#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ADAM12	8038	genome.wustl.edu	37	10	127782552	127782552	+	Splice_Site	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr10:127782552G>T	ENST00000368679.4	-	11	1464		c.e11+1		ADAM12_ENST00000368676.4_Splice_Site	NM_003474.4	NP_003465.3	O43184	ADA12_HUMAN	ADAM metallopeptidase domain 12						cell adhesion (GO:0007155)|epidermal growth factor receptor signaling pathway (GO:0007173)|myoblast fusion (GO:0007520)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|SH3 domain binding (GO:0017124)|zinc ion binding (GO:0008270)			biliary_tract(1)|breast(7)|central_nervous_system(4)|endometrium(5)|kidney(3)|large_intestine(11)|liver(1)|lung(24)|ovary(2)|prostate(1)|skin(4)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	69		all_epithelial(44;7.06e-05)|all_lung(145;0.00563)|Lung NSC(174;0.00834)|Colorectal(57;0.102)|all_neural(114;0.107)|Breast(234;0.22)		COAD - Colon adenocarcinoma(40;0.141)|Colorectal(40;0.216)		AATGGTACTTGCCCGGTGGAA	0.512																																																	0													208.0	183.0	191.0					10																	127782552		2203	4300	6503	SO:0001630	splice_region_variant	8038			AF023476	CCDS7653.1, CCDS7654.1	10q26	2008-07-29	2008-07-29		ENSG00000148848	ENSG00000148848		"""ADAM metallopeptidase domain containing"""	190	protein-coding gene	gene with protein product	"""meltrin alpha"""	602714	"""a disintegrin and metalloproteinase domain 12 (meltrin alpha)"""			9417060, 18342566	Standard	NM_003474		Approved	MCMPMltna, MLTN	uc001ljk.2	O43184	OTTHUMG00000019243	ENST00000368679.4:c.1154+1C>A	10.37:g.127782552G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60470|Q5JRP0|Q5JRP1|Q6P9E3|Q6UWB0	Splice_Site	SNP	-	e11+2	ENST00000368679.4	37	c.1154+2	CCDS7653.1	10	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584339	0.46110	.	.	ENSG00000148848	ENST00000368679;ENST00000368676	.	.	.	4.79	1.65	0.23941	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.4146	0.16365	0.5931:0.0:0.4069:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	ADAM12	127772542	1.000000	0.71417	1.000000	0.80357	0.789000	0.44602	4.341000	0.59335	0.603000	0.29913	0.455000	0.32223	.	ADAM12	-	-		0.512	ADAM12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM12	HGNC	protein_coding	OTTHUMT00000050961.1	G		Intron	127782552	-1	no_errors	ENST00000368679	ensembl	human	known	70_37	splice_site	SNP	1.000	T
ADCY9	115	genome.wustl.edu	37	16	4029235	4029235	+	Missense_Mutation	SNP	C	C	T	rs142198070		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:4029235C>T	ENST00000294016.3	-	8	3099	c.2561G>A	c.(2560-2562)cGc>cAc	p.R854H		NM_001116.3	NP_001107.2	O60503	ADCY9_HUMAN	adenylate cyclase 9	854					activation of phospholipase C activity (GO:0007202)|activation of protein kinase A activity (GO:0034199)|adenylate cyclase-activating G-protein coupled receptor signaling pathway (GO:0007189)|adenylate cyclase-inhibiting G-protein coupled receptor signaling pathway (GO:0007193)|cellular response to glucagon stimulus (GO:0071377)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|intracellular signal transduction (GO:0035556)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(11)|lung(9)|ovary(5)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	47						CTCCAGCAGGCGCTTGGTGCA	0.662																																																	0								C	HIS/ARG	1,4393	2.1+/-5.4	0,1,2196	60.0	60.0	60.0		2561	2.1	1.0	16	dbSNP_134	60	0,8600		0,0,4300	no	missense	ADCY9	NM_001116.3	29	0,1,6496	TT,TC,CC		0.0,0.0228,0.0077	benign	854/1354	4029235	1,12993	2197	4300	6497	SO:0001583	missense	115			AF036927	CCDS32382.1	16p13.3	2013-02-04				ENSG00000162104	4.6.1.1	"""Adenylate cyclases"""	240	protein-coding gene	gene with protein product		603302				9628827	Standard	NM_001116		Approved	AC9	uc002cvx.3	O60503		ENST00000294016.3:c.2561G>A	16.37:g.4029235C>T	ENSP00000294016:p.Arg854His	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2V5|A7E2X2|D3DUD1|O60273|Q4ZHT9|Q4ZIR5|Q9BWT4|Q9UGP2	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,smart_A/G_cyclase,pfscan_A/G_cyclase	p.R854H	ENST00000294016.3	37	c.2561	CCDS32382.1	16	.	.	.	.	.	.	.	.	.	.	C	14.58	2.577186	0.45902	2.28E-4	0.0	ENSG00000162104	ENST00000294016	D	0.83335	-1.71	5.54	2.08	0.27032	.	0.544492	0.20631	N	0.088598	T	0.69700	0.3140	L	0.27053	0.805	0.30493	N	0.771183	B	0.09022	0.002	B	0.04013	0.001	T	0.58446	-0.7635	10	0.13470	T	0.59	.	12.0346	0.53417	0.0:0.7791:0.0:0.2209	.	854	O60503	ADCY9_HUMAN	H	854	ENSP00000294016:R854H	ENSP00000294016:R854H	R	-	2	0	ADCY9	3969236	0.002000	0.14202	1.000000	0.80357	0.997000	0.91878	0.107000	0.15375	0.713000	0.32060	0.655000	0.94253	CGC	ADCY9	-	NULL		0.662	ADCY9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY9	HGNC	protein_coding	OTTHUMT00000438076.1	C			4029235	-1	no_errors	ENST00000294016	ensembl	human	known	70_37	missense	SNP	0.851	T
ADPGK	83440	genome.wustl.edu	37	15	73076523	73076523	+	5'Flank	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr15:73076523G>A	ENST00000311669.8	-	0	0				ADPGK_ENST00000567733.1_5'Flank|ADPGK-AS1_ENST00000566745.1_RNA|ADPGK-AS1_ENST00000563592.1_RNA	NM_031284.4	NP_112574.3	Q9BRR6	ADPGK_HUMAN	ADP-dependent glucokinase						glycolytic process (GO:0006096)	extracellular region (GO:0005576)|membrane (GO:0016020)	ADP-specific glucokinase activity (GO:0043843)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|lung(2)|skin(1)	7						CGGCGCTTCTGAGAGGAATAG	0.612											OREG0023259	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001631	upstream_gene_variant	100287559			AL136873	CCDS42057.1	15q24.1	2012-07-02			ENSG00000159322	ENSG00000159322			25250	protein-coding gene	gene with protein product		611861				11230166	Standard	NM_031284		Approved	DKFZp434B195, ADP-GK	uc002avf.4	Q9BRR6	OTTHUMG00000172777		15.37:g.73076523G>A	Exception_encountered	Somatic	1142	WXS	Illumina HiSeq	Phase_IV	Q49AU7|Q8NBI1|Q8WZ90|Q96NF8|Q9H0A7	RNA	SNP	-	NULL	ENST00000311669.8	37	NULL	CCDS42057.1	15																																																																																			ADPGK-AS1	-	-		0.612	ADPGK-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADPGK-AS1	HGNC	protein_coding	OTTHUMT00000420434.1	G	NM_031284		73076523	+1	no_errors	ENST00000563592	ensembl	human	known	70_37	rna	SNP	0.000	A
AFF3	3899	genome.wustl.edu	37	2	100199393	100199393	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:100199393G>C	ENST00000409236.2	-	15	2772	c.2660C>G	c.(2659-2661)tCt>tGt	p.S887C	AFF3_ENST00000317233.4_Missense_Mutation_p.S887C|AFF3_ENST00000409579.1_Missense_Mutation_p.S912C|AFF3_ENST00000356421.2_Missense_Mutation_p.S912C			P51826	AFF3_HUMAN	AF4/FMR2 family, member 3	887					embryonic hindlimb morphogenesis (GO:0035116)|regulation of transcription, DNA-templated (GO:0006355)|response to tumor necrosis factor (GO:0034612)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	double-stranded DNA binding (GO:0003690)			NS(1)|breast(3)|central_nervous_system(1)|cervix(3)|endometrium(9)|kidney(4)|large_intestine(20)|liver(1)|lung(28)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|urinary_tract(3)	86						TTTGTGTTTAGATGCATCAGA	0.423																																																	0													171.0	156.0	161.0					2																	100199393		2203	4300	6503	SO:0001583	missense	3899			U34360	CCDS33258.1, CCDS42723.1	2q11.2-q12	2008-02-05	2005-06-27	2005-06-27	ENSG00000144218	ENSG00000144218			6473	protein-coding gene	gene with protein product		601464	"""lymphoid nuclear protein related to AF4"""	LAF4		8662235, 8555498	Standard	XM_005263945		Approved	MLLT2-like	uc002taf.3	P51826	OTTHUMG00000153011	ENST00000409236.2:c.2660C>G	2.37:g.100199393G>C	ENSP00000387207:p.Ser887Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZM46|B9EGL9|D3DVI6|Q53RD6|Q53S47|Q53SI6|Q53TB9|Q59F27|Q8IWJ5	Missense_Mutation	SNP	pfam_TF_AF4/FMR2	p.S912C	ENST00000409236.2	37	c.2735	CCDS42723.1	2	.	.	.	.	.	.	.	.	.	.	G	13.15	2.150514	0.37923	.	.	ENSG00000144218	ENST00000317233;ENST00000356421;ENST00000409579;ENST00000409236	T;T;T;T	0.68181	-0.31;-0.31;-0.31;-0.31	6.07	5.18	0.71444	.	0.160832	0.41938	N	0.000789	T	0.54287	0.1849	N	0.19112	0.55	0.33873	D	0.635131	B;B	0.18166	0.002;0.026	B;B	0.19391	0.01;0.025	T	0.62167	-0.6911	10	0.54805	T	0.06	.	15.4296	0.75081	0.0:0.143:0.857:0.0	.	887;912	P51826;P51826-2	AFF3_HUMAN;.	C	887;912;912;887	ENSP00000317421:S887C;ENSP00000348793:S912C;ENSP00000386834:S912C;ENSP00000387207:S887C	ENSP00000317421:S887C	S	-	2	0	AFF3	99565825	1.000000	0.71417	0.210000	0.23637	0.983000	0.72400	4.658000	0.61497	1.537000	0.49254	0.655000	0.94253	TCT	AFF3	-	pfam_TF_AF4/FMR2		0.423	AFF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AFF3	HGNC	protein_coding	OTTHUMT00000328982.3	G	NM_002285		100199393	-1	no_errors	ENST00000356421	ensembl	human	known	70_37	missense	SNP	0.924	C
AGBL3	340351	genome.wustl.edu	37	7	134674004	134674004	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr7:134674004G>T	ENST00000436302.2	+	3	320	c.67G>T	c.(67-69)Gag>Tag	p.E23*	AGBL3_ENST00000458078.1_5'UTR|AGBL3_ENST00000359383.3_Nonsense_Mutation_p.E23*|AGBL3_ENST00000435976.2_Nonsense_Mutation_p.E23*|AGBL3_ENST00000494702.2_3'UTR	NM_178563.3	NP_848658.3	Q8NEM8	CBPC3_HUMAN	ATP/GTP binding protein-like 3	23						cytoplasm (GO:0005737)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(3)|lung(2)|skin(3)	10						ATTTTAGGATGAGGATATGTT	0.269																																																	0													113.0	102.0	105.0					7																	134674004		692	1588	2280	SO:0001587	stop_gained	340351			BC030651	CCDS47718.1	7q33	2014-06-23			ENSG00000146856	ENSG00000146856			27981	protein-coding gene	gene with protein product							Standard	NM_178563		Approved	MGC32955, CCP3	uc011kpw.2	Q8NEM8	OTTHUMG00000155406	ENST00000436302.2:c.67G>T	7.37:g.134674004G>T	ENSP00000388275:p.Glu23*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z827|Q9H965	Nonsense_Mutation	SNP	pfam_Peptidase_M14	p.E23*	ENST00000436302.2	37	c.67	CCDS47718.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.777621	0.96929	.	.	ENSG00000146856	ENST00000436302;ENST00000359383;ENST00000435976;ENST00000455283	.	.	.	5.44	3.6	0.41247	.	0.398124	0.23680	N	0.045629	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-9.682	9.9167	0.41439	0.1455:0.0:0.8545:0.0	.	.	.	.	X	23	.	ENSP00000275763:E23X	E	+	1	0	AGBL3	134324544	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	2.066000	0.41452	2.541000	0.85698	0.563000	0.77884	GAG	AGBL3	-	NULL		0.269	AGBL3-007	KNOWN	basic|appris_principal|CCDS	protein_coding	AGBL3	HGNC	protein_coding	OTTHUMT00000376655.1	G	NM_178563		134674004	+1	no_errors	ENST00000436302	ensembl	human	known	70_37	nonsense	SNP	1.000	T
AJAP1	55966	genome.wustl.edu	37	1	4834486	4834486	+	Splice_Site	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:4834486G>A	ENST00000378191.4	+	5	1544		c.e5-1		AJAP1_ENST00000378190.3_Splice_Site	NM_018836.3	NP_061324.1	Q9UKB5	AJAP1_HUMAN	adherens junctions associated protein 1						cell adhesion (GO:0007155)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(6)|lung(11)|ovary(1)|prostate(1)|urinary_tract(1)	24	all_cancers(77;0.071)|Ovarian(185;0.0721)	all_cancers(23;1.77e-36)|all_epithelial(116;1.26e-21)|all_lung(118;3.51e-08)|Lung NSC(185;3.47e-06)|all_neural(13;8.84e-06)|all_hematologic(16;7.61e-05)|Breast(487;0.000507)|Renal(390;0.0007)|Colorectal(325;0.00117)|Hepatocellular(190;0.0071)|Glioma(11;0.0155)|Myeloproliferative disorder(586;0.0258)|Ovarian(437;0.0409)|Lung SC(97;0.133)|Medulloblastoma(700;0.215)		Epithelial(90;3.89e-35)|OV - Ovarian serous cystadenocarcinoma(86;1.97e-19)|GBM - Glioblastoma multiforme(42;3.71e-19)|Colorectal(212;4.57e-06)|COAD - Colon adenocarcinoma(227;0.00019)|Kidney(185;0.000969)|BRCA - Breast invasive adenocarcinoma(365;0.00122)|STAD - Stomach adenocarcinoma(132;0.00578)|KIRC - Kidney renal clear cell carcinoma(229;0.0126)|READ - Rectum adenocarcinoma(331;0.0689)		GTTCACCGCAGACCCTCCTCT	0.527																																																	0													191.0	172.0	178.0					1																	4834486		2203	4300	6503	SO:0001630	splice_region_variant	55966			AF175409	CCDS54.1	1p36.32	2008-02-05	2008-01-08		ENSG00000196581	ENSG00000196581			30801	protein-coding gene	gene with protein product	"""transmembrane protein SHREW1"""	610972				14595118	Standard	NM_001042478		Approved	SHREW1, SHREW-1, MOT8	uc001aln.3	Q9UKB5	OTTHUMG00000000645	ENST00000378191.4:c.1164-1G>A	1.37:g.4834486G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9Y229	Splice_Site	SNP	-	e5-1	ENST00000378191.4	37	c.1164-1	CCDS54.1	1	.	.	.	.	.	.	.	.	.	.	G	12.38	1.921515	0.33908	.	.	ENSG00000196581	ENST00000378190;ENST00000378191	.	.	.	5.07	5.07	0.68467	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	17.4418	0.87567	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	AJAP1	4734346	1.000000	0.71417	0.870000	0.34147	0.016000	0.09150	9.124000	0.94394	2.347000	0.79759	0.655000	0.94253	.	AJAP1	-	-		0.527	AJAP1-001	KNOWN	NMD_exception|basic|appris_principal|CCDS	protein_coding	AJAP1	HGNC	protein_coding	OTTHUMT00000001542.3	G	NM_018836	Intron	4834486	+1	no_errors	ENST00000378190	ensembl	human	known	70_37	splice_site	SNP	1.000	A
ANO6	196527	genome.wustl.edu	37	12	45833560	45833560	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:45833560G>A	ENST00000425752.2	+	20	2931	c.2629G>A	c.(2629-2631)Gaa>Aaa	p.E877K	ANO6_ENST00000435642.1_Missense_Mutation_p.E877K	NM_001142679.1	NP_001136151.1	Q4KMQ2	ANO6_HUMAN	anoctamin 6	0					activation of blood coagulation via clotting cascade (GO:0002543)|blood coagulation (GO:0007596)|bone mineralization involved in bone maturation (GO:0035630)|calcium activated galactosylceramide scrambling (GO:0061591)|calcium activated phosphatidylcholine scrambling (GO:0061590)|calcium activated phosphatidylserine scrambling (GO:0061589)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|chloride transmembrane transport (GO:1902476)|chloride transport (GO:0006821)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|phosphatidylserine exposure on blood platelet (GO:0097045)|phospholipid scrambling (GO:0017121)|positive regulation of endothelial cell apoptotic process (GO:2000353)|regulation of anion transport (GO:0044070)|transmembrane transport (GO:0055085)	cell surface (GO:0009986)|chloride channel complex (GO:0034707)|extracellular vesicular exosome (GO:0070062)|intracellular (GO:0005622)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|intracellular calcium activated chloride channel activity (GO:0005229)|phospholipid scramblase activity (GO:0017128)|voltage-gated chloride channel activity (GO:0005247)|voltage-gated ion channel activity (GO:0005244)			central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	46						gtttgtcgatgaaattagact	0.388																																																	0													168.0	137.0	147.0					12																	45833560		692	1591	2283	SO:0001583	missense	196527			AL832340	CCDS31782.1, CCDS44865.1, CCDS44866.1, CCDS55819.1	12q12-q13.11	2014-09-17	2008-08-28	2008-08-28				"""Ion channels / Chloride channels : Calcium activated : Anoctamins"""	25240	protein-coding gene	gene with protein product		608663	"""transmembrane protein 16F"""	TMEM16F		15067359, 24692353	Standard	NM_001025356		Approved	DKFZp313M0720	uc010slf.2	Q4KMQ2	OTTHUMG00000169564	ENST00000425752.2:c.2629G>A	12.37:g.45833560G>A	ENSP00000391417:p.Glu877Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNM6|B9EGG0|E7ENK4|E9PB30|E9PCT2|Q8N3Q2	Missense_Mutation	SNP	pfam_Anoctamin	p.E877K	ENST00000425752.2	37	c.2629	CCDS44865.1	12	.	.	.	.	.	.	.	.	.	.	G	10.73	1.431179	0.25726	.	.	ENSG00000177119	ENST00000425752;ENST00000435642	T;T	0.71341	-0.56;-0.56	2.22	0.185	0.15096	.	.	.	.	.	T	0.44705	0.1306	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.32955	-0.9887	9	0.66056	D	0.02	.	2.6169	0.04906	0.1767:0.0:0.513:0.3104	.	877	E9PCT2	.	K	877	ENSP00000391417:E877K;ENSP00000413840:E877K	ENSP00000391417:E877K	E	+	1	0	ANO6	44119827	0.013000	0.17824	0.008000	0.14137	0.016000	0.09150	-0.836000	0.04382	0.038000	0.15604	0.460000	0.39030	GAA	ANO6	-	NULL		0.388	ANO6-002	KNOWN	basic|CCDS	protein_coding	ANO6	HGNC	protein_coding	OTTHUMT00000404819.1	G	XM_113743		45833560	+1	no_errors	ENST00000425752	ensembl	human	known	70_37	missense	SNP	0.009	A
AP1G1	164	genome.wustl.edu	37	16	71841764	71841765	+	5'UTR	INS	-	-	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:71841764_71841765insA	ENST00000569748.1	-	0	802_803				AP1G1_ENST00000433195.2_5'UTR|AP1G1_ENST00000570297.1_5'UTR|AP1G1_ENST00000299980.4_Intron|AP1G1_ENST00000423132.2_Intron|AP1G1_ENST00000393512.3_Intron			O43747	AP1G1_HUMAN	adaptor-related protein complex 1, gamma 1 subunit						antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|endosome to melanosome transport (GO:0035646)|Golgi to lysosome transport (GO:0090160)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|membrane organization (GO:0061024)|positive regulation of natural killer cell degranulation (GO:0043323)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|post-Golgi vesicle-mediated transport (GO:0006892)|regulation of defense response to virus by virus (GO:0050690)|viral process (GO:0016032)	AP-type membrane coat adaptor complex (GO:0030119)|clathrin adaptor complex (GO:0030131)|clathrin-coated vesicle (GO:0030136)|clathrin-coated vesicle membrane (GO:0030665)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|recycling endosome (GO:0055037)|trans-Golgi network membrane (GO:0032588)	GTP-dependent protein binding (GO:0030742)|kinesin binding (GO:0019894)|protein transporter activity (GO:0008565)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(8)|large_intestine(6)|lung(7)|ovary(4)|pancreas(1)|urinary_tract(1)	28		Ovarian(137;0.125)				TAATAGGGGAGAAAAAAAAATA	0.406																																																	0																																										SO:0001623	5_prime_UTR_variant	164			Y12226	CCDS32480.1, CCDS45522.1	16q23	2009-08-03				ENSG00000166747			555	protein-coding gene	gene with protein product	"""gamma1-adaptin"""	603533		CLAPG1, ADTG		9653655, 9733768	Standard	NM_001128		Approved		uc010cgg.3	O43747		ENST00000569748.1:c.-108->T	16.37:g.71841773_71841773dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	O75709|O75842|Q9UG09|Q9Y3U4	RNA	INS	-	NULL	ENST00000569748.1	37	NULL	CCDS32480.1	16																																																																																			AP1G1	-	-		0.406	AP1G1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AP1G1	HGNC	protein_coding	OTTHUMT00000434149.1	-			71841765	-1	no_errors	ENST00000570297	ensembl	human	known	70_37	rna	INS	0.007:0.002	A
APLNR	187	genome.wustl.edu	37	11	57003977	57003977	+	Missense_Mutation	SNP	G	G	A	rs373170562		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:57003977G>A	ENST00000606794.1	-	1	698	c.502C>T	c.(502-504)Cgc>Tgc	p.R168C		NM_005161.4	NP_005152.1	P35414	APJ_HUMAN	apelin receptor	168					G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation (GO:0007369)|heart development (GO:0007507)|regulation of body fluid levels (GO:0050878)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|receptor activity (GO:0004872)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	32						CCGGTGGTGCGTAACACCATG	0.642																																																	0								G	CYS/ARG	0,4400		0,0,2200	71.0	60.0	64.0		502	5.2	1.0	11		64	1,8585	1.2+/-3.3	0,1,4292	no	missense	APLNR	NM_005161.4	180	0,1,6492	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	168/381	57003977	1,12985	2200	4293	6493	SO:0001583	missense	187			U03642	CCDS7950.1	11q12.1	2012-08-08	2008-05-12	2008-05-12	ENSG00000134817	ENSG00000134817			339	protein-coding gene	gene with protein product	"""APJ (apelin) receptor"""	600052	"""angiotensin II receptor-like 1"""	AGTRL1		8294032, 14622440	Standard	NM_005161		Approved	FLJ90771, APJ, APJR	uc001njo.3	P35414	OTTHUMG00000167021	ENST00000606794.1:c.502C>T	11.37:g.57003977G>A	ENSP00000475344:p.Arg168Cys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM,prints_APJ_rcpt,prints_GPCR_Rhodpsn,prints_P2_purnocptor,prints_ATII_rcpt	p.R168C	ENST00000606794.1	37	c.502	CCDS7950.1	11	.	.	.	.	.	.	.	.	.	.	G	19.25	3.790650	0.70452	0.0	1.16E-4	ENSG00000134817	ENST00000257254;ENST00000326830;ENST00000444275	T	0.38401	1.14	5.25	5.25	0.73442	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.70081	0.3183	M	0.93062	3.375	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.77563	-0.2541	10	0.56958	D	0.05	-15.6458	18.4449	0.90680	0.0:0.0:1.0:0.0	.	168	P35414	APJ_HUMAN	C	168;49;87	ENSP00000257254:R168C	ENSP00000257254:R168C	R	-	1	0	APLNR	56760553	1.000000	0.71417	0.971000	0.41717	0.939000	0.58152	7.415000	0.80131	2.448000	0.82819	0.555000	0.69702	CGC	APLNR	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_TAS2_rcpt,pfscan_GPCR_Rhodpsn_7TM		0.642	APLNR-004	KNOWN	basic|appris_principal|CCDS	protein_coding	APLNR	HGNC	protein_coding	OTTHUMT00000470575.1	G	NM_005161		57003977	-1	no_errors	ENST00000257254	ensembl	human	known	70_37	missense	SNP	1.000	A
ATF7IP	55729	genome.wustl.edu	37	12	14613464	14613464	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:14613464G>C	ENST00000540793.1	+	8	2349	c.2194G>C	c.(2194-2196)Gtc>Ctc	p.V732L	ATF7IP_ENST00000261168.4_Missense_Mutation_p.V732L|ATF7IP_ENST00000541654.1_3'UTR|ATF7IP_ENST00000536444.1_Missense_Mutation_p.V731L|ATF7IP_ENST00000543189.1_Missense_Mutation_p.V731L|ATF7IP_ENST00000544627.1_Missense_Mutation_p.V740L			Q6VMQ6	MCAF1_HUMAN	activating transcription factor 7 interacting protein	732	Interaction with SETDB1.				DNA methylation (GO:0006306)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0045898)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	nucleus (GO:0005634)				cervix(1)|endometrium(7)|kidney(5)|large_intestine(10)|liver(2)|lung(22)|ovary(1)|prostate(4)|skin(1)|urinary_tract(1)	54						TCCAGCAGTTGTCAGTAGTCA	0.398																																																	0													107.0	103.0	104.0					12																	14613464		2203	4300	6503	SO:0001583	missense	55729			AJ242978	CCDS8663.1, CCDS66326.1, CCDS66327.1, CCDS73449.1	12p13.1	2005-11-18				ENSG00000171681			20092	protein-coding gene	gene with protein product		613644				10976766, 10777215	Standard	XM_005253424		Approved	FLJ10688, p621	uc001rbw.3	Q6VMQ6		ENST00000540793.1:c.2194G>C	12.37:g.14613464G>C	ENSP00000444589:p.Val732Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	F5GX74|G3V1U0|Q4G0T9|Q6P3T3|Q86XW5|Q9NVJ9|Q9NWC2|Q9Y4X8	Missense_Mutation	SNP	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.V732L	ENST00000540793.1	37	c.2194	CCDS8663.1	12	.	.	.	.	.	.	.	.	.	.	G	13.61	2.287148	0.40494	.	.	ENSG00000171681	ENST00000261168;ENST00000543189;ENST00000536444;ENST00000544627;ENST00000540793	T;T;T;T;T	0.20332	2.1;2.08;2.1;2.1;2.1	6.02	6.02	0.97574	.	0.309558	0.27901	N	0.017386	T	0.18509	0.0444	L	0.43152	1.355	0.33450	D	0.583487	B;B;B;B	0.23377	0.023;0.023;0.084;0.084	B;B;B;B	0.21917	0.007;0.007;0.037;0.037	T	0.12604	-1.0541	10	0.32370	T	0.25	-6.9913	10.2327	0.43264	0.0703:0.1368:0.7929:0.0	.	731;732;731;343	G3V1U0;Q6VMQ6;Q6VMQ6-2;B3KQF8	.;MCAF1_HUMAN;.;.	L	732;731;731;740;732	ENSP00000261168:V732L;ENSP00000443179:V731L;ENSP00000445955:V731L;ENSP00000440440:V740L;ENSP00000444589:V732L	ENSP00000261168:V732L	V	+	1	0	ATF7IP	14504731	0.995000	0.38212	0.998000	0.56505	0.994000	0.84299	2.411000	0.44600	2.857000	0.98124	0.650000	0.86243	GTC	ATF7IP	-	NULL		0.398	ATF7IP-024	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATF7IP	HGNC	protein_coding	OTTHUMT00000401400.1	G	NM_018179		14613464	+1	no_errors	ENST00000261168	ensembl	human	known	70_37	missense	SNP	0.914	C
B2M	567	genome.wustl.edu	37	15	45007645	45007645	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr15:45007645C>G	ENST00000558401.1	+	2	162	c.92C>G	c.(91-93)tCa>tGa	p.S31*	B2M_ENST00000559916.1_Nonsense_Mutation_p.S31*|B2M_ENST00000544417.1_Nonsense_Mutation_p.S31*|B2M_ENST00000559220.1_Intron	NM_004048.2	NP_004039.1	P61769	B2MG_HUMAN	beta-2-microglobulin	31	Ig-like C1-type.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of exogenous protein antigen via MHC class Ib, TAP-dependent (GO:0002481)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|innate immune response (GO:0045087)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|protein refolding (GO:0042026)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|response to cadmium ion (GO:0046686)|response to drug (GO:0042493)|response to molecule of bacterial origin (GO:0002237)|retina homeostasis (GO:0001895)|T cell differentiation in thymus (GO:0033077)|viral process (GO:0016032)	cytoplasm (GO:0005737)|early endosome lumen (GO:0031905)|early endosome membrane (GO:0031901)|endoplasmic reticulum lumen (GO:0005788)|ER to Golgi transport vesicle membrane (GO:0012507)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	identical protein binding (GO:0042802)			breast(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(30)|kidney(8)|large_intestine(6)|lung(6)|ovary(2)|skin(2)|urinary_tract(1)	59		all_cancers(109;1.88e-13)|all_epithelial(112;2.13e-11)|Lung NSC(122;2.22e-07)|all_lung(180;1.81e-06)|Melanoma(134;0.0122)		all cancers(107;4.16e-21)|GBM - Glioblastoma multiforme(94;8.97e-07)|COAD - Colon adenocarcinoma(120;0.0357)|Colorectal(105;0.0377)|Lung(196;0.0903)|LUSC - Lung squamous cell carcinoma(244;0.192)		CAGGTTTACTCACGTCATCCA	0.413																																																	0													160.0	160.0	160.0					15																	45007645		2198	4298	6496	SO:0001587	stop_gained	567			AB021288	CCDS10113.1	15q21-q22.2	2013-01-11			ENSG00000166710	ENSG00000166710		"""Immunoglobulin superfamily / C1-set domain containing"""	914	protein-coding gene	gene with protein product		109700					Standard	NM_004048		Approved		uc001zuc.3	P61769	OTTHUMG00000131247	ENST00000558401.1:c.92C>G	15.37:g.45007645C>G	ENSP00000452780:p.Ser31*	Somatic		WXS	Illumina HiSeq	Phase_IV	P01884|Q540F8|Q6IAT8|Q9UCK0|Q9UD48|Q9UDF4	Nonsense_Mutation	SNP	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like	p.S31*	ENST00000558401.1	37	c.92	CCDS10113.1	15	.	.	.	.	.	.	.	.	.	.	C	15.48	2.846911	0.51164	.	.	ENSG00000166710	ENST00000349264;ENST00000544417;ENST00000396754	.	.	.	5.82	5.82	0.92795	.	0.287438	0.39341	N	0.001388	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	15.5992	0.76611	0.0:1.0:0.0:0.0	.	.	.	.	X	31	.	ENSP00000340858:S31X	S	+	2	0	B2M	42794937	0.201000	0.23410	0.150000	0.22450	0.052000	0.14988	3.145000	0.50623	2.752000	0.94435	0.655000	0.94253	TCA	B2M	-	pfscan_Ig-like		0.413	B2M-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	B2M	HGNC	protein_coding	OTTHUMT00000254007.2	C	NM_004048		45007645	+1	no_errors	ENST00000544417	ensembl	human	known	70_37	nonsense	SNP	0.686	G
ATP8B4	79895	genome.wustl.edu	37	15	50271846	50271846	+	Silent	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr15:50271846G>C	ENST00000284509.6	-	12	1143	c.1002C>G	c.(1000-1002)ctC>ctG	p.L334L	RNA5SP394_ENST00000364216.1_RNA|ATP8B4_ENST00000559829.1_Silent_p.L334L|ATP8B4_ENST00000558959.1_5'UTR	NM_024837.2	NP_079113.2	Q8TF62	AT8B4_HUMAN	ATPase, class I, type 8B, member 4	334						Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|magnesium ion binding (GO:0000287)|phospholipid-translocating ATPase activity (GO:0004012)			breast(6)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|lung(27)|ovary(2)|pancreas(1)|prostate(1)|skin(7)|urinary_tract(1)	73		all_lung(180;0.00183)		all cancers(107;2.41e-07)|GBM - Glioblastoma multiforme(94;8.28e-05)		CAACTGTATTGAGAATAATAA	0.318																																																	0													100.0	114.0	109.0					15																	50271846		2196	4295	6491	SO:0001819	synonymous_variant	79895			AB075819	CCDS32238.1	15q21.2	2010-04-20	2007-09-19		ENSG00000104043	ENSG00000104043		"""ATPases / P-type"""	13536	protein-coding gene	gene with protein product		609123	"""ATPase, Class I, type 8B, member 4"""			11015572	Standard	NM_024837		Approved	ATPIM, KIAA1939	uc001zxu.3	Q8TF62		ENST00000284509.6:c.1002C>G	15.37:g.50271846G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H727	Silent	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,superfamily_HAD-like_dom,superfamily_ATPase_cation_domN,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr	p.L334	ENST00000284509.6	37	c.1002	CCDS32238.1	15																																																																																			ATP8B4	-	pfam_ATPase_P-typ_ATPase-assoc-dom,tigrfam_ATPase_P-typ_Plipid-transl,tigrfam_ATPase_P-typ_ion-transptr		0.318	ATP8B4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP8B4	HGNC	protein_coding	OTTHUMT00000418100.1	G	NM_024837		50271846	-1	no_errors	ENST00000284509	ensembl	human	known	70_37	silent	SNP	0.999	C
B3GAT1	27087	genome.wustl.edu	37	11	134252735	134252735	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:134252735G>A	ENST00000524765.1	-	4	5331	c.787C>T	c.(787-789)Cgg>Tgg	p.R263W	B3GAT1_ENST00000312527.4_Missense_Mutation_p.R263W|B3GAT1_ENST00000537389.1_Missense_Mutation_p.R276W|B3GAT1_ENST00000531510.1_5'Flank|B3GAT1_ENST00000392580.1_Missense_Mutation_p.R263W			Q9P2W7	B3GA1_HUMAN	beta-1,3-glucuronyltransferase 1	263					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|protein glycosylation (GO:0006486)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase activity (GO:0015018)|metal ion binding (GO:0046872)|UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	19	all_hematologic(175;0.127)	all_cancers(12;1.39e-23)|all_epithelial(12;7.17e-17)|all_lung(97;1.19e-05)|Lung NSC(97;2.76e-05)|Breast(109;0.000162)|Medulloblastoma(222;0.0125)|all_neural(223;0.0137)|Esophageal squamous(93;0.0559)		Epithelial(10;2.58e-11)|all cancers(11;5.75e-10)|BRCA - Breast invasive adenocarcinoma(10;9.69e-09)|OV - Ovarian serous cystadenocarcinoma(99;0.000879)|Lung(977;0.0864)		AGAATGAGCCGCAGGTTGACG	0.592																																																	0													103.0	82.0	89.0					11																	134252735		2201	4297	6498	SO:0001583	missense	27087			AB029396	CCDS8500.1	11q25	2014-07-08	2014-07-08		ENSG00000109956	ENSG00000109956	2.4.1.135	"""CD molecules"", ""Beta-1,3-glucuronyltransferases"""	921	protein-coding gene	gene with protein product	"""galactosylgalactosylxylosylprotein 3-beta-glucuronosyltransferase 1"", ""glucuronosyltransferase P"""	151290	"""CD57 antigen"""	CD57, LEU7			Standard	XM_005271506		Approved	GlcAT-P, HNK-1, NK-1	uc001qhq.3	Q9P2W7	OTTHUMG00000167180	ENST00000524765.1:c.787C>T	11.37:g.134252735G>A	ENSP00000433847:p.Arg263Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96FS7	Missense_Mutation	SNP	pfam_Glyco_trans_43	p.R276W	ENST00000524765.1	37	c.826	CCDS8500.1	11	.	.	.	.	.	.	.	.	.	.	G	16.44	3.123733	0.56613	.	.	ENSG00000109956	ENST00000392580;ENST00000312527;ENST00000524765;ENST00000537389	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.22	1.01	0.19927	.	0.104326	0.64402	D	0.000007	T	0.56077	0.1961	L	0.52905	1.665	0.58432	D	0.999999	B;B	0.26483	0.15;0.029	B;B	0.18871	0.02;0.023	T	0.57347	-0.7827	10	0.66056	D	0.02	-29.4685	15.8236	0.78678	0.0:0.0:0.353:0.647	.	276;263	F5H0S0;Q9P2W7	.;B3GA1_HUMAN	W	263;263;263;276	ENSP00000376359:R263W;ENSP00000307875:R263W;ENSP00000433847:R263W;ENSP00000445983:R276W	ENSP00000307875:R263W	R	-	1	2	B3GAT1	133757945	0.115000	0.22152	0.998000	0.56505	0.993000	0.82548	-0.035000	0.12205	0.031000	0.15407	0.491000	0.48974	CGG	B3GAT1	-	pfam_Glyco_trans_43		0.592	B3GAT1-002	KNOWN	alternative_3_UTR|alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	B3GAT1	HGNC	protein_coding	OTTHUMT00000393639.1	G	NM_018644		134252735	-1	no_errors	ENST00000537389	ensembl	human	known	70_37	missense	SNP	0.996	A
BAZ2A	11176	genome.wustl.edu	37	12	57000122	57000122	+	Intron	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:57000122C>A	ENST00000551812.1	-	12	2393				BAZ2A_ENST00000179765.5_Intron|BAZ2A_ENST00000549884.1_Intron|BAZ2A_ENST00000379441.3_Intron	NM_013449.3	NP_038477.2	Q9UIF9	BAZ2A_HUMAN	bromodomain adjacent to zinc finger domain, 2A						chromatin remodeling (GO:0006338)|chromatin silencing at rDNA (GO:0000183)|DNA methylation (GO:0006306)|heterochromatin assembly involved in chromatin silencing (GO:0070869)|histone deacetylation (GO:0016575)|histone H3-K9 methylation (GO:0051567)|histone H4 deacetylation (GO:0070933)|histone H4-K20 methylation (GO:0034770)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromatin silencing complex (GO:0005677)|nucleolus (GO:0005730)|rDNA heterochromatin (GO:0033553)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|lysine-acetylated histone binding (GO:0070577)|RNA binding (GO:0003723)|zinc ion binding (GO:0008270)			breast(1)|cervix(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|lung(15)|urinary_tract(1)	31						GAAGTCATTTCTCCTCAAACT	0.468																																																	0													105.0	91.0	95.0					12																	57000122		1897	4114	6011	SO:0001627	intron_variant	11176			AB032254	CCDS44924.1, CCDS73483.1	12q13.3	2013-01-28				ENSG00000076108		"""Zinc fingers, PHD-type"""	962	protein-coding gene	gene with protein product	"""TTF-I interacting peptide 5"""	605682				10662543, 11532953	Standard	XM_005268596		Approved	KIAA0314, TIP5, WALp3	uc001slq.1	Q9UIF9	OTTHUMG00000170332	ENST00000551812.1:c.2200-26G>T	12.37:g.57000122C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KN66|O00536|O15030|Q68DI8|Q96H26	RNA	SNP	-	NULL	ENST00000551812.1	37	NULL	CCDS44924.1	12																																																																																			BAZ2A	-	-		0.468	BAZ2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BAZ2A	HGNC	protein_coding	OTTHUMT00000408561.1	C	NM_013449		57000122	-1	no_errors	ENST00000549763	ensembl	human	known	70_37	rna	SNP	1.000	A
BRCA2	675	genome.wustl.edu	37	13	32937315	32937315	+	Splice_Site	SNP	G	G	A	rs397507950|rs81002874		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:32937315G>A	ENST00000380152.3	+	18	8209		c.e18-1		BRCA2_ENST00000544455.1_Splice_Site			P51587	BRCA2_HUMAN	breast cancer 2, early onset						brain development (GO:0007420)|cell aging (GO:0007569)|centrosome duplication (GO:0051298)|cytokinesis (GO:0000910)|DNA damage response, signal transduction by p53 class mediator resulting in transcription of p21 class mediator (GO:0006978)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via homologous recombination (GO:0000724)|female gonad development (GO:0008585)|hemopoiesis (GO:0030097)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|inner cell mass cell proliferation (GO:0001833)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|male meiosis I (GO:0007141)|negative regulation of mammary gland epithelial cell proliferation (GO:0033600)|nucleotide-excision repair (GO:0006289)|oocyte maturation (GO:0001556)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cytokinesis (GO:0032465)|replication fork protection (GO:0048478)|response to gamma radiation (GO:0010332)|response to UV-C (GO:0010225)|response to X-ray (GO:0010165)|spermatogenesis (GO:0007283)	BRCA2-MAGE-D1 complex (GO:0033593)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein complex (GO:0043234)|secretory granule (GO:0030141)	gamma-tubulin binding (GO:0043015)|H3 histone acetyltransferase activity (GO:0010484)|H4 histone acetyltransferase activity (GO:0010485)|protease binding (GO:0002020)|single-stranded DNA binding (GO:0003697)	p.?(2)		NS(3)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(32)|liver(1)|lung(41)|oesophagus(5)|ovary(22)|pancreas(4)|prostate(3)|salivary_gland(1)|skin(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	183		Lung SC(185;0.0262)		all cancers(112;7.13e-07)|Epithelial(112;1.59e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.000732)|BRCA - Breast invasive adenocarcinoma(63;0.0291)|GBM - Glioblastoma multiforme(144;0.0704)		TTCACTTTTAGATATGATACG	0.328			"""D, Mis, N, F, S"""		"""breast, ovarian, pancreatic"""	"""breast, ovarian, pancreatic, leukemia  (FANCB, FANCD1)"""		Homologous recombination	Pancreatic Cancer, Familial Clustering of;Li-Fraumeni syndrome;Hereditary Prostate Cancer;Hereditary Breast-Ovarian Cancer, BRCA2 type;Fanconi Anemia type D1, bi-allelic BRCA2 mutations;Fanconi Anemia	TCGA Ovarian(8;0.087)																											Esophageal Squamous(138;838 1285 7957 30353 30468 36915 49332)		yes	Rec	yes	Hereditary breast/ovarian cancer	13	13q12	675	familial breast/ovarian cancer gene 2		"""L, E"""	2	Unknown(2)	lung(2)	GRCh37	CS030294	BRCA2	S	rs81002874						40.0	39.0	39.0					13																	32937315		2202	4299	6501	SO:0001630	splice_region_variant	675	Familial Cancer Database	incl.: Hereditary Pancreatic Adenocarcinoma, Insulin-Dependent Diabetes Mellitus - Exocrine Insufficiency - Familial Pancreatic Cancer, PNCA1;LFS, SBLA syndrome (Sarcoma Breast Leukemia Adrenal cancer), incl.: Cancer with In Vitro Radioresistence, Familial, Li-Fraumeni-like s.;HPC; ;FANCD1;Pancytopenia Dysmelia, FA (several complementation groups)	U43746	CCDS9344.1	13q12-q13	2014-09-17	2003-10-14		ENSG00000139618	ENSG00000139618		"""Fanconi anemia, complementation groups"""	1101	protein-coding gene	gene with protein product	"""BRCA1/BRCA2-containing complex, subunit 2"""	600185	"""Fanconi anemia, complementation group D1"""	FANCD1, FACD, FANCD		8091231, 7581463, 15057823	Standard	NM_000059		Approved	FAD, FAD1, BRCC2	uc001uub.1	P51587	OTTHUMG00000017411	ENST00000380152.3:c.7977-1G>A	13.37:g.32937315G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O00183|O15008|Q13879|Q5TBJ7	Splice_Site	SNP	-	e17-1	ENST00000380152.3	37	c.7977-1	CCDS9344.1	13	.	.	.	.	.	.	.	.	.	.	G	21.6	4.178481	0.78564	.	.	ENSG00000139618	ENST00000380152;ENST00000544455	.	.	.	4.93	4.93	0.64822	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.5097	0.90911	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	BRCA2	31835315	1.000000	0.71417	1.000000	0.80357	0.910000	0.53928	9.420000	0.97426	2.451000	0.82905	0.467000	0.42956	.	BRCA2	-	-		0.328	BRCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRCA2	HGNC	protein_coding	OTTHUMT00000046000.2	G	NM_000059	Intron	32937315	+1	no_errors	ENST00000380152	ensembl	human	known	70_37	splice_site	SNP	1.000	A
EDRF1	26098	genome.wustl.edu	37	10	127414249	127414249	+	Splice_Site	SNP	A	A	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr10:127414249A>G	ENST00000356792.4	+	6	867		c.e6-1		C10orf137_ENST00000337623.3_Splice_Site	NM_001202438.1	NP_001189367.1	Q3B7T1	EDRF1_HUMAN							regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(20)|ovary(8)|pancreas(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	61		all_lung(145;0.0096)|Lung NSC(174;0.0145)|Colorectal(57;0.0846)|all_neural(114;0.0936)				TGGTTTGGCCAGTATCAATGG	0.423																																																	0													54.0	52.0	52.0					10																	127414249		2203	4300	6503	SO:0001630	splice_region_variant	26098																														ENST00000356792.4:c.636-1A>G	10.37:g.127414249A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RC65|Q3KR40|Q4G190|Q5VZQ4|Q8IZ74|Q9Y3W4	Splice_Site	SNP	-	e6-2	ENST00000356792.4	37	c.636-2	CCDS55733.1	10	.	.	.	.	.	.	.	.	.	.	A	19.32	3.804168	0.70682	.	.	ENSG00000107938	ENST00000356792;ENST00000392732;ENST00000337623	.	.	.	4.85	4.85	0.62838	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.9034	0.70699	1.0:0.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	C10orf137	127404239	1.000000	0.71417	0.959000	0.39883	0.963000	0.63663	8.402000	0.90205	2.177000	0.69029	0.528000	0.53228	.	C10orf137	-	-		0.423	C10orf137-007	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	C10orf137	HGNC	protein_coding	OTTHUMT00000388539.1	A		Intron	127414249	+1	no_errors	ENST00000356792	ensembl	human	known	70_37	splice_site	SNP	1.000	G
C16orf89	146556	genome.wustl.edu	37	16	5115993	5115993	+	5'UTR	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:5115993C>A	ENST00000315997.5	-	0	118				C16orf89_ENST00000474471.3_5'Flank|C16orf89_ENST00000422873.1_Missense_Mutation_p.G11W|C16orf89_ENST00000472572.3_5'UTR|ALG1_ENST00000588623.1_Intron|C16orf89_ENST00000350219.4_Missense_Mutation_p.G11W	NM_152459.4	NP_689672.4	Q6UX73	CP089_HUMAN	chromosome 16 open reading frame 89							cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	protein homodimerization activity (GO:0042803)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(4)|ovary(1)|skin(1)|urinary_tract(1)	12						GCCCTCCTCCCACCTCCTTCC	0.672																																																	0													12.0	14.0	13.0					16																	5115993		2019	4185	6204	SO:0001623	5_prime_UTR_variant	146556				CCDS42116.1, CCDS45404.1, CCDS42116.2, CCDS45404.2	16p13.3	2011-12-12			ENSG00000153446	ENSG00000153446			28687	protein-coding gene	gene with protein product						12975309, 20578903	Standard	NM_001098514		Approved	MGC45438	uc010bud.3	Q6UX73	OTTHUMG00000159314	ENST00000315997.5:c.-84G>T	16.37:g.5115993C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUM5|Q8N2I3|Q8N4T1	Missense_Mutation	SNP	NULL	p.G11W	ENST00000315997.5	37	c.31	CCDS42116.2	16	.	.	.	.	.	.	.	.	.	.	C	4.623	0.115750	0.08831	.	.	ENSG00000153446	ENST00000422873;ENST00000350219	T;T	0.37752	1.18;1.63	4.58	1.25	0.21368	.	.	.	.	.	T	0.18800	0.0451	.	.	.	0.09310	N	1	B	0.21905	0.062	B	0.20384	0.029	T	0.23797	-1.0178	7	.	.	.	-9.3775	3.2692	0.06875	0.2009:0.5562:0.0:0.2429	.	11	G3V0F0	.	W	11	ENSP00000390402:G11W;ENSP00000283478:G11W	.	G	-	1	0	C16orf89	5055994	0.000000	0.05858	0.013000	0.15412	0.025000	0.11179	-0.077000	0.11394	0.375000	0.24679	-0.158000	0.13435	GGG	C16orf89	-	NULL		0.672	C16orf89-001	KNOWN	upstream_ATG|basic|CCDS	protein_coding	C16orf89	HGNC	protein_coding	OTTHUMT00000354524.1	C	NM_152459		5115993	-1	no_errors	ENST00000350219	ensembl	human	known	70_37	missense	SNP	0.006	A
C4orf50	389197	genome.wustl.edu	37	4	5990869	5990870	+	5'Flank	DEL	CT	CT	-	rs143859826		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr4:5990869_5990870delCT	ENST00000324058.5	-	0	0				C4orf50_ENST00000531445.1_Frame_Shift_Del_p.E210fs			Q6ZRC1	CD050_HUMAN	chromosome 4 open reading frame 50											breast(1)|large_intestine(2)|lung(5)|ovary(1)|pancreas(2)|skin(3)|urinary_tract(1)	15						TTTTTGTCACCTCTCTCTCTCT	0.455																																																	0																																										SO:0001631	upstream_gene_variant	389197			BC140710		4p16.1	2009-04-14			ENSG00000181215	ENSG00000181215			33766	protein-coding gene	gene with protein product							Standard	XM_003119922		Approved	FLJ46481		Q6ZRC1	OTTHUMG00000149971		4.37:g.5990879_5990880delCT	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		Frame_Shift_Del	DEL	NULL	p.E210fs	ENST00000324058.5	37	c.630_629		4																																																																																			C4orf50	-	NULL		0.455	C4orf50-201	KNOWN	basic|appris_candidate	protein_coding	C4orf50	HGNC	protein_coding		CT	NM_207405		5990870	-1	no_errors	ENST00000531445	ensembl	human	known	70_37	frame_shift_del	DEL	0.000:0.000	-
PRR31	101928638	genome.wustl.edu	37	9	139866088	139866088	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:139866088G>T	ENST00000371629.1	+	4	624	c.499G>T	c.(499-501)Gag>Tag	p.E167*				Q5SQ13	PRR31_HUMAN		167										lung(1)	1						CTGGGCTGGGGAGGGAGGGGT	0.637																																																	0																																										SO:0001587	stop_gained	203235																														ENST00000371629.1:c.499G>T	9.37:g.139866088G>T	ENSP00000360692:p.Glu167*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	superfamily_Calycin-like	p.E167*	ENST00000371629.1	37	c.499		9	.	.	.	.	.	.	.	.	.	.	G	13.80	2.345797	0.41599	.	.	ENSG00000198454	ENST00000371629	.	.	.	1.37	-0.927	0.10451	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	2.3199	0.04207	0.2668:0.3363:0.3969:0.0	.	.	.	.	X	167	.	ENSP00000360692:E167X	E	+	1	0	C9orf141	138985909	0.000000	0.05858	0.000000	0.03702	0.108000	0.19459	-0.871000	0.04223	-0.312000	0.08741	0.305000	0.20034	GAG	C9orf141	-	NULL		0.637	C9orf141-001	KNOWN	basic|appris_principal	protein_coding	C9orf141	HGNC	protein_coding	OTTHUMT00000055250.1	G			139866088	+1	no_errors	ENST00000371629	ensembl	human	known	70_37	nonsense	SNP	0.006	T
CACNA2D2	9254	genome.wustl.edu	37	3	50404531	50404531	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:50404531C>T	ENST00000479441.1	-	29	2431	c.2432G>A	c.(2431-2433)aGg>aAg	p.R811K	XXcos-LUCA11.4_ENST00000606259.1_RNA|XXcos-LUCA11.4_ENST00000606665.1_RNA|CACNA2D2_ENST00000424201.2_Missense_Mutation_p.R804K|XXcos-LUCA11.5_ENST00000606589.1_Intron|CACNA2D2_ENST00000435965.1_Missense_Mutation_p.R811K|CACNA2D2_ENST00000266039.3_Missense_Mutation_p.R804K|CACNA2D2_ENST00000360963.3_Missense_Mutation_p.R735K|CACNA2D2_ENST00000429770.1_Missense_Mutation_p.R804K|CACNA2D2_ENST00000395083.1_Missense_Mutation_p.R804K|CACNA2D2_ENST00000423994.2_Missense_Mutation_p.R811K|XXcos-LUCA11.4_ENST00000607088.1_RNA|XXcos-LUCA11.4_ENST00000607362.1_RNA|XXcos-LUCA11.4_ENST00000607583.1_RNA|XXcos-LUCA11.4_ENST00000607121.1_RNA			Q9NY47	CA2D2_HUMAN	calcium channel, voltage-dependent, alpha 2/delta subunit 2	811					energy reserve metabolic process (GO:0006112)|muscle fiber development (GO:0048747)|neuromuscular junction development (GO:0007528)|positive regulation of organ growth (GO:0046622)|regulation of insulin secretion (GO:0050796)|regulation of multicellular organism growth (GO:0040014)|rhythmic synaptic transmission (GO:0060024)|small molecule metabolic process (GO:0044281)	plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			breast(3)|cervix(1)|endometrium(4)|large_intestine(4)|lung(8)|ovary(2)|prostate(4)|skin(4)|urinary_tract(1)	31				BRCA - Breast invasive adenocarcinoma(193;0.000365)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)	Amiodarone(DB01118)|Bepridil(DB01244)|Felodipine(DB01023)|Gabapentin(DB00996)|Isradipine(DB00270)|Nitrendipine(DB01054)|Spironolactone(DB00421)	CTCCAGCGGCCTTAACAGGGC	0.612																																																	0													37.0	36.0	37.0					3																	50404531		2203	4299	6502	SO:0001583	missense	9254			AF040709	CCDS33763.1, CCDS54588.1, CCDS63647.1	3p21.3	2004-02-27			ENSG00000007402	ENSG00000007402		"""Calcium channel subunits"""	1400	protein-coding gene	gene with protein product	"""gene 26"""	607082					Standard	XM_005265581		Approved	KIAA0558	uc003daq.3	Q9NY47	OTTHUMG00000156887	ENST00000479441.1:c.2432G>A	3.37:g.50404531C>T	ENSP00000418081:p.Arg811Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD15|Q9NY48|Q9UEW0|Q9Y268	Missense_Mutation	SNP	pfam_VWA_N,pfam_VDCC_a2/dsu,pfam_Cache_domain,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R811K	ENST00000479441.1	37	c.2432	CCDS54588.1	3	.	.	.	.	.	.	.	.	.	.	C	0.854	-0.737495	0.03111	.	.	ENSG00000007402	ENST00000423994;ENST00000429770;ENST00000266039;ENST00000360963;ENST00000435965;ENST00000395083;ENST00000424201;ENST00000479441	T;T;T;T;T;T;T;T	0.69435	-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4;-0.4	5.73	4.85	0.62838	.	0.749470	0.12899	N	0.429967	T	0.46092	0.1375	N	0.08118	0	0.30531	N	0.767401	B;B	0.15719	0.008;0.014	B;B	0.11329	0.003;0.006	T	0.29518	-1.0009	10	0.15499	T	0.54	-9.0548	13.8423	0.63446	0.0:0.9262:0.0:0.0738	.	811;804	Q9NY47;Q9NY47-2	CA2D2_HUMAN;.	K	811;804;804;735;811;804;804;811	ENSP00000407393:R811K;ENSP00000404631:R804K;ENSP00000266039:R804K;ENSP00000354228:R735K;ENSP00000390526:R811K;ENSP00000378519:R804K;ENSP00000390329:R804K;ENSP00000418081:R811K	ENSP00000266039:R804K	R	-	2	0	CACNA2D2	50379535	0.998000	0.40836	0.988000	0.46212	0.026000	0.11368	4.429000	0.59901	2.722000	0.93159	0.655000	0.94253	AGG	CACNA2D2	-	NULL		0.612	CACNA2D2-005	KNOWN	basic|appris_candidate|CCDS	protein_coding	CACNA2D2	HGNC	protein_coding	OTTHUMT00000346457.1	C	NM_006030		50404531	-1	no_errors	ENST00000435965	ensembl	human	known	70_37	missense	SNP	0.933	T
CANX	821	genome.wustl.edu	37	5	179146670	179146670	+	Splice_Site	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr5:179146670G>A	ENST00000247461.4	+	9	1113	c.913G>A	c.(913-915)Gat>Aat	p.D305N	CANX_ENST00000504734.1_Splice_Site_p.D305N|CANX_ENST00000452673.2_Splice_Site_p.D305N|CANX_ENST00000512607.2_Splice_Site_p.D197N|CANX_ENST00000415618.2_Splice_Site_p.D340N	NM_001746.3	NP_001737.1	P27824	CALX_HUMAN	calnexin	305	4 X approximate repeats.|P domain (Extended arm). {ECO:0000250}.				aging (GO:0007568)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular protein metabolic process (GO:0044267)|chaperone-mediated protein folding (GO:0061077)|clathrin-mediated endocytosis (GO:0072583)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|protein secretion (GO:0009306)|synaptic vesicle endocytosis (GO:0048488)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|ER-mitochondrion membrane contact site (GO:0044233)|extracellular vesicular exosome (GO:0070062)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ribosome (GO:0005840)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|kidney(4)|large_intestine(2)|lung(7)|prostate(2)|urinary_tract(3)	22	all_cancers(89;0.000129)|all_epithelial(37;5.59e-05)|Renal(175;0.000159)|Lung NSC(126;0.00121)|all_lung(126;0.00218)	all_cancers(40;0.0413)|Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)		Antihemophilic Factor(DB00025)|Tenecteplase(DB00031)	GTATTTAAGGGATGAAGATGC	0.408																																																	0													59.0	61.0	60.0					5																	179146670		2203	4300	6503	SO:0001630	splice_region_variant	821			L18887	CCDS4447.1	5q35	2008-07-18			ENSG00000127022	ENSG00000127022			1473	protein-coding gene	gene with protein product	"""major histocompatibility complex class I antigen-binding protein p88"""	114217				1326756, 8136357	Standard	NM_001746		Approved	CNX, IP90, P90	uc003mkl.3	P27824	OTTHUMG00000130910	ENST00000247461.4:c.912-1G>A	5.37:g.179146670G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5V8|B4DGP8|B4E2T8|D3DWQ3|D6R9K3	Missense_Mutation	SNP	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,superfamily_Calreticulin/calnexin_P,prints_Calret/calnex	p.D340N	ENST00000247461.4	37	c.1018	CCDS4447.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.228210	0.95173	.	.	ENSG00000127022	ENST00000504734;ENST00000415618;ENST00000452673;ENST00000247461;ENST00000502673;ENST00000512607;ENST00000376953	T;T;T;T;T;T	0.55588	0.51;0.51;0.51;0.51;0.51;0.51	5.72	5.72	0.89469	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Calreticulin/calnexin, P (1);Calreticulin/calnexin, conserved site (1);	0.000000	0.85682	D	0.000000	T	0.74846	0.3770	M	0.80332	2.49	0.80722	D	1	D;P;D	0.63880	0.993;0.932;0.993	D;P;D	0.67382	0.951;0.768;0.914	T	0.76077	-0.3091	10	0.56958	D	0.05	-29.0835	19.8724	0.96855	0.0:0.0:1.0:0.0	.	340;241;305	B4DGP8;Q6ZP56;P27824	.;.;CALX_HUMAN	N	305;340;305;305;241;197;241	ENSP00000424063:D305N;ENSP00000394817:D340N;ENSP00000391646:D305N;ENSP00000247461:D305N;ENSP00000421107:D241N;ENSP00000423588:D197N	ENSP00000247461:D305N	D	+	1	0	CANX	179079276	1.000000	0.71417	1.000000	0.80357	0.967000	0.64934	9.869000	0.99810	2.708000	0.92522	0.561000	0.74099	GAT	CANX	-	pfam_Calret/calnex,superfamily_ConA-like_lec_gl_sf,superfamily_Calreticulin/calnexin_P		0.408	CANX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CANX	HGNC	protein_coding	OTTHUMT00000253500.2	G	NM_001024649	Missense_Mutation	179146670	+1	no_errors	ENST00000415618	ensembl	human	known	70_37	missense	SNP	1.000	A
