#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ACTN4	81	genome.wustl.edu	37	19	39219695	39219695	+	Silent	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:39219695G>A	ENST00000252699.2	+	20	2554	c.2478G>A	c.(2476-2478)gtG>gtA	p.V826V	ACTN4_ENST00000497637.1_3'UTR|ACTN4_ENST00000424234.2_Silent_p.V436V|ACTN4_ENST00000390009.3_Silent_p.V607V	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	826	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Mediates interaction with MICALL2. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V826V(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCGGCCTTGTGACCTTCCAAG	0.597																																					Colon(168;199 1940 10254 46213 46384)												1	Substitution - coding silent(1)	cervix(1)											131.0	102.0	112.0					19																	39219695		2203	4300	6503	SO:0001819	synonymous_variant	81			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.2478G>A	19.37:g.39219695G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4K467|D6PXK4|O76048	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.V826	ENST00000252699.2	37	c.2478	CCDS12518.1	19																																																																																			ACTN4	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.597	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	G			39219695	+1	no_errors	ENST00000252699	ensembl	human	known	70_37	silent	SNP	1.000	A
ACTN4	81	genome.wustl.edu	37	19	39219695	39219695	+	Silent	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:39219695G>A	ENST00000252699.2	+	20	2554	c.2478G>A	c.(2476-2478)gtG>gtA	p.V826V	ACTN4_ENST00000497637.1_3'UTR|ACTN4_ENST00000424234.2_Silent_p.V436V|ACTN4_ENST00000390009.3_Silent_p.V607V	NM_004924.4	NP_004915.2	O43707	ACTN4_HUMAN	actinin, alpha 4	826	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.|Mediates interaction with MICALL2. {ECO:0000250}.				actin filament bundle assembly (GO:0051017)|blood coagulation (GO:0007596)|negative regulation of cellular component movement (GO:0051271)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cellular component movement (GO:0051272)|positive regulation of pinocytosis (GO:0048549)|positive regulation of sodium:proton antiporter activity (GO:0032417)|protein localization to tight junction (GO:1902396)|protein transport (GO:0015031)|regulation of apoptotic process (GO:0042981)|response to hypoxia (GO:0001666)|tight junction assembly (GO:0070830)	cell-cell junction (GO:0005911)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|neuron projection (GO:0043005)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|platelet alpha granule lumen (GO:0031093)|protein complex (GO:0043234)|pseudopodium (GO:0031143)|ribonucleoprotein complex (GO:0030529)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|calcium ion binding (GO:0005509)|integrin binding (GO:0005178)|nucleoside binding (GO:0001882)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)	p.V826V(1)		NS(1)|cervix(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(12)|ovary(1)|prostate(1)|skin(1)|urinary_tract(3)	30	all_cancers(60;1.57e-05)|Ovarian(47;0.103)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)			GCGGCCTTGTGACCTTCCAAG	0.597																																					Colon(168;199 1940 10254 46213 46384)												1	Substitution - coding silent(1)	cervix(1)											131.0	102.0	112.0					19																	39219695		2203	4300	6503	SO:0001819	synonymous_variant	81			D89980	CCDS12518.1	19q13	2013-01-10			ENSG00000130402	ENSG00000130402		"""EF-hand domain containing"""	166	protein-coding gene	gene with protein product		604638	"""focal segmental glomerulosclerosis 1"""	FSGS1		9461087, 10700177	Standard	NM_004924		Approved		uc002oja.2	O43707	OTTHUMG00000137382	ENST00000252699.2:c.2478G>A	19.37:g.39219695G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4K467|D6PXK4|O76048	Silent	SNP	pfam_Spectrin_repeat,pfam_CH-domain,pfam_EF-hand_Ca_insen,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_EF_hand_Ca-bd,pfscan_CH-domain,pfscan_EF_HAND_2	p.V826	ENST00000252699.2	37	c.2478	CCDS12518.1	19																																																																																			ACTN4	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.597	ACTN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACTN4	HGNC	protein_coding	OTTHUMT00000268091.1	G			39219695	+1	no_errors	ENST00000252699	ensembl	human	known	70_37	silent	SNP	1.000	A
AHDC1	27245	genome.wustl.edu	37	1	27875174	27875174	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:27875174C>T	ENST00000247087.5	-	5	4049	c.3453G>A	c.(3451-3453)caG>caA	p.Q1151Q	AHDC1_ENST00000374011.2_Silent_p.Q1151Q			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1151							DNA binding (GO:0003677)	p.Q1151Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCTTCACCTTCTGCGGTGTGT	0.582																																																	1	Substitution - coding silent(1)	cervix(1)											87.0	81.0	83.0					1																	27875174		2203	4299	6502	SO:0001819	synonymous_variant	27245			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3453G>A	1.37:g.27875174C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	NULL	p.Q1151	ENST00000247087.5	37	c.3453	CCDS30652.1	1																																																																																			AHDC1	-	NULL		0.582	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3	C			27875174	-1	no_errors	ENST00000247087	ensembl	human	known	70_37	silent	SNP	1.000	T
AHDC1	27245	genome.wustl.edu	37	1	27875174	27875174	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:27875174C>T	ENST00000247087.5	-	5	4049	c.3453G>A	c.(3451-3453)caG>caA	p.Q1151Q	AHDC1_ENST00000374011.2_Silent_p.Q1151Q			Q5TGY3	AHDC1_HUMAN	AT hook, DNA binding motif, containing 1	1151							DNA binding (GO:0003677)	p.Q1151Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(8)|lung(20)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	42		all_lung(284;1.06e-05)|Lung NSC(340;1.86e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.00503)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0434)|OV - Ovarian serous cystadenocarcinoma(117;8.48e-25)|Colorectal(126;9.17e-09)|COAD - Colon adenocarcinoma(152;1.84e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.00192)|BRCA - Breast invasive adenocarcinoma(304;0.00259)|STAD - Stomach adenocarcinoma(196;0.00311)|READ - Rectum adenocarcinoma(331;0.0291)		GCTTCACCTTCTGCGGTGTGT	0.582																																																	1	Substitution - coding silent(1)	cervix(1)											87.0	81.0	83.0					1																	27875174		2203	4299	6502	SO:0001819	synonymous_variant	27245			AK125431	CCDS30652.1	1p36.13	2008-02-05			ENSG00000126705	ENSG00000126705			25230	protein-coding gene	gene with protein product		615790				8619474, 9110174	Standard	XM_005245848		Approved	DJ159A19.3, RP1-159A19.1	uc009vsy.3	Q5TGY3	OTTHUMG00000003398	ENST00000247087.5:c.3453G>A	1.37:g.27875174C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TGY4|Q6PJK1|Q6ZUQ6|Q99769|Q9NUF5	Silent	SNP	NULL	p.Q1151	ENST00000247087.5	37	c.3453	CCDS30652.1	1																																																																																			AHDC1	-	NULL		0.582	AHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AHDC1	HGNC	protein_coding	OTTHUMT00000009523.3	C			27875174	-1	no_errors	ENST00000247087	ensembl	human	known	70_37	silent	SNP	1.000	T
AK2	204	genome.wustl.edu	37	1	33476353	33476353	+	3'UTR	SNP	C	C	T	rs66599471		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:33476353C>T	ENST00000373449.2	-	0	817				AK2_ENST00000548033.1_3'UTR|AK2_ENST00000491241.1_5'UTR|RP1-117O3.2_ENST00000427524.1_RNA	NM_001199199.1|NM_013411.4	NP_001186128.1|NP_037543.1			adenylate kinase 2											kidney(1)|large_intestine(2)|lung(4)|skin(1)	8		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)				CACCCTTCCCCTCTGCCCAGC	0.552																																																	0													46.0	42.0	43.0					1																	33476353		692	1591	2283	SO:0001624	3_prime_UTR_variant	204			U84371	CCDS373.1, CCDS374.1	1p35.1	2014-09-17			ENSG00000004455	ENSG00000004455	2.7.4.3	"""Adenylate kinases"""	362	protein-coding gene	gene with protein product		103020				8843353, 6961883	Standard	NM_013411		Approved		uc001bwp.2	P54819	OTTHUMG00000004131	ENST00000373449.2:c.*77G>A	1.37:g.33476353C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000373449.2	37	NULL	CCDS373.1	1																																																																																			AK2	-	-		0.552	AK2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AK2	HGNC	protein_coding	OTTHUMT00000011884.1	C	NM_001625		33476353	-1	no_errors	ENST00000491241	ensembl	human	known	70_37	rna	SNP	0.999	T
ADCY10	55811	genome.wustl.edu	37	1	167791359	167791359	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:167791359C>G	ENST00000367851.4	-	30	4373	c.4189G>C	c.(4189-4191)Gaa>Caa	p.E1397Q	ADCY10_ENST00000545172.1_Missense_Mutation_p.E1244Q|ADCY10_ENST00000367848.1_Missense_Mutation_p.E1305Q|RP1-313L4.3_ENST00000451545.1_RNA	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1397					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.E1397Q(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAACATTCTTCAAATGTTCTA	0.398																																																	1	Substitution - Missense(1)	cervix(1)											130.0	122.0	125.0					1																	167791359		2203	4300	6503	SO:0001583	missense	55811			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4189G>C	1.37:g.167791359C>G	ENSP00000356825:p.Glu1397Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.E1397Q	ENST00000367851.4	37	c.4189	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171480	0.57584	.	.	ENSG00000143199	ENST00000545172;ENST00000271426;ENST00000367851;ENST00000367848	T;T;T	0.77229	-1.08;-1.08;-1.08	5.98	5.08	0.68730	.	0.335335	0.25823	N	0.028064	T	0.72128	0.3422	M	0.65975	2.015	0.29713	N	0.839251	D;P	0.57571	0.98;0.938	P;B	0.49922	0.626;0.422	T	0.75150	-0.3419	9	0.41790	T	0.15	-9.9741	11.1818	0.48633	0.0:0.9158:0.0:0.0842	.	1305;1397	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	Q	1244;298;1397;1305	ENSP00000441992:E1244Q;ENSP00000356825:E1397Q;ENSP00000356822:E1305Q	ENSP00000271426:E298Q	E	-	1	0	ADCY10	166057983	0.995000	0.38212	1.000000	0.80357	0.897000	0.52465	0.615000	0.24329	1.542000	0.49330	0.650000	0.86243	GAA	ADCY10	-	pirsf_Adenylate_cylcase_typ10		0.398	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	C	NM_018417		167791359	-1	no_errors	ENST00000367851	ensembl	human	known	70_37	missense	SNP	1.000	G
ADCY10	55811	genome.wustl.edu	37	1	167791359	167791359	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:167791359C>G	ENST00000367851.4	-	30	4373	c.4189G>C	c.(4189-4191)Gaa>Caa	p.E1397Q	ADCY10_ENST00000545172.1_Missense_Mutation_p.E1244Q|ADCY10_ENST00000367848.1_Missense_Mutation_p.E1305Q|RP1-313L4.3_ENST00000451545.1_RNA	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	1397					cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.E1397Q(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AAACATTCTTCAAATGTTCTA	0.398																																																	1	Substitution - Missense(1)	cervix(1)											130.0	122.0	125.0					1																	167791359		2203	4300	6503	SO:0001583	missense	55811			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.4189G>C	1.37:g.167791359C>G	ENSP00000356825:p.Glu1397Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Missense_Mutation	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.E1397Q	ENST00000367851.4	37	c.4189	CCDS1265.1	1	.	.	.	.	.	.	.	.	.	.	C	16.61	3.171480	0.57584	.	.	ENSG00000143199	ENST00000545172;ENST00000271426;ENST00000367851;ENST00000367848	T;T;T	0.77229	-1.08;-1.08;-1.08	5.98	5.08	0.68730	.	0.335335	0.25823	N	0.028064	T	0.72128	0.3422	M	0.65975	2.015	0.29713	N	0.839251	D;P	0.57571	0.98;0.938	P;B	0.49922	0.626;0.422	T	0.75150	-0.3419	9	0.41790	T	0.15	-9.9741	11.1818	0.48633	0.0:0.9158:0.0:0.0842	.	1305;1397	Q96PN6-2;Q96PN6	.;ADCYA_HUMAN	Q	1244;298;1397;1305	ENSP00000441992:E1244Q;ENSP00000356825:E1397Q;ENSP00000356822:E1305Q	ENSP00000271426:E298Q	E	-	1	0	ADCY10	166057983	0.995000	0.38212	1.000000	0.80357	0.897000	0.52465	0.615000	0.24329	1.542000	0.49330	0.650000	0.86243	GAA	ADCY10	-	pirsf_Adenylate_cylcase_typ10		0.398	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	C	NM_018417		167791359	-1	no_errors	ENST00000367851	ensembl	human	known	70_37	missense	SNP	1.000	G
ANKIB1	54467	genome.wustl.edu	37	7	92027863	92027863	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:92027863A>G	ENST00000265742.3	+	20	3246	c.2870A>G	c.(2869-2871)gAc>gGc	p.D957G		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	957							zinc ion binding (GO:0008270)	p.D957G(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTGATCCTGACTCAGCTGGC	0.493																																																	1	Substitution - Missense(1)	cervix(1)											135.0	131.0	132.0					7																	92027863		2039	4187	6226	SO:0001583	missense	54467			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2870A>G	7.37:g.92027863A>G	ENSP00000265742:p.Asp957Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	pfam_Znf_C6HC,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Znf_RING,smart_Znf_C6HC,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING	p.D957G	ENST00000265742.3	37	c.2870	CCDS47639.1	7	.	.	.	.	.	.	.	.	.	.	A	11.22	1.575652	0.28092	.	.	ENSG00000001629	ENST00000265742	T	0.10668	2.85	5.61	4.43	0.53597	.	0.616321	0.17414	N	0.175083	T	0.09905	0.0243	N	0.24115	0.695	0.47862	D	0.99953	P;B	0.34724	0.465;0.006	B;B	0.36666	0.23;0.008	T	0.13791	-1.0496	10	0.87932	D	0	.	12.9259	0.58260	0.8644:0.1356:0.0:0.0	.	309;957	Q4VBX8;Q9P2G1	.;AKIB1_HUMAN	G	957	ENSP00000265742:D957G	ENSP00000265742:D957G	D	+	2	0	ANKIB1	91865799	1.000000	0.71417	0.990000	0.47175	0.431000	0.31685	5.647000	0.67923	1.024000	0.39682	0.533000	0.62120	GAC	ANKIB1	-	NULL		0.493	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKIB1	HGNC	protein_coding	OTTHUMT00000342018.1	A			92027863	+1	no_errors	ENST00000265742	ensembl	human	known	70_37	missense	SNP	0.980	G
ANKIB1	54467	genome.wustl.edu	37	7	92027863	92027863	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:92027863A>G	ENST00000265742.3	+	20	3246	c.2870A>G	c.(2869-2871)gAc>gGc	p.D957G		NM_019004.1	NP_061877.1	Q9P2G1	AKIB1_HUMAN	ankyrin repeat and IBR domain containing 1	957							zinc ion binding (GO:0008270)	p.D957G(1)		cervix(1)|endometrium(7)|kidney(3)|large_intestine(10)|lung(19)|skin(1)	41	all_cancers(62;2.06e-09)|all_epithelial(64;9.24e-09)|Breast(17;0.0034)|all_lung(186;0.0509)|Lung NSC(181;0.0692)		STAD - Stomach adenocarcinoma(171;6.16e-05)|all cancers(6;0.00183)|Lung(22;0.123)|LUSC - Lung squamous cell carcinoma(200;0.225)			AGTGATCCTGACTCAGCTGGC	0.493																																																	1	Substitution - Missense(1)	cervix(1)											135.0	131.0	132.0					7																	92027863		2039	4187	6226	SO:0001583	missense	54467			AB037807	CCDS47639.1	7q21.3	2013-01-10			ENSG00000001629	ENSG00000001629		"""Ankyrin repeat domain containing"""	22215	protein-coding gene	gene with protein product							Standard	NM_019004		Approved	DKFZP434A0225, KIAA1386	uc003ulw.2	Q9P2G1	OTTHUMG00000155859	ENST00000265742.3:c.2870A>G	7.37:g.92027863A>G	ENSP00000265742:p.Asp957Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6GMS4|Q6P3S9|Q9NTD7|Q9NW49	Missense_Mutation	SNP	pfam_Znf_C6HC,pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Znf_RING,smart_Znf_C6HC,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Ubiquitin-int_motif,pfscan_Znf_RING	p.D957G	ENST00000265742.3	37	c.2870	CCDS47639.1	7	.	.	.	.	.	.	.	.	.	.	A	11.22	1.575652	0.28092	.	.	ENSG00000001629	ENST00000265742	T	0.10668	2.85	5.61	4.43	0.53597	.	0.616321	0.17414	N	0.175083	T	0.09905	0.0243	N	0.24115	0.695	0.47862	D	0.99953	P;B	0.34724	0.465;0.006	B;B	0.36666	0.23;0.008	T	0.13791	-1.0496	10	0.87932	D	0	.	12.9259	0.58260	0.8644:0.1356:0.0:0.0	.	309;957	Q4VBX8;Q9P2G1	.;AKIB1_HUMAN	G	957	ENSP00000265742:D957G	ENSP00000265742:D957G	D	+	2	0	ANKIB1	91865799	1.000000	0.71417	0.990000	0.47175	0.431000	0.31685	5.647000	0.67923	1.024000	0.39682	0.533000	0.62120	GAC	ANKIB1	-	NULL		0.493	ANKIB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKIB1	HGNC	protein_coding	OTTHUMT00000342018.1	A			92027863	+1	no_errors	ENST00000265742	ensembl	human	known	70_37	missense	SNP	0.980	G
ARHGEF11	9826	genome.wustl.edu	37	1	156907208	156907208	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:156907208G>A	ENST00000361409.2	-	38	4895	c.4153C>T	c.(4153-4155)Cag>Tag	p.Q1385*	ARHGEF11_ENST00000487682.1_5'UTR|MIR765_ENST00000390226.1_RNA|ARHGEF11_ENST00000368194.3_Nonsense_Mutation_p.Q1425*|ARHGEF11_ENST00000315174.8_Nonsense_Mutation_p.Q801*	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1385					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q1425*(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGTCAGGCTGAGGGGGGCTC	0.622																																																	1	Substitution - Nonsense(1)	cervix(1)											54.0	53.0	54.0					1																	156907208		2203	4300	6503	SO:0001587	stop_gained	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.4153C>T	1.37:g.156907208G>A	ENSP00000354644:p.Gln1385*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVD0|Q5VY40|Q6PFW2	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,pfam_Regulat_G_prot_signal,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_DH-domain	p.Q1425*	ENST00000361409.2	37	c.4273	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.297364	0.99655	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	.	.	.	5.33	4.39	0.52855	.	0.299782	0.24245	N	0.040227	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-5.2986	13.9465	0.64089	0.0:0.0:0.8466:0.1534	.	.	.	.	X	1425;1385;801	.	ENSP00000313470:Q801X	Q	-	1	0	ARHGEF11	155173832	0.979000	0.34478	0.038000	0.18304	0.176000	0.22953	3.472000	0.53114	1.199000	0.43173	0.561000	0.74099	CAG	ARHGEF11	-	NULL		0.622	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	G	NM_198236		156907208	-1	no_errors	ENST00000368194	ensembl	human	known	70_37	nonsense	SNP	0.330	A
ARHGEF11	9826	genome.wustl.edu	37	1	156907208	156907208	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:156907208G>A	ENST00000361409.2	-	38	4895	c.4153C>T	c.(4153-4155)Cag>Tag	p.Q1385*	ARHGEF11_ENST00000487682.1_5'UTR|MIR765_ENST00000390226.1_RNA|ARHGEF11_ENST00000368194.3_Nonsense_Mutation_p.Q1425*|ARHGEF11_ENST00000315174.8_Nonsense_Mutation_p.Q801*	NM_014784.3	NP_055599.1	O15085	ARHGB_HUMAN	Rho guanine nucleotide exchange factor (GEF) 11	1385					actin cytoskeleton organization (GO:0030036)|apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|cellular component movement (GO:0006928)|cytokinesis (GO:0000910)|establishment of cell polarity (GO:0030010)|G-protein coupled receptor signaling pathway (GO:0007186)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell growth (GO:0001558)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)|striated muscle contraction (GO:0006941)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular (GO:0005622)|membrane (GO:0016020)	G-protein coupled receptor binding (GO:0001664)|GTPase activator activity (GO:0005096)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.Q1425*(1)		NS(1)|breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(15)|lung(27)|ovary(4)|pancreas(2)|pleura(1)|prostate(4)|skin(7)|stomach(1)|urinary_tract(2)	81	all_hematologic(923;0.0839)|Hepatocellular(266;0.158)					CTGTCAGGCTGAGGGGGGCTC	0.622																																																	1	Substitution - Nonsense(1)	cervix(1)											54.0	53.0	54.0					1																	156907208		2203	4300	6503	SO:0001587	stop_gained	9826			AB002378	CCDS1162.1, CCDS1163.1	1q21	2011-11-16			ENSG00000132694	ENSG00000132694		"""Rho guanine nucleotide exchange factors"""	14580	protein-coding gene	gene with protein product		605708				10526156, 9205841	Standard	NM_014784		Approved	KIAA0380, GTRAP48, PDZ-RHOGEF	uc001fqn.3	O15085	OTTHUMG00000041292	ENST00000361409.2:c.4153C>T	1.37:g.156907208G>A	ENSP00000354644:p.Gln1385*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVD0|Q5VY40|Q6PFW2	Nonsense_Mutation	SNP	pfam_Regulat_G_prot_signal-like,pfam_DH-domain,pfam_PDZ,pfam_Regulat_G_prot_signal,superfamily_DH-domain,superfamily_Regulat_G_prot_signal_superfam,superfamily_PDZ,smart_PDZ,smart_Regulat_G_prot_signal,smart_DH-domain,smart_Pleckstrin_homology,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_Regulat_G_prot_signal,pfscan_DH-domain	p.Q1425*	ENST00000361409.2	37	c.4273	CCDS1162.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.297364	0.99655	.	.	ENSG00000132694	ENST00000368194;ENST00000361409;ENST00000315174	.	.	.	5.33	4.39	0.52855	.	0.299782	0.24245	N	0.040227	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-5.2986	13.9465	0.64089	0.0:0.0:0.8466:0.1534	.	.	.	.	X	1425;1385;801	.	ENSP00000313470:Q801X	Q	-	1	0	ARHGEF11	155173832	0.979000	0.34478	0.038000	0.18304	0.176000	0.22953	3.472000	0.53114	1.199000	0.43173	0.561000	0.74099	CAG	ARHGEF11	-	NULL		0.622	ARHGEF11-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ARHGEF11	HGNC	protein_coding	OTTHUMT00000098931.1	G	NM_198236		156907208	-1	no_errors	ENST00000368194	ensembl	human	known	70_37	nonsense	SNP	0.330	A
ATOH8	84913	genome.wustl.edu	37	2	85982063	85982063	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:85982063G>C	ENST00000306279.3	+	1	1047	c.751G>C	c.(751-753)Gag>Cag	p.E251Q	ATOH8_ENST00000463422.1_3'UTR	NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	251	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E251Q(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CGCAGCCTTCGAGGCGCTCAG	0.716																																																	1	Substitution - Missense(1)	cervix(1)											11.0	12.0	12.0					2																	85982063		1972	3847	5819	SO:0001583	missense	84913			AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.751G>C	2.37:g.85982063G>C	ENSP00000304676:p.Glu251Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q504S2|Q659B0	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.E251Q	ENST00000306279.3	37	c.751	CCDS1985.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572617	0.86542	.	.	ENSG00000168874	ENST00000306279	D	0.97941	-4.62	3.79	3.79	0.43588	Helix-loop-helix DNA-binding (5);	0.309943	0.30820	N	0.008802	D	0.97558	0.9200	L	0.40543	1.245	0.52501	D	0.999955	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.983	D	0.97406	0.9999	10	0.56958	D	0.05	-14.0198	13.9484	0.64101	0.0:0.0:1.0:0.0	.	251;251	Q96SQ7;Q96SQ7-2	ATOH8_HUMAN;.	Q	251	ENSP00000304676:E251Q	ENSP00000304676:E251Q	E	+	1	0	ATOH8	85835574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.819000	0.75262	2.411000	0.81874	0.462000	0.41574	GAG	ATOH8	-	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom		0.716	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH8	HGNC	protein_coding	OTTHUMT00000252496.1	G	NM_032827		85982063	+1	no_errors	ENST00000306279	ensembl	human	known	70_37	missense	SNP	1.000	C
ATOH8	84913	genome.wustl.edu	37	2	85982063	85982063	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:85982063G>C	ENST00000306279.3	+	1	1047	c.751G>C	c.(751-753)Gag>Cag	p.E251Q	ATOH8_ENST00000463422.1_3'UTR	NM_032827.6	NP_116216.2	Q96SQ7	ATOH8_HUMAN	atonal homolog 8 (Drosophila)	251	bHLH. {ECO:0000255|PROSITE- ProRule:PRU00981}.				cell differentiation (GO:0030154)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)	p.E251Q(1)		cervix(1)|endometrium(1)|large_intestine(1)|lung(2)	5						CGCAGCCTTCGAGGCGCTCAG	0.716																																																	1	Substitution - Missense(1)	cervix(1)											11.0	12.0	12.0					2																	85982063		1972	3847	5819	SO:0001583	missense	84913			AK074681	CCDS1985.1	2p11.2	2013-05-21			ENSG00000168874	ENSG00000168874		"""Basic helix-loop-helix proteins"""	24126	protein-coding gene	gene with protein product	"""basic helix loop helix transcription factor 6"""					12419857	Standard	NM_032827		Approved	HATH6, FLJ14708, bHLHa21	uc002sqn.3	Q96SQ7	OTTHUMG00000130178	ENST00000306279.3:c.751G>C	2.37:g.85982063G>C	ENSP00000304676:p.Glu251Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q504S2|Q659B0	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.E251Q	ENST00000306279.3	37	c.751	CCDS1985.1	2	.	.	.	.	.	.	.	.	.	.	G	24.8	4.572617	0.86542	.	.	ENSG00000168874	ENST00000306279	D	0.97941	-4.62	3.79	3.79	0.43588	Helix-loop-helix DNA-binding (5);	0.309943	0.30820	N	0.008802	D	0.97558	0.9200	L	0.40543	1.245	0.52501	D	0.999955	D;D	0.89917	1.0;0.999	D;D	0.79784	0.993;0.983	D	0.97406	0.9999	10	0.56958	D	0.05	-14.0198	13.9484	0.64101	0.0:0.0:1.0:0.0	.	251;251	Q96SQ7;Q96SQ7-2	ATOH8_HUMAN;.	Q	251	ENSP00000304676:E251Q	ENSP00000304676:E251Q	E	+	1	0	ATOH8	85835574	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	6.819000	0.75262	2.411000	0.81874	0.462000	0.41574	GAG	ATOH8	-	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom		0.716	ATOH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATOH8	HGNC	protein_coding	OTTHUMT00000252496.1	G	NM_032827		85982063	+1	no_errors	ENST00000306279	ensembl	human	known	70_37	missense	SNP	1.000	C
ATP5F1	515	genome.wustl.edu	37	1	112002183	112002183	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:112002183G>A	ENST00000369722.3	+	6	1224	c.618G>A	c.(616-618)atG>atA	p.M206I	ATP5F1_ENST00000369721.4_3'UTR|ATP5F1_ENST00000483994.1_Missense_Mutation_p.M145I	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	206					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)	p.M206I(1)		breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGCAGAACATGATGCGTCGAA	0.423																																																	1	Substitution - Missense(1)	cervix(1)											89.0	91.0	90.0					1																	112002183		2203	4300	6503	SO:0001583	missense	515			X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.618G>A	1.37:g.112002183G>A	ENSP00000358737:p.Met206Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BQ68|Q9BRU8	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_bsu_mt	p.M206I	ENST00000369722.3	37	c.618	CCDS836.1	1	.	.	.	.	.	.	.	.	.	.	G	8.357	0.832340	0.16820	.	.	ENSG00000116459	ENST00000369722;ENST00000483994	T;T	0.29142	1.58;1.58	4.85	4.85	0.62838	.	0.047998	0.85682	D	0.000000	T	0.10121	0.0248	L	0.45051	1.395	0.36170	D	0.848733	B;B	0.29162	0.235;0.235	B;B	0.25614	0.062;0.062	T	0.08207	-1.0733	10	0.15952	T	0.53	.	7.7762	0.29039	0.0861:0.2973:0.6166:0.0	.	206;206	Q08ET0;P24539	.;AT5F1_HUMAN	I	206;145	ENSP00000358737:M206I;ENSP00000420366:M145I	ENSP00000358737:M206I	M	+	3	0	ATP5F1	111803706	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	2.478000	0.45189	2.414000	0.81942	0.467000	0.42956	ATG	ATP5F1	-	pfam_ATPase_F0-cplx_bsu_mt		0.423	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5F1	HGNC	protein_coding	OTTHUMT00000032455.1	G	NM_001688		112002183	+1	no_errors	ENST00000369722	ensembl	human	known	70_37	missense	SNP	1.000	A
ATP5F1	515	genome.wustl.edu	37	1	112002183	112002183	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:112002183G>A	ENST00000369722.3	+	6	1224	c.618G>A	c.(616-618)atG>atA	p.M206I	ATP5F1_ENST00000369721.4_3'UTR|ATP5F1_ENST00000483994.1_Missense_Mutation_p.M145I	NM_001688.4	NP_001679.2	P24539	AT5F1_HUMAN	ATP synthase, H+ transporting, mitochondrial Fo complex, subunit B1	206					ATP catabolic process (GO:0006200)|ATP synthesis coupled proton transport (GO:0015986)|cellular metabolic process (GO:0044237)|mitochondrial ATP synthesis coupled proton transport (GO:0042776)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)|substantia nigra development (GO:0021762)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrial proton-transporting ATP synthase complex (GO:0005753)|mitochondrial proton-transporting ATP synthase complex, coupling factor F(o) (GO:0000276)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	hydrogen ion transmembrane transporter activity (GO:0015078)|transmembrane transporter activity (GO:0022857)	p.M206I(1)		breast(1)|cervix(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)	8		all_cancers(81;8.16e-06)|all_epithelial(167;5.63e-06)|all_lung(203;0.000152)|Lung NSC(277;0.000301)		Lung(183;0.0238)|Colorectal(144;0.0296)|all cancers(265;0.0488)|Epithelial(280;0.0732)|COAD - Colon adenocarcinoma(174;0.114)|LUSC - Lung squamous cell carcinoma(189;0.135)		TGCAGAACATGATGCGTCGAA	0.423																																																	1	Substitution - Missense(1)	cervix(1)											89.0	91.0	90.0					1																	112002183		2203	4300	6503	SO:0001583	missense	515			X60221	CCDS836.1	1p13.2	2012-10-12	2010-06-11		ENSG00000116459	ENSG00000116459		"""Mitochondrial respiratory chain complex / Complex V"", ""ATPases / F-type"""	840	protein-coding gene	gene with protein product		603270	"""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit b, isoform 1"", ""ATP synthase, H+ transporting, mitochondrial F0 complex, subunit B1"""			1831354	Standard	XM_005270929		Approved		uc001ebc.3	P24539	OTTHUMG00000011745	ENST00000369722.3:c.618G>A	1.37:g.112002183G>A	ENSP00000358737:p.Met206Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BQ68|Q9BRU8	Missense_Mutation	SNP	pfam_ATPase_F0-cplx_bsu_mt	p.M206I	ENST00000369722.3	37	c.618	CCDS836.1	1	.	.	.	.	.	.	.	.	.	.	G	8.357	0.832340	0.16820	.	.	ENSG00000116459	ENST00000369722;ENST00000483994	T;T	0.29142	1.58;1.58	4.85	4.85	0.62838	.	0.047998	0.85682	D	0.000000	T	0.10121	0.0248	L	0.45051	1.395	0.36170	D	0.848733	B;B	0.29162	0.235;0.235	B;B	0.25614	0.062;0.062	T	0.08207	-1.0733	10	0.15952	T	0.53	.	7.7762	0.29039	0.0861:0.2973:0.6166:0.0	.	206;206	Q08ET0;P24539	.;AT5F1_HUMAN	I	206;145	ENSP00000358737:M206I;ENSP00000420366:M145I	ENSP00000358737:M206I	M	+	3	0	ATP5F1	111803706	1.000000	0.71417	1.000000	0.80357	0.027000	0.11550	2.478000	0.45189	2.414000	0.81942	0.467000	0.42956	ATG	ATP5F1	-	pfam_ATPase_F0-cplx_bsu_mt		0.423	ATP5F1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP5F1	HGNC	protein_coding	OTTHUMT00000032455.1	G	NM_001688		112002183	+1	no_errors	ENST00000369722	ensembl	human	known	70_37	missense	SNP	1.000	A
ATP2B4	493	genome.wustl.edu	37	1	203693066	203693066	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:203693066C>G	ENST00000357681.5	+	19	4205	c.3082C>G	c.(3082-3084)Cag>Gag	p.Q1028E	ATP2B4_ENST00000367219.3_Missense_Mutation_p.Q1016E|ATP2B4_ENST00000367218.3_Missense_Mutation_p.Q1028E|ATP2B4_ENST00000341360.2_Missense_Mutation_p.Q1028E|ATP2B4_ENST00000391954.2_Intron	NM_001684.4	NP_001675.3	P23634	AT2B4_HUMAN	ATPase, Ca++ transporting, plasma membrane 4	1028					blood coagulation (GO:0007596)|calcium ion homeostasis (GO:0055074)|calcium ion import across plasma membrane (GO:0098703)|calcium ion transmembrane transport (GO:0070588)|cellular calcium ion homeostasis (GO:0006874)|cellular response to epinephrine stimulus (GO:0071872)|ion transmembrane transport (GO:0034220)|negative regulation of adrenergic receptor signaling pathway involved in heart process (GO:1901205)|negative regulation of arginine catabolic process (GO:1900082)|negative regulation of calcineurin-NFAT signaling cascade (GO:0070885)|negative regulation of cardiac muscle hypertrophy in response to stress (GO:1903243)|negative regulation of citrulline biosynthetic process (GO:1903249)|negative regulation of nitric oxide biosynthetic process (GO:0045019)|negative regulation of nitric oxide mediated signal transduction (GO:0010751)|negative regulation of nitric-oxide synthase activity (GO:0051001)|negative regulation of peptidyl-cysteine S-nitrosylation (GO:1902083)|negative regulation of the force of heart contraction (GO:0098736)|positive regulation of cAMP-dependent protein kinase activity (GO:2000481)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of sodium ion transmembrane transport (GO:1902305)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to hydrostatic pressure (GO:0051599)|transmembrane transport (GO:0055085)	caveola (GO:0005901)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATP binding (GO:0005524)|calcium-transporting ATPase activity (GO:0005388)|calmodulin binding (GO:0005516)|metal ion binding (GO:0046872)|nitric-oxide synthase binding (GO:0050998)|protein phosphatase 2B binding (GO:0030346)|scaffold protein binding (GO:0097110)	p.Q1028E(2)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(2)|large_intestine(10)|lung(20)|ovary(2)|prostate(6)|skin(1)|stomach(1)|urinary_tract(3)	56	all_cancers(21;0.071)|all_epithelial(62;0.228)		BRCA - Breast invasive adenocarcinoma(75;0.109)			CAGCCTGTCTCAGTGGCTGTG	0.522																																																	2	Substitution - Missense(2)	cervix(2)											158.0	160.0	159.0					1																	203693066		2203	4300	6503	SO:0001583	missense	493			M25874	CCDS1440.1, CCDS30977.1	1q32.1	2010-04-20	2005-05-26		ENSG00000058668	ENSG00000058668	3.6.3.8	"""ATPases / P-type"""	817	protein-coding gene	gene with protein product	"""plasma membrane calcium-transporting ATPase 4"""	108732	"""matrix-remodelling associated 1"""	ATP2B2, MXRA1		1674727	Standard	NM_001001396		Approved	PMCA4	uc001gzw.3	P23634	OTTHUMG00000035906	ENST00000357681.5:c.3082C>G	1.37:g.203693066C>G	ENSP00000350310:p.Gln1028Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B1APW5|B1APW6|Q13450|Q13452|Q13455|Q16817|Q7Z3S1	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_ATP_Ca_trans_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,pfam_HAD-SF_hydro-like_3,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_Ca-transp_PMCA,tigrfam_ATPase_P-typ_ion-transptr	p.Q1028E	ENST00000357681.5	37	c.3082	CCDS1440.1	1	.	.	.	.	.	.	.	.	.	.	C	17.28	3.349901	0.61183	.	.	ENSG00000058668	ENST00000357681;ENST00000367218;ENST00000367219;ENST00000341360	D;D;D;D	0.88586	-2.4;-2.4;-2.4;-2.4	5.19	5.19	0.71726	ATPase, P-type cation-transporter, C-terminal (1);ATPase, P-type,  transmembrane domain (1);	0.324485	0.23014	N	0.052935	D	0.87434	0.6176	L	0.57130	1.785	0.80722	D	1	P;B;B	0.36027	0.533;0.333;0.089	B;B;B	0.34452	0.183;0.179;0.061	D	0.86754	0.1962	10	0.39692	T	0.17	-11.0051	18.2983	0.90154	0.0:1.0:0.0:0.0	.	1028;1028;1028	P23634;P23634-6;B1APW5	AT2B4_HUMAN;.;.	E	1028;1028;1016;1028	ENSP00000350310:Q1028E;ENSP00000356187:Q1028E;ENSP00000356188:Q1016E;ENSP00000340930:Q1028E	ENSP00000340930:Q1028E	Q	+	1	0	ATP2B4	201959689	1.000000	0.71417	0.992000	0.48379	0.823000	0.46562	7.748000	0.85085	2.426000	0.82243	0.650000	0.86243	CAG	ATP2B4	-	pfam_ATPase_P-typ_cation-transptr_C,tigrfam_ATPase_P-typ_Ca-transp_PMCA		0.522	ATP2B4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP2B4	HGNC	protein_coding	OTTHUMT00000087462.1	C	NM_001001396		203693066	+1	no_errors	ENST00000357681	ensembl	human	known	70_37	missense	SNP	1.000	G
CAPN14	440854	genome.wustl.edu	37	2	31428146	31428146	+	Silent	SNP	G	G	A	rs368808576		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:31428146G>A	ENST00000403897.3	-	2	309	c.168C>T	c.(166-168)atC>atT	p.I56I	CAPN14_ENST00000444918.2_Silent_p.I56I	NM_001145122.1	NP_001138594.1	A8MX76	CAN14_HUMAN	calpain 14	56	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				proteolysis (GO:0006508)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|calcium-dependent cysteine-type endopeptidase activity (GO:0004198)			NS(1)|endometrium(2)|prostate(1)|skin(1)|stomach(2)	7						AGCCACTGCCGATGGAGCTCA	0.632													G|||	1	0.000199681	0.0	0.0	5008	,	,		15646	0.0		0.001	False		,,,				2504	0.0																0								G		0,1384		0,0,692	24.0	34.0	31.0		168	-5.0	0.0	2		31	3,3179		0,3,1588	no	coding-synonymous	CAPN14	NM_001145122.1		0,3,2280	AA,AG,GG		0.0943,0.0,0.0657		56/685	31428146	3,4563	692	1591	2283	SO:0001819	synonymous_variant	440854			AC015980	CCDS46254.1	2p23.1-p21	2013-01-10			ENSG00000214711	ENSG00000214711		"""EF-hand domain containing"""	16664	protein-coding gene	gene with protein product		610229				11675017	Standard	NM_001145122		Approved		uc010yms.2	A8MX76	OTTHUMG00000152039	ENST00000403897.3:c.168C>T	2.37:g.31428146G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRU9	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,superfamily_Calpain_domain_III,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,pfscan_EF_HAND_2,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.I56	ENST00000403897.3	37	c.168	CCDS46254.1	2																																																																																			CAPN14	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat		0.632	CAPN14-002	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	CAPN14	HGNC	protein_coding	OTTHUMT00000325010.1	G	NM_001145122		31428146	-1	no_errors	ENST00000444918	ensembl	human	known	70_37	silent	SNP	0.879	A
GLIPR1L1	256710	genome.wustl.edu	37	12	75765017	75765017	+	IGR	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:75765017C>T	ENST00000378695.4	+	0	885				CAPS2_ENST00000442339.2_Intron			Q6UWM5	GPRL1_HUMAN	GLI pathogenesis-related 1 like 1						binding of sperm to zona pellucida (GO:0007339)	acrosomal vesicle (GO:0001669)|extracellular region (GO:0005576)|sperm connecting piece (GO:0097224)				endometrium(2)|kidney(1)|large_intestine(2)|lung(3)|prostate(1)|skin(1)	10						tgatgtaaatccgagagtcca	0.493																																																	0																																										SO:0001628	intergenic_variant	84698			BC014603	CCDS9009.1	12q21.1	2014-06-03				ENSG00000173401			28392	protein-coding gene	gene with protein product		610395				12477932	Standard	NM_152779		Approved	MGC26856	uc001sxn.3	Q6UWM5	OTTHUMG00000169755		12.37:g.75765017C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96L06	RNA	SNP	-	NULL	ENST00000378695.4	37	NULL		12																																																																																			CAPS2	-	-		0.493	GLIPR1L1-002	KNOWN	basic|appris_candidate_longest	protein_coding	CAPS2	HGNC	protein_coding	OTTHUMT00000405714.1	C	NM_152779		75765017	-1	no_errors	ENST00000486196	ensembl	human	putative	70_37	rna	SNP	0.011	T
CASP8	841	genome.wustl.edu	37	2	202136259	202136259	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:202136259C>G	ENST00000432109.2	+	4	515	c.326C>G	c.(325-327)tCa>tGa	p.S109*	CASP8_ENST00000323492.7_Nonsense_Mutation_p.S109*|CASP8_ENST00000392259.2_Nonsense_Mutation_p.S109*|CASP8_ENST00000264274.9_Nonsense_Mutation_p.S109*|CASP8_ENST00000264275.5_Nonsense_Mutation_p.S141*|CASP8_ENST00000392266.3_Nonsense_Mutation_p.S109*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.S168*|CASP8_ENST00000392258.3_Nonsense_Mutation_p.S109*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	109	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.S141*(4)|p.S168*(2)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						TATCAGATTTCAGAAGAAGTG	0.398										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												6	Substitution - Nonsense(6)	cervix(3)|lung(3)											126.0	126.0	126.0					2																	202136259		2203	4300	6503	SO:0001587	stop_gained	841			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.326C>G	2.37:g.202136259C>G	ENSP00000412523:p.Ser109*	Somatic		WXS	Illumina HiSeq	Phase_IV	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.S168*	ENST00000432109.2	37	c.503	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701361	0.30142	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	.	.	.	4.71	2.91	0.33838	.	0.709600	0.13250	N	0.402162	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	6.9251	0.24410	0.0:0.7193:0.154:0.1267	.	.	.	.	X	109;109;109;109;109;141;6;109;109;109;168;109;109;109;109	.	ENSP00000264274:S109X	S	+	2	0	CASP8	201844504	0.999000	0.42202	0.995000	0.50966	0.028000	0.11728	2.426000	0.44731	0.586000	0.29626	0.563000	0.77884	TCA	CASP8	-	pfam_DED,superfamily_DEATH-like,smart_DED,pfscan_DED		0.398	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	C	NM_001228		202136259	+1	no_errors	ENST00000358485	ensembl	human	known	70_37	nonsense	SNP	0.992	G
CASP8	841	genome.wustl.edu	37	2	202136259	202136259	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:202136259C>G	ENST00000432109.2	+	4	515	c.326C>G	c.(325-327)tCa>tGa	p.S109*	CASP8_ENST00000323492.7_Nonsense_Mutation_p.S109*|CASP8_ENST00000392259.2_Nonsense_Mutation_p.S109*|CASP8_ENST00000264274.9_Nonsense_Mutation_p.S109*|CASP8_ENST00000264275.5_Nonsense_Mutation_p.S141*|CASP8_ENST00000392266.3_Nonsense_Mutation_p.S109*|CASP8_ENST00000358485.4_Nonsense_Mutation_p.S168*|CASP8_ENST00000392258.3_Nonsense_Mutation_p.S109*	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	109	DED 2. {ECO:0000255|PROSITE- ProRule:PRU00065}.				activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)	p.S141*(4)|p.S168*(2)		breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						TATCAGATTTCAGAAGAAGTG	0.398										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												6	Substitution - Nonsense(6)	cervix(3)|lung(3)											126.0	126.0	126.0					2																	202136259		2203	4300	6503	SO:0001587	stop_gained	841			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.326C>G	2.37:g.202136259C>G	ENSP00000412523:p.Ser109*	Somatic		WXS	Illumina HiSeq	Phase_IV	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Nonsense_Mutation	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.S168*	ENST00000432109.2	37	c.503	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	C	11.65	1.701361	0.30142	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000392259;ENST00000392266;ENST00000432109;ENST00000264275;ENST00000450491;ENST00000440732;ENST00000392258;ENST00000447616;ENST00000358485;ENST00000392261;ENST00000413726;ENST00000323492;ENST00000429881	.	.	.	4.71	2.91	0.33838	.	0.709600	0.13250	N	0.402162	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.41790	T	0.15	.	6.9251	0.24410	0.0:0.7193:0.154:0.1267	.	.	.	.	X	109;109;109;109;109;141;6;109;109;109;168;109;109;109;109	.	ENSP00000264274:S109X	S	+	2	0	CASP8	201844504	0.999000	0.42202	0.995000	0.50966	0.028000	0.11728	2.426000	0.44731	0.586000	0.29626	0.563000	0.77884	TCA	CASP8	-	pfam_DED,superfamily_DEATH-like,smart_DED,pfscan_DED		0.398	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	C	NM_001228		202136259	+1	no_errors	ENST00000358485	ensembl	human	known	70_37	nonsense	SNP	0.992	G
DRC7	84229	genome.wustl.edu	37	16	57760115	57760115	+	Missense_Mutation	SNP	C	C	T	rs143054335	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:57760115C>T	ENST00000360716.3	+	14	2115	c.1894C>T	c.(1894-1896)Cgc>Tgc	p.R632C	CCDC135_ENST00000394337.4_Missense_Mutation_p.R632C|CCDC135_ENST00000336825.8_Missense_Mutation_p.R567C			Q8IY82	CC135_HUMAN		632					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)		p.R632C(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GGCCTCCAAGCGCGAGTTCCT	0.662																																																	1	Substitution - Missense(1)	cervix(1)											68.0	61.0	63.0					16																	57760115		2198	4298	6496	SO:0001583	missense	84229																														ENST00000360716.3:c.1894C>T	16.37:g.57760115C>T	ENSP00000353942:p.Arg632Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	NULL	p.R632C	ENST00000360716.3	37	c.1894	CCDS10787.1	16	.	.	.	.	.	.	.	.	.	.	c	19.47	3.834278	0.71373	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.14893	2.64;2.47;2.64	4.98	3.98	0.46160	.	0.278210	0.32884	N	0.005530	T	0.40145	0.1105	M	0.85630	2.765	0.44562	D	0.997523	D;D	0.89917	1.0;1.0	D;D	0.78314	0.987;0.991	T	0.32375	-0.9909	10	0.72032	D	0.01	-26.7085	6.3029	0.21123	0.3095:0.6029:0.0:0.0876	.	567;632	Q8IY82-2;Q8IY82	.;CC135_HUMAN	C	632;567;632	ENSP00000377869:R632C;ENSP00000338938:R567C;ENSP00000353942:R632C	ENSP00000338938:R567C	R	+	1	0	CCDC135	56317616	0.998000	0.40836	0.988000	0.46212	0.979000	0.70002	0.647000	0.24812	2.325000	0.78763	0.655000	0.94253	CGC	CCDC135	-	NULL		0.662	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC135	HGNC	protein_coding	OTTHUMT00000433323.2	C			57760115	+1	no_errors	ENST00000360716	ensembl	human	known	70_37	missense	SNP	1.000	T
DRC7	84229	genome.wustl.edu	37	16	57760115	57760115	+	Missense_Mutation	SNP	C	C	T	rs143054335	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:57760115C>T	ENST00000360716.3	+	14	2115	c.1894C>T	c.(1894-1896)Cgc>Tgc	p.R632C	CCDC135_ENST00000394337.4_Missense_Mutation_p.R632C|CCDC135_ENST00000336825.8_Missense_Mutation_p.R567C			Q8IY82	CC135_HUMAN		632					cell differentiation (GO:0030154)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|motile cilium (GO:0031514)		p.R632C(1)		breast(1)|central_nervous_system(2)|cervix(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30						GGCCTCCAAGCGCGAGTTCCT	0.662																																																	1	Substitution - Missense(1)	cervix(1)											68.0	61.0	63.0					16																	57760115		2198	4298	6496	SO:0001583	missense	84229																														ENST00000360716.3:c.1894C>T	16.37:g.57760115C>T	ENSP00000353942:p.Arg632Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K943|Q8NAA0|Q9H080	Missense_Mutation	SNP	NULL	p.R632C	ENST00000360716.3	37	c.1894	CCDS10787.1	16	.	.	.	.	.	.	.	.	.	.	c	19.47	3.834278	0.71373	.	.	ENSG00000159625	ENST00000394337;ENST00000336825;ENST00000360716	T;T;T	0.14893	2.64;2.47;2.64	4.98	3.98	0.46160	.	0.278210	0.32884	N	0.005530	T	0.40145	0.1105	M	0.85630	2.765	0.44562	D	0.997523	D;D	0.89917	1.0;1.0	D;D	0.78314	0.987;0.991	T	0.32375	-0.9909	10	0.72032	D	0.01	-26.7085	6.3029	0.21123	0.3095:0.6029:0.0:0.0876	.	567;632	Q8IY82-2;Q8IY82	.;CC135_HUMAN	C	632;567;632	ENSP00000377869:R632C;ENSP00000338938:R567C;ENSP00000353942:R632C	ENSP00000338938:R567C	R	+	1	0	CCDC135	56317616	0.998000	0.40836	0.988000	0.46212	0.979000	0.70002	0.647000	0.24812	2.325000	0.78763	0.655000	0.94253	CGC	CCDC135	-	NULL		0.662	CCDC135-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC135	HGNC	protein_coding	OTTHUMT00000433323.2	C			57760115	+1	no_errors	ENST00000360716	ensembl	human	known	70_37	missense	SNP	1.000	T
CBFA2T3	863	genome.wustl.edu	37	16	88952492	88952492	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:88952492G>A	ENST00000268679.4	-	6	1166	c.770C>T	c.(769-771)aCg>aTg	p.T257M	CBFA2T3_ENST00000436887.2_Missense_Mutation_p.T232M|RP11-830F9.5_ENST00000562574.1_RNA|CBFA2T3_ENST00000448839.1_Missense_Mutation_p.T181M|CBFA2T3_ENST00000360302.2_Missense_Mutation_p.T171M|RP11-830F9.5_ENST00000562405.1_RNA|CBFA2T3_ENST00000327483.5_Missense_Mutation_p.T171M|RP11-830F9.5_ENST00000569249.1_RNA|RP11-830F9.5_ENST00000565053.1_RNA	NM_005187.5	NP_005178.4	O75081	MTG16_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 3	257	Mediates interaction with PDE7A (in isoform 2).|Mediates localization to the nucleus. {ECO:0000250}.|TAFH. {ECO:0000255|PROSITE- ProRule:PRU00440}.				cell proliferation (GO:0008283)|granulocyte differentiation (GO:0030851)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	Golgi apparatus (GO:0005794)|membrane (GO:0016020)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(2)|large_intestine(4)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17				BRCA - Breast invasive adenocarcinoma(80;0.0275)		CTGGGCGGGCGTCTGCTTGGC	0.657			T	RUNX1	AML																																			Dom	yes		16	16q24	863	"""core-binding factor, runt domain, alpha subunit 2; translocated to, 3 (MTG-16)"""		L	0																																										SO:0001583	missense	863			AF052213	CCDS10972.1, CCDS10973.1	16q24	2013-10-16			ENSG00000129993	ENSG00000129993		"""Zinc fingers, MYND-type"", ""A-kinase anchor proteins"""	1537	protein-coding gene	gene with protein product	"""myeloid translocation gene 8 and 16b"""	603870				9790752, 20150326	Standard	NM_005187		Approved	MTGR2, ZMYND4, MTG16	uc002fmm.2	O75081	OTTHUMG00000137864	ENST00000268679.4:c.770C>T	16.37:g.88952492G>A	ENSP00000268679:p.Thr257Met	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DX78|O60615|O60616|O60617|O75082|O75107|O75108|Q0P5Z6|Q6P5W6	Missense_Mutation	SNP	pfam_NHR2,pfam_TAFH_NHR1,pfam_Znf_MYND,smart_TAFH_NHR1,pfscan_TAFH_NHR1,pfscan_Znf_MYND,prints_ETO,prints_MTG16	p.T257M	ENST00000268679.4	37	c.770	CCDS10972.1	16	.	.	.	.	.	.	.	.	.	.	G	12.50	1.957741	0.34565	.	.	ENSG00000129993	ENST00000327483;ENST00000268679;ENST00000436887;ENST00000448839;ENST00000360302	T;T;T;T;T	0.45276	0.9;0.9;0.9;0.9;0.9	5.06	1.82	0.25136	TAFH/NHR1 (3);	0.165435	0.52532	D	0.000072	T	0.49490	0.1560	L	0.38175	1.15	0.44736	D	0.99773	D;D;D;D	0.89917	0.999;1.0;0.999;0.999	P;D;D;D	0.72338	0.826;0.976;0.977;0.954	T	0.44832	-0.9302	10	0.87932	D	0	-13.7268	9.8372	0.40977	0.0:0.3591:0.3932:0.2477	.	232;257;257;171	E7EU24;B2RBQ7;O75081;O75081-2	.;.;MTG16_HUMAN;.	M	171;257;232;181;171	ENSP00000332122:T171M;ENSP00000268679:T257M;ENSP00000395739:T232M;ENSP00000401254:T181M;ENSP00000353449:T171M	ENSP00000268679:T257M	T	-	2	0	CBFA2T3	87479993	0.997000	0.39634	0.550000	0.28217	0.013000	0.08279	2.438000	0.44837	0.193000	0.20303	0.462000	0.41574	ACG	CBFA2T3	-	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1,prints_ETO		0.657	CBFA2T3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CBFA2T3	HGNC	protein_coding	OTTHUMT00000269545.2	G	NM_005187		88952492	-1	no_errors	ENST00000268679	ensembl	human	known	70_37	missense	SNP	0.998	A
CDH2	1000	genome.wustl.edu	37	18	25570188	25570188	+	Missense_Mutation	SNP	C	C	T	rs201148355		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr18:25570188C>T	ENST00000269141.3	-	10	1894	c.1471G>A	c.(1471-1473)Gta>Ata	p.V491I	CDH2_ENST00000399380.3_Missense_Mutation_p.V460I	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	491	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.V491I(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTTTCATTTACGTCAATAACT	0.468																																																	1	Substitution - Missense(1)	cervix(1)						C	ILE/VAL	0,4406		0,0,2203	133.0	123.0	127.0		1471	6.2	1.0	18		127	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDH2	NM_001792.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	491/907	25570188	1,13005	2203	4300	6503	SO:0001583	missense	1000			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1471G>A	18.37:g.25570188C>T	ENSP00000269141:p.Val491Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin	p.V491I	ENST00000269141.3	37	c.1471	CCDS11891.1	18	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871347	0.72065	0.0	1.16E-4	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.62232	0.04;0.04	6.16	6.16	0.99307	Cadherin (3);Cadherin-like (1);	0.056760	0.64402	D	0.000001	T	0.61476	0.2350	L	0.49699	1.58	0.80722	D	1	B;B	0.17268	0.021;0.007	B;B	0.08055	0.003;0.001	T	0.53961	-0.8364	10	0.49607	T	0.09	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	460;491	A8MWK3;P19022	.;CADH2_HUMAN	I	491;460	ENSP00000269141:V491I;ENSP00000382312:V460I	ENSP00000269141:V491I	V	-	1	0	CDH2	23824186	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	GTA	CDH2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.468	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH2	HGNC	protein_coding	OTTHUMT00000133246.3	C	NM_001792		25570188	-1	no_errors	ENST00000269141	ensembl	human	known	70_37	missense	SNP	1.000	T
CDH2	1000	genome.wustl.edu	37	18	25570188	25570188	+	Missense_Mutation	SNP	C	C	T	rs201148355		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr18:25570188C>T	ENST00000269141.3	-	10	1894	c.1471G>A	c.(1471-1473)Gta>Ata	p.V491I	CDH2_ENST00000399380.3_Missense_Mutation_p.V460I	NM_001792.3	NP_001783.2	P19022	CADH2_HUMAN	cadherin 2, type 1, N-cadherin (neuronal)	491	Cadherin 3. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|blood vessel morphogenesis (GO:0048514)|calcium-dependent cell-cell adhesion (GO:0016339)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell-cell adhesion mediated by cadherin (GO:0044331)|cell-cell junction organization (GO:0045216)|glial cell differentiation (GO:0010001)|heterophilic cell-cell adhesion (GO:0007157)|homophilic cell adhesion (GO:0007156)|muscle cell differentiation (GO:0042692)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|neuronal stem cell maintenance (GO:0097150)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of muscle cell differentiation (GO:0051149)|striated muscle cell differentiation (GO:0051146)	apical plasma membrane (GO:0016324)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intercalated disc (GO:0014704)|lamellipodium (GO:0030027)|plasma membrane (GO:0005886)|synapse (GO:0045202)	alpha-catenin binding (GO:0045294)|beta-catenin binding (GO:0008013)|calcium ion binding (GO:0005509)|gamma-catenin binding (GO:0045295)	p.V491I(1)		NS(1)|breast(5)|cervix(2)|endometrium(7)|kidney(3)|large_intestine(22)|lung(32)|ovary(4)|prostate(1)|skin(1)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	82						TTTTCATTTACGTCAATAACT	0.468																																																	1	Substitution - Missense(1)	cervix(1)						C	ILE/VAL	0,4406		0,0,2203	133.0	123.0	127.0		1471	6.2	1.0	18		127	1,8599	1.2+/-3.3	0,1,4299	no	missense	CDH2	NM_001792.3	29	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	benign	491/907	25570188	1,13005	2203	4300	6503	SO:0001583	missense	1000			S42303	CCDS11891.1	18q12.1	2010-01-26			ENSG00000170558	ENSG00000170558		"""CD molecules"", ""Cadherins / Major cadherins"""	1759	protein-coding gene	gene with protein product	"""N-cadherin"""	114020		NCAD		2384753, 7731968, 2216790	Standard	NM_001792		Approved	CDHN, CD325	uc002kwg.2	P19022	OTTHUMG00000059940	ENST00000269141.3:c.1471G>A	18.37:g.25570188C>T	ENSP00000269141:p.Val491Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWK3|B0YIY6|Q14923|Q8N173	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,pfam_Cadherin_pro_dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin,prints_Desmocollin	p.V491I	ENST00000269141.3	37	c.1471	CCDS11891.1	18	.	.	.	.	.	.	.	.	.	.	C	19.67	3.871347	0.72065	0.0	1.16E-4	ENSG00000170558	ENST00000269141;ENST00000399380	T;T	0.62232	0.04;0.04	6.16	6.16	0.99307	Cadherin (3);Cadherin-like (1);	0.056760	0.64402	D	0.000001	T	0.61476	0.2350	L	0.49699	1.58	0.80722	D	1	B;B	0.17268	0.021;0.007	B;B	0.08055	0.003;0.001	T	0.53961	-0.8364	10	0.49607	T	0.09	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	460;491	A8MWK3;P19022	.;CADH2_HUMAN	I	491;460	ENSP00000269141:V491I;ENSP00000382312:V460I	ENSP00000269141:V491I	V	-	1	0	CDH2	23824186	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.487000	0.81328	2.937000	0.99478	0.650000	0.86243	GTA	CDH2	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.468	CDH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH2	HGNC	protein_coding	OTTHUMT00000133246.3	C	NM_001792		25570188	-1	no_errors	ENST00000269141	ensembl	human	known	70_37	missense	SNP	1.000	T
