronins"", ""WD repeat domain containing"""	21356	protein-coding gene	gene with protein product							Standard	NM_032854		Approved	FLJ14871	uc002hel.2	Q6QEF8	OTTHUMG00000132732	ENST00000445145.2:c.1041C>T	17.37:g.27943318G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU26|Q71MF3|Q8WYH7|Q96K02	Silent	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I347	ENST00000445145.2	37	c.1041		17																																																																																			CORO6	-	pfam_DUF1900		0.572	CORO6-202	KNOWN	basic|appris_candidate_longest	protein_coding	CORO6	HGNC	protein_coding	OTTHUMT00000447831.1	G	NM_032854		27943318	-1	no_errors	ENST00000345068	ensembl	human	known	70_37	silent	SNP	1.000	A
CPEB2	132864	genome.wustl.edu	37	4	15004504	15004504	+	5'Flank	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:15004504C>T	ENST00000507071.1	+	0	0				CPEB2_ENST00000345451.3_5'Flank|CPEB2_ENST00000382395.3_5'Flank|RP11-665G4.1_ENST00000502344.1_RNA|CPEB2_ENST00000259997.5_5'Flank|CPEB2_ENST00000541112.1_Silent_p.L69L|CPEB2_ENST00000382401.3_5'Flank|CPEB2_ENST00000538197.1_Silent_p.L69L|CPEB2_ENST00000442003.2_Silent_p.L69L			Q7Z5Q1	CPEB2_HUMAN	cytoplasmic polyadenylation element binding protein 2						cellular response to arsenic-containing substance (GO:0071243)|cellular response to hypoxia (GO:0071456)|cellular response to insulin stimulus (GO:0032869)|cellular response to oxidative stress (GO:0034599)|negative regulation of cytoplasmic translation (GO:2000766)|negative regulation of cytoplasmic translational elongation (GO:1900248)|negative regulation of GTPase activity (GO:0034260)	cytoplasm (GO:0005737)|messenger ribonucleoprotein complex (GO:1990124)|nucleus (GO:0005634)	GTPase inhibitor activity (GO:0005095)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|ribosomal large subunit binding (GO:0043023)|ribosomal small subunit binding (GO:0043024)|ribosome binding (GO:0043022)|translation repressor activity, nucleic acid binding (GO:0000900)			autonomic_ganglia(1)|breast(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(4)|prostate(1)|skin(3)	14						CCGTCCCCCTcggcggcggcg	0.711																																																	0																																										SO:0001631	upstream_gene_variant	132864			AY247744	CCDS56325.1, CCDS56326.1	4p15.33	2013-02-12			ENSG00000137449	ENSG00000137449		"""RNA binding motif (RRM) containing"""	21745	protein-coding gene	gene with protein product		610605				12672660	Standard	NM_182485		Approved		uc003gnk.2	Q7Z5Q1	OTTHUMG00000090669		4.37:g.15004504C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	E7EPM3|F5H160|Q3B8N6|Q3MI89|Q3MI90|Q3MI92|Q7Z5Q0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L69	ENST00000507071.1	37	c.207		4																																																																																			CPEB2	-	NULL		0.711	CPEB2-001	KNOWN	basic|appris_candidate	protein_coding	CPEB2	HGNC	protein_coding	OTTHUMT00000207349.2	C	XM_059607		15004504	+1	no_errors	ENST00000538197	ensembl	human	known	70_37	silent	SNP	0.900	T
CRAMP1L	57585	genome.wustl.edu	37	16	1720687	1720687	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:1720687G>A	ENST00000397412.3	+	20	3621	c.3522G>A	c.(3520-3522)aaG>aaA	p.K1174K	CRAMP1L_ENST00000262317.4_Silent_p.K549K|CRAMP1L_ENST00000436138.3_Silent_p.K1171K|LA16c-431H6.6_ENST00000454337.1_3'UTR|CRAMP1L_ENST00000293925.5_Silent_p.K1174K			Q96RY5	CRML_HUMAN	Crm, cramped-like (Drosophila)	1174	Ser-rich.					nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)			NS(2)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(6)|pancreas(1)	22						CCCCAGAGAAGAGCCGGAAGA	0.572																																																	0													150.0	154.0	153.0					16																	1720687		1963	4151	6114	SO:0001819	synonymous_variant	57585			AB037847	CCDS10440.2	16p13.3	2008-07-30	2001-11-28		ENSG00000007545	ENSG00000007545			14122	protein-coding gene	gene with protein product			"""Crm (Cramped Drosophila)-like"""				Standard	NM_020825		Approved	KIAA1426	uc010uvh.2	Q96RY5	OTTHUMG00000074087	ENST00000397412.3:c.3522G>A	16.37:g.1720687G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MZL1|B1AJY1|Q8NDN1|Q9P2C1	Silent	SNP	superfamily_Homeodomain-like,smart_SANT/Myb	p.K1174	ENST00000397412.3	37	c.3522	CCDS10440.2	16																																																																																			CRAMP1L	-	NULL		0.572	CRAMP1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRAMP1L	HGNC	protein_coding	OTTHUMT00000157297.4	G			1720687	+1	no_errors	ENST00000293925	ensembl	human	known	70_37	silent	SNP	1.000	A
CRB1	23418	genome.wustl.edu	37	1	197404045	197404045	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:197404045T>C	ENST00000367400.3	+	9	3187	c.3052T>C	c.(3052-3054)Ttt>Ctt	p.F1018L	CRB1_ENST00000544212.1_Missense_Mutation_p.F499L|CRB1_ENST00000367399.2_Missense_Mutation_p.F906L|CRB1_ENST00000538660.1_Intron|CRB1_ENST00000367397.1_Missense_Mutation_p.F399L|CRB1_ENST00000535699.1_Missense_Mutation_p.F994L	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	1018	Laminin G-like 3. {ECO:0000255|PROSITE- ProRule:PRU00122}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						TGGCAACAGCTTTTATATGCT	0.403																																																	0													69.0	73.0	72.0					1																	197404045		2203	4300	6503	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.3052T>C	1.37:g.197404045T>C	ENSP00000356370:p.Phe1018Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.F1018L	ENST00000367400.3	37	c.3052	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	T	5.287	0.238437	0.10023	.	.	ENSG00000134376	ENST00000535699;ENST00000367400;ENST00000367399;ENST00000544212;ENST00000367397;ENST00000367401	T;T;T;T;T	0.77229	-1.08;-1.08;-1.08;-1.08;-1.08	5.44	1.76	0.24704	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	.	.	.	.	T	0.62073	0.2398	L	0.38531	1.155	0.20975	N	0.999813	P;P;B;P	0.38617	0.587;0.587;0.009;0.64	B;B;B;B	0.36567	0.146;0.146;0.013;0.228	T	0.50110	-0.8866	9	0.30854	T	0.27	.	2.4482	0.04511	0.2619:0.07:0.137:0.5312	.	994;906;667;1018	F5H0L2;P82279-3;P82279-4;P82279	.;.;.;CRUM1_HUMAN	L	994;1018;906;499;399;667	ENSP00000438786:F994L;ENSP00000356370:F1018L;ENSP00000356369:F906L;ENSP00000444556:F499L;ENSP00000356367:F399L	ENSP00000356367:F399L	F	+	1	0	CRB1	195670668	0.730000	0.28100	0.035000	0.18076	0.888000	0.51559	0.591000	0.23969	0.033000	0.15463	0.533000	0.62120	TTT	CRB1	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.403	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	T	NM_201253		197404045	+1	no_errors	ENST00000367400	ensembl	human	known	70_37	missense	SNP	0.004	C
CRMP1	1400	genome.wustl.edu	37	4	5827529	5827530	+	Intron	INS	-	-	AT	rs199554578|rs532679865	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:5827529_5827530insAT	ENST00000397890.2	-	13	1676				CRMP1_ENST00000511535.1_Intron|CRMP1_ENST00000512574.1_Intron|EVC_ENST00000382674.2_Intron|CRMP1_ENST00000324989.7_Intron	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1						axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		cacgcacacacgacaggtgcac	0.515														172	0.034345	0.0605	0.0389	5008	,	,		23103	0.0		0.0557	False		,,,				2504	0.0092																0																																										SO:0001627	intron_variant	1400			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1462-143->AT	4.37:g.5827529_5827530insAT		Somatic		WXS	Illumina HiSeq	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	RNA	INS	-	NULL	ENST00000397890.2	37	NULL	CCDS43207.1	4																																																																																			CRMP1	-	-		0.515	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	-	NM_001313		5827530	-1	no_errors	ENST00000513911	ensembl	human	known	70_37	rna	INS	0.000:0.001	AT
CRMP1	1400	genome.wustl.edu	37	4	5830336	5830336	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:5830336G>A	ENST00000397890.2	-	12	1555	c.1341C>T	c.(1339-1341)atC>atT	p.I447I	CRMP1_ENST00000511535.1_5'UTR|CRMP1_ENST00000512574.1_Silent_p.I445I|EVC_ENST00000382674.2_3'UTR|CRMP1_ENST00000324989.7_Silent_p.I561I	NM_001313.3	NP_001304.1	Q14194	DPYL1_HUMAN	collapsin response mediator protein 1	447					axon guidance (GO:0007411)|nervous system development (GO:0007399)|nucleobase-containing compound metabolic process (GO:0006139)|pyrimidine nucleobase catabolic process (GO:0006208)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|neuronal cell body (GO:0043025)	hydrolase activity, acting on carbon-nitrogen (but not peptide) bonds, in cyclic amides (GO:0016812)			NS(1)|cervix(2)|endometrium(4)|large_intestine(10)|lung(11)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	36				Colorectal(103;0.0721)		TGCCCTGGCTGATGACCACTA	0.567																																																	0													147.0	99.0	116.0					4																	5830336		2203	4300	6503	SO:0001819	synonymous_variant	1400			D78012	CCDS33950.1, CCDS43207.1, CCDS75102.1	4p16.1	2008-05-15			ENSG00000072832	ENSG00000072832			2365	protein-coding gene	gene with protein product		602462				8973361	Standard	XM_005247940		Approved	DRP-1, DPYSL1	uc003gis.3	Q14194	OTTHUMG00000125489	ENST00000397890.2:c.1341C>T	4.37:g.5830336G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0EJG6|Q13024|Q4W5F1|Q96TC8	Silent	SNP	pfam_Amidohydro_1,superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase	p.I561	ENST00000397890.2	37	c.1683	CCDS43207.1	4																																																																																			CRMP1	-	superfamily_Metal-dep_hydrolase_composite,tigrfam_Hydantoinase/dihydroPyrase		0.567	CRMP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CRMP1	HGNC	protein_coding	OTTHUMT00000358871.1	G	NM_001313		5830336	-1	no_errors	ENST00000324989	ensembl	human	known	70_37	silent	SNP	1.000	A
CRYBG3	131544	genome.wustl.edu	37	3	97660064	97660064	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:97660064A>G	ENST00000182096.4	+	17	2798	c.2734A>G	c.(2734-2736)Acc>Gcc	p.T912A	CRYBG3_ENST00000389622.2_Missense_Mutation_p.T119A|CRYBG3_ENST00000485253.1_3'UTR	NM_153605.3	NP_705833.3	Q68DQ2	CRBG3_HUMAN	beta-gamma crystallin domain containing 3	2860							carbohydrate binding (GO:0030246)			breast(1)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(9)|lung(10)|stomach(1)|upper_aerodigestive_tract(2)	32						TCTAGCAGACACCAGGGCAAC	0.458																																																	0													118.0	113.0	114.0					3																	97660064		1882	4105	5987	SO:0001583	missense	131544					3q11.2	2008-09-30			ENSG00000080200	ENSG00000080200			34427	protein-coding gene	gene with protein product							Standard	NM_153605		Approved	DKFZp667G2110	uc021xbn.2	Q68DQ2	OTTHUMG00000159187	ENST00000182096.4:c.2734A>G	3.37:g.97660064A>G	ENSP00000182096:p.Thr912Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DLE8|F6VHI2|Q4G0V8|Q7Z4R9|Q86VD0|Q8N262|Q8N7F1|Q8NDQ8	Missense_Mutation	SNP	pfam_Beta/gamma_crystallin,pfam_Ricin_B_lectin,superfamily_G_crystallin-rel,superfamily_Ricin_B_lectin,smart_Beta/gamma_crystallin,smart_Ricin_B_lectin,pfscan_Ricin_B_lectin,pfscan_Beta/gamma_crystallin,prints_Beta/gamma_crystallin	p.T912A	ENST00000182096.4	37	c.2734		3	.	.	.	.	.	.	.	.	.	.	A	10.21	1.287948	0.23478	.	.	ENSG00000080200	ENST00000182096;ENST00000495403;ENST00000389622	T;T;T	0.79454	1.06;-1.27;1.06	6.07	-1.29	0.09288	Ricin B-related lectin (1);Ricin B lectin (2);	0.695097	0.12618	N	0.453278	T	0.49321	0.1550	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.28038	-1.0056	10	0.25106	T	0.35	.	1.9996	0.03464	0.4503:0.2117:0.2349:0.103	.	912	Q68DQ2	CRBG3_HUMAN	A	912;118;119	ENSP00000182096:T912A;ENSP00000418420:T118A;ENSP00000374273:T119A	ENSP00000182096:T912A	T	+	1	0	CRYBG3	99142754	0.000000	0.05858	0.138000	0.22173	0.765000	0.43378	-0.531000	0.06171	0.170000	0.19704	0.477000	0.44152	ACC	CRYBG3	-	pfam_Ricin_B_lectin,superfamily_Ricin_B_lectin,smart_Ricin_B_lectin		0.458	CRYBG3-001	KNOWN	basic|appris_principal	protein_coding	CRYBG3	HGNC	protein_coding	OTTHUMT00000353751.1	A	NM_153605		97660064	+1	no_errors	ENST00000182096	ensembl	human	known	70_37	missense	SNP	0.005	G
CRYZ	1429	genome.wustl.edu	37	1	75172054	75172054	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:75172054C>T	ENST00000340866.5	-	9	1003	c.916G>A	c.(916-918)Gag>Aag	p.E306K	CRYZ_ENST00000370872.3_Missense_Mutation_p.E169K|CRYZ_ENST00000370871.3_Missense_Mutation_p.E272K|CRYZ_ENST00000417775.1_Missense_Mutation_p.E306K|CRYZ_ENST00000492102.1_5'UTR	NM_001889.3	NP_001880.2	Q08257	QOR_HUMAN	crystallin, zeta (quinone reductase)	306					protein homotetramerization (GO:0051289)|visual perception (GO:0007601)|xenobiotic catabolic process (GO:0042178)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	mRNA 3'-UTR binding (GO:0003730)|NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)	10					Dicoumarol(DB00266)	GCCACCTTCTCCAATGGATAT	0.403																																																	0													91.0	88.0	89.0					1																	75172054		2203	4300	6503	SO:0001583	missense	1429				CCDS665.1, CCDS44162.1, CCDS44163.1	1p31.1	2013-02-14			ENSG00000116791	ENSG00000116791			2419	protein-coding gene	gene with protein product		123691					Standard	NM_001889		Approved		uc001dgj.3	Q08257	OTTHUMG00000009620	ENST00000340866.5:c.916G>A	1.37:g.75172054C>T	ENSP00000339399:p.Glu306Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NN60|D3DQ76|Q53FT0|Q59EU7|Q5HYE7|Q6NSK9	Missense_Mutation	SNP	pfam_ADH_C,pfam_ADH_GroES-like,superfamily_GroES-like,smart_PKS_ER	p.E306K	ENST00000340866.5	37	c.916	CCDS665.1	1	.	.	.	.	.	.	.	.	.	.	C	14.71	2.616387	0.46736	.	.	ENSG00000116791	ENST00000340866;ENST00000370872;ENST00000417775;ENST00000370871	T;T;T;T	0.40225	3.0;1.04;3.0;3.6	5.05	5.05	0.67936	.	0.429508	0.24587	N	0.037254	T	0.35364	0.0929	M	0.84082	2.675	0.53005	D	0.999961	B;B;B	0.30605	0.031;0.287;0.047	B;B;B	0.32149	0.04;0.141;0.02	T	0.30090	-0.9990	10	0.31617	T	0.26	.	14.7869	0.69810	0.0:0.8551:0.1449:0.0	.	169;272;306	Q5HYE7;A6NN60;Q08257	.;.;QOR_HUMAN	K	306;169;306;272	ENSP00000339399:E306K;ENSP00000359909:E169K;ENSP00000399805:E306K;ENSP00000359908:E272K	ENSP00000339399:E306K	E	-	1	0	CRYZ	74944642	1.000000	0.71417	0.997000	0.53966	0.698000	0.40448	4.945000	0.63568	2.351000	0.79841	0.655000	0.94253	GAG	CRYZ	-	smart_PKS_ER		0.403	CRYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZ	HGNC	protein_coding	OTTHUMT00000026514.1	C			75172054	-1	no_errors	ENST00000340866	ensembl	human	known	70_37	missense	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113564878	113564878	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:113564878C>T	ENST00000297405.5	-	26	4550	c.4306G>A	c.(4306-4308)Gac>Aac	p.D1436N	CSMD3_ENST00000352409.3_Missense_Mutation_p.D1436N|CSMD3_ENST00000455883.2_Missense_Mutation_p.D1332N|CSMD3_ENST00000343508.3_Missense_Mutation_p.D1396N	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	1436	CUB 8. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						AGGTTATTGTCATATGGAAAA	0.358										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													86.0	81.0	83.0					8																	113564878		2203	4300	6503	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.4306G>A	8.37:g.113564878C>T	ENSP00000297405:p.Asp1436Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.D1436N	ENST00000297405.5	37	c.4306	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	C	22.4	4.284808	0.80803	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28	4.74	4.74	0.60224	CUB (5);	0.000000	0.64402	D	0.000001	T	0.32704	0.0838	L	0.59912	1.85	0.42729	D	0.993704	D;D;P	0.56287	0.969;0.975;0.935	P;P;P	0.58660	0.757;0.843;0.759	T	0.02546	-1.1143	10	0.16896	T	0.51	.	18.2856	0.90113	0.0:1.0:0.0:0.0	.	1332;1436;1396	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	N	1396;1436;776;1332;1436	ENSP00000345799:D1396N;ENSP00000297405:D1436N;ENSP00000341558:D776N;ENSP00000412263:D1332N;ENSP00000343124:D1436N	ENSP00000297405:D1436N	D	-	1	0	CSMD3	113634054	1.000000	0.71417	1.000000	0.80357	0.947000	0.59692	7.609000	0.82925	2.617000	0.88574	0.655000	0.94253	GAC	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.358	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	C	NM_052900		113564878	-1	no_errors	ENST00000297405	ensembl	human	known	70_37	missense	SNP	1.000	T
CSMD3	114788	genome.wustl.edu	37	8	113668533	113668533	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:113668533G>A	ENST00000297405.5	-	18	3098	c.2854C>T	c.(2854-2856)Cat>Tat	p.H952Y	CSMD3_ENST00000352409.3_Missense_Mutation_p.H952Y|CSMD3_ENST00000455883.2_Missense_Mutation_p.H848Y|CSMD3_ENST00000343508.3_Missense_Mutation_p.H912Y	NM_198123.1	NP_937756.1	Q7Z407	CSMD3_HUMAN	CUB and Sushi multiple domains 3	952	CUB 5. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(7)|central_nervous_system(6)|endometrium(44)|haematopoietic_and_lymphoid_tissue(8)|kidney(36)|large_intestine(72)|liver(5)|lung(389)|ovary(24)|prostate(6)|skin(23)|upper_aerodigestive_tract(19)|urinary_tract(7)	646						GGCCCATCATGAACTTCCAGA	0.333										HNSCC(6;0.00088)|TCGA Ovarian(7;0.080)																																							0													68.0	74.0	72.0					8																	113668533		2203	4300	6503	SO:0001583	missense	114788			AY210419	CCDS6315.1, CCDS6316.2, CCDS6317.1	8q23.3	2007-01-06			ENSG00000164796	ENSG00000164796			19291	protein-coding gene	gene with protein product		608399					Standard	NM_052900		Approved		uc003ynu.3	Q7Z407	OTTHUMG00000157027	ENST00000297405.5:c.2854C>T	8.37:g.113668533G>A	ENSP00000297405:p.His952Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96PZ3	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.H952Y	ENST00000297405.5	37	c.2854	CCDS6315.1	8	.	.	.	.	.	.	.	.	.	.	G	9.611	1.131272	0.21041	.	.	ENSG00000164796	ENST00000343508;ENST00000297405;ENST00000339701;ENST00000455883;ENST00000352409	T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51	5.12	5.12	0.69794	CUB (5);	0.000000	0.64402	D	0.000001	T	0.38268	0.1034	N	0.00510	-1.415	0.44728	D	0.997727	D;D;D	0.71674	0.997;0.998;0.975	D;D;P	0.85130	0.995;0.997;0.836	T	0.50783	-0.8787	10	0.02654	T	1	.	18.9148	0.92501	0.0:0.0:1.0:0.0	.	848;952;912	Q7Z407-3;Q7Z407;Q7Z407-2	.;CSMD3_HUMAN;.	Y	912;952;292;848;952	ENSP00000345799:H912Y;ENSP00000297405:H952Y;ENSP00000341558:H292Y;ENSP00000412263:H848Y;ENSP00000343124:H952Y	ENSP00000297405:H952Y	H	-	1	0	CSMD3	113737709	1.000000	0.71417	1.000000	0.80357	0.463000	0.32649	7.924000	0.87555	2.537000	0.85549	0.585000	0.79938	CAT	CSMD3	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.333	CSMD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSMD3	HGNC	protein_coding	OTTHUMT00000347141.1	G	NM_052900		113668533	-1	no_errors	ENST00000297405	ensembl	human	known	70_37	missense	SNP	1.000	A
CSNK1G2	1455	genome.wustl.edu	37	19	1954126	1954127	+	Intron	INS	-	-	A	rs201081323|rs386805796|rs66547847|rs34622118|rs571867760	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:1954126_1954127insA	ENST00000255641.8	+	1	230				CSNK1G2-AS1_ENST00000314315.3_RNA|CSNK1G2-AS1_ENST00000586395.1_RNA	NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GCACCTGATGCGTTAAACCCAT	0.624													-|-|A|insertion	2509	0.500998	0.2943	0.5634	5008	,	,		18058	0.4752		0.664	False		,,,				2504	0.5951				Ovarian(91;880 1392 21236 36928 37598)												0																																										SO:0001627	intron_variant	255193			AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.-266+12709->A	19.37:g.1954126_1954127insA		Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU42|O00704|Q8WUB1	RNA	INS	-	NULL	ENST00000255641.8	37	NULL	CCDS12077.1	19																																																																																			CSNK1G2-AS1	-	-		0.624	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1G2-AS1	HGNC	protein_coding	OTTHUMT00000449287.1	-	NM_001319		1954127	-1	no_errors	ENST00000314315	ensembl	human	known	70_37	rna	INS	0.000:0.000	A
CSNK1G2	1455	genome.wustl.edu	37	19	1954128	1954128	+	Intron	SNP	T	T	C	rs34797288|rs386805796|rs200069426	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:1954128T>C	ENST00000255641.8	+	1	230				CSNK1G2-AS1_ENST00000314315.3_RNA|CSNK1G2-AS1_ENST00000586395.1_RNA	NM_001319.6	NP_001310.3	P78368	KC1G2_HUMAN	casein kinase 1, gamma 2						protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|peptide binding (GO:0042277)|protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|kidney(1)|lung(3)|prostate(1)|skin(1)|stomach(1)	8		Ovarian(11;2.11e-07)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		ACCTGATGCGTTAAACCCATT	0.622													T|||	2510	0.501198	0.2943	0.5634	5008	,	,		17439	0.4752		0.665	False		,,,				2504	0.5951				Ovarian(91;880 1392 21236 36928 37598)												0																																										SO:0001627	intron_variant	255193			AF001177	CCDS12077.1	19p13.3	2013-01-17			ENSG00000133275	ENSG00000133275			2455	protein-coding gene	gene with protein product		602214				9403068	Standard	NM_001319		Approved	CK1g2	uc002lul.4	P78368		ENST00000255641.8:c.-266+12711T>C	19.37:g.1954128T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU42|O00704|Q8WUB1	RNA	SNP	-	NULL	ENST00000255641.8	37	NULL	CCDS12077.1	19																																																																																			CSNK1G2-AS1	-	-		0.622	CSNK1G2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSNK1G2-AS1	HGNC	protein_coding	OTTHUMT00000449287.1	T	NM_001319		1954128	-1	no_errors	ENST00000314315	ensembl	human	known	70_37	rna	SNP	0.001	C
CSRNP2	81566	genome.wustl.edu	37	12	51458056	51458056	+	Missense_Mutation	SNP	C	C	T	rs377254873		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:51458056C>T	ENST00000228515.1	-	5	1402	c.1105G>A	c.(1105-1107)Gaa>Aaa	p.E369K		NM_030809.2	NP_110436.1	Q9H175	CSRN2_HUMAN	cysteine-serine-rich nuclear protein 2	369					apoptotic process (GO:0006915)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	phosphatase binding (GO:0019902)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(5)|urinary_tract(1)	14						CACAGCTCTTCGGGGACAGCC	0.602																																																	0								C	LYS/GLU	0,4406		0,0,2203	61.0	67.0	65.0		1105	3.0	0.5	12		65	1,8599	1.2+/-3.3	0,1,4299	no	missense	CSRNP2	NM_030809.2	56	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	369/544	51458056	1,13005	2203	4300	6503	SO:0001583	missense	81566			AJ298133	CCDS8807.1	12q13.11-q13.12	2012-04-17	2009-01-07	2009-01-07				"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	16006	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 72"""		"""chromosome 12 open reading frame 22"", ""family with sequence similarity 130, member A1"""	C12orf22, FAM130A1		17726538	Standard	NM_030809		Approved	C12ORF2, TAIP-12, PPP1R72	uc001rxu.2	Q9H175		ENST00000228515.1:c.1105G>A	12.37:g.51458056C>T	ENSP00000228515:p.Glu369Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	prints_Cys/Ser-rich_nuc_prot	p.E369K	ENST00000228515.1	37	c.1105	CCDS8807.1	12	.	.	.	.	.	.	.	.	.	.	C	13.02	2.111915	0.37242	0.0	1.16E-4	ENSG00000110925	ENST00000228515	T	0.47869	0.83	4.91	2.97	0.34412	.	0.374313	0.24801	N	0.035493	T	0.24470	0.0593	N	0.08118	0	0.22610	N	0.998938	B	0.15719	0.014	B	0.09377	0.004	T	0.14615	-1.0466	10	0.27785	T	0.31	-9.6472	8.9332	0.35684	0.1632:0.6674:0.1694:0.0	.	369	Q9H175	CSRN2_HUMAN	K	369	ENSP00000228515:E369K	ENSP00000228515:E369K	E	-	1	0	CSRNP2	49744323	0.003000	0.15002	0.528000	0.27938	0.972000	0.66771	0.451000	0.21779	0.705000	0.31890	0.555000	0.69702	GAA	CSRNP2	-	NULL		0.602	CSRNP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSRNP2	HGNC	protein_coding	OTTHUMT00000404893.1	C			51458056	-1	no_errors	ENST00000228515	ensembl	human	known	70_37	missense	SNP	0.641	T
CTAG2	30848	genome.wustl.edu	37	X	153880858	153880858	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:153880858C>T	ENST00000247306.4	-	2	380	c.317G>A	c.(316-318)cGc>cAc	p.R106H	CTAG2_ENST00000369585.3_Missense_Mutation_p.R106H	NM_020994.3	NP_066274.2	O75638	CTAG2_HUMAN	cancer/testis antigen 2	106						centrosome (GO:0005813)				central_nervous_system(1)|endometrium(1)|lung(6)|ovary(1)|pancreas(1)	10	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CAGGATCCTGCGGACCAGCTC	0.617																																																	0													42.0	41.0	41.0					X																	153880858		2203	4298	6501	SO:0001583	missense	30848			AJ012833	CCDS14759.1, CCDS35455.1	Xq28	2009-08-18			ENSG00000126890	ENSG00000126890			2492	protein-coding gene	gene with protein product	"""CTL-recognized antigen on melanoma"", ""LAGE-1a protein"", ""cancer/testis antigen family 6, member 2a"", ""cancer/testis antigen family 6, member 2b"""	300396				9626360, 10399963	Standard	NM_020994		Approved	LAGE-1, CAMEL, LAGE1, ESO2, MGC3803, MGC138724, CT6.2a, CT6.2b, LAGE-1a, LAGE-1b	uc004fmi.2	O75638	OTTHUMG00000024239	ENST00000247306.4:c.317G>A	X.37:g.153880858C>T	ENSP00000247306:p.Arg106His	Somatic		WXS	Illumina HiSeq	Phase_IV	O75637|Q0VIL6|Q14CD6|Q2Z1N4|Q9BU80|Q9UJ89|Q9Y479	Missense_Mutation	SNP	pfam_EKC/KEOPS_Pcc1	p.R106H	ENST00000247306.4	37	c.317	CCDS14759.1	X	.	.	.	.	.	.	.	.	.	.	C	7.881	0.730224	0.15507	.	.	ENSG00000126890	ENST00000247306;ENST00000369585;ENST00000454505	T;T	0.30448	1.53;1.53	2.77	-3.07	0.05363	.	.	.	.	.	T	0.16428	0.0395	L	0.41710	1.295	0.09310	N	1	P;P	0.48016	0.904;0.789	B;B	0.38296	0.27;0.177	T	0.08391	-1.0724	9	0.39692	T	0.17	-0.5484	0.6842	0.00880	0.3022:0.334:0.1474:0.2164	.	106;106	O75638;O75638-2	CTAG2_HUMAN;.	H	106;106;48	ENSP00000247306:R106H;ENSP00000358598:R106H	ENSP00000247306:R106H	R	-	2	0	CTAG2	153534052	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.594000	0.05733	-1.034000	0.03295	-0.508000	0.04489	CGC	CTAG2	-	pfam_EKC/KEOPS_Pcc1		0.617	CTAG2-001	PUTATIVE	basic|CCDS	protein_coding	CTAG2	HGNC	protein_coding	OTTHUMT00000061176.1	C	NM_020994		153880858	-1	no_errors	ENST00000369585	ensembl	human	known	70_37	missense	SNP	0.000	T
CXADRP3	440224	genome.wustl.edu	37	18	14478894	14478894	+	lincRNA	SNP	T	T	A	rs72883372|rs199941399	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:14478894T>A	ENST00000581457.1	-	0	1014					NR_024076.1				coxsackie virus and adenovirus receptor pseudogene 3																		CACCAGGAGCTTTTTTTCACT	0.363													T|||	538	0.107428	0.2829	0.0591	5008	,	,		19845	0.0		0.0686	False		,,,				2504	0.0552																0																																												440224					18p11.21	2013-09-19			ENSG00000265766	ENSG00000265766			33974	pseudogene	pseudogene							Standard	NR_024076		Approved		uc010xai.2		OTTHUMG00000178700		18.37:g.14478894T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000581457.1	37	NULL		18																																																																																			CXADRP3	-	-		0.363	CXADRP3-001	KNOWN	basic	lincRNA	CXADRP3	HGNC	lincRNA	OTTHUMT00000443008.1	T	NR_024076		14478894	-1	no_errors	ENST00000581457	ensembl	human	known	70_37	rna	SNP	1.000	A
PBDC1	51260	genome.wustl.edu	37	X	75395419	75395419	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:75395419G>A	ENST00000373358.3	+	4	471	c.268G>A	c.(268-270)Gaa>Aaa	p.E90K	PBDC1_ENST00000373357.3_Missense_Mutation_p.E90K	NM_016500.3	NP_057584.2	Q9BVG4	PBDC1_HUMAN	polysaccharide biosynthesis domain containing 1	90																	GTTGGACCCAGAAGAACTCAA	0.353																																																	0													63.0	56.0	59.0					X																	75395419		2203	4300	6503	SO:0001583	missense	51260			BC001220	CCDS14432.1, CCDS75995.1	Xq13.2	2012-11-28	2012-11-28	2012-11-28	ENSG00000102390	ENSG00000102390			28790	protein-coding gene	gene with protein product			"""chromosome X open reading frame 26"""	CXorf26		11042152	Standard	NM_016500		Approved	MGC874	uc004ecl.1	Q9BVG4	OTTHUMG00000021876	ENST00000373358.3:c.268G>A	X.37:g.75395419G>A	ENSP00000362456:p.Glu90Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Put_polysacc_synth	p.E90K	ENST00000373358.3	37	c.268	CCDS14432.1	X	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668488	0.88348	.	.	ENSG00000102390	ENST00000373358;ENST00000373357	.	.	.	4.87	4.87	0.63330	Yst0336-like domain (1);	0.046414	0.85682	D	0.000000	T	0.78444	0.4284	M	0.82716	2.605	0.54753	D	0.999981	D	0.63880	0.993	P	0.62649	0.905	T	0.82065	-0.0642	9	0.72032	D	0.01	-28.1309	14.5104	0.67784	0.0:0.0:1.0:0.0	.	90	Q9BVG4	CX026_HUMAN	K	90	.	ENSP00000362455:E90K	E	+	1	0	CXorf26	75311821	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	7.114000	0.77103	2.395000	0.81488	0.544000	0.68410	GAA	CXorf26	-	pfam_Put_polysacc_synth		0.353	PBDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXorf26	HGNC	protein_coding	OTTHUMT00000057294.1	G	NM_016500		75395419	+1	no_errors	ENST00000373358	ensembl	human	known	70_37	missense	SNP	1.000	A
CYP21A2	1589	genome.wustl.edu	37	6	32008783	32008783	+	Missense_Mutation	SNP	C	C	T	rs6445	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32008783C>T	ENST00000418967.2	+	10	1518	c.1360C>T	c.(1360-1362)Ccc>Tcc	p.P454S	CYP21A2_ENST00000435122.2_Missense_Mutation_p.P424S	NM_000500.7	NP_000491.4	P08686	CP21A_HUMAN	cytochrome P450, family 21, subfamily A, polypeptide 2	453					glucocorticoid biosynthetic process (GO:0006704)|mineralocorticoid biosynthetic process (GO:0006705)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)	heme binding (GO:0020037)|iron ion binding (GO:0005506)|steroid 21-monooxygenase activity (GO:0004509)|steroid binding (GO:0005496)|steroid hydroxylase activity (GO:0008395)			NS(1)|breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)	11					Ketoconazole(DB01026)	CACGCTGCTGCCCTCCGGGGA	0.716													C|||	9	0.00179712	0.0008	0.0029	5008	,	,		16812	0.0		0.006	False		,,,				2504	0.0				Melanoma(174;1669 1998 3915 34700 46447)												0			GRCh37	CM920233	CYP21A2	M	rs6445						2.0	2.0	2.0					6																	32008783		1010	1912	2922	SO:0001583	missense	1589			X58906	CCDS4735.1, CCDS47406.1	6p21.3	2014-09-17	2003-01-14		ENSG00000231852	ENSG00000231852	1.14.99.10	"""Cytochrome P450s"""	2600	protein-coding gene	gene with protein product	"""Steroid 21-monooxygenase"""	613815	"""cytochrome P450, subfamily XXIA (steroid 21-hydroxylase, congenital adrenal hyperplasia), polypeptide 2"""	CYP21, CYP21B			Standard	NM_000500		Approved	P450c21B, CA21H, CPS1, CAH1	uc021yvd.1	P08686	OTTHUMG00000031069	ENST00000418967.2:c.1360C>T	6.37:g.32008783C>T	ENSP00000408860:p.Pro454Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BHY6|P04033|Q01204|Q08AG8|Q16749|Q16806|Q5ST44|Q96NU8	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.P454S	ENST00000418967.2	37	c.1360	CCDS4735.1	6	.	.	.	.	.	.	.	.	.	.	c	15.77	2.930926	0.52866	.	.	ENSG00000231852	ENST00000418967;ENST00000435122	T;T	0.69040	-0.37;-0.37	4.6	3.72	0.42706	.	0.000000	0.48286	D	0.000188	T	0.67924	0.2945	M	0.67517	2.055	0.42608	A	0.993304	D;D	0.63880	0.993;0.988	D;D	0.65573	0.914;0.936	T	0.70995	-0.4720	9	0.49607	T	0.09	.	9.1229	0.36797	0.0:0.8984:0.0:0.1016	.	424;454	Q5ST44;Q16874	.;.	S	454;424	ENSP00000408860:P454S;ENSP00000415043:P424S	ENSP00000408860:P454S	P	+	1	0	CYP21A2	32116762	0.992000	0.36948	0.965000	0.40720	0.373000	0.29922	1.355000	0.34068	1.287000	0.44583	0.651000	0.88453	CCC	CYP21A2	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.716	CYP21A2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP21A2	HGNC	protein_coding	OTTHUMT00000268768.2	C	NM_000500		32008783	+1	no_errors	ENST00000418967	ensembl	human	known	70_37	missense	SNP	0.998	T
CYP39A1	51302	genome.wustl.edu	37	6	46604179	46604179	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:46604179C>T	ENST00000275016.2	-	5	882	c.679G>A	c.(679-681)Gag>Aag	p.E227K		NM_016593.3	NP_057677.2	Q9NYL5	CP39A_HUMAN	cytochrome P450, family 39, subfamily A, polypeptide 1	227					bile acid biosynthetic process (GO:0006699)|bile acid catabolic process (GO:0030573)|bile acid metabolic process (GO:0008206)|cholesterol catabolic process (GO:0006707)|digestion (GO:0007586)|small molecule metabolic process (GO:0044281)|sterol metabolic process (GO:0016125)|xenobiotic metabolic process (GO:0006805)	endoplasmic reticulum membrane (GO:0005789)|intracellular membrane-bounded organelle (GO:0043231)	24-hydroxycholesterol 7alpha-hydroxylase activity (GO:0033782)|heme binding (GO:0020037)|iron ion binding (GO:0005506)|oxysterol 7-alpha-hydroxylase activity (GO:0008396)|steroid 7-alpha-hydroxylase activity (GO:0008387)		EIF3K/CYP39A1(2)	NS(1)|endometrium(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(2)|skin(2)	21						ATGTTTTTCTCAAACAGTTCC	0.289																																																	0													52.0	53.0	52.0					6																	46604179		2203	4291	6494	SO:0001583	missense	51302			AF237982	CCDS4916.1, CCDS75465.1	6p21.1-p11.2	2008-02-05	2003-01-14		ENSG00000146233	ENSG00000146233		"""Cytochrome P450s"""	17449	protein-coding gene	gene with protein product		605994	"""cytochrome P450, subfamily XXXIX (oxysterol 7 alpha-hydroxylase), polypeptide 1"""			10748047	Standard	NM_016593		Approved		uc003oyf.1	Q9NYL5	OTTHUMG00000014785	ENST00000275016.2:c.679G>A	6.37:g.46604179C>T	ENSP00000275016:p.Glu227Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VTT0|Q96FW5	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_E_grp-I	p.E227K	ENST00000275016.2	37	c.679	CCDS4916.1	6	.	.	.	.	.	.	.	.	.	.	C	14.79	2.639540	0.47153	.	.	ENSG00000146233	ENST00000275016	T	0.68331	-0.32	5.97	5.97	0.96955	.	0.250920	0.42548	D	0.000685	T	0.53965	0.1829	L	0.55834	1.745	0.40827	D	0.983557	P;P	0.41978	0.602;0.767	P;P	0.49561	0.531;0.615	T	0.54892	-0.8225	10	0.06891	T	0.86	-9.5597	12.5242	0.56077	0.0:0.9232:0.0:0.0768	.	207;227	B7Z786;Q9NYL5	.;CP39A_HUMAN	K	227	ENSP00000275016:E227K	ENSP00000275016:E227K	E	-	1	0	CYP39A1	46712138	1.000000	0.71417	0.882000	0.34594	0.056000	0.15407	2.786000	0.47790	2.838000	0.97847	0.561000	0.74099	GAG	CYP39A1	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.289	CYP39A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP39A1	HGNC	protein_coding	OTTHUMT00000040787.1	C			46604179	-1	no_errors	ENST00000275016	ensembl	human	known	70_37	missense	SNP	0.996	T
DAB2IP	153090	genome.wustl.edu	37	9	124522649	124522649	+	Silent	SNP	C	C	T	rs150428926	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:124522649C>T	ENST00000408936.3	+	6	1283	c.1101C>T	c.(1099-1101)ctC>ctT	p.L367L	DAB2IP_ENST00000259371.2_Silent_p.L339L|DAB2IP_ENST00000309989.1_Silent_p.L243L			Q5VWQ8	DAB2P_HUMAN	DAB2 interacting protein	367					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|angiogenesis (GO:0001525)|cell cycle (GO:0007049)|cell motility involved in cerebral cortex radial glia guided migration (GO:0021814)|cellular protein catabolic process (GO:0044257)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to tumor necrosis factor (GO:0071356)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|endothelial cell apoptotic process (GO:0072577)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to endoplasmic reticulum stress (GO:0070059)|layer formation in cerebral cortex (GO:0021819)|negative regulation of angiogenesis (GO:0016525)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of catenin import into nucleus (GO:0035414)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cyclin catabolic process (GO:2000599)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of epithelial cell migration (GO:0010633)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial to mesenchymal transition (GO:0010719)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of G0 to G1 transition (GO:0070317)|negative regulation of GTPase activity (GO:0034260)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of phosphatidylinositol 3-kinase activity (GO:0043553)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|negative regulation of Ras GTPase activity (GO:0034261)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of toll-like receptor 4 signaling pathway (GO:0034144)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030948)|negative regulation of vascular endothelial growth factor signaling pathway (GO:1900747)|neuron projection morphogenesis (GO:0048812)|positive regulation of apoptotic process (GO:0043065)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of dendrite development (GO:1900006)|positive regulation of JNK cascade (GO:0046330)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron migration (GO:2001224)|positive regulation of neuron projection development (GO:0010976)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein catabolic process (GO:0045732)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of Ras GTPase activity (GO:0032320)|positive regulation of synapse maturation (GO:0090129)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of ARF GTPase activity (GO:0032312)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein complex assembly (GO:0043254)|response to unfolded protein (GO:0006986)|transformed cell apoptotic process (GO:0006927)|tube formation (GO:0035148)|vascular endothelial growth factor receptor-2 signaling pathway (GO:0036324)	axon (GO:0030424)|cerebellar mossy fiber (GO:0044300)|climbing fiber (GO:0044301)|cytoplasm (GO:0005737)|endocytic vesicle (GO:0030139)|extracellular vesicular exosome (GO:0070062)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|neuronal cell body (GO:0043025)|neuronal cell body membrane (GO:0032809)|parallel fiber (GO:1990032)|plasma membrane (GO:0005886)	14-3-3 protein binding (GO:0071889)|death receptor binding (GO:0005123)|identical protein binding (GO:0042802)|kinase binding (GO:0019900)|mitogen-activated protein kinase kinase binding (GO:0031434)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|phosphatidylinositol 3-kinase binding (GO:0043548)|phosphatidylinositol 3-kinase regulatory subunit binding (GO:0036312)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|protein complex binding (GO:0032403)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase 2A binding (GO:0051721)|Ras GTPase activator activity (GO:0005099)|SH3 domain binding (GO:0017124)|signaling adaptor activity (GO:0035591)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			breast(3)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(8)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	27						AGCCCATCCTCAGTGCCAAGA	0.597																																																	0								C	,	1,4405	2.1+/-5.4	0,1,2202	62.0	45.0	51.0		1017,729	2.6	1.0	9	dbSNP_134	51	15,8585	10.5+/-38.8	0,15,4285	no	coding-synonymous,coding-synonymous	DAB2IP	NM_032552.2,NM_138709.1	,	0,16,6487	TT,TC,CC		0.1744,0.0227,0.123	,	339/1133,243/1066	124522649	16,12990	2203	4300	6503	SO:0001819	synonymous_variant	153090			AF367051	CCDS6832.1, CCDS6833.2	9q33.1-q33.3	2008-07-21			ENSG00000136848	ENSG00000136848			17294	protein-coding gene	gene with protein product	"""nGAP-like protein"", ""DOC-2/DAB2 interactive protein"", ""ASK-interacting protein"", ""ASK1-interacting protein 1"""	609205				11944990, 11812785	Standard	XM_005251721		Approved	AF9Q34, DIP1/2, KIAA1743, AIP1	uc004bln.3	Q5VWQ8	OTTHUMG00000020595	ENST00000408936.3:c.1101C>T	9.37:g.124522649C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8V2|A6NHI9|B0QZB1|G3XA90|Q8TDL2|Q96SE1|Q9C0C0	Silent	SNP	pfam_DUF3498,pfam_RasGAP,pfam_C2_Ca-dep,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_C2_Ca-dep,smart_RasGAP,pfscan_Pleckstrin_homology,pfscan_RasGAP	p.L367	ENST00000408936.3	37	c.1101		9																																																																																			DAB2IP	-	superfamily_Rho_GTPase_activation_prot,smart_RasGAP		0.597	DAB2IP-009	KNOWN	basic|appris_candidate_longest	protein_coding	DAB2IP	HGNC	protein_coding	OTTHUMT00000317857.1	C	NM_032552		124522649	+1	no_errors	ENST00000408936	ensembl	human	known	70_37	silent	SNP	1.000	T
DAPK2	23604	genome.wustl.edu	37	15	64215459	64215459	+	Intron	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:64215459G>C	ENST00000457488.1	-	9	889				DAPK2_ENST00000261891.3_Intron|DAPK2_ENST00000558069.1_Silent_p.L314L	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2						anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		AGTGGCATTTGAGAGTGTACT	0.562																																																	0																																										SO:0001627	intron_variant	23604			AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.858+1555C>G	15.37:g.64215459G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	E9JGM7|O75892|Q24JS1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.L314	ENST00000457488.1	37	c.942	CCDS10188.1	15																																																																																			DAPK2	-	superfamily_Kinase-like_dom		0.562	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	G	NM_014326		64215459	-1	no_errors	ENST00000558069	ensembl	human	putative	70_37	silent	SNP	1.000	C
DCAF8L1	139425	genome.wustl.edu	37	X	27998107	27998107	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:27998107G>A	ENST00000441525.1	-	1	1459	c.1345C>T	c.(1345-1347)Cgg>Tgg	p.R449W		NM_001017930.1	NP_001017930.1	A6NGE4	DC8L1_HUMAN	DDB1 and CUL4 associated factor 8-like 1	449										NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(10)|lung(24)|ovary(3)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	56						AACTCACTCCGGGGGCCATAG	0.468																																																	0													40.0	36.0	37.0					X																	27998107		2202	4300	6502	SO:0001583	missense	139425				CCDS35222.1	Xp22.11	2013-01-09	2009-07-17	2009-07-17	ENSG00000226372	ENSG00000226372		"""WD repeat domain containing"""	31810	protein-coding gene	gene with protein product			"""WD repeat domain 42B"""	WDR42B			Standard	NM_001017930		Approved		uc004dbx.1	A6NGE4	OTTHUMG00000021312	ENST00000441525.1:c.1345C>T	X.37:g.27998107G>A	ENSP00000405222:p.Arg449Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXX1	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R449W	ENST00000441525.1	37	c.1345	CCDS35222.1	X	.	.	.	.	.	.	.	.	.	.	G	10.81	1.455402	0.26161	.	.	ENSG00000226372	ENST00000441525	D	0.81499	-1.5	0.842	-1.68	0.08212	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.862399	0.10300	N	0.691227	D	0.86447	0.5935	M	0.85197	2.74	0.29810	N	0.831725	D	0.76494	0.999	D	0.63793	0.918	T	0.77547	-0.2547	9	0.72032	D	0.01	-1.237	.	.	.	.	449	A6NGE4	DC8L1_HUMAN	W	449	ENSP00000405222:R449W	ENSP00000405222:R449W	R	-	1	2	DCAF8L1	27908028	0.339000	0.24784	0.228000	0.23943	0.072000	0.16883	1.053000	0.30442	-1.303000	0.02332	-0.998000	0.02512	CGG	DCAF8L1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.468	DCAF8L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF8L1	HGNC	protein_coding	OTTHUMT00000056150.2	G	XM_066690		27998107	-1	no_errors	ENST00000441525	ensembl	human	known	70_37	missense	SNP	0.933	A
DCHS2	54798	genome.wustl.edu	37	4	155287390	155287390	+	Silent	SNP	C	C	T	rs78251264	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:155287390C>T	ENST00000357232.4	-	5	665	c.666G>A	c.(664-666)tcG>tcA	p.S222S	DCHS2_ENST00000339452.1_Silent_p.S816S	NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	222	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		TAAAAAGGGACGACACGTTTC	0.448													C|||	2	0.000399361	0.0	0.0	5008	,	,		20691	0.0		0.001	False		,,,				2504	0.001																0								C	,	2,4404	4.2+/-10.8	0,2,2201	149.0	132.0	138.0		2448,666	-11.4	0.0	4	dbSNP_131	138	8,8592	6.4+/-24.3	0,8,4292	no	coding-synonymous,coding-synonymous	DCHS2	NM_001142552.1,NM_017639.3	,	0,10,6493	TT,TC,CC		0.093,0.0454,0.0769	,	816/1370,222/2917	155287390	10,12996	2203	4300	6503	SO:0001819	synonymous_variant	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.666G>A	4.37:g.155287390C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Silent	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S222	ENST00000357232.4	37	c.666	CCDS3785.1	4																																																																																			DCHS2	-	superfamily_Cadherin-like,pfscan_Cadherin		0.448	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	C	NM_001142552		155287390	-1	no_errors	ENST00000357232	ensembl	human	known	70_37	silent	SNP	0.000	T
DENND2C	163259	genome.wustl.edu	37	1	115168413	115168413	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:115168413C>T	ENST00000393274.1	-	4	818	c.193G>A	c.(193-195)Gag>Aag	p.E65K	DENND2C_ENST00000481894.1_5'Flank|DENND2C_ENST00000393277.1_Missense_Mutation_p.E65K|DENND2C_ENST00000393276.3_Missense_Mutation_p.E65K	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	65					positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		CTCTTTCTCTCAGCTATAGGA	0.368																																																	0													185.0	192.0	190.0					1																	115168413		2203	4300	6503	SO:0001583	missense	163259				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.193G>A	1.37:g.115168413C>T	ENSP00000376955:p.Glu65Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL26|Q5TCX6|Q6P3R3	Missense_Mutation	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.E65K	ENST00000393274.1	37	c.193	CCDS58018.1	1	.	.	.	.	.	.	.	.	.	.	C	1.400	-0.578471	0.03854	.	.	ENSG00000175984	ENST00000393276;ENST00000393274;ENST00000369540;ENST00000393277	T;T;T	0.08008	3.76;3.78;3.14	5.77	2.83	0.33086	.	32.566100	0.00166	N	0.000000	T	0.01800	0.0057	L	0.36672	1.1	0.09310	N	1	B;B	0.21309	0.054;0.014	B;B	0.17433	0.013;0.018	T	0.39165	-0.9627	10	0.06891	T	0.86	.	5.7493	0.18138	0.0:0.6212:0.1552:0.2236	.	65;65	Q68D51;Q68D51-3	DEN2C_HUMAN;.	K	65	ENSP00000376957:E65K;ENSP00000376955:E65K;ENSP00000376958:E65K	ENSP00000358553:E65K	E	-	1	0	DENND2C	114969936	0.000000	0.05858	0.016000	0.15963	0.014000	0.08584	-0.066000	0.11598	0.767000	0.33267	0.644000	0.83932	GAG	DENND2C	-	NULL		0.368	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	C	NM_198459		115168413	-1	no_errors	ENST00000393274	ensembl	human	known	70_37	missense	SNP	0.000	T
DENND6B	414918	genome.wustl.edu	37	22	50751893	50751893	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:50751893C>G	ENST00000413817.3	-	16	1400	c.1329G>C	c.(1327-1329)aaG>aaC	p.K443N	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	443					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										GCGTGATGCTCTTCTGCAGGG	0.687																																																	0													21.0	26.0	25.0					22																	50751893		1891	4068	5959	SO:0001583	missense	414918			AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.1329G>C	22.37:g.50751893C>G	ENSP00000391524:p.Lys443Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6X8I5	Missense_Mutation	SNP	pfam_Afi1_N,pfam_DENN_dom,pfam_Secretory_pathway_prot_Avl9	p.K443N	ENST00000413817.3	37	c.1329	CCDS46732.1	22	.	.	.	.	.	.	.	.	.	.	C	13.17	2.156675	0.38119	.	.	ENSG00000205593	ENST00000413817	.	.	.	4.82	2.71	0.32032	.	0.249402	0.45361	D	0.000368	T	0.38401	0.1039	L	0.50333	1.59	0.38243	D	0.941373	P;P	0.35433	0.501;0.501	B;B	0.27608	0.081;0.081	T	0.40365	-0.9567	9	0.54805	T	0.06	-23.4131	5.8748	0.18822	0.0:0.6631:0.1589:0.1781	.	443;443	Q8NEG7;C9JIV6	F116B_HUMAN;.	N	443	.	ENSP00000391524:K443N	K	-	3	2	FAM116B	49094465	0.129000	0.22400	0.983000	0.44433	0.927000	0.56198	-0.233000	0.09041	1.010000	0.39314	0.313000	0.20887	AAG	DENND6B	-	pfam_Afi1_N		0.687	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND6B	HGNC	protein_coding	OTTHUMT00000316845.3	C	NM_001001794		50751893	-1	no_errors	ENST00000413817	ensembl	human	known	70_37	missense	SNP	0.944	G
DGCR5	26220	genome.wustl.edu	37	22	18979648	18979648	+	RNA	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:18979648G>A	ENST00000421572.1	+	0	1136				DGCR5_ENST00000438934.1_RNA|DGCR5_ENST00000440005.2_RNA|DGCR5_ENST00000537283.1_RNA					DiGeorge syndrome critical region gene 5 (non-protein coding)																		GTGGGGCAGTGAGCCTCCTGC	0.637																																																	0																																												26220			X91348		22q11	2012-10-16	2008-08-13		ENSG00000237517	ENSG00000237517		"""Long non-coding RNAs"""	16757	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 37"", ""long intergenic non-protein coding RNA 37"""					8659529	Standard	NR_002733		Approved	NCRNA00037, LINC00037	uc021wku.1		OTTHUMG00000149977		22.37:g.18979648G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000421572.1	37	NULL		22																																																																																			DGCR5	-	-		0.637	DGCR5-004	KNOWN	basic|exp_conf	antisense	DGCR5	HGNC	antisense	OTTHUMT00000316630.1	G	NR_002733		18979648	+1	no_errors	ENST00000438934	ensembl	human	known	70_37	rna	SNP	0.000	A
DENND6B	414918	genome.wustl.edu	37	22	50752655	50752655	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:50752655C>T	ENST00000413817.3	-	13	1190	c.1119G>A	c.(1117-1119)aaG>aaA	p.K373K	XX-C283C717.1_ENST00000453835.1_RNA	NM_001001794.3	NP_001001794.3	Q8NEG7	DEN6B_HUMAN	DENN/MADD domain containing 6B	373					positive regulation of Rab GTPase activity (GO:0032851)	endosome (GO:0005768)	Rab guanyl-nucleotide exchange factor activity (GO:0017112)										TGTCCAGGGTCTTCAACCTTG	0.642																																																	0													40.0	46.0	44.0					22																	50752655		1952	4129	6081	SO:0001819	synonymous_variant	414918			AK054743	CCDS46732.1	22q13.33	2012-10-03	2012-10-03	2012-10-03	ENSG00000205593	ENSG00000205593		"""DENN/MADD domain containing"""	32690	protein-coding gene	gene with protein product			"""family with sequence similarity 116, member B"""	FAM116B		21330364	Standard	NM_001001794		Approved	MGC33692, AFI1B	uc011arv.1	Q8NEG7	OTTHUMG00000150210	ENST00000413817.3:c.1119G>A	22.37:g.50752655C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6X8I5	Silent	SNP	pfam_Afi1_N,pfam_DENN_dom,pfam_Secretory_pathway_prot_Avl9	p.K373	ENST00000413817.3	37	c.1119	CCDS46732.1	22																																																																																			DENND6B	-	pfam_Afi1_N		0.642	DENND6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DENND6B	HGNC	protein_coding	OTTHUMT00000316845.3	C	NM_001001794		50752655	-1	no_errors	ENST00000413817	ensembl	human	known	70_37	silent	SNP	1.000	T
DIS3	22894	genome.wustl.edu	37	13	73337593	73337593	+	Nonsense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr13:73337593G>C	ENST00000377767.4	-	16	2223	c.2123C>G	c.(2122-2124)tCa>tGa	p.S708*	DIS3_ENST00000377780.4_Nonsense_Mutation_p.S678*|DIS3_ENST00000545453.1_Nonsense_Mutation_p.S546*	NM_014953.3	NP_055768.3	Q9Y2L1	RRP44_HUMAN	DIS3 exosome endoribonuclease and 3'-5' exoribonuclease	708					CUT catabolic process (GO:0071034)|exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|positive regulation of GTPase activity (GO:0043547)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|rRNA catabolic process (GO:0016075)|rRNA processing (GO:0006364)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exosome (RNase complex) (GO:0000178)|membrane (GO:0016020)|nuclear exosome (RNase complex) (GO:0000176)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|endonuclease activity (GO:0004519)|guanyl-nucleotide exchange factor activity (GO:0005085)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(7)|kidney(5)|large_intestine(10)|lung(6)|prostate(2)|skin(1)	35		Breast(118;0.0074)|Acute lymphoblastic leukemia(28;0.0195)		GBM - Glioblastoma multiforme(99;0.000181)		CCTTACCCTTGACCTGGCTGC	0.333										Multiple Myeloma(4;0.011)																																							0													92.0	93.0	92.0					13																	73337593		2203	4300	6503	SO:0001587	stop_gained	22894			AB023225	CCDS9447.1, CCDS45057.1	13q21.32	2014-03-05	2014-03-05	2007-01-12	ENSG00000083520	ENSG00000083520			20604	protein-coding gene	gene with protein product	"""exosome component 11"""	607533	"""KIAA1008"", ""DIS3 mitotic control homolog (S. cerevisiae)"""	KIAA1008		11935316, 9562621	Standard	XM_005266294		Approved	dis3p, RRP44, EXOSC11	uc001vix.4	Q9Y2L1	OTTHUMG00000017070	ENST00000377767.4:c.2123C>G	13.37:g.73337593G>C	ENSP00000366997:p.Ser708*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NI21|B2RBL2|Q5W0P7|Q5W0P8|Q658Z7|Q7Z481|Q8WWI2|Q9UG36	Nonsense_Mutation	SNP	pfam_RNase_II/R,smart_PINc_nuc-bd,smart_RNase_II/R	p.S708*	ENST00000377767.4	37	c.2123	CCDS9447.1	13	.	.	.	.	.	.	.	.	.	.	G	44	10.866689	0.99480	.	.	ENSG00000083520	ENST00000377767;ENST00000377780;ENST00000545453	.	.	.	5.74	5.74	0.90152	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19590	T	0.45	.	19.9357	0.97140	0.0:0.0:1.0:0.0	.	.	.	.	X	708;678;546	.	ENSP00000366997:S708X	S	-	2	0	DIS3	72235594	1.000000	0.71417	0.954000	0.39281	0.273000	0.26683	9.837000	0.99465	2.715000	0.92844	0.655000	0.94253	TCA	DIS3	-	pfam_RNase_II/R,smart_RNase_II/R		0.333	DIS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DIS3	HGNC	protein_coding	OTTHUMT00000045250.2	G	NM_014953		73337593	-1	no_errors	ENST00000377767	ensembl	human	known	70_37	nonsense	SNP	1.000	C
DISC1	27185	genome.wustl.edu	37	1	232094594	232094594	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:232094594A>G	ENST00000439617.2	+	10	2055	c.2002A>G	c.(2002-2004)Act>Gct	p.T668A	DISC1_ENST00000535983.1_Intron|DISC1_ENST00000537876.1_Missense_Mutation_p.Y552C|DISC1_ENST00000366637.3_5'UTR|DISC1_ENST00000427560.1_3'UTR	NM_001164537.1|NM_001164540.1|NM_018662.2	NP_001158009.1|NP_001158012.1|NP_061132.2	Q9NRI5	DISC1_HUMAN	disrupted in schizophrenia 1	668	Interaction with ATF4 and ATF5.|Interaction with TRAF3IP1.|Necessary and sufficient for interaction with PCNT and localization at the centrosome.				canonical Wnt signaling pathway (GO:0060070)|cell proliferation in forebrain (GO:0021846)|cellular protein localization (GO:0034613)|cerebral cortex radially oriented cell migration (GO:0021799)|microtubule cytoskeleton organization (GO:0000226)|mitochondrial calcium ion homeostasis (GO:0051560)|neuron migration (GO:0001764)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of Wnt signaling pathway (GO:0030177)|regulation of neuron projection development (GO:0010975)|regulation of synapse maturation (GO:0090128)|TOR signaling (GO:0031929)	cell junction (GO:0030054)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|postsynaptic membrane (GO:0045211)				breast(1)|cervix(1)|kidney(1)|large_intestine(1)|liver(2)|lung(6)|skin(2)|upper_aerodigestive_tract(1)	15		all_cancers(173;0.0208)|Prostate(94;0.0975)				GAAGGAAAATACTATGAAGTA	0.328																																																	0													124.0	110.0	115.0					1																	232094594		1836	4089	5925	SO:0001583	missense	27185			AF222980	CCDS31055.1, CCDS31056.1, CCDS53482.1, CCDS53483.1, CCDS53484.1, CCDS59205.1, CCDS59206.1, CCDS59207.1	1q42.1	2008-02-05			ENSG00000162946	ENSG00000162946			2888	protein-coding gene	gene with protein product		605210				10814723	Standard	NM_001164550		Approved		uc010pxh.2	Q9NRI5	OTTHUMG00000037835	ENST00000439617.2:c.2002A>G	1.37:g.232094594A>G	ENSP00000403888:p.Thr668Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLH2|C4P091|C4P095|C4P0A1|C4P0A3|C4P0B3|C4P0B6|C4P0C1|C9J6D0|O75045|Q5VT44|Q5VT45|Q8IXJ0|Q8IXJ1|Q9BX19|Q9NRI3|Q9NRI4	Missense_Mutation	SNP	superfamily_Prefoldin	p.T668A	ENST00000439617.2	37	c.2002		1	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	A|A|A	4.509|4.509|4.509	0.094517|0.094517|0.094517	0.08632|0.08632|0.08632	.|.|.	.|.|.	ENSG00000162946|ENSG00000162946|ENSG00000162946	ENST00000422590|ENST00000439617;ENST00000366637;ENST00000366638;ENST00000532576|ENST00000537876	.|T|T	.|0.09723|0.13307	.|2.95|2.6	5.25|5.25|5.25	1.64|1.64|1.64	0.23874|0.23874|0.23874	.|.|.	.|0.411176|.	.|0.25017|.	.|N|.	.|0.033784|.	T|T|T	0.10766|0.10766|0.10766	0.0263|0.0263|0.0263	.|.|.	.|.|.	.|.|.	0.09310|0.09310|0.09310	N|N|N	1|1|1	.|B;B;B;P;B;P;B;B|B	.|0.37731|0.10296	.|0.009;0.347;0.084;0.607;0.1;0.607;0.208;0.208|0.003	.|B;B;B;B;B;B;B;B|B	.|0.30782|0.15052	.|0.022;0.12;0.05;0.12;0.038;0.12;0.068;0.068|0.012	T|T|T	0.27938|0.27938|0.27938	-1.0059|-1.0059|-1.0059	4|9|8	.|0.02654|0.87932	.|T|D	.|1|0	-0.0362|-0.0362|-0.0362	7.1694|7.1694|7.1694	0.25710|0.25710|0.25710	0.6077:0.0:0.3923:0.0|0.6077:0.0:0.3923:0.0|0.6077:0.0:0.3923:0.0	.|.|.	.|700;546;700;668;546;668;668;668|552	.|C4P096;C4P094;E2QRA4;C4P098;F5H1F1;C4P0A4;Q9NRI5-2;Q9NRI5|C4P0A1	.|.;.;.;.;.;.;.;DISC1_HUMAN|.	M|A|C	70|668;668;700;546|552	.|ENSP00000403888:T668A|ENSP00000440909:Y552C	.|ENSP00000355597:T668A|ENSP00000440909:Y552C	I|T|Y	+|+|+	3|1|2	3|0|0	DISC1|DISC1|DISC1	230161217|230161217|230161217	0.000000|0.000000|0.000000	0.05858|0.05858|0.05858	0.001000|0.001000|0.001000	0.08648|0.08648|0.08648	0.530000|0.530000|0.530000	0.34684|0.34684|0.34684	0.331000|0.331000|0.331000	0.19733|0.19733|0.19733	0.463000|0.463000|0.463000	0.27118|0.27118|0.27118	0.533000|0.533000|0.533000	0.62120|0.62120|0.62120	ATA|ACT|TAC	DISC1	-	NULL		0.328	DISC1-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest	protein_coding	DISC1	HGNC	protein_coding	OTTHUMT00000092351.2	A	NM_018662		232094594	+1	no_errors	ENST00000439617	ensembl	human	known	70_37	missense	SNP	0.016	G
DLGAP1	9229	genome.wustl.edu	37	18	3508607	3508607	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:3508607C>T	ENST00000315677.3	-	11	3127	c.2532G>A	c.(2530-2532)caG>caA	p.Q844Q	DLGAP1_ENST00000515196.2_Silent_p.Q844Q|DLGAP1_ENST00000584874.1_Silent_p.Q844Q|DLGAP1_ENST00000534970.1_Silent_p.Q528Q|DLGAP1_ENST00000539435.1_Silent_p.Q552Q|DLGAP1_ENST00000400150.3_Silent_p.Q560Q|DLGAP1_ENST00000400147.2_Silent_p.Q542Q|DLGAP1_ENST00000400155.1_Silent_p.Q550Q|DLGAP1_ENST00000400149.3_Silent_p.Q534Q|DLGAP1_ENST00000581699.1_Silent_p.Q550Q|DLGAP1_ENST00000400145.2_Silent_p.Q542Q|DLGAP1_ENST00000581527.1_Silent_p.Q844Q	NM_004746.3	NP_004737.2	O14490	DLGP1_HUMAN	discs, large (Drosophila) homolog-associated protein 1	844					synaptic transmission (GO:0007268)	cell junction (GO:0030054)|neuronal postsynaptic density (GO:0097481)|postsynaptic membrane (GO:0045211)				breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(6)|urinary_tract(1)	56		Colorectal(8;0.0257)				GGTAGAATTTCTGGGCCATGA	0.438																																																	0													73.0	66.0	69.0					18																	3508607		2203	4300	6503	SO:0001819	synonymous_variant	9229			AB000277	CCDS11836.1, CCDS42406.1, CCDS56049.1, CCDS56050.1, CCDS56051.1, CCDS56052.1, CCDS56053.1, CCDS74191.1	18p11.3	2008-07-28	2001-11-28		ENSG00000170579	ENSG00000170579			2905	protein-coding gene	gene with protein product		605445	"""discs, large (Drosophila) homolog-associated protein 1"""			9024696, 9286858	Standard	NM_004746		Approved	GKAP, SAPAP1, DAP-1	uc002kmf.3	O14490	OTTHUMG00000131537	ENST00000315677.3:c.2532G>A	18.37:g.3508607C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWN8|B2RMU8|B7WPA1|B7Z2H2|B7Z2I2|B7Z9Y4|O14489|P78335	Silent	SNP	pfam_GKAP	p.Q844	ENST00000315677.3	37	c.2532	CCDS11836.1	18																																																																																			DLGAP1	-	pfam_GKAP		0.438	DLGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP1	HGNC	protein_coding	OTTHUMT00000254394.4	C			3508607	-1	no_errors	ENST00000315677	ensembl	human	known	70_37	silent	SNP	1.000	T
DLGAP2	9228	genome.wustl.edu	37	8	1616746	1616746	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:1616746G>C	ENST00000421627.2	+	6	1956	c.1822G>C	c.(1822-1824)Gag>Cag	p.E608Q		NM_004745.3	NP_004736.2	Q9P1A6	DLGP2_HUMAN	discs, large (Drosophila) homolog-associated protein 2	687					neuron-neuron synaptic transmission (GO:0007270)	cell junction (GO:0030054)|neurofilament (GO:0005883)|postsynaptic membrane (GO:0045211)				breast(1)|endometrium(6)|lung(31)|prostate(3)	41		Ovarian(12;0.0271)|Hepatocellular(245;0.0838)|Colorectal(14;0.0846)		BRCA - Breast invasive adenocarcinoma(11;0.000169)|READ - Rectum adenocarcinoma(644;0.171)		CCACCTGCCAGAGAGCCAGAG	0.652																																																	0													14.0	19.0	17.0					8																	1616746		2097	4202	6299	SO:0001583	missense	9228			AB000275	CCDS47760.1, CCDS75689.1	8p23	2007-12-06	2001-11-28		ENSG00000198010	ENSG00000198010			2906	protein-coding gene	gene with protein product		605438	"""discs, large (Drosophila) homolog-associated protein 2"""			9286858, 10854099	Standard	NM_004745		Approved	DAP-2	uc003wpl.4	Q9P1A6	OTTHUMG00000163599	ENST00000421627.2:c.1822G>C	8.37:g.1616746G>C	ENSP00000400258:p.Glu608Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A1QCF8|A1QCF9|A5D8Y2|O14488|O14664|Q9P1A7	Missense_Mutation	SNP	pfam_GKAP	p.E608Q	ENST00000421627.2	37	c.1822	CCDS47760.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.184|5.184	0.219437|0.219437	0.09863|0.09863	.|.	.|.	ENSG00000198010|ENSG00000198010	ENST00000356067;ENST00000421627|ENST00000520901	T|.	0.12039|.	2.72|.	5.52|5.52	5.52|5.52	0.82312|0.82312	.|.	1.194990|.	0.05640|.	N|.	0.583167|.	T|T	0.53738|0.53738	0.1815|0.1815	L|L	0.42245|0.42245	1.32|1.32	0.21220|0.21220	N|N	0.99976|0.99976	B;B|.	0.25772|.	0.006;0.134|.	B;B|.	0.25405|.	0.012;0.06|.	T|T	0.48198|0.48198	-0.9056|-0.9056	10|5	0.18276|.	T|.	0.48|.	-4.8339|-4.8339	19.4384|19.4384	0.94807|0.94807	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	687;687|.	Q9P1A6-2;Q9P1A6|.	.;DLGP2_HUMAN|.	Q|H	653;608|624	ENSP00000400258:E608Q|.	ENSP00000348366:E653Q|.	E|Q	+|+	1|3	0|2	DLGAP2|DLGAP2	1604153|1604153	1.000000|1.000000	0.71417|0.71417	0.010000|0.010000	0.14722|0.14722	0.002000|0.002000	0.02628|0.02628	6.751000|6.751000	0.74893|0.74893	2.589000|2.589000	0.87451|0.87451	0.650000|0.650000	0.86243|0.86243	GAG|CAG	DLGAP2	-	NULL		0.652	DLGAP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DLGAP2	HGNC	protein_coding	OTTHUMT00000374478.1	G	NM_004745		1616746	+1	no_errors	ENST00000421627	ensembl	human	known	70_37	missense	SNP	0.477	C
DMD	1756	genome.wustl.edu	37	X	32486617	32486617	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:32486617G>A	ENST00000357033.4	-	23	3366	c.3160C>T	c.(3160-3162)Cag>Tag	p.Q1054*	DMD_ENST00000378677.2_Nonsense_Mutation_p.Q1050*	NM_000109.3|NM_004006.2|NM_004011.3|NM_004012.3|NM_004014.2	NP_000100.2|NP_003997|NP_004002.2|NP_004003.1|NP_004005.1	P11532	DMD_HUMAN	dystrophin	1054					cardiac muscle cell action potential (GO:0086001)|cardiac muscle contraction (GO:0060048)|cellular protein complex assembly (GO:0043623)|cellular protein localization (GO:0034613)|extracellular matrix organization (GO:0030198)|motile cilium assembly (GO:0044458)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of peptidyl-serine phosphorylation (GO:0033137)|peptide biosynthetic process (GO:0043043)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of neuron projection development (GO:0010976)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of cellular response to growth factor stimulus (GO:0090287)|regulation of heart rate (GO:0002027)|regulation of release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0010880)|regulation of ryanodine-sensitive calcium-release channel activity (GO:0060314)|regulation of skeletal muscle contraction (GO:0014819)|regulation of skeletal muscle contraction by regulation of release of sequestered calcium ion (GO:0014809)|regulation of voltage-gated calcium channel activity (GO:1901385)	cell junction (GO:0030054)|cell surface (GO:0009986)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dystrophin-associated glycoprotein complex (GO:0016010)|filopodium (GO:0030175)|filopodium membrane (GO:0031527)|membrane raft (GO:0045121)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|syntrophin complex (GO:0016013)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|dystroglycan binding (GO:0002162)|myosin binding (GO:0017022)|nitric-oxide synthase binding (GO:0050998)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)|zinc ion binding (GO:0008270)			NS(2)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(17)|liver(1)|lung(25)|ovary(3)|pancreas(3)|prostate(2)|skin(1)|urinary_tract(2)	77		all_cancers(2;1.22e-16)|Acute lymphoblastic leukemia(2;4.65e-06)|all_hematologic(2;0.00108)|all_epithelial(3;0.00626)|all_neural(2;0.0189)|all_lung(315;0.182)|Glioma(3;0.203)				TGAATTACCTGAATTTTTCGG	0.368																																																	0													46.0	39.0	41.0					X																	32486617		2201	4297	6498	SO:0001587	stop_gained	1756			AF047505	CCDS14231.1, CCDS14232.1, CCDS14233.1, CCDS14234.1, CCDS48091.1, CCDS55394.1, CCDS55395.1, CCDS75965.1	Xp21.2	2014-09-17	2008-08-01		ENSG00000198947	ENSG00000198947			2928	protein-coding gene	gene with protein product	"""muscular dystrophy, Duchenne and Becker types"""	300377	"""dystrophin (muscular dystrophy, Duchenne and Becker types), includes DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272"", ""mental retardation, X-linked 85"""	MRX85		3282674, 3607877, 23900271	Standard	NM_004019		Approved	BMD, DXS142, DXS164, DXS206, DXS230, DXS239, DXS268, DXS269, DXS270, DXS272	uc004dda.1	P11532	OTTHUMG00000021336	ENST00000357033.4:c.3160C>T	X.37:g.32486617G>A	ENSP00000354923:p.Gln1054*	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PDN1|Q02295|Q14169|Q14170|Q5JYU0|Q6NSJ9|Q7KZ48|Q8N754|Q9UCW3|Q9UCW4	Nonsense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_CH-domain,pfam_Znf_ZZ,pfam_WW_Rsp5_WWP,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_WW_Rsp5_WWP,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_WW_Rsp5_WWP,smart_Znf_ZZ,pirsf_Dystrophin/utrophin,pfscan_CH-domain,pfscan_WW_Rsp5_WWP,pfscan_Znf_ZZ	p.Q1054*	ENST00000357033.4	37	c.3160	CCDS14233.1	X	.	.	.	.	.	.	.	.	.	.	G	42	9.197135	0.99098	.	.	ENSG00000198947	ENST00000534884;ENST00000378677;ENST00000357033;ENST00000542849;ENST00000535280	.	.	.	5.12	4.23	0.50019	.	0.000000	0.32503	U	0.006013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.40728	T	0.16	.	14.8448	0.70251	0.0:0.1408:0.8591:0.0	.	.	.	.	X	1046;1050;1054;1054;931	.	ENSP00000354923:Q1054X	Q	-	1	0	DMD	32396538	1.000000	0.71417	1.000000	0.80357	0.533000	0.34776	5.736000	0.68597	1.004000	0.39156	0.538000	0.68166	CAG	DMD	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin,pirsf_Dystrophin/utrophin		0.368	DMD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DMD	HGNC	protein_coding	OTTHUMT00000056182.2	G	NM_004006		32486617	-1	no_errors	ENST00000357033	ensembl	human	known	70_37	nonsense	SNP	1.000	A
DNAH14	127602	genome.wustl.edu	37	1	225231637	225231637	+	Intron	DEL	T	T	-	rs569001107	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:225231637delT	ENST00000445597.2	+	11	1825				DNAH14_ENST00000439375.2_Frame_Shift_Del_p.F622fs|DNAH14_ENST00000430092.1_Frame_Shift_Del_p.F622fs			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14						microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						CAGATTGGAGTTTTCAGTAAA	0.274													TTTT|TTTT|TTT|deletion	12	0.00239617	0.0	0.0058	5008	,	,		16878	0.0		0.008	False		,,,				2504	0.0																0										3,1747		0,3,872	28.0	24.0	25.0			-9.6	0.1	1		26	21,3687		0,21,1833	no	frameshift	DNAH14	NM_001373.1		0,24,2705	A1A1,A1R,RR		0.5663,0.1714,0.4397			225231637	24,5434	692	1557	2249	SO:0001627	intron_variant	127602			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.1825+821T>-	1.37:g.225231637delT		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Frame_Shift_Del	DEL	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.S623fs	ENST00000445597.2	37	c.1864		1																																																																																			DNAH14	-	NULL		0.274	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	T	XM_059166		225231637	+1	no_errors	ENST00000430092	ensembl	human	known	70_37	frame_shift_del	DEL	0.637	-
DNAH7	56171	genome.wustl.edu	37	2	196834744	196834744	+	Silent	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:196834744A>G	ENST00000312428.6	-	17	2233	c.2133T>C	c.(2131-2133)gaT>gaC	p.D711D		NM_018897.2	NP_061720.2	Q8WXX0	DYH7_HUMAN	dynein, axonemal, heavy chain 7	711	Stem. {ECO:0000250}.				cilium movement (GO:0003341)|cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)	axonemal dynein complex (GO:0005858)|cilium (GO:0005929)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|microtubule motor activity (GO:0003777)			NS(4)|breast(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(15)|large_intestine(28)|liver(3)|lung(100)|ovary(4)|prostate(5)|skin(26)|upper_aerodigestive_tract(2)|urinary_tract(3)	205						CATCCTGAAGATCTCCAAATG	0.328																																																	0													88.0	83.0	85.0					2																	196834744		1833	4078	5911	SO:0001819	synonymous_variant	56171			AF327442	CCDS42794.1	2q33.1	2013-01-10	2006-09-04		ENSG00000118997	ENSG00000118997		"""Axonemal dyneins"", ""EF-hand domain containing"""	18661	protein-coding gene	gene with protein product		610061	"""dynein, axonemal, heavy polypeptide 7"""			9373155, 11877439	Standard	NM_018897		Approved	KIAA0944	uc002utj.4	Q8WXX0	OTTHUMG00000154438	ENST00000312428.6:c.2133T>C	2.37:g.196834744A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZX8|O00433|O95492|Q4G152|Q53QX7|Q53S64|Q53T02|Q68CY5|Q8N1Z2|Q9UMS3|Q9Y2F3	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_Signal_recog_particle_SRP9/14,smart_AAA+_ATPase,pfscan_EF_HAND_2	p.D711	ENST00000312428.6	37	c.2133	CCDS42794.1	2																																																																																			DNAH7	-	NULL		0.328	DNAH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH7	HGNC	protein_coding	OTTHUMT00000335202.3	A	NM_018897		196834744	-1	no_errors	ENST00000312428	ensembl	human	known	70_37	silent	SNP	0.198	G
DNM2	1785	genome.wustl.edu	37	19	10886548	10886548	+	Silent	SNP	C	C	T	rs140788791	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:10886548C>T	ENST00000355667.6	+	4	635	c.555C>T	c.(553-555)gaC>gaT	p.D185D	DNM2_ENST00000591819.1_3'UTR|DNM2_ENST00000389253.4_Silent_p.D185D|DNM2_ENST00000359692.6_Silent_p.D185D|DNM2_ENST00000585892.1_Silent_p.D185D|DNM2_ENST00000408974.4_Silent_p.D185D|DNM2_ENST00000314646.5_Silent_p.D185D	NM_001005360.2|NM_001190716.1	NP_001005360.1|NP_001177645.1	P50570	DYN2_HUMAN	dynamin 2	185	Dynamin-type G.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|endocytosis (GO:0006897)|G2/M transition of mitotic cell cycle (GO:0000086)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|nitric oxide metabolic process (GO:0046209)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription, DNA-templated (GO:0045893)|post-Golgi vesicle-mediated transport (GO:0006892)|receptor internalization (GO:0031623)|regulation of nitric-oxide synthase activity (GO:0050999)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic vesicle transport (GO:0048489)|transferrin transport (GO:0033572)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	enzyme binding (GO:0019899)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|microtubule binding (GO:0008017)			breast(2)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(6)|kidney(2)|large_intestine(10)|lung(11)|ovary(2)|skin(3)|upper_aerodigestive_tract(2)	42			Epithelial(33;4.17e-05)|all cancers(31;8.48e-05)			CCAACTCCGACGCCCTCAAGC	0.602			"""F, N, Splice, Mis, O"""		ETP ALL																																			Rec	yes		19	19p13.2	1785	dynamin 2		L	0								C	,,,,	0,4406		0,0,2203	62.0	57.0	59.0		555,555,555,555,555	-10.8	0.0	19	dbSNP_134	59	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	DNM2	NM_001005360.2,NM_001005361.2,NM_001005362.2,NM_001190716.1,NM_004945.3	,,,,	0,2,6501	TT,TC,CC		0.0233,0.0,0.0154	,,,,	185/871,185/871,185/867,185/870,185/867	10886548	2,13004	2203	4300	6503	SO:0001819	synonymous_variant	1785				CCDS32907.1, CCDS32908.1, CCDS45968.1, CCDS45969.1, CCDS59351.1	19p	2014-09-17						"""Pleckstrin homology (PH) domain containing"""	2974	protein-coding gene	gene with protein product	"""dynamin II"", ""cytoskeletal protein"""	602378				7590285, 9143510	Standard	NM_001190716		Approved	DYNII, DYN2, CMTDIB, CMTDI1, DI-CMTB	uc002mps.2	P50570		ENST00000355667.6:c.555C>T	19.37:g.10886548C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1B6|E7EV30|E9PEQ4|K7ESI9|Q5I0Y0|Q7Z5S3|Q9UPH4	Silent	SNP	pfam_Dynamin_central,pfam_Dynamin_GTPase,pfam_GED,pfam_Pleckstrin_homology,smart_Dynamin_GTPase,smart_Pleckstrin_homology,smart_GED,pfscan_Pleckstrin_homology,prints_Dynamin	p.D185	ENST00000355667.6	37	c.555	CCDS45968.1	19																																																																																			DNM2	-	pfam_Dynamin_GTPase,smart_Dynamin_GTPase,prints_Dynamin		0.602	DNM2-001	KNOWN	basic|CCDS	protein_coding	DNM2	HGNC	protein_coding	OTTHUMT00000452592.1	C	NM_004945		10886548	+1	no_errors	ENST00000314646	ensembl	human	known	70_37	silent	SNP	0.015	T
DPY19L1	23333	genome.wustl.edu	37	7	34971262	34971262	+	Missense_Mutation	SNP	C	C	T	rs200053924		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:34971262C>T	ENST00000310974.4	-	22	2095	c.1951G>A	c.(1951-1953)Gtg>Atg	p.V651M		NM_015283.1	NP_056098.1	Q2PZI1	D19L1_HUMAN	dpy-19-like 1 (C. elegans)	651						integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity, transferring glycosyl groups (GO:0016757)			endometrium(3)|kidney(5)|large_intestine(8)|lung(8)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	31						GAATCCTTCACCAAGAGGTTA	0.428																																																	0								C	MET/VAL	0,3590		0,0,1795	52.0	44.0	46.0		1951	5.3	1.0	7		46	1,8085		0,1,4042	no	missense	DPY19L1	NM_015283.1	21	0,1,5837	TT,TC,CC		0.0124,0.0,0.0086	benign	651/676	34971262	1,11675	1795	4043	5838	SO:0001583	missense	23333			AB020684	CCDS43567.1	7p14.3-p14.2	2006-04-26			ENSG00000173852	ENSG00000173852			22205	protein-coding gene	gene with protein product		613892					Standard	NM_015283		Approved	KIAA0877	uc003tem.4	Q2PZI1	OTTHUMG00000154888	ENST00000310974.4:c.1951G>A	7.37:g.34971262C>T	ENSP00000308695:p.Val651Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O94954|Q4G151	Missense_Mutation	SNP	pfam_Dpy-19	p.V651M	ENST00000310974.4	37	c.1951	CCDS43567.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.01|12.01	1.810455|1.810455	0.32053|0.32053	0.0|0.0	1.24E-4|1.24E-4	ENSG00000173852|ENSG00000173852	ENST00000428054|ENST00000389292;ENST00000310974	.|T	.|0.55052	.|0.54	5.26|5.26	5.26|5.26	0.73747|0.73747	.|.	.|0.281316	.|0.35349	.|N	.|0.003262	T|T	0.50922|0.50922	0.1644|0.1644	N|N	0.17474|0.17474	0.49|0.49	0.29148|0.29148	N|N	0.878576|0.878576	.|D	.|0.62365	.|0.991	.|P	.|0.62014	.|0.897	T|T	0.46345|0.46345	-0.9198|-0.9198	5|10	.|0.29301	.|T	.|0.29	-18.8071|-18.8071	11.2867|11.2867	0.49226|0.49226	0.0:0.9066:0.0:0.0934|0.0:0.9066:0.0:0.0934	.|.	.|651	.|Q2PZI1	.|D19L1_HUMAN	D|M	58|61;651	.|ENSP00000308695:V651M	.|ENSP00000308695:V651M	G|V	-|-	2|1	0|0	DPY19L1|DPY19L1	34937787|34937787	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.492000|2.492000	0.45311|0.45311	2.462000|2.462000	0.83206|0.83206	0.643000|0.643000	0.83706|0.83706	GGT|GTG	DPY19L1	-	pfam_Dpy-19		0.428	DPY19L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DPY19L1	HGNC	protein_coding	OTTHUMT00000337506.1	C			34971262	-1	no_errors	ENST00000310974	ensembl	human	known	70_37	missense	SNP	1.000	T
DRD3	1814	genome.wustl.edu	37	3	113850099	113850099	+	Missense_Mutation	SNP	G	G	A	rs201876283		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:113850099G>A	ENST00000460779.1	-	7	1161	c.872C>T	c.(871-873)gCg>gTg	p.A291V	DRD3_ENST00000467632.1_Missense_Mutation_p.A291V|DRD3_ENST00000295881.7_Intron|DRD3_ENST00000383673.2_Missense_Mutation_p.A291V	NM_001282563.1	NP_001269492.1	P35462	DRD3_HUMAN	dopamine receptor D3	291					acid secretion (GO:0046717)|adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|arachidonic acid secretion (GO:0050482)|behavioral response to cocaine (GO:0048148)|cellular calcium ion homeostasis (GO:0006874)|circadian regulation of gene expression (GO:0032922)|dopamine metabolic process (GO:0042417)|G-protein coupled receptor internalization (GO:0002031)|G-protein coupled receptor signaling pathway (GO:0007186)|gastric emptying (GO:0035483)|learning (GO:0007612)|learning or memory (GO:0007611)|locomotory behavior (GO:0007626)|musculoskeletal movement, spinal reflex action (GO:0050883)|negative regulation of adenylate cyclase activity (GO:0007194)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine receptor signaling pathway (GO:0060160)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein secretion (GO:0050709)|negative regulation of sodium:proton antiporter activity (GO:0032416)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokinesis (GO:0032467)|positive regulation of dopamine receptor signaling pathway (GO:0060161)|positive regulation of mitosis (GO:0045840)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|prepulse inhibition (GO:0060134)|regulation of blood volume by renin-angiotensin (GO:0002016)|regulation of cAMP metabolic process (GO:0030814)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|regulation of dopamine secretion (GO:0014059)|regulation of dopamine uptake involved in synaptic transmission (GO:0051584)|regulation of lipid metabolic process (GO:0019216)|regulation of locomotion involved in locomotory behavior (GO:0090325)|regulation of multicellular organism growth (GO:0040014)|response to amphetamine (GO:0001975)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|response to histamine (GO:0034776)|response to morphine (GO:0043278)|social behavior (GO:0035176)|synaptic transmission, dopaminergic (GO:0001963)|visual learning (GO:0008542)	apical part of cell (GO:0045177)|cell projection (GO:0042995)|endocytic vesicle (GO:0030139)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	dopamine binding (GO:0035240)|dopamine neurotransmitter receptor activity, coupled via Gi/Go (GO:0001591)|drug binding (GO:0008144)			central_nervous_system(2)|endometrium(1)|kidney(2)|large_intestine(4)|liver(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)	36					Amisulpride(DB06288)|Amoxapine(DB00543)|Apomorphine(DB00714)|Aripiprazole(DB01238)|Asenapine(DB06216)|Bromocriptine(DB01200)|Cabergoline(DB00248)|Chlorpromazine(DB00477)|Chlorprothixene(DB01239)|Clozapine(DB00363)|Domperidone(DB01184)|Dopamine(DB00988)|Haloperidol(DB00502)|Iloperidone(DB04946)|L-DOPA(DB01235)|Lisuride(DB00589)|Loxapine(DB00408)|Methotrimeprazine(DB01403)|Mianserin(DB06148)|Mirtazapine(DB00370)|Olanzapine(DB00334)|Paliperidone(DB01267)|Pergolide(DB01186)|Pimozide(DB01100)|Pramipexole(DB00413)|Quetiapine(DB01224)|Remoxipride(DB00409)|Risperidone(DB00734)|Ropinirole(DB00268)|Rotigotine(DB05271)|Sulpiride(DB00391)|Yohimbine(DB01392)|Ziprasidone(DB00246)	GAGCTTGGGCGCTATGGTGGG	0.542																																																	0													198.0	203.0	201.0					3																	113850099		2203	4300	6503	SO:0001583	missense	1814				CCDS2978.1, CCDS33829.1	3q13.3	2012-08-08			ENSG00000151577	ENSG00000151577		"""GPCR / Class A : Dopamine receptors"""	3024	protein-coding gene	gene with protein product		126451				1916765	Standard	XM_005247171		Approved		uc003ebc.1	P35462	OTTHUMG00000159334	ENST00000460779.1:c.872C>T	3.37:g.113850099G>A	ENSP00000419402:p.Ala291Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4V5|Q4VBM8	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Dopa_D3_rcpt,prints_GPCR_Rhodpsn,prints_Dopamine_rcpt	p.A291V	ENST00000460779.1	37	c.872	CCDS2978.1	3	.	.	.	.	.	.	.	.	.	.	G	12.66	2.005881	0.35415	.	.	ENSG00000151577	ENST00000460779;ENST00000467632;ENST00000383673	T;T;T	0.72505	-0.66;-0.66;-0.66	5.52	5.52	0.82312	GPCR, rhodopsin-like superfamily (1);	0.216999	0.39834	N	0.001249	T	0.61887	0.2383	L	0.46741	1.465	0.36969	D	0.893749	B;B;B	0.30526	0.028;0.283;0.283	B;B;B	0.22880	0.028;0.042;0.042	T	0.61969	-0.6953	10	0.14656	T	0.56	.	16.9919	0.86356	0.0:0.0:1.0:0.0	.	291;291;291	A1A4V4;A8K8E4;P35462	.;.;DRD3_HUMAN	V	291	ENSP00000419402:A291V;ENSP00000420662:A291V;ENSP00000373169:A291V	ENSP00000373169:A291V	A	-	2	0	DRD3	115332789	1.000000	0.71417	1.000000	0.80357	0.702000	0.40608	4.877000	0.63086	2.866000	0.98385	0.650000	0.86243	GCG	DRD3	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Dopa_D3_rcpt		0.542	DRD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DRD3	HGNC	protein_coding	OTTHUMT00000354699.1	G	NM_000796.3		113850099	-1	no_errors	ENST00000383673	ensembl	human	known	70_37	missense	SNP	0.998	A
DSG4	147409	genome.wustl.edu	37	18	28983423	28983423	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:28983423C>T	ENST00000308128.4	+	11	1597	c.1462C>T	c.(1462-1464)Cct>Tct	p.P488S	DSG4_ENST00000359747.4_Missense_Mutation_p.P488S|RP11-534N16.1_ENST00000578477.1_RNA|RP11-534N16.1_ENST00000581856.1_RNA|RP11-534N16.1_ENST00000581452.1_RNA	NM_177986.3	NP_817123.1	Q86SJ6	DSG4_HUMAN	desmoglein 4	488	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				anagen (GO:0042640)|BMP signaling pathway (GO:0030509)|homophilic cell adhesion (GO:0007156)|keratinocyte differentiation (GO:0030216)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.P488T(2)		NS(1)|breast(1)|central_nervous_system(6)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(11)|liver(2)|lung(35)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	70			OV - Ovarian serous cystadenocarcinoma(10;0.00504)			TATTGAGGTTCCTGATATCAA	0.383																																																	2	Substitution - Missense(2)	lung(2)											97.0	88.0	91.0					18																	28983423		2203	4300	6503	SO:0001583	missense	147409			AY177664, AY168788	CCDS11897.1, CCDS45845.1	18q12.1	2010-01-26			ENSG00000175065	ENSG00000175065		"""Cadherins / Major cadherins"""	21307	protein-coding gene	gene with protein product		607892				12648213	Standard	NM_001134453		Approved	CDHF13, LAH	uc002kwq.2	Q86SJ6	OTTHUMG00000131979	ENST00000308128.4:c.1462C>T	18.37:g.28983423C>T	ENSP00000311859:p.Pro488Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUI1|Q6Y9L9|Q8IXV4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmoglein,prints_Desmo_cadherin	p.P488S	ENST00000308128.4	37	c.1462	CCDS11897.1	18	.	.	.	.	.	.	.	.	.	.	C	13.62	2.292155	0.40594	.	.	ENSG00000175065	ENST00000308128;ENST00000359747	T;T	0.60040	0.22;0.22	5.71	4.82	0.62117	Cadherin (4);Cadherin-like (1);	0.509237	0.14813	N	0.296908	T	0.60932	0.2307	M	0.75447	2.3	0.30742	N	0.746096	B;B	0.28258	0.134;0.205	B;B	0.30029	0.045;0.11	T	0.62300	-0.6883	10	0.36615	T	0.2	.	15.532	0.75970	0.0:0.6235:0.3765:0.0	.	488;488	Q86SJ6-2;Q86SJ6	.;DSG4_HUMAN	S	488	ENSP00000311859:P488S;ENSP00000352785:P488S	ENSP00000311859:P488S	P	+	1	0	DSG4	27237421	1.000000	0.71417	1.000000	0.80357	0.885000	0.51271	1.417000	0.34770	1.508000	0.48769	0.655000	0.94253	CCT	DSG4	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmo_cadherin		0.383	DSG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DSG4	HGNC	protein_coding	OTTHUMT00000254941.1	C	NM_177986		28983423	+1	no_errors	ENST00000359747	ensembl	human	known	70_37	missense	SNP	1.000	T
DSPP	1834	genome.wustl.edu	37	4	88537522	88537522	+	Silent	SNP	C	C	T	rs111884410		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:88537522C>T	ENST00000282478.7	+	4	3741	c.3708C>T	c.(3706-3708)gaC>gaT	p.D1236D	DSPP_ENST00000399271.1_Silent_p.D1236D|RP11-742B18.1_ENST00000506480.1_RNA			Q9NZW4	DSPP_HUMAN	dentin sialophosphoprotein	1236	Asp/Ser-rich.				biomineral tissue development (GO:0031214)|cellular response to cell-matrix adhesion (GO:0071460)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)			breast(2)|central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(8)|lung(13)|ovary(1)|skin(3)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	47		Hepatocellular(203;0.114)|all_hematologic(202;0.236)		OV - Ovarian serous cystadenocarcinoma(123;0.000508)		aaagcagcgacagcagtgaca	0.537																																																	0													73.0	88.0	82.0					4																	88537522		1653	2956	4609	SO:0001819	synonymous_variant	1834			AF163151	CCDS43248.1	4q21.3	2008-02-05			ENSG00000152591	ENSG00000152591			3054	protein-coding gene	gene with protein product		125485		DFNA39, DGI1		8995371, 9533027	Standard	NM_014208		Approved	DMP3	uc003hqu.3	Q9NZW4	OTTHUMG00000161061	ENST00000282478.7:c.3708C>T	4.37:g.88537522C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MUI0|O95815	Silent	SNP	NULL	p.D1236	ENST00000282478.7	37	c.3708	CCDS43248.1	4																																																																																			DSPP	-	NULL		0.537	DSPP-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	DSPP	HGNC	protein_coding	OTTHUMT00000363616.3	C	NM_014208		88537522	+1	no_errors	ENST00000282478	ensembl	human	known	70_37	silent	SNP	0.991	T
DTX2	113878	genome.wustl.edu	37	7	76112111	76112111	+	Silent	SNP	C	C	T	rs143776913	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:76112111C>T	ENST00000324432.5	+	5	1065	c.555C>T	c.(553-555)atC>atT	p.I185I	DTX2_ENST00000307569.8_Silent_p.I185I|DTX2_ENST00000446820.2_Silent_p.I185I|DTX2_ENST00000413936.2_Silent_p.I185I|DTX2_ENST00000446600.1_Silent_p.I94I|DTX2_ENST00000430490.2_Silent_p.I185I	NM_020892.2	NP_065943.2	Q86UW9	DTX2_HUMAN	deltex 2, E3 ubiquitin ligase	185					Notch signaling pathway (GO:0007219)|protein ubiquitination (GO:0016567)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(14)|ovary(1)|skin(1)|stomach(2)	27						TGACCACCATCATCGCTCCGC	0.652																																																	0													48.0	49.0	49.0					7																	76112111		2203	4299	6502	SO:0001819	synonymous_variant	113878				CCDS5587.1, CCDS43605.1	7q11.23	2014-01-28	2014-01-28		ENSG00000091073	ENSG00000091073		"""RING-type (C3HC4) zinc fingers"""	15973	protein-coding gene	gene with protein product		613141	"""deltex (Drosophila) homolog 2"", ""deltex homolog 2 (Drosophila)"""			12670957	Standard	NM_020892		Approved	RNF58, KIAA1528	uc003ufh.4	Q86UW9	OTTHUMG00000162594	ENST00000324432.5:c.555C>T	7.37:g.76112111C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6XM87|Q6XM88|Q96H69|Q9H890|Q9P200	Silent	SNP	pfam_WWE-dom,smart_WWE-dom_subgr,smart_Znf_RING,pfscan_WWE-dom,pfscan_Znf_RING	p.I185	ENST00000324432.5	37	c.555	CCDS5587.1	7																																																																																			DTX2	-	NULL		0.652	DTX2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DTX2	HGNC	protein_coding	OTTHUMT00000253104.2	C			76112111	+1	no_errors	ENST00000324432	ensembl	human	known	70_37	silent	SNP	0.331	T
DUSP1	1843	genome.wustl.edu	37	5	172196702	172196702	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:172196702C>G	ENST00000239223.3	-	3	851	c.609G>C	c.(607-609)ttG>ttC	p.L203F	RP11-779O18.3_ENST00000523005.1_RNA	NM_004417.3	NP_004408.1	P28562	DUS1_HUMAN	dual specificity phosphatase 1	203	Tyrosine-protein phosphatase.				cellular response to hormone stimulus (GO:0032870)|endoderm formation (GO:0001706)|inactivation of MAPK activity (GO:0000188)|intracellular signal transduction (GO:0035556)|mitotic cell cycle arrest (GO:0071850)|negative regulation of apoptotic process (GO:0043066)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of meiotic cell cycle (GO:0051447)|peptidyl-threonine dephosphorylation (GO:0035970)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of apoptotic process (GO:0043065)|protein dephosphorylation (GO:0006470)|regulation of apoptotic process (GO:0042981)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to estradiol (GO:0032355)|response to glucocorticoid (GO:0051384)|response to hydrogen peroxide (GO:0042542)|response to light stimulus (GO:0009416)|response to oxidative stress (GO:0006979)|response to retinoic acid (GO:0032526)|response to testosterone (GO:0033574)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|non-membrane spanning protein tyrosine phosphatase activity (GO:0004726)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|protein tyrosine/threonine phosphatase activity (GO:0008330)			NS(1)|breast(2)|endometrium(1)|large_intestine(1)|liver(1)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.000159)|Lung NSC(126;0.00431)|all_lung(126;0.00729)	all_hematologic(541;4.11e-18)|Breast(839;0.00637)|Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|Ovarian(839;0.15)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)	GBM - Glioblastoma multiforme(465;0.0103)		AGACGTTGATCAAGGCAGTGA	0.552																																																	0													204.0	170.0	182.0					5																	172196702		2203	4300	6503	SO:0001583	missense	1843			X68277	CCDS4380.1	5q35.1	2011-06-09			ENSG00000120129	ENSG00000120129		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3064	protein-coding gene	gene with protein product		600714		PTPN10		1406996, 7806236	Standard	NM_004417		Approved	HVH1, CL100, MKP-1	uc003mbv.2	P28562	OTTHUMG00000130523	ENST00000239223.3:c.609G>C	5.37:g.172196702C>G	ENSP00000239223:p.Leu203Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQL9|Q2V508	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Rhodanese-like_dom,pfam_Tyr_Pase_rcpt/non-rcpt,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pirsf_MKP,pfscan_Rhodanese-like_dom,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP	p.L203F	ENST00000239223.3	37	c.609	CCDS4380.1	5	.	.	.	.	.	.	.	.	.	.	C	17.72	3.457954	0.63401	.	.	ENSG00000120129	ENST00000239223;ENST00000457103;ENST00000434080	T	0.61742	0.08	5.32	4.4	0.53042	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	0.000000	0.85682	D	0.000000	T	0.75302	0.3831	M	0.78916	2.43	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.97110	0.995;1.0	T	0.78858	-0.2038	10	0.87932	D	0	.	14.0732	0.64872	0.0:0.7228:0.2772:0.0	.	203;160	P28562;B4DNT2	DUS1_HUMAN;.	F	203;176;138	ENSP00000239223:L203F	ENSP00000239223:L203F	L	-	3	2	DUSP1	172129308	0.960000	0.32886	1.000000	0.80357	0.997000	0.91878	-0.027000	0.12371	2.498000	0.84270	0.561000	0.74099	TTG	DUSP1	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pirsf_MKP,pfscan_Dual-sp_phosphatase_subgr_cat,prints_MKP,prints_Atypical_DUSP		0.552	DUSP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP1	HGNC	protein_coding	OTTHUMT00000252943.3	C	NM_004417		172196702	-1	no_errors	ENST00000239223	ensembl	human	known	70_37	missense	SNP	1.000	G
DUSP13	51207	genome.wustl.edu	37	10	76867864	76867864	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:76867864C>T	ENST00000372702.3	-	2	316	c.253G>A	c.(253-255)Ggc>Agc	p.G85S	DUSP13_ENST00000607131.1_Intron|DUSP13_ENST00000491677.2_5'UTR|DUSP13_ENST00000372700.3_Intron|DUSP13_ENST00000607009.1_5'UTR			Q9UII6	DS13B_HUMAN	dual specificity phosphatase 13	94					meiotic nuclear division (GO:0007126)|protein dephosphorylation (GO:0006470)|spermatogenesis (GO:0007283)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			large_intestine(3)|lung(3)|prostate(1)|urinary_tract(1)	8	all_cancers(46;0.0207)|all_epithelial(25;0.00126)|Prostate(51;0.0112)|Ovarian(15;0.0348)					ACACTGCTGCCGTAGAAGTCA	0.612																																					NSCLC(174;1655 2059 12324 40663 42963)												0													40.0	48.0	45.0					10																	76867864		2030	4164	6194	SO:0001583	missense	51207			AB027004	CCDS7346.1, CCDS31224.1, CCDS53542.1	10q23.1	2013-10-25			ENSG00000079393	ENSG00000079393		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	19681	protein-coding gene	gene with protein product		613191				10585869	Standard	XM_005269883		Approved	BEDP, TMDP, FLJ32450, DUSP13A, DUSP13B	uc001jwu.3	Q6B8I1	OTTHUMG00000018516	ENST00000372702.3:c.253G>A	10.37:g.76867864C>T	ENSP00000361787:p.Gly85Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K776|A8K782|B3KPY1|B3KXT0|B4DUK0|Q5JSC6|Q6IAR0|Q96GC2	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP,prints_Atypical_DUSP_famA	p.G85S	ENST00000372702.3	37	c.253	CCDS53542.1	10	.	.	.	.	.	.	.	.	.	.	C	24.0	4.480457	0.84747	.	.	ENSG00000079393	ENST00000372702	T	0.59772	0.24	5.2	4.29	0.51040	Dual specificity phosphatase, catalytic domain (1);Dual specificity phosphatase, subgroup, catalytic domain (2);	.	.	.	.	T	0.63674	0.2531	L	0.53561	1.675	0.80722	D	1	D	0.76494	0.999	D	0.67900	0.954	T	0.60586	-0.7234	9	0.15066	T	0.55	.	7.8421	0.29403	0.1631:0.755:0.0:0.0819	.	85	Q6B8I1	MDSP_HUMAN	S	85	ENSP00000361787:G85S	ENSP00000361787:G85S	G	-	1	0	DUSP13	76537870	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.302000	0.59092	1.396000	0.46663	0.655000	0.94253	GGC	DUSP13	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Dual-sp_phosphatase_subgr_cat		0.612	DUSP13-012	KNOWN	NMD_exception|basic|CCDS	protein_coding	DUSP13	HGNC	protein_coding	OTTHUMT00000401503.3	C			76867864	-1	no_errors	ENST00000372702	ensembl	human	known	70_37	missense	SNP	0.998	T
DYNC1H1	1778	genome.wustl.edu	37	14	102477145	102477145	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:102477145C>T	ENST00000360184.4	+	32	6638	c.6474C>T	c.(6472-6474)ttC>ttT	p.F2158F		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2158					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)			NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						CGCTGCTCTTCAGCCTCCTGT	0.567																																																	0													107.0	97.0	101.0					14																	102477145		2203	4300	6503	SO:0001819	synonymous_variant	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.6474C>T	14.37:g.102477145C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Silent	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.F2158	ENST00000360184.4	37	c.6474	CCDS9966.1	14																																																																																			DYNC1H1	-	NULL		0.567	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	C	NM_001376		102477145	+1	no_errors	ENST00000360184	ensembl	human	known	70_37	silent	SNP	1.000	T
EDAR	10913	genome.wustl.edu	37	2	109527312	109527312	+	Intron	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:109527312G>A	ENST00000258443.2	-	8	1086				EDAR_ENST00000376651.1_Missense_Mutation_p.S249F|EDAR_ENST00000409271.1_Missense_Mutation_p.S249F	NM_022336.3	NP_071731.1	Q9UNE0	EDAR_HUMAN	ectodysplasin A receptor						apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|epidermis development (GO:0008544)|hair follicle development (GO:0001942)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|salivary gland cavitation (GO:0060662)	apical part of cell (GO:0045177)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|prostate(1)|skin(1)	16						ACAGGCTGGGGAGAGAGGAGG	0.662																																																	0													51.0	52.0	51.0					2																	109527312		2203	4300	6503	SO:0001627	intron_variant	10913			AF130988	CCDS2081.1	2q13	2013-05-22	2004-08-09		ENSG00000135960	ENSG00000135960		"""Tumor necrosis factor receptor superfamily"""	2895	protein-coding gene	gene with protein product		604095	"""ectodysplasin 1, anhidrotic receptor"""	ED3, DL		10431241, 9375732	Standard	NM_022336		Approved	ED5, EDA3, Edar, ED1R, EDA1R	uc002teq.4	Q9UNE0	OTTHUMG00000130982	ENST00000258443.2:c.656-6C>T	2.37:g.109527312G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9H2|B4DLC5|D3DX74|E9PC98|Q52LL5|Q9UND9	Missense_Mutation	SNP	pfam_Death,superfamily_DEATH-like	p.S249F	ENST00000258443.2	37	c.746	CCDS2081.1	2	.	.	.	.	.	.	.	.	.	.	G	19.89	3.911323	0.72983	.	.	ENSG00000135960	ENST00000409271;ENST00000376651	D;D	0.91124	-2.79;-2.79	5.11	2.0	0.26442	.	2.019150	0.02299	N	0.070965	D	0.85465	0.5703	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.69018	-0.5256	9	0.59425	D	0.04	.	3.6815	0.08312	0.2178:0.0:0.3745:0.4077	.	249	E9PC98	.	F	249	ENSP00000386371:S249F;ENSP00000365839:S249F	ENSP00000365839:S249F	S	-	2	0	EDAR	108893744	0.002000	0.14202	0.000000	0.03702	0.743000	0.42351	0.371000	0.20450	0.066000	0.16515	0.561000	0.74099	TCC	EDAR	-	NULL		0.662	EDAR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDAR	HGNC	protein_coding	OTTHUMT00000253595.1	G			109527312	-1	no_errors	ENST00000376651	ensembl	human	known	70_37	missense	SNP	0.000	A
EDEM3	80267	genome.wustl.edu	37	1	184703699	184703699	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:184703699C>T	ENST00000318130.8	-	5	690	c.424G>A	c.(424-426)Gta>Ata	p.V142I	EDEM3_ENST00000367512.3_Missense_Mutation_p.V99I	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	142					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						AAGACTGATACGACTACATCG	0.244																																																	0													44.0	48.0	47.0					1																	184703699		2197	4290	6487	SO:0001583	missense	80267			AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.424G>A	1.37:g.184703699C>T	ENSP00000318147:p.Val142Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,pfam_Protease-assoc_domain,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.V142I	ENST00000318130.8	37	c.424	CCDS1363.2	1	.	.	.	.	.	.	.	.	.	.	C	31	5.079557	0.94050	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.72394	-0.65;-0.65	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.82245	0.4995	L	0.58428	1.81	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.67900	0.954;0.954	T	0.81671	-0.0827	10	0.54805	T	0.06	.	20.0795	0.97766	0.0:1.0:0.0:0.0	.	142;99	Q9BZQ6;B7ZLZ2	EDEM3_HUMAN;.	I	142;99	ENSP00000318147:V142I;ENSP00000356482:V99I	ENSP00000318147:V142I	V	-	1	0	EDEM3	182970322	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.302000	0.78861	2.747000	0.94245	0.650000	0.86243	GTA	EDEM3	-	pfam_Glyco_hydro_47,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47		0.244	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM3	HGNC	protein_coding	OTTHUMT00000085785.3	C	NM_025191		184703699	-1	no_errors	ENST00000318130	ensembl	human	known	70_37	missense	SNP	1.000	T
EDNRA	1909	genome.wustl.edu	37	4	148464977	148464978	+	3'UTR	INS	-	-	A	rs200631888|rs10305936	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:148464977_148464978insA	ENST00000324300.5	+	0	3006_3007				EDNRA_ENST00000503721.1_3'UTR|EDNRA_ENST00000358556.4_3'UTR|EDNRA_ENST00000339690.5_3'UTR	NM_001957.3	NP_001948.1	P25101	EDNRA_HUMAN	endothelin receptor type A						activation of adenylate cyclase activity (GO:0007190)|activation of phospholipase C activity (GO:0007202)|aging (GO:0007568)|artery smooth muscle contraction (GO:0014824)|cell proliferation (GO:0008283)|cellular response to mechanical stimulus (GO:0071260)|endothelin receptor signaling pathway (GO:0086100)|enteric nervous system development (GO:0048484)|fibroblast proliferation (GO:0048144)|G-protein coupled receptor signaling pathway (GO:0007186)|glomerular filtration (GO:0003094)|glucose transport (GO:0015758)|head development (GO:0060322)|heart development (GO:0007507)|histamine secretion (GO:0001821)|in utero embryonic development (GO:0001701)|maternal process involved in parturition (GO:0060137)|metabolic process (GO:0008152)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cAMP biosynthetic process (GO:0030818)|neural crest cell development (GO:0014032)|patterning of blood vessels (GO:0001569)|penile erection (GO:0043084)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of cytosolic calcium ion concentration involved in phospholipase C-activating G-protein coupled signaling pathway (GO:0051482)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of inflammatory response (GO:0050729)|positive regulation of kidney development (GO:0090184)|positive regulation of neutrophil chemotaxis (GO:0090023)|positive regulation of odontogenesis (GO:0042482)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of blood pressure (GO:0008217)|regulation of epithelial cell proliferation (GO:0050678)|respiratory gaseous exchange (GO:0007585)|response to hypoxia (GO:0001666)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|Rho protein signal transduction (GO:0007266)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|smooth muscle cell proliferation (GO:0048659)|smooth muscle contraction (GO:0006939)|vasoconstriction (GO:0042310)	integral component of plasma membrane (GO:0005887)|nuclear membrane (GO:0031965)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)	endothelin receptor activity (GO:0004962)|phosphatidylinositol phospholipase C activity (GO:0004435)			breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(3)|ovary(1)	17	all_hematologic(180;0.151)			GBM - Glioblastoma multiforme(119;0.154)	Acetylsalicylic acid(DB00945)|Bosentan(DB00559)|MACITENTAN(DB08932)|Sitaxentan(DB06268)	CACCAGAACTTACGATTCTTCA	0.411													A|A|AA|insertion	1973	0.39397	0.2481	0.4049	5008	,	,		16418	0.3998		0.3449	False		,,,				2504	0.6278																0																																										SO:0001624	3_prime_UTR_variant	1909			D90348	CCDS3769.1, CCDS54810.1, CCDS58927.1	4q31.22	2013-09-20			ENSG00000151617	ENSG00000151617		"""GPCR / Class A : Endothelin receptors"""	3179	protein-coding gene	gene with protein product		131243				1659806	Standard	NM_001957		Approved		uc003iky.3	P25101	OTTHUMG00000161354	ENST00000324300.5:c.*1208->A	4.37:g.148464978_148464978dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R723|B4E2V6|B7Z9G6|D3DP03|E7ER36|O43441|Q16432|Q16433|Q8TBH2	RNA	INS	-	NULL	ENST00000324300.5	37	NULL	CCDS3769.1	4																																																																																			EDNRA	-	-		0.411	EDNRA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDNRA	HGNC	protein_coding	OTTHUMT00000364635.1	-			148464978	+1	no_errors	ENST00000503721	ensembl	human	known	70_37	rna	INS	0.020:0.001	A
EEF1DP3	196549	genome.wustl.edu	37	13	32527156	32527156	+	RNA	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr13:32527156G>A	ENST00000428783.1	+	0	856							Q658K8	EF1DL_HUMAN	eukaryotic translation elongation factor 1 delta pseudogene 3								translation elongation factor activity (GO:0003746)										CAGCGACAATGAGGCAACACA	0.602																																																	0													22.0	20.0	21.0					13																	32527156		692	1591	2283			196549					13q13.1	2012-10-23			ENSG00000229715	ENSG00000229715			30486	pseudogene	pseudogene						12477932	Standard	NR_027062		Approved		uc001utu.3	Q658K8	OTTHUMG00000016691		13.37:g.32527156G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AR3	RNA	SNP	-	NULL	ENST00000428783.1	37	NULL		13																																																																																			EEF1DP3	-	-		0.602	EEF1DP3-001	KNOWN	basic	processed_transcript	EEF1DP3	HGNC	pseudogene	OTTHUMT00000044400.2	G	NR_027062		32527156	+1	no_errors	ENST00000428783	ensembl	human	known	70_37	rna	SNP	1.000	A
EGF	1950	genome.wustl.edu	37	4	110897270	110897270	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:110897270C>T	ENST00000265171.5	+	13	2377	c.1932C>T	c.(1930-1932)ccC>ccT	p.P644P	EGF_ENST00000503392.1_Silent_p.P644P|EGF_ENST00000509793.1_Silent_p.P602P	NM_001178130.1|NM_001963.4	NP_001171601.1|NP_001954.2	P01133	EGF_HUMAN	epidermal growth factor	644					activation of MAPKK activity (GO:0000186)|activation of transmembrane receptor protein tyrosine kinase activity (GO:0007171)|angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|branching morphogenesis of an epithelial tube (GO:0048754)|DNA replication (GO:0006260)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|mammary gland alveolus development (GO:0060749)|negative regulation of cholesterol efflux (GO:0090370)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of secretion (GO:0051048)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cerebellar granule cell precursor proliferation (GO:0021940)|positive regulation of DNA binding (GO:0043388)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of hyaluronan biosynthetic process (GO:1900127)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of mitosis (GO:0045840)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of phosphorylation (GO:0042327)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of calcium ion import (GO:0090279)|regulation of protein localization to cell surface (GO:2000008)|signal transduction (GO:0007165)|STAT protein import into nucleus (GO:0007262)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|plasma membrane (GO:0005886)|platelet alpha granule lumen (GO:0031093)	calcium ion binding (GO:0005509)|epidermal growth factor receptor binding (GO:0005154)|growth factor activity (GO:0008083)|transmembrane receptor protein tyrosine kinase activator activity (GO:0030297)			breast(1)|central_nervous_system(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(19)|ovary(1)|pancreas(1)|prostate(1)|skin(4)|soft_tissue(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Hepatocellular(203;0.0893)		OV - Ovarian serous cystadenocarcinoma(123;9.87e-06)	Sucralfate(DB00364)	TAATCTGGCCCAGTGGAATAA	0.458																																																	0													165.0	161.0	163.0					4																	110897270		2203	4300	6503	SO:0001819	synonymous_variant	1950			X04571	CCDS3689.1, CCDS54794.1, CCDS54795.1	4q25	2012-10-02	2010-05-11		ENSG00000138798	ENSG00000138798			3229	protein-coding gene	gene with protein product		131530	"""epidermal growth factor (beta-urogastrone)"""				Standard	NM_001963		Approved		uc003hzy.4	P01133	OTTHUMG00000132044	ENST00000265171.5:c.1932C>T	4.37:g.110897270C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRK7|E7EVD2|E9PBF0|Q52LZ6	Silent	SNP	pfam_LDLR_classB_rpt,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,smart_LDLR_classB_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,pirsf_Pro-epidermal_GF,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt	p.P644	ENST00000265171.5	37	c.1932	CCDS3689.1	4																																																																																			EGF	-	pfam_LDLR_classB_rpt,smart_LDLR_classB_rpt,pirsf_Pro-epidermal_GF,pfscan_LDLR_classB_rpt		0.458	EGF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EGF	HGNC	protein_coding	OTTHUMT00000255065.1	C			110897270	+1	no_errors	ENST00000265171	ensembl	human	known	70_37	silent	SNP	1.000	T
EHD4	30844	genome.wustl.edu	37	15	42193115	42193115	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:42193115C>T	ENST00000220325.4	-	6	1437	c.1354G>A	c.(1354-1356)Gac>Aac	p.D452N	RP11-23P13.6_ENST00000564432.2_RNA	NM_139265.3	NP_644670.1	Q9H223	EHD4_HUMAN	EH-domain containing 4	452	EH. {ECO:0000255|PROSITE- ProRule:PRU00077}.				cellular response to growth factor stimulus (GO:0071363)|endocytic recycling (GO:0032456)|pinocytosis (GO:0006907)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|protein homooligomerization (GO:0051260)|regulation of endocytosis (GO:0030100)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|nucleic acid binding (GO:0003676)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(7)|ovary(2)|stomach(1)|urinary_tract(1)	20		all_cancers(109;2.54e-12)|all_epithelial(112;6.59e-11)|Lung NSC(122;2.17e-07)|all_lung(180;8.79e-07)|Melanoma(134;0.091)		OV - Ovarian serous cystadenocarcinoma(18;1.6e-19)|GBM - Glioblastoma multiforme(94;3.77e-06)|COAD - Colon adenocarcinoma(120;0.0474)|Colorectal(105;0.0538)		AAGAGCTCGTCGTAGACGGGC	0.617																																																	0													79.0	67.0	71.0					15																	42193115		2203	4299	6502	SO:0001583	missense	30844			AF181265	CCDS10081.1	15q11.1	2013-01-10			ENSG00000103966	ENSG00000103966		"""EF-hand domain containing"""	3245	protein-coding gene	gene with protein product		605892		PAST4		10673336, 11533061	Standard	NM_139265		Approved		uc001zot.3	Q9H223	OTTHUMG00000130370	ENST00000220325.4:c.1354G>A	15.37:g.42193115C>T	ENSP00000220325:p.Asp452Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HAR1|Q9NZN2	Missense_Mutation	SNP	pfam_Dynamin_GTPase,smart_EPS15_homology,pfscan_EF_HAND_2,pfscan_EPS15_homology	p.D452N	ENST00000220325.4	37	c.1354	CCDS10081.1	15	.	.	.	.	.	.	.	.	.	.	C	21.7	4.194825	0.78902	.	.	ENSG00000103966	ENST00000220325	T	0.28895	1.59	4.68	4.68	0.58851	EPS15 homology (EH) (2);EF-hand-like domain (1);	0.049674	0.85682	D	0.000000	T	0.47322	0.1439	M	0.88842	2.985	0.80722	D	1	P	0.43607	0.812	B	0.43301	0.415	T	0.59742	-0.7397	10	0.46703	T	0.11	-22.4995	17.9348	0.89009	0.0:1.0:0.0:0.0	.	452	Q9H223	EHD4_HUMAN	N	452	ENSP00000220325:D452N	ENSP00000220325:D452N	D	-	1	0	EHD4	39980407	1.000000	0.71417	0.785000	0.31869	0.959000	0.62525	7.759000	0.85235	2.299000	0.77371	0.543000	0.68304	GAC	EHD4	-	smart_EPS15_homology,pfscan_EPS15_homology		0.617	EHD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHD4	HGNC	protein_coding	OTTHUMT00000252737.2	C	NM_139265		42193115	-1	no_errors	ENST00000220325	ensembl	human	known	70_37	missense	SNP	1.000	T
ELF3	1999	genome.wustl.edu	37	1	201981105	201981105	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:201981105G>T	ENST00000359651.3	+	2	3376	c.184G>T	c.(184-186)Gaa>Taa	p.E62*	ELF3_ENST00000495848.1_3'UTR|ELF3_ENST00000367283.3_Nonsense_Mutation_p.E62*|ELF3_ENST00000367284.5_Nonsense_Mutation_p.E62*|RP11-510N19.5_ENST00000504773.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						CTGGTTGGGGGAACAGCCCCA	0.537																																																	0													99.0	101.0	101.0					1																	201981105		2203	4300	6503	SO:0001587	stop_gained	1999			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.184G>T	1.37:g.201981105G>T	ENSP00000352673:p.Glu62*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,prints_Ets,pfscan_Ets	p.E62*	ENST00000359651.3	37	c.184	CCDS1419.1	1	.	.	.	.	.	.	.	.	.	.	G	17.89	3.500064	0.64298	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044;ENST00000446188	.	.	.	5.45	3.17	0.36434	.	0.809565	0.11722	N	0.535790	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07644	T	0.81	.	12.3508	0.55146	0.1675:0.0:0.8325:0.0	.	.	.	.	X	62;62;62;62;60	.	ENSP00000311348:E62X	E	+	1	0	ELF3	200247728	1.000000	0.71417	0.835000	0.33067	0.112000	0.19704	4.136000	0.58004	1.235000	0.43724	0.591000	0.81541	GAA	ELF3	-	pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom		0.537	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELF3	HGNC	protein_coding	OTTHUMT00000087360.1	G	NM_004433		201981105	+1	no_errors	ENST00000359651	ensembl	human	known	70_37	nonsense	SNP	0.564	T
ELF3	1999	genome.wustl.edu	37	1	201981549	201981549	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:201981549G>A	ENST00000359651.3	+	3	3655	c.463G>A	c.(463-465)Gac>Aac	p.D155N	ELF3_ENST00000495848.1_3'UTR|ELF3_ENST00000367283.3_Missense_Mutation_p.D155N|ELF3_ENST00000367284.5_Missense_Mutation_p.D155N|RP11-510N19.5_ENST00000504773.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GGAGGCCCTAGACCCAGGGCC	0.577																																																	0													84.0	93.0	90.0					1																	201981549		2203	4300	6503	SO:0001583	missense	1999			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.463G>A	1.37:g.201981549G>A	ENSP00000352673:p.Asp155Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,prints_Ets,pfscan_Ets	p.D155N	ENST00000359651.3	37	c.463	CCDS1419.1	1	.	.	.	.	.	.	.	.	.	.	G	15.16	2.750139	0.49257	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044;ENST00000446188	T;T;T;T	0.55930	2.45;2.45;2.45;0.49	4.81	3.84	0.44239	.	1.943430	0.02215	N	0.063469	T	0.53981	0.1830	L	0.60455	1.87	0.09310	N	1	P	0.39665	0.682	B	0.37239	0.244	T	0.47636	-0.9102	10	0.72032	D	0.01	.	9.4262	0.38581	0.1094:0.0:0.8906:0.0	.	155	P78545	ELF3_HUMAN	N	155;155;155;155;153	ENSP00000352673:D155N;ENSP00000356253:D155N;ENSP00000356252:D155N;ENSP00000405162:D153N	ENSP00000311348:D155N	D	+	1	0	ELF3	200248172	0.916000	0.31088	0.005000	0.12908	0.238000	0.25445	1.791000	0.38744	0.920000	0.36970	-0.367000	0.07326	GAC	ELF3	-	NULL		0.577	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELF3	HGNC	protein_coding	OTTHUMT00000087360.1	G	NM_004433		201981549	+1	no_errors	ENST00000359651	ensembl	human	known	70_37	missense	SNP	0.053	A
ELF3	1999	genome.wustl.edu	37	1	201982373	201982373	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:201982373G>A	ENST00000359651.3	+	6	3944	c.752G>A	c.(751-753)cGa>cAa	p.R251Q	ELF3_ENST00000367283.3_Missense_Mutation_p.R251Q|ELF3_ENST00000367284.5_Missense_Mutation_p.R251Q|RP11-510N19.5_ENST00000504773.1_RNA|RP11-465N4.4_ENST00000419190.1_RNA					E74-like factor 3 (ets domain transcription factor, epithelial-specific )											breast(2)|endometrium(2)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	20						GGCCGGCCCCGAAAGCTGAGC	0.642																																																	0													71.0	76.0	75.0					1																	201982373		2203	4300	6503	SO:0001583	missense	1999			AF016295	CCDS1419.1	1q32.2	2008-02-05			ENSG00000163435	ENSG00000163435			3318	protein-coding gene	gene with protein product		602191		ESX		9395241, 9129154	Standard	NM_001114309		Approved	EPR-1, ESE-1, ERT	uc001gxh.4	P78545	OTTHUMG00000035867	ENST00000359651.3:c.752G>A	1.37:g.201982373G>A	ENSP00000352673:p.Arg251Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,prints_Ets,pfscan_Ets	p.R251Q	ENST00000359651.3	37	c.752	CCDS1419.1	1	.	.	.	.	.	.	.	.	.	.	G	25.5	4.643990	0.87859	.	.	ENSG00000163435	ENST00000359651;ENST00000367284;ENST00000367283;ENST00000310044	T;T;T	0.16196	2.36;2.36;2.36	5.63	5.63	0.86233	AT hook, DNA-binding motif (1);	2.194570	0.01612	N	0.022581	T	0.44644	0.1303	M	0.72118	2.19	0.38662	D	0.952099	D	0.89917	1.0	D	0.80764	0.994	T	0.15607	-1.0431	10	0.16896	T	0.51	.	12.1786	0.54199	0.0806:0.0:0.9194:0.0	.	251	P78545	ELF3_HUMAN	Q	251;251;251;228	ENSP00000352673:R251Q;ENSP00000356253:R251Q;ENSP00000356252:R251Q	ENSP00000311348:R228Q	R	+	2	0	ELF3	200248996	0.938000	0.31826	0.996000	0.52242	0.992000	0.81027	3.837000	0.55820	2.659000	0.90383	0.561000	0.74099	CGA	ELF3	-	NULL		0.642	ELF3-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ELF3	HGNC	protein_coding	OTTHUMT00000087360.1	G	NM_004433		201982373	+1	no_errors	ENST00000359651	ensembl	human	known	70_37	missense	SNP	0.996	A
EMCN	51705	genome.wustl.edu	37	4	101401162	101401164	+	In_Frame_Del	DEL	AAC	AAC	-	rs199955415|rs367883693|rs80331904|rs201510590	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	AAC	AAC					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:101401162_101401164delAAC	ENST00000296420.4	-	2	275_277	c.97_99delGTT	c.(97-99)gttdel	p.V33del	EMCN_ENST00000511970.1_In_Frame_Del_p.V33del|EMCN_ENST00000502327.1_5'UTR|EMCN_ENST00000305864.3_In_Frame_Del_p.V33del	NM_001159694.1|NM_016242.3	NP_001153166.1|NP_057326.2	Q9ULC0	MUCEN_HUMAN	endomucin	33						extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|upper_aerodigestive_tract(1)	13				OV - Ovarian serous cystadenocarcinoma(123;2.49e-08)		TTGTTGTAGTAACAACAAGTGAA	0.31														1741	0.347644	0.2458	0.4092	5008	,	,		16968	0.7202		0.0944	False		,,,				2504	0.318																0									,	958,3302		118,722,1290					,	-3.3	0.0		dbSNP_54	133	803,7437		45,713,3362	no	coding,coding	EMCN	NM_016242.3,NM_001159694.1	,	163,1435,4652	A1A1,A1R,RR		9.7451,22.4883,14.088	,	,		1761,10739				SO:0001651	inframe_deletion	51705			AF205940	CCDS3655.1, CCDS54782.1	4q22.1	2008-02-05			ENSG00000164035	ENSG00000164035		"""Mucins"""	16041	protein-coding gene	gene with protein product		608350				11418125, 11594763	Standard	NM_016242		Approved	MUC14	uc003hvr.3	Q9ULC0	OTTHUMG00000131051	ENST00000296420.4:c.97_99delGTT	4.37:g.101401165_101401167delAAC	ENSP00000296420:p.Val33del	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K716|B4E347|Q8NEY5|Q8WWE7|Q9NRM8	In_Frame_Del	DEL	pfam_Endomucin	p.V33in_frame_del	ENST00000296420.4	37	c.99_97	CCDS3655.1	4																																																																																			EMCN	-	pfam_Endomucin		0.310	EMCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMCN	HGNC	protein_coding	OTTHUMT00000253699.2	AAC	NM_016242		101401164	-1	no_errors	ENST00000296420	ensembl	human	known	70_37	in_frame_del	DEL	0.000:0.000:0.000	-
