#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCD4	5826	genome.wustl.edu	37	14	74763119	74763119	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:74763119G>T	ENST00000356924.4	-	5	602	c.459C>A	c.(457-459)ttC>ttA	p.F153L	ABCD4_ENST00000557588.1_Missense_Mutation_p.F153L|ABCD4_ENST00000557554.1_Intron|ABCD4_ENST00000298816.7_Missense_Mutation_p.F66L|AC005519.4_ENST00000554532.2_RNA	NM_005050.3	NP_005041.1	O14678	ABCD4_HUMAN	ATP-binding cassette, sub-family D (ALD), member 4	153	ABC transmembrane type-1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				cobalamin metabolic process (GO:0009235)|transmembrane transport (GO:0055085)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|peroxisome (GO:0005777)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)	p.F153L(1)		cervix(2)|endometrium(3)|kidney(3)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	27				BRCA - Breast invasive adenocarcinoma(234;0.00153)		GCTGCCGGCAGAATCGCTCCA	0.577																																																	1	Substitution - Missense(1)	cervix(1)											100.0	80.0	87.0					14																	74763119		2203	4300	6503	SO:0001583	missense	5826			AF009746	CCDS9828.1	14q24	2012-03-14			ENSG00000119688	ENSG00000119688		"""ATP binding cassette transporters / subfamily D"""	68	protein-coding gene	gene with protein product		603214		PXMP1L		9266848, 9302272	Standard	NR_003256		Approved	PMP69, P70R, EST352188	uc001xpr.2	O14678	OTTHUMG00000171207	ENST00000356924.4:c.459C>A	14.37:g.74763119G>T	ENSP00000349396:p.Phe153Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5L7|Q6IAQ0|Q96E75	Missense_Mutation	SNP	pfam_ABC_Ald_N,pfam_ABC_transporter-like,superfamily_ABC_transptrTM_dom_typ1,smart_AAA+_ATPase,pfscan_ABC_transporter-like,pfscan_ABC_transporter_type1	p.F153L	ENST00000356924.4	37	c.459	CCDS9828.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	5.180|5.180	0.218694|0.218694	0.09810|0.09810	.|.	.|.	ENSG00000119688|ENSG00000119688	ENST00000356924;ENST00000298816;ENST00000557588|ENST00000556971	D;D;D|.	0.99867|.	-7.31;-7.31;-7.31|.	4.82|4.82	2.89|2.89	0.33648|0.33648	ABC transporter, N-terminal (1);ABC transporter, transmembrane domain, type 1 (1);ABC transporter, integral membrane type 1 (1);|.	0.184107|.	0.50627|.	N|.	0.000105|.	T|T	0.47930|0.47930	0.1472|0.1472	N|N	0.17800|0.17800	0.525|0.525	0.43824|0.43824	D|D	0.996397|0.996397	B;B|.	0.10296|.	0.001;0.003|.	B;B|.	0.17722|.	0.005;0.019|.	T|T	0.28713|0.28713	-1.0035|-1.0035	10|5	0.37606|.	T|.	0.19|.	.|.	14.3301|14.3301	0.66550|0.66550	0.0:0.4317:0.5683:0.0|0.0:0.4317:0.5683:0.0	.|.	66;153|.	F8W7M4;O14678|.	.;ABCD4_HUMAN|.	L|Y	153;66;153|113	ENSP00000349396:F153L;ENSP00000298816:F66L;ENSP00000451993:F153L|.	ENSP00000298816:F66L|.	F|S	-|-	3|2	2|0	ABCD4|ABCD4	73832872|73832872	1.000000|1.000000	0.71417|0.71417	0.965000|0.965000	0.40720|0.40720	0.993000|0.993000	0.82548|0.82548	1.714000|1.714000	0.37961|0.37961	0.555000|0.555000	0.29079|0.29079	0.650000|0.650000	0.86243|0.86243	TTC|TCT	ABCD4	-	pfam_ABC_Ald_N,superfamily_ABC_transptrTM_dom_typ1,pfscan_ABC_transporter_type1		0.577	ABCD4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCD4	HGNC	protein_coding	OTTHUMT00000314382.1	G	NM_005050		74763119	-1	no_errors	ENST00000356924	ensembl	human	known	70_37	missense	SNP	1.000	T
ACAP1	9744	genome.wustl.edu	37	17	7253489	7253489	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:7253489C>G	ENST00000158762.3	+	20	2211	c.2005C>G	c.(2005-2007)Cga>Gga	p.R669G	KCTD11_ENST00000333751.3_5'Flank|RP11-542C16.1_ENST00000572417.1_RNA|ACAP1_ENST00000570504.1_5'Flank|ACAP1_ENST00000575415.1_5'Flank|ACAP1_ENST00000574499.1_5'Flank|ACAP1_ENST00000571471.1_5'Flank	NM_014716.3	NP_055531.1	Q15027	ACAP1_HUMAN	ArfGAP with coiled-coil, ankyrin repeat and PH domains 1	669	Required for interaction with GULP1.				protein transport (GO:0015031)|regulation of ARF GTPase activity (GO:0032312)	endosome (GO:0005768)|membrane (GO:0016020)	ARF GTPase activator activity (GO:0008060)|zinc ion binding (GO:0008270)	p.R669G(1)		NS(1)|breast(5)|cervix(3)|endometrium(4)|kidney(1)|large_intestine(7)|liver(1)|lung(6)|prostate(3)|skin(1)|urinary_tract(1)	33						TCTGGGGGCTCGAGACTCTGA	0.637																																																	1	Substitution - Missense(1)	cervix(1)											75.0	78.0	77.0					17																	7253489		2203	4300	6503	SO:0001583	missense	9744			D30758	CCDS11101.1	17p13.1	2013-01-11	2008-09-22	2008-09-22	ENSG00000072818	ENSG00000072818		"""ADP-ribosylation factor GTPase activating proteins"", ""Pleckstrin homology (PH) domain containing"", ""Ankyrin repeat domain containing"""	16467	protein-coding gene	gene with protein product		607763	"""centaurin, beta 1"""	CENTB1		11050434, 11062263	Standard	NM_014716		Approved	KIAA0050	uc002ggd.2	Q15027	OTTHUMG00000102199	ENST00000158762.3:c.2005C>G	17.37:g.7253489C>G	ENSP00000158762:p.Arg669Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53XN9	Missense_Mutation	SNP	pfam_ArfGAP,pfam_Pleckstrin_homology,superfamily_Ankyrin_rpt-contain_dom,smart_Pleckstrin_homology,smart_ArfGAP,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Pleckstrin_homology,pfscan_PLipase_C_PInositol-sp_X_dom,pfscan_ArfGAP,prints_ArfGAP	p.R669G	ENST00000158762.3	37	c.2005	CCDS11101.1	17	.	.	.	.	.	.	.	.	.	.	C	10.85	1.466072	0.26335	.	.	ENSG00000072818	ENST00000158762	T	0.68479	-0.33	5.26	4.29	0.51040	Ankyrin repeat-containing domain (3);	1.035270	0.07590	N	0.921741	T	0.63803	0.2542	L	0.58925	1.835	0.24617	N	0.993694	P	0.36354	0.549	B	0.39339	0.297	T	0.52003	-0.8633	10	0.23302	T	0.38	.	7.2639	0.26219	0.0:0.7395:0.171:0.0895	.	669	Q15027	ACAP1_HUMAN	G	669	ENSP00000158762:R669G	ENSP00000158762:R669G	R	+	1	2	ACAP1	7194213	0.004000	0.15560	0.442000	0.26870	0.967000	0.64934	0.863000	0.27913	1.441000	0.47550	0.448000	0.29417	CGA	ACAP1	-	superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.637	ACAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ACAP1	HGNC	protein_coding	OTTHUMT00000220049.4	C	NM_014716		7253489	+1	no_errors	ENST00000158762	ensembl	human	known	70_37	missense	SNP	0.221	G
ADAD1	132612	genome.wustl.edu	37	4	123301290	123301290	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:123301290G>C	ENST00000296513.2	+	3	251	c.66G>C	c.(64-66)aaG>aaC	p.K22N	ADAD1_ENST00000388724.2_Missense_Mutation_p.K22N|ADAD1_ENST00000388725.2_Missense_Mutation_p.K4N	NM_139243.3	NP_640336.1	Q96M93	ADAD1_HUMAN	adenosine deaminase domain containing 1 (testis-specific)	22					multicellular organismal development (GO:0007275)|RNA processing (GO:0006396)|spermatid development (GO:0007286)	nucleus (GO:0005634)	adenosine deaminase activity (GO:0004000)|RNA binding (GO:0003723)	p.K22N(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(8)|lung(18)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)	35						TGCTGAAAAAGAACCTGCCAG	0.483																																																	1	Substitution - Missense(1)	cervix(1)											80.0	68.0	72.0					4																	123301290		2203	4300	6503	SO:0001583	missense	132612			AK057303	CCDS34058.1, CCDS54800.1, CCDS54801.1	4q27	2007-05-31			ENSG00000164113	ENSG00000164113			30713	protein-coding gene	gene with protein product		614130				7543294, 9541871	Standard	NM_139243		Approved	Tenr	uc003iep.3	Q96M93	OTTHUMG00000150128	ENST00000296513.2:c.66G>C	4.37:g.123301290G>C	ENSP00000296513:p.Lys22Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKN4|B7WPB0|D3DNX2|Q8IWG6|Q8NA06	Missense_Mutation	SNP	pfam_A_deamin,pfam_Ds-RNA-bd,smart_Ds-RNA-bd,smart_A_deamin,pfscan_Ds-RNA-bd,pfscan_A_deamin	p.K22N	ENST00000296513.2	37	c.66	CCDS34058.1	4	.	.	.	.	.	.	.	.	.	.	G	20.5	4.000078	0.74818	.	.	ENSG00000164113	ENST00000446706;ENST00000296513;ENST00000439307;ENST00000388724;ENST00000388725	T;T;T	0.47177	0.85;0.87;0.94	5.12	4.24	0.50183	.	0.170957	0.39341	N	0.001391	T	0.53850	0.1822	L	0.34521	1.04	0.32277	N	0.568044	P;D	0.76494	0.547;0.999	B;D	0.66847	0.28;0.947	T	0.63786	-0.6558	10	0.72032	D	0.01	-14.2665	10.5619	0.45150	0.1025:0.0:0.8975:0.0	.	22;22	Q96M93-2;Q96M93	.;ADAD1_HUMAN	N	22;22;22;22;4	ENSP00000296513:K22N;ENSP00000373376:K22N;ENSP00000373377:K4N	ENSP00000296513:K22N	K	+	3	2	ADAD1	123520740	1.000000	0.71417	1.000000	0.80357	0.934000	0.57294	3.681000	0.54648	1.063000	0.40649	0.555000	0.69702	AAG	ADAD1	-	NULL		0.483	ADAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAD1	HGNC	protein_coding	OTTHUMT00000316452.1	G	NM_139243		123301290	+1	no_errors	ENST00000296513	ensembl	human	known	70_37	missense	SNP	1.000	C
ADCY10	55811	genome.wustl.edu	37	1	167852753	167852753	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:167852753G>A	ENST00000367851.4	-	9	1126	c.942C>T	c.(940-942)atC>atT	p.I314I	ADCY10_ENST00000367848.1_Silent_p.I222I|ADCY10_ENST00000545172.1_Silent_p.I161I	NM_018417.4	NP_060887.2	Q96PN6	ADCYA_HUMAN	adenylate cyclase 10 (soluble)	314	Guanylate cyclase 2. {ECO:0000255|PROSITE-ProRule:PRU00099}.				cAMP biosynthetic process (GO:0006171)|intracellular signal transduction (GO:0035556)|positive regulation of apoptotic process (GO:0043065)|spermatogenesis (GO:0007283)	apical part of cell (GO:0045177)|axon (GO:0030424)|basal part of cell (GO:0045178)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite (GO:0030425)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenylate cyclase activity (GO:0004016)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)	p.I314I(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(3)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(11)|lung(26)|ovary(2)|prostate(4)|skin(6)|stomach(1)|urinary_tract(1)	63						AGGCATCCTGGATGGCTGGGC	0.448																																																	1	Substitution - coding silent(1)	cervix(1)											208.0	183.0	191.0					1																	167852753		2203	4300	6503	SO:0001819	synonymous_variant	55811			AF271058	CCDS1265.1, CCDS53426.1, CCDS72977.1	1q24	2013-02-04			ENSG00000143199	ENSG00000143199	4.6.1.1	"""Adenylate cyclases"""	21285	protein-coding gene	gene with protein product	"""soluble adenylyl cyclase"", ""Hypercalciuria, absorptive, 2"""	605205					Standard	XM_006711449		Approved	SAC, Sacy, SACI, HCA2, RP1-313L4.2	uc001ger.3	Q96PN6	OTTHUMG00000034573	ENST00000367851.4:c.942C>T	1.37:g.167852753G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZF0|F5GWS5|O95558|Q5R329|Q5R330|Q8WXV4|Q9NNX0	Silent	SNP	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10,pfscan_A/G_cyclase	p.I314	ENST00000367851.4	37	c.942	CCDS1265.1	1																																																																																			ADCY10	-	pfam_A/G_cyclase,superfamily_A/G_cyclase,pirsf_Adenylate_cylcase_typ10		0.448	ADCY10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCY10	HGNC	protein_coding	OTTHUMT00000083663.1	G	NM_018417		167852753	-1	no_errors	ENST00000367851	ensembl	human	known	70_37	silent	SNP	1.000	A
AGBL5	60509	genome.wustl.edu	37	2	27276285	27276285	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:27276285C>T	ENST00000360131.4	+	3	390	c.231C>T	c.(229-231)ttC>ttT	p.F77F	AGBL5_ENST00000323064.8_Silent_p.F77F|RP11-503P10.1_ENST00000607407.1_RNA	NM_021831.5	NP_068603.4	Q8NDL9	CBPC5_HUMAN	ATP/GTP binding protein-like 5	77					protein branching point deglutamylation (GO:0035611)|protein deglutamylation (GO:0035608)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	metallocarboxypeptidase activity (GO:0004181)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)	p.F77F(1)		breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|large_intestine(5)|lung(8)|ovary(3)|pancreas(1)|prostate(2)|skin(1)	28	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GGTTCTACTTCAGCGTCCGGG	0.522																																																	1	Substitution - coding silent(1)	cervix(1)											109.0	100.0	103.0					2																	27276285		2203	4300	6503	SO:0001819	synonymous_variant	60509			BC007415	CCDS1732.3, CCDS42665.1	2p23.3	2014-06-23			ENSG00000084693	ENSG00000084693			26147	protein-coding gene	gene with protein product	"""cytosolic carboxypeptidase 5"""	615900				24022482	Standard	NM_001035507		Approved	FLJ21839, CCP5	uc002rie.3	Q8NDL9	OTTHUMG00000128406	ENST00000360131.4:c.231C>T	2.37:g.27276285C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VDI7|B7WPG9|B7Z7I7|D6W548|Q53SW0|Q53SZ0|Q96IK8|Q9H6V0|Q9H8P8	Silent	SNP	pfam_Peptidase_M14	p.F77	ENST00000360131.4	37	c.231	CCDS1732.3	2																																																																																			AGBL5	-	NULL		0.522	AGBL5-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AGBL5	HGNC	protein_coding	OTTHUMT00000309033.1	C	NM_021831		27276285	+1	no_errors	ENST00000360131	ensembl	human	known	70_37	silent	SNP	1.000	T
AHNAK2	113146	genome.wustl.edu	37	14	105417015	105417015	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:105417015G>A	ENST00000333244.5	-	7	4892	c.4773C>T	c.(4771-4773)ctC>ctT	p.L1591L	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	1591						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)		p.L1591L(1)		cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			GGGGCCCCTTGAGGTCCACTT	0.592																																																	1	Substitution - coding silent(1)	cervix(1)											116.0	126.0	123.0					14																	105417015		1810	4026	5836	SO:0001819	synonymous_variant	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.4773C>T	14.37:g.105417015G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Silent	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.L1591	ENST00000333244.5	37	c.4773	CCDS45177.1	14																																																																																			AHNAK2	-	NULL		0.592	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	G	NM_138420		105417015	-1	no_errors	ENST00000333244	ensembl	human	known	70_37	silent	SNP	0.007	A
ANK2	287	genome.wustl.edu	37	4	114267077	114267077	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:114267077C>T	ENST00000357077.4	+	35	4323	c.4270C>T	c.(4270-4272)Cct>Tct	p.P1424S	ANK2_ENST00000506722.1_Missense_Mutation_p.P1415S|ANK2_ENST00000509550.1_Missense_Mutation_p.P600S|ANK2_ENST00000394537.3_Missense_Mutation_p.P1424S|ANK2_ENST00000264366.6_Missense_Mutation_p.P1391S|ANK2_ENST00000510275.2_Missense_Mutation_p.P76S	NM_001148.4	NP_001139.3	Q01484	ANK2_HUMAN	ankyrin 2, neuronal	1424					atrial cardiac muscle cell action potential (GO:0086014)|atrial cardiac muscle cell to AV node cell communication (GO:0086066)|atrial septum development (GO:0003283)|axon guidance (GO:0007411)|cardiac muscle contraction (GO:0060048)|cellular calcium ion homeostasis (GO:0006874)|cellular protein localization (GO:0034613)|membrane depolarization during SA node cell action potential (GO:0086046)|paranodal junction assembly (GO:0030913)|positive regulation of calcium ion transmembrane transporter activity (GO:1901021)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cation channel activity (GO:2001259)|positive regulation of gene expression (GO:0010628)|positive regulation of potassium ion transmembrane transporter activity (GO:1901018)|positive regulation of potassium ion transport (GO:0043268)|protein localization to cell surface (GO:0034394)|protein localization to endoplasmic reticulum (GO:0070972)|protein localization to M-band (GO:0036309)|protein localization to organelle (GO:0033365)|protein localization to plasma membrane (GO:0072659)|protein localization to T-tubule (GO:0036371)|protein stabilization (GO:0050821)|protein targeting to plasma membrane (GO:0072661)|regulation of calcium ion transmembrane transporter activity (GO:1901019)|regulation of calcium ion transport (GO:0051924)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of cardiac muscle cell membrane potential (GO:0086036)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by calcium ion signaling (GO:0010882)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|regulation of heart rate by cardiac conduction (GO:0086091)|regulation of protein stability (GO:0031647)|regulation of release of sequestered calcium ion into cytosol (GO:0051279)|regulation of ventricular cardiac muscle cell membrane repolarization (GO:0060307)|response to methylmercury (GO:0051597)|SA node cell action potential (GO:0086015)|SA node cell to atrial cardiac muscle cell communication (GO:0086070)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|T-tubule organization (GO:0033292)|ventricular cardiac muscle cell action potential (GO:0086005)	A band (GO:0031672)|basolateral plasma membrane (GO:0016323)|costamere (GO:0043034)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|intercalated disc (GO:0014704)|intracellular (GO:0005622)|M band (GO:0031430)|membrane raft (GO:0045121)|neuron projection (GO:0043005)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|enzyme binding (GO:0019899)|ion channel binding (GO:0044325)|potassium channel regulator activity (GO:0015459)|protein binding, bridging (GO:0030674)|protein kinase binding (GO:0019901)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)	p.P1424S(1)		NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(10)|cervix(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(54)|liver(2)|lung(112)|ovary(8)|pancreas(1)|prostate(7)|skin(11)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(10)	248		Ovarian(17;0.0448)|Hepatocellular(203;0.218)		OV - Ovarian serous cystadenocarcinoma(123;4.92e-05)		GACTCAGGAACCTTGCGGACG	0.408																																																	1	Substitution - Missense(1)	cervix(1)											123.0	106.0	112.0					4																	114267077		2203	4300	6503	SO:0001583	missense	287			M37123	CCDS3702.1, CCDS43261.1, CCDS54796.1	4q25-q26	2014-09-17	2003-03-12		ENSG00000145362	ENSG00000145362		"""Ankyrin repeat domain containing"""	493	protein-coding gene	gene with protein product		106410	"""long (electrocardiographic) QT syndrome 4"""	LQT4		7485162, 12571597	Standard	NM_001148		Approved		uc003ibe.4	Q01484	OTTHUMG00000132912	ENST00000357077.4:c.4270C>T	4.37:g.114267077C>T	ENSP00000349588:p.Pro1424Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q01485|Q08AC7|Q08AC8|Q7Z3L5	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_ZU5,pfam_Death,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ankyrin_rpt,smart_ZU5,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_ZU5,prints_Ankyrin_rpt	p.P1424S	ENST00000357077.4	37	c.4270	CCDS3702.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	33|33	5.198202|5.198202	0.94997|0.94997	.|.	.|.	ENSG00000145362|ENSG00000145362	ENST00000503423;ENST00000506722;ENST00000431447;ENST00000504454;ENST00000394537;ENST00000357077;ENST00000264366;ENST00000343056;ENST00000509550;ENST00000510275|ENST00000514960;ENST00000504415	T;T;T;T;T;T;T;T|.	0.27402|.	1.67;1.67;1.67;1.67;1.67;1.67;1.67;1.67|.	6.08|6.08	6.08|6.08	0.98989|0.98989	.|.	0.000000|.	0.56097|.	D|.	0.000030|.	T|T	0.77391|0.77391	0.4123|0.4123	M|M	0.71581|0.71581	2.175|2.175	0.58432|0.58432	D|D	0.999998|0.999998	D;D;D;D;D;D;D|.	0.89917|.	1.0;1.0;0.984;1.0;0.998;1.0;1.0|.	D;D;D;D;D;D;D|.	0.91635|.	0.982;0.998;0.917;0.998;0.976;0.999;0.999|.	T|T	0.73773|0.73773	-0.3877|-0.3877	10|5	0.87932|.	D|.	0|.	.|.	20.6721|20.6721	0.99693|0.99693	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	600;1391;470;436;1424;1424;1415|.	E9PCH6;Q01484;F8W694;Q7Z344;Q01484-2;Q01484-4;Q01484-5|.	.;ANK2_HUMAN;.;.;.;.;.|.	S|I	1337;1415;470;1439;1424;1424;1391;1415;600;76|436;76	ENSP00000421011:P1337S;ENSP00000421067:P1415S;ENSP00000424722:P1439S;ENSP00000378044:P1424S;ENSP00000349588:P1424S;ENSP00000264366:P1391S;ENSP00000426944:P600S;ENSP00000421023:P76S|.	ENSP00000264366:P1391S|.	P|T	+|+	1|2	0|0	ANK2|ANK2	114486526|114486526	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.805000|0.805000	0.45488|0.45488	4.872000|4.872000	0.63050|0.63050	2.894000|2.894000	0.99253|0.99253	0.591000|0.591000	0.81541|0.81541	CCT|ACC	ANK2	-	NULL		0.408	ANK2-001	KNOWN	basic|CCDS	protein_coding	ANK2	HGNC	protein_coding	OTTHUMT00000256422.2	C	NM_001148		114267077	+1	no_errors	ENST00000357077	ensembl	human	known	70_37	missense	SNP	1.000	T
AP2A1	160	genome.wustl.edu	37	19	50295238	50295238	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:50295238C>T	ENST00000359032.5	+	5	520	c.520C>T	c.(520-522)Cga>Tga	p.R174*	AP2A1_ENST00000354293.5_Nonsense_Mutation_p.R174*|AP2A1_ENST00000600199.1_3'UTR	NM_014203.2	NP_055018.2	O95782	AP2A1_HUMAN	adaptor-related protein complex 2, alpha 1 subunit	174					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|axon guidance (GO:0007411)|endocytosis (GO:0006897)|epidermal growth factor receptor signaling pathway (GO:0007173)|Golgi to endosome transport (GO:0006895)|intracellular protein transport (GO:0006886)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)|negative regulation of hyaluronan biosynthetic process (GO:1900126)|neurotrophin TRK receptor signaling pathway (GO:0048011)|regulation of defense response to virus by virus (GO:0050690)|synaptic transmission (GO:0007268)|viral process (GO:0016032)	AP-2 adaptor complex (GO:0030122)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|clathrin coat of trans-Golgi network vesicle (GO:0030130)|clathrin-coated endocytic vesicle membrane (GO:0030669)|cytosol (GO:0005829)|endocytic vesicle membrane (GO:0030666)|membrane (GO:0016020)|plasma membrane (GO:0005886)	protein kinase binding (GO:0019901)|protein transporter activity (GO:0008565)	p.R174*(2)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(3)|lung(7)|ovary(2)	19		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.0023)|GBM - Glioblastoma multiforme(134;0.0157)		GTGCCTCCTTCGACTGTACAA	0.647																																																	2	Substitution - Nonsense(2)	cervix(2)											72.0	79.0	77.0					19																	50295238		2173	4259	6432	SO:0001587	stop_gained	160			AA993745	CCDS46148.1, CCDS46149.1	19q13.3	2008-05-23				ENSG00000196961			561	protein-coding gene	gene with protein product		601026		CLAPA1, ADTAA		2564002	Standard	NM_014203		Approved		uc002ppn.3	O95782		ENST00000359032.5:c.520C>T	19.37:g.50295238C>T	ENSP00000351926:p.Arg174*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96CI7|Q96PP6|Q96PP7|Q9H070	Nonsense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,pfam_Clathrin_a-adaptin_app_sub_C,pfam_Clathrin_a/b/g-adaptin_app_Ig,superfamily_ARM-type_fold,superfamily_Coatomer/calthrin_app_sub_C,superfamily_Coatomer/clathrin_app_Ig-like,smart_Clathrin_a/b/g-adaptin_app_Ig,pirsf_AP2_complex_asu	p.R174*	ENST00000359032.5	37	c.520	CCDS46148.1	19	.	.	.	.	.	.	.	.	.	.	C	26.7	4.758674	0.89843	.	.	ENSG00000196961	ENST00000354293;ENST00000359032	.	.	.	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	12.2428	0.54553	0.1702:0.8298:0.0:0.0	.	.	.	.	X	174	.	ENSP00000346246:R174X	R	+	1	2	AP2A1	54987050	1.000000	0.71417	1.000000	0.80357	0.069000	0.16628	3.022000	0.49659	2.334000	0.79466	0.655000	0.94253	CGA	AP2A1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP2_complex_asu		0.647	AP2A1-008	NOVEL	non_canonical_U12|basic|appris_candidate_longest|CCDS	protein_coding	AP2A1	HGNC	protein_coding	OTTHUMT00000465809.1	C			50295238	+1	no_errors	ENST00000354293	ensembl	human	known	70_37	nonsense	SNP	1.000	T
AP3B1	8546	genome.wustl.edu	37	5	77524005	77524005	+	Missense_Mutation	SNP	G	G	T	rs62001053	byFrequency	TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr5:77524005G>T	ENST00000255194.6	-	4	513	c.338C>A	c.(337-339)gCa>gAa	p.A113E	AP3B1_ENST00000519295.1_Missense_Mutation_p.A64E	NM_001271769.1	NP_001258698.1	O00203	AP3B1_HUMAN	adaptor-related protein complex 3, beta 1 subunit	113					anterograde axon cargo transport (GO:0008089)|anterograde synaptic vesicle transport (GO:0048490)|antigen processing and presentation, exogenous lipid antigen via MHC class Ib (GO:0048007)|blood coagulation (GO:0007596)|intracellular protein transport (GO:0006886)|melanosome organization (GO:0032438)|positive regulation of NK T cell differentiation (GO:0051138)|protein targeting to lysosome (GO:0006622)	AP-3 adaptor complex (GO:0030123)|cytoplasmic vesicle (GO:0031410)|Golgi apparatus (GO:0005794)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)	GTP-dependent protein binding (GO:0030742)|protein phosphatase binding (GO:0019903)	p.A113E(1)		breast(5)|central_nervous_system(2)|cervix(1)|endometrium(3)|large_intestine(12)|lung(12)|prostate(1)|skin(2)|urinary_tract(1)	39		all_lung(232;0.000397)|Lung NSC(167;0.00106)|Ovarian(174;0.0105)|Prostate(461;0.215)		OV - Ovarian serous cystadenocarcinoma(54;8.23e-47)|Epithelial(54;2.74e-41)|all cancers(79;4.8e-36)		GGACAGGAGTGCAAGATCCTG	0.378									Hermansky-Pudlak syndrome																																								1	Substitution - Missense(1)	cervix(1)											103.0	98.0	99.0					5																	77524005		2203	4300	6503	SO:0001583	missense	8546	Familial Cancer Database	HPS, HPS1-8	U81504	CCDS4041.1, CCDS64186.1	5q14.1	2014-09-17			ENSG00000132842	ENSG00000132842			566	protein-coding gene	gene with protein product		603401				9182526, 9151686	Standard	NM_003664		Approved	ADTB3A, HPS2	uc003kfj.4	O00203	OTTHUMG00000106919	ENST00000255194.6:c.338C>A	5.37:g.77524005G>T	ENSP00000255194:p.Ala113Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	E5RJ68|O00580|Q7Z393|Q9HD66	Missense_Mutation	SNP	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta	p.A113E	ENST00000255194.6	37	c.338	CCDS4041.1	5	.	.	.	.	.	.	.	.	.	.	G	32	5.166777	0.94768	.	.	ENSG00000132842	ENST00000255194;ENST00000519295;ENST00000535760	T;T	0.31247	1.5;1.5	5.48	5.48	0.80851	Clathrin/coatomer adaptor, adaptin-like, N-terminal (1);Armadillo-like helical (1);Armadillo-type fold (1);	0.213874	0.47852	D	0.000205	T	0.69548	0.3123	H	0.96720	3.87	0.80722	D	1	D	0.55800	0.973	D	0.63113	0.911	T	0.80417	-0.1391	10	0.87932	D	0	-7.9659	19.7648	0.96335	0.0:0.0:1.0:0.0	.	113	O00203	AP3B1_HUMAN	E	113;64;113	ENSP00000255194:A113E;ENSP00000430597:A64E	ENSP00000255194:A113E	A	-	2	0	AP3B1	77559761	1.000000	0.71417	0.998000	0.56505	0.985000	0.73830	7.970000	0.88000	2.739000	0.93911	0.579000	0.79373	GCA	AP3B1	-	pfam_Clathrin/coatomer_adapt-like_N,superfamily_ARM-type_fold,pirsf_AP3_beta		0.378	AP3B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AP3B1	HGNC	protein_coding	OTTHUMT00000225548.2	G			77524005	-1	no_errors	ENST00000255194	ensembl	human	known	70_37	missense	SNP	1.000	T
ARHGAP6	395	genome.wustl.edu	37	X	11187767	11187767	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chrX:11187767G>T	ENST00000337414.4	-	9	2539	c.1667C>A	c.(1666-1668)aCc>aAc	p.T556N	ARHGAP6_ENST00000491514.1_5'UTR|ARHGAP6_ENST00000380732.3_Missense_Mutation_p.T588N|ARHGAP6_ENST00000380718.1_Missense_Mutation_p.T556N|ARHGAP6_ENST00000413512.3_Missense_Mutation_p.T365N|ARHGAP6_ENST00000534860.1_Missense_Mutation_p.T381N|ARHGAP6_ENST00000303025.6_Missense_Mutation_p.T353N|ARHGAP6_ENST00000380736.1_Missense_Mutation_p.T353N	NM_013427.2	NP_038286.2	O43182	RHG06_HUMAN	Rho GTPase activating protein 6	556	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin filament polymerization (GO:0030041)|activation of phospholipase C activity (GO:0007202)|focal adhesion assembly (GO:0048041)|negative regulation of focal adhesion assembly (GO:0051895)|negative regulation of stress fiber assembly (GO:0051497)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of signal transduction (GO:0009967)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|Rho protein signal transduction (GO:0007266)|small GTPase mediated signal transduction (GO:0007264)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|cytoplasm (GO:0005737)|cytosol (GO:0005829)	phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|Rho GTPase activator activity (GO:0005100)|SH3/SH2 adaptor activity (GO:0005070)	p.T556N(1)		cervix(1)|endometrium(5)|kidney(1)|large_intestine(5)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	38						TCCAAATATGGTGGCTAAGTT	0.453																																																	1	Substitution - Missense(1)	cervix(1)											147.0	122.0	130.0					X																	11187767		2203	4300	6503	SO:0001583	missense	395			AF012272	CCDS14140.1, CCDS14141.1, CCDS14142.1	Xp22.3	2008-02-05			ENSG00000047648	ENSG00000047648		"""Rho GTPase activating proteins"""	676	protein-coding gene	gene with protein product		300118				9417914	Standard	XM_005274507		Approved	rhoGAPX-1	uc004cup.1	O43182	OTTHUMG00000021134	ENST00000337414.4:c.1667C>A	X.37:g.11187767G>T	ENSP00000338967:p.Thr556Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RWQ0|O43437|Q9P1B3|Q9UK81|Q9UK82	Missense_Mutation	SNP	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom	p.T556N	ENST00000337414.4	37	c.1667	CCDS14140.1	X	.	.	.	.	.	.	.	.	.	.	G	28.2	4.900944	0.92035	.	.	ENSG00000047648	ENST00000534860;ENST00000380736;ENST00000303025;ENST00000337414;ENST00000380717;ENST00000380718;ENST00000413512;ENST00000380732	T;T;T;T;T;T;T;T	0.20463	2.07;2.07;2.07;2.07;2.07;2.07;2.07;2.07	5.66	5.66	0.87406	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.000000	0.56097	D	0.000035	T	0.57902	0.2085	M	0.91406	3.205	0.80722	D	1	D;D;D;D;D	0.89917	0.999;1.0;0.999;1.0;1.0	D;D;D;D;D	0.85130	0.985;0.991;0.948;0.996;0.997	T	0.67925	-0.5544	10	0.72032	D	0.01	.	18.7976	0.92001	0.0:0.0:1.0:0.0	.	365;353;556;556;556	B7Z8H7;O43182-5;O43182-2;O43182;A8KAL3	.;.;.;RHG06_HUMAN;.	N	381;353;353;556;392;556;365;588	ENSP00000438135:T381N;ENSP00000370112:T353N;ENSP00000302312:T353N;ENSP00000338967:T556N;ENSP00000370093:T392N;ENSP00000370094:T556N;ENSP00000389394:T365N;ENSP00000370108:T588N	ENSP00000302312:T353N	T	-	2	0	ARHGAP6	11097688	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.273000	0.95719	2.385000	0.81259	0.600000	0.82982	ACC	ARHGAP6	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.453	ARHGAP6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARHGAP6	HGNC	protein_coding	OTTHUMT00000055760.2	G	NM_013427		11187767	-1	no_errors	ENST00000337414	ensembl	human	known	70_37	missense	SNP	1.000	T
