#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AGBL5	60509	genome.wustl.edu	37	2	27278881	27278881	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:27278881G>C	ENST00000360131.4	+	7	1399	c.1240G>C	c.(1240-1242)Gag>Cag	p.E414Q	RP11-503P10.1_ENST00000607407.1_RNA|AGBL5_ENST00000323064.8_Missense_Mutation_p.E414Q	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	414					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGGGCTTGAAGAGTCAGCCCC	0.522																																																	0													168.0	168.0	168.0					2																	27278881		2203	4300	6503	SO:0001583	missense	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.1240G>C	2.37:g.27278881G>C	ENSP00000353249:p.Glu414Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Missense_Mutation	SNP	pfam_Peptidase_M14	p.E414Q	ENST00000360131.4	37	c.1240	CCDS1732.3	2	.	.	.	.	.	.	.	.	.	.	G	5.988	0.366309	0.11352	.	.	ENSG00000084693	ENST00000323064;ENST00000360131	T;T	0.37058	1.22;1.22	5.88	3.06	0.35304	.	1.028630	0.07622	N	0.927130	T	0.31544	0.0800	L	0.46157	1.445	0.19300	N	0.999978	B;B;B	0.06786	0.001;0.0;0.0	B;B;B	0.12156	0.007;0.001;0.004	T	0.35151	-0.9800	10	0.13470	T	0.59	-4.6663	9.8923	0.41298	0.0:0.3822:0.4984:0.1195	.	414;414;414	Q8NDL9;Q8NDL9-3;Q8NDL9-2	CBPC5_HUMAN;.;.	Q	414	ENSP00000323681:E414Q;ENSP00000353249:E414Q	ENSP00000323681:E414Q	E	+	1	0	AGBL5	27132385	0.115000	0.22152	0.418000	0.26571	0.102000	0.19082	1.952000	0.40343	0.373000	0.24621	0.491000	0.48974	GAG	AGBL5	-	NULL		0.522	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	G	NM_021831		27278881	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	missense	SNP	0.429	C
ANKRD20A5P	440482	genome.wustl.edu	37	18	14179188	14179188	+	RNA	SNP	T	T	C	rs569096068	byFrequency	TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr18:14179188T>C	ENST00000581935.1	+	0	93							A0PJZ0	A20A5_HUMAN	ankyrin repeat domain 20 family, member A5, pseudogene											lung(3)	3						TGTGGTGGACTGGGCTGGATC	0.607													N|||	2	0.000399361	0.0	0.0	5008	,	,		10966	0.001		0.001	False		,,,				2504	0.0																0																																												440482			BC022023		18p11.21	2011-06-01	2011-06-01	2011-06-01	ENSG00000186481	ENSG00000186481			33833	pseudogene	pseudogene			"""ankyrin repeat domain 20 family, member A5"""	ANKRD20A5			Standard	NR_040113		Approved	MGC26718	uc010xag.2	A0PJZ0	OTTHUMG00000157172		18.37:g.14179188T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G1B6	RNA	SNP	-	NULL	ENST00000581935.1	37	NULL		18																																																																																			ANKRD20A5P	-	-		0.607	ANKRD20A5P-002	KNOWN	basic	processed_transcript	ANKRD20A5P	HGNC	pseudogene	OTTHUMT00000442833.1	T			14179188	+1	no_errors	ENST00000581181	ensembl	human	known	70_37	rna	SNP	0.115	C
APBB1IP	54518	genome.wustl.edu	37	10	26800778	26800778	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr10:26800778C>G	ENST00000376236.4	+	7	1089	c.634C>G	c.(634-636)Cat>Gat	p.H212D	RNA5SP307_ENST00000362863.1_RNA	NM_019043.3	NP_061916.3	Q7Z5R6	AB1IP_HUMAN	amyloid beta (A4) precursor protein-binding, family B, member 1 interacting protein	212	Ras-associating. {ECO:0000255|PROSITE- ProRule:PRU00166}.				blood coagulation (GO:0007596)|platelet activation (GO:0030168)|signal transduction (GO:0007165)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|plasma membrane (GO:0005886)				central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(27)|skin(7)|upper_aerodigestive_tract(1)	45						CGAGAAAACTCATTGTGACTG	0.473																																																	0													160.0	150.0	153.0					10																	26800778		2203	4300	6503	SO:0001583	missense	54518			AB085852	CCDS31167.1	10p12.1	2013-01-10			ENSG00000077420	ENSG00000077420		"""Pleckstrin homology (PH) domain containing"""	17379	protein-coding gene	gene with protein product	"""Rap1-GTP-interacting adaptor molecule"""	609036				9407065	Standard	NM_019043		Approved	INAG1, RIAM	uc001iss.3	Q7Z5R6	OTTHUMG00000017841	ENST00000376236.4:c.634C>G	10.37:g.26800778C>G	ENSP00000365411:p.His212Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWS8|Q8IYL7|Q8IZZ7	Missense_Mutation	SNP	pfam_Ras-assoc,pfam_Pleckstrin_homology,smart_Ras-assoc,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Ras-assoc	p.H212D	ENST00000376236.4	37	c.634	CCDS31167.1	10	.	.	.	.	.	.	.	.	.	.	C	27.3	4.820050	0.90873	.	.	ENSG00000077420	ENST00000445780;ENST00000376236	T	0.75367	-0.93	5.65	5.65	0.86999	Ras-association (3);	0.000000	0.85682	D	0.000000	D	0.87625	0.6224	M	0.82132	2.575	0.80722	D	1	P;D	0.89917	0.774;1.0	P;D	0.91635	0.809;0.999	D	0.88244	0.2912	10	0.66056	D	0.02	.	19.717	0.96124	0.0:1.0:0.0:0.0	.	212;212	B4E100;Q7Z5R6	.;AB1IP_HUMAN	D	212	ENSP00000365411:H212D	ENSP00000365411:H212D	H	+	1	0	APBB1IP	26840784	1.000000	0.71417	0.998000	0.56505	0.990000	0.78478	7.471000	0.80985	2.661000	0.90470	0.655000	0.94253	CAT	APBB1IP	-	pfam_Ras-assoc,smart_Ras-assoc,pfscan_Ras-assoc		0.473	APBB1IP-003	KNOWN	basic|appris_principal|CCDS	protein_coding	APBB1IP	HGNC	protein_coding	OTTHUMT00000047270.1	C	NM_019043		26800778	+1	no_errors	ENST00000376236	ensembl	human	known	70_37	missense	SNP	1.000	G
ARPC1A	10552	genome.wustl.edu	37	7	98951669	98951669	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:98951669C>G	ENST00000262942.5	+	6	762	c.638C>G	c.(637-639)tCt>tGt	p.S213C	ARPC1A_ENST00000471960.1_3'UTR|ARPC1A_ENST00000432884.2_Missense_Mutation_p.S166C	NM_001190996.1|NM_006409.3	NP_001177925.1|NP_006400.2	Q92747	ARC1A_HUMAN	actin related protein 2/3 complex, subunit 1A, 41kDa	213					actin cytoskeleton organization (GO:0030036)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of actin filament polymerization (GO:0030833)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	actin binding (GO:0003779)			endometrium(3)|large_intestine(5)|liver(2)|lung(7)|ovary(1)|prostate(1)	19	all_cancers(62;4.46e-09)|all_epithelial(64;3.44e-10)|Lung NSC(181;0.0053)|all_lung(186;0.00895)|Esophageal squamous(72;0.0258)		STAD - Stomach adenocarcinoma(171;0.215)			GTAAGCTTCTCTGCCAGTGGG	0.587																																																	0													60.0	63.0	62.0					7																	98951669		2203	4300	6503	SO:0001583	missense	10552			Y08999	CCDS5660.1	7q22.1	2013-03-14	2002-08-29		ENSG00000241685	ENSG00000241685		"""Actin related protein 2/3 complex subunits"", ""WD repeat domain containing"""	703	protein-coding gene	gene with protein product	"""actin binding protein (Schizosaccharomyces pombe sop2-like)"", ""SOP2-like protein"""	604220	"""actin related protein 2/3 complex, subunit 1A (41 kD)"""			8978670, 9230079	Standard	NM_006409		Approved	SOP2Hs, SOP2L, Arc40	uc003upx.2	Q92747	OTTHUMG00000154553	ENST00000262942.5:c.638C>G	7.37:g.98951669C>G	ENSP00000262942:p.Ser213Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D276|B4DLQ7|D6W5S1|Q7Z5U8|Q86WU5|Q8IXQ0	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S213C	ENST00000262942.5	37	c.638	CCDS5660.1	7	.	.	.	.	.	.	.	.	.	.	c	26.5	4.746641	0.89663	.	.	ENSG00000241685	ENST00000432884;ENST00000262942	T;T	0.72725	-0.68;-0.68	5.05	5.05	0.67936	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	D	0.87877	0.6288	M	0.91612	3.225	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.90572	0.4523	10	0.87932	D	0	.	18.7488	0.91806	0.0:1.0:0.0:0.0	.	208;213	Q53GB6;Q92747	.;ARC1A_HUMAN	C	166;213	ENSP00000408578:S166C;ENSP00000262942:S213C	ENSP00000262942:S213C	S	+	2	0	ARPC1A	98789605	1.000000	0.71417	0.994000	0.49952	0.991000	0.79684	7.779000	0.85648	2.516000	0.84829	0.555000	0.69702	TCT	ARPC1A	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_ARPC2/3_su1		0.587	ARPC1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARPC1A	HGNC	protein_coding	OTTHUMT00000335908.1	C	NM_006409		98951669	+1	no_errors	ENST00000262942	ensembl	human	known	70_37	missense	SNP	1.000	G
B4GALNT1	2583	genome.wustl.edu	37	12	58020692	58020692	+	Silent	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:58020692G>A	ENST00000341156.4	-	11	2021	c.1437C>T	c.(1435-1437)gtC>gtT	p.V479V	B4GALNT1_ENST00000418555.2_Silent_p.V424V	NM_001478.3	NP_001469.1	Q00973	B4GN1_HUMAN	beta-1,4-N-acetyl-galactosaminyl transferase 1	479					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|ganglioside biosynthetic process (GO:0001574)|glycosphingolipid metabolic process (GO:0006687)|lipid glycosylation (GO:0030259)|lipid storage (GO:0019915)|protein glycosylation (GO:0006486)|spermatogenesis (GO:0007283)	integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)|plasma membrane (GO:0005886)	(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase activity (GO:0003947)			breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(4)|lung(6)|prostate(1)|stomach(1)|urinary_tract(1)	20	Melanoma(17;0.122)		BRCA - Breast invasive adenocarcinoma(9;0.109)			GATCCACCACGACGTCGGAGC	0.577																																																	0													83.0	65.0	71.0					12																	58020692		2203	4300	6503	SO:0001819	synonymous_variant	2583			M83651	CCDS8950.1, CCDS61170.1, CCDS61171.1	12q13.3	2013-09-11	2006-01-08	2006-01-08	ENSG00000135454	ENSG00000135454	2.4.1.92	"""Beta 4-glycosyltransferases"", ""Glycosyltransferase family 2 domain containing"""	4117	protein-coding gene	gene with protein product	"""GD2 synthase, GM2 synthase"""	601873	"""UDP-N-acetyl-alpha-D-galactosamine:(N-acetylneuraminyl)-galactosylglucosylceramide N-acetylgalactosaminyltransferase (GalNAc-T)"", ""UDP-Gal:betaGlcNAc beta-1,4-N-acetylgalactosaminyltransferase transferase 1"", ""spastic paraplegia 26"""	GALGT, SPG26		1601877, 23746551	Standard	NM_001478		Approved	beta1-4GalNAc-T	uc001spg.2	Q00973	OTTHUMG00000170190	ENST00000341156.4:c.1437C>T	12.37:g.58020692G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DE26|Q8N636	Silent	SNP	pfam_Glyco_trans_2,pirsf_GM2_synthase	p.V479	ENST00000341156.4	37	c.1437	CCDS8950.1	12																																																																																			B4GALNT1	-	pirsf_GM2_synthase		0.577	B4GALNT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	B4GALNT1	HGNC	protein_coding	OTTHUMT00000407853.1	G	NM_001478		58020692	-1	no_errors	ENST00000341156	ensembl	human	known	70_37	silent	SNP	0.025	A
BAZ1B	9031	genome.wustl.edu	37	7	72907165	72907165	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:72907165G>C	ENST00000339594.4	-	5	996	c.658C>G	c.(658-660)Cac>Gac	p.H220D	BAZ1B_ENST00000404251.1_Missense_Mutation_p.H220D	NM_032408.3	NP_115784.1	Q9UIG0	BAZ1B_HUMAN	bromodomain adjacent to zinc finger domain, 1B	220	Mediates the tyrosine-protein kinase activity.				cellular response to DNA damage stimulus (GO:0006974)|chromatin assembly or disassembly (GO:0006333)|chromatin-mediated maintenance of transcription (GO:0048096)|double-strand break repair (GO:0006302)|heart morphogenesis (GO:0003007)|histone phosphorylation (GO:0016572)|peptidyl-tyrosine phosphorylation (GO:0018108)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed chromosome (GO:0000793)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|histone kinase activity (GO:0035173)|lysine-acetylated histone binding (GO:0070577)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)|vitamin D receptor activator activity (GO:0071884)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|cervix(1)|endometrium(5)|kidney(5)|large_intestine(12)|lung(20)|ovary(5)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	61		Lung NSC(55;0.0659)|all_lung(88;0.152)				TCATATTTGTGAGGCAGAAAT	0.343																																					Esophageal Squamous(112;1167 1561 21085 43672 48228)												0													122.0	118.0	120.0					7																	72907165		2203	4300	6503	SO:0001583	missense	9031			AF084479	CCDS5549.1	7q11.23	2013-01-28			ENSG00000009954	ENSG00000009954		"""Zinc fingers, PHD-type"""	961	protein-coding gene	gene with protein product	"""Williams-Beuren syndrome chromosome region 9"", ""Williams-Beuren syndrome chromosome region 10"", ""transcription factor WSTF"""	605681		WBSCR9, WBSCR10		9858827, 9828126	Standard	NM_032408		Approved	WSTF	uc003tyc.3	Q9UIG0	OTTHUMG00000023847	ENST00000339594.4:c.658C>G	7.37:g.72907165G>C	ENSP00000342434:p.His220Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGK3|D3DXE9|O95039|O95247|O95277|Q6P1K4|Q86UJ6	Missense_Mutation	SNP	pfam_WSTF_Acf1_Cbp146,pfam_Bromodomain,pfam_Znf_PHD-finger,superfamily_Bromodomain,superfamily_Znf_FYVE_PHD,superfamily_ARM-type_fold,smart_DDT_dom_subgr,smart_Znf_PHD,smart_Bromodomain,pfscan_WSTF_Acf1_Cbp146,pfscan_Znf_PHD-finger,pfscan_Znf_RING,pfscan_DDT_dom_superfamily,pfscan_Bromodomain,prints_Bromodomain	p.H220D	ENST00000339594.4	37	c.658	CCDS5549.1	7	.	.	.	.	.	.	.	.	.	.	G	21.7	4.193771	0.78902	.	.	ENSG00000009954	ENST00000339594;ENST00000404251	T;T	0.58506	0.33;0.33	5.71	5.71	0.89125	.	0.053789	0.64402	D	0.000001	T	0.50667	0.1629	L	0.29908	0.895	0.58432	D	0.999995	P	0.48764	0.915	B	0.42062	0.374	T	0.55780	-0.8087	10	0.59425	D	0.04	-16.6076	18.8345	0.92155	0.0:0.0:1.0:0.0	.	220	Q9UIG0	BAZ1B_HUMAN	D	220	ENSP00000342434:H220D;ENSP00000385442:H220D	ENSP00000342434:H220D	H	-	1	0	BAZ1B	72545101	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.952000	0.75989	2.690000	0.91761	0.585000	0.79938	CAC	BAZ1B	-	NULL		0.343	BAZ1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAZ1B	HGNC	protein_coding	OTTHUMT00000252123.4	G	NM_032408		72907165	-1	no_errors	ENST00000339594	ensembl	human	known	70_37	missense	SNP	1.000	C
BICD1	636	genome.wustl.edu	37	12	32520654	32520654	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:32520654G>A	ENST00000281474.5	+	9	2918	c.2815G>A	c.(2815-2817)Ggg>Agg	p.G939R	BICD1_ENST00000548411.1_3'UTR	NM_001714.2	NP_001705.2	Q96G01	BICD1_HUMAN	bicaudal D homolog 1 (Drosophila)	939					anatomical structure morphogenesis (GO:0009653)|intracellular mRNA localization (GO:0008298)|microtubule anchoring at microtubule organizing center (GO:0072393)|minus-end-directed organelle transport along microtubule (GO:0072385)|negative regulation of phospholipase C activity (GO:1900275)|negative regulation of phospholipase C-activating G-protein coupled receptor signaling pathway (GO:1900737)|positive regulation of receptor-mediated endocytosis (GO:0048260)|protein localization to organelle (GO:0033365)|regulation of proteinase activated receptor activity (GO:1900276)|RNA processing (GO:0006396)|stress granule assembly (GO:0034063)|viral process (GO:0016032)	cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|host cell viral assembly compartment (GO:0072517)|membrane (GO:0016020)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	cytoskeletal adaptor activity (GO:0008093)|dynactin binding (GO:0034452)|dynein binding (GO:0045502)|proteinase activated receptor binding (GO:0031871)|Rab GTPase binding (GO:0017137)|structural constituent of cytoskeleton (GO:0005200)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(14)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	46	all_cancers(9;5.13e-11)|all_epithelial(9;2.71e-11)|all_lung(12;6.66e-10)|Acute lymphoblastic leukemia(23;0.0122)|Lung SC(12;0.0213)|all_hematologic(23;0.0429)|Esophageal squamous(101;0.204)		OV - Ovarian serous cystadenocarcinoma(6;0.0201)			ACAACTAGCCGGGAGGCAAGA	0.512																																																	0													119.0	103.0	108.0					12																	32520654		2203	4300	6503	SO:0001583	missense	636			U90028	CCDS8726.1, CCDS44859.1	12p11.2-p11.1	2005-01-13	2001-11-28			ENSG00000151746			1049	protein-coding gene	gene with protein product		602204	"""Bicaudal D (Drosophila) homolog 1"""			9367685	Standard	NM_001714		Approved		uc001rku.3	Q96G01	OTTHUMG00000169307	ENST00000281474.5:c.2815G>A	12.37:g.32520654G>A	ENSP00000281474:p.Gly939Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2C3|F8W113|O43892|O43893	Missense_Mutation	SNP	pfam_Bicaudal-D_microtubule-assoc,superfamily_SPOC-like	p.G939R	ENST00000281474.5	37	c.2815	CCDS8726.1	12	.	.	.	.	.	.	.	.	.	.	G	9.953	1.220719	0.22457	.	.	ENSG00000151746	ENST00000281474	T	0.39406	1.08	5.25	1.85	0.25348	.	0.305106	0.23807	N	0.044365	T	0.17023	0.0409	N	0.08118	0	0.80722	D	1	B	0.02656	0.0	B	0.01281	0.0	T	0.05801	-1.0863	10	0.13853	T	0.58	.	4.763	0.13116	0.2523:0.3348:0.4129:0.0	.	939	Q96G01	BICD1_HUMAN	R	939	ENSP00000281474:G939R	ENSP00000281474:G939R	G	+	1	0	BICD1	32411921	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	1.165000	0.31822	0.563000	0.29222	0.591000	0.81541	GGG	BICD1	-	NULL		0.512	BICD1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	BICD1	HGNC	protein_coding	OTTHUMT00000403380.1	G	NM_001714		32520654	+1	no_errors	ENST00000281474	ensembl	human	known	70_37	missense	SNP	1.000	A
BRS3	680	genome.wustl.edu	37	X	135574302	135574302	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chrX:135574302C>G	ENST00000370648.3	+	3	1196	c.968C>G	c.(967-969)tCt>tGt	p.S323C		NM_001727.1	NP_001718.1	P32247	BRS3_HUMAN	bombesin-like receptor 3	323					adult feeding behavior (GO:0008343)|glucose metabolic process (GO:0006006)|regulation of blood pressure (GO:0008217)	integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	bombesin receptor activity (GO:0004946)			endometrium(2)|kidney(1)|large_intestine(4)|lung(13)|ovary(1)|pancreas(1)|prostate(1)	23	Acute lymphoblastic leukemia(192;0.000127)					TTCAGCAATTCTTGCGTAAAC	0.468																																																	0													221.0	197.0	205.0					X																	135574302		2203	4300	6503	SO:0001583	missense	680				CCDS14656.1	Xq26.3	2014-02-21			ENSG00000102239	ENSG00000102239		"""GPCR / Class A : Bombesin receptors"""	1113	protein-coding gene	gene with protein product		300107				8383682	Standard	NM_001727		Approved	BB3	uc004ezv.1	P32247	OTTHUMG00000022726	ENST00000370648.3:c.968C>G	X.37:g.135574302C>G	ENSP00000359682:p.Ser323Cys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_Bombesin_rcpt_3,prints_Bombsn_rcpt,prints_GPCR_Rhodpsn,prints_NPY_rcpt	p.S323C	ENST00000370648.3	37	c.968	CCDS14656.1	X	.	.	.	.	.	.	.	.	.	.	C	22.1	4.246861	0.80024	.	.	ENSG00000102239	ENST00000370648	T	0.78003	-1.14	5.81	5.81	0.92471	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	D	0.91050	0.7184	M	0.91249	3.19	0.58432	D	0.999999	D	0.89917	1.0	D	0.97110	1.0	D	0.92676	0.6154	10	0.87932	D	0	-15.4372	19.0174	0.92900	0.0:1.0:0.0:0.0	.	323	P32247	BRS3_HUMAN	C	323	ENSP00000359682:S323C	ENSP00000359682:S323C	S	+	2	0	BRS3	135401968	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.487000	0.81328	2.439000	0.82584	0.600000	0.82982	TCT	BRS3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srv,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_NPY_rcpt		0.468	BRS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BRS3	HGNC	protein_coding	OTTHUMT00000059005.1	C	NM_001727		135574302	+1	no_errors	ENST00000370648	ensembl	human	known	70_37	missense	SNP	1.000	G
C3orf67	200844	genome.wustl.edu	37	3	58898469	58898469	+	Intron	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr3:58898469C>T	ENST00000482387.1	-	2	272				RP11-147N17.1_ENST00000493123.1_RNA|RP11-147N17.1_ENST00000463703.1_RNA|C3orf67_ENST00000295966.7_Intron|RP11-147N17.1_ENST00000482372.1_RNA|C3orf67_ENST00000472469.1_Intron|RP11-147N17.1_ENST00000492031.1_RNA			Q6ZVT6	CC067_HUMAN	chromosome 3 open reading frame 67											endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(3)|prostate(2)|skin(1)	19		all_cancers(2;0.000156)|all_epithelial(2;0.000493)|Breast(2;0.00446)|all_lung(2;0.074)|Lung NSC(2;0.248)		BRCA - Breast invasive adenocarcinoma(55;5.93e-06)|Kidney(10;0.00155)|KIRC - Kidney renal clear cell carcinoma(10;0.00172)|OV - Ovarian serous cystadenocarcinoma(275;0.23)		GCTGAGTTACCTGCAGAGTAT	0.323																																																	0																																										SO:0001627	intron_variant	200844			AK124920	CCDS33776.1	3p14.2	2011-01-25			ENSG00000163689	ENSG00000163689			24763	protein-coding gene	gene with protein product							Standard	NM_198463		Approved	FLJ42117, FLJ42930	uc003dkt.1	Q6ZVT6	OTTHUMG00000159151	ENST00000482387.1:c.175+964G>A	3.37:g.58898469C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EKV6|Q6ZV69	Splice_Site	SNP	-	e7-1	ENST00000482387.1	37	c.551-1		3																																																																																			C3orf67	-	-		0.323	C3orf67-003	KNOWN	basic	protein_coding	C3orf67	HGNC	protein_coding	OTTHUMT00000353803.1	C	NM_198463		58898469	-1	no_errors	ENST00000479931	ensembl	human	known	70_37	splice_site	SNP	0.017	T
CCDC64B	146439	genome.wustl.edu	37	16	3078714	3078714	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr16:3078714C>T	ENST00000572449.1	-	8	1287	c.1225G>A	c.(1225-1227)Gag>Aag	p.E409K	CCDC64B_ENST00000389347.4_Missense_Mutation_p.E409K|CCDC64B_ENST00000573514.1_Missense_Mutation_p.E202K			A1A5D9	BICR2_HUMAN	coiled-coil domain containing 64B	409										breast(1)|endometrium(2)|large_intestine(1)	4						TTCACGGCCTCGTCCCGGTCT	0.627																																																	0													37.0	50.0	46.0					16																	3078714		2012	4135	6147	SO:0001583	missense	146439			BC128602	CCDS45393.1	16p13.3	2008-07-04				ENSG00000162069			33584	protein-coding gene	gene with protein product							Standard	NM_001103175		Approved		uc002ctf.4	A1A5D9		ENST00000572449.1:c.1225G>A	16.37:g.3078714C>T	ENSP00000459043:p.Glu409Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q658L9	Missense_Mutation	SNP	superfamily_Sig_transdc_His_kinase_dimeric	p.E409K	ENST00000572449.1	37	c.1225	CCDS45393.1	16	.	.	.	.	.	.	.	.	.	.	C	12.16	1.855219	0.32791	.	.	ENSG00000162069	ENST00000389347	T	0.35605	1.3	4.81	2.8	0.32819	.	0.145050	0.43110	D	0.000606	T	0.34483	0.0899	M	0.70275	2.135	0.09310	N	1	P	0.43287	0.802	B	0.39027	0.288	T	0.25882	-1.0119	10	0.59425	D	0.04	-6.9416	8.0252	0.30434	0.0:0.7486:0.1612:0.0902	.	409	A1A5D9	BICR2_HUMAN	K	409	ENSP00000373998:E409K	ENSP00000373998:E409K	E	-	1	0	CCDC64B	3018715	0.263000	0.24083	0.002000	0.10522	0.812000	0.45895	0.729000	0.26028	0.434000	0.26340	0.561000	0.74099	GAG	CCDC64B	-	NULL		0.627	CCDC64B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC64B	HGNC	protein_coding	OTTHUMT00000436991.1	C			3078714	-1	no_errors	ENST00000389347	ensembl	human	known	70_37	missense	SNP	0.009	T