CHD7	55636	genome.wustl.edu	37	8	61765871	61765871	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:61765871C>T	ENST00000423902.2	+	31	7066	c.6587C>T	c.(6586-6588)aCc>aTc	p.T2196I	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2196	Glu-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.T2196I(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GAAGAAGAAACCGATGGCAGC	0.537																																																	2	Substitution - Missense(2)	cervix(2)											24.0	26.0	25.0					8																	61765871		1976	4162	6138	SO:0001583	missense	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6587C>T	8.37:g.61765871C>T	ENSP00000392028:p.Thr2196Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.T2196I	ENST00000423902.2	37	c.6587	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	C	2.301	-0.360129	0.05103	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.71698	-0.59	5.3	2.45	0.29901	.	1.789100	0.02946	N	0.141028	T	0.53899	0.1825	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.43798	-0.9369	10	0.41790	T	0.15	7.1207	8.7463	0.34589	0.0:0.7553:0.0:0.2447	.	2196	Q9P2D1	CHD7_HUMAN	I	2196	ENSP00000392028:T2196I	ENSP00000307304:T2196I	T	+	2	0	CHD7	61928425	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.917000	0.28665	0.207000	0.20607	-0.150000	0.13652	ACC	CHD7	-	NULL		0.537	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	C	XM_098762		61765871	+1	no_errors	ENST00000307121	ensembl	human	known	70_37	missense	SNP	0.005	T
CHD7	55636	genome.wustl.edu	37	8	61765871	61765871	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:61765871C>T	ENST00000423902.2	+	31	7066	c.6587C>T	c.(6586-6588)aCc>aTc	p.T2196I	CHD7_ENST00000524602.1_Intron	NM_017780.3	NP_060250.2	Q9P2D1	CHD7_HUMAN	chromodomain helicase DNA binding protein 7	2196	Glu-rich.				adult heart development (GO:0007512)|adult walking behavior (GO:0007628)|artery morphogenesis (GO:0048844)|blood circulation (GO:0008015)|central nervous system development (GO:0007417)|chromatin modification (GO:0016568)|cognition (GO:0050890)|cranial nerve development (GO:0021545)|embryonic hindlimb morphogenesis (GO:0035116)|epithelium development (GO:0060429)|face development (GO:0060324)|female genitalia development (GO:0030540)|genitalia development (GO:0048806)|heart morphogenesis (GO:0003007)|in utero embryonic development (GO:0001701)|inner ear morphogenesis (GO:0042472)|limb development (GO:0060173)|nose development (GO:0043584)|olfactory behavior (GO:0042048)|olfactory bulb development (GO:0021772)|olfactory nerve development (GO:0021553)|palate development (GO:0060021)|positive regulation of multicellular organism growth (GO:0040018)|regulation of growth hormone secretion (GO:0060123)|regulation of neurogenesis (GO:0050767)|regulation of transcription, DNA-templated (GO:0006355)|retina development in camera-type eye (GO:0060041)|rRNA processing (GO:0006364)|semicircular canal morphogenesis (GO:0048752)|sensory perception of sound (GO:0007605)|skeletal system development (GO:0001501)|T cell differentiation (GO:0030217)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|DNA binding (GO:0003677)|helicase activity (GO:0004386)	p.T2196I(2)		NS(1)|breast(6)|central_nervous_system(8)|cervix(2)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(16)|lung(49)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|urinary_tract(3)	123		all_cancers(86;0.2)|all_lung(136;0.0402)|Lung NSC(129;0.0459)|all_epithelial(80;0.0477)	BRCA - Breast invasive adenocarcinoma(89;0.143)			GAAGAAGAAACCGATGGCAGC	0.537																																																	2	Substitution - Missense(2)	cervix(2)											24.0	26.0	25.0					8																	61765871		1976	4162	6138	SO:0001583	missense	55636			AB037837	CCDS47865.1	8q12.2	2014-09-17				ENSG00000171316			20626	protein-coding gene	gene with protein product		608892	"""CHARGE association"""	CRG		15300250, 18834967	Standard	NM_017780		Approved	KIAA1416, FLJ20357, FLJ20361	uc003xue.3	Q9P2D1		ENST00000423902.2:c.6587C>T	8.37:g.61765871C>T	ENSP00000392028:p.Thr2196Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	D0VBA5|E9PNZ2|Q05DI5|Q2TAN4|Q66K35|Q7Z6C0|Q7Z7Q2|Q9NXA0|Q9NXA3	Missense_Mutation	SNP	pfam_SNF2_N,pfam_BRK_domain,pfam_Chromo_domain,pfam_Helicase_C,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,smart_BRK_domain,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.T2196I	ENST00000423902.2	37	c.6587	CCDS47865.1	8	.	.	.	.	.	.	.	.	.	.	C	2.301	-0.360129	0.05103	.	.	ENSG00000171316	ENST00000307121;ENST00000423902	T	0.71698	-0.59	5.3	2.45	0.29901	.	1.789100	0.02946	N	0.141028	T	0.53899	0.1825	N	0.08118	0	0.09310	N	1	B	0.13594	0.008	B	0.09377	0.004	T	0.43798	-0.9369	10	0.41790	T	0.15	7.1207	8.7463	0.34589	0.0:0.7553:0.0:0.2447	.	2196	Q9P2D1	CHD7_HUMAN	I	2196	ENSP00000392028:T2196I	ENSP00000307304:T2196I	T	+	2	0	CHD7	61928425	0.000000	0.05858	0.000000	0.03702	0.003000	0.03518	0.917000	0.28665	0.207000	0.20607	-0.150000	0.13652	ACC	CHD7	-	NULL		0.537	CHD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD7	HGNC	protein_coding	OTTHUMT00000383468.2	C	XM_098762		61765871	+1	no_errors	ENST00000307121	ensembl	human	known	70_37	missense	SNP	0.005	T
CHRNA5	1138	genome.wustl.edu	37	15	78882360	78882360	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:78882360G>C	ENST00000299565.5	+	5	827	c.627G>C	c.(625-627)aaG>aaC	p.K209N	RP11-650L12.2_ENST00000567141.1_RNA|CHRNA5_ENST00000559554.1_Intron	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	209					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.K209N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	ATGTAGACAAGAGAGATTTTT	0.403																																																	2	Substitution - Missense(2)	cervix(1)|endometrium(1)											118.0	118.0	118.0					15																	78882360		2196	4293	6489	SO:0001583	missense	1138				CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.627G>C	15.37:g.78882360G>C	ENSP00000299565:p.Lys209Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15824|Q99554	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.K209N	ENST00000299565.5	37	c.627	CCDS10304.1	15	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447622	0.43429	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	T	0.79141	-1.24	5.37	2.41	0.29592	Neurotransmitter-gated ion-channel ligand-binding (3);	0.087086	0.85682	D	0.000000	T	0.77909	0.4201	L	0.37697	1.125	0.80722	D	1	D	0.53745	0.962	P	0.60286	0.872	T	0.77156	-0.2691	10	0.72032	D	0.01	.	8.8328	0.35093	0.3924:0.0:0.6076:0.0	.	209	P30532	ACHA5_HUMAN	N	209;160	ENSP00000299565:K209N	ENSP00000299565:K209N	K	+	3	2	CHRNA5	76669415	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.981000	0.29526	0.736000	0.32559	0.655000	0.94253	AAG	CHRNA5	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.403	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA5	HGNC	protein_coding	OTTHUMT00000290106.1	G			78882360	+1	no_errors	ENST00000299565	ensembl	human	known	70_37	missense	SNP	1.000	C
CHRNA5	1138	genome.wustl.edu	37	15	78882360	78882360	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:78882360G>C	ENST00000299565.5	+	5	827	c.627G>C	c.(625-627)aaG>aaC	p.K209N	RP11-650L12.2_ENST00000567141.1_RNA|CHRNA5_ENST00000559554.1_Intron	NM_000745.3	NP_000736.2	P30532	ACHA5_HUMAN	cholinergic receptor, nicotinic, alpha 5 (neuronal)	209					behavioral response to nicotine (GO:0035095)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|ion transmembrane transport (GO:0034220)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|transport (GO:0006810)	acetylcholine-gated channel complex (GO:0005892)|cell junction (GO:0030054)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	acetylcholine receptor activity (GO:0015464)|acetylcholine-activated cation-selective channel activity (GO:0004889)|ligand-gated ion channel activity (GO:0015276)	p.K209N(2)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(4)|lung(1)|ovary(1)|prostate(1)|skin(3)	15					Galantamine(DB00674)|Nicotine(DB00184)	ATGTAGACAAGAGAGATTTTT	0.403																																																	2	Substitution - Missense(2)	cervix(1)|endometrium(1)											118.0	118.0	118.0					15																	78882360		2196	4293	6489	SO:0001583	missense	1138				CCDS10304.1	15q24	2012-02-11	2012-02-07		ENSG00000169684	ENSG00000169684		"""Cholinergic receptors"", ""Ligand-gated ion channels / Acetylcholine receptors, nicotinic"""	1959	protein-coding gene	gene with protein product	"""acetylcholine receptor, nicotinic, alpha 5 (neuronal)"""	118505	"""cholinergic receptor, nicotinic, alpha polypeptide 5"""			2004777	Standard	NM_000745		Approved		uc002bdy.3	P30532	OTTHUMG00000143858	ENST00000299565.5:c.627G>C	15.37:g.78882360G>C	ENSP00000299565:p.Lys209Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15824|Q99554	Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_Nicotinic_acetylcholine_rcpt,prints_Neur_channel,tigrfam_Neur_channel	p.K209N	ENST00000299565.5	37	c.627	CCDS10304.1	15	.	.	.	.	.	.	.	.	.	.	G	14.14	2.447622	0.43429	.	.	ENSG00000169684	ENST00000299565;ENST00000394802	T	0.79141	-1.24	5.37	2.41	0.29592	Neurotransmitter-gated ion-channel ligand-binding (3);	0.087086	0.85682	D	0.000000	T	0.77909	0.4201	L	0.37697	1.125	0.80722	D	1	D	0.53745	0.962	P	0.60286	0.872	T	0.77156	-0.2691	10	0.72032	D	0.01	.	8.8328	0.35093	0.3924:0.0:0.6076:0.0	.	209	P30532	ACHA5_HUMAN	N	209;160	ENSP00000299565:K209N	ENSP00000299565:K209N	K	+	3	2	CHRNA5	76669415	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	0.981000	0.29526	0.736000	0.32559	0.655000	0.94253	AAG	CHRNA5	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.403	CHRNA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHRNA5	HGNC	protein_coding	OTTHUMT00000290106.1	G			78882360	+1	no_errors	ENST00000299565	ensembl	human	known	70_37	missense	SNP	1.000	C
CLMN	79789	genome.wustl.edu	37	14	95670454	95670454	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:95670454C>G	ENST00000298912.4	-	9	1345	c.1232G>C	c.(1231-1233)aGa>aCa	p.R411T		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	411					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R411T(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GTTCTCCTTTCTGGATGATAA	0.493																																																	1	Substitution - Missense(1)	cervix(1)											101.0	99.0	99.0					14																	95670454		2203	4300	6503	SO:0001583	missense	79789			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1232G>C	14.37:g.95670454C>G	ENSP00000298912:p.Arg411Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R411T	ENST00000298912.4	37	c.1232	CCDS9933.1	14	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747445	0.49257	.	.	ENSG00000165959	ENST00000298912	D	0.94537	-3.45	5.91	3.87	0.44632	.	0.157587	0.29846	N	0.011059	D	0.94122	0.8115	M	0.62723	1.935	0.80722	D	1	D	0.57257	0.979	P	0.54270	0.747	D	0.93089	0.6498	10	0.62326	D	0.03	.	5.8896	0.18899	0.0:0.747:0.0:0.253	.	411	Q96JQ2	CLMN_HUMAN	T	411	ENSP00000298912:R411T	ENSP00000298912:R411T	R	-	2	0	CLMN	94740207	.	.	0.960000	0.40013	0.160000	0.22226	.	.	1.505000	0.48720	-0.140000	0.14226	AGA	CLMN	-	NULL		0.493	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2	C			95670454	-1	no_errors	ENST00000298912	ensembl	human	known	70_37	missense	SNP	0.970	G
CLMN	79789	genome.wustl.edu	37	14	95670454	95670454	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:95670454C>G	ENST00000298912.4	-	9	1345	c.1232G>C	c.(1231-1233)aGa>aCa	p.R411T		NM_024734.3	NP_079010.2	Q96JQ2	CLMN_HUMAN	calmin (calponin-like, transmembrane)	411					negative regulation of cell proliferation (GO:0008285)|neuron projection development (GO:0031175)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)		p.R411T(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(10)|lung(17)|prostate(3)|skin(3)	44				Epithelial(152;0.193)		GTTCTCCTTTCTGGATGATAA	0.493																																																	1	Substitution - Missense(1)	cervix(1)											101.0	99.0	99.0					14																	95670454		2203	4300	6503	SO:0001583	missense	79789			AB033014	CCDS9933.1	14q32.13	2012-10-02			ENSG00000165959	ENSG00000165959			19972	protein-coding gene	gene with protein product		611121				11386753	Standard	NM_024734		Approved	FLJ12383, KIAA1188, KIAA0500	uc001yef.2	Q96JQ2	OTTHUMG00000171629	ENST00000298912.4:c.1232G>C	14.37:g.95670454C>G	ENSP00000298912:p.Arg411Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAR7|Q9H713|Q9HA23|Q9HA57|Q9UFP4|Q9ULN2	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,pfscan_CH-domain	p.R411T	ENST00000298912.4	37	c.1232	CCDS9933.1	14	.	.	.	.	.	.	.	.	.	.	C	15.15	2.747445	0.49257	.	.	ENSG00000165959	ENST00000298912	D	0.94537	-3.45	5.91	3.87	0.44632	.	0.157587	0.29846	N	0.011059	D	0.94122	0.8115	M	0.62723	1.935	0.80722	D	1	D	0.57257	0.979	P	0.54270	0.747	D	0.93089	0.6498	10	0.62326	D	0.03	.	5.8896	0.18899	0.0:0.747:0.0:0.253	.	411	Q96JQ2	CLMN_HUMAN	T	411	ENSP00000298912:R411T	ENSP00000298912:R411T	R	-	2	0	CLMN	94740207	.	.	0.960000	0.40013	0.160000	0.22226	.	.	1.505000	0.48720	-0.140000	0.14226	AGA	CLMN	-	NULL		0.493	CLMN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLMN	HGNC	protein_coding	OTTHUMT00000414518.2	C			95670454	-1	no_errors	ENST00000298912	ensembl	human	known	70_37	missense	SNP	0.970	G
COL6A6	131873	genome.wustl.edu	37	3	130289750	130289750	+	Missense_Mutation	SNP	T	T	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:130289750T>G	ENST00000358511.6	+	6	2521	c.2490T>G	c.(2488-2490)gaT>gaG	p.D830E	COL6A6_ENST00000453409.2_Missense_Mutation_p.D830E	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	830	Nonhelical region.|VWFA 5. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TCATGAAGGATTTTATGATTG	0.413																																																	0													84.0	87.0	86.0					3																	130289750		1867	4112	5979	SO:0001583	missense	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.2490T>G	3.37:g.130289750T>G	ENSP00000351310:p.Asp830Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Missense_Mutation	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D830E	ENST00000358511.6	37	c.2490	CCDS46911.1	3	.	.	.	.	.	.	.	.	.	.	T	6.721	0.501792	0.12822	.	.	ENSG00000206384	ENST00000358511;ENST00000453409	D;D	0.82803	-1.65;-1.65	4.79	-4.53	0.03462	von Willebrand factor, type A (3);	0.212138	0.32987	N	0.005410	T	0.61974	0.2390	N	0.13198	0.31	0.21933	N	0.999466	B	0.09022	0.002	B	0.14578	0.011	T	0.49762	-0.8905	10	0.39692	T	0.17	.	7.5525	0.27806	0.0:0.4037:0.2563:0.34	.	830	A6NMZ7	CO6A6_HUMAN	E	830	ENSP00000351310:D830E;ENSP00000399236:D830E	ENSP00000351310:D830E	D	+	3	2	COL6A6	131772440	0.007000	0.16637	0.900000	0.35374	0.483000	0.33249	-1.092000	0.03366	-0.534000	0.06315	-0.441000	0.05720	GAT	COL6A6	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.413	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	T	NM_001102608		130289750	+1	no_errors	ENST00000358511	ensembl	human	known	70_37	missense	SNP	0.446	G
DDX5	1655	genome.wustl.edu	37	17	62501870	62501870	+	Intron	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:62501870G>C	ENST00000225792.5	-	1	446				CEP95_ENST00000553412.1_5'Flank|CEP95_ENST00000556440.2_5'Flank|DDX5_ENST00000578804.1_Missense_Mutation_p.S13C|CEP95_ENST00000581056.1_5'Flank|DDX5_ENST00000450599.2_Intron	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5						cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			GCACCTAACAGATGTTCCTTC	0.602			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0																																										SO:0001627	intron_variant	1655			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.44+323C>G	17.37:g.62501870G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.S13C	ENST00000225792.5	37	c.38	CCDS11659.1	17																																																																																			DDX5	-	NULL		0.602	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	G	NM_004396		62501870	-1	no_errors	ENST00000578804	ensembl	human	putative	70_37	missense	SNP	0.001	C
CYTH1	9267	genome.wustl.edu	37	17	76672041	76672041	+	3'UTR	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:76672041G>A	ENST00000446868.3	-	0	1399				CYTH1_ENST00000589297.1_3'UTR|CYTH1_ENST00000361101.4_3'UTR|CYTH1_ENST00000586175.1_5'UTR|CYTH1_ENST00000585509.1_3'UTR|CYTH1_ENST00000591455.1_3'UTR|CYTH1_ENST00000589296.1_Silent_p.F58F			Q15438	CYH1_HUMAN	cytohesin 1						establishment of epithelial cell polarity (GO:0090162)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)|regulation of cell adhesion (GO:0030155)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|lipid binding (GO:0008289)			endometrium(4)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|skin(2)|upper_aerodigestive_tract(2)	19						AGCAAAAGCTGAAGCTAGTCT	0.582																																																	0																																										SO:0001624	3_prime_UTR_variant	9267			M85169	CCDS32754.1, CCDS42392.2	17q25	2014-05-02	2008-08-14	2008-08-14	ENSG00000108669	ENSG00000108669		"""Pleckstrin homology (PH) domain containing"""	9501	protein-coding gene	gene with protein product		182115	"""pleckstrin homology, Sec7 and coiled-coil domains 1"""	PSCD1		1511013, 8449036, 21628335, 20018626	Standard	XM_006722180		Approved	B2-1, D17S811E, cytohesin-1	uc002jvw.3	Q15438	OTTHUMG00000150253	ENST00000446868.3:c.*132C>T	17.37:g.76672041G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFW7|B7Z1T4|Q9P123|Q9P124	Silent	SNP	NULL	p.F58	ENST00000446868.3	37	c.174		17																																																																																			CYTH1	-	NULL		0.582	CYTH1-001	KNOWN	basic|appris_candidate_longest	protein_coding	CYTH1	HGNC	protein_coding	OTTHUMT00000317099.1	G	NM_004762		76672041	-1	no_errors	ENST00000589296	ensembl	human	putative	70_37	silent	SNP	1.000	A
DENND2C	163259	genome.wustl.edu	37	1	115142027	115142027	+	Silent	SNP	C	C	T	rs548792563	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:115142027C>T	ENST00000393274.1	-	16	2776	c.2151G>A	c.(2149-2151)ccG>ccA	p.P717P	DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393277.1_Intron|DENND2C_ENST00000393276.3_Silent_p.P660P	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	717	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P660P(1)		NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCAGGTGAACGGATACAGTG	0.463													C|||	3	0.000599042	0.0	0.0	5008	,	,		14295	0.0		0.0	False		,,,				2504	0.0031																1	Substitution - coding silent(1)	cervix(1)											157.0	127.0	137.0					1																	115142027		2203	4300	6503	SO:0001819	synonymous_variant	163259				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2151G>A	1.37:g.115142027C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL26|Q5TCX6|Q6P3R3	Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.P717	ENST00000393274.1	37	c.2151	CCDS58018.1	1																																																																																			DENND2C	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom		0.463	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	C	NM_198459		115142027	-1	no_errors	ENST00000393274	ensembl	human	known	70_37	silent	SNP	0.298	T
DENND2C	163259	genome.wustl.edu	37	1	115142027	115142027	+	Silent	SNP	C	C	T	rs548792563	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:115142027C>T	ENST00000393274.1	-	16	2776	c.2151G>A	c.(2149-2151)ccG>ccA	p.P717P	DENND2C_ENST00000481894.1_5'UTR|DENND2C_ENST00000393277.1_Intron|DENND2C_ENST00000393276.3_Silent_p.P660P	NM_001256404.1	NP_001243333.1	Q68D51	DEN2C_HUMAN	DENN/MADD domain containing 2C	717	DENN. {ECO:0000255|PROSITE- ProRule:PRU00304}.				positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)	p.P660P(1)		NS(2)|breast(2)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|skin(3)	37	all_epithelial(7;9.54e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)		GCCAGGTGAACGGATACAGTG	0.463													C|||	3	0.000599042	0.0	0.0	5008	,	,		14295	0.0		0.0	False		,,,				2504	0.0031																1	Substitution - coding silent(1)	cervix(1)											157.0	127.0	137.0					1																	115142027		2203	4300	6503	SO:0001819	synonymous_variant	163259				CCDS875.1, CCDS58018.1	1p13.2-p13.1	2012-10-03			ENSG00000175984	ENSG00000175984		"""DENN/MADD domain containing"""	24748	protein-coding gene	gene with protein product							Standard	NM_198459		Approved	FLJ37099, DKFZp686G0351, DKFZp779P1149, dJ1156J9.1, RP5-1156J9.1	uc001efd.1	Q68D51	OTTHUMG00000011893	ENST00000393274.1:c.2151G>A	1.37:g.115142027C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL26|Q5TCX6|Q6P3R3	Silent	SNP	pfam_DENN_dom,pfam_uDENN_dom,pfam_dDENN_dom,smart_uDENN_dom,smart_DENN_dom,smart_dDENN_dom,pfscan_DENN_dom,pfscan_uDENN_dom,pfscan_dDENN_dom	p.P717	ENST00000393274.1	37	c.2151	CCDS58018.1	1																																																																																			DENND2C	-	pfam_DENN_dom,smart_DENN_dom,pfscan_DENN_dom		0.463	DENND2C-005	KNOWN	basic|CCDS	protein_coding	DENND2C	HGNC	protein_coding	OTTHUMT00000314822.1	C	NM_198459		115142027	-1	no_errors	ENST00000393274	ensembl	human	known	70_37	silent	SNP	0.298	T
DERL1	79139	genome.wustl.edu	37	8	124042857	124042857	+	Nonsense_Mutation	SNP	G	G	A	rs564730174		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:124042857G>A	ENST00000259512.4	-	2	553	c.253C>T	c.(253-255)Cga>Tga	p.R85*	DERL1_ENST00000405944.3_Nonsense_Mutation_p.R85*|DERL1_ENST00000419562.2_Intron|RP11-557C18.3_ENST00000521258.1_RNA	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	85					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)	p.R85*(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GTTTCAAGTCGCGTAGAATAC	0.373																																																	1	Substitution - Nonsense(1)	cervix(1)											63.0	71.0	68.0					8																	124042857		2203	4300	6503	SO:0001587	stop_gained	79139			BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.253C>T	8.37:g.124042857G>A	ENSP00000259512:p.Arg85*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KW41|E9PH19	Nonsense_Mutation	SNP	pfam_DER1	p.R85*	ENST00000259512.4	37	c.253	CCDS6337.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.458734	0.98296	.	.	ENSG00000136986	ENST00000259512;ENST00000405944	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	14.5293	0.67912	0.0:0.0:0.8534:0.1466	.	.	.	.	X	85	.	ENSP00000259512:R85X	R	-	1	2	DERL1	124112038	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.854000	0.55949	2.824000	0.97209	0.655000	0.94253	CGA	DERL1	-	pfam_DER1		0.373	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERL1	HGNC	protein_coding	OTTHUMT00000381714.2	G	NM_024295		124042857	-1	no_errors	ENST00000259512	ensembl	human	known	70_37	nonsense	SNP	1.000	A
DERL1	79139	genome.wustl.edu	37	8	124042857	124042857	+	Nonsense_Mutation	SNP	G	G	A	rs564730174		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:124042857G>A	ENST00000259512.4	-	2	553	c.253C>T	c.(253-255)Cga>Tga	p.R85*	DERL1_ENST00000405944.3_Nonsense_Mutation_p.R85*|DERL1_ENST00000419562.2_Intron|RP11-557C18.3_ENST00000521258.1_RNA	NM_001134671.2|NM_024295.5	NP_001128143.1|NP_077271.1	Q9BUN8	DERL1_HUMAN	derlin 1	85					endoplasmic reticulum unfolded protein response (GO:0030968)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|establishment of protein localization (GO:0045184)|intracellular transport of viral protein in host cell (GO:0019060)|response to unfolded protein (GO:0006986)|retrograde protein transport, ER to cytosol (GO:0030970)	early endosome (GO:0005769)|endoplasmic reticulum (GO:0005783)|Hrd1p ubiquitin ligase complex (GO:0000836)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|membrane (GO:0016020)	MHC class I protein binding (GO:0042288)|receptor activity (GO:0004872)	p.R85*(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(3)	8	Lung NSC(37;1.06e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GTTTCAAGTCGCGTAGAATAC	0.373																																																	1	Substitution - Nonsense(1)	cervix(1)											63.0	71.0	68.0					8																	124042857		2203	4300	6503	SO:0001587	stop_gained	79139			BC002457	CCDS6337.1, CCDS47915.1	8q24.13	2012-02-01	2012-02-01		ENSG00000136986	ENSG00000136986			28454	protein-coding gene	gene with protein product		608813	"""Der1-like domain family, member 1"""			12975309, 15215855	Standard	NM_024295		Approved	MGC3067, PRO2577, FLJ13784, DER1, DER-1, derlin-1	uc003ypl.3	Q9BUN8	OTTHUMG00000165080	ENST00000259512.4:c.253C>T	8.37:g.124042857G>A	ENSP00000259512:p.Arg85*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KW41|E9PH19	Nonsense_Mutation	SNP	pfam_DER1	p.R85*	ENST00000259512.4	37	c.253	CCDS6337.1	8	.	.	.	.	.	.	.	.	.	.	G	39	7.458734	0.98296	.	.	ENSG00000136986	ENST00000259512;ENST00000405944	.	.	.	5.65	5.65	0.86999	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.05436	T	0.98	.	14.5293	0.67912	0.0:0.0:0.8534:0.1466	.	.	.	.	X	85	.	ENSP00000259512:R85X	R	-	1	2	DERL1	124112038	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.854000	0.55949	2.824000	0.97209	0.655000	0.94253	CGA	DERL1	-	pfam_DER1		0.373	DERL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DERL1	HGNC	protein_coding	OTTHUMT00000381714.2	G	NM_024295		124042857	-1	no_errors	ENST00000259512	ensembl	human	known	70_37	nonsense	SNP	1.000	A
DESI1	27351	genome.wustl.edu	37	22	41999352	41999352	+	Silent	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:41999352A>G	ENST00000263256.6	-	5	580	c.324T>C	c.(322-324)tgT>tgC	p.C108C	DESI1_ENST00000463886.1_5'UTR	NM_015704.2	NP_056519.1	Q6ICB0	DESI1_HUMAN	desumoylating isopeptidase 1	108	PPPDE peptidase.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)	p.C108C(1)									TGAAGGTGTTACAATTGTGTT	0.463																																																	1	Substitution - coding silent(1)	cervix(1)											219.0	187.0	197.0					22																	41999352		2203	4300	6503	SO:0001819	synonymous_variant	27351			AF038183	CCDS33652.1	22q13.2	2012-05-16	2012-05-16	2012-05-16	ENSG00000100418	ENSG00000100418			24577	protein-coding gene	gene with protein product		614637	"""family with sequence similarity 152, member B"", ""PPPDE peptidase domain containing 2"""	FAM152B, PPPDE2		8619474, 9110174, 22370726	Standard	NM_015704		Approved	D15Wsu75e	uc003bam.2	Q6ICB0	OTTHUMG00000044632	ENST00000263256.6:c.324T>C	22.37:g.41999352A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_DUF862_euk	p.C108	ENST00000263256.6	37	c.324	CCDS33652.1	22																																																																																			DESI1	-	pfam_DUF862_euk		0.463	DESI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	DESI1	HGNC	protein_coding	OTTHUMT00000104124.3	A	NM_015704		41999352	-1	no_errors	ENST00000263256	ensembl	human	novel	70_37	silent	SNP	1.000	G
DESI1	27351	genome.wustl.edu	37	22	41999352	41999352	+	Silent	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:41999352A>G	ENST00000263256.6	-	5	580	c.324T>C	c.(322-324)tgT>tgC	p.C108C	DESI1_ENST00000463886.1_5'UTR	NM_015704.2	NP_056519.1	Q6ICB0	DESI1_HUMAN	desumoylating isopeptidase 1	108	PPPDE peptidase.					cytoplasm (GO:0005737)|nucleus (GO:0005634)	peptidase activity (GO:0008233)	p.C108C(1)									TGAAGGTGTTACAATTGTGTT	0.463																																																	1	Substitution - coding silent(1)	cervix(1)											219.0	187.0	197.0					22																	41999352		2203	4300	6503	SO:0001819	synonymous_variant	27351			AF038183	CCDS33652.1	22q13.2	2012-05-16	2012-05-16	2012-05-16	ENSG00000100418	ENSG00000100418			24577	protein-coding gene	gene with protein product		614637	"""family with sequence similarity 152, member B"", ""PPPDE peptidase domain containing 2"""	FAM152B, PPPDE2		8619474, 9110174, 22370726	Standard	NM_015704		Approved	D15Wsu75e	uc003bam.2	Q6ICB0	OTTHUMG00000044632	ENST00000263256.6:c.324T>C	22.37:g.41999352A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_DUF862_euk	p.C108	ENST00000263256.6	37	c.324	CCDS33652.1	22																																																																																			DESI1	-	pfam_DUF862_euk		0.463	DESI1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	DESI1	HGNC	protein_coding	OTTHUMT00000104124.3	A	NM_015704		41999352	-1	no_errors	ENST00000263256	ensembl	human	novel	70_37	silent	SNP	1.000	G
DNAH10	196385	genome.wustl.edu	37	12	124270380	124270380	+	Nonsense_Mutation	SNP	C	C	T	rs200542157		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:124270380C>T	ENST00000409039.3	+	9	1160	c.1135C>T	c.(1135-1137)Cga>Tga	p.R379*		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	379	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R379*(1)|p.R197*(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GATCATCTCCCGACACTACAA	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		16156	0.001		0.0	False		,,,				2504	0.0																2	Substitution - Nonsense(2)	cervix(2)											130.0	113.0	119.0					12																	124270380		2203	4300	6503	SO:0001587	stop_gained	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1135C>T	12.37:g.124270380C>T	ENSP00000386770:p.Arg379*	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.R379*	ENST00000409039.3	37	c.1135	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	37	6.400232	0.97537	.	.	ENSG00000197653	ENST00000409039	.	.	.	5.82	1.12	0.20585	.	0.100365	0.38492	N	0.001664	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.738	0.85452	0.3996:0.6004:0.0:0.0	.	.	.	.	X	379	.	ENSP00000386770:R379X	R	+	1	2	DNAH10	122836333	0.291000	0.24352	0.027000	0.17364	0.991000	0.79684	0.823000	0.27366	0.288000	0.22398	0.561000	0.74099	CGA	DNAH10	-	pfam_Dynein_heavy_dom-1		0.567	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	C			124270380	+1	no_errors	ENST00000409039	ensembl	human	known	70_37	nonsense	SNP	0.125	T
DNAH10	196385	genome.wustl.edu	37	12	124270380	124270380	+	Nonsense_Mutation	SNP	C	C	T	rs200542157		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:124270380C>T	ENST00000409039.3	+	9	1160	c.1135C>T	c.(1135-1137)Cga>Tga	p.R379*		NM_207437.3	NP_997320.2	Q8IVF4	DYH10_HUMAN	dynein, axonemal, heavy chain 10	379	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.R379*(1)|p.R197*(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(1)	52	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000207)|Epithelial(86;0.000556)|all cancers(50;0.00346)		GATCATCTCCCGACACTACAA	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		16156	0.001		0.0	False		,,,				2504	0.0																2	Substitution - Nonsense(2)	cervix(2)											130.0	113.0	119.0					12																	124270380		2203	4300	6503	SO:0001587	stop_gained	196385			AJ132089	CCDS9255.2	12q24	2008-02-05	2006-09-04		ENSG00000197653	ENSG00000197653		"""Axonemal dyneins"""	2941	protein-coding gene	gene with protein product		605884	"""dynein, axonemal, heavy polypeptide 10"""				Standard	NM_207437		Approved	FLJ43808	uc001uft.4	Q8IVF4	OTTHUMG00000154477	ENST00000409039.3:c.1135C>T	12.37:g.124270380C>T	ENSP00000386770:p.Arg379*	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JMF5|O95495|Q6ZUC9|Q6ZUP6|Q8N761	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom-1,pfam_ATPase_dyneun-rel_AAA,superfamily_PyrdxlP-dep_Trfase_major_dom,smart_AAA+_ATPase	p.R379*	ENST00000409039.3	37	c.1135	CCDS9255.2	12	.	.	.	.	.	.	.	.	.	.	C	37	6.400232	0.97537	.	.	ENSG00000197653	ENST00000409039	.	.	.	5.82	1.12	0.20585	.	0.100365	0.38492	N	0.001664	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	16.738	0.85452	0.3996:0.6004:0.0:0.0	.	.	.	.	X	379	.	ENSP00000386770:R379X	R	+	1	2	DNAH10	122836333	0.291000	0.24352	0.027000	0.17364	0.991000	0.79684	0.823000	0.27366	0.288000	0.22398	0.561000	0.74099	CGA	DNAH10	-	pfam_Dynein_heavy_dom-1		0.567	DNAH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH10	HGNC	protein_coding	OTTHUMT00000335420.3	C			124270380	+1	no_errors	ENST00000409039	ensembl	human	known	70_37	nonsense	SNP	0.125	T
DQX1	165545	genome.wustl.edu	37	2	74751187	74751187	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:74751187C>T	ENST00000404568.3	-	4	898	c.679G>A	c.(679-681)Gag>Aag	p.E227K	DQX1_ENST00000393951.2_Missense_Mutation_p.E227K|DQX1_ENST00000495597.1_5'UTR	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	227						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.E109K(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TCACCAGGCTCTCTGGGTATA	0.562																																																	1	Substitution - Missense(1)	cervix(1)											77.0	76.0	76.0					2																	74751187		2203	4300	6503	SO:0001583	missense	165545			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.679G>A	2.37:g.74751187C>T	ENSP00000384621:p.Glu227Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.E227K	ENST00000404568.3	37	c.679	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	C	9.221	1.033412	0.19590	.	.	ENSG00000144045	ENST00000393951;ENST00000404568;ENST00000451518	T;T;T	0.21543	4.3;4.3;2.0	5.38	3.58	0.41010	DEAD-like helicase (1);	0.745129	0.12423	N	0.470223	T	0.11410	0.0278	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24728	-1.0152	10	0.87932	D	0	-29.6447	7.9497	0.30008	0.0:0.8112:0.0:0.1888	.	227	Q8TE96	DQX1_HUMAN	K	227;227;109	ENSP00000377523:E227K;ENSP00000384621:E227K;ENSP00000392969:E109K	ENSP00000377523:E227K	E	-	1	0	DQX1	74604695	0.000000	0.05858	0.453000	0.27007	0.523000	0.34469	0.273000	0.18662	0.651000	0.30788	0.609000	0.83330	GAG	DQX1	-	smart_Helicase_ATP-bd		0.562	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	HGNC	protein_coding	OTTHUMT00000252230.3	C	NM_133637		74751187	-1	no_errors	ENST00000393951	ensembl	human	known	70_37	missense	SNP	0.003	T
DQX1	165545	genome.wustl.edu	37	2	74751187	74751187	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:74751187C>T	ENST00000404568.3	-	4	898	c.679G>A	c.(679-681)Gag>Aag	p.E227K	DQX1_ENST00000393951.2_Missense_Mutation_p.E227K|DQX1_ENST00000495597.1_5'UTR	NM_133637.2	NP_598376.2	Q8TE96	DQX1_HUMAN	DEAQ box RNA-dependent ATPase 1	227						nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)	p.E109K(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(7)|ovary(2)|skin(1)	18						TCACCAGGCTCTCTGGGTATA	0.562																																																	1	Substitution - Missense(1)	cervix(1)											77.0	76.0	76.0					2																	74751187		2203	4300	6503	SO:0001583	missense	165545			AK074337	CCDS1949.2	2p12	2010-04-20	2009-01-15		ENSG00000144045	ENSG00000144045			20410	protein-coding gene	gene with protein product			"""DEAQ box polypeptide 1 (RNA-dependent ATPase)"""				Standard	NM_133637		Approved	FLJ23757	uc010yrw.2	Q8TE96	OTTHUMG00000129965	ENST00000404568.3:c.679G>A	2.37:g.74751187C>T	ENSP00000384621:p.Glu227Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6B017|Q8NAM8	Missense_Mutation	SNP	pfam_Helicase-assoc_dom,pfam_DUF1605,smart_Helicase_ATP-bd,smart_Helicase-assoc_dom,pfscan_Helicase_ATP-bd	p.E227K	ENST00000404568.3	37	c.679	CCDS1949.2	2	.	.	.	.	.	.	.	.	.	.	C	9.221	1.033412	0.19590	.	.	ENSG00000144045	ENST00000393951;ENST00000404568;ENST00000451518	T;T;T	0.21543	4.3;4.3;2.0	5.38	3.58	0.41010	DEAD-like helicase (1);	0.745129	0.12423	N	0.470223	T	0.11410	0.0278	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.24728	-1.0152	10	0.87932	D	0	-29.6447	7.9497	0.30008	0.0:0.8112:0.0:0.1888	.	227	Q8TE96	DQX1_HUMAN	K	227;227;109	ENSP00000377523:E227K;ENSP00000384621:E227K;ENSP00000392969:E109K	ENSP00000377523:E227K	E	-	1	0	DQX1	74604695	0.000000	0.05858	0.453000	0.27007	0.523000	0.34469	0.273000	0.18662	0.651000	0.30788	0.609000	0.83330	GAG	DQX1	-	smart_Helicase_ATP-bd		0.562	DQX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DQX1	HGNC	protein_coding	OTTHUMT00000252230.3	C	NM_133637		74751187	-1	no_errors	ENST00000393951	ensembl	human	known	70_37	missense	SNP	0.003	T
EHMT1	79813	genome.wustl.edu	37	9	140669695	140669695	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:140669695C>G	ENST00000460843.1	+	11	1809	c.1782C>G	c.(1780-1782)ttC>ttG	p.F594L	EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000334856.6_Missense_Mutation_p.F563L|EHMT1_ENST00000462484.1_Missense_Mutation_p.F594L	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	594					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.F594L(1)|p.F563L(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GTGGCTACTTCTGCACAGCGG	0.632																																																	2	Substitution - Missense(2)	cervix(2)											57.0	43.0	48.0					9																	140669695		2203	4300	6503	SO:0001583	missense	79813			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.1782C>G	9.37:g.140669695C>G	ENSP00000417980:p.Phe594Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.F594L	ENST00000460843.1	37	c.1782	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848037	0.91277	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;D	0.83914	0.18;-0.57;-1.78	5.34	5.34	0.76211	.	0.098692	0.85682	D	0.000000	D	0.90435	0.7005	M	0.82323	2.585	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.81914	0.984;0.995;0.991	D	0.91056	0.4882	10	0.87932	D	0	.	10.6011	0.45367	0.0:0.8807:0.0:0.1193	.	594;563;594	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	L	563;563;594;594	ENSP00000334476:F563L;ENSP00000417328:F594L;ENSP00000417980:F594L	ENSP00000334476:F563L	F	+	3	2	EHMT1	139789516	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.248000	0.51430	2.645000	0.89757	0.491000	0.48974	TTC	EHMT1	-	NULL		0.632	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	C	NM_024757		140669695	+1	no_errors	ENST00000460843	ensembl	human	known	70_37	missense	SNP	1.000	G
EHMT1	79813	genome.wustl.edu	37	9	140669695	140669695	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:140669695C>G	ENST00000460843.1	+	11	1809	c.1782C>G	c.(1780-1782)ttC>ttG	p.F594L	EHMT1_ENST00000371394.2_3'UTR|EHMT1_ENST00000334856.6_Missense_Mutation_p.F563L|EHMT1_ENST00000462484.1_Missense_Mutation_p.F594L	NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	594					chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)	p.F594L(1)|p.F563L(1)		breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GTGGCTACTTCTGCACAGCGG	0.632																																																	2	Substitution - Missense(2)	cervix(2)											57.0	43.0	48.0					9																	140669695		2203	4300	6503	SO:0001583	missense	79813			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.1782C>G	9.37:g.140669695C>G	ENSP00000417980:p.Phe594Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.F594L	ENST00000460843.1	37	c.1782	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	C	27.6	4.848037	0.91277	.	.	ENSG00000181090	ENST00000334856;ENST00000371400;ENST00000462484;ENST00000460843	T;T;D	0.83914	0.18;-0.57;-1.78	5.34	5.34	0.76211	.	0.098692	0.85682	D	0.000000	D	0.90435	0.7005	M	0.82323	2.585	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.81914	0.984;0.995;0.991	D	0.91056	0.4882	10	0.87932	D	0	.	10.6011	0.45367	0.0:0.8807:0.0:0.1193	.	594;563;594	Q9H9B1;Q9H9B1-2;Q9H9B1-4	EHMT1_HUMAN;.;.	L	563;563;594;594	ENSP00000334476:F563L;ENSP00000417328:F594L;ENSP00000417980:F594L	ENSP00000334476:F563L	F	+	3	2	EHMT1	139789516	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	3.248000	0.51430	2.645000	0.89757	0.491000	0.48974	TTC	EHMT1	-	NULL		0.632	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	C	NM_024757		140669695	+1	no_errors	ENST00000460843	ensembl	human	known	70_37	missense	SNP	1.000	G
Y_RNA	0	genome.wustl.edu	37	6	130895150	130895150	+	RNA	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:130895150G>C	ENST00000365568.1	-	0	107																											ataaagtctagtcaagtgaag	0.328																																																	0																																												0																															6.37:g.130895150G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000365568.1	37	NULL		6																																																																																			Y_RNA	-	-		0.328	Y_RNA.406-201	NOVEL	basic	misc_RNA	ENSG00000202438	RFAM	misc_RNA		G			130895150	-1	no_errors	ENST00000365568	ensembl	human	novel	70_37	rna	SNP	0.022	C
RNVU1-14	101954266	genome.wustl.edu	37	1	148241519	148241519	+	RNA	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:148241519G>A	ENST00000384770.1	+	0	55					NR_104075.1				RNA, variant U1 small nuclear 14																		ttctcagggcgaagcttatcc	0.532																																																	0																																												0					1q21.2	2013-05-15			ENSG00000207501	ENSG00000207501		"""ncRNAs / Small nuclear RNAs"""	48319	non-coding RNA	RNA, small nuclear						23070852	Standard	NR_104075		Approved	vU1.14, RNU1-37					1.37:g.148241519G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000384770.1	37	NULL		1																																																																																			U1	-	-		0.532	RNVU1-14-201	KNOWN	basic	snRNA	ENSG00000207501	RFAM	snRNA		G	NR_104075		148241519	+1	no_errors	ENST00000384770	ensembl	human	novel	70_37	rna	SNP	0.002	A
RP1-29C18.9	0	genome.wustl.edu	37	22	49966751	49966751	+	RNA	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:49966751G>C	ENST00000393264.2	-	0	1539																											ggattggatggatggatgcat	0.488																																																	0																																												0																															22.37:g.49966751G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000393264.2	37	NULL		22																																																																																			RP1-29C18.9	-	-		0.488	RP1-29C18.9-001	KNOWN	basic|exp_conf	sense_intronic	ENSG00000213279	Clone_based_vega_gene	sense_intronic	OTTHUMT00000317429.1	G			49966751	-1	no_errors	ENST00000393264	ensembl	human	known	70_37	rna	SNP	0.000	C
GOLGA6L4	643707	genome.wustl.edu	37	15	82934851	82934851	+	Silent	SNP	T	T	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:82934851T>C	ENST00000559949.1	-	6	788	c.729A>G	c.(727-729)ctA>ctG	p.L243L	RP13-996F3.5_ENST00000560844.1_5'UTR																NS(1)	1						CCTGTTCACGTAGCCTCTCCT	0.552																																																	0																																										SO:0001819	synonymous_variant	0																														ENST00000559949.1:c.729A>G	15.37:g.82934851T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.L229	ENST00000559949.1	37	c.687		15																																																																																			RP13-996F3.5	-	NULL		0.552	RP13-996F3.5-001	PUTATIVE	basic|appris_principal	protein_coding	ENSG00000215749	Clone_based_vega_gene	protein_coding	OTTHUMT00000419268.1	T			82934851	-1	no_errors	ENST00000426571	ensembl	human	known	70_37	silent	SNP	0.799	C
FAM91A3P	729182	genome.wustl.edu	37	1	149261469	149261469	+	lincRNA	SNP	T	T	G	rs149434917	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:149261469T>G	ENST00000325963.8	+	0	1016																											CAGAAATAACTTAAACATGTC	0.393													t|||	30	0.00599042	0.0023	0.0014	5008	,	,		23872	0.0179		0.0	False		,,,				2504	0.0082																0																																												0																															1.37:g.149261469T>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000325963.8	37	NULL		1																																																																																			RP11-403I13.4	-	-		0.393	RP11-403I13.4-002	KNOWN	not_best_in_genome_evidence|basic	lincRNA	ENSG00000223779	Clone_based_vega_gene	lincRNA	OTTHUMT00000099551.1	T			149261469	+1	no_errors	ENST00000325963	ensembl	human	known	70_37	rna	SNP	0.930	G
LINC01247	101929390	genome.wustl.edu	37	2	6514589	6514590	+	lincRNA	INS	-	-	A	rs538131582|rs5829056	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:6514589_6514590insA	ENST00000448901.1	-	0	964_965																											gacttcatctcaaaaaaaaaaa	0.446													|||unknown(HR)	1981	0.395567	0.4123	0.3991	5008	,	,		16316	0.5308		0.2734	False		,,,				2504	0.3569																0																																												0																															2.37:g.6514600_6514600dupA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000448901.1	37	NULL		2																																																																																			AC105253.1	-	-		0.446	AC105253.1-001	KNOWN	basic	lincRNA	ENSG00000227007	Clone_based_vega_gene	lincRNA	OTTHUMT00000322744.1	-			6514590	-1	no_errors	ENST00000448901	ensembl	human	known	70_37	rna	INS	0.004:0.006	A
TJP2	9414	genome.wustl.edu	37	9	71736638	71736638	+	Intron	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:71736638C>T	ENST00000453658.2	+	1	58					NM_001170414.2	NP_001163885.1	Q9UDY2	ZO2_HUMAN	tight junction protein 2						apoptotic process (GO:0006915)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|hippo signaling (GO:0035329)|nucleotide phosphorylation (GO:0046939)|response to organic substance (GO:0010033)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	guanylate kinase activity (GO:0004385)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(8)|kidney(2)|large_intestine(5)|lung(9)|prostate(3)|skin(3)|soft_tissue(1)|upper_aerodigestive_tract(1)	35						gccACCGGCTCTAGGCAAGTA	0.801																																																	0																																										SO:0001627	intron_variant	0			L27476	CCDS6627.1, CCDS6628.1, CCDS55314.1, CCDS55315.1, CCDS55316.1, CCDS55317.1	9q13-q21	2012-07-12	2012-07-12		ENSG00000119139	ENSG00000119139			11828	protein-coding gene	gene with protein product	"""Friedreich ataxia region gene X104 (tight junction protein ZO-2)"", ""zona occludens 2"""	607709	"""deafness, autosomal dominant 51"""	DFNA51		7951235, 20602916	Standard	NM_001170630		Approved	ZO-2, X104, ZO2	uc011lrv.2	Q9UDY2	OTTHUMG00000019978	ENST00000453658.2:c.-131+357C>T	9.37:g.71736638C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A3H9|B7Z2R8|B7Z7T6|F5H301|F5H886|Q15883|Q5VXL0|Q5VXL1|Q8N756|Q8NI14|Q99839|Q9UDY0|Q9UDY1	RNA	SNP	-	NULL	ENST00000453658.2	37	NULL	CCDS55317.1	9																																																																																			RP11-265B8.4	-	-		0.801	TJP2-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ENSG00000227410	Clone_based_vega_gene	protein_coding		C	NM_201629		71736638	+1	no_errors	ENST00000413932	ensembl	human	putative	70_37	rna	SNP	0.770	T
RP5-857K21.4	0	genome.wustl.edu	37	1	647148	647148	+	lincRNA	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:647148C>G	ENST00000414688.1	-	0	323																											TCCATACCTTCAAGTTTGCTC	0.363																																																	0																																												0																															1.37:g.647148C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000414688.1	37	NULL		1																																																																																			RP5-857K21.4	-	-		0.363	RP5-857K21.4-004	KNOWN	basic	lincRNA	ENSG00000230021	Clone_based_vega_gene	lincRNA	OTTHUMT00000006713.2	C			647148	-1	no_errors	ENST00000419394	ensembl	human	known	70_37	rna	SNP	0.001	G
THSD7A	221981	genome.wustl.edu	37	7	11559789	11559789	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:11559789G>A	ENST00000423059.4	-	6	2074				AC004538.3_ENST00000445839.1_RNA	NM_015204.2	NP_056019.1	Q9UPZ6	THS7A_HUMAN	thrombospondin, type I, domain containing 7A						angiogenesis (GO:0001525)|cell differentiation (GO:0030154)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(1)|autonomic_ganglia(1)|breast(5)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(7)|lung(68)|ovary(3)|pancreas(1)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(11)	113				UCEC - Uterine corpus endometrioid carcinoma (126;0.163)		AACAACTACTgagatgtaata	0.383										HNSCC(18;0.044)																																							0																																										SO:0001627	intron_variant	0				CCDS47543.1	7p21.3	2006-10-16			ENSG00000005108	ENSG00000005108			22207	protein-coding gene	gene with protein product		612249					Standard	NM_015204		Approved	KIAA0960	uc021zzn.1	Q9UPZ6	OTTHUMG00000152346	ENST00000423059.4:c.1822+21256C>T	7.37:g.11559789G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000423059.4	37	NULL	CCDS47543.1	7																																																																																			AC004538.3	-	-		0.383	THSD7A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000230333	Clone_based_vega_gene	protein_coding	OTTHUMT00000325944.4	G	XM_928187.2		11559789	+1	no_errors	ENST00000445839	ensembl	human	known	70_37	rna	SNP	0.000	A
ZNF462	58499	genome.wustl.edu	37	9	109737169	109737169	+	Intron	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:109737169C>T	ENST00000277225.5	+	9	7121				ZNF462_ENST00000457913.1_Intron|ZNF462_ENST00000441147.2_Intron|ZNF462_ENST00000542028.1_Intron|RP11-508N12.2_ENST00000439901.1_RNA			Q96JM2	ZN462_HUMAN	zinc finger protein 462						chromatin organization (GO:0006325)|negative regulation of DNA binding (GO:0043392)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|autonomic_ganglia(2)|breast(5)|central_nervous_system(4)|cervix(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(17)|large_intestine(20)|lung(32)|ovary(5)|prostate(6)|skin(2)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	119						ATGATTGTACCTATGAGATAA	0.343																																																	0																																										SO:0001627	intron_variant	0			AB058706	CCDS35096.1	9q31.3	2008-02-05			ENSG00000148143	ENSG00000148143		"""Zinc fingers, C2H2-type"""	21684	protein-coding gene	gene with protein product							Standard	NM_021224		Approved	DKFZP762N2316, KIAA1803, Zfp462	uc004bcz.3	Q96JM2	OTTHUMG00000020438	ENST00000277225.5:c.6832+615C>T	9.37:g.109737169C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T0T4|Q8N408	RNA	SNP	-	NULL	ENST00000277225.5	37	NULL	CCDS35096.1	9																																																																																			RP11-508N12.2	-	-		0.343	ZNF462-001	KNOWN	basic|CCDS	protein_coding	ENSG00000230782	Clone_based_vega_gene	protein_coding	OTTHUMT00000053532.2	C	NM_021224		109737169	-1	no_errors	ENST00000439901	ensembl	human	known	70_37	rna	SNP	0.001	T
AC011747.6	0	genome.wustl.edu	37	2	8763013	8763013	+	lincRNA	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:8763013G>C	ENST00000425678.1	-	0	59																											CCGTTAGacagacagacacac	0.537																																																	0																																												0																															2.37:g.8763013G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000425678.1	37	NULL		2																																																																																			AC011747.6	-	-		0.537	AC011747.6-001	KNOWN	basic|exp_conf	lincRNA	ENSG00000231083	Clone_based_vega_gene	lincRNA	OTTHUMT00000323325.1	G			8763013	-1	no_errors	ENST00000425678	ensembl	human	known	70_37	rna	SNP	0.000	C
RP11-495P10.8	0	genome.wustl.edu	37	1	147763200	147763200	+	lincRNA	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:147763200G>C	ENST00000434245.2	-	0	452																											ccaaaggcctgagaaccagga	0.493																																																	0																																												0																															1.37:g.147763200G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000434245.2	37	NULL		1																																																																																			RP11-495P10.8	-	-		0.493	RP11-495P10.8-001	KNOWN	basic	lincRNA	ENSG00000231196	Clone_based_vega_gene	lincRNA	OTTHUMT00000039533.2	G			147763200	-1	no_errors	ENST00000434245	ensembl	human	known	70_37	rna	SNP	0.193	C
RP3-470B24.5	0	genome.wustl.edu	37	6	168377051	168377051	+	lincRNA	SNP	G	G	C	rs369914425|rs71004179		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:168377051G>C	ENST00000538528.1	-	0	568																											CTGCAGTGTGGGGGGAGGAGA	0.632																																																	0																																												0																															6.37:g.168377051G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000538528.1	37	NULL		6																																																																																			RP3-470B24.5	-	-		0.632	RP3-470B24.5-201	KNOWN	basic	lincRNA	ENSG00000235994	Clone_based_vega_gene	lincRNA		G			168377051	-1	no_errors	ENST00000538528	ensembl	human	known	70_37	rna	SNP	0.355	C
EXD3	54932	genome.wustl.edu	37	9	140315619	140315619	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:140315619G>A	ENST00000340951.4	-	1	149				snoU13_ENST00000606918.1_RNA|NOXA1_ENST00000392815.2_5'Flank|EXD3_ENST00000342129.4_Intron|NOXA1_ENST00000341349.2_5'Flank|EXD3_ENST00000475006.1_Intron|EXD3_ENST00000465160.2_Intron|EXD3_ENST00000479452.1_Intron	NM_017820.3	NP_060290.3	Q9NX53	MUT7B_HUMAN	exonuclease 3'-5' domain containing 3											NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(5)|prostate(2)	12						tcataagcatgatgattgcct	0.473																																																	0																																										SO:0001627	intron_variant	0				CCDS48066.1, CCDS75942.1	9q34.3	2009-03-04			ENSG00000187609	ENSG00000187609			26023	protein-coding gene	gene with protein product							Standard	XM_005266093		Approved	LOC54932, FLJ20433, mut-7	uc004cmp.2	Q8N9H8	OTTHUMG00000156149	ENST00000340951.4:c.46+1946C>T	9.37:g.140315619G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P1M1|Q8IXT8	RNA	SNP	-	NULL	ENST00000340951.4	37	NULL	CCDS48066.1	9																																																																																			snoU13	-	-		0.473	EXD3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000238994	RFAM	protein_coding	OTTHUMT00000343182.1	G	NM_017820		140315619	+1	no_errors	ENST00000458861	ensembl	human	novel	70_37	rna	SNP	0.036	A
NPSR1	387129	genome.wustl.edu	37	7	34793237	34793237	+	Intron	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:34793237G>C	ENST00000360581.1	+	3	408				NPSR1-AS1_ENST00000419766.1_RNA|RN7SL132P_ENST00000478131.2_RNA|NPSR1_ENST00000381542.1_Intron|NPSR1_ENST00000531252.1_Intron|NPSR1_ENST00000381553.3_Intron|NPSR1_ENST00000359791.1_Intron|NPSR1_ENST00000381539.3_Intron	NM_207172.1	NP_997055.1	Q6W5P4	NPSR1_HUMAN	neuropeptide S receptor 1							cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	neuropeptide receptor activity (GO:0008188)|vasopressin receptor activity (GO:0005000)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(5)|lung(14)|pancreas(1)|skin(7)	31					Halothane(DB01159)	gttggaaacagagcaagtcaa	0.473																																																	0																																										SO:0001627	intron_variant	0			AY255536	CCDS5443.1, CCDS5444.1, CCDS75579.1, CCDS75580.1, CCDS75581.1	7p14.3	2012-08-08	2006-05-10	2006-05-10	ENSG00000187258	ENSG00000187258		"""GPCR / Class A : Neuropeptide receptors : S"""	23631	protein-coding gene	gene with protein product		608595	"""G protein-coupled receptor 154"""	GPR154		12679517, 15073379	Standard	NM_207173		Approved	PGR14, GPRA	uc003tei.1	Q6W5P4	OTTHUMG00000099383	ENST00000360581.1:c.281-24837G>C	7.37:g.34793237G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RTZ4|Q2XP58|Q56H76|Q56H77|Q56H78|Q6JSL4|Q6JSL5|Q6JSL6|Q6JSL7|Q6JSL8|Q6W5P3|Q6ZMB8	RNA	SNP	-	NULL	ENST00000360581.1	37	NULL	CCDS5444.1	7																																																																																			Metazoa_SRP	-	-		0.473	NPSR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000242653	RFAM	protein_coding	OTTHUMT00000216837.1	G	NM_207173		34793237	+1	no_errors	ENST00000478131	ensembl	human	novel	70_37	rna	SNP	0.001	C
CTD-2134P3.1	0	genome.wustl.edu	37	5	28809279	28809279	+	lincRNA	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr5:28809279C>T	ENST00000504398.1	-	0	77																											TGGACCTGGCCGTCCTGGGGC	0.627																																																	0																																												0																															5.37:g.28809279C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000504398.1	37	NULL		5																																																																																			CTD-2134P3.1	-	-		0.627	CTD-2134P3.1-001	KNOWN	basic	lincRNA	ENSG00000250453	Clone_based_vega_gene	lincRNA	OTTHUMT00000366455.1	C			28809279	-1	no_errors	ENST00000504398	ensembl	human	known	70_37	rna	SNP	1.000	T