ARHGEF2	9181	genome.wustl.edu	37	1	155931936	155931936	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:155931936C>T	ENST00000361247.4	-	10	1278	c.1179G>A	c.(1177-1179)aaG>aaA	p.K393K	ARHGEF2_ENST00000313695.7_Silent_p.K365K|ARHGEF2_ENST00000462460.2_Silent_p.K438K|ARHGEF2_ENST00000368315.4_Silent_p.K394K|ARHGEF2_ENST00000477754.2_Intron|ARHGEF2_ENST00000313667.4_Silent_p.K392K|ARHGEF2_ENST00000368316.1_Silent_p.K365K	NM_001162383.1|NM_001162384.1	NP_001155855.1|NP_001155856.1	Q92974	ARHG2_HUMAN	Rho/Rac guanine nucleotide exchange factor (GEF) 2	393	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.				actin filament organization (GO:0007015)|apoptotic signaling pathway (GO:0097190)|cell morphogenesis (GO:0000902)|cellular hyperosmotic response (GO:0071474)|cellular response to muramyl dipeptide (GO:0071225)|cellular response to tumor necrosis factor (GO:0071356)|establishment of mitotic spindle orientation (GO:0000132)|innate immune response (GO:0045087)|intracellular protein transport (GO:0006886)|mitotic nuclear division (GO:0007067)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of intrinsic apoptotic signaling pathway in response to osmotic stress (GO:1902219)|negative regulation of microtubule depolymerization (GO:0007026)|negative regulation of necroptotic process (GO:0060546)|negative regulation of neurogenesis (GO:0050768)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of Rac GTPase activity (GO:0032855)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of tumor necrosis factor production (GO:0032760)|regulation of cell proliferation (GO:0042127)|regulation of Rho protein signal transduction (GO:0035023)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|protein complex (GO:0043234)|ruffle membrane (GO:0032587)|tight junction (GO:0005923)|vesicle (GO:0031982)	microtubule binding (GO:0008017)|Rac GTPase binding (GO:0048365)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)|Rho GTPase binding (GO:0017048)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)	p.K365K(1)		breast(4)|cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(6)|lung(15)|ovary(1)|skin(2)	40	Hepatocellular(266;0.133)|all_hematologic(923;0.145)|all_neural(408;0.195)					GTAACGGGTACTTGGTGATGC	0.642																																					Melanoma(178;35 2768 6610 28839)												1	Substitution - coding silent(1)	cervix(1)											74.0	75.0	75.0					1																	155931936		2203	4300	6503	SO:0001819	synonymous_variant	9181			AB014551	CCDS1125.1, CCDS53375.1, CCDS53376.1	1q21-q22	2013-01-10	2009-06-12		ENSG00000116584	ENSG00000116584		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	682	protein-coding gene	gene with protein product		607560	"""rho/rac guanine nucleotide exchange factor (GEF) 2"""			9857026, 9734811	Standard	NM_004723		Approved	LFP40, GEF-H1, KIAA0651, P40	uc001fmt.2	Q92974	OTTHUMG00000017464	ENST00000361247.4:c.1179G>A	1.37:g.155931936C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVA6|O75142|Q15079|Q5VY92|Q8TDA3|Q8WUG4|Q9H023	Silent	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.K394	ENST00000361247.4	37	c.1182	CCDS53376.1	1																																																																																			ARHGEF2	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.642	ARHGEF2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	ARHGEF2	HGNC	protein_coding	OTTHUMT00000046204.2	C	NM_004723		155931936	-1	no_errors	ENST00000368315	ensembl	human	known	70_37	silent	SNP	1.000	T
BMP1	649	genome.wustl.edu	37	8	22056829	22056829	+	Intron	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:22056829G>C	ENST00000306385.5	+	15	2777				BMP1_ENST00000354870.5_Intron|BMP1_ENST00000306349.8_Intron|BMP1_ENST00000397816.3_Missense_Mutation_p.R801T	NM_006129.4	NP_006120.1	P13497	BMP1_HUMAN	bone morphogenetic protein 1						cartilage condensation (GO:0001502)|cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|lipoprotein metabolic process (GO:0042157)|multicellular organismal development (GO:0007275)|ossification (GO:0001503)|positive regulation of cartilage development (GO:0061036)|proteolysis (GO:0006508)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)	extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|membrane-bounded vesicle (GO:0031988)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|peptidase activity (GO:0008233)|zinc ion binding (GO:0008270)			breast(1)|endometrium(7)|kidney(2)|large_intestine(7)|lung(7)|ovary(2)|prostate(1)|skin(3)	30				Colorectal(74;0.00229)|COAD - Colon adenocarcinoma(73;0.0661)|READ - Rectum adenocarcinoma(644;0.11)		CCTAAGCCAAGAAGGAGAAGA	0.612																																																	0													54.0	65.0	61.0					8																	22056829		2203	4300	6503	SO:0001627	intron_variant	649				CCDS6026.1, CCDS34856.1	8p21	2013-02-06	2004-08-09		ENSG00000168487	ENSG00000168487	3.4.24.19	"""Bone morphogenetic proteins"""	1067	protein-coding gene	gene with protein product	"""procollagen C-endopeptidase"""	112264	"""procollagen C-endopeptidase"""	PCOLC		2004778	Standard	NM_006129		Approved		uc003xbg.3	P13497	OTTHUMG00000097761	ENST00000306385.5:c.2107+1896G>C	8.37:g.22056829G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6F5|B2RN46|D3DSR0|Q13292|Q13872|Q14874|Q99421|Q99422|Q99423|Q9UL38	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.R801T	ENST00000306385.5	37	c.2402	CCDS6026.1	8	.	.	.	.	.	.	.	.	.	.	G	15.01	2.707392	0.48412	.	.	ENSG00000168487	ENST00000397816	T	0.65364	-0.15	5.02	5.02	0.67125	.	.	.	.	.	T	0.54287	0.1849	.	.	.	0.80722	D	1	B	0.14012	0.009	B	0.20955	0.032	T	0.51403	-0.8710	8	0.40728	T	0.16	.	13.8287	0.63366	0.0:0.0:1.0:0.0	.	801	P13497-6	.	T	801	ENSP00000380917:R801T	ENSP00000380917:R801T	R	+	2	0	BMP1	22112774	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.046000	0.49846	2.342000	0.79632	0.462000	0.41574	AGA	BMP1	-	pirsf_BMP_1/tolloid-like		0.612	BMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BMP1	HGNC	protein_coding	OTTHUMT00000214995.2	G	NM_006132		22056829	+1	no_errors	ENST00000397816	ensembl	human	known	70_37	missense	SNP	1.000	C
ZGRF1	55345	genome.wustl.edu	37	4	113461126	113461127	+	Frame_Shift_Ins	INS	-	-	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:113461126_113461127insT	ENST00000505019.1	-	27	6189_6190	c.6064_6065insA	c.(6064-6066)agafs	p.R2022fs	RP11-402J6.1_ENST00000504009.1_RNA	NM_018392.4	NP_060862.3	Q86YA3	ZGRF1_HUMAN		2022						integral component of membrane (GO:0016021)	zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(3)|kidney(5)|large_intestine(6)|lung(21)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	45		Ovarian(17;0.156)		OV - Ovarian serous cystadenocarcinoma(123;0.000676)		AACATTCATTCTTTTTTCTGAA	0.406																																																	0																																										SO:0001589	frameshift_variant	55345																														ENST00000505019.1:c.6065dupA	4.37:g.113461132_113461132dupT	ENSP00000424737:p.Arg2022fs	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQX2|B4DSN6|B4DYU8|E9PDE1|G5EA02|Q6ZU11|Q9NSW3|Q9NUJ4	Frame_Shift_Ins	INS	pfam_DUF2439,pfam_Znf_GRF	p.R2022fs	ENST00000505019.1	37	c.6065_6064		4																																																																																			C4orf21	-	NULL		0.406	C4orf21-003	KNOWN	basic|appris_principal	protein_coding	C4orf21	HGNC	protein_coding	OTTHUMT00000256413.1	-			113461127	-1	no_errors	ENST00000505019	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:0.990	T
CARD11	84433	genome.wustl.edu	37	7	2972191	2972191	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:2972191C>T	ENST00000396946.4	-	11	1951	c.1548G>A	c.(1546-1548)ctG>ctA	p.L516L		NM_032415.4	NP_115791.3	Q9BXL7	CAR11_HUMAN	caspase recruitment domain family, member 11	516					Fc-epsilon receptor signaling pathway (GO:0038095)|innate immune response (GO:0045087)|nucleotide phosphorylation (GO:0046939)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of cytokine production (GO:0001819)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of interleukin-2 biosynthetic process (GO:0045086)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of T cell proliferation (GO:0042102)|regulation of apoptotic process (GO:0042981)|regulation of B cell differentiation (GO:0045577)|regulation of T cell differentiation (GO:0045580)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|thymic T cell selection (GO:0045061)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|immunological synapse (GO:0001772)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	CARD domain binding (GO:0050700)|guanylate kinase activity (GO:0004385)	p.L509L(1)		NS(1)|breast(3)|central_nervous_system(1)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(62)|kidney(11)|large_intestine(13)|lung(31)|ovary(4)|prostate(5)|skin(7)|upper_aerodigestive_tract(2)	150		Ovarian(82;0.0115)		OV - Ovarian serous cystadenocarcinoma(56;8.44e-14)		ATGTTCGCTTCAGGCTGATGG	0.493			Mis		DLBCL																																			Dom	yes		7	7p22	84433	"""caspase recruitment domain family, member 11"""		L	1	Substitution - coding silent(1)	cervix(1)											144.0	114.0	124.0					7																	2972191		2203	4300	6503	SO:0001819	synonymous_variant	84433			AF322641	CCDS5336.2	7p22	2014-09-17			ENSG00000198286	ENSG00000198286			16393	protein-coding gene	gene with protein product	"""card-maguk protein 1"", ""bcl10-interacting maguk protein 3"""	607210				11278692, 11356195	Standard	NM_032415		Approved	CARMA1, BIMP3	uc003smv.3	Q9BXL7	OTTHUMG00000023023	ENST00000396946.4:c.1548G>A	7.37:g.2972191C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1Z7|Q2NKN7|Q548H3	Silent	SNP	pfam_CARD,superfamily_DEATH-like,superfamily_PDZ,pfscan_CARD	p.L516	ENST00000396946.4	37	c.1548	CCDS5336.2	7																																																																																			CARD11	-	NULL		0.493	CARD11-011	KNOWN	basic|appris_principal|CCDS	protein_coding	CARD11	HGNC	protein_coding	OTTHUMT00000059344.4	C	NM_032415		2972191	-1	no_errors	ENST00000396946	ensembl	human	known	70_37	silent	SNP	1.000	T
CATSPER2	117155	genome.wustl.edu	37	15	43928408	43928408	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr15:43928408C>T	ENST00000321596.5	-	8	1051	c.852G>A	c.(850-852)ccG>ccA	p.P284P	CATSPER2_ENST00000396879.1_Silent_p.P284P|CATSPER2_ENST00000354127.4_Silent_p.P284P|CATSPER2_ENST00000355438.2_Silent_p.P284P|CATSPER2_ENST00000381761.1_Silent_p.P290P|STRC_ENST00000541030.1_Intron|RNU6-610P_ENST00000384264.1_RNA			Q96P56	CTSR2_HUMAN	cation channel, sperm associated 2	284					calcium ion import (GO:0070509)|cell differentiation (GO:0030154)|membrane depolarization during action potential (GO:0086010)|multicellular organism reproduction (GO:0032504)|multicellular organismal development (GO:0007275)|single fertilization (GO:0007338)|sperm motility (GO:0030317)|sperm-egg recognition (GO:0035036)|spermatogenesis (GO:0007283)	CatSper complex (GO:0036128)|motile cilium (GO:0031514)|plasma membrane (GO:0005886)	calcium activated cation channel activity (GO:0005227)|voltage-gated calcium channel activity (GO:0005245)	p.P284P(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(8)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22		all_cancers(109;3.26e-15)|all_epithelial(112;1.48e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.027)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.56e-07)		CCAGGGAATTCGGGAGGTCCC	0.418																																																	1	Substitution - coding silent(1)	cervix(1)											51.0	52.0	52.0					15																	43928408		2199	4296	6495	SO:0001819	synonymous_variant	117155			AF411817	CCDS10099.1, CCDS32216.1, CCDS73714.1	15q15.3	2011-07-05			ENSG00000166762	ENSG00000166762		"""Voltage-gated ion channels / Cation channels, sperm associated"""	18810	protein-coding gene	gene with protein product		607249				11675491, 16382101	Standard	NM_172095		Approved		uc001zsh.3	Q96P56	OTTHUMG00000059902	ENST00000321596.5:c.852G>A	15.37:g.43928408C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NHT9|Q96P54|Q96P55	Silent	SNP	pfam_Ion_trans_dom	p.P284	ENST00000321596.5	37	c.852	CCDS10099.1	15																																																																																			CATSPER2	-	pfam_Ion_trans_dom		0.418	CATSPER2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CATSPER2	HGNC	protein_coding	OTTHUMT00000133151.2	C	NM_054020		43928408	-1	no_errors	ENST00000299989	ensembl	human	known	70_37	silent	SNP	0.001	T
CBX4	8535	genome.wustl.edu	37	17	77807985	77807985	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:77807985C>T	ENST00000269397.4	-	5	1633	c.1456G>A	c.(1456-1458)Gag>Aag	p.E486K		NM_003655.2	NP_003646.2	O00257	CBX4_HUMAN	chromobox homolog 4	486	Interaction with BMI1.				chromatin modification (GO:0016568)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein sumoylation (GO:0016925)|transcription, DNA-templated (GO:0006351)	nuclear body (GO:0016604)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|PRC1 complex (GO:0035102)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|ligase activity (GO:0016874)|single-stranded RNA binding (GO:0003727)|SUMO binding (GO:0032183)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)	p.E486K(1)		breast(1)|cervix(1)|endometrium(1)|large_intestine(1)|lung(7)|ovary(1)|prostate(3)|skin(2)|urinary_tract(1)	18			OV - Ovarian serous cystadenocarcinoma(97;0.0102)|BRCA - Breast invasive adenocarcinoma(99;0.0224)			CTGGGCGGCTCCCCGGCCTCG	0.721																																																	1	Substitution - Missense(1)	cervix(1)											11.0	15.0	13.0					17																	77807985		2063	4084	6147	SO:0001583	missense	8535			AF013956	CCDS32758.1	17q25.3	2010-07-06	2010-06-24		ENSG00000141582	ENSG00000141582			1554	protein-coding gene	gene with protein product	"""NS5ATP1-binding protein 16"", ""Pc class 2 homolog (Drosophila)"""	603079	"""chromobox homolog 4 (Drosophila Pc class)"""			9315667	Standard	NM_003655		Approved	hPC2, PC2, NBP16	uc002jxe.3	O00257	OTTHUMG00000150415	ENST00000269397.4:c.1456G>A	17.37:g.77807985C>T	ENSP00000269397:p.Glu486Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1PJR7|Q6TPI8|Q96C04	Missense_Mutation	SNP	pfam_Chromo_domain,superfamily_Chromodomain-like,smart_Chromo_domain/shadow,prints_Chromo_dom_subgr,pfscan_Chromo_domain/shadow	p.E486K	ENST00000269397.4	37	c.1456	CCDS32758.1	17	.	.	.	.	.	.	.	.	.	.	c	13.95	2.390297	0.42410	.	.	ENSG00000141582	ENST00000269397;ENST00000343048	.	.	.	3.3	3.3	0.37823	.	1.686940	0.04796	U	0.432531	T	0.49609	0.1567	L	0.36672	1.1	0.80722	D	1	B	0.31318	0.319	B	0.26310	0.068	T	0.44329	-0.9335	9	0.62326	D	0.03	0.4137	9.9504	0.41636	0.0:1.0:0.0:0.0	.	486	O00257	CBX4_HUMAN	K	486;216	.	ENSP00000269397:E486K	E	-	1	0	CBX4	75422580	0.006000	0.16342	0.602000	0.28890	0.507000	0.33981	1.581000	0.36558	1.686000	0.51046	0.306000	0.20318	GAG	CBX4	-	NULL		0.721	CBX4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CBX4	HGNC	protein_coding	OTTHUMT00000318007.1	C	NM_003655		77807985	-1	no_errors	ENST00000269397	ensembl	human	known	70_37	missense	SNP	0.257	T
CC2D1B	200014	genome.wustl.edu	37	1	52822821	52822821	+	Intron	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:52822821C>T	ENST00000371586.2	-	16	1909				CC2D1B_ENST00000438831.1_Intron|CC2D1B_ENST00000460261.1_5'UTR|CC2D1B_ENST00000284376.3_Intron	NM_032449.2	NP_115825.1	Q5T0F9	C2D1B_HUMAN	coiled-coil and C2 domain containing 1B							nucleus (GO:0005634)	RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)			breast(1)|large_intestine(6)|lung(13)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	27						CAAGGCCCCTCGGGCCCCAAG	0.537																																																	0													30.0	31.0	31.0					1																	52822821		2203	4300	6503	SO:0001627	intron_variant	200014			AB058739	CCDS30714.1	1p32.3	2008-02-05			ENSG00000154222	ENSG00000154222			29386	protein-coding gene	gene with protein product						11347906	Standard	NM_032449		Approved	KIAA1836	uc001ctq.2	Q5T0F9	OTTHUMG00000008102	ENST00000371586.2:c.1771-23G>A	1.37:g.52822821C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q49AE8|Q5T0F8|Q5T0G0|Q6ZNQ1|Q96AP3|Q96I04|Q96JJ1	RNA	SNP	-	NULL	ENST00000371586.2	37	NULL	CCDS30714.1	1																																																																																			CC2D1B	-	-		0.537	CC2D1B-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CC2D1B	HGNC	protein_coding	OTTHUMT00000022189.1	C	NM_032449		52822821	-1	no_errors	ENST00000460261	ensembl	human	known	70_37	rna	SNP	1.000	T
CCDC78	124093	genome.wustl.edu	37	16	773855	773855	+	Splice_Site	SNP	A	A	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr16:773855A>G	ENST00000293889.6	-	11	1239		c.e11+1			NM_001031737.2	NP_001026907.2	A2IDD5	CCD78_HUMAN	coiled-coil domain containing 78						cell projection organization (GO:0030030)|de novo centriole assembly (GO:0098535)|skeletal muscle contraction (GO:0003009)	centriole (GO:0005814)|deuterosome (GO:0098536)|perinuclear region of cytoplasm (GO:0048471)|sarcolemma (GO:0042383)|sarcoplasmic reticulum (GO:0016529)		p.?(1)		central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(1)|lung(2)|skin(3)	9		Hepatocellular(780;0.0218)				GAGGGCACTCACTGTGGCTCT	0.657																																																	1	Unknown(1)	cervix(1)											31.0	31.0	31.0					16																	773855		2174	4286	6460	SO:0001630	splice_region_variant	124093			BC042110	CCDS32353.1	16p13.3	2014-07-15		2006-02-20	ENSG00000162004	ENSG00000162004			14153	protein-coding gene	gene with protein product		614666		C16orf25		24075808	Standard	NM_001031737		Approved	FLJ34512	uc002cjg.3	A2IDD5	OTTHUMG00000121176	ENST00000293889.6:c.1133+1T>C	16.37:g.773855A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DNY4|B4E1U6|Q05BY7|Q05CA0|Q6T2V5|Q6ZR33|Q8IUR3|Q8NAY7|Q96S12	Splice_Site	SNP	-	e11+2	ENST00000293889.6	37	c.1133+2	CCDS32353.1	16	.	.	.	.	.	.	.	.	.	.	A	11.95	1.793110	0.31685	.	.	ENSG00000162004	ENST00000345165;ENST00000293889	.	.	.	3.65	3.65	0.41850	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	6.0791	0.19931	0.877:0.0:0.123:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	CCDC78	713856	0.001000	0.12720	0.980000	0.43619	0.044000	0.14063	0.900000	0.28431	1.610000	0.50200	0.379000	0.24179	.	CCDC78	-	-		0.657	CCDC78-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC78	HGNC	protein_coding	OTTHUMT00000241665.3	A	NM_173476	Intron	773855	-1	no_errors	ENST00000293889	ensembl	human	known	70_37	splice_site	SNP	0.989	G
CCM2L	140706	genome.wustl.edu	37	20	30610588	30610588	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr20:30610588C>T	ENST00000300415.8	+	6	1072	c.1059C>T	c.(1057-1059)ctC>ctT	p.L353L	CCM2L_ENST00000262659.8_Silent_p.L353L			Q9NUG4	CCM2L_HUMAN	cerebral cavernous malformation 2-like	353																	GGCCATGGCTCTGCAGCCGCA	0.567																																																	0													71.0	54.0	60.0					20																	30610588		2203	4300	6503	SO:0001819	synonymous_variant	140706			AL031658	CCDS13195.1	20q11.21	2012-10-30	2012-10-30	2012-10-30	ENSG00000101331	ENSG00000101331			16153	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 160"""	C20orf160			Standard	NM_080625		Approved	dJ310O13.5	uc002wxf.2	Q9NUG4	OTTHUMG00000032197	ENST00000300415.8:c.1059C>T	20.37:g.30610588C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JYR9|Q8N5F1|Q8N6G8|Q96MD5	Silent	SNP	NULL	p.L353	ENST00000300415.8	37	c.1059		20																																																																																			CCM2L	-	NULL		0.567	CCM2L-201	KNOWN	basic|appris_candidate_longest	protein_coding	CCM2L	HGNC	protein_coding		C	NM_080625		30610588	+1	no_errors	ENST00000300415	ensembl	human	known	70_37	silent	SNP	0.985	T
CCS	9973	genome.wustl.edu	37	11	66366699	66366699	+	Silent	SNP	C	C	G	rs377031880		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr11:66366699C>G	ENST00000533244.1	+	3	666	c.225C>G	c.(223-225)ctC>ctG	p.L75L	CCS_ENST00000310190.4_Silent_p.L56L	NM_005125.1	NP_005116.1	O14618	CCS_HUMAN	copper chaperone for superoxide dismutase	75	HMA. {ECO:0000255|PROSITE- ProRule:PRU00280}.				copper ion transmembrane transport (GO:0035434)|intracellular copper ion transport (GO:0015680)|positive regulation of oxidoreductase activity (GO:0051353)|removal of superoxide radicals (GO:0019430)|superoxide metabolic process (GO:0006801)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	copper ion binding (GO:0005507)|copper ion transmembrane transporter activity (GO:0005375)|protein disulfide oxidoreductase activity (GO:0015035)|superoxide dismutase activity (GO:0004784)|zinc ion binding (GO:0008270)	p.L75L(1)		breast(2)|cervix(1)|large_intestine(2)|lung(3)|stomach(1)	9						AGGCGGTACTCAAGGGCATGG	0.607																																																	1	Substitution - coding silent(1)	cervix(1)											62.0	53.0	56.0					11																	66366699		2200	4295	6495	SO:0001819	synonymous_variant	9973			AF002210	CCDS8146.1	11q13.2	2012-09-20			ENSG00000173992	ENSG00000173992			1613	protein-coding gene	gene with protein product		603864				9295278	Standard	NM_005125		Approved		uc001oir.3	O14618	OTTHUMG00000167238	ENST00000533244.1:c.225C>G	11.37:g.66366699C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M366|Q8NEV0	Silent	SNP	pfam_SOD_Cu_Zn_dom,pfam_HeavyMe-assoc_HMA,superfamily_SOD_Cu_Zn_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA,prints_SOD_Cu_Zn_dom	p.L75	ENST00000533244.1	37	c.225	CCDS8146.1	11																																																																																			CCS	-	superfamily_SOD_Cu_Zn_dom,superfamily_HeavyMe-assoc_HMA,pfscan_HeavyMe-assoc_HMA		0.607	CCS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCS	HGNC	protein_coding	OTTHUMT00000393826.1	C	NM_005125		66366699	+1	no_errors	ENST00000533244	ensembl	human	known	70_37	silent	SNP	1.000	G
CDC42BPA	8476	genome.wustl.edu	37	1	227299834	227299834	+	Intron	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:227299834C>T	ENST00000366769.3	-	14	3293				CDC42BPA_ENST00000366766.2_Intron|CDC42BPA_ENST00000334218.5_Intron|CDC42BPA_ENST00000535525.1_Intron|CDC42BPA_ENST00000366765.3_Intron|CDC42BPA_ENST00000366764.2_Intron|CDC42BPA_ENST00000366767.3_Intron	NM_003607.3	NP_003598.2			CDC42 binding protein kinase alpha (DMPK-like)											NS(1)|breast(4)|cervix(1)|endometrium(8)|kidney(8)|large_intestine(12)|lung(32)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(3)|urinary_tract(2)	77		all_cancers(173;0.156)|Prostate(94;0.0792)				CCATTTTCTTCAGCATAATTA	0.368																																																	0																																										SO:0001627	intron_variant	8476			U59305	CCDS1558.1, CCDS1559.1	1q42.11	2011-11-23	2001-11-28		ENSG00000143776	ENSG00000143776			1737	protein-coding gene	gene with protein product	"""myotonic dystrophy kinase-related Cdc42-binding kinase"""	603412	"""CDC42-binding protein kinase alpha (DMPK-like)"""				Standard	NM_003607		Approved	MRCKA, PK428, FLJ23347, KIAA0451, MRCK	uc001hqr.3	Q5VT25	OTTHUMG00000037618	ENST00000366769.3:c.2001+178G>A	1.37:g.227299834C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000366769.3	37	NULL	CCDS1558.1	1																																																																																			CDC42BPA	-	-		0.368	CDC42BPA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDC42BPA	HGNC	protein_coding	OTTHUMT00000091696.1	C	NM_014826		227299834	-1	no_errors	ENST00000466538	ensembl	human	known	70_37	rna	SNP	0.002	T
CDCA2	157313	genome.wustl.edu	37	8	25319603	25319603	+	Missense_Mutation	SNP	G	G	A	rs149260399		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:25319603G>A	ENST00000330560.3	+	4	743	c.266G>A	c.(265-267)cGa>cAa	p.R89Q	CDCA2_ENST00000380665.3_Missense_Mutation_p.R74Q	NM_152562.2	NP_689775.2	Q69YH5	CDCA2_HUMAN	cell division cycle associated 2	89					mitotic nuclear division (GO:0007067)|positive regulation of protein dephosphorylation (GO:0035307)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.R89Q(1)		breast(3)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(7)|lung(10)|ovary(1)|prostate(3)	35		all_cancers(63;0.0378)|Ovarian(32;0.000878)|all_epithelial(46;0.0162)|Breast(100;0.0164)|Prostate(55;0.191)		UCEC - Uterine corpus endometrioid carcinoma (27;0.022)|Epithelial(17;1.37e-11)|Colorectal(74;0.0129)|COAD - Colon adenocarcinoma(73;0.0443)		AAATGTAGACGACGTTCTGCA	0.403																																																	1	Substitution - Missense(1)	cervix(1)						G	GLN/ARG	0,4406		0,0,2203	103.0	102.0	102.0		266	5.4	0.6	8	dbSNP_134	102	2,8598	2.2+/-6.3	0,2,4298	no	missense	CDCA2	NM_152562.2	43	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	probably-damaging	89/1024	25319603	2,13004	2203	4300	6503	SO:0001583	missense	157313			BG354575	CCDS6049.1	8p21.2	2014-06-12			ENSG00000184661	ENSG00000184661			14623	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 81"""					12188893, 16492807	Standard	NM_152562		Approved	Repo-Man, PPP1R81	uc003xep.1	Q69YH5	OTTHUMG00000099429	ENST00000330560.3:c.266G>A	8.37:g.25319603G>A	ENSP00000328228:p.Arg89Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SX74|Q4G0W0|Q5RKN0|Q69YI4|Q6P464|Q8N7C1	Missense_Mutation	SNP	NULL	p.R89Q	ENST00000330560.3	37	c.266	CCDS6049.1	8	.	.	.	.	.	.	.	.	.	.	G	14.52	2.559604	0.45590	0.0	2.33E-4	ENSG00000184661	ENST00000330560;ENST00000380665	T;T	0.66638	-0.22;-0.22	5.45	5.45	0.79879	.	0.000000	0.47455	D	0.000229	T	0.81206	0.4774	M	0.76002	2.32	0.37956	D	0.93281	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.84970	0.0882	10	0.87932	D	0	-11.0538	14.7814	0.69769	0.0:0.0:1.0:0.0	.	89;74;89	B7Z5Q5;E9PEI0;Q69YH5	.;.;CDCA2_HUMAN	Q	89;74	ENSP00000328228:R89Q;ENSP00000370040:R74Q	ENSP00000328228:R89Q	R	+	2	0	CDCA2	25375520	0.908000	0.30866	0.564000	0.28396	0.054000	0.15201	4.883000	0.63128	2.546000	0.85860	0.491000	0.48974	CGA	CDCA2	-	NULL		0.403	CDCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDCA2	HGNC	protein_coding	OTTHUMT00000216891.3	G	NM_152562		25319603	+1	no_errors	ENST00000330560	ensembl	human	known	70_37	missense	SNP	0.844	A
CENPE	1062	genome.wustl.edu	37	4	104035655	104035655	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:104035655C>G	ENST00000265148.3	-	46	7586	c.7497G>C	c.(7495-7497)ttG>ttC	p.L2499F	CENPE_ENST00000380026.3_Missense_Mutation_p.L2378F	NM_001813.2	NP_001804.2	Q02224	CENPE_HUMAN	centromere protein E, 312kDa	2499					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|kinetochore assembly (GO:0051382)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic chromosome movement towards spindle pole (GO:0007079)|mitotic metaphase plate congression (GO:0007080)|multicellular organismal development (GO:0007275)|positive regulation of protein kinase activity (GO:0045860)|regulation of mitotic metaphase/anaphase transition (GO:0030071)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|condensed chromosome outer kinetochore (GO:0000940)|condensed chromosome, centromeric region (GO:0000779)|condensed nuclear chromosome kinetochore (GO:0000778)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinesin complex (GO:0005871)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|midbody (GO:0030496)|mitotic spindle midzone (GO:1990023)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|kinetochore binding (GO:0043515)|microtubule motor activity (GO:0003777)	p.L2462F(1)		NS(3)|breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(20)|lung(34)|ovary(5)|pancreas(1)|prostate(2)|skin(3)|stomach(5)|urinary_tract(3)	101				OV - Ovarian serous cystadenocarcinoma(123;2.95e-08)		GATTTTCTCTCAATAGCCTTA	0.328																																																	1	Substitution - Missense(1)	cervix(1)											179.0	166.0	171.0					4																	104035655		2202	4300	6502	SO:0001583	missense	1062			Z15005	CCDS34042.1, CCDS68768.1	4q24-q25	2013-11-05	2002-08-29			ENSG00000138778		"""Kinesins"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	1856	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 61"""	117143	"""centromere protein E (312kD)"""			7851898	Standard	NM_001286734		Approved	KIF10, PPP1R61	uc003hxb.1	Q02224		ENST00000265148.3:c.7497G>C	4.37:g.104035655C>G	ENSP00000265148:p.Leu2499Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKY9|A8K2U7|Q4LE75	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,superfamily_STAT_TF_coiled-coil,superfamily_Signal_recog_particl_SRP54_hlx,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.L2499F	ENST00000265148.3	37	c.7497	CCDS34042.1	4	.	.	.	.	.	.	.	.	.	.	C	13.60	2.287052	0.40494	.	.	ENSG00000138778	ENST00000265148;ENST00000380026	T;T	0.79554	-1.28;-1.23	4.77	1.59	0.23543	.	.	.	.	.	D	0.85813	0.5784	M	0.65498	2.005	0.30610	N	0.759593	D;D	0.89917	1.0;0.998	D;D	0.87578	0.998;0.996	T	0.79711	-0.1689	9	0.87932	D	0	.	6.2312	0.20736	0.0:0.6008:0.0:0.3992	.	2378;2499	Q02224-3;Q02224	.;CENPE_HUMAN	F	2499;2378	ENSP00000265148:L2499F;ENSP00000369365:L2378F	ENSP00000265148:L2499F	L	-	3	2	CENPE	104255104	0.989000	0.36119	0.941000	0.38009	0.465000	0.32709	0.464000	0.21988	0.372000	0.24591	0.591000	0.81541	TTG	CENPE	-	NULL		0.328	CENPE-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CENPE	HGNC	protein_coding		C			104035655	-1	no_errors	ENST00000265148	ensembl	human	known	70_37	missense	SNP	0.857	G