CD163	9332	genome.wustl.edu	37	12	7640251	7640251	+	Missense_Mutation	SNP	A	A	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:7640251A>C	ENST00000359156.4	-	8	1956	c.1754T>G	c.(1753-1755)tTg>tGg	p.L585W	CD163_ENST00000396620.3_Missense_Mutation_p.L618W|CD163_ENST00000432237.2_Missense_Mutation_p.L585W|CD163_ENST00000539632.1_5'Flank|CD163_ENST00000541972.1_Missense_Mutation_p.L573W	NM_004244.5	NP_004235.4	Q86VB7	C163A_HUMAN	CD163 molecule	585	SRCR 6. {ECO:0000255|PROSITE- ProRule:PRU00196}.				acute-phase response (GO:0006953)|receptor-mediated endocytosis (GO:0006898)	endocytic vesicle membrane (GO:0030666)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	scavenger receptor activity (GO:0005044)			breast(1)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(33)|ovary(6)|pancreas(2)|prostate(1)|skin(5)|urinary_tract(4)	76					WF10(DB05389)	GCCATTCACCAAGCGAATTTC	0.493																																																	0													72.0	73.0	72.0					12																	7640251		2203	4300	6503	SO:0001583	missense	9332			Z22968	CCDS8578.1, CCDS53742.1	12p13	2006-03-28	2006-03-28		ENSG00000177575	ENSG00000177575		"""CD molecules"""	1631	protein-coding gene	gene with protein product		605545	"""CD163 antigen"""			10403791, 8370408	Standard	NM_004244		Approved	M130, MM130	uc001qsz.3	Q86VB7	OTTHUMG00000168353	ENST00000359156.4:c.1754T>G	12.37:g.7640251A>C	ENSP00000352071:p.Leu585Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JIG2|Q07898|Q07899|Q07900|Q07901|Q2VLH7	Missense_Mutation	SNP	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt,prints_Srcr_rcpt	p.L585W	ENST00000359156.4	37	c.1754	CCDS8578.1	12	.	.	.	.	.	.	.	.	.	.	A	14.62	2.589521	0.46214	.	.	ENSG00000177575	ENST00000359156;ENST00000541972;ENST00000396620;ENST00000432237	T;T;T;T	0.61158	0.13;0.13;0.13;0.13	5.21	3.99	0.46301	Speract/scavenger receptor (1);Speract/scavenger receptor-related (2);	0.000000	0.56097	D	0.000022	D	0.82287	0.5004	H	0.97491	4.015	0.09310	N	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;0.991;1.0	T	0.75693	-0.3229	10	0.87932	D	0	.	10.1968	0.43060	0.8332:0.1668:0.0:0.0	.	618;585;585	C9JHR8;Q86VB7-3;Q86VB7	.;.;C163A_HUMAN	W	585;573;618;585	ENSP00000352071:L585W;ENSP00000444071:L573W;ENSP00000379863:L618W;ENSP00000403885:L585W	ENSP00000352071:L585W	L	-	2	0	CD163	7531518	0.981000	0.34729	0.985000	0.45067	0.695000	0.40330	7.281000	0.78621	2.094000	0.63399	0.533000	0.62120	TTG	CD163	-	superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt		0.493	CD163-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD163	HGNC	protein_coding	OTTHUMT00000399396.2	A	NM_004244, NM_203416		7640251	-1	no_errors	ENST00000359156	ensembl	human	known	70_37	missense	SNP	0.116	C
CDK17	5128	genome.wustl.edu	37	12	96717761	96717761	+	Missense_Mutation	SNP	G	G	C	rs376992444		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:96717761G>C	ENST00000261211.3	-	3	851	c.248C>G	c.(247-249)tCc>tGc	p.S83C	CDK17_ENST00000543119.2_Missense_Mutation_p.S83C|CDK17_ENST00000542666.1_Missense_Mutation_p.S30C	NM_001170464.2|NM_002595.4	NP_001163935.1|NP_002586.2	Q00537	CDK17_HUMAN	cyclin-dependent kinase 17	83					protein phosphorylation (GO:0006468)		ATP binding (GO:0005524)|cyclin-dependent protein serine/threonine kinase activity (GO:0004693)|protein kinase activity (GO:0004672)	p.S83F(1)		breast(1)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(6)|lung(11)|ovary(4)|prostate(2)|skin(1)	37						TGCCATGAAGGAGCCAAGGCT	0.443																																																	1	Substitution - Missense(1)	skin(1)						G	CYS/SER,CYS/SER	0,4406		0,0,2203	76.0	71.0	73.0		248,248	5.7	1.0	12		73	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	CDK17	NM_002595.4,NM_001170464.2	112,112	0,1,6502	CC,CG,GG		0.0116,0.0,0.0077	benign,benign	83/524,83/524	96717761	1,13005	2203	4300	6503	SO:0001583	missense	5128				CCDS9061.1, CCDS53819.1	12q23.1	2011-11-08	2009-12-16	2009-12-16		ENSG00000059758		"""Cyclin-dependent kinases"""	8750	protein-coding gene	gene with protein product		603440	"""PCTAIRE protein kinase 2"""	PCTK2		9370357, 19884882	Standard	NM_001170464		Approved	PCTAIRE2	uc009ztk.3	Q00537		ENST00000261211.3:c.248C>G	12.37:g.96717761G>C	ENSP00000261211:p.Ser83Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1U6|B2RCQ2|Q8NEB8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.S83C	ENST00000261211.3	37	c.248	CCDS9061.1	12	.	.	.	.	.	.	.	.	.	.	G	18.60	3.659234	0.67586	0.0	1.16E-4	ENSG00000059758	ENST00000261211;ENST00000543119;ENST00000542666;ENST00000551816;ENST00000552496;ENST00000548734;ENST00000552262	T;T;T;T;T;T	0.71222	-0.52;-0.53;-0.55;0.76;0.74;0.67	5.72	5.72	0.89469	.	0.000000	0.85682	D	0.000000	T	0.71031	0.3292	L	0.56769	1.78	0.80722	D	1	B;B	0.10296	0.003;0.0	B;B	0.13407	0.009;0.0	T	0.65928	-0.6049	10	0.59425	D	0.04	-8.7223	20.3236	0.98685	0.0:0.0:1.0:0.0	.	83;83	A8K1U6;Q00537	.;CDK17_HUMAN	C	83;83;30;83;83;103;83	ENSP00000261211:S83C;ENSP00000444459:S83C;ENSP00000442926:S30C;ENSP00000450058:S83C;ENSP00000447282:S83C;ENSP00000447441:S103C	ENSP00000261211:S83C	S	-	2	0	CDK17	95241892	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	9.327000	0.96396	2.876000	0.98609	0.644000	0.83932	TCC	CDK17	-	NULL		0.443	CDK17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDK17	HGNC	protein_coding	OTTHUMT00000408751.1	G	NM_002595		96717761	-1	no_errors	ENST00000261211	ensembl	human	known	70_37	missense	SNP	1.000	C
CNIH4	29097	genome.wustl.edu	37	1	224563706	224563706	+	3'UTR	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:224563706G>A	ENST00000465271.1	+	0	677				CNIH4_ENST00000468318.1_3'UTR|CNIH4_ENST00000366857.5_3'UTR|CNIH4_ENST00000366858.3_Intron|CNIH4_ENST00000366856.3_Intron	NM_014184.3	NP_054903.1	Q9P003	CNIH4_HUMAN	cornichon family AMPA receptor auxiliary protein 4						intracellular signal transduction (GO:0035556)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)				kidney(3)|lung(2)|ovary(2)	7				GBM - Glioblastoma multiforme(131;0.00341)		TTGAGTTTCTGTAGATTTCTA	0.333																																																	0																																										SO:0001624	3_prime_UTR_variant	29097				CCDS1543.1, CCDS60429.1, CCDS60430.1	1q42.12	2013-08-28	2013-08-28		ENSG00000143771	ENSG00000143771			25013	protein-coding gene	gene with protein product			"""cornichon homolog 4 (Drosophila)"""			11042152	Standard	NM_014184		Approved	HSPC163	uc001hom.2	Q9P003	OTTHUMG00000037635	ENST00000465271.1:c.*182G>A	1.37:g.224563706G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1Q8|B2R553|Q9H0X8	RNA	SNP	-	NULL	ENST00000465271.1	37	NULL	CCDS1543.1	1																																																																																			CNIH4	-	-		0.333	CNIH4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CNIH4	HGNC	protein_coding	OTTHUMT00000091754.1	G	NM_014184		224563706	+1	no_errors	ENST00000468318	ensembl	human	known	70_37	rna	SNP	1.000	A
CNNM1	26507	genome.wustl.edu	37	10	101090572	101090572	+	Silent	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr10:101090572G>A	ENST00000356713.4	+	1	1717	c.1428G>A	c.(1426-1428)gtG>gtA	p.V476V	CNNM1_ENST00000446890.1_Silent_p.V405V|CNNM1_ENST00000370528.3_Silent_p.V405V|CNNM1_ENST00000370534.4_Silent_p.V111V	NM_020348.2	NP_065081.2	Q9NRU3	CNNM1_HUMAN	cyclin and CBS domain divalent metal cation transport mediator 1	476	CBS 1. {ECO:0000255|PROSITE- ProRule:PRU00703}.				ion transport (GO:0006811)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	adenyl nucleotide binding (GO:0030554)			NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(10)|lung(5)|ovary(1)|prostate(1)|skin(1)	25		Colorectal(252;0.234)		Epithelial(162;6.82e-10)|all cancers(201;5.62e-08)		ACAACATTGTGGACATTTTAT	0.592																																																	0													89.0	73.0	78.0					10																	101090572		2203	4300	6503	SO:0001819	synonymous_variant	26507			AF169226	CCDS7478.2	10q24.2	2014-08-08	2014-08-07		ENSG00000119946	ENSG00000119946			102	protein-coding gene	gene with protein product		607802	"""cyclin M1"""	ACDP1		21393841	Standard	NM_020348		Approved		uc001kpp.4	Q9NRU3	OTTHUMG00000018881	ENST00000356713.4:c.1428G>A	10.37:g.101090572G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4QQG7|Q4QQH8|Q4QQP9|Q9NT45	Silent	SNP	pfam_DUF21,pfam_Cysta_beta_synth_core	p.V476	ENST00000356713.4	37	c.1428	CCDS7478.2	10																																																																																			CNNM1	-	NULL		0.592	CNNM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNNM1	HGNC	protein_coding	OTTHUMT00000049792.2	G	NM_020348		101090572	+1	no_errors	ENST00000356713	ensembl	human	known	70_37	silent	SNP	1.000	A
CNR1	1268	genome.wustl.edu	37	6	88853991	88853991	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:88853991C>T	ENST00000537554.1	-	2	4565	c.1003G>A	c.(1003-1005)Gcc>Acc	p.A335T	CNR1_ENST00000549716.1_Missense_Mutation_p.A274T|CNR1_ENST00000468898.1_Missense_Mutation_p.A302T|CNR1_ENST00000369501.2_Missense_Mutation_p.A335T|CNR1_ENST00000428600.2_Missense_Mutation_p.A335T|CNR1_ENST00000369499.2_Missense_Mutation_p.A335T|CNR1_ENST00000362094.5_3'UTR|CNR1_ENST00000549890.1_Missense_Mutation_p.A335T|CNR1_ENST00000535130.1_Missense_Mutation_p.A335T	NM_001160226.1|NM_001160258.1	NP_001153698.1|NP_001153730.1	P21554	CNR1_HUMAN	cannabinoid receptor 1 (brain)	335					adenylate cyclase-modulating G-protein coupled receptor signaling pathway (GO:0007188)|aging (GO:0007568)|G-protein coupled receptor signaling pathway, coupled to cyclic nucleotide second messenger (GO:0007187)|glucose homeostasis (GO:0042593)|maternal process involved in female pregnancy (GO:0060135)|memory (GO:0007613)|negative regulation of action potential (GO:0045759)|negative regulation of blood pressure (GO:0045776)|negative regulation of dopamine secretion (GO:0033602)|negative regulation of fatty acid beta-oxidation (GO:0031999)|negative regulation of mast cell activation (GO:0033004)|negative regulation of nitric-oxide synthase activity (GO:0051001)|positive regulation of acute inflammatory response to antigenic stimulus (GO:0002866)|positive regulation of apoptotic process (GO:0043065)|positive regulation of blood pressure (GO:0045777)|positive regulation of fever generation (GO:0031622)|positive regulation of neuron projection development (GO:0010976)|regulation of feeding behavior (GO:0060259)|regulation of insulin secretion (GO:0050796)|regulation of penile erection (GO:0060405)|regulation of synaptic transmission, GABAergic (GO:0032228)|regulation of synaptic transmission, glutamatergic (GO:0051966)|response to cocaine (GO:0042220)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to morphine (GO:0043278)|response to nicotine (GO:0035094)|response to nutrient (GO:0007584)|sensory perception of pain (GO:0019233)|spermatogenesis (GO:0007283)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cannabinoid receptor activity (GO:0004949)|drug binding (GO:0008144)			breast(2)|endometrium(3)|kidney(1)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(10)|urinary_tract(1)	37		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.15)	Dronabinol(DB00470)|Nabilone(DB00486)|Rimonabant(DB06155)	TCCATGCGGGCTTGGTCTGGC	0.562																																																	0													162.0	167.0	165.0					6																	88853991		2203	4300	6503	SO:0001583	missense	1268			AF107262	CCDS5015.1, CCDS5016.1, CCDS5016.2	6q14-q15	2012-08-08			ENSG00000118432	ENSG00000118432		"""GPCR / Class A : Cannabinoid receptors"""	2159	protein-coding gene	gene with protein product		114610		CNR			Standard	NM_016083		Approved	CB1K5, CB-R, CB1, CANN6, CB1A	uc003pmq.4	P21554	OTTHUMG00000015184	ENST00000537554.1:c.1003G>A	6.37:g.88853991C>T	ENSP00000441046:p.Ala335Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R9T4|E1P512|Q13949|Q495Z0|Q4PLI4|Q4VBM6|Q5JVL5|Q5UB37|Q9UNN0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pirsf_Cnoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Cnoid_rcpt_1,prints_Cnbnoid_rcpt,prints_GPCR_Rhodpsn	p.A335T	ENST00000537554.1	37	c.1003	CCDS5015.1	6	.	.	.	.	.	.	.	.	.	.	C	4.304	0.055694	0.08291	.	.	ENSG00000118432	ENST00000369501;ENST00000535130;ENST00000537554;ENST00000369499;ENST00000549890;ENST00000468898;ENST00000428600;ENST00000549716	T;T;T;T;T;T;T;T	0.72725	-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68;-0.68	6.05	4.06	0.47325	GPCR, rhodopsin-like superfamily (1);	0.198416	0.52532	N	0.000069	T	0.35008	0.0917	L	0.32530	0.975	0.41235	D	0.986601	B;B	0.02656	0.0;0.0	B;B	0.09377	0.001;0.004	T	0.31503	-0.9941	10	0.22706	T	0.39	.	4.3691	0.11239	0.0:0.5763:0.0:0.4237	.	302;335	P21554-3;P21554	.;CNR1_HUMAN	T	335;335;335;335;335;302;335;274	ENSP00000358513:A335T;ENSP00000442689:A335T;ENSP00000441046:A335T;ENSP00000358511:A335T;ENSP00000446819:A335T;ENSP00000420188:A302T;ENSP00000412192:A335T;ENSP00000449549:A274T	ENSP00000358511:A335T	A	-	1	0	CNR1	88910710	1.000000	0.71417	1.000000	0.80357	0.656000	0.38851	1.249000	0.32839	1.575000	0.49775	0.655000	0.94253	GCC	CNR1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pirsf_Cnoid_rcpt_1,pfscan_GPCR_Rhodpsn_7TM,prints_Cnbnoid_rcpt		0.562	CNR1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	CNR1	HGNC	protein_coding	OTTHUMT00000354204.2	C			88853991	-1	no_errors	ENST00000369499	ensembl	human	known	70_37	missense	SNP	1.000	T
DDX26B	203522	genome.wustl.edu	37	X	134711302	134711302	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chrX:134711302C>G	ENST00000370752.4	+	14	2292	c.1958C>G	c.(1957-1959)tCg>tGg	p.S653W	DDX26B_ENST00000481908.1_Intron	NM_182540.4	NP_872346.3	Q5JSJ4	DX26B_HUMAN	DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 26B	653										large_intestine(1)|lung(8)	9	Acute lymphoblastic leukemia(192;6.56e-05)					CCCTCAGCCTCGTGGTTCCCA	0.483																																																	0													193.0	154.0	167.0					X																	134711302		2203	4300	6503	SO:0001583	missense	203522			AK096544	CCDS35401.1	Xq26	2008-02-05			ENSG00000165359	ENSG00000165359		"""DEAD-boxes"""	27334	protein-coding gene	gene with protein product							Standard	NM_182540		Approved	FLJ41215	uc004eyw.4	Q5JSJ4	OTTHUMG00000022484	ENST00000370752.4:c.1958C>G	X.37:g.134711302C>G	ENSP00000359788:p.Ser653Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5CZA2|Q6IPS3|Q6ZTU5|Q6ZWE4	Missense_Mutation	SNP	pfscan_VWF_A	p.S653W	ENST00000370752.4	37	c.1958	CCDS35401.1	X	.	.	.	.	.	.	.	.	.	.	C	15.92	2.975682	0.53720	.	.	ENSG00000165359	ENST00000370752	T	0.33216	1.42	5.23	2.43	0.29744	.	0.525100	0.21139	N	0.079509	T	0.36991	0.0987	M	0.64997	1.995	0.42735	D	0.993722	D;D	0.59767	0.986;0.963	P;P	0.53593	0.59;0.73	T	0.09465	-1.0673	10	0.37606	T	0.19	-0.2647	5.5256	0.16957	0.0:0.6153:0.1391:0.2456	.	653;653	B9EIK3;Q5JSJ4	.;DX26B_HUMAN	W	653	ENSP00000359788:S653W	ENSP00000359788:S653W	S	+	2	0	DDX26B	134538968	0.206000	0.23470	0.996000	0.52242	0.984000	0.73092	0.890000	0.28295	0.137000	0.18759	-0.914000	0.02751	TCG	DDX26B	-	NULL		0.483	DDX26B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX26B	HGNC	protein_coding	OTTHUMT00000058420.1	C	NM_182540		134711302	+1	no_errors	ENST00000370752	ensembl	human	known	70_37	missense	SNP	0.995	G
DHX8	1659	genome.wustl.edu	37	17	41585300	41585300	+	Nonsense_Mutation	SNP	G	G	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr17:41585300G>T	ENST00000262415.3	+	15	2305	c.2233G>T	c.(2233-2235)Gaa>Taa	p.E745*	DHX8_ENST00000540306.1_Nonsense_Mutation_p.E745*	NM_004941.1	NP_004932.1	Q14562	DHX8_HUMAN	DEAH (Asp-Glu-Ala-His) box polypeptide 8	745					ATP catabolic process (GO:0006200)|mRNA splicing, via spliceosome (GO:0000398)|RNA processing (GO:0006396)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|identical protein binding (GO:0042802)|poly(A) RNA binding (GO:0044822)			breast(1)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(9)|lung(17)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|urinary_tract(1)	42		Breast(137;0.00908)		BRCA - Breast invasive adenocarcinoma(366;0.08)		ATATCCAGTGGAAATACTGTA	0.433																																					NSCLC(56;1548 1661 49258 49987)												0													105.0	98.0	101.0					17																	41585300		2203	4300	6503	SO:0001587	stop_gained	1659			D50487	CCDS11464.1	17q21.31	2005-08-19	2003-06-13	2003-06-20		ENSG00000067596		"""DEAH-boxes"""	2749	protein-coding gene	gene with protein product		600396	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 8 (RNA helicase)"""	DDX8		7935475	Standard	NM_004941		Approved	HRH1, PRP22, PRPF22	uc002idu.1	Q14562		ENST00000262415.3:c.2233G>T	17.37:g.41585300G>T	ENSP00000262415:p.Glu745*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,pfam_Rbsml_prot_S1_RNA-bd_dom,pfam_Helicase_C,pfam_DNA/RNA_helicase_DEAD/DEAH_N,superfamily_NA-bd_OB-fold-like,smart_RNA-binding_domain_S1,smart_Helicase_ATP-bd,smart_Helicase_C,smart_Helicase-assoc_dom,pfscan_Rbsml_prot_S1_RNA-bd_dom,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E745*	ENST00000262415.3	37	c.2233	CCDS11464.1	17	.	.	.	.	.	.	.	.	.	.	G	40	7.970452	0.98588	.	.	ENSG00000067596	ENST00000540306;ENST00000262415	.	.	.	6.08	6.08	0.98989	.	0.046486	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.6603	0.95864	0.0:0.0:1.0:0.0	.	.	.	.	X	745	.	ENSP00000262415:E745X	E	+	1	0	DHX8	38940826	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.760000	0.98935	2.894000	0.99253	0.591000	0.81541	GAA	DHX8	-	smart_Helicase_ATP-bd		0.433	DHX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHX8	HGNC	protein_coding	OTTHUMT00000453485.1	G			41585300	+1	no_errors	ENST00000262415	ensembl	human	known	70_37	nonsense	SNP	1.000	T
DMBT1	1755	genome.wustl.edu	37	10	124336050	124336050	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr10:124336050G>T	ENST00000338354.3	+	7	525	c.419G>T	c.(418-420)tGt>tTt	p.C140F	DMBT1_ENST00000344338.3_Missense_Mutation_p.C140F|DMBT1_ENST00000368956.2_Missense_Mutation_p.C140F|DMBT1_ENST00000359586.6_Missense_Mutation_p.C140F|DMBT1_ENST00000368955.3_Missense_Mutation_p.C140F|DMBT1_ENST00000368909.3_Missense_Mutation_p.C140F|DMBT1_ENST00000330163.4_Missense_Mutation_p.C140F			Q9UGM3	DMBT1_HUMAN	deleted in malignant brain tumors 1	140	SRCR 1. {ECO:0000255|PROSITE- ProRule:PRU00196}.				defense response to virus (GO:0051607)|epithelial cell differentiation (GO:0030855)|induction of bacterial agglutination (GO:0043152)|innate immune response (GO:0045087)|inner cell mass cell proliferation (GO:0001833)|pattern recognition receptor signaling pathway (GO:0002221)|positive regulation of epithelial cell differentiation (GO:0030858)|protein transport (GO:0015031)|receptor-mediated endocytosis (GO:0006898)|viral process (GO:0016032)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|phagocytic vesicle membrane (GO:0030670)|proteinaceous extracellular matrix (GO:0005578)|zymogen granule membrane (GO:0042589)	calcium-dependent protein binding (GO:0048306)|scavenger receptor activity (GO:0005044)|signaling pattern recognition receptor activity (GO:0008329)|zymogen binding (GO:0035375)			breast(2)|central_nervous_system(7)|cervix(3)|endometrium(8)|kidney(1)|large_intestine(1)|lung(46)|prostate(1)|urinary_tract(3)	72		all_neural(114;0.0765)|Lung NSC(174;0.132)|all_lung(145;0.163)|Breast(234;0.238)				AACGTGGTCTGTAGGCAGCTG	0.607																																					Ovarian(182;93 2026 18125 22222 38972)												0													188.0	192.0	191.0					10																	124336050		2121	4264	6385	SO:0001583	missense	1755				CCDS44490.1, CCDS44491.1, CCDS44492.1	10q25.3-q26.1	2008-08-01			ENSG00000187908	ENSG00000187908			2926	protein-coding gene	gene with protein product		601969				9288095, 17548659	Standard	NM_004406		Approved	GP340, muclin	uc001lgk.1	Q9UGM3	OTTHUMG00000019185	ENST00000338354.3:c.419G>T	10.37:g.124336050G>T	ENSP00000342210:p.Cys140Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDG4|A6NDJ5|A8E4R5|B1ARE7|B1ARE8|B1ARE9|B1ARF0|B7Z8Y2|F8WEF7|Q59EX0|Q5JR26|Q6MZN4|Q96DU4|Q9UGM2|Q9UJ57|Q9UKJ4|Q9Y211|Q9Y4V9	Missense_Mutation	SNP	pfam_Srcr_rcpt,pfam_CUB,pfam_ZP_dom,superfamily_Srcr_rcpt-rel,superfamily_CUB,smart_Srcr_rcpt-rel,smart_CUB,smart_ZP_dom,pfscan_CUB,pfscan_Srcr_rcpt,pfscan_ZP_dom,prints_Srcr_rcpt	p.C140F	ENST00000338354.3	37	c.419		10	.	.	.	.	.	.	.	.	.	.	g	16.14	3.039635	0.55003	.	.	ENSG00000187908	ENST00000338354;ENST00000368915;ENST00000341278;ENST00000368953;ENST00000339871;ENST00000368942;ENST00000327438;ENST00000344338;ENST00000339712;ENST00000330163;ENST00000368909;ENST00000368955;ENST00000368956;ENST00000359586	D;D;D;D;D;D;D	0.91237	-2.81;-2.81;-2.81;-2.81;-2.81;-2.81;-2.81	4.63	4.63	0.57726	Speract/scavenger receptor (3);Speract/scavenger receptor-related (2);	.	.	.	.	D	0.98043	0.9355	H	0.99942	5.005	0.58432	D	0.999992	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.999;1.0	D	0.99878	1.1107	9	0.87932	D	0	.	17.8516	0.88748	0.0:0.0:1.0:0.0	.	140;140;140;140;140	F8WEF7;Q9UGM3-6;Q9UGM3-2;Q9UGM3-3;Q9UGM3	.;.;.;.;DMBT1_HUMAN	F	140	ENSP00000342210:C140F;ENSP00000343175:C140F;ENSP00000327747:C140F;ENSP00000357905:C140F;ENSP00000357951:C140F;ENSP00000357952:C140F;ENSP00000352593:C140F	ENSP00000331522:C140F	C	+	2	0	DMBT1	124326040	1.000000	0.71417	0.996000	0.52242	0.084000	0.17831	7.561000	0.82288	2.284000	0.76573	0.655000	0.94253	TGT	DMBT1	-	pfam_Srcr_rcpt,superfamily_Srcr_rcpt-rel,smart_Srcr_rcpt-rel,pfscan_Srcr_rcpt		0.607	DMBT1-001	KNOWN	basic|appris_principal	protein_coding	DMBT1	HGNC	protein_coding	OTTHUMT00000050792.2	G	NM_004406		124336050	+1	no_errors	ENST00000368915	ensembl	human	known	70_37	missense	SNP	1.000	T
DST	667	genome.wustl.edu	37	6	56469029	56469029	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:56469029C>G	ENST00000361203.3	-	36	9771	c.9764G>C	c.(9763-9765)aGa>aCa	p.R3255T	DST_ENST00000446842.2_Missense_Mutation_p.R2929T|DST_ENST00000312431.6_Missense_Mutation_p.R3255T|DST_ENST00000370769.4_Missense_Mutation_p.R3255T|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Missense_Mutation_p.R3433T|DST_ENST00000244364.6_Intron			Q03001	DYST_HUMAN	dystonin	3255					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AGTTAATTCTCTCATCAATTC	0.343																																																	0													38.0	35.0	36.0					6																	56469029		1825	4081	5906	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000361203.3:c.9764G>C	6.37:g.56469029C>G	ENSP00000354508:p.Arg3255Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_Plectin_repeat,pfam_CH-domain,pfam_GAS2_dom,pfam_CAMSAP_CH,superfamily_CH-domain,superfamily_GAS2_dom,superfamily_ABC_transptrTM_dom_typ1,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,smart_EF_hand_Ca-bd,smart_GAS2_dom,pfscan_CH-domain,pfscan_EF_HAND_2	p.R3433T	ENST00000361203.3	37	c.10298		6	.	.	.	.	.	.	.	.	.	.	C	13.28	2.189908	0.38707	.	.	ENSG00000151914	ENST00000370754;ENST00000370769;ENST00000446842;ENST00000312431;ENST00000361203;ENST00000439203	T;T;T;T;T;T	0.80824	0.03;0.03;0.99;-1.42;0.03;-0.19	5.66	1.2	0.21068	.	0.516425	0.17397	N	0.175711	T	0.58694	0.2140	.	.	.	0.24248	N	0.995334	P	0.38504	0.634	B	0.36845	0.234	T	0.51348	-0.8717	8	0.56958	D	0.05	.	9.4066	0.38466	0.0:0.6452:0.0:0.3548	.	2929	Q03001-9	.	T	3433;3255;2929;3255;3255;2929	ENSP00000359790:R3433T;ENSP00000359805:R3255T;ENSP00000393645:R2929T;ENSP00000307959:R3255T;ENSP00000354508:R3255T;ENSP00000404924:R2929T	ENSP00000307959:R3255T	R	-	2	0	DST	56576988	0.952000	0.32445	0.964000	0.40570	0.740000	0.42216	0.702000	0.25631	0.196000	0.20367	0.655000	0.94253	AGA	DST	-	superfamily_ABC_transptrTM_dom_typ1		0.343	DST-004	NOVEL	not_organism_supported|basic|appris_candidate	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041021.3	C	NM_001723		56469029	-1	no_errors	ENST00000370754	ensembl	human	known	70_37	missense	SNP	0.981	G