CYSTM1	84418	genome.wustl.edu	37	5	139582271	139582271	+	Intron	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr5:139582271G>C	ENST00000261811.4	+	2	851				CYSTM1_ENST00000509789.2_Intron|CTB-131B5.2_ENST00000508713.1_RNA	NM_032412.3	NP_115788.1	Q9H1C7	CYTM1_HUMAN	cysteine-rich transmembrane module containing 1							extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)											CTCTTGGATTGACTTACACTT	0.448																																																	0																																										SO:0001627	intron_variant	0			AJ245877	CCDS4221.1	5q31.3	2012-02-23	2012-02-23	2012-02-23	ENSG00000120306	ENSG00000120306			30239	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 32"""	C5orf32		19933165	Standard	NM_032412		Approved	ORF1-FL49	uc003lfd.3	Q9H1C7	OTTHUMG00000129243	ENST00000261811.4:c.187+8034G>C	5.37:g.139582271G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TBA5	RNA	SNP	-	NULL	ENST00000261811.4	37	NULL	CCDS4221.1	5																																																																																			CTB-131B5.2	-	-		0.448	CYSTM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000250069	Clone_based_vega_gene	protein_coding	OTTHUMT00000251342.2	G	NM_032412		139582271	+1	no_errors	ENST00000508713	ensembl	human	known	70_37	rna	SNP	0.001	C
RP11-566H8.2	0	genome.wustl.edu	37	8	31196731	31196731	+	RNA	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:31196731C>T	ENST00000524017.1	+	0	19				RP11-566H8.3_ENST00000524022.1_lincRNA																							GTCTGCTCTTCAGCATCCCCT	0.383																																																	0																																												0																															8.37:g.31196731C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000524017.1	37	NULL		8																																																																																			RP11-566H8.2	-	-		0.383	RP11-566H8.2-001	KNOWN	basic	lincRNA	ENSG00000254095	Clone_based_vega_gene	processed_transcript	OTTHUMT00000376374.1	C			31196731	+1	no_errors	ENST00000524017	ensembl	human	known	70_37	rna	SNP	0.000	T
RP11-624D11.2	0	genome.wustl.edu	37	11	30065934	30065934	+	lincRNA	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:30065934C>T	ENST00000527819.1	-	0	99																											ctattggccACAATAGGTCTC	0.418																																																	0																																												0																															11.37:g.30065934C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000527819.1	37	NULL		11																																																																																			RP11-624D11.2	-	-		0.418	RP11-624D11.2-001	KNOWN	basic	lincRNA	ENSG00000254532	Clone_based_vega_gene	lincRNA	OTTHUMT00000388076.1	C			30065934	-1	no_errors	ENST00000527819	ensembl	human	known	70_37	rna	SNP	0.001	T
RP11-266O8.1	0	genome.wustl.edu	37	15	94039493	94039493	+	lincRNA	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:94039493G>C	ENST00000543286.1	+	0	545																											GGGCAGTGCTGAGTCATTCAC	0.398																																																	0																																												0																															15.37:g.94039493G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000543286.1	37	NULL		15																																																																																			RP11-266O8.1	-	-		0.398	RP11-266O8.1-003	KNOWN	basic	lincRNA	ENSG00000257060	Clone_based_vega_gene	lincRNA	OTTHUMT00000415156.1	G			94039493	+1	no_errors	ENST00000556519	ensembl	human	known	70_37	rna	SNP	0.033	C
PDZRN4	29951	genome.wustl.edu	37	12	41867287	41867287	+	Intron	SNP	G	G	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:41867287G>T	ENST00000402685.2	+	4	851				PDZRN4_ENST00000298919.7_Intron|RP11-413B19.2_ENST00000547168.1_RNA|PDZRN4_ENST00000539469.2_Intron	NM_001164595.1	NP_001158067.1	Q6ZMN7	PZRN4_HUMAN	PDZ domain containing ring finger 4								ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(23)|lung(29)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	77	all_cancers(12;0.000673)	Lung NSC(34;0.0205)|all_lung(34;0.0264)				AAGCTCTCAGGATTTCAGGAA	0.478																																																	0																																										SO:0001627	intron_variant	0			AK094690	CCDS8739.1, CCDS53777.1	12q12	2008-08-14	2008-08-14			ENSG00000165966		"""RING-type (C3HC4) zinc fingers"""	30552	protein-coding gene	gene with protein product	"""similar to semaF cytoplasmic domain associated protein 3"""	609730				11230166, 15010864	Standard	NM_013377		Approved	DKFZp434B0417, LNX4, FLJ33777, IMAGE5767589	uc010skn.2	Q6ZMN7		ENST00000402685.2:c.844-32971G>T	12.37:g.41867287G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LY3|Q52LY4|Q6N052|Q8IUU1|Q9NTP7	RNA	SNP	-	NULL	ENST00000402685.2	37	NULL	CCDS53777.1	12																																																																																			RP11-413B19.2	-	-		0.478	PDZRN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000257228	Clone_based_vega_gene	protein_coding	OTTHUMT00000403701.1	G	NM_013377		41867287	-1	no_errors	ENST00000547168	ensembl	human	known	70_37	rna	SNP	0.000	T
CTD-2200A16.1	0	genome.wustl.edu	37	14	99791163	99791163	+	lincRNA	SNP	A	A	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:99791163A>T	ENST00000555595.1	-	0	180																											TATTATACACACACGCACATA	0.507																																																	0																																												0																															14.37:g.99791163A>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000555595.1	37	NULL		14																																																																																			CTD-2200A16.1	-	-		0.507	CTD-2200A16.1-001	KNOWN	basic	lincRNA	ENSG00000258383	Clone_based_vega_gene	lincRNA	OTTHUMT00000413594.1	A			99791163	-1	no_errors	ENST00000555595	ensembl	human	known	70_37	rna	SNP	0.000	T
KRT8P11	347265	genome.wustl.edu	37	9	102068876	102068876	+	IGR	SNP	G	G	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:102068876G>T								RN7SKP225 (22221 upstream) : NAMA (48815 downstream)																							CGAGTCCTCTGACGTCCTGTC	0.677																																																	0																																										SO:0001628	intergenic_variant	0																															9.37:g.102068876G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.D495Y		37	c.1483		9	.	.	.	.	.	.	.	.	.	.	G	13.33	2.206036	0.39003	.	.	ENSG00000222039	ENST00000409686	D	0.83837	-1.77	0.522	0.522	0.17053	.	.	.	.	.	D	0.83848	0.5343	.	.	.	0.50632	D	0.999885	.	.	.	.	.	.	T	0.81890	-0.0725	6	0.87932	D	0	.	6.7831	0.23657	1.0E-4:0.0:0.9999:0.0	.	.	.	.	Y	495	ENSP00000404011:D495Y	ENSP00000404011:D495Y	D	+	1	0	KRT8P11	101108697	0.982000	0.34865	0.013000	0.15412	0.025000	0.11179	2.103000	0.41806	0.508000	0.28173	0.313000	0.20887	GAC	KRT8P11	-	NULL	0	0.677					ENSG00000259197	Uniprot_genename			G			102068876	+1	no_errors	ENST00000409686	ensembl	human	known	70_37	missense	SNP	1.000	T
RP11-594N15.3	0	genome.wustl.edu	37	8	79520545	79520545	+	RNA	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:79520545C>G	ENST00000565862.1	+	0	2359																											ttgatcctttcagactaagcc	0.423																																																	0																																												0																															8.37:g.79520545C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000565862.1	37	NULL		8																																																																																			RP11-594N15.3	-	-		0.423	RP11-594N15.3-001	KNOWN	basic	sense_overlapping	ENSG00000260398	Clone_based_vega_gene	sense_overlapping	OTTHUMT00000423041.1	C			79520545	+1	no_errors	ENST00000565862	ensembl	human	known	70_37	rna	SNP	0.003	G
CATSPERB	79820	genome.wustl.edu	37	14	92225683	92225683	+	RNA	SNP	C	C	A	rs186320216	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:92225683C>A	ENST00000565058.1	-	0	459																											gtgtgtgagacggggagaaac	0.498																																																	0																																												0																															14.37:g.92225683C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000565058.1	37	NULL		14																																																																																			RP11-747H7.3	-	-		0.498	RP11-747H7.3-001	KNOWN	basic	sense_intronic	ENSG00000260711	Clone_based_vega_gene	sense_intronic	OTTHUMT00000421598.1	C			92225683	-1	no_errors	ENST00000565058	ensembl	human	known	70_37	rna	SNP	0.002	A
LOC103344931	103344931	genome.wustl.edu	37	10	114586234	114586234	+	RNA	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr10:114586234G>A	ENST00000564352.1	+	0	2986																											ACCACCCGGAGAGATTTAATC	0.478																																																	0																																												0																															10.37:g.114586234G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000564352.1	37	NULL		10																																																																																			RP11-57H14.4	-	-		0.478	RP11-57H14.4-001	KNOWN	basic	sense_overlapping	ENSG00000260917	Clone_based_vega_gene	sense_overlapping	OTTHUMT00000431623.1	G			114586234	+1	no_errors	ENST00000564352	ensembl	human	known	70_37	rna	SNP	0.017	A
ANKRD11	29123	genome.wustl.edu	37	16	89391072	89391072	+	Intron	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:89391072C>T	ENST00000301030.4	-	3	402				ANKRD11_ENST00000563291.1_Intron|ANKRD11_ENST00000378330.2_Intron|AC137932.6_ENST00000565667.1_RNA|AC137932.6_ENST00000562995.1_RNA	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11						bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		ttcttccatgctggatacttc	0.572																																																	0																																										SO:0001627	intron_variant	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.59-7586G>A	16.37:g.89391072C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NTG1|Q6QMF8	RNA	SNP	-	NULL	ENST00000301030.4	37	NULL	CCDS32513.1	16																																																																																			AC137932.6	-	-		0.572	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261253	Clone_based_vega_gene	protein_coding	OTTHUMT00000430462.3	C	NM_013275		89391072	+1	no_errors	ENST00000562995	ensembl	human	known	70_37	rna	SNP	0.020	T
ANKRD11	29123	genome.wustl.edu	37	16	89391419	89391419	+	Intron	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:89391419C>G	ENST00000301030.4	-	3	402				ANKRD11_ENST00000563291.1_Intron|ANKRD11_ENST00000378330.2_Intron|AC137932.6_ENST00000565667.1_RNA|AC137932.6_ENST00000562995.1_RNA	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11						bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		agtccactctcatcagggcca	0.463																																																	0																																										SO:0001627	intron_variant	0			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.59-7933G>C	16.37:g.89391419C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NTG1|Q6QMF8	RNA	SNP	-	NULL	ENST00000301030.4	37	NULL	CCDS32513.1	16																																																																																			AC137932.6	-	-		0.463	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000261253	Clone_based_vega_gene	protein_coding	OTTHUMT00000430462.3	C	NM_013275		89391419	+1	no_errors	ENST00000562995	ensembl	human	known	70_37	rna	SNP	0.006	G
RP11-96B5.4	0	genome.wustl.edu	37	10	52724049	52724049	+	lincRNA	SNP	C	C	T	rs73330832	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr10:52724049C>T	ENST00000561565.1	+	0	20																											gggtccacttccccactgtga	0.502																																																	0																																												0																															10.37:g.52724049C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000561565.1	37	NULL		10																																																																																			RP11-96B5.4	-	-		0.502	RP11-96B5.4-001	KNOWN	basic	lincRNA	ENSG00000261368	Clone_based_vega_gene	lincRNA	OTTHUMT00000431596.1	C			52724049	+1	no_errors	ENST00000561565	ensembl	human	known	70_37	rna	SNP	0.005	T
LINC00662	148189	genome.wustl.edu	37	19	28251724	28251724	+	lincRNA	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:28251724C>G	ENST00000562493.1	-	0	33																											tcaattgtctctataattaga	0.463																																																	0																																												0																															19.37:g.28251724C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000562493.1	37	NULL		19																																																																																			CTC-459F4.1	-	-		0.463	CTC-459F4.1-001	KNOWN	basic	lincRNA	ENSG00000261770	Clone_based_vega_gene	lincRNA	OTTHUMT00000431028.1	C			28251724	-1	no_errors	ENST00000562493	ensembl	human	known	70_37	rna	SNP	0.297	G
LOC101927277	101927277	genome.wustl.edu	37	19	32081958	32081958	+	lincRNA	SNP	T	T	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:32081958T>C	ENST00000562167.1	-	0	2663				AC011525.4_ENST00000590611.2_lincRNA																							ttgtgctttttccccaaattc	0.468																																																	0																																												0																															19.37:g.32081958T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000562167.1	37	NULL		19																																																																																			AC011525.2	-	-		0.468	AC011525.2-001	KNOWN	basic	lincRNA	ENSG00000261400	Clone_based_vega_gene	lincRNA	OTTHUMT00000431043.3	T			32081958	-1	no_errors	ENST00000562167	ensembl	human	known	70_37	rna	SNP	0.000	C
HS3ST3B1	9953	genome.wustl.edu	37	17	14232701	14232702	+	Intron	INS	-	-	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:14232701_14232702insG	ENST00000360954.2	+	2	990				RP11-214O1.3_ENST00000584683.1_lincRNA	NM_006041.1	NP_006032.1	Q9Y662	HS3SB_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3B1						carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparan sulfate proteoglycan biosynthetic process, enzymatic modification (GO:0015015)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of plasma membrane (GO:0005887)	[heparan sulfate]-glucosamine 3-sulfotransferase 1 activity (GO:0008467)|[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)			large_intestine(3)|lung(3)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0887)		ggaaggaaggaaggaaggagag	0.381																																																	0																																										SO:0001627	intron_variant	0			AF105377	CCDS11167.1	17p12	2007-04-02			ENSG00000125430	ENSG00000125430	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5198	protein-coding gene	gene with protein product		604058				9988767	Standard	NM_006041		Approved	3OST3B1, 30ST3B1	uc002goh.1	Q9Y662	OTTHUMG00000058810	ENST00000360954.2:c.555-15643->G	17.37:g.14232701_14232702insG		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KN58|D3DTS6	RNA	INS	-	NULL	ENST00000360954.2	37	NULL	CCDS11167.1	17																																																																																			RP11-214O1.3	-	-		0.381	HS3ST3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000266378	Clone_based_vega_gene	protein_coding	OTTHUMT00000129998.1	-	NM_006041		14232702	+1	no_errors	ENST00000584683	ensembl	human	known	70_37	rna	INS	0.001:0.001	G
GNAS-AS1	149775	genome.wustl.edu	37	20	57411560	57411560	+	RNA	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr20:57411560C>G	ENST00000424094.2	-	0	819				RP4-806M20.3_ENST00000601795.1_lincRNA|GNAS-AS1_ENST00000598163.1_RNA	NR_002785.2				GNAS antisense RNA 1																		ACTGCGCTTTCCTGTCCAACT	0.448																																																	0																																												0			AJ251759		20q13.32	2012-10-19	2012-08-15	2010-11-25	ENSG00000235590	ENSG00000235590		"""Long non-coding RNAs"", ""-"""	24872	non-coding RNA	RNA, long non-coding	"""GNAS antisense"", ""non-protein coding RNA 75"""	610540	"""GNAS antisense RNA (non-protein coding)"", ""GNAS antisense RNA 1 (non-protein coding)"""	GNASAS, GNAS-AS		10749992	Standard	NR_002785		Approved	SANG, NESP-AS, NESPAS, GNAS1AS, NCRNA00075	uc002xzs.2		OTTHUMG00000060481		20.37:g.57411560C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000424094.2	37	NULL		20																																																																																			RP4-806M20.3	-	-		0.448	GNAS-AS1-001	KNOWN	basic	antisense	ENSG00000268333	Clone_based_vega_gene	antisense	OTTHUMT00000133891.2	C	NR_002785		57411560	-1	no_errors	ENST00000601795	ensembl	human	putative	70_37	rna	SNP	0.413	G
EXOC3L4	91828	genome.wustl.edu	37	14	103566829	103566829	+	Silent	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:103566829G>C	ENST00000380069.3	+	1	349	c.273G>C	c.(271-273)ctG>ctC	p.L91L	RP11-736N17.8_ENST00000559843.1_RNA	NM_001077594.1	NP_001071062.1	Q17RC7	EX3L4_HUMAN	exocyst complex component 3-like 4	91					exocytosis (GO:0006887)	exocyst (GO:0000145)		p.L91L(1)		cervix(2)|endometrium(2)|lung(4)|ovary(1)|skin(1)	10						GGCAAGCCCTGAATGACGGCC	0.662																																																	1	Substitution - coding silent(1)	cervix(1)											21.0	22.0	21.0					14																	103566829		2203	4299	6502	SO:0001819	synonymous_variant	91828			AK000671	CCDS32163.1	14q32.32	2011-01-31	2011-01-31	2011-01-31	ENSG00000205436	ENSG00000205436			20120	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 73"""	C14orf73			Standard	NM_001077594		Approved		uc001ymk.3	Q17RC7		ENST00000380069.3:c.273G>C	14.37:g.103566829G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14CR2	Silent	SNP	pfam_Sec6	p.L91	ENST00000380069.3	37	c.273	CCDS32163.1	14																																																																																			EXOC3L4	-	NULL		0.662	EXOC3L4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EXOC3L4	HGNC	protein_coding	OTTHUMT00000415663.1	G	XM_941093		103566829	+1	no_errors	ENST00000380069	ensembl	human	known	70_37	silent	SNP	0.000	C
FAM129A	116496	genome.wustl.edu	37	1	184764870	184764870	+	Silent	SNP	G	G	C	rs376073509		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:184764870G>C	ENST00000367511.3	-	14	2221	c.2028C>G	c.(2026-2028)ctC>ctG	p.L676L	FAM129A_ENST00000487074.1_5'UTR	NM_052966.2	NP_443198.1	Q9BZQ8	NIBAN_HUMAN	family with sequence similarity 129, member A	676					negative regulation of protein phosphorylation (GO:0001933)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of translation (GO:0045727)|response to endoplasmic reticulum stress (GO:0034976)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)		p.L676L(2)		autonomic_ganglia(1)|breast(1)|cervix(2)|endometrium(4)|large_intestine(6)|liver(1)|lung(22)|ovary(3)|skin(3)|upper_aerodigestive_tract(2)	45						ATGTGCCCGGGAGTCCTGCTG	0.577																																																	2	Substitution - coding silent(2)	cervix(1)|lung(1)											64.0	55.0	58.0					1																	184764870		2203	4300	6503	SO:0001819	synonymous_variant	116496			AF288391	CCDS1364.1	1q25	2008-10-08	2006-11-23	2006-11-23	ENSG00000135842	ENSG00000135842			16784	protein-coding gene	gene with protein product	"""cell growth inhibiting protein 39"""		"""chromosome 1 open reading frame 24"""	C1orf24		15085203, 16444351	Standard	NM_052966		Approved	NIBAN, GIG39	uc001gra.4	Q9BZQ8	OTTHUMG00000035388	ENST00000367511.3:c.2028C>G	1.37:g.184764870G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TTR2|Q5TEM8|Q8TEI5|Q9H593|Q9H9Y8|Q9HCB9	Silent	SNP	NULL	p.L676	ENST00000367511.3	37	c.2028	CCDS1364.1	1																																																																																			FAM129A	-	NULL		0.577	FAM129A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM129A	HGNC	protein_coding	OTTHUMT00000085786.1	G			184764870	-1	no_errors	ENST00000367511	ensembl	human	known	70_37	silent	SNP	0.000	C
FAM182B	728882	genome.wustl.edu	37	20	25847936	25847936	+	Intron	SNP	C	C	T	rs371671885		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr20:25847936C>T	ENST00000478164.1	-	1	198				FAM182B_ENST00000376404.2_Intron			Q5T319	F182B_HUMAN	family with sequence similarity 182, member B											lung(1)	1						CTCCCATTCCCGGCTTCCTCT	0.557																																																	0																																										SO:0001627	intron_variant	728882					20p11.1	2010-07-14			ENSG00000175170	ENSG00000175170			34503	pseudogene	pseudogene							Standard	NR_027061		Approved			Q5T319	OTTHUMG00000032136	ENST00000478164.1:c.794+652G>A	20.37:g.25847936C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G0Q1	RNA	SNP	-	NULL	ENST00000478164.1	37	NULL		20																																																																																			FAM182B	-	-		0.557	FAM182B-005	KNOWN	basic	processed_transcript	FAM182B	HGNC	protein_coding	OTTHUMT00000316665.1	C	NR_026714		25847936	-1	no_errors	ENST00000424021	ensembl	human	known	70_37	rna	SNP	0.056	T
FAT3	120114	genome.wustl.edu	37	11	92086050	92086050	+	Missense_Mutation	SNP	C	C	T	rs538781318		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:92086050C>T	ENST00000298047.6	+	1	789	c.772C>T	c.(772-774)Cgc>Tgc	p.R258C	FAT3_ENST00000409404.2_Missense_Mutation_p.R258C|FAT3_ENST00000525166.1_Missense_Mutation_p.R108C|FAT3_ENST00000541502.1_Missense_Mutation_p.R258C			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	258	Cadherin 2. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.R258C(2)|p.R258S(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				TCACATTGAGCGCATAAATGA	0.428										TCGA Ovarian(4;0.039)			C|||	1	0.000199681	0.0008	0.0	5008	,	,		21189	0.0		0.0	False		,,,				2504	0.0																4	Substitution - Missense(4)	cervix(2)|lung(2)											186.0	178.0	181.0					11																	92086050		2000	4175	6175	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.772C>T	11.37:g.92086050C>T	ENSP00000298047:p.Arg258Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.R258C	ENST00000298047.6	37	c.772		11	.	.	.	.	.	.	.	.	.	.	C	18.34	3.603479	0.66445	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.61980	0.06;0.06;0.06;0.06	4.83	4.83	0.62350	.	.	.	.	.	T	0.76557	0.4004	L	0.56769	1.78	0.58432	D	0.999999	D	0.89917	1.0	D	0.91635	0.999	T	0.78940	-0.2006	9	0.66056	D	0.02	.	17.2694	0.87097	0.0:1.0:0.0:0.0	.	258	Q8TDW7-3	.	C	258;258;258;108	ENSP00000298047:R258C;ENSP00000387040:R258C;ENSP00000443786:R258C;ENSP00000432586:R108C	ENSP00000298047:R258C	R	+	1	0	FAT3	91725698	1.000000	0.71417	0.953000	0.39169	0.741000	0.42261	7.752000	0.85141	2.359000	0.80004	0.557000	0.71058	CGC	FAT3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.428	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		C	NM_001008781		92086050	+1	no_errors	ENST00000298047	ensembl	human	known	70_37	missense	SNP	1.000	T
FAT3	120114	genome.wustl.edu	37	11	92088452	92088452	+	Silent	SNP	T	T	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:92088452T>C	ENST00000298047.6	+	1	3191	c.3174T>C	c.(3172-3174)atT>atC	p.I1058I	FAT3_ENST00000409404.2_Silent_p.I1058I|FAT3_ENST00000525166.1_Silent_p.I908I|FAT3_ENST00000541502.1_Silent_p.I1058I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1058	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I1058I(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTCACGCATTGGAACAAGCG	0.498										TCGA Ovarian(4;0.039)																																							2	Substitution - coding silent(2)	cervix(2)											107.0	102.0	104.0					11																	92088452		2033	4191	6224	SO:0001819	synonymous_variant	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3174T>C	11.37:g.92088452T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.I1058	ENST00000298047.6	37	c.3174		11																																																																																			FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.498	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		T	NM_001008781		92088452	+1	no_errors	ENST00000298047	ensembl	human	known	70_37	silent	SNP	0.994	C
FAT3	120114	genome.wustl.edu	37	11	92088452	92088452	+	Silent	SNP	T	T	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:92088452T>C	ENST00000298047.6	+	1	3191	c.3174T>C	c.(3172-3174)atT>atC	p.I1058I	FAT3_ENST00000409404.2_Silent_p.I1058I|FAT3_ENST00000525166.1_Silent_p.I908I|FAT3_ENST00000541502.1_Silent_p.I1058I			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	1058	Cadherin 10. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.I1058I(2)		NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACTCACGCATTGGAACAAGCG	0.498										TCGA Ovarian(4;0.039)																																							2	Substitution - coding silent(2)	cervix(2)											107.0	102.0	104.0					11																	92088452		2033	4191	6224	SO:0001819	synonymous_variant	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.3174T>C	11.37:g.92088452T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDB0|Q96AU6	Silent	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.I1058	ENST00000298047.6	37	c.3174		11																																																																																			FAT3	-	pfam_Cadherin,superfamily_Cadherin-like,pfscan_Cadherin		0.498	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		T	NM_001008781		92088452	+1	no_errors	ENST00000298047	ensembl	human	known	70_37	silent	SNP	0.994	C
FLG	2312	genome.wustl.edu	37	1	152278555	152278555	+	Missense_Mutation	SNP	T	T	C	rs80221306	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:152278555T>C	ENST00000368799.1	-	3	8842	c.8807A>G	c.(8806-8808)gAc>gGc	p.D2936G	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2936	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			ACCAGCTCTGTCTTCTTGATG	0.552									Ichthyosis																																								0								T	GLY/ASP	267,3373		3,261,1556	22.0	34.0	31.0		8807	1.3	0.0	1	dbSNP_131	31	809,7583		0,809,3387	no	missense	FLG	NM_002016.1	94	3,1070,4943	CC,CT,TT		9.6401,7.3352,8.9428	benign	2936/4062	152278555	1076,10956	1820	4196	6016	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8807A>G	1.37:g.152278555T>C	ENSP00000357789:p.Asp2936Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.D2936G	ENST00000368799.1	37	c.8807	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	T	7.089	0.571862	0.13623	0.073352	0.096401	ENSG00000143631	ENST00000368799	T	0.01685	4.69	1.29	1.29	0.21616	.	.	.	.	.	T	0.00815	0.0027	M	0.70595	2.14	0.80722	P	0.0	B	0.17852	0.024	B	0.10450	0.005	T	0.39375	-0.9617	8	0.22706	T	0.39	.	4.7721	0.13160	0.0:0.0:0.0:1.0	.	2936	P20930	FILA_HUMAN	G	2936	ENSP00000357789:D2936G	ENSP00000357789:D2936G	D	-	2	0	FLG	150545179	0.000000	0.05858	0.001000	0.08648	0.004000	0.04260	-0.386000	0.07370	0.851000	0.35264	0.248000	0.18094	GAC	FLG	-	NULL		0.552	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	T	NM_002016		152278555	-1	no_errors	ENST00000368799	ensembl	human	known	70_37	missense	SNP	0.001	C
RNA5SP414	100873665	genome.wustl.edu	37	16	34982740	34982740	+	lincRNA	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:34982740G>A	ENST00000516580.1	+	0	0				5S_rRNA_ENST00000516234.1_lincRNA|RNA5SP413_ENST00000516373.1_RNA|RNA5SP415_ENST00000517246.1_RNA|5S_rRNA_ENST00000516136.1_lincRNA|RNA5SP410_ENST00000516285.1_RNA																							atgggggaccgcctggagaga	0.597																																																	0																																												400533																															16.37:g.34982740G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000516580.1	37	NULL		16																																																																																			RP11-352B15.1	-	-		0.597	5S_rRNA.6-203	KNOWN	basic	rRNA	FLJ26245	Clone_based_vega_gene	lincRNA		G			34982740	+1	no_errors	ENST00000565625	ensembl	human	known	70_37	rna	SNP	0.692	A
FRMPD2	143162	genome.wustl.edu	37	10	49383976	49383976	+	Missense_Mutation	SNP	T	T	C	rs200957845		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr10:49383976T>C	ENST00000374201.3	-	23	3204	c.2902A>G	c.(2902-2904)Att>Gtt	p.I968V	FRMPD2_ENST00000463706.1_5'UTR|FRMPD2_ENST00000305531.3_Missense_Mutation_p.I943V|FRMPD2_ENST00000407470.4_Missense_Mutation_p.I936V|FRMPD2_ENST00000474573.1_5'UTR	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	968	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		CTGGTGTTAATGCCACCCTGA	0.532																																																	0													3.0	1.0	1.0					10																	49383976		81	163	244	SO:0001583	missense	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2902A>G	10.37:g.49383976T>C	ENSP00000363317:p.Ile968Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.I968V	ENST00000374201.3	37	c.2902	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	T	0.019	-1.452426	0.01080	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	T;T;T	0.26810	1.71;1.71;1.71	4.81	-0.335	0.12662	PDZ/DHR/GLGF (4);	.	.	.	.	T	0.10723	0.0262	N	0.03891	-0.335	0.09310	N	1	B;B;B	0.18863	0.006;0.031;0.016	B;B;B	0.23419	0.016;0.046;0.024	T	0.39165	-0.9627	9	0.21540	T	0.41	.	9.0019	0.36088	0.0:0.3679:0.0:0.6321	.	943;968;936	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	V	968;943;936	ENSP00000363317:I968V;ENSP00000307079:I943V;ENSP00000384339:I936V	ENSP00000307079:I943V	I	-	1	0	FRMPD2	49053982	0.623000	0.27094	0.520000	0.27837	0.722000	0.41435	0.524000	0.22940	-0.339000	0.08401	0.528000	0.53228	ATT	FRMPD2	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ		0.532	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	T	NM_152428		49383976	-1	no_errors	ENST00000374201	ensembl	human	known	70_37	missense	SNP	0.060	C
Unknown	0	genome.wustl.edu	37	22	18830883	18830883	+	IGR	SNP	G	G	A	rs369605741		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:18830883G>A								GGT3P (37891 upstream) : AC008132.13 (3440 downstream)																							CTGGAAAATGGCTAAGTCGGG	0.398																																																	0																																										SO:0001628	intergenic_variant	2679																															22.37:g.18830883G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		22																																																																																			GGT3P	-	-	0	0.398					GGT3P	HGNC			G			18830883	-1	no_errors	ENST00000445651	ensembl	human	known	70_37	rna	SNP	0.094	A
GINS2	51659	genome.wustl.edu	37	16	85722474	85722474	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:85722474C>A	ENST00000253462.3	-	1	131	c.31G>T	c.(31-33)Gag>Tag	p.E11*	C16orf74_ENST00000602758.1_5'Flank	NM_016095.2	NP_057179.1	Q9Y248	PSF2_HUMAN	GINS complex subunit 2 (Psf2 homolog)	11					DNA strand elongation involved in DNA replication (GO:0006271)|mitotic cell cycle (GO:0000278)	nucleoplasm (GO:0005654)				endometrium(2)|large_intestine(2)|lung(2)	6						AGCTCCTTCTCGGCGAGGAAT	0.682																																																	0													28.0	23.0	25.0					16																	85722474		2163	4227	6390	SO:0001587	stop_gained	51659			BC003186	CCDS10953.1	16q24.1	2008-02-05			ENSG00000131153	ENSG00000131153			24575	protein-coding gene	gene with protein product		610609				11042152, 10810093	Standard	NM_016095		Approved	PSF2, Pfs2	uc002fja.3	Q9Y248	OTTHUMG00000137646	ENST00000253462.3:c.31G>T	16.37:g.85722474C>A	ENSP00000253462:p.Glu11*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUM5|Q6IAG9	Nonsense_Mutation	SNP	pfam_GINS_complex,pirsf_GINS_Psf2_subgr	p.E11*	ENST00000253462.3	37	c.31	CCDS10953.1	16	.	.	.	.	.	.	.	.	.	.	C	28.0	4.881404	0.91740	.	.	ENSG00000131153	ENST00000253462	.	.	.	3.94	2.99	0.34606	.	0.064498	0.64402	D	0.000010	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.49607	T	0.09	-32.0537	10.3871	0.44148	0.0:0.9005:0.0:0.0995	.	.	.	.	X	11	.	ENSP00000253462:E11X	E	-	1	0	GINS2	84279975	1.000000	0.71417	0.940000	0.37924	0.132000	0.20833	5.828000	0.69307	0.879000	0.35944	-0.339000	0.08088	GAG	GINS2	-	pirsf_GINS_Psf2_subgr		0.682	GINS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GINS2	HGNC	protein_coding	OTTHUMT00000269098.1	C	NM_016095		85722474	-1	no_errors	ENST00000253462	ensembl	human	known	70_37	nonsense	SNP	1.000	A
GOLGB1	2804	genome.wustl.edu	37	3	121414091	121414091	+	Missense_Mutation	SNP	T	T	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:121414091T>G	ENST00000340645.5	-	13	5389	c.5264A>C	c.(5263-5265)gAg>gCg	p.E1755A	GOLGB1_ENST00000393667.3_Missense_Mutation_p.E1760A	NM_001256487.1|NM_001256488.1|NM_004487.4	NP_001243416.1|NP_001243417.1|NP_004478.3	Q14789	GOGB1_HUMAN	golgin B1	1755					Golgi organization (GO:0007030)	cis-Golgi network (GO:0005801)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)	p.E1755A(1)		NS(1)|autonomic_ganglia(1)|breast(7)|central_nervous_system(2)|cervix(2)|endometrium(12)|kidney(3)|large_intestine(26)|liver(2)|lung(36)|ovary(7)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(13)	119				GBM - Glioblastoma multiforme(114;0.0989)		ATCTTGAACCTCTTCACTTAG	0.388																																																	1	Substitution - Missense(1)	cervix(1)											174.0	167.0	170.0					3																	121414091		2203	4300	6503	SO:0001583	missense	2804			X75304	CCDS3004.1, CCDS58847.1, CCDS74989.1	3q13	2010-02-12	2010-02-12	2007-07-27	ENSG00000173230	ENSG00000173230			4429	protein-coding gene	gene with protein product	"""macrogolgin"", ""golgi integral membrane protein 1"""	602500	"""golgi autoantigen, golgin subfamily b, macrogolgin (with transmembrane signal), 1"", ""golgin B1, golgi integral membrane protein"""			7691276, 15004235	Standard	NM_001256486		Approved	GCP, GCP372, giantin, GOLIM1	uc010hrc.4	Q14789	OTTHUMG00000159411	ENST00000340645.5:c.5264A>C	3.37:g.121414091T>G	ENSP00000341848:p.Glu1755Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ91|D3DN92|E7EP74|Q14398	Missense_Mutation	SNP	superfamily_Prefoldin,superfamily_STAT_TF_coiled-coil,smart_Leu_zip_homeo	p.E1755A	ENST00000340645.5	37	c.5264	CCDS3004.1	3	.	.	.	.	.	.	.	.	.	.	T	11.85	1.760975	0.31137	.	.	ENSG00000173230	ENST00000340645;ENST00000393667	T;T	0.17854	2.25;2.25	5.8	5.8	0.92144	.	0.123149	0.36932	N	0.002333	T	0.30916	0.0780	M	0.71581	2.175	0.46260	D	0.998956	P;P;P;P	0.47910	0.901;0.901;0.901;0.902	P;P;P;P	0.49999	0.475;0.558;0.558;0.628	T	0.02339	-1.1174	10	0.45353	T	0.12	.	14.1023	0.65065	0.0:0.0:0.0:1.0	.	1680;1760;1760;1755	F1T0J2;E7EP74;B2ZZ91;Q14789	.;.;.;GOGB1_HUMAN	A	1755;1760	ENSP00000341848:E1755A;ENSP00000377275:E1760A	ENSP00000341848:E1755A	E	-	2	0	GOLGB1	122896781	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	4.781000	0.62389	2.203000	0.70933	0.460000	0.39030	GAG	GOLGB1	-	smart_Leu_zip_homeo		0.388	GOLGB1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	GOLGB1	HGNC	protein_coding	OTTHUMT00000355159.1	T	NM_004487		121414091	-1	no_errors	ENST00000340645	ensembl	human	known	70_37	missense	SNP	1.000	G
GPR126	57211	genome.wustl.edu	37	6	142737195	142737195	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:142737195G>T	ENST00000230173.6	+	20	3408	c.2932G>T	c.(2932-2934)Ggc>Tgc	p.G978C	GPR126_ENST00000367608.2_Missense_Mutation_p.G950C|GPR126_ENST00000296932.8_Missense_Mutation_p.G950C|GPR126_ENST00000367609.3_Missense_Mutation_p.G978C	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	978					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G978C(1)|p.G949C(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CTGCATCATTGGCTGGGGTAA	0.333																																																	2	Substitution - Missense(2)	cervix(2)											80.0	74.0	76.0					6																	142737195		1827	4075	5902	SO:0001583	missense	57211			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.2932G>T	6.37:g.142737195G>T	ENSP00000230173:p.Gly978Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB,superfamily_ConA-like_lec_gl_sf,smart_CUB,smart_Pentaxin,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G978C	ENST00000230173.6	37	c.2932	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617439	0.87359	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88	5.33	5.33	0.75918	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000004	D	0.93314	0.7869	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93950	0.7231	10	0.87932	D	0	.	19.3992	0.94621	0.0:0.0:1.0:0.0	.	950;978;950;978	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	C	978;950;950;978	ENSP00000230173:G978C;ENSP00000356580:G950C;ENSP00000296932:G950C;ENSP00000356581:G978C	ENSP00000230173:G978C	G	+	1	0	GPR126	142778888	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.420000	0.97426	2.659000	0.90383	0.650000	0.86243	GGC	GPR126	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.333	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	G			142737195	+1	no_errors	ENST00000367609	ensembl	human	known	70_37	missense	SNP	1.000	T
GPR126	57211	genome.wustl.edu	37	6	142737195	142737195	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:142737195G>T	ENST00000230173.6	+	20	3408	c.2932G>T	c.(2932-2934)Ggc>Tgc	p.G978C	GPR126_ENST00000367608.2_Missense_Mutation_p.G950C|GPR126_ENST00000296932.8_Missense_Mutation_p.G950C|GPR126_ENST00000367609.3_Missense_Mutation_p.G978C	NM_020455.5	NP_065188	Q86SQ4	GP126_HUMAN	G protein-coupled receptor 126	978					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)	p.G978C(1)|p.G949C(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(12)|lung(10)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(3)	36	Breast(32;0.176)			OV - Ovarian serous cystadenocarcinoma(155;9.33e-06)|GBM - Glioblastoma multiforme(68;0.00121)		CTGCATCATTGGCTGGGGTAA	0.333																																																	2	Substitution - Missense(2)	cervix(2)											80.0	74.0	76.0					6																	142737195		1827	4075	5902	SO:0001583	missense	57211			AK027843	CCDS47489.1, CCDS47490.1, CCDS47491.1, CCDS55064.1	6q23.1-q24.3	2014-08-08			ENSG00000112414	ENSG00000112414		"""-"", ""GPCR / Class B : Orphans"""	13841	protein-coding gene	gene with protein product		612243				12565841	Standard	NM_001032395		Approved	FLJ14937	uc010khe.3	Q86SQ4	OTTHUMG00000015709	ENST00000230173.6:c.2932G>T	6.37:g.142737195G>T	ENSP00000230173:p.Gly978Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TGN7|Q6DHZ4|Q6F3F5|Q6F3F6|Q6F3F7|Q6F3F8|Q6MZU7|Q8IXA4|Q8NC14|Q96JW0	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_CUB,pfam_GPS_dom,pfam_Pentaxin,superfamily_CUB,superfamily_ConA-like_lec_gl_sf,smart_CUB,smart_Pentaxin,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like	p.G978C	ENST00000230173.6	37	c.2932	CCDS47490.1	6	.	.	.	.	.	.	.	.	.	.	G	25.2	4.617439	0.87359	.	.	ENSG00000112414	ENST00000230173;ENST00000367608;ENST00000296932;ENST00000367609	D;D;D;D	0.84660	-1.88;-1.88;-1.88;-1.88	5.33	5.33	0.75918	GPCR, family 2-like (1);	0.000000	0.64402	D	0.000004	D	0.93314	0.7869	M	0.88979	2.995	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.97110	1.0;1.0;1.0;1.0	D	0.93950	0.7231	10	0.87932	D	0	.	19.3992	0.94621	0.0:0.0:1.0:0.0	.	950;978;950;978	Q86SQ4-4;Q86SQ4-3;Q86SQ4-2;Q86SQ4	.;.;.;GP126_HUMAN	C	978;950;950;978	ENSP00000230173:G978C;ENSP00000356580:G950C;ENSP00000296932:G950C;ENSP00000356581:G978C	ENSP00000230173:G978C	G	+	1	0	GPR126	142778888	1.000000	0.71417	1.000000	0.80357	0.948000	0.59901	9.420000	0.97426	2.659000	0.90383	0.650000	0.86243	GGC	GPR126	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like		0.333	GPR126-001	KNOWN	basic|CCDS	protein_coding	GPR126	HGNC	protein_coding	OTTHUMT00000042487.2	G			142737195	+1	no_errors	ENST00000367609	ensembl	human	known	70_37	missense	SNP	1.000	T
GRIN2A	2903	genome.wustl.edu	37	16	9858383	9858383	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:9858383C>T	ENST00000396573.2	-	14	3327	c.3018G>A	c.(3016-3018)gcG>gcA	p.A1006A	GRIN2A_ENST00000330684.3_Silent_p.A1006A|GRIN2A_ENST00000562109.1_Silent_p.A1006A|GRIN2A_ENST00000535259.1_Silent_p.A849A|GRIN2A_ENST00000396575.2_Silent_p.A1006A|GRIN2A_ENST00000404927.2_Silent_p.A1006A	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1006					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.A1006A(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTCTAGAGTTCGCTTTGGATT	0.507																																																	1	Substitution - coding silent(1)	cervix(1)											93.0	92.0	93.0					16																	9858383		2197	4300	6497	SO:0001819	synonymous_variant	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3018G>A	16.37:g.9858383C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00669|Q17RZ6	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A1006	ENST00000396573.2	37	c.3018	CCDS10539.1	16																																																																																			GRIN2A	-	pfam_NMDAR2_C		0.507	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	C			9858383	-1	no_errors	ENST00000330684	ensembl	human	known	70_37	silent	SNP	0.109	T
GRIN2A	2903	genome.wustl.edu	37	16	9858383	9858383	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:9858383C>T	ENST00000396573.2	-	14	3327	c.3018G>A	c.(3016-3018)gcG>gcA	p.A1006A	GRIN2A_ENST00000330684.3_Silent_p.A1006A|GRIN2A_ENST00000562109.1_Silent_p.A1006A|GRIN2A_ENST00000535259.1_Silent_p.A849A|GRIN2A_ENST00000396575.2_Silent_p.A1006A|GRIN2A_ENST00000404927.2_Silent_p.A1006A	NM_000833.3	NP_000824.1	Q12879	NMDE1_HUMAN	glutamate receptor, ionotropic, N-methyl D-aspartate 2A	1006					directional locomotion (GO:0033058)|dopamine metabolic process (GO:0042417)|glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|learning or memory (GO:0007611)|memory (GO:0007613)|negative regulation of protein catabolic process (GO:0042177)|neurogenesis (GO:0022008)|positive regulation of apoptotic process (GO:0043065)|protein localization (GO:0008104)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of sensory perception of pain (GO:0051930)|regulation of synaptic plasticity (GO:0048167)|response to amphetamine (GO:0001975)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to wounding (GO:0009611)|sensory perception of pain (GO:0019233)|serotonin metabolic process (GO:0042428)|sleep (GO:0030431)|startle response (GO:0001964)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)|visual learning (GO:0008542)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|synaptic vesicle (GO:0008021)	calcium channel activity (GO:0005262)|extracellular-glutamate-gated ion channel activity (GO:0005234)|N-methyl-D-aspartate selective glutamate receptor activity (GO:0004972)|zinc ion binding (GO:0008270)	p.A1006A(1)		NS(7)|breast(5)|cervix(1)|endometrium(11)|kidney(6)|large_intestine(36)|lung(71)|ovary(4)|prostate(9)|skin(45)|upper_aerodigestive_tract(2)|urinary_tract(1)	198					Acamprosate(DB00659)|Acetylcysteine(DB06151)|Atomoxetine(DB00289)|Felbamate(DB00949)|Gabapentin(DB00996)|Glycine(DB00145)|Halothane(DB01159)|Ketobemidone(DB06738)|Memantine(DB01043)|Milnacipran(DB04896)|Pentobarbital(DB00312)|Pethidine(DB00454)|Phenobarbital(DB01174)|Secobarbital(DB00418)	GTCTAGAGTTCGCTTTGGATT	0.507																																																	1	Substitution - coding silent(1)	cervix(1)											93.0	92.0	93.0					16																	9858383		2197	4300	6497	SO:0001819	synonymous_variant	2903				CCDS10539.1, CCDS45407.1	16p13.2	2012-08-29			ENSG00000183454	ENSG00000183454		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4585	protein-coding gene	gene with protein product		138253		NMDAR2A		9480759	Standard	XM_005255267		Approved	GluN2A	uc002czo.4	Q12879	OTTHUMG00000129721	ENST00000396573.2:c.3018G>A	16.37:g.9858383C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00669|Q17RZ6	Silent	SNP	pfam_NMDAR2_C,pfam_Iontro_glu_rcpt,pfam_SBP_bac_3,pfam_Glu_rcpt_Glu/Gly-bd,pfam_ANF_lig-bd_rcpt,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A1006	ENST00000396573.2	37	c.3018	CCDS10539.1	16																																																																																			GRIN2A	-	pfam_NMDAR2_C		0.507	GRIN2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIN2A	HGNC	protein_coding	OTTHUMT00000251930.3	C			9858383	-1	no_errors	ENST00000330684	ensembl	human	known	70_37	silent	SNP	0.109	T
GUF1	60558	genome.wustl.edu	37	4	44691410	44691410	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr4:44691410C>T	ENST00000281543.5	+	10	1380	c.1186C>T	c.(1186-1188)Ctg>Ttg	p.L396L	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)									p.L396L(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						TAGCCTTGCTCTGGGTGCTGG	0.378																																																	1	Substitution - coding silent(1)	cervix(1)											129.0	133.0	132.0					4																	44691410		2203	4300	6503	SO:0001819	synonymous_variant	60558				CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1186C>T	4.37:g.44691410C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_EF_GTP-bd_dom,pfam_LepA_GTP-bd_C,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Small_GTPase,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,prints_EF_GTP-bd_dom,tigrfam_EF-4,tigrfam_Small_GTP-bd_dom	p.L396	ENST00000281543.5	37	c.1186	CCDS3468.1	4																																																																																			GUF1	-	superfamily_Elongation_fac_G/III/V,tigrfam_EF-4		0.378	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUF1	HGNC	protein_coding	OTTHUMT00000250469.3	C	NM_021927		44691410	+1	no_errors	ENST00000281543	ensembl	human	known	70_37	silent	SNP	0.546	T
GUF1	60558	genome.wustl.edu	37	4	44691410	44691410	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr4:44691410C>T	ENST00000281543.5	+	10	1380	c.1186C>T	c.(1186-1188)Ctg>Ttg	p.L396L	GUF1_ENST00000506793.1_3'UTR	NM_021927.2	NP_068746.2			GUF1 GTPase homolog (S. cerevisiae)									p.L396L(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19						TAGCCTTGCTCTGGGTGCTGG	0.378																																																	1	Substitution - coding silent(1)	cervix(1)											129.0	133.0	132.0					4																	44691410		2203	4300	6503	SO:0001819	synonymous_variant	60558				CCDS3468.1	4p13	2006-02-16			ENSG00000151806	ENSG00000151806			25799	protein-coding gene	gene with protein product						8553703	Standard	NM_021927		Approved	FLJ13220	uc003gww.4	Q8N442	OTTHUMG00000128608	ENST00000281543.5:c.1186C>T	4.37:g.44691410C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_EF_GTP-bd_dom,pfam_LepA_GTP-bd_C,pfam_Transl_elong_EFG/EF2_C,pfam_Transl_elong_EFTu/EF1A_2,pfam_Small_GTPase,superfamily_Elongation_fac_G/III/V,superfamily_Transl_elong_init/rib_B-barrel,prints_EF_GTP-bd_dom,tigrfam_EF-4,tigrfam_Small_GTP-bd_dom	p.L396	ENST00000281543.5	37	c.1186	CCDS3468.1	4																																																																																			GUF1	-	superfamily_Elongation_fac_G/III/V,tigrfam_EF-4		0.378	GUF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GUF1	HGNC	protein_coding	OTTHUMT00000250469.3	C	NM_021927		44691410	+1	no_errors	ENST00000281543	ensembl	human	known	70_37	silent	SNP	0.546	T
HEXA	3073	genome.wustl.edu	37	15	72638962	72638962	+	Silent	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:72638962G>A	ENST00000268097.5	-	11	1739	c.1236C>T	c.(1234-1236)ttC>ttT	p.F412F	HEXA_ENST00000457859.2_Intron|RP11-106M3.3_ENST00000570175.1_RNA|HEXA_ENST00000567159.1_Silent_p.F412F|HEXA_ENST00000566304.1_Silent_p.F423F|HEXA_ENST00000429918.2_Silent_p.F239F|RP11-106M3.2_ENST00000379915.4_RNA	NM_000520.4	NP_000511.2	P06865	HEXA_HUMAN	hexosaminidase A (alpha polypeptide)	412					carbohydrate metabolic process (GO:0005975)|cell death (GO:0008219)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|hyaluronan catabolic process (GO:0030214)|hyaluronan metabolic process (GO:0030212)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)	beta-N-acetylhexosaminidase activity (GO:0004563)|protein heterodimerization activity (GO:0046982)	p.F412F(1)		breast(2)|cervix(1)|endometrium(3)|kidney(3)|lung(7)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	24						GAAGGGCCCGGAAGCCGGCCT	0.498																																																	1	Substitution - coding silent(1)	cervix(1)											136.0	149.0	144.0					15																	72638962		2199	4297	6496	SO:0001819	synonymous_variant	3073			M13520	CCDS10243.1	15q24.1	2012-10-02			ENSG00000213614	ENSG00000213614	3.2.1.52		4878	protein-coding gene	gene with protein product	"""Tay Sachs disease"", ""GM2 gangliosidosis"""	606869				2952641, 3013851	Standard	NM_000520		Approved		uc002aun.4	P06865	OTTHUMG00000133445	ENST00000268097.5:c.1236C>T	15.37:g.72638962G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKE7|E7ENH7|Q53HS8|Q6AI32	Silent	SNP	pfam_Glyco_hydro_20_cat-core,pfam_Glyco_hydro_20b,superfamily_Glycoside_hydrolase_SF,prints_Beta_hexosaminidase_sua/sub	p.F412	ENST00000268097.5	37	c.1236	CCDS10243.1	15																																																																																			HEXA	-	pfam_Glyco_hydro_20_cat-core,superfamily_Glycoside_hydrolase_SF		0.498	HEXA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXA	HGNC	protein_coding	OTTHUMT00000257317.2	G	NM_000520		72638962	-1	no_errors	ENST00000268097	ensembl	human	known	70_37	silent	SNP	1.000	A
IPO13	9670	genome.wustl.edu	37	1	44433064	44433064	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:44433064C>T	ENST00000372343.3	+	19	3353	c.2691C>T	c.(2689-2691)ttC>ttT	p.F897F	DPH2_ENST00000396758.2_5'Flank|IPO13_ENST00000372339.3_Silent_p.F115F|DPH2_ENST00000412950.2_5'Flank|DPH2_ENST00000255108.3_5'Flank	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	897					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.F897F(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				AGCACTGCTTCAGCCTCCTGA	0.612																																																	1	Substitution - coding silent(1)	cervix(1)											65.0	64.0	65.0					1																	44433064		2203	4300	6503	SO:0001819	synonymous_variant	9670			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.2691C>T	1.37:g.44433064C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F897	ENST00000372343.3	37	c.2691	CCDS503.1	1																																																																																			IPO13	-	NULL		0.612	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO13	HGNC	protein_coding	OTTHUMT00000022846.1	C	NM_014652		44433064	+1	no_errors	ENST00000372343	ensembl	human	known	70_37	silent	SNP	1.000	T
IPO13	9670	genome.wustl.edu	37	1	44433064	44433064	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:44433064C>T	ENST00000372343.3	+	19	3353	c.2691C>T	c.(2689-2691)ttC>ttT	p.F897F	DPH2_ENST00000396758.2_5'Flank|IPO13_ENST00000372339.3_Silent_p.F115F|DPH2_ENST00000412950.2_5'Flank|DPH2_ENST00000255108.3_5'Flank	NM_014652.3	NP_055467.3	O94829	IPO13_HUMAN	importin 13	897					protein import into nucleus (GO:0006606)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.F897F(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(6)|lung(13)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0821)				AGCACTGCTTCAGCCTCCTGA	0.612																																																	1	Substitution - coding silent(1)	cervix(1)											65.0	64.0	65.0					1																	44433064		2203	4300	6503	SO:0001819	synonymous_variant	9670			AB018267	CCDS503.1	1p34.1	2008-02-05			ENSG00000117408	ENSG00000117408		"""Importins"""	16853	protein-coding gene	gene with protein product		610411				9872452, 11447110	Standard	NM_014652		Approved	IMP13, KIAA0724, RANBP13	uc001ckx.3	O94829	OTTHUMG00000008297	ENST00000372343.3:c.2691C>T	1.37:g.44433064C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPY4|Q5T4X3|Q7LC04|Q96HS3|Q9H8N3|Q9UFR1	Silent	SNP	pfam_Exportin-1/Importin-b-like,pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F897	ENST00000372343.3	37	c.2691	CCDS503.1	1																																																																																			IPO13	-	NULL		0.612	IPO13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPO13	HGNC	protein_coding	OTTHUMT00000022846.1	C	NM_014652		44433064	+1	no_errors	ENST00000372343	ensembl	human	known	70_37	silent	SNP	1.000	T
IQSEC2	23096	genome.wustl.edu	37	X	53278057	53278057	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chrX:53278057C>G	ENST00000375368.5	-	5	2475	c.2275G>C	c.(2275-2277)Gag>Cag	p.E759Q	IQSEC2_ENST00000375365.2_Missense_Mutation_p.E564Q|IQSEC2_ENST00000396435.3_Missense_Mutation_p.E769Q			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	759	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.E766Q(1)|p.E769Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ATACCCTTCTCTGGCTTCCTG	0.532																																																	2	Substitution - Missense(2)	cervix(2)											44.0	30.0	35.0					X																	53278057		2203	4300	6503	SO:0001583	missense	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2275G>C	X.37:g.53278057C>G	ENSP00000364517:p.Glu759Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.E769Q	ENST00000375368.5	37	c.2305		X	.	.	.	.	.	.	.	.	.	.	C	22.4	4.291021	0.80914	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.55234	0.53;0.53;0.53	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.72095	0.3418	M	0.66439	2.03	0.80722	D	1	P;D	0.71674	0.545;0.998	P;D	0.80764	0.502;0.994	T	0.73914	-0.3832	10	0.72032	D	0.01	.	17.9436	0.89032	0.0:1.0:0.0:0.0	.	769;564	Q5JU85-2;Q5JU85-3	.;.	Q	769;759;564	ENSP00000379712:E769Q;ENSP00000364517:E759Q;ENSP00000364514:E564Q	ENSP00000364514:E564Q	E	-	1	0	IQSEC2	53294782	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.818000	0.86416	2.513000	0.84729	0.600000	0.82982	GAG	IQSEC2	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7		0.532	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		C	XM_291345		53278057	-1	no_errors	ENST00000396435	ensembl	human	known	70_37	missense	SNP	1.000	G
IQSEC2	23096	genome.wustl.edu	37	X	53278057	53278057	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chrX:53278057C>G	ENST00000375368.5	-	5	2475	c.2275G>C	c.(2275-2277)Gag>Cag	p.E759Q	IQSEC2_ENST00000375365.2_Missense_Mutation_p.E564Q|IQSEC2_ENST00000396435.3_Missense_Mutation_p.E769Q			Q5JU85	IQEC2_HUMAN	IQ motif and Sec7 domain 2	759	SEC7. {ECO:0000255|PROSITE- ProRule:PRU00189}.				actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|nucleus (GO:0005634)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.E766Q(1)|p.E769Q(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(4)|lung(10)|ovary(4)|skin(1)	29						ATACCCTTCTCTGGCTTCCTG	0.532																																																	2	Substitution - Missense(2)	cervix(2)											44.0	30.0	35.0					X																	53278057		2203	4300	6503	SO:0001583	missense	23096			AB011094	CCDS35298.1, CCDS48130.1	Xp11.23	2014-01-31			ENSG00000124313	ENSG00000124313			29059	protein-coding gene	gene with protein product		300522	"""mental retardation, X-linked 1 (non-dysmorphic)"""	MRX1		9628581, 20473311	Standard	NM_001243197		Approved	KIAA0522	uc004dsd.3	Q5JU85	OTTHUMG00000021608	ENST00000375368.5:c.2275G>C	X.37:g.53278057C>G	ENSP00000364517:p.Glu759Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KT97|C7SDG1|O60275|Q5JUX1	Missense_Mutation	SNP	pfam_Sec7,superfamily_Sec7,smart_Sec7,smart_Pleckstrin_homology,pfscan_IQ_motif_EF-hand-BS,pfscan_Sec7	p.E769Q	ENST00000375368.5	37	c.2305		X	.	.	.	.	.	.	.	.	.	.	C	22.4	4.291021	0.80914	.	.	ENSG00000124313	ENST00000396435;ENST00000375368;ENST00000375365	T;T;T	0.55234	0.53;0.53;0.53	5.93	5.93	0.95920	.	0.000000	0.85682	D	0.000000	T	0.72095	0.3418	M	0.66439	2.03	0.80722	D	1	P;D	0.71674	0.545;0.998	P;D	0.80764	0.502;0.994	T	0.73914	-0.3832	10	0.72032	D	0.01	.	17.9436	0.89032	0.0:1.0:0.0:0.0	.	769;564	Q5JU85-2;Q5JU85-3	.;.	Q	769;759;564	ENSP00000379712:E769Q;ENSP00000364517:E759Q;ENSP00000364514:E564Q	ENSP00000364514:E564Q	E	-	1	0	IQSEC2	53294782	1.000000	0.71417	1.000000	0.80357	0.840000	0.47671	7.818000	0.86416	2.513000	0.84729	0.600000	0.82982	GAG	IQSEC2	-	pfam_Sec7,superfamily_Sec7,smart_Sec7,pfscan_Sec7		0.532	IQSEC2-201	KNOWN	basic	protein_coding	IQSEC2	HGNC	protein_coding		C	XM_291345		53278057	-1	no_errors	ENST00000396435	ensembl	human	known	70_37	missense	SNP	1.000	G