CDC14B	8555	genome.wustl.edu	37	9	99266041	99266041	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:99266041C>A	ENST00000375241.1	-	14	1942	c.1491G>T	c.(1489-1491)ttG>ttT	p.L497F	CDC14B_ENST00000463569.1_3'UTR|CDC14B_ENST00000375240.3_Missense_Mutation_p.L458F|CDC14B_ENST00000375242.3_Missense_Mutation_p.L460F|CDC14B_ENST00000265659.2_Intron	NM_003671.3|NM_033331.2	NP_003662.1|NP_201588.1	O60729	CC14B_HUMAN	cell division cycle 14B	497					activation of anaphase-promoting complex activity (GO:0051488)|DNA repair (GO:0006281)|G2 DNA damage checkpoint (GO:0031572)|peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)	nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(5)|ovary(1)|prostate(1)	15		Acute lymphoblastic leukemia(62;0.0559)				TTACTTAACGCAAGACTGTTT	0.378																																																	0													82.0	79.0	80.0					9																	99266041		2203	4300	6503	SO:0001583	missense	8555			AF023158	CCDS6721.1, CCDS6722.1, CCDS43853.1	9q22.3	2013-01-17	2013-01-17		ENSG00000081377	ENSG00000081377		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : CDC14s"""	1719	protein-coding gene	gene with protein product		603505	"""CDC14 (cell division cycle 14, S. cerevisiae) homolog B"", ""CDC14 cell division cycle 14 homolog B (S. cerevisiae)"""			9367992	Standard	NM_003671		Approved	Cdc14B1, Cdc14B2, CDC14B3, hCDC14B	uc004awj.3	O60729	OTTHUMG00000020300	ENST00000375241.1:c.1491G>T	9.37:g.99266041C>A	ENSP00000364389:p.Leu497Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6N5X8|A8MQ20|B1AL31|B1AL32|O43183|O60730|Q5JU08	Missense_Mutation	SNP	pfam_Dual-sp_phosphatase_cat-dom,pfam_Tyr_Pase_rcpt/non-rcpt,smart_Dual-sp_phosphatase_subgr_cat,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat	p.L497F	ENST00000375241.1	37	c.1491	CCDS6722.1	9	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383380	0.61845	.	.	ENSG00000081377	ENST00000375241;ENST00000375240;ENST00000375242	D;D;D	0.93247	-3.19;-3.08;-3.12	4.88	2.0	0.26442	.	0.663319	0.13071	N	0.416136	D	0.91740	0.7388	N	0.14661	0.345	0.80722	D	1	P;D;D	0.71674	0.874;0.998;0.998	B;D;D	0.78314	0.347;0.991;0.991	D	0.87530	0.2452	10	0.56958	D	0.05	-18.2259	7.4736	0.27363	0.0:0.725:0.0:0.275	.	458;497;460	O60729-2;O60729;A8MQ20	.;CC14B_HUMAN;.	F	497;458;460	ENSP00000364389:L497F;ENSP00000364388:L458F;ENSP00000364390:L460F	ENSP00000364388:L458F	L	-	3	2	CDC14B	98305862	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	1.658000	0.37376	0.246000	0.21394	0.557000	0.71058	TTG	CDC14B	-	NULL		0.378	CDC14B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC14B	HGNC	protein_coding	OTTHUMT00000053278.2	C	NM_033331		99266041	-1	no_errors	ENST00000375241	ensembl	human	known	70_37	missense	SNP	1.000	A
CDC7	8317	genome.wustl.edu	37	1	91989963	91989963	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:91989963C>T	ENST00000428239.1	+	12	1955	c.1696C>T	c.(1696-1698)Cat>Tat	p.H566Y	CDC7_ENST00000234626.6_Missense_Mutation_p.H566Y|CDC7_ENST00000430031.2_Missense_Mutation_p.H538Y	NM_001134420.1	NP_001127892.1	O00311	CDC7_HUMAN	cell division cycle 7	566	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell cycle phase transition (GO:0044770)|cell division (GO:0051301)|DNA replication (GO:0006260)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G2/M transition of mitotic cell cycle (GO:0010971)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)	cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinase activity (GO:0016301)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|ovary(2)|prostate(1)|stomach(2)	23		all_lung(203;0.0165)|Lung NSC(277;0.0562)		all cancers(265;0.00108)|Epithelial(280;0.0184)|KIRC - Kidney renal clear cell carcinoma(1967;0.124)		AGCTTTGTTGCATCCATTTTT	0.338																																																	0													90.0	95.0	94.0					1																	91989963		2197	4299	6496	SO:0001583	missense	8317			AF015592	CCDS734.1	1p22	2013-01-17	2013-01-17	2003-07-23	ENSG00000097046	ENSG00000097046			1745	protein-coding gene	gene with protein product		603311	"""CDC7 (cell division cycle 7, S. cerevisiae, homolog)-like 1"", ""CDC7 cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 (S. cerevisiae)"", ""cell division cycle 7 homolog (S. cerevisiae)"""	CDC7L1		9405610, 9250678	Standard	NM_003503		Approved	Hsk1, huCdc7, HsCdc7	uc001dof.3	O00311	OTTHUMG00000047810	ENST00000428239.1:c.1696C>T	1.37:g.91989963C>T	ENSP00000393139:p.His566Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DT31|O00558|Q5T5U5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.H566Y	ENST00000428239.1	37	c.1696	CCDS734.1	1	.	.	.	.	.	.	.	.	.	.	C	29.9	5.045237	0.93685	.	.	ENSG00000097046	ENST00000430031;ENST00000234626;ENST00000428239	T;T;T	0.10860	2.83;2.83;2.83	6.16	6.16	0.99307	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.33731	0.0873	M	0.83852	2.665	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.999;1.0	T	0.05517	-1.0880	10	0.72032	D	0.01	-15.2591	20.8598	0.99761	0.0:1.0:0.0:0.0	.	538;566;566	B7Z5H7;B2R6V2;O00311	.;.;CDC7_HUMAN	Y	538;566;566	ENSP00000407477:H538Y;ENSP00000234626:H566Y;ENSP00000393139:H566Y	ENSP00000234626:H566Y	H	+	1	0	CDC7	91762551	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.571000	0.82399	2.937000	0.99478	0.650000	0.86243	CAT	CDC7	-	pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,pfscan_Prot_kinase_cat_dom		0.338	CDC7-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC7	HGNC	protein_coding	OTTHUMT00000027928.1	C	NM_003503		91989963	+1	no_errors	ENST00000234626	ensembl	human	known	70_37	missense	SNP	1.000	T
CHST1	8534	genome.wustl.edu	37	11	45671730	45671730	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:45671730G>A	ENST00000308064.2	-	4	1414	c.744C>T	c.(742-744)cgC>cgT	p.R248R	RP11-495O11.1_ENST00000525563.1_RNA|CHST1_ENST00000533673.1_5'Flank	NM_003654.5	NP_003645.1	O43916	CHST1_HUMAN	carbohydrate (keratan sulfate Gal-6) sulfotransferase 1	248					carbohydrate metabolic process (GO:0005975)|galactose metabolic process (GO:0006012)|glycosaminoglycan metabolic process (GO:0030203)|inflammatory response (GO:0006954)|keratan sulfate biosynthetic process (GO:0018146)|keratan sulfate metabolic process (GO:0042339)|polysaccharide metabolic process (GO:0005976)|small molecule metabolic process (GO:0044281)|sulfur compound metabolic process (GO:0006790)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	keratan sulfotransferase activity (GO:0045130)|sulfotransferase activity (GO:0008146)			breast(1)|endometrium(3)|large_intestine(10)|lung(17)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(1)	42				GBM - Glioblastoma multiforme(35;3e-06)|BRCA - Breast invasive adenocarcinoma(625;0.0781)		GGTACGTGTCGCGGAAGGTCT	0.642																																																	0													62.0	57.0	59.0					11																	45671730		2203	4299	6502	SO:0001819	synonymous_variant	8534			U65637	CCDS7913.1	11p11.2	2010-04-29			ENSG00000175264	ENSG00000175264		"""Sulfotransferases, membrane-bound"""	1969	protein-coding gene	gene with protein product		603797				9405439, 9639683	Standard	NM_003654		Approved	C6ST, KSGal6ST	uc001mys.2	O43916		ENST00000308064.2:c.744C>T	11.37:g.45671730G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQP2	Silent	SNP	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase	p.R248	ENST00000308064.2	37	c.744	CCDS7913.1	11																																																																																			CHST1	-	pfam_Sulfotransferase_dom,pirsf_Carbohydrate_sulfotransferase		0.642	CHST1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHST1	HGNC	protein_coding	OTTHUMT00000390127.1	G	NM_003654		45671730	-1	no_errors	ENST00000308064	ensembl	human	known	70_37	silent	SNP	0.392	A
CIB1	10519	genome.wustl.edu	37	15	90777075	90777075	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr15:90777075C>T	ENST00000328649.6	-	1	204	c.43G>A	c.(43-45)Gag>Aag	p.E15K	GDPGP1_ENST00000558017.1_5'UTR	NM_006384.3	NP_006375.2	Q99828	CIB1_HUMAN	calcium and integrin binding 1 (calmyrin)	15					angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell adhesion (GO:0007155)|cell division (GO:0051301)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to growth factor stimulus (GO:0071363)|cellular response to nerve growth factor stimulus (GO:1990090)|cellular response to tumor necrosis factor (GO:0071356)|cytoplasmic microtubule organization (GO:0031122)|double-strand break repair (GO:0006302)|endomitotic cell cycle (GO:0007113)|extrinsic apoptotic signaling pathway (GO:0097191)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of megakaryocyte differentiation (GO:0045653)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of neuron projection development (GO:0010977)|negative regulation of protein kinase B signaling (GO:0051898)|negative regulation of protein phosphorylation (GO:0001933)|platelet formation (GO:0030220)|positive regulation of calcineurin-NFAT signaling cascade (GO:0070886)|positive regulation of cell adhesion mediated by integrin (GO:0033630)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell migration involved in sprouting angiogenesis (GO:0090050)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-matrix adhesion (GO:0001954)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of gene expression involved in extracellular matrix organization (GO:1901313)|positive regulation of male germ cell proliferation (GO:2000256)|positive regulation of metalloenzyme activity (GO:0048554)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|positive regulation of protein targeting to membrane (GO:0090314)|positive regulation of substrate adhesion-dependent cell spreading (GO:1900026)|regulation of cell division (GO:0051302)|regulation of cell proliferation (GO:0042127)|response to ischemia (GO:0002931)|spermatid development (GO:0007286)|thrombopoietin-mediated signaling pathway (GO:0038163)	cell periphery (GO:0071944)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|filopodium tip (GO:0032433)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|lamellipodium (GO:0030027)|membrane (GO:0016020)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|protein anchor (GO:0043495)|Ras GTPase binding (GO:0017016)			lung(1)|prostate(1)	2	Melanoma(11;0.00551)|Lung NSC(78;0.0141)|all_lung(78;0.0303)		BRCA - Breast invasive adenocarcinoma(143;0.00269)|KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|STAD - Stomach adenocarcinoma(125;0.217)			ACCTGGTACTCGGCCAGCAGC	0.741																																																	0													7.0	11.0	9.0					15																	90777075		2050	4020	6070	SO:0001583	missense	10519			U82226	CCDS10360.1, CCDS73781.1	15q25.3-q26	2013-01-10			ENSG00000185043	ENSG00000185043		"""EF-hand domain containing"""	16920	protein-coding gene	gene with protein product		602293				9030514, 10826701	Standard	NM_006384		Approved	SIP2-28, CALMYRIN, CIB, KIP	uc031qtq.1	Q99828	OTTHUMG00000149808	ENST00000328649.6:c.43G>A	15.37:g.90777075C>T	ENSP00000333873:p.Glu15Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU40|H6WJF3|O00693|O00735|Q6IB49|Q96J54|Q99971	Missense_Mutation	SNP	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.E15K	ENST00000328649.6	37	c.43	CCDS10360.1	15	.	.	.	.	.	.	.	.	.	.	C	36	5.656343	0.96724	.	.	ENSG00000185043	ENST00000328649	T	0.10288	2.89	4.84	4.84	0.62591	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	T	0.29882	0.0747	M	0.69358	2.11	0.80722	D	1	D	0.76494	0.999	D	0.79784	0.993	T	0.00733	-1.1589	10	0.56958	D	0.05	-21.4019	13.3172	0.60413	0.0:1.0:0.0:0.0	.	15	Q99828	CIB1_HUMAN	K	15	ENSP00000333873:E15K	ENSP00000333873:E15K	E	-	1	0	CIB1	88578079	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	5.088000	0.64486	2.523000	0.85059	0.609000	0.83330	GAG	CIB1	-	NULL		0.741	CIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIB1	HGNC	protein_coding	OTTHUMT00000313419.1	C			90777075	-1	no_errors	ENST00000328649	ensembl	human	known	70_37	missense	SNP	1.000	T
CNTNAP1	8506	genome.wustl.edu	37	17	40850830	40850830	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr17:40850830C>G	ENST00000264638.4	+	24	4274	c.4057C>G	c.(4057-4059)Cca>Gca	p.P1353A	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	1353					axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		CAACCAagctccagcctcagc	0.662																																																	0													27.0	26.0	26.0					17																	40850830		2203	4300	6503	SO:0001583	missense	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.4057C>G	17.37:g.40850830C>G	ENSP00000264638:p.Pro1353Ala	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.P1353A	ENST00000264638.4	37	c.4057	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	C	0.037	-1.303531	0.01353	.	.	ENSG00000108797	ENST00000264638	D	0.89123	-2.47	4.79	1.38	0.22167	.	0.204961	0.24590	N	0.037235	T	0.71099	0.3300	N	0.08118	0	0.21220	N	0.999757	B	0.02656	0.0	B	0.01281	0.0	T	0.56768	-0.7924	10	0.30078	T	0.28	.	2.878	0.05638	0.1867:0.5295:0.1812:0.1025	.	1353	P78357	CNTP1_HUMAN	A	1353	ENSP00000264638:P1353A	ENSP00000264638:P1353A	P	+	1	0	CNTNAP1	38104356	0.057000	0.20700	0.713000	0.30519	0.187000	0.23431	1.295000	0.33377	0.970000	0.38263	0.561000	0.74099	CCA	CNTNAP1	-	NULL		0.662	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	C	NM_003632		40850830	+1	no_errors	ENST00000264638	ensembl	human	known	70_37	missense	SNP	0.174	G
COL12A1	1303	genome.wustl.edu	37	6	75865553	75865553	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr6:75865553G>A	ENST00000322507.8	-	16	3577	c.3268C>T	c.(3268-3270)Cct>Tct	p.P1090S	COL12A1_ENST00000345356.6_Intron|COL12A1_ENST00000483888.2_Missense_Mutation_p.P1090S|COL12A1_ENST00000416123.2_Missense_Mutation_p.P1090S	NM_004370.5	NP_004361.3	Q99715	COCA1_HUMAN	collagen, type XII, alpha 1	1090	Fibronectin type-III 8. {ECO:0000255|PROSITE-ProRule:PRU00316}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skeletal system development (GO:0001501)	collagen type XII trimer (GO:0005595)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|vesicle (GO:0031982)	extracellular matrix structural constituent conferring tensile strength (GO:0030020)			breast(7)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(44)|liver(1)|lung(77)|ovary(7)|prostate(3)|skin(4)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(2)	169						AGGTTTCTAGGAGACTTAAAC	0.418																																																	0													83.0	84.0	84.0					6																	75865553		1815	4074	5889	SO:0001583	missense	1303			U73779	CCDS43481.1, CCDS43482.1	6q12-q13	2013-02-11	2003-07-24		ENSG00000111799	ENSG00000111799		"""Proteoglycans / Extracellular Matrix : Collagen proteoglycans"", ""Collagens"", ""Fibronectin type III domain containing"""	2188	protein-coding gene	gene with protein product	"""collagen type XII proteoglycan"""	120320	"""collagen, type XII, alpha 1-like"""	COL12A1L		9143499	Standard	XM_006715334		Approved		uc003phs.3	Q99715	OTTHUMG00000015051	ENST00000322507.8:c.3268C>T	6.37:g.75865553G>A	ENSP00000325146:p.Pro1090Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O43853|Q15955|Q5VYK1|Q5VYK2|Q71UR3|Q99716	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_VWF_A,pfam_Collagen,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_VWF_A,smart_Laminin_G,pfscan_Fibronectin_type3,pfscan_VWF_A	p.P1090S	ENST00000322507.8	37	c.3268	CCDS43482.1	6	.	.	.	.	.	.	.	.	.	.	G	20.3	3.962054	0.74016	.	.	ENSG00000111799	ENST00000322507;ENST00000432784;ENST00000416123;ENST00000483888	T;T;T	0.72615	-0.67;-0.67;-0.67	5.66	5.66	0.87406	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.063724	0.64402	D	0.000010	D	0.87075	0.6087	M	0.92169	3.28	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.87180	0.2227	10	0.46703	T	0.11	.	20.1225	0.97967	0.0:0.0:1.0:0.0	.	1090	Q99715	COCA1_HUMAN	S	1090	ENSP00000325146:P1090S;ENSP00000412864:P1090S;ENSP00000421216:P1090S	ENSP00000325146:P1090S	P	-	1	0	COL12A1	75922273	1.000000	0.71417	0.998000	0.56505	0.828000	0.46876	9.420000	0.97426	2.831000	0.97527	0.650000	0.86243	CCT	COL12A1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.418	COL12A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL12A1	HGNC	protein_coding	OTTHUMT00000041249.3	G	NM_004370		75865553	-1	no_errors	ENST00000322507	ensembl	human	known	70_37	missense	SNP	1.000	A
COL27A1	85301	genome.wustl.edu	37	9	117063996	117063996	+	Splice_Site	SNP	C	C	T	rs145134644		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:117063996C>T	ENST00000356083.3	+	55	5235	c.4844C>T	c.(4843-4845)cCg>cTg	p.P1615L		NM_032888.2	NP_116277.2	Q8IZC6	CORA1_HUMAN	collagen, type XXVII, alpha 1	1615	Collagen-like 16.|Pro-rich.|Triple-helical region.				extracellular matrix organization (GO:0030198)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|fibrillar collagen trimer (GO:0005583)	extracellular matrix structural constituent (GO:0005201)|metal ion binding (GO:0046872)			central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(17)|lung(30)|ovary(4)|prostate(6)|skin(3)|soft_tissue(1)|stomach(1)|urinary_tract(3)	80						CCCGGCCCCCCGGTAGGTAAC	0.622																																																	0								C	LEU/PRO	0,4406		0,0,2203	27.0	31.0	29.0		4844	5.5	1.0	9	dbSNP_134	29	1,8599	1.2+/-3.3	0,1,4299	no	missense-near-splice	COL27A1	NM_032888.2	98	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	1615/1861	117063996	1,13005	2203	4300	6503	SO:0001630	splice_region_variant	85301			AB058773	CCDS6802.1	9q33.1	2013-01-16			ENSG00000196739	ENSG00000196739		"""Collagens"""	22986	protein-coding gene	gene with protein product		608461				12766169	Standard	NM_032888		Approved	KIAA1870, MGC11337, FLJ11895	uc011lxl.2	Q8IZC6	OTTHUMG00000020537	ENST00000356083.3:c.4845+1C>T	9.37:g.117063996C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q66K43|Q96JF7	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.P1615L	ENST00000356083.3	37	c.4844	CCDS6802.1	9	.	.	.	.	.	.	.	.	.	.	C	17.15	3.315403	0.60524	0.0	1.16E-4	ENSG00000196739	ENST00000356083;ENST00000357257	D	0.94092	-3.35	5.47	5.47	0.80525	.	.	.	.	.	D	0.97498	0.9181	H	0.94264	3.515	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.97669	1.0165	9	0.46703	T	0.11	.	14.8145	0.70020	0.0:1.0:0.0:0.0	.	1615	Q8IZC6	CORA1_HUMAN	L	1615	ENSP00000348385:P1615L	ENSP00000348385:P1615L	P	+	2	0	COL27A1	116103817	1.000000	0.71417	1.000000	0.80357	0.851000	0.48451	5.174000	0.65015	2.570000	0.86706	0.462000	0.41574	CCG	COL27A1	-	pfam_Collagen		0.622	COL27A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL27A1	HGNC	protein_coding	OTTHUMT00000053763.1	C	NM_032888	Missense_Mutation	117063996	+1	no_errors	ENST00000356083	ensembl	human	known	70_37	missense	SNP	1.000	T
COLEC10	10584	genome.wustl.edu	37	8	120118095	120118095	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr8:120118095A>T	ENST00000332843.2	+	6	540	c.499A>T	c.(499-501)Aag>Tag	p.K167*		NM_006438.3	NP_006429.2	Q9Y6Z7	COL10_HUMAN	collectin sub-family member 10 (C-type lectin)	167	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.					collagen trimer (GO:0005581)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)	mannose binding (GO:0005537)			endometrium(2)|kidney(3)|large_intestine(3)|lung(8)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	21	all_cancers(13;4.13e-26)|Lung NSC(37;1.36e-07)|Ovarian(258;0.018)|Hepatocellular(40;0.234)		STAD - Stomach adenocarcinoma(47;0.00113)			GCAGGAAGAGAAGAACTACAG	0.468																																																	0													84.0	65.0	71.0					8																	120118095		2203	4300	6503	SO:0001587	stop_gained	10584			AB002631	CCDS6327.1	8q23-q24.1	2007-12-19				ENSG00000184374		"""Collectins"""	2220	protein-coding gene	gene with protein product		607620				10224141	Standard	NM_006438		Approved	CL-L1	uc003yoo.3	Q9Y6Z7		ENST00000332843.2:c.499A>T	8.37:g.120118095A>T	ENSP00000332723:p.Lys167*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SYH6|Q6UW19	Nonsense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.K167*	ENST00000332843.2	37	c.499	CCDS6327.1	8	.	.	.	.	.	.	.	.	.	.	A	25.6	4.659171	0.88154	.	.	ENSG00000184374	ENST00000332843	.	.	.	5.39	5.39	0.77823	.	0.056595	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-23.2651	11.6719	0.51406	0.852:0.1479:0.0:0.0	.	.	.	.	X	167	.	ENSP00000332723:K167X	K	+	1	0	COLEC10	120187276	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	5.721000	0.68477	2.174000	0.68829	0.454000	0.30748	AAG	COLEC10	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.468	COLEC10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COLEC10	HGNC	protein_coding	OTTHUMT00000381225.1	A			120118095	+1	no_errors	ENST00000332843	ensembl	human	known	70_37	nonsense	SNP	1.000	T
RTP5	285093	genome.wustl.edu	37	2	242815292	242815292	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:242815292C>T	ENST00000343216.3	+	2	1613	c.1585C>T	c.(1585-1587)Cct>Tct	p.P529S		NM_173821.2	NP_776182.2																					AGACGAGCGCCCTGGCCGTGC	0.642																																																	0													60.0	71.0	67.0					2																	242815292		2047	4163	6210	SO:0001583	missense	0																														ENST00000343216.3:c.1585C>T	2.37:g.242815292C>T	ENSP00000345374:p.Pro529Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.P529S	ENST00000343216.3	37	c.1585	CCDS42843.1	2	.	.	.	.	.	.	.	.	.	.	.	1.012	-0.687430	0.03328	.	.	ENSG00000188011	ENST00000343216	T	0.21734	1.99	2.16	-4.32	0.03688	.	.	.	.	.	T	0.07728	0.0194	N	0.08118	0	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.34054	-0.9844	9	0.18276	T	0.48	.	5.013	0.14322	0.0:0.426:0.3179:0.2562	.	529	Q14D33	CB085_HUMAN	S	529	ENSP00000345374:P529S	ENSP00000345374:P529S	P	+	1	0	C2orf85	242463965	0.000000	0.05858	0.000000	0.03702	0.241000	0.25554	-0.496000	0.06436	-1.920000	0.01069	0.196000	0.17591	CCT	CXXC11	-	NULL		0.642	CXXC11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CXXC11	HGNC	protein_coding	OTTHUMT00000322310.1	C			242815292	+1	no_errors	ENST00000343216	ensembl	human	known	70_37	missense	SNP	0.000	T
DCC	1630	genome.wustl.edu	37	18	50683791	50683791	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr18:50683791C>T	ENST00000442544.2	+	8	1943	c.1327C>T	c.(1327-1329)Cga>Tga	p.R443*	DCC_ENST00000581580.1_Nonsense_Mutation_p.R98*|DCC_ENST00000412726.1_Nonsense_Mutation_p.R291*	NM_005215.3	NP_005206.2	P43146	DCC_HUMAN	DCC netrin 1 receptor	443	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|dorsal/ventral axon guidance (GO:0033563)|negative regulation of collateral sprouting (GO:0048671)|negative regulation of dendrite development (GO:2000171)|negative regulation of neuron projection development (GO:0010977)|neuron migration (GO:0001764)|positive regulation of apoptotic process (GO:0043065)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of neuron projection development (GO:0010976)|regulation of apoptotic process (GO:0042981)|response to amphetamine (GO:0001975)|spinal cord ventral commissure morphogenesis (GO:0021965)	axon (GO:0030424)|cytosol (GO:0005829)|growth cone membrane (GO:0032584)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	netrin receptor activity (GO:0005042)|transcription coactivator activity (GO:0003713)|transmembrane signaling receptor activity (GO:0004888)			NS(3)|breast(2)|central_nervous_system(1)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(23)|liver(1)|lung(56)|ovary(7)|pancreas(3)|prostate(2)|skin(16)|stomach(2)|upper_aerodigestive_tract(4)|urinary_tract(6)	148		all_cancers(7;0.11)|all_epithelial(6;0.00126)		Colorectal(16;0.0251)|COAD - Colon adenocarcinoma(17;0.0942)		GGTTTCCAGCCGATTTGTCCG	0.527																																																	0													164.0	150.0	155.0					18																	50683791		2203	4300	6503	SO:0001587	stop_gained	1630			X76132	CCDS11952.1	18q21.1	2014-06-20	2014-06-20		ENSG00000187323	ENSG00000187323		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2701	protein-coding gene	gene with protein product	"""immunoglobulin superfamily, DCC subclass, member 1"""	120470	"""deleted in colorectal carcinoma"""			2294591, 24400119	Standard	NM_005215		Approved	IGDCC1, NTN1R1	uc002lfe.2	P43146	OTTHUMG00000132698	ENST00000442544.2:c.1327C>T	18.37:g.50683791C>T	ENSP00000389140:p.Arg443*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Neogenin_C,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Ig_V-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R443*	ENST00000442544.2	37	c.1327	CCDS11952.1	18	.	.	.	.	.	.	.	.	.	.	C	35	5.415037	0.96092	.	.	ENSG00000187323	ENST00000442544;ENST00000304775;ENST00000412726	.	.	.	5.44	5.44	0.79542	.	0.000000	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0448	0.89329	0.0:1.0:0.0:0.0	.	.	.	.	X	443;376;291	.	ENSP00000304146:R376X	R	+	1	2	DCC	48937789	1.000000	0.71417	0.998000	0.56505	0.764000	0.43329	7.027000	0.76463	2.567000	0.86603	0.561000	0.74099	CGA	DCC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.527	DCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCC	HGNC	protein_coding	OTTHUMT00000255996.3	C	NM_005215		50683791	+1	no_errors	ENST00000442544	ensembl	human	known	70_37	nonsense	SNP	1.000	T
DCP2	167227	genome.wustl.edu	37	5	112346477	112346477	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr5:112346477C>T	ENST00000389063.2	+	10	1270	c.1072C>T	c.(1072-1074)Cgg>Tgg	p.R358W	DCP2_ENST00000515408.1_Missense_Mutation_p.R323W|DCP2_ENST00000543319.1_Missense_Mutation_p.R147W	NM_152624.5	NP_689837	Q8IU60	DCP2_HUMAN	decapping mRNA 2	358					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|histone mRNA catabolic process (GO:0071044)|mRNA catabolic process (GO:0006402)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)	cytoplasmic mRNA processing body (GO:0000932)|cytosol (GO:0005829)|nucleus (GO:0005634)|RISC complex (GO:0016442)	exoribonuclease activity, producing 5'-phosphomonoesters (GO:0016896)|m7G(5')pppN diphosphatase activity (GO:0050072)|manganese ion binding (GO:0030145)|RNA binding (GO:0003723)			endometrium(3)|large_intestine(6)|lung(1)	10		all_cancers(142;4.41e-05)|all_epithelial(76;3.65e-07)|Colorectal(10;0.00115)|Prostate(80;0.00133)|Ovarian(225;0.0443)		OV - Ovarian serous cystadenocarcinoma(64;6.98e-08)|Epithelial(69;7.87e-08)|all cancers(49;1.06e-05)|COAD - Colon adenocarcinoma(37;0.0123)|Colorectal(14;0.0171)		ACTTCATCCACGGAAACTTCA	0.313																																																	0													160.0	169.0	166.0					5																	112346477		2201	4300	6501	SO:0001583	missense	167227			AY135173	CCDS34210.1, CCDS56377.1	5q22	2013-05-02	2013-05-02		ENSG00000172795	ENSG00000172795	3.6.1.62	"""Nudix motif containing"""	24452	protein-coding gene	gene with protein product	"""nudix (nucleoside diphosphate linked moiety X)-type motif 20"", ""M(7)GpppN-mRNA hydrolase"""	609844	"""DCP2 decapping enzyme homolog (S. cerevisiae)"""			12218187, 12417715	Standard	NM_152624		Approved	NUDT20	uc003kqh.3	Q8IU60	OTTHUMG00000162853	ENST00000389063.2:c.1072C>T	5.37:g.112346477C>T	ENSP00000373715:p.Arg358Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J778|Q6P2D4|Q7Z5W5|Q8NBG5	Missense_Mutation	SNP	pfam_mRNA_decapping_BoxA,pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like	p.R358W	ENST00000389063.2	37	c.1072	CCDS34210.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	20.7|20.7	4.028532|4.028532	0.75390|0.75390	.|.	.|.	ENSG00000172795|ENSG00000172795	ENST00000515408;ENST00000389063;ENST00000543319|ENST00000513585	T;T|.	0.69175|.	-0.38;0.27|.	5.74|5.74	3.78|3.78	0.43462|0.43462	.|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.44808|0.44808	0.1311|0.1311	L|L	0.32530|0.32530	0.975|0.975	0.58432|0.58432	D|D	0.999999|0.999999	D;D|.	0.89917|.	1.0;1.0|.	D;D|.	0.91635|.	0.999;0.998|.	T|T	0.27502|0.27502	-1.0072|-1.0072	10|5	0.87932|.	D|.	0|.	.|.	7.772|7.772	0.29015|0.29015	0.3052:0.5729:0.1219:0.0|0.3052:0.5729:0.1219:0.0	.|.	323;358|.	Q8IU60-2;Q8IU60|.	.;DCP2_HUMAN|.	W|M	323;358;147|339	ENSP00000425770:R323W;ENSP00000373715:R358W|.	ENSP00000373715:R358W|.	R|T	+|+	1|2	2|0	DCP2|DCP2	112374376|112374376	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.990000|0.990000	0.78478|0.78478	2.566000|2.566000	0.45948|0.45948	1.413000|1.413000	0.46997|0.46997	0.637000|0.637000	0.83480|0.83480	CGG|ACG	DCP2	-	NULL		0.313	DCP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCP2	HGNC	protein_coding	OTTHUMT00000370765.3	C	NM_152624		112346477	+1	no_errors	ENST00000389063	ensembl	human	known	70_37	missense	SNP	1.000	T
DDX50	79009	genome.wustl.edu	37	10	70670829	70670829	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr10:70670829G>A	ENST00000373585.3	+	4	573	c.466G>A	c.(466-468)Ggg>Agg	p.G156R	RNU6-571P_ENST00000384128.1_RNA	NM_024045.1	NP_076950.1	Q9BQ39	DDX50_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 50	156						membrane (GO:0016020)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)			breast(2)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|liver(2)|lung(6)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)	29						TACAGGTCGAGGGGTAACATA	0.318																																																	0													106.0	110.0	109.0					10																	70670829		2203	4300	6503	SO:0001583	missense	79009			AF334103	CCDS7283.1	10q22.2	2010-09-30			ENSG00000107625	ENSG00000107625		"""DEAD-boxes"""	17906	protein-coding gene	gene with protein product		610373				11891046	Standard	NM_024045		Approved	GU2, MGC3199, GUB, RH-II/GuB	uc001jou.3	Q9BQ39	OTTHUMG00000018362	ENST00000373585.3:c.466G>A	10.37:g.70670829G>A	ENSP00000362687:p.Gly156Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VX37|Q8WV76|Q9BWI8	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_GUCT,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.G156R	ENST00000373585.3	37	c.466	CCDS7283.1	10	.	.	.	.	.	.	.	.	.	.	G	24.1	4.492843	0.84962	.	.	ENSG00000107625	ENST00000373585;ENST00000541832	T	0.35605	1.3	5.22	5.22	0.72569	RNA helicase, DEAD-box type, Q motif (1);DEAD-like helicase (1);	0.194707	0.56097	N	0.000040	T	0.41213	0.1149	L	0.34521	1.04	0.80722	D	1	P;B	0.52842	0.956;0.169	P;B	0.49829	0.623;0.327	T	0.36578	-0.9742	10	0.87932	D	0	-8.4298	19.2003	0.93710	0.0:0.0:1.0:0.0	.	156;156	Q9BQ39;B4DED6	DDX50_HUMAN;.	R	156	ENSP00000362687:G156R	ENSP00000362687:G156R	G	+	1	0	DDX50	70340835	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	9.398000	0.97281	2.598000	0.87819	0.485000	0.47835	GGG	DDX50	-	smart_Helicase_ATP-bd		0.318	DDX50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX50	HGNC	protein_coding	OTTHUMT00000048363.1	G	NM_024045		70670829	+1	no_errors	ENST00000373585	ensembl	human	known	70_37	missense	SNP	1.000	A
DLG2	1740	genome.wustl.edu	37	11	83877982	83877982	+	Intron	SNP	C	C	T	rs533326448	byFrequency	TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:83877982C>T	ENST00000532653.1	-	4	561				DLG2_ENST00000398309.2_Intron|DLG2_ENST00000524982.1_Intron|DLG2_ENST00000376106.3_Intron|DLG2_ENST00000330014.6_Intron|DLG2_ENST00000280241.8_Intron|DLG2_ENST00000543673.1_Intron|DLG2_ENST00000418306.2_Intron|DLG2_ENST00000537455.1_Intron|DLG2_ENST00000376104.2_Intron|DLG2_ENST00000398301.2_Intron|DLG2_ENST00000531015.1_Intron			Q14168	MPP2_HUMAN	discs, large homolog 2 (Drosophila)						nucleotide phosphorylation (GO:0046939)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	guanylate kinase activity (GO:0004385)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(11)|lung(35)|ovary(3)|pancreas(2)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	71		all_cancers(6;0.00791)|Acute lymphoblastic leukemia(157;4.44e-05)|all_hematologic(158;0.0036)				GTAACACTTACGGTAATATTT	0.373													C|||	7	0.00139776	0.0008	0.0	5008	,	,		19436	0.0		0.0	False		,,,				2504	0.0061																0													122.0	124.0	124.0					11																	83877982		876	1990	2866	SO:0001627	intron_variant	1740			U32376	CCDS41696.1, CCDS44690.1, CCDS44691.1, CCDS44692.1, CCDS55782.1, CCDS73357.1	11q21	2012-04-17	2008-12-15		ENSG00000150672	ENSG00000150672		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	2901	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 58"""	603583	"""discs, large homolog 2, chapsyn-110 (Drosophila)"""			8755482, 9806853	Standard	NM_001142702		Approved	PSD-93, PSD93, chapsyn-110, PPP1R58	uc001pak.2	Q15700	OTTHUMG00000134309	ENST00000532653.1:c.259-3428G>A	11.37:g.83877982C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DGE9|B4DRJ0|B7Z3G8|E7EV80|E7EV91|E7EX01|Q53ES9|Q5CZB9|Q9BQJ2	RNA	SNP	-	NULL	ENST00000532653.1	37	NULL		11																																																																																			DLG2	-	-		0.373	DLG2-009	NOVEL	basic|appris_candidate	protein_coding	DLG2	HGNC	protein_coding	OTTHUMT00000259253.2	C	NM_001364		83877982	-1	no_errors	ENST00000524941	ensembl	human	known	70_37	rna	SNP	0.000	T
DMWD	1762	genome.wustl.edu	37	19	46289788	46289788	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:46289788C>T	ENST00000270223.6	-	3	1011	c.966G>A	c.(964-966)atG>atA	p.M322I	AC011530.4_ENST00000593999.1_5'Flank|DMWD_ENST00000377735.3_Missense_Mutation_p.M322I|DMWD_ENST00000601370.1_5'Flank	NM_004943.1	NP_004934.1	Q09019	DMWD_HUMAN	dystrophia myotonica, WD repeat containing	322										central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	16		Ovarian(192;0.0308)|all_neural(266;0.112)		OV - Ovarian serous cystadenocarcinoma(262;0.00604)|GBM - Glioblastoma multiforme(486;0.0807)|Epithelial(262;0.236)		AGTAGCTCTTCATGAGCCCAC	0.637																																																	0													53.0	57.0	55.0					19																	46289788		2203	4300	6503	SO:0001583	missense	1762			L19267	CCDS33054.1	19q13.32	2013-01-09	2007-02-20		ENSG00000185800	ENSG00000185800		"""WD repeat domain containing"""	2936	protein-coding gene	gene with protein product		609857	"""dystrophia myotonica-containing WD repeat motif"""			1302022	Standard	NM_004943		Approved	DMR-N9, gene59, D19S593E	uc021uwc.1	Q09019	OTTHUMG00000169044	ENST00000270223.6:c.966G>A	19.37:g.46289788C>T	ENSP00000270223:p.Met322Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.M322I	ENST00000270223.6	37	c.966	CCDS33054.1	19	.	.	.	.	.	.	.	.	.	.	C	16.92	3.255089	0.59321	.	.	ENSG00000185800	ENST00000377735;ENST00000270223	T;T	0.25250	1.81;1.81	3.81	3.81	0.43845	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.31765	0.0807	N	0.16307	0.4	0.54753	D	0.999986	P;P;P	0.49447	0.924;0.908;0.851	P;D;P	0.64144	0.878;0.922;0.838	T	0.13202	-1.0518	10	0.51188	T	0.08	-30.9731	13.5872	0.61937	0.0:1.0:0.0:0.0	.	7;322;322	Q8WUW6;G5E9A7;Q09019	.;.;DMWD_HUMAN	I	322	ENSP00000366964:M322I;ENSP00000270223:M322I	ENSP00000270223:M322I	M	-	3	0	DMWD	50981628	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.223000	0.78033	2.165000	0.68154	0.462000	0.41574	ATG	DMWD	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.637	DMWD-002	KNOWN	basic|appris_principal|CCDS	protein_coding	DMWD	HGNC	protein_coding	OTTHUMT00000402063.1	C	NM_004943		46289788	-1	no_errors	ENST00000270223	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAH6	1768	genome.wustl.edu	37	2	84806665	84806665	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:84806665G>A	ENST00000237449.6	+	13	2099	c.2091G>A	c.(2089-2091)atG>atA	p.M697I	DNAH6_ENST00000398278.2_Missense_Mutation_p.M697I|DNAH6_ENST00000389394.3_Missense_Mutation_p.M697I			Q9C0G6	DYH6_HUMAN	dynein, axonemal, heavy chain 6	697	Stem. {ECO:0000250}.				cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)			NS(2)|breast(9)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(3)|lung(14)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)	57						TAAATTTTATGCTTCCTCGTC	0.328																																																	0													108.0	104.0	105.0					2																	84806665		2203	4300	6503	SO:0001583	missense	1768			U61736	CCDS46348.1	2p11.2	2011-05-24	2006-09-04		ENSG00000115423	ENSG00000115423		"""Axonemal dyneins"""	2951	protein-coding gene	gene with protein product		603336	"""dynein, axonemal, heavy polypeptide 6"", ""dynein heavy chain-like 1"""	DNHL1		8812413	Standard	NM_001370		Approved	Dnahc6, HL-2, FLJ37357	uc010fgb.3	Q9C0G6	OTTHUMG00000128957	ENST00000237449.6:c.2091G>A	2.37:g.84806665G>A	ENSP00000237449:p.Met697Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJN9|B5MEE0|B7ZL99|O95493|Q53QZ1|Q53TE5|Q8N1W6|Q92861|Q96BL6|Q9H030|Q9H5E1	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.M697I	ENST00000237449.6	37	c.2091	CCDS46348.1	2	.	.	.	.	.	.	.	.	.	.	G	5.409	0.260710	0.10239	.	.	ENSG00000115423	ENST00000389394;ENST00000398278;ENST00000237449	T;T;T	0.23348	1.91;2.04;1.91	5.6	5.6	0.85130	.	0.000000	0.49916	D	0.000139	T	0.22085	0.0532	L	0.33485	1.01	0.33523	D	0.592649	B;B	0.20459	0.001;0.045	B;B	0.17722	0.002;0.019	T	0.14364	-1.0475	10	0.16896	T	0.51	.	18.3806	0.90449	0.0:0.0:1.0:0.0	.	697;276	Q9C0G6;Q9C0G6-3	DYH6_HUMAN;.	I	697	ENSP00000374045:M697I;ENSP00000381326:M697I;ENSP00000237449:M697I	ENSP00000237449:M697I	M	+	3	0	DNAH6	84660176	1.000000	0.71417	1.000000	0.80357	0.734000	0.41952	4.135000	0.57997	2.650000	0.89964	0.655000	0.94253	ATG	DNAH6	-	NULL		0.328	DNAH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH6	HGNC	protein_coding	OTTHUMT00000328537.2	G	NM_001370		84806665	+1	no_errors	ENST00000237449	ensembl	human	known	70_37	missense	SNP	1.000	A
DTNA	1837	genome.wustl.edu	37	18	32438352	32438352	+	Missense_Mutation	SNP	C	C	T	rs371363393		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr18:32438352C>T	ENST00000399113.3	+	15	1555	c.1555C>T	c.(1555-1557)Cgg>Tgg	p.R519W	DTNA_ENST00000269190.7_Missense_Mutation_p.R520W|DTNA_ENST00000399121.5_Missense_Mutation_p.R459W|DTNA_ENST00000598774.1_Missense_Mutation_p.R462W|DTNA_ENST00000601125.1_Missense_Mutation_p.R141W|DTNA_ENST00000269192.7_Missense_Mutation_p.R228W|DTNA_ENST00000444659.1_Missense_Mutation_p.R519W|DTNA_ENST00000598142.1_Missense_Mutation_p.R462W|DTNA_ENST00000399097.3_Missense_Mutation_p.R167W|DTNA_ENST00000348997.5_Missense_Mutation_p.R516W|DTNA_ENST00000283365.9_Missense_Mutation_p.R462W|DTNA_ENST00000598334.1_Missense_Mutation_p.R459W|DTNA_ENST00000269191.6_Missense_Mutation_p.R519W|DTNA_ENST00000597599.1_Missense_Mutation_p.R459W|DTNA_ENST00000556414.3_Missense_Mutation_p.R171W|DTNA_ENST00000595022.1_Missense_Mutation_p.R459W|DTNA_ENST00000596745.1_Missense_Mutation_p.R269W|DTNA_ENST00000591182.1_Missense_Mutation_p.R167W|DTNA_ENST00000599844.1_Missense_Mutation_p.R141W|DTNA_ENST00000597674.1_Missense_Mutation_p.R141W			Q9Y4J8	DTNA_HUMAN	dystrobrevin, alpha	519					neuromuscular synaptic transmission (GO:0007274)|signal transduction (GO:0007165)|striated muscle contraction (GO:0006941)|synaptic transmission (GO:0007268)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|protein complex (GO:0043234)|sarcolemma (GO:0042383)|synapse (GO:0045202)	calcium ion binding (GO:0005509)|zinc ion binding (GO:0008270)	p.R520R(1)|p.R519R(1)|p.R167R(1)		endometrium(1)|haematopoietic_and_lymphoid_tissue(4)|kidney(1)|large_intestine(2)|lung(19)|prostate(1)|upper_aerodigestive_tract(1)	29						GGCAGAACTCCGGCTCCTCAG	0.507																																																	3	Substitution - coding silent(3)	lung(3)						C	TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG,TRP/ARG	1,4405	2.1+/-5.4	0,1,2202	56.0	53.0	54.0		1375,1375,1375,1375,682,625,511,805,1555,1555,1384,1546,1384,499,421	4.6	1.0	18		54	0,8600		0,0,4300	no	missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense,missense	DTNA	NM_001198938.1,NM_001198939.1,NM_001198940.1,NM_001198941.1,NM_001198942.1,NM_001198943.1,NM_001198944.1,NM_001198945.1,NM_001390.4,NM_001391.5,NM_032975.3,NM_032978.6,NM_032979.4,NM_032980.3,NM_032981.4	101,101,101,101,101,101,101,101,101,101,101,101,101,101,101	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging,probably-damaging	459/725,459/691,459/684,459/511,228/453,209/434,171/396,269/321,519/744,519/571,462/687,516/568,462/514,167/392,141/193	32438352	1,13005	2203	4300	6503	SO:0001583	missense	1837			U84540	CCDS11908.1, CCDS11909.1, CCDS42426.1, CCDS45848.1, CCDS56060.1, CCDS56061.1, CCDS56062.1, CCDS56063.1, CCDS59309.1, CCDS59310.1, CCDS59311.1, CCDS59312.1, CCDS59313.1, CCDS59314.1	18q12	2014-09-17			ENSG00000134769	ENSG00000134769			3057	protein-coding gene	gene with protein product	"""dystrophin-related protein 3"""	601239				8081380, 15834686	Standard	NM_001390		Approved	D18S892E, DTN, DTN-1, DTN-2, DTN-3, DRP3	uc010dmn.1	Q9Y4J8	OTTHUMG00000132309	ENST00000399113.3:c.1555C>T	18.37:g.32438352C>T	ENSP00000382064:p.Arg519Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K541|A8MSZ0|A8MUY4|B4DGS6|B4DIR0|B4DIU8|M0QYX6|M0R397|O15332|O15333|O75697|Q13197|Q13198|Q13199|Q13498|Q13499|Q13500|Q59GK7|Q9BS59	Missense_Mutation	SNP	pfam_EF-hand_dom_typ1,pfam_EF-hand_dom_typ2,pfam_Znf_ZZ,smart_Znf_ZZ,pirsf_Distrobrevin,pfscan_Znf_ZZ	p.R520W	ENST00000399113.3	37	c.1558	CCDS59311.1	18	.	.	.	.	.	.	.	.	.	.	C	20.2	3.956598	0.73902	2.27E-4	0.0	ENSG00000134769	ENST00000399119;ENST00000283365;ENST00000399114;ENST00000269190;ENST00000399097;ENST00000348997;ENST00000399121;ENST00000444659;ENST00000269191;ENST00000399113;ENST00000269192;ENST00000450377;ENST00000556414	T;T;T;T;T;T	0.25085	1.91;1.82;1.89;1.82;1.89;1.82	5.52	4.63	0.57726	.	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	L	0.59436	1.845	0.58432	D	0.999995	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.91635	0.998;0.999;0.991;0.988;0.999;0.998;0.999;0.991;0.998;0.997;0.999;0.993;0.987;0.99;0.953	T	0.49495	-0.8934	10	0.87932	D	0	-18.23	14.631	0.68655	0.2638:0.7362:0.0:0.0	.	171;228;209;269;141;519;519;459;462;167;516;459;470;462;462	B4DIU8;B4DIR0;B7Z3X3;B4DGS6;Q9Y4J8-8;Q9Y4J8;Q9Y4J8-3;A8K541;F5H5C1;Q9Y4J8-6;Q9Y4J8-4;E9PEH8;Q59GK7;Q9Y4J8-2;Q9Y4J8-5	.;.;.;.;.;DTNA_HUMAN;.;.;.;.;.;.;.;.;.	W	462;462;459;520;167;516;519;519;519;519;228;167;171	ENSP00000283365:R462W;ENSP00000269190:R520W;ENSP00000336682:R516W;ENSP00000405819:R519W;ENSP00000269191:R519W;ENSP00000382064:R519W	ENSP00000269190:R520W	R	+	1	2	DTNA	30692350	0.983000	0.35010	1.000000	0.80357	0.998000	0.95712	2.385000	0.44371	1.294000	0.44707	0.650000	0.86243	CGG	DTNA	-	pirsf_Distrobrevin		0.507	DTNA-005	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	DTNA	HGNC	protein_coding	OTTHUMT00000255422.2	C	NM_001390		32438352	+1	no_errors	ENST00000269190	ensembl	human	known	70_37	missense	SNP	0.993	T
ECI2	10455	genome.wustl.edu	37	6	4130608	4130608	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr6:4130608C>T	ENST00000380118.3	-	4	535	c.499G>A	c.(499-501)Gag>Aag	p.E167K	ECI2_ENST00000380125.2_Missense_Mutation_p.E137K|ECI2_ENST00000361538.2_Missense_Mutation_p.E137K|C6orf201_ENST00000380175.4_Intron|ECI2_ENST00000465828.1_Missense_Mutation_p.E137K|ECI2_ENST00000413766.2_5'UTR|C6orf201_ENST00000333388.5_Intron			O75521	ECI2_HUMAN	enoyl-CoA delta isomerase 2	167	ECH-like.				fatty acid catabolic process (GO:0009062)	intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	dodecenoyl-CoA delta-isomerase activity (GO:0004165)|fatty-acyl-CoA binding (GO:0000062)|receptor binding (GO:0005102)			endometrium(2)|kidney(2)|large_intestine(2)|lung(4)|upper_aerodigestive_tract(1)	11						AACATTACCTCAGTGTTTATG	0.413																																																	0													168.0	144.0	152.0					6																	4130608		2203	4300	6503	SO:0001583	missense	10455			AF069301	CCDS4490.1, CCDS43420.1, CCDS43420.2	6p24.3	2011-03-15	2011-03-15	2011-03-15	ENSG00000198721	ENSG00000198721			14601	protein-coding gene	gene with protein product	"""acyl-Coenzyme A binding domain containing 2"", "" Hepatocellular carcinoma-associated antigen 88"""	608024	"""peroxisomal D3,D2-enoyl-CoA isomerase"""	PECI		10419495	Standard	NM_206836		Approved	ACBD2, DRS1, HCA88	uc003mwf.3	O75521	OTTHUMG00000014158	ENST00000380118.3:c.499G>A	6.37:g.4130608C>T	ENSP00000369461:p.Glu167Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JYK5|Q5JYK7|Q7L124|Q8N0X0|Q9BUE9|Q9H0T9|Q9NQH1|Q9NYH7|Q9UN55	Missense_Mutation	SNP	pfam_Acyl-CoA-binding_protein,pfam_Crotonase_core,superfamily_Acyl-CoA-binding_protein,prints_Acyl-CoA-binding_protein	p.E167K	ENST00000380118.3	37	c.499	CCDS43420.2	6	.	.	.	.	.	.	.	.	.	.	C	10.84	1.463806	0.26335	.	.	ENSG00000198721	ENST00000380118;ENST00000380125;ENST00000361538;ENST00000465828;ENST00000495548	T;T;T;T;T	0.68479	-0.33;-0.33;-0.33;-0.33;0.83	5.69	0.619	0.17630	Crotonase, core (1);	0.794386	0.12451	N	0.467725	T	0.32102	0.0818	L	0.46741	1.465	0.34517	D	0.707785	B	0.14438	0.01	B	0.16289	0.015	T	0.03025	-1.1081	10	0.25751	T	0.34	.	3.7781	0.08669	0.0729:0.2503:0.3181:0.3587	.	167	O75521	ECI2_HUMAN	K	167;137;137;137;214	ENSP00000369461:E167K;ENSP00000369468:E137K;ENSP00000354737:E137K;ENSP00000420309:E137K;ENSP00000417459:E214K	ENSP00000354737:E137K	E	-	1	0	ECI2	4075607	0.007000	0.16637	0.049000	0.19019	0.003000	0.03518	-0.043000	0.12043	0.066000	0.16515	-0.910000	0.02820	GAG	ECI2	-	pfam_Crotonase_core		0.413	ECI2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ECI2	HGNC	protein_coding	OTTHUMT00000039716.4	C	NM_006117		4130608	-1	no_errors	ENST00000380118	ensembl	human	known	70_37	missense	SNP	0.016	T
CRACR2A	84766	genome.wustl.edu	37	12	3736711	3736711	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:3736711C>T	ENST00000440314.2	-	17	2296	c.1823G>A	c.(1822-1824)cGg>cAg	p.R608Q		NM_001144958.1	NP_001138430.1	Q9BSW2	EFC4B_HUMAN		52					activation of store-operated calcium channel activity (GO:0032237)|immune system process (GO:0002376)|positive regulation of calcium ion transport (GO:0051928)|store-operated calcium entry (GO:0002115)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|endometrium(3)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|pancreas(2)|prostate(1)|upper_aerodigestive_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(31;0.00287)|COAD - Colon adenocarcinoma(12;0.0264)			GGTGATGCACCGGTACCTGCC	0.617																																																	0													57.0	62.0	61.0					12																	3736711		692	1591	2283	SO:0001583	missense	84766																														ENST00000440314.2:c.1823G>A	12.37:g.3736711C>T	ENSP00000409382:p.Arg608Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1X0|B9EK63	Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_EF_hand_Ca-bd,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,pfscan_EF_HAND_2,tigrfam_Small_GTP-bd_dom	p.R608Q	ENST00000440314.2	37	c.1823	CCDS44803.1	12	.	.	.	.	.	.	.	.	.	.	C	32	5.160174	0.94727	.	.	ENSG00000130038	ENST00000440314	T	0.77098	-1.07	5.4	5.4	0.78164	.	0.056595	0.64402	D	0.000001	D	0.87265	0.6134	.	.	.	0.80722	D	1	D	0.89917	1.0	D	0.69307	0.963	D	0.88672	0.3196	9	0.87932	D	0	.	14.6716	0.68948	0.0:1.0:0.0:0.0	.	608	Q9BSW2-2	.	Q	608	ENSP00000409382:R608Q	ENSP00000409382:R608Q	R	-	2	0	EFCAB4B	3606972	1.000000	0.71417	0.944000	0.38274	0.933000	0.57130	6.846000	0.75399	2.523000	0.85059	0.655000	0.94253	CGG	EFCAB4B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.617	EFCAB4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EFCAB4B	HGNC	protein_coding	OTTHUMT00000398640.2	C			3736711	-1	no_errors	ENST00000440314	ensembl	human	known	70_37	missense	SNP	0.999	T
EGFLAM	133584	genome.wustl.edu	37	5	38427342	38427342	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr5:38427342C>A	ENST00000354891.3	+	14	2388	c.2042C>A	c.(2041-2043)aCc>aAc	p.T681N	EGFLAM_ENST00000397202.2_Missense_Mutation_p.T47N|EGFLAM_ENST00000336740.6_Missense_Mutation_p.T447N|EGFLAM-AS1_ENST00000508986.1_RNA|EGFLAM_ENST00000322350.5_Missense_Mutation_p.T681N	NM_001205301.1	NP_001192230.1	Q63HQ2	EGFLA_HUMAN	EGF-like, fibronectin type III and laminin G domains	681	Laminin G-like 2. {ECO:0000255|PROSITE- ProRule:PRU00122}.				extracellular matrix organization (GO:0030198)|peptide cross-linking via chondroitin 4-sulfate glycosaminoglycan (GO:0019800)|positive regulation of cell-substrate adhesion (GO:0010811)	basement membrane (GO:0005604)|cell junction (GO:0030054)|interstitial matrix (GO:0005614)|synapse (GO:0045202)	glycosaminoglycan binding (GO:0005539)			NS(1)|breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(43)|ovary(1)|pancreas(3)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	85	all_lung(31;0.000385)					GGCTCTGGGACCGGTGTCCTC	0.507																																					Colon(62;485 1295 3347 17454)												0													147.0	151.0	149.0					5																	38427342		2203	4300	6503	SO:0001583	missense	133584			AK097549	CCDS3924.1, CCDS3925.1, CCDS47199.1, CCDS56363.1	5p13.2-p13.1	2014-04-03			ENSG00000164318	ENSG00000164318		"""Fibronectin type III domain containing"""	26810	protein-coding gene	gene with protein product	"""pikachurin"", ""agrin-like"""					18641643, 20078962, 22760553	Standard	NM_182801		Approved	FLJ39155, AGRINL, AGRNL, PIKA	uc003jlc.2	Q63HQ2	OTTHUMG00000131139	ENST00000354891.3:c.2042C>A	5.37:g.38427342C>A	ENSP00000346964:p.Thr681Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6D7|Q5U643|Q6P3V1|Q8N124|Q8N197|Q8N7Y0|Q8N8N5|Q8NAL2	Missense_Mutation	SNP	pfam_Laminin_G,pfam_Fibronectin_type3,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Fibronectin_type3,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Fibronectin_type3,pfscan_Laminin_G	p.T681N	ENST00000354891.3	37	c.2042	CCDS56363.1	5	.	.	.	.	.	.	.	.	.	.	C	19.45	3.830339	0.71258	.	.	ENSG00000164318	ENST00000354891;ENST00000322350;ENST00000336740;ENST00000397202;ENST00000339580	T;T;T;T	0.80033	-1.1;-1.1;-1.1;-1.33	5.44	5.44	0.79542	Concanavalin A-like lectin/glucanase (1);Concanavalin A-like lectin/glucanase, subgroup (1);Laminin G domain (2);Laminin G, subdomain 2 (1);	0.279348	0.40222	N	0.001142	D	0.89329	0.6684	M	0.83118	2.625	0.80722	D	1	D;D;P	0.55800	0.967;0.973;0.93	P;P;P	0.58266	0.681;0.836;0.721	D	0.89918	0.4057	10	0.54805	T	0.06	.	19.2577	0.93952	0.0:1.0:0.0:0.0	.	447;681;681	Q63HQ2-4;Q63HQ2;Q63HQ2-2	.;EGFLA_HUMAN;.	N	681;681;447;47;447	ENSP00000346964:T681N;ENSP00000313084:T681N;ENSP00000337607:T447N;ENSP00000380385:T47N	ENSP00000313084:T681N	T	+	2	0	EGFLAM	38463099	1.000000	0.71417	0.654000	0.29608	0.993000	0.82548	4.394000	0.59671	2.555000	0.86185	0.561000	0.74099	ACC	EGFLAM	-	pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,pfscan_Laminin_G		0.507	EGFLAM-004	KNOWN	basic|CCDS	protein_coding	EGFLAM	HGNC	protein_coding	OTTHUMT00000367323.1	C	NM_152403		38427342	+1	no_errors	ENST00000354891	ensembl	human	known	70_37	missense	SNP	0.990	A