DST	667	genome.wustl.edu	37	6	56480748	56480748	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:56480748C>T	ENST00000370765.6	-	24	7624	c.7517G>A	c.(7516-7518)aGa>aAa	p.R2506K	DST_ENST00000446842.2_Intron|DST_ENST00000312431.6_Intron|DST_ENST00000370769.4_Intron|DST_ENST00000370788.2_Intron|DST_ENST00000421834.2_Intron|DST_ENST00000370754.5_Intron|DST_ENST00000244364.6_Intron|DST_ENST00000361203.3_Intron	NM_001723.5	NP_001714.1	Q03001	DYST_HUMAN	dystonin	1802					axonogenesis (GO:0007409)|cell adhesion (GO:0007155)|cell cycle arrest (GO:0007050)|cell motility (GO:0048870)|cytoplasmic microtubule organization (GO:0031122)|cytoskeleton organization (GO:0007010)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)|integrin-mediated signaling pathway (GO:0007229)|intermediate filament cytoskeleton organization (GO:0045104)|maintenance of cell polarity (GO:0030011)|microtubule cytoskeleton organization (GO:0000226)|regulation of microtubule polymerization or depolymerization (GO:0031110)|response to wounding (GO:0009611)|retrograde axon cargo transport (GO:0008090)	actin cytoskeleton (GO:0015629)|axon (GO:0030424)|basal plasma membrane (GO:0009925)|basement membrane (GO:0005604)|cell leading edge (GO:0031252)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|integral component of membrane (GO:0016021)|intermediate filament (GO:0005882)|intermediate filament cytoskeleton (GO:0045111)|microtubule cytoskeleton (GO:0015630)|microtubule plus-end (GO:0035371)|neurofilament cytoskeleton (GO:0060053)|nucleus (GO:0005634)|Z disc (GO:0030018)	calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|microtubule plus-end binding (GO:0051010)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			NS(1)|breast(5)|central_nervous_system(8)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(22)|lung(43)|ovary(7)|prostate(1)|skin(4)|upper_aerodigestive_tract(3)	105	Lung NSC(77;0.103)		LUSC - Lung squamous cell carcinoma(124;0.0485)|Lung(124;0.0956)			AACCAGGCCTCTATGCAAAGC	0.512																																																	0													78.0	81.0	80.0					6																	56480748		2203	4300	6503	SO:0001583	missense	667			M22942, M69225	CCDS4959.1, CCDS47443.1, CCDS75474.1	6p12.1	2013-01-10	2004-06-25	2004-07-01	ENSG00000151914	ENSG00000151914		"""EF-hand domain containing"""	1090	protein-coding gene	gene with protein product		113810	"""bullous pemphigoid antigen 1, 230/240kDa"""	BPAG1		2461961, 2276744	Standard	NM_001144770		Approved	BP240, KIAA0728, FLJ21489, FLJ13425, FLJ32235, FLJ30627, CATX-15, BPA, MACF2	uc021zba.2	Q03001	OTTHUMG00000014913	ENST00000370765.6:c.7517G>A	6.37:g.56480748C>T	ENSP00000359801:p.Arg2506Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z3H1|O94833|Q12825|Q13266|Q13267|Q13775|Q5TBT0|Q5TBT2|Q5TF23|Q5TF24|Q8N1T8|Q8N8J3|Q8WXK8|Q8WXK9|Q96AK9|Q96DQ5|Q96J76|Q96QT5|Q9H555|Q9UGD7|Q9UGD8|Q9UN10	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_Spectrin_repeat,superfamily_Ig/albumin-bd,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R2506K	ENST00000370765.6	37	c.7517	CCDS4959.1	6	.	.	.	.	.	.	.	.	.	.	C	2.703	-0.270547	0.05716	.	.	ENSG00000151914	ENST00000370765	T	0.78246	-1.16	5.94	3.95	0.45737	.	.	.	.	.	T	0.47154	0.1430	.	.	.	0.09310	N	0.999999	B	0.06786	0.001	B	0.08055	0.003	T	0.20273	-1.0280	7	0.37606	T	0.19	.	7.1415	0.25558	0.136:0.7159:0.0:0.1482	.	2506	Q03001-3	.	K	2506	ENSP00000359801:R2506K	ENSP00000359801:R2506K	R	-	2	0	DST	56588707	1.000000	0.71417	0.705000	0.30386	0.622000	0.37654	2.215000	0.42862	0.693000	0.31634	0.557000	0.71058	AGA	DST	-	pfam_Plectin_repeat,smart_Plectin_repeat		0.512	DST-010	KNOWN	basic|CCDS	protein_coding	DST	HGNC	protein_coding	OTTHUMT00000041027.2	C	NM_001723		56480748	-1	no_errors	ENST00000370765	ensembl	human	known	70_37	missense	SNP	0.946	T
DUSP10	11221	genome.wustl.edu	37	1	221875661	221875662	+	3'UTR	INS	-	-	A	rs3215279		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:221875661_221875662insA	ENST00000366899.3	-	0	1779_1780				DUSP10_ENST00000468085.1_5'UTR|DUSP10_ENST00000544095.1_3'UTR|DUSP10_ENST00000323825.3_3'UTR	NM_007207.4	NP_009138.1	Q9Y6W6	DUS10_HUMAN	dual specificity phosphatase 10						inactivation of MAPK activity (GO:0000188)|JNK cascade (GO:0007254)|negative regulation of JNK cascade (GO:0046329)|negative regulation of JUN kinase activity (GO:0043508)|negative regulation of respiratory burst involved in inflammatory response (GO:0060266)|oligodendrocyte differentiation (GO:0048709)|protein dephosphorylation (GO:0006470)|regulation of adaptive immune response (GO:0002819)|response to lipopolysaccharide (GO:0032496)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	MAP kinase phosphatase activity (GO:0033549)|MAP kinase tyrosine/serine/threonine phosphatase activity (GO:0017017)|phosphatase activity (GO:0016791)|phosphoprotein phosphatase activity (GO:0004721)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)			NS(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(16)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				GBM - Glioblastoma multiforme(131;0.0103)		CTCCCAACTACAAAAAAAAAAA	0.351																																																	0																																										SO:0001624	3_prime_UTR_variant	11221			AB026436	CCDS1528.1	1q41	2011-06-09			ENSG00000143507	ENSG00000143507		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : MAP kinase phosphatases"""	3065	protein-coding gene	gene with protein product		608867				10391943, 10597297	Standard	NM_007207		Approved	MKP-5, MKP5	uc001hmy.2	Q9Y6W6	OTTHUMG00000037269	ENST00000366899.3:c.*93->T	1.37:g.221875672_221875672dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTB4|Q6GSI4|Q9H9Z5	RNA	INS	-	NULL	ENST00000366899.3	37	NULL	CCDS1528.1	1																																																																																			DUSP10	-	-		0.351	DUSP10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP10	HGNC	protein_coding	OTTHUMT00000090716.1	-	NM_007207		221875662	-1	no_errors	ENST00000468085	ensembl	human	known	70_37	rna	INS	0.001:0.040	A
LINC00943	100507206	genome.wustl.edu	37	12	127229808	127229809	+	lincRNA	INS	-	-	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:127229808_127229809insT	ENST00000535544.1	+	0	1825_1826				LINC00944_ENST00000540684.1_lincRNA					long intergenic non-protein coding RNA 943																		TGACTTCCATGTTTTTTTTAGA	0.342																																																	0																																												0					12q24.32	2013-05-30			ENSG00000189238	ENSG00000189238		"""Long non-coding RNAs"""	48639	non-coding RNA	RNA, long non-coding							Standard	NR_038256		Approved				OTTHUMG00000168479		12.37:g.127229816_127229816dupT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000535544.1	37	NULL		12																																																																																			RP11-173C20.1	-	-		0.342	LINC00943-002	KNOWN	basic	lincRNA	ENSG00000189238	Clone_based_vega_gene	lincRNA	OTTHUMT00000399867.1	-			127229809	+1	no_errors	ENST00000345111	ensembl	human	known	70_37	rna	INS	0.006:0.004	T
LOC101927285	101927285	genome.wustl.edu	37	2	59504880	59504881	+	lincRNA	DEL	TG	TG	-	rs78259922|rs112895922		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:59504880_59504881delTG	ENST00000409590.1	+	0	381_382				RP11-444A22.1_ENST00000606382.1_lincRNA|AC007131.2_ENST00000444001.2_lincRNA																							tgtgtgtgtctgtgtgtgtgtg	0.361																																																	0																																												0																															2.37:g.59504890_59504891delTG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL	ENST00000409590.1	37	NULL		2																																																																																			AC007131.1	-	-		0.361	AC007131.1-001	KNOWN	basic	lincRNA	ENSG00000222030	Clone_based_vega_gene	lincRNA	OTTHUMT00000327020.2	TG			59504881	+1	no_errors	ENST00000409590	ensembl	human	known	70_37	rna	DEL	0.227:0.215	-
MUC3A	4584	genome.wustl.edu	37	7	100608201	100608201	+	Intron	SNP	C	C	T	rs77005990	byFrequency	TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:100608201C>T	ENST00000319509.7	+	6	2041				RP11-395B7.2_ENST00000434775.1_RNA|RP11-395B7.2_ENST00000420080.1_RNA			Q02505	MUC3A_HUMAN	mucin 3A, cell surface associated						cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|extracellular matrix structural constituent (GO:0005201)			breast(3)|central_nervous_system(3)|endometrium(1)|kidney(1)|large_intestine(1)|lung(32)|prostate(3)	44						CTCCACACTCCCCCAGACGGA	0.602																																																	0																																										SO:0001627	intron_variant	0			AF113616		7q22.1	2012-04-20	2006-03-14		ENSG00000169894	ENSG00000169894		"""Mucins"""	7513	protein-coding gene	gene with protein product		158371	"""mucin 3A, intestinal"""	MUC3		2393399, 10973822	Standard	XM_006710192		Approved		uc003uxl.1	Q02505	OTTHUMG00000157038	ENST00000319509.7:c.2042-106C>T	7.37:g.100608201C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O14650|O14651|O43418|O43421|Q02506|Q6W763|Q9H3Q7|Q9UKW9|Q9UN93|Q9UN94|Q9UN95	RNA	SNP	-	NULL	ENST00000319509.7	37	NULL		7																																																																																			RP11-395B7.2	-	-		0.602	MUC3A-001	KNOWN	mRNA_start_NF|cds_start_NF|basic|appris_candidate_longest	protein_coding	ENSG00000225946	Clone_based_vega_gene	protein_coding	OTTHUMT00000347215.1	C	XM_001725354		100608201	-1	no_errors	ENST00000420080	ensembl	human	known	70_37	rna	SNP	0.001	T
AC003101.1	0	genome.wustl.edu	37	17	29898310	29898310	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr17:29898310C>T	ENST00000412403.1	+	1	150	c.146C>T	c.(145-147)gCc>gTc	p.A49V																								GGGGGCAGAGCCAAGCCCCAA	0.602																																																	0																																										SO:0001583	missense	0																														ENST00000412403.1:c.146C>T	17.37:g.29898310C>T	ENSP00000389901:p.Ala49Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.A49V	ENST00000412403.1	37	c.146		17	.	.	.	.	.	.	.	.	.	.	c	14.19	2.462205	0.43736	.	.	ENSG00000228768	ENST00000412403	.	.	.	4.49	-2.54	0.06307	.	.	.	.	.	T	0.18130	0.0435	.	.	.	.	.	.	.	.	.	.	.	.	T	0.26155	-1.0111	3	.	.	.	.	0.9051	0.01282	0.1496:0.3225:0.2611:0.2668	.	.	.	.	V	49	.	.	A	+	2	0	AC003101.1	26922423	0.571000	0.26659	0.001000	0.08648	0.295000	0.27426	-0.128000	0.10531	-0.460000	0.07003	-0.119000	0.15052	GCC	AC003101.1	-	NULL		0.602	AC003101.1-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000228768	Clone_based_vega_gene	protein_coding	OTTHUMT00000256194.1	C			29898310	+1	no_errors	ENST00000412403	ensembl	human	putative	70_37	missense	SNP	0.000	T
RP6-24A23.6	0	genome.wustl.edu	37	X	107965690	107965690	+	3'UTR	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chrX:107965690G>A	ENST00000563887.1	-	0	172				RP6-24A23.7_ENST00000564206.1_RNA																							TGGAGTAGACGAAGATAAAAT	0.353													G|||	1	0.000264901	0.0	0.0	3775	,	,		12794	0.0		0.001	False		,,,				2504	0.0																0																																										SO:0001624	3_prime_UTR_variant	0																														ENST00000563887.1:c.*59C>T	X.37:g.107965690G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000563887.1	37	NULL		X																																																																																			RP6-24A23.7	-	-		0.353	RP6-24A23.6-001	PUTATIVE	mRNA_start_NF|cds_start_NF|basic|appris_principal|readthrough_transcript|exp_conf	protein_coding	ENSG00000261409	Clone_based_vega_gene	protein_coding	OTTHUMT00000430276.1	G			107965690	-1	no_errors	ENST00000564206	ensembl	human	known	70_37	rna	SNP	0.014	A
POLR2J	5439	genome.wustl.edu	37	7	102120598	102120598	+	5'Flank	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:102120598C>T	ENST00000292614.5	-	0	0				AC093668.3_ENST00000607525.1_RNA|POLR2J_ENST00000393794.3_5'Flank	NM_006234.4	NP_006225.1	P52435	RPB11_HUMAN	polymerase (RNA) II (DNA directed) polypeptide J, 13.3kDa						7-methylguanosine mRNA capping (GO:0006370)|DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|nucleotide-excision repair (GO:0006289)|positive regulation of viral transcription (GO:0050434)|RNA splicing (GO:0008380)|transcription elongation from RNA polymerase II promoter (GO:0006368)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription-coupled nucleotide-excision repair (GO:0006283)|viral process (GO:0016032)	DNA-directed RNA polymerase II, core complex (GO:0005665)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|LRR domain binding (GO:0030275)			pancreas(2)	2						gctccttggtctagcggtaac	0.547																																																	0																																										SO:0001631	upstream_gene_variant	0			X98433	CCDS5724.1	7q11.2	2013-01-21	2002-08-29		ENSG00000005075	ENSG00000005075		"""RNA polymerase subunits"""	9197	protein-coding gene	gene with protein product		604150	"""polymerase (RNA) II (DNA directed) polypeptide J (13.3kD)"""				Standard	XM_005250452		Approved	RPB11, hRPB14, RPB11A, RPB11m, POLR2J1	uc003uzp.1	P52435	OTTHUMG00000150387		7.37:g.102120598C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D6V8|O43375	RNA	SNP	-	NULL	ENST00000292614.5	37	NULL	CCDS5724.1	7																																																																																			AC093668.4	-	-		0.547	POLR2J-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000264132	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000317913.1	C	NM_006234		102120598	+1	no_errors	ENST00000583109	ensembl	human	novel	70_37	rna	SNP	0.168	T
ERC2	26059	genome.wustl.edu	37	3	56207477	56207477	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr3:56207477C>T	ENST00000288221.6	-	4	1401	c.1146G>A	c.(1144-1146)atG>atA	p.M382I		NM_015576.1	NP_056391.1	O15083	ERC2_HUMAN	ELKS/RAB6-interacting/CAST family member 2	382						cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|growth cone (GO:0030426)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)				breast(2)|endometrium(5)|large_intestine(6)|liver(1)|lung(14)|ovary(2)|urinary_tract(1)	31				KIRC - Kidney renal clear cell carcinoma(284;0.0667)|Kidney(284;0.0873)|OV - Ovarian serous cystadenocarcinoma(275;0.219)		TTCCTACCTTCATTTCGATGA	0.453																																																	0													88.0	91.0	90.0					3																	56207477		2105	4236	6341	SO:0001583	missense	26059			AB002376	CCDS46851.1	3p14.3	2006-08-14			ENSG00000187672	ENSG00000187672			31922	protein-coding gene	gene with protein product							Standard	NM_015576		Approved	CAST, CAST1, KIAA0378, SPBC110, Spc110, ELKSL	uc003dhr.1	O15083	OTTHUMG00000158390	ENST00000288221.6:c.1146G>A	3.37:g.56207477C>T	ENSP00000288221:p.Met382Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2T9F6|Q86TK4	Missense_Mutation	SNP	pfam_CAZ_cplx_RIM-bd_prot,superfamily_Prefoldin	p.M382I	ENST00000288221.6	37	c.1146	CCDS46851.1	3	.	.	.	.	.	.	.	.	.	.	C	27.4	4.831098	0.91036	.	.	ENSG00000187672	ENST00000288221	T	0.45668	0.89	5.43	5.43	0.79202	.	0.037893	0.85682	D	0.000000	T	0.59376	0.2189	M	0.61703	1.905	0.53688	D	0.999976	P	0.40180	0.705	P	0.52758	0.708	T	0.58081	-0.7699	10	0.56958	D	0.05	-21.2203	19.6011	0.95561	0.0:1.0:0.0:0.0	.	382	O15083	ERC2_HUMAN	I	382	ENSP00000288221:M382I	ENSP00000288221:M382I	M	-	3	0	ERC2	56182517	1.000000	0.71417	1.000000	0.80357	0.953000	0.61014	7.345000	0.79337	2.703000	0.92315	0.557000	0.71058	ATG	ERC2	-	pfam_CAZ_cplx_RIM-bd_prot		0.453	ERC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERC2	HGNC	protein_coding	OTTHUMT00000350884.2	C	NM_015576		56207477	-1	no_errors	ENST00000288221	ensembl	human	known	70_37	missense	SNP	1.000	T
ESYT3	83850	genome.wustl.edu	37	3	138195301	138195301	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr3:138195301C>G	ENST00000389567.4	+	22	2777	c.2591C>G	c.(2590-2592)tCa>tGa	p.S864*	ESYT3_ENST00000460133.1_3'UTR	NM_031913.3	NP_114119.2	A0FGR9	ESYT3_HUMAN	extended synaptotagmin-like protein 3	864					lipid transport (GO:0006869)	extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|integral component of plasma membrane (GO:0005887)|intrinsic component of endoplasmic reticulum membrane (GO:0031227)|organelle membrane contact site (GO:0044232)	lipid binding (GO:0008289)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|large_intestine(7)|lung(9)|prostate(1)|skin(1)|urinary_tract(1)	25						ATTGACTTATCAAAAGAAGAT	0.348																																																	0													151.0	139.0	143.0					3																	138195301		1855	4099	5954	SO:0001587	stop_gained	83850			AJ303366	CCDS3101.2	3q22.3	2014-07-02	2009-06-23	2009-06-23	ENSG00000158220	ENSG00000158220		"""Synaptotagmins"""	24295	protein-coding gene	gene with protein product			"""family with sequence similarity 62 (C2 domain containing), member C"""	FAM62C		11543631, 17672888	Standard	NM_031913		Approved	CHR3SYT	uc003esk.3	A0FGR9	OTTHUMG00000147354	ENST00000389567.4:c.2591C>G	3.37:g.138195301C>G	ENSP00000374218:p.Ser864*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0G5|Q6ZV21|Q8NDZ5|Q9BQR9	Nonsense_Mutation	SNP	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting,prints_C2_dom	p.S864*	ENST00000389567.4	37	c.2591	CCDS3101.2	3	.	.	.	.	.	.	.	.	.	.	C	41	8.535977	0.98852	.	.	ENSG00000158220	ENST00000389567	.	.	.	4.95	4.95	0.65309	.	0.280593	0.23933	U	0.043135	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	-15.6774	15.7284	0.77780	0.0:1.0:0.0:0.0	.	.	.	.	X	864	.	ENSP00000374218:S864X	S	+	2	0	ESYT3	139677991	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	3.279000	0.51670	2.580000	0.87095	0.555000	0.69702	TCA	ESYT3	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep		0.348	ESYT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ESYT3	HGNC	protein_coding	OTTHUMT00000303993.1	C	NM_031913		138195301	+1	no_errors	ENST00000389567	ensembl	human	known	70_37	nonsense	SNP	1.000	G
ETV6	2120	genome.wustl.edu	37	12	12037483	12037483	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:12037483G>C	ENST00000396373.4	+	6	1388	c.1114G>C	c.(1114-1116)Gat>Cat	p.D372H		NM_001987.4	NP_001978.1	P41212	ETV6_HUMAN	ets variant 6	372					cell differentiation (GO:0030154)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)	protein domain specific binding (GO:0019904)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001227)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|sequence-specific DNA binding transcription factor activity (GO:0003700)		ETV6/JAK2(11)|ETV6/ITPR2(2)|ETV6/NTRK3(238)	breast(3)|endometrium(1)|haematopoietic_and_lymphoid_tissue(15)|kidney(1)|large_intestine(6)|lung(10)|ovary(2)|pancreas(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(2;1.88e-12)|Acute lymphoblastic leukemia(2;6.91e-39)|all_hematologic(2;2.7e-36)				CCGGATAGTGGATCCCAACGG	0.463			T	"""NTRK3, RUNX1, PDGFRB, ABL1, MN1, ABL2, FACL6, CHIC2, ARNT, JAK2, EVI1, CDX2, STL, HLXB9, MDS2, PER1, SYK, TTL, FGFR3, PAX5"""	"""congenital fibrosarcoma, multiple leukemia and lymphoma,  secretory breast, MDS, ALL"""																																			Dom	yes		12	12p13	2120	ets variant gene 6 (TEL oncogene)		"""L, E, M"""	0													106.0	99.0	101.0					12																	12037483		2203	4300	6503	SO:0001583	missense	2120			BC043399	CCDS8643.1	12p13	2014-09-17	2008-09-12		ENSG00000139083	ENSG00000139083			3495	protein-coding gene	gene with protein product	"""TEL oncogene"""	600618	"""ets variant gene 6 (TEL oncogene)"""			7731705	Standard	NM_001987		Approved	TEL	uc001qzz.3	P41212	OTTHUMG00000168538	ENST00000396373.4:c.1114G>C	12.37:g.12037483G>C	ENSP00000379658:p.Asp372His	Somatic		WXS	Illumina HiSeq	Phase_IV	A3QVP6|A8K076|Q9UMF6|Q9UMF7|Q9UMG0	Missense_Mutation	SNP	pfam_Ets,pfam_Pointed_dom,superfamily_SAM/pointed,smart_Pointed_dom,smart_Ets,pfscan_Ets,prints_Ets	p.D372H	ENST00000396373.4	37	c.1114	CCDS8643.1	12	.	.	.	.	.	.	.	.	.	.	G	28.1	4.890817	0.91889	.	.	ENSG00000139083	ENST00000396373	T	0.17691	2.26	5.63	5.63	0.86233	Winged helix-turn-helix transcription repressor DNA-binding (1);Ets (4);	0.000000	0.85682	D	0.000000	T	0.51601	0.1684	M	0.88979	2.995	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.59386	-0.7464	10	0.87932	D	0	.	19.2738	0.94021	0.0:0.0:1.0:0.0	.	372	P41212	ETV6_HUMAN	H	372	ENSP00000379658:D372H	ENSP00000379658:D372H	D	+	1	0	ETV6	11928750	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.636000	0.89361	0.655000	0.94253	GAT	ETV6	-	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets		0.463	ETV6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ETV6	HGNC	protein_coding	OTTHUMT00000400130.2	G	NM_001987		12037483	+1	no_errors	ENST00000396373	ensembl	human	known	70_37	missense	SNP	1.000	C
EVPL	2125	genome.wustl.edu	37	17	74006158	74006158	+	Missense_Mutation	SNP	C	C	T	rs373420968		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr17:74006158C>T	ENST00000301607.3	-	22	3381	c.3128G>A	c.(3127-3129)cGc>cAc	p.R1043H	EVPL_ENST00000586740.1_Missense_Mutation_p.R1065H	NM_001988.2	NP_001979.2	Q92817	EVPL_HUMAN	envoplakin	1043	Central fibrous rod domain.				epidermis development (GO:0008544)|keratinization (GO:0031424)|keratinocyte differentiation (GO:0030216)|peptide cross-linking (GO:0018149)	cell junction (GO:0030054)|cornified envelope (GO:0001533)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	protein binding, bridging (GO:0030674)|structural molecule activity (GO:0005198)			breast(4)|central_nervous_system(4)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)	54						ATCCTCCCCGCGGAGCTGCTG	0.647																																																	0								C	HIS/ARG	0,4406		0,0,2203	74.0	79.0	77.0		3128	1.0	0.0	17		77	1,8599	1.2+/-3.3	0,1,4299	no	missense	EVPL	NM_001988.2	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	1043/2034	74006158	1,13005	2203	4300	6503	SO:0001583	missense	2125			U53786	CCDS11737.1	17q25	2008-07-18				ENSG00000167880			3503	protein-coding gene	gene with protein product		601590				8938451, 10409435	Standard	NM_001988		Approved	EVPK	uc002jqi.2	Q92817		ENST00000301607.3:c.3128G>A	17.37:g.74006158C>T	ENSP00000301607:p.Arg1043His	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUV5	Missense_Mutation	SNP	pfam_Plectin_repeat,superfamily_Ferritin/RNR-like,smart_Spectrin/alpha-actinin,smart_Plectin_repeat	p.R1043H	ENST00000301607.3	37	c.3128	CCDS11737.1	17	.	.	.	.	.	.	.	.	.	.	C	11.32	1.605102	0.28623	0.0	1.16E-4	ENSG00000167880	ENST00000301607	T	0.69175	-0.38	5.34	1.03	0.20045	.	0.573346	0.18780	N	0.131364	T	0.61299	0.2336	M	0.68317	2.08	0.09310	N	1	D;D	0.57899	0.981;0.958	P;B	0.44518	0.452;0.373	T	0.56523	-0.7965	10	0.72032	D	0.01	-2.1761	5.8712	0.18805	0.0:0.5036:0.1271:0.3692	.	1065;1043	B7ZLH8;Q92817	.;EVPL_HUMAN	H	1043	ENSP00000301607:R1043H	ENSP00000301607:R1043H	R	-	2	0	EVPL	71517753	0.000000	0.05858	0.001000	0.08648	0.079000	0.17450	0.604000	0.24164	-0.005000	0.14395	0.491000	0.48974	CGC	EVPL	-	NULL		0.647	EVPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EVPL	HGNC	protein_coding	OTTHUMT00000449483.1	C	NM_001988		74006158	-1	no_errors	ENST00000301607	ensembl	human	known	70_37	missense	SNP	0.001	T
EYS	346007	genome.wustl.edu	37	6	65707507	65707507	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:65707507C>T	ENST00000370621.3	-	14	2753	c.2227G>A	c.(2227-2229)Gag>Aag	p.E743K	EYS_ENST00000370616.2_Missense_Mutation_p.E743K|EYS_ENST00000503581.1_Missense_Mutation_p.E743K			Q5T1H1	EYS_HUMAN	eyes shut homolog (Drosophila)	743	EGF-like 9; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				detection of light stimulus involved in visual perception (GO:0050908)|skeletal muscle tissue regeneration (GO:0043403)	extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)			breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(12)|lung(42)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)	69						GAATTGTGCTCACAGGCATTC	0.398																																																	0													148.0	119.0	128.0					6																	65707507		692	1591	2283	SO:0001583	missense	346007				CCDS4967.1, CCDS47445.1, CCDS47446.1	6q12	2014-01-28	2008-10-20	2008-10-20	ENSG00000188107	ENSG00000188107			21555	protein-coding gene	gene with protein product		612424	"""chromosome 6 open reading frame 180"", ""EGF-like-domain, multiple 11"", ""retinitis pigmentosa 25 (autosomal recessive)"", ""EGF-like-domain, multiple 10"", ""chromosome 6 open reading frame 178"", ""chromosome 6 open reading frame 179"""	C6orf180, EGFL11, RP25, EGFL10, C6orf178, C6orf179		18836446, 18976725	Standard	NM_001142800		Approved	dJ1018A4.2, bA166P24.2, SPAM, bA307F22.3, dJ303F19.1, bA74E24.1	uc011dxu.1	Q5T1H1	OTTHUMG00000014971	ENST00000370621.3:c.2227G>A	6.37:g.65707507C>T	ENSP00000359655:p.Glu743Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUR2|A8MVE7|B7TYK8|B7UUQ3|B7ZBE7|B7ZBE8|B7ZBR3|B9ZVD2|Q5SZM4|Q5T3C8|Q5T669|Q5TEL3|Q5TEL4|Q5VVG4|Q6UY05|Q9H557|Q9NQ15	Missense_Mutation	SNP	pfam_Laminin_G,pfam_EG-like_dom,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.E743K	ENST00000370621.3	37	c.2227		6	.	.	.	.	.	.	.	.	.	.	C	12.70	2.015316	0.35511	.	.	ENSG00000188107	ENST00000503581;ENST00000370621;ENST00000370616	D;D;D	0.90955	-2.76;-2.76;-2.76	4.89	3.11	0.35812	.	0.257278	0.20575	N	0.089642	T	0.61060	0.2317	N	0.12569	0.235	0.80722	D	1	B	0.31318	0.319	B	0.30105	0.111	T	0.60276	-0.7295	10	0.06494	T	0.89	.	7.9432	0.29971	0.0:0.7446:0.0:0.2554	.	743	Q5T1H1-1	.	K	743	ENSP00000424243:E743K;ENSP00000359655:E743K;ENSP00000359650:E743K	ENSP00000359650:E743K	E	-	1	0	EYS	65764228	0.759000	0.28416	0.241000	0.24154	0.951000	0.60555	0.546000	0.23284	0.484000	0.27630	0.655000	0.94253	GAG	EYS	-	smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.398	EYS-001	KNOWN	basic	protein_coding	EYS	HGNC	protein_coding	OTTHUMT00000351351.3	C	XM_294050		65707507	-1	no_errors	ENST00000370616	ensembl	human	known	70_37	missense	SNP	0.979	T