KCNIP4	80333	genome.wustl.edu	37	4	21731537	21731537	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr4:21731537G>A	ENST00000382152.2	-	1	229				KCNIP4_ENST00000447367.2_Intron	NM_025221.5	NP_079497.2	Q6PIL6	KCIP4_HUMAN	Kv channel interacting protein 4							dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|potassium channel activity (GO:0005267)|voltage-gated ion channel activity (GO:0005244)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(6)|prostate(1)|upper_aerodigestive_tract(1)	13		Breast(46;0.134)				TATGATGTGTGACTCATTAAT	0.299																																																	0																																										SO:0001627	intron_variant	80333			AF453244	CCDS3428.1, CCDS43215.1, CCDS43216.1, CCDS43217.1, CCDS47035.1	4p15.32	2013-01-10			ENSG00000185774	ENSG00000185774		"""EF-hand domain containing"""	30083	protein-coding gene	gene with protein product		608182				11805342, 11847232	Standard	XM_005248190		Approved	CALP, KCHIP4, MGC44947	uc003gqh.1	Q6PIL6	OTTHUMG00000128557	ENST00000382152.2:c.61+218656C>T	4.37:g.21731537G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3YAB8|Q3YAB9|Q3YAC0|Q3YAC1|Q3YAC2|Q4W5G8|Q8NEU0|Q9BWT2|Q9H294|Q9H2A4	RNA	SNP	-	NULL	ENST00000382152.2	37	NULL	CCDS43216.1	4																																																																																			KCNIP4	-	-		0.299	KCNIP4-004	KNOWN	non_canonical_conserved|basic|CCDS	protein_coding	KCNIP4	HGNC	protein_coding	OTTHUMT00000360407.3	G	NM_025221		21731537	-1	no_errors	ENST00000512102	ensembl	human	known	70_37	rna	SNP	0.000	A
KDM4B	23030	genome.wustl.edu	37	19	5135504	5135504	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:5135504C>G	ENST00000159111.4	+	15	2458	c.2240C>G	c.(2239-2241)tCc>tGc	p.S747C	KDM4B_ENST00000536461.1_Missense_Mutation_p.S781C	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	747					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)	p.S747C(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CCTGCCAACTCCTACATCGGC	0.642																																																	1	Substitution - Missense(1)	cervix(1)											48.0	39.0	42.0					19																	5135504		2203	4300	6503	SO:0001583	missense	23030			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.2240C>G	19.37:g.5135504C>G	ENSP00000159111:p.Ser747Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.S747C	ENST00000159111.4	37	c.2240	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502800	0.85176	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.19669	2.15;2.13	4.22	4.22	0.49857	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.143626	0.48767	D	0.000178	T	0.46521	0.1397	M	0.73598	2.24	0.50039	D	0.99984	D;D	0.76494	0.999;0.999	D;D	0.68192	0.947;0.956	T	0.54523	-0.8281	10	0.87932	D	0	-43.3582	16.5853	0.84726	0.0:1.0:0.0:0.0	.	781;747	F5GX28;O94953	.;KDM4B_HUMAN	C	747;781	ENSP00000159111:S747C;ENSP00000440495:S781C	ENSP00000159111:S747C	S	+	2	0	KDM4B	5086504	1.000000	0.71417	0.959000	0.39883	0.948000	0.59901	7.727000	0.84838	1.905000	0.55150	0.561000	0.74099	TCC	KDM4B	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD		0.642	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	HGNC	protein_coding	OTTHUMT00000450558.1	C	NM_015015		5135504	+1	no_errors	ENST00000159111	ensembl	human	known	70_37	missense	SNP	1.000	G
KDM4B	23030	genome.wustl.edu	37	19	5135504	5135504	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:5135504C>G	ENST00000159111.4	+	15	2458	c.2240C>G	c.(2239-2241)tCc>tGc	p.S747C	KDM4B_ENST00000536461.1_Missense_Mutation_p.S781C	NM_015015.2	NP_055830	O94953	KDM4B_HUMAN	lysine (K)-specific demethylase 4B	747					chromatin modification (GO:0016568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	dioxygenase activity (GO:0051213)|zinc ion binding (GO:0008270)	p.S747C(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(1)|liver(1)|lung(14)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	32						CCTGCCAACTCCTACATCGGC	0.642																																																	1	Substitution - Missense(1)	cervix(1)											48.0	39.0	42.0					19																	5135504		2203	4300	6503	SO:0001583	missense	23030			AB020683	CCDS12138.1	19p13.3	2013-01-23	2009-04-06	2009-04-06		ENSG00000127663		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	29136	protein-coding gene	gene with protein product	"""tudor domain containing 14B"""	609765	"""jumonji domain containing 2B"""	JMJD2B		10048485, 15138608	Standard	NM_015015		Approved	KIAA0876, TDRD14B	uc002mbq.4	O94953		ENST00000159111.4:c.2240C>G	19.37:g.5135504C>G	ENSP00000159111:p.Ser747Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGN8|D6W631|O75274|Q6P3R5|Q9P1V1|Q9UF40	Missense_Mutation	SNP	pfam_JmjC_dom,pfam_TF_JmjN,superfamily_Znf_FYVE_PHD,smart_TF_JmjN,smart_JmjC_dom,smart_Znf_PHD,smart_Tudor,pfscan_TF_JmjN,pfscan_JmjC_dom	p.S747C	ENST00000159111.4	37	c.2240	CCDS12138.1	19	.	.	.	.	.	.	.	.	.	.	C	24.2	4.502800	0.85176	.	.	ENSG00000127663	ENST00000159111;ENST00000536461	T;T	0.19669	2.15;2.13	4.22	4.22	0.49857	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, PHD-type (1);Zinc finger, FYVE/PHD-type (1);	0.143626	0.48767	D	0.000178	T	0.46521	0.1397	M	0.73598	2.24	0.50039	D	0.99984	D;D	0.76494	0.999;0.999	D;D	0.68192	0.947;0.956	T	0.54523	-0.8281	10	0.87932	D	0	-43.3582	16.5853	0.84726	0.0:1.0:0.0:0.0	.	781;747	F5GX28;O94953	.;KDM4B_HUMAN	C	747;781	ENSP00000159111:S747C;ENSP00000440495:S781C	ENSP00000159111:S747C	S	+	2	0	KDM4B	5086504	1.000000	0.71417	0.959000	0.39883	0.948000	0.59901	7.727000	0.84838	1.905000	0.55150	0.561000	0.74099	TCC	KDM4B	-	superfamily_Znf_FYVE_PHD,smart_Znf_PHD		0.642	KDM4B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4B	HGNC	protein_coding	OTTHUMT00000450558.1	C	NM_015015		5135504	+1	no_errors	ENST00000159111	ensembl	human	known	70_37	missense	SNP	1.000	G
KCNJ14	3770	genome.wustl.edu	37	19	48965011	48965011	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:48965011C>T	ENST00000391884.1	+	1	506	c.30C>T	c.(28-30)ctC>ctT	p.L10L	KCNJ14_ENST00000342291.2_Silent_p.L10L			Q9UNX9	KCJ14_HUMAN	potassium inwardly-rectifying channel, subfamily J, member 14	10					potassium ion transmembrane transport (GO:0071805)|synaptic transmission (GO:0007268)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	inward rectifier potassium channel activity (GO:0005242)			cervix(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(2)|urinary_tract(1)	10		all_epithelial(76;2.38e-06)|all_lung(116;4.89e-06)|Lung NSC(112;9.34e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000109)|all cancers(93;0.000129)|Epithelial(262;0.0081)|GBM - Glioblastoma multiforme(486;0.0222)	Yohimbine(DB01392)	TACGCCGCCTCAGCGGCGCCC	0.731																																					NSCLC(148;170 3504 35216)												0													2.0	3.0	2.0					19																	48965011		1422	3136	4558	SO:0001819	synonymous_variant	3770			BC042033	CCDS12721.1	19q13	2011-07-05				ENSG00000182324		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, Inwardly rectifying"""	6260	protein-coding gene	gene with protein product		603953				9592090, 10723734, 16382105	Standard	NM_013348		Approved	Kir2.4, IRK4	uc002pje.2	Q9UNX9		ENST00000391884.1:c.30C>T	19.37:g.48965011C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_K_chnl_inward-rec_Kir,superfamily_Ig_E-set,pirsf_K_chnl_inward-rec_Kir,prints_K_chnl_inward-rec_Kir	p.L10	ENST00000391884.1	37	c.30	CCDS12721.1	19																																																																																			KCNJ14	-	NULL		0.731	KCNJ14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNJ14	HGNC	protein_coding	OTTHUMT00000466127.1	C	NM_013348		48965011	+1	no_errors	ENST00000342291	ensembl	human	known	70_37	silent	SNP	0.029	T
KLK3	354	genome.wustl.edu	37	19	51361307	51361307	+	Missense_Mutation	SNP	C	C	G	rs146422657	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:51361307C>G	ENST00000326003.2	+	3	270	c.229C>G	c.(229-231)Cgg>Ggg	p.R77G	KLK3_ENST00000595952.1_Intron|KLK3_ENST00000360617.3_Missense_Mutation_p.R77G|KLK3_ENST00000597483.1_Intron|KLK3_ENST00000593997.1_Missense_Mutation_p.R77G	NM_001030047.1|NM_001030048.1|NM_001648.2	NP_001025218.1|NP_001025219.1|NP_001639.1	P07288	KLK3_HUMAN	kallikrein-related peptidase 3	77	Peptidase S1. {ECO:0000255|PROSITE- ProRule:PRU00274}.				cellular protein metabolic process (GO:0044267)|negative regulation of angiogenesis (GO:0016525)	extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	serine-type endopeptidase activity (GO:0004252)|serine-type peptidase activity (GO:0008236)	p.R77G(2)		breast(1)|cervix(2)|kidney(2)|large_intestine(1)|lung(10)|ovary(1)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	24		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00763)|GBM - Glioblastoma multiforme(134;0.0144)		CTTGCTGGGTCGGCACAGCCT	0.542																																					Colon(185;1767 2023 13025 30120 37630)												2	Substitution - Missense(2)	cervix(2)											60.0	52.0	55.0					19																	51361307		2203	4300	6503	SO:0001583	missense	354			X14810	CCDS12807.1, CCDS33083.1, CCDS46155.1	19q13.41	2012-10-02	2006-10-27			ENSG00000142515		"""Kallikreins"""	6364	protein-coding gene	gene with protein product		176820	"""kallikrein 3, (prostate specific antigen)"""	APS		2456523, 2436946, 16800724, 16800723	Standard	NM_001648		Approved	PSA	uc021uyi.1	P07288		ENST00000326003.2:c.229C>G	19.37:g.51361307C>G	ENSP00000314151:p.Arg77Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JXH3|G3V0H4|G3XAE3|Q15096|Q16272|Q86TG8|Q8IXI4	Missense_Mutation	SNP	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6,prints_Peptidase_S1A	p.R77G	ENST00000326003.2	37	c.229	CCDS12807.1	19	.	.	.	.	.	.	.	.	.	.	C	13.89	2.372845	0.42105	.	.	ENSG00000142515	ENST00000326003;ENST00000360617;ENST00000326052	D;D	0.88741	-2.42;-2.42	2.31	-0.0166	0.13971	.	0.247838	0.21280	N	0.077168	D	0.85141	0.5629	N	0.13140	0.3	0.09310	N	0.999998	D;D	0.71674	0.983;0.998	D;D	0.68765	0.929;0.96	T	0.74907	-0.3504	10	0.87932	D	0	.	4.6508	0.12594	0.0:0.4115:0.4445:0.144	.	77;77	Q8NCW4;G3XAE3	.;.	G	77	ENSP00000314151:R77G;ENSP00000353829:R77G	ENSP00000314151:R77G	R	+	1	2	KLK3	56053119	0.000000	0.05858	0.004000	0.12327	0.254000	0.26022	-0.114000	0.10757	0.067000	0.16545	0.505000	0.49811	CGG	KLK3	-	pfam_Peptidase_S1_S6,superfamily_Pept_cys/ser_Trypsin-like,smart_Peptidase_S1_S6,pfscan_Peptidase_S1_S6		0.542	KLK3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	KLK3	HGNC	protein_coding	OTTHUMT00000464067.1	C	NM_145864		51361307	+1	no_errors	ENST00000326003	ensembl	human	known	70_37	missense	SNP	0.190	G
LAMP3	27074	genome.wustl.edu	37	3	182880495	182880495	+	5'UTR	SNP	C	C	G	rs11543123	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:182880495C>G	ENST00000265598.3	-	0	204				LAMP3_ENST00000466939.1_5'Flank|LAMP3_ENST00000486686.1_5'UTR	NM_014398.3	NP_055213.2	Q9UQV4	LAMP3_HUMAN	lysosomal-associated membrane protein 3						cell proliferation (GO:0008283)|immune system process (GO:0002376)	alveolar lamellar body membrane (GO:0097233)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)				breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(9)|ovary(2)|prostate(2)	28	all_cancers(143;9.14e-14)|Ovarian(172;0.0355)		all cancers(12;2.91e-44)|Epithelial(37;5.52e-38)|LUSC - Lung squamous cell carcinoma(7;7.12e-25)|Lung(8;6.39e-23)|OV - Ovarian serous cystadenocarcinoma(80;4.16e-21)			GGGCAGGCCCCGAATCGGTGC	0.701																																																	0													3.0	5.0	4.0					3																	182880495		1112	2089	3201	SO:0001623	5_prime_UTR_variant	27074			AB013924	CCDS3242.1	3q26.3-q27	2011-11-24			ENSG00000078081	ENSG00000078081		"""CD molecules"""	14582	protein-coding gene	gene with protein product		605883				9721848	Standard	NM_014398		Approved	LAMP, TSC403, DC-LAMP, DCLAMP, CD208	uc003flh.4	Q9UQV4	OTTHUMG00000158387	ENST00000265598.3:c.-52G>C	3.37:g.182880495C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNS4|O94781|Q8NEC8	RNA	SNP	-	NULL	ENST00000265598.3	37	NULL	CCDS3242.1	3																																																																																			LAMP3	-	-		0.701	LAMP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMP3	HGNC	protein_coding	OTTHUMT00000350863.1	C			182880495	-1	no_errors	ENST00000486686	ensembl	human	known	70_37	rna	SNP	0.000	G
LINC00200	399706	genome.wustl.edu	37	10	1210607	1210607	+	lincRNA	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr10:1210607C>T	ENST00000425630.1	+	0	2429					NR_015376.2				long intergenic non-protein coding RNA 200																		tataatgtatcacctcatgcg	0.383																																																	0																																												399706			AK097673		10p15.3	2012-10-12	2011-08-11	2011-08-11	ENSG00000229205	ENSG00000229205		"""Long non-coding RNAs"""	30974	non-coding RNA	RNA, long non-coding			"""chromosome 10 open reading frame 139"", ""non-protein coding RNA 200"""	C10orf139, NCRNA00200			Standard	NR_015376		Approved	FLJ40354	uc010qag.1		OTTHUMG00000017539		10.37:g.1210607C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000425630.1	37	NULL		10																																																																																			LINC00200	-	-		0.383	LINC00200-001	KNOWN	basic	lincRNA	LINC00200	HGNC	lincRNA	OTTHUMT00000046417.2	C	NR_015376		1210607	+1	no_errors	ENST00000425630	ensembl	human	known	70_37	rna	SNP	0.005	T
LINC00324	284029	genome.wustl.edu	37	17	8126238	8126238	+	lincRNA	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:8126238C>T	ENST00000315707.3	-	0	586				RP11-849F2.8_ENST00000602405.1_lincRNA	NR_026951.1				long intergenic non-protein coding RNA 324																		GCGGACGTTGCCGCGAACCGC	0.632																																																	0																																												284029			AK092109		17p13.1	2012-10-12	2011-08-10	2011-08-10	ENSG00000178977	ENSG00000178977		"""Long non-coding RNAs"""	26628	non-coding RNA	RNA, long non-coding			"""chromosome 17 open reading frame 44"", ""non-protein coding RNA 324"""	C17orf44, NCRNA00324			Standard	NR_026951		Approved	FLJ34790, MGC104931	uc002gkp.4		OTTHUMG00000132866		17.37:g.8126238C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000315707.3	37	NULL		17																																																																																			LINC00324	-	-		0.632	LINC00324-001	KNOWN	basic	lincRNA	LINC00324	HGNC	lincRNA	OTTHUMT00000256341.1	C			8126238	-1	no_errors	ENST00000315707	ensembl	human	known	70_37	rna	SNP	0.000	T
LINC00511	400619	genome.wustl.edu	37	17	70400718	70400718	+	IGR	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:70400718C>T								RP11-1124B17.1 (49441 upstream) : RP11-57A1.1 (21361 downstream)																							tggggtctctctgtgttgccc	0.488																																																	0																																										SO:0001628	intergenic_variant	400619																															17.37:g.70400718C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		17																																																																																			LINC00511	-	-	0	0.488					LINC00511	HGNC			C			70400718	-1	no_errors	ENST00000457958	ensembl	human	known	70_37	rna	SNP	0.000	T
LNP1	348801	genome.wustl.edu	37	3	100170714	100170714	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:100170714G>C	ENST00000383693.3	+	3	1588	c.308G>C	c.(307-309)aGa>aCa	p.R103T	LNP1_ENST00000489752.1_Missense_Mutation_p.R116T	NM_001085451.1	NP_001078920.1	A1A4G5	LNP1_HUMAN	leukemia NUP98 fusion partner 1	103								p.R103T(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6						TCAAAAGGAAGATCCCATTCC	0.438																																																	1	Substitution - Missense(1)	cervix(1)											105.0	99.0	101.0					3																	100170714		1843	4088	5931	SO:0001583	missense	348801				CCDS43120.1	3q12.2	2014-05-12			ENSG00000206535	ENSG00000206535			28014	protein-coding gene	gene with protein product						16467868	Standard	NM_001085451		Approved	NP3	uc003dtx.4	A1A4G5	OTTHUMG00000159082	ENST00000383693.3:c.308G>C	3.37:g.100170714G>C	ENSP00000373191:p.Arg103Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLT3	Missense_Mutation	SNP	NULL	p.R103T	ENST00000383693.3	37	c.308	CCDS43120.1	3	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637151	0.67130	.	.	ENSG00000206535	ENST00000383693;ENST00000489752	.	.	.	5.32	3.53	0.40419	.	0.167323	0.37012	N	0.002299	T	0.32315	0.0825	L	0.34521	1.04	0.29120	N	0.880289	D	0.53312	0.959	P	0.47981	0.563	T	0.17837	-1.0356	9	0.72032	D	0.01	-26.7986	9.2432	0.37509	0.1707:0.0:0.8293:0.0	.	103	A1A4G5	LNP1_HUMAN	T	103;116	.	ENSP00000373191:R103T	R	+	2	0	LNP1	101653404	0.254000	0.23992	0.468000	0.27192	0.864000	0.49448	2.272000	0.43373	0.649000	0.30751	0.461000	0.40582	AGA	LNP1	-	NULL		0.438	LNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNP1	HGNC	protein_coding	OTTHUMT00000353232.1	G			100170714	+1	no_errors	ENST00000383693	ensembl	human	known	70_37	missense	SNP	0.991	C
LNP1	348801	genome.wustl.edu	37	3	100170714	100170714	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:100170714G>C	ENST00000383693.3	+	3	1588	c.308G>C	c.(307-309)aGa>aCa	p.R103T	LNP1_ENST00000489752.1_Missense_Mutation_p.R116T	NM_001085451.1	NP_001078920.1	A1A4G5	LNP1_HUMAN	leukemia NUP98 fusion partner 1	103								p.R103T(1)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)	6						TCAAAAGGAAGATCCCATTCC	0.438																																																	1	Substitution - Missense(1)	cervix(1)											105.0	99.0	101.0					3																	100170714		1843	4088	5931	SO:0001583	missense	348801				CCDS43120.1	3q12.2	2014-05-12			ENSG00000206535	ENSG00000206535			28014	protein-coding gene	gene with protein product						16467868	Standard	NM_001085451		Approved	NP3	uc003dtx.4	A1A4G5	OTTHUMG00000159082	ENST00000383693.3:c.308G>C	3.37:g.100170714G>C	ENSP00000373191:p.Arg103Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLT3	Missense_Mutation	SNP	NULL	p.R103T	ENST00000383693.3	37	c.308	CCDS43120.1	3	.	.	.	.	.	.	.	.	.	.	G	18.50	3.637151	0.67130	.	.	ENSG00000206535	ENST00000383693;ENST00000489752	.	.	.	5.32	3.53	0.40419	.	0.167323	0.37012	N	0.002299	T	0.32315	0.0825	L	0.34521	1.04	0.29120	N	0.880289	D	0.53312	0.959	P	0.47981	0.563	T	0.17837	-1.0356	9	0.72032	D	0.01	-26.7986	9.2432	0.37509	0.1707:0.0:0.8293:0.0	.	103	A1A4G5	LNP1_HUMAN	T	103;116	.	ENSP00000373191:R103T	R	+	2	0	LNP1	101653404	0.254000	0.23992	0.468000	0.27192	0.864000	0.49448	2.272000	0.43373	0.649000	0.30751	0.461000	0.40582	AGA	LNP1	-	NULL		0.438	LNP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNP1	HGNC	protein_coding	OTTHUMT00000353232.1	G			100170714	+1	no_errors	ENST00000383693	ensembl	human	known	70_37	missense	SNP	0.991	C
RP1-153P14.5	0	genome.wustl.edu	37	6	37513563	37513563	+	lincRNA	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:37513563C>A	ENST00000414875.2	+	0	269				RP1-153P14.3_ENST00000445172.1_RNA																							AATGCTCTATCCTGTGGCCCA	0.493																																																	0																																												100505550																															6.37:g.37513563C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000414875.2	37	NULL		6																																																																																			RP1-153P14.3	-	-		0.493	RP1-153P14.5-001	KNOWN	basic|exp_conf	lincRNA	LOC100505550	Clone_based_vega_gene	lincRNA	OTTHUMT00000040407.2	C			37513563	-1	no_errors	ENST00000445172	ensembl	human	known	70_37	rna	SNP	0.000	A
AL589743.1	0	genome.wustl.edu	37	14	19656218	19656218	+	lincRNA	SNP	C	C	T	rs149753831		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:19656218C>T	ENST00000418499.3	+	0	705																											cccgccaccacgcccaggtaa	0.567																																																	0																																												100506303																															14.37:g.19656218C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000418499.3	37	NULL		14																																																																																			AL589743.1	-	-		0.567	AL589743.1-003	KNOWN	basic	lincRNA	LOC100506303	Clone_based_vega_gene	lincRNA	OTTHUMT00000317887.3	C			19656218	+1	no_errors	ENST00000418499	ensembl	human	known	70_37	rna	SNP	0.047	T
RP3-468B3.2	0	genome.wustl.edu	37	6	33884079	33884079	+	lincRNA	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:33884079C>T	ENST00000530000.1	+	0	4687																											cccaatatttcatgtaggttc	0.443																																																	0																																												100653005																															6.37:g.33884079C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000530000.1	37	NULL		6																																																																																			RP3-468B3.2	-	-		0.443	RP3-468B3.2-003	KNOWN	basic	lincRNA	LOC100653005	Clone_based_vega_gene	lincRNA	OTTHUMT00000389020.1	C			33884079	+1	no_errors	ENST00000530000	ensembl	human	known	70_37	rna	SNP	0.026	T
IQSEC3	440073	genome.wustl.edu	37	12	251277	251277	+	Intron	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:251277C>T	ENST00000538872.1	+	5	2271				RP11-598F7.4_ENST00000505893.2_RNA|IQSEC3_ENST00000382841.2_Intron|IQSEC3_ENST00000326261.4_Intron|RP11-598F7.4_ENST00000508953.2_RNA			Q9UPP2	IQEC3_HUMAN	IQ motif and Sec7 domain 3						actin cytoskeleton organization (GO:0030036)|positive regulation of GTPase activity (GO:0043547)|regulation of ARF protein signal transduction (GO:0032012)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|inhibitory synapse (GO:0060077)|postsynaptic membrane (GO:0045211)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)			central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(18)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_cancers(10;0.016)|all_lung(10;0.0222)|all_epithelial(11;0.0262)|Lung NSC(10;0.031)		OV - Ovarian serous cystadenocarcinoma(31;0.00456)	LUAD - Lung adenocarcinoma(1;0.172)|Lung(1;0.179)		CTCCATTCTTCAGGGACCCTC	0.602																																																	0																																										SO:0001627	intron_variant	574538			AB029033	CCDS31725.1, CCDS53728.1	12p13.33	2014-03-18			ENSG00000120645	ENSG00000120645			29193	protein-coding gene	gene with protein product		612118				10470851	Standard	NM_001170738		Approved	KIAA1110, MGC30156	uc001qhw.2	Q9UPP2	OTTHUMG00000167975	ENST00000538872.1:c.2153+826C>T	12.37:g.251277C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NIF2|A6NKV9|Q8TB43	RNA	SNP	-	NULL	ENST00000538872.1	37	NULL	CCDS53728.1	12																																																																																			RP11-598F7.4	-	-		0.602	IQSEC3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC574538	Clone_based_vega_gene	protein_coding	OTTHUMT00000397382.3	C	XM_495902		251277	-1	no_errors	ENST00000505893	ensembl	human	known	70_37	rna	SNP	0.001	T
LINC01128	643837	genome.wustl.edu	37	1	789144	789144	+	RNA	SNP	G	G	C	rs373293973	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:789144G>C	ENST00000445118.2	+	0	924					NR_047519.1|NR_047520.1|NR_047521.1|NR_047522.1|NR_047523.1|NR_047524.1|NR_047525.1																						CGACCCTGATGAACATGAGAT	0.532													.|||	946	0.188898	0.1982	0.1744	5008	,	,		29778	0.2599		0.171	False		,,,				2504	0.1319																0																																												643837																															1.37:g.789144G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445118.2	37	NULL		1																																																																																			RP11-206L10.11	-	-		0.532	RP11-206L10.11-001	KNOWN	basic	lincRNA	LOC643837	Clone_based_vega_gene	processed_transcript	OTTHUMT00000007015.2	G			789144	+1	no_errors	ENST00000445118	ensembl	human	known	70_37	rna	SNP	0.000	C
PAX8	7849	genome.wustl.edu	37	2	113993935	113993935	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:113993935G>A	ENST00000429538.3	-	8	1093				AC016683.6_ENST00000445745.1_RNA|AC016683.6_ENST00000431844.2_RNA|PAX8_ENST00000263334.5_Intron|AC016683.6_ENST00000422956.2_RNA|PAX8_ENST00000397647.3_Intron|PAX8_ENST00000348715.5_Intron|PAX8_ENST00000263335.7_Intron|AC016683.6_ENST00000556070.1_RNA|AC016683.6_ENST00000451179.1_RNA|AC016683.6_ENST00000456685.1_RNA|AC016683.6_ENST00000437551.1_RNA|AC016683.6_ENST00000436293.2_RNA|AC016683.6_ENST00000333145.5_RNA|AC016683.6_ENST00000553869.2_RNA	NM_003466.3	NP_003457.1	Q06710	PAX8_HUMAN	paired box 8						anatomical structure morphogenesis (GO:0009653)|branching involved in ureteric bud morphogenesis (GO:0001658)|cellular response to gonadotropin stimulus (GO:0071371)|central nervous system development (GO:0007417)|inner ear morphogenesis (GO:0042472)|kidney development (GO:0001822)|mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0003337)|mesonephros development (GO:0001823)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric distal convoluted tubule development (GO:0072221)|metanephric epithelium development (GO:0072207)|metanephric nephron tubule formation (GO:0072289)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process involved in metanephric collecting duct development (GO:1900215)|negative regulation of apoptotic process involved in metanephric nephron tubule development (GO:1900218)|negative regulation of mesenchymal cell apoptotic process involved in metanephric nephron morphogenesis (GO:0072305)|negative regulation of mesenchymal cell apoptotic process involved in metanephros development (GO:1900212)|otic vesicle development (GO:0071599)|positive regulation of branching involved in ureteric bud morphogenesis (GO:0090190)|positive regulation of mesenchymal to epithelial transition involved in metanephros morphogenesis (GO:0072108)|positive regulation of metanephric DCT cell differentiation (GO:2000594)|positive regulation of thyroid hormone generation (GO:2000611)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|pronephric field specification (GO:0039003)|pronephros development (GO:0048793)|regulation of apoptotic process (GO:0042981)|regulation of metanephric nephron tubule epithelial cell differentiation (GO:0072307)|regulation of thyroid-stimulating hormone secretion (GO:2000612)|thyroid gland development (GO:0030878)|thyroid-stimulating hormone signaling pathway (GO:0038194)|transcription, DNA-templated (GO:0006351)|urogenital system development (GO:0001655)	nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|sequence-specific DNA binding transcription factor activity (GO:0003700)|thyroid-stimulating hormone receptor activity (GO:0004996)|transcription regulatory region DNA binding (GO:0044212)		PAX8/PPARG(117)	breast(1)|endometrium(4)|kidney(2)|large_intestine(1)|liver(1)|lung(9)|ovary(1)|skin(1)	20						GCCCGGCCTAGGACCGGAGGC	0.766			T	PPARG	follicular thyroid		Thyroid dysgenesis																														Ovarian(188;7 2067 9084 29802 29892)			Dom	yes		2	2q12-q14	7849	paired box gene 8	yes	E	0																																										SO:0001627	intron_variant	654433			X69699	CCDS42735.1, CCDS42736.1, CCDS46398.1, CCDS46399.1	2q13	2011-06-20	2007-07-12		ENSG00000125618	ENSG00000125618		"""Paired boxes"", ""Homeoboxes / PRD class"""	8622	protein-coding gene	gene with protein product		167415	"""paired box gene 8"""			8431641, 7981748	Standard	NM_003466		Approved		uc010yxt.2	Q06710	OTTHUMG00000128529	ENST00000429538.3:c.898+242C>T	2.37:g.113993935G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q09155|Q16337|Q16338|Q16339|Q4ZG35|Q96J49	RNA	SNP	-	NULL	ENST00000429538.3	37	NULL	CCDS46398.1	2																																																																																			AC016683.6	-	-		0.766	PAX8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC654433	Clone_based_vega_gene	protein_coding	OTTHUMT00000250353.5	G			113993935	+1	no_errors	ENST00000436293	ensembl	human	known	70_37	rna	SNP	0.274	A
LRP11	84918	genome.wustl.edu	37	6	150157417	150157417	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:150157417C>G	ENST00000239367.2	-	5	1061	c.1056G>C	c.(1054-1056)aaG>aaC	p.K352N	LRP11_ENST00000463728.1_5'Flank|LRP11_ENST00000546019.1_Missense_Mutation_p.K97N	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	352						integral component of membrane (GO:0016021)		p.K352N(1)		cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GGGTTACCATCTTGCGGTCCA	0.498																																																	1	Substitution - Missense(1)	cervix(1)											74.0	67.0	69.0					6																	150157417		2203	4300	6503	SO:0001583	missense	84918			AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.1056G>C	6.37:g.150157417C>G	ENSP00000239367:p.Lys352Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYC0|Q96SN6	Missense_Mutation	SNP	pfam_MANSC_N,pfam_LDrepeatLR_classA_rpt,superfamily_PKD_dom,superfamily_LDrepeatLR_classA_rpt,smart_MANSC_N,smart_PKD/Chitinase_dom,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_MANSC,pfscan_PKD_dom	p.K352N	ENST00000239367.2	37	c.1056	CCDS5220.1	6	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697791	0.48307	.	.	ENSG00000120256	ENST00000239367;ENST00000546019	T;D	0.96745	3.45;-4.11	5.93	3.18	0.36537	.	0.072201	0.64402	D	0.000003	D	0.95364	0.8495	M	0.63843	1.955	0.39940	D	0.974397	D	0.69078	0.997	D	0.63703	0.917	D	0.93293	0.6670	10	0.23302	T	0.38	-17.7518	9.1767	0.37116	0.0:0.7771:0.0:0.2229	.	352	Q86VZ4	LRP11_HUMAN	N	352;97	ENSP00000239367:K352N;ENSP00000440196:K97N	ENSP00000239367:K352N	K	-	3	2	LRP11	150199110	0.593000	0.26840	0.472000	0.27241	0.501000	0.33797	0.318000	0.19504	1.523000	0.49018	0.563000	0.77884	AAG	LRP11	-	NULL		0.498	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP11	HGNC	protein_coding	OTTHUMT00000042664.1	C	NM_032832		150157417	-1	no_errors	ENST00000239367	ensembl	human	known	70_37	missense	SNP	0.602	G
LRP11	84918	genome.wustl.edu	37	6	150157417	150157417	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:150157417C>G	ENST00000239367.2	-	5	1061	c.1056G>C	c.(1054-1056)aaG>aaC	p.K352N	LRP11_ENST00000463728.1_5'Flank|LRP11_ENST00000546019.1_Missense_Mutation_p.K97N	NM_032832.5	NP_116221.3	Q86VZ4	LRP11_HUMAN	low density lipoprotein receptor-related protein 11	352						integral component of membrane (GO:0016021)		p.K352N(1)		cervix(1)|kidney(5)|large_intestine(1)|lung(1)	8		Ovarian(120;0.0907)	BRCA - Breast invasive adenocarcinoma(37;0.193)	OV - Ovarian serous cystadenocarcinoma(155;4.56e-12)|GBM - Glioblastoma multiforme(68;0.225)		GGGTTACCATCTTGCGGTCCA	0.498																																																	1	Substitution - Missense(1)	cervix(1)											74.0	67.0	69.0					6																	150157417		2203	4300	6503	SO:0001583	missense	84918			AK027641	CCDS5220.1	6q24.3	2013-02-27			ENSG00000120256	ENSG00000120256		"""Low density lipoprotein receptors"""	16936	protein-coding gene	gene with protein product							Standard	NM_032832		Approved	bA350J20.3, MANSC3	uc003qng.2	Q86VZ4	OTTHUMG00000015801	ENST00000239367.2:c.1056G>C	6.37:g.150157417C>G	ENSP00000239367:p.Lys352Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VYC0|Q96SN6	Missense_Mutation	SNP	pfam_MANSC_N,pfam_LDrepeatLR_classA_rpt,superfamily_PKD_dom,superfamily_LDrepeatLR_classA_rpt,smart_MANSC_N,smart_PKD/Chitinase_dom,smart_LDrepeatLR_classA_rpt,pfscan_LDrepeatLR_classA_rpt,pfscan_MANSC,pfscan_PKD_dom	p.K352N	ENST00000239367.2	37	c.1056	CCDS5220.1	6	.	.	.	.	.	.	.	.	.	.	C	14.98	2.697791	0.48307	.	.	ENSG00000120256	ENST00000239367;ENST00000546019	T;D	0.96745	3.45;-4.11	5.93	3.18	0.36537	.	0.072201	0.64402	D	0.000003	D	0.95364	0.8495	M	0.63843	1.955	0.39940	D	0.974397	D	0.69078	0.997	D	0.63703	0.917	D	0.93293	0.6670	10	0.23302	T	0.38	-17.7518	9.1767	0.37116	0.0:0.7771:0.0:0.2229	.	352	Q86VZ4	LRP11_HUMAN	N	352;97	ENSP00000239367:K352N;ENSP00000440196:K97N	ENSP00000239367:K352N	K	-	3	2	LRP11	150199110	0.593000	0.26840	0.472000	0.27241	0.501000	0.33797	0.318000	0.19504	1.523000	0.49018	0.563000	0.77884	AAG	LRP11	-	NULL		0.498	LRP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP11	HGNC	protein_coding	OTTHUMT00000042664.1	C	NM_032832		150157417	-1	no_errors	ENST00000239367	ensembl	human	known	70_37	missense	SNP	0.602	G
MAGI2-AS3	100505881	genome.wustl.edu	37	7	79088737	79088737	+	RNA	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:79088737C>G	ENST00000414797.1	+	0	560				MAGI2-AS3_ENST00000448636.1_RNA|MAGI2-AS3_ENST00000451809.1_RNA|MAGI2-AS3_ENST00000446159.1_RNA|MAGI2-AS3_ENST00000424477.1_RNA|MAGI2-AS3_ENST00000422093.1_RNA|MAGI2-AS3_ENST00000429408.1_RNA|MAGI2-AS3_ENST00000426835.1_RNA|MAGI2-AS3_ENST00000448195.1_RNA	NR_038344.1				MAGI2 antisense RNA 3																		ttcCAGCATTCTTGGCCCAGT	0.348																																																	0																																												100505881					7q21.11	2012-10-12	2012-08-15		ENSG00000234456	ENSG00000234456		"""Long non-coding RNAs"""	40862	non-coding RNA	RNA, long non-coding			"""MAGI2 antisense RNA 3 (non-protein coding)"""				Standard	NR_038344		Approved		uc022agq.1		OTTHUMG00000155465		7.37:g.79088737C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000414797.1	37	NULL		7																																																																																			MAGI2-AS3	-	-		0.348	MAGI2-AS3-003	KNOWN	basic	antisense	MAGI2-AS3	HGNC	processed_transcript	OTTHUMT00000340236.1	C			79088737	+1	no_errors	ENST00000424477	ensembl	human	known	70_37	rna	SNP	0.000	G
MALAT1	378938	genome.wustl.edu	37	11	65268741	65268742	+	lincRNA	INS	-	-	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:65268741_65268742insC	ENST00000534336.1	+	0	3509_3510				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CAGTTCTTTTTCCCTTAGGTCT	0.396																																																	0																																												378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268744_65268744dupC		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-		0.396	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	NR_002819		65268742	+1	no_errors	ENST00000534336	ensembl	human	known	70_37	rna	INS	1.000:1.000	C
MALAT1	378938	genome.wustl.edu	37	11	65268741	65268742	+	lincRNA	INS	-	-	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:65268741_65268742insC	ENST00000534336.1	+	0	3509_3510				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		CAGTTCTTTTTCCCTTAGGTCT	0.396																																																	0																																												378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65268744_65268744dupC		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-		0.396	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	-	NR_002819		65268742	+1	no_errors	ENST00000534336	ensembl	human	known	70_37	rna	INS	1.000:1.000	C
MAN1B1	11253	genome.wustl.edu	37	9	139998224	139998224	+	Intron	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:139998224A>G	ENST00000371589.4	+	8	1327				MAN1B1_ENST00000540391.1_3'UTR|MAN1B1_ENST00000474902.1_Intron	NM_016219.4	NP_057303.2	Q9UKM7	MA1B1_HUMAN	mannosidase, alpha, class 1B, member 1						cellular protein metabolic process (GO:0044267)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein folding (GO:0006457)|protein N-linked glycosylation (GO:0006487)|protein N-linked glycosylation via asparagine (GO:0018279)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum quality control compartment (GO:0044322)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|vesicle (GO:0031982)	calcium ion binding (GO:0005509)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			autonomic_ganglia(1)|central_nervous_system(2)|kidney(1)|large_intestine(2)|liver(2)|lung(4)|ovary(2)	14	all_cancers(76;0.0926)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.0878)	OV - Ovarian serous cystadenocarcinoma(145;3.08e-05)|Epithelial(140;0.000513)		TTACATTCACACTGTTGCAGG	0.537																																																	0																																										SO:0001627	intron_variant	11253			AF145732	CCDS7029.1	9q34.3	2014-05-27			ENSG00000177239	ENSG00000177239			6823	protein-coding gene	gene with protein product	"""endoplasmic reticulum alpha-mannosidase 1"", ""alpha 1,2-mannosidase"", ""endoplasmic reticulum mannosyl-oligosaccharide 1,2-alpha-mannosidase 1"", ""ER alpha 1,2-mannosidase"", ""Man9GlcNAc2-specific processing alpha-mannosidase"""	604346				10409699, 10521544	Standard	NM_016219		Approved	MANA-ER, MRT15	uc004cld.3	Q9UKM7	OTTHUMG00000020978	ENST00000371589.4:c.1254+2100A>G	9.37:g.139998224A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VSG3|Q9BRS9|Q9Y5K7	RNA	SNP	-	NULL	ENST00000371589.4	37	NULL	CCDS7029.1	9																																																																																			MAN1B1	-	-		0.537	MAN1B1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	MAN1B1	HGNC	protein_coding	OTTHUMT00000055294.2	A	NM_016219		139998224	+1	no_errors	ENST00000540391	ensembl	human	known	70_37	rna	SNP	0.570	G
MAP3K14	9020	genome.wustl.edu	37	17	43351847	43351847	+	RNA	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:43351847G>A	ENST00000344686.2	-	0	1509							Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase 14						cellular response to mechanical stimulus (GO:0071260)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|T cell costimulation (GO:0031295)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|NF-kappaB-inducing kinase activity (GO:0004704)|protein kinase activity (GO:0004672)	p.F468F(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GCAGCTCCATGAAGATGTTGA	0.537																																																	1	Substitution - coding silent(1)	cervix(1)											62.0	66.0	64.0					17																	43351847		2042	4197	6239			9020			Y10256	CCDS74079.1	17q21.31	2014-06-16			ENSG00000006062	ENSG00000006062	2.7.11.25	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6853	protein-coding gene	gene with protein product	"""serine/threonine protein-kinase"""	604655				9020361	Standard	NM_003954		Approved	NIK, HSNIK, FTDCR1B, HS	uc002iiw.1	Q99558	OTTHUMG00000180364		17.37:g.43351847G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2D8|D3DX67|Q8IYN1	RNA	SNP	-	NULL	ENST00000344686.2	37	NULL		17																																																																																			MAP3K14	-	-		0.537	MAP3K14-201	KNOWN	basic	processed_transcript	MAP3K14	HGNC	processed_transcript		G	NM_003954		43351847	-1	no_errors	ENST00000344686	ensembl	human	known	70_37	rna	SNP	1.000	A
MAP3K14	9020	genome.wustl.edu	37	17	43351847	43351847	+	RNA	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:43351847G>A	ENST00000344686.2	-	0	1509							Q99558	M3K14_HUMAN	mitogen-activated protein kinase kinase kinase 14						cellular response to mechanical stimulus (GO:0071260)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|immune response (GO:0006955)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|T cell costimulation (GO:0031295)	cytosol (GO:0005829)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|NF-kappaB-inducing kinase activity (GO:0004704)|protein kinase activity (GO:0004672)	p.F468F(1)		breast(3)|central_nervous_system(4)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(4)|lung(5)|ovary(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	27						GCAGCTCCATGAAGATGTTGA	0.537																																																	1	Substitution - coding silent(1)	cervix(1)											62.0	66.0	64.0					17																	43351847		2042	4197	6239			9020			Y10256	CCDS74079.1	17q21.31	2014-06-16			ENSG00000006062	ENSG00000006062	2.7.11.25	"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6853	protein-coding gene	gene with protein product	"""serine/threonine protein-kinase"""	604655				9020361	Standard	NM_003954		Approved	NIK, HSNIK, FTDCR1B, HS	uc002iiw.1	Q99558	OTTHUMG00000180364		17.37:g.43351847G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2D8|D3DX67|Q8IYN1	RNA	SNP	-	NULL	ENST00000344686.2	37	NULL		17																																																																																			MAP3K14	-	-		0.537	MAP3K14-201	KNOWN	basic	processed_transcript	MAP3K14	HGNC	processed_transcript		G	NM_003954		43351847	-1	no_errors	ENST00000344686	ensembl	human	known	70_37	rna	SNP	1.000	A
MARCKS	4082	genome.wustl.edu	37	6	114181151	114181151	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:114181151C>T	ENST00000368635.4	+	2	776	c.395C>T	c.(394-396)tCg>tTg	p.S132L		NM_002356.5	NP_002347.5	P29966	MARCS_HUMAN	myristoylated alanine-rich protein kinase C substrate	132					energy reserve metabolic process (GO:0006112)|regulation of insulin secretion (GO:0050796)|small molecule metabolic process (GO:0044281)	actin cytoskeleton (GO:0015629)|cell cortex (GO:0005938)|centrosome (GO:0005813)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|germinal vesicle (GO:0042585)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)|calmodulin binding (GO:0005516)			breast(1)|kidney(1)|large_intestine(1)|lung(1)	4		all_cancers(87;7.65e-05)|all_epithelial(87;0.000296)|all_hematologic(75;0.0172)|Colorectal(196;0.0317)|all_lung(197;0.198)		Epithelial(106;1.59e-07)|all cancers(137;9.85e-07)|OV - Ovarian serous cystadenocarcinoma(136;0.000322)		GCCGCCTCCTCGACTTCTTCG	0.677																																																	0													4.0	6.0	5.0					6																	114181151		1528	3514	5042	SO:0001583	missense	4082			M68956	CCDS5101.1	6q21	2014-04-10	2001-12-17	2001-12-20	ENSG00000155130	ENSG00000277443			6759	protein-coding gene	gene with protein product		177061	"""myristoylated alanine-rich protein kinase C substrate (MARCKS, 80K-L)"""	MACS		1560845, 8420923	Standard	NM_002356		Approved	PKCSL, 80K-L	uc003pvy.4	P29966	OTTHUMG00000188327	ENST00000368635.4:c.395C>T	6.37:g.114181151C>T	ENSP00000357624:p.Ser132Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P560|Q2LA83|Q5TDB7	Missense_Mutation	SNP	pfam_MARCKS,prints_MARCKS	p.S132L	ENST00000368635.4	37	c.395	CCDS5101.1	6	.	.	.	.	.	.	.	.	.	.	C	17.42	3.385653	0.61956	.	.	ENSG00000155130	ENST00000368635	T	0.32023	1.47	2.76	1.86	0.25419	.	0.298995	0.18501	N	0.139349	T	0.04998	0.0134	N	0.08118	0	0.29736	N	0.837523	B	0.06786	0.001	B	0.01281	0.0	T	0.30534	-0.9975	10	0.59425	D	0.04	.	5.7935	0.18373	0.0:0.8323:0.0:0.1677	.	132	P29966	MARCS_HUMAN	L	132	ENSP00000357624:S132L	ENSP00000357624:S132L	S	+	2	0	MARCKS	114287844	0.410000	0.25376	0.996000	0.52242	0.947000	0.59692	1.169000	0.31871	0.249000	0.21456	0.455000	0.32223	TCG	MARCKS	-	pfam_MARCKS		0.677	MARCKS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARCKS	HGNC	protein_coding	OTTHUMT00000041903.1	C	NM_002356		114181151	+1	no_errors	ENST00000368635	ensembl	human	known	70_37	missense	SNP	0.996	T
MBD3L5	284428	genome.wustl.edu	37	19	7030637	7030637	+	Silent	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:7030637G>A	ENST00000329753.5	+	1	49	c.15G>A	c.(13-15)gcG>gcA	p.A5A		NM_001136507.1	NP_001129979.1	A6NJ08	MB3L5_HUMAN	methyl-CpG binding domain protein 3-like 5	5																	GAGAGCCTGCGTTCACCTCTT	0.483																																																	0													6.0	9.0	8.0					19																	7030637		650	1513	2163	SO:0001819	synonymous_variant	284428				CCDS45942.1	19p13.2	2014-04-01			ENSG00000237247	ENSG00000237247			37204	protein-coding gene	gene with protein product							Standard	NM_001136507		Approved		uc010xjl.2	A6NJ08	OTTHUMG00000181973	ENST00000329753.5:c.15G>A	19.37:g.7030637G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.A5	ENST00000329753.5	37	c.15	CCDS45942.1	19																																																																																			MBD3L5	-	NULL		0.483	MBD3L5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD3L5	HGNC	protein_coding	OTTHUMT00000458497.1	G	NM_001136507		7030637	+1	no_errors	ENST00000329753	ensembl	human	known	70_37	silent	SNP	0.000	A
MCM7	4176	genome.wustl.edu	37	7	99696993	99696993	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:99696993C>A	ENST00000303887.5	-	4	955	c.310G>T	c.(310-312)Gag>Tag	p.E104*	AP4M1_ENST00000359593.4_5'Flank|AP4M1_ENST00000422582.1_5'Flank|AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000354230.3_5'UTR|MCM7_ENST00000343023.6_Nonsense_Mutation_p.E104*|AP4M1_ENST00000429084.1_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	104					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.E104*(1)		endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGCCGATGCTCAATGTAAACG	0.478																																																	1	Substitution - Nonsense(1)	cervix(1)											70.0	77.0	75.0					7																	99696993		2203	4300	6503	SO:0001587	stop_gained	4176				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.310G>T	7.37:g.99696993C>A	ENSP00000307288:p.Glu104*	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.E104*	ENST00000303887.5	37	c.310	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.175218	0.98114	.	.	ENSG00000166508	ENST00000343023;ENST00000303887;ENST00000542483	.	.	.	4.57	3.67	0.42095	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-3.9543	12.2388	0.54530	0.0:0.8269:0.1731:0.0	.	.	.	.	X	104;104;41	.	ENSP00000307288:E104X	E	-	1	0	MCM7	99534929	1.000000	0.71417	0.984000	0.44739	0.247000	0.25773	6.987000	0.76206	1.095000	0.41419	0.563000	0.77884	GAG	MCM7	-	superfamily_NA-bd_OB-fold-like		0.478	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	C			99696993	-1	no_errors	ENST00000303887	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MCM7	4176	genome.wustl.edu	37	7	99696993	99696993	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:99696993C>A	ENST00000303887.5	-	4	955	c.310G>T	c.(310-312)Gag>Tag	p.E104*	AP4M1_ENST00000359593.4_5'Flank|AP4M1_ENST00000422582.1_5'Flank|AP4M1_ENST00000421755.1_5'Flank|MCM7_ENST00000354230.3_5'UTR|MCM7_ENST00000343023.6_Nonsense_Mutation_p.E104*|AP4M1_ENST00000429084.1_5'Flank	NM_005916.3	NP_005907.3	P33993	MCM7_HUMAN	minichromosome maintenance complex component 7	104					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to epidermal growth factor stimulus (GO:0071364)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|regulation of phosphorylation (GO:0042325)|response to drug (GO:0042493)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|MCM complex (GO:0042555)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA helicase activity (GO:0003678)|single-stranded DNA binding (GO:0003697)	p.E104*(1)		endometrium(1)|kidney(5)|large_intestine(5)|lung(4)|ovary(1)|stomach(1)	17	Lung NSC(181;0.0181)|all_lung(186;0.0284)|Esophageal squamous(72;0.0439)					AGCCGATGCTCAATGTAAACG	0.478																																																	1	Substitution - Nonsense(1)	cervix(1)											70.0	77.0	75.0					7																	99696993		2203	4300	6503	SO:0001587	stop_gained	4176				CCDS5683.1, CCDS5684.1	7q21.3-q22.1	2014-06-12	2007-04-04		ENSG00000166508	ENSG00000166508			6950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 104"""	600592	"""minichromosome maintenance deficient (S. cerevisiae) 7"", ""MCM7 minichromosome maintenance deficient 7 (S. cerevisiae)"""	MCM2		7842741	Standard	NM_005916		Approved	CDC47, PPP1R104	uc003usw.1	P33993	OTTHUMG00000154671	ENST00000303887.5:c.310G>T	7.37:g.99696993C>A	ENSP00000307288:p.Glu104*	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2A1|A4D2A2|E9PGN9|Q15076|Q96D34|Q96GL1	Nonsense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_Mg_chelatse_chII,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,smart_AAA+_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_DNA-dep_ATPase,prints_MCM_7,prints_MCM_4	p.E104*	ENST00000303887.5	37	c.310	CCDS5683.1	7	.	.	.	.	.	.	.	.	.	.	C	38	7.175218	0.98114	.	.	ENSG00000166508	ENST00000343023;ENST00000303887;ENST00000542483	.	.	.	4.57	3.67	0.42095	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.30854	T	0.27	-3.9543	12.2388	0.54530	0.0:0.8269:0.1731:0.0	.	.	.	.	X	104;104;41	.	ENSP00000307288:E104X	E	-	1	0	MCM7	99534929	1.000000	0.71417	0.984000	0.44739	0.247000	0.25773	6.987000	0.76206	1.095000	0.41419	0.563000	0.77884	GAG	MCM7	-	superfamily_NA-bd_OB-fold-like		0.478	MCM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM7	HGNC	protein_coding	OTTHUMT00000336534.3	C			99696993	-1	no_errors	ENST00000303887	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MED1	5469	genome.wustl.edu	37	17	37604118	37604118	+	Missense_Mutation	SNP	C	C	T	rs372091824		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:37604118C>T	ENST00000394287.3	-	2	270	c.65G>A	c.(64-66)cGg>cAg	p.R22Q	MED1_ENST00000300651.6_Missense_Mutation_p.R22Q			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.R22Q(1)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TGCATGGAGCCGTTCCAGGAG	0.393										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												1	Substitution - Missense(1)	cervix(1)						C	GLN/ARG	0,4406		0,0,2203	152.0	137.0	142.0		65	5.7	1.0	17		142	1,8599	1.2+/-3.3	0,1,4299	no	missense	MED1	NM_004774.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	22/1582	37604118	1,13005	2203	4300	6503	SO:0001583	missense	5469			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.65G>A	17.37:g.37604118C>T	ENSP00000377828:p.Arg22Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.R22Q	ENST00000394287.3	37	c.65		17	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052212	0.55218	0.0	1.16E-4	ENSG00000125686	ENST00000394287;ENST00000300651	T	0.34072	1.38	5.65	5.65	0.86999	.	.	.	.	.	T	0.32346	0.0826	L	0.27053	0.805	0.39988	D	0.975	D;P	0.53619	0.961;0.938	B;B	0.42386	0.325;0.386	T	0.20207	-1.0282	9	0.66056	D	0.02	-6.1371	19.3899	0.94576	0.0:1.0:0.0:0.0	.	22;22	Q15648;Q15648-3	MED1_HUMAN;.	Q	22	ENSP00000300651:R22Q	ENSP00000300651:R22Q	R	-	2	0	MED1	34857644	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.502000	0.53332	2.679000	0.91253	0.558000	0.71614	CGG	MED1	-	NULL		0.393	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256944.1	C	NM_004774		37604118	-1	no_errors	ENST00000300651	ensembl	human	known	70_37	missense	SNP	1.000	T
MED1	5469	genome.wustl.edu	37	17	37604118	37604118	+	Missense_Mutation	SNP	C	C	T	rs372091824		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:37604118C>T	ENST00000394287.3	-	2	270	c.65G>A	c.(64-66)cGg>cAg	p.R22Q	MED1_ENST00000300651.6_Missense_Mutation_p.R22Q			O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)	p.R22Q(1)		NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TGCATGGAGCCGTTCCAGGAG	0.393										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												1	Substitution - Missense(1)	cervix(1)						C	GLN/ARG	0,4406		0,0,2203	152.0	137.0	142.0		65	5.7	1.0	17		142	1,8599	1.2+/-3.3	0,1,4299	no	missense	MED1	NM_004774.3	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging	22/1582	37604118	1,13005	2203	4300	6503	SO:0001583	missense	5469			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000394287.3:c.65G>A	17.37:g.37604118C>T	ENSP00000377828:p.Arg22Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Missense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.R22Q	ENST00000394287.3	37	c.65		17	.	.	.	.	.	.	.	.	.	.	C	16.19	3.052212	0.55218	0.0	1.16E-4	ENSG00000125686	ENST00000394287;ENST00000300651	T	0.34072	1.38	5.65	5.65	0.86999	.	.	.	.	.	T	0.32346	0.0826	L	0.27053	0.805	0.39988	D	0.975	D;P	0.53619	0.961;0.938	B;B	0.42386	0.325;0.386	T	0.20207	-1.0282	9	0.66056	D	0.02	-6.1371	19.3899	0.94576	0.0:1.0:0.0:0.0	.	22;22	Q15648;Q15648-3	MED1_HUMAN;.	Q	22	ENSP00000300651:R22Q	ENSP00000300651:R22Q	R	-	2	0	MED1	34857644	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	3.502000	0.53332	2.679000	0.91253	0.558000	0.71614	CGG	MED1	-	NULL		0.393	MED1-002	PUTATIVE	basic|exp_conf	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256944.1	C	NM_004774		37604118	-1	no_errors	ENST00000300651	ensembl	human	known	70_37	missense	SNP	1.000	T