EME1	146956	genome.wustl.edu	37	17	48452978	48452979	+	In_Frame_Ins	INS	-	-	AGC	rs76993288|rs36080231|rs67225428|rs558756129|rs3060668	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:48452978_48452979insAGC	ENST00000338165.4	+	2	491_492	c.409_410insAGC	c.(409-411)aag>aAGCag	p.137_138insQ	MRPL27_ENST00000225969.4_5'Flank|MRPL27_ENST00000507088.1_5'Flank|MRPL27_ENST00000503633.1_5'Flank|MRPL27_ENST00000442592.3_5'Flank|EME1_ENST00000393271.2_In_Frame_Ins_p.137_138insQ|EME1_ENST00000511648.2_In_Frame_Ins_p.137_138insQ	NM_152463.2	NP_689676.2	Q96AY2	EME1_HUMAN	essential meiotic structure-specific endonuclease 1	137					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|response to intra-S DNA damage checkpoint signaling (GO:0072429)	cytoplasm (GO:0005737)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|endonuclease activity (GO:0004519)|metal ion binding (GO:0046872)			endometrium(4)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	19	Breast(11;5.62e-19)		BRCA - Breast invasive adenocarcinoma(22;2.43e-08)			TGACTGGAAAAAGCCCTTTCCA	0.47								Direct reversal of damage;Homologous recombination						2233	0.445887	0.7269	0.5836	5008	,	,		21332	0.1111		0.4473	False		,,,				2504	0.3119																0									,	2895,1369		988,919,225					,	1.0	0.9		dbSNP_130	80	3907,4347		928,2051,1148	no	coding,coding	EME1	NM_152463.2,NM_001166131.1	,	1916,2970,1373	A1A1,A1R,RR		47.3346,32.106,45.6622	,	,		6802,5716				SO:0001652	inframe_insertion	146956			BC016470	CCDS11565.1, CCDS54141.1	17q21.33	2013-07-03	2013-07-03			ENSG00000154920			24965	protein-coding gene	gene with protein product	"""SLX2 structure-specific endonuclease subunit homolog A (S. cerevisiae)"""	610885	"""essential meiotic endonuclease 1 homolog 1 (S. pombe)"""			12721304	Standard	NM_001166131		Approved	FLJ31364, MMS4L, SLX2A	uc010dbp.2	Q96AY2		ENST00000338165.4:c.410_412dupAGC	17.37:g.48452979_48452981dupAGC	ENSP00000339897:p.Lys137_Pro138insGln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96N62	In_Frame_Ins	INS	pfam_ERCC4_domain,smart_ERCC4_domain	p.138in_frame_insQ	ENST00000338165.4	37	c.409_410	CCDS11565.1	17																																																																																			EME1	-	NULL		0.470	EME1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EME1	HGNC	protein_coding	OTTHUMT00000367118.3	-	NM_152463		48452979	+1	no_errors	ENST00000393271	ensembl	human	known	70_37	in_frame_ins	INS	0.140:0.176	AGC
BCRP7	100133163	genome.wustl.edu	37	22	18844654	18844654	+	3'UTR	SNP	T	T	A	rs5747869		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:18844654T>A	ENST00000412938.1	+	0	2904																											GGCAAGGCCTTCCAGGATAGG	0.542																																																	0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000412938.1:c.*2901T>A	22.37:g.18844654T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000412938.1	37	NULL		22																																																																																			AC008103.5	-	-		0.542	AC008132.13-002	KNOWN	basic	processed_transcript	ENSG00000161103	Clone_based_vega_gene	protein_coding	OTTHUMT00000471615.1	T			18844654	+1	no_errors	ENST00000412938	ensembl	human	known	70_37	rna	SNP	0.005	A
BCRP2	400892	genome.wustl.edu	37	22	21470273	21470273	+	lincRNA	SNP	C	C	T	rs201593827	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:21470273C>T	ENST00000420508.1	-	0	3455				BCRP2_ENST00000461808.1_RNA																							GGAGATCGAGCGCCGAGGCAT	0.617													.|||	1055	0.210663	0.2988	0.1686	5008	,	,		10935	0.0645		0.2704	False		,,,				2504	0.2106																0																																												0																															22.37:g.21470273C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000420508.1	37	NULL		22																																																																																			KB-1592A4.15	-	-		0.617	KB-1592A4.15-001	KNOWN	basic	lincRNA	ENSG00000197210	Clone_based_vega_gene	lincRNA	OTTHUMT00000320579.1	C			21470273	-1	no_errors	ENST00000420508	ensembl	human	known	70_37	rna	SNP	1.000	T
TDRD15	100129278	genome.wustl.edu	37	2	21366018	21366018	+	Silent	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:21366018A>G	ENST00000405799.1	+	4	6009	c.5679A>G	c.(5677-5679)gtA>gtG	p.V1893V				B5MCY1	TDR15_HUMAN	tudor domain containing 15	1893							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										AACTGAAAGTAGATGTCATTC	0.333																																																	0																																										SO:0001819	synonymous_variant	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.5679A>G	2.37:g.21366018A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.V1893	ENST00000405799.1	37	c.5679		2																																																																																			AC010872.2	-	superfamily_Staphylococal_nuclease_OB-fold		0.333	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	ENSG00000218819	Clone_based_vega_gene	protein_coding	OTTHUMT00000323948.1	A			21366018	+1	no_errors	ENST00000405799	ensembl	human	novel	70_37	silent	SNP	0.977	G
LOC151174	151174	genome.wustl.edu	37	2	239142249	239142249	+	5'Flank	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:239142249C>T	ENST00000409070.1	-	0	0				AC016757.3_ENST00000334973.4_5'Flank|AC096574.4_ENST00000456601.1_RNA|AC016757.3_ENST00000409376.1_5'Flank|AC016757.3_ENST00000409942.1_5'Flank|AC016757.3_ENST00000470346.1_5'Flank																							TTCAAGAATTCGTCATCACGC	0.428																																																	0																																										SO:0001631	upstream_gene_variant	0																															2.37:g.239142249C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000409070.1	37	NULL		2																																																																																			AC096574.4	-	-		0.428	AC016757.3-006	PUTATIVE	basic|appris_candidate_longest	protein_coding	ENSG00000225057	Clone_based_vega_gene	protein_coding	OTTHUMT00000328480.1	C			239142249	+1	no_errors	ENST00000456601	ensembl	human	known	70_37	rna	SNP	1.000	T
DHRS4L1	728635	genome.wustl.edu	37	14	24517441	24517441	+	RNA	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:24517441G>A	ENST00000558293.1	+	0	514					NR_102693.1																						CGAGGGTACAGAGAGTGAGAG	0.532																																																	0													141.0	146.0	144.0					14																	24517441		2203	4300	6503			0																															14.37:g.24517441G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000558293.1	37	NULL		14																																																																																			RP11-468E2.9	-	-		0.532	RP11-468E2.9-005	KNOWN	basic	processed_transcript	ENSG00000225766	Clone_based_vega_gene	pseudogene	OTTHUMT00000417272.1	G			24517441	+1	no_errors	ENST00000558293	ensembl	human	known	70_37	rna	SNP	0.104	A
RP13-60M5.2	0	genome.wustl.edu	37	9	91262343	91262344	+	lincRNA	INS	-	-	TGG	rs397759669|rs33915680|rs5899049	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:91262343_91262344insTGG	ENST00000418343.2	-	0	407_408																											CTCTGGACACATGGAGAAGATG	0.436														2263	0.451877	0.7723	0.415	5008	,	,		20835	0.1786		0.4105	False		,,,				2504	0.3691																0										2620,1100		939,742,179						-3.5	0.0		dbSNP_114	65	3287,4641		721,1845,1398	no	coding	LOC286238	NM_001100111.1		1660,2587,1577	A1A1,A1R,RR		41.4606,29.5699,49.2874				5907,5741						0																															9.37:g.91262344_91262346dupTGG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000418343.2	37	NULL		9																																																																																			RP13-60M5.2	-	-		0.436	RP13-60M5.2-001	KNOWN	basic	lincRNA	ENSG00000228189	Clone_based_vega_gene	lincRNA	OTTHUMT00000052976.2	-			91262344	-1	no_errors	ENST00000418343	ensembl	human	known	70_37	rna	INS	0.000:0.000	TGG
ANTXRLP1	100996567	genome.wustl.edu	37	10	47640061	47640061	+	RNA	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:47640061C>A	ENST00000454837.1	-	0	192					NR_103827.1				anthrax toxin receptor-like pseudogene 1																		CCACTGCAAACACATGGTCCG	0.597																																																	0																																												0					10q11.22	2014-05-06			ENSG00000243536	ENSG00000263482			45004	pseudogene	pseudogene							Standard	NR_103827		Approved				OTTHUMG00000188317		10.37:g.47640061C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000454837.1	37	NULL		10																																																																																			RP11-292F22.6	-	-		0.597	ANTXRLP1-001	KNOWN	basic	processed_transcript	ENSG00000243536	Clone_based_vega_gene	pseudogene	OTTHUMT00000047859.2	C			47640061	-1	no_errors	ENST00000543148	ensembl	human	known	70_37	rna	SNP	0.000	A
LOC646522	646522	genome.wustl.edu	37	11	133668128	133668128	+	lincRNA	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:133668128G>A	ENST00000526254.1	-	0	121																											CTTCTTGAAGGTTGTTTCTCT	0.413																																																	0																																												0																															11.37:g.133668128G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000526254.1	37	NULL		11																																																																																			RP11-448P19.1	-	-		0.413	RP11-448P19.1-001	KNOWN	basic	lincRNA	ENSG00000255258	Clone_based_vega_gene	lincRNA	OTTHUMT00000393279.1	G			133668128	-1	no_errors	ENST00000530621	ensembl	human	known	70_37	rna	SNP	0.000	A
FAM205B	389715	genome.wustl.edu	37	9	34834494	34834494	+	RNA	SNP	C	C	T	rs77822083		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:34834494C>T	ENST00000455647.2	-	0	1899							Q63HN1	F205B_HUMAN	family with sequence similarity 205, member B																		CCAGCGATGGCGAATCGACTG	0.577																																																	0																																												0					9p13.3	2013-05-22	2011-08-15	2011-08-15	ENSG00000257198	ENSG00000257198			24504	other	unknown			"""chromosome 9 open reading frame 144"""	C9orf144			Standard	NR_024481		Approved	DKFZp434J193, C9orf144A	uc003zvp.4	Q63HN1	OTTHUMG00000019839		9.37:g.34834494C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZRJ7	Missense_Mutation	SNP	NULL	p.R332H	ENST00000455647.2	37	c.995		9	.	.	.	.	.	.	.	.	.	.	T	1.664	-0.510638	0.04231	.	.	ENSG00000257198	ENST00000455647	.	.	.	4.41	3.22	0.36961	.	0.280362	0.25636	N	0.029303	T	0.16514	0.0397	.	.	.	0.22803	P	0.99871139	B	0.02656	0.0	B	0.01281	0.0	T	0.30149	-0.9988	7	0.02654	T	1	.	6.2739	0.20969	0.0:0.2081:0.0:0.7919	rs3893071;rs4636291	332	Q63HN1	F205B_HUMAN	H	332	.	ENSP00000398718:R332H	R	-	2	0	AL589645.1	34824494	0.178000	0.23122	0.985000	0.45067	0.646000	0.38490	0.671000	0.25172	0.754000	0.32968	-0.369000	0.07265	CGC	FAM205B	-	NULL		0.577	FAM205B-001	KNOWN	basic	processed_transcript	ENSG00000257198	Uniprot_genename	pseudogene	OTTHUMT00000052246.5	C	NR_024481		34834494	-1	no_errors	ENST00000455647	ensembl	human	known	70_37	missense	SNP	0.759	T
RP11-1000B6.3	0	genome.wustl.edu	37	15	32878265	32878265	+	lincRNA	SNP	A	A	G	rs79517917	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:32878265A>G	ENST00000564670.1	+	0	145																											TCATCGTGCAAAGACATGCCA	0.418													A|||	389	0.0776757	0.0098	0.147	5008	,	,		17869	0.003		0.2247	False		,,,				2504	0.046																0																																												0																															15.37:g.32878265A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000564670.1	37	NULL		15																																																																																			RP11-1000B6.3	-	-		0.418	RP11-1000B6.3-003	KNOWN	basic	lincRNA	ENSG00000261064	Clone_based_vega_gene	lincRNA	OTTHUMT00000429854.1	A			32878265	+1	no_errors	ENST00000564670	ensembl	human	known	70_37	rna	SNP	1.000	G
CEP131	22994	genome.wustl.edu	37	17	79173392	79173392	+	Intron	SNP	G	G	A	rs371113124		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:79173392G>A	ENST00000269392.4	-	10	1271				AZI1_ENST00000374782.3_Intron|AZI1_ENST00000450824.2_Intron|AZI1_ENST00000570482.2_5'Flank|AZI1_ENST00000575907.1_Intron|RP11-455O6.2_ENST00000571085.1_RNA	NM_014984.2	NP_055799.2	Q9UPN4	CP131_HUMAN							cell differentiation (GO:0030154)|G2/M transition of mitotic cell cycle (GO:0000086)|intraciliary transport involved in cilium morphogenesis (GO:0035735)|mitotic cell cycle (GO:0000278)|multicellular organismal development (GO:0007275)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular protein transport (GO:0090316)|regulation of centrosome duplication (GO:0010824)|spermatogenesis (GO:0007283)	BBSome (GO:0034464)|cell projection (GO:0042995)|centriolar satellite (GO:0034451)|centriole (GO:0005814)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(3)|endometrium(6)|kidney(3)|large_intestine(1)|lung(12)|ovary(2)|prostate(3)|urinary_tract(5)	36	all_neural(118;0.0804)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0272)|OV - Ovarian serous cystadenocarcinoma(97;0.117)			GGGAGAGGACGACCCCAGGCT	0.692																																																	0								G	,	0,4380		0,0,2190	21.0	18.0	19.0		,	-1.3	0.0	17		19	2,8580		0,2,4289	no	intron,intron	AZI1	NM_001009811.2,NM_014984.2	,	0,2,6479	AA,AG,GG		0.0233,0.0,0.0154	,	,	79173392	2,12960	2190	4291	6481	SO:0001627	intron_variant	0																														ENST00000269392.4:c.1024-43C>T	17.37:g.79173392G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHI8|B2RN11|Q96F50	RNA	SNP	-	NULL	ENST00000269392.4	37	NULL		17																																																																																			RP11-455O6.2	-	-		0.692	AZI1-001	KNOWN	basic|appris_candidate_longest	protein_coding	ENSG00000262115	Clone_based_vega_gene	protein_coding	OTTHUMT00000256070.1	G			79173392	+1	no_errors	ENST00000571085	ensembl	human	known	70_37	rna	SNP	0.000	A
EDC4	23644	genome.wustl.edu	37	16	67917366	67917366	+	Intron	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:67917366C>A	ENST00000358933.5	+	28	4088				NRN1L_ENST00000339176.3_5'Flank|NRN1L_ENST00000576147.1_5'Flank|CTC-479C5.10_ENST00000572067.1_lincRNA	NM_014329.4	NP_055144.3	Q6P2E9	EDC4_HUMAN	enhancer of mRNA decapping 4						exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(4)|lung(8)|ovary(4)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	41		Ovarian(137;0.0563)		OV - Ovarian serous cystadenocarcinoma(108;0.0042)|Epithelial(162;0.0185)|all cancers(182;0.121)		CTGGAGCTCTCACTAGCCCAC	0.512											OREG0023890	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	0			U17474	CCDS10849.1	16q22.1	2008-02-05			ENSG00000038358	ENSG00000038358			17157	protein-coding gene	gene with protein product		606030				9067524	Standard	NM_014329		Approved	RCD-8, Ge-1, HEDLS	uc002eur.3	Q6P2E9	OTTHUMG00000137543	ENST00000358933.5:c.3850-105C>A	16.37:g.67917366C>A		Somatic	1103	WXS	Illumina HiSeq	Phase_IV	A6NGM1|A8K4T4|Q13025|Q13826|Q6ZR12|Q7Z6H7	RNA	SNP	-	NULL	ENST00000358933.5	37	NULL	CCDS10849.1	16																																																																																			CTC-479C5.10	-	-		0.512	EDC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263126	Clone_based_vega_gene	protein_coding	OTTHUMT00000268874.2	C	NM_014329		67917366	+1	no_errors	ENST00000572067	ensembl	human	known	70_37	rna	SNP	0.000	A
DPYS	1807	genome.wustl.edu	37	8	105447684	105447684	+	Intron	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:105447684C>G	ENST00000351513.2	-	5	926				AP003471.3_ENST00000579547.1_RNA	NM_001385.2	NP_001376.1	Q14117	DPYS_HUMAN	dihydropyrimidinase						beta-alanine metabolic process (GO:0019482)|nucleobase-containing small molecule metabolic process (GO:0055086)|protein homotetramerization (GO:0051289)|pyrimidine nucleobase catabolic process (GO:0006208)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|small molecule metabolic process (GO:0044281)|thymine catabolic process (GO:0006210)|uracil catabolic process (GO:0006212)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|dihydropyrimidinase activity (GO:0004157)|thymine binding (GO:0002059)|uracil binding (GO:0002058)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	41			OV - Ovarian serous cystadenocarcinoma(57;1.61e-06)|STAD - Stomach adenocarcinoma(118;0.229)			GAGAACTAATCTAGTTTTAtt	0.403																																																	0																																										SO:0001627	intron_variant	0			D78011	CCDS6302.1	8q22	2004-01-22			ENSG00000147647	ENSG00000147647			3013	protein-coding gene	gene with protein product		613326				8973361	Standard	NM_001385		Approved	DHPase	uc003yly.4	Q14117	OTTHUMG00000164891	ENST00000351513.2:c.794-5755G>C	8.37:g.105447684C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000351513.2	37	NULL	CCDS6302.1	8																																																																																			AP003471.3	-	-		0.403	DPYS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266734	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000380814.1	C	NM_001385		105447684	-1	no_errors	ENST00000579547	ensembl	human	novel	70_37	rna	SNP	0.035	G
AC015849.16	0	genome.wustl.edu	37	17	34236083	34236083	+	lincRNA	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:34236083C>T	ENST00000587132.1	-	0	1944																											GAATGGGTATCTGATAATAAT	0.507																																																	0																																												0																															17.37:g.34236083C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000587132.1	37	NULL		17																																																																																			AC015849.16	-	-		0.507	AC015849.16-001	KNOWN	basic	lincRNA	ENSG00000266999	Clone_based_vega_gene	lincRNA	OTTHUMT00000449325.1	C			34236083	-1	no_errors	ENST00000587132	ensembl	human	known	70_37	rna	SNP	0.001	T
PRR22	163154	genome.wustl.edu	37	19	5784377	5784377	+	Intron	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:5784377G>A	ENST00000419421.2	-	2	298				CTB-54O9.9_ENST00000586012.1_Missense_Mutation_p.P74S	NM_001134316.1	NP_001127788.1	Q8IZ63	PRR22_HUMAN	proline rich 22											endometrium(2)|large_intestine(1)|prostate(1)|urinary_tract(1)	5						GGGCTCAGGGGAGGCCGGTAC	0.622																																																	0													55.0	63.0	60.0					19																	5784377		692	1591	2283	SO:0001627	intron_variant	0			BC023278	CCDS45933.1	19p13.3	2012-12-20			ENSG00000212123	ENSG00000212123			28354	protein-coding gene	gene with protein product						12477932	Standard	NM_001134316		Approved	MGC24975	uc010xiv.1	Q8IZ63	OTTHUMG00000180553	ENST00000419421.2:c.193+10C>T	19.37:g.5784377G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PB31	Missense_Mutation	SNP	NULL	p.P74S	ENST00000419421.2	37	c.220	CCDS45933.1	19																																																																																			CTB-54O9.9	-	NULL		0.622	PRR22-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267157	Clone_based_vega_gene	protein_coding	OTTHUMT00000368523.1	G	NM_153359		5784377	-1	no_errors	ENST00000586012	ensembl	human	putative	70_37	missense	SNP	0.003	A
SDCCAG3P1	388478	genome.wustl.edu	37	18	57677665	57677665	+	lincRNA	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:57677665C>G	ENST00000585691.1	+	0	153																											AGCTCTGAATCTCATTCAGCT	0.473																																																	0																																												0																															18.37:g.57677665C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000585691.1	37	NULL		18																																																																																			RP11-866E20.3	-	-		0.473	RP11-866E20.3-001	KNOWN	basic	lincRNA	ENSG00000267462	Clone_based_vega_gene	lincRNA	OTTHUMT00000449078.1	C			57677665	+1	no_errors	ENST00000585691	ensembl	human	known	70_37	rna	SNP	0.761	G
ELL	8178	genome.wustl.edu	37	19	18554204	18554205	+	3'UTR	INS	-	-	AC	rs200890072|rs35927606|rs10625416		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:18554204_18554205insAC	ENST00000262809.4	-	0	3294_3295				CTD-3137H5.1_ENST00000594590.2_RNA	NM_006532.3	NP_006523.1	P55199	ELL_HUMAN	elongation factor RNA polymerase II						gene expression (GO:0010467)|in utero embryonic development (GO:0001701)|negative regulation of phosphatase activity (GO:0010923)|positive regulation of DNA-templated transcription, elongation (GO:0032786)|positive regulation of transcription elongation from RNA polymerase II promoter (GO:0032968)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|positive regulation of viral transcription (GO:0050434)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|viral process (GO:0016032)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	phosphatase binding (GO:0019902)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|liver(1)|lung(5)|prostate(1)	19				GBM - Glioblastoma multiforme(1328;7.81e-07)		TAGAAAAATAGACATCTGTATT	0.574			T	MLL	AL																																			Dom	yes		19	19p13.1	8178	ELL gene (11-19 lysine-rich leukemia gene)		L	0																																										SO:0001624	3_prime_UTR_variant	0			U16282	CCDS12380.1	19p13.1	2012-04-17	2005-05-23			ENSG00000105656		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	23114	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 68"""	600284	"""chromosome 19 open reading frame 17"""	C19orf17		7991593, 8596958	Standard	NM_006532		Approved	Men, ELL1, PPP1R68	uc002njh.3	P55199		ENST00000262809.4:c.*1358->GT	19.37:g.18554205_18554206dupAC		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000262809.4	37	NULL	CCDS12380.1	19																																																																																			CTD-3137H5.1	-	-		0.574	ELL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000268199	Clone_based_vega_gene	protein_coding	OTTHUMT00000466362.1	-	NM_006532		18554205	+1	no_errors	ENST00000594590	ensembl	human	known	70_37	rna	INS	0.000:0.003	AC
CLIP3	25999	genome.wustl.edu	37	19	36510251	36510251	+	Intron	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:36510251G>C	ENST00000360535.4	-	8	1146				AC002116.7_ENST00000586962.1_RNA|CLIP3_ENST00000593074.1_Intron	NM_015526.2	NP_056341.1	Q96DZ5	CLIP3_HUMAN	CAP-GLY domain containing linker protein 3						chaperone-mediated protein transport (GO:0072321)|fat cell differentiation (GO:0045444)|membrane biogenesis (GO:0044091)|negative regulation of microtubule polymerization (GO:0031115)|peptidyl-L-cysteine S-palmitoylation (GO:0018230)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endocytosis (GO:0045807)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of glucose transport (GO:0010828)|positive regulation of protein phosphorylation (GO:0001934)	early endosome membrane (GO:0031901)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)|recycling endosome membrane (GO:0055038)|trans-Golgi network (GO:0005802)|trans-Golgi network membrane (GO:0032588)	ganglioside binding (GO:0035594)|microtubule binding (GO:0008017)			cervix(1)|endometrium(6)|large_intestine(3)|lung(7)|ovary(2)|pancreas(1)|prostate(1)|skin(2)	23	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GGAATGCTGGGAGGCCAACGT	0.637																																																	0													27.0	22.0	24.0					19																	36510251		2197	4296	6493	SO:0001627	intron_variant	0			AJ427922	CCDS12486.1	19q13.12	2014-08-12			ENSG00000105270	ENSG00000105270		"""Ankyrin repeat domain containing"""	24314	protein-coding gene	gene with protein product	"""CLIP-170-related"", ""restin-like 1"""	607382				11854307	Standard	NM_015526		Approved	CLIPR-59, RSNL1	uc002ocz.2	Q96DZ5	OTTHUMG00000181747	ENST00000360535.4:c.919-43C>G	19.37:g.36510251G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0E4|Q8WWL1|Q96C99|Q9UFT7	RNA	SNP	-	NULL	ENST00000360535.4	37	NULL	CCDS12486.1	19																																																																																			AC002116.7	-	-		0.637	CLIP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267698	Clone_based_vega_gene	protein_coding	OTTHUMT00000457426.1	G	NM_015526		36510251	+1	no_errors	ENST00000586962	ensembl	human	known	70_37	rna	SNP	0.002	C
ENTPD2	954	genome.wustl.edu	37	9	139946066	139946066	+	Silent	SNP	C	C	T	rs200985282	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:139946066C>T	ENST00000355097.2	-	3	329	c.282G>A	c.(280-282)caG>caA	p.Q94Q	ENTPD2_ENST00000460614.1_5'Flank|ENTPD2_ENST00000312665.5_Silent_p.Q94Q|RP11-229P13.15_ENST00000439076.1_RNA	NM_001246.3|NM_203468.2	NP_001237.1|NP_982293.1	Q9Y5L3	ENTP2_HUMAN	ectonucleoside triphosphate diphosphohydrolase 2	94					G-protein coupled receptor signaling pathway (GO:0007186)|platelet activation (GO:0030168)|purine ribonucleoside diphosphate catabolic process (GO:0009181)	basal lamina (GO:0005605)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|nucleoside-diphosphatase activity (GO:0017110)|nucleoside-triphosphatase activity (GO:0017111)			endometrium(1)|lung(5)|prostate(1)|skin(2)|urinary_tract(3)	12	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.123)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		CAACAAGACTCTGGCTGGCCC	0.632																																																	0													45.0	46.0	46.0					9																	139946066		2199	4299	6498	SO:0001819	synonymous_variant	954			U91510	CCDS7025.1, CCDS7026.1	9q34	2008-07-21			ENSG00000054179	ENSG00000054179			3364	protein-coding gene	gene with protein product	"""CD39-like-1"", ""ecto-ATPase"""	602012		CD39L1		9271669	Standard	NM_203468		Approved	NTPDase-2	uc004ckw.2	Q9Y5L3	OTTHUMG00000020953	ENST00000355097.2:c.282G>A	9.37:g.139946066C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O15464|Q5SPY6|Q5SPY7	Silent	SNP	pfam_GDA1_CD39_NTPase	p.Q94	ENST00000355097.2	37	c.282	CCDS7026.1	9																																																																																			ENTPD2	-	pfam_GDA1_CD39_NTPase		0.632	ENTPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENTPD2	HGNC	protein_coding	OTTHUMT00000055169.1	C	NM_203468		139946066	-1	no_errors	ENST00000355097	ensembl	human	known	70_37	silent	SNP	0.999	T
EPB41L3	23136	genome.wustl.edu	37	18	5630528	5630528	+	IGR	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:5630528C>T								SNORD112 (51044 upstream) : AP001032.1 (31415 downstream)																							TTCGAATTCTCCGGGGTCCAG	0.662																																																	0													46.0	52.0	50.0					18																	5630528		876	1991	2867	SO:0001628	intergenic_variant	23136																															18.37:g.5630528C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		18	.	.	.	.	.	.	.	.	.	.	C	3.669	-0.067932	0.07228	.	.	ENSG00000082397	ENST00000542652	.	.	.	4.49	1.65	0.23941	.	.	.	.	.	T	0.41766	0.1173	.	.	.	0.25104	N	0.990764	.	.	.	.	.	.	T	0.36407	-0.9749	5	0.87932	D	0	.	6.9578	0.24580	0.0:0.699:0.0:0.301	.	.	.	.	E	38	.	ENSP00000443394:G38E	G	-	2	0	EPB41L3	5620528	0.204000	0.23447	0.101000	0.21167	0.024000	0.10985	0.350000	0.20079	0.147000	0.19030	0.462000	0.41574	GGA	EPB41L3	-	-	0	0.662					EPB41L3	HGNC			C			5630528	-1	no_errors	ENST00000578431	ensembl	human	known	70_37	rna	SNP	0.193	T
EPHA1-AS1	285965	genome.wustl.edu	37	7	143219873	143219873	+	RNA	SNP	T	T	G	rs200874362	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:143219873T>G	ENST00000429289.1	+	0	4349					NR_033897.1				EPHA1 antisense RNA 1																		GTCACCAGACTGTAGATTGAC	0.428													T|||	1621	0.323682	0.2852	0.2939	5008	,	,		17136	0.3998		0.3121	False		,,,				2504	0.3303																0																																												285965			AL833583		7q35	2012-10-12	2012-08-15		ENSG00000229153	ENSG00000229153		"""Long non-coding RNAs"""	27799	non-coding RNA	RNA, long non-coding			"""EPHA1 antisense RNA 1 (non-protein coding)"""				Standard	NR_033897		Approved		uc003wda.4		OTTHUMG00000155893		7.37:g.143219873T>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000429289.1	37	NULL		7																																																																																			EPHA1-AS1	-	-		0.428	EPHA1-AS1-001	KNOWN	basic	antisense	EPHA1-AS1	HGNC	antisense	OTTHUMT00000342151.1	T	NR_033897		143219873	+1	no_errors	ENST00000429289	ensembl	human	known	70_37	rna	SNP	0.168	G
EPHX1	2052	genome.wustl.edu	37	1	226019653	226019653	+	Silent	SNP	G	G	A	rs1131873	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:226019653G>A	ENST00000366837.4	+	3	553	c.357G>A	c.(355-357)aaG>aaA	p.K119K	EPHX1_ENST00000467015.1_3'UTR|EPHX1_ENST00000272167.5_Silent_p.K119K	NM_000120.3	NP_000111.1	P07099	HYEP_HUMAN	epoxide hydrolase 1, microsomal (xenobiotic)	119					aromatic compound catabolic process (GO:0019439)|response to toxic substance (GO:0009636)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	cis-stilbene-oxide hydrolase activity (GO:0033961)|epoxide hydrolase activity (GO:0004301)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(7)|ovary(3)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.197)					TCAAGACTAAGATTGAAGGTA	0.438													G|||	957	0.191094	0.1165	0.1484	5008	,	,		23249	0.2867		0.162	False		,,,				2504	0.2536																0								G	,	643,3763	275.7+/-272.7	50,543,1610	88.0	80.0	83.0		357,357	3.7	1.0	1	dbSNP_100	83	1236,7364	247.8+/-275.7	82,1072,3146	no	coding-synonymous,coding-synonymous	EPHX1	NM_000120.3,NM_001136018.2	,	132,1615,4756	AA,AG,GG		14.3721,14.5937,14.4472	,	119/456,119/456	226019653	1879,11127	2203	4300	6503	SO:0001819	synonymous_variant	2052			J03518	CCDS1547.1	1q42.1	2009-07-10			ENSG00000143819	ENSG00000143819	3.3.2.9		3401	protein-coding gene	gene with protein product		132810		EPHX		9925921	Standard	NM_000120		Approved		uc001hpk.3	P07099	OTTHUMG00000037743	ENST00000366837.4:c.357G>A	1.37:g.226019653G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8N0|Q5VTJ6|Q9NP75|Q9NPE7|Q9NQU6|Q9NQU7|Q9NQU8|Q9NQU9|Q9NQV0|Q9NQV1|Q9NQV2	Silent	SNP	pfam_Epoxide_hydro_N,pfam_AB_hydrolase_1,pirsf_Epoxide_hydrolase,prints_Epox_hydrolase-like	p.K119	ENST00000366837.4	37	c.357	CCDS1547.1	1																																																																																			EPHX1	-	pfam_Epoxide_hydro_N,pirsf_Epoxide_hydrolase		0.438	EPHX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHX1	HGNC	protein_coding	OTTHUMT00000092064.1	G	NM_000120		226019653	+1	no_errors	ENST00000272167	ensembl	human	known	70_37	silent	SNP	1.000	A
EPX	8288	genome.wustl.edu	37	17	56277684	56277684	+	Missense_Mutation	SNP	C	C	T	rs150579989	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:56277684C>T	ENST00000225371.5	+	10	1746	c.1636C>T	c.(1636-1638)Cgg>Tgg	p.R546W		NM_000502.4	NP_000493.1	P11678	PERE_HUMAN	eosinophil peroxidase	546					defense response to nematode (GO:0002215)|eosinophil migration (GO:0072677)|hydrogen peroxide catabolic process (GO:0042744)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-5 production (GO:0032714)|positive regulation of interleukin-4 production (GO:0032753)	extracellular vesicular exosome (GO:0070062)	heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			breast(2)|endometrium(9)|kidney(1)|large_intestine(9)|liver(2)|lung(20)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)	48					Melatonin(DB01065)	CCGGCTGTTTCGGCAAGTGAG	0.637											OREG0024608	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	2	0.000399361	0.0	0.0	5008	,	,		17683	0.0		0.001	False		,,,				2504	0.001																0								C	TRP/ARG	3,4403	6.2+/-15.9	0,3,2200	67.0	66.0	66.0		1636	-2.8	0.0	17	dbSNP_134	66	22,8578	16.0+/-53.3	0,22,4278	yes	missense	EPX	NM_000502.4	101	0,25,6478	TT,TC,CC		0.2558,0.0681,0.1922	probably-damaging	546/716	56277684	25,12981	2203	4300	6503	SO:0001583	missense	8288			M26515	CCDS11602.1	17q23.1	2006-09-25				ENSG00000121053	1.11.1.7		3423	protein-coding gene	gene with protein product		131399				2550461, 2541222	Standard	NM_000502		Approved	EPO, EPP, EPX-PEN	uc002ivq.3	P11678		ENST00000225371.5:c.1636C>T	17.37:g.56277684C>T	ENSP00000225371:p.Arg546Trp	Somatic	1014	WXS	Illumina HiSeq	Phase_IV	Q4TVP3	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal,prints_Haem_peroxidase_animal_subgr	p.R546W	ENST00000225371.5	37	c.1636	CCDS11602.1	17	.	.	.	.	.	.	.	.	.	.	C	16.08	3.021520	0.54576	6.81E-4	0.002558	ENSG00000121053	ENST00000225371	T	0.70516	-0.49	5.66	-2.77	0.05877	.	0.953121	0.08899	N	0.877571	T	0.71484	0.3345	M	0.74389	2.26	0.09310	N	1	D	0.61080	0.989	P	0.53185	0.72	T	0.62305	-0.6882	10	0.66056	D	0.02	-0.0147	1.7466	0.02963	0.2837:0.2379:0.3278:0.1506	.	546	P11678	PERE_HUMAN	W	546	ENSP00000225371:R546W	ENSP00000225371:R546W	R	+	1	2	EPX	53632683	0.000000	0.05858	0.005000	0.12908	0.593000	0.36681	0.006000	0.13152	-0.101000	0.12219	-0.123000	0.14984	CGG	EPX	-	pfam_Haem_peroxidase_animal,superfamily_Haem_peroxidase,pfscan_Haem_peroxidase_animal		0.637	EPX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPX	HGNC	protein_coding	OTTHUMT00000443367.1	C	NM_000502		56277684	+1	no_errors	ENST00000225371	ensembl	human	known	70_37	missense	SNP	0.001	T
EXTL3	2137	genome.wustl.edu	37	8	28575450	28575450	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:28575450C>T	ENST00000220562.4	+	3	2776	c.1874C>T	c.(1873-1875)tCa>tTa	p.S625L	EXTL3_ENST00000523149.1_Missense_Mutation_p.S241L|EXTL3_ENST00000519886.1_Intron	NM_001440.2	NP_001431.1	O43909	EXTL3_HUMAN	exostosin-like glycosyltransferase 3	625					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|positive regulation of cell growth (GO:0030307)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)	glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase activity (GO:0001888)|metal ion binding (GO:0046872)			biliary_tract(1)|endometrium(3)|kidney(2)|large_intestine(15)|lung(8)|ovary(1)|prostate(2)|skin(2)|soft_tissue(1)|urinary_tract(1)	36		Ovarian(32;0.069)		KIRC - Kidney renal clear cell carcinoma(542;0.107)|Kidney(114;0.129)|Colorectal(74;0.228)		GTGTTGCCCTCAGAGGCCAAA	0.542																																																	0													91.0	89.0	89.0					8																	28575450		2203	4300	6503	SO:0001583	missense	2137			U76188	CCDS6070.1	8p22-p12	2013-03-01	2013-03-01		ENSG00000012232	ENSG00000012232	2.4.1.223	"""Exostosin glycosyltransferase family"""	3518	protein-coding gene	gene with protein product	"""REG receptor"", ""glucuronyl-galactosyl-proteoglycan 4-alpha-N-acetylglucosaminyltransferase"""	605744	"""exostoses (multiple)-like 3"""			9479495, 9450183, 11257457	Standard	NM_001440		Approved	botv, REGR	uc003xgz.2	O43909	OTTHUMG00000102146	ENST00000220562.4:c.1874C>T	8.37:g.28575450C>T	ENSP00000220562:p.Ser625Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DST8|O00225|Q53XT3	Missense_Mutation	SNP	pfam_HexNAc_Trfase_a,pfam_Exostosin	p.S625L	ENST00000220562.4	37	c.1874	CCDS6070.1	8	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501081	0.85176	.	.	ENSG00000012232	ENST00000523149;ENST00000220562	D;D	0.96685	-3.53;-4.09	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	D	0.97816	0.9283	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.69142	0.962	D	0.97561	1.0098	10	0.54805	T	0.06	-14.152	20.5948	0.99439	0.0:1.0:0.0:0.0	.	625	O43909	EXTL3_HUMAN	L	241;625	ENSP00000428691:S241L;ENSP00000220562:S625L	ENSP00000220562:S625L	S	+	2	0	EXTL3	28631369	1.000000	0.71417	0.986000	0.45419	0.996000	0.88848	7.818000	0.86416	2.873000	0.98535	0.563000	0.77884	TCA	EXTL3	-	NULL		0.542	EXTL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXTL3	HGNC	protein_coding	OTTHUMT00000219987.3	C	NM_001440		28575450	+1	no_errors	ENST00000220562	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM102A	399665	genome.wustl.edu	37	9	130707744	130707744	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:130707744C>T	ENST00000373095.1	-	8	1194	c.819G>A	c.(817-819)atG>atA	p.M273I	FAM102A_ENST00000300434.3_5'UTR|FAM102A_ENST00000373084.4_Missense_Mutation_p.M131I	NM_001035254.2	NP_001030331.1	Q5T9C2	F102A_HUMAN	family with sequence similarity 102, member A	273										breast(1)|cervix(1)|large_intestine(3)|lung(1)|ovary(4)	10						CCTCCACGGTCATGCCAAGGC	0.701																																																	0													17.0	17.0	17.0					9																	130707744		2173	4267	6440	SO:0001583	missense	399665				CCDS6888.1, CCDS35150.1	9q34.11	2012-11-05	2005-11-17	2005-11-17	ENSG00000167106	ENSG00000167106			31419	protein-coding gene	gene with protein product	"""sym-3 homolog A (C. elegans)"""	610891	"""chromosome 9 open reading frame 132"""	C9orf132			Standard	NM_001035254		Approved	Eeig1, bA203J24.7, SYM-3A	uc004bsx.2	Q5T9C2	OTTHUMG00000020720	ENST00000373095.1:c.819G>A	9.37:g.130707744C>T	ENSP00000362187:p.Met273Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A329|Q8TEL4	Missense_Mutation	SNP	pfam_NT-C2	p.M273I	ENST00000373095.1	37	c.819	CCDS35150.1	9	.	.	.	.	.	.	.	.	.	.	C	7.503	0.653033	0.14580	.	.	ENSG00000167106	ENST00000373095;ENST00000373084	T;T	0.21543	2.0;2.0	4.89	2.02	0.26589	.	0.605189	0.19137	N	0.121793	T	0.08582	0.0213	N	0.08118	0	0.29690	N	0.841016	B	0.16396	0.017	B	0.14023	0.01	T	0.30031	-0.9992	10	0.20046	T	0.44	-8.9446	5.5138	0.16896	0.0:0.6185:0.143:0.2385	.	273	Q5T9C2	F102A_HUMAN	I	273;131	ENSP00000362187:M273I;ENSP00000362176:M131I	ENSP00000362176:M131I	M	-	3	0	FAM102A	129747565	0.994000	0.37717	0.770000	0.31555	0.513000	0.34164	0.623000	0.24447	0.131000	0.18576	0.313000	0.20887	ATG	FAM102A	-	NULL		0.701	FAM102A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM102A	HGNC	protein_coding	OTTHUMT00000054298.2	C			130707744	-1	no_errors	ENST00000373095	ensembl	human	known	70_37	missense	SNP	0.879	T
AMER1	139285	genome.wustl.edu	37	X	63409824	63409824	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:63409824C>T	ENST00000330258.3	-	2	3615	c.3343G>A	c.(3343-3345)Gag>Aag	p.E1115K	AMER1_ENST00000374869.3_Intron|AMER1_ENST00000403336.1_Intron	NM_152424.3	NP_689637.3	Q5JTC6	AMER1_HUMAN	APC membrane recruitment protein 1	1115					adipose tissue development (GO:0060612)|bone development (GO:0060348)|mesenchymal cell differentiation involved in kidney development (GO:0072161)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|regulation of canonical Wnt signaling pathway (GO:0060828)|Wnt signaling pathway (GO:0016055)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	beta-catenin binding (GO:0008013)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)	p.0?(67)									GCACCTTGCTCAGCCCTCTCC	0.582																																																	67	Whole gene deletion(67)	kidney(65)|ovary(1)|large_intestine(1)											13.0	13.0	13.0					X																	63409824		1945	4096	6041	SO:0001583	missense	139285			AK097146	CCDS14377.2	Xq11.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000184675	ENSG00000184675		"""-"""	26837	protein-coding gene	gene with protein product	"""Wilms Tumor on the X"", ""adenomatous polyposis coli membrane recruitment 1"""	300647	"""family with sequence similarity 123B"""	FAM123B		21304492, 21498506, 20843316	Standard	NM_152424		Approved	RP11-403E24.2, FLJ39827, WTX	uc004dvo.3	Q5JTC6	OTTHUMG00000021703	ENST00000330258.3:c.3343G>A	X.37:g.63409824C>T	ENSP00000329117:p.Glu1115Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2IB86|Q8N885	Missense_Mutation	SNP	pfam_Uncharacterised_FAM123	p.E1115K	ENST00000330258.3	37	c.3343	CCDS14377.2	X	.	.	.	.	.	.	.	.	.	.	C	4.017	0.000501	0.07819	.	.	ENSG00000184675	ENST00000330258	T	0.48522	0.81	4.95	0.246	0.15516	.	.	.	.	.	T	0.29556	0.0737	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.21280	-1.0250	8	.	.	.	-0.1105	8.5465	0.33424	0.0:0.5513:0.0:0.4487	.	1115	Q5JTC6	F123B_HUMAN	K	1115	ENSP00000329117:E1115K	.	E	-	1	0	FAM123B	63326549	0.000000	0.05858	0.003000	0.11579	0.012000	0.07955	-0.730000	0.04915	-0.004000	0.14419	-1.131000	0.01979	GAG	FAM123B	-	NULL		0.582	AMER1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM123B	HGNC	protein_coding	OTTHUMT00000316584.1	C	NM_152424		63409824	-1	no_errors	ENST00000330258	ensembl	human	known	70_37	missense	SNP	0.000	T
FAM153B	202134	genome.wustl.edu	37	5	175520229	175520229	+	Silent	SNP	G	G	A	rs200046108	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:175520229G>A	ENST00000253490.4	+	5	348	c.291G>A	c.(289-291)cgG>cgA	p.R97R	FAM153B_ENST00000515817.1_Silent_p.R20R|FAM153B_ENST00000510151.1_Silent_p.R20R|FAM153B_ENST00000512862.1_Silent_p.R20R			P0C7A2	F153B_HUMAN	family with sequence similarity 153, member B	97										endometrium(3)|kidney(2)|large_intestine(1)|lung(8)|ovary(1)|prostate(1)	16	all_cancers(89;0.00406)|Renal(175;0.000269)|Lung NSC(126;0.0103)|all_lung(126;0.0164)	Medulloblastoma(196;0.0208)|all_neural(177;0.0416)|all_hematologic(541;0.214)	Kidney(164;3.85e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000183)	Kidney(146;0.0965)		GGCGACTACGGGAGCTCCACC	0.483													g|||	37	0.00738818	0.0015	0.0115	5008	,	,		19875	0.0		0.0249	False		,,,				2504	0.002																0								G		18,4138		2,14,2062	26.0	24.0	25.0		291	-1.6	0.0	5		25	222,6804		62,98,3353	no	coding-synonymous	FAM153B	NM_001079529.2		64,112,5415	AA,AG,GG		3.1597,0.4331,2.1463		97/388	175520229	240,10942	2078	3513	5591	SO:0001819	synonymous_variant	202134			AK055006	CCDS43401.1, CCDS43401.2	5q35.2	2010-05-12			ENSG00000182230	ENSG00000182230			27323	protein-coding gene	gene with protein product							Standard	NM_001265615		Approved		uc031smb.1	P0C7A2	OTTHUMG00000163181	ENST00000253490.4:c.291G>A	5.37:g.175520229G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTI1	Silent	SNP	prints_FAM153	p.R97	ENST00000253490.4	37	c.291		5																																																																																			FAM153B	-	prints_FAM153		0.483	FAM153B-201	KNOWN	basic|appris_candidate_longest	protein_coding	FAM153B	HGNC	protein_coding		G	NM_001079529		175520229	+1	no_errors	ENST00000253490	ensembl	human	known	70_37	silent	SNP	0.000	A
FAM153A	285596	genome.wustl.edu	37	5	177151329	177151329	+	Missense_Mutation	SNP	T	T	G	rs141664226	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:177151329T>G	ENST00000440605.3	-	19	1089	c.806A>C	c.(805-807)gAa>gCa	p.E269A	FAM153A_ENST00000510276.1_Missense_Mutation_p.E269A|FAM153A_ENST00000393518.3_Missense_Mutation_p.E103A|FAM153A_ENST00000513554.1_Missense_Mutation_p.E103A	NM_173663.3	NP_775934.3	Q9UHL3	F153A_HUMAN	family with sequence similarity 153, member A	269										kidney(6)|large_intestine(1)|lung(1)|prostate(1)|skin(1)|stomach(1)	11	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TTCTGTTGCTTCTTCTGCAGG	0.507													t|||	732	0.146166	0.2882	0.1225	5008	,	,		21510	0.0357		0.1133	False		,,,				2504	0.1186																0													3.0	4.0	4.0					5																	177151329		1504	2905	4409	SO:0001583	missense	285596			AB018295	CCDS34305.1	5q35.3	2010-05-12			ENSG00000170074	ENSG00000170074			29940	protein-coding gene	gene with protein product	"""NY REN 7 antigen"""					10508479, 9872452	Standard	NM_173663		Approved	NY-REN-7	uc003mic.3	Q9UHL3	OTTHUMG00000163394	ENST00000440605.3:c.806A>C	5.37:g.177151329T>G	ENSP00000411506:p.Glu269Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0F3|O94852	Missense_Mutation	SNP	prints_FAM153	p.E269A	ENST00000440605.3	37	c.806	CCDS34305.1	5	.	.	.	.	.	.	.	.	.	.	.	8.900	0.956196	0.18507	.	.	ENSG00000170074	ENST00000440977;ENST00000393518;ENST00000510276;ENST00000440605;ENST00000513554;ENST00000505531	.	.	.	0.893	-1.79	0.07932	.	.	.	.	.	T	0.23649	0.0572	N	0.14661	0.345	0.80722	P	0.0	P;P	0.37398	0.593;0.593	P;P	0.45577	0.486;0.486	T	0.30563	-0.9974	7	0.87932	D	0	.	2.2386	0.04014	0.0:0.2849:0.3131:0.4021	.	103;269	A8MWQ6;Q9UHL3	.;F153A_HUMAN	A	346;103;269;269;103;103	.	ENSP00000353887:E269A	E	-	2	0	FAM153A	177083935	0.738000	0.28186	0.000000	0.03702	0.015000	0.08874	-1.604000	0.02076	-0.946000	0.03677	-1.149000	0.01842	GAA	FAM153A	-	NULL		0.507	FAM153A-022	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	FAM153A	HGNC	protein_coding	OTTHUMT00000417242.1	T	NM_173663		177151329	-1	no_errors	ENST00000360669	ensembl	human	known	70_37	missense	SNP	0.000	G
FAM171B	165215	genome.wustl.edu	37	2	187559047	187559048	+	In_Frame_Ins	INS	-	-	CAA	rs73979342|rs144403657|rs71017336	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:187559047_187559048insCAA	ENST00000304698.5	+	1	350_351	c.147_148insCAA	c.(148-150)caa>CAAcaa	p.50_50Q>QQ	AC017101.10_ENST00000453665.1_RNA	NM_177454.3	NP_803237.3	Q6P995	F171B_HUMAN	family with sequence similarity 171, member B	50	Gln-rich.					integral component of membrane (GO:0016021)	DNA binding (GO:0003677)			NS(1)|breast(6)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(22)|ovary(6)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	54						agcagcagcagcaacaacaaca	0.634														2602	0.519569	0.5106	0.5216	5008	,	,		14904	0.7183		0.4404	False		,,,				2504	0.407																0																																										SO:0001652	inframe_insertion	165215			AF361495	CCDS33347.1	2q32.2	2008-06-16	2008-06-16	2008-06-16	ENSG00000144369	ENSG00000144369			29412	protein-coding gene	gene with protein product			"""KIAA1946"""	KIAA1946		11853319	Standard	NM_177454		Approved	FLJ34104	uc002ups.3	Q6P995	OTTHUMG00000154278	ENST00000304698.5:c.160_162dupCAA	2.37:g.187559054_187559056dupCAA	ENSP00000304108:p.Gln56dup	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53SK3|Q8N1Y4|Q8N3K1|Q8N970|Q8NB81|Q8TF55|Q8WYR8	In_Frame_Ins	INS	pfam_Uncharacterised_FAM171	p.53in_frame_insQ	ENST00000304698.5	37	c.147_148	CCDS33347.1	2																																																																																			FAM171B	-	NULL		0.634	FAM171B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM171B	HGNC	protein_coding	OTTHUMT00000334679.1	-	NM_177454		187559048	+1	no_errors	ENST00000304698	ensembl	human	known	70_37	in_frame_ins	INS	0.634:0.592	CAA
FAM177A1	283635	genome.wustl.edu	37	14	35546373	35546373	+	Silent	SNP	T	T	C	rs3211139	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:35546373T>C	ENST00000382406.3	+	4	345	c.288T>C	c.(286-288)ggT>ggC	p.G96G	FAM177A1_ENST00000280987.4_Silent_p.G119G|FAM177A1_ENST00000396472.1_Silent_p.G96G			Q8N128	F177A_HUMAN	family with sequence similarity 177, member A1	96										breast(1)|large_intestine(1)|lung(2)|urinary_tract(1)	5						TTACCTGGGGTCCCTACTTAT	0.373													C|||	707	0.141174	0.2292	0.1066	5008	,	,		18771	0.0327		0.1272	False		,,,				2504	0.1728																0								C	,	953,3453	734.7+/-410.6	111,731,1361	265.0	247.0	253.0		288,357	0.1	1.0	14	dbSNP_116	253	1312,7288	757.8+/-407.5	103,1106,3091	no	coding-synonymous,coding-synonymous	FAM177A1	NM_001079519.1,NM_173607.3	,	214,1837,4452	CC,CT,TT		15.2558,21.6296,17.415	,	96/214,119/237	35546373	2265,10741	2203	4300	6503	SO:0001819	synonymous_variant	283635			BG722411	CCDS9653.2, CCDS41944.1	14q13.2	2008-07-09	2008-07-09	2008-07-09	ENSG00000151327	ENSG00000151327			19829	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 24"""	C14orf24			Standard	NM_001079519		Approved		uc001wsq.3	Q8N128	OTTHUMG00000140217	ENST00000382406.3:c.288T>C	14.37:g.35546373T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CT2	Silent	SNP	NULL	p.G119	ENST00000382406.3	37	c.357	CCDS41944.1	14																																																																																			FAM177A1	-	NULL		0.373	FAM177A1-010	KNOWN	basic|appris_candidate|CCDS	protein_coding	FAM177A1	HGNC	protein_coding	OTTHUMT00000410816.1	T	NM_173607		35546373	+1	no_errors	ENST00000280987	ensembl	human	known	70_37	silent	SNP	0.981	C
FAM205A	259308	genome.wustl.edu	37	9	34725047	34725047	+	Silent	SNP	C	C	T	rs78716275		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:34725047C>T	ENST00000378788.3	-	4	2229	c.2190G>A	c.(2188-2190)ccG>ccA	p.P730P		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	730						integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GATGCAGGTCCGGGTCACTTG	0.552																																																	0													95.0	56.0	68.0					9																	34725047		692	1591	2283	SO:0001819	synonymous_variant	259308				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.2190G>A	9.37:g.34725047C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MVW7	Silent	SNP	NULL	p.P730	ENST00000378788.3	37	c.2190	CCDS55305.1	9																																																																																			FAM205A	-	NULL		0.552	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2	C	NM_001141917		34725047	-1	no_errors	ENST00000378788	ensembl	human	novel	70_37	silent	SNP	0.000	T
FAM205A	259308	genome.wustl.edu	37	9	34725742	34725742	+	Missense_Mutation	SNP	T	T	C	rs62547039	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:34725742T>C	ENST00000378788.3	-	4	1534	c.1495A>G	c.(1495-1497)Atg>Gtg	p.M499V		NM_001141917.1	NP_001135389.1	Q6ZU69	F205A_HUMAN	family with sequence similarity 205, member A	499				M -> V (in Ref. 1; BAC86357). {ECO:0000305}.		integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(1)|endometrium(2)|kidney(1)	4						GATGGAGACATCCAGTTTGGG	0.522													C|||	3282	0.655351	0.5522	0.6023	5008	,	,		17881	0.6994		0.66	False		,,,				2504	0.7822																0													11.0	10.0	10.0					9																	34725742		692	1588	2280	SO:0001583	missense	259308				CCDS55305.1	9p13.3	2014-05-16			ENSG00000205108	ENSG00000205108			41911	protein-coding gene	gene with protein product							Standard	NM_001141917		Approved	C9orf144B	uc011lor.2	Q6ZU69	OTTHUMG00000000448	ENST00000378788.3:c.1495A>G	9.37:g.34725742T>C	ENSP00000417711:p.Met499Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MVW7	Missense_Mutation	SNP	NULL	p.M499V	ENST00000378788.3	37	c.1495	CCDS55305.1	9	.	.	.	.	.	.	.	.	.	.	C	0.013	-1.645525	0.00792	.	.	ENSG00000205108	ENST00000378788	T	0.05580	3.42	3.8	-1.25	0.09405	.	.	.	.	.	T	0.01730	0.0055	N	0.01576	-0.805	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.46569	-0.9182	8	0.08179	T	0.78	.	4.0301	0.09705	0.1751:0.2904:0.0:0.5345	rs62547039	499	Q6ZU69	F205A_HUMAN	V	499	ENSP00000417711:M499V	ENSP00000417711:M499V	M	-	1	0	RP11-195F19.10	34715742	0.000000	0.05858	0.000000	0.03702	0.208000	0.24298	-0.459000	0.06728	-0.758000	0.04690	-0.215000	0.12644	ATG	FAM205A	-	NULL		0.522	FAM205A-001	NOVEL	basic|appris_principal|CCDS	protein_coding	FAM205A	HGNC	protein_coding	OTTHUMT00000001150.2	T	NM_001141917		34725742	-1	no_errors	ENST00000378788	ensembl	human	novel	70_37	missense	SNP	0.000	C
FAM81B	153643	genome.wustl.edu	37	5	94728539	94728539	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:94728539G>C	ENST00000283357.5	+	2	212	c.166G>C	c.(166-168)Gag>Cag	p.E56Q	FAM81B_ENST00000506418.1_3'UTR	NM_152548.2	NP_689761	Q96LP2	FA81B_HUMAN	family with sequence similarity 81, member B	56						nucleus (GO:0005634)				central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(4)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22		all_cancers(142;1.1e-06)|all_epithelial(76;1.48e-09)|all_lung(232;0.000696)|Lung NSC(167;0.000947)|Ovarian(225;0.00473)		all cancers(79;1.04e-16)		TGCGACTGCAGAGGAACAGCC	0.413																																																	0													45.0	45.0	45.0					5																	94728539		1860	4094	5954	SO:0001583	missense	153643				CCDS43341.1	5q15	2008-02-05			ENSG00000153347	ENSG00000153347			26335	protein-coding gene	gene with protein product							Standard	NM_152548		Approved	FLJ25333	uc003kla.1	Q96LP2	OTTHUMG00000162837	ENST00000283357.5:c.166G>C	5.37:g.94728539G>C	ENSP00000283357:p.Glu56Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E56Q	ENST00000283357.5	37	c.166	CCDS43341.1	5	.	.	.	.	.	.	.	.	.	.	G	4.846	0.157305	0.09236	.	.	ENSG00000153347	ENST00000283357	T	0.26223	1.75	5.6	-2.96	0.05547	.	1.135760	0.06444	N	0.726574	T	0.23210	0.0561	L	0.56769	1.78	0.09310	N	1	B	0.17268	0.021	B	0.12837	0.008	T	0.38585	-0.9654	10	0.48119	T	0.1	-0.1902	6.2937	0.21075	0.3083:0.3377:0.354:0.0	.	56	Q96LP2	FA81B_HUMAN	Q	56	ENSP00000283357:E56Q	ENSP00000283357:E56Q	E	+	1	0	FAM81B	94754295	0.015000	0.18098	0.000000	0.03702	0.005000	0.04900	0.514000	0.22786	-0.469000	0.06911	-1.092000	0.02172	GAG	FAM81B	-	NULL		0.413	FAM81B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM81B	HGNC	protein_coding	OTTHUMT00000370690.1	G	NM_152548		94728539	+1	no_errors	ENST00000283357	ensembl	human	known	70_37	missense	SNP	0.000	C
ALG1L2	644974	genome.wustl.edu	37	3	129818153	129818153	+	RNA	DEL	A	A	-	rs56848274	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:129818153delA	ENST00000507643.1	+	0	815				AC083906.2_ENST00000578837.1_RNA			C9J202	AG1L2_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like 2								transferase activity, transferring glycosyl groups (GO:0016757)										ATAGGGAAACAGTTTCTGGTC	0.507													a|A|-|deletion	1556	0.310703	0.2171	0.3631	5008	,	,		19351	0.248		0.4175	False		,,,				2504	0.3548																0																																												729375			BC127756		3q22.1	2013-02-22	2013-02-22		ENSG00000251287	ENSG00000251287		"""Glycosyltransferase group 1 domain containing"""	37258	other	unknown			"""asparagine-linked glycosylation 1-like 2"""				Standard	NM_001136152		Approved		uc011bld.2	C9J202	OTTHUMG00000159782		3.37:g.129818153delA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL	ENST00000507643.1	37	NULL		3																																																																																			FAM86HP	-	-		0.507	ALG1L2-002	KNOWN	basic	processed_transcript	FAM86HP	HGNC	pseudogene	OTTHUMT00000357289.1	A	NM_001136152		129818153	-1	no_errors	ENST00000511564	ensembl	human	putative	70_37	rna	DEL	0.428	-
ALG1L	200810	genome.wustl.edu	37	3	125647512	125647512	+	IGR	SNP	T	T	G	rs1976458	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:125647512T>G	ENST00000340333.3	-	0	805				FAM86JP_ENST00000485843.1_RNA	NM_001015050.2|NM_001195223.1	NP_001015050.2|NP_001182152.1	Q6GMV1	ALG1L_HUMAN	ALG1, chitobiosyldiphosphodolichol beta-mannosyltransferase-like								transferase activity, transferring glycosyl groups (GO:0016757)			large_intestine(2)|lung(2)	4						ATGGGAAAGCTGATAAAACTT	0.428													.|||	1203	0.240216	0.5076	0.1542	5008	,	,		20495	0.1071		0.172	False		,,,				2504	0.1472																0																																										SO:0001628	intergenic_variant	100125556			BC073816	CCDS33840.1, CCDS74998.1	3q21.2	2013-02-22	2013-02-22		ENSG00000189366	ENSG00000189366		"""Glycosyltransferase group 1 domain containing"""	33721	protein-coding gene	gene with protein product	"""asparagine-linked glycosylation 1-like 1"""		"""asparagine-linked glycosylation 1-like"""				Standard	NM_001015050		Approved	ALG1L1	uc003eig.2	Q6GMV1	OTTHUMG00000159588		3.37:g.125647512T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNA5	RNA	SNP	-	NULL	ENST00000340333.3	37	NULL	CCDS33840.1	3																																																																																			FAM86JP	-	-		0.428	ALG1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM86JP	HGNC	protein_coding	OTTHUMT00000356347.1	T	NM_001015050		125647512	+1	no_errors	ENST00000467239	ensembl	human	known	70_37	rna	SNP	0.017	G
FBXW10	10517	genome.wustl.edu	37	17	18659415	18659415	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:18659415G>C	ENST00000395665.4	+	6	1401	c.1180G>C	c.(1180-1182)Gag>Cag	p.E394Q	FBXW10_ENST00000395667.1_Missense_Mutation_p.E394Q|FBXW10_ENST00000308799.4_Missense_Mutation_p.E423Q|FBXW10_ENST00000301938.4_Missense_Mutation_p.E394Q			Q5XX13	FBW10_HUMAN	F-box and WD repeat domain containing 10	394										NS(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42						GGTCCTGATAGAGGAGAGAAA	0.458																																																	0													169.0	149.0	156.0					17																	18659415		2203	4300	6503	SO:0001583	missense	10517			BC028364	CCDS11199.2, CCDS11199.3, CCDS58524.1	17p11	2013-01-09	2007-02-08	2004-07-21	ENSG00000171931	ENSG00000171931		"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	1211	protein-coding gene	gene with protein product		611679	"""chromosome 17 open reading frame 1A"", ""F-box and WD-40 domain protein 10"""	C17orf1, C17orf1A		9787083, 7586531	Standard	NM_001267585		Approved	SM2SH2, HREP, Fbw10	uc002guk.3	Q5XX13	OTTHUMG00000059048	ENST00000395665.4:c.1180G>C	17.37:g.18659415G>C	ENSP00000379025:p.Glu394Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JRY8|C9JZD7|Q8TC00|Q9H0F0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E423Q	ENST00000395665.4	37	c.1267	CCDS11199.3	17	.	.	.	.	.	.	.	.	.	.	G	8.793	0.930957	0.18131	.	.	ENSG00000171931	ENST00000395667;ENST00000308799;ENST00000301938;ENST00000395665	T;T;T;T	0.61510	1.75;0.1;1.75;1.75	2.89	2.89	0.33648	F-box domain, Skp2-like (1);	0.000000	0.39615	U	0.001320	T	0.65657	0.2712	M	0.74258	2.255	0.44515	D	0.997463	P;D;P;P	0.52996	0.734;0.957;0.615;0.946	B;P;B;P	0.52793	0.421;0.709;0.241;0.637	T	0.70066	-0.4974	10	0.56958	D	0.05	.	11.2575	0.49063	0.0:0.0:1.0:0.0	.	394;423;394;394	Q5XX13-3;Q5XX13-2;Q5XX13;Q5XX13-4	.;.;FBW10_HUMAN;.	Q	394;423;394;394	ENSP00000379026:E394Q;ENSP00000310382:E423Q;ENSP00000306937:E394Q;ENSP00000379025:E394Q	ENSP00000306937:E394Q	E	+	1	0	FBXW10	18600140	1.000000	0.71417	0.990000	0.47175	0.099000	0.18886	6.705000	0.74644	1.439000	0.47511	0.184000	0.17185	GAG	FBXW10	-	superfamily_F-box_dom_cyclin-like		0.458	FBXW10-003	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	FBXW10	HGNC	protein_coding	OTTHUMT00000313531.2	G	NM_031456		18659415	+1	no_errors	ENST00000308799	ensembl	human	known	70_37	missense	SNP	1.000	C
FCHO1	23149	genome.wustl.edu	37	19	17883355	17883355	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:17883355G>C	ENST00000596536.1	+	10	967	c.684G>C	c.(682-684)caG>caC	p.Q228H	FCHO1_ENST00000252771.7_Missense_Mutation_p.Q228H|FCHO1_ENST00000597512.1_Missense_Mutation_p.Q235H|FCHO1_ENST00000539407.1_Missense_Mutation_p.Q228H|FCHO1_ENST00000595033.1_Missense_Mutation_p.Q178H|FCHO1_ENST00000600676.1_Missense_Mutation_p.Q228H|FCHO1_ENST00000594202.1_Missense_Mutation_p.Q228H|FCHO1_ENST00000389133.4_Missense_Mutation_p.Q228H|FCHO1_ENST00000596951.1_Missense_Mutation_p.Q228H	NM_015122.2	NP_055937.1	O14526	FCHO1_HUMAN	FCH domain only 1	228	Mediates membrane-binding.				clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)	coated pit (GO:0005905)|plasma membrane (GO:0005886)	AP-2 adaptor complex binding (GO:0035612)			NS(2)|breast(1)|large_intestine(6)|liver(1)|lung(12)	22						CGCACGTGCAGATTGGGCAGG	0.612																																																	0													126.0	98.0	107.0					19																	17883355		2203	4300	6503	SO:0001583	missense	23149			AB006628	CCDS32955.1, CCDS59365.1, CCDS59366.1	19p13.12	2008-02-05				ENSG00000130475			29002	protein-coding gene	gene with protein product		613437				12477932	Standard	NM_001161357		Approved	KIAA0290	uc002nhg.3	O14526		ENST00000596536.1:c.684G>C	19.37:g.17883355G>C	ENSP00000470731:p.Gln228His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHE6|A8K5U5|B4E120|Q05C93|Q8IW22	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,superfamily_Clathrin_mu_C,smart_FCH,pfscan_FCH	p.Q228H	ENST00000596536.1	37	c.684	CCDS32955.1	19	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036867	0.54896	.	.	ENSG00000130475	ENST00000252771;ENST00000389133;ENST00000539407	T;T;T	0.43294	0.95;0.95;0.95	4.71	0.925	0.19424	.	0.055988	0.64402	D	0.000001	T	0.51584	0.1683	M	0.68593	2.085	0.36509	D	0.869468	D;D;D	0.89917	0.998;0.999;1.0	P;D;D	0.71656	0.905;0.946;0.974	T	0.55885	-0.8070	10	0.51188	T	0.08	-24.2655	3.0935	0.06302	0.0989:0.1744:0.5472:0.1795	.	178;228;228	B4E120;O14526;O14526-2	.;FCHO1_HUMAN;.	H	228	ENSP00000252771:Q228H;ENSP00000373785:Q228H;ENSP00000437978:Q228H	ENSP00000252771:Q228H	Q	+	3	2	FCHO1	17744355	1.000000	0.71417	0.997000	0.53966	0.850000	0.48378	1.451000	0.35145	0.627000	0.30340	0.561000	0.74099	CAG	FCHO1	-	NULL		0.612	FCHO1-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	FCHO1	HGNC	protein_coding	OTTHUMT00000466946.2	G	NM_015122		17883355	+1	no_errors	ENST00000252771	ensembl	human	known	70_37	missense	SNP	0.997	C
FCGBP	8857	genome.wustl.edu	37	19	40402410	40402410	+	Silent	SNP	G	G	A	rs2023286	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:40402410G>A	ENST00000221347.6	-	11	4996	c.4989C>T	c.(4987-4989)ggC>ggT	p.G1663G		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	1663						extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			GCAGGCACACGCCCTGGCCAC	0.642													G|||	946	0.188898	0.3464	0.1412	5008	,	,		19398	0.1359		0.1829	False		,,,				2504	0.0706																0													3.0	3.0	3.0					19																	40402410		1985	3897	5882	SO:0001819	synonymous_variant	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.4989C>T	19.37:g.40402410G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O95784	Silent	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.G1663	ENST00000221347.6	37	c.4989	CCDS12546.1	19																																																																																			FCGBP	-	smart_Fol_N,smart_VWF_type-D		0.642	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	G	NM_003890		40402410	-1	no_errors	ENST00000221347	ensembl	human	known	70_37	silent	SNP	0.001	A
FCHO2	115548	genome.wustl.edu	37	5	72350364	72350364	+	Missense_Mutation	SNP	C	C	T	rs369958358		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:72350364C>T	ENST00000430046.2	+	15	1314	c.1198C>T	c.(1198-1200)Cgg>Tgg	p.R400W	FCHO2_ENST00000341845.6_Intron|FCHO2_ENST00000512348.1_Missense_Mutation_p.R367W	NM_001146032.1|NM_138782.2	NP_001139504.1|NP_620137.2	Q0JRZ9	FCHO2_HUMAN	FCH domain only 2	400					clathrin coat assembly (GO:0048268)|clathrin-mediated endocytosis (GO:0072583)|membrane invagination (GO:0010324)|protein localization to plasma membrane (GO:0072659)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)|prostate(1)	17		Lung NSC(167;0.0465)|Ovarian(174;0.0908)|Prostate(461;0.165)		OV - Ovarian serous cystadenocarcinoma(47;4.6e-53)		ACAGATGAATCGGAATTTGTC	0.254																																																	0													91.0	78.0	82.0					5																	72350364		1363	3107	4470	SO:0001583	missense	115548			AL831971	CCDS47230.1, CCDS54868.1	5q13.2	2005-08-15			ENSG00000157107	ENSG00000157107			25180	protein-coding gene	gene with protein product		613438				15254787	Standard	NM_138782		Approved		uc003kcl.3	Q0JRZ9	OTTHUMG00000162413	ENST00000430046.2:c.1198C>T	5.37:g.72350364C>T	ENSP00000393776:p.Arg400Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6W7|B2RNQ9|B4DHK0|E9PG79|Q0JTJ3|Q96CF5	Missense_Mutation	SNP	pfam_Muniscin_C-term_mu_dom,pfam_FCH,smart_FCH,pfscan_FCH	p.R400W	ENST00000430046.2	37	c.1198	CCDS47230.1	5	.	.	.	.	.	.	.	.	.	.	C	13.78	2.339398	0.41398	.	.	ENSG00000157107	ENST00000430046;ENST00000512348	T;T	0.19532	2.14;2.14	5.44	4.52	0.55395	.	.	.	.	.	T	0.23886	0.0578	M	0.74647	2.275	0.80722	D	1	D;P	0.59357	0.985;0.916	B;B	0.36766	0.232;0.19	T	0.26849	-1.0091	9	0.72032	D	0.01	.	14.5161	0.67821	0.1455:0.8544:0.0:0.0	.	367;400	E9PG79;Q0JRZ9	.;FCHO2_HUMAN	W	400;367	ENSP00000393776:R400W;ENSP00000427296:R367W	ENSP00000393776:R400W	R	+	1	2	FCHO2	72386120	1.000000	0.71417	1.000000	0.80357	0.591000	0.36615	1.069000	0.30641	2.712000	0.92718	0.650000	0.86243	CGG	FCHO2	-	NULL		0.254	FCHO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCHO2	HGNC	protein_coding	OTTHUMT00000368795.3	C	XM_291142		72350364	+1	no_errors	ENST00000430046	ensembl	human	known	70_37	missense	SNP	1.000	T
FER1L6	654463	genome.wustl.edu	37	8	124998374	124998374	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:124998374C>T	ENST00000522917.1	+	12	1683	c.1477C>T	c.(1477-1479)Cgg>Tgg	p.R493W	FER1L6_ENST00000399018.1_Missense_Mutation_p.R493W|FER1L6-AS1_ENST00000518567.1_RNA	NM_001039112.2	NP_001034201.2	Q2WGJ9	FR1L6_HUMAN	fer-1-like family member 6	493						integral component of membrane (GO:0016021)				NS(2)|breast(3)|central_nervous_system(2)|endometrium(9)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(18)|liver(1)|lung(49)|ovary(5)|prostate(3)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(1)	118	Lung NSC(37;4.1e-12)|Ovarian(258;0.00438)|all_neural(195;0.0741)		STAD - Stomach adenocarcinoma(47;0.00186)			CATGATTGACCGGAAGATTGG	0.353																																																	0													114.0	107.0	109.0					8																	124998374		1824	4075	5899	SO:0001583	missense	654463			AB196633	CCDS43767.1	8q24.13	2014-06-27	2014-06-27		ENSG00000214814	ENSG00000214814			28065	protein-coding gene	gene with protein product			"""fer-1-like 6 (C. elegans)"""				Standard	NM_001039112		Approved	C8ORFK23	uc003yqw.3	Q2WGJ9	OTTHUMG00000164998	ENST00000522917.1:c.1477C>T	8.37:g.124998374C>T	ENSP00000428280:p.Arg493Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_Ferlin_B-domain,pfam_FerIin-domain,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_ABC_transptrTM_dom_typ1,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.R493W	ENST00000522917.1	37	c.1477	CCDS43767.1	8	.	.	.	.	.	.	.	.	.	.	C	20.7	4.029649	0.75504	.	.	ENSG00000214814	ENST00000522917;ENST00000399018	D;D	0.82344	-1.6;-1.6	5.46	-0.517	0.11947	.	0.000000	0.64402	U	0.000001	D	0.89801	0.6820	M	0.78456	2.415	0.54753	D	0.999981	D	0.89917	1.0	D	0.91635	0.999	D	0.90518	0.4486	10	0.72032	D	0.01	.	15.8788	0.79185	0.747:0.253:0.0:0.0	.	493	Q2WGJ9	FR1L6_HUMAN	W	493	ENSP00000428280:R493W;ENSP00000381982:R493W	ENSP00000381982:R493W	R	+	1	2	FER1L6	125067555	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	1.811000	0.38942	0.193000	0.20303	-0.188000	0.12872	CGG	FER1L6	-	NULL		0.353	FER1L6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FER1L6	HGNC	protein_coding	OTTHUMT00000381400.1	C	NM_001039112		124998374	+1	no_errors	ENST00000399018	ensembl	human	known	70_37	missense	SNP	1.000	T
FES	2242	genome.wustl.edu	37	15	91428290	91428290	+	Silent	SNP	C	C	T	rs11539637	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:91428290C>T	ENST00000328850.3	+	2	157	c.15C>T	c.(13-15)tcC>tcT	p.S5S	FES_ENST00000394300.3_Silent_p.S5S|FES_ENST00000444422.2_Silent_p.S5S|FES_ENST00000450438.2_Silent_p.S5S|FES_ENST00000394302.1_Silent_p.S5S|FES_ENST00000414248.2_Silent_p.S5S	NM_002005.3	NP_001996.1	P07332	FES_HUMAN	FES proto-oncogene, tyrosine kinase	5	FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.|Important for interaction with membranes containing phosphoinositides.				axon guidance (GO:0007411)|cell proliferation (GO:0008283)|multicellular organismal development (GO:0007275)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of microtubule polymerization (GO:0031116)|positive regulation of myeloid cell differentiation (GO:0045639)|positive regulation of neuron projection development (GO:0010976)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell adhesion (GO:0030155)|regulation of cell differentiation (GO:0045595)|regulation of cell motility (GO:2000145)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of mast cell degranulation (GO:0043304)|regulation of vesicle-mediated transport (GO:0060627)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule cytoskeleton (GO:0015630)	ATP binding (GO:0005524)|immunoglobulin receptor binding (GO:0034987)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphatidylinositol binding (GO:0035091)|protein tyrosine kinase activity (GO:0004713)			lung(2)|ovary(1)	3	Lung NSC(78;0.0771)|all_lung(78;0.137)		Lung(145;0.229)			GCTTCTCTTCCGAGCTGTGCA	0.632													C|||	2942	0.58746	0.382	0.7277	5008	,	,		19330	0.8065		0.5258	False		,,,				2504	0.6033																0								C	,,,	1859,2537	529.5+/-372.7	378,1103,717	106.0	119.0	115.0		15,15,15,15	-9.8	0.0	15	dbSNP_120	115	4555,4041	593.3+/-393.1	1210,2135,953	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	FES	NM_001143783.1,NM_001143784.1,NM_001143785.1,NM_002005.3	,,,	1588,3238,1670	TT,TC,CC		47.0102,42.2884,49.3688	,,,	5/765,5/753,5/695,5/823	91428290	6414,6578	2198	4298	6496	SO:0001819	synonymous_variant	2242			X52192	CCDS10365.1, CCDS45349.1, CCDS45350.1, CCDS45351.1	15q26.1	2014-06-26	2014-06-26		ENSG00000182511	ENSG00000182511	2.7.10.1	"""SH2 domain containing"""	3657	protein-coding gene	gene with protein product	"""Oncogene FES, feline sarcoma virus"", ""c-fes/fps protein"""	190030	"""feline sarcoma (Snyder-Theilen) viral (v-fes)/Fujinami avian sarcoma (PRCII) viral (v-fps) oncogene homolog"", ""feline sarcoma oncogene"""			1870997	Standard	NM_002005		Approved	FPS	uc002bpv.3	P07332	OTTHUMG00000044456	ENST00000328850.3:c.15C>T	15.37:g.91428290C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6E6|B4DUD0|E9PC94|E9PC95|Q2VXS7|Q2VXS8|Q2VXT0|Q6GTU5	Silent	SNP	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_FCH,superfamily_Kinase-like_dom,superfamily_t-SNARE,smart_FCH,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,pfscan_FCH,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.S5	ENST00000328850.3	37	c.15	CCDS10365.1	15																																																																																			FES	-	pirsf_Tyr_kinase_non-rcpt_Fes_subgr,pfam_FCH,smart_FCH,pfscan_FCH		0.632	FES-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FES	HGNC	protein_coding	OTTHUMT00000313497.1	C	NM_002005		91428290	+1	no_errors	ENST00000328850	ensembl	human	known	70_37	silent	SNP	0.022	T
FGD3	89846	genome.wustl.edu	37	9	95797696	95797696	+	Missense_Mutation	SNP	C	C	T	rs201485764		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:95797696C>T	ENST00000375482.3	+	18	2499	c.2003C>T	c.(2002-2004)tCg>tTg	p.S668L	FGD3_ENST00000416701.2_Missense_Mutation_p.S667L|FGD3_ENST00000538555.1_Missense_Mutation_p.S271L|FGD3_ENST00000337352.6_Missense_Mutation_p.S668L	NM_001083536.1	NP_001077005.1	Q5JSP0	FGD3_HUMAN	FYVE, RhoGEF and PH domain containing 3	668	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|urinary_tract(1)	17						AGGCTGGACTCGGGGCATGTG	0.647													C|||	1	0.000199681	0.0008	0.0	5008	,	,		17423	0.0		0.0	False		,,,				2504	0.0																0								C	LEU/SER,LEU/SER	5,4291		0,5,2143	29.0	38.0	35.0		2003,2003	1.4	0.0	9		35	0,8522		0,0,4261	yes	missense,missense	FGD3	NM_001083536.1,NM_033086.2	145,145	0,5,6404	TT,TC,CC		0.0,0.1164,0.039	benign,benign	668/726,668/726	95797696	5,12813	2148	4261	6409	SO:0001583	missense	89846			AK000004	CCDS43849.1, CCDS69619.1	9q22	2013-01-10	2004-08-24		ENSG00000127084	ENSG00000127084		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	16027	protein-coding gene	gene with protein product			"""FGD1 family, member 3"""			11214971	Standard	NM_001083536		Approved	FLJ00004, ZFYVE5	uc004asz.2	Q5JSP0	OTTHUMG00000021032	ENST00000375482.3:c.2003C>T	9.37:g.95797696C>T	ENSP00000364631:p.Ser668Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	F8W7P2|Q4VX84|Q7Z7D9|Q8N5G1	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,superfamily_Znf_FYVE_PHD,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.S668L	ENST00000375482.3	37	c.2003	CCDS43849.1	9	.	.	.	.	.	.	.	.	.	.	C	3.664	-0.068912	0.07228	0.001164	0.0	ENSG00000127084	ENST00000375482;ENST00000416701;ENST00000337352;ENST00000538555	T;T;T;T	0.72167	-0.52;-0.52;-0.52;-0.63	4.52	1.42	0.22433	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	1.562800	0.04244	N	0.337459	T	0.45155	0.1328	N	0.03324	-0.35	0.09310	N	1	B;B	0.22414	0.069;0.004	B;B	0.09377	0.004;0.003	T	0.30031	-0.9992	10	0.27082	T	0.32	.	4.4601	0.11663	0.0:0.5645:0.1989:0.2366	.	667;668	F8W7P2;Q5JSP0	.;FGD3_HUMAN	L	668;667;668;271	ENSP00000364631:S668L;ENSP00000413833:S667L;ENSP00000336914:S668L;ENSP00000442560:S271L	ENSP00000336914:S668L	S	+	2	0	FGD3	94837517	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.088000	0.11198	0.177000	0.19895	0.561000	0.74099	TCG	FGD3	-	smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.647	FGD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FGD3	HGNC	protein_coding	OTTHUMT00000055493.1	C	NM_033086		95797696	+1	no_errors	ENST00000337352	ensembl	human	known	70_37	missense	SNP	0.000	T
FGGY	55277	genome.wustl.edu	37	1	60228310	60228311	+	3'UTR	INS	-	-	TC	rs10668386|rs10626387|rs536126375	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:60228310_60228311insTC	ENST00000303721.7	+	0	1884_1885				FGGY_ENST00000371212.1_3'UTR|FGGY_ENST00000371218.4_3'UTR|RP4-782L23.2_ENST00000443012.1_RNA|FGGY_ENST00000371210.1_3'UTR	NM_018291.3	NP_060761.3	Q96C11	FGGY_HUMAN	FGGY carbohydrate kinase domain containing						carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|neuron cellular homeostasis (GO:0070050)		kinase activity (GO:0016301)|phosphotransferase activity, alcohol group as acceptor (GO:0016773)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	22	all_cancers(7;7.36e-05)					CATTAAAGACTTGTCATTTGAT	0.401														4283	0.855232	0.73	0.8934	5008	,	,		18566	0.997		0.831	False		,,,				2504	0.8763																0									,	3174,1092		1169,836,128					,	-0.2	0.9		dbSNP_119	68	6907,1347		2888,1131,108	no	utr-3,utr-3	FGGY	NM_018291.3,NM_001113411.1	,	4057,1967,236	A1A1,A1R,RR		16.3194,25.5977,19.4808	,	,		10081,2439				SO:0001624	3_prime_UTR_variant	55277				CCDS611.2, CCDS44155.1, CCDS58003.1, CCDS60155.1	1p32.1	2008-10-23			ENSG00000172456	ENSG00000172456			25610	protein-coding gene	gene with protein product		611370				17671248	Standard	NM_018291		Approved	FLJ10986	uc009wac.3	Q96C11	OTTHUMG00000008424	ENST00000303721.7:c.*55->TC	1.37:g.60228310_60228311insTC		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AK92|B1AK93|B1AK94|B2RDR8|D3DQ56|Q9HA63|Q9NV20	RNA	INS	-	NULL	ENST00000303721.7	37	NULL	CCDS611.2	1																																																																																			FGGY	-	-		0.401	FGGY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGGY	HGNC	protein_coding	OTTHUMT00000023210.2	-	NM_001113411		60228311	+1	no_errors	ENST00000471169	ensembl	human	known	70_37	rna	INS	0.775:0.824	TC
FIG4	9896	genome.wustl.edu	37	6	110107615	110107615	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:110107615G>C	ENST00000230124.3	+	18	2183	c.2059G>C	c.(2059-2061)Gat>Cat	p.D687H	FIG4_ENST00000441478.2_Missense_Mutation_p.D410H	NM_014845.5	NP_055660.1	Q92562	FIG4_HUMAN	FIG4 phosphoinositide 5-phosphatase	687					cell death (GO:0008219)|locomotory behavior (GO:0007626)|myelin assembly (GO:0032288)|negative regulation of myelination (GO:0031642)|neuron development (GO:0048666)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phospholipid metabolic process (GO:0006644)|pigmentation (GO:0043473)|positive regulation of neuron projection development (GO:0010976)|small molecule metabolic process (GO:0044281)|vacuole organization (GO:0007033)	early endosome membrane (GO:0031901)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|late endosome membrane (GO:0031902)	phosphatidylinositol-3,5-bisphosphate 5-phosphatase activity (GO:0043813)|phosphatidylinositol-3-phosphatase activity (GO:0004438)|phosphatidylinositol-4-phosphate phosphatase activity (GO:0043812)			central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)	32		all_cancers(87;8.63e-07)|Acute lymphoblastic leukemia(125;2.66e-08)|all_hematologic(75;1.13e-06)|all_epithelial(87;0.000124)|all_lung(197;0.0187)|Colorectal(196;0.0492)|Lung SC(18;0.0548)		OV - Ovarian serous cystadenocarcinoma(136;0.0355)|Epithelial(106;0.038)|all cancers(137;0.0425)|BRCA - Breast invasive adenocarcinoma(108;0.079)		GAGCAGCTTTGATGATACCTT	0.358																																																	0													178.0	171.0	173.0					6																	110107615		2203	4300	6503	SO:0001583	missense	9896			D87464	CCDS5078.1	6q21	2014-09-17	2014-08-04	2007-07-30	ENSG00000112367	ENSG00000112367			16873	protein-coding gene	gene with protein product		609390	"""KIAA0274"", ""FIG4 homolog (S. cerevisiae)"", ""FIG4 homolog, SAC1 lipid phosphatase domain containing (S. cerevisiae)"""	KIAA0274		9039502, 11274189, 17572665	Standard	NM_014845		Approved	SAC3, hSac3, dJ249I4.1, ALS11, CMT4J	uc003ptt.2	Q92562	OTTHUMG00000015352	ENST00000230124.3:c.2059G>C	6.37:g.110107615G>C	ENSP00000230124:p.Asp687His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53H49|Q5TCS6	Missense_Mutation	SNP	pfam_Syja_N,pfscan_Syja_N	p.D687H	ENST00000230124.3	37	c.2059	CCDS5078.1	6	.	.	.	.	.	.	.	.	.	.	G	18.12	3.552182	0.65311	.	.	ENSG00000112367	ENST00000441478;ENST00000230124	T;T	0.53857	1.91;0.6	5.71	4.84	0.62591	.	0.099314	0.64402	D	0.000002	T	0.50548	0.1622	L	0.27053	0.805	0.58432	D	0.999999	P;D	0.71674	0.741;0.998	B;D	0.69142	0.336;0.962	T	0.58405	-0.7642	10	0.54805	T	0.06	-19.5867	16.5139	0.84294	0.0:0.0:0.8682:0.1318	.	410;687	F5H8L9;Q92562	.;FIG4_HUMAN	H	410;687	ENSP00000399443:D410H;ENSP00000230124:D687H	ENSP00000230124:D687H	D	+	1	0	FIG4	110214308	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.174000	0.94824	1.546000	0.49388	0.650000	0.86243	GAT	FIG4	-	NULL		0.358	FIG4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FIG4	HGNC	protein_coding	OTTHUMT00000041768.1	G	NM_014845		110107615	+1	no_errors	ENST00000230124	ensembl	human	known	70_37	missense	SNP	1.000	C
FKBP7	51661	genome.wustl.edu	37	2	179330469	179330469	+	3'UTR	DEL	A	A	-	rs75348694|rs11336824	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:179330469delA	ENST00000424785.2	-	0	755				FKBP7_ENST00000464248.1_5'UTR	NM_001135212.1|NM_181342.2	NP_001128684.1|NP_851939.1	Q9Y680	FKBP7_HUMAN	FK506 binding protein 7						chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|urinary_tract(1)	8			OV - Ovarian serous cystadenocarcinoma(117;0.00406)|Epithelial(96;0.0159)|all cancers(119;0.0564)			GTAAATAGCTAAAAAAAAAAA	0.318														2149	0.429113	0.5144	0.2622	5008	,	,		19034	0.6637		0.2435	False		,,,				2504	0.3814				Melanoma(26;682 927 5286 17599 46613)												0									,	22,0,2021,2223		0,0,5,17,0,0,0,442,1132,537	23.0	31.0	29.0		,	-0.9	0.0	2	dbSNP_130	38	39,11,1862,6340		0,0,4,35,0,1,10,124,1609,2343	no	utr-3,utr-3	FKBP7	NM_181342.2,NM_001135212.1	,	0,0,9,52,0,1,10,566,2741,2880	A1A1,A1A2,A1A3,A1R,A2A2,A2A3,A2R,A3A3,A3R,RR		23.1701,47.8903,31.5945	,	,	179330469	61,11,3883,8563	2187	4293	6480	SO:0001624	3_prime_UTR_variant	51661			AF092137	CCDS2280.1, CCDS46462.1	2q31.2	2013-01-10	2001-11-28		ENSG00000079150	ENSG00000079150		"""EF-hand domain containing"""	3723	protein-coding gene	gene with protein product		607062	"""FK506-binding protein 7"""			9806833	Standard	NM_181342		Approved	FKBP23	uc002umk.3	Q9Y680	OTTHUMG00000132577	ENST00000424785.2:c.*28T>-	2.37:g.179330469delA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZG70|Q6V3B2|Q86U65|Q96DA4|Q9Y6B0	RNA	DEL	-	NULL	ENST00000424785.2	37	NULL	CCDS2280.1	2																																																																																			FKBP7	-	-		0.318	FKBP7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FKBP7	HGNC	protein_coding	OTTHUMT00000255783.1	A	NM_181342		179330469	-1	no_errors	ENST00000464248	ensembl	human	known	70_37	rna	DEL	0.000	-
FKBPL	63943	genome.wustl.edu	37	6	32096556	32096556	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32096556C>T	ENST00000375156.3	-	2	1272	c.1002G>A	c.(1000-1002)aaG>aaA	p.K334K	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	334					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										CATCCTGGTTCTTCCCCTGAA	0.507																																																	0													175.0	186.0	182.0					6																	32096556		2203	4300	6503	SO:0001819	synonymous_variant	63943			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.1002G>A	6.37:g.32096556C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5V3|B0UYX8|Q9H5G3	Silent	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.K334	ENST00000375156.3	37	c.1002	CCDS4738.1	6																																																																																			FKBPL	-	NULL		0.507	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBPL	HGNC	protein_coding	OTTHUMT00000076221.2	C			32096556	-1	no_errors	ENST00000375156	ensembl	human	known	70_37	silent	SNP	1.000	T
FKBPL	63943	genome.wustl.edu	37	6	32097077	32097077	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32097077C>G	ENST00000375156.3	-	2	751	c.481G>C	c.(481-483)Gag>Cag	p.E161Q	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	161					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										AAGCATTTCTCTATGAGCTCC	0.577																																																	0													178.0	187.0	184.0					6																	32097077		2203	4300	6503	SO:0001583	missense	63943			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.481G>C	6.37:g.32097077C>G	ENSP00000364298:p.Glu161Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E161Q	ENST00000375156.3	37	c.481	CCDS4738.1	6	.	.	.	.	.	.	.	.	.	.	C	22.5	4.295715	0.81025	.	.	ENSG00000204315	ENST00000375156	D	0.85861	-2.04	5.38	5.38	0.77491	.	0.000000	0.45126	D	0.000388	D	0.84465	0.5478	N	0.24115	0.695	0.47374	D	0.999407	D	0.76494	0.999	D	0.66716	0.946	D	0.86806	0.1995	10	0.72032	D	0.01	-16.9716	16.6778	0.85284	0.0:1.0:0.0:0.0	.	161	Q9UIM3	FKBPL_HUMAN	Q	161	ENSP00000364298:E161Q	ENSP00000364298:E161Q	E	-	1	0	FKBPL	32205055	0.993000	0.37304	0.963000	0.40424	0.994000	0.84299	4.840000	0.62817	2.804000	0.96469	0.462000	0.41574	GAG	FKBPL	-	NULL		0.577	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBPL	HGNC	protein_coding	OTTHUMT00000076221.2	C			32097077	-1	no_errors	ENST00000375156	ensembl	human	known	70_37	missense	SNP	0.994	G
FKBPL	63943	genome.wustl.edu	37	6	32097143	32097143	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32097143C>G	ENST00000375156.3	-	2	685	c.415G>C	c.(415-417)Gag>Cag	p.E139Q	ATF6B_ENST00000375203.3_5'Flank|ATF6B_ENST00000375201.4_5'Flank|ATF6B_ENST00000468502.1_5'Flank	NM_022110.3	NP_071393.2	Q9UIM3	FKBPL_HUMAN	FK506 binding protein like	139					chaperone-mediated protein folding (GO:0061077)|protein peptidyl-prolyl isomerization (GO:0000413)|response to radiation (GO:0009314)	endoplasmic reticulum membrane (GO:0005789)	FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)										GTCCAGCCCTCTGGCGGCCCT	0.562																																																	0													172.0	192.0	185.0					6																	32097143		2203	4300	6503	SO:0001583	missense	63943			AF139374	CCDS4738.1	6p21.3	2013-12-13	2001-11-28		ENSG00000204315	ENSG00000204315		"""Tetratricopeptide (TTC) repeat domain containing"""	13949	protein-coding gene	gene with protein product	"""WAF-1/CIP1 stabilizing protein 39"""		"""FK506-binding protein like"""			9056895	Standard	NM_022110		Approved	DIR1, NG7, WISp39	uc003nzr.3	Q9UIM3	OTTHUMG00000031129	ENST00000375156.3:c.415G>C	6.37:g.32097143C>G	ENSP00000364298:p.Glu139Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5V3|B0UYX8|Q9H5G3	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E139Q	ENST00000375156.3	37	c.415	CCDS4738.1	6	.	.	.	.	.	.	.	.	.	.	C	14.99	2.700327	0.48307	.	.	ENSG00000204315	ENST00000375156	T	0.81415	-1.49	5.23	4.35	0.52113	.	0.407546	0.22055	N	0.065257	T	0.47911	0.1471	N	0.24115	0.695	0.29606	N	0.847302	B	0.20550	0.046	B	0.18263	0.021	T	0.31943	-0.9925	10	0.34782	T	0.22	-15.0424	7.0876	0.25266	0.0:0.735:0.1755:0.0895	.	139	Q9UIM3	FKBPL_HUMAN	Q	139	ENSP00000364298:E139Q	ENSP00000364298:E139Q	E	-	1	0	FKBPL	32205121	0.446000	0.25665	0.999000	0.59377	0.985000	0.73830	1.152000	0.31663	1.410000	0.46936	0.462000	0.41574	GAG	FKBPL	-	NULL		0.562	FKBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBPL	HGNC	protein_coding	OTTHUMT00000076221.2	C			32097143	-1	no_errors	ENST00000375156	ensembl	human	known	70_37	missense	SNP	0.999	G
FNBP1L	54874	genome.wustl.edu	37	1	93988993	93988993	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:93988993G>T	ENST00000271234.7	+	4	438	c.287G>T	c.(286-288)aGa>aTa	p.R96I	FNBP1L_ENST00000260506.8_Missense_Mutation_p.R96I|FNBP1L_ENST00000370256.4_Missense_Mutation_p.R96I|FNBP1L_ENST00000370253.2_Missense_Mutation_p.R96I|FNBP1L_ENST00000604705.1_Missense_Mutation_p.R96I	NM_001164473.2	NP_001157945.1	Q5T0N5	FBP1L_HUMAN	formin binding protein 1-like	96	F-BAR domain. {ECO:0000250}.				autophagy (GO:0006914)|clathrin-mediated endocytosis (GO:0072583)|membrane budding (GO:0006900)|membrane invagination (GO:0010324)|membrane tubulation (GO:0097320)|positive regulation of filopodium assembly (GO:0051491)|vesicle organization (GO:0016050)|vesicle transport along actin filament (GO:0030050)	cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	lipid binding (GO:0008289)			breast(2)|kidney(2)|large_intestine(4)|lung(2)|urinary_tract(1)	11		all_lung(203;0.00206)|Lung NSC(277;0.00902)|Melanoma(281;0.155)		all cancers(265;0.00666)|GBM - Glioblastoma multiforme(16;0.0378)|Epithelial(280;0.111)		ATGGCGCACAGAGTGTATGGT	0.348																																																	0													104.0	98.0	100.0					1																	93988993		1925	4154	6079	SO:0001583	missense	54874				CCDS53343.1, CCDS53344.1, CCDS60192.1	1p22.1	2008-02-05	2004-11-16	2004-11-17	ENSG00000137942	ENSG00000137942			20851	protein-coding gene	gene with protein product		608848	"""chromosome 1 open reading frame 39"""	C1orf39		14654988	Standard	NM_017737		Approved	TOCA1, FLJ20275	uc010otk.2	Q5T0N5	OTTHUMG00000010863	ENST00000271234.7:c.287G>T	1.37:g.93988993G>T	ENSP00000271234:p.Arg96Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	J3QSS4|Q5T0N6|Q6B097|Q6P653|Q6R4Q4|Q9NXG1	Missense_Mutation	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_HR1_rho-bd,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain	p.R96I	ENST00000271234.7	37	c.287	CCDS53343.1	1	.	.	.	.	.	.	.	.	.	.	G	20.5	4.005671	0.74932	.	.	ENSG00000137942	ENST00000370256;ENST00000271234;ENST00000260506;ENST00000370253	T;T;T;T	0.42900	0.96;0.96;0.96;0.96	5.95	5.95	0.96441	.	0.089149	0.85682	D	0.000000	T	0.37732	0.1014	L	0.47716	1.5	0.58432	D	0.999999	D;B	0.56968	0.978;0.31	P;B	0.46543	0.52;0.059	T	0.23332	-1.0191	10	0.62326	D	0.03	-11.9015	20.3719	0.98893	0.0:0.0:1.0:0.0	.	96;96	Q5T0N5-4;Q5T0N5-3	.;.	I	96	ENSP00000359278:R96I;ENSP00000271234:R96I;ENSP00000260506:R96I;ENSP00000359275:R96I	ENSP00000260506:R96I	R	+	2	0	FNBP1L	93761581	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.631000	0.61304	2.826000	0.97356	0.491000	0.48974	AGA	FNBP1L	-	NULL		0.348	FNBP1L-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	FNBP1L	HGNC	protein_coding		G	NM_017737		93988993	+1	no_errors	ENST00000271234	ensembl	human	known	70_37	missense	SNP	1.000	T
FNDC9	408263	genome.wustl.edu	37	5	156769931	156769931	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:156769931G>T	ENST00000312349.4	-	2	801	c.614C>A	c.(613-615)gCg>gAg	p.A205E	CYFIP2_ENST00000442283.2_Intron|CYFIP2_ENST00000521420.1_Intron|CYFIP2_ENST00000347377.6_Intron|CYFIP2_ENST00000377576.3_Intron|CYFIP2_ENST00000435847.2_Intron|CYFIP2_ENST00000318218.6_Intron|CYFIP2_ENST00000522463.1_Intron|CYFIP2_ENST00000541131.1_Intron	NM_001001343.3	NP_001001343.2	Q8TBE3	FNDC9_HUMAN	fibronectin type III domain containing 9	205						integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|urinary_tract(1)	9						TAAGGCACCCGCATCAGGGGC	0.607											OREG0016977	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													43.0	46.0	45.0					5																	156769931		2203	4300	6503	SO:0001583	missense	408263			BC022570	CCDS4337.1	5q33.3	2013-02-11	2011-01-25	2011-01-25	ENSG00000172568	ENSG00000172568		"""Fibronectin type III domain containing"""	33547	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 40"""	C5orf40			Standard	NM_001001343		Approved	MGC27121	uc003lwu.2	Q8TBE3	OTTHUMG00000130248	ENST00000312349.4:c.614C>A	5.37:g.156769931G>T	ENSP00000310594:p.Ala205Glu	Somatic	1781	WXS	Illumina HiSeq	Phase_IV	A8K0Y6	Missense_Mutation	SNP	superfamily_Fibronectin_type3	p.A205E	ENST00000312349.4	37	c.614	CCDS4337.1	5	.	.	.	.	.	.	.	.	.	.	G	9.142	1.014181	0.19277	.	.	ENSG00000172568	ENST00000312349	T	0.23950	1.88	5.08	-10.2	0.00374	.	1.276520	0.05731	N	0.599640	T	0.10465	0.0256	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.39820	-0.9595	10	0.54805	T	0.06	-0.3439	6.0271	0.19660	0.0875:0.226:0.4939:0.1926	.	205	Q8TBE3	FNDC9_HUMAN	E	205	ENSP00000310594:A205E	ENSP00000310594:A205E	A	-	2	0	FNDC9	156702509	0.000000	0.05858	0.000000	0.03702	0.066000	0.16364	-0.649000	0.05384	-4.285000	0.00059	-0.424000	0.05967	GCG	FNDC9	-	NULL		0.607	FNDC9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FNDC9	HGNC	protein_coding	OTTHUMT00000252573.2	G	NM_001001343		156769931	-1	no_errors	ENST00000312349	ensembl	human	known	70_37	missense	SNP	0.000	T
FOSB	2354	genome.wustl.edu	37	19	45975845	45975845	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:45975845G>C	ENST00000353609.3	+	4	1184	c.592G>C	c.(592-594)Gag>Cag	p.E198Q	FOSB_ENST00000592811.1_Missense_Mutation_p.E149Q|FOSB_ENST00000443841.2_Missense_Mutation_p.E55Q|FOSB_ENST00000586615.1_Missense_Mutation_p.E149Q|ERCC1_ENST00000423698.2_Intron|FOSB_ENST00000417353.2_Missense_Mutation_p.E162Q|FOSB_ENST00000592436.1_Missense_Mutation_p.E198Q|FOSB_ENST00000591858.1_Missense_Mutation_p.E159Q|FOSB_ENST00000585836.1_Missense_Mutation_p.E123Q	NM_006732.2	NP_006723.2	P53539	FOSB_HUMAN	FBJ murine osteosarcoma viral oncogene homolog B	198	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to mechanical stimulus (GO:0009612)|response to morphine (GO:0043278)|response to progesterone (GO:0032570)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)			NS(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|pancreas(1)	13		Ovarian(192;0.051)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00814)|Epithelial(262;0.18)|GBM - Glioblastoma multiforme(486;0.242)		AGCAGAGCTGGAGTCGGAGAT	0.567																																																	0													30.0	36.0	34.0					19																	45975845		2203	4300	6503	SO:0001583	missense	2354				CCDS12664.1, CCDS46113.1	19q13.3	2013-01-10						"""basic leucine zipper proteins"""	3797	protein-coding gene	gene with protein product	"""oncogene FOS-B"", ""activator protein 1"""	164772				1301997	Standard	NM_006732		Approved	G0S3, GOSB, GOS3, AP-1, MGC42291, DKFZp686C0818	uc002pbx.4	P53539		ENST00000353609.3:c.592G>C	19.37:g.45975845G>C	ENSP00000245919:p.Glu198Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9K5|A8VJE1|A8VJE6|A8VJF0|A8VJF3|A8VJF7|A8VJG1|A8VJG5|A8VJG9|E7EPR6|E9PHJ3|K7EMJ6|Q49AD7	Missense_Mutation	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos	p.E198Q	ENST00000353609.3	37	c.592	CCDS12664.1	19	.	.	.	.	.	.	.	.	.	.	G	11.84	1.758953	0.31137	.	.	ENSG00000125740	ENST00000353609;ENST00000417353;ENST00000455928;ENST00000443841	T;T;T	0.77229	0.56;-0.0;-1.08	4.77	4.77	0.60923	Basic-leucine zipper (bZIP) transcription factor (2);bZIP transcription factor, bZIP-1 (1);	0.000000	0.85682	D	0.000000	T	0.63177	0.2489	N	0.01128	-1	0.58432	D	0.999992	D;D;D;P;D;D	0.64830	0.981;0.986;0.994;0.769;0.994;0.986	P;P;D;P;P;P	0.63597	0.88;0.887;0.916;0.888;0.88;0.887	T	0.64976	-0.6280	10	0.02654	T	1	-0.6094	15.3826	0.74673	0.0:0.0:1.0:0.0	.	55;159;123;55;162;198	E7EPR6;A8VJF0;A8VJF3;A8VJG5;E9PHJ3;P53539	.;.;.;.;.;FOSB_HUMAN	Q	198;162;198;55	ENSP00000245919:E198Q;ENSP00000407207:E162Q;ENSP00000414177:E55Q	ENSP00000245919:E198Q	E	+	1	0	FOSB	50667685	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	2.959000	0.49153	2.497000	0.84241	0.549000	0.68633	GAG	FOSB	-	pfam_bZIP,smart_bZIP,pfscan_bZIP,prints_Leuzip_Fos		0.567	FOSB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOSB	HGNC	protein_coding	OTTHUMT00000459561.1	G	NM_006732		45975845	+1	no_errors	ENST00000353609	ensembl	human	known	70_37	missense	SNP	1.000	C
FOXH1	8928	genome.wustl.edu	37	8	145700624	145700624	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:145700624G>A	ENST00000377317.4	-	2	773	c.195C>T	c.(193-195)gcC>gcT	p.A65A	FOXH1_ENST00000525197.1_Intron	NM_003923.2	NP_003914.1	O75593	FOXH1_HUMAN	forkhead box H1	65					aorta morphogenesis (GO:0035909)|axial mesoderm development (GO:0048318)|cardiac right ventricle morphogenesis (GO:0003215)|embryonic heart tube anterior/posterior pattern specification (GO:0035054)|heart looping (GO:0001947)|negative regulation of androgen receptor activity (GO:2000824)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of intracellular estrogen receptor signaling pathway (GO:0033147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nodal signaling pathway involved in determination of lateral mesoderm left/right asymmetry (GO:1900164)|outflow tract morphogenesis (GO:0003151)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|secondary heart field specification (GO:0003139)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ventricular trabecula myocardium morphogenesis (GO:0003222)	activin responsive factor complex (GO:0032444)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	androgen receptor binding (GO:0050681)|bHLH transcription factor binding (GO:0043425)|co-SMAD binding (GO:0070410)|enhancer binding (GO:0035326)|protein domain specific binding (GO:0019904)|R-SMAD binding (GO:0070412)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|SMAD binding (GO:0046332)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(2)	5	all_cancers(97;4.61e-11)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.08e-41)|Epithelial(56;8.67e-41)|all cancers(56;1.76e-35)|BRCA - Breast invasive adenocarcinoma(115;0.035)|Colorectal(110;0.055)			AGGGGAACACGGCCTGGACCT	0.667																																																	0													36.0	36.0	36.0					8																	145700624		2202	4298	6500	SO:0001819	synonymous_variant	8928			AF076292	CCDS6428.1	8q24.3	2014-08-12			ENSG00000160973			"""Forkhead boxes"""	3814	protein-coding gene	gene with protein product		603621				9702198	Standard	NM_003923		Approved	FAST1	uc003zdc.3	O75593	OTTHUMG00000165172	ENST00000377317.4:c.195C>T	8.37:g.145700624G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWM4	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.A65	ENST00000377317.4	37	c.195	CCDS6428.1	8																																																																																			FOXH1	-	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head		0.667	FOXH1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXH1	HGNC	protein_coding	OTTHUMT00000382451.1	G			145700624	-1	no_errors	ENST00000377317	ensembl	human	known	70_37	silent	SNP	0.562	A
FOXP2	93986	genome.wustl.edu	37	7	114329979	114329979	+	Nonstop_Mutation	SNP	T	T	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:114329979T>A	ENST00000393494.2	+	17	2425	c.2146T>A	c.(2146-2148)Tga>Aga	p.*716R	FOXP2_ENST00000393498.2_Nonstop_Mutation_p.*695R|FOXP2_ENST00000350908.4_Nonstop_Mutation_p.*716R|FOXP2_ENST00000403559.4_Nonstop_Mutation_p.*733R|FOXP2_ENST00000393491.3_Nonstop_Mutation_p.*531R|FOXP2_ENST00000393489.3_Nonstop_Mutation_p.*624R|FOXP2_ENST00000408937.3_Nonstop_Mutation_p.*741R			O15409	FOXP2_HUMAN	forkhead box P2	0					camera-type eye development (GO:0043010)|caudate nucleus development (GO:0021757)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|growth (GO:0040007)|lung alveolus development (GO:0048286)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of epithelial cell proliferation involved in lung morphogenesis (GO:0060501)|positive regulation of mesenchymal cell proliferation (GO:0002053)|post-embryonic development (GO:0009791)|putamen development (GO:0021758)|righting reflex (GO:0060013)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|vocal learning (GO:0042297)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(3)|endometrium(7)|kidney(4)|large_intestine(7)|lung(22)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	52						AGATCTGGAATGAGAACTGAC	0.403																																																	0													121.0	115.0	117.0					7																	114329979		2203	4300	6503	SO:0001578	stop_lost	93986			U80741	CCDS5760.1, CCDS5761.1, CCDS43635.1, CCDS5761.2, CCDS55154.1	7q31	2008-07-18			ENSG00000128573	ENSG00000128573		"""Forkhead boxes"""	13875	protein-coding gene	gene with protein product	"""trinucleotide repeat containing 10"", ""forkhead/winged-helix transcription factor"", ""speech and language disorder 1"", ""CAG repeat protein 44"""	605317		TNRC10, SPCH1		11586359, 9225980	Standard	NM_014491		Approved	CAGH44	uc003vgz.3	O15409	OTTHUMG00000023131	ENST00000393494.2:c.2146T>A	7.37:g.114329979T>A	ENSP00000377132:p.*716Argext*9	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUV6|A4D0U8|A6NNW4|B4DLD9|Q6ZND1|Q75MJ3|Q8IZE0|Q8N0W2|Q8N6B7|Q8N6B8|Q8NFQ1|Q8NFQ2|Q8NFQ3|Q8NFQ4|Q8TD74	Nonstop_Mutation	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.*741R	ENST00000393494.2	37	c.2221	CCDS5760.1	7	.	.	.	.	.	.	.	.	.	.	T	24.2	4.501771	0.85176	.	.	ENSG00000128573	ENST00000393494;ENST00000408937;ENST00000403559;ENST00000350908;ENST00000393498;ENST00000393489;ENST00000393491	.	.	.	5.96	5.96	0.96718	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.4447	0.83919	0.0:0.0:0.0:1.0	.	.	.	.	R	716;741;733;716;693;624;531	.	.	X	+	1	0	FOXP2	114117215	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.698000	0.84413	2.284000	0.76573	0.528000	0.53228	TGA	FOXP2	-	NULL		0.403	FOXP2-014	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	FOXP2	HGNC	protein_coding	OTTHUMT00000317366.1	T	NM_014491		114329979	+1	no_errors	ENST00000408937	ensembl	human	known	70_37	nonstop	SNP	1.000	A
FOXP4	116113	genome.wustl.edu	37	6	41555242	41555242	+	Silent	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:41555242G>C	ENST00000307972.4	+	6	876	c.864G>C	c.(862-864)cgG>cgC	p.R288R	FOXP4_ENST00000409208.1_Silent_p.R288R|FOXP4_ENST00000373063.3_Silent_p.R287R|FOXP4_ENST00000373057.3_Silent_p.R286R|FOXP4_ENST00000373060.1_Silent_p.R288R			Q8IVH2	FOXP4_HUMAN	forkhead box P4	288					embryonic foregut morphogenesis (GO:0048617)|heart development (GO:0007507)|lung secretory cell differentiation (GO:0061140)|negative regulation of lung goblet cell differentiation (GO:1901250)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	16	Ovarian(28;0.0327)|Colorectal(47;0.196)					TCACATCTCGGAGAGACAGGT	0.672											OREG0004065	type=REGULATORY REGION|Gene=FOXP4|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													49.0	54.0	52.0					6																	41555242		2203	4300	6503	SO:0001819	synonymous_variant	116113			AB080747	CCDS4856.1, CCDS34447.1, CCDS34448.1	6p21.1	2008-02-05			ENSG00000137166	ENSG00000137166		"""Forkhead boxes"""	20842	protein-coding gene	gene with protein product		608924					Standard	XM_006714991		Approved	FLJ40908	uc003oql.3	Q8IVH2	OTTHUMG00000014679	ENST00000307972.4:c.864G>C	6.37:g.41555242G>C		Somatic	902	WXS	Illumina HiSeq	Phase_IV	Q5W098|Q7Z7F8|Q8IW55|Q96E19	Silent	SNP	pfam_TF_fork_head,smart_TF_fork_head,pfscan_TF_fork_head,prints_TF_fork_head	p.R288	ENST00000307972.4	37	c.864	CCDS34447.1	6																																																																																			FOXP4	-	NULL		0.672	FOXP4-002	KNOWN	basic|CCDS	protein_coding	FOXP4	HGNC	protein_coding	OTTHUMT00000106767.1	G	NM_138457		41555242	+1	no_errors	ENST00000307972	ensembl	human	known	70_37	silent	SNP	1.000	C
FOXRED2	80020	genome.wustl.edu	37	22	36892065	36892065	+	Missense_Mutation	SNP	G	G	T	rs377718449		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:36892065G>T	ENST00000397224.4	-	7	1666	c.1573C>A	c.(1573-1575)Cag>Aag	p.Q525K	FOXRED2_ENST00000216187.6_Missense_Mutation_p.Q525K|FOXRED2_ENST00000366463.3_Missense_Mutation_p.Q77K|FOXRED2_ENST00000397223.4_Missense_Mutation_p.Q525K	NM_001102371.1	NP_001095841.1	Q8IWF2	FXRD2_HUMAN	FAD-dependent oxidoreductase domain containing 2	525					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)	endoplasmic reticulum lumen (GO:0005788)	flavin adenine dinucleotide binding (GO:0050660)|glycoprotein binding (GO:0001948)|oxidoreductase activity (GO:0016491)			breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(5)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22						AAGTTAGACTGCCAGGCATCT	0.527																																																	0													107.0	98.0	101.0					22																	36892065		2203	4300	6503	SO:0001583	missense	80020			BC027716	CCDS13929.1	22q12.3	2006-07-05			ENSG00000100350	ENSG00000100350			26264	protein-coding gene	gene with protein product		613777				12477932	Standard	NM_024955		Approved	FLJ23322	uc003app.4	Q8IWF2	OTTHUMG00000044614	ENST00000397224.4:c.1573C>A	22.37:g.36892065G>T	ENSP00000380401:p.Gln525Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDI4|Q8N378|Q96BD1|Q9H5L5|Q9H6M8	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD	p.Q525K	ENST00000397224.4	37	c.1573	CCDS13929.1	22	.	.	.	.	.	.	.	.	.	.	G	1.864	-0.461872	0.04508	.	.	ENSG00000100350	ENST00000397224;ENST00000216187;ENST00000366463;ENST00000397223	T;T;T;T	0.39997	2.63;2.63;1.05;2.63	5.52	4.48	0.54585	.	0.289846	0.39341	N	0.001386	T	0.25717	0.0626	N	0.20685	0.6	0.38127	D	0.93804	B	0.06786	0.001	B	0.04013	0.001	T	0.14952	-1.0454	10	0.02654	T	1	-17.0162	15.3129	0.74048	0.0:0.0:0.8548:0.1452	.	525	Q8IWF2	FXRD2_HUMAN	K	525;525;77;525	ENSP00000380401:Q525K;ENSP00000216187:Q525K;ENSP00000382543:Q77K;ENSP00000380400:Q525K	ENSP00000216187:Q525K	Q	-	1	0	FOXRED2	35222011	1.000000	0.71417	1.000000	0.80357	0.470000	0.32858	5.366000	0.66122	1.279000	0.44446	0.650000	0.86243	CAG	FOXRED2	-	NULL		0.527	FOXRED2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FOXRED2	HGNC	protein_coding	OTTHUMT00000104098.2	G	NM_024955		36892065	-1	no_errors	ENST00000216187	ensembl	human	known	70_37	missense	SNP	1.000	T
FRMPD2	143162	genome.wustl.edu	37	10	49388901	49388901	+	Missense_Mutation	SNP	C	C	T	rs61840030	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:49388901C>T	ENST00000374201.3	-	21	3037	c.2735G>A	c.(2734-2736)gGg>gAg	p.G912E	FRMPD2_ENST00000463706.1_5'Flank|FRMPD2_ENST00000305531.3_Missense_Mutation_p.G887E|FRMPD2_ENST00000407470.4_Missense_Mutation_p.G880E	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	912					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		GCTCTGCACCCCAGCCATGTC	0.483																																																	0													1.0	1.0	1.0					10																	49388901		70	202	272	SO:0001583	missense	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2735G>A	10.37:g.49388901C>T	ENSP00000363317:p.Gly912Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.G912E	ENST00000374201.3	37	c.2735	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	C	5.948	0.358910	0.11239	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.62788	0.03;0.0;0.0	5.13	-10.3	0.00346	.	.	.	.	.	T	0.29190	0.0726	N	0.14661	0.345	0.80722	P	0.0	B;B;B	0.27450	0.103;0.179;0.103	B;B;B	0.25140	0.058;0.033;0.058	T	0.08351	-1.0726	8	0.07813	T	0.8	.	3.5111	0.07708	0.1915:0.103:0.1445:0.561	.	887;912;880	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	E	912;887;880	ENSP00000363317:G912E;ENSP00000307079:G887E;ENSP00000384339:G880E	ENSP00000307079:G887E	G	-	2	0	FRMPD2	49058907	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.517000	0.02248	-3.272000	0.00199	-0.145000	0.13849	GGG	FRMPD2	-	NULL		0.483	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	C	NM_152428		49388901	-1	no_errors	ENST00000374201	ensembl	human	known	70_37	missense	SNP	0.000	T
FRRS1	391059	genome.wustl.edu	37	1	100185200	100185200	+	Missense_Mutation	SNP	C	C	T	rs149529384		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:100185200C>T	ENST00000414213.1	-	10	1611	c.1010G>A	c.(1009-1011)cGa>cAa	p.R337Q	FRRS1_ENST00000287474.5_Missense_Mutation_p.R337Q			Q6ZNA5	FRRS1_HUMAN	ferric-chelate reductase 1	337	Cytochrome b561. {ECO:0000255|PROSITE- ProRule:PRU00242}.					integral component of membrane (GO:0016021)	ferric-chelate reductase activity (GO:0000293)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(12)|pancreas(1)|skin(1)|urinary_tract(1)	26		all_epithelial(167;2.09e-06)|all_lung(203;0.000435)|Lung NSC(277;0.00201)		Epithelial(280;0.0718)|all cancers(265;0.126)|COAD - Colon adenocarcinoma(174;0.148)|Lung(183;0.206)		CTTGTAAATTCGACCTGCAAA	0.358																																																	0								C	GLN/ARG	0,4406		0,0,2203	94.0	93.0	94.0		1010	-0.1	1.0	1	dbSNP_134	94	1,8599	1.2+/-3.3	0,1,4299	no	missense	FRRS1	NM_001013660.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	337/627	100185200	1,13005	2203	4300	6503	SO:0001583	missense	391059			AK131302	CCDS30780.1	1p21.3	2009-11-30	2006-02-22	2006-02-22	ENSG00000156869	ENSG00000156869			27622	protein-coding gene	gene with protein product		611578	"""stromal cell derived factor receptor 2 homolog (mouse)"""	SDFR2			Standard	NM_001013660		Approved	SDR2	uc001dsh.1	Q6ZNA5	OTTHUMG00000010768	ENST00000414213.1:c.1010G>A	1.37:g.100185200C>T	ENSP00000393884:p.Arg337Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLN7	Missense_Mutation	SNP	pfam_Reeler_dom,pfam_DOMON_domain,smart_DOMON_domain,smart_Cyt_b561/ferric_Rdtase_TM,pfscan_DOMON_domain,pfscan_Reeler_dom,pfscan_Cyt_b561/ferric_Rdtase_TM	p.R337Q	ENST00000414213.1	37	c.1010		1	.	.	.	.	.	.	.	.	.	.	C	11.54	1.670381	0.29693	0.0	1.16E-4	ENSG00000156869	ENST00000414213;ENST00000287474	.	.	.	5.76	-0.0873	0.13677	.	1.168270	0.05951	N	0.638847	T	0.05868	0.0153	L	0.28115	0.83	0.22226	N	0.999276	B	0.30114	0.269	B	0.20384	0.029	T	0.25606	-1.0127	9	0.13470	T	0.59	-0.1698	1.9691	0.03402	0.1299:0.3971:0.1277:0.3453	.	337	Q6ZNA5-2	.	Q	337	.	ENSP00000287474:R337Q	R	-	2	0	FRRS1	99957788	0.025000	0.19082	0.969000	0.41365	0.966000	0.64601	-1.036000	0.03560	0.070000	0.16634	0.655000	0.94253	CGA	FRRS1	-	smart_DOMON_domain,pfscan_Cyt_b561/ferric_Rdtase_TM		0.358	FRRS1-201	KNOWN	basic|appris_principal	protein_coding	FRRS1	HGNC	protein_coding		C	NM_001013660		100185200	-1	no_errors	ENST00000287474	ensembl	human	known	70_37	missense	SNP	0.651	T
GABRB1	2560	genome.wustl.edu	37	4	47405722	47405722	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:47405722G>A	ENST00000295454.3	+	7	1121	c.829G>A	c.(829-831)Gca>Aca	p.A277T	GABRB1_ENST00000538619.1_Missense_Mutation_p.A207T	NM_000812.3	NP_000803.2	P18505	GBRB1_HUMAN	gamma-aminobutyric acid (GABA) A receptor, beta 1	277					cellular response to histamine (GO:0071420)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|chloride channel complex (GO:0034707)|GABA-A receptor complex (GO:1902711)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|GABA-A receptor activity (GO:0004890)|ligand-gated ion channel activity (GO:0015276)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(22)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44					Acamprosate(DB00659)|Adinazolam(DB00546)|Alprazolam(DB00404)|Amoxapine(DB00543)|Bromazepam(DB01558)|Butabarbital(DB00237)|Butalbital(DB00241)|Chlordiazepoxide(DB00475)|Cinolazepam(DB01594)|Clobazam(DB00349)|Clonazepam(DB01068)|Clorazepate(DB00628)|Clotiazepam(DB01559)|Desflurane(DB01189)|Diazepam(DB00829)|Enflurane(DB00228)|Ergoloid mesylate(DB01049)|Estazolam(DB01215)|Eszopiclone(DB00402)|Ethchlorvynol(DB00189)|Etomidate(DB00292)|Fludiazepam(DB01567)|Flumazenil(DB01205)|Flurazepam(DB00690)|Gamma Hydroxybutyric Acid(DB01440)|Glutethimide(DB01437)|Halazepam(DB00801)|Halothane(DB01159)|Isoflurane(DB00753)|Ketazolam(DB01587)|Lindane(DB00431)|Lorazepam(DB00186)|Meprobamate(DB00371)|Methoxyflurane(DB01028)|Methyprylon(DB01107)|Midazolam(DB00683)|Nitrazepam(DB01595)|Olanzapine(DB00334)|Oxazepam(DB00842)|Pentobarbital(DB00312)|Prazepam(DB01588)|Primidone(DB00794)|Propofol(DB00818)|Quazepam(DB01589)|Sevoflurane(DB01236)|Talbutal(DB00306)|Temazepam(DB00231)|Topiramate(DB00273)|Triazolam(DB00897)	AGCCAGAGTCGCACTAGGTAA	0.398																																																	0													99.0	95.0	97.0					4																	47405722		2203	4300	6503	SO:0001583	missense	2560				CCDS3474.1	4p12	2012-06-22			ENSG00000163288	ENSG00000163288		"""GABA receptors"", ""Ligand-gated ion channels / GABA(A) receptors"""	4081	protein-coding gene	gene with protein product	"""GABA(A) receptor, beta 1"""	137190					Standard	NM_000812		Approved		uc003gxh.3	P18505	OTTHUMG00000044269	ENST00000295454.3:c.829G>A	4.37:g.47405722G>A	ENSP00000295454:p.Ala277Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6U7|D6REL3|Q16166|Q8TBK3	Missense_Mutation	SNP	pfam_Neurotrans-gated_channel_TM,pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_GABAAb_rcpt,prints_Neur_channel,prints_GABBAg_rcpt,tigrfam_Neur_channel	p.A277T	ENST00000295454.3	37	c.829	CCDS3474.1	4	.	.	.	.	.	.	.	.	.	.	G	35	5.576386	0.96565	.	.	ENSG00000163288	ENST00000295454;ENST00000538619	D;D	0.84516	-1.86;-1.86	5.43	5.43	0.79202	Neurotransmitter-gated ion-channel transmembrane domain (2);	0.000000	0.85682	D	0.000000	D	0.90212	0.6940	L	0.43598	1.365	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.85130	0.923;0.997	D	0.90645	0.4578	10	0.87932	D	0	-16.2007	19.4279	0.94751	0.0:0.0:1.0:0.0	.	207;277	F5GXV5;P18505	.;GBRB1_HUMAN	T	277;207	ENSP00000295454:A277T;ENSP00000440330:A207T	ENSP00000295454:A277T	A	+	1	0	GABRB1	47100479	1.000000	0.71417	0.979000	0.43373	0.969000	0.65631	9.657000	0.98554	2.824000	0.97209	0.655000	0.94253	GCA	GABRB1	-	pfam_Neurotrans-gated_channel_TM,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,tigrfam_Neur_channel		0.398	GABRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GABRB1	HGNC	protein_coding	OTTHUMT00000216896.1	G			47405722	+1	no_errors	ENST00000295454	ensembl	human	known	70_37	missense	SNP	1.000	A
GJC2	57165	genome.wustl.edu	37	1	228346171	228346171	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:228346171G>A	ENST00000366714.2	+	2	887	c.712G>A	c.(712-714)Gag>Aag	p.E238K		NM_020435.3	NP_065168.2	Q5T442	CXG2_HUMAN	gap junction protein, gamma 2, 47kDa	238					cell death (GO:0008219)|cell-cell signaling (GO:0007267)|response to toxic substance (GO:0009636)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)	gap junction channel activity (GO:0005243)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)	7		Prostate(94;0.0405)				GTACGGCTTCGAGGTGCGACC	0.652																																																	0													73.0	74.0	73.0					1																	228346171		2203	4300	6503	SO:0001583	missense	57165			AF014643	CCDS1569.1	1q41-q42	2009-01-02	2007-12-14	2007-11-06	ENSG00000198835	ENSG00000198835		"""Ion channels / Gap junction proteins (connexins)"""	17494	protein-coding gene	gene with protein product	"""connexin 47"""	608803	"""gap junction protein, alpha 12, 47kDa"""	GJA12		19056803	Standard	NM_020435		Approved	CX47, CX46.6, SPG44	uc001hsk.3	Q5T442	OTTHUMG00000039771	ENST00000366714.2:c.712G>A	1.37:g.228346171G>A	ENSP00000355675:p.Glu238Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O43440|Q7Z7J2|Q8IWJ9	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin	p.E238K	ENST00000366714.2	37	c.712	CCDS1569.1	1	.	.	.	.	.	.	.	.	.	.	G	14.70	2.613585	0.46631	.	.	ENSG00000198835	ENST00000366714	D	0.95342	-3.68	4.05	4.05	0.47172	Gap junction protein, cysteine-rich domain (1);	0.201643	0.36409	N	0.002605	D	0.87877	0.6288	N	0.17800	0.525	0.39215	D	0.963389	B	0.29188	0.236	B	0.26202	0.067	D	0.85928	0.1450	10	0.25751	T	0.34	.	12.3286	0.55026	0.0:0.1704:0.8296:0.0	.	238	Q5T442	CXG2_HUMAN	K	238	ENSP00000355675:E238K	ENSP00000355675:E238K	E	+	1	0	GJC2	226412794	1.000000	0.71417	0.997000	0.53966	0.455000	0.32408	4.098000	0.57748	2.112000	0.64535	0.305000	0.20034	GAG	GJC2	-	pfam_Connexin_CCC		0.652	GJC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJC2	HGNC	protein_coding	OTTHUMT00000095985.1	G	NM_020435		228346171	+1	no_errors	ENST00000366714	ensembl	human	known	70_37	missense	SNP	0.998	A
GNB1L	54584	genome.wustl.edu	37	22	19776159	19776160	+	3'UTR	INS	-	-	G	rs3214094|rs373968313	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:19776159_19776160insG	ENST00000329517.6	-	0	1292_1293				GNB1L_ENST00000405009.1_Intron|GNB1L_ENST00000460402.1_5'UTR|GNB1L_ENST00000403325.1_3'UTR	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like						G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					CCTTGAGGTTTCAGGCCAAGGC	0.614													-|-|G|insertion	911	0.181909	0.0333	0.2334	5008	,	,		18010	0.4504		0.1163	False		,,,				2504	0.137																0										175,4045		14,147,1949						1.1	0.0		dbSNP_106	42	933,7233		93,747,3243	no	utr-3	GNB1L	NM_053004.2		107,894,5192	A1A1,A1R,RR		11.4254,4.1469,8.9456				1108,11278				SO:0001624	3_prime_UTR_variant	54584			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.*73->C	22.37:g.19776159_19776160insG		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H2S2|Q9H4M4	RNA	INS	-	NULL	ENST00000329517.6	37	NULL	CCDS13768.1	22																																																																																			GNB1L	-	-		0.614	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB1L	HGNC	protein_coding	OTTHUMT00000075202.1	-			19776160	-1	no_errors	ENST00000460402	ensembl	human	known	70_37	rna	INS	0.001:0.001	G
GNS	2799	genome.wustl.edu	37	12	65146511	65146511	+	Silent	SNP	G	G	A	rs376829383		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:65146511G>A	ENST00000258145.3	-	2	389	c.219C>T	c.(217-219)ctC>ctT	p.L73L	GNS_ENST00000418919.2_Silent_p.L17L|GNS_ENST00000542058.1_Intron|GNS_ENST00000543646.1_Silent_p.L105L	NM_002076.3	NP_002067.1	P15586	GNS_HUMAN	glucosamine (N-acetyl)-6-sulfatase	73					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)	metal ion binding (GO:0046872)|N-acetylglucosamine-6-sulfatase activity (GO:0008449)|sulfuric ester hydrolase activity (GO:0008484)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(4)	15	Lung NSC(1;7.25e-14)|all_lung(1;1.25e-12)		LUAD - Lung adenocarcinoma(6;0.115)	GBM - Glioblastoma multiforme(28;0.0435)		TCTCTCCGATGAGAGCTTTGG	0.333																																																	0													62.0	63.0	63.0					12																	65146511		2203	4300	6503	SO:0001819	synonymous_variant	2799				CCDS8970.1	12q14	2010-05-04	2008-08-01		ENSG00000135677	ENSG00000135677	3.1.6.14		4422	protein-coding gene	gene with protein product	"""Sanfilippo disease IIID"", ""N-acetylglucosamine-6-sulfatase"""	607664					Standard	NM_002076		Approved		uc001ssg.4	P15586	OTTHUMG00000168819	ENST00000258145.3:c.219C>T	12.37:g.65146511G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYH8|Q53F05	Silent	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase	p.L73	ENST00000258145.3	37	c.219	CCDS8970.1	12																																																																																			GNS	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core,pirsf_GlcNAc_6-SO4ase		0.333	GNS-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GNS	HGNC	protein_coding	OTTHUMT00000401195.2	G			65146511	-1	no_errors	ENST00000258145	ensembl	human	known	70_37	silent	SNP	0.984	A
GOLGA8EP	390535	genome.wustl.edu	37	15	23445354	23445354	+	RNA	SNP	C	C	G	rs200529476	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:23445354C>G	ENST00000526079.1	+	0	2174				AC100757.1_ENST00000458911.1_RNA|RN7SL106P_ENST00000488468.2_RNA	NR_027407.1|NR_033350.1				golgin A8 family, member E, pseudogene																		CCCACGACAACCCTACTGCAC	0.597																																																	0													6.0	7.0	6.0					15																	23445354		1451	3371	4822			390535					15q11.2	2014-03-21	2012-10-05	2012-10-05	ENSG00000175676	ENSG00000175676			32377	pseudogene	pseudogene			"""golgi autoantigen, golgin subfamily a, 8E"", ""golgin A8 family, member E"""	GOLGA8E		12477932	Standard	NR_033350		Approved		uc001yvu.3		OTTHUMG00000167132		15.37:g.23445354C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000526079.1	37	NULL		15																																																																																			GOLGA8EP	-	-		0.597	GOLGA8EP-002	KNOWN	basic	processed_transcript	GOLGA8EP	HGNC	pseudogene	OTTHUMT00000393312.1	C	NR_033350.1		23445354	+1	no_errors	ENST00000526079	ensembl	human	known	70_37	rna	SNP	0.006	G
GOLGA8I	283796	genome.wustl.edu	37	15	23259270	23259270	+	Silent	SNP	A	A	G	rs200991698	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:23259270A>G	ENST00000450802.3	+	5	422	c.324A>G	c.(322-324)aaA>aaG	p.K108K		NM_001282468.1|NM_001282472.1|NM_001282484.1|NM_001282490.1|NM_001282493.1|NM_001282494.1	NP_001269397.1|NP_001269401.1|NP_001269413.1|NP_001269419.1|NP_001269422.1|NP_001269423.1	A6NC78	GOG8I_HUMAN	golgin A8 family, member I	108						Golgi apparatus (GO:0005794)|membrane (GO:0016020)											AACAGAAGAAACAAGTGGAAC	0.522													.|||	4069	0.8125	0.7549	0.7579	5008	,	,		20799	0.997		0.6352	False		,,,				2504	0.9213																0																																										SO:0001819	synonymous_variant	283796			AK093104		15q11.2	2013-01-17	2012-10-05	2012-10-05	ENSG00000153666	ENSG00000277561			26660	other	unknown	"""FLJ35785"""		"""golgi autoantigen, golgin subfamily a, 9 pseudogene"", ""golgin A9, pseudogene"", ""golgin A8 family, member I, pseudogene"""	GOLGA9P, GOLGA8IP			Standard	NR_024074		Approved	FLJ35785	uc001yvh.1	A6NC78	OTTHUMG00000129149	ENST00000450802.3:c.324A>G	15.37:g.23259270A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.K108	ENST00000450802.3	37	c.324		15																																																																																			GOLGA8I	-	NULL		0.522	GOLGA8I-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal	protein_coding	GOLGA8I	HGNC	protein_coding	OTTHUMT00000251213.2	A	NR_024074		23259270	+1	no_errors	ENST00000450802	ensembl	human	known	70_37	silent	SNP	0.243	G