GFRA1	2674	genome.wustl.edu	37	10	118031536	118031536	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr10:118031536G>C	ENST00000355422.6	-	2	556	c.6C>G	c.(4-6)ttC>ttG	p.F2L	GFRA1_ENST00000369236.1_Missense_Mutation_p.F2L|GFRA1_ENST00000439649.3_Missense_Mutation_p.F2L|GFRA1_ENST00000490345.1_5'UTR	NM_005264.4	NP_005255.1	P56159	GFRA1_HUMAN	GDNF family receptor alpha 1	2					axon guidance (GO:0007411)|cell surface receptor signaling pathway (GO:0007166)|glial cell-derived neurotrophic factor receptor signaling pathway (GO:0035860)	anchored component of membrane (GO:0031225)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|plasma membrane (GO:0005886)	glial cell-derived neurotrophic factor receptor activity (GO:0016167)|receptor binding (GO:0005102)			endometrium(2)|large_intestine(10)|liver(1)|lung(8)|ovary(2)|pancreas(1)|prostate(1)|stomach(1)	26		Lung NSC(174;0.21)		all cancers(201;0.0337)		GGGTCGCCAGGAACATGGTGC	0.677																																					Ovarian(128;329 1725 45498 46808 50759)												0													7.0	10.0	9.0					10																	118031536		2094	4117	6211	SO:0001583	missense	2674			AF038421	CCDS7593.1, CCDS44481.1	10q25-q26	2011-01-25			ENSG00000151892	ENSG00000151892			4243	protein-coding gene	gene with protein product		601496		GDNFRA		9465905, 9545641	Standard	NM_005264		Approved	RETL1, GDNFR, GFR-ALPHA-1, RET1L, TRNR1	uc001lcj.3	P56159	OTTHUMG00000019097	ENST00000355422.6:c.6C>G	10.37:g.118031536G>C	ENSP00000347591:p.Phe2Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA21|O15507|O43912	Missense_Mutation	SNP	pfam_GDNF/GAS1,smart_GDNF/GAS1,pirsf_Glial_neurotroph_fac_rcpt_a1/2,prints_GDNF_rcpt,prints_GDNF_rcpt_A1	p.F2L	ENST00000355422.6	37	c.6	CCDS44481.1	10	.	.	.	.	.	.	.	.	.	.	G	17.60	3.430984	0.62844	.	.	ENSG00000151892	ENST00000439649;ENST00000369236;ENST00000355422;ENST00000369234	T;T;T;T	0.29655	1.56;1.56;1.57;1.57	5.51	3.42	0.39159	.	1.022860	0.07784	N	0.953842	T	0.23727	0.0574	L	0.36672	1.1	0.80722	D	1	B;B	0.20780	0.028;0.048	B;B	0.18561	0.01;0.022	T	0.05115	-1.0905	10	0.13853	T	0.58	-10.8117	8.8753	0.35340	0.3011:0.0:0.6989:0.0	.	2;2	P56159;P56159-2	GFRA1_HUMAN;.	L	2	ENSP00000393725:F2L;ENSP00000358239:F2L;ENSP00000347591:F2L;ENSP00000358237:F2L	ENSP00000347591:F2L	F	-	3	2	GFRA1	118021526	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	1.377000	0.34317	1.320000	0.45209	0.561000	0.74099	TTC	GFRA1	-	pirsf_Glial_neurotroph_fac_rcpt_a1/2		0.677	GFRA1-002	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	GFRA1	HGNC	protein_coding	OTTHUMT00000050512.2	G	NM_145793		118031536	-1	no_errors	ENST00000439649	ensembl	human	known	70_37	missense	SNP	1.000	C
HCN2	610	genome.wustl.edu	37	19	590519	590519	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr19:590519G>A	ENST00000251287.2	+	1	627	c.574G>A	c.(574-576)Gag>Aag	p.E192K		NM_001194.3	NP_001185.3	Q9UL51	HCN2_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 2	192	Involved in subunit assembly. {ECO:0000250}.				cell-cell signaling (GO:0007267)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|potassium ion transmembrane transport (GO:0071805)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	cAMP binding (GO:0030552)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			endometrium(5)|lung(4)	9		all_epithelial(18;2.78e-22)|Acute lymphoblastic leukemia(61;2.53e-14)|all_hematologic(61;8.18e-10)|Lung NSC(49;3.55e-06)|all_lung(49;5.41e-06)|Breast(49;4.08e-05)|Hepatocellular(1079;0.137)|Renal(1328;0.228)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		CGTGGAGCGCGAGCAGGAGCG	0.711																																					Melanoma(145;1175 2427 8056 36306)												0													12.0	15.0	14.0					19																	590519		2099	4130	6229	SO:0001583	missense	610			AF064877	CCDS12035.1	19p13	2011-07-05				ENSG00000099822		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4846	protein-coding gene	gene with protein product		602781		BCNG2		9405696, 9630217, 16382102	Standard	NM_001194		Approved	BCNG-2, HAC-1	uc002lpe.3	Q9UL51		ENST00000251287.2:c.574G>A	19.37:g.590519G>A	ENSP00000251287:p.Glu192Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O60742|O60743|O75267|Q9UBS2	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.E192K	ENST00000251287.2	37	c.574	CCDS12035.1	19	.	.	.	.	.	.	.	.	.	.	.	27.7	4.854166	0.91355	.	.	ENSG00000099822	ENST00000251287	D	0.84660	-1.88	2.44	1.16	0.20824	Ion transport N-terminal (1);	.	.	.	.	D	0.91324	0.7264	M	0.90309	3.105	0.58432	D	0.999997	D	0.89917	1.0	D	0.81914	0.995	D	0.88911	0.3359	9	0.23891	T	0.37	.	8.9084	0.35537	0.0:0.0:0.7771:0.2229	.	192	Q9UL51	HCN2_HUMAN	K	192	ENSP00000251287:E192K	ENSP00000251287:E192K	E	+	1	0	HCN2	541519	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	5.515000	0.67049	1.306000	0.44926	0.282000	0.19409	GAG	HCN2	-	pfam_Ion_trans_N		0.711	HCN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN2	HGNC	protein_coding	OTTHUMT00000452100.1	G	NM_001194		590519	+1	no_errors	ENST00000251287	ensembl	human	known	70_37	missense	SNP	1.000	A
HECTD4	283450	genome.wustl.edu	37	12	112670844	112670844	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:112670844C>T	ENST00000430131.2	-	37	5840	c.4695G>A	c.(4693-4695)atG>atA	p.M1565I	HECTD4_ENST00000550722.1_Missense_Mutation_p.M1841I|HECTD4_ENST00000377560.5_Missense_Mutation_p.M1815I			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1565					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)										CAACTTTCTCCATGTTGGCGC	0.458																																																	0													104.0	94.0	97.0					12																	112670844		1928	4154	6082	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4695G>A	12.37:g.112670844C>T	ENSP00000404379:p.Met1565Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.M1815I	ENST00000430131.2	37	c.5445		12	.	.	.	.	.	.	.	.	.	.	C	34	5.343672	0.95807	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.54675	0.56;0.57;0.56	5.34	5.34	0.76211	.	.	.	.	.	T	0.52354	0.1729	N	0.24115	0.695	0.80722	D	1	P	0.35872	0.525	P	0.45428	0.48	T	0.57353	-0.7826	9	0.87932	D	0	.	19.4219	0.94725	0.0:1.0:0.0:0.0	.	1565	Q9Y4D8	K0614_HUMAN	I	1815;1565;1841	ENSP00000366783:M1815I;ENSP00000404379:M1565I;ENSP00000449784:M1841I	ENSP00000366783:M1815I	M	-	3	0	C12orf51	111155227	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.445000	0.80570	2.659000	0.90383	0.655000	0.94253	ATG	HECTD4	-	NULL		0.458	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		C	NM_173813		112670844	-1	no_errors	ENST00000377560	ensembl	human	known	70_37	missense	SNP	1.000	T
HECTD4	283450	genome.wustl.edu	37	12	112670864	112670864	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:112670864G>T	ENST00000430131.2	-	37	5820	c.4675C>A	c.(4675-4677)Ctt>Att	p.L1559I	HECTD4_ENST00000550722.1_Missense_Mutation_p.L1835I|HECTD4_ENST00000377560.5_Missense_Mutation_p.L1809I			Q9Y4D8	HECD4_HUMAN	HECT domain containing E3 ubiquitin protein ligase 4	1559					glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)	p.L1809I(1)|p.L1559I(1)									CCAGTACCAAGTCGGAAGGGC	0.498																																																	2	Substitution - Missense(2)	endometrium(2)											87.0	79.0	82.0					12																	112670864		1935	4150	6085	SO:0001583	missense	283450			AK091473		12q24.13	2013-07-17	2012-08-14	2012-08-14	ENSG00000173064	ENSG00000173064			26611	protein-coding gene	gene with protein product			"""chromosome 12 open reading frame 51"""	C12orf51		21270382	Standard	NM_001109662		Approved	FLJ34154, KIAA0614	uc021reb.1	Q9Y4D8	OTTHUMG00000150719	ENST00000430131.2:c.4675C>A	12.37:g.112670864G>T	ENSP00000404379:p.Leu1559Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	L8B0P6|Q3MJD5|Q6P0A0|Q7L530|Q8NB70|Q8WU73|Q96NT9|Q9NZS4|Q9UFT6	Missense_Mutation	SNP	pfam_HECT,superfamily_HECT,superfamily_ConA-like_lec_gl_sf,smart_HECT,pfscan_HECT	p.L1809I	ENST00000430131.2	37	c.5425		12	.	.	.	.	.	.	.	.	.	.	G	36	5.749202	0.96882	.	.	ENSG00000173064	ENST00000377560;ENST00000430131;ENST00000550722	T;T;T	0.56776	0.44;0.45;0.44	5.34	5.34	0.76211	.	.	.	.	.	T	0.61060	0.2317	N	0.24115	0.695	0.80722	D	1	P	0.52842	0.956	D	0.65010	0.931	T	0.65425	-0.6171	9	0.87932	D	0	.	19.4219	0.94725	0.0:0.0:1.0:0.0	.	1559	Q9Y4D8	K0614_HUMAN	I	1809;1559;1835	ENSP00000366783:L1809I;ENSP00000404379:L1559I;ENSP00000449784:L1835I	ENSP00000366783:L1809I	L	-	1	0	C12orf51	111155247	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.575000	0.82447	2.659000	0.90383	0.655000	0.94253	CTT	HECTD4	-	NULL		0.498	HECTD4-202	KNOWN	basic	protein_coding	HECTD4	HGNC	protein_coding		G	NM_173813		112670864	-1	no_errors	ENST00000377560	ensembl	human	known	70_37	missense	SNP	1.000	T
HOXA1	3198	genome.wustl.edu	37	7	27135385	27135385	+	Silent	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:27135385G>A	ENST00000343060.4	-	1	208	c.147C>T	c.(145-147)ggC>ggT	p.G49G	HOTAIRM1_ENST00000425358.2_RNA|HOTAIRM1_ENST00000429611.3_RNA|HOXA1_ENST00000355633.5_Silent_p.G49G|HOTAIRM1_ENST00000434063.3_RNA|HOTAIRM1_ENST00000495032.1_RNA	NM_005522.4	NP_005513	P49639	HXA1_HUMAN	homeobox A1	49					abducens nerve formation (GO:0021599)|anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|artery development (GO:0060840)|artery morphogenesis (GO:0048844)|central nervous system neuron differentiation (GO:0021953)|cochlea development (GO:0090102)|cochlea morphogenesis (GO:0090103)|cognition (GO:0050890)|embryonic neurocranium morphogenesis (GO:0048702)|facial nerve structural organization (GO:0021612)|facial nucleus development (GO:0021754)|inner ear development (GO:0048839)|motor neuron axon guidance (GO:0008045)|multicellular organismal development (GO:0007275)|neuromuscular process (GO:0050905)|optokinetic behavior (GO:0007634)|outer ear morphogenesis (GO:0042473)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of behavior (GO:0050795)|rhombomere 3 development (GO:0021569)|rhombomere 4 development (GO:0021570)|rhombomere 5 development (GO:0021571)|semicircular canal formation (GO:0060876)|sensory perception of sound (GO:0007605)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)			endometrium(2)|kidney(2)|large_intestine(4)|liver(1)|lung(14)|ovary(4)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AGCGGTCGTCGCCGCCGCAAC	0.662											OREG0003750	type=REGULATORY REGION|Gene=BC031342|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													43.0	48.0	46.0					7																	27135385		2202	4300	6502	SO:0001819	synonymous_variant	3198				CCDS5401.1, CCDS5402.2	7p15.2	2011-06-20	2005-12-22		ENSG00000105991	ENSG00000105991		"""Homeoboxes / ANTP class : HOXL subclass"""	5099	protein-coding gene	gene with protein product		142955	"""homeo box A1"""	HOX1F, HOX1		1973146	Standard	NM_153620		Approved		uc003sye.3	P49639	OTTHUMG00000023207	ENST00000343060.4:c.147C>T	7.37:g.27135385G>A		Somatic	792	WXS	Illumina HiSeq	Phase_IV	A4D184|B2R8U7|O43363	Silent	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa	p.G49	ENST00000343060.4	37	c.147	CCDS5401.1	7																																																																																			HOXA1	-	NULL		0.662	HOXA1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	HOXA1	HGNC	protein_coding	OTTHUMT00000358454.1	G			27135385	-1	no_errors	ENST00000343060	ensembl	human	known	70_37	silent	SNP	0.998	A
IQGAP1	8826	genome.wustl.edu	37	15	90996474	90996474	+	Silent	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr15:90996474G>A	ENST00000268182.5	+	13	1561	c.1437G>A	c.(1435-1437)ttG>ttA	p.L479L	IQGAP1_ENST00000560738.1_Intron	NM_003870.3	NP_003861.1	P46940	IQGA1_HUMAN	IQ motif containing GTPase activating protein 1	479					cellular response to calcium ion (GO:0071277)|cellular response to epidermal growth factor stimulus (GO:0071364)|energy reserve metabolic process (GO:0006112)|epidermal growth factor receptor signaling pathway (GO:0007173)|glomerular visceral epithelial cell development (GO:0072015)|negative regulation of catalytic activity (GO:0043086)|negative regulation of dephosphorylation (GO:0035305)|neuron projection extension (GO:1990138)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|regulation of cytokine production (GO:0001817)|regulation of insulin secretion (GO:0050796)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	actin filament (GO:0005884)|axon (GO:0030424)|cell junction (GO:0030054)|cell leading edge (GO:0031252)|cytoplasm (GO:0005737)|cytoplasmic ribonucleoprotein granule (GO:0036464)|extracellular vesicular exosome (GO:0070062)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|midbody (GO:0030496)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)	calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|GTPase activator activity (GO:0005096)|GTPase inhibitor activity (GO:0005095)|phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|protein serine/threonine kinase activator activity (GO:0043539)|Ras GTPase activator activity (GO:0005099)			breast(2)|central_nervous_system(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(18)|ovary(2)|pancreas(1)|prostate(3)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	59	Melanoma(11;0.00551)|Lung NSC(78;0.0237)|all_lung(78;0.0488)		BRCA - Breast invasive adenocarcinoma(143;0.0745)|KIRC - Kidney renal clear cell carcinoma(17;0.138)|Kidney(142;0.194)			GGAAGCAATTGAGCAGTTCAG	0.478																																																	0													214.0	199.0	204.0					15																	90996474		2198	4298	6496	SO:0001819	synonymous_variant	8826			D29640	CCDS10362.1	15q26.1	2008-07-18			ENSG00000140575	ENSG00000140575			6110	protein-coding gene	gene with protein product	"""RasGAP-like with IQ motifs"""	603379				8051149, 8670801	Standard	XM_005254984		Approved	p195, KIAA0051, SAR1, HUMORFA01	uc002bpl.1	P46940	OTTHUMG00000149832	ENST00000268182.5:c.1437G>A	15.37:g.90996474G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A7MBM3	Silent	SNP	pfam_RasGAP,pfam_RasGAP_C,pfam_IQ_motif_EF-hand-BS,pfam_CH-domain,pfam_WW_Rsp5_WWP,superfamily_Rho_GTPase_activation_prot,superfamily_CH-domain,smart_CH-domain,smart_WW_Rsp5_WWP,smart_IQ_motif_EF-hand-BS,smart_RasGAP,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS,pfscan_WW_Rsp5_WWP,pfscan_RasGAP	p.L479	ENST00000268182.5	37	c.1437	CCDS10362.1	15																																																																																			IQGAP1	-	NULL		0.478	IQGAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQGAP1	HGNC	protein_coding	OTTHUMT00000313493.1	G	NM_003870		90996474	+1	no_errors	ENST00000268182	ensembl	human	known	70_37	silent	SNP	1.000	A
KCNK10	54207	genome.wustl.edu	37	14	88652178	88652178	+	Missense_Mutation	SNP	C	C	T	rs201379405		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr14:88652178C>T	ENST00000340700.5	-	7	1769	c.1318G>A	c.(1318-1320)Gag>Aag	p.E440K	KCNK10_ENST00000312350.5_Missense_Mutation_p.E445K|KCNK10_ENST00000319231.5_Missense_Mutation_p.E445K	NM_021161.4	NP_066984.1	P57789	KCNKA_HUMAN	potassium channel, subfamily K, member 10	440					signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(3)|pancreas(2)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	47						ATGTTGTCCTCGGACGCACCC	0.557																																																	0													112.0	106.0	108.0					14																	88652178		2203	4300	6503	SO:0001583	missense	54207			AF279890	CCDS9880.1, CCDS9881.1, CCDS9882.1	14q31	2014-06-12						"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Two-P"""	6273	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 97"""	605873				10880510, 16382106	Standard	NM_021161		Approved	K2p10.1, TREK-2, TREK2, PPP1R97	uc001xwn.3	P57789		ENST00000340700.5:c.1318G>A	14.37:g.88652178C>T	ENSP00000343104:p.Glu440Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8T4|B2RCT3|B5TJL4|Q6B014|Q8TDK7|Q8TDK8|Q9HB59	Missense_Mutation	SNP	pfam_Ion_trans_2,prints_2pore_dom_K_chnl_TREK,prints_2pore_dom_K_chnl,prints_2pore_dom_K_chnl_TRAAK,prints_2pore_dom_K_chnl_TASK	p.E445K	ENST00000340700.5	37	c.1333	CCDS9880.1	14	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502559	0.85176	.	.	ENSG00000100433	ENST00000340700;ENST00000312350;ENST00000319231	D;D;D	0.94613	-3.45;-3.46;-3.47	5.71	5.71	0.89125	.	0.282689	0.33477	N	0.004865	D	0.96103	0.8730	L	0.46157	1.445	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.71184	0.972;0.972;0.972	D	0.95795	0.8828	10	0.51188	T	0.08	.	18.8558	0.92251	0.0:1.0:0.0:0.0	.	440;445;445	P57789;B2R8T4;Q6B014	KCNKA_HUMAN;.;.	K	440;445;445	ENSP00000343104:E440K;ENSP00000310568:E445K;ENSP00000312811:E445K	ENSP00000310568:E445K	E	-	1	0	KCNK10	87721931	1.000000	0.71417	0.958000	0.39756	0.723000	0.41478	7.480000	0.81109	2.709000	0.92574	0.655000	0.94253	GAG	KCNK10	-	NULL		0.557	KCNK10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNK10	HGNC	protein_coding	OTTHUMT00000410167.1	C	NM_021161		88652178	-1	no_errors	ENST00000312350	ensembl	human	known	70_37	missense	SNP	1.000	T
KIRREL2	84063	genome.wustl.edu	37	19	36357423	36357423	+	3'UTR	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr19:36357423C>T	ENST00000360202.5	+	0	2354				NPHS1_ENST00000591817.1_5'UTR|KIRREL2_ENST00000262625.7_Silent_p.I629I|APLP1_ENST00000586861.1_5'Flank|KIRREL2_ENST00000347900.6_Silent_p.I579I|APLP1_ENST00000221891.4_5'Flank|APLP1_ENST00000537454.2_5'Flank	NM_032123.5|NM_199180.2	NP_115499.4|NP_954649.2	Q6UWL6	KIRR2_HUMAN	kin of IRRE like 2 (Drosophila)						cell adhesion (GO:0007155)|negative regulation of protein phosphorylation (GO:0001933)|single organismal cell-cell adhesion (GO:0016337)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|slit diaphragm (GO:0036057)				breast(2)|central_nervous_system(1)|endometrium(6)|large_intestine(6)|liver(2)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	48	all_lung(56;7.14e-07)|Lung NSC(56;1.12e-06)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0515)			GTCCTGGGATCTCCAACTTGC	0.532																																																	0													96.0	99.0	98.0					19																	36357423		2203	4300	6503	SO:0001624	3_prime_UTR_variant	84063			AL136654	CCDS12479.1, CCDS12480.1, CCDS12481.1	19q13.13	2013-01-29				ENSG00000126259		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / C2-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	18816	protein-coding gene	gene with protein product		607762				12837264, 12504092	Standard	NM_199180		Approved	NLG1, NEPH3, FILTRIN, DKFZp564A1164, MGC15718	uc002ocb.4	Q6UWL6		ENST00000360202.5:c.*29C>T	19.37:g.36357423C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9JHF1|C9JJ76|F1T0I2|Q6P1R1|Q7Z5P1|Q7Z5P2|Q96IQ8|Q9H0T1	Silent	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_CD80_C2-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.I629	ENST00000360202.5	37	c.1887	CCDS12481.1	19																																																																																			KIRREL2	-	NULL		0.532	KIRREL2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIRREL2	HGNC	protein_coding	OTTHUMT00000452561.1	C	NM_032123		36357423	+1	no_errors	ENST00000262625	ensembl	human	known	70_37	silent	SNP	0.011	T
LAMC3	10319	genome.wustl.edu	37	9	133914593	133914593	+	Missense_Mutation	SNP	G	G	A	rs372564761		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr9:133914593G>A	ENST00000361069.4	+	6	1374	c.1241G>A	c.(1240-1242)cGc>cAc	p.R414H	LAMC3_ENST00000480883.1_3'UTR	NM_006059.3	NP_006050.3	Q9Y6N6	LAMC3_HUMAN	laminin, gamma 3	414	Laminin EGF-like 3. {ECO:0000255|PROSITE- ProRule:PRU00460}.				astrocyte development (GO:0014002)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|extracellular matrix organization (GO:0030198)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	basement membrane (GO:0005604)|extracellular region (GO:0005576)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	structural molecule activity (GO:0005198)			endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(31)|ovary(3)|pancreas(1)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	69	all_hematologic(7;0.0028)	Myeloproliferative disorder(178;0.204)		OV - Ovarian serous cystadenocarcinoma(145;5.06e-05)|Epithelial(140;0.000551)		AAGTGTGACCGCTGTCTGCCC	0.632																																																	0								G	HIS/ARG	0,4406		0,0,2203	57.0	51.0	53.0		1241	3.3	1.0	9		53	1,8599	1.2+/-3.3	0,1,4299	no	missense	LAMC3	NM_006059.3	29	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	probably-damaging	414/1576	133914593	1,13005	2203	4300	6503	SO:0001583	missense	10319			AF041835	CCDS6938.1	9q31-q34	2013-03-01			ENSG00000050555	ENSG00000050555		"""Laminins"""	6494	protein-coding gene	gene with protein product		604349				10225960	Standard	NM_006059		Approved	DKFZp434E202	uc004caa.1	Q9Y6N6	OTTHUMG00000020819	ENST00000361069.4:c.1241G>A	9.37:g.133914593G>A	ENSP00000354360:p.Arg414His	Somatic		WXS	Illumina HiSeq	Phase_IV	B1APX9|B1APY0|Q59H72	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_Laminin_N,pfam_Laminin_B_type_IV,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_N	p.R414H	ENST00000361069.4	37	c.1241	CCDS6938.1	9	.	.	.	.	.	.	.	.	.	.	G	22.7	4.330588	0.81690	0.0	1.16E-4	ENSG00000050555	ENST00000361069;ENST00000355048;ENST00000320021	T	0.64260	-0.09	5.12	3.28	0.37604	EGF-like, laminin (4);	0.353196	0.32655	N	0.005820	T	0.75671	0.3881	M	0.84219	2.685	0.37163	D	0.902674	D	0.69078	0.997	P	0.61722	0.893	T	0.79978	-0.1575	10	0.56958	D	0.05	.	10.5961	0.45338	0.1588:0.0:0.8412:0.0	.	414	Q9Y6N6	LAMC3_HUMAN	H	414	ENSP00000354360:R414H	ENSP00000325873:R414H	R	+	2	0	LAMC3	132904414	0.687000	0.27671	1.000000	0.80357	0.924000	0.55760	2.070000	0.41491	0.664000	0.31047	0.655000	0.94253	CGC	LAMC3	-	pfam_EGF_laminin,smart_EGF_laminin,smart_EG-like_dom,pfscan_EGF_laminin		0.632	LAMC3-004	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMC3	HGNC	protein_coding	OTTHUMT00000054717.3	G	NM_006059		133914593	+1	no_errors	ENST00000361069	ensembl	human	known	70_37	missense	SNP	0.994	A