CEP78	84131	genome.wustl.edu	37	9	80855103	80855103	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr9:80855103C>T	ENST00000424347.2	+	2	707	c.418C>T	c.(418-420)Cta>Tta	p.L140L	CEP78_ENST00000277082.5_Silent_p.L140L|CEP78_ENST00000376597.4_Silent_p.L140L|CEP78_ENST00000376598.2_Silent_p.L140L|CEP78_ENST00000415759.2_Silent_p.L140L			Q5JTW2	CEP78_HUMAN	centrosomal protein 78kDa	140					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	centrosome (GO:0005813)|cytosol (GO:0005829)		p.L140L(2)		breast(1)|cervix(1)|endometrium(5)|large_intestine(7)|lung(4)|ovary(1)|stomach(1)|urinary_tract(1)	21						TTTAACTATTCTAGCAAAGGT	0.353																																																	2	Substitution - coding silent(2)	cervix(2)											85.0	81.0	82.0					9																	80855103		1827	4088	5915	SO:0001819	synonymous_variant	84131			BC058931	CCDS47984.1, CCDS47985.1	9q21.2	2014-02-20	2005-12-01	2005-12-01	ENSG00000148019	ENSG00000148019			25740	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 81"""	C9orf81		14654843	Standard	NM_001098802		Approved	FLJ12643	uc004aky.4	Q5JTW2	OTTHUMG00000020062	ENST00000424347.2:c.418C>T	9.37:g.80855103C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4S8|E9PHX5|Q5BJE3|Q5JTW0|Q5JTW1|Q9H9N3	Silent	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.L140	ENST00000424347.2	37	c.418		9																																																																																			CEP78	-	NULL		0.353	CEP78-001	KNOWN	basic|appris_candidate	protein_coding	CEP78	HGNC	protein_coding	OTTHUMT00000052766.2	C	XM_095991		80855103	+1	no_errors	ENST00000376597	ensembl	human	known	70_37	silent	SNP	0.136	T
CIRBP	1153	genome.wustl.edu	37	19	1270131	1270131	+	Intron	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:1270131C>T	ENST00000588030.1	+	2	254				CIRBP_ENST00000589686.1_Intron|CIRBP_ENST00000444172.2_Intron|CIRBP_ENST00000320936.5_Intron|CIRBP_ENST00000589660.1_Intron|CIRBP_ENST00000587323.1_Intron|CIRBP_ENST00000591935.1_Intron|CIRBP_ENST00000586773.1_5'Flank|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000413636.2_Intron|CIRBP_ENST00000589710.1_Intron|CIRBP_ENST00000585630.1_5'Flank|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000588230.1_Intron|CIRBP_ENST00000586472.1_Intron|CIRBP_ENST00000589235.1_Intron|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000587896.1_Intron			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TTATCACTTCCGGGGCCATCC	0.602																																																	0													43.0	43.0	43.0					19																	1270131		1935	4130	6065	SO:0001627	intron_variant	148046			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.-6-796C>T	19.37:g.1270131C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KT17|B4E2X2	RNA	SNP	-	NULL	ENST00000588030.1	37	NULL	CCDS12059.1	19																																																																																			CIRBP-AS1	-	-		0.602	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP-AS1	HGNC	protein_coding	OTTHUMT00000449969.1	C	NM_001280		1270131	-1	no_errors	ENST00000585832	ensembl	human	known	70_37	rna	SNP	0.000	T
CIRBP	1153	genome.wustl.edu	37	19	1272191	1272191	+	Intron	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:1272191C>G	ENST00000588030.1	+	6	762				CIRBP_ENST00000589686.1_Intron|CIRBP_ENST00000444172.2_Missense_Mutation_p.Q162E|CIRBP_ENST00000320936.5_Intron|CIRBP_ENST00000589660.1_Intron|CIRBP_ENST00000587323.1_Missense_Mutation_p.Q215E|CIRBP_ENST00000591935.1_Intron|C19orf24_ENST00000409293.4_5'Flank|CIRBP_ENST00000586773.1_Intron|CIRBP-AS1_ENST00000585832.1_RNA|CIRBP_ENST00000413636.2_Missense_Mutation_p.Q181E|CIRBP_ENST00000589710.1_Missense_Mutation_p.Q215E|CIRBP_ENST00000585630.1_Intron|CIRBP_ENST00000588090.1_Intron|CIRBP_ENST00000588230.1_Missense_Mutation_p.Q215E|CIRBP_ENST00000586472.1_Intron|CIRBP_ENST00000589235.1_Intron|CIRBP-AS1_ENST00000600215.1_RNA|CIRBP_ENST00000587896.1_Missense_Mutation_p.Q215E			Q14011	CIRBP_HUMAN	cold inducible RNA binding protein						mRNA stabilization (GO:0048255)|positive regulation of translation (GO:0045727)|response to cold (GO:0009409)|response to UV (GO:0009411)|stress granule assembly (GO:0034063)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|nucleus (GO:0005634)	mRNA 3'-UTR binding (GO:0003730)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|small ribosomal subunit rRNA binding (GO:0070181)|translation repressor activity (GO:0030371)			endometrium(1)|large_intestine(1)|lung(3)	5		Acute lymphoblastic leukemia(61;4.36e-14)|all_hematologic(61;4.84e-09)|Lung NSC(49;0.000332)|all_lung(49;0.000498)|Breast(49;0.0014)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TCTGTCCTCTCAGAGCCATTT	0.572																																																	0																																										SO:0001627	intron_variant	1153			D78134	CCDS12059.1, CCDS74244.1, CCDS74245.1	19p13.3	2013-02-12	2001-11-28		ENSG00000099622	ENSG00000099622		"""RNA binding motif (RRM) containing"""	1982	protein-coding gene	gene with protein product	"""Cold-inducible RNA-binding protein"", ""glycine-rich RNA binding protein"""	602649	"""cold inducible RNA-binding protein"""			9434172, 9151692	Standard	NM_001280		Approved	CIRP	uc002lrr.4	Q14011		ENST00000588030.1:c.502+141C>G	19.37:g.1272191C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KT17|B4E2X2	Missense_Mutation	SNP	NULL	p.Q162E	ENST00000588030.1	37	c.484	CCDS12059.1	19	.	.	.	.	.	.	.	.	.	.	C	8.828	0.939302	0.18281	.	.	ENSG00000099622	ENST00000413636;ENST00000444172	T	0.69175	-0.38	2.27	-0.398	0.12418	.	.	.	.	.	T	0.45637	0.1352	.	.	.	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.21348	-1.0248	7	.	.	.	.	5.9683	0.19338	0.0:0.5173:0.3598:0.1229	.	181;215	B4E2X2;D6W5Y5	.;.	E	181;162	ENSP00000412831:Q181E	.	Q	+	1	0	CIRBP	1223191	0.040000	0.19996	0.159000	0.22649	0.199000	0.23934	0.289000	0.18957	-0.352000	0.08237	0.306000	0.20318	CAG	CIRBP	-	NULL		0.572	CIRBP-011	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIRBP	HGNC	protein_coding	OTTHUMT00000449969.1	C	NM_001280		1272191	+1	no_errors	ENST00000444172	ensembl	human	known	70_37	missense	SNP	0.007	G
CKAP2L	150468	genome.wustl.edu	37	2	113496492	113496492	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:113496492C>T	ENST00000302450.6	-	9	2224	c.2146G>A	c.(2146-2148)Gaa>Aaa	p.E716K	NT5DC4_ENST00000327581.4_Intron|CKAP2L_ENST00000541405.1_Missense_Mutation_p.E551K	NM_152515.3	NP_689728.3	Q8IYA6	CKP2L_HUMAN	cytoskeleton associated protein 2-like	716						centrosome (GO:0005813)|cytoplasm (GO:0005737)		p.E716K(1)		breast(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(4)|lung(15)|skin(1)|upper_aerodigestive_tract(1)	28						TCTAACAGTTCATCAAGAGAA	0.438																																																	1	Substitution - Missense(1)	cervix(1)											133.0	138.0	136.0					2																	113496492		2203	4300	6503	SO:0001583	missense	150468			AL832036	CCDS2100.1	2q13	2008-02-05			ENSG00000169607	ENSG00000169607			26877	protein-coding gene	gene with protein product						12477932	Standard	NM_152515		Approved	FLJ40629	uc002tie.2	Q8IYA6	OTTHUMG00000131313	ENST00000302450.6:c.2146G>A	2.37:g.113496492C>T	ENSP00000305204:p.Glu716Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K915|B4DZE3|B7ZAC6|F5H0M5|Q53QF8|Q53RS8|Q8N1J8	Missense_Mutation	SNP	NULL	p.E716K	ENST00000302450.6	37	c.2146	CCDS2100.1	2	.	.	.	.	.	.	.	.	.	.	C	32	5.150752	0.94645	.	.	ENSG00000169607	ENST00000541405;ENST00000302450	T;T	0.23348	1.91;1.91	5.45	5.45	0.79879	.	0.269079	0.40640	N	0.001055	T	0.49915	0.1585	M	0.68317	2.08	0.38219	D	0.940694	D;D	0.76494	0.971;0.999	P;D	0.68943	0.783;0.961	T	0.51356	-0.8716	10	0.66056	D	0.02	-18.6918	17.5912	0.87997	0.0:1.0:0.0:0.0	.	305;716	Q8IYA6-2;Q8IYA6	.;CKP2L_HUMAN	K	551;716	ENSP00000438763:E551K;ENSP00000305204:E716K	ENSP00000305204:E716K	E	-	1	0	CKAP2L	113212963	0.983000	0.35010	0.160000	0.22671	0.951000	0.60555	3.073000	0.50057	2.941000	0.99782	0.655000	0.94253	GAA	CKAP2L	-	NULL		0.438	CKAP2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CKAP2L	HGNC	protein_coding	OTTHUMT00000254082.2	C	NM_152515		113496492	-1	no_errors	ENST00000302450	ensembl	human	known	70_37	missense	SNP	0.741	T
CLASRP	11129	genome.wustl.edu	37	19	45571722	45571722	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:45571722G>C	ENST00000221455.3	+	16	1850	c.1752G>C	c.(1750-1752)aaG>aaC	p.K584N	CLASRP_ENST00000544944.2_Intron|CLASRP_ENST00000391953.4_Missense_Mutation_p.K522N	NM_007056.2	NP_008987	Q8N2M8	CLASR_HUMAN	CLK4-associating serine/arginine rich protein	584	Arg-rich.				mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)		p.K584N(1)		breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(2)|lung(6)|pancreas(2)|prostate(1)	16						GGATGCAGAAGGCGCTGAACA	0.602																																																	1	Substitution - Missense(1)	cervix(1)											111.0	94.0	100.0					19																	45571722		2203	4300	6503	SO:0001583	missense	11129			AF042800	CCDS12652.2, CCDS62710.1	19q13.3	2010-09-21	2010-09-21	2010-09-21	ENSG00000104859	ENSG00000104859			17731	protein-coding gene	gene with protein product	"""Clk4 associating SR-related protein"""		"""splicing factor, arginine/serine-rich 16"""	SFRS16		12169693	Standard	NM_007056		Approved	SWAP2, CLASP	uc002pak.3	Q8N2M8	OTTHUMG00000150189	ENST00000221455.3:c.1752G>C	19.37:g.45571722G>C	ENSP00000221455:p.Lys584Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DDT8|F8WAG9|O96026|Q6UW71|Q96DX2	Missense_Mutation	SNP	pfam_SWAP_N_domain	p.K584N	ENST00000221455.3	37	c.1752	CCDS12652.2	19	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	18.05|18.05	3.536499|3.536499	0.65085|0.65085	.|.	.|.	ENSG00000104859|ENSG00000104859	ENST00000391952|ENST00000221455;ENST00000391953	T|T;T	0.33654|0.21932	1.4|1.98;1.98	5.44|5.44	3.27|3.27	0.37495|0.37495	.|.	.|0.000000	.|0.37857	.|U	.|0.001915	T|T	0.33000|0.33000	0.0848|0.0848	L|L	0.51422|0.51422	1.61|1.61	0.80722|0.80722	D|D	1|1	.|D;D	.|0.76494	.|0.999;0.981	.|D;D	.|0.78314	.|0.991;0.95	T|T	0.05451|0.05451	-1.0884|-1.0884	7|10	0.87932|0.22109	D|T	0|0.4	-30.7299|-30.7299	7.6123|7.6123	0.28137|0.28137	0.2036:0.0:0.7964:0.0|0.2036:0.0:0.7964:0.0	.|.	.|522;584	.|F8WAG9;Q8N2M8	.|.;CLASR_HUMAN	R|N	586|584;522	ENSP00000375814:G586R|ENSP00000221455:K584N;ENSP00000375815:K522N	ENSP00000375814:G586R|ENSP00000221455:K584N	G|K	+|+	1|3	0|2	CLASRP|CLASRP	50263562|50263562	1.000000|1.000000	0.71417|0.71417	0.999000|0.999000	0.59377|0.59377	0.996000|0.996000	0.88848|0.88848	1.436000|1.436000	0.34980|0.34980	0.630000|0.630000	0.30394|0.30394	0.561000|0.561000	0.74099|0.74099	GGC|AAG	CLASRP	-	NULL		0.602	CLASRP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLASRP	HGNC	protein_coding	OTTHUMT00000316749.1	G	NM_007056		45571722	+1	no_errors	ENST00000221455	ensembl	human	known	70_37	missense	SNP	1.000	C
CLCN6	1185	genome.wustl.edu	37	1	11900256	11900256	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:11900256G>A	ENST00000346436.6	+	23	2638	c.2586G>A	c.(2584-2586)ctG>ctA	p.L862L	CLCN6_ENST00000376487.3_Silent_p.L840L|NPPA-AS1_ENST00000446542.1_RNA|CLCN6_ENST00000312413.6_3'UTR	NM_001286.3	NP_001277	P51797	CLCN6_HUMAN	chloride channel, voltage-sensitive 6	862	CBS 2. {ECO:0000255|PROSITE- ProRule:PRU00703}.				cell volume homeostasis (GO:0006884)|chloride transport (GO:0006821)|ion transmembrane transport (GO:0034220)|regulation of anion transport (GO:0044070)|response to mechanical stimulus (GO:0009612)|signal transduction (GO:0007165)|transmembrane transport (GO:0055085)	endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	antiporter activity (GO:0015297)|ATP binding (GO:0005524)|voltage-gated chloride channel activity (GO:0005247)	p.L862L(1)		cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(7)|lung(12)|prostate(2)|skin(4)	36	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;6.13e-06)|COAD - Colon adenocarcinoma(227;0.000274)|BRCA - Breast invasive adenocarcinoma(304;0.000311)|Kidney(185;0.000816)|KIRC - Kidney renal clear cell carcinoma(229;0.00268)|STAD - Stomach adenocarcinoma(313;0.00743)|READ - Rectum adenocarcinoma(331;0.0649)		AGGCCCGGCTGAGGCAGCACT	0.607																																																	1	Substitution - coding silent(1)	cervix(1)											104.0	98.0	100.0					1																	11900256		2203	4300	6503	SO:0001819	synonymous_variant	1185			X83378	CCDS138.1, CCDS57972.1	1p36	2012-09-26	2012-02-23		ENSG00000011021	ENSG00000011021		"""Ion channels / Chloride channels : Voltage-sensitive"""	2024	protein-coding gene	gene with protein product		602726	"""chloride channel 6"""			8543009	Standard	NM_001286		Approved	CLC-6, KIAA0046, ClC-6	uc001ate.5	P51797	OTTHUMG00000002299	ENST00000346436.6:c.2586G>A	1.37:g.11900256G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1T4|B4DGT7|F8W9R3|O60818|O60819|O60820|O60821|P78520|P78521|Q17R81|Q5SNW2|Q5SNW3|Q5SNX1|Q5SNX2|Q5SNX3|Q99427|Q99428|Q99429	Silent	SNP	pfam_Cl-channel_volt-gated,pfam_Cysta_beta_synth_core,superfamily_Cl-channel_core,smart_Cysta_beta_synth_core,prints_Cl-channel_volt-gated,prints_Cl_channel-6	p.L862	ENST00000346436.6	37	c.2586	CCDS138.1	1																																																																																			CLCN6	-	NULL		0.607	CLCN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCN6	HGNC	protein_coding	OTTHUMT00000006639.2	G	NM_001286		11900256	+1	no_errors	ENST00000346436	ensembl	human	known	70_37	silent	SNP	0.999	A
CNTN3	5067	genome.wustl.edu	37	3	74535723	74535723	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:74535723C>G	ENST00000263665.6	-	3	269	c.242G>C	c.(241-243)gGa>gCa	p.G81A		NM_020872.1	NP_065923.1	Q9P232	CNTN3_HUMAN	contactin 3 (plasmacytoma associated)	81	Ig-like C2-type 1.				cell adhesion (GO:0007155)|nervous system development (GO:0007399)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)		p.G81A(1)		NS(2)|breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(14)|lung(39)|ovary(1)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	83		Lung NSC(201;0.138)|Lung SC(41;0.21)		Epithelial(33;0.00212)|BRCA - Breast invasive adenocarcinoma(55;0.00258)|LUSC - Lung squamous cell carcinoma(21;0.00461)|Lung(16;0.01)		AAGATTTCCTCCATTCAACTT	0.373																																																	1	Substitution - Missense(1)	cervix(1)											128.0	125.0	126.0					3																	74535723		2203	4300	6503	SO:0001583	missense	5067			AB040929	CCDS33790.1	3p12.3	2013-02-11			ENSG00000113805	ENSG00000113805		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	2173	protein-coding gene	gene with protein product		601325		PANG		8661054, 8586965	Standard	XM_005264757		Approved	BIG-1	uc003dpm.1	Q9P232	OTTHUMG00000158813	ENST00000263665.6:c.242G>C	3.37:g.74535723C>G	ENSP00000263665:p.Gly81Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EK50|Q9H039	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G81A	ENST00000263665.6	37	c.242	CCDS33790.1	3	.	.	.	.	.	.	.	.	.	.	C	18.59	3.655963	0.67586	.	.	ENSG00000113805	ENST00000263665	T	0.51574	0.7	5.83	5.83	0.93111	Immunoglobulin I-set (1);Immunoglobulin subtype 2 (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.061219	0.64402	D	0.000004	T	0.60025	0.2237	L	0.56199	1.76	0.48452	D	0.999651	P	0.42456	0.78	P	0.53313	0.723	T	0.56703	-0.7935	10	0.49607	T	0.09	.	17.6078	0.88044	0.0:1.0:0.0:0.0	.	81	Q9P232	CNTN3_HUMAN	A	81	ENSP00000263665:G81A	ENSP00000263665:G81A	G	-	2	0	CNTN3	74618413	0.555000	0.26530	0.855000	0.33649	0.847000	0.48162	0.220000	0.17660	2.763000	0.94921	0.585000	0.79938	GGA	CNTN3	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.373	CNTN3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTN3	HGNC	protein_coding	OTTHUMT00000352306.1	C	NM_020872		74535723	-1	no_errors	ENST00000263665	ensembl	human	known	70_37	missense	SNP	1.000	G
CRB1	23418	genome.wustl.edu	37	1	197390187	197390187	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:197390187G>A	ENST00000367400.3	+	6	1364	c.1229G>A	c.(1228-1230)gGt>gAt	p.G410D	CRB1_ENST00000543483.1_Missense_Mutation_p.G109D|CRB1_ENST00000535699.1_Missense_Mutation_p.G341D|CRB1_ENST00000476483.1_3'UTR|CRB1_ENST00000544212.1_5'UTR|CRB1_ENST00000367399.2_Missense_Mutation_p.G298D|CRB1_ENST00000538660.1_Missense_Mutation_p.G410D|CRB1_ENST00000367397.1_5'UTR	NM_201253.2	NP_957705.1	P82279	CRUM1_HUMAN	crumbs family member 1, photoreceptor morphogenesis associated	410	EGF-like 10; calcium-binding. {ECO:0000255|PROSITE-ProRule:PRU00076}.				cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|eye photoreceptor cell development (GO:0042462)|plasma membrane organization (GO:0007009)	extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|microvillus (GO:0005902)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.G410D(1)		NS(1)|breast(4)|central_nervous_system(2)|cervix(3)|endometrium(13)|kidney(4)|large_intestine(21)|lung(58)|ovary(7)|prostate(3)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	132						CAAAATGGTGGTACTTGTGAG	0.368																																																	1	Substitution - Missense(1)	cervix(1)											152.0	138.0	143.0					1																	197390187		2203	4300	6503	SO:0001583	missense	23418				CCDS1390.1, CCDS53454.1, CCDS58052.1, CCDS58053.1	1q31-q32.1	2014-02-06	2014-02-06		ENSG00000134376	ENSG00000134376			2343	protein-coding gene	gene with protein product		604210	"""crumbs (Drosophila) homolog 1"", ""crumbs homolog 1 (Drosophila)"""	RP12		10373321, 10508521	Standard	NM_201253		Approved	LCA8	uc001gtz.3	P82279	OTTHUMG00000035663	ENST00000367400.3:c.1229G>A	1.37:g.197390187G>A	ENSP00000356370:p.Gly410Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A308|B7Z5T2|B9EG71|Q5K3A6|Q5TC28|Q5VUT1|Q6N027|Q8WWY0|Q8WWY1	Missense_Mutation	SNP	pfam_EG-like_dom,pfam_Laminin_G,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_Laminin_G,pfscan_EG-like_dom,pfscan_Laminin_G	p.G410D	ENST00000367400.3	37	c.1229	CCDS1390.1	1	.	.	.	.	.	.	.	.	.	.	G	22.7	4.319505	0.81469	.	.	ENSG00000134376	ENST00000535699;ENST00000538660;ENST00000367400;ENST00000367399;ENST00000543483;ENST00000367401	D;D;D;D;D	0.97480	-4.4;-4.4;-4.4;-4.4;-4.4	5.57	5.57	0.84162	EGF-like calcium-binding, conserved site (1);EGF (1);EGF-like calcium-binding (1);Epidermal growth factor-like, type 3 (1);	.	.	.	.	D	0.98934	0.9638	M	0.93854	3.465	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;0.998;1.0	D	0.99501	1.0953	9	0.87932	D	0	.	19.5429	0.95281	0.0:0.0:1.0:0.0	.	410;341;298;59;410	B7Z5T2;F5H0L2;P82279-3;P82279-4;P82279	.;.;.;.;CRUM1_HUMAN	D	341;410;410;298;109;59	ENSP00000438786:G341D;ENSP00000438091:G410D;ENSP00000356370:G410D;ENSP00000356369:G298D;ENSP00000439579:G109D	ENSP00000356369:G298D	G	+	2	0	CRB1	195656810	1.000000	0.71417	0.941000	0.38009	0.929000	0.56500	5.941000	0.70195	2.607000	0.88179	0.585000	0.79938	GGT	CRB1	-	pfam_EG-like_dom,pfam_EGF_extracell,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_EG-like_dom		0.368	CRB1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	CRB1	HGNC	protein_coding	OTTHUMT00000086565.2	G	NM_201253		197390187	+1	no_errors	ENST00000367400	ensembl	human	known	70_37	missense	SNP	0.998	A
COG2	22796	genome.wustl.edu	37	1	230804495	230804495	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:230804495A>G	ENST00000366669.4	+	6	674	c.559A>G	c.(559-561)Agc>Ggc	p.S187G	COG2_ENST00000366668.3_Missense_Mutation_p.S187G|COG2_ENST00000534989.1_Missense_Mutation_p.S128G|COG2_ENST00000535166.1_Missense_Mutation_p.S71G	NM_001145036.1|NM_007357.2	NP_001138508.1|NP_031383.1	Q14746	COG2_HUMAN	component of oligomeric golgi complex 2	187					Golgi organization (GO:0007030)|intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|oligosaccharide biosynthetic process (GO:0009312)|protein glycosylation (GO:0006486)	cytosol (GO:0005829)|Golgi membrane (GO:0000139)|Golgi stack (GO:0005795)|Golgi transport complex (GO:0017119)	protein transporter activity (GO:0008565)	p.S187G(1)		NS(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(11)|prostate(2)|skin(2)|urinary_tract(3)	27	Breast(184;0.0871)|Ovarian(103;0.183)	Prostate(94;0.178)				TGCTGTTCAAAGCAAAGGCAT	0.378																																																	1	Substitution - Missense(1)	cervix(1)											156.0	149.0	151.0					1																	230804495		2203	4300	6503	SO:0001583	missense	22796			Z34975	CCDS1584.1, CCDS44329.1	1q42.2	2008-02-05	2002-05-28	2002-05-31	ENSG00000135775	ENSG00000135775		"""Components of oligomeric golgi complex"""	6546	protein-coding gene	gene with protein product		606974	"""low density lipoprotein receptor defect C complementing"""	LDLC		7962052	Standard	NM_007357		Approved		uc001htw.3	Q14746	OTTHUMG00000037753	ENST00000366669.4:c.559A>G	1.37:g.230804495A>G	ENSP00000355629:p.Ser187Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86U99	Missense_Mutation	SNP	pfam_COG_complex_COG2_C,pfam_COG_su2_N	p.S187G	ENST00000366669.4	37	c.559	CCDS1584.1	1	.	.	.	.	.	.	.	.	.	.	A	28.9	4.961696	0.92791	.	.	ENSG00000135775	ENST00000366669;ENST00000535166;ENST00000366668;ENST00000534989	T;T;T;T	0.32753	1.44;1.44;1.44;1.44	5.14	5.14	0.70334	.	0.000000	0.85682	D	0.000000	T	0.27765	0.0683	L	0.58101	1.795	0.80722	D	1	P;B	0.41188	0.741;0.151	B;B	0.34242	0.178;0.032	T	0.07868	-1.0750	10	0.17832	T	0.49	-17.3432	15.2399	0.73461	1.0:0.0:0.0:0.0	.	187;187	Q86U99;Q14746	.;COG2_HUMAN	G	187;71;187;128	ENSP00000355629:S187G;ENSP00000445724:S71G;ENSP00000355628:S187G;ENSP00000440349:S128G	ENSP00000355628:S187G	S	+	1	0	COG2	228871118	1.000000	0.71417	0.997000	0.53966	0.995000	0.86356	8.920000	0.92779	2.071000	0.62044	0.533000	0.62120	AGC	COG2	-	NULL		0.378	COG2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COG2	HGNC	protein_coding	OTTHUMT00000092087.1	A	NM_007357		230804495	+1	no_errors	ENST00000366669	ensembl	human	known	70_37	missense	SNP	1.000	G
CUL4A	8451	genome.wustl.edu	37	13	113909425	113909425	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr13:113909425C>G	ENST00000375440.4	+	18	2101	c.2017C>G	c.(2017-2019)Cag>Gag	p.Q673E	CUL4A_ENST00000326335.4_Missense_Mutation_p.Q573E|CUL4A_ENST00000375441.3_Missense_Mutation_p.Q573E|CUL4A_ENST00000451881.1_Missense_Mutation_p.Q573E	NM_001008895.1	NP_001008895.1	Q13619	CUL4A_HUMAN	cullin 4A	673					cell cycle arrest (GO:0007050)|DNA repair (GO:0006281)|G1/S transition of mitotic cell cycle (GO:0000082)|hemopoiesis (GO:0030097)|intrinsic apoptotic signaling pathway (GO:0097193)|negative regulation of cell proliferation (GO:0008285)|negative regulation of granulocyte differentiation (GO:0030853)|positive regulation of cell proliferation (GO:0008284)|positive regulation of G1/S transition of mitotic cell cycle (GO:1900087)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|regulation of nucleotide-excision repair (GO:2000819)|regulation of protein metabolic process (GO:0051246)|somatic stem cell maintenance (GO:0035019)|viral process (GO:0016032)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)		p.Q573E(1)		NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|large_intestine(5)|lung(5)|skin(1)	17	Lung NSC(43;0.0161)|all_neural(89;0.0804)|Hepatocellular(20;0.0877)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.0482)|all_epithelial(44;0.0148)|all_lung(25;0.0271)|Lung NSC(25;0.0977)|Breast(118;0.188)	all cancers(43;0.112)			CAATCAAATTCAGATGAAGGA	0.338																																																	1	Substitution - Missense(1)	cervix(1)											79.0	84.0	82.0					13																	113909425		2203	4300	6503	SO:0001583	missense	8451			U58090	CCDS9533.1, CCDS41908.1, CCDS73604.1	13q34	2011-05-24			ENSG00000139842	ENSG00000139842			2554	protein-coding gene	gene with protein product		603137				8681378	Standard	NM_001008895		Approved		uc021rmv.1	Q13619	OTTHUMG00000017384	ENST00000375440.4:c.2017C>G	13.37:g.113909425C>G	ENSP00000364589:p.Gln673Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2W2|O75834|Q589T6|Q5TC62|Q6UP08|Q9UP17	Missense_Mutation	SNP	pfam_Cullin_N,pfam_Cullin_neddylation_domain,superfamily_Cullin_repeat-like_dom,superfamily_Cullin_homology,smart_Cullin_homology,smart_Cullin_neddylation_domain,pfscan_Cullin_homology	p.Q673E	ENST00000375440.4	37	c.2017	CCDS41908.1	13	.	.	.	.	.	.	.	.	.	.	C	23.0	4.356788	0.82243	.	.	ENSG00000139842	ENST00000375441;ENST00000451881;ENST00000326335;ENST00000375440	T;T;T;T	0.74421	-0.84;-0.84;-0.84;-0.71	5.1	5.1	0.69264	Winged helix-turn-helix transcription repressor DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.88043	0.6331	H	0.96916	3.905	0.80722	D	1	D;D	0.56746	0.977;0.977	P;P	0.52031	0.688;0.688	D	0.90712	0.4628	10	0.40728	T	0.16	-37.7494	18.8745	0.92329	0.0:1.0:0.0:0.0	.	673;673	Q13619;A8MSH7	CUL4A_HUMAN;.	E	573;573;573;673	ENSP00000364590:Q573E;ENSP00000389118:Q573E;ENSP00000322132:Q573E;ENSP00000364589:Q673E	ENSP00000322132:Q573E	Q	+	1	0	CUL4A	112957426	1.000000	0.71417	0.965000	0.40720	0.904000	0.53231	7.306000	0.78905	2.527000	0.85204	0.462000	0.41574	CAG	CUL4A	-	NULL		0.338	CUL4A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CUL4A	HGNC	protein_coding	OTTHUMT00000045888.3	C	NM_003589		113909425	+1	no_errors	ENST00000375440	ensembl	human	known	70_37	missense	SNP	1.000	G
CYP2B7P	1556	genome.wustl.edu	37	19	41447224	41447224	+	RNA	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:41447224C>T	ENST00000599198.1	+	0	723					NR_001278.1															NS(1)|endometrium(6)|kidney(1)|lung(2)|ovary(1)|skin(1)	12						TCTCTGGCTTCTTGAAATACT	0.527																																																	0																																												1556																															19.37:g.41447224C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000599198.1	37	NULL		19																																																																																			CYP2B7P1	-	-		0.527	CYP2B7P1-006	KNOWN	basic	processed_transcript	CYP2B7P1	HGNC	pseudogene	OTTHUMT00000465180.1	C			41447224	+1	no_errors	ENST00000599198	ensembl	human	known	70_37	rna	SNP	0.039	T
DCAF12L1	139170	genome.wustl.edu	37	X	125685755	125685755	+	Silent	SNP	C	C	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chrX:125685755C>A	ENST00000371126.1	-	1	1079	c.837G>T	c.(835-837)gcG>gcT	p.A279A		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	279								p.A279A(1)		breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						CCAAGGACACCGCTCCCAGTT	0.632																																																	1	Substitution - coding silent(1)	cervix(1)											50.0	48.0	49.0					X																	125685755		2203	4300	6503	SO:0001819	synonymous_variant	139170			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.837G>T	X.37:g.125685755C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IYK3	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.A279	ENST00000371126.1	37	c.837	CCDS14610.1	X																																																																																			DCAF12L1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat		0.632	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	C	NM_178470		125685755	-1	no_errors	ENST00000371126	ensembl	human	known	70_37	silent	SNP	0.008	A
DDX52	11056	genome.wustl.edu	37	17	35986056	35986056	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:35986056C>T	ENST00000349699.2	-	8	1064	c.1021G>A	c.(1021-1023)Gcc>Acc	p.A341T	DDX52_ENST00000394367.3_Missense_Mutation_p.A233T	NM_007010.3	NP_008941.2	Q9Y2R4	DDX52_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 52	341	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.					membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|poly(A) RNA binding (GO:0044822)	p.A341T(1)		biliary_tract(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(5)|ovary(1)|skin(3)	17		Breast(25;0.00637)|Ovarian(249;0.15)				GATGTGCAGGCCAGGAAAATG	0.443																																																	1	Substitution - Missense(1)	cervix(1)											147.0	130.0	136.0					17																	35986056		2203	4300	6503	SO:0001583	missense	11056			AF077033	CCDS11323.1	17q21.1	2014-05-06			ENSG00000141141	ENSG00000278053		"""DEAD-boxes"""	20038	protein-coding gene	gene with protein product		612500				11124703	Standard	XM_006721650		Approved	ROK1	uc002hoi.2	Q9Y2R4	OTTHUMG00000188475	ENST00000349699.2:c.1021G>A	17.37:g.35986056C>T	ENSP00000268854:p.Ala341Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86YG1|Q8N213|Q9NVE0|Q9Y482	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,pfam_Helicase/UvrB_dom,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.A341T	ENST00000349699.2	37	c.1021	CCDS11323.1	17	.	.	.	.	.	.	.	.	.	.	C	33	5.211178	0.95069	.	.	ENSG00000141141	ENST00000349699;ENST00000394367	T;T	0.15372	2.43;2.43	5.8	5.8	0.92144	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.108705	0.64402	D	0.000009	T	0.43722	0.1260	M	0.70903	2.155	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.09292	-1.0681	10	0.45353	T	0.12	-6.0194	19.0512	0.93046	0.0:1.0:0.0:0.0	.	341	Q9Y2R4	DDX52_HUMAN	T	341;233	ENSP00000268854:A341T;ENSP00000377893:A233T	ENSP00000268854:A341T	A	-	1	0	DDX52	33060169	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	5.561000	0.67339	2.741000	0.93983	0.650000	0.86243	GCC	DDX52	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.443	DDX52-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX52	HGNC	protein_coding	OTTHUMT00000256795.1	C	NM_152300		35986056	-1	no_errors	ENST00000349699	ensembl	human	known	70_37	missense	SNP	1.000	T