GOLGA8H	728498	genome.wustl.edu	37	15	30905994	30905994	+	Missense_Mutation	SNP	G	G	A	rs199794386	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:30905994G>A	ENST00000566740.1	+	16	1390	c.1390G>A	c.(1390-1392)Gag>Aag	p.E464K	RN7SL628P_ENST00000473920.2_RNA|AC026150.1_ENST00000408431.1_RNA			P0CJ92	GOG8H_HUMAN	golgin A8 family, member H	464						Golgi apparatus (GO:0005794)											GGACCACCTGGAGGAGAAGGC	0.542																																																	0																																										SO:0001583	missense	728498				CCDS61576.1	15q13.2	2012-10-05			ENSG00000261794	ENSG00000261794			37443	protein-coding gene	gene with protein product	"""golgi autoantigen, golgin subfamily a, 6-like 11"""						Standard	NM_001282490		Approved	GOLGA6L11		P0CJ92	OTTHUMG00000175654	ENST00000566740.1:c.1390G>A	15.37:g.30905994G>A	ENSP00000456894:p.Glu464Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E464K	ENST00000566740.1	37	c.1390		15																																																																																			GOLGA8H	-	NULL		0.542	GOLGA8H-001	NOVEL	basic|appris_principal	protein_coding	GOLGA8H	HGNC	protein_coding	OTTHUMT00000430724.1	G	XM_001724395		30905994	+1	no_errors	ENST00000566740	ensembl	human	novel	70_37	missense	SNP	1.000	A
GOLGB1	2804	genome.wustl.edu	37	3	121412667	121412667	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:121412667C>G	ENST00000340645.5	-	13	6813	c.6688G>C	c.(6688-6690)Gaa>Caa	p.E2230Q	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E2235Q	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	2230					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		CAATTATCTTCTTTGAGTCTA	0.363																																																	0													230.0	207.0	215.0					3																	121412667		2203	4300	6503	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.6688G>C	3.37:g.121412667C>G	ENSP00000341848:p.Glu2230Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.E2230Q	ENST00000340645.5	37	c.6688	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	C	12.64	1.998685	0.35226	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.26067	1.77;1.76	5.75	5.75	0.90469	.	0.106278	0.41294	D	0.000912	T	0.42832	0.1220	M	0.68952	2.095	0.49582	D	0.999807	D;P;P;D	0.55800	0.973;0.879;0.879;0.973	P;P;P;P	0.55011	0.71;0.448;0.448;0.766	T	0.06826	-1.0805	10	0.24483	T	0.36	.	17.4537	0.87600	0.0:1.0:0.0:0.0	.	2155;2235;2235;2230	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	Q	2230;2235	ENSP00000341848:E2230Q;ENSP00000377275:E2235Q	ENSP00000341848:E2230Q	E	-	1	0	GOLGB1	122895357	1.000000	0.71417	1.000000	0.80357	0.964000	0.63967	3.888000	0.56204	2.716000	0.92895	0.655000	0.94253	GAA	GOLGB1	-	NULL		0.363	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	C	NM_004487		121412667	-1	no_errors	ENST00000340645	ensembl	human	known	70_37	missense	SNP	1.000	G
GOLGB1	2804	genome.wustl.edu	37	3	121433719	121433719	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:121433719C>A	ENST00000340645.5	-	10	1503	c.1378G>T	c.(1378-1380)Gag>Tag	p.E460*	GOLGB1_ENST00000393667.3_Nonsense_Mutation_p.E465*	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	460					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		TGTGTGCCCTCATTATAAACA	0.368																																																	0													126.0	126.0	126.0					3																	121433719		2203	4300	6503	SO:0001587	stop_gained	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.1378G>T	3.37:g.121433719C>A	ENSP00000341848:p.Glu460*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Nonsense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.E460*	ENST00000340645.5	37	c.1378	CCDS3004.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.394566|5.394566	0.96009|0.96009	.|.	.|.	ENSG00000173230|ENSG00000173230	ENST00000340645;ENST00000393667;ENST00000494517;ENST00000426235|ENST00000489400	.|.	.|.	.|.	5.05|5.05	1.98|1.98	0.26296|0.26296	.|.	0.214234|.	0.31963|.	N|.	0.006782|.	.|T	.|0.39911	.|0.1096	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.46386	.|-0.9195	.|3	0.11182|.	T|.	0.66|.	.|.	6.2053|6.2053	0.20600|0.20600	0.0:0.5002:0.3904:0.1093|0.0:0.5002:0.3904:0.1093	.|.	.|.	.|.	.|.	X|I	460;465;424;272|330	.|.	ENSP00000341848:E460X|.	E|M	-|-	1|3	0|0	GOLGB1|GOLGB1	122916409|122916409	0.022000|0.022000	0.18835|0.18835	0.504000|0.504000	0.27639|0.27639	0.768000|0.768000	0.43524|0.43524	0.377000|0.377000	0.20552|0.20552	0.635000|0.635000	0.30488|0.30488	-0.282000|-0.282000	0.10007|0.10007	GAG|ATG	GOLGB1	-	NULL		0.368	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	C	NM_004487		121433719	-1	no_errors	ENST00000340645	ensembl	human	known	70_37	nonsense	SNP	0.284	A
GPC6	10082	genome.wustl.edu	37	13	95055328	95055328	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr13:95055328G>A	ENST00000377047.4	+	9	2140	c.1525G>A	c.(1525-1527)Gag>Aag	p.E509K		NM_005708.3	NP_005699.1	Q9Y625	GPC6_HUMAN	glypican 6	509					carbohydrate metabolic process (GO:0005975)|cell migration (GO:0016477)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|phototransduction, visible light (GO:0007603)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|lysosomal lumen (GO:0043202)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(13)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	38	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;5.48e-07)|all_epithelial(2;5.69e-08)|all_lung(2;2.19e-05)|Lung NSC(4;6.09e-05)|Breast(118;0.0395)|Renal(2;0.0568)|Hepatocellular(115;0.217)				GTGTCCCACGGAGTTTGAGTT	0.562																																																	0													159.0	165.0	163.0					13																	95055328		2203	4300	6503	SO:0001583	missense	10082			AF111178	CCDS9469.1	13q32	2008-02-05			ENSG00000183098	ENSG00000183098		"""Proteoglycans / Cell Surface : Glypicans"""	4454	protein-coding gene	gene with protein product	"""glypican proteoglycan 6"""	604404				10329016	Standard	NM_005708		Approved		uc001vlt.3	Q9Y625	OTTHUMG00000017205	ENST00000377047.4:c.1525G>A	13.37:g.95055328G>A	ENSP00000366246:p.Glu509Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K279|Q96SG5|Q96SG8|Q9H1P4	Missense_Mutation	SNP	pfam_Glypican	p.E509K	ENST00000377047.4	37	c.1525	CCDS9469.1	13	.	.	.	.	.	.	.	.	.	.	G	35	5.524305	0.96431	.	.	ENSG00000183098	ENST00000377047	T	0.52057	0.68	5.84	5.84	0.93424	.	0.164374	0.53938	D	0.000053	T	0.58538	0.2129	L	0.52905	1.665	0.47476	D	0.999431	P	0.42296	0.775	P	0.51297	0.665	T	0.45731	-0.9241	10	0.25106	T	0.35	.	20.1432	0.98067	0.0:0.0:1.0:0.0	.	509	Q9Y625	GPC6_HUMAN	K	509	ENSP00000366246:E509K	ENSP00000366246:E509K	E	+	1	0	GPC6	93853329	1.000000	0.71417	0.995000	0.50966	0.994000	0.84299	6.312000	0.72840	2.769000	0.95229	0.561000	0.74099	GAG	GPC6	-	pfam_Glypican		0.562	GPC6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPC6	HGNC	protein_coding	OTTHUMT00000045460.4	G	NM_005708		95055328	+1	no_errors	ENST00000377047	ensembl	human	known	70_37	missense	SNP	1.000	A
GRIK1	2897	genome.wustl.edu	37	21	30961186	30961186	+	Silent	SNP	G	G	A	rs2229899	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr21:30961186G>A	ENST00000399907.1	-	11	1953	c.1542C>T	c.(1540-1542)aaC>aaT	p.N514N	GRIK1_ENST00000309434.7_Silent_p.N516N|GRIK1_ENST00000399913.1_Silent_p.N514N|GRIK1_ENST00000327783.4_Silent_p.N514N|GRIK1_ENST00000535441.1_Silent_p.N516N|GRIK1_ENST00000399909.1_Silent_p.N499N|GRIK1_ENST00000399914.1_Silent_p.N499N|GRIK1_ENST00000389125.3_Silent_p.N499N|GRIK1_ENST00000389124.2_Silent_p.N514N	NM_000830.3	NP_000821.1	P39086	GRIK1_HUMAN	glutamate receptor, ionotropic, kainate 1	514					adult behavior (GO:0030534)|behavioral response to pain (GO:0048266)|central nervous system development (GO:0007417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|nervous system development (GO:0007399)|positive regulation of gamma-aminobutyric acid secretion (GO:0014054)|positive regulation of synaptic transmission, GABAergic (GO:0032230)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	cell junction (GO:0030054)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|kainate selective glutamate receptor complex (GO:0032983)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(11)|lung(18)|ovary(1)|prostate(4)|skin(1)|stomach(1)|urinary_tract(1)	45					Topiramate(DB00273)	TAACCATCCCGTTCCACTCCC	0.368													G|||	83	0.0165735	0.0015	0.0288	5008	,	,		18246	0.001		0.0547	False		,,,				2504	0.0051																0								G	,	30,4376	37.6+/-69.7	0,30,2173	160.0	153.0	156.0		1542,1497	2.3	1.0	21	dbSNP_131	156	368,8232	122.4+/-181.4	11,346,3943	no	coding-synonymous,coding-synonymous	GRIK1	NM_000830.3,NM_175611.2	,	11,376,6116	AA,AG,GG		4.2791,0.6809,3.0601	,	514/919,499/906	30961186	398,12608	2203	4300	6503	SO:0001819	synonymous_variant	2897				CCDS33530.1, CCDS42913.1	21q22	2012-08-29			ENSG00000171189	ENSG00000171189		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4579	protein-coding gene	gene with protein product		138245		GLUR5		8468067	Standard	XM_005260942		Approved	GluK1	uc002yno.1	P39086	OTTHUMG00000078879	ENST00000399907.1:c.1542C>T	21.37:g.30961186G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13001|Q86SU9	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.N516	ENST00000399907.1	37	c.1548	CCDS42913.1	21																																																																																			GRIK1	-	pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt		0.368	GRIK1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIK1	HGNC	protein_coding	OTTHUMT00000171979.1	G			30961186	-1	no_errors	ENST00000535441	ensembl	human	known	70_37	silent	SNP	1.000	A
GRM8	2918	genome.wustl.edu	37	7	126078884	126078884	+	3'UTR	DEL	T	T	-	rs34182595	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:126078884delT	ENST00000339582.2	-	0	3824				GRM8_ENST00000444921.2_3'UTR|GRM8_ENST00000358373.3_3'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8						adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)			breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				TTCAACAGCATTTTTTTTCAC	0.308										HNSCC(24;0.065)			?|TTTTTTTT|TTTTTTT|unsure	2027	0.404752	0.3646	0.4568	5008	,	,		18057	0.38		0.4235	False		,,,				2504	0.4284																0																																										SO:0001624	3_prime_UTR_variant	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.*289A>-	7.37:g.126078884delT		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	RNA	DEL	-	NULL	ENST00000339582.2	37	NULL	CCDS5794.1	7																																																																																			GRM8	-	-		0.308	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	T			126078884	-1	no_errors	ENST00000489939	ensembl	human	known	70_37	rna	DEL	0.998	-
GSTTP2	653399	genome.wustl.edu	37	22	24401740	24401740	+	RNA	SNP	C	C	T	rs575883315	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:24401740C>T	ENST00000466426.1	-	0	115									glutathione S-transferase theta pseudogene 2																		CATGCTTCTTCGAGAAGATGT	0.582													c|||	2	0.000399361	0.0008	0.0	5008	,	,		19785	0.0		0.001	False		,,,				2504	0.0																0																																												653399					22q11.23	2010-09-29			ENSG00000239334	ENSG00000276950			33606	pseudogene	pseudogene							Standard	NR_003082		Approved		uc002zzh.1		OTTHUMG00000150811		22.37:g.24401740C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000466426.1	37	NULL		22																																																																																			GSTTP2	-	-		0.582	GSTTP2-002	KNOWN	basic	processed_transcript	GSTTP2	HGNC	pseudogene	OTTHUMT00000322304.1	C			24401740	-1	no_errors	ENST00000389399	ensembl	human	known	70_37	rna	SNP	0.959	T
MTG2	26164	genome.wustl.edu	37	20	60768573	60768573	+	Missense_Mutation	SNP	C	C	T	rs41284984	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:60768573C>T	ENST00000370823.3	+	2	115	c.97C>T	c.(97-99)Cgg>Tgg	p.R33W	MTG2_ENST00000536470.1_Intron|MTG2_ENST00000436421.2_Missense_Mutation_p.R33W	NM_015666.3	NP_056481.1	Q9H4K7	MTG2_HUMAN	mitochondrial ribosome-associated GTPase 2	33	Localized in the mitochondria.|Not localized in the mitochondria.				GTP catabolic process (GO:0006184)|regulation of mitochondrial translation (GO:0070129)|regulation of respiratory system process (GO:0044065)|ribosome biogenesis (GO:0042254)	mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial ribosome (GO:0005761)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|magnesium ion binding (GO:0000287)										GAAGCCCAGCCGGCTACTGCC	0.627													C|||	66	0.0131789	0.0008	0.0231	5008	,	,		18183	0.0		0.0447	False		,,,				2504	0.0041																0								C	TRP/ARG	36,4370	40.8+/-73.8	0,36,2167	65.0	69.0	68.0		97	-5.4	0.0	20	dbSNP_127	68	369,8231	121.8+/-180.9	9,351,3940	yes	missense	GTPBP5	NM_015666.3	101	9,387,6107	TT,TC,CC		4.2907,0.8171,3.1139	benign	33/407	60768573	405,12601	2203	4300	6503	SO:0001583	missense	26164			AK001603	CCDS13492.1	20q13.33	2013-05-24	2013-05-24	2013-05-24	ENSG00000101181	ENSG00000101181			16239	protein-coding gene	gene with protein product		610919	"""GTP-binding protein 5 (putative)"", ""GTP binding protein 5 (putative)"""	GTPBP5		17054726, 23396448	Standard	NM_015666		Approved	FLJ10741, dJ1005F21.2, ObgH1		Q9H4K7	OTTHUMG00000032897	ENST00000370823.3:c.97C>T	20.37:g.60768573C>T	ENSP00000359859:p.Arg33Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDR3|B4DR85|Q96I17|Q9NVG9|Q9UFR4	Missense_Mutation	SNP	pfam_GTP1_OBG_dom,pfam_GTP_binding_domain,pfam_Fe2_transport_prot_B_N,pfam_Small_GTPase_ARF/SAR,superfamily_GTP1_OBG_dom,pirsf_GTP-bd_Obg/CgtA,prints_GTP_binding_domain,tigrfam_GTP-bd_Obg/CgtA,tigrfam_Small_GTP-bd_dom	p.R33W	ENST00000370823.3	37	c.97	CCDS13492.1	20	44	0.020146520146520148	0	0.0	11	0.03038674033149171	0	0.0	33	0.04353562005277045	C	12.21	1.869502	0.32977	0.008171	0.042907	ENSG00000101181	ENST00000436421;ENST00000370823;ENST00000448254	T;T;T	0.24350	1.86;2.68;2.18	4.17	-5.4	0.02656	.	3.317530	0.00654	N	0.000566	T	0.02380	0.0073	N	0.08118	0	0.09310	N	1	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.14337	-1.0476	10	0.36615	T	0.2	-0.151	3.8869	0.09102	0.398:0.1715:0.0:0.4305	rs41284984	33;33;33	Q5JXJ0;E7EU10;Q9H4K7	.;.;GTPB5_HUMAN	W	33	ENSP00000392267:R33W;ENSP00000359859:R33W;ENSP00000414693:R33W	ENSP00000359859:R33W	R	+	1	2	GTPBP5	60201968	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.749000	0.04813	-0.992000	0.03472	-0.203000	0.12734	CGG	GTPBP5	-	NULL		0.627	MTG2-008	KNOWN	basic|appris_principal|CCDS	protein_coding	GTPBP5	HGNC	protein_coding	OTTHUMT00000079989.1	C	NM_015666		60768573	+1	no_errors	ENST00000370823	ensembl	human	known	70_37	missense	SNP	0.000	T
LINC01219	104355220	genome.wustl.edu	37	11	2016662	2016662	+	lincRNA	SNP	T	T	C	rs2839703	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:2016662T>C	ENST00000418612.1	+	0	1444				H19_ENST00000390168.4_RNA																							ACACTCGTACTGAGACTCAAG	0.592													C|||	1347	0.26897	0.0794	0.3617	5008	,	,		12664	0.3343		0.3986	False		,,,				2504	0.2587																0								C		211,1539		17,177,681	23.0	22.0	22.0			-5.9	0.0	11	dbSNP_100	22	1558,2420		301,956,732	no	intergenic				318,1133,1413	CC,CT,TT		39.1654,12.0571,30.8834			2016662	1769,3959	875	1989	2864			283120																															11.37:g.2016662T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000418612.1	37	NULL		11																																																																																			H19	-	-		0.592	AC051649.6-001	KNOWN	basic	lincRNA	H19	HGNC	lincRNA	OTTHUMT00000034754.1	T			2016662	-1	no_errors	ENST00000411754	ensembl	human	known	70_37	rna	SNP	0.000	C
HBS1L	10767	genome.wustl.edu	37	6	135286429	135286429	+	Splice_Site	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:135286429C>T	ENST00000367837.5	-	18	2250		c.e18-1		HBS1L_ENST00000367826.2_Splice_Site|HBS1L_ENST00000367824.4_Splice_Site|HBS1L_ENST00000445176.2_Splice_Site|HBS1L_ENST00000527578.1_Splice_Site|HBS1L_ENST00000415177.2_Splice_Site	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase						signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		ATTCTTTTATCTGTTAAAACA	0.289																																																	0													60.0	62.0	61.0					6																	135286429		2200	4296	6496	SO:0001630	splice_region_variant	10767			U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.2044-1G>A	6.37:g.135286429C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Splice_Site	SNP	-	e18-1	ENST00000367837.5	37	c.2044-1	CCDS5173.1	6	.	.	.	.	.	.	.	.	.	.	C	18.84	3.708413	0.68615	.	.	ENSG00000112339	ENST00000367837;ENST00000527578;ENST00000415177;ENST00000367826;ENST00000367824;ENST00000533274;ENST00000445176	.	.	.	5.98	5.98	0.97165	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.1762	0.86842	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	HBS1L	135328122	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	4.337000	0.59310	2.838000	0.97847	0.655000	0.94253	.	HBS1L	-	-		0.289	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBS1L	HGNC	protein_coding	OTTHUMT00000042339.2	C		Intron	135286429	-1	no_errors	ENST00000367837	ensembl	human	known	70_37	splice_site	SNP	1.000	T
HBS1L	10767	genome.wustl.edu	37	6	135287550	135287550	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:135287550C>G	ENST00000367837.5	-	17	2166	c.1960G>C	c.(1960-1962)Gag>Cag	p.E654Q	HBS1L_ENST00000367826.2_Missense_Mutation_p.E612Q|HBS1L_ENST00000367824.4_Missense_Mutation_p.E490Q|HBS1L_ENST00000445176.2_Missense_Mutation_p.E378Q|HBS1L_ENST00000527578.1_Missense_Mutation_p.E490Q|HBS1L_ENST00000415177.2_Missense_Mutation_p.E589Q	NM_001145158.1|NM_006620.3	NP_001138630.1|NP_006611.1	Q9Y450	HBS1L_HUMAN	HBS1-like translational GTPase	654					signal transduction (GO:0007165)|translation (GO:0006412)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)			NS(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(7)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	20	Colorectal(23;0.221)			OV - Ovarian serous cystadenocarcinoma(155;0.0046)|GBM - Glioblastoma multiforme(68;0.00702)		TTATATAGCTCAAGAGCTATT	0.358																																																	0													144.0	136.0	139.0					6																	135287550		2203	4300	6503	SO:0001583	missense	10767			U87791	CCDS5173.1, CCDS47479.1, CCDS47480.1	6q23.3	2014-04-30	2014-04-30		ENSG00000112339	ENSG00000112339			4834	protein-coding gene	gene with protein product	"""eRF3 family member"""	612450	"""HBS1 (S. cerevisiae)-like"", ""HBS1-like (S. cerevisiae)"""			9872408, 23667253	Standard	NM_006620		Approved	ERFS, HBS1, HSPC276, KIAA1038, DKFZp434g247, EF-1a, eRF3c	uc003qez.2	Q9Y450	OTTHUMG00000015626	ENST00000367837.5:c.1960G>C	6.37:g.135287550C>G	ENSP00000356811:p.Glu654Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z365|Q4VX89|Q4VX90|Q5T7G3|Q8NDW9|Q9UPW3	Missense_Mutation	SNP	pfam_DUF1916,pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_EF_GTP-bd_dom	p.E654Q	ENST00000367837.5	37	c.1960	CCDS5173.1	6	.	.	.	.	.	.	.	.	.	.	C	33	5.219180	0.95104	.	.	ENSG00000112339	ENST00000367837;ENST00000527578;ENST00000415177;ENST00000367826;ENST00000367824;ENST00000533274;ENST00000445176	T;T;T;T;T;T;T	0.71222	-0.54;-0.46;-0.47;-0.55;-0.46;-0.51;0.59	5.96	5.96	0.96718	Translation elongation factor EF1A/initiation factor IF2gamma, C-terminal (1);Translation elongation factor EFTu/EF1A, C-terminal (1);	0.000000	0.85682	D	0.000000	D	0.86793	0.6018	M	0.90309	3.105	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.999;1.0	D	0.88036	0.2778	10	0.87932	D	0	-21.7016	20.4008	0.98991	0.0:1.0:0.0:0.0	.	612;654	Q9Y450-4;Q9Y450	.;HBS1L_HUMAN	Q	654;490;589;612;490;524;378	ENSP00000356811:E654Q;ENSP00000436256:E490Q;ENSP00000389826:E589Q;ENSP00000356800:E612Q;ENSP00000356798:E490Q;ENSP00000434533:E524Q;ENSP00000415305:E378Q	ENSP00000356798:E490Q	E	-	1	0	HBS1L	135329243	1.000000	0.71417	0.978000	0.43139	0.928000	0.56348	7.265000	0.78442	2.826000	0.97356	0.655000	0.94253	GAG	HBS1L	-	pfam_Transl_elong_EFTu/EF1A_C,superfamily_Transl_elong_EF1A/Init_IF2_C		0.358	HBS1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HBS1L	HGNC	protein_coding	OTTHUMT00000042339.2	C			135287550	-1	no_errors	ENST00000367837	ensembl	human	known	70_37	missense	SNP	1.000	G
HCAR3	8843	genome.wustl.edu	37	12	123200354	123200354	+	Missense_Mutation	SNP	G	G	A	rs200905183	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:123200354G>A	ENST00000528880.2	-	1	1085	c.931C>T	c.(931-933)Cgc>Tgc	p.R311C	HCAR1_ENST00000356987.2_Intron|RP11-324E6.6_ENST00000543611.1_lincRNA	NM_006018.2	NP_006009.2	P49019	HCAR3_HUMAN	hydroxycarboxylic acid receptor 3	311					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	9					Niacin(DB00627)	TGGAGGCAGCGGTTGATCAAA	0.542																																																	0								G	CYS/ARG	141,4177		11,119,2029	38.0	52.0	47.0		931	2.0	0.9	12	dbSNP_134	47	1417,7167		82,1253,2957	no	missense	HCAR3	NM_006018.2	180	93,1372,4986	AA,AG,GG		16.5075,3.2654,12.0756	benign	311/388	123200354	1558,11344	2159	4292	6451	SO:0001583	missense	8843			D10923	CCDS53842.1	12q24.31	2012-08-08	2011-05-30	2011-05-30		ENSG00000255398		"""GPCR / Class A : Hydroxy-carboxylic acid receptors"""	16824	protein-coding gene	gene with protein product		606039	"""G protein-coupled receptor 109B"""	GPR109B		7505609, 9205127, 18983141, 21454438	Standard	NM_006018		Approved	HCA3, HM74	uc001ucy.4	P49019		ENST00000528880.2:c.931C>T	12.37:g.123200354G>A	ENSP00000436714:p.Arg311Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4G5|B2R830|E9PI97|Q8NGE4	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_P2_purnocptor	p.R311C	ENST00000528880.2	37	c.931	CCDS53842.1	12	.	.	.	.	.	.	.	.	.	.	g	5.415	0.261672	0.10239	0.032654	0.165075	ENSG00000255398	ENST00000528880	T	0.35048	1.33	3.26	1.96	0.26148	.	.	.	.	.	T	0.00073	0.0002	N	0.25332	0.735	0.09310	N	1	B	0.23377	0.084	B	0.16722	0.016	T	0.16394	-1.0404	9	0.28530	T	0.3	.	3.6353	0.08146	0.4011:0.0:0.5989:0.0	.	311	E9PI97	.	C	311	ENSP00000436714:R311C	ENSP00000436714:R311C	R	-	1	0	HCAR3	121766307	0.352000	0.24895	0.927000	0.36925	0.456000	0.32438	1.250000	0.32850	1.514000	0.48869	0.184000	0.17185	CGC	HCAR3	-	NULL		0.542	HCAR3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCAR3	HGNC	protein_coding	OTTHUMT00000387549.2	G	NM_006018		123200354	-1	no_errors	ENST00000528880	ensembl	human	known	70_37	missense	SNP	0.015	A
HCFC1	3054	genome.wustl.edu	37	X	153224134	153224134	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:153224134C>T	ENST00000310441.7	-	10	2655	c.1689G>A	c.(1687-1689)tcG>tcA	p.S563S	HCFC1_ENST00000461098.1_5'Flank|HCFC1_ENST00000354233.3_Silent_p.S494S|HCFC1_ENST00000369984.4_Silent_p.S563S	NM_005334.2	NP_005325.2	P51610	HCFC1_HUMAN	host cell factor C1	563					cell cycle (GO:0007049)|chromatin organization (GO:0006325)|histone H4-K16 acetylation (GO:0043984)|histone H4-K5 acetylation (GO:0043981)|histone H4-K8 acetylation (GO:0043982)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle (GO:0045787)|positive regulation of gene expression (GO:0010628)|protein stabilization (GO:0050821)|regulation of protein complex assembly (GO:0043254)|regulation of transcription, DNA-templated (GO:0006355)|release from viral latency (GO:0019046)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|membrane (GO:0016020)|mitochondrion (GO:0005739)|MLL1 complex (GO:0071339)|MLL5-L complex (GO:0070688)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	chromatin binding (GO:0003682)|identical protein binding (GO:0042802)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(12)|kidney(3)|large_intestine(3)|lung(18)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	47	all_cancers(53;6.23e-16)|all_epithelial(53;5.61e-10)|all_lung(58;3.99e-07)|Lung NSC(58;5.02e-07)|all_hematologic(71;4.25e-06)|Acute lymphoblastic leukemia(192;6.56e-05)					CCGTGGGTGCCGAGGAAGGGG	0.657																																																	0													41.0	47.0	45.0					X																	153224134		2049	4159	6208	SO:0001819	synonymous_variant	3054				CCDS44020.1	Xq28	2014-06-12	2014-06-09		ENSG00000172534	ENSG00000172534			4839	protein-coding gene	gene with protein product	"""VP16-accessory protein"", ""protein phosphatase 1, regulatory subunit 89"""	300019	"""mental retardation, X-linked 3"", ""host cell factor C1 (VP16-accessory protein)"""	HFC1, MRX3		8392914, 23000143	Standard	XM_005274664		Approved	HCF-1, HCF1, CFF, VCAF, MGC70925, PPP1R89	uc004fjp.3	P51610	OTTHUMG00000024222	ENST00000310441.7:c.1689G>A	X.37:g.153224134C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P4G5	Silent	SNP	pfam_Kelch_2,pfam_Kelch_1,superfamily_Fibronectin_type3,smart_Fibronectin_type3	p.S563	ENST00000310441.7	37	c.1689	CCDS44020.1	X																																																																																			HCFC1	-	NULL		0.657	HCFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCFC1	HGNC	protein_coding	OTTHUMT00000061099.4	C	NM_005334		153224134	-1	no_errors	ENST00000310441	ensembl	human	known	70_37	silent	SNP	0.933	T
HCN3	57657	genome.wustl.edu	37	1	155258445	155258445	+	3'UTR	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:155258445A>G	ENST00000368358.3	+	0	2524				HCN3_ENST00000496230.1_3'UTR	NM_020897.2	NP_065948.1	Q9P1Z3	HCN3_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 3						potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	27	all_lung(78;2.32e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		Epithelial(20;3.72e-10)|all cancers(21;1.19e-09)|BRCA - Breast invasive adenocarcinoma(34;0.000752)|LUSC - Lung squamous cell carcinoma(543;0.193)			AGCTTGTCCCATCATAATCCa	0.493																																																	0																																										SO:0001624	3_prime_UTR_variant	57657			AB040968	CCDS1108.1	1q21.2	2011-07-05			ENSG00000143630	ENSG00000143630		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	19183	protein-coding gene	gene with protein product		609973				16382102	Standard	NM_020897		Approved	KIAA1535	uc001fjz.2	Q9P1Z3	OTTHUMG00000035872	ENST00000368358.3:c.*191A>G	1.37:g.155258445A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DV90|Q4VX12|Q8N6W6|Q9BWQ2	RNA	SNP	-	NULL	ENST00000368358.3	37	NULL	CCDS1108.1	1																																																																																			HCN3	-	-		0.493	HCN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN3	HGNC	protein_coding	OTTHUMT00000087388.1	A	NM_020897		155258445	+1	no_errors	ENST00000492035	ensembl	human	known	70_37	rna	SNP	0.009	G
HELQ	113510	genome.wustl.edu	37	4	84337943	84337943	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:84337943C>T	ENST00000295488.3	-	17	3301	c.3139G>A	c.(3139-3141)Gta>Ata	p.V1047I	HELQ_ENST00000510985.1_Missense_Mutation_p.V980I	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	1047					double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)			breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						ATTGTCCTTACGAGCACTTCA	0.363								Other identified genes with known or suspected DNA repair function																																									0													194.0	184.0	188.0					4																	84337943		2203	4300	6503	SO:0001583	missense	113510			AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.3139G>A	4.37:g.84337943C>T	ENSP00000295488:p.Val1047Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.V1047I	ENST00000295488.3	37	c.3139	CCDS3603.1	4	.	.	.	.	.	.	.	.	.	.	C	2.266	-0.368070	0.05069	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.66099	0.16;-0.19	5.75	0.772	0.18510	.	0.426015	0.25795	N	0.028251	T	0.46328	0.1387	L	0.38838	1.175	0.41031	D	0.985153	B;B	0.13594	0.007;0.008	B;B	0.08055	0.003;0.003	T	0.24657	-1.0154	10	0.33141	T	0.24	-6.6562	8.7867	0.34825	0.0:0.5687:0.0:0.4313	.	980;1047	E3W980;Q8TDG4	.;HELQ_HUMAN	I	1047;980	ENSP00000295488:V1047I;ENSP00000424539:V980I	ENSP00000295488:V1047I	V	-	1	0	HELQ	84556967	0.343000	0.24818	0.042000	0.18584	0.153000	0.21895	0.954000	0.29175	0.138000	0.18790	-1.076000	0.02234	GTA	HELQ	-	superfamily_DNA_repair_Rad51/TF_NusA_a-hlx		0.363	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELQ	HGNC	protein_coding	OTTHUMT00000252810.1	C	NM_133636		84337943	-1	no_errors	ENST00000295488	ensembl	human	known	70_37	missense	SNP	0.824	T
HILPDA	29923	genome.wustl.edu	37	7	128098199	128098199	+	3'UTR	DEL	T	T	-	rs79181290	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:128098199delT	ENST00000257696.4	+	0	1078				RP11-212P7.3_ENST00000462662.1_RNA|RP11-155G14.6_ENST00000493710.1_RNA|HILPDA_ENST00000481454.1_3'UTR	NM_001098786.1|NM_013332.3	NP_001092256.1|NP_037464.1	Q9Y5L2	HLPDA_HUMAN	hypoxia inducible lipid droplet-associated						autocrine signaling (GO:0035425)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytokine production (GO:0001819)|positive regulation of lipid storage (GO:0010884)|response to stress (GO:0006950)	cell surface (GO:0009986)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|lipid particle (GO:0005811)|secretory granule (GO:0030141)	receptor binding (GO:0005102)										GAATGTCTTATGCTCAATTAT	0.453													T|T|-|deletion	629	0.125599	0.0492	0.1052	5008	,	,		18928	0.0992		0.1799	False		,,,				2504	0.2147																0																																										SO:0001624	3_prime_UTR_variant	29923			AF144755	CCDS5802.1	7q32.1	2011-11-02	2011-11-02	2011-11-02	ENSG00000135245	ENSG00000135245			28859	protein-coding gene	gene with protein product	"""hypoxia inducible gene 2"""		"""chromosome 7 open reading frame 68"""	C7orf68		10690527, 15930302	Standard	NM_001098786		Approved	FLJ21076, HIG-2, HIG2	uc010lli.3	Q9Y5L2	OTTHUMG00000157712	ENST00000257696.4:c.*685T>-	7.37:g.128098199delT		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0Z5|Q52LY5|Q53HJ7	RNA	DEL	-	NULL	ENST00000257696.4	37	NULL	CCDS5802.1	7																																																																																			HILPDA	-	-		0.453	HILPDA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HILPDA	HGNC	protein_coding	OTTHUMT00000349450.1	T	NM_013332		128098199	+1	no_errors	ENST00000466473	ensembl	human	known	70_37	rna	DEL	0.000	-
HIST1H2BC	8347	genome.wustl.edu	37	6	26123911	26123911	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:26123911G>C	ENST00000314332.5	-	1	227	c.222C>G	c.(220-222)atC>atG	p.I74M	HIST1H2BC_ENST00000396984.1_Missense_Mutation_p.I74M|HIST1H2AC_ENST00000602637.1_5'Flank|HIST1H2AC_ENST00000377791.2_5'Flank			P62807	H2B1C_HUMAN	histone cluster 1, H2bc	74					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)	p.I74I(1)		NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(1)|lung(9)|ovary(1)	16						CCTCGCCCGCGATGCGCTCAA	0.582																																																	1	Substitution - coding silent(1)	lung(1)											120.0	118.0	119.0					6																	26123911		2203	4300	6503	SO:0001583	missense	8347			Z80783	CCDS4584.1	6p22.1	2011-01-27	2006-10-11	2003-02-14	ENSG00000180596	ENSG00000180596		"""Histones / Replication-dependent"""	4757	protein-coding gene	gene with protein product		602847	"""H2B histone family, member L"", ""histone 1, H2bc"""	H2BFL		9119399, 12408966	Standard	NM_003526		Approved	H2B/l, H2B.1	uc003ngl.3	P62807	OTTHUMG00000014425	ENST00000314332.5:c.222C>G	6.37:g.26123911G>C	ENSP00000321744:p.Ile74Met	Somatic		WXS	Illumina HiSeq	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.I74M	ENST00000314332.5	37	c.222	CCDS4584.1	6	.	.	.	.	.	.	.	.	.	.	.	15.98	2.992662	0.54041	.	.	ENSG00000180596	ENST00000314332;ENST00000396984	T;T	0.46063	0.88;0.88	5.61	1.76	0.24704	Histone-fold (2);Histone core (1);	.	.	.	.	T	0.43277	0.1240	.	.	.	0.28905	N	0.893058	D	0.58970	0.984	D	0.69824	0.966	T	0.25710	-1.0124	8	0.87932	D	0	.	6.3306	0.21269	0.2142:0.0:0.6573:0.1285	.	74	P62807	H2B1C_HUMAN	M	74	ENSP00000321744:I74M;ENSP00000380180:I74M	ENSP00000321744:I74M	I	-	3	3	HIST1H2BC	26231890	1.000000	0.71417	0.999000	0.59377	0.321000	0.28281	1.790000	0.38734	0.099000	0.17552	-0.911000	0.02809	ATC	HIST1H2BC	-	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B		0.582	HIST1H2BC-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BC	HGNC	protein_coding	OTTHUMT00000468022.1	G	NM_003526		26123911	-1	no_errors	ENST00000314332	ensembl	human	known	70_37	missense	SNP	1.000	C
HLA-DQB1	3119	genome.wustl.edu	37	6	32629764	32629764	+	Missense_Mutation	SNP	C	C	T	rs1130398	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32629764C>T	ENST00000399082.3	-	2	415	c.371G>A	c.(370-372)aGc>aAc	p.S124N	HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.S214N|HLA-DQB1-AS1_ENST00000419852.1_RNA|HLA-DQB1_ENST00000399084.1_Missense_Mutation_p.S214N|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.S214N|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.S214N|HLA-DQB1_ENST00000460185.1_5'Flank			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	214	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	GGTGATGGGGCTCTGGAGGCT	0.537									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				.|||	1981	0.395567	0.3154	0.5476	5008	,	,		17107	0.4782		0.3946	False		,,,				2504	0.3119				Esophageal Squamous(151;720 1825 15000 40336 43415)												0								T	ASN/SER	1305,3089		211,883,1103	54.0	59.0	57.0		641	1.6	0.9	6	dbSNP_86	57	3090,5502		594,1902,1800	yes	missense	HLA-DQB1	NM_002123.4	46	805,2785,2903	TT,TC,CC		35.9637,29.6996,33.8441	benign	214/262	32629764	4395,8591	2197	4296	6493	SO:0001583	missense	3119	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.371G>A	6.37:g.32629764C>T	ENSP00000382032:p.Ser124Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.S214N	ENST00000399082.3	37	c.641		6	930	0.4258241758241758	152	0.3089430894308943	190	0.5248618784530387	283	0.49475524475524474	305	0.4023746701846966	.	5.911	0.352128	0.11182	0.296996	0.359637	ENSG00000179344	ENST00000399082;ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084	T;T;T;T;T	0.02974	4.09;4.09;4.09;4.09;4.09	4.52	1.62	0.23740	.	0.726356	0.13327	N	0.396223	T	0.00784	0.0026	.	.	.	0.52099	P	5.999999999994898E-5	B;B;B;B	0.02656	0.0;0.0;0.0;0.0	B;B;B;B	0.04013	0.001;0.001;0.001;0.001	T	0.45977	-0.9224	8	0.59425	D	0.04	.	3.5408	0.07811	0.0:0.4996:0.1955:0.3049	rs1130398;rs3189185;rs9273924;rs12722372;rs17412846;rs28724254;rs34909169	214;179;214;214	A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.	N	124;214;214;214;214	ENSP00000382032:S124N;ENSP00000382029:S214N;ENSP00000364080:S214N;ENSP00000407332:S214N;ENSP00000382034:S214N	ENSP00000364080:S214N	S	-	2	0	HLA-DQB1	32737742	0.000000	0.05858	0.933000	0.37362	0.413000	0.31143	-0.126000	0.10563	0.319000	0.23209	-0.642000	0.03964	AGC	HLA-DQB1	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like		0.537	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	HLA-DQB1	HGNC	protein_coding	OTTHUMT00000276131.1	C	NM_002123		32629764	-1	no_errors	ENST00000374943	ensembl	human	known	70_37	missense	SNP	0.989	T
HLA-V	352962	genome.wustl.edu	37	6	29761280	29761280	+	RNA	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:29761280G>T	ENST00000457107.1	+	0	506									major histocompatibility complex, class I, V (pseudogene)																		tttacagaaggaagaatacgt	0.443																																																	0																																												352962			M96332		6p21.3	2012-10-05	2007-12-12	2007-12-12	ENSG00000181126	ENSG00000181126		"""Histocompatibility complex"""	23482	pseudogene	pseudogene			"""HLA-75 pseudogene"""	HLA-75			Standard	NG_002729		Approved	dJ377H14.4			OTTHUMG00000031277		6.37:g.29761280G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000457107.1	37	NULL		6																																																																																			HLA-V	-	-		0.443	HLA-V-003	KNOWN	basic	processed_transcript	HLA-V	HGNC	pseudogene	OTTHUMT00000105231.1	G	NG_002729		29761280	+1	no_errors	ENST00000457107	ensembl	human	known	70_37	rna	SNP	0.016	T
HLA-DQB1	3119	genome.wustl.edu	37	6	32629891	32629891	+	Missense_Mutation	SNP	C	C	T	rs386699585|rs1063323	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32629891C>T	ENST00000399082.3	-	2	288	c.244G>A	c.(244-246)Gcc>Acc	p.A82T	HLA-DQB1_ENST00000434651.2_Missense_Mutation_p.A172T|HLA-DQB1-AS1_ENST00000419852.1_RNA|HLA-DQB1_ENST00000399084.1_Missense_Mutation_p.A172T|XXbac-BPG254F23.6_ENST00000443574.1_RNA|HLA-DQB1_ENST00000374943.4_Missense_Mutation_p.A172T|HLA-DQB1_ENST00000399079.3_Missense_Mutation_p.A172T|HLA-DQB1_ENST00000460185.1_5'Flank			P01920	DQB1_HUMAN	major histocompatibility complex, class II, DQ beta 1	172	Beta-1.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cytokine-mediated signaling pathway (GO:0019221)|humoral immune response mediated by circulating immunoglobulin (GO:0002455)|immune response (GO:0006955)|immunoglobulin production involved in immunoglobulin mediated immune response (GO:0002381)|interferon-gamma-mediated signaling pathway (GO:0060333)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|MHC class II protein complex (GO:0042613)|plasma membrane (GO:0005886)|trans-Golgi network membrane (GO:0032588)|transport vesicle membrane (GO:0030658)	MHC class II receptor activity (GO:0032395)|peptide antigen binding (GO:0042605)			breast(1)|large_intestine(1)|lung(1)|pancreas(1)	4					"""""""Insulin(DB00071)"""	ACAACGCCGGCTGTCTCCTCC	0.547									T-cell Lymphoma, (Cutaneous) , Familial Clustering of;Sjgren syndrome;Melanoma, Familial Clustering of;ACTH-independent macronodular adrenal hyperplasia				.|||	1979	0.395168	0.3154	0.5447	5008	,	,		15401	0.4782		0.3946	False		,,,				2504	0.3119				Esophageal Squamous(151;720 1825 15000 40336 43415)												0								T	THR/ALA	1264,3120		198,868,1126	45.0	47.0	47.0		514	1.8	0.0	6	dbSNP_86	47	3012,5578		578,1856,1861	no	missense	HLA-DQB1	NM_002123.4	58	776,2724,2987	TT,TC,CC		35.064,28.8321,32.9582	benign	172/262	32629891	4276,8698	2192	4295	6487	SO:0001583	missense	3119	Familial Cancer Database	incl.: Mycosis Fungoides, Sezary syndrome, Adult T-cell Lymphoma;Sjogren syndrome; ;AIMAH, Cushing disease, Adrenal, Familial		CCDS43451.1, CCDS59006.1	6p21.3	2013-01-11			ENSG00000179344	ENSG00000179344		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4944	protein-coding gene	gene with protein product		604305		HLA-DQB			Standard	NM_001243962		Approved	IDDM1, CELIAC1	uc031snw.1	P01920	OTTHUMG00000031124	ENST00000399082.3:c.244G>A	6.37:g.32629891C>T	ENSP00000382032:p.Ala82Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A1KR27|A2RPH3|A4Q9R4|A4USG2|A4USG5|A6N8I7|A9YQA0|B0S7Y7|B1A0K6|B1GXI3|B3VLT3|B5BLN7|B7VU69|C0MQ34|C0MQ35|C8ZL52|C8ZLJ8|C8ZLJ9|C9DRQ3|O19708|O19713|O19724|O62861|O78046|O78221|O78223|O98034|O98201|P01917|P01918|P01919|P03992|P05537|P79482|P79526|P79544|P79551|Q08GC8|Q09035|Q0E4V9|Q1M312|Q29731|Q29877|Q29884|Q29915|Q29966|Q2P9N3|Q2QK85|Q30061|Q30075|Q30076|Q30080|Q30081|Q30082|Q30083|Q30084|Q30089|Q30095|Q31633|Q38I47|Q45UE3|Q4QZB5|Q53I44|Q564J6|Q5G841|Q5ISH1|Q5ISH3|Q5W1E1|Q5Y7G8|Q643R4|Q6B9X1|Q70VH8|Q7YP69|Q8HWH0|Q8MH58|Q8SNB4|Q8SND1|Q8SP70|Q8WMA3|Q9BD17|Q9MYH2|Q9TPA9|Q9XRY6|Q9XRY7|Q9XRZ2	Missense_Mutation	SNP	pfam_MHC_II_b_N,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_MHC_II_b_N,smart_Ig_C1-set,pfscan_Ig-like	p.A172T	ENST00000399082.3	37	c.514		6	927	0.42445054945054944	152	0.3089430894308943	189	0.5220994475138122	281	0.49125874125874125	305	0.4023746701846966	.	0.892	-0.725235	0.03158	0.288321	0.35064	ENSG00000179344	ENST00000399082;ENST00000399079;ENST00000374943;ENST00000434651;ENST00000399084;ENST00000447884	T;T;T;T;T	0.02812	4.15;4.15;4.15;4.15;4.15	4.52	1.78	0.24846	.	0.459394	0.20863	N	0.084310	T	0.00815	0.0027	.	.	.	0.80722	P	0.0	B;B;B;B	0.13594	0.002;0.001;0.008;0.0	B;B;B;B	0.12837	0.003;0.003;0.008;0.003	T	0.48969	-0.8987	8	0.31617	T	0.26	.	8.6058	0.33773	0.0:0.7426:0.0:0.2574	rs1063323;rs3204390;rs9280014;rs17840143;rs28724256;rs34109183	172;137;172;172	A2AAZ0;A2VCT9;Q5Y7D6;Q5Y7A9	.;.;.;.	T	82;172;172;172;172;108	ENSP00000382032:A82T;ENSP00000382029:A172T;ENSP00000364080:A172T;ENSP00000407332:A172T;ENSP00000382034:A172T	ENSP00000364080:A172T	A	-	1	0	HLA-DQB1	32737869	0.000000	0.05858	0.034000	0.17996	0.001000	0.01503	0.431000	0.21444	0.057000	0.16193	-1.922000	0.00515	GCC	HLA-DQB1	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like		0.547	HLA-DQB1-007	NOVEL	basic|exp_conf	protein_coding	HLA-DQB1	HGNC	protein_coding	OTTHUMT00000276131.1	C	NM_002123		32629891	-1	no_errors	ENST00000374943	ensembl	human	known	70_37	missense	SNP	0.053	T
HOXC13	3229	genome.wustl.edu	37	12	54333242	54333242	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:54333242G>A	ENST00000243056.3	+	1	708	c.552G>A	c.(550-552)gcG>gcA	p.A184A	HOXC-AS5_ENST00000512916.2_RNA	NM_017410.2	NP_059106.2	P31276	HXC13_HUMAN	homeobox C13	184					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|hair follicle development (GO:0001942)|nail development (GO:0035878)|tongue morphogenesis (GO:0043587)	nucleus (GO:0005634)	chromatin binding (GO:0003682)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)			breast(1)|large_intestine(1)|skin(1)	3						CCTACCAGGCGATGCCCGGCT	0.682			T	NUP98	AML																																			Dom	yes		12	12q13.3	3229	homeo box C13		L	0													20.0	21.0	21.0					12																	54333242		2197	4293	6490	SO:0001819	synonymous_variant	3229				CCDS8865.1	12q13.13	2011-06-20	2005-12-22		ENSG00000123364	ENSG00000123364		"""Homeoboxes / ANTP class : HOXL subclass"""	5125	protein-coding gene	gene with protein product		142976	"""homeo box C13"""	HOX3, HOX3G		1973146, 1358459	Standard	NM_017410		Approved		uc001sei.3	P31276	OTTHUMG00000160008	ENST00000243056.3:c.552G>A	12.37:g.54333242G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BL02|Q96J32|Q9NR24|Q9NYD5	Silent	SNP	pfam_Homeodomain,pfam_HoxA13_N,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.A184	ENST00000243056.3	37	c.552	CCDS8865.1	12																																																																																			HOXC13	-	NULL		0.682	HOXC13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXC13	HGNC	protein_coding	OTTHUMT00000358865.2	G			54333242	+1	no_errors	ENST00000243056	ensembl	human	known	70_37	silent	SNP	0.995	A
IL12A	3592	genome.wustl.edu	37	3	159707994	159707994	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:159707994C>T	ENST00000305579.2	+	2	466	c.159C>T	c.(157-159)ctC>ctT	p.L53L	IL12A_ENST00000480787.1_Silent_p.L53L|IL12A-AS1_ENST00000497452.1_RNA|IL12A_ENST00000466512.1_Silent_p.L53L	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	19					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			TGGACCACCTCAGTTTGGCCA	0.612																																																	0													81.0	74.0	76.0					3																	159707994		2203	4300	6503	SO:0001819	synonymous_variant	3592			M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.159C>T	3.37:g.159707994C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96QZ1	Silent	SNP	pfam_IL12,superfamily_4_helix_cytokine-like_core	p.L53	ENST00000305579.2	37	c.159	CCDS3187.1	3																																																																																			IL12A	-	pfam_IL12		0.612	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12A	HGNC	protein_coding	OTTHUMT00000352602.2	C	NM_000882		159707994	+1	no_errors	ENST00000305579	ensembl	human	known	70_37	silent	SNP	0.000	T
IL12RB1	3594	genome.wustl.edu	37	19	18179257	18179257	+	Silent	SNP	G	G	A	rs367647802		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:18179257G>A	ENST00000600835.2	-	12	1567	c.1269C>T	c.(1267-1269)caC>caT	p.H423H	IL12RB1_ENST00000593993.2_Silent_p.H423H			P42701	I12R1_HUMAN	interleukin 12 receptor, beta 1	423	Fibronectin type-III 4. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cellular response to interferon-gamma (GO:0071346)|cytokine-mediated signaling pathway (GO:0019221)|interleukin-12-mediated signaling pathway (GO:0035722)|interleukin-23-mediated signaling pathway (GO:0038155)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of activated T cell proliferation (GO:0042104)|positive regulation of defense response to virus by host (GO:0002230)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of memory T cell differentiation (GO:0043382)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T-helper 1 type immune response (GO:0002827)|positive regulation of T-helper 17 cell lineage commitment (GO:2000330)|positive regulation of T-helper 17 type immune response (GO:2000318)|signal transduction (GO:0007165)	external side of plasma membrane (GO:0009897)|interleukin-12 receptor complex (GO:0042022)|interleukin-23 receptor complex (GO:0072536)	cytokine receptor activity (GO:0004896)			endometrium(1)|kidney(1)|lung(3)|pancreas(1)|skin(2)	8						GCTTCTCGGGGTGCGCAGAGG	0.502																																																	0								G		0,4046		0,0,2023	116.0	117.0	117.0		1269	2.0	0.2	19		117	1,8347		0,1,4173	no	coding-synonymous	IL12RB1	NM_005535.1		0,1,6196	AA,AG,GG		0.012,0.0,0.0081		423/663	18179257	1,12393	2023	4174	6197	SO:0001819	synonymous_variant	3594			U03187	CCDS32957.1, CCDS54232.1	19p13.1	2014-09-17						"""Interleukins and interleukin receptors"", ""CD molecules"", ""Fibronectin type III domain containing"""	5971	protein-coding gene	gene with protein product		601604		IL12RB		9284929	Standard	XM_005259893		Approved	CD212	uc002nhw.1	P42701		ENST00000600835.2:c.1269C>T	19.37:g.18179257G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K308|B2RPF1|B7ZKK3|Q8N6Q7	Silent	SNP	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.H423	ENST00000600835.2	37	c.1269	CCDS54232.1	19																																																																																			IL12RB1	-	NULL		0.502	IL12RB1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12RB1	HGNC	protein_coding	OTTHUMT00000466525.3	G			18179257	-1	no_errors	ENST00000430026	ensembl	human	known	70_37	silent	SNP	0.260	A
INHBC	3626	genome.wustl.edu	37	12	57843668	57843668	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:57843668G>T	ENST00000309668.2	+	2	1049	c.922G>T	c.(922-924)Gca>Tca	p.A308S		NM_005538.2	NP_005529.1	P55103	INHBC_HUMAN	inhibin, beta C	308					growth (GO:0040007)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	transforming growth factor beta receptor binding (GO:0005160)			breast(2)|endometrium(1)|large_intestine(6)|liver(2)|lung(4)|prostate(1)	16						CAACACAGCTGCAGGCACCAC	0.562																																																	0													69.0	63.0	65.0					12																	57843668		2203	4300	6503	SO:0001583	missense	3626				CCDS8938.1	12q13	2008-02-05				ENSG00000175189			6068	protein-coding gene	gene with protein product		601233				7826378	Standard	NM_005538		Approved		uc001snv.1	P55103	OTTHUMG00000169994	ENST00000309668.2:c.922G>T	12.37:g.57843668G>T	ENSP00000308716:p.Ala308Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3Y2	Missense_Mutation	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaC	p.A308S	ENST00000309668.2	37	c.922	CCDS8938.1	12	.	.	.	.	.	.	.	.	.	.	G	4.966	0.179422	0.09443	.	.	ENSG00000175189	ENST00000309668	D	0.83506	-1.73	4.1	-0.276	0.12902	Transforming growth factor-beta, C-terminal (3);	0.986824	0.08286	N	0.969209	T	0.63570	0.2522	N	0.11756	0.17	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.45833	-0.9234	9	.	.	.	0.6254	3.914	0.09214	0.2809:0.0:0.4453:0.2738	.	308	P55103	INHBC_HUMAN	S	308	ENSP00000308716:A308S	.	A	+	1	0	INHBC	56129935	0.000000	0.05858	0.002000	0.10522	0.988000	0.76386	-0.079000	0.11357	-0.043000	0.13513	0.655000	0.94253	GCA	INHBC	-	pfam_TGF-b_C,smart_TGF-b_C		0.562	INHBC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBC	HGNC	protein_coding	OTTHUMT00000406770.1	G	NM_005538		57843668	+1	no_errors	ENST00000309668	ensembl	human	known	70_37	missense	SNP	0.003	T
INO80	54617	genome.wustl.edu	37	15	41364136	41364136	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:41364136C>G	ENST00000361937.3	-	12	1940	c.1516G>C	c.(1516-1518)Gag>Cag	p.E506Q	INO80_ENST00000401393.3_Missense_Mutation_p.E506Q			Q9ULG1	INO80_HUMAN	INO80 complex subunit	506	Assembles INO80 complex module consisting of conserved components ACTR8, ACTL6A and YY1.				ATP catabolic process (GO:0006200)|cellular response to ionizing radiation (GO:0071479)|cellular response to UV (GO:0034644)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|mitotic sister chromatid segregation (GO:0000070)|positive regulation of cell growth (GO:0030307)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of G1/S transition of mitotic cell cycle (GO:2000045)|spindle assembly (GO:0051225)|UV-damage excision repair (GO:0070914)	Ino80 complex (GO:0031011)|microtubule (GO:0005874)|nucleus (GO:0005634)	alpha-tubulin binding (GO:0043014)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)			NS(1)|breast(4)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						GGAATATCCTCACCAGCCCGG	0.458																																																	0													102.0	108.0	106.0					15																	41364136		2203	4300	6503	SO:0001583	missense	54617			AB033085	CCDS10071.1	15q15.1	2013-08-21	2013-08-21	2008-08-07	ENSG00000128908	ENSG00000128908	3.6.1.3	"""INO80 complex subunits"""	26956	protein-coding gene	gene with protein product	"""INO80 complex subunit A"""	610169	"""INO80 complex homolog 1 (S. cerevisiae)"", ""INO80 homolog (S. cerevisiae)"""	INOC1		16298340, 16230350, 20237820	Standard	NM_017553		Approved	KIAA1259, Ino80, hINO80, INO80A	uc001zni.3	Q9ULG1	OTTHUMG00000130209	ENST00000361937.3:c.1516G>C	15.37:g.41364136C>G	ENSP00000355205:p.Glu506Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8X4|Q9NTG6	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E506Q	ENST00000361937.3	37	c.1516	CCDS10071.1	15	.	.	.	.	.	.	.	.	.	.	C	21.5	4.153364	0.78114	.	.	ENSG00000128908	ENST00000361937;ENST00000401393	D;D	0.93604	-3.25;-3.25	4.94	4.94	0.65067	.	0.055428	0.64402	D	0.000001	D	0.90532	0.7033	L	0.47716	1.5	0.80722	D	1	P	0.51057	0.941	B	0.42163	0.378	D	0.88618	0.3161	10	0.15499	T	0.54	.	18.4288	0.90618	0.0:1.0:0.0:0.0	.	506	Q9ULG1	INO80_HUMAN	Q	506	ENSP00000355205:E506Q;ENSP00000384686:E506Q	ENSP00000355205:E506Q	E	-	1	0	INO80	39151428	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.651000	0.83577	2.593000	0.87608	0.650000	0.86243	GAG	INO80	-	NULL		0.458	INO80-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80	HGNC	protein_coding	OTTHUMT00000252527.2	C	NM_017553		41364136	-1	no_errors	ENST00000361937	ensembl	human	known	70_37	missense	SNP	1.000	G
INPP4A	3631	genome.wustl.edu	37	2	99198162	99198162	+	Intron	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:99198162G>T	ENST00000523221.1	+	23	2801				INPP4A_ENST00000409016.4_Intron|INPP4A_ENST00000409463.1_Intron|INPP4A_ENST00000409540.3_Silent_p.L936L|INPP4A_ENST00000409851.3_Intron|INPP4A_ENST00000074304.5_Intron|INPP4A_ENST00000545415.1_Intron			Q96PE3	INP4A_HUMAN	inositol polyphosphate-4-phosphatase, type I, 107kDa						inositol phosphate metabolic process (GO:0043647)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	phosphatidylinositol-3,4-bisphosphate 4-phosphatase activity (GO:0016316)|phosphatidylinositol-4,5-bisphosphate 4-phosphatase activity (GO:0034597)			breast(1)|endometrium(9)|kidney(2)|large_intestine(5)|lung(16)|ovary(2)|prostate(4)|upper_aerodigestive_tract(4)	43						CCAATTTACTGATTGTGTGGC	0.438																																																	0													79.0	77.0	77.0					2																	99198162		1881	4111	5992	SO:0001627	intron_variant	3631			U26398	CCDS46369.1, CCDS46370.1, CCDS46371.1, CCDS46372.1	2q11.2	2008-05-27	2002-08-29		ENSG00000040933	ENSG00000040933			6074	protein-coding gene	gene with protein product		600916	"""inositol polyphosphate-4-phosphatase, type I, 107kD"""	INPP4		7608176, 9295334	Standard	NM_004027		Approved		uc002syy.3	Q96PE3	OTTHUMG00000153106	ENST00000523221.1:c.2801+4556G>T	2.37:g.99198162G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O15326|Q13187|Q53TD8|Q8TC02	Silent	SNP	superfamily_C2_Ca/lipid-bd_dom_CaLB	p.L936	ENST00000523221.1	37	c.2808	CCDS46369.1	2																																																																																			INPP4A	-	NULL		0.438	INPP4A-009	KNOWN	basic|CCDS	protein_coding	INPP4A	HGNC	protein_coding	OTTHUMT00000376095.1	G	NM_001566		99198162	+1	no_errors	ENST00000409540	ensembl	human	known	70_37	silent	SNP	1.000	T
INTS4	92105	genome.wustl.edu	37	11	77629950	77629950	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:77629950G>A	ENST00000534064.1	-	15	1873	c.1839C>T	c.(1837-1839)ttC>ttT	p.F613F		NM_033547.3	NP_291025.3	Q96HW7	INT4_HUMAN	integrator complex subunit 4	613					snRNA processing (GO:0016180)	integrator complex (GO:0032039)			INTS4/GAB2(2)	NS(2)|cervix(3)|endometrium(3)|kidney(3)|large_intestine(4)|lung(9)|ovary(2)|prostate(5)|upper_aerodigestive_tract(1)	32	all_cancers(14;4.53e-19)|all_epithelial(13;1.73e-21)|Breast(9;2.71e-16)|Ovarian(111;0.152)		Epithelial(5;1.13e-46)|all cancers(3;8.92e-44)|BRCA - Breast invasive adenocarcinoma(5;8.4e-26)|OV - Ovarian serous cystadenocarcinoma(8;1.05e-23)			TCTGCTGCAGGAACTGCTGGG	0.502																																																	0													96.0	93.0	94.0					11																	77629950		2200	4292	6492	SO:0001819	synonymous_variant	92105			BC015664	CCDS31644.1	11q14.1	2006-04-26			ENSG00000149262	ENSG00000149262			25048	protein-coding gene	gene with protein product		611348				16239144	Standard	NM_033547		Approved	INT4, MGC16733, MST093	uc001oys.3	Q96HW7	OTTHUMG00000166629	ENST00000534064.1:c.1839C>T	11.37:g.77629950G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2YD62|Q6PJG4|Q7Z4E7|Q96G32|Q96GA1|Q9BRC0	Silent	SNP	pfam_HEAT,superfamily_ARM-type_fold	p.F613	ENST00000534064.1	37	c.1839	CCDS31644.1	11																																																																																			INTS4	-	NULL		0.502	INTS4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS4	HGNC	protein_coding	OTTHUMT00000390927.1	G	NM_033547		77629950	-1	no_errors	ENST00000534064	ensembl	human	known	70_37	silent	SNP	0.999	A
IPPK	64768	genome.wustl.edu	37	9	95400399	95400399	+	Missense_Mutation	SNP	C	C	T	rs150868938		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:95400399C>T	ENST00000287996.3	-	9	1076	c.800G>A	c.(799-801)cGg>cAg	p.R267Q	IPPK_ENST00000375522.1_5'Flank	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	267					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)	p.R267Q(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						CAGCAGCACCCGTGTGATCAC	0.667																																																	1	Substitution - Missense(1)	ovary(1)						C	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	43.0	42.0	43.0		800	1.7	0.9	9	dbSNP_134	43	0,8600		0,0,4300	no	missense	IPPK	NM_022755.5	43	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging	267/492	95400399	1,13005	2203	4300	6503	SO:0001583	missense	64768			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.800G>A	9.37:g.95400399C>T	ENSP00000287996:p.Arg267Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T9F7|Q9H7V8	Missense_Mutation	SNP	pfam_Ins_P5_2-kin	p.R267Q	ENST00000287996.3	37	c.800	CCDS6699.1	9	.	.	.	.	.	.	.	.	.	.	C	9.534	1.111522	0.20714	2.27E-4	0.0	ENSG00000127080	ENST00000287996	T	0.29142	1.58	5.11	1.72	0.24424	.	0.536654	0.20746	N	0.086441	T	0.07413	0.0187	N	0.03608	-0.345	0.28375	N	0.919836	P	0.45768	0.866	B	0.30716	0.119	T	0.15178	-1.0446	10	0.15066	T	0.55	-17.6797	3.2612	0.06849	0.4503:0.3445:0.115:0.0901	.	267	Q9H8X2	IPPK_HUMAN	Q	267	ENSP00000287996:R267Q	ENSP00000287996:R267Q	R	-	2	0	IPPK	94440220	0.333000	0.24731	0.858000	0.33744	0.312000	0.27988	1.020000	0.30027	0.651000	0.30788	0.462000	0.41574	CGG	IPPK	-	pfam_Ins_P5_2-kin		0.667	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPPK	HGNC	protein_coding	OTTHUMT00000053101.1	C	NM_022755		95400399	-1	no_errors	ENST00000287996	ensembl	human	known	70_37	missense	SNP	0.349	T
INVS	27130	genome.wustl.edu	37	9	103035345	103035345	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:103035345G>C	ENST00000262457.2	+	12	1956	c.1771G>C	c.(1771-1773)Gat>Cat	p.D591H	INVS_ENST00000262456.2_Missense_Mutation_p.D591H|INVS_ENST00000541287.1_Missense_Mutation_p.D495H	NM_014425.3	NP_055240.2	Q9Y283	INVS_HUMAN	inversin	591					embryonic heart tube left/right pattern formation (GO:0060971)|kidney development (GO:0001822)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|pancreas development (GO:0031016)|post-embryonic development (GO:0009791)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.D591F(1)		breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(4)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	31		Acute lymphoblastic leukemia(62;0.056)				GTTGAGAAAAGATGCTGCTGC	0.522																																																	1	Substitution - Missense(1)	ovary(1)											101.0	97.0	98.0					9																	103035345		2203	4300	6503	SO:0001583	missense	27130			AF039217	CCDS6746.1, CCDS6747.1	9q31	2013-01-10	2003-08-11		ENSG00000119509	ENSG00000119509		"""Ankyrin repeat domain containing"""	17870	protein-coding gene	gene with protein product	"""nephrocystin 2"""	243305	"""nephronophthisis 2 (infantile)"""	NPHP2		12872123	Standard	NM_014425		Approved		uc004bap.2	Q9Y283	OTTHUMG00000020364	ENST00000262457.2:c.1771G>C	9.37:g.103035345G>C	ENSP00000262457:p.Asp591His	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2Y2|Q2NKL0|Q5W0T6|Q8IVX8|Q9BRB9|Q9Y488|Q9Y498	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_IQ_motif_EF-hand-BS,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_IQ_motif_EF-hand-BS,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_IQ_motif_EF-hand-BS,prints_Ankyrin_rpt	p.D591H	ENST00000262457.2	37	c.1771	CCDS6746.1	9	.	.	.	.	.	.	.	.	.	.	G	20.7	4.039965	0.75732	.	.	ENSG00000119509	ENST00000262457;ENST00000541287;ENST00000262456	T;T;T	0.45668	0.89;0.89;1.01	5.28	5.28	0.74379	.	0.086938	0.85682	D	0.000000	T	0.57592	0.2064	L	0.36672	1.1	0.53688	D	0.999979	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.996;0.998;0.999	T	0.59343	-0.7472	10	0.66056	D	0.02	.	19.2664	0.93988	0.0:0.0:1.0:0.0	.	495;591;591	F5GZH2;Q9Y283;Q9Y283-2	.;INVS_HUMAN;.	H	591;495;591	ENSP00000262457:D591H;ENSP00000444454:D495H;ENSP00000262456:D591H	ENSP00000262456:D591H	D	+	1	0	INVS	102075166	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.823000	0.86660	2.628000	0.89032	0.491000	0.48974	GAT	INVS	-	NULL		0.522	INVS-005	KNOWN	basic|appris_principal|CCDS	protein_coding	INVS	HGNC	protein_coding	OTTHUMT00000053407.1	G	NM_014425		103035345	+1	no_errors	ENST00000262457	ensembl	human	known	70_37	missense	SNP	1.000	C
IQCF1	132141	genome.wustl.edu	37	3	51928921	51928921	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:51928921G>C	ENST00000310914.5	-	4	665	c.603C>G	c.(601-603)ttC>ttG	p.F201L		NM_152397.2	NP_689610.2	Q8N6M8	IQCF1_HUMAN	IQ motif containing F1	201										central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(3)|ovary(1)|prostate(1)	12				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000541)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		CCTTTATTGAGAAGGGAATAC	0.483																																																	0													67.0	67.0	67.0					3																	51928921		2203	4300	6503	SO:0001583	missense	132141			BC029595	CCDS2836.1	3p21.31	2008-02-05			ENSG00000173389	ENSG00000173389			28607	protein-coding gene	gene with protein product						12477932	Standard	NM_152397		Approved	MGC39725	uc003dbv.3	Q8N6M8	OTTHUMG00000156908	ENST00000310914.5:c.603C>G	3.37:g.51928921G>C	ENSP00000307958:p.Phe201Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N711	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.F201L	ENST00000310914.5	37	c.603	CCDS2836.1	3	.	.	.	.	.	.	.	.	.	.	G	0.008	-1.888968	0.00527	.	.	ENSG00000173389	ENST00000310914	T	0.20463	2.07	4.06	-0.0151	0.13977	.	0.280527	0.25777	N	0.028379	T	0.03871	0.0109	N	0.01128	-1	0.20403	N	0.999902	B	0.02656	0.0	B	0.01281	0.0	T	0.36432	-0.9748	10	0.02654	T	1	-2.3814	2.8033	0.05420	0.3614:0.0:0.4362:0.2024	.	201	Q8N6M8	IQCF1_HUMAN	L	201	ENSP00000307958:F201L	ENSP00000307958:F201L	F	-	3	2	IQCF1	51903961	1.000000	0.71417	0.996000	0.52242	0.059000	0.15707	0.627000	0.24506	-0.017000	0.14103	0.448000	0.29417	TTC	IQCF1	-	NULL		0.483	IQCF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF1	HGNC	protein_coding	OTTHUMT00000346568.1	G	NM_152397		51928921	-1	no_errors	ENST00000310914	ensembl	human	known	70_37	missense	SNP	0.996	C
IRF5	3663	genome.wustl.edu	37	7	128587476	128587476	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:128587476G>A	ENST00000402030.2	+	6	698	c.626G>A	c.(625-627)gGc>gAc	p.G209D	IRF5_ENST00000473745.1_Missense_Mutation_p.G209D|IRF5_ENST00000477535.1_Intron|IRF5_ENST00000357234.5_Missense_Mutation_p.G225D|IRF5_ENST00000249375.4_Missense_Mutation_p.G209D	NM_001098629.1|NM_001098630.1	NP_001092099.1|NP_001092100.1	Q13568	IRF5_HUMAN	interferon regulatory factor 5	209					cytokine-mediated signaling pathway (GO:0019221)|defense response to virus (GO:0051607)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interferon-alpha production (GO:0032727)|positive regulation of interferon-beta production (GO:0032728)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muramyl dipeptide (GO:0032495)|response to peptidoglycan (GO:0032494)|transcription, DNA-templated (GO:0006351)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	regulatory region DNA binding (GO:0000975)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|lung(1)|prostate(1)	15						AACCCTGCTGGCTTCAGGGAG	0.711																																																	0													9.0	11.0	10.0					7																	128587476		2168	4244	6412	SO:0001583	missense	3663				CCDS5808.1, CCDS43645.1, CCDS56512.1	7q32	2008-07-18			ENSG00000128604	ENSG00000128604			6120	protein-coding gene	gene with protein product		607218					Standard	XM_005250317		Approved		uc003vog.3	Q13568	OTTHUMG00000158410	ENST00000402030.2:c.626G>A	7.37:g.128587476G>A	ENSP00000385352:p.Gly209Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1J8|A8DUA8|A8DUA9|E7EQ16|E7EW54|Q1A7B4|Q64GA9|Q64GB1|Q64GB2|Q6RCM8|Q9BQF0	Missense_Mutation	SNP	pfam_Interferon_reg_factor-3,pfam_Interferon_reg_fact_DNA-bd_dom,superfamily_SMAD_FHA_domain,smart_Interferon_reg_fact_DNA-bd_dom,prints_Interferon_reg_fact_DNA-bd_dom	p.G225D	ENST00000402030.2	37	c.674	CCDS5808.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.597|5.597	0.294873|0.294873	0.10622|0.10622	.|.	.|.	ENSG00000128604|ENSG00000128604	ENST00000430204|ENST00000357234;ENST00000402030;ENST00000249375;ENST00000473745;ENST00000412326	.|D;D;D;D	.|0.97328	.|-4.34;-4.32;-4.32;-4.32	5.17|5.17	-1.76|-1.76	0.08006|0.08006	.|.	.|.	.|.	.|.	.|.	D|D	0.90096|0.90096	0.6906|0.6906	N|N	0.17474|0.17474	0.49|0.49	0.21290|0.21290	N|N	0.999735|0.999735	B|B;B	0.17038|0.02656	0.02|0.0;0.0	B|B;B	0.12156|0.09377	0.007|0.001;0.004	T|T	0.80303|0.80303	-0.1439|-0.1439	8|9	0.52906|0.12103	T|T	0.07|0.63	-12.5968|-12.5968	6.4092|6.4092	0.21682|0.21682	0.2456:0.4051:0.3493:0.0|0.2456:0.4051:0.3493:0.0	.|.	198|209;225	E9PC81|Q13568;Q13568-2	.|IRF5_HUMAN;.	T|D	198|225;209;209;209;199	.|ENSP00000349770:G225D;ENSP00000385352:G209D;ENSP00000249375:G209D;ENSP00000419149:G209D	ENSP00000409106:A198T|ENSP00000249375:G209D	A|G	+|+	1|2	0|0	IRF5|IRF5	128374712|128374712	0.018000|0.018000	0.18449|0.18449	0.134000|0.134000	0.22075|0.22075	0.196000|0.196000	0.23810|0.23810	0.031000|0.031000	0.13710|0.13710	-0.215000|-0.215000	0.10063|0.10063	0.561000|0.561000	0.74099|0.74099	GCT|GGC	IRF5	-	NULL		0.711	IRF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IRF5	HGNC	protein_coding	OTTHUMT00000350934.1	G	NM_001098627		128587476	+1	no_errors	ENST00000357234	ensembl	human	known	70_37	missense	SNP	0.148	A
ISL2	64843	genome.wustl.edu	37	15	76632843	76632843	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:76632843C>G	ENST00000290759.4	+	4	898	c.738C>G	c.(736-738)gaC>gaG	p.D246E	RP11-685G9.2_ENST00000559539.1_RNA	NM_145805.1	NP_665804.1	Q96A47	ISL2_HUMAN	ISL LIM homeobox 2	246					negative regulation of neuron differentiation (GO:0045665)|neuron development (GO:0048666)|peripheral nervous system neuron development (GO:0048935)|regulation of transcription, DNA-templated (GO:0006355)|retinal ganglion cell axon guidance (GO:0031290)|spinal cord motor neuron cell fate specification (GO:0021520)|visceral motor neuron differentiation (GO:0021524)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|lung(2)|ovary(1)|skin(1)	6						GCTGCAAGGACAAGAAGAAAT	0.642																																					GBM(97;953 1391 16164 31496 36951)												0													33.0	38.0	37.0					15																	76632843		2197	4293	6490	SO:0001583	missense	64843			AK001022	CCDS10290.1	15q24.3	2012-03-09	2007-07-13		ENSG00000159556	ENSG00000159556		"""Homeoboxes / LIM class"""	18524	protein-coding gene	gene with protein product		609481	"""ISL2 transcription factor, LIM/homeodomain, (islet-2)"""				Standard	NM_145805		Approved	FLJ10160	uc002bbw.1	Q96A47	OTTHUMG00000143723	ENST00000290759.4:c.738C>G	15.37:g.76632843C>G	ENSP00000290759:p.Asp246Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KM37	Missense_Mutation	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.D246E	ENST00000290759.4	37	c.738	CCDS10290.1	15	.	.	.	.	.	.	.	.	.	.	C	24.3	4.516403	0.85495	.	.	ENSG00000159556	ENST00000290759	D	0.95588	-3.75	5.05	4.13	0.48395	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.000000	0.85682	D	0.000000	D	0.93887	0.8044	N	0.20685	0.6	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.90113	0.4193	10	0.07644	T	0.81	.	11.62	0.51113	0.0:0.912:0.0:0.088	.	246	Q96A47	ISL2_HUMAN	E	246	ENSP00000290759:D246E	ENSP00000290759:D246E	D	+	3	2	ISL2	74419898	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.953000	0.56699	1.253000	0.44018	-0.266000	0.10368	GAC	ISL2	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.642	ISL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISL2	HGNC	protein_coding	OTTHUMT00000289779.1	C			76632843	+1	no_errors	ENST00000290759	ensembl	human	known	70_37	missense	SNP	1.000	G
ITIH5	80760	genome.wustl.edu	37	10	7679252	7679252	+	Silent	SNP	G	G	A	rs369114884		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:7679252G>A	ENST00000256861.6	-	5	669	c.591C>T	c.(589-591)atC>atT	p.I197I	ITIH5_ENST00000434980.1_5'UTR|ITIH5_ENST00000397146.2_Silent_p.I197I|ITIH5_ENST00000446830.2_5'UTR|ITIH5_ENST00000397145.2_Silent_p.I197I	NM_030569.6	NP_085046.5	Q86UX2	ITIH5_HUMAN	inter-alpha-trypsin inhibitor heavy chain family, member 5	197					hyaluronan metabolic process (GO:0030212)	extracellular region (GO:0005576)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(5)|kidney(6)|large_intestine(21)|lung(25)|ovary(4)|pancreas(1)|skin(2)|stomach(1)|urinary_tract(3)	75						CCAGGGATGCGATGCCCGCGC	0.657																																																	0													74.0	75.0	75.0					10																	7679252		2203	4300	6503	SO:0001819	synonymous_variant	80760					10p14	2011-10-26	2011-10-26		ENSG00000123243	ENSG00000123243			21449	protein-coding gene	gene with protein product		609783	"""inter-alpha (globulin) inhibitor H5"""			14744536	Standard	NM_001001851		Approved	MGC10848	uc021pmv.1	Q86UX2	OTTHUMG00000017635	ENST00000256861.6:c.591C>T	10.37:g.7679252G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T664|Q5T665|Q5T666|Q6AI60|Q6UXB7|Q8TF48|Q8WYV2|Q96K70	Silent	SNP	pfam_ITI_HC_C,pfam_VIT,pfam_VWF_A,smart_VIT,smart_VWF_A,pfscan_VWF_A	p.I197	ENST00000256861.6	37	c.591		10																																																																																			ITIH5	-	NULL		0.657	ITIH5-001	KNOWN	basic|appris_principal	protein_coding	ITIH5	HGNC	protein_coding	OTTHUMT00000046688.1	G	NM_030569		7679252	-1	no_errors	ENST00000256861	ensembl	human	known	70_37	silent	SNP	0.049	A
KDM7A	80853	genome.wustl.edu	37	7	139797431	139797431	+	Missense_Mutation	SNP	G	G	T	rs6950119	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:139797431G>T	ENST00000397560.2	-	15	2027	c.1930C>A	c.(1930-1932)Cgt>Agt	p.R644S	JHDM1D_ENST00000006967.5_Missense_Mutation_p.R644S|Y_RNA_ENST00000515919.1_RNA	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN		644			R -> S (in dbSNP:rs6950119). {ECO:0000269|PubMed:11214970}.		histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)	p.R644S(1)		central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					GATTTCACACGTGTAAAAAAC	0.433													G|||	1640	0.327476	0.4039	0.2767	5008	,	,		20930	0.245		0.334	False		,,,				2504	0.3384																1	Substitution - Missense(1)	lung(1)						G	SER/ARG	1415,2283		266,883,700	67.0	64.0	65.0		1930	3.2	1.0	7	dbSNP_116	65	2782,5404		475,1832,1786	yes	missense	JHDM1D	NM_030647.1	110	741,2715,2486	TT,TG,GG		33.9849,38.2639,35.3164	benign	644/942	139797431	4197,7687	1849	4093	5942	SO:0001583	missense	80853																														ENST00000397560.2:c.1930C>A	7.37:g.139797431G>T	ENSP00000380692:p.Arg644Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_JmjC_dom,pfscan_JmjC_dom,pfscan_Znf_PHD-finger	p.R644S	ENST00000397560.2	37	c.1930	CCDS43658.1	7	664	0.304029304029304	188	0.3821138211382114	103	0.2845303867403315	137	0.2395104895104895	236	0.3113456464379947	G	4.224	0.040418	0.08148	0.382639	0.339849	ENSG00000006459	ENST00000397560;ENST00000006967	T;T	0.12465	2.92;2.68	5.53	3.18	0.36537	.	0.323397	0.40469	N	0.001093	T	0.00012	0.0000	N	0.00146	-1.995	0.34970	P	0.24697000000000002	B	0.02656	0.0	B	0.01281	0.0	T	0.43147	-0.9409	9	0.20519	T	0.43	-3.5099	8.5295	0.33326	0.1204:0.0:0.1557:0.7239	rs6950119;rs52801179;rs60741643;rs6950119	644	Q6ZMT4	KDM7_HUMAN	S	644	ENSP00000380692:R644S;ENSP00000006967:R644S	ENSP00000006967:R644S	R	-	1	0	JHDM1D	139443900	1.000000	0.71417	1.000000	0.80357	0.966000	0.64601	2.472000	0.45136	0.399000	0.25367	-0.237000	0.12165	CGT	JHDM1D	-	NULL		0.433	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JHDM1D	HGNC	protein_coding	OTTHUMT00000348460.1	G			139797431	-1	no_errors	ENST00000397560	ensembl	human	known	70_37	missense	SNP	1.000	T
JRKL	8690	genome.wustl.edu	37	11	96125364	96125364	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:96125364G>A	ENST00000332349.4	+	2	1798	c.1551G>A	c.(1549-1551)caG>caA	p.Q517Q	CCDC82_ENST00000525786.1_5'Flank|JRKL_ENST00000546177.1_Intron|CCDC82_ENST00000542662.1_5'Flank|JRKL_ENST00000458427.1_Silent_p.Q517Q	NM_001261833.1	NP_001248762.1	Q9Y4A0	JERKL_HUMAN	JRK-like	517					central nervous system development (GO:0007417)	nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|kidney(1)|large_intestine(5)|lung(3)|upper_aerodigestive_tract(1)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)		BRCA - Breast invasive adenocarcinoma(274;0.148)		GAAATAAACAGAAGATGACAA	0.328																																																	0													35.0	33.0	33.0					11																	96125364		2196	4283	6479	SO:0001819	synonymous_variant	8690			AF004715	CCDS8308.1	11q21	2014-03-28	2014-03-28		ENSG00000183340	ENSG00000183340			6200	protein-coding gene	gene with protein product		603211	"""erky (mouse) homolog-like"", ""jerky homolog-like (mouse)"""			9240447	Standard	NM_003772		Approved	HHMJG	uc009ywu.4	Q9Y4A0	OTTHUMG00000154950	ENST00000332349.4:c.1551G>A	11.37:g.96125364G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3G4|B2RAJ3|Q32MC2	Silent	SNP	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.Q517	ENST00000332349.4	37	c.1551	CCDS8308.1	11																																																																																			JRKL	-	NULL		0.328	JRKL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JRKL	HGNC	protein_coding	OTTHUMT00000337775.2	G	NM_003772		96125364	+1	no_errors	ENST00000332349	ensembl	human	known	70_37	silent	SNP	1.000	A
KANK1	23189	genome.wustl.edu	37	9	734665	734666	+	Intron	INS	-	-	A	rs377485461|rs77731420|rs142267604	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:734665_734666insA	ENST00000382303.1	+	11	3897				KANK1_ENST00000382297.2_Intron|KANK1_ENST00000382293.3_Intron|KANK1_ENST00000489369.1_3'UTR	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1						negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		gaccctgtctcaaaaaaaaaaT	0.426													|||unknown(HR)	1149	0.229433	0.0991	0.1902	5008	,	,		21353	0.1687		0.3718	False		,,,				2504	0.3497																0																																										SO:0001627	intron_variant	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.3246-82->A	9.37:g.734675_734675dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	RNA	INS	-	NULL	ENST00000382303.1	37	NULL	CCDS34976.1	9																																																																																			KANK1	-	-		0.426	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	-	NM_015158		734666	+1	no_errors	ENST00000489369	ensembl	human	known	70_37	rna	INS	0.002:0.002	A
KCNAB1	7881	genome.wustl.edu	37	3	156254594	156254594	+	3'UTR	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:156254594G>A	ENST00000490337.1	+	0	1382				KCNAB1_ENST00000389636.5_3'UTR|KCNAB1_ENST00000497291.1_3'UTR|KCNAB1_ENST00000302490.8_3'UTR|KCNAB1_ENST00000471742.1_3'UTR	NM_172160.2	NP_751892.1	Q14722	KCAB1_HUMAN	potassium voltage-gated channel, shaker-related subfamily, beta member 1						learning or memory (GO:0007611)|potassium ion transport (GO:0006813)|regulation of potassium ion transmembrane transporter activity (GO:1901016)|synaptic transmission (GO:0007268)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel regulator activity (GO:0015459)|voltage-gated potassium channel activity (GO:0005249)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	28			LUSC - Lung squamous cell carcinoma(72;0.0461)|Lung(72;0.0465)			GCCCAGTACAGAAAGGTGTTA	0.483																																																	0																																										SO:0001624	3_prime_UTR_variant	7881			U33428	CCDS3174.1, CCDS3175.1, CCDS33882.1	3q26.1	2006-11-29			ENSG00000169282	ENSG00000169282		"""Potassium channels"", ""Aldo-keto reductases"""	6228	protein-coding gene	gene with protein product		601141				8838324, 7499366	Standard	NM_172160		Approved	AKR6A3, KCNA1B, hKvBeta3, Kvb1.3, hKvb3	uc003far.2	Q14722	OTTHUMG00000158552	ENST00000490337.1:c.*58G>A	3.37:g.156254594G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9H8|A8KAD4|B3KPZ4|Q13031|Q13302|Q16547|Q6PI60|Q99869	RNA	SNP	-	NULL	ENST00000490337.1	37	NULL	CCDS3174.1	3																																																																																			KCNAB1	-	-		0.483	KCNAB1-002	KNOWN	basic|CCDS	protein_coding	KCNAB1	HGNC	protein_coding	OTTHUMT00000351411.1	G	NM_003471		156254594	+1	no_errors	ENST00000497291	ensembl	human	known	70_37	rna	SNP	0.621	A
KCNC4	3749	genome.wustl.edu	37	1	110765970	110765970	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:110765970C>T	ENST00000369787.3	+	2	1090	c.1063C>T	c.(1063-1065)Ctg>Ttg	p.L355L	KCNC4_ENST00000413138.3_Silent_p.L355L|KCNC4_ENST00000438661.2_Silent_p.L355L|KCNC4_ENST00000412512.2_Intron	NM_004978.4	NP_004969.2	Q03721	KCNC4_HUMAN	potassium voltage-gated channel, Shaw-related subfamily, member 4	355					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|regulation of neurotransmitter secretion (GO:0046928)|synaptic transmission (GO:0007268)	axon terminus (GO:0043679)|neuromuscular junction (GO:0031594)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			central_nervous_system(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|liver(2)|lung(11)|ovary(1)|skin(2)	32		all_cancers(81;9.88e-06)|all_epithelial(167;3.23e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)		Lung(183;0.0238)|all cancers(265;0.0693)|Epithelial(280;0.0748)|Colorectal(144;0.112)|LUSC - Lung squamous cell carcinoma(189;0.135)		CGTGCGCATCCTGCGTATCTT	0.637																																																	0													71.0	59.0	63.0					1																	110765970		2203	4300	6503	SO:0001819	synonymous_variant	3749			BC101769	CCDS821.1, CCDS44193.1	1p21	2012-07-05			ENSG00000116396	ENSG00000116396		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	6236	protein-coding gene	gene with protein product		176265	"""chromosome 1 open reading frame 30"""	C1orf30		1920536, 1740329, 16382104	Standard	NM_004978		Approved	Kv3.4, HKSHIIIC	uc001dzh.3	Q03721	OTTHUMG00000011037	ENST00000369787.3:c.1063C>T	1.37:g.110765970C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MIM4|Q5TBI6	Silent	SNP	pfam_Ion_trans_dom,pfam_T1-type_BTB,pfam_K_chnl_volt-dep_Kv3_ID,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv3.4,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9	p.L355	ENST00000369787.3	37	c.1063	CCDS821.1	1																																																																																			KCNC4	-	pfam_Ion_trans_dom,prints_K_chnl		0.637	KCNC4-004	KNOWN	basic|CCDS	protein_coding	KCNC4	HGNC	protein_coding	OTTHUMT00000052146.2	C	NM_001039574		110765970	+1	no_errors	ENST00000369787	ensembl	human	known	70_37	silent	SNP	1.000	T
KCNJ10	3766	genome.wustl.edu	37	1	160012204	160012204	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:160012204C>T	ENST00000368089.3	-	2	345	c.119G>A	c.(118-120)aGa>aAa	p.R40K	KCNJ10_ENST00000509700.1_5'Flank	NM_002241.4	NP_002232.2	P78508	KCJ10_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 10	40					adult walking behavior (GO:0007628)|central nervous system myelination (GO:0022010)|inflammatory response (GO:0006954)|L-glutamate uptake involved in synaptic transmission (GO:0051935)|membrane hyperpolarization (GO:0060081)|optic nerve development (GO:0021554)|potassium ion homeostasis (GO:0055075)|potassium ion import (GO:0010107)|potassium ion transport (GO:0006813)|protein homotetramerization (GO:0051289)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of resting membrane potential (GO:0060075)|regulation of sensory perception of pain (GO:0051930)|response to blue light (GO:0009637)|response to glucocorticoid (GO:0051384)|response to mineralocorticoid (GO:0051385)|synaptic transmission (GO:0007268)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of plasma membrane (GO:0005887)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATP-activated inward rectifier potassium channel activity (GO:0015272)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|prostate(1)	17	all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)		Yohimbine(DB01392)	GTGCTCCATTCTCACGTTGCT	0.547																																					GBM(167;1368 2014 14817 36425 43215)												0													191.0	157.0	168.0					1																	160012204		2203	4300	6503	SO:0001583	missense	3766			U52155	CCDS1193.1	1q23.2	2011-07-05			ENSG00000177807	ENSG00000177807		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6256	protein-coding gene	gene with protein product		602208				9367690, 8995301, 16382105	Standard	NM_002241		Approved	Kir4.1, Kir1.2	uc001fuw.2	P78508	OTTHUMG00000024073	ENST00000368089.3:c.119G>A	1.37:g.160012204C>T	ENSP00000357068:p.Arg40Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KME7|Q5VUT9|Q8N4I7|Q92808	Missense_Mutation	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir1.2,prints_K_chnl_inward-rec_Kir1.1	p.R40K	ENST00000368089.3	37	c.119	CCDS1193.1	1	.	.	.	.	.	.	.	.	.	.	C	14.47	2.543645	0.45280	.	.	ENSG00000177807	ENST00000368089	D	0.93604	-3.25	5.17	5.17	0.71159	Potassium channel, inwardly rectifying, Kir, conserved region 2 (1);	0.052945	0.64402	D	0.000001	D	0.88336	0.6409	L	0.45051	1.395	0.43195	D	0.995036	B	0.23735	0.09	B	0.28849	0.095	D	0.86404	0.1744	10	0.56958	D	0.05	.	16.2022	0.82088	0.0:1.0:0.0:0.0	.	40	P78508	IRK10_HUMAN	K	40	ENSP00000357068:R40K	ENSP00000357068:R40K	R	-	2	0	KCNJ10	158278828	0.013000	0.17824	0.999000	0.59377	0.969000	0.65631	2.409000	0.44583	2.688000	0.91661	0.591000	0.81541	AGA	KCNJ10	-	pfam_K_chnl_inward-rec_Kir,pirsf_K_chnl_inward-rec_Kir		0.547	KCNJ10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ10	HGNC	protein_coding	OTTHUMT00000060629.1	C	NM_002241		160012204	-1	no_errors	ENST00000368089	ensembl	human	known	70_37	missense	SNP	0.980	T
KCNV1	27012	genome.wustl.edu	37	8	110980666	110980666	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:110980666C>T	ENST00000524391.1	-	4	2186	c.1154G>A	c.(1153-1155)tGg>tAg	p.W385*	KCNV1_ENST00000297404.1_Nonsense_Mutation_p.W385*			Q6PIU1	KCNV1_HUMAN	potassium channel, subfamily V, member 1	385					potassium ion transport (GO:0006813)|protein homooligomerization (GO:0051260)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	delayed rectifier potassium channel activity (GO:0005251)|ion channel inhibitor activity (GO:0008200)|potassium channel regulator activity (GO:0015459)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(20)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	37	all_neural(195;0.219)		OV - Ovarian serous cystadenocarcinoma(57;5.35e-13)			GGTGGTGGCCCACCACCATGC	0.453																																																	0													98.0	96.0	97.0					8																	110980666		2203	4300	6503	SO:0001587	stop_gained	27012			AF167082	CCDS6314.1	8q23.2	2011-07-05				ENSG00000164794		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels"""	18861	protein-coding gene	gene with protein product		608164				8670833, 16382104	Standard	NM_014379		Approved	Kv8.1	uc003ynr.4	Q6PIU1		ENST00000524391.1:c.1154G>A	8.37:g.110980666C>T	ENSP00000435954:p.Trp385*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UHJ4	Nonsense_Mutation	SNP	pfam_T1-type_BTB,pfam_Ion_trans_dom,pfam_Ion_trans_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,prints_K_chnl,prints_K_chnl_volt-dep_Kv8,prints_K_chnl_volt-dep_Kv,prints_K_chnl_volt-dep_Kv9,prints_K_chnl_volt-dep_Kv3,prints_K_chnl_volt-dep_Kv6,prints_K_chnl_volt-dep_Kv4	p.W385*	ENST00000524391.1	37	c.1154	CCDS6314.1	8	.	.	.	.	.	.	.	.	.	.	C	40	8.147969	0.98678	.	.	ENSG00000164794	ENST00000524391;ENST00000297404;ENST00000545728	.	.	.	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0522	0.89353	0.0:1.0:0.0:0.0	.	.	.	.	X	385;385;261	.	ENSP00000297404:W385X	W	-	2	0	KCNV1	111049842	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.814000	0.86154	2.479000	0.83701	0.655000	0.94253	TGG	KCNV1	-	pfam_Ion_trans_dom,pfam_Ion_trans_2,prints_K_chnl		0.453	KCNV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNV1	HGNC	protein_coding	OTTHUMT00000385525.1	C	NM_014379		110980666	-1	no_errors	ENST00000297404	ensembl	human	known	70_37	nonsense	SNP	1.000	T
KCP	375616	genome.wustl.edu	37	7	128526788	128526788	+	RNA	SNP	C	C	G	rs199965771	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:128526788C>G	ENST00000476647.2	-	0	2735							Q6ZWJ8	KCP_HUMAN	kielin/chordin-like protein							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)	4						CTGAGAGAGACAGCCTGTGGG	0.677													C|||	12	0.00239617	0.0	0.0014	5008	,	,		14467	0.0		0.0089	False		,,,				2504	0.002																0								C	SER/CYS	2,1382		0,2,690	69.0	63.0	65.0		2510	4.9	1.0	7		65	25,3157		0,25,1566	yes	missense	KCP	NM_001135914.1	112	0,27,2256	GG,GC,CC		0.7857,0.1445,0.5913	probably-damaging	837/1504	128526788	27,4539	692	1591	2283			375616			AK122706		7q32.3	2009-11-06	2009-02-18	2009-02-18	ENSG00000135253	ENSG00000135253			17585	protein-coding gene	gene with protein product	"""kielin"""	609344	"""cysteine rich BMP regulator 2 (chordin-like)"""	CRIM2		15793581	Standard	NM_001135914		Approved	FLJ33365, NET67	uc011kor.2	Q6ZWJ8	OTTHUMG00000158363		7.37:g.128526788C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NBE0	RNA	SNP	-	NULL	ENST00000476647.2	37	NULL		7																																																																																			KCP	-	-		0.677	KCP-006	KNOWN	basic	processed_transcript	KCP	HGNC	processed_transcript	OTTHUMT00000403051.1	C	NM_199349		128526788	-1	no_errors	ENST00000297801	ensembl	human	known	70_37	rna	SNP	1.000	G
KHDRBS1	10657	genome.wustl.edu	37	1	32508884	32508884	+	3'UTR	DEL	A	A	-	rs180680107	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:32508884delA	ENST00000327300.7	+	0	2158				KHDRBS1_ENST00000307714.8_3'UTR	NM_006559.1	NP_006550.1			KH domain containing, RNA binding, signal transduction associated 1											endometrium(4)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	14		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TAATTGATATAAAAAAAAAAA	0.294																																					Ovarian(173;401 1982 12359 31110 42403)												0																																										SO:0001624	3_prime_UTR_variant	10657			U78971	CCDS350.1, CCDS60067.1	1p32	2008-07-18			ENSG00000121774	ENSG00000121774			18116	protein-coding gene	gene with protein product	"""GAP-associated tyrosine phosphoprotein p62 (Sam68)"""	602489				1374686, 10564820	Standard	NM_006559		Approved	Sam68, p62, FLJ34027	uc001bub.4	Q07666	OTTHUMG00000003921	ENST00000327300.7:c.*659A>-	1.37:g.32508884delA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL	ENST00000327300.7	37	NULL	CCDS350.1	1																																																																																			KHDRBS1	-	-		0.294	KHDRBS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDRBS1	HGNC	protein_coding	OTTHUMT00000011199.4	A	NM_006559		32508884	+1	no_errors	ENST00000307714	ensembl	human	known	70_37	rna	DEL	0.991	-
CEMIP	57214	genome.wustl.edu	37	15	81241206	81241206	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:81241206C>T	ENST00000394685.3	+	30	4446	c.4027C>T	c.(4027-4029)Cac>Tac	p.H1343Y	KIAA1199_ENST00000220244.3_Missense_Mutation_p.H1343Y|RP11-351M8.2_ENST00000560873.1_RNA|KIAA1199_ENST00000356249.5_Missense_Mutation_p.H1343Y|MESDC2_ENST00000560244.1_5'UTR			Q8WUJ3	CEMIP_HUMAN		1343					hyaluronan catabolic process (GO:0030214)|positive regulation of cell migration (GO:0030335)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase C activity (GO:1900020)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|sensory perception of sound (GO:0007605)	clathrin-coated vesicle membrane (GO:0030665)|coated pit (GO:0005905)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	clathrin heavy chain binding (GO:0032050)|ER retention sequence binding (GO:0046923)|hyaluronic acid binding (GO:0005540)|hyalurononglucosaminidase activity (GO:0004415)			breast(4)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(10)|lung(14)|ovary(1)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	49						CACTGAGGATCACAAAGCCAA	0.517																																																	0													182.0	156.0	165.0					15																	81241206		2203	4300	6503	SO:0001583	missense	57214																														ENST00000394685.3:c.4027C>T	15.37:g.81241206C>T	ENSP00000378177:p.His1343Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6L9J5|Q9H1K5|Q9NPN9|Q9ULM1	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.H1343Y	ENST00000394685.3	37	c.4027	CCDS10315.1	15	.	.	.	.	.	.	.	.	.	.	C	15.39	2.818051	0.50633	.	.	ENSG00000103888	ENST00000220244;ENST00000394685;ENST00000356249	T;T;T	0.65178	-0.14;-0.14;-0.14	5.35	3.29	0.37713	.	0.318671	0.32134	N	0.006529	T	0.43986	0.1272	N	0.22421	0.69	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.34700	-0.9818	10	0.39692	T	0.17	-19.7515	8.2952	0.31982	0.0:0.5602:0.3455:0.0943	.	1343	Q8WUJ3	K1199_HUMAN	Y	1343	ENSP00000220244:H1343Y;ENSP00000378177:H1343Y;ENSP00000348583:H1343Y	ENSP00000220244:H1343Y	H	+	1	0	KIAA1199	79028261	0.999000	0.42202	0.959000	0.39883	0.982000	0.71751	1.850000	0.39328	1.404000	0.46819	0.650000	0.86243	CAC	KIAA1199	-	NULL		0.517	KIAA1199-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1199	HGNC	protein_coding	OTTHUMT00000291389.1	C			81241206	+1	no_errors	ENST00000220244	ensembl	human	known	70_37	missense	SNP	0.499	T
KIAA1755	85449	genome.wustl.edu	37	20	36850988	36850988	+	Silent	SNP	C	C	T	rs35524973	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:36850988C>T	ENST00000279024.4	-	10	2551	c.2280G>A	c.(2278-2280)agG>agA	p.R760R		NM_001029864.1	NP_001025035.1	Q5JYT7	K1755_HUMAN	KIAA1755	760										breast(2)|endometrium(3)|kidney(1)|large_intestine(5)|lung(31)|ovary(5)|pancreas(2)|skin(4)|stomach(1)	54		Myeloproliferative disorder(115;0.00874)				TGCTCAGGCACCTGGTAGCCT	0.657											OREG0025921	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	C|||	113	0.0225639	0.0507	0.013	5008	,	,		17572	0.002		0.0159	False		,,,				2504	0.0194																0								C		274,4132	150.7+/-184.7	12,250,1941	39.0	35.0	37.0		2280	3.0	1.0	20	dbSNP_126	37	143,8457	68.4+/-130.8	3,137,4160	no	coding-synonymous	KIAA1755	NM_001029864.1		15,387,6101	TT,TC,CC		1.6628,6.2188,3.2062		760/1201	36850988	417,12589	2203	4300	6503	SO:0001819	synonymous_variant	85449			AB051542	CCDS33467.1	20q11.23	2007-12-07			ENSG00000149633	ENSG00000149633			29372	protein-coding gene	gene with protein product						11214970	Standard	NM_001029864		Approved	RP5-1054A22.3	uc002xhy.1	Q5JYT7	OTTHUMG00000032436	ENST00000279024.4:c.2280G>A	20.37:g.36850988C>T		Somatic	866	WXS	Illumina HiSeq	Phase_IV	Q9C0A8	Silent	SNP	superfamily_CRAL-TRIO_dom	p.R760	ENST00000279024.4	37	c.2280	CCDS33467.1	20																																																																																			KIAA1755	-	NULL		0.657	KIAA1755-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1755	HGNC	protein_coding	OTTHUMT00000079144.3	C	NM_001029864		36850988	-1	no_errors	ENST00000279024	ensembl	human	known	70_37	silent	SNP	0.379	T
KIAA1841	84542	genome.wustl.edu	37	2	61361326	61361326	+	Frame_Shift_Del	DEL	G	G	-	rs142269591	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:61361326delG	ENST00000295031.5	+	21	2460	c.2083delG	c.(2083-2085)ggtfs	p.G695fs		NM_032506.2	NP_115895.2	Q6NSI8	K1841_HUMAN	KIAA1841	0										breast(3)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	25			Epithelial(17;0.193)			cagaaaaagtggTTTGAGCAG	0.393													GG|GG|G|deletion	119	0.023762	0.0038	0.036	5008	,	,		21790	0.001		0.0736	False		,,,				2504	0.0143																0										74,4190		0,74,2058	171.0	143.0	152.0			0.8	0.1	2	dbSNP_134	161	685,7569		38,609,3480	no	frameshift	KIAA1841	NM_032506.2		38,683,5538	A1A1,A1R,RR		8.299,1.7355,6.0633			61361326	759,11759	2203	4286	6489	SO:0001589	frameshift_variant	84542			BC070104	CCDS1867.1, CCDS46296.1	2p15	2010-06-22			ENSG00000162929	ENSG00000162929			29387	protein-coding gene	gene with protein product						11347906	Standard	NM_032506		Approved		uc002saw.4	Q6NSI8	OTTHUMG00000129421	ENST00000295031.5:c.2083delG	2.37:g.61361326delG	ENSP00000295031:p.Gly695fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AF0|Q6ZND0|Q96JI6	Frame_Shift_Del	DEL	pfam_DUF3342,superfamily_BTB/POZ_fold,superfamily_Homeodomain-like	p.G695fs	ENST00000295031.5	37	c.2083	CCDS1867.1	2																																																																																			KIAA1841	-	NULL		0.393	KIAA1841-001	KNOWN	basic|CCDS	protein_coding	KIAA1841	HGNC	protein_coding	OTTHUMT00000251580.1	G	NM_032506		61361326	+1	no_errors	ENST00000295031	ensembl	human	known	70_37	frame_shift_del	DEL	0.088	-
KIAA2026	158358	genome.wustl.edu	37	9	5923156	5923156	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:5923156A>G	ENST00000399933.3	-	8	2839	c.2840T>C	c.(2839-2841)cTt>cCt	p.L947P	KIAA2026_ENST00000381461.2_Missense_Mutation_p.L917P	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	947										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		CCTTGGAGAAAGCTCTTTTGT	0.378																																																	0													197.0	187.0	190.0					9																	5923156		1920	4150	6070	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.2840T>C	9.37:g.5923156A>G	ENSP00000382815:p.Leu947Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.L947P	ENST00000399933.3	37	c.2840		9	.	.	.	.	.	.	.	.	.	.	A	16.85	3.237765	0.58886	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.44	5.44	0.79542	.	0.184196	0.36234	N	0.002714	T	0.65207	0.2669	L	0.29908	0.895	0.58432	D	0.999997	D	0.69078	0.997	D	0.66979	0.948	T	0.69495	-0.5130	9	0.87932	D	0	-11.8357	15.4781	0.75501	1.0:0.0:0.0:0.0	.	947	Q5HYC2	K2026_HUMAN	P	947;917	.	ENSP00000370870:L917P	L	-	2	0	KIAA2026	5913156	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.478000	0.66806	2.054000	0.61138	0.402000	0.26972	CTT	KIAA2026	-	NULL		0.378	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	A	NM_001017969		5923156	-1	no_errors	ENST00000399933	ensembl	human	novel	70_37	missense	SNP	1.000	G
KIAA2026	158358	genome.wustl.edu	37	9	5988363	5988363	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:5988363C>G	ENST00000399933.3	-	2	775	c.776G>C	c.(775-777)aGa>aCa	p.R259T	KIAA2026_ENST00000381461.2_Missense_Mutation_p.R259T	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	259										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TTCTTTTGCTCTCAGCTGTTC	0.378																																																	0													90.0	86.0	87.0					9																	5988363		1835	4072	5907	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.776G>C	9.37:g.5988363C>G	ENSP00000382815:p.Arg259Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.R259T	ENST00000399933.3	37	c.776		9	.	.	.	.	.	.	.	.	.	.	C	14.13	2.442474	0.43326	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	4.79	4.79	0.61399	.	0.104348	0.40908	U	0.000992	T	0.43743	0.1261	L	0.34521	1.04	0.34897	D	0.746129	B	0.30281	0.275	B	0.33890	0.172	T	0.59215	-0.7496	9	0.66056	D	0.02	.	11.6831	0.51470	0.0:0.9177:0.0:0.0823	.	259	Q5HYC2	K2026_HUMAN	T	259	.	ENSP00000370870:R259T	R	-	2	0	KIAA2026	5978363	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.094000	0.50227	2.381000	0.81170	0.484000	0.47621	AGA	KIAA2026	-	NULL		0.378	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	C	NM_001017969		5988363	-1	no_errors	ENST00000399933	ensembl	human	novel	70_37	missense	SNP	1.000	G
KLHL20	27252	genome.wustl.edu	37	1	173735316	173735316	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:173735316G>A	ENST00000209884.4	+	8	1319	c.1183G>A	c.(1183-1185)Gat>Aat	p.D395N	KLHL20_ENST00000546011.1_Missense_Mutation_p.D206N	NM_014458.3	NP_055273.2	Q9Y2M5	KLH20_HUMAN	kelch-like family member 20	395					cytoskeleton organization (GO:0007010)|Golgi to endosome transport (GO:0006895)|negative regulation of apoptotic process (GO:0043066)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein K33-linked ubiquitination (GO:1990390)|protein transport (GO:0015031)|protein ubiquitination (GO:0016567)|response to interferon-alpha (GO:0035455)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|Cul3-RING ubiquitin ligase complex (GO:0031463)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|PML body (GO:0016605)|trans-Golgi network (GO:0005802)	interferon-gamma binding (GO:0019964)|ubiquitin-protein transferase activity (GO:0004842)			breast(3)|endometrium(6)|kidney(1)|large_intestine(8)|lung(14)|ovary(1)|upper_aerodigestive_tract(1)	34						GTGGAGCAGTGATGTGGCCCC	0.463																																					GBM(159;862 2695 6559 23041)												0													241.0	216.0	225.0					1																	173735316		2203	4300	6503	SO:0001583	missense	27252			AB026190	CCDS1310.1	1q25.1	2013-01-30	2013-01-30		ENSG00000076321	ENSG00000076321		"""Kelch-like"", ""BTB/POZ domain containing"""	25056	protein-coding gene	gene with protein product			"""kelch-like 20 (Drosophila)"""			14668487, 20389280	Standard	NM_014458		Approved	KLEIP, KHLHX	uc001gjc.3	Q9Y2M5	OTTHUMG00000040548	ENST00000209884.4:c.1183G>A	1.37:g.173735316G>A	ENSP00000209884:p.Asp395Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMA0|B4DUR0|Q5TZF2|Q5ZF45|Q9H457	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BACK,pfam_BTB_POZ,pfam_Kelch_2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.D395N	ENST00000209884.4	37	c.1183	CCDS1310.1	1	.	.	.	.	.	.	.	.	.	.	G	23.1	4.374525	0.82573	.	.	ENSG00000076321	ENST00000546011;ENST00000209884	T;T	0.73363	-0.74;-0.2	5.5	5.5	0.81552	Galactose oxidase, beta-propeller (1);	0.093769	0.64402	D	0.000001	T	0.46718	0.1407	N	0.19112	0.55	0.80722	D	1	B;B	0.27882	0.192;0.047	B;B	0.26416	0.069;0.025	T	0.49707	-0.8911	10	0.14656	T	0.56	.	18.1691	0.89739	0.0:0.0:1.0:0.0	.	206;395	B4DUR0;Q9Y2M5	.;KLH20_HUMAN	N	206;395	ENSP00000443121:D206N;ENSP00000209884:D395N	ENSP00000209884:D395N	D	+	1	0	KLHL20	172001939	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	9.689000	0.98673	2.575000	0.86900	0.650000	0.86243	GAT	KLHL20	-	smart_Kelch_1,pirsf_Kelch-like_gigaxonin		0.463	KLHL20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL20	HGNC	protein_coding	OTTHUMT00000097582.1	G	NM_014458		173735316	+1	no_errors	ENST00000209884	ensembl	human	known	70_37	missense	SNP	1.000	A
KLHL23	151230	genome.wustl.edu	37	2	170591825	170591825	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:170591825G>C	ENST00000392647.2	+	2	545	c.301G>C	c.(301-303)Gaa>Caa	p.E101Q	KLHL23_ENST00000602521.1_Intron|KLHL23_ENST00000272797.4_Missense_Mutation_p.E101Q	NM_144711.5	NP_653312.2	Q8NBE8	KLH23_HUMAN	kelch-like family member 23	101	BTB. {ECO:0000255|PROSITE- ProRule:PRU00037}.									breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(4)|skin(1)|urinary_tract(1)	16						TTCCCAAATTGAAATAACTAA	0.373																																																	0													53.0	57.0	56.0					2																	170591825		2201	4300	6501	SO:0001583	missense	151230			BC010437	CCDS2236.1	2q31.1	2013-01-30	2013-01-30		ENSG00000213160	ENSG00000213160		"""Kelch-like"", ""BTB/POZ domain containing"""	27506	protein-coding gene	gene with protein product			"""kelch-like 23 (Drosophila)"""				Standard	NM_144711		Approved	MGC2610, FLJ37812, MGC22679	uc002ufi.2	Q8NBE8	OTTHUMG00000132213	ENST00000392647.2:c.301G>C	2.37:g.170591825G>C	ENSP00000376419:p.Glu101Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N9B9|Q96FT8	Missense_Mutation	SNP	pfam_Kelch_1,pfam_BTB_POZ,pfam_BACK,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like	p.E101Q	ENST00000392647.2	37	c.301	CCDS2236.1	2	.	.	.	.	.	.	.	.	.	.	G	4.477	0.088398	0.08583	.	.	ENSG00000213160	ENST00000272797;ENST00000392647	T;T	0.68025	-0.3;-0.3	5.81	4.83	0.62350	BTB/POZ-like (2);BTB/POZ (1);BTB/POZ fold (2);	0.296018	0.36034	N	0.002828	T	0.38746	0.1052	N	0.10809	0.05	0.31224	N	0.69713	B	0.10296	0.003	B	0.16289	0.015	T	0.38887	-0.9640	9	0.13853	T	0.58	.	3.4802	0.07599	0.2286:0.2774:0.494:0.0	.	101	Q8NBE8	KLH23_HUMAN	Q	101	ENSP00000272797:E101Q;ENSP00000376419:E101Q	ENSP00000272797:E101Q	E	+	1	0	KLHL23	170300071	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.490000	0.35573	2.738000	0.93877	0.655000	0.94253	GAA	KLHL23	-	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,pirsf_Kelch-like_gigaxonin,pfscan_BTB/POZ-like		0.373	KLHL23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLHL23	HGNC	protein_coding	OTTHUMT00000255271.2	G	NM_144711		170591825	+1	no_errors	ENST00000272797	ensembl	human	known	70_37	missense	SNP	1.000	C
KRT1	3848	genome.wustl.edu	37	12	53069235	53069235	+	Silent	SNP	G	G	A	rs540699806|rs11170232|rs267607656	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:53069235G>A	ENST00000252244.3	-	9	1735	c.1677C>T	c.(1675-1677)taC>taT	p.Y559Y		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	559	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						ctccggagccgtagctgctac	0.682													G|||	2135	0.426318	0.4947	0.4424	5008	,	,		8632	0.2411		0.4523	False		,,,				2504	0.4867																0													4.0	5.0	4.0					12																	53069235		1823	3683	5506	SO:0001819	synonymous_variant	3848			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1677C>T	12.37:g.53069235G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.Y559	ENST00000252244.3	37	c.1677	CCDS8836.1	12																																																																																			KRT1	-	NULL		0.682	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	G	NM_006121		53069235	-1	no_errors	ENST00000252244	ensembl	human	known	70_37	silent	SNP	0.007	A
KRT1	3848	genome.wustl.edu	37	12	53069243	53069243	+	Missense_Mutation	SNP	T	T	C	rs77846840|rs540699806|rs267607656	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:53069243T>C	ENST00000252244.3	-	9	1727	c.1669A>G	c.(1669-1671)Agc>Ggc	p.S557G		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	557	Gly/Ser-rich.|Tail.				complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)	p.S557_G563delSSYGSGG(3)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						ccgtagctgctacctccggag	0.682																																																	3	Deletion - In frame(3)	prostate(2)|central_nervous_system(1)											4.0	4.0	4.0					12																	53069243		1805	3566	5371	SO:0001583	missense	3848			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1669A>G	12.37:g.53069243T>C	ENSP00000252244:p.Ser557Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.S557G	ENST00000252244.3	37	c.1669	CCDS8836.1	12	.	.	.	.	.	.	.	.	.	.	t	12.77	2.037794	0.35989	.	.	ENSG00000167768	ENST00000252244	T	0.81247	-1.47	3.63	0.628	0.17681	.	.	.	.	.	T	0.54711	0.1875	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.48490	-0.9031	8	0.07644	T	0.81	.	5.639	0.17552	0.0:0.6406:0.1602:0.1993	.	557	P04264	K2C1_HUMAN	G	557	ENSP00000252244:S557G	ENSP00000252244:S557G	S	-	1	0	KRT1	51355510	0.000000	0.05858	0.034000	0.17996	0.201000	0.24016	-0.192000	0.09587	-0.104000	0.12154	-1.598000	0.00824	AGC	KRT1	-	NULL		0.682	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	T	NM_006121		53069243	-1	no_errors	ENST00000252244	ensembl	human	known	70_37	missense	SNP	0.300	C
KRT16P2	400578	genome.wustl.edu	37	17	16735648	16735648	+	RNA	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:16735648C>T	ENST00000579062.1	-	0	240									keratin 16 pseudogene 2																		GCGTTGGCCTCCTCCAGAGCA	0.597																																																	0																																												400578					17p11.2	2010-02-25			ENSG00000227300	ENSG00000227300			37807	pseudogene	pseudogene							Standard	NR_029392		Approved		uc010vwr.1		OTTHUMG00000059177		17.37:g.16735648C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000579062.1	37	NULL		17																																																																																			KRT16P2	-	-		0.597	KRT16P2-002	KNOWN	basic	processed_transcript	KRT16P2	HGNC	pseudogene	OTTHUMT00000444288.2	C	NR_029392		16735648	-1	no_errors	ENST00000579062	ensembl	human	known	70_37	rna	SNP	1.000	T
KRTAP4-7	100132476	genome.wustl.edu	37	17	39240673	39240673	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:39240673C>G	ENST00000391417.4	+	1	215	c.215C>G	c.(214-216)aCg>aGg	p.T72R		NM_033061.3	NP_149050.3	Q9BYR0	KRA47_HUMAN	keratin associated protein 4-7	72	31 X 5 AA repeats of C-C-[GIKRQVHEML]- [SPTRV]-[STVQRCP].				aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				NS(1)|endometrium(3)|kidney(1)|lung(1)|prostate(2)|urinary_tract(1)	9						TGCTGTGAGACGACctgctgc	0.652																																																	0													18.0	30.0	27.0					17																	39240673		691	1591	2282	SO:0001583	missense	100132476			AJ406939	CCDS45673.1	17q21.2	2013-06-25			ENSG00000240871	ENSG00000240871		"""Keratin associated proteins"""	18898	protein-coding gene	gene with protein product						11279113	Standard	NM_033061		Approved	KAP4.7	uc010wfn.2	Q9BYR0	OTTHUMG00000133582	ENST00000391417.4:c.215C>G	17.37:g.39240673C>G	ENSP00000375236:p.Thr72Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVM6|A8MQ08|A8MTL4	Missense_Mutation	SNP	pfam_Keratin-assoc	p.T72R	ENST00000391417.4	37	c.215	CCDS45673.1	17	.	.	.	.	.	.	.	.	.	.	.	5.135	0.210550	0.09757	.	.	ENSG00000240871	ENST00000391417	T	0.01388	4.95	3.54	1.35	0.21983	.	.	.	.	.	T	0.01592	0.0051	.	.	.	0.09310	N	1	B	0.27286	0.174	B	0.30572	0.117	T	0.46871	-0.9160	8	0.72032	D	0.01	.	6.5286	0.22314	0.0:0.706:0.183:0.111	.	72	Q9BYR0	KRA47_HUMAN	R	72	ENSP00000375236:T72R	ENSP00000375236:T72R	T	+	2	0	KRTAP4-7	36494199	0.000000	0.05858	0.000000	0.03702	0.006000	0.05464	0.962000	0.29280	0.093000	0.17368	-0.398000	0.06409	ACG	KRTAP4-7	-	pfam_Keratin-assoc		0.652	KRTAP4-7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRTAP4-7	HGNC	protein_coding	OTTHUMT00000257686.1	C			39240673	+1	no_errors	ENST00000391417	ensembl	human	known	70_37	missense	SNP	0.004	G
KRTAP4-8	728224	genome.wustl.edu	37	17	39254335	39254336	+	Start_Codon_Ins	INS	-	-	T	rs201764113	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:39254335_39254336insT	ENST00000333822.4	-	0	57_58					NM_031960.2	NP_114166.1	Q9BYQ9	KRA48_HUMAN	keratin associated protein 4-8						aging (GO:0007568)|hair cycle (GO:0042633)	keratin filament (GO:0045095)				endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(1)|prostate(1)	11						GGAGTTGACCATGGTGTCAGAG	0.55													T|T|TT|insertion	2826	0.564297	0.6543	0.6124	5008	,	,		18816	0.4147		0.6183	False		,,,				2504	0.5072																0										2669,1587		858,953,317						3.6	1.0			26	5156,3084		1626,1904,590	no	frameshift	KRTAP4-8	NM_031960.2		2484,2857,907	A1A1,A1R,RR		37.4272,37.2885,37.38				7825,4671				SO:0001582	initiator_codon_variant	728224			AJ406940	CCDS45674.1	17q21.2	2013-06-25			ENSG00000204880	ENSG00000204880		"""Keratin associated proteins"""	17230	protein-coding gene	gene with protein product						11279113	Standard	NM_031960		Approved	KAP4.8	uc010wfo.2	Q9BYQ9	OTTHUMG00000133580	ENST00000333822.4:c.2dupA	17.37:g.39254336_39254336dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MSH3	Frame_Shift_Ins	INS	pfam_Keratin-assoc	p.M1fs	ENST00000333822.4	37	c.2_1	CCDS45674.1	17																																																																																			KRTAP4-8	-	NULL		0.550	KRTAP4-8-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	KRTAP4-8	HGNC	protein_coding	OTTHUMT00000257684.1	-	NM_031960		39254336	-1	no_errors	ENST00000333822	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	T
LAD1	3898	genome.wustl.edu	37	1	201356002	201356004	+	In_Frame_Del	DEL	CCA	CCA	-	rs78190062|rs552300739|rs35119736|rs398053706|rs386638482	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	CCA	CCA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:201356002_201356004delCCA	ENST00000391967.2	-	3	786_788	c.485_487delTGG	c.(484-489)gtgggc>ggc	p.V162del	LAD1_ENST00000367313.3_In_Frame_Del_p.V176del	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	162						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						GGCTCCCTGCCCACCAAGCTCTC	0.586														301	0.0601038	0.0666	0.0504	5008	,	,		15375	0.0575		0.0686	False		,,,				2504	0.0521																0										826,3440		92,642,1399						-0.4	0.0		dbSNP_131	54	717,7533		40,637,3448	no	coding	LAD1	NM_005558.3		132,1279,4847	A1A1,A1R,RR		8.6909,19.3624,12.3282				1543,10973				SO:0001651	inframe_deletion	3898			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.485_487delTGG	1.37:g.201356005_201356007delCCA	ENSP00000375829:p.Val162del	Somatic		WXS	Illumina HiSeq	Phase_IV	O95614|Q96GD8	In_Frame_Del	DEL	pirsf_Ladinin_1	p.V176in_frame_del	ENST00000391967.2	37	c.529_527	CCDS1410.1	1																																																																																			LAD1	-	pirsf_Ladinin_1		0.586	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAD1	HGNC	protein_coding	OTTHUMT00000086946.1	CCA	NM_005558		201356004	-1	no_errors	ENST00000367313	ensembl	human	known	70_37	in_frame_del	DEL	0.000:0.000:0.000	-
LAMA1	284217	genome.wustl.edu	37	18	6983109	6983109	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:6983109C>T	ENST00000389658.3	-	40	5878	c.5785G>A	c.(5785-5787)Gag>Aag	p.E1929K		NM_005559.3	NP_005550.2	P25391	LAMA1_HUMAN	laminin, alpha 1	1929	Domain II and I.				axon guidance (GO:0007411)|branching involved in salivary gland morphogenesis (GO:0060445)|cell adhesion (GO:0007155)|cell surface receptor signaling pathway (GO:0007166)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|establishment of epithelial cell apical/basal polarity (GO:0045198)|extracellular matrix organization (GO:0030198)|morphogenesis of an epithelial sheet (GO:0002011)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of embryonic development (GO:0045995)|retinal blood vessel morphogenesis (GO:0061304)	basement membrane (GO:0005604)|cell-cell junction (GO:0005911)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|laminin-1 complex (GO:0005606)|laminin-3 complex (GO:0005608)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|glycosphingolipid binding (GO:0043208)			NS(4)|breast(7)|central_nervous_system(3)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(49)|liver(1)|lung(71)|ovary(9)|pancreas(3)|prostate(5)|skin(11)|stomach(7)|upper_aerodigestive_tract(8)|urinary_tract(3)	205		Colorectal(10;0.172)				AGGCTCGTCTCAGTCACAGTC	0.517																																																	0													105.0	100.0	102.0					18																	6983109		2203	4300	6503	SO:0001583	missense	284217			X58531	CCDS32787.1	18p11.3	2013-03-01			ENSG00000101680	ENSG00000101680		"""Laminins"""	6481	protein-coding gene	gene with protein product		150320		LAMA		2591971	Standard	NM_005559		Approved		uc002knm.3	P25391	OTTHUMG00000133478	ENST00000389658.3:c.5785G>A	18.37:g.6983109C>T	ENSP00000374309:p.Glu1929Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_EGF_laminin,pfam_Laminin_B_type_IV,pfam_Laminin_N,pfam_Laminin_I,pfam_Laminin_II,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N	p.E1929K	ENST00000389658.3	37	c.5785	CCDS32787.1	18	.	.	.	.	.	.	.	.	.	.	C	10.39	1.338255	0.24253	.	.	ENSG00000101680	ENST00000389658	T	0.18016	2.24	5.23	-10.5	0.00291	.	1.768100	0.02808	N	0.123967	T	0.08626	0.0214	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.14531	-1.0469	10	0.13853	T	0.58	.	10.0415	0.42162	0.0:0.2819:0.2192:0.4989	.	1929	P25391	LAMA1_HUMAN	K	1929	ENSP00000374309:E1929K	ENSP00000374309:E1929K	E	-	1	0	LAMA1	6973109	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-1.907000	0.01589	-3.841000	0.00100	-1.835000	0.00590	GAG	LAMA1	-	NULL		0.517	LAMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA1	HGNC	protein_coding	OTTHUMT00000257369.1	C	NM_005559		6983109	-1	no_errors	ENST00000389658	ensembl	human	known	70_37	missense	SNP	0.000	T
LBX2	85474	genome.wustl.edu	37	2	74729814	74729814	+	5'Flank	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:74729814G>A	ENST00000377566.4	-	0	0				LBX2_ENST00000460508.3_Missense_Mutation_p.S58L|RP11-523H20.3_ENST00000606287.1_RNA|LBX2-AS1_ENST00000603175.1_RNA|PCGF1_ENST00000480844.2_5'Flank|LBX2_ENST00000550249.1_Intron|LBX2_ENST00000341396.2_Intron|LBX2-AS1_ENST00000548978.2_RNA	NM_001282430.1	NP_001269359.1	Q6XYB7	LBX2_HUMAN	ladybird homeobox 2						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)			central_nervous_system(1)|kidney(1)|large_intestine(1)|lung(1)	4						GCAGGCCTGTGAGTTGTTTTC	0.592																																																	0													69.0	74.0	73.0					2																	74729814		2203	4300	6503	SO:0001631	upstream_gene_variant	85474			AC005041	CCDS33228.1, CCDS62938.1	2p13.1	2014-05-06	2007-02-15		ENSG00000179528	ENSG00000179528		"""Homeoboxes / ANTP class : NKL subclass"""	15525	protein-coding gene	gene with protein product		607164	"""ladybird homeobox homolog 2 (Drosophila)"""			11386758	Standard	NM_001282430		Approved		uc002slw.3	Q6XYB7	OTTHUMG00000170595		2.37:g.74729814G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z5Y8	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain	p.S58L	ENST00000377566.4	37	c.173		2	.	.	.	.	.	.	.	.	.	.	G	6.833	0.522851	0.13066	.	.	ENSG00000179528	ENST00000460508	D	0.91577	-2.87	3.15	1.32	0.21799	.	.	.	.	.	T	0.81054	0.4743	.	.	.	0.18873	N	0.999989	B	0.13594	0.008	B	0.11329	0.006	T	0.64972	-0.6281	8	0.24483	T	0.36	.	4.5746	0.12226	0.1293:0.2278:0.6428:0.0	.	58	Q6XYB7-2	.	L	58	ENSP00000417116:S58L	ENSP00000417116:S58L	S	-	2	0	LBX2	74583322	0.000000	0.05858	0.006000	0.13384	0.002000	0.02628	0.517000	0.22832	0.355000	0.24131	-0.479000	0.04858	TCA	LBX2	-	NULL		0.592	LBX2-002	KNOWN	basic|appris_principal	protein_coding	LBX2	HGNC	protein_coding	OTTHUMT00000328490.1	G	NM_001009812		74729814	-1	no_errors	ENST00000460508	ensembl	human	known	70_37	missense	SNP	0.007	A
LEPR	3953	genome.wustl.edu	37	1	66087044	66087044	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:66087044G>A	ENST00000349533.6	+	18	2685	c.2500G>A	c.(2500-2502)Gaa>Aaa	p.E834K	LEPR_ENST00000344610.8_Missense_Mutation_p.E834K|LEPR_ENST00000406510.3_Intron|LEPR_ENST00000371058.1_Missense_Mutation_p.E834K|LEPR_ENST00000371059.3_Missense_Mutation_p.E834K|LEPR_ENST00000371060.3_Missense_Mutation_p.E834K	NM_002303.5	NP_002294.2	O15243	OBRG_HUMAN	leptin receptor	0					negative regulation of growth hormone receptor signaling pathway (GO:0060400)|negative regulation of JAK-STAT cascade (GO:0046426)|negative regulation of protein localization to cell surface (GO:2000009)	endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	receptor binding (GO:0005102)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(22)|skin(2)	36				OV - Ovarian serous cystadenocarcinoma(397;0.00722)|KIRC - Kidney renal clear cell carcinoma(1967;0.094)		AGATGATATTGAAAAACACCA	0.284																																																	0													123.0	115.0	118.0					1																	66087044		2203	4298	6501	SO:0001583	missense	3953			U43168	CCDS631.1, CCDS30740.1, CCDS30741.1, CCDS55604.1	1p31	2014-09-17			ENSG00000116678	ENSG00000116678		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6554	protein-coding gene	gene with protein product		601007				8548812, 8812446	Standard	NM_001003680		Approved	OBR, CD295	uc001dci.3	P48357	OTTHUMG00000009115	ENST00000349533.6:c.2500G>A	1.37:g.66087044G>A	ENSP00000330393:p.Glu834Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6FHL5	Missense_Mutation	SNP	pfam_IgC2-like_lig-bd,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E834K	ENST00000349533.6	37	c.2500	CCDS631.1	1	.	.	.	.	.	.	.	.	.	.	G	8.710	0.911805	0.17907	.	.	ENSG00000116678	ENST00000344610;ENST00000349533;ENST00000371060;ENST00000371059;ENST00000371058	T;T;T;T;T	0.56611	0.51;0.45;0.52;0.5;0.51	5.12	3.2	0.36748	.	0.782162	0.11593	N	0.548515	T	0.40372	0.1114	M	0.65975	2.015	0.20489	N	0.999896	P;P;P	0.44429	0.565;0.835;0.835	B;B;P	0.45794	0.108;0.39;0.493	T	0.15925	-1.0420	10	0.40728	T	0.16	-0.8384	11.115	0.48256	0.1634:0.0:0.8366:0.0	.	834;834;834	P48357;P48357-2;P48357-3	LEPR_HUMAN;.;.	K	834	ENSP00000340884:E834K;ENSP00000330393:E834K;ENSP00000360099:E834K;ENSP00000360098:E834K;ENSP00000360097:E834K	ENSP00000340884:E834K	E	+	1	0	LEPR	65859632	0.988000	0.35896	0.848000	0.33437	0.046000	0.14306	4.824000	0.62701	1.283000	0.44513	0.585000	0.79938	GAA	LEPR	-	NULL		0.284	LEPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEPR	HGNC	protein_coding	OTTHUMT00000025275.1	G	NM_002303		66087044	+1	no_errors	ENST00000349533	ensembl	human	known	70_37	missense	SNP	0.031	A
LGALS1	3956	genome.wustl.edu	37	22	38071707	38071707	+	5'UTR	SNP	A	A	G	rs12403	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:38071707A>G	ENST00000215909.5	+	0	93					NM_002305.3	NP_002296.1	P09382	LEG1_HUMAN	lectin, galactoside-binding, soluble, 1						apoptotic process (GO:0006915)|cellular response to glucose stimulus (GO:0071333)|cellular response to organic cyclic compound (GO:0071407)|multicellular organismal response to stress (GO:0033555)|myoblast differentiation (GO:0045445)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of neuron projection development (GO:0010977)|plasma cell differentiation (GO:0002317)|positive regulation of erythrocyte aggregation (GO:0034120)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|regulation of apoptotic process (GO:0042981)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|signal transduction (GO:0007165)|T cell costimulation (GO:0031295)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|nucleus (GO:0005634)|proteinaceous extracellular matrix (GO:0005578)	galactoside binding (GO:0016936)|lactose binding (GO:0030395)|poly(A) RNA binding (GO:0044822)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(1)|lung(1)	3	Melanoma(58;0.0574)					CCTGGACTCAATCATGGCTTG	0.622													A|||	299	0.0597045	0.0719	0.0533	5008	,	,		13162	0.001		0.0537	False		,,,				2504	0.1145				Pancreas(23;406 890 14304 26016)												0								A		299,4009		8,283,1863	41.0	30.0	34.0			-5.8	0.2	22	dbSNP_131	34	463,7927		12,439,3744	no	utr-5	LGALS1	NM_002305.3		20,722,5607	GG,GA,AA		5.5185,6.9406,6.0009			38071707	762,11936	2154	4195	6349	SO:0001623	5_prime_UTR_variant	3956				CCDS13954.1	22q13.1	2014-01-30	2008-07-25		ENSG00000100097	ENSG00000100097		"""Lectins, galactoside-binding"", ""Endogenous ligands"""	6561	protein-coding gene	gene with protein product	"""galectin 1"""	150570				1988031, 12271131	Standard	NM_002305		Approved	GBP	uc003atn.3	P09382	OTTHUMG00000150661	ENST00000215909.5:c.-3A>G	22.37:g.38071707A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5E8|Q9UDK5	RNA	SNP	-	NULL	ENST00000215909.5	37	NULL	CCDS13954.1	22																																																																																			LGALS1	-	-		0.622	LGALS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LGALS1	HGNC	protein_coding	OTTHUMT00000319482.1	A	NM_002305		38071707	+1	no_errors	ENST00000480207	ensembl	human	known	70_37	rna	SNP	0.037	G