LRRC53	100144878	genome.wustl.edu	37	1	74946275	74946275	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:74946275G>T	ENST00000294635.4	-	3	580	c.466C>A	c.(466-468)Ctc>Atc	p.L156I	TNNI3K_ENST00000370891.2_Intron|FPGT-TNNI3K_ENST00000557284.2_Intron|LRRC53_ENST00000416014.2_Missense_Mutation_p.L156I|TNNI3K_ENST00000326637.3_Intron			A6NM62	LRC53_HUMAN	leucine rich repeat containing 53	156						integral component of membrane (GO:0016021)				NS(1)|breast(1)|lung(2)	4						AGACTGTGGAGATTCGTGCCT	0.498																																																	0																																										SO:0001583	missense	100144878					1p31.3	2010-08-31			ENSG00000162621	ENSG00000162621			25255	protein-coding gene	gene with protein product							Standard			Approved			A6NM62	OTTHUMG00000009621	ENST00000294635.4:c.466C>A	1.37:g.74946275G>T	ENSP00000294635:p.Leu156Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_typical-subtyp	p.L156I	ENST00000294635.4	37	c.466		1	.	.	.	.	.	.	.	.	.	.	G	21.2	4.111531	0.77210	.	.	ENSG00000162621	ENST00000416014;ENST00000294635	T;T	0.70749	-0.51;-0.51	5.09	5.09	0.68999	.	0.000000	0.53938	D	0.000055	T	0.78886	0.4354	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.82028	-0.0660	7	0.87932	D	0	-1.2265	17.2581	0.87063	0.0:0.0:1.0:0.0	.	.	.	.	I	156	ENSP00000391861:L156I;ENSP00000294635:L156I	ENSP00000294635:L156I	L	-	1	0	LRRC53	74718863	1.000000	0.71417	0.524000	0.27887	0.973000	0.67179	6.414000	0.73318	2.357000	0.79964	0.462000	0.41574	CTC	LRRC53	-	smart_Leu-rich_rpt_typical-subtyp		0.498	LRRC53-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	LRRC53	HGNC	protein_coding	OTTHUMT00000026515.2	G			74946275	-1	no_errors	ENST00000294635	ensembl	human	known	70_37	missense	SNP	0.820	T
MALAT1	378938	genome.wustl.edu	37	11	65265397	65265397	+	lincRNA	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr11:65265397C>T	ENST00000534336.1	+	0	165				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		GACGCAGCGACGAGTTGTGCT	0.582																																																	0													135.0	133.0	134.0					11																	65265397		874	1988	2862			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65265397C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-		0.582	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	C	NR_002819		65265397	+1	no_errors	ENST00000534336	ensembl	human	known	70_37	rna	SNP	0.001	T
MANEA	79694	genome.wustl.edu	37	6	96034516	96034516	+	Silent	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:96034516C>T	ENST00000358812.4	+	2	335	c.201C>T	c.(199-201)atC>atT	p.I67I	MANEA_ENST00000369293.1_Silent_p.I67I	NM_024641.3	NP_078917.2	Q5SRI9	MANEA_HUMAN	mannosidase, endo-alpha	67	Catalytic. {ECO:0000305}.				cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)			breast(2)|endometrium(3)|kidney(2)|liver(2)|lung(13)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)	26		all_cancers(76;1.01e-06)|Acute lymphoblastic leukemia(125;3.58e-09)|all_hematologic(75;1.22e-06)|all_epithelial(107;0.00433)|Colorectal(196;0.0341)		BRCA - Breast invasive adenocarcinoma(108;0.148)		GTGACAGAATCAACAGTGAAA	0.363																																																	0													84.0	86.0	85.0					6																	96034516		2203	4300	6503	SO:0001819	synonymous_variant	79694			AK022900	CCDS5032.1	6q16.2	2008-02-05			ENSG00000172469	ENSG00000172469			21072	protein-coding gene	gene with protein product		612327					Standard	NM_024641		Approved	FLJ12838, mandaselin	uc003poo.2	Q5SRI9	OTTHUMG00000016296	ENST00000358812.4:c.201C>T	6.37:g.96034516C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8M6|Q5SRJ0|Q6MZV0|Q70JE9|Q7Z3V7|Q8WWX5|Q9H9D2	Silent	SNP	superfamily_Glycoside_hydrolase_SF	p.I67	ENST00000358812.4	37	c.201	CCDS5032.1	6																																																																																			MANEA	-	NULL		0.363	MANEA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MANEA	HGNC	protein_coding	OTTHUMT00000043644.1	C	NM_024641		96034516	+1	no_errors	ENST00000358812	ensembl	human	known	70_37	silent	SNP	0.002	T
MIR522	574495	genome.wustl.edu	37	19	54255684	54255684	+	RNA	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr19:54255684C>G	ENST00000385071.1	+	0	87				MIR527_ENST00000385244.1_RNA|RNU6-751P_ENST00000516382.1_RNA|MIR519A1_ENST00000385257.1_RNA	NR_030217.1				microRNA 522																		GAAGCGCTTTCTGTTGTCTGA	0.418																																																	0													154.0	147.0	149.0					19																	54255684		1568	3582	5150			574496					19q13.42	2011-09-12		2008-12-18	ENSG00000207806	ENSG00000207806		"""ncRNAs / Micro RNAs"""	32127	non-coding RNA	RNA, micro				MIRN522			Standard	NR_030217		Approved	hsa-mir-522	uc021vat.1				19.37:g.54255684C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000385071.1	37	NULL		19																																																																																			MIR519A1	-	-		0.418	MIR522-201	KNOWN	basic	miRNA	MIR519A1	HGNC	miRNA		C	NR_030217		54255684	+1	no_errors	ENST00000385257	ensembl	human	known	70_37	rna	SNP	0.012	G
MPDZ	8777	genome.wustl.edu	37	9	13140127	13140127	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr9:13140127C>G	ENST00000319217.7	-	28	4109	c.3862G>C	c.(3862-3864)Gag>Cag	p.E1288Q	MPDZ_ENST00000541718.1_Missense_Mutation_p.E1288Q|MPDZ_ENST00000447879.1_Missense_Mutation_p.E1255Q|MPDZ_ENST00000546205.1_Missense_Mutation_p.E1302Q|MPDZ_ENST00000381022.2_Missense_Mutation_p.E1288Q|MPDZ_ENST00000538841.1_Missense_Mutation_p.E147Q|MPDZ_ENST00000536827.1_Missense_Mutation_p.E1255Q|MPDZ_ENST00000540202.1_5'UTR|MPDZ_ENST00000381015.4_Missense_Mutation_p.E1288Q	NM_001261406.1	NP_001248335.1	O75970	MPDZ_HUMAN	multiple PDZ domain protein	1288					cell adhesion (GO:0007155)|myelination (GO:0042552)|viral process (GO:0016032)	apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|neuron projection (GO:0043005)|postsynaptic membrane (GO:0045211)|Schmidt-Lanterman incisure (GO:0043220)|tight junction (GO:0005923)	protein C-terminus binding (GO:0008022)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(15)|ovary(5)|prostate(7)|stomach(1)|urinary_tract(2)	61				GBM - Glioblastoma multiforme(50;2.03e-06)		TTCTCTGGCTCTGACTCTGAC	0.478																																																	0													132.0	138.0	136.0					9																	13140127		1963	4159	6122	SO:0001583	missense	8777			AF093419	CCDS47951.1, CCDS59119.1, CCDS59120.1	9p23	2008-05-15			ENSG00000107186	ENSG00000107186			7208	protein-coding gene	gene with protein product		603785					Standard	NM_003829		Approved	MUPP1	uc003zlb.4	O75970	OTTHUMG00000021031	ENST00000319217.7:c.3862G>C	9.37:g.13140127C>G	ENSP00000320006:p.Glu1288Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLC2|B2RTS3|B7ZMI4|O43798|Q4LE30|Q5CZ80|Q5JTX3|Q5JTX6|Q5JTX7|Q5JUC3|Q5JUC4|Q5VZ62|Q8N790	Missense_Mutation	SNP	pfam_PDZ,pfam_L27_2,superfamily_PDZ,smart_PDZ,pfscan_L27,pfscan_PDZ	p.E1288Q	ENST00000319217.7	37	c.3862		9	.	.	.	.	.	.	.	.	.	.	C	18.05	3.536119	0.64972	.	.	ENSG00000107186	ENST00000319217;ENST00000541718;ENST00000381022;ENST00000545857;ENST00000538841;ENST00000536827;ENST00000447879;ENST00000381015;ENST00000399902;ENST00000546205;ENST00000433359	T;T;T;T;T;T;T;T;T;T	0.47869	2.89;2.84;2.84;2.7;2.83;2.88;2.93;2.89;2.88;0.83	5.94	5.02	0.67125	.	0.297938	0.23941	N	0.043045	T	0.60261	0.2255	M	0.63843	1.955	0.80722	D	1	P;B;P;D;P	0.63046	0.77;0.014;0.846;0.992;0.846	B;B;P;P;P	0.58210	0.432;0.019;0.557;0.835;0.557	T	0.56992	-0.7887	10	0.18710	T	0.47	.	16.9495	0.86240	0.0:0.8721:0.1279:0.0	.	1255;147;1255;1168;1288	B7ZMI4;B7ZB24;O75970-3;E7EPZ1;O75970-2	.;.;.;.;.	Q	1288;1288;1288;224;147;1255;1255;1288;1168;1302;110	ENSP00000320006:E1288Q;ENSP00000439807:E1288Q;ENSP00000370410:E1288Q;ENSP00000444230:E224Q;ENSP00000444717:E147Q;ENSP00000444151:E1255Q;ENSP00000415208:E1255Q;ENSP00000370403:E1288Q;ENSP00000446358:E1302Q;ENSP00000389705:E110Q	ENSP00000320006:E1288Q	E	-	1	0	MPDZ	13130127	0.988000	0.35896	0.368000	0.25939	0.817000	0.46193	2.962000	0.49176	1.474000	0.48178	0.557000	0.71058	GAG	MPDZ	-	NULL		0.478	MPDZ-001	KNOWN	not_organism_supported|basic	protein_coding	MPDZ	HGNC	protein_coding	OTTHUMT00000055485.2	C	NM_003829		13140127	-1	no_errors	ENST00000319217	ensembl	human	known	70_37	missense	SNP	0.965	G
MREG	55686	genome.wustl.edu	37	2	216809669	216809669	+	Nonsense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:216809669G>A	ENST00000263268.6	-	5	857	c.562C>T	c.(562-564)Cga>Tga	p.R188*		NM_018000.2	NP_060470.2	Q8N565	MREG_HUMAN	melanoregulin	188						plasma membrane (GO:0005886)				large_intestine(1)|lung(2)	3		Renal(323;0.0328)		Epithelial(149;4.64e-07)|all cancers(144;5.56e-05)|LUSC - Lung squamous cell carcinoma(224;0.00832)|Lung(261;0.0111)		GGGTAAGTTCGACGAGCAAGC	0.498																																																	0													60.0	59.0	59.0					2																	216809669		1903	4117	6020	SO:0001587	stop_gained	55686			AK000978	CCDS46513.1	2q35	2013-09-27			ENSG00000118242	ENSG00000118242			25478	protein-coding gene	gene with protein product		609207				19240024, 22275436	Standard	NM_018000		Approved	FLJ10116, DSU, WDT2	uc002vfo.3	Q8N565	OTTHUMG00000154828	ENST00000263268.6:c.562C>T	2.37:g.216809669G>A	ENSP00000263268:p.Arg188*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53R89|Q53TC1|Q5XKB6|Q9NWC9|Q9P1S1	Nonsense_Mutation	SNP	NULL	p.R188*	ENST00000263268.6	37	c.562	CCDS46513.1	2	.	.	.	.	.	.	.	.	.	.	G	28.7	4.947099	0.92593	.	.	ENSG00000118242	ENST00000236976;ENST00000263268	.	.	.	5.92	5.02	0.67125	.	1.032050	0.07595	N	0.922682	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	0.0694	13.2803	0.60210	0.0:0.1575:0.8425:0.0	.	.	.	.	X	188	.	ENSP00000236976:R188X	R	-	1	2	MREG	216517914	0.155000	0.22806	0.980000	0.43619	0.932000	0.56968	0.958000	0.29227	2.813000	0.96785	0.561000	0.74099	CGA	MREG	-	NULL		0.498	MREG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MREG	HGNC	protein_coding	OTTHUMT00000337297.1	G	NM_018000		216809669	-1	no_errors	ENST00000263268	ensembl	human	known	70_37	nonsense	SNP	0.683	A
MUC17	140453	genome.wustl.edu	37	7	100682525	100682525	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:100682525G>C	ENST00000306151.4	+	3	7892	c.7828G>C	c.(7828-7830)Gaa>Caa	p.E2610Q		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	2610	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)			NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					CACTTCTACTGAAACCAGTTC	0.448																																																	0													249.0	252.0	251.0					7																	100682525		2203	4300	6503	SO:0001583	missense	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.7828G>C	7.37:g.100682525G>C	ENSP00000302716:p.Glu2610Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O14761|Q685J2|Q8TDH7	Missense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.E2610Q	ENST00000306151.4	37	c.7828	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	G	0.165	-1.077274	0.01903	.	.	ENSG00000169876	ENST00000306151	T	0.02085	4.46	0.673	-0.319	0.12725	.	.	.	.	.	T	0.00967	0.0032	N	0.02539	-0.55	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.49072	-0.8977	9	0.13470	T	0.59	.	6.4507	0.21902	0.0:0.3075:0.6925:0.0	.	2610	Q685J3	MUC17_HUMAN	Q	2610	ENSP00000302716:E2610Q	ENSP00000302716:E2610Q	E	+	1	0	MUC17	100469245	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.513000	0.06305	-0.134000	0.11516	-1.525000	0.00928	GAA	MUC17	-	NULL		0.448	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	G	NM_001040105		100682525	+1	no_errors	ENST00000306151	ensembl	human	known	70_37	missense	SNP	0.001	C
MYH7B	57644	genome.wustl.edu	37	20	33587058	33587058	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr20:33587058C>T	ENST00000262873.7	+	34	4608	c.4516C>T	c.(4516-4518)Cgg>Tgg	p.R1506W		NM_020884.3	NP_065935.2	A7E2Y1	MYH7B_HUMAN	myosin, heavy chain 7B, cardiac muscle, beta	1464						membrane (GO:0016020)|myosin filament (GO:0032982)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(5)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(8)|lung(19)|ovary(5)|prostate(3)|upper_aerodigestive_tract(2)|urinary_tract(3)	54			BRCA - Breast invasive adenocarcinoma(18;0.00691)			GGAGGAACGGCGGCGGCAGGA	0.682																																																	0													20.0	38.0	32.0					20																	33587058		2147	4249	6396	SO:0001583	missense	57644			AB040945	CCDS42869.1	20q11	2011-09-27	2006-09-29		ENSG00000078814	ENSG00000078814		"""Myosins / Myosin superfamily : Class II"""	15906	protein-coding gene	gene with protein product		609928	"""myosin, heavy polypeptide 7B, cardiac muscle, beta"""			11919279, 15014174	Standard	XM_006723839		Approved	KIAA1512, dJ756N5.1, MYH14, MHC14	uc002xbi.2	A7E2Y1	OTTHUMG00000032320	ENST00000262873.7:c.4516C>T	20.37:g.33587058C>T	ENSP00000262873:p.Arg1506Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JVW7|Q6NT44|Q6NT57|Q6WG75|Q96I57|Q9NWE2|Q9P216	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Myosin_S1_N,superfamily_Prefoldin,superfamily_tRNA-bd_arm,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R1506W	ENST00000262873.7	37	c.4516	CCDS42869.1	20	.	.	.	.	.	.	.	.	.	.	C	20.9	4.065350	0.76187	.	.	ENSG00000078814	ENST00000262873	T	0.80214	-1.35	4.69	-1.83	0.07833	Myosin tail (1);	0.000000	0.32301	N	0.006296	D	0.86100	0.5852	M	0.69823	2.125	0.37070	D	0.89848	D	0.76494	0.999	D	0.63381	0.914	D	0.88579	0.3135	10	0.87932	D	0	.	16.0669	0.80891	0.8169:0.1831:0.0:0.0	.	1464	A7E2Y1	MYH7B_HUMAN	W	1506	ENSP00000262873:R1506W	ENSP00000262873:R1506W	R	+	1	2	MYH7B	33050719	1.000000	0.71417	0.997000	0.53966	0.988000	0.76386	3.186000	0.50942	-0.090000	0.12462	0.561000	0.74099	CGG	MYH7B	-	pfam_Myosin_tail		0.682	MYH7B-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH7B	HGNC	protein_coding	OTTHUMT00000078833.2	C	NM_020884		33587058	+1	no_errors	ENST00000262873	ensembl	human	novel	70_37	missense	SNP	1.000	T
MYO3B	140469	genome.wustl.edu	37	2	171264296	171264296	+	Silent	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:171264296G>A	ENST00000408978.4	+	22	2735	c.2592G>A	c.(2590-2592)ctG>ctA	p.L864L	MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000334231.6_Silent_p.L873L|MYO3B_ENST00000409044.3_Silent_p.L864L	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	864	Myosin motor.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						TTGTGGTCCTGAGAACGTCAG	0.443																																																	0													202.0	195.0	197.0					2																	171264296		1916	4136	6052	SO:0001819	synonymous_variant	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.2592G>A	2.37:g.171264296G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.L873	ENST00000408978.4	37	c.2619	CCDS42773.1	2																																																																																			MYO3B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.443	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	HGNC	protein_coding	OTTHUMT00000333410.1	G			171264296	+1	no_errors	ENST00000334231	ensembl	human	known	70_37	silent	SNP	1.000	A
NBPF1	55672	genome.wustl.edu	37	1	16889985	16889985	+	3'UTR	SNP	T	T	C	rs6603880	byFrequency	TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:16889985T>C	ENST00000430580.2	-	0	4760					NM_017940.3	NP_060410.2	Q3BBV0	NBPF1_HUMAN	neuroblastoma breakpoint family, member 1							cytoplasm (GO:0005737)									UCEC - Uterine corpus endometrioid carcinoma (279;0.00459)|BRCA - Breast invasive adenocarcinoma(304;7.52e-06)|COAD - Colon adenocarcinoma(227;1.05e-05)|Kidney(64;0.00016)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.179)		ATCCCTCCTGTGTTAAAGATG	0.428																																																	0																																										SO:0001624	3_prime_UTR_variant	55672			AB051480		1p36.13	2013-01-30			ENSG00000219481	ENSG00000219481		"""neuroblastoma breakpoint family"""	26088	protein-coding gene	gene with protein product		610501				11214970, 16079250	Standard	NM_017940		Approved	FLJ20719, KIAA1693	uc001ayw.4	Q3BBV0	OTTHUMG00000002487	ENST00000430580.2:c.*453A>G	1.37:g.16889985T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N4E8|Q9C0H0	RNA	SNP	-	NULL	ENST00000430580.2	37	NULL		1																																																																																			NBPF1	-	-		0.428	NBPF1-005	NOVEL	upstream_uORF|basic|appris_principal	protein_coding	NBPF1	HGNC	protein_coding	OTTHUMT00000106436.3	T	NM_017940		16889985	-1	no_errors	ENST00000401007	ensembl	human	known	70_37	rna	SNP	0.040	C
NUBPL	80224	genome.wustl.edu	37	14	32068519	32068519	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr14:32068519G>A	ENST00000281081.7	+	4	361	c.316G>A	c.(316-318)Gtg>Atg	p.V106M	NUBPL_ENST00000536705.1_Missense_Mutation_p.V10M	NM_001201573.1|NM_001201574.1|NM_025152.2	NP_001188502.1|NP_001188503.1|NP_079428.2	Q8TB37	NUBPL_HUMAN	nucleotide binding protein-like	106					mitochondrial respiratory chain complex I assembly (GO:0032981)|mitochondrion morphogenesis (GO:0070584)	mitochondrion (GO:0005739)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)			endometrium(1)|lung(2)|prostate(1)|skin(1)	5	Hepatocellular(127;0.0604)|Prostate(35;0.15)|Breast(36;0.214)		LUAD - Lung adenocarcinoma(48;0.00192)|Lung(238;0.00714)|BRCA - Breast invasive adenocarcinoma(188;0.0677)|STAD - Stomach adenocarcinoma(7;0.173)	GBM - Glioblastoma multiforme(265;0.0102)		TTTGCTAGATGTGGATGTGTA	0.318																																																	0													98.0	89.0	92.0					14																	32068519		1808	4089	5897	SO:0001583	missense	80224			AK022722	CCDS41940.1	14q12	2012-10-12	2005-01-07	2005-01-07	ENSG00000151413	ENSG00000151413		"""Mitochondrial respiratory chain complex assembly factors"""	20278	protein-coding gene	gene with protein product	"""iron-sulfur protein required for NADH dehydrogenase"""	613621	"""chromosome 14 open reading frame 127"""	C14orf127			Standard	NM_025152		Approved	FLJ12660, IND1, huInd1	uc001wrk.4	Q8TB37	OTTHUMG00000170521	ENST00000281081.7:c.316G>A	14.37:g.32068519G>A	ENSP00000281081:p.Val106Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DHZ1|Q86TZ4|Q9H9M2	Missense_Mutation	SNP	pfam_ATPase-like_ParA/MinD,pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_ATPase_MipZ/NubP2/Cfd1	p.V106M	ENST00000281081.7	37	c.316	CCDS41940.1	14	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158972	0.78226	.	.	ENSG00000151413	ENST00000281081;ENST00000551314;ENST00000536705	T;T;T	0.43688	0.94;0.97;0.94	5.4	5.4	0.78164	.	0.201880	0.51477	D	0.000091	T	0.42154	0.1190	N	0.21097	0.63	0.33240	D	0.557116	B;P	0.40282	0.26;0.711	B;P	0.47528	0.195;0.549	T	0.57545	-0.7793	10	0.87932	D	0	-0.8507	16.946	0.86230	0.0:0.0:1.0:0.0	.	10;106	B4DWB0;Q8TB37	.;NUBPL_HUMAN	M	106;54;10	ENSP00000281081:V106M;ENSP00000447234:V54M;ENSP00000439286:V10M	ENSP00000281081:V106M	V	+	1	0	NUBPL	31138270	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	6.967000	0.76079	2.553000	0.86117	0.491000	0.48974	GTG	NUBPL	-	pfam_CobQ/CobB/MinD/ParA_Nub-bd_dom,pfam_ATPase_MipZ/NubP2/Cfd1		0.318	NUBPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUBPL	HGNC	protein_coding	OTTHUMT00000409519.1	G	NM_025152		32068519	+1	no_errors	ENST00000281081	ensembl	human	known	70_37	missense	SNP	1.000	A
NVL	4931	genome.wustl.edu	37	1	224477278	224477278	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:224477278C>T	ENST00000281701.6	-	13	1742	c.1483G>A	c.(1483-1485)Gaa>Aaa	p.E495K	NVL_ENST00000469075.1_Missense_Mutation_p.E404K|NVL_ENST00000340871.4_Missense_Mutation_p.E306K|NVL_ENST00000361463.3_Missense_Mutation_p.E389K|NVL_ENST00000391875.2_Missense_Mutation_p.E389K|NVL_ENST00000482491.1_Missense_Mutation_p.E219K	NM_002533.3	NP_002524.2	O15381	NVL_HUMAN	nuclear VCP-like	495						membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)			breast(3)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(10)|lung(13)|ovary(1)|prostate(1)|skin(4)|soft_tissue(1)|urinary_tract(1)	42				GBM - Glioblastoma multiforme(131;0.00501)		TTCTGCTGTTCCTGTAGCTTC	0.478																																																	0													111.0	96.0	101.0					1																	224477278		2203	4300	6503	SO:0001583	missense	4931			U78772	CCDS1541.1, CCDS1542.1, CCDS58062.1, CCDS58063.1	1q41-q42.2	2010-04-21			ENSG00000143748	ENSG00000143748		"""ATPases / AAA-type"""	8070	protein-coding gene	gene with protein product	"""Nuclear valosin-containing protein-like"", ""nuclear VCP-like protein"""	602426				9286697	Standard	NM_002533		Approved		uc001hok.3	O15381	OTTHUMG00000037536	ENST00000281701.6:c.1483G>A	1.37:g.224477278C>T	ENSP00000281701:p.Glu495Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMC4|B4DP98|Q96EM7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,pfam_ATPase_AAA-2,pfam_ATPase_dyneun-rel_AAA,pfam_Zeta_toxin_domain,smart_AAA+_ATPase	p.E495K	ENST00000281701.6	37	c.1483	CCDS1541.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.75|11.75	1.730949|1.730949	0.30684|0.30684	.|.	.|.	ENSG00000143748|ENSG00000143748	ENST00000281701;ENST00000391875;ENST00000469075;ENST00000482491;ENST00000340871;ENST00000361463|ENST00000469968	D;D;D;D;D;D|.	0.95205|.	-3.49;-3.5;-3.49;-3.39;-3.36;-3.64|.	5.48|5.48	3.55|3.55	0.40652|0.40652	.|.	0.443131|.	0.25272|.	N|.	0.031862|.	T|T	0.33990|0.33990	0.0882|0.0882	L|L	0.31476|0.31476	0.935|0.935	0.09310|0.09310	N|N	1|1	B;B;B|.	0.11235|.	0.0;0.004;0.0|.	B;B;B|.	0.09377|.	0.001;0.004;0.001|.	T|T	0.18209|0.18209	-1.0344|-1.0344	10|5	0.07325|.	T|.	0.83|.	-4.4608|-4.4608	9.2778|9.2778	0.37709|0.37709	0.0:0.7321:0.1389:0.129|0.0:0.7321:0.1389:0.129	.|.	306;404;495|.	B4DMC4;B4DP98;O15381|.	.;.;NVL_HUMAN|.	K|E	495;389;404;219;306;389|377	ENSP00000281701:E495K;ENSP00000375747:E389K;ENSP00000417826:E404K;ENSP00000417213:E219K;ENSP00000341362:E306K;ENSP00000354779:E389K|.	ENSP00000281701:E495K|.	E|G	-|-	1|2	0|0	NVL|NVL	222543901|222543901	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.297000|0.297000	0.27493|0.27493	0.404000|0.404000	0.20999|0.20999	1.409000|1.409000	0.46915|0.46915	0.563000|0.563000	0.77884|0.77884	GAA|GGA	NVL	-	NULL		0.478	NVL-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NVL	HGNC	protein_coding	OTTHUMT00000091453.2	C	NM_002533		224477278	-1	no_errors	ENST00000281701	ensembl	human	known	70_37	missense	SNP	0.011	T
PACSIN3	29763	genome.wustl.edu	37	11	47204045	47204045	+	Silent	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr11:47204045G>A	ENST00000539589.1	-	4	462	c.120C>T	c.(118-120)gtC>gtT	p.V40V	PACSIN3_ENST00000298838.6_Silent_p.V40V	NM_001184975.1	NP_001171904.1	Q9UKS6	PACN3_HUMAN	protein kinase C and casein kinase substrate in neurons 3	40	F-BAR domain. {ECO:0000250}.|FCH. {ECO:0000255|PROSITE- ProRule:PRU00083}.				endocytosis (GO:0006897)|membrane tubulation (GO:0097320)|negative regulation of calcium ion transport (GO:0051926)|negative regulation of endocytosis (GO:0045806)|positive regulation of membrane protein ectodomain proteolysis (GO:0051044)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	calcium channel inhibitor activity (GO:0019855)|cytoskeletal protein binding (GO:0008092)|lipid binding (GO:0008289)			central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(5)	11						GGAAGCAGCTGACCAGGTCCC	0.657																																																	0													54.0	54.0	54.0					11																	47204045		2201	4298	6499	SO:0001819	synonymous_variant	29763			AF130979	CCDS31481.1	11p12-p11	2008-02-05				ENSG00000165912			8572	protein-coding gene	gene with protein product	"""syndapin III"""	606513				10531379	Standard	NM_016223		Approved	SDPIII	uc001ndx.3	Q9UKS6		ENST00000539589.1:c.120C>T	11.37:g.47204045G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NH84|Q9H331|Q9NWV9	Silent	SNP	pfam_FCH,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_FCH,smart_SH3_domain,pfscan_FCH,pfscan_SH3_domain,prints_SH3_domain	p.V40	ENST00000539589.1	37	c.120	CCDS31481.1	11																																																																																			PACSIN3	-	pfam_FCH,smart_FCH,pfscan_FCH		0.657	PACSIN3-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PACSIN3	HGNC	protein_coding	OTTHUMT00000391632.1	G	NM_016223		47204045	-1	no_errors	ENST00000298838	ensembl	human	known	70_37	silent	SNP	1.000	A