DIDO1	11083	genome.wustl.edu	37	20	61542823	61542823	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr20:61542823G>A	ENST00000266070.4	-	3	467	c.142C>T	c.(142-144)Ctg>Ttg	p.L48L	DIDO1_ENST00000395335.2_Silent_p.L48L|DIDO1_ENST00000395340.1_Silent_p.L48L|DIDO1_ENST00000266071.5_Silent_p.L48L|DIDO1_ENST00000354665.4_Silent_p.L48L|DIDO1_ENST00000395343.1_Silent_p.L48L|DIDO1_ENST00000370368.1_Silent_p.L48L|DIDO1_ENST00000370371.4_Silent_p.L48L|DIDO1_ENST00000370366.1_Silent_p.L48L	NM_033081.2	NP_149072.2	Q9BTC0	DIDO1_HUMAN	death inducer-obliterator 1	48					apoptotic signaling pathway (GO:0097190)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|zinc ion binding (GO:0008270)	p.L48L(2)		NS(6)|breast(5)|central_nervous_system(1)|cervix(3)|endometrium(6)|kidney(1)|large_intestine(17)|lung(39)|ovary(8)|prostate(3)|skin(7)|stomach(2)|upper_aerodigestive_tract(1)	99	Breast(26;5.68e-08)					GGCGGCTCCAGTGGGTCAGCC	0.647																																					Melanoma(25;381 482 3385 5362 7955 17159 17174 40604 47095)												2	Substitution - coding silent(2)	cervix(2)											31.0	35.0	34.0					20																	61542823		2199	4300	6499	SO:0001819	synonymous_variant	11083			AB002331	CCDS13508.2, CCDS13509.1, CCDS33506.1	20q13.33	2013-01-28	2005-11-11	2005-11-11	ENSG00000101191	ENSG00000101191		"""Zinc fingers, PHD-type"""	2680	protein-coding gene	gene with protein product		604140	"""chromosome 20 open reading frame 158"", ""death associated transcription factor 1"""	C20orf158, DATF1		10393935	Standard	NM_033081		Approved	DIO1, dJ885L7.8, FLJ11265, KIAA0333, DIO-1, BYE1	uc002ydr.2	Q9BTC0	OTTHUMG00000032945	ENST00000266070.4:c.142C>T	20.37:g.61542823G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MY65|B9EH82|E1P5I1|O15043|Q3ZTL7|Q3ZTL8|Q4VXS1|Q4VXS2|Q4VXV8|Q4VXV9|Q96D72|Q9BQW0|Q9BW03|Q9H4G6|Q9H4G7|Q9NTU8|Q9NUM8|Q9UFB6	Silent	SNP	pfam_TFIIS_cen_dom,pfam_SPOC_C,pfam_Znf_PHD-finger,superfamily_TFIIS_cen_dom,superfamily_Znf_FYVE_PHD,smart_Znf_PHD,smart_TFS2M,pfscan_Znf_PHD-finger	p.L48	ENST00000266070.4	37	c.142	CCDS33506.1	20																																																																																			DIDO1	-	NULL		0.647	DIDO1-201	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DIDO1	HGNC	protein_coding	OTTHUMT00000080091.2	G	NM_080796		61542823	-1	no_errors	ENST00000266070	ensembl	human	known	70_37	silent	SNP	0.000	A
DIP2A	23181	genome.wustl.edu	37	21	47929216	47929216	+	Silent	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr21:47929216G>C	ENST00000417564.2	+	7	852	c.831G>C	c.(829-831)ctG>ctC	p.L277L	DIP2A_ENST00000427143.2_Silent_p.L213L|DIP2A_ENST00000466639.1_Silent_p.L234L|DIP2A_ENST00000318711.7_Silent_p.L278L|DIP2A_ENST00000457905.3_Silent_p.L277L|DIP2A_ENST00000435722.3_Silent_p.L277L|DIP2A_ENST00000400274.1_Silent_p.L277L			Q14689	DIP2A_HUMAN	DIP2 disco-interacting protein 2 homolog A (Drosophila)	277					multicellular organismal development (GO:0007275)|negative regulation of gene expression (GO:0010629)|regulation of apoptotic process (GO:0042981)	cell surface (GO:0009986)|nucleus (GO:0005634)	catalytic activity (GO:0003824)	p.L213L(1)|p.L278L(1)|p.L277L(1)		cervix(1)|endometrium(7)|kidney(2)|large_intestine(6)|lung(22)|ovary(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	43	Breast(49;0.0933)			Epithelial(3;3.12e-06)|OV - Ovarian serous cystadenocarcinoma(3;5.68e-06)|all cancers(3;4.08e-05)|Colorectal(79;0.0129)|COAD - Colon adenocarcinoma(84;0.0824)		AGCAGCTTCTGAACACCCTGA	0.502																																																	3	Substitution - coding silent(3)	cervix(3)											139.0	143.0	141.0					21																	47929216		2017	4195	6212	SO:0001819	synonymous_variant	23181			AF490768	CCDS46655.1, CCDS46656.1, CCDS46657.1, CCDS54490.1, CCDS54491.1	21q22.3	2010-08-20	2006-01-13	2006-01-13	ENSG00000160305	ENSG00000160305			17217	protein-coding gene	gene with protein product		607711	"""chromosome 21 open reading frame 106"""	C21orf106			Standard	NM_015151		Approved	Dip2, KIAA0184	uc002zjo.2	Q14689	OTTHUMG00000090717	ENST00000417564.2:c.831G>C	21.37:g.47929216G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6P4T3|B4E0F0|E7EMA5|Q8IVA3|Q8N4S2|Q8TD89|Q96ML9	Silent	SNP	pfam_AMP-dep_Synth/Lig,pfam_DMAP1-bd	p.L278	ENST00000417564.2	37	c.834	CCDS46655.1	21																																																																																			DIP2A	-	NULL		0.502	DIP2A-012	KNOWN	basic|CCDS	protein_coding	DIP2A	HGNC	protein_coding	OTTHUMT00000376736.1	G	NM_015151		47929216	+1	no_errors	ENST00000318711	ensembl	human	known	70_37	silent	SNP	0.072	C
DLC1	10395	genome.wustl.edu	37	8	13162751	13162751	+	Intron	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:13162751G>A	ENST00000276297.4	-	5	1758				DLC1_ENST00000316609.5_Intron|DLC1_ENST00000511869.1_Missense_Mutation_p.L459F	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein						actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						AGATTGGCGAGAAAACAGAAC	0.279																																																	0													72.0	75.0	74.0					8																	13162751		2202	4298	6500	SO:0001627	intron_variant	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.1348+26C>T	8.37:g.13162751G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	NULL	p.L459F	ENST00000276297.4	37	c.1375	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	G	5.214	0.224942	0.09916	.	.	ENSG00000164741	ENST00000511869	T	0.13778	2.56	3.99	-0.245	0.13027	.	.	.	.	.	T	0.05686	0.0149	N	0.08118	0	0.09310	N	1	B	0.12013	0.005	B	0.12156	0.007	T	0.41395	-0.9511	9	0.27082	T	0.32	.	4.3082	0.10958	0.4494:0.1809:0.3697:0.0	.	459	E9PF76	.	F	459	ENSP00000425878:L459F	ENSP00000425878:L459F	L	-	1	0	DLC1	13207122	0.010000	0.17322	0.007000	0.13788	0.011000	0.07611	-0.220000	0.09215	-0.053000	0.13289	0.471000	0.43371	CTC	DLC1	-	NULL		0.279	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	G	NM_182643, NM_006094		13162751	-1	no_errors	ENST00000511869	ensembl	human	novel	70_37	missense	SNP	0.003	A
DMXL2	23312	genome.wustl.edu	37	15	51755661	51755661	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr15:51755661C>T	ENST00000251076.5	-	33	8125	c.7838G>A	c.(7837-7839)cGa>cAa	p.R2613Q	RP11-707P17.2_ENST00000559173.1_RNA|RP11-707P17.1_ENST00000561007.1_RNA|RP11-707P17.2_ENST00000559977.1_RNA|DMXL2_ENST00000449909.3_Missense_Mutation_p.R1977Q|DMXL2_ENST00000543779.2_Missense_Mutation_p.R2614Q|RP11-707P17.2_ENST00000560727.1_RNA	NM_001174116.1|NM_015263.3	NP_001167587.1|NP_056078.2	Q8TDJ6	DMXL2_HUMAN	Dmx-like 2	2613						cell junction (GO:0030054)|extracellular space (GO:0005615)|membrane (GO:0016020)|synaptic vesicle (GO:0008021)	Rab GTPase binding (GO:0017137)	p.R2613Q(1)		breast(4)|central_nervous_system(1)|cervix(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(26)|liver(1)|lung(28)|ovary(7)|prostate(7)|skin(4)|stomach(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	101				all cancers(107;0.00494)		ATGCCAAAGTCGTTTGACTGG	0.303																																																	1	Substitution - Missense(1)	cervix(1)											66.0	73.0	70.0					15																	51755661		2195	4289	6484	SO:0001583	missense	23312			AB020663	CCDS10141.1, CCDS53945.1, CCDS53946.1	15q21.2	2013-01-10			ENSG00000104093	ENSG00000104093		"""WD repeat domain containing"""	2938	protein-coding gene	gene with protein product	"""rabconnectin 3"""	612186					Standard	NM_001174116		Approved	RC3, KIAA0856	uc010ufy.2	Q8TDJ6	OTTHUMG00000131749	ENST00000251076.5:c.7838G>A	15.37:g.51755661C>T	ENSP00000251076:p.Arg2613Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTR3|B7ZMH3|F5GWF1|O94938	Missense_Mutation	SNP	pfam_Rav1p_C,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.R2614Q	ENST00000251076.5	37	c.7841	CCDS10141.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.494045	0.96339	.	.	ENSG00000104093	ENST00000251076;ENST00000543779;ENST00000449909;ENST00000436119	T;T;T	0.55930	0.52;0.52;0.49	5.26	5.26	0.73747	.	0.000000	0.85682	D	0.000000	T	0.76919	0.4055	M	0.85777	2.775	0.80722	D	1	D;D;D;D	0.89917	1.0;0.998;0.999;1.0	D;D;D;D	0.85130	0.997;0.945;0.984;0.996	T	0.80384	-0.1405	10	0.87932	D	0	.	19.0674	0.93117	0.0:1.0:0.0:0.0	.	2614;1977;2613;2614	F5GWF1;B2RTR3;Q8TDJ6;B7ZMH3	.;.;DMXL2_HUMAN;.	Q	2613;2614;1977;158	ENSP00000251076:R2613Q;ENSP00000441858:R2614Q;ENSP00000400855:R1977Q	ENSP00000251076:R2613Q	R	-	2	0	DMXL2	49542953	1.000000	0.71417	0.990000	0.47175	0.997000	0.91878	7.211000	0.77933	2.732000	0.93576	0.557000	0.71058	CGA	DMXL2	-	NULL		0.303	DMXL2-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	DMXL2	HGNC	protein_coding	OTTHUMT00000254671.2	C	NM_015263		51755661	-1	no_errors	ENST00000543779	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20975107	20975107	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr16:20975107C>G	ENST00000261383.3	-	53	10098	c.10099G>C	c.(10099-10101)Gag>Cag	p.E3367Q	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3367					cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)	p.E3367Q(2)		NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		TTGTCCTTCTCAAACAGAGAA	0.493																																																	2	Substitution - Missense(2)	cervix(2)											133.0	105.0	114.0					16																	20975107		2201	4300	6501	SO:0001583	missense	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10099G>C	16.37:g.20975107C>G	ENSP00000261383:p.Glu3367Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.E3367Q	ENST00000261383.3	37	c.10099	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	22.6	4.305280	0.81247	.	.	ENSG00000158486	ENST00000261383	T	0.68181	-0.31	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	D	0.88887	0.6559	H	0.97103	3.94	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.91913	0.5541	10	0.87932	D	0	.	20.0137	0.97470	0.0:1.0:0.0:0.0	.	3367	Q8TD57	DYH3_HUMAN	Q	3367	ENSP00000261383:E3367Q	ENSP00000261383:E3367Q	E	-	1	0	DNAH3	20882608	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.818000	0.86416	2.734000	0.93682	0.563000	0.77884	GAG	DNAH3	-	NULL		0.493	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	C	NM_017539		20975107	-1	no_errors	ENST00000261383	ensembl	human	known	70_37	missense	SNP	1.000	G
DNAJB1	3337	genome.wustl.edu	37	19	14627324	14627324	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:14627324C>T	ENST00000254322.2	-	2	816	c.746G>A	c.(745-747)aGa>aAa	p.R249K	DNAJB1_ENST00000396969.4_Missense_Mutation_p.R149K	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1	249					chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)	p.R249K(1)		NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		AGAGCCATCTCTCTTAAAGAT	0.498																																																	1	Substitution - Missense(1)	cervix(1)											69.0	70.0	69.0					19																	14627324		2203	4300	6503	SO:0001583	missense	3337			D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.746G>A	19.37:g.14627324C>T	ENSP00000254322:p.Arg249Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX52	Missense_Mutation	SNP	pfam_DnaJ_C,pfam_DnaJ_N,superfamily_DnaJ_N,superfamily_HSP40/DnaJ_pept-bd,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.R249K	ENST00000254322.2	37	c.746	CCDS12312.1	19	.	.	.	.	.	.	.	.	.	.	c	35	5.483348	0.96307	.	.	ENSG00000132002	ENST00000254322;ENST00000396969	T;T	0.51325	0.71;0.71	5.19	5.19	0.71726	HSP40/DnaJ peptide-binding (1);	0.000000	0.85682	D	0.000000	T	0.79868	0.4520	H	0.97214	3.96	0.80722	D	1	D	0.89917	1.0	D	0.77004	0.989	D	0.87268	0.2284	10	0.87932	D	0	.	16.1947	0.82018	0.0:1.0:0.0:0.0	.	249	P25685	DNJB1_HUMAN	K	249;149	ENSP00000254322:R249K;ENSP00000444212:R149K	ENSP00000254322:R249K	R	-	2	0	DNAJB1	14488324	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.657000	0.83745	2.424000	0.82194	0.561000	0.74099	AGA	DNAJB1	-	pfam_DnaJ_C,superfamily_HSP40/DnaJ_pept-bd		0.498	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB1	HGNC	protein_coding	OTTHUMT00000465987.1	C	NM_006145		14627324	-1	no_errors	ENST00000254322	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAJB1	3337	genome.wustl.edu	37	19	14627859	14627859	+	Splice_Site	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:14627859C>T	ENST00000254322.2	-	2	282		c.e2-1		DNAJB1_ENST00000396969.4_Splice_Site	NM_006145.1	NP_006136.1	P25685	DNJB1_HUMAN	DnaJ (Hsp40) homolog, subfamily B, member 1						chaperone cofactor-dependent protein refolding (GO:0070389)|chaperone mediated protein folding requiring cofactor (GO:0051085)|negative regulation of inclusion body assembly (GO:0090084)|positive regulation of ATPase activity (GO:0032781)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATPase activator activity (GO:0001671)|ATPase binding (GO:0051117)|chaperone binding (GO:0051087)|Hsp70 protein binding (GO:0030544)|unfolded protein binding (GO:0051082)	p.?(1)		NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(1)|lung(7)|prostate(1)|urinary_tract(1)	16				GBM - Glioblastoma multiforme(1328;0.0476)		CCCTTTAGGCCTGAAAAGCAG	0.547																																																	1	Unknown(1)	cervix(1)											37.0	40.0	39.0					19																	14627859		2193	4292	6485	SO:0001630	splice_region_variant	3337			D49547	CCDS12312.1, CCDS74295.1	19p13.12	2014-08-12			ENSG00000132002	ENSG00000132002		"""Heat shock proteins / DNAJ (HSP40)"""	5270	protein-coding gene	gene with protein product	"""radial spoke 16 homolog B (Chlamydomonas)"""	604572		HSPF1		8975727, 8250930	Standard	XM_006722733		Approved	Hsp40, Sis1, RSPH16B	uc002myz.1	P25685	OTTHUMG00000183289	ENST00000254322.2:c.212-1G>A	19.37:g.14627859C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DX52	Splice_Site	SNP	-	e2-1	ENST00000254322.2	37	c.212-1	CCDS12312.1	19	.	.	.	.	.	.	.	.	.	.	C	15.65	2.897735	0.52227	.	.	ENSG00000132002	ENST00000254322	.	.	.	4.53	4.53	0.55603	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.7596	0.69596	0.0:1.0:0.0:0.0	.	.	.	.	.	-1	.	.	.	-	.	.	DNAJB1	14488859	1.000000	0.71417	1.000000	0.80357	0.436000	0.31835	7.360000	0.79487	2.063000	0.61619	0.511000	0.50034	.	DNAJB1	-	-		0.547	DNAJB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJB1	HGNC	protein_coding	OTTHUMT00000465987.1	C	NM_006145	Intron	14627859	-1	no_errors	ENST00000254322	ensembl	human	known	70_37	splice_site	SNP	1.000	T
DNLZ	728489	genome.wustl.edu	37	9	139257980	139257997	+	In_Frame_Del	DEL	GCCCCAGAGCCGCCGCGG	GCCCCAGAGCCGCCGCGG	-	rs568634364		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	GCCCCAGAGCCGCCGCGG	GCCCCAGAGCCGCCGCGG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr9:139257980_139257997delGCCCCAGAGCCGCCGCGG	ENST00000371738.3	-	1	244_261	c.170_187delCCGCGGCGGCTCTGGGGC	c.(169-189)cccgcggcggctctggggcgc>cgc	p.PAAALG57del	CARD9_ENST00000460290.1_5'Flank|DNLZ_ENST00000371739.3_In_Frame_Del_p.PAAALG57del	NM_001080849.1	NP_001074318.1	Q5SXM8	DNLZ_HUMAN	DNL-type zinc finger	57						mitochondrion (GO:0005739)	zinc ion binding (GO:0008270)			central_nervous_system(1)|prostate(1)	2		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.42e-06)|Epithelial(140;3.3e-06)		GCCTCCACGCGCCCCAGAgccgccgcgggccccggccc	0.771																																																	0										0,2596		0,0,1298						1.7	0.0			7	9,5207		1,7,2600	no	coding	DNLZ	NM_001080849.1		1,7,3898	A1A1,A1R,RR		0.1725,0.0,0.1152				9,7803				SO:0001651	inframe_deletion	728489			AL592301	CCDS35179.1	9q34.3	2013-01-10	2007-12-18	2007-12-18	ENSG00000213221	ENSG00000213221		"""Zinc fingers"""	33879	protein-coding gene	gene with protein product	"""translocase of inner mitochondrial membrane 15 homolog (yeast)"", ""HSP70 escort protein"""		"""chromosome 9 open reading frame 151"""	C9orf151		21530495, 22162012	Standard	NM_001080849		Approved	RP11-413M3.2, ZIM17, bA413M3.2, TIMM15, HEP	uc004chf.2	Q5SXM8	OTTHUMG00000020931	ENST00000371738.3:c.170_187delCCGCGGCGGCTCTGGGGC	9.37:g.139257980_139257997delGCCCCAGAGCCGCCGCGG	ENSP00000360803:p.Pro57_Gly62del	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUX5|B9EJE1	In_Frame_Del	DEL	pfam_Znf_DNL-typ	p.PAAALG57in_frame_del	ENST00000371738.3	37	c.187_170	CCDS35179.1	9																																																																																			DNLZ	-	NULL		0.771	DNLZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNLZ	HGNC	protein_coding	OTTHUMT00000055075.2	GCCCCAGAGCCGCCGCGG	NM_001080849		139257997	-1	no_errors	ENST00000371738	ensembl	human	known	70_37	in_frame_del	DEL	0.005:0.007:0.064:0.067:0.062:0.062:0.050:0.044:0.061:0.084:0.058:0.081:0.066:0.064:0.036:0.037:0.050:0.061	-
DOCK3	1795	genome.wustl.edu	37	3	50816135	50816135	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:50816135C>G	ENST00000266037.9	+	2	90	c.67C>G	c.(67-69)Caa>Gaa	p.Q23E		NM_004947.4	NP_004938.1	Q8IZD9	DOCK3_HUMAN	dedicator of cytokinesis 3	23	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.Q12E(1)|p.Q23E(1)		breast(2)|cervix(1)|endometrium(10)|kidney(4)|lung(22)|prostate(5)|urinary_tract(1)	45				BRCA - Breast invasive adenocarcinoma(193;0.00105)|KIRC - Kidney renal clear cell carcinoma(197;0.00449)|Kidney(197;0.00518)		ATCTGTCCCTCAAGGGTTGGT	0.383																																																	2	Substitution - Missense(2)	cervix(2)											135.0	117.0	123.0					3																	50816135		1849	4090	5939	SO:0001583	missense	1795			AB002297	CCDS46835.1	3p21	2008-02-01			ENSG00000088538	ENSG00000088538			2989	protein-coding gene	gene with protein product		603123	"""dedicator of cyto-kinesis 3"""			9205841	Standard	NM_004947		Approved	KIAA0299, MOCA, PBP	uc011bds.2	Q8IZD9	OTTHUMG00000156892	ENST00000266037.9:c.67C>G	3.37:g.50816135C>G	ENSP00000266037:p.Gln23Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	O15017	Missense_Mutation	SNP	pfam_DOCK_C,pfam_SH3_2,superfamily_SH3_domain,superfamily_ARM-type_fold,smart_SH3_domain,pfscan_SH3_domain	p.Q23E	ENST00000266037.9	37	c.67	CCDS46835.1	3	.	.	.	.	.	.	.	.	.	.	N	19.16	3.773113	0.69992	.	.	ENSG00000088538	ENST00000266037	T	0.06768	3.26	5.4	5.4	0.78164	Src homology-3 domain (3);Variant SH3 (1);	0.179734	0.37623	N	0.002011	T	0.11067	0.0270	N	0.11313	0.125	0.43403	D	0.995531	P	0.42620	0.785	P	0.53988	0.739	T	0.40232	-0.9574	10	0.33940	T	0.23	.	16.458	0.84029	0.0:1.0:0.0:0.0	.	23	Q8IZD9	DOCK3_HUMAN	E	23	ENSP00000266037:Q23E	ENSP00000266037:Q23E	Q	+	1	0	DOCK3	50791139	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	5.104000	0.64584	2.692000	0.91855	0.655000	0.94253	CAA	DOCK3	-	pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain		0.383	DOCK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK3	HGNC	protein_coding	OTTHUMT00000346478.5	C	NM_004947		50816135	+1	no_errors	ENST00000266037	ensembl	human	known	70_37	missense	SNP	1.000	G
DPEP2	64174	genome.wustl.edu	37	16	68026017	68026017	+	Missense_Mutation	SNP	C	C	T	rs564605320		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr16:68026017C>T	ENST00000572888.1	-	3	1120	c.470G>A	c.(469-471)cGc>cAc	p.R157H	DPEP2_ENST00000412757.2_Missense_Mutation_p.R157H|DPEP2_ENST00000393847.1_Missense_Mutation_p.R157H			Q9H4A9	DPEP2_HUMAN	dipeptidase 2	157					arachidonic acid metabolic process (GO:0019369)|leukotriene metabolic process (GO:0006691)|small molecule metabolic process (GO:0044281)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	dipeptidase activity (GO:0016805)|dipeptidyl-peptidase activity (GO:0008239)|metal ion binding (GO:0046872)|metalloexopeptidase activity (GO:0008235)	p.R157H(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)|skin(2)|upper_aerodigestive_tract(1)	17		Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0119)|Epithelial(162;0.0489)|all cancers(182;0.239)		ACACATGCGGCGTATGAGGTC	0.577													C|||	1	0.000199681	0.0	0.0	5008	,	,		21857	0.0		0.001	False		,,,				2504	0.0																1	Substitution - Missense(1)	cervix(1)											128.0	118.0	121.0					16																	68026017		2198	4300	6498	SO:0001583	missense	64174			AJ295149	CCDS10857.1	16q22.1	2011-07-22			ENSG00000167261	ENSG00000167261	3.4.13.19		23028	protein-coding gene	gene with protein product		609925					Standard	NM_022355		Approved		uc002eve.4	Q9H4A9	OTTHUMG00000137542	ENST00000572888.1:c.470G>A	16.37:g.68026017C>T	ENSP00000458977:p.Arg157His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCF8|Q6UX92|Q8TC95	Missense_Mutation	SNP	pfam_Peptidase_M19	p.R157H	ENST00000572888.1	37	c.470	CCDS10857.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	7.935|7.935	0.741612|0.741612	0.15642|0.15642	.|.	.|.	ENSG00000167261|ENSG00000167261	ENST00000268795|ENST00000393847;ENST00000412757;ENST00000322384	.|T;T	.|0.23950	.|1.88;1.88	4.77|4.77	-7.87|-7.87	0.01183|0.01183	.|.	.|0.521379	.|0.20118	.|N	.|0.098861	T|T	0.12050|0.12050	0.0293|0.0293	N|N	0.25957|0.25957	0.775|0.775	0.09310|0.09310	N|N	0.999998|0.999998	B|B;B	0.12630|0.10296	0.006|0.003;0.001	B|B;B	0.11329|0.15484	0.006|0.013;0.005	T|T	0.24012|0.24012	-1.0172|-1.0172	8|10	0.87932|0.18276	D|T	0|0.48	-2.1282|-2.1282	11.1866|11.1866	0.48660|0.48660	0.0:0.1698:0.1058:0.7244|0.0:0.1698:0.1058:0.7244	.|.	115|157;70	B4DNP7|Q9H4A9;Q9H4A9-2	.|DPEP2_HUMAN;.	T|H	115|157;157;70	.|ENSP00000377430:R157H;ENSP00000412549:R157H	ENSP00000268795:A115T|ENSP00000314702:R70H	A|R	-|-	1|2	0|0	DPEP2|DPEP2	66583518|66583518	0.000000|0.000000	0.05858|0.05858	0.006000|0.006000	0.13384|0.13384	0.846000|0.846000	0.48090|0.48090	-1.952000|-1.952000	0.01528|0.01528	-1.274000|-1.274000	0.02421|0.02421	-0.254000|-0.254000	0.11334|0.11334	GCC|CGC	DPEP2	-	pfam_Peptidase_M19		0.577	DPEP2-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DPEP2	HGNC	protein_coding	OTTHUMT00000437026.1	C	NM_022355		68026017	-1	no_errors	ENST00000393847	ensembl	human	known	70_37	missense	SNP	0.001	T
DYNC1H1	1778	genome.wustl.edu	37	14	102481656	102481656	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:102481656C>T	ENST00000360184.4	+	35	7393	c.7229C>T	c.(7228-7230)tCc>tTc	p.S2410F		NM_001376.4	NP_001367.2	Q14204	DYHC1_HUMAN	dynein, cytoplasmic 1, heavy chain 1	2410	AAA 2. {ECO:0000250}.				antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cell death (GO:0008219)|cytoplasmic mRNA processing body assembly (GO:0033962)|G2/M transition of mitotic cell cycle (GO:0000086)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|mitotic spindle organization (GO:0007052)|stress granule assembly (GO:0034063)|transport (GO:0006810)	centrosome (GO:0005813)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|membrane (GO:0016020)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|poly(A) RNA binding (GO:0044822)	p.S2410F(1)		NS(1)|biliary_tract(1)|breast(4)|central_nervous_system(5)|cervix(1)|endometrium(21)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(28)|lung(60)|ovary(9)|pancreas(1)|prostate(6)|skin(7)|stomach(3)|upper_aerodigestive_tract(4)|urinary_tract(2)	166						GAGGCCGCTTCCCCCATGCTG	0.617																																																	1	Substitution - Missense(1)	cervix(1)											31.0	29.0	30.0					14																	102481656		2203	4300	6503	SO:0001583	missense	1778			AB002323	CCDS9966.1	14q32.31	2006-12-21	2005-11-24	2005-11-24		ENSG00000197102		"""Cytoplasmic dyneins"""	2961	protein-coding gene	gene with protein product		600112	"""dynein, cytoplasmic, heavy polypeptide 1"""	DNECL, DNCL, DNCH1		16260502, 8666668	Standard	NM_001376		Approved	Dnchc1, HL-3, p22, DHC1	uc001yks.2	Q14204		ENST00000360184.4:c.7229C>T	14.37:g.102481656C>T	ENSP00000348965:p.Ser2410Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1R0|Q6DKQ7|Q8WU28|Q92814|Q9Y4G5	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-1,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Thioredoxin-like_fold,superfamily_Glutathione-S-Trfase_C-like,smart_AAA+_ATPase	p.S2410F	ENST00000360184.4	37	c.7229	CCDS9966.1	14	.	.	.	.	.	.	.	.	.	.	C	21.1	4.104522	0.77096	.	.	ENSG00000197102	ENST00000360184	T	0.21031	2.03	5.59	5.59	0.84812	.	0.000000	0.85682	D	0.000000	T	0.33847	0.0877	M	0.67397	2.05	0.80722	D	1	P	0.44344	0.833	P	0.45167	0.472	T	0.07927	-1.0747	10	0.62326	D	0.03	.	19.5963	0.95541	0.0:1.0:0.0:0.0	.	2410	Q14204	DYHC1_HUMAN	F	2410	ENSP00000348965:S2410F	ENSP00000348965:S2410F	S	+	2	0	DYNC1H1	101551409	1.000000	0.71417	0.980000	0.43619	0.859000	0.49053	7.465000	0.80898	2.648000	0.89879	0.561000	0.74099	TCC	DYNC1H1	-	NULL		0.617	DYNC1H1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DYNC1H1	HGNC	protein_coding	OTTHUMT00000414574.1	C	NM_001376		102481656	+1	no_errors	ENST00000360184	ensembl	human	known	70_37	missense	SNP	1.000	T
ECT2L	345930	genome.wustl.edu	37	6	139206714	139206714	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr6:139206714G>A	ENST00000423192.1	+	16	2261	c.2100G>A	c.(2098-2100)ctG>ctA	p.L700L	ECT2L_ENST00000367682.2_Silent_p.L700L|ECT2L_ENST00000541398.1_Intron			Q008S8	ECT2L_HUMAN	epithelial cell transforming 2 like	700	DH. {ECO:0000255|PROSITE- ProRule:PRU00062}.						Rho guanyl-nucleotide exchange factor activity (GO:0005089)	p.L700L(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|kidney(1)|large_intestine(7)|lung(12)|skin(1)|upper_aerodigestive_tract(1)	30						CCAAAATGCTGAGGTACGTTC	0.493			"""N, Splice, Mis"""		ETP ALL																																			Rec	yes		6	6q24.1	345930	epithelial cell transforming sequence 2 oncogene-like		L	1	Substitution - coding silent(1)	cervix(1)											105.0	98.0	100.0					6																	139206714		1918	4121	6039	SO:0001819	synonymous_variant	345930				CCDS43508.1	6q24.1	2014-03-11	2014-03-11		ENSG00000203734	ENSG00000203734		"""Rho guanine nucleotide exchange factors"", ""F-boxes /  ""other"""""	21118	protein-coding gene	gene with protein product	"""lung specific F-box and DH domain containing protein"", ""F-box protein 49"""		"""chromosome 6 open reading frame 91"", ""epithelial cell transforming sequence 2 oncogene-like"""	C6orf91			Standard	NM_001077706		Approved	ARHGEF32, FBXO49, LFDH	uc021zfx.1	Q008S8	OTTHUMG00000015679	ENST00000423192.1:c.2100G>A	6.37:g.139206714G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUV6|Q5JWK2|Q5JWK3|Q5JWK4	Silent	SNP	pfam_DH-domain,pfam_F-box_dom_cyclin-like,superfamily_DH-domain,superfamily_F-box_dom_cyclin-like,smart_DH-domain,pfscan_DH-domain	p.L700	ENST00000423192.1	37	c.2100	CCDS43508.1	6																																																																																			ECT2L	-	pfam_DH-domain,superfamily_DH-domain,smart_DH-domain,pfscan_DH-domain		0.493	ECT2L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ECT2L	HGNC	protein_coding	OTTHUMT00000042441.3	G	NM_001077706		139206714	+1	no_errors	ENST00000367682	ensembl	human	known	70_37	silent	SNP	1.000	A
EDA	1896	genome.wustl.edu	37	X	69176994	69176994	+	Intron	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chrX:69176994C>T	ENST00000374552.4	+	2	744				EDA_ENST00000374553.2_Intron|EDA_ENST00000502251.1_3'UTR|EDA_ENST00000524573.1_Intron	NM_001399.4	NP_001390.1	Q92838	EDA_HUMAN	ectodysplasin A						cell differentiation (GO:0030154)|cell-matrix adhesion (GO:0007160)|ectoderm development (GO:0007398)|gene expression (GO:0010467)|hair follicle placode formation (GO:0060789)|immune response (GO:0006955)|odontogenesis of dentin-containing tooth (GO:0042475)|pigmentation (GO:0043473)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|salivary gland cavitation (GO:0060662)|signal transduction (GO:0007165)|trachea gland development (GO:0061153)	apical part of cell (GO:0045177)|collagen trimer (GO:0005581)|cytoskeleton (GO:0005856)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(2)|urinary_tract(1)	14						TAAGTCTACTCAGTTGATCCT	0.413																																																	0													113.0	107.0	109.0					X																	69176994		2203	4300	6503	SO:0001627	intron_variant	1896			U59227	CCDS14394.1, CCDS35318.1, CCDS35319.1, CCDS43966.1, CCDS35318.2, CCDS35319.2, CCDS55436.1	Xq12-q13.1	2013-05-22	2004-08-09	2004-08-12	ENSG00000158813	ENSG00000158813		"""Tumor necrosis factor (ligand) superfamily"""	3157	protein-coding gene	gene with protein product		300451	"""ectodermal dysplasia 1, anhidrotic"", ""oligodontia 1"""	ED1, EDA2, ODT1		8696334, 18657636, 16583127	Standard	NM_001005612		Approved	EDA1, XLHED, HED, XHED, ED1-A1, ED1-A2, EDA-A1, EDA-A2	uc004dxs.3	Q92838	OTTHUMG00000021764	ENST00000374552.4:c.502+12C>T	X.37:g.69176994C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUZ2|A2A337|B7ZLU2|B7ZLU4|O75910|Q5JS00|Q5JUM7|Q9UP77|Q9Y6L0|Q9Y6L1|Q9Y6L2|Q9Y6L3|Q9Y6L4	RNA	SNP	-	NULL	ENST00000374552.4	37	NULL	CCDS14394.1	X	.	.	.	.	.	.	.	.	.	.	C	5.085	0.201279	0.09652	.	.	ENSG00000158813	ENST00000513754	.	.	.	4.19	1.21	0.21127	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	5.0838	0.14671	0.0:0.4188:0.0:0.5812	.	.	.	.	X	172	.	.	Q	+	1	0	EDA	69093719	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-0.491000	0.06474	0.106000	0.17784	-0.197000	0.12766	CAG	EDA	-	-		0.413	EDA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EDA	HGNC	protein_coding	OTTHUMT00000057048.2	C	NM_001399		69176994	+1	no_errors	ENST00000502251	ensembl	human	known	70_37	rna	SNP	0.000	T