MGAT4C	25834	genome.wustl.edu	37	12	86373207	86373207	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:86373207C>A	ENST00000604798.1	-	8	2501	c.1297G>T	c.(1297-1299)Gga>Tga	p.G433*	MGAT4C_ENST00000549405.2_Nonsense_Mutation_p.G433*|MGAT4C_ENST00000552808.2_Nonsense_Mutation_p.G433*|MGAT4C_ENST00000393205.2_Nonsense_Mutation_p.G462*|MGAT4C_ENST00000332156.1_Nonsense_Mutation_p.G433*|MGAT4C_ENST00000548651.1_Nonsense_Mutation_p.G433*			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	433					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.G433*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TTGAATTCTCCTAGTCTTAAG	0.343																																																	1	Substitution - Nonsense(1)	cervix(1)											78.0	78.0	78.0					12																	86373207		2203	4299	6502	SO:0001587	stop_gained	25834				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.1297G>T	12.37:g.86373207C>A	ENSP00000474896:p.Gly433*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRH2|Q4G199|Q9UIU5	Nonsense_Mutation	SNP	pfam_Glyco_transf_54,superfamily_LSM_dom	p.G462*	ENST00000604798.1	37	c.1384	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.237117	0.95240	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.1738	19.9607	0.97248	0.0:1.0:0.0:0.0	.	.	.	.	X	433;462;433;433;433;433	.	ENSP00000331664:G433X	G	-	1	0	MGAT4C	84897338	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.814000	0.86154	2.713000	0.92767	0.585000	0.79938	GGA	MGAT4C	-	NULL		0.343	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	HGNC	protein_coding	OTTHUMT00000406212.2	C	NM_013244		86373207	-1	no_errors	ENST00000393205	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MGAT4C	25834	genome.wustl.edu	37	12	86373207	86373207	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:86373207C>A	ENST00000604798.1	-	8	2501	c.1297G>T	c.(1297-1299)Gga>Tga	p.G433*	MGAT4C_ENST00000549405.2_Nonsense_Mutation_p.G433*|MGAT4C_ENST00000552808.2_Nonsense_Mutation_p.G433*|MGAT4C_ENST00000393205.2_Nonsense_Mutation_p.G462*|MGAT4C_ENST00000332156.1_Nonsense_Mutation_p.G433*|MGAT4C_ENST00000548651.1_Nonsense_Mutation_p.G433*			Q9UBM8	MGT4C_HUMAN	MGAT4 family, member C	433					cellular protein metabolic process (GO:0044267)|post-translational protein modification (GO:0043687)|protein N-linked glycosylation via asparagine (GO:0018279)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	alpha-1,3-mannosylglycoprotein 4-beta-N-acetylglucosaminyltransferase activity (GO:0008454)|metal ion binding (GO:0046872)	p.G433*(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(9)|lung(17)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	41						TTGAATTCTCCTAGTCTTAAG	0.343																																																	1	Substitution - Nonsense(1)	cervix(1)											78.0	78.0	78.0					12																	86373207		2203	4299	6502	SO:0001587	stop_gained	25834				CCDS9030.1	12q21	2014-07-14	2014-07-14		ENSG00000182050	ENSG00000182050		"""Mannosyl-glycoprotein beta N-acetylglucosaminyltransferases"""	30871	protein-coding gene	gene with protein product		607385	"""mannosyl (alpha-1,3-)-glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme C (putative)"""			10570912	Standard	NM_013244		Approved	HGNT-IV-H	uc001tal.4	Q9UBM8	OTTHUMG00000169846	ENST00000604798.1:c.1297G>T	12.37:g.86373207C>A	ENSP00000474896:p.Gly433*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRH2|Q4G199|Q9UIU5	Nonsense_Mutation	SNP	pfam_Glyco_transf_54,superfamily_LSM_dom	p.G462*	ENST00000604798.1	37	c.1384	CCDS9030.1	12	.	.	.	.	.	.	.	.	.	.	C	33	5.237117	0.95240	.	.	ENSG00000182050	ENST00000332156;ENST00000393205;ENST00000549405;ENST00000550460;ENST00000552808;ENST00000548651	.	.	.	5.76	5.76	0.90799	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-16.1738	19.9607	0.97248	0.0:1.0:0.0:0.0	.	.	.	.	X	433;462;433;433;433;433	.	ENSP00000331664:G433X	G	-	1	0	MGAT4C	84897338	1.000000	0.71417	1.000000	0.80357	0.905000	0.53344	7.814000	0.86154	2.713000	0.92767	0.585000	0.79938	GGA	MGAT4C	-	NULL		0.343	MGAT4C-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	MGAT4C	HGNC	protein_coding	OTTHUMT00000406212.2	C	NM_013244		86373207	-1	no_errors	ENST00000393205	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PEG3	5178	genome.wustl.edu	37	19	57352729	57352729	+	5'Flank	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:57352729C>T	ENST00000326441.9	-	0	0				PEG3_ENST00000423103.2_5'Flank|PEG3_ENST00000594706.1_5'Flank|MIMT1_ENST00000599641.1_lincRNA|PEG3_ENST00000598410.1_5'Flank|ZIM2_ENST00000599935.1_5'Flank|PEG3_ENST00000593695.1_5'Flank|ZIM2_ENST00000391708.3_5'Flank|ZIM2_ENST00000593711.1_5'Flank|ZIM2_ENST00000221722.5_5'Flank	NM_006210.2	NP_006201.1	Q9GZU2	PEG3_HUMAN	paternally expressed 3						apoptotic process (GO:0006915)|genetic imprinting (GO:0071514)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|nucleic acid binding (GO:0003676)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			NS(1)|biliary_tract(4)|breast(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(27)|lung(84)|ovary(8)|pancreas(5)|prostate(6)|skin(8)|stomach(2)|upper_aerodigestive_tract(6)	170		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0269)		acaCCGGGCACGTGCGGTTTA	0.517																																																	0																																										SO:0001631	upstream_gene_variant	100073347			AB006625	CCDS12948.1, CCDS58684.1, CCDS58685.1	19q13.4	2013-01-09				ENSG00000198300		"""Zinc fingers, C2H2-type"", ""-"", ""-"", ""-"""	8826	protein-coding gene	gene with protein product		601483				9149948	Standard	NM_006210		Approved	ZKSCAN22, KIAA0287, ZNF904, ZSCAN24	uc010etr.2	Q9GZU2			19.37:g.57352729C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2B8|B4DIM4|C9JP50|P78418|Q5H9P9|Q7Z7H7|Q8TF75|Q9GZY2	RNA	SNP	-	NULL	ENST00000326441.9	37	NULL	CCDS12948.1	19																																																																																			MIMT1	-	-		0.517	PEG3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	MIMT1	HGNC	protein_coding	OTTHUMT00000416099.2	C			57352729	+1	no_errors	ENST00000597105	ensembl	human	known	70_37	rna	SNP	0.000	T
FAM83H	286077	genome.wustl.edu	37	8	144815256	144815256	+	Intron	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:144815256G>C	ENST00000388913.3	-	1	111				MIR4664_ENST00000583819.1_RNA	NM_198488.3	NP_940890	Q6ZRV2	FA83H_HUMAN	family with sequence similarity 83, member H						biomineral tissue development (GO:0031214)					central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(12)|pancreas(1)|prostate(3)|urinary_tract(1)	21	all_cancers(97;3.74e-11)|all_epithelial(106;2.62e-09)|Lung NSC(106;0.00013)|all_lung(105;0.000374)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;3.38e-41)|Epithelial(56;6.8e-40)|all cancers(56;6.43e-35)|Colorectal(110;0.055)|BRCA - Breast invasive adenocarcinoma(115;0.146)			GTGGGGTGCGGAGGACGGGGC	0.652																																																	0																																										SO:0001627	intron_variant	100616318			AK127960	CCDS6410.2	8q24.3	2014-03-13			ENSG00000180921	ENSG00000180921			24797	protein-coding gene	gene with protein product		611927				18252228	Standard	NM_198488		Approved	FLJ46072	uc003yzk.3	Q6ZRV2	OTTHUMG00000133559	ENST00000388913.3:c.14+604C>G	8.37:g.144815256G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A0JLS2|Q8N4W0	RNA	SNP	-	NULL	ENST00000388913.3	37	NULL	CCDS6410.2	8																																																																																			MIR4664	-	-		0.652	FAM83H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MIR4664	HGNC	protein_coding	OTTHUMT00000257632.2	G	NM_198488		144815256	-1	no_errors	ENST00000583819	ensembl	human	known	70_37	rna	SNP	0.000	C
MON2	23041	genome.wustl.edu	37	12	62895398	62895398	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:62895398G>A	ENST00000393632.2	+	7	1100	c.709G>A	c.(709-711)Ggc>Agc	p.G237S	MON2_ENST00000546600.1_Missense_Mutation_p.G237S|MON2_ENST00000280379.6_Missense_Mutation_p.G237S|MON2_ENST00000552738.1_Missense_Mutation_p.G237S|MON2_ENST00000552115.1_Missense_Mutation_p.G237S|MON2_ENST00000549378.1_3'UTR|MON2_ENST00000393630.3_Missense_Mutation_p.G237S|MON2_ENST00000393629.2_Missense_Mutation_p.G237S	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	237					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.G237S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTGGCTAGTGGGCATGACAGA	0.388																																																	1	Substitution - Missense(1)	cervix(1)											124.0	118.0	120.0					12																	62895398		2203	4300	6503	SO:0001583	missense	23041				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.709G>A	12.37:g.62895398G>A	ENSP00000377252:p.Gly237Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	p.G237S	ENST00000393632.2	37	c.709	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.921014	0.97105	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.66099	-0.19;-0.05;-0.05;-0.19;-0.19;-0.05;0.49	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	M	0.65498	2.005	0.80722	D	1	D;P;P;D;D	0.89917	1.0;0.933;0.925;1.0;1.0	D;P;P;D;D	0.97110	0.997;0.886;0.848;1.0;1.0	T	0.77429	-0.2591	9	.	.	.	-7.8861	18.4671	0.90760	0.0:0.0:1.0:0.0	.	237;237;237;237;237	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4;Q7Z3U7	.;.;.;.;MON2_HUMAN	S	237;237;237;237;165;237;237;237	ENSP00000377252:G237S;ENSP00000377250:G237S;ENSP00000280379:G237S;ENSP00000447407:G237S;ENSP00000449215:G237S;ENSP00000377249:G237S;ENSP00000446635:G237S	.	G	+	1	0	MON2	61181665	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.837000	0.99465	2.473000	0.83533	0.460000	0.39030	GGC	MON2	-	superfamily_ARM-type_fold		0.388	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	G	NM_015026		62895398	+1	no_errors	ENST00000393630	ensembl	human	known	70_37	missense	SNP	1.000	A
MON2	23041	genome.wustl.edu	37	12	62895398	62895398	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:62895398G>A	ENST00000393632.2	+	7	1100	c.709G>A	c.(709-711)Ggc>Agc	p.G237S	MON2_ENST00000546600.1_Missense_Mutation_p.G237S|MON2_ENST00000280379.6_Missense_Mutation_p.G237S|MON2_ENST00000552738.1_Missense_Mutation_p.G237S|MON2_ENST00000552115.1_Missense_Mutation_p.G237S|MON2_ENST00000549378.1_3'UTR|MON2_ENST00000393630.3_Missense_Mutation_p.G237S|MON2_ENST00000393629.2_Missense_Mutation_p.G237S	NM_015026.2	NP_055841.2	Q7Z3U7	MON2_HUMAN	MON2 homolog (S. cerevisiae)	237					actin cytoskeleton organization (GO:0030036)|Golgi to endosome transport (GO:0006895)|positive regulation of GTPase activity (GO:0043547)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	extracellular vesicular exosome (GO:0070062)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)	p.G237S(1)		NS(1)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(5)|kidney(3)|large_intestine(15)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	57			BRCA - Breast invasive adenocarcinoma(9;0.218)	GBM - Glioblastoma multiforme(28;0.128)		TTGGCTAGTGGGCATGACAGA	0.388																																																	1	Substitution - Missense(1)	cervix(1)											124.0	118.0	120.0					12																	62895398		2203	4300	6503	SO:0001583	missense	23041				CCDS31849.1, CCDS61175.1, CCDS61177.1, CCDS61178.1	12q14.1	2014-08-12	2006-04-04		ENSG00000061987	ENSG00000061987			29177	protein-coding gene	gene with protein product			"""MON2 homolog (yeast)"""			16301316, 24285343	Standard	NM_015026		Approved	KIAA1040	uc001sre.3	Q7Z3U7	OTTHUMG00000169992	ENST00000393632.2:c.709G>A	12.37:g.62895398G>A	ENSP00000377252:p.Gly237Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D8U7|A7E2Y0|B9EGP5|F8VWA6|F8W1Z6|Q86TA2|Q8N3I5|Q8NAI0|Q8NHE2|Q9UPW1	Missense_Mutation	SNP	pfam_DUF1981_SEC7_assoc,superfamily_ARM-type_fold	p.G237S	ENST00000393632.2	37	c.709	CCDS31849.1	12	.	.	.	.	.	.	.	.	.	.	G	36	5.921014	0.97105	.	.	ENSG00000061987	ENST00000393632;ENST00000393630;ENST00000280379;ENST00000546600;ENST00000261188;ENST00000552738;ENST00000393629;ENST00000552115	T;T;T;T;T;T;T	0.66099	-0.19;-0.05;-0.05;-0.19;-0.19;-0.05;0.49	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.78162	0.4240	M	0.65498	2.005	0.80722	D	1	D;P;P;D;D	0.89917	1.0;0.933;0.925;1.0;1.0	D;P;P;D;D	0.97110	0.997;0.886;0.848;1.0;1.0	T	0.77429	-0.2591	9	.	.	.	-7.8861	18.4671	0.90760	0.0:0.0:1.0:0.0	.	237;237;237;237;237	B9EGP5;F8VWA6;F8W1Z6;Q7Z3U7-4;Q7Z3U7	.;.;.;.;MON2_HUMAN	S	237;237;237;237;165;237;237;237	ENSP00000377252:G237S;ENSP00000377250:G237S;ENSP00000280379:G237S;ENSP00000447407:G237S;ENSP00000449215:G237S;ENSP00000377249:G237S;ENSP00000446635:G237S	.	G	+	1	0	MON2	61181665	1.000000	0.71417	0.999000	0.59377	0.996000	0.88848	9.837000	0.99465	2.473000	0.83533	0.460000	0.39030	GGC	MON2	-	superfamily_ARM-type_fold		0.388	MON2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MON2	HGNC	protein_coding	OTTHUMT00000406767.3	G	NM_015026		62895398	+1	no_errors	ENST00000393630	ensembl	human	known	70_37	missense	SNP	1.000	A
MORF4L1	10933	genome.wustl.edu	37	15	79140359	79140359	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:79140359G>A	ENST00000379535.4	+	2	679							Q9UBU8	MO4L1_HUMAN	mortality factor 4 like 1						cell proliferation (GO:0008283)|chromatin organization (GO:0006325)|double-strand break repair via homologous recombination (GO:0000724)|histone deacetylation (GO:0016575)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nucleoplasm (GO:0005654)|Sin3 complex (GO:0016580)	chromatin binding (GO:0003682)|protein N-terminus binding (GO:0047485)			breast(1)|large_intestine(3)|lung(4)|prostate(1)|urinary_tract(1)	10						gcgagggtccgtggcttcatt	0.517																																																	0																																										SO:0001627	intron_variant	10933			AF100615	CCDS10307.1, CCDS32304.1, CCDS58393.1	15q25.1	2009-07-13			ENSG00000185787	ENSG00000185787			16989	protein-coding gene	gene with protein product	"""MORF-related gene on chromosome 15"", ""Esa1p-associated factor 3 homolog (S. cerevisiae)"""	607303				8619474, 9110174	Standard	NM_006791		Approved	MRG15, MORFRG15, HsT17725, Eaf3, MEAF3	uc002bel.4	Q9UBU8	OTTHUMG00000143865	ENST00000379535.4:c.115+7342G>A	15.37:g.79140359G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DKN6|B7Z6R1|D3DW88|O95899|Q5QTS1|Q6NVX8|Q86YT7|Q9HBP6|Q9NSW5	RNA	SNP	-	NULL	ENST00000379535.4	37	NULL		15																																																																																			MORF4L1	-	-		0.517	MORF4L1-007	PUTATIVE	basic|exp_conf	protein_coding	MORF4L1	HGNC	protein_coding	OTTHUMT00000417833.1	G	NM_006791		79140359	+1	no_errors	ENST00000559697	ensembl	human	known	70_37	rna	SNP	0.034	A
MTPAP	55149	genome.wustl.edu	37	10	30602411	30602411	+	3'UTR	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr10:30602411G>C	ENST00000263063.4	-	0	1919				MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_3'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase						cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GGGGGCCAATGAGAAGATCAT	0.418																																																	0																																										SO:0001624	3_prime_UTR_variant	55149			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.*127C>G	10.37:g.30602411G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	RNA	SNP	-	NULL	ENST00000263063.4	37	NULL	CCDS7165.1	10																																																																																			MTPAP	-	-		0.418	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	HGNC	protein_coding	OTTHUMT00000047426.2	G	NM_018109		30602411	-1	no_errors	ENST00000488290	ensembl	human	known	70_37	rna	SNP	0.000	C
MTPAP	55149	genome.wustl.edu	37	10	30602411	30602411	+	3'UTR	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr10:30602411G>C	ENST00000263063.4	-	0	1919				MTPAP_ENST00000488290.1_5'UTR|MTPAP_ENST00000358107.4_3'UTR	NM_018109.3	NP_060579.3	Q9NVV4	PAPD1_HUMAN	mitochondrial poly(A) polymerase						cell death (GO:0008219)|histone mRNA catabolic process (GO:0071044)|mRNA polyadenylation (GO:0006378)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|poly(A) RNA binding (GO:0044822)|polynucleotide adenylyltransferase activity (GO:0004652)|protein homodimerization activity (GO:0042803)|UTP binding (GO:0002134)			breast(1)|endometrium(5)|kidney(1)|large_intestine(8)|lung(13)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	33						GGGGGCCAATGAGAAGATCAT	0.418																																																	0																																										SO:0001624	3_prime_UTR_variant	55149			AL122121	CCDS7165.1	10p12.1	2014-01-30	2009-01-12	2009-01-12	ENSG00000107951	ENSG00000107951			25532	protein-coding gene	gene with protein product	"""TUTase1"""	613669	"""PAP associated domain containing 1"""	PAPD1		12239557, 15769737, 15547249	Standard	NM_018109		Approved	FLJ10486, mtPAP, SPAX4	uc001iva.4	Q9NVV4	OTTHUMG00000017895	ENST00000263063.4:c.*127C>G	10.37:g.30602411G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRX0|Q659E3|Q6P7E5|Q9HA74	RNA	SNP	-	NULL	ENST00000263063.4	37	NULL	CCDS7165.1	10																																																																																			MTPAP	-	-		0.418	MTPAP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTPAP	HGNC	protein_coding	OTTHUMT00000047426.2	G	NM_018109		30602411	-1	no_errors	ENST00000488290	ensembl	human	known	70_37	rna	SNP	0.000	C
MUC17	140453	genome.wustl.edu	37	7	100676739	100676739	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:100676739C>G	ENST00000306151.4	+	3	2106	c.2042C>G	c.(2041-2043)tCa>tGa	p.S681*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	681	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S681*(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATGCCAACCTCAACTTATACT	0.483																																																	1	Substitution - Nonsense(1)	cervix(1)											319.0	323.0	321.0					7																	100676739		2203	4300	6503	SO:0001587	stop_gained	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2042C>G	7.37:g.100676739C>G	ENSP00000302716:p.Ser681*	Somatic		WXS	Illumina HiSeq	Phase_IV	O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S681*	ENST00000306151.4	37	c.2042	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490968	0.84962	.	.	ENSG00000169876	ENST00000306151	.	.	.	1.22	1.22	0.21188	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	8.4632	0.32940	0.0:1.0:0.0:0.0	.	.	.	.	X	681	.	ENSP00000302716:S681X	S	+	2	0	MUC17	100463459	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.537000	0.06128	1.015000	0.39444	0.395000	0.25975	TCA	MUC17	-	NULL		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	C	NM_001040105		100676739	+1	no_errors	ENST00000306151	ensembl	human	known	70_37	nonsense	SNP	0.002	G
MUC17	140453	genome.wustl.edu	37	7	100676739	100676739	+	Nonsense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:100676739C>G	ENST00000306151.4	+	3	2106	c.2042C>G	c.(2041-2043)tCa>tGa	p.S681*		NM_001040105.1	NP_001035194.1	Q685J3	MUC17_HUMAN	mucin 17, cell surface associated	681	59 X approximate tandem repeats.|Ser-rich.				cellular homeostasis (GO:0019725)|cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)	extracellular matrix constituent, lubricant activity (GO:0030197)|PDZ domain binding (GO:0030165)	p.S681*(1)		NS(3)|breast(14)|central_nervous_system(2)|cervix(2)|endometrium(27)|haematopoietic_and_lymphoid_tissue(2)|kidney(18)|large_intestine(28)|lung(179)|ovary(19)|pancreas(1)|prostate(13)|skin(26)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	343	Lung NSC(181;0.136)|all_lung(186;0.182)					ATGCCAACCTCAACTTATACT	0.483																																																	1	Substitution - Nonsense(1)	cervix(1)											319.0	323.0	321.0					7																	100676739		2203	4300	6503	SO:0001587	stop_gained	140453			AJ606307	CCDS34711.1	7q22	2007-01-17	2006-03-14		ENSG00000169876	ENSG00000169876		"""Mucins"""	16800	protein-coding gene	gene with protein product		608424				11855812	Standard	NM_001040105		Approved		uc003uxp.1	Q685J3	OTTHUMG00000157030	ENST00000306151.4:c.2042C>G	7.37:g.100676739C>G	ENSP00000302716:p.Ser681*	Somatic		WXS	Illumina HiSeq	Phase_IV	O14761|Q685J2|Q8TDH7	Nonsense_Mutation	SNP	pfam_SEA,smart_SEA,pfscan_EG-like_dom,pfscan_SEA	p.S681*	ENST00000306151.4	37	c.2042	CCDS34711.1	7	.	.	.	.	.	.	.	.	.	.	C	24.1	4.490968	0.84962	.	.	ENSG00000169876	ENST00000306151	.	.	.	1.22	1.22	0.21188	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.15499	T	0.54	.	8.4632	0.32940	0.0:1.0:0.0:0.0	.	.	.	.	X	681	.	ENSP00000302716:S681X	S	+	2	0	MUC17	100463459	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.537000	0.06128	1.015000	0.39444	0.395000	0.25975	TCA	MUC17	-	NULL		0.483	MUC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MUC17	HGNC	protein_coding	OTTHUMT00000347161.1	C	NM_001040105		100676739	+1	no_errors	ENST00000306151	ensembl	human	known	70_37	nonsense	SNP	0.002	G
MUC5AC	4586	genome.wustl.edu	37	11	1214870	1214870	+	3'UTR	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:1214870C>T	ENST00000358378.6	+	0	1351							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		CTGCTGCCATCACTACCAGTG	0.692																																																	0													32.0	32.0	32.0					11																	1214870		866	1989	2855	SO:0001624	3_prime_UTR_variant	4586			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*1348C>T	11.37:g.1214870C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	RNA	SNP	-	NULL	ENST00000358378.6	37	NULL		11																																																																																			MUC5AC	-	-		0.692	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	HGNC	protein_coding	OTTHUMT00000396096.2	C	XM_001130382		1214870	+1	no_errors	ENST00000358378	ensembl	human	putative	70_37	rna	SNP	0.354	T
MUC5AC	4586	genome.wustl.edu	37	11	1214870	1214870	+	3'UTR	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:1214870C>T	ENST00000358378.6	+	0	1351							P98088	MUC5A_HUMAN	mucin 5AC, oligomeric mucus/gel-forming						cellular protein metabolic process (GO:0044267)|extracellular fibril organization (GO:0043206)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)	extracellular vesicular exosome (GO:0070062)|fibril (GO:0043205)|Golgi lumen (GO:0005796)	extracellular matrix structural constituent (GO:0005201)			NS(1)|breast(2)|central_nervous_system(7)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(5)|kidney(9)|large_intestine(19)|liver(1)|lung(89)|ovary(7)|prostate(8)|skin(9)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(1)	203		all_cancers(49;2.94e-05)|Breast(177;0.00257)|all_epithelial(84;0.00314)|Ovarian(85;0.0228)|Medulloblastoma(188;0.0321)|all_neural(188;0.0762)		BRCA - Breast invasive adenocarcinoma(625;0.00146)|Lung(200;0.0612)|LUSC - Lung squamous cell carcinoma(625;0.0724)		CTGCTGCCATCACTACCAGTG	0.692																																																	0													32.0	32.0	32.0					11																	1214870		866	1989	2855	SO:0001624	3_prime_UTR_variant	4586			AJ001402, AJ298317		11p15.5	2007-04-23	2006-03-14		ENSG00000215182	ENSG00000215182		"""Mucins"""	7515	protein-coding gene	gene with protein product		158373	"""mucin 5, subtypes A and C, tracheobronchial/gastric"""			7826332, 9588204	Standard	XM_006709945		Approved	MUC5	uc001lsz.3	P98088	OTTHUMG00000154270	ENST00000358378.6:c.*1348C>T	11.37:g.1214870C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O60460|O76065|Q13792|Q14425|Q658Q1|Q7M4S5|Q8N4M9|Q8WWQ3|Q8WWQ4|Q8WWQ5	RNA	SNP	-	NULL	ENST00000358378.6	37	NULL		11																																																																																			MUC5AC	-	-		0.692	MUC5AC-002	PUTATIVE	basic|exp_conf	processed_transcript	MUC5AC	HGNC	protein_coding	OTTHUMT00000396096.2	C	XM_001130382		1214870	+1	no_errors	ENST00000358378	ensembl	human	putative	70_37	rna	SNP	0.354	T
MYH9	4627	genome.wustl.edu	37	22	36690135	36690136	+	Intron	INS	-	-	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:36690135_36690136insA	ENST00000216181.5	-	28	4068					NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle						actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GCGGAGGCCTCACCTGCAGCTT	0.639			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0																																										SO:0001627	intron_variant	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.3837+1->T	22.37:g.36690136_36690136dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Splice_Site	INS	-	e27+2	ENST00000216181.5	37	c.3837+2_3837+1	CCDS13927.1	22																																																																																			MYH9	-	-		0.639	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	-	NM_002473		36690136	-1	no_errors	ENST00000216181	ensembl	human	known	70_37	splice_site_ins	INS	1.000:1.000	A
MYH9	4627	genome.wustl.edu	37	22	36690135	36690136	+	Intron	INS	-	-	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:36690135_36690136insA	ENST00000216181.5	-	28	4068					NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle						actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						GCGGAGGCCTCACCTGCAGCTT	0.639			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0																																										SO:0001627	intron_variant	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.3837+1->T	22.37:g.36690136_36690136dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Splice_Site	INS	-	e27+2	ENST00000216181.5	37	c.3837+2_3837+1	CCDS13927.1	22																																																																																			MYH9	-	-		0.639	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	-	NM_002473		36690136	-1	no_errors	ENST00000216181	ensembl	human	known	70_37	splice_site_ins	INS	1.000:1.000	A
NDUFAF5	79133	genome.wustl.edu	37	20	13796890	13796890	+	Intron	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr20:13796890C>T	ENST00000378106.5	+	9	897				NDUFAF5_ENST00000475968.1_Intron|NDUFAF5_ENST00000463598.1_Intron	NM_024120.4	NP_077025.2	Q5TEU4	NDUF5_HUMAN	NADH dehydrogenase (ubiquinone) complex I, assembly factor 5						mitochondrial respiratory chain complex I assembly (GO:0032981)	extrinsic component of mitochondrial inner membrane (GO:0031314)	methyltransferase activity (GO:0008168)										CCTGAAATTTCACTTGCCTGT	0.428																																																	0																																										SO:0001627	intron_variant	79133				CCDS13118.1, CCDS33441.1	20p12.1	2012-10-12	2012-05-08	2012-05-08	ENSG00000101247	ENSG00000101247		"""Mitochondrial respiratory chain complex assembly factors"""	15899	protein-coding gene	gene with protein product		612360	"""chromosome 20 open reading frame 7"""	C20orf7		18940309, 21607760	Standard	NM_024120		Approved	dJ842G6.1	uc002wom.3	Q5TEU4	OTTHUMG00000031909	ENST00000378106.5:c.779-219C>T	20.37:g.13796890C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K166|Q6GPH3|Q9H6F4	RNA	SNP	-	NULL	ENST00000378106.5	37	NULL	CCDS13118.1	20																																																																																			NDUFAF5	-	-		0.428	NDUFAF5-006	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFAF5	HGNC	protein_coding	OTTHUMT00000078057.2	C	NM_001039375		13796890	+1	no_errors	ENST00000479682	ensembl	human	known	70_37	rna	SNP	0.000	T
NCOA6	23054	genome.wustl.edu	37	20	33356297	33356297	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr20:33356297C>A	ENST00000374796.2	-	6	3054	c.484G>T	c.(484-486)Gag>Tag	p.E162*	NCOA6_ENST00000359003.2_Nonsense_Mutation_p.E162*			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	162	CREBBP-binding region.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.E162*(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						AATCCCGCCTCCATCCTAACT	0.448																																																	1	Substitution - Nonsense(1)	cervix(1)											147.0	129.0	135.0					20																	33356297		2203	4300	6503	SO:0001587	stop_gained	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.484G>T	20.37:g.33356297C>A	ENSP00000363929:p.Glu162*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Nonsense_Mutation	SNP	NULL	p.E162*	ENST00000374796.2	37	c.484	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	C	53	21.620878	0.99942	.	.	ENSG00000198646	ENST00000374796;ENST00000359003;ENST00000397675	.	.	.	5.56	5.56	0.83823	.	0.085391	0.48767	D	0.000161	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-8.4877	19.5248	0.95199	0.0:1.0:0.0:0.0	.	.	.	.	X	162	.	ENSP00000351894:E162X	E	-	1	0	NCOA6	32819958	1.000000	0.71417	0.983000	0.44433	0.044000	0.14063	7.453000	0.80700	2.621000	0.88768	0.591000	0.81541	GAG	NCOA6	-	NULL		0.448	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	C	NM_014071		33356297	-1	no_errors	ENST00000359003	ensembl	human	known	70_37	nonsense	SNP	1.000	A
NCOA6	23054	genome.wustl.edu	37	20	33356297	33356297	+	Nonsense_Mutation	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr20:33356297C>A	ENST00000374796.2	-	6	3054	c.484G>T	c.(484-486)Gag>Tag	p.E162*	NCOA6_ENST00000359003.2_Nonsense_Mutation_p.E162*			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	162	CREBBP-binding region.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)	p.E162*(1)		NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						AATCCCGCCTCCATCCTAACT	0.448																																																	1	Substitution - Nonsense(1)	cervix(1)											147.0	129.0	135.0					20																	33356297		2203	4300	6503	SO:0001587	stop_gained	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.484G>T	20.37:g.33356297C>A	ENSP00000363929:p.Glu162*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Nonsense_Mutation	SNP	NULL	p.E162*	ENST00000374796.2	37	c.484	CCDS13241.1	20	.	.	.	.	.	.	.	.	.	.	C	53	21.620878	0.99942	.	.	ENSG00000198646	ENST00000374796;ENST00000359003;ENST00000397675	.	.	.	5.56	5.56	0.83823	.	0.085391	0.48767	D	0.000161	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-8.4877	19.5248	0.95199	0.0:1.0:0.0:0.0	.	.	.	.	X	162	.	ENSP00000351894:E162X	E	-	1	0	NCOA6	32819958	1.000000	0.71417	0.983000	0.44433	0.044000	0.14063	7.453000	0.80700	2.621000	0.88768	0.591000	0.81541	GAG	NCOA6	-	NULL		0.448	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	C	NM_014071		33356297	-1	no_errors	ENST00000359003	ensembl	human	known	70_37	nonsense	SNP	1.000	A
NLRC5	84166	genome.wustl.edu	37	16	57075481	57075481	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:57075481C>G	ENST00000262510.6	+	18	3249	c.3024C>G	c.(3022-3024)caC>caG	p.H1008Q	NLRC5_ENST00000308149.7_Missense_Mutation_p.H1008Q|NLRC5_ENST00000539144.1_Missense_Mutation_p.H1008Q|NLRC5_ENST00000436936.1_Missense_Mutation_p.H1008Q	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1008					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.H1008Q(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GTCACCTCCACCTCGAGTGAG	0.517																																																	1	Substitution - Missense(1)	cervix(1)											73.0	69.0	70.0					16																	57075481		2198	4300	6498	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3024C>G	16.37:g.57075481C>G	ENSP00000262510:p.His1008Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.H1008Q	ENST00000262510.6	37	c.3024	CCDS10773.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.81|13.81	2.348345|2.348345	0.41599|0.41599	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.52983|.	0.64;0.64;0.64;0.64;0.64;0.64|.	3.84|3.84	1.74|1.74	0.24563|0.24563	.|.	.|.	.|.	.|.	.|.	T|T	0.16128|0.16128	0.0388|0.0388	N|N	0.08118|0.08118	0|0	0.21064|0.21064	N|N	0.999792|0.999792	D;B;B;P|.	0.69078|.	0.997;0.213;0.141;0.917|.	D;B;B;P|.	0.65684|.	0.937;0.108;0.079;0.732|.	T|T	0.25082|0.25082	-1.0142|-1.0142	9|5	0.38643|.	T|.	0.18|.	.|.	5.2003|5.2003	0.15260|0.15260	0.0:0.7021:0.0:0.2979|0.0:0.7021:0.0:0.2979	.|.	1008;1008;1008;1008|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	Q|A	1008;1008;1008;482;1008;515;307|761	ENSP00000262510:H1008Q;ENSP00000308886:H1008Q;ENSP00000389739:H1008Q;ENSP00000441727:H1008Q;ENSP00000441597:H515Q;ENSP00000440153:H307Q|.	ENSP00000262510:H1008Q|.	H|P	+|+	3|1	2|0	NLRC5|NLRC5	55632982|55632982	0.014000|0.014000	0.17966|0.17966	0.542000|0.542000	0.28115|0.28115	0.104000|0.104000	0.19210|0.19210	-0.088000|-0.088000	0.11198|0.11198	0.496000|0.496000	0.27904|0.27904	-0.345000|-0.345000	0.07892|0.07892	CAC|CCT	NLRC5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.517	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	C	NM_032206		57075481	+1	no_errors	ENST00000262510	ensembl	human	known	70_37	missense	SNP	0.614	G
NLRC5	84166	genome.wustl.edu	37	16	57075481	57075481	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:57075481C>G	ENST00000262510.6	+	18	3249	c.3024C>G	c.(3022-3024)caC>caG	p.H1008Q	NLRC5_ENST00000308149.7_Missense_Mutation_p.H1008Q|NLRC5_ENST00000539144.1_Missense_Mutation_p.H1008Q|NLRC5_ENST00000436936.1_Missense_Mutation_p.H1008Q	NM_032206.4	NP_115582.4	Q86WI3	NLRC5_HUMAN	NLR family, CARD domain containing 5	1008					defense response to virus (GO:0051607)|innate immune response (GO:0045087)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|negative regulation of type I interferon-mediated signaling pathway (GO:0060339)|positive regulation of interferon-gamma-mediated signaling pathway (GO:0060335)|positive regulation of MHC class I biosynthetic process (GO:0045345)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of kinase activity (GO:0043549)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)	p.H1008Q(1)		NS(2)|breast(2)|central_nervous_system(3)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(21)|ovary(8)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	75		all_neural(199;0.225)				GTCACCTCCACCTCGAGTGAG	0.517																																																	1	Substitution - Missense(1)	cervix(1)											73.0	69.0	70.0					16																	57075481		2198	4300	6498	SO:0001583	missense	84166			AF389420	CCDS10773.1	16q13	2008-02-05			ENSG00000140853	ENSG00000140853		"""Nucleotide-binding domain and leucine rich repeat containing"""	29933	protein-coding gene	gene with protein product	"""nucleotide-binding oligomerization domain, leucine rich repeat and CARD domain containing 5"", ""NOD-like receptor C5"""	613537				12615073	Standard	NM_032206		Approved	NOD27, CLR16.1, FLJ21709	uc021tiu.1	Q86WI3	OTTHUMG00000133470	ENST00000262510.6:c.3024C>G	16.37:g.57075481C>G	ENSP00000262510:p.His1008Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MEF1|C9JMD8|Q6P4A6|Q86VM7|Q8NF42|Q8TEE2|Q8TEJ1|Q969L7	Missense_Mutation	SNP	pfam_Leu-rich_rpt,smart_Leu-rich_rpt_RNase_inh_sub-typ,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_NACHT_NTPase	p.H1008Q	ENST00000262510.6	37	c.3024	CCDS10773.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	13.81|13.81	2.348345|2.348345	0.41599|0.41599	.|.	.|.	ENSG00000140853|ENSG00000140853	ENST00000262510;ENST00000308149;ENST00000436936;ENST00000327982;ENST00000539144;ENST00000538110;ENST00000543030|ENST00000538805	T;T;T;T;T;T|.	0.52983|.	0.64;0.64;0.64;0.64;0.64;0.64|.	3.84|3.84	1.74|1.74	0.24563|0.24563	.|.	.|.	.|.	.|.	.|.	T|T	0.16128|0.16128	0.0388|0.0388	N|N	0.08118|0.08118	0|0	0.21064|0.21064	N|N	0.999792|0.999792	D;B;B;P|.	0.69078|.	0.997;0.213;0.141;0.917|.	D;B;B;P|.	0.65684|.	0.937;0.108;0.079;0.732|.	T|T	0.25082|0.25082	-1.0142|-1.0142	9|5	0.38643|.	T|.	0.18|.	.|.	5.2003|5.2003	0.15260|0.15260	0.0:0.7021:0.0:0.2979|0.0:0.7021:0.0:0.2979	.|.	1008;1008;1008;1008|.	Q86WI3-5;Q86WI3-4;Q86WI3-6;Q86WI3|.	.;.;.;NLRC5_HUMAN|.	Q|A	1008;1008;1008;482;1008;515;307|761	ENSP00000262510:H1008Q;ENSP00000308886:H1008Q;ENSP00000389739:H1008Q;ENSP00000441727:H1008Q;ENSP00000441597:H515Q;ENSP00000440153:H307Q|.	ENSP00000262510:H1008Q|.	H|P	+|+	3|1	2|0	NLRC5|NLRC5	55632982|55632982	0.014000|0.014000	0.17966|0.17966	0.542000|0.542000	0.28115|0.28115	0.104000|0.104000	0.19210|0.19210	-0.088000|-0.088000	0.11198|0.11198	0.496000|0.496000	0.27904|0.27904	-0.345000|-0.345000	0.07892|0.07892	CAC|CCT	NLRC5	-	smart_Leu-rich_rpt_RNase_inh_sub-typ		0.517	NLRC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NLRC5	HGNC	protein_coding	OTTHUMT00000257346.1	C	NM_032206		57075481	+1	no_errors	ENST00000262510	ensembl	human	known	70_37	missense	SNP	0.614	G
OR2T2	401992	genome.wustl.edu	37	1	248616883	248616883	+	Missense_Mutation	SNP	T	T	A	rs143551105	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:248616883T>A	ENST00000342927.3	+	1	807	c.785T>A	c.(784-786)cTg>cAg	p.L262Q		NM_001004136.1	NP_001004136.1	Q6IF00	OR2T2_HUMAN	olfactory receptor, family 2, subfamily T, member 2	262						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(21)|ovary(1)|skin(5)|upper_aerodigestive_tract(1)	37	all_cancers(71;0.000108)|all_epithelial(71;1.03e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0265)			ACCAACGTGCTGCCCCACTCC	0.537																																																	0													21.0	19.0	20.0					1																	248616883		2179	4264	6443	SO:0001583	missense	401992			BK004462	CCDS31116.1	1q44	2012-08-09	2002-11-13	2002-11-15	ENSG00000196240	ENSG00000196240		"""GPCR / Class A : Olfactory receptors"""	14725	protein-coding gene	gene with protein product			"""olfactory receptor, family 2, subfamily T, member 2 pseudogene"""	OR2T2P		14983052	Standard	NM_001004136		Approved		uc001iek.1	Q6IF00	OTTHUMG00000040480	ENST00000342927.3:c.785T>A	1.37:g.248616883T>A	ENSP00000343062:p.Leu262Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNM1|B9EH01	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L262Q	ENST00000342927.3	37	c.785	CCDS31116.1	1	.	.	.	.	.	.	.	.	.	.	t	9.878	1.200859	0.22121	.	.	ENSG00000196240	ENST00000342927	T	0.37584	1.19	3.5	2.26	0.28386	GPCR, rhodopsin-like superfamily (1);	0.000000	0.35291	N	0.003307	T	0.28962	0.0719	N	0.04260	-0.245	0.19300	N	0.999975	D	0.89917	1.0	D	0.97110	1.0	T	0.06092	-1.0846	10	0.30078	T	0.28	.	5.2576	0.15555	0.1723:0.0:0.1769:0.6508	.	262	Q6IF00	OR2T2_HUMAN	Q	262	ENSP00000343062:L262Q	ENSP00000343062:L262Q	L	+	2	0	OR2T2	246683506	0.000000	0.05858	0.864000	0.33941	0.263000	0.26337	0.284000	0.18864	1.431000	0.47355	0.374000	0.22700	CTG	OR2T2	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.537	OR2T2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2T2	HGNC	protein_coding	OTTHUMT00000097421.1	T	NM_001004136		248616883	+1	no_errors	ENST00000342927	ensembl	human	known	70_37	missense	SNP	0.339	A
OR7G1	125962	genome.wustl.edu	37	19	9225923	9225923	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:9225923C>T	ENST00000541538.1	-	1	516	c.517G>A	c.(517-519)Gaa>Aaa	p.E173K	OR7G1_ENST00000293614.1_Missense_Mutation_p.E173K	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E173K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						AAAGGGATTTCAACGTTTTTG	0.443																																																	1	Substitution - Missense(1)	cervix(1)											121.0	113.0	115.0					19																	9225923		2203	4300	6503	SO:0001583	missense	125962				CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.517G>A	19.37:g.9225923C>T	ENSP00000444134:p.Glu173Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFJ5|Q96RA1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E173K	ENST00000541538.1	37	c.517	CCDS32898.2	19	.	.	.	.	.	.	.	.	.	.	c	11.09	1.535644	0.27475	.	.	ENSG00000161807	ENST00000293614;ENST00000541538	T;T	0.00123	8.7;8.7	3.78	0.186	0.15105	GPCR, rhodopsin-like superfamily (1);	0.182670	0.25916	U	0.027471	T	0.00144	0.0004	L	0.41356	1.27	0.09310	N	1	B	0.24092	0.097	B	0.33690	0.168	T	0.27773	-1.0064	10	0.52906	T	0.07	.	5.0896	0.14700	0.0:0.4606:0.354:0.1853	.	173	Q8NGA0	OR7G1_HUMAN	K	173	ENSP00000293614:E173K;ENSP00000444134:E173K	ENSP00000293614:E173K	E	-	1	0	OR7G1	9086923	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.079000	0.03410	0.312000	0.23038	-0.505000	0.04504	GAA	OR7G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.443	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G1	HGNC	protein_coding	OTTHUMT00000397912.1	C			9225923	-1	no_errors	ENST00000293614	ensembl	human	known	70_37	missense	SNP	0.000	T
OR7G1	125962	genome.wustl.edu	37	19	9225923	9225923	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:9225923C>T	ENST00000541538.1	-	1	516	c.517G>A	c.(517-519)Gaa>Aaa	p.E173K	OR7G1_ENST00000293614.1_Missense_Mutation_p.E173K	NM_001005192.2	NP_001005192.2	Q8NGA0	OR7G1_HUMAN	olfactory receptor, family 7, subfamily G, member 1	173						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.E173K(1)		breast(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(6)|ovary(2)|skin(2)	20						AAAGGGATTTCAACGTTTTTG	0.443																																																	1	Substitution - Missense(1)	cervix(1)											121.0	113.0	115.0					19																	9225923		2203	4300	6503	SO:0001583	missense	125962				CCDS32898.1, CCDS32898.2	19p13.2	2013-09-24			ENSG00000161807	ENSG00000161807		"""GPCR / Class A : Olfactory receptors"""	8465	protein-coding gene	gene with protein product				OR7G1P			Standard	NM_001005192		Approved	OR19-15	uc021uoi.1	Q8NGA0	OTTHUMG00000168067	ENST00000541538.1:c.517G>A	19.37:g.9225923C>T	ENSP00000444134:p.Glu173Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFJ5|Q96RA1	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E173K	ENST00000541538.1	37	c.517	CCDS32898.2	19	.	.	.	.	.	.	.	.	.	.	c	11.09	1.535644	0.27475	.	.	ENSG00000161807	ENST00000293614;ENST00000541538	T;T	0.00123	8.7;8.7	3.78	0.186	0.15105	GPCR, rhodopsin-like superfamily (1);	0.182670	0.25916	U	0.027471	T	0.00144	0.0004	L	0.41356	1.27	0.09310	N	1	B	0.24092	0.097	B	0.33690	0.168	T	0.27773	-1.0064	10	0.52906	T	0.07	.	5.0896	0.14700	0.0:0.4606:0.354:0.1853	.	173	Q8NGA0	OR7G1_HUMAN	K	173	ENSP00000293614:E173K;ENSP00000444134:E173K	ENSP00000293614:E173K	E	-	1	0	OR7G1	9086923	0.000000	0.05858	0.001000	0.08648	0.006000	0.05464	-1.079000	0.03410	0.312000	0.23038	-0.505000	0.04504	GAA	OR7G1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.443	OR7G1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7G1	HGNC	protein_coding	OTTHUMT00000397912.1	C			9225923	-1	no_errors	ENST00000293614	ensembl	human	known	70_37	missense	SNP	0.000	T
PCDHA13	56136	genome.wustl.edu	37	5	140262124	140262124	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr5:140262124G>A	ENST00000289272.2	+	1	271	c.271G>A	c.(271-273)Gac>Aac	p.D91N	PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.D91N|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D91N(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTCGGATCGACCGCGAGGA	0.592																																					Melanoma(147;1739 1852 5500 27947 37288)												1	Substitution - Missense(1)	cervix(1)											119.0	131.0	127.0					5																	140262124		2203	4297	6500	SO:0001583	missense	56136			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.271G>A	5.37:g.140262124G>A	ENSP00000289272:p.Asp91Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D91N	ENST00000289272.2	37	c.271	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.242002	0.95272	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.52295	0.67;0.67	5.58	5.58	0.84498	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.80534	0.4641	H	0.97707	4.06	0.48762	D	0.999701	D;D;D	0.69078	0.997;0.991;0.988	D;D;P	0.68192	0.91;0.956;0.704	D	0.87435	0.2391	9	0.87932	D	0	.	19.1623	0.93539	0.0:0.0:1.0:0.0	.	91;91;91	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	N	91	ENSP00000386821:D91N;ENSP00000289272:D91N	ENSP00000289272:D91N	D	+	1	0	PCDHA13	140242308	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.731000	0.98807	2.621000	0.88768	0.561000	0.74099	GAC	PCDHA13	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.592	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	G	NM_018904		140262124	+1	no_errors	ENST00000289272	ensembl	human	known	70_37	missense	SNP	1.000	A
PCDHA13	56136	genome.wustl.edu	37	5	140262124	140262124	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr5:140262124G>A	ENST00000289272.2	+	1	271	c.271G>A	c.(271-273)Gac>Aac	p.D91N	PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Missense_Mutation_p.D91N|PCDHA5_ENST00000529619.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA11_ENST00000398640.2_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA1_ENST00000504120.2_Intron	NM_018904.2|NM_031865.1	NP_061727.1|NP_114071.1	Q9Y5I0	PCDAD_HUMAN	protocadherin alpha 13	91	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D91N(1)		NS(1)|biliary_tract(2)|breast(3)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(7)|kidney(2)|large_intestine(18)|liver(3)|lung(23)|ovary(4)|prostate(6)|skin(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	95			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TTCTCGGATCGACCGCGAGGA	0.592																																					Melanoma(147;1739 1852 5500 27947 37288)												1	Substitution - Missense(1)	cervix(1)											119.0	131.0	127.0					5																	140262124		2203	4297	6500	SO:0001583	missense	56136			AF152478	CCDS4240.1	5q31	2010-11-26			ENSG00000239389	ENSG00000239389		"""Cadherins / Protocadherins : Clustered"""	8667	other	complex locus constituent	"""KIAA0345-like 1"", ""ortholog of mouse CNR5"""	606319		CNRS5		10380929, 10662547	Standard	NM_018904		Approved	CNR5, CRNR5, CNRN5, PCDH-ALPHA13		Q9Y5I0	OTTHUMG00000129614	ENST00000289272.2:c.271G>A	5.37:g.140262124G>A	ENSP00000289272:p.Asp91Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O75277	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D91N	ENST00000289272.2	37	c.271	CCDS4240.1	5	.	.	.	.	.	.	.	.	.	.	G	33	5.242002	0.95272	.	.	ENSG00000239389	ENST00000409494;ENST00000289272	T;T	0.52295	0.67;0.67	5.58	5.58	0.84498	Cadherin, N-terminal (1);Cadherin (4);Cadherin-like (1);	.	.	.	.	T	0.80534	0.4641	H	0.97707	4.06	0.48762	D	0.999701	D;D;D	0.69078	0.997;0.991;0.988	D;D;P	0.68192	0.91;0.956;0.704	D	0.87435	0.2391	9	0.87932	D	0	.	19.1623	0.93539	0.0:0.0:1.0:0.0	.	91;91;91	Q9Y5I0;C9JA99;Q9Y5I0-2	PCDAD_HUMAN;.;.	N	91	ENSP00000386821:D91N;ENSP00000289272:D91N	ENSP00000289272:D91N	D	+	1	0	PCDHA13	140242308	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.731000	0.98807	2.621000	0.88768	0.561000	0.74099	GAC	PCDHA13	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.592	PCDHA13-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA13	HGNC	protein_coding	OTTHUMT00000335000.1	G	NM_018904		140262124	+1	no_errors	ENST00000289272	ensembl	human	known	70_37	missense	SNP	1.000	A
PHF21A	51317	genome.wustl.edu	37	11	45975137	45975137	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:45975137C>T	ENST00000418153.2	-	10	1232	c.1033G>A	c.(1033-1035)Gag>Aag	p.E345K	PHF21A_ENST00000527753.1_5'UTR|PHF21A_ENST00000323180.6_Missense_Mutation_p.E346K|PHF21A_ENST00000257821.4_Missense_Mutation_p.E346K			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	345					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E346K(1)|p.E345K(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						GTGCGGCTCTCTGTTTGTTTC	0.418																																																	2	Substitution - Missense(2)	cervix(2)											150.0	134.0	139.0					11																	45975137		2202	4299	6501	SO:0001583	missense	51317			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.1033G>A	11.37:g.45975137C>T	ENSP00000398824:p.Glu345Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E346K	ENST00000418153.2	37	c.1036	CCDS44578.1	11	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189559	0.78789	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153	T;T;T	0.59638	0.25;0.25;0.25	5.93	5.93	0.95920	.	0.449206	0.26314	N	0.025093	T	0.73297	0.3569	M	0.66939	2.045	0.54753	D	0.999988	B;B;D	0.56035	0.105;0.009;0.974	B;B;D	0.70487	0.023;0.015;0.969	T	0.64592	-0.6371	10	0.10377	T	0.69	-11.1215	20.3495	0.98807	0.0:1.0:0.0:0.0	.	345;346;346	Q96BD5;Q96BD5-2;Q96BD5-3	PF21A_HUMAN;.;.	K	346;346;345	ENSP00000257821:E346K;ENSP00000323152:E346K;ENSP00000398824:E345K	ENSP00000257821:E346K	E	-	1	0	PHF21A	45931713	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.284000	0.65627	2.814000	0.96858	0.591000	0.81541	GAG	PHF21A	-	NULL		0.418	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF21A	HGNC	protein_coding	OTTHUMT00000392583.1	C	NM_016621		45975137	-1	no_errors	ENST00000257821	ensembl	human	known	70_37	missense	SNP	1.000	T
PHF21A	51317	genome.wustl.edu	37	11	45975137	45975137	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:45975137C>T	ENST00000418153.2	-	10	1232	c.1033G>A	c.(1033-1035)Gag>Aag	p.E345K	PHF21A_ENST00000527753.1_5'UTR|PHF21A_ENST00000323180.6_Missense_Mutation_p.E346K|PHF21A_ENST00000257821.4_Missense_Mutation_p.E346K			Q96BD5	PF21A_HUMAN	PHD finger protein 21A	345					blood coagulation (GO:0007596)|chromatin modification (GO:0016568)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription, DNA-templated (GO:0006355)|suckling behavior (GO:0001967)|transcription, DNA-templated (GO:0006351)	histone deacetylase complex (GO:0000118)|nucleoplasm (GO:0005654)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.E346K(1)|p.E345K(1)		central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(10)|lung(9)|skin(2)|upper_aerodigestive_tract(2)	29						GTGCGGCTCTCTGTTTGTTTC	0.418																																																	2	Substitution - Missense(2)	cervix(2)											150.0	134.0	139.0					11																	45975137		2202	4299	6501	SO:0001583	missense	51317			AL359593	CCDS31474.1, CCDS44578.1	11p11.2	2013-01-28			ENSG00000135365	ENSG00000135365		"""Zinc fingers, PHD-type"""	24156	protein-coding gene	gene with protein product		608325				11214970, 12032298	Standard	NM_001101802		Approved	BHC80, KIAA1696, BM-006	uc001ncc.4	Q96BD5	OTTHUMG00000167038	ENST00000418153.2:c.1033G>A	11.37:g.45975137C>T	ENSP00000398824:p.Glu345Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQP5|Q6AWA2|Q9C0G7|Q9H8V9|Q9HAK6|Q9NZE9	Missense_Mutation	SNP	pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.E346K	ENST00000418153.2	37	c.1036	CCDS44578.1	11	.	.	.	.	.	.	.	.	.	.	C	21.7	4.189559	0.78789	.	.	ENSG00000135365	ENST00000257821;ENST00000323180;ENST00000418153	T;T;T	0.59638	0.25;0.25;0.25	5.93	5.93	0.95920	.	0.449206	0.26314	N	0.025093	T	0.73297	0.3569	M	0.66939	2.045	0.54753	D	0.999988	B;B;D	0.56035	0.105;0.009;0.974	B;B;D	0.70487	0.023;0.015;0.969	T	0.64592	-0.6371	10	0.10377	T	0.69	-11.1215	20.3495	0.98807	0.0:1.0:0.0:0.0	.	345;346;346	Q96BD5;Q96BD5-2;Q96BD5-3	PF21A_HUMAN;.;.	K	346;346;345	ENSP00000257821:E346K;ENSP00000323152:E346K;ENSP00000398824:E345K	ENSP00000257821:E346K	E	-	1	0	PHF21A	45931713	1.000000	0.71417	1.000000	0.80357	0.957000	0.61999	5.284000	0.65627	2.814000	0.96858	0.591000	0.81541	GAG	PHF21A	-	NULL		0.418	PHF21A-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	PHF21A	HGNC	protein_coding	OTTHUMT00000392583.1	C	NM_016621		45975137	-1	no_errors	ENST00000257821	ensembl	human	known	70_37	missense	SNP	1.000	T
PLOD1	5351	genome.wustl.edu	37	1	12032267	12032268	+	Intron	DEL	CT	CT	-	rs374572593|rs397836640|rs3047221|rs539999558|rs200355479	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	CT	CT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:12032267_12032268delCT	ENST00000196061.4	+	18	1929				PLOD1_ENST00000376369.3_Intron	NM_000302.3	NP_000293.2	Q02809	PLOD1_HUMAN	procollagen-lysine, 2-oxoglutarate 5-dioxygenase 1						cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|extracellular matrix organization (GO:0030198)|hydroxylysine biosynthetic process (GO:0046947)|oxidation-reduction process (GO:0055114)|response to hypoxia (GO:0001666)	endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)	iron ion binding (GO:0005506)|L-ascorbic acid binding (GO:0031418)|procollagen-lysine 5-dioxygenase activity (GO:0008475)|protein homodimerization activity (GO:0042803)			breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(5)|lung(15)|ovary(3)|prostate(1)|upper_aerodigestive_tract(1)	29	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.06e-06)|COAD - Colon adenocarcinoma(227;0.000273)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000809)|KIRC - Kidney renal clear cell carcinoma(229;0.00267)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)	Succinic acid(DB00139)|Vitamin C(DB00126)	tccttccttcctctctctctct	0.455														1849	0.369209	0.3094	0.3357	5008	,	,		20242	0.4306		0.334	False		,,,				2504	0.4468																0																																										SO:0001627	intron_variant	5351			BC016657	CCDS142.1	1p36.22	2011-08-25	2011-08-24	2004-12-14	ENSG00000083444	ENSG00000083444	1.14.11.4		9081	protein-coding gene	gene with protein product	"""lysyl hydroxlase 1"""	153454	"""procollagen-lysine 1, 2-oxoglutarate 5-dioxygenase (lysine hydroxylase, Ehlers-Danlos syndrome type VI)"""	LLH, PLOD		1577494	Standard	NM_000302		Approved	LH1	uc001atm.3	Q02809	OTTHUMG00000002393	ENST00000196061.4:c.1903-661CT>-	1.37:g.12032277_12032278delCT		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR87|Q96AV9|Q9H132	RNA	DEL	-	NULL	ENST00000196061.4	37	NULL	CCDS142.1	1																																																																																			PLOD1	-	-		0.455	PLOD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PLOD1	HGNC	protein_coding	OTTHUMT00000006865.1	CT	NM_000302		12032268	+1	no_errors	ENST00000481933	ensembl	human	known	70_37	rna	DEL	0.005:0.004	-
PNPLA6	10908	genome.wustl.edu	37	19	7626141	7626141	+	Missense_Mutation	SNP	G	G	A	rs144558473		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:7626141G>A	ENST00000221249.6	+	34	4278	c.3847G>A	c.(3847-3849)Gac>Aac	p.D1283N	PNPLA6_ENST00000545201.2_Missense_Mutation_p.D1256N|PNPLA6_ENST00000450331.3_Missense_Mutation_p.D1283N|PNPLA6_ENST00000414982.3_Missense_Mutation_p.D1331N|PNPLA6_ENST00000600737.1_Missense_Mutation_p.D1321N	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1322					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CGCCGGACCCGACTGCTCGAG	0.657																																																	0								G	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	20.0	25.0	23.0		3991,3766,3847,3961,3847	3.5	0.9	19	dbSNP_134	23	1,8597		0,1,4298	no	missense,missense,missense,missense,missense	PNPLA6	NM_001166111.1,NM_001166112.1,NM_001166113.1,NM_001166114.1,NM_006702.4	23,23,23,23,23	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	1331/1376,1256/1301,1283/1328,1321/1366,1283/1328	7626141	1,13003	2203	4299	6502	SO:0001583	missense	10908			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3847G>A	19.37:g.7626141G>A	ENSP00000221249:p.Asp1283Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.D1331N	ENST00000221249.6	37	c.3991	CCDS32891.1	19	.	.	.	.	.	.	.	.	.	.	g	14.80	2.644589	0.47258	0.0	1.16E-4	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.05717	3.44;3.49;3.4;3.44	4.55	3.46	0.39613	.	0.303789	0.26470	U	0.024200	T	0.12732	0.0309	L	0.58101	1.795	0.44523	D	0.997474	D;D;D;P	0.59357	0.969;0.985;0.982;0.824	B;P;P;B	0.54499	0.372;0.754;0.576;0.391	T	0.08597	-1.0714	10	0.21540	T	0.41	-18.6081	11.7662	0.51933	0.0:0.0:0.8243:0.1757	.	1322;1256;1321;1283	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	N	1283;1256;1331;1283	ENSP00000221249:D1283N;ENSP00000443323:D1256N;ENSP00000407509:D1331N;ENSP00000394348:D1283N	ENSP00000221249:D1283N	D	+	1	0	PNPLA6	7532141	1.000000	0.71417	0.874000	0.34290	0.020000	0.10135	6.522000	0.73783	2.363000	0.80096	0.561000	0.74099	GAC	PNPLA6	-	NULL		0.657	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000459275.1	G	NM_006702		7626141	+1	no_errors	ENST00000414982	ensembl	human	known	70_37	missense	SNP	0.985	A
PNPLA6	10908	genome.wustl.edu	37	19	7626141	7626141	+	Missense_Mutation	SNP	G	G	A	rs144558473		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:7626141G>A	ENST00000221249.6	+	34	4278	c.3847G>A	c.(3847-3849)Gac>Aac	p.D1283N	PNPLA6_ENST00000545201.2_Missense_Mutation_p.D1256N|PNPLA6_ENST00000450331.3_Missense_Mutation_p.D1283N|PNPLA6_ENST00000414982.3_Missense_Mutation_p.D1331N|PNPLA6_ENST00000600737.1_Missense_Mutation_p.D1321N	NM_006702.4	NP_006693.3	Q8IY17	PLPL6_HUMAN	patatin-like phospholipase domain containing 6	1322					angiogenesis (GO:0001525)|cell death (GO:0008219)|lipid catabolic process (GO:0016042)|organ morphogenesis (GO:0009887)|phosphatidylcholine metabolic process (GO:0046470)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(6)|lung(14)|ovary(3)|stomach(1)|upper_aerodigestive_tract(1)	35						CGCCGGACCCGACTGCTCGAG	0.657																																																	0								G	ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP,ASN/ASP	0,4406		0,0,2203	20.0	25.0	23.0		3991,3766,3847,3961,3847	3.5	0.9	19	dbSNP_134	23	1,8597		0,1,4298	no	missense,missense,missense,missense,missense	PNPLA6	NM_001166111.1,NM_001166112.1,NM_001166113.1,NM_001166114.1,NM_006702.4	23,23,23,23,23	0,1,6501	AA,AG,GG		0.0116,0.0,0.0077	benign,benign,benign,benign,benign	1331/1376,1256/1301,1283/1328,1321/1366,1283/1328	7626141	1,13003	2203	4299	6502	SO:0001583	missense	10908			AJ004832	CCDS32891.1, CCDS54206.1, CCDS54207.1, CCDS59343.1	19p13.2	2013-09-11						"""Patatin-like phospholipase domain containing"""	16268	protein-coding gene	gene with protein product	"""neuropathy target esterase"""	603197				9576844, 16799181, 19029121	Standard	NM_006702		Approved	NTE, sws, iPLA2delta, SPG39	uc010xjq.2	Q8IY17		ENST00000221249.6:c.3847G>A	19.37:g.7626141G>A	ENSP00000221249:p.Asp1283Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGQ0|B4DFB9|B7Z7T2|F5H5K9|J3KQS3|O60859|Q86W58|Q9UG58	Missense_Mutation	SNP	pfam_cNMP-bd_dom,pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom	p.D1331N	ENST00000221249.6	37	c.3991	CCDS32891.1	19	.	.	.	.	.	.	.	.	.	.	g	14.80	2.644589	0.47258	0.0	1.16E-4	ENSG00000032444	ENST00000221249;ENST00000545201;ENST00000414982;ENST00000450331	T;T;T;T	0.05717	3.44;3.49;3.4;3.44	4.55	3.46	0.39613	.	0.303789	0.26470	U	0.024200	T	0.12732	0.0309	L	0.58101	1.795	0.44523	D	0.997474	D;D;D;P	0.59357	0.969;0.985;0.982;0.824	B;P;P;B	0.54499	0.372;0.754;0.576;0.391	T	0.08597	-1.0714	10	0.21540	T	0.41	-18.6081	11.7662	0.51933	0.0:0.0:0.8243:0.1757	.	1322;1256;1321;1283	Q8IY17;F5H5K9;Q8IY17-3;Q8IY17-2	PLPL6_HUMAN;.;.;.	N	1283;1256;1331;1283	ENSP00000221249:D1283N;ENSP00000443323:D1256N;ENSP00000407509:D1331N;ENSP00000394348:D1283N	ENSP00000221249:D1283N	D	+	1	0	PNPLA6	7532141	1.000000	0.71417	0.874000	0.34290	0.020000	0.10135	6.522000	0.73783	2.363000	0.80096	0.561000	0.74099	GAC	PNPLA6	-	NULL		0.657	PNPLA6-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	PNPLA6	HGNC	protein_coding	OTTHUMT00000459275.1	G	NM_006702		7626141	+1	no_errors	ENST00000414982	ensembl	human	known	70_37	missense	SNP	0.985	A