PARD3B	117583	genome.wustl.edu	37	2	206165403	206165403	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:206165403G>A	ENST00000406610.2	+	17	2542	c.2335G>A	c.(2335-2337)Gag>Aag	p.E779K	PARD3B_ENST00000349953.3_Missense_Mutation_p.E779K|PARD3B_ENST00000462231.1_Missense_Mutation_p.E779K|PARD3B_ENST00000358768.2_Missense_Mutation_p.E717K|PARD3B_ENST00000351153.1_Intron	NM_057177.6|NM_152526.5|NM_205863.3	NP_476518.4|NP_689739.4|NP_995585.2	Q8TEW8	PAR3L_HUMAN	par-3 family cell polarity regulator beta	779					cell cycle (GO:0007049)|cell division (GO:0051301)	membrane (GO:0016020)|tight junction (GO:0005923)				breast(1)|endometrium(9)|kidney(2)|large_intestine(6)|liver(4)|lung(33)|ovary(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)	65		all_cancers(1;2.88e-06)|all_epithelial(1;3.23e-06)		Epithelial(149;0.0739)		AGGCTGCAATGAGAGCTTTAG	0.507																																																	0													99.0	102.0	101.0					2																	206165403		1929	4141	6070	SO:0001583	missense	117583			AB053321	CCDS42804.1, CCDS42805.1, CCDS42806.1	2q33.3	2013-08-28	2013-08-28	2006-09-28	ENSG00000116117	ENSG00000116117			14446	protein-coding gene	gene with protein product			"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 19"", ""par-3 partitioning defective 3 homolog B (C. elegans)"""	ALS2CR19		11586298, 12459187	Standard	NM_057177		Approved	Par3L, PAR3beta	uc002vap.2	Q8TEW8	OTTHUMG00000154562	ENST00000406610.2:c.2335G>A	2.37:g.206165403G>A	ENSP00000385848:p.Glu779Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PE87|Q8IUC7|Q8IUC9|Q96DK9|Q96N09|Q96NX6|Q96NX7|Q96Q29	Missense_Mutation	SNP	pfam_DUF3534,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E779K	ENST00000406610.2	37	c.2335		2	.	.	.	.	.	.	.	.	.	.	G	29.8	5.040068	0.93630	.	.	ENSG00000116117	ENST00000406610;ENST00000358768;ENST00000349953	T;T;T	0.31769	1.48;1.48;1.48	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.58764	0.2145	M	0.75615	2.305	0.46954	D	0.999264	D;D;D	0.71674	0.998;0.997;0.991	D;D;D	0.77004	0.989;0.981;0.919	T	0.57300	-0.7835	10	0.51188	T	0.08	.	19.9376	0.97146	0.0:0.0:1.0:0.0	.	779;717;779	Q8TEW8;Q8TEW8-2;Q8TEW8-5	PAR3L_HUMAN;.;.	K	779;717;779	ENSP00000385848:E779K;ENSP00000351618:E717K;ENSP00000340280:E779K	ENSP00000340280:E779K	E	+	1	0	PARD3B	205873648	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	5.712000	0.68407	2.711000	0.92665	0.655000	0.94253	GAG	PARD3B	-	NULL		0.507	PARD3B-001	KNOWN	basic|appris_candidate_longest	protein_coding	PARD3B	HGNC	protein_coding	OTTHUMT00000335992.1	G	NM_057177		206165403	+1	no_errors	ENST00000406610	ensembl	human	known	70_37	missense	SNP	1.000	A
PDE4B	5142	genome.wustl.edu	37	1	66828900	66828900	+	Missense_Mutation	SNP	G	G	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:66828900G>C	ENST00000329654.4	+	11	1257	c.1070G>C	c.(1069-1071)gGa>gCa	p.G357A	PDE4B_ENST00000371045.5_Missense_Mutation_p.G185A|PDE4B_ENST00000371049.3_Missense_Mutation_p.G357A|PDE4B_ENST00000423207.2_Missense_Mutation_p.G342A|PDE4B_ENST00000480109.2_Missense_Mutation_p.G124A	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific	357					cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	AATGTGGCTGGATATTCTCAC	0.373																																																	0													93.0	91.0	92.0					1																	66828900		2203	4300	6503	SO:0001583	missense	5142			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.1070G>C	1.37:g.66828900G>C	ENSP00000332116:p.Gly357Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom,prints_PDEase	p.G357A	ENST00000329654.4	37	c.1070	CCDS632.1	1	.	.	.	.	.	.	.	.	.	.	G	13.06	2.124669	0.37533	.	.	ENSG00000184588	ENST00000329654;ENST00000341517;ENST00000371049;ENST00000423207;ENST00000371045;ENST00000531025;ENST00000526197;ENST00000480109	T;T;T;T;T;T;T;T	0.69561	-0.41;-0.41;-0.41;-0.41;-0.41;2.03;2.04;-0.41	5.96	5.96	0.96718	5&apos (1);-cyclic nucleotide phosphodiesterase, catalytic domain (1);3&apos (1);	0.210963	0.50627	D	0.000112	T	0.34919	0.0914	N	0.08118	0	0.39423	D	0.966941	B;B;B;B;B	0.12013	0.0;0.001;0.005;0.0;0.001	B;B;B;B;B	0.09377	0.001;0.002;0.004;0.001;0.001	T	0.27088	-1.0084	10	0.52906	T	0.07	.	15.8507	0.78927	0.0:0.1349:0.8651:0.0	.	124;342;227;347;357	A5YW33;Q07343-3;Q13945;Q59GM8;Q07343	.;.;.;.;PDE4B_HUMAN	A	357;357;357;342;185;138;138;124	ENSP00000332116:G357A;ENSP00000342637:G357A;ENSP00000360088:G357A;ENSP00000392947:G342A;ENSP00000360084:G185A;ENSP00000437249:G138A;ENSP00000436104:G138A;ENSP00000432592:G124A	ENSP00000332116:G357A	G	+	2	0	PDE4B	66601488	1.000000	0.71417	1.000000	0.80357	0.413000	0.31143	5.270000	0.65547	2.831000	0.97527	0.650000	0.86243	GGA	PDE4B	-	NULL		0.373	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	G	NM_002600		66828900	+1	no_errors	ENST00000329654	ensembl	human	known	70_37	missense	SNP	0.999	C
PEX6	5190	genome.wustl.edu	37	6	42935238	42935238	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:42935238C>G	ENST00000304611.8	-	8	1821	c.1752G>C	c.(1750-1752)caG>caC	p.Q584H	PEX6_ENST00000244546.4_Missense_Mutation_p.Q584H	NM_000287.3	NP_000278.3	Q13608	PEX6_HUMAN	peroxisomal biogenesis factor 6	584					ATP catabolic process (GO:0006200)|peroxisome organization (GO:0007031)|protein import into peroxisome matrix, translocation (GO:0016561)|protein stabilization (GO:0050821)|protein targeting to peroxisome (GO:0006625)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisomal membrane (GO:0005778)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|ATPase activity, coupled (GO:0042623)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)			NS(1)|breast(1)|endometrium(2)|large_intestine(2)|lung(5)|ovary(1)|prostate(3)	15			all cancers(41;0.00235)|Colorectal(64;0.00237)|COAD - Colon adenocarcinoma(64;0.00473)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.0562)			GAAATGCTGTCTGCACATCAG	0.647																																																	0													40.0	35.0	36.0					6																	42935238		2203	4300	6503	SO:0001583	missense	5190			U56602	CCDS4877.1	6p22-p11	2010-04-21			ENSG00000124587	ENSG00000124587		"""ATPases / AAA-type"""	8859	protein-coding gene	gene with protein product		601498				8670792	Standard	NM_000287		Approved	PXAAA1, PAF-2	uc003otf.3	Q13608	OTTHUMG00000014713	ENST00000304611.8:c.1752G>C	6.37:g.42935238C>G	ENSP00000303511:p.Gln584His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T8W1|Q8WYQ0|Q8WYQ1|Q8WYQ2|Q99476	Missense_Mutation	SNP	pfam_ATPase_AAA_core,smart_AAA+_ATPase	p.Q584H	ENST00000304611.8	37	c.1752	CCDS4877.1	6	.	.	.	.	.	.	.	.	.	.	C	14.60	2.582651	0.46006	.	.	ENSG00000124587	ENST00000304611;ENST00000244546	T;T	0.78481	-1.18;-1.18	5.27	4.35	0.52113	ATPase, AAA-type, core (1);ATPase, AAA+ type, core (1);	0.527136	0.20690	N	0.087470	T	0.61400	0.2344	L	0.46157	1.445	0.38739	D	0.953839	B	0.13145	0.007	B	0.14578	0.011	T	0.66909	-0.5804	10	0.87932	D	0	-11.6035	12.6981	0.57016	0.1644:0.8356:0.0:0.0	.	584	Q13608	PEX6_HUMAN	H	584	ENSP00000303511:Q584H;ENSP00000244546:Q584H	ENSP00000244546:Q584H	Q	-	3	2	PEX6	43043216	1.000000	0.71417	1.000000	0.80357	0.935000	0.57460	1.068000	0.30629	2.454000	0.82982	0.561000	0.74099	CAG	PEX6	-	pfam_ATPase_AAA_core,smart_AAA+_ATPase		0.647	PEX6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PEX6	HGNC	protein_coding	OTTHUMT00000040569.1	C	NM_000287		42935238	-1	no_errors	ENST00000304611	ensembl	human	known	70_37	missense	SNP	1.000	G
PKHD1L1	93035	genome.wustl.edu	37	8	110497378	110497378	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr8:110497378G>A	ENST00000378402.5	+	58	9786	c.9682G>A	c.(9682-9684)Gat>Aat	p.D3228N		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	3228					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			CATTCTTAATGATAGCCTTTC	0.313										HNSCC(38;0.096)																																							0													119.0	119.0	119.0					8																	110497378		1829	4080	5909	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.9682G>A	8.37:g.110497378G>A	ENSP00000367655:p.Asp3228Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.D3228N	ENST00000378402.5	37	c.9682	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	12.52	1.963069	0.34659	.	.	ENSG00000205038	ENST00000378402;ENST00000526472	D;D	0.85411	-1.98;-1.8	5.3	4.39	0.52855	Pectin lyase fold/virulence factor (1);	0.468936	0.22432	N	0.060122	T	0.74076	0.3669	N	0.17723	0.515	0.23903	N	0.996515	B	0.17852	0.024	B	0.22386	0.039	T	0.56571	-0.7957	10	0.16896	T	0.51	.	13.0823	0.59121	0.0:0.0:0.8391:0.1609	.	3228	Q86WI1	PKHL1_HUMAN	N	3228;156	ENSP00000367655:D3228N;ENSP00000437376:D156N	ENSP00000367655:D3228N	D	+	1	0	PKHD1L1	110566554	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	2.950000	0.49081	2.463000	0.83235	0.563000	0.77884	GAT	PKHD1L1	-	superfamily_Pectin_lyase_fold/virulence		0.313	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	G	NM_177531		110497378	+1	no_errors	ENST00000378402	ensembl	human	known	70_37	missense	SNP	1.000	A
PLCH1	23007	genome.wustl.edu	37	3	155203347	155203347	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr3:155203347G>T	ENST00000340059.7	-	22	2795	c.2796C>A	c.(2794-2796)agC>agA	p.S932R	PLCH1_ENST00000334686.6_Missense_Mutation_p.S894R|PLCH1_ENST00000494598.1_Missense_Mutation_p.S912R|PLCH1_ENST00000414191.1_Missense_Mutation_p.S894R|PLCH1_ENST00000447496.2_Missense_Mutation_p.S932R|PLCH1-AS2_ENST00000472913.1_RNA|PLCH1_ENST00000460012.1_Missense_Mutation_p.S894R	NM_001130960.1	NP_001124432.1	Q4KWH8	PLCH1_HUMAN	phospholipase C, eta 1	932					inositol phosphate metabolic process (GO:0043647)|lipid catabolic process (GO:0016042)|phosphatidylinositol-mediated signaling (GO:0048015)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase C activity (GO:0050429)|phosphatidylinositol phospholipase C activity (GO:0004435)|signal transducer activity (GO:0004871)			NS(3)|breast(3)|endometrium(9)|kidney(4)|large_intestine(20)|lung(45)|ovary(2)|prostate(5)|skin(8)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	107			Lung(72;0.11)|LUSC - Lung squamous cell carcinoma(72;0.114)			AGCCCATTTTGCTCTTTTTCC	0.493																																																	0													153.0	142.0	146.0					3																	155203347		2203	4300	6503	SO:0001583	missense	23007			AB028992	CCDS33881.1, CCDS46939.1, CCDS46940.1	3q25	2013-01-10	2006-03-16	2006-03-16	ENSG00000114805	ENSG00000114805	3.1.4.11	"""EF-hand domain containing"""	29185	protein-coding gene	gene with protein product		612835	"""phospholipase C-like 3"""	PLCL3		15702972	Standard	NM_014996		Approved	KIAA1069, MGC117152, DKFZp434C1372, PLCeta1	uc021xge.1	Q4KWH8	OTTHUMG00000158477	ENST00000340059.7:c.2796C>A	3.37:g.155203347G>T	ENSP00000345988:p.Ser932Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q29RV9|Q4KWH9|Q68CN0|Q86XK4|Q9H9U2|Q9UPT3	Missense_Mutation	SNP	pfam_PLipase_C_PInositol-sp_X_dom,pfam_PLipase_C_Pinositol-sp_Y,pfam_PLipase_C_EF-hand-like,pfam_C2_Ca-dep,superfamily_PLC-like_Pdiesterase_TIM-brl,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Pleckstrin_homology,smart_EF_hand_Ca-bd,smart_PLipase_C_PInositol-sp_X_dom,smart_PLipase_C_Pinositol-sp_Y,smart_C2_Ca-dep,pfscan_EF_HAND_2,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_PLipase_C_Pinositol-sp_Y,prints_Pinositol_PLipase_C	p.S932R	ENST00000340059.7	37	c.2796	CCDS46939.1	3	.	.	.	.	.	.	.	.	.	.	G	23.7	4.450237	0.84101	.	.	ENSG00000114805	ENST00000494598;ENST00000460012;ENST00000447496;ENST00000340059;ENST00000334686;ENST00000414191	T;T;T;T;T;T	0.32272	1.99;1.92;1.46;1.83;1.92;1.92	5.88	5.0	0.66597	.	0.270333	0.43747	D	0.000530	T	0.47488	0.1448	L	0.54323	1.7	0.48135	D	0.999592	D;D;P	0.65815	0.995;0.992;0.696	D;P;B	0.64237	0.923;0.84;0.419	T	0.16928	-1.0386	10	0.33940	T	0.23	.	15.4227	0.75025	0.0677:0.0:0.9323:0.0	.	894;932;932	Q4KWH8-2;Q4KWH8;Q4KWH8-3	.;PLCH1_HUMAN;.	R	912;894;932;932;894;894	ENSP00000419100:S912R;ENSP00000417502:S894R;ENSP00000402759:S932R;ENSP00000345988:S932R;ENSP00000335469:S894R;ENSP00000412977:S894R	ENSP00000335469:S894R	S	-	3	2	PLCH1	156686041	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	0.875000	0.28079	2.789000	0.95967	0.655000	0.94253	AGC	PLCH1	-	NULL		0.493	PLCH1-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLCH1	HGNC	protein_coding	OTTHUMT00000351125.1	G	NM_014996		155203347	-1	no_errors	ENST00000340059	ensembl	human	known	70_37	missense	SNP	1.000	T
PON3	5446	genome.wustl.edu	37	7	95025649	95025649	+	Missense_Mutation	SNP	A	A	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:95025649A>G	ENST00000265627.5	-	1	24	c.14T>C	c.(13-15)gTg>gCg	p.V5A	PON3_ENST00000427422.1_Missense_Mutation_p.V5A|PON3_ENST00000451904.1_Missense_Mutation_p.V5A|PON3_ENST00000475439.1_5'Flank|PON1_ENST00000542556.1_Missense_Mutation_p.V5A	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	5					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	GACCAGCGCCACGAGCTTCCC	0.677																																																	0													91.0	82.0	85.0					7																	95025649		2203	4300	6503	SO:0001583	missense	5444			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.14T>C	7.37:g.95025649A>G	ENSP00000265627:p.Val5Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2,prints_Paraoxonase1	p.V5A	ENST00000265627.5	37	c.14	CCDS5639.1	7	.	.	.	.	.	.	.	.	.	.	A	13.46	2.242980	0.39697	.	.	ENSG00000005421;ENSG00000105852;ENSG00000105852	ENST00000542556;ENST00000265627;ENST00000427422	T;T;T	0.40225	1.04;1.04;1.31	4.45	3.31	0.37934	Six-bladed beta-propeller, TolB-like (1);	0.849335	0.10580	N	0.658080	T	0.31420	0.0796	L	0.35723	1.085	0.09310	N	1	B;B;B	0.14438	0.01;0.001;0.001	B;B;B	0.08055	0.003;0.002;0.001	T	0.19031	-1.0318	10	0.39692	T	0.17	-1.1973	6.6476	0.22945	0.8951:0.0:0.1049:0.0	.	5;5;5	B4E2I0;F5H4W9;Q15166	.;.;PON3_HUMAN	A	5	ENSP00000444854:V5A;ENSP00000265627:V5A;ENSP00000413276:V5A	ENSP00000444854:V5A	V	-	2	0	PON1;PON3	94863585	0.069000	0.21087	0.052000	0.19188	0.692000	0.40212	1.905000	0.39878	1.053000	0.40415	0.459000	0.35465	GTG	PON1	-	NULL		0.677	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON1	HGNC	protein_coding	OTTHUMT00000333007.1	A	NM_000940		95025649	-1	no_errors	ENST00000542556	ensembl	human	known	70_37	missense	SNP	0.056	G
PXDNL	137902	genome.wustl.edu	37	8	52359699	52359699	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr8:52359699G>T	ENST00000356297.4	-	12	1490	c.1390C>A	c.(1390-1392)Cag>Aag	p.Q464K	PXDNL_ENST00000543296.1_Missense_Mutation_p.Q464K	NM_144651.4	NP_653252	A1KZ92	PXDNL_HUMAN	peroxidasin homolog (Drosophila)-like	464	Ig-like C2-type 3.				hydrogen peroxide catabolic process (GO:0042744)|oxidation-reduction process (GO:0055114)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)	endonuclease activity (GO:0004519)|heme binding (GO:0020037)|metal ion binding (GO:0046872)|peroxidase activity (GO:0004601)			NS(1)|breast(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(6)|lung(25)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	48		all_cancers(86;0.107)|Lung NSC(129;0.00641)|all_epithelial(80;0.00716)|all_lung(136;0.015)				ACTGTATGCTGGCCTTCCACA	0.512																																																	0													109.0	107.0	107.0					8																	52359699		2028	4190	6218	SO:0001583	missense	137902				CCDS47855.1	8q11.21-q11.22	2013-02-18	2007-01-12		ENSG00000147485	ENSG00000147485		"""Immunoglobulin superfamily / I-set domain containing"""	26359	protein-coding gene	gene with protein product	"""polysomal ribonuclease 1 homolog (Xenopus)"""	615904	"""peroxidasin homolog-like (Drosophila)"""			22543864	Standard	NM_144651		Approved	FLJ25471, PMR1	uc003xqu.4	A1KZ92	OTTHUMG00000164244	ENST00000356297.4:c.1390C>A	8.37:g.52359699G>T	ENSP00000348645:p.Gln464Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B5ME43|B6CGZ3|H0YBM9|Q6ZMR2|Q96LH9	Missense_Mutation	SNP	pfam_Haem_peroxidase_animal,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_VWF_C,pfam_Leu-rich_rpt,superfamily_Haem_peroxidase,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,smart_VWF_C,pfscan_VWF_C,pfscan_Haem_peroxidase_animal,pfscan_Ig-like,prints_Haem_peroxidase_animal_subgr	p.Q464K	ENST00000356297.4	37	c.1390	CCDS47855.1	8	.	.	.	.	.	.	.	.	.	.	G	2.349	-0.349263	0.05173	.	.	ENSG00000147485	ENST00000356297;ENST00000543296	T;T	0.80909	-1.43;-1.43	3.89	3.01	0.34805	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.61578	0.2358	N	0.11341	0.13	0.19945	N	0.99994	B	0.02656	0.0	B	0.08055	0.003	T	0.48547	-0.9026	9	0.30078	T	0.28	.	7.3871	0.26888	0.1282:0.0:0.8718:0.0	.	464	A1KZ92	PXDNL_HUMAN	K	464	ENSP00000348645:Q464K;ENSP00000444865:Q464K	ENSP00000348645:Q464K	Q	-	1	0	PXDNL	52522252	0.000000	0.05858	0.001000	0.08648	0.065000	0.16274	0.546000	0.23284	0.613000	0.30089	0.467000	0.42956	CAG	PXDNL	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.512	PXDNL-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PXDNL	HGNC	protein_coding	OTTHUMT00000377905.1	G	NM_144651		52359699	-1	no_errors	ENST00000356297	ensembl	human	known	70_37	missense	SNP	0.685	T
PZP	5858	genome.wustl.edu	37	12	9307355	9307355	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr12:9307355C>T	ENST00000261336.2	-	29	3659	c.3631G>A	c.(3631-3633)Gag>Aag	p.E1211K	PZP_ENST00000381997.2_Missense_Mutation_p.E997K	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	1211					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)			breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						ATCTCCACCTCAGCAGAGGGA	0.562																																					Melanoma(125;1402 1695 4685 34487 38571)												0													81.0	78.0	79.0					12																	9307355		2203	4300	6503	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.3631G>A	12.37:g.9307355C>T	ENSP00000261336:p.Glu1211Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.E1211K	ENST00000261336.2	37	c.3631	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	C	22.0	4.229464	0.79688	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.34072	1.38;1.38	3.73	2.83	0.33086	Terpenoid cylases/protein prenyltransferase alpha-alpha toroid (1);A-macroglobulin complement component (1);	0.218651	0.29932	U	0.010821	T	0.63920	0.2552	M	0.89785	3.06	0.29202	N	0.875122	P;D	0.89917	0.521;1.0	B;D	0.83275	0.158;0.996	T	0.63941	-0.6523	10	0.87932	D	0	.	11.4	0.49864	0.0:0.9065:0.0:0.0935	.	997;1211	P20742-2;P20742	.;PZP_HUMAN	K	1211;997	ENSP00000261336:E1211K;ENSP00000371427:E997K	ENSP00000261336:E1211K	E	-	1	0	PZP	9198622	0.965000	0.33210	0.999000	0.59377	0.970000	0.65996	1.619000	0.36965	0.868000	0.35678	-0.251000	0.11542	GAG	PZP	-	pfam_A2M_comp,superfamily_Terpenoid_cyclase/PrenylTrfase		0.562	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	C	NM_002864		9307355	-1	no_errors	ENST00000261336	ensembl	human	known	70_37	missense	SNP	1.000	T
RAB8A	4218	genome.wustl.edu	37	19	16238844	16238844	+	Silent	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr19:16238844C>G	ENST00000300935.3	+	6	696	c.423C>G	c.(421-423)ctC>ctG	p.L141L	CTD-2231E14.8_ENST00000597983.1_RNA|RAB8A_ENST00000586682.1_Silent_p.L141L	NM_005370.4	NP_005361.2	P61006	RAB8A_HUMAN	RAB8A, member RAS oncogene family	141					axonogenesis (GO:0007409)|cellular response to insulin stimulus (GO:0032869)|cilium assembly (GO:0042384)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi vesicle fusion to target membrane (GO:0048210)|GTP catabolic process (GO:0006184)|membrane organization (GO:0061024)|mitotic cell cycle (GO:0000278)|protein localization to plasma membrane (GO:0072659)|protein transport (GO:0015031)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of protein transport (GO:0051223)|small GTPase mediated signal transduction (GO:0007264)|vesicle docking involved in exocytosis (GO:0006904)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|cilium (GO:0005929)|cytoplasmic vesicle membrane (GO:0030659)|dendrite (GO:0030425)|extracellular vesicular exosome (GO:0070062)|Golgi membrane (GO:0000139)|neuronal cell body (GO:0043025)|nonmotile primary cilium (GO:0031513)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|primary cilium (GO:0072372)|recycling endosome membrane (GO:0055038)|trans-Golgi network transport vesicle (GO:0030140)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)|Rab GTPase binding (GO:0017137)			endometrium(2)|large_intestine(1)|lung(2)|prostate(2)|skin(1)	8						AGCTGGCCCTCGACTATGGAA	0.612																																																	0													84.0	68.0	73.0					19																	16238844		2203	4300	6503	SO:0001819	synonymous_variant	4218				CCDS12339.1	19p13.2-p13.1	2008-05-14	2004-01-30	2004-01-30		ENSG00000167461		"""RAB, member RAS oncogene"""	7007	protein-coding gene	gene with protein product		165040	"""mel transforming oncogene (derived from cell line NK14)"""	MEL		1886711, 8408203	Standard	NM_005370		Approved	RAB8	uc002ndn.4	P61006		ENST00000300935.3:c.423C>G	19.37:g.16238844C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DEK7|P24407|Q6FHV5	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_Gtr1_RagA,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.L141	ENST00000300935.3	37	c.423	CCDS12339.1	19																																																																																			RAB8A	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_ARF,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,tigrfam_Small_GTP-bd_dom		0.612	RAB8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB8A	HGNC	protein_coding	OTTHUMT00000460186.1	C	NM_005370		16238844	+1	no_errors	ENST00000300935	ensembl	human	known	70_37	silent	SNP	0.861	G
RBM33	155435	genome.wustl.edu	37	7	155537712	155537712	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr7:155537712C>T	ENST00000401878.3	+	14	2593	c.2395C>T	c.(2395-2397)Cgc>Tgc	p.R799C	RBM33_ENST00000341148.3_5'Flank	NM_053043.2	NP_444271.2	Q96EV2	RBM33_HUMAN	RNA binding motif protein 33	799							nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(3)|cervix(1)|endometrium(8)|kidney(3)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	27	all_neural(206;0.101)	all_hematologic(28;0.0592)	OV - Ovarian serous cystadenocarcinoma(82;0.011)	UCEC - Uterine corpus endometrioid carcinoma (81;0.2)		AGAACAGAAACGCCTAAGAGA	0.458																																																	0													25.0	26.0	26.0					7																	155537712		2203	4300	6503	SO:0001583	missense	155435			AL832196	CCDS5941.2	7q36.3	2013-02-12			ENSG00000184863	ENSG00000184863		"""RNA binding motif (RRM) containing"""	27223	protein-coding gene	gene with protein product			"""proline rich 8"""	PRR8			Standard	NM_053043		Approved	DKFZp686F102, MGC20460, DKFZp434D1319	uc010lqk.1	Q96EV2	OTTHUMG00000150260	ENST00000401878.3:c.2395C>T	7.37:g.155537712C>T	ENSP00000384160:p.Arg799Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D244|B5MC24|Q52LF5|Q75LN9|Q75ML5|Q9NSV0	Missense_Mutation	SNP	smart_RRM_dom	p.R799C	ENST00000401878.3	37	c.2395	CCDS5941.2	7	.	.	.	.	.	.	.	.	.	.	C	26.5	4.739281	0.89573	.	.	ENSG00000184863	ENST00000401878	T	0.61627	0.09	5.95	5.95	0.96441	.	0.000000	0.64402	D	0.000002	T	0.76040	0.3932	M	0.63843	1.955	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.998	T	0.76187	-0.3051	10	0.87932	D	0	.	20.3932	0.98965	0.0:1.0:0.0:0.0	.	516;799	B4DVQ2;Q96EV2	.;RBM33_HUMAN	C	799	ENSP00000384160:R799C	ENSP00000384160:R799C	R	+	1	0	RBM33	155230473	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.138000	0.77305	2.824000	0.97209	0.655000	0.94253	CGC	RBM33	-	NULL		0.458	RBM33-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RBM33	HGNC	protein_coding	OTTHUMT00000317225.3	C	NM_001008408		155537712	+1	no_errors	ENST00000401878	ensembl	human	known	70_37	missense	SNP	1.000	T