ZNF606	80095	genome.wustl.edu	37	19	58513717	58513717	+	Intron	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:58513717C>G	ENST00000341164.4	-	1	570				ZNF606_ENST00000536132.1_Intron|ZNF606_ENST00000547121.1_Intron|ZNF606_ENST00000547828.1_Intron|CTD-2368P22.1_ENST00000550135.1_Nonsense_Mutation_p.S80*|ZNF606_ENST00000546715.1_Intron|ZNF606_ENST00000552579.1_Intron	NM_025027.3	NP_079303.2	Q8WXB4	ZN606_HUMAN	zinc finger protein 606						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;5.46e-05)|all_neural(62;0.0182)|Breast(46;0.0389)|Ovarian(87;0.0443)|Renal(1328;0.157)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.0168)		ATTTCCTCCTCAAGACCGACG	0.637																																																	0																																										SO:0001627	intron_variant	0			AB058755	CCDS12968.1	19q13.43	2013-01-08			ENSG00000166704	ENSG00000166704		"""Zinc fingers, C2H2-type"", ""-"""	25879	protein-coding gene	gene with protein product		613905		ZNF328		11347906	Standard	XM_005259276		Approved	FLJ14260, KIAA1852	uc002qqw.3	Q8WXB4	OTTHUMG00000169804	ENST00000341164.4:c.50+430G>C	19.37:g.58513717C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAN2|Q8NE04|Q96JH5	Nonsense_Mutation	SNP	NULL	p.S80*	ENST00000341164.4	37	c.239	CCDS12968.1	19	.	.	.	.	.	.	.	.	.	.	C	19.56	3.851094	0.71719	.	.	ENSG00000176593	ENST00000550135	.	.	.	2.85	2.85	0.33270	.	.	.	.	.	.	.	.	.	.	.	0.34755	D	0.73216	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	9.811	0.40824	0.0:1.0:0.0:0.0	.	.	.	.	X	80	.	ENSP00000449124:S80X	S	+	2	0	CTD-2368P22.1	63205529	0.001000	0.12720	0.002000	0.10522	0.060000	0.15804	0.861000	0.27885	1.517000	0.48917	0.462000	0.41574	TCA	CTD-2368P22.1	-	NULL		0.637	ZNF606-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000176593	Clone_based_vega_gene	protein_coding	OTTHUMT00000405961.1	C	NM_025027		58513717	+1	no_errors	ENST00000550135	ensembl	human	putative	70_37	nonsense	SNP	0.003	G
MT-CO1	4512	genome.wustl.edu	37	M	5703	5703	+	5'Flank	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chrM:5703G>A	ENST00000361624.2	+	0	0				MT-TL1_ENST00000386347.1_RNA|MT-TY_ENST00000387409.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-TQ_ENST00000387372.1_RNA|MT-TD_ENST00000387419.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TI_ENST00000387365.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-RNR2_ENST00000387347.2_RNA|MT-ATP6_ENST00000361899.2_5'Flank|MT-TK_ENST00000387421.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						TTAACAGCTAAGCACCCTAAT	0.473																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.5703G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			J01415.9	-	-		0.473	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000210135	Clone_based_ensembl_gene	protein_coding		G	YP_003024028		5703	-1	no_errors	ENST00000387400	ensembl	human	novel	70_37	rna	SNP	NULL	A
MT-CO3	4514	genome.wustl.edu	37	M	7525	7525	+	5'Flank	SNP	T	T	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chrM:7525T>C	ENST00000362079.2	+	0	0				MT-TY_ENST00000387409.1_RNA|MT-TW_ENST00000387382.1_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TS1_ENST00000387416.2_RNA|MT-ND4L_ENST00000361335.1_5'Flank|MT-TD_ENST00000387419.1_RNA|MT-ATP8_ENST00000361851.1_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-ND3_ENST00000361227.2_5'Flank|MT-TG_ENST00000387429.1_RNA|MT-TR_ENST00000387439.1_RNA|MT-CO2_ENST00000361739.1_5'Flank|MT-ATP6_ENST00000361899.2_5'Flank|MT-TK_ENST00000387421.1_RNA			P00414	COX3_HUMAN	mitochondrially encoded cytochrome c oxidase III						aerobic electron transport chain (GO:0019646)|cellular metabolic process (GO:0044237)|respiratory chain complex IV assembly (GO:0008535)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)			breast(1)|endometrium(10)|kidney(14)|lung(1)|urinary_tract(1)	27						cAAAAAGGTATTAGAAAAACC	0.383																																																	0																																										SO:0001631	upstream_gene_variant	0					mitochondria	2012-11-16	2005-02-15	2005-02-16	ENSG00000198938	ENSG00000198938		"""Mitochondrial respiratory chain complex / Complex IV"""	7422	protein-coding gene	gene with protein product		516050	"""cytochrome c oxidase III"""	MTCO3			Standard			Approved	COX3, COIII, CO3		P00414			M.37:g.7525T>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14Y83	RNA	SNP	-	NULL	ENST00000362079.2	37	NULL		MT																																																																																			J01415.13	-	-		0.383	MT-CO3-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000210154	Clone_based_ensembl_gene	protein_coding		T	YP_003024032		7525	+1	no_errors	ENST00000387419	ensembl	human	novel	70_37	rna	SNP	NULL	C
BACE2	25825	genome.wustl.edu	37	21	42554159	42554159	+	Intron	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr21:42554159C>T	ENST00000330333.6	+	1	775				PLAC4_ENST00000536486.1_RNA|PLAC4_ENST00000414699.1_RNA|BACE2_ENST00000347667.5_Intron|BACE2-IT1_ENST00000433378.1_RNA|PLAC4_ENST00000430327.2_RNA|PLAC4_ENST00000440221.2_RNA|BACE2_ENST00000328735.6_Intron	NM_012105.3	NP_036237.2	Q9Y5Z0	BACE2_HUMAN	beta-site APP-cleaving enzyme 2						membrane protein ectodomain proteolysis (GO:0006509)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|peptide hormone processing (GO:0016486)|proteolysis (GO:0006508)	endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	aspartic-type endopeptidase activity (GO:0004190)			endometrium(2)|large_intestine(3)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	14		Prostate(19;1.57e-07)|all_epithelial(19;0.0251)				ggttgtagtgcccttcctttg	0.428																																																	0																																										SO:0001627	intron_variant	0			AF117892	CCDS13668.1, CCDS13669.1, CCDS13670.1	21q22.3	2011-08-11			ENSG00000182240	ENSG00000182240			934	protein-coding gene	gene with protein product		605668		AEPLC		10965118, 10830953	Standard	NM_138991		Approved	CEAP1, DRAP, ALP56	uc002yyw.3	Q9Y5Z0	OTTHUMG00000086742	ENST00000330333.6:c.312+13657C>T	21.37:g.42554159C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7P1|Q5DIH8|Q8N2D4|Q9H2V8|Q9NZL1|Q9NZL2|Q9UJT6	RNA	SNP	-	NULL	ENST00000330333.6	37	NULL	CCDS13668.1	21																																																																																			AL773572.7	-	-		0.428	BACE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000225745	Clone_based_vega_gene	protein_coding	OTTHUMT00000195056.1	C			42554159	-1	no_errors	ENST00000414699	ensembl	human	known	70_37	rna	SNP	0.140	T
CTD-2090I13.1	0	genome.wustl.edu	37	1	227618414	227618414	+	lincRNA	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:227618414G>A	ENST00000445817.1	+	0	1649																											CACTGAGGATGAGGTGGAACG	0.483																																																	0																																												0																															1.37:g.227618414G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445817.1	37	NULL		1																																																																																			CTD-2090I13.1	-	-		0.483	CTD-2090I13.1-001	KNOWN	basic	lincRNA	ENSG00000234277	Clone_based_vega_gene	lincRNA	OTTHUMT00000091688.1	G			227618414	+1	no_errors	ENST00000445817	ensembl	human	known	70_37	rna	SNP	1.000	A
CTD-2090I13.1	0	genome.wustl.edu	37	1	227618564	227618564	+	lincRNA	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:227618564G>C	ENST00000445817.1	+	0	1799																											TGGAGTGATTGAAGAAGTTTC	0.542																																																	0																																												0																															1.37:g.227618564G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445817.1	37	NULL		1																																																																																			CTD-2090I13.1	-	-		0.542	CTD-2090I13.1-001	KNOWN	basic	lincRNA	ENSG00000234277	Clone_based_vega_gene	lincRNA	OTTHUMT00000091688.1	G			227618564	+1	no_errors	ENST00000445817	ensembl	human	known	70_37	rna	SNP	1.000	C
POTEG	404785	genome.wustl.edu	37	14	19563232	19563232	+	Intron	SNP	T	T	C	rs572050981	byFrequency	TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr14:19563232T>C	ENST00000409832.3	+	5	969				RNU6-1239P_ENST00000391310.1_RNA|CTD-2311B13.5_ENST00000548748.1_lincRNA	NM_001005356.2	NP_001005356.1	Q6S5H5	POTEG_HUMAN	POTE ankyrin domain family, member G											cervix(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(31)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	47						CCCTTCCTTTTAACCTTGGTG	0.368													C|||	234	0.0467252	0.0371	0.0375	5008	,	,		9293	0.0575		0.0646	False		,,,				2504	0.0368																0																																										SO:0001627	intron_variant	0				CCDS73610.1	14q11.2	2013-01-10	2008-11-26	2008-11-26	ENSG00000222036	ENSG00000222036		"""POTE ankyrin domain containing"", ""Ankyrin repeat domain containing"""	33896	protein-coding gene	gene with protein product	"""cancer/testis antigen family 104, member 4"""	608916	"""ANKRD26-like family C, member 2"""	A26C2			Standard	NR_027480		Approved	POTE14, POTE-14, POTE14alpha, CT104.4	uc001vuz.1	Q6S5H5	OTTHUMG00000170340	ENST00000409832.3:c.918-172T>C	14.37:g.19563232T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L153|A6NMI9|Q6S5H6|Q6S8J2	RNA	SNP	-	NULL	ENST00000409832.3	37	NULL	CCDS32018.1	14																																																																																			CTD-2311B13.5	-	-		0.368	POTEG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000258252	Clone_based_vega_gene	protein_coding	OTTHUMT00000408579.1	T	NM_001005356		19563232	-1	no_errors	ENST00000548748	ensembl	human	known	70_37	rna	SNP	0.050	C
SUMO1	7341	genome.wustl.edu	37	2	203104351	203104351	+	5'Flank	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:203104351G>C	ENST00000392246.2	-	0	0				SUMO1_ENST00000409205.1_5'Flank|SUMO1_ENST00000392244.3_5'Flank|SUMO1_ENST00000409712.1_5'Flank|SUMO1_ENST00000392245.1_5'Flank|SUMO1_ENST00000409368.1_5'Flank|AC079354.2_ENST00000594829.1_Missense_Mutation_p.Q20H|SUMO1_ENST00000409498.2_5'Flank|SUMO1_ENST00000409181.1_5'Flank	NM_003352.4	NP_003343.1	P63165	SUMO1_HUMAN	small ubiquitin-like modifier 1						cellular protein metabolic process (GO:0044267)|cytokine-mediated signaling pathway (GO:0019221)|DNA repair (GO:0006281)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of DNA binding (GO:0043392)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription, DNA-templated (GO:0045892)|palate development (GO:0060021)|PML body organization (GO:0030578)|positive regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032436)|positive regulation of protein complex assembly (GO:0031334)|post-translational protein modification (GO:0043687)|protein localization to nuclear pore (GO:0090204)|protein sumoylation (GO:0016925)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of protein localization (GO:0032880)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|nuclear membrane (GO:0031965)|nuclear pore (GO:0005643)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PML body (GO:0016605)|synapse (GO:0045202)	poly(A) RNA binding (GO:0044822)|SUMO ligase activity (GO:0019789)|ubiquitin protein ligase binding (GO:0031625)										ATCTGGCTCAGAACTATGACA	0.478																																																	0																																										SO:0001631	upstream_gene_variant	0			U38784	CCDS2352.1, CCDS46493.1	2q33	2013-06-05	2013-06-05	2004-05-19	ENSG00000116030	ENSG00000116030			12502	protein-coding gene	gene with protein product		601912	"""ubiquitin-like 1 (sentrin)"", ""SMT3 suppressor of mif two 3 homolog 1 (yeast)"", ""SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae)"""	UBL1		8812453, 8906799	Standard	NM_003352		Approved	PIC1, GMP1, SMT3C, SUMO-1, SMT3H3, OFC10	uc002uyz.1	P63165	OTTHUMG00000132839		2.37:g.203104351G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MUS8|B2R4I5|P55856|Q6FGG0|Q6NZ62|Q93068	Missense_Mutation	SNP	NULL	p.Q20H	ENST00000392246.2	37	c.60	CCDS2352.1	2																																																																																			AC079354.2	-	NULL		0.478	SUMO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000267889	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000256312.2	G	NM_003352		203104351	+1	no_errors	ENST00000594829	ensembl	human	known	70_37	missense	SNP	0.995	C
ANKRD18A	253650	genome.wustl.edu	37	9	38620536	38620536	+	5'UTR	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:38620536C>T	ENST00000399703.5	-	0	121				FAM201A_ENST00000471864.1_RNA|FAM201A_ENST00000484285.2_RNA|FAM201A_ENST00000377680.3_RNA	NM_147195.2	NP_671728.2	Q8IVF6	AN18A_HUMAN	ankyrin repeat domain 18A											NS(1)|breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|lung(3)|prostate(1)|skin(2)|stomach(1)	16						CCGAGTGAGCCCAGCTAAGCC	0.637																																																	0																																										SO:0001623	5_prime_UTR_variant	158228			AB095935	CCDS55311.1	9p13.1	2013-01-10			ENSG00000180071	ENSG00000180071		"""Ankyrin repeat domain containing"""	23643	protein-coding gene	gene with protein product							Standard	NM_147195		Approved	KIAA2015, FLJ35740	uc004abg.4	Q8IVF6	OTTHUMG00000019950	ENST00000399703.5:c.-254G>A	9.37:g.38620536C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD11|A8MVU5|Q5SY86|Q7Z468|Q8NA88	RNA	SNP	-	NULL	ENST00000399703.5	37	NULL	CCDS55311.1	9																																																																																			FAM201A	-	-		0.637	ANKRD18A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM201A	HGNC	protein_coding	OTTHUMT00000052506.3	C			38620536	+1	no_errors	ENST00000471864	ensembl	human	putative	70_37	rna	SNP	0.003	T
EXD3	54932	genome.wustl.edu	37	9	140260773	140260773	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:140260773C>G	ENST00000479452.1	-	8	785	c.697G>C	c.(697-699)Gag>Cag	p.E233Q	EXD3_ENST00000340951.4_Intron|EXD3_ENST00000475006.1_5'Flank|EXD3_ENST00000342129.4_Intron			Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3	0										NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						CCCAGCCGCTCCTCTCCAGAG	0.582																																																	0																																										SO:0001583	missense	54932				CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000479452.1:c.697G>C	9.37:g.140260773C>G	ENSP00000431859:p.Glu233Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P1M1|Q8IXT8	Missense_Mutation	SNP	NULL	p.E233Q	ENST00000479452.1	37	c.697		9	.	.	.	.	.	.	.	.	.	.	C	15.08	2.726389	0.48833	.	.	ENSG00000187609	ENST00000479452	T	0.36520	1.25	2.54	-5.06	0.02946	.	.	.	.	.	T	0.21801	0.0525	.	.	.	0.09310	N	1	B	0.10296	0.003	B	0.11329	0.006	T	0.28808	-1.0032	8	0.87932	D	0	.	3.9866	0.09519	0.0:0.3537:0.3292:0.3171	.	233	Q8N9H8-4	.	Q	233	ENSP00000431859:E233Q	ENSP00000431859:E233Q	E	-	1	0	EXD3	139380594	0.000000	0.05858	0.000000	0.03702	0.361000	0.29550	-1.120000	0.03273	-1.313000	0.02303	0.313000	0.20887	GAG	EXD3	-	NULL		0.582	EXD3-005	PUTATIVE	basic	protein_coding	EXD3	HGNC	protein_coding	OTTHUMT00000343186.2	C	NM_017820		140260773	-1	no_errors	ENST00000479452	ensembl	human	putative	70_37	missense	SNP	0.000	G
FAM96B	51647	genome.wustl.edu	37	16	66967633	66967633	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:66967633G>T	ENST00000422424.2	-	3	267	c.232C>A	c.(232-234)Ccc>Acc	p.P78T	CES2_ENST00000417689.1_5'Flank|CES2_ENST00000317091.4_5'Flank	NM_016062.3	NP_057146.1	Q9Y3D0	MIP18_HUMAN	family with sequence similarity 96, member B	78					chromosome segregation (GO:0007059)|small molecule metabolic process (GO:0044281)	CIA complex (GO:0097361)|cytoplasm (GO:0005737)|MMXD complex (GO:0071817)|nucleus (GO:0005634)|spindle (GO:0005819)				kidney(1)	1		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0862)|Epithelial(162;0.198)		GTACTCTCGGGGTCGCTAACC	0.527																																																	0													33.0	40.0	38.0					16																	66967633		2114	4212	6326	SO:0001583	missense	51647				CCDS45506.1	16q22.1	2014-01-16			ENSG00000166595	ENSG00000166595			24261	protein-coding gene	gene with protein product		614778				11042152, 10810093, 23891004	Standard	NM_016062		Approved	CGI-128	uc021tjy.2	Q9Y3D0	OTTHUMG00000175408	ENST00000422424.2:c.232C>A	16.37:g.66967633G>T	ENSP00000387471:p.Pro78Thr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DUF59	p.P78T	ENST00000422424.2	37	c.232	CCDS45506.1	16	.	.	.	.	.	.	.	.	.	.	G	15.25	2.778308	0.49786	.	.	ENSG00000166595	ENST00000422424	.	.	.	4.94	2.84	0.33178	Domain of unknown function DUF59 (1);	0.679967	0.14182	N	0.335956	T	0.13030	0.0316	N	0.03608	-0.345	0.26828	N	0.968632	B	0.02656	0.0	B	0.09377	0.004	T	0.20273	-1.0280	9	0.17832	T	0.49	-12.5081	3.1966	0.06635	0.0949:0.2576:0.4833:0.1642	.	78	Q9Y3D0	MIP18_HUMAN	T	78	.	ENSP00000387471:P78T	P	-	1	0	FAM96B	65525134	0.923000	0.31300	0.674000	0.29902	0.964000	0.63967	2.187000	0.42602	1.301000	0.44836	0.563000	0.77884	CCC	FAM96B	-	pfam_DUF59		0.527	FAM96B-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	FAM96B	HGNC	protein_coding	OTTHUMT00000429890.1	G	NM_016062		66967633	-1	no_errors	ENST00000422424	ensembl	human	known	70_37	missense	SNP	0.888	T
FAR2	55711	genome.wustl.edu	37	12	29449988	29449988	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:29449988C>T	ENST00000536681.3	+	4	646	c.400C>T	c.(400-402)Cag>Tag	p.Q134*	FAR2_ENST00000182377.4_Nonsense_Mutation_p.Q134*|FAR2_ENST00000547116.1_Nonsense_Mutation_p.Q37*|RP11-996F15.2_ENST00000553105.1_RNA	NM_001271783.1|NM_001271784.1	NP_001258712.1|NP_001258713.1	Q96K12	FACR2_HUMAN	fatty acyl CoA reductase 2	134					cellular lipid metabolic process (GO:0044255)|ether lipid biosynthetic process (GO:0008611)|long-chain fatty-acyl-CoA metabolic process (GO:0035336)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|peroxisomal matrix (GO:0005782)|peroxisome (GO:0005777)	fatty-acyl-CoA reductase (alcohol-forming) activity (GO:0080019)|long-chain-fatty-acyl-CoA reductase activity (GO:0050062)			central_nervous_system(1)|endometrium(3)|large_intestine(6)|liver(2)|lung(15)|prostate(1)|stomach(1)	29						TGCCACCCGGCAGCTCTTGCT	0.418																																																	0													143.0	147.0	145.0					12																	29449988		2203	4300	6503	SO:0001587	stop_gained	55711			AL136843	CCDS8717.1, CCDS61084.1	12p11.23	2013-07-30	2008-06-06	2008-06-06	ENSG00000064763	ENSG00000064763	1.2.1.-	"""Short chain dehydrogenase/reductase superfamily / Atypical members"""	25531	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 10E, member 2"""		"""male sterility domain containing 1"""	MLSTD1		15220348, 15220349, 19027726	Standard	NM_001271783		Approved	FLJ10462, SDR10E2	uc001ris.5	Q96K12	OTTHUMG00000169320	ENST00000536681.3:c.400C>T	12.37:g.29449988C>T	ENSP00000443291:p.Gln134*	Somatic		WXS	Illumina HiSeq	Phase_IV	F8VV73|Q9H0D5|Q9NVW8	Nonsense_Mutation	SNP	pfam_Male_sterile_NAD-bd,pfam_FAR,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_Polysac_CapD-like	p.Q134*	ENST00000536681.3	37	c.400	CCDS8717.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.236819	0.95240	.	.	ENSG00000064763	ENST00000551451;ENST00000536681;ENST00000182377;ENST00000547116	.	.	.	5.44	4.53	0.55603	.	0.198614	0.45126	D	0.000384	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.20046	T	0.44	-5.2425	12.9811	0.58564	0.18:0.82:0.0:0.0	.	.	.	.	X	37;134;134;37	.	ENSP00000182377:Q134X	Q	+	1	0	FAR2	29341255	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.406000	0.34646	1.219000	0.43474	0.585000	0.79938	CAG	FAR2	-	pfam_Male_sterile_NAD-bd,pfam_Epimerase_deHydtase,pfam_3Beta_OHSteriod_DH/Estase,pfam_Polysac_CapD-like		0.418	FAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAR2	HGNC	protein_coding	OTTHUMT00000403479.2	C	NM_018099		29449988	+1	no_errors	ENST00000182377	ensembl	human	known	70_37	nonsense	SNP	1.000	T
FCGR2A	2212	genome.wustl.edu	37	1	161475785	161475785	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:161475785G>T	ENST00000271450.6	+	2	132	c.94G>T	c.(94-96)Gac>Tac	p.D32Y	FCGR2A_ENST00000367972.4_Missense_Mutation_p.D32Y	NM_001136219.1|NM_021642.3	NP_001129691.1|NP_067674.2	P12318	FCG2A_HUMAN	Fc fragment of IgG, low affinity IIa, receptor (CD32)	32					Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				autonomic_ganglia(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(11)|ovary(1)	19	all_cancers(52;4.89e-16)|all_hematologic(112;0.0207)		BRCA - Breast invasive adenocarcinoma(70;0.00376)		Abciximab(DB00054)|Adalimumab(DB00051)|Alefacept(DB00092)|Alemtuzumab(DB00087)|Basiliximab(DB00074)|Bevacizumab(DB00112)|Cetuximab(DB00002)|Daclizumab(DB00111)|Efalizumab(DB00095)|Etanercept(DB00005)|Gemtuzumab ozogamicin(DB00056)|Ibritumomab(DB00078)|Intravenous Immunoglobulin(DB00028)|Muromonab(DB00075)|Natalizumab(DB00108)|Palivizumab(DB00110)|Rituximab(DB00073)|Tositumomab(DB00081)|Trastuzumab(DB00072)	AGCTTCTGCAGACAGTCAAGC	0.498																																																	0													416.0	399.0	405.0					1																	161475785		2203	4300	6503	SO:0001583	missense	2212			J03619	CCDS30922.1, CCDS44264.1	1q23	2013-01-11	2005-02-02		ENSG00000143226	ENSG00000143226		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	3616	protein-coding gene	gene with protein product	"""Immunoglobulin G Fc receptor II"""	146790	"""Fc fragment of IgG, low affinity IIa, receptor for (CD32)"""	FCG2, FCGR2A1, FCGR2		2139735	Standard	NM_021642		Approved	CD32, CD32A, IGFR2, CDw32	uc001gan.3	P12318	OTTHUMG00000034469	ENST00000271450.6:c.94G>T	1.37:g.161475785G>T	ENSP00000271450:p.Asp32Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUN1|Q8WW64	Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.D32Y	ENST00000271450.6	37	c.94	CCDS44264.1	1	.	.	.	.	.	.	.	.	.	.	G	14.06	2.423323	0.43020	.	.	ENSG00000143226	ENST00000367972;ENST00000271450	T;T	0.01854	4.6;4.63	4.44	2.5	0.30297	.	3.150310	0.01428	N	0.014634	T	0.01765	0.0056	N	0.08118	0	0.21256	N	0.999746	D;D	0.61697	0.982;0.99	P;D	0.63597	0.827;0.916	T	0.55211	-0.8176	9	0.51188	T	0.08	.	11.1362	0.48375	0.0:0.3614:0.6386:0.0	.	32;32	P12318;P12318-2	FCG2A_HUMAN;.	Y	32	ENSP00000356949:D32Y;ENSP00000271450:D32Y	ENSP00000271450:D32Y	D	+	1	0	FCGR2A	159742409	0.002000	0.14202	0.001000	0.08648	0.006000	0.05464	1.242000	0.32755	0.409000	0.25649	0.650000	0.86243	GAC	FCGR2A	-	NULL		0.498	FCGR2A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FCGR2A	HGNC	protein_coding	OTTHUMT00000083318.3	G	NM_021642		161475785	+1	no_errors	ENST00000271450	ensembl	human	known	70_37	missense	SNP	0.003	T
FGD5	152273	genome.wustl.edu	37	3	14862555	14862555	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:14862555G>A	ENST00000285046.5	+	1	2087	c.1977G>A	c.(1975-1977)ctG>ctA	p.L659L	FGD5_ENST00000543601.1_Silent_p.L418L	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	659					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						TCCTGGCACTGACGTTTAAGA	0.507																																																	0													83.0	82.0	82.0					3																	14862555		1979	4167	6146	SO:0001819	synonymous_variant	152273			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.1977G>A	3.37:g.14862555G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.L659	ENST00000285046.5	37	c.1977	CCDS46767.1	3																																																																																			FGD5	-	NULL		0.507	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	G	NM_152536		14862555	+1	no_errors	ENST00000285046	ensembl	human	known	70_37	silent	SNP	1.000	A
FGD5	152273	genome.wustl.edu	37	3	14862755	14862755	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:14862755G>C	ENST00000285046.5	+	1	2287	c.2177G>C	c.(2176-2178)aGa>aCa	p.R726T	FGD5_ENST00000543601.1_Missense_Mutation_p.R485T	NM_152536.3	NP_689749.3	Q6ZNL6	FGD5_HUMAN	FYVE, RhoGEF and PH domain containing 5	726					actin cytoskeleton organization (GO:0030036)|cytoskeleton organization (GO:0007010)|filopodium assembly (GO:0046847)|positive regulation of GTPase activity (GO:0043547)|regulation of Cdc42 GTPase activity (GO:0043088)|regulation of cell shape (GO:0008360)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	guanyl-nucleotide exchange factor activity (GO:0005085)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|small GTPase binding (GO:0031267)			NS(2)|breast(2)|endometrium(3)|kidney(5)|large_intestine(10)|lung(25)|ovary(3)|pancreas(1)|prostate(2)|urinary_tract(1)	54						ATCTTTTATAGAGATGGCAAG	0.587																																																	0													53.0	56.0	55.0					3																	14862755		1889	4107	5996	SO:0001583	missense	152273			AK097276	CCDS46767.1	3p25.1	2013-01-10			ENSG00000154783	ENSG00000154783		"""Zinc fingers, FYVE domain containing"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	19117	protein-coding gene	gene with protein product		614788					Standard	NM_152536		Approved	ZFYVE23, FLJ39957, FLJ00274	uc003bzc.3	Q6ZNL6	OTTHUMG00000155556	ENST00000285046.5:c.2177G>C	3.37:g.14862755G>C	ENSP00000285046:p.Arg726Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KVQ3|Q6MZY1|Q7Z303|Q8IYP3|Q8N861|Q8N8G4	Missense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Znf_FYVE,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Znf_FYVE,pfscan_Pleckstrin_homology,pfscan_Znf_FYVE-rel,pfscan_DH-domain	p.R726T	ENST00000285046.5	37	c.2177	CCDS46767.1	3	.	.	.	.	.	.	.	.	.	.	G	14.73	2.622472	0.46840	.	.	ENSG00000154783	ENST00000285046;ENST00000543601	T;T	0.79653	-1.29;-1.16	5.03	3.21	0.36854	.	0.117427	0.41194	D	0.000923	T	0.72779	0.3503	L	0.54323	1.7	0.09310	N	1	P;D	0.54772	0.932;0.968	B;B	0.42851	0.321;0.4	T	0.67791	-0.5579	10	0.62326	D	0.03	-24.3096	5.1191	0.14851	0.4111:0.0:0.5889:0.0	.	485;726	B7ZM68;Q6ZNL6	.;FGD5_HUMAN	T	726;485	ENSP00000285046:R726T;ENSP00000445949:R485T	ENSP00000285046:R726T	R	+	2	0	FGD5	14837759	1.000000	0.71417	0.088000	0.20740	0.985000	0.73830	3.586000	0.53950	1.250000	0.43966	0.591000	0.81541	AGA	FGD5	-	NULL		0.587	FGD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGD5	HGNC	protein_coding	OTTHUMT00000340628.1	G	NM_152536		14862755	+1	no_errors	ENST00000285046	ensembl	human	known	70_37	missense	SNP	0.192	C
FRMD6	122786	genome.wustl.edu	37	14	52194513	52194513	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr14:52194513C>T	ENST00000344768.5	+	14	1831	c.1635C>T	c.(1633-1635)ctC>ctT	p.L545L	FRMD6_ENST00000395718.2_Silent_p.L537L|FRMD6_ENST00000554167.1_Silent_p.L468L|FRMD6_ENST00000356218.4_Silent_p.L537L|FRMD6_ENST00000553556.1_Silent_p.L187L			Q96NE9	FRMD6_HUMAN	FERM domain containing 6	545					apical constriction (GO:0003383)|cellular protein localization (GO:0034613)|regulation of actin filament-based process (GO:0032970)	apical junction complex (GO:0043296)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				breast(2)|central_nervous_system(1)|endometrium(7)|large_intestine(7)|lung(11)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	34	all_epithelial(31;0.0163)|Breast(41;0.089)					GCTTGAGCCTCGATGACATCA	0.453																																																	0													162.0	138.0	146.0					14																	52194513		2203	4300	6503	SO:0001819	synonymous_variant	122786			BI465118	CCDS9704.1, CCDS58318.1, CCDS58319.1	14q22.1	2011-06-22	2005-07-20	2005-07-20	ENSG00000139926	ENSG00000139926			19839	protein-coding gene	gene with protein product	"""expanded homolog"""	614555	"""chromosome 14 open reading frame 31"""	C14orf31			Standard	NM_152330		Approved	MGC17921, willin, EX1	uc001wzd.3	Q96NE9	OTTHUMG00000140294	ENST00000344768.5:c.1635C>T	14.37:g.52194513C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSB9|Q5HYF2|Q8N2X1|Q8WUH7	Silent	SNP	pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_FERM_central,smart_Band_41_domain,pfscan_FERM_domain	p.L545	ENST00000344768.5	37	c.1635	CCDS58318.1	14																																																																																			FRMD6	-	NULL		0.453	FRMD6-002	KNOWN	basic|CCDS	protein_coding	FRMD6	HGNC	protein_coding	OTTHUMT00000276881.1	C	NM_152330		52194513	+1	no_errors	ENST00000344768	ensembl	human	known	70_37	silent	SNP	0.756	T
FXR2	9513	genome.wustl.edu	37	17	7495874	7495874	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr17:7495874G>A	ENST00000250113.7	-	15	2107	c.1773C>T	c.(1771-1773)cgC>cgT	p.R591R	SOX15_ENST00000250055.2_5'Flank|SOX15_ENST00000538513.2_5'Flank|MPDU1_ENST00000423172.2_3'UTR|FXR2_ENST00000573057.1_5'Flank|SOX15_ENST00000570788.1_5'Flank	NM_004860.3	NP_004851.2	P51116	FXR2_HUMAN	fragile X mental retardation, autosomal homolog 2	591	Poly-Arg.		R -> P (in dbSNP:rs36013555).			cytoplasm (GO:0005737)|cytosolic large ribosomal subunit (GO:0022625)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			NS(1)|breast(2)|endometrium(6)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)	26				READ - Rectum adenocarcinoma(115;0.17)		CACGGTTACGGCGGCGGCGGC	0.542																																																	0													147.0	153.0	151.0					17																	7495874		2023	4164	6187	SO:0001819	synonymous_variant	9513			U31501	CCDS45604.1	17p13.3	2014-09-17				ENSG00000129245			4024	protein-coding gene	gene with protein product		605339		FMR1L2		7489725, 9259278	Standard	NM_004860		Approved		uc002gia.2	P51116		ENST00000250113.7:c.1773C>T	17.37:g.7495874G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9M2|D3DTQ1|Q86V09|Q8WUM2	Silent	SNP	pfam_Frag_X_MRP_fam,pfam_KH_dom_type_1,pfam_Agenet-like_dom,smart_KH_dom,pfscan_KH_dom_type_1	p.R591	ENST00000250113.7	37	c.1773	CCDS45604.1	17																																																																																			FXR2	-	NULL		0.542	FXR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FXR2	HGNC	protein_coding	OTTHUMT00000441084.1	G			7495874	-1	no_errors	ENST00000250113	ensembl	human	known	70_37	silent	SNP	1.000	A
GBAS	2631	genome.wustl.edu	37	7	56066732	56066732	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr7:56066732C>G	ENST00000322090.3	+	10	857	c.828C>G	c.(826-828)atC>atG	p.I276M	GBAS_ENST00000446778.1_Missense_Mutation_p.I237M	NM_001483.2	NP_001474.1	O75323	NIPS2_HUMAN	glioblastoma amplified sequence	276					ATP biosynthetic process (GO:0006754)|negative regulation of ATP citrate synthase activity (GO:2000984)|oxidative phosphorylation (GO:0006119)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|mitochondrion (GO:0005739)				breast(1)|central_nervous_system(1)|large_intestine(1)|lung(2)	5	Breast(14;0.214)		Lung(13;0.00024)|LUSC - Lung squamous cell carcinoma(13;0.00099)			AATCCAGAATCATGATCCCAC	0.368																																																	0													146.0	130.0	135.0					7																	56066732		2203	4300	6503	SO:0001583	missense	2631			AF029786	CCDS5521.1, CCDS56488.1	7p12	2014-03-11			ENSG00000146729	ENSG00000146729			4179	protein-coding gene	gene with protein product		603004				9615231, 9661659, 20888800	Standard	NM_001483		Approved	NIPSNAP2	uc003tre.2	O75323	OTTHUMG00000022932	ENST00000322090.3:c.828C>G	7.37:g.56066732C>G	ENSP00000313050:p.Ile276Met	Somatic		WXS	Illumina HiSeq	Phase_IV	C9IYJ3|O43801|Q53X96	Missense_Mutation	SNP	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel	p.I276M	ENST00000322090.3	37	c.828	CCDS5521.1	7	.	.	.	.	.	.	.	.	.	.	C	17.05	3.288986	0.59976	.	.	ENSG00000146729	ENST00000322090;ENST00000446778	T;T	0.58940	0.3;0.3	5.83	4.02	0.46733	Dimeric alpha-beta barrel (1);	0.000000	0.85682	D	0.000000	T	0.77758	0.4178	M	0.92459	3.31	0.54753	D	0.999986	D;D	0.76494	0.999;0.987	D;P	0.77004	0.989;0.908	T	0.78140	-0.2320	10	0.87932	D	0	-16.2734	6.6411	0.22909	0.1442:0.7078:0.0:0.148	.	237;276	C9IYJ3;O75323	.;NIPS2_HUMAN	M	276;237	ENSP00000313050:I276M;ENSP00000406855:I237M	ENSP00000313050:I276M	I	+	3	3	GBAS	56034226	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.349000	0.33998	0.802000	0.34089	0.655000	0.94253	ATC	GBAS	-	pfam_NIPSNAP,superfamily_Dimeric_a/b-barrel		0.368	GBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GBAS	HGNC	protein_coding	OTTHUMT00000251524.1	C	NM_001483		56066732	+1	no_errors	ENST00000322090	ensembl	human	known	70_37	missense	SNP	1.000	G
GFPT1	2673	genome.wustl.edu	37	2	69569334	69569334	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:69569334G>A	ENST00000357308.4	-	13	1331	c.1153C>T	c.(1153-1155)Cgg>Tgg	p.R385W	GFPT1_ENST00000361060.5_Missense_Mutation_p.R367W	NM_001244710.1	NP_001231639.1	Q06210	GFPT1_HUMAN	glutamine--fructose-6-phosphate transaminase 1	385	Isomerase.|SIS 1. {ECO:0000255|PROSITE- ProRule:PRU00797}.				activation of signaling protein activity involved in unfolded protein response (GO:0006987)|carbohydrate biosynthetic process (GO:0016051)|cellular protein metabolic process (GO:0044267)|cellular response to insulin stimulus (GO:0032869)|circadian regulation of gene expression (GO:0032922)|dolichol-linked oligosaccharide biosynthetic process (GO:0006488)|endoplasmic reticulum unfolded protein response (GO:0030968)|energy reserve metabolic process (GO:0006112)|fructose 6-phosphate metabolic process (GO:0006002)|glucosamine biosynthetic process (GO:0006042)|glutamine metabolic process (GO:0006541)|negative regulation of glycogen biosynthetic process (GO:0045719)|post-translational protein modification (GO:0043687)|protein homotetramerization (GO:0051289)|protein N-linked glycosylation via asparagine (GO:0018279)|response to sucrose (GO:0009744)|UDP-N-acetylglucosamine biosynthetic process (GO:0006048)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	amino acid binding (GO:0016597)|carbohydrate binding (GO:0030246)|glutamine-fructose-6-phosphate transaminase (isomerizing) activity (GO:0004360)			endometrium(1)|large_intestine(3)|lung(5)|skin(3)	12						ATCAAACGCCGGCATCTCTGG	0.338																																																	0													135.0	146.0	143.0					2																	69569334		2203	4300	6503	SO:0001583	missense	2673				CCDS33216.1, CCDS58713.1	2p13	2014-09-17	2010-05-11		ENSG00000198380	ENSG00000198380	2.6.1.16		4241	protein-coding gene	gene with protein product		138292	"""glutamine-fructose-6-phosphate transaminase 1"""	GFPT		1460020	Standard	NM_002056		Approved	GFAT, GFA, GFAT1	uc002sfi.2	Q06210	OTTHUMG00000152666	ENST00000357308.4:c.1153C>T	2.37:g.69569334G>A	ENSP00000349860:p.Arg385Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53QE6|Q9BXF8	Missense_Mutation	SNP	pfam_SIS,pfam_GATase_dom,tigrfam_GlmS_trans	p.R385W	ENST00000357308.4	37	c.1153	CCDS58713.1	2	.	.	.	.	.	.	.	.	.	.	G	19.66	3.868374	0.72065	.	.	ENSG00000198380	ENST00000357308;ENST00000361060	T;T	0.73363	-0.74;-0.74	5.02	4.13	0.48395	.	0.000000	0.85682	D	0.000000	D	0.90229	0.6945	H	0.96777	3.88	0.80722	D	1	D	0.89917	1.0	D	0.78314	0.991	D	0.93167	0.6563	10	0.87932	D	0	-10.6831	14.0257	0.64584	0.0:0.0:0.848:0.152	.	367	Q06210-2	.	W	385;367	ENSP00000349860:R385W;ENSP00000354347:R367W	ENSP00000349860:R385W	R	-	1	2	GFPT1	69422838	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	2.990000	0.49401	1.324000	0.45282	0.557000	0.71058	CGG	GFPT1	-	pfam_SIS,tigrfam_GlmS_trans		0.338	GFPT1-201	KNOWN	basic|CCDS	protein_coding	GFPT1	HGNC	protein_coding		G			69569334	-1	no_errors	ENST00000357308	ensembl	human	known	70_37	missense	SNP	1.000	A
GGT5	2687	genome.wustl.edu	37	22	24621550	24621550	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr22:24621550G>A	ENST00000327365.4	-	9	1716	c.1300C>T	c.(1300-1302)Cga>Tga	p.R434*	GGT5_ENST00000418439.2_Nonsense_Mutation_p.R357*|GGT5_ENST00000263112.7_Nonsense_Mutation_p.R402*|GGT5_ENST00000398292.3_Nonsense_Mutation_p.R434*	NM_001099781.1|NM_004121.2	NP_001093251.1|NP_004112.2	P36269	GGT5_HUMAN	gamma-glutamyltransferase 5	434					arachidonic acid metabolic process (GO:0019369)|cellular amino acid metabolic process (GO:0006520)|glutathione biosynthetic process (GO:0006750)|glutathione metabolic process (GO:0006749)|inflammatory response (GO:0006954)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of external side of plasma membrane (GO:0031362)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	gamma-glutamyltransferase activity (GO:0003840)|glutathione hydrolase activity (GO:0036374)			breast(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(3)|skin(3)	28						CGGGGGCATCGCTCGCATAAG	0.647																																																	0													69.0	58.0	62.0					22																	24621550		2203	4300	6503	SO:0001587	stop_gained	2687			M64099	CCDS13825.1, CCDS42989.1, CCDS42990.1	22q11.23	2008-03-25	2008-03-10	2008-03-10	ENSG00000099998	ENSG00000099998		"""Gamma-glutamyltransferases"""	4260	protein-coding gene	gene with protein product		137168	"""gamma-glutamyltransferase-like activity 1"""	GGTLA1		1676842, 8095916, 18357469	Standard	NM_004121		Approved	GGT-REL	uc002zzp.4	P36269	OTTHUMG00000150796	ENST00000327365.4:c.1300C>T	22.37:g.24621550G>A	ENSP00000330080:p.Arg434*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53XM9|Q6GMP0|Q96FC1|Q9UFM5	Nonsense_Mutation	SNP	pfam_GGT_peptidase,prints_GGT_peptidase	p.R434*	ENST00000327365.4	37	c.1300	CCDS13825.1	22	.	.	.	.	.	.	.	.	.	.	G	12.77	2.036082	0.35893	.	.	ENSG00000099998	ENST00000327365;ENST00000263112;ENST00000438024;ENST00000398292;ENST00000418439	.	.	.	4.36	-1.26	0.09376	.	1.584780	0.03754	N	0.257086	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-8.5604	6.5437	0.22394	0.1555:0.0:0.4979:0.3466	.	.	.	.	X	434;402;349;434;357	.	ENSP00000263112:R402X	R	-	1	2	GGT5	22951550	0.946000	0.32159	0.908000	0.35775	0.046000	0.14306	0.008000	0.13197	-0.126000	0.11682	-0.426000	0.05927	CGA	GGT5	-	pfam_GGT_peptidase		0.647	GGT5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GGT5	HGNC	protein_coding	OTTHUMT00000320119.1	G	NM_004121		24621550	-1	no_errors	ENST00000398292	ensembl	human	known	70_37	nonsense	SNP	0.934	A
GLRA4	441509	genome.wustl.edu	37	X	102979867	102979867	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chrX:102979867C>A	ENST00000372617.4	-	2	581	c.161G>T	c.(160-162)cGa>cTa	p.R54L	GLRA4_ENST00000469567.1_5'Flank	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	54						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)			cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						TCCAGATGTTCGCCCCATAAG	0.498																																																	0													58.0	56.0	57.0					X																	102979867		1912	4139	6051	SO:0001583	missense	441509			Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.161G>T	X.37:g.102979867C>A	ENSP00000361700:p.Arg54Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Neur_channel,tigrfam_Neur_channel	p.R54L	ENST00000372617.4	37	c.161	CCDS43980.2	X	.	.	.	.	.	.	.	.	.	.	C	18.62	3.663144	0.67700	.	.	ENSG00000188828	ENST00000372617	T	0.79653	-1.29	5.73	3.96	0.45880	Neurotransmitter-gated ion-channel ligand-binding (3);	0.060042	0.64402	D	0.000002	T	0.74764	0.3759	N	0.12182	0.205	0.44395	D	0.997303	B;B	0.28552	0.215;0.114	P;B	0.48524	0.58;0.417	T	0.66320	-0.5953	10	0.26408	T	0.33	.	8.7737	0.34749	0.0:0.7672:0.1479:0.0849	.	54;13	Q5JXX5;B9WSA6	GLRA4_HUMAN;.	L	54	ENSP00000361700:R54L	ENSP00000361700:R54L	R	-	2	0	GLRA4	102866523	0.960000	0.32886	0.829000	0.32907	0.954000	0.61252	2.638000	0.46562	0.574000	0.29417	0.600000	0.82982	CGA	GLRA4	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,prints_Glycine_rcpt_A,tigrfam_Neur_channel		0.498	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLRA4	HGNC	protein_coding	OTTHUMT00000057742.2	C	NM_001024452		102979867	-1	no_errors	ENST00000372617	ensembl	human	known	70_37	missense	SNP	0.974	A
GOLGA2P5	55592	genome.wustl.edu	37	12	100562920	100562921	+	RNA	INS	-	-	T	rs58822438		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:100562920_100562921insT	ENST00000397112.4	-	0	599					NR_036632.1		Q9HBQ8	GGA2B_HUMAN								Golgi apparatus (GO:0005794)				large_intestine(1)|lung(3)	4						GGTCTCATTTGTTTTttttttt	0.406																																																	0																																												55592																															12.37:g.100562931_100562931dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NSV2	RNA	INS	-	NULL	ENST00000397112.4	37	NULL		12																																																																																			GOLGA2B	-	-		0.406	GOLGA2B-004	KNOWN	basic	processed_transcript	GOLGA2P5	Clone_based_vega_gene	pseudogene	OTTHUMT00000396439.2	-			100562921	-1	no_errors	ENST00000421840	ensembl	human	known	70_37	rna	INS	0.000:0.000	T
GRAMD1B	57476	genome.wustl.edu	37	11	123448268	123448268	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:123448268G>A	ENST00000529750.1	+	2	544	c.217G>A	c.(217-219)Ggc>Agc	p.G73S	GRAMD1B_ENST00000456860.2_Missense_Mutation_p.G73S|GRAMD1B_ENST00000322282.7_Missense_Mutation_p.G73S	NM_020716.1	NP_065767.1	Q3KR37	GRM1B_HUMAN	GRAM domain containing 1B	73						integral component of membrane (GO:0016021)|membrane (GO:0016020)				NS(1)|breast(1)|endometrium(1)|large_intestine(5)|lung(17)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	30		Breast(109;0.00204)|Lung NSC(97;0.0177)|all_lung(97;0.0179)|Medulloblastoma(222;0.0425)|all_neural(223;0.112)		BRCA - Breast invasive adenocarcinoma(274;7.32e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0394)		CGGCCGGAGCGGCGGCAAGAA	0.657											OREG0021454	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													11.0	16.0	14.0					11																	123448268		2010	4170	6180	SO:0001583	missense	57476			AB033027	CCDS53720.1, CCDS66253.1, CCDS66254.1	11q24.1	2005-11-02				ENSG00000023171			29214	protein-coding gene	gene with protein product						10574462	Standard	NM_001286564		Approved	KIAA1201	uc001pyx.2	Q3KR37		ENST00000529750.1:c.217G>A	11.37:g.123448268G>A	ENSP00000436500:p.Gly73Ser	Somatic	1526	WXS	Illumina HiSeq	Phase_IV	Q6UW85|Q9ULL9	Missense_Mutation	SNP	pfam_GRAM,smart_GRAM	p.G73S	ENST00000529750.1	37	c.217	CCDS53720.1	11	.	.	.	.	.	.	.	.	.	.	G	11.52	1.661959	0.29515	.	.	ENSG00000023171	ENST00000539133;ENST00000456860;ENST00000322282;ENST00000529750;ENST00000529432;ENST00000534764	T;T;T;T;T	0.30182	1.87;1.96;1.96;1.99;1.54	4.92	3.88	0.44766	.	0.104272	0.64402	N	0.000003	T	0.15522	0.0374	N	0.19112	0.55	0.53688	D	0.999973	B;B;B;B	0.29341	0.242;0.014;0.033;0.008	B;B;B;B	0.23419	0.046;0.013;0.009;0.009	T	0.05241	-1.0897	10	0.07990	T	0.79	.	9.5291	0.39182	0.1758:0.0:0.8242:0.0	.	33;73;73;73	B7Z4N9;F5H572;Q3KR37;E7EPH8	.;.;GRM1B_HUMAN;.	S	73;73;73;73;33;69	ENSP00000402457:G73S;ENSP00000325628:G73S;ENSP00000436500:G73S;ENSP00000432987:G33S;ENSP00000434214:G69S	ENSP00000325628:G73S	G	+	1	0	GRAMD1B	122953478	1.000000	0.71417	0.779000	0.31741	0.982000	0.71751	2.949000	0.49074	0.884000	0.36064	0.462000	0.41574	GGC	GRAMD1B	-	NULL		0.657	GRAMD1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRAMD1B	HGNC	protein_coding	OTTHUMT00000387404.2	G	XM_370660		123448268	+1	no_errors	ENST00000322282	ensembl	human	known	70_37	missense	SNP	0.999	A
GRK6	2870	genome.wustl.edu	37	5	176859762	176859762	+	Missense_Mutation	SNP	G	G	T	rs2230881	byFrequency	TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr5:176859762G>T	ENST00000355472.5	+	5	563	c.395G>T	c.(394-396)cGg>cTg	p.R132L	GRK6_ENST00000528793.1_Missense_Mutation_p.R132L|GRK6_ENST00000507633.1_Missense_Mutation_p.R132L|GRK6_ENST00000393576.3_Missense_Mutation_p.R132L|GRK6_ENST00000355958.5_Missense_Mutation_p.R132L	NM_001004106.2|NM_002082.3	NP_001004106.1|NP_002073.2	P43250	GRK6_HUMAN	G protein-coupled receptor kinase 6	132	N-terminal.|RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|Wnt signaling pathway (GO:0016055)	membrane (GO:0016020)	ATP binding (GO:0005524)|G-protein coupled receptor kinase activity (GO:0004703)			breast(1)|endometrium(4)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|prostate(5)|stomach(1)	25	all_cancers(89;1.15e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			TGCACCCAGCGGCTGGAGCAG	0.632																																																	0													22.0	24.0	23.0					5																	176859762		2202	4299	6501	SO:0001583	missense	2870				CCDS34303.1, CCDS43406.1, CCDS47348.1	5q35	2011-01-14	2004-02-04	2004-02-06	ENSG00000198055	ENSG00000198055			4545	protein-coding gene	gene with protein product		600869		GPRK6		8415712	Standard	NM_002082		Approved		uc021yiu.1	P43250	OTTHUMG00000163401	ENST00000355472.5:c.395G>T	5.37:g.176859762G>T	ENSP00000347655:p.Arg132Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O60541|Q13652	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Regulat_G_prot_signal,superfamily_Kinase-like_dom,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_AGC-kinase_C,pfscan_Regulat_G_prot_signal,pfscan_Prot_kinase_cat_dom,prints_GPCR_kinase	p.R132L	ENST00000355472.5	37	c.395	CCDS34303.1	5	.	.	.	.	.	.	.	.	.	.	G	11.32	1.603766	0.28534	.	.	ENSG00000198055	ENST00000506296;ENST00000511244;ENST00000355472;ENST00000507633;ENST00000393576;ENST00000355958;ENST00000528793	T;T;T;T;T;T;T	0.01998	4.51;4.51;4.51;4.51;4.51;4.51;4.51	4.99	1.03	0.20045	Regulator of G protein signalling (3);Regulator of G protein signalling superfamily (1);	0.220399	0.43260	D	0.000594	T	0.03053	0.0090	L	0.58810	1.83	0.54753	D	0.999981	B;B;B;B	0.31174	0.024;0.075;0.009;0.311	B;B;B;B	0.32465	0.031;0.05;0.007;0.146	T	0.51926	-0.8643	10	0.31617	T	0.26	-8.8572	9.4546	0.38747	0.3049:0.0:0.6951:0.0	.	132;102;132;132	P43250;B3KPS5;P43250-2;D6RHX8	GRK6_HUMAN;.;.;.	L	100;100;132;132;132;132;132	ENSP00000421055:R100L;ENSP00000425391:R100L;ENSP00000347655:R132L;ENSP00000427581:R132L;ENSP00000377204:R132L;ENSP00000348230:R132L;ENSP00000433511:R132L	ENSP00000347655:R132L	R	+	2	0	GRK6	176792368	0.765000	0.28485	0.995000	0.50966	0.250000	0.25880	0.561000	0.23515	-0.087000	0.12528	-0.258000	0.10820	CGG	GRK6	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal		0.632	GRK6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRK6	HGNC	protein_coding	OTTHUMT00000373204.1	G	NM_002082		176859762	+1	no_errors	ENST00000528793	ensembl	human	known	70_37	missense	SNP	1.000	T
GSG1	83445	genome.wustl.edu	37	12	13243620	13243620	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:13243620G>A	ENST00000432710.2	-	2	313	c.181C>T	c.(181-183)Ccc>Tcc	p.P61S	GSG1_ENST00000457134.2_Missense_Mutation_p.P48S|GSG1_ENST00000324458.8_Missense_Mutation_p.P61S|GSG1_ENST00000396310.2_Missense_Mutation_p.P45S|GSG1_ENST00000351606.6_Missense_Mutation_p.P61S|GSG1_ENST00000537302.1_Missense_Mutation_p.P48S|GSG1_ENST00000396302.3_Missense_Mutation_p.P48S|GSG1_ENST00000337630.6_Missense_Mutation_p.P48S	NM_001206842.1	NP_001193771.1	Q2KHT4	GSG1_HUMAN	germ cell associated 1	48						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(3)|lung(4)|skin(1)|urinary_tract(1)	10		Prostate(47;0.183)		BRCA - Breast invasive adenocarcinoma(232;0.15)		TCGCACAGGGGCTTGGGCACC	0.537																																																	0													121.0	106.0	111.0					12																	13243620		2203	4300	6503	SO:0001583	missense	83445			BC001796	CCDS8659.2, CCDS44835.1, CCDS44836.1, CCDS55806.1, CCDS55807.1, CCDS55808.1	12p13.31	2007-12-03			ENSG00000111305	ENSG00000111305			19716	protein-coding gene	gene with protein product							Standard	NM_031289		Approved	MGC3146	uc001rbn.3	Q2KHT4	OTTHUMG00000150148	ENST00000432710.2:c.181C>T	12.37:g.13243620G>A	ENSP00000405032:p.Pro61Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N4M3|Q8NBR4|Q8NBS0|Q8NBT1|Q96LP9|Q96SI6|Q9BUY4	Missense_Mutation	SNP	pfam_GSG-1	p.P61S	ENST00000432710.2	37	c.181	CCDS55808.1	12	.	.	.	.	.	.	.	.	.	.	G	28.6	4.938490	0.92526	.	.	ENSG00000111305	ENST00000337630;ENST00000324458;ENST00000396310;ENST00000396302;ENST00000457134;ENST00000432710;ENST00000537302;ENST00000351606;ENST00000405543;ENST00000545401;ENST00000542415;ENST00000545699	T;T;T;T;T;T;T;T;T;T;T	0.59772	0.24;0.24;0.24;0.24;0.24;0.24;0.24;0.24;0.24;0.24;0.24	5.4	5.4	0.78164	.	0.000000	0.85682	D	0.000000	T	0.80904	0.4713	M	0.88640	2.97	0.58432	D	0.999996	D;D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D;D	0.97110	0.999;0.999;1.0;1.0;0.999;0.999;1.0;1.0	D	0.83441	0.0043	10	0.54805	T	0.06	.	19.1798	0.93619	0.0:0.0:1.0:0.0	.	61;61;61;48;48;48;48;48	Q2KHT4-7;Q2KHT4-6;G3XAB9;Q2KHT4;Q2KHT4-5;Q2KHT4-2;F1T0A0;F1T0A1	.;.;.;GSG1_HUMAN;.;.;.;.	S	48;61;45;48;48;61;48;61;45;61;61;48	ENSP00000336816:P48S;ENSP00000320838:P61S;ENSP00000379604:P45S;ENSP00000379596:P48S;ENSP00000398384:P48S;ENSP00000405032:P61S;ENSP00000441718:P48S;ENSP00000336857:P61S;ENSP00000445884:P61S;ENSP00000439676:P61S;ENSP00000440684:P48S	ENSP00000320838:P61S	P	-	1	0	GSG1	13134887	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.470000	0.97683	2.537000	0.85549	0.561000	0.74099	CCC	GSG1	-	pfam_GSG-1		0.537	GSG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GSG1	HGNC	protein_coding	OTTHUMT00000316546.1	G	NM_031289		13243620	-1	no_errors	ENST00000324458	ensembl	human	known	70_37	missense	SNP	1.000	A
HECTD4	283450	genome.wustl.edu	37	12	112605159	112605159	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:112605159C>A	ENST00000430131.2	-	71	12375	c.11230G>T	c.(11230-11232)Gat>Tat	p.D3744Y	HECTD4_ENST00000550722.1_Missense_Mutation_p.D4020Y|HECTD4_ENST00000377560.5_Missense_Mutation_p.D3994Y			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	3744	HECT. {ECO:0000255|PROSITE- ProRule:PRU00104}.				glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										GTGAGGATATCCGCTTCCTGC	0.612																																																	0													85.0	91.0	89.0					12																	112605159		2052	4179	6231	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.11230G>T	12.37:g.112605159C>A	ENSP00000404379:p.Asp3744Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.D3994Y	ENST00000430131.2	37	c.11980		12	.	.	.	.	.	.	.	.	.	.	C	23.8	4.462549	0.84425	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722;ENST00000547085	T;T;T	0.67171	-0.25;-0.25;-0.25	5.45	5.45	0.79879	HECT (4);	.	.	.	.	D	0.86306	0.5901	M	0.91818	3.245	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.89066	0.3466	9	0.87932	D	0	.	19.2694	0.94003	0.0:1.0:0.0:0.0	.	3744	Q9Y4D8	K0614_HUMAN	Y	3994;3744;4020;209	ENSP00000366783:D3994Y;ENSP00000404379:D3744Y;ENSP00000449784:D4020Y	ENSP00000366783:D3994Y	D	-	1	0	C12orf51	111089542	1.000000	0.71417	1.000000	0.80357	0.794000	0.44872	7.336000	0.79245	2.576000	0.86940	0.491000	0.48974	GAT	HECTD4	-	pfam_HECT,superfamily_HECT,smart_HECT,pfscan_HECT		0.612	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		C	NM_173813		112605159	-1	no_errors	ENST00000377560	ensembl	human	known	70_37	missense	SNP	1.000	A