EPHA2	1969	genome.wustl.edu	37	1	16474972	16474972	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:16474972C>T	ENST00000358432.5	-	3	878	c.724G>A	c.(724-726)Gag>Aag	p.E242K	EPHA2_ENST00000461614.1_5'UTR	NM_004431.3	NP_004422.2	P29317	EPHA2_HUMAN	EPH receptor A2	242	Cys-rich.				activation of Rac GTPase activity (GO:0032863)|angiogenesis (GO:0001525)|axial mesoderm formation (GO:0048320)|bone remodeling (GO:0046849)|branching involved in mammary gland duct morphogenesis (GO:0060444)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|ephrin receptor signaling pathway (GO:0048013)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|keratinocyte differentiation (GO:0030216)|lens fiber cell morphogenesis (GO:0070309)|mammary gland epithelial cell proliferation (GO:0033598)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase B signaling (GO:0051898)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|notochord cell development (GO:0060035)|notochord formation (GO:0014028)|osteoblast differentiation (GO:0001649)|osteoclast differentiation (GO:0030316)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|post-anal tail morphogenesis (GO:0036342)|protein kinase B signaling (GO:0043491)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of lamellipodium assembly (GO:0010591)|response to growth factor (GO:0070848)|skeletal system development (GO:0001501)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cell projection (GO:0042995)|cell surface (GO:0009986)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|leading edge membrane (GO:0031256)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)	p.E242K(1)		NS(1)|biliary_tract(1)|breast(3)|central_nervous_system(3)|cervix(2)|endometrium(1)|kidney(1)|large_intestine(6)|lung(12)|ovary(2)|pancreas(1)|prostate(3)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	42		Colorectal(325;3.46e-05)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0221)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0181)|Colorectal(212;3.63e-07)|COAD - Colon adenocarcinoma(227;2.25e-05)|BRCA - Breast invasive adenocarcinoma(304;9.58e-05)|Kidney(64;0.000175)|KIRC - Kidney renal clear cell carcinoma(64;0.00261)|STAD - Stomach adenocarcinoma(313;0.00669)|READ - Rectum adenocarcinoma(331;0.0649)	Dasatinib(DB01254)|Regorafenib(DB08896)	ATACGGGGCTCTTCACCCCCC	0.667																																																	1	Substitution - Missense(1)	cervix(1)											64.0	60.0	62.0					1																	16474972		2203	4300	6503	SO:0001583	missense	1969			BC037166	CCDS169.1	1p36	2013-02-11	2004-10-28		ENSG00000142627	ENSG00000142627	2.7.10.1	"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3386	protein-coding gene	gene with protein product		176946	"""EphA2"""	ECK		9119409	Standard	NM_004431		Approved		uc001aya.2	P29317	OTTHUMG00000009527	ENST00000358432.5:c.724G>A	1.37:g.16474972C>T	ENSP00000351209:p.Glu242Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B5A968|Q8N3Z2	Missense_Mutation	SNP	pirsf_Tyr_kinase_ephrin_rcpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,pfam_Interferon_alpha/beta_rcpt_bsu,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom	p.E242K	ENST00000358432.5	37	c.724	CCDS169.1	1	.	.	.	.	.	.	.	.	.	.	C	9.898	1.205986	0.22205	.	.	ENSG00000142627	ENST00000358432	T	0.72167	-0.63	5.14	5.14	0.70334	.	0.110201	0.40302	N	0.001125	T	0.57272	0.2042	N	0.21373	0.66	0.32858	D	0.507602	B;B	0.29936	0.262;0.0	B;B	0.20184	0.028;0.001	T	0.68116	-0.5494	10	0.56958	D	0.05	.	16.0881	0.81073	0.0:1.0:0.0:0.0	.	242;242	B5A968;P29317	.;EPHA2_HUMAN	K	242	ENSP00000351209:E242K	ENSP00000351209:E242K	E	-	1	0	EPHA2	16347559	0.000000	0.05858	0.980000	0.43619	0.216000	0.24613	1.082000	0.30803	2.393000	0.81446	0.561000	0.74099	GAG	EPHA2	-	pirsf_Tyr_kinase_ephrin_rcpt		0.667	EPHA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHA2	HGNC	protein_coding	OTTHUMT00000026322.1	C	NM_004431		16474972	-1	no_errors	ENST00000358432	ensembl	human	known	70_37	missense	SNP	1.000	T
EPHA10	284656	genome.wustl.edu	37	1	38227478	38227478	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:38227478C>T	ENST00000373048.4	-	3	448	c.449G>A	c.(448-450)cGc>cAc	p.R150H	EPHA10_ENST00000319637.6_Missense_Mutation_p.R150H|EPHA10_ENST00000427468.2_Missense_Mutation_p.R150H	NM_001099439.1	NP_001092909.1	Q5JZY3	EPHAA_HUMAN	EPH receptor A10	150	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.		R -> H (in a gastric adenocarcinoma sample; somatic mutation). {ECO:0000269|PubMed:17344846}.		ephrin receptor signaling pathway (GO:0048013)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|transmembrane-ephrin receptor activity (GO:0005005)	p.R150H(2)		NS(2)|breast(4)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(4)|lung(13)|prostate(3)|skin(8)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50	Acute lymphoblastic leukemia(166;0.074)|all_hematologic(146;0.197)	Myeloproliferative disorder(586;0.0255)|all_neural(195;0.164)				GTCGATTTTGCGGGGCCGGCT	0.667																																																	2	Substitution - Missense(2)	cervix(1)|stomach(1)											28.0	34.0	32.0					1																	38227478		2197	4296	6493	SO:0001583	missense	284656			AK090974	CCDS425.1, CCDS41305.1	1p34.3	2013-02-11			ENSG00000183317	ENSG00000183317		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	19987	protein-coding gene	gene with protein product		611123				12477932	Standard	NM_001099439		Approved	FLJ16103, FLJ33655	uc009vvi.3	Q5JZY3	OTTHUMG00000004325	ENST00000373048.4:c.449G>A	1.37:g.38227478C>T	ENSP00000362139:p.Arg150His	Somatic		WXS	Illumina HiSeq	Phase_IV	A4FU89|J3KPB5|Q6NW42	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_SAM/pointed,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R150H	ENST00000373048.4	37	c.449	CCDS41305.1	1	.	.	.	.	.	.	.	.	.	.	C	13.66	2.302145	0.40694	.	.	ENSG00000183317	ENST00000427468;ENST00000373048;ENST00000319637	T;T;T	0.03689	3.84;3.84;3.84	4.75	-0.744	0.11101	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.552391	0.15315	N	0.268849	T	0.07593	0.0191	L	0.45137	1.4	0.80722	D	1	B;D	0.76494	0.017;0.999	B;D	0.63033	0.008;0.91	T	0.41088	-0.9528	10	0.35671	T	0.21	.	6.552	0.22440	0.0:0.4868:0.1255:0.3877	.	150;150	Q5JZY3;Q5JZY3-2	EPHAA_HUMAN;.	H	150	ENSP00000397746:R150H;ENSP00000362139:R150H;ENSP00000316395:R150H	ENSP00000316395:R150H	R	-	2	0	EPHA10	38000065	0.913000	0.31002	0.887000	0.34795	0.778000	0.44026	0.081000	0.14823	-0.224000	0.09928	-1.020000	0.02445	CGC	EPHA10	-	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom,pirsf_Tyr_kinase_ephrin_rcpt		0.667	EPHA10-003	KNOWN	not_organism_supported|basic|appris_candidate|CCDS	protein_coding	EPHA10	HGNC	protein_coding	OTTHUMT00000012497.2	C	NM_173641		38227478	-1	no_errors	ENST00000427468	ensembl	human	known	70_37	missense	SNP	0.952	T
ERV3-1	2086	genome.wustl.edu	37	7	64452419	64452419	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:64452419G>C	ENST00000394323.2	-	2	1486	c.986C>G	c.(985-987)tCa>tGa	p.S329*	ZNF117_ENST00000282869.6_5'Flank	NM_001007253.3	NP_001007254.2	Q14264	ENR1_HUMAN	endogenous retrovirus group 3, member 1	329						extracellular vesicular exosome (GO:0070062)|viral envelope (GO:0019031)		p.S329*(1)		breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)	16						gctctgacttgatggtgcagg	0.478																																																	1	Substitution - Nonsense(1)	cervix(1)											98.0	93.0	95.0					7																	64452419		1878	4114	5992	SO:0001587	stop_gained	2086			AK295189	CCDS47595.1	7p12-q11	2014-05-02	2011-05-05	2011-05-05	ENSG00000213462	ENSG00000213462			3454	other	endogenous retrovirus		131170	"""endogenous retroviral sequence 3 (includes zinc finger protein H-plk/HPF9)"", ""endogenous retroviral sequence 3"""	ERV3		2115127, 6495650, 21542922	Standard	NM_001007253		Approved	H-PLK, HERV-R, ERV-R, envR	uc011kdr.2	Q14264	OTTHUMG00000165023	ENST00000394323.2:c.986C>G	7.37:g.64452419G>C	ENSP00000391594:p.Ser329*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	NULL	p.S329*	ENST00000394323.2	37	c.986	CCDS47595.1	7	.	.	.	.	.	.	.	.	.	.	.	29.1	4.976968	0.92982	.	.	ENSG00000213462	ENST00000394323	.	.	.	0.109	0.109	0.14578	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.34782	T	0.22	.	.	.	.	.	.	.	.	X	329	.	ENSP00000391594:S329X	S	-	2	0	ERV3-1	64089854	0.080000	0.21391	0.097000	0.21041	0.097000	0.18754	0.230000	0.17852	0.181000	0.19994	0.184000	0.17185	TCA	ERV3-1	-	NULL		0.478	ERV3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERV3-1	HGNC	protein_coding	OTTHUMT00000381468.1	G	NM_001007253		64452419	-1	no_errors	ENST00000394323	ensembl	human	known	70_37	nonsense	SNP	0.108	C
FAM181A	90050	genome.wustl.edu	37	14	94395423	94395423	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:94395423G>C	ENST00000267594.5	+	3	1285	c.978G>C	c.(976-978)caG>caC	p.Q326H	FAM181A-AS1_ENST00000554742.1_RNA|FAM181A_ENST00000557000.2_Missense_Mutation_p.Q264H|FAM181A_ENST00000557719.1_Missense_Mutation_p.Q264H|FAM181A_ENST00000556222.1_Missense_Mutation_p.Q264H	NM_001207073.1|NM_001207074.1|NM_138344.4	NP_001194002.1|NP_001194003.1|NP_612353.3	Q8N9Y4	F181A_HUMAN	family with sequence similarity 181, member A	326								p.Q326H(1)		cervix(1)|endometrium(2)|large_intestine(8)|lung(4)|prostate(1)|skin(2)	18						GCCTGGGGCAGAAGGTGTGCA	0.647																																																	1	Substitution - Missense(1)	cervix(1)											32.0	36.0	34.0					14																	94395423		2203	4299	6502	SO:0001583	missense	90050			BC009073	CCDS9914.1, CCDS55939.1	14q32.12	2011-11-30	2008-07-22	2008-07-22	ENSG00000140067	ENSG00000140067			20491	protein-coding gene	gene with protein product			"""chromosome 14 open reading frame 152"""	C14orf152			Standard	NM_138344		Approved		uc021saz.1	Q8N9Y4	OTTHUMG00000171297	ENST00000267594.5:c.978G>C	14.37:g.94395423G>C	ENSP00000267594:p.Gln326His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD39|Q96GY1	Missense_Mutation	SNP	NULL	p.Q326H	ENST00000267594.5	37	c.978	CCDS9914.1	14	.	.	.	.	.	.	.	.	.	.	G	14.11	2.436744	0.43224	.	.	ENSG00000140067	ENST00000557719;ENST00000267594;ENST00000556222;ENST00000557000	T;T;T	0.33216	1.42;1.42;1.42	4.48	1.47	0.22746	.	0.408437	0.19311	N	0.117393	T	0.38427	0.1040	L	0.47716	1.5	0.31587	N	0.654354	D	0.64830	0.994	P	0.62740	0.906	T	0.43491	-0.9388	10	0.72032	D	0.01	0.1113	4.6098	0.12397	0.3537:0.153:0.4933:0.0	.	326	Q8N9Y4	F181A_HUMAN	H	264;326;264;315	ENSP00000451802:Q264H;ENSP00000267594:Q326H;ENSP00000451678:Q264H	ENSP00000267594:Q326H	Q	+	3	2	FAM181A	93465176	1.000000	0.71417	0.993000	0.49108	0.814000	0.46013	1.367000	0.34204	0.011000	0.14865	0.313000	0.20887	CAG	FAM181A	-	NULL		0.647	FAM181A-001	KNOWN	basic|CCDS	protein_coding	FAM181A	HGNC	protein_coding	OTTHUMT00000412840.1	G	NM_138344		94395423	+1	no_errors	ENST00000267594	ensembl	human	known	70_37	missense	SNP	0.999	C
FBXO25	26260	genome.wustl.edu	37	8	400077	400077	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:400077C>G	ENST00000276326.5	+	6	588	c.469C>G	c.(469-471)Caa>Gaa	p.Q157E	RP11-91J19.3_ENST00000607549.1_RNA|FBXO25_ENST00000382824.1_Missense_Mutation_p.Q90E|FBXO25_ENST00000350302.3_Missense_Mutation_p.Q157E|FBXO25_ENST00000352684.2_Missense_Mutation_p.Q90E	NM_183421.1	NP_904357.1	Q8TCJ0	FBX25_HUMAN	F-box protein 25	157					protein ubiquitination (GO:0016567)	nucleus (GO:0005634)|SCF ubiquitin ligase complex (GO:0019005)|ubiquitin ligase complex (GO:0000151)	ubiquitin-protein transferase activity (GO:0004842)	p.Q157E(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|pancreas(1)|prostate(1)	10		Ovarian(12;0.00965)|Colorectal(14;0.0815)|Myeloproliferative disorder(644;0.116)|all_neural(12;0.122)		Epithelial(5;3.14e-14)|OV - Ovarian serous cystadenocarcinoma(5;1.56e-07)|BRCA - Breast invasive adenocarcinoma(11;1.88e-06)		TAAAATCGTTCAAAAGGGTAA	0.338																																																	1	Substitution - Missense(1)	cervix(1)											101.0	102.0	101.0					8																	400077		2203	4300	6503	SO:0001583	missense	26260			AF174605	CCDS5952.1, CCDS5953.1, CCDS5954.1	8p23.3	2007-03-30	2004-06-15		ENSG00000147364	ENSG00000147364		"""F-boxes /  ""other"""""	13596	protein-coding gene	gene with protein product		609098	"""F-box only protein 25"""			10531035, 10531037	Standard	NM_012173		Approved	FBX25	uc003wox.3	Q8TCJ0	OTTHUMG00000090341	ENST00000276326.5:c.469C>G	8.37:g.400077C>G	ENSP00000276326:p.Gln157Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PJ83|Q7Z4V4|Q9UKB8	Missense_Mutation	SNP	superfamily_F-box_dom_cyclin-like	p.Q157E	ENST00000276326.5	37	c.469	CCDS5953.1	8	.	.	.	.	.	.	.	.	.	.	C	11.94	1.788257	0.31593	.	.	ENSG00000147364	ENST00000350302;ENST00000352684;ENST00000276326;ENST00000447233;ENST00000382824	T;T;T;T	0.18338	2.22;2.22;2.22;2.22	5.98	5.98	0.97165	.	0.249823	0.42420	D	0.000712	T	0.18173	0.0436	L	0.53249	1.67	0.34545	D	0.710699	B;B;B	0.28636	0.015;0.218;0.218	B;B;B	0.30572	0.022;0.117;0.117	T	0.11084	-1.0602	10	0.02654	T	1	-7.1649	17.9231	0.88973	0.0:1.0:0.0:0.0	.	90;157;157	Q8TCJ0-3;Q8TCJ0-2;Q8TCJ0	.;.;FBX25_HUMAN	E	157;90;157;157;90	ENSP00000342077:Q157E;ENSP00000341345:Q90E;ENSP00000276326:Q157E;ENSP00000372274:Q90E	ENSP00000276326:Q157E	Q	+	1	0	FBXO25	390077	0.488000	0.25996	0.993000	0.49108	0.962000	0.63368	2.854000	0.48325	2.833000	0.97629	0.655000	0.94253	CAA	FBXO25	-	NULL		0.338	FBXO25-001	KNOWN	basic|CCDS	protein_coding	FBXO25	HGNC	protein_coding	OTTHUMT00000206710.2	C	NM_012173		400077	+1	no_errors	ENST00000276326	ensembl	human	known	70_37	missense	SNP	0.978	G
FBXW7	55294	genome.wustl.edu	37	4	153247245	153247245	+	Nonsense_Mutation	SNP	A	A	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:153247245A>T	ENST00000281708.4	-	10	2786	c.1557T>A	c.(1555-1557)taT>taA	p.Y519*	FBXW7_ENST00000393956.3_Nonsense_Mutation_p.Y343*|FBXW7_ENST00000296555.5_Nonsense_Mutation_p.Y401*|FBXW7_ENST00000263981.5_Nonsense_Mutation_p.Y439*|FBXW7_ENST00000603841.1_Nonsense_Mutation_p.Y519*|FBXW7_ENST00000603548.1_Nonsense_Mutation_p.Y519*	NM_033632.3	NP_361014.1	Q969H0	FBXW7_HUMAN	F-box and WD repeat domain containing 7, E3 ubiquitin protein ligase	519					cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|lipid homeostasis (GO:0055088)|lung development (GO:0030324)|negative regulation of DNA endoreduplication (GO:0032876)|negative regulation of hepatocyte proliferation (GO:2000346)|negative regulation of Notch signaling pathway (GO:0045746)|negative regulation of SREBP signaling pathway (GO:2000639)|negative regulation of triglyceride biosynthetic process (GO:0010868)|Notch signaling pathway (GO:0007219)|positive regulation of epidermal growth factor-activated receptor activity (GO:0045741)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|positive regulation of proteasomal protein catabolic process (GO:1901800)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:2000060)|positive regulation of ubiquitin-protein transferase activity (GO:0051443)|protein stabilization (GO:0050821)|protein ubiquitination (GO:0016567)|regulation of cell cycle G1/S phase transition (GO:1902806)|regulation of lipid storage (GO:0010883)|regulation of protein localization (GO:0032880)|SCF-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031146)|sister chromatid cohesion (GO:0007062)|vasculature development (GO:0001944)|vasculogenesis (GO:0001570)|viral process (GO:0016032)	cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Parkin-FBXW7-Cul1 ubiquitin ligase complex (GO:1990452)|protein complex (GO:0043234)|SCF ubiquitin ligase complex (GO:0019005)	cyclin binding (GO:0030332)|identical protein binding (GO:0042802)|protein binding, bridging (GO:0030674)|sequence-specific DNA binding transcription factor activity (GO:0003700)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activator activity (GO:0097027)	p.Y519*(2)|p.Y401*(1)|p.Y439*(1)|p.Y280*(1)|p.?(1)		NS(1)|biliary_tract(8)|bone(1)|breast(5)|central_nervous_system(6)|cervix(2)|endometrium(36)|haematopoietic_and_lymphoid_tissue(159)|kidney(6)|large_intestine(155)|lung(31)|ovary(10)|pancreas(3)|prostate(2)|skin(6)|stomach(16)|upper_aerodigestive_tract(9)|urinary_tract(6)	462	all_hematologic(180;0.093)	Acute lymphoblastic leukemia(8;0.000629)|all_hematologic(8;0.067)				CCATAAAATCATATGCTCCAC	0.438			"""Mis, N, D, F"""		"""colorectal, endometrial, T-ALL"""																																			Rec	yes		4	4q31.3	55294	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"""		"""E, L"""	6	Substitution - Nonsense(5)|Unknown(1)	cervix(5)|haematopoietic_and_lymphoid_tissue(1)											197.0	189.0	192.0					4																	153247245		2203	4300	6503	SO:0001587	stop_gained	55294			AF411971	CCDS3777.1, CCDS3778.1, CCDS34078.1, CCDS64082.1	4q31.23	2013-01-09	2012-02-23					"""F-boxes / WD-40 domains"", ""WD repeat domain containing"""	16712	protein-coding gene	gene with protein product	"""archipelago homolog (Drosophila)"""	606278	"""F-box and WD-40 domain protein 7 (archipelago homolog, Drosophila)"", ""F-box and WD repeat domain containing 7"""			10531037, 11425854	Standard	NM_018315		Approved	AGO, FLJ11071, SEL-10, SEL10, FBW7, FBX30, CDC4, FBXW6	uc003ims.3	Q969H0		ENST00000281708.4:c.1557T>A	4.37:g.153247245A>T	ENSP00000281708:p.Tyr519*	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLP9|Q68DR0|Q96A16|Q96LE0|Q96RI2|Q9NUX6	Nonsense_Mutation	SNP	pfam_WD40_repeat,pfam_F-box_dom_cyclin-like,superfamily_WD40_repeat_dom,superfamily_F-box_dom_cyclin-like,smart_F-box_dom_cyclin-like,smart_WD40_repeat,pfscan_F-box_dom_cyclin-like,pfscan_WD40_repeat,pfscan_WD40_repeat_dom,prints_G-protein_beta_WD-40_rep	p.Y519*	ENST00000281708.4	37	c.1557	CCDS3777.1	4	.	.	.	.	.	.	.	.	.	.	A	36	5.927683	0.97110	.	.	ENSG00000109670	ENST00000281708;ENST00000296555;ENST00000263981;ENST00000393956	.	.	.	5.72	3.28	0.37604	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-21.7378	9.1729	0.37093	0.798:0.0:0.202:0.0	.	.	.	.	X	519;401;439;343	.	ENSP00000263981:Y439X	Y	-	3	2	FBXW7	153466695	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	3.713000	0.54882	1.087000	0.41251	0.528000	0.53228	TAT	FBXW7	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.438	FBXW7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FBXW7	HGNC	protein_coding	OTTHUMT00000469956.1	A			153247245	-1	no_errors	ENST00000281708	ensembl	human	known	70_37	nonsense	SNP	1.000	T
FGF21	26291	genome.wustl.edu	37	19	49260187	49260187	+	Silent	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:49260187C>G	ENST00000593756.1	+	3	812	c.240C>G	c.(238-240)ctC>ctG	p.L80L	FUT1_ENST00000310160.3_5'Flank|FGF21_ENST00000222157.3_Silent_p.L80L			Q9NSA1	FGF21_HUMAN	fibroblast growth factor 21	80					cell-cell signaling (GO:0007267)|positive regulation of cell proliferation (GO:0008284)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of glucose import (GO:0046326)|positive regulation of low-density lipoprotein particle receptor biosynthetic process (GO:0045716)|positive regulation of MAPKKK cascade by fibroblast growth factor receptor signaling pathway (GO:0090080)|regulation of low-density lipoprotein particle clearance (GO:0010988)|signal transduction (GO:0007165)	extracellular region (GO:0005576)		p.L80L(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(2)|upper_aerodigestive_tract(1)	8		all_lung(116;1.7e-06)|all_epithelial(76;3.52e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		OV - Ovarian serous cystadenocarcinoma(262;0.000134)|all cancers(93;0.000348)|Epithelial(262;0.019)|GBM - Glioblastoma multiforme(486;0.022)		CCTTAGGTCTCCTGCAGCTGA	0.597																																																	1	Substitution - coding silent(1)	cervix(1)											118.0	120.0	120.0					19																	49260187		2203	4300	6503	SO:0001819	synonymous_variant	26291			AB021975	CCDS12734.1	19q13.33	2012-09-20			ENSG00000105550	ENSG00000105550			3678	protein-coding gene	gene with protein product		609436				10858549	Standard	XM_005258731		Approved		uc002pko.1	Q9NSA1		ENST00000593756.1:c.240C>G	19.37:g.49260187C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N683	Silent	SNP	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,pirsf_Fibroblast_GF_15/19/21,prints_GF_heparin-bd,prints_IL1_HBGF	p.L80	ENST00000593756.1	37	c.240	CCDS12734.1	19																																																																																			FGF21	-	pfam_IL1_HBGF,superfamily_Cytokine_IL1-like,smart_IL1_HBGF,pirsf_Fibroblast_GF_15/19/21		0.597	FGF21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FGF21	HGNC	protein_coding	OTTHUMT00000466200.1	C			49260187	+1	no_errors	ENST00000222157	ensembl	human	known	70_37	silent	SNP	0.986	G
FHDC1	85462	genome.wustl.edu	37	4	153864414	153864414	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:153864414G>A	ENST00000511601.1	+	2	393	c.205G>A	c.(205-207)Gag>Aag	p.E69K	FHDC1_ENST00000260008.3_Missense_Mutation_p.E69K			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	69								p.E69K(1)	ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					ACTTCCTGGGGAGCCTCCCAT	0.577																																																	1	Substitution - Missense(1)	cervix(1)											26.0	26.0	26.0					4																	153864414		2198	4287	6485	SO:0001583	missense	85462			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.205G>A	4.37:g.153864414G>A	ENSP00000427567:p.Glu69Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.E69K	ENST00000511601.1	37	c.205	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	G	5.555	0.287353	0.10513	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.28895	1.59;1.59	4.85	4.0	0.46444	Actin-binding FH2 (1);	2.808940	0.01051	N	0.004469	T	0.18800	0.0451	N	0.08118	0	0.21416	N	0.999695	B	0.25904	0.137	B	0.20767	0.031	T	0.24584	-1.0156	10	0.09084	T	0.74	.	11.3669	0.49677	0.0902:0.0:0.9097:0.0	.	69	Q9C0D6	FHDC1_HUMAN	K	69	ENSP00000427567:E69K;ENSP00000260008:E69K	ENSP00000260008:E69K	E	+	1	0	FHDC1	154083864	0.999000	0.42202	0.185000	0.23176	0.400000	0.30750	3.168000	0.50801	1.182000	0.42928	0.563000	0.77884	GAG	FHDC1	-	superfamily_FH2_actin-bd		0.577	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	G	NM_033393		153864414	+1	no_errors	ENST00000260008	ensembl	human	known	70_37	missense	SNP	0.822	A
FRMD5	84978	genome.wustl.edu	37	15	44166325	44166325	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr15:44166325C>T	ENST00000417257.1	-	14	1647	c.1471G>A	c.(1471-1473)Gag>Aag	p.E491K	FRMD5_ENST00000484674.1_Missense_Mutation_p.E397K|FRMD5_ENST00000402883.1_Missense_Mutation_p.E491K	NM_032892.3	NP_116281.2	Q7Z6J6	FRMD5_HUMAN	FERM domain containing 5	491						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extrinsic component of membrane (GO:0019898)|integral component of membrane (GO:0016021)		p.E491K(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(1)|lung(5)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	14		all_cancers(109;2.29e-15)|all_epithelial(112;9.98e-13)|Lung NSC(122;4.89e-08)|all_lung(180;5.08e-07)|Melanoma(134;0.0275)		all cancers(107;8.63e-20)|GBM - Glioblastoma multiforme(94;3.63e-06)		ACCTGTTCCTCCTCGGGCCCG	0.567																																																	1	Substitution - Missense(1)	cervix(1)											125.0	103.0	110.0					15																	44166325		2198	4298	6496	SO:0001583	missense	84978			BC007796	CCDS10107.2, CCDS73715.1, CCDS73716.1	15q15.3	2005-08-09			ENSG00000171877	ENSG00000171877			28214	protein-coding gene	gene with protein product							Standard	XM_005254729		Approved	MGC14161	uc001ztl.3	Q7Z6J6	OTTHUMG00000060475	ENST00000417257.1:c.1471G>A	15.37:g.44166325C>T	ENSP00000403067:p.Glu491Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NBG4	Missense_Mutation	SNP	pfam_FERM_N,pfam_FERM_central,pfam_FERM-adjacent,pfam_FERM_PH-like_C,superfamily_FERM_central,smart_Band_41_domain,prints_Band_41_fam,prints_Ez/rad/moesin,pfscan_FERM_domain	p.E491K	ENST00000417257.1	37	c.1471	CCDS10107.2	15	.	.	.	.	.	.	.	.	.	.	C	3.861	-0.029965	0.07543	.	.	ENSG00000171877	ENST00000417257;ENST00000402883;ENST00000449926	D;D;D	0.84370	-1.64;-1.8;-1.84	6.03	4.09	0.47781	.	0.269102	0.36628	N	0.002487	T	0.76716	0.4026	N	0.22421	0.69	0.25736	N	0.985216	B;B;B;B	0.23249	0.082;0.049;0.012;0.01	B;B;B;B	0.21708	0.036;0.016;0.011;0.022	T	0.61417	-0.7067	10	0.29301	T	0.29	.	15.9267	0.79624	0.0:0.4771:0.5229:0.0	.	476;491;491;164	Q7Z6J6-2;Q7Z6J6;B5MC67;A8K1U8	.;FRMD5_HUMAN;.;.	K	491;491;457	ENSP00000403067:E491K;ENSP00000384142:E491K;ENSP00000399684:E457K	ENSP00000384142:E491K	E	-	1	0	FRMD5	41953617	0.971000	0.33674	1.000000	0.80357	0.979000	0.70002	1.354000	0.34056	0.815000	0.34398	0.655000	0.94253	GAG	FRMD5	-	NULL		0.567	FRMD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMD5	HGNC	protein_coding	OTTHUMT00000133879.1	C	NM_032892		44166325	-1	no_errors	ENST00000417257	ensembl	human	known	70_37	missense	SNP	1.000	T
FRY	10129	genome.wustl.edu	37	13	32749764	32749764	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr13:32749764G>C	ENST00000380250.3	+	20	2912	c.2416G>C	c.(2416-2418)Gat>Cat	p.D806H		NM_023037.2	NP_075463.2	Q5TBA9	FRY_HUMAN	furry homolog (Drosophila)	806						cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)		p.D806H(1)		NS(3)|breast(4)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(31)|lung(50)|ovary(5)|pancreas(1)|prostate(6)|skin(9)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	132		Lung SC(185;0.0271)		all cancers(112;4.81e-05)|Epithelial(112;0.000656)|OV - Ovarian serous cystadenocarcinoma(117;0.0123)|BRCA - Breast invasive adenocarcinoma(63;0.0295)|GBM - Glioblastoma multiforme(144;0.104)		AGCAGTTTCGGATTCAGTAAG	0.378																																																	1	Substitution - Missense(1)	cervix(1)											149.0	136.0	140.0					13																	32749764		1862	4104	5966	SO:0001583	missense	10129			AL049784	CCDS41875.1	13q13.1	2008-02-05	2005-11-24	2005-11-24	ENSG00000073910	ENSG00000073910			20367	protein-coding gene	gene with protein product		614818	"""chromosome 13 open reading frame 14"""	C13orf14		14702039, 8812419	Standard	NM_023037		Approved	bA37E23.1, 13CDNA73, CG003	uc001utx.3	Q5TBA9	OTTHUMG00000016696	ENST00000380250.3:c.2416G>C	13.37:g.32749764G>C	ENSP00000369600:p.Asp806His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9Y3N6	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.D806H	ENST00000380250.3	37	c.2416	CCDS41875.1	13	.	.	.	.	.	.	.	.	.	.	G	27.6	4.843418	0.91197	.	.	ENSG00000073910	ENST00000380250	T	0.26518	1.73	5.9	5.9	0.94986	.	0.000000	0.85682	D	0.000000	T	0.54334	0.1852	M	0.74881	2.28	0.80722	D	1	D	0.69078	0.997	D	0.71414	0.973	T	0.53920	-0.8370	10	0.72032	D	0.01	.	20.2789	0.98501	0.0:0.0:1.0:0.0	.	806	Q5TBA9	FRY_HUMAN	H	806	ENSP00000369600:D806H	ENSP00000369600:D806H	D	+	1	0	FRY	31647764	1.000000	0.71417	0.979000	0.43373	0.967000	0.64934	9.402000	0.97298	2.788000	0.95919	0.650000	0.86243	GAT	FRY	-	superfamily_ARM-type_fold		0.378	FRY-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRY	HGNC	protein_coding	OTTHUMT00000044405.1	G	NM_023037		32749764	+1	no_errors	ENST00000380250	ensembl	human	known	70_37	missense	SNP	1.000	C
FRYL	285527	genome.wustl.edu	37	4	48537794	48537794	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:48537794C>T	ENST00000503238.1	-	45	6443	c.6444G>A	c.(6442-6444)atG>atA	p.M2148I	FRYL_ENST00000507873.2_5'UTR|FRYL_ENST00000264319.7_5'UTR|FRYL_ENST00000537810.1_Missense_Mutation_p.M2148I|FRYL_ENST00000358350.4_Missense_Mutation_p.M2148I			O94915	FRYL_HUMAN	FRY-like	2148					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)			p.M2148I(1)		breast(2)|central_nervous_system(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(21)|lung(38)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(1)	91						TGTACAAACTCATCATGTGTG	0.368																																																	1	Substitution - Missense(1)	cervix(1)											103.0	104.0	103.0					4																	48537794		1904	4131	6035	SO:0001583	missense	285527			AL833170	CCDS43227.1	4p12	2011-08-03	2006-11-17	2005-11-24	ENSG00000075539	ENSG00000075539			29127	protein-coding gene	gene with protein product			"""KIAA0826"", ""furry homolog-like (Drosophila)"""	KIAA0826		10048485	Standard	NM_015030		Approved	DKFZp686E205	uc003gyh.1	O94915	OTTHUMG00000160608	ENST00000503238.1:c.6444G>A	4.37:g.48537794C>T	ENSP00000426064:p.Met2148Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O95640|Q8WTZ5|Q9NT40	Missense_Mutation	SNP	superfamily_ARM-type_fold	p.M2148I	ENST00000503238.1	37	c.6444	CCDS43227.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	34|34	5.353771|5.353771	0.95830|0.95830	.|.	.|.	ENSG00000075539|ENSG00000075539	ENST00000514617|ENST00000503238;ENST00000358350;ENST00000537810	.|T;T;T	.|0.28666	.|1.6;1.6;1.6	5.98|5.98	5.98|5.98	0.97165|0.97165	.|Armadillo-type fold (1);	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.59555|0.59555	0.2202|0.2202	M|M	0.76170|0.76170	2.325|2.325	0.80722|0.80722	D|D	1|1	.|D;D;D	.|0.69078	.|0.969;0.983;0.997	.|D;D;D	.|0.81914	.|0.968;0.992;0.995	T|T	0.58901|0.58901	-0.7554|-0.7554	5|10	.|0.66056	.|D	.|0.02	.|.	20.4366|20.4366	0.99092|0.99092	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|978;2148;2148	.|Q6ZR29;O94915;F5GX82	.|.;FRYL_HUMAN;.	K|I	1018|2148	.|ENSP00000426064:M2148I;ENSP00000351113:M2148I;ENSP00000441114:M2148I	.|ENSP00000351113:M2148I	E|M	-|-	1|3	0|0	FRYL|FRYL	48232551|48232551	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.943000|0.943000	0.58893|0.58893	7.776000|7.776000	0.85560|0.85560	2.837000|2.837000	0.97791|0.97791	0.591000|0.591000	0.81541|0.81541	GAG|ATG	FRYL	-	superfamily_ARM-type_fold		0.368	FRYL-011	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FRYL	HGNC	protein_coding	OTTHUMT00000369265.2	C			48537794	-1	no_errors	ENST00000358350	ensembl	human	known	70_37	missense	SNP	1.000	T
GADD45B	4616	genome.wustl.edu	37	19	2477087	2477087	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:2477087C>T	ENST00000215631.4	+	3	439	c.207C>T	c.(205-207)atC>atT	p.I69I	GADD45B_ENST00000587345.1_Silent_p.I69I	NM_015675.3	NP_056490.2	O75293	GA45B_HUMAN	growth arrest and DNA-damage-inducible, beta	69					activation of MAPKK activity (GO:0000186)|activation of MAPKKK activity (GO:0000185)|apoptotic process (GO:0006915)|cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of apoptotic process (GO:0043065)|positive regulation of JNK cascade (GO:0046330)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of cell cycle (GO:0051726)|response to stress (GO:0006950)	cytoplasm (GO:0005737)|nucleus (GO:0005634)		p.I69I(1)		cervix(2)|lung(1)|ovary(1)	4		Hepatocellular(1079;0.137)		UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		AGGATGACATCGCCCTGCAAA	0.622											OREG0025141	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					1	Substitution - coding silent(1)	cervix(1)											109.0	84.0	92.0					19																	2477087		2203	4300	6503	SO:0001819	synonymous_variant	4616			AF090950	CCDS32868.1	19p13.3	2012-10-02			ENSG00000099860	ENSG00000099860			4096	protein-coding gene	gene with protein product	"""myeloid differentiation primary response"", ""growth arrest and DNA-damage-inducible beta"""	604948		MYD118		1899477, 9827804	Standard	NM_015675		Approved	GADD45BETA, DKFZP566B133	uc002lwb.2	O75293	OTTHUMG00000180434	ENST00000215631.4:c.207C>T	19.37:g.2477087C>T		Somatic	603	WXS	Illumina HiSeq	Phase_IV	A8KAM2|O75960|Q17R46	Silent	SNP	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45	p.I69	ENST00000215631.4	37	c.207	CCDS32868.1	19																																																																																			GADD45B	-	pfam_Ribosomal_L7Ae/L30e/S12e/Gad45		0.622	GADD45B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GADD45B	HGNC	protein_coding	OTTHUMT00000451337.1	C	NM_015675		2477087	+1	no_errors	ENST00000215631	ensembl	human	known	70_37	silent	SNP	0.999	T