POLR1A	25885	genome.wustl.edu	37	2	86259429	86259429	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:86259429G>C	ENST00000263857.6	-	29	4616	c.4238C>G	c.(4237-4239)tCt>tGt	p.S1413C	POLR1A_ENST00000409681.1_Missense_Mutation_p.S1413C			O95602	RPA1_HUMAN	polymerase (RNA) I polypeptide A, 194kDa	1413					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|zinc ion binding (GO:0008270)	p.S1413C(1)		NS(1)|breast(4)|cervix(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(20)|ovary(3)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	63						TTTGGCATCAGAGGCATCGGC	0.597																																																	1	Substitution - Missense(1)	cervix(1)											159.0	173.0	168.0					2																	86259429		2124	4227	6351	SO:0001583	missense	25885			AK025568	CCDS42706.1	2p11.2	2013-01-21			ENSG00000068654	ENSG00000068654		"""RNA polymerase subunits"""	17264	protein-coding gene	gene with protein product						9236775	Standard	NM_015425		Approved	DKFZP586M0122, FLJ21915, RPO1-4, RPA1	uc002sqs.3	O95602	OTTHUMG00000153165	ENST00000263857.6:c.4238C>G	2.37:g.86259429G>C	ENSP00000263857:p.Ser1413Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7T0|D6W5M0|Q0VG05|Q9UEH0|Q9UFT9	Missense_Mutation	SNP	pfam_RNA_pol_Rpb1_5,pfam_RNA_pol_asu,pfam_RNA_pol_Rpb1_3,pfam_RNA_pol_Rpb1_4,pfam_RNA_pol_Rpb1_1,smart_RNA_pol_N	p.S1413C	ENST00000263857.6	37	c.4238	CCDS42706.1	2	.	.	.	.	.	.	.	.	.	.	G	17.62	3.435001	0.62955	.	.	ENSG00000068654	ENST00000263857;ENST00000409681	T;T	0.68479	-0.33;-0.33	4.94	4.94	0.65067	RNA polymerase Rpb1, domain 5 (1);	0.364495	0.30392	N	0.009735	T	0.77718	0.4172	L	0.60455	1.87	0.49130	D	0.999754	D	0.69078	0.997	P	0.60173	0.87	T	0.79820	-0.1642	10	0.72032	D	0.01	-14.6938	19.0512	0.93046	0.0:0.0:1.0:0.0	.	1413	O95602	RPA1_HUMAN	C	1413	ENSP00000263857:S1413C;ENSP00000386300:S1413C	ENSP00000263857:S1413C	S	-	2	0	POLR1A	86112940	1.000000	0.71417	0.967000	0.41034	0.748000	0.42578	8.683000	0.91236	2.677000	0.91161	0.462000	0.41574	TCT	POLR1A	-	pfam_RNA_pol_Rpb1_5		0.597	POLR1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1A	HGNC	protein_coding	OTTHUMT00000329830.2	G	NM_015425		86259429	-1	no_errors	ENST00000263857	ensembl	human	known	70_37	missense	SNP	0.988	C
UBE2D4	51619	genome.wustl.edu	37	7	43982844	43982844	+	Intron	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:43982844C>T	ENST00000222402.3	+	4	287				UBE2D4_ENST00000394798.4_Intron|POLR2J4_ENST00000427076.1_RNA|UBE2D4_ENST00000446008.1_Intron	NM_015983.3	NP_057067.1	Q9Y2X8	UB2D4_HUMAN	ubiquitin-conjugating enzyme E2D 4 (putative)						protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)	5						TGAGCTGGTGCTGGCCTTACT	0.527																																					Esophageal Squamous(27;401 815 16344 30604)												0																																										SO:0001627	intron_variant	84820			BC004104	CCDS5474.1	7p13	2005-08-11			ENSG00000078967	ENSG00000078967		"""Ubiquitin-conjugating enzymes E2"""	21647	protein-coding gene	gene with protein product						12690205	Standard	NM_015983		Approved	HBUCE1	uc003tja.2	Q9Y2X8	OTTHUMG00000128971	ENST00000222402.3:c.198+214C>T	7.37:g.43982844C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1V0	RNA	SNP	-	NULL	ENST00000222402.3	37	NULL	CCDS5474.1	7																																																																																			POLR2J4	-	-		0.527	UBE2D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2J4	HGNC	protein_coding	OTTHUMT00000250958.2	C	NM_015983		43982844	-1	no_errors	ENST00000427076	ensembl	human	known	70_37	rna	SNP	0.029	T
UBE2D4	51619	genome.wustl.edu	37	7	43991565	43991565	+	Intron	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:43991565A>G	ENST00000222402.3	+	7	487				UBE2D4_ENST00000394798.4_Intron|POLR2J4_ENST00000427076.1_RNA|RP5-1165K10.2_ENST00000454572.1_RNA	NM_015983.3	NP_057067.1	Q9Y2X8	UB2D4_HUMAN	ubiquitin-conjugating enzyme E2D 4 (putative)						protein K11-linked ubiquitination (GO:0070979)|protein K27-linked ubiquitination (GO:0044314)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K6-linked ubiquitination (GO:0085020)|protein K63-linked ubiquitination (GO:0070534)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)			endometrium(1)|large_intestine(2)|lung(1)|pancreas(1)	5						TTTTAGACATACCAAAAGTGA	0.289																																					Esophageal Squamous(27;401 815 16344 30604)												0																																										SO:0001627	intron_variant	84820			BC004104	CCDS5474.1	7p13	2005-08-11			ENSG00000078967	ENSG00000078967		"""Ubiquitin-conjugating enzymes E2"""	21647	protein-coding gene	gene with protein product						12690205	Standard	NM_015983		Approved	HBUCE1	uc003tja.2	Q9Y2X8	OTTHUMG00000128971	ENST00000222402.3:c.399-684A>G	7.37:g.43991565A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1V0	RNA	SNP	-	NULL	ENST00000222402.3	37	NULL	CCDS5474.1	7																																																																																			POLR2J4	-	-		0.289	UBE2D4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR2J4	HGNC	protein_coding	OTTHUMT00000250958.2	A	NM_015983		43991565	-1	no_errors	ENST00000454572	ensembl	human	known	70_37	rna	SNP	0.005	G
PRKDC	5591	genome.wustl.edu	37	8	48685753	48685754	+	5'UTR	INS	-	-	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:48685753_48685754insA	ENST00000523565.1	-	0	13422_13423				PRKDC_ENST00000338368.3_3'UTR|PRKDC_ENST00000314191.2_3'UTR			P78527	PRKDC_HUMAN	protein kinase, DNA-activated, catalytic polypeptide						B cell lineage commitment (GO:0002326)|brain development (GO:0007420)|cellular protein modification process (GO:0006464)|cellular response to insulin stimulus (GO:0032869)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|ectopic germ cell programmed cell death (GO:0035234)|heart development (GO:0007507)|immunoglobulin V(D)J recombination (GO:0033152)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|negative regulation of protein phosphorylation (GO:0001933)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of apoptotic process (GO:0043065)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|pro-B cell differentiation (GO:0002328)|protein destabilization (GO:0031648)|regulation of circadian rhythm (GO:0042752)|response to gamma radiation (GO:0010332)|rhythmic process (GO:0048511)|signal transduction involved in mitotic G1 DNA damage checkpoint (GO:0072431)|somitogenesis (GO:0001756)|T cell differentiation in thymus (GO:0033077)|T cell lineage commitment (GO:0002360)|T cell receptor V(D)J recombination (GO:0033153)|telomere maintenance (GO:0000723)	cytosol (GO:0005829)|DNA-dependent protein kinase-DNA ligase 4 complex (GO:0005958)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA-dependent protein kinase activity (GO:0004677)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|transcription factor binding (GO:0008134)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(9)|cervix(3)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(30)|lung(56)|ovary(6)|pancreas(1)|prostate(8)|skin(7)	147		all_cancers(86;0.0336)|all_epithelial(80;0.00111)|Lung NSC(129;0.00363)|all_lung(136;0.00391)			Caffeine(DB00201)	GTGTTAGAAGGAAAAAAAAAAA	0.396								Non-homologous end-joining																													Esophageal Squamous(79;1091 1253 12329 31680 40677)												0																																										SO:0001623	5_prime_UTR_variant	5591				CCDS75734.1, CCDS75735.1	8q11	2014-09-17				ENSG00000253729	2.7.11.1		9413	protein-coding gene	gene with protein product		600899		HYRC, HYRC1		7638222	Standard	NM_001081640		Approved	DNPK1, p350, DNAPK, XRCC7, DNA-PKcs	uc003xqi.3	P78527		ENST00000523565.1:c.-86->T	8.37:g.48685764_48685764dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	P78528|Q13327|Q13337|Q14175|Q59H99|Q7Z611|Q96SE6|Q9UME3	RNA	INS	-	NULL	ENST00000523565.1	37	NULL		8																																																																																			PRKDC	-	-		0.396	PRKDC-002	KNOWN	basic	processed_transcript	PRKDC	HGNC	protein_coding	OTTHUMT00000377896.1	-	NM_001081640		48685754	-1	no_errors	ENST00000523565	ensembl	human	known	70_37	rna	INS	0.001:0.001	A
PROB1	389333	genome.wustl.edu	37	5	138728516	138728516	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr5:138728516C>T	ENST00000434752.2	-	1	2369	c.2255G>A	c.(2254-2256)cGa>cAa	p.R752Q	MZB1_ENST00000457570.2_5'Flank|MZB1_ENST00000302125.8_5'Flank|MZB1_ENST00000412103.2_5'Flank	NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	752	Pro-rich.																GCCGCGCGCTCGCACTCGCGA	0.711																																																	0													8.0	13.0	12.0					5																	138728516		689	1576	2265	SO:0001583	missense	389333			AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.2255G>A	5.37:g.138728516C>T	ENSP00000416033:p.Arg752Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E007	Missense_Mutation	SNP	NULL	p.R752Q	ENST00000434752.2	37	c.2255	CCDS54909.1	5	.	.	.	.	.	.	.	.	.	.	C	4.968	0.179779	0.09443	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.07	-7.99	0.01131	.	.	.	.	.	T	0.11153	0.0272	N	0.08118	0	0.09310	N	1	B	0.19935	0.04	B	0.15870	0.014	T	0.22941	-1.0202	8	0.12766	T	0.61	2.2119	1.4276	0.02326	0.1323:0.246:0.3223:0.2994	.	752	E7EW31	CE065_HUMAN	Q	752	.	ENSP00000416033:R752Q	R	-	2	0	AC135457.1	138756415	0.000000	0.05858	0.000000	0.03702	0.018000	0.09664	-1.509000	0.02264	-1.827000	0.01204	0.561000	0.74099	CGA	PROB1	-	NULL		0.711	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROB1	HGNC	protein_coding	OTTHUMT00000470735.1	C	NM_001161546		138728516	-1	no_errors	ENST00000434752	ensembl	human	known	70_37	missense	SNP	0.000	T
PTP4A2	8073	genome.wustl.edu	37	1	32384717	32384717	+	5'UTR	DEL	A	A	-	rs532230753|rs370536901	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:32384717delA	ENST00000602725.1	-	0	367				PTP4A2_ENST00000470404.1_5'UTR|PTP4A2_ENST00000356536.3_5'UTR|PTP4A2_ENST00000526960.1_5'Flank|PTP4A2_ENST00000344035.6_5'UTR|RP11-84A19.4_ENST00000602889.1_lincRNA|PTP4A2_ENST00000457805.2_5'UTR			Q12974	TP4A2_HUMAN	protein tyrosine phosphatase type IVA, member 2						peptidyl-tyrosine dephosphorylation (GO:0035335)	cytoplasm (GO:0005737)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)	prenylated protein tyrosine phosphatase activity (GO:0004727)			kidney(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)				GGGGAAAGTGAAAAAAAAAAA	0.368													|||unknown(HR)	282	0.0563099	0.1762	0.013	5008	,	,		21482	0.0079		0.0139	False		,,,				2504	0.0184																0													35.0	38.0	37.0					1																	32384717		2203	4300	6503	SO:0001623	5_prime_UTR_variant	8073			L48723	CCDS348.1, CCDS53292.1, CCDS59193.1	1p35	2011-06-09			ENSG00000184007	ENSG00000184007		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PRLs"""	9635	protein-coding gene	gene with protein product		601584		PTP4A		8661118, 9514946	Standard	NM_080391		Approved	HU-PP-1, PTPCAAX2, OV-1, ptp-IV1a, PRL-2	uc001bty.2	Q12974	OTTHUMG00000003801	ENST00000602725.1:c.-51T>-	1.37:g.32384717delA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9I8|B4DM39|D3DPP0|E9PGJ6|O00649|Q15197|Q15259|Q15260|Q15261|R4GN50	RNA	DEL	-	NULL	ENST00000602725.1	37	NULL	CCDS348.1	1																																																																																			PTP4A2	-	-		0.368	PTP4A2-019	KNOWN	basic|appris_principal|CCDS	protein_coding	PTP4A2	HGNC	protein_coding	OTTHUMT00000468092.1	A	NM_080391		32384717	-1	no_errors	ENST00000532289	ensembl	human	putative	70_37	rna	DEL	0.000	-
RAD54L2	23132	genome.wustl.edu	37	3	51697389	51697389	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:51697389G>A	ENST00000409535.2	+	22	4482	c.4357G>A	c.(4357-4359)Gat>Aat	p.D1453N	RAD54L2_ENST00000296477.3_Missense_Mutation_p.D1147N	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1453						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)	p.D1453N(1)		NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CAGCTCCAATGATGATGAGGA	0.577																																																	1	Substitution - Missense(1)	cervix(1)											48.0	47.0	47.0					3																	51697389		2203	4300	6503	SO:0001583	missense	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.4357G>A	3.37:g.51697389G>A	ENSP00000386520:p.Asp1453Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB57|Q9BV54	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D1453N	ENST00000409535.2	37	c.4357	CCDS33765.2	3	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956038	0.34471	.	.	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.94092	-3.25;-3.35	5.56	5.56	0.83823	.	0.268401	0.33712	N	0.004624	D	0.86297	0.5899	N	0.08118	0	0.80722	D	1	B;B	0.16166	0.004;0.016	B;B	0.13407	0.007;0.009	T	0.81475	-0.0916	10	0.38643	T	0.18	-3.9597	17.0337	0.86468	0.0:0.0:1.0:0.0	.	1453;1042	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	N	1453;1147	ENSP00000386520:D1453N;ENSP00000296477:D1147N	ENSP00000296477:D1147N	D	+	1	0	RAD54L2	51672429	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.380000	0.66202	2.609000	0.88269	0.655000	0.94253	GAT	RAD54L2	-	NULL		0.577	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	G	NM_015106		51697389	+1	no_errors	ENST00000409535	ensembl	human	known	70_37	missense	SNP	1.000	A
RAD54L2	23132	genome.wustl.edu	37	3	51697389	51697389	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:51697389G>A	ENST00000409535.2	+	22	4482	c.4357G>A	c.(4357-4359)Gat>Aat	p.D1453N	RAD54L2_ENST00000296477.3_Missense_Mutation_p.D1147N	NM_015106.2	NP_055921.2	Q9Y4B4	ARIP4_HUMAN	RAD54-like 2 (S. cerevisiae)	1453						nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|transcription cofactor activity (GO:0003712)	p.D1453N(1)		NS(2)|breast(1)|cervix(2)|endometrium(4)|large_intestine(5)|liver(2)|lung(9)|ovary(4)|skin(2)	31				BRCA - Breast invasive adenocarcinoma(193;0.000102)|Kidney(197;0.000758)|KIRC - Kidney renal clear cell carcinoma(197;0.000896)		CAGCTCCAATGATGATGAGGA	0.577																																																	1	Substitution - Missense(1)	cervix(1)											48.0	47.0	47.0					3																	51697389		2203	4300	6503	SO:0001583	missense	23132			AB018352	CCDS33765.2	3p21.2	2006-01-17			ENSG00000164080	ENSG00000164080			29123	protein-coding gene	gene with protein product						9872452	Standard	NM_015106		Approved	KIAA0809, SRISNF2L	uc011bdt.2	Q9Y4B4	OTTHUMG00000152936	ENST00000409535.2:c.4357G>A	3.37:g.51697389G>A	ENSP00000386520:p.Asp1453Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TB57|Q9BV54	Missense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D1453N	ENST00000409535.2	37	c.4357	CCDS33765.2	3	.	.	.	.	.	.	.	.	.	.	G	12.50	1.956038	0.34471	.	.	ENSG00000164080	ENST00000409535;ENST00000296477	D;D	0.94092	-3.25;-3.35	5.56	5.56	0.83823	.	0.268401	0.33712	N	0.004624	D	0.86297	0.5899	N	0.08118	0	0.80722	D	1	B;B	0.16166	0.004;0.016	B;B	0.13407	0.007;0.009	T	0.81475	-0.0916	10	0.38643	T	0.18	-3.9597	17.0337	0.86468	0.0:0.0:1.0:0.0	.	1453;1042	Q9Y4B4;B3KV54	ARIP4_HUMAN;.	N	1453;1147	ENSP00000386520:D1453N;ENSP00000296477:D1147N	ENSP00000296477:D1147N	D	+	1	0	RAD54L2	51672429	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	5.380000	0.66202	2.609000	0.88269	0.655000	0.94253	GAT	RAD54L2	-	NULL		0.577	RAD54L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD54L2	HGNC	protein_coding	OTTHUMT00000328700.2	G	NM_015106		51697389	+1	no_errors	ENST00000409535	ensembl	human	known	70_37	missense	SNP	1.000	A
RELN	5649	genome.wustl.edu	37	7	103193976	103193976	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:103193976C>T	ENST00000428762.1	-	40	6163	c.6004G>A	c.(6004-6006)Gaa>Aaa	p.E2002K	RELN_ENST00000424685.2_Missense_Mutation_p.E2002K|RELN_ENST00000343529.5_Missense_Mutation_p.E2002K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2002					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.E2002K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCACCAACTTCATTTGAAACA	0.363																																					NSCLC(146;835 1944 15585 22231 52158)												1	Substitution - Missense(1)	cervix(1)											117.0	106.0	110.0					7																	103193976		2203	4300	6503	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6004G>A	7.37:g.103193976C>T	ENSP00000392423:p.Glu2002Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.E2002K	ENST00000428762.1	37	c.6004	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.264760	0.95399	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.27720	1.65;1.65;1.65	5.63	5.63	0.86233	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.48624	0.1510	L	0.53249	1.67	0.80722	D	1	P;D	0.60575	0.941;0.988	P;P	0.56751	0.754;0.805	T	0.38993	-0.9635	10	0.59425	D	0.04	.	20.0401	0.97581	0.0:1.0:0.0:0.0	.	2002;2002	P78509-2;P78509	.;RELN_HUMAN	K	2002	ENSP00000392423:E2002K;ENSP00000345694:E2002K;ENSP00000388446:E2002K	ENSP00000345694:E2002K	E	-	1	0	RELN	102981212	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.445000	0.80570	2.805000	0.96524	0.655000	0.94253	GAA	RELN	-	superfamily_Neuraminidase		0.363	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	C	NM_005045		103193976	-1	no_errors	ENST00000424685	ensembl	human	known	70_37	missense	SNP	1.000	T
RELN	5649	genome.wustl.edu	37	7	103193976	103193976	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:103193976C>T	ENST00000428762.1	-	40	6163	c.6004G>A	c.(6004-6006)Gaa>Aaa	p.E2002K	RELN_ENST00000424685.2_Missense_Mutation_p.E2002K|RELN_ENST00000343529.5_Missense_Mutation_p.E2002K	NM_005045.3	NP_005036.2	P78509	RELN_HUMAN	reelin	2002					associative learning (GO:0008306)|axon guidance (GO:0007411)|brain development (GO:0007420)|cell adhesion (GO:0007155)|cell morphogenesis involved in differentiation (GO:0000904)|central nervous system development (GO:0007417)|cerebral cortex tangential migration (GO:0021800)|dendrite development (GO:0016358)|glial cell differentiation (GO:0010001)|hippocampus development (GO:0021766)|lateral motor column neuron migration (GO:0097477)|layer formation in cerebral cortex (GO:0021819)|long-term memory (GO:0007616)|N-methyl-D-aspartate receptor clustering (GO:0097114)|neuron migration (GO:0001764)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of dendritic spine morphogenesis (GO:0061003)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of lateral motor column neuron migration (GO:1902078)|positive regulation of long-term synaptic potentiation (GO:1900273)|positive regulation of neuron projection development (GO:0010976)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase activity (GO:0045860)|positive regulation of protein tyrosine kinase activity (GO:0061098)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|positive regulation of synapse maturation (GO:0090129)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|positive regulation of TOR signaling (GO:0032008)|postsynaptic density protein 95 clustering (GO:0097119)|receptor localization to synapse (GO:0097120)|reelin-mediated signaling pathway (GO:0038026)|regulation of behavior (GO:0050795)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of synaptic transmission (GO:0050804)|response to pain (GO:0048265)|spinal cord patterning (GO:0021511)|ventral spinal cord development (GO:0021517)	cytoplasm (GO:0005737)|dendrite (GO:0030425)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	lipoprotein particle receptor binding (GO:0070325)|metal ion binding (GO:0046872)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|serine-type peptidase activity (GO:0008236)|very-low-density lipoprotein particle receptor binding (GO:0070326)	p.E2002K(1)		NS(3)|breast(8)|central_nervous_system(3)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(4)|kidney(6)|large_intestine(43)|lung(101)|ovary(9)|pancreas(2)|prostate(4)|skin(14)|stomach(2)|upper_aerodigestive_tract(12)|urinary_tract(2)	227				COAD - Colon adenocarcinoma(1;8.98e-05)|Colorectal(1;0.00184)		TCACCAACTTCATTTGAAACA	0.363																																					NSCLC(146;835 1944 15585 22231 52158)												1	Substitution - Missense(1)	cervix(1)											117.0	106.0	110.0					7																	103193976		2203	4300	6503	SO:0001583	missense	5649				CCDS34722.1, CCDS47680.1	7q22	2008-07-18			ENSG00000189056	ENSG00000189056			9957	protein-coding gene	gene with protein product		600514				9049633	Standard	NM_005045		Approved	RL, PRO1598	uc010liz.3	P78509	OTTHUMG00000157247	ENST00000428762.1:c.6004G>A	7.37:g.103193976C>T	ENSP00000392423:p.Glu2002Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0P9|A4D0Q0|Q86UJ0|Q86UJ8|Q8NDV0|Q9UDQ2	Missense_Mutation	SNP	pfam_EGF_extracell,pfam_Reeler_dom,pfam_BNR_rpt,superfamily_Neuraminidase,superfamily_Growth_fac_rcpt,smart_EG-like_dom,pfscan_EG-like_dom,pfscan_Reeler_dom	p.E2002K	ENST00000428762.1	37	c.6004	CCDS47680.1	7	.	.	.	.	.	.	.	.	.	.	C	33	5.264760	0.95399	.	.	ENSG00000189056	ENST00000428762;ENST00000343529;ENST00000424685;ENST00000448171	T;T;T	0.27720	1.65;1.65;1.65	5.63	5.63	0.86233	Neuraminidase (1);	0.000000	0.85682	D	0.000000	T	0.48624	0.1510	L	0.53249	1.67	0.80722	D	1	P;D	0.60575	0.941;0.988	P;P	0.56751	0.754;0.805	T	0.38993	-0.9635	10	0.59425	D	0.04	.	20.0401	0.97581	0.0:1.0:0.0:0.0	.	2002;2002	P78509-2;P78509	.;RELN_HUMAN	K	2002	ENSP00000392423:E2002K;ENSP00000345694:E2002K;ENSP00000388446:E2002K	ENSP00000345694:E2002K	E	-	1	0	RELN	102981212	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	7.445000	0.80570	2.805000	0.96524	0.655000	0.94253	GAA	RELN	-	superfamily_Neuraminidase		0.363	RELN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RELN	HGNC	protein_coding	OTTHUMT00000348148.1	C	NM_005045		103193976	-1	no_errors	ENST00000424685	ensembl	human	known	70_37	missense	SNP	1.000	T
RNF217	154214	genome.wustl.edu	37	6	125284221	125284221	+	Silent	SNP	C	C	T	rs375186638	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:125284221C>T	ENST00000521654.2	+	1	531	c.531C>T	c.(529-531)ccC>ccT	p.P177P	RNF217_ENST00000560949.1_5'UTR|RP11-510H23.1_ENST00000439075.1_RNA			Q8TC41	RN217_HUMAN	ring finger protein 217	177					protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(3)|skin(1)|urinary_tract(1)	11			LUSC - Lung squamous cell carcinoma(4;0.0263)|Lung(4;0.0828)	GBM - Glioblastoma multiforme(226;0.0162)		CCGAGGCCCCCGCCTCGGAGC	0.706													C|||	2	0.000399361	0.0	0.0014	5008	,	,		12566	0.0		0.001	False		,,,				2504	0.0																0								C		0,1706		0,0,853	5.0	5.0	5.0			-0.6	0.0	6		5	8,3876		0,8,1934	no	intergenic				0,8,2787	TT,TC,CC		0.206,0.0,0.1431			125284221	8,5582	853	1942	2795	SO:0001819	synonymous_variant	154214			BC026087	CCDS5129.1, CCDS69191.1	6q22.33	2014-07-15	2007-08-20	2007-08-20	ENSG00000146373	ENSG00000146373		"""RING-type (C3HC4) zinc fingers"""	21487	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 172"", ""IBR domain containing 1"""	C6orf172, IBRDC1			Standard	NM_001286398		Approved	MGC26996, dJ84N20.1	uc003pzs.3	Q8TC41	OTTHUMG00000015504	ENST00000521654.2:c.531C>T	6.37:g.125284221C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	H7C5V4|Q5TCA4|Q9BX48	Silent	SNP	pfam_Znf_C6HC,smart_Znf_C6HC	p.P177	ENST00000521654.2	37	c.531		6																																																																																			RNF217	-	NULL		0.706	RNF217-002	NOVEL	basic|appris_principal	protein_coding	RNF217	HGNC	protein_coding	OTTHUMT00000042063.3	C	NM_152553		125284221	+1	no_errors	ENST00000521654	ensembl	human	novel	70_37	silent	SNP	0.001	T
RPGR	6103	genome.wustl.edu	37	X	38146175	38146175	+	Intron	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chrX:38146175C>G	ENST00000339363.3	-	14	2688				RPGR_ENST00000318842.7_Intron|TM4SF2_ENST00000465127.1_Intron|RPGR_ENST00000309513.3_Intron|RPGR_ENST00000338898.3_Intron|RPGR_ENST00000378505.2_Missense_Mutation_p.E693Q|RPGR_ENST00000342811.3_Intron			Q92834	RPGR_HUMAN	retinitis pigmentosa GTPase regulator						cilium assembly (GO:0042384)|eye photoreceptor cell development (GO:0042462)|intracellular protein transport (GO:0006886)|intraciliary transport (GO:0042073)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	centrosome (GO:0005813)|ciliary basal body (GO:0036064)|Golgi apparatus (GO:0005794)|photoreceptor outer segment (GO:0001750)|sperm flagellum (GO:0036126)	guanyl-nucleotide exchange factor activity (GO:0005085)|poly(A) RNA binding (GO:0044822)	p.E693Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	25						agttccttctctccctctcct	0.522																																																	1	Substitution - Missense(1)	cervix(1)											199.0	146.0	164.0					X																	38146175		2201	4297	6498	SO:0001627	intron_variant	6103			U57629	CCDS14246.1, CCDS35229.1	Xp11.4	2013-06-06	2004-02-13		ENSG00000156313	ENSG00000156313			10295	protein-coding gene	gene with protein product		312610	"""retinitis pigmentosa 15"", ""cone dystrophy 1 (X-linked)"""	CRD, RP3, RP15, COD1		8673101, 8817343	Standard	XM_005272633		Approved	CORDX1	uc004ded.1	Q92834	OTTHUMG00000021361	ENST00000339363.3:c.2520+171G>C	X.37:g.38146175C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B1ARN3|E9PE28|O00702|O00737|Q3KN84|Q8N5T6|Q93039|Q9HD29|Q9UMR1	Missense_Mutation	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.E693Q	ENST00000339363.3	37	c.2077		X	.	.	.	.	.	.	.	.	.	.	c	5.833	0.337961	0.11013	.	.	ENSG00000156313	ENST00000378505	T	0.59502	0.26	2.48	1.54	0.23209	.	1.175510	0.06783	U	0.785563	T	0.48909	0.1526	L	0.49126	1.545	0.24552	N	0.994016	B	0.30281	0.275	B	0.20767	0.031	T	0.29488	-1.0010	10	0.29301	T	0.29	.	9.5959	0.39573	0.0:0.7871:0.2129:0.0	.	693	E9PE28	.	Q	693	ENSP00000367766:E693Q	ENSP00000367766:E693Q	E	-	1	0	RPGR	38031119	0.016000	0.18221	0.038000	0.18304	0.128000	0.20619	0.350000	0.20079	0.258000	0.21686	0.353000	0.21931	GAG	RPGR	-	NULL		0.522	RPGR-203	KNOWN	basic|appris_candidate	protein_coding	RPGR	HGNC	protein_coding		C	NM_000328		38146175	-1	no_errors	ENST00000378505	ensembl	human	known	70_37	missense	SNP	0.440	G
PARP2	10038	genome.wustl.edu	37	14	20811367	20811367	+	5'Flank	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:20811367G>A	ENST00000250416.5	+	0	0				PARP2_ENST00000527915.1_5'Flank|RP11-203M5.2_ENST00000528210.1_RNA|RPPH1_ENST00000554988.1_RNA|PARP2_ENST00000429687.3_5'Flank	NM_001042618.1|NM_005484.3	NP_001036083.1|NP_005475.2	Q9UGN5	PARP2_HUMAN	poly (ADP-ribose) polymerase 2						base-excision repair (GO:0006284)|DNA repair (GO:0006281)|extrinsic apoptotic signaling pathway (GO:0097191)|protein ADP-ribosylation (GO:0006471)	nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|NAD+ ADP-ribosyltransferase activity (GO:0003950)			central_nervous_system(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(1)|pancreas(1)	15	all_cancers(95;0.00092)	all_lung(585;0.235)	Epithelial(56;5.34e-07)|all cancers(55;3.7e-06)	GBM - Glioblastoma multiforme(265;0.00888)|READ - Rectum adenocarcinoma(17;0.0649)		GCCCCTCCCCGAAGGGCGGGG	0.667								Poly(ADP-ribose) polymerase (PARP) enzymes that bind to DNA																																									0																																										SO:0001631	upstream_gene_variant	85495			AF085734	CCDS41910.1, CCDS45077.1	14q11.2-q12	2010-02-16	2008-07-28	2004-08-26	ENSG00000129484	ENSG00000129484		"""Poly (ADP-ribose) polymerases"""	272	protein-coding gene	gene with protein product		607725	"""ADP-ribosyltransferase (NAD+; poly(ADP-ribose) polymerase)-like 2"", ""poly (ADP-ribose) polymerase family, member 2"""	ADPRTL2		10329013, 18353725	Standard	NM_005484		Approved		uc001vxc.3	Q9UGN5	OTTHUMG00000166106		14.37:g.20811367G>A	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TEU4|Q9NUV2|Q9UMR4|Q9Y6C8	RNA	SNP	-	NULL	ENST00000250416.5	37	NULL	CCDS41910.1	14																																																																																			RPPH1	-	-		0.667	PARP2-002	KNOWN	basic|CCDS	protein_coding	RPPH1	HGNC	protein_coding	OTTHUMT00000387847.2	G			20811367	-1	no_errors	ENST00000516869	ensembl	human	known	70_37	rna	SNP	0.000	A
S100A1	6271	genome.wustl.edu	37	1	153604234	153604234	+	Missense_Mutation	SNP	G	G	A	rs375726273		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:153604234G>A	ENST00000292169.1	+	3	315	c.202G>A	c.(202-204)Ggg>Agg	p.G68R	S100A13_ENST00000491177.1_5'Flank|S100A1_ENST00000368698.3_Missense_Mutation_p.G121R|RP1-178F15.4_ENST00000469931.2_RNA|S100A13_ENST00000368699.1_Intron|S100A1_ENST00000368696.3_3'UTR|S100A1_ENST00000469893.1_3'UTR|CHTOP_ENST00000368694.3_5'Flank|RP1-178F15.4_ENST00000607839.1_RNA|CHTOP_ENST00000403433.1_5'Flank|RP1-178F15.5_ENST00000497086.1_RNA	NM_006271.1	NP_006262.1	P23297	S10A1_HUMAN	S100 calcium binding protein A1	68	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|regulation of heart contraction (GO:0008016)|substantia nigra development (GO:0021762)	M band (GO:0031430)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)	p.G68W(1)|p.G68R(1)		breast(1)|cervix(1)|lung(2)	4	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	GAATGGAGACGGGGAGGTGGA	0.542																																					Ovarian(74;601 1703 10548 31787)												2	Substitution - Missense(2)	cervix(1)|lung(1)						G	,ARG/GLY	0,4406		0,0,2203	431.0	399.0	410.0		,202	5.1	1.0	1		410	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	S100A1,S100A13	NM_001024210.1,NM_006271.1	,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,probably-damaging	,68/95	153604234	1,13005	2203	4300	6503	SO:0001583	missense	6271			BC014392	CCDS1047.1	1q21	2013-01-10	2001-11-28		ENSG00000160678	ENSG00000160678		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10486	protein-coding gene	gene with protein product		176940	"""S100 calcium-binding protein A1"""	S100A		1998503	Standard	NM_006271		Approved	S100-alpha	uc001fck.1	P23297	OTTHUMG00000037041	ENST00000292169.1:c.202G>A	1.37:g.153604234G>A	ENSP00000292169:p.Gly68Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5D9|Q5T7Y3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.G121R	ENST00000292169.1	37	c.361	CCDS1047.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.178466	0.94846	0.0	1.16E-4	ENSG00000160678	ENST00000368698;ENST00000292169	T;D	0.90197	1.83;-2.63	5.12	5.12	0.69794	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93035	0.7783	.	.	.	0.80722	D	1	D	0.76494	0.999	P	0.59825	0.864	D	0.92736	0.6204	9	0.51188	T	0.08	.	16.1017	0.81175	0.0:0.0:1.0:0.0	.	68	P23297	S10A1_HUMAN	R	121;68	ENSP00000357687:G121R;ENSP00000292169:G68R	ENSP00000292169:G68R	G	+	1	0	S100A1	151870858	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.072000	0.76777	2.659000	0.90383	0.655000	0.94253	GGG	S100A1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.542	S100A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A1	HGNC	protein_coding	OTTHUMT00000089933.1	G	NM_006271		153604234	+1	no_errors	ENST00000368698	ensembl	human	known	70_37	missense	SNP	1.000	A
S100A1	6271	genome.wustl.edu	37	1	153604234	153604234	+	Missense_Mutation	SNP	G	G	A	rs375726273		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:153604234G>A	ENST00000292169.1	+	3	315	c.202G>A	c.(202-204)Ggg>Agg	p.G68R	S100A13_ENST00000491177.1_5'Flank|S100A1_ENST00000368698.3_Missense_Mutation_p.G121R|RP1-178F15.4_ENST00000469931.2_RNA|S100A13_ENST00000368699.1_Intron|S100A1_ENST00000368696.3_3'UTR|S100A1_ENST00000469893.1_3'UTR|CHTOP_ENST00000368694.3_5'Flank|RP1-178F15.4_ENST00000607839.1_RNA|CHTOP_ENST00000403433.1_5'Flank|RP1-178F15.5_ENST00000497086.1_RNA	NM_006271.1	NP_006262.1	P23297	S10A1_HUMAN	S100 calcium binding protein A1	68	EF-hand 2. {ECO:0000255|PROSITE- ProRule:PRU00448}.				intracellular signal transduction (GO:0035556)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|regulation of heart contraction (GO:0008016)|substantia nigra development (GO:0021762)	M band (GO:0031430)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)	p.G68W(1)|p.G68R(1)		breast(1)|cervix(1)|lung(2)	4	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	GAATGGAGACGGGGAGGTGGA	0.542																																					Ovarian(74;601 1703 10548 31787)												2	Substitution - Missense(2)	cervix(1)|lung(1)						G	,ARG/GLY	0,4406		0,0,2203	431.0	399.0	410.0		,202	5.1	1.0	1		410	1,8599	1.2+/-3.3	0,1,4299	no	intron,missense	S100A1,S100A13	NM_001024210.1,NM_006271.1	,125	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	,probably-damaging	,68/95	153604234	1,13005	2203	4300	6503	SO:0001583	missense	6271			BC014392	CCDS1047.1	1q21	2013-01-10	2001-11-28		ENSG00000160678	ENSG00000160678		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10486	protein-coding gene	gene with protein product		176940	"""S100 calcium-binding protein A1"""	S100A		1998503	Standard	NM_006271		Approved	S100-alpha	uc001fck.1	P23297	OTTHUMG00000037041	ENST00000292169.1:c.202G>A	1.37:g.153604234G>A	ENSP00000292169:p.Gly68Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5D9|Q5T7Y3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.G121R	ENST00000292169.1	37	c.361	CCDS1047.1	1	.	.	.	.	.	.	.	.	.	.	G	32	5.178466	0.94846	0.0	1.16E-4	ENSG00000160678	ENST00000368698;ENST00000292169	T;D	0.90197	1.83;-2.63	5.12	5.12	0.69794	S100/Calbindin-D9k, conserved site (1);EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.93035	0.7783	.	.	.	0.80722	D	1	D	0.76494	0.999	P	0.59825	0.864	D	0.92736	0.6204	9	0.51188	T	0.08	.	16.1017	0.81175	0.0:0.0:1.0:0.0	.	68	P23297	S10A1_HUMAN	R	121;68	ENSP00000357687:G121R;ENSP00000292169:G68R	ENSP00000292169:G68R	G	+	1	0	S100A1	151870858	1.000000	0.71417	0.999000	0.59377	0.997000	0.91878	7.072000	0.76777	2.659000	0.90383	0.655000	0.94253	GGG	S100A1	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.542	S100A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A1	HGNC	protein_coding	OTTHUMT00000089933.1	G	NM_006271		153604234	+1	no_errors	ENST00000368698	ensembl	human	known	70_37	missense	SNP	1.000	A
RUSC1	23623	genome.wustl.edu	37	1	155294395	155294395	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:155294395G>A	ENST00000368352.5	+	3	1508				RUSC1_ENST00000368347.4_Intron|RUSC1_ENST00000368354.3_Intron|RUSC1_ENST00000462780.1_Intron|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000292254.4_5'UTR|RUSC1-AS1_ENST00000443642.1_RNA|RUSC1_ENST00000368349.4_Intron	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			GCTGTGCCCTGAGGGAGGGCA	0.701																																																	0																																										SO:0001627	intron_variant	23623			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910	ENST00000368352.5:c.1358-241G>A	1.37:g.155294395G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	RNA	SNP	-	NULL	ENST00000368352.5	37	NULL	CCDS41410.1	1																																																																																			RUSC1	-	-		0.701	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1	HGNC	protein_coding	OTTHUMT00000039071.1	G			155294395	+1	no_errors	ENST00000471876	ensembl	human	known	70_37	rna	SNP	0.010	A
SCN8A	6334	genome.wustl.edu	37	12	52139775	52139775	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:52139775G>C	ENST00000354534.6	+	13	2265	c.2087G>C	c.(2086-2088)aGa>aCa	p.R696T	SCN8A_ENST00000545061.1_Missense_Mutation_p.R696T|SCN8A_ENST00000550891.1_Missense_Mutation_p.R696T	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	696					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.R696T(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CGGAAGGACAGAATCAACAGT	0.393																																																	2	Substitution - Missense(2)	cervix(2)											106.0	104.0	104.0					12																	52139775		1872	4090	5962	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2087G>C	12.37:g.52139775G>C	ENSP00000346534:p.Arg696Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R696T	ENST00000354534.6	37	c.2087	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708894	0.68615	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96	5.18	4.29	0.51040	Domain of unknown function DUF3451 (1);	0.117105	0.64402	D	0.000018	D	0.95541	0.8551	M	0.76938	2.355	0.58432	D	0.999999	D;D;B;D	0.76494	0.999;0.98;0.275;0.999	D;P;B;D	0.72982	0.979;0.718;0.172;0.978	D	0.96063	0.9040	10	0.87932	D	0	.	14.3391	0.66614	0.0713:0.0:0.9287:0.0	.	696;707;696;696	F8VWM7;Q9UQD0-3;F8VRN5;Q9UQD0	.;.;.;SCN8A_HUMAN	T	696;696;696;696;609	ENSP00000448415:R696T;ENSP00000346534:R696T;ENSP00000440360:R696T;ENSP00000347255:R696T	ENSP00000346534:R696T	R	+	2	0	SCN8A	50426042	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.263000	0.95617	1.554000	0.49487	-0.150000	0.13652	AGA	SCN8A	-	pfam_DUF3451		0.393	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	G	NM_014191		52139775	+1	no_errors	ENST00000354534	ensembl	human	known	70_37	missense	SNP	1.000	C
SCN8A	6334	genome.wustl.edu	37	12	52139775	52139775	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:52139775G>C	ENST00000354534.6	+	13	2265	c.2087G>C	c.(2086-2088)aGa>aCa	p.R696T	SCN8A_ENST00000545061.1_Missense_Mutation_p.R696T|SCN8A_ENST00000550891.1_Missense_Mutation_p.R696T	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit	696					adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)	p.R696T(2)		breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	CGGAAGGACAGAATCAACAGT	0.393																																																	2	Substitution - Missense(2)	cervix(2)											106.0	104.0	104.0					12																	52139775		1872	4090	5962	SO:0001583	missense	6334			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.2087G>C	12.37:g.52139775G>C	ENSP00000346534:p.Arg696Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B9VWG8|O95788|Q9NYX2|Q9UPB2	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,pfam_IQ_motif_EF-hand-BS,smart_IQ_motif_EF-hand-BS,prints_Na_channel_a8su,prints_Na_channel_asu,prints_PKD_2,pfscan_IQ_motif_EF-hand-BS	p.R696T	ENST00000354534.6	37	c.2087	CCDS44891.1	12	.	.	.	.	.	.	.	.	.	.	G	18.84	3.708894	0.68615	.	.	ENSG00000196876	ENST00000550891;ENST00000354534;ENST00000545061;ENST00000355133;ENST00000357961	D;D;D;D	0.92048	-2.96;-2.96;-2.96;-2.96	5.18	4.29	0.51040	Domain of unknown function DUF3451 (1);	0.117105	0.64402	D	0.000018	D	0.95541	0.8551	M	0.76938	2.355	0.58432	D	0.999999	D;D;B;D	0.76494	0.999;0.98;0.275;0.999	D;P;B;D	0.72982	0.979;0.718;0.172;0.978	D	0.96063	0.9040	10	0.87932	D	0	.	14.3391	0.66614	0.0713:0.0:0.9287:0.0	.	696;707;696;696	F8VWM7;Q9UQD0-3;F8VRN5;Q9UQD0	.;.;.;SCN8A_HUMAN	T	696;696;696;696;609	ENSP00000448415:R696T;ENSP00000346534:R696T;ENSP00000440360:R696T;ENSP00000347255:R696T	ENSP00000346534:R696T	R	+	2	0	SCN8A	50426042	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	9.263000	0.95617	1.554000	0.49487	-0.150000	0.13652	AGA	SCN8A	-	pfam_DUF3451		0.393	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCN8A	HGNC	protein_coding	OTTHUMT00000404372.3	G	NM_014191		52139775	+1	no_errors	ENST00000354534	ensembl	human	known	70_37	missense	SNP	1.000	C
SDCCAG3	10807	genome.wustl.edu	37	9	139302311	139302311	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:139302311C>T	ENST00000357365.3	-	4	498	c.369G>A	c.(367-369)tcG>tcA	p.S123S	SDCCAG3_ENST00000298537.7_Silent_p.S100S|PMPCA_ENST00000399219.3_5'Flank|PMPCA_ENST00000371717.3_5'Flank|SDCCAG3_ENST00000461693.1_5'Flank|PMPCA_ENST00000371720.1_5'Flank|SDCCAG3_ENST00000371725.3_Silent_p.S50S	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	123						cytoplasm (GO:0005737)		p.S123S(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		GATCCTCTTTCGAGAGGCCGA	0.483																																																	1	Substitution - coding silent(1)	cervix(1)											118.0	124.0	122.0					9																	139302311		1911	4120	6031	SO:0001819	synonymous_variant	10807			AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.369G>A	9.37:g.139302311C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Silent	SNP	NULL	p.S123	ENST00000357365.3	37	c.369	CCDS43904.1	9																																																																																			SDCCAG3	-	NULL		0.483	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCCAG3	HGNC	protein_coding	OTTHUMT00000055060.2	C	NM_006643		139302311	-1	no_errors	ENST00000357365	ensembl	human	known	70_37	silent	SNP	0.000	T
SDCCAG3	10807	genome.wustl.edu	37	9	139302311	139302311	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:139302311C>T	ENST00000357365.3	-	4	498	c.369G>A	c.(367-369)tcG>tcA	p.S123S	SDCCAG3_ENST00000298537.7_Silent_p.S100S|PMPCA_ENST00000399219.3_5'Flank|PMPCA_ENST00000371717.3_5'Flank|SDCCAG3_ENST00000461693.1_5'Flank|PMPCA_ENST00000371720.1_5'Flank|SDCCAG3_ENST00000371725.3_Silent_p.S50S	NM_001039707.1	NP_001034796.1	Q96C92	SDCG3_HUMAN	serologically defined colon cancer antigen 3	123						cytoplasm (GO:0005737)		p.S123S(1)		NS(1)|breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(9)	16		Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;8.18e-06)|Epithelial(140;9.31e-06)		GATCCTCTTTCGAGAGGCCGA	0.483																																																	1	Substitution - coding silent(1)	cervix(1)											118.0	124.0	122.0					9																	139302311		1911	4120	6031	SO:0001819	synonymous_variant	10807			AF039688	CCDS6999.2, CCDS43903.1, CCDS43904.1	9q34.3	2010-10-27			ENSG00000165689	ENSG00000165689			10667	protein-coding gene	gene with protein product						9610721	Standard	XM_005266050		Approved	NY-CO-3	uc004chi.3	Q96C92	OTTHUMG00000020928	ENST00000357365.3:c.369G>A	9.37:g.139302311C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCP1|O60525|Q5SXN1|Q5SXN2|Q5SXN3|Q5SXN4|Q5SXN8|Q6V704|Q9NVY5	Silent	SNP	NULL	p.S123	ENST00000357365.3	37	c.369	CCDS43904.1	9																																																																																			SDCCAG3	-	NULL		0.483	SDCCAG3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCCAG3	HGNC	protein_coding	OTTHUMT00000055060.2	C	NM_006643		139302311	-1	no_errors	ENST00000357365	ensembl	human	known	70_37	silent	SNP	0.000	T
SDHAP1	255812	genome.wustl.edu	37	3	195692419	195692419	+	RNA	SNP	C	C	G	rs77887672		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:195692419C>G	ENST00000427841.1	-	0	2089					NR_003264.2				succinate dehydrogenase complex, subunit A, flavoprotein pseudogene 1																		CGCACCTGAGCCCAGAAACAC	0.468																																					Ovarian(67;1158 1227 12109 20189 43170)												0																																												255812			BC071730		3q29	2009-12-02	2006-11-21	2009-12-02	ENSG00000185485	ENSG00000185485			32455	pseudogene	pseudogene			"""succinate dehydrogenase complex, subunit A, flavoprotein-like 1"""	SDHAL1, SDHALP1			Standard	NR_003264		Approved		uc003fvy.3		OTTHUMG00000155716		3.37:g.195692419C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000427841.1	37	NULL		3																																																																																			SDHAP1	-	-		0.468	SDHAP1-002	KNOWN	basic	processed_transcript	SDHAP1	HGNC	pseudogene	OTTHUMT00000341367.1	C			195692419	-1	no_errors	ENST00000354559	ensembl	human	known	70_37	rna	SNP	0.082	G
SEPHS2	22928	genome.wustl.edu	37	16	30456484	30456484	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:30456484C>T	ENST00000478753.2	-	1	1018	c.565G>A	c.(565-567)Gaa>Aaa	p.E189K	SEPHS2_ENST00000542752.1_Missense_Mutation_p.E132K|SEPHS2_ENST00000500504.2_Missense_Mutation_p.E189K			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	189					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)	p.E189K(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						GTTACCTTTTCGCGTTCCTCC	0.542																																					Esophageal Squamous(81;1142 1261 11202 24614 35697)												1	Substitution - Missense(1)	cervix(1)											119.0	115.0	116.0					16																	30456484		2160	4251	6411	SO:0001583	missense	22928			BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.565G>A	16.37:g.30456484C>T	ENSP00000418669:p.Glu189Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUQ2	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.E132K	ENST00000478753.2	37	c.394		16	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885980	0.33348	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.29917	1.55;1.55;1.55	5.64	4.7	0.59300	PurM, N-terminal-like (1);AIR synthase-related protein (1);	0.159251	0.56097	N	0.000040	T	0.19765	0.0475	N	0.19112	0.55	0.80722	D	1	B;B	0.20164	0.042;0.008	B;B	0.14023	0.01;0.008	T	0.04961	-1.0915	10	0.23891	T	0.37	-10.0612	12.5595	0.56273	0.0:0.9193:0.0:0.0807	.	189;132	Q99611;F5H8F9	SPS2_HUMAN;.	K	189;132;140;189	ENSP00000418669:E189K;ENSP00000443601:E132K;ENSP00000426234:E189K	ENSP00000390233:E140K	E	-	1	0	SEPHS2	30363985	1.000000	0.71417	0.027000	0.17364	0.090000	0.18270	5.731000	0.68554	1.535000	0.49220	0.655000	0.94253	GAA	SEPHS2	-	pfam_AIR_synth_N_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD		0.542	SEPHS2-001	KNOWN	basic|seleno	protein_coding	SEPHS2	HGNC	protein_coding	OTTHUMT00000109640.11	C	NM_012248		30456484	-1	no_errors	ENST00000542752	ensembl	human	known	70_37	missense	SNP	0.994	T
SEPHS2	22928	genome.wustl.edu	37	16	30456484	30456484	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:30456484C>T	ENST00000478753.2	-	1	1018	c.565G>A	c.(565-567)Gaa>Aaa	p.E189K	SEPHS2_ENST00000542752.1_Missense_Mutation_p.E132K|SEPHS2_ENST00000500504.2_Missense_Mutation_p.E189K			Q99611	SPS2_HUMAN	selenophosphate synthetase 2	189					selenocysteine biosynthetic process (GO:0016260)		ATP binding (GO:0005524)|selenide, water dikinase activity (GO:0004756)	p.E189K(1)		breast(3)|cervix(1)|kidney(1)|large_intestine(3)|lung(1)|upper_aerodigestive_tract(1)	10						GTTACCTTTTCGCGTTCCTCC	0.542																																					Esophageal Squamous(81;1142 1261 11202 24614 35697)												1	Substitution - Missense(1)	cervix(1)											119.0	115.0	116.0					16																	30456484		2160	4251	6411	SO:0001583	missense	22928			BC002381		16p11.2	2013-02-15			ENSG00000179918	ENSG00000179918			19686	protein-coding gene	gene with protein product		606218				10608886	Standard	NM_012248		Approved	SPS2, SPS2b	uc021tgl.1	Q99611	OTTHUMG00000176988	ENST00000478753.2:c.565G>A	16.37:g.30456484C>T	ENSP00000418669:p.Glu189Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUQ2	Missense_Mutation	SNP	pfam_AIR_synth_C_dom,pfam_AIR_synth_N_dom,superfamily_AIR_synth_C_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD	p.E132K	ENST00000478753.2	37	c.394		16	.	.	.	.	.	.	.	.	.	.	C	12.26	1.885980	0.33348	.	.	ENSG00000179918	ENST00000478753;ENST00000542752;ENST00000418751;ENST00000500504	T;T;T	0.29917	1.55;1.55;1.55	5.64	4.7	0.59300	PurM, N-terminal-like (1);AIR synthase-related protein (1);	0.159251	0.56097	N	0.000040	T	0.19765	0.0475	N	0.19112	0.55	0.80722	D	1	B;B	0.20164	0.042;0.008	B;B	0.14023	0.01;0.008	T	0.04961	-1.0915	10	0.23891	T	0.37	-10.0612	12.5595	0.56273	0.0:0.9193:0.0:0.0807	.	189;132	Q99611;F5H8F9	SPS2_HUMAN;.	K	189;132;140;189	ENSP00000418669:E189K;ENSP00000443601:E132K;ENSP00000426234:E189K	ENSP00000390233:E140K	E	-	1	0	SEPHS2	30363985	1.000000	0.71417	0.027000	0.17364	0.090000	0.18270	5.731000	0.68554	1.535000	0.49220	0.655000	0.94253	GAA	SEPHS2	-	pfam_AIR_synth_N_dom,superfamily_PurM_N-like,pirsf_SelD,tigrfam_SelD		0.542	SEPHS2-001	KNOWN	basic|seleno	protein_coding	SEPHS2	HGNC	protein_coding	OTTHUMT00000109640.11	C	NM_012248		30456484	-1	no_errors	ENST00000542752	ensembl	human	known	70_37	missense	SNP	0.994	T
MKL1	57591	genome.wustl.edu	37	22	40803462	40803462	+	IGR	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:40803462G>A	ENST00000355630.3	-	0	4496				SGSM3_ENST00000454798.2_Missense_Mutation_p.E405K|SGSM3_ENST00000248929.9_Missense_Mutation_p.E472K	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E472K(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GCGGGACCACGAGAACTACGT	0.632			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	1	Substitution - Missense(1)	cervix(1)											32.0	33.0	33.0					22																	40803462		2202	4300	6502	SO:0001628	intergenic_variant	27352			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		22.37:g.40803462G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Run,pfam_SH3_domain,pfam_SH3_2,superfamily_Rab-GTPase-TBC_dom,superfamily_SH3_domain,smart_Rab-GTPase-TBC_dom,smart_SH3_domain,smart_Run,pfscan_Run,pfscan_SH3_domain,pfscan_Rab-GTPase-TBC_dom	p.E472K	ENST00000355630.3	37	c.1414	CCDS14003.1	22	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415359	0.83449	.	.	ENSG00000100359	ENST00000248929;ENST00000454798	T;T	0.14893	2.58;2.47	5.41	5.41	0.78517	.	0.118916	0.64402	D	0.000011	T	0.22085	0.0532	M	0.72118	2.19	0.80722	D	1	B;B;P;P	0.47409	0.427;0.427;0.895;0.798	B;B;B;B	0.36289	0.066;0.066;0.175;0.221	T	0.08289	-1.0729	10	0.45353	T	0.12	.	19.1834	0.93632	0.0:0.0:1.0:0.0	.	409;405;500;472	B4DVE3;B4DMS2;Q96HU1-2;Q96HU1	.;.;.;SGSM3_HUMAN	K	472;405	ENSP00000248929:E472K;ENSP00000390998:E405K	ENSP00000248929:E472K	E	+	1	0	SGSM3	39133408	1.000000	0.71417	0.997000	0.53966	0.685000	0.39939	9.229000	0.95273	2.529000	0.85273	0.561000	0.74099	GAG	SGSM3	-	NULL		0.632	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM3	HGNC	protein_coding	OTTHUMT00000321522.1	G	NM_020831		40803462	+1	no_errors	ENST00000248929	ensembl	human	known	70_37	missense	SNP	1.000	A
MKL1	57591	genome.wustl.edu	37	22	40803462	40803462	+	IGR	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:40803462G>A	ENST00000355630.3	-	0	4496				SGSM3_ENST00000454798.2_Missense_Mutation_p.E405K|SGSM3_ENST00000248929.9_Missense_Mutation_p.E472K	NM_020831.3	NP_065882.1	Q969V6	MKL1_HUMAN	megakaryoblastic leukemia (translocation) 1						negative regulation of apoptotic signaling pathway (GO:2001234)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription via serum response element binding (GO:0010735)|smooth muscle cell differentiation (GO:0051145)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	actin binding (GO:0003779)|actin monomer binding (GO:0003785)|leucine zipper domain binding (GO:0043522)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription regulatory region sequence-specific DNA binding (GO:0000976)	p.E472K(1)		breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(3)|lung(13)|ovary(4)|skin(1)|stomach(1)|urinary_tract(1)	30						GCGGGACCACGAGAACTACGT	0.632			T	RBM15	acute megakaryocytic leukemia																																			Dom	yes		22	22q13	57591	megakaryoblastic leukemia (translocation) 1		L	1	Substitution - Missense(1)	cervix(1)											32.0	33.0	33.0					22																	40803462		2202	4300	6502	SO:0001628	intergenic_variant	27352			AB037859	CCDS14003.1, CCDS74865.1, CCDS74866.1	22q13	2008-06-12			ENSG00000196588	ENSG00000196588			14334	protein-coding gene	gene with protein product	"""megakaryocytic acute leukemia"", ""myocardin-related transcription factor A"", ""basic, SAP and coiled-coil domain"""	606078				11431691, 12019265, 14970199	Standard	XM_005261692		Approved	KIAA1438, MAL, MRTF-A, BSAC	uc003ayw.1	Q969V6	OTTHUMG00000151146		22.37:g.40803462G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TCL1|Q96SC5|Q96SC6|Q9P2B0	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,pfam_Run,pfam_SH3_domain,pfam_SH3_2,superfamily_Rab-GTPase-TBC_dom,superfamily_SH3_domain,smart_Rab-GTPase-TBC_dom,smart_SH3_domain,smart_Run,pfscan_Run,pfscan_SH3_domain,pfscan_Rab-GTPase-TBC_dom	p.E472K	ENST00000355630.3	37	c.1414	CCDS14003.1	22	.	.	.	.	.	.	.	.	.	.	G	23.4	4.415359	0.83449	.	.	ENSG00000100359	ENST00000248929;ENST00000454798	T;T	0.14893	2.58;2.47	5.41	5.41	0.78517	.	0.118916	0.64402	D	0.000011	T	0.22085	0.0532	M	0.72118	2.19	0.80722	D	1	B;B;P;P	0.47409	0.427;0.427;0.895;0.798	B;B;B;B	0.36289	0.066;0.066;0.175;0.221	T	0.08289	-1.0729	10	0.45353	T	0.12	.	19.1834	0.93632	0.0:0.0:1.0:0.0	.	409;405;500;472	B4DVE3;B4DMS2;Q96HU1-2;Q96HU1	.;.;.;SGSM3_HUMAN	K	472;405	ENSP00000248929:E472K;ENSP00000390998:E405K	ENSP00000248929:E472K	E	+	1	0	SGSM3	39133408	1.000000	0.71417	0.997000	0.53966	0.685000	0.39939	9.229000	0.95273	2.529000	0.85273	0.561000	0.74099	GAG	SGSM3	-	NULL		0.632	MKL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGSM3	HGNC	protein_coding	OTTHUMT00000321522.1	G	NM_020831		40803462	+1	no_errors	ENST00000248929	ensembl	human	known	70_37	missense	SNP	1.000	A
SHANK1	50944	genome.wustl.edu	37	19	51169762	51169762	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:51169762C>G	ENST00000293441.1	-	22	5473	c.5455G>C	c.(5455-5457)Gag>Cag	p.E1819Q	SHANK1_ENST00000359082.3_Missense_Mutation_p.E1810Q|SHANK1_ENST00000391813.1_Missense_Mutation_p.E1206Q|SHANK1_ENST00000391814.1_Missense_Mutation_p.E1827Q|SYT3_ENST00000544769.1_Intron	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1819					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.E1819Q(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ACTTCTGGCTCTACAGCCACC	0.726																																																	1	Substitution - Missense(1)	cervix(1)											5.0	6.0	5.0					19																	51169762		2092	4122	6214	SO:0001583	missense	50944			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5455G>C	19.37:g.51169762C>G	ENSP00000293441:p.Glu1819Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.E1827Q	ENST00000293441.1	37	c.5479	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	C	8.018	0.758899	0.15846	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.39592	1.19;1.6;1.17;1.07	2.06	2.06	0.26882	.	4.537710	0.01465	U	0.016020	T	0.34919	0.0914	N	0.12746	0.255	0.27614	N	0.948572	P;D	0.56968	0.92;0.978	B;P	0.50049	0.26;0.629	T	0.44205	-0.9343	10	0.15066	T	0.55	.	9.7994	0.40755	0.0:1.0:0.0:0.0	.	1819;1206	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	Q	1819;1206;1810;1827	ENSP00000293441:E1819Q;ENSP00000375689:E1206Q;ENSP00000351984:E1810Q;ENSP00000375690:E1827Q	ENSP00000293441:E1819Q	E	-	1	0	SHANK1	55861574	0.151000	0.22747	0.776000	0.31678	0.537000	0.34900	3.327000	0.52045	1.460000	0.47911	0.195000	0.17529	GAG	SHANK1	-	NULL		0.726	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	C	NM_016148		51169762	-1	no_errors	ENST00000391814	ensembl	human	known	70_37	missense	SNP	0.964	G