HEG1	57493	genome.wustl.edu	37	3	124739958	124739958	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:124739958C>T	ENST00000311127.4	-	4	997	c.930G>A	c.(928-930)gaG>gaA	p.E310E	HEG1_ENST00000477536.1_5'Flank	NM_020733.1	NP_065784.1	Q9ULI3	HEG1_HUMAN	heart development protein with EGF-like domains 1	310					cardiac atrium morphogenesis (GO:0003209)|cell-cell junction assembly (GO:0007043)|endothelial cell morphogenesis (GO:0001886)|in utero embryonic development (GO:0001701)|lung development (GO:0030324)|lymph circulation (GO:0003017)|lymph vessel development (GO:0001945)|multicellular organism growth (GO:0035264)|pericardium development (GO:0060039)|post-embryonic development (GO:0009791)|regulation of body fluid levels (GO:0050878)|vasculogenesis (GO:0001570)|venous blood vessel morphogenesis (GO:0048845)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(24)|ovary(2)|urinary_tract(4)	47						TGTTAAGCTTCTCTGTACTTT	0.433																																																	0													40.0	38.0	38.0					3																	124739958		1946	4148	6094	SO:0001819	synonymous_variant	57493			AK074987	CCDS46898.1	3q21.2	2013-03-08	2013-03-08		ENSG00000173706	ENSG00000173706			29227	protein-coding gene	gene with protein product	"""heart of glass"""	614182	"""HEG homolog 1 (zebrafish)"""			10574462, 19151727, 23007647	Standard	NM_020733		Approved	KIAA1237, HEG	uc003ehs.4	Q9ULI3	OTTHUMG00000159486	ENST00000311127.4:c.930G>A	3.37:g.124739958C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NX66|Q8NC40|Q9BSV0	Silent	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom	p.E310	ENST00000311127.4	37	c.930	CCDS46898.1	3																																																																																			HEG1	-	NULL		0.433	HEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEG1	HGNC	protein_coding	OTTHUMT00000355732.2	C	XM_087386		124739958	-1	no_errors	ENST00000311127	ensembl	human	known	70_37	silent	SNP	0.001	T
HIPK4	147746	genome.wustl.edu	37	19	40895762	40895762	+	Silent	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:40895762G>C	ENST00000291823.2	-	1	332	c.48C>G	c.(46-48)gtC>gtG	p.V16V		NM_144685.3	NP_653286.2	Q8NE63	HIPK4_HUMAN	homeodomain interacting protein kinase 4	16	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				histone phosphorylation (GO:0016572)|peptidyl-serine phosphorylation (GO:0018105)|protein autophosphorylation (GO:0046777)|regulation of signal transduction by p53 class mediator (GO:1901796)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|endometrium(5)|large_intestine(2)|lung(5)|ovary(1)|prostate(2)|skin(2)|stomach(1)|urinary_tract(1)	20			Lung(22;4.95e-05)|LUSC - Lung squamous cell carcinoma(20;0.000292)			CCTTGCCCAAGACCTCGATGA	0.637																																																	0													72.0	58.0	63.0					19																	40895762		2203	4300	6503	SO:0001819	synonymous_variant	147746			BC034501	CCDS12555.1	19q13.2	2008-02-05				ENSG00000160396			19007	protein-coding gene	gene with protein product		611712					Standard	NM_144685		Approved	FLJ32818	uc002onp.3	Q8NE63		ENST00000291823.2:c.48C>G	19.37:g.40895762G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K863|Q96M54	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.V16	ENST00000291823.2	37	c.48	CCDS12555.1	19																																																																																			HIPK4	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.637	HIPK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIPK4	HGNC	protein_coding	OTTHUMT00000462593.1	G	NM_144685		40895762	-1	no_errors	ENST00000291823	ensembl	human	known	70_37	silent	SNP	0.986	C
HNRNPK	3190	genome.wustl.edu	37	9	86585658	86585658	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:86585658G>A	ENST00000376264.2	-	15	1443	c.1185C>T	c.(1183-1185)ccC>ccT	p.P395P	MIR7-1_ENST00000384871.1_RNA|HNRNPK_ENST00000376281.4_Silent_p.P395P|HNRNPK_ENST00000351839.3_Silent_p.P395P|RP11-575L7.8_ENST00000448389.1_RNA|HNRNPK_ENST00000360384.5_Silent_p.P395P|HNRNPK_ENST00000376263.3_Silent_p.P395P	NM_002140.3|NM_031262.2	NP_002131.2|NP_112552.1	P61978	HNRPK_HUMAN	heterogeneous nuclear ribonucleoprotein K	395	2 X 22 AA approximate repeats.|5 X 4 AA repeats of G-X-G-G.|KH 3. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of receptor-mediated endocytosis (GO:0048260)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of lipid transport by positive regulation of transcription from RNA polymerase II promoter (GO:0072369)|regulation of low-density lipoprotein particle clearance (GO:0010988)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)|signal transduction (GO:0007165)|viral process (GO:0016032)	catalytic step 2 spliceosome (GO:0071013)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|single-stranded DNA binding (GO:0003697)			endometrium(3)|kidney(2)|large_intestine(4)|lung(8)|skin(1)|stomach(1)	19						TTACATCTTTGGGAATAGTTA	0.318																																																	0													70.0	74.0	73.0					9																	86585658		2203	4299	6502	SO:0001819	synonymous_variant	3190				CCDS6667.1, CCDS6668.1	9q21.32-q21.33	2011-10-24		2008-04-18	ENSG00000165119	ENSG00000165119			5044	protein-coding gene	gene with protein product	"""transformation upregulated nuclear protein"""	600712		HNRPK		8107114	Standard	NM_031263		Approved	CSBP, TUNP	uc004anf.4	P61978	OTTHUMG00000020107	ENST00000376264.2:c.1185C>T	9.37:g.86585658G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q07244|Q15671|Q59F98|Q5T6W4|Q60577|Q922Y7|Q96J62	Silent	SNP	pfam_KH_dom_type_1,pfam_ROK_N,smart_KH_dom,pfscan_KH_dom_type_1	p.P395	ENST00000376264.2	37	c.1185	CCDS6667.1	9																																																																																			HNRNPK	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.318	HNRNPK-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	HNRNPK	HGNC	protein_coding	OTTHUMT00000052846.2	G			86585658	-1	no_errors	ENST00000376263	ensembl	human	known	70_37	silent	SNP	1.000	A
ITGA5	3678	genome.wustl.edu	37	12	54793645	54793646	+	Intron	INS	-	-	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:54793645_54793646insA	ENST00000293379.4	-	26	2989				RP11-753H16.3_ENST00000550474.1_RNA|RP11-753H16.5_ENST00000552785.1_RNA	NM_002205.2	NP_002196.2	P08648	ITA5_HUMAN	integrin, alpha 5 (fibronectin receptor, alpha polypeptide)						angiogenesis (GO:0001525)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell-cell adhesion mediated by integrin (GO:0033631)|cell-substrate adhesion (GO:0031589)|cell-substrate junction assembly (GO:0007044)|endodermal cell differentiation (GO:0035987)|extracellular matrix organization (GO:0030198)|heterophilic cell-cell adhesion (GO:0007157)|heterotypic cell-cell adhesion (GO:0034113)|integrin-mediated signaling pathway (GO:0007229)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|memory (GO:0007613)|negative regulation of anoikis (GO:2000811)|positive regulation of cell migration (GO:0030335)|positive regulation of cell-substrate adhesion (GO:0010811)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of vascular endothelial growth factor receptor signaling pathway (GO:0030949)|viral process (GO:0016032)|wound healing, spreading of epidermal cells (GO:0035313)	alphav-beta3 integrin-vitronectin complex (GO:0071062)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|external side of plasma membrane (GO:0009897)|focal adhesion (GO:0005925)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)|ruffle (GO:0001726)|synapse (GO:0045202)	metal ion binding (GO:0046872)|platelet-derived growth factor receptor binding (GO:0005161)|vascular endothelial growth factor receptor 2 binding (GO:0043184)			NS(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(11)|ovary(2)|prostate(1)|upper_aerodigestive_tract(2)	34						CTGCCTGACTTACCAGGATCTG	0.535											OREG0021897	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0																																										SO:0001627	intron_variant	3678				CCDS8880.1	12q11-q13	2010-03-23				ENSG00000161638		"""CD molecules"", ""Integrins"""	6141	protein-coding gene	gene with protein product		135620		FNRA		2454952	Standard	NM_002205		Approved	CD49e	uc001sga.3	P08648	OTTHUMG00000169841	ENST00000293379.4:c.2727+1->T	12.37:g.54793646_54793646dupA		Somatic	1003	WXS	Illumina HiSeq	Phase_IV	Q96HA5	Splice_Site	INS	-	e26+2	ENST00000293379.4	37	c.2727+2_2727+1	CCDS8880.1	12																																																																																			ITGA5	-	-		0.535	ITGA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGA5	HGNC	protein_coding	OTTHUMT00000406174.1	-			54793646	-1	no_errors	ENST00000293379	ensembl	human	known	70_37	splice_site_ins	INS	0.966:0.998	A
ITPKB	3707	genome.wustl.edu	37	1	226829634	226829634	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:226829634G>A	ENST00000272117.3	-	4	2438	c.2439C>T	c.(2437-2439)atC>atT	p.I813I	ITPKB_ENST00000429204.1_Silent_p.I813I			P27987	IP3KB_HUMAN	inositol-trisphosphate 3-kinase B	813					cell surface receptor signaling pathway (GO:0007166)|inositol phosphate metabolic process (GO:0043647)|MAPK cascade (GO:0000165)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of Ras protein signal transduction (GO:0046579)|positive thymic T cell selection (GO:0045059)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|inositol-1,4,5-trisphosphate 3-kinase activity (GO:0008440)			central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(13)|ovary(4)|prostate(1)|skin(1)	30		Prostate(94;0.0773)				TGATTCCCTCGATCCTGAACC	0.657																																					Colon(84;110 1851 5306 33547)												0													107.0	89.0	95.0					1																	226829634		2203	4300	6503	SO:0001819	synonymous_variant	3707			AJ242780	CCDS1555.1	1q42.12	2011-04-28	2011-04-28		ENSG00000143772	ENSG00000143772	2.7.1.127		6179	protein-coding gene	gene with protein product		147522	"""inositol 1,4,5-trisphosphate 3-kinase B"""			1654894, 1330886	Standard	NM_002221		Approved	IP3KB, IP3-3KB	uc010pvo.2	P27987	OTTHUMG00000037582	ENST00000272117.3:c.2439C>T	1.37:g.226829634G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VWL9|Q5VWM0|Q96BZ2|Q96JS1|Q9UH47	Silent	SNP	pfam_IPK	p.I813	ENST00000272117.3	37	c.2439	CCDS1555.1	1																																																																																			ITPKB	-	pfam_IPK		0.657	ITPKB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPKB	HGNC	protein_coding	OTTHUMT00000091632.1	G	NM_002221		226829634	-1	no_errors	ENST00000272117	ensembl	human	known	70_37	silent	SNP	0.995	A
KDM4E	390245	genome.wustl.edu	37	11	94759882	94759882	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:94759882C>T	ENST00000450979.2	+	1	1461	c.1161C>T	c.(1159-1161)tcC>tcT	p.S387S		NM_001161630.1	NP_001155102.1	B2RXH2	KDM4E_HUMAN	lysine (K)-specific demethylase 4E	387					histone H3-K9 demethylation (GO:0033169)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|metal ion binding (GO:0046872)			breast(1)|endometrium(7)|kidney(1)|lung(3)	12						AGCCTGTGTCCTCAGGGCACT	0.537																																																	0													61.0	60.0	60.0					11																	94759882		692	1591	2283	SO:0001819	synonymous_variant	390245			BC157851	CCDS44713.1	11q21	2012-03-30	2012-03-28	2012-03-28		ENSG00000235268		"""Chromatin-modifying enzymes / K-demethylases"""	37098	protein-coding gene	gene with protein product			"""lysine (K)-specific demethylase 4D-like"""	KDM4DL		21076780	Standard	NM_001161630		Approved	JMJD2E	uc010ruf.1	B2RXH2		ENST00000450979.2:c.1161C>T	11.37:g.94759882C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_JmjC_dom,pfam_TF_JmjN,smart_TF_JmjN,smart_JmjC_dom,pfscan_TF_JmjN,pfscan_JmjC_dom	p.S387	ENST00000450979.2	37	c.1161	CCDS44713.1	11																																																																																			KDM4E	-	NULL		0.537	KDM4E-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4E	HGNC	protein_coding	OTTHUMT00000396649.1	C	NM_001161630		94759882	+1	no_errors	ENST00000450979	ensembl	human	known	70_37	silent	SNP	0.000	T
KIAA0907	22889	genome.wustl.edu	37	1	155899543	155899543	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:155899543G>A	ENST00000368321.3	-	3	367	c.344C>T	c.(343-345)aCa>aTa	p.T115I	KIAA0907_ENST00000368320.3_Missense_Mutation_p.T115I|KIAA0907_ENST00000482337.1_5'UTR|KIAA0907_ENST00000368319.3_Missense_Mutation_p.T115I	NM_014949.2	NP_055764.2	Q7Z7F0	K0907_HUMAN	KIAA0907	115							RNA binding (GO:0003723)			breast(1)|endometrium(2)|kidney(1)|large_intestine(4)|liver(1)|lung(11)|urinary_tract(1)	21	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)		OV - Ovarian serous cystadenocarcinoma(3;8.82e-06)			GTTCCTACATGTGAGAGGCAC	0.473																																																	0													159.0	142.0	148.0					1																	155899543		2203	4300	6503	SO:0001583	missense	22889			BC062637	CCDS30885.1	1q22	2012-11-30			ENSG00000132680	ENSG00000132680			29145	protein-coding gene	gene with protein product						10048485	Standard	NM_014949		Approved	BLOM7	uc001fmi.1	Q7Z7F0	OTTHUMG00000014103	ENST00000368321.3:c.344C>T	1.37:g.155899543G>A	ENSP00000357304:p.Thr115Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O94981|Q7L7Q2|Q7Z7E9|Q8TBQ0	Missense_Mutation	SNP	NULL	p.T115I	ENST00000368321.3	37	c.344	CCDS30885.1	1	.	.	.	.	.	.	.	.	.	.	G	16.59	3.165543	0.57476	.	.	ENSG00000132680	ENST00000368321;ENST00000368320;ENST00000368319	.	.	.	5.32	5.32	0.75619	.	0.049831	0.85682	D	0.000000	T	0.41949	0.1181	L	0.41710	1.295	0.58432	D	0.999999	B;P;B;B;B;P	0.45827	0.112;0.642;0.112;0.244;0.112;0.867	B;B;B;B;B;B	0.41988	0.047;0.139;0.02;0.043;0.047;0.372	T	0.31503	-0.9941	9	0.34782	T	0.22	-8.5552	18.7817	0.91934	0.0:0.0:1.0:0.0	.	115;115;115;115;115;115	D3DVA4;Q7Z7F0-4;A8K1I7;Q7Z7F0-3;Q7Z7F0-2;Q7Z7F0	.;.;.;.;.;K0907_HUMAN	I	115	.	ENSP00000357302:T115I	T	-	2	0	KIAA0907	154166167	1.000000	0.71417	0.990000	0.47175	0.998000	0.95712	6.049000	0.71053	2.767000	0.95098	0.563000	0.77884	ACA	KIAA0907	-	NULL		0.473	KIAA0907-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0907	HGNC	protein_coding	OTTHUMT00000039583.1	G	NM_014949		155899543	-1	no_errors	ENST00000368321	ensembl	human	known	70_37	missense	SNP	1.000	A
KIAA1217	56243	genome.wustl.edu	37	10	24835135	24835135	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr10:24835135C>G	ENST00000376454.3	+	21	5744	c.5714C>G	c.(5713-5715)tCa>tGa	p.S1905*	KIAA1217_ENST00000376462.1_Nonsense_Mutation_p.S1226*|KIAA1217_ENST00000376452.3_Nonsense_Mutation_p.S1336*|KIAA1217_ENST00000458595.1_Nonsense_Mutation_p.S1311*|KIAA1217_ENST00000396445.1_3'UTR|KIAA1217_ENST00000376451.2_3'UTR	NM_019590.3	NP_062536.2	Q5T5P2	SKT_HUMAN	KIAA1217	1905	Ser-rich. {ECO:0000255}.				embryonic skeletal system development (GO:0048706)	cytoplasm (GO:0005737)				breast(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(3)|large_intestine(19)|lung(19)|ovary(5)|prostate(3)|skin(3)|urinary_tract(1)	70						tcctccgtctcACTGAATCAA	0.542																																																	0													97.0	85.0	89.0					10																	24835135		2203	4300	6503	SO:0001587	stop_gained	56243			BX640796	CCDS31165.1, CCDS41496.1, CCDS60501.1, CCDS60502.1, CCDS60504.1, CCDS60505.1	10p12.31	2009-09-16			ENSG00000120549	ENSG00000120549			25428	protein-coding gene	gene with protein product	"""sickle tail"""					10574462	Standard	XM_005252500		Approved	DKFZP761L0424, SKT	uc001iru.4	Q5T5P2	OTTHUMG00000017824	ENST00000376454.3:c.5714C>G	10.37:g.24835135C>G	ENSP00000365637:p.Ser1905*	Somatic		WXS	Illumina HiSeq	Phase_IV	A5LHW9|A6NLF3|A6PVQ5|A6PVQ6|A6PVQ7|B9EGK4|Q4KMG4|Q5T5P3|Q5T7H3|Q6MZZ6|Q6ZUI4|Q8WV45|Q9NSR2|Q9ULK3	Nonsense_Mutation	SNP	pfam_AIP3_C	p.S1905*	ENST00000376454.3	37	c.5714	CCDS31165.1	10	.	.	.	.	.	.	.	.	.	.	C	42	9.247267	0.99113	.	.	ENSG00000120549	ENST00000376462;ENST00000458595;ENST00000376454;ENST00000376452;ENST00000450158	.	.	.	4.51	4.51	0.55191	.	0.085303	0.49916	D	0.000134	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.46703	T	0.11	.	16.8539	0.86000	0.0:1.0:0.0:0.0	.	.	.	.	X	1226;1311;1905;1336;1494	.	ENSP00000365635:S1336X	S	+	2	0	KIAA1217	24875141	0.622000	0.27085	0.011000	0.14972	0.481000	0.33189	2.327000	0.43858	2.061000	0.61500	0.655000	0.94253	TCA	KIAA1217	-	NULL		0.542	KIAA1217-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIAA1217	HGNC	protein_coding	OTTHUMT00000047223.2	C	NM_019590		24835135	+1	no_errors	ENST00000376454	ensembl	human	known	70_37	nonsense	SNP	0.924	G
KIAA2026	158358	genome.wustl.edu	37	9	5921188	5921188	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:5921188G>A	ENST00000399933.3	-	8	4807	c.4808C>T	c.(4807-4809)aCc>aTc	p.T1603I	KIAA2026_ENST00000381461.2_Missense_Mutation_p.T1573I	NM_001017969.2	NP_001017969.2	Q5HYC2	K2026_HUMAN	KIAA2026	1603										breast(6)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(15)|ovary(2)|prostate(2)|skin(1)	46		Acute lymphoblastic leukemia(23;0.158)		GBM - Glioblastoma multiforme(50;0.00155)|Lung(218;0.124)		TCCTTTTGGGGTTACATTTTG	0.348																																																	0													148.0	135.0	139.0					9																	5921188		1853	4100	5953	SO:0001583	missense	158358			AB095946		9p24.1	2014-01-10			ENSG00000183354	ENSG00000183354			23378	protein-coding gene	gene with protein product							Standard	NM_001017969		Approved	FLJ20375	uc003zjq.4	Q5HYC2	OTTHUMG00000019507	ENST00000399933.3:c.4808C>T	9.37:g.5921188G>A	ENSP00000382815:p.Thr1603Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTP2|B9EGW7|Q4VXA2|Q8IVE5	Missense_Mutation	SNP	superfamily_Bromodomain	p.T1603I	ENST00000399933.3	37	c.4808		9	.	.	.	.	.	.	.	.	.	.	G	4.193	0.034475	0.08101	.	.	ENSG00000183354	ENST00000399933;ENST00000381461	.	.	.	5.13	2.24	0.28232	.	0.571033	0.16887	N	0.195467	T	0.25195	0.0612	L	0.27053	0.805	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.15037	-1.0451	9	0.38643	T	0.18	1.5865	4.3456	0.11131	0.3321:0.0:0.5161:0.1518	.	1603	Q5HYC2	K2026_HUMAN	I	1603;1573	.	ENSP00000370870:T1573I	T	-	2	0	KIAA2026	5911188	0.994000	0.37717	0.833000	0.33012	0.329000	0.28539	1.758000	0.38410	0.307000	0.22880	-0.225000	0.12378	ACC	KIAA2026	-	NULL		0.348	KIAA2026-002	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	KIAA2026	HGNC	protein_coding	OTTHUMT00000051652.2	G	NM_001017969		5921188	-1	no_errors	ENST00000399933	ensembl	human	novel	70_37	missense	SNP	0.154	A
KIF4A	24137	genome.wustl.edu	37	X	69521874	69521874	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chrX:69521874C>A	ENST00000374403.3	+	6	723	c.641C>A	c.(640-642)gCc>gAc	p.A214D	KIF4A_ENST00000374388.3_Missense_Mutation_p.A214D	NM_012310.4	NP_036442.3	O95239	KIF4A_HUMAN	kinesin family member 4A	214	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				anterograde axon cargo transport (GO:0008089)|antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|organelle organization (GO:0006996)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle microtubule (GO:0005876)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|DNA binding (GO:0003677)|microtubule motor activity (GO:0003777)|plus-end-directed microtubule motor activity (GO:0008574)			breast(6)|endometrium(9)|kidney(3)|large_intestine(8)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	51						CGATCTCATGCCATCTTTACA	0.398																																																	0													85.0	72.0	76.0					X																	69521874		2203	4299	6502	SO:0001583	missense	24137			AF179308	CCDS14401.1	Xq13.1	2008-08-11			ENSG00000090889	ENSG00000090889		"""Kinesins"""	13339	protein-coding gene	gene with protein product	"""chromokinesin"""	300521				10773663	Standard	NM_012310		Approved	KIF4-G1, KIF4, HSA271784, FLJ12530, FLJ12655, FLJ14204, FLJ20631	uc004dyg.3	O95239	OTTHUMG00000021775	ENST00000374403.3:c.641C>A	X.37:g.69521874C>A	ENSP00000363524:p.Ala214Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7V5|D3DVU4|Q86TN3|Q86XX7|Q9NNY6|Q9NY24|Q9UMW3	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.A214D	ENST00000374403.3	37	c.641	CCDS14401.1	X	.	.	.	.	.	.	.	.	.	.	C	25.9	4.688983	0.88735	.	.	ENSG00000090889	ENST00000374388;ENST00000374403	T;T	0.74947	-0.89;-0.89	5.21	5.21	0.72293	Kinesin, motor domain (5);	0.000000	0.52532	D	0.000079	D	0.91188	0.7224	H	0.97682	4.055	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.77557	0.989;0.99	D	0.94424	0.7643	10	0.87932	D	0	.	16.7677	0.85528	0.0:1.0:0.0:0.0	.	214;214	O95239;O95239-2	KIF4A_HUMAN;.	D	214	ENSP00000363509:A214D;ENSP00000363524:A214D	ENSP00000363509:A214D	A	+	2	0	KIF4A	69438599	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.487000	0.81328	2.163000	0.67991	0.538000	0.68166	GCC	KIF4A	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom		0.398	KIF4A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIF4A	HGNC	protein_coding	OTTHUMT00000057068.1	C	NM_012310		69521874	+1	no_errors	ENST00000374403	ensembl	human	known	70_37	missense	SNP	1.000	A
KLHL29	114818	genome.wustl.edu	37	2	23929507	23929507	+	Silent	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:23929507G>T	ENST00000486442.1	+	14	3318	c.2601G>T	c.(2599-2601)gtG>gtT	p.V867V		NM_052920.1	NP_443152.1	Q96CT2	KLH29_HUMAN	kelch-like family member 29	867										breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|lung(1)|ovary(3)	10						GCTGCGTCGTGATAAAGAAAT	0.547																																																	0													44.0	47.0	46.0					2																	23929507		692	1591	2283	SO:0001819	synonymous_variant	114818				CCDS54335.1	2p23.3	2013-09-27	2013-02-22	2007-01-09	ENSG00000119771	ENSG00000119771		"""Kelch-like"", ""BTB/POZ domain containing"""	29404	protein-coding gene	gene with protein product			"""kelch repeat and BTB (POZ) domain containing 9"", ""kelch-like 29 (Drosophila)"""	KBTBD9		11572484	Standard	NM_052920		Approved	KIAA1921	uc010ykg.2	Q96CT2	OTTHUMG00000151899	ENST00000486442.1:c.2601G>T	2.37:g.23929507G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N388|Q96BF0|Q96PW7	Silent	SNP	pfam_Kelch_1,pfam_BACK,pfam_Kelch_2,pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_BACK,smart_Kelch_1,pfscan_BTB/POZ-like	p.V867	ENST00000486442.1	37	c.2601	CCDS54335.1	2																																																																																			KLHL29	-	smart_Kelch_1		0.547	KLHL29-001	KNOWN	mRNA_start_NF|basic|appris_principal|CCDS	protein_coding	KLHL29	HGNC	protein_coding	OTTHUMT00000324315.3	G	NM_052920		23929507	+1	no_errors	ENST00000486442	ensembl	human	known	70_37	silent	SNP	1.000	T
KRT16P3	644945	genome.wustl.edu	37	17	20404880	20404880	+	RNA	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr17:20404880G>T	ENST00000580113.1	-	0	1012									keratin 16 pseudogene 3																		GAGGAGCAGGGAGACAGCTGG	0.567																																																	0																																												644945			BC110641		17p11.2	2014-06-12			ENSG00000214822	ENSG00000214822			37808	pseudogene	pseudogene			"""cytokeratin, Smith Magenis syndrome chromosome region"""	KERSMCR			Standard	NR_029393		Approved	MGC102966	uc002gxb.3		OTTHUMG00000130724		17.37:g.20404880G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000580113.1	37	NULL		17																																																																																			KRT16P3	-	-		0.567	KRT16P3-004	KNOWN	basic	processed_transcript	KRT16P3	HGNC	pseudogene	OTTHUMT00000443764.1	G	NR_029393		20404880	-1	no_errors	ENST00000580621	ensembl	human	known	70_37	rna	SNP	0.202	T
LACC1	144811	genome.wustl.edu	37	13	44455579	44455579	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:44455579C>T	ENST00000441843.1	+	2	943	c.458C>T	c.(457-459)aCa>aTa	p.T153I	CCDC122_ENST00000476570.2_5'Flank|LACC1_ENST00000325686.6_Missense_Mutation_p.T153I|CCDC122_ENST00000444614.3_5'Flank	NM_001128303.1	NP_001121775.1	Q8IV20	LACC1_HUMAN	laccase (multicopper oxidoreductase) domain containing 1	153																	AACGTAATCACAGCTCAAGAA	0.338																																																	0													73.0	79.0	77.0					13																	44455579		2203	4300	6503	SO:0001583	missense	144811			AK096044	CCDS9391.1	13q14.11	2012-05-11	2011-08-09	2011-08-09	ENSG00000179630	ENSG00000179630			26789	protein-coding gene	gene with protein product		613409	"""chromosome 13 open reading frame 31"""	C13orf31		16740638, 22504414	Standard	NM_153218		Approved	FLJ38725	uc010acg.3	Q8IV20	OTTHUMG00000016826	ENST00000441843.1:c.458C>T	13.37:g.44455579C>T	ENSP00000391747:p.Thr153Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A3Z6|Q8N8X5	Missense_Mutation	SNP	pfam_Cu_polyphenol_OxRdtase_Laccase,superfamily_Cytotoxic_necrot_fac-like_cat	p.T153I	ENST00000441843.1	37	c.458	CCDS9391.1	13	.	.	.	.	.	.	.	.	.	.	C	10.45	1.354186	0.24512	.	.	ENSG00000179630	ENST00000441843;ENST00000425906;ENST00000325686	T;T	0.46063	0.88;0.88	5.87	4.11	0.48088	.	0.279522	0.40144	N	0.001170	T	0.42854	0.1221	M	0.68317	2.08	0.09310	N	0.999994	D	0.56035	0.974	P	0.45913	0.497	T	0.44421	-0.9329	10	0.72032	D	0.01	-1.9567	6.8097	0.23796	0.1438:0.7127:0.0:0.1436	.	153	Q8IV20	LACC1_HUMAN	I	153	ENSP00000391747:T153I;ENSP00000317619:T153I	ENSP00000317619:T153I	T	+	2	0	LACC1	43353579	0.065000	0.20965	0.915000	0.36163	0.190000	0.23558	2.195000	0.42677	0.903000	0.36546	0.655000	0.94253	ACA	LACC1	-	NULL		0.338	LACC1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	LACC1	HGNC	protein_coding	OTTHUMT00000044726.3	C	NM_153218		44455579	+1	no_errors	ENST00000325686	ensembl	human	known	70_37	missense	SNP	0.181	T
LAMB2	3913	genome.wustl.edu	37	3	49160566	49160566	+	Splice_Site	SNP	A	A	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:49160566A>G	ENST00000418109.1	-	27	4387	c.4223T>C	c.(4222-4224)cTg>cCg	p.L1408P	USP19_ENST00000417901.1_5'Flank|USP19_ENST00000398892.3_5'Flank|LAMB2_ENST00000305544.4_Splice_Site_p.L1408P|LAMB2_ENST00000464891.1_5'Flank|USP19_ENST00000488993.1_5'Flank|USP19_ENST00000453664.1_5'Flank|USP19_ENST00000434032.2_5'Flank|USP19_ENST00000398888.2_5'Flank	NM_002292.3	NP_002283.3	P55268	LAMB2_HUMAN	laminin, beta 2 (laminin S)	1408	Domain II.				astrocyte development (GO:0014002)|axon extension involved in regeneration (GO:0048677)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|metanephric glomerular basement membrane development (GO:0072274)|metanephric glomerular visceral epithelial cell development (GO:0072249)|neuromuscular junction development (GO:0007528)|retina development in camera-type eye (GO:0060041)|Schwann cell development (GO:0014044)|visual perception (GO:0007601)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|laminin-11 complex (GO:0043260)|laminin-3 complex (GO:0005608)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|endometrium(15)|kidney(3)|large_intestine(6)|lung(21)|ovary(4)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	61				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.00219)|KIRC - Kidney renal clear cell carcinoma(197;0.00245)		CAACCTCACCAGCTCATTTAT	0.577																																																	0													105.0	99.0	101.0					3																	49160566		2203	4300	6503	SO:0001630	splice_region_variant	3913				CCDS2789.1	3p21.3-p21.2	2013-03-01			ENSG00000172037	ENSG00000172037		"""Laminins"""	6487	protein-coding gene	gene with protein product	"""laminin S"""	150325		LAMS		2922051, 10393422	Standard	NM_002292		Approved		uc003cwe.3	P55268	OTTHUMG00000156807	ENST00000418109.1:c.4224+1T>C	3.37:g.49160566A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16321	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,pfscan_Laminin_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.L1408P	ENST00000418109.1	37	c.4223	CCDS2789.1	3	.	.	.	.	.	.	.	.	.	.	A	9.087	1.000746	0.19121	.	.	ENSG00000172037	ENST00000418109;ENST00000305544;ENST00000395387	T;T	0.34275	1.37;1.37	5.5	5.5	0.81552	.	0.131736	0.47093	D	0.000248	T	0.42337	0.1198	L	0.47716	1.5	0.80722	D	1	D	0.60575	0.988	P	0.54664	0.758	T	0.26503	-1.0101	10	0.39692	T	0.17	.	9.288	0.37769	0.7267:0.0:0.0:0.2733	.	1408	P55268	LAMB2_HUMAN	P	1408;1408;175	ENSP00000388325:L1408P;ENSP00000307156:L1408P	ENSP00000307156:L1408P	L	-	2	0	LAMB2	49135570	1.000000	0.71417	0.997000	0.53966	0.086000	0.17979	5.029000	0.64121	2.076000	0.62316	0.482000	0.46254	CTG	LAMB2	-	NULL		0.577	LAMB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMB2	HGNC	protein_coding	OTTHUMT00000345939.1	A	NM_002292	Missense_Mutation	49160566	-1	no_errors	ENST00000305544	ensembl	human	known	70_37	missense	SNP	1.000	G
LILRA2	11027	genome.wustl.edu	37	19	55086222	55086222	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:55086222C>G	ENST00000251377.3	+	5	510	c.377C>G	c.(376-378)tCa>tGa	p.S126*	LILRB1_ENST00000396321.2_Intron|LILRA2_ENST00000251376.3_Nonsense_Mutation_p.S126*|LILRA2_ENST00000391737.1_Nonsense_Mutation_p.S114*|LILRA2_ENST00000495786.1_3'UTR|LILRA2_ENST00000391738.3_Nonsense_Mutation_p.S126*|LILRB1_ENST00000418536.2_Intron|LILRB1_ENST00000448689.1_Intron			Q8N149	LIRA2_HUMAN	leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 2	126	Ig-like C2-type 2.				defense response (GO:0006952)|immune system process (GO:0002376)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	antigen binding (GO:0003823)|receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(4)|large_intestine(2)|lung(33)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	50				GBM - Glioblastoma multiforme(193;0.0963)		CCCACCCTCTCAGCTCTGCCC	0.567																																																	0													126.0	121.0	122.0					19																	55086222		2203	4300	6503	SO:0001587	stop_gained	11027			U82275	CCDS12900.1, CCDS46179.1, CCDS74453.1	19q13.4	2013-01-11			ENSG00000239998	ENSG00000239998		"""Leukocyte immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6603	protein-coding gene	gene with protein product		604812				9079806, 9548455	Standard	XM_005258452		Approved	LIR-7, ILT1, CD85h, LIR7		Q8N149	OTTHUMG00000065703	ENST00000251377.3:c.377C>G	19.37:g.55086222C>G	ENSP00000251377:p.Ser126*	Somatic		WXS	Illumina HiSeq	Phase_IV	O75020	Nonsense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pirsf_A1B_glyco/leuk_Ig-like_rcpt,pfscan_Ig-like	p.S126*	ENST00000251377.3	37	c.377	CCDS46179.1	19	.	.	.	.	.	.	.	.	.	.	C	15.61	2.885941	0.51908	.	.	ENSG00000239998	ENST00000439534;ENST00000251377;ENST00000391738;ENST00000251376;ENST00000391737	.	.	.	2.93	1.85	0.25348	.	0.638257	0.13460	N	0.386259	.	.	.	.	.	.	0.22081	N	0.999377	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	.	6.2118	0.20633	0.0:0.8502:0.0:0.1498	.	.	.	.	X	126;126;126;126;114	.	ENSP00000251376:S126X	S	+	2	0	LILRA2	59778034	0.379000	0.25123	0.070000	0.20053	0.079000	0.17450	0.970000	0.29383	0.550000	0.28991	0.508000	0.49915	TCA	LILRA2	-	pirsf_A1B_glyco/leuk_Ig-like_rcpt		0.567	LILRA2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LILRA2	HGNC	protein_coding	OTTHUMT00000140813.2	C			55086222	+1	no_errors	ENST00000251377	ensembl	human	known	70_37	nonsense	SNP	0.228	G
PRKAG2	51422	genome.wustl.edu	37	7	151507895	151507895	+	Intron	SNP	A	A	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr7:151507895A>G	ENST00000287878.4	-	2	619				RP13-452N2.1_ENST00000462083.2_RNA|PRKAG2_ENST00000392801.2_Intron	NM_016203.3	NP_057287.2	Q9UGJ0	AAKG2_HUMAN	protein kinase, AMP-activated, gamma 2 non-catalytic subunit						ATP biosynthetic process (GO:0006754)|carnitine shuttle (GO:0006853)|cell cycle arrest (GO:0007050)|cellular lipid metabolic process (GO:0044255)|energy reserve metabolic process (GO:0006112)|fatty acid biosynthetic process (GO:0006633)|glycogen metabolic process (GO:0005977)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|membrane organization (GO:0061024)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of protein serine/threonine kinase activity (GO:0071901)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of protein kinase activity (GO:0045860)|regulation of fatty acid biosynthetic process (GO:0042304)|regulation of fatty acid metabolic process (GO:0019217)|regulation of fatty acid oxidation (GO:0046320)|regulation of glucose import (GO:0046324)|regulation of glycolytic process (GO:0006110)|small molecule metabolic process (GO:0044281)|sterol biosynthetic process (GO:0016126)	AMP-activated protein kinase complex (GO:0031588)|cytosol (GO:0005829)|extracellular space (GO:0005615)|nucleoplasm (GO:0005654)	ADP binding (GO:0043531)|AMP binding (GO:0016208)|ATP binding (GO:0005524)|cAMP-dependent protein kinase inhibitor activity (GO:0004862)|cAMP-dependent protein kinase regulator activity (GO:0008603)|phosphorylase kinase regulator activity (GO:0008607)|protein kinase activator activity (GO:0030295)|protein kinase binding (GO:0019901)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(10)|upper_aerodigestive_tract(1)	26	all_neural(206;0.187)	all_hematologic(28;0.0605)	OV - Ovarian serous cystadenocarcinoma(82;0.00252)	UCEC - Uterine corpus endometrioid carcinoma (81;0.185)	Acetylsalicylic acid(DB00945)	TAAAATCAAAACAAACACCTA	0.483																																																	0													245.0	205.0	217.0					7																	151507895		692	1591	2283	SO:0001627	intron_variant	644090			AF087875	CCDS5928.1, CCDS43683.1, CCDS47752.1	7q35-q36	2014-09-17			ENSG00000106617	ENSG00000106617			9386	protein-coding gene	gene with protein product	"""AMPK gamma2"""	602743				8557660, 8621499	Standard	NM_024429		Approved	AAKG, AAKG2, H91620p, WPWS, CMH6	uc003wkk.3	Q9UGJ0	OTTHUMG00000157324	ENST00000287878.4:c.115-24268T>C	7.37:g.151507895A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53Y07|Q6NUI0|Q75MP4|Q9NUZ9|Q9UDN8|Q9ULX8	RNA	SNP	-	NULL	ENST00000287878.4	37	NULL	CCDS5928.1	7																																																																																			RP13-452N2.1	-	-		0.483	PRKAG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC644090	Clone_based_vega_gene	protein_coding	OTTHUMT00000348440.2	A	NM_016203		151507895	+1	no_errors	ENST00000462083	ensembl	human	known	70_37	rna	SNP	0.465	G
LPIN2	9663	genome.wustl.edu	37	18	2931377	2931377	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr18:2931377G>T	ENST00000261596.4	-	9	1571	c.1333C>A	c.(1333-1335)Cag>Aag	p.Q445K		NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2	445					cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		CCCACGGACTGTGGGGACTGG	0.602																																																	0													49.0	37.0	41.0					18																	2931377		2203	4300	6503	SO:0001583	missense	9663			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.1333C>A	18.37:g.2931377G>T	ENSP00000261596:p.Gln445Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD25|D3DUH3	Missense_Mutation	SNP	pfam_LNS2,pfam_Lipin_N,superfamily_HAD-like_dom,smart_LNS2	p.Q445K	ENST00000261596.4	37	c.1333	CCDS11829.1	18	.	.	.	.	.	.	.	.	.	.	G	33	5.275024	0.95459	.	.	ENSG00000101577	ENST00000261596	T	0.80824	-1.42	5.96	5.96	0.96718	.	0.000000	0.85682	D	0.000000	D	0.82660	0.5085	L	0.53561	1.675	0.80722	D	1	D	0.54772	0.968	P	0.49953	0.627	T	0.77824	-0.2444	10	0.18710	T	0.47	-23.3326	20.4018	0.98996	0.0:0.0:1.0:0.0	.	445	Q92539	LPIN2_HUMAN	K	445	ENSP00000261596:Q445K	ENSP00000261596:Q445K	Q	-	1	0	LPIN2	2921377	1.000000	0.71417	0.997000	0.53966	0.994000	0.84299	9.316000	0.96319	2.815000	0.96918	0.650000	0.86243	CAG	LPIN2	-	NULL		0.602	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LPIN2	HGNC	protein_coding	OTTHUMT00000254363.2	G	NM_014646		2931377	-1	no_errors	ENST00000261596	ensembl	human	known	70_37	missense	SNP	1.000	T
LRFN5	145581	genome.wustl.edu	37	14	42077623	42077623	+	5'UTR	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr14:42077623G>A	ENST00000298119.4	+	0	851				LRFN5_ENST00000554120.1_5'UTR|LRFN5_ENST00000555279.1_3'UTR	NM_152447.3	NP_689660.2	Q96NI6	LRFN5_HUMAN	leucine rich repeat and fibronectin type III domain containing 5							integral component of membrane (GO:0016021)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(12)|liver(1)|lung(67)|ovary(5)|pancreas(3)|prostate(1)|skin(9)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(2)	120			LUAD - Lung adenocarcinoma(50;0.0223)|Lung(238;0.0728)	GBM - Glioblastoma multiforme(112;0.00847)		CCTACGATGCGGGTGCTGAGC	0.652										HNSCC(30;0.082)																																							0																																										SO:0001623	5_prime_UTR_variant	145581			AK055365	CCDS9678.1	14q21.1	2013-02-11	2004-02-02	2004-02-04	ENSG00000165379	ENSG00000165379		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	20360	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 8"""	612811	"""chromosome 14 open reading frame 146"""	C14orf146		16828986	Standard	NM_152447		Approved	FIGLER8, SALM5	uc001wvm.3	Q96NI6	OTTHUMG00000140261	ENST00000298119.4:c.-339G>A	14.37:g.42077623G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU78|Q86XL2	RNA	SNP	-	NULL	ENST00000298119.4	37	NULL	CCDS9678.1	14																																																																																			LRFN5	-	-		0.652	LRFN5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRFN5	HGNC	protein_coding	OTTHUMT00000276786.1	G	NM_152447		42077623	+1	no_errors	ENST00000553926	ensembl	human	known	70_37	rna	SNP	1.000	A
LTK	4058	genome.wustl.edu	37	15	41797410	41797410	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr15:41797410G>T	ENST00000263800.6	-	15	2017	c.1921C>A	c.(1921-1923)Cac>Aac	p.H641N	LTK_ENST00000561619.1_Missense_Mutation_p.H339N|LTK_ENST00000355166.5_Missense_Mutation_p.H580N|LTK_ENST00000453182.2_Missense_Mutation_p.H511N	NM_002344.5	NP_002335.2	P29376	LTK_HUMAN	leukocyte receptor tyrosine kinase	641	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell proliferation (GO:0008283)|cellular response to retinoic acid (GO:0071300)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|positive regulation of cardiac muscle cell apoptotic process (GO:0010666)|positive regulation of neuron projection development (GO:0010976)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(16)|skin(3)|urinary_tract(1)	26		all_cancers(109;1.89e-19)|all_epithelial(112;2.28e-16)|Lung NSC(122;5.34e-11)|all_lung(180;1.33e-09)|Melanoma(134;0.0179)|Ovarian(310;0.143)|Colorectal(260;0.172)		OV - Ovarian serous cystadenocarcinoma(18;2.1e-17)|GBM - Glioblastoma multiforme(113;1.34e-06)|Colorectal(105;0.0148)|BRCA - Breast invasive adenocarcinoma(123;0.113)		CCTAACCTGTGGATGAAGTGA	0.582										TSP Lung(18;0.14)																																							0													70.0	62.0	65.0					15																	41797410		2203	4300	6503	SO:0001583	missense	4058			D16105	CCDS10077.1, CCDS10078.1, CCDS45237.1	15q15.1-q21.1	2009-07-10	2008-01-23		ENSG00000062524	ENSG00000062524	2.7.10.1		6721	protein-coding gene	gene with protein product		151520	"""leukocyte tyrosine kinase"""			2320375	Standard	NM_206961		Approved	TYK1	uc001zoa.3	P29376	OTTHUMG00000130339	ENST00000263800.6:c.1921C>A	15.37:g.41797410G>T	ENSP00000263800:p.His641Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNJ8|B4DL89|E9PFX4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.H641N	ENST00000263800.6	37	c.1921	CCDS10077.1	15	.	.	.	.	.	.	.	.	.	.	G	19.81	3.896105	0.72639	.	.	ENSG00000062524	ENST00000355166;ENST00000263800;ENST00000453182	D;D;D	0.97404	-4.37;-4.37;-1.86	4.29	3.3	0.37823	Serine-threonine/tyrosine-protein kinase (2);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	.	.	.	.	D	0.98934	0.9638	H	0.98682	4.3	0.52501	D	0.999958	D;D;D;D	0.89917	1.0;0.999;1.0;1.0	D;D;D;D	0.97110	0.999;0.979;1.0;1.0	D	0.98378	1.0557	9	0.87932	D	0	.	10.0	0.41922	0.1116:0.0:0.8884:0.0	.	511;511;580;641	E9PFX4;B4DL89;P29376-4;P29376	.;.;.;LTK_HUMAN	N	580;641;511	ENSP00000347293:H580N;ENSP00000263800:H641N;ENSP00000392196:H511N	ENSP00000263800:H641N	H	-	1	0	LTK	39584702	1.000000	0.71417	0.977000	0.42913	0.991000	0.79684	3.425000	0.52771	0.894000	0.36317	0.561000	0.74099	CAC	LTK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom		0.582	LTK-001	KNOWN	basic|CCDS	protein_coding	LTK	HGNC	protein_coding	OTTHUMT00000252690.2	G			41797410	-1	no_errors	ENST00000263800	ensembl	human	known	70_37	missense	SNP	1.000	T
LYRM4	57128	genome.wustl.edu	37	6	5144479	5144479	+	Intron	SNP	T	T	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr6:5144479T>C	ENST00000330636.4	-	3	413				LYRM4_ENST00000468929.1_Intron|LYRM4_ENST00000464010.1_Silent_p.T75T|LYRM4_ENST00000480566.1_Intron	NM_020408.4	NP_065141.3	Q9HD34	LYRM4_HUMAN	LYR motif containing 4						small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)				endometrium(1)	1	Ovarian(93;0.11)	all_hematologic(90;0.0901)				TCCTGGCGGCTGTGCCTTGCT	0.547																																					NSCLC(130;1006 2426 17608 36797)												0													49.0	52.0	51.0					6																	5144479		692	1591	2283	SO:0001627	intron_variant	57128			AF258559	CCDS4493.1, CCDS54961.1	6p25.1	2008-02-05	2006-09-19	2006-09-19	ENSG00000214113	ENSG00000214113		"""LYR motif containing"""	21365	protein-coding gene	gene with protein product		613311	"""chromosome 6 open reading frame 149"""	C6orf149			Standard	XM_005249239		Approved	CGI-203, ISD11	uc021ykw.1	Q9HD34	OTTHUMG00000014173	ENST00000330636.4:c.208-34754A>G	6.37:g.5144479T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K543|Q5XKP1	Silent	SNP	pfam_Complex1_LYR	p.T75	ENST00000330636.4	37	c.225	CCDS4493.1	6																																																																																			LYRM4	-	NULL		0.547	LYRM4-001	KNOWN	basic|CCDS	protein_coding	LYRM4	HGNC	protein_coding	OTTHUMT00000353461.3	T	NM_020408		5144479	-1	no_errors	ENST00000464010	ensembl	human	putative	70_37	silent	SNP	0.000	C
MDGA2	161357	genome.wustl.edu	37	14	47566263	47566263	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr14:47566263G>A	ENST00000399232.2	-	6	1146	c.782C>T	c.(781-783)aCa>aTa	p.T261I	MDGA2_ENST00000439988.3_Missense_Mutation_p.T330I|MDGA2_ENST00000426342.1_Missense_Mutation_p.T32I|MDGA2_ENST00000357362.3_Missense_Mutation_p.T32I	NM_001113498.2	NP_001106970.3	Q7Z553	MDGA2_HUMAN	MAM domain containing glycosylphosphatidylinositol anchor 2	261	Ig-like 3.				pattern specification process (GO:0007389)|spinal cord motor neuron differentiation (GO:0021522)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)				breast(3)|endometrium(4)|kidney(2)|large_intestine(14)|lung(41)|ovary(4)|pancreas(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(5)	76						ACATACTAATGTTATGGCCTC	0.438																																																	0													124.0	118.0	120.0					14																	47566263		1906	4112	6018	SO:0001583	missense	161357			AI859192	CCDS41948.1, CCDS45098.1, CCDS45098.2, CCDS45098.3	14q21.2	2013-01-29	2007-04-03	2007-04-03	ENSG00000139915	ENSG00000139915		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	19835	protein-coding gene	gene with protein product		611128	"""MAM domain containing 1"""	MAMDC1		15019943	Standard	NM_001113498		Approved		uc001wwj.4	Q7Z553	OTTHUMG00000029429	ENST00000399232.2:c.782C>T	14.37:g.47566263G>A	ENSP00000382178:p.Thr261Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	F6W3S7|J3KPX6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_MAM_dom,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_MAM_dom,pfscan_MAM_dom,pfscan_Ig-like	p.T330I	ENST00000399232.2	37	c.989		14	.	.	.	.	.	.	.	.	.	.	G	25.1	4.606287	0.87157	.	.	ENSG00000139915	ENST00000439988;ENST00000426342;ENST00000399232;ENST00000357362	T;T;T;T	0.16743	2.32;2.32;2.32;2.32	5.65	5.65	0.86999	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.52532	U	0.000066	T	0.33585	0.0868	L	0.56340	1.77	0.80722	D	1	D	0.53462	0.96	P	0.58130	0.833	T	0.00257	-1.1872	10	0.28530	T	0.3	.	18.6475	0.91416	0.0:0.0:1.0:0.0	.	261	Q7Z553	MDGA2_HUMAN	I	261;32;330;32	ENSP00000400011:T261I;ENSP00000405456:T32I;ENSP00000382178:T330I;ENSP00000349925:T32I	ENSP00000349925:T32I	T	-	2	0	MDGA2	46636013	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.067000	0.93955	2.821000	0.97095	0.650000	0.86243	ACA	MDGA2	-	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.438	MDGA2-001	KNOWN	upstream_ATG|basic|appris_principal	protein_coding	MDGA2	HGNC	protein_coding	OTTHUMT00000073352.5	G	NM_182830		47566263	-1	no_errors	ENST00000399232	ensembl	human	known	70_37	missense	SNP	1.000	A
MDN1	23195	genome.wustl.edu	37	6	90455255	90455255	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr6:90455255C>T	ENST00000369393.3	-	28	4110	c.3995G>A	c.(3994-3996)tGt>tAt	p.C1332Y	MDN1_ENST00000428876.1_Missense_Mutation_p.C1332Y			Q9NU22	MDN1_HUMAN	MDN1, midasin homolog (yeast)	1332					ATP catabolic process (GO:0006200)|protein complex assembly (GO:0006461)	cytoplasm (GO:0005737)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|unfolded protein binding (GO:0051082)			NS(1)|breast(13)|central_nervous_system(2)|cervix(3)|endometrium(22)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(52)|liver(1)|lung(83)|ovary(10)|pancreas(1)|prostate(10)|skin(6)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	218		all_cancers(76;1.47e-06)|Acute lymphoblastic leukemia(125;2.23e-10)|Prostate(29;5.55e-10)|all_hematologic(105;2.42e-06)|all_epithelial(107;0.00246)		BRCA - Breast invasive adenocarcinoma(108;0.0193)		AGATTGAGGACACAATTTTTT	0.393																																																	0													85.0	86.0	86.0					6																	90455255		2203	4300	6503	SO:0001583	missense	23195			AF503925	CCDS5024.1	6q15	2014-01-28			ENSG00000112159	ENSG00000112159			18302	protein-coding gene	gene with protein product						9205841, 12102729	Standard	XM_005248699		Approved	KIAA0301	uc003pnn.1	Q9NU22	OTTHUMG00000015213	ENST00000369393.3:c.3995G>A	6.37:g.90455255C>T	ENSP00000358400:p.Cys1332Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	O15019|Q5T794	Missense_Mutation	SNP	pfam_ATPase_dyneun-rel_AAA,pfam_ATPase_AAA-3,superfamily_ARM-type_fold,smart_AAA+_ATPase,smart_VWF_A,pirsf_Midasin,pfscan_VWF_A	p.C1332Y	ENST00000369393.3	37	c.3995	CCDS5024.1	6	.	.	.	.	.	.	.	.	.	.	C	10.84	1.465123	0.26335	.	.	ENSG00000112159	ENST00000369393;ENST00000428876	T;T	0.02974	4.09;4.09	6.07	5.21	0.72293	.	0.288789	0.41097	D	0.000955	T	0.00784	0.0026	L	0.31294	0.92	0.30736	N	0.746645	B	0.12630	0.006	B	0.06405	0.002	T	0.47018	-0.9149	10	0.10377	T	0.69	.	9.3759	0.38283	0.0:0.7775:0.0:0.2225	.	1332	Q9NU22	MDN1_HUMAN	Y	1332	ENSP00000358400:C1332Y;ENSP00000413970:C1332Y	ENSP00000358400:C1332Y	C	-	2	0	MDN1	90511976	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	3.952000	0.56691	1.584000	0.49913	0.655000	0.94253	TGT	MDN1	-	pirsf_Midasin		0.393	MDN1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	MDN1	HGNC	protein_coding	OTTHUMT00000041514.2	C			90455255	-1	no_errors	ENST00000369393	ensembl	human	known	70_37	missense	SNP	0.995	T
MFSD5	84975	genome.wustl.edu	37	12	53647154	53647154	+	Missense_Mutation	SNP	C	C	A	rs373745086		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:53647154C>A	ENST00000329548.4	+	2	726	c.535C>A	c.(535-537)Cat>Aat	p.H179N	MFSD5_ENST00000534842.1_Missense_Mutation_p.H286N	NM_032889.4	NP_116278.3	Q6N075	MFSD5_HUMAN	major facilitator superfamily domain containing 5	179					ion transport (GO:0006811)	integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)				breast(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)|skin(3)|urinary_tract(1)	16						CTTCTGGAACCATGTGCTGGC	0.607																																																	0													143.0	143.0	143.0					12																	53647154		2203	4300	6503	SO:0001583	missense	84975			AK097576	CCDS8851.1, CCDS53796.1	12q13.13	2012-03-09			ENSG00000182544	ENSG00000182544			28156	protein-coding gene	gene with protein product							Standard	NM_032889		Approved	MGC11308	uc001sch.2	Q6N075	OTTHUMG00000170028	ENST00000329548.4:c.535C>A	12.37:g.53647154C>A	ENSP00000332624:p.His179Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	G3V1N7|Q6NW04|Q8N7W8|Q8NCK0|Q96IA5	Missense_Mutation	SNP	pfam_DUF791,pfam_MFS,superfamily_MFS_dom_general_subst_transpt	p.H286N	ENST00000329548.4	37	c.856	CCDS8851.1	12	.	.	.	.	.	.	.	.	.	.	C	3.888	-0.024670	0.07589	.	.	ENSG00000182544	ENST00000551660;ENST00000534842;ENST00000328704;ENST00000329548	T;T	0.79352	-1.26;-1.26	4.36	4.36	0.52297	Major facilitator superfamily domain, general substrate transporter (1);	0.350346	0.30252	N	0.010055	T	0.48484	0.1502	N	0.01250	-0.93	0.31765	N	0.632822	B;B	0.15473	0.001;0.013	B;B	0.12837	0.008;0.008	T	0.53165	-0.8477	10	0.49607	T	0.09	-8.2349	7.559	0.27841	0.1854:0.6351:0.1796:0.0	.	179;286	Q6N075;G3V1N7	MFSD5_HUMAN;.	N	286;286;286;179	ENSP00000442688:H286N;ENSP00000332624:H179N	ENSP00000331231:H286N	H	+	1	0	MFSD5	51933421	0.998000	0.40836	1.000000	0.80357	0.993000	0.82548	1.441000	0.35035	2.268000	0.75426	0.561000	0.74099	CAT	MFSD5	-	pfam_DUF791,pfam_MFS,superfamily_MFS_dom_general_subst_transpt		0.607	MFSD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFSD5	HGNC	protein_coding	OTTHUMT00000406896.1	C	NM_032889		53647154	+1	no_errors	ENST00000534842	ensembl	human	known	70_37	missense	SNP	0.998	A
METTL25	84190	genome.wustl.edu	37	12	82752432	82752432	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:82752432G>A	ENST00000248306.3	+	1	157	c.88G>A	c.(88-90)Gcc>Acc	p.A30T	CCDC59_ENST00000548126.1_Intron|METTL25_ENST00000547357.1_3'UTR|CCDC59_ENST00000256151.7_5'UTR	NM_032230.2	NP_115606.2	Q8N6Q8	MET25_HUMAN	methyltransferase like 25	30							methyltransferase activity (GO:0008168)										CCTGAGGGATGCCCTGTCCAT	0.617											OREG0022008	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													109.0	89.0	95.0					12																	82752432		2203	4300	6503	SO:0001583	missense	84190			BC029120	CCDS9024.1	12q21.31	2012-08-13	2012-08-13	2012-08-13	ENSG00000127720	ENSG00000127720			26228	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 26"""	C12orf26			Standard	NM_032230		Approved	FLJ22789	uc001szq.3	Q8N6Q8	OTTHUMG00000170252	ENST00000248306.3:c.88G>A	12.37:g.82752432G>A	ENSP00000248306:p.Ala30Thr	Somatic	1216	WXS	Illumina HiSeq	Phase_IV	Q9H5Y3	Missense_Mutation	SNP	NULL	p.A30T	ENST00000248306.3	37	c.88	CCDS9024.1	12	.	.	.	.	.	.	.	.	.	.	G	8.732	0.916854	0.17907	.	.	ENSG00000127720	ENST00000248306;ENST00000548200	T	0.30714	1.52	5.49	4.6	0.57074	.	0.120861	0.64402	D	0.000010	T	0.25531	0.0621	L	0.45581	1.43	0.38409	D	0.945862	B	0.02656	0.0	B	0.04013	0.001	T	0.09250	-1.0683	10	0.23302	T	0.38	-8.4152	10.3879	0.44152	0.1516:0.0:0.8484:0.0	.	30	Q8N6Q8	CL026_HUMAN	T	30	ENSP00000248306:A30T	ENSP00000248306:A30T	A	+	1	0	C12orf26	81276563	0.913000	0.31002	0.094000	0.20943	0.054000	0.15201	1.873000	0.39558	1.330000	0.45394	-0.143000	0.13931	GCC	METTL25	-	NULL		0.617	METTL25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	METTL25	HGNC	protein_coding	OTTHUMT00000408192.1	G	NM_032230		82752432	+1	no_errors	ENST00000248306	ensembl	human	known	70_37	missense	SNP	0.919	A