LMO1	4004	genome.wustl.edu	37	11	8251849	8251849	+	Silent	SNP	G	G	A	rs376120856		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:8251849G>A	ENST00000335790.3	-	2	723	c.228C>T	c.(226-228)cgC>cgT	p.R76R	LMO1_ENST00000534484.1_Silent_p.R65R|LMO1_ENST00000428101.2_Silent_p.R75R	NM_002315.2	NP_002306.1	P25800	RBTN1_HUMAN	LIM domain only 1 (rhombotin 1)	76	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	zinc ion binding (GO:0008270)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|skin(1)	5				Epithelial(150;1.59e-07)|BRCA - Breast invasive adenocarcinoma(625;0.203)		TCAGGTAGTCGCGTCGGCACA	0.652			"""T, A"""	TRD@	"""T-ALL, neuroblastoma"""	neuroblastoma																																	yes	Dom	yes		11	11p15	4004	LIM domain only 1 (rhombotin 1) (RBTN1)		L	0								G		0,4402		0,0,2201	77.0	80.0	79.0		228	-9.7	0.1	11		79	1,8591	1.2+/-3.3	0,1,4295	no	coding-synonymous	LMO1	NM_002315.1		0,1,6496	AA,AG,GG		0.0116,0.0,0.0077		76/157	8251849	1,12993	2201	4296	6497	SO:0001819	synonymous_variant	4004			M26682	CCDS44534.1, CCDS58118.1	11p15	2014-09-17			ENSG00000166407	ENSG00000166407			6641	protein-coding gene	gene with protein product		186921		RBTN1		2034676, 1703797	Standard	NM_002315		Approved	TTG1, RHOM1	uc001mgh.2	P25800	OTTHUMG00000165833	ENST00000335790.3:c.228C>T	11.37:g.8251849G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PSF5|Q4VBC5|Q8IXR0	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM	p.R76	ENST00000335790.3	37	c.228	CCDS44534.1	11																																																																																			LMO1	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.652	LMO1-001	KNOWN	basic|CCDS	protein_coding	LMO1	HGNC	protein_coding	OTTHUMT00000386503.2	G	NM_002315		8251849	-1	no_errors	ENST00000335790	ensembl	human	known	70_37	silent	SNP	0.334	A
LOC728554	728554	genome.wustl.edu	37	5	177309472	177309472	+	RNA	SNP	A	A	G	rs199793923	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:177309472A>G	ENST00000506672.1	+	0	804					NR_003615.2																						CAGGAAGTGCAGATGCTTTGG	0.493																																																	0																																												100128340																															5.37:g.177309472A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000506672.1	37	NULL		5																																																																																			RP11-423H2.1	-	-		0.493	RP11-423H2.1-002	KNOWN	basic	processed_transcript	LOC100128340	Clone_based_vega_gene	pseudogene	OTTHUMT00000373226.1	A			177309472	+1	no_errors	ENST00000358442	ensembl	human	known	70_37	rna	SNP	0.982	G
CADM3	57863	genome.wustl.edu	37	1	159166883	159166883	+	Intron	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:159166883C>T	ENST00000368125.4	+	7	1109				CADM3_ENST00000368124.4_Intron|CADM3_ENST00000497636.1_Intron|CTA-134P22.2_ENST00000415675.2_RNA	NM_001127173.1	NP_001120645.1	Q8N126	CADM3_HUMAN	cell adhesion molecule 3						adherens junction organization (GO:0034332)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|protein localization (GO:0008104)	cell-cell junction (GO:0005911)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|endometrium(5)|kidney(4)|large_intestine(12)|lung(20)|ovary(2)|pancreas(1)|prostate(2)|skin(3)	55	all_hematologic(112;0.0429)					CCTCCAGAATCTCCTTTCTCT	0.493																																																	0													85.0	78.0	80.0					1																	159166883		2203	4300	6503	SO:0001627	intron_variant	100131825			AY046418	CCDS1182.1, CCDS44251.1	1q21.2-q22	2013-01-29	2007-02-07	2007-02-07	ENSG00000162706	ENSG00000162706		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	17601	protein-coding gene	gene with protein product	"""nectin-like 1"""	609743	"""immunoglobulin superfamily, member 4B"""	IGSF4B		11536053	Standard	NM_021189		Approved	BIgR, FLJ10698, TSLL1, NECL1, SynCAM3, Necl-1	uc001ftk.2	Q8N126	OTTHUMG00000037177	ENST00000368125.4:c.952+33C>T	1.37:g.159166883C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IZQ9|Q9NVJ5|Q9UJP1	RNA	SNP	-	NULL	ENST00000368125.4	37	NULL	CCDS44251.1	1																																																																																			CTA-134P22.2	-	-		0.493	CADM3-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	LOC100131825	Clone_based_vega_gene	protein_coding	OTTHUMT00000090330.1	C	NM_021189		159166883	-1	no_errors	ENST00000415675	ensembl	human	known	70_37	rna	SNP	0.000	T
CALML3-AS1	100132159	genome.wustl.edu	37	10	5558145	5558146	+	RNA	INS	-	-	C	rs5782832|rs397783543|rs78975789	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:5558145_5558146insC	ENST00000543008.1	-	0	2591_2592				CALML3-AS1_ENST00000542093.1_RNA|CALML3-AS1_ENST00000545372.1_RNA					CALML3 antisense RNA 1																		AATCAAACAGGCACCTGGGCAA	0.535													C|C|CC|insertion	3212	0.641374	0.6067	0.7305	5008	,	,		19768	0.6696		0.6163	False		,,,				2504	0.6217																0																																												100132159			DA220455, DA770774		10p15.1	2012-12-04			ENSG00000205488	ENSG00000205488		"""Long non-coding RNAs"""	44682	non-coding RNA	RNA, long non-coding							Standard	NR_120497		Approved				OTTHUMG00000168090		10.37:g.5558146_5558146dupC		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000543008.1	37	NULL		10																																																																																			RP11-116G8.4	-	-		0.535	CALML3-AS1-001	KNOWN	basic	antisense	LOC100132159	Clone_based_vega_gene	antisense	OTTHUMT00000398076.1	-			5558146	-1	no_errors	ENST00000380330	ensembl	human	known	70_37	rna	INS	0.000:0.001	C
NPIPB5	100132247	genome.wustl.edu	37	16	22545321	22545321	+	Silent	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:22545321C>G	ENST00000517539.1	+	8	1092	c.1017C>G	c.(1015-1017)ctC>ctG	p.L339L	NPIPB5_ENST00000424340.1_Silent_p.L339L|NPIPB5_ENST00000415654.1_3'UTR			A8MRT5	NPIB5_HUMAN	nuclear pore complex interacting protein family, member B5	339	Pro-rich.					integral component of membrane (GO:0016021)											ATGATAATCTCAAGACACCTC	0.562																																																	0													8.0	5.0	6.0					16																	22545321		82	554	636	SO:0001819	synonymous_variant	100132247				CCDS45443.1	16p12.2	2013-06-11			ENSG00000243716	ENSG00000243716			37233	protein-coding gene	gene with protein product							Standard	NM_001135865		Approved			A8MRT5	OTTHUMG00000163573	ENST00000517539.1:c.1017C>G	16.37:g.22545321C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DK13	Silent	SNP	pfam_NPIP	p.L339	ENST00000517539.1	37	c.1017	CCDS45443.1	16																																																																																			61E3.4	-	pfam_NPIP		0.562	NPIPB5-002	NOVEL	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	LOC100132247	Uniprot_genename	protein_coding	OTTHUMT00000374343.2	C	NM_001135865		22545321	+1	no_errors	ENST00000424340	ensembl	human	known	70_37	silent	SNP	0.885	G
MGAT4D	152586	genome.wustl.edu	37	4	141383121	141383121	+	Missense_Mutation	SNP	A	A	T	rs12505221	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:141383121A>T	ENST00000503109.2	-	7	723	c.724T>A	c.(724-726)Ttg>Atg	p.L242M	RP11-542P2.1_ENST00000511113.1_Missense_Mutation_p.L242M|RP11-542P2.1_ENST00000515354.1_Intron|RP11-542P2.1_ENST00000511632.1_Intron																							GCATACAGCAACAAAATGCAA	0.333													T|||	1403	0.280152	0.2216	0.3228	5008	,	,		12332	0.2946		0.2247	False		,,,				2504	0.3712																0																																										SO:0001583	missense	152586																														ENST00000503109.2:c.724T>A	4.37:g.141383121A>T	ENSP00000426225:p.Leu242Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Glyco_transf_54	p.L242M	ENST00000503109.2	37	c.724		4	549	0.25137362637362637	113	0.22967479674796748	115	0.31767955801104975	163	0.28496503496503495	158	0.20844327176781002	T	2.034	-0.421675	0.04734	.	.	ENSG00000205301	ENST00000511113;ENST00000503109	T;T	0.43688	0.94;0.94	4.61	4.61	0.57282	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.46028	P	0.0011729999999999796	.	.	.	.	.	.	T	0.26189	-1.0110	5	0.02654	T	1	-11.7719	9.8885	0.41276	0.1531:0.0:0.0:0.8469	rs12505221;rs52817708;rs12505221	.	.	.	M	242	ENSP00000421185:L242M;ENSP00000426225:L242M	ENSP00000426225:L242M	L	-	1	2	RP11-542P2.1	141602571	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	4.583000	0.60964	0.796000	0.33947	-0.257000	0.10917	TTG	RP11-542P2.1	-	pfam_Glyco_transf_54		0.333	RP11-542P2.1-008	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LOC152586	Clone_based_vega_gene	protein_coding	OTTHUMT00000369949.1	A			141383121	-1	no_errors	ENST00000511113	ensembl	human	putative	70_37	missense	SNP	1.000	T
MGAT4D	152586	genome.wustl.edu	37	4	141403529	141403529	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:141403529G>A	ENST00000503109.2	-	2	204	c.205C>T	c.(205-207)Cga>Tga	p.R69*	RP11-542P2.1_ENST00000511113.1_Nonsense_Mutation_p.R69*|RP11-542P2.1_ENST00000515354.1_Nonsense_Mutation_p.R69*|RP11-542P2.1_ENST00000511632.1_Intron																							TACTTCATTCGATTCAAAACT	0.269																																																	0																																										SO:0001587	stop_gained	152586																														ENST00000503109.2:c.205C>T	4.37:g.141403529G>A	ENSP00000426225:p.Arg69*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Glyco_transf_54	p.R69*	ENST00000503109.2	37	c.205		4	.	.	.	.	.	.	.	.	.	.	G	12.99	2.102545	0.37145	.	.	ENSG00000205301	ENST00000515354;ENST00000511113;ENST00000503109	.	.	.	4.77	-3.09	0.05331	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.10902	T	0.67	1.2775	7.8741	0.29584	0.0:0.1936:0.4854:0.321	.	.	.	.	X	69	.	ENSP00000426225:R69X	R	-	1	2	RP11-542P2.1	141622979	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.166000	0.09954	-0.690000	0.05142	0.585000	0.79938	CGA	RP11-542P2.1	-	NULL		0.269	RP11-542P2.1-008	NOVEL	not_organism_supported|basic|appris_candidate_longest	protein_coding	LOC152586	Clone_based_vega_gene	protein_coding	OTTHUMT00000369949.1	G			141403529	-1	no_errors	ENST00000511113	ensembl	human	putative	70_37	nonsense	SNP	0.000	A
TENC1	23371	genome.wustl.edu	37	12	53439347	53439347	+	5'Flank	SNP	A	A	G	rs537201748	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:53439347A>G	ENST00000379902.3	+	0	0				RP11-983P16.4_ENST00000546793.1_RNA|RP11-983P16.4_ENST00000546767.1_RNA|RP11-983P16.4_ENST00000607643.1_RNA|RP11-983P16.4_ENST00000550601.1_RNA|RP11-983P16.4_ENST00000552905.1_RNA|RP11-983P16.4_ENST00000546566.1_RNA	NM_198316.1	NP_938072.1	Q63HR2	TENC1_HUMAN	tensin like C1 domain containing phosphatase (tensin 2)						cellular homeostasis (GO:0019725)|collagen metabolic process (GO:0032963)|intracellular signal transduction (GO:0035556)|kidney development (GO:0001822)|multicellular organism growth (GO:0035264)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|response to muscle activity (GO:0014850)	focal adhesion (GO:0005925)|plasma membrane (GO:0005886)	metal ion binding (GO:0046872)|phosphoprotein phosphatase activity (GO:0004721)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|liver(2)|lung(19)|ovary(1)|pancreas(1)|stomach(3)	34						CCAAATGCCAATTTCTGGGTG	0.517													A|||	67	0.0133786	0.0008	0.0159	5008	,	,		17906	0.0		0.0427	False		,,,				2504	0.0123																0																																										SO:0001631	upstream_gene_variant	283335			AF518729	CCDS8842.1, CCDS8843.1, CCDS8844.1	12q13.13	2013-02-14	2004-03-05			ENSG00000111077		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"", ""SH2 domain containing"""	19737	protein-coding gene	gene with protein product	"""tensin 2"""	607717	"""tensin like C1 domain-containing phosphatase"""				Standard	NM_015319		Approved	KIAA1075, C1-TEN, TNS2	uc001sbp.3	Q63HR2	OTTHUMG00000169730		12.37:g.53439347A>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDF2|A2VDF3|A2VDI8|A5PKY4|Q2NL80|Q76MW6|Q7Z5T9|Q8NFF9|Q8NFG0|Q96P25|Q9NT29|Q9UPS7	RNA	SNP	-	NULL	ENST00000379902.3	37	NULL	CCDS8844.1	12																																																																																			RP11-983P16.4	-	-		0.517	TENC1-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	LOC283335	Clone_based_vega_gene	protein_coding	OTTHUMT00000405644.4	A	NM_170754		53439347	-1	no_errors	ENST00000546793	ensembl	human	known	70_37	rna	SNP	0.001	G
U1	0	genome.wustl.edu	37	1	17198851	17198851	+	lincRNA	SNP	G	G	C	rs7364841	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:17198851G>C	ENST00000362684.1	+	0	0																											AGCTGCGGCCGGGTCGCTGCA	0.652																																																	0																																												440570																															1.37:g.17198851G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000362684.1	37	NULL		1																																																																																			RP11-108M9.3	-	-		0.652	U1.1-201	KNOWN	basic	snRNA	LOC440570	Clone_based_vega_gene	lincRNA		G			17198851	+1	no_errors	ENST00000438002	ensembl	human	known	70_37	rna	SNP	0.001	C
U1	0	genome.wustl.edu	37	1	17198882	17198882	+	lincRNA	SNP	C	C	T	rs7367174		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:17198882C>T	ENST00000362684.1	+	0	0																											GGCCTCCGGACTCGTGGCCTC	0.627																																																	0																																												440570																															1.37:g.17198882C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000362684.1	37	NULL		1																																																																																			RP11-108M9.3	-	-		0.627	U1.1-201	KNOWN	basic	snRNA	LOC440570	Clone_based_vega_gene	lincRNA		C			17198882	+1	no_errors	ENST00000438002	ensembl	human	known	70_37	rna	SNP	0.001	T
PLSCR2	57047	genome.wustl.edu	37	3	146113577	146113577	+	RNA	DEL	T	T	-	rs11340803|rs397797751	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:146113577delT	ENST00000490344.1	-	0	474																											GCATCAATGCTTTAATTTTAA	0.313													TTT|TTT|TT|deletion	2909	0.580871	0.4554	0.5922	5008	,	,		17246	0.5982		0.5646	False		,,,				2504	0.7413																0																																												440981																															3.37:g.146113577delT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL	ENST00000490344.1	37	NULL		3																																																																																			RP11-758I14.3	-	-		0.313	RP11-758I14.3-002	KNOWN	basic	processed_transcript	LOC440981	Clone_based_vega_gene	pseudogene	OTTHUMT00000355269.1	T			146113577	-1	no_errors	ENST00000490344	ensembl	human	known	70_37	rna	DEL	1.000	-
LOC729218	729218	genome.wustl.edu	37	4	119551832	119551832	+	lincRNA	SNP	G	G	A	rs201707823		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:119551832G>A	ENST00000567913.2	+	0	1343																											TTCTGAAGTCGACCTCACCAG	0.612																																																	0																																												729218																															4.37:g.119551832G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000567913.2	37	NULL		4																																																																																			RP11-384K6.6	-	-		0.612	RP11-384K6.6-001	KNOWN	basic	lincRNA	LOC729218	Clone_based_vega_gene	lincRNA	OTTHUMT00000364170.2	G			119551832	+1	no_errors	ENST00000567913	ensembl	human	known	70_37	rna	SNP	0.172	A
RP11-469N6.1	0	genome.wustl.edu	37	11	134605647	134605647	+	lincRNA	SNP	A	A	G	rs113767151	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:134605647A>G	ENST00000513405.1	+	0	158																											GCTGGGGTTCATGGGCAGAGT	0.627													N|||	2898	0.578674	0.6218	0.5865	5008	,	,		8811	0.6786		0.5318	False		,,,				2504	0.4601																0																																												729305																															11.37:g.134605647A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000513405.1	37	NULL		11																																																																																			RP11-469N6.1	-	-		0.627	RP11-469N6.1-001	KNOWN	basic|exp_conf	lincRNA	LOC729305	Clone_based_vega_gene	lincRNA	OTTHUMT00000382010.2	A			134605647	+1	no_errors	ENST00000513405	ensembl	human	putative	70_37	rna	SNP	0.010	G
RP11-469N6.1	0	genome.wustl.edu	37	11	134605754	134605754	+	lincRNA	SNP	C	C	T	rs377412522	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:134605754C>T	ENST00000513405.1	+	0	265																											AACTGGGGTTCGTGGGCAGAG	0.642													C|||	240	0.0479233	0.0363	0.0605	5008	,	,		16179	0.0129		0.1054	False		,,,				2504	0.0317																0																																												729305																															11.37:g.134605754C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000513405.1	37	NULL		11																																																																																			RP11-469N6.1	-	-		0.642	RP11-469N6.1-001	KNOWN	basic|exp_conf	lincRNA	LOC729305	Clone_based_vega_gene	lincRNA	OTTHUMT00000382010.2	C			134605754	+1	no_errors	ENST00000513405	ensembl	human	putative	70_37	rna	SNP	0.567	T
AC011718.2	0	genome.wustl.edu	37	22	20640559	20640559	+	lincRNA	SNP	A	A	G	rs376378248	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:20640559A>G	ENST00000577456.1	-	0	1001																											CCTCATTACCAATGCCTTGTA	0.468													G|||	972	0.194089	0.1309	0.1311	5008	,	,		28280	0.2341		0.1899	False		,,,				2504	0.2873																0																																												729461																															22.37:g.20640559A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000577456.1	37	NULL		22																																																																																			AC011718.2	-	-		0.468	AC011718.2-004	KNOWN	basic	lincRNA	LOC729461	Clone_based_vega_gene	lincRNA	OTTHUMT00000444810.1	A			20640559	-1	no_errors	ENST00000577456	ensembl	human	known	70_37	rna	SNP	0.961	G
LRRC37A	9884	genome.wustl.edu	37	17	44374710	44374710	+	Silent	SNP	A	A	G	rs62073222	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:44374710A>G	ENST00000320254.5	+	1	2214	c.2211A>G	c.(2209-2211)ccA>ccG	p.P737P	LRRC37A_ENST00000393465.3_Silent_p.P737P|LRRC37A_ENST00000496930.1_Intron|ARL17B_ENST00000570618.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	737						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		AGGTTAAACCATCTCCAACCA	0.517													.|||	3389	0.676717	0.3147	0.7046	5008	,	,		21665	0.8909		0.6789	False		,,,				2504	0.9233																0													1.0	1.0	1.0					17																	44374710		79	123	202	SO:0001819	synonymous_variant	9884			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.2211A>G	17.37:g.44374710A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DY2|Q8IWC7	Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.P737	ENST00000320254.5	37	c.2211	CCDS11504.2	17																																																																																			LRRC37A	-	NULL		0.517	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	HGNC	protein_coding	OTTHUMT00000313519.3	A	NM_014834		44374710	+1	no_errors	ENST00000320254	ensembl	human	known	70_37	silent	SNP	0.000	G
LRRC37A	9884	genome.wustl.edu	37	17	44374957	44374957	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:44374957G>C	ENST00000320254.5	+	1	2461	c.2458G>C	c.(2458-2460)Gag>Cag	p.E820Q	LRRC37A_ENST00000393465.3_Missense_Mutation_p.E820Q|LRRC37A_ENST00000496930.1_Intron|ARL17B_ENST00000570618.1_Intron	NM_014834.4	NP_055649.4	A6NMS7	L37A1_HUMAN	leucine rich repeat containing 37A	820						integral component of membrane (GO:0016021)				endometrium(1)|lung(2)|pancreas(6)|prostate(1)|skin(1)	11		Melanoma(429;0.211)		BRCA - Breast invasive adenocarcinoma(366;0.232)		AACTGCACCAGAGGAACACAA	0.493																																																	0													1.0	1.0	1.0					17																	44374957		13	15	28	SO:0001583	missense	9884			BC040501	CCDS11504.2	17q21.31	2014-04-01			ENSG00000176681	ENSG00000176681			29069	protein-coding gene	gene with protein product						9628581, 15533724	Standard	NM_014834		Approved	KIAA0563	uc031rbr.1	A6NMS7	OTTHUMG00000149841	ENST00000320254.5:c.2458G>C	17.37:g.44374957G>C	ENSP00000326324:p.Glu820Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q68DY2|Q8IWC7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.E820Q	ENST00000320254.5	37	c.2458	CCDS11504.2	17	.	.	.	.	.	.	.	.	.	.	g	3.046	-0.196370	0.06259	.	.	ENSG00000176681	ENST00000393466;ENST00000393465;ENST00000320254	T;T	0.60920	0.16;0.15	2.36	-1.58	0.08479	.	.	.	.	.	T	0.43545	0.1252	L	0.52573	1.65	0.09310	N	1	B	0.12630	0.006	B	0.10450	0.005	T	0.29212	-1.0019	9	0.28530	T	0.3	.	3.9209	0.09244	0.333:0.3054:0.3616:0.0	.	820	A6NMS7	L37A1_HUMAN	Q	820	ENSP00000377108:E820Q;ENSP00000326324:E820Q	ENSP00000326324:E820Q	E	+	1	0	LRRC37A	41730734	0.000000	0.05858	0.000000	0.03702	0.033000	0.12548	-0.338000	0.07842	-0.325000	0.08577	0.175000	0.17021	GAG	LRRC37A	-	NULL		0.493	LRRC37A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LRRC37A	HGNC	protein_coding	OTTHUMT00000313519.3	G	NM_014834		44374957	+1	no_errors	ENST00000320254	ensembl	human	known	70_37	missense	SNP	0.000	C
LRWD1	222229	genome.wustl.edu	37	7	102108823	102108823	+	Splice_Site	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:102108823G>C	ENST00000292616.5	+	7	1070	c.918G>C	c.(916-918)gaG>gaC	p.E306D	MIR5090_ENST00000582533.1_RNA	NM_152892.1	NP_690852.1	Q9UFC0	LRWD1_HUMAN	leucine-rich repeats and WD repeat domain containing 1	306					chromatin modification (GO:0016568)|chromatin organization (GO:0006325)|DNA replication initiation (GO:0006270)|establishment of protein localization to chromatin (GO:0071169)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nuclear origin of replication recognition complex (GO:0005664)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)|telomeric heterochromatin (GO:0031933)	chromatin binding (GO:0003682)|methyl-CpG binding (GO:0008327)|methylated histone binding (GO:0035064)			central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(1)|skin(1)|stomach(2)	20						CCTGGGAGGAGGGTACATGGT	0.657																																																	0													16.0	18.0	18.0					7																	102108823		2199	4290	6489	SO:0001630	splice_region_variant	222229			AL133057	CCDS34715.1	7q22.1	2013-01-10			ENSG00000161036	ENSG00000161036		"""WD repeat domain containing"""	21769	protein-coding gene	gene with protein product	"""origin recognition complex associated"", ""centromere protein 33"""	615167				20932478, 20850016, 20180869	Standard	NM_152892		Approved	DKFZp434K1815, ORCA, CENP-33	uc003uzn.3	Q9UFC0	OTTHUMG00000157718	ENST00000292616.5:c.919+1G>C	7.37:g.102108823G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4K2|B2R9G2|Q8N0T9|Q8WV43|Q96GJ2	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Leu-rich_rpt,superfamily_WD40_repeat_dom,smart_Leu-rich_rpt_typical-subtyp,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E306D	ENST00000292616.5	37	c.918	CCDS34715.1	7	.	.	.	.	.	.	.	.	.	.	G	0.126	-1.119511	0.01785	.	.	ENSG00000161036	ENST00000292616	T	0.61627	0.09	5.04	2.06	0.26882	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.648004	0.17135	N	0.185663	T	0.29491	0.0735	N	0.10874	0.06	0.28364	N	0.920315	B	0.16166	0.016	B	0.10450	0.005	T	0.16305	-1.0407	10	0.11794	T	0.64	-1.1101	4.8886	0.13715	0.2029:0.3737:0.4234:0.0	.	306	Q9UFC0	LRWD1_HUMAN	D	306	ENSP00000292616:E306D	ENSP00000292616:E306D	E	+	3	2	LRWD1	101895828	1.000000	0.71417	0.983000	0.44433	0.097000	0.18754	0.302000	0.19192	0.688000	0.31529	0.561000	0.74099	GAG	LRWD1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.657	LRWD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRWD1	HGNC	protein_coding	OTTHUMT00000349493.1	G	NM_152892	Missense_Mutation	102108823	+1	no_errors	ENST00000292616	ensembl	human	known	70_37	missense	SNP	0.922	C
LTF	4057	genome.wustl.edu	37	3	46480801	46480801	+	Silent	SNP	A	A	G	rs9110	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:46480801A>G	ENST00000231751.4	-	15	2189	c.1894T>C	c.(1894-1896)Ttg>Ctg	p.L632L	LTF_ENST00000426532.2_Silent_p.L588L|LTF_ENST00000417439.1_Silent_p.L630L|LTF_ENST00000493056.1_5'UTR	NM_002343.3	NP_002334.2	P02788	TRFL_HUMAN	lactotransferrin	632	Transferrin-like 2. {ECO:0000255|PROSITE- ProRule:PRU00741}.				antibacterial humoral response (GO:0019731)|antifungal humoral response (GO:0019732)|bone morphogenesis (GO:0060349)|humoral immune response (GO:0006959)|innate immune response in mucosa (GO:0002227)|interaction with host (GO:0051701)|iron assimilation by chelation and transport (GO:0033214)|iron ion transport (GO:0006826)|negative regulation of apoptotic process (GO:0043066)|negative regulation of lipopolysaccharide-mediated signaling pathway (GO:0031665)|negative regulation of osteoclast development (GO:2001205)|negative regulation of single-species biofilm formation in or on host organism (GO:1900229)|negative regulation of tumor necrosis factor (ligand) superfamily member 11 production (GO:2000308)|ossification (GO:0001503)|phagosome maturation (GO:0090382)|positive regulation of bone mineralization involved in bone maturation (GO:1900159)|positive regulation of chondrocyte proliferation (GO:1902732)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoblast proliferation (GO:0033690)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of toll-like receptor 4 signaling pathway (GO:0034145)|regulation of cytokine production (GO:0001817)|regulation of tumor necrosis factor production (GO:0032680)|response to host immune response (GO:0052572)|retina homeostasis (GO:0001895)|transcription, DNA-templated (GO:0006351)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|phagocytic vesicle lumen (GO:0097013)|secretory granule (GO:0030141)|specific granule (GO:0042581)	DNA binding (GO:0003677)|ferric iron binding (GO:0008199)|heparin binding (GO:0008201)|iron ion binding (GO:0005506)|protein serine/threonine kinase activator activity (GO:0043539)|serine-type endopeptidase activity (GO:0004252)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(4)|kidney(3)|large_intestine(5)|lung(13)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)	40				all cancers(1;7.55e-14)|GBM - Glioblastoma multiforme(1;2.1e-09)|Epithelial(1;9.25e-07)|Colorectal(1;3.81e-05)|BRCA - Breast invasive adenocarcinoma(193;0.00129)|COAD - Colon adenocarcinoma(1;0.00308)|KIRC - Kidney renal clear cell carcinoma(197;0.0205)|Kidney(197;0.0242)|OV - Ovarian serous cystadenocarcinoma(275;0.089)		TGGTGGAGCAACACCTGTTTC	0.552													G|||	2617	0.522564	0.6452	0.3991	5008	,	,		21524	0.6349		0.3131	False		,,,				2504	0.544																0			GRCh37	CM073189	LTF	M	rs9110	G	,	2549,1857	537.9+/-374.9	733,1083,387	139.0	106.0	117.0		1762,1894	5.1	0.3	3	dbSNP_52	117	2432,6168	698.1+/-405.0	347,1738,2215	no	coding-synonymous,coding-synonymous	LTF	NM_001199149.1,NM_002343.3	,	1080,2821,2602	GG,GA,AA		28.2791,42.1471,38.2977	,	588/667,632/711	46480801	4981,8025	2203	4300	6503	SO:0001819	synonymous_variant	4057				CCDS33747.1, CCDS56251.1	3p21.31	2012-10-02			ENSG00000012223	ENSG00000012223			6720	protein-coding gene	gene with protein product		150210				17476971, 3356163	Standard	NM_001199149		Approved	HLF2	uc003cpq.3	P02788	OTTHUMG00000156325	ENST00000231751.4:c.1894T>C	3.37:g.46480801A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9U8|B2MV13|B7Z4X2|E7EQH5|O00756|Q16780|Q16785|Q16786|Q16789|Q5DSM0|Q8IU92|Q8IZH6|Q8TCD2|Q96KZ4|Q96KZ5|Q9H1Z3|Q9UCY5	Silent	SNP	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin,prints_Transferrin_fam	p.L632	ENST00000231751.4	37	c.1894	CCDS33747.1	3																																																																																			LTF	-	pfam_Transferrin_fam,smart_Transferrin_fam,pirsf_Transferrin		0.552	LTF-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LTF	HGNC	protein_coding	OTTHUMT00000343951.2	A	NM_002343		46480801	-1	no_errors	ENST00000231751	ensembl	human	known	70_37	silent	SNP	0.948	G
MAGEB6	158809	genome.wustl.edu	37	X	26212614	26212614	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:26212614G>A	ENST00000379034.1	+	2	800	c.651G>A	c.(649-651)ttG>ttA	p.L217L		NM_173523.2	NP_775794.2	Q8N7X4	MAGB6_HUMAN	melanoma antigen family B, 6	217	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.									breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|liver(1)|lung(18)|ovary(3)|prostate(2)	33						AGTCCATTTTGAAGGCAGACA	0.478																																																	0													85.0	72.0	76.0					X																	26212614		2202	4300	6502	SO:0001819	synonymous_variant	158809			AF320514	CCDS14217.1	Xp22.12	2009-03-17			ENSG00000176746	ENSG00000176746			23796	protein-coding gene	gene with protein product	"""cancer/testis antigen family 3, member 4"""	300467				10861452	Standard	NM_173523		Approved	FLJ40242, MAGE-B6, MAGEB6A, CT3.4	uc004dbr.3	Q8N7X4	OTTHUMG00000021285	ENST00000379034.1:c.651G>A	X.37:g.26212614G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GS19|Q9H219	Silent	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.L217	ENST00000379034.1	37	c.651	CCDS14217.1	X																																																																																			MAGEB6	-	pfam_MAGE,pfscan_MAGE		0.478	MAGEB6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEB6	HGNC	protein_coding	OTTHUMT00000056123.1	G	NM_173523		26212614	+1	no_errors	ENST00000379034	ensembl	human	known	70_37	silent	SNP	0.000	A
MAP1B	4131	genome.wustl.edu	37	5	71411577	71411577	+	Silent	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:71411577C>G	ENST00000296755.7	+	2	535	c.237C>G	c.(235-237)ctC>ctG	p.L79L	MAP1B_ENST00000504183.1_3'UTR	NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	79					axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		ACCAAGAACTCAAACTTTTTG	0.463																																					Melanoma(17;367 822 11631 31730 47712)												0													151.0	137.0	141.0					5																	71411577		2203	4300	6503	SO:0001819	synonymous_variant	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.237C>G	5.37:g.71411577C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.L79	ENST00000296755.7	37	c.237	CCDS4012.1	5																																																																																			MAP1B	-	NULL		0.463	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	C	NM_005909		71411577	+1	no_errors	ENST00000296755	ensembl	human	known	70_37	silent	SNP	1.000	G
MAN2A1	4124	genome.wustl.edu	37	5	109110547	109110547	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:109110547C>T	ENST00000261483.4	+	8	2307	c.1255C>T	c.(1255-1257)Ctc>Ttc	p.L419F		NM_002372.2	NP_002363.2	Q16706	MA2A1_HUMAN	mannosidase, alpha, class 2A, member 1	419					cellular protein metabolic process (GO:0044267)|in utero embryonic development (GO:0001701)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|mannose metabolic process (GO:0006013)|mitochondrion organization (GO:0007005)|N-glycan processing (GO:0006491)|positive regulation of neurogenesis (GO:0050769)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)|respiratory gaseous exchange (GO:0007585)|retina morphogenesis in camera-type eye (GO:0060042)|vacuole organization (GO:0007033)	cis-Golgi network (GO:0005801)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|hydrolase activity, hydrolyzing N-glycosyl compounds (GO:0016799)|mannosyl-oligosaccharide 1,3-1,6-alpha-mannosidase activity (GO:0004572)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|endometrium(7)|kidney(2)|large_intestine(13)|lung(20)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	55		all_cancers(142;8.66e-07)|all_epithelial(76;7.73e-09)|Prostate(80;0.000303)|Lung NSC(167;0.0186)|all_lung(232;0.0241)|Ovarian(225;0.0444)|Colorectal(57;0.0959)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;2.17e-10)|Epithelial(69;1.37e-09)|COAD - Colon adenocarcinoma(37;0.141)		TACCAAAGTTCTCCTGGCTCC	0.363																																																	0													74.0	75.0	75.0					5																	109110547		2202	4300	6502	SO:0001583	missense	4124				CCDS34209.1	5q21.3	2013-09-20			ENSG00000112893	ENSG00000112893	3.2.1.114		6824	protein-coding gene	gene with protein product	"""golgi integral membrane protein 7"""	154582		MANA2		1757461, 15004235	Standard	NM_002372		Approved	GOLIM7	uc003kou.1	Q16706	OTTHUMG00000162834	ENST00000261483.4:c.1255C>T	5.37:g.109110547C>T	ENSP00000261483:p.Leu419Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16767	Missense_Mutation	SNP	pfam_Glyco_hydro_38_core,pfam_Glyco_hydro_38_C,pfam_Glyco_hydro_38_cen_dom,superfamily_Glyco_hydro-type_carb-bd,superfamily_Glyco_hydro/deAcase_b/a-brl,smart_Glyco_hydro_38_cen_dom	p.L419F	ENST00000261483.4	37	c.1255	CCDS34209.1	5	.	.	.	.	.	.	.	.	.	.	C	18.97	3.736524	0.69304	.	.	ENSG00000112893	ENST00000261483	T	0.29397	1.57	5.95	0.797	0.18654	Glycoside hydrolase/deacetylase, beta/alpha-barrel (1);Glycoside hydrolase, family 38, core (2);	0.320185	0.34338	N	0.004051	T	0.64450	0.2599	H	0.94582	3.555	0.53005	D	0.999968	D	0.55605	0.972	D	0.72075	0.976	T	0.74618	-0.3605	10	0.72032	D	0.01	-3.0672	15.4961	0.75653	0.0:0.3082:0.6297:0.0621	.	419	Q16706	MA2A1_HUMAN	F	419	ENSP00000261483:L419F	ENSP00000261483:L419F	L	+	1	0	MAN2A1	109138446	0.361000	0.24972	0.243000	0.24186	0.844000	0.47949	0.632000	0.24583	-0.153000	0.11137	0.563000	0.77884	CTC	MAN2A1	-	pfam_Glyco_hydro_38_core,superfamily_Glyco_hydro/deAcase_b/a-brl		0.363	MAN2A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN2A1	HGNC	protein_coding	OTTHUMT00000370680.1	C			109110547	+1	no_errors	ENST00000261483	ensembl	human	known	70_37	missense	SNP	0.885	T
MAP2K3	5606	genome.wustl.edu	37	17	21215457	21215457	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:21215457G>C	ENST00000342679.4	+	10	1027	c.778G>C	c.(778-780)Gag>Cag	p.E260Q	MAP2K3_ENST00000361818.5_Missense_Mutation_p.E231Q|MAP2K3_ENST00000316920.6_Missense_Mutation_p.E231Q	NM_145109.2	NP_659731.1	P46734	MP2K3_HUMAN	mitogen-activated protein kinase kinase 3	260	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of MAPK activity (GO:0000187)|cardiac muscle contraction (GO:0060048)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokine biosynthetic process (GO:0042035)|signal transduction (GO:0007165)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|MAP kinase kinase activity (GO:0004708)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)								COAD - Colon adenocarcinoma(3;0.0131)|Colorectal(15;0.0553)		GCTGCAGATTGAGATGGCCAT	0.682																																																	0													59.0	59.0	59.0					17																	21215457		2203	4300	6503	SO:0001583	missense	5606			L36719	CCDS11217.1, CCDS11218.1	17q11.2	2011-06-09			ENSG00000034152	ENSG00000034152		"""Mitogen-activated protein kinase cascade / Kinase kinases"""	6843	protein-coding gene	gene with protein product	"""MAPK/ERK kinase 3"", ""MAP kinase kinase 3"", ""dual specificity mitogen activated protein kinase kinase 3"""	602315		PRKMK3		9465908	Standard	NM_145109		Approved	MEK3, MKK3, MAPKK3	uc002gys.3	P46734	OTTHUMG00000134322	ENST00000342679.4:c.778G>C	17.37:g.21215457G>C	ENSP00000345083:p.Glu260Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSK7|Q99441|Q9UE71|Q9UE72	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E260Q	ENST00000342679.4	37	c.778	CCDS11217.1	17	.	.	.	.	.	.	.	.	.	.	G	26.5	4.743528	0.89663	.	.	ENSG00000034152	ENST00000342679;ENST00000395491;ENST00000361818;ENST00000316920	T;T	0.55760	0.5;0.5	5.84	5.84	0.93424	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000004	T	0.77267	0.4105	M	0.85197	2.74	0.80722	D	1	D	0.76494	0.999	D	0.73380	0.98	T	0.79787	-0.1656	10	0.87932	D	0	-51.728	20.1306	0.97998	0.0:0.0:1.0:0.0	.	260	P46734	MP2K3_HUMAN	Q	260;231;231;264	ENSP00000345083:E260Q;ENSP00000355081:E231Q	ENSP00000319139:E264Q	E	+	1	0	MAP2K3	21156050	1.000000	0.71417	0.978000	0.43139	0.603000	0.37013	9.690000	0.98676	2.751000	0.94390	0.655000	0.94253	GAG	MAP2K3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.682	MAP2K3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP2K3	HGNC	protein_coding	OTTHUMT00000259374.2	G	NM_145109		21215457	+1	no_errors	ENST00000342679	ensembl	human	known	70_37	missense	SNP	1.000	C
MAP4	4134	genome.wustl.edu	37	3	47956424	47956424	+	Missense_Mutation	SNP	C	C	T	rs1137524	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:47956424C>T	ENST00000360240.6	-	8	2400	c.1882G>A	c.(1882-1884)Gtc>Atc	p.V628I	MAP4_ENST00000426837.2_Missense_Mutation_p.V645I|MAP4_ENST00000395734.3_Missense_Mutation_p.V628I|MAP4_ENST00000383737.4_Intron	NM_002375.4	NP_002366.2	P27816	MAP4_HUMAN	microtubule-associated protein 4	628			V -> I (in dbSNP:rs1137524). {ECO:0000269|PubMed:1718985, ECO:0000269|PubMed:18669648, ECO:0000269|PubMed:20068231}.		cell division (GO:0051301)|establishment of spindle orientation (GO:0051294)|microtubule sliding (GO:0051012)|mitotic spindle organization (GO:0007052)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|mitotic spindle (GO:0072686)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|structural molecule activity (GO:0005198)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(2)	32				BRCA - Breast invasive adenocarcinoma(193;0.000721)|KIRC - Kidney renal clear cell carcinoma(197;0.00641)|Kidney(197;0.00736)	Docetaxel(DB01248)|Paclitaxel(DB01229)	GTTCCTGTGACGGTTTCTAAA	0.443													C|||	1947	0.388778	0.5628	0.3963	5008	,	,		18715	0.2847		0.3002	False		,,,				2504	0.3466																0								C	ILE/VAL,ILE/VAL	2353,2053	607.5+/-391.0	627,1099,477	127.0	132.0	130.0		1882,1882	0.4	0.0	3	dbSNP_86	130	2696,5904	431.8+/-356.9	429,1838,2033	yes	missense,missense	MAP4	NM_001134364.1,NM_002375.4	29,29	1056,2937,2510	TT,TC,CC		31.3488,46.5956,38.8205	probably-damaging,probably-damaging	628/1136,628/1153	47956424	5049,7957	2203	4300	6503	SO:0001583	missense	4134				CCDS33750.1, CCDS46818.1, CCDS46821.1	3p21	2008-07-18			ENSG00000047849	ENSG00000047849			6862	protein-coding gene	gene with protein product		157132				1905296	Standard	NM_002375		Approved		uc003csb.2	P27816	OTTHUMG00000156828	ENST00000360240.6:c.1882G>A	3.37:g.47956424C>T	ENSP00000353375:p.Val628Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13082|Q59FT2|Q68D74|Q6ZUW9|Q86V26|Q96A76|Q96NS9	Missense_Mutation	SNP	pfam_Tau/MAP_tubulin-bd_rpt	p.V628I	ENST00000360240.6	37	c.1882	CCDS33750.1	3	736	0.336996336996337	242	0.491869918699187	129	0.356353591160221	144	0.2517482517482518	221	0.29155672823219	C	6.223	0.409250	0.11812	0.534044	0.313488	ENSG00000047849	ENST00000395734;ENST00000426837;ENST00000360240	T;T;T	0.10192	3.1;2.9;3.1	4.42	0.416	0.16416	.	.	.	.	.	T	0.00012	0.0000	M	0.72118	2.19	0.80722	P	0.0	B;B;P	0.35208	0.137;0.216;0.49	B;B;B	0.22152	0.017;0.024;0.038	T	0.40496	-0.9560	8	0.34782	T	0.22	-1.0291	1.6979	0.02866	0.1672:0.4786:0.1625:0.1917	rs1137524;rs2230170;rs3201296;rs6442089;rs11548143;rs17434449;rs52792140;rs59940954;rs6442089	605;628;628	C9JFC3;P27816-6;P27816	.;.;MAP4_HUMAN	I	628;645;628	ENSP00000379083:V628I;ENSP00000407602:V645I;ENSP00000353375:V628I	ENSP00000353375:V628I	V	-	1	0	MAP4	47931428	0.019000	0.18553	0.014000	0.15608	0.015000	0.08874	-0.083000	0.11286	-0.054000	0.13266	-1.067000	0.02272	GTC	MAP4	-	NULL		0.443	MAP4-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP4	HGNC	protein_coding	OTTHUMT00000346085.1	C	NM_002375		47956424	-1	no_errors	ENST00000360240	ensembl	human	known	70_37	missense	SNP	0.021	T
MAP4K1	11184	genome.wustl.edu	37	19	39096337	39096337	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:39096337C>T	ENST00000591517.1	-	18	1262	c.1234G>A	c.(1234-1236)Ggg>Agg	p.G412R	MAP4K1_ENST00000423454.2_Missense_Mutation_p.G74R|MAP4K1_ENST00000589130.1_Missense_Mutation_p.G408R|MAP4K1_ENST00000396857.2_Missense_Mutation_p.G412R|MAP4K1_ENST00000586296.1_Intron|MAP4K1_ENST00000589002.1_5'Flank	NM_007181.4	NP_009112.1	Q92918	M4K1_HUMAN	mitogen-activated protein kinase kinase kinase kinase 1	412					activation of JUN kinase activity (GO:0007257)|activation of MAPKKK activity (GO:0000185)|cell proliferation (GO:0008283)|intracellular signal transduction (GO:0035556)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|response to stress (GO:0006950)	membrane (GO:0016020)	ATP binding (GO:0005524)|MAP kinase kinase kinase kinase activity (GO:0008349)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|small GTPase regulator activity (GO:0005083)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(24)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(1)	44	all_cancers(60;6.42e-06)|Ovarian(47;0.103)		Lung(45;0.000751)|LUSC - Lung squamous cell carcinoma(53;0.00272)			CCCATGCTCCCAGGACCCTCG	0.627																																																	0													15.0	16.0	16.0					19																	39096337		1948	4081	6029	SO:0001583	missense	11184			U66464	CCDS42564.1, CCDS59385.1	19q13.1-q13.4	2011-06-09				ENSG00000104814	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinase kinase kinase kinases"""	6863	protein-coding gene	gene with protein product	"""hematopoietic progenitor kinase 1"""	601983				8824585	Standard	NM_001042600		Approved	HPK1	uc002oix.1	Q92918		ENST00000591517.1:c.1234G>A	19.37:g.39096337C>T	ENSP00000465039:p.Gly412Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Citron,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Citron,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G412R	ENST00000591517.1	37	c.1234	CCDS59385.1	19	.	.	.	.	.	.	.	.	.	.	.	11.19	1.566044	0.27915	.	.	ENSG00000104814	ENST00000396857;ENST00000221409;ENST00000423454	T;T	0.23950	1.88;2.88	3.92	2.87	0.33458	.	1.966200	0.02171	N	0.059702	T	0.39332	0.1074	N	0.24115	0.695	0.21105	N	0.999787	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.998;0.999;0.997	T	0.32402	-0.9908	10	0.62326	D	0.03	.	7.9653	0.30095	0.0:0.8783:0.0:0.1217	.	74;412;412	B4E087;Q92918-2;Q92918	.;.;M4K1_HUMAN	R	412;412;74	ENSP00000380066:G412R;ENSP00000396383:G74R	ENSP00000221409:G412R	G	-	1	0	MAP4K1	43788177	0.001000	0.12720	0.101000	0.21167	0.245000	0.25701	0.617000	0.24359	0.951000	0.37770	0.462000	0.41574	GGG	MAP4K1	-	NULL		0.627	MAP4K1-002	KNOWN	basic|CCDS	protein_coding	MAP4K1	HGNC	protein_coding	OTTHUMT00000453390.1	C	NM_001042600		39096337	-1	no_errors	ENST00000591517	ensembl	human	known	70_37	missense	SNP	0.354	T
MAP7	9053	genome.wustl.edu	37	6	136687065	136687065	+	Missense_Mutation	SNP	C	C	T	rs35350783	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:136687065C>T	ENST00000354570.3	-	10	1491	c.1081G>A	c.(1081-1083)Gtc>Atc	p.V361I	RP3-406A7.3_ENST00000571188.1_RNA|MAP7_ENST00000454590.1_Missense_Mutation_p.V383I|MAP7_ENST00000432797.2_Missense_Mutation_p.V215I|MAP7_ENST00000544465.1_Missense_Mutation_p.V346I|MAP7_ENST00000438100.2_Missense_Mutation_p.V346I	NM_001198616.1|NM_001198617.1|NM_001198619.1|NM_003980.4	NP_001185545.1|NP_001185546.1|NP_001185548.1|NP_003971.1	Q14244	MAP7_HUMAN	microtubule-associated protein 7	361	Pro-rich.		V -> I (in dbSNP:rs35350783).		cell morphogenesis (GO:0000902)|cell proliferation (GO:0008283)|establishment or maintenance of cell polarity (GO:0007163)|fertilization (GO:0009566)|germ cell development (GO:0007281)|glycosphingolipid metabolic process (GO:0006687)|homeostasis of number of cells (GO:0048872)|Leydig cell differentiation (GO:0033327)|microtubule bundle formation (GO:0001578)|microtubule cytoskeleton organization (GO:0000226)|nucleus organization (GO:0006997)|organ growth (GO:0035265)|protein localization to plasma membrane (GO:0072659)|response to osmotic stress (GO:0006970)|response to retinoic acid (GO:0032526)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|microtubule cytoskeleton (GO:0015630)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)|structural molecule activity (GO:0005198)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(11)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	Colorectal(23;0.24)			GBM - Glioblastoma multiforme(68;0.00199)|OV - Ovarian serous cystadenocarcinoma(155;0.00643)		GGGGGCCGGACCTGAGCAGGA	0.587													C|||	69	0.013778	0.0	0.0245	5008	,	,		16642	0.0		0.0398	False		,,,				2504	0.0123																0								C	ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL,ILE/VAL	25,4381	31.7+/-61.6	1,23,2179	67.0	69.0	68.0		1147,1171,1036,1147,1036,970,799,643,643,1081	0.8	0.1	6	dbSNP_126	68	312,8288	111.8+/-172.0	5,302,3993	yes	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	MAP7	NM_001198608.1,NM_001198609.1,NM_001198611.1,NM_001198614.1,NM_001198615.1,NM_001198616.1,NM_001198617.1,NM_001198618.1,NM_001198619.1,NM_003980.4	29,29,29,29,29,29,29,29,29,29	6,325,6172	TT,TC,CC		3.6279,0.5674,2.5911	benign,benign,benign,benign,benign,benign,benign,benign,benign,benign	383/772,391/780,346/735,383/772,346/735,324/713,267/656,215/604,215/604,361/750	136687065	337,12669	2203	4300	6503	SO:0001583	missense	9053			X73882	CCDS5178.1, CCDS56452.1, CCDS56453.1, CCDS56454.1, CCDS56455.1, CCDS75527.1, CCDS75528.1, CCDS75529.1	6q23.2	2008-07-28			ENSG00000135525	ENSG00000135525			6869	protein-coding gene	gene with protein product		604108				8408219	Standard	NM_003980		Approved	E-MAP-115	uc011edg.2	Q14244	OTTHUMG00000015646	ENST00000354570.3:c.1081G>A	6.37:g.136687065C>T	ENSP00000346581:p.Val361Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z290|B7Z400|B7Z5S7|B7Z9U7|C9JPS0|E9PCP3|F5H1E2|Q7Z6S0|Q8TAU5|Q9NY82|Q9NY83	Missense_Mutation	SNP	pfam_E-MAP-115	p.V383I	ENST00000354570.3	37	c.1147	CCDS5178.1	6	45	0.020604395604395604	0	0.0	12	0.03314917127071823	0	0.0	33	0.04353562005277045	C	14.10	2.435414	0.43224	0.005674	0.036279	ENSG00000135525	ENST00000354570;ENST00000454590;ENST00000544465;ENST00000438100;ENST00000432797;ENST00000345567	T;T;T;T;T	0.08896	3.04;3.04;3.04;3.04;3.04	5.8	0.749	0.18381	.	1.589500	0.03691	N	0.247014	T	0.02193	0.0068	L	0.33485	1.01	0.09310	N	1	B;B;B;B;B;B;B	0.02656	0.0;0.0;0.0;0.0;0.0;0.0;0.0	B;B;B;B;B;B;B	0.04013	0.0;0.0;0.001;0.0;0.001;0.001;0.0	T	0.43637	-0.9379	10	0.38643	T	0.18	1.2411	6.2258	0.20708	0.0:0.3989:0.3265:0.2746	rs35350783	346;383;346;383;267;324;361	B7Z290;B7ZB64;F5H1E2;E9PCP3;F8W783;Q14244-2;Q14244	.;.;.;.;.;.;MAP7_HUMAN	I	361;383;346;346;215;267	ENSP00000346581:V361I;ENSP00000414712:V383I;ENSP00000445737:V346I;ENSP00000400790:V346I;ENSP00000414879:V215I	ENSP00000344217:V267I	V	-	1	0	MAP7	136728758	0.012000	0.17670	0.126000	0.21872	0.948000	0.59901	-0.066000	0.11598	0.100000	0.17581	0.650000	0.86243	GTC	MAP7	-	NULL		0.587	MAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP7	HGNC	protein_coding	OTTHUMT00000042382.2	C	NM_003980		136687065	-1	no_errors	ENST00000454590	ensembl	human	known	70_37	missense	SNP	0.014	T
MAST2	23139	genome.wustl.edu	37	1	46500934	46500934	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:46500934G>C	ENST00000361297.2	+	29	4876	c.4593G>C	c.(4591-4593)caG>caC	p.Q1531H	MAST2_ENST00000372009.2_Missense_Mutation_p.Q1341H	NM_015112.2	NP_055927.2			microtubule associated serine/threonine kinase 2											breast(1)|lung(3)|ovary(5)|stomach(2)	11	Acute lymphoblastic leukemia(166;0.155)|Lung SC(450;0.184)					AAGTGAGCCAGAGTGTGGCCC	0.602																																																	0													29.0	33.0	32.0					1																	46500934		2093	4218	6311	SO:0001583	missense	23139			AB047005	CCDS41326.1	1p34.1	2008-02-05			ENSG00000086015	ENSG00000086015			19035	protein-coding gene	gene with protein product		612257					Standard	NM_015112		Approved	MAST205, KIAA0807	uc001cov.3	Q6P0Q8	OTTHUMG00000008007	ENST00000361297.2:c.4593G>C	1.37:g.46500934G>C	ENSP00000354671:p.Gln1531His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_MA_Ser/Thr_Kinase_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_PDZ,superfamily_Kinase-like_dom,superfamily_MAST_pre-PK_dom,superfamily_PDZ,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_PDZ,pfscan_PDZ,pfscan_Prot_kinase_cat_dom	p.Q1531H	ENST00000361297.2	37	c.4593	CCDS41326.1	1	.	.	.	.	.	.	.	.	.	.	g	2.744	-0.261549	0.05791	.	.	ENSG00000086015	ENST00000361297;ENST00000372009;ENST00000456625	T;T	0.63913	-0.02;-0.07	4.82	2.76	0.32466	.	0.629264	0.13493	N	0.383847	T	0.41119	0.1145	N	0.12182	0.205	0.09310	N	0.999999	B;B	0.06786	0.001;0.001	B;B	0.04013	0.001;0.001	T	0.26916	-1.0089	10	0.41790	T	0.15	-8.2246	8.324	0.32145	0.1348:0.1551:0.7101:0.0	.	1341;1531	E7ERL6;Q6P0Q8	.;MAST2_HUMAN	H	1531;1341;218	ENSP00000354671:Q1531H;ENSP00000361079:Q1341H	ENSP00000354671:Q1531H	Q	+	3	2	MAST2	46273521	0.381000	0.25140	0.879000	0.34478	0.040000	0.13550	1.368000	0.34216	1.224000	0.43551	0.454000	0.30748	CAG	MAST2	-	NULL		0.602	MAST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAST2	HGNC	protein_coding	OTTHUMT00000021977.1	G	NM_015112		46500934	+1	no_errors	ENST00000361297	ensembl	human	known	70_37	missense	SNP	0.725	C
MATN2	4147	genome.wustl.edu	37	8	99006749	99006749	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:99006749G>A	ENST00000520016.1	+	6	1247	c.1123G>A	c.(1123-1125)Gag>Aag	p.E375K	MATN2_ENST00000521689.1_Missense_Mutation_p.E375K|MATN2_ENST00000524308.1_Intron|MATN2_ENST00000522025.2_Missense_Mutation_p.E91K|MATN2_ENST00000254898.5_Missense_Mutation_p.E375K			O00339	MATN2_HUMAN	matrilin 2	375	EGF-like 4. {ECO:0000255|PROSITE- ProRule:PRU00076}.					proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)			breast(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(17)|ovary(2)|urinary_tract(1)	31	Breast(36;1.43e-06)		OV - Ovarian serous cystadenocarcinoma(57;0.244)			ATGTCAGCACGAGTGTGTTAA	0.423																																																	0													173.0	170.0	171.0					8																	99006749		1949	4141	6090	SO:0001583	missense	4147			U69263	CCDS55264.1, CCDS55265.1	8q22.1-q22.2	2008-05-15							6908	protein-coding gene	gene with protein product		602108				9083061, 11852232	Standard	XM_005250920		Approved		uc003yic.3	O00339		ENST00000520016.1:c.1123G>A	8.37:g.99006749G>A	ENSP00000430487:p.Glu375Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K106|E7EW74|E9PD48|E9PGL2|Q6UWA5|Q7Z5X1|Q8NDE6|Q96FT5|Q9NSZ1	Missense_Mutation	SNP	pfam_VWF_A,pfam_EGF-like_Ca-bd,pfam_EG-like_dom,pfam_Matrilin_coiled-coil_trimer,smart_VWF_A,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_VWF_A	p.E375K	ENST00000520016.1	37	c.1123	CCDS55264.1	8	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.34|15.34	2.805771|2.805771	0.50421|0.50421	.|.	.|.	ENSG00000132561|ENSG00000132561	ENST00000521689;ENST00000254898;ENST00000522025;ENST00000520016;ENST00000519585;ENST00000522270|ENST00000518154;ENST00000521041	D;D;D;D;D;D|.	0.96265|.	-3.96;-3.96;-2.23;-3.96;-2.23;-3.96|.	5.73|5.73	5.73|5.73	0.89815|0.89815	EGF-like calcium-binding (2);Epidermal growth factor-like, type 3 (1);|.	0.000000|.	0.56097|.	D|.	0.000030|.	T|T	0.47948|0.47948	0.1473|0.1473	N|N	0.11698|0.11698	0.16|0.16	0.48511|0.48511	D|D	0.999665|0.999665	D;D;D;D|.	0.76494|.	0.994;0.983;0.996;0.999|.	P;P;P;D|.	0.63597|.	0.849;0.652;0.893;0.916|.	T|T	0.41858|0.41858	-0.9485|-0.9485	10|5	0.16896|.	T|.	0.51|.	-26.3085|-26.3085	16.8302|16.8302	0.85942|0.85942	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	375;375;375;375|.	E9PF03;O00339-2;O00339;Q8N2G3|.	.;.;MATN2_HUMAN;.|.	K|Q	375;375;91;375;91;72|157;129	ENSP00000429977:E375K;ENSP00000254898:E375K;ENSP00000429010:E91K;ENSP00000430487:E375K;ENSP00000429042:E91K;ENSP00000429825:E72K|.	ENSP00000254898:E375K|.	E|R	+|+	1|2	0|0	MATN2|MATN2	99075925|99075925	1.000000|1.000000	0.71417|0.71417	0.950000|0.950000	0.38849|0.38849	0.698000|0.698000	0.40448|0.40448	5.024000|5.024000	0.64090|0.64090	2.708000|2.708000	0.92522|0.92522	0.467000|0.467000	0.42956|0.42956	GAG|CGA	MATN2	-	pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.423	MATN2-004	KNOWN	non_canonical_conserved|basic|appris_candidate|CCDS	protein_coding	MATN2	HGNC	protein_coding	OTTHUMT00000380332.1	G			99006749	+1	no_errors	ENST00000254898	ensembl	human	known	70_37	missense	SNP	0.995	A
MDGA2	161357	genome.wustl.edu	37	14	47770696	47770696	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:47770696C>T	ENST00000399232.2	-	2	495	c.131G>A	c.(130-132)cGc>cAc	p.R44H	MDGA2_ENST00000439988.3_Missense_Mutation_p.R113H|MDGA2_ENST00000357362.3_5'UTR|MDGA2_ENST00000426342.1_5'UTR|MDGA2_ENST00000472499.2_5'UTR	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	44	Ig-like 1.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						TTCGGAGTAGCGCTCCTCTTC	0.507																																																	0													173.0	156.0	161.0					14																	47770696		692	1591	2283	SO:0001583	missense	161357			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.131G>A	14.37:g.47770696C>T	ENSP00000382178:p.Arg44His	Somatic		WXS	Illumina HiSeq	Phase_IV	F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like	p.R113H	ENST00000399232.2	37	c.338		14	.	.	.	.	.	.	.	.	.	.	C	18.18	3.566036	0.65651	.	.	ENSG00000139915	ENST00000439988;ENST00000399232;ENST00000486952	T;T;T	0.55588	0.51;0.51;0.51	5.2	5.2	0.72013	Immunoglobulin-like (1);	0.000000	0.36066	U	0.002803	T	0.63177	0.2489	L	0.32530	0.975	0.80722	D	1	D	0.76494	0.999	D	0.70935	0.971	T	0.64504	-0.6392	10	0.54805	T	0.06	.	17.7007	0.88293	0.0:1.0:0.0:0.0	.	44	Q7Z553	MDGA2_HUMAN	H	44;113;68	ENSP00000400011:R44H;ENSP00000382178:R113H;ENSP00000452515:R68H	ENSP00000382178:R113H	R	-	2	0	MDGA2	46840446	1.000000	0.71417	1.000000	0.80357	0.050000	0.14768	4.668000	0.61568	2.591000	0.87537	0.650000	0.86243	CGC	MDGA2	-	pfscan_Ig-like		0.507	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	C	NM_182830		47770696	-1	no_errors	ENST00000399232	ensembl	human	known	70_37	missense	SNP	1.000	T
MEST	4232	genome.wustl.edu	37	7	130142525	130142525	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:130142525C>T	ENST00000223215.4	+	10	1011	c.790C>T	c.(790-792)Cgc>Tgc	p.R264C	MEST_ENST00000393187.1_Missense_Mutation_p.R255C|MEST_ENST00000437945.1_Missense_Mutation_p.R264C|MEST_ENST00000462132.1_3'UTR|MEST_ENST00000416162.2_Missense_Mutation_p.R221C|MEST_ENST00000341441.5_Missense_Mutation_p.R255C|MEST_ENST00000378576.4_Missense_Mutation_p.R221C	NM_001253900.1|NM_002402.3	NP_001240829.1|NP_002393.2	Q5EB52	MEST_HUMAN	mesoderm specific transcript	264					mesoderm development (GO:0007498)|regulation of lipid storage (GO:0010883)|response to retinoic acid (GO:0032526)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	hydrolase activity (GO:0016787)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|ovary(2)	12	Melanoma(18;0.0435)					GTTCAGAAGGCGCTGGGTGGG	0.428																																					Colon(126;2182 2305 6517 35181)												0													91.0	91.0	91.0					7																	130142525		2203	4300	6503	SO:0001583	missense	4232				CCDS5822.1, CCDS5823.1, CCDS59081.1	7q32	2014-08-22	2012-12-07		ENSG00000106484	ENSG00000106484			7028	protein-coding gene	gene with protein product	"""Paternally-expressed gene 1"""	601029	"""mesoderm specific transcript (mouse) homolog"", ""mesoderm specific transcript homolog (mouse)"""			8884280	Standard	NM_002402		Approved	PEG1	uc003vqg.3	Q5EB52	OTTHUMG00000156661	ENST00000223215.4:c.790C>T	7.37:g.130142525C>T	ENSP00000223215:p.Arg264Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6S1|O14973|O15007|Q6AI49|Q92571	Missense_Mutation	SNP	pfam_AB_hydrolase_1,pfam_DUF1057,prints_Epox_hydrolase-like	p.R264C	ENST00000223215.4	37	c.790	CCDS5822.1	7	.	.	.	.	.	.	.	.	.	.	C	35	5.492348	0.96339	.	.	ENSG00000106484	ENST00000341441;ENST00000427521;ENST00000416162;ENST00000378576;ENST00000393187;ENST00000223215;ENST00000437945	T;T;T;T;T;T;T	0.60548	3.71;0.18;3.71;3.71;3.71;3.71;3.71	6.08	6.08	0.98989	.	0.000000	0.85682	D	0.000000	T	0.77896	0.4199	M	0.85777	2.775	0.80722	D	1	D;B;B;B	0.67145	0.996;0.26;0.26;0.257	D;B;B;B	0.63283	0.913;0.057;0.057;0.037	T	0.79943	-0.1590	10	0.66056	D	0.02	-10.0627	17.8207	0.88649	0.0:1.0:0.0:0.0	.	250;264;264;221	B4DQW6;C9JW74;Q5EB52;Q5EB52-3	.;.;MEST_HUMAN;.	C	255;221;221;221;255;264;264	ENSP00000342749:R255C;ENSP00000409505:R221C;ENSP00000408933:R221C;ENSP00000367839:R221C;ENSP00000376884:R255C;ENSP00000223215:R264C;ENSP00000401657:R264C	ENSP00000223215:R264C	R	+	1	0	MEST	129929761	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	4.676000	0.61627	2.890000	0.99128	0.655000	0.94253	CGC	MEST	-	pfam_AB_hydrolase_1		0.428	MEST-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEST	HGNC	protein_coding	OTTHUMT00000345183.2	C	NM_002402		130142525	+1	no_errors	ENST00000223215	ensembl	human	known	70_37	missense	SNP	1.000	T
METTL10	399818	genome.wustl.edu	37	10	126463297	126463297	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:126463297G>A	ENST00000368836.2	-	4	382	c.346C>T	c.(346-348)Cag>Tag	p.Q116*	RP11-12J10.3_ENST00000494792.1_Silent_p.F80F	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	116							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		CCAGAAAGCTGAATTGCAGAA	0.229																																																	0													19.0	22.0	21.0					10																	126463297		2054	4109	6163	SO:0001587	stop_gained	399818				CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.346C>T	10.37:g.126463297G>A	ENSP00000357829:p.Gln116*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MPY7	Nonsense_Mutation	SNP	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase	p.Q116*	ENST00000368836.2	37	c.346	CCDS31307.1	10	.	.	.	.	.	.	.	.	.	.	G	32	5.164056	0.94727	.	.	ENSG00000203791	ENST00000368836;ENST00000358960	.	.	.	5.65	4.72	0.59763	.	0.181905	0.48767	D	0.000177	.	.	.	.	.	.	0.80722	A	1.000000	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	-2.9484	11.273	0.49150	0.0:0.1332:0.7197:0.1471	.	.	.	.	X	116	.	ENSP00000351845:Q116X	Q	-	1	0	METTL10	126453287	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	2.504000	0.45416	1.564000	0.49628	0.655000	0.94253	CAG	METTL10	-	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase		0.229	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL10	HGNC	protein_coding	OTTHUMT00000050884.1	G	NM_212554		126463297	-1	no_errors	ENST00000368836	ensembl	human	known	70_37	nonsense	SNP	1.000	A
METTL10	399818	genome.wustl.edu	37	10	126463309	126463309	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:126463309G>A	ENST00000368836.2	-	4	370	c.334C>T	c.(334-336)Cct>Tct	p.P112S	RP11-12J10.3_ENST00000494792.1_Silent_p.L76L	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	112							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		ATTGCAGAAGGAGAGTAATCA	0.224																																																	0													19.0	22.0	21.0					10																	126463309		2056	4113	6169	SO:0001583	missense	399818				CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.334C>T	10.37:g.126463309G>A	ENSP00000357829:p.Pro112Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MPY7	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase	p.P112S	ENST00000368836.2	37	c.334	CCDS31307.1	10	.	.	.	.	.	.	.	.	.	.	G	13.19	2.163733	0.38217	.	.	ENSG00000203791	ENST00000368836;ENST00000358960	T	0.64260	-0.09	5.65	2.69	0.31865	.	0.332824	0.31554	N	0.007449	T	0.52597	0.1744	L	0.35644	1.08	0.36839	D	0.887280	B;B;B	0.31769	0.005;0.127;0.339	B;B;B	0.37989	0.017;0.262;0.148	T	0.59284	-0.7483	9	0.35671	T	0.21	-7.5041	10.2455	0.43339	0.0:0.2468:0.4977:0.2555	.	34;113;112	E7EP98;B5MDU2;Q5JPI9	.;.;MTL10_HUMAN	S	112	ENSP00000357829:P112S	ENSP00000351845:P112S	P	-	1	0	METTL10	126453299	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.675000	0.37555	0.433000	0.26313	0.655000	0.94253	CCT	METTL10	-	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase		0.224	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL10	HGNC	protein_coding	OTTHUMT00000050884.1	G	NM_212554		126463309	-1	no_errors	ENST00000368836	ensembl	human	known	70_37	missense	SNP	0.998	A
METTL10	399818	genome.wustl.edu	37	10	126463311	126463311	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:126463311G>A	ENST00000368836.2	-	4	368	c.332C>T	c.(331-333)tCt>tTt	p.S111F	RP11-12J10.3_ENST00000494792.1_Missense_Mutation_p.L76F	NM_212554.2	NP_997719.2	Q5JPI9	MET10_HUMAN	methyltransferase like 10	111							methyltransferase activity (GO:0008168)			endometrium(1)|large_intestine(2)|lung(1)|urinary_tract(1)	5		all_lung(145;0.0186)|Lung NSC(174;0.0295)|all_neural(114;0.116)|Colorectal(57;0.172)		Colorectal(40;0.101)|COAD - Colon adenocarcinoma(40;0.111)		TGCAGAAGGAGAGTAATCAAT	0.224																																																	0													19.0	22.0	21.0					10																	126463311		2058	4111	6169	SO:0001583	missense	399818				CCDS31307.1	10q26.13	2010-01-15			ENSG00000203791	ENSG00000203791			33787	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 138"""	C10orf138			Standard	NM_212554		Approved	Em:AC068896.3	uc001lhy.1	Q5JPI9	OTTHUMG00000019217	ENST00000368836.2:c.332C>T	10.37:g.126463311G>A	ENSP00000357829:p.Ser111Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MPY7	Missense_Mutation	SNP	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase	p.S111F	ENST00000368836.2	37	c.332	CCDS31307.1	10	.	.	.	.	.	.	.	.	.	.	G	18.85	3.710418	0.68730	.	.	ENSG00000203791	ENST00000368836;ENST00000358960	T	0.75367	-0.93	5.65	4.71	0.59529	.	0.059833	0.64402	D	0.000001	D	0.88325	0.6406	M	0.89785	3.06	0.44595	D	0.997565	D;D;D	0.89917	0.997;1.0;1.0	D;D;D	0.85130	0.947;0.997;0.989	D	0.90376	0.4384	9	0.87932	D	0	-17.7063	15.8153	0.78595	0.0:0.3286:0.6714:0.0	.	33;112;111	E7EP98;B5MDU2;Q5JPI9	.;.;MTL10_HUMAN	F	111	ENSP00000357829:S111F	ENSP00000351845:S111F	S	-	2	0	METTL10	126453301	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.582000	0.53921	2.941000	0.99782	0.655000	0.94253	TCT	METTL10	-	pfam_Methyltransf_11,pfam_Ribosomal-L11_MeTrfase_PrmA,pfam_Small_mtfrase_dom,pfam_tRNA_(Gua-N-7)_MeTrfase		0.224	METTL10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL10	HGNC	protein_coding	OTTHUMT00000050884.1	G	NM_212554		126463311	-1	no_errors	ENST00000368836	ensembl	human	known	70_37	missense	SNP	1.000	A
MFSD6	54842	genome.wustl.edu	37	2	191301100	191301100	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:191301100C>T	ENST00000392328.1	+	3	669	c.345C>T	c.(343-345)ttC>ttT	p.F115F	MFSD6_ENST00000281416.7_Silent_p.F115F	NM_017694.3	NP_060164.3	Q6ZSS7	MFSD6_HUMAN	major facilitator superfamily domain containing 6	115					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|large_intestine(2)|lung(5)|ovary(2)|prostate(1)|skin(3)|stomach(1)	23						TCATTGAATTCTGCAGTGCCC	0.443																																																	0													78.0	80.0	79.0					2																	191301100		2203	4300	6503	SO:0001819	synonymous_variant	54842				CCDS2306.1	2q32.2	2008-10-29			ENSG00000151690	ENSG00000151690			24711	protein-coding gene	gene with protein product		613476					Standard	NM_017694		Approved	FLJ20160	uc002urz.2	Q6ZSS7	OTTHUMG00000132671	ENST00000392328.1:c.345C>T	2.37:g.191301100C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3KSZ4|Q86TH2|Q9NXM3	Silent	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.F115	ENST00000392328.1	37	c.345	CCDS2306.1	2																																																																																			MFSD6	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.443	MFSD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD6	HGNC	protein_coding	OTTHUMT00000255931.1	C			191301100	+1	no_errors	ENST00000281416	ensembl	human	known	70_37	silent	SNP	1.000	T
LARP7	51574	genome.wustl.edu	37	4	113569401	113569403	+	Intron	DEL	GTG	GTG	-	rs368344055		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	GTG	GTG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:113569401_113569403delGTG	ENST00000344442.5	+	8	1420				MIR302A_ENST00000385192.1_RNA|MIR367_ENST00000362299.1_RNA|MIR302C_ENST00000362232.1_RNA|MIR302B_ENST00000510655.1_RNA|MIR302B_ENST00000362188.1_RNA|MIR302D_ENST00000362275.1_RNA|MIR302B_ENST00000509938.1_RNA|LARP7_ENST00000509061.1_Intron|LARP7_ENST00000324052.6_Intron|MIR302B_ENST00000505215.1_RNA	NM_016648.3	NP_057732.2	Q4G0J3	LARP7_HUMAN	La ribonucleoprotein domain family, member 7						RNA processing (GO:0006396)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			endometrium(2)|large_intestine(2)|lung(8)|ovary(4)|skin(1)	17		Ovarian(17;0.0443)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.000603)		CCACGTTTAAGTGGTGGGGAGCC	0.32																																																	0									,	15,3929		7,1,1964					,	5.7	1.0			68	2,7432		0,2,3715	no	intron,intron	LARP7	NM_016648.2,NM_015454.1	,	7,3,5679	A1A1,A1R,RR		0.0269,0.3803,0.1494	,	,		17,11361				SO:0001627	intron_variant	407028			AF068284	CCDS3701.2, CCDS58924.1	4q25	2013-02-12			ENSG00000174720	ENSG00000174720		"""La ribonucleoprotein domain containing"", ""RNA binding motif (RRM) containing"""	24912	protein-coding gene	gene with protein product	"""P-TEFb-interaction protein for 7SK stability"""	612026				18191186, 18249148, 18281698, 22865833, 22488152	Standard	NM_016648		Approved	HDCMA18P, PIP7S, DKFZP564K112	uc003ibb.4	Q4G0J3	OTTHUMG00000132909	ENST00000344442.5:c.1142+411GTG>-	4.37:g.113569404_113569406delGTG		Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZHN6|Q3B7A9|Q9P1S7|Q9Y3Z8	RNA	DEL	-	NULL	ENST00000344442.5	37	NULL	CCDS3701.2	4																																																																																			MIR302A	-	-		0.320	LARP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR302A	HGNC	protein_coding	OTTHUMT00000256417.2	GTG	NM_016648		113569403	-1	no_errors	ENST00000385192	ensembl	human	known	70_37	rna	DEL	1.000:1.000:0.997	-
KMT2D	8085	genome.wustl.edu	37	12	49425449	49425449	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:49425449G>A	ENST00000301067.7	-	39	13038	c.13039C>T	c.(13039-13041)Cag>Tag	p.Q4347*		NM_003482.3	NP_003473.3	O14686	KMT2D_HUMAN	lysine (K)-specific methyltransferase 2D	4347	Pro-rich.				chromatin silencing (GO:0006342)|histone H3-K4 methylation (GO:0051568)|oocyte growth (GO:0001555)|oogenesis (GO:0048477)|positive regulation of cell proliferation (GO:0008284)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to estrogen (GO:0043627)|transcription, DNA-templated (GO:0006351)	histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)										GTTGGCCCCTGAGGTTTGGGG	0.622																																																	0													22.0	23.0	22.0					12																	49425449		1887	4110	5997	SO:0001587	stop_gained	8085			AF010403	CCDS44873.1	12q13.12	2013-05-09	2013-05-09	2013-05-09	ENSG00000167548	ENSG00000167548		"""Chromatin-modifying enzymes / K-methyltransferases"", ""Zinc fingers, PHD-type"""	7133	protein-coding gene	gene with protein product		602113	"""trinucleotide repeat containing 21"", ""myeloid/lymphoid or mixed-lineage leukemia 2"""	TNRC21, MLL2		9247308	Standard	NM_003482		Approved	ALR, MLL4, CAGL114		O14686	OTTHUMG00000166524	ENST00000301067.7:c.13039C>T	12.37:g.49425449G>A	ENSP00000301067:p.Gln4347*	Somatic		WXS	Illumina HiSeq	Phase_IV	O14687	Nonsense_Mutation	SNP	pfam_Znf_PHD-finger,pfam_SET_dom,pfam_FYrich_C,pfam_FYrich_N,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Znf_RING,smart_HMG_superfamily,smart_FYrich_N,smart_FYrich_C,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_Znf_PHD-finger,pfscan_Znf_RING	p.Q4347*	ENST00000301067.7	37	c.13039	CCDS44873.1	12	.	.	.	.	.	.	.	.	.	.	G	52	19.374241	0.99918	.	.	ENSG00000167548	ENST00000301067	.	.	.	4.73	4.73	0.59995	.	0.307321	0.18779	N	0.131386	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.6208	0.51117	0.0891:0.0:0.9109:0.0	.	.	.	.	X	4347	.	ENSP00000301067:Q4347X	Q	-	1	0	MLL2	47711716	1.000000	0.71417	1.000000	0.80357	0.356000	0.29392	4.689000	0.61723	2.572000	0.86782	0.655000	0.94253	CAG	MLL2	-	NULL		0.622	KMT2D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MLL2	HGNC	protein_coding	OTTHUMT00000390183.2	G			49425449	-1	no_errors	ENST00000301067	ensembl	human	known	70_37	nonsense	SNP	0.992	A
MMP16	4325	genome.wustl.edu	37	8	89053782	89053782	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:89053782G>A	ENST00000286614.6	-	10	2012	c.1731C>T	c.(1729-1731)ctC>ctT	p.L577L		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	577					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	CCAATACAAGGAGGCATAAGG	0.478																																																	0													244.0	197.0	213.0					8																	89053782		2203	4300	6503	SO:0001819	synonymous_variant	4325			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1731C>T	8.37:g.89053782G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAN7|Q14824|Q52H48	Silent	SNP	pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.L577	ENST00000286614.6	37	c.1731	CCDS6246.1	8																																																																																			MMP16	-	pfam_Pept_M10A_metallopeptidase_C		0.478	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	G	NM_005941		89053782	-1	no_errors	ENST00000286614	ensembl	human	known	70_37	silent	SNP	1.000	A
MRC2	9902	genome.wustl.edu	37	17	60749358	60749358	+	Splice_Site	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:60749358G>A	ENST00000303375.5	+	8	1708		c.e8-1			NM_006039.4	NP_006030.2	Q9UBG0	MRC2_HUMAN	mannose receptor, C type 2						collagen catabolic process (GO:0030574)|endocytosis (GO:0006897)|osteoblast differentiation (GO:0001649)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	carbohydrate binding (GO:0030246)|collagen binding (GO:0005518)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(2)|large_intestine(11)|lung(28)|ovary(2)|prostate(1)|skin(3)	53						TGCACCCCCAGAGGTGGAGGA	0.557																																																	0													78.0	80.0	79.0					17																	60749358		2203	4300	6503	SO:0001630	splice_region_variant	9902			AB014609	CCDS11634.1	17q23	2011-08-30				ENSG00000011028		"""CD molecules"", ""C-type lectin domain containing"""	16875	protein-coding gene	gene with protein product		612264				9734811, 8702911	Standard	NM_006039		Approved	KIAA0709, ENDO180, CLEC13E, CD280	uc002jad.4	Q9UBG0		ENST00000303375.5:c.1307-1G>A	17.37:g.60749358G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8K4|D3DU08|Q7LGE7|Q9Y5P9	Splice_Site	SNP	-	e8-1	ENST00000303375.5	37	c.1307-1	CCDS11634.1	17	.	.	.	.	.	.	.	.	.	.	G	18.02	3.529114	0.64860	.	.	ENSG00000011028	ENST00000303375	.	.	.	4.81	4.81	0.61882	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.877	0.88828	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	MRC2	58103090	1.000000	0.71417	1.000000	0.80357	0.506000	0.33950	9.497000	0.97970	2.209000	0.71365	0.462000	0.41574	.	MRC2	-	-		0.557	MRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRC2	HGNC	protein_coding	OTTHUMT00000445152.1	G		Intron	60749358	+1	no_errors	ENST00000303375	ensembl	human	known	70_37	splice_site	SNP	1.000	A
MRPL18	29074	genome.wustl.edu	37	6	160211646	160211648	+	In_Frame_Del	DEL	GTT	GTT	-	rs58504486|rs79336325	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	GTT	GTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:160211646_160211648delGTT	ENST00000367034.4	+	1	149_151	c.27_29delGTT	c.(25-30)gggttg>ggg	p.L10del	TCP1_ENST00000546023.1_5'Flank|TCP1_ENST00000321394.7_5'Flank|TCP1_ENST00000392168.2_5'Flank|TCP1_ENST00000420894.2_5'Flank|MRPL18_ENST00000480842.1_3'UTR|TCP1_ENST00000544255.1_5'Flank	NM_014161.3	NP_054880.2	Q9H0U6	RM18_HUMAN	mitochondrial ribosomal protein L18	10				Missing (in Ref. 2; AAF29043). {ECO:0000305}.	rRNA import into mitochondrion (GO:0035928)|translation (GO:0006412)	extracellular space (GO:0005615)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|structural constituent of ribosome (GO:0003735)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(4)	11		Breast(66;0.000776)|Ovarian(120;0.0303)		OV - Ovarian serous cystadenocarcinoma(65;1.44e-18)|BRCA - Breast invasive adenocarcinoma(81;5.79e-06)		GGTTTTGGGGGTTGTTCTCGGTT	0.571														3331	0.665136	0.4818	0.8285	5008	,	,		17145	0.5883		0.7575	False		,,,				2504	0.7812																0										2244,2020		587,1070,475						2.9	0.0		dbSNP_130	101	6166,2086		2314,1538,274	no	coding	MRPL18	NM_014161.3		2901,2608,749	A1A1,A1R,RR		25.2787,47.3734,32.806				8410,4106				SO:0001651	inframe_deletion	29074			AF161556	CCDS5270.1	6q25.3	2012-09-13			ENSG00000112110	ENSG00000112110		"""Mitochondrial ribosomal proteins / large subunits"""	14477	protein-coding gene	gene with protein product		611831				11042152, 11551941	Standard	NM_014161		Approved	HSPC071	uc003qsw.4	Q9H0U6	OTTHUMG00000015942	ENST00000367034.4:c.27_29delGTT	6.37:g.160211649_160211651delGTT	ENSP00000356001:p.Leu10del	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TAP9|Q9NZW8	In_Frame_Del	DEL	pfam_Ribosomal_L18/L5	p.L10in_frame_del	ENST00000367034.4	37	c.27_29	CCDS5270.1	6																																																																																			MRPL18	-	NULL		0.571	MRPL18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL18	HGNC	protein_coding	OTTHUMT00000042925.1	GTT			160211648	+1	no_errors	ENST00000367034	ensembl	human	known	70_37	in_frame_del	DEL	0.010:0.006:0.000	-
MUC12	10071	genome.wustl.edu	37	7	100638812	100638812	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:100638812C>T	ENST00000379442.3	+	5	5397	c.5397C>T	c.(5395-5397)ctC>ctT	p.L1799L	MUC12_ENST00000536621.1_Silent_p.L1656L			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	1799	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						CCTCAGGCCTCCTTGAAGCAT	0.557																																																	0													70.0	82.0	78.0					7																	100638812		692	1590	2282	SO:0001819	synonymous_variant	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.5397C>T	7.37:g.100638812C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Silent	SNP	pfam_SEA	p.L1799	ENST00000379442.3	37	c.5397		7																																																																																			MUC12	-	NULL		0.557	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	C	XM_379904		100638812	+1	no_errors	ENST00000379442	ensembl	human	known	70_37	silent	SNP	0.000	T
MRPS33	51650	genome.wustl.edu	37	7	140710384	140710384	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:140710384C>T	ENST00000393008.3	-	2	205	c.50G>A	c.(49-51)cGg>cAg	p.R17Q	MRPS33_ENST00000324787.5_Missense_Mutation_p.R17Q|MRPS33_ENST00000472343.1_5'Flank|MRPS33_ENST00000496958.1_Missense_Mutation_p.R17Q|MRPS33_ENST00000469351.1_Missense_Mutation_p.R17Q|MRPS33_ENST00000467334.1_Missense_Mutation_p.R7Q	NM_016071.3	NP_057155.1	Q9Y291	RT33_HUMAN	mitochondrial ribosomal protein S33	17					translation (GO:0006412)	mitochondrial small ribosomal subunit (GO:0005763)	structural constituent of ribosome (GO:0003735)			breast(2)|endometrium(1)|kidney(1)	4	Melanoma(164;0.00956)					ACCAAATAGCCGGGCACTGAG	0.438																																																	0													136.0	127.0	130.0					7																	140710384		2203	4300	6503	SO:0001583	missense	51650			AF078858	CCDS5864.1	7q34	2012-09-13			ENSG00000090263	ENSG00000090263		"""Mitochondrial ribosomal proteins / small subunits"""	16634	protein-coding gene	gene with protein product		611993				11279123, 10810093	Standard	NM_016071		Approved	CGI-139	uc003vwe.4	Q9Y291	OTTHUMG00000157456	ENST00000393008.3:c.50G>A	7.37:g.140710384C>T	ENSP00000376732:p.Arg17Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ribosomal_S27/S33_mit	p.R17Q	ENST00000393008.3	37	c.50	CCDS5864.1	7	.	.	.	.	.	.	.	.	.	.	C	18.23	3.577076	0.65878	.	.	ENSG00000090263	ENST00000544013;ENST00000393008;ENST00000324787;ENST00000496958;ENST00000469351;ENST00000467334	.	.	.	5.33	4.45	0.53987	.	0.113858	0.64402	D	0.000009	T	0.39332	0.1074	L	0.42744	1.35	0.53688	D	0.999977	P	0.46277	0.875	B	0.33960	0.173	T	0.38200	-0.9672	9	0.51188	T	0.08	-26.746	11.3874	0.49793	0.0:0.8408:0.0:0.1592	.	17	Q9Y291	RT33_HUMAN	Q	17;17;17;17;17;7	.	ENSP00000320567:R17Q	R	-	2	0	MRPS33	140356853	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	3.838000	0.55828	1.391000	0.46566	0.591000	0.81541	CGG	MRPS33	-	pfam_Ribosomal_S27/S33_mit		0.438	MRPS33-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MRPS33	HGNC	protein_coding	OTTHUMT00000348878.1	C	NM_053035		140710384	-1	no_errors	ENST00000324787	ensembl	human	known	70_37	missense	SNP	1.000	T
MUC16	94025	genome.wustl.edu	37	19	9084975	9084975	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:9084975G>A	ENST00000397910.4	-	1	7043	c.6840C>T	c.(6838-6840)ctC>ctT	p.L2280L		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	2280	Ser-rich.|Thr-rich.				cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						ACTCATGAGTGAGAGATGAAA	0.458																																																	0													57.0	55.0	56.0					19																	9084975		1916	4140	6056	SO:0001819	synonymous_variant	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.6840C>T	19.37:g.9084975G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQW5|Q96RK2	Silent	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.L2280	ENST00000397910.4	37	c.6840	CCDS54212.1	19																																																																																			MUC16	-	NULL		0.458	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	G	NM_024690		9084975	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	silent	SNP	0.043	A
MUC5B	727897	genome.wustl.edu	37	11	1264292	1264292	+	Missense_Mutation	SNP	C	C	T	rs61997210	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:1264292C>T	ENST00000529681.1	+	31	6240	c.6182C>T	c.(6181-6183)gCc>gTc	p.A2061V	MUC5B_ENST00000447027.1_Missense_Mutation_p.A2064V|RP11-532E4.2_ENST00000532061.2_RNA	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	2061	11 X approximate tandem repeats, Ser/Thr- rich.|7 X Cys-rich subdomain repeats.|Thr-rich.				cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCTTCACAGCCACCCCCTCC	0.647													C|||	242	0.0483227	0.0575	0.1052	5008	,	,		16379	0.003		0.0497	False		,,,				2504	0.0409																0								C	VAL/ALA	223,3813		11,201,1806	76.0	95.0	89.0		6182	-2.0	0.0	11	dbSNP_129	89	412,7944		29,354,3795	no	missense	MUC5B	NM_002458.2	64	40,555,5601	TT,TC,CC		4.9306,5.5253,5.1243	benign	2061/5763	1264292	635,11757	2018	4178	6196	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.6182C>T	11.37:g.1264292C>T	ENSP00000436812:p.Ala2061Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.A2064V	ENST00000529681.1	37	c.6191	CCDS44515.2	11	85	0.03891941391941392	17	0.034552845528455285	28	0.07734806629834254	0	0.0	40	0.052770448548812667	c	6.988	0.552384	0.13374	0.055253	0.049306	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.17213	2.29;2.47	1.96	-1.97	0.07503	.	.	.	.	.	T	0.00666	0.0022	M	0.65975	2.015	0.09310	N	1	B;P	0.43477	0.435;0.808	B;B	0.32393	0.111;0.145	T	0.10800	-1.0614	9	0.87932	D	0	.	5.8273	0.18560	0.1889:0.4363:0.3747:0.0	rs61997210	2754;2064	A7Y9J9;E9PBJ0	.;.	V	2061;2064;2062;2131	ENSP00000436812:A2061V;ENSP00000415793:A2064V	ENSP00000343037:A2062V	A	+	2	0	MUC5B	1220868	0.000000	0.05858	0.000000	0.03702	0.044000	0.14063	0.106000	0.15354	-0.202000	0.10268	0.195000	0.17529	GCC	MUC5B	-	NULL		0.647	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	C	XM_001126093		1264292	+1	no_errors	ENST00000447027	ensembl	human	known	70_37	missense	SNP	0.000	T
MYBPC1	4604	genome.wustl.edu	37	12	102045046	102045046	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:102045046G>C	ENST00000550270.1	+	14	1326	c.1326G>C	c.(1324-1326)caG>caC	p.Q442H	MYBPC1_ENST00000550501.1_Intron|RP11-755O11.2_ENST00000552081.1_RNA|MYBPC1_ENST00000536007.1_Missense_Mutation_p.Q423H|MYBPC1_ENST00000547509.1_Missense_Mutation_p.Q428H|MYBPC1_ENST00000551300.1_Missense_Mutation_p.Q343H|MYBPC1_ENST00000441232.1_Missense_Mutation_p.Q442H|RP11-755O11.2_ENST00000547027.1_RNA|MYBPC1_ENST00000553190.1_Missense_Mutation_p.Q442H|MYBPC1_ENST00000361466.2_Missense_Mutation_p.Q467H|MYBPC1_ENST00000392934.3_Missense_Mutation_p.Q429H|MYBPC1_ENST00000452455.2_Missense_Mutation_p.Q442H|MYBPC1_ENST00000541119.1_Missense_Mutation_p.Q430H|MYBPC1_ENST00000549145.1_Missense_Mutation_p.Q455H|MYBPC1_ENST00000360610.2_Missense_Mutation_p.Q442H|MYBPC1_ENST00000545503.2_Missense_Mutation_p.Q442H|MYBPC1_ENST00000361685.2_Missense_Mutation_p.Q467H|MYBPC1_ENST00000547405.1_Missense_Mutation_p.Q416H			Q00872	MYPC1_HUMAN	myosin binding protein C, slow type	442	Ig-like C2-type 4.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myofibril (GO:0030016)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			breast(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|liver(1)|lung(22)|ovary(4)|prostate(1)|skin(4)|urinary_tract(2)	57						TGACTGATCAGACTGTAAATC	0.433																																																	0													135.0	140.0	138.0					12																	102045046		2203	4300	6503	SO:0001583	missense	4604				CCDS9083.1, CCDS9084.1, CCDS9085.1, CCDS55877.1, CCDS58268.1, CCDS58269.1, CCDS58270.1, CCDS58271.1, CCDS58272.1, CCDS58273.1	12q23.2	2013-02-11	2001-11-28		ENSG00000196091	ENSG00000196091		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7549	protein-coding gene	gene with protein product		160794	"""myosin-binding protein C, slow-type"""			8375400, 16918501	Standard	NM_002465		Approved		uc010svs.2	Q00872	OTTHUMG00000170274	ENST00000550270.1:c.1326G>C	12.37:g.102045046G>C	ENSP00000449702:p.Gln442His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKR5|B7Z8G8|B7ZL02|B7ZL09|B7ZL10|E7ESM5|E7EWS6|G3XAE8|Q15497|Q17RR7|Q569K7|Q86T48|Q86TC8|Q8N3L2	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.Q467H	ENST00000550270.1	37	c.1401	CCDS9085.1	12	.	.	.	.	.	.	.	.	.	.	G	17.87	3.495438	0.64186	.	.	ENSG00000196091	ENST00000547405;ENST00000452455;ENST00000441232;ENST00000360610;ENST00000392934;ENST00000547509;ENST00000361685;ENST00000549145;ENST00000553190;ENST00000540770;ENST00000545503;ENST00000536007;ENST00000541119;ENST00000361466;ENST00000551300;ENST00000550270	T;T;T;T;T;T;T;T;T;T;T;T;T;T;T	0.67523	-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27;-0.27	5.55	0.208	0.15221	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like fold (1);	0.619515	0.13382	N	0.392058	T	0.67277	0.2876	L	0.61387	1.9	0.34346	D	0.689366	P;P;B;P;B;B;P;P;B;P;P	0.39071	0.658;0.658;0.446;0.658;0.431;0.431;0.606;0.658;0.392;0.606;0.606	P;P;P;P;P;P;P;P;B;P;P	0.50314	0.617;0.549;0.637;0.549;0.617;0.617;0.482;0.617;0.382;0.482;0.482	T	0.72228	-0.4354	10	0.72032	D	0.01	.	2.7499	0.05277	0.2069:0.2135:0.4662:0.1133	.	423;430;442;442;429;416;442;442;467;467;455	B7ZL02;B7ZL10;E7EWS6;B7ZL09;E7ESM5;Q17RR7;Q00872-3;Q00872;G3XAE8;Q00872-2;F8VZY0	.;.;.;.;.;.;.;MYPC1_HUMAN;.;.;.	H	416;442;442;442;429;428;467;455;442;467;442;423;430;467;343;442	ENSP00000448175:Q416H;ENSP00000400908:Q442H;ENSP00000388989:Q442H;ENSP00000353822:Q442H;ENSP00000376665:Q429H;ENSP00000447362:Q428H;ENSP00000354845:Q467H;ENSP00000447660:Q455H;ENSP00000447900:Q442H;ENSP00000440034:Q442H;ENSP00000446128:Q423H;ENSP00000442847:Q430H;ENSP00000354849:Q467H;ENSP00000447116:Q343H;ENSP00000449702:Q442H	ENSP00000353822:Q442H	Q	+	3	2	MYBPC1	100569177	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.472000	0.35376	0.717000	0.32145	0.655000	0.94253	CAG	MYBPC1	-	pfam_Ig_I-set,smart_Ig_sub		0.433	MYBPC1-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	MYBPC1	HGNC	protein_coding	OTTHUMT00000408806.1	G			102045046	+1	no_errors	ENST00000361466	ensembl	human	known	70_37	missense	SNP	0.756	C
MYH11	4629	genome.wustl.edu	37	16	15917215	15917215	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:15917215G>A	ENST00000300036.5	-	3	508	c.399C>T	c.(397-399)atC>atT	p.I133I	MYH11_ENST00000576790.2_Silent_p.I133I|MYH11_ENST00000396324.3_Silent_p.I133I|MYH11_ENST00000452625.2_Silent_p.I133I	NM_002474.2	NP_002465.1	P35749	MYH11_HUMAN	myosin, heavy chain 11, smooth muscle	133	Myosin motor.				axon guidance (GO:0007411)|cardiac muscle fiber development (GO:0048739)|elastic fiber assembly (GO:0048251)|muscle contraction (GO:0006936)|skeletal muscle myosin thick filament assembly (GO:0030241)|smooth muscle contraction (GO:0006939)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|smooth muscle contractile fiber (GO:0030485)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|motor activity (GO:0003774)|structural constituent of muscle (GO:0008307)			NS(2)|breast(7)|central_nervous_system(1)|endometrium(11)|kidney(5)|large_intestine(34)|liver(1)|lung(37)|ovary(9)|pancreas(1)|prostate(7)|skin(7)|upper_aerodigestive_tract(1)	123						TCTCCGAGTAGATGGGCAGGT	0.562			T	CBFB	AML																																			Dom	yes		16	16p13.13-p13.12	4629	"""myosin, heavy polypeptide 11, smooth muscle"""		L	0													205.0	152.0	170.0					16																	15917215		2197	4300	6497	SO:0001819	synonymous_variant	4629			X69292	CCDS10565.1, CCDS10566.1, CCDS45423.1, CCDS45424.1	16p13.11	2011-09-27	2006-09-29		ENSG00000133392	ENSG00000133392		"""Myosins / Myosin superfamily : Class II"""	7569	protein-coding gene	gene with protein product		160745	"""myosin, heavy polypeptide 11, smooth muscle"""			7684189	Standard	NM_001040113		Approved	SMMHC, SMHC	uc002ddx.3	P35749	OTTHUMG00000129935	ENST00000300036.5:c.399C>T	16.37:g.15917215G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D2JYH7|O00396|O94944|P78422|Q3MIV8|Q3MNF0|Q3MNF1	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.I133	ENST00000300036.5	37	c.399	CCDS10565.1	16																																																																																			MYH11	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom,prints_Myosin_head_motor_dom		0.562	MYH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH11	HGNC	protein_coding	OTTHUMT00000252192.2	G	NM_001040113		15917215	-1	no_errors	ENST00000396324	ensembl	human	known	70_37	silent	SNP	1.000	A
MYH3	4621	genome.wustl.edu	37	17	10538311	10538311	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:10538311G>A	ENST00000583535.1	-	31	4289	c.4202C>T	c.(4201-4203)tCc>tTc	p.S1401F	MYH3_ENST00000226209.7_Missense_Mutation_p.S1401F	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	1401					actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						CTGTTCCTCGGAATCTTGAAG	0.433																																																	0													98.0	96.0	97.0					17																	10538311		2203	4300	6503	SO:0001583	missense	4621				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.4202C>T	17.37:g.10538311G>A	ENSP00000464317:p.Ser1401Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15492	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1401F	ENST00000583535.1	37	c.4202	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	G	26.5	4.740574	0.89573	.	.	ENSG00000109063	ENST00000226209	T	0.77877	-1.13	5.34	5.34	0.76211	Myosin tail (1);	.	.	.	.	T	0.80476	0.4630	L	0.48642	1.525	0.52501	D	0.999954	P	0.41420	0.749	P	0.47705	0.555	T	0.82002	-0.0673	9	0.72032	D	0.01	.	19.3898	0.94576	0.0:0.0:1.0:0.0	.	1401	P11055	MYH3_HUMAN	F	1401	ENSP00000226209:S1401F	ENSP00000226209:S1401F	S	-	2	0	MYH3	10479036	1.000000	0.71417	0.949000	0.38748	0.972000	0.66771	8.000000	0.88501	2.640000	0.89533	0.655000	0.94253	TCC	MYH3	-	pfam_Myosin_tail		0.433	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	G	NM_002470		10538311	-1	no_errors	ENST00000226209	ensembl	human	known	70_37	missense	SNP	1.000	A
MYO5B	4645	genome.wustl.edu	37	18	47480737	47480737	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:47480737G>T	ENST00000285039.7	-	13	1913	c.1614C>A	c.(1612-1614)ttC>ttA	p.F538L		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	538	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		GGGGCTTCTGGAAGTGCTGGC	0.572																																																	0													84.0	94.0	91.0					18																	47480737		2039	4185	6224	SO:0001583	missense	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1614C>A	18.37:g.47480737G>T	ENSP00000285039:p.Phe538Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1R3|Q0P656|Q9H6Y6	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.F538L	ENST00000285039.7	37	c.1614	CCDS42436.1	18	.	.	.	.	.	.	.	.	.	.	G	26.8	4.773848	0.90108	.	.	ENSG00000167306	ENST00000285039;ENST00000356732	D	0.89415	-2.51	4.79	4.79	0.61399	Myosin head, motor domain (2);	0.000000	0.85682	D	0.000000	D	0.88625	0.6487	M	0.64630	1.985	0.80722	D	1	B;B	0.33919	0.078;0.432	B;B	0.36766	0.232;0.158	D	0.88657	0.3186	10	0.49607	T	0.09	.	17.4649	0.87629	0.0:0.0:1.0:0.0	.	537;538	Q7Z7A5;Q9ULV0	.;MYO5B_HUMAN	L	538;537	ENSP00000285039:F538L	ENSP00000285039:F538L	F	-	3	2	MYO5B	45734735	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	3.172000	0.50832	2.192000	0.70111	0.462000	0.41574	TTC	MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.572	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	G			47480737	-1	no_errors	ENST00000285039	ensembl	human	known	70_37	missense	SNP	1.000	T
MYO5C	55930	genome.wustl.edu	37	15	52553091	52553091	+	Silent	SNP	C	C	T	rs372026654		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:52553091C>T	ENST00000261839.7	-	10	1442	c.1281G>A	c.(1279-1281)caG>caA	p.Q427Q	MYO5C_ENST00000541028.1_5'Flank|MYO5C_ENST00000443683.2_Intron	NM_018728.3	NP_061198.2	Q9NQX4	MYO5C_HUMAN	myosin VC	427	Myosin motor.					extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)	ATP binding (GO:0005524)|motor activity (GO:0003774)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(8)|kidney(7)|large_intestine(15)|lung(12)|ovary(7)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	66				all cancers(107;0.0137)		TAAAAGTGTGCTGCTTGCCTG	0.438																																																	0								C		1,3809		0,1,1904	107.0	101.0	103.0		1281	3.4	1.0	15		103	4,8236		0,4,4116	no	coding-synonymous	MYO5C	NM_018728.3		0,5,6020	TT,TC,CC		0.0485,0.0262,0.0415		427/1743	52553091	5,12045	1905	4120	6025	SO:0001819	synonymous_variant	55930			AF272390	CCDS42036.1	15q21	2011-09-27				ENSG00000128833		"""Myosins / Myosin superfamily : Class V"""	7604	protein-coding gene	gene with protein product	"""myosin 5C"""	610022				11870218	Standard	NM_018728		Approved	MGC74969	uc010bff.3	Q9NQX4		ENST00000261839.7:c.1281G>A	15.37:g.52553091C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P1W8	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.Q427	ENST00000261839.7	37	c.1281	CCDS42036.1	15																																																																																			MYO5C	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.438	MYO5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5C	HGNC	protein_coding	OTTHUMT00000419562.1	C	NM_018728		52553091	-1	no_errors	ENST00000261839	ensembl	human	known	70_37	silent	SNP	1.000	T
NAP1L2	4674	genome.wustl.edu	37	X	72432946	72432946	+	Nonstop_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:72432946C>G	ENST00000373517.3	-	1	1738	c.1383G>C	c.(1381-1383)taG>taC	p.*461Y	NAP1L2_ENST00000536638.1_Nonstop_Mutation_p.*319Y	NM_021963.3	NP_068798.1	Q9ULW6	NP1L2_HUMAN	nucleosome assembly protein 1-like 2	0					nucleosome assembly (GO:0006334)|positive regulation of histone H3-K14 acetylation (GO:0071442)|positive regulation of histone H3-K9 acetylation (GO:2000617)|positive regulation of neuron differentiation (GO:0045666)|regulation of stem cell division (GO:2000035)	nucleus (GO:0005634)	chromatin binding (GO:0003682)			NS(1)|breast(2)|endometrium(2)|kidney(3)|large_intestine(6)|lung(12)|skin(3)	29	Renal(35;0.156)					ATACTCTGCTCTAACGATCAA	0.338																																																	0													48.0	39.0	42.0					X																	72432946		2203	4299	6502	SO:0001578	stop_lost	4674			AF136178	CCDS14423.1	Xq13	2008-02-05			ENSG00000186462	ENSG00000186462			7638	protein-coding gene	gene with protein product		300026				8789438	Standard	NM_021963		Approved	BPX, MGC26243	uc004ebi.3	Q9ULW6	OTTHUMG00000021827	ENST00000373517.3:c.1383G>C	X.37:g.72432946C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RE61|B4E161|Q8TAN6	Nonstop_Mutation	SNP	pfam_NAP_family	p.*461Y	ENST00000373517.3	37	c.1383	CCDS14423.1	X	.	.	.	.	.	.	.	.	.	.	c	0.010	-1.794979	0.00617	.	.	ENSG00000186462	ENST00000373517;ENST00000536638	.	.	.	3.2	1.89	0.25635	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0662	0.19864	0.0:0.1385:0.0:0.8615	.	.	.	.	Y	461;319	.	.	X	-	3	2	NAP1L2	72349671	1.000000	0.71417	0.691000	0.30163	0.073000	0.16967	1.492000	0.35594	0.440000	0.26502	-0.505000	0.04504	TAG	NAP1L2	-	NULL		0.338	NAP1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAP1L2	HGNC	protein_coding	OTTHUMT00000057225.1	C	NM_021963		72432946	-1	no_errors	ENST00000373517	ensembl	human	known	70_37	nonstop	SNP	0.841	G
NBEAL1	65065	genome.wustl.edu	37	2	204075772	204075772	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:204075772G>C	ENST00000449802.1	+	53	8123	c.7790G>C	c.(7789-7791)gGa>gCa	p.G2597A		NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	2597										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						TGTATAATCGGAGAACACATT	0.353																																																	0													85.0	81.0	82.0					2																	204075772		1840	4090	5930	SO:0001583	missense	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.7790G>C	2.37:g.204075772G>C	ENSP00000399903:p.Gly2597Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.G2597A	ENST00000449802.1	37	c.7790	CCDS46495.1	2	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	13.59|13.59	2.283477|2.283477	0.40394|0.40394	.|.	.|.	ENSG00000144426|ENSG00000144426	ENST00000434469|ENST00000449802;ENST00000340268;ENST00000414576	.|T;T	.|0.39997	.|4.45;1.05	5.19|5.19	5.19|5.19	0.71726|0.71726	.|WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	.|0.108207	.|0.64402	.|D	.|0.000005	T|T	0.49184|0.49184	0.1542|0.1542	M|M	0.81341|0.81341	2.54|2.54	0.40521|0.40521	D|D	0.980833|0.980833	.|B;P;P	.|0.49635	.|0.321;0.696;0.926	.|B;B;B	.|0.44224	.|0.281;0.254;0.444	T|T	0.55535|0.55535	-0.8126|-0.8126	5|10	.|0.34782	.|T	.|0.22	.|.	14.3422|14.3422	0.66636|0.66636	0.0:0.1482:0.8518:0.0|0.0:0.1482:0.8518:0.0	.|.	.|1307;2597;2586	.|D1MPS9;Q6ZS30;C9JGK5	.|.;NBEL1_HUMAN;.	Q|A	125|2597;2507;612	.|ENSP00000399903:G2597A;ENSP00000388466:G612A	.|ENSP00000344985:G2507A	E|G	+|+	1|2	0|0	NBEAL1|NBEAL1	203784017|203784017	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.925000|0.925000	0.55904|0.55904	6.253000|6.253000	0.72453|0.72453	2.402000|2.402000	0.81655|0.81655	0.491000|0.491000	0.48974|0.48974	GAG|GGA	NBEAL1	-	superfamily_WD40_repeat_dom		0.353	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	G			204075772	+1	no_errors	ENST00000449802	ensembl	human	known	70_37	missense	SNP	1.000	C
NBPF15	284565	genome.wustl.edu	37	1	148594447	148594447	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:148594447C>G	ENST00000369187.3	+	19	2309	c.1820C>G	c.(1819-1821)tCa>tGa	p.S607*	NBPF15_ENST00000442702.2_Nonsense_Mutation_p.S607*	NM_173638.3	NP_775909.2	Q8N660	NBPFF_HUMAN	neuroblastoma breakpoint family, member 15	607	NBPF 6. {ECO:0000255|PROSITE- ProRule:PRU00647}.					cytoplasm (GO:0005737)				NS(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(3)|skin(2)	12	all_hematologic(923;0.032)					TTACAGGACTCACTGGATAGA	0.448																																																	0													174.0	226.0	208.0					1																	148594447		2203	4297	6500	SO:0001587	stop_gained	284565			BC023087	CCDS72852.1	1q21.1	2014-01-16			ENSG00000243452	ENSG00000266338		"""neuroblastoma breakpoint family"""	28791	protein-coding gene	gene with protein product		610414, 614005	"""neuroblastoma breakpoint family, member 16"""	NBPF16		16079250	Standard	NM_173638		Approved	MGC8902	uc001esc.2	Q8N660	OTTHUMG00000013634	ENST00000369187.3:c.1820C>G	1.37:g.148594447C>G	ENSP00000358188:p.Ser607*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3BBV9|Q8IX77	Nonsense_Mutation	SNP	pfam_NBPF_dom	p.S607*	ENST00000369187.3	37	c.1820	CCDS932.1	1	.	.	.	.	.	.	.	.	.	.	.	36	5.744327	0.96882	.	.	ENSG00000243452	ENST00000442702;ENST00000369187	.	.	.	0.502	0.502	0.16932	.	.	.	.	.	.	.	.	.	.	.	0.54753	D	0.999981	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	.	.	.	.	.	.	.	X	607	.	ENSP00000358188:S607X	S	+	2	0	NBPF15	146861071	0.997000	0.39634	0.021000	0.16686	0.013000	0.08279	0.762000	0.26503	0.557000	0.29117	0.377000	0.23210	TCA	NBPF15	-	pfam_NBPF_dom		0.448	NBPF15-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NBPF15	HGNC	protein_coding	OTTHUMT00000038609.3	C	NM_173638		148594447	+1	no_errors	ENST00000369187	ensembl	human	known	70_37	nonsense	SNP	0.022	G
NCOR1	9611	genome.wustl.edu	37	17	16012109	16012109	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:16012109C>G	ENST00000268712.3	-	19	2430	c.2173G>C	c.(2173-2175)Gac>Cac	p.D725H	NCOR1_ENST00000583226.1_5'UTR|NCOR1_ENST00000395848.1_Missense_Mutation_p.D616H|NCOR1_ENST00000395851.1_Missense_Mutation_p.D725H	NM_006311.3	NP_006302.2	O75376	NCOR1_HUMAN	nuclear receptor corepressor 1	725					CD4-positive, CD25-positive, alpha-beta regulatory T cell differentiation (GO:0002361)|cellular lipid metabolic process (GO:0044255)|cholesterol homeostasis (GO:0042632)|chromatin modification (GO:0016568)|circadian regulation of gene expression (GO:0032922)|definitive erythrocyte differentiation (GO:0060318)|gene expression (GO:0010467)|negative regulation of JNK cascade (GO:0046329)|negative regulation of phosphatidylinositol 3-kinase signaling (GO:0014067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of histone deacetylation (GO:0031065)|regulation of fatty acid transport (GO:2000191)|regulation of glycolytic process by negative regulation of transcription from RNA polymerase II promoter (GO:0072362)|regulation of lipid transport by negative regulation of transcription from RNA polymerase II promoter (GO:0072368)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|spindle assembly (GO:0051225)|thalamus development (GO:0021794)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)|transcription factor complex (GO:0005667)|transcriptional repressor complex (GO:0017053)	chromatin binding (GO:0003682)|histone deacetylase binding (GO:0042826)|histone deacetylase regulator activity (GO:0035033)|nuclear hormone receptor binding (GO:0035257)|RNA polymerase II activating transcription factor binding (GO:0001102)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)			NS(2)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(17)|lung(26)|ovary(1)|prostate(7)|skin(2)|upper_aerodigestive_tract(6)|urinary_tract(10)	107				UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		CCTTCGCTGTCTTCTGGATTT	0.378																																																	0													120.0	113.0	116.0					17																	16012109		2203	4300	6503	SO:0001583	missense	9611			AF044209	CCDS11175.1, CCDS54094.1, CCDS54095.1	17p11.2	2014-06-12	2010-06-10		ENSG00000141027	ENSG00000141027			7672	protein-coding gene	gene with protein product	"""thyroid hormone- and retinoic acid receptor-associated corepressor 1"", ""protein phosphatase 1, regulatory subunit 109"""	600849	"""nuclear receptor co-repressor 1"""			7566114, 9724795	Standard	NM_006311		Approved	N-CoR, hCIT529I10, TRAC1, hN-CoR, KIAA1047, MGC104216, PPP1R109	uc002gpo.3	O75376	OTTHUMG00000059309	ENST00000268712.3:c.2173G>C	17.37:g.16012109C>G	ENSP00000268712:p.Asp725His	Somatic		WXS	Illumina HiSeq	Phase_IV	B3DLF8|E9PGV6|Q86YY0|Q9UPV5|Q9UQ18	Missense_Mutation	SNP	pfam_SANT/Myb,superfamily_Homeodomain-like,smart_SANT/Myb,pfscan_Myb-like_dom	p.D725H	ENST00000268712.3	37	c.2173	CCDS11175.1	17	.	.	.	.	.	.	.	.	.	.	C	16.81	3.226407	0.58668	.	.	ENSG00000141027	ENST00000268712;ENST00000395851;ENST00000395849;ENST00000395848	T;T;T	0.47177	0.85;0.85;0.85	5.31	5.31	0.75309	.	0.091270	0.64402	D	0.000001	T	0.65333	0.2681	L	0.55481	1.735	0.80722	D	1	B;D;D	0.89917	0.326;0.999;1.0	B;D;D	0.87578	0.113;0.995;0.998	T	0.64080	-0.6491	10	0.45353	T	0.12	-13.0551	17.9624	0.89090	0.0:1.0:0.0:0.0	.	616;725;725	E9PGV6;O75376;O75376-2	.;NCOR1_HUMAN;.	H	725;725;616;616	ENSP00000268712:D725H;ENSP00000379192:D725H;ENSP00000379189:D616H	ENSP00000268712:D725H	D	-	1	0	NCOR1	15952834	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	6.483000	0.73617	2.489000	0.83994	0.591000	0.81541	GAC	NCOR1	-	NULL		0.378	NCOR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOR1	HGNC	protein_coding	OTTHUMT00000131751.5	C	NM_006311		16012109	-1	no_errors	ENST00000268712	ensembl	human	known	70_37	missense	SNP	1.000	G
NEB	4703	genome.wustl.edu	37	2	152436012	152436012	+	Intron	SNP	T	T	G	rs62174690	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:152436012T>G	ENST00000172853.10	-	78	11749				NEB_ENST00000427231.2_Missense_Mutation_p.K5515T|NEB_ENST00000409198.1_Intron|NEB_ENST00000397345.3_Missense_Mutation_p.K5515T|NEB_ENST00000604864.1_Missense_Mutation_p.K5515T|NEB_ENST00000603639.1_Missense_Mutation_p.K5515T			P20929	NEBU_HUMAN	nebulin						muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|regulation of actin filament length (GO:0030832)|somatic muscle development (GO:0007525)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Z disc (GO:0030018)	structural constituent of muscle (GO:0008307)			NS(5)|autonomic_ganglia(3)|breast(9)|central_nervous_system(5)|cervix(3)|endometrium(35)|kidney(16)|large_intestine(77)|liver(1)|lung(99)|ovary(9)|pancreas(3)|prostate(13)|skin(7)|stomach(8)|upper_aerodigestive_tract(6)|urinary_tract(2)	301				BRCA - Breast invasive adenocarcinoma(221;0.219)		GATGGAGATCTTGGCTTTGTG	0.527																																																	0													2.0	2.0	2.0					2																	152436012		196	550	746	SO:0001627	intron_variant	4703			X83957	CCDS46424.1, CCDS54407.1, CCDS54408.1, CCDS74588.1	2q22	2014-09-17			ENSG00000183091	ENSG00000183091			7720	protein-coding gene	gene with protein product	"""nemaline myopathy type 2"""	161650		NEM2		10051637, 9359044	Standard	NM_001164507		Approved	NEB177D	uc010fnx.3	P20929	OTTHUMG00000153784	ENST00000172853.10:c.11602-3144A>C	2.37:g.152436012T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	F8WCL5|F8WCP0|Q15346|Q53QQ2|Q53TG8	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_Adhesion_dom_bac,superfamily_6-PGluconate_DH_C-like,smart_Nebulin_35r-motif,smart_SH3_domain,pfscan_Nebulin_35r-motif,pfscan_SH3_domain,prints_Nebulin	p.K5515T	ENST00000172853.10	37	c.16544		2	.	.	.	.	.	.	.	.	.	.	T	9.476	1.096883	0.20552	.	.	ENSG00000183091	ENST00000397345;ENST00000427231;ENST00000413693	T;T;T	0.34275	1.37;1.37;1.37	4.73	3.57	0.40892	.	.	.	.	.	T	0.41073	0.1143	M	0.81802	2.56	0.09310	P	1.0	B	0.26775	0.159	B	0.27796	0.083	T	0.53187	-0.8474	8	0.48119	T	0.1	.	10.5212	0.44920	0.0:0.0767:0.0:0.9233	.	245	Q14215	.	T	5515;5515;245	ENSP00000380505:K5515T;ENSP00000416578:K5515T;ENSP00000410961:K245T	ENSP00000380505:K5515T	K	-	2	0	NEB	152144258	1.000000	0.71417	1.000000	0.80357	0.048000	0.14542	2.185000	0.42584	0.945000	0.37605	0.421000	0.28195	AAG	NEB	-	NULL		0.527	NEB-201	KNOWN	basic	protein_coding	NEB	HGNC	protein_coding		T	NM_004543		152436012	-1	no_errors	ENST00000397345	ensembl	human	known	70_37	missense	SNP	1.000	G
NEK4	6787	genome.wustl.edu	37	3	52800349	52800349	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:52800349G>C	ENST00000233027.5	-	3	605	c.403C>G	c.(403-405)Caa>Gaa	p.Q135E	NEK4_ENST00000535191.1_Missense_Mutation_p.Q46E|NEK4_ENST00000383721.4_Missense_Mutation_p.Q135E	NM_001193533.1|NM_003157.4	NP_001180462.1|NP_003148.2	P51957	NEK4_HUMAN	NIMA-related kinase 4	135	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				mitotic nuclear division (GO:0007067)|protein phosphorylation (GO:0006468)	nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(9)|lung(10)	26				BRCA - Breast invasive adenocarcinoma(193;7.44e-05)|Kidney(197;0.000711)|KIRC - Kidney renal clear cell carcinoma(197;0.00086)|OV - Ovarian serous cystadenocarcinoma(275;0.0513)		AAGACATTTTGAGTTTTCAGA	0.358																																																	0													202.0	177.0	186.0					3																	52800349		2203	4300	6503	SO:0001583	missense	6787			L20321	CCDS2863.1, CCDS54593.1	3p21.1	2012-11-15	2012-11-15	2002-05-10	ENSG00000114904	ENSG00000114904	2.7.11.1		11399	protein-coding gene	gene with protein product	"""serine/threonine protein kinase-2"""	601959	"""serine/threonine kinase 2"", ""NIMA (never in mitosis gene a)-related kinase 4"""	STK2		8208544	Standard	NM_001193533		Approved	NRK2, pp12301	uc003dfq.4	P51957	OTTHUMG00000158836	ENST00000233027.5:c.403C>G	3.37:g.52800349G>C	ENSP00000233027:p.Gln135Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5YM70|B2R633|B7Z200|Q6P576	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.Q135E	ENST00000233027.5	37	c.403	CCDS2863.1	3	.	.	.	.	.	.	.	.	.	.	G	25.7	4.668831	0.88348	.	.	ENSG00000114904	ENST00000233027;ENST00000535191;ENST00000383721;ENST00000461689	T;T;T;T	0.20069	2.12;2.1;2.12;2.1	5.95	5.08	0.68730	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.25791	0.0628	N	0.04655	-0.195	0.80722	D	1	D;D;D	0.89917	1.0;0.999;0.999	D;D;D	0.91635	0.999;0.993;0.996	T	0.43798	-0.9369	10	0.72032	D	0.01	.	14.9996	0.71462	0.068:0.0:0.932:0.0	.	46;135;135	B7Z200;P51957-2;P51957	.;.;NEK4_HUMAN	E	135;46;135;46	ENSP00000233027:Q135E;ENSP00000437703:Q46E;ENSP00000373227:Q135E;ENSP00000419666:Q46E	ENSP00000233027:Q135E	Q	-	1	0	NEK4	52775389	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.471000	0.97696	1.521000	0.48983	0.655000	0.94253	CAA	NEK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.358	NEK4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NEK4	HGNC	protein_coding	OTTHUMT00000352386.2	G	NM_003157		52800349	-1	no_errors	ENST00000233027	ensembl	human	known	70_37	missense	SNP	1.000	C
NKX3-1	4824	genome.wustl.edu	37	8	23538902	23538902	+	Silent	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:23538902A>G	ENST00000380871.4	-	2	574	c.537T>C	c.(535-537)acT>acC	p.T179T	NKX3-1_ENST00000523261.1_Silent_p.T104T	NM_006167.3	NP_006158.2	Q99801	NKX31_HUMAN	NK3 homeobox 1	179					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|androgen receptor signaling pathway (GO:0030521)|branching involved in prostate gland morphogenesis (GO:0060442)|branching morphogenesis of an epithelial tube (GO:0048754)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to steroid hormone stimulus (GO:0071383)|cellular response to tumor necrosis factor (GO:0071356)|dorsal aorta development (GO:0035907)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|heart development (GO:0007507)|male gonad development (GO:0008584)|metanephros development (GO:0001656)|mitotic cell cycle arrest (GO:0071850)|multicellular organismal development (GO:0007275)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of gene expression (GO:0010629)|negative regulation of insulin-like growth factor receptor signaling pathway (GO:0043569)|negative regulation of mitotic cell cycle (GO:0045930)|negative regulation of transcription, DNA-templated (GO:0045892)|pharyngeal system development (GO:0060037)|positive regulation of androgen secretion (GO:2000836)|positive regulation of apoptotic signaling pathway (GO:2001235)|positive regulation of cell death (GO:0010942)|positive regulation of cell division (GO:0051781)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of gene expression (GO:0010628)|positive regulation of intrinsic apoptotic signaling pathway (GO:2001244)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of response to DNA damage stimulus (GO:2001022)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|protein kinase B signaling (GO:0043491)|regulation of transcription, DNA-templated (GO:0006355)|response to testosterone (GO:0033574)|salivary gland development (GO:0007431)|somitogenesis (GO:0001756)|steroid hormone mediated signaling pathway (GO:0043401)	intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor activity (GO:0004882)|core promoter binding (GO:0001047)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|histone deacetylase binding (GO:0042826)|protein kinase activator activity (GO:0030295)|protein self-association (GO:0043621)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity (GO:0000983)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			large_intestine(3)|lung(4)|prostate(5)|skin(2)	14		Prostate(55;0.114)		Colorectal(74;0.0146)|COAD - Colon adenocarcinoma(73;0.061)|BRCA - Breast invasive adenocarcinoma(99;0.0708)		GCTTTCGCTTAGTCTTATAGC	0.587																																																	0													161.0	158.0	159.0					8																	23538902		2203	4300	6503	SO:0001819	synonymous_variant	4824				CCDS6042.1, CCDS59095.1	8p21.2	2012-03-09	2007-07-09	2002-10-04	ENSG00000167034	ENSG00000167034		"""Homeoboxes / ANTP class : NKL subclass"""	7838	protein-coding gene	gene with protein product		602041	"""NK homeobox (Drosophila), family 3, A"", ""NK3 transcription factor related, locus 1 (Drosophila)"""	NKX3A		9226374	Standard	NM_006167		Approved	NKX3.1, BAPX2	uc011kzx.2	Q99801	OTTHUMG00000097851	ENST00000380871.4:c.537T>C	8.37:g.23538902A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O15465|Q9H2P4|Q9H2P5|Q9H2P6|Q9H2P7|Q9HBG0	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.T179	ENST00000380871.4	37	c.537	CCDS6042.1	8																																																																																			NKX3-1	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa		0.587	NKX3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKX3-1	HGNC	protein_coding	OTTHUMT00000215141.2	A			23538902	-1	no_errors	ENST00000380871	ensembl	human	known	70_37	silent	SNP	1.000	G
NLRP11	204801	genome.wustl.edu	37	19	56312940	56312940	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:56312940C>T	ENST00000589093.1	-	5	2262	c.2169G>A	c.(2167-2169)ctG>ctA	p.L723L	NLRP11_ENST00000592953.1_Silent_p.L624L|NLRP11_ENST00000589824.2_Silent_p.L669L|NLRP11_ENST00000360133.3_Silent_p.L669L|NLRP11_ENST00000443188.1_Silent_p.L723L			P59045	NAL11_HUMAN	NLR family, pyrin domain containing 11	723							ATP binding (GO:0005524)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, reduced ascorbate as one donor, and incorporation of one atom of oxygen (GO:0016715)|poly(A) RNA binding (GO:0044822)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|prostate(1)|skin(5)|stomach(2)|upper_aerodigestive_tract(3)	66		Colorectal(82;0.0002)		GBM - Glioblastoma multiforme(193;0.0325)		CAACTCACCTCAGATGACTTA	0.493																																																	0													121.0	102.0	108.0					19																	56312940		2203	4300	6503	SO:0001819	synonymous_variant	204801			AY095145	CCDS12935.1, CCDS74458.1	19q13.43	2008-02-05	2006-12-08	2006-12-08		ENSG00000179873		"""Nucleotide-binding domain and leucine rich repeat containing"""	22945	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 11"""	609664	"""NACHT, leucine rich repeat and PYD containing 11"""	NALP11		12563287, 12019269	Standard	NM_145007		Approved	PYPAF6, NOD17, PAN10, CLR19.6	uc010ygf.2	P59045		ENST00000589093.1:c.2169G>A	19.37:g.56312940C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JSF5|Q2TV85|Q2TV86|Q53ZZ0|Q8NBF5	Silent	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.L723	ENST00000589093.1	37	c.2169	CCDS12935.1	19																																																																																			NLRP11	-	NULL		0.493	NLRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP11	HGNC	protein_coding	OTTHUMT00000453657.1	C	NM_145007		56312940	-1	no_errors	ENST00000443188	ensembl	human	known	70_37	silent	SNP	0.050	T
NME7	29922	genome.wustl.edu	37	1	169293721	169293721	+	Silent	SNP	G	G	A	rs1140523	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:169293721G>A	ENST00000367811.3	-	2	277	c.21C>T	c.(19-21)ttC>ttT	p.F7F	NME7_ENST00000469474.1_5'Flank|NME7_ENST00000472647.1_Intron|RP4-800F24.1_ENST00000432081.1_RNA	NM_013330.3	NP_037462.1	Q9Y5B8	NDK7_HUMAN	NME/NM23 family member 7	7	DM10. {ECO:0000255|PROSITE- ProRule:PRU00665}.				brain development (GO:0007420)|ciliary receptor clustering involved in smoothened signaling pathway (GO:0060830)|CTP biosynthetic process (GO:0006241)|determination of left/right symmetry (GO:0007368)|epithelial cilium movement (GO:0003351)|GTP biosynthetic process (GO:0006183)|intraciliary transport (GO:0042073)|left/right pattern formation (GO:0060972)|UTP biosynthetic process (GO:0006228)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|nucleoside diphosphate kinase activity (GO:0004550)			central_nervous_system(1)|kidney(1)|large_intestine(5)|lung(8)|skin(1)	16	all_hematologic(923;0.208)					CAATGAAAACGAATCTTTCAC	0.348													G|||	1137	0.227037	0.1732	0.389	5008	,	,		17160	0.0238		0.4394	False		,,,				2504	0.1759																0								G	,	999,3407	373.4+/-320.8	115,769,1319	86.0	81.0	83.0		21,	-1.0	0.5	1	dbSNP_116	83	3677,4923	525.5+/-380.8	784,2109,1407	no	coding-synonymous,intron	NME7	NM_013330.3,NM_197972.1	,	899,2878,2726	AA,AG,GG		42.7558,22.6736,35.9526	,	7/377,	169293721	4676,8330	2203	4300	6503	SO:0001819	synonymous_variant	29922			AF153191	CCDS1277.1, CCDS44274.1	1q24.2	2014-07-31	2012-05-18		ENSG00000143156	ENSG00000143156			20461	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 67"""	613465	"""non-metastatic cells 7, protein expressed in (nucleoside-diphosphate kinase)"""			19852809	Standard	NM_197972		Approved	FLJ37194, NM23-H7, CFAP67	uc001gfu.3	Q9Y5B8	OTTHUMG00000034586	ENST00000367811.3:c.21C>T	1.37:g.169293721G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3T6|A8MY09|B3KSW9|Q5TGZ4	Silent	SNP	pfam_Nucleoside_diP_kinase,superfamily_Nucleoside_diP_kinase,smart_Uncharacterised_DM10,smart_Nucleoside_diP_kinase,pirsf_NDK7,prints_Nucleoside_diP_kinase	p.F7	ENST00000367811.3	37	c.21	CCDS1277.1	1																																																																																			NME7	-	smart_Uncharacterised_DM10,pirsf_NDK7		0.348	NME7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NME7	HGNC	protein_coding	OTTHUMT00000083688.1	G	NM_013330		169293721	-1	no_errors	ENST00000367811	ensembl	human	known	70_37	silent	SNP	0.718	A
NMT1	4836	genome.wustl.edu	37	17	43171154	43171154	+	Silent	SNP	C	C	T	rs1132898	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:43171154C>T	ENST00000592782.1	+	5	618	c.487C>T	c.(487-489)Ctg>Ttg	p.L163L	NMT1_ENST00000590114.1_3'UTR|NMT1_ENST00000258960.2_Silent_p.L163L			P30419	NMT1_HUMAN	N-myristoyltransferase 1	163					apoptotic process (GO:0006915)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway (GO:0097193)|N-terminal protein myristoylation (GO:0006499)|phototransduction, visible light (GO:0007603)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|protein lipoylation (GO:0009249)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|viral process (GO:0016032)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	catalytic activity (GO:0003824)|glycylpeptide N-tetradecanoyltransferase activity (GO:0004379)			breast(2)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|prostate(1)	8		Prostate(33;0.155)				TGCTTTGGACCTGGGCGATCG	0.592													C|||	997	0.199081	0.3616	0.134	5008	,	,		16891	0.0367		0.1769	False		,,,				2504	0.2157																0								C		1432,2974	464.5+/-353.9	247,938,1018	79.0	65.0	70.0		487	4.1	1.0	17	dbSNP_86	70	1747,6853	316.3+/-312.7	170,1407,2723	no	coding-synonymous	NMT1	NM_021079.3		417,2345,3741	TT,TC,CC		20.314,32.5011,24.4426		163/497	43171154	3179,9827	2203	4300	6503	SO:0001819	synonymous_variant	4836				CCDS11494.1	17q21.31	2012-10-02			ENSG00000136448	ENSG00000136448			7857	protein-coding gene	gene with protein product	"""alternative, short form NMT-S"", ""myristoyl-CoA:protein N-myristoyltransferase"", ""long form, NMT-L"""	160993				1570339	Standard	NM_021079		Approved	NMT	uc002ihz.3	P30419	OTTHUMG00000180003	ENST00000592782.1:c.487C>T	17.37:g.43171154C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7C1|Q9UE09	Silent	SNP	pfam_MyristoylCoA_TrFase_C,pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase	p.L163	ENST00000592782.1	37	c.487	CCDS11494.1	17																																																																																			NMT1	-	pfam_MyristoylCoA_TrFase_N,superfamily_Acyl_CoA_acyltransferase,pirsf_MyristoylCoA_TrFase		0.592	NMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMT1	HGNC	protein_coding	OTTHUMT00000449239.1	C	NM_021079		43171154	+1	no_errors	ENST00000258960	ensembl	human	known	70_37	silent	SNP	1.000	T