SHANK1	50944	genome.wustl.edu	37	19	51169762	51169762	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:51169762C>G	ENST00000293441.1	-	22	5473	c.5455G>C	c.(5455-5457)Gag>Cag	p.E1819Q	SHANK1_ENST00000359082.3_Missense_Mutation_p.E1810Q|SHANK1_ENST00000391813.1_Missense_Mutation_p.E1206Q|SHANK1_ENST00000391814.1_Missense_Mutation_p.E1827Q|SYT3_ENST00000544769.1_Intron	NM_016148.2	NP_057232.2	Q9Y566	SHAN1_HUMAN	SH3 and multiple ankyrin repeat domains 1	1819					adult behavior (GO:0030534)|associative learning (GO:0008306)|cytoskeletal anchoring at plasma membrane (GO:0007016)|dendritic spine morphogenesis (GO:0060997)|determination of affect (GO:0050894)|habituation (GO:0046959)|long-term memory (GO:0007616)|negative regulation of actin filament bundle assembly (GO:0032232)|neuromuscular process controlling balance (GO:0050885)|olfactory behavior (GO:0042048)|positive regulation of dendritic spine development (GO:0060999)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|protein complex assembly (GO:0006461)|protein localization to synapse (GO:0035418)|regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000311)|righting reflex (GO:0060013)|social behavior (GO:0035176)|synapse maturation (GO:0060074)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|excitatory synapse (GO:0060076)|intracellular (GO:0005622)|membrane (GO:0016020)|N-methyl-D-aspartate selective glutamate receptor complex (GO:0017146)|neuron projection (GO:0043005)|neuronal postsynaptic density (GO:0097481)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	ankyrin repeat binding (GO:0071532)|GKAP/Homer scaffold activity (GO:0030160)|identical protein binding (GO:0042802)|ionotropic glutamate receptor binding (GO:0035255)|protein C-terminus binding (GO:0008022)|protein complex binding (GO:0032403)|scaffold protein binding (GO:0097110)|SH3 domain binding (GO:0017124)|somatostatin receptor binding (GO:0031877)	p.E1819Q(1)		breast(1)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(15)|liver(1)|lung(21)|ovary(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	64		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00493)|GBM - Glioblastoma multiforme(134;0.0199)		ACTTCTGGCTCTACAGCCACC	0.726																																																	1	Substitution - Missense(1)	cervix(1)											5.0	6.0	5.0					19																	51169762		2092	4122	6214	SO:0001583	missense	50944			AF163302	CCDS12799.1	19q13.3	2013-01-10			ENSG00000161681	ENSG00000161681		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	15474	protein-coding gene	gene with protein product	"""somatostatin receptor-interacting protein"""	604999				10551867	Standard	NM_016148		Approved	SSTRIP, SPANK-1, synamon	uc002psx.1	Q9Y566	OTTHUMG00000137380	ENST00000293441.1:c.5455G>C	19.37:g.51169762C>G	ENSP00000293441:p.Glu1819Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MXP5|B7WNY6|Q9NYW9	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SAM_type1,pfam_SH3_2,pfam_SAM_2,pfam_PDZ,pfam_SH3_domain,superfamily_Ankyrin_rpt-contain_dom,superfamily_PDZ,superfamily_SH3_domain,superfamily_SAM/pointed,smart_Ankyrin_rpt,smart_SH3_domain,smart_PDZ,smart_SAM,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_PDZ,pfscan_SAM,pfscan_SH3_domain	p.E1827Q	ENST00000293441.1	37	c.5479	CCDS12799.1	19	.	.	.	.	.	.	.	.	.	.	C	8.018	0.758899	0.15846	.	.	ENSG00000161681	ENST00000293441;ENST00000391813;ENST00000359082;ENST00000391814	T;T;T;T	0.39592	1.19;1.6;1.17;1.07	2.06	2.06	0.26882	.	4.537710	0.01465	U	0.016020	T	0.34919	0.0914	N	0.12746	0.255	0.27614	N	0.948572	P;D	0.56968	0.92;0.978	B;P	0.50049	0.26;0.629	T	0.44205	-0.9343	10	0.15066	T	0.55	.	9.7994	0.40755	0.0:1.0:0.0:0.0	.	1819;1206	Q9Y566;Q9Y566-2	SHAN1_HUMAN;.	Q	1819;1206;1810;1827	ENSP00000293441:E1819Q;ENSP00000375689:E1206Q;ENSP00000351984:E1810Q;ENSP00000375690:E1827Q	ENSP00000293441:E1819Q	E	-	1	0	SHANK1	55861574	0.151000	0.22747	0.776000	0.31678	0.537000	0.34900	3.327000	0.52045	1.460000	0.47911	0.195000	0.17529	GAG	SHANK1	-	NULL		0.726	SHANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHANK1	HGNC	protein_coding	OTTHUMT00000268071.1	C	NM_016148		51169762	-1	no_errors	ENST00000391814	ensembl	human	known	70_37	missense	SNP	0.964	G
SLC32A1	140679	genome.wustl.edu	37	20	37356217	37356217	+	Silent	SNP	C	C	T	rs143574180		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr20:37356217C>T	ENST00000217420.1	+	2	776	c.513C>T	c.(511-513)taC>taT	p.Y171Y		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	171					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.Y171Y(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGTGCCTGTACGAGGAGAATG	0.652																																																	1	Substitution - coding silent(1)	cervix(1)						C		0,4406		0,0,2203	78.0	63.0	68.0		513	3.2	1.0	20	dbSNP_134	68	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC32A1	NM_080552.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		171/526	37356217	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140679			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.513C>T	20.37:g.37356217C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N489	Silent	SNP	pfam_AA_transpt_TM	p.Y171	ENST00000217420.1	37	c.513	CCDS13307.1	20																																																																																			SLC32A1	-	pfam_AA_transpt_TM		0.652	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC32A1	HGNC	protein_coding	OTTHUMT00000079206.1	C	NM_080552		37356217	+1	no_errors	ENST00000217420	ensembl	human	known	70_37	silent	SNP	1.000	T
SLC32A1	140679	genome.wustl.edu	37	20	37356217	37356217	+	Silent	SNP	C	C	T	rs143574180		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr20:37356217C>T	ENST00000217420.1	+	2	776	c.513C>T	c.(511-513)taC>taT	p.Y171Y		NM_080552.2	NP_542119.1	Q9H598	VIAAT_HUMAN	solute carrier family 32 (GABA vesicular transporter), member 1	171					aging (GO:0007568)|ion transport (GO:0006811)|neurotransmitter secretion (GO:0007269)|synaptic transmission (GO:0007268)|transmembrane transport (GO:0055085)	cell tip (GO:0051286)|clathrin-sculpted gamma-aminobutyric acid transport vesicle membrane (GO:0061202)|cone cell pedicle (GO:0044316)|dendrite (GO:0030425)|dendrite terminus (GO:0044292)|inhibitory synapse (GO:0060077)|integral component of membrane (GO:0016021)|neuron projection (GO:0043005)|neuron projection terminus (GO:0044306)|plasma membrane (GO:0005886)|synaptic vesicle membrane (GO:0030672)	gamma-aminobutyric acid:proton symporter activity (GO:0015495)|glycine transmembrane transporter activity (GO:0015187)	p.Y171Y(1)		breast(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(11)|lung(16)|urinary_tract(1)	38		Myeloproliferative disorder(115;0.00878)			Glycine(DB00145)	CGTGCCTGTACGAGGAGAATG	0.652																																																	1	Substitution - coding silent(1)	cervix(1)						C		0,4406		0,0,2203	78.0	63.0	68.0		513	3.2	1.0	20	dbSNP_134	68	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	SLC32A1	NM_080552.2		0,1,6502	TT,TC,CC		0.0116,0.0,0.0077		171/526	37356217	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	140679			AL133519	CCDS13307.1	20q11	2013-05-22			ENSG00000101438	ENSG00000101438		"""Solute carriers"""	11018	protein-coding gene	gene with protein product			"""vesicular inhibitory amino acid transporter"""	VIAAT		19843525	Standard	NM_080552		Approved	VGAT, bA122O1.1	uc002xjc.3	Q9H598	OTTHUMG00000032457	ENST00000217420.1:c.513C>T	20.37:g.37356217C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N489	Silent	SNP	pfam_AA_transpt_TM	p.Y171	ENST00000217420.1	37	c.513	CCDS13307.1	20																																																																																			SLC32A1	-	pfam_AA_transpt_TM		0.652	SLC32A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC32A1	HGNC	protein_coding	OTTHUMT00000079206.1	C	NM_080552		37356217	+1	no_errors	ENST00000217420	ensembl	human	known	70_37	silent	SNP	1.000	T
SMS	6611	genome.wustl.edu	37	X	21958934	21958934	+	5'UTR	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chrX:21958934C>T	ENST00000404933.2	+	0	244				SMS_ENST00000379404.1_5'UTR|SMS_ENST00000478094.1_3'UTR|SMS_ENST00000415881.2_5'UTR	NM_004595.4	NP_004586.2	P52788	SPSY_HUMAN	spermine synthase						cellular nitrogen compound metabolic process (GO:0034641)|methionine metabolic process (GO:0006555)|polyamine metabolic process (GO:0006595)|small molecule metabolic process (GO:0044281)|spermine biosynthetic process (GO:0006597)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	spermidine synthase activity (GO:0004766)|spermine synthase activity (GO:0016768)			endometrium(2)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)|skin(2)	14					Spermine(DB00127)	CACAGGGCCTCGCCTCACTAT	0.751																																																	0													3.0	2.0	2.0					X																	21958934		1475	2834	4309	SO:0001623	5_prime_UTR_variant	6611			AD001528	CCDS14203.1, CCDS59161.1	Xp22.1	2014-05-16			ENSG00000102172	ENSG00000102172			11123	protein-coding gene	gene with protein product		300105	"""Snyder-Robinson X-linked mental retardation syndrome"""	SRS		7546290, 9299240, 14508504	Standard	NM_004595		Approved	SPMSY, SpS, MRSR	uc004dag.4	P52788	OTTHUMG00000021239	ENST00000404933.2:c.-9C>T	X.37:g.21958934C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHA7|A6NI34|B2R9M0|O00544|Q9UQS1	RNA	SNP	-	NULL	ENST00000404933.2	37	NULL	CCDS14203.1	X																																																																																			SMS	-	-		0.751	SMS-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SMS	HGNC	protein_coding	OTTHUMT00000056032.1	C	NM_004595		21958934	+1	no_errors	ENST00000478094	ensembl	human	known	70_37	rna	SNP	0.893	T
SNAPC2	6618	genome.wustl.edu	37	19	7987549	7987549	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:7987549G>A	ENST00000221573.6	+	5	956	c.905G>A	c.(904-906)aGc>aAc	p.S302N	SNAPC2_ENST00000597584.1_Missense_Mutation_p.S65N	NM_003083.3	NP_003074.1	Q13487	SNPC2_HUMAN	small nuclear RNA activating complex, polypeptide 2, 45kDa	302					gene expression (GO:0010467)|snRNA transcription (GO:0009301)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						GCCGAGCACAGCGAACTGAAA	0.667																																																	0													80.0	104.0	96.0					19																	7987549		2203	4300	6503	SO:0001583	missense	6618			U44898	CCDS12190.1	19p13	2008-07-22	2002-08-29			ENSG00000104976			11135	protein-coding gene	gene with protein product		605076	"""small nuclear RNA activating complex, polypeptide 2, 45kD"""			8633057	Standard	NM_003083		Approved	SNAP45, PTFdelta	uc002miw.2	Q13487		ENST00000221573.6:c.905G>A	19.37:g.7987549G>A	ENSP00000221573:p.Ser302Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBZ6|D6W663|Q13486	Missense_Mutation	SNP	pfam_SnAPC_su2-like	p.S302N	ENST00000221573.6	37	c.905	CCDS12190.1	19	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694775	0.30052	.	.	ENSG00000104976	ENST00000221573	T	0.53857	0.6	4.46	-4.55	0.03441	.	1.738350	0.02720	N	0.113853	T	0.46698	0.1406	L	0.60455	1.87	0.09310	N	1	B	0.23937	0.094	B	0.25614	0.062	T	0.45338	-0.9268	10	0.51188	T	0.08	2.1892	5.9782	0.19393	0.0917:0.5606:0.2163:0.1313	.	302	Q13487	SNPC2_HUMAN	N	302	ENSP00000221573:S302N	ENSP00000221573:S302N	S	+	2	0	SNAPC2	7893549	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.106000	0.10890	-0.400000	0.07656	0.455000	0.32223	AGC	SNAPC2	-	pfam_SnAPC_su2-like		0.667	SNAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC2	HGNC	protein_coding	OTTHUMT00000461358.1	G	NM_003083		7987549	+1	no_errors	ENST00000221573	ensembl	human	known	70_37	missense	SNP	0.000	A
SNAPC2	6618	genome.wustl.edu	37	19	7987549	7987549	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr19:7987549G>A	ENST00000221573.6	+	5	956	c.905G>A	c.(904-906)aGc>aAc	p.S302N	SNAPC2_ENST00000597584.1_Missense_Mutation_p.S65N	NM_003083.3	NP_003074.1	Q13487	SNPC2_HUMAN	small nuclear RNA activating complex, polypeptide 2, 45kDa	302					gene expression (GO:0010467)|snRNA transcription (GO:0009301)|transcription from RNA polymerase II promoter (GO:0006366)|transcription from RNA polymerase III promoter (GO:0006383)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(1)|urinary_tract(1)	6						GCCGAGCACAGCGAACTGAAA	0.667																																																	0													80.0	104.0	96.0					19																	7987549		2203	4300	6503	SO:0001583	missense	6618			U44898	CCDS12190.1	19p13	2008-07-22	2002-08-29			ENSG00000104976			11135	protein-coding gene	gene with protein product		605076	"""small nuclear RNA activating complex, polypeptide 2, 45kD"""			8633057	Standard	NM_003083		Approved	SNAP45, PTFdelta	uc002miw.2	Q13487		ENST00000221573.6:c.905G>A	19.37:g.7987549G>A	ENSP00000221573:p.Ser302Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBZ6|D6W663|Q13486	Missense_Mutation	SNP	pfam_SnAPC_su2-like	p.S302N	ENST00000221573.6	37	c.905	CCDS12190.1	19	.	.	.	.	.	.	.	.	.	.	G	11.63	1.694775	0.30052	.	.	ENSG00000104976	ENST00000221573	T	0.53857	0.6	4.46	-4.55	0.03441	.	1.738350	0.02720	N	0.113853	T	0.46698	0.1406	L	0.60455	1.87	0.09310	N	1	B	0.23937	0.094	B	0.25614	0.062	T	0.45338	-0.9268	10	0.51188	T	0.08	2.1892	5.9782	0.19393	0.0917:0.5606:0.2163:0.1313	.	302	Q13487	SNPC2_HUMAN	N	302	ENSP00000221573:S302N	ENSP00000221573:S302N	S	+	2	0	SNAPC2	7893549	0.000000	0.05858	0.000000	0.03702	0.014000	0.08584	-0.106000	0.10890	-0.400000	0.07656	0.455000	0.32223	AGC	SNAPC2	-	pfam_SnAPC_su2-like		0.667	SNAPC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNAPC2	HGNC	protein_coding	OTTHUMT00000461358.1	G	NM_003083		7987549	+1	no_errors	ENST00000221573	ensembl	human	known	70_37	missense	SNP	0.000	A
SNORD3B-1	26851	genome.wustl.edu	37	17	18965611	18965611	+	lincRNA	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr17:18965611G>A	ENST00000363359.1	+	0	432				SNORD3B-2_ENST00000364880.1_lincRNA					small nucleolar RNA, C/D box 3B-1																		GTCTTGGCGCGAGGCGGGGGA	0.557																																																	0																																												780852			AF020534, AF020533, AF020532		17p11.2	2013-09-05	2006-11-28	2006-11-28	ENSG00000200229	ENSG00000265185			10168	non-coding RNA	RNA, small nucleolar			"""RNA, U3A1 small nucleolar, RNA, U3A1 small nucleolar"""	RNU3A1		9365252	Standard	NR_003271		Approved	U3a, U3b1, U3b2					17.37:g.18965611G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000363359.1	37	NULL		17																																																																																			SNORD3B-1	-	-		0.557	SNORD3B-1-201	KNOWN	basic	snoRNA	SNORD3B-2	Clone_based_vega_gene	lincRNA		G	NR_003271		18965611	+1	no_errors	ENST00000577988	ensembl	human	known	70_37	rna	SNP	0.011	A
SNTG2	54221	genome.wustl.edu	37	2	1357626	1357626	+	Intron	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:1357626G>C	ENST00000308624.5	+	17	1617				SNTG2_ENST00000407292.1_Intron	NM_018968.3	NP_061841.2	Q9NY99	SNTG2_HUMAN	syntrophin, gamma 2						central nervous system development (GO:0007417)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|syntrophin complex (GO:0016013)	PDZ domain binding (GO:0030165)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(9)|lung(20)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	52	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.00469)		all cancers(51;0.0178)|OV - Ovarian serous cystadenocarcinoma(76;0.07)|Epithelial(75;0.0864)|GBM - Glioblastoma multiforme(21;0.173)		GAGATTGATTGAGGACATTTG	0.443																																																	0																																										SO:0001627	intron_variant	54221			AJ003029	CCDS46220.1	2p25	2008-05-23			ENSG00000172554	ENSG00000172554			13741	protein-coding gene	gene with protein product		608715				10747910	Standard	NM_018968		Approved	SYN5, G2SYN	uc002qwq.3	Q9NY99	OTTHUMG00000151370	ENST00000308624.5:c.1489-13489G>C	2.37:g.1357626G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q05AH5	RNA	SNP	-	NULL	ENST00000308624.5	37	NULL	CCDS46220.1	2																																																																																			SNTG2	-	-		0.443	SNTG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SNTG2	HGNC	protein_coding	OTTHUMT00000322454.1	G	NM_018968		1357626	+1	no_errors	ENST00000472606	ensembl	human	known	70_37	rna	SNP	0.999	C
SNX20	124460	genome.wustl.edu	37	16	50707548	50707548	+	Silent	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:50707548G>A	ENST00000330943.4	-	4	891	c.720C>T	c.(718-720)ctC>ctT	p.L240L	RP11-401P9.5_ENST00000570167.1_RNA|SNX20_ENST00000423026.2_Intron|RP11-401P9.5_ENST00000570241.2_RNA|SNX20_ENST00000300590.3_Intron	NM_182854.2	NP_878274.1	Q7Z614	SNX20_HUMAN	sorting nexin 20	240					protein transport (GO:0015031)	endosome (GO:0005768)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	phosphatidylinositol binding (GO:0035091)			kidney(1)|large_intestine(3)|lung(5)|ovary(2)|prostate(1)|skin(2)|stomach(1)	15						CGGGGCGGTCGAGGTCGCGGT	0.751																																																	0													4.0	5.0	5.0					16																	50707548		1753	3448	5201	SO:0001819	synonymous_variant	124460			AK055837	CCDS10745.1, CCDS10744.1, CCDS45481.1	16q12.1	2008-03-25	2008-03-25		ENSG00000167208	ENSG00000167208		"""Sorting nexins"""	30390	protein-coding gene	gene with protein product	"""selectin ligand interactor cytoplasmic 1"""	613281				18196517, 16782399	Standard	NM_182854		Approved	SLIC-1, SLIC1	uc002egk.2	Q7Z614	OTTHUMG00000133173	ENST00000330943.4:c.720C>T	16.37:g.50707548G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9D5|Q08E98|Q6P4H2|Q8IV59	Silent	SNP	pfam_Phox,superfamily_Phox,smart_Phox,pfscan_Phox	p.L240	ENST00000330943.4	37	c.720	CCDS10745.1	16																																																																																			SNX20	-	NULL		0.751	SNX20-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SNX20	HGNC	protein_coding	OTTHUMT00000256879.2	G	NM_153337		50707548	-1	no_errors	ENST00000330943	ensembl	human	known	70_37	silent	SNP	0.864	A
SOGA3	387104	genome.wustl.edu	37	6	127837445	127837445	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr6:127837445C>T	ENST00000525778.1	-	2	1060	c.315G>A	c.(313-315)gcG>gcA	p.A105A	SOGA3_ENST00000368268.2_Silent_p.A105A|SOGA3_ENST00000556132.1_Silent_p.A105A|SOGA3_ENST00000465909.2_Silent_p.A105A|SOGA3_ENST00000481848.2_Silent_p.A105A			Q5TF21	SOGA3_HUMAN	SOGA family member 3	105	Gly-rich.				regulation of autophagy (GO:0010506)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)											CCAGGGGCGTCGCCTTCTCGG	0.736																																																	0													4.0	5.0	5.0					6																	127837445		1536	3592	5128	SO:0001819	synonymous_variant	387104			AK096490	CCDS43505.1	6q22.33	2013-03-28	2012-02-27	2012-02-27	ENSG00000214338	ENSG00000214338			21494	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 174"""	C6orf174			Standard	NM_001012279		Approved	dJ403A15.3	uc003qbd.3	Q5TF21	OTTHUMG00000166438	ENST00000525778.1:c.315G>A	6.37:g.127837445C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_DUF3166	p.A105	ENST00000525778.1	37	c.315	CCDS43505.1	6																																																																																			SOGA3	-	NULL		0.736	SOGA3-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	SOGA3	HGNC	protein_coding	OTTHUMT00000388246.1	C	NM_001012279		127837445	-1	no_errors	ENST00000368268	ensembl	human	known	70_37	silent	SNP	0.089	T
SOS2	6655	genome.wustl.edu	37	14	50597312	50597312	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:50597312C>G	ENST00000216373.5	-	20	3518	c.3244G>C	c.(3244-3246)Gca>Cca	p.A1082P	SOS2_ENST00000543680.1_Missense_Mutation_p.A1049P	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	1082					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1082P(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GAGGTTGGTGCTGACACTGTT	0.428																																																	2	Substitution - Missense(2)	cervix(2)											190.0	164.0	173.0					14																	50597312		2203	4300	6503	SO:0001583	missense	6655			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.3244G>C	14.37:g.50597312C>G	ENSP00000216373:p.Ala1082Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.A1082P	ENST00000216373.5	37	c.3244	CCDS9697.1	14	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448818	0.43531	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.80033	-1.33;-1.19	5.62	5.62	0.85841	.	0.168793	0.52532	D	0.000062	T	0.71417	0.3337	L	0.28115	0.83	0.40883	D	0.984015	B;B	0.12013	0.005;0.005	B;B	0.14023	0.01;0.01	T	0.67078	-0.5761	10	0.42905	T	0.14	.	15.169	0.72854	0.0:0.8594:0.1406:0.0	.	1049;1082	B7ZKT6;Q07890	.;SOS2_HUMAN	P	1082;1049	ENSP00000216373:A1082P;ENSP00000445328:A1049P	ENSP00000216373:A1082P	A	-	1	0	SOS2	49667062	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.112000	0.57845	2.657000	0.90304	0.484000	0.47621	GCA	SOS2	-	NULL		0.428	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	HGNC	protein_coding	OTTHUMT00000276878.2	C			50597312	-1	no_errors	ENST00000216373	ensembl	human	known	70_37	missense	SNP	1.000	G
SOS2	6655	genome.wustl.edu	37	14	50597312	50597312	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr14:50597312C>G	ENST00000216373.5	-	20	3518	c.3244G>C	c.(3244-3246)Gca>Cca	p.A1082P	SOS2_ENST00000543680.1_Missense_Mutation_p.A1049P	NM_006939.2	NP_008870.2	Q07890	SOS2_HUMAN	son of sevenless homolog 2 (Drosophila)	1082					apoptotic signaling pathway (GO:0097190)|axon guidance (GO:0007411)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of small GTPase mediated signal transduction (GO:0051057)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)	DNA binding (GO:0003677)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.A1082P(2)		cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|lung(16)|ovary(2)|skin(1)	39	all_epithelial(31;0.000822)|Breast(41;0.0065)					GAGGTTGGTGCTGACACTGTT	0.428																																																	2	Substitution - Missense(2)	cervix(2)											190.0	164.0	173.0					14																	50597312		2203	4300	6503	SO:0001583	missense	6655			L13858	CCDS9697.1	14q21	2013-01-10	2001-12-04		ENSG00000100485	ENSG00000100485		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11188	protein-coding gene	gene with protein product		601247	"""son of sevenless (Drosophilia) homolog 2"""			8276400	Standard	NM_006939		Approved		uc001wxs.4	Q07890	OTTHUMG00000140292	ENST00000216373.5:c.3244G>C	14.37:g.50597312C>G	ENSP00000216373:p.Ala1082Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKT6|D3DSB4|Q15503|Q17RN1	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Ras-like_Gua-exchang_fac_N,pfam_DH-domain,pfam_Pleckstrin_homology,pfam_Histone_core_D,superfamily_Ras_GEF_dom,superfamily_Histone-fold,superfamily_DH-domain,smart_DH-domain,smart_Pleckstrin_homology,smart_Ras-like_Gua-exchang_fac_N,smart_RasGRF_CDC25,pfscan_Pleckstrin_homology,pfscan_DH-domain,pfscan_RasGRF_CDC25,pfscan_Ras-like_Gua-exchang_fac_N	p.A1082P	ENST00000216373.5	37	c.3244	CCDS9697.1	14	.	.	.	.	.	.	.	.	.	.	C	14.15	2.448818	0.43531	.	.	ENSG00000100485	ENST00000216373;ENST00000543680	T;T	0.80033	-1.33;-1.19	5.62	5.62	0.85841	.	0.168793	0.52532	D	0.000062	T	0.71417	0.3337	L	0.28115	0.83	0.40883	D	0.984015	B;B	0.12013	0.005;0.005	B;B	0.14023	0.01;0.01	T	0.67078	-0.5761	10	0.42905	T	0.14	.	15.169	0.72854	0.0:0.8594:0.1406:0.0	.	1049;1082	B7ZKT6;Q07890	.;SOS2_HUMAN	P	1082;1049	ENSP00000216373:A1082P;ENSP00000445328:A1049P	ENSP00000216373:A1082P	A	-	1	0	SOS2	49667062	1.000000	0.71417	1.000000	0.80357	0.873000	0.50193	4.112000	0.57845	2.657000	0.90304	0.484000	0.47621	GCA	SOS2	-	NULL		0.428	SOS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SOS2	HGNC	protein_coding	OTTHUMT00000276878.2	C			50597312	-1	no_errors	ENST00000216373	ensembl	human	known	70_37	missense	SNP	1.000	G
SPG11	80208	genome.wustl.edu	37	15	44941174	44941174	+	Missense_Mutation	SNP	G	G	C	rs312262728		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:44941174G>C	ENST00000261866.7	-	7	1508	c.1492C>G	c.(1492-1494)Caa>Gaa	p.Q498E	SPG11_ENST00000558319.1_Missense_Mutation_p.Q498E|SPG11_ENST00000559193.1_Missense_Mutation_p.Q498E|SPG11_ENST00000427534.2_Missense_Mutation_p.Q498E|SPG11_ENST00000535302.2_Missense_Mutation_p.Q498E	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	498					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.Q498E(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AACTCTTCTTGAGTCAAACCA	0.363																																																	1	Substitution - Missense(1)	cervix(1)											87.0	85.0	85.0					15																	44941174		2198	4298	6496	SO:0001583	missense	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.1492C>G	15.37:g.44941174G>C	ENSP00000261866:p.Gln498Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.Q498E	ENST00000261866.7	37	c.1492	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152171	0.78001	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	D;T;T	0.81579	-1.51;-1.27;-1.26	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.89763	0.6809	M	0.71581	2.175	0.52501	D	0.999958	D;D;D;D	0.89917	1.0;1.0;0.996;0.999	D;D;D;D	0.87578	0.996;0.996;0.984;0.998	D	0.89787	0.3965	10	0.72032	D	0.01	.	19.7539	0.96283	0.0:0.0:1.0:0.0	.	498;498;498;498	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	E	498	ENSP00000261866:Q498E;ENSP00000445278:Q498E;ENSP00000396110:Q498E	ENSP00000261866:Q498E	Q	-	1	0	SPG11	42728466	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.657000	0.83745	2.770000	0.95276	0.563000	0.77884	CAA	SPG11	-	NULL		0.363	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	G			44941174	-1	no_errors	ENST00000261866	ensembl	human	known	70_37	missense	SNP	1.000	C
SPG11	80208	genome.wustl.edu	37	15	44941174	44941174	+	Missense_Mutation	SNP	G	G	C	rs312262728		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:44941174G>C	ENST00000261866.7	-	7	1508	c.1492C>G	c.(1492-1494)Caa>Gaa	p.Q498E	SPG11_ENST00000558319.1_Missense_Mutation_p.Q498E|SPG11_ENST00000559193.1_Missense_Mutation_p.Q498E|SPG11_ENST00000427534.2_Missense_Mutation_p.Q498E|SPG11_ENST00000535302.2_Missense_Mutation_p.Q498E	NM_025137.3	NP_079413.3	Q96JI7	SPTCS_HUMAN	spastic paraplegia 11 (autosomal recessive)	498					cell death (GO:0008219)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)		p.Q498E(1)		autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(4)|large_intestine(16)|lung(24)|ovary(5)|prostate(3)|skin(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	72		all_cancers(109;1.29e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;1.34e-07)|all_lung(180;1.21e-06)|Melanoma(134;0.0122)		all cancers(107;2.93e-22)|GBM - Glioblastoma multiforme(94;1.55e-06)|COAD - Colon adenocarcinoma(120;0.0432)|Colorectal(105;0.0484)|Lung(196;0.104)|LUSC - Lung squamous cell carcinoma(244;0.214)		AACTCTTCTTGAGTCAAACCA	0.363																																																	1	Substitution - Missense(1)	cervix(1)											87.0	85.0	85.0					15																	44941174		2198	4298	6496	SO:0001583	missense	80208				CCDS10112.1, CCDS53939.1	15q13-q15	2007-11-13			ENSG00000104133	ENSG00000104133			11226	protein-coding gene	gene with protein product	"""spatacsin"""	610844	"""KIAA1840"""	KIAA1840		10408536, 17322883	Standard	NM_001160227		Approved	FLJ21439	uc001ztx.3	Q96JI7	OTTHUMG00000131199	ENST00000261866.7:c.1492C>G	15.37:g.44941174G>C	ENSP00000261866:p.Gln498Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAX9|B9EK60|F5H3N6|Q4VC11|Q58G86|Q69YG6|Q6NW01|Q8N270|Q8TBU9|Q9H734	Missense_Mutation	SNP	NULL	p.Q498E	ENST00000261866.7	37	c.1492	CCDS10112.1	15	.	.	.	.	.	.	.	.	.	.	G	21.5	4.152171	0.78001	.	.	ENSG00000104133	ENST00000261866;ENST00000535302;ENST00000427534	D;T;T	0.81579	-1.51;-1.27;-1.26	5.85	5.85	0.93711	.	0.000000	0.85682	D	0.000000	D	0.89763	0.6809	M	0.71581	2.175	0.52501	D	0.999958	D;D;D;D	0.89917	1.0;1.0;0.996;0.999	D;D;D;D	0.87578	0.996;0.996;0.984;0.998	D	0.89787	0.3965	10	0.72032	D	0.01	.	19.7539	0.96283	0.0:0.0:1.0:0.0	.	498;498;498;498	C4B7M2;F5H3N6;B9EK60;Q96JI7	.;.;.;SPTCS_HUMAN	E	498	ENSP00000261866:Q498E;ENSP00000445278:Q498E;ENSP00000396110:Q498E	ENSP00000261866:Q498E	Q	-	1	0	SPG11	42728466	1.000000	0.71417	1.000000	0.80357	0.814000	0.46013	7.657000	0.83745	2.770000	0.95276	0.563000	0.77884	CAA	SPG11	-	NULL		0.363	SPG11-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPG11	HGNC	protein_coding	OTTHUMT00000253927.1	G			44941174	-1	no_errors	ENST00000261866	ensembl	human	known	70_37	missense	SNP	1.000	C
ST5	6764	genome.wustl.edu	37	11	8725068	8725068	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:8725068G>A	ENST00000534127.1	-	17	2957				ST5_ENST00000534278.1_Intron|ST5_ENST00000530991.1_Intron|ST5_ENST00000526757.1_Intron|ST5_ENST00000526099.1_Intron|RPL27A_ENST00000531102.1_Intron|ST5_ENST00000530438.1_Intron|ST5_ENST00000313726.6_Intron|ST5_ENST00000357665.1_Intron	NM_005418.3	NP_005409.3	P78524	ST5_HUMAN	suppression of tumorigenicity 5						positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of Rab GTPase activity (GO:0032851)		Rab guanyl-nucleotide exchange factor activity (GO:0017112)			NS(1)|breast(2)|endometrium(5)|kidney(3)|large_intestine(13)|liver(1)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	39				Epithelial(150;2.63e-07)|BRCA - Breast invasive adenocarcinoma(625;0.0352)		CGCTCAGGCCGTGCCAAAGCA	0.617																																																	0																																										SO:0001627	intron_variant	6764			U15131	CCDS7791.1, CCDS7792.1	11p15	2012-10-04				ENSG00000166444		"""DENN/MADD domain containing"""	11350	protein-coding gene	gene with protein product	"""DENN/MADD domain containing 2B"""	140750				1390339	Standard	NM_005418		Approved	HTS1, DENND2B, p126	uc001mgt.3	P78524		ENST00000534127.1:c.2572-801C>T	11.37:g.8725068G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6X7|B3KXQ6|P78523|Q16492|Q7KYY2|Q7KZ12|Q8NE12|Q9BQQ6	RNA	SNP	-	NULL	ENST00000534127.1	37	NULL	CCDS7791.1	11																																																																																			ST5	-	-		0.617	ST5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ST5	HGNC	protein_coding	OTTHUMT00000386518.1	G	NM_005418		8725068	-1	no_errors	ENST00000526837	ensembl	human	known	70_37	rna	SNP	0.000	A
ST8SIA3	51046	genome.wustl.edu	37	18	55020123	55020123	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr18:55020123G>A	ENST00000324000.3	+	1	2080	c.46G>A	c.(46-48)Gtc>Atc	p.V16I		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	16					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.V16I(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GCTGGGGCTGGTCATGCTCAG	0.602																																																	1	Substitution - Missense(1)	cervix(1)											66.0	64.0	65.0					18																	55020123		2203	4300	6503	SO:0001583	missense	51046			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.46G>A	18.37:g.55020123G>A	ENSP00000320431:p.Val16Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.V16I	ENST00000324000.3	37	c.46	CCDS32834.1	18	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825918	0.50739	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.49139	0.79	4.55	2.7	0.31948	.	0.195530	0.43260	N	0.000581	T	0.34483	0.0899	L	0.44542	1.39	0.50467	D	0.999875	B	0.02656	0.0	B	0.04013	0.001	T	0.08785	-1.0705	10	0.17369	T	0.5	.	8.6077	0.33784	0.0869:0.1537:0.7593:0.0	.	16	O43173	SIA8C_HUMAN	I	123;16	ENSP00000320431:V16I	ENSP00000320431:V16I	V	+	1	0	ST8SIA3	53171121	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	2.327000	0.43858	0.345000	0.23873	0.491000	0.48974	GTC	ST8SIA3	-	pirsf_Sialyl_trans		0.602	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	G	NM_015879		55020123	+1	no_errors	ENST00000324000	ensembl	human	known	70_37	missense	SNP	1.000	A
ST8SIA3	51046	genome.wustl.edu	37	18	55020123	55020123	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr18:55020123G>A	ENST00000324000.3	+	1	2080	c.46G>A	c.(46-48)Gtc>Atc	p.V16I		NM_015879.2	NP_056963.2	O43173	SIA8C_HUMAN	ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 3	16					cellular protein metabolic process (GO:0044267)|ganglioside biosynthetic process (GO:0001574)|glycoprotein metabolic process (GO:0009100)|glycosphingolipid biosynthetic process (GO:0006688)|N-glycan processing (GO:0006491)|oligosaccharide metabolic process (GO:0009311)|post-translational protein modification (GO:0043687)|protein glycosylation (GO:0006486)|protein N-linked glycosylation via asparagine (GO:0018279)|sialylation (GO:0097503)	Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)	alpha-N-acetylneuraminate alpha-2,8-sialyltransferase activity (GO:0003828)|sialic acid binding (GO:0033691)	p.V16I(1)		breast(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(16)|prostate(1)|skin(3)	36				READ - Rectum adenocarcinoma(59;0.19)|Colorectal(16;0.205)		GCTGGGGCTGGTCATGCTCAG	0.602																																																	1	Substitution - Missense(1)	cervix(1)											66.0	64.0	65.0					18																	55020123		2203	4300	6503	SO:0001583	missense	51046			AF004668	CCDS32834.1	18q21.31	2013-03-01	2005-02-07	2005-02-07	ENSG00000177511	ENSG00000177511		"""Sialyltransferases"""	14269	protein-coding gene	gene with protein product	"""ST8Sia III"""	609478	"""sialyltransferase 8C (alpha2,3Galbeta1,4GlcNAcalpha 2,8-sialyltransferase)"""	SIAT8C			Standard	NM_015879		Approved		uc002lgn.3	O43173	OTTHUMG00000180101	ENST00000324000.3:c.46G>A	18.37:g.55020123G>A	ENSP00000320431:p.Val16Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0F2|Q6B085|Q9NS41	Missense_Mutation	SNP	pfam_Glyco_trans_29,pirsf_Sialyl_trans	p.V16I	ENST00000324000.3	37	c.46	CCDS32834.1	18	.	.	.	.	.	.	.	.	.	.	G	15.41	2.825918	0.50739	.	.	ENSG00000177511	ENST00000541833;ENST00000324000	T	0.49139	0.79	4.55	2.7	0.31948	.	0.195530	0.43260	N	0.000581	T	0.34483	0.0899	L	0.44542	1.39	0.50467	D	0.999875	B	0.02656	0.0	B	0.04013	0.001	T	0.08785	-1.0705	10	0.17369	T	0.5	.	8.6077	0.33784	0.0869:0.1537:0.7593:0.0	.	16	O43173	SIA8C_HUMAN	I	123;16	ENSP00000320431:V16I	ENSP00000320431:V16I	V	+	1	0	ST8SIA3	53171121	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	2.327000	0.43858	0.345000	0.23873	0.491000	0.48974	GTC	ST8SIA3	-	pirsf_Sialyl_trans		0.602	ST8SIA3-001	KNOWN	upstream_uORF|basic|appris_principal|CCDS	protein_coding	ST8SIA3	HGNC	protein_coding	OTTHUMT00000449765.1	G	NM_015879		55020123	+1	no_errors	ENST00000324000	ensembl	human	known	70_37	missense	SNP	1.000	A
STRN	6801	genome.wustl.edu	37	2	37193479	37193480	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:37193479_37193480insC	ENST00000263918.4	-	1	135_136	c.127_128insG	c.(127-129)gccfs	p.A43fs	STRN_ENST00000379213.2_Frame_Shift_Ins_p.A31fs	NM_003162.3	NP_003153.2	O43815	STRN_HUMAN	striatin, calmodulin binding protein	43					dendrite development (GO:0016358)|locomotory behavior (GO:0007626)|negative regulation of cell proliferation (GO:0008285)|tight junction assembly (GO:0070830)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|tight junction (GO:0005923)	armadillo repeat domain binding (GO:0070016)|calmodulin binding (GO:0005516)|estrogen receptor binding (GO:0030331)|protein complex binding (GO:0032403)|protein phosphatase 2A binding (GO:0051721)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(16)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	33		Ovarian(717;0.0129)|all_hematologic(82;0.21)				CTGGGCTCGGgccgcccccgcc	0.748																																																	0																																										SO:0001589	frameshift_variant	6801			AJ223814	CCDS1784.1	2p22.2	2013-01-10	2001-11-28		ENSG00000115808	ENSG00000115808		"""WD repeat domain containing"""	11424	protein-coding gene	gene with protein product		614765	"""striatin, calmodulin-binding protein"""			9693043, 8769426	Standard	NM_003162		Approved	SG2NA	uc002rpn.3	O43815	OTTHUMG00000100959	ENST00000263918.4:c.128dupG	2.37:g.37193481_37193481dupC	ENSP00000263918:p.Ala43fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KP65|Q53TQ8|Q9NP38	Frame_Shift_Ins	INS	pfam_Striatin_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.A43fs	ENST00000263918.4	37	c.128_127	CCDS1784.1	2																																																																																			STRN	-	NULL		0.748	STRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STRN	HGNC	protein_coding	OTTHUMT00000218568.1	-			37193480	-1	no_errors	ENST00000263918	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	C
TAS2R16	50833	genome.wustl.edu	37	7	122634943	122634943	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:122634943C>T	ENST00000249284.2	-	1	811	c.746G>A	c.(745-747)gGt>gAt	p.G249D		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	249					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)	p.G249D(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AAATAGAGTACCTATAATGGT	0.428																																																	1	Substitution - Missense(1)	cervix(1)											128.0	122.0	124.0					7																	122634943		2203	4300	6503	SO:0001583	missense	50833			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.746G>A	7.37:g.122634943C>T	ENSP00000249284:p.Gly249Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.G249D	ENST00000249284.2	37	c.746	CCDS5785.1	7	.	.	.	.	.	.	.	.	.	.	C	1.145	-0.648449	0.03506	.	.	ENSG00000128519	ENST00000249284	T	0.37411	1.2	4.67	-6.08	0.02151	.	1.821080	0.02999	N	0.147885	T	0.23532	0.0569	L	0.45137	1.4	0.09310	N	1	B	0.20261	0.043	B	0.23018	0.043	T	0.12656	-1.0539	10	0.14656	T	0.56	.	2.1544	0.03808	0.1193:0.1828:0.2284:0.4695	.	249	Q9NYV7	T2R16_HUMAN	D	249	ENSP00000249284:G249D	ENSP00000249284:G249D	G	-	2	0	TAS2R16	122422179	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.207000	0.00558	-1.151000	0.02836	-0.345000	0.07892	GGT	TAS2R16	-	pfam_TAS2_rcpt		0.428	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	HGNC	protein_coding	OTTHUMT00000347409.1	C	NM_016945		122634943	-1	no_errors	ENST00000249284	ensembl	human	known	70_37	missense	SNP	0.000	T
TAS2R16	50833	genome.wustl.edu	37	7	122634943	122634943	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:122634943C>T	ENST00000249284.2	-	1	811	c.746G>A	c.(745-747)gGt>gAt	p.G249D		NM_016945.2	NP_058641.1	Q9NYV7	T2R16_HUMAN	taste receptor, type 2, member 16	249					detection of chemical stimulus involved in sensory perception of bitter taste (GO:0001580)|G-protein coupled receptor signaling pathway (GO:0007186)	endoplasmic reticulum (GO:0005783)|external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	bitter taste receptor activity (GO:0033038)	p.G249D(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(18)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31						AAATAGAGTACCTATAATGGT	0.428																																																	1	Substitution - Missense(1)	cervix(1)											128.0	122.0	124.0					7																	122634943		2203	4300	6503	SO:0001583	missense	50833			AF227139	CCDS5785.1	7q31.1-q31.3	2012-08-22			ENSG00000128519	ENSG00000128519		"""Taste receptors / Type 2"", ""GPCR / Unclassified : Taste receptors"""	14921	protein-coding gene	gene with protein product		604867				10761934	Standard	NM_016945		Approved	T2R16	uc003vkl.1	Q9NYV7	OTTHUMG00000157090	ENST00000249284.2:c.746G>A	7.37:g.122634943C>T	ENSP00000249284:p.Gly249Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0X2|Q502V3|Q549U8|Q645W1	Missense_Mutation	SNP	pfam_TAS2_rcpt	p.G249D	ENST00000249284.2	37	c.746	CCDS5785.1	7	.	.	.	.	.	.	.	.	.	.	C	1.145	-0.648449	0.03506	.	.	ENSG00000128519	ENST00000249284	T	0.37411	1.2	4.67	-6.08	0.02151	.	1.821080	0.02999	N	0.147885	T	0.23532	0.0569	L	0.45137	1.4	0.09310	N	1	B	0.20261	0.043	B	0.23018	0.043	T	0.12656	-1.0539	10	0.14656	T	0.56	.	2.1544	0.03808	0.1193:0.1828:0.2284:0.4695	.	249	Q9NYV7	T2R16_HUMAN	D	249	ENSP00000249284:G249D	ENSP00000249284:G249D	G	-	2	0	TAS2R16	122422179	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-3.207000	0.00558	-1.151000	0.02836	-0.345000	0.07892	GGT	TAS2R16	-	pfam_TAS2_rcpt		0.428	TAS2R16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAS2R16	HGNC	protein_coding	OTTHUMT00000347409.1	C	NM_016945		122634943	-1	no_errors	ENST00000249284	ensembl	human	known	70_37	missense	SNP	0.000	T
TENM4	26011	genome.wustl.edu	37	11	78412896	78412896	+	Silent	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:78412896G>A	ENST00000278550.7	-	28	5224	c.4762C>T	c.(4762-4764)Ctg>Ttg	p.L1588L		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1588					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.L1588L(2)									GTATCAAACAGATAGAGCTCC	0.507																																																	2	Substitution - coding silent(2)	cervix(2)											126.0	129.0	128.0					11																	78412896		2039	4177	6216	SO:0001819	synonymous_variant	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.4762C>T	11.37:g.78412896G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.L1588	ENST00000278550.7	37	c.4762	CCDS44688.1	11																																																																																			TENM4	-	NULL		0.507	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	G			78412896	-1	no_errors	ENST00000278550	ensembl	human	known	70_37	silent	SNP	1.000	A
TENM4	26011	genome.wustl.edu	37	11	78412896	78412896	+	Silent	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr11:78412896G>A	ENST00000278550.7	-	28	5224	c.4762C>T	c.(4762-4764)Ctg>Ttg	p.L1588L		NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	1588					cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)	p.L1588L(2)									GTATCAAACAGATAGAGCTCC	0.507																																																	2	Substitution - coding silent(2)	cervix(2)											126.0	129.0	128.0					11																	78412896		2039	4177	6216	SO:0001819	synonymous_variant	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.4762C>T	11.37:g.78412896G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Silent	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.L1588	ENST00000278550.7	37	c.4762	CCDS44688.1	11																																																																																			TENM4	-	NULL		0.507	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	G			78412896	-1	no_errors	ENST00000278550	ensembl	human	known	70_37	silent	SNP	1.000	A
THAP7	80764	genome.wustl.edu	37	22	21354220	21354220	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:21354220C>T	ENST00000215742.4	-	4	1053	c.879G>A	c.(877-879)ctG>ctA	p.L293L	THAP7-AS1_ENST00000429962.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7_ENST00000399133.2_Silent_p.L293L|THAP7-AS1_ENST00000436079.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	293					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)	p.L293L(2)		cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CATGCTCCTTCAGAGTCTGGC	0.657																																																	2	Substitution - coding silent(2)	cervix(1)|lung(1)											31.0	32.0	32.0					22																	21354220		2201	4298	6499	SO:0001819	synonymous_variant	80764			BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.879G>A	22.37:g.21354220C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD97|D3DX40	Silent	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.L293	ENST00000215742.4	37	c.879	CCDS13787.1	22																																																																																			THAP7	-	NULL		0.657	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP7	HGNC	protein_coding	OTTHUMT00000320405.1	C	NM_030573		21354220	-1	no_errors	ENST00000215742	ensembl	human	known	70_37	silent	SNP	1.000	T
THAP7	80764	genome.wustl.edu	37	22	21354220	21354220	+	Silent	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:21354220C>T	ENST00000215742.4	-	4	1053	c.879G>A	c.(877-879)ctG>ctA	p.L293L	THAP7-AS1_ENST00000429962.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7_ENST00000399133.2_Silent_p.L293L|THAP7-AS1_ENST00000436079.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	293					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)	p.L293L(2)		cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CATGCTCCTTCAGAGTCTGGC	0.657																																																	2	Substitution - coding silent(2)	cervix(1)|lung(1)											31.0	32.0	32.0					22																	21354220		2201	4298	6499	SO:0001819	synonymous_variant	80764			BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.879G>A	22.37:g.21354220C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD97|D3DX40	Silent	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.L293	ENST00000215742.4	37	c.879	CCDS13787.1	22																																																																																			THAP7	-	NULL		0.657	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP7	HGNC	protein_coding	OTTHUMT00000320405.1	C	NM_030573		21354220	-1	no_errors	ENST00000215742	ensembl	human	known	70_37	silent	SNP	1.000	T
TMEM132B	114795	genome.wustl.edu	37	12	126128683	126128683	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:126128683C>T	ENST00000299308.3	+	6	1492	c.1484C>T	c.(1483-1485)aCg>aTg	p.T495M	TMEM132B_ENST00000535886.1_Missense_Mutation_p.T7M	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	495						integral component of membrane (GO:0016021)		p.T495M(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAAGTGGACACGATTGTGAAC	0.507																																																	1	Substitution - Missense(1)	cervix(1)											106.0	105.0	106.0					12																	126128683		2018	4177	6195	SO:0001583	missense	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1484C>T	12.37:g.126128683C>T	ENSP00000299308:p.Thr495Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	NULL	p.T495M	ENST00000299308.3	37	c.1484	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	C	13.28	2.191203	0.38707	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.39592	1.07;1.07	5.52	5.52	0.82312	.	0.229812	0.37761	N	0.001941	T	0.33469	0.0864	L	0.29908	0.895	0.49389	D	0.999785	P	0.38978	0.652	B	0.31946	0.138	T	0.19943	-1.0290	10	0.54805	T	0.06	.	19.4324	0.94776	0.0:1.0:0.0:0.0	.	495	Q14DG7	T132B_HUMAN	M	495;7	ENSP00000299308:T495M;ENSP00000440436:T7M	ENSP00000299308:T495M	T	+	2	0	TMEM132B	124694636	1.000000	0.71417	0.972000	0.41901	0.076000	0.17211	5.363000	0.66104	2.578000	0.87016	0.655000	0.94253	ACG	TMEM132B	-	NULL		0.507	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	HGNC	protein_coding	OTTHUMT00000400043.1	C	NM_052907		126128683	+1	no_errors	ENST00000299308	ensembl	human	known	70_37	missense	SNP	1.000	T
TMEM132B	114795	genome.wustl.edu	37	12	126128683	126128683	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:126128683C>T	ENST00000299308.3	+	6	1492	c.1484C>T	c.(1483-1485)aCg>aTg	p.T495M	TMEM132B_ENST00000535886.1_Missense_Mutation_p.T7M	NM_052907.2	NP_443139.2	Q14DG7	T132B_HUMAN	transmembrane protein 132B	495						integral component of membrane (GO:0016021)		p.T495M(1)		NS(1)|breast(9)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(45)|ovary(5)|pancreas(1)|prostate(4)|skin(15)|upper_aerodigestive_tract(3)|urinary_tract(1)	107	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000423)|Epithelial(86;0.00394)|all cancers(50;0.0362)		AAAGTGGACACGATTGTGAAC	0.507																																																	1	Substitution - Missense(1)	cervix(1)											106.0	105.0	106.0					12																	126128683		2018	4177	6195	SO:0001583	missense	114795			AB067493	CCDS41859.1, CCDS66501.1	12q24.31	2006-03-02							29397	protein-coding gene	gene with protein product						11572484	Standard	NM_001286219		Approved	KIAA1906, KIAA1786	uc001uhe.1	Q14DG7		ENST00000299308.3:c.1484C>T	12.37:g.126128683C>T	ENSP00000299308:p.Thr495Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRG8|Q8NA73|Q96JN9|Q96PY1	Missense_Mutation	SNP	NULL	p.T495M	ENST00000299308.3	37	c.1484	CCDS41859.1	12	.	.	.	.	.	.	.	.	.	.	C	13.28	2.191203	0.38707	.	.	ENSG00000139364	ENST00000299308;ENST00000535886	T;T	0.39592	1.07;1.07	5.52	5.52	0.82312	.	0.229812	0.37761	N	0.001941	T	0.33469	0.0864	L	0.29908	0.895	0.49389	D	0.999785	P	0.38978	0.652	B	0.31946	0.138	T	0.19943	-1.0290	10	0.54805	T	0.06	.	19.4324	0.94776	0.0:1.0:0.0:0.0	.	495	Q14DG7	T132B_HUMAN	M	495;7	ENSP00000299308:T495M;ENSP00000440436:T7M	ENSP00000299308:T495M	T	+	2	0	TMEM132B	124694636	1.000000	0.71417	0.972000	0.41901	0.076000	0.17211	5.363000	0.66104	2.578000	0.87016	0.655000	0.94253	ACG	TMEM132B	-	NULL		0.507	TMEM132B-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM132B	HGNC	protein_coding	OTTHUMT00000400043.1	C	NM_052907		126128683	+1	no_errors	ENST00000299308	ensembl	human	known	70_37	missense	SNP	1.000	T
TNRC18	84629	genome.wustl.edu	37	7	5401610	5401610	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:5401610G>A	ENST00000430969.1	-	13	4798	c.4450C>T	c.(4450-4452)Cgg>Tgg	p.R1484W	TNRC18_ENST00000399537.4_Missense_Mutation_p.R1484W	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1484							chromatin binding (GO:0003682)	p.R1484W(2)|p.R539W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		AGCCGCATCCGGAAGTCCAGC	0.657																																																	3	Substitution - Missense(3)	cervix(3)											21.0	25.0	24.0					7																	5401610		2072	4202	6274	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4450C>T	7.37:g.5401610G>A	ENSP00000395538:p.Arg1484Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.R1484W	ENST00000430969.1	37	c.4450	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104704	0.77096	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.44083	0.95;0.93;1.65	5.52	4.61	0.57282	.	0.000000	0.41500	D	0.000872	T	0.64283	0.2584	M	0.78637	2.42	0.52099	D	0.999943	D	0.89917	1.0	D	0.91635	0.999	T	0.68232	-0.5463	10	0.87932	D	0	.	13.3846	0.60789	0.0:0.0:0.6705:0.3295	.	1484	O15417	TNC18_HUMAN	W	1484;1484;539;17	ENSP00000382452:R1484W;ENSP00000395538:R1484W;ENSP00000395990:R17W	ENSP00000382452:R1484W	R	-	1	2	TNRC18	5368136	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.237000	0.58681	2.606000	0.88127	0.561000	0.74099	CGG	TNRC18	-	NULL		0.657	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		G			5401610	-1	no_errors	ENST00000399537	ensembl	human	known	70_37	missense	SNP	1.000	A
TNRC18	84629	genome.wustl.edu	37	7	5401610	5401610	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr7:5401610G>A	ENST00000430969.1	-	13	4798	c.4450C>T	c.(4450-4452)Cgg>Tgg	p.R1484W	TNRC18_ENST00000399537.4_Missense_Mutation_p.R1484W	NM_001080495.2	NP_001073964.2	O15417	TNC18_HUMAN	trinucleotide repeat containing 18	1484							chromatin binding (GO:0003682)	p.R1484W(2)|p.R539W(1)		central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(8)	11		Ovarian(82;0.142)		UCEC - Uterine corpus endometrioid carcinoma (126;0.195)|OV - Ovarian serous cystadenocarcinoma(56;5.32e-15)		AGCCGCATCCGGAAGTCCAGC	0.657																																																	3	Substitution - Missense(3)	cervix(3)											21.0	25.0	24.0					7																	5401610		2072	4202	6274	SO:0001583	missense	84629			U80753	CCDS47534.1	7p22.1	2012-04-17			ENSG00000182095	ENSG00000182095		"""Trinucleotide (CAG) repeat containing"""	11962	protein-coding gene	gene with protein product						9225980	Standard	NM_001080495		Approved	CAGL79, TNRC18A, KIAA1856	uc003soi.4	O15417	OTTHUMG00000151831	ENST00000430969.1:c.4450C>T	7.37:g.5401610G>A	ENSP00000395538:p.Arg1484Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MX41|Q96JH1|Q96K91	Missense_Mutation	SNP	pfam_BAH_dom,smart_BAH_dom,pfscan_BAH_dom	p.R1484W	ENST00000430969.1	37	c.4450	CCDS47534.1	7	.	.	.	.	.	.	.	.	.	.	G	21.1	4.104704	0.77096	.	.	ENSG00000182095	ENST00000399537;ENST00000430969;ENST00000399544;ENST00000440081	T;T;T	0.44083	0.95;0.93;1.65	5.52	4.61	0.57282	.	0.000000	0.41500	D	0.000872	T	0.64283	0.2584	M	0.78637	2.42	0.52099	D	0.999943	D	0.89917	1.0	D	0.91635	0.999	T	0.68232	-0.5463	10	0.87932	D	0	.	13.3846	0.60789	0.0:0.0:0.6705:0.3295	.	1484	O15417	TNC18_HUMAN	W	1484;1484;539;17	ENSP00000382452:R1484W;ENSP00000395538:R1484W;ENSP00000395990:R17W	ENSP00000382452:R1484W	R	-	1	2	TNRC18	5368136	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.237000	0.58681	2.606000	0.88127	0.561000	0.74099	CGG	TNRC18	-	NULL		0.657	TNRC18-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TNRC18	HGNC	protein_coding		G			5401610	-1	no_errors	ENST00000399537	ensembl	human	known	70_37	missense	SNP	1.000	A
TPTE	7179	genome.wustl.edu	37	21	10942949	10942949	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr21:10942949C>T	ENST00000361285.4	-	12	967	c.638G>A	c.(637-639)aGa>aAa	p.R213K	TPTE_ENST00000342420.5_Missense_Mutation_p.R175K|TPTE_ENST00000298232.7_Missense_Mutation_p.R195K|TPTE_ENST00000415664.2_5'UTR	NM_199261.2	NP_954870	P56180	TPTE_HUMAN	transmembrane phosphatase with tensin homology	213					peptidyl-tyrosine dephosphorylation (GO:0035335)|protein dephosphorylation (GO:0006470)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)	ion channel activity (GO:0005216)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)	p.R195K(1)|p.R213K(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(19)|lung(76)|ovary(2)|prostate(2)|skin(8)|urinary_tract(1)	130			Colorectal(6;3.44e-05)|COAD - Colon adenocarcinoma(6;0.00727)|READ - Rectum adenocarcinoma(6;0.0723)	UCEC - Uterine corpus endometrioid carcinoma (6;0.0974)|all cancers(6;2.54e-22)|Epithelial(6;4.21e-19)|OV - Ovarian serous cystadenocarcinoma(6;1.16e-09)|BRCA - Breast invasive adenocarcinoma(6;7.72e-05)|Lung(8;0.000189)|LUSC - Lung squamous cell carcinoma(6;0.00379)|GBM - Glioblastoma multiforme(6;0.00391)|Kidney(17;0.0773)|LUAD - Lung adenocarcinoma(8;0.247)		TTCAAGTTGTCTTTTTTGATG	0.323																																																	2	Substitution - Missense(2)	cervix(2)											94.0	87.0	90.0					21																	10942949		2203	4299	6502	SO:0001583	missense	7179			AF007118	CCDS74771.1, CCDS74772.1, CCDS74773.1	21p11	2011-06-09			ENSG00000166157	ENSG00000274391		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : PTENs"""	12023	protein-coding gene	gene with protein product	"""PTEN-related tyrosine phosphatase"", ""cancer/testis antigen 44"""	604336				10830953, 14659893	Standard	NM_001290224		Approved	PTEN2, CT44	uc002yip.1	P56180	OTTHUMG00000074127	ENST00000361285.4:c.638G>A	21.37:g.10942949C>T	ENSP00000355208:p.Arg213Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAP7|C9J6D6|C9JKK8|Q6XPS4|Q6XPS5|Q71JA8|Q8NCS8	Missense_Mutation	SNP	pfam_Tensin_phosphatase_C2-dom,pfam_Dual-sp_phosphatase_cat-dom,pfam_Ion_trans_dom,superfamily_C2_Ca/lipid-bd_dom_CaLB,pfscan_Tyr/Dual-specificity_Pase,pfscan_Phosphatase_tensin-typ,pfscan_Tensin_phosphatase_C2-dom	p.R213K	ENST00000361285.4	37	c.638	CCDS13560.2	21	.	.	.	.	.	.	.	.	.	.	.	6.682	0.494506	0.12702	.	.	ENSG00000166157	ENST00000298232;ENST00000361285;ENST00000342420	D;D;D	0.98381	-4.9;-4.9;-4.9	2.07	2.07	0.26955	Ion transport (1);	0.166921	0.52532	U	0.000074	D	0.94981	0.8376	N	0.22421	0.69	0.36008	D	0.83786	B;B;B	0.24317	0.042;0.082;0.101	B;B;B	0.37091	0.051;0.091;0.241	D	0.92281	0.5833	10	0.16420	T	0.52	-13.1627	10.2257	0.43225	0.0:1.0:0.0:0.0	.	175;195;213	P56180-3;P56180-2;P56180	.;.;TPTE_HUMAN	K	195;213;175	ENSP00000298232:R195K;ENSP00000355208:R213K;ENSP00000344441:R175K	ENSP00000298232:R195K	R	-	2	0	TPTE	9964820	0.999000	0.42202	0.868000	0.34077	0.079000	0.17450	0.422000	0.21296	1.470000	0.48102	0.194000	0.17425	AGA	TPTE	-	pfam_Ion_trans_dom		0.323	TPTE-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TPTE	HGNC	protein_coding	OTTHUMT00000157413.1	C			10942949	-1	no_errors	ENST00000361285	ensembl	human	known	70_37	missense	SNP	1.000	T