MOV10L1	54456	genome.wustl.edu	37	22	50599405	50599405	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr22:50599405G>C	ENST00000262794.5	+	26	3558	c.3475G>C	c.(3475-3477)Ggt>Cgt	p.G1159R	MOV10L1_ENST00000395852.1_Missense_Mutation_p.G286R|MOV10L1_ENST00000540615.1_Intron|MOV10L1_ENST00000545383.1_Missense_Mutation_p.G1159R|MOV10L1_ENST00000395858.3_Missense_Mutation_p.G1113R	NM_018995.2	NP_061868.1	Q9BXT6	M10L1_HUMAN	Mov10 RISC complex RNA helicase like 1	1159					ATP catabolic process (GO:0006200)|germ cell development (GO:0007281)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	intracellular (GO:0005622)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|magnesium ion binding (GO:0000287)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|kidney(5)|large_intestine(18)|lung(20)|ovary(3)|prostate(1)|skin(9)|stomach(4)|urinary_tract(3)	67		all_cancers(38;3.31e-11)|all_epithelial(38;5.69e-10)|all_lung(38;3.73e-05)|Breast(42;0.000525)|Lung NSC(38;0.000954)|Ovarian(80;0.0367)|Lung SC(80;0.114)		LUAD - Lung adenocarcinoma(64;0.0215)|BRCA - Breast invasive adenocarcinoma(115;0.24)		CCCCTGTTTTGGTGCTTTGCT	0.517																																																	0													233.0	216.0	222.0					22																	50599405		2203	4300	6503	SO:0001583	missense	54456			AF285604	CCDS14084.1, CCDS54541.1, CCDS54542.1, CCDS54543.1	22q13.33	2014-07-02	2014-07-02		ENSG00000073146	ENSG00000073146			7201	protein-coding gene	gene with protein product	"""cardiac helicase activated by MEF2C protein"""	605794	"""Mov10 (mouse)-like 1"", ""Mov10l1, Moloney leukemia virus 10-like 1, homolog (mouse)"""			11279525	Standard	NM_018995		Approved	DJ402G11.8, DKFZp434B0717, CHAMP	uc003bjj.3	Q9BXT6	OTTHUMG00000044648	ENST00000262794.5:c.3475G>C	22.37:g.50599405G>C	ENSP00000262794:p.Gly1159Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E211|A8MXC6|B7WPP1|B7Z7R1|F5H403|Q5TGD5|Q8NBD4|Q9NXW3|Q9UFB3|Q9UGX9	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.G1159R	ENST00000262794.5	37	c.3475	CCDS14084.1	22	.	.	.	.	.	.	.	.	.	.	.	1.156	-0.645362	0.03531	.	.	ENSG00000073146	ENST00000545383;ENST00000262794;ENST00000395858;ENST00000395852	D;D;T;D	0.91792	-1.62;-1.62;-1.38;-2.91	5.14	2.82	0.32997	.	0.395476	0.32593	N	0.005899	T	0.81108	0.4754	L	0.27053	0.805	0.80722	D	1	B;B;B	0.18741	0.0;0.03;0.017	B;B;B	0.14023	0.001;0.01;0.007	T	0.67715	-0.5599	10	0.11485	T	0.65	-9.6345	2.5637	0.04778	0.2858:0.0:0.4882:0.226	.	286;1113;1159	Q9BXT6-2;A8MXC6;Q9BXT6	.;.;M10L1_HUMAN	R	1159;1159;1113;286	ENSP00000438978:G1159R;ENSP00000262794:G1159R;ENSP00000379199:G1113R;ENSP00000379193:G286R	ENSP00000262794:G1159R	G	+	1	0	MOV10L1	48941532	0.980000	0.34600	0.020000	0.16555	0.006000	0.05464	2.148000	0.42235	1.097000	0.41459	0.498000	0.49722	GGT	MOV10L1	-	NULL		0.517	MOV10L1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MOV10L1	HGNC	protein_coding	OTTHUMT00000075009.2	G	NM_018995		50599405	+1	no_errors	ENST00000262794	ensembl	human	known	70_37	missense	SNP	0.909	C
MPHOSPH6	10200	genome.wustl.edu	37	16	82203748	82203748	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:82203748C>G	ENST00000258169.4	-	1	83	c.33G>C	c.(31-33)aaG>aaC	p.K11N	MPHOSPH6_ENST00000567729.1_5'UTR|MPHOSPH6_ENST00000569021.1_Missense_Mutation_p.K11N|CTD-2588J6.2_ENST00000563841.1_lincRNA|MPHOSPH6_ENST00000563504.1_5'UTR	NM_005792.2	NP_005783.2	Q99547	MPH6_HUMAN	M-phase phosphoprotein 6	11					maturation of 5.8S rRNA (GO:0000460)	cytoplasm (GO:0005737)|exosome (RNase complex) (GO:0000178)|nucleolus (GO:0005730)|nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(1)|large_intestine(1)|lung(3)	5						GCAGTAGATTCTTGGACAACC	0.716																																																	0													33.0	24.0	27.0					16																	82203748		2199	4298	6497	SO:0001583	missense	10200			X98263	CCDS10937.1	16q23.3	2008-03-03			ENSG00000135698	ENSG00000135698			7214	protein-coding gene	gene with protein product		605500				8885239	Standard	NM_005792		Approved	MPP6	uc002fgw.3	Q99547	OTTHUMG00000137632	ENST00000258169.4:c.33G>C	16.37:g.82203748C>G	ENSP00000258169:p.Lys11Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAF0	Missense_Mutation	SNP	pfam_MPP6	p.K11N	ENST00000258169.4	37	c.33	CCDS10937.1	16	.	.	.	.	.	.	.	.	.	.	C	21.0	4.083898	0.76642	.	.	ENSG00000135698	ENST00000258169	T	0.52754	0.65	4.68	4.68	0.58851	.	0.094954	0.64402	D	0.000001	T	0.41743	0.1172	L	0.46819	1.47	0.58432	D	0.999997	B	0.24618	0.107	B	0.30716	0.119	T	0.43410	-0.9393	10	0.66056	D	0.02	-15.0115	8.6647	0.34114	0.0:0.898:0.0:0.102	.	11	Q99547	MPH6_HUMAN	N	11	ENSP00000258169:K11N	ENSP00000258169:K11N	K	-	3	2	MPHOSPH6	80761249	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	1.098000	0.31000	2.415000	0.81967	0.650000	0.86243	AAG	MPHOSPH6	-	pfam_MPP6		0.716	MPHOSPH6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPHOSPH6	HGNC	protein_coding	OTTHUMT00000269058.1	C	NM_005792		82203748	-1	no_errors	ENST00000258169	ensembl	human	known	70_37	missense	SNP	1.000	G
MTX2	10651	genome.wustl.edu	37	2	177188191	177188191	+	Splice_Site	SNP	T	T	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:177188191T>G	ENST00000249442.6	+	4	418	c.207T>G	c.(205-207)tcT>tcG	p.S69S	MTX2_ENST00000392529.2_Splice_Site_p.S59S|MTX2_ENST00000443241.1_Intron	NM_006554.4	NP_006545.1	O75431	MTX2_HUMAN	metaxin 2	69					cellular protein metabolic process (GO:0044267)|mitochondrial transport (GO:0006839)|protein targeting to mitochondrion (GO:0006626)	mitochondrial outer membrane (GO:0005741)				breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|ovary(1)|upper_aerodigestive_tract(1)	12			OV - Ovarian serous cystadenocarcinoma(117;0.00365)|Epithelial(96;0.0654)|all cancers(119;0.181)			TGTCTCCATCTGGTAAGTGTG	0.318																																																	0													222.0	194.0	204.0					2																	177188191		2203	4300	6503	SO:0001630	splice_region_variant	10651			AF053551	CCDS2272.1	2q31.1	2012-02-07			ENSG00000128654	ENSG00000128654			7506	protein-coding gene	gene with protein product		608555				10381257, 17624330	Standard	NM_006554		Approved		uc002ukx.3	O75431	OTTHUMG00000132514	ENST00000249442.6:c.208+1T>G	2.37:g.177188191T>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8JZZ4|Q53S50|Q53SQ2|Q5M7Z6|Q8IZ68	Silent	SNP	pfam_Tom37/metaxin,superfamily_Glutathione-S-Trfase_C-like,superfamily_Thioredoxin-like_fold	p.S69	ENST00000249442.6	37	c.207	CCDS2272.1	2																																																																																			MTX2	-	pfam_Tom37/metaxin,superfamily_Thioredoxin-like_fold		0.318	MTX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTX2	HGNC	protein_coding	OTTHUMT00000255695.4	T	NM_006554	Silent	177188191	+1	no_errors	ENST00000249442	ensembl	human	known	70_37	silent	SNP	1.000	G
MUC16	94025	genome.wustl.edu	37	19	9014541	9014541	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:9014541A>G	ENST00000397910.4	-	31	38637	c.38434T>C	c.(38434-38436)Tat>Cat	p.Y12812H		NM_024690.2	NP_078966.2	Q8WXI7	MUC16_HUMAN	mucin 16, cell surface associated	12814	SEA 5. {ECO:0000255|PROSITE- ProRule:PRU00188}.			Missing (in Ref. 3; AAK74120). {ECO:0000305}.	cell adhesion (GO:0007155)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|vesicle (GO:0031982)				NS(9)|autonomic_ganglia(1)|breast(26)|central_nervous_system(11)|cervix(1)|endometrium(46)|haematopoietic_and_lymphoid_tissue(5)|kidney(35)|large_intestine(91)|liver(1)|lung(278)|ovary(17)|pancreas(2)|prostate(17)|skin(18)|soft_tissue(1)|stomach(8)|upper_aerodigestive_tract(16)|urinary_tract(7)	590						CCATTGACATAGAGACTGTTT	0.557																																																	0													194.0	157.0	169.0					19																	9014541		1945	4138	6083	SO:0001583	missense	94025			AF414442	CCDS54212.1	19p13.2	2008-02-05	2006-03-14			ENSG00000181143		"""Mucins"""	15582	protein-coding gene	gene with protein product		606154				11369781	Standard	XM_006722941		Approved	CA125, FLJ14303	uc002mkp.3	Q8WXI7		ENST00000397910.4:c.38434T>C	19.37:g.9014541A>G	ENSP00000381008:p.Tyr12812His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZQW5|Q96RK2	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_SEA	p.Y12812H	ENST00000397910.4	37	c.38434	CCDS54212.1	19	.	.	.	.	.	.	.	.	.	.	.	7.732	0.699516	0.15106	.	.	ENSG00000181143	ENST00000397910	T	0.30714	1.52	3.03	3.03	0.35002	.	.	.	.	.	T	0.54886	0.1886	M	0.85542	2.76	.	.	.	D	0.76494	0.999	D	0.87578	0.998	T	0.67321	-0.5700	8	0.87932	D	0	.	7.7341	0.28804	1.0:0.0:0.0:0.0	.	12812	B5ME49	.	H	12812	ENSP00000381008:Y12812H	ENSP00000381008:Y12812H	Y	-	1	0	MUC16	8875541	0.984000	0.35163	0.975000	0.42487	0.035000	0.12851	3.298000	0.51818	1.367000	0.46095	0.254000	0.18369	TAT	MUC16	-	NULL		0.557	MUC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC16	HGNC	protein_coding	OTTHUMT00000402806.1	A	NM_024690		9014541	-1	no_errors	ENST00000397910	ensembl	human	known	70_37	missense	SNP	0.994	G
MYBPC2	4606	genome.wustl.edu	37	19	50957284	50957284	+	Missense_Mutation	SNP	C	C	T	rs539054221		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:50957284C>T	ENST00000357701.5	+	17	1808	c.1757C>T	c.(1756-1758)aCg>aTg	p.T586M		NM_004533.3	NP_004524.3	Q14324	MYPC2_HUMAN	myosin binding protein C, fast type	586	Ig-like C2-type 5.				cell adhesion (GO:0007155)|muscle filament sliding (GO:0030049)	cytosol (GO:0005829)|myosin filament (GO:0032982)	structural constituent of muscle (GO:0008307)			breast(1)	1		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.0079)|GBM - Glioblastoma multiforme(134;0.0144)		CAGGTATTCACGACCACCGAG	0.612													c|||	1	0.000199681	0.0008	0.0	5008	,	,		16791	0.0		0.0	False		,,,				2504	0.0																0													22.0	26.0	24.0					19																	50957284		2084	4201	6285	SO:0001583	missense	4606				CCDS46152.1	19q13.33	2013-02-11	2001-11-28		ENSG00000086967	ENSG00000086967		"""Myosin binding proteins"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7550	protein-coding gene	gene with protein product	"""fast-type muscle myosin-binding-protein C"""	160793	"""myosin-binding protein C, fast-type"""			8375400	Standard	NM_004533		Approved	MYBPCF, MYBPC, MGC163408	uc002psf.2	Q14324		ENST00000357701.5:c.1757C>T	19.37:g.50957284C>T	ENSP00000350332:p.Thr586Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4G9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.T586M	ENST00000357701.5	37	c.1757	CCDS46152.1	19	.	.	.	.	.	.	.	.	.	.	c	9.300	1.052822	0.19907	.	.	ENSG00000086967	ENST00000357701	T	0.40756	1.02	3.09	3.09	0.35607	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.641649	0.11207	U	0.588070	T	0.39989	0.1099	M	0.67700	2.07	0.28772	N	0.900316	B	0.27286	0.174	B	0.23574	0.047	T	0.29088	-1.0023	10	0.21014	T	0.42	.	11.5404	0.50663	0.0:1.0:0.0:0.0	.	586	Q14324	MYPC2_HUMAN	M	586	ENSP00000350332:T586M	ENSP00000350332:T586M	T	+	2	0	MYBPC2	55649096	0.195000	0.23338	0.034000	0.17996	0.029000	0.11900	4.688000	0.61715	1.771000	0.52183	0.394000	0.25966	ACG	MYBPC2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.612	MYBPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYBPC2	HGNC	protein_coding	OTTHUMT00000464751.1	C	NM_004533		50957284	+1	no_errors	ENST00000357701	ensembl	human	known	70_37	missense	SNP	0.017	T
NAV3	89795	genome.wustl.edu	37	12	78562612	78562612	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:78562612G>C	ENST00000397909.2	+	24	5120	c.4947G>C	c.(4945-4947)caG>caC	p.Q1649H	NAV3_ENST00000536525.2_Missense_Mutation_p.Q1649H|NAV3_ENST00000266692.7_Missense_Mutation_p.Q1472H|NAV3_ENST00000228327.6_Missense_Mutation_p.Q1649H			Q8IVL0	NAV3_HUMAN	neuron navigator 3	1649						membrane (GO:0016020)|nuclear envelope (GO:0005635)				NS(2)|breast(5)|central_nervous_system(2)|cervix(1)|endometrium(13)|kidney(16)|large_intestine(39)|liver(2)|lung(126)|ovary(5)|pancreas(3)|prostate(6)|skin(5)|stomach(2)|upper_aerodigestive_tract(8)|urinary_tract(1)	236						CGGCTATTCAGGGAGCACTGA	0.378										HNSCC(70;0.22)																																							0													77.0	79.0	78.0					12																	78562612		1829	4070	5899	SO:0001583	missense	89795			AB023155	CCDS41815.1, CCDS66432.1	12q14.3	2008-08-05				ENSG00000067798			15998	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 1"", ""steerin 3"""	611629				12079279, 12062803	Standard	XM_005269215		Approved	KIAA0938, POMFIL1	uc001syo.3	Q8IVL0	OTTHUMG00000170001	ENST00000397909.2:c.4947G>C	12.37:g.78562612G>C	ENSP00000381007:p.Gln1649His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NFW7|Q9Y2E7	Missense_Mutation	SNP	pfam_CH-domain,pfam_ATPase_AAA_core,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.Q1649H	ENST00000397909.2	37	c.4947		12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	15.14|15.14	2.745329|2.745329	0.49151|0.49151	.|.	.|.	ENSG00000067798|ENSG00000067798	ENST00000552895|ENST00000536525;ENST00000397909;ENST00000228327;ENST00000266692;ENST00000378640;ENST00000550788	.|D;D;D;D;D	.|0.93547	.|-3.24;-3.24;-3.24;-3.24;-3.24	5.41|5.41	1.55|1.55	0.23275|0.23275	.|.	.|0.000000	.|0.38005	.|U	.|0.001858	D|D	0.89199|0.89199	0.6647|0.6647	L|L	0.35793|0.35793	1.09|1.09	0.80722|0.80722	D|D	1|1	.|P;P;D;D	.|0.58970	.|0.836;0.681;0.984;0.958	.|P;B;P;P	.|0.50896	.|0.519;0.299;0.653;0.584	D|D	0.83771|0.83771	0.0220|0.0220	5|10	.|0.34782	.|T	.|0.22	-13.8589|-13.8589	3.7668|3.7668	0.08626|0.08626	0.4453:0.0:0.3873:0.1674|0.4453:0.0:0.3873:0.1674	.|.	.|1649;1472;1649;1649	.|E7EUC6;Q8IVL0-3;Q8IVL0;Q8IVL0-2	.|.;.;NAV3_HUMAN;.	R|H	544|1649;1649;1649;1472;270;278	.|ENSP00000446132:Q1649H;ENSP00000381007:Q1649H;ENSP00000228327:Q1649H;ENSP00000266692:Q1472H;ENSP00000448303:Q278H	.|ENSP00000228327:Q1649H	G|Q	+|+	1|3	0|2	NAV3|NAV3	77086743|77086743	0.994000|0.994000	0.37717|0.37717	1.000000|1.000000	0.80357|0.80357	0.994000|0.994000	0.84299|0.84299	0.371000|0.371000	0.20450|0.20450	0.368000|0.368000	0.24481|0.24481	0.650000|0.650000	0.86243|0.86243	GGG|CAG	NAV3	-	NULL		0.378	NAV3-001	KNOWN	basic	protein_coding	NAV3	HGNC	protein_coding	OTTHUMT00000406812.1	G	NM_001024383		78562612	+1	no_errors	ENST00000397909	ensembl	human	known	70_37	missense	SNP	0.998	C
NCKAP5	344148	genome.wustl.edu	37	2	133489419	133489419	+	Silent	SNP	G	G	A	rs370892586		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:133489419G>A	ENST00000409261.1	-	17	5707	c.5334C>T	c.(5332-5334)gaC>gaT	p.D1778D	NCKAP5_ENST00000473859.1_5'Flank|NCKAP5_ENST00000409213.1_Silent_p.D459D|NCKAP5_ENST00000317721.6_Silent_p.D1778D|NCKAP5_ENST00000405974.3_Silent_p.D459D	NM_207363.2	NP_997246.2	O14513	NCKP5_HUMAN	NCK-associated protein 5	1778										NS(4)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(29)|lung(51)|prostate(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	118						GGCGCTGGCCGTCTGTGGAGG	0.592																																																	0								A	,	0,4138		0,0,2069	92.0	97.0	95.0		5334,1377	-1.3	0.0	2		95	2,8402		0,2,4200	no	coding-synonymous,coding-synonymous	NCKAP5	NM_207363.2,NM_207481.3	,	0,2,6269	AA,AG,GG		0.0238,0.0,0.0159	,	1778/1910,459/591	133489419	2,12540	2069	4202	6271	SO:0001819	synonymous_variant	344148			AB005217	CCDS46417.1, CCDS46418.1	2q21.2	2010-02-17			ENSG00000176771	ENSG00000176771			29847	protein-coding gene	gene with protein product	"""Nck associated protein 5"", ""peripheral clock protein"""	608789				9344857	Standard	NM_207363		Approved	NAP5, ERIH1, ERIH2	uc002ttp.3	O14513	OTTHUMG00000153573	ENST00000409261.1:c.5334C>T	2.37:g.133489419G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZL0|Q29SS9|Q29ST0|Q2NL90|Q6ZVE2|Q8NAS3	Silent	SNP	NULL	p.D1778	ENST00000409261.1	37	c.5334	CCDS46418.1	2																																																																																			NCKAP5	-	NULL		0.592	NCKAP5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NCKAP5	HGNC	protein_coding	OTTHUMT00000331663.1	G	NM_207481		133489419	-1	no_errors	ENST00000317721	ensembl	human	known	70_37	silent	SNP	0.007	A
NFKBIE	4794	genome.wustl.edu	37	6	44233388	44233388	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr6:44233388C>T	ENST00000275015.5	-	1	112	c.113G>A	c.(112-114)cGg>cAg	p.R38Q		NM_004556.2	NP_004547.2	O00221	IKBE_HUMAN	nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, epsilon	38					cytoplasmic sequestering of transcription factor (GO:0042994)|D-serine transport (GO:0042942)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|perinuclear region of cytoplasm (GO:0048471)				breast(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)|urinary_tract(1)	10	all_cancers(18;2e-05)|all_lung(25;0.00747)|Hepatocellular(11;0.00908)|Ovarian(13;0.0273)		Colorectal(64;0.00337)|COAD - Colon adenocarcinoma(64;0.00536)			tccccgcccccggcgggcgcT	0.736																																																	0													1.0	2.0	2.0					6																	44233388		1025	2159	3184	SO:0001583	missense	4794			U91616	CCDS34463.1	6p21.1	2013-01-10			ENSG00000146232	ENSG00000146232		"""Ankyrin repeat domain containing"""	7799	protein-coding gene	gene with protein product		604548				9135156	Standard	NM_004556		Approved	IKBE	uc003oxe.1	O00221	OTTHUMG00000014762	ENST00000275015.5:c.113G>A	6.37:g.44233388C>T	ENSP00000275015:p.Arg38Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T9V9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.R38Q	ENST00000275015.5	37	c.113	CCDS34463.1	6	.	.	.	.	.	.	.	.	.	.	C	13.82	2.350680	0.41599	.	.	ENSG00000146232	ENST00000275015	T	0.54479	0.57	4.95	3.11	0.35812	.	.	.	.	.	T	0.11793	0.0287	N	0.08118	0	0.22342	N	0.999188	B	0.18610	0.029	B	0.18561	0.022	T	0.30416	-0.9979	9	0.25751	T	0.34	-36.1185	7.3071	0.26453	0.0:0.7345:0.1708:0.0947	.	38	O00221	IKBE_HUMAN	Q	38	ENSP00000275015:R38Q	ENSP00000275015:R38Q	R	-	2	0	NFKBIE	44341366	0.010000	0.17322	0.546000	0.28166	0.001000	0.01503	-0.290000	0.08354	0.560000	0.29169	-0.182000	0.12963	CGG	NFKBIE	-	NULL		0.736	NFKBIE-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NFKBIE	HGNC	protein_coding	OTTHUMT00000040733.2	C			44233388	-1	no_errors	ENST00000275015	ensembl	human	known	70_37	missense	SNP	0.899	T
NKG7	4818	genome.wustl.edu	37	19	51875736	51875736	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:51875736G>A	ENST00000221978.5	-	1	233	c.54C>T	c.(52-54)ttC>ttT	p.F18F	NKG7_ENST00000600427.1_Silent_p.F18F|NKG7_ENST00000595217.1_Silent_p.F18F	NM_005601.3	NP_005592.1	Q16617	NKG7_HUMAN	natural killer cell granule protein 7	18						integral component of plasma membrane (GO:0005887)				central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10		all_neural(266;0.0199)		GBM - Glioblastoma multiforme(134;0.000211)|OV - Ovarian serous cystadenocarcinoma(262;0.00979)		CAATCAGGCAGAACATCAGGC	0.617																																																	0													63.0	66.0	65.0					19																	51875736		2203	4300	6503	SO:0001819	synonymous_variant	4818				CCDS12830.1	19q13.41	2014-03-07	2014-03-07		ENSG00000105374	ENSG00000105374			7830	protein-coding gene	gene with protein product	"""granule membrane protein 17"""	606008	"""natural killer cell group 7 sequence"""			8458737	Standard	NM_005601		Approved	GIG1, GMP-17	uc002pwj.3	Q16617	OTTHUMG00000182898	ENST00000221978.5:c.54C>T	19.37:g.51875736G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_PMP22/EMP/MP20/Claudin	p.F18	ENST00000221978.5	37	c.54	CCDS12830.1	19																																																																																			NKG7	-	pfam_PMP22/EMP/MP20/Claudin		0.617	NKG7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NKG7	HGNC	protein_coding	OTTHUMT00000464260.2	G	NM_005601		51875736	-1	no_errors	ENST00000221978	ensembl	human	known	70_37	silent	SNP	0.000	A
NLRP1	22861	genome.wustl.edu	37	17	5463357	5463357	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr17:5463357C>A	ENST00000572272.1	-	4	658	c.659G>T	c.(658-660)aGa>aTa	p.R220I	NLRP1_ENST00000269280.4_Missense_Mutation_p.R220I|NLRP1_ENST00000262467.5_Missense_Mutation_p.R220I|NLRP1_ENST00000577119.1_Missense_Mutation_p.R220I|NLRP1_ENST00000354411.3_Missense_Mutation_p.R220I|NLRP1_ENST00000571307.1_5'UTR|NLRP1_ENST00000345221.3_Missense_Mutation_p.R220I			Q9C000	NALP1_HUMAN	NLR family, pyrin domain containing 1	220					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|defense response to bacterium (GO:0042742)|innate immune response (GO:0045087)|neuron apoptotic process (GO:0051402)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of interleukin-1 beta secretion (GO:0050718)|regulation of inflammatory response (GO:0050727)|response to muramyl dipeptide (GO:0032495)	cytosol (GO:0005829)|intracellular (GO:0005622)|NLRP1 inflammasome complex (GO:0072558)|nucleus (GO:0005634)	ATP binding (GO:0005524)|cysteine-type endopeptidase activator activity involved in apoptotic process (GO:0008656)|enzyme binding (GO:0019899)|protein domain specific binding (GO:0019904)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(17)|liver(5)|lung(17)|ovary(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	65		Colorectal(1115;3.48e-05)				CTCTCTTTCTCTGATTTCTAA	0.478																																																	0													18.0	20.0	20.0					17																	5463357		2166	4276	6442	SO:0001583	missense	22861			AB023143	CCDS32537.1, CCDS42244.1, CCDS42245.1, CCDS42246.1, CCDS58508.1	17p13	2014-01-29	2006-12-08	2006-12-08	ENSG00000091592	ENSG00000091592		"""Nucleotide-binding domain and leucine rich repeat containing"""	14374	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 1"""	606636	"""NACHT, leucine rich repeat and PYD (pyrin domain) containing 1"", ""systemic lupus erythematosus, vitiligo-related 1"""	NALP1, SLEV1		8781126, 12563287, 17377159	Standard	NM_033006		Approved	KIAA0926, DKFZp586O1822, CARD7, NAC, CLR17.1, DEFCAP, VAMAS1	uc002gci.3	Q9C000		ENST00000572272.1:c.659G>T	17.37:g.5463357C>A	ENSP00000460475:p.Arg220Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PE50|I6L9D9|Q9BZZ8|Q9BZZ9|Q9H5Z7|Q9H5Z8|Q9HAV8|Q9UFT4|Q9Y2E0	Missense_Mutation	SNP	pfam_CARD,pfam_DAPIN,pfam_Leu-rich_rpt,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_CARD,pfscan_DAPIN,prints_Disease_R	p.R220I	ENST00000572272.1	37	c.659	CCDS42246.1	17	.	.	.	.	.	.	.	.	.	.	C	12.96	2.095712	0.36952	.	.	ENSG00000091592	ENST00000544378;ENST00000262467;ENST00000269280;ENST00000354411;ENST00000345221	T;T;T;T;T	0.77750	-1.12;-1.12;-1.08;-1.07;-1.08	3.99	-3.28	0.05033	.	1.642320	0.04097	N	0.312196	T	0.61160	0.2325	N	0.19112	0.55	0.09310	N	1	P;P;P;P;P	0.49635	0.926;0.926;0.879;0.926;0.879	B;B;B;B;B	0.41202	0.35;0.35;0.19;0.35;0.19	T	0.57406	-0.7817	10	0.66056	D	0.02	.	4.4004	0.11383	0.0:0.3411:0.306:0.3529	.	220;220;220;220;220	Q9C000-3;Q9C000-4;Q9C000;Q9C000-2;E9PE50	.;.;NALP1_HUMAN;.;.	I	220	ENSP00000442029:R220I;ENSP00000262467:R220I;ENSP00000269280:R220I;ENSP00000346390:R220I;ENSP00000324366:R220I	ENSP00000262467:R220I	R	-	2	0	NLRP1	5404081	0.000000	0.05858	0.000000	0.03702	0.331000	0.28603	-1.415000	0.02469	-0.697000	0.05092	0.460000	0.39030	AGA	NLRP1	-	NULL		0.478	NLRP1-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP1	HGNC	protein_coding	OTTHUMT00000439517.1	C	NM_033004		5463357	-1	no_errors	ENST00000572272	ensembl	human	known	70_37	missense	SNP	0.001	A
NLRP13	126204	genome.wustl.edu	37	19	56423094	56423094	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:56423094C>T	ENST00000342929.3	-	5	2088	c.2089G>A	c.(2089-2091)Gaa>Aaa	p.E697K	NLRP13_ENST00000588751.1_Missense_Mutation_p.E697K	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	697							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		AAGTCCCTTTCAAGGATGTGA	0.383																																																	0													85.0	94.0	91.0					19																	56423094		2203	4300	6503	SO:0001583	missense	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.2089G>A	19.37:g.56423094C>T	ENSP00000343891:p.Glu697Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E697K	ENST00000342929.3	37	c.2089	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	C	3.444	-0.113422	0.06881	.	.	ENSG00000173572	ENST00000342929	D	0.87966	-2.32	1.82	-2.41	0.06562	.	.	.	.	.	T	0.71213	0.3313	N	0.20807	0.61	0.09310	N	1	B	0.24533	0.105	B	0.19391	0.025	T	0.57573	-0.7788	9	0.05436	T	0.98	.	9.3607	0.38195	0.0:0.6723:0.3277:0.0	.	697	Q86W25	NAL13_HUMAN	K	697	ENSP00000343891:E697K	ENSP00000343891:E697K	E	-	1	0	NLRP13	61114906	0.000000	0.05858	0.000000	0.03702	0.004000	0.04260	-0.194000	0.09559	-0.460000	0.07003	-0.386000	0.06593	GAA	NLRP13	-	NULL		0.383	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	C	NM_176810		56423094	-1	no_errors	ENST00000342929	ensembl	human	known	70_37	missense	SNP	0.000	T
NLRP13	126204	genome.wustl.edu	37	19	56423238	56423238	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:56423238C>T	ENST00000342929.3	-	5	1944	c.1945G>A	c.(1945-1947)Gac>Aac	p.D649N	NLRP13_ENST00000588751.1_Missense_Mutation_p.D649N	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	649							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		TTTGTGAAGTCTTCCTCCTGG	0.413																																																	0													107.0	102.0	104.0					19																	56423238		2203	4300	6503	SO:0001583	missense	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1945G>A	19.37:g.56423238C>T	ENSP00000343891:p.Asp649Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D649N	ENST00000342929.3	37	c.1945	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	C	6.086	0.384146	0.11524	.	.	ENSG00000173572	ENST00000342929	D	0.88277	-2.36	2.48	-0.0766	0.13722	.	.	.	.	.	T	0.75860	0.3907	N	0.19112	0.55	0.20074	N	0.999934	B	0.16396	0.017	B	0.09377	0.004	T	0.57539	-0.7794	9	0.12103	T	0.63	.	6.4227	0.21752	0.0:0.7495:0.0:0.2505	.	649	Q86W25	NAL13_HUMAN	N	649	ENSP00000343891:D649N	ENSP00000343891:D649N	D	-	1	0	NLRP13	61115050	0.000000	0.05858	0.410000	0.26471	0.127000	0.20565	-0.724000	0.04947	-0.143000	0.11334	0.543000	0.68304	GAC	NLRP13	-	NULL		0.413	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	C	NM_176810		56423238	-1	no_errors	ENST00000342929	ensembl	human	known	70_37	missense	SNP	0.874	T
NLRP13	126204	genome.wustl.edu	37	19	56423490	56423490	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:56423490C>G	ENST00000342929.3	-	5	1692	c.1693G>C	c.(1693-1695)Gag>Cag	p.E565Q	NLRP13_ENST00000588751.1_Missense_Mutation_p.E565Q	NM_176810.2	NP_789780.2	Q86W25	NAL13_HUMAN	NLR family, pyrin domain containing 13	565							ATP binding (GO:0005524)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(13)|lung(58)|ovary(4)|pancreas(2)|prostate(2)|skin(13)|stomach(2)|urinary_tract(1)	109		Colorectal(82;3.48e-05)|Ovarian(87;0.0481)|Renal(1328;0.218)		GBM - Glioblastoma multiforme(193;0.0642)		ATCTTCATCTCTTGTGGCTTT	0.433																																																	0													127.0	136.0	133.0					19																	56423490		2203	4300	6503	SO:0001583	missense	126204			AY154468	CCDS33119.1	19q13.43	2008-02-05	2006-12-08	2006-12-08	ENSG00000173572	ENSG00000173572		"""Nucleotide-binding domain and leucine rich repeat containing"""	22937	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 13"""	609660	"""NACHT, leucine rich repeat and PYD containing 13"""	NALP13		12563287	Standard	NM_176810		Approved	NOD14, PAN13, CLR19.7	uc010ygg.2	Q86W25	OTTHUMG00000167839	ENST00000342929.3:c.1693G>C	19.37:g.56423490C>G	ENSP00000343891:p.Glu565Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7RTR5	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.E565Q	ENST00000342929.3	37	c.1693	CCDS33119.1	19	.	.	.	.	.	.	.	.	.	.	C	13.55	2.270187	0.40194	.	.	ENSG00000173572	ENST00000342929	D	0.90324	-2.65	2.48	2.48	0.30137	.	.	.	.	.	D	0.89185	0.6643	L	0.43923	1.385	0.21064	N	0.999793	D	0.56035	0.974	P	0.52881	0.712	T	0.79446	-0.1800	9	0.32370	T	0.25	.	9.0117	0.36146	0.0:1.0:0.0:0.0	.	565	Q86W25	NAL13_HUMAN	Q	565	ENSP00000343891:E565Q	ENSP00000343891:E565Q	E	-	1	0	NLRP13	61115302	0.002000	0.14202	0.438000	0.26821	0.074000	0.17049	0.200000	0.17257	1.363000	0.46019	0.543000	0.68304	GAG	NLRP13	-	NULL		0.433	NLRP13-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NLRP13	HGNC	protein_coding	OTTHUMT00000396560.1	C	NM_176810		56423490	-1	no_errors	ENST00000342929	ensembl	human	known	70_37	missense	SNP	0.535	G
NLRP3	114548	genome.wustl.edu	37	1	247582049	247582049	+	5'UTR	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:247582049G>T	ENST00000336119.3	+	0	699				NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_5'Flank|NLRP3_ENST00000366497.2_5'UTR|NLRP3_ENST00000348069.2_5'UTR|NLRP3_ENST00000391828.3_Intron|NLRP3_ENST00000366496.2_5'UTR	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3						activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			TTCACTGCCTGGTATCTTAGT	0.463																																																	0													30.0	32.0	31.0					1																	247582049		2203	4300	6503	SO:0001623	5_prime_UTR_variant	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.-48G>T	1.37:g.247582049G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	RNA	SNP	-	NULL	ENST00000336119.3	37	NULL	CCDS1632.1	1																																																																																			NLRP3	-	-		0.463	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	G	NM_004895		247582049	+1	no_errors	ENST00000474792	ensembl	human	known	70_37	rna	SNP	0.000	T
NLRP3	114548	genome.wustl.edu	37	1	247587658	247587658	+	Missense_Mutation	SNP	G	G	A	rs121908153		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:247587658G>A	ENST00000336119.3	+	3	1659	c.913G>A	c.(913-915)Gat>Aat	p.D305N	NLRP3_ENST00000474792.1_3'UTR|NLRP3_ENST00000391827.2_Missense_Mutation_p.D305N|NLRP3_ENST00000366497.2_Missense_Mutation_p.D305N|NLRP3_ENST00000348069.2_Missense_Mutation_p.D305N|NLRP3_ENST00000391828.3_Missense_Mutation_p.D305N|NLRP3_ENST00000366496.2_Missense_Mutation_p.D305N	NM_001127462.2|NM_001243133.1|NM_004895.4	NP_001120934.1|NP_001230062.1|NP_004886.3	Q96P20	NALP3_HUMAN	NLR family, pyrin domain containing 3	305	NACHT. {ECO:0000255|PROSITE- ProRule:PRU00136}.		D -> G (in CINCA). {ECO:0000269|PubMed:14630794}.|D -> N (in CINCA and MWS). {ECO:0000269|PubMed:11992256, ECO:0000269|PubMed:12032915, ECO:0000269|PubMed:12483741, ECO:0000269|PubMed:14630794, ECO:0000269|PubMed:15593220}.		activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|cellular response to lipopolysaccharide (GO:0071222)|defense response (GO:0006952)|defense response to virus (GO:0051607)|detection of biotic stimulus (GO:0009595)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|interleukin-1 beta production (GO:0032611)|interleukin-1 secretion (GO:0050701)|interleukin-18 production (GO:0032621)|negative regulation of acute inflammatory response (GO:0002674)|negative regulation of inflammatory response (GO:0050728)|negative regulation of interleukin-1 beta secretion (GO:0050713)|negative regulation of NF-kappaB import into nucleus (GO:0042347)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|NLRP3 inflammasome complex assembly (GO:0044546)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|positive regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043280)|positive regulation of interleukin-1 beta secretion (GO:0050718)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|protein oligomerization (GO:0051259)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|NLRP3 inflammasome complex (GO:0072559)	ATP binding (GO:0005524)|peptidoglycan binding (GO:0042834)			NS(1)|breast(3)|endometrium(6)|kidney(1)|large_intestine(19)|lung(85)|ovary(9)|pancreas(2)|prostate(4)|skin(8)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	142	all_cancers(71;9.66e-05)|all_epithelial(71;1.85e-05)|Breast(184;0.0226)|Ovarian(71;0.0377)|all_lung(81;0.0662)|Lung NSC(105;0.0724)	all_cancers(173;0.0172)	OV - Ovarian serous cystadenocarcinoma(106;0.0141)			GGACGGCTTCGATGAGCTGCA	0.577																																																	0			GRCh37	CM021071|CM076355	NLRP3	M	rs121908153						74.0	73.0	73.0					1																	247587658		2203	4300	6503	SO:0001583	missense	114548			AF054176	CCDS1632.1, CCDS1633.1, CCDS44346.1, CCDS44347.1	1q44	2014-09-17	2006-12-08	2006-12-08	ENSG00000162711	ENSG00000162711		"""Nucleotide-binding domain and leucine rich repeat containing"""	16400	protein-coding gene	gene with protein product	"""Cryopyrin"", ""nucleotide-binding oligomerization domain, leucine rich repeat and pyrin domain containing 3"""	606416	"""cold autoinflammatory syndrome 1"""	C1orf7, CIAS1		10741953	Standard	NM_183395		Approved	AGTAVPRL, AII, AVP, FCAS, FCU, NALP3, PYPAF1, MWS, CLR1.1	uc001icr.3	Q96P20	OTTHUMG00000040647	ENST00000336119.3:c.913G>A	1.37:g.247587658G>A	ENSP00000337383:p.Asp305Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RC97|B7ZKS9|B7ZKT2|B7ZKT3|O75434|Q17RS2|Q59H68|Q5JQS8|Q5JQS9|Q6TG35|Q8TCW0|Q8TEU9|Q8WXH9	Missense_Mutation	SNP	pfam_DAPIN,superfamily_DEATH-like,smart_Leu-rich_rpt_RNase_inh_sub-typ,pfscan_NACHT_NTPase,pfscan_DAPIN	p.D305N	ENST00000336119.3	37	c.913	CCDS1632.1	1	.	.	.	.	.	.	.	.	.	.	G	17.23	3.335843	0.60853	.	.	ENSG00000162711	ENST00000391828;ENST00000366497;ENST00000336119;ENST00000348069;ENST00000366496;ENST00000391827	D;D;D;D;D;D	0.88354	-2.37;-2.37;-2.37;-2.37;-2.37;-2.37	4.04	4.04	0.47022	NACHT nucleoside triphosphatase (1);	0.000000	0.53938	D	0.000055	D	0.95645	0.8584	H	0.95504	3.68	0.48632	D	0.999681	D;D;D;D;D	0.89917	1.0;1.0;0.992;0.999;1.0	D;D;P;D;D	0.97110	0.993;0.988;0.761;0.962;1.0	D	0.95988	0.8983	10	0.87932	D	0	.	11.9927	0.53184	0.0:0.0:1.0:0.0	.	305;305;305;305;305	B7ZKS9;Q96P20-4;Q96P20-2;Q96P20-5;Q96P20	.;.;.;.;NALP3_HUMAN	N	305	ENSP00000375704:D305N;ENSP00000355453:D305N;ENSP00000337383:D305N;ENSP00000294752:D305N;ENSP00000355452:D305N;ENSP00000375703:D305N	ENSP00000337383:D305N	D	+	1	0	NLRP3	245654281	1.000000	0.71417	0.247000	0.24249	0.325000	0.28411	6.713000	0.74686	2.543000	0.85770	0.563000	0.77884	GAT	NLRP3	-	pfscan_NACHT_NTPase		0.577	NLRP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRP3	HGNC	protein_coding	OTTHUMT00000097740.1	G	NM_004895		247587658	+1	no_errors	ENST00000336119	ensembl	human	known	70_37	missense	SNP	0.998	A
NNMT	4837	genome.wustl.edu	37	11	114167330	114167330	+	Missense_Mutation	SNP	C	C	T	rs141072720		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:114167330C>T	ENST00000535401.1	+	3	316	c.52C>T	c.(52-54)Cgg>Tgg	p.R18W	RP11-64D24.2_ENST00000544925.1_RNA|NNMT_ENST00000545255.1_5'Flank|NNMT_ENST00000299964.3_Missense_Mutation_p.R18W|NNMT_ENST00000541754.1_5'Flank|NNMT_ENST00000542647.1_5'Flank			P40261	NNMT_HUMAN	nicotinamide N-methyltransferase	18					methylation (GO:0032259)|organ regeneration (GO:0031100)|response to drug (GO:0042493)|response to organonitrogen compound (GO:0010243)|small molecule metabolic process (GO:0044281)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	nicotinamide N-methyltransferase activity (GO:0008112)			kidney(1)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	16		all_cancers(61;4.83e-16)|all_epithelial(67;7.28e-09)|all_hematologic(158;0.000135)|Melanoma(852;0.000902)|Acute lymphoblastic leukemia(157;0.000967)|Breast(348;0.0101)|all_neural(223;0.0281)|Medulloblastoma(222;0.0425)|Prostate(24;0.0906)		BRCA - Breast invasive adenocarcinoma(274;2.79e-06)|Epithelial(105;1.32e-05)|all cancers(92;0.000144)|OV - Ovarian serous cystadenocarcinoma(223;0.128)	Niacin(DB00627)	TTTTAACCCTCGGGATTACCT	0.428																																																	0													78.0	72.0	74.0					11																	114167330		2201	4296	6497	SO:0001583	missense	4837			U08021	CCDS8368.1	11q23.1	2007-08-15					2.1.1.1		7861	protein-coding gene	gene with protein product		600008				8575745	Standard	NM_006169		Approved		uc001pos.1	P40261		ENST00000535401.1:c.52C>T	11.37:g.114167330C>T	ENSP00000441434:p.Arg18Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans	p.R18W	ENST00000535401.1	37	c.52	CCDS8368.1	11	.	.	.	.	.	.	.	.	.	.	C	14.35	2.510545	0.44660	.	.	ENSG00000166741	ENST00000535401;ENST00000299964	T;T	0.03745	3.82;3.82	5.36	2.21	0.28008	.	0.529823	0.16933	N	0.193574	T	0.06416	0.0165	L	0.39514	1.22	0.20196	N	0.999929	D	0.71674	0.998	P	0.56612	0.802	T	0.30475	-0.9977	10	0.46703	T	0.11	-0.012	4.0946	0.09985	0.3265:0.4995:0.0:0.174	.	18	P40261	NNMT_HUMAN	W	18	ENSP00000441434:R18W;ENSP00000299964:R18W	ENSP00000299964:R18W	R	+	1	2	NNMT	113672540	0.000000	0.05858	0.260000	0.24451	0.692000	0.40212	-0.064000	0.11636	0.611000	0.30052	-0.293000	0.09583	CGG	NNMT	-	pfam_NNMT_TEMT_trans,pirsf_NNMT_TEMT_trans		0.428	NNMT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NNMT	HGNC	protein_coding	OTTHUMT00000398951.1	C	NM_006169		114167330	+1	no_errors	ENST00000299964	ensembl	human	known	70_37	missense	SNP	0.097	T
NOS1AP	9722	genome.wustl.edu	37	1	162326888	162326890	+	In_Frame_Del	DEL	CAG	CAG	-			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	CAG	CAG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:162326888_162326890delCAG	ENST00000361897.5	+	8	1303_1305	c.901_903delCAG	c.(901-903)cagdel	p.Q306del	NOS1AP_ENST00000530878.1_In_Frame_Del_p.Q301del	NM_001164757.1|NM_014697.2	NP_001158229.1|NP_055512.1	O75052	CAPON_HUMAN	nitric oxide synthase 1 (neuronal) adaptor protein	306	Poly-Gln.				regulation of apoptotic process (GO:0042981)|regulation of nitric oxide biosynthetic process (GO:0045428)|regulation of nitric-oxide synthase activity (GO:0050999)		nitric-oxide synthase binding (GO:0050998)			NS(1)|breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	32	all_hematologic(112;0.203)		BRCA - Breast invasive adenocarcinoma(70;0.0537)			gcagctcctccagcagcAGCAGC	0.611																																																	0																																										SO:0001651	inframe_deletion	9722			AB007933	CCDS1237.1, CCDS44267.1, CCDS53421.1	1q23.3	2010-08-20			ENSG00000198929	ENSG00000198929			16859	protein-coding gene	gene with protein product	"""C-terminal PDZ domain ligand of neuronal nitric oxide synthase"""	605551				9455484, 9459447	Standard	NM_001126060		Approved	KIAA0464, CAPON	uc001gbv.2	O75052	OTTHUMG00000024049	ENST00000361897.5:c.901_903delCAG	1.37:g.162326897_162326899delCAG	ENSP00000355133:p.Gln306del	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLF5|O43564|Q3T551|Q5VU95	In_Frame_Del	DEL	pfam_PTyr_interaction_dom,smart_PTyr_interaction_dom,pfscan_PTyr_interaction_dom	p.Q304in_frame_del	ENST00000361897.5	37	c.901_903	CCDS1237.1	1																																																																																			NOS1AP	-	NULL		0.611	NOS1AP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NOS1AP	HGNC	protein_coding	OTTHUMT00000060555.2	CAG	NM_014697		162326890	+1	no_errors	ENST00000361897	ensembl	human	known	70_37	in_frame_del	DEL	1.000:1.000:1.000	-
NOTCH3	4854	genome.wustl.edu	37	19	15292550	15292550	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:15292550G>A	ENST00000263388.2	-	17	2704	c.2629C>T	c.(2629-2631)Cct>Tct	p.P877S		NM_000435.2	NP_000426.2	Q9UM47	NOTC3_HUMAN	notch 3	877	EGF-like 22; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				forebrain development (GO:0030900)|gene expression (GO:0010467)|glomerular capillary formation (GO:0072104)|negative regulation of neuron differentiation (GO:0045665)|neuron fate commitment (GO:0048663)|Notch receptor processing (GO:0007220)|Notch signaling pathway (GO:0007219)|positive regulation of smooth muscle cell proliferation (GO:0048661)|regulation of transcription, DNA-templated (GO:0006355)|transcription initiation from RNA polymerase II promoter (GO:0006367)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			breast(4)|central_nervous_system(3)|endometrium(10)|kidney(3)|large_intestine(16)|liver(1)|lung(31)|ovary(8)|prostate(3)|skin(7)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(1)	93			OV - Ovarian serous cystadenocarcinoma(3;2.6e-20)|Epithelial(3;1.34e-16)|all cancers(3;5.13e-15)			GCGAAACCAGGGAGGCAGGAG	0.667																																																	0													34.0	29.0	31.0					19																	15292550		2187	4291	6478	SO:0001583	missense	4854			U97669	CCDS12326.1	19p13.2-p13.1	2013-01-10	2010-06-24			ENSG00000074181		"""Ankyrin repeat domain containing"""	7883	protein-coding gene	gene with protein product		600276	"""Notch (Drosophila) homolog 3"", ""Notch homolog 3 (Drosophila)"""	CADASIL		7835890	Standard	NM_000435		Approved	CASIL	uc002nan.3	Q9UM47		ENST00000263388.2:c.2629C>T	19.37:g.15292550G>A	ENSP00000263388:p.Pro877Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UEB3|Q9UPL3|Q9Y6L8	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_EGF-like_Ca-bd,pfam_Ankyrin_rpt,pfam_Notch_dom,pfam_Notch_NODP_dom,pfam_Notch_NOD_dom,pfam_EGF_extracell,pfam_DUF3454_notch,superfamily_Ankyrin_rpt-contain_dom,superfamily_Notch_dom,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Notch_dom,smart_Ankyrin_rpt,pirsf_Notch,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_EG-like_dom,pfscan_Notch_dom,prints_Notch_3,prints_Notch_dom	p.P877S	ENST00000263388.2	37	c.2629	CCDS12326.1	19	.	.	.	.	.	.	.	.	.	.	G	11.06	1.526409	0.27299	.	.	ENSG00000074181	ENST00000263388;ENST00000539383	D	0.91351	-2.83	5.45	0.757	0.18427	EGF (1);EGF-like region, conserved site (2);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	1.547150	0.04532	N	0.386524	D	0.89908	0.6851	M	0.62088	1.915	0.09310	N	1	B;B	0.11235	0.004;0.003	B;B	0.27170	0.032;0.077	T	0.74985	-0.3477	10	0.41790	T	0.15	.	10.198	0.43067	0.0:0.3572:0.3978:0.245	.	828;877	Q59FL3;Q9UM47	.;NOTC3_HUMAN	S	877;827	ENSP00000263388:P877S	ENSP00000263388:P877S	P	-	1	0	NOTCH3	15153550	0.674000	0.27549	0.058000	0.19502	0.654000	0.38779	1.238000	0.32707	0.007000	0.14760	-0.225000	0.12378	CCT	NOTCH3	-	pfam_EG-like_dom,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_Notch,pfscan_EG-like_dom		0.667	NOTCH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOTCH3	HGNC	protein_coding	OTTHUMT00000465714.1	G	NM_000435		15292550	-1	no_errors	ENST00000263388	ensembl	human	known	70_37	missense	SNP	0.005	A
NPLOC4	55666	genome.wustl.edu	37	17	79564302	79564302	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr17:79564302C>T	ENST00000331134.6	-	10	1177	c.962G>A	c.(961-963)cGa>cAa	p.R321Q	NPLOC4_ENST00000539314.1_Missense_Mutation_p.R160Q|NPLOC4_ENST00000374747.5_Missense_Mutation_p.R321Q	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	321					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			GGTACCCTTTCGGGTATCTTC	0.478																																																	0													124.0	122.0	123.0					17																	79564302		2005	4170	6175	SO:0001583	missense	55666			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.962G>A	17.37:g.79564302C>T	ENSP00000331487:p.Arg321Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Missense_Mutation	SNP	pfam_NPL4,pfam_NPL4_Zn-bd_put,pfam_Npl4_Ub-like_dom,pirsf_PolyUb_recognition_cplx_Npl4	p.R321Q	ENST00000331134.6	37	c.962	CCDS45812.1	17	.	.	.	.	.	.	.	.	.	.	C	16.34	3.095828	0.56075	.	.	ENSG00000182446	ENST00000331134;ENST00000374747;ENST00000539314	.	.	.	5.54	5.54	0.83059	Nuclear pore localisation protein NPL4 (1);	0.000000	0.85682	D	0.000000	T	0.47525	0.1450	L	0.43152	1.355	0.80722	D	1	B;B;P	0.34757	0.096;0.412;0.467	B;B;B	0.23275	0.028;0.026;0.045	T	0.43130	-0.9410	9	0.15952	T	0.53	-11.8617	19.9063	0.97008	0.0:1.0:0.0:0.0	.	160;321;321	B4DG89;Q8TAT6-2;Q8TAT6	.;.;NPL4_HUMAN	Q	321;320;160	.	ENSP00000331487:R321Q	R	-	2	0	NPLOC4	77174740	1.000000	0.71417	0.982000	0.44146	0.991000	0.79684	7.314000	0.78988	2.774000	0.95407	0.644000	0.83932	CGA	NPLOC4	-	pfam_NPL4,pirsf_PolyUb_recognition_cplx_Npl4		0.478	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	HGNC	protein_coding	OTTHUMT00000440140.1	C			79564302	-1	no_errors	ENST00000374747	ensembl	human	known	70_37	missense	SNP	1.000	T
NT5C1B	93034	genome.wustl.edu	37	2	18768822	18768822	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:18768822C>G	ENST00000359846.2	-	2	144	c.67G>C	c.(67-69)Gaa>Caa	p.E23Q	NT5C1B_ENST00000304081.4_Missense_Mutation_p.E23Q|NT5C1B_ENST00000460052.1_5'UTR|NT5C1B_ENST00000600945.1_Missense_Mutation_p.E23Q|NT5C1B-RDH14_ENST00000532967.1_Missense_Mutation_p.E23Q	NM_001002006.2|NM_001199086.1|NM_001199087.1|NM_001199088.1	NP_001002006.1|NP_001186015.1|NP_001186016.1|NP_001186017.1	Q96P26	5NT1B_HUMAN	5'-nucleotidase, cytosolic IB	23					nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide catabolic process (GO:0006195)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	5'-nucleotidase activity (GO:0008253)|magnesium ion binding (GO:0000287)|nucleotide binding (GO:0000166)			endometrium(2)|kidney(2)|large_intestine(10)|lung(8)|ovary(1)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	29	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.177)	Ovarian(717;0.208)				TTTTCTGCTTCTAGACTCTCT	0.398																																																	0													177.0	166.0	169.0					2																	18768822		2203	4300	6503	SO:0001583	missense	93034			AF356185	CCDS33149.1, CCDS33150.1	2p24.2	2010-08-13			ENSG00000185013	ENSG00000185013	3.1.3.5		17818	protein-coding gene	gene with protein product		610526				11690631	Standard	NM_033253		Approved	AIRP, CN-IB		Q96P26	OTTHUMG00000151765	ENST00000359846.2:c.67G>C	2.37:g.18768822C>G	ENSP00000352904:p.Glu23Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MCR0|B7ZVX7|Q53RX2|Q8N9W3|Q8NA26|Q96DU5|Q96KE6|Q96M25|Q96SA3	Missense_Mutation	SNP	pfam_5-nucleotidase	p.E23Q	ENST00000359846.2	37	c.67	CCDS33150.1	2	.	.	.	.	.	.	.	.	.	.	C	10.20	1.284829	0.23392	.	.	ENSG00000250741;ENSG00000250741;ENSG00000185013;ENSG00000185013;ENSG00000185013	ENST00000532967;ENST00000444297;ENST00000304081;ENST00000359846;ENST00000416783	D	0.91740	-2.9	5.1	5.1	0.69264	.	0.584454	0.15513	N	0.258453	D	0.85902	0.5805	N	0.19112	0.55	0.09310	N	1	P;P;P;P;B;P;P;P	0.49447	0.924;0.813;0.759;0.924;0.319;0.745;0.629;0.745	B;B;B;B;B;B;B;B	0.43082	0.352;0.202;0.23;0.352;0.193;0.407;0.23;0.407	T	0.79778	-0.1660	10	0.66056	D	0.02	-5.527	9.4552	0.38750	0.0:0.9065:0.0:0.0935	.	23;23;23;23;23;23;23;23	E7EXB7;B4DZ86;B4DXQ9;B4DXZ9;C9J2C7;Q96P26-2;Q96P26;Q96P26-4	.;.;.;.;.;.;5NT1B_HUMAN;.	Q	23	ENSP00000412639:E23Q	ENSP00000305979:E23Q	E	-	1	0	NT5C1B-RDH14;NT5C1B	18632303	0.922000	0.31269	0.712000	0.30502	0.157000	0.22087	2.142000	0.42177	2.648000	0.89879	0.563000	0.77884	GAA	NT5C1B	-	NULL		0.398	NT5C1B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NT5C1B	HGNC	protein_coding	OTTHUMT00000323822.1	C			18768822	-1	no_errors	ENST00000359846	ensembl	human	known	70_37	missense	SNP	0.272	G
PAMR1	25891	genome.wustl.edu	37	11	35454018	35454018	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:35454018C>T	ENST00000378880.2	-	11	2494	c.2049G>A	c.(2047-2049)tgG>tgA	p.W683*	PAMR1_ENST00000378878.3_Nonsense_Mutation_p.W572*|PAMR1_ENST00000532848.1_Nonsense_Mutation_p.W643*|PAMR1_ENST00000278360.3_Nonsense_Mutation_p.W700*	NM_001001991.1	NP_001001991.1	Q6UXH9	PAMR1_HUMAN	peptidase domain containing associated with muscle regeneration 1	683	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.					extracellular region (GO:0005576)	serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	26						CCATCAGATGCCAGCGTGGCT	0.562																																																	0													83.0	79.0	80.0					11																	35454018		2202	4298	6500	SO:0001587	stop_gained	25891				CCDS7898.1, CCDS31460.1, CCDS60759.1, CCDS60760.1	11p13	2009-09-30			ENSG00000149090	ENSG00000149090			24554	protein-coding gene	gene with protein product	"""regeneration-associated muscle protease"""					15111323	Standard	NM_001282675		Approved	RAMP, DKFZP586H2123	uc001mwf.3	Q6UXH9	OTTHUMG00000166328	ENST00000378880.2:c.2049G>A	11.37:g.35454018C>T	ENSP00000368158:p.Trp683*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MQ58|B7ZA73|Q5EBL7|Q5JPI4|Q6N062|Q71RE9|Q96JW2|Q9Y432	Nonsense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_CUB,pfam_Sushi_SCR_CCP,pfam_EG-like_dom,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_Complement_control_module,smart_EG-like_dom,smart_CUB,smart_EGF-like_Ca-bd,smart_Sushi_SCR_CCP,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_EG-like_dom,pfscan_Sushi_SCR_CCP,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.W700*	ENST00000378880.2	37	c.2100	CCDS31460.1	11	.	.	.	.	.	.	.	.	.	.	C	41	8.731175	0.98931	.	.	ENSG00000149090	ENST00000278360;ENST00000378880;ENST00000378878;ENST00000532848;ENST00000527605	.	.	.	5.34	5.34	0.76211	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.4131	0.94683	0.0:1.0:0.0:0.0	.	.	.	.	X	700;683;572;643;660	.	ENSP00000278360:W700X	W	-	3	0	PAMR1	35410594	1.000000	0.71417	1.000000	0.80357	0.550000	0.35303	7.773000	0.85462	2.656000	0.90262	0.561000	0.74099	TGG	PAMR1	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.562	PAMR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAMR1	HGNC	protein_coding	OTTHUMT00000389177.1	C	NM_015430		35454018	-1	no_errors	ENST00000278360	ensembl	human	known	70_37	nonsense	SNP	1.000	T
OR8K5	219453	genome.wustl.edu	37	11	55927228	55927228	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:55927228C>A	ENST00000313447.1	-	1	565	c.566G>T	c.(565-567)tGc>tTc	p.C189F		NM_001004058.2	NP_001004058.2	Q8NH50	OR8K5_HUMAN	olfactory receptor, family 8, subfamily K, member 5	189						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			large_intestine(3)|lung(24)|ovary(2)|pancreas(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	34	Esophageal squamous(21;0.00693)	Lung NSC(402;0.197)|all_epithelial(135;0.236)				TGCATTTGAGCAAAGCATAGG	0.348																																																	0													87.0	89.0	88.0					11																	55927228		2201	4296	6497	SO:0001583	missense	219453			BK004347	CCDS31521.1	11q11	2012-08-09			ENSG00000181752	ENSG00000181752		"""GPCR / Class A : Olfactory receptors"""	15315	protein-coding gene	gene with protein product							Standard	NM_001004058		Approved		uc010rja.2	Q8NH50	OTTHUMG00000166820	ENST00000313447.1:c.566G>T	11.37:g.55927228C>A	ENSP00000323853:p.Cys189Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFB5	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.C189F	ENST00000313447.1	37	c.566	CCDS31521.1	11	.	.	.	.	.	.	.	.	.	.	C	14.13	2.443790	0.43429	.	.	ENSG00000181752	ENST00000313447	T	0.00460	7.27	4.07	2.17	0.27698	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000007	T	0.01730	0.0055	H	0.97806	4.08	0.38074	D	0.936469	P	0.47677	0.899	P	0.53266	0.722	T	0.14924	-1.0455	10	0.87932	D	0	.	9.6135	0.39676	0.0:0.8384:0.0:0.1616	.	189	Q8NH50	OR8K5_HUMAN	F	189	ENSP00000323853:C189F	ENSP00000323853:C189F	C	-	2	0	OR8K5	55683804	0.402000	0.25311	0.908000	0.35775	0.829000	0.46940	1.122000	0.31295	0.472000	0.27344	-1.079000	0.02226	TGC	OR8K5	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.348	OR8K5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR8K5	HGNC	protein_coding	OTTHUMT00000391543.1	C	NM_001004058		55927228	-1	no_errors	ENST00000313447	ensembl	human	known	70_37	missense	SNP	1.000	A
OR10W1	81341	genome.wustl.edu	37	11	58034493	58034493	+	Missense_Mutation	SNP	T	T	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:58034493T>G	ENST00000395079.2	-	1	1239	c.838A>C	c.(838-840)Atc>Ctc	p.I280L		NM_207374.3	NP_997257.2	Q8NGF6	O10W1_HUMAN	olfactory receptor, family 10, subfamily W, member 1	280						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			kidney(2)|large_intestine(2)|lung(19)|ovary(2)|skin(1)	26		Breast(21;0.0589)				AGGGCATAGATAAGTGGGTTG	0.537																																																	0													107.0	100.0	102.0					11																	58034493		2201	4295	6496	SO:0001583	missense	81341			AB065850	CCDS7968.1	11q12.1	2012-08-09	2004-03-04	2004-03-05		ENSG00000172772		"""GPCR / Class A : Olfactory receptors"""	15139	protein-coding gene	gene with protein product			"""olfactory receptor, family 10, subfamily W, member 1 pseudogene"""	OR10W1P			Standard	NM_207374		Approved		uc001nmq.1	Q8NGF6		ENST00000395079.2:c.838A>C	11.37:g.58034493T>G	ENSP00000378516:p.Ile280Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUD2|A8MTE1|Q6UXQ2	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.I280L	ENST00000395079.2	37	c.838	CCDS7968.1	11	.	.	.	.	.	.	.	.	.	.	T	17.01	3.278105	0.59758	.	.	ENSG00000172772	ENST00000395079	T	0.51817	0.69	5.7	4.58	0.56647	GPCR, rhodopsin-like superfamily (1);	0.000000	0.51477	D	0.000095	T	0.48429	0.1499	M	0.78637	2.42	0.36688	D	0.87942	D	0.57571	0.98	B	0.41036	0.346	T	0.63107	-0.6711	10	0.87932	D	0	.	10.5898	0.45304	0.0:0.0763:0.0:0.9237	.	280	Q8NGF6	O10W1_HUMAN	L	280	ENSP00000378516:I280L	ENSP00000378516:I280L	I	-	1	0	OR10W1	57791069	1.000000	0.71417	0.774000	0.31636	0.897000	0.52465	3.940000	0.56599	0.993000	0.38866	0.533000	0.62120	ATC	OR10W1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn		0.537	OR10W1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10W1	HGNC	protein_coding	OTTHUMT00000394704.1	T	NM_207374		58034493	-1	no_errors	ENST00000395079	ensembl	human	known	70_37	missense	SNP	0.994	G