NPHP3	27031	genome.wustl.edu	37	3	132401567	132401567	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:132401567C>T	ENST00000337331.5	-	26	3878	c.3792G>A	c.(3790-3792)ctG>ctA	p.L1264L	NPHP3_ENST00000326682.8_3'UTR	NM_153240.4	NP_694972.3	Q7Z494	NPHP3_HUMAN	nephronophthisis 3 (adolescent)	1264					atrial septum development (GO:0003283)|cilium morphogenesis (GO:0060271)|convergent extension involved in gastrulation (GO:0060027)|determination of intestine left/right asymmetry (GO:0071908)|determination of left/right symmetry (GO:0007368)|determination of liver left/right asymmetry (GO:0071910)|determination of pancreatic left/right asymmetry (GO:0035469)|determination of stomach left/right asymmetry (GO:0071909)|epithelial cilium movement involved in determination of left/right asymmetry (GO:0060287)|establishment or maintenance of cell polarity (GO:0007163)|extracellular matrix organization (GO:0030198)|heart looping (GO:0001947)|kidney development (GO:0001822)|kidney morphogenesis (GO:0060993)|lipid metabolic process (GO:0006629)|lung development (GO:0030324)|maintenance of organ identity (GO:0048496)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|photoreceptor cell maintenance (GO:0045494)|regulation of cAMP metabolic process (GO:0030814)|regulation of planar cell polarity pathway involved in neural tube closure (GO:2000167)|regulation of Wnt signaling pathway, planar cell polarity pathway (GO:2000095)|ureter development (GO:0072189)|Wnt signaling pathway (GO:0016055)	cilium (GO:0005929)|primary cilium (GO:0072372)				NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(5)|lung(15)|ovary(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	42						CTAAATTTTTCAGTGTTTCTC	0.338																																																	0													103.0	108.0	107.0					3																	132401567		2203	4300	6503	SO:0001819	synonymous_variant	27031			AB056657	CCDS3078.1	3q22	2014-07-18			ENSG00000113971	ENSG00000113971		"""Tetratricopeptide (TTC) repeat domain containing"""	7907	protein-coding gene	gene with protein product	"""nephrocystin-3"", ""Meckel syndrome, type 7"", ""cilia and flagella associated protein 31"""	608002				12872122, 15381417	Standard	NM_153240		Approved	NPH3, KIAA2000, FLJ30691, FLJ36696, MKS7, SLSN3, CFAP31	uc003epe.2	Q7Z494	OTTHUMG00000159713	ENST00000337331.5:c.3792G>A	3.37:g.132401567C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JPE3|Q5JPE6|Q68D99|Q6NVH3|Q7Z492|Q7Z493|Q8N9R2|Q8NCM5|Q96N70|Q96NK2	Silent	SNP	pfam_TPR-1,pfam_TPR-3,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.L1264	ENST00000337331.5	37	c.3792	CCDS3078.1	3																																																																																			NPHP3	-	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom		0.338	NPHP3-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NPHP3	HGNC	protein_coding	OTTHUMT00000357020.2	C	NM_153240		132401567	-1	no_errors	ENST00000337331	ensembl	human	known	70_37	silent	SNP	0.998	T
NPPB	4879	genome.wustl.edu	37	1	11917620	11917621	+	3'UTR	INS	-	-	A	rs543928951|rs35207557|rs35458601	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:11917620_11917621insA	ENST00000376468.3	-	0	593_594					NM_002521.2	NP_002512.1	P16860	ANFB_HUMAN	natriuretic peptide B						body fluid secretion (GO:0007589)|cell surface receptor signaling pathway (GO:0007166)|cGMP biosynthetic process (GO:0006182)|negative regulation of angiogenesis (GO:0016525)|negative regulation of cell growth (GO:0030308)|positive regulation of renal sodium excretion (GO:0035815)|positive regulation of urine volume (GO:0035810)|receptor guanylyl cyclase signaling pathway (GO:0007168)|regulation of blood pressure (GO:0008217)|regulation of blood vessel size (GO:0050880)|regulation of vascular permeability (GO:0043114)|regulation of vasodilation (GO:0042312)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|protein complex (GO:0043234)	diuretic hormone activity (GO:0008613)|hormone activity (GO:0005179)|receptor binding (GO:0005102)			haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;4.88e-06)|COAD - Colon adenocarcinoma(227;0.000241)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|Kidney(185;0.000722)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)	Carvedilol(DB01136)	ATAAATACATTAAAAAAATGAG	0.376													?|AAAAAAA|AAAAAAAA|unsure	1471	0.29373	0.3714	0.2032	5008	,	,		17585	0.0823		0.3797	False		,,,				2504	0.3824																0																																										SO:0001624	3_prime_UTR_variant	4879			BC025785	CCDS140.1	1p36.2	2014-01-30	2010-11-09		ENSG00000120937	ENSG00000120937		"""Endogenous ligands"""	7940	protein-coding gene	gene with protein product		600295	"""natriuretic peptide precursor B"""			2597152	Standard	NM_002521		Approved		uc001atj.3	P16860	OTTHUMG00000002389	ENST00000376468.3:c.*92->T	1.37:g.11917627_11917627dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B0ZBE9|Q6FGY0|Q9P2Q7	RNA	INS	-	NULL	ENST00000376468.3	37	NULL	CCDS140.1	1																																																																																			NPPB	-	-		0.376	NPPB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPPB	HGNC	protein_coding	OTTHUMT00000006854.1	-	NM_002521		11917621	-1	no_errors	ENST00000474547	ensembl	human	known	70_37	rna	INS	0.005:0.009	A
NPY2R	4887	genome.wustl.edu	37	4	156135804	156135804	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:156135804C>T	ENST00000329476.3	+	2	1202	c.713C>T	c.(712-714)tCc>tTc	p.S238F	NPY2R_ENST00000506608.1_Missense_Mutation_p.S238F	NM_000910.2	NP_000901.1	P49146	NPY2R_HUMAN	neuropeptide Y receptor Y2	238					adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|behavioral fear response (GO:0001662)|cardiac left ventricle morphogenesis (GO:0003214)|locomotory behavior (GO:0007626)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|negative regulation of feeding behavior (GO:2000252)|negative regulation of neurological system process (GO:0031645)|negative regulation of secretion (GO:0051048)|negative regulation of synaptic transmission, glutamatergic (GO:0051967)|neuropeptide signaling pathway (GO:0007218)|nitric oxide mediated signal transduction (GO:0007263)|outflow tract morphogenesis (GO:0003151)|positive regulation of cell adhesion (GO:0045785)|positive regulation of circadian sleep/wake cycle, non-REM sleep (GO:0046010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of dopamine secretion (GO:0033603)|positive regulation of peptide secretion (GO:0002793)|positive regulation of smooth muscle contraction (GO:0045987)|regulation of sensory perception of pain (GO:0051930)|secretion (GO:0046903)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel regulator activity (GO:0005246)|neuropeptide Y receptor activity (GO:0004983)|peptide YY receptor activity (GO:0001601)|receptor activity (GO:0004872)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(17)|prostate(1)|skin(5)|urinary_tract(1)	36	all_hematologic(180;0.24)	Renal(120;0.0854)			Cysteamine(DB00847)	ATATCATTTTCCTACACTCGC	0.443																																																	0													96.0	97.0	97.0					4																	156135804		2203	4300	6503	SO:0001583	missense	4887			U42766	CCDS3791.1	4q31	2012-08-08				ENSG00000185149		"""GPCR / Class A : Neuropeptide receptors : Y"""	7957	protein-coding gene	gene with protein product		162642				7559383	Standard	NM_000910		Approved		uc003ioq.3	P49146		ENST00000329476.3:c.713C>T	4.37:g.156135804C>T	ENSP00000332591:p.Ser238Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13281|Q13457|Q4W5G7|Q6AZZ6|Q9UE67	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY2_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt,prints_NPFF_rcpt	p.S238F	ENST00000329476.3	37	c.713	CCDS3791.1	4	.	.	.	.	.	.	.	.	.	.	C	14.94	2.684370	0.47991	.	.	ENSG00000185149	ENST00000329476;ENST00000506608	T;T	0.42513	0.97;0.97	5.74	5.74	0.90152	GPCR, rhodopsin-like superfamily (1);	0.050013	0.85682	D	0.000000	T	0.40423	0.1116	N	0.12422	0.21	0.46376	D	0.999014	P	0.39071	0.658	P	0.47891	0.56	T	0.43845	-0.9366	10	0.72032	D	0.01	.	18.9139	0.92496	0.0:1.0:0.0:0.0	.	238	P49146	NPY2R_HUMAN	F	238	ENSP00000332591:S238F;ENSP00000426366:S238F	ENSP00000332591:S238F	S	+	2	0	NPY2R	156355254	1.000000	0.71417	0.990000	0.47175	0.946000	0.59487	6.079000	0.71291	2.709000	0.92574	0.643000	0.83706	TCC	NPY2R	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_NPY2_rcpt,prints_GPCR_Rhodpsn		0.443	NPY2R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPY2R	HGNC	protein_coding	OTTHUMT00000365128.1	C	NM_000910		156135804	+1	no_errors	ENST00000329476	ensembl	human	known	70_37	missense	SNP	1.000	T
NSA2	10412	genome.wustl.edu	37	5	74069849	74069849	+	Silent	SNP	T	T	C	rs374489548		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:74069849T>C	ENST00000296802.5	+	5	1048	c.679T>C	c.(679-681)Ttg>Ctg	p.L227L		NM_014886.3	NP_055701.1	O95478	NSA2_HUMAN	NSA2 ribosome biogenesis homolog (S. cerevisiae)	227					rRNA processing (GO:0006364)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|kidney(1)|lung(1)|ovary(1)|skin(1)	7						TGTGAGCGAATTGGGCCTTGT	0.398																																																	0								T		0,4406		0,0,2203	106.0	101.0	103.0		679	-8.6	0.5	5		103	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	NSA2	NM_014886.3		0,1,6502	CC,CT,TT		0.0116,0.0,0.0077		227/261	74069849	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	10412			AF077615	CCDS4025.1, CCDS75260.1	5q13.3	2010-01-18			ENSG00000164346	ENSG00000164346			30728	protein-coding gene	gene with protein product	"""hairy cell leukemia protein 1"", ""TGF beta-inducible nuclear protein 1"""	612497				11124703, 10486207	Standard	NM_014886		Approved	HUSSY-29, HCLG1, FLJ94393, TINP1	uc003kdk.2	O95478	OTTHUMG00000131273	ENST00000296802.5:c.679T>C	5.37:g.74069849T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ribosomal_S8e/biogenesis_NSA2	p.L227	ENST00000296802.5	37	c.679	CCDS4025.1	5																																																																																			NSA2	-	pfam_Ribosomal_S8e/biogenesis_NSA2		0.398	NSA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NSA2	HGNC	protein_coding	OTTHUMT00000254041.3	T	NM_014886		74069849	+1	no_errors	ENST00000296802	ensembl	human	known	70_37	silent	SNP	0.965	C
NRG2	9542	genome.wustl.edu	37	5	139235358	139235358	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:139235358C>T	ENST00000361474.1	-	6	1419	c.1195G>A	c.(1195-1197)Gag>Aag	p.E399K	NRG2_ENST00000340391.3_Missense_Mutation_p.E196K|NRG2_ENST00000358522.3_Missense_Mutation_p.E401K|NRG2_ENST00000545385.1_Missense_Mutation_p.E401K|NRG2_ENST00000394770.1_Silent_p.P418P|NRG2_ENST00000541337.1_Missense_Mutation_p.E333K|NRG2_ENST00000289409.4_Missense_Mutation_p.E393K|CTB-35F21.4_ENST00000504413.1_RNA|NRG2_ENST00000289422.7_Missense_Mutation_p.E407K	NM_004883.2	NP_004874.1	O14511	NRG2_HUMAN	neuregulin 2	399					embryo development (GO:0009790)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol-mediated signaling (GO:0048015)|signal transduction (GO:0007165)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(2)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(5)|ovary(1)|pancreas(2)|prostate(1)|skin(1)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	25			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TACAGCTCCTCGGCTTCTGCA	0.602																																																	0													113.0	104.0	107.0					5																	139235358		2203	4300	6503	SO:0001583	missense	9542				CCDS4217.1, CCDS54910.1	5q23-q33	2013-01-11			ENSG00000158458	ENSG00000158458		"""Immunoglobulin superfamily / I-set domain containing"""	7998	protein-coding gene	gene with protein product	"""neural- and thymus-derived activator for ErbB kinases"", ""divergent of neuregulin-1"""	603818				9168114, 9168115	Standard	NM_004883		Approved	Don-1, NTAK, HRG2	uc003lev.2	O14511	OTTHUMG00000129241	ENST00000361474.1:c.1195G>A	5.37:g.139235358C>T	ENSP00000354910:p.Glu399Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Neuregulin_1_C,pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_EG-like_dom,pfscan_Ig-like	p.E401K	ENST00000361474.1	37	c.1201	CCDS4217.1	5	.	.	.	.	.	.	.	.	.	.	C	35	5.421707	0.96111	.	.	ENSG00000158458	ENST00000541337;ENST00000289422;ENST00000361474;ENST00000446269;ENST00000545385;ENST00000340391;ENST00000289409;ENST00000358522	T;T;T;T;T;T;T	0.61742	0.08;0.08;0.08;0.08;0.08;1.61;0.08	5.02	5.02	0.67125	Neuregulin 1-related, C-terminal (1);	0.065283	0.64402	D	0.000011	T	0.77471	0.4135	M	0.77313	2.365	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.997;0.998;0.997;0.997	T	0.80360	-0.1415	10	0.62326	D	0.03	-30.8951	18.3286	0.90261	0.0:1.0:0.0:0.0	.	393;399;401;407	O14511-2;O14511;O14511-4;O14511-3	.;NRG2_HUMAN;.;.	K	333;407;399;407;401;196;393;401	ENSP00000444235:E333K;ENSP00000289422:E407K;ENSP00000354910:E399K;ENSP00000438753:E401K;ENSP00000342660:E196K;ENSP00000289409:E393K;ENSP00000351323:E401K	ENSP00000289409:E393K	E	-	1	0	NRG2	139215542	1.000000	0.71417	0.980000	0.43619	0.765000	0.43378	7.729000	0.84864	2.342000	0.79632	0.462000	0.41574	GAG	NRG2	-	pfam_Neuregulin_1_C		0.602	NRG2-001	KNOWN	basic|CCDS	protein_coding	NRG2	HGNC	protein_coding	OTTHUMT00000251340.1	C	NM_013982		139235358	-1	no_errors	ENST00000545385	ensembl	human	known	70_37	missense	SNP	1.000	T
NT5C3B	115024	genome.wustl.edu	37	17	39991472	39991472	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:39991472C>T	ENST00000435506.2	-	3	233	c.164G>A	c.(163-165)cGa>cAa	p.R55Q	RN7SL871P_ENST00000583512.1_RNA|NT5C3B_ENST00000269534.8_Missense_Mutation_p.R47Q|KLHL10_ENST00000293303.4_5'Flank|NT5C3B_ENST00000521789.1_Missense_Mutation_p.R22Q			Q969T7	5NT3B_HUMAN	5'-nucleotidase, cytosolic IIIB	55					nucleotide metabolic process (GO:0009117)	cytoplasm (GO:0005737)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)										AGAAGGGCATCGCTTTCCATT	0.403																																																	0													127.0	112.0	117.0					17																	39991472		2203	4300	6503	SO:0001583	missense	115024				CCDS11410.1, CCDS11410.2	17q21.2	2013-01-31	2013-01-31	2013-01-31	ENSG00000141698	ENSG00000141698	3.1.3.5		28300	protein-coding gene	gene with protein product			"""5'-nucleotidase, cytosolic III-like"""	NT5C3L		23223233	Standard	NM_052935		Approved	MGC20781	uc021txo.1	Q969T7	OTTHUMG00000133499	ENST00000435506.2:c.164G>A	17.37:g.39991472C>T	ENSP00000389948:p.Arg55Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWB9|C9JKC4|Q7L3B7	Missense_Mutation	SNP	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu	p.R47Q	ENST00000435506.2	37	c.140	CCDS11410.2	17	.	.	.	.	.	.	.	.	.	.	C	31	5.095210	0.94197	.	.	ENSG00000141698	ENST00000269534;ENST00000521789;ENST00000393911;ENST00000435506;ENST00000415460	D;D;D;D	0.82893	-1.66;-1.66;-1.66;-1.66	4.56	3.58	0.41010	HAD-like domain (1);	0.062956	0.64402	D	0.000013	D	0.90051	0.6893	M	0.80847	2.515	0.51767	D	0.99993	D;D;D	0.89917	0.999;1.0;0.998	P;D;P	0.68353	0.683;0.957;0.683	D	0.89901	0.4044	10	0.41790	T	0.15	1.8599	14.3371	0.66598	0.0:0.8505:0.1495:0.0	.	55;22;47	C9JKC4;E5RH64;Q969T7	.;.;5NT3L_HUMAN	Q	47;22;89;55;55	ENSP00000269534:R47Q;ENSP00000429878:R22Q;ENSP00000389948:R55Q;ENSP00000397742:R55Q	ENSP00000269534:R47Q	R	-	2	0	NT5C3L	37244998	0.990000	0.36364	0.998000	0.56505	0.987000	0.75469	5.747000	0.68689	1.122000	0.41944	0.558000	0.71614	CGA	NT5C3L	-	pfam_Pyrimidine_nucleotidase_eu,superfamily_HAD-like_dom,tigrfam_Pyrimidine_nucleotidase_eu		0.403	NT5C3B-008	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NT5C3L	HGNC	protein_coding	OTTHUMT00000257430.2	C	NM_052935		39991472	-1	no_errors	ENST00000269534	ensembl	human	known	70_37	missense	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228496035	228496035	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:228496035C>T	ENST00000422127.1	+	47	12734	c.12690C>T	c.(12688-12690)gtC>gtT	p.V4230V	OBSCN_ENST00000284548.11_Silent_p.V4230V|OBSCN_ENST00000570156.2_Silent_p.V5187V|OBSCN_ENST00000366707.4_Silent_p.V1864V|OBSCN_ENST00000366709.4_Silent_p.V1349V	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	4230	Ig-like 43.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CTGGCACTGTCTCCTTCCATT	0.627																																																	0													28.0	32.0	30.0					1																	228496035		2122	4227	6349	SO:0001819	synonymous_variant	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.12690C>T	1.37:g.228496035C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.V4230	ENST00000422127.1	37	c.12690	CCDS58065.1	1																																																																																			OBSCN	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2		0.627	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		C	NM_052843		228496035	+1	no_errors	ENST00000422127	ensembl	human	known	70_37	silent	SNP	0.996	T
OBSL1	23363	genome.wustl.edu	37	2	220427347	220427347	+	Silent	SNP	G	G	T	rs10804275	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:220427347G>T	ENST00000404537.1	-	8	2786	c.2730C>A	c.(2728-2730)gcC>gcA	p.A910A	OBSL1_ENST00000373873.4_Silent_p.A910A|OBSL1_ENST00000373876.1_Silent_p.A910A|OBSL1_ENST00000289656.3_Silent_p.A497A|RP11-256I23.2_ENST00000597192.1_RNA|OBSL1_ENST00000265318.4_Silent_p.A910A|OBSL1_ENST00000603926.1_Silent_p.A910A	NM_015311.2	NP_056126.1	O75147	OBSL1_HUMAN	obscurin-like 1	910	Ig-like 7.				cardiac myofibril assembly (GO:0055003)|cytoskeleton organization (GO:0007010)|Golgi organization (GO:0007030)|microtubule cytoskeleton organization (GO:0000226)|positive regulation of dendrite morphogenesis (GO:0050775)|protein localization to Golgi apparatus (GO:0034067)|regulation of mitosis (GO:0007088)	3M complex (GO:1990393)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|intercalated disc (GO:0014704)|M band (GO:0031430)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	cytoskeletal adaptor activity (GO:0008093)						Renal(207;0.0376)		Epithelial(149;2.02e-07)|all cancers(144;1.68e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00834)		CCAGGCGCACGGCTGCCACAT	0.672													G|||	850	0.169728	0.0983	0.2608	5008	,	,		17634	0.2123		0.2406	False		,,,				2504	0.0849																0								G	,,	601,3791		49,503,1644	29.0	35.0	33.0		2730,2730,2730	-4.7	0.6	2	dbSNP_120	33	2123,6451		272,1579,2436	no	coding-synonymous,coding-synonymous,coding-synonymous	OBSL1	NM_001173408.1,NM_001173431.1,NM_015311.2	,,	321,2082,4080	TT,TG,GG		24.7609,13.684,21.0088	,,	910/1026,910/1544,910/1897	220427347	2724,10242	2196	4287	6483	SO:0001819	synonymous_variant	23363			BC007201	CCDS46520.1, CCDS54433.1, CCDS63134.1	2q35	2013-01-29			ENSG00000124006	ENSG00000124006		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	29092	protein-coding gene	gene with protein product		610991				9734811	Standard	NM_015311		Approved	KIAA0657	uc010fwk.3	O75147	OTTHUMG00000059157	ENST00000404537.1:c.2730C>A	2.37:g.220427347G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4KVA4|A4KVA5|Q96IW3|S4R3M6	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.A910	ENST00000404537.1	37	c.2730	CCDS46520.1	2																																																																																			OBSL1	-	smart_Ig_sub,pfscan_Ig-like		0.672	OBSL1-014	KNOWN	basic|appris_principal|CCDS	protein_coding	OBSL1	HGNC	protein_coding	OTTHUMT00000322012.1	G			220427347	-1	no_errors	ENST00000404537	ensembl	human	known	70_37	silent	SNP	0.398	T
OGFR	11054	genome.wustl.edu	37	20	61442885	61442885	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:61442885G>A	ENST00000290291.6	+	6	562	c.537G>A	c.(535-537)ggG>ggA	p.G179G	OGFR_ENST00000370461.1_Silent_p.G127G	NM_007346.2	NP_031372.2	Q9NZT2	OGFR_HUMAN	opioid growth factor receptor	179					opioid receptor signaling pathway (GO:0038003)|regulation of cell growth (GO:0001558)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	opioid receptor activity (GO:0004985)			endometrium(2)|kidney(1)|lung(4)|prostate(3)|skin(4)|upper_aerodigestive_tract(3)	17	Breast(26;3.65e-08)					GCTTCTACGGGATCCGGCTGG	0.637																																																	0													22.0	24.0	23.0					20																	61442885		2191	4293	6484	SO:0001819	synonymous_variant	11054			AF109134	CCDS13504.1	20q13.3	2008-05-02			ENSG00000060491	ENSG00000060491			15768	protein-coding gene	gene with protein product		606459				10677613	Standard	NM_007346		Approved	7-60	uc002ydj.3	Q9NZT2	OTTHUMG00000032937	ENST00000290291.6:c.537G>A	20.37:g.61442885G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O96029|Q4VXW5|Q96CM2|Q9BQW1|Q9H4H0|Q9H7J5|Q9NZT3|Q9NZT4	Silent	SNP	pfam_OGF_rcpt,pfam_OGF_rcpt_rpt	p.G179	ENST00000290291.6	37	c.537	CCDS13504.1	20	.	.	.	.	.	.	.	.	.	.	G	3.723	-0.057204	0.07317	.	.	ENSG00000060491	ENST00000370469	.	.	.	4.86	-1.75	0.08031	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.9826	0.47504	0.1901:0.5705:0.2394:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	OGFR	60913330	0.049000	0.20398	0.993000	0.49108	0.238000	0.25445	-0.694000	0.05115	-0.142000	0.11354	-0.311000	0.09066	.	OGFR	-	pfam_OGF_rcpt		0.637	OGFR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OGFR	HGNC	protein_coding	OTTHUMT00000080067.1	G			61442885	+1	no_errors	ENST00000290291	ensembl	human	known	70_37	silent	SNP	0.898	A
OPHN1	4983	genome.wustl.edu	37	X	67432048	67432048	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:67432048C>T	ENST00000355520.5	-	8	1245	c.604G>A	c.(604-606)Gcc>Acc	p.A202T	OPHN1_ENST00000540071.1_Missense_Mutation_p.A202T	NM_002547.2	NP_002538.1	O60890	OPHN1_HUMAN	oligophrenin 1	202					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|negative regulation of proteasomal protein catabolic process (GO:1901799)|nervous system development (GO:0007399)|regulation of endocytosis (GO:0030100)|regulation of small GTPase mediated signal transduction (GO:0051056)|regulation of synaptic transmission, glutamatergic (GO:0051966)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic vesicle endocytosis (GO:0048488)	actin cytoskeleton (GO:0015629)|cell junction (GO:0030054)|cytosol (GO:0005829)|dendritic spine (GO:0043197)|terminal bouton (GO:0043195)	phospholipid binding (GO:0005543)|Rho GTPase activator activity (GO:0005100)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(13)|ovary(3)|skin(2)	31						TGAAGAAAGGCCAAGACCTAG	0.383																																																	0													82.0	65.0	70.0					X																	67432048		2203	4300	6503	SO:0001583	missense	4983			AJ001189	CCDS14388.1	Xq12	2011-07-04			ENSG00000079482	ENSG00000079482		"""Rho GTPase activating proteins"""	8148	protein-coding gene	gene with protein product		300127	"""mental retardation, X-linked 60"""	MRX60		9195162, 9582072	Standard	NM_002547		Approved	OPN1, ARHGAP41	uc004dww.4	O60890	OTTHUMG00000021744	ENST00000355520.5:c.604G>A	X.37:g.67432048C>T	ENSP00000347710:p.Ala202Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIP8|Q5JQ81|Q6PCC1|Q8WX47	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_Pleckstrin_homology,smart_RhoGAP_dom,pfscan_Pleckstrin_homology,pfscan_RhoGAP_dom	p.A202T	ENST00000355520.5	37	c.604	CCDS14388.1	X	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343983	0.61073	.	.	ENSG00000079482	ENST00000355520;ENST00000540071	T;T	0.04809	3.55;3.55	5.34	5.34	0.76211	.	0.054439	0.64402	D	0.000001	T	0.05502	0.0145	L	0.41573	1.285	0.58432	D	0.999991	B;B;B	0.32653	0.154;0.378;0.379	B;B;B	0.33750	0.028;0.169;0.048	T	0.33954	-0.9848	10	0.51188	T	0.08	.	9.3379	0.38062	0.0:0.9001:0.0:0.0999	.	202;202;202	F5H2E3;Q6PCC1;O60890	.;.;OPHN1_HUMAN	T	202	ENSP00000347710:A202T;ENSP00000438617:A202T	ENSP00000347710:A202T	A	-	1	0	OPHN1	67348773	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.087000	0.64480	2.376000	0.81061	0.600000	0.82982	GCC	OPHN1	-	NULL		0.383	OPHN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OPHN1	HGNC	protein_coding	OTTHUMT00000057011.1	C	NM_002547		67432048	-1	no_errors	ENST00000355520	ensembl	human	known	70_37	missense	SNP	1.000	T
OR10K2	391107	genome.wustl.edu	37	1	158389842	158389842	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:158389842G>A	ENST00000314902.2	-	1	814	c.815C>T	c.(814-816)gCt>gTt	p.A272V		NM_001004476.1	NP_001004476.1	Q6IF99	O10K2_HUMAN	olfactory receptor, family 10, subfamily K, member 2	272						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|breast(1)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(2)|lung(19)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_hematologic(112;0.0378)					TGATATTAGAGCATCCTGGCT	0.388																																																	0													106.0	106.0	106.0					1																	158389842		2203	4300	6503	SO:0001583	missense	391107			AB065642	CCDS30896.1	1q23.1	2012-08-09			ENSG00000180708	ENSG00000180708		"""GPCR / Class A : Olfactory receptors"""	14826	protein-coding gene	gene with protein product							Standard	NM_001004476		Approved		uc010pii.2	Q6IF99	OTTHUMG00000019638	ENST00000314902.2:c.815C>T	1.37:g.158389842G>A	ENSP00000324251:p.Ala272Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A272V	ENST00000314902.2	37	c.815	CCDS30896.1	1	.	.	.	.	.	.	.	.	.	.	g	1.958	-0.439608	0.04636	.	.	ENSG00000180708	ENST00000314902	T	0.00084	8.75	4.23	1.29	0.21616	GPCR, rhodopsin-like superfamily (1);	0.503954	0.16555	N	0.209320	T	0.00039	0.0001	N	0.16130	0.375	0.09310	N	1	B	0.09022	0.002	B	0.14023	0.01	T	0.44726	-0.9309	10	0.66056	D	0.02	.	3.2346	0.06760	0.2875:0.0:0.4387:0.2738	.	272	Q6IF99	O10K2_HUMAN	V	272	ENSP00000324251:A272V	ENSP00000324251:A272V	A	-	2	0	OR10K2	156656466	0.000000	0.05858	0.161000	0.22692	0.005000	0.04900	-0.017000	0.12590	0.167000	0.19631	0.591000	0.81541	GCT	OR10K2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.388	OR10K2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10K2	HGNC	protein_coding	OTTHUMT00000051854.1	G	NM_001004476		158389842	-1	no_errors	ENST00000314902	ensembl	human	known	70_37	missense	SNP	0.000	A
OR1B1	347169	genome.wustl.edu	37	9	125391770	125391771	+	Frame_Shift_Ins	INS	-	-	A	rs398102330|rs78126045|rs11421222	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:125391770_125391771insA	ENST00000304833.3	-	1	81_82	c.44_45insT	c.(43-45)ttgfs	p.L15fs	RP11-64P14.7_ENST00000419604.1_RNA|RP11-64P14.7_ENST00000431442.1_RNA	NM_001004450.1	NP_001004450.1	Q8NGR6	OR1B1_HUMAN	olfactory receptor, family 1, subfamily B, member 1	15						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(6)|prostate(1)	16						ACCCAAGGAGCAAAAAAACCGG	0.475													?|AAAAAAA|AAAAAAAA|unsure	2046	0.408546	0.3888	0.2954	5008	,	,		22113	0.3383		0.504	False		,,,				2504	0.4898																0										1831,2421		393,1045,688						-0.3	0.5		dbSNP_134	87	4104,4128		1026,2052,1038	no	frameshift	OR1B1	NM_001004450.1		1419,3097,1726	A1A1,A1R,RR		49.8542,43.0621,47.5409				5935,6549				SO:0001589	frameshift_variant	347169			AC006313	CCDS35126.1	9q33.2	2012-08-09			ENSG00000171484	ENSG00000171484		"""GPCR / Class A : Olfactory receptors"""	8181	protein-coding gene	gene with protein product							Standard	NM_001004450		Approved	OR9-B	uc011lyz.2	Q8NGR6	OTTHUMG00000020616	ENST00000304833.3:c.45dupT	9.37:g.125391777_125391777dupA	ENSP00000303151:p.Leu15fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFN3	Frame_Shift_Ins	INS	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L15fs	ENST00000304833.3	37	c.45_44	CCDS35126.1	9																																																																																			OR1B1	-	NULL		0.475	OR1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1B1	HGNC	protein_coding	OTTHUMT00000053947.2	-	NM_001004450		125391771	-1	no_errors	ENST00000304833	ensembl	human	novel	70_37	frame_shift_ins	INS	0.004:0.028	A
OR1S1	219959	genome.wustl.edu	37	11	57983167	57983167	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:57983167C>T	ENST00000309433.6	+	1	951	c.951C>T	c.(949-951)ctC>ctT	p.L317L		NM_001004458.1	NP_001004458.1	Q8NH92	OR1S1_HUMAN	olfactory receptor, family 1, subfamily S, member 1	317						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|central_nervous_system(1)|endometrium(24)|kidney(1)|large_intestine(1)|liver(1)|lung(10)|prostate(1)|skin(2)|stomach(3)|urinary_tract(3)	48		Breast(21;0.0589)				TGAGAAAGCTCATCAATAGAA	0.418																																																	0													141.0	140.0	141.0					11																	57983167		2201	4295	6496	SO:0001819	synonymous_variant	219959			BK004299	CCDS31546.1	11q12.1	2012-08-09			ENSG00000172774	ENSG00000172774		"""GPCR / Class A : Olfactory receptors"""	8227	protein-coding gene	gene with protein product							Standard	NM_001004458		Approved	OST034	uc010rkc.2	Q8NH92	OTTHUMG00000167463	ENST00000309433.6:c.951C>T	11.37:g.57983167C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFG3	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L317	ENST00000309433.6	37	c.951	CCDS31546.1	11																																																																																			OR1S1	-	NULL		0.418	OR1S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1S1	HGNC	protein_coding	OTTHUMT00000394705.1	C	NM_001004458		57983167	+1	no_errors	ENST00000309433	ensembl	human	known	70_37	silent	SNP	0.000	T
OR2M2	391194	genome.wustl.edu	37	1	248343929	248343929	+	Silent	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:248343929C>A	ENST00000359682.2	+	1	642	c.642C>A	c.(640-642)atC>atA	p.I214I		NM_001004688.1	NP_001004688.1	Q96R28	OR2M2_HUMAN	olfactory receptor, family 2, subfamily M, member 2	214						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|autonomic_ganglia(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(45)|ovary(3)|prostate(1)|skin(3)	70	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0245)			TTGCAATCATCATTGCTTCCT	0.438																																																	0													235.0	218.0	224.0					1																	248343929		2203	4300	6503	SO:0001819	synonymous_variant	391194			AF399616	CCDS31106.1	1q44	2012-08-09			ENSG00000198601	ENSG00000198601		"""GPCR / Class A : Olfactory receptors"""	8268	protein-coding gene	gene with protein product						12213199	Standard	NM_001004688		Approved	OST423, OR2M2Q	uc010pzf.2	Q96R28	OTTHUMG00000040460	ENST00000359682.2:c.642C>A	1.37:g.248343929C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A3KFT4	Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I214	ENST00000359682.2	37	c.642	CCDS31106.1	1																																																																																			OR2M2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.438	OR2M2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2M2	HGNC	protein_coding	OTTHUMT00000097356.2	C	NM_001004688		248343929	+1	no_errors	ENST00000359682	ensembl	human	known	70_37	silent	SNP	0.108	A
OR2T12	127064	genome.wustl.edu	37	1	248458876	248458876	+	Frame_Shift_Del	DEL	T	T	-	rs11339452	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:248458876delT	ENST00000317996.1	-	1	4	c.5delA	c.(4-6)gagfs	p.E2fs		NM_001004692.1	NP_001004692.1	Q8NG77	O2T12_HUMAN	olfactory receptor, family 2, subfamily T, member 12	2						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E2fs*2(1)|p.E2G(1)		endometrium(4)|kidney(3)|large_intestine(3)|lung(25)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	43	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0201)			ATTTCTCATCTCCATAATTTC	0.428													|||unknown(ALL_OTHER_Ns)	1075	0.214657	0.0159	0.245	5008	,	,		14731	0.3591		0.174	False		,,,				2504	0.3548																2	Substitution - Missense(1)|Deletion - Frameshift(1)	lung(1)|pancreas(1)								202,4060		4,194,1933	66.0	61.0	62.0			-2.7	0.0	1	dbSNP_120	70	1430,6824		123,1184,2820	no	frameshift	OR2T12	NM_001004692.1		127,1378,4753	A1A1,A1R,RR		17.3249,4.7396,13.0393			248458876	1632,10884	2200	4211	6411	SO:0001589	frameshift_variant	127064			BK004485	CCDS31110.1	1q44	2012-08-09			ENSG00000177201	ENSG00000177201		"""GPCR / Class A : Olfactory receptors"""	19592	protein-coding gene	gene with protein product							Standard	NM_001004692		Approved		uc010pzj.2	Q8NG77	OTTHUMG00000040457	ENST00000317996.1:c.5delA	1.37:g.248458876delT	ENSP00000324583:p.Glu2fs	Somatic		WXS	Illumina HiSeq	Phase_IV		Frame_Shift_Del	DEL	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E2fs	ENST00000317996.1	37	c.5	CCDS31110.1	1																																																																																			OR2T12	-	NULL		0.428	OR2T12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T12	HGNC	protein_coding	OTTHUMT00000097353.1	T	NM_001004692		248458876	-1	no_errors	ENST00000317996	ensembl	human	known	70_37	frame_shift_del	DEL	0.004	-
ORMDL2	29095	genome.wustl.edu	37	12	56214128	56214128	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:56214128G>A	ENST00000243045.5	+	4	606	c.411G>A	c.(409-411)ccG>ccA	p.P137P	SARNP_ENST00000444631.2_5'Flank|RP11-762I7.5_ENST00000552719.1_Intron|SARNP_ENST00000552080.1_5'Flank|ORMDL2_ENST00000550836.1_Silent_p.P49P|SARNP_ENST00000336133.3_5'Flank|RP11-762I7.5_ENST00000546837.1_Intron|ORMDL2_ENST00000548974.1_Silent_p.P137P|ORMDL2_ENST00000552672.1_Silent_p.P103P	NM_014182.4	NP_054901.1	Q53FV1	ORML2_HUMAN	ORMDL sphingolipid biosynthesis regulator 2	137					ceramide metabolic process (GO:0006672)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(1)|lung(3)	4						TACTGCTGCCGAAGTTGCCCC	0.507																																																	0													242.0	209.0	220.0					12																	56214128		2203	4300	6503	SO:0001819	synonymous_variant	29095			AF395707	CCDS8893.1	12q13.2	2014-06-16	2014-06-16			ENSG00000123353			16037	protein-coding gene	gene with protein product		610074	"""ORM1 (S. cerevisiae)-like 2"", ""ORM1-like 2 (S. cerevisiae)"""			12093374, 23066021	Standard	NM_014182		Approved	HSPC160, adoplin-2, MST095, MSTP095	uc001shw.1	Q53FV1		ENST00000243045.5:c.411G>A	12.37:g.56214128G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RA58|Q7Z4E5|Q8NFX0|Q9P004	Silent	SNP	pfam_ORMDL,pirsf_ORMDL	p.P137	ENST00000243045.5	37	c.411	CCDS8893.1	12																																																																																			ORMDL2	-	pfam_ORMDL,pirsf_ORMDL		0.507	ORMDL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ORMDL2	HGNC	protein_coding	OTTHUMT00000407934.1	G	NM_014182		56214128	+1	no_errors	ENST00000243045	ensembl	human	known	70_37	silent	SNP	0.765	A
OTUD5	55593	genome.wustl.edu	37	X	48792259	48792259	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:48792259C>T	ENST00000156084.4	-	3	781	c.721G>A	c.(721-723)Gag>Aag	p.E241K	OTUD5_ENST00000428668.2_Missense_Mutation_p.E24K|OTUD5_ENST00000396743.3_Missense_Mutation_p.E241K|OTUD5_ENST00000376488.3_Missense_Mutation_p.E241K|OTUD5_ENST00000484499.1_5'UTR	NM_017602.3	NP_060072.1	Q96G74	OTUD5_HUMAN	OTU deubiquitinase 5	241	OTU. {ECO:0000255|PROSITE- ProRule:PRU00139}.				innate immune response (GO:0045087)|negative regulation of type I interferon production (GO:0032480)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|response to lipopolysaccharide (GO:0032496)	cytosol (GO:0005829)	ubiquitin-specific protease activity (GO:0004843)			endometrium(2)|large_intestine(3)|lung(6)|pancreas(2)	13						CGCACAACCTCATGCATGTCC	0.522																																																	0													84.0	64.0	71.0					X																	48792259		2203	4300	6503	SO:0001583	missense	55593				CCDS14313.1, CCDS48104.1, CCDS48105.1	Xp11.23	2014-06-09	2014-02-24		ENSG00000068308	ENSG00000068308		"""OTU domain containing"""	25402	protein-coding gene	gene with protein product		300713	"""OTU domain containing 5"""			24143256	Standard	NM_001136157		Approved	DKFZp761A052, DUBA	uc004dlu.3	Q96G74	OTTHUMG00000024130	ENST00000156084.4:c.721G>A	X.37:g.48792259C>T	ENSP00000156084:p.Glu241Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DGG7|G5E9D7|Q4KMN9|Q8N6T5|Q9H650|Q9H9U0|Q9NT65	Missense_Mutation	SNP	pfam_OTU,pfscan_OTU	p.E241K	ENST00000156084.4	37	c.721	CCDS14313.1	X	.	.	.	.	.	.	.	.	.	.	C	18.42	3.620329	0.66787	.	.	ENSG00000068308	ENST00000396743;ENST00000453548;ENST00000455452;ENST00000156084;ENST00000376488;ENST00000428668	T;T;T;T;T	0.29917	1.55;1.55;1.55;1.55;1.55	5.71	5.71	0.89125	Ovarian tumour, otubain (2);	0.000000	0.85682	D	0.000000	T	0.15652	0.0377	N	0.04746	-0.17	0.80722	D	1	B;B;B	0.32862	0.004;0.387;0.193	B;B;B	0.28465	0.015;0.09;0.035	T	0.13522	-1.0506	10	0.11182	T	0.66	-23.5141	17.811	0.88616	0.0:1.0:0.0:0.0	.	24;241;241	B4DGG7;Q96G74;G5E9D7	.;OTUD5_HUMAN;.	K	241;217;114;241;241;24	ENSP00000379969:E241K;ENSP00000390767:E114K;ENSP00000156084:E241K;ENSP00000365671:E241K;ENSP00000401629:E24K	ENSP00000156084:E241K	E	-	1	0	OTUD5	48677203	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.725000	0.74752	2.566000	0.86566	0.529000	0.55759	GAG	OTUD5	-	pfam_OTU,pfscan_OTU		0.522	OTUD5-003	KNOWN	basic|CCDS	protein_coding	OTUD5	HGNC	protein_coding	OTTHUMT00000060799.1	C	NM_017602		48792259	-1	no_errors	ENST00000156084	ensembl	human	known	70_37	missense	SNP	1.000	T
OTUD7A	161725	genome.wustl.edu	37	15	31851254	31851254	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:31851254C>T	ENST00000307050.4	-	3	560	c.468G>A	c.(466-468)ctG>ctA	p.L156L	OTUD7A_ENST00000382902.1_Silent_p.L156L	NM_130901.1	NP_570971.1	Q8TE49	OTU7A_HUMAN	OTU deubiquitinase 7A	156					protein K11-linked deubiquitination (GO:0035871)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(7)|large_intestine(4)|lung(11)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(4)	30		all_lung(180;1.6e-09)		all cancers(64;2.44e-19)|Epithelial(43;6.82e-14)|GBM - Glioblastoma multiforme(186;1.49e-05)|BRCA - Breast invasive adenocarcinoma(123;0.00189)|Lung(196;0.208)		TGTACACGCTCAGGTCTGGCA	0.582																																																	0													108.0	81.0	90.0					15																	31851254		2201	4300	6501	SO:0001819	synonymous_variant	161725			AJ430383	CCDS10026.1	15q13.1	2014-02-24	2014-02-24	2006-07-07	ENSG00000169918	ENSG00000169918		"""OTU domain containing"""	20718	protein-coding gene	gene with protein product		612024	"""chromosome 15 open reading frame 16"", ""OTU domain containing 7"", ""OTU domain containing 7A"""	C15orf16, OTUD7		23827681	Standard	NM_130901		Approved	CEZANNE2	uc001zfq.3	Q8TE49	OTTHUMG00000129275	ENST00000307050.4:c.468G>A	15.37:g.31851254C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWK5	Silent	SNP	pfam_OTU,superfamily_UBA-like,smart_Znf_A20,pfscan_OTU,pfscan_Znf_A20	p.L156	ENST00000307050.4	37	c.468	CCDS10026.1	15																																																																																			OTUD7A	-	NULL		0.582	OTUD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OTUD7A	HGNC	protein_coding	OTTHUMT00000251393.2	C	NM_130901		31851254	-1	no_errors	ENST00000382902	ensembl	human	known	70_37	silent	SNP	0.985	T
PCBP1	5093	genome.wustl.edu	37	2	70314915	70314915	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:70314915C>G	ENST00000303577.5	+	1	331	c.40C>G	c.(40-42)Ctc>Gtc	p.L14V	PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	14	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						AAATGTGACTCTCACCATTCG	0.577																																					Colon(85;1146 1307 3484 18706 25380)												0													96.0	98.0	97.0					2																	70314915		2203	4300	6503	SO:0001583	missense	5093				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.40C>G	2.37:g.70314915C>G	ENSP00000305556:p.Leu14Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13157|Q14975	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.L14V	ENST00000303577.5	37	c.40	CCDS1898.1	2	.	.	.	.	.	.	.	.	.	.	C	13.21	2.168769	0.38315	.	.	ENSG00000169564	ENST00000303577	T	0.39406	1.08	4.14	2.25	0.28309	K Homology (1);K Homology, type 1 (1);	0.079486	0.50627	D	0.000105	T	0.30792	0.0776	L	0.38733	1.17	0.58432	D	0.999999	B	0.26081	0.141	B	0.29942	0.109	T	0.05099	-1.0906	10	0.16896	T	0.51	.	10.9846	0.47514	0.334:0.666:0.0:0.0	.	14	Q15365	PCBP1_HUMAN	V	14	ENSP00000305556:L14V	ENSP00000305556:L14V	L	+	1	0	PCBP1	70168419	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.414000	0.59802	0.661000	0.30985	0.650000	0.86243	CTC	PCBP1	-	smart_KH_dom,pfscan_KH_dom_type_1		0.577	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCBP1	HGNC	protein_coding	OTTHUMT00000251844.1	C	NM_006196		70314915	+1	no_errors	ENST00000303577	ensembl	human	known	70_37	missense	SNP	1.000	G
PCBP1	5093	genome.wustl.edu	37	2	70314924	70314924	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:70314924C>T	ENST00000303577.5	+	1	340	c.49C>T	c.(49-51)Cgg>Tgg	p.R17W	PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000452431.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	17	KH 1. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						TCTCACCATTCGGCTTCTTAT	0.567																																					Colon(85;1146 1307 3484 18706 25380)												0													101.0	102.0	102.0					2																	70314924		2203	4300	6503	SO:0001583	missense	5093				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.49C>T	2.37:g.70314924C>T	ENSP00000305556:p.Arg17Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13157|Q14975	Missense_Mutation	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.R17W	ENST00000303577.5	37	c.49	CCDS1898.1	2	.	.	.	.	.	.	.	.	.	.	C	12.47	1.948812	0.34377	.	.	ENSG00000169564	ENST00000303577	T	0.36520	1.25	4.14	0.12	0.14691	K Homology (1);K Homology, type 1, subgroup (1);K Homology, type 1 (1);	0.066973	0.56097	D	0.000024	T	0.56485	0.1988	H	0.98027	4.13	0.58432	D	0.999995	P	0.44776	0.843	P	0.48952	0.596	T	0.56619	-0.7949	10	0.87932	D	0	.	4.0227	0.09673	0.4732:0.342:0.0:0.1847	.	17	Q15365	PCBP1_HUMAN	W	17	ENSP00000305556:R17W	ENSP00000305556:R17W	R	+	1	2	PCBP1	70168428	1.000000	0.71417	0.992000	0.48379	0.990000	0.78478	1.960000	0.40422	0.016000	0.14998	-0.142000	0.14014	CGG	PCBP1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.567	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCBP1	HGNC	protein_coding	OTTHUMT00000251844.1	C	NM_006196		70314924	+1	no_errors	ENST00000303577	ensembl	human	known	70_37	missense	SNP	0.998	T
PCDHB15	56121	genome.wustl.edu	37	5	140626529	140626529	+	Silent	SNP	C	C	T	rs17844564	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:140626529C>T	ENST00000231173.3	+	1	1383	c.1383C>T	c.(1381-1383)cgC>cgT	p.R461R		NM_018935.2	NP_061758.1	Q9Y5E8	PCDBF_HUMAN	protocadherin beta 15	461	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|endometrium(8)|kidney(3)|large_intestine(14)|liver(1)|lung(18)|ovary(3)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)	61			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00339)			TGTTCGTCCGCGAGAACAACA	0.637													C|||	584	0.116613	0.1263	0.1787	5008	,	,		16065	0.0397		0.1551	False		,,,				2504	0.0992																0								C		557,3849		70,417,1716	78.0	83.0	82.0		1383	-1.1	0.7	5	dbSNP_123	82	1414,7174		126,1162,3006	no	coding-synonymous	PCDHB15	NM_018935.2		196,1579,4722	TT,TC,CC		16.4648,12.6419,15.1685		461/788	140626529	1971,11023	2203	4294	6497	SO:0001819	synonymous_variant	56121			AF152494	CCDS4257.1	5q31	2011-06-07			ENSG00000113248	ENSG00000113248		"""Cadherins / Protocadherins : Clustered"""	8686	other	protocadherin		606341				10380929	Standard	NM_018935		Approved	PCDH-BETA15	uc003lje.3	Q9Y5E8	OTTHUMG00000129609	ENST00000231173.3:c.1383C>T	5.37:g.140626529C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IUX5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R461	ENST00000231173.3	37	c.1383	CCDS4257.1	5																																																																																			PCDHB15	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin,prints_Cadherin		0.637	PCDHB15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHB15	HGNC	protein_coding	OTTHUMT00000251804.2	C	NM_018935		140626529	+1	no_errors	ENST00000231173	ensembl	human	known	70_37	silent	SNP	0.002	T
PDE7B	27115	genome.wustl.edu	37	6	136512915	136512915	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:136512915G>A	ENST00000308191.6	+	13	1593	c.1290G>A	c.(1288-1290)ggG>ggA	p.G430G	RP13-143G15.4_ENST00000417643.1_RNA|RP13-143G15.4_ENST00000585946.1_RNA|RP13-143G15.4_ENST00000591521.1_RNA	NM_018945.3	NP_061818.1	Q9NP56	PDE7B_HUMAN	phosphodiesterase 7B	430					cAMP catabolic process (GO:0006198)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)	cytosol (GO:0005829)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|metal ion binding (GO:0046872)			breast(1)|kidney(1)|large_intestine(5)|lung(7)|ovary(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	21	Colorectal(23;0.24)			OV - Ovarian serous cystadenocarcinoma(155;0.0136)|GBM - Glioblastoma multiforme(68;0.0147)	Caffeine(DB00201)|Dyphylline(DB00651)|Ketotifen(DB00920)	GTGGCAGCGGGCCTGACCACG	0.672																																																	0													30.0	29.0	29.0					6																	136512915		2199	4291	6490	SO:0001819	synonymous_variant	27115			AB038040	CCDS5175.1	6q23-q24	2008-03-18			ENSG00000171408	ENSG00000171408	3.1.4.17	"""Phosphodiesterases"""	8792	protein-coding gene	gene with protein product		604645				10618442	Standard	XM_005266931		Approved		uc003qgp.3	Q9NP56	OTTHUMG00000015641	ENST00000308191.6:c.1290G>A	6.37:g.136512915G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W154	Silent	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.G430	ENST00000308191.6	37	c.1290	CCDS5175.1	6																																																																																			PDE7B	-	NULL		0.672	PDE7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE7B	HGNC	protein_coding	OTTHUMT00000042371.1	G			136512915	+1	no_errors	ENST00000308191	ensembl	human	known	70_37	silent	SNP	0.000	A
PDLIM7	9260	genome.wustl.edu	37	5	176917897	176917897	+	Silent	SNP	C	C	T	rs1132445	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:176917897C>T	ENST00000355841.2	-	7	612	c.546G>A	c.(544-546)ccG>ccA	p.P182P	PDLIM7_ENST00000359895.2_Silent_p.P148P|PDLIM7_ENST00000356618.4_Silent_p.P182P|PDLIM7_ENST00000393551.1_Silent_p.P182P|PDLIM7_ENST00000355572.2_Silent_p.P182P	NM_005451.3	NP_005442.2	Q9NR12	PDLI7_HUMAN	PDZ and LIM domain 7 (enigma)	182					actin cytoskeleton organization (GO:0030036)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of osteoblast differentiation (GO:0045669)|receptor-mediated endocytosis (GO:0006898)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|ruffle (GO:0001726)|stress fiber (GO:0001725)	zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|urinary_tract(1)	10	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GCTCCTCATCCGGGTCTTGCA	0.602													C|||	118	0.0235623	0.0061	0.0375	5008	,	,		14772	0.001		0.0646	False		,,,				2504	0.0184																0								C	,,	69,4337	62.9+/-100.1	0,69,2134	59.0	59.0	59.0		546,444,546	1.5	1.0	5	dbSNP_131	59	656,7944	167.3+/-219.0	29,598,3673	no	coding-synonymous,coding-synonymous,coding-synonymous	PDLIM7	NM_005451.3,NM_203352.1,NM_213636.1	,,	29,667,5807	TT,TC,CC		7.6279,1.566,5.5744	,,	182/458,148/424,182/223	176917897	725,12281	2203	4300	6503	SO:0001819	synonymous_variant	9260			BC001093	CCDS4422.1, CCDS4423.1, CCDS4424.1	5q35.3	2008-02-05			ENSG00000196923	ENSG00000196923			22958	protein-coding gene	gene with protein product		605903				11874232	Standard	NM_005451		Approved	ENIGMA	uc003mhc.1	Q9NR12	OTTHUMG00000130853	ENST00000355841.2:c.546G>A	5.37:g.176917897C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14250|Q5XG82|Q6NVZ5|Q96C91|Q9BXB8|Q9BXB9	Silent	SNP	pfam_Znf_LIM,pfam_PDZ,superfamily_PDZ,smart_PDZ,smart_Znf_LIM,pfscan_Znf_LIM,pfscan_PDZ	p.P182	ENST00000355841.2	37	c.546	CCDS4422.1	5																																																																																			PDLIM7	-	NULL		0.602	PDLIM7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PDLIM7	HGNC	protein_coding	OTTHUMT00000253423.1	C	NM_005451		176917897	-1	no_errors	ENST00000355841	ensembl	human	known	70_37	silent	SNP	0.998	T
PEX2	5828	genome.wustl.edu	37	8	77912230	77912230	+	5'UTR	SNP	G	G	T	rs12718	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:77912230G>T	ENST00000419564.2	-	0	300				PEX2_ENST00000522527.1_5'UTR|PEX2_ENST00000357039.4_5'UTR|PEX2_ENST00000520103.1_5'UTR|PEX2_ENST00000520203.1_5'UTR	NM_001172087.1	NP_001165558.1	P28328	PEX2_HUMAN	peroxisomal biogenesis factor 2						bile acid biosynthetic process (GO:0006699)|cholesterol homeostasis (GO:0042632)|fatty acid beta-oxidation (GO:0006635)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|peroxisome organization (GO:0007031)|protein destabilization (GO:0031648)|protein import into peroxisome matrix (GO:0016558)|regulation of cholesterol biosynthetic process (GO:0045540)|very long-chain fatty acid metabolic process (GO:0000038)	Cdc73/Paf1 complex (GO:0016593)|integral component of peroxisomal membrane (GO:0005779)|membrane (GO:0016020)|peroxisomal membrane (GO:0005778)	zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)	14						ACTGACCTTAGGAGTCTGCGA	0.512													G|||	1391	0.277756	0.2837	0.3487	5008	,	,		16481	0.3224		0.2068	False		,,,				2504	0.2464																0																																										SO:0001623	5_prime_UTR_variant	5828			M86852	CCDS6221.1	8q21.11	2010-02-09	2010-01-25	2010-01-25		ENSG00000164751		"""RING-type (C3HC4) zinc fingers"""	9717	protein-coding gene	gene with protein product	"""Zellweger syndrome"", ""peroxin 2"""	170993	"""peroxisomal membrane protein 3 (35kD, Zellweger syndrome)"", ""peroxisomal membrane protein 3, 35kDa"""	PXMP3		1546315, 8858157	Standard	NM_000318		Approved	PMP35, PAF-1, RNF72, ZWS3	uc022awf.1	P28328		ENST00000419564.2:c.-165C>A	8.37:g.77912230G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q567S6|Q9BW41	RNA	SNP	-	NULL	ENST00000419564.2	37	NULL	CCDS6221.1	8																																																																																			PEX2	-	-		0.512	PEX2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX2	HGNC	protein_coding	OTTHUMT00000379122.1	G	NM_000318		77912230	-1	no_errors	ENST00000520203	ensembl	human	known	70_37	rna	SNP	0.062	T
PEX5L	51555	genome.wustl.edu	37	3	179593166	179593166	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:179593166C>G	ENST00000467460.1	-	6	935	c.605G>C	c.(604-606)aGa>aCa	p.R202T	PEX5L_ENST00000472994.1_Missense_Mutation_p.R143T|PEX5L_ENST00000485199.1_Missense_Mutation_p.R167T|PEX5L_ENST00000476138.1_Missense_Mutation_p.R159T|PEX5L_ENST00000263962.8_Missense_Mutation_p.R200T|PEX5L_ENST00000392649.3_Missense_Mutation_p.R94T|PEX5L_ENST00000468741.1_Missense_Mutation_p.R10T|PEX5L_ENST00000467440.2_5'UTR|PEX5L_ENST00000465751.1_Missense_Mutation_p.R178T|PEX5L_ENST00000464614.1_Missense_Mutation_p.R94T|PEX5L-AS1_ENST00000466064.1_RNA	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like	202					maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			TGATCCAGTTCTAGATGAGGA	0.378																																																	0													201.0	179.0	186.0					3																	179593166		2203	4300	6503	SO:0001583	missense	51555			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.605G>C	3.37:g.179593166C>G	ENSP00000419975:p.Arg202Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	Missense_Mutation	SNP	pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R202T	ENST00000467460.1	37	c.605	CCDS3236.1	3	.	.	.	.	.	.	.	.	.	.	C	15.91	2.973518	0.53720	.	.	ENSG00000114757	ENST00000467460;ENST00000263962;ENST00000485199;ENST00000382596;ENST00000392649;ENST00000468741;ENST00000476138;ENST00000467440;ENST00000472994;ENST00000464614;ENST00000465751;ENST00000496721;ENST00000491640;ENST00000469198	D;D;D;D;D;D;D;D;D	0.88431	-2.37;-2.38;-2.34;-2.35;-2.34;-2.34;-2.34;-2.35;-2.35	5.88	5.88	0.94601	.	0.202042	0.52532	D	0.000063	T	0.82130	0.4970	N	0.22421	0.69	0.54753	D	0.999986	P;B;B;P;P;P	0.38370	0.495;0.276;0.118;0.628;0.628;0.495	B;B;B;B;B;B	0.36922	0.119;0.049;0.049;0.184;0.236;0.119	T	0.82920	-0.0218	10	0.51188	T	0.08	-9.9263	13.4402	0.61108	0.0:0.9287:0.0:0.0713	.	143;178;94;200;167;202	E7EUZ0;E9PH97;E9PEC1;Q8IYB4-2;Q8IYB4-3;Q8IYB4	.;.;.;.;.;PEX5R_HUMAN	T	202;200;167;200;94;10;159;90;143;94;178;10;10;191	ENSP00000419975:R202T;ENSP00000263962:R200T;ENSP00000418440:R167T;ENSP00000376420:R94T;ENSP00000418665:R10T;ENSP00000420555:R159T;ENSP00000418054:R143T;ENSP00000417270:R94T;ENSP00000419348:R178T	ENSP00000263962:R200T	R	-	2	0	PEX5L	181075860	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	3.768000	0.55295	2.788000	0.95919	0.650000	0.86243	AGA	PEX5L	-	NULL		0.378	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1	C	NM_016559		179593166	-1	no_errors	ENST00000467460	ensembl	human	known	70_37	missense	SNP	1.000	G
PFN4	375189	genome.wustl.edu	37	2	24338428	24338428	+	3'UTR	SNP	T	T	G	rs1056123	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:24338428T>G	ENST00000313213.4	-	0	786				PFN4_ENST00000465360.1_5'UTR	NM_199346.1	NP_955378.1	Q8NHR9	PROF4_HUMAN	profilin family, member 4						actin cytoskeleton organization (GO:0030036)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	lipid binding (GO:0008289)			breast(1)|kidney(1)|large_intestine(1)|lung(1)|ovary(1)|pancreas(1)	6	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AATAATAAAATTGTCTTTCAT	0.303													G|||	484	0.0966454	0.0764	0.0533	5008	,	,		18548	0.0377		0.1392	False		,,,				2504	0.1718																0								G		346,4058	761.7+/-413.1	12,322,1868	51.0	50.0	50.0			-2.0	0.0	2	dbSNP_86	50	1208,7388	754.8+/-407.5	83,1042,3173	no	utr-3	PFN4	NM_199346.1		95,1364,5041	GG,GT,TT		14.053,7.8565,11.9538			24338428	1554,11446	2202	4298	6500	SO:0001624	3_prime_UTR_variant	375189			BC029523	CCDS1709.1	2p24.1	2008-02-05			ENSG00000176732	ENSG00000176732			31103	protein-coding gene	gene with protein product							Standard	NM_199346		Approved		uc002rfa.1	Q8NHR9	OTTHUMG00000090816	ENST00000313213.4:c.*25A>C	2.37:g.24338428T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TL9	RNA	SNP	-	NULL	ENST00000313213.4	37	NULL	CCDS1709.1	2																																																																																			PFN4	-	-		0.303	PFN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PFN4	HGNC	protein_coding	OTTHUMT00000207617.2	T	NM_199346		24338428	-1	no_errors	ENST00000465360	ensembl	human	known	70_37	rna	SNP	0.000	G
PHF21B	112885	genome.wustl.edu	37	22	45312345	45312345	+	Missense_Mutation	SNP	C	C	T	rs8135982	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:45312345C>T	ENST00000313237.5	-	4	529	c.379G>A	c.(379-381)Ggc>Agc	p.G127S	PHF21B_ENST00000403565.1_5'UTR|PHF21B_ENST00000447824.3_Missense_Mutation_p.G115S|PHF21B_ENST00000404079.2_Missense_Mutation_p.G115S|PHF21B_ENST00000396103.3_Missense_Mutation_p.G127S	NM_138415.4	NP_612424.1	Q96EK2	PF21B_HUMAN	PHD finger protein 21B	127			G -> S (in dbSNP:rs8135982).				zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(14)|ovary(2)|prostate(1)|skin(2)	25		all_neural(38;0.00802)|Glioma(61;0.0353)|Ovarian(80;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0203)		GGCTGGCTGCCGGGCGCTGGC	0.701													C|||	419	0.0836661	0.1528	0.0764	5008	,	,		12027	0.001		0.0726	False		,,,				2504	0.092																0								C	SER/GLY,SER/GLY,SER/GLY	552,3832		29,494,1669	21.0	26.0	24.0		379,343,379	-0.3	1.0	22	dbSNP_116	24	539,8039		23,493,3773	no	missense,missense,missense	PHF21B	NM_001135862.2,NM_001242450.1,NM_138415.4	56,56,56	52,987,5442	TT,TC,CC		6.2835,12.5912,8.4169	benign,benign,benign	127/490,115/478,127/532	45312345	1091,11871	2192	4289	6481	SO:0001583	missense	112885			AK091480	CCDS14061.1, CCDS56234.1, CCDS63504.1	22q13.31	2013-01-28			ENSG00000056487	ENSG00000056487		"""Zinc fingers, PHD-type"""	25161	protein-coding gene	gene with protein product			"""PHD finger protein 4"""	PHF4		12477932	Standard	NM_138415		Approved	BHC80L, FLJ34161	uc011aql.2	Q96EK2	OTTHUMG00000151199	ENST00000313237.5:c.379G>A	22.37:g.45312345C>T	ENSP00000324403:p.Gly127Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QYW3|B0QYW4|B3KRU4|B7Z4F8|Q5TFL2|Q6ICC0	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.G127S	ENST00000313237.5	37	c.379	CCDS14061.1	22	161	0.07371794871794872	71	0.1443089430894309	26	0.0718232044198895	0	0.0	64	0.08443271767810026	C	12.62	1.993878	0.35131	0.125912	0.062835	ENSG00000056487	ENST00000313237;ENST00000396103;ENST00000404079;ENST00000447824;ENST00000420689	T;T;T;T;T	0.20598	2.06;2.06;2.06;2.06;2.06	4.91	-0.345	0.12624	.	0.462648	0.18750	N	0.132215	T	0.00073	0.0002	N	0.25647	0.755	0.50171	P	1.4499999999995072E-4	B;B;B;B	0.23591	0.007;0.007;0.004;0.088	B;B;B;B	0.14023	0.007;0.01;0.002;0.01	T	0.39099	-0.9630	9	0.05436	T	0.98	-12.3752	9.7905	0.40704	0.0:0.4785:0.0:0.5215	rs8135982	115;127;115;127	B7Z657;Q96EK2-3;B7Z4F8;Q96EK2	.;.;.;PF21B_HUMAN	S	127;127;115;115;115	ENSP00000324403:G127S;ENSP00000379410:G127S;ENSP00000385105:G115S;ENSP00000388619:G115S;ENSP00000401294:G115S	ENSP00000324403:G127S	G	-	1	0	PHF21B	43691009	0.204000	0.23447	0.996000	0.52242	0.983000	0.72400	-0.075000	0.11431	-0.154000	0.11118	0.655000	0.94253	GGC	PHF21B	-	NULL		0.701	PHF21B-001	KNOWN	basic|CCDS	protein_coding	PHF21B	HGNC	protein_coding	OTTHUMT00000321731.2	C	NM_138415		45312345	-1	no_errors	ENST00000313237	ensembl	human	known	70_37	missense	SNP	0.961	T
PHTF2	57157	genome.wustl.edu	37	7	77580942	77580942	+	Silent	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:77580942C>G	ENST00000248550.7	+	17	2200	c.2124C>G	c.(2122-2124)ctC>ctG	p.L708L	PHTF2_ENST00000307305.8_Silent_p.L670L|PHTF2_ENST00000416283.2_Silent_p.L674L|PHTF2_ENST00000275575.7_Silent_p.L618L|PHTF2_ENST00000422959.2_Silent_p.L674L			Q8N3S3	PHTF2_HUMAN	putative homeodomain transcription factor 2	708					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(2)|kidney(3)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)	19						AGATAAACCTCTACTTGAAAA	0.279																																																	0													25.0	24.0	24.0					7																	77580942		1673	3762	5435	SO:0001819	synonymous_variant	57157			AL136883	CCDS47621.1, CCDS47622.1, CCDS47623.1, CCDS47624.1	7q11.23-q21	2008-02-01			ENSG00000006576	ENSG00000006576			13411	protein-coding gene	gene with protein product						10729229	Standard	NM_020432		Approved	DKFZp434D166	uc003ugq.4	Q8N3S3	OTTHUMG00000155557	ENST00000248550.7:c.2124C>G	7.37:g.77580942C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0JP04|A0JP05|A4D1C2|E9PEE3|G5E9H7|Q6NW35|Q8TBW4|Q9H099	Silent	SNP	pfam_TF_homeodomain_male	p.L708	ENST00000248550.7	37	c.2124		7																																																																																			PHTF2	-	NULL		0.279	PHTF2-006	KNOWN	basic	protein_coding	PHTF2	HGNC	protein_coding	OTTHUMT00000340638.2	C	NM_020432		77580942	+1	no_errors	ENST00000248550	ensembl	human	known	70_37	silent	SNP	1.000	G
PI4KB	5298	genome.wustl.edu	37	1	151288811	151288811	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:151288811C>T	ENST00000368873.1	-	2	315	c.147G>A	c.(145-147)caG>caA	p.Q49Q	PI4KB_ENST00000368874.4_Silent_p.Q49Q|PI4KB_ENST00000368872.1_Silent_p.Q49Q|PI4KB_ENST00000368875.2_Silent_p.Q61Q|PI4KB_ENST00000529142.1_Intron|PI4KB_ENST00000271657.5_Silent_p.Q61Q			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	49	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.				phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			GGCAGGCCTTCTGGGCCACCT	0.587																																					Colon(154;765 1838 9854 28443 37492)												0													59.0	52.0	55.0					1																	151288811		2203	4300	6503	SO:0001819	synonymous_variant	5298			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.147G>A	1.37:g.151288811C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Silent	SNP	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.Q61	ENST00000368873.1	37	c.183		1																																																																																			PI4KB	-	NULL		0.587	PI4KB-002	KNOWN	basic	protein_coding	PI4KB	HGNC	protein_coding	OTTHUMT00000034400.3	C	NM_002651		151288811	-1	no_errors	ENST00000271657	ensembl	human	known	70_37	silent	SNP	1.000	T
PIK3C2G	5288	genome.wustl.edu	37	12	18658367	18658367	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:18658367C>T	ENST00000266497.5	+	22	3210	c.3172C>T	c.(3172-3174)Cat>Tat	p.H1058Y	PIK3C2G_ENST00000433979.1_Missense_Mutation_p.H1058Y|PIK3C2G_ENST00000538779.1_Missense_Mutation_p.H1099Y			O75747	P3C2G_HUMAN	phosphatidylinositol-4-phosphate 3-kinase, catalytic subunit type 2 gamma	1058	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				chemotaxis (GO:0006935)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-3-phosphate biosynthetic process (GO:0036092)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|phosphatidylinositol binding (GO:0035091)|phosphatidylinositol phosphate kinase activity (GO:0016307)			breast(5)|central_nervous_system(6)|endometrium(2)|kidney(4)|large_intestine(8)|lung(31)|ovary(2)|prostate(1)|skin(2)|stomach(4)|upper_aerodigestive_tract(1)	66		Hepatocellular(102;0.194)				ATTCTTAGGTCATGCACAAAC	0.368																																																	0													76.0	69.0	71.0					12																	18658367		1886	4133	6019	SO:0001583	missense	5288			AJ000008	CCDS44839.1, CCDS73452.1	12p12	2012-07-13	2012-07-13		ENSG00000139144	ENSG00000139144	2.7.1.154		8973	protein-coding gene	gene with protein product		609001	"""phosphoinositide-3-kinase, class 2, gamma polypeptide"""			9878262	Standard	XM_005253393		Approved		uc001rdt.3	O75747	OTTHUMG00000168841	ENST00000266497.5:c.3172C>T	12.37:g.18658367C>T	ENSP00000266497:p.His1058Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3U0	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_PInositide-3_kin_accessory_dom,pfam_PI3K_C2_dom,pfam_Phox,pfam_PI3K_Ras-bd_dom,pfam_C2_Ca-dep,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Phox,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,smart_Phox,smart_C2_Ca-dep,pfscan_Phox,pfscan_PI3/4_kinase_cat_dom	p.H1099Y	ENST00000266497.5	37	c.3295	CCDS44839.1	12	.	.	.	.	.	.	.	.	.	.	C	20.8	4.054148	0.75960	.	.	ENSG00000139144	ENST00000433979;ENST00000266497;ENST00000538779	T;T;T	0.80909	-1.43;-1.43;-1.43	5.33	5.33	0.75918	Protein kinase-like domain (1);Phosphatidylinositol 3-/4-kinase, catalytic (4);	0.193790	0.44483	D	0.000446	D	0.90082	0.6902	M	0.80508	2.5	0.48395	D	0.99964	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.73380	0.98;0.966;0.98	D	0.90823	0.4710	10	0.72032	D	0.01	-21.3692	18.194	0.89815	0.0:1.0:0.0:0.0	.	1098;1099;1058	B7ZLY6;F5H369;O75747	.;.;P3C2G_HUMAN	Y	1058;1058;1099	ENSP00000404845:H1058Y;ENSP00000266497:H1058Y;ENSP00000445381:H1099Y	ENSP00000266497:H1058Y	H	+	1	0	PIK3C2G	18549634	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	4.767000	0.62286	2.771000	0.95319	0.650000	0.86243	CAT	PIK3C2G	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.368	PIK3C2G-002	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PIK3C2G	HGNC	protein_coding	OTTHUMT00000401316.1	C	NM_004570		18658367	+1	no_errors	ENST00000538779	ensembl	human	known	70_37	missense	SNP	1.000	T
PIK3CA	5290	genome.wustl.edu	37	3	178936091	178936091	+	Missense_Mutation	SNP	G	G	A	rs104886003		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:178936091G>A	ENST00000263967.3	+	10	1790	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K		NM_006218.2	NP_006209.2	P42336	PK3CA_HUMAN	phosphatidylinositol-4,5-bisphosphate 3-kinase, catalytic subunit alpha	545	PIK helical. {ECO:0000255|PROSITE- ProRule:PRU00878}.		E -> A (in CWS5 and HCC; also found in a glioblastoma multiforme sample). {ECO:0000269|PubMed:15608678, ECO:0000269|PubMed:15924253, ECO:0000269|PubMed:23246288}.|E -> G (in KERSEB; also found in an endometrial carcinoma sample). {ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:17673550}.|E -> K (in MCAP, KERSEB, CRC and BC; shows an increase in lipid kinase activity; oncogenic in vivo; occurs in the interface between the PI3K helical domain and the nSH2 (N-terminal SH2) region of the p85 regulatory subunit and may reduce the inhibitory effect of p85; requires interaction with RAS to induce cellular transformation; enhances invadopodia-mediated extracellular matrix degradation and invasion in breast cancer cells). {ECO:0000269|PubMed:15289301, ECO:0000269|PubMed:15520168, ECO:0000269|PubMed:15712344, ECO:0000269|PubMed:15784156, ECO:0000269|PubMed:15994075, ECO:0000269|PubMed:16322209, ECO:0000269|PubMed:16353168, ECO:0000269|PubMed:16533766, ECO:0000269|PubMed:17673550, ECO:0000269|PubMed:22729224}.		angiogenesis (GO:0001525)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|endothelial cell migration (GO:0043542)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|glucose metabolic process (GO:0006006)|hypomethylation of CpG island (GO:0044029)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|insulin receptor signaling pathway via phosphatidylinositol 3-kinase (GO:0038028)|leukocyte migration (GO:0050900)|negative regulation of anoikis (GO:2000811)|negative regulation of fibroblast apoptotic process (GO:2000270)|negative regulation of neuron apoptotic process (GO:0043524)|neurotrophin TRK receptor signaling pathway (GO:0048011)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|platelet activation (GO:0030168)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|protein kinase B signaling (GO:0043491)|regulation of genetic imprinting (GO:2000653)|regulation of multicellular organism growth (GO:0040014)|small molecule metabolic process (GO:0044281)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|vasculature development (GO:0001944)	1-phosphatidylinositol-4-phosphate 3-kinase, class IA complex (GO:0005943)|cytosol (GO:0005829)|lamellipodium (GO:0030027)|phosphatidylinositol 3-kinase complex (GO:0005942)|plasma membrane (GO:0005886)	1-phosphatidylinositol-3-kinase activity (GO:0016303)|1-phosphatidylinositol-4-phosphate 3-kinase activity (GO:0035005)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phosphatidylinositol 3-kinase activity (GO:0035004)|phosphatidylinositol-4,5-bisphosphate 3-kinase activity (GO:0046934)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.E545K(881)|p.E545Q(18)		NS(16)|autonomic_ganglia(4)|biliary_tract(22)|bone(1)|breast(2150)|central_nervous_system(110)|cervix(33)|endometrium(473)|eye(1)|haematopoietic_and_lymphoid_tissue(35)|kidney(14)|large_intestine(1202)|liver(42)|lung(202)|meninges(1)|oesophagus(28)|ovary(235)|pancreas(17)|penis(8)|pituitary(12)|prostate(10)|skin(155)|small_intestine(1)|soft_tissue(18)|stomach(121)|thyroid(80)|upper_aerodigestive_tract(70)|urinary_tract(208)	5269	all_cancers(143;1.19e-17)|Ovarian(172;0.00769)|Breast(254;0.155)		OV - Ovarian serous cystadenocarcinoma(80;9.59e-28)|GBM - Glioblastoma multiforme(14;0.003)|BRCA - Breast invasive adenocarcinoma(182;0.0282)		Caffeine(DB00201)	TGAAATCACTGAGCAGGAGAA	0.353	E545K(BC3C_URINARY_TRACT)|E545K(BFTC909_KIDNEY)|E545K(DLD1_LARGE_INTESTINE)|E545K(ESS1_ENDOMETRIUM)|E545K(HCC202_BREAST)|E545K(HCT15_LARGE_INTESTINE)|E545K(HSC4_UPPER_AERODIGESTIVE_TRACT)|E545K(HT1197_URINARY_TRACT)|E545K(HUH28_BILIARY_TRACT)|E545K(KYSE510_OESOPHAGUS)|E545K(L363_HAEMATOPOIETIC_AND_LYMPHOID_TISSUE)|E545K(MCF7_BREAST)|E545K(MDAMB361_BREAST)|E545K(MKN1_STOMACH)|E545K(NCIH460_LUNG)|E545K(NCIH508_LARGE_INTESTINE)|E545K(NCIH596_LUNG)|E545K(RERFLCSQ1_LUNG)|E545K(TCCSUP_URINARY_TRACT)|E545K(TE5_OESOPHAGUS)	57	Mis		"""colorectal, gastric, gliobastoma, breast"""					HNSCC(19;0.045)|TSP Lung(28;0.18)																											Colon(199;1504 1750 3362 26421 31210 32040)			Dom	yes		3	3q26.3	5290	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""		"""E, O"""	899	Substitution - Missense(899)	breast(308)|large_intestine(286)|urinary_tract(97)|lung(44)|endometrium(37)|ovary(25)|stomach(17)|upper_aerodigestive_tract(16)|skin(14)|central_nervous_system(13)|cervix(13)|thyroid(7)|oesophagus(7)|penis(4)|kidney(3)|soft_tissue(2)|pancreas(2)|haematopoietic_and_lymphoid_tissue(1)|biliary_tract(1)|NS(1)|pituitary(1)											61.0	60.0	60.0					3																	178936091		1813	4072	5885	SO:0001583	missense	5290				CCDS43171.1	3q26.3	2014-09-17	2012-07-13		ENSG00000121879	ENSG00000121879	2.7.1.153		8975	protein-coding gene	gene with protein product		171834	"""phosphoinositide-3-kinase, catalytic, alpha polypeptide"""			1322797	Standard	NM_006218		Approved	PI3K	uc003fjk.3	P42336	OTTHUMG00000157311	ENST00000263967.3:c.1633G>A	3.37:g.178936091G>A	ENSP00000263967:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CW1|Q99762	Missense_Mutation	SNP	pfam_PInositide-3_kin_accessory_dom,pfam_PI3/4_kinase_cat_dom,pfam_PI3K_Ras-bd_dom,pfam_PI3K_C2_dom,pfam_PI3K_adapt-bd_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_PI3K_adapt-bd_dom,smart_PI3K_Ras-bd_dom,smart_PI3K_C2_dom,smart_PInositide-3_kin_accessory_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.E545K	ENST00000263967.3	37	c.1633	CCDS43171.1	3	.	.	.	.	.	.	.	.	.	.	G	36	5.703347	0.96812	.	.	ENSG00000121879	ENST00000263967	T	0.63255	-0.03	5.78	5.78	0.91487	Phosphoinositide 3-kinase, accessory (PIK) domain (3);Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.73822	0.3636	L	0.51914	1.62	0.80722	D	1	D	0.62365	0.991	D	0.62955	0.909	T	0.68872	-0.5294	10	0.32370	T	0.25	-25.7963	20.0024	0.97423	0.0:0.0:1.0:0.0	.	545	P42336	PK3CA_HUMAN	K	545	ENSP00000263967:E545K	ENSP00000263967:E545K	E	+	1	0	PIK3CA	180418785	1.000000	0.71417	1.000000	0.80357	0.951000	0.60555	9.476000	0.97823	2.722000	0.93159	0.467000	0.42956	GAG	PIK3CA	-	pfam_PInositide-3_kin_accessory_dom,superfamily_ARM-type_fold,smart_PInositide-3_kin_accessory_dom		0.353	PIK3CA-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	PIK3CA	HGNC	protein_coding	OTTHUMT00000348409.2	G			178936091	+1	no_errors	ENST00000263967	ensembl	human	known	70_37	missense	SNP	1.000	A
PIP4K2A	5305	genome.wustl.edu	37	10	22839628	22839628	+	Missense_Mutation	SNP	T	T	C	rs2230469	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:22839628T>C	ENST00000376573.4	-	7	980	c.752A>G	c.(751-753)aAc>aGc	p.N251S	PIP4K2A_ENST00000545335.1_Missense_Mutation_p.N192S|PIP4K2A_ENST00000323883.7_Missense_Mutation_p.N111S	NM_005028.4	NP_005019.2	P48426	PI42A_HUMAN	phosphatidylinositol-5-phosphate 4-kinase, type II, alpha	251	PIPK. {ECO:0000255|PROSITE- ProRule:PRU00781}.		N -> S (in dbSNP:rs10828317). {ECO:0000269|PubMed:7639683}.		megakaryocyte development (GO:0035855)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol phosphorylation (GO:0046854)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	1-phosphatidylinositol-4-phosphate 5-kinase activity (GO:0016308)|1-phosphatidylinositol-5-phosphate 4-kinase activity (GO:0016309)|ATP binding (GO:0005524)			endometrium(4)|kidney(13)|large_intestine(4)|lung(6)|ovary(1)|skin(1)	29						GACCTTCTTGTTGTTGTCATC	0.363											OREG0020068	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)	T|||	1063	0.21226	0.0696	0.134	5008	,	,		18073	0.3839		0.3131	False		,,,				2504	0.18																0			GRCh37	CM068312	PIP4K2A	M	rs10828317	T	SER/ASN	456,3948	217.4+/-235.8	29,398,1775	180.0	175.0	177.0		752	6.1	1.0	10	dbSNP_120	177	2740,5860	437.2+/-358.5	451,1838,2011	yes	missense	PIP4K2A	NM_005028.4	46	480,2236,3786	CC,CT,TT		31.8605,10.3542,24.5771	benign	251/407	22839628	3196,9808	2202	4300	6502	SO:0001583	missense	5305			S78798	CCDS7141.1	10p12.2	2007-08-21	2007-08-14	2007-08-14	ENSG00000150867	ENSG00000150867			8997	protein-coding gene	gene with protein product		603140	"""phosphatidylinositol-4-phosphate 5-kinase, type II, alpha"""	PIP5K2A		7852364, 9367159	Standard	NM_005028		Approved	PIP5KIIA, PIP5KIIalpha	uc001irl.4	P48426	OTTHUMG00000017810	ENST00000376573.4:c.752A>G	10.37:g.22839628T>C	ENSP00000365757:p.Asn251Ser	Somatic	759	WXS	Illumina HiSeq	Phase_IV	B0YJ66|B4DGX2|D3DRV1|P53807|Q5VUX3	Missense_Mutation	SNP	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub	p.N251S	ENST00000376573.4	37	c.752	CCDS7141.1	10	564	0.25824175824175827	38	0.07723577235772358	44	0.12154696132596685	232	0.40559440559440557	250	0.32981530343007914	T	9.613	1.131741	0.21041	0.103542	0.318605	ENSG00000150867	ENST00000376573;ENST00000323883;ENST00000545335	T;T;T	0.34275	1.37;1.37;1.37	6.07	6.07	0.98685	Phosphatidylinositol-4-phosphate 5-kinase, core (2);Phosphatidylinositol-4-phosphate 5-kinase, core, subgroup (1);	0.042713	0.85682	D	0.000000	T	0.00012	0.0000	N	0.11673	0.155	0.09310	P	0.999999748043	B;B	0.06786	0.001;0.0	B;B	0.11329	0.006;0.004	T	0.45760	-0.9239	9	0.15066	T	0.55	-58.1863	16.6277	0.84984	0.0:0.0:0.0:1.0	rs10828317;rs52795826;rs59726485;rs10828317	111;251	B4DH09;P48426	.;PI42A_HUMAN	S	251;111;192	ENSP00000365757:N251S;ENSP00000326294:N111S;ENSP00000442098:N192S	ENSP00000326294:N111S	N	-	2	0	PIP4K2A	22879634	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	5.912000	0.69948	2.330000	0.79161	0.528000	0.53228	AAC	PIP4K2A	-	pfam_PInositol-4-P-5-kinase_core,smart_PInositol-4P-5-kinase_core_sub		0.363	PIP4K2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIP4K2A	HGNC	protein_coding	OTTHUMT00000047193.1	T	NM_005028		22839628	-1	no_errors	ENST00000376573	ensembl	human	known	70_37	missense	SNP	1.000	C
PKHD1	5314	genome.wustl.edu	37	6	51907736	51907736	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:51907736G>A	ENST00000371117.3	-	27	3293	c.3018C>T	c.(3016-3018)atC>atT	p.I1006I	PKHD1_ENST00000340994.4_Silent_p.I1006I	NM_138694.3	NP_619639.3	P08F94	PKHD1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)	1006	IPT/TIG 4.				cellular calcium ion homeostasis (GO:0006874)|cilium assembly (GO:0042384)|homeostatic process (GO:0042592)|kidney development (GO:0001822)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cellular component movement (GO:0051271)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of protein kinase B signaling (GO:0051898)|positive regulation of cell proliferation (GO:0008284)|regulation of centrosome duplication (GO:0010824)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of TOR signaling (GO:0032006)|single organismal cell-cell adhesion (GO:0016337)	anchored component of external side of plasma membrane (GO:0031362)|apical plasma membrane (GO:0016324)|centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|primary cilium (GO:0072372)	receptor activity (GO:0004872)			NS(1)|autonomic_ganglia(1)|breast(8)|central_nervous_system(5)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(11)|large_intestine(59)|lung(139)|ovary(16)|prostate(8)|skin(20)|soft_tissue(1)|stomach(2)|upper_aerodigestive_tract(7)|urinary_tract(5)	304	Lung NSC(77;0.0605)					CAGTGGCACTGATGGCAAGAC	0.478																																																	0													111.0	107.0	108.0					6																	51907736		2203	4300	6503	SO:0001819	synonymous_variant	5314			AF480064	CCDS4935.1, CCDS4936.1	6p21.2-p12	2012-11-26	2003-04-16		ENSG00000170927	ENSG00000170927			9016	protein-coding gene	gene with protein product	"""tigmin"", ""polyductin"", ""fibrocystin"""	606702	"""TIG multiple domains 1"""	TIGM1		9503014	Standard	NM_138694		Approved	ARPKD, FCYT	uc003pah.1	P08F94	OTTHUMG00000014841	ENST00000371117.3:c.3018C>T	6.37:g.51907736G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUA2|Q5VUA3|Q5VWV1|Q86Z26|Q8TCZ9	Silent	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,smart_IPT_TIG_rcpt,smart_PbH1	p.I1006	ENST00000371117.3	37	c.3018	CCDS4935.1	6																																																																																			PKHD1	-	superfamily_Ig_E-set		0.478	PKHD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKHD1	HGNC	protein_coding	OTTHUMT00000040893.1	G	NM_138694		51907736	-1	no_errors	ENST00000371117	ensembl	human	known	70_37	silent	SNP	0.027	A
PKHD1L1	93035	genome.wustl.edu	37	8	110460419	110460419	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:110460419G>C	ENST00000378402.5	+	39	5928	c.5824G>C	c.(5824-5826)Gag>Cag	p.E1942Q		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1942	IPT/TIG 12.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CTTTGGCTTTGAGATCTTGGA	0.378										HNSCC(38;0.096)																																							0													62.0	61.0	61.0					8																	110460419		1930	4143	6073	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.5824G>C	8.37:g.110460419G>C	ENSP00000367655:p.Glu1942Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.E1942Q	ENST00000378402.5	37	c.5824	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	12.36	1.913663	0.33815	.	.	ENSG00000205038	ENST00000378402	D	0.84442	-1.85	5.43	5.43	0.79202	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.189262	0.43747	D	0.000526	T	0.77538	0.4145	N	0.08118	0	0.27817	N	0.94193	B	0.17038	0.02	B	0.34346	0.18	T	0.70927	-0.4739	10	0.49607	T	0.09	.	17.0915	0.86623	0.0:0.0:1.0:0.0	.	1942	Q86WI1	PKHL1_HUMAN	Q	1942	ENSP00000367655:E1942Q	ENSP00000367655:E1942Q	E	+	1	0	PKHD1L1	110529595	0.967000	0.33354	0.023000	0.16930	0.033000	0.12548	3.689000	0.54706	2.697000	0.92050	0.585000	0.79938	GAG	PKHD1L1	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt		0.378	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	G	NM_177531		110460419	+1	no_errors	ENST00000378402	ensembl	human	known	70_37	missense	SNP	0.770	C
PKLR	5313	genome.wustl.edu	37	1	155265458	155265458	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:155265458C>T	ENST00000342741.4	-	3	411	c.373G>A	c.(373-375)Gag>Aag	p.E125K	PKLR_ENST00000392414.3_Missense_Mutation_p.E94K	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	125					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TCCCGCACCTCGTGGGAGCCG	0.662																																																	0													78.0	67.0	71.0					1																	155265458		2203	4300	6503	SO:0001583	missense	5313			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.373G>A	1.37:g.155265458C>T	ENSP00000339933:p.Glu125Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.E125K	ENST00000342741.4	37	c.373	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	C	21.2	4.106248	0.77096	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741;ENST00000271946	D;D	0.99537	-6.11;-6.11	4.25	1.12	0.20585	Pyruvate/Phosphoenolpyruvate kinase (2);Pyruvate kinase, barrel (1);	0.236645	0.42053	N	0.000778	D	0.98912	0.9631	M	0.88105	2.93	0.58432	D	0.999998	P;P	0.40000	0.698;0.698	B;P	0.45881	0.37;0.496	D	0.99445	1.0939	10	0.87932	D	0	-17.2291	7.2625	0.26212	0.0:0.5772:0.3275:0.0953	.	125;116	P30613;B1AVT1	KPYR_HUMAN;.	K	150;94;125;61	ENSP00000376214:E94K;ENSP00000339933:E125K	ENSP00000271946:E61K	E	-	1	0	PKLR	153532082	1.000000	0.71417	0.825000	0.32803	0.903000	0.53119	3.709000	0.54853	0.132000	0.18615	0.650000	0.86243	GAG	PKLR	-	pfam_Pyrv_Knase_brl,superfamily_Pyrv/PenolPyrv_Kinase,tigrfam_Pyr_Knase		0.662	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	C	NM_000298		155265458	-1	no_errors	ENST00000342741	ensembl	human	known	70_37	missense	SNP	0.997	T
PKP1	5317	genome.wustl.edu	37	1	201286771	201286771	+	Silent	SNP	C	C	T	rs1722779	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:201286771C>T	ENST00000352845.3	+	5	918	c.918C>T	c.(916-918)gcC>gcT	p.A306A	PKP1_ENST00000263946.3_Silent_p.A306A|PKP1_ENST00000475988.1_3'UTR|PKP1_ENST00000367324.3_Silent_p.A306A			Q13835	PKP1_HUMAN	plakophilin 1	306					apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|intermediate filament bundle assembly (GO:0045110)|multicellular organismal development (GO:0007275)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)	desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|intermediate filament (GO:0005882)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	intermediate filament binding (GO:0019215)|lamin binding (GO:0005521)|signal transducer activity (GO:0004871)|structural constituent of epidermis (GO:0030280)			NS(2)|breast(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|ovary(5)|prostate(1)	22						TCCAGCAGGCCGCGGCAGGGG	0.647													C|||	844	0.16853	0.1316	0.1945	5008	,	,		17421	0.2302		0.1978	False		,,,				2504	0.1063																0								C	,	584,3818		41,502,1658	27.0	29.0	28.0		918,918	-11.1	0.0	1	dbSNP_89	28	1794,6806		192,1410,2698	no	coding-synonymous,coding-synonymous	PKP1	NM_000299.3,NM_001005337.2	,	233,1912,4356	TT,TC,CC		20.8605,13.2667,18.2895	,	306/748,306/727	201286771	2378,10624	2201	4300	6501	SO:0001819	synonymous_variant	5317			X79293	CCDS30966.1, CCDS30967.1	1q32	2014-06-18	2014-06-18		ENSG00000081277	ENSG00000081277		"""Armadillo repeat containing"""	9023	protein-coding gene	gene with protein product	"""ectodermal dysplasia/skin fragility syndrome"""	601975	"""plakophilin 1 (ectodermal dysplasia/skin fragility syndrome)"""			9272178	Standard	NM_001005337		Approved	B6P	uc001gwd.3	Q13835	OTTHUMG00000035729	ENST00000352845.3:c.918C>T	1.37:g.201286771C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00645|Q14CA0|Q15152	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo	p.A306	ENST00000352845.3	37	c.918	CCDS30966.1	1																																																																																			PKP1	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo		0.647	PKP1-004	KNOWN	basic|CCDS	protein_coding	PKP1	HGNC	protein_coding	OTTHUMT00000086897.1	C	NM_000299		201286771	+1	no_errors	ENST00000263946	ensembl	human	known	70_37	silent	SNP	0.002	T
PLCD1	5333	genome.wustl.edu	37	3	38049577	38049577	+	Nonsense_Mutation	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:38049577C>A	ENST00000334661.4	-	14	2335	c.2113G>T	c.(2113-2115)Gaa>Taa	p.E705*	PLCD1_ENST00000463876.1_Nonsense_Mutation_p.E726*	NM_006225.3	NP_006216.2	P51178	PLCD1_HUMAN	phospholipase C, delta 1	705	C2. {ECO:0000255|PROSITE- ProRule:PRU00041}.				angiogenesis (GO:0001525)|inositol phosphate metabolic process (GO:0043647)|intracellular signal transduction (GO:0035556)|labyrinthine layer blood vessel development (GO:0060716)|lipid catabolic process (GO:0016042)|phospholipid metabolic process (GO:0006644)|regulation of cell proliferation (GO:0042127)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|GTPase activating protein binding (GO:0032794)|phosphatidic acid binding (GO:0070300)|phosphatidylinositol phosphate binding (GO:1901981)|phosphatidylinositol phospholipase C activity (GO:0004435)|phosphatidylserine binding (GO:0001786)|signal transducer activity (GO:0004871)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(6)|lung(6)|prostate(1)|skin(1)	24				KIRC - Kidney renal clear cell carcinoma(284;0.0519)|Kidney(284;0.0653)		TCATAATCTTCCACCAAGAAG	0.522																																																	0													113.0	104.0	107.0					3																	38049577		2203	4300	6503	SO:0001587	stop_gained	5333				CCDS2671.1, CCDS46793.1	3p22-p21.3	2013-01-10			ENSG00000187091	ENSG00000187091	3.1.4.11	"""EF-hand domain containing"""	9060	protein-coding gene	gene with protein product		602142				9345909	Standard	NM_001130964		Approved		uc003chm.3	P51178	OTTHUMG00000130813	ENST00000334661.4:c.2113G>T	3.37:g.38049577C>A	ENSP00000335600:p.Glu705*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KR14|Q86VN8	Nonsense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.E726*	ENST00000334661.4	37	c.2176	CCDS2671.1	3	.	.	.	.	.	.	.	.	.	.	C	38	7.171164	0.98111	.	.	ENSG00000187091	ENST00000463876;ENST00000334661	.	.	.	5.11	5.11	0.69529	.	0.151633	0.64402	D	0.000019	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	.	18.4971	0.90869	0.0:1.0:0.0:0.0	.	.	.	.	X	726;705	.	ENSP00000335600:E705X	E	-	1	0	PLCD1	38024581	1.000000	0.71417	0.997000	0.53966	0.035000	0.12851	4.853000	0.62911	2.555000	0.86185	0.655000	0.94253	GAA	PLCD1	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting		0.522	PLCD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLCD1	HGNC	protein_coding	OTTHUMT00000253359.2	C			38049577	-1	no_errors	ENST00000463876	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PLCXD1	55344	genome.wustl.edu	37	X	207451	207451	+	Intron	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:207451C>T	ENST00000381657.2	+	4	907				PLCXD1_ENST00000381663.3_Intron|PLCXD1_ENST00000399012.1_Intron|PLCXD1_ENST00000484611.2_3'UTR	NM_018390.3	NP_060860.1	Q9NUJ7	PLCX1_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 1						lipid metabolic process (GO:0006629)		phosphoric diester hydrolase activity (GO:0008081)			endometrium(3)|large_intestine(1)|lung(7)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				GAGGTGCGGCCGGGCTGAGGT	0.677													c|||	2082	0.415735	0.882	0.3012	5008	,	,		13923	0.12		0.3072	False		,,,				2504	0.2832																0								T		3534,872		1410,714,79	137.0	118.0	125.0			-2.4	0.0	X	dbSNP_134	125	2646,5944		406,1834,2055	no	intron	PLCXD1	NM_018390.3		1816,2548,2134	TT,TC,CC		30.8033,19.7912,47.5531			207451	6180,6816	2203	4295	6498	SO:0001627	intron_variant	55344			AK002185	CCDS14103.1	Xp22.33 and Yp11.32	2010-07-28			ENSG00000182378	ENSG00000182378		"""Pseudoautosomal regions / PAR1"""	23148	protein-coding gene	gene with protein product							Standard	NM_018390		Approved	FLJ11323	uc004cpc.3	Q9NUJ7	OTTHUMG00000022693	ENST00000381657.2:c.393+8C>T	X.37:g.207451C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2BH51|A2BH52	RNA	SNP	-	NULL	ENST00000381657.2	37	NULL	CCDS14103.1	X																																																																																			PLCXD1	-	-		0.677	PLCXD1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PLCXD1	HGNC	protein_coding	OTTHUMT00000058879.2	C	NM_018390		207451	+1	no_errors	ENST00000484611	ensembl	human	known	70_37	rna	SNP	0.000	T
PLCXD2	257068	genome.wustl.edu	37	3	111427075	111427075	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:111427075G>C	ENST00000477665.1	+	2	790	c.466G>C	c.(466-468)Gag>Cag	p.E156Q	PLCXD2_ENST00000393934.3_Missense_Mutation_p.E156Q	NM_001185106.1	NP_001172035.1	Q0VAA5	PLCX2_HUMAN	phosphatidylinositol-specific phospholipase C, X domain containing 2	156	PI-PLC X-box. {ECO:0000255|PROSITE- ProRule:PRU00270}.				lipid catabolic process (GO:0016042)		phosphoric diester hydrolase activity (GO:0008081)|signal transducer activity (GO:0004871)			endometrium(1)|large_intestine(5)|lung(9)|prostate(1)|skin(1)	17						GCACCCCCAGGAGATTATCTT	0.502																																																	0													119.0	117.0	118.0					3																	111427075		2203	4300	6503	SO:0001583	missense	257068			AK056141	CCDS2961.1, CCDS54619.1	3q13.2	2004-09-09			ENSG00000240891	ENSG00000240891			26462	protein-coding gene	gene with protein product							Standard	NM_001185106		Approved	FLJ31579	uc003dxz.3	Q0VAA5	OTTHUMG00000159279	ENST00000477665.1:c.466G>C	3.37:g.111427075G>C	ENSP00000420686:p.Glu156Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96N12	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom	p.E156Q	ENST00000477665.1	37	c.466	CCDS54619.1	3	.	.	.	.	.	.	.	.	.	.	G	18.79	3.699394	0.68501	.	.	ENSG00000240891	ENST00000393934;ENST00000477665;ENST00000468174	T;T	0.64803	-0.12;-0.12	5.62	5.62	0.85841	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);Phospholipase C, phosphatidylinositol-specific , X domain (2);	.	.	.	.	D	0.86062	0.5843	H	0.96269	3.795	0.53005	D	0.999968	D;D;D	0.89917	0.996;1.0;0.999	D;D;D	0.87578	0.986;0.998;0.996	D	0.89761	0.3947	9	0.72032	D	0.01	-26.6371	17.5138	0.87767	0.0:0.0:1.0:0.0	.	66;156;156	C9JB87;Q0VAA5;Q0VAA5-2	.;PLCX2_HUMAN;.	Q	156;156;66	ENSP00000377511:E156Q;ENSP00000420686:E156Q	ENSP00000377511:E156Q	E	+	1	0	PLCXD2	112909765	1.000000	0.71417	0.994000	0.49952	0.648000	0.38561	7.786000	0.85741	2.804000	0.96469	0.655000	0.94253	GAG	PLCXD2	-	pfam_PLipase_C_PInositol-sp_X_dom,superfamily_PLC-like_Pdiesterase_TIM-brl,smart_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_PInositol-sp_X_dom		0.502	PLCXD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCXD2	HGNC	protein_coding	OTTHUMT00000354322.1	G	NM_153268		111427075	+1	no_errors	ENST00000477665	ensembl	human	known	70_37	missense	SNP	0.996	C
PLEKHH3	79990	genome.wustl.edu	37	17	40820270	40820270	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:40820270C>T	ENST00000591022.1	-	13	2644	c.2257G>A	c.(2257-2259)Gag>Aag	p.E753K	PLEKHH3_ENST00000412503.1_Missense_Mutation_p.E576K|PLEKHH3_ENST00000293349.6_Missense_Mutation_p.E750K|PLEKHH3_ENST00000456950.2_5'UTR	NM_024927.4	NP_079203	Q7Z736	PKHH3_HUMAN	pleckstrin homology domain containing, family H (with MyTH4 domain) member 3	753	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|extracellular space (GO:0005615)				endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|prostate(2)|skin(2)	13		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.14)		CAGGGCCTCTCGGGGGAGGGG	0.637																																																	0													33.0	40.0	37.0					17																	40820270		2203	4300	6503	SO:0001583	missense	79990			BC052978	CCDS11434.1	17q21.2	2013-01-11				ENSG00000068137		"""Pleckstrin homology (PH) domain containing"""	26105	protein-coding gene	gene with protein product						12477932	Standard	NM_024927		Approved	FLJ21019	uc002iau.3	Q7Z736		ENST00000591022.1:c.2257G>A	17.37:g.40820270C>T	ENSP00000468678:p.Glu753Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JQ76|Q59H20|Q96B28|Q9H7D6|Q9NT18	Missense_Mutation	SNP	pfam_MyTH4_dom,pfam_FERM_central,pfam_Ras-assoc,superfamily_FERM_central,smart_Pleckstrin_homology,smart_MyTH4_dom,smart_Band_41_domain,pfscan_FERM_domain,pfscan_MyTH4_dom,pfscan_Pleckstrin_homology	p.E753K	ENST00000591022.1	37	c.2257	CCDS11434.1	17	.	.	.	.	.	.	.	.	.	.	C	26.6	4.756375	0.89843	.	.	ENSG00000068137	ENST00000293349;ENST00000412503	D	0.88818	-2.43	4.61	4.61	0.57282	FERM domain (1);	0.137838	0.33309	N	0.005052	T	0.69495	0.3117	N	0.02539	-0.55	0.23640	N	0.997223	B	0.25105	0.118	B	0.16722	0.016	T	0.53472	-0.8434	10	0.02654	T	1	-14.5469	13.1262	0.59356	0.0:1.0:0.0:0.0	.	753	Q7Z736	PKHH3_HUMAN	K	753;576	ENSP00000411885:E576K	ENSP00000293349:E753K	E	-	1	0	PLEKHH3	38073796	0.937000	0.31787	0.991000	0.47740	0.995000	0.86356	2.347000	0.44036	2.564000	0.86499	0.555000	0.69702	GAG	PLEKHH3	-	pfscan_FERM_domain		0.637	PLEKHH3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLEKHH3	HGNC	protein_coding	OTTHUMT00000452332.1	C	NM_024927		40820270	-1	no_errors	ENST00000591022	ensembl	human	known	70_37	missense	SNP	0.992	T
POM121C	100101267	genome.wustl.edu	37	7	75048104	75048104	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:75048104C>T	ENST00000257665.5	-	13	3664	c.3665G>A	c.(3664-3666)cGa>cAa	p.R1222Q	NSUN5P1_ENST00000393633.2_RNA|POM121C_ENST00000453279.2_Missense_Mutation_p.R980Q			A8CG34	P121C_HUMAN	POM121 transmembrane nucleoporin C	1222	Pore side. {ECO:0000255}.				mRNA transport (GO:0051028)|protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|nuclear pore (GO:0005643)				central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)|skin(1)|urinary_tract(1)	14						GTGCTGCCTTCGGGCCTGCAG	0.582																																																	0													10.0	13.0	12.0					7																	75048104		2104	4178	6282	SO:0001583	missense	100101267				CCDS47617.1	7q11.23	2012-03-13	2012-03-13		ENSG00000135213	ENSG00000272391			34005	protein-coding gene	gene with protein product		615754	"""POM121 membrane glycoprotein C"""			17900573	Standard	NM_001099415		Approved		uc003udk.4	A8CG34	OTTHUMG00000156238	ENST00000257665.5:c.3665G>A	7.37:g.75048104C>T	ENSP00000257665:p.Arg1222Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O75115|Q9Y2N3|Q9Y4S7	Missense_Mutation	SNP	NULL	p.R1222Q	ENST00000257665.5	37	c.3665		7	.	.	.	.	.	.	.	.	.	.	C	20.9	4.058774	0.76074	.	.	ENSG00000135213	ENST00000257665;ENST00000453279	T;T	0.63913	1.34;-0.07	2.87	2.87	0.33458	.	.	.	.	.	T	0.74581	0.3735	M	0.67397	2.05	0.36210	D	0.851321	D	0.76494	0.999	D	0.79108	0.992	T	0.80993	-0.1134	9	0.87932	D	0	.	11.2806	0.49192	0.0:1.0:0.0:0.0	.	1222	A8CG34	P121C_HUMAN	Q	1222;980	ENSP00000257665:R1222Q;ENSP00000414208:R980Q	ENSP00000257665:R1222Q	R	-	2	0	POM121C	74886040	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	5.548000	0.67255	1.596000	0.50062	0.400000	0.26472	CGA	POM121C	-	NULL		0.582	POM121C-003	KNOWN	basic|appris_candidate_longest	protein_coding	POM121C	HGNC	protein_coding	OTTHUMT00000343919.2	C	NM_001099415		75048104	-1	no_errors	ENST00000257665	ensembl	human	known	70_37	missense	SNP	1.000	T
POMZP3	22932	genome.wustl.edu	37	7	76239480	76239480	+	3'UTR	SNP	C	C	A	rs711306	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:76239480C>A	ENST00000310842.4	-	0	1312				POMZP3_ENST00000275569.4_3'UTR|UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion											kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				CATGGTCACCCCTCCTGTCCA	0.567													a|||	2728	0.544728	0.5976	0.5432	5008	,	,		20788	0.4256		0.5586	False		,,,				2504	0.5828																0													27.0	25.0	26.0					7																	76239480		2201	4274	6475	SO:0001624	3_prime_UTR_variant	22932			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.*64G>T	7.37:g.76239480C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	F6STJ3|Q12903|Q9BWB4	RNA	SNP	-	NULL	ENST00000310842.4	37	NULL	CCDS43606.1	7																																																																																			POMZP3	-	-		0.567	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMZP3	HGNC	protein_coding	OTTHUMT00000341775.1	C	NM_012230		76239480	-1	no_errors	ENST00000454656	ensembl	human	known	70_37	rna	SNP	0.488	A
POMZP3	22932	genome.wustl.edu	37	7	76239503	76239504	+	3'UTR	INS	-	-	C	rs140446540|rs554052644	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:76239503_76239504insC	ENST00000310842.4	-	0	1288_1289				POMZP3_ENST00000275569.4_3'UTR|UPK3B_ENST00000443097.2_Intron|AC004980.7_ENST00000418663.1_RNA|UPK3B_ENST00000419923.2_Intron	NM_012230.3	NP_036362.3	Q6PJE2	POZP3_HUMAN	POM121 and ZP3 fusion											kidney(3)|lung(2)	5		Myeloproliferative disorder(862;0.204)				AAGATCAGTGGCCCCACGGTGA	0.545													cccc|CCCC|CCCCC|insertion	2728	0.544728	0.5961	0.5447	5008	,	,		23101	0.4246		0.5586	False		,,,				2504	0.5849																0									,	2602,1654		800,1002,326					,	0.4	0.7		dbSNP_134	45	4805,3433		1447,1911,761	no	utr-3,utr-3	POMZP3	NM_152992.2,NM_012230.3	,	2247,2913,1087	A1A1,A1R,RR		41.6727,38.8628,40.7155	,	,		7407,5087				SO:0001624	3_prime_UTR_variant	22932			U10099	CCDS5590.1, CCDS43606.1	7q11.2	2010-06-24	2010-06-24		ENSG00000146707	ENSG00000146707			9203	protein-coding gene	gene with protein product	"""POM-ZP3 fusion protein"", ""POM121/ZP3 fusion protein"""	600587	"""POM (POM121 rat homolog) and ZP3 fusion"", ""POM (POM121 homolog, rat) and ZP3 fusion"""			7789967	Standard	NM_012230		Approved	POM-ZP3, POM121	uc003uft.3	Q6PJE2	OTTHUMG00000023514	ENST00000310842.4:c.*41->G	7.37:g.76239507_76239507dupC		Somatic		WXS	Illumina HiSeq	Phase_IV	F6STJ3|Q12903|Q9BWB4	RNA	INS	-	NULL	ENST00000310842.4	37	NULL	CCDS43606.1	7																																																																																			POMZP3	-	-		0.545	POMZP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POMZP3	HGNC	protein_coding	OTTHUMT00000341775.1	-	NM_012230		76239504	-1	no_errors	ENST00000454656	ensembl	human	known	70_37	rna	INS	0.808:0.777	C
POTEF	728378	genome.wustl.edu	37	2	130877956	130877956	+	Missense_Mutation	SNP	T	T	C	rs200786675	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:130877956T>C	ENST00000409914.2	-	3	532	c.133A>G	c.(133-135)Act>Gct	p.T45A	POTEF_ENST00000360967.5_Missense_Mutation_p.T45A|POTEF_ENST00000357462.5_Missense_Mutation_p.T45A|POTEF_ENST00000361163.4_Missense_Mutation_p.T45A	NM_001099771.2	NP_001093241.1	A5A3E0	POTEF_HUMAN	POTE ankyrin domain family, member F	45					retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				breast(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(4)|lung(28)|ovary(3)|prostate(3)|skin(4)|upper_aerodigestive_tract(1)	53						TCTCCAGAAGTGCCCACGTTG	0.592																																																	0								T	ALA/THR	11,4395		0,11,2192	125.0	131.0	129.0		133		0.0	2		129	145,8445		2,141,4152	no	missense	POTEF	NM_001099771.2	58	2,152,6344	CC,CT,TT		1.688,0.2497,1.2004	benign	45/1076	130877956	156,12840	2203	4295	6498	SO:0001583	missense	728378			EF523384	CCDS46409.1	2q21.1	2013-01-10	2008-11-26	2008-11-26	ENSG00000196604	ENSG00000196604		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33905	protein-coding gene	gene with protein product			"""ANKRD26-like family C, member 1B"""	A26C1B		17101985	Standard	NM_001099771		Approved	POTEACTIN, POTE2alpha	uc010fmh.2	A5A3E0	OTTHUMG00000153628	ENST00000409914.2:c.133A>G	2.37:g.130877956T>C	ENSP00000386786:p.Thr45Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NC34	Missense_Mutation	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.T45A	ENST00000409914.2	37	c.133	CCDS46409.1	2	.	.	.	.	.	.	.	.	.	.	.	7.056	0.565381	0.13498	0.002497	0.01688	ENSG00000196604	ENST00000357462;ENST00000409914;ENST00000360967;ENST00000361163	T;T;T;T	0.78816	-1.21;-1.21;1.57;1.54	.	.	.	.	.	.	.	.	T	0.47525	0.1450	L	0.43152	1.355	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.45804	-0.9236	7	0.87932	D	0	.	.	.	.	.	45	A5A3E0	POTEF_HUMAN	A	45	ENSP00000350052:T45A;ENSP00000386786:T45A;ENSP00000354232:T45A;ENSP00000355012:T45A	ENSP00000350052:T45A	T	-	1	0	POTEF	130594426	0.002000	0.14202	0.020000	0.16555	0.020000	0.10135	-0.879000	0.04188	-1.371000	0.02141	-1.353000	0.01230	ACT	POTEF	-	NULL		0.592	POTEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEF	HGNC	protein_coding	OTTHUMT00000331889.2	T	NM_001099771		130877956	-1	no_errors	ENST00000357462	ensembl	human	known	70_37	missense	SNP	0.022	C
POTEE	445582	genome.wustl.edu	37	2	131984449	131984449	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:131984449G>A	ENST00000356920.5	+	4	958	c.864G>A	c.(862-864)gtG>gtA	p.V288V	POTEE_ENST00000358087.5_Silent_p.V298V|PLEKHB2_ENST00000303908.3_Intron|RNU6-127P_ENST00000390897.1_RNA|PLEKHB2_ENST00000404460.1_Intron	NM_001083538.1	NP_001077007.1	Q6S8J3	POTEE_HUMAN	POTE ankyrin domain family, member E	288					retina homeostasis (GO:0001895)|substantia nigra development (GO:0021762)	blood microparticle (GO:0072562)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)											AGCAAGTCGTGAAATTTTTAA	0.338																																																	0													97.0	114.0	108.0					2																	131984449		1504	2704	4208	SO:0001819	synonymous_variant	445582			AY462868	CCDS46414.1	2q21.1	2014-04-10	2008-11-26	2008-11-26	ENSG00000188219	ENSG00000188219		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33895	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 2"""	608914	"""ANKRD26-like family C, member 1A"""	A26C1A			Standard	NM_001083538		Approved	POTE2, POTE-2, A26C1, POTE2gamma, CT104.2	uc002tsn.2	Q6S8J3	OTTHUMG00000186974	ENST00000356920.5:c.864G>A	2.37:g.131984449G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6S8J4|Q6S8J5|Q6S8J8	Silent	SNP	pfam_Actin-like,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Actin-like,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Actin-like	p.V288	ENST00000356920.5	37	c.864	CCDS46414.1	2																																																																																			POTEE	-	superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.338	POTEE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	POTEE	Uniprot_genename	protein_coding		G	NM_001083538		131984449	+1	no_errors	ENST00000356920	ensembl	human	known	70_37	silent	SNP	0.340	A
PPARG	5468	genome.wustl.edu	37	3	12421301	12421301	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:12421301G>C	ENST00000287820.6	+	2	302	c.181G>C	c.(181-183)Gat>Cat	p.D61H	PPARG_ENST00000397000.1_Missense_Mutation_p.D33H|PPARG_ENST00000397026.2_Missense_Mutation_p.D39H|PPARG_ENST00000397010.2_Missense_Mutation_p.D33H|PPARG_ENST00000539812.1_Missense_Mutation_p.D31H|PPARG_ENST00000397015.2_Missense_Mutation_p.D33H|PPARG_ENST00000309576.6_Missense_Mutation_p.D33H|PPARG_ENST00000397012.2_Missense_Mutation_p.D33H	NM_015869.4	NP_056953.2	P37231	PPARG_HUMAN	peroxisome proliferator-activated receptor gamma	61					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|brown fat cell differentiation (GO:0050873)|cell fate commitment (GO:0045165)|cell maturation (GO:0048469)|cellular response to insulin stimulus (GO:0032869)|cellular response to lithium ion (GO:0071285)|epithelial cell differentiation (GO:0030855)|fatty acid oxidation (GO:0019395)|G-protein coupled receptor signaling pathway (GO:0007186)|gene expression (GO:0010467)|glucose homeostasis (GO:0042593)|heart development (GO:0007507)|innate immune response (GO:0045087)|lipid homeostasis (GO:0055088)|lipid metabolic process (GO:0006629)|lipoprotein transport (GO:0042953)|long-chain fatty acid transport (GO:0015909)|low-density lipoprotein particle receptor biosynthetic process (GO:0045713)|monocyte differentiation (GO:0030224)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of cell growth (GO:0030308)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of receptor biosynthetic process (GO:0010871)|negative regulation of sequestering of triglyceride (GO:0010891)|negative regulation of smooth muscle cell proliferation (GO:0048662)|negative regulation of telomerase activity (GO:0051974)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|organ regeneration (GO:0031100)|peroxisome proliferator activated receptor signaling pathway (GO:0035357)|placenta development (GO:0001890)|positive regulation of fat cell differentiation (GO:0045600)|positive regulation of fatty acid oxidation (GO:0046321)|positive regulation of oligodendrocyte differentiation (GO:0048714)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of blood pressure (GO:0008217)|regulation of cholesterol transporter activity (GO:0060694)|regulation of transcription involved in cell fate commitment (GO:0060850)|response to caffeine (GO:0031000)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to lipid (GO:0033993)|response to low-density lipoprotein particle (GO:0055098)|response to nutrient (GO:0007584)|response to retinoic acid (GO:0032526)|response to vitamin A (GO:0033189)|signal transduction (GO:0007165)|transcription initiation from RNA polymerase II promoter (GO:0006367)|white fat cell differentiation (GO:0050872)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	activating transcription factor binding (GO:0033613)|arachidonic acid binding (GO:0050544)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|drug binding (GO:0008144)|enzyme binding (GO:0019899)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|prostaglandin receptor activity (GO:0004955)|retinoid X receptor binding (GO:0046965)|RNA polymerase II regulatory region DNA binding (GO:0001012)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)		PAX8/PPARG(117)	breast(2)|endometrium(4)|kidney(3)|large_intestine(1)|lung(6)|ovary(1)|prostate(1)|skin(1)|stomach(1)	20					Balsalazide(DB01014)|Bezafibrate(DB01393)|Glipizide(DB01067)|Ibuprofen(DB01050)|Icosapent(DB00159)|Indomethacin(DB00328)|Mesalazine(DB00244)|Mitiglinide(DB01252)|Nateglinide(DB00731)|Pioglitazone(DB01132)|Repaglinide(DB00912)|Rosiglitazone(DB00412)|Sulfasalazine(DB00795)|Telmisartan(DB00966)	CCACTCCTTTGATATCAAGCC	0.463			T	PAX8	follicular thyroid		"""Insulin resistance ; lipodystrophy, familial partial L;diabetes mellitus, insulin-resistantI, with acanthosis nigricans and hypertension"""																																	Dom	yes		3	3p25	5468	"""peroxisome proliferative activated receptor, gamma"""	yes	E	0													192.0	167.0	175.0					3																	12421301		2203	4300	6503	SO:0001583	missense	5468			X90563	CCDS2609.1, CCDS2610.2	3p25	2013-01-16	2006-10-17		ENSG00000132170	ENSG00000132170		"""Nuclear hormone receptors"""	9236	protein-coding gene	gene with protein product		601487	"""peroxisome proliferative activated receptor, gamma"""			7862171, 9750197	Standard	NM_005037		Approved	PPARG1, PPARG2, NR1C3, PPARgamma	uc003bwx.3	P37231	OTTHUMG00000129764	ENST00000287820.6:c.181G>C	3.37:g.12421301G>C	ENSP00000287820:p.Asp61His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3G6|B5BUA1|O00684|O00710|O14515|Q0QJH8|Q15178|Q15179|Q15180|Q15832|Q86U60|Q96J12	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_PPARgamma_N,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_1Cnucl_rcpt,prints_1Cnucl_rcpt_G,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.D61H	ENST00000287820.6	37	c.181	CCDS2609.1	3	.	.	.	.	.	.	.	.	.	.	G	25.4	4.639422	0.87760	.	.	ENSG00000132170	ENST00000397010;ENST00000397029;ENST00000309576;ENST00000397015;ENST00000455517;ENST00000397012;ENST00000397026;ENST00000438682;ENST00000397000;ENST00000539812;ENST00000287820	T;T;T;T;T;T;T;T;T;T;T	0.65732	-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17;-0.17	5.8	5.8	0.92144	.	0.058200	0.64402	D	0.000003	T	0.77824	0.4188	L	0.59436	1.845	0.58432	D	0.999999	D;D;D	0.89917	0.999;1.0;0.999	D;D;D	0.97110	0.969;1.0;0.969	T	0.75747	-0.3209	10	0.46703	T	0.11	.	20.0716	0.97726	0.0:0.0:1.0:0.0	.	61;47;33	P37231;Q4W4C7;E9PFX5	PPARG_HUMAN;.;.	H	33;33;33;33;33;33;39;33;33;31;61	ENSP00000380205:D33H;ENSP00000380224:D33H;ENSP00000312472:D33H;ENSP00000380210:D33H;ENSP00000411931:D33H;ENSP00000380207:D33H;ENSP00000380221:D39H;ENSP00000392285:D33H;ENSP00000380196:D33H;ENSP00000438940:D31H;ENSP00000287820:D61H	ENSP00000287820:D61H	D	+	1	0	PPARG	12396301	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	8.870000	0.92336	2.741000	0.93983	0.585000	0.79938	GAT	PPARG	-	prints_1Cnucl_rcpt_G		0.463	PPARG-002	KNOWN	basic|CCDS	protein_coding	PPARG	HGNC	protein_coding	OTTHUMT00000251979.2	G	NM_005037		12421301	+1	no_errors	ENST00000287820	ensembl	human	known	70_37	missense	SNP	1.000	C
PPEF2	5470	genome.wustl.edu	37	4	76794424	76794424	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:76794424G>A	ENST00000286719.7	-	12	1718	c.1362C>T	c.(1360-1362)ggC>ggT	p.G454G		NM_006239.2	NP_006230.2	O14830	PPE2_HUMAN	protein phosphatase, EF-hand calcium binding domain 2	454	Catalytic.				detection of stimulus involved in sensory perception (GO:0050906)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of peptidyl-threonine phosphorylation (GO:0010801)|protein dephosphorylation (GO:0006470)|regulation of JUN kinase activity (GO:0043506)|regulation of MAP kinase activity (GO:0043405)|visual perception (GO:0007601)	cilium (GO:0005929)|cytoplasm (GO:0005737)	calcium ion binding (GO:0005509)|Hsp70 protein binding (GO:0030544)|Hsp90 protein binding (GO:0051879)|iron ion binding (GO:0005506)|manganese ion binding (GO:0030145)|mitogen-activated protein kinase kinase kinase binding (GO:0031435)|protein serine/threonine phosphatase activity (GO:0004722)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(4)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	50			Lung(101;0.0809)|LUSC - Lung squamous cell carcinoma(112;0.0934)			TGGCCTTGCAGCCCTCTTGAG	0.448																																					NSCLC(105;1359 1603 15961 44567 47947)												0													125.0	119.0	121.0					4																	76794424		2203	4300	6503	SO:0001819	synonymous_variant	5470			AF023456	CCDS34013.1	4q21.1	2013-01-10			ENSG00000156194	ENSG00000156194		"""Serine/threonine phosphatases / Protein phosphatase, catalytic subunits"", ""EF-hand domain containing"""	9244	protein-coding gene	gene with protein product	"""protein phosphatase 7, catalytic subunit, beta isozyme"""	602256				9326663, 12051765	Standard	NM_006239		Approved	PPP7CB	uc003hix.3	O14830	OTTHUMG00000160915	ENST00000286719.7:c.1362C>T	4.37:g.76794424G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O14831	Silent	SNP	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,pfam_PPP_dom,smart_Ser/Thr-sp_prot-phosphatase,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,prints_Ser/Thr-sp_prot-phosphatase	p.G454	ENST00000286719.7	37	c.1362	CCDS34013.1	4																																																																																			PPEF2	-	pirsf_Ser/Thr-Pase_EF-hand_contain,pfam_Metallo_PEstase_dom,smart_Ser/Thr-sp_prot-phosphatase		0.448	PPEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPEF2	HGNC	protein_coding	OTTHUMT00000362929.1	G	NM_006239		76794424	-1	no_errors	ENST00000286719	ensembl	human	known	70_37	silent	SNP	1.000	A
PPIE	10450	genome.wustl.edu	37	1	40204803	40204805	+	Intron	DEL	CTT	CTT	-	rs140607790	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	CTT	CTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:40204803_40204805delCTT	ENST00000324379.5	+	1	50				PPIE_ENST00000470213.1_Intron|PPIE_ENST00000356511.2_Intron|PPIE_ENST00000372830.1_Intron|PPIE_ENST00000480169.1_3'UTR	NM_006112.3	NP_006103.1	Q9UNP9	PPIE_HUMAN	peptidylprolyl isomerase E (cyclophilin E)						mRNA splicing, via spliceosome (GO:0000398)|positive regulation of viral genome replication (GO:0045070)|protein folding (GO:0006457)|regulation of transcription, DNA-templated (GO:0006355)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)	cyclosporin A binding (GO:0016018)|nucleotide binding (GO:0000166)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			kidney(3)|large_intestine(2)|lung(2)|prostate(1)|urinary_tract(1)	9	all_cancers(7;1.63e-13)|all_lung(5;2.27e-16)|all_epithelial(6;1.35e-15)|Lung NSC(20;1.49e-06)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0255)	OV - Ovarian serous cystadenocarcinoma(33;1.87e-18)|Epithelial(16;2.7e-17)|all cancers(16;5.5e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			AAAGTGCAGACTTCTTAGCAGTA	0.527														272	0.0543131	0.0983	0.0533	5008	,	,		17515	0.0		0.0517	False		,,,				2504	0.0542																0																																										SO:0001627	intron_variant	10450			AF042385	CCDS442.1, CCDS443.1, CCDS53299.1	1p32	2013-02-12			ENSG00000084072	ENSG00000084072		"""RNA binding motif (RRM) containing"""	9258	protein-coding gene	gene with protein product	"""peptidyl-prolyl cis-trans isomerase E"", ""cyclophilin 33"", ""cyclophilin E"", ""PPIase E"", ""rotamase E"", ""peptidylprolyl isomerase E, isoform 1"""	602435				9747881	Standard	NM_203456		Approved	CyP-33, MGC3736, MGC111222	uc001cdw.3	Q9UNP9	OTTHUMG00000009248	ENST00000324379.5:c.31+200CTT>-	1.37:g.40204806_40204808delCTT		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R971|O43634|O43635|Q32Q72|Q3S611|Q5TGA0|Q5TGA2|Q5TGA3|Q9UIZ5	RNA	DEL	-	NULL	ENST00000324379.5	37	NULL	CCDS443.1	1																																																																																			PPIE	-	-		0.527	PPIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPIE	HGNC	protein_coding	OTTHUMT00000025642.2	CTT	NM_006112		40204805	+1	no_errors	ENST00000480169	ensembl	human	known	70_37	rna	DEL	0.000:0.000:0.000	-
PPME1	51400	genome.wustl.edu	37	11	73915461	73915461	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:73915461C>T	ENST00000328257.8	+	3	582	c.259C>T	c.(259-261)Cat>Tat	p.H87Y	PPME1_ENST00000542710.1_3'UTR|PPME1_ENST00000398427.4_Missense_Mutation_p.H87Y			Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	87					negative regulation of catalytic activity (GO:0043086)|protein demethylation (GO:0006482)|regulation of catalytic activity (GO:0050790)		protein C-terminal methylesterase activity (GO:0051722)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(2)	5	Breast(11;3.29e-05)					TGGAGGAGGTCATTCTGCCCT	0.398																																																	0													137.0	131.0	133.0					11																	73915461		1907	4106	6013	SO:0001583	missense	51400				CCDS44678.1, CCDS60891.1	11q13.4	2014-03-14			ENSG00000214517	ENSG00000214517	3.1.1.89		30178	protein-coding gene	gene with protein product		611117				10318862	Standard	NM_016147		Approved	PME-1	uc009yty.4	Q9Y570	OTTHUMG00000168115	ENST00000328257.8:c.259C>T	11.37:g.73915461C>T	ENSP00000329867:p.His87Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMU6|B5MEE7|J3QT22|Q8WYG8|Q9NVT5|Q9UI18	Missense_Mutation	SNP	pirsf_PPase_methylesterase_euk	p.H87Y	ENST00000328257.8	37	c.259	CCDS44678.1	11	.	.	.	.	.	.	.	.	.	.	C	11.54	1.668809	0.29604	.	.	ENSG00000214517	ENST00000328257;ENST00000398427;ENST00000544401	T;T;T	0.68025	-0.3;-0.3;4.99	5.93	5.93	0.95920	.	0.045801	0.85682	D	0.000000	T	0.53769	0.1817	L	0.27053	0.805	0.80722	D	1	B	0.16166	0.016	B	0.23716	0.048	T	0.51403	-0.8710	10	0.02654	T	1	-23.2801	19.1254	0.93380	0.0:1.0:0.0:0.0	.	87	Q9Y570	PPME1_HUMAN	Y	87	ENSP00000329867:H87Y;ENSP00000381461:H87Y;ENSP00000438632:H87Y	ENSP00000329867:H87Y	H	+	1	0	PPME1	73593109	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	6.802000	0.75175	2.826000	0.97356	0.655000	0.94253	CAT	PPME1	-	pirsf_PPase_methylesterase_euk		0.398	PPME1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PPME1	HGNC	protein_coding	OTTHUMT00000398254.1	C	NM_016147		73915461	+1	no_errors	ENST00000328257	ensembl	human	known	70_37	missense	SNP	1.000	T
PPME1	51400	genome.wustl.edu	37	11	73915487	73915487	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:73915487C>A	ENST00000328257.8	+	3	608	c.285C>A	c.(283-285)ttC>ttA	p.F95L	PPME1_ENST00000542710.1_3'UTR|PPME1_ENST00000398427.4_Missense_Mutation_p.F95L			Q9Y570	PPME1_HUMAN	protein phosphatase methylesterase 1	95					negative regulation of catalytic activity (GO:0043086)|protein demethylation (GO:0006482)|regulation of catalytic activity (GO:0050790)		protein C-terminal methylesterase activity (GO:0051722)|protein phosphatase 2A binding (GO:0051721)|protein phosphatase binding (GO:0019903)|protein phosphatase inhibitor activity (GO:0004864)|protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(1)|large_intestine(2)|lung(2)	5	Breast(11;3.29e-05)					GGGCTGTGTTCACGGTAAGTA	0.413																																																	0													134.0	126.0	128.0					11																	73915487		1913	4117	6030	SO:0001583	missense	51400				CCDS44678.1, CCDS60891.1	11q13.4	2014-03-14			ENSG00000214517	ENSG00000214517	3.1.1.89		30178	protein-coding gene	gene with protein product		611117				10318862	Standard	NM_016147		Approved	PME-1	uc009yty.4	Q9Y570	OTTHUMG00000168115	ENST00000328257.8:c.285C>A	11.37:g.73915487C>A	ENSP00000329867:p.Phe95Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KMU6|B5MEE7|J3QT22|Q8WYG8|Q9NVT5|Q9UI18	Missense_Mutation	SNP	pirsf_PPase_methylesterase_euk	p.F95L	ENST00000328257.8	37	c.285	CCDS44678.1	11	.	.	.	.	.	.	.	.	.	.	C	15.80	2.940119	0.52972	.	.	ENSG00000214517	ENST00000328257;ENST00000398427;ENST00000544401	T;T;T	0.61859	0.07;0.07;5.12	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.39306	0.1073	N	0.17312	0.475	0.80722	D	1	B	0.20887	0.049	B	0.29353	0.101	T	0.23691	-1.0181	10	0.05833	T	0.94	-24.5312	12.4466	0.55654	0.0:0.923:0.0:0.077	.	95	Q9Y570	PPME1_HUMAN	L	95	ENSP00000329867:F95L;ENSP00000381461:F95L;ENSP00000438632:F95L	ENSP00000329867:F95L	F	+	3	2	PPME1	73593135	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.326000	0.33735	2.826000	0.97356	0.655000	0.94253	TTC	PPME1	-	pirsf_PPase_methylesterase_euk		0.413	PPME1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	PPME1	HGNC	protein_coding	OTTHUMT00000398254.1	C	NM_016147		73915487	+1	no_errors	ENST00000328257	ensembl	human	known	70_37	missense	SNP	1.000	A
PPP1R12B	4660	genome.wustl.edu	37	1	202407189	202407190	+	Intron	INS	-	-	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:202407189_202407190insT	ENST00000608999.1	+	10	1611				PPP1R12B_ENST00000336894.4_Intron|RP11-175B9.2_ENST00000602961.1_RNA|PPP1R12B_ENST00000356764.2_3'UTR|PPP1R12B_ENST00000480184.1_Frame_Shift_Ins_p.V499fs	NM_001197131.1|NM_002481.3	NP_001184060.1|NP_002472.2	O60237	MYPT2_HUMAN	protein phosphatase 1, regulatory subunit 12B						G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|positive regulation of catalytic activity (GO:0043085)|regulation of muscle contraction (GO:0006937)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	enzyme activator activity (GO:0008047)			central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(7)|lung(17)|ovary(4)|skin(3)|urinary_tract(1)	41			BRCA - Breast invasive adenocarcinoma(75;0.166)			TTCCAAGGCAGTTTTTTTTTTC	0.391																																																	0																																										SO:0001627	intron_variant	4660			AB003062	CCDS1426.1, CCDS44294.1, CCDS44295.1, CCDS53458.1, CCDS53459.1, CCDS73005.1	1q32.1	2013-01-10	2011-10-04	2001-08-10	ENSG00000077157	ENSG00000077157		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	7619	protein-coding gene	gene with protein product	"""myosin phosphatase regulatory subunit"", ""myosin phosphatase, target subunit 2"""	603768	"""protein phosphatase 1, regulatory (inhibitor) subunit 12B"""	MYPT2		9570949	Standard	NM_002481		Approved	MGC87886, MGC131980, PP1bp55	uc001gya.2	O60237	OTTHUMG00000041393	ENST00000608999.1:c.1458+37->T	1.37:g.202407199_202407199dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MYF5|B7ZMN6|Q2TAI8|Q5T506|Q5VUK2|Q8N179|Q9HCB7|Q9HCB8	Frame_Shift_Ins	INS	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.F503fs	ENST00000608999.1	37	c.1495_1496	CCDS1426.1	1																																																																																			PPP1R12B	-	NULL		0.391	PPP1R12B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPP1R12B	HGNC	protein_coding	OTTHUMT00000099166.3	-	NM_032105		202407190	+1	no_errors	ENST00000480184	ensembl	human	novel	70_37	frame_shift_ins	INS	0.085:0.041	T