GLRA4	441509	genome.wustl.edu	37	X	102979469	102979469	+	Splice_Site	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chrX:102979469C>T	ENST00000372617.4	-	3	690	c.270G>A	c.(268-270)atG>atA	p.M90I	GLRA4_ENST00000469567.1_5'Flank	NM_001024452.2	NP_001019623.2	Q5JXX5	GLRA4_HUMAN	glycine receptor, alpha 4	90						cell junction (GO:0030054)|chloride channel complex (GO:0034707)|integral component of plasma membrane (GO:0005887)|postsynaptic membrane (GO:0045211)	chloride channel activity (GO:0005254)|extracellular ligand-gated ion channel activity (GO:0005230)|glycine binding (GO:0016594)|transmitter-gated ion channel activity (GO:0022824)	p.M90I(2)		cervix(1)|endometrium(2)|large_intestine(2)|lung(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	21						GATCCCTTACCATTGTGGTCT	0.547																																																	2	Substitution - Missense(2)	cervix(2)											86.0	87.0	86.0					X																	102979469		2069	4206	6275	SO:0001630	splice_region_variant	441509			Z93848	CCDS43980.2	Xq22.2	2012-01-16			ENSG00000188828	ENSG00000188828		"""Ligand-gated ion channels / Glycine receptors"""	31715	protein-coding gene	gene with protein product							Standard	NM_001024452		Approved		uc011mse.2	Q5JXX5	OTTHUMG00000022110	ENST00000372617.4:c.270+1G>A	X.37:g.102979469C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Neur_chan_lig-bd,pfam_Neurotrans-gated_channel_TM,superfamily_Neur_chan_lig-bd,superfamily_Neurotrans-gated_channel_TM,prints_GABAA_rcpt,prints_Glycine_rcpt_A,prints_Neur_channel,tigrfam_Neur_channel	p.M90I	ENST00000372617.4	37	c.270	CCDS43980.2	X	.	.	.	.	.	.	.	.	.	.	C	22.4	4.280467	0.80692	.	.	ENSG00000188828	ENST00000372617	T	0.79141	-1.24	5.79	5.79	0.91817	Neurotransmitter-gated ion-channel ligand-binding (3);	0.039115	0.85682	D	0.000000	D	0.91257	0.7244	H	0.95187	3.635	0.58432	D	0.999991	D;D	0.89917	1.0;1.0	D;D	0.79784	0.993;0.993	D	0.93440	0.6793	9	.	.	.	.	14.2505	0.66016	0.0:1.0:0.0:0.0	.	90;49	Q5JXX5;B9WSA6	GLRA4_HUMAN;.	I	90	ENSP00000361700:M90I	.	M	-	3	0	GLRA4	102866125	1.000000	0.71417	1.000000	0.80357	0.777000	0.43975	7.506000	0.81665	2.440000	0.82611	0.529000	0.55759	ATG	GLRA4	-	pfam_Neur_chan_lig-bd,superfamily_Neur_chan_lig-bd,tigrfam_Neur_channel		0.547	GLRA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLRA4	HGNC	protein_coding	OTTHUMT00000057742.2	C	NM_001024452	Missense_Mutation	102979469	-1	no_errors	ENST00000372617	ensembl	human	known	70_37	missense	SNP	1.000	T
GPR183	1880	genome.wustl.edu	37	13	99948184	99948184	+	Missense_Mutation	SNP	A	A	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr13:99948184A>C	ENST00000376414.4	-	2	299	c.216T>G	c.(214-216)aaT>aaG	p.N72K	UBAC2_ENST00000403766.3_Intron|UBAC2_ENST00000376440.2_Intron	NM_004951.4	NP_004942.1	P32249	GP183_HUMAN	G protein-coupled receptor 183	72					G-protein coupled receptor signaling pathway (GO:0007186)|humoral immune response (GO:0006959)|immune response (GO:0006955)|mature B cell differentiation involved in immune response (GO:0002313)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|oxysterol binding (GO:0008142)	p.N72K(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(5)|lung(10)|prostate(1)|skin(1)	23						AAATCACCAAATTTGTTGAAT	0.433																																																	1	Substitution - Missense(1)	cervix(1)											116.0	110.0	112.0					13																	99948184		2203	4300	6503	SO:0001583	missense	1880			L08177	CCDS9492.1	13q32.3	2012-08-21	2008-07-21	2008-07-21	ENSG00000169508	ENSG00000169508		"""GPCR / Class A : Orphans"""	3128	protein-coding gene	gene with protein product	"""EBV-induced G-protein coupled receptor 2"""	605741	"""Epstein-Barr virus induced gene 2 (lymphocyte-specific G protein-coupled receptor)"""	EBI2		8383238	Standard	NM_004951		Approved		uc001vog.3	P32249	OTTHUMG00000017263	ENST00000376414.4:c.216T>G	13.37:g.99948184A>C	ENSP00000365596:p.Asn72Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8N5|Q53F99|Q5JUH7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn,prints_P2_purnocptor	p.N72K	ENST00000376414.4	37	c.216	CCDS9492.1	13	.	.	.	.	.	.	.	.	.	.	A	18.19	3.568012	0.65651	.	.	ENSG00000169508	ENST00000376414	T	0.51071	0.72	5.81	-4.57	0.03421	GPCR, rhodopsin-like superfamily (1);	0.000000	0.85682	D	0.000000	T	0.74764	0.3759	H	0.97051	3.93	0.45607	D	0.998544	D	0.89917	1.0	D	0.87578	0.998	T	0.82645	-0.0355	9	.	.	.	.	15.6099	0.76707	0.4163:0.0:0.5837:0.0	.	72	P32249	GP183_HUMAN	K	72	ENSP00000365596:N72K	.	N	-	3	2	GPR183	98746185	0.547000	0.26465	0.086000	0.20670	0.989000	0.77384	-0.097000	0.11042	-0.596000	0.05821	0.533000	0.62120	AAT	GPR183	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfam_7TM_GPCR_serpentine_rcpt_Srx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.433	GPR183-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR183	HGNC	protein_coding	OTTHUMT00000045582.2	A	NM_004951		99948184	-1	no_errors	ENST00000376414	ensembl	human	known	70_37	missense	SNP	0.796	C
GRM8	2918	genome.wustl.edu	37	7	126542611	126542611	+	Missense_Mutation	SNP	T	T	C	rs553795874		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:126542611T>C	ENST00000339582.2	-	6	1949	c.1141A>G	c.(1141-1143)Ata>Gta	p.I381V	GRM8_ENST00000358373.3_Missense_Mutation_p.I381V|GRM8_ENST00000405249.1_Missense_Mutation_p.I381V|GRM8_ENST00000444921.2_Missense_Mutation_p.I381V|GRM8_ENST00000480995.1_5'UTR			O00222	GRM8_HUMAN	glutamate receptor, metabotropic 8	381					adenylate cyclase-inhibiting G-protein coupled glutamate receptor signaling pathway (GO:0007196)|negative regulation of cAMP biosynthetic process (GO:0030818)|regulation of synaptic transmission, glutamatergic (GO:0051966)|sensory perception of smell (GO:0007608)|visual perception (GO:0007601)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	G-protein coupled receptor activity (GO:0004930)|glutamate receptor activity (GO:0008066)|group III metabotropic glutamate receptor activity (GO:0001642)	p.I381V(2)		breast(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(4)|large_intestine(16)|lung(62)|ovary(5)|pancreas(1)|prostate(1)|skin(14)|stomach(1)|upper_aerodigestive_tract(6)|urinary_tract(4)	125		Prostate(267;0.186)				CATTTCTTTATATGACTGTTC	0.358										HNSCC(24;0.065)			T|||	1	0.000199681	0.0	0.0	5008	,	,		16632	0.0		0.0	False		,,,				2504	0.001																2	Substitution - Missense(2)	cervix(2)											64.0	65.0	65.0					7																	126542611		2203	4298	6501	SO:0001583	missense	2918				CCDS5794.1, CCDS47696.1	7q31.3-q32.1	2012-08-29			ENSG00000179603	ENSG00000179603		"""GPCR / Class C : Glutamate receptors, metabotropic"", ""Glutamate receptors"""	4600	protein-coding gene	gene with protein product		601116				8824806	Standard	NM_000845		Approved	GLUR8, GPRC1H, mGlu8, MGLUR8	uc003vlr.2	O00222	OTTHUMG00000022888	ENST00000339582.2:c.1141A>G	7.37:g.126542611T>C	ENSP00000344173:p.Ile381Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0Y3|B0FZ74|B0M0L0|O15493|O95945|O95946|Q3MIV9|Q52M02|Q6J165	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_GPCR_3_C,pfam_GPCR_3_9-Cys_dom,pfscan_GPCR_3_C,prints_GPCR_3,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt,prints_GPCR_3_mtglu_rcpt_4	p.I381V	ENST00000339582.2	37	c.1141	CCDS5794.1	7	.	.	.	.	.	.	.	.	.	.	T	5.750	0.322883	0.10900	.	.	ENSG00000179603	ENST00000339582;ENST00000444921;ENST00000358373;ENST00000405249	D;D;D;D	0.85702	-2.02;-2.02;-2.02;-2.02	4.88	2.39	0.29439	Extracellular ligand-binding receptor (1);	0.364566	0.28595	N	0.014784	T	0.63260	0.2496	N	0.11064	0.09	0.30367	N	0.783283	B;B;B	0.15141	0.002;0.012;0.001	B;B;B	0.11329	0.006;0.006;0.006	T	0.49224	-0.8962	10	0.10377	T	0.69	.	2.6692	0.05062	0.1466:0.081:0.1526:0.6198	.	381;381;381	O00222-3;O00222-2;O00222	.;.;GRM8_HUMAN	V	381	ENSP00000344173:I381V;ENSP00000409790:I381V;ENSP00000351142:I381V;ENSP00000385731:I381V	ENSP00000344173:I381V	I	-	1	0	GRM8	126329847	1.000000	0.71417	0.984000	0.44739	0.995000	0.86356	1.839000	0.39220	0.197000	0.20387	0.418000	0.28097	ATA	GRM8	-	pfam_ANF_lig-bd_rcpt,prints_GPCR_3_mtglu_rcpt_8,prints_GPCR_3_mtglu_rcpt_4		0.358	GRM8-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRM8	HGNC	protein_coding	OTTHUMT00000059209.4	T			126542611	-1	no_errors	ENST00000339582	ensembl	human	known	70_37	missense	SNP	0.996	C
HAX1	10456	genome.wustl.edu	37	1	154245822	154245822	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:154245822C>T	ENST00000328703.7	+	2	277	c.64C>T	c.(64-66)Ccc>Tcc	p.P22S	HAX1_ENST00000483970.2_Missense_Mutation_p.P22S|HAX1_ENST00000457918.2_Intron|HAX1_ENST00000532105.1_Intron	NM_006118.3	NP_006109.2	O00165	HAX1_HUMAN	HCLS1 associated protein X-1	22	Required for localization in mitochondria. {ECO:0000250}.				cellular response to cytokine stimulus (GO:0071345)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of actin filament polymerization (GO:0030833)|regulation of apoptotic process (GO:0042981)|regulation of mitochondrion degradation (GO:1903146)|regulation of protein targeting to mitochondrion (GO:1903214)	actin cytoskeleton (GO:0015629)|cytoplasmic vesicle (GO:0031410)|endoplasmic reticulum (GO:0005783)|lamellipodium (GO:0030027)|membrane (GO:0016020)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|sarcoplasmic reticulum (GO:0016529)|transcription factor complex (GO:0005667)	interleukin-1 binding (GO:0019966)|protein N-terminus binding (GO:0047485)	p.P22S(2)		cervix(1)|endometrium(2)|large_intestine(2)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	15	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			CCACAGAGATCCCTTTTTTGG	0.488									Kostmann syndrome																																								2	Substitution - Missense(2)	cervix(1)|lung(1)											70.0	71.0	70.0					1																	154245822		2203	4300	6503	SO:0001583	missense	10456	Familial Cancer Database	Kostmann Infantile Agranulocytosis, Severe Congenital Neutropenia, Congenital Agranulocytosis	U68566	CCDS1064.1, CCDS44230.1	1q21.3	2014-09-17			ENSG00000143575	ENSG00000143575			16915	protein-coding gene	gene with protein product	"""HCLS1 (and PKD2) associated protein"""	605998				9058808, 10760273	Standard	NM_006118		Approved	HS1BP1, HCLSBP1	uc001fes.3	O00165	OTTHUMG00000035978	ENST00000328703.7:c.64C>T	1.37:g.154245822C>T	ENSP00000329002:p.Pro22Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8W4W9|A8W4X0|B4DUJ7|Q5VYD5|Q5VYD7|Q96AU4|Q9BS80	Missense_Mutation	SNP	pirsf_HS1--assoc_X-1	p.P22S	ENST00000328703.7	37	c.64	CCDS1064.1	1	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970654	0.92919	.	.	ENSG00000143575	ENST00000328703;ENST00000483970;ENST00000435087	T;T;T	0.44083	0.93;0.93;0.93	5.58	5.58	0.84498	.	0.000000	0.85682	D	0.000000	T	0.61937	0.2387	M	0.80183	2.485	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.65240	-0.6216	10	0.72032	D	0.01	-13.9636	16.6434	0.85138	0.0:1.0:0.0:0.0	.	22;22	O00165-2;O00165	.;HAX1_HUMAN	S	22	ENSP00000329002:P22S;ENSP00000435088:P22S;ENSP00000394920:P22S	ENSP00000329002:P22S	P	+	1	0	HAX1	152512446	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.721000	0.47260	2.776000	0.95493	0.655000	0.94253	CCC	HAX1	-	pirsf_HS1--assoc_X-1		0.488	HAX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HAX1	HGNC	protein_coding	OTTHUMT00000087650.1	C	NM_006118		154245822	+1	no_errors	ENST00000483970	ensembl	human	known	70_37	missense	SNP	1.000	T
HELQ	113510	genome.wustl.edu	37	4	84361036	84361036	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:84361036C>T	ENST00000295488.3	-	8	1950	c.1788G>A	c.(1786-1788)atG>atA	p.M596I	HELQ_ENST00000510985.1_Missense_Mutation_p.M529I	NM_133636.2	NP_598375	Q8TDG4	HELQ_HUMAN	helicase, POLQ-like	596	Helicase C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00542}.				double-strand break repair via homologous recombination (GO:0000724)	nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|nucleic acid binding (GO:0003676)	p.M596I(1)		breast(1)|cervix(2)|endometrium(2)|kidney(2)|large_intestine(10)|lung(17)|ovary(2)|skin(2)	38						ATTTGCATATCATTTCTGCTA	0.294								Other identified genes with known or suspected DNA repair function																																									1	Substitution - Missense(1)	cervix(1)											45.0	48.0	47.0					4																	84361036		2203	4298	6501	SO:0001583	missense	113510			AF436845	CCDS3603.1, CCDS75158.1	4q21.23	2009-02-26			ENSG00000163312	ENSG00000163312			18536	protein-coding gene	gene with protein product		606769				11751861	Standard	XM_005262711		Approved	Hel308	uc003hom.3	Q8TDG4	OTTHUMG00000130423	ENST00000295488.3:c.1788G>A	4.37:g.84361036C>T	ENSP00000295488:p.Met596Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q05DF9|Q502W9|Q659B8|Q6ZQX4|Q6ZTS4|Q96EX7	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,superfamily_DNA_repair_Rad51/TF_NusA_a-hlx,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.M596I	ENST00000295488.3	37	c.1788	CCDS3603.1	4	.	.	.	.	.	.	.	.	.	.	C	27.8	4.868335	0.91587	.	.	ENSG00000163312	ENST00000295488;ENST00000510985	T;T	0.41758	0.99;0.99	5.68	5.68	0.88126	Helicase, C-terminal (2);	0.037067	0.85682	D	0.000000	T	0.36826	0.0981	L	0.39147	1.195	0.80722	D	1	P;B	0.41159	0.74;0.409	B;B	0.36666	0.23;0.184	T	0.08249	-1.0731	10	0.25751	T	0.34	.	19.7785	0.96405	0.0:1.0:0.0:0.0	.	529;596	E3W980;Q8TDG4	.;HELQ_HUMAN	I	596;529	ENSP00000295488:M596I;ENSP00000424539:M529I	ENSP00000295488:M596I	M	-	3	0	HELQ	84580060	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.794000	0.85869	2.675000	0.91044	0.655000	0.94253	ATG	HELQ	-	smart_Helicase_C,pfscan_Helicase_C		0.294	HELQ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HELQ	HGNC	protein_coding	OTTHUMT00000252810.1	C	NM_133636		84361036	-1	no_errors	ENST00000295488	ensembl	human	known	70_37	missense	SNP	1.000	T
HELZ2	85441	genome.wustl.edu	37	20	62195546	62195546	+	Silent	SNP	G	G	A	rs547243901		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr20:62195546G>A	ENST00000467148.1	-	8	4698	c.4629C>T	c.(4627-4629)agC>agT	p.S1543S	HELZ2_ENST00000427522.2_Silent_p.S974S	NM_001037335.2	NP_001032412.2	Q9BYK8	HELZ2_HUMAN	helicase with zinc finger 2, transcriptional coactivator	1543					cellular lipid metabolic process (GO:0044255)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	membrane (GO:0016020)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|helicase activity (GO:0004386)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.S1543S(2)									GCGTGCACTCGCTGCCCACCA	0.652													G|||	1	0.000199681	0.0008	0.0	5008	,	,		15101	0.0		0.0	False		,,,				2504	0.0																2	Substitution - coding silent(2)	cervix(1)|central_nervous_system(1)											33.0	22.0	26.0					20																	62195546		2188	4295	6483	SO:0001819	synonymous_variant	85441			AB201715	CCDS13527.1, CCDS33508.1	20q13.33	2012-09-26			ENSG00000130589	ENSG00000130589			30021	protein-coding gene	gene with protein product	"""peroxisomal proliferator activated receptor A interacting complex 285"", ""PPARG-DBD-interacting protein 1"""	611265				11214970, 12189208, 16239304	Standard	NM_001037335		Approved	PDIP1, PRIC285, KIAA1769	uc002yfm.2	Q9BYK8	OTTHUMG00000032969	ENST00000467148.1:c.4629C>T	20.37:g.62195546G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3C2G2|Q4VXQ1|Q8TEF3|Q96ND3|Q9C094	Silent	SNP	pfam_RNase_II/R,smart_RNase_II/R	p.S1543	ENST00000467148.1	37	c.4629	CCDS33508.1	20																																																																																			HELZ2	-	pfam_RNase_II/R,smart_RNase_II/R		0.652	HELZ2-003	KNOWN	basic|appris_principal|CCDS	protein_coding	HELZ2	HGNC	protein_coding	OTTHUMT00000354127.1	G	NM_001037335		62195546	-1	no_errors	ENST00000467148	ensembl	human	known	70_37	silent	SNP	0.000	A
HGD	3081	genome.wustl.edu	37	3	120363243	120363243	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:120363243A>G	ENST00000283871.5	-	10	1156	c.697T>C	c.(697-699)Tgg>Cgg	p.W233R		NM_000187.3	NP_000178.2	Q93099	HGD_HUMAN	homogentisate 1,2-dioxygenase	233					cellular nitrogen compound metabolic process (GO:0034641)|L-phenylalanine catabolic process (GO:0006559)|small molecule metabolic process (GO:0044281)|tyrosine catabolic process (GO:0006572)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	homogentisate 1,2-dioxygenase activity (GO:0004411)|metal ion binding (GO:0046872)	p.W233R(1)		cervix(1)|endometrium(4)|kidney(2)|large_intestine(3)|lung(11)|ovary(1)|prostate(1)|skin(2)	25				GBM - Glioblastoma multiforme(114;0.158)		TCCTCATACCAGGCAATGGGT	0.448																																																	1	Substitution - Missense(1)	cervix(1)											103.0	101.0	102.0					3																	120363243		2203	4296	6499	SO:0001583	missense	3081				CCDS3000.1	3q	2010-04-27	2010-04-27		ENSG00000113924	ENSG00000113924	1.13.11.5		4892	protein-coding gene	gene with protein product	"""homogentisate oxidase"""	607474	"""homogentisate 1,2-dioxygenase (homogentisate oxidase)"""	AKU		8188241	Standard	NM_000187		Approved	HGO	uc003edw.3	Q93099	OTTHUMG00000159441	ENST00000283871.5:c.697T>C	3.37:g.120363243A>G	ENSP00000283871:p.Trp233Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K417|B2R8Z0	Missense_Mutation	SNP	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase	p.W233R	ENST00000283871.5	37	c.697	CCDS3000.1	3	.	.	.	.	.	.	.	.	.	.	A	13.06	2.125591	0.37533	.	.	ENSG00000113924	ENST00000283871	D	0.98762	-5.12	6.06	6.06	0.98353	Cupin, RmlC-type (1);	0.000000	0.85682	D	0.000000	D	0.97405	0.9151	M	0.64567	1.98	0.80722	D	1	P	0.44986	0.847	B	0.41466	0.358	D	0.97092	0.9791	10	0.25106	T	0.35	-0.0624	15.4333	0.75121	1.0:0.0:0.0:0.0	.	233	Q93099	HGD_HUMAN	R	233	ENSP00000283871:W233R	ENSP00000283871:W233R	W	-	1	0	HGD	121845933	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	8.423000	0.90264	2.324000	0.78689	0.533000	0.62120	TGG	HGD	-	pfam_Homogentis_dOase,superfamily_RmlC_Cupin,tigrfam_Homogentis_dOase		0.448	HGD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HGD	HGNC	protein_coding	OTTHUMT00000355410.1	A			120363243	-1	no_errors	ENST00000283871	ensembl	human	known	70_37	missense	SNP	1.000	G
HNRNPUL2	221092	genome.wustl.edu	37	11	62491178	62491178	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr11:62491178G>A	ENST00000301785.5	-	4	964	c.772C>T	c.(772-774)Caa>Taa	p.Q258*	HNRNPUL2-BSCL2_ENST00000403734.2_Nonsense_Mutation_p.Q258*	NM_001079559.2	NP_001073027.1	Q1KMD3	HNRL2_HUMAN	heterogeneous nuclear ribonucleoprotein U-like 2	258	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					membrane (GO:0016020)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)	p.Q258*(1)		NS(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	20						TTGCTCACTTGAAAATGCAGA	0.458																																																	1	Substitution - Nonsense(1)	cervix(1)											86.0	82.0	83.0					11																	62491178		1856	4101	5957	SO:0001587	stop_gained	221092				CCDS41659.1	11q12	2013-07-16		2008-04-18	ENSG00000214753	ENSG00000214753			25451	protein-coding gene	gene with protein product				HNRPUL2			Standard	NM_001079559		Approved	DKFZp762N1910	uc001nuw.3	Q1KMD3	OTTHUMG00000167773	ENST00000301785.5:c.772C>T	11.37:g.62491178G>A	ENSP00000301785:p.Gln258*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3B3	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_SAP_DNA-bd,pfam_Zeta_toxin_domain,pfam_Chromatin_KTI12,superfamily_ConA-like_lec_gl_sf,smart_SAP_DNA-bd,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_SAP_DNA-bd	p.Q258*	ENST00000301785.5	37	c.772	CCDS41659.1	11	.	.	.	.	.	.	.	.	.	.	G	37	6.607664	0.97701	.	.	ENSG00000214753	ENST00000301785	.	.	.	5.09	5.09	0.68999	.	0.122396	0.56097	D	0.000039	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-9.6436	10.9953	0.47571	0.0:0.0:0.8143:0.1857	.	.	.	.	X	258	.	ENSP00000301785:Q258X	Q	-	1	0	HNRNPUL2	62247754	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.617000	0.67716	2.659000	0.90383	0.655000	0.94253	CAA	HNRNPUL2	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY		0.458	HNRNPUL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HNRNPUL2	HGNC	protein_coding	OTTHUMT00000396208.2	G	XM_495877		62491178	-1	no_errors	ENST00000301785	ensembl	human	known	70_37	nonsense	SNP	1.000	A
IGFL4	444882	genome.wustl.edu	37	19	46543814	46543814	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:46543814A>G	ENST00000377697.1	-	2	85	c.32T>C	c.(31-33)aTt>aCt	p.I11T	IGFL4_ENST00000601672.1_5'UTR|IGFL4_ENST00000595006.1_5'UTR	NM_001002923.1	NP_001002923.1	Q6B9Z1	IGFL4_HUMAN	IGF-like family member 4	11						extracellular space (GO:0005615)		p.I11T(1)		cervix(1)|kidney(1)|lung(1)	3		all_neural(266;0.113)|Ovarian(192;0.127)		OV - Ovarian serous cystadenocarcinoma(262;0.0036)|GBM - Glioblastoma multiforme(486;0.022)|Epithelial(262;0.208)		AAGTTCAAAAATGAAGATGGC	0.498																																																	1	Substitution - Missense(1)	cervix(1)											111.0	96.0	101.0					19																	46543814		2203	4300	6503	SO:0001583	missense	444882			AY672114	CCDS33057.1	19q13.32	2006-07-14							32931	protein-coding gene	gene with protein product		610547				14702039	Standard	NM_001002923		Approved		uc002pdy.1	Q6B9Z1		ENST00000377697.1:c.32T>C	19.37:g.46543814A>G	ENSP00000366926:p.Ile11Thr	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.I11T	ENST00000377697.1	37	c.32	CCDS33057.1	19	.	.	.	.	.	.	.	.	.	.	A	11.35	1.613877	0.28712	.	.	ENSG00000204869	ENST00000377697	T	0.27890	1.64	2.22	-0.0452	0.13852	.	2.051440	0.03135	U	0.165746	T	0.22322	0.0538	L	0.32530	0.975	0.09310	N	1	B	0.20459	0.045	B	0.08055	0.003	T	0.26292	-1.0107	10	0.72032	D	0.01	.	1.8386	0.03145	0.5526:0.0:0.1723:0.2751	.	11	Q6B9Z1	IGFL4_HUMAN	T	11	ENSP00000366926:I11T	ENSP00000366926:I11T	I	-	2	0	IGFL4	51235654	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.467000	0.22035	-0.071000	0.12886	0.327000	0.21459	ATT	IGFL4	-	NULL		0.498	IGFL4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	IGFL4	HGNC	protein_coding	OTTHUMT00000461698.1	A	NM_001002923		46543814	-1	no_errors	ENST00000377697	ensembl	human	known	70_37	missense	SNP	0.000	G
IKZF1	10320	genome.wustl.edu	37	7	50468081	50468081	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:50468081G>A	ENST00000331340.3	+	8	1471	c.1316G>A	c.(1315-1317)cGc>cAc	p.R439H	IKZF1_ENST00000357364.4_Missense_Mutation_p.R352H|IKZF1_ENST00000440768.2_3'UTR|IKZF1_ENST00000439701.1_Missense_Mutation_p.R397H|IKZF1_ENST00000359197.5_Missense_Mutation_p.R397H|IKZF1_ENST00000346667.4_Missense_Mutation_p.R209H|IKZF1_ENST00000349824.4_Missense_Mutation_p.R296H|IKZF1_ENST00000438033.1_Missense_Mutation_p.R352H|IKZF1_ENST00000343574.5_Missense_Mutation_p.R352H	NM_001220769.1|NM_001220772.1|NM_001220773.1|NM_001220775.1|NM_006060.4	NP_001207698.1|NP_001207701.1|NP_001207702.1|NP_001207704.1|NP_006051.1	Q13422	IKZF1_HUMAN	IKAROS family zinc finger 1 (Ikaros)	439					B cell differentiation (GO:0030183)|cell cycle (GO:0007049)|chromatin modification (GO:0016568)|forebrain development (GO:0030900)|lymph node development (GO:0048535)|mesoderm development (GO:0007498)|natural killer cell differentiation (GO:0001779)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Peyer's patch development (GO:0048541)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of neutrophil differentiation (GO:0045660)|positive regulation of NK T cell differentiation (GO:0051138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|retina development in camera-type eye (GO:0060041)|T cell differentiation (GO:0030217)|thymus development (GO:0048538)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.?(28)|p.R439H(1)		haematopoietic_and_lymphoid_tissue(275)|lung(1)	276	Glioma(55;0.08)|all_neural(89;0.245)	Acute lymphoblastic leukemia(4;7.29e-10)|all_hematologic(4;4.8e-07)				GACCTGCTGCGCGCCGCCTCC	0.672			"""D,T"""	BCL6	"""ALL, DLBCL"""																																			"""Rec,Dom"""	yes		7	7p12.2	10320	IKAROS family zinc finger 1		L	29	Unknown(28)|Substitution - Missense(1)	haematopoietic_and_lymphoid_tissue(28)|cervix(1)											26.0	31.0	29.0					7																	50468081		2111	4224	6335	SO:0001583	missense	10320			U40462	CCDS59055.1, CCDS69299.1, CCDS75596.1, CCDS75597.1	7p12.2	2014-06-12	2006-08-25	2006-08-25	ENSG00000185811	ENSG00000185811		"""Zinc fingers, C2H2-type"", ""IKAROS zinc fingers"""	13176	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 92"""	603023	"""zinc finger protein, subfamily 1A, 1 (Ikaros)"""	ZNFN1A1		1439790, 7935426	Standard	NM_006060		Approved	hIk-1, LyF-1, Hs.54452, IKAROS, PPP1R92	uc003tow.4	Q13422	OTTHUMG00000155907	ENST00000331340.3:c.1316G>A	7.37:g.50468081G>A	ENSP00000331614:p.Arg439His	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D260|B4E0Z1|D3DVM5|O00598|Q53XL2|Q69BM4|Q8WVA3	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R439H	ENST00000331340.3	37	c.1316		7	.	.	.	.	.	.	.	.	.	.	G	32	5.159332	0.94686	.	.	ENSG00000185811	ENST00000346667;ENST00000343574;ENST00000359197;ENST00000349824;ENST00000357364;ENST00000331340;ENST00000438033;ENST00000439701	D;D;D;D;D;D;D;D	0.96619	-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07;-4.07	5.52	5.52	0.82312	.	0.047895	0.85682	D	0.000000	D	0.98251	0.9421	.	.	.	0.52501	D	0.999959	D;D;D;D;D	0.89917	1.0;0.999;0.999;1.0;1.0	D;D;D;D;D	0.91635	0.999;0.951;0.967;0.989;0.997	D	0.98847	1.0757	9	0.66056	D	0.02	-1.727	19.4353	0.94792	0.0:0.0:1.0:0.0	.	352;209;352;397;439	Q13422-2;Q13422-6;Q13422-3;Q13422-7;Q13422	.;.;.;.;IKZF1_HUMAN	H	209;352;397;296;352;439;352;397	ENSP00000340080:R209H;ENSP00000342750:R352H;ENSP00000352123:R397H;ENSP00000342485:R296H;ENSP00000349928:R352H;ENSP00000331614:R439H;ENSP00000396554:R352H;ENSP00000413025:R397H	ENSP00000331614:R439H	R	+	2	0	IKZF1	50435575	1.000000	0.71417	0.943000	0.38184	0.966000	0.64601	4.973000	0.63763	2.593000	0.87608	0.650000	0.86243	CGC	IKZF1	-	NULL		0.672	IKZF1-001	KNOWN	basic|appris_principal	protein_coding	IKZF1	HGNC	protein_coding	OTTHUMT00000342242.1	G	NM_006060		50468081	+1	no_errors	ENST00000331340	ensembl	human	known	70_37	missense	SNP	1.000	A
INO80D	54891	genome.wustl.edu	37	2	206882465	206882465	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:206882465G>T	ENST00000403263.1	-	8	1885	c.1481C>A	c.(1480-1482)tCt>tAt	p.S494Y		NM_017759.4	NP_060229.3	Q53TQ3	IN80D_HUMAN	INO80 complex subunit D	494					DNA recombination (GO:0006310)|DNA repair (GO:0006281)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)		p.S389Y(1)|p.S494Y(1)		NS(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(3)|lung(9)|ovary(2)|prostate(1)|urinary_tract(2)	26						AACTGGCACAGAGCACTGCTG	0.413																																																	2	Substitution - Missense(2)	cervix(2)											105.0	107.0	106.0					2																	206882465		1893	4136	6029	SO:0001583	missense	54891				CCDS46500.1	2q33.3	2011-07-06			ENSG00000114933	ENSG00000114933		"""INO80 complex subunits"""	25997	protein-coding gene	gene with protein product						16230350	Standard	NM_017759		Approved	FLJ20309	uc002vaz.4	Q53TQ3	OTTHUMG00000154649	ENST00000403263.1:c.1481C>A	2.37:g.206882465G>T	ENSP00000384198:p.Ser494Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KU68|B9EG77|Q6PJC6|Q6PJU1|Q6PKA1|Q9NXD5	Missense_Mutation	SNP	NULL	p.S494Y	ENST00000403263.1	37	c.1481	CCDS46500.1	2	.	.	.	.	.	.	.	.	.	.	G	25.8	4.679951	0.88542	.	.	ENSG00000114933	ENST00000403263;ENST00000233270;ENST00000424117	T;T	0.47869	0.83;0.83	5.3	4.39	0.52855	.	0.106892	0.64402	D	0.000003	T	0.59252	0.2180	M	0.65975	2.015	0.54753	D	0.999987	P	0.46142	0.873	P	0.51777	0.679	T	0.65022	-0.6269	10	0.72032	D	0.01	.	15.996	0.80243	0.0:0.1343:0.8657:0.0	.	494	Q53TQ3-2	.	Y	494;494;389	ENSP00000384198:S494Y;ENSP00000402369:S389Y	ENSP00000233270:S494Y	S	-	2	0	INO80D	206590710	1.000000	0.71417	0.993000	0.49108	0.965000	0.64279	7.821000	0.86641	2.478000	0.83669	0.655000	0.94253	TCT	INO80D	-	NULL		0.413	INO80D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INO80D	HGNC	protein_coding	OTTHUMT00000336459.1	G	NM_017759		206882465	-1	no_errors	ENST00000403263	ensembl	human	known	70_37	missense	SNP	1.000	T
IQCB1	9657	genome.wustl.edu	37	3	121527805	121527805	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:121527805G>A	ENST00000310864.6	-	6	659	c.445C>T	c.(445-447)Ctc>Ttc	p.L149F	IQCB1_ENST00000349820.6_Missense_Mutation_p.L149F	NM_001023570.2	NP_001018864.2	Q15051	IQCB1_HUMAN	IQ motif containing B1	149					cilium assembly (GO:0042384)|maintenance of organ identity (GO:0048496)|photoreceptor cell maintenance (GO:0045494)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|intercellular bridge (GO:0045171)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|photoreceptor connecting cilium (GO:0032391)|photoreceptor outer segment (GO:0001750)	calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)	p.L149F(1)		NS(1)|biliary_tract(1)|breast(3)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(7)|lung(11)|prostate(1)|skin(1)	30				GBM - Glioblastoma multiforme(114;0.0983)		AGCCAGAAGAGAGAATCAGTC	0.323																																																	1	Substitution - Missense(1)	cervix(1)											60.0	68.0	66.0					3																	121527805		2203	4299	6502	SO:0001583	missense	9657			D25278	CCDS33836.1, CCDS33837.1	3q21.1	2014-01-28	2004-09-02		ENSG00000173226	ENSG00000173226			28949	protein-coding gene	gene with protein product	"""nephrocystin-5"""	609237	"""IQ calmodulin-binding motif containing 1"""			15723066	Standard	NM_001023571		Approved	KIAA0036, NPHP5, SLSN5	uc010hre.1	Q15051	OTTHUMG00000128677	ENST00000310864.6:c.445C>T	3.37:g.121527805G>A	ENSP00000311505:p.Leu149Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KS08|Q3KS09|Q5DKQ7|Q8NI79|Q9BS08	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.L149F	ENST00000310864.6	37	c.445	CCDS33837.1	3	.	.	.	.	.	.	.	.	.	.	G	18.58	3.655163	0.67472	.	.	ENSG00000173226	ENST00000310864;ENST00000349820	T;T	0.09817	2.94;2.94	5.54	3.73	0.42828	.	0.355034	0.29293	N	0.012562	T	0.14743	0.0356	N	0.14661	0.345	0.24603	N	0.993769	D;B	0.65815	0.995;0.004	D;B	0.72982	0.979;0.018	T	0.02821	-1.1106	10	0.72032	D	0.01	-2.4745	8.3747	0.32436	0.1783:0.0:0.8217:0.0	.	149;149	Q15051;Q15051-2	IQCB1_HUMAN;.	F	149	ENSP00000311505:L149F;ENSP00000323756:L149F	ENSP00000311505:L149F	L	-	1	0	IQCB1	123010495	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	1.041000	0.30291	1.587000	0.49959	0.650000	0.86243	CTC	IQCB1	-	NULL		0.323	IQCB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCB1	HGNC	protein_coding	OTTHUMT00000250573.1	G	NM_014642		121527805	-1	no_errors	ENST00000310864	ensembl	human	known	70_37	missense	SNP	1.000	A