NXPE2	120406	genome.wustl.edu	37	11	114578298	114578298	+	IGR	SNP	C	C	T	rs568029041		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:114578298C>T	ENST00000389586.4	+	0	1873				NXPE2_ENST00000375475.5_3'UTR	NM_182495.5	NP_872301.2	Q96DL1	NXPE2_HUMAN	neurexophilin and PC-esterase domain family, member 2							integral component of membrane (GO:0016021)											catttttaagcgtacaattca	0.448													c|||	1	0.000199681	0.0	0.0	5008	,	,		19615	0.0		0.0	False		,,,				2504	0.001																0																																										SO:0001628	intergenic_variant	120406			AK057953	CCDS44738.1	11q23.2	2012-06-14	2012-06-11	2012-06-11	ENSG00000204361	ENSG00000204361			26331	protein-coding gene	gene with protein product			"""family with sequence similarity 55, member B"""	FAM55B			Standard	NM_182495		Approved	FLJ25224	uc009yyy.2	Q96DL1	OTTHUMG00000168293		11.37:g.114578298C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKI8	RNA	SNP	-	NULL	ENST00000389586.4	37	NULL	CCDS44738.1	11																																																																																			NXPE2	-	-		0.448	NXPE2-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	NXPE2	HGNC	protein_coding	OTTHUMT00000399181.1	C	NM_182495		114578298	+1	no_errors	ENST00000541074	ensembl	human	known	70_37	rna	SNP	0.000	T
PCDHGA2	56113	genome.wustl.edu	37	5	140720206	140720206	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr5:140720206C>T	ENST00000394576.2	+	1	1668	c.1668C>T	c.(1666-1668)aaC>aaT	p.N556N	PCDHGA1_ENST00000517417.1_Intron	NM_018915.2	NP_061738.1	Q9Y5H1	PCDG2_HUMAN	protocadherin gamma subfamily A, 2	556	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(3)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(20)|lung(32)|ovary(1)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	77			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGGACCAGAACGACAACGCGC	0.617																																																	0													162.0	162.0	162.0					5																	140720206		2203	4300	6503	SO:0001819	synonymous_variant	56113			AF152508	CCDS47289.1	5q31	2011-03-28			ENSG00000081853	ENSG00000081853		"""Cadherins / Protocadherins : Clustered"""	8700	other	protocadherin		606289				10380929	Standard	NM_018915		Approved	PCDH-GAMMA-A2		Q9Y5H1	OTTHUMG00000163679	ENST00000394576.2:c.1668C>T	5.37:g.140720206C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LL6|Q9Y5D5	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.N556	ENST00000394576.2	37	c.1668	CCDS47289.1	5																																																																																			PCDHGA2	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.617	PCDHGA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGA2	HGNC	protein_coding	OTTHUMT00000374738.1	C	NM_018915		140720206	+1	no_errors	ENST00000394576	ensembl	human	known	70_37	silent	SNP	0.364	T
PDXDC2P	283970	genome.wustl.edu	37	16	70055830	70055830	+	RNA	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:70055830G>C	ENST00000531894.1	-	0	1154					NR_003610.1		Q6P474	PDXD2_HUMAN	pyridoxal-dependent decarboxylase domain containing 2, pseudogene						carboxylic acid metabolic process (GO:0019752)		carboxy-lyase activity (GO:0016831)|pyridoxal phosphate binding (GO:0030170)										GGGCTTATTTGATATAAGACC	0.408																																																	0																																												283970					16q22.1	2014-03-20	2010-09-02	2010-09-02	ENSG00000196696	ENSG00000196696			27559	pseudogene	pseudogene			"""pyridoxal-dependent decarboxylase domain containing 2"""	PDXDC2			Standard	NR_003610		Approved	DKFZp761H1120	uc010vlq.1	Q6P474	OTTHUMG00000167595		16.37:g.70055830G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9Z5	RNA	SNP	-	NULL	ENST00000531894.1	37	NULL		16																																																																																			PDXDC2P	-	-		0.408	PDXDC2P-001	KNOWN	basic|readthrough_transcript	processed_transcript	PDXDC2P	HGNC	processed_transcript	OTTHUMT00000395258.1	G			70055830	-1	no_errors	ENST00000525331	ensembl	human	known	70_37	rna	SNP	1.000	C
PEX11A	8800	genome.wustl.edu	37	15	90226789	90226789	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr15:90226789A>G	ENST00000300056.3	-	3	712	c.563T>C	c.(562-564)cTg>cCg	p.L188P	PEX11A_ENST00000561257.1_Missense_Mutation_p.L157P|PEX11A_ENST00000561224.1_Intron|PEX11A_ENST00000559170.1_3'UTR|PEX11A_ENST00000557982.1_Intron	NM_001271573.1	NP_001258502.1	O75192	PX11A_HUMAN	peroxisomal biogenesis factor 11 alpha	188					brown fat cell differentiation (GO:0050873)|cellular lipid metabolic process (GO:0044255)|peroxisome fission (GO:0016559)|peroxisome membrane biogenesis (GO:0016557)|peroxisome organization (GO:0007031)|regulation of peroxisome size (GO:0044375)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	integral component of peroxisomal membrane (GO:0005779)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)|protein complex (GO:0043234)	protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(2)|lung(3)	7	Lung NSC(78;0.0237)|all_lung(78;0.0478)		KIRC - Kidney renal clear cell carcinoma(17;0.0286)|Kidney(142;0.0514)|BRCA - Breast invasive adenocarcinoma(143;0.128)			ATGCTGCTTCAGAGATCGGAA	0.473																																																	0													242.0	248.0	246.0					15																	90226789		2200	4299	6499	SO:0001583	missense	8800			AF093668	CCDS10354.1, CCDS61751.1	15q	2008-08-26	2008-08-26		ENSG00000166821	ENSG00000166821			8852	protein-coding gene	gene with protein product		603866	"""peroxisomal biogenesis factor 11A"""			9792670	Standard	NM_003847		Approved	PEX11-ALPHA, MGC119947, MGC138534	uc002boi.4	O75192	OTTHUMG00000149809	ENST00000300056.3:c.563T>C	15.37:g.90226789A>G	ENSP00000300056:p.Leu188Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DV88	Missense_Mutation	SNP	pfam_PEX11	p.L188P	ENST00000300056.3	37	c.563	CCDS10354.1	15	.	.	.	.	.	.	.	.	.	.	A	14.75	2.629340	0.46944	.	.	ENSG00000166821	ENST00000300056	T	0.47177	0.85	5.75	5.75	0.90469	.	0.059477	0.64402	D	0.000002	T	0.67795	0.2931	M	0.82323	2.585	0.80722	D	1	D	0.89917	1.0	D	0.85130	0.997	T	0.69420	-0.5150	10	0.38643	T	0.18	-9.3839	9.6848	0.40091	0.9228:0.0:0.0772:0.0	.	188	O75192	PX11A_HUMAN	P	188	ENSP00000300056:L188P	ENSP00000300056:L188P	L	-	2	0	PEX11A	88027793	1.000000	0.71417	1.000000	0.80357	0.216000	0.24613	8.852000	0.92215	2.188000	0.69820	0.533000	0.62120	CTG	PEX11A	-	pfam_PEX11		0.473	PEX11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX11A	HGNC	protein_coding	OTTHUMT00000313420.1	A	NM_003847		90226789	-1	no_errors	ENST00000300056	ensembl	human	known	70_37	missense	SNP	0.976	G
PLEK2	26499	genome.wustl.edu	37	14	67854156	67854156	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr14:67854156G>A	ENST00000216446.4	-	9	1092	c.952C>T	c.(952-954)Cag>Tag	p.Q318*		NM_016445.1	NP_057529.1	Q9NYT0	PLEK2_HUMAN	pleckstrin 2	318	PH 2. {ECO:0000255|PROSITE- ProRule:PRU00145}.				actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|stomach(1)	15				all cancers(60;0.000728)|OV - Ovarian serous cystadenocarcinoma(108;0.00593)|BRCA - Breast invasive adenocarcinoma(234;0.00953)		AGGTTTCCCTGGACATTCCCT	0.438																																																	0													142.0	130.0	134.0					14																	67854156		2203	4300	6503	SO:0001587	stop_gained	26499			AF228603	CCDS9782.1	14q23.3	2014-08-12			ENSG00000100558	ENSG00000100558		"""Pleckstrin homology (PH) domain containing"""	19238	protein-coding gene	gene with protein product		608007				11911883, 17658464	Standard	NM_016445		Approved		uc001xjh.1	Q9NYT0	OTTHUMG00000171247	ENST00000216446.4:c.952C>T	14.37:g.67854156G>A	ENSP00000216446:p.Gln318*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96JT0	Nonsense_Mutation	SNP	pfam_Pleckstrin_homology,pfam_DEP_dom,smart_Pleckstrin_homology,smart_DEP_dom,pfscan_DEP_dom,pfscan_Pleckstrin_homology	p.Q318*	ENST00000216446.4	37	c.952	CCDS9782.1	14	.	.	.	.	.	.	.	.	.	.	G	35	5.541689	0.96474	.	.	ENSG00000100558	ENST00000216446	.	.	.	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-10.4977	18.3439	0.90314	0.0:0.0:1.0:0.0	.	.	.	.	X	318	.	ENSP00000216446:Q318X	Q	-	1	0	PLEK2	66923909	1.000000	0.71417	1.000000	0.80357	0.973000	0.67179	8.472000	0.90407	2.773000	0.95371	0.655000	0.94253	CAG	PLEK2	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.438	PLEK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEK2	HGNC	protein_coding	OTTHUMT00000412547.2	G			67854156	-1	no_errors	ENST00000216446	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PLEKHA5	54477	genome.wustl.edu	37	12	19282988	19282988	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:19282988G>A	ENST00000299275.6	+	2	99	c.93G>A	c.(91-93)gaG>gaA	p.E31E	PLEKHA5_ENST00000429027.2_Silent_p.E31E|PLEKHA5_ENST00000309364.4_Silent_p.E31E|PLEKHA5_ENST00000355397.3_Silent_p.E31E|PLEKHA5_ENST00000540972.1_Silent_p.E31E|PLEKHA5_ENST00000538714.1_Silent_p.E31E|PLEKHA5_ENST00000539256.1_5'UTR|PLEKHA5_ENST00000359180.3_Silent_p.E31E|PLEKHA5_ENST00000317589.4_Silent_p.E31E	NM_019012.5	NP_061885.2	Q9HAU0	PKHA5_HUMAN	pleckstrin homology domain containing, family A member 5	31	WW 1. {ECO:0000255|PROSITE- ProRule:PRU00224}.				reproductive system development (GO:0061458)	cytosol (GO:0005829)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)			autonomic_ganglia(1)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	Acute lymphoblastic leukemia(4;0.000455)|all_hematologic(4;0.00804)					CCTGCAGCGAGGAGGCCAAGA	0.716																																					Pancreas(196;329 2193 11246 14234 19524)												0													12.0	12.0	12.0					12																	19282988		2144	4200	6344	SO:0001819	synonymous_variant	54477			AF302150	CCDS8682.1, CCDS44840.1, CCDS44840.2, CCDS55809.1, CCDS58213.1, CCDS58214.1	12p12	2013-01-10			ENSG00000052126	ENSG00000052126		"""Pleckstrin homology (PH) domain containing"""	30036	protein-coding gene	gene with protein product		607770				11214970, 11001876	Standard	NM_001143821		Approved	PEPP2, KIAA1686, FLJ10667	uc031qgo.1	Q9HAU0	OTTHUMG00000167921	ENST00000299275.6:c.93G>A	12.37:g.19282988G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0JP03|B4DGS1|E9PHQ3|F5H0I0|Q6NSF8|Q86ST7|Q8N3K6|Q96DY9|Q9BVR4|Q9C0H7|Q9H924|Q9NVK8	Silent	SNP	pfam_Pleckstrin_homology,superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_WW_Rsp5_WWP	p.E31	ENST00000299275.6	37	c.93	CCDS8682.1	12																																																																																			PLEKHA5	-	superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP		0.716	PLEKHA5-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLEKHA5	HGNC	protein_coding	OTTHUMT00000397013.1	G	NM_019012		19282988	+1	no_errors	ENST00000317589	ensembl	human	known	70_37	silent	SNP	1.000	A
PPFIA1	8500	genome.wustl.edu	37	11	70221172	70221172	+	Silent	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:70221172G>T	ENST00000253925.7	+	24	3503	c.3288G>T	c.(3286-3288)ctG>ctT	p.L1096L	PPFIA1_ENST00000389547.3_Silent_p.L1096L|AP000487.5_ENST00000500185.2_RNA|PPFIA1_ENST00000530548.1_3'UTR|AP000487.5_ENST00000530690.1_RNA	NM_003626.3	NP_003617.1	Q13136	LIPA1_HUMAN	protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), alpha 1	1096	SAM 3. {ECO:0000255|PROSITE- ProRule:PRU00184}.				cell-matrix adhesion (GO:0007160)|negative regulation of establishment of protein localization to plasma membrane (GO:0090005)|negative regulation of stress fiber assembly (GO:0051497)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|presynaptic active zone (GO:0048786)	signal transducer activity (GO:0004871)			breast(3)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(11)|lung(31)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	65			BRCA - Breast invasive adenocarcinoma(2;1.04e-44)|LUSC - Lung squamous cell carcinoma(11;1.46e-14)|STAD - Stomach adenocarcinoma(18;0.0513)			TGGCACTGCTGTTACAGATCC	0.468																																																	0													83.0	69.0	74.0					11																	70221172		2200	4294	6494	SO:0001819	synonymous_variant	8500			U22816	CCDS31627.1, CCDS31628.1	11q13.3	2013-01-10			ENSG00000131626	ENSG00000131626		"""Sterile alpha motif (SAM) domain containing"""	9245	protein-coding gene	gene with protein product	"""Liprin-alpha1"""	611054				7796809, 9624153	Standard	NM_003626		Approved	LIP.1, LIPRIN	uc001opo.3	Q13136	OTTHUMG00000167266	ENST00000253925.7:c.3288G>T	11.37:g.70221172G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLE3|Q13135|Q14567|Q8N4I2	Silent	SNP	pfam_SAM_type1,pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM	p.L1096	ENST00000253925.7	37	c.3288	CCDS31627.1	11																																																																																			PPFIA1	-	pfam_SAM_2,superfamily_SAM/pointed,smart_SAM,pfscan_SAM		0.468	PPFIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PPFIA1	HGNC	protein_coding	OTTHUMT00000393905.1	G	NM_003626		70221172	+1	no_errors	ENST00000253925	ensembl	human	known	70_37	silent	SNP	0.001	T
PPP1R16B	26051	genome.wustl.edu	37	20	37536814	37536814	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr20:37536814C>A	ENST00000299824.1	+	10	1361	c.1172C>A	c.(1171-1173)aCa>aAa	p.T391K	PPP1R16B_ENST00000373331.2_Missense_Mutation_p.T349K	NM_015568.2	NP_056383.1	Q96T49	PP16B_HUMAN	protein phosphatase 1, regulatory subunit 16B	391					regulation of filopodium assembly (GO:0051489)|signal transduction (GO:0007165)	nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(4)|kidney(3)|large_intestine(10)|lung(23)|prostate(2)|skin(4)|upper_aerodigestive_tract(2)	49		Myeloproliferative disorder(115;0.00878)				GAGACCAGGACAGACCAAGAG	0.597																																																	0													96.0	88.0	91.0					20																	37536814		2203	4300	6503	SO:0001583	missense	26051			AB020630	CCDS13309.1, CCDS54462.1	20q11.23	2013-01-10	2011-10-04		ENSG00000101445	ENSG00000101445		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	15850	protein-coding gene	gene with protein product	"""TGF-beta-inhibited membrane-associated protein"", ""ankyrin repeat domain protein 4"""	613275	"""protein phosphatase 1, regulatory (inhibitor) subunit 16B"""			10048485, 12055102	Standard	NM_001172735		Approved	KIAA0823, TIMAP, ANKRD4	uc002xje.3	Q96T49	OTTHUMG00000032465	ENST00000299824.1:c.1172C>A	20.37:g.37536814C>A	ENSP00000299824:p.Thr391Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRR6|E9PFS8|O94912|Q5W9G4|Q9NQG4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pirsf_Pase-1_reg_su_16AB_euk,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.T391K	ENST00000299824.1	37	c.1172	CCDS13309.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	21.9|21.9	4.209585|4.209585	0.79240|0.79240	.|.	.|.	ENSG00000101445|ENSG00000101445	ENST00000438192|ENST00000299824;ENST00000373331	.|T;T	.|0.71579	.|-0.34;-0.58	5.79|5.79	5.79|5.79	0.91817|0.91817	.|.	.|0.164261	.|0.56097	.|D	.|0.000034	T|T	0.52821|0.52821	0.1758|0.1758	N|N	0.08118|0.08118	0|0	0.46078|0.46078	D|D	0.99885|0.99885	.|B;B	.|0.25441	.|0.126;0.002	.|B;B	.|0.18263	.|0.021;0.003	T|T	0.49153|0.49153	-0.8969|-0.8969	5|10	.|0.19147	.|T	.|0.46	.|.	20.0987|20.0987	0.97860|0.97860	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|349;391	.|E9PFS8;Q96T49	.|.;PP16B_HUMAN	K|K	292|391;349	.|ENSP00000299824:T391K;ENSP00000362428:T349K	.|ENSP00000299824:T391K	Q|T	+|+	1|2	0|0	PPP1R16B|PPP1R16B	36970228|36970228	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.999000|0.999000	0.98932|0.98932	7.395000|7.395000	0.79876|0.79876	2.771000|2.771000	0.95319|0.95319	0.644000|0.644000	0.83932|0.83932	CAG|ACA	PPP1R16B	-	pirsf_Pase-1_reg_su_16AB_euk		0.597	PPP1R16B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R16B	HGNC	protein_coding	OTTHUMT00000079220.2	C	NM_015568		37536814	+1	no_errors	ENST00000299824	ensembl	human	known	70_37	missense	SNP	1.000	A
PRDM11	56981	genome.wustl.edu	37	11	45203391	45203391	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:45203391C>T	ENST00000530656.1	+	2	176	c.176C>T	c.(175-177)aCg>aTg	p.T59M	PRDM11_ENST00000263765.4_Missense_Mutation_p.T59M|PRDM11_ENST00000424263.2_Missense_Mutation_p.T25M			Q9NQV5	PRD11_HUMAN	PR domain containing 11	59				KTEVCSPLRD -> NPS (in Ref. 1; AAF87244). {ECO:0000305}.			methyltransferase activity (GO:0008168)			endometrium(3)|kidney(3)|large_intestine(5)|lung(10)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	26						GTGGTGAAGACGGAGGTCTGC	0.622																																					NSCLC(118;1511 1736 6472 36603 43224)												0													83.0	68.0	73.0					11																	45203391		2203	4299	6502	SO:0001583	missense	56981			AF275818	CCDS58130.1, CCDS73277.1	11p11	2008-07-21			ENSG00000019485	ENSG00000019485			13996	protein-coding gene	gene with protein product	"""PR-domain containing protein 11"""						Standard	NM_001256695		Approved	PFM8	uc031qab.1	Q9NQV5	OTTHUMG00000166478	ENST00000530656.1:c.176C>T	11.37:g.45203391C>T	ENSP00000435976:p.Thr59Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N9F1	Missense_Mutation	SNP	pfscan_SET_dom	p.T59M	ENST00000530656.1	37	c.176		11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.942844	0.73672	.	.	ENSG00000019485	ENST00000263765;ENST00000530656;ENST00000526442;ENST00000424263	T;T;T;T	0.52057	0.68;0.68;0.68;0.68	5.28	5.28	0.74379	.	0.000000	0.64402	D	0.000003	T	0.58708	0.2141	L	0.36672	1.1	0.34090	D	0.660586	D	0.89917	1.0	D	0.87578	0.998	T	0.69971	-0.5000	10	0.87932	D	0	-14.3311	13.6261	0.62165	0.0:0.8448:0.1552:0.0	.	59	Q9NQV5	PRD11_HUMAN	M	59;59;25;25	ENSP00000263765:T59M;ENSP00000435976:T59M;ENSP00000431898:T25M;ENSP00000394314:T25M	ENSP00000263765:T59M	T	+	2	0	PRDM11	45159967	0.995000	0.38212	0.994000	0.49952	0.991000	0.79684	3.190000	0.50973	2.472000	0.83506	0.491000	0.48974	ACG	PRDM11	-	NULL		0.622	PRDM11-001	KNOWN	basic|appris_candidate_longest	protein_coding	PRDM11	HGNC	protein_coding	OTTHUMT00000389928.1	C	NM_020229		45203391	+1	no_errors	ENST00000263765	ensembl	human	known	70_37	missense	SNP	0.998	T
PTPRF	5792	genome.wustl.edu	37	1	44088218	44088218	+	3'UTR	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:44088218G>C	ENST00000359947.4	+	0	6608				PTPRF_ENST00000372413.3_3'UTR|PTPRF_ENST00000496447.1_3'UTR|PTPRF_ENST00000372414.3_3'UTR|PTPRF_ENST00000422171.2_3'UTR	NM_002840.3	NP_002831.2	P10586	PTPRF_HUMAN	protein tyrosine phosphatase, receptor type, F						cell adhesion (GO:0007155)|cell migration (GO:0016477)|negative regulation of receptor binding (GO:1900121)|peptidyl-tyrosine dephosphorylation (GO:0035335)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)	heparin binding (GO:0008201)|protein tyrosine phosphatase activity (GO:0004725)|transmembrane receptor protein tyrosine phosphatase activity (GO:0005001)			NS(2)|breast(4)|central_nervous_system(3)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(24)|ovary(4)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)	72	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				CTGCCAGCCTGAGCGGAGGCT	0.527																																																	0																																										SO:0001624	3_prime_UTR_variant	5792			Y00815	CCDS489.2, CCDS490.2	1p34	2013-02-11			ENSG00000142949	ENSG00000142949		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Transmembrane receptor-like"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	9670	protein-coding gene	gene with protein product		179590		LAR		7558042	Standard	NM_130440		Approved		uc001cjr.3	P10586	OTTHUMG00000007501	ENST00000359947.4:c.*544G>C	1.37:g.44088218G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPX6|D3DPX7|Q5T021|Q5T022|Q5W9G2|Q86WS0	RNA	SNP	-	NULL	ENST00000359947.4	37	NULL	CCDS489.2	1																																																																																			PTPRF	-	-		0.527	PTPRF-001	KNOWN	basic|CCDS	protein_coding	PTPRF	HGNC	protein_coding	OTTHUMT00000019710.1	G			44088218	+1	no_errors	ENST00000477970	ensembl	human	known	70_37	rna	SNP	0.004	C
RPL29	6159	genome.wustl.edu	37	3	52027880	52027880	+	Frame_Shift_Del	DEL	T	T	-	rs375418619		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:52027880delT	ENST00000466397.1	-	4	505	c.365delA	c.(364-366)aagfs	p.K122fs	RPL29_ENST00000294189.6_Frame_Shift_Del_p.K122fs|RPL29_ENST00000479017.1_Frame_Shift_Del_p.K122fs|RPL29_ENST00000475248.1_Frame_Shift_Del_p.K122fs|RPL29_ENST00000495383.1_Frame_Shift_Del_p.K122fs			P47914	RL29_HUMAN	ribosomal protein L29	122					cellular protein metabolic process (GO:0044267)|embryo implantation (GO:0007566)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytosol (GO:0005829)|cytosolic large ribosomal subunit (GO:0022625)|membrane (GO:0016020)	heparin binding (GO:0008201)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			lung(1)	1				BRCA - Breast invasive adenocarcinoma(193;8.01e-05)|Kidney(197;0.000537)|KIRC - Kidney renal clear cell carcinoma(197;0.000716)		ggccttggcctttggccGGCA	0.627																																																	0													26.0	32.0	30.0					3																	52027880		1787	3474	5261	SO:0001589	frameshift_variant	6159			U10248	CCDS2845.1	3p21.3-p21.2	2013-03-11			ENSG00000162244	ENSG00000162244		"""L ribosomal proteins"""	10331	protein-coding gene	gene with protein product	"""60S ribosomal protein L29"", ""heparin/heparan sulfate-interacting protein"", ""HP/HS-interacting protein"", ""heparin/heparan sulfate-binding protein"", ""cell surface heparin-binding protein HIP"""	601832	"""ribosomal protein L29 pseudogene 10"""	RPL29P10		8597591	Standard	NM_000992		Approved	HIP, HUMRPL29, L29	uc003dcs.3	P47914	OTTHUMG00000155262	ENST00000466397.1:c.365delA	3.37:g.52027880delT	ENSP00000418868:p.Lys122fs	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0H3|B2R4M8|Q6IPY3	Frame_Shift_Del	DEL	pfam_Ribosomal_L29e	p.K122fs	ENST00000466397.1	37	c.365	CCDS2845.1	3																																																																																			RPL29	-	NULL		0.627	RPL29-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RPL29	HGNC	protein_coding	OTTHUMT00000349680.2	T	NM_000992		52027880	-1	no_errors	ENST00000294189	ensembl	human	known	70_37	frame_shift_del	DEL	0.982	-
RPRD2	23248	genome.wustl.edu	37	1	150443762	150443762	+	Silent	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:150443762C>A	ENST00000369068.4	+	11	2342	c.2338C>A	c.(2338-2340)Cga>Aga	p.R780R	RPRD2_ENST00000401000.4_Silent_p.R754R|RPRD2_ENST00000492220.1_3'UTR|RPRD2_ENST00000539519.1_Silent_p.R754R	NM_015203.3	NP_056018.2	Q5VT52	RPRD2_HUMAN	regulation of nuclear pre-mRNA domain containing 2	780	Ser-rich.					DNA-directed RNA polymerase II, holoenzyme (GO:0016591)				central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(4)|lung(20)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	37						AAGCTACCCCCGAGAGCTCTC	0.493																																																	0													81.0	78.0	79.0					1																	150443762		1895	4115	6010	SO:0001819	synonymous_variant	23248			BX641025	CCDS44216.1, CCDS72907.1	1q21.2	2012-02-09	2008-08-15	2008-07-28	ENSG00000163125	ENSG00000163125			29039	protein-coding gene	gene with protein product		614695	"""KIAA0460"""	KIAA0460		22231121	Standard	XM_005245033		Approved	FLJ32145, HSPC099	uc009wlr.3	Q5VT52	OTTHUMG00000012808	ENST00000369068.4:c.2338C>A	1.37:g.150443762C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6N8|B3KPT1|B4E2Q6|O75048|Q5VT51|Q5VT53|Q6MZL4|Q86XD2|Q9P0D7	Silent	SNP	pfam_RNA_pol_II-bd,superfamily_ENTH_VHS,superfamily_Ricin_B_lectin,smart_RNA_polymerase_II_lsu_CTD	p.R780	ENST00000369068.4	37	c.2338	CCDS44216.1	1																																																																																			RPRD2	-	NULL		0.493	RPRD2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPRD2	HGNC	protein_coding	OTTHUMT00000035844.1	C	NM_015203		150443762	+1	no_errors	ENST00000369068	ensembl	human	known	70_37	silent	SNP	1.000	A
SCRIB	23513	genome.wustl.edu	37	8	144896051	144896051	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr8:144896051G>A	ENST00000320476.3	-	3	299	c.293C>T	c.(292-294)cCg>cTg	p.P98L	SCRIB_ENST00000356994.2_Missense_Mutation_p.P98L|MIR937_ENST00000401271.1_RNA|SCRIB_ENST00000377533.3_Missense_Mutation_p.P17L	NM_015356.4	NP_056171	Q14160	SCRIB_HUMAN	scribbled planar cell polarity protein	98	Sufficient for targeting to adherens junction and to inhibit cell proliferation.				activation of Rac GTPase activity (GO:0032863)|apoptotic process involved in morphogenesis (GO:0060561)|astrocyte cell migration (GO:0043615)|asymmetric protein localization (GO:0008105)|auditory receptor cell stereocilium organization (GO:0060088)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cochlear nucleus development (GO:0021747)|establishment of apical/basal cell polarity (GO:0035089)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of mitotic cell cycle (GO:0045930)|neural tube closure (GO:0001843)|positive chemotaxis (GO:0050918)|positive regulation of apoptotic process (GO:0043065)|positive regulation of receptor recycling (GO:0001921)|protein localization to adherens junction (GO:0071896)|single organismal cell-cell adhesion (GO:0016337)|synaptic vesicle endocytosis (GO:0048488)|synaptic vesicle targeting (GO:0016080)|viral process (GO:0016032)|wound healing (GO:0042060)	basolateral plasma membrane (GO:0016323)|cell projection (GO:0042995)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|myelin sheath abaxonal region (GO:0035748)|plasma membrane (GO:0005886)|Scrib-APC-beta-catenin complex (GO:0034750)				NS(1)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(20)|ovary(2)|pancreas(1)|skin(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	42	all_cancers(97;2.31e-11)|all_epithelial(106;1.58e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.46e-41)|Epithelial(56;1.23e-39)|all cancers(56;1.12e-34)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.18)			GATGCTCTCCGGGATCTCAGG	0.637																																					Pancreas(51;966 1133 10533 14576 29674)												0													43.0	43.0	43.0					8																	144896051		2203	4300	6503	SO:0001583	missense	23513			AY062238	CCDS6411.1, CCDS6412.1	8q24.3	2013-03-05	2013-03-05		ENSG00000180900	ENSG00000180900			30377	protein-coding gene	gene with protein product		607733	"""scribbled homolog (Drosophila)"""			11027293, 14681682	Standard	NM_182706		Approved	KIAA0147, SCRB1, Vartul	uc003yzo.1	Q14160	OTTHUMG00000165154	ENST00000320476.3:c.293C>T	8.37:g.144896051G>A	ENSP00000322938:p.Pro98Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P496|Q7Z5D1|Q8WWV8|Q96C69|Q96GG1	Missense_Mutation	SNP	pfam_PDZ,pfam_Leu-rich_rpt,superfamily_PDZ,smart_Leu-rich_rpt_typical-subtyp,smart_PDZ,pfscan_PDZ	p.P98L	ENST00000320476.3	37	c.293	CCDS6411.1	8	.	.	.	.	.	.	.	.	.	.	g	24.2	4.510042	0.85282	.	.	ENSG00000180900	ENST00000356994;ENST00000320476;ENST00000377533	T;D;T	0.85258	1.73;-1.96;1.41	4.45	4.45	0.53987	.	.	.	.	.	D	0.94768	0.8311	H	0.96460	3.825	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.96523	0.9387	9	0.87932	D	0	.	16.0386	0.80648	0.0:0.0:1.0:0.0	.	98;98	Q14160;Q14160-3	SCRIB_HUMAN;.	L	98;98;17	ENSP00000349486:P98L;ENSP00000322938:P98L;ENSP00000366756:P17L	ENSP00000322938:P98L	P	-	2	0	SCRIB	144968039	1.000000	0.71417	0.939000	0.37840	0.602000	0.36980	9.109000	0.94291	2.197000	0.70478	0.558000	0.71614	CCG	SCRIB	-	smart_Leu-rich_rpt_typical-subtyp		0.637	SCRIB-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SCRIB	HGNC	protein_coding	OTTHUMT00000382215.1	G	NM_015356		144896051	-1	no_errors	ENST00000320476	ensembl	human	known	70_37	missense	SNP	1.000	A
SCUBE1	80274	genome.wustl.edu	37	22	43606203	43606203	+	Silent	SNP	G	G	T	rs148300839		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr22:43606203G>T	ENST00000360835.4	-	19	2553	c.2427C>A	c.(2425-2427)atC>atA	p.I809I	Z82214.3_ENST00000420269.1_RNA	NM_173050.3	NP_766638.2	Q8IWY4	SCUB1_HUMAN	signal peptide, CUB domain, EGF-like 1	809	CUB. {ECO:0000255|PROSITE- ProRule:PRU00059}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|endothelial cell differentiation (GO:0045446)|inflammatory response (GO:0006954)|post-embryonic development (GO:0009791)|protein homooligomerization (GO:0051260)	cell surface (GO:0009986)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein heterodimerization activity (GO:0046982)			autonomic_ganglia(1)|breast(1)|central_nervous_system(2)|endometrium(2)|kidney(4)|large_intestine(4)|lung(11)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31		all_neural(38;0.0414)|Ovarian(80;0.07)				TGGGGGACTCGATGTAGCCGG	0.662																																																	0													78.0	65.0	69.0					22																	43606203		2203	4300	6503	SO:0001819	synonymous_variant	80274				CCDS14048.1	22q13	2008-07-01			ENSG00000159307	ENSG00000159307			13441	protein-coding gene	gene with protein product		611746				11087664	Standard	NM_173050		Approved		uc003bdt.2	Q8IWY4	OTTHUMG00000150679	ENST00000360835.4:c.2427C>A	22.37:g.43606203G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5R336	Silent	SNP	pfam_EGF-like_Ca-bd,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_EG-like_dom,pfam_CUB,superfamily_CUB,superfamily_Growth_fac_rcpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_CUB,pfscan_CUB,pfscan_EG-like_dom	p.I809	ENST00000360835.4	37	c.2427	CCDS14048.1	22																																																																																			SCUBE1	-	pfam_CUB,superfamily_CUB,smart_CUB,pfscan_CUB		0.662	SCUBE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCUBE1	HGNC	protein_coding	OTTHUMT00000319582.3	G	NM_173050		43606203	-1	no_errors	ENST00000360835	ensembl	human	known	70_37	silent	SNP	0.993	T
SFTPA1	653509	genome.wustl.edu	37	10	81373001	81373001	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr10:81373001C>G	ENST00000398636.3	+	5	487	c.349C>G	c.(349-351)Caa>Gaa	p.Q117E	SFTPA1_ENST00000428376.2_Missense_Mutation_p.Q117E|SFTPA1_ENST00000372313.5_Missense_Mutation_p.Q58E|SFTPA1_ENST00000372308.3_Missense_Mutation_p.Q117E|SFTPA1_ENST00000419470.2_Missense_Mutation_p.Q132E	NM_001164644.1|NM_001164646.1|NM_005411.4	NP_001158116.1|NP_001158118.1|NP_005402.3	Q8IWL2	SFTA1_HUMAN	surfactant protein A1	117					lipid transport (GO:0006869)|respiratory gaseous exchange (GO:0007585)	collagen trimer (GO:0005581)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	carbohydrate binding (GO:0030246)|lipid transporter activity (GO:0005319)			endometrium(1)|lung(8)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	12	all_cancers(46;0.197)|Breast(12;0.000326)|Prostate(51;0.00985)|all_epithelial(25;0.0149)		Epithelial(14;0.00957)|all cancers(16;0.0179)|Colorectal(32;0.229)			CTTTAGACATCAAATCCTGCA	0.562																																																	0													206.0	208.0	207.0					10																	81373001		2203	4296	6499	SO:0001583	missense	653509			BC026229	CCDS44444.1, CCDS44445.1, CCDS44444.2	10q22.3	2012-11-02	2008-08-26			ENSG00000122852		"""Collectins"""	10798	protein-coding gene	gene with protein product	"""surfactant, pulmonary-associated protein A1A"""	178630	"""surfactant, pulmonary-associated protein A1"""	SFTP1			Standard	NM_001093770		Approved	SP-A, SP-A1, COLEC4	uc009xry.3	Q8IWL2		ENST00000398636.3:c.349C>G	10.37:g.81373001C>G	ENSP00000381633:p.Gln117Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3T8|B7ZW50|E3VLD8|E3VLD9|E3VLE0|E3VLE1|G5E9J3|P07714|Q14DV4|Q5RIR5|Q5RIR7|Q6PIT0|Q8TC19	Missense_Mutation	SNP	pfam_C-type_lectin,pfam_Collagen,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.Q132E	ENST00000398636.3	37	c.394	CCDS44445.1	10	.	.	.	.	.	.	.	.	.	.	.	3.838	-0.034454	0.07543	.	.	ENSG00000122852	ENST00000372308;ENST00000398636;ENST00000428376;ENST00000372313;ENST00000419470;ENST00000394569;ENST00000429958;ENST00000439264	D;D;D;T;D;D;D	0.88124	-2.13;-2.1;-2.1;2.94;-2.05;-2.34;-2.34	2.71	1.75	0.24633	.	0.424841	0.22940	N	0.053794	T	0.78874	0.4352	L	0.49126	1.545	0.24819	N	0.992598	B;B;B	0.25563	0.061;0.101;0.129	B;B;B	0.22753	0.018;0.041;0.018	T	0.60806	-0.7190	10	0.15952	T	0.53	-1.4991	6.6945	0.23191	0.281:0.719:0.0:0.0	.	117;132;117	Q8IWL1;G5E9J3;Q8IWL2	SFPA2_HUMAN;.;SFTA1_HUMAN	E	117;117;117;58;132;117;117;117	ENSP00000361382:Q117E;ENSP00000381633:Q117E;ENSP00000411102:Q117E;ENSP00000361387:Q58E;ENSP00000397082:Q132E;ENSP00000395527:Q117E;ENSP00000401649:Q117E	ENSP00000361382:Q117E	Q	+	1	0	SFTPA1	81043007	0.799000	0.28903	0.738000	0.30950	0.436000	0.31835	0.643000	0.24750	0.651000	0.30788	0.448000	0.29417	CAA	SFTPA1	-	NULL		0.562	SFTPA1-203	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SFTPA1	HGNC	protein_coding		C	NM_005411		81373001	+1	no_errors	ENST00000419470	ensembl	human	known	70_37	missense	SNP	0.836	G
SHKBP1	92799	genome.wustl.edu	37	19	41096211	41096211	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:41096211G>A	ENST00000291842.5	+	16	1700	c.1651G>A	c.(1651-1653)Gag>Aag	p.E551K	SHKBP1_ENST00000600733.1_Missense_Mutation_p.E526K|SHKBP1_ENST00000597649.1_3'UTR|LTBP4_ENST00000204005.9_5'Flank|LTBP4_ENST00000545697.1_5'Flank	NM_138392.3	NP_612401.2	Q8TBC3	SHKB1_HUMAN	SH3KBP1 binding protein 1	551					protein homooligomerization (GO:0051260)					breast(1)|cervix(1)|endometrium(1)|kidney(4)|large_intestine(5)|lung(10)|ovary(2)|pancreas(1)|skin(3)|urinary_tract(1)	29			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			GCTGGAGTGCGAGGGCTCCCG	0.701																																																	0													17.0	20.0	19.0					19																	41096211		2198	4294	6492	SO:0001583	missense	92799			AF258553	CCDS12560.1	19q13.2	2013-01-10				ENSG00000160410		"""WD repeat domain containing"""	19214	protein-coding gene	gene with protein product						11152963	Standard	NM_138392		Approved	PP203, Sb1	uc002oob.3	Q8TBC3		ENST00000291842.5:c.1651G>A	19.37:g.41096211G>A	ENSP00000291842:p.Glu551Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N2I6|Q8WY93|Q96IB8	Missense_Mutation	SNP	pfam_T1-type_BTB,pfam_WD40_repeat,superfamily_BTB/POZ_fold,superfamily_WD40_repeat_dom,smart_BTB/POZ-like,smart_WD40_repeat,pfscan_BTB/POZ-like	p.E551K	ENST00000291842.5	37	c.1651	CCDS12560.1	19	.	.	.	.	.	.	.	.	.	.	g	24.7	4.560045	0.86335	.	.	ENSG00000160410	ENST00000291842;ENST00000446701	T	0.49139	0.79	4.5	4.5	0.54988	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.64402	D	0.000001	T	0.69223	0.3087	M	0.77616	2.38	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;0.999;1.0;0.999	D;D;D;D;D	0.78314	0.991;0.981;0.988;0.986;0.972	T	0.74685	-0.3582	10	0.87932	D	0	-20.4062	16.1117	0.81270	0.0:0.0:1.0:0.0	.	429;331;388;551;551	B4DLI0;B4DUW2;B3KVX8;B2R6W9;Q8TBC3	.;.;.;.;SHKB1_HUMAN	K	551;331	ENSP00000291842:E551K	ENSP00000291842:E551K	E	+	1	0	SHKBP1	45788051	1.000000	0.71417	0.935000	0.37517	0.411000	0.31082	9.062000	0.93920	2.329000	0.79093	0.306000	0.20318	GAG	SHKBP1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.701	SHKBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHKBP1	HGNC	protein_coding	OTTHUMT00000462613.2	G	NM_138392		41096211	+1	no_errors	ENST00000291842	ensembl	human	known	70_37	missense	SNP	1.000	A
SHOX	6473	genome.wustl.edu	37	X	595405	595405	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chrX:595405C>T	ENST00000554971.1	+	2	421	c.330C>T	c.(328-330)gaC>gaT	p.D110D	SHOX_ENST00000334060.3_Silent_p.D110D|SHOX_ENST00000381575.1_Silent_p.D110D|SHOX_ENST00000381578.1_Silent_p.D110D			O15266	SHOX_HUMAN	short stature homeobox	110					skeletal system development (GO:0001501)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|lung(9)|prostate(1)	13		all_cancers(21;4.28e-07)|all_epithelial(21;2.07e-08)|all_lung(23;2.81e-05)|Lung NSC(23;0.000693)|Lung SC(21;0.122)				AGGACGAGGACGGGCAGACCA	0.622																																					Ovarian(95;18 1419 12424 14056 28266)												0													124.0	115.0	118.0					X																	595405		2203	4296	6499	SO:0001819	synonymous_variant	6473			U82668	CCDS14106.1, CCDS14107.1	Xp22.33 and Yp11.32	2014-07-16			ENSG00000185960	ENSG00000185960		"""Pseudoautosomal regions / PAR1"", ""Homeoboxes / PRD class"""	10853	protein-coding gene	gene with protein product		312865, 400020				9259282, 9140395	Standard	XR_247282		Approved	PHOG, GCFX, SS, SHOXY	uc004cph.1	O15266	OTTHUMG00000021053	ENST00000554971.1:c.330C>T	X.37:g.595405C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00412|O00413|O15267	Silent	SNP	pfam_Homeodomain,pfam_OAR_dom,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_OAR_dom,pfscan_Homeodomain,prints_HTH_motif	p.D110	ENST00000554971.1	37	c.330	CCDS14107.1	X																																																																																			SHOX	-	superfamily_Homeodomain-like		0.622	SHOX-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SHOX	HGNC	protein_coding	OTTHUMT00000411999.3	C	NM_000451		595405	+1	no_errors	ENST00000381578	ensembl	human	known	70_37	silent	SNP	1.000	T
SLC17A9	63910	genome.wustl.edu	37	20	61588825	61588825	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr20:61588825C>T	ENST00000370351.4	+	3	421	c.290C>T	c.(289-291)gCc>gTc	p.A97V	SLC17A9_ENST00000488738.1_3'UTR|SLC17A9_ENST00000370349.3_Missense_Mutation_p.A91V	NM_022082.3	NP_071365	Q9BYT1	S17A9_HUMAN	solute carrier family 17 (vesicular nucleotide transporter), member 9	97					exocytosis (GO:0006887)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)	transporter activity (GO:0005215)			endometrium(2)|kidney(1)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	23						CTGCTGTCAGCCTCTGCCTGG	0.632																																																	0													79.0	87.0	84.0					20																	61588825		2168	4260	6428	SO:0001583	missense	63910			AK027065	CCDS42901.1	20q13.33	2013-07-18	2013-07-18	2009-01-22	ENSG00000101194	ENSG00000101194		"""Solute carriers"""	16192	protein-coding gene	gene with protein product		612107	"""chromosome 20 open reading frame 59"", ""solute carrier family 17, member 9"""	C20orf59		18375752	Standard	NM_022082		Approved	FLJ23412, VNUT	uc002yea.4	Q9BYT1	OTTHUMG00000032951	ENST00000370351.4:c.290C>T	20.37:g.61588825C>T	ENSP00000359376:p.Ala97Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTF2|Q5W198|Q8TB07|Q8TBP4|Q8TEL5|Q9BYT0|Q9BYT2	Missense_Mutation	SNP	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom	p.A97V	ENST00000370351.4	37	c.290	CCDS42901.1	20	.	.	.	.	.	.	.	.	.	.	C	33	5.194578	0.94960	.	.	ENSG00000101194	ENST00000370351;ENST00000370349;ENST00000411611	T;T;T	0.56941	0.43;0.43;0.43	4.57	4.57	0.56435	Major facilitator superfamily domain, general substrate transporter (1);Major facilitator superfamily domain (1);	0.000000	0.85682	D	0.000000	T	0.53126	0.1777	N	0.25201	0.72	0.80722	D	1	P;D;D	0.56746	0.94;0.977;0.972	P;D;P	0.65323	0.897;0.934;0.891	T	0.45440	-0.9261	10	0.02654	T	1	.	17.3543	0.87331	0.0:1.0:0.0:0.0	.	117;97;91	B4DPU8;Q9BYT1;Q9BYT1-2	.;S17A9_HUMAN;.	V	97;91;117	ENSP00000359376:A97V;ENSP00000359374:A91V;ENSP00000388215:A117V	ENSP00000359374:A91V	A	+	2	0	SLC17A9	61059270	1.000000	0.71417	0.858000	0.33744	0.933000	0.57130	7.117000	0.77129	2.098000	0.63641	0.561000	0.74099	GCC	SLC17A9	-	pfam_MFS,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom		0.632	SLC17A9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC17A9	HGNC	protein_coding	OTTHUMT00000080100.1	C	NM_022082		61588825	+1	no_errors	ENST00000370351	ensembl	human	known	70_37	missense	SNP	0.997	T
SLC38A2	54407	genome.wustl.edu	37	12	46759016	46759016	+	Intron	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:46759016C>G	ENST00000256689.5	-	8	1008				SLC38A2_ENST00000551374.1_Missense_Mutation_p.E12Q|SLC38A2_ENST00000547252.1_Intron	NM_018976.4	NP_061849.2	Q96QD8	S38A2_HUMAN	solute carrier family 38, member 2						amino acid transport (GO:0006865)|glutamate secretion (GO:0014047)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|sodium ion transport (GO:0006814)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	amino acid transmembrane transporter activity (GO:0015171)|symporter activity (GO:0015293)			cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	18	Lung SC(27;0.192)|Renal(347;0.236)		OV - Ovarian serous cystadenocarcinoma(5;0.0048)|Epithelial(2;0.0374)	GBM - Glioblastoma multiforme(48;0.226)		CAAATATCCTCTGAAAAATAT	0.353																																					Ovarian(9;448 492 8335 28722 40361)												0													48.0	49.0	49.0					12																	46759016		2203	4300	6503	SO:0001627	intron_variant	54407			AB037803	CCDS8749.1	12q13.11	2014-08-12			ENSG00000134294	ENSG00000134294		"""Solute carriers"""	13448	protein-coding gene	gene with protein product		605180				10747860, 17237199	Standard	NM_018976		Approved	SAT2, ATA2, KIAA1382, SNAT2	uc001rpg.3	Q96QD8	OTTHUMG00000169471	ENST00000256689.5:c.564-44G>C	12.37:g.46759016C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IA88|Q6ZMG2|Q9HAV3|Q9NVA8|Q9P2G5	Missense_Mutation	SNP	pfam_AA_transpt_TM	p.E12Q	ENST00000256689.5	37	c.34	CCDS8749.1	12	.	.	.	.	.	.	.	.	.	.	C	4.811	0.150856	0.09185	.	.	ENSG00000134294	ENST00000551374	T	0.22134	1.97	3.73	1.85	0.25348	.	.	.	.	.	T	0.12178	0.0296	.	.	.	0.09310	N	1	B	0.26809	0.16	B	0.24155	0.051	T	0.33574	-0.9863	7	.	.	.	.	6.7929	0.23709	0.0:0.6863:0.0:0.3137	.	12	F8VQW8	.	Q	12	ENSP00000450406:E12Q	.	E	-	1	0	SLC38A2	45045283	0.000000	0.05858	0.002000	0.10522	0.011000	0.07611	0.113000	0.15499	0.211000	0.20683	-0.251000	0.11542	GAG	SLC38A2	-	NULL		0.353	SLC38A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC38A2	HGNC	protein_coding	OTTHUMT00000404226.1	C			46759016	-1	no_errors	ENST00000551374	ensembl	human	novel	70_37	missense	SNP	0.017	G
SLC4A1AP	22950	genome.wustl.edu	37	2	27898427	27898427	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:27898427G>A	ENST00000326019.6	+	6	1656	c.1374G>A	c.(1372-1374)tgG>tgA	p.W458*		NM_018158.2	NP_060628.2	Q9BWU0	NADAP_HUMAN	solute carrier family 4 (anion exchanger), member 1, adaptor protein	458						cytoplasm (GO:0005737)|nucleus (GO:0005634)				breast(2)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(9)|upper_aerodigestive_tract(1)	23	Acute lymphoblastic leukemia(172;0.155)					CCAAGAACTGGGAAGATGAAG	0.363																																																	0													103.0	107.0	106.0					2																	27898427		2203	4300	6503	SO:0001587	stop_gained	22950				CCDS33166.1	2p23.3	2010-03-11	2001-11-28		ENSG00000163798	ENSG00000163798			13813	protein-coding gene	gene with protein product	"""lung cancer oncogene 3"""	602655	"""solute carrier family 4 (anion exchanger), member 1, adapter protein"""			9422766	Standard	NM_018158		Approved	kanadaptin, HLC3	uc002rlk.4	Q9BWU0	OTTHUMG00000151944	ENST00000326019.6:c.1374G>A	2.37:g.27898427G>A	ENSP00000323837:p.Trp458*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJ39|Q4KMT1|Q4KMX0|Q7Z5Q9|Q9NVN2	Nonsense_Mutation	SNP	pfam_FHA_dom,pfam_Ds-RNA-bd,superfamily_SMAD_FHA_domain,smart_FHA_dom,pfscan_FHA_dom	p.W458*	ENST00000326019.6	37	c.1374	CCDS33166.1	2	.	.	.	.	.	.	.	.	.	.	G	38	7.182898	0.98118	.	.	ENSG00000163798	ENST00000326019	.	.	.	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.07175	T	0.84	-3.7967	19.5643	0.95386	0.0:0.0:1.0:0.0	.	.	.	.	X	458	.	ENSP00000323837:W458X	W	+	3	0	SLC4A1AP	27751931	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.148000	0.94652	2.639000	0.89480	0.555000	0.69702	TGG	SLC4A1AP	-	NULL		0.363	SLC4A1AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A1AP	HGNC	protein_coding	OTTHUMT00000324550.1	G	NM_018158		27898427	+1	no_errors	ENST00000326019	ensembl	human	known	70_37	nonsense	SNP	1.000	A
TBR1	10716	genome.wustl.edu	37	2	162281186	162281186	+	3'UTR	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:162281186C>T	ENST00000389554.3	+	0	2814				AC009487.4_ENST00000437683.1_RNA|AC009487.5_ENST00000505579.1_RNA|AC009487.4_ENST00000444164.1_RNA	NM_006593.2	NP_006584.1	Q16650	TBR1_HUMAN	T-box, brain, 1						axon guidance (GO:0007411)|brain development (GO:0007420)|hindbrain development (GO:0030902)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of neuron projection development (GO:0010975)|specification of organ identity (GO:0010092)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(15)|ovary(1)|prostate(1)|skin(3)	30						CCACCCAGCGCGTCCTTTCTT	0.502																																																	0																																										SO:0001624	3_prime_UTR_variant	57282			U49250	CCDS33310.1	2q24.2	2011-06-13			ENSG00000136535	ENSG00000136535		"""T-boxes"""	11590	protein-coding gene	gene with protein product		604616				7619531	Standard	NM_006593		Approved		uc002ubw.1	Q16650	OTTHUMG00000153888	ENST00000389554.3:c.*448C>T	2.37:g.162281186C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0AZS4|B2R6G5|Q14DC5|Q53TH0|Q56A81	RNA	SNP	-	NULL	ENST00000389554.3	37	NULL	CCDS33310.1	2																																																																																			SLC4A10	-	-		0.502	TBR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC4A10	HGNC	protein_coding	OTTHUMT00000332845.1	C	NM_006593		162281186	+1	no_errors	ENST00000482861	ensembl	human	known	70_37	rna	SNP	1.000	T
SMCR8	140775	genome.wustl.edu	37	17	18219778	18219778	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr17:18219778C>T	ENST00000406438.3	+	1	1155	c.675C>T	c.(673-675)taC>taT	p.Y225Y	TOP3A_ENST00000542570.1_5'Flank|TOP3A_ENST00000321105.5_5'Flank|TOP3A_ENST00000582230.1_5'Flank	NM_144775.2	NP_658988.2	Q8TEV9	SMCR8_HUMAN	Smith-Magenis syndrome chromosome region, candidate 8	225						nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(3)|kidney(4)|large_intestine(1)|lung(7)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	21						AAGGCTTTTACTCATCTCAGG	0.463																																																	0													59.0	55.0	56.0					17																	18219778		2203	4300	6503	SO:0001819	synonymous_variant	140775			AF467440	CCDS11195.2	17p11.2	2014-06-12			ENSG00000176994	ENSG00000176994			17921	protein-coding gene	gene with protein product						11997338, 23248642	Standard	NM_144775		Approved	FLJ34716	uc002gsy.4	Q8TEV9	OTTHUMG00000059394	ENST00000406438.3:c.675C>T	17.37:g.18219778C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKZ5|Q3ZCN0|Q6PJL3	Silent	SNP	pfam_Folliculin	p.Y225	ENST00000406438.3	37	c.675	CCDS11195.2	17																																																																																			SMCR8	-	NULL		0.463	SMCR8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCR8	HGNC	protein_coding	OTTHUMT00000132065.2	C	NM_144775		18219778	+1	no_errors	ENST00000406438	ensembl	human	known	70_37	silent	SNP	0.991	T
SMG1	23049	genome.wustl.edu	37	16	18849988	18849988	+	Silent	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:18849988G>C	ENST00000446231.2	-	43	7381	c.6969C>G	c.(6967-6969)gtC>gtG	p.V2323V	SMG1_ENST00000389467.3_Silent_p.V2323V			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	2323	PI3K/PI4K. {ECO:0000255|PROSITE- ProRule:PRU00269}.				DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						CCATAGACATGACTGCAGTAG	0.388																																																	0													107.0	97.0	101.0					16																	18849988		1877	4113	5990	SO:0001819	synonymous_variant	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.6969C>G	16.37:g.18849988G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Silent	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.V2323	ENST00000446231.2	37	c.6969	CCDS45430.1	16																																																																																			SMG1	-	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom		0.388	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	G	NM_015092		18849988	-1	no_errors	ENST00000389467	ensembl	human	known	70_37	silent	SNP	1.000	C
SPATA13	221178	genome.wustl.edu	37	13	24868965	24868965	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:24868965G>A	ENST00000382095.4	+	9	1701	c.1294G>A	c.(1294-1296)Gac>Aac	p.D432N	SPATA13_ENST00000409126.1_Missense_Mutation_p.D292N|RP11-307N16.6_ENST00000382141.4_Missense_Mutation_p.D935N|SPATA13_ENST00000382108.3_Missense_Mutation_p.D1057N|SPATA13_ENST00000343003.6_Missense_Mutation_p.D376N|SPATA13_ENST00000399949.2_Missense_Mutation_p.D354N|SPATA13_ENST00000424834.2_Missense_Mutation_p.D1057N	NM_153023.2	NP_694568.1	Q96N96	SPT13_HUMAN	spermatogenesis associated 13	432					cell migration (GO:0016477)|filopodium assembly (GO:0046847)|lamellipodium assembly (GO:0030032)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Rac GTPase activity (GO:0032855)|regulation of cell migration (GO:0030334)	cytoplasm (GO:0005737)|filopodium (GO:0030175)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			breast(4)|endometrium(2)|large_intestine(9)|lung(4)|ovary(1)|prostate(1)|skin(2)	23		all_cancers(29;4.05e-15)|all_lung(29;2.77e-14)|all_epithelial(30;7.77e-13)|Lung SC(185;0.0279)		all cancers(112;0.00616)|Epithelial(112;0.0195)|OV - Ovarian serous cystadenocarcinoma(117;0.0705)|Lung(94;0.231)		GGAGAGCATCGACAAGATAGC	0.542																																																	0													120.0	97.0	105.0					13																	24868965		2203	4300	6503	SO:0001583	missense	221178			AK055770	CCDS9305.1, CCDS53857.1, CCDS66517.1, CCDS66518.1, CCDS73553.1	13q12.13	2013-01-10			ENSG00000182957	ENSG00000182957		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	23222	protein-coding gene	gene with protein product		613324					Standard	NM_001286795		Approved	FLJ31208, ARHGEF29	uc021rhg.1	Q96N96	OTTHUMG00000016578	ENST00000382095.4:c.1294G>A	13.37:g.24868965G>A	ENSP00000371527:p.Asp432Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VEA9|A6NF85|B4DQB1|B4DSZ0|B4DVM8|J3KPJ7|J3KQH2|Q5VX68|Q6ZML1|Q8N873|Q8TEK6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_SH3_domain,smart_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.D1057N	ENST00000382095.4	37	c.3169	CCDS9305.1	13	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	19.57|19.57	3.852835|3.852835	0.71719|0.71719	.|.	.|.	ENSG00000182957|ENSG00000182957	ENST00000382108;ENST00000382095;ENST00000434675;ENST00000438694;ENST00000399949;ENST00000409126;ENST00000343003|ENST00000424834	D;D;D;D;D;D|.	0.88124|.	-2.34;-2.34;-2.34;-2.34;-2.34;-2.34|.	5.42|5.42	4.57|4.57	0.56435|0.56435	Dbl homology (DH) domain (2);|.	0.043527|.	0.85682|.	N|.	0.000000|.	T|T	0.70298|0.70298	0.3208|0.3208	M|M	0.68317|0.68317	2.08|2.08	0.58432|0.58432	D|D	0.999999|0.999999	B;B;B;B;B;B|.	0.29646|.	0.253;0.098;0.09;0.168;0.057;0.034|.	B;B;B;B;B;B|.	0.20184|.	0.02;0.028;0.017;0.028;0.028;0.012|.	T|T	0.69789|0.69789	-0.5050|-0.5050	10|5	0.66056|.	D|.	0.02|.	.|.	13.0145|13.0145	0.58749|0.58749	0.0774:0.0:0.9226:0.0|0.0774:0.0:0.9226:0.0	.|.	292;376;316;378;354;432|.	E9PFR9;Q96N96-3;Q96N96-5;Q96N96-4;Q96N96-2;Q96N96|.	.;.;.;.;.;SPT13_HUMAN|.	N|Q	1057;432;330;378;354;292;376|1094	ENSP00000371542:D1057N;ENSP00000371527:D432N;ENSP00000401605:D330N;ENSP00000382830:D354N;ENSP00000386471:D292N;ENSP00000343631:D376N|.	ENSP00000343631:D376N|.	D|R	+|+	1|2	0|0	SPATA13|SPATA13	23766965|23766965	1.000000|1.000000	0.71417|0.71417	0.998000|0.998000	0.56505|0.56505	0.994000|0.994000	0.84299|0.84299	7.602000|7.602000	0.82796|0.82796	1.304000|1.304000	0.44892|0.44892	0.561000|0.561000	0.74099|0.74099	GAC|CGA	SPATA13	-	superfamily_DH-domain		0.542	SPATA13-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SPATA13	HGNC	protein_coding	OTTHUMT00000044180.2	G	NM_153023		24868965	+1	no_errors	ENST00000382108	ensembl	human	known	70_37	missense	SNP	1.000	A