TRAF5	7188	genome.wustl.edu	37	1	211532937	211532937	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:211532937G>A	ENST00000261464.5	+	5	432				TRAF5_ENST00000336184.2_Intron|TRAF5_ENST00000427925.2_Intron|TRAF5_ENST00000462410.1_3'UTR|TRAF5_ENST00000367004.3_Intron	NM_001033910.2	NP_001029082.1	O00463	TRAF5_HUMAN	TNF receptor-associated factor 5						apoptotic process (GO:0006915)|positive regulation of cell proliferation (GO:0008284)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	CD40 receptor complex (GO:0035631)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytosol (GO:0005829)	signal transducer activity (GO:0004871)|thioesterase binding (GO:0031996)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(8)|lung(6)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29				OV - Ovarian serous cystadenocarcinoma(81;0.00946)|all cancers(67;0.0808)|Epithelial(68;0.144)		GAACTAACCTGAGAATATGAG	0.408																																																	0																																										SO:0001627	intron_variant	7188			AB000509	CCDS1497.1	1q32	2008-02-05			ENSG00000082512	ENSG00000082512		"""RING-type (C3HC4) zinc fingers"""	12035	protein-coding gene	gene with protein product		602356				9126477	Standard	NM_001033910		Approved	RNF84	uc001hii.3	O00463	OTTHUMG00000036997	ENST00000261464.5:c.379-317G>A	1.37:g.211532937G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DIS9|B4E0A2|Q6FHY1	RNA	SNP	-	NULL	ENST00000261464.5	37	NULL	CCDS1497.1	1																																																																																			TRAF5	-	-		0.408	TRAF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRAF5	HGNC	protein_coding	OTTHUMT00000089825.1	G	NM_004619		211532937	+1	no_errors	ENST00000462410	ensembl	human	known	70_37	rna	SNP	0.007	A
TSSC1	7260	genome.wustl.edu	37	2	3323586	3323586	+	Intron	SNP	G	G	A	rs77535814|rs71412006		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:3323586G>A	ENST00000382125.4	-	3	452				TSSC1_ENST00000478754.1_5'UTR|TSSC1_ENST00000443925.2_Intron|TSSC1_ENST00000398659.4_Intron	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1											breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		GGGCAACACCGCACCTGCAGG	0.652																																					Colon(140;1261 1762 4183 34270 49743)												0																																										SO:0001627	intron_variant	7260			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.259+18201C>T	2.37:g.3323586G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D6W4Y1|O43179|Q53S19|Q53SG2	RNA	SNP	-	NULL	ENST00000382125.4	37	NULL	CCDS1651.1	2																																																																																			TSSC1	-	-		0.652	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC1	HGNC	protein_coding	OTTHUMT00000206694.2	G	NM_003310		3323586	-1	no_errors	ENST00000478754	ensembl	human	known	70_37	rna	SNP	0.735	A
TSSC1	7260	genome.wustl.edu	37	2	3323588	3323588	+	Intron	SNP	A	A	C	rs78494370|rs71412006		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:3323588A>C	ENST00000382125.4	-	3	452				TSSC1_ENST00000478754.1_5'UTR|TSSC1_ENST00000443925.2_Intron|TSSC1_ENST00000398659.4_Intron	NM_003310.2	NP_003301.1	Q53HC9	TSSC1_HUMAN	tumor suppressing subtransferable candidate 1											breast(2)|kidney(2)|large_intestine(3)|lung(9)|prostate(1)|skin(1)	18	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.093)	all_cancers(51;0.212)		OV - Ovarian serous cystadenocarcinoma(76;0.00877)|Epithelial(75;0.0283)|all cancers(51;0.0464)		GCAACACCGCACCTGCAGGCA	0.652																																					Colon(140;1261 1762 4183 34270 49743)												0																																										SO:0001627	intron_variant	7260			AF019952	CCDS1651.1	2p25.3	2013-01-10			ENSG00000032389	ENSG00000032389		"""WD repeat domain containing"""	12383	protein-coding gene	gene with protein product		608998				9403053, 9925925	Standard	NM_003310		Approved		uc002qxj.2	Q53HC9	OTTHUMG00000090329	ENST00000382125.4:c.259+18199T>G	2.37:g.3323588A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D6W4Y1|O43179|Q53S19|Q53SG2	RNA	SNP	-	NULL	ENST00000382125.4	37	NULL	CCDS1651.1	2																																																																																			TSSC1	-	-		0.652	TSSC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSSC1	HGNC	protein_coding	OTTHUMT00000206694.2	A	NM_003310		3323588	-1	no_errors	ENST00000478754	ensembl	human	known	70_37	rna	SNP	0.961	C
TTC16	158248	genome.wustl.edu	37	9	130486698	130486698	+	Intron	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:130486698C>G	ENST00000373289.3	+	8	1197				TTC16_ENST00000489226.1_Intron|TTC16_ENST00000393748.4_Missense_Mutation_p.S215C|PTRH1_ENST00000429848.1_Intron|PTRH1_ENST00000419060.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16											central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CTCGCCATCTCTAAGGCCCCC	0.632																																																	0																																										SO:0001627	intron_variant	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1117+55C>G	9.37:g.130486698C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S215C	ENST00000373289.3	37	c.644	CCDS6875.1	9	.	.	.	.	.	.	.	.	.	.	C	7.037	0.561839	0.13498	.	.	ENSG00000167094	ENST00000393748	.	.	.	2.53	0.411	0.16392	.	.	.	.	.	T	0.24661	0.0598	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25745	-1.0123	4	.	.	.	.	5.175	0.15129	0.198:0.6665:0.0:0.1354	.	.	.	.	C	215	.	.	S	+	2	0	TTC16	129526519	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.065000	0.11617	-0.170000	0.10816	-1.786000	0.00637	TCT	TTC16	-	NULL		0.632	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	C	NM_144965		130486698	+1	no_errors	ENST00000393748	ensembl	human	known	70_37	missense	SNP	0.000	G
TTC16	158248	genome.wustl.edu	37	9	130486698	130486698	+	Intron	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:130486698C>G	ENST00000373289.3	+	8	1197				TTC16_ENST00000489226.1_Intron|TTC16_ENST00000393748.4_Missense_Mutation_p.S215C|PTRH1_ENST00000429848.1_Intron|PTRH1_ENST00000419060.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16											central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						CTCGCCATCTCTAAGGCCCCC	0.632																																																	0																																										SO:0001627	intron_variant	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1117+55C>G	9.37:g.130486698C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYG4|B5ME24|Q5JU66|Q96M72	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S215C	ENST00000373289.3	37	c.644	CCDS6875.1	9	.	.	.	.	.	.	.	.	.	.	C	7.037	0.561839	0.13498	.	.	ENSG00000167094	ENST00000393748	.	.	.	2.53	0.411	0.16392	.	.	.	.	.	T	0.24661	0.0598	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.25745	-1.0123	4	.	.	.	.	5.175	0.15129	0.198:0.6665:0.0:0.1354	.	.	.	.	C	215	.	.	S	+	2	0	TTC16	129526519	0.000000	0.05858	0.000000	0.03702	0.013000	0.08279	-0.065000	0.11617	-0.170000	0.10816	-1.786000	0.00637	TCT	TTC16	-	NULL		0.632	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	C	NM_144965		130486698	+1	no_errors	ENST00000393748	ensembl	human	known	70_37	missense	SNP	0.000	G
TTC16	158248	genome.wustl.edu	37	9	130486938	130486938	+	Intron	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:130486938C>G	ENST00000373289.3	+	9	1197				TTC16_ENST00000489226.1_Intron|TTC16_ENST00000393748.4_3'UTR|PTRH1_ENST00000429848.1_5'UTR|PTRH1_ENST00000419060.1_Intron	NM_144965.1	NP_659402.1	Q8NEE8	TTC16_HUMAN	tetratricopeptide repeat domain 16											central_nervous_system(2)|endometrium(3)|lung(7)|ovary(3)|pancreas(2)|prostate(4)|skin(1)	22						TATCAGCCACCAGTTTCAGGC	0.652																																																	0																																										SO:0001627	intron_variant	158248			AK057342	CCDS6875.1	9q34.13	2013-01-10			ENSG00000167094	ENSG00000167094		"""Tetratricopeptide (TTC) repeat domain containing"""	26536	protein-coding gene	gene with protein product						12477932	Standard	NM_144965		Approved	FLJ32780	uc004brq.1	Q8NEE8	OTTHUMG00000020711	ENST00000373289.3:c.1118-97C>G	9.37:g.130486938C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DYG4|B5ME24|Q5JU66|Q96M72	RNA	SNP	-	NULL	ENST00000373289.3	37	NULL	CCDS6875.1	9																																																																																			TTC16	-	-		0.652	TTC16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TTC16	HGNC	protein_coding	OTTHUMT00000054224.1	C	NM_144965		130486938	+1	no_errors	ENST00000488285	ensembl	human	known	70_37	rna	SNP	0.000	G
TTC28	23331	genome.wustl.edu	37	22	28396518	28396518	+	Intron	SNP	C	C	T	rs557287364	byFrequency	TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr22:28396518C>T	ENST00000397906.2	-	15	4540				TTC28-AS1_ENST00000435348.1_RNA|TTC28-AS1_ENST00000426594.1_RNA|TTC28-AS1_ENST00000424161.1_RNA|TTC28-AS1_ENST00000428584.1_RNA|TTC28-AS1_ENST00000434221.1_RNA|TTC28-AS1_ENST00000417497.1_RNA|TTC28-AS1_ENST00000452612.1_RNA|TTC28-AS1_ENST00000453632.1_RNA|TTC28-AS1_ENST00000454741.1_RNA|TTC28-AS1_ENST00000433317.1_RNA	NM_001145418.1	NP_001138890.1	Q96AY4	TTC28_HUMAN	tetratricopeptide repeat domain 28						mitotic nuclear division (GO:0007067)|regulation of mitotic cell cycle (GO:0007346)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|midbody (GO:0030496)				endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)	12						CAAGGACATCCGGAGTTGGAG	0.627													C|||	2	0.000399361	0.0008	0.0	5008	,	,		16720	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	284900			AB028966	CCDS46678.1	22q12.1	2013-01-10			ENSG00000100154	ENSG00000100154		"""Tetratricopeptide (TTC) repeat domain containing"""	29179	protein-coding gene	gene with protein product		615098				10470851	Standard	NM_001145418		Approved	KIAA1043	uc003adp.4	Q96AY4	OTTHUMG00000151006	ENST00000397906.2:c.4398+843G>A	22.37:g.28396518C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	K7ZRV2|O95928|O95929|Q5W189|Q9NTE4|Q9UG31|Q9UGG5|Q9UPV8|Q9Y3S5	RNA	SNP	-	NULL	ENST00000397906.2	37	NULL	CCDS46678.1	22																																																																																			TTC28-AS1	-	-		0.627	TTC28-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	TTC28-AS1	HGNC	protein_coding	OTTHUMT00000320930.2	C	XM_929318		28396518	+1	no_errors	ENST00000428584	ensembl	human	known	70_37	rna	SNP	0.000	T
TUBGCP5	114791	genome.wustl.edu	37	15	22833552	22833552	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:22833552C>T	ENST00000283645.4	+	1	158	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.R10W	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	10					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.R10W(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ACCGTGGAGTCGGTTGGACGC	0.697																																																	1	Substitution - Missense(1)	cervix(1)											8.0	9.0	9.0					15																	22833552		2119	4220	6339	SO:0001583	missense	114791			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.28C>T	15.37:g.22833552C>T	ENSP00000283645:p.Arg10Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.R10W	ENST00000283645.4	37	c.28	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	.	16.85	3.236031	0.58886	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.26660	1.73;1.72	5.23	-0.5	0.12012	.	1.048490	0.07430	N	0.895554	T	0.22820	0.0551	L	0.51422	1.61	0.09310	N	1	P;D	0.56968	0.926;0.978	B;B	0.42522	0.39;0.39	T	0.22765	-1.0207	10	0.62326	D	0.03	0.001	5.5139	0.16896	0.1034:0.6194:0.101:0.1761	.	10;10	Q96RT8;E9PB12	GCP5_HUMAN;.	W	10	ENSP00000283645:R10W;ENSP00000409217:R10W	ENSP00000283645:R10W	R	+	1	2	TUBGCP5	20384993	0.216000	0.23585	0.000000	0.03702	0.000000	0.00434	0.534000	0.23098	-0.276000	0.09206	-0.797000	0.03246	CGG	TUBGCP5	-	NULL		0.697	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	HGNC	protein_coding	OTTHUMT00000250998.2	C	NM_052903		22833552	+1	no_errors	ENST00000283645	ensembl	human	known	70_37	missense	SNP	0.000	T
TUBGCP5	114791	genome.wustl.edu	37	15	22833552	22833552	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:22833552C>T	ENST00000283645.4	+	1	158	c.28C>T	c.(28-30)Cgg>Tgg	p.R10W	TUBGCP5_ENST00000453949.2_Missense_Mutation_p.R10W	NM_052903.4	NP_443135.3	Q96RT8	GCP5_HUMAN	tubulin, gamma complex associated protein 5	10					G2/M transition of mitotic cell cycle (GO:0000086)|microtubule nucleation (GO:0007020)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gamma-tubulin ring complex (GO:0008274)|microtubule (GO:0005874)|nucleus (GO:0005634)|spindle pole (GO:0000922)	microtubule binding (GO:0008017)	p.R10W(1)		breast(5)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(6)|lung(23)|prostate(1)|skin(2)|urinary_tract(1)	46		all_cancers(20;2.26e-25)|all_epithelial(15;2.1e-22)|Lung NSC(15;3.36e-17)|all_lung(15;1.04e-16)|Breast(32;0.000776)|Colorectal(260;0.0488)		all cancers(64;2.86e-06)|Epithelial(43;2.63e-05)|BRCA - Breast invasive adenocarcinoma(123;0.000949)		ACCGTGGAGTCGGTTGGACGC	0.697																																																	1	Substitution - Missense(1)	cervix(1)											8.0	9.0	9.0					15																	22833552		2119	4220	6339	SO:0001583	missense	114791			AB067486	CCDS73697.1, CCDS73698.1	15q11.1	2014-04-17			ENSG00000153575	ENSG00000275835			18600	protein-coding gene	gene with protein product	"""gamma-tubulin complex component GCP5"""	608147				11694571	Standard	NM_052903		Approved	GCP5, KIAA1899	uc001yur.4	Q96RT8	OTTHUMG00000188371	ENST00000283645.4:c.28C>T	15.37:g.22833552C>T	ENSP00000283645:p.Arg10Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PB12|Q6IQ52|Q96PY8	Missense_Mutation	SNP	pfam_Spc97_Spc98	p.R10W	ENST00000283645.4	37	c.28	CCDS10008.1	15	.	.	.	.	.	.	.	.	.	.	.	16.85	3.236031	0.58886	.	.	ENSG00000153575	ENST00000283645;ENST00000453949	T;T	0.26660	1.73;1.72	5.23	-0.5	0.12012	.	1.048490	0.07430	N	0.895554	T	0.22820	0.0551	L	0.51422	1.61	0.09310	N	1	P;D	0.56968	0.926;0.978	B;B	0.42522	0.39;0.39	T	0.22765	-1.0207	10	0.62326	D	0.03	0.001	5.5139	0.16896	0.1034:0.6194:0.101:0.1761	.	10;10	Q96RT8;E9PB12	GCP5_HUMAN;.	W	10	ENSP00000283645:R10W;ENSP00000409217:R10W	ENSP00000283645:R10W	R	+	1	2	TUBGCP5	20384993	0.216000	0.23585	0.000000	0.03702	0.000000	0.00434	0.534000	0.23098	-0.276000	0.09206	-0.797000	0.03246	CGG	TUBGCP5	-	NULL		0.697	TUBGCP5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TUBGCP5	HGNC	protein_coding	OTTHUMT00000250998.2	C	NM_052903		22833552	+1	no_errors	ENST00000283645	ensembl	human	known	70_37	missense	SNP	0.000	T
TXNRD1	7296	genome.wustl.edu	37	12	104725378	104725378	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr12:104725378G>C	ENST00000529546.1	+	11	1270	c.1045G>C	c.(1045-1047)Gag>Cag	p.E349Q	TXNRD1_ENST00000526390.1_Missense_Mutation_p.E431Q|TXNRD1_ENST00000526691.1_Missense_Mutation_p.E439Q|TXNRD1_ENST00000542918.1_Missense_Mutation_p.E437Q|TXNRD1_ENST00000524698.1_Missense_Mutation_p.E387Q|TXNRD1_ENST00000397736.2_Missense_Mutation_p.E431Q|TXNRD1_ENST00000429002.2_Missense_Mutation_p.E537Q|TXNRD1_ENST00000503506.2_Missense_Mutation_p.E387Q|TXNRD1_ENST00000525566.1_Missense_Mutation_p.E537Q|TXNRD1_ENST00000378070.4_Missense_Mutation_p.E486Q|TXNRD1_ENST00000388854.3_Missense_Mutation_p.E439Q|TXNRD1_ENST00000354940.6_Missense_Mutation_p.E387Q|TXNRD1_ENST00000526950.1_Missense_Mutation_p.E456Q|TXNRD1_ENST00000540716.1_Missense_Mutation_p.E349Q|TXNRD1_ENST00000427956.1_Missense_Mutation_p.E502Q			Q16881	TRXR1_HUMAN	thioredoxin reductase 1	537					cell proliferation (GO:0008283)|cell redox homeostasis (GO:0045454)|cellular lipid metabolic process (GO:0044255)|mesoderm formation (GO:0001707)|nucleobase-containing small molecule interconversion (GO:0015949)|nucleobase-containing small molecule metabolic process (GO:0055086)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	electron carrier activity (GO:0009055)|flavin adenine dinucleotide binding (GO:0050660)|NADP binding (GO:0050661)|protein disulfide oxidoreductase activity (GO:0015035)|thioredoxin-disulfide reductase activity (GO:0004791)	p.E537Q(2)|p.E387Q(2)|p.E537K(1)|p.E387K(1)		cervix(1)|endometrium(3)|kidney(2)|large_intestine(2)|lung(5)|skin(1)|stomach(1)|urinary_tract(1)	16					Arsenic trioxide(DB01169)|Flavin adenine dinucleotide(DB03147)	TGGCCTTTCTGAGGAGAAAGC	0.353																																					Ovarian(139;555 1836 9186 9946 10884)												6	Substitution - Missense(6)	urinary_tract(2)|cervix(2)|endometrium(2)											69.0	64.0	66.0					12																	104725378		1826	4081	5907	SO:0001583	missense	7296				CCDS53820.1, CCDS53821.1, CCDS53823.1, CCDS58274.1	12q23-q24.1	2012-03-01							12437	protein-coding gene	gene with protein product		601112				7589432	Standard	NM_001093771		Approved	TXNR, GRIM-12, Trxr1	uc021rcx.2	Q16881		ENST00000529546.1:c.1045G>C	12.37:g.104725378G>C	ENSP00000434919:p.Glu349Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z1F4|B7Z3Y8|B7Z904|E9PMY9|F5H780|Q6FI31|Q6VB40|Q6VB41|Q6VB42|Q6VBP2|Q6VBP3|Q6VBP4|Q6VBP5|Q6VBP9|Q6VBQ0|Q6YNQ1|Q76P53|Q7LA96|Q8WVC8|Q99475|Q9UES8|Q9UH79	Missense_Mutation	SNP	pfam_Pyr_nucl-diS_OxRdtase_FAD/NAD,pfam_Pyr_nucl-diS_OxRdtase_dimer,pfam_Pyr_OxRdtase_NAD-bd_dom,pfam_FAD_bind_dom,pfam_Glutaredoxin,superfamily_FAD/NAD-linked_Rdtase_dimer,superfamily_Thioredoxin-like_fold,prints_FAD_pyr_nucl-diS_OxRdtase,prints_Hg_reductase,prints_Pyridine_nuc-diS_OxRdtase_2,tigrfam_Thioredoxin/glutathione_Rdtase	p.E537Q	ENST00000529546.1	37	c.1609	CCDS58274.1	12	.	.	.	.	.	.	.	.	.	.	G	31	5.074625	0.94000	.	.	ENSG00000198431	ENST00000525566;ENST00000429002;ENST00000503506;ENST00000526691;ENST00000388854;ENST00000354940;ENST00000526390;ENST00000529546;ENST00000540716;ENST00000524698;ENST00000542918;ENST00000378070;ENST00000397736;ENST00000427956;ENST00000526950	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.95518	-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73;-3.73	5.67	5.67	0.87782	FAD/NAD-linked reductase, dimerisation (1);Pyridine nucleotide-disulphide oxidoreductase, dimerisation (2);	0.000000	0.85682	D	0.000000	D	0.98520	0.9506	H	0.94964	3.605	0.80722	D	1	D;D;D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0;1.0;1.0	D;D;D;D;D;D;D	0.97110	1.0;0.999;1.0;0.999;0.999;0.999;0.999	D	0.99204	1.0874	10	0.87932	D	0	-33.965	19.8349	0.96652	0.0:0.0:1.0:0.0	.	437;431;537;439;387;537;502	B7Z2S5;E2QRB9;B7Z904;Q16881-4;B2R5P6;Q16881;E7EW10	.;.;.;.;.;TRXR1_HUMAN;.	Q	537;537;387;439;439;387;431;349;349;387;437;486;431;502;456	ENSP00000434516:E537Q;ENSP00000412045:E537Q;ENSP00000421934:E387Q;ENSP00000435929:E439Q;ENSP00000373506:E439Q;ENSP00000347020:E387Q;ENSP00000435123:E431Q;ENSP00000434919:E349Q;ENSP00000442709:E349Q;ENSP00000433425:E387Q;ENSP00000440978:E437Q;ENSP00000367310:E486Q;ENSP00000380844:E431Q;ENSP00000393328:E502Q;ENSP00000432812:E456Q	ENSP00000347020:E387Q	E	+	1	0	TXNRD1	103249508	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.532000	0.98057	2.693000	0.91896	0.650000	0.86243	GAG	TXNRD1	-	pfam_Pyr_nucl-diS_OxRdtase_dimer,superfamily_FAD/NAD-linked_Rdtase_dimer,tigrfam_Thioredoxin/glutathione_Rdtase		0.353	TXNRD1-004	PUTATIVE	basic|exp_conf|CCDS|seleno	protein_coding	TXNRD1	HGNC	protein_coding	OTTHUMT00000389969.1	G	NM_003330		104725378	+1	no_errors	ENST00000429002	ensembl	human	known	70_37	missense	SNP	1.000	C
TYRO3	7301	genome.wustl.edu	37	15	41859705	41859705	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr15:41859705G>C	ENST00000263798.3	+	7	1155	c.931G>C	c.(931-933)Gac>Cac	p.D311H	TYRO3_ENST00000559066.1_Missense_Mutation_p.D266H	NM_006293.3	NP_006284.2	Q06418	TYRO3_HUMAN	TYRO3 protein tyrosine kinase	311	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				apoptotic cell clearance (GO:0043277)|cell adhesion (GO:0007155)|forebrain cell migration (GO:0021885)|natural killer cell differentiation (GO:0001779)|negative regulation of inflammatory response (GO:0050728)|negative regulation of innate immune response (GO:0045824)|negative regulation of lymphocyte activation (GO:0051250)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|neuron cellular homeostasis (GO:0070050)|ovulation cycle (GO:0042698)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol 3-kinase signaling (GO:0014065)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|protein autophosphorylation (GO:0046777)|protein kinase B signaling (GO:0043491)|secretion by cell (GO:0032940)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|spermatogenesis (GO:0007283)|substrate adhesion-dependent cell spreading (GO:0034446)|vagina development (GO:0060068)	endoplasmic reticulum membrane (GO:0005789)|integral component of plasma membrane (GO:0005887)|nuclear envelope (GO:0005635)|nucleus (GO:0005634)	ATP binding (GO:0005524)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.D303H(1)|p.D311H(1)		central_nervous_system(1)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(26)|ovary(3)|prostate(1)	43		all_cancers(109;7.33e-15)|all_epithelial(112;2.8e-12)|Lung NSC(122;3.48e-08)|all_lung(180;1.71e-07)|Melanoma(134;0.0262)		OV - Ovarian serous cystadenocarcinoma(18;3.31e-18)|GBM - Glioblastoma multiforme(113;9.31e-07)|BRCA - Breast invasive adenocarcinoma(123;0.117)		TCCCTATGCTGACTGGGTGCC	0.642																																																	2	Substitution - Missense(2)	cervix(2)											86.0	85.0	86.0					15																	41859705		2203	4300	6503	SO:0001583	missense	7301			D50479	CCDS10080.1	15q15.1-q21.1	2013-02-11			ENSG00000092445	ENSG00000092445	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12446	protein-coding gene	gene with protein product		600341		RSE		7851890	Standard	NM_006293		Approved	Dtk, Brt, Tif, Sky	uc001zof.2	Q06418	OTTHUMG00000130341	ENST00000263798.3:c.931G>C	15.37:g.41859705G>C	ENSP00000263798:p.Asp311His	Somatic		WXS	Illumina HiSeq	Phase_IV	O14953|Q86VR3	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D311H	ENST00000263798.3	37	c.931	CCDS10080.1	15	.	.	.	.	.	.	.	.	.	.	G	9.703	1.155079	0.21371	.	.	ENSG00000092445	ENST00000540218;ENST00000263798	T	0.55234	0.53	4.64	4.64	0.57946	Fibronectin, type III (2);Immunoglobulin-like fold (1);	0.000000	0.44902	D	0.000407	T	0.36963	0.0986	N	0.17082	0.46	0.32440	N	0.546866	B	0.19706	0.038	B	0.14578	0.011	T	0.43540	-0.9385	10	0.36615	T	0.2	-25.7546	14.5246	0.67878	0.0:0.0:1.0:0.0	.	311	Q06418	TYRO3_HUMAN	H	243;311	ENSP00000263798:D311H	ENSP00000263798:D311H	D	+	1	0	TYRO3	39646997	0.998000	0.40836	1.000000	0.80357	0.999000	0.98932	2.565000	0.45939	2.417000	0.82017	0.655000	0.94253	GAC	TYRO3	-	superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.642	TYRO3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRO3	HGNC	protein_coding	OTTHUMT00000252693.2	G			41859705	+1	no_errors	ENST00000263798	ensembl	human	known	70_37	missense	SNP	0.999	C
USH2A	7399	genome.wustl.edu	37	1	215848679	215848679	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:215848679G>A	ENST00000307340.3	-	63	12960	c.12574C>T	c.(12574-12576)Cgc>Tgc	p.R4192C	USH2A_ENST00000366943.2_Missense_Mutation_p.R4192C	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4192	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> H (in RP39; dbSNP:rs199605265). {ECO:0000269|PubMed:22334370}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R4192C(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGCATCTGCGAATCACTTCA	0.438										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	cervix(1)											114.0	114.0	114.0					1																	215848679		2203	4300	6503	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12574C>T	1.37:g.215848679G>A	ENSP00000305941:p.Arg4192Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.R4192C	ENST00000307340.3	37	c.12574	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978775	0.74360	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	D;T	0.85088	-1.94;0.57	5.25	5.25	0.73442	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.157439	0.29767	N	0.011254	D	0.90525	0.7031	M	0.79123	2.44	0.42286	D	0.992115	D	0.76494	0.999	P	0.60609	0.877	D	0.90311	0.4337	10	0.41790	T	0.15	.	13.783	0.63093	0.0:0.0:0.8467:0.1533	.	4192	O75445	USH2A_HUMAN	C	4192	ENSP00000305941:R4192C;ENSP00000355910:R4192C	ENSP00000305941:R4192C	R	-	1	0	USH2A	213915302	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.993000	0.49425	2.454000	0.82982	0.650000	0.86243	CGC	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	G	NM_007123		215848679	-1	no_errors	ENST00000366943	ensembl	human	known	70_37	missense	SNP	1.000	A
USH2A	7399	genome.wustl.edu	37	1	215848679	215848679	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr1:215848679G>A	ENST00000307340.3	-	63	12960	c.12574C>T	c.(12574-12576)Cgc>Tgc	p.R4192C	USH2A_ENST00000366943.2_Missense_Mutation_p.R4192C	NM_206933.2	NP_996816	O75445	USH2A_HUMAN	Usher syndrome 2A (autosomal recessive, mild)	4192	Fibronectin type-III 27. {ECO:0000255|PROSITE-ProRule:PRU00316}.		R -> H (in RP39; dbSNP:rs199605265). {ECO:0000269|PubMed:22334370}.		hair cell differentiation (GO:0035315)|inner ear receptor cell differentiation (GO:0060113)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)|response to stimulus (GO:0050896)|sensory perception of light stimulus (GO:0050953)|sensory perception of sound (GO:0007605)|visual perception (GO:0007601)	apical plasma membrane (GO:0016324)|basement membrane (GO:0005604)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|stereocilia ankle link complex (GO:0002142)|stereocilium bundle (GO:0032421)|stereocilium membrane (GO:0060171)	collagen binding (GO:0005518)|myosin binding (GO:0017022)	p.R4192C(1)		NS(7)|breast(20)|central_nervous_system(3)|cervix(2)|endometrium(32)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(71)|liver(2)|lung(282)|ovary(25)|pancreas(2)|prostate(12)|skin(22)|stomach(7)|upper_aerodigestive_tract(20)|urinary_tract(3)	527				OV - Ovarian serous cystadenocarcinoma(81;0.0547)|all cancers(67;0.0875)		AAGCATCTGCGAATCACTTCA	0.438										HNSCC(13;0.011)																																							1	Substitution - Missense(1)	cervix(1)											114.0	114.0	114.0					1																	215848679		2203	4300	6503	SO:0001583	missense	7399			AF055580	CCDS1516.1, CCDS31025.1	1q41	2013-02-11			ENSG00000042781	ENSG00000042781		"""Fibronectin type III domain containing"""	12601	protein-coding gene	gene with protein product	"""usherin"""	608400		USH2		9624053, 10729113	Standard	NM_007123		Approved	RP39	uc001hku.1	O75445	OTTHUMG00000037079	ENST00000307340.3:c.12574C>T	1.37:g.215848679G>A	ENSP00000305941:p.Arg4192Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VVM9|Q6S362|Q9NS27	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_EGF_laminin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,superfamily_Fibronectin_type3,smart_LamG-like,smart_Laminin_N,smart_EGF_laminin,smart_Fibronectin_type3,smart_Laminin_G,pfscan_EGF_laminin,pfscan_Fibronectin_type3,pfscan_Laminin_G,pfscan_Laminin_N	p.R4192C	ENST00000307340.3	37	c.12574	CCDS31025.1	1	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978775	0.74360	.	.	ENSG00000042781	ENST00000307340;ENST00000366943	D;T	0.85088	-1.94;0.57	5.25	5.25	0.73442	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.157439	0.29767	N	0.011254	D	0.90525	0.7031	M	0.79123	2.44	0.42286	D	0.992115	D	0.76494	0.999	P	0.60609	0.877	D	0.90311	0.4337	10	0.41790	T	0.15	.	13.783	0.63093	0.0:0.0:0.8467:0.1533	.	4192	O75445	USH2A_HUMAN	C	4192	ENSP00000305941:R4192C;ENSP00000355910:R4192C	ENSP00000305941:R4192C	R	-	1	0	USH2A	213915302	1.000000	0.71417	1.000000	0.80357	0.977000	0.68977	2.993000	0.49425	2.454000	0.82982	0.650000	0.86243	CGC	USH2A	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.438	USH2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USH2A	HGNC	protein_coding	OTTHUMT00000128138.1	G	NM_007123		215848679	-1	no_errors	ENST00000366943	ensembl	human	known	70_37	missense	SNP	1.000	A
USP4	7375	genome.wustl.edu	37	3	49331005	49331005	+	Intron	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr3:49331005G>A	ENST00000265560.4	-	14	1930				USP4_ENST00000351842.4_Intron	NM_003363.3	NP_003354.2	Q13107	UBP4_HUMAN	ubiquitin specific peptidase 4 (proto-oncogene)						negative regulation of protein ubiquitination (GO:0031397)|protein deubiquitination (GO:0016579)|protein localization to cell surface (GO:0034394)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|lysosome (GO:0005764)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	adenosine receptor binding (GO:0031685)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			breast(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|liver(1)|lung(10)|ovary(3)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	33		Ovarian(412;0.00308)|Myeloproliferative disorder(1037;0.0255)|Hepatocellular(537;0.121)		OV - Ovarian serous cystadenocarcinoma(275;4.74e-26)|Kidney(197;2.22e-07)|KIRC - Kidney renal clear cell carcinoma(197;5.14e-06)|BRCA - Breast invasive adenocarcinoma(193;9.46e-05)		ttgggaggctgaggcagcaga	0.517																																																	0																																										SO:0001627	intron_variant	7375			U20657	CCDS2793.1, CCDS2794.1, CCDS58832.1	3p21.3	2005-10-11	2005-08-08		ENSG00000114316	ENSG00000114316		"""Ubiquitin-specific peptidases"""	12627	protein-coding gene	gene with protein product		603486	"""ubiquitin specific protease 4 (proto-oncogene)"""	UNP		12838346, 9464533	Standard	NM_199443		Approved	Unph	uc003cwq.2	Q13107	OTTHUMG00000156825	ENST00000265560.4:c.1883+834C>T	3.37:g.49331005G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6Y0|C9IY91|O43452|O43453|Q08AK8	RNA	SNP	-	NULL	ENST00000265560.4	37	NULL	CCDS2793.1	3																																																																																			USP4	-	-		0.517	USP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	USP4	HGNC	protein_coding	OTTHUMT00000346069.1	G	NM_199443		49331005	-1	no_errors	ENST00000475873	ensembl	human	known	70_37	rna	SNP	0.018	A
VDAC3	7419	genome.wustl.edu	37	8	42256271	42256271	+	Silent	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:42256271A>G	ENST00000022615.4	+	5	227	c.159A>G	c.(157-159)aaA>aaG	p.K53K	VDAC3_ENST00000392935.3_Silent_p.K54K|VDAC3_ENST00000522572.1_Silent_p.K54K|VDAC3_ENST00000521158.1_Silent_p.K54K			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	53					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)	p.K53K(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	ATACAGGGAAAGCATCAGGCA	0.353																																																	1	Substitution - coding silent(1)	cervix(1)											76.0	72.0	73.0					8																	42256271		2203	4300	6503	SO:0001819	synonymous_variant	7419			AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.159A>G	8.37:g.42256271A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UIS0	Silent	SNP	pfam_Porin_Euk,prints_Porin_Euk	p.K54	ENST00000022615.4	37	c.162	CCDS6131.1	8																																																																																			VDAC3	-	pfam_Porin_Euk		0.353	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	VDAC3	HGNC	protein_coding	OTTHUMT00000377574.1	A			42256271	+1	no_errors	ENST00000392935	ensembl	human	known	70_37	silent	SNP	1.000	G
VDAC3	7419	genome.wustl.edu	37	8	42256271	42256271	+	Silent	SNP	A	A	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr8:42256271A>G	ENST00000022615.4	+	5	227	c.159A>G	c.(157-159)aaA>aaG	p.K53K	VDAC3_ENST00000392935.3_Silent_p.K54K|VDAC3_ENST00000522572.1_Silent_p.K54K|VDAC3_ENST00000521158.1_Silent_p.K54K			Q9Y277	VDAC3_HUMAN	voltage-dependent anion channel 3	53					adenine transport (GO:0015853)	extracellular vesicular exosome (GO:0070062)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|pore complex (GO:0046930)	nucleotide binding (GO:0000166)|porin activity (GO:0015288)|voltage-gated anion channel activity (GO:0008308)	p.K53K(1)		cervix(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(1)|upper_aerodigestive_tract(1)	7	all_cancers(6;3.86e-23)|all_lung(13;6.47e-12)|Lung NSC(13;1.08e-10)|Ovarian(28;0.00769)|Prostate(17;0.0119)|Lung SC(25;0.211)	all_lung(54;0.00671)|Lung NSC(58;0.0184)|Esophageal squamous(32;0.131)|Hepatocellular(245;0.133)|Renal(179;0.151)	BRCA - Breast invasive adenocarcinoma(8;3.48e-10)|OV - Ovarian serous cystadenocarcinoma(14;0.00266)|Lung(22;0.00849)|LUSC - Lung squamous cell carcinoma(45;0.024)		Dihydroxyaluminium(DB01375)	ATACAGGGAAAGCATCAGGCA	0.353																																																	1	Substitution - coding silent(1)	cervix(1)											76.0	72.0	73.0					8																	42256271		2203	4300	6503	SO:0001819	synonymous_variant	7419			AF038962	CCDS6131.1, CCDS47850.1	8p11.21	2011-11-15			ENSG00000078668	ENSG00000078668		"""Voltage-dependent anion channels"""	12674	protein-coding gene	gene with protein product		610029				9653160, 9781040	Standard	NM_001135694		Approved	HD-VDAC3	uc003xpc.3	Q9Y277	OTTHUMG00000164168	ENST00000022615.4:c.159A>G	8.37:g.42256271A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UIS0	Silent	SNP	pfam_Porin_Euk,prints_Porin_Euk	p.K54	ENST00000022615.4	37	c.162	CCDS6131.1	8																																																																																			VDAC3	-	pfam_Porin_Euk		0.353	VDAC3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	VDAC3	HGNC	protein_coding	OTTHUMT00000377574.1	A			42256271	+1	no_errors	ENST00000392935	ensembl	human	known	70_37	silent	SNP	1.000	G
WAS	7454	genome.wustl.edu	37	X	48547408	48547408	+	Silent	SNP	C	C	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chrX:48547408C>A	ENST00000376701.4	+	10	1366	c.1291C>A	c.(1291-1293)Cgg>Agg	p.R431R		NM_000377.2	NP_000368.1	P42768	WASP_HUMAN	Wiskott-Aldrich syndrome	431	WH2. {ECO:0000255|PROSITE- ProRule:PRU00406}.				actin filament polymerization (GO:0030041)|actin filament-based movement (GO:0030048)|actin polymerization or depolymerization (GO:0008154)|blood coagulation (GO:0007596)|defense response (GO:0006952)|endosomal transport (GO:0016197)|epidermis development (GO:0008544)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|immune response (GO:0006955)|innate immune response (GO:0045087)|positive regulation of Arp2/3 complex-mediated actin nucleation (GO:2000601)|protein complex assembly (GO:0006461)|regulation of catalytic activity (GO:0050790)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	actin cytoskeleton (GO:0015629)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|vesicle membrane (GO:0012506)	identical protein binding (GO:0042802)|phospholipase binding (GO:0043274)|protein kinase binding (GO:0019901)|SH3 domain binding (GO:0017124)|small GTPase regulator activity (GO:0005083)	p.R431R(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(9)|ovary(4)|skin(1)|upper_aerodigestive_tract(1)	28		all_lung(315;1.27e-10)				TGGTGGGGGTCGGGGAGCGCT	0.677			"""Mis, N, F, S"""			lymphoma																																		X-linked recessive		Wiskott-Aldrich syndrome	X	Xp11.23-p11.22	7454	Wiskott-Aldrich syndrome		L	1	Substitution - coding silent(1)	cervix(1)											8.0	9.0	8.0					X																	48547408		2063	4032	6095	SO:0001819	synonymous_variant	7454			AF115548	CCDS14303.1	Xp11.4-p11.21	2014-09-17	2012-07-12		ENSG00000015285	ENSG00000015285			12731	protein-coding gene	gene with protein product	"""eczema-thrombocytopenia"""	300392	"""thrombocytopenia 1 (X-linked)"", ""Wiskott-Aldrich syndrome (eczema-thrombocytopenia)"""	IMD2, THC		7795648	Standard	NM_000377		Approved	WASP	uc004dkm.4	P42768	OTTHUMG00000034483	ENST00000376701.4:c.1291C>A	X.37:g.48547408C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BU11|Q9UNJ9	Silent	SNP	pfam_EVH1,pfam_PAK_box_Rho-bd,pfam_WH2_dom,superfamily_WASP_C,smart_EVH1,smart_PAK_box_Rho-bd,smart_WH2_dom,pfscan_PAK_box_Rho-bd,pfscan_EVH1,pfscan_WH2_dom	p.R431	ENST00000376701.4	37	c.1291	CCDS14303.1	X																																																																																			WAS	-	pfam_WH2_dom,superfamily_WASP_C,smart_WH2_dom,pfscan_WH2_dom		0.677	WAS-007	KNOWN	basic|appris_principal|CCDS	protein_coding	WAS	HGNC	protein_coding	OTTHUMT00000083379.1	C	NM_000377		48547408	+1	no_errors	ENST00000376701	ensembl	human	known	70_37	silent	SNP	1.000	A
WDR59	79726	genome.wustl.edu	37	16	74999681	74999681	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:74999681C>G	ENST00000262144.6	-	2	224	c.94G>C	c.(94-96)Gtg>Ctg	p.V32L	WDR59_ENST00000562331.1_5'UTR	NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	32								p.V32L(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CCAGAAAGCACTGCATGCTGC	0.498																																																	1	Substitution - Missense(1)	cervix(1)											119.0	110.0	113.0					16																	74999681		2198	4300	6498	SO:0001583	missense	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.94G>C	16.37:g.74999681C>G	ENSP00000262144:p.Val32Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_UBQ-conjugating_enzyme/RWD,smart_WD40_repeat,smart_RWD-domain,pfscan_RWD-domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V32L	ENST00000262144.6	37	c.94	CCDS32488.1	16	.	.	.	.	.	.	.	.	.	.	C	9.365	1.068900	0.20147	.	.	ENSG00000103091	ENST00000262144;ENST00000536050	T	0.69561	-0.41	5.6	5.6	0.85130	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70193	0.3196	N	0.22421	0.69	0.80722	D	1	P;B	0.47910	0.902;0.021	D;B	0.64595	0.927;0.026	T	0.64377	-0.6422	10	0.19147	T	0.46	-15.9885	17.7982	0.88579	0.0:1.0:0.0:0.0	.	32;32	Q6PJI9-2;Q6PJI9	.;WDR59_HUMAN	L	32;11	ENSP00000262144:V32L	ENSP00000262144:V32L	V	-	1	0	WDR59	73557182	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.300000	0.72776	2.654000	0.90174	0.561000	0.74099	GTG	WDR59	-	superfamily_WD40_repeat_dom		0.498	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR59	HGNC	protein_coding	OTTHUMT00000410601.3	C	NM_030581		74999681	-1	no_errors	ENST00000262144	ensembl	human	known	70_37	missense	SNP	1.000	G
WDR59	79726	genome.wustl.edu	37	16	74999681	74999681	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr16:74999681C>G	ENST00000262144.6	-	2	224	c.94G>C	c.(94-96)Gtg>Ctg	p.V32L	WDR59_ENST00000562331.1_5'UTR	NM_030581.3	NP_085058.3	Q6PJI9	WDR59_HUMAN	WD repeat domain 59	32								p.V32L(1)		breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|ovary(1)|prostate(1)	27						CCAGAAAGCACTGCATGCTGC	0.498																																																	1	Substitution - Missense(1)	cervix(1)											119.0	110.0	113.0					16																	74999681		2198	4300	6498	SO:0001583	missense	79726			AB067510	CCDS32488.1	16q22.3	2013-01-09				ENSG00000103091		"""WD repeat domain containing"""	25706	protein-coding gene	gene with protein product						11572484	Standard	XM_005256146		Approved	FLJ12270	uc002fdh.1	Q6PJI9		ENST00000262144.6:c.94G>C	16.37:g.74999681C>G	ENSP00000262144:p.Val32Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRC3|Q71RE7|Q96PW5|Q9BSW6|Q9HA43	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_UBQ-conjugating_enzyme/RWD,smart_WD40_repeat,smart_RWD-domain,pfscan_RWD-domain,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.V32L	ENST00000262144.6	37	c.94	CCDS32488.1	16	.	.	.	.	.	.	.	.	.	.	C	9.365	1.068900	0.20147	.	.	ENSG00000103091	ENST00000262144;ENST00000536050	T	0.69561	-0.41	5.6	5.6	0.85130	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.70193	0.3196	N	0.22421	0.69	0.80722	D	1	P;B	0.47910	0.902;0.021	D;B	0.64595	0.927;0.026	T	0.64377	-0.6422	10	0.19147	T	0.46	-15.9885	17.7982	0.88579	0.0:1.0:0.0:0.0	.	32;32	Q6PJI9-2;Q6PJI9	.;WDR59_HUMAN	L	32;11	ENSP00000262144:V32L	ENSP00000262144:V32L	V	-	1	0	WDR59	73557182	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	6.300000	0.72776	2.654000	0.90174	0.561000	0.74099	GTG	WDR59	-	superfamily_WD40_repeat_dom		0.498	WDR59-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR59	HGNC	protein_coding	OTTHUMT00000410601.3	C	NM_030581		74999681	-1	no_errors	ENST00000262144	ensembl	human	known	70_37	missense	SNP	1.000	G
DPH7	92715	genome.wustl.edu	37	9	140459760	140459761	+	Intron	INS	-	-	CT	rs143882698|rs71493674		TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr9:140459760_140459761insCT	ENST00000277540.2	-	6	798				DPH7_ENST00000479650.1_Intron	NM_138778.2	NP_620133.1	Q9BTV6	DPH7_HUMAN	diphthamide biosynthesis 7						peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)												CCCCTGGGTGACTGTCTGTGAG	0.604																																																	0																																										SO:0001627	intron_variant	92715			AK075115	CCDS7047.1	9q34.3	2013-06-20	2013-06-20	2013-06-20	ENSG00000148399	ENSG00000148399		"""WD repeat domain containing"""	25199	protein-coding gene	gene with protein product		613210	"""chromosome 9 open reading frame 112"", ""WD repeat domain 85"""	C9orf112, WDR85		23486472	Standard	NM_138778		Approved	FLJ90634, RRT2	uc004cnk.1	Q9BTV6	OTTHUMG00000020991	ENST00000277540.2:c.641-154->AG	9.37:g.140459761_140459762dupCT		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AB7	RNA	INS	-	NULL	ENST00000277540.2	37	NULL	CCDS7047.1	9																																																																																			WDR85	-	-		0.604	DPH7-009	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR85	HGNC	protein_coding	OTTHUMT00000055350.1	-	NM_138778		140459761	-1	no_errors	ENST00000497237	ensembl	human	known	70_37	rna	INS	0.802:0.760	CT
WNK3	65267	genome.wustl.edu	37	X	54324625	54324625	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chrX:54324625C>T	ENST00000375159.2	-	6	1380	c.1381G>A	c.(1381-1383)Gaa>Aaa	p.E461K	WNK3_ENST00000354646.2_Missense_Mutation_p.E461K|WNK3_ENST00000375169.3_Missense_Mutation_p.E461K			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	461					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E461K(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TATGCTACTTCCTCAGGTGTA	0.363																																																	1	Substitution - Missense(1)	cervix(1)											208.0	185.0	192.0					X																	54324625		2203	4300	6503	SO:0001583	missense	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1381G>A	X.37:g.54324625C>T	ENSP00000364301:p.Glu461Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E461K	ENST00000375159.2	37	c.1381	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508108	0.85282	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.36340	1.26;1.26;1.26	5.04	4.14	0.48551	Serine/threonine-protein kinase OSR1/WNK, CCT domain (1);	0.000000	0.51477	D	0.000096	T	0.43389	0.1245	L	0.39147	1.195	0.43073	D	0.994717	P;P	0.45902	0.84;0.868	P;P	0.54026	0.622;0.74	T	0.40059	-0.9583	10	0.54805	T	0.06	-13.9631	13.5759	0.61875	0.0:0.8474:0.1526:0.0	.	461;461	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	K	461	ENSP00000364312:E461K;ENSP00000346667:E461K;ENSP00000364301:E461K	ENSP00000346667:E461K	E	-	1	0	WNK3	54341350	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.840000	0.69402	2.095000	0.63458	0.513000	0.50165	GAA	WNK3	-	pfam_Kinase_OSR1/WNK_CCT		0.363	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	C	NM_020922		54324625	-1	no_errors	ENST00000354646	ensembl	human	known	70_37	missense	SNP	1.000	T
WNK3	65267	genome.wustl.edu	37	X	54324625	54324625	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chrX:54324625C>T	ENST00000375159.2	-	6	1380	c.1381G>A	c.(1381-1383)Gaa>Aaa	p.E461K	WNK3_ENST00000354646.2_Missense_Mutation_p.E461K|WNK3_ENST00000375169.3_Missense_Mutation_p.E461K			Q9BYP7	WNK3_HUMAN	WNK lysine deficient protein kinase 3	461					intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of ion transmembrane transporter activity (GO:0032414)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of rubidium ion transmembrane transporter activity (GO:2000688)|positive regulation of rubidium ion transport (GO:2000682)|positive regulation of sodium ion transmembrane transporter activity (GO:2000651)|positive regulation of sodium ion transport (GO:0010765)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of ion homeostasis (GO:2000021)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|tight junction (GO:0005923)	ATP binding (GO:0005524)|chloride channel inhibitor activity (GO:0019869)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E461K(1)		autonomic_ganglia(1)|biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(17)|lung(24)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	80						TATGCTACTTCCTCAGGTGTA	0.363																																																	1	Substitution - Missense(1)	cervix(1)											208.0	185.0	192.0					X																	54324625		2203	4300	6503	SO:0001583	missense	65267			AJ409088	CCDS14357.1, CCDS35302.1	Xp11.22	2008-05-14	2005-01-19	2005-01-22	ENSG00000196632	ENSG00000196632			14543	protein-coding gene	gene with protein product		300358	"""protein kinase, lysine deficient 3"""	PRKWNK3			Standard	NM_020922		Approved		uc004dtc.2	Q9BYP7	OTTHUMG00000021626	ENST00000375159.2:c.1381G>A	X.37:g.54324625C>T	ENSP00000364301:p.Glu461Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKG2|Q5JRC1|Q6JP76|Q8TCX6|Q9HCK6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Kinase_OSR1/WNK_CCT,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E461K	ENST00000375159.2	37	c.1381	CCDS14357.1	X	.	.	.	.	.	.	.	.	.	.	C	24.2	4.508108	0.85282	.	.	ENSG00000196632	ENST00000375169;ENST00000354646;ENST00000375159	T;T;T	0.36340	1.26;1.26;1.26	5.04	4.14	0.48551	Serine/threonine-protein kinase OSR1/WNK, CCT domain (1);	0.000000	0.51477	D	0.000096	T	0.43389	0.1245	L	0.39147	1.195	0.43073	D	0.994717	P;P	0.45902	0.84;0.868	P;P	0.54026	0.622;0.74	T	0.40059	-0.9583	10	0.54805	T	0.06	-13.9631	13.5759	0.61875	0.0:0.8474:0.1526:0.0	.	461;461	Q9BYP7-3;Q9BYP7	.;WNK3_HUMAN	K	461	ENSP00000364312:E461K;ENSP00000346667:E461K;ENSP00000364301:E461K	ENSP00000346667:E461K	E	-	1	0	WNK3	54341350	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	5.840000	0.69402	2.095000	0.63458	0.513000	0.50165	GAA	WNK3	-	pfam_Kinase_OSR1/WNK_CCT		0.363	WNK3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WNK3	HGNC	protein_coding	OTTHUMT00000056799.2	C	NM_020922		54324625	-1	no_errors	ENST00000354646	ensembl	human	known	70_37	missense	SNP	1.000	T
WNT10A	80326	genome.wustl.edu	37	2	219754750	219754750	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:219754750G>A	ENST00000258411.3	+	3	1054	c.421G>A	c.(421-423)Gtg>Atg	p.V141M	WNT10A_ENST00000483911.1_3'UTR	NM_025216.2	NP_079492.2	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family, member 10A	141					cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|epidermis morphogenesis (GO:0048730)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|neural crest cell differentiation (GO:0014033)|neuron differentiation (GO:0030182)|odontogenesis (GO:0042476)|positive regulation of gene expression (GO:0010628)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sebaceous gland development (GO:0048733)|skin development (GO:0043588)|tongue development (GO:0043586)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.V141M(1)		breast(1)|cervix(1)|endometrium(2)|lung(6)|skin(2)	12		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCAGCTGGCGTGGTGCACGC	0.612																																																	1	Substitution - Missense(1)	cervix(1)											93.0	80.0	85.0					2																	219754750		2203	4300	6503	SO:0001583	missense	80326			AB059569	CCDS2426.1	2q35	2008-05-23			ENSG00000135925	ENSG00000135925		"""Wingless-type MMTV integration sites"""	13829	protein-coding gene	gene with protein product		606268				11350055, 17847007	Standard	NM_025216		Approved		uc002vjd.1	Q9GZT5	OTTHUMG00000133085	ENST00000258411.3:c.421G>A	2.37:g.219754750G>A	ENSP00000258411:p.Val141Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53S44|Q96TA7|Q9H7S8	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt10	p.V141M	ENST00000258411.3	37	c.421	CCDS2426.1	2	.	.	.	.	.	.	.	.	.	.	G	16.77	3.213846	0.58452	.	.	ENSG00000135925	ENST00000258411	T	0.81247	-1.47	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.89684	0.6786	M	0.80616	2.505	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.91076	0.4896	10	0.87932	D	0	.	16.7309	0.85434	0.0:0.0:1.0:0.0	.	141	Q9GZT5	WN10A_HUMAN	M	141	ENSP00000258411:V141M	ENSP00000258411:V141M	V	+	1	0	WNT10A	219462994	1.000000	0.71417	0.922000	0.36590	0.061000	0.15899	9.522000	0.98032	2.594000	0.87642	0.655000	0.94253	GTG	WNT10A	-	pfam_Wnt,smart_Wnt,prints_Wnt		0.612	WNT10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT10A	HGNC	protein_coding	OTTHUMT00000256730.2	G	NM_025216		219754750	+1	no_errors	ENST00000258411	ensembl	human	known	70_37	missense	SNP	1.000	A
WNT10A	80326	genome.wustl.edu	37	2	219754750	219754750	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr2:219754750G>A	ENST00000258411.3	+	3	1054	c.421G>A	c.(421-423)Gtg>Atg	p.V141M	WNT10A_ENST00000483911.1_3'UTR	NM_025216.2	NP_079492.2	Q9GZT5	WN10A_HUMAN	wingless-type MMTV integration site family, member 10A	141					cell fate commitment (GO:0045165)|cellular response to transforming growth factor beta stimulus (GO:0071560)|epidermis morphogenesis (GO:0048730)|hair follicle development (GO:0001942)|hair follicle morphogenesis (GO:0031069)|neural crest cell differentiation (GO:0014033)|neuron differentiation (GO:0030182)|odontogenesis (GO:0042476)|positive regulation of gene expression (GO:0010628)|regulation of odontogenesis of dentin-containing tooth (GO:0042487)|sebaceous gland development (GO:0048733)|skin development (GO:0043588)|tongue development (GO:0043586)|Wnt signaling pathway (GO:0016055)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)	p.V141M(1)		breast(1)|cervix(1)|endometrium(2)|lung(6)|skin(2)	12		Renal(207;0.0474)		Epithelial(149;4.26e-07)|all cancers(144;8.8e-05)|LUSC - Lung squamous cell carcinoma(224;0.008)|Lung(261;0.00942)		AGCAGCTGGCGTGGTGCACGC	0.612																																																	1	Substitution - Missense(1)	cervix(1)											93.0	80.0	85.0					2																	219754750		2203	4300	6503	SO:0001583	missense	80326			AB059569	CCDS2426.1	2q35	2008-05-23			ENSG00000135925	ENSG00000135925		"""Wingless-type MMTV integration sites"""	13829	protein-coding gene	gene with protein product		606268				11350055, 17847007	Standard	NM_025216		Approved		uc002vjd.1	Q9GZT5	OTTHUMG00000133085	ENST00000258411.3:c.421G>A	2.37:g.219754750G>A	ENSP00000258411:p.Val141Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53S44|Q96TA7|Q9H7S8	Missense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt10	p.V141M	ENST00000258411.3	37	c.421	CCDS2426.1	2	.	.	.	.	.	.	.	.	.	.	G	16.77	3.213846	0.58452	.	.	ENSG00000135925	ENST00000258411	T	0.81247	-1.47	4.7	4.7	0.59300	.	0.000000	0.85682	D	0.000000	D	0.89684	0.6786	M	0.80616	2.505	0.80722	D	1	D	0.71674	0.998	D	0.74023	0.982	D	0.91076	0.4896	10	0.87932	D	0	.	16.7309	0.85434	0.0:0.0:1.0:0.0	.	141	Q9GZT5	WN10A_HUMAN	M	141	ENSP00000258411:V141M	ENSP00000258411:V141M	V	+	1	0	WNT10A	219462994	1.000000	0.71417	0.922000	0.36590	0.061000	0.15899	9.522000	0.98032	2.594000	0.87642	0.655000	0.94253	GTG	WNT10A	-	pfam_Wnt,smart_Wnt,prints_Wnt		0.612	WNT10A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT10A	HGNC	protein_coding	OTTHUMT00000256730.2	G	NM_025216		219754750	+1	no_errors	ENST00000258411	ensembl	human	known	70_37	missense	SNP	1.000	A
ZMYM2	7750	genome.wustl.edu	37	13	20637063	20637063	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr13:20637063G>C	ENST00000382874.2	+	19	3179	c.2989G>C	c.(2989-2991)Gat>Cat	p.D997H	ZMYM2_ENST00000382871.2_Missense_Mutation_p.D997H|ZMYM2_ENST00000382869.3_Missense_Mutation_p.D997H	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	997					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.D997H(2)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CAGCATGCCTGATGTACCATA	0.363																																																	2	Substitution - Missense(2)	cervix(2)											85.0	87.0	86.0					13																	20637063		1866	4105	5971	SO:0001583	missense	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.2989G>C	13.37:g.20637063G>C	ENSP00000372327:p.Asp997His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.D997H	ENST00000382874.2	37	c.2989	CCDS45016.1	13	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260259	0.80246	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.18810	2.19	5.66	5.66	0.87406	.	0.093144	0.64402	D	0.000001	T	0.29620	0.0739	L	0.46157	1.445	0.80722	D	1	B	0.26258	0.145	B	0.36418	0.224	T	0.06356	-1.0831	10	0.66056	D	0.02	-15.1043	19.7461	0.96252	0.0:0.0:1.0:0.0	.	997	Q9UBW7	ZMYM2_HUMAN	H	997;997;995;995;375	ENSP00000372322:D997H	ENSP00000372322:D997H	D	+	1	0	ZMYM2	19535063	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.155000	0.77445	2.645000	0.89757	0.650000	0.86243	GAT	ZMYM2	-	NULL		0.363	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	HGNC	protein_coding	OTTHUMT00000044051.2	G	NM_003453		20637063	+1	no_errors	ENST00000382869	ensembl	human	known	70_37	missense	SNP	1.000	C
ZMYM2	7750	genome.wustl.edu	37	13	20637063	20637063	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VL-01A-21D-A10S-08	TCGA-DS-A0VL-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	80482bf1-3ae3-4e8f-ba04-21192caf30d5	c1a153fd-d788-4e0f-b1a8-a3052a0f60b6	g.chr13:20637063G>C	ENST00000382874.2	+	19	3179	c.2989G>C	c.(2989-2991)Gat>Cat	p.D997H	ZMYM2_ENST00000382871.2_Missense_Mutation_p.D997H|ZMYM2_ENST00000382869.3_Missense_Mutation_p.D997H	NM_001190964.1	NP_001177893.1	Q9UBW7	ZMYM2_HUMAN	zinc finger, MYM-type 2	997					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|PML body (GO:0016605)	ubiquitin conjugating enzyme binding (GO:0031624)|zinc ion binding (GO:0008270)	p.D997H(2)		large_intestine(3)|lung(3)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	10		all_cancers(29;8.65e-21)|all_epithelial(30;1.04e-18)|all_lung(29;6.75e-18)|Lung SC(185;0.0262)|Ovarian(182;0.162)		all cancers(112;0.000148)|Epithelial(112;0.000249)|OV - Ovarian serous cystadenocarcinoma(117;0.00816)|Lung(94;0.0173)|LUSC - Lung squamous cell carcinoma(192;0.0856)		CAGCATGCCTGATGTACCATA	0.363																																																	2	Substitution - Missense(2)	cervix(2)											85.0	87.0	86.0					13																	20637063		1866	4105	5971	SO:0001583	missense	7750			AF012126	CCDS45016.1	13q11-q12	2013-01-08	2006-07-13	2006-07-13	ENSG00000121741	ENSG00000121741		"""Zinc fingers, MYM type"""	12989	protein-coding gene	gene with protein product		602221	"""zinc finger protein 198"""	ZNF198		9499416, 9425908	Standard	XM_005266517		Approved	RAMP, FIM, MYM	uc001ums.3	Q9UBW7	OTTHUMG00000016507	ENST00000382874.2:c.2989G>C	13.37:g.20637063G>C	ENSP00000372327:p.Asp997His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDG0|A6NI02|O43212|O43434|O60898|Q5W0Q4|Q5W0T3|Q63HP0|Q8NE39|Q9H0V5|Q9H538|Q9UEU2	Missense_Mutation	SNP	pfam_Znf_MYM,pfam_DUF3504,smart_TRASH	p.D997H	ENST00000382874.2	37	c.2989	CCDS45016.1	13	.	.	.	.	.	.	.	.	.	.	G	22.2	4.260259	0.80246	.	.	ENSG00000121741	ENST00000382869;ENST00000456228;ENST00000382874;ENST00000382871;ENST00000382870	T	0.18810	2.19	5.66	5.66	0.87406	.	0.093144	0.64402	D	0.000001	T	0.29620	0.0739	L	0.46157	1.445	0.80722	D	1	B	0.26258	0.145	B	0.36418	0.224	T	0.06356	-1.0831	10	0.66056	D	0.02	-15.1043	19.7461	0.96252	0.0:0.0:1.0:0.0	.	997	Q9UBW7	ZMYM2_HUMAN	H	997;997;995;995;375	ENSP00000372322:D997H	ENSP00000372322:D997H	D	+	1	0	ZMYM2	19535063	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	7.155000	0.77445	2.645000	0.89757	0.650000	0.86243	GAT	ZMYM2	-	NULL		0.363	ZMYM2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMYM2	HGNC	protein_coding	OTTHUMT00000044051.2	G	NM_003453		20637063	+1	no_errors	ENST00000382869	ensembl	human	known	70_37	missense	SNP	1.000	C