SOCS3	9021	genome.wustl.edu	37	17	76355089	76355089	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr17:76355089C>T	ENST00000330871.2	-	2	503	c.88G>A	c.(88-90)Gag>Aag	p.E30K	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	30	Kinase inhibitory region (KIR).				branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			AGCTGGTACTCGCTCTTGGAG	0.667																																																	0													13.0	12.0	12.0					17																	76355089		2183	4290	6473	SO:0001583	missense	9021			AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.88G>A	17.37:g.76355089C>T	ENSP00000330341:p.Glu30Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O14509	Missense_Mutation	SNP	pfam_SH2,pfam_SOCS_C,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.E30K	ENST00000330871.2	37	c.88	CCDS11756.1	17	.	.	.	.	.	.	.	.	.	.	C	16.32	3.089541	0.55968	.	.	ENSG00000184557	ENST00000330871	T	0.44482	0.92	4.16	4.16	0.48862	SH2 motif (1);	0.123969	0.53938	D	0.000044	T	0.31513	0.0799	L	0.44542	1.39	0.48571	D	0.999676	P	0.45569	0.861	B	0.29353	0.101	T	0.42015	-0.9476	10	0.66056	D	0.02	-18.8506	16.4477	0.83947	0.0:1.0:0.0:0.0	.	30	O14543	SOCS3_HUMAN	K	30	ENSP00000330341:E30K	ENSP00000330341:E30K	E	-	1	0	SOCS3	73866684	1.000000	0.71417	1.000000	0.80357	0.616000	0.37450	5.497000	0.66924	1.858000	0.53909	0.467000	0.42956	GAG	SOCS3	-	NULL		0.667	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS3	HGNC	protein_coding	OTTHUMT00000437300.1	C			76355089	-1	no_errors	ENST00000330871	ensembl	human	known	70_37	missense	SNP	1.000	T
SOCS3	9021	genome.wustl.edu	37	17	76355093	76355093	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr17:76355093C>G	ENST00000330871.2	-	2	499	c.84G>C	c.(82-84)aaG>aaC	p.K28N	RP11-806H10.4_ENST00000592569.1_lincRNA	NM_003955.3	NP_003946.3	O14543	SOCS3_HUMAN	suppressor of cytokine signaling 3	28	Kinase inhibitory region (KIR).				branching involved in labyrinthine layer morphogenesis (GO:0060670)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of apoptotic process (GO:0043066)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of protein kinase activity (GO:0006469)|placenta blood vessel development (GO:0060674)|positive regulation of cell differentiation (GO:0045597)|protein ubiquitination (GO:0016567)|regulation of growth (GO:0040008)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|spongiotrophoblast differentiation (GO:0060708)|trophoblast giant cell differentiation (GO:0060707)|type I interferon signaling pathway (GO:0060337)	cytosol (GO:0005829)	protein kinase inhibitor activity (GO:0004860)			kidney(1)|lung(2)|ovary(1)|pancreas(1)|skin(1)	6			BRCA - Breast invasive adenocarcinoma(99;0.000688)|OV - Ovarian serous cystadenocarcinoma(97;0.0554)			GGTACTCGCTCTTGGAGCTGA	0.667																																																	0													12.0	11.0	12.0					17																	76355093		2186	4289	6475	SO:0001583	missense	9021			AB004904	CCDS11756.1	17q25.3	2014-09-17						"""Suppressors of cytokine signaling"", ""SH2 domain containing"""	19391	protein-coding gene	gene with protein product		604176				9266833, 9344848	Standard	NM_003955		Approved	SSI-3, CIS3, SOCS-3, Cish3	uc002jvl.2	O14543		ENST00000330871.2:c.84G>C	17.37:g.76355093C>G	ENSP00000330341:p.Lys28Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O14509	Missense_Mutation	SNP	pfam_SH2,pfam_SOCS_C,smart_SH2,smart_SOCS_C,pfscan_SOCS_C,pfscan_SH2	p.K28N	ENST00000330871.2	37	c.84	CCDS11756.1	17	.	.	.	.	.	.	.	.	.	.	C	13.42	2.230839	0.39399	.	.	ENSG00000184557	ENST00000330871	T	0.48522	0.81	4.16	2.08	0.27032	.	0.310057	0.29480	N	0.012027	T	0.34337	0.0894	L	0.52573	1.65	0.41278	D	0.986893	P	0.48764	0.915	B	0.38428	0.273	T	0.13980	-1.0489	10	0.51188	T	0.08	-14.499	5.8842	0.18872	0.0:0.6641:0.1578:0.1781	.	28	O14543	SOCS3_HUMAN	N	28	ENSP00000330341:K28N	ENSP00000330341:K28N	K	-	3	2	SOCS3	73866688	1.000000	0.71417	1.000000	0.80357	0.644000	0.38419	1.245000	0.32790	0.696000	0.31696	0.467000	0.42956	AAG	SOCS3	-	NULL		0.667	SOCS3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOCS3	HGNC	protein_coding	OTTHUMT00000437300.1	C			76355093	-1	no_errors	ENST00000330871	ensembl	human	known	70_37	missense	SNP	1.000	G
SOX2	6657	genome.wustl.edu	37	3	181430944	181430944	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr3:181430944C>G	ENST00000325404.1	+	1	1223	c.796C>G	c.(796-798)Cag>Gag	p.Q266E	SOX2_ENST00000431565.2_Missense_Mutation_p.Q266E	NM_003106.3	NP_003097.1	P48431	SOX2_HUMAN	SRY (sex determining region Y)-box 2	266					adenohypophysis development (GO:0021984)|cell cycle arrest (GO:0007050)|cerebral cortex development (GO:0021987)|chromatin organization (GO:0006325)|detection of mechanical stimulus involved in equilibrioception (GO:0050973)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|diencephalon morphogenesis (GO:0048852)|endodermal cell fate specification (GO:0001714)|epithelial tube branching involved in lung morphogenesis (GO:0060441)|eye development (GO:0001654)|forebrain development (GO:0030900)|forebrain neuron differentiation (GO:0021879)|glial cell fate commitment (GO:0021781)|inner ear development (GO:0048839)|inner ear morphogenesis (GO:0042472)|lens induction in camera-type eye (GO:0060235)|lung alveolus development (GO:0048286)|male genitalia development (GO:0030539)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of epithelial cell proliferation (GO:0050680)|negative regulation of neuron differentiation (GO:0045665)|negative regulation of osteoblast differentiation (GO:0045668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neuron fate commitment (GO:0048663)|neuronal stem cell maintenance (GO:0097150)|olfactory placode formation (GO:0030910)|osteoblast differentiation (GO:0001649)|pigment biosynthetic process (GO:0046148)|pituitary gland development (GO:0021983)|positive regulation of epithelial cell differentiation (GO:0030858)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuroblast proliferation (GO:0002052)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043281)|regulation of gene expression (GO:0010468)|regulation of transcription, DNA-templated (GO:0006355)|response to growth factor (GO:0070848)|response to retinoic acid (GO:0032526)|response to wounding (GO:0009611)|retina morphogenesis in camera-type eye (GO:0060042)|somatic stem cell maintenance (GO:0035019)|tongue development (GO:0043586)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nuclear transcription factor complex (GO:0044798)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|miRNA binding (GO:0035198)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(1)|skin(1)	10	all_cancers(143;1.22e-16)|Ovarian(172;0.0283)		all cancers(12;1.82e-48)|Epithelial(37;9.85e-40)|OV - Ovarian serous cystadenocarcinoma(80;7.37e-23)|Lung(8;2.01e-21)|GBM - Glioblastoma multiforme(1;2.13e-08)			GGCGCCCTGCCAGGCCGGGGA	0.672			A		"""NSCLC, oesophageal squamous carcinoma"""		MICROPHTHALMIA AND ESOPHAGEAL ATRESIA SYNDROME																																	Dom	yes		3	3q26.3-q27	6657	SRY (sex determining region Y)-box 2	yes	E	0													39.0	36.0	37.0					3																	181430944		2192	4287	6479	SO:0001583	missense	6657			BC013923	CCDS3239.1	3q26.3-q27	2014-09-17						"""SRY (sex determining region Y)-boxes"""	11195	protein-coding gene	gene with protein product		184429				7849401	Standard	NM_003106		Approved		uc003fkx.3	P48431		ENST00000325404.1:c.796C>G	3.37:g.181430944C>G	ENSP00000323588:p.Gln266Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14537	Missense_Mutation	SNP	pfam_TF_SOX,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.Q266E	ENST00000325404.1	37	c.796	CCDS3239.1	3	.	.	.	.	.	.	.	.	.	.	C	13.92	2.382355	0.42207	.	.	ENSG00000181449	ENST00000431565;ENST00000325404	D;D	0.82526	-1.62;-1.62	5.5	5.5	0.81552	.	0.000000	0.85682	D	0.000000	T	0.80909	0.4714	M	0.64404	1.975	0.80722	D	1	B	0.32040	0.353	B	0.26693	0.072	T	0.78043	-0.2358	10	0.30854	T	0.27	.	18.7542	0.91826	0.0:1.0:0.0:0.0	.	266	P48431	SOX2_HUMAN	E	266	ENSP00000439111:Q266E;ENSP00000323588:Q266E	ENSP00000323588:Q266E	Q	+	1	0	SOX2	182913638	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.748000	0.68697	2.735000	0.93741	0.655000	0.94253	CAG	SOX2	-	NULL		0.672	SOX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOX2	HGNC	protein_coding	OTTHUMT00000350419.1	C	NM_003106		181430944	+1	no_errors	ENST00000325404	ensembl	human	known	70_37	missense	SNP	1.000	G
SPATA3	130560	genome.wustl.edu	37	2	231865094	231865094	+	Silent	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:231865094C>T	ENST00000452881.1	+	2	423	c.315C>T	c.(313-315)cgC>cgT	p.R105R	SPATA3_ENST00000455816.1_Silent_p.R105R|SPATA3_ENST00000424440.1_Silent_p.R105R|SPATA3_ENST00000433428.2_Silent_p.R105R|SPATA3_ENST00000409956.1_Intron			Q8NHX4	SPTA3_HUMAN	spermatogenesis associated 3	105										endometrium(2)|lung(1)	3						CTCTGATTCGCGCCGGCCCGC	0.657																																																	0													37.0	36.0	36.0					2																	231865094		692	1591	2283	SO:0001819	synonymous_variant	130560			AY032925	CCDS2481.1	2q37.1	2008-02-05			ENSG00000173699	ENSG00000173699			17884	protein-coding gene	gene with protein product							Standard	NM_139073		Approved	TSARG1	uc010zmd.2	Q8NHX4	OTTHUMG00000133221	ENST00000452881.1:c.315C>T	2.37:g.231865094C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86WX5|Q8N9Y6	Missense_Mutation	SNP	NULL	p.R13C	ENST00000452881.1	37	c.37	CCDS2481.1	2																																																																																			SPATA3	-	NULL		0.657	SPATA3-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	SPATA3	HGNC	protein_coding	OTTHUMT00000256956.2	C	NM_139073		231865094	+1	no_errors	ENST00000454918	ensembl	human	known	70_37	missense	SNP	0.000	T
SYDE1	85360	genome.wustl.edu	37	19	15222460	15222460	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr19:15222460C>T	ENST00000342784.2	+	6	1466	c.1435C>T	c.(1435-1437)Ctt>Ttt	p.L479F	SYDE1_ENST00000600440.1_Missense_Mutation_p.L412F|SYDE1_ENST00000600252.1_Missense_Mutation_p.L136F	NM_033025.4	NP_149014.3	Q6ZW31	SYDE1_HUMAN	synapse defective 1, Rho GTPase, homolog 1 (C. elegans)	479	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				activation of Rho GTPase activity (GO:0032862)|positive regulation of synaptic transmission (GO:0050806)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptonemal complex assembly (GO:0007130)	cerebellar mossy fiber (GO:0044300)|cytosol (GO:0005829)|synaptic membrane (GO:0097060)	Rho GTPase activator activity (GO:0005100)			endometrium(4)|kidney(1)|large_intestine(7)|lung(2)|ovary(1)|pancreas(1)|skin(1)	17						CAAGGATTATCTTCGAGAGTT	0.597																																																	0													76.0	73.0	74.0					19																	15222460		2203	4300	6503	SO:0001583	missense	85360			BC029926	CCDS12324.1, CCDS74299.1	19p13.12	2008-02-05				ENSG00000105137			25824	protein-coding gene	gene with protein product						12477932	Standard	XM_005260126		Approved	7h3, FLJ13511	uc002nah.1	Q6ZW31		ENST00000342784.2:c.1435C>T	19.37:g.15222460C>T	ENSP00000341489:p.Leu479Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7L2I8|Q8N6J2|Q9H8K4	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.L479F	ENST00000342784.2	37	c.1435	CCDS12324.1	19	.	.	.	.	.	.	.	.	.	.	C	11.89	1.773758	0.31411	.	.	ENSG00000105137	ENST00000342784	T	0.60424	0.19	5.44	4.4	0.53042	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.086997	0.47852	N	0.000215	T	0.52468	0.1736	L	0.42632	1.34	0.58432	D	0.999998	P;B;B	0.34892	0.474;0.178;0.261	B;B;B	0.43867	0.434;0.112;0.434	T	0.44574	-0.9319	10	0.21014	T	0.42	.	8.5026	0.33168	0.0:0.8242:0.0:0.1758	.	412;412;479	B2RD93;Q6ZW31-2;Q6ZW31	.;.;SYDE1_HUMAN	F	479	ENSP00000341489:L479F	ENSP00000341489:L479F	L	+	1	0	SYDE1	15083460	0.927000	0.31430	0.921000	0.36526	0.428000	0.31595	1.911000	0.39937	1.299000	0.44798	0.655000	0.94253	CTT	SYDE1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.597	SYDE1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYDE1	HGNC	protein_coding	OTTHUMT00000465666.1	C	NM_033025		15222460	+1	no_errors	ENST00000342784	ensembl	human	known	70_37	missense	SNP	1.000	T
TCHH	7062	genome.wustl.edu	37	1	152082938	152082938	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:152082938C>G	ENST00000368804.1	-	2	2754	c.2755G>C	c.(2755-2757)Gag>Cag	p.E919Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	919	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			CTTCTCTTCTCGCGCTCCTCT	0.592																																																	0													126.0	134.0	132.0					1																	152082938		2108	4228	6336	SO:0001583	missense	7062			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2755G>C	1.37:g.152082938C>G	ENSP00000357794:p.Glu919Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.E919Q	ENST00000368804.1	37	c.2755	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	c	7.769	0.707006	0.15239	.	.	ENSG00000159450	ENST00000368804	T	0.06068	3.35	3.68	-2.24	0.06909	.	.	.	.	.	T	0.00906	0.0030	L	0.32530	0.975	0.09310	N	1	B	0.26672	0.156	B	0.16289	0.015	T	0.48670	-0.9015	9	0.12430	T	0.62	.	1.8118	0.03092	0.3077:0.2437:0.3373:0.1113	.	919	Q07283	TRHY_HUMAN	Q	919	ENSP00000357794:E919Q	ENSP00000357794:E919Q	E	-	1	0	TCHH	150349562	0.000000	0.05858	0.000000	0.03702	0.072000	0.16883	-1.450000	0.02390	-0.512000	0.06505	0.455000	0.32223	GAG	TCHH	-	NULL		0.592	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	C	NM_007113		152082938	-1	no_errors	ENST00000368804	ensembl	human	known	70_37	missense	SNP	0.000	G
TCHH	7062	genome.wustl.edu	37	1	152082962	152082962	+	Missense_Mutation	SNP	C	C	G	rs572141539		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:152082962C>G	ENST00000368804.1	-	2	2730	c.2731G>C	c.(2731-2733)Gag>Cag	p.E911Q		NM_007113.2	NP_009044.2	Q07283	TRHY_HUMAN	trichohyalin	911	10 X 30 AA tandem repeats.				keratinization (GO:0031424)	cytoskeleton (GO:0005856)	calcium ion binding (GO:0005509)			NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(20)|kidney(9)|large_intestine(16)|lung(33)|ovary(3)|pancreas(1)|prostate(4)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(4)	105	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TGTAGCTCCTCCTCCTCCTCC	0.582																																																	0													119.0	129.0	126.0					1																	152082962		2122	4238	6360	SO:0001583	missense	7062			L09190	CCDS41396.1	1q21-q23	2013-01-10		2006-01-27	ENSG00000159450	ENSG00000159450		"""EF-hand domain containing"""	11791	protein-coding gene	gene with protein product		190370		THH		1431214	Standard	NM_007113		Approved		uc001ezp.3	Q07283	OTTHUMG00000013066	ENST00000368804.1:c.2731G>C	1.37:g.152082962C>G	ENSP00000357794:p.Glu911Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VUI3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.E911Q	ENST00000368804.1	37	c.2731	CCDS41396.1	1	.	.	.	.	.	.	.	.	.	.	c	8.205	0.798959	0.16397	.	.	ENSG00000159450	ENST00000368804	T	0.06933	3.24	4.22	0.544	0.17185	.	.	.	.	.	T	0.01940	0.0061	L	0.36672	1.1	0.09310	N	1	B	0.17465	0.022	B	0.12837	0.008	T	0.46205	-0.9208	9	0.21014	T	0.42	-2.8438	9.8112	0.40824	0.1138:0.2352:0.651:0.0	.	911	Q07283	TRHY_HUMAN	Q	911	ENSP00000357794:E911Q	ENSP00000357794:E911Q	E	-	1	0	TCHH	150349586	0.000000	0.05858	0.002000	0.10522	0.077000	0.17291	-0.431000	0.06965	-0.273000	0.09246	0.455000	0.32223	GAG	TCHH	-	NULL		0.582	TCHH-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCHH	HGNC	protein_coding	OTTHUMT00000036671.2	C	NM_007113		152082962	-1	no_errors	ENST00000368804	ensembl	human	known	70_37	missense	SNP	0.001	G
TET2	54790	genome.wustl.edu	37	4	106157306	106157306	+	Nonsense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr4:106157306C>G	ENST00000540549.1	+	3	3067	c.2207C>G	c.(2206-2208)tCa>tGa	p.S736*	TET2_ENST00000513237.1_Nonsense_Mutation_p.S757*|TET2_ENST00000380013.4_Nonsense_Mutation_p.S736*|TET2_ENST00000545826.1_Nonsense_Mutation_p.S736*|TET2_ENST00000394764.1_Nonsense_Mutation_p.S736*|TET2_ENST00000305737.2_Nonsense_Mutation_p.S736*|TET2_ENST00000413648.2_Nonsense_Mutation_p.S736*			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	736	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		TCCCAGAGTTCACATCTCCCT	0.413			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													78.0	81.0	80.0					4																	106157306		2203	4300	6503	SO:0001587	stop_gained	54790			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2207C>G	4.37:g.106157306C>G	ENSP00000442788:p.Ser736*	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Nonsense_Mutation	SNP	NULL	p.S736*	ENST00000540549.1	37	c.2207	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	40	8.158281	0.98683	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	.	.	.	5.81	4.79	0.61399	.	4.107910	0.00834	N	0.001685	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.39692	T	0.17	.	15.7779	0.78240	0.0:0.9244:0.0:0.0756	.	.	.	.	X	736;736;736;757;736;736;736	.	ENSP00000265149:S736X	S	+	2	0	TET2	106376755	0.094000	0.21725	0.050000	0.19076	0.860000	0.49131	2.531000	0.45650	2.746000	0.94184	0.655000	0.94253	TCA	TET2	-	NULL		0.413	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	C	NM_017628		106157306	+1	no_errors	ENST00000380013	ensembl	human	known	70_37	nonsense	SNP	0.011	G
TET2	54790	genome.wustl.edu	37	4	106157380	106157380	+	Missense_Mutation	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr4:106157380C>G	ENST00000540549.1	+	3	3141	c.2281C>G	c.(2281-2283)Cct>Gct	p.P761A	TET2_ENST00000513237.1_Missense_Mutation_p.P782A|TET2_ENST00000380013.4_Missense_Mutation_p.P761A|TET2_ENST00000545826.1_Missense_Mutation_p.P761A|TET2_ENST00000394764.1_Missense_Mutation_p.P761A|TET2_ENST00000305737.2_Missense_Mutation_p.P761A|TET2_ENST00000413648.2_Missense_Mutation_p.P761A			Q6N021	TET2_HUMAN	tet methylcytosine dioxygenase 2	761	Gln-rich.				5-methylcytosine catabolic process (GO:0006211)|cell cycle (GO:0007049)|DNA demethylation (GO:0080111)|histone H3-K4 trimethylation (GO:0080182)|kidney development (GO:0001822)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|post-embryonic development (GO:0009791)|protein O-linked glycosylation (GO:0006493)		DNA binding (GO:0003677)|ferrous iron binding (GO:0008198)|methylcytosine dioxygenase activity (GO:0070579)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1272)|kidney(3)|large_intestine(11)|lung(10)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	1314		Myeloproliferative disorder(5;0.0393)		OV - Ovarian serous cystadenocarcinoma(123;7.18e-08)		CCAGACTTTTCCTCACCCCCA	0.388			"""Mis N, F"""		MDS																																			Rec	yes		4	4q24	54790	tet oncogene family member 2		L	0													62.0	66.0	65.0					4																	106157380		2203	4300	6503	SO:0001583	missense	54790			AB046766	CCDS3666.1, CCDS47120.1	4q24	2014-09-17	2011-09-30	2008-03-12	ENSG00000168769	ENSG00000168769			25941	protein-coding gene	gene with protein product		612839	"""KIAA1546"", ""tet oncogene family member 2"""	KIAA1546		10997877, 12646957	Standard	NM_017628		Approved	FLJ20032	uc003hxk.3	Q6N021	OTTHUMG00000131213	ENST00000540549.1:c.2281C>G	4.37:g.106157380C>G	ENSP00000442788:p.Pro761Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDU0|Q2TB88|Q3LIB8|Q96JX5|Q9HCM6|Q9NXW0	Missense_Mutation	SNP	NULL	p.P761A	ENST00000540549.1	37	c.2281	CCDS47120.1	4	.	.	.	.	.	.	.	.	.	.	C	4.938	0.174278	0.09391	.	.	ENSG00000168769	ENST00000305737;ENST00000540549;ENST00000545826;ENST00000513237;ENST00000380013;ENST00000394764;ENST00000413648	T;T;T;T;T;T;T	0.03717	3.83;4.5;3.83;4.5;4.5;3.83;3.84	5.48	-0.0428	0.13862	.	.	.	.	.	T	0.01940	0.0061	N	0.08118	0	0.09310	N	1	B;B;B	0.12013	0.002;0.002;0.005	B;B;B	0.14578	0.001;0.001;0.011	T	0.49652	-0.8917	9	0.19590	T	0.45	.	6.7328	0.23393	0.0:0.3573:0.2272:0.4155	.	782;761;761	E7EQS8;Q6N021;Q6N021-2	.;TET2_HUMAN;.	A	761;761;761;782;761;761;761	ENSP00000306705:P761A;ENSP00000442788:P761A;ENSP00000442867:P761A;ENSP00000425443:P782A;ENSP00000369351:P761A;ENSP00000378245:P761A;ENSP00000391448:P761A	ENSP00000265149:P761A	P	+	1	0	TET2	106376829	0.001000	0.12720	0.060000	0.19600	0.805000	0.45488	-0.378000	0.07446	-0.361000	0.08125	0.655000	0.94253	CCT	TET2	-	NULL		0.388	TET2-202	KNOWN	basic|appris_candidate|CCDS	protein_coding	TET2	HGNC	protein_coding	OTTHUMT00000253952.2	C	NM_017628		106157380	+1	no_errors	ENST00000380013	ensembl	human	known	70_37	missense	SNP	0.028	G
TMPRSS7	344805	genome.wustl.edu	37	3	111794194	111794194	+	Missense_Mutation	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr3:111794194C>T	ENST00000452346.2	+	15	1813	c.1810C>T	c.(1810-1812)Cac>Tac	p.H604Y	TMPRSS7_ENST00000419127.1_Missense_Mutation_p.H478Y			Q7RTY8	TMPS7_HUMAN	transmembrane protease, serine 7	604					proteolysis (GO:0006508)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)			breast(2)|endometrium(6)|kidney(2)|large_intestine(4)|lung(11)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	34						CTCCGCCCTTCACCGCATCAT	0.537																																																	0													99.0	104.0	103.0					3																	111794194		1950	4166	6116	SO:0001583	missense	344805			BN000125	CCDS43129.2	3q13.2	2010-04-13	2004-03-16		ENSG00000176040	ENSG00000176040		"""Serine peptidases / Transmembrane"""	30846	protein-coding gene	gene with protein product			"""type II transmembrane serine protease 7"""			12838346	Standard	NM_001042575		Approved		uc010hqb.2	Q7RTY8	OTTHUMG00000157148	ENST00000452346.2:c.1810C>T	3.37:g.111794194C>T	ENSP00000398236:p.His604Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J8P7|E9PAS3|Q17RH4	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,pfam_SEA,pfam_LDrepeatLR_classA_rpt,pfam_CUB,superfamily_Pept_cys/ser_Trypsin-like,superfamily_CUB,superfamily_LDrepeatLR_classA_rpt,smart_CUB,smart_LDrepeatLR_classA_rpt,smart_Peptidase_S1_S6,pfscan_CUB,pfscan_LDrepeatLR_classA_rpt,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.H478Y	ENST00000452346.2	37	c.1432		3	.	.	.	.	.	.	.	.	.	.	C	3.483	-0.105534	0.06967	.	.	ENSG00000176040	ENST00000452346;ENST00000443106;ENST00000437906;ENST00000419127	T;T	0.60171	0.21;0.21	4.31	1.51	0.23008	Peptidase cysteine/serine, trypsin-like (1);	0.494247	0.22349	N	0.061231	T	0.34366	0.0895	N	0.17631	0.505	0.21897	N	0.999481	P;B	0.34934	0.476;0.439	B;B	0.33339	0.057;0.162	T	0.23976	-1.0173	10	0.72032	D	0.01	.	2.972	0.05926	0.1435:0.553:0.1396:0.1639	.	604;478	Q7RTY8;Q7RTY8-2	TMPS7_HUMAN;.	Y	604;592;578;478	ENSP00000398236:H604Y;ENSP00000411645:H478Y	ENSP00000411645:H478Y	H	+	1	0	TMPRSS7	113276884	0.806000	0.28996	0.150000	0.22450	0.128000	0.20619	1.192000	0.32150	0.326000	0.23384	0.655000	0.94253	CAC	TMPRSS7	-	superfamily_Pept_cys/ser_Trypsin-like,superfamily_LDrepeatLR_classA_rpt		0.537	TMPRSS7-003	NOVEL	NAGNAG_splice_site|not_organism_supported|basic|exp_conf	protein_coding	TMPRSS7	HGNC	protein_coding	OTTHUMT00000347592.2	C	XM_293599		111794194	+1	no_errors	ENST00000419127	ensembl	human	known	70_37	missense	SNP	0.289	T