PPP1R2P1	100507444	genome.wustl.edu	37	6	32847310	32847310	+	RNA	DEL	C	C	-	rs575537708|rs9280218	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32847310delC	ENST00000420261.1	-	0	315							Q96PQ5	IPP2L_HUMAN	protein phosphatase 1, regulatory (inhibitor) subunit 2 pseudogene 1						glycogen metabolic process (GO:0005977)|regulation of phosphoprotein phosphatase activity (GO:0043666)|regulation of signal transduction (GO:0009966)		protein phosphatase inhibitor activity (GO:0004864)										AAGTTCTTAGCCAAGCTATCT	0.458													CC|CC|C|deletion	1657	0.330871	0.3971	0.3588	5008	,	,		21039	0.2758		0.3419	False		,,,				2504	0.2669																0																																												100507444			AF275684		6p21.32	2013-06-10		2001-08-31	ENSG00000234515	ENSG00000234515			9289	pseudogene	pseudogene				PPP1R2P		11696978, 7949733	Standard	NG_027882		Approved	IPP-2P		Q96PQ5	OTTHUMG00000031273		6.37:g.32847310delC		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL	ENST00000420261.1	37	NULL		6																																																																																			PPP1R2P1	-	-		0.458	PPP1R2P1-002	KNOWN	basic	processed_transcript	PPP1R2P1	HGNC	pseudogene	OTTHUMT00000276488.1	C	NG_027882		32847310	-1	no_errors	ENST00000420261	ensembl	human	known	70_37	rna	DEL	0.001	-
PPP2R5C	5527	genome.wustl.edu	37	14	102368166	102368166	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:102368166G>A	ENST00000334743.5	+	9	1011	c.963G>A	c.(961-963)gtG>gtA	p.V321V	PPP2R5C_ENST00000328724.5_Silent_p.V376V|PPP2R5C_ENST00000422945.2_Silent_p.V352V|PPP2R5C_ENST00000557095.1_Silent_p.V321V|PPP2R5C_ENST00000445439.3_Silent_p.V321V|PPP2R5C_ENST00000350249.3_Silent_p.V321V	NM_002719.3	NP_002710.2	Q13362	2A5G_HUMAN	protein phosphatase 2, regulatory subunit B', gamma	321					DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|negative regulation of cell proliferation (GO:0008285)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	chromosome, centromeric region (GO:0000775)|nucleus (GO:0005634)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			breast(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(6)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	20						CAGAATTTGTGAAGATCATGG	0.438																																																	0													91.0	93.0	92.0					14																	102368166		2203	4300	6503	SO:0001819	synonymous_variant	5527			L42375	CCDS9964.1, CCDS9965.1, CCDS45163.1, CCDS53911.1, CCDS53912.1	14q32.31	2010-06-18	2010-04-14		ENSG00000078304	ENSG00000078304		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9311	protein-coding gene	gene with protein product		601645	"""protein phosphatase 2, regulatory subunit B (B56), gamma isoform"", ""protein phosphatase 2, regulatory subunit B', gamma isoform"""			7592815	Standard	NM_002719		Approved	B56G, PR61G	uc001ykk.3	Q13362		ENST00000334743.5:c.963G>A	14.37:g.102368166G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYJ8|B5BUA5|F5GWP3|Q14391|Q15060|Q15174|Q6ZN33	Silent	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.V352	ENST00000334743.5	37	c.1056	CCDS9964.1	14																																																																																			PPP2R5C	-	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56		0.438	PPP2R5C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5C	HGNC	protein_coding	OTTHUMT00000414373.2	G	NM_002719		102368166	+1	no_errors	ENST00000422945	ensembl	human	known	70_37	silent	SNP	0.998	A
PRCP	5547	genome.wustl.edu	37	11	82564294	82564294	+	Missense_Mutation	SNP	T	T	G	rs2229437	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:82564294T>G	ENST00000313010.3	-	3	530	c.336A>C	c.(334-336)gaA>gaC	p.E112D	PRCP_ENST00000393399.2_Missense_Mutation_p.E133D|PRCP_ENST00000535099.1_Missense_Mutation_p.E7D	NM_005040.2	NP_005031.1	P42785	PCP_HUMAN	prolylcarboxypeptidase (angiotensinase C)	112			E -> D (in dbSNP:rs2298668). {ECO:0000269|PubMed:14702039}.		angiogenesis involved in wound healing (GO:0060055)|blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|energy homeostasis (GO:0097009)|glucose homeostasis (GO:0042593)|negative regulation of systemic arterial blood pressure (GO:0003085)|plasma kallikrein-kinin cascade (GO:0002353)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of reactive oxygen species metabolic process (GO:2000377)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)	basal part of cell (GO:0045178)|extracellular vesicular exosome (GO:0070062)|lysosome (GO:0005764)|plasma membrane (GO:0005886)	serine-type carboxypeptidase activity (GO:0004185)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(7)|prostate(1)|skin(2)|urinary_tract(1)	17						TAGCTTTCAGTTCCTCAGCCA	0.383													T|||	698	0.139377	0.1051	0.1297	5008	,	,		17253	0.1131		0.1869	False		,,,				2504	0.1708																0								T	ASP/GLU,ASP/GLU	565,3841	250.0+/-257.2	43,479,1681	115.0	96.0	103.0		336,399	2.9	1.0	11	dbSNP_100	103	1545,7055	290.4+/-299.8	144,1257,2899	yes	missense,missense	PRCP	NM_005040.2,NM_199418.2	45,45	187,1736,4580	GG,GT,TT		17.9651,12.8234,16.2233	benign,benign	112/497,133/518	82564294	2110,10896	2203	4300	6503	SO:0001583	missense	5547			BC001500, BI827978, L13977	CCDS8262.1, CCDS41695.1	11q14	2005-10-04				ENSG00000137509			9344	protein-coding gene	gene with protein product		176785				8344943	Standard	NM_199418		Approved	PCP, HUMPCP	uc001ozr.3	P42785		ENST00000313010.3:c.336A>C	11.37:g.82564294T>G	ENSP00000317362:p.Glu112Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MU24|B2R7B7|B3KRK5|B5BU34	Missense_Mutation	SNP	pfam_Peptidase_S28	p.E133D	ENST00000313010.3	37	c.399	CCDS8262.1	11	302	0.1382783882783883	51	0.10365853658536585	52	0.143646408839779	57	0.09965034965034965	142	0.18733509234828497	T	14.55	2.569018	0.45798	0.128234	0.179651	ENSG00000137509	ENST00000313010;ENST00000393399;ENST00000535099;ENST00000531801;ENST00000534631;ENST00000527444;ENST00000531128;ENST00000534396;ENST00000529671;ENST00000528082;ENST00000532809;ENST00000533126;ENST00000534264	T;T;T;T;T;T;T;T;T;T;T;T;T	0.15718	2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4;2.4	5.27	2.94	0.34122	.	0.000000	0.85682	D	0.000000	T	0.00039	0.0001	M	0.65677	2.01	0.23304	P	0.99794875	B;B	0.23540	0.001;0.087	B;B	0.27608	0.005;0.081	T	0.16041	-1.0416	8	.	.	.	-22.6635	7.2281	0.26026	0.0:0.3153:0.0:0.6847	rs2298668;rs17649579;rs52813874;rs2298668	112;133	P42785;A8MU24	PCP_HUMAN;.	D	112;133;7;7;7;7;7;7;71;7;58;7;7	ENSP00000317362:E112D;ENSP00000377055:E133D;ENSP00000442077:E7D;ENSP00000432004:E7D;ENSP00000431559:E7D;ENSP00000436141:E7D;ENSP00000431435:E7D;ENSP00000432506:E7D;ENSP00000434771:E71D;ENSP00000435071:E7D;ENSP00000437169:E58D;ENSP00000431496:E7D;ENSP00000436095:E7D	.	E	-	3	2	PRCP	82241942	0.998000	0.40836	1.000000	0.80357	0.988000	0.76386	0.547000	0.23299	0.864000	0.35578	0.528000	0.53228	GAA	PRCP	-	pfam_Peptidase_S28		0.383	PRCP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRCP	HGNC	protein_coding	OTTHUMT00000391792.1	T	NM_005040		82564294	-1	no_errors	ENST00000393399	ensembl	human	known	70_37	missense	SNP	1.000	G
PRKDC	5591	genome.wustl.edu	37	8	48776016	48776016	+	Silent	SNP	T	T	C	rs201140159		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:48776016T>C	ENST00000314191.2	-	43	5747	c.5691A>G	c.(5689-5691)caA>caG	p.Q1897Q	PRKDC_ENST00000338368.3_Silent_p.Q1897Q|PRKDC_ENST00000523565.1_5'UTR	NM_006904.6	NP_008835.5	P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide	1898					B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	CATGGAAAACTTGATTAATTT	0.323								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0								T	,	0,3690		0,0,1845	134.0	131.0	132.0		5693,5693	2.3	0.9	8		132	4,8176		0,4,4086	yes	coding-synonymous,coding-synonymous	PRKDC	NM_001081640.1,NM_006904.6	,	0,4,5931	CC,CT,TT		0.0489,0.0,0.0337	,	1898/4098,1898/4129	48776016	4,11866	1845	4090	5935	SO:0001819	synonymous_variant	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000314191.2:c.5691A>G	8.37:g.48776016T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	Silent	SNP	pfam_NUC194,pfam_PIK-rel_kinase_FAT,pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.Q1897	ENST00000314191.2	37	c.5691		8																																																																																			PRKDC	-	pfam_NUC194,superfamily_ARM-type_fold		0.323	PRKDC-201	KNOWN	basic|appris_principal	protein_coding	PRKDC	HGNC	protein_coding		T	NM_001081640		48776016	-1	no_errors	ENST00000314191	ensembl	human	known	70_37	silent	SNP	1.000	C
PRKG1	5592	genome.wustl.edu	37	10	53667321	53667321	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:53667321C>T	ENST00000401604.2	+	5	902	c.708C>T	c.(706-708)gtC>gtT	p.V236V	PRKG1_ENST00000373980.4_Silent_p.V251V|PRKG1_ENST00000373985.1_Silent_p.V224V			Q13976	KGP1_HUMAN	protein kinase, cGMP-dependent, type I	236	cGMP-binding, low affinity.				actin cytoskeleton organization (GO:0030036)|blood coagulation (GO:0007596)|cGMP-mediated signaling (GO:0019934)|dendrite development (GO:0016358)|forebrain development (GO:0030900)|negative regulation of platelet aggregation (GO:0090331)|neuron migration (GO:0001764)|protein phosphorylation (GO:0006468)|regulation of GTPase activity (GO:0043087)|relaxation of vascular smooth muscle (GO:0060087)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium channel regulator activity (GO:0005246)|cGMP binding (GO:0030553)|cGMP-dependent protein kinase activity (GO:0004692)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|ovary(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	53		all_cancers(4;2.13e-08)|all_epithelial(4;2.44e-08)|all_lung(4;0.000173)		all cancers(4;1.18e-05)|GBM - Glioblastoma multiforme(4;0.000359)|Epithelial(53;0.00532)|Lung(62;0.0606)		TTGCTGATGTCCTTGAAGAGG	0.433																																																	0													202.0	182.0	189.0					10																	53667321		2203	4300	6503	SO:0001819	synonymous_variant	5592				CCDS7244.1	10q11.2	2009-07-10			ENSG00000185532	ENSG00000185532	2.7.11.1		9414	protein-coding gene	gene with protein product		176894		PRKGR1B, PRKG1B		2792381, 1544322	Standard	NM_001098512		Approved	PGK, PKG	uc001jjo.3	Q13976	OTTHUMG00000018248	ENST00000401604.2:c.708C>T	10.37:g.53667321C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A5YM56|B3KSF3|E2PU10|P14619|Q5JP05|Q5JSJ6|Q6P5T7	Silent	SNP	pirsf_cGMP-dependent_protein_kinase,pfam_Prot_kinase_cat_dom,pfam_cNMP-bd_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,prints_cGMP_dep_kinase,prints_cAMP/cGMP_kin,pfscan_cNMP-bd_dom,pfscan_Prot_kinase_cat_dom	p.V251	ENST00000401604.2	37	c.753	CCDS44399.1	10																																																																																			PRKG1	-	pirsf_cGMP-dependent_protein_kinase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,prints_cGMP_dep_kinase,pfscan_cNMP-bd_dom		0.433	PRKG1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRKG1	HGNC	protein_coding		C			53667321	+1	no_errors	ENST00000373980	ensembl	human	known	70_37	silent	SNP	1.000	T
PROB1	389333	genome.wustl.edu	37	5	138728722	138728722	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:138728722G>A	ENST00000434752.2	-	1	2163	c.2049C>T	c.(2047-2049)ttC>ttT	p.F683F		NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	683	Pro-rich.																AATCCTTGATGAAAACGGAAG	0.682																																																	0													5.0	9.0	8.0					5																	138728722		671	1570	2241	SO:0001819	synonymous_variant	389333			AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.2049C>T	5.37:g.138728722G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E007	Silent	SNP	NULL	p.F683	ENST00000434752.2	37	c.2049	CCDS54909.1	5																																																																																			PROB1	-	NULL		0.682	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROB1	HGNC	protein_coding	OTTHUMT00000470735.1	G	NM_001161546		138728722	-1	no_errors	ENST00000434752	ensembl	human	known	70_37	silent	SNP	0.244	A
PRPF3	9129	genome.wustl.edu	37	1	150305545	150305545	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:150305545G>C	ENST00000324862.6	+	6	768	c.603G>C	c.(601-603)gaG>gaC	p.E201D	PRPF3_ENST00000414970.2_Missense_Mutation_p.E152D|PRPF3_ENST00000543398.1_Missense_Mutation_p.E66D|PRPF3_ENST00000467329.1_3'UTR	NM_004698.2	NP_004689.1	O43395	PRPF3_HUMAN	pre-mRNA processing factor 3	201					mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	Cajal body (GO:0015030)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U4/U6 x U5 tri-snRNP complex (GO:0046540)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|kidney(3)|large_intestine(2)|lung(9)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	Lung NSC(24;5.57e-29)|Breast(34;0.000844)|Ovarian(49;0.0167)|all_hematologic(923;0.0597)|Hepatocellular(266;0.0997)|Colorectal(459;0.171)		LUSC - Lung squamous cell carcinoma(543;0.171)	Colorectal(1306;0.0149)		ATGCCATTGAGAAGGCAAGGA	0.532																																					Ovarian(168;1070 2670 5178 20729)												0													66.0	63.0	64.0					1																	150305545		2203	4300	6503	SO:0001583	missense	9129			AF001947	CCDS951.1	1q21.1	2013-07-16	2013-06-10		ENSG00000117360	ENSG00000117360			17348	protein-coding gene	gene with protein product		607301	"""retinitis pigmentosa 18 (autosomal dominant)"", ""PRP3 pre-mRNA processing factor 3 homolog (yeast)"", ""PRP3 pre-mRNA processing factor 3 homolog (S. cerevisiae)"""	RP18			Standard	NM_004698		Approved	Prp3, hPrp3, SNRNP90	uc001eum.4	O43395	OTTHUMG00000012807	ENST00000324862.6:c.603G>C	1.37:g.150305545G>C	ENSP00000315379:p.Glu201Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DSY9|O43446|Q5VT54	Missense_Mutation	SNP	pfam_Pre-mRNA_splic_Prp3,pfam_DUF1115,pfam_PWI,superfamily_PWI,smart_PWI	p.E201D	ENST00000324862.6	37	c.603	CCDS951.1	1	.	.	.	.	.	.	.	.	.	.	G	12.66	2.004839	0.35415	.	.	ENSG00000117360	ENST00000324862;ENST00000414970;ENST00000543398	T;T	0.78481	-1.18;-1.09	5.33	0.805	0.18703	.	0.046049	0.85682	D	0.000000	T	0.39091	0.1065	L	0.27053	0.805	0.58432	D	0.999999	B;B	0.11235	0.003;0.004	B;B	0.10450	0.005;0.005	T	0.17167	-1.0378	10	0.11794	T	0.64	-19.0702	7.3417	0.26640	0.3427:0.0:0.5456:0.1118	.	152;201	E7EVD1;O43395	.;PRPF3_HUMAN	D	201;152;66	ENSP00000315379:E201D;ENSP00000387844:E152D	ENSP00000315379:E201D	E	+	3	2	PRPF3	148572169	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.460000	0.35244	0.255000	0.21593	-0.157000	0.13467	GAG	PRPF3	-	NULL		0.532	PRPF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF3	HGNC	protein_coding	OTTHUMT00000035836.1	G	NM_004698		150305545	+1	no_errors	ENST00000324862	ensembl	human	known	70_37	missense	SNP	0.992	C
PTH1R	5745	genome.wustl.edu	37	3	46945099	46945099	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:46945099G>C	ENST00000313049.5	+	14	1938	c.1735G>C	c.(1735-1737)Gag>Cag	p.E579Q	PTH1R_ENST00000430002.2_Missense_Mutation_p.E579Q|PTH1R_ENST00000449590.1_Missense_Mutation_p.E579Q|PTH1R_ENST00000418619.1_Missense_Mutation_p.E579Q			Q03431	PTH1R_HUMAN	parathyroid hormone 1 receptor	579					adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|bone mineralization (GO:0030282)|bone resorption (GO:0045453)|cell maturation (GO:0048469)|chondrocyte differentiation (GO:0002062)|G-protein coupled receptor signaling pathway (GO:0007186)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|negative regulation of cell proliferation (GO:0008285)|osteoblast development (GO:0002076)|phospholipase C-activating G-protein coupled receptor signaling pathway (GO:0007200)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of inositol phosphate biosynthetic process (GO:0060732)|skeletal system development (GO:0001501)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|brush border membrane (GO:0031526)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	parathyroid hormone receptor activity (GO:0004991)|peptide hormone binding (GO:0017046)|protein self-association (GO:0043621)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(3)|liver(1)|lung(5)|skin(2)|stomach(1)|urinary_tract(2)	19					Preotact(DB05829)|Teriparatide(DB06285)	CTCTGGGCCTGAGCGGCCACC	0.632																																																	0													73.0	83.0	80.0					3																	46945099		2203	4300	6503	SO:0001583	missense	5745				CCDS2747.1	3p22-p21.1	2012-08-10	2008-11-18	2008-11-18	ENSG00000160801	ENSG00000160801		"""GPCR / Class B : Parathyroid hormone receptors"""	9608	protein-coding gene	gene with protein product		168468	"""parathyroid hormone receptor 1"""	PTHR, PTHR1		8020952	Standard	NM_001184744		Approved		uc021wxg.1	Q03431	OTTHUMG00000133515	ENST00000313049.5:c.1735G>C	3.37:g.46945099G>C	ENSP00000321999:p.Glu579Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M1U3	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPCR_2_extracellular_dom,smart_GPCR_2_extracellular_dom,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_parathyroid_rcpt	p.E579Q	ENST00000313049.5	37	c.1735	CCDS2747.1	3	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644892	0.29246	.	.	ENSG00000160801	ENST00000449590;ENST00000418619;ENST00000430002;ENST00000313049;ENST00000313063;ENST00000422115	T;T;T;T;T	0.78481	0.65;0.65;0.65;0.65;-1.18	5.02	2.18	0.27775	.	.	.	.	.	T	0.57373	0.2049	N	0.14661	0.345	0.09310	N	1	B	0.14012	0.009	B	0.13407	0.009	T	0.41106	-0.9527	9	0.25751	T	0.34	.	5.4122	0.16354	0.1726:0.3213:0.5061:0.0	.	579	Q03431	PTH1R_HUMAN	Q	579;579;579;579;884;168	ENSP00000402723:E579Q;ENSP00000411424:E579Q;ENSP00000413774:E579Q;ENSP00000321999:E579Q;ENSP00000396176:E168Q	ENSP00000321999:E579Q	E	+	1	0	PTH1R	46920103	1.000000	0.71417	0.128000	0.21923	0.888000	0.51559	3.182000	0.50910	0.368000	0.24481	-0.302000	0.09304	GAG	PTH1R	-	NULL		0.632	PTH1R-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTH1R	HGNC	protein_coding	OTTHUMT00000257481.1	G	NM_000316		46945099	+1	no_errors	ENST00000313049	ensembl	human	known	70_37	missense	SNP	0.113	C
PTPDC1	138639	genome.wustl.edu	37	9	96857672	96857672	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:96857672G>A	ENST00000375360.3	+	6	868	c.528G>A	c.(526-528)gtG>gtA	p.V176V	PTPDC1_ENST00000288976.3_Silent_p.V228V	NM_001253830.1|NM_177995.2	NP_001240759.1|NP_818931.1	A2A3K4	PTPC1_HUMAN	protein tyrosine phosphatase domain containing 1	176	Tyrosine-protein phosphatase.				cilium morphogenesis (GO:0060271)|smoothened signaling pathway (GO:0007224)		protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|kidney(3)|large_intestine(7)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	32						TGGTGAAGGTGATGACATTTG	0.408																																																	0													225.0	198.0	207.0					9																	96857672		2203	4300	6503	SO:0001819	synonymous_variant	138639			BC051654	CCDS6707.1, CCDS6708.1, CCDS75860.1	9q22.32	2011-06-09			ENSG00000158079	ENSG00000158079		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	30184	protein-coding gene	gene with protein product	"""protein tyrosine phosphatase PTP9Q22"""					14702039	Standard	NM_152422		Approved	PTP9Q22, FLJ37312	uc010mrj.2	A2A3K4	OTTHUMG00000020258	ENST00000375360.3:c.528G>A	9.37:g.96857672G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3M4|Q6NXE8|Q8IWM1|Q8N1X4|Q8N9F5	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.V176	ENST00000375360.3	37	c.528	CCDS6707.1	9																																																																																			PTPDC1	-	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase		0.408	PTPDC1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPDC1	HGNC	protein_coding	OTTHUMT00000215007.1	G	NM_177995, NM_152422		96857672	+1	no_errors	ENST00000375360	ensembl	human	known	70_37	silent	SNP	1.000	A
PTPRS	5802	genome.wustl.edu	37	19	5273571	5273571	+	Silent	SNP	T	T	G	rs1141371	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:5273571T>G	ENST00000587303.1	-	3	360	c.261A>C	c.(259-261)gcA>gcC	p.A87A	PTPRS_ENST00000588012.1_Silent_p.A87A|PTPRS_ENST00000590509.1_Silent_p.A87A|PTPRS_ENST00000348075.2_Silent_p.A87A|PTPRS_ENST00000588552.1_5'UTR|PTPRS_ENST00000262963.6_Silent_p.A87A|PTPRS_ENST00000357368.4_Silent_p.A87A|PTPRS_ENST00000353284.2_Silent_p.A87A|PTPRS_ENST00000372412.4_Silent_p.A87A|PTPRS_ENST00000592099.1_Silent_p.A87A			Q13332	PTPRS_HUMAN	protein tyrosine phosphatase, receptor type, S	87	Ig-like C2-type 1.				cell adhesion (GO:0007155)|cerebellum development (GO:0021549)|cerebral cortex development (GO:0021987)|corpus callosum development (GO:0022038)|extracellular matrix organization (GO:0030198)|hippocampus development (GO:0021766)|peptidyl-tyrosine dephosphorylation (GO:0035335)|spinal cord development (GO:0021510)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(1)|biliary_tract(1)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(9)|ovary(4)|prostate(1)|skin(12)|stomach(2)|upper_aerodigestive_tract(1)	61				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0321)|Lung(535;0.182)	Alendronate(DB00630)|Etidronic acid(DB01077)	GCACTGCCCCTGCACTCTCAT	0.582													T|||	819	0.163538	0.2943	0.1527	5008	,	,		20134	0.002		0.2266	False		,,,				2504	0.0961																0								T	,,,	1168,3238	412.4+/-336.1	151,866,1186	94.0	82.0	86.0		261,261,261,261	-8.0	0.6	19	dbSNP_86	86	1924,6676	339.9+/-323.4	208,1508,2584	no	coding-synonymous,coding-synonymous,coding-synonymous,coding-synonymous	PTPRS	NM_002850.3,NM_130853.2,NM_130854.2,NM_130855.2	,,,	359,2374,3770	GG,GT,TT		22.3721,26.5093,23.7736	,,,	87/1949,87/1502,87/1911,87/1506	5273571	3092,9914	2203	4300	6503	SO:0001819	synonymous_variant	5802			U35234	CCDS12139.1, CCDS12140.1, CCDS45930.1, CCDS74265.1	19p13.3	2013-02-11				ENSG00000105426		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9681	protein-coding gene	gene with protein product		601576				8954782, 8524829	Standard	NM_002850		Approved		uc002mbv.3	Q13332		ENST00000587303.1:c.261A>C	19.37:g.5273571T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O75255|O75870|Q15718|Q16341|Q2M3R7	Silent	SNP	pfam_Tyr_Pase_rcpt/non-rcpt,pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Tyr_Pase_rcpt/non-rcpt,smart_Tyr_Pase_cat,prints_Tyr_Pase_rcpt/non-rcpt,pfscan_Fibronectin_type3,pfscan_Tyr/Dual-specificity_Pase,pfscan_Tyr_Pase_rcpt/non-rcpt,pfscan_Ig-like	p.A87	ENST00000587303.1	37	c.261	CCDS45930.1	19																																																																																			PTPRS	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.582	PTPRS-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PTPRS	HGNC	protein_coding	OTTHUMT00000450762.2	T			5273571	-1	no_errors	ENST00000372412	ensembl	human	known	70_37	silent	SNP	0.079	G
PWP1	11137	genome.wustl.edu	37	12	108082489	108082489	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:108082489G>A	ENST00000412830.3	+	3	397	c.229G>A	c.(229-231)Gag>Aag	p.E77K	PWP1_ENST00000541166.1_Missense_Mutation_p.E15K	NM_007062.1	NP_008993.1	Q13610	PWP1_HUMAN	PWP1 homolog (S. cerevisiae)	77					transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleus (GO:0005634)				breast(3)|endometrium(4)|kidney(1)|large_intestine(8)|lung(6)|urinary_tract(1)	23						AGAGCCCCTGGAGGATGGTGA	0.522																																																	0													128.0	119.0	122.0					12																	108082489		2203	4300	6503	SO:0001583	missense	11137			BC000067	CCDS9114.1	12q23.3	2013-06-10				ENSG00000136045		"""WD repeat domain containing"""	17015	protein-coding gene	gene with protein product	"""endonuclein"""					7828893, 11850830	Standard	NM_007062		Approved	IEF-SSP-9502	uc001tmo.1	Q13610	OTTHUMG00000169913	ENST00000412830.3:c.229G>A	12.37:g.108082489G>A	ENSP00000387365:p.Glu77Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3R6|Q7Z3X9	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.E77K	ENST00000412830.3	37	c.229	CCDS9114.1	12	.	.	.	.	.	.	.	.	.	.	.	10.98	1.504500	0.26949	.	.	ENSG00000136045	ENST00000412830;ENST00000547995;ENST00000258531;ENST00000546068;ENST00000538327;ENST00000541166	T;T	0.70516	-0.45;-0.49	5.82	4.86	0.63082	.	0.602245	0.17545	N	0.170392	T	0.54498	0.1862	L	0.28014	0.82	0.09310	N	1	B	0.26318	0.146	B	0.22152	0.038	T	0.36040	-0.9764	10	0.23302	T	0.38	.	10.3032	0.43665	0.0:0.1346:0.7113:0.1541	.	77	Q13610	PWP1_HUMAN	K	77;15;77;77;77;15	ENSP00000387365:E77K;ENSP00000445249:E15K	ENSP00000258531:E77K	E	+	1	0	PWP1	106606619	0.945000	0.32115	0.996000	0.52242	0.964000	0.63967	1.534000	0.36051	2.742000	0.94016	0.579000	0.79373	GAG	PWP1	-	NULL		0.522	PWP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PWP1	HGNC	protein_coding	OTTHUMT00000406539.1	G	NM_007062		108082489	+1	no_errors	ENST00000412830	ensembl	human	known	70_37	missense	SNP	0.002	A
PYGB	5834	genome.wustl.edu	37	20	25228957	25228957	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:25228957C>T	ENST00000216962.4	+	1	253	c.143C>T	c.(142-144)aCg>aTg	p.T48M		NM_002862.3	NP_002853.2	P11216	PYGB_HUMAN	phosphorylase, glycogen; brain	48					carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycogen catabolic process (GO:0005980)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	glycogen phosphorylase activity (GO:0008184)|pyridoxal phosphate binding (GO:0030170)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(12)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	31						AATGTGGCCACGCCCCGCGAC	0.687																																																	0													56.0	42.0	46.0					20																	25228957		2202	4300	6502	SO:0001583	missense	5834				CCDS13171.1	20p11.21	2013-03-01			ENSG00000100994	ENSG00000100994	2.4.1.1	"""Glycogen phosphorylases"""	9723	protein-coding gene	gene with protein product	"""glycogen phosphorylase, brain form"""	138550					Standard	NM_002862		Approved		uc002wup.3	P11216	OTTHUMG00000032117	ENST00000216962.4:c.143C>T	20.37:g.25228957C>T	ENSP00000216962:p.Thr48Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AK1|Q9NPX8	Missense_Mutation	SNP	pfam_Glyco_trans_35,pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas	p.T48M	ENST00000216962.4	37	c.143	CCDS13171.1	20	.	.	.	.	.	.	.	.	.	.	C	28.7	4.946524	0.92593	.	.	ENSG00000100994	ENST00000216962	D	0.89196	-2.48	4.16	3.21	0.36854	.	0.000000	0.85682	D	0.000000	D	0.91516	0.7321	M	0.94101	3.495	0.80722	D	1	D	0.61697	0.99	P	0.45377	0.478	D	0.91955	0.5574	10	0.87932	D	0	-6.2383	10.1229	0.42632	0.0:0.8988:0.0:0.1012	.	48	P11216	PYGB_HUMAN	M	48	ENSP00000216962:T48M	ENSP00000216962:T48M	T	+	2	0	PYGB	25176957	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.173000	0.77612	1.095000	0.41419	0.555000	0.69702	ACG	PYGB	-	pirsf_Glyco_trans_35,tigrfam_Glycg_phsphrylas		0.687	PYGB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PYGB	HGNC	protein_coding	OTTHUMT00000078415.2	C	NM_002862		25228957	+1	no_errors	ENST00000216962	ensembl	human	known	70_37	missense	SNP	1.000	T
RABGGTB	5876	genome.wustl.edu	37	1	76253045	76253046	+	Intron	INS	-	-	A	rs3831900|rs397692920	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:76253045_76253046insA	ENST00000319942.3	+	2	74				RABGGTB_ENST00000496055.1_Intron|RABGGTB_ENST00000370826.3_Intron|SNORD45B_ENST00000364617.1_RNA|SNORD45A_ENST00000384512.1_RNA|RABGGTB_ENST00000535300.1_Intron|SNORD45C_ENST00000383893.1_RNA	NM_004582.3	NP_004573.2	P53611	PGTB2_HUMAN	Rab geranylgeranyltransferase, beta subunit						cellular protein modification process (GO:0006464)|protein geranylgeranylation (GO:0018344)|visual perception (GO:0007601)	Rab-protein geranylgeranyltransferase complex (GO:0005968)	Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(7)|ovary(1)	19						cctagtTAGTTACAATTTTTAA	0.441													A|A|AA|insertion	1049	0.209465	0.2905	0.2003	5008	,	,		18796	0.0228		0.3101	False		,,,				2504	0.1953																0																																										SO:0001627	intron_variant	5876			U49245	CCDS669.1	1p31	2008-02-05			ENSG00000137955	ENSG00000137955			9796	protein-coding gene	gene with protein product		179080				8706741, 8954794	Standard	NM_004582		Approved		uc001dgy.2	P53611	OTTHUMG00000009786	ENST00000319942.3:c.4-136->A	1.37:g.76253046_76253046dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q92697	RNA	INS	-	NULL	ENST00000319942.3	37	NULL	CCDS669.1	1																																																																																			RABGGTB	-	-		0.441	RABGGTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RABGGTB	HGNC	protein_coding	OTTHUMT00000026972.1	-	NM_004582		76253046	+1	no_errors	ENST00000471759	ensembl	human	known	70_37	rna	INS	0.003:0.002	A
RANBP3	8498	genome.wustl.edu	37	19	5925689	5925689	+	Missense_Mutation	SNP	G	G	T	rs199604597		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:5925689G>T	ENST00000340578.6	-	10	930	c.873C>A	c.(871-873)gaC>gaA	p.D291E	RANBP3_ENST00000591092.1_Missense_Mutation_p.D218E|RANBP3_ENST00000541471.1_Missense_Mutation_p.D163E|RANBP3_ENST00000439268.2_Missense_Mutation_p.D286E|RANBP3_ENST00000034275.8_Missense_Mutation_p.D223E	NM_003624.2|NM_007320.2|NM_007322.2	NP_003615.2|NP_015559.2|NP_015561.1	Q9H6Z4	RANB3_HUMAN	RAN binding protein 3	291					intracellular transport (GO:0046907)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	R-SMAD binding (GO:0070412)|Ran GTPase binding (GO:0008536)			breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	18						CGGTTGGCGTGTCTGCGCTGG	0.602																																																	0								G	GLU/ASP,GLU/ASP,GLU/ASP	0,4250		0,0,2125	84.0	92.0	89.0		858,669,873	-2.6	0.1	19		89	3,8439		0,3,4218	yes	missense,missense,missense	RANBP3	NM_003624.2,NM_007320.2,NM_007322.2	45,45,45	0,3,6343	TT,TG,GG		0.0355,0.0,0.0236	benign,benign,benign	286/563,223/500,291/568	5925689	3,12689	2125	4221	6346	SO:0001583	missense	8498			Y08698	CCDS42477.1, CCDS42478.1, CCDS45935.1, CCDS74268.1	19p13.3	2008-02-05							9850	protein-coding gene	gene with protein product		603327				9637251	Standard	NM_007322		Approved		uc002mdw.3	Q9H6Z4		ENST00000340578.6:c.873C>A	19.37:g.5925689G>T	ENSP00000341483:p.Asp291Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAT8|O60405|O75759|O75760|Q9BT47|Q9UG74	Missense_Mutation	SNP	pfam_Ran_bind_dom,smart_Ran_bind_dom,pfscan_Ran_bind_dom	p.D291E	ENST00000340578.6	37	c.873	CCDS42478.1	19	.	.	.	.	.	.	.	.	.	.	G	0.066	-1.212330	0.01555	0.0	3.55E-4	ENSG00000031823	ENST00000340578;ENST00000439268;ENST00000034275;ENST00000324807;ENST00000541471	T;T;T;T	0.27557	1.68;1.68;2.41;1.66	5.19	-2.63	0.06133	.	0.547712	0.21417	N	0.074893	T	0.07638	0.0192	N	0.01493	-0.835	0.26635	N	0.9724	B;B;B;B;B;B;B	0.06786	0.001;0.0;0.0;0.0;0.0;0.001;0.0	B;B;B;B;B;B;B	0.08055	0.003;0.001;0.001;0.001;0.002;0.002;0.001	T	0.34428	-0.9829	10	0.07644	T	0.81	-7.1892	7.5124	0.27581	0.0:0.1587:0.5345:0.3068	.	163;286;163;218;223;286;291	F5H4C2;Q53GE1;B7Z5P4;B7Z7F3;Q9H6Z4-3;Q9H6Z4-2;Q9H6Z4	.;.;.;.;.;.;RANB3_HUMAN	E	291;286;223;222;163	ENSP00000341483:D291E;ENSP00000404837:D286E;ENSP00000034275:D223E;ENSP00000445071:D163E	ENSP00000034275:D223E	D	-	3	2	RANBP3	5876689	0.000000	0.05858	0.093000	0.20910	0.290000	0.27261	-0.870000	0.04228	-0.829000	0.04268	-0.397000	0.06425	GAC	RANBP3	-	NULL		0.602	RANBP3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RANBP3	HGNC	protein_coding	OTTHUMT00000452304.1	G	NM_007322		5925689	-1	no_errors	ENST00000340578	ensembl	human	known	70_37	missense	SNP	0.656	T
LRRC14	9684	genome.wustl.edu	37	8	145742524	145742524	+	5'Flank	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:145742524C>A	ENST00000292524.1	+	0	0				LRRC14_ENST00000529022.1_5'Flank|RECQL4_ENST00000428558.2_Missense_Mutation_p.K88N|RECQL4_ENST00000532237.1_5'UTR	NM_001272036.1|NM_014665.2	NP_001258965.1|NP_055480.1	Q15048	LRC14_HUMAN	leucine rich repeat containing 14											endometrium(1)|lung(3)|prostate(1)	5	all_cancers(97;5.56e-11)|all_epithelial(106;3.54e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;1.48e-41)|Epithelial(56;1.85e-40)|all cancers(56;3.59e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0483)|Colorectal(110;0.055)			ACTGTGGACTCTTGGTCGCAG	0.672																																																	0													16.0	18.0	18.0					8																	145742524		1938	4136	6074	SO:0001631	upstream_gene_variant	9401			BC011377	CCDS6432.1	8q24.3	2012-08-20			ENSG00000160959	ENSG00000160959			20419	protein-coding gene	gene with protein product						7584026	Standard	NM_001272036		Approved	KIAA0014, LRRC14A	uc003zdk.3	Q15048	OTTHUMG00000165179		8.37:g.145742524C>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0A8|D3DWM8	RNA	SNP	-	NULL	ENST00000292524.1	37	NULL	CCDS6432.1	8																																																																																			RECQL4	-	-		0.672	LRRC14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RECQL4	HGNC	protein_coding	OTTHUMT00000382494.1	C	NM_014665		145742524	-1	no_errors	ENST00000428558	ensembl	human	known	70_37	rna	SNP	0.000	A
REEP5	7905	genome.wustl.edu	37	5	112257809	112257809	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:112257809C>T	ENST00000379638.4	-	1	427	c.79G>A	c.(79-81)Gag>Aag	p.E27K	REEP5_ENST00000474542.2_5'Flank|REEP5_ENST00000545426.1_Missense_Mutation_p.E27K|REEP5_ENST00000513339.1_Missense_Mutation_p.E27K|REEP5_ENST00000504247.1_Missense_Mutation_p.E27K	NM_005669.4	NP_005660.4	Q00765	REEP5_HUMAN	receptor accessory protein 5	27						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)		p.E27K(1)		endometrium(1)|large_intestine(2)|lung(1)|ovary(1)	5		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		Epithelial(69;1.3e-09)|OV - Ovarian serous cystadenocarcinoma(64;1.26e-08)|all cancers(49;3.56e-07)|Colorectal(14;0.00778)|COAD - Colon adenocarcinoma(37;0.013)		GTTTTGGCCTCGAGCTTGGCC	0.677																																																	1	Substitution - Missense(1)	lung(1)											72.0	66.0	68.0					5																	112257809		2202	4300	6502	SO:0001583	missense	7905			BC000232	CCDS4109.2	5q22-q23	2008-02-05	2006-02-07	2006-02-07	ENSG00000129625	ENSG00000129625		"""Receptor accessory proteins"""	30077	protein-coding gene	gene with protein product	"""deleted in polyposis 1"", ""polyposis locus protein 1"", ""polyposis coli region hypothetical protein DP1"""	125265	"""chromosome 5 open reading frame 18"""	C5orf18		16271481, 15550249	Standard	NM_005669		Approved	DP1, TB2, D5S346	uc003kqe.1	Q00765	OTTHUMG00000128807	ENST00000379638.4:c.79G>A	5.37:g.112257809C>T	ENSP00000368959:p.Glu27Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z681|D3DT04|Q04198|Q5QGT0|Q9BWH9	Missense_Mutation	SNP	pfam_TB2_DP1_HVA22	p.E27K	ENST00000379638.4	37	c.79	CCDS4109.2	5	.	.	.	.	.	.	.	.	.	.	C	21.3	4.135209	0.77662	.	.	ENSG00000129625	ENST00000379638;ENST00000513339;ENST00000545426;ENST00000504247	T;T;T;T	0.55588	0.51;0.51;0.51;0.51	4.3	4.3	0.51218	.	0.000000	0.85682	D	0.000000	T	0.79902	0.4526	H	0.94264	3.515	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.80764	0.969;0.994	D	0.86830	0.2010	10	0.87932	D	0	-41.9862	16.3524	0.83220	0.0:1.0:0.0:0.0	.	27;27	B7Z510;Q00765	.;REEP5_HUMAN	K	27	ENSP00000368959:E27K;ENSP00000425901:E27K;ENSP00000442940:E27K;ENSP00000421881:E27K	ENSP00000368959:E27K	E	-	1	0	REEP5	112285708	1.000000	0.71417	1.000000	0.80357	0.006000	0.05464	6.323000	0.72891	1.932000	0.55993	0.655000	0.94253	GAG	REEP5	-	NULL		0.677	REEP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	REEP5	HGNC	protein_coding	OTTHUMT00000250739.2	C	NM_005669		112257809	-1	no_errors	ENST00000379638	ensembl	human	known	70_37	missense	SNP	1.000	T
RGAG1	57529	genome.wustl.edu	37	X	109696520	109696520	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:109696520C>A	ENST00000465301.2	+	3	2921	c.2675C>A	c.(2674-2676)cCa>cAa	p.P892Q	RGAG1_ENST00000540313.1_Missense_Mutation_p.P892Q	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	892										NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						GTGCGAGCCCCAGCCTCTGGA	0.552																																																	0													107.0	108.0	108.0					X																	109696520		2203	4300	6503	SO:0001583	missense	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.2675C>A	X.37:g.109696520C>A	ENSP00000419786:p.Pro892Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.P892Q	ENST00000465301.2	37	c.2675	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	14.08	2.429888	0.43122	.	.	ENSG00000243978	ENST00000465301;ENST00000540313	T;T	0.42513	0.97;0.97	3.57	3.57	0.40892	.	0.808577	0.10163	N	0.708138	T	0.41096	0.1144	L	0.54323	1.7	0.09310	N	0.999999	P	0.47677	0.899	P	0.45681	0.49	T	0.28202	-1.0051	9	.	.	.	2.0311	6.0827	0.19950	0.0:0.8605:0.0:0.1395	.	892	Q8NET4	RGAG1_HUMAN	Q	892	ENSP00000419786:P892Q;ENSP00000441452:P892Q	.	P	+	2	0	RGAG1	109583176	0.073000	0.21202	0.017000	0.16124	0.012000	0.07955	3.898000	0.56281	2.040000	0.60383	0.600000	0.82982	CCA	RGAG1	-	NULL		0.552	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	C	NM_020769		109696520	+1	no_errors	ENST00000465301	ensembl	human	known	70_37	missense	SNP	0.053	A
RGPD8	727851	genome.wustl.edu	37	2	113145814	113145814	+	Missense_Mutation	SNP	C	C	T	rs17041523		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:113145814C>T	ENST00000302558.3	-	20	4899	c.4708G>A	c.(4708-4710)Gga>Aga	p.G1570R	RGPD8_ENST00000409750.1_Missense_Mutation_p.G1430R	NM_001164463.1	NP_001157935.1	O14715	RGPD8_HUMAN	RANBP2-like and GRIP domain containing 8	1570					protein targeting to Golgi (GO:0000042)	nuclear pore (GO:0005643)	Ran GTPase binding (GO:0008536)			endometrium(4)|kidney(1)|lung(1)|prostate(3)|urinary_tract(1)	10						AAACTAAATCCAAACAAAGAC	0.338																																																	0													1.0	1.0	1.0					2																	113145814		9	54	63	SO:0001583	missense	727851			AF012086	CCDS46394.1	2q13	2013-01-10	2005-12-20	2005-12-20	ENSG00000169629	ENSG00000169629		"""Tetratricopeptide (TTC) repeat domain containing"""	9849	protein-coding gene	gene with protein product		602752	"""RAN binding protein 2-like 1"""	RANBP2L1		9480752	Standard	NM_001164463		Approved	RanBP2alpha	uc002ths.2	O14715	OTTHUMG00000153289	ENST00000302558.3:c.4708G>A	2.37:g.113145814C>T	ENSP00000306637:p.Gly1570Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5CZA8	Missense_Mutation	SNP	pfam_Ran_bind_dom,pfam_GRIP,pfam_TPR-1,pfam_TPR_2,superfamily_GRIP,smart_TPR_repeat,smart_Ran_bind_dom,smart_GRIP,pfscan_GRIP,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_Ran_bind_dom	p.G1570R	ENST00000302558.3	37	c.4708	CCDS46394.1	2	.	.	.	.	.	.	.	.	.	.	-	8.946	0.966975	0.18659	.	.	ENSG00000169629	ENST00000302558;ENST00000409750	T;T	0.52754	0.66;0.65	2.3	2.3	0.28687	.	.	.	.	.	T	0.62660	0.2446	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.76575	0.988	T	0.65170	-0.6233	9	0.66056	D	0.02	-28.2303	10.3508	0.43934	0.0:1.0:0.0:0.0	.	1570	O14715	RGPD8_HUMAN	R	1570;1430	ENSP00000306637:G1570R;ENSP00000386511:G1430R	ENSP00000306637:G1570R	G	-	1	0	RGPD8	112862285	1.000000	0.71417	1.000000	0.80357	0.589000	0.36550	4.184000	0.58323	1.299000	0.44798	0.152000	0.16155	GGA	RGPD8	-	NULL		0.338	RGPD8-006	KNOWN	basic|appris_principal|CCDS	protein_coding	RGPD8	HGNC	protein_coding	OTTHUMT00000375951.1	C	XM_001722279		113145814	-1	no_errors	ENST00000302558	ensembl	human	known	70_37	missense	SNP	1.000	T
RHOU	58480	genome.wustl.edu	37	1	228871693	228871693	+	Silent	SNP	C	C	T	rs3738073	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:228871693C>T	ENST00000366691.3	+	1	870	c.204C>T	c.(202-204)agC>agT	p.S68S		NM_021205.5	NP_067028.1			ras homolog family member U											breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)|stomach(1)	13	Breast(184;0.162)	Prostate(94;0.183)				TGGTGGTGAGCTACACCACCA	0.751													c|||	646	0.128994	0.0893	0.0951	5008	,	,		7479	0.0427		0.172	False		,,,				2504	0.2515																0										451,3945		35,381,1782	20.0	25.0	23.0		204	3.7	1.0	1	dbSNP_107	23	1682,6908		177,1328,2790	no	coding-synonymous	RHOU	NM_021205.5		212,1709,4572	TT,TC,CC		19.5809,10.2593,16.4254		68/259	228871693	2133,10853	2198	4295	6493	SO:0001819	synonymous_variant	58480				CCDS1575.1	1q42.11-q42.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000116574	ENSG00000116574			17794	protein-coding gene	gene with protein product	"""Ryu GTPase"", ""Wnt-1 responsive Cdc42 homolog"", ""2310026M05Rik"", ""GTP-binding protein like 1"", ""CDC42-like GTPase"", ""GTP-binding protein SB128"", ""ras-like gene family member U"""	606366	"""ras homolog gene family, member U"""	ARHU		11459829	Standard	NM_021205		Approved	WRCH-1, DJ646B12.2, FLJ10616, WRCH1, CDC42L1, hG28K, fJ646B12.2	uc001htf.3	Q7L0Q8	OTTHUMG00000037919	ENST00000366691.3:c.204C>T	1.37:g.228871693C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.S68	ENST00000366691.3	37	c.204	CCDS1575.1	1																																																																																			RHOU	-	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.751	RHOU-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOU	HGNC	protein_coding	OTTHUMT00000092555.1	C	NM_021205		228871693	+1	no_errors	ENST00000366691	ensembl	human	known	70_37	silent	SNP	1.000	T
RNASEH2C	84153	genome.wustl.edu	37	11	65487294	65487294	+	Intron	SNP	C	C	G	rs377465285		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:65487294C>G	ENST00000308418.4	-	4	657				RNASEH2C_ENST00000527610.1_Silent_p.A230A|RNASEH2C_ENST00000528220.1_Intron	NM_032193.3	NP_115569.2	Q8TDP1	RNH2C_HUMAN	ribonuclease H2, subunit C						RNA catabolic process (GO:0006401)	nucleus (GO:0005634)|ribonuclease H2 complex (GO:0032299)				cervix(1)	1						CAACAGGAGTCGCCTCTACTG	0.532																																																	0								C		1,4401	2.1+/-5.4	0,1,2200	62.0	52.0	55.0			3.2	0.3	11		55	0,8594		0,0,4297	no	intron	RNASEH2C	NM_032193.3		0,1,6497	GG,GC,CC		0.0,0.0227,0.0077			65487294	1,12995	2201	4297	6498	SO:0001627	intron_variant	84153			AF312034	CCDS8111.1	11q13.1	2014-09-17							24116	protein-coding gene	gene with protein product	"""Aicardi-Goutieres syndrome 3"""	610330				8244390, 16845400	Standard	NM_032193		Approved	AYP1, AGS3	uc001ofn.3	Q8TDP1		ENST00000308418.4:c.469-14G>C	11.37:g.65487294C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H7F5	Silent	SNP	pfam_RNase_H2_suC	p.A230	ENST00000308418.4	37	c.690	CCDS8111.1	11																																																																																			RNASEH2C	-	NULL		0.532	RNASEH2C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASEH2C	HGNC	protein_coding	OTTHUMT00000390693.2	C	NM_032193		65487294	-1	no_errors	ENST00000527610	ensembl	human	putative	70_37	silent	SNP	0.082	G
RNF31	55072	genome.wustl.edu	37	14	24626844	24626844	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:24626844G>C	ENST00000324103.6	+	16	3044	c.2724G>C	c.(2722-2724)aaG>aaC	p.K908N	RNF31_ENST00000382687.3_Missense_Mutation_p.K757N|RP11-468E2.4_ENST00000558468.1_Missense_Mutation_p.K383N|RNA5SP383_ENST00000362934.1_RNA|RNF31_ENST00000559275.1_Missense_Mutation_p.K757N	NM_017999.4	NP_060469.4	Q96EP0	RNF31_HUMAN	ring finger protein 31	908					CD40 signaling pathway (GO:0023035)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein linear polyubiquitination (GO:0097039)|protein polyubiquitination (GO:0000209)|T cell receptor signaling pathway (GO:0050852)	CD40 receptor complex (GO:0035631)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|LUBAC complex (GO:0071797)	ligase activity (GO:0016874)|ubiquitin binding (GO:0043130)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(4)|skin(2)|soft_tissue(1)	39				GBM - Glioblastoma multiforme(265;0.00861)		TTTACGCCAAGAATGTAAGCC	0.587																																																	0													106.0	114.0	111.0					14																	24626844		2011	4163	6174	SO:0001583	missense	55072			AK000973	CCDS41931.1	14q11.2	2012-09-20			ENSG00000092098	ENSG00000092098		"""RING-type (C3HC4) zinc fingers"""	16031	protein-coding gene	gene with protein product	"""HOIL-1-interacting protein"""	612487				10422847	Standard	NM_017999		Approved	ZIBRA, FLJ10111, FLJ23501, HOIP	uc001wmn.1	Q96EP0	OTTHUMG00000028798	ENST00000324103.6:c.2724G>C	14.37:g.24626844G>C	ENSP00000315112:p.Lys908Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A0A962|Q86VI2|Q8TEI0|Q96GB4|Q96NF1|Q9H5F1|Q9NWD2	Missense_Mutation	SNP	pfam_PUB_domain,pfam_Znf_C6HC,superfamily_UBA-like,superfamily_DEATH-like,superfamily_Znf_FYVE_PHD,smart_Znf_RanBP2,smart_Znf_C6HC,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Znf_RanBP2	p.K908N	ENST00000324103.6	37	c.2724	CCDS41931.1	14	.	.	.	.	.	.	.	.	.	.	G	13.14	2.149337	0.37923	.	.	ENSG00000092098	ENST00000382682;ENST00000324103;ENST00000382687	T;T	0.76968	-1.06;-1.06	5.64	4.75	0.60458	Zinc finger, C6HC-type (1);Zinc finger, RING-type (1);	0.119241	0.56097	D	0.000039	T	0.69949	0.3168	N	0.04260	-0.245	0.36724	D	0.881313	D;B;D;D	0.71674	0.997;0.192;0.997;0.998	P;B;P;D	0.66351	0.879;0.028;0.879;0.943	T	0.74825	-0.3533	10	0.42905	T	0.14	-29.4896	7.3471	0.26670	0.2417:0.0:0.7583:0.0	.	908;667;908;757	A0A962;B3KV71;Q96EP0;Q96EP0-3	.;.;RNF31_HUMAN;.	N	341;908;757	ENSP00000315112:K908N;ENSP00000372134:K757N	ENSP00000315112:K908N	K	+	3	2	RNF31	23696684	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	1.313000	0.33585	1.617000	0.50277	0.650000	0.86243	AAG	RNF31	-	smart_Znf_C6HC		0.587	RNF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF31	HGNC	protein_coding	OTTHUMT00000071921.3	G	NM_017999		24626844	+1	no_errors	ENST00000324103	ensembl	human	known	70_37	missense	SNP	1.000	C
SBSPON	157869	genome.wustl.edu	37	8	73982179	73982179	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:73982179G>A	ENST00000297354.6	-	4	742	c.538C>T	c.(538-540)Cac>Tac	p.H180Y	SBSPON_ENST00000519697.1_5'UTR	NM_153225.3	NP_694957.3	Q8IVN8	SBSPO_HUMAN	somatomedin B and thrombospondin, type 1 domain containing	180					immune response (GO:0006955)	proteinaceous extracellular matrix (GO:0005578)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)										AGAGCACAGTGAGGAGTCAAG	0.463																																																	0													102.0	100.0	100.0					8																	73982179		1987	4175	6162	SO:0001583	missense	157869				CCDS43747.2	8q21.11	2013-08-07	2012-05-15	2012-05-15	ENSG00000164764	ENSG00000164764			30362	protein-coding gene	gene with protein product	"""RPE spondin"", ""rpe-spondin"""		"""chromosome 8 open reading frame 84"""	C8orf84		12107410	Standard	NM_153225		Approved	RPESP	uc003xzf.3	Q8IVN8	OTTHUMG00000157144	ENST00000297354.6:c.538C>T	8.37:g.73982179G>A	ENSP00000297354:p.His180Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAA5|Q96J64	Missense_Mutation	SNP	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Somatomedin_B_dom,pfscan_Thrombospondin_1_rpt	p.H180Y	ENST00000297354.6	37	c.538	CCDS43747.2	8	.	.	.	.	.	.	.	.	.	.	G	6.859	0.527874	0.13127	.	.	ENSG00000164764	ENST00000297354	T	0.21734	1.99	5.82	4.76	0.60689	.	0.532223	0.21133	N	0.079603	T	0.09379	0.0231	N	0.16743	0.435	0.30153	N	0.802893	B	0.06786	0.001	B	0.04013	0.001	T	0.33343	-0.9872	10	0.02654	T	1	-10.4336	6.2302	0.20730	0.137:0.1943:0.6687:0.0	.	180	Q8IVN8	RPESP_HUMAN	Y	180	ENSP00000297354:H180Y	ENSP00000297354:H180Y	H	-	1	0	C8orf84	74144733	1.000000	0.71417	0.968000	0.41197	0.848000	0.48234	3.928000	0.56506	2.767000	0.95098	0.655000	0.94253	CAC	SBSPON	-	NULL		0.463	SBSPON-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SBSPON	HGNC	protein_coding	OTTHUMT00000347584.2	G	NM_153225		73982179	-1	no_errors	ENST00000297354	ensembl	human	known	70_37	missense	SNP	0.856	A
SCN11A	11280	genome.wustl.edu	37	3	38938634	38938634	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:38938634C>T	ENST00000302328.3	-	14	2303	c.2105G>A	c.(2104-2106)gGa>gAa	p.G702E	SCN11A_ENST00000444237.2_Missense_Mutation_p.G702E|SCN11A_ENST00000456224.3_Missense_Mutation_p.G702E|SCN11A_ENST00000450244.1_Missense_Mutation_p.G702E	NM_014139.2	NP_054858.2	Q9UI33	SCNBA_HUMAN	sodium channel, voltage-gated, type XI, alpha subunit	702					cell death (GO:0008219)|membrane depolarization during action potential (GO:0086010)|neuronal action potential (GO:0019228)|regulation of sensory perception of pain (GO:0051930)|response to drug (GO:0042493)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	C-fiber (GO:0044299)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)	voltage-gated sodium channel activity (GO:0005248)			NS(3)|biliary_tract(1)|breast(4)|cervix(2)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(29)|lung(29)|ovary(3)|pancreas(2)|prostate(12)|skin(14)|upper_aerodigestive_tract(5)|urinary_tract(3)	119				Kidney(284;0.00202)|KIRC - Kidney renal clear cell carcinoma(284;0.00226)	Cocaine(DB00907)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGTCAGGCTTCCAAGGGCTCC	0.443																																																	0													60.0	59.0	59.0					3																	38938634		2203	4300	6503	SO:0001583	missense	11280			AF126739	CCDS33737.1	3p22.2	2012-02-26	2007-01-23		ENSG00000168356	ENSG00000168356		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10583	protein-coding gene	gene with protein product		604385	"""sodium channel, voltage-gated, type XI, alpha polypeptide"", ""sodium channel, voltage-gated, type XII, alpha"""	SCN12A		10444332, 16382098	Standard	NM_014139		Approved	Nav1.9, NaN, SNS-2	uc021wvy.1	Q9UI33	OTTHUMG00000048246	ENST00000302328.3:c.2105G>A	3.37:g.38938634C>T	ENSP00000307599:p.Gly702Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NN05|C9JD48|C9JR31|Q68K15|Q8NDX3|Q9UHE0|Q9UHM0	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_Na_trans_assoc,prints_Na_channel_asu	p.G702E	ENST00000302328.3	37	c.2105	CCDS33737.1	3	.	.	.	.	.	.	.	.	.	.	C	27.3	4.815227	0.90790	.	.	ENSG00000168356	ENST00000302328;ENST00000450244;ENST00000456224;ENST00000444237	D;D;D;D	0.98585	-5.01;-5.01;-5.01;-5.01	5.95	5.95	0.96441	Ion transport (1);	0.053201	0.85682	D	0.000000	D	0.99196	0.9721	M	0.90814	3.15	0.53688	D	0.999979	D	0.89917	1.0	D	0.80764	0.994	D	0.99364	1.0918	10	0.87932	D	0	.	20.4024	0.99000	0.0:1.0:0.0:0.0	.	702	Q9UI33	SCNBA_HUMAN	E	702	ENSP00000307599:G702E;ENSP00000400945:G702E;ENSP00000416757:G702E;ENSP00000408028:G702E	ENSP00000307599:G702E	G	-	2	0	SCN11A	38913638	1.000000	0.71417	0.999000	0.59377	0.985000	0.73830	7.776000	0.85560	2.827000	0.97445	0.650000	0.86243	GGA	SCN11A	-	pfam_Ion_trans_dom		0.443	SCN11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN11A	HGNC	protein_coding	OTTHUMT00000109746.4	C	NM_014139		38938634	-1	no_errors	ENST00000302328	ensembl	human	known	70_37	missense	SNP	1.000	T
SEMA4B	10509	genome.wustl.edu	37	15	90768237	90768237	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:90768237C>T	ENST00000411539.2	+	10	1492	c.1232C>T	c.(1231-1233)tCa>tTa	p.S411L	SEMA4B_ENST00000332496.6_Missense_Mutation_p.S411L|SEMA4B_ENST00000379122.3_Missense_Mutation_p.S406L	NM_198925.2	NP_945119.1	Q9NPR2	SEM4B_HUMAN	sema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4B	406	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)	receptor activity (GO:0004872)			NS(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|ovary(1)|stomach(1)	12	Melanoma(11;0.00551)|Lung NSC(78;0.0125)|all_lung(78;0.0272)		BRCA - Breast invasive adenocarcinoma(143;0.0107)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			AAGATCAACTCATCCCTGCAG	0.632																																																	0													95.0	107.0	103.0					15																	90768237		2164	4263	6427	SO:0001583	missense	10509			AB051532	CCDS45347.1	15q25	2008-07-18						"""Semaphorins"""	10730	protein-coding gene	gene with protein product				SEMAC		7748561	Standard	NM_020210		Approved	SemC, KIAA1745, MGC131831	uc002boz.3	Q9NPR2		ENST00000411539.2:c.1232C>T	15.37:g.90768237C>T	ENSP00000394720:p.Ser411Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UXE3|Q8WVP9|Q96FK5|Q9C0B8|Q9H691|Q9NPM8|Q9NPN0	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.S411L	ENST00000411539.2	37	c.1232	CCDS45347.1	15	.	.	.	.	.	.	.	.	.	.	C	26.3	4.720481	0.89205	.	.	ENSG00000185033	ENST00000332496;ENST00000379122;ENST00000411539	T;T;T	0.34072	1.38;1.38;1.38	5.15	5.15	0.70609	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.127980	0.53938	D	0.000043	T	0.70657	0.3249	M	0.93420	3.415	0.58432	D	0.999999	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.85130	0.995;0.997;0.997	T	0.79848	-0.1630	10	0.87932	D	0	.	17.6042	0.88033	0.0:1.0:0.0:0.0	.	406;411;406	Q9NPR2-2;Q2NL81;Q9NPR2	.;.;SEM4B_HUMAN	L	411;406;411	ENSP00000332204:S411L;ENSP00000368417:S406L;ENSP00000394720:S411L	ENSP00000332204:S411L	S	+	2	0	SEMA4B	88569241	0.991000	0.36638	0.879000	0.34478	0.963000	0.63663	3.763000	0.55257	2.412000	0.81896	0.561000	0.74099	TCA	SEMA4B	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.632	SEMA4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA4B	HGNC	protein_coding	OTTHUMT00000416810.1	C	NM_198925		90768237	+1	no_errors	ENST00000332496	ensembl	human	known	70_37	missense	SNP	0.997	T
SFMBT1	51460	genome.wustl.edu	37	3	52941132	52941132	+	Missense_Mutation	SNP	G	G	A	rs549341438		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:52941132G>A	ENST00000394752.3	-	19	2666	c.2284C>T	c.(2284-2286)Cgc>Tgc	p.R762C	SFMBT1_ENST00000296295.6_Missense_Mutation_p.R762C|SFMBT1_ENST00000394750.1_Missense_Mutation_p.R762C|SFMBT1_ENST00000358080.2_Missense_Mutation_p.R762C	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	762					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		GAAAAGGTGCGAAGCTCCCTT	0.383													G|||	1	0.000199681	0.0	0.0	5008	,	,		17975	0.0		0.0	False		,,,				2504	0.001																0													153.0	153.0	153.0					3																	52941132		2203	4300	6503	SO:0001583	missense	51460			AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.2284C>T	3.37:g.52941132G>A	ENSP00000378235:p.Arg762Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q402F7|Q96C73|Q9Y4Q9	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.R762C	ENST00000394752.3	37	c.2284	CCDS2867.1	3	.	.	.	.	.	.	.	.	.	.	G	16.92	3.256622	0.59321	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750	T;T;T;T	0.15718	2.4;2.4;2.51;2.4	6.04	5.16	0.70880	.	0.171869	0.51477	D	0.000089	T	0.19327	0.0464	L	0.56769	1.78	0.58432	D	0.999999	B;B	0.13145	0.007;0.004	B;B	0.08055	0.003;0.001	T	0.02208	-1.1195	10	0.72032	D	0.01	.	11.4062	0.49900	0.0:0.1276:0.7231:0.1492	.	762;762	Q9UHJ3-2;Q9UHJ3	.;SMBT1_HUMAN	C	762	ENSP00000378235:R762C;ENSP00000350789:R762C;ENSP00000296295:R762C;ENSP00000378233:R762C	ENSP00000296295:R762C	R	-	1	0	SFMBT1	52916172	0.999000	0.42202	0.014000	0.15608	0.976000	0.68499	2.656000	0.46716	1.546000	0.49388	0.563000	0.77884	CGC	SFMBT1	-	NULL		0.383	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT1	HGNC	protein_coding	OTTHUMT00000353040.3	G	NM_016329		52941132	-1	no_errors	ENST00000358080	ensembl	human	known	70_37	missense	SNP	0.976	A
SFMBT1	51460	genome.wustl.edu	37	3	52941608	52941608	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:52941608G>A	ENST00000394752.3	-	18	2430	c.2048C>T	c.(2047-2049)tCt>tTt	p.S683F	SFMBT1_ENST00000296295.6_Missense_Mutation_p.S683F|SFMBT1_ENST00000394750.1_Missense_Mutation_p.S683F|SFMBT1_ENST00000358080.2_Missense_Mutation_p.S683F	NM_016329.3	NP_057413.2	Q9UHJ3	SMBT1_HUMAN	Scm-like with four mbt domains 1	683					cell differentiation (GO:0030154)|chromatin modification (GO:0016568)|negative regulation of muscle organ development (GO:0048635)|negative regulation of transcription, DNA-templated (GO:0045892)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	histone binding (GO:0042393)|transcription corepressor activity (GO:0003714)			breast(2)|endometrium(3)|kidney(3)|large_intestine(8)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(1)	24				BRCA - Breast invasive adenocarcinoma(193;9.91e-05)|Kidney(197;0.000644)|KIRC - Kidney renal clear cell carcinoma(197;0.000792)|OV - Ovarian serous cystadenocarcinoma(275;0.113)		AACAGATGCAGAGGAGCGTTT	0.463																																																	0													130.0	133.0	132.0					3																	52941608		2203	4300	6503	SO:0001583	missense	51460			AF168132	CCDS2867.1	3p21.31	2013-01-10			ENSG00000163935	ENSG00000163935		"""Sterile alpha motif (SAM) domain containing"""	20255	protein-coding gene	gene with protein product		607319				10661410	Standard	NM_016329		Approved	RU1, DKFZp434L243, SFMBT	uc003dgh.3	Q9UHJ3	OTTHUMG00000159052	ENST00000394752.3:c.2048C>T	3.37:g.52941608G>A	ENSP00000378235:p.Ser683Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q402F7|Q96C73|Q9Y4Q9	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_Mbt,smart_SAM,pfscan_Mbt	p.S683F	ENST00000394752.3	37	c.2048	CCDS2867.1	3	.	.	.	.	.	.	.	.	.	.	G	32	5.159141	0.94686	.	.	ENSG00000163935	ENST00000394752;ENST00000358080;ENST00000296295;ENST00000394750	T;T;T;T	0.18502	2.21;2.21;2.26;2.21	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.47210	0.1433	M	0.77820	2.39	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.969	T	0.35151	-0.9800	10	0.66056	D	0.02	.	20.5827	0.99408	0.0:0.0:1.0:0.0	.	683;683	Q9UHJ3-2;Q9UHJ3	.;SMBT1_HUMAN	F	683	ENSP00000378235:S683F;ENSP00000350789:S683F;ENSP00000296295:S683F;ENSP00000378233:S683F	ENSP00000296295:S683F	S	-	2	0	SFMBT1	52916648	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.347000	0.97059	2.941000	0.99782	0.655000	0.94253	TCT	SFMBT1	-	NULL		0.463	SFMBT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT1	HGNC	protein_coding	OTTHUMT00000353040.3	G	NM_016329		52941608	-1	no_errors	ENST00000358080	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC12A2	6558	genome.wustl.edu	37	5	127469859	127469859	+	Silent	SNP	A	A	G	rs2228112	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:127469859A>G	ENST00000262461.2	+	6	1380	c.1191A>G	c.(1189-1191)gaA>gaG	p.E397E	SLC12A2_ENST00000343225.4_Silent_p.E397E	NM_001046.2	NP_001037.1	P55011	S12A2_HUMAN	solute carrier family 12 (sodium/potassium/chloride transporter), member 2	397					ammonium transmembrane transport (GO:0072488)|ammonium transport (GO:0015696)|branching involved in mammary gland duct morphogenesis (GO:0060444)|chloride transmembrane transport (GO:1902476)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|gamma-aminobutyric acid signaling pathway (GO:0007214)|hyperosmotic response (GO:0006972)|ion transport (GO:0006811)|mammary duct terminal end bud growth (GO:0060763)|multicellular organism growth (GO:0035264)|positive regulation of cell volume (GO:0045795)|potassium ion transport (GO:0006813)|sodium ion transport (GO:0006814)|transepithelial ammonium transport (GO:0070634)|transepithelial chloride transport (GO:0030321)|transmembrane transport (GO:0055085)|transport (GO:0006810)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ammonium transmembrane transporter activity (GO:0008519)|sodium:potassium:chloride symporter activity (GO:0008511)			breast(3)|endometrium(5)|kidney(5)|large_intestine(12)|lung(16)|ovary(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	48		all_cancers(142;0.0972)|Prostate(80;0.151)	KIRC - Kidney renal clear cell carcinoma(527;0.0268)|Kidney(363;0.0488)	Epithelial(69;0.0433)|OV - Ovarian serous cystadenocarcinoma(64;0.0978)	Bumetanide(DB00887)|Potassium Chloride(DB00761)|Quinethazone(DB01325)	TTTTCTAGGAACATTCCATAC	0.328													A|||	1975	0.394369	0.7337	0.3977	5008	,	,		17350	0.3294		0.1918	False		,,,				2504	0.2086																0								A		2732,1674	653.5+/-399.6	854,1024,325	101.0	112.0	108.0		1191	2.5	1.0	5	dbSNP_98	108	1896,6700	334.1+/-320.8	196,1504,2598	no	coding-synonymous	SLC12A2	NM_001046.2		1050,2528,2923	GG,GA,AA		22.0568,37.9936,35.5945		397/1213	127469859	4628,8374	2203	4298	6501	SO:0001819	synonymous_variant	6558				CCDS4144.1, CCDS58965.1	5q23.3	2014-06-13	2013-07-18		ENSG00000064651	ENSG00000064651		"""Solute carriers"""	10911	protein-coding gene	gene with protein product	"""bumetanide-sensitive sodium-(potassium)-chloride cotransporter 1"", ""basolateral Na-K-Cl symporter"", ""protein phosphatase 1, regulatory subunit 141"""	600840				7629105	Standard	NM_001256461		Approved	NKCC1, BSC, BSC2, PPP1R141	uc003kus.3	P55011	OTTHUMG00000128983	ENST00000262461.2:c.1191A>G	5.37:g.127469859A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N713|Q8WWH7	Silent	SNP	pfam_AA-permease_dom,pfam_AA_permease_N,prints_Na/K/Cl_cotranspt1,prints_Na/K/Cl_cotranspt,tigrfam_Na/K/Cl_cotransptS	p.E397	ENST00000262461.2	37	c.1191	CCDS4144.1	5																																																																																			SLC12A2	-	pfam_AA-permease_dom,tigrfam_Na/K/Cl_cotransptS		0.328	SLC12A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC12A2	HGNC	protein_coding	OTTHUMT00000250972.1	A	NM_001046		127469859	+1	no_errors	ENST00000262461	ensembl	human	known	70_37	silent	SNP	0.995	G
SIL1	64374	genome.wustl.edu	37	5	138463538	138463538	+	5'UTR	SNP	G	G	C	rs11555154	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:138463538G>C	ENST00000394817.2	-	0	134				SIL1_ENST00000509534.1_Missense_Mutation_p.L7V|SIL1_ENST00000265195.5_5'UTR	NM_022464.4	NP_071909.1	Q9H173	SIL1_HUMAN	SIL1 nucleotide exchange factor						intracellular protein transport (GO:0006886)|protein folding (GO:0006457)	endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)	unfolded protein binding (GO:0051082)			endometrium(4)|kidney(1)|large_intestine(3)|lung(4)|urinary_tract(1)	13			KIRC - Kidney renal clear cell carcinoma(527;0.00185)|Kidney(363;0.00325)			GCCATAGTCAGGGACCTGCAG	0.552									Marinesco-Sjgren syndrome				G|||	153	0.0305511	0.0076	0.0677	5008	,	,		21019	0.005		0.0775	False		,,,				2504	0.0133																0								G	,	93,4313		1,91,2111	23.0	21.0	22.0		,	1.8	0.0	5	dbSNP_132	22	683,7917		26,631,3643	no	utr-5,utr-5	SIL1	NM_001037633.1,NM_022464.4	,	27,722,5754	CC,CG,GG		7.9419,2.1108,5.9665	,	,	138463538	776,12230	2203	4300	6503	SO:0001623	5_prime_UTR_variant	64374	Familial Cancer Database	Marinesco-Sjogren syndrome	AK075177	CCDS4209.1	5q31	2013-08-21	2013-08-21		ENSG00000120725	ENSG00000120725			24624	protein-coding gene	gene with protein product		608005	"""Marinesco-Sjogren syndrome"", ""SIL1 homolog, endoplasmic reticulum chaperone (S. cerevisiae)"""	MSS		11101517, 12356756, 16282977	Standard	XM_006714671		Approved	BAP, ULG5	uc003ldp.3	Q9H173	OTTHUMG00000129226	ENST00000394817.2:c.-6C>G	5.37:g.138463538G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQC2|Q8N2L3	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.L7V	ENST00000394817.2	37	c.19	CCDS4209.1	5	106	0.048534798534798536	6	0.012195121951219513	32	0.08839779005524862	4	0.006993006993006993	64	0.08443271767810026	G	8.793	0.931095	0.18131	0.021108	0.079419	ENSG00000120725	ENST00000509534;ENST00000507002;ENST00000505830	T;T;T	0.71934	-0.61;-0.14;-0.14	4.74	1.82	0.25136	.	.	.	.	.	T	0.06554	0.0168	.	.	.	0.80722	P	0.0	.	.	.	.	.	.	T	0.52003	-0.8633	5	0.87932	D	0	.	2.9965	0.06000	0.1017:0.2379:0.5045:0.1559	.	.	.	.	V	7;9;9	ENSP00000426858:L7V;ENSP00000421890:L9V;ENSP00000426460:L9V	ENSP00000426460:L9V	L	-	1	2	SIL1	138491437	0.006000	0.16342	0.011000	0.14972	0.001000	0.01503	-0.125000	0.10579	0.601000	0.29879	-0.140000	0.14226	CTG	SIL1	-	NULL		0.552	SIL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIL1	HGNC	protein_coding	OTTHUMT00000251319.1	G	NM_022464		138463538	-1	no_errors	ENST00000509534	ensembl	human	putative	70_37	missense	SNP	0.001	C
SH3TC2	79628	genome.wustl.edu	37	5	148386525	148386525	+	Silent	SNP	T	T	G	rs6871030	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:148386525T>G	ENST00000515425.1	-	16	3695	c.3594A>C	c.(3592-3594)ccA>ccC	p.P1198P	SH3TC2_ENST00000502274.1_Silent_p.P60P|SH3TC2_ENST00000512049.1_Silent_p.P1191P|SH3TC2_ENST00000538184.1_3'UTR	NM_024577.3	NP_078853.2	Q8TF17	S3TC2_HUMAN	SH3 domain and tetratricopeptide repeats 2	1198					cell death (GO:0008219)|peripheral nervous system myelin maintenance (GO:0032287)|regulation of ERBB signaling pathway (GO:1901184)|regulation of intracellular protein transport (GO:0033157)	cytoplasmic vesicle (GO:0031410)|plasma membrane (GO:0005886)|recycling endosome (GO:0055037)				breast(1)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(12)|ovary(3)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	39			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TCTGCAGCCATGGTGGACAGA	0.562													G|||	1920	0.383387	0.4902	0.3055	5008	,	,		19946	0.2222		0.4046	False		,,,				2504	0.4387																0								G		2477,1929		478,1521,204	122.0	121.0	122.0		3594	-2.6	0.6	5	dbSNP_116	122	3502,5098		681,2140,1479	no	coding-synonymous	SH3TC2	NM_024577.3		1159,3661,1683	GG,GT,TT		40.7209,43.7812,45.9711		1198/1289	148386525	5979,7027	2203	4300	6503	SO:0001819	synonymous_variant	79628			AK127248	CCDS4293.1	5q32	2014-09-17			ENSG00000169247	ENSG00000169247		"""Tetratricopeptide (TTC) repeat domain containing"""	29427	protein-coding gene	gene with protein product		608206				14574644	Standard	NM_024577		Approved	KIAA1985, CMT4C	uc003lpu.3	Q8TF17	OTTHUMG00000129930	ENST00000515425.1:c.3594A>C	5.37:g.148386525T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWE5|Q14CC0|Q14CF5|Q9H8I5	Silent	SNP	pfam_SH3_domain,pfam_TPR-1,superfamily_SH3_domain,smart_SH3_domain,smart_TPR_repeat,pfscan_SH3_domain	p.P1198	ENST00000515425.1	37	c.3594	CCDS4293.1	5																																																																																			SH3TC2	-	smart_TPR_repeat		0.562	SH3TC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH3TC2	HGNC	protein_coding	OTTHUMT00000252186.2	T	NM_024577		148386525	-1	no_errors	ENST00000515425	ensembl	human	known	70_37	silent	SNP	0.142	G
SLC22A1	6580	genome.wustl.edu	37	6	160560881	160560883	+	In_Frame_Del	DEL	ATG	ATG	-	rs202220802|rs72552763|rs35191146|rs142448543|rs34305973|rs35167514	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	ATG	ATG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:160560881_160560883delATG	ENST00000366963.4	+	7	1405_1407	c.1258_1260delATG	c.(1258-1260)atgdel	p.M420del	SLC22A1_ENST00000457470.2_In_Frame_Del_p.M420del|SLC22A1_ENST00000324965.4_In_Frame_Del_p.M420del	NM_003057.2|NM_153187.1	NP_003048.1|NP_694857.1	O15245	S22A1_HUMAN	solute carrier family 22 (organic cation transporter), member 1	420			Missing (no changes in the MPP uptake. No changes in the MPP uptake; when associated with V-408). {ECO:0000269|PubMed:12439218, ECO:0000269|PubMed:12719534, ECO:0000269|PubMed:14702039}.		dopamine transport (GO:0015872)|drug transmembrane transport (GO:0006855)|epinephrine transport (GO:0048241)|establishment or maintenance of transmembrane electrochemical gradient (GO:0010248)|norepinephrine transport (GO:0015874)|organic cation transport (GO:0015695)|protein homooligomerization (GO:0051260)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)	basolateral plasma membrane (GO:0016323)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	acetylcholine transmembrane transporter activity (GO:0005277)|dopamine transmembrane transporter activity (GO:0005329)|norepinephrine transmembrane transporter activity (GO:0005333)|organic cation transmembrane transporter activity (GO:0015101)|quaternary ammonium group transmembrane transporter activity (GO:0015651)|secondary active organic cation transmembrane transporter activity (GO:0008513)		SLC22A1/CUTA(2)	breast(1)|endometrium(3)|large_intestine(3)|lung(13)|upper_aerodigestive_tract(1)	21		Breast(66;0.000776)|Ovarian(120;0.00556)		OV - Ovarian serous cystadenocarcinoma(65;2.73e-17)|BRCA - Breast invasive adenocarcinoma(81;1.1e-06)	Acebutolol(DB01193)|Acepromazine(DB01614)|Aciclovir(DB00787)|Amantadine(DB00915)|Amiloride(DB00594)|Aminohippurate(DB00345)|Caspofungin(DB00520)|Chlorphenamine(DB01114)|Chlorpromazine(DB00477)|Choline(DB00122)|Cimetidine(DB00501)|Cladribine(DB00242)|Clonidine(DB00575)|Codeine(DB00318)|Cytarabine(DB00987)|Desipramine(DB01151)|Dinoprostone(DB00917)|Diphenhydramine(DB01075)|Disopyramide(DB00280)|Dopamine(DB00988)|Epinephrine(DB00668)|Estradiol(DB00783)|Estropipate(DB04574)|Ganciclovir(DB01004)|Gentian Violet(DB00406)|Guanidine(DB00536)|Histamine Phosphate(DB00667)|Imatinib(DB00619)|Imipramine(DB00458)|Indinavir(DB00224)|Lamivudine(DB00709)|Latanoprost(DB00654)|Metformin(DB00331)|Midazolam(DB00683)|Nelfinavir(DB00220)|Nicotine(DB00184)|Norepinephrine(DB00368)|Oxaliplatin(DB00526)|Pancuronium(DB01337)|Phenformin(DB00914)|Phenoxybenzamine(DB00925)|Pipotiazine(DB01621)|Pramipexole(DB00413)|Prazosin(DB00457)|Probenecid(DB01032)|Procainamide(DB01035)|Progesterone(DB00396)|Quinidine(DB00908)|Quinine(DB00468)|Ranitidine(DB00863)|Reserpine(DB00206)|Rocuronium(DB00728)|Saquinavir(DB01232)|Spermine(DB00127)|Testosterone(DB00624)|Thiamine(DB00152)|Thioproperazine(DB01622)|Thiothixene(DB01623)|Tubocurarine(DB01199)|Vecuronium(DB01339)|Verapamil(DB00661)	CTGCCTCGTCATGATTTTTATCT	0.517														592	0.118211	0.0454	0.2882	5008	,	,		14486	0.005		0.1839	False		,,,				2504	0.1452																0			GRCh37	CD072492	SLC22A1	D	rs35191146																																			SO:0001651	inframe_deletion	6580			U77086	CCDS5274.1, CCDS5275.1	6q25.3	2013-05-22			ENSG00000175003	ENSG00000175003		"""Solute carriers"""	10963	protein-coding gene	gene with protein product		602607				9605850	Standard	NM_003057		Approved	OCT1	uc003qtc.3	O15245	OTTHUMG00000015947	ENST00000366963.4:c.1258_1260delATG	6.37:g.160560881_160560883delATG	ENSP00000355930:p.Met420del	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFF3|A8K1H2|C9JSU6|O15395|Q9NQD4	In_Frame_Del	DEL	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.M420in_frame_del	ENST00000366963.4	37	c.1258_1260	CCDS5274.1	6																																																																																			SLC22A1	-	pfam_Sub_transporter,pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.517	SLC22A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC22A1	HGNC	protein_coding	OTTHUMT00000042938.2	ATG			160560883	+1	no_errors	ENST00000366963	ensembl	human	known	70_37	in_frame_del	DEL	0.394:0.028:0.014	-
SLC22A31	146429	genome.wustl.edu	37	16	89265101	89265101	+	Missense_Mutation	SNP	C	C	T	rs74640353|rs386794095	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:89265101C>T	ENST00000562855.2	-	6	886	c.887G>A	c.(886-888)gGc>gAc	p.G296D				A6NKX4	S22AV_HUMAN	solute carrier family 22, member 31	296					ion transport (GO:0006811)	integral component of membrane (GO:0016021)	transmembrane transporter activity (GO:0022857)										GTCCCCGGGGCCCACGCCACT	0.652													T|||	1716	0.342652	0.2829	0.2507	5008	,	,		17190	0.5109		0.3082	False		,,,				2504	0.3507																0																																										SO:0001583	missense	146429				CCDS73927.1	16q24.3	2014-02-12	2011-07-12		ENSG00000259803	ENSG00000259803		"""Solute carriers"""	27091	protein-coding gene	gene with protein product							Standard	NM_001242757		Approved		uc021tmr.1	A6NKX4	OTTHUMG00000175615	ENST00000562855.2:c.887G>A	16.37:g.89265101C>T	ENSP00000474621:p.Gly296Asp	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000562855.2	37	NULL		16																																																																																			SLC22A31	-	-		0.652	SLC22A31-006	NOVEL	basic|appris_principal	protein_coding	SLC22A31	HGNC	protein_coding	OTTHUMT00000469767.1	C	NM_001242757		89265101	-1	no_errors	ENST00000562855	ensembl	human	known	70_37	rna	SNP	0.001	T
SLC24A4	123041	genome.wustl.edu	37	14	92923626	92923626	+	Intron	SNP	A	A	G	rs78863223	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:92923626A>G	ENST00000532405.1	+	12	1481				SLC24A4_ENST00000556739.1_3'UTR|SLC24A4_ENST00000393265.2_Intron|SLC24A4_ENST00000351924.5_Intron|SLC24A4_ENST00000531433.1_Intron|SLC24A4_ENST00000298877.1_Intron			Q8NFF2	NCKX4_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 4						amelogenesis (GO:0097186)|cellular calcium ion homeostasis (GO:0006874)|ion transport (GO:0006811)|response to stimulus (GO:0050896)|sensory perception of smell (GO:0007608)|transmembrane transport (GO:0055085)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium, potassium:sodium antiporter activity (GO:0008273)|symporter activity (GO:0015293)			breast(3)|endometrium(2)|kidney(2)|large_intestine(6)|lung(20)|ovary(2)|skin(1)	36		all_cancers(154;0.0347)|all_epithelial(191;0.163)		Colorectal(1;0.00242)|COAD - Colon adenocarcinoma(157;0.047)|Epithelial(152;0.0781)|READ - Rectum adenocarcinoma(1;0.176)|all cancers(159;0.182)		tgtcattcctagaacacactg	0.572													A|||	895	0.178714	0.2194	0.1009	5008	,	,		14446	0.2034		0.1461	False		,,,				2504	0.1871				NSCLC(10;315 435 10383 28450 38798)												0																																										SO:0001627	intron_variant	123041			AF520704	CCDS9903.1, CCDS45155.1, CCDS45156.1, CCDS9903.2, CCDS45155.2	14q32.12	2013-05-22			ENSG00000140090	ENSG00000140090		"""Solute carriers"""	10978	protein-coding gene	gene with protein product		609840					Standard	NM_153646		Approved	NCKX4	uc001yak.3	Q8NFF2	OTTHUMG00000167589	ENST00000532405.1:c.1255+674A>G	14.37:g.92923626A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DHE7|B9ZVY2|Q8N8U6|Q8NCX1|Q8NFF0|Q8NFF1	RNA	SNP	-	NULL	ENST00000532405.1	37	NULL	CCDS9903.2	14																																																																																			SLC24A4	-	-		0.572	SLC24A4-001	KNOWN	basic|CCDS	protein_coding	SLC24A4	HGNC	protein_coding	OTTHUMT00000395240.1	A	NM_153646		92923626	+1	no_errors	ENST00000556739	ensembl	human	known	70_37	rna	SNP	0.000	G
SLC25A41	284427	genome.wustl.edu	37	19	6433695	6433695	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:6433695G>A	ENST00000321510.6	-	1	78	c.10C>T	c.(10-12)Cag>Tag	p.Q4*	SLC25A23_ENST00000601760.1_5'Flank	NM_173637.3	NP_775908.2			solute carrier family 25, member 41											large_intestine(1)|lung(3)|stomach(1)|upper_aerodigestive_tract(1)	6						TCCCCAGGCTGAGCGCCCATG	0.562																																																	0													31.0	31.0	31.0					19																	6433695		1944	4151	6095	SO:0001587	stop_gained	284427			AK097761	CCDS45937.1	19p13.3	2013-05-22			ENSG00000181240	ENSG00000181240		"""Solute carriers"""	28533	protein-coding gene	gene with protein product		610822				16949250	Standard	NM_173637		Approved	FLJ40442, MGC34725, APC4	uc010dus.3	Q8N5S1		ENST00000321510.6:c.10C>T	19.37:g.6433695G>A	ENSP00000322649:p.Gln4*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier	p.Q4*	ENST00000321510.6	37	c.10	CCDS45937.1	19	.	.	.	.	.	.	.	.	.	.	G	15.89	2.966634	0.53507	.	.	ENSG00000181240	ENST00000321510;ENST00000458275	.	.	.	3.09	-2.96	0.05547	.	0.974568	0.08352	U	0.959071	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	5.5996	0.17347	0.0:0.3153:0.2972:0.3876	.	.	.	.	X	4	.	ENSP00000322649:Q4X	Q	-	1	0	SLC25A41	6384695	0.000000	0.05858	0.000000	0.03702	0.064000	0.16182	0.043000	0.13971	-0.384000	0.07845	0.313000	0.20887	CAG	SLC25A41	-	NULL		0.562	SLC25A41-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A41	HGNC	protein_coding	OTTHUMT00000462222.1	G	NM_173637		6433695	-1	no_errors	ENST00000321510	ensembl	human	known	70_37	nonsense	SNP	0.000	A
SLC25A6	293	genome.wustl.edu	37	X	1508324	1508324	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:1508324G>A	ENST00000381401.5	-	2	1122	c.408C>T	c.(406-408)ttC>ttT	p.F136F	SLC25A6_ENST00000475167.1_5'UTR	NM_001636.3	NP_001627.2	P12236	ADT3_HUMAN	solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 6	136					active induction of host immune response by virus (GO:0046732)|ADP transport (GO:0015866)|apoptotic process (GO:0006915)|ATP transport (GO:0015867)|cellular protein metabolic process (GO:0044267)|energy reserve metabolic process (GO:0006112)|modulation by virus of host morphology or physiology (GO:0019048)|protein targeting to mitochondrion (GO:0006626)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)|viral life cycle (GO:0019058)|viral process (GO:0016032)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial inner membrane presequence translocase complex (GO:0005744)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP:ADP antiporter activity (GO:0005471)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(8)|upper_aerodigestive_tract(1)	11		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)			Clodronate(DB00720)	GGGTTCTGGCGAAATCCAGCG	0.652													g|||	1617	0.322883	0.4856	0.3256	5008	,	,		17263	0.1062		0.2724	False		,,,				2504	0.3763																0								G		1974,2432		461,1052,690	110.0	118.0	115.0		408	-1.4	0.4	X	dbSNP_134	115	2176,6416		278,1620,2398	no	coding-synonymous	SLC25A6	NM_001636.3		739,2672,3088	AA,AG,GG		25.3259,44.8025,31.928		136/299	1508324	4150,8848	2203	4296	6499	SO:0001819	synonymous_variant	293			AY007135	CCDS14114.1	Xp22.32 and Yp11.3	2013-05-22			ENSG00000169100	ENSG00000169100		"""Pseudoautosomal regions / PAR1"", ""Solute carriers"""	10992	protein-coding gene	gene with protein product		300151, 403000		ANT3			Standard	NM_001636		Approved	ANT3Y, MGC17525	uc004cpt.3	P12236	OTTHUMG00000021058	ENST00000381401.5:c.408C>T	X.37:g.1508324G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96C49	Silent	SNP	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier,prints_Aden_trnslctor,prints_Mit_uncoupling	p.F136	ENST00000381401.5	37	c.408	CCDS14114.1	X																																																																																			SLC25A6	-	pfam_Mitochondrial_sb/sol_carrier,superfamily_Mt_carrier_dom,pfscan_Mitochondrial_sb/sol_carrier,prints_Mit_carrier		0.652	SLC25A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC25A6	HGNC	protein_coding	OTTHUMT00000055596.1	G	NM_001636		1508324	-1	no_errors	ENST00000381401	ensembl	human	known	70_37	silent	SNP	0.997	A
SLC34A2	10568	genome.wustl.edu	37	4	25677909	25677909	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:25677909C>A	ENST00000382051.3	+	13	1661	c.1611C>A	c.(1609-1611)ttC>ttA	p.F537L	SLC34A2_ENST00000503434.1_Missense_Mutation_p.F536L|SLC34A2_ENST00000504570.1_Missense_Mutation_p.F536L	NM_001177998.1|NM_006424.2	NP_001171469.1|NP_006415	O95436	NPT2B_HUMAN	solute carrier family 34 (type II sodium/phosphate contransporter), member 2	537					aging (GO:0007568)|cellular phosphate ion homeostasis (GO:0030643)|in utero embryonic development (GO:0001701)|ion transport (GO:0006811)|phosphate ion transmembrane transport (GO:0035435)|phosphate ion transport (GO:0006817)|response to estradiol (GO:0032355)|response to estrogen (GO:0043627)|response to fructose (GO:0009750)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|microvillus membrane (GO:0031528)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	phosphate ion binding (GO:0042301)|sodium ion binding (GO:0031402)|sodium-dependent phosphate transmembrane transporter activity (GO:0015321)|sodium:phosphate symporter activity (GO:0005436)	p.F537F(1)	SLC34A2/ROS1(14)	breast(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(9)|lung(18)|ovary(1)|prostate(1)|skin(4)	41		Breast(46;0.0503)				TCATCTTCTTCTTCCTGATCC	0.602			T	ROS1	NSCLC																																			Dom	yes		4	4p15.2	10568	"""solute carrier family 34 (sodium phosphate), member 2"""		E	1	Substitution - coding silent(1)	lung(1)											179.0	164.0	169.0					4																	25677909		2203	4300	6503	SO:0001583	missense	10568			AF111856	CCDS3435.1, CCDS54750.1	4p15.2	2013-07-17	2013-07-17		ENSG00000157765	ENSG00000157765		"""Solute carriers"""	11020	protein-coding gene	gene with protein product		604217	"""solute carrier family 34 (sodium phosphate), member 2"""			10329428, 10610722	Standard	NM_006424		Approved	NAPI-3B	uc003grr.3	O95436	OTTHUMG00000097757	ENST00000382051.3:c.1611C>A	4.37:g.25677909C>A	ENSP00000371483:p.Phe537Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PL17|Q8N2K2|Q8WYA9|Q9P0V7	Missense_Mutation	SNP	pfam_Na/Pi_transpt,superfamily_ABC_transptrTM_dom_typ1,tigrfam_Na/Pi_transpt	p.F537L	ENST00000382051.3	37	c.1611	CCDS3435.1	4	.	.	.	.	.	.	.	.	.	.	C	24.9	4.584293	0.86748	.	.	ENSG00000157765	ENST00000504570;ENST00000382051;ENST00000503434	T;T;T	0.43688	0.94;1.0;0.94	5.18	4.32	0.51571	.	0.000000	0.85682	D	0.000000	T	0.68668	0.3026	M	0.89287	3.02	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.74061	-0.3786	10	0.54805	T	0.06	-41.3295	14.623	0.68599	0.0:0.9258:0.0:0.0742	.	536;537	O95436-2;O95436	.;NPT2B_HUMAN	L	536;537;536	ENSP00000425501:F536L;ENSP00000371483:F537L;ENSP00000423021:F536L	ENSP00000371483:F537L	F	+	3	2	SLC34A2	25287007	0.993000	0.37304	0.879000	0.34478	0.888000	0.51559	2.679000	0.46909	2.584000	0.87258	0.561000	0.74099	TTC	SLC34A2	-	tigrfam_Na/Pi_transpt		0.602	SLC34A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC34A2	HGNC	protein_coding	OTTHUMT00000214990.1	C	NM_006424		25677909	+1	no_errors	ENST00000382051	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC6A2	6530	genome.wustl.edu	37	16	55734174	55734174	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:55734174T>C	ENST00000379906.2	+	12	1969	c.1714T>C	c.(1714-1716)Tac>Cac	p.Y572H	SLC6A2_ENST00000219833.8_Missense_Mutation_p.Y572H|SLC6A2_ENST00000566163.1_Missense_Mutation_p.Y527H|SLC6A2_ENST00000567238.1_Missense_Mutation_p.Y467H|SLC6A2_ENST00000561820.1_Missense_Mutation_p.Y572H|SLC6A2_ENST00000568943.1_Missense_Mutation_p.Y572H|SLC6A2_ENST00000414754.3_Intron	NM_001043.3	NP_001034.1	P23975	SC6A2_HUMAN	solute carrier family 6 (neurotransmitter transporter), member 2	572					monoamine transport (GO:0015844)|norepinephrine transport (GO:0015874)|response to drug (GO:0042493)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)	monoamine transmembrane transporter activity (GO:0008504)|norepinephrine:sodium symporter activity (GO:0005334)			breast(1)|endometrium(3)|kidney(1)|large_intestine(8)|lung(20)|ovary(3)|pancreas(2)|prostate(2)|upper_aerodigestive_tract(1)	41				BRCA - Breast invasive adenocarcinoma(181;0.01)|Kidney(780;0.0267)	Amitriptyline(DB00321)|Amoxapine(DB00543)|Amphetamine(DB00182)|Atomoxetine(DB00289)|Bupropion(DB01156)|Chlorphenamine(DB01114)|Citalopram(DB00215)|Clomipramine(DB01242)|Cocaine(DB00907)|Debrisoquin(DB04840)|Desipramine(DB01151)|Desvenlafaxine(DB06700)|Dexmethylphenidate(DB06701)|Dextroamphetamine(DB01576)|Dextromethorphan(DB00514)|Diethylpropion(DB00937)|Dopamine(DB00988)|Doxepin(DB01142)|Droxidopa(DB06262)|Duloxetine(DB00476)|Ephedra(DB01363)|Ephedrine(DB01364)|Ergotamine(DB00696)|Escitalopram(DB01175)|Ginkgo biloba(DB01381)|Guanadrel(DB00226)|Guanethidine(DB01170)|Imipramine(DB00458)|Iobenguane(DB06704)|Ketamine(DB01221)|Levomilnacipran(DB08918)|Levonordefrin(DB06707)|Loxapine(DB00408)|Maprotiline(DB00934)|Mazindol(DB00579)|Methamphetamine(DB01577)|Methylphenidate(DB00422)|Mianserin(DB06148)|Milnacipran(DB04896)|Mirtazapine(DB00370)|Nefazodone(DB01149)|Norepinephrine(DB00368)|Nortriptyline(DB00540)|Orphenadrine(DB01173)|Paroxetine(DB00715)|Pethidine(DB00454)|Phendimetrazine(DB01579)|Phenmetrazine(DB00830)|Phentermine(DB00191)|Protriptyline(DB00344)|Pseudoephedrine(DB00852)|Reboxetine(DB00234)|Sibutramine(DB01105)|Tapentadol(DB06204)|Tramadol(DB00193)|Trimipramine(DB00726)|Venlafaxine(DB00285)	GGTGCCCATCTACGTCATCTA	0.622																																																	0													101.0	87.0	91.0					16																	55734174		2198	4300	6498	SO:0001583	missense	6530				CCDS10754.1, CCDS54011.1, CCDS58463.1	16q12.2	2013-07-19	2013-07-19		ENSG00000103546	ENSG00000103546		"""Solute carriers"""	11048	protein-coding gene	gene with protein product	"""norepinephrine transporter"""	163970	"""solute carrier family 6 (neurotransmitter transporter, noradrenalin), member 2"""	NET1, NAT1, SLC6A5		2008212	Standard	NM_001043		Approved	NET	uc021tio.1	P23975	OTTHUMG00000133208	ENST00000379906.2:c.1714T>C	16.37:g.55734174T>C	ENSP00000369237:p.Tyr572His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R707|B4DX48|Q96KH8	Missense_Mutation	SNP	pfam_Na/ntran_symport,pfscan_Na/ntran_symport,prints_Na/ntran_symport,prints_Na/ntran_symport_noradrenaline	p.Y572H	ENST00000379906.2	37	c.1714	CCDS10754.1	16	.	.	.	.	.	.	.	.	.	.	T	14.46	2.543431	0.45280	.	.	ENSG00000103546	ENST00000414754;ENST00000537705;ENST00000379906;ENST00000219833	T;T	0.75821	-0.97;-0.97	5.38	5.38	0.77491	.	0.000000	0.85682	D	0.000000	D	0.87593	0.6216	M	0.88450	2.955	0.51233	D	0.999919	D;D;D	0.63880	0.984;0.993;0.993	P;D;D	0.70016	0.882;0.95;0.967	D	0.89755	0.3943	10	0.66056	D	0.02	.	14.3744	0.66862	0.0:0.0:0.0:1.0	.	286;467;572	F5H0T4;B4DX48;P23975	.;.;SC6A2_HUMAN	H	572;286;572;572	ENSP00000369237:Y572H;ENSP00000219833:Y572H	ENSP00000219833:Y572H	Y	+	1	0	SLC6A2	54291675	1.000000	0.71417	0.587000	0.28692	0.138000	0.21146	7.607000	0.82883	2.022000	0.59522	0.533000	0.62120	TAC	SLC6A2	-	pfam_Na/ntran_symport,pfscan_Na/ntran_symport		0.622	SLC6A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC6A2	HGNC	protein_coding	OTTHUMT00000256922.2	T			55734174	+1	no_errors	ENST00000219833	ensembl	human	known	70_37	missense	SNP	0.823	C
SLCO1B7	338821	genome.wustl.edu	37	12	21229400	21229400	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:21229400C>T	ENST00000421593.2	+	12	1621	c.1621C>T	c.(1621-1623)Cca>Tca	p.P541S	LST3_ENST00000540229.1_Missense_Mutation_p.P649S|SLCO1B3_ENST00000553473.1_Missense_Mutation_p.P649S|RP11-125O5.2_ENST00000590779.1_Silent_p.F41F|SLCO1B7_ENST00000554957.1_Missense_Mutation_p.P588S|LST3_ENST00000381541.3_Missense_Mutation_p.P588S	NM_001009562.4	NP_001009562.3	G3V0H7	SO1B7_HUMAN	solute carrier organic anion transporter family, member 1B7 (non-functional)	541						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(25)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	46						TATTCTAGTTCCAATATATTT	0.368																																																	0													168.0	175.0	173.0					12																	21229400		2203	4300	6503	SO:0001583	missense	28234			AF401642	CCDS44843.1	12p12.3	2013-05-22			ENSG00000205754	ENSG00000205754		"""Solute carriers"""	32934	protein-coding gene	gene with protein product							Standard	NM_001009562		Approved	LST3, SLC21A21		G3V0H7	OTTHUMG00000169045	ENST00000421593.2:c.1621C>T	12.37:g.21229400C>T	ENSP00000394168:p.Pro541Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q71QF0	Missense_Mutation	SNP	pfam_OA_transporter,pfam_MFS,pfam_Kazal-type_dom,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_OA_transporter	p.P649S	ENST00000421593.2	37	c.1945	CCDS44843.1	12	.	.	.	.	.	.	.	.	.	.	.	13.34	2.207923	0.39003	.	.	ENSG00000111700;ENSG00000257046;ENSG00000257046;ENSG00000205754;ENSG00000205754;ENSG00000205754	ENST00000553473;ENST00000381541;ENST00000540229;ENST00000554957;ENST00000421593;ENST00000545916	D;T;D;T;T;T	0.82984	-1.67;0.31;-1.67;0.31;0.31;0.31	2.4	2.4	0.29515	.	0.000000	0.85682	D	0.000000	D	0.91071	0.7190	M	0.89658	3.05	0.44539	D	0.997495	D;D;D	0.89917	0.999;0.997;1.0	D;D;D	0.91635	0.994;0.99;0.999	D	0.91468	0.5194	10	0.87932	D	0	.	9.9439	0.41598	0.0:1.0:0.0:0.0	.	541;588;649	G3V0H7;F5H094;Q5JAR4	.;.;.	S	649;588;649;588;541;50	ENSP00000451758:P649S;ENSP00000370952:P588S;ENSP00000441269:P649S;ENSP00000452013:P588S;ENSP00000394168:P541S;ENSP00000439857:P50S	ENSP00000370952:P588S	P	+	1	0	SLCO1B3;SLCO1B7;RP11-545J16.1	21120667	0.996000	0.38824	1.000000	0.80357	0.332000	0.28634	5.274000	0.65569	1.322000	0.45245	0.205000	0.17691	CCA	SLCO1B3	-	pfam_OA_transporter,superfamily_MFS_dom_general_subst_transpt		0.368	SLCO1B7-001	KNOWN	basic|CCDS	protein_coding	SLCO1B3	HGNC	protein_coding	OTTHUMT00000402066.1	C	NM_001009562		21229400	+1	no_errors	ENST00000553473	ensembl	human	known	70_37	missense	SNP	1.000	T
SMARCA4	6597	genome.wustl.edu	37	19	11172893	11172893	+	3'UTR	SNP	G	G	A	rs559071626	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:11172893G>A	ENST00000429416.3	+	0	5626				SMARCA4_ENST00000450717.3_3'UTR|SMARCA4_ENST00000358026.2_3'UTR|SMARCA4_ENST00000413806.3_3'UTR	NM_001128844.1	NP_001122316.1	P51532	SMCA4_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4						aortic smooth muscle cell differentiation (GO:0035887)|ATP catabolic process (GO:0006200)|ATP-dependent chromatin remodeling (GO:0043044)|blastocyst growth (GO:0001832)|blastocyst hatching (GO:0001835)|cell morphogenesis (GO:0000902)|chromatin remodeling (GO:0006338)|definitive erythrocyte differentiation (GO:0060318)|DNA methylation on cytosine within a CG sequence (GO:0010424)|embryonic hindlimb morphogenesis (GO:0035116)|embryonic organ morphogenesis (GO:0048562)|epidermis morphogenesis (GO:0048730)|extracellular matrix organization (GO:0030198)|forebrain development (GO:0030900)|glial cell fate determination (GO:0007403)|heart trabecula formation (GO:0060347)|hindbrain development (GO:0030902)|histone H3 acetylation (GO:0043966)|keratinocyte differentiation (GO:0030216)|lens fiber cell development (GO:0070307)|liver development (GO:0001889)|methylation-dependent chromatin silencing (GO:0006346)|negative regulation of androgen receptor signaling pathway (GO:0060766)|negative regulation of cell growth (GO:0030308)|negative regulation of G1/S transition of mitotic cell cycle (GO:2000134)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription from RNA polymerase II promoter during mitosis (GO:0007070)|negative regulation of transcription, DNA-templated (GO:0045892)|neural retina development (GO:0003407)|nucleosome disassembly (GO:0006337)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of DNA binding (GO:0043388)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|stem cell maintenance (GO:0019827)|vasculogenesis (GO:0001570)	extracellular space (GO:0005615)|heterochromatin (GO:0000792)|membrane (GO:0016020)|nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nuclear euchromatin (GO:0005719)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA-dependent ATPase activity (GO:0008094)|helicase activity (GO:0004386)|lysine-acetylated histone binding (GO:0070577)|p53 binding (GO:0002039)|protein N-terminus binding (GO:0047485)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription coactivator activity (GO:0001105)|Tat protein binding (GO:0030957)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.?(1)		adrenal_gland(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(23)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|liver(4)|lung(60)|ovary(10)|pancreas(7)|prostate(3)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	163		all_lung(6;0.0512)|Lung NSC(9;0.0568)				GGGGCCCGGCGAGGGTATGTC	0.522			"""F, N, Mis"""		NSCLC								G|||	8	0.00159744	0.0015	0.0043	5008	,	,		17092	0.0		0.003	False		,,,				2504	0.0							Rec	yes		19	19p13.2	6597	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily a, member 4"""		E	1	Unknown(1)	lung(1)																																								SO:0001624	3_prime_UTR_variant	6597			D26156	CCDS12253.1, CCDS45972.1, CCDS45973.1, CCDS54217.1, CCDS54218.1	19p13.3	2014-09-17	2006-11-09		ENSG00000127616	ENSG00000127616			11100	protein-coding gene	gene with protein product	"""SNF2-like 4"", ""global transcription activator homologous sequence"", ""sucrose nonfermenting-like 4"", ""mitotic growth and transcription activator"", ""BRM/SWI2-related gene 1"", ""homeotic gene regulator"", ""nuclear protein GRB1"", ""brahma protein-like 1"", ""ATP-dependent helicase SMARCA4"""	603254		SNF2L4		8208605	Standard	NM_003072		Approved	hSNF2b, BRG1, BAF190, SNF2, SWI2, SNF2-BETA, SNF2LB, FLJ39786	uc010dxo.3	P51532	OTTHUMG00000169272	ENST00000429416.3:c.*401G>A	19.37:g.11172893G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1A8Z4|B1A8Z5|B1A8Z6|B1A8Z7|E9PBR8|O95052|Q9HBD3	RNA	SNP	-	NULL	ENST00000429416.3	37	NULL	CCDS12253.1	19																																																																																			SMARCA4	-	-		0.522	SMARCA4-007	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	SMARCA4	HGNC	protein_coding	OTTHUMT00000452638.2	G	NM_003072		11172893	+1	no_errors	ENST00000586921	ensembl	human	known	70_37	rna	SNP	0.018	A
SMG1	23049	genome.wustl.edu	37	16	18881990	18881990	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:18881990G>A	ENST00000446231.2	-	18	2846	c.2434C>T	c.(2434-2436)Cgt>Tgt	p.R812C	snoU13_ENST00000459248.1_RNA|SMG1_ENST00000389467.3_Missense_Mutation_p.R812C			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	812	Interaction with SMG8 and SMG9.		R -> C. {ECO:0000269|PubMed:17344846}.		DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TGTCGAATACGAGTTCCACTG	0.373																																																	0													41.0	34.0	36.0					16																	18881990		1873	4115	5988	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.2434C>T	16.37:g.18881990G>A	ENSP00000402515:p.Arg812Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.R812C	ENST00000446231.2	37	c.2434	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	20.6	4.025493	0.75390	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.12774	2.65;2.65	5.57	4.62	0.57501	Armadillo-type fold (1);	0.000000	0.56097	D	0.000034	T	0.11922	0.0290	L	0.40543	1.245	0.46222	D	0.998931	D	0.56287	0.975	B	0.37422	0.249	T	0.03315	-1.1049	10	0.59425	D	0.04	.	14.4855	0.67614	0.0704:0.0:0.9296:0.0	.	812	Q96Q15	SMG1_HUMAN	C	812	ENSP00000402515:R812C;ENSP00000374118:R812C	ENSP00000374118:R812C	R	-	1	0	SMG1	18789491	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.363000	0.66104	1.375000	0.46248	0.555000	0.69702	CGT	SMG1	-	superfamily_ARM-type_fold		0.373	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	G	NM_015092		18881990	-1	no_errors	ENST00000389467	ensembl	human	known	70_37	missense	SNP	1.000	A
SMG1	23049	genome.wustl.edu	37	16	18902217	18902217	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:18902217G>C	ENST00000446231.2	-	5	988	c.576C>G	c.(574-576)atC>atG	p.I192M	SMG1_ENST00000565224.1_Missense_Mutation_p.I166M|SMG1_ENST00000389467.3_Missense_Mutation_p.I192M			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	192	Interaction with SMG8 and SMG9.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CAGCAGCCAAGATATTATCCA	0.249																																																	0													64.0	59.0	61.0					16																	18902217		1795	4046	5841	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.576C>G	16.37:g.18902217G>C	ENSP00000402515:p.Ile192Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.I192M	ENST00000446231.2	37	c.576	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	G	15.44	2.835372	0.50951	.	.	ENSG00000157106	ENST00000446231;ENST00000389467;ENST00000532700	T;T;T	0.73789	-0.78;-0.78;-0.78	4.65	4.65	0.58169	Armadillo-like helical (1);Armadillo-type fold (1);	0.077291	0.49305	U	0.000148	T	0.75729	0.3889	L	0.29908	0.895	0.34729	D	0.729527	D	0.65815	0.995	P	0.55055	0.767	D	0.83929	0.0305	10	0.72032	D	0.01	.	17.9167	0.88953	0.0:0.0:1.0:0.0	.	192	Q96Q15	SMG1_HUMAN	M	192;192;166	ENSP00000402515:I192M;ENSP00000374118:I192M;ENSP00000432825:I166M	ENSP00000374118:I192M	I	-	3	3	SMG1	18809718	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	4.840000	0.62817	2.294000	0.77228	0.555000	0.69702	ATC	SMG1	-	superfamily_ARM-type_fold		0.249	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	G	NM_015092		18902217	-1	no_errors	ENST00000389467	ensembl	human	known	70_37	missense	SNP	1.000	C
SMPD1	6609	genome.wustl.edu	37	11	6411941	6411941	+	Missense_Mutation	SNP	C	C	T	rs550365194|rs550067660|rs71467507|rs78250081|rs558809956|rs3838786	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:6411941C>T	ENST00000342245.4	+	1	281	c.113C>T	c.(112-114)gCg>gTg	p.A38V	SMPD1_ENST00000527275.1_Missense_Mutation_p.A38V|SMPD1_ENST00000533196.1_3'UTR|SMPD1_ENST00000356761.2_Missense_Mutation_p.A38V|SMPD1_ENST00000299397.3_Missense_Mutation_p.A38V	NM_000543.4|NM_001007593.2	NP_000534.3|NP_001007594.2	P17405	ASM_HUMAN	sphingomyelin phosphodiesterase 1, acid lysosomal	38					cell death (GO:0008219)|ceramide biosynthetic process (GO:0046513)|glycosphingolipid metabolic process (GO:0006687)|negative regulation of MAP kinase activity (GO:0043407)|nervous system development (GO:0007399)|positive regulation of apoptotic process (GO:0043065)|positive regulation of protein dephosphorylation (GO:0035307)|response to cocaine (GO:0042220)|response to drug (GO:0042493)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)|sphingomyelin catabolic process (GO:0006685)|sphingomyelin metabolic process (GO:0006684)|termination of signal transduction (GO:0023021)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|lamellar body (GO:0042599)|lysosomal lumen (GO:0043202)	hydrolase activity, acting on glycosyl bonds (GO:0016798)|sphingomyelin phosphodiesterase activity (GO:0004767)			breast(1)|central_nervous_system(2)|kidney(1)|large_intestine(8)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|urinary_tract(3)	23		Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.029)		Epithelial(150;4.9e-08)|BRCA - Breast invasive adenocarcinoma(625;0.189)	Amlodipine(DB00381)|Chlorpromazine(DB00477)|Desipramine(DB01151)	ctggtgctggcgctggcgctg	0.711																																																	0													11.0	14.0	13.0					11																	6411941		2185	4258	6443	SO:0001583	missense	6609			AB209775	CCDS31409.1, CCDS44531.1, CCDS31409.2	11p15.4-p15.1	2010-04-28	2008-02-04		ENSG00000166311	ENSG00000166311	3.1.4.12		11120	protein-coding gene	gene with protein product	"""acid sphingomyelinase"""	607608				1711683	Standard	NM_000543		Approved	ASM	uc001mcw.3	P17405	OTTHUMG00000165453	ENST00000342245.4:c.113C>T	11.37:g.6411941C>T	ENSP00000340409:p.Ala38Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8M3|E9PKS3|P17406|Q13811|Q16837|Q16841	Missense_Mutation	SNP	pfam_Metallo_PEstase_dom,superfamily_Saposin-like,smart_SaposinB,pirsf_Sphingomy_PDE,pfscan_SaposinB	p.A38V	ENST00000342245.4	37	c.113	CCDS44531.1	11	.	.	.	.	.	.	.	.	.	.	C	13.43	2.234305	0.39498	.	.	ENSG00000166311	ENST00000299397;ENST00000356761;ENST00000342245;ENST00000527275	T;T;T;T	0.09723	2.95;2.95;2.95;2.95	4.54	-1.08	0.09936	.	.	.	.	.	T	0.04363	0.0120	N	0.08118	0	0.09310	N	1	B;B	0.15473	0.002;0.013	B;B	0.10450	0.002;0.005	T	0.47275	-0.9130	9	0.12103	T	0.63	.	6.8659	0.24093	0.0:0.5614:0.262:0.1766	.	38;38	E9PKS3;G3XAB5	.;.	V	38	ENSP00000299397:A38V;ENSP00000349203:A38V;ENSP00000340409:A38V;ENSP00000435350:A38V	ENSP00000299397:A38V	A	+	2	0	SMPD1	6368517	0.000000	0.05858	0.130000	0.21974	0.033000	0.12548	-2.110000	0.01334	-0.479000	0.06813	-1.305000	0.01319	GCG	SMPD1	-	pirsf_Sphingomy_PDE		0.711	SMPD1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SMPD1	HGNC	protein_coding	OTTHUMT00000384205.1	C	NM_000543		6411941	+1	no_errors	ENST00000342245	ensembl	human	known	70_37	missense	SNP	0.351	T
SNF8	11267	genome.wustl.edu	37	17	47007747	47007747	+	3'UTR	SNP	T	T	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:47007747T>C	ENST00000502492.1	-	0	1249				SNF8_ENST00000290330.3_3'UTR|AC091133.1_ENST00000435491.1_RNA|SNF8_ENST00000514089.1_5'UTR			Q96H20	SNF8_HUMAN	SNF8, ESCRT-II complex subunit						endosomal transport (GO:0016197)|membrane organization (GO:0061024)|protein transport (GO:0015031)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	protein homodimerization activity (GO:0042803)|transcription factor binding (GO:0008134)			breast(1)|endometrium(1)|lung(1)	3						TGGAACTTTTTTTCTATTTTT	0.433																																																	0																																										SO:0001624	3_prime_UTR_variant	11267			AF156102	CCDS11541.1	17q21.32	2013-06-05	2013-06-05		ENSG00000159210	ENSG00000159210			17028	protein-coding gene	gene with protein product		610904	"""SNF8, ESCRT-II complex subunit, homolog (S. cerevisiae)"""			10419521, 15329733	Standard	NM_007241		Approved	EAP30, VPS22, Dot3	uc002ioj.3	Q96H20	OTTHUMG00000160569	ENST00000502492.1:c.*90A>G	17.37:g.47007747T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IXY3|Q9UN50	RNA	SNP	-	NULL	ENST00000502492.1	37	NULL	CCDS11541.1	17																																																																																			SNF8	-	-		0.433	SNF8-001	KNOWN	basic|CCDS	protein_coding	SNF8	HGNC	protein_coding	OTTHUMT00000361172.1	T	NM_007241		47007747	-1	no_errors	ENST00000514089	ensembl	human	known	70_37	rna	SNP	0.000	C
TRNAU1AP	54952	genome.wustl.edu	37	1	28907222	28907222	+	IGR	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:28907222G>A	ENST00000373830.3	+	0	1793				SNHG12_ENST00000384581.1_RNA|SNHG12_ENST00000488745.1_RNA|SNHG12_ENST00000531126.1_RNA|SNHG12_ENST00000384342.1_RNA|SNHG12_ENST00000384584.1_RNA|SNHG12_ENST00000483436.1_RNA|SNORD99_ENST00000408612.1_RNA|SNHG12_ENST00000475441.1_RNA	NM_017846.4	NP_060316.1	Q9NX07	TSAP1_HUMAN	tRNA selenocysteine 1 associated protein 1						selenocysteine incorporation (GO:0001514)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(2)|ovary(1)|pancreas(1)|skin(1)	8						TTGGTCCTCAGAATGATACAA	0.408																																																	0																																										SO:0001628	intergenic_variant	85028				CCDS324.1	1p35.3	2013-02-12	2008-09-05	2008-09-05	ENSG00000180098	ENSG00000180098		"""RNA binding motif (RRM) containing"""	30813	protein-coding gene	gene with protein product			"""tRNA selenocysteine associated protein 1"""	TRSPAP1		10606267, 16230358	Standard	NM_017846		Approved	SECP43, FLJ20503	uc001bqi.3	Q9NX07	OTTHUMG00000003653		1.37:g.28907222G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SU7	RNA	SNP	-	NULL	ENST00000373830.3	37	NULL	CCDS324.1	1																																																																																			SNHG12	-	-		0.408	TRNAU1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNHG12	HGNC	protein_coding	OTTHUMT00000010346.1	G	NM_017846		28907222	-1	no_errors	ENST00000464612	ensembl	human	known	70_37	rna	SNP	0.156	A
SNRNP70	6625	genome.wustl.edu	37	19	49610936	49610936	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:49610936C>G	ENST00000598441.1	+	9	856	c.632C>G	c.(631-633)tCa>tGa	p.S211*	SNRNP70_ENST00000221448.5_Nonsense_Mutation_p.S211*			P08621	RU17_HUMAN	small nuclear ribonucleoprotein 70kDa (U1)	211					gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)|U1 snRNP (GO:0005685)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(3)|skin(2)	12						ATCCGGCATTCAGGCCGCGAT	0.657																																																	0													62.0	61.0	61.0					19																	49610936		2203	4300	6503	SO:0001587	stop_gained	6625				CCDS12756.1, CCDS74417.1	19q13.3	2013-02-12	2008-10-29	2008-10-29		ENSG00000104852		"""RNA binding motif (RRM) containing"""	11150	protein-coding gene	gene with protein product		180740	"""small nuclear ribonucleoprotein 70kDa (RNP antigen)"""	RNPU1Z, RPU1, SNRP70			Standard	XM_005259177		Approved	U1-70K, Snp1	uc021uxh.1	P08621		ENST00000598441.1:c.632C>G	19.37:g.49610936C>G	ENSP00000472998:p.Ser211*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUA3|P78493|P78494|Q15364|Q15686|Q15687|Q15689|Q99377|Q9UE45|Q9UE46|Q9UE47|Q9UE48|Q9UFQ6	Nonsense_Mutation	SNP	pfam_U1snRNP70_N,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.S211*	ENST00000598441.1	37	c.632	CCDS12756.1	19	.	.	.	.	.	.	.	.	.	.	C	51	18.510427	0.99906	.	.	ENSG00000104852	ENST00000221448;ENST00000544278	.	.	.	4.52	4.52	0.55395	.	0.064368	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-4.5377	16.3877	0.83522	0.0:1.0:0.0:0.0	.	.	.	.	X	211;115	.	ENSP00000221448:S211X	S	+	2	0	SNRNP70	54302748	0.998000	0.40836	0.980000	0.43619	0.989000	0.77384	4.035000	0.57297	2.238000	0.73509	0.462000	0.41574	TCA	SNRNP70	-	NULL		0.657	SNRNP70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNRNP70	HGNC	protein_coding	OTTHUMT00000466266.1	C	NM_003089		49610936	+1	no_errors	ENST00000598441	ensembl	human	known	70_37	nonsense	SNP	1.000	G
SOX6	55553	genome.wustl.edu	37	11	16036581	16036581	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:16036581C>G	ENST00000352083.6	-	13	1716	c.1639G>C	c.(1639-1641)Gag>Cag	p.E547Q	SOX6_ENST00000527619.1_Missense_Mutation_p.E523Q|SOX6_ENST00000528429.1_Missense_Mutation_p.E547Q|SOX6_ENST00000528252.1_Missense_Mutation_p.E520Q|SOX6_ENST00000396356.3_Missense_Mutation_p.E547Q|SOX6_ENST00000316399.6_Missense_Mutation_p.E547Q			P35712	SOX6_HUMAN	SRY (sex determining region Y)-box 6	547					astrocyte differentiation (GO:0048708)|cardiac muscle cell differentiation (GO:0055007)|cartilage development (GO:0051216)|cell morphogenesis (GO:0000902)|cellular response to transforming growth factor beta stimulus (GO:0071560)|erythrocyte development (GO:0048821)|gene silencing (GO:0016458)|in utero embryonic development (GO:0001701)|muscle organ development (GO:0007517)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|oligodendrocyte cell fate specification (GO:0021778)|positive regulation of cartilage development (GO:0061036)|positive regulation of chondrocyte differentiation (GO:0032332)|positive regulation of mesenchymal stem cell differentiation (GO:2000741)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			NS(1)|breast(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|pancreas(1)|prostate(2)	43						CCCAAATTCTCAAAGCGCGTT	0.463																																																	0													73.0	71.0	72.0					11																	16036581		2200	4293	6493	SO:0001583	missense	55553			AF309034	CCDS7821.1, CCDS53604.1, CCDS53605.1	11p15.3	2008-02-05						"""SRY (sex determining region Y)-boxes"""	16421	protein-coding gene	gene with protein product		607257				11255018	Standard	NM_033326		Approved		uc001mme.3	P35712		ENST00000352083.6:c.1639G>C	11.37:g.16036581C>G	ENSP00000339876:p.Glu547Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VX7|Q9BXQ3|Q9BXQ4|Q9BXQ5|Q9H0I8	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.E547Q	ENST00000352083.6	37	c.1639		11	.	.	.	.	.	.	.	.	.	.	C	19.86	3.905736	0.72868	.	.	ENSG00000110693	ENST00000316399;ENST00000352083;ENST00000396356;ENST00000528252;ENST00000527619;ENST00000528429	D;D;D;D;D;D	0.98512	-4.69;-4.96;-4.69;-4.97;-4.97;-4.96	6.02	6.02	0.97574	.	0.094486	0.64402	D	0.000001	D	0.98469	0.9490	M	0.69358	2.11	0.80722	D	1	P;B;B	0.47034	0.889;0.133;0.184	P;B;B	0.55011	0.766;0.243;0.173	D	0.98402	1.0568	10	0.48119	T	0.1	.	20.5407	0.99260	0.0:1.0:0.0:0.0	.	547;547;523	P35712-3;P35712;P35712-2	.;SOX6_HUMAN;.	Q	547;547;547;520;523;547	ENSP00000324948:E547Q;ENSP00000339876:E547Q;ENSP00000379644:E547Q;ENSP00000432134:E520Q;ENSP00000434455:E523Q;ENSP00000433233:E547Q	ENSP00000324948:E547Q	E	-	1	0	SOX6	15993157	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.158000	0.77470	2.865000	0.98341	0.655000	0.94253	GAG	SOX6	-	NULL		0.463	SOX6-201	KNOWN	basic|appris_candidate_longest	protein_coding	SOX6	HGNC	protein_coding	OTTHUMT00000386811.1	C	NM_033326		16036581	-1	no_errors	ENST00000352083	ensembl	human	known	70_37	missense	SNP	1.000	G
SPATA31A3	727830	genome.wustl.edu	37	9	40702760	40702760	+	Missense_Mutation	SNP	T	T	G	rs192661010	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:40702760T>G	ENST00000356699.5	+	4	446	c.417T>G	c.(415-417)caT>caG	p.H139Q	SPATA31A3_ENST00000463536.1_3'UTR|RP11-395E19.5_ENST00000432614.1_lincRNA	NM_001083124.1	NP_001076593.1	Q5VYP0	S31A3_HUMAN	SPATA31 subfamily A, member 3	139	Pro-rich.				cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)											AGTCCTCTCATGAGCCTATGG	0.597													T|||	514	0.102636	0.0885	0.1009	5008	,	,		20141	0.003		0.2286	False		,,,				2504	0.0961																0								T	GLN/HIS	382,3416		13,356,1530	53.0	63.0	60.0		417	-3.7	0.0	9	dbSNP_134	60	1741,6417		82,1577,2420	no	missense	FAM75A3	NM_001083124.1	24	95,1933,3950	GG,GT,TT		21.341,10.0579,17.7568	possibly-damaging	139/1348	40702760	2123,9833	1899	4079	5978	SO:0001583	missense	727830					9p12	2012-10-15	2012-10-12	2012-10-12	ENSG00000147926				32003	protein-coding gene	gene with protein product			"""family with sequence similarity 75, member A3"""	FAM75A3		20850414	Standard	NM_001083124		Approved	OTTHUMG00000013164, DKFZp434B204	uc010mmj.3	Q5VYP0	OTTHUMG00000013164	ENST00000356699.5:c.417T>G	9.37:g.40702760T>G	ENSP00000349132:p.His139Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.H139Q	ENST00000356699.5	37	c.417	CCDS47969.1	9	.	.	.	.	.	.	.	.	.	.	T	1.786	-0.480697	0.04383	0.100579	0.21341	ENSG00000147926	ENST00000356699	T	0.03889	3.77	1.86	-3.73	0.04398	.	1.943840	0.02631	N	0.104336	T	0.00012	0.0000	N	0.02916	-0.46	0.80722	P	0.0	B	0.12013	0.005	B	0.11329	0.006	T	0.45760	-0.9239	9	0.25106	T	0.35	0.3542	0.1983	0.00142	0.2674:0.2166:0.2878:0.2282	.	139	Q5VYP0	F75A3_HUMAN	Q	139	ENSP00000349132:H139Q	ENSP00000349132:H139Q	H	+	3	2	FAM75A3	40692760	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-1.285000	0.02791	-1.013000	0.03383	-0.836000	0.03065	CAT	SPATA31A3	-	NULL		0.597	SPATA31A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA31A3	HGNC	protein_coding	OTTHUMT00000036919.1	T	NM_001083124		40702760	+1	no_errors	ENST00000356699	ensembl	human	known	70_37	missense	SNP	0.000	G
SPATS2	65244	genome.wustl.edu	37	12	49919880	49919880	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:49919880C>T	ENST00000553127.1	+	15	1993	c.1480C>T	c.(1480-1482)Cag>Tag	p.Q494*	SPATS2_ENST00000552918.1_Nonsense_Mutation_p.Q494*|SPATS2_ENST00000321898.6_Nonsense_Mutation_p.Q494*			Q86XZ4	SPAS2_HUMAN	spermatogenesis associated, serine-rich 2	494						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(4)|kidney(1)|large_intestine(7)|lung(1)|prostate(1)|urinary_tract(4)	21						TGCTCCATCTCAGGCACCAGG	0.537																																																	0													145.0	121.0	129.0					12																	49919880		2203	4300	6503	SO:0001587	stop_gained	65244			AK023179	CCDS31794.1	12q13.12	2009-06-12							18650	protein-coding gene	gene with protein product		611667				11944913, 17989879	Standard	NM_023071		Approved	SPATA10, SCR59, FLJ13117	uc001rud.2	Q86XZ4		ENST00000553127.1:c.1480C>T	12.37:g.49919880C>T	ENSP00000448228:p.Gln494*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8G9|Q9H7D4|Q9H8Y7|Q9H8Z8	Nonsense_Mutation	SNP	pfam_DUF1387,superfamily_UBA-like	p.Q494*	ENST00000553127.1	37	c.1480	CCDS31794.1	12	.	.	.	.	.	.	.	.	.	.	C	38	6.735190	0.97801	.	.	ENSG00000123352	ENST00000553127;ENST00000321898;ENST00000552918;ENST00000395063	.	.	.	4.26	4.26	0.50523	.	0.372397	0.27886	N	0.017457	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.32370	T	0.25	-4.6443	15.0587	0.71936	0.0:1.0:0.0:0.0	.	.	.	.	X	494	.	ENSP00000326841:Q494X	Q	+	1	0	SPATS2	48206147	0.687000	0.27671	0.925000	0.36789	0.892000	0.51952	4.387000	0.59626	2.690000	0.91761	0.579000	0.79373	CAG	SPATS2	-	NULL		0.537	SPATS2-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPATS2	HGNC	protein_coding	OTTHUMT00000404023.1	C	NM_023071		49919880	+1	no_errors	ENST00000321898	ensembl	human	known	70_37	nonsense	SNP	0.886	T
SPEF1	25876	genome.wustl.edu	37	20	3759528	3759528	+	Intron	SNP	C	C	T	rs2281478	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:3759528C>T	ENST00000379756.3	-	4	579				SPEF1_ENST00000463490.1_5'UTR	NM_015417.4	NP_056232.2	Q9Y4P9	SPEF1_HUMAN	sperm flagellar 1							axoneme (GO:0005930)|cytoskeleton (GO:0005856)|motile cilium (GO:0031514)				cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	8						CTTCCACTCTCACAAGTGACA	0.547													C|||	2554	0.509984	0.4592	0.5576	5008	,	,		18761	0.623		0.498	False		,,,				2504	0.4407																0								C		643,741		143,357,192	42.0	51.0	48.0			0.9	0.0	20	dbSNP_100	48	1736,1446		453,830,308	no	intron	SPEF1	NM_015417.4		596,1187,500	TT,TC,CC		45.4431,46.4595,47.8975			3759528	2379,2187	692	1591	2283	SO:0001627	intron_variant	25876			AL080154	CCDS13063.2	20p13	2013-09-23	2007-08-20	2007-08-20	ENSG00000101222	ENSG00000101222			15874	protein-coding gene	gene with protein product		610674	"""chromosome 20 open reading frame 28"""	C20orf28		15979255	Standard	NM_015417		Approved	DKFZP434I114, SPEF1A	uc002wjj.3	Q9Y4P9	OTTHUMG00000031756	ENST00000379756.3:c.418+69G>A	20.37:g.3759528C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A5YM71|D3DVY0|Q5JX78	RNA	SNP	-	NULL	ENST00000379756.3	37	NULL	CCDS13063.2	20																																																																																			SPEF1	-	-		0.547	SPEF1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEF1	HGNC	protein_coding	OTTHUMT00000077760.2	C			3759528	-1	no_errors	ENST00000463490	ensembl	human	known	70_37	rna	SNP	0.003	T
SPG20	23111	genome.wustl.edu	37	13	36909405	36909405	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr13:36909405C>T	ENST00000451493.1	-	2	780	c.563G>A	c.(562-564)gGa>gAa	p.G188E	SPG20_ENST00000438666.2_Missense_Mutation_p.G188E|SPG20_ENST00000495510.1_5'UTR|SPG20_ENST00000355182.4_Missense_Mutation_p.G188E|SPG20_ENST00000494062.2_Missense_Mutation_p.G188E	NM_001142295.1	NP_001135767.1	Q8N0X7	SPG20_HUMAN	spastic paraplegia 20 (Troyer syndrome)	188					abscission (GO:0009838)|adipose tissue development (GO:0060612)|cell death (GO:0008219)|cell division (GO:0051301)|lipid particle organization (GO:0034389)|negative regulation of BMP signaling pathway (GO:0030514)|negative regulation of collateral sprouting in absence of injury (GO:0048698)|neuromuscular process (GO:0050905)|regulation of mitochondrial membrane potential (GO:0051881)	cytoplasm (GO:0005737)|lipid particle (GO:0005811)|midbody (GO:0030496)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)|synapse (GO:0045202)	ubiquitin protein ligase binding (GO:0031625)			breast(1)|endometrium(2)|kidney(1)|large_intestine(8)|lung(10)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	27		Breast(139;0.014)|Lung SC(185;0.0548)|Prostate(109;0.174)	KIRC - Kidney renal clear cell carcinoma(5;0.119)|Kidney(79;0.169)	all cancers(112;2.42e-08)|Epithelial(112;1.58e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00128)|BRCA - Breast invasive adenocarcinoma(63;0.0125)|GBM - Glioblastoma multiforme(144;0.026)		AGAATCTGTTCCATAGGATAC	0.473																																																	0													63.0	62.0	62.0					13																	36909405		2203	4300	6503	SO:0001583	missense	23111			AB011182	CCDS9356.1	13q13.1	2008-07-04	2007-04-23		ENSG00000133104	ENSG00000133104			18514	protein-coding gene	gene with protein product	"""spartin"""	607111				6022528, 12134148	Standard	NM_001142294		Approved	KIAA0610, TAHCCP1	uc001uvm.3	Q8N0X7	OTTHUMG00000016730	ENST00000451493.1:c.563G>A	13.37:g.36909405C>T	ENSP00000414147:p.Gly188Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	O60349|Q86Y67|Q9H1T2|Q9H1T3	Missense_Mutation	SNP	pfam_Senescence/spartin,pfam_MIT,smart_MIT	p.G188E	ENST00000451493.1	37	c.563	CCDS9356.1	13	.	.	.	.	.	.	.	.	.	.	C	32	5.112568	0.94339	.	.	ENSG00000133104	ENST00000438666;ENST00000355182;ENST00000451493;ENST00000423217	D;D;D	0.93366	-3.21;-3.21;-3.21	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.96371	0.8816	M	0.68317	2.08	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.999;1.0;0.999	D	0.94903	0.8058	10	0.37606	T	0.19	-27.5733	20.4192	0.99033	0.0:1.0:0.0:0.0	.	188;188;188	A8K6Q9;B3KMI3;Q8N0X7	.;.;SPG20_HUMAN	E	188	ENSP00000406061:G188E;ENSP00000347314:G188E;ENSP00000414147:G188E	ENSP00000347314:G188E	G	-	2	0	SPG20	35807405	1.000000	0.71417	0.995000	0.50966	0.978000	0.69477	6.935000	0.75886	2.831000	0.97527	0.650000	0.86243	GGA	SPG20	-	NULL		0.473	SPG20-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SPG20	HGNC	protein_coding	OTTHUMT00000044494.2	C			36909405	-1	no_errors	ENST00000355182	ensembl	human	known	70_37	missense	SNP	1.000	T