IQCG	84223	genome.wustl.edu	37	3	197616500	197616500	+	Nonsense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:197616500G>C	ENST00000265239.6	-	12	1707	c.1283C>G	c.(1282-1284)tCa>tGa	p.S428*	IQCG_ENST00000455191.1_Nonsense_Mutation_p.S428*	NM_032263.3	NP_115639.1	Q9H095	IQCG_HUMAN	IQ motif containing G	428						extracellular vesicular exosome (GO:0070062)		p.S428*(1)		autonomic_ganglia(1)|breast(2)|cervix(1)|kidney(1)|large_intestine(3)|lung(10)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21	all_cancers(143;1.15e-09)|Ovarian(172;0.0418)|Breast(254;0.0976)		Epithelial(36;7.19e-24)|all cancers(36;3.34e-22)|OV - Ovarian serous cystadenocarcinoma(49;1.1e-18)|LUSC - Lung squamous cell carcinoma(58;6.94e-07)|Lung(62;9.92e-07)	GBM - Glioblastoma multiforme(93;0.149)		TTTGCCTTTTGAATCCTTGCT	0.458																																																	1	Substitution - Nonsense(1)	cervix(1)											310.0	275.0	287.0					3																	197616500		2203	4300	6503	SO:0001587	stop_gained	84223			AL136889	CCDS3331.1	3q29	2014-07-18			ENSG00000114473	ENSG00000114473			25251	protein-coding gene	gene with protein product	"""dynein regulatory complex subunit 9"""	612477				11230166, 23427265, 24362311	Standard	NM_032263		Approved	DKFZp434B227, DRC9, CFAP122	uc003fyo.3	Q9H095	OTTHUMG00000155408	ENST00000265239.6:c.1283C>G	3.37:g.197616500G>C	ENSP00000265239:p.Ser428*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BST2|Q9HAG8	Nonsense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS	p.S428*	ENST00000265239.6	37	c.1283	CCDS3331.1	3	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035783	0.93630	.	.	ENSG00000114473	ENST00000265239;ENST00000455191	.	.	.	5.21	2.47	0.30058	.	1.778200	0.02762	N	0.118717	.	.	.	.	.	.	0.09310	N	0.999998	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	3.7125	6.5284	0.22314	0.2078:0.0:0.6638:0.1284	.	.	.	.	X	428	.	ENSP00000265239:S428X	S	-	2	0	IQCG	199100897	0.237000	0.23815	0.005000	0.12908	0.501000	0.33797	1.907000	0.39897	0.464000	0.27142	0.650000	0.86243	TCA	IQCG	-	NULL		0.458	IQCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCG	HGNC	protein_coding	OTTHUMT00000339730.1	G	NM_032263		197616500	-1	no_errors	ENST00000265239	ensembl	human	known	70_37	nonsense	SNP	0.002	C
JUNB	3726	genome.wustl.edu	37	19	12903536	12903536	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:12903536C>T	ENST00000302754.4	+	1	1227	c.951C>T	c.(949-951)ctC>ctT	p.L317L		NM_002229.2	NP_002220.1	P17275	JUNB_HUMAN	jun B proto-oncogene	317	Leucine-zipper. {ECO:0000255|PROSITE- ProRule:PRU00978}.|bZIP. {ECO:0000255|PROSITE- ProRule:PRU00978}.				cellular response to calcium ion (GO:0071277)|cellular response to hormone stimulus (GO:0032870)|decidualization (GO:0046697)|embryonic process involved in female pregnancy (GO:0060136)|gene expression (GO:0010467)|labyrinthine layer blood vessel development (GO:0060716)|osteoblast differentiation (GO:0001649)|osteoblast proliferation (GO:0033687)|osteoclast differentiation (GO:0030316)|positive regulation of cell differentiation (GO:0045597)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cAMP (GO:0051591)|response to corticosterone (GO:0051412)|response to cytokine (GO:0034097)|response to drug (GO:0042493)|response to light stimulus (GO:0009416)|response to mechanical stimulus (GO:0009612)|response to peptide hormone (GO:0043434)|response to progesterone (GO:0032570)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)|transforming growth factor beta receptor signaling pathway (GO:0007179)|trophectodermal cell differentiation (GO:0001829)|vasculogenesis (GO:0001570)	chromatin (GO:0000785)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.L317L(1)		central_nervous_system(1)|cervix(1)|kidney(1)|lung(3)	6						CCGGCCTCCTCCGGGAGCAGG	0.652																																																	1	Substitution - coding silent(1)	cervix(1)											25.0	25.0	25.0					19																	12903536		2200	4299	6499	SO:0001819	synonymous_variant	3726			M29039	CCDS12280.1	19p13.13	2013-01-10				ENSG00000171223		"""basic leucine zipper proteins"""	6205	protein-coding gene	gene with protein product		165161				2513129	Standard	NM_002229		Approved		uc002mvc.3	P17275		ENST00000302754.4:c.951C>T	19.37:g.12903536C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96GH3	Silent	SNP	pfam_JNK,pfam_bZIP,superfamily_Euk_TF_DNA-bd,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun	p.L317	ENST00000302754.4	37	c.951	CCDS12280.1	19																																																																																			JUNB	-	pfam_bZIP,smart_bZIP,pfscan_bZIP,prints_Leuzip_Jun		0.652	JUNB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JUNB	HGNC	protein_coding	OTTHUMT00000451015.1	C	NM_002229		12903536	+1	no_errors	ENST00000302754	ensembl	human	known	70_37	silent	SNP	0.986	T
CCAR2	57805	genome.wustl.edu	37	8	22470619	22470619	+	Missense_Mutation	SNP	G	G	A	rs200429085		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:22470619G>A	ENST00000308511.4	+	8	923	c.674G>A	c.(673-675)cGg>cAg	p.R225Q	RP11-582J16.5_ENST00000521025.1_RNA|CCAR2_ENST00000389279.3_Missense_Mutation_p.R225Q|CCAR2_ENST00000520861.1_5'UTR			Q8N163	CCAR2_HUMAN	cell cycle and apoptosis regulator 2	225					cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|mitochondrial fragmentation involved in apoptotic process (GO:0043653)|mRNA processing (GO:0006397)|negative regulation of catalytic activity (GO:0043086)|negative regulation of intrinsic apoptotic signaling pathway in response to DNA damage (GO:1902230)|negative regulation of proteasomal ubiquitin-dependent protein catabolic process (GO:0032435)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage checkpoint (GO:2000003)|regulation of circadian rhythm (GO:0042752)|regulation of DNA-templated transcription, elongation (GO:0032784)|regulation of protein stability (GO:0031647)|response to UV (GO:0009411)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|DBIRD complex (GO:0044609)|mitochondrial matrix (GO:0005759)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)	enzyme binding (GO:0019899)|enzyme inhibitor activity (GO:0004857)|poly(A) RNA binding (GO:0044822)|RNA polymerase II core binding (GO:0000993)	p.R225Q(1)									CCTCCTTACCGGGTCCACCTC	0.537																																																	1	Substitution - Missense(1)	cervix(1)											94.0	68.0	77.0					8																	22470619		2203	4300	6503	SO:0001583	missense	57805			AL834351	CCDS34863.1	8p22	2013-08-22	2013-08-22	2013-08-22		ENSG00000158941			23360	protein-coding gene	gene with protein product	"""deleted in breast cancer"""	607359	"""KIAA1967"""	KIAA1967		12370419	Standard	NM_021174		Approved	DBC-1, DBC1, NET35	uc003xci.3	Q8N163		ENST00000308511.4:c.674G>A	8.37:g.22470619G>A	ENSP00000310670:p.Arg225Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL03|B2RB79|D3DSR6|Q6P0Q9|Q8N3G7|Q8N8M1|Q8TF34|Q9H9Q9|Q9HD12|Q9NT55	Missense_Mutation	SNP	superfamily_NA-bd_OB-fold-like	p.R225Q	ENST00000308511.4	37	c.674	CCDS34863.1	8	.	.	.	.	.	.	.	.	.	.	G	31	5.103525	0.94245	.	.	ENSG00000158941	ENST00000308511;ENST00000389279;ENST00000522599	T;T;T	0.44083	1.48;1.48;0.93	5.87	5.87	0.94306	.	0.169307	0.41294	D	0.000904	T	0.49338	0.1551	N	0.22421	0.69	0.80722	D	1	D	0.69078	0.997	D	0.70227	0.968	T	0.24048	-1.0171	10	0.19590	T	0.45	-31.6041	17.4969	0.87720	0.0:0.0:1.0:0.0	.	225	Q8N163	K1967_HUMAN	Q	225;225;43	ENSP00000310670:R225Q;ENSP00000373930:R225Q;ENSP00000429739:R43Q	ENSP00000310670:R225Q	R	+	2	0	KIAA1967	22526564	1.000000	0.71417	0.999000	0.59377	0.976000	0.68499	5.197000	0.65141	2.941000	0.99782	0.655000	0.94253	CGG	KIAA1967	-	NULL		0.537	CCAR2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA1967	HGNC	protein_coding	OTTHUMT00000375865.1	G	NM_021174		22470619	+1	no_errors	ENST00000308511	ensembl	human	known	70_37	missense	SNP	1.000	A
LARP1	23367	genome.wustl.edu	37	5	154092620	154092620	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr5:154092620G>A	ENST00000336314.4	+	1	159	c.135G>A	c.(133-135)ccG>ccA	p.P45P		NM_015315.3	NP_056130.2	Q6PKG0	LARP1_HUMAN	La ribonucleoprotein domain family, member 1	63					cell proliferation (GO:0008283)|positive regulation of macroautophagy (GO:0016239)|positive regulation of translation (GO:0045727)|TOR signaling (GO:0031929)|translational initiation (GO:0006413)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	eukaryotic initiation factor 4E binding (GO:0008190)|mRNA 3'-UTR binding (GO:0003730)|mRNA 5'-UTR binding (GO:0048027)|poly(A) RNA binding (GO:0044822)|RNA cap binding (GO:0000339)|translation activator activity (GO:0008494)|translation initiation factor binding (GO:0031369)	p.P45P(1)		breast(1)|endometrium(3)|kidney(2)|large_intestine(10)|lung(9)|ovary(3)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	33	Renal(175;0.00488)	Medulloblastoma(196;0.0354)|all_neural(177;0.147)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CAGCTGCCCCGAGGAAGGAGC	0.597																																																	1	Substitution - coding silent(1)	cervix(1)											50.0	49.0	49.0					5																	154092620		2203	4300	6503	SO:0001819	synonymous_variant	23367			AB018274	CCDS4328.1	5q33.2	2014-02-12			ENSG00000155506	ENSG00000155506		"""La ribonucleoprotein domain containing"""	29531	protein-coding gene	gene with protein product		612059				9872452, 10878606	Standard	NM_015315		Approved	LARP, KIAA0731, MGC19556	uc003lvo.4	Q6PKG0	OTTHUMG00000130191	ENST00000336314.4:c.135G>A	5.37:g.154092620G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O94836|Q8N4M2|Q8NB73|Q9UFD7	Silent	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,smart_DM15,pfscan_Lupus_La_RNA-bd	p.P45	ENST00000336314.4	37	c.135	CCDS4328.1	5																																																																																			LARP1	-	NULL		0.597	LARP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP1	HGNC	protein_coding	OTTHUMT00000252509.1	G	NM_033551		154092620	+1	no_errors	ENST00000336314	ensembl	human	known	70_37	silent	SNP	0.000	A
LCMT1	51451	genome.wustl.edu	37	16	25172470	25172470	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr16:25172470C>T	ENST00000399069.3	+	6	669	c.514C>T	c.(514-516)Ctc>Ttc	p.L172F	LCMT1_ENST00000572869.1_3'UTR|LCMT1_ENST00000380966.4_Intron	NM_016309.2	NP_057393.2	Q9UIC8	LCMT1_HUMAN	leucine carboxyl methyltransferase 1	172	S-adenosyl-L-methionine binding.				C-terminal protein methylation (GO:0006481)|cellular protein modification process (GO:0006464)|negative regulation of protein complex assembly (GO:0031333)|protein methylation (GO:0006479)|regulation of apoptotic process (GO:0042981)|regulation of glucose metabolic process (GO:0010906)|regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090266)	cytosol (GO:0005829)	protein C-terminal carboxyl O-methyltransferase activity (GO:0003880)|S-adenosylmethionine-dependent methyltransferase activity (GO:0008757)	p.L172F(1)							GBM - Glioblastoma multiforme(48;0.0336)	L-Leucine(DB00149)	TGGAGCAGATCTCCGAGACCT	0.348																																					Colon(200;565 2072 24396 47922 50898)												1	Substitution - Missense(1)	cervix(1)											55.0	53.0	54.0					16																	25172470		1846	4099	5945	SO:0001583	missense	51451			AF037601	CCDS45445.1, CCDS45446.1	16p12.1	2014-08-01			ENSG00000205629	ENSG00000205629			17557	protein-coding gene	gene with protein product	"""protein phosphatase methyltransferase 1"""	610286				10810093	Standard	XM_005255354		Approved	CGI-68, PPMT1	uc002dnx.1	Q9UIC8	OTTHUMG00000177182	ENST00000399069.3:c.514C>T	16.37:g.25172470C>T	ENSP00000382021:p.Leu172Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL89|A8K770|Q53FC5|Q96CI5|Q9H6I9|Q9NTG4|Q9Y378	Missense_Mutation	SNP	pfam_LCM_MeTrfase,pirsf_Leu_CO_MeTrfase_LCTM1	p.L172F	ENST00000399069.3	37	c.514	CCDS45445.1	16	.	.	.	.	.	.	.	.	.	.	C	17.62	3.433683	0.62955	.	.	ENSG00000205629	ENST00000399069;ENST00000380962	T	0.27890	1.64	5.83	4.88	0.63580	.	0.000000	0.85682	D	0.000000	T	0.67933	0.2946	H	0.96691	3.865	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	T	0.78811	-0.2057	10	0.87932	D	0	-15.6313	12.6955	0.57001	0.0:0.9205:0.0:0.0795	.	172	Q9UIC8	LCMT1_HUMAN	F	172;189	ENSP00000382021:L172F	ENSP00000370349:L189F	L	+	1	0	LCMT1	25079971	1.000000	0.71417	1.000000	0.80357	0.618000	0.37518	3.042000	0.49815	1.473000	0.48159	0.655000	0.94253	CTC	LCMT1	-	pfam_LCM_MeTrfase,pirsf_Leu_CO_MeTrfase_LCTM1		0.348	LCMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LCMT1	HGNC	protein_coding	OTTHUMT00000435747.4	C	NM_016309		25172470	+1	no_errors	ENST00000399069	ensembl	human	known	70_37	missense	SNP	1.000	T
LCN10	414332	genome.wustl.edu	37	9	139637353	139637353	+	Start_Codon_SNP	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr9:139637353C>T	ENST00000474369.1	-	1	2	c.3G>A	c.(1-3)atG>atA	p.M1I	LCN6_ENST00000435202.1_3'UTR|LCN10_ENST00000497771.1_Start_Codon_SNP_p.M1I|LCN6_ENST00000471509.1_5'Flank|LCN10_ENST00000527229.1_Start_Codon_SNP_p.M1I|LCN6_ENST00000480584.1_Intron			Q6JVE6	LCN10_HUMAN	lipocalin 10	1					transport (GO:0006810)	extracellular region (GO:0005576)		p.M1I(2)		breast(2)|cervix(1)|large_intestine(1)	4	all_cancers(76;0.0882)|all_epithelial(76;0.228)	Myeloproliferative disorder(178;0.0511)		OV - Ovarian serous cystadenocarcinoma(145;5.32e-06)|Epithelial(140;7.83e-05)		gcccctgcctcatcttcaccc	0.677																																																	2	Substitution - Missense(2)	cervix(2)											65.0	52.0	56.0					9																	139637353		2200	4297	6497	SO:0001582	initiator_codon_variant	414332			AY301271	CCDS35182.2	9q34.3	2011-10-24			ENSG00000187922	ENSG00000187922		"""Lipocalins"""	20892	protein-coding gene	gene with protein product		612904				15363845	Standard	NM_001001712		Approved		uc004civ.3	Q6JVE6	OTTHUMG00000150428	ENST00000474369.1:c.3G>A	9.37:g.139637353C>T	ENSP00000420564:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUU3|B0QZ79	Missense_Mutation	SNP	superfamily_Calycin-like	p.M1I	ENST00000474369.1	37	c.3	CCDS35182.2	9	.	.	.	.	.	.	.	.	.	.	C	13.99	2.401154	0.42613	.	.	ENSG00000187922	ENST00000527229;ENST00000497771;ENST00000474369	T;T	0.29917	1.55;1.57	3.26	3.26	0.37387	.	.	.	.	.	T	0.37732	0.1014	.	.	.	0.80722	D	1	P;P;P	0.45715	0.865;0.865;0.865	P;P;P	0.47573	0.472;0.55;0.55	T	0.41645	-0.9497	8	0.87932	D	0	-7.083	12.7997	0.57578	0.0:1.0:0.0:0.0	.	1;1;1	E9PK15;Q6JVE6;Q6JVE6-2	.;LCN10_HUMAN;.	I	1	ENSP00000418491:M1I;ENSP00000420564:M1I	ENSP00000435948:M1I	M	-	3	0	LCN10	138757174	0.004000	0.15560	0.438000	0.26821	0.018000	0.09664	1.370000	0.34238	1.773000	0.52216	0.552000	0.68991	ATG	LCN10	-	NULL		0.677	LCN10-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LCN10	HGNC	protein_coding	OTTHUMT00000318062.2	C	NM_001001712	Missense_Mutation	139637353	-1	no_errors	ENST00000497771	ensembl	human	known	70_37	missense	SNP	0.416	T
USP3	9960	genome.wustl.edu	37	15	63881069	63881069	+	Intron	SNP	C	C	T	rs1143374		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr15:63881069C>T	ENST00000380324.3	+	13	1458				USP3-AS1_ENST00000561256.1_RNA|USP3_ENST00000540797.1_Intron|USP3_ENST00000539772.1_Intron|USP3_ENST00000268049.7_Intron|USP3_ENST00000558218.1_Intron|USP3-AS1_ENST00000560350.1_RNA|USP3_ENST00000558285.1_Intron|USP3-AS1_ENST00000558831.1_RNA|USP3-AS1_ENST00000560622.1_RNA|USP3_ENST00000559711.1_Intron|USP3-AS1_ENST00000560962.1_RNA|USP3-AS1_ENST00000559861.1_RNA|USP3-AS1_ENST00000559357.1_RNA|USP3-AS1_ENST00000561191.1_RNA|USP3-AS1_ENST00000559737.1_RNA	NM_006537.3	NP_006528.2	Q9Y6I4	UBP3_HUMAN	ubiquitin specific peptidase 3						DNA repair (GO:0006281)|histone deubiquitination (GO:0016578)|mitotic cell cycle (GO:0000278)|regulation of protein stability (GO:0031647)|ubiquitin-dependent protein catabolic process (GO:0006511)	nuclear chromatin (GO:0000790)	histone binding (GO:0042393)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			endometrium(3)|large_intestine(7)|lung(4)	14				GBM - Glioblastoma multiforme(80;0.0187)		GTAAGATTGTCATCACATGGA	0.458																																																	0																																										SO:0001627	intron_variant	100130855			AF073344	CCDS32265.1, CCDS58370.1	15q22.3	2008-04-11	2005-08-08			ENSG00000140455		"""Ubiquitin-specific peptidases"""	12626	protein-coding gene	gene with protein product		604728	"""ubiquitin specific protease 3"""			12838346	Standard	NM_006537		Approved		uc002amf.4	Q9Y6I4		ENST00000380324.3:c.1329+55C>T	15.37:g.63881069C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DVU5|F5H1A6|Q8WVD0	RNA	SNP	-	NULL	ENST00000380324.3	37	NULL	CCDS32265.1	15																																																																																			RP11-265M18.2	-	-		0.458	USP3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100130855	Clone_based_vega_gene	protein_coding	OTTHUMT00000417773.1	C			63881069	-1	no_errors	ENST00000558831	ensembl	human	known	70_37	rna	SNP	0.000	T
KDM7A	80853	genome.wustl.edu	37	7	139878081	139878081	+	5'Flank	SNP	T	T	C	rs151189285|rs146325560		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:139878081T>C	ENST00000397560.2	-	0	0				JHDM1D-AS1_ENST00000566699.1_RNA|JHDM1D_ENST00000006967.5_5'Flank	NM_030647.1	NP_085150.1	Q6ZMT4	KDM7A_HUMAN							histone H3-K27 demethylation (GO:0071557)|histone H3-K36 demethylation (GO:0070544)|histone H3-K9 demethylation (GO:0033169)|histone H4-K20 demethylation (GO:0035574)|midbrain development (GO:0030901)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K27 specific) (GO:0071558)|histone demethylase activity (H3-K36 specific) (GO:0051864)|histone demethylase activity (H3-K9 specific) (GO:0032454)|histone demethylase activity (H4-K20 specific) (GO:0035575)|iron ion binding (GO:0005506)|methylated histone binding (GO:0035064)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, 2-oxoglutarate as one donor, and incorporation of one atom each of oxygen into both donors (GO:0016706)|zinc ion binding (GO:0008270)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(1)|lung(10)|ovary(1)|prostate(1)|skin(1)|stomach(1)	22	Melanoma(164;0.0142)					ccttccttccttccctccctc	0.478																																																	0																																										SO:0001631	upstream_gene_variant	100134229																															7.37:g.139878081T>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1S9|C9JJH9|C9JQU2|Q6MZL8|Q9C0E5	RNA	SNP	-	NULL	ENST00000397560.2	37	NULL	CCDS43658.1	7																																																																																			RP4-659J6.2	-	-		0.478	JHDM1D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100134229	Clone_based_vega_gene	protein_coding	OTTHUMT00000348460.1	T			139878081	+1	no_errors	ENST00000566699	ensembl	human	known	70_37	rna	SNP	0.131	C
RP11-423O2.5	0	genome.wustl.edu	37	1	142803370	142803370	+	lincRNA	SNP	T	T	G	rs61814264	byFrequency	TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:142803370T>G	ENST00000423385.1	-	0	1595																											ttattatgtttcccaagctgg	0.398																																																	0																																												100996920																															1.37:g.142803370T>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000423385.1	37	NULL		1																																																																																			RP11-423O2.5	-	-		0.398	RP11-423O2.5-001	KNOWN	basic	lincRNA	LOC100996920	Clone_based_vega_gene	lincRNA	OTTHUMT00000193203.1	T			142803370	-1	no_errors	ENST00000423385	ensembl	human	putative	70_37	rna	SNP	0.001	G
LPXN	9404	genome.wustl.edu	37	11	58318619	58318619	+	Silent	SNP	C	C	A	rs1047979	byFrequency	TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr11:58318619C>A	ENST00000395074.2	-	5	493	c.405G>T	c.(403-405)ctG>ctT	p.L135L	LPXN_ENST00000528489.1_Silent_p.L115L|LPXN_ENST00000528954.1_Silent_p.L140L	NM_004811.2	NP_004802.1	O60711	LPXN_HUMAN	leupaxin	135					cell adhesion (GO:0007155)|negative regulation of B cell receptor signaling pathway (GO:0050859)|negative regulation of cell adhesion (GO:0007162)|protein complex assembly (GO:0006461)|regulation of cell adhesion mediated by integrin (GO:0033628)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|podosome (GO:0002102)	transcription cofactor activity (GO:0003712)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|large_intestine(2)|lung(6)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	14		Breast(21;0.00725)|all_epithelial(135;0.0101)|all_lung(304;0.24)				ATTCCTGCTCCAGACCCCCAA	0.552																																																	0													108.0	88.0	95.0					11																	58318619		2201	4295	6496	SO:0001819	synonymous_variant	9404			AF062075	CCDS7969.1, CCDS53635.1	11q12.1	2013-09-20			ENSG00000110031	ENSG00000110031			14061	protein-coding gene	gene with protein product		605390				9565592	Standard	NM_004811		Approved	LDPL	uc001nmw.3	O60711	OTTHUMG00000167466	ENST00000395074.2:c.405G>T	11.37:g.58318619C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8B4|B4DV71|Q53FW6|Q6FI07	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pirsf_Leupaxin,pfscan_Znf_LIM	p.L140	ENST00000395074.2	37	c.420	CCDS7969.1	11																																																																																			LPXN	-	pirsf_Leupaxin		0.552	LPXN-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	LPXN	HGNC	protein_coding	OTTHUMT00000394709.1	C	NM_004811		58318619	-1	no_errors	ENST00000528954	ensembl	human	known	70_37	silent	SNP	1.000	A
MAEL	84944	genome.wustl.edu	37	1	166963303	166963303	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:166963303G>A	ENST00000367872.4	+	5	764	c.520G>A	c.(520-522)Gca>Aca	p.A174T	MAEL_ENST00000367870.2_Missense_Mutation_p.A143T|MAEL_ENST00000491055.1_3'UTR	NM_032858.1	NP_116247.1	Q96JY0	MAEL_HUMAN	maelstrom spermatogenic transposon silencer	174					cell differentiation (GO:0030154)|cell morphogenesis (GO:0000902)|DNA methylation involved in gamete generation (GO:0043046)|fertilization (GO:0009566)|gene silencing by RNA (GO:0031047)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|male meiosis (GO:0007140)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|piRNA metabolic process (GO:0034587)|regulation of organ growth (GO:0046620)|spermatogenesis (GO:0007283)|synapsis (GO:0007129)	autosome (GO:0030849)|chromatin (GO:0000785)|chromatoid body (GO:0033391)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|perinuclear region of cytoplasm (GO:0048471)|piP-body (GO:0071547)|XY body (GO:0001741)	DNA binding (GO:0003677)	p.A174T(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(12)|skin(4)	28						TTGTCAGGCTGCAAGTAAGTA	0.323																																																	1	Substitution - Missense(1)	cervix(1)											77.0	79.0	78.0					1																	166963303		2203	4299	6502	SO:0001583	missense	84944			AK027810, DQ076156	CCDS1257.1, CCDS65712.1, CCDS72975.1	1q24.1	2013-10-11	2012-12-18		ENSG00000143194	ENSG00000143194			25929	protein-coding gene	gene with protein product	"""cancer/testis antigen 128"", ""spermatogenesis associated 35"""	611368	"""maelstrom homolog (Drosophila)"""			19693694, 18694567	Standard	NM_001286378		Approved	FLJ14904, CT128, SPATA35	uc001gdy.1	Q96JY0	OTTHUMG00000034432	ENST00000367872.4:c.520G>A	1.37:g.166963303G>A	ENSP00000356846:p.Ala174Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DY43|E9JVC3|Q49AP9|Q5VZP8|Q9UIW6	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,superfamily_CH-domain	p.A174T	ENST00000367872.4	37	c.520	CCDS1257.1	1	.	.	.	.	.	.	.	.	.	.	G	20.1	3.935726	0.73442	.	.	ENSG00000143194	ENST00000367872;ENST00000367870;ENST00000447624	T;T;T	0.44881	0.91;0.91;0.94	4.97	4.97	0.65823	.	0.000000	0.64402	D	0.000006	T	0.37156	0.0993	N	0.14661	0.345	0.45250	D	0.998258	D;D	0.89917	1.0;1.0	D;D	0.75484	0.986;0.986	T	0.25257	-1.0137	10	0.30854	T	0.27	.	17.1671	0.86819	0.0:0.0:1.0:0.0	.	143;174	E9JVC3;Q96JY0	.;MAEL_HUMAN	T	174;143;143	ENSP00000356846:A174T;ENSP00000356844:A143T;ENSP00000402143:A143T	ENSP00000356844:A143T	A	+	1	0	MAEL	165229927	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.950000	0.70265	2.580000	0.87095	0.591000	0.81541	GCA	MAEL	-	superfamily_CH-domain		0.323	MAEL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAEL	HGNC	protein_coding	OTTHUMT00000083239.1	G	NM_032858		166963303	+1	no_errors	ENST00000367872	ensembl	human	known	70_37	missense	SNP	1.000	A
MAPK1	5594	genome.wustl.edu	37	22	22127164	22127164	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr22:22127164C>T	ENST00000215832.6	-	7	1152	c.964G>A	c.(964-966)Gag>Aag	p.E322K	MAPK1_ENST00000398822.3_Missense_Mutation_p.E322K|MAPK1_ENST00000544786.1_Missense_Mutation_p.E278K	NM_002745.4	NP_002736.3	P28482	MK01_HUMAN	mitogen-activated protein kinase 1	322					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|caveolin-mediated endocytosis (GO:0072584)|cell cycle (GO:0007049)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|chemotaxis (GO:0006935)|cytosine metabolic process (GO:0019858)|epidermal growth factor receptor signaling pathway (GO:0007173)|ERBB signaling pathway (GO:0038127)|ERK1 and ERK2 cascade (GO:0070371)|Fc-epsilon receptor signaling pathway (GO:0038095)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|labyrinthine layer blood vessel development (GO:0060716)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mammary gland epithelial cell proliferation (GO:0033598)|MAPK cascade (GO:0000165)|MAPK import into nucleus (GO:0000189)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|negative regulation of cell differentiation (GO:0045596)|neurotrophin TRK receptor signaling pathway (GO:0048011)|organ morphogenesis (GO:0009887)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|platelet activation (GO:0030168)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of peptidyl-threonine phosphorylation (GO:0010800)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|Ras protein signal transduction (GO:0007265)|regulation of cytoskeleton organization (GO:0051493)|regulation of early endosome to late endosome transport (GO:2000641)|regulation of Golgi inheritance (GO:0090170)|regulation of protein stability (GO:0031647)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of stress-activated MAPK cascade (GO:0032872)|response to epidermal growth factor (GO:0070849)|response to estrogen (GO:0043627)|response to exogenous dsRNA (GO:0043330)|response to stress (GO:0006950)|response to toxic substance (GO:0009636)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|small GTPase mediated signal transduction (GO:0007264)|stress-activated MAPK cascade (GO:0051403)|synaptic transmission (GO:0007268)|T cell receptor signaling pathway (GO:0050852)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|transcription, DNA-templated (GO:0006351)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|early endosome (GO:0005769)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|late endosome (GO:0005770)|microtubule cytoskeleton (GO:0015630)|mitochondrion (GO:0005739)|mitotic spindle (GO:0072686)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|perikaryon (GO:0043204)|protein complex (GO:0043234)|pseudopodium (GO:0031143)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|MAP kinase activity (GO:0004707)|phosphatase binding (GO:0019902)|protein serine/threonine kinase activity (GO:0004674)|RNA polymerase II carboxy-terminal domain kinase activity (GO:0008353)	p.E322K(1)		NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(2)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	17	Colorectal(54;0.105)	all_lung(157;3.89e-05)		READ - Rectum adenocarcinoma(21;0.0689)	Arsenic trioxide(DB01169)|Isoprenaline(DB01064)	GCTCTTACCTCGTCACTCGGG	0.478																																																	1	Substitution - Missense(1)	cervix(1)											165.0	132.0	143.0					22																	22127164		2203	4300	6503	SO:0001583	missense	5594			M84489	CCDS13795.1	22q11.2	2014-09-17			ENSG00000100030	ENSG00000100030	2.7.11.1	"""Mitogen-activated protein kinase cascade / Kinases"""	6871	protein-coding gene	gene with protein product		176948		PRKM2, PRKM1			Standard	NM_138957		Approved	ERK, ERK2, p41mapk, MAPK2	uc002zvn.3	P28482	OTTHUMG00000030508	ENST00000215832.6:c.964G>A	22.37:g.22127164C>T	ENSP00000215832:p.Glu322Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8CZ64	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_MAPK_ERK1/2,prints_MAPK_ERK3/4	p.E322K	ENST00000215832.6	37	c.964	CCDS13795.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.567659	0.96540	.	.	ENSG00000100030	ENST00000215832;ENST00000415911;ENST00000398822;ENST00000544786	T;T;T	0.46063	0.88;0.88;0.88	4.9	4.9	0.64082	Protein kinase-like domain (1);	0.000000	0.85682	D	0.000000	T	0.79275	0.4418	H	0.98388	4.22	0.80722	D	1	D;D	0.89917	0.999;1.0	P;D	0.83275	0.905;0.996	D	0.87609	0.2502	10	0.87932	D	0	-8.3311	18.6384	0.91386	0.0:1.0:0.0:0.0	.	278;322	A8CZ64;P28482	.;MK01_HUMAN	K	322;310;322;278	ENSP00000215832:E322K;ENSP00000381803:E322K;ENSP00000440842:E278K	ENSP00000215832:E322K	E	-	1	0	MAPK1	20457164	1.000000	0.71417	0.999000	0.59377	0.862000	0.49288	7.564000	0.82326	2.706000	0.92434	0.655000	0.94253	GAG	MAPK1	-	superfamily_Kinase-like_dom,prints_MAPK_ERK1/2		0.478	MAPK1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MAPK1	HGNC	protein_coding	OTTHUMT00000075396.2	C			22127164	-1	no_errors	ENST00000215832	ensembl	human	known	70_37	missense	SNP	1.000	T