ST8SIA4	7903	genome.wustl.edu	37	5	100191850	100191850	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr5:100191850G>A	ENST00000231461.5	-	4	1064	c.754C>T	c.(754-756)Cga>Tga	p.R252*		NM_005668.4	NP_005659.1	Q92187	SIA8D_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4	252					axon guidance (GO:0007411)|cellular protein modification process (GO:0006464)|ganglioside biosynthetic process (GO:0001574)|N-glycan processing (GO:0006491)|nervous system development (GO:0007399)|oligosaccharide metabolic process (GO:0009311)|protein glycosylation (GO:0006486)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.R252*(1)		NS(1)|central_nervous_system(1)|endometrium(3)|large_intestine(11)|lung(7)|stomach(1)|upper_aerodigestive_tract(1)	25		all_cancers(142;1.5e-07)|all_epithelial(76;1.43e-10)|Prostate(80;0.000644)|Lung NSC(167;0.0059)|all_lung(232;0.00914)|Ovarian(225;0.024)|Colorectal(57;0.09)|Breast(839;0.203)		COAD - Colon adenocarcinoma(37;0.00402)		TAGGCAGTTCGCACTTTCAGT	0.433																																																	1	Substitution - Nonsense(1)	large_intestine(1)											150.0	132.0	138.0					5																	100191850		2203	4300	6503	SO:0001587	stop_gained	7903			L41680	CCDS4091.1, CCDS47252.1	5q21	2013-03-01	2003-01-14	2005-02-07	ENSG00000113532	ENSG00000113532		"""Sialyltransferases"""	10871	protein-coding gene	gene with protein product	"""ST8Sia IV"""	602547	"""sialyltransferase 8 (alpha-2, 8-polysialytransferase) D"""	SIAT8D		7624364	Standard	NM_005668		Approved	PST, PST1	uc003knk.3	Q92187	OTTHUMG00000128727	ENST00000231461.5:c.754C>T	5.37:g.100191850G>A	ENSP00000231461:p.Arg252*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA07|G3V104|Q8N1F4|Q92693	Nonsense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.R252*	ENST00000231461.5	37	c.754	CCDS4091.1	5	.	.	.	.	.	.	.	.	.	.	G	35	5.577882	0.96565	.	.	ENSG00000113532	ENST00000231461	.	.	.	5.32	4.44	0.53790	.	0.078508	0.50627	D	0.000103	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-20.9773	12.5902	0.56439	0.0:0.0:0.6999:0.3001	.	.	.	.	X	252	.	ENSP00000231461:R252X	R	-	1	2	ST8SIA4	100219749	1.000000	0.71417	0.996000	0.52242	0.225000	0.24961	4.415000	0.59809	1.437000	0.47472	0.591000	0.81541	CGA	ST8SIA4	-	pfam_Glyco_trans_29,pirsf_Sialyl_trans		0.433	ST8SIA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ST8SIA4	HGNC	protein_coding	OTTHUMT00000250632.3	G	NM_005668		100191850	-1	no_errors	ENST00000231461	ensembl	human	known	70_37	nonsense	SNP	1.000	A
STOML3	161003	genome.wustl.edu	37	13	39542567	39542567	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:39542567C>T	ENST00000379631.4	-	6	965	c.621G>A	c.(619-621)gaG>gaA	p.E207E	STOML3_ENST00000423210.1_Silent_p.E198E	NM_145286.2	NP_660329.1	Q8TAV4	STML3_HUMAN	stomatin (EPB72)-like 3	207					signal transduction (GO:0007165)	cilium (GO:0005929)|integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)				breast(1)|large_intestine(2)|lung(5)|ovary(1)|prostate(1)|skin(1)	11		Lung NSC(96;1.42e-05)|Prostate(109;0.00851)|Breast(139;0.0199)|Lung SC(185;0.0743)		all cancers(112;2.93e-08)|Epithelial(112;3.64e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00107)|BRCA - Breast invasive adenocarcinoma(63;0.00349)|GBM - Glioblastoma multiforme(144;0.0137)		TGGCCTCAGCCTCGGCTGCCA	0.562																																																	0													97.0	91.0	93.0					13																	39542567		2203	4300	6503	SO:0001819	synonymous_variant	161003			BC025760	CCDS9367.1, CCDS45040.1	13q13.2	2004-03-05			ENSG00000133115	ENSG00000133115			19420	protein-coding gene	gene with protein product		608327				12122055	Standard	NM_145286		Approved	SRO, Epb7.2l	uc001uwx.3	Q8TAV4	OTTHUMG00000016763	ENST00000379631.4:c.621G>A	13.37:g.39542567C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E285|Q5JS35	Silent	SNP	pfam_Band_7,smart_Band_7,prints_Stomatin	p.E207	ENST00000379631.4	37	c.621	CCDS9367.1	13																																																																																			STOML3	-	pfam_Band_7,smart_Band_7,prints_Stomatin		0.562	STOML3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	STOML3	HGNC	protein_coding	OTTHUMT00000044604.2	C			39542567	-1	no_errors	ENST00000379631	ensembl	human	known	70_37	silent	SNP	1.000	T
STRA6	64220	genome.wustl.edu	37	15	74486261	74486261	+	Silent	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr15:74486261G>T	ENST00000323940.5	-	8	845	c.600C>A	c.(598-600)atC>atA	p.I200I	STRA6_ENST00000563965.1_Silent_p.I239I|STRA6_ENST00000423167.2_Silent_p.I191I|STRA6_ENST00000395105.4_Silent_p.I200I|STRA6_ENST00000574439.1_5'UTR|STRA6_ENST00000574278.1_Silent_p.I215I|STRA6_ENST00000416286.3_Silent_p.I192I|STRA6_ENST00000535552.1_Silent_p.I237I|STRA6_ENST00000449139.2_Silent_p.I200I	NM_001142617.1|NM_001142618.1|NM_001142619.1	NP_001136089.1|NP_001136090.1|NP_001136091.1	Q9BX79	STRA6_HUMAN	stimulated by retinoic acid 6	200					adrenal gland development (GO:0030325)|alveolar primary septum development (GO:0061143)|artery morphogenesis (GO:0048844)|blood vessel development (GO:0001568)|cognition (GO:0050890)|developmental growth (GO:0048589)|diaphragm development (GO:0060539)|digestive tract morphogenesis (GO:0048546)|ductus arteriosus closure (GO:0097070)|ear development (GO:0043583)|embryonic camera-type eye formation (GO:0060900)|embryonic digestive tract development (GO:0048566)|eyelid development in camera-type eye (GO:0061029)|face morphogenesis (GO:0060325)|feeding behavior (GO:0007631)|female genitalia development (GO:0030540)|head development (GO:0060322)|head morphogenesis (GO:0060323)|heart development (GO:0007507)|kidney development (GO:0001822)|learning (GO:0007612)|lung alveolus development (GO:0048286)|lung development (GO:0030324)|lung vasculature development (GO:0060426)|neuromuscular process (GO:0050905)|nose morphogenesis (GO:0043585)|paramesonephric duct development (GO:0061205)|phototransduction, visible light (GO:0007603)|positive regulation of behavior (GO:0048520)|positive regulation of JAK-STAT cascade (GO:0046427)|pulmonary artery morphogenesis (GO:0061156)|pulmonary valve morphogenesis (GO:0003184)|retinoic acid metabolic process (GO:0042573)|retinoid metabolic process (GO:0001523)|retinol transport (GO:0034633)|smooth muscle tissue development (GO:0048745)|uterus morphogenesis (GO:0061038)|ventricular septum development (GO:0003281)|vitamin A import (GO:0071939)|vocal learning (GO:0042297)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	receptor activity (GO:0004872)|vitamin transporter activity (GO:0051183)			NS(1)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(5)|skin(1)|stomach(2)	26						AGTACTTGTAGATCTGGACAG	0.577																																																	0													141.0	152.0	148.0					15																	74486261		2198	4297	6495	SO:0001819	synonymous_variant	64220			AF352728	CCDS10261.1, CCDS45301.1, CCDS45302.1, CCDS55973.1, CCDS55974.1, CCDS58387.1	15q24.1	2014-07-14	2012-12-07		ENSG00000137868	ENSG00000137868			30650	protein-coding gene	gene with protein product	"""retinol binding protein 4 receptor"""	610745	"""stimulated by retinoic acid gene 6 homolog (mouse)"", ""stimulated by retinoic acid 6 homolog (mouse)"""			17255476, 17273977	Standard	NM_022369		Approved	FLJ12541	uc002axj.3	Q9BX79	OTTHUMG00000138998	ENST00000323940.5:c.600C>A	15.37:g.74486261G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7F1|B7Z5M9|B7Z862|D3DW54|F5GYI8|I3L1G8|Q6PJF8|Q71RB9|Q7L9G1|Q7Z3U9|Q8TB21|Q9BX78|Q9H9U8	Silent	SNP	NULL	p.I239	ENST00000323940.5	37	c.717	CCDS10261.1	15																																																																																			STRA6	-	NULL		0.577	STRA6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	STRA6	HGNC	protein_coding	OTTHUMT00000272891.1	G			74486261	-1	no_errors	ENST00000563965	ensembl	human	known	70_37	silent	SNP	0.999	T
SULT1C4	27233	genome.wustl.edu	37	2	108999913	108999913	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:108999913G>C	ENST00000272452.2	+	5	888	c.562G>C	c.(562-564)Gaa>Caa	p.E188Q	SULT1C4_ENST00000409309.3_Missense_Mutation_p.E113Q	NM_006588.2	NP_006579.2	O75897	ST1C4_HUMAN	sulfotransferase family, cytosolic, 1C, member 4	188					3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|small molecule metabolic process (GO:0044281)|sulfation (GO:0051923)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	sulfotransferase activity (GO:0008146)			endometrium(1)|large_intestine(3)|lung(7)|upper_aerodigestive_tract(1)	12						AGGATGGTGGGAAGCCAAAGA	0.468																																																	0													136.0	116.0	122.0					2																	108999913		2203	4300	6503	SO:0001583	missense	27233			AF055584	CCDS2077.1	2q12.3	2008-09-04	2007-03-16	2007-03-16	ENSG00000198075	ENSG00000198075		"""Sulfotransferases, cytosolic"""	11457	protein-coding gene	gene with protein product		608357	"""sulfotransferase family, cytosolic, 1C, member 2"""	SULT1C2		10783263, 9852044	Standard	NM_006588		Approved	SULT1C	uc002tea.1	O75897	OTTHUMG00000130958	ENST00000272452.2:c.562G>C	2.37:g.108999913G>C	ENSP00000272452:p.Glu188Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q069I8|Q08AS5|Q53S63	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.E188Q	ENST00000272452.2	37	c.562	CCDS2077.1	2	.	.	.	.	.	.	.	.	.	.	G	13.66	2.304862	0.40795	.	.	ENSG00000198075	ENST00000272452;ENST00000409309	T;T	0.01933	4.55;4.55	4.65	-3.01	0.05463	Sulfotransferase domain (1);	1.176420	0.06182	N	0.679663	T	0.02267	0.0070	N	0.25957	0.775	0.28774	N	0.900214	B;B	0.28933	0.228;0.003	B;B	0.30782	0.12;0.015	T	0.45381	-0.9265	10	0.51188	T	0.08	.	8.9672	0.35883	0.6949:0.1276:0.1775:0.0	.	113;188	Q08AS5;O75897	.;ST1C4_HUMAN	Q	188;113	ENSP00000272452:E188Q;ENSP00000387225:E113Q	ENSP00000272452:E188Q	E	+	1	0	SULT1C4	108366345	0.312000	0.24545	0.071000	0.20095	0.977000	0.68977	-0.052000	0.11865	-0.776000	0.04578	0.609000	0.83330	GAA	SULT1C4	-	pfam_Sulfotransferase_dom		0.468	SULT1C4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SULT1C4	HGNC	protein_coding	OTTHUMT00000253561.1	G	NM_006588		108999913	+1	no_errors	ENST00000272452	ensembl	human	known	70_37	missense	SNP	0.813	C
TAS1R2	80834	genome.wustl.edu	37	1	19180891	19180891	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:19180891G>T	ENST00000375371.3	-	3	1094	c.1073C>A	c.(1072-1074)aCc>aAc	p.T358N	RP13-279N23.2_ENST00000494072.3_3'UTR	NM_152232.2	NP_689418.2	Q8TE23	TS1R2_HUMAN	taste receptor, type 1, member 2	358					detection of chemical stimulus involved in sensory perception of sweet taste (GO:0001582)|G-protein coupled receptor signaling pathway (GO:0007186)|positive regulation of cytokinesis (GO:0032467)|sensory perception of sweet taste (GO:0050916)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	protein heterodimerization activity (GO:0046982)|taste receptor activity (GO:0008527)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(4)|large_intestine(10)|lung(14)|ovary(1)|pancreas(3)|prostate(1)|skin(3)|stomach(1)	45		Colorectal(325;3.46e-05)|all_lung(284;0.000321)|Lung NSC(340;0.000398)|Renal(390;0.000518)|Breast(348;0.000812)|Ovarian(437;0.00764)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00466)|BRCA - Breast invasive adenocarcinoma(304;3.56e-05)|Kidney(64;0.000177)|KIRC - Kidney renal clear cell carcinoma(64;0.00262)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Aspartame(DB00168)	CTGGTTGCAGGTATAGCTCTG	0.622																																																	0													111.0	100.0	104.0					1																	19180891		2203	4300	6503	SO:0001583	missense	80834				CCDS187.1	1p36.13	2012-08-22	2003-03-07		ENSG00000179002	ENSG00000179002		"""Taste receptors / Type 1"", ""GPCR / Unclassified : Taste receptors"""	14905	protein-coding gene	gene with protein product		606226	"""G protein-coupled receptor 71"""	GPR71			Standard	NM_152232		Approved	T1R2, TR2	uc001bba.1	Q8TE23	OTTHUMG00000002442	ENST00000375371.3:c.1073C>A	1.37:g.19180891G>T	ENSP00000364520:p.Thr358Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TZ19	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3	p.T358N	ENST00000375371.3	37	c.1073	CCDS187.1	1	.	.	.	.	.	.	.	.	.	.	G	9.033	0.987858	0.18966	.	.	ENSG00000179002	ENST00000375371	D	0.86097	-2.07	4.67	3.75	0.43078	Extracellular ligand-binding receptor (1);	0.177250	0.26847	N	0.022198	T	0.80138	0.4568	L	0.53249	1.67	0.33525	D	0.59287	B	0.24258	0.1	B	0.28916	0.096	T	0.76724	-0.2854	10	0.16420	T	0.52	.	10.0195	0.42035	0.0:0.0:0.7986:0.2014	.	358	Q8TE23	TS1R2_HUMAN	N	358	ENSP00000364520:T358N	ENSP00000364520:T358N	T	-	2	0	TAS1R2	19053478	0.985000	0.35326	0.978000	0.43139	0.187000	0.23431	0.683000	0.25349	1.181000	0.42912	0.462000	0.41574	ACC	TAS1R2	-	pfam_ANF_lig-bd_rcpt		0.622	TAS1R2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	TAS1R2	HGNC	protein_coding	OTTHUMT00000006953.1	G			19180891	-1	no_errors	ENST00000375371	ensembl	human	novel	70_37	missense	SNP	0.995	T
TARBP1	6894	genome.wustl.edu	37	1	234536926	234536926	+	Splice_Site	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:234536926C>A	ENST00000040877.1	-	25	4071		c.e25+1		TARBP1_ENST00000483404.1_Splice_Site	NM_005646.3	NP_005637.3	Q13395	TARB1_HUMAN	TAR (HIV-1) RNA binding protein 1						regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA processing (GO:0006396)	nucleus (GO:0005634)	RNA binding (GO:0003723)|RNA methyltransferase activity (GO:0008173)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|kidney(7)|large_intestine(6)|lung(22)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(4)	55	Ovarian(103;0.0339)	all_cancers(173;0.00995)|Prostate(94;0.0115)|all_epithelial(177;0.172)	OV - Ovarian serous cystadenocarcinoma(106;0.000263)			TCTCTACTCACCTCTAGACAA	0.343																																																	0													91.0	85.0	87.0					1																	234536926		2203	4300	6503	SO:0001630	splice_region_variant	6894				CCDS1601.1	1q42.2	2012-06-12	2007-06-26		ENSG00000059588	ENSG00000059588			11568	protein-coding gene	gene with protein product	"""tRNA methyltransferase 3 homolog (S. cerevisiae)"""	605052	"""Tar (HIV-1) RNA binding protein 1"""			1936997	Standard	NM_005646		Approved	TRP-185, TRM3	uc001hwd.3	Q13395	OTTHUMG00000037947	ENST00000040877.1:c.4071+1G>T	1.37:g.234536926C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H581	Splice_Site	SNP	-	e25+1	ENST00000040877.1	37	c.4071+1	CCDS1601.1	1	.	.	.	.	.	.	.	.	.	.	C	21.7	4.185852	0.78789	.	.	ENSG00000059588	ENST00000040877	.	.	.	5.99	5.99	0.97316	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.4488	0.99124	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	TARBP1	232603549	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	6.975000	0.76128	2.843000	0.97960	0.655000	0.94253	.	TARBP1	-	-		0.343	TARBP1-001	NOVEL	basic|appris_principal|CCDS	protein_coding	TARBP1	HGNC	protein_coding	OTTHUMT00000092616.1	C	NM_005646	Intron	234536926	-1	no_errors	ENST00000040877	ensembl	human	known	70_37	splice_site	SNP	1.000	A
TBC1D20	128637	genome.wustl.edu	37	20	418073	418073	+	3'UTR	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr20:418073G>T	ENST00000354200.4	-	0	2516				TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20						acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				AACAAACCTGGCTTTGCTTAC	0.433																																																	0																																										SO:0001624	3_prime_UTR_variant	128637			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.*1157C>A	20.37:g.418073G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	RNA	SNP	-	NULL	ENST00000354200.4	37	NULL	CCDS13002.1	20																																																																																			TBC1D20	-	-		0.433	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2	G	NM_144628		418073	-1	no_errors	ENST00000461188	ensembl	human	known	70_37	rna	SNP	0.129	T
TBC1D24	57465	genome.wustl.edu	37	16	2547037	2547037	+	Silent	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:2547037C>A	ENST00000293970.5	+	2	1021	c.888C>A	c.(886-888)tcC>tcA	p.S296S	TBC1D24_ENST00000434757.2_Silent_p.S296S|TBC1D24_ENST00000567020.1_Silent_p.S296S|RP11-20I23.1_ENST00000564543.1_Silent_p.S296S	NM_001199107.1	NP_001186036.1	Q9ULP9	TBC24_HUMAN	TBC1 domain family, member 24	296					neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|terminal bouton (GO:0043195)	Rab GTPase activator activity (GO:0005097)			endometrium(2)|kidney(4)|large_intestine(3)|lung(4)	13						GCCTCTTCTCCCGCAAGGAGA	0.592																																																	0													44.0	51.0	48.0					16																	2547037		2133	4251	6384	SO:0001819	synonymous_variant	57465			AB032997	CCDS42107.1, CCDS55980.1	16p13.3	2014-05-07				ENSG00000162065			29203	protein-coding gene	gene with protein product	"""TBC/LysM-associated domain containing 6"""	613577	"""deafness, autosomal recessive 86"""	DFNB86		10574461, 24387994, 24729539	Standard	NM_001199107		Approved	KIAA1171, TLDC6, DFNA65	uc002cql.3	Q9ULP9		ENST00000293970.5:c.888C>A	16.37:g.2547037C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0JNW3|B9A6M6|Q2KJ08	Silent	SNP	pfam_TLDc,pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,smart_TLDc	p.S296	ENST00000293970.5	37	c.888	CCDS55980.1	16																																																																																			TBC1D24	-	superfamily_Rab-GTPase-TBC_dom		0.592	TBC1D24-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TBC1D24	HGNC	protein_coding	OTTHUMT00000435637.1	C	NM_020705		2547037	+1	no_errors	ENST00000293970	ensembl	human	known	70_37	silent	SNP	0.997	A
TBCB	1155	genome.wustl.edu	37	19	36606994	36606994	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:36606994C>G	ENST00000221855.3	+	2	741	c.166C>G	c.(166-168)Ctg>Gtg	p.L56V	POLR2I_ENST00000221859.4_5'Flank|TBCB_ENST00000585746.1_Missense_Mutation_p.L5V|TBCB_ENST00000392178.4_3'UTR|TBCB_ENST00000586868.1_Missense_Mutation_p.L5V|TBCB_ENST00000589996.1_Missense_Mutation_p.L56V	NM_001281.2	NP_001272.2	Q99426	TBCB_HUMAN	tubulin folding cofactor B	56					'de novo' posttranslational protein folding (GO:0051084)|cell differentiation (GO:0030154)|cellular protein metabolic process (GO:0044267)|nervous system development (GO:0007399)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)				large_intestine(2)|lung(1)|skin(1)|upper_aerodigestive_tract(1)	5	Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.06)			GGAACTGGAGCTGTATGGAGT	0.597																																																	0													91.0	67.0	75.0					19																	36606994		2203	4300	6503	SO:0001583	missense	1155			AF013488	CCDS12488.1, CCDS74344.1	19q13.11-q13.12	2008-02-05	2006-11-22	2006-11-22	ENSG00000105254	ENSG00000105254			1989	protein-coding gene	gene with protein product		601303	"""cytoskeleton-associated protein 1"", ""cytoskeleton associated protein 1"""	CKAP1		8978778	Standard	NM_001281		Approved	CG22, CKAPI	uc002odg.1	Q99426	OTTHUMG00000048143	ENST00000221855.3:c.166C>G	19.37:g.36606994C>G	ENSP00000221855:p.Leu56Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O00111|O00674|O14728|Q6FGY5	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.L56V	ENST00000221855.3	37	c.166	CCDS12488.1	19	.	.	.	.	.	.	.	.	.	.	C	8.033	0.762098	0.15914	.	.	ENSG00000105254	ENST00000221855;ENST00000392178	D	0.93366	-3.21	5.43	4.4	0.53042	.	0.099075	0.51477	D	0.000084	D	0.91553	0.7332	M	0.74467	2.265	0.54753	D	0.999986	B;B	0.33857	0.429;0.391	B;B	0.31442	0.052;0.13	D	0.89519	0.3777	10	0.35671	T	0.21	-21.1121	12.2276	0.54470	0.0:0.9164:0.0:0.0836	.	5;56	Q6FGY5;Q99426	.;TBCB_HUMAN	V	56	ENSP00000221855:L56V	ENSP00000221855:L56V	L	+	1	2	TBCB	41298834	1.000000	0.71417	1.000000	0.80357	0.232000	0.25224	1.464000	0.35288	1.300000	0.44818	-0.657000	0.03884	CTG	TBCB	-	NULL		0.597	TBCB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCB	HGNC	protein_coding	OTTHUMT00000156291.2	C	NM_001281		36606994	+1	no_errors	ENST00000221855	ensembl	human	known	70_37	missense	SNP	1.000	G
TCN1	6947	genome.wustl.edu	37	11	59620777	59620777	+	Missense_Mutation	SNP	C	C	T	rs371448135		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:59620777C>T	ENST00000257264.3	-	8	1243	c.1139G>A	c.(1138-1140)cGc>cAc	p.R380H	TCN1_ENST00000532419.1_5'Flank	NM_001062.3	NP_001053.2	P20061	TCO1_HUMAN	transcobalamin I (vitamin B12 binding protein, R binder family)	380	Globular C-terminal beta domain.				cobalamin metabolic process (GO:0009235)|cobalamin transport (GO:0015889)|cobalt ion transport (GO:0006824)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	cobalamin binding (GO:0031419)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(15)|ovary(2)|prostate(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29		all_epithelial(135;0.198)			Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)	CCCCCATGAGCGCTCCTCCAT	0.458																																																	0								C	HIS/ARG	1,4401	2.1+/-5.4	0,1,2200	102.0	103.0	102.0		1139	0.6	0.0	11		102	0,8590		0,0,4295	no	missense	TCN1	NM_001062.3	29	0,1,6495	TT,TC,CC		0.0,0.0227,0.0077	benign	380/434	59620777	1,12991	2201	4295	6496	SO:0001583	missense	6947			J05068	CCDS7978.1	11q11-q12	2008-07-21			ENSG00000134827	ENSG00000134827			11652	protein-coding gene	gene with protein product	"""haptocorin"", ""haptocorrin"""	189905					Standard	NM_001062		Approved	TCI, TC1	uc001noj.2	P20061	OTTHUMG00000167400	ENST00000257264.3:c.1139G>A	11.37:g.59620777C>T	ENSP00000257264:p.Arg380His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAC5|Q8WV77	Missense_Mutation	SNP	pfam_Cbl-bd_transpt_euk	p.R380H	ENST00000257264.3	37	c.1139	CCDS7978.1	11	.	.	.	.	.	.	.	.	.	.	C	11.69	1.712534	0.30322	2.27E-4	0.0	ENSG00000134827	ENST00000257264	T	0.29655	1.56	4.75	0.563	0.17296	.	0.918437	0.09038	N	0.857726	T	0.15349	0.0370	N	0.14661	0.345	0.09310	N	1	B	0.28055	0.199	B	0.22386	0.039	T	0.26292	-1.0107	10	0.30854	T	0.27	-18.5463	5.4242	0.16417	0.0:0.5068:0.3095:0.1837	.	380	P20061	TCO1_HUMAN	H	380	ENSP00000257264:R380H	ENSP00000257264:R380H	R	-	2	0	TCN1	59377353	0.000000	0.05858	0.000000	0.03702	0.063000	0.16089	-1.141000	0.03207	0.086000	0.17137	0.650000	0.86243	CGC	TCN1	-	NULL		0.458	TCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCN1	HGNC	protein_coding	OTTHUMT00000394503.1	C	NM_001062		59620777	-1	no_errors	ENST00000257264	ensembl	human	known	70_37	missense	SNP	0.000	T
TERT	7015	genome.wustl.edu	37	5	1280343	1280343	+	Missense_Mutation	SNP	G	G	T	rs146439826		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr5:1280343G>T	ENST00000310581.5	-	4	1937	c.1880C>A	c.(1879-1881)cCt>cAt	p.P627H	TERT_ENST00000296820.5_Missense_Mutation_p.P627H|TERT_ENST00000334602.6_Missense_Mutation_p.P627H|TERT_ENST00000508104.2_Missense_Mutation_p.P627H	NM_001193376.1|NM_198253.2	NP_001180305.1|NP_937983.2	O14746	TERT_HUMAN	telomerase reverse transcriptase	627	Reverse transcriptase. {ECO:0000255|PROSITE-ProRule:PRU00405}.				DNA strand elongation (GO:0022616)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|replicative senescence (GO:0090399)|telomere formation via telomerase (GO:0032203)|telomere maintenance (GO:0000723)|telomere maintenance via telomerase (GO:0007004)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear telomere cap complex (GO:0000783)|nucleoplasm (GO:0005654)|telomerase holoenzyme complex (GO:0005697)	metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|telomerase activity (GO:0003720)|telomeric DNA binding (GO:0042162)|telomeric RNA binding (GO:0070034)|telomeric template RNA reverse transcriptase activity (GO:0003721)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|kidney(4)|large_intestine(3)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	41	all_cancers(3;3.17e-16)|Lung NSC(6;8.55e-15)|all_lung(6;7.2e-14)|all_epithelial(6;1.87e-10)		Epithelial(17;0.00105)|all cancers(22;0.00178)|OV - Ovarian serous cystadenocarcinoma(19;0.00239)|Lung(60;0.185)		Zidovudine(DB00495)	CAGCCCGTCAGGCTTGGGGAT	0.597									TERT Mutation-Associated Haematological Disorders;Pulmonary Fibrosis, Idiopathic;Congenital Dyskeratosis																																								0													98.0	94.0	96.0					5																	1280343		2203	4300	6503	SO:0001583	missense	7015	Familial Cancer Database	;Hamman-Rich syndrome, Fibrocystic Pulmonary Dysplasia;Zinsser-Engman-Cole syndrome, Dyskeratosis Congenita	AF015950	CCDS3861.2, CCDS54831.1	5p15.33	2014-09-17			ENSG00000164362	ENSG00000164362			11730	protein-coding gene	gene with protein product		187270				9252327	Standard	NM_198253		Approved	TRT, TP2, TCS1, hEST2, EST2	uc003jcb.1	O14746	OTTHUMG00000090357	ENST00000310581.5:c.1880C>A	5.37:g.1280343G>T	ENSP00000309572:p.Pro627His	Somatic		WXS	Illumina HiSeq	Phase_IV	O14783|Q2XS35|Q8N6C3|Q8NG38|Q8NG46	Missense_Mutation	SNP	pfam_Telomerase_RBD,pfam_RVT,smart_Telomerase_RBD,pfscan_RVT,prints_Telomerase_RT	p.P627H	ENST00000310581.5	37	c.1880	CCDS3861.2	5	.	.	.	.	.	.	.	.	.	.	G	10.39	1.337603	0.24253	.	.	ENSG00000164362	ENST00000310581;ENST00000296820;ENST00000334602;ENST00000508104	D;D;D;D	0.96716	-4.1;-4.04;-4.0;-4.04	4.48	0.402	0.16344	Reverse transcriptase (1);	0.358987	0.30177	N	0.010239	D	0.95671	0.8592	M	0.65975	2.015	0.09310	N	0.999999	D;D;D	0.69078	0.99;0.997;0.983	P;P;B	0.56865	0.634;0.808;0.431	D	0.89839	0.4001	10	0.44086	T	0.13	-0.1107	5.0078	0.14297	0.27:0.1518:0.5782:0.0	.	627;627;627	O14746-3;O14746;Q8NG38	.;TERT_HUMAN;.	H	627	ENSP00000309572:P627H;ENSP00000296820:P627H;ENSP00000334346:P627H;ENSP00000426042:P627H	ENSP00000296820:P627H	P	-	2	0	TERT	1333343	0.340000	0.24792	0.043000	0.18650	0.110000	0.19582	0.627000	0.24506	-0.268000	0.09312	0.407000	0.27541	CCT	TERT	-	pfscan_RVT		0.597	TERT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TERT	HGNC	protein_coding	OTTHUMT00000206729.2	G			1280343	-1	no_errors	ENST00000310581	ensembl	human	known	70_37	missense	SNP	0.090	T
TEX11	56159	genome.wustl.edu	37	X	69772050	69772050	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chrX:69772050A>G	ENST00000395889.2	-	29	2646	c.2491T>C	c.(2491-2493)Tcg>Ccg	p.S831P	TEX11_ENST00000344304.3_Missense_Mutation_p.S831P|TEX11_ENST00000374320.2_Missense_Mutation_p.S506P|TEX11_ENST00000374333.2_Missense_Mutation_p.S816P	NM_001003811.1	NP_001003811.1	Q8IYF3	TEX11_HUMAN	testis expressed 11	831					chiasma assembly (GO:0051026)|fertilization (GO:0009566)|male gonad development (GO:0008584)|male meiosis chromosome segregation (GO:0007060)|meiotic gene conversion (GO:0006311)|negative regulation of apoptotic process (GO:0043066)|reciprocal meiotic recombination (GO:0007131)|resolution of meiotic recombination intermediates (GO:0000712)|synaptonemal complex assembly (GO:0007130)	central element (GO:0000801)				breast(4)|central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(12)|lung(13)|ovary(3)|prostate(3)|skin(3)	48	Renal(35;0.156)					TCTACATTCGACGCCCCATCT	0.418																																																	0													79.0	69.0	72.0					X																	69772050		2203	4300	6503	SO:0001583	missense	56159			AF285594	CCDS35323.1, CCDS43968.1	Xp11	2008-02-05	2007-03-13		ENSG00000120498	ENSG00000120498			11733	protein-coding gene	gene with protein product		300311	"""testis expressed sequence 11"""			11279525	Standard	NM_001003811		Approved	TSGA3, TGC1	uc004dyl.3	Q8IYF3	OTTHUMG00000021782	ENST00000395889.2:c.2491T>C	X.37:g.69772050A>G	ENSP00000379226:p.Ser831Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8V6|Q5JQQ8|Q96LZ4|Q96M47|Q9BXU6	Missense_Mutation	SNP	pfam_Meiosis_specific_SPO22,smart_TPR_repeat	p.S831P	ENST00000395889.2	37	c.2491	CCDS35323.1	X	.	.	.	.	.	.	.	.	.	.	A	2.611	-0.290830	0.05568	.	.	ENSG00000120498	ENST00000374333;ENST00000395889;ENST00000374320;ENST00000344304	T;T;T;T	0.50001	1.36;1.36;0.76;1.36	4.96	-0.0675	0.13760	.	0.638172	0.14696	N	0.303874	T	0.19846	0.0477	N	0.05383	-0.06	0.09310	N	1	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.001	T	0.15321	-1.0441	9	.	.	.	0.6286	3.2215	0.06717	0.2643:0.0:0.2366:0.4991	.	816;831	Q8IYF3-3;Q8IYF3	.;TEX11_HUMAN	P	816;831;506;831	ENSP00000363453:S816P;ENSP00000379226:S831P;ENSP00000363440:S506P;ENSP00000340995:S831P	.	S	-	1	0	TEX11	69688775	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	0.812000	0.27211	-0.017000	0.14103	0.486000	0.48141	TCG	TEX11	-	NULL		0.418	TEX11-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TEX11	HGNC	protein_coding	OTTHUMT00000359072.1	A			69772050	-1	no_errors	ENST00000344304	ensembl	human	known	70_37	missense	SNP	0.000	G
TEX15	56154	genome.wustl.edu	37	8	30717450	30717450	+	5'UTR	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr8:30717450C>A	ENST00000523186.1	-	0	743							Q9BXT5	TEX15_HUMAN	testis expressed 15						fertilization (GO:0009566)|homeostasis of number of cells within a tissue (GO:0048873)|male genitalia development (GO:0030539)|male meiosis (GO:0007140)|protein localization to chromosome (GO:0034502)|regulation of double-strand break repair via homologous recombination (GO:0010569)|regulation of protein localization (GO:0032880)|spermatogenesis (GO:0007283)|synaptonemal complex assembly (GO:0007130)					NS(2)|breast(3)|cervix(5)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(38)|lung(56)|ovary(5)|pancreas(1)|prostate(2)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	138				KIRC - Kidney renal clear cell carcinoma(542;0.0918)|Kidney(114;0.111)		GCTTGCAGTTCAATGGTATCT	0.328																																																	0																																										SO:0001623	5_prime_UTR_variant	56154			AF285605	CCDS6080.1	8p22	2009-03-25	2007-03-13			ENSG00000133863			11738	protein-coding gene	gene with protein product	"""cancer/testis antigen 42"""	605795	"""testis expressed sequence 15"""			11279525	Standard	NM_031271		Approved	CT42	uc003xil.3	Q9BXT5		ENST00000523186.1:c.-777G>T	8.37:g.30717450C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000523186.1	37	NULL		8																																																																																			TEX15	-	-		0.328	TEX15-002	KNOWN	basic	processed_transcript	TEX15	HGNC	protein_coding	OTTHUMT00000376194.2	C			30717450	-1	no_errors	ENST00000523186	ensembl	human	known	70_37	rna	SNP	0.517	A
TGFBR2	7048	genome.wustl.edu	37	3	30691762	30691762	+	Splice_Site	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:30691762G>A	ENST00000295754.5	+	3	646	c.264G>A	c.(262-264)tgG>tgA	p.W88*	TGFBR2_ENST00000359013.4_Splice_Site_p.W113*	NM_003242.5	NP_003233.4	P37173	TGFR2_HUMAN	transforming growth factor, beta receptor II (70/80kDa)	88					activation of protein kinase activity (GO:0032147)|aging (GO:0007568)|apoptotic process (GO:0006915)|blood vessel development (GO:0001568)|brain development (GO:0007420)|bronchus morphogenesis (GO:0060434)|cartilage development (GO:0051216)|common-partner SMAD protein phosphorylation (GO:0007182)|digestive tract development (GO:0048565)|embryo implantation (GO:0007566)|embryonic cranial skeleton morphogenesis (GO:0048701)|embryonic hemopoiesis (GO:0035162)|gastrulation (GO:0007369)|heart development (GO:0007507)|in utero embryonic development (GO:0001701)|lens development in camera-type eye (GO:0002088)|lens fiber cell apoptotic process (GO:1990086)|lung lobe morphogenesis (GO:0060463)|mammary gland morphogenesis (GO:0060443)|myeloid dendritic cell differentiation (GO:0043011)|negative regulation of cardiac muscle cell proliferation (GO:0060044)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|organ regeneration (GO:0031100)|palate development (GO:0060021)|pathway-restricted SMAD protein phosphorylation (GO:0060389)|patterning of blood vessels (GO:0001569)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of angiogenesis (GO:0045766)|positive regulation of B cell tolerance induction (GO:0002663)|positive regulation of cell proliferation (GO:0008284)|positive regulation of epithelial cell migration (GO:0010634)|positive regulation of mesenchymal cell proliferation (GO:0002053)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of skeletal muscle tissue regeneration (GO:0043415)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of T cell tolerance induction (GO:0002666)|positive regulation of tolerance induction to self antigen (GO:0002651)|protein phosphorylation (GO:0006468)|receptor-mediated endocytosis (GO:0006898)|regulation of cell proliferation (GO:0042127)|response to cholesterol (GO:0070723)|response to drug (GO:0042493)|response to estrogen (GO:0043627)|response to glucose (GO:0009749)|response to mechanical stimulus (GO:0009612)|response to nutrient (GO:0007584)|smoothened signaling pathway (GO:0007224)|trachea formation (GO:0060440)|transforming growth factor beta receptor signaling pathway (GO:0007179)|vasculogenesis (GO:0001570)|wound healing (GO:0042060)	caveola (GO:0005901)|cytosol (GO:0005829)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|transforming growth factor beta receptor homodimeric complex (GO:0070022)	ATP binding (GO:0005524)|glycosaminoglycan binding (GO:0005539)|metal ion binding (GO:0046872)|receptor signaling protein serine/threonine kinase activity (GO:0004702)|SMAD binding (GO:0046332)|transforming growth factor beta binding (GO:0050431)|transforming growth factor beta receptor activity, type II (GO:0005026)|transforming growth factor beta-activated receptor activity (GO:0005024)|transmembrane receptor protein serine/threonine kinase activity (GO:0004675)|type I transforming growth factor beta receptor binding (GO:0034713)|type III transforming growth factor beta receptor binding (GO:0034714)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(15)|lung(10)|ovary(3)|pancreas(12)|skin(1)|stomach(5)|upper_aerodigestive_tract(2)	53						TTCACTCTAGGAGAAAGAATG	0.443																																																	0													92.0	89.0	90.0					3																	30691762		2203	4300	6503	SO:0001630	splice_region_variant	7048				CCDS2648.1, CCDS33727.1	3p22	2014-09-17	2002-08-29		ENSG00000163513	ENSG00000163513			11773	protein-coding gene	gene with protein product		190182	"""transforming growth factor, beta receptor II (70-80kD)"""	MFS2		1319842, 15235604	Standard	NM_001024847		Approved		uc003cen.3	P37173	OTTHUMG00000130569	ENST00000295754.5:c.264-1G>A	3.37:g.30691762G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DTV5|Q15580|Q6DKT6|Q99474	Nonsense_Mutation	SNP	pfam_Transforming_GF_b_rcpt_2_ecto,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Transform_growth_fac-b_typ-2,prints_Activin_II/TGFBeta-II_recpt,pfscan_Prot_kinase_cat_dom	p.W113*	ENST00000295754.5	37	c.339	CCDS2648.1	3	.	.	.	.	.	.	.	.	.	.	G	40	8.290493	0.98745	.	.	ENSG00000163513	ENST00000295754;ENST00000359013	.	.	.	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.1054	0.97890	0.0:0.0:1.0:0.0	.	.	.	.	X	88;113	.	.	W	+	3	0	TGFBR2	30666766	1.000000	0.71417	1.000000	0.80357	0.832000	0.47134	7.895000	0.87343	2.757000	0.94681	0.655000	0.94253	TGG	TGFBR2	-	pfam_Transforming_GF_b_rcpt_2_ecto,pirsf_Transform_growth_fac-b_typ-2		0.443	TGFBR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGFBR2	HGNC	protein_coding	OTTHUMT00000252994.2	G		Nonsense_Mutation	30691762	+1	no_errors	ENST00000359013	ensembl	human	known	70_37	nonsense	SNP	1.000	A
THOP1	7064	genome.wustl.edu	37	19	2805036	2805036	+	Silent	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:2805036G>C	ENST00000307741.6	+	6	815	c.612G>C	c.(610-612)ctG>ctC	p.L204L	THOP1_ENST00000586677.1_Silent_p.L83L	NM_003249.3	NP_003240.1	P52888	THOP1_HUMAN	thimet oligopeptidase 1	204					intracellular signal transduction (GO:0035556)|peptide metabolic process (GO:0006518)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)|peptide binding (GO:0042277)			NS(1)|central_nervous_system(1)|endometrium(1)|lung(8)|ovary(2)|skin(1)	14				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGACTTTCTGAACTCCCTGG	0.587																																																	0													61.0	48.0	53.0					19																	2805036		2200	4296	6496	SO:0001819	synonymous_variant	7064				CCDS12095.1	19p13.3	2008-02-05				ENSG00000172009	3.4.24.15		11793	protein-coding gene	gene with protein product		601117				9790774	Standard	NM_003249		Approved		uc002lwj.3	P52888		ENST00000307741.6:c.612G>C	19.37:g.2805036G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSE2|Q9UCB3	Silent	SNP	pfam_Pept_M3A_M3B	p.L204	ENST00000307741.6	37	c.612	CCDS12095.1	19																																																																																			THOP1	-	NULL		0.587	THOP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THOP1	HGNC	protein_coding	OTTHUMT00000451587.2	G			2805036	+1	no_errors	ENST00000307741	ensembl	human	known	70_37	silent	SNP	0.998	C
TM4SF19	116211	genome.wustl.edu	37	3	196050851	196050851	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:196050851C>T	ENST00000273695.3	-	5	592	c.467G>A	c.(466-468)cGt>cAt	p.R156H	TM4SF19_ENST00000442633.1_Missense_Mutation_p.R156H|TM4SF19_ENST00000446879.1_Missense_Mutation_p.V155I|TM4SF19_ENST00000454715.1_Missense_Mutation_p.R130H|TM4SF19-AS1_ENST00000444939.1_RNA|TM4SF19-AS1_ENST00000452051.1_RNA|TM4SF19-AS1_ENST00000420226.1_RNA	NM_001204897.1|NM_138461.3	NP_001191826.1|NP_612470.2	Q96DZ7	T4S19_HUMAN	transmembrane 4 L six family member 19	156						integral component of membrane (GO:0016021)				endometrium(2)|kidney(2)|large_intestine(3)|lung(5)	12	all_cancers(143;1.19e-08)|Ovarian(172;0.0634)|Breast(254;0.206)		Epithelial(36;3.94e-24)|all cancers(36;4.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;8.53e-19)|LUSC - Lung squamous cell carcinoma(58;1.51e-06)|Lung(62;1.95e-06)	GBM - Glioblastoma multiforme(46;0.00314)		CCAGAGCGAACGGTCATACAG	0.537																																																	0													68.0	64.0	65.0					3																	196050851		2203	4300	6503	SO:0001583	missense	116211			BC013113	CCDS3316.1, CCDS56299.1	3q29	2005-08-09			ENSG00000145107	ENSG00000145107			25167	protein-coding gene	gene with protein product						12477932	Standard	NM_138461		Approved		uc021xjs.1	Q96DZ7	OTTHUMG00000155675	ENST00000273695.3:c.467G>A	3.37:g.196050851C>T	ENSP00000273695:p.Arg156His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RV20|E9PH22|Q336K7	Missense_Mutation	SNP	pfam_L6_membrane	p.R156H	ENST00000273695.3	37	c.467	CCDS3316.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	1.899|1.899	-0.453465|-0.453465	0.04540|0.04540	.|.	.|.	ENSG00000145107|ENSG00000145107	ENST00000454715;ENST00000273695|ENST00000446879	T;T|T	0.31247|0.24350	1.5;1.5|1.86	5.13|5.13	-8.16|-8.16	0.01061|0.01061	.|.	0.861805|.	0.10026|.	N|.	0.725424|.	T|T	0.13415|0.13415	0.0325|0.0325	N|N	0.10874|0.10874	0.06|0.06	0.21256|0.21256	N|N	0.999745|0.999745	B;B|B	0.14012|0.25390	0.004;0.009|0.125	B;B|B	0.10450|0.11329	0.004;0.005|0.006	T|T	0.18304|0.18304	-1.0341|-1.0341	10|9	0.32370|0.66056	T|D	0.25|0.02	-11.171|-11.171	17.5894|17.5894	0.87991|0.87991	0.0:0.7759:0.0:0.2241|0.0:0.7759:0.0:0.2241	.|.	130;156|155	E9PH22;Q96DZ7|C9JCD5	.;T4S19_HUMAN|.	H|I	130;156|155	ENSP00000387728:R130H;ENSP00000273695:R156H|ENSP00000395280:V155I	ENSP00000273695:R156H|ENSP00000395280:V155I	R|V	-|-	2|1	0|0	TM4SF19|TM4SF19	197535248|197535248	0.000000|0.000000	0.05858|0.05858	0.008000|0.008000	0.14137|0.14137	0.221000|0.221000	0.24807|0.24807	-5.556000|-5.556000	0.00113|0.00113	-1.588000|-1.588000	0.01627|0.01627	-0.471000|-0.471000	0.05019|0.05019	CGT|GTT	TM4SF19	-	pfam_L6_membrane		0.537	TM4SF19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TM4SF19	HGNC	protein_coding	OTTHUMT00000341174.1	C	NM_138461		196050851	-1	no_errors	ENST00000273695	ensembl	human	known	70_37	missense	SNP	0.005	T
TMED8	283578	genome.wustl.edu	37	14	77808308	77808308	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr14:77808308C>G	ENST00000216468.7	-	6	839	c.784G>C	c.(784-786)Gag>Cag	p.E262Q		NM_213601.1	NP_998766.1	Q6PL24	TMED8_HUMAN	transmembrane emp24 protein transport domain containing 8	262	GOLD. {ECO:0000255|PROSITE- ProRule:PRU00096}.				transport (GO:0006810)	integral component of membrane (GO:0016021)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(4)	15			Kidney(204;0.164)	BRCA - Breast invasive adenocarcinoma(234;0.0281)		GAGCCTCTCTCCACATCTCCA	0.607																																																	0													48.0	39.0	42.0					14																	77808308		2203	4300	6503	SO:0001583	missense	283578			AK095650	CCDS32125.1	14q24.3	2005-08-26	2005-08-26	2005-01-07		ENSG00000100580			18633	protein-coding gene	gene with protein product			"""family with sequence similarity 15, member B"", ""transmembrane emp24 domain containing 8"""	FAM15B			Standard	NM_213601		Approved		uc001xto.1	Q6PL24		ENST00000216468.7:c.784G>C	14.37:g.77808308C>G	ENSP00000216468:p.Glu262Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KTI6|Q3MJB0|Q9P1V9	Missense_Mutation	SNP	superfamily_GOLD,pfscan_GOLD	p.E262Q	ENST00000216468.7	37	c.784	CCDS32125.1	14	.	.	.	.	.	.	.	.	.	.	C	29.7	5.030832	0.93575	.	.	ENSG00000100580	ENST00000216468	T	0.29142	1.58	6.08	6.08	0.98989	GOLD (2);	0.000000	0.85682	D	0.000000	T	0.58452	0.2123	M	0.70595	2.14	0.80722	D	1	D	0.89917	1.0	D	0.79784	0.993	T	0.55927	-0.8063	10	0.62326	D	0.03	-31.9021	20.2598	0.98436	0.0:1.0:0.0:0.0	.	262	Q6PL24	TMED8_HUMAN	Q	262	ENSP00000216468:E262Q	ENSP00000216468:E262Q	E	-	1	0	TMED8	76878061	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.785000	0.68998	2.890000	0.99128	0.655000	0.94253	GAG	TMED8	-	superfamily_GOLD,pfscan_GOLD		0.607	TMED8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMED8	HGNC	protein_coding	OTTHUMT00000414100.1	C	NM_213601		77808308	-1	no_errors	ENST00000216468	ensembl	human	known	70_37	missense	SNP	1.000	G
TMEM117	84216	genome.wustl.edu	37	12	44782997	44782997	+	3'UTR	SNP	T	T	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:44782997T>A	ENST00000266534.3	+	0	2214				TMEM117_ENST00000546978.1_3'UTR|TMEM117_ENST00000551577.1_3'UTR	NM_032256.1	NP_115632.1	Q9H0C3	TM117_HUMAN	transmembrane protein 117							endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(14)|urinary_tract(1)	23	Lung SC(27;0.192)			GBM - Glioblastoma multiforme(48;0.124)		CACCTTTTAATTTTTATTGGC	0.388																																																	0																																										SO:0001624	3_prime_UTR_variant	84216			BC060798	CCDS8745.1, CCDS73462.1	12q12	2006-02-03				ENSG00000139173			25308	protein-coding gene	gene with protein product						11230166	Standard	NM_001286211		Approved	DKFZp434K2435	uc001rod.3	Q9H0C3	OTTHUMG00000169427	ENST00000266534.3:c.*542T>A	12.37:g.44782997T>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000266534.3	37	NULL	CCDS8745.1	12																																																																																			TMEM117	-	-		0.388	TMEM117-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM117	HGNC	protein_coding	OTTHUMT00000403969.1	T	NM_032256		44782997	+1	no_errors	ENST00000546978	ensembl	human	known	70_37	rna	SNP	0.974	A
TMEM39B	55116	genome.wustl.edu	37	1	32541383	32541383	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:32541383G>T	ENST00000336294.5	+	3	457	c.311G>T	c.(310-312)tGg>tTg	p.W104L	TMEM39B_ENST00000373634.4_5'UTR|RP11-277A4.4_ENST00000366152.3_RNA|TMEM39B_ENST00000456834.2_Missense_Mutation_p.W104L|TMEM39B_ENST00000427288.1_5'UTR|TMEM39B_ENST00000487305.1_3'UTR	NM_018056.2	NP_060526.2	Q9GZU3	TM39B_HUMAN	transmembrane protein 39B	104						integral component of membrane (GO:0016021)				endometrium(2)|kidney(1)|lung(5)|ovary(1)|prostate(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)|Ovarian(437;0.101)|Breast(348;0.174)				AAGACAGTGTGGTGGTATCCA	0.537																																																	0													71.0	54.0	59.0					1																	32541383		692	1591	2283	SO:0001583	missense	55116			AL136695	CCDS351.2	1p35.1	2008-02-05			ENSG00000121775	ENSG00000121775			25510	protein-coding gene	gene with protein product						12477932	Standard	NM_018056		Approved	FLJ10315	uc010ogv.2	Q9GZU3	OTTHUMG00000004020	ENST00000336294.5:c.311G>T	1.37:g.32541383G>T	ENSP00000338165:p.Trp104Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKN8|B4DQE6|B4DTN8|D3DPP4|Q6IA44	Missense_Mutation	SNP	pfam_Uncharacterised_TMEM39	p.W104L	ENST00000336294.5	37	c.311	CCDS351.2	1	.	.	.	.	.	.	.	.	.	.	G	26.4	4.738367	0.89573	.	.	ENSG00000121775	ENST00000336294;ENST00000373633;ENST00000438825;ENST00000456834	.	.	.	5.05	5.05	0.67936	.	0.000000	0.85682	D	0.000000	D	0.83746	0.5321	M	0.82323	2.585	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.86313	0.1687	9	0.87932	D	0	-9.3944	18.7717	0.91894	0.0:0.0:1.0:0.0	.	104	Q9GZU3	TM39B_HUMAN	L	104	.	ENSP00000338165:W104L	W	+	2	0	TMEM39B	32313970	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.385000	0.97223	2.511000	0.84671	0.555000	0.69702	TGG	TMEM39B	-	pfam_Uncharacterised_TMEM39		0.537	TMEM39B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM39B	HGNC	protein_coding	OTTHUMT00000011489.2	G	NM_018056		32541383	+1	no_errors	ENST00000336294	ensembl	human	known	70_37	missense	SNP	1.000	T
TMTC4	84899	genome.wustl.edu	37	13	101264734	101264734	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:101264734C>T	ENST00000376234.3	-	16	2114	c.1925G>A	c.(1924-1926)aGa>aAa	p.R642K	TMTC4_ENST00000342624.5_Missense_Mutation_p.R661K|TMTC4_ENST00000328767.5_Missense_Mutation_p.R531K	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	642						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CAGTGCCTCTCTTCCAACTGC	0.418																																																	0													152.0	145.0	148.0					13																	101264734		2203	4300	6503	SO:0001583	missense	84899				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1925G>A	13.37:g.101264734C>T	ENSP00000365408:p.Arg642Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R661K	ENST00000376234.3	37	c.1982	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	C	11.74	1.727638	0.30593	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.54279	0.58;0.58;0.58	5.68	5.68	0.88126	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.086437	0.85682	D	0.000000	T	0.31231	0.0790	N	0.04508	-0.205	0.48571	D	0.999678	B;B;B	0.33379	0.02;0.019;0.41	B;B;B	0.30401	0.003;0.013;0.115	T	0.22138	-1.0225	10	0.10636	T	0.68	.	19.791	0.96456	0.0:1.0:0.0:0.0	.	531;642;661	B7Z666;Q5T4D3;Q5T4D3-3	.;TMTC4_HUMAN;.	K	642;661;531	ENSP00000365408:R642K;ENSP00000343871:R661K;ENSP00000365409:R531K	ENSP00000365409:R531K	R	-	2	0	TMTC4	100062735	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	3.599000	0.54045	2.677000	0.91161	0.491000	0.48974	AGA	TMTC4	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.418	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	C	NM_032813		101264734	-1	no_errors	ENST00000342624	ensembl	human	known	70_37	missense	SNP	1.000	T
TMTC4	84899	genome.wustl.edu	37	13	101264747	101264747	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:101264747C>T	ENST00000376234.3	-	16	2101	c.1912G>A	c.(1912-1914)Gaa>Aaa	p.E638K	TMTC4_ENST00000342624.5_Missense_Mutation_p.E657K|TMTC4_ENST00000328767.5_Missense_Mutation_p.E527K	NM_001079669.1	NP_001073137.1	Q5T4D3	TMTC4_HUMAN	transmembrane and tetratricopeptide repeat containing 4	638						integral component of membrane (GO:0016021)				breast(3)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|liver(1)|lung(14)|ovary(2)|prostate(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	34	all_neural(89;0.0837)|Medulloblastoma(90;0.18)|Lung SC(71;0.184)					CCAACTGCTTCAGCTTGGGCT	0.403																																																	0													128.0	125.0	126.0					13																	101264747		2203	4300	6503	SO:0001583	missense	84899				CCDS9497.2, CCDS41904.1, CCDS66575.1	13q32.3	2013-01-10	2006-01-06		ENSG00000125247	ENSG00000125247		"""Tetratricopeptide (TTC) repeat domain containing"""	25904	protein-coding gene	gene with protein product							Standard	XM_005254082		Approved	FLJ14624, FLJ22153	uc001vot.3	Q5T4D3	OTTHUMG00000017289	ENST00000376234.3:c.1912G>A	13.37:g.101264747C>T	ENSP00000365408:p.Glu638Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLI7|B7Z666|Q5T4D4|Q5T4D5|Q5T4D6|Q8WV63|Q96SU8	Missense_Mutation	SNP	pfam_TPR-1,pfam_DUF1736,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.E657K	ENST00000376234.3	37	c.1969	CCDS41904.1	13	.	.	.	.	.	.	.	.	.	.	C	22.4	4.286966	0.80803	.	.	ENSG00000125247	ENST00000376234;ENST00000342624;ENST00000328767	T;T;T	0.52295	0.67;0.67;0.67	5.68	5.68	0.88126	Tetratricopeptide-like helical (1);Tetratricopeptide repeat-containing (1);	0.000000	0.85682	D	0.000000	T	0.49541	0.1563	L	0.59436	1.845	0.80722	D	1	B;P;P	0.39044	0.404;0.656;0.656	B;B;B	0.39419	0.147;0.205;0.299	T	0.40961	-0.9535	10	0.27082	T	0.32	.	19.791	0.96456	0.0:1.0:0.0:0.0	.	527;638;657	B7Z666;Q5T4D3;Q5T4D3-3	.;TMTC4_HUMAN;.	K	638;657;527	ENSP00000365408:E638K;ENSP00000343871:E657K;ENSP00000365409:E527K	ENSP00000365409:E527K	E	-	1	0	TMTC4	100062748	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.431000	0.80335	2.677000	0.91161	0.491000	0.48974	GAA	TMTC4	-	smart_TPR_repeat,pfscan_TPR-contain_dom		0.403	TMTC4-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TMTC4	HGNC	protein_coding	OTTHUMT00000045649.2	C	NM_032813		101264747	-1	no_errors	ENST00000342624	ensembl	human	known	70_37	missense	SNP	1.000	T