SPNS3	201305	genome.wustl.edu	37	17	4389826	4389826	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:4389826G>A	ENST00000355530.2	+	11	1678	c.1398G>A	c.(1396-1398)ctG>ctA	p.L466L	RP13-580F15.2_ENST00000577176.1_RNA|RP13-580F15.2_ENST00000576086.1_RNA|SPNS3_ENST00000333476.2_Silent_p.L339L|RP13-580F15.2_ENST00000577064.1_RNA	NM_182538.4	NP_872344.3	Q6ZMD2	SPNS3_HUMAN	spinster homolog 3 (Drosophila)	466					lipid transport (GO:0006869)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)				NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(7)|ovary(1)|prostate(1)|skin(6)|stomach(2)	28						GCTTCCTGCTGACTGCGCTGT	0.677																																																	0													37.0	40.0	39.0					17																	4389826		2203	4300	6503	SO:0001819	synonymous_variant	201305				CCDS11045.1	17p13.2	2014-08-12			ENSG00000182557	ENSG00000182557			28433	protein-coding gene	gene with protein product		611701					Standard	NM_182538		Approved	MGC29671	uc002fxt.3	Q6ZMD2	OTTHUMG00000177737	ENST00000355530.2:c.1398G>A	17.37:g.4389826G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IZ31	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.L466	ENST00000355530.2	37	c.1398	CCDS11045.1	17																																																																																			SPNS3	-	superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.677	SPNS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPNS3	HGNC	protein_coding	OTTHUMT00000438793.1	G	NM_182538		4389826	+1	no_errors	ENST00000355530	ensembl	human	known	70_37	silent	SNP	0.836	A
SPTB	6710	genome.wustl.edu	37	14	65216120	65216120	+	Silent	SNP	C	C	T	rs57421986	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:65216120C>T	ENST00000556626.1	-	36	7033	c.6891G>A	c.(6889-6891)gcG>gcA	p.A2297A	SPTB_ENST00000342835.4_5'UTR|SPTB_ENST00000389722.3_Silent_p.A2297A			P11277	SPTB1_HUMAN	spectrin, beta, erythrocytic	0					actin filament capping (GO:0051693)|axon guidance (GO:0007411)|hemopoiesis (GO:0030097)|plasma membrane organization (GO:0007009)|porphyrin-containing compound biosynthetic process (GO:0006779)	actin cytoskeleton (GO:0015629)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|protein complex (GO:0043234)|spectrin (GO:0008091)|spectrin-associated cytoskeleton (GO:0014731)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|ankyrin binding (GO:0030506)|structural constituent of cytoskeleton (GO:0005200)			breast(5)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(36)|ovary(8)|pancreas(1)|prostate(4)|skin(10)|urinary_tract(3)	106		all_lung(585;4.15e-09)		all cancers(60;4.33e-34)|OV - Ovarian serous cystadenocarcinoma(108;8.32e-20)|BRCA - Breast invasive adenocarcinoma(234;0.0628)		GCAGGCTCTGCGCCTTGACGC	0.632													C|||	523	0.104433	0.2421	0.0346	5008	,	,		13049	0.0317		0.0775	False		,,,				2504	0.0706																0								C		979,3427	354.6+/-312.7	114,751,1338	56.0	50.0	52.0		6891	-9.5	0.4	14	dbSNP_129	52	509,8091	139.8+/-196.4	16,477,3807	no	coding-synonymous	SPTB	NM_001024858.2		130,1228,5145	TT,TC,CC		5.9186,22.2197,11.4409		2297/2329	65216120	1488,11518	2203	4300	6503	SO:0001819	synonymous_variant	6710				CCDS32099.1, CCDS32100.1	14q24.1-q24.2	2013-01-10	2008-07-29			ENSG00000070182		"""Pleckstrin homology (PH) domain containing"""	11274	protein-coding gene	gene with protein product	"""spherocytosis, clinical type I"""	182870				2209094	Standard	NM_001024858		Approved		uc001xhr.3	P11277		ENST00000556626.1:c.6891G>A	14.37:g.65216120C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15510|Q15519	Silent	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_CAMSAP_CH,pfam_Pleckstrin_homology,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.A2297	ENST00000556626.1	37	c.6891	CCDS32099.1	14																																																																																			SPTB	-	pirsf_Spectrin_bsu		0.632	SPTB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTB	HGNC	protein_coding	OTTHUMT00000414076.1	C			65216120	-1	no_errors	ENST00000389722	ensembl	human	known	70_37	silent	SNP	0.288	T
SPTBN2	6712	genome.wustl.edu	37	11	66478212	66478212	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:66478212C>T	ENST00000533211.1	-	10	1245	c.914G>A	c.(913-915)cGc>cAc	p.R305H	RN7SL12P_ENST00000473849.2_RNA|SPTBN2_ENST00000529997.1_Missense_Mutation_p.R305H|SPTBN2_ENST00000309996.2_Missense_Mutation_p.R305H			O15020	SPTN2_HUMAN	spectrin, beta, non-erythrocytic 2	305					actin filament capping (GO:0051693)|adult behavior (GO:0030534)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|cell death (GO:0008219)|cerebellar Purkinje cell layer morphogenesis (GO:0021692)|multicellular organism growth (GO:0035264)|synapse assembly (GO:0007416)|vesicle-mediated transport (GO:0016192)	apical plasma membrane (GO:0016324)|cytosol (GO:0005829)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|spectrin (GO:0008091)	actin binding (GO:0003779)|phospholipid binding (GO:0005543)|structural constituent of cytoskeleton (GO:0005200)			autonomic_ganglia(1)|breast(1)|central_nervous_system(4)|cervix(1)|endometrium(10)|kidney(5)|large_intestine(15)|liver(1)|lung(22)|ovary(2)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	74						CTCCACCAGGCGCTCTGCCTC	0.627																																																	0													65.0	55.0	59.0					11																	66478212		2200	4295	6495	SO:0001583	missense	6712			AB008567, AF026487, AF026488, AF079569	CCDS8150.1	11q13.2	2013-01-10			ENSG00000173898	ENSG00000173898		"""Pleckstrin homology (PH) domain containing"""	11276	protein-coding gene	gene with protein product		604985	"""spinocerebellar ataxia 5"""	SCA5		9826670, 16429157	Standard	NM_006946		Approved		uc001ojd.3	O15020	OTTHUMG00000167262	ENST00000533211.1:c.914G>A	11.37:g.66478212C>T	ENSP00000432568:p.Arg305His	Somatic		WXS	Illumina HiSeq	Phase_IV	O14872|O14873	Missense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.R305H	ENST00000533211.1	37	c.914	CCDS8150.1	11	.	.	.	.	.	.	.	.	.	.	C	23.1	4.372044	0.82573	.	.	ENSG00000173898	ENST00000533211;ENST00000309996;ENST00000529997;ENST00000443262	T;T;T	0.68479	-0.33;-0.33;-0.33	5.0	4.07	0.47477	.	0.125415	0.56097	N	0.000028	T	0.69070	0.3070	M	0.68952	2.095	0.30226	N	0.796313	D	0.65815	0.995	P	0.53760	0.734	T	0.67569	-0.5637	10	0.38643	T	0.18	.	6.1719	0.20422	0.0:0.7095:0.0:0.2905	.	305	O15020	SPTN2_HUMAN	H	305	ENSP00000432568:R305H;ENSP00000311489:R305H;ENSP00000433593:R305H	ENSP00000311489:R305H	R	-	2	0	SPTBN2	66234788	0.315000	0.24571	1.000000	0.80357	0.992000	0.81027	1.645000	0.37238	1.302000	0.44855	0.563000	0.77884	CGC	SPTBN2	-	pirsf_Spectrin_bsu		0.627	SPTBN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN2	HGNC	protein_coding	OTTHUMT00000393892.2	C	NM_006946		66478212	-1	no_errors	ENST00000309996	ensembl	human	known	70_37	missense	SNP	1.000	T
SRC	6714	genome.wustl.edu	37	20	36032761	36032761	+	3'UTR	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:36032761G>T	ENST00000373578.2	+	0	2939				SRC_ENST00000373558.2_3'UTR|SRC_ENST00000445403.1_3'UTR|SRC_ENST00000477066.1_3'UTR|SRC_ENST00000373567.2_3'UTR|SRC_ENST00000360723.4_3'UTR|SRC_ENST00000358208.4_3'UTR	NM_198291.1	NP_938033.1	P12931	SRC_HUMAN	SRC proto-oncogene, non-receptor tyrosine kinase						axon guidance (GO:0007411)|blood coagulation (GO:0007596)|bone resorption (GO:0045453)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell cycle (GO:0007049)|cellular response to progesterone stimulus (GO:0071393)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|leukocyte migration (GO:0050900)|membrane organization (GO:0061024)|negative regulation of anoikis (GO:2000811)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|negative regulation of mitochondrial depolarization (GO:0051902)|negative regulation of protein homooligomerization (GO:0032463)|neurotrophin TRK receptor signaling pathway (GO:0048011)|oogenesis (GO:0048477)|peptidyl-tyrosine phosphorylation (GO:0018108)|platelet activation (GO:0030168)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of integrin activation (GO:0033625)|positive regulation of podosome assembly (GO:0071803)|positive regulation of protein kinase B signaling (GO:0051897)|progesterone receptor signaling pathway (GO:0050847)|protein autophosphorylation (GO:0046777)|Ras protein signal transduction (GO:0007265)|regulation of bone resorption (GO:0045124)|regulation of caveolin-mediated endocytosis (GO:2001286)|regulation of cell-cell adhesion (GO:0022407)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of epithelial cell migration (GO:0010632)|regulation of intracellular estrogen receptor signaling pathway (GO:0033146)|regulation of protein binding (GO:0043393)|regulation of vascular permeability (GO:0043114)|response to interleukin-1 (GO:0070555)|signal complex assembly (GO:0007172)|signal transduction (GO:0007165)|stress fiber assembly (GO:0043149)|T cell costimulation (GO:0031295)|transforming growth factor beta receptor signaling pathway (GO:0007179)|uterus development (GO:0060065)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|late endosome (GO:0005770)|lysosome (GO:0005764)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|enzyme binding (GO:0019899)|ephrin receptor binding (GO:0046875)|growth factor receptor binding (GO:0070851)|heme binding (GO:0020037)|integrin binding (GO:0005178)|ion channel binding (GO:0044325)|kinase activity (GO:0016301)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|phosphoprotein binding (GO:0051219)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|central_nervous_system(1)|endometrium(3)|kidney(2)|large_intestine(16)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	30		Myeloproliferative disorder(115;0.00878)			Bosutinib(DB06616)|Dasatinib(DB01254)|Ponatinib(DB08901)	gcttgtgggtgatgtttgacc	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	6714			AF077754	CCDS13294.1	20q12-q13	2014-06-25	2014-06-25		ENSG00000197122	ENSG00000197122		"""SH2 domain containing"""	11283	protein-coding gene	gene with protein product		190090	"""v-src avian sarcoma (Schmidt-Ruppin A-2) viral oncogene homolog"""	SRC1		2582238	Standard	NM_005417		Approved	ASV, c-src	uc002xgy.3	P12931	OTTHUMG00000032417	ENST00000373578.2:c.*979G>T	20.37:g.36032761G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5V4|Q76P87|Q86VB9|Q9H5A8	RNA	SNP	-	NULL	ENST00000373578.2	37	NULL	CCDS13294.1	20																																																																																			SRC	-	-		0.577	SRC-001	KNOWN	non_canonical_TEC|basic|appris_principal|CCDS	protein_coding	SRC	HGNC	protein_coding	OTTHUMT00000268142.1	G	NM_005417		36032761	+1	no_errors	ENST00000477066	ensembl	human	known	70_37	rna	SNP	0.001	T
SSC4D	136853	genome.wustl.edu	37	7	76033741	76033741	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr7:76033741C>T	ENST00000275560.3	-	2	363	c.16G>A	c.(16-18)Gag>Aag	p.E6K	ZP3_ENST00000336517.4_Intron	NM_080744.1	NP_542782.1												p.E6K(1)		autonomic_ganglia(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(2)|lung(9)|pancreas(1)|prostate(1)|skin(2)|urinary_tract(1)	21						ATTAGCATCTCTGCTTCCTTG	0.542																																																	1	Substitution - Missense(1)	urinary_tract(1)											136.0	128.0	131.0					7																	76033741		2203	4300	6503	SO:0001583	missense	136853																														ENST00000275560.3:c.16G>A	7.37:g.76033741C>T	ENSP00000275560:p.Glu6Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.E6K	ENST00000275560.3	37	c.16	CCDS5585.1	7	.	.	.	.	.	.	.	.	.	.	C	17.08	3.297007	0.60086	.	.	ENSG00000146700	ENST00000275560	T	0.01272	5.07	4.99	4.09	0.47781	.	0.826433	0.10648	N	0.650169	T	0.02342	0.0072	L	0.59436	1.845	0.80722	D	1	B	0.31318	0.319	B	0.24155	0.051	T	0.51710	-0.8671	10	0.62326	D	0.03	.	11.4779	0.50308	0.0:0.8188:0.1812:0.0	.	6	Q8WTU2	SRB4D_HUMAN	K	6	ENSP00000275560:E6K	ENSP00000275560:E6K	E	-	1	0	SRCRB4D	75871677	1.000000	0.71417	0.507000	0.27676	0.225000	0.24961	2.031000	0.41117	1.443000	0.47586	0.552000	0.68991	GAG	SRCRB4D	-	NULL		0.542	SRCRB4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRCRB4D	HGNC	protein_coding	OTTHUMT00000253001.3	C			76033741	-1	no_errors	ENST00000275560	ensembl	human	known	70_37	missense	SNP	0.915	T
SRGAP1	57522	genome.wustl.edu	37	12	64491142	64491142	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:64491142G>A	ENST00000355086.3	+	15	2324	c.1800G>A	c.(1798-1800)ctG>ctA	p.L600L	SRGAP1_ENST00000543397.1_Silent_p.L537L|RP11-196H14.2_ENST00000535594.1_RNA|SRGAP1_ENST00000357825.3_Silent_p.L577L	NM_020762.2	NP_065813.1	Q7Z6B7	SRGP1_HUMAN	SLIT-ROBO Rho GTPase activating protein 1	600	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				axon guidance (GO:0007411)|cell migration (GO:0016477)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	Rho GTPase activator activity (GO:0005100)			breast(4)|central_nervous_system(3)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(26)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	65			GBM - Glioblastoma multiforme(3;0.000139)|BRCA - Breast invasive adenocarcinoma(9;0.225)	GBM - Glioblastoma multiforme(28;0.0608)		TTAACGATCTGATTTCTTGTA	0.423																																																	0													86.0	83.0	84.0					12																	64491142		2203	4300	6503	SO:0001819	synonymous_variant	57522			AB037725	CCDS8967.1	12q13.13	2011-07-04			ENSG00000196935	ENSG00000196935		"""Rho GTPase activating proteins"""	17382	protein-coding gene	gene with protein product		606523				11672528	Standard	NM_020762		Approved	KIAA1304, ARHGAP13	uc010ssp.1	Q7Z6B7	OTTHUMG00000168750	ENST00000355086.3:c.1800G>A	12.37:g.64491142G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H8A3|Q9P2P2	Silent	SNP	pfam_RhoGAP_dom,pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_Rho_GTPase_activation_prot,superfamily_SH3_domain,superfamily_Fuc/Ara_isomerase_C,smart_FCH,smart_RhoGAP_dom,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,pfscan_RhoGAP_dom	p.L600	ENST00000355086.3	37	c.1800	CCDS8967.1	12																																																																																			SRGAP1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.423	SRGAP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRGAP1	HGNC	protein_coding	OTTHUMT00000400896.1	G			64491142	+1	no_errors	ENST00000355086	ensembl	human	known	70_37	silent	SNP	1.000	A
SRRM5	100170229	genome.wustl.edu	37	19	44117582	44117582	+	Missense_Mutation	SNP	T	T	C	rs10410000	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:44117582T>C	ENST00000607544.1	+	3	1631	c.1309T>C	c.(1309-1311)Tgc>Cgc	p.C437R	ZNF428_ENST00000300811.3_Intron|SRRM5_ENST00000526798.1_Missense_Mutation_p.C452R|SRRM5_ENST00000417606.1_Missense_Mutation_p.C437R			B3KS81	SRRM5_HUMAN	serine/arginine repetitive matrix 5	437	Ser-rich.			C -> R (in Ref. 1; BAG60212). {ECO:0000305}.				p.C437R(1)		endometrium(11)|kidney(2)|skin(1)|stomach(1)	15						GGCGAGAGATTGCAGCCGATC	0.527													C|||	1056	0.210863	0.2814	0.2666	5008	,	,		15615	0.2698		0.1481	False		,,,				2504	0.0798																1	Substitution - Missense(1)	endometrium(1)											53.0	65.0	62.0					19																	44117582		692	1591	2283	SO:0001583	missense	100170229			AK297891	CCDS46095.1	19q13.31	2013-09-20			ENSG00000226763	ENSG00000226763			37248	protein-coding gene	gene with protein product							Standard	NM_001145641		Approved		uc010xwr.2	B3KS81	OTTHUMG00000165480	ENST00000607544.1:c.1309T>C	19.37:g.44117582T>C	ENSP00000476253:p.Cys437Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DNF0	Missense_Mutation	SNP	NULL	p.C452R	ENST00000607544.1	37	c.1354	CCDS46095.1	19	.	.	.	.	.	.	.	.	.	.	C	4.598	0.111134	0.08831	.	.	ENSG00000226763	ENST00000526798;ENST00000417606	.	.	.	3.92	-3.58	0.04597	.	.	.	.	.	T	0.17704	0.0425	N	0.08118	0	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.27839	-1.0062	7	0.20519	T	0.43	.	6.7094	0.23268	0.1388:0.2466:0.0:0.6145	rs10410000	437	B3KS81	SRRM5_HUMAN	R	452;437	.	ENSP00000414512:C437R	C	+	1	0	SRRM5	48809422	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.651000	0.05372	-0.877000	0.04012	-0.801000	0.03215	TGC	SRRM5	-	NULL		0.527	SRRM5-001	KNOWN	alternative_5_UTR|upstream_ATG|basic|appris_candidate|readthrough_transcript|CCDS	protein_coding	SRRM5	HGNC	protein_coding	OTTHUMT00000384398.2	T	NM_001145641		44117582	+1	no_errors	ENST00000526798	ensembl	human	known	70_37	missense	SNP	0.000	C
ACTA2	59	genome.wustl.edu	37	10	90733048	90733048	+	Intron	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr10:90733048C>T	ENST00000458208.1	-	1	452				STAMBPL1_ENST00000371927.3_Missense_Mutation_p.S455L	NM_001141945.1	NP_001135417.1	P62736	ACTA_HUMAN	actin, alpha 2, smooth muscle, aorta						glomerular mesangial cell development (GO:0072144)|muscle contraction (GO:0006936)|regulation of blood pressure (GO:0008217)|response to virus (GO:0009615)|vascular smooth muscle contraction (GO:0014829)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|protein complex (GO:0043234)|smooth muscle contractile fiber (GO:0030485)	ATP binding (GO:0005524)|protein kinase binding (GO:0019901)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|skin(1)|urinary_tract(2)	17		Colorectal(252;0.0161)		Colorectal(12;0.000123)|COAD - Colon adenocarcinoma(12;0.00018)		TCTAGGTCATCATCACCATCT	0.443																																																	0													77.0	74.0	75.0					10																	90733048		876	1991	2867	SO:0001627	intron_variant	57559			X13839	CCDS7392.1	10q23.31	2014-09-17			ENSG00000107796	ENSG00000107796			130	protein-coding gene	gene with protein product		102620				2398629	Standard	NM_001141945		Approved	ACTSA	uc001kfp.3	P62736	OTTHUMG00000018700	ENST00000458208.1:c.22+17647G>A	10.37:g.90733048C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8A4|P03996|P04108|Q6FI19	Missense_Mutation	SNP	pfam_JAB1_Mov34_MPN_PAD1,smart_JAB1_Mov34_MPN_PAD1	p.S455L	ENST00000458208.1	37	c.1364	CCDS7392.1	10	.	.	.	.	.	.	.	.	.	.	C	13.13	2.145654	0.37923	.	.	ENSG00000138134	ENST00000371927	T	0.24151	1.87	3.19	1.28	0.21552	.	0.717353	0.10838	N	0.628565	T	0.15435	0.0372	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24835	-1.0149	9	0.41790	T	0.15	.	4.2937	0.10890	0.0:0.6267:0.2389:0.1344	.	455	Q96FJ0-2	.	L	455	ENSP00000360995:S455L	ENSP00000360995:S455L	S	+	2	0	STAMBPL1	90723028	0.000000	0.05858	0.012000	0.15200	0.401000	0.30781	0.053000	0.14184	0.353000	0.24079	0.655000	0.94253	TCA	STAMBPL1	-	NULL		0.443	ACTA2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	STAMBPL1	HGNC	protein_coding	OTTHUMT00000049264.1	C	NM_001613		90733048	+1	no_errors	ENST00000371927	ensembl	human	known	70_37	missense	SNP	0.019	T
STIL	6491	genome.wustl.edu	37	1	47765776	47765776	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:47765776G>T	ENST00000360380.3	-	7	865	c.502C>A	c.(502-504)Ctg>Atg	p.L168M	STIL_ENST00000337817.5_Missense_Mutation_p.L168M|STIL_ENST00000396221.2_Missense_Mutation_p.L168M|STIL_ENST00000243182.6_Missense_Mutation_p.L168M|STIL_ENST00000371877.3_Missense_Mutation_p.L168M	NM_001282936.1	NP_001269865.1	Q15468	STIL_HUMAN	SCL/TAL1 interrupting locus	168					cell proliferation (GO:0008283)|determination of left/right symmetry (GO:0007368)|embryonic axis specification (GO:0000578)|floor plate development (GO:0033504)|forebrain development (GO:0030900)|heart looping (GO:0001947)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of apoptotic process (GO:0043066)|neural tube closure (GO:0001843)|neural tube development (GO:0021915)|notochord development (GO:0030903)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cytoplasm (GO:0005737)				central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(9)|lung(14)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)	36		Acute lymphoblastic leukemia(5;0.00116)|all_hematologic(5;0.00444)				AGGGAAAGCAGCTTACCACAG	0.368																																																	0													101.0	95.0	97.0					1																	47765776		2203	4300	6503	SO:0001583	missense	6491			M74558	CCDS548.1, CCDS41329.1, CCDS72785.1, CCDS72786.1	1p32	2010-02-09	2005-11-29	2005-11-29	ENSG00000123473	ENSG00000123473			10879	protein-coding gene	gene with protein product		181590	"""TAL1 (SCL) interrupting locus"""	SIL		2209547	Standard	NM_003035		Approved	MCPH7	uc001crd.1	Q15468	OTTHUMG00000007851	ENST00000360380.3:c.502C>A	1.37:g.47765776G>T	ENSP00000353544:p.Leu168Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T0C5|Q68CN9	Missense_Mutation	SNP	NULL	p.L168M	ENST00000360380.3	37	c.502	CCDS548.1	1	.	.	.	.	.	.	.	.	.	.	G	17.40	3.380547	0.61845	.	.	ENSG00000123473	ENST00000360380;ENST00000337817;ENST00000371877;ENST00000396221;ENST00000243182	T;T;T;T;T	0.58358	0.34;0.34;0.34;0.34;0.34	5.47	3.58	0.41010	.	0.000000	0.85682	D	0.000000	T	0.65974	0.2743	M	0.65320	2	0.47441	D	0.999428	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.999	T	0.65689	-0.6107	10	0.87932	D	0	-6.4499	8.632	0.33926	0.2933:0.0:0.7067:0.0	.	168;168;168	E9PSF2;Q15468-2;Q15468	.;.;STIL_HUMAN	M	168	ENSP00000353544:L168M;ENSP00000337367:L168M;ENSP00000360944:L168M;ENSP00000379523:L168M;ENSP00000243182:L168M	ENSP00000243182:L168M	L	-	1	2	STIL	47538363	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.546000	0.36179	0.648000	0.30732	0.557000	0.71058	CTG	STIL	-	NULL		0.368	STIL-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	STIL	HGNC	protein_coding	OTTHUMT00000021649.2	G	NM_003035		47765776	-1	no_errors	ENST00000371877	ensembl	human	known	70_37	missense	SNP	1.000	T
STK11	6794	genome.wustl.edu	37	19	1220433	1220433	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:1220433G>A	ENST00000326873.7	+	4	1699	c.526G>A	c.(526-528)Gac>Aac	p.D176N		NM_000455.4	NP_000446.1	Q15831	STK11_HUMAN	serine/threonine kinase 11	176	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.		D -> N (in PJS; loss of kinase activity, leading to greatly reduced autophosphorylation; fails to phosphorylate PTEN in vitro; no significant effect on nucleocytoplasmic localization). {ECO:0000269|PubMed:9837816}.|D -> Y (in sporadic cancer; somatic mutation; Loss of kinase activity).		activation of protein kinase activity (GO:0032147)|anoikis (GO:0043276)|autophagy (GO:0006914)|axonogenesis (GO:0007409)|canonical Wnt signaling pathway (GO:0060070)|cell cycle arrest (GO:0007050)|cellular response to DNA damage stimulus (GO:0006974)|energy reserve metabolic process (GO:0006112)|establishment of cell polarity (GO:0030010)|glucose homeostasis (GO:0042593)|Golgi localization (GO:0051645)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of epithelial cell proliferation involved in prostate gland development (GO:0060770)|positive regulation of axonogenesis (GO:0050772)|positive regulation of gluconeogenesis (GO:0045722)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|positive thymic T cell selection (GO:0045059)|protein autophosphorylation (GO:0046777)|protein heterooligomerization (GO:0051291)|protein phosphorylation (GO:0006468)|regulation of cell growth (GO:0001558)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of protein kinase B signaling (GO:0051896)|regulation of Wnt signaling pathway (GO:0030111)|response to glucagon (GO:0033762)|response to ionizing radiation (GO:0010212)|response to lipid (GO:0033993)|small molecule metabolic process (GO:0044281)|spermatid development (GO:0007286)|T cell receptor signaling pathway (GO:0050852)|TCR signalosome assembly (GO:0036399)|tissue homeostasis (GO:0001894)|vasculature development (GO:0001944)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|TCR signalosome (GO:0036398)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|p53 binding (GO:0002039)|protein kinase activator activity (GO:0030295)|protein serine/threonine kinase activity (GO:0004674)	p.0?(20)|p.Y156fs*87(4)|p.?(4)|p.D176Y(1)		biliary_tract(1)|breast(3)|cervix(35)|gastrointestinal_tract_(site_indeterminate)(5)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(14)|liver(1)|lung(219)|oesophagus(1)|ovary(4)|pancreas(6)|prostate(2)|skin(15)|small_intestine(1)|stomach(9)|testis(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	328		Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;7.93e-06)|all_lung(49;1.25e-05)|Breast(49;0.000172)|Renal(1328;0.0183)|Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|Lung(535;0.00942)|STAD - Stomach adenocarcinoma(1328;0.18)		TGTGCACAAGGACATCAAGCC	0.657		14	"""D, Mis, N, F, S"""		"""NSCLC, pancreatic"""	"""jejunal harmartoma, ovarian, testicular, pancreatic"""			Peutz-Jeghers syndrome	TSP Lung(3;<1E-08)																													yes	Rec	yes	Peutz-Jeghers syndrome	19	19p13.3	6794	serine/threonine kinase 11 gene (LKB1)		"""E, M, O"""	29	Whole gene deletion(20)|Unknown(4)|Deletion - Frameshift(4)|Substitution - Missense(1)	cervix(15)|lung(10)|oesophagus(1)|ovary(1)|kidney(1)|pancreas(1)	GRCh37	CM981867	STK11	M							44.0	51.0	49.0					19																	1220433		2101	4242	6343	SO:0001583	missense	6794	Familial Cancer Database	PJS, Hamartous Intestinal Polyposis	U63333	CCDS45896.1	19p13.3	2014-09-17	2005-12-13			ENSG00000118046			11389	protein-coding gene	gene with protein product	"""polarization-related protein LKB1"""	602216	"""serine/threonine kinase 11 (Peutz-Jeghers syndrome)"""			9425897	Standard	XM_005259617		Approved	PJS, LKB1	uc002lrl.1	Q15831		ENST00000326873.7:c.526G>A	19.37:g.1220433G>A	ENSP00000324856:p.Asp176Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBX7|E7EW76	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D176N	ENST00000326873.7	37	c.526	CCDS45896.1	19	.	.	.	.	.	.	.	.	.	.	G	33	5.202493	0.94997	.	.	ENSG00000118046	ENST00000326873;ENST00000405031	D	0.92965	-3.14	5.6	5.6	0.85130	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.093272	0.64402	D	0.000001	D	0.97748	0.9261	H	0.97516	4.02	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.98922	1.0784	10	0.87932	D	0	-57.5296	18.5988	0.91240	0.0:0.0:1.0:0.0	.	176	Q15831	STK11_HUMAN	N	176	ENSP00000324856:D176N	ENSP00000324856:D176N	D	+	1	0	STK11	1171433	1.000000	0.71417	1.000000	0.80357	0.564000	0.35744	9.729000	0.98795	2.644000	0.89710	0.561000	0.74099	GAC	STK11	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.657	STK11-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	STK11	HGNC	protein_coding	OTTHUMT00000449839.3	G	NM_000455		1220433	+1	no_errors	ENST00000326873	ensembl	human	known	70_37	missense	SNP	1.000	A
STK32B	55351	genome.wustl.edu	37	4	5500722	5500722	+	Missense_Mutation	SNP	G	G	A	rs367898855		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:5500722G>A	ENST00000282908.5	+	12	1579	c.1157G>A	c.(1156-1158)cGa>cAa	p.R386Q	STK32B_ENST00000508728.1_3'UTR|STK32B_ENST00000510398.1_Missense_Mutation_p.R339Q|STK32B_ENST00000512636.1_Missense_Mutation_p.R309Q	NM_018401.1	NP_060871.1			serine/threonine kinase 32B											breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(10)|lung(16)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	39						ACCGACAGCCGAGGGGGAGGC	0.627																																																	0								G	GLN/ARG	1,4405	2.1+/-5.4	0,1,2202	133.0	104.0	114.0		1157	3.2	0.1	4		114	0,8600		0,0,4300	no	missense	STK32B	NM_018401.1	43	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	benign	386/415	5500722	1,13005	2203	4300	6503	SO:0001583	missense	55351			AJ250839	CCDS3380.1	4p16	2009-09-30			ENSG00000152953	ENSG00000152953			14217	protein-coding gene	gene with protein product						10700184	Standard	XM_005247982		Approved	STKG6, YANK2, STK32, HSA250839	uc003gih.1	Q9NY57	OTTHUMG00000090423	ENST00000282908.5:c.1157G>A	4.37:g.5500722G>A	ENSP00000282908:p.Arg386Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.R386Q	ENST00000282908.5	37	c.1157	CCDS3380.1	4	.	.	.	.	.	.	.	.	.	.	G	1.409	-0.575936	0.03882	2.27E-4	0.0	ENSG00000152953	ENST00000282908;ENST00000512636;ENST00000510398	T;T;T	0.67523	-0.19;0.13;-0.27	4.94	3.23	0.37069	.	0.224264	0.21256	U	0.077544	T	0.49525	0.1562	L	0.44542	1.39	0.09310	N	1	B	0.30193	0.272	B	0.18871	0.023	T	0.26677	-1.0096	10	0.13853	T	0.58	.	7.7799	0.29058	0.1952:0.0:0.8048:0.0	.	386	Q9NY57	ST32B_HUMAN	Q	386;309;339	ENSP00000282908:R386Q;ENSP00000423209:R309Q;ENSP00000420984:R339Q	ENSP00000282908:R386Q	R	+	2	0	STK32B	5551623	0.025000	0.19082	0.089000	0.20774	0.001000	0.01503	1.420000	0.34804	0.513000	0.28278	-0.254000	0.11334	CGA	STK32B	-	NULL		0.627	STK32B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK32B	HGNC	protein_coding	OTTHUMT00000206854.4	G	NM_018401		5500722	+1	no_errors	ENST00000282908	ensembl	human	known	70_37	missense	SNP	0.033	A
SUCO	51430	genome.wustl.edu	37	1	172571295	172571295	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:172571295C>G	ENST00000263688.3	+	21	3329	c.3110C>G	c.(3109-3111)tCt>tGt	p.S1037C	SUCO_ENST00000608151.1_Missense_Mutation_p.S1189C|SUCO_ENST00000610051.1_Missense_Mutation_p.S666C|SUCO_ENST00000367723.4_Missense_Mutation_p.S1188C	NM_014283.3	NP_055098.1	Q9UBS9	SUCO_HUMAN	SUN domain containing ossification factor	1037					multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of bone remodeling (GO:0046850)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|rough endoplasmic reticulum (GO:0005791)											CGAAATACTTCTCAATTTGAT	0.328																																																	0													122.0	110.0	114.0					1																	172571295		2202	4300	6502	SO:0001583	missense	51430			AF097535	CCDS1303.1, CCDS65726.1, CCDS65727.1, CCDS72984.1	1q24	2012-07-10	2012-07-10	2012-07-10	ENSG00000094975	ENSG00000094975			1240	protein-coding gene	gene with protein product	"""SUN-like protein 1"", ""osteopotentia"""		"""chromosome 1 open reading frame 9"""	C1orf9		10673381, 20440000	Standard	NM_001282750		Approved	CH1, SLP1, OPT	uc001giq.4	Q9UBS9	OTTHUMG00000034839	ENST00000263688.3:c.3110C>G	1.37:g.172571295C>G	ENSP00000263688:p.Ser1037Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNU4|Q9BQB9|Q9BXQ2|Q9UL04	Missense_Mutation	SNP	pfam_Sad1_UNC_C,superfamily_Galactose-bd-like	p.S1189C	ENST00000263688.3	37	c.3566	CCDS1303.1	1	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177400	0.78564	.	.	ENSG00000094975	ENST00000367723;ENST00000263688	.	.	.	5.54	5.54	0.83059	.	0.105878	0.64402	D	0.000004	T	0.74650	0.3744	M	0.67953	2.075	0.48395	D	0.999647	D;D;D;D	0.89917	0.997;1.0;1.0;1.0	D;D;D;D	0.85130	0.962;0.997;0.963;0.963	T	0.77078	-0.2721	9	0.87932	D	0	-13.8829	18.0513	0.89349	0.0:1.0:0.0:0.0	.	666;1037;1189;1037	B4DYM4;B4DZJ3;Q5H945;Q9UBS9	.;.;.;OSPT_HUMAN	C	1189;1037	.	ENSP00000263688:S1037C	S	+	2	0	C1orf9	170837918	1.000000	0.71417	0.993000	0.49108	0.998000	0.95712	4.217000	0.58547	2.585000	0.87301	0.650000	0.86243	TCT	SUCO	-	NULL		0.328	SUCO-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUCO	HGNC	protein_coding	OTTHUMT00000084273.1	C	NM_016227		172571295	+1	no_errors	ENST00000367723	ensembl	human	known	70_37	missense	SNP	1.000	G
SULT1A2	6799	genome.wustl.edu	37	16	28606917	28606917	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:28606917G>A	ENST00000395630.1	-	3	578	c.228C>T	c.(226-228)ttC>ttT	p.F76F	SULT1A2_ENST00000335715.4_Silent_p.F76F|SULT1A2_ENST00000533150.1_Silent_p.F76F	NM_177528.2	NP_803564	P50226	ST1A2_HUMAN	sulfotransferase family, cytosolic, 1A, phenol-preferring, member 2	76					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|amine biosynthetic process (GO:0009309)|catecholamine metabolic process (GO:0006584)|phenol-containing compound metabolic process (GO:0018958)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	aryl sulfotransferase activity (GO:0004062)|flavonol 3-sulfotransferase activity (GO:0047894)|sulfotransferase activity (GO:0008146)			NS(2)|breast(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(3)|skin(2)	14						GCACCCGCATGAAGATGGGAG	0.597																																																	0													94.0	88.0	90.0					16																	28606917		2197	4300	6497	SO:0001819	synonymous_variant	6799			U34804	CCDS10636.1	16p12.1	2008-02-05			ENSG00000197165	ENSG00000197165	2.8.2.1	"""Sulfotransferases, cytosolic"""	11454	protein-coding gene	gene with protein product		601292		STP2		8661000, 8912648	Standard	NM_001054		Approved	HAST4	uc002dqh.2	P50226	OTTHUMG00000048082	ENST00000395630.1:c.228C>T	16.37:g.28606917G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A9QY25|P78393|Q14CJ7	Silent	SNP	pfam_Sulfotransferase_dom	p.F76	ENST00000395630.1	37	c.228	CCDS10636.1	16																																																																																			SULT1A2	-	pfam_Sulfotransferase_dom		0.597	SULT1A2-201	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1A2	HGNC	protein_coding	OTTHUMT00000109415.2	G	NM_001054		28606917	-1	no_errors	ENST00000335715	ensembl	human	known	70_37	silent	SNP	0.000	A
SUMO3	6612	genome.wustl.edu	37	21	46226929	46226929	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr21:46226929G>A	ENST00000397898.3	-	4	381	c.299C>T	c.(298-300)tCg>tTg	p.S100L	SUMO3_ENST00000479153.1_5'UTR|SUMO3_ENST00000332859.6_Silent_p.I83I|AL773604.8_ENST00000417820.1_RNA|SUMO3_ENST00000411651.2_Silent_p.I121I					small ubiquitin-like modifier 3											prostate(1)	1				Colorectal(79;0.058)		GGAACACGTCGATGGTGTCCT	0.607																																																	0													79.0	67.0	71.0					21																	46226929		2203	4300	6503	SO:0001583	missense	6612				CCDS33587.1, CCDS68220.1	21q22.3	2013-06-05	2013-06-05	2004-05-19	ENSG00000184900	ENSG00000184900			11124	protein-coding gene	gene with protein product		602231	"""SMT3 (suppressor of mif two 3, yeast) homolog 1"", ""SMT3 suppressor of mif two 3 homolog 3 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 3 (S. cerevisiae)"""	SMT3H1		9119407	Standard	NM_006936		Approved	SMT3A	uc002zfz.1	P55854	OTTHUMG00000090256	ENST00000397898.3:c.299C>T	21.37:g.46226929G>A	ENSP00000380995:p.Ser100Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_SUMO,pfam_Ubiquitin,smart_Ubiquitin	p.S100L	ENST00000397898.3	37	c.299		21	.	.	.	.	.	.	.	.	.	.	G	11.58	1.680950	0.29872	.	.	ENSG00000184900	ENST00000397898	T	0.26223	1.75	5.52	-4.3	0.03710	.	.	.	.	.	T	0.21387	0.0515	.	.	.	0.80722	D	1	B	0.18610	0.029	B	0.08055	0.003	T	0.09250	-1.0683	8	0.72032	D	0.01	.	15.628	0.76878	0.7167:0.0:0.2833:0.0	.	100	A8MUA9	.	L	100	ENSP00000380995:S100L	ENSP00000380995:S100L	S	-	2	0	SUMO3	45051357	0.057000	0.20700	0.678000	0.29963	0.924000	0.55760	-0.760000	0.04756	-0.751000	0.04734	-0.136000	0.14681	TCG	SUMO3	-	NULL		0.607	SUMO3-002	NOVEL	basic|exp_conf	protein_coding	SUMO3	HGNC	protein_coding	OTTHUMT00000206561.1	G			46226929	-1	no_errors	ENST00000397898	ensembl	human	novel	70_37	missense	SNP	0.253	A
SYNE2	23224	genome.wustl.edu	37	14	64469664	64469664	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:64469664C>T	ENST00000344113.4	+	30	4225	c.4013C>T	c.(4012-4014)tCt>tTt	p.S1338F	SYNE2_ENST00000554584.1_Missense_Mutation_p.S1338F|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Missense_Mutation_p.S1338F	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1338					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		GCTAAACTCTCTGCTGAGCCC	0.423																																																	0													64.0	63.0	63.0					14																	64469664		1869	4117	5986	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.4013C>T	14.37:g.64469664C>T	ENSP00000341781:p.Ser1338Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.S1338F	ENST00000344113.4	37	c.4013	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	9.167	1.020235	0.19433	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.59638	0.61;0.62;0.25	5.48	5.48	0.80851	.	0.000000	0.51477	D	0.000084	T	0.71804	0.3383	L	0.53249	1.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.72338	0.95;0.977	T	0.69811	-0.5044	10	0.40728	T	0.16	.	17.5303	0.87813	0.0:1.0:0.0:0.0	.	1338;1338	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	F	1338	ENSP00000350719:S1338F;ENSP00000341781:S1338F;ENSP00000452570:S1338F	ENSP00000261678:S1338F	S	+	2	0	SYNE2	63539417	0.034000	0.19679	0.028000	0.17463	0.008000	0.06430	3.332000	0.52083	2.583000	0.87209	0.591000	0.81541	TCT	SYNE2	-	NULL		0.423	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	C	NM_182914		64469664	+1	no_errors	ENST00000358025	ensembl	human	known	70_37	missense	SNP	0.178	T
SYNE2	23224	genome.wustl.edu	37	14	64473854	64473854	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:64473854C>G	ENST00000344113.4	+	31	4703	c.4491C>G	c.(4489-4491)ttC>ttG	p.F1497L	SYNE2_ENST00000554584.1_Missense_Mutation_p.F1497L|SYNE2_ENST00000357395.3_5'UTR|SYNE2_ENST00000358025.3_Missense_Mutation_p.F1497L	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	1497					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		TTCCACACTTCAAAGATGGCA	0.363																																																	0													174.0	161.0	165.0					14																	64473854		1833	4099	5932	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.4491C>G	14.37:g.64473854C>G	ENSP00000341781:p.Phe1497Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.F1497L	ENST00000344113.4	37	c.4491	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	7.864	0.726614	0.15439	.	.	ENSG00000054654	ENST00000358025;ENST00000344113;ENST00000554584;ENST00000261678	T;T;T	0.31247	1.5;1.5;1.5	5.62	3.71	0.42584	.	0.514144	0.18456	N	0.140681	T	0.21186	0.0510	L	0.38531	1.155	0.24039	N	0.996086	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.13282	-1.0515	10	0.09843	T	0.71	.	11.6369	0.51209	0.1208:0.6751:0.2041:0.0	.	1497;1497	Q8WXH0;Q8WXH0-2	SYNE2_HUMAN;.	L	1497	ENSP00000350719:F1497L;ENSP00000341781:F1497L;ENSP00000452570:F1497L	ENSP00000261678:F1497L	F	+	3	2	SYNE2	63543607	0.000000	0.05858	0.713000	0.30519	0.476000	0.33039	-0.141000	0.10327	2.628000	0.89032	0.655000	0.94253	TTC	SYNE2	-	smart_Spectrin/alpha-actinin		0.363	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	C	NM_182914		64473854	+1	no_errors	ENST00000358025	ensembl	human	known	70_37	missense	SNP	0.257	G
SYNM	23336	genome.wustl.edu	37	15	99670265	99670265	+	Missense_Mutation	SNP	C	C	T	rs3743244	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:99670265C>T	ENST00000560674.1	+	4	1311	c.842C>T	c.(841-843)cCg>cTg	p.P281L	SYNM_ENST00000328642.7_Missense_Mutation_p.P566L|SYNM_ENST00000336292.6_Missense_Mutation_p.P566L|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	567	Coil 2.|Interaction with DMD and UTRN.|Rod.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						AAGGACTCACCGAAGGAGAAG	0.502													C|||	673	0.134385	0.1921	0.196	5008	,	,		20942	0.0496		0.1342	False		,,,				2504	0.1002				Pancreas(125;1071 1762 21750 40003 40381)												0								C	LEU/PRO,LEU/PRO	666,3410		49,568,1421	62.0	65.0	64.0		1699,1699	-9.0	0.0	15	dbSNP_107	64	1267,7119		100,1067,3026	yes	missense,missense	SYNM	NM_145728.2,NM_015286.5	98,98	149,1635,4447	TT,TC,CC		15.1085,16.3395,15.5112	benign,benign	567/1566,567/1254	99670265	1933,10529	2038	4193	6231	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.842C>T	15.37:g.99670265C>T	ENSP00000453040:p.Pro281Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	pfam_F	p.P566L	ENST00000560674.1	37	c.1697		15	292	0.1336996336996337	106	0.21544715447154472	67	0.1850828729281768	19	0.033216783216783216	100	0.13192612137203166	C	4.018	0.000810	0.07819	0.163395	0.151085	ENSG00000182253	ENST00000336292;ENST00000328642	T;T	0.26660	1.72;1.72	5.87	-9.0	0.00747	.	.	.	.	.	T	0.00012	0.0000	.	.	.	0.80722	P	0.0	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.20306	-1.0279	7	0.02654	T	1	.	4.3567	0.11181	0.1725:0.4512:0.1752:0.2011	rs3743244	567;566	O15061;C9JIE4	SYNEM_HUMAN;.	L	566	ENSP00000336775:P566L;ENSP00000330469:P566L	ENSP00000330469:P566L	P	+	2	0	SYNM	97487788	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.999000	0.01467	-1.737000	0.01350	-0.982000	0.02568	CCG	SYNM	-	NULL		0.502	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	HGNC	protein_coding	OTTHUMT00000415698.2	C	NM_145728		99670265	+1	no_errors	ENST00000336292	ensembl	human	known	70_37	missense	SNP	0.000	T
SYNM	23336	genome.wustl.edu	37	15	99671795	99671795	+	Missense_Mutation	SNP	C	C	T	rs5030699	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:99671795C>T	ENST00000560674.1	+	4	2841	c.2372C>T	c.(2371-2373)tCa>tTa	p.S791L	SYNM_ENST00000328642.7_Missense_Mutation_p.S1076L|SYNM_ENST00000336292.6_Missense_Mutation_p.S1076L|RP11-6O2.4_ENST00000566974.1_RNA|SYNM_ENST00000561323.1_3'UTR			O15061	SYNEM_HUMAN	synemin, intermediate filament protein	1077	Tail.				intermediate filament cytoskeleton organization (GO:0045104)	adherens junction (GO:0005912)|costamere (GO:0043034)|intermediate filament (GO:0005882)|membrane (GO:0016020)|neurofilament cytoskeleton (GO:0060053)	intermediate filament binding (GO:0019215)|structural constituent of cytoskeleton (GO:0005200)|structural constituent of muscle (GO:0008307)|vinculin binding (GO:0017166)			NS(1)|breast(1)|central_nervous_system(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(6)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	29						TACATCCCTTCAGGCGAGAGC	0.687													C|||	354	0.0706869	0.0514	0.1556	5008	,	,		17574	0.0288		0.0765	False		,,,				2504	0.0736				Pancreas(125;1071 1762 21750 40003 40381)												0								C	LEU/SER,LEU/SER	200,3882		3,194,1844	18.0	22.0	20.0		3229,3229	4.4	0.0	15	dbSNP_113	20	710,7712		36,638,3537	yes	missense,missense	SYNM	NM_145728.2,NM_015286.5	145,145	39,832,5381	TT,TC,CC		8.4303,4.8996,7.2777	benign,benign	1077/1566,1077/1254	99671795	910,11594	2041	4211	6252	SO:0001583	missense	23336			AK026420	CCDS73786.1, CCDS73787.1	15q26.3	2014-09-17	2008-09-19	2008-09-19	ENSG00000182253	ENSG00000182253		"""A-kinase anchor proteins"", ""Intermediate filaments type IV"""	24466	protein-coding gene	gene with protein product	"""synemin alpha"", ""synemin beta"""	606087	"""desmuslin"""	DMN		11737198, 11454237	Standard	NM_145728		Approved	KIAA0353, SYN	uc002bup.3	O15061		ENST00000560674.1:c.2372C>T	15.37:g.99671795C>T	ENSP00000453040:p.Ser791Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2Y2|Q2TBJ4|Q5NJJ9|Q8TE61|Q8TE62	Missense_Mutation	SNP	pfam_F	p.S1076L	ENST00000560674.1	37	c.3227		15	140	0.0641025641025641	23	0.046747967479674794	47	0.1298342541436464	10	0.017482517482517484	60	0.079155672823219	C	10.17	1.275596	0.23307	0.048996	0.084303	ENSG00000182253	ENST00000336292;ENST00000328642	D;D	0.87334	-2.24;-1.97	5.37	4.45	0.53987	.	.	.	.	.	T	0.05227	0.0139	.	.	.	0.80722	P	0.0	B;P	0.46395	0.061;0.877	B;B	0.40636	0.024;0.335	T	0.58674	-0.7595	7	0.72032	D	0.01	.	13.6198	0.62130	0.0:0.845:0.155:0.0	.	1077;1076	O15061;C9JIE4	SYNEM_HUMAN;.	L	1076	ENSP00000336775:S1076L;ENSP00000330469:S1076L	ENSP00000330469:S1076L	S	+	2	0	SYNM	97489318	0.003000	0.15002	0.001000	0.08648	0.002000	0.02628	1.868000	0.39509	1.233000	0.43693	0.563000	0.77884	TCA	SYNM	-	NULL		0.687	SYNM-003	PUTATIVE	basic|exp_conf	protein_coding	SYNM	HGNC	protein_coding	OTTHUMT00000415698.2	C	NM_145728		99671795	+1	no_errors	ENST00000336292	ensembl	human	known	70_37	missense	SNP	0.003	T
SYT11	23208	genome.wustl.edu	37	1	155838304	155838304	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:155838304G>C	ENST00000368324.4	+	2	836	c.583G>C	c.(583-585)Gac>Cac	p.D195H	SYT11_ENST00000539162.1_Intron	NM_152280.4	NP_689493.3	Q9BT88	SYT11_HUMAN	synaptotagmin XI	195	C2 1. {ECO:0000255|PROSITE- ProRule:PRU00041}.				negative regulation of neurotransmitter secretion (GO:0046929)	cell junction (GO:0030054)|integral component of plasma membrane (GO:0005887)|synaptic vesicle (GO:0008021)	metal ion binding (GO:0046872)|transporter activity (GO:0005215)			breast(2)|central_nervous_system(1)|endometrium(1)|lung(12)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;0.000162)			CCAGGGATCTGACCCCTACAT	0.547																																																	0													83.0	78.0	80.0					1																	155838304		2203	4300	6503	SO:0001583	missense	23208			D38522	CCDS1122.1	1q22	2013-01-21			ENSG00000132718	ENSG00000132718		"""Synaptotagmins"""	19239	protein-coding gene	gene with protein product		608741				11543631	Standard	NM_152280		Approved	KIAA0080, MGC10881, MGC17226, DKFZp781D015	uc001fmg.3	Q9BT88	OTTHUMG00000014105	ENST00000368324.4:c.583G>C	1.37:g.155838304G>C	ENSP00000357307:p.Asp195His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14998|Q5W0D4|Q68CT5|Q8IXU3|Q96SU2	Missense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_Synaptotagmin	p.D195H	ENST00000368324.4	37	c.583	CCDS1122.1	1	.	.	.	.	.	.	.	.	.	.	G	26.8	4.774518	0.90108	.	.	ENSG00000132718	ENST00000368324	T	0.15834	2.39	5.97	5.97	0.96955	C2 membrane targeting protein (1);C2 calcium-dependent membrane targeting (2);C2 calcium/lipid-binding domain, CaLB (1);	0.000000	0.85682	D	0.000000	T	0.58380	0.2118	H	0.98612	4.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.75105	-0.3435	10	0.87932	D	0	.	20.0189	0.97489	0.0:0.0:1.0:0.0	.	195	Q9BT88	SYT11_HUMAN	H	195	ENSP00000357307:D195H	ENSP00000357307:D195H	D	+	1	0	SYT11	154104928	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.835000	0.99442	2.828000	0.97474	0.655000	0.94253	GAC	SYT11	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting		0.547	SYT11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYT11	HGNC	protein_coding	OTTHUMT00000039597.1	G	NM_152280		155838304	+1	no_errors	ENST00000368324	ensembl	human	known	70_37	missense	SNP	1.000	C
TAF10	6881	genome.wustl.edu	37	11	6632183	6632183	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:6632183G>C	ENST00000299424.4	-	5	1104	c.627C>G	c.(625-627)atC>atG	p.I209M	TAF10_ENST00000531760.1_5'Flank|RP11-732A19.2_ENST00000527398.1_RNA	NM_006284.3	NP_006275.1	Q12962	TAF10_HUMAN	TAF10 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 30kDa	209					chromatin organization (GO:0006325)|DNA-templated transcription, initiation (GO:0006352)|gene expression (GO:0010467)|histone deubiquitination (GO:0016578)|histone H3 acetylation (GO:0043966)|protein homooligomerization (GO:0051260)|regulation of transcription, DNA-templated (GO:0006355)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PCAF complex (GO:0000125)|perinuclear region of cytoplasm (GO:0048471)|STAGA complex (GO:0030914)|transcription factor TFIID complex (GO:0005669)|transcription factor TFTC complex (GO:0033276)	enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|RNA polymerase binding (GO:0070063)|transcription coactivator activity (GO:0003713)						Medulloblastoma(188;0.00263)|all_neural(188;0.026)|Breast(177;0.0481)		Epithelial(150;2.9e-09)|BRCA - Breast invasive adenocarcinoma(625;0.129)		TCTTCACATTGATGCCATACT	0.502																																																	0													158.0	138.0	144.0					11																	6632183		2201	4296	6497	SO:0001583	missense	6881			U13991, U25816	CCDS7769.1	11p15.5-p15.2	2006-11-14	2002-08-29	2001-12-07	ENSG00000166337	ENSG00000166337			11543	protein-coding gene	gene with protein product		600475	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, H, 30kD"""	TAF2H, TAF2A		7923369	Standard	NM_006284		Approved	TAFII30	uc001mej.2	Q12962	OTTHUMG00000133402	ENST00000299424.4:c.627C>G	11.37:g.6632183G>C	ENSP00000299424:p.Ile209Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O00703|Q13175|Q6FH13	Missense_Mutation	SNP	pfam_TFIID_30kDa,pirsf_TFIID_30kDa,prints_TFIID_30kDa	p.I209M	ENST00000299424.4	37	c.627	CCDS7769.1	11	.	.	.	.	.	.	.	.	.	.	G	14.62	2.589539	0.46214	.	.	ENSG00000166337	ENST00000299424	T	0.57107	0.42	4.99	4.0	0.46444	.	0.057276	0.64402	D	0.000002	T	0.63815	0.2543	M	0.66506	2.035	0.52099	D	0.99994	D	0.59357	0.985	P	0.57720	0.826	T	0.65635	-0.6120	10	0.52906	T	0.07	-10.2634	12.3685	0.55242	0.0953:0.0:0.9047:0.0	.	209	Q12962	TAF10_HUMAN	M	209	ENSP00000299424:I209M	ENSP00000299424:I209M	I	-	3	3	TAF10	6588759	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	2.859000	0.48364	2.582000	0.87167	0.655000	0.94253	ATC	TAF10	-	pirsf_TFIID_30kDa,prints_TFIID_30kDa		0.502	TAF10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF10	HGNC	protein_coding	OTTHUMT00000257259.2	G	NM_006284		6632183	-1	no_errors	ENST00000299424	ensembl	human	known	70_37	missense	SNP	1.000	C
TBC1D10B	26000	genome.wustl.edu	37	16	30369438	30369438	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:30369438C>G	ENST00000409939.3	-	9	2334	c.2254G>C	c.(2254-2256)Gag>Cag	p.E752Q	RP11-347C12.10_ENST00000563252.1_lincRNA|CD2BP2_ENST00000305596.3_5'Flank	NM_015527.3	NP_056342.3	Q4KMP7	TB10B_HUMAN	TBC1 domain family, member 10B	752					positive regulation of Rab GTPase activity (GO:0032851)|regulation of Rab GTPase activity (GO:0032313)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(1)|lung(2)|urinary_tract(1)	6			Colorectal(24;0.193)			ttctctcgctctttctcctgc	0.587																																																	0													163.0	117.0	133.0					16																	30369438		1987	3851	5838	SO:0001583	missense	26000			BC063112	CCDS10676.2	16p11.2	2013-07-09			ENSG00000169221	ENSG00000169221			24510	protein-coding gene	gene with protein product		613620				20404108	Standard	NM_015527		Approved	DKFZP434P1750, Rab27A-GAPbeta, FLJ13130, EPI64B	uc002dxt.3	Q4KMP7	OTTHUMG00000132396	ENST00000409939.3:c.2254G>C	16.37:g.30369438C>G	ENSP00000386538:p.Glu752Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B9A6L0|Q6IN54|Q6P530|Q71RG7|Q86VC5|Q9H8Z2|Q9NUN6|Q9UFP2	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E752Q	ENST00000409939.3	37	c.2254	CCDS10676.2	16	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141117	0.37825	.	.	ENSG00000169221	ENST00000409939	T	0.65178	-0.14	3.11	3.11	0.35812	.	0.115701	0.29783	N	0.011208	T	0.64057	0.2564	L	0.32530	0.975	0.44168	D	0.996973	D	0.76494	0.999	P	0.61275	0.886	T	0.60125	-0.7324	10	0.23302	T	0.38	.	13.7686	0.63010	0.0:1.0:0.0:0.0	.	752	Q4KMP7	TB10B_HUMAN	Q	752	ENSP00000386538:E752Q	ENSP00000386538:E752Q	E	-	1	0	TBC1D10B	30276939	0.999000	0.42202	0.969000	0.41365	0.478000	0.33099	4.618000	0.61211	1.691000	0.51100	0.313000	0.20887	GAG	TBC1D10B	-	NULL		0.587	TBC1D10B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D10B	HGNC	protein_coding	OTTHUMT00000255527.3	C	NM_015527		30369438	-1	no_errors	ENST00000409939	ensembl	human	known	70_37	missense	SNP	1.000	G
TBC1D3P1-DHX40P1	653645	genome.wustl.edu	37	17	58085852	58085852	+	lincRNA	SNP	T	T	C	rs201705592	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:58085852T>C	ENST00000407042.3	-	0	1584									TBC1D3P1-DHX40P1 readthrough transcribed pseudogene																		AGAGGCAAGGTCCTGAGGTGG	0.602																																																	0																																												653645					17q23.1	2014-09-10	2012-12-07		ENSG00000267104	ENSG00000267104			42362	other	readthrough			"""TBC1D3P1-DHX40P1 readthrough (non-protein coding)"""				Standard	NR_002924		Approved		uc002iyf.2		OTTHUMG00000179977		17.37:g.58085852T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000407042.3	37	NULL		17																																																																																			TBC1D3P1-DHX40P1	-	-		0.602	TBC1D3P1-DHX40P1-201	KNOWN	basic	lincRNA	TBC1D3P1-DHX40P1	HGNC	lincRNA		T	NR_002924		58085852	-1	no_errors	ENST00000407042	ensembl	human	known	70_37	rna	SNP	0.130	C
TBC1D16	125058	genome.wustl.edu	37	17	77984012	77984012	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:77984012G>A	ENST00000310924.2	-	3	841	c.726C>T	c.(724-726)atC>atT	p.I242I		NM_001271844.1|NM_001271845.1|NM_019020.2	NP_001258773.1|NP_001258774.1|NP_061893.2	Q8TBP0	TBC16_HUMAN	TBC1 domain family, member 16	242	Ser-rich.						Rab GTPase activator activity (GO:0005097)			NS(1)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(3)	28	all_neural(118;0.167)		OV - Ovarian serous cystadenocarcinoma(97;0.00739)|BRCA - Breast invasive adenocarcinoma(99;0.0819)			GCGCCGCGCTGATGGGCGAGA	0.637																																					Ovarian(14;397 562 4850 31922 49378)												0													42.0	43.0	43.0					17																	77984012		2203	4300	6503	SO:0001819	synonymous_variant	125058			AL157485	CCDS11766.1, CCDS62351.1, CCDS62352.1, CCDS62353.1	17q25.3	2013-07-10				ENSG00000167291			28356	protein-coding gene	gene with protein product						23019362	Standard	NM_019020		Approved	MGC25062, FLJ20748	uc002jxj.4	Q8TBP0		ENST00000310924.2:c.726C>T	17.37:g.77984012G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9A6L7|I3L1E0|I3L4U2|Q8N3Z4|Q96DH7	Silent	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.I242	ENST00000310924.2	37	c.726	CCDS11766.1	17																																																																																			TBC1D16	-	NULL		0.637	TBC1D16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D16	HGNC	protein_coding	OTTHUMT00000437145.1	G	NM_019020		77984012	-1	no_errors	ENST00000310924	ensembl	human	known	70_37	silent	SNP	1.000	A
TCERG1	10915	genome.wustl.edu	37	5	145843128	145843128	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:145843128G>T	ENST00000296702.5	+	5	945	c.907G>T	c.(907-909)Gat>Tat	p.D303Y	TCERG1_ENST00000394421.2_Missense_Mutation_p.D303Y	NM_006706.3	NP_006697.2	O14776	TCRG1_HUMAN	transcription elongation regulator 1	303	Thr-rich.				negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II repressing transcription factor binding (GO:0001103)|RNA polymerase II transcription corepressor activity (GO:0001106)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(3)|endometrium(5)|kidney(4)|large_intestine(18)|lung(9)|ovary(2)|prostate(3)|skin(1)	46		Lung NSC(249;0.00188)|all_lung(500;0.00307)|all_neural(839;0.0424)|Breast(839;0.0743)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CACAACACAAGATCAGACCCC	0.408																																																	0													196.0	194.0	195.0					5																	145843128		2203	4300	6503	SO:0001583	missense	10915			AF017789	CCDS4282.1, CCDS43379.1	5q31	2010-01-25	2002-01-24	2002-01-25	ENSG00000113649	ENSG00000113649			15630	protein-coding gene	gene with protein product	"""transcription factor CA150"", ""co-activator of 150 kDa"", ""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"", ""TATA box-binding protein-associated factor 2S"""	605409	"""TATA box binding protein (TBP)-associated factor, RNA polymerase II, S, 150kD"""	TAF2S		9315662, 11003711	Standard	XM_005268365		Approved	CA150, Urn1	uc003lob.3	O14776	OTTHUMG00000129683	ENST00000296702.5:c.907G>T	5.37:g.145843128G>T	ENSP00000296702:p.Asp303Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKN2|Q59EA1	Missense_Mutation	SNP	pfam_FF_domain,pfam_WW_Rsp5_WWP,superfamily_FF_domain,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_FF_domain,pfscan_WW_Rsp5_WWP	p.D303Y	ENST00000296702.5	37	c.907	CCDS4282.1	5	.	.	.	.	.	.	.	.	.	.	G	15.08	2.728541	0.48833	.	.	ENSG00000113649	ENST00000296702;ENST00000394421	T;T	0.29655	1.56;1.56	5.39	5.39	0.77823	.	0.218926	0.39407	N	0.001372	T	0.34513	0.0900	N	0.22421	0.69	0.39701	D	0.971186	P;P;P	0.50943	0.94;0.736;0.617	P;P;B	0.50708	0.543;0.648;0.446	T	0.19128	-1.0315	10	0.59425	D	0.04	-6.6899	19.1351	0.93424	0.0:0.0:1.0:0.0	.	303;303;303	B7Z921;O14776-2;O14776	.;.;TCRG1_HUMAN	Y	303	ENSP00000296702:D303Y;ENSP00000377943:D303Y	ENSP00000296702:D303Y	D	+	1	0	TCERG1	145823321	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.778000	0.75043	2.506000	0.84524	0.563000	0.77884	GAT	TCERG1	-	NULL		0.408	TCERG1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TCERG1	HGNC	protein_coding	OTTHUMT00000251886.1	G	NM_001040006		145843128	+1	no_errors	ENST00000296702	ensembl	human	known	70_37	missense	SNP	1.000	T
TDRG1	732253	genome.wustl.edu	37	6	40347108	40347109	+	RNA	INS	-	-	T	rs200906954	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:40347108_40347109insT	ENST00000373170.2	+	0	649_650				TDRG1_ENST00000448433.1_RNA|TDRG1_ENST00000451810.1_RNA|TDRG1_ENST00000448559.1_RNA	NR_024015.1		Q3Y452	TDRG1_HUMAN	testis development related 1 (non-protein coding)						multicellular organismal development (GO:0007275)	cytoplasm (GO:0005737)											GGGAAGCCCCCCCACCCCTTAG	0.525													-|-|T|insertion	19	0.00379393	0.0008	0.013	5008	,	,		16290	0.0		0.0089	False		,,,				2504	0.0																0																																												732253			DQ168992		6p21.2	2014-07-18	2011-12-13		ENSG00000204091	ENSG00000204091		"""-"""	43642	non-coding RNA	RNA, long non-coding	"""long intergenic non-protein coding RNA 532"""	615676				19403381, 22123530, 24595048	Standard	NR_024015		Approved	LINC00532	uc003opg.2		OTTHUMG00000014660		6.37:g.40347108_40347109insT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000373170.2	37	NULL		6																																																																																			TDRG1	-	-		0.525	TDRG1-002	KNOWN	basic	antisense	TDRG1	HGNC	antisense	OTTHUMT00000040484.1	-	NR_024015		40347109	+1	no_errors	ENST00000373170	ensembl	human	known	70_37	rna	INS	0.000:0.000	T
TEF	7008	genome.wustl.edu	37	22	41783471	41783471	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:41783471G>A	ENST00000266304.4	+	2	390	c.274G>A	c.(274-276)Gaa>Aaa	p.E92K	TEF_ENST00000406644.3_Missense_Mutation_p.E62K	NM_003216.3	NP_003207.1	Q10587	TEF_HUMAN	thyrotrophic embryonic factor	92					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|rhythmic process (GO:0048511)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.E92K(1)		kidney(1)|large_intestine(2)|lung(2)|ovary(1)	6						ATATGATGGCGAATCTTTCCA	0.612																																																	1	Substitution - Missense(1)	kidney(1)											132.0	118.0	123.0					22																	41783471		2203	4300	6503	SO:0001583	missense	7008				CCDS14014.1, CCDS46716.1	22q13.2	2013-01-10			ENSG00000167074	ENSG00000167074		"""basic leucine zipper proteins"""	11722	protein-coding gene	gene with protein product		188595				7835883, 15665112	Standard	NM_001145398		Approved	KIAA1655	uc003azy.4	Q10587	OTTHUMG00000150968	ENST00000266304.4:c.274G>A	22.37:g.41783471G>A	ENSP00000266304:p.Glu92Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QYS8|B2RC22|Q15729|Q7Z3J7|Q8IU94|Q96TG4	Missense_Mutation	SNP	pfam_bZIP,smart_bZIP,pfscan_bZIP	p.E92K	ENST00000266304.4	37	c.274	CCDS14014.1	22	.	.	.	.	.	.	.	.	.	.	G	28.7	4.943185	0.92526	.	.	ENSG00000167074	ENST00000406644;ENST00000433913;ENST00000266304	.	.	.	5.56	5.56	0.83823	.	0.047301	0.85682	D	0.000000	T	0.72366	0.3451	L	0.46157	1.445	0.80722	D	1	D;D;D	0.71674	0.995;0.998;0.998	P;P;P	0.59171	0.727;0.825;0.853	T	0.74256	-0.3724	9	0.72032	D	0.01	-37.9878	19.5275	0.95212	0.0:0.0:1.0:0.0	.	97;92;62	B4DIH3;Q10587;Q10587-2	.;TEF_HUMAN;.	K	62;62;92	.	ENSP00000266304:E92K	E	+	1	0	TEF	40113417	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	8.003000	0.88520	2.616000	0.88540	0.563000	0.77884	GAA	TEF	-	NULL		0.612	TEF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEF	HGNC	protein_coding	OTTHUMT00000320692.1	G	NM_003216		41783471	+1	no_errors	ENST00000266304	ensembl	human	known	70_37	missense	SNP	1.000	A
TFB2M	64216	genome.wustl.edu	37	1	246729346	246729346	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:246729346G>C	ENST00000366514.4	-	1	280	c.95C>G	c.(94-96)aCg>aGg	p.T32R	TFB2M_ENST00000544618.1_Missense_Mutation_p.T32R|CNST_ENST00000366512.3_5'Flank|CNST_ENST00000366513.4_5'Flank	NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	32					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			ATGCTTTCGCGTCGCCGCTTC	0.622																																																	0													41.0	46.0	44.0					1																	246729346		2203	4300	6503	SO:0001583	missense	64216			AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.95C>G	1.37:g.246729346G>C	ENSP00000355471:p.Thr32Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H626	Missense_Mutation	SNP	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur	p.T32R	ENST00000366514.4	37	c.95	CCDS1627.1	1	.	.	.	.	.	.	.	.	.	.	G	6.069	0.381093	0.11466	.	.	ENSG00000162851	ENST00000366514;ENST00000544618	T	0.30981	1.51	3.92	-1.24	0.09435	.	1.309040	0.04960	N	0.461991	T	0.10937	0.0267	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.18085	-1.0348	10	0.02654	T	1	-4.4524	0.5356	0.00636	0.2073:0.1718:0.2349:0.386	.	32	Q9H5Q4	TFB2M_HUMAN	R	32	ENSP00000355471:T32R	ENSP00000355471:T32R	T	-	2	0	TFB2M	244795969	0.000000	0.05858	0.000000	0.03702	0.080000	0.17528	-0.089000	0.11180	-0.230000	0.09840	-0.362000	0.07510	ACG	TFB2M	-	pirsf_Mt_di-Me-Ado_Trfase_2_prcur		0.622	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFB2M	HGNC	protein_coding	OTTHUMT00000096673.1	G	NM_022366		246729346	-1	no_errors	ENST00000366514	ensembl	human	known	70_37	missense	SNP	0.000	C
THSD7B	80731	genome.wustl.edu	37	2	137852605	137852605	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:137852605G>A	ENST00000409968.1	+	4	1291	c.1113G>A	c.(1111-1113)atG>atA	p.M371I	THSD7B_ENST00000413152.2_Missense_Mutation_p.M340I|THSD7B_ENST00000543459.1_Missense_Mutation_p.M230I|THSD7B_ENST00000272643.3_Missense_Mutation_p.M371I			Q9C0I4	THS7B_HUMAN	thrombospondin, type I, domain containing 7B	371	TSP type-1 4. {ECO:0000255|PROSITE- ProRule:PRU00210}.					integral component of membrane (GO:0016021)		p.M340I(1)|p.M371I(1)		NS(3)|breast(3)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(14)|lung(57)|ovary(4)|pancreas(3)|prostate(11)|skin(4)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(3)	134				BRCA - Breast invasive adenocarcinoma(221;0.19)		TGAAGCACATGGCTATTGGAG	0.527																																																	2	Substitution - Missense(2)	lung(2)											90.0	98.0	95.0					2																	137852605		1940	4148	6088	SO:0001583	missense	80731					2q22.1	2006-11-24			ENSG00000144229	ENSG00000144229			29348	protein-coding gene	gene with protein product						11214970	Standard	NM_001080427		Approved	KIAA1679	uc002tva.1	Q9C0I4	OTTHUMG00000153590	ENST00000409968.1:c.1113G>A	2.37:g.137852605G>A	ENSP00000387145:p.Met371Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt	p.M371I	ENST00000409968.1	37	c.1113		2	.	.	.	.	.	.	.	.	.	.	g	2.364	-0.346024	0.05208	.	.	ENSG00000144229	ENST00000409968;ENST00000272643;ENST00000413152;ENST00000543459	T;T;T;T	0.52983	0.64;0.64;0.64;0.64	5.84	-0.84	0.10755	.	0.742587	0.13888	N	0.355824	T	0.14313	0.0346	N	0.01417	-0.88	0.18873	N	0.999983	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.17198	-1.0377	10	0.25751	T	0.34	.	2.4179	0.04440	0.1026:0.1892:0.3444:0.3637	.	371;340	Q9C0I4;C9JKN6	THS7B_HUMAN;.	I	371;371;340;230	ENSP00000387145:M371I;ENSP00000272643:M371I;ENSP00000413841:M340I;ENSP00000443370:M230I	ENSP00000272643:M371I	M	+	3	0	THSD7B	137569075	0.985000	0.35326	0.018000	0.16275	0.541000	0.35023	0.230000	0.17852	-0.364000	0.08088	-1.499000	0.00960	ATG	THSD7B	-	pfam_Thrombospondin_1_rpt,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.527	THSD7B-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	THSD7B	HGNC	protein_coding	OTTHUMT00000331769.2	G	XM_046570.9		137852605	+1	no_errors	ENST00000272643	ensembl	human	known	70_37	missense	SNP	0.427	A
TIGD6	81789	genome.wustl.edu	37	5	149374880	149374880	+	Frame_Shift_Del	DEL	T	T	-	rs397756704|rs3832324|rs201139146	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:149374880delT	ENST00000296736.3	-	2	1806	c.1032delA	c.(1030-1032)caafs	p.Q344fs	TIGD6_ENST00000515406.2_Frame_Shift_Del_p.Q344fs	NM_030953.3	NP_112215.1	Q17RP2	TIGD6_HUMAN	tigger transposable element derived 6	344	DDE.					nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(2)|ovary(2)|prostate(1)|stomach(1)	10			KIRC - Kidney renal clear cell carcinoma(527;0.000962)|Kidney(363;0.00147)			CCACCTCTTCTTGATCCTCAC	0.502													TT|TT|T|deletion	2598	0.51877	0.3616	0.4813	5008	,	,		23962	0.5853		0.6074	False		,,,				2504	0.5982																0										1735,2529		362,1011,759	98.0	51.0	67.0			2.2	0.0	5	dbSNP_130	135	5379,2875		1759,1861,507	yes	frameshift	TIGD6	NM_030953.3		2121,2872,1266	A1A1,A1R,RR		34.8316,40.6895,43.1698			149374880	7114,5404	2168	4015	6183	SO:0001589	frameshift_variant	81789			AK056604	CCDS4301.1	5q33.1	2008-02-05			ENSG00000164296	ENSG00000164296			18332	protein-coding gene	gene with protein product						11230166	Standard	NM_030953		Approved	DKFZp761E2110	uc003lrj.3	Q17RP2	OTTHUMG00000130045	ENST00000296736.3:c.1032delA	5.37:g.149374880delT	ENSP00000296736:p.Gln344fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTZ8|Q96MQ4|Q9H0X7	Frame_Shift_Del	DEL	pfam_DDE_SF_endonuclease_CENPB-like,pfam_HTH_CenpB_DNA-bd_dom,pfam_HTH_Psq,superfamily_Homeodomain-like,smart_HTH_CenpB_DNA-bd_dom,pfscan_HTH_Psq	p.E345fs	ENST00000296736.3	37	c.1032	CCDS4301.1	5																																																																																			TIGD6	-	pfam_DDE_SF_endonuclease_CENPB-like		0.502	TIGD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGD6	HGNC	protein_coding	OTTHUMT00000252324.1	T	NM_030953		149374880	-1	no_errors	ENST00000296736	ensembl	human	known	70_37	frame_shift_del	DEL	0.000	-
TJP1	7082	genome.wustl.edu	37	15	30018627	30018627	+	Missense_Mutation	SNP	T	T	C	rs2229515	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:30018627T>C	ENST00000346128.6	-	18	2842	c.2368A>G	c.(2368-2370)Att>Gtt	p.I790V	TJP1_ENST00000400011.2_Missense_Mutation_p.I794V|RP11-680F8.4_ENST00000560740.1_RNA|TJP1_ENST00000545208.2_Missense_Mutation_p.I790V|TJP1_ENST00000356107.6_Missense_Mutation_p.I790V	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	790			I -> V (in dbSNP:rs7179270). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:8395056, ECO:0000269|Ref.3}.		apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		TGTTGTTGAATTGCTTCTTTC	0.353													T|||	710	0.141773	0.0582	0.2003	5008	,	,		19009	0.124		0.1262	False		,,,				2504	0.2474				Melanoma(77;681 1843 6309 6570)												0								T	VAL/ILE,VAL/ILE	259,3443		10,239,1602	108.0	102.0	104.0		2368,2368	3.5	0.9	15	dbSNP_116	104	902,7290		51,800,3245	yes	missense,missense	TJP1	NM_003257.3,NM_175610.2	29,29	61,1039,4847	CC,CT,TT		11.0107,6.9962,9.7612	possibly-damaging,possibly-damaging	790/1749,790/1669	30018627	1161,10733	1851	4096	5947	SO:0001583	missense	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.2368A>G	15.37:g.30018627T>C	ENSP00000281537:p.Ile790Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.I790V	ENST00000346128.6	37	c.2368	CCDS42007.1	15	241	0.11034798534798534	33	0.06707317073170732	64	0.17679558011049723	62	0.10839160839160839	82	0.10817941952506596	T	17.10	3.303927	0.60305	0.069962	0.110107	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.20598	2.06;2.06;2.06;2.06	5.82	3.52	0.40303	Guanylate kinase/L-type calcium channel (1);Guanylate kinase (2);	0.148108	0.64402	N	0.000011	T	0.00073	0.0002	L	0.58302	1.8	0.09310	P	0.9999999999999991	P;P;P;B	0.40834	0.541;0.633;0.73;0.004	P;B;P;B	0.53518	0.522;0.324;0.728;0.006	T	0.06752	-1.0809	8	.	.	.	.	8.452	0.32877	0.0:0.2098:0.0:0.7902	rs7179270;rs60430516;rs7179270	783;790;790;794	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	V	790;794;790;790;790	ENSP00000281537:I790V;ENSP00000382890:I794V;ENSP00000441202:I790V;ENSP00000348416:I790V	.	I	-	1	0	TJP1	27805919	1.000000	0.71417	0.852000	0.33557	0.776000	0.43924	2.833000	0.48159	0.475000	0.27415	0.533000	0.62120	ATT	TJP1	-	pfam_Guanylate_kin,smart_Guanylate_kin/L-typ_Ca_channel,pfscan_Guanylate_kin		0.353	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	T	NM_003257		30018627	-1	no_errors	ENST00000346128	ensembl	human	known	70_37	missense	SNP	0.976	C
TLR7	51284	genome.wustl.edu	37	X	12903659	12903659	+	Missense_Mutation	SNP	A	A	T	rs179008	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:12903659A>T	ENST00000380659.3	+	3	171	c.32A>T	c.(31-33)cAa>cTa	p.Q11L		NM_016562.3	NP_057646.1	Q9NYK1	TLR7_HUMAN	toll-like receptor 7	11			Q -> L (in dbSNP:rs179008). {ECO:0000269|PubMed:19924287}.		cellular response to mechanical stimulus (GO:0071260)|defense response to virus (GO:0051607)|I-kappaB phosphorylation (GO:0007252)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|microglial cell activation involved in immune response (GO:0002282)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|pathogen-associated molecular pattern dependent induction by symbiont of host innate immune response (GO:0052033)|positive regulation of chemokine production (GO:0032722)|positive regulation of inflammatory response (GO:0050729)|positive regulation of interferon-alpha biosynthetic process (GO:0045356)|positive regulation of interferon-beta biosynthetic process (GO:0045359)|positive regulation of interferon-gamma biosynthetic process (GO:0045078)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of interleukin-8 biosynthetic process (GO:0045416)|positive regulation of interleukin-8 production (GO:0032757)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	cytoplasm (GO:0005737)|early phagosome (GO:0032009)|endolysosome membrane (GO:0036020)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|endosome membrane (GO:0010008)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	double-stranded RNA binding (GO:0003725)|drug binding (GO:0008144)|single-stranded RNA binding (GO:0003727)|siRNA binding (GO:0035197)|transmembrane signaling receptor activity (GO:0004888)			NS(1)|breast(4)|endometrium(5)|kidney(1)|large_intestine(8)|lung(18)|ovary(2)|pancreas(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	44					Hydroxychloroquine(DB01611)|Imiquimod(DB00724)	CTGAAGAGACAAATTCTTATC	0.358													A|||	446	0.118146	0.0908	0.1599	3775	,	,		14565	0.0		0.1759	False		,,,				2504	0.0389																0			GRCh37	CM084786	TLR7	M	rs179008	A	LEU/GLN	521,3314		25,397,74,1210,497	129.0	129.0	129.0		32	-5.4	0.0	X	dbSNP_79	129	1429,5299		98,792,441,1538,1431	yes	missense	TLR7	NM_016562.3	113	123,1189,515,2748,1928	TT,TA,T,AA,A		21.2396,13.5854,18.4607	benign	11/1050	12903659	1950,8613	2203	4300	6503	SO:0001583	missense	51284			AF240467	CCDS14151.1	Xp22.3	2008-02-05			ENSG00000196664	ENSG00000196664			15631	protein-coding gene	gene with protein product		300365				11022119	Standard	NM_016562		Approved		uc004cvc.3	Q9NYK1	OTTHUMG00000021137	ENST00000380659.3:c.32A>T	X.37:g.12903659A>T	ENSP00000370034:p.Gln11Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D1CS69|Q9NR98	Missense_Mutation	SNP	pfam_Leu-rich_rpt,pfam_TIR_dom,superfamily_TIR_dom,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_TIR_dom,pfscan_TIR_dom	p.Q11L	ENST00000380659.3	37	c.32	CCDS14151.1	X	253	0.1525015069318867	34	0.0735930735930736	38	0.1165644171779141	0	0.0	110	0.16224188790560473	A	8.200	0.797989	0.16327	0.135854	0.212396	ENSG00000196664	ENST00000380659	T	0.46819	0.86	5.72	-5.42	0.02640	.	0.888102	0.09632	N	0.776072	T	0.00012	0.0000	L	0.29908	0.895	0.80722	P	0.0	B	0.02656	0.0	B	0.01281	0.0	T	0.24657	-1.0154	9	0.37606	T	0.19	.	1.4567	0.02387	0.262:0.3564:0.1455:0.2361	rs179008;rs629938;rs17256060;rs179008	11	Q9NYK1	TLR7_HUMAN	L	11	ENSP00000370034:Q11L	ENSP00000370034:Q11L	Q	+	2	0	TLR7	12813580	0.000000	0.05858	0.000000	0.03702	0.519000	0.34347	0.053000	0.14184	-0.637000	0.05516	0.421000	0.28195	CAA	TLR7	-	NULL		0.358	TLR7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLR7	HGNC	protein_coding	OTTHUMT00000055769.1	A	NM_016562		12903659	+1	no_errors	ENST00000380659	ensembl	human	known	70_37	missense	SNP	0.000	T
TLX3	30012	genome.wustl.edu	37	5	170737337	170737337	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:170737337C>T	ENST00000296921.5	+	2	687	c.605C>T	c.(604-606)tCc>tTc	p.S202F		NM_021025.2	NP_066305.2	O43711	TLX3_HUMAN	T-cell leukemia homeobox 3	202					central nervous system development (GO:0007417)|negative regulation of neuron differentiation (GO:0045665)|neuron fate specification (GO:0048665)|neuron migration (GO:0001764)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of transcription, DNA-templated (GO:0006355)|respiratory gaseous exchange (GO:0007585)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			central_nervous_system(1)	1	Renal(175;0.000159)|Lung NSC(126;0.00576)|all_lung(126;0.00963)	Medulloblastoma(196;0.0399)|all_neural(177;0.0966)	Kidney(164;7.24e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000516)			CTCGCCAAGTCCCTCAAAATG	0.632			T	BCL11B	T-ALL																																Esophageal Squamous(33;43 807 3116 3348 30094)			Dom	yes		5	5q35.1	30012	"""T-cell leukemia, homeobox 3 (HOX11L2)"""		L	0													31.0	30.0	30.0					5																	170737337		2202	4300	6502	SO:0001583	missense	30012			AJ223798	CCDS34288.1	5q35.1	2011-06-20	2005-12-22	2002-05-31	ENSG00000164438	ENSG00000164438		"""Homeoboxes / ANTP class : NKL subclass"""	13532	protein-coding gene	gene with protein product		604640	"""homeo box 11-like 2"", ""T-cell leukemia, homeobox 3"""	HOX11L2		11435718, 11435716	Standard	NM_021025		Approved	RNX	uc003mbf.3	O43711	OTTHUMG00000163207	ENST00000296921.5:c.605C>T	5.37:g.170737337C>T	ENSP00000296921:p.Ser202Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AD3	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.S202F	ENST00000296921.5	37	c.605	CCDS34288.1	5	.	.	.	.	.	.	.	.	.	.	C	23.0	4.366423	0.82463	.	.	ENSG00000164438	ENST00000296921	D	0.96396	-4.0	4.46	4.46	0.54185	Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);Homeobox, conserved site (1);	0.104602	0.64402	D	0.000003	D	0.97346	0.9132	M	0.69248	2.105	0.58432	D	0.999998	P	0.52463	0.953	P	0.62649	0.905	D	0.97125	0.9814	10	0.39692	T	0.17	.	16.7192	0.85406	0.0:1.0:0.0:0.0	.	202	O43711	TLX3_HUMAN	F	202	ENSP00000296921:S202F	ENSP00000296921:S202F	S	+	2	0	TLX3	170669942	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.856000	0.62932	2.027000	0.59764	0.505000	0.49811	TCC	TLX3	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.632	TLX3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	TLX3	HGNC	protein_coding	OTTHUMT00000372076.3	C			170737337	+1	no_errors	ENST00000296921	ensembl	human	known	70_37	missense	SNP	1.000	T
RNF212	285498	genome.wustl.edu	37	4	1109039	1109039	+	5'Flank	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:1109039G>A	ENST00000433731.2	-	0	0				RNF212_ENST00000505730.1_5'Flank|RNF212_ENST00000333673.5_5'Flank|RP11-20I20.2_ENST00000504969.1_RNA|RNF212_ENST00000382968.5_5'Flank|TMED11P_ENST00000502630.1_RNA			Q495C1	RN212_HUMAN	ring finger protein 212						chiasma assembly (GO:0051026)|meiotic gene conversion (GO:0006311)|protein sumoylation (GO:0016925)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(1)|skin(1)	10			OV - Ovarian serous cystadenocarcinoma(23;0.0179)	UCEC - Uterine corpus endometrioid carcinoma (64;0.151)		TGTCCTTATTGATAATATTTT	0.274																																																	0																																										SO:0001631	upstream_gene_variant	100379220			AK096160	CCDS3345.1, CCDS46996.1, CCDS54704.1	4p16.3	2013-02-27	2007-01-19	2007-01-19	ENSG00000178222	ENSG00000178222		"""RING-type (C3HC4) zinc fingers"""	27729	protein-coding gene	gene with protein product		612041	"""hypothetical protein LOC285498"""	LOC285498		23396135	Standard	NM_001131034		Approved	FLJ38841	uc003gcj.3	Q495C1	OTTHUMG00000118997		4.37:g.1109039G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J8N0|Q495C0|Q86W82|Q8IY99|Q8N8U7	RNA	SNP	-	NULL	ENST00000433731.2	37	NULL	CCDS46996.1	4																																																																																			TMED11P	-	-		0.274	RNF212-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMED11P	HGNC	protein_coding	OTTHUMT00000359124.2	G	NM_194439		1109039	-1	no_errors	ENST00000502630	ensembl	human	known	70_37	rna	SNP	0.000	A
TMEM150B	284417	genome.wustl.edu	37	19	55824298	55824298	+	Silent	SNP	G	G	A	rs201710040	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:55824298G>A	ENST00000326652.4	-	8	813	c.631C>T	c.(631-633)Ctg>Ttg	p.L211L	TMEM150B_ENST00000438693.1_Silent_p.L211L|CTD-2105E13.14_ENST00000596786.1_RNA	NM_001282011.1	NP_001268940.1	A6NC51	T150B_HUMAN	transmembrane protein 150B	211						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)	3						TGAACACACAGGGTGCAGCTC	0.687													G|||	11	0.00219649	0.0	0.0014	5008	,	,		13386	0.0		0.004	False		,,,				2504	0.0061																0								G		7,4241		0,7,2117	22.0	28.0	26.0		631	2.4	0.9	19		26	46,8434		0,46,4194	no	coding-synonymous	TMEM150B	NM_001085488.1		0,53,6311	AA,AG,GG		0.5425,0.1648,0.4164		211/234	55824298	53,12675	2124	4240	6364	SO:0001819	synonymous_variant	284417			BC020862	CCDS42629.1	19q13.42	2009-06-12	2009-06-12	2009-06-12		ENSG00000180061			34415	protein-coding gene	gene with protein product			"""transmembrane protein 224"""	TMEM224			Standard	XM_005258812		Approved		uc010esw.1	A6NC51		ENST00000326652.4:c.631C>T	19.37:g.55824298G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZW71	Silent	SNP	pfam_Frag1/DRAM/Sfk1	p.L211	ENST00000326652.4	37	c.631	CCDS42629.1	19																																																																																			TMEM150B	-	NULL		0.687	TMEM150B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM150B	HGNC	protein_coding	OTTHUMT00000452685.1	G	NM_001085488		55824298	-1	no_errors	ENST00000326652	ensembl	human	known	70_37	silent	SNP	0.992	A
TMEM165	55858	genome.wustl.edu	37	4	56291621	56291622	+	3'UTR	DEL	AA	AA	-	rs35154686	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	AA	AA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:56291621_56291622delAA	ENST00000381334.5	+	0	1210_1211				TMEM165_ENST00000506198.1_3'UTR|TMEM165_ENST00000542052.1_3'UTR|TMEM165_ENST00000514904.1_3'UTR	NM_018475.4	NP_060945.2	Q9HC07	TM165_HUMAN	transmembrane protein 165						cellular calcium ion homeostasis (GO:0006874)|Golgi calcium ion transport (GO:0032472)|protein N-linked glycosylation (GO:0006487)|regulation of lysosomal lumen pH (GO:0035751)	endosome membrane (GO:0010008)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|trans-Golgi network membrane (GO:0032588)				endometrium(1)|kidney(1)|large_intestine(2)	4	Lung NSC(11;0.00545)|Glioma(25;0.08)|all_neural(26;0.101)|all_epithelial(27;0.135)		LUSC - Lung squamous cell carcinoma(4;1.62e-07)|Lung(4;1.34e-06)|Epithelial(7;0.0103)			GGTTTTTAACAAGCTGTTTGTT	0.312														1780	0.355431	0.1604	0.4236	5008	,	,		18473	0.5714		0.2982	False		,,,				2504	0.407																0										828,3438		86,656,1391						-1.2	0.1		dbSNP_126	178	2465,5783		372,1721,2031	no	utr-3	TMEM165	NM_018475.3		458,2377,3422	A1A1,A1R,RR		29.886,19.4093,26.3145				3293,9221				SO:0001624	3_prime_UTR_variant	55858			AF183409	CCDS3499.1	4q12	2014-03-13			ENSG00000134851	ENSG00000134851			30760	protein-coding gene	gene with protein product	"""TPA regulated locus"""	614726				3202867, 22683087, 23575229	Standard	NM_018475		Approved	TMPT27, TPARL, GDT1	uc003hax.3	Q9HC07	OTTHUMG00000128735	ENST00000381334.5:c.*3AA>-	4.37:g.56291621_56291622delAA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3P8|B4DHW1|Q9BTN9|Q9NZ34	RNA	DEL	-	NULL	ENST00000381334.5	37	NULL	CCDS3499.1	4																																																																																			TMEM165	-	-		0.312	TMEM165-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM165	HGNC	protein_coding	OTTHUMT00000250646.4	AA	NM_018475		56291622	+1	no_errors	ENST00000508561	ensembl	human	known	70_37	rna	DEL	0.010:0.001	-
TMEM2	23670	genome.wustl.edu	37	9	74360096	74360096	+	Missense_Mutation	SNP	C	C	T	rs25689	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:74360096C>T	ENST00000377044.4	-	4	1411	c.872G>A	c.(871-873)cGc>cAc	p.R291H	TMEM2_ENST00000377066.5_Missense_Mutation_p.R291H	NM_001135820.1|NM_013390.2	NP_001129292.1|NP_037522.1	Q9UHN6	TMEM2_HUMAN	transmembrane protein 2	291			R -> H (in dbSNP:rs25689).|R -> L (in dbSNP:rs25689).|R -> P (in dbSNP:rs25689).		multicellular organismal development (GO:0007275)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(15)|liver(1)|lung(19)|ovary(2)|prostate(5)|skin(1)|stomach(1)|urinary_tract(2)	56		all_epithelial(88;4.56e-14)|Myeloproliferative disorder(762;0.0255)		GBM - Glioblastoma multiforme(74;7.45e-21)|OV - Ovarian serous cystadenocarcinoma(323;1.02e-16)		GCTCTCATTGCGGTATTCATG	0.483													T|||	1423	0.284145	0.3608	0.2752	5008	,	,		19539	0.1766		0.2187	False		,,,				2504	0.365																0								T	HIS/ARG,HIS/ARG	1447,2959	681.5+/-404.0	239,969,995	100.0	98.0	99.0		872,872	6.0	1.0	9	dbSNP_72	99	1817,6783	732.2+/-406.8	187,1443,2670	yes	missense,missense	TMEM2	NM_001135820.1,NM_013390.2	29,29	426,2412,3665	TT,TC,CC		21.1279,32.8416,25.0961	benign,benign	291/1321,291/1384	74360096	3264,9742	2203	4300	6503	SO:0001583	missense	23670				CCDS6638.1, CCDS47979.1	9q21.13	2011-07-19			ENSG00000135048	ENSG00000135048			11869	protein-coding gene	gene with protein product		605835					Standard	NM_013390		Approved		uc011lsa.1	Q9UHN6	OTTHUMG00000020000	ENST00000377044.4:c.872G>A	9.37:g.74360096C>T	ENSP00000366243:p.Arg291His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8W9|B2RTQ6|Q5T838|Q5T839|Q5T840|Q5T841|Q8NBP6|Q9P2D5	Missense_Mutation	SNP	pfam_G8_domain,superfamily_Pectin_lyase_fold/virulence	p.R291H	ENST00000377044.4	37	c.872	CCDS6638.1	9	513	0.2348901098901099	169	0.3434959349593496	81	0.22375690607734808	102	0.17832167832167833	161	0.21240105540897097	T	10.08	1.251990	0.22880	0.328416	0.211279	ENSG00000135048	ENST00000377044;ENST00000377066	T;T	0.73152	-0.72;-0.66	6.03	6.03	0.97812	.	0.486723	0.25836	N	0.027997	T	0.00012	0.0000	N	0.04508	-0.205	0.09310	P	0.999999999999999	B;B	0.02656	0.0;0.0	B;B	0.04013	0.0;0.001	T	0.18147	-1.0346	9	0.33940	T	0.23	.	9.0014	0.36083	0.0:0.0672:0.134:0.7989	rs25689;rs3739782;rs59504885;rs25689	291;291	Q9UHN6;Q9UHN6-2	TMEM2_HUMAN;.	H	291	ENSP00000366243:R291H;ENSP00000366266:R291H	ENSP00000366243:R291H	R	-	2	0	TMEM2	73549916	1.000000	0.71417	0.999000	0.59377	0.960000	0.62799	1.925000	0.40074	1.106000	0.41623	-0.254000	0.11334	CGC	TMEM2	-	NULL		0.483	TMEM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM2	HGNC	protein_coding	OTTHUMT00000052618.2	C	NM_013390		74360096	-1	no_errors	ENST00000377044	ensembl	human	known	70_37	missense	SNP	0.995	T
TMEM87B	84910	genome.wustl.edu	37	2	112832536	112832538	+	Splice_Site	DEL	AAT	AAT	-	rs201146763|rs71385858	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	AAT	AAT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:112832536_112832538delAAT	ENST00000283206.4	+	5	867_869	c.498_500delAAT	c.(496-501)tcaatg>tcg	p.M167del		NM_032824.2	NP_116213.1	Q96K49	TM87B_HUMAN	transmembrane protein 87B	167						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(11)|ovary(1)	19						AGGAAAGATCAATGGTAAGCAGT	0.3														1297	0.258986	0.2118	0.2954	5008	,	,		17959	0.1835		0.3976	False		,,,				2504	0.2321																0										915,3343		103,709,1317						3.6	0.8		dbSNP_130	41	3245,4989		636,1973,1508	no	coding-near-splice	TMEM87B	NM_032824.2		739,2682,2825	A1A1,A1R,RR		39.4098,21.489,33.3013				4160,8332				SO:0001630	splice_region_variant	84910			AC092645	CCDS33275.1	2q13	2008-02-05			ENSG00000153214	ENSG00000153214			25913	protein-coding gene	gene with protein product							Standard	NM_032824		Approved	FLJ14681	uc002thm.2	Q96K49	OTTHUMG00000153266	ENST00000283206.4:c.501+1AAT>-	2.37:g.112832536_112832538delAAT		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2M9|Q1RLN2|Q53R54	In_Frame_Del	DEL	pfam_TM_rcpt_euk	p.M167in_frame_del	ENST00000283206.4	37	c.498_500	CCDS33275.1	2																																																																																			TMEM87B	-	NULL		0.300	TMEM87B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM87B	HGNC	protein_coding	OTTHUMT00000330500.1	AAT	NM_032824	In_Frame_Del	112832538	+1	no_errors	ENST00000283206	ensembl	human	known	70_37	in_frame_del	DEL	0.197:0.117:0.110	-
TMPRSS13	84000	genome.wustl.edu	37	11	117789272	117789272	+	Silent	SNP	G	G	A	rs371192091	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:117789272G>A	ENST00000430170.2	-	2	390	c.303C>T	c.(301-303)tcC>tcT	p.S101S	TMPRSS13_ENST00000526090.1_Silent_p.S101S|TMPRSS13_ENST00000445164.2_Silent_p.S101S|TMPRSS13_ENST00000528626.1_Silent_p.S101S|TMPRSS13_ENST00000524993.1_Silent_p.S101S	NM_001244995.1	NP_001231924.1	Q9BYE2	TMPSD_HUMAN	transmembrane protease, serine 13	101						blood microparticle (GO:0072562)|integral component of membrane (GO:0016021)	scavenger receptor activity (GO:0005044)|serine-type endopeptidase activity (GO:0004252)			endometrium(1)|kidney(3)|large_intestine(6)|lung(7)|pancreas(1)|prostate(1)|urinary_tract(1)	20	all_hematologic(175;0.0487)	Medulloblastoma(222;0.0425)|all_hematologic(192;0.196)|all_neural(223;0.234)		BRCA - Breast invasive adenocarcinoma(274;1.78e-05)|Epithelial(105;0.00106)		ATGACCTGCCGGATGAGGACC	0.622													G|||	3	0.000599042	0.0008	0.0	5008	,	,		16905	0.0		0.002	False		,,,				2504	0.0																0								G	,,	1,4185		0,1,2092	71.0	83.0	79.0		303,303,303	-11.4	0.0	11		79	14,8400		1,12,4194	no	coding-synonymous,coding-synonymous,coding-synonymous	TMPRSS13	NM_001077263.2,NM_001206789.1,NM_001206790.1	,,	1,13,6286	AA,AG,GG		0.1664,0.0239,0.119	,,	101/568,101/533,101/492	117789272	15,12585	2093	4207	6300	SO:0001819	synonymous_variant	84000			AB048796	CCDS41721.1, CCDS55788.1, CCDS55789.1, CCDS58185.1	11q23	2010-04-13	2005-03-11	2005-03-12	ENSG00000137747	ENSG00000137747		"""Serine peptidases / Transmembrane"""	29808	protein-coding gene	gene with protein product		610050	"""transmembrane protease, serine 11"""	TMPRSS11		11267681	Standard	NM_001077263		Approved	MSPL	uc001prs.2	Q9BYE2	OTTHUMG00000166992	ENST00000430170.2:c.303C>T	11.37:g.117789272G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DTM9|E9PIJ5|F8WAJ3|Q86YM4|Q96JY8|Q9BYE1	Silent	SNP	pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,superfamily_Pept_cys/ser_Trypsin-like,superfamily_Srcr_rcpt-rel,superfamily_LDrepeatLR_classA_rpt,smart_Srcr_rcpt-rel,smart_Peptidase_S1_S6,pirsf_Peptidase_S1A_TMPRSS13,pfscan_Srcr_rcpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.S101	ENST00000430170.2	37	c.303	CCDS58185.1	11																																																																																			TMPRSS13	-	pirsf_Peptidase_S1A_TMPRSS13		0.622	TMPRSS13-006	PUTATIVE	basic|appris_candidate|exp_conf|CCDS	protein_coding	TMPRSS13	HGNC	protein_coding	OTTHUMT00000392318.1	G	NM_032046		117789272	-1	no_errors	ENST00000445164	ensembl	human	known	70_37	silent	SNP	0.000	A
TMPRSS9	360200	genome.wustl.edu	37	19	2425109	2425109	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:2425109C>T	ENST00000332578.3	+	15	2725	c.2725C>T	c.(2725-2727)Ctc>Ttc	p.L909F		NM_182973.1	NP_892018.1	Q7Z410	TMPS9_HUMAN	transmembrane protease, serine 9	909	Peptidase S1 3. {ECO:0000255|PROSITE- ProRule:PRU00274}.				plasminogen activation (GO:0031639)	integral component of plasma membrane (GO:0005887)	serine-type endopeptidase activity (GO:0004252)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(3)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		GTTCTACAATCTCTACACGCT	0.716																																																	0													17.0	14.0	15.0					19																	2425109		2192	4285	6477	SO:0001583	missense	360200			AJ488946	CCDS12088.1	19p13.3	2010-04-13						"""Serine peptidases / Transmembrane"""	30079	protein-coding gene	gene with protein product	"""polyserase 1"""	610477				12886014	Standard	NM_182973		Approved		uc010xgx.2	Q7Z410		ENST00000332578.3:c.2725C>T	19.37:g.2425109C>T	ENSP00000330264:p.Leu909Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZND6|Q7Z411	Missense_Mutation	SNP	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1_S6,pfam_Peptidase_S1A_nudel,pfam_LDrepeatLR_classA_rpt,superfamily_Pept_cys/ser_Trypsin-like,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,prints_Peptidase_S1A,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6	p.L909F	ENST00000332578.3	37	c.2725	CCDS12088.1	19	.	.	.	.	.	.	.	.	.	.	C	17.23	3.336464	0.60963	.	.	ENSG00000178297	ENST00000332578	D	0.88664	-2.41	4.08	1.65	0.23941	Peptidase cysteine/serine, trypsin-like (1);Peptidase S1/S6, chymotrypsin/Hap (3);	0.275088	0.25127	N	0.032932	T	0.79661	0.4484	N	0.05124	-0.11	0.24817	N	0.992606	P	0.52692	0.955	P	0.53360	0.724	T	0.70425	-0.4875	10	0.31617	T	0.26	.	5.3476	0.16018	0.3074:0.3302:0.3623:0.0	.	909	Q7Z410	TMPS9_HUMAN	F	909	ENSP00000330264:L909F	ENSP00000330264:L909F	L	+	1	0	TMPRSS9	2376109	0.876000	0.30132	1.000000	0.80357	0.989000	0.77384	0.580000	0.23803	0.636000	0.30508	0.561000	0.74099	CTC	TMPRSS9	-	pirsf_Pept_S1A_polyserase-1,pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.716	TMPRSS9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMPRSS9	HGNC	protein_coding	OTTHUMT00000451330.3	C	NM_182973		2425109	+1	no_errors	ENST00000332578	ensembl	human	known	70_37	missense	SNP	0.998	T
TNXB	7148	genome.wustl.edu	37	6	32012817	32012817	+	Silent	SNP	C	C	T	rs113926083	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:32012817C>T	ENST00000375244.3	-	32	11094	c.10893G>A	c.(10891-10893)aaG>aaA	p.K3631K	TNXB_ENST00000451343.1_Silent_p.K60K|TNXB_ENST00000375247.2_Silent_p.K3629K			P22105	TENX_HUMAN	tenascin XB	3676	Fibronectin type-III 28. {ECO:0000255|PROSITE-ProRule:PRU00316}.				actin cytoskeleton organization (GO:0030036)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|collagen fibril organization (GO:0030199)|collagen metabolic process (GO:0032963)|elastic fiber assembly (GO:0048251)|extracellular fibril organization (GO:0043206)|fatty acid metabolic process (GO:0006631)|regulation of JUN kinase activity (GO:0043506)|single organismal cell-cell adhesion (GO:0016337)|triglyceride metabolic process (GO:0006641)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|proteinaceous extracellular matrix (GO:0005578)	heparin binding (GO:0008201)|integrin binding (GO:0005178)			endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|prostate(1)	8						GCCCCAGGCGCTTCCCTTCAT	0.642																																																	0													17.0	16.0	16.0					6																	32012817		1502	2704	4206	SO:0001819	synonymous_variant	7148			X71923	CCDS4736.1	6p21.3	2013-02-11			ENSG00000168477	ENSG00000168477		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	11976	protein-coding gene	gene with protein product		600985		TNXB1, TNXB2		8530023	Standard	NM_019105		Approved	TNXBS, XBS, XB	uc021yvf.2	P22105	OTTHUMG00000031088	ENST00000375244.3:c.10893G>A	6.37:g.32012817C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	P78530|P78531|Q08424|Q08AM0|Q08AM1|Q59GU7|Q5SQD3|Q5ST74|Q7L8Q4|Q8N4R1|Q9NPK9|Q9UC10|Q9UC11|Q9UC12|Q9UC13|Q9UMG7	Silent	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.K3629	ENST00000375244.3	37	c.10887		6																																																																																			TNXB	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	TNXB-001	PUTATIVE	not_organism_supported|basic|appris_candidate_longest	protein_coding	TNXB	HGNC	protein_coding	OTTHUMT00000268927.2	C	NM_019105		32012817	-1	no_errors	ENST00000375247	ensembl	human	known	70_37	silent	SNP	0.882	T
TPM2	7169	genome.wustl.edu	37	9	35683240	35683241	+	Splice_Site	INS	-	-	G	rs35401252|rs199476157|rs368128547|rs149115565	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:35683240_35683241insG	ENST00000360958.2	-	9	877		c.e9-2		TPM2_ENST00000378292.3_Intron|TPM2_ENST00000378300.5_Intron|TPM2_ENST00000329305.2_Intron	NM_003289.3	NP_003280.2	P07951	TPM2_HUMAN	tropomyosin 2 (beta)						muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of ATPase activity (GO:0043462)	cytosol (GO:0005829)|muscle thin filament tropomyosin (GO:0005862)	actin binding (GO:0003779)|structural constituent of muscle (GO:0008307)			NS(1)|breast(1)|cervix(1)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	15	all_epithelial(49;0.121)		Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			AGACTTCATCTGGGGGGGGTCC	0.55													GGGGGGG|GGGGGGGG|GGGGGGGGG|cryptic_indel	1313	0.262181	0.1505	0.2896	5008	,	,		19764	0.2917		0.3608	False		,,,				2504	0.2618																0																																										SO:0001630	splice_region_variant	7169				CCDS6586.1, CCDS6587.1	9p13	2014-09-17	2003-12-02		ENSG00000198467	ENSG00000198467		"""Tropomyosins"""	12011	protein-coding gene	gene with protein product	"""nemaline myopathy type 4"""	190990	"""arthrogryposis multiplex congenital, distal, type 1"""	AMCD1		7606936	Standard	NM_003289		Approved	DA1, NEM4	uc003zxq.3	P07951	OTTHUMG00000019878	ENST00000360958.2:c.773-2->C	9.37:g.35683248_35683248dupG		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NM85|P06468|Q13894|Q53FM4|Q5TCU4|Q5TCU7|Q9UH67	Splice_Site	INS	-	e9-2	ENST00000360958.2	37	c.773-3_773-2	CCDS6587.1	9																																																																																			TPM2	-	-		0.550	TPM2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPM2	HGNC	protein_coding	OTTHUMT00000052376.1	-	NM_003289	Intron	35683241	-1	no_errors	ENST00000360958	ensembl	human	known	70_37	splice_site_ins	INS	1.000:1.000	G
TPTEP1	387590	genome.wustl.edu	37	22	17082969	17082969	+	lincRNA	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:17082969G>A	ENST00000426585.1	+	0	36									transmembrane phosphatase with tensin homology pseudogene 1																		CGTCGGAGGAGAACAAGTGCG	0.721																																																	0																																												387590					22q11.1	2013-10-15			ENSG00000100181	ENSG00000100181			43648	pseudogene	pseudogene						14659893	Standard	NR_001591		Approved	psiTPTE22	uc002zlr.3		OTTHUMG00000141300		22.37:g.17082969G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000426585.1	37	NULL		22																																																																																			TPTEP1	-	-		0.721	TPTEP1-002	KNOWN	basic	lincRNA	TPTEP1	HGNC	lincRNA	OTTHUMT00000280575.1	G	NR_001591		17082969	+1	no_errors	ENST00000400593	ensembl	human	known	70_37	rna	SNP	0.994	A
TRAP1	10131	genome.wustl.edu	37	16	3722736	3722736	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:3722736G>A	ENST00000246957.5	-	10	1218	c.1130C>T	c.(1129-1131)aCg>aTg	p.T377M	TRAP1_ENST00000575671.1_Missense_Mutation_p.T168M|TRAP1_ENST00000573872.1_Intron|TRAP1_ENST00000538171.1_Missense_Mutation_p.T324M	NM_016292.2	NP_057376.2	Q12931	TRAP1_HUMAN	TNF receptor-associated protein 1	377					chaperone-mediated protein folding (GO:0061077)|negative regulation of cellular respiration (GO:1901856)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|regulation of reactive oxygen species metabolic process (GO:2000377)|response to stress (GO:0006950)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|protein kinase binding (GO:0019901)|tumor necrosis factor receptor binding (GO:0005164)			central_nervous_system(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(7)|skin(1)|upper_aerodigestive_tract(1)	19		Ovarian(90;0.0261)				CAGGATGTCCGTGGCCTTGGT	0.627																																																	0													137.0	94.0	108.0					16																	3722736		2197	4300	6497	SO:0001583	missense	10131			AF154108	CCDS10508.1, CCDS61824.1	16p13.3	2011-09-02			ENSG00000126602	ENSG00000126602		"""Heat shock proteins / HSPC"""	16264	protein-coding gene	gene with protein product		606219				10652318, 7876093	Standard	NM_016292		Approved	HSP75, HSP90L	uc002cvt.4	Q12931	OTTHUMG00000129427	ENST00000246957.5:c.1130C>T	16.37:g.3722736G>A	ENSP00000246957:p.Thr377Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR68|D3DUC8|F5H897|O43642|O75235|Q9UHL5	Missense_Mutation	SNP	pfam_Hsp90,pfam_ATPase-like_ATP-bd,superfamily_Ribosomal_S5_D2-typ_fold,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pirsf_Hsp90,prints_Hsp90_N	p.T377M	ENST00000246957.5	37	c.1130	CCDS10508.1	16	.	.	.	.	.	.	.	.	.	.	G	19.13	3.767249	0.69878	.	.	ENSG00000126602	ENST00000246957;ENST00000538171	T;T	0.09911	2.93;2.93	5.35	5.35	0.76521	Ribosomal protein S5 domain 2-type fold (1);	0.672013	0.16333	N	0.219053	T	0.22360	0.0539	L	0.52573	1.65	0.09310	N	0.99999	P;P	0.43857	0.588;0.819	P;P	0.50109	0.498;0.631	T	0.02208	-1.1195	10	0.87932	D	0	-5.8681	18.3915	0.90485	0.0:0.0:1.0:0.0	.	324;377	F5H897;Q12931	.;TRAP1_HUMAN	M	377;324	ENSP00000246957:T377M;ENSP00000442070:T324M	ENSP00000246957:T377M	T	-	2	0	TRAP1	3662737	0.995000	0.38212	0.015000	0.15790	0.697000	0.40408	7.431000	0.80335	2.665000	0.90641	0.491000	0.48974	ACG	TRAP1	-	pfam_Hsp90,superfamily_Ribosomal_S5_D2-typ_fold,pirsf_Hsp90		0.627	TRAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAP1	HGNC	protein_coding	OTTHUMT00000251586.2	G	NM_016292		3722736	-1	no_errors	ENST00000246957	ensembl	human	known	70_37	missense	SNP	0.276	A
TRIM36	55521	genome.wustl.edu	37	5	114462253	114462253	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:114462253G>A	ENST00000282369.3	-	10	2255	c.2134C>T	c.(2134-2136)Cag>Tag	p.Q712*	TRIM36_ENST00000513154.1_Nonsense_Mutation_p.Q700*|TRIM36_ENST00000514154.1_Nonsense_Mutation_p.Q557*	NM_018700.3	NP_061170.2	Q9NQ86	TRI36_HUMAN	tripartite motif containing 36	712	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.				acrosome reaction (GO:0007340)|regulation of cell cycle (GO:0051726)	acrosomal vesicle (GO:0001669)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(15)|ovary(4)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	37		all_cancers(142;0.00133)|all_epithelial(76;2.41e-05)|Prostate(80;0.00955)|Ovarian(225;0.0443)|Breast(839;0.195)		OV - Ovarian serous cystadenocarcinoma(64;3.62e-08)|Epithelial(69;7.69e-08)|all cancers(49;9.33e-06)		TCTTCAAGCTGAATTCCTCCA	0.388																																																	0													108.0	100.0	102.0					5																	114462253		2202	4300	6502	SO:0001587	stop_gained	55521			AJ272269	CCDS4115.1, CCDS34211.1, CCDS34212.1, CCDS75287.1	5q22	2013-02-11	2011-01-25		ENSG00000152503	ENSG00000152503		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16280	protein-coding gene	gene with protein product	"""zinc-binding protein Rbcc728"", ""tripartite motif protein 36"", ""RING finger protein 98"""	609317	"""tripartite motif-containing 36"""			11331580	Standard	XM_005272031		Approved	RBCC728, RNF98, HAPRIN	uc003kqs.3	Q9NQ86	OTTHUMG00000128892	ENST00000282369.3:c.2134C>T	5.37:g.114462253G>A	ENSP00000282369:p.Gln712*	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3Z1|A6NDD0|B7Z3V4|B7ZAV7|E9PFI8|Q0P5Z9	Nonsense_Mutation	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,pfam_SPRY_rcpt,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.Q712*	ENST00000282369.3	37	c.2134	CCDS4115.1	5	.	.	.	.	.	.	.	.	.	.	G	38	7.206943	0.98136	.	.	ENSG00000152503	ENST00000282369;ENST00000513154;ENST00000514154	.	.	.	5.73	5.73	0.89815	.	0.237095	0.44097	D	0.000496	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.16896	T	0.51	.	20.2699	0.98469	0.0:0.0:1.0:0.0	.	.	.	.	X	712;700;557	.	ENSP00000282369:Q712X	Q	-	1	0	TRIM36	114490152	1.000000	0.71417	0.777000	0.31699	0.990000	0.78478	7.348000	0.79366	2.854000	0.98071	0.655000	0.94253	CAG	TRIM36	-	pfscan_B30.2/SPRY		0.388	TRIM36-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM36	HGNC	protein_coding	OTTHUMT00000250854.2	G	NM_018700		114462253	-1	no_errors	ENST00000282369	ensembl	human	known	70_37	nonsense	SNP	0.998	A
TRIOBP	11078	genome.wustl.edu	37	22	38167740	38167740	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:38167740G>A	ENST00000406386.3	+	22	7188	c.6933G>A	c.(6931-6933)caG>caA	p.Q2311Q	TRIOBP_ENST00000403663.2_Silent_p.Q598Q	NM_001039141.2	NP_001034230.1	Q9H2D6	TARA_HUMAN	TRIO and F-actin binding protein	2311					actin modification (GO:0030047)|barbed-end actin filament capping (GO:0051016)|mitotic nuclear division (GO:0007067)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	actin filament binding (GO:0051015)|GTP-Rho binding (GO:0017049)|myosin II binding (GO:0045159)|ubiquitin protein ligase binding (GO:0031625)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	Melanoma(58;0.0574)					AGATGATGCAGAAGGTAGGTC	0.592																																																	0													53.0	57.0	56.0					22																	38167740		1997	4170	6167	SO:0001819	synonymous_variant	11078			AB051449	CCDS33644.1, CCDS43015.1, CCDS43016.1	22q13.1	2014-06-03			ENSG00000100106	ENSG00000100106		"""Pleckstrin homology (PH) domain containing"""	17009	protein-coding gene	gene with protein product		609761		DFNB28		11148140, 16385457, 16385458	Standard	NM_001039141		Approved	HRIHFB2122, KIAA1662, Tara, TAP68	uc003atr.3	Q9H2D6	OTTHUMG00000150657	ENST00000406386.3:c.6933G>A	22.37:g.38167740G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHD4|B1AHD7|F2Z2W0|F8W6V6|O94797|Q2PZW8|Q2Q3Z9|Q2Q400|Q5R3M6|Q96DW1|Q9BT77|Q9BTL7|Q9BY98|Q9Y3L4	Silent	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.Q2311	ENST00000406386.3	37	c.6933	CCDS43015.1	22																																																																																			TRIOBP	-	NULL		0.592	TRIOBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRIOBP	HGNC	protein_coding	OTTHUMT00000319439.2	G			38167740	+1	no_errors	ENST00000406386	ensembl	human	known	70_37	silent	SNP	1.000	A
TRMT10C	54931	genome.wustl.edu	37	3	101284448	101284448	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:101284448G>A	ENST00000309922.6	+	2	977	c.823G>A	c.(823-825)Gaa>Aaa	p.E275K		NM_017819.2	NP_060289.2	Q7L0Y3	MRRP1_HUMAN	tRNA methyltransferase 10 homolog C (S. cerevisiae)	275	SAM-dependent MTase TRM10-type. {ECO:0000255|PROSITE-ProRule:PRU01012}.				mitochondrial RNA 5'-end processing (GO:0000964)|tRNA processing (GO:0008033)	mitochondrial nucleoid (GO:0042645)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	methyltransferase activity (GO:0008168)|poly(A) RNA binding (GO:0044822)										AACATCAACAGAAAAGTCTCA	0.323																																																	0													79.0	79.0	79.0					3																	101284448		1826	4069	5895	SO:0001583	missense	54931			AK000439	CCDS43122.1	3q12.3	2012-06-28	2012-06-28	2012-06-28	ENSG00000174173	ENSG00000174173			26022	protein-coding gene	gene with protein product	"""mitochondrial RNase P subunit 1"""	615423	"""RNA (guanine-9-) methyltransferase domain containing 1"""	RG9MTD1		18984158	Standard	NM_017819		Approved	FLJ20432, MRPP1	uc003duz.4	Q7L0Y3	OTTHUMG00000159114	ENST00000309922.6:c.823G>A	3.37:g.101284448G>A	ENSP00000312356:p.Glu275Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NRG5|Q9NX54|Q9Y596	Missense_Mutation	SNP	pfam_tRNA_m1G_MeTrfase	p.E275K	ENST00000309922.6	37	c.823	CCDS43122.1	3	.	.	.	.	.	.	.	.	.	.	G	31	5.085349	0.94100	.	.	ENSG00000174173	ENST00000309922;ENST00000495642	T;T	0.26957	1.7;1.7	6.17	6.17	0.99709	.	0.200887	0.52532	D	0.000072	T	0.54127	0.1839	M	0.76574	2.34	0.58432	D	0.999999	D	0.67145	0.996	D	0.69479	0.964	T	0.46400	-0.9194	10	0.51188	T	0.08	-4.6168	20.8794	0.99867	0.0:0.0:1.0:0.0	.	275	Q7L0Y3	MRRP1_HUMAN	K	275	ENSP00000312356:E275K;ENSP00000419389:E275K	ENSP00000312356:E275K	E	+	1	0	RG9MTD1	102767138	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	6.261000	0.72509	2.941000	0.99782	0.655000	0.94253	GAA	TRMT10C	-	pfam_tRNA_m1G_MeTrfase		0.323	TRMT10C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRMT10C	HGNC	protein_coding	OTTHUMT00000353400.2	G	NM_017819		101284448	+1	no_errors	ENST00000309922	ensembl	human	known	70_37	missense	SNP	1.000	A
TRPM2	7226	genome.wustl.edu	37	21	45811190	45811190	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr21:45811190C>T	ENST00000397928.1	+	11	1921	c.1476C>T	c.(1474-1476)ctC>ctT	p.L492L	TRPM2_ENST00000498430.1_3'UTR|TRPM2_ENST00000397932.2_Silent_p.L492L|TRPM2_ENST00000300481.9_Silent_p.L492L|TRPM2_ENST00000300482.5_Silent_p.L492L	NM_003307.3	NP_003298	O94759	TRPM2_HUMAN	transient receptor potential cation channel, subfamily M, member 2	492					calcium ion transmembrane transport (GO:0070588)|calcium ion transport (GO:0006816)|ion transmembrane transport (GO:0034220)|response to hydroperoxide (GO:0033194)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	ADP-ribose diphosphatase activity (GO:0047631)|calcium channel activity (GO:0005262)|manganese ion transmembrane transporter activity (GO:0005384)|sodium channel activity (GO:0005272)			breast(3)|central_nervous_system(2)|endometrium(4)|kidney(3)|large_intestine(15)|lung(29)|ovary(3)|pancreas(1)|prostate(5)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(1)	76						CAGCTGCACTCATCTCCAACA	0.527																																																	0													131.0	94.0	107.0					21																	45811190		2203	4300	6503	SO:0001819	synonymous_variant	7226			AB001535	CCDS13710.1	21q22.3	2011-12-14		2002-01-18	ENSG00000142185	ENSG00000142185		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Nudix motif containing"""	12339	protein-coding gene	gene with protein product		603749		TRPC7		9806837, 11385575, 16382100	Standard	NR_038257		Approved	KNP3, LTRPC2, NUDT9L1, NUDT9H, EREG1	uc002zew.1	O94759	OTTHUMG00000040840	ENST00000397928.1:c.1476C>T	21.37:g.45811190C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSL6|Q5KTC2|Q6J3P5|Q96KN6|Q96Q93	Silent	SNP	pfam_Ion_trans_dom,superfamily_NUDIX_hydrolase_dom-like	p.L492	ENST00000397928.1	37	c.1476	CCDS13710.1	21																																																																																			TRPM2	-	NULL		0.527	TRPM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPM2	HGNC	protein_coding	OTTHUMT00000098086.1	C	NM_003307		45811190	+1	no_errors	ENST00000300482	ensembl	human	known	70_37	silent	SNP	1.000	T
TRPM3	80036	genome.wustl.edu	37	9	73458045	73458046	+	Splice_Site	INS	-	-	A	rs3833697|rs533390097	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:73458045_73458046insA	ENST00000377111.2	-	5	920		c.e5-2		TRPM3_ENST00000408909.2_Splice_Site|TRPM3_ENST00000377106.1_Splice_Site|TRPM3_ENST00000361823.5_Splice_Site|TRPM3_ENST00000377110.3_Splice_Site|TRPM3_ENST00000396283.1_Splice_Site|TRPM3_ENST00000396280.5_Splice_Site|TRPM3_ENST00000377097.3_Splice_Site|TRPM3_ENST00000357533.2_Splice_Site|TRPM3_ENST00000377105.1_Splice_Site|TRPM3_ENST00000396285.1_Splice_Site|TRPM3_ENST00000423814.3_Splice_Site|TRPM3_ENST00000360823.2_Splice_Site|TRPM3_ENST00000396292.4_Splice_Site|TRPM3_ENST00000377101.1_Splice_Site|TRPM3_ENST00000358082.3_Splice_Site	NM_001007471.2	NP_001007472.2	Q9HCF6	TRPM3_HUMAN	transient receptor potential cation channel, subfamily M, member 3						calcium ion transmembrane transport (GO:0070588)|cation transport (GO:0006812)|detection of temperature stimulus (GO:0016048)|ion transmembrane transport (GO:0034220)|sensory perception of temperature stimulus (GO:0050951)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)			NS(2)|breast(4)|central_nervous_system(2)|endometrium(6)|kidney(1)|large_intestine(18)|liver(1)|lung(46)|ovary(3)|pancreas(2)|prostate(5)|skin(4)|urinary_tract(1)	95						GAATAACACCTAAAAAAAAAAG	0.371																																																	0									,,,,,,,,	2873,228,1163		935,177,826,1,49,144					,,,,,,,,	4.6	0.9		dbSNP_130	42	5493,56,2699		1753,52,1935,0,4,380	no	intron,intron,intron,intron,intron,intron,intron,intron,intron	TRPM3	NM_206948.2,NM_206947.3,NM_206946.3,NM_206945.3,NM_206944.3,NM_024971.5,NM_020952.4,NM_001007471.2,NM_001007470.1	,,,,,,,,	2688,229,2761,1,53,524	A1A1,A1A2,A1R,A2A2,A2R,RR		33.402,32.622,33.1362	,,,,,,,,	,,,,,,,,		8366,284,3862				SO:0001630	splice_region_variant	80036			AB046836	CCDS6634.1, CCDS6635.1, CCDS6636.1, CCDS6637.1, CCDS43835.1, CCDS65064.1	9q21.11	2011-12-14			ENSG00000083067	ENSG00000083067		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17992	protein-coding gene	gene with protein product	"""melastatin 2"""	608961				16382100	Standard	NM_206946		Approved	KIAA1616, LTRPC3, GON-2	uc004aid.3	Q9HCF6	OTTHUMG00000019997	ENST00000377111.2:c.677-2->T	9.37:g.73458055_73458055dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A3F6|A9Z1Y7|Q5VW02|Q5VW03|Q5VW04|Q5W5T7|Q86SH0|Q86SH6|Q86UL0|Q86WK1|Q86WK2|Q86WK3|Q86WK4|Q86YZ9|Q86Z00|Q86Z01|Q9H0X2	Splice_Site	INS	-	e5-2	ENST00000377111.2	37	c.683-3_683-2		9																																																																																			TRPM3	-	-		0.371	TRPM3-007	NOVEL	basic|exp_conf	protein_coding	TRPM3	HGNC	protein_coding	OTTHUMT00000214157.5	-	NM_206945	Intron	73458046	-1	no_errors	ENST00000423814	ensembl	human	known	70_37	splice_site_ins	INS	0.995:0.010	A
TRPV1	7442	genome.wustl.edu	37	17	3477080	3477080	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:3477080G>A	ENST00000571088.1	-	13	2163	c.1950C>T	c.(1948-1950)ttC>ttT	p.F650F	TRPV1_ENST00000310522.5_Silent_p.F590F|TRPV1_ENST00000174621.6_Silent_p.F648F|TRPV1_ENST00000399756.4_Silent_p.F650F|TRPV1_ENST00000399759.3_Silent_p.F650F|TRPV1_ENST00000425167.2_Silent_p.F661F|SHPK_ENST00000572705.1_Silent_p.F650F|TRPV1_ENST00000576351.1_Silent_p.F640F	NM_018727.5	NP_061197.4	Q8NER1	TRPV1_HUMAN	transient receptor potential cation channel, subfamily V, member 1	650					calcium ion transmembrane transport (GO:0070588)|cell surface receptor signaling pathway (GO:0007166)|cellular response to alkaloid (GO:0071312)|cellular response to ATP (GO:0071318)|chemosensory behavior (GO:0007635)|ion transmembrane transport (GO:0034220)|thermoception (GO:0050955)|transmembrane transport (GO:0055085)|transport (GO:0006810)	cell junction (GO:0030054)|cell projection (GO:0042995)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ATP binding (GO:0005524)|calcium channel activity (GO:0005262)|calcium-release channel activity (GO:0015278)|excitatory extracellular ligand-gated ion channel activity (GO:0005231)|phosphoprotein binding (GO:0051219)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|urinary_tract(1)	17				Lung(1;0.055)|COAD - Colon adenocarcinoma(5;0.0896)|LUAD - Lung adenocarcinoma(1115;0.131)	Alpha-Linolenic Acid(DB00132)|Aspartame(DB00168)|Icosapent(DB00159)	AGTTCTCAGTGAACTCCAGGT	0.562																																					Melanoma(38;962 1762 15789)												0													127.0	128.0	127.0					17																	3477080		2198	4299	6497	SO:0001819	synonymous_variant	7442			AJ272063	CCDS45576.1	17p13.2	2014-08-12	2002-01-29	2002-02-01	ENSG00000196689	ENSG00000262304		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	12716	protein-coding gene	gene with protein product		602076	"""vanilloid receptor subtype 1"""	VR1		9349813, 11549313, 16382100	Standard	NM_018727		Approved		uc010vrt.2	Q8NER1	OTTHUMG00000177649	ENST00000571088.1:c.1950C>T	17.37:g.3477080G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUA9|Q3LU47|Q9H0G9|Q9H303|Q9H304|Q9NQ74|Q9NY22	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	p.F650	ENST00000571088.1	37	c.1950	CCDS45576.1	17																																																																																			TRPV1	-	prints_TRPV1-4_channel,tigrfam_TRP_channel		0.562	TRPV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV1	HGNC	protein_coding	OTTHUMT00000438254.1	G	NM_018727		3477080	-1	no_errors	ENST00000399756	ensembl	human	known	70_37	silent	SNP	1.000	A
TSNARE1	203062	genome.wustl.edu	37	8	143425329	143425329	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:143425329C>G	ENST00000307180.3	-	4	860	c.743G>C	c.(742-744)aGa>aCa	p.R248T	TSNARE1_ENST00000520166.1_Missense_Mutation_p.R248T|TSNARE1_ENST00000524325.1_Missense_Mutation_p.R248T|TSNARE1_ENST00000519651.1_Intron	NM_145003.3	NP_659440.2	Q96NA8	TSNA1_HUMAN	t-SNARE domain containing 1	248					intracellular protein transport (GO:0006886)|synaptic vesicle exocytosis (GO:0016079)	integral component of membrane (GO:0016021)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)|SNARE binding (GO:0000149)			breast(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(6)|ovary(2)|stomach(2)|urinary_tract(1)	20	all_cancers(97;7.39e-11)|all_epithelial(106;8.98e-09)|Lung NSC(106;0.000167)|all_lung(105;0.000332)|Ovarian(258;0.0315)|Acute lymphoblastic leukemia(118;0.155)					GAACTCACCTCTGGGCGGCTC	0.652																																																	0													19.0	16.0	17.0					8																	143425329		2119	4165	6284	SO:0001583	missense	203062					8q24.3	2005-08-18							26437	protein-coding gene	gene with protein product						14702039	Standard	XM_005250828		Approved	FLJ31164	uc003ywk.3	Q96NA8		ENST00000307180.3:c.743G>C	8.37:g.143425329C>G	ENSP00000303437:p.Arg248Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLB0|Q14D03	Missense_Mutation	SNP	pfam_T_SNARE_dom,superfamily_t-SNARE,smart_Syntaxin_N,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.R248T	ENST00000307180.3	37	c.743	CCDS6384.1	8	.	.	.	.	.	.	.	.	.	.	C	9.286	1.049416	0.19827	.	.	ENSG00000171045	ENST00000524325;ENST00000307180;ENST00000520166	T;T;T	0.11385	2.78;2.78;2.78	3.91	1.99	0.26369	.	0.198821	0.23859	U	0.043870	T	0.09862	0.0242	L	0.57536	1.79	0.22701	N	0.998837	B;B;B	0.26081	0.141;0.068;0.068	B;B;B	0.15052	0.012;0.012;0.012	T	0.22556	-1.0213	10	0.56958	D	0.05	-18.0688	5.4157	0.16372	0.0:0.6755:0.2053:0.1192	.	248;248;248	B7ZLB0;Q96NA8;A0AVG3	.;TSNA1_HUMAN;.	T	248	ENSP00000428763:R248T;ENSP00000303437:R248T;ENSP00000427770:R248T	ENSP00000303437:R248T	R	-	2	0	TSNARE1	143423236	0.000000	0.05858	0.784000	0.31847	0.736000	0.42039	-0.046000	0.11983	0.208000	0.20626	0.603000	0.83216	AGA	TSNARE1	-	NULL		0.652	TSNARE1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSNARE1	HGNC	protein_coding		C	NM_145003		143425329	-1	no_errors	ENST00000307180	ensembl	human	known	70_37	missense	SNP	0.907	G
TTLL10	254173	genome.wustl.edu	37	1	1111633	1111633	+	Intron	SNP	A	A	G	rs375448418	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:1111633A>G	ENST00000379290.1	+	3	146				TTLL10_ENST00000379289.1_Intron|TTLL10-AS1_ENST00000379317.1_RNA			Q6ZVT0	TTL10_HUMAN	tubulin tyrosine ligase-like family, member 10						cellular protein modification process (GO:0006464)					haematopoietic_and_lymphoid_tissue(3)|large_intestine(1)|lung(2)|skin(1)	7	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;9.48e-15)|all_lung(118;9.67e-07)|Lung NSC(185;5.59e-05)|Renal(390;0.00571)|Breast(487;0.0183)|Hepatocellular(190;0.0268)|Myeloproliferative disorder(586;0.028)|Ovarian(437;0.127)|Lung SC(97;0.217)		Epithelial(90;4.75e-36)|OV - Ovarian serous cystadenocarcinoma(86;5.82e-22)|Colorectal(212;3.94e-05)|COAD - Colon adenocarcinoma(227;4.22e-05)|Kidney(185;0.00227)|BRCA - Breast invasive adenocarcinoma(365;0.00461)|STAD - Stomach adenocarcinoma(132;0.00644)|KIRC - Kidney renal clear cell carcinoma(229;0.0339)|Lung(427;0.199)		GACGCTGTGCAGGTGGAGAGA	0.662													A|||	583	0.116414	0.2171	0.0519	5008	,	,		23196	0.121		0.0527	False		,,,				2504	0.0869																0																																										SO:0001627	intron_variant	100506376			AK093438	CCDS8.1, CCDS44036.1	1p36.33	2014-01-28	2005-07-29	2005-07-29	ENSG00000162571	ENSG00000162571		"""Tubulin tyrosine ligase-like family"""	26693	protein-coding gene	gene with protein product			"""tubulin tyrosine ligase-like family, member 5"""	TTLL5		15890843	Standard	NM_153254		Approved	FLJ36119	uc001acy.2	Q6ZVT0	OTTHUMG00000000851	ENST00000379290.1:c.-28+1764A>G	1.37:g.1111633A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AMF6|Q5T2W4|Q5T2W5|Q8N9X2	RNA	SNP	-	NULL	ENST00000379290.1	37	NULL	CCDS44036.1	1																																																																																			TTLL10-AS1	-	-		0.662	TTLL10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TTLL10-AS1	HGNC	protein_coding	OTTHUMT00000002421.3	A	NM_153254		1111633	-1	no_errors	ENST00000379317	ensembl	human	known	70_37	rna	SNP	0.979	G
TTLL8	164714	genome.wustl.edu	37	22	50472866	50472866	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr22:50472866G>A	ENST00000266182.6	-	9	946	c.947C>T	c.(946-948)aCg>aTg	p.T316M	TTLL8_ENST00000440475.1_Missense_Mutation_p.T300M			A6PVC2	TTLL8_HUMAN	tubulin tyrosine ligase-like family, member 8	336	TTL. {ECO:0000255|PROSITE- ProRule:PRU00568}.				cilium assembly (GO:0042384)|protein polyglycylation (GO:0018094)	axoneme (GO:0005930)|cilium (GO:0005929)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	protein-glycine ligase activity (GO:0070735)|protein-glycine ligase activity, initiating (GO:0070736)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|lung(6)|ovary(4)	12		all_cancers(38;3.44e-07)|all_epithelial(38;2.44e-06)|all_lung(38;0.00141)|Breast(42;0.00519)|Lung NSC(38;0.0199)|Ovarian(80;0.142)|Lung SC(80;0.162)		READ - Rectum adenocarcinoma(2;0.000882)|Colorectal(2;0.00311)|BRCA - Breast invasive adenocarcinoma(115;0.226)		GTTCACAGACGTGATTCTATT	0.527																																																	0													44.0	48.0	47.0					22																	50472866		1976	4175	6151	SO:0001583	missense	164714					22q13.33	2013-02-14			ENSG00000138892	ENSG00000138892		"""Tubulin tyrosine ligase-like family"""	34000	protein-coding gene	gene with protein product						15890843	Standard	XM_003403745		Approved			A6PVC2	OTTHUMG00000150241	ENST00000266182.6:c.947C>T	22.37:g.50472866G>A	ENSP00000266182:p.Thr316Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDV0	Missense_Mutation	SNP	pfam_Tub_tyr_ligase	p.T316M	ENST00000266182.6	37	c.947		22	.	.	.	.	.	.	.	.	.	.	G	3.248	-0.153853	0.06585	.	.	ENSG00000138892	ENST00000266182;ENST00000440475;ENST00000433387	T;T;T	0.42900	3.45;0.96;0.96	4.72	-3.56	0.04626	.	1.506590	0.03808	N	0.265433	T	0.16085	0.0387	N	0.11064	0.09	0.09310	N	1	P	0.35944	0.529	B	0.22601	0.04	T	0.08146	-1.0736	10	0.42905	T	0.14	.	0.2398	0.00191	0.3124:0.2316:0.2335:0.2225	.	316	B5MDV0	.	M	316;300;336	ENSP00000266182:T316M;ENSP00000387509:T300M;ENSP00000392252:T336M	ENSP00000266182:T316M	T	-	2	0	TTLL8	48814993	0.000000	0.05858	0.000000	0.03702	0.041000	0.13682	-0.129000	0.10515	-0.457000	0.07033	0.561000	0.74099	ACG	TTLL8	-	pfam_Tub_tyr_ligase		0.527	TTLL8-201	KNOWN	basic|appris_candidate_longest	protein_coding	TTLL8	HGNC	protein_coding		G	NM_001080447		50472866	-1	no_errors	ENST00000266182	ensembl	human	known	70_37	missense	SNP	0.000	A