TNC	3371	genome.wustl.edu	37	9	117822051	117822051	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr9:117822051G>A	ENST00000350763.4	-	14	4675	c.4264C>T	c.(4264-4266)Cgg>Tgg	p.R1422W	TNC_ENST00000341037.4_Missense_Mutation_p.R1331W|TNC_ENST00000340094.3_Intron|TNC_ENST00000346706.3_Intron|TNC_ENST00000345230.3_Intron|TNC_ENST00000535648.1_Intron|TNC_ENST00000537320.1_Intron|TNC_ENST00000423613.2_Missense_Mutation_p.R1422W|TNC_ENST00000542877.1_Intron	NM_002160.3	NP_002151.2	P24821	TENA_HUMAN	tenascin C	1422	Fibronectin type-III 9. {ECO:0000255|PROSITE-ProRule:PRU00316}.				bud outgrowth involved in lung branching (GO:0060447)|cell adhesion (GO:0007155)|cellular response to prostaglandin D stimulus (GO:0071799)|cellular response to retinoic acid (GO:0071300)|cellular response to vitamin D (GO:0071305)|extracellular matrix organization (GO:0030198)|mesenchymal-epithelial cell signaling involved in prostate gland development (GO:0060739)|negative regulation of cell adhesion (GO:0007162)|neuromuscular junction development (GO:0007528)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|peripheral nervous system axon regeneration (GO:0014012)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|prostate gland epithelium morphogenesis (GO:0060740)|response to ethanol (GO:0045471)|response to fibroblast growth factor (GO:0071774)|response to mechanical stimulus (GO:0009612)|response to wounding (GO:0009611)|wound healing (GO:0042060)	basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|focal adhesion (GO:0005925)|interstitial matrix (GO:0005614)|membrane (GO:0016020)	syndecan binding (GO:0045545)			NS(3)|breast(5)|central_nervous_system(4)|endometrium(8)|kidney(6)|large_intestine(32)|liver(1)|lung(39)|ovary(1)|pancreas(2)|prostate(5)|skin(5)|stomach(5)|upper_aerodigestive_tract(2)|urinary_tract(2)	120						CTATAGCCCCGGATCACCCCA	0.572																																																	0													132.0	140.0	138.0					9																	117822051		2203	4300	6503	SO:0001583	missense	3371				CCDS6811.1	9q33.1	2014-01-28	2008-07-31	2002-06-07	ENSG00000041982	ENSG00000041982		"""Fibrinogen C domain containing"", ""Fibronectin type III domain containing"""	5318	protein-coding gene	gene with protein product	"""hexabrachion (tenascin)"""	187380	"""hexabrachion (tenascin C, cytotactin)"", ""deafness, autosomal dominant 56"""	HXB, DFNA56		1704365, 1707164, 23936043	Standard	NM_002160		Approved	TN, MGC167029	uc004bjj.4	P24821	OTTHUMG00000021010	ENST00000350763.4:c.4264C>T	9.37:g.117822051G>A	ENSP00000265131:p.Arg1422Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	C9IYT7|C9J575|C9J6D9|C9J848|Q14583|Q15567|Q5T7S3	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Fibrinogen_a/b/g_C,pfam_EGF_extracell,superfamily_Fibrinogen_a/b/g_C,superfamily_Fibronectin_type3,smart_EG-like_dom,smart_Fibronectin_type3,smart_Fibrinogen_a/b/g_C,pfscan_EG-like_dom,pfscan_Fibronectin_type3	p.R1422W	ENST00000350763.4	37	c.4264	CCDS6811.1	9	.	.	.	.	.	.	.	.	.	.	G	21.7	4.189647	0.78789	.	.	ENSG00000041982	ENST00000350763;ENST00000341037;ENST00000423613	T;T;T	0.58060	0.36;0.36;0.36	5.69	4.77	0.60923	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.714583	0.13239	N	0.402988	T	0.69620	0.3131	M	0.71581	2.175	0.80722	D	1	D;D	0.64830	0.99;0.994	P;P	0.59595	0.86;0.806	T	0.71048	-0.4705	10	0.72032	D	0.01	.	15.7277	0.77774	0.0:0.0:0.8622:0.1378	.	1422;1422	E9PC84;P24821	.;TENA_HUMAN	W	1422;1331;1422	ENSP00000265131:R1422W;ENSP00000339553:R1331W;ENSP00000411406:R1422W	ENSP00000339553:R1331W	R	-	1	2	TNC	116861872	0.981000	0.34729	0.971000	0.41717	0.973000	0.67179	1.371000	0.34250	1.340000	0.45581	0.563000	0.77884	CGG	TNC	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.572	TNC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNC	HGNC	protein_coding	OTTHUMT00000055418.2	G	NM_002160		117822051	-1	no_errors	ENST00000350763	ensembl	human	known	70_37	missense	SNP	0.993	A
TTN	7273	genome.wustl.edu	37	2	179582503	179582503	+	Silent	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:179582503C>T	ENST00000591111.1	-	85	24371	c.24147G>A	c.(24145-24147)ctG>ctA	p.L8049L	TTN_ENST00000342175.6_Intron|TTN_ENST00000342992.6_Silent_p.L7122L|TTN_ENST00000359218.5_Intron|TTN_ENST00000460472.2_Intron|TTN_ENST00000589042.1_Silent_p.L8366L|TTN-AS1_ENST00000585451.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12239	Ig-like 63.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			GAACGTCTTTCAGTTTTCTTG	0.418																																																	0													34.0	33.0	33.0					2																	179582503		1845	4098	5943	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.24147G>A	2.37:g.179582503C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L7122	ENST00000591111.1	37	c.21366		2																																																																																			TTN	-	pfam_Ig_I-set,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like		0.418	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179582503	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	0.996	T
TYW5	129450	genome.wustl.edu	37	2	200820195	200820195	+	5'UTR	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr2:200820195G>A	ENST00000354611.4	-	0	264				C2orf47_ENST00000295079.2_Intron|C2orf47_ENST00000392290.1_5'Flank|C2orf69_ENST00000491721.1_3'UTR|TYW5_ENST00000452512.2_5'UTR	NM_001039693.2	NP_001034782.1	A2RUC4	TYW5_HUMAN	tRNA-yW synthesizing protein 5						wybutosine biosynthetic process (GO:0031591)		iron ion binding (GO:0005506)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|protein homodimerization activity (GO:0042803)|tRNA binding (GO:0000049)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(1)|lung(1)	8						CCCGGCCATGGTTGCTCACGC	0.652																																																	0													22.0	26.0	25.0					2																	200820195		1975	4159	6134	SO:0001623	5_prime_UTR_variant	129450			AK095272	CCDS42795.1	2q33.1	2011-05-09	2011-05-09	2011-05-09	ENSG00000162971	ENSG00000162971			26754	protein-coding gene	gene with protein product			"""chromosome 2 open reading frame 60"""	C2orf60		20739293	Standard	NM_001039693		Approved	FLJ37953	uc002uvi.4	A2RUC4	OTTHUMG00000132770	ENST00000354611.4:c.-2C>T	2.37:g.200820195G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNE3|Q8N1R2	RNA	SNP	-	NULL	ENST00000354611.4	37	NULL	CCDS42795.1	2																																																																																			TYW5	-	-		0.652	TYW5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYW5	HGNC	protein_coding	OTTHUMT00000256144.3	G	NM_001039693		200820195	-1	no_errors	ENST00000452512	ensembl	human	known	70_37	rna	SNP	0.000	A
ULBP1	80329	genome.wustl.edu	37	6	150290300	150290300	+	Silent	SNP	C	C	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:150290300C>T	ENST00000229708.3	+	3	472	c.429C>T	c.(427-429)ttC>ttT	p.F143F		NM_025218.2	NP_079494.1	Q9BZM6	N2DL1_HUMAN	UL16 binding protein 1	143	MHC class I alpha-2 like.				antigen processing and presentation (GO:0019882)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of immune response (GO:0050776)	anchored component of plasma membrane (GO:0046658)|endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)	natural killer cell lectin-like receptor binding (GO:0046703)			large_intestine(3)|lung(5)|pancreas(1)|skin(1)	10		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;2.14e-11)		AGTTCCTCTTCAATGGACAGA	0.522																																																	0													89.0	87.0	88.0					6																	150290300		2203	4300	6503	SO:0001819	synonymous_variant	80329			AF304377	CCDS5223.1	6q25	2003-04-29			ENSG00000111981	ENSG00000111981			14893	protein-coding gene	gene with protein product		605697				11239445, 11827464	Standard	XM_005267151		Approved	RAET1I	uc003qnp.3	Q9BZM6	OTTHUMG00000015810	ENST00000229708.3:c.429C>T	6.37:g.150290300C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VY81|Q8IZW3|Q8IZX6	Silent	SNP	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog	p.F143	ENST00000229708.3	37	c.429	CCDS5223.1	6																																																																																			ULBP1	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog		0.522	ULBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULBP1	HGNC	protein_coding	OTTHUMT00000042677.2	C			150290300	+1	no_errors	ENST00000229708	ensembl	human	known	70_37	silent	SNP	0.000	T
UNC93B1	81622	genome.wustl.edu	37	11	67759316	67759316	+	Missense_Mutation	SNP	C	C	T	rs4014596		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr11:67759316C>T	ENST00000227471.2	-	12	1571	c.1492G>A	c.(1492-1494)Gtg>Atg	p.V498M	UNC93B1_ENST00000530331.1_5'UTR	NM_030930.2	NP_112192.2	Q9H1C4	UN93B_HUMAN	unc-93 homolog B1 (C. elegans)	499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|defense response to virus (GO:0051607)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 7 signaling pathway (GO:0034154)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)	early phagosome (GO:0032009)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)		p.V498M(1)									ACCAGCAGCACCGCCAGCTTA	0.741																																																	1	Substitution - Missense(1)	skin(1)											2.0	2.0	2.0					11																	67759316		806	1754	2560	SO:0001583	missense	81622			AJ271326	CCDS73334.1	11q13.2	2014-09-17	2001-11-28		ENSG00000110057	ENSG00000110057			13481	protein-coding gene	gene with protein product		608204	"""unc93 (C. elegans) homolog B1"""			11867227	Standard	NM_030930		Approved	UNC93	uc001omw.1	Q9H1C4	OTTHUMG00000167472	ENST00000227471.2:c.1492G>A	11.37:g.67759316C>T	ENSP00000227471:p.Val498Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O95764|Q569H6|Q710D4	Missense_Mutation	SNP	pfam_Ion_channel_UNC-93,superfamily_MFS_dom_general_subst_transpt	p.V498M	ENST00000227471.2	37	c.1492		11	.	.	.	.	.	.	.	.	.	.	.	19.11	3.764070	0.69878	.	.	ENSG00000110057	ENST00000227471	D	0.82344	-1.6	4.98	2.8	0.32819	.	0.313238	0.30437	N	0.009625	T	0.66147	0.2760	N	0.19112	0.55	0.29268	N	0.870868	P	0.41265	0.744	B	0.39068	0.289	T	0.65010	-0.6272	10	0.66056	D	0.02	-19.153	2.9617	0.05895	0.2401:0.5562:0.0:0.2037	rs4014596	499	Q9H1C4	UN93B_HUMAN	M	498	ENSP00000227471:V498M	ENSP00000227471:V498M	V	-	1	0	UNC93B1	67515892	0.992000	0.36948	1.000000	0.80357	0.856000	0.48823	1.973000	0.40550	2.318000	0.78349	0.491000	0.48974	GTG	UNC93B1	-	NULL		0.741	UNC93B1-201	KNOWN	basic|appris_principal	protein_coding	UNC93B1	HGNC	protein_coding		C	NM_030930		67759316	-1	no_errors	ENST00000227471	ensembl	human	known	70_37	missense	SNP	0.997	T
USP1	7398	genome.wustl.edu	37	1	62910594	62910594	+	Missense_Mutation	SNP	G	G	T			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr1:62910594G>T	ENST00000339950.4	+	6	1558	c.743G>T	c.(742-744)aGc>aTc	p.S248I	USP1_ENST00000371146.1_Missense_Mutation_p.S248I	NM_003368.4	NP_003359.3	O94782	UBP1_HUMAN	ubiquitin specific peptidase 1	248	USP.				DNA repair (GO:0006281)|monoubiquitinated protein deubiquitination (GO:0035520)|protein deubiquitination (GO:0016579)|regulation of DNA repair (GO:0006282)|response to UV (GO:0009411)|skeletal system development (GO:0001501)|ubiquitin-dependent protein catabolic process (GO:0006511)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(2)|kidney(1)|large_intestine(1)|lung(10)|ovary(2)|prostate(2)|stomach(1)	19		all_neural(321;0.0281)		BRCA - Breast invasive adenocarcinoma(111;8.01e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00245)|OV - Ovarian serous cystadenocarcinoma(397;0.0535)		GGTATTAACAGCATAGAGATG	0.358																																					Ovarian(122;1846 2315 3982 19504)												0													80.0	83.0	82.0					1																	62910594		2203	4298	6501	SO:0001583	missense	7398				CCDS621.1	1p31.3	2008-05-14	2005-08-08		ENSG00000162607	ENSG00000162607		"""Ubiquitin-specific peptidases"""	12607	protein-coding gene	gene with protein product		603478	"""ubiquitin specific protease 1"""			12838346	Standard	NM_003368		Approved		uc001dak.2	O94782	OTTHUMG00000008972	ENST00000339950.4:c.743G>T	1.37:g.62910594G>T	ENSP00000343526:p.Ser248Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJ95|D3DQ57|Q05BX7|Q59H66|Q9UFR0|Q9UNJ3	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.S248I	ENST00000339950.4	37	c.743	CCDS621.1	1	.	.	.	.	.	.	.	.	.	.	G	8.868	0.948595	0.18356	.	.	ENSG00000162607	ENST00000371146;ENST00000339950	T;T	0.20738	2.05;2.05	5.5	-1.65	0.08291	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	1.024180	0.07677	N	0.936481	T	0.10035	0.0246	N	0.08118	0	0.09310	N	1	B	0.16396	0.017	B	0.18871	0.023	T	0.35549	-0.9784	10	0.42905	T	0.14	0.2606	6.3035	0.21125	0.4046:0.2375:0.358:0.0	.	248	O94782	UBP1_HUMAN	I	248	ENSP00000360188:S248I;ENSP00000343526:S248I	ENSP00000343526:S248I	S	+	2	0	USP1	62683182	0.000000	0.05858	0.000000	0.03702	0.434000	0.31775	0.140000	0.16056	-0.119000	0.11830	0.650000	0.86243	AGC	USP1	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.358	USP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP1	HGNC	protein_coding	OTTHUMT00000024881.1	G	NM_001017415		62910594	+1	no_errors	ENST00000339950	ensembl	human	known	70_37	missense	SNP	0.000	T
USP31	57478	genome.wustl.edu	37	16	23098489	23098489	+	Missense_Mutation	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr16:23098489G>A	ENST00000219689.7	-	9	1545	c.1546C>T	c.(1546-1548)Cgt>Tgt	p.R516C		NM_020718.3	NP_065769.3	Q86UV5	UBP48_HUMAN	ubiquitin specific peptidase 31	0	DUSP 1. {ECO:0000255|PROSITE- ProRule:PRU00613}.				ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ubiquitin-specific protease activity (GO:0004843)	p.R516C(1)		breast(4)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(13)|lung(17)|ovary(4)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|urinary_tract(2)	57				GBM - Glioblastoma multiforme(48;0.0187)		CTGACCACACGCAAGCTGAAT	0.393																																																	1	Substitution - Missense(1)	large_intestine(1)											57.0	52.0	54.0					16																	23098489		2197	4300	6497	SO:0001583	missense	57478			AB033029	CCDS10607.1	16p12.3	2008-02-05	2005-08-08		ENSG00000103404	ENSG00000103404		"""Ubiquitin-specific peptidases"""	20060	protein-coding gene	gene with protein product			"""ubiquitin specific protease 31"""			12838346	Standard	NM_020718		Approved	KIAA1203	uc002dll.3	Q70CQ4	OTTHUMG00000094793	ENST00000219689.7:c.1546C>T	16.37:g.23098489G>A	ENSP00000219689:p.Arg516Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKS7|Q2M3I4|Q5SZI4|Q5T3T5|Q6NX53|Q8N3F6|Q96F64|Q96IQ3|Q9H5N3|Q9H5T7|Q9NUJ6|Q9NXR0	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.R516C	ENST00000219689.7	37	c.1546	CCDS10607.1	16	.	.	.	.	.	.	.	.	.	.	G	22.4	4.281888	0.80692	.	.	ENSG00000103404	ENST00000219689	T	0.12361	2.69	5.29	4.33	0.51752	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);	0.069245	0.64402	D	0.000012	T	0.33323	0.0859	L	0.57130	1.785	0.80722	D	1	D	0.89917	1.0	D	0.73380	0.98	T	0.07501	-1.0769	10	0.72032	D	0.01	-10.0162	15.0649	0.71986	0.0:0.1424:0.8576:0.0	.	516	Q70CQ4	UBP31_HUMAN	C	516	ENSP00000219689:R516C	ENSP00000219689:R516C	R	-	1	0	USP31	23005990	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	7.381000	0.79718	1.218000	0.43458	0.563000	0.77884	CGT	USP31	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.393	USP31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP31	HGNC	protein_coding	OTTHUMT00000211607.1	G	NM_020718		23098489	-1	no_errors	ENST00000219689	ensembl	human	known	70_37	missense	SNP	1.000	A
WWC2	80014	genome.wustl.edu	37	4	184019362	184019362	+	5'Flank	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr4:184019362G>A	ENST00000403733.3	+	0	0				WWC2_ENST00000378925.3_5'Flank|WWC2_ENST00000448232.2_5'Flank|WWC2_ENST00000513834.1_5'Flank|WWC2-AS2_ENST00000578387.1_lincRNA	NM_024949.5	NP_079225.5	Q6AWC2	WWC2_HUMAN	WW and C2 domain containing 2						negative regulation of hippo signaling (GO:0035331)|negative regulation of organ growth (GO:0046621)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	cytosol (GO:0005829)	kinase binding (GO:0019900)|protein complex scaffold (GO:0032947)			NS(1)|breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(15)|ovary(2)|prostate(1)|stomach(1)|urinary_tract(3)	32		all_lung(41;5.28e-14)|Lung NSC(41;1.35e-13)|Colorectal(36;0.00681)|Hepatocellular(41;0.00886)|Renal(120;0.00992)|Prostate(90;0.0237)|all_hematologic(60;0.0592)|Esophageal squamous(56;0.179)|all_neural(102;0.202)		all cancers(43;3.38e-24)|Epithelial(43;1.4e-20)|OV - Ovarian serous cystadenocarcinoma(60;1.09e-09)|GBM - Glioblastoma multiforme(59;3.33e-05)|Colorectal(24;3.58e-05)|STAD - Stomach adenocarcinoma(60;4.21e-05)|COAD - Colon adenocarcinoma(29;0.000171)|LUSC - Lung squamous cell carcinoma(40;0.0145)|READ - Rectum adenocarcinoma(43;0.242)		AGTAGCTGCTGAATAAATAAA	0.716																																																	0													6.0	7.0	7.0					4																	184019362		683	1576	2259	SO:0001631	upstream_gene_variant	152641			BC017957	CCDS34109.2	4q35.1	2010-08-05	2006-11-09		ENSG00000151718	ENSG00000151718		"""WW, C2 and coiled-coil domain containing"""	24148	protein-coding gene	gene with protein product			"""WW, C2 and coiled-coil domain containing 2"""			12477932	Standard	NM_024949		Approved	BOMB, FLJ22029	uc010irx.3	Q6AWC2	OTTHUMG00000150685		4.37:g.184019362G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32Q84|Q69YQ1|Q6AWB8|Q6ZSY9|Q6ZU09|Q7Z620|Q8TEB8|Q9H6P0	RNA	SNP	-	NULL	ENST00000403733.3	37	NULL	CCDS34109.2	4	.	.	.	.	.	.	.	.	.	.	G	12.43	1.934181	0.34096	.	.	ENSG00000251359	ENST00000506413	.	.	.	3.55	1.7	0.24286	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	6.0967	0.20025	0.1177:0.1943:0.688:0.0	.	.	.	.	X	127	.	ENSP00000421843:Q127X	Q	-	1	0	C4orf38	184256356	0.064000	0.20934	0.014000	0.15608	0.264000	0.26372	0.153000	0.16323	0.440000	0.26502	0.561000	0.74099	CAG	WWC2-AS2	-	-		0.716	WWC2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	WWC2-AS2	HGNC	protein_coding	OTTHUMT00000319608.1	G	NM_024949		184019362	-1	no_errors	ENST00000506413	ensembl	human	known	70_37	rna	SNP	0.080	A
XRRA1	143570	genome.wustl.edu	37	11	74656094	74656094	+	5'UTR	SNP	C	C	G			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr11:74656094C>G	ENST00000340360.6	-	0	296				XRRA1_ENST00000533598.1_5'UTR|XRRA1_ENST00000321448.8_Intron|AP001992.1_ENST00000578538.1_RNA|XRRA1_ENST00000527087.1_5'UTR	NM_182969.2	NP_892014.1			X-ray radiation resistance associated 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(8)|prostate(3)	20						GGCCCCTTAACTTCCTTTTTT	0.388																																																	0																																										SO:0001623	5_prime_UTR_variant	143570			AK074152	CCDS44680.1, CCDS58159.1, CCDS58160.1	11q13.4	2010-03-19			ENSG00000166435	ENSG00000166435			18868	protein-coding gene	gene with protein product		609788				12908878, 17295261	Standard	NM_182969		Approved	FLJ00225	uc009yub.3	Q6P2D8		ENST00000340360.6:c.-36G>C	11.37:g.74656094C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000340360.6	37	NULL	CCDS44680.1	11																																																																																			XRRA1	-	-		0.388	XRRA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XRRA1	HGNC	protein_coding	OTTHUMT00000384715.1	C	NM_182969		74656094	-1	no_errors	ENST00000524430	ensembl	human	known	70_37	rna	SNP	0.782	G
ZNF318	24149	genome.wustl.edu	37	6	43307344	43307344	+	Silent	SNP	C	C	T	rs537066765		TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr6:43307344C>T	ENST00000361428.2	-	10	4469	c.4392G>A	c.(4390-4392)ccG>ccA	p.P1464P	ZNF318_ENST00000318149.3_Intron	NM_014345.2	NP_055160.2	Q5VUA4	ZN318_HUMAN	zinc finger protein 318	1464	Pro-rich.				meiotic nuclear division (GO:0007126)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|zinc ion binding (GO:0008270)			autonomic_ganglia(1)|breast(8)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(11)|lung(21)|ovary(3)|prostate(1)|skin(1)|stomach(1)|urinary_tract(1)	61			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.0171)|OV - Ovarian serous cystadenocarcinoma(102;0.0579)			GAGCAGCAGACGGGGCAGCTG	0.527													C|||	1	0.000199681	0.0008	0.0	5008	,	,		12293	0.0		0.0	False		,,,				2504	0.0																0													44.0	41.0	42.0					6																	43307344		2203	4300	6503	SO:0001819	synonymous_variant	24149			AF090114	CCDS4895.2	6p21.1	2013-09-19			ENSG00000171467	ENSG00000171467		"""Zinc fingers, C2H2-type"""	13578	protein-coding gene	gene with protein product						10873617	Standard	NM_014345		Approved	HRIHFB2436, ZFP318	uc003oux.3	Q5VUA4	OTTHUMG00000014732	ENST00000361428.2:c.4392G>A	6.37:g.43307344C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O94796|Q4G0E4|Q8NEM6|Q9UNU8|Q9Y2W9	Silent	SNP	smart_Znf_U1	p.P1464	ENST00000361428.2	37	c.4392	CCDS4895.2	6																																																																																			ZNF318	-	NULL		0.527	ZNF318-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF318	HGNC	protein_coding	OTTHUMT00000040601.2	C	NM_014345		43307344	-1	no_errors	ENST00000361428	ensembl	human	known	70_37	silent	SNP	0.077	T
ZNF582	147948	genome.wustl.edu	37	19	56901419	56901419	+	Silent	SNP	G	G	A			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chr19:56901419G>A	ENST00000301310.4	-	4	341	c.183C>T	c.(181-183)ggC>ggT	p.G61G	ZNF582_ENST00000586929.1_Silent_p.G61G|AC006116.12_ENST00000589671.1_RNA	NM_144690.1	NP_653291.1	Q96NG8	ZN582_HUMAN	zinc finger protein 582	61	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	26		Colorectal(82;0.000256)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0547)		AGGGCTCTTTGCCTTGCTCTA	0.552																																					Ovarian(183;1887 2032 4349 30507 51343)												0													104.0	95.0	98.0					19																	56901419		2203	4300	6503	SO:0001819	synonymous_variant	147948			AK055489	CCDS33121.1	19q13.43	2013-07-15			ENSG00000018869	ENSG00000018869		"""Zinc fingers, C2H2-type"", ""-"""	26421	protein-coding gene	gene with protein product		615600				12477932	Standard	NM_144690		Approved	FLJ30927	uc002qmz.1	Q96NG8	OTTHUMG00000181939	ENST00000301310.4:c.183C>T	19.37:g.56901419G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DQZ9|B7Z9R3|Q6PJT6	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G61	ENST00000301310.4	37	c.183	CCDS33121.1	19																																																																																			ZNF582	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.552	ZNF582-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF582	HGNC	protein_coding	OTTHUMT00000458387.2	G	NM_144690		56901419	-1	no_errors	ENST00000301310	ensembl	human	known	70_37	silent	SNP	0.000	A
ZNF674	641339	genome.wustl.edu	37	X	46382534	46382534	+	Intron	SNP	G	G	C			TCGA-C5-A7UC-01A-11D-A351-09	TCGA-C5-A7UC-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	bb76b8b0-ee5f-4955-9b4c-2f8378a458f2	0a95dc33-f2e6-4723-a85e-87f716883112	g.chrX:46382534G>C	ENST00000523374.1	-	5	464				ZNF674_ENST00000518795.1_5'UTR|ZNF674_ENST00000414387.2_Intron	NM_001039891.2|NM_001146291.1|NM_001190417.1	NP_001034980.1|NP_001139763.1|NP_001177346.1	Q2M3X9	ZN674_HUMAN	zinc finger protein 674						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)	2						ctgtatgcaagatataGTAAT	0.323																																																	0																																										SO:0001627	intron_variant	641339			AY971607	CCDS48099.1, CCDS55406.1	Xp11.3	2013-01-08	2010-09-15		ENSG00000251192	ENSG00000251192		"""Zinc fingers, C2H2-type"", ""-"""	17625	protein-coding gene	gene with protein product		300573		MRX92		16385466	Standard	NM_001039891		Approved	ZNF673B	uc004dgr.3	Q2M3X9	OTTHUMG00000021420	ENST00000523374.1:c.253+5235C>G	X.37:g.46382534G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DHE2|E9PHQ4	RNA	SNP	-	NULL	ENST00000523374.1	37	NULL	CCDS48099.1	X																																																																																			ZNF674	-	-		0.323	ZNF674-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF674	HGNC	protein_coding	OTTHUMT00000056357.2	G	NM_001039891		46382534	-1	no_errors	ENST00000518795	ensembl	human	known	70_37	rna	SNP	0.525	C