TOPBP1	11073	genome.wustl.edu	37	3	133347439	133347439	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr3:133347439C>A	ENST00000260810.5	-	15	2790	c.2659G>T	c.(2659-2661)Gcc>Tcc	p.A887S		NM_007027.3	NP_008958.2	Q92547	TOPB1_HUMAN	topoisomerase (DNA) II binding protein 1	887					cellular response to DNA damage stimulus (GO:0006974)|DNA metabolic process (GO:0006259)|DNA repair (GO:0006281)|response to ionizing radiation (GO:0010212)	chromosome (GO:0005694)|condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|male germ cell nucleus (GO:0001673)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|protein C-terminus binding (GO:0008022)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(5)|lung(14)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(1)	40						TGAGGGCTGGCAGAAAGAGCG	0.408								Other conserved DNA damage response genes																													Ovarian(21;193 658 4424 15423 17362)												0													67.0	65.0	66.0					3																	133347439		1924	4147	6071	SO:0001583	missense	11073			AB019397	CCDS46919.1	3q22.1	2004-06-21			ENSG00000163781	ENSG00000163781			17008	protein-coding gene	gene with protein product		607760				9461304, 9039502	Standard	NM_007027		Approved	KIAA0259, TOP2BP1	uc003eps.3	Q92547	OTTHUMG00000159773	ENST00000260810.5:c.2659G>T	3.37:g.133347439C>A	ENSP00000260810:p.Ala887Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7W8|Q7LGC1|Q9UEB9	Missense_Mutation	SNP	pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_Secretoglobin,smart_BRCT_dom,pfscan_BRCT_dom	p.A887S	ENST00000260810.5	37	c.2659	CCDS46919.1	3	.	.	.	.	.	.	.	.	.	.	C	25.0	4.591701	0.86953	.	.	ENSG00000163781	ENST00000260810	T	0.13657	2.57	5.31	5.31	0.75309	.	0.261015	0.42053	D	0.000775	T	0.21022	0.0506	M	0.61703	1.905	0.58432	D	0.999999	P	0.46706	0.883	P	0.45232	0.474	T	0.03807	-1.1002	10	0.15066	T	0.55	.	19.3331	0.94299	0.0:1.0:0.0:0.0	.	887	Q92547	TOPB1_HUMAN	S	887	ENSP00000260810:A887S	ENSP00000260810:A887S	A	-	1	0	TOPBP1	134830129	1.000000	0.71417	1.000000	0.80357	0.845000	0.48019	6.917000	0.75782	2.628000	0.89032	0.650000	0.86243	GCC	TOPBP1	-	NULL		0.408	TOPBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOPBP1	HGNC	protein_coding	OTTHUMT00000357254.1	C	NM_007027		133347439	-1	no_errors	ENST00000260810	ensembl	human	known	70_37	missense	SNP	1.000	A
CACNA1H	8912	genome.wustl.edu	37	16	1272918	1272918	+	IGR	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr16:1272918C>A	ENST00000348261.5	+	0	8084				TPSG1_ENST00000234798.4_Splice_Site	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit						aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	GTTCAGGGACCTGGGAGGGAA	0.647																																																	0													26.0	16.0	20.0					16																	1272918		2193	4289	6482	SO:0001628	intergenic_variant	25823			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180			16.37:g.1272918C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Splice_Site	SNP	-	e4-1	ENST00000348261.5	37	c.246-1	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	c	10.49	1.364757	0.24684	.	.	ENSG00000116176	ENST00000234798	.	.	.	2.72	1.74	0.24563	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	7.3656	0.26770	0.0:0.858:0.0:0.142	.	.	.	.	.	-1	.	.	.	-	.	.	TPSG1	1212919	0.000000	0.05858	0.440000	0.26846	0.389000	0.30415	-0.243000	0.08915	0.453000	0.26858	0.556000	0.70494	.	TPSG1	-	-		0.647	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	TPSG1	HGNC	protein_coding	OTTHUMT00000421601.1	C	NM_001005407		1272918	-1	no_errors	ENST00000234798	ensembl	human	known	70_37	splice_site	SNP	0.758	A
TRIM51HP	440041	genome.wustl.edu	37	11	55062922	55062922	+	RNA	SNP	A	A	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:55062922A>G	ENST00000526016.1	-	0	715					NR_038174.2				tripartite motif-containing 51H, pseudogene																		ATGATACCCCATGGTCAGTTC	0.428																																																	0																																												440041					11q11	2012-11-02			ENSG00000166007	ENSG00000166007		"""Triparite motif-containing / Pseudogenes"""	43977	pseudogene	pseudogene							Standard	NR_038174		Approved		uc021qjb.1		OTTHUMG00000166775		11.37:g.55062922A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000526016.1	37	NULL		11																																																																																			TRIM51HP	-	-		0.428	TRIM51HP-002	PUTATIVE	basic|exp_conf	processed_transcript	TRIM51HP	HGNC	pseudogene	OTTHUMT00000391438.1	A			55062922	-1	no_errors	ENST00000526016	ensembl	human	putative	70_37	rna	SNP	0.002	G
TRIM67	440730	genome.wustl.edu	37	1	231334844	231334844	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:231334844G>C	ENST00000366653.5	+	3	1192	c.1192G>C	c.(1192-1194)Gtg>Ctg	p.V398L	TRIM67_ENST00000444294.3_Missense_Mutation_p.V398L|TRIM67_ENST00000366652.2_Missense_Mutation_p.V398L|TRIM67_ENST00000449018.3_Missense_Mutation_p.V336L			Q6ZTA4	TRI67_HUMAN	tripartite motif containing 67	398					negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	zinc ion binding (GO:0008270)			breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	29	Breast(184;0.0871)	all_cancers(173;0.189)|Prostate(94;0.167)				TGATGCCCTTGTGGATGCTTT	0.517																																																	0													156.0	162.0	160.0					1																	231334844		2004	4171	6175	SO:0001583	missense	440730			AK126782	CCDS44333.1, CCDS73048.1	1q42.2	2014-02-17	2011-01-25		ENSG00000119283	ENSG00000119283		"""Tripartite motif containing / Tripartite motif containing"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	31859	protein-coding gene	gene with protein product		610584	"""tripartite motif-containing 67"""				Standard	NM_001004342		Approved	TNL	uc009xfn.1	Q6ZTA4	OTTHUMG00000037958	ENST00000366653.5:c.1192G>C	1.37:g.231334844G>C	ENSP00000355613:p.Val398Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TER7|Q5TER8|Q7Z4K7	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Fibronectin_type3,pfscan_Znf_B-box	p.V398L	ENST00000366653.5	37	c.1192	CCDS44333.1	1	.	.	.	.	.	.	.	.	.	.	G	19.60	3.858033	0.71834	.	.	ENSG00000119283	ENST00000444294;ENST00000366652;ENST00000449018;ENST00000366653	T;T;T;T	0.70045	-0.44;-0.35;-0.37;-0.45	5.61	5.61	0.85477	B-box, C-terminal (1);	0.063956	0.64402	D	0.000008	T	0.50171	0.1600	N	0.12182	0.205	0.50039	D	0.999845	B	0.34015	0.435	B	0.26202	0.067	T	0.53165	-0.8477	10	0.46703	T	0.11	.	19.6258	0.95677	0.0:0.0:1.0:0.0	.	398	Q6ZTA4	TRI67_HUMAN	L	398;398;336;398	ENSP00000412124:V398L;ENSP00000355612:V398L;ENSP00000400163:V336L;ENSP00000355613:V398L	ENSP00000355612:V398L	V	+	1	0	TRIM67	229401467	1.000000	0.71417	0.998000	0.56505	0.961000	0.63080	6.939000	0.75911	2.638000	0.89438	0.561000	0.74099	GTG	TRIM67	-	smart_Bbox_C		0.517	TRIM67-001	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	TRIM67	HGNC	protein_coding	OTTHUMT00000092649.3	G	NM_001004342		231334844	+1	no_errors	ENST00000366652	ensembl	human	known	70_37	missense	SNP	1.000	C
TRIM58	25893	genome.wustl.edu	37	1	248039700	248039700	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:248039700T>C	ENST00000366481.3	+	6	1418	c.1370T>C	c.(1369-1371)aTc>aCc	p.I457T	OR2W3_ENST00000537741.1_Intron	NM_015431.3	NP_056246.3	Q8NG06	TRI58_HUMAN	tripartite motif containing 58	457	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(39)|ovary(4)|pancreas(1)|skin(7)|stomach(1)	63	all_cancers(71;0.000139)|all_epithelial(71;1.58e-05)|Breast(184;0.0117)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)	all_cancers(173;0.0286)	OV - Ovarian serous cystadenocarcinoma(106;0.0319)			ACTCCTCTTATCTTGCCACCC	0.408																																																	0													125.0	119.0	121.0					1																	248039700		2203	4300	6503	SO:0001583	missense	25893			AF327057	CCDS1636.1	1q44	2013-01-09	2011-01-25		ENSG00000162722	ENSG00000162722		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	24150	protein-coding gene	gene with protein product			"""tripartite motif-containing 58"""				Standard	NM_015431		Approved	BIA2	uc001ido.3	Q8NG06	OTTHUMG00000040203	ENST00000366481.3:c.1370T>C	1.37:g.248039700T>C	ENSP00000355437:p.Ile457Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6B0H9	Missense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_ConA-like_lec_gl_sf,smart_Znf_RING,smart_Znf_B-box,smart_PRY,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.I457T	ENST00000366481.3	37	c.1370	CCDS1636.1	1	.	.	.	.	.	.	.	.	.	.	T	0.024	-1.389961	0.01185	.	.	ENSG00000162722	ENST00000366481	T	0.59638	0.25	4.05	-4.6	0.03390	Concanavalin A-like lectin/glucanase (1);SPla/RYanodine receptor subgroup (1);B30.2/SPRY domain (1);	0.750321	0.12128	N	0.497058	T	0.16385	0.0394	N	0.00633	-1.31	0.09310	N	1	B	0.10296	0.003	B	0.17722	0.019	T	0.25813	-1.0121	10	0.17369	T	0.5	.	2.0995	0.03676	0.1501:0.3971:0.154:0.2987	.	457	Q8NG06	TRI58_HUMAN	T	457	ENSP00000355437:I457T	ENSP00000355437:I457T	I	+	2	0	TRIM58	246106323	0.000000	0.05858	0.000000	0.03702	0.038000	0.13279	-0.116000	0.10724	-0.945000	0.03681	-0.280000	0.10049	ATC	TRIM58	-	superfamily_ConA-like_lec_gl_sf,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY		0.408	TRIM58-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM58	HGNC	protein_coding	OTTHUMT00000096860.1	T	NM_015431		248039700	+1	no_errors	ENST00000366481	ensembl	human	known	70_37	missense	SNP	0.000	C
TRIP12	9320	genome.wustl.edu	37	2	230670551	230670551	+	Intron	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr2:230670551G>A	ENST00000283943.5	-	17	2531				TRIP12_ENST00000389044.4_Intron|TRIP12_ENST00000543084.1_Intron|TRIP12_ENST00000389045.3_Nonsense_Mutation_p.R504*	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12						cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		GTATAAACTCGTCCCAGAGTG	0.413																																																	0													92.0	85.0	87.0					2																	230670551		2203	4300	6503	SO:0001627	intron_variant	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.2353-33C>T	2.37:g.230670551G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Nonsense_Mutation	SNP	pfam_HECT,pfam_WWE-dom,superfamily_HECT,superfamily_ARM-type_fold,smart_WWE-dom_subgr,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.R504*	ENST00000283943.5	37	c.1510	CCDS33391.1	2	.	.	.	.	.	.	.	.	.	.	G	40	8.241620	0.98722	.	.	ENSG00000153827	ENST00000389045	.	.	.	5.77	5.77	0.91146	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.2216	0.89903	0.0:0.0:1.0:0.0	.	.	.	.	X	504	.	.	R	-	1	2	TRIP12	230378795	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.827000	0.99397	2.729000	0.93468	0.644000	0.83932	CGA	TRIP12	-	pfam_WWE-dom,superfamily_ARM-type_fold,smart_WWE-dom_subgr,pfscan_WWE-dom		0.413	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	G	NM_004238		230670551	-1	no_errors	ENST00000389045	ensembl	human	novel	70_37	nonsense	SNP	1.000	A
TSC22D4	81628	genome.wustl.edu	37	7	100075164	100075164	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr7:100075164G>T	ENST00000300181.2	-	2	1252	c.498C>A	c.(496-498)ttC>ttA	p.F166L	TSC22D4_ENST00000496728.1_5'Flank|TSC22D4_ENST00000393991.1_Intron	NM_030935.3	NP_112197.1	Q9Y3Q8	T22D4_HUMAN	TSC22 domain family, member 4	166					negative regulation of transcription, DNA-templated (GO:0045892)|response to osmotic stress (GO:0006970)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|kidney(1)|large_intestine(1)|lung(2)|skin(1)|urinary_tract(1)	8	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					GTCCCCCAGTGAAGGAGCGGG	0.711																																																	0													10.0	12.0	11.0					7																	100075164		2079	4117	6196	SO:0001583	missense	81628			BC010406	CCDS5695.1	7p21-p15	2010-04-30			ENSG00000166925	ENSG00000166925			21696	protein-coding gene	gene with protein product		611914					Standard	NM_030935		Approved	THG-1, TILZ2	uc003uva.3	Q9Y3Q8	OTTHUMG00000150233	ENST00000300181.2:c.498C>A	7.37:g.100075164G>T	ENSP00000300181:p.Phe166Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2C3|A8MWR6|D6W5V9	Missense_Mutation	SNP	pfam_TSC-22_Dip_Bun	p.F166L	ENST00000300181.2	37	c.498	CCDS5695.1	7	.	.	.	.	.	.	.	.	.	.	G	12.89	2.074894	0.36566	.	.	ENSG00000166925	ENST00000300181	.	.	.	5.01	0.826	0.18829	.	0.512211	0.16465	N	0.213203	T	0.42562	0.1208	L	0.44542	1.39	0.44937	D	0.997951	B;B	0.06786	0.001;0.0	B;B	0.06405	0.002;0.0	T	0.13124	-1.0521	8	.	.	.	-0.1807	6.3949	0.21607	0.0901:0.0:0.3732:0.5367	.	166;166	Q8IV54;Q9Y3Q8	.;T22D4_HUMAN	L	166	.	.	F	-	3	2	TSC22D4	99913100	0.383000	0.25156	0.940000	0.37924	0.914000	0.54420	-0.239000	0.08965	0.083000	0.17047	0.298000	0.19748	TTC	TSC22D4	-	NULL		0.711	TSC22D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSC22D4	HGNC	protein_coding	OTTHUMT00000316970.1	G	NM_030935		100075164	-1	no_errors	ENST00000300181	ensembl	human	known	70_37	missense	SNP	0.614	T
TTC28	23331	genome.wustl.edu	37	22	28410369	28410369	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr22:28410369C>T	ENST00000397906.2	-	14	4226	c.4085G>A	c.(4084-4086)aGc>aAc	p.S1362N		NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28	1362					mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						GCTCGTCATGCTCTGGCAGCT	0.627																																																	0													81.0	91.0	88.0					22																	28410369		692	1591	2283	SO:0001583	missense	23331			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.4085G>A	22.37:g.28410369C>T	ENSP00000381003:p.Ser1362Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	Missense_Mutation	SNP	pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S1362N	ENST00000397906.2	37	c.4085	CCDS46678.1	22	.	.	.	.	.	.	.	.	.	.	C	21.7	4.191531	0.78902	.	.	ENSG00000100154	ENST00000397906	D	0.91124	-2.79	4.75	3.73	0.42828	.	0.051905	0.85682	D	0.000000	D	0.90803	0.7112	L	0.32530	0.975	0.58432	D	0.999999	D	0.71674	0.998	P	0.62813	0.907	D	0.90536	0.4499	10	0.54805	T	0.06	-23.7133	11.9005	0.52680	0.0:0.9139:0.0:0.0861	.	1362	Q96AY4	TTC28_HUMAN	N	1362	ENSP00000381003:S1362N	ENSP00000381003:S1362N	S	-	2	0	TTC28	26740369	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	7.141000	0.77330	1.138000	0.42230	0.650000	0.86243	AGC	TTC28	-	NULL		0.627	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28	HGNC	protein_coding	OTTHUMT00000320930.2	C	XM_929318		28410369	-1	no_errors	ENST00000397906	ensembl	human	novel	70_37	missense	SNP	1.000	T
TUB	7275	genome.wustl.edu	37	11	8117170	8117170	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:8117170C>T	ENST00000299506.2	+	5	672	c.523C>T	c.(523-525)Cgg>Tgg	p.R175W	TUB_ENST00000534099.1_Missense_Mutation_p.R181W|TUB_ENST00000305253.4_Missense_Mutation_p.R230W	NM_177972.2	NP_813977.1	P50607	TUB_HUMAN	tubby bipartite transcription factor	175					multicellular organismal macromolecule metabolic process (GO:0044259)|phagocytosis (GO:0006909)|phototransduction (GO:0007602)|positive regulation of phagocytosis (GO:0050766)|response to hormone (GO:0009725)|retina development in camera-type eye (GO:0060041)|sensory perception of sound (GO:0007605)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	G-protein coupled photoreceptor activity (GO:0008020)|protein complex binding (GO:0032403)			breast(1)|cervix(1)|endometrium(9)|large_intestine(7)|lung(5)|ovary(1)|stomach(1)|upper_aerodigestive_tract(1)	26		all_lung(207;6.91e-20)|Lung NSC(207;3.36e-17)		Epithelial(150;1.69e-62)|BRCA - Breast invasive adenocarcinoma(625;8.54e-06)|LUSC - Lung squamous cell carcinoma(625;0.000184)		TGGGGGCGAACGGCCCAGCGG	0.637																																																	0													21.0	24.0	23.0					11																	8117170		2198	4295	6493	SO:0001583	missense	7275			U54644	CCDS7786.1, CCDS7787.1	11p15.5	2013-08-06	2013-08-06		ENSG00000166402	ENSG00000166402			12406	protein-coding gene	gene with protein product		601197	"""tubby (mouse) homolog"", ""tubby homolog (mouse)"""			8612280	Standard	NM_003320		Approved	rd5	uc001mfy.3	P50607	OTTHUMG00000165690	ENST00000299506.2:c.523C>T	11.37:g.8117170C>T	ENSP00000299506:p.Arg175Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQU4|O00293|Q6B007	Missense_Mutation	SNP	pfam_Tubby_C,superfamily_Tubby_C-like,prints_Tubby_N,prints_Tubby_C	p.R230W	ENST00000299506.2	37	c.688	CCDS7787.1	11	.	.	.	.	.	.	.	.	.	.	C	14.95	2.689295	0.48097	.	.	ENSG00000166402	ENST00000534099;ENST00000305253;ENST00000299506	D;D;D	0.85861	-2.02;-2.04;-2.01	5.38	5.38	0.77491	Tubby, N-terminal (1);	1.074330	0.06950	N	0.814481	D	0.84754	0.5542	L	0.29908	0.895	0.09310	N	1	P;P;D	0.53885	0.807;0.807;0.963	B;B;P	0.46975	0.296;0.296;0.533	T	0.78112	-0.2331	10	0.72032	D	0.01	-13.4967	17.8888	0.88865	0.0:1.0:0.0:0.0	.	181;175;230	E9PQR4;P50607;P50607-2	.;TUB_HUMAN;.	W	181;230;175	ENSP00000434400:R181W;ENSP00000305426:R230W;ENSP00000299506:R175W	ENSP00000299506:R175W	R	+	1	2	TUB	8073746	0.095000	0.21747	0.006000	0.13384	0.602000	0.36980	3.332000	0.52083	2.531000	0.85337	0.561000	0.74099	CGG	TUB	-	prints_Tubby_N		0.637	TUB-003	PUTATIVE	basic|appris_principal|CCDS	protein_coding	TUB	HGNC	protein_coding	OTTHUMT00000385823.1	C	NM_003320		8117170	+1	no_errors	ENST00000305253	ensembl	human	known	70_37	missense	SNP	0.051	T
UBE2O	63893	genome.wustl.edu	37	17	74395865	74395865	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr17:74395865G>T	ENST00000319380.7	-	9	1357	c.1293C>A	c.(1291-1293)agC>agA	p.S431R	UBE2O_ENST00000587581.1_5'Flank	NM_022066.3	NP_071349.3	Q9C0C9	UBE2O_HUMAN	ubiquitin-conjugating enzyme E2O	431					positive regulation of BMP signaling pathway (GO:0030513)|protein K63-linked ubiquitination (GO:0070534)|protein monoubiquitination (GO:0006513)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(17)|ovary(2)|prostate(2)|skin(3)|stomach(1)|urinary_tract(1)	36						TCTCCTCAGGGCTGGCAGACT	0.622																																																	0													102.0	109.0	107.0					17																	74395865		2203	4300	6503	SO:0001583	missense	63893			AB051521	CCDS32742.1	17q25.1	2013-10-09			ENSG00000175931	ENSG00000175931			29554	protein-coding gene	gene with protein product						11311559, 11214970	Standard	NM_022066		Approved	E2-230K	uc002jrm.4	Q9C0C9	OTTHUMG00000180178	ENST00000319380.7:c.1293C>A	17.37:g.74395865G>T	ENSP00000323687:p.Ser431Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDU5|Q69YP4|Q6PIZ2|Q86UA4|Q8N425|Q8TBN1|Q9BSW1|Q9H6E6|Q9H7E4|Q9H9B2	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.S431R	ENST00000319380.7	37	c.1293	CCDS32742.1	17	.	.	.	.	.	.	.	.	.	.	G	5.838	0.338755	0.11069	.	.	ENSG00000175931	ENST00000319380	T	0.72725	-0.68	4.98	-1.3	0.09259	.	0.550782	0.19715	N	0.107706	T	0.45357	0.1338	N	0.19112	0.55	0.24481	N	0.99434	B	0.20671	0.047	B	0.14578	0.011	T	0.27806	-1.0063	10	0.10902	T	0.67	-28.3015	7.3773	0.26835	0.3344:0.1198:0.5459:0.0	.	431	Q9C0C9	UBE2O_HUMAN	R	431	ENSP00000323687:S431R	ENSP00000323687:S431R	S	-	3	2	UBE2O	71907460	1.000000	0.71417	0.883000	0.34634	0.019000	0.09904	0.419000	0.21247	-0.069000	0.12931	-1.332000	0.01269	AGC	UBE2O	-	NULL		0.622	UBE2O-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2O	HGNC	protein_coding	OTTHUMT00000450123.1	G	NM_022066		74395865	-1	no_errors	ENST00000319380	ensembl	human	known	70_37	missense	SNP	0.723	T
UGGT2	55757	genome.wustl.edu	37	13	96485211	96485211	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:96485211C>G	ENST00000376747.3	-	38	4568	c.4498G>C	c.(4498-4500)Gat>Cat	p.D1500H		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1500	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TCAAGATGATCTAATAGTTGT	0.368																																																	0													217.0	191.0	200.0					13																	96485211		2202	4299	6501	SO:0001583	missense	55757			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.4498G>C	13.37:g.96485211C>G	ENSP00000365938:p.Asp1500His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.D1500H	ENST00000376747.3	37	c.4498	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	9.517	1.107328	0.20714	.	.	ENSG00000102595	ENST00000376747	T	0.08458	3.09	5.87	3.09	0.35607	.	0.416166	0.27792	N	0.017830	T	0.07548	0.0190	L	0.46157	1.445	0.58432	D	0.999999	B	0.11235	0.004	B	0.11329	0.006	T	0.18335	-1.0340	10	0.45353	T	0.12	-6.699	5.0084	0.14300	0.0:0.4546:0.2382:0.3072	.	1500	Q9NYU1	UGGG2_HUMAN	H	1500	ENSP00000365938:D1500H	ENSP00000365938:D1500H	D	-	1	0	UGGT2	95283212	1.000000	0.71417	0.761000	0.31378	0.285000	0.27093	1.076000	0.30729	0.838000	0.34948	0.655000	0.94253	GAT	UGGT2	-	NULL		0.368	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	C	NM_020121		96485211	-1	no_errors	ENST00000376747	ensembl	human	known	70_37	missense	SNP	0.814	G
UGGT2	55757	genome.wustl.edu	37	13	96485250	96485250	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr13:96485250C>G	ENST00000376747.3	-	38	4529	c.4459G>C	c.(4459-4461)Gaa>Caa	p.E1487Q		NM_020121.3	NP_064506.3	Q9NYU1	UGGG2_HUMAN	UDP-glucose glycoprotein glucosyltransferase 2	1487	Glucosyltransferase.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|UDP-glucosylation (GO:0097359)	endoplasmic reticulum lumen (GO:0005788)	UDP-glucose:glycoprotein glucosyltransferase activity (GO:0003980)	p.E1487Q(1)		NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(17)|lung(20)|ovary(3)|pancreas(1)|prostate(4)|urinary_tract(2)	60						TCCACCCATTCTGGGACAATT	0.353																																																	1	Substitution - Missense(1)	lung(1)											197.0	176.0	183.0					13																	96485250		2201	4299	6500	SO:0001583	missense	55757			AF227906	CCDS9480.1	13q32.1	2009-07-23	2009-07-23	2009-07-23	ENSG00000102595	ENSG00000102595			15664	protein-coding gene	gene with protein product	"""UDP-glucose:glycoprotein glucosyltransferase 2"""	605898	"""UDP-glucose ceramide glucosyltransferase-like 2"""	UGCGL2		10694380	Standard	NM_020121		Approved	FLJ11485, HUGT2, FLJ10873, MGC150689, MGC87276, MGC117360	uc001vmt.3	Q9NYU1	OTTHUMG00000017230	ENST00000376747.3:c.4459G>C	13.37:g.96485250C>G	ENSP00000365938:p.Glu1487Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKL4|Q08AD0|Q5JQR8|Q8N5K0|Q9UFC4	Missense_Mutation	SNP	pfam_UDP-g_GGtrans,pfam_Glyco_trans_8	p.E1487Q	ENST00000376747.3	37	c.4459	CCDS9480.1	13	.	.	.	.	.	.	.	.	.	.	C	28.9	4.962105	0.92791	.	.	ENSG00000102595	ENST00000376747	T	0.23754	1.89	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.62196	0.2408	M	0.89840	3.065	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	T	0.68473	-0.5399	10	0.87932	D	0	-25.4093	20.2079	0.98282	0.0:1.0:0.0:0.0	.	1487	Q9NYU1	UGGG2_HUMAN	Q	1487	ENSP00000365938:E1487Q	ENSP00000365938:E1487Q	E	-	1	0	UGGT2	95283251	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.988000	0.76212	2.781000	0.95711	0.655000	0.94253	GAA	UGGT2	-	NULL		0.353	UGGT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGGT2	HGNC	protein_coding	OTTHUMT00000045507.1	C	NM_020121		96485250	-1	no_errors	ENST00000376747	ensembl	human	known	70_37	missense	SNP	1.000	G
UPP1	7378	genome.wustl.edu	37	7	48146627	48146627	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr7:48146627C>T	ENST00000331803.4	+	8	1217	c.594C>T	c.(592-594)agC>agT	p.S198S	UPP1_ENST00000341253.4_Silent_p.S198S|UPP1_ENST00000482015.1_3'UTR|UPP1_ENST00000429491.2_Silent_p.S61S|UPP1_ENST00000395564.4_Silent_p.S198S			Q16831	UPP1_HUMAN	uridine phosphorylase 1	198					cellular response to glucose starvation (GO:0042149)|nucleobase-containing compound metabolic process (GO:0006139)|nucleobase-containing small molecule metabolic process (GO:0055086)|nucleotide catabolic process (GO:0009166)|pyrimidine nucleobase metabolic process (GO:0006206)|pyrimidine nucleoside catabolic process (GO:0046135)|pyrimidine nucleoside salvage (GO:0043097)|small molecule metabolic process (GO:0044281)|UMP salvage (GO:0044206)|uridine metabolic process (GO:0046108)	cytosol (GO:0005829)	uridine phosphorylase activity (GO:0004850)	p.S198S(1)		breast(1)|endometrium(2)|large_intestine(1)|lung(12)|ovary(1)|upper_aerodigestive_tract(1)	18					Fluorouracil(DB00544)	CAGAGCTGAGCGAGTTCACCA	0.552																																																	1	Substitution - coding silent(1)	large_intestine(1)											123.0	112.0	116.0					7																	48146627		2203	4300	6503	SO:0001819	synonymous_variant	7378			AK096167	CCDS5507.1	7p12.3	2012-10-02	2003-08-28	2003-08-29	ENSG00000183696	ENSG00000183696	2.4.2.3		12576	protein-coding gene	gene with protein product		191730	"""uridine phosphorylase"""	UP		752472, 11807789	Standard	NM_003364		Approved	UPASE, UPP, UDRPASE	uc003toj.3	Q16831	OTTHUMG00000129253	ENST00000331803.4:c.594C>T	7.37:g.48146627C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVM4|Q15362	Silent	SNP	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk	p.S198	ENST00000331803.4	37	c.594	CCDS5507.1	7																																																																																			UPP1	-	pfam_Nucleoside_phosphorylase_d,tigrfam_Uridine_phosphorylase_euk		0.552	UPP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UPP1	HGNC	protein_coding	OTTHUMT00000251360.1	C	NM_003364		48146627	+1	no_errors	ENST00000331803	ensembl	human	known	70_37	silent	SNP	0.001	T
VPS37C	55048	genome.wustl.edu	37	11	60900771	60900771	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:60900771C>T	ENST00000301765.5	-	4	536	c.304G>A	c.(304-306)Gac>Aac	p.D102N		NM_017966.4	NP_060436.4	A5D8V6	VP37C_HUMAN	vacuolar protein sorting 37 homolog C (S. cerevisiae)	102	VPS37 C-terminal. {ECO:0000255|PROSITE- ProRule:PRU00646}.				endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7						TGCAGAAGGTCTAACAAGGTC	0.537																																																	0													75.0	57.0	63.0					11																	60900771		2203	4299	6502	SO:0001583	missense	55048			AK097326	CCDS31573.1	11q12.2	2008-02-05	2006-04-04			ENSG00000167987			26097	protein-coding gene	gene with protein product		610038	"""vacuolar protein sorting 37C (yeast)"""			15509564	Standard	XM_005274077		Approved	FLJ20847	uc001nqv.1	A5D8V6		ENST00000301765.5:c.304G>A	11.37:g.60900771C>T	ENSP00000301765:p.Asp102Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3K4	Missense_Mutation	SNP	pfam_Mod_r	p.D102N	ENST00000301765.5	37	c.304	CCDS31573.1	11	.	.	.	.	.	.	.	.	.	.	C	22.8	4.341893	0.81911	.	.	ENSG00000167987	ENST00000301765;ENST00000540084;ENST00000538036	T;T	0.76839	-1.05;-1.05	5.01	5.01	0.66863	Modifier of rudimentary, Modr (2);	0.180038	0.49916	D	0.000139	T	0.69540	0.3122	L	0.38838	1.175	0.30779	N	0.742238	P;P	0.43938	0.822;0.503	P;B	0.46172	0.506;0.409	T	0.65228	-0.6219	10	0.08599	T	0.76	-16.562	11.0581	0.47931	0.0:0.9144:0.0:0.0856	.	102;102	B4DYD9;A5D8V6	.;VP37C_HUMAN	N	102	ENSP00000301765:D102N;ENSP00000446013:D102N	ENSP00000301765:D102N	D	-	1	0	VPS37C	60657347	0.926000	0.31397	0.974000	0.42286	0.982000	0.71751	1.799000	0.38824	2.318000	0.78349	0.561000	0.74099	GAC	VPS37C	-	pfam_Mod_r		0.537	VPS37C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37C	HGNC	protein_coding	OTTHUMT00000396467.1	C	NM_017966		60900771	-1	no_errors	ENST00000301765	ensembl	human	known	70_37	missense	SNP	1.000	T
VPS37C	55048	genome.wustl.edu	37	11	60901632	60901632	+	Silent	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr11:60901632C>T	ENST00000301765.5	-	3	373	c.141G>A	c.(139-141)cgG>cgA	p.R47R		NM_017966.4	NP_060436.4	A5D8V6	VP37C_HUMAN	vacuolar protein sorting 37 homolog C (S. cerevisiae)	47					endosomal transport (GO:0016197)|intracellular transport of virus (GO:0075733)|membrane organization (GO:0061024)|protein transport (GO:0015031)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral protein processing (GO:0019082)|virion assembly (GO:0019068)	endosome membrane (GO:0010008)|ESCRT I complex (GO:0000813)|extracellular vesicular exosome (GO:0070062)				breast(1)|kidney(1)|large_intestine(3)|lung(1)|skin(1)	7						CTGCCAGGCTCCGGTTGGTGG	0.582																																																	0													68.0	67.0	68.0					11																	60901632		2203	4299	6502	SO:0001819	synonymous_variant	55048			AK097326	CCDS31573.1	11q12.2	2008-02-05	2006-04-04			ENSG00000167987			26097	protein-coding gene	gene with protein product		610038	"""vacuolar protein sorting 37C (yeast)"""			15509564	Standard	XM_005274077		Approved	FLJ20847	uc001nqv.1	A5D8V6		ENST00000301765.5:c.141G>A	11.37:g.60901632C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3K4	Silent	SNP	pfam_Mod_r	p.R47	ENST00000301765.5	37	c.141	CCDS31573.1	11																																																																																			VPS37C	-	pfam_Mod_r		0.582	VPS37C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS37C	HGNC	protein_coding	OTTHUMT00000396467.1	C	NM_017966		60901632	-1	no_errors	ENST00000301765	ensembl	human	known	70_37	silent	SNP	0.958	T
VWF	7450	genome.wustl.edu	37	12	6128901	6128901	+	Missense_Mutation	SNP	T	T	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr12:6128901T>A	ENST00000261405.5	-	28	3937	c.3683A>T	c.(3682-3684)gAt>gTt	p.D1228V		NM_000552.3	NP_000543	P04275	VWF_HUMAN	von Willebrand factor	1228					blood coagulation (GO:0007596)|blood coagulation, intrinsic pathway (GO:0007597)|cell adhesion (GO:0007155)|cell-substrate adhesion (GO:0031589)|extracellular matrix organization (GO:0030198)|hemostasis (GO:0007599)|liver development (GO:0001889)|placenta development (GO:0001890)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|protein homooligomerization (GO:0051260)|response to wounding (GO:0009611)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|proteinaceous extracellular matrix (GO:0005578)|Weibel-Palade body (GO:0033093)	chaperone binding (GO:0051087)|collagen binding (GO:0005518)|glycoprotein binding (GO:0001948)|identical protein binding (GO:0042802)|immunoglobulin binding (GO:0019865)|integrin binding (GO:0005178)|protease binding (GO:0002020)|protein homodimerization activity (GO:0042803)|protein N-terminus binding (GO:0047485)			NS(1)|breast(6)|central_nervous_system(5)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(41)|ovary(7)|pancreas(2)|prostate(6)|skin(15)|stomach(1)|upper_aerodigestive_tract(5)	129					Antihemophilic Factor(DB00025)	GTTGACAACATCACAGTGGCT	0.542																																																	0													12.0	15.0	14.0					12																	6128901		2200	4292	6492	SO:0001583	missense	7450				CCDS8539.1	12p13.3	2014-09-17			ENSG00000110799	ENSG00000110799		"""Endogenous ligands"""	12726	protein-coding gene	gene with protein product		613160		F8VWF		2251280	Standard	NM_000552		Approved		uc001qnn.1	P04275	OTTHUMG00000168265	ENST00000261405.5:c.3683A>T	12.37:g.6128901T>A	ENSP00000261405:p.Asp1228Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCE8|Q99806	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_VWF_A,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_VWF_A,smart_Cys_knot_C,pirsf_VWF,pfscan_Cys_knot_C,pfscan_VWF_A,pfscan_VWF_C	p.D1228V	ENST00000261405.5	37	c.3683	CCDS8539.1	12	.	.	.	.	.	.	.	.	.	.	.	17.46	3.395882	0.62177	.	.	ENSG00000110799	ENST00000261405	T	0.36878	1.23	4.94	4.94	0.65067	.	0.153345	0.30519	N	0.009451	T	0.40645	0.1125	M	0.69823	2.125	0.80722	D	1	P	0.50710	0.938	B	0.43508	0.422	T	0.37911	-0.9685	10	0.36615	T	0.2	.	13.5574	0.61768	0.0:0.0:0.0:1.0	.	1228	P04275	VWF_HUMAN	V	1228	ENSP00000261405:D1228V	ENSP00000261405:D1228V	D	-	2	0	VWF	5999162	1.000000	0.71417	0.986000	0.45419	0.826000	0.46750	5.146000	0.64845	2.084000	0.62774	0.454000	0.30748	GAT	VWF	-	pirsf_VWF		0.542	VWF-002	KNOWN	basic|appris_principal|CCDS	protein_coding	VWF	HGNC	protein_coding	OTTHUMT00000399020.1	T	NM_000552		6128901	-1	no_errors	ENST00000261405	ensembl	human	known	70_37	missense	SNP	1.000	A
XPNPEP1	7511	genome.wustl.edu	37	10	111652824	111652824	+	Missense_Mutation	SNP	T	T	C			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr10:111652824T>C	ENST00000502935.1	-	4	375	c.256A>G	c.(256-258)Att>Gtt	p.I86V	XPNPEP1_ENST00000369680.4_Missense_Mutation_p.I43V|XPNPEP1_ENST00000322238.8_Missense_Mutation_p.I86V|XPNPEP1_ENST00000430337.1_Intron|XPNPEP1_ENST00000369683.1_Intron					X-prolyl aminopeptidase (aminopeptidase P) 1, soluble											endometrium(2)|kidney(9)|large_intestine(4)|lung(9)|ovary(3)|pancreas(2)|skin(1)|urinary_tract(1)	31		Breast(234;0.174)		Epithelial(162;1.64e-05)|all cancers(201;0.000564)|BRCA - Breast invasive adenocarcinoma(275;0.0721)		CATGGAGCAATATACTCACTC	0.512																																																	0													86.0	75.0	79.0					10																	111652824		2203	4300	6503	SO:0001583	missense	7511				CCDS7560.1, CCDS7560.2, CCDS53576.1	10q25.3	2006-01-16	2002-07-17		ENSG00000108039	ENSG00000108039	3.4.11.9		12822	protein-coding gene	gene with protein product		602443	"""X-prolyl aminopeptidase (aminopeptidase P)-like"""	XPNPEP, XPNPEPL1, XPNPEPL			Standard	NM_020383		Approved		uc001kyp.2	Q9NQW7	OTTHUMG00000019029	ENST00000502935.1:c.256A>G	10.37:g.111652824T>C	ENSP00000421566:p.Ile86Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Pept_M24_structural-domain,pfam_Creatinase,superfamily_Pept_M24_structural-domain	p.I86V	ENST00000502935.1	37	c.256	CCDS7560.2	10	.	.	.	.	.	.	.	.	.	.	T	14.55	2.568127	0.45798	.	.	ENSG00000108039	ENST00000502935;ENST00000322238;ENST00000369680;ENST00000403138;ENST00000423625	.	.	.	5.77	5.77	0.91146	Creatinase (1);	0.048581	0.85682	D	0.000000	T	0.34745	0.0908	N	0.05592	-0.015	0.45330	D	0.998325	B;B;B	0.11235	0.004;0.004;0.001	B;B;B	0.17722	0.008;0.004;0.019	T	0.28396	-1.0045	9	0.05721	T	0.95	-15.8611	14.6735	0.68961	0.0:0.0:0.0:1.0	.	86;86;43	B4E2P4;G5E9Y2;Q9NQW7	.;.;XPP1_HUMAN	V	86;86;43;43;43	.	ENSP00000324011:I86V	I	-	1	0	XPNPEP1	111642814	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	4.816000	0.62642	2.200000	0.70718	0.459000	0.35465	ATT	XPNPEP1	-	pfam_Creatinase		0.512	XPNPEP1-015	KNOWN	basic|CCDS	protein_coding	XPNPEP1	HGNC	protein_coding	OTTHUMT00000050264.2	T			111652824	-1	no_errors	ENST00000502935	ensembl	human	known	70_37	missense	SNP	1.000	C
YLPM1	56252	genome.wustl.edu	37	14	75266120	75266120	+	Nonsense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr14:75266120C>T	ENST00000325680.7	+	5	4244	c.4120C>T	c.(4120-4122)Cga>Tga	p.R1374*	YLPM1_ENST00000552421.1_Intron|YLPM1_ENST00000238571.3_Nonsense_Mutation_p.R1179*	NM_019589.2	NP_062535.2	P49750	YLPM1_HUMAN	YLP motif containing 1	1179					regulation of telomere maintenance (GO:0032204)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(4)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(12)|lung(24)|ovary(3)|pancreas(1)|prostate(1)|skin(1)|urinary_tract(1)	62			KIRC - Kidney renal clear cell carcinoma(43;0.238)	BRCA - Breast invasive adenocarcinoma(234;0.00162)		GTTGAGGATTCGAGAGTATCC	0.463																																																	0													219.0	206.0	210.0					14																	75266120		1931	4149	6080	SO:0001587	stop_gained	56252			AK090435	CCDS45135.1	14q24.3	2014-06-13	2004-07-15	2004-07-15	ENSG00000119596	ENSG00000119596			17798	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 169"""		"""chromosome 14 open reading frame 170"""	C14orf170		7596406	Standard	NM_019589		Approved	ZAP, PPP1R169	uc001xqj.4	P49750	OTTHUMG00000172503	ENST00000325680.7:c.4120C>T	14.37:g.75266120C>T	ENSP00000324463:p.Arg1374*	Somatic		WXS	Illumina HiSeq	Phase_IV	P49752|Q96I64|Q9P1V7	Nonsense_Mutation	SNP	superfamily_FH2_actin-bd	p.R1374*	ENST00000325680.7	37	c.4120	CCDS45135.1	14	.	.	.	.	.	.	.	.	.	.	C	38	6.642530	0.97730	.	.	ENSG00000119596	ENST00000325680;ENST00000238571;ENST00000423680	.	.	.	5.79	4.87	0.63330	.	0.000000	0.50627	D	0.000115	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.7341	16.3006	0.82807	0.1329:0.8671:0.0:0.0	.	.	.	.	X	1374;1179;1087	.	ENSP00000238571:R1179X	R	+	1	2	YLPM1	74335873	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.047000	0.49854	2.753000	0.94483	0.537000	0.68136	CGA	YLPM1	-	NULL		0.463	YLPM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YLPM1	Uniprot_genename	protein_coding	OTTHUMT00000404451.1	C	NM_019589		75266120	+1	no_errors	ENST00000325680	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ZCCHC12	170261	genome.wustl.edu	37	X	117959931	117959931	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chrX:117959931G>A	ENST00000310164.2	+	4	1231	c.724G>A	c.(724-726)Gca>Aca	p.A242T		NM_173798.2	NP_776159.1	Q6PEW1	ZCH12_HUMAN	zinc finger, CCHC domain containing 12	242					BMP signaling pathway (GO:0030509)|transcription, DNA-templated (GO:0006351)	nuclear speck (GO:0016607)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			breast(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)|prostate(2)	22						GGTGGAGAGGGCAGTCAGCCC	0.493																																																	0													66.0	56.0	59.0					X																	117959931		2203	4300	6503	SO:0001583	missense	170261			AK122676	CCDS14574.1	Xq24	2013-10-11			ENSG00000174460	ENSG00000174460		"""Zinc fingers, CCHC domain containing"", ""Paraneoplastic Ma antigens"""	27273	protein-coding gene	gene with protein product	"""paraneoplastic Ma antigen family member 7A"""	300701				21739307, 19578717	Standard	NM_173798		Approved	FLJ16123, SIZN, SIZN1, PNMA7A	uc004equ.3	Q6PEW1	OTTHUMG00000022261	ENST00000310164.2:c.724G>A	X.37:g.117959931G>A	ENSP00000308921:p.Ala242Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KV48|Q6PID5|Q8N1C1	Missense_Mutation	SNP	superfamily_Znf_CCHC	p.A242T	ENST00000310164.2	37	c.724	CCDS14574.1	X	.	.	.	.	.	.	.	.	.	.	G	12.41	1.930697	0.34096	.	.	ENSG00000174460	ENST00000310164	T	0.52057	0.68	3.1	3.1	0.35709	.	.	.	.	.	T	0.65502	0.2697	M	0.79123	2.44	0.30221	N	0.796831	D	0.89917	1.0	D	0.87578	0.998	T	0.61033	-0.7144	9	0.49607	T	0.09	-3.6395	8.8131	0.34978	0.0:0.0:1.0:0.0	.	242	Q6PEW1	ZCH12_HUMAN	T	242	ENSP00000308921:A242T	ENSP00000308921:A242T	A	+	1	0	ZCCHC12	117843959	1.000000	0.71417	0.982000	0.44146	0.114000	0.19823	3.765000	0.55272	1.807000	0.52817	0.600000	0.82982	GCA	ZCCHC12	-	NULL		0.493	ZCCHC12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCCHC12	HGNC	protein_coding	OTTHUMT00000058014.1	G	NM_173798		117959931	+1	no_errors	ENST00000310164	ensembl	human	known	70_37	missense	SNP	0.972	A
ZCCHC17	51538	genome.wustl.edu	37	1	31836882	31836882	+	Nonsense_Mutation	SNP	A	A	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr1:31836882A>T	ENST00000373714.1	+	8	829	c.568A>T	c.(568-570)Aag>Tag	p.K190*	ZCCHC17_ENST00000422613.2_Nonsense_Mutation_p.K192*|FABP3_ENST00000497275.1_5'Flank|ZCCHC17_ENST00000546109.1_Nonsense_Mutation_p.K182*|ZCCHC17_ENST00000344147.5_Nonsense_Mutation_p.K190*	NM_001282568.1|NM_001282570.1	NP_001269497.1|NP_001269499.1	Q9NP64	NO40_HUMAN	zinc finger, CCHC domain containing 17	190	Lys-rich.					cytosolic large ribosomal subunit (GO:0022625)|nucleolus (GO:0005730)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(2)|ovary(1)|skin(1)	6		Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.127)|all_neural(195;0.146)|Medulloblastoma(700;0.151)|Breast(348;0.222)		STAD - Stomach adenocarcinoma(196;0.0215)|READ - Rectum adenocarcinoma(331;0.168)		TTTTCAGGAGAAGAAGAAAAA	0.393																																																	0													53.0	57.0	56.0					1																	31836882		2203	4300	6503	SO:0001587	stop_gained	51538			AF151085	CCDS341.1, CCDS60061.1, CCDS72741.1, CCDS72742.1, CCDS72743.1, CCDS72744.1	1p35.2	2008-05-02			ENSG00000121766	ENSG00000121766		"""Zinc fingers, CCHC domain containing"""	30246	protein-coding gene	gene with protein product						12202495, 12893261	Standard	NM_001282572		Approved	PS1D, HSPC251, pNO40	uc001bsp.1	Q9NP64	OTTHUMG00000003791	ENST00000373714.1:c.568A>T	1.37:g.31836882A>T	ENSP00000362819:p.Lys190*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DY38|D3DPN4|Q6PKH4|Q9NYG4|Q9P0M8	Nonsense_Mutation	SNP	pfam_Rbsml_prot_S1_RNA-bd_dom,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,pfscan_Rbsml_prot_S1_RNA-bd_dom	p.K192*	ENST00000373714.1	37	c.574	CCDS341.1	1	.	.	.	.	.	.	.	.	.	.	A	23.9	4.472891	0.84640	.	.	ENSG00000121766	ENST00000344147;ENST00000373714;ENST00000546109;ENST00000422613	.	.	.	5.64	4.52	0.55395	.	0.091246	0.85682	D	0.000000	.	.	.	.	.	.	0.44012	D	0.996722	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.2352	0.37461	0.9188:0.0:0.0812:0.0	.	.	.	.	X	190;190;182;192	.	ENSP00000343557:K190X	K	+	1	0	ZCCHC17	31609469	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.189000	0.65098	1.160000	0.42584	0.528000	0.53228	AAG	ZCCHC17	-	NULL		0.393	ZCCHC17-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ZCCHC17	HGNC	protein_coding	OTTHUMT00000010665.1	A	NM_016505		31836882	+1	no_errors	ENST00000422613	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ZER1	10444	genome.wustl.edu	37	9	131497626	131497626	+	Silent	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr9:131497626G>A	ENST00000291900.2	-	14	2533	c.2127C>T	c.(2125-2127)ctC>ctT	p.L709L	RP11-545E17.3_ENST00000443631.1_RNA	NM_006336.2	NP_006327.2	Q7Z7L7	ZER1_HUMAN	zyg-11 related, cell cycle regulator	709					protein ubiquitination (GO:0016567)|regulation of ubiquitin-protein transferase activity (GO:0051438)	Cul2-RING ubiquitin ligase complex (GO:0031462)	ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|kidney(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|urinary_tract(1)	15						AGACAGACACGAGGTTATACA	0.547																																																	0													83.0	71.0	75.0					9																	131497626		2203	4300	6503	SO:0001819	synonymous_variant	10444			X99802	CCDS6910.1	9q33.3	2013-01-17	2012-12-10	2007-01-04	ENSG00000160445	ENSG00000160445		"""ZYG11 cell cycle regulator family"""	30960	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 60"", ""zyg-11 homolog B (C. elegans)-like"", ""zer-1 homolog (C. elegans)"""	C9orf60, ZYG11BL		11719588	Standard	NM_006336		Approved	ZYG, Hzyg	uc004bwa.2	Q7Z7L7	OTTHUMG00000020759	ENST00000291900.2:c.2127C>T	9.37:g.131497626G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O00156|Q5T272|Q5T273	Silent	SNP	superfamily_ARM-type_fold,smart_Armadillo	p.L709	ENST00000291900.2	37	c.2127	CCDS6910.1	9																																																																																			ZER1	-	superfamily_ARM-type_fold		0.547	ZER1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZER1	HGNC	protein_coding	OTTHUMT00000054491.1	G	NM_006336		131497626	-1	no_errors	ENST00000291900	ensembl	human	known	70_37	silent	SNP	1.000	A
MOG	4340	genome.wustl.edu	37	6	29641066	29641066	+	IGR	SNP	G	G	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr6:29641066G>A	ENST00000376917.3	+	0	2160				ZFP57_ENST00000488757.1_Silent_p.L274L|ZFP57_ENST00000376881.3_Silent_p.L254L|ZFP57_ENST00000376883.1_Silent_p.L254L	NM_002433.4|NM_206809.3	NP_002424.3|NP_996532.2	Q16653	MOG_HUMAN	myelin oligodendrocyte glycoprotein						cell adhesion (GO:0007155)|central nervous system development (GO:0007417)|positive regulation of MyD88-dependent toll-like receptor signaling pathway (GO:0034126)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)|lung(8)|ovary(1)|skin(2)	19						GGTGGCGTTTGAGCTCAGACT	0.557																																																	0													131.0	142.0	138.0					6																	29641066		1314	2572	3886	SO:0001628	intergenic_variant	346171				CCDS4667.1, CCDS34366.1, CCDS34367.1, CCDS34368.1, CCDS34369.1, CCDS34370.1, CCDS47394.1, CCDS47395.1, CCDS47395.2, CCDS54977.1	6p22.1	2014-01-16			ENSG00000204655	ENSG00000204655		"""Immunoglobulin superfamily / V-set domain containing"", ""Butyrophilins"""	7197	protein-coding gene	gene with protein product		159465					Standard	NM_002433		Approved	BTN6, BTNL11	uc003nne.3	Q16653	OTTHUMG00000031099		6.37:g.29641066G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDR4|A6NNJ9|A8MY31|B0UZR9|E9PGF0|F8W9D5|O00713|O00714|O00715|Q13054|Q13055|Q14855|Q29ZN8|Q56UY0|Q5JNX7|Q5JNY1|Q5JNY2|Q5JNY4|Q5SSB5|Q5SSB6|Q5STL9|Q5STM0|Q5STM1|Q5STM2|Q5STM5|Q5SUK5|Q5SUK7|Q5SUK8|Q5SUK9|Q5SUL0|Q5SUL1|Q8IYG5|Q92891|Q92892|Q92893|Q92894|Q92895|Q93053|Q96KU9|Q96KV0|Q96KV1|Q99605	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L274	ENST00000376917.3	37	c.822	CCDS34370.1	6																																																																																			ZFP57	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.557	MOG-001	KNOWN	basic|CCDS	protein_coding	ZFP57	HGNC	protein_coding	OTTHUMT00000076160.3	G	NM_002433		29641066	-1	no_errors	ENST00000488757	ensembl	human	known	70_37	silent	SNP	0.373	A
ZNF519	162655	genome.wustl.edu	37	18	14105758	14105758	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr18:14105758C>T	ENST00000590202.1	-	3	933	c.781G>A	c.(781-783)Gga>Aga	p.G261R	RP11-411B10.3_ENST00000592926.1_RNA|ZNF519_ENST00000589498.1_Intron|ZNF519_ENST00000589203.1_Intron	NM_145287.3	NP_660330.2	Q8TB69	ZN519_HUMAN	zinc finger protein 519	261					negative regulation of transcription during meiosis (GO:0051038)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(9)|urinary_tract(1)	18						GATTTTTCTCCAGTGTTAATT	0.323																																																	0													44.0	49.0	47.0					18																	14105758		2202	4300	6502	SO:0001583	missense	162655			BC024227	CCDS32797.1	18p11.21	2014-06-18			ENSG00000175322	ENSG00000175322		"""Zinc fingers, C2H2-type"", ""-"""	30574	protein-coding gene	gene with protein product	"""similar to Zinc finger protein 85 (Zinc finger protein HPF4) (HTF1)"""					12477932	Standard	NM_145287		Approved	HsT2362, FLJ36809	uc002kst.2	Q8TB69	OTTHUMG00000182055	ENST00000590202.1:c.781G>A	18.37:g.14105758C>T	ENSP00000464872:p.Gly261Arg	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G261R	ENST00000590202.1	37	c.781	CCDS32797.1	18	.	.	.	.	.	.	.	.	.	.	C	9.980	1.227974	0.22542	.	.	ENSG00000175322	ENST00000309305	.	.	.	0.646	0.646	0.17789	.	.	.	.	.	T	0.35248	0.0925	L	0.42686	1.345	0.25427	N	0.988216	D	0.55800	0.973	P	0.49799	0.622	T	0.18053	-1.0349	8	0.56958	D	0.05	.	7.2226	0.25997	0.0:0.9999:0.0:1.0E-4	.	261	Q8TB69	ZN519_HUMAN	R	261	.	ENSP00000307908:G261R	G	-	1	0	ZNF519	14095758	0.018000	0.18449	0.004000	0.12327	0.279000	0.26890	2.803000	0.47924	0.661000	0.30985	0.089000	0.15464	GGA	ZNF519	-	NULL		0.323	ZNF519-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF519	HGNC	protein_coding	OTTHUMT00000459037.1	C	NM_145287		14105758	-1	no_errors	ENST00000590202	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF99	7652	genome.wustl.edu	37	19	22939472	22939472	+	IGR	SNP	A	A	G	rs55891931		TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:22939472A>G	ENST00000596209.1	-	0	2686				CTC-451A6.4_ENST00000442497.2_lincRNA|ZNF99_ENST00000397104.3_Missense_Mutation_p.F900S	NM_001080409.2	NP_001073878.2	A8MXY4	ZNF99_HUMAN	zinc finger protein 99						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(20)|lung(55)|ovary(2)|prostate(10)|skin(5)|stomach(9)|upper_aerodigestive_tract(2)|urinary_tract(3)	124		Lung NSC(12;0.0207)|all_lung(12;0.0214)|all_epithelial(12;0.102)				AAGGGTCGAGAAATTGTTAAA	0.353																																																	0													40.0	53.0	49.0					19																	22939472		1825	4165	5990	SO:0001628	intergenic_variant	7652			BC021822	CCDS59369.1	19p12	2013-01-08	2006-01-17		ENSG00000213973	ENSG00000213973		"""Zinc fingers, C2H2-type"", ""-"""	13175	protein-coding gene	gene with protein product		603981	"""zinc finger protein 99 (F8281)"", ""chromosome 19 open reading frame 9"""	C19orf9			Standard	NM_001080409		Approved	MGC24986	uc021urt.1	A8MXY4			19.37:g.22939472A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	M0R335	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F900S	ENST00000596209.1	37	c.2699	CCDS59369.1	19	.	.	.	.	.	.	.	.	.	.	N	0.001	-2.974208	0.00047	.	.	ENSG00000213973	ENST00000397104	T	0.36157	1.27	0.503	-1.01	0.10169	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.14657	0.0354	.	.	.	0.09310	N	1	B	0.13145	0.007	B	0.11329	0.006	T	0.25676	-1.0125	7	0.12766	T	0.61	.	.	.	.	rs55891931	900	A8MXY4	ZNF99_HUMAN	S	900	ENSP00000380293:F900S	ENSP00000380293:F900S	F	-	2	0	ZNF99	22731312	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-6.020000	0.00085	-2.544000	0.00483	-1.973000	0.00462	TTC	ZNF99	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.353	ZNF99-001	NOVEL	not_best_in_genome_evidence|basic|CCDS	protein_coding	ZNF99	HGNC	protein_coding	OTTHUMT00000464591.1	A	XM_065124		22939472	-1	no_errors	ENST00000397104	ensembl	human	known	70_37	missense	SNP	0.000	G
ZNF808	388558	genome.wustl.edu	37	19	53059187	53059187	+	3'UTR	SNP	G	G	C	rs563832469	byFrequency	TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr19:53059187G>C	ENST00000359798.4	+	0	3198				ZNF701_ENST00000478039.1_3'UTR	NM_001039886.3	NP_001034975.2	Q8N4W9	ZN808_HUMAN	zinc finger protein 808						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(8)|kidney(3)|lung(12)|urinary_tract(1)	24				OV - Ovarian serous cystadenocarcinoma(262;0.00501)|GBM - Glioblastoma multiforme(134;0.0213)		GGACATCAGAGAATCCATACT	0.423																																																	0																																										SO:0001624	3_prime_UTR_variant	55762			CR749856	CCDS46167.1	19q13.41	2013-01-08			ENSG00000198482	ENSG00000198482		"""Zinc fingers, C2H2-type"", ""-"""	33230	protein-coding gene	gene with protein product							Standard	NM_001039886		Approved		uc010epq.1	Q8N4W9	OTTHUMG00000158230	ENST00000359798.4:c.*306G>C	19.37:g.53059187G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CN7	RNA	SNP	-	NULL	ENST00000359798.4	37	NULL	CCDS46167.1	19																																																																																			ZNF701	-	-		0.423	ZNF808-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF701	HGNC	protein_coding	OTTHUMT00000350447.3	G	NM_001039886		53059187	+1	no_errors	ENST00000478039	ensembl	human	known	70_37	rna	SNP	0.942	C
ZSCAN12	9753	genome.wustl.edu	37	6	28358451	28358451	+	Missense_Mutation	SNP	C	C	A			TCGA-C5-A7CK-01A-11D-A32I-09	TCGA-C5-A7CK-10A-01D-A32I-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	7934ac64-f6c7-4305-b8e3-2443a39b55e7	a5ad3742-8d09-4cba-a882-37abf734f166	g.chr6:28358451C>A	ENST00000361028.1	-	4	1761	c.1616G>T	c.(1615-1617)aGc>aTc	p.S539I	ZSCAN12_ENST00000396827.3_Missense_Mutation_p.S539I			O43309	ZSC12_HUMAN	zinc finger and SCAN domain containing 12	539					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|endometrium(3)|urinary_tract(1)	6						CTGAATGAGGCTGGTGATTCC	0.488																																																	0													163.0	140.0	147.0					6																	28358451		692	1591	2283	SO:0001583	missense	9753			AB007886		6p21	2013-01-08	2007-02-20	2007-02-20	ENSG00000158691	ENSG00000158691		"""-"", ""Zinc fingers, C2H2-type"""	13172	protein-coding gene	gene with protein product		603978	"""zinc finger protein 305"", ""zinc finger protein 96"""	ZNF305, ZNF96		9244436	Standard	NM_001163391		Approved	KIAA0426, ZNF29K1, ZFP96, dJ29K1.2	uc011dlh.2	O43309	OTTHUMG00000014522	ENST00000361028.1:c.1616G>T	6.37:g.28358451C>A	ENSP00000354305:p.Ser539Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O43724	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Tscrpt_reg_SCAN,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.S539I	ENST00000361028.1	37	c.1616		6	.	.	.	.	.	.	.	.	.	.	C	12.83	2.054335	0.36277	.	.	ENSG00000158691	ENST00000361028;ENST00000396827	T;T	0.15952	2.38;2.38	3.15	2.19	0.27852	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.10035	0.0246	N	0.21508	0.67	0.09310	N	1	D;B	0.67145	0.996;0.267	D;B	0.63488	0.915;0.176	T	0.17228	-1.0376	9	0.62326	D	0.03	.	3.3262	0.07067	0.0:0.5258:0.2351:0.2391	.	539;539	A8K187;O43309	.;ZSC12_HUMAN	I	539	ENSP00000354305:S539I;ENSP00000380039:S539I	ENSP00000354305:S539I	S	-	2	0	ZSCAN12	28466430	0.000000	0.05858	0.999000	0.59377	0.997000	0.91878	-0.677000	0.05215	1.585000	0.49928	0.650000	0.86243	AGC	ZSCAN12	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.488	ZSCAN12-001	KNOWN	basic|appris_principal	protein_coding	ZSCAN12	HGNC	protein_coding	OTTHUMT00000040190.1	C	NM_014724		28358451	-1	no_errors	ENST00000361028	ensembl	human	known	70_37	missense	SNP	0.065	A