TTN	7273	genome.wustl.edu	37	2	179484535	179484535	+	Silent	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:179484535G>C	ENST00000591111.1	-	200	41810	c.41586C>G	c.(41584-41586)ctC>ctG	p.L13862L	TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000589907.1_RNA|RP11-171I2.4_ENST00000605334.1_lincRNA|TTN_ENST00000359218.5_Silent_p.L6563L|TTN_ENST00000342992.6_Silent_p.L12935L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000456053.1_RNA|TTN_ENST00000460472.2_Silent_p.L6438L|TTN-AS1_ENST00000589487.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000342175.6_Silent_p.L6630L|TTN-AS1_ENST00000604956.1_RNA|TTN_ENST00000589042.1_Silent_p.L15503L			Q8WZ42	TITIN_HUMAN	titin	13862					adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TATCTTTATTGAGTTCTGCTA	0.398																																																	0													150.0	143.0	145.0					2																	179484535		1854	4090	5944	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.41586C>G	2.37:g.179484535G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L12935	ENST00000591111.1	37	c.38805		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	G	NM_133378		179484535	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	0.999	C
TUBB2A	7280	genome.wustl.edu	37	6	3154871	3154871	+	Silent	SNP	A	A	C	rs17849443	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:3154871A>C	ENST00000333628.3	-	4	626	c.564T>G	c.(562-564)tcT>tcG	p.S188S	TUBB2A_ENST00000489942.1_5'UTR|RP1-40E16.11_ENST00000447644.1_RNA	NM_001069.2	NP_001060.1	Q13885	TBB2A_HUMAN	tubulin, beta 2A class IIa	188					'de novo' posttranslational protein folding (GO:0051084)|cellular protein metabolic process (GO:0044267)|microtubule-based process (GO:0007017)|protein folding (GO:0006457)|protein polymerization (GO:0051258)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|nucleus (GO:0005634)|vesicle (GO:0031982)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural constituent of cytoskeleton (GO:0005200)			endometrium(2)|large_intestine(4)|lung(2)|skin(1)	9	Ovarian(93;0.0386)	all_hematologic(90;0.0895)				GCTGGTGGACAGAGAGGGTGG	0.567													A|||	2006	0.400559	0.1823	0.4496	5008	,	,		18775	0.4226		0.6819	False		,,,				2504	0.3487																0								A		859,3547		124,611,1468	188.0	100.0	130.0		564	-10.0	0.0	6	dbSNP_123	130	5483,3115		1998,1487,814	no	coding-synonymous	TUBB2A	NM_001069.2		2122,2098,2282	CC,CA,AA		36.2294,19.4961,48.7696		188/446	3154871	6342,6662	2203	4299	6502	SO:0001819	synonymous_variant	7280			AY159127	CCDS4484.1	6p25.2	2012-10-02	2011-10-10	2005-11-03	ENSG00000137267	ENSG00000137267		"""Tubulins"""	12412	protein-coding gene	gene with protein product	"""class IIa beta-tubulin"""	615101	"""tubulin, beta polypeptide"", ""tubulin, beta 2"", ""tubulin, beta 2A"""	TUBB, TUBB2		14574404	Standard	NM_001069		Approved	dJ40E16.7	uc003mvc.3	Q13885	OTTHUMG00000014135	ENST00000333628.3:c.564T>G	6.37:g.3154871A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6FGZ8|Q8IWR2	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Beta_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Gamma_tubulin,prints_Delta_tubulin,prints_Alpha_tubulin	p.S188	ENST00000333628.3	37	c.564	CCDS4484.1	6																																																																																			TUBB2A	-	pfam_Tubulin_FtsZ_GTPase,superfamily_Tubulin_FtsZ_GTPase,smart_Tubulin_FtsZ_GTPase,prints_Tubulin,prints_Delta_tubulin		0.567	TUBB2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBB2A	HGNC	protein_coding	OTTHUMT00000039662.1	A	NM_001069		3154871	-1	no_errors	ENST00000333628	ensembl	human	known	70_37	silent	SNP	0.003	C
TUBG2	27175	genome.wustl.edu	37	17	40818755	40818755	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:40818755C>T	ENST00000251412.7	+	11	1492	c.1293C>T	c.(1291-1293)ctC>ctT	p.L431L	PLEKHH3_ENST00000456950.2_5'Flank	NM_016437.2	NP_057521.1	Q9NRH3	TBG2_HUMAN	tubulin, gamma 2	431					cytoplasmic microtubule organization (GO:0031122)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	cytoplasmic microtubule (GO:0005881)|cytosol (GO:0005829)|gamma-tubulin complex (GO:0000930)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|pericentriolar material (GO:0000242)|spindle microtubule (GO:0005876)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	15		Breast(137;0.00116)		BRCA - Breast invasive adenocarcinoma(366;0.141)		TTCAGGAGCTCATTGATGAGT	0.537																																																	0													119.0	100.0	106.0					17																	40818755		2203	4300	6503	SO:0001819	synonymous_variant	27175			AF225971	CCDS32658.1	17q21.2	2014-09-04			ENSG00000037042	ENSG00000037042		"""Tubulins"""	12419	protein-coding gene	gene with protein product		605785					Standard	NM_016437		Approved		uc010wgr.2	Q9NRH3	OTTHUMG00000180640	ENST00000251412.7:c.1293C>T	17.37:g.40818755C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDI4|Q32NB2	Silent	SNP	pfam_Tubulin_FtsZ_GTPase,pfam_Tubulin/FtsZ_2-layer-sand-dom,pfam_Misato_II_myosin-like,superfamily_Tubulin_FtsZ_GTPase,superfamily_Tub_FtsZ_C,smart_Tubulin_FtsZ_GTPase,smart_Tubulin/FtsZ_2-layer-sand-dom,prints_Gamma_tubulin,prints_Tubulin,prints_Epsilon_tubulin,prints_Delta_tubulin,prints_Beta_tubulin,prints_Alpha_tubulin	p.L431	ENST00000251412.7	37	c.1293	CCDS32658.1	17																																																																																			TUBG2	-	superfamily_Tub_FtsZ_C,prints_Gamma_tubulin		0.537	TUBG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBG2	HGNC	protein_coding	OTTHUMT00000452326.1	C	NM_016437		40818755	+1	no_errors	ENST00000251412	ensembl	human	known	70_37	silent	SNP	1.000	T
TULP4	56995	genome.wustl.edu	37	6	158870081	158870081	+	Silent	SNP	A	A	G	rs705956	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:158870081A>G	ENST00000367097.3	+	4	1954	c.597A>G	c.(595-597)agA>agG	p.R199R	TULP4_ENST00000367094.2_Silent_p.R199R	NM_020245.4	NP_064630.2	Q9NRJ4	TULP4_HUMAN	tubby like protein 4	199			R -> S (in dbSNP:rs705956).		intracellular signal transduction (GO:0035556)|protein ubiquitination (GO:0016567)|regulation of transcription, DNA-templated (GO:0006355)|response to nutrient (GO:0007584)	cytoplasm (GO:0005737)	sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(7)|kidney(2)|large_intestine(15)|lung(17)|ovary(1)|pancreas(1)|prostate(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	49		Breast(66;0.000781)|Ovarian(120;0.0308)|Lung SC(201;0.164)|Prostate(117;0.171)		OV - Ovarian serous cystadenocarcinoma(65;1.64e-18)|BRCA - Breast invasive adenocarcinoma(81;2.67e-05)		GCCACGGCAGAATGCTGGCCC	0.612													G|||	3032	0.605431	0.7844	0.5288	5008	,	,		20217	0.3968		0.5895	False		,,,				2504	0.6493																0								G	,	3371,1035	381.6+/-324.1	1305,761,137	166.0	121.0	136.0		597,597	3.5	1.0	6	dbSNP_86	136	5009,3591	519.7+/-379.5	1469,2071,760	no	coding-synonymous,coding-synonymous	TULP4	NM_001007466.1,NM_020245.3	,	2774,2832,897	GG,GA,AA		41.7558,23.4907,35.5682	,	199/679,199/1544	158870081	8380,4626	2203	4300	6503	SO:0001819	synonymous_variant	56995				CCDS34561.1, CCDS34562.1	6q25-q26	2013-01-10			ENSG00000130338	ENSG00000130338		"""WD repeat domain containing"""	15530	protein-coding gene	gene with protein product						11595174	Standard	NM_020245		Approved	TUSP, KIAA1397	uc003qrf.3	Q9NRJ4	OTTHUMG00000015910	ENST00000367097.3:c.597A>G	6.37:g.158870081A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T3M2|Q5T3M3|Q9HD22|Q9P2F0	Silent	SNP	pfam_Tubby_C,pfam_SOCS_C,pfam_WD40_repeat,superfamily_Tubby_C-like,superfamily_WD40_repeat_dom,superfamily_Tumour_necrosis_fac-like,smart_WD40_repeat,smart_SOCS_C,pfscan_SOCS_C,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R199	ENST00000367097.3	37	c.597	CCDS34561.1	6																																																																																			TULP4	-	superfamily_WD40_repeat_dom,pfscan_WD40_repeat_dom		0.612	TULP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TULP4	HGNC	protein_coding	OTTHUMT00000042869.1	A	NM_020245		158870081	+1	no_errors	ENST00000367097	ensembl	human	known	70_37	silent	SNP	1.000	G
TXNIP	10628	genome.wustl.edu	37	1	145441217	145441217	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:145441217G>A	ENST00000369317.4	+	8	1509	c.1175G>A	c.(1174-1176)tGa>tAa	p.*392*	TXNIP_ENST00000475171.1_3'UTR	NM_006472.3	NP_006463.3	Q9H3M7	TXNIP_HUMAN	thioredoxin interacting protein	0					cell cycle (GO:0007049)|cellular response to tumor cell (GO:0071228)|innate immune response (GO:0045087)|keratinocyte differentiation (GO:0030216)|negative regulation of cell division (GO:0051782)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of apoptotic process (GO:0043065)|protein import into nucleus (GO:0006606)|regulation of cell proliferation (GO:0042127)|response to calcium ion (GO:0051592)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to glucose (GO:0009749)|response to hydrogen peroxide (GO:0042542)|response to mechanical stimulus (GO:0009612)|response to progesterone (GO:0032570)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|mitochondrial intermembrane space (GO:0005758)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)|ubiquitin protein ligase binding (GO:0031625)			breast(3)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(1)|lung(5)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	21	all_hematologic(18;0.0187)|Acute lymphoblastic leukemia(18;0.0786)					AATGTGCAGTGAGCATGTGGA	0.408																																																	0													111.0	105.0	107.0					1																	145441217		2203	4300	6503	SO:0001819	synonymous_variant	10628			S73591	CCDS72876.1	1q11	2008-07-18			ENSG00000117289	ENSG00000265972			16952	protein-coding gene	gene with protein product	"""upregulated by 1,25-dihydroxyvitamin D-3"", ""thioredoxin binding protein 2"""	606599				8086474	Standard	NM_006472		Approved	VDUP1, EST01027, HHCPA78, THIF	uc001enn.4	Q9H3M7	OTTHUMG00000013755	ENST00000369317.4:c.1175G>A	1.37:g.145441217G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3D3|Q16226|Q6PML0|Q9BXG9	Silent	SNP	pfam_Arrestin-like_N,pfam_Arrestin_C-like,superfamily_Ig_E-set	p.*392	ENST00000369317.4	37	c.1175	CCDS913.1	1																																																																																			TXNIP	-	NULL		0.408	TXNIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNIP	HGNC	protein_coding	OTTHUMT00000038547.1	G	NM_006472		145441217	+1	no_errors	ENST00000369317	ensembl	human	known	70_37	silent	SNP	0.999	A
TXNL4A	10907	genome.wustl.edu	37	18	77737623	77737623	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr18:77737623G>A	ENST00000269601.5	-	2	432	c.232C>T	c.(232-234)Cca>Tca	p.P78S	TXNL4A_ENST00000585474.1_Missense_Mutation_p.P7S|TXNL4A_ENST00000588162.1_Intron|TXNL4A_ENST00000591711.1_Missense_Mutation_p.P78S|TXNL4A_ENST00000592837.1_Missense_Mutation_p.P7S|TXNL4A_ENST00000592957.1_Missense_Mutation_p.P7S	NM_006701.2	NP_006692.1	P83876	TXN4A_HUMAN	thioredoxin-like 4A	78					gene expression (GO:0010467)|mitotic nuclear division (GO:0007067)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)|spliceosomal complex assembly (GO:0000245)	nucleoplasm (GO:0005654)|spliceosomal complex (GO:0005681)				breast(1)|large_intestine(1)|lung(3)	5		all_cancers(4;1.15e-12)|all_epithelial(4;8.61e-09)|all_lung(4;0.00366)|Lung NSC(4;0.00683)|Esophageal squamous(42;0.0212)|Ovarian(4;0.0646)|Melanoma(33;0.2)		OV - Ovarian serous cystadenocarcinoma(15;7.36e-07)|BRCA - Breast invasive adenocarcinoma(31;0.0249)		ACAGTACATGGATCGTATAAC	0.294																																					Ovarian(160;2333 2597 11821 36245)												0													127.0	124.0	125.0					18																	77737623		2203	4300	6503	SO:0001583	missense	10907			AF023612	CCDS32852.1	18q23	2013-07-16	2004-08-11	2004-08-12		ENSG00000141759			30551	protein-coding gene	gene with protein product	"""similar to S. pombe dim1+"""	611595	"""thioredoxin-like 4"""	TXNL4		11015569	Standard	NM_006701		Approved	U5-15kD, DIM1, HsT161, DIB1, SNRNP15	uc002lnp.3	P83876		ENST00000269601.5:c.232C>T	18.37:g.77737623G>A	ENSP00000269601:p.Pro78Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RC18|O14834	Missense_Mutation	SNP	pfam_mRNA_splic_U5,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,pirsf_mRNA_splic_U5	p.P78S	ENST00000269601.5	37	c.232	CCDS32852.1	18	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281894	0.80692	.	.	ENSG00000141759	ENST00000269601;ENST00000355491	.	.	.	5.72	5.72	0.89469	Thioredoxin-like fold (2);	0.000000	0.85682	D	0.000000	D	0.88858	0.6551	H	0.97465	4.01	0.80722	D	1	P;P	0.46142	0.873;0.863	P;P	0.56088	0.791;0.69	D	0.91457	0.5186	9	0.56958	D	0.05	-19.1613	19.4579	0.94903	0.0:0.0:1.0:0.0	.	78;78	O14835;P83876	.;TXN4A_HUMAN	S	78	.	ENSP00000269601:P78S	P	-	1	0	TXNL4A	75838611	1.000000	0.71417	0.911000	0.35937	0.535000	0.34838	8.348000	0.90064	2.700000	0.92200	0.453000	0.30009	CCA	TXNL4A	-	pfam_mRNA_splic_U5,pfam_Thioredoxin_domain,superfamily_Thioredoxin-like_fold,pirsf_mRNA_splic_U5		0.294	TXNL4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TXNL4A	HGNC	protein_coding	OTTHUMT00000451036.1	G	NM_006701		77737623	-1	no_errors	ENST00000269601	ensembl	human	known	70_37	missense	SNP	1.000	A
TYR	7299	genome.wustl.edu	37	11	89017961	89017961	+	Missense_Mutation	SNP	G	G	A	rs1126809	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:89017961G>A	ENST00000263321.5	+	4	1707	c.1205G>A	c.(1204-1206)cGa>cAa	p.R402Q		NM_000372.4	NP_000363.1	P14679	TYRO_HUMAN	tyrosinase	402			R -> G (in OCA1B).|R -> L (in OCA1A). {ECO:0000269|PubMed:15146472}.|R -> Q (in dbSNP:rs1126809). {ECO:0000269|PubMed:10987646, ECO:0000269|PubMed:15146472, ECO:0000269|PubMed:2342539, ECO:0000269|PubMed:7955413, ECO:0000269|PubMed:9158138}.		cell proliferation (GO:0008283)|eye pigment biosynthetic process (GO:0006726)|melanin biosynthetic process from tyrosine (GO:0006583)|thymus development (GO:0048538)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|Golgi-associated vesicle (GO:0005798)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|melanosome (GO:0042470)|perinuclear region of cytoplasm (GO:0048471)	copper ion binding (GO:0005507)|monophenol monooxygenase activity (GO:0004503)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(25)|ovary(2)|pancreas(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	48		Acute lymphoblastic leukemia(157;2.33e-05)|all_hematologic(158;0.0033)			Azelaic Acid(DB00548)|Mimosine(DB01055)|Monobenzone(DB00600)	CAGTGGCTCCGAAGGCACCGT	0.368													G|||	407	0.08127	0.0091	0.1254	5008	,	,		15773	0.001		0.2525	False		,,,				2504	0.0542																0			GRCh37	CM041478|CM971555	TYR	M	rs1126809	G	GLN/ARG	223,4179	130.2+/-166.9	8,207,1986	60.0	61.0	61.0	http://www.ncbi.nlm.nih.gov/sites/varvu?gene	1205	4.7	1.0	11	dbSNP_86	61	2418,6180	399.1+/-346.3	322,1774,2203	yes	missense	TYR	NM_000372.4	43	330,1981,4189	AA,AG,GG		28.1228,5.0659,20.3154	probably-damaging	402/530	89017961	2641,10359	2201	4299	6500	SO:0001583	missense	7299			M27160	CCDS8284.1	11q14.3	2013-09-27	2012-09-28		ENSG00000077498	ENSG00000077498	1.14.18.1		12442	protein-coding gene	gene with protein product	"""oculocutaneous albinism IA"""	606933					Standard	NM_000372		Approved	OCAIA, OCA1A, OCA1	uc001pcs.3	P14679	OTTHUMG00000167294	ENST00000263321.5:c.1205G>A	11.37:g.89017961G>A	ENSP00000263321:p.Arg402Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15675|Q15676|Q15680|Q8TAK4|Q9BYY0|Q9BZX1	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.R402Q	ENST00000263321.5	37	c.1205	CCDS8284.1	11	244	0.11172161172161173	5	0.01016260162601626	53	0.1464088397790055	0	0.0	186	0.24538258575197888	G	29.5	5.013726	0.93404	0.050659	0.281228	ENSG00000077498	ENST00000263321	D	0.98234	-4.81	4.68	4.68	0.58851	Tyrosinase (1);Uncharacterised domain, di-copper centre (2);	0.000000	0.85682	D	0.000000	T	0.00440	0.0014	M	0.66378	2.025	0.09310	P	0.999999826736	D	0.76494	0.999	D	0.80764	0.994	T	0.00000	-1.7609	8	.	.	.	.	17.6247	0.88091	0.0:0.0:1.0:0.0	rs62645918	402	P14679	TYRO_HUMAN	Q	402	ENSP00000263321:R402Q	.	R	+	2	0	TYR	88657609	1.000000	0.71417	0.999000	0.59377	0.990000	0.78478	7.499000	0.81566	2.166000	0.68216	0.555000	0.69702	CGA	TYR	-	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre		0.368	TYR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYR	HGNC	protein_coding	OTTHUMT00000394045.2	G	NM_000372		89017961	+1	no_errors	ENST00000263321	ensembl	human	known	70_37	missense	SNP	1.000	A
UBA6	55236	genome.wustl.edu	37	4	68511735	68511735	+	Splice_Site	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:68511735C>G	ENST00000322244.5	-	16	1376		c.e16-1			NM_018227.5	NP_060697.4	A0AVT1	UBA6_HUMAN	ubiquitin-like modifier activating enzyme 6						protein ubiquitination (GO:0016567)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|cytosol (GO:0005829)	ATP binding (GO:0005524)|FAT10 activating enzyme activity (GO:0019780)|ligase activity (GO:0016874)			central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(6)|liver(1)|lung(23)|skin(2)|upper_aerodigestive_tract(2)	44						TCTATCTCCTCTGAAAAAAAT	0.279																																																	0													55.0	59.0	58.0					4																	68511735		2201	4298	6499	SO:0001630	splice_region_variant	55236			AK094164	CCDS3516.1	4q13.2	2008-02-05	2007-11-30	2007-11-30	ENSG00000033178	ENSG00000033178		"""Ubiquitin-like modifier activating enzymes"""	25581	protein-coding gene	gene with protein product	"""UBA6, ubiquitin-activating enzyme E1"""	611361	"""ubiquitin-activating enzyme E1-like 2"""	UBE1L2		17580310	Standard	NM_018227		Approved	FLJ10808	uc003hdg.4	A0AVT1	OTTHUMG00000129299	ENST00000322244.5:c.1317-1G>C	4.37:g.68511735C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6N8M7|B2RAV3|Q4W5K0|Q6UV21|Q86T78|Q86TC7|Q8N5T3|Q8N9E4|Q9H3T7|Q9NVC9	Splice_Site	SNP	-	e16-1	ENST00000322244.5	37	c.1317-1	CCDS3516.1	4	.	.	.	.	.	.	.	.	.	.	C	14.06	2.423248	0.43020	.	.	ENSG00000033178	ENST00000322244	.	.	.	5.33	5.33	0.75918	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	19.0224	0.92920	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	UBA6	68194330	1.000000	0.71417	0.976000	0.42696	0.258000	0.26162	5.826000	0.69293	2.468000	0.83385	0.467000	0.42956	.	UBA6	-	-		0.279	UBA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBA6	HGNC	protein_coding	OTTHUMT00000251429.2	C	NM_018227	Intron	68511735	-1	no_errors	ENST00000322244	ensembl	human	known	70_37	splice_site	SNP	1.000	G
UBC	7316	genome.wustl.edu	37	12	125397061	125397061	+	Silent	SNP	G	G	A	rs17840844	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr12:125397061G>A	ENST00000536769.1	-	1	2833	c.1257C>T	c.(1255-1257)gaC>gaT	p.D419D	UBC_ENST00000538617.1_Intron|UBC_ENST00000536661.1_5'Flank|UBC_ENST00000339647.5_Silent_p.D419D|UBC_ENST00000546120.1_Silent_p.D343D			P0CG48	UBC_HUMAN	ubiquitin C	419	Ubiquitin-like 6. {ECO:0000255|PROSITE- ProRule:PRU00214}.				activation of MAPK activity (GO:0000187)|anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|carbohydrate metabolic process (GO:0005975)|cellular response to hypoxia (GO:0071456)|cytokine-mediated signaling pathway (GO:0019221)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|DNA repair (GO:0006281)|endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G1/S transition of mitotic cell cycle (GO:0000082)|G2/M transition of mitotic cell cycle (GO:0000086)|gene expression (GO:0010467)|glucose metabolic process (GO:0006006)|glycogen biosynthetic process (GO:0005978)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|intracellular transport of virus (GO:0075733)|ion transmembrane transport (GO:0034220)|JNK cascade (GO:0007254)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of apoptotic process (GO:0043066)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|negative regulation of type I interferon production (GO:0032480)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|neurotrophin TRK receptor signaling pathway (GO:0048011)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of apoptotic process (GO:0043065)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of type I interferon production (GO:0032479)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|stress-activated MAPK cascade (GO:0051403)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|transmembrane transport (GO:0055085)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	poly(A) RNA binding (GO:0044822)|protease binding (GO:0002020)			breast(3)|endometrium(4)|kidney(4)|large_intestine(2)|lung(13)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;6.17e-05)|Epithelial(86;0.000207)|all cancers(50;0.00308)		ACCTCTGCTGGTCAGGAGGGA	0.537													G|||	1838	0.367013	0.1657	0.4308	5008	,	,		31861	0.2103		0.5686	False		,,,				2504	0.5481																0													54.0	52.0	53.0					12																	125397061		2150	4211	6361	SO:0001819	synonymous_variant	7316				CCDS9260.1	12q24.3	2008-09-08			ENSG00000150991	ENSG00000150991			12468	protein-coding gene	gene with protein product	"""polyubiquitin-C"""	191340				1315303, 11872750	Standard	NM_021009		Approved		uc001ugs.4	P0CG48		ENST00000536769.1:c.1257C>T	12.37:g.125397061G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	P02248|P02249|P02250|P62988|Q29120|Q6LBL4|Q6LDU5|Q8WYN8|Q91887|Q91888|Q9BWD6|Q9BX98|Q9UEF2|Q9UEG1|Q9UEK8|Q9UPK7	Silent	SNP	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup,prints_Ubiquitin_subgr	p.D419	ENST00000536769.1	37	c.1257	CCDS9260.1	12																																																																																			UBC	-	pfam_Ubiquitin,pfam_SUMO,smart_Ubiquitin,pfscan_Ubiquitin_supergroup		0.537	UBC-007	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UBC	HGNC	protein_coding	OTTHUMT00000400177.1	G	NM_021009		125397061	-1	no_errors	ENST00000339647	ensembl	human	known	70_37	silent	SNP	1.000	A
UBR3	130507	genome.wustl.edu	37	2	170728794	170728794	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:170728794C>T	ENST00000272793.5	+	2	644	c.594C>T	c.(592-594)gtC>gtT	p.V198V	UBR3_ENST00000418381.1_Silent_p.V198V			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	198					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						TTCCCTGTGTCCCTAAAGACT	0.289																																																	0													132.0	117.0	121.0					2																	170728794		692	1574	2266	SO:0001819	synonymous_variant	130507			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.594C>T	2.37:g.170728794C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Silent	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.V198	ENST00000272793.5	37	c.594		2																																																																																			UBR3	-	NULL		0.289	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	C	NM_172070		170728794	+1	no_errors	ENST00000272793	ensembl	human	known	70_37	silent	SNP	0.996	T
UBR4	23352	genome.wustl.edu	37	1	19408294	19408295	+	Intron	INS	-	-	C	rs75559748|rs67232976	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:19408294_19408295insC	ENST00000375254.3	-	103	15036				UBR4_ENST00000375226.2_Intron|UBR4_ENST00000429347.2_Intron|UBR4_ENST00000375225.3_Frame_Shift_Ins_p.P3fs|UBR4_ENST00000375267.2_Intron|AL137127.1_ENST00000582644.1_RNA|UBR4_ENST00000543981.1_Intron|UBR4_ENST00000375217.2_Intron|UBR4_ENST00000375224.1_Intron	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4						protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		TTCTTCCCTGGCCCCATGTCTA	0.545													CCCCC|CCCC|CCCCC|deletion	1850	0.369409	0.3351	0.4236	5008	,	,		18797	0.3611		0.4026	False		,,,				2504	0.3517																0																																										SO:0001627	intron_variant	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.15009-227->G	1.37:g.19408298_19408298dupC		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Frame_Shift_Ins	INS	NULL	p.P2fs	ENST00000375254.3	37	c.7_6	CCDS189.1	1																																																																																			UBR4	-	NULL		0.545	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	-	NM_020765		19408295	-1	no_errors	ENST00000375225	ensembl	human	known	70_37	frame_shift_ins	INS	0.000:0.000	C
UBR4	23352	genome.wustl.edu	37	1	19513763	19513763	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:19513763C>G	ENST00000375254.3	-	13	1554	c.1527G>C	c.(1525-1527)ttG>ttC	p.L509F	UBR4_ENST00000375226.2_Missense_Mutation_p.L509F|UBR4_ENST00000375267.2_Missense_Mutation_p.L509F|UBR4_ENST00000375217.2_Missense_Mutation_p.L509F	NM_020765.2	NP_065816.2	Q5T4S7	UBR4_HUMAN	ubiquitin protein ligase E3 component n-recognin 4	509					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(7)|central_nervous_system(1)|cervix(2)|endometrium(23)|kidney(25)|large_intestine(25)|liver(2)|lung(47)|ovary(10)|pancreas(2)|prostate(7)|skin(5)|stomach(5)|upper_aerodigestive_tract(4)|urinary_tract(6)	171		Colorectal(325;3.46e-05)|Renal(390;0.000147)|all_lung(284;0.000328)|Lung NSC(340;0.000406)|Breast(348;0.000814)|Ovarian(437;0.00774)|Myeloproliferative disorder(586;0.0256)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00674)|BRCA - Breast invasive adenocarcinoma(304;5.43e-05)|Kidney(64;0.000337)|KIRC - Kidney renal clear cell carcinoma(64;0.00426)|STAD - Stomach adenocarcinoma(196;0.00715)|READ - Rectum adenocarcinoma(331;0.0816)		CCATAATGCTCAAGGCTGCAG	0.473																																																	0													88.0	79.0	82.0					1																	19513763		2203	4300	6503	SO:0001583	missense	23352			AF348492	CCDS189.1	1p36.13	2008-06-23	2007-06-19	2007-06-19	ENSG00000127481	ENSG00000127481		"""Ubiquitin protein ligase E3 component n-recognins"""	30313	protein-coding gene	gene with protein product		609890	"""zinc finger, UBR1 type 1"""	ZUBR1		14702039, 10718198, 16055722	Standard	XM_005245802		Approved	KIAA1307, KIAA0462, RBAF600	uc001bbi.3	Q5T4S7	OTTHUMG00000002498	ENST00000375254.3:c.1527G>C	1.37:g.19513763C>G	ENSP00000364403:p.Leu509Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MPT2|A8MQ33|A8MQB1|O60646|O75050|Q4QRK5|Q5T4S8|Q5T4S9|Q5TBN8|Q5TBP2|Q6DKH8|Q6P4A4|Q7L8P7|Q8IXJ4|Q8TDN5|Q8WV67|Q9HA46|Q9P2N9|Q9UG82	Missense_Mutation	SNP	superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.L509F	ENST00000375254.3	37	c.1527	CCDS189.1	1	.	.	.	.	.	.	.	.	.	.	C	8.565	0.878771	0.17395	.	.	ENSG00000127481	ENST00000375254;ENST00000375267;ENST00000375217;ENST00000375226	T;T;T;T	0.32515	1.47;1.47;1.45;1.45	5.97	3.96	0.45880	.	0.000000	0.64402	D	0.000001	T	0.33381	0.0861	N	0.20685	0.6	0.80722	D	1	D	0.65815	0.995	D	0.72982	0.979	T	0.06250	-1.0837	10	0.19590	T	0.45	.	8.8414	0.35144	0.0:0.6354:0.2888:0.0758	.	509	Q5T4S7	UBR4_HUMAN	F	509	ENSP00000364403:L509F;ENSP00000364416:L509F;ENSP00000364365:L509F;ENSP00000364374:L509F	ENSP00000364365:L509F	L	-	3	2	UBR4	19386350	1.000000	0.71417	0.967000	0.41034	0.828000	0.46876	0.812000	0.27211	1.481000	0.48307	0.655000	0.94253	TTG	UBR4	-	NULL		0.473	UBR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBR4	HGNC	protein_coding	OTTHUMT00000007085.1	C	NM_020765		19513763	-1	no_errors	ENST00000375267	ensembl	human	known	70_37	missense	SNP	1.000	G
UHRF2	115426	genome.wustl.edu	37	9	6499822	6499822	+	Intron	DEL	C	C	-	rs57099869	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr9:6499822delC	ENST00000276893.5	+	13	2076				UHRF2_ENST00000485617.2_Intron	NM_152896.2	NP_690856.1	Q96PU4	UHRF2_HUMAN	ubiquitin-like with PHD and ring finger domains 2, E3 ubiquitin protein ligase						cell cycle (GO:0007049)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|positive regulation of cell cycle arrest (GO:0071158)|protein autoubiquitination (GO:0051865)|protein ubiquitination (GO:0016567)|regulation of cell cycle (GO:0051726)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone binding (GO:0042393)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			cervix(2)|endometrium(2)|kidney(3)|large_intestine(4)|lung(5)|ovary(1)	17		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.0392)|Lung(218;0.129)		TCTCCCTCCTCCCCCCCCATC	0.488														1461	0.291733	0.5318	0.2651	5008	,	,		16578	0.246		0.163	False		,,,				2504	0.1656																0													25.0	33.0	30.0					9																	6499822		2191	4298	6489	SO:0001627	intron_variant	115426			AF274049	CCDS6469.1	9p24.1	2013-01-28	2012-02-23		ENSG00000147854	ENSG00000147854		"""RING-type (C3HC4) zinc fingers"", ""Zinc fingers, PHD-type"""	12557	protein-coding gene	gene with protein product	"""Np95-like ring finger protein"""	615211	"""ubiquitin-like with PHD and ring finger domains 2"""			12176013	Standard	NM_152896		Approved	RNF107, NIRF, URF2, MGC33463	uc003zjy.3	Q96PU4	OTTHUMG00000019521	ENST00000276893.5:c.1909-13C>-	9.37:g.6499822delC		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYR1|Q5VYR3|Q659C8|Q8TAG7	RNA	DEL	-	NULL	ENST00000276893.5	37	NULL	CCDS6469.1	9																																																																																			UHRF2	-	-		0.488	UHRF2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF2	HGNC	protein_coding	OTTHUMT00000051665.3	C	NM_152306		6499822	+1	no_errors	ENST00000492853	ensembl	human	known	70_37	rna	DEL	0.000	-
ULK4P2	100288380	genome.wustl.edu	37	15	30888946	30888946	+	RNA	SNP	T	T	A	rs71478486	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:30888946T>A	ENST00000569682.1	+	0	252									ULK4 pseudogene 2																		GTTGAGGTAATGTCTTTTATG	0.403													t|||	1784	0.35623	0.5741	0.3357	5008	,	,		18580	0.1498		0.339	False		,,,				2504	0.3067																0																																												100288380					15q13.2	2013-09-12	2013-09-12	2011-11-25	ENSG00000260128	ENSG00000260128			15776	pseudogene	pseudogene			"""family with sequence similarity 7, member A2"", ""unc-51-like kinase 4 (C. elegans) pseudogene 2"""	FAM7A2		11829490	Standard	NR_027470		Approved	D-X			OTTHUMG00000175653		15.37:g.30888946T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000569682.1	37	NULL		15																																																																																			ULK4P2	-	-		0.403	ULK4P2-002	PUTATIVE	basic	processed_transcript	ULK4P2	HGNC	pseudogene	OTTHUMT00000430722.1	T			30888946	+1	no_errors	ENST00000566793	ensembl	human	putative	70_37	rna	SNP	0.164	A
UNC79	57578	genome.wustl.edu	37	14	94079237	94079237	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr14:94079237G>A	ENST00000393151.2	+	27	3849	c.3849G>A	c.(3847-3849)gtG>gtA	p.V1283V	UNC79_ENST00000256339.4_Silent_p.V1106V|UNC79_ENST00000555664.1_Silent_p.V1283V|UNC79_ENST00000553484.1_Silent_p.V1305V			Q9P2D8	UNC79_HUMAN	unc-79 homolog (C. elegans)	1283					behavioral response to ethanol (GO:0048149)|ion transmembrane transport (GO:0034220)|multicellular organism growth (GO:0035264)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(3)|cervix(2)|endometrium(10)|kidney(7)|large_intestine(18)|liver(1)|lung(64)|ovary(1)|prostate(5)|skin(3)|urinary_tract(4)	118						TGATTACAGTGCTCATGAAGT	0.517																																																	0													128.0	107.0	114.0					14																	94079237		2203	4300	6503	SO:0001819	synonymous_variant	57578			AB037830	CCDS9911.2	14q32.13	2011-08-18	2011-08-18	2011-08-18	ENSG00000133958	ENSG00000133958			19966	protein-coding gene	gene with protein product			"""KIAA1409"""	KIAA1409		20714347, 21040849	Standard	NM_020818		Approved		uc001ybs.1	Q9P2D8	OTTHUMG00000029783	ENST00000393151.2:c.3849G>A	14.37:g.94079237G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDL6|Q6ZUT7	Silent	SNP	superfamily_ARM-type_fold	p.V1305	ENST00000393151.2	37	c.3915		14																																																																																			UNC79	-	superfamily_ARM-type_fold		0.517	UNC79-006	KNOWN	basic	protein_coding	UNC79	HGNC	protein_coding	OTTHUMT00000412766.1	G	XM_028395		94079237	+1	no_errors	ENST00000553484	ensembl	human	known	70_37	silent	SNP	1.000	A
USP10	9100	genome.wustl.edu	37	16	84808824	84808824	+	Silent	SNP	C	C	G	rs774298	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:84808824C>G	ENST00000219473.7	+	13	2315	c.2202C>G	c.(2200-2202)ctC>ctG	p.L734L	USP10_ENST00000570191.1_Silent_p.L738L	NM_001272075.1|NM_005153.2	NP_001259004.1|NP_005144.2	Q14694	UBP10_HUMAN	ubiquitin specific peptidase 10	734	USP.				autophagy (GO:0006914)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA repair (GO:0006281)|protein deubiquitination (GO:0016579)|regulation of autophagy (GO:0010506)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|early endosome (GO:0005769)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ion channel binding (GO:0044325)|p53 binding (GO:0002039)|poly(A) RNA binding (GO:0044822)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)	p.L734L(1)		endometrium(3)|kidney(1)|large_intestine(7)|lung(3)|prostate(1)|stomach(1)|urinary_tract(1)	17						CCTATCGGCTCTTTGCAGGTG	0.398													c|||	2179	0.435104	0.3079	0.3818	5008	,	,		20790	0.506		0.6163	False		,,,				2504	0.3855																1	Substitution - coding silent(1)	stomach(1)						C		1235,2437		217,801,818	74.0	71.0	72.0		2202	-9.5	0.8	16	dbSNP_86	72	5013,3165		1528,1957,604	no	coding-synonymous	USP10	NM_005153.2		1745,2758,1422	GG,GC,CC		38.7014,33.6329,47.2743		734/799	84808824	6248,5602	1836	4089	5925	SO:0001819	synonymous_variant	9100			D80012	CCDS45537.1, CCDS62004.1	16q	2008-03-25	2005-08-08			ENSG00000103194		"""Ubiquitin-specific peptidases"""	12608	protein-coding gene	gene with protein product		609818	"""ubiquitin specific protease 10"""			12838346	Standard	NM_005153		Approved	UBPO, KIAA0190	uc002fii.3	Q14694		ENST00000219473.7:c.2202C>G	16.37:g.84808824C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDJ8|B4DS84|Q9BWG7|Q9NSL7	Silent	SNP	pfam_Peptidase_C19,pfam_Ataxin-2_C,pfscan_Peptidase_C19	p.L738	ENST00000219473.7	37	c.2214	CCDS45537.1	16																																																																																			USP10	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.398	USP10-001	KNOWN	upstream_ATG|basic|appris_principal|CCDS	protein_coding	USP10	HGNC	protein_coding	OTTHUMT00000433660.1	C			84808824	+1	no_errors	ENST00000570191	ensembl	human	known	70_37	silent	SNP	0.820	G
USP17L2	377630	genome.wustl.edu	37	8	11995785	11995785	+	Missense_Mutation	SNP	T	T	A	rs202050503	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:11995785T>A	ENST00000333796.3	-	1	801	c.485A>T	c.(484-486)cAt>cTt	p.H162L	FAM66D_ENST00000434078.2_RNA	NM_001256869.1|NM_001256871.1|NM_001256872.1|NM_001256873.1|NM_001256874.1|NM_201402.2	NP_001243798.1|NP_001243800.1|NP_001243801.1|NP_001243802.1|NP_001243803.1|NP_958804.2	Q6R6M4	U17L2_HUMAN	ubiquitin specific peptidase 17-like family member 2	162	USP.				apoptotic process (GO:0006915)|CAAX-box protein processing (GO:0071586)|cell cycle checkpoint (GO:0000075)|mitotic cell cycle checkpoint (GO:0007093)|negative regulation of histone deacetylation (GO:0031064)|negative regulation of protein processing (GO:0010955)|negative regulation of protein targeting to membrane (GO:0090315)|negative regulation of Ras GTPase activity (GO:0034261)|positive regulation of MDA-5 signaling pathway (GO:1900245)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of RIG-I signaling pathway (GO:1900246)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of apoptotic process (GO:0042981)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of defense response to virus by host (GO:0050691)|regulation of ruffle assembly (GO:1900027)|ubiquitin-dependent protein catabolic process (GO:0006511)	endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			central_nervous_system(1)|kidney(1)|large_intestine(11)|liver(1)|lung(8)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	29						GAGAAATTCATGGGCATCTTC	0.532													T|||	307	0.0613019	0.0469	0.0677	5008	,	,		23378	0.001		0.0974	False		,,,				2504	0.1012																0													6.0	7.0	7.0					8																	11995785		951	2134	3085	SO:0001583	missense	377630			BC156290	CCDS43713.1	8p23.1	2012-10-09	2012-10-09		ENSG00000223443	ENSG00000223443			34434	protein-coding gene	gene with protein product	"""deubiquitinating enzyme 3"""	610186	"""ubiquitin specific peptidase 17-like 2"""				Standard	NM_201402		Approved	DUB3	uc003wvc.1	Q6R6M4	OTTHUMG00000165295	ENST00000333796.3:c.485A>T	8.37:g.11995785T>A	ENSP00000333329:p.His162Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_HABP4_PAIRBP1-bd,pfscan_Peptidase_C19	p.H162L	ENST00000333796.3	37	c.485	CCDS43713.1	8	.	.	.	.	.	.	.	.	.	.	T	15.26	2.782069	0.49891	.	.	ENSG00000223443	ENST00000333796	T	0.06142	3.34	0.745	0.745	0.18359	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.000000	0.64402	D	0.000001	T	0.22859	0.0552	M	0.90369	3.11	0.28205	P	0.9271922	D	0.76494	0.999	D	0.83275	0.996	T	0.16129	-1.0413	9	0.87932	D	0	.	3.8607	0.08994	0.0:0.0:0.0:1.0	.	162	Q6R6M4	U17L2_HUMAN	L	162	ENSP00000333329:H162L	ENSP00000333329:H162L	H	-	2	0	USP17L2	12033194	1.000000	0.71417	0.411000	0.26484	0.226000	0.24999	2.084000	0.41625	0.611000	0.30052	0.386000	0.25728	CAT	USP17L2	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.532	USP17L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP17L2	HGNC	protein_coding	OTTHUMT00000383303.2	T	NM_201402		11995785	-1	no_errors	ENST00000333796	ensembl	human	known	70_37	missense	SNP	1.000	A
USP9X	8239	genome.wustl.edu	37	X	41029361	41029361	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chrX:41029361G>A	ENST00000324545.8	+	19	3383	c.2750G>A	c.(2749-2751)cGa>cAa	p.R917Q	USP9X_ENST00000378308.2_Missense_Mutation_p.R917Q	NM_001039590.2|NM_001039591.2	NP_001034679.2|NP_001034680.2	Q93008	USP9X_HUMAN	ubiquitin specific peptidase 9, X-linked	917					axon extension (GO:0048675)|BMP signaling pathway (GO:0030509)|cerebellar cortex structural organization (GO:0021698)|chromosome segregation (GO:0007059)|female gamete generation (GO:0007292)|gene expression (GO:0010467)|hippocampus development (GO:0021766)|in utero embryonic development (GO:0001701)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron migration (GO:0001764)|post-embryonic development (GO:0009791)|protein deubiquitination (GO:0016579)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|ubiquitin-dependent protein catabolic process (GO:0006511)	apical part of cell (GO:0045177)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|growth cone (GO:0030426)|membrane (GO:0016020)	co-SMAD binding (GO:0070410)|cysteine-type endopeptidase activity (GO:0004197)|cysteine-type peptidase activity (GO:0008234)|ubiquitin thiolesterase activity (GO:0004221)			NS(3)|breast(6)|central_nervous_system(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(6)|large_intestine(16)|lung(29)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87						TCAGTACGACGATGTATTCTC	0.413																																					Ovarian(172;1807 2695 35459 49286)												0													141.0	127.0	132.0					X																	41029361		2182	4292	6474	SO:0001583	missense	8239			X98296	CCDS43930.1, CCDS55403.1	Xp11.4	2010-08-03	2006-02-14		ENSG00000124486	ENSG00000124486		"""Ubiquitin-specific peptidases"""	12632	protein-coding gene	gene with protein product		300072	"""ubiquitin specific protease 9, X chromosome (fat facets-like Drosophila)"", ""ubiquitin specific protease 9, X-linked (fat facets-like, Drosophila)"", ""ubiquitin specific peptidase 9, X-linked (fat facets-like, Drosophila)"""			8922996	Standard	NM_001039590		Approved	DFFRX, FAF	uc004dfb.3	Q93008	OTTHUMG00000021367	ENST00000324545.8:c.2750G>A	X.37:g.41029361G>A	ENSP00000316357:p.Arg917Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O75550|Q8WWT3|Q8WX12	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.R917Q	ENST00000324545.8	37	c.2750	CCDS43930.1	X	.	.	.	.	.	.	.	.	.	.	G	33	5.267822	0.95399	.	.	ENSG00000124486	ENST00000378308;ENST00000324545	T;T	0.03301	3.98;3.98	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	T	0.18257	0.0438	M	0.78801	2.425	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	T	0.15925	-1.0420	10	0.13470	T	0.59	.	19.0483	0.93030	0.0:0.0:1.0:0.0	.	917;917	Q93008-1;Q93008	.;USP9X_HUMAN	Q	917	ENSP00000367558:R917Q;ENSP00000316357:R917Q	ENSP00000316357:R917Q	R	+	2	0	USP9X	40914305	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.869000	0.99810	2.448000	0.82819	0.594000	0.82650	CGA	USP9X	-	NULL		0.413	USP9X-003	KNOWN	basic|CCDS	protein_coding	USP9X	HGNC	protein_coding	OTTHUMT00000056250.4	G	NM_004652		41029361	+1	no_errors	ENST00000324545	ensembl	human	known	70_37	missense	SNP	1.000	A
UVSSA	57654	genome.wustl.edu	37	4	1377703	1377703	+	Missense_Mutation	SNP	C	C	T	rs372587885		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr4:1377703C>T	ENST00000389851.4	+	13	2458	c.2011C>T	c.(2011-2013)Cgc>Tgc	p.R671C	UVSSA_ENST00000512728.1_Missense_Mutation_p.R222C|UVSSA_ENST00000511216.1_Missense_Mutation_p.R671C|UVSSA_ENST00000511563.1_Missense_Mutation_p.R222C|UVSSA_ENST00000507531.1_Missense_Mutation_p.R671C	NM_020894.2	NP_065945.2	Q2YD98	UVSSA_HUMAN	UV-stimulated scaffold protein A	671					protein ubiquitination (GO:0016567)|response to UV (GO:0009411)|transcription-coupled nucleotide-excision repair (GO:0006283)	chromosome (GO:0005694)	RNA polymerase II core binding (GO:0000993)										CGCCCGCGCTCGCATTGGGAG	0.637																																																	0								C	CYS/ARG	2,4402	4.2+/-10.8	0,2,2200	69.0	62.0	64.0		2011	2.9	0.2	4		64	0,8600		0,0,4300	no	missense	KIAA1530	NM_020894.2	180	0,2,6500	TT,TC,CC		0.0,0.0454,0.0154	benign	671/710	1377703	2,13002	2202	4300	6502	SO:0001583	missense	57654			BC021930	CCDS33938.1	4p16.3	2012-04-27	2012-04-27	2012-04-27		ENSG00000163945			29304	protein-coding gene	gene with protein product		614632	"""KIAA1530"""	KIAA1530		10819331, 22466610, 22466611, 22466612	Standard	NM_020894		Approved		uc003gde.4	Q2YD98		ENST00000389851.4:c.2011C>T	4.37:g.1377703C>T	ENSP00000374501:p.Arg671Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9E6|B2RU11|Q8WTX4|Q9P1Z8	Missense_Mutation	SNP	pfam_DUF2043,superfamily_ENTH_VHS	p.R671C	ENST00000389851.4	37	c.2011	CCDS33938.1	4	.	.	.	.	.	.	.	.	.	.	C	10.47	1.358757	0.24598	4.54E-4	0.0	ENSG00000163945	ENST00000511216;ENST00000389851;ENST00000507531;ENST00000511563;ENST00000512728	T;T;T;T;T	0.60040	0.59;0.59;0.59;0.22;0.22	4.98	2.92	0.33932	.	0.054303	0.64402	N	0.000001	T	0.47002	0.1422	L	0.56199	1.76	0.80722	D	1	B	0.32128	0.357	B	0.20577	0.03	T	0.53521	-0.8427	10	0.87932	D	0	.	9.8379	0.40980	0.1797:0.7437:0.0:0.0765	.	671	Q2YD98	K1530_HUMAN	C	671;671;671;222;222	ENSP00000425130:R671C;ENSP00000374501:R671C;ENSP00000421741:R671C;ENSP00000423340:R222C;ENSP00000427701:R222C	ENSP00000374501:R671C	R	+	1	0	KIAA1530	1367703	0.970000	0.33590	0.203000	0.23512	0.320000	0.28249	2.288000	0.43514	1.229000	0.43630	0.499000	0.49734	CGC	UVSSA	-	NULL		0.637	UVSSA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UVSSA	HGNC	protein_coding	OTTHUMT00000359480.1	C	NM_020894		1377703	+1	no_errors	ENST00000389851	ensembl	human	known	70_37	missense	SNP	0.778	T
VCAN	1462	genome.wustl.edu	37	5	82837569	82837569	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr5:82837569C>T	ENST00000265077.3	+	8	9312	c.8747C>T	c.(8746-8748)tCt>tTt	p.S2916F	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Intron|VCAN_ENST00000343200.5_Missense_Mutation_p.S1929F|VCAN-AS1_ENST00000513899.1_RNA|VCAN_ENST00000512590.2_Intron|VCAN-AS1_ENST00000512090.1_RNA|VCAN_ENST00000513016.1_3'UTR	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	2916	GAG-beta.				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	ATGGAAGCTTCTCCCACAGAA	0.403																																																	0													73.0	78.0	76.0					5																	82837569		2203	4299	6502	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.8747C>T	5.37:g.82837569C>T	ENSP00000265077:p.Ser2916Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.S2916F	ENST00000265077.3	37	c.8747	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	C	13.12	2.141742	0.37825	.	.	ENSG00000038427	ENST00000265077;ENST00000343200	T;T	0.18960	2.18;2.18	6.03	4.03	0.46877	.	0.518704	0.19425	N	0.114599	T	0.20047	0.0482	L	0.59436	1.845	0.20926	N	0.999828	B;B	0.24368	0.102;0.013	B;B	0.23018	0.043;0.014	T	0.19877	-1.0292	10	0.46703	T	0.11	.	6.7025	0.23232	0.1367:0.6898:0.0:0.1735	.	1929;2916	P13611-2;P13611	.;CSPG2_HUMAN	F	2916;1929	ENSP00000265077:S2916F;ENSP00000340062:S1929F	ENSP00000265077:S2916F	S	+	2	0	VCAN	82873325	0.835000	0.29415	0.236000	0.24074	0.243000	0.25628	1.433000	0.34947	0.690000	0.31570	0.655000	0.94253	TCT	VCAN	-	NULL		0.403	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	C	NM_004385		82837569	+1	no_errors	ENST00000265077	ensembl	human	known	70_37	missense	SNP	0.162	T
VNN3	55350	genome.wustl.edu	37	6	133044194	133044194	+	Splice_Site	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr6:133044194C>T	ENST00000414302.2	-	6	1183		c.e6-1		VNN3_ENST00000207771.3_Splice_Site|VNN3_ENST00000425515.2_Splice_Site|VNN3_ENST00000423615.2_Splice_Site|VNN3_ENST00000275223.3_Splice_Site|VNN3_ENST00000417437.2_Splice_Site|VNN3_ENST00000367927.5_Splice_Site|VNN3_ENST00000519686.2_Splice_Site|VNN3_ENST00000427187.2_Splice_Site|VNN3_ENST00000392393.3_Splice_Site|VNN3_ENST00000509351.1_3'UTR			Q9NY84	VNN3_HUMAN	vanin 3						nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)			cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		CTCTTGAAATCTGGTCAAAGA	0.488																																																	0													70.0	58.0	62.0					6																	133044194		876	1991	2867	SO:0001630	splice_region_variant	55350			AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000414302.2:c.400-1G>A	6.37:g.133044194C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	Splice_Site	SNP	-	e8-1	ENST00000414302.2	37	c.1375-1		6	.	.	.	.	.	.	.	.	.	.	C	14.07	2.425191	0.43020	.	.	ENSG00000093134	ENST00000207771	.	.	.	5.18	3.39	0.38822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	9.3372	0.38058	0.0:0.8303:0.0:0.1697	.	.	.	.	.	-1	.	.	.	-	.	.	VNN3	133085887	0.989000	0.36119	0.810000	0.32431	0.720000	0.41350	1.543000	0.36147	0.677000	0.31305	0.563000	0.77884	.	VNN3	-	-		0.488	VNN3-008	KNOWN	NMD_exception|basic|exp_conf	protein_coding	VNN3	HGNC	protein_coding	OTTHUMT00000398413.1	C	NR_028290	Intron	133044194	-1	no_errors	ENST00000207771	ensembl	human	known	70_37	splice_site	SNP	0.967	T
VPS13B	157680	genome.wustl.edu	37	8	100833669	100833669	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:100833669G>A	ENST00000358544.2	+	50	9328	c.9217G>A	c.(9217-9219)Gat>Aat	p.D3073N	VPS13B_ENST00000395996.1_3'UTR|VPS13B_ENST00000357162.2_Missense_Mutation_p.D3048N	NM_017890.4	NP_060360.3	Q7Z7G8	VP13B_HUMAN	vacuolar protein sorting 13 homolog B (yeast)	3073					protein transport (GO:0015031)			p.D3073H(1)		NS(1)|autonomic_ganglia(1)|breast(6)|central_nervous_system(4)|cervix(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(37)|lung(78)|ovary(8)|pancreas(3)|prostate(5)|skin(9)|upper_aerodigestive_tract(4)|urinary_tract(9)	193	Breast(36;3.73e-07)		OV - Ovarian serous cystadenocarcinoma(57;0.00636)			AGCGTTTGTTGATACTGAAAT	0.428																																					Colon(161;2205 2542 7338 31318)												1	Substitution - Missense(1)	prostate(1)											270.0	249.0	256.0					8																	100833669		2203	4300	6503	SO:0001583	missense	157680			AJ608772	CCDS6280.1, CCDS6281.1, CCDS6283.1, CCDS47903.1	8q22-q23	2014-09-17	2006-12-19	2005-04-08	ENSG00000132549	ENSG00000132549			2183	protein-coding gene	gene with protein product		607817	"""Cohen syndrome 1"""	CHS1, COH1		7920642, 15498460	Standard	NM_181661		Approved		uc003yiv.4	Q7Z7G8	OTTHUMG00000140383	ENST00000358544.2:c.9217G>A	8.37:g.100833669G>A	ENSP00000351346:p.Asp3073Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JD30|Q709C6|Q709C7|Q7Z7G4|Q7Z7G5|Q7Z7G6|Q7Z7G7|Q8NB77|Q9NWV1|Q9Y4E7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.D3073N	ENST00000358544.2	37	c.9217	CCDS6280.1	8	.	.	.	.	.	.	.	.	.	.	G	15.69	2.909493	0.52439	.	.	ENSG00000132549	ENST00000357162;ENST00000358544	T;T	0.78126	-1.15;-1.15	5.76	4.88	0.63580	.	0.348284	0.30879	N	0.008690	T	0.68933	0.3055	N	0.24115	0.695	0.80722	D	1	B;B	0.24258	0.078;0.1	B;B	0.27380	0.079;0.036	T	0.65869	-0.6063	10	0.51188	T	0.08	.	16.8419	0.85971	0.0:0.1285:0.8715:0.0	.	3048;3073	Q7Z7G8-2;Q7Z7G8	.;VP13B_HUMAN	N	3048;3073	ENSP00000349685:D3048N;ENSP00000351346:D3073N	ENSP00000349685:D3048N	D	+	1	0	VPS13B	100902845	1.000000	0.71417	1.000000	0.80357	0.926000	0.56050	4.603000	0.61105	1.417000	0.47077	0.655000	0.94253	GAT	VPS13B	-	NULL		0.428	VPS13B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	VPS13B	HGNC	protein_coding	OTTHUMT00000277138.1	G	NM_184042		100833669	+1	no_errors	ENST00000358544	ensembl	human	known	70_37	missense	SNP	1.000	A
VPS18	57617	genome.wustl.edu	37	15	41191573	41191573	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:41191573C>T	ENST00000220509.5	+	4	896	c.557C>T	c.(556-558)cCg>cTg	p.P186L	VPS18_ENST00000558474.1_Intron	NM_020857.2	NP_065908.1	Q9P253	VPS18_HUMAN	vacuolar protein sorting 18 homolog (S. cerevisiae)	186					endosome organization (GO:0007032)|intracellular protein transport (GO:0006886)|lysosome organization (GO:0007040)|vesicle-mediated transport (GO:0016192)|viral entry into host cell (GO:0046718)	actin filament (GO:0005884)|early endosome (GO:0005769)|HOPS complex (GO:0030897)|lysosomal membrane (GO:0005765)	metal ion binding (GO:0046872)			autonomic_ganglia(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(6)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	28		all_cancers(109;1.35e-17)|all_epithelial(112;3.78e-15)|Lung NSC(122;9.68e-11)|all_lung(180;2.25e-09)|Melanoma(134;0.0574)|Ovarian(310;0.0822)|Colorectal(260;0.0946)		GBM - Glioblastoma multiforme(113;1.07e-05)|COAD - Colon adenocarcinoma(120;0.15)|BRCA - Breast invasive adenocarcinoma(123;0.164)		GGCCCTGCTCCGGATCTCTAC	0.612																																																	0													87.0	91.0	90.0					15																	41191573		2203	4300	6503	SO:0001583	missense	57617			AF308802	CCDS10069.1	15q14-q15	2006-12-19	2006-12-19		ENSG00000104142	ENSG00000104142			15972	protein-coding gene	gene with protein product		608551	"""vacuolar protein sorting protein 18"""			11250079, 16203730	Standard	NM_020857		Approved	KIAA1475, PEP3	uc001zne.3	Q9P253	OTTHUMG00000130135	ENST00000220509.5:c.557C>T	15.37:g.41191573C>T	ENSP00000220509:p.Pro186Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCG0|Q96DI3|Q9H268	Missense_Mutation	SNP	pfam_Pep3_Vps18,pfam_Clathrin_H-chain/VPS_repeat,superfamily_ARM-type_fold	p.P186L	ENST00000220509.5	37	c.557	CCDS10069.1	15	.	.	.	.	.	.	.	.	.	.	C	8.112	0.778954	0.16120	.	.	ENSG00000104142	ENST00000220509	T	0.41400	1.0	4.74	4.74	0.60224	.	0.000000	0.85682	D	0.000000	T	0.34395	0.0896	L	0.38175	1.15	0.80722	D	1	B	0.20459	0.045	B	0.12837	0.008	T	0.11131	-1.0600	10	0.15952	T	0.53	-17.1657	18.2707	0.90068	0.0:1.0:0.0:0.0	.	186	Q9P253	VPS18_HUMAN	L	186	ENSP00000220509:P186L	ENSP00000220509:P186L	P	+	2	0	VPS18	38978865	1.000000	0.71417	0.953000	0.39169	0.984000	0.73092	4.772000	0.62324	2.609000	0.88269	0.655000	0.94253	CCG	VPS18	-	NULL		0.612	VPS18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS18	HGNC	protein_coding	OTTHUMT00000252443.2	C			41191573	+1	no_errors	ENST00000220509	ensembl	human	known	70_37	missense	SNP	1.000	T
VWCE	220001	genome.wustl.edu	37	11	61034994	61034994	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:61034994G>A	ENST00000335613.5	-	16	2291	c.1905C>T	c.(1903-1905)atC>atT	p.I635I	VWCE_ENST00000535710.1_Silent_p.I100I	NM_152718.2	NP_689931.2	Q96DN2	VWCE_HUMAN	von Willebrand factor C and EGF domains	635	VWFC 5. {ECO:0000255|PROSITE- ProRule:PRU00220}.					extracellular region (GO:0005576)	calcium ion binding (GO:0005509)			biliary_tract(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(17)|ovary(3)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	37						TGTTATAGAAGATTCTGCCTG	0.607																																																	0													135.0	106.0	116.0					11																	61034994		2203	4299	6502	SO:0001819	synonymous_variant	220001			AK056571	CCDS8002.1	11q12.2	2006-08-04			ENSG00000167992	ENSG00000167992			26487	protein-coding gene	gene with protein product		611115				12869306	Standard	NM_152718		Approved	URG11, FLJ32009, VWC1	uc001nra.3	Q96DN2	OTTHUMG00000168208	ENST00000335613.5:c.1905C>T	11.37:g.61034994G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKV0|Q7Z7L6|Q86WK8	Silent	SNP	pfam_VWF_C,pfam_EGF-like_Ca-bd,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_VWF_C,smart_VWC_out,pfscan_EG-like_dom,pfscan_VWF_C	p.I635	ENST00000335613.5	37	c.1905	CCDS8002.1	11																																																																																			VWCE	-	pfam_VWF_C,smart_VWF_C,pfscan_VWF_C		0.607	VWCE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VWCE	HGNC	protein_coding	OTTHUMT00000398811.1	G	NM_152718		61034994	-1	no_errors	ENST00000335613	ensembl	human	known	70_37	silent	SNP	1.000	A
WHAMMP3	339005	genome.wustl.edu	37	15	23201566	23201566	+	RNA	SNP	C	C	A	rs201716755	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:23201566C>A	ENST00000400153.2	-	0	886					NR_003521.1		Q1A5X7	WHAL1_HUMAN	WAS protein homolog associated with actin, golgi membranes and microtubules pseudogene 3																		TCCAGCCCGTCTGGTCCATTC	0.408													c|||	2350	0.469249	0.3707	0.4337	5008	,	,		16868	0.6022		0.498	False		,,,				2504	0.4611																0																																												339005			BC048987		15q11.2	2014-03-20	2011-06-24	2011-06-24	ENSG00000187667	ENSG00000276141			27892	pseudogene	pseudogene			"""WAS protein homology region 2 domain containing 1-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1"", ""WAS protein homolog associated with actin, golgi membranes and microtubules-like 1 (pseudogene)"""	WHDC1L1, WHAMML1		18226259	Standard	NR_003521		Approved		uc001yvg.3	Q1A5X7	OTTHUMG00000171921		15.37:g.23201566C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q1A5X8|Q52M16|Q52M18	RNA	SNP	-	NULL	ENST00000400153.2	37	NULL		15																																																																																			WHAMMP3	-	-		0.408	WHAMMP3-001	KNOWN	basic	processed_transcript	WHAMMP3	HGNC	pseudogene	OTTHUMT00000415907.1	C	NR_003521		23201566	-1	no_errors	ENST00000400153	ensembl	human	known	70_37	rna	SNP	0.678	A
WDR73	84942	genome.wustl.edu	37	15	85186837	85186837	+	Missense_Mutation	SNP	T	T	C	rs72750868	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr15:85186837T>C	ENST00000434634.2	-	8	1061	c.1001A>G	c.(1000-1002)gAt>gGt	p.D334G	SCAND2P_ENST00000348993.5_RNA|WDR73_ENST00000398528.3_5'UTR	NM_032856.2	NP_116245.2	Q6P4I2	WDR73_HUMAN	WD repeat domain 73	334										cervix(1)|large_intestine(1)|lung(1)	3						CCCATTTCCATCTAGGAAGAT	0.512													T|||	222	0.0443291	0.0348	0.0375	5008	,	,		18533	0.001		0.0954	False		,,,				2504	0.0542																0								T	GLY/ASP	133,4077		2,129,1974	123.0	132.0	129.0		1001	2.1	0.1	15	dbSNP_130	129	684,7778		31,622,3578	yes	missense	WDR73	NM_032856.2	94	33,751,5552	CC,CT,TT		8.0832,3.1591,6.4473	possibly-damaging	334/379	85186837	817,11855	2105	4231	6336	SO:0001583	missense	84942			AK027200	CCDS45339.1	15q25.2	2013-01-09				ENSG00000177082		"""WD repeat domain containing"""	25928	protein-coding gene	gene with protein product						12477932	Standard	NM_032856		Approved	FLJ14888, HSPC264	uc002bkw.2	Q6P4I2		ENST00000434634.2:c.1001A>G	15.37:g.85186837T>C	ENSP00000387982:p.Asp334Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96JZ1|Q9P0B7	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat	p.D334G	ENST00000434634.2	37	c.1001	CCDS45339.1	15	98	0.04487179487179487	9	0.018292682926829267	16	0.04419889502762431	0	0.0	73	0.09630606860158311	T	14.47	2.546086	0.45383	0.031591	0.080832	ENSG00000177082	ENST00000398528;ENST00000434634	T	0.47177	0.85	5.91	2.11	0.27256	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.593517	0.19326	N	0.117019	T	0.00724	0.0024	N	0.25890	0.77	0.09310	N	1	B	0.12013	0.005	B	0.09377	0.004	T	0.06180	-1.0841	10	0.17832	T	0.49	-11.2672	5.71	0.17929	0.0:0.0849:0.3321:0.583	.	334	Q6P4I2	WDR73_HUMAN	G	342;334	ENSP00000387982:D334G	ENSP00000381539:D342G	D	-	2	0	WDR73	82987841	0.046000	0.20272	0.065000	0.19835	0.032000	0.12392	0.678000	0.25277	0.471000	0.27319	-0.250000	0.11733	GAT	WDR73	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.512	WDR73-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR73	HGNC	protein_coding	OTTHUMT00000418195.1	T	NM_032856		85186837	-1	no_errors	ENST00000434634	ensembl	human	known	70_37	missense	SNP	0.042	C
WIZ	58525	genome.wustl.edu	37	19	15549635	15549635	+	Missense_Mutation	SNP	C	C	T	rs566359642		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:15549635C>T	ENST00000389282.4	-	3	2239	c.2026G>A	c.(2026-2028)Gcg>Acg	p.A676T	WIZ_ENST00000263381.7_Intron			O95785	WIZ_HUMAN	widely interspaced zinc finger motifs	676					positive regulation of nuclear cell cycle DNA replication (GO:0010571)|protein heterotrimerization (GO:0070208)|protein stabilization (GO:0050821)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|stomach(1)|urinary_tract(1)	24						CCCAGCGGCGCGTCCAGGAGC	0.721													C|||	1	0.000199681	0.0	0.0014	5008	,	,		11840	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001583	missense	58525			AK091183	CCDS42516.1	19p13.12	2012-10-05	2007-01-18		ENSG00000011451	ENSG00000011451		"""Zinc fingers, C2H2-type"""	30917	protein-coding gene	gene with protein product			"""WIZ zinc finger"""			9795207, 12226707	Standard	NM_021241		Approved	ZNF803	uc002nbb.4	O95785		ENST00000389282.4:c.2026G>A	19.37:g.15549635C>T	ENSP00000373933:p.Ala676Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVH1|B7ZM82|M0QY21|Q4G0E0|Q6P6B0|Q6ZN24|Q7LDY6|Q7LDZ1|Q96IG5|Q96SQ6|Q9BUR8|Q9NPT1	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.A676T	ENST00000389282.4	37	c.2026		19	.	.	.	.	.	.	.	.	.	.	C	7.603	0.673285	0.14776	.	.	ENSG00000011451	ENST00000389282	T	0.02656	4.21	4.72	-5.81	0.02340	.	0.918471	0.09087	N	0.850451	T	0.01124	0.0037	.	.	.	0.09310	N	0.999999	.	.	.	.	.	.	T	0.49341	-0.8950	7	0.15499	T	0.54	-0.0488	1.2036	0.01890	0.2857:0.1821:0.105:0.4271	.	.	.	.	T	676	ENSP00000373933:A676T	ENSP00000373933:A676T	A	-	1	0	WIZ	15410635	0.000000	0.05858	0.000000	0.03702	0.422000	0.31414	-1.605000	0.02074	-0.416000	0.07473	-0.237000	0.12165	GCG	WIZ	-	NULL		0.721	WIZ-201	KNOWN	basic|appris_principal	protein_coding	WIZ	HGNC	protein_coding		C	NM_021241		15549635	-1	no_errors	ENST00000389282	ensembl	human	known	70_37	missense	SNP	0.000	T
WWOX	51741	genome.wustl.edu	37	16	78420775	78420775	+	Missense_Mutation	SNP	G	G	A	rs11545029	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:78420775G>A	ENST00000566780.1	+	6	901	c.535G>A	c.(535-537)Gca>Aca	p.A179T	WWOX_ENST00000406884.2_Intron|WWOX_ENST00000539474.2_Intron|WWOX_ENST00000408984.3_Missense_Mutation_p.A179T|WWOX_ENST00000402655.2_Intron	NM_016373.2	NP_057457.1	Q9NZC7	WWOX_HUMAN	WW domain containing oxidoreductase	179	Interaction with MAPT. {ECO:0000250}.		A -> T (in dbSNP:rs12918952). {ECO:0000269|PubMed:11572989, ECO:0000269|Ref.5}.		cellular response to transforming growth factor beta stimulus (GO:0071560)|extrinsic apoptotic signaling pathway (GO:0097191)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of Wnt signaling pathway (GO:0030178)|osteoblast differentiation (GO:0001649)|oxidation-reduction process (GO:0055114)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|skeletal system morphogenesis (GO:0048705)|steroid metabolic process (GO:0008202)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	coenzyme binding (GO:0050662)|cofactor binding (GO:0048037)|enzyme binding (GO:0019899)|oxidoreductase activity (GO:0016491)|protein dimerization activity (GO:0046983)			large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	7		all_cancers(2;1.97e-181)|all_epithelial(2;3.85e-160)|all_lung(2;2.03e-39)|Lung NSC(2;7.16e-35)|Colorectal(2;6.96e-21)|all_hematologic(2;1.13e-16)|Melanoma(2;5.16e-06)|all_neural(2;8.84e-06)|Renal(2;5.26e-05)|Medulloblastoma(2;0.00498)|Breast(2;0.00631)|Lung SC(2;0.0261)|Prostate(104;0.167)		UCEC - Uterine corpus endometrioid carcinoma (2;0.012)|Epithelial(1;2.65e-39)|all cancers(1;3.26e-34)|STAD - Stomach adenocarcinoma(1;5.1e-20)|COAD - Colon adenocarcinoma(1;1.04e-11)|Colorectal(1;3.4e-11)|OV - Ovarian serous cystadenocarcinoma(1;1.01e-10)|BRCA - Breast invasive adenocarcinoma(1;0.00196)|Kidney(780;0.232)		CAAGGTAGAAGCAATGACCCT	0.418													G|||	1319	0.263379	0.1067	0.4035	5008	,	,		17481	0.0635		0.6064	False		,,,				2504	0.229																0								G	THR/ALA	757,3125		69,619,1253	116.0	109.0	111.0		535	5.5	1.0	16	dbSNP_121	111	4823,3443		1405,2013,715	yes	missense	WWOX	NM_016373.2	58	1474,2632,1968	AA,AG,GG		41.6526,19.5003,45.9335	benign	179/415	78420775	5580,6568	1941	4133	6074	SO:0001583	missense	51741			AF187015	CCDS42196.1, CCDS42197.1	16q23.3-q24.1	2012-08-15	2002-01-14		ENSG00000186153	ENSG00000186153	1.1.1.-	"""Short chain dehydrogenase/reductase superfamily / Classical SDR fold cluster 2"""	12799	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 41C, member 1"""	605131	"""WW domain-containing oxidoreductase"""			10786676, 10861292, 19027726	Standard	XR_243411		Approved	FOR, WOX1, SDR41C1	uc002ffk.3	Q9NZC7	OTTHUMG00000176851	ENST00000566780.1:c.535G>A	16.37:g.78420775G>A	ENSP00000457230:p.Ala179Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K323|Q5MYT5|Q96KM3|Q96RF2|Q9BTT8|Q9NPC9|Q9NRF4|Q9NRF5|Q9NRF6|Q9NRK1|Q9NZC5	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP,prints_Glc/ribitol_DH	p.A179T	ENST00000566780.1	37	c.535	CCDS42196.1	16	714	0.3269230769230769	64	0.13008130081300814	151	0.4171270718232044	43	0.07517482517482517	456	0.6015831134564644	G	16.46	3.128484	0.56721	0.195003	0.583474	ENSG00000186153	ENST00000408984;ENST00000299644	D	0.87650	-2.28	5.52	5.52	0.82312	NAD(P)-binding domain (1);	0.058121	0.64402	D	0.000002	T	0.00012	0.0000	N	0.25031	0.7	0.22468	P	0.999079915	B	0.24132	0.098	B	0.27076	0.076	T	0.45160	-0.9280	9	0.42905	T	0.14	.	19.4505	0.94865	0.0:0.0:1.0:0.0	rs12918952;rs52836483;rs12918952	179	Q9NZC7	WWOX_HUMAN	T	179;22	ENSP00000386161:A179T	ENSP00000299644:A22T	A	+	1	0	WWOX	76978276	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	8.072000	0.89496	2.597000	0.87782	0.655000	0.94253	GCA	WWOX	-	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR		0.418	WWOX-005	KNOWN	basic|appris_principal|CCDS	protein_coding	WWOX	HGNC	protein_coding	OTTHUMT00000434328.1	G			78420775	+1	no_errors	ENST00000566780	ensembl	human	known	70_37	missense	SNP	1.000	A
XIRP2	129446	genome.wustl.edu	37	2	168102429	168102429	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:168102429C>T	ENST00000409195.1	+	9	4616	c.4527C>T	c.(4525-4527)atC>atT	p.I1509I	XIRP2_ENST00000409728.1_Intron|XIRP2_ENST00000409605.1_Intron|XIRP2_ENST00000295237.9_Silent_p.I1509I|XIRP2_ENST00000409043.1_Intron|XIRP2_ENST00000409273.1_Silent_p.I1287I|XIRP2_ENST00000420519.1_Intron|XIRP2_ENST00000409756.2_Intron	NM_152381.5	NP_689594.4	A4UGR9	XIRP2_HUMAN	xin actin-binding repeat containing 2	1334					actin cytoskeleton organization (GO:0030036)|cardiac muscle tissue morphogenesis (GO:0055008)|cell-cell junction organization (GO:0045216)|ventricular septum development (GO:0003281)	cell junction (GO:0030054)|Z disc (GO:0030018)				NS(3)|biliary_tract(2)|breast(5)|cervix(3)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(51)|lung(160)|ovary(7)|pancreas(3)|prostate(11)|skin(14)|stomach(5)|upper_aerodigestive_tract(8)|urinary_tract(7)	315						ATAAAGGTATCACAAAAATGA	0.388																																																	0													80.0	73.0	76.0					2																	168102429		1889	4118	6007	SO:0001819	synonymous_variant	129446			AK056582	CCDS42768.1, CCDS42769.1, CCDS56143.1, CCDS56144.1, CCDS56145.1	2q31.1	2013-10-25	2007-06-27	2007-06-27	ENSG00000163092	ENSG00000163092			14303	protein-coding gene	gene with protein product	"""myomaxin"""	609778	"""cardiomyopathy associated 3"""	CMYA3		17046827, 12203715, 15454575	Standard	NM_001079810		Approved		uc002udx.3	A4UGR9	OTTHUMG00000154027	ENST00000409195.1:c.4527C>T	2.37:g.168102429C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJ94|B2BBS0|B2BBS1|B2BBS4|B3KVH0|J3KNB1|Q53R52|Q5MJ67|Q702N7|Q86T36|Q86T38|Q86T46|Q86T51|Q86T53|Q86T55|Q86T79|Q86TB6|Q8N1M9|Q8N3R5|Q8TBV6	Silent	SNP	pfam_Actin-binding_Xin_repeat,superfamily_FH2_actin-bd	p.I1509	ENST00000409195.1	37	c.4527	CCDS42769.1	2																																																																																			XIRP2	-	NULL		0.388	XIRP2-001	KNOWN	basic|CCDS	protein_coding	XIRP2	HGNC	protein_coding	OTTHUMT00000333547.1	C	NM_152381		168102429	+1	no_errors	ENST00000295237	ensembl	human	known	70_37	silent	SNP	0.003	T
XPO4	64328	genome.wustl.edu	37	13	21358048	21358048	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr13:21358048G>A	ENST00000255305.6	-	23	3340	c.3269C>T	c.(3268-3270)tCt>tTt	p.S1090F	XPO4_ENST00000400602.2_Missense_Mutation_p.S1090F			Q9C0E2	XPO4_HUMAN	exportin 4	1090					positive regulation of protein export from nucleus (GO:0046827)|protein transport (GO:0015031)	cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(1)|endometrium(10)|kidney(4)|large_intestine(7)|lung(14)|ovary(1)|prostate(3)|upper_aerodigestive_tract(1)	41		all_cancers(29;5.05e-24)|all_epithelial(30;5.56e-20)|all_lung(29;2.38e-16)|Lung SC(185;0.0262)|Hepatocellular(188;0.244)		all cancers(112;0.000521)|Epithelial(112;0.000892)|OV - Ovarian serous cystadenocarcinoma(117;0.0148)|Lung(94;0.0189)|LUSC - Lung squamous cell carcinoma(192;0.0548)		GACCAGTTCAGAATATTCAGC	0.398																																																	0													92.0	83.0	86.0					13																	21358048		1931	4153	6084	SO:0001583	missense	64328			AB051508	CCDS41872.1	13q11	2011-04-13			ENSG00000132953	ENSG00000132953		"""Exportins"""	17796	protein-coding gene	gene with protein product		611449				11214970, 10944119	Standard	NM_022459		Approved	FLJ13046, KIAA1721	uc001unq.4	Q9C0E2	OTTHUMG00000016528	ENST00000255305.6:c.3269C>T	13.37:g.21358048G>A	ENSP00000255305:p.Ser1090Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUZ5|Q8N3V6|Q9H934	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.S1090F	ENST00000255305.6	37	c.3269	CCDS41872.1	13	.	.	.	.	.	.	.	.	.	.	G	16.86	3.238076	0.58886	.	.	ENSG00000132953	ENST00000400602;ENST00000255305	T;T	0.68331	-0.32;-0.32	5.77	5.77	0.91146	Armadillo-like helical (1);Armadillo-type fold (1);	0.128293	0.56097	D	0.000038	T	0.66752	0.2821	L	0.34521	1.04	0.80722	D	1	B	0.30361	0.277	B	0.40285	0.325	T	0.65047	-0.6263	10	0.52906	T	0.07	-6.3297	19.9915	0.97366	0.0:0.0:1.0:0.0	.	1090	Q9C0E2	XPO4_HUMAN	F	1090	ENSP00000383444:S1090F;ENSP00000255305:S1090F	ENSP00000255305:S1090F	S	-	2	0	XPO4	20256048	1.000000	0.71417	0.897000	0.35233	0.701000	0.40568	9.467000	0.97671	2.723000	0.93209	0.655000	0.94253	TCT	XPO4	-	superfamily_ARM-type_fold		0.398	XPO4-001	KNOWN	non_canonical_conserved|non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	XPO4	HGNC	protein_coding	OTTHUMT00000044096.1	G	NM_022459		21358048	-1	no_errors	ENST00000255305	ensembl	human	known	70_37	missense	SNP	1.000	A
XRRA1	143570	genome.wustl.edu	37	11	74651899	74651899	+	Silent	SNP	G	G	A	rs201378132		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr11:74651899G>A	ENST00000340360.6	-	3	356	c.25C>T	c.(25-27)Ctg>Ttg	p.L9L	XRRA1_ENST00000321448.8_Intron|XRRA1_ENST00000527087.1_Silent_p.L9L|XRRA1_ENST00000533598.1_Intron	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						CCATCATCCAGCTTGTAGATT	0.517													G|||	1	0.000199681	0.0	0.0	5008	,	,		21449	0.0		0.001	False		,,,				2504	0.0																0								G		0,4270		0,0,2135	56.0	56.0	56.0		25	-0.4	1.0	11		56	7,8531		0,7,4262	no	coding-synonymous	XRRA1	NM_182969.1		0,7,6397	AA,AG,GG		0.082,0.0,0.0547		9/793	74651899	7,12801	2135	4269	6404	SO:0001819	synonymous_variant	143570			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.25C>T	11.37:g.74651899G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L9	ENST00000340360.6	37	c.25	CCDS44680.1	11																																																																																			XRRA1	-	NULL		0.517	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	G	NM_182969		74651899	-1	no_errors	ENST00000340360	ensembl	human	known	70_37	silent	SNP	0.963	A
YTHDF3	253943	genome.wustl.edu	37	8	64122594	64122594	+	3'UTR	DEL	A	A	-	rs200482681	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:64122594delA	ENST00000517371.1	+	0	713				YTHDF3_ENST00000542911.2_3'UTR|YTHDF3_ENST00000539294.1_3'UTR|YTHDF3_ENST00000521674.1_3'UTR			Q7Z739	YTHD3_HUMAN	YTH domain family, member 3								N6-methyladenosine-containing RNA binding (GO:1990247)|poly(A) RNA binding (GO:0044822)					Breast(64;0.0716)	all_cancers(86;0.169)|Lung NSC(129;0.0324)|all_lung(136;0.0593)|all_epithelial(80;0.146)	BRCA - Breast invasive adenocarcinoma(89;0.161)			TGAATTTGTTAAATACTAACA	0.323													AAA|AAA|AA|deletion	29	0.00579073	0.0015	0.0144	5008	,	,		19738	0.0		0.0109	False		,,,				2504	0.0061																0																																										SO:0001624	3_prime_UTR_variant	253943			BC052970	CCDS75747.1, CCDS75748.1, CCDS75749.1	8q12.3	2013-06-07	2004-11-16		ENSG00000185728	ENSG00000185728			26465	protein-coding gene	gene with protein product			"""YTH domain family 3"""			12477932	Standard	NM_152758		Approved	FLJ31657	uc003xuz.4	Q7Z739	OTTHUMG00000164369	ENST00000517371.1:c.*330A>-	8.37:g.64122594delA		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXL4|Q63Z37|Q659A3	RNA	DEL	-	NULL	ENST00000517371.1	37	NULL		8																																																																																			YTHDF3	-	-		0.323	YTHDF3-010	PUTATIVE	basic	protein_coding	YTHDF3	HGNC	protein_coding	OTTHUMT00000378466.4	A	NM_152758		64122594	+1	no_errors	ENST00000339066	ensembl	human	known	70_37	rna	DEL	1.000	-
ZAK	51776	genome.wustl.edu	37	2	174055646	174055646	+	Silent	SNP	T	T	C	rs35853276	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:174055646T>C	ENST00000375213.3	+	6	517	c.439T>C	c.(439-441)Ttg>Ctg	p.L147L	MLTK_ENST00000409176.2_Silent_p.L147L|MLTK_ENST00000539448.1_Silent_p.L147L|MLK7-AS1_ENST00000422703.1_RNA|MLTK_ENST00000480606.1_3'UTR|MLK7-AS1_ENST00000419609.1_RNA|MLTK_ENST00000338983.3_Silent_p.L147L|MLTK_ENST00000431503.2_Silent_p.L46L	NM_016653.2	NP_057737.2	Q9NYL2	MLTK_HUMAN		147	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				activation of JUN kinase activity (GO:0007257)|activation of MAPKK activity (GO:0000186)|cell cycle arrest (GO:0007050)|cell cycle checkpoint (GO:0000075)|cell death (GO:0008219)|cell differentiation (GO:0030154)|cell proliferation (GO:0008283)|cytoskeleton organization (GO:0007010)|DNA damage checkpoint (GO:0000077)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|response to radiation (GO:0009314)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MAP kinase kinase kinase activity (GO:0004709)|poly(A) RNA binding (GO:0044822)|protein serine/threonine kinase activity (GO:0004674)										TGATGGAGTATTGAAGGTAGG	0.269													T|||	715	0.142772	0.3071	0.0821	5008	,	,		19235	0.0		0.1103	False		,,,				2504	0.1442																0								T	,	1068,3338	368.3+/-318.6	120,828,1255	67.0	76.0	73.0		439,439	-0.3	0.8	2	dbSNP_126	73	874,7720	195.1+/-240.3	49,776,3472	no	coding-synonymous,coding-synonymous	ZAK	NM_016653.2,NM_133646.2	,	169,1604,4727	CC,CT,TT		10.1699,24.2397,14.9385	,	147/801,147/456	174055646	1942,11058	2203	4297	6500	SO:0001819	synonymous_variant	51776																														ENST00000375213.3:c.439T>C	2.37:g.174055646T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPG2|Q53SX1|Q580W8|Q59GY5|Q86YW8|Q9HCC4|Q9HCC5|Q9HDD2|Q9NYE9	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SAM_type1,pfam_SAM_2,superfamily_Kinase-like_dom,superfamily_SAM/pointed,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.L147	ENST00000375213.3	37	c.439	CCDS42777.1	2																																																																																			MLTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.269	MLTK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZAK	Uniprot_genename	protein_coding	OTTHUMT00000255401.1	T			174055646	+1	no_errors	ENST00000375213	ensembl	human	known	70_37	silent	SNP	0.727	C
ZBBX	79740	genome.wustl.edu	37	3	166958669	166958669	+	Missense_Mutation	SNP	G	G	A	rs200693691		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr3:166958669G>A	ENST00000392766.2	-	21	2655	c.2315C>T	c.(2314-2316)tCa>tTa	p.S772L	ZBBX_ENST00000307529.5_Missense_Mutation_p.S811L|ZBBX_ENST00000392767.2_Missense_Mutation_p.S772L|ZBBX_ENST00000392764.1_Missense_Mutation_p.S743L|ZBBX_ENST00000455345.2_Missense_Mutation_p.S811L	NM_001199201.1|NM_024687.3	NP_001186130.1|NP_078963.2	A8MT70	ZBBX_HUMAN	zinc finger, B-box domain containing	772						intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(5)|kidney(5)|large_intestine(9)|liver(1)|lung(38)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(1)	70						CTCAGAAAGTGACAGCAAAGA	0.368																																																	0													141.0	134.0	136.0					3																	166958669		1916	4125	6041	SO:0001583	missense	79740			AK026702	CCDS3199.2, CCDS56295.1, CCDS56296.1	3q26.1	2010-03-23			ENSG00000169064	ENSG00000169064			26245	protein-coding gene	gene with protein product						12477932	Standard	NM_024687		Approved	FLJ23049	uc011bpc.2	A8MT70	OTTHUMG00000133560	ENST00000392766.2:c.2315C>T	3.37:g.166958669G>A	ENSP00000376519:p.Ser772Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MV69|B3KSC1|B5MDJ6|F2Z370|Q9H5T8	Missense_Mutation	SNP	pfam_Znf_B-box	p.S811L	ENST00000392766.2	37	c.2432	CCDS3199.2	3	.	.	.	.	.	.	.	.	.	.	G	17.24	3.338491	0.60963	.	.	ENSG00000169064	ENST00000392766;ENST00000392767;ENST00000455345;ENST00000307529;ENST00000392764	T;T;T;T;T	0.52057	0.68;0.68;0.68;0.68;0.68	4.99	4.99	0.66335	.	0.483180	0.17355	N	0.177275	T	0.46814	0.1412	L	0.40543	1.245	0.32208	N	0.576857	P;P	0.40180	0.705;0.58	B;B	0.44044	0.439;0.254	T	0.59752	-0.7395	10	0.87932	D	0	-8.9268	13.9602	0.64175	0.0:0.0:1.0:0.0	.	811;772	A8MT70-2;A8MT70	.;ZBBX_HUMAN	L	772;772;811;811;743	ENSP00000376519:S772L;ENSP00000376520:S772L;ENSP00000390232:S811L;ENSP00000305065:S811L;ENSP00000376517:S743L	ENSP00000305065:S811L	S	-	2	0	ZBBX	168441363	0.849000	0.29639	1.000000	0.80357	0.978000	0.69477	1.652000	0.37313	2.752000	0.94435	0.557000	0.71058	TCA	ZBBX	-	NULL		0.368	ZBBX-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZBBX	HGNC	protein_coding	OTTHUMT00000257657.3	G	NM_024687		166958669	-1	no_errors	ENST00000307529	ensembl	human	known	70_37	missense	SNP	1.000	A
ZFHX3	463	genome.wustl.edu	37	16	72992896	72992896	+	Silent	SNP	G	G	A	rs201339061	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:72992896G>A	ENST00000268489.5	-	2	1821	c.1149C>T	c.(1147-1149)tcC>tcT	p.S383S	ZFHX3_ENST00000397992.5_Intron	NM_006885.3	NP_008816.3	Q15911	ZFHX3_HUMAN	zinc finger homeobox 3	383					brain development (GO:0007420)|cell cycle arrest (GO:0007050)|muscle organ development (GO:0007517)|negative regulation of myoblast differentiation (GO:0045662)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of myoblast differentiation (GO:0045663)|regulation of neuron differentiation (GO:0045664)|regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	mitochondrion (GO:0005739)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	enzyme binding (GO:0019899)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			NS(3)|breast(7)|cervix(2)|endometrium(18)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(22)|liver(1)|lung(46)|ovary(5)|pancreas(1)|prostate(15)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(11)	153		Ovarian(137;0.13)				GGCCAGCGGCGGAGCCCGCTG	0.582																																																	0													47.0	61.0	56.0					16																	72992896		2197	4298	6495	SO:0001819	synonymous_variant	463			D10250	CCDS10908.1, CCDS54035.1	16q22.3	2012-03-09	2007-08-09	2007-08-09	ENSG00000140836	ENSG00000140836		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	777	protein-coding gene	gene with protein product		104155	"""AT-binding transcription factor 1"""	ATBF1		1719379, 7592926	Standard	NM_006885		Approved	ZNF927	uc002fck.3	Q15911	OTTHUMG00000137599	ENST00000268489.5:c.1149C>T	16.37:g.72992896G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWS8|O15101|Q13719	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.S383	ENST00000268489.5	37	c.1149	CCDS10908.1	16																																																																																			ZFHX3	-	NULL		0.582	ZFHX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFHX3	HGNC	protein_coding	OTTHUMT00000269008.1	G	NM_006885		72992896	-1	no_errors	ENST00000268489	ensembl	human	known	70_37	silent	SNP	0.690	A
ZFP36L2	678	genome.wustl.edu	37	2	43452373	43452373	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:43452373C>T	ENST00000282388.3	-	2	863	c.570G>A	c.(568-570)ccG>ccA	p.P190P	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	190	RNA-binding.				cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				TCTTGTACTTCGGATGGCGAG	0.647																																																	0													45.0	42.0	43.0					2																	43452373		2203	4300	6503	SO:0001819	synonymous_variant	678			X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.570G>A	2.37:g.43452373C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TB4|Q9BSJ3	Silent	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.P190	ENST00000282388.3	37	c.570	CCDS1811.1	2																																																																																			ZFP36L2	-	NULL		0.647	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L2	HGNC	protein_coding	OTTHUMT00000250513.2	C	NM_006887		43452373	-1	no_errors	ENST00000282388	ensembl	human	known	70_37	silent	SNP	0.977	T
ZFP36L2	678	genome.wustl.edu	37	2	43452886	43452886	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:43452886C>G	ENST00000282388.3	-	2	350	c.57G>C	c.(55-57)gaG>gaC	p.E19D	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	19					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				CCAGGGATTTCTCTGTCTGCC	0.627																																																	0													18.0	20.0	19.0					2																	43452886		2183	4266	6449	SO:0001583	missense	678			X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.57G>C	2.37:g.43452886C>G	ENSP00000282388:p.Glu19Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.E19D	ENST00000282388.3	37	c.57	CCDS1811.1	2	.	.	.	.	.	.	.	.	.	.	C	17.70	3.453116	0.63290	.	.	ENSG00000152518	ENST00000282388	T	0.49139	0.79	5.48	4.59	0.56863	Tis11B-like protein, N-terminal (1);	0.065232	0.64402	D	0.000013	T	0.38532	0.1044	L	0.40543	1.245	0.80722	D	1	B	0.14805	0.011	B	0.19946	0.027	T	0.15009	-1.0452	10	0.27082	T	0.32	-18.1629	11.7373	0.51773	0.1385:0.728:0.1335:0.0	.	19	P47974	TISD_HUMAN	D	19	ENSP00000282388:E19D	ENSP00000282388:E19D	E	-	3	2	ZFP36L2	43306390	0.979000	0.34478	1.000000	0.80357	0.985000	0.73830	0.320000	0.19540	1.274000	0.44362	0.655000	0.94253	GAG	ZFP36L2	-	pfam_Tis11B_N		0.627	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L2	HGNC	protein_coding	OTTHUMT00000250513.2	C	NM_006887		43452886	-1	no_errors	ENST00000282388	ensembl	human	known	70_37	missense	SNP	1.000	G
ZHX2	22882	genome.wustl.edu	37	8	123966102	123966102	+	Silent	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr8:123966102G>A	ENST00000314393.4	+	3	3187	c.2352G>A	c.(2350-2352)gaG>gaA	p.E784E		NM_014943.3	NP_055758.1	Q9Y6X8	ZHX2_HUMAN	zinc fingers and homeoboxes 2	784					mRNA catabolic process (GO:0006402)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|somatic stem cell maintenance (GO:0035019)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(10)|lung(15)|ovary(1)|prostate(1)|skin(4)|stomach(3)|urinary_tract(1)	45	Lung NSC(37;2e-09)|Ovarian(258;0.0205)|Hepatocellular(40;0.105)		STAD - Stomach adenocarcinoma(47;0.00527)			GTAGCGACGAGAACGAGGAGT	0.607																																					Esophageal Squamous(94;1056 1388 11767 13799 49639)												0													97.0	88.0	91.0					8																	123966102		2203	4300	6503	SO:0001819	synonymous_variant	22882			AB020661	CCDS6336.1	8q24.13	2012-03-09	2004-01-23		ENSG00000178764	ENSG00000178764		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	18513	protein-coding gene	gene with protein product		609185	"""zinc-fingers and homeoboxes 2"""			10048485, 12741956	Standard	XM_005250837		Approved	KIAA0854	uc003ypk.1	Q9Y6X8	OTTHUMG00000165077	ENST00000314393.4:c.2352G>A	8.37:g.123966102G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E784	ENST00000314393.4	37	c.2352	CCDS6336.1	8																																																																																			ZHX2	-	NULL		0.607	ZHX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZHX2	HGNC	protein_coding	OTTHUMT00000381709.1	G	NM_014943		123966102	+1	no_errors	ENST00000314393	ensembl	human	known	70_37	silent	SNP	0.967	A
ZNF100	163227	genome.wustl.edu	37	19	21910630	21910630	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:21910630C>T	ENST00000358296.6	-	5	682	c.484G>A	c.(484-486)Gat>Aat	p.D162N	ZNF100_ENST00000305570.6_Missense_Mutation_p.D98N	NM_173531.3	NP_775802.2	Q8IYN0	ZN100_HUMAN	zinc finger protein 100	162					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(11)|skin(1)|upper_aerodigestive_tract(1)	21						AATTTGTTATCATGTTCTTTG	0.323																																																	0													166.0	168.0	167.0					19																	21910630		2051	4238	6289	SO:0001583	missense	163227			BC035579	CCDS42538.1	19p13.1	2013-01-08	2003-12-19		ENSG00000197020	ENSG00000197020		"""Zinc fingers, C2H2-type"", ""-"""	12880	protein-coding gene	gene with protein product		603982	"""zinc finger protein 100 (Y1)"""			12477932	Standard	NM_173531		Approved		uc002nqi.3	Q8IYN0		ENST00000358296.6:c.484G>A	19.37:g.21910630C>T	ENSP00000351042:p.Asp162Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7M4M0	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D162N	ENST00000358296.6	37	c.484	CCDS42538.1	19	.	.	.	.	.	.	.	.	.	.	.	8.987	0.976885	0.18812	.	.	ENSG00000197020	ENST00000358296	T	0.04758	3.56	1.44	-2.88	0.05682	.	.	.	.	.	T	0.02848	0.0085	N	0.14661	0.345	0.09310	N	1	B;B	0.22276	0.033;0.067	B;B	0.28465	0.007;0.09	T	0.44467	-0.9326	9	0.49607	T	0.09	.	3.7996	0.08753	0.2322:0.5973:0.0:0.1704	.	162;216	Q8IYN0;Q4G131	ZN100_HUMAN;.	N	162	ENSP00000351042:D162N	ENSP00000351042:D162N	D	-	1	0	ZNF100	21702470	.	.	0.002000	0.10522	0.497000	0.33675	.	.	-0.966000	0.03587	0.174000	0.16983	GAT	ZNF100	-	NULL		0.323	ZNF100-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF100	HGNC	protein_coding	OTTHUMT00000464087.1	C	NM_173531		21910630	-1	no_errors	ENST00000358296	ensembl	human	known	70_37	missense	SNP	0.001	T
ZNF155	7711	genome.wustl.edu	37	19	44500677	44500677	+	Missense_Mutation	SNP	A	A	T	rs62640893	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:44500677A>T	ENST00000270014.2	+	5	796	c.668A>T	c.(667-669)cAg>cTg	p.Q223L	RP11-15A1.7_ENST00000589021.1_RNA|ZNF155_ENST00000590615.1_Missense_Mutation_p.Q223L|ZNF155_ENST00000407951.2_Missense_Mutation_p.Q234L|RP11-15A1.7_ENST00000586860.1_RNA	NM_001260487.1|NM_198089.2	NP_001247416|NP_932355	Q12901	ZN155_HUMAN	zinc finger protein 155	223					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|upper_aerodigestive_tract(2)	15		Prostate(69;0.0352)				CAAACTCATCAGAGAGTCCAC	0.428													A|||	26	0.00519169	0.0068	0.0043	5008	,	,		23473	0.0		0.002	False		,,,				2504	0.0123				NSCLC(61;554 1277 20909 42067 42312)												0								A	LEU/GLN,LEU/GLN	25,4381	31.7+/-61.6	1,23,2179	140.0	137.0	138.0		668,668	1.5	0.0	19	dbSNP_129	138	39,8561	26.3+/-74.7	0,39,4261	no	missense,missense	ZNF155	NM_003445.2,NM_198089.1	113,113	1,62,6440	TT,TA,AA		0.4535,0.5674,0.4921	possibly-damaging,possibly-damaging	223/539,223/539	44500677	64,12942	2203	4300	6503	SO:0001583	missense	7711			U09852	CCDS12634.1, CCDS58668.1	19q13.2-q13.32	2013-01-08	2006-08-22			ENSG00000204920		"""Zinc fingers, C2H2-type"", ""-"""	12940	protein-coding gene	gene with protein product		604086	"""zinc finger protein 155 (pHZ-96)"""			7557990	Standard	NM_001260486		Approved	pHZ-96	uc010xwt.2	Q12901		ENST00000270014.2:c.668A>T	19.37:g.44500677A>T	ENSP00000270014:p.Gln223Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BDE6|B2RB63|B4DM95|J3KQ08|Q6AZZ8|Q9UIE1|Q9UK14	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q223L	ENST00000270014.2	37	c.668	CCDS12634.1	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	18.48|18.48	3.633909|3.633909	0.67130|0.67130	0.005674|0.005674	0.004535|0.004535	ENSG00000204920|ENSG00000204920	ENST00000407951;ENST00000270014|ENST00000425747	T;T|.	0.05580|.	3.42;3.42|.	2.59|2.59	1.48|1.48	0.22813|0.22813	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);|.	.|.	.|.	.|.	.|.	T|.	0.16257|.	0.0391|.	N|N	0.11756|0.11756	0.17|0.17	0.23657|0.23657	N|N	0.997188|0.997188	P;D|.	0.57899|.	0.813;0.981|.	P;P|.	0.62649|.	0.755;0.905|.	T|.	0.20706|.	-1.0267|.	9|.	0.62326|0.87932	D|D	0.03|0	.|.	6.8359|6.8359	0.23935|0.23935	0.7917:0.0:0.0:0.2083|0.7917:0.0:0.0:0.2083	rs62640893|rs62640893	234;223|.	B4DM95;Q12901|.	.;ZN155_HUMAN|.	L|X	234;223|97	ENSP00000385163:Q234L;ENSP00000270014:Q223L|.	ENSP00000270014:Q223L|ENSP00000401576:R97X	Q|R	+|+	2|1	0|2	ZNF155|ZNF155	49192517|49192517	0.000000|0.000000	0.05858|0.05858	0.029000|0.029000	0.17559|0.17559	0.601000|0.601000	0.36947|0.36947	-0.729000|-0.729000	0.04920|0.04920	0.183000|0.183000	0.20059|0.20059	0.379000|0.379000	0.24179|0.24179	CAG|AGA	ZNF155	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.428	ZNF155-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF155	HGNC	protein_coding	OTTHUMT00000460074.1	A	NM_003445		44500677	+1	no_errors	ENST00000270014	ensembl	human	known	70_37	missense	SNP	0.947	T
ZNF207	7756	genome.wustl.edu	37	17	30692393	30692393	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:30692393C>G	ENST00000321233.6	+	7	821	c.667C>G	c.(667-669)Caa>Gaa	p.Q223E	ZNF207_ENST00000341711.6_Missense_Mutation_p.Q140E|ZNF207_ENST00000394670.4_Missense_Mutation_p.Q239E|ZNF207_ENST00000394673.2_Missense_Mutation_p.Q239E|ZNF207_ENST00000342555.6_Missense_Mutation_p.Q242E|ZNF207_ENST00000577908.1_Missense_Mutation_p.Q239E	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207	223					attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			TCCAATGACTCAAGCACAGGC	0.483																																																	0													87.0	81.0	83.0					17																	30692393		2203	4300	6503	SO:0001583	missense	7756			AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810	ENST00000321233.6:c.667C>G	17.37:g.30692393C>G	ENSP00000322777:p.Gln223Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	Missense_Mutation	SNP	smart_Znf_C2H2-like	p.Q239E	ENST00000321233.6	37	c.715	CCDS11271.1	17	.	.	.	.	.	.	.	.	.	.	C	23.4	4.407738	0.83340	.	.	ENSG00000010244	ENST00000394670;ENST00000394673;ENST00000394679;ENST00000321233;ENST00000341711;ENST00000342555	T;T	0.45276	0.97;0.9	5.87	5.87	0.94306	.	0.000000	0.64402	D	0.000001	T	0.52386	0.1731	L	0.43152	1.355	0.58432	D	0.999999	B;B;B;B;P	0.43578	0.368;0.368;0.368;0.368;0.811	B;B;B;B;P	0.57960	0.078;0.078;0.078;0.078;0.83	T	0.24476	-1.0159	10	0.06625	T	0.88	.	20.2119	0.98289	0.0:1.0:0.0:0.0	.	223;242;239;239;223	A8MTG3;Q59G94;E1P660;O43670-2;O43670	.;.;.;.;ZN207_HUMAN	E	239;223;242;239;140;223	ENSP00000378165:Q239E;ENSP00000344913:Q140E	ENSP00000322777:Q239E	Q	+	1	0	ZNF207	27716506	1.000000	0.71417	1.000000	0.80357	0.922000	0.55478	7.757000	0.85209	2.784000	0.95788	0.585000	0.79938	CAA	ZNF207	-	NULL		0.483	ZNF207-003	KNOWN	basic|CCDS	protein_coding	ZNF207	HGNC	protein_coding	OTTHUMT00000256251.2	C			30692393	+1	no_errors	ENST00000394670	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF295-AS1	150142	genome.wustl.edu	37	21	43444588	43444588	+	lincRNA	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr21:43444588C>T	ENST00000596595.1	+	0	2397							Q8N0V1	ZNAS1_HUMAN	ZNF295 antisense RNA 1																		GTGCTGCTCTCCTCTGTGTCC	0.582																																																	0													205.0	203.0	204.0					21																	43444588		692	1591	2283			150142					21q22.3	2012-10-12	2012-08-15	2011-08-11	ENSG00000237232	ENSG00000237232		"""Long non-coding RNAs"""	23130	non-coding RNA	RNA, long non-coding			"""chromosome 21 open reading frame 121"", ""non-protein coding RNA 318"", ""ZNF295 antisense RNA 1 (non-protein coding)"""	C21orf121, NCRNA00318			Standard	NR_119384		Approved	PRED87	uc011aeu.1	Q8N0V1	OTTHUMG00000086787		21.37:g.43444588C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000596595.1	37	NULL		21																																																																																			ZNF295-AS1	-	-		0.582	ZNF295-AS1-201	KNOWN	basic	lincRNA	ZNF295-AS1	HGNC	lincRNA		C	NR_027273		43444588	+1	no_errors	ENST00000412906	ensembl	human	known	70_37	rna	SNP	0.000	T
ZNF337	26152	genome.wustl.edu	37	20	25656944	25656944	+	Missense_Mutation	SNP	C	C	T	rs370233494		TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:25656944C>T	ENST00000376436.1	-	4	1519	c.980G>A	c.(979-981)cGa>cAa	p.R327Q	RP4-694B14.5_ENST00000428254.1_RNA|ZNF337_ENST00000538750.1_Missense_Mutation_p.R295Q|RP4-694B14.5_ENST00000421829.1_RNA|RP4-694B14.5_ENST00000439498.1_RNA|ZNF337_ENST00000481610.1_5'Flank|RP4-694B14.5_ENST00000455791.1_RNA|RP4-694B14.5_ENST00000414393.1_RNA|ZNF337_ENST00000252979.5_Missense_Mutation_p.R327Q			Q9Y3M9	ZN337_HUMAN	zinc finger protein 337	327					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(8)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	32						AGTATAGCCTCGCCCACACTC	0.488																																																	0								C	GLN/ARG	0,4406		0,0,2203	101.0	95.0	97.0		980	1.3	0.0	20		97	1,8599		0,1,4299	no	missense	ZNF337	NM_015655.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	327/752	25656944	1,13005	2203	4300	6503	SO:0001583	missense	26152				CCDS13174.1	20p11.1	2013-09-20			ENSG00000130684	ENSG00000130684		"""Zinc fingers, C2H2-type"", ""-"""	15809	protein-coding gene	gene with protein product							Standard	XM_005260702		Approved	dJ694B14.1	uc002wuz.3	Q9Y3M9	OTTHUMG00000032131	ENST00000376436.1:c.980G>A	20.37:g.25656944C>T	ENSP00000365619:p.Arg327Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DSM2|Q9Y3Y5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R327Q	ENST00000376436.1	37	c.980	CCDS13174.1	20	.	.	.	.	.	.	.	.	.	.	.	21.2	4.120691	0.77323	0.0	1.16E-4	ENSG00000130684	ENST00000376436;ENST00000252979;ENST00000376412;ENST00000538750	T;T;T	0.18960	2.18;2.18;2.18	1.34	1.34	0.21922	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.19725	0.0474	L	0.48218	1.51	0.20489	N	0.999897	D;D	0.55605	0.972;0.972	P;P	0.46629	0.522;0.522	T	0.15925	-1.0420	9	0.72032	D	0.01	.	3.7001	0.08379	0.0:0.757:0.0:0.243	.	295;327	B4DSM2;Q9Y3M9	.;ZN337_HUMAN	Q	327;327;327;295	ENSP00000365619:R327Q;ENSP00000252979:R327Q;ENSP00000442181:R295Q	ENSP00000252979:R327Q	R	-	2	0	ZNF337	25604944	0.997000	0.39634	0.034000	0.17996	0.976000	0.68499	1.963000	0.40452	1.049000	0.40321	0.306000	0.20318	CGA	ZNF337	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.488	ZNF337-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF337	HGNC	protein_coding	OTTHUMT00000078454.1	C			25656944	-1	no_errors	ENST00000252979	ensembl	human	known	70_37	missense	SNP	0.724	T
ZNF512B	57473	genome.wustl.edu	37	20	62598315	62598315	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr20:62598315A>G	ENST00000450537.1	-	4	367	c.307T>C	c.(307-309)Tcg>Ccg	p.S103P	ZNF512B_ENST00000369888.1_Missense_Mutation_p.S103P|ZNF512B_ENST00000217130.3_Missense_Mutation_p.S103P			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	103					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					TTCACCCTCGAGTGTGCCTTG	0.607																																																	0													133.0	117.0	123.0					20																	62598315		2203	4300	6503	SO:0001583	missense	57473			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.307T>C	20.37:g.62598315A>G	ENSP00000393795:p.Ser103Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AK9|Q9ULM4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S103P	ENST00000450537.1	37	c.307	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	A	25.3	4.623409	0.87460	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.35236	1.32;1.32;1.32	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.47691	0.1459	L	0.29908	0.895	0.44976	D	0.997997	D	0.76494	0.999	D	0.83275	0.996	T	0.49485	-0.8935	10	0.62326	D	0.03	-19.3008	13.4862	0.61366	1.0:0.0:0.0:0.0	.	103	Q96KM6	Z512B_HUMAN	P	103	ENSP00000358904:S103P;ENSP00000393795:S103P;ENSP00000217130:S103P	ENSP00000217130:S103P	S	-	1	0	ZNF512B	62068759	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	8.575000	0.90766	1.929000	0.55896	0.397000	0.26171	TCG	ZNF512B	-	NULL		0.607	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF512B	HGNC	protein_coding	OTTHUMT00000080246.1	A	NM_020713		62598315	-1	no_errors	ENST00000217130	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF513	130557	genome.wustl.edu	37	2	27600419	27600419	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr2:27600419G>A	ENST00000323703.6	-	4	1817	c.1619C>T	c.(1618-1620)tCa>tTa	p.S540L	ZNF513_ENST00000491924.1_5'Flank|ZNF513_ENST00000407879.1_Missense_Mutation_p.S478L	NM_144631.5	NP_653232.3	Q8N8E2	ZN513_HUMAN	zinc finger protein 513	540					regulation of transcription, DNA-templated (GO:0006355)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|transcription, DNA-templated (GO:0006351)|visual perception (GO:0007601)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|transcription regulatory region DNA binding (GO:0044212)			endometrium(5)|kidney(1)|large_intestine(2)|lung(7)|ovary(2)	17	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					AGTTCAGGATGAGTCTGTGTG	0.607																																																	0													37.0	39.0	38.0					2																	27600419		2203	4300	6503	SO:0001583	missense	130557			AL833946	CCDS1751.1, CCDS56114.1	2p23.3	2014-01-28			ENSG00000163795	ENSG00000163795		"""Zinc fingers, C2H2-type"""	26498	protein-coding gene	gene with protein product		613598				12477932	Standard	NM_001201459		Approved	FLJ32203, RP58	uc002rkk.3	Q8N8E2	OTTHUMG00000097783	ENST00000323703.6:c.1619C>T	2.37:g.27600419G>A	ENSP00000318373:p.Ser540Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3S5|B7WP71|Q3ZCU1|Q68CJ1|Q86UZ3|Q8NDL8|Q96ML3	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S540L	ENST00000323703.6	37	c.1619	CCDS1751.1	2	.	.	.	.	.	.	.	.	.	.	G	14.70	2.614727	0.46631	.	.	ENSG00000163795	ENST00000323703;ENST00000407879	T;T	0.07021	3.23;3.26	4.61	4.61	0.57282	.	0.000000	0.39083	N	0.001477	T	0.05181	0.0138	N	0.08118	0	0.33802	D	0.626856	P	0.47409	0.895	B	0.38056	0.264	T	0.25847	-1.0120	10	0.87932	D	0	-5.1868	16.1523	0.81632	0.0:0.0:1.0:0.0	.	540	Q8N8E2	ZN513_HUMAN	L	540;478	ENSP00000318373:S540L;ENSP00000384874:S478L	ENSP00000318373:S540L	S	-	2	0	ZNF513	27453923	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	2.046000	0.41260	2.388000	0.81334	0.561000	0.74099	TCA	ZNF513	-	NULL		0.607	ZNF513-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF513	HGNC	protein_coding	OTTHUMT00000215026.2	G	NM_144631		27600419	-1	no_errors	ENST00000323703	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNF561	93134	genome.wustl.edu	37	19	9730240	9730240	+	5'UTR	SNP	T	T	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:9730240T>C	ENST00000302851.3	-	0	256				C19orf82_ENST00000586614.1_5'Flank|ZNF561_ENST00000326044.5_5'UTR|ZNF561_ENST00000495503.1_5'UTR|C19orf82_ENST00000592851.1_5'Flank|C19orf82_ENST00000587536.1_5'Flank|C19orf82_ENST00000591056.1_5'Flank|ZNF561_ENST00000424629.1_5'UTR|ZNF561_ENST00000354661.4_5'UTR	NM_152289.2	NP_689502.2	Q8N587	ZN561_HUMAN	zinc finger protein 561						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(2)|large_intestine(3)|lung(5)|ovary(1)	14						TTCCTCTTTGTACAGGGTTAT	0.443																																																	0																																										SO:0001623	5_prime_UTR_variant	93134			AK074787	CCDS12216.2	19p13.2	2013-09-20			ENSG00000171469	ENSG00000171469		"""Zinc fingers, C2H2-type"", ""-"""	28684	protein-coding gene	gene with protein product						12477932	Standard	NM_152289		Approved	MGC45408	uc002mlu.3	Q8N587	OTTHUMG00000157054	ENST00000302851.3:c.-108A>G	19.37:g.9730240T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E2Q8|Q6PJS0	RNA	SNP	-	NULL	ENST00000302851.3	37	NULL	CCDS12216.2	19																																																																																			ZNF561	-	-		0.443	ZNF561-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF561	HGNC	protein_coding	OTTHUMT00000347272.2	T	NM_152289		9730240	-1	no_errors	ENST00000465974	ensembl	human	known	70_37	rna	SNP	0.004	C
ZNF578	147660	genome.wustl.edu	37	19	53014505	53014505	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:53014505G>A	ENST00000421239.2	+	6	1115	c.871G>A	c.(871-873)Gaa>Aaa	p.E291K	CTD-3099C6.5_ENST00000599143.1_RNA	NM_001099694.1	NP_001093164.1	Q96N58	ZN578_HUMAN	zinc finger protein 578	291					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)								GBM - Glioblastoma multiforme(134;0.00819)|OV - Ovarian serous cystadenocarcinoma(262;0.01)		CAAGTGTAATGAATGTGGAAA	0.393																																																	0													108.0	112.0	111.0					19																	53014505		2203	4300	6503	SO:0001583	missense	147660			AK095562	CCDS54310.1	19q13.41	2013-09-20			ENSG00000258405	ENSG00000258405		"""Zinc fingers, C2H2-type"", ""-"""	26449	protein-coding gene	gene with protein product							Standard	NM_001099694		Approved	FLJ31384	uc002pzp.4	Q96N58	OTTHUMG00000156468	ENST00000421239.2:c.871G>A	19.37:g.53014505G>A	ENSP00000459216:p.Glu291Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR51|I3L1Y6	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E291K	ENST00000421239.2	37	c.871	CCDS54310.1	19	.	.	.	.	.	.	.	.	.	.	-	11.18	1.561959	0.27915	.	.	ENSG00000258405	ENST00000553364	.	.	.	1.18	-0.482	0.12078	.	.	.	.	.	T	0.39384	0.1076	N	0.25380	0.74	0.09310	N	1	D	0.59767	0.986	D	0.70227	0.968	T	0.29640	-1.0005	7	.	.	.	.	7.6091	0.28120	0.0:0.3919:0.6081:0.0	.	291	G3V4F6	.	K	291	.	.	E	+	1	0	ZNF578	57706317	.	.	0.017000	0.16124	0.134000	0.20937	.	.	0.646000	0.30693	0.290000	0.19541	GAA	ZNF578	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.393	ZNF578-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	ZNF578	HGNC	protein_coding	OTTHUMT00000344298.3	G	NM_152472		53014505	+1	no_errors	ENST00000421239	ensembl	human	known	70_37	missense	SNP	0.002	A
ZNF587B	100293516	genome.wustl.edu	37	19	58352729	58352729	+	Silent	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:58352729C>T	ENST00000442832.4	+	3	921	c.687C>T	c.(685-687)ctC>ctT	p.L229L	ZNF587B_ENST00000316462.4_Intron|CTD-2583A14.10_ENST00000598031.1_Intron|ZNF587B_ENST00000594901.1_Silent_p.L229L	NM_001204818.1	NP_001191747.1	E7ETH6	Z587B_HUMAN	zinc finger protein 587B	229					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)										AACATATACTCAGTCAGCACC	0.428																																																	0																																										SO:0001819	synonymous_variant	100293516			AK299091	CCDS56109.1	19q13.43	2013-01-08				ENSG00000269343		"""Zinc fingers, C2H2-type"", ""-"""	37142	protein-coding gene	gene with protein product							Standard	NM_001204818		Approved		uc021vcp.1	E7ETH6		ENST00000442832.4:c.687C>T	19.37:g.58352729C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR41	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L229	ENST00000442832.4	37	c.687	CCDS56109.1	19																																																																																			ZNF587B	-	NULL		0.428	ZNF587B-001	KNOWN	non_canonical_U12|basic|CCDS	protein_coding	ZNF587B	HGNC	protein_coding	OTTHUMT00000466834.2	C	NM_001204818		58352729	+1	no_errors	ENST00000442832	ensembl	human	known	70_37	silent	SNP	0.000	T
ZNF646	9726	genome.wustl.edu	37	16	31088999	31088999	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:31088999G>C	ENST00000394979.2	+	1	1777	c.1354G>C	c.(1354-1356)Gag>Cag	p.E452Q	ZNF646_ENST00000300850.5_Missense_Mutation_p.E452Q			O15015	ZN646_HUMAN	zinc finger protein 646	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(4)|large_intestine(1)|lung(21)|ovary(1)|prostate(4)|skin(3)	49						CACCCACAAAGAGGAAGAGGA	0.627																																																	0													65.0	77.0	73.0					16																	31088999		2197	4300	6497	SO:0001583	missense	9726			AB002294	CCDS10702.1	16p11.2	2013-01-08			ENSG00000167395	ENSG00000167395		"""Zinc fingers, C2H2-type"""	29004	protein-coding gene	gene with protein product							Standard	NM_014699		Approved	KIAA0296	uc002eap.3	O15015	OTTHUMG00000047355	ENST00000394979.2:c.1354G>C	16.37:g.31088999G>C	ENSP00000378429:p.Glu452Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IVD8	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E452Q	ENST00000394979.2	37	c.1354		16	.	.	.	.	.	.	.	.	.	.	G	8.188	0.795261	0.16327	.	.	ENSG00000167395	ENST00000300850;ENST00000394979	T;T	0.08984	3.03;3.04	5.82	4.87	0.63330	.	.	.	.	.	T	0.11110	0.0271	L	0.27053	0.805	0.09310	N	1	D	0.57571	0.98	P	0.51229	0.663	T	0.24512	-1.0158	9	0.27082	T	0.32	-1.2716	13.604	0.62037	0.0754:0.0:0.9246:0.0	.	452	O15015-2	.	Q	452	ENSP00000300850:E452Q;ENSP00000378429:E452Q	ENSP00000300850:E452Q	E	+	1	0	ZNF646	30996500	0.047000	0.20315	0.004000	0.12327	0.200000	0.23975	2.138000	0.42140	1.472000	0.48140	0.655000	0.94253	GAG	ZNF646	-	NULL		0.627	ZNF646-003	KNOWN	basic	protein_coding	ZNF646	HGNC	protein_coding	OTTHUMT00000108510.2	G	NM_014699		31088999	+1	no_errors	ENST00000300850	ensembl	human	known	70_37	missense	SNP	0.330	C
ZNF683	257101	genome.wustl.edu	37	1	26694260	26694260	+	Missense_Mutation	SNP	T	T	C	rs10794532	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr1:26694260T>C	ENST00000436292.1	-	3	263	c.143A>G	c.(142-144)gAc>gGc	p.D48G	ZNF683_ENST00000403843.1_Missense_Mutation_p.D48G|ZNF683_ENST00000349618.3_Missense_Mutation_p.D48G|ZNF683_ENST00000374204.1_Missense_Mutation_p.D48G			Q8IZ20	ZN683_HUMAN	zinc finger protein 683	48			D -> G (in dbSNP:rs10794532).		natural killer cell differentiation (GO:0001779)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(8)|prostate(1)|skin(1)	15		all_cancers(24;2.39e-25)|Colorectal(325;3.46e-05)|all_lung(284;5.94e-05)|Lung NSC(340;7.26e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.00637)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;1.76e-26)|Colorectal(126;1.38e-08)|COAD - Colon adenocarcinoma(152;9.31e-07)|KIRC - Kidney renal clear cell carcinoma(1967;0.000751)|BRCA - Breast invasive adenocarcinoma(304;0.00099)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00793)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.159)|LUSC - Lung squamous cell carcinoma(448;0.233)		ATCCACCATGTCTGGAAGTGG	0.652													T|||	1726	0.344649	0.2428	0.2536	5008	,	,		15531	0.5794		0.1879	False		,,,				2504	0.4663																0								T	GLY/ASP,GLY/ASP	960,3446		101,758,1344	24.0	21.0	22.0		143,143	0.2	0.0	1	dbSNP_120	22	1621,6977		155,1311,2833	yes	missense,missense	ZNF683	NM_001114759.1,NM_173574.2	94,94	256,2069,4177	CC,CT,TT		18.8532,21.7885,19.8477	probably-damaging,probably-damaging	48/505,48/505	26694260	2581,10423	2203	4299	6502	SO:0001583	missense	257101			BC029505	CCDS279.2	1p36.11	2013-01-08			ENSG00000176083	ENSG00000176083		"""Zinc fingers, C2H2-type"""	28495	protein-coding gene	gene with protein product	"""hypothetical protein MGC33414"""					12477932	Standard	NM_173574		Approved	MGC33414	uc009vsj.1	Q8IZ20	OTTHUMG00000003521	ENST00000436292.1:c.143A>G	1.37:g.26694260T>C	ENSP00000388792:p.Asp48Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T141|Q5T146|Q5T147|Q5T149|Q8NEN4	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.D48G	ENST00000436292.1	37	c.143		1	683	0.31272893772893773	120	0.24390243902439024	93	0.2569060773480663	325	0.5681818181818182	145	0.19129287598944592	T	18.39	3.613996	0.66672	0.217885	0.188532	ENSG00000176083	ENST00000403843;ENST00000436292;ENST00000374204;ENST00000349618;ENST00000455900;ENST00000451801;ENST00000423508;ENST00000416125	T;T;T;T;T;T;T;T	0.31510	2.78;2.78;2.71;2.71;1.87;1.88;1.49;1.51	4.0	0.232	0.15381	.	0.164799	0.28841	N	0.013975	T	0.00012	0.0000	L	0.27053	0.805	0.80722	P	0.0	D;B	0.89917	1.0;0.137	D;B	0.83275	0.996;0.022	T	0.44817	-0.9303	9	0.59425	D	0.04	-13.15	3.1562	0.06505	0.0:0.2402:0.2195:0.5403	rs10794532;rs57949490;rs10794532	48;48	Q8IZ20-2;Q8IZ20	.;ZN683_HUMAN	G	48;48;48;48;56;48;56;48	ENSP00000384782:D48G;ENSP00000388792:D48G;ENSP00000363320:D48G;ENSP00000344095:D48G;ENSP00000411289:D56G;ENSP00000411290:D48G;ENSP00000391584:D56G;ENSP00000401961:D48G	ENSP00000344095:D48G	D	-	2	0	ZNF683	26566847	0.030000	0.19436	0.037000	0.18230	0.746000	0.42486	1.344000	0.33941	0.605000	0.29947	0.379000	0.24179	GAC	ZNF683	-	NULL		0.652	ZNF683-202	KNOWN	basic|appris_candidate_longest	protein_coding	ZNF683	HGNC	protein_coding	OTTHUMT00000009794.2	T	NM_173574		26694260	-1	no_errors	ENST00000403843	ensembl	human	known	70_37	missense	SNP	0.002	C
ZNF69	7620	genome.wustl.edu	37	19	12016104	12016104	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:12016104C>T	ENST00000429654.2	+	4	1032	c.892C>T	c.(892-894)Cac>Tac	p.H298Y	ZNF69_ENST00000340180.5_Intron			Q9UC07	ZNF69_HUMAN	zinc finger protein 69	298					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(1)|skin(2)	4				Lung(535;0.011)		TGAAAGGATTCACACGGGAGA	0.423																																																	0																																										SO:0001583	missense	7620			X60076	CCDS32914.1	19p13.2	2013-01-08	2006-05-12		ENSG00000198429	ENSG00000198429		"""Zinc fingers, C2H2-type"", ""-"""	13138	protein-coding gene	gene with protein product		194543	"""zinc finger protein 69 (Cos5)"""			1639391	Standard	NM_021915		Approved	Cos5	uc002mst.4	Q9UC07	OTTHUMG00000156526	ENST00000429654.2:c.892C>T	19.37:g.12016104C>T	ENSP00000402985:p.His298Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VA7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H298Y	ENST00000429654.2	37	c.892		19	.	.	.	.	.	.	.	.	.	.	c	15.15	2.747267	0.49257	.	.	ENSG00000198429	ENST00000429654	T	0.67523	-0.27	0.94	0.94	0.19513	.	.	.	.	.	T	0.70055	0.3180	.	.	.	0.34751	D	0.731778	.	.	.	.	.	.	T	0.77672	-0.2500	6	0.87932	D	0	.	9.4728	0.38853	0.0:1.0:0.0:0.0	.	.	.	.	Y	298	ENSP00000402985:H298Y	ENSP00000402985:H298Y	H	+	1	0	ZNF69	11877104	0.999000	0.42202	0.172000	0.22920	0.009000	0.06853	5.311000	0.65786	0.827000	0.34685	0.405000	0.27470	CAC	ZNF69	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF69-002	KNOWN	basic|appris_principal	protein_coding	ZNF69	HGNC	protein_coding	OTTHUMT00000344082.1	C	NM_021915		12016104	+1	no_errors	ENST00000429654	ensembl	human	known	70_37	missense	SNP	0.992	T
ZNF750	79755	genome.wustl.edu	37	17	80788294	80788294	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr17:80788294C>G	ENST00000269394.3	-	3	2729	c.1896G>C	c.(1894-1896)caG>caC	p.Q632H	TBCD_ENST00000539345.2_Intron|ZNF750_ENST00000572562.1_Missense_Mutation_p.Q233H|TBCD_ENST00000397466.2_Intron|TBCD_ENST00000355528.4_Intron	NM_024702.2	NP_078978.2	Q32MQ0	ZN750_HUMAN	zinc finger protein 750	632					cell differentiation (GO:0030154)|epidermis development (GO:0008544)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	core promoter sequence-specific DNA binding (GO:0001046)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(3)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(4)|lung(12)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	31	Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0514)|all_epithelial(8;0.0748)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.149)			CGGCTGCCGTCTGCTTCTGCT	0.726																																																	0													32.0	34.0	33.0					17																	80788294		2202	4298	6500	SO:0001583	missense	79755			AK023903	CCDS11819.1	17q25.3	2008-05-02				ENSG00000141579			25843	protein-coding gene	gene with protein product		610226				16751772	Standard	NM_024702		Approved	FLJ13841, Zfp750	uc002kga.3	Q32MQ0		ENST00000269394.3:c.1896G>C	17.37:g.80788294C>G	ENSP00000269394:p.Gln632His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H899	Missense_Mutation	SNP	NULL	p.Q632H	ENST00000269394.3	37	c.1896	CCDS11819.1	17	.	.	.	.	.	.	.	.	.	.	C	17.59	3.426435	0.62733	.	.	ENSG00000141579	ENST00000269394;ENST00000543850	T	0.15952	2.38	5.42	-0.742	0.11108	.	0.000000	0.64402	D	0.000020	T	0.33673	0.0871	M	0.65498	2.005	0.49483	D	0.999798	D	0.89917	1.0	D	0.91635	0.999	T	0.02743	-1.1116	9	.	.	.	-27.5599	11.068	0.47987	0.0:0.5706:0.0:0.4294	.	632	Q32MQ0	ZN750_HUMAN	H	632;225	ENSP00000269394:Q632H	.	Q	-	3	2	ZNF750	78381583	0.850000	0.29656	0.969000	0.41365	0.632000	0.37999	-0.096000	0.11059	-0.060000	0.13132	-0.218000	0.12543	CAG	ZNF750	-	NULL		0.726	ZNF750-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF750	HGNC	protein_coding	OTTHUMT00000439074.2	C	NM_024702		80788294	-1	no_errors	ENST00000269394	ensembl	human	known	70_37	missense	SNP	0.999	G
ZNF764	92595	genome.wustl.edu	37	16	30566961	30566961	+	Missense_Mutation	SNP	A	A	C			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr16:30566961A>C	ENST00000252797.2	-	3	861	c.781T>G	c.(781-783)Tgc>Ggc	p.C261G	ZNF764_ENST00000395091.2_Missense_Mutation_p.C260G|AC002310.13_ENST00000568114.1_Intron	NM_001172679.1|NM_033410.3	NP_001166150.1|NP_219363.2	Q96H86	ZN764_HUMAN	zinc finger protein 764	261					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(1)	7						CAGTCGGCGCAGCCATAGGGT	0.721																																																	0													4.0	6.0	5.0					16																	30566961		2039	4047	6086	SO:0001583	missense	92595			BC008821	CCDS10683.1, CCDS54001.1	16p11.2	2013-01-08			ENSG00000169951	ENSG00000169951		"""Zinc fingers, C2H2-type"", ""-"""	28200	protein-coding gene	gene with protein product						12477932	Standard	NM_033410		Approved	MGC13138	uc002dyq.3	Q96H86	OTTHUMG00000132406	ENST00000252797.2:c.781T>G	16.37:g.30566961A>C	ENSP00000252797:p.Cys261Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MZF4|B3KSN2|H9KV99|Q9BWS1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.C261G	ENST00000252797.2	37	c.781	CCDS10683.1	16	.	.	.	.	.	.	.	.	.	.	A	17.04	3.288398	0.59976	.	.	ENSG00000169951	ENST00000252797;ENST00000395091	D;D	0.85258	-1.96;-1.96	4.74	4.74	0.60224	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.42172	D	0.000749	D	0.94892	0.8349	H	0.97758	4.07	0.45777	D	0.998661	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.96318	0.9234	10	0.87932	D	0	-13.5261	13.3827	0.60778	1.0:0.0:0.0:0.0	.	260;261	B3KSN2;Q96H86	.;ZN764_HUMAN	G	261;260	ENSP00000252797:C261G;ENSP00000378526:C260G	ENSP00000252797:C261G	C	-	1	0	ZNF764	30474462	1.000000	0.71417	0.952000	0.39060	0.090000	0.18270	9.064000	0.93933	1.998000	0.58463	0.379000	0.24179	TGC	ZNF764	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.721	ZNF764-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ZNF764	HGNC	protein_coding	OTTHUMT00000255541.1	A	NM_033410		30566961	-1	no_errors	ENST00000252797	ensembl	human	known	70_37	missense	SNP	0.991	C
ZNF773	374928	genome.wustl.edu	37	19	58017753	58017753	+	Missense_Mutation	SNP	C	C	A	rs201340833|rs61731281|rs386811330	byFrequency	TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:58017753C>A	ENST00000282292.4	+	4	430	c.290C>A	c.(289-291)gCa>gAa	p.A97E	ZNF773_ENST00000599847.1_Intron|ZNF773_ENST00000598770.1_Missense_Mutation_p.A96E|ZNF773_ENST00000593916.1_Intron	NM_198542.1	NP_940944.1	Q6PK81	ZN773_HUMAN	zinc finger protein 773	97					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(4)|kidney(2)|large_intestine(5)|lung(6)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	22		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0254)		AAGGCTGAGGCAGCTGCTGAG	0.488													A|||	859	0.171526	0.2716	0.1484	5008	,	,		22832	0.1002		0.2018	False		,,,				2504	0.0951																0													84.0	87.0	86.0					19																	58017753		2203	4300	6503	SO:0001583	missense	374928			BC005167	CCDS33134.1	19q13.43	2013-01-08	2006-12-15	2006-12-15		ENSG00000152439		"""Zinc fingers, C2H2-type"", ""-"""	30487	protein-coding gene	gene with protein product			"""zinc finger protein 419B"""	ZNF419B		12477932	Standard	NM_198542		Approved	MGC4728	uc002qox.3	Q6PK81		ENST00000282292.4:c.290C>A	19.37:g.58017753C>A	ENSP00000282292:p.Ala97Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96DL8	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.A97E	ENST00000282292.4	37	c.290	CCDS33134.1	19	.	.	.	.	.	.	.	.	.	.	A	0.009	-1.856327	0.00558	.	.	ENSG00000152439	ENST00000282292	T	0.05649	3.41	1.25	1.25	0.21368	.	.	.	.	.	T	0.02929	0.0087	N	0.05280	-0.08	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.46789	-0.9166	9	0.28530	T	0.3	.	5.476	0.16695	0.7127:0.2873:0.0:0.0	rs61731281	96;97	Q6PK81-2;Q6PK81	.;ZN773_HUMAN	E	97	ENSP00000282292:A97E	ENSP00000282292:A97E	A	+	2	0	ZNF773	62709565	0.001000	0.12720	0.001000	0.08648	0.001000	0.01503	0.333000	0.19768	0.000000	0.14550	-0.824000	0.03097	GCA	ZNF773	-	NULL		0.488	ZNF773-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF773	HGNC	protein_coding	OTTHUMT00000466475.1	C	NM_198542		58017753	+1	no_errors	ENST00000282292	ensembl	human	known	70_37	missense	SNP	0.008	A
ZNF814	730051	genome.wustl.edu	37	19	58385818	58385818	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A3HE-01A-21D-A22X-09	TCGA-C5-A3HE-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	a5ef4c25-9b8c-4b52-92ac-6f0bfff93282	a6eaeac8-9943-4ea1-b40b-ccf53e8544b0	g.chr19:58385818G>A	ENST00000435989.2	-	3	1174	c.940C>T	c.(940-942)Cat>Tat	p.H314Y	ZNF814_ENST00000600634.1_Intron|ZNF814_ENST00000597832.1_Intron|ZNF814_ENST00000597342.1_Intron|ZNF814_ENST00000596604.1_Intron|ZNF814_ENST00000595295.1_Intron	NM_001144989.1	NP_001138461.1	B7Z6K7	ZN814_HUMAN	zinc finger protein 814	314					regulation of transcription, DNA-templated (GO:0006355)	intracellular (GO:0005622)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|central_nervous_system(2)|endometrium(3)|kidney(9)|lung(2)|prostate(4)|skin(1)|urinary_tract(3)	25						ACTCTCTGATGATTACTGAAG	0.368																																																	0													9.0	7.0	8.0					19																	58385818		674	1517	2191	SO:0001583	missense	730051				CCDS46212.1	19q13.43	2013-01-08			ENSG00000204514	ENSG00000204514		"""Zinc fingers, C2H2-type"", ""-"""	33258	protein-coding gene	gene with protein product							Standard	NM_001144989		Approved		uc002qqo.2	B7Z6K7		ENST00000435989.2:c.940C>T	19.37:g.58385818G>A	ENSP00000410545:p.His314Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF35	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H314Y	ENST00000435989.2	37	c.940	CCDS46212.1	19	.	.	.	.	.	.	.	.	.	.	.	10.34	1.323985	0.24080	.	.	ENSG00000204514	ENST00000435989	D	0.86769	-2.17	2.49	2.49	0.30216	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.94016	0.8083	M	0.92412	3.305	0.09310	N	1	D	0.76494	0.999	D	0.66351	0.943	D	0.86063	0.1533	9	0.87932	D	0	.	12.2184	0.54420	0.0:0.0:1.0:0.0	.	314	B7Z6K7	ZN814_HUMAN	Y	314	ENSP00000410545:H314Y	ENSP00000410545:H314Y	H	-	1	0	ZNF814	63077630	0.005000	0.15991	0.002000	0.10522	0.208000	0.24298	1.328000	0.33758	1.441000	0.47550	0.134000	0.15878	CAT	ZNF814	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.368	ZNF814-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF814	HGNC	protein_coding	OTTHUMT00000466976.1	G	XM_001725708		58385818	-1	no_errors	ENST00000435989	ensembl	human	known	70_37	missense	SNP	0.013	A