MED9	55090	genome.wustl.edu	37	17	17380479	17380479	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:17380479C>G	ENST00000268711.3	+	1	180	c.124C>G	c.(124-126)Caa>Gaa	p.Q42E	MED9_ENST00000580462.1_Missense_Mutation_p.Q42E|MED9_ENST00000585041.1_3'UTR	NM_018019.2	NP_060489.1	Q9NWA0	MED9_HUMAN	mediator complex subunit 9	42	Pro-rich.					mediator complex (GO:0016592)	RNA polymerase II transcription cofactor activity (GO:0001104)	p.Q42E(1)		cervix(1)|endometrium(1)|large_intestine(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	7						ccctgcgcctcaaccgcagca	0.652																																																	1	Substitution - Missense(1)	cervix(1)											17.0	17.0	17.0					17																	17380479		2200	4294	6494	SO:0001583	missense	55090			BC000647	CCDS11184.1	17p11.2	2007-07-30	2007-07-30		ENSG00000141026	ENSG00000141026			25487	protein-coding gene	gene with protein product		609878	"""mediator of RNA polymerase II transcription, subunit 9 homolog (S. cerevisiae)"""			11997338	Standard	NM_018019		Approved	FLJ10193, MED25	uc002grh.1	Q9NWA0	OTTHUMG00000059293	ENST00000268711.3:c.124C>G	17.37:g.17380479C>G	ENSP00000268711:p.Gln42Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Mediator_Med9	p.Q42E	ENST00000268711.3	37	c.124	CCDS11184.1	17	.	.	.	.	.	.	.	.	.	.	C	6.662	0.490626	0.12702	.	.	ENSG00000141026	ENST00000268711	.	.	.	5.28	4.27	0.50696	.	0.657798	0.14216	N	0.333717	T	0.25827	0.0629	L	0.27053	0.805	0.09310	N	1	B	0.23316	0.083	B	0.16289	0.015	T	0.18053	-1.0349	9	0.02654	T	1	-15.9447	11.544	0.50681	0.0:0.819:0.181:0.0	.	42	Q9NWA0	MED9_HUMAN	E	42	.	ENSP00000268711:Q42E	Q	+	1	0	MED9	17321204	0.299000	0.24426	0.050000	0.19076	0.555000	0.35460	1.435000	0.34969	1.158000	0.42547	0.591000	0.81541	CAA	MED9	-	NULL		0.652	MED9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED9	HGNC	protein_coding	OTTHUMT00000131669.2	C	NM_018019		17380479	+1	no_errors	ENST00000268711	ensembl	human	known	70_37	missense	SNP	0.035	G
MESDC2	23184	genome.wustl.edu	37	15	81274372	81274372	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr15:81274372C>T	ENST00000261758.4	-	2	451	c.365G>A	c.(364-366)gGa>gAa	p.G122E		NM_015154.1	NP_055969.1	Q14696	MESD_HUMAN	mesoderm development candidate 2	122	Chaperone domain. {ECO:0000250}.				mesoderm development (GO:0007498)|protein folding (GO:0006457)|protein localization to cell surface (GO:0034394)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum (GO:0005783)|plasma membrane (GO:0005886)		p.G122E(1)		cervix(1)|large_intestine(5)|ovary(1)|urinary_tract(1)	8						AGTAGGGCTTCCTGATACAGT	0.468																																																	1	Substitution - Missense(1)	cervix(1)											157.0	131.0	140.0					15																	81274372		2203	4300	6503	SO:0001583	missense	23184			D42039	CCDS32308.1	15q13	2008-07-18							13520	protein-coding gene	gene with protein product		607783				7788527, 11247670	Standard	NM_015154		Approved	KIAA0081, BOCA, MESD	uc002bfy.1	Q14696		ENST00000261758.4:c.365G>A	15.37:g.81274372C>T	ENSP00000261758:p.Gly122Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DW84|D3DW96|Q969U1	Missense_Mutation	SNP	pfam_Mesoderm_development_cand-2	p.G122E	ENST00000261758.4	37	c.365	CCDS32308.1	15	.	.	.	.	.	.	.	.	.	.	C	21.8	4.197887	0.79015	.	.	ENSG00000117899	ENST00000261758	.	.	.	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	T	0.78201	0.4246	M	0.66939	2.045	0.80722	D	1	D	0.76494	0.999	D	0.77004	0.989	T	0.79040	-0.1966	9	0.51188	T	0.08	-0.5172	18.5891	0.91202	0.0:1.0:0.0:0.0	.	122	Q14696	MESD_HUMAN	E	122	.	ENSP00000261758:G122E	G	-	2	0	MESDC2	79061427	1.000000	0.71417	0.359000	0.25824	0.524000	0.34500	7.449000	0.80643	2.379000	0.81126	0.650000	0.86243	GGA	MESDC2	-	pfam_Mesoderm_development_cand-2		0.468	MESDC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MESDC2	HGNC	protein_coding	OTTHUMT00000417673.2	C	NM_015154		81274372	-1	no_errors	ENST00000261758	ensembl	human	known	70_37	missense	SNP	1.000	T
MMEL1	79258	genome.wustl.edu	37	1	2537001	2537001	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:2537001C>T	ENST00000378412.3	-	9	973	c.812G>A	c.(811-813)cGg>cAg	p.R271Q	MMEL1_ENST00000502556.1_Intron|MMEL1_ENST00000288709.6_Missense_Mutation_p.R262Q			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	271						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)	p.R262Q(1)		cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		ACCCACCTTCCGGTTGCTGCC	0.647																																																	1	Substitution - Missense(1)	cervix(1)											62.0	64.0	64.0					1																	2537001		2203	4300	6503	SO:0001583	missense	79258			AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.812G>A	1.37:g.2537001C>T	ENSP00000367668:p.Arg271Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.R271Q	ENST00000378412.3	37	c.812	CCDS30569.2	1	.	.	.	.	.	.	.	.	.	.	C	9.938	1.216781	0.22373	.	.	ENSG00000142606	ENST00000288709;ENST00000378412	T;T	0.73047	-0.71;-0.71	5.0	-1.33	0.09172	Peptidase M13 (1);	0.346287	0.33309	N	0.005052	T	0.36166	0.0957	N	0.01771	-0.73	0.21802	N	0.999535	B	0.12013	0.005	B	0.12156	0.007	T	0.30475	-0.9977	10	0.15499	T	0.54	-8.0335	9.0096	0.36133	0.0:0.3529:0.0:0.6471	.	271	Q495T6	MMEL1_HUMAN	Q	262;271	ENSP00000288709:R262Q;ENSP00000367668:R271Q	ENSP00000288709:R262Q	R	-	2	0	MMEL1	2526861	0.653000	0.27358	0.030000	0.17652	0.054000	0.15201	0.334000	0.19787	-0.568000	0.06038	-0.469000	0.05056	CGG	MMEL1	-	pfam_Peptidase_M13_N		0.647	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMEL1	HGNC	protein_coding	OTTHUMT00000002395.2	C	NM_033467		2537001	-1	no_errors	ENST00000378412	ensembl	human	known	70_37	missense	SNP	0.946	T
MOGAT1	116255	genome.wustl.edu	37	2	223553201	223553201	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:223553201G>T	ENST00000446656.3	+	2	233	c.233G>T	c.(232-234)tGg>tTg	p.W78L		NM_058165.2	NP_477513.2	Q96PD6	MOGT1_HUMAN	monoacylglycerol O-acyltransferase 1	78					diacylglycerol biosynthetic process (GO:0006651)|glycerol metabolic process (GO:0006071)|triglyceride biosynthetic process (GO:0019432)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)	2-acylglycerol O-acyltransferase activity (GO:0003846)|diacylglycerol O-acyltransferase activity (GO:0004144)	p.W78L(1)|p.W77L(1)		breast(1)|cervix(1)|endometrium(1)|lung(5)|urinary_tract(1)	9		Renal(207;0.0183)		Epithelial(121;4.13e-10)|all cancers(144;2.06e-07)|LUSC - Lung squamous cell carcinoma(224;0.00829)|Lung(261;0.0105)		ATCAAAAATTGGACTCTTTGG	0.368																																					Ovarian(93;205 1446 2385 11581 25911)												2	Substitution - Missense(2)	cervix(2)											128.0	115.0	119.0					2																	223553201		1864	4111	5975	SO:0001583	missense	116255			AF384163	CCDS46524.1	2q36.2	2006-10-06	2004-05-28	2004-05-28	ENSG00000124003	ENSG00000124003			18210	protein-coding gene	gene with protein product		610268	"""diacylglycerol O-acyltransferase 2 like 1"""	DGAT2L1		14970677	Standard	NM_058165		Approved	DGAT2L, MGAT1	uc010fws.1	Q96PD6	OTTHUMG00000153394	ENST00000446656.3:c.233G>T	2.37:g.223553201G>T	ENSP00000406674:p.Trp78Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IEE5	Missense_Mutation	SNP	pfam_DAGAT	p.W78L	ENST00000446656.3	37	c.233	CCDS46524.1	2	.	.	.	.	.	.	.	.	.	.	G	13.88	2.368842	0.42003	.	.	ENSG00000124003	ENST00000446656	T	0.12879	2.64	4.82	3.9	0.45041	.	0.284072	0.31323	N	0.007854	T	0.12561	0.0305	L	0.45285	1.41	0.32143	N	0.585269	B	0.17667	0.023	B	0.22880	0.042	T	0.11446	-1.0587	10	0.10902	T	0.67	-4.6333	14.4416	0.67321	0.0:0.0:0.8515:0.1485	.	78	Q96PD6	MOGT1_HUMAN	L	78	ENSP00000406674:W78L	ENSP00000406674:W78L	W	+	2	0	MOGAT1	223261445	1.000000	0.71417	0.154000	0.22540	0.602000	0.36980	4.193000	0.58385	1.320000	0.45209	0.655000	0.94253	TGG	MOGAT1	-	pfam_DAGAT		0.368	MOGAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MOGAT1	HGNC	protein_coding	OTTHUMT00000331010.3	G	NM_058165		223553201	+1	no_errors	ENST00000446656	ensembl	human	known	70_37	missense	SNP	0.646	T
MPEG1	219972	genome.wustl.edu	37	11	58980271	58980271	+	Missense_Mutation	SNP	G	G	A	rs574261219		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr11:58980271G>A	ENST00000361050.3	-	1	153	c.68C>T	c.(67-69)tCg>tTg	p.S23L	RN7SL42P_ENST00000579786.1_RNA	NM_001039396.1	NP_001034485.1	Q2M385	MPEG1_HUMAN	macrophage expressed 1	23						integral component of membrane (GO:0016021)		p.S23L(1)		NS(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(21)|ovary(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	39		all_epithelial(135;0.125)				CATCTCTCCCGAAGGCTTGCC	0.552													g|||	1	0.000199681	0.0	0.0	5008	,	,		19028	0.0		0.0	False		,,,				2504	0.001																1	Substitution - Missense(1)	cervix(1)											94.0	97.0	96.0					11																	58980271		2010	4165	6175	SO:0001583	missense	219972			AK097211	CCDS41650.1	11q12.1	2013-07-31				ENSG00000197629			29619	protein-coding gene	gene with protein product	"""macrophage expressed gene 1"""	610390				7888681, 23257510	Standard	NM_001039396		Approved	MPG1	uc001nnu.4	Q2M385		ENST00000361050.3:c.68C>T	11.37:g.58980271G>A	ENSP00000354335:p.Ser23Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M1T6|Q8TEF8	Missense_Mutation	SNP	pfam_MACPF,smart_MACPF	p.S23L	ENST00000361050.3	37	c.68	CCDS41650.1	11	.	.	.	.	.	.	.	.	.	.	g	0.470	-0.885119	0.02511	.	.	ENSG00000197629	ENST00000361050;ENST00000545098	T	0.20738	2.05	5.37	0.348	0.16026	.	0.270973	0.29653	N	0.011548	T	0.03564	0.0102	N	0.00408	-1.53	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.39702	-0.9601	10	0.02654	T	1	-0.9447	5.6078	0.17389	0.5715:0.1347:0.2937:0.0	.	23	Q2M385	MPEG1_HUMAN	L	23	ENSP00000354335:S23L	ENSP00000354335:S23L	S	-	2	0	MPEG1	58736847	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.304000	0.08199	-0.477000	0.06832	-2.015000	0.00435	TCG	MPEG1	-	NULL		0.552	MPEG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPEG1	HGNC	protein_coding	OTTHUMT00000370027.1	G	NM_001039396		58980271	-1	no_errors	ENST00000361050	ensembl	human	known	70_37	missense	SNP	0.000	A
MYH7	4625	genome.wustl.edu	37	14	23894516	23894516	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:23894516C>T	ENST00000355349.3	-	21	2560	c.2398G>A	c.(2398-2400)Gag>Aag	p.E800K		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	800	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.E800K(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		TTTTTGTACTCCATTCTGGCG	0.592																																																	1	Substitution - Missense(1)	cervix(1)											98.0	81.0	87.0					14																	23894516		2203	4300	6503	SO:0001583	missense	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2398G>A	14.37:g.23894516C>T	ENSP00000347507:p.Glu800Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E800K	ENST00000355349.3	37	c.2398	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	36	5.674919	0.96764	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.95069	-3.6	4.6	4.6	0.57074	.	.	.	.	.	D	0.94742	0.8303	M	0.74389	2.26	0.80722	D	1	P	0.39391	0.671	B	0.43301	0.415	D	0.94352	0.7580	9	0.38643	T	0.18	.	17.9586	0.89078	0.0:1.0:0.0:0.0	.	800	P12883	MYH7_HUMAN	K	800	ENSP00000347507:E800K	ENSP00000347507:E800K	E	-	1	0	MYH7	22964356	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	4.410000	0.59774	2.543000	0.85770	0.563000	0.77884	GAG	MYH7	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.592	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	C	NM_000257		23894516	-1	no_errors	ENST00000355349	ensembl	human	known	70_37	missense	SNP	1.000	T
MYH7	4625	genome.wustl.edu	37	14	23894521	23894521	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:23894521C>T	ENST00000355349.3	-	21	2555	c.2393G>A	c.(2392-2394)aGa>aAa	p.R798K		NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	798	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)	p.R798K(1)		NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTACTCCATTCTGGCGAGCAC	0.592																																																	1	Substitution - Missense(1)	cervix(1)											98.0	81.0	87.0					14																	23894521		2203	4300	6503	SO:0001583	missense	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.2393G>A	14.37:g.23894521C>T	ENSP00000347507:p.Arg798Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R798K	ENST00000355349.3	37	c.2393	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	C	35	5.508914	0.96386	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	D	0.96491	-4.03	4.6	4.6	0.57074	.	.	.	.	.	D	0.98030	0.9351	M	0.88450	2.955	0.58432	D	0.999998	P	0.38597	0.639	P	0.53401	0.725	D	0.99376	1.0921	9	0.72032	D	0.01	.	17.9586	0.89078	0.0:1.0:0.0:0.0	.	798	P12883	MYH7_HUMAN	K	798	ENSP00000347507:R798K	ENSP00000347507:R798K	R	-	2	0	MYH7	22964361	0.736000	0.28164	1.000000	0.80357	0.969000	0.65631	7.210000	0.77924	2.543000	0.85770	0.563000	0.77884	AGA	MYH7	-	smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.592	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	C	NM_000257		23894521	-1	no_errors	ENST00000355349	ensembl	human	known	70_37	missense	SNP	1.000	T
MYO18A	399687	genome.wustl.edu	37	17	27430627	27430627	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:27430627C>G	ENST00000527372.1	-	21	3677	c.3497G>C	c.(3496-3498)gGc>gCc	p.G1166A	MYO18A_ENST00000531253.1_Missense_Mutation_p.G1166A|MYO18A_ENST00000354329.4_Missense_Mutation_p.G1166A|MYO18A_ENST00000533112.1_Missense_Mutation_p.G1166A	NM_078471.3	NP_510880.2	Q92614	MY18A_HUMAN	myosin XVIIIA	1166	Myosin motor.				actomyosin structure organization (GO:0031032)|cell migration (GO:0016477)|DNA metabolic process (GO:0006259)|Golgi organization (GO:0007030)|Golgi vesicle budding (GO:0048194)|negative regulation of apoptotic process (GO:0043066)|positive regulation of protein secretion (GO:0050714)	actomyosin (GO:0042641)|Golgi membrane (GO:0000139)|membrane (GO:0016020)|myosin complex (GO:0016459)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|DNA binding (GO:0003677)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)	p.G1166A(2)		NS(1)|cervix(1)|endometrium(6)|kidney(6)|lung(20)|urinary_tract(2)	36			Epithelial(11;4.97e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000221)|all cancers(11;0.000234)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			CCGGCTCAGGCCCATGCAGCA	0.662																																					Esophageal Squamous(182;472 2015 7001 15270 22562)												2	Substitution - Missense(2)	cervix(2)											47.0	53.0	51.0					17																	27430627		2068	4203	6271	SO:0001583	missense	399687			D86970	CCDS45641.1, CCDS45642.1	17q11.2	2011-09-27			ENSG00000196535	ENSG00000196535		"""Myosins / Myosin superfamily : Class XVIII"""	31104	protein-coding gene	gene with protein product		610067				12761286	Standard	NM_078471		Approved	KIAA0216, MysPDZ	uc002hdt.1	Q92614	OTTHUMG00000166360	ENST00000527372.1:c.3497G>C	17.37:g.27430627C>G	ENSP00000437073:p.Gly1166Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5H9U3|Q5W9F9|Q5W9G1|Q8IXP8	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_PDZ,superfamily_PDZ,superfamily_Regulat_G_prot_signal_superfam,smart_PDZ,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_PDZ,pfscan_RecA_monomer-monomer_interface,prints_Myosin_head_motor_dom	p.G1166A	ENST00000527372.1	37	c.3497	CCDS45642.1	17	.	.	.	.	.	.	.	.	.	.	C	25.4	4.637045	0.87760	.	.	ENSG00000196535	ENST00000354329;ENST00000359450;ENST00000533112;ENST00000531253;ENST00000527372;ENST00000529799;ENST00000540575;ENST00000458428	D;D;D;D	0.98649	-5.05;-5.05;-5.05;-5.05	5.31	5.31	0.75309	Myosin head, motor domain (2);	0.100729	0.64402	D	0.000002	D	0.99309	0.9758	M	0.93062	3.375	0.54753	D	0.999986	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;0.999;0.999;0.999;1.0	D	0.98962	1.0798	10	0.66056	D	0.02	.	15.9063	0.79433	0.0:1.0:0.0:0.0	.	835;778;1166;1166;1166	Q92614-2;F8W6Y3;Q92614-3;Q92614-4;Q92614	.;.;.;.;MY18A_HUMAN	A	1166;1166;1166;1166;1166;62;62;778	ENSP00000346291:G1166A;ENSP00000435932:G1166A;ENSP00000434228:G1166A;ENSP00000437073:G1166A	ENSP00000346291:G1166A	G	-	2	0	MYO18A	24454753	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.892000	0.75644	2.472000	0.83506	0.462000	0.41574	GGC	MYO18A	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.662	MYO18A-001	KNOWN	basic|CCDS	protein_coding	MYO18A	HGNC	protein_coding	OTTHUMT00000389396.1	C	NM_078471		27430627	-1	no_errors	ENST00000354329	ensembl	human	known	70_37	missense	SNP	1.000	G
NCK1	4690	genome.wustl.edu	37	3	136664454	136664454	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:136664454G>A	ENST00000481752.1	+	3	420	c.256G>A	c.(256-258)Gtg>Atg	p.V86M	NCK1_ENST00000469404.1_Missense_Mutation_p.V22M|NCK1_ENST00000288986.2_Missense_Mutation_p.V86M			P16333	NCK1_HUMAN	NCK adaptor protein 1	86					actin filament organization (GO:0007015)|axon guidance (GO:0007411)|cell migration (GO:0016477)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|lamellipodium assembly (GO:0030032)|negative regulation of cell death (GO:0060548)|negative regulation of protein kinase activity (GO:0006469)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of translation (GO:0006417)|response to other organism (GO:0051707)|signal complex assembly (GO:0007172)|T cell activation (GO:0042110)|T cell receptor signaling pathway (GO:0050852)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle membrane (GO:0012506)	cytoskeletal adaptor activity (GO:0008093)|protein kinase inhibitor activity (GO:0004860)|receptor binding (GO:0005102)|receptor signaling complex scaffold activity (GO:0030159)|receptor tyrosine kinase binding (GO:0030971)	p.V86M(1)		cervix(1)|endometrium(1)|large_intestine(2)|lung(6)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	13						AAAACCTAGTGTGCCAGATTC	0.383																																																	1	Substitution - Missense(1)	cervix(1)											62.0	66.0	64.0					3																	136664454		2203	4300	6503	SO:0001583	missense	4690			X17576	CCDS3092.1, CCDS54644.1	3q21	2013-02-14			ENSG00000158092	ENSG00000158092		"""SH2 domain containing"""	7664	protein-coding gene	gene with protein product		600508		NCK		7806213, 9737977	Standard	XM_005247498		Approved	NCKalpha	uc003erh.3	P16333	OTTHUMG00000159781	ENST00000481752.1:c.256G>A	3.37:g.136664454G>A	ENSP00000417273:p.Val86Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z751|D3DNE3	Missense_Mutation	SNP	pfam_SH3_domain,pfam_SH3_2,pfam_SH2,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,pirsf_Cytoplasmic_NCK,pfscan_SH2,pfscan_SH3_domain,prints_SH2,prints_SH3_domain	p.V86M	ENST00000481752.1	37	c.256	CCDS3092.1	3	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970627	0.53614	.	.	ENSG00000158092	ENST00000288986;ENST00000481752;ENST00000491539;ENST00000485096;ENST00000488930;ENST00000469404;ENST00000467911	T;T;T;T;T;T;T	0.68181	-0.28;-0.28;1.5;1.51;2.19;-0.31;2.19	6.16	6.16	0.99307	Src homology-3 domain (1);	0.104877	0.64402	D	0.000008	T	0.50599	0.1625	N	0.17082	0.46	0.35951	D	0.833928	B;B	0.10296	0.003;0.0	B;B	0.10450	0.005;0.002	T	0.54430	-0.8295	10	0.46703	T	0.11	-5.0334	11.5872	0.50925	0.0798:0.0:0.9202:0.0	.	22;86	B7Z751;P16333	.;NCK1_HUMAN	M	86;86;86;86;86;22;22	ENSP00000288986:V86M;ENSP00000417273:V86M;ENSP00000419302:V86M;ENSP00000419677:V86M;ENSP00000417729:V86M;ENSP00000419631:V22M;ENSP00000418060:V22M	ENSP00000288986:V86M	V	+	1	0	NCK1	138147144	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.143000	0.64826	2.937000	0.99478	0.650000	0.86243	GTG	NCK1	-	superfamily_SH3_domain,pirsf_Cytoplasmic_NCK		0.383	NCK1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	NCK1	HGNC	protein_coding	OTTHUMT00000357307.1	G	NM_006153		136664454	+1	no_errors	ENST00000288986	ensembl	human	known	70_37	missense	SNP	1.000	A
NF1	4763	genome.wustl.edu	37	17	29528441	29528441	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:29528441C>T	ENST00000358273.4	+	11	1581	c.1198C>T	c.(1198-1200)Cag>Tag	p.Q400*	NF1_ENST00000356175.3_Nonsense_Mutation_p.Q400*|NF1_ENST00000431387.4_Nonsense_Mutation_p.Q400*	NM_001042492.2	NP_001035957.1	P21359	NF1_HUMAN	neurofibromin 1	400					actin cytoskeleton organization (GO:0030036)|adrenal gland development (GO:0030325)|artery morphogenesis (GO:0048844)|brain development (GO:0007420)|camera-type eye morphogenesis (GO:0048593)|cell communication (GO:0007154)|cerebral cortex development (GO:0021987)|cognition (GO:0050890)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|forebrain astrocyte development (GO:0021897)|forebrain morphogenesis (GO:0048853)|heart development (GO:0007507)|liver development (GO:0001889)|MAPK cascade (GO:0000165)|metanephros development (GO:0001656)|myelination in peripheral nervous system (GO:0022011)|negative regulation of angiogenesis (GO:0016525)|negative regulation of astrocyte differentiation (GO:0048712)|negative regulation of cell migration (GO:0030336)|negative regulation of cell-matrix adhesion (GO:0001953)|negative regulation of endothelial cell proliferation (GO:0001937)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of MAPK cascade (GO:0043409)|negative regulation of neuroblast proliferation (GO:0007406)|negative regulation of neurotransmitter secretion (GO:0046929)|negative regulation of oligodendrocyte differentiation (GO:0048715)|negative regulation of osteoclast differentiation (GO:0045671)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of Rac protein signal transduction (GO:0035021)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of transcription factor import into nucleus (GO:0042992)|neural tube development (GO:0021915)|osteoblast differentiation (GO:0001649)|peripheral nervous system development (GO:0007422)|phosphatidylinositol 3-kinase signaling (GO:0014065)|pigmentation (GO:0043473)|positive regulation of adenylate cyclase activity (GO:0045762)|positive regulation of apoptotic process (GO:0043065)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Ras GTPase activity (GO:0032320)|Ras protein signal transduction (GO:0007265)|regulation of angiogenesis (GO:0045765)|regulation of blood vessel endothelial cell migration (GO:0043535)|regulation of bone resorption (GO:0045124)|regulation of cell-matrix adhesion (GO:0001952)|regulation of glial cell differentiation (GO:0045685)|regulation of long-term neuronal synaptic plasticity (GO:0048169)|regulation of Ras GTPase activity (GO:0032318)|regulation of synaptic transmission, GABAergic (GO:0032228)|response to hypoxia (GO:0001666)|Schwann cell development (GO:0014044)|skeletal muscle tissue development (GO:0007519)|smooth muscle tissue development (GO:0048745)|spinal cord development (GO:0021510)|sympathetic nervous system development (GO:0048485)|visual learning (GO:0008542)|wound healing (GO:0042060)	axon (GO:0030424)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)|membrane (GO:0016020)|nucleus (GO:0005634)	phosphatidylcholine binding (GO:0031210)|phosphatidylethanolamine binding (GO:0008429)|Ras GTPase activator activity (GO:0005099)	p.0?(8)|p.?(6)|p.Q400*(2)	NF1/ACCN1(2)	autonomic_ganglia(12)|breast(11)|central_nervous_system(72)|cervix(6)|endometrium(12)|haematopoietic_and_lymphoid_tissue(59)|kidney(9)|large_intestine(39)|liver(1)|lung(80)|ovary(20)|pancreas(2)|prostate(2)|skin(8)|soft_tissue(249)|stomach(2)|thyroid(1)|upper_aerodigestive_tract(5)|urinary_tract(9)	599		all_cancers(10;1.29e-12)|all_epithelial(10;0.00347)|all_hematologic(16;0.00556)|Acute lymphoblastic leukemia(14;0.00593)|Breast(31;0.014)|Myeloproliferative disorder(56;0.0255)|all_lung(9;0.0321)|Lung NSC(157;0.0659)		UCEC - Uterine corpus endometrioid carcinoma (4;4.38e-05)|all cancers(4;1.64e-26)|Epithelial(4;9.15e-23)|OV - Ovarian serous cystadenocarcinoma(4;3.58e-21)|GBM - Glioblastoma multiforme(4;0.00146)		CTGCCTGGCTCAGAATTCACC	0.308			"""D, Mis, N, F, S, O"""		"""neurofibroma, glioma"""	"""neurofibroma, glioma"""			Neurofibromatosis, type 1	TCGA GBM(6;<1E-08)|TSP Lung(7;0.0071)|TCGA Ovarian(3;0.0088)																													yes	Rec	yes	Neurofibromatosis type 1	17	17q12	4763	neurofibromatosis type 1 gene		O	16	Whole gene deletion(8)|Unknown(6)|Substitution - Nonsense(2)	soft_tissue(7)|autonomic_ganglia(3)|central_nervous_system(3)|cervix(2)|lung(1)											78.0	86.0	83.0					17																	29528441		2203	4295	6498	SO:0001587	stop_gained	4763	Familial Cancer Database	NF1, von Recklinghausen disease, incl.: Hereditary Spinal Neurofibromatosis, Neurofibromatosis-Noonan syndrome		CCDS11264.1, CCDS42292.1, CCDS45645.1	17q11.2	2014-09-17	2008-07-31		ENSG00000196712	ENSG00000196712			7765	protein-coding gene	gene with protein product	"""neurofibromatosis"", ""von Recklinghausen disease"", ""Watson disease"""	613113				1715669	Standard	NM_000267		Approved		uc002hgg.3	P21359	OTTHUMG00000132871	ENST00000358273.4:c.1198C>T	17.37:g.29528441C>T	ENSP00000351015:p.Gln400*	Somatic		WXS	Illumina HiSeq	Phase_IV	O00662|Q14284|Q14930|Q14931|Q9UMK3	Nonsense_Mutation	SNP	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,superfamily_ARM-type_fold,superfamily_CRAL-TRIO_dom,smart_RasGAP,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_RasGAP	p.Q400*	ENST00000358273.4	37	c.1198	CCDS42292.1	17	.	.	.	.	.	.	.	.	.	.	C	25.5	4.647345	0.87958	.	.	ENSG00000196712	ENST00000431387;ENST00000358273;ENST00000356175;ENST00000456735	.	.	.	5.17	5.17	0.71159	.	0.119548	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06891	T	0.86	.	18.6538	0.91441	0.0:1.0:0.0:0.0	.	.	.	.	X	400;400;400;66	.	ENSP00000348498:Q400X	Q	+	1	0	NF1	26552567	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	4.284000	0.58983	2.412000	0.81896	0.491000	0.48974	CAG	NF1	-	superfamily_ARM-type_fold		0.308	NF1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NF1	HGNC	protein_coding	OTTHUMT00000256351.2	C	NM_000267		29528441	+1	no_errors	ENST00000358273	ensembl	human	known	70_37	nonsense	SNP	1.000	T
NFAT5	10725	genome.wustl.edu	37	16	69727754	69727754	+	Silent	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr16:69727754C>G	ENST00000354436.2	+	12	4290	c.3972C>G	c.(3970-3972)ccC>ccG	p.P1324P	NFAT5_ENST00000393742.2_Silent_p.P1248P|NFAT5_ENST00000567239.1_Silent_p.P1341P|NFAT5_ENST00000566899.1_Silent_p.P1248P|NFAT5_ENST00000349945.1_Silent_p.P1248P|NFAT5_ENST00000432919.1_Silent_p.P1342P	NM_006599.3	NP_006590.1	O94916	NFAT5_HUMAN	nuclear factor of activated T-cells 5, tonicity-responsive	1324					cytokine production (GO:0001816)|excretion (GO:0007588)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of calcineurin-NFAT signaling cascade (GO:0070884)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.P1342P(1)|p.P1248P(1)		NS(1)|breast(2)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)	37						AGCAACAGCCCATGCAATTTC	0.463																																																	2	Substitution - coding silent(2)	cervix(2)											94.0	89.0	91.0					16																	69727754		2198	4300	6498	SO:0001819	synonymous_variant	10725			AF134870	CCDS10881.1, CCDS10882.1, CCDS45519.1	16q22.1	2009-11-24			ENSG00000102908	ENSG00000102908		"""Nuclear factor of activated T-cells"""	7774	protein-coding gene	gene with protein product		604708				10377394	Standard	NM_173214		Approved	TONEBP, KIAA0827, NFATL1, OREBP, NFATZ, NF-AT5	uc002exl.2	O94916	OTTHUMG00000137572	ENST00000354436.2:c.3972C>G	16.37:g.69727754C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRB4|A6H8V5|E9PHR7|O95693|Q7LA65|Q969Q8|Q96QH3|Q9UN18	Silent	SNP	pfam_RHD,superfamily_p53-like_TF_DNA-bd,superfamily_Ig_E-set,smart_IPT_TIG_rcpt,pfscan_RHD,prints_NFAT	p.P1342	ENST00000354436.2	37	c.4026	CCDS10881.1	16																																																																																			NFAT5	-	NULL		0.463	NFAT5-001	KNOWN	basic|CCDS	protein_coding	NFAT5	HGNC	protein_coding	OTTHUMT00000268952.2	C	NM_138714		69727754	+1	no_errors	ENST00000432919	ensembl	human	known	70_37	silent	SNP	1.000	G
NOX3	50508	genome.wustl.edu	37	6	155764498	155764498	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr6:155764498G>C	ENST00000159060.2	-	5	497	c.395C>G	c.(394-396)tCc>tGc	p.S132C		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	132	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.S132C(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		GGCCTCCTCGGACTGGCTCCA	0.577																																																	1	Substitution - Missense(1)	cervix(1)											96.0	81.0	86.0					6																	155764498		2203	4300	6503	SO:0001583	missense	50508			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.395C>G	6.37:g.155764498G>C	ENSP00000159060:p.Ser132Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HBJ9	Missense_Mutation	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.S132C	ENST00000159060.2	37	c.395	CCDS5250.1	6	.	.	.	.	.	.	.	.	.	.	G	13.21	2.170252	0.38315	.	.	ENSG00000074771	ENST00000159060	D	0.95885	-3.84	5.52	5.52	0.82312	Flavoprotein transmembrane component (1);	0.599135	0.15946	N	0.236957	D	0.96200	0.8761	L	0.59436	1.845	0.35640	D	0.810885	D	0.63046	0.992	P	0.59948	0.866	D	0.96459	0.9340	10	0.56958	D	0.05	-6.607	17.6208	0.88080	0.0:0.0:1.0:0.0	.	132	Q9HBY0	NOX3_HUMAN	C	132	ENSP00000159060:S132C	ENSP00000159060:S132C	S	-	2	0	NOX3	155806190	0.998000	0.40836	0.245000	0.24217	0.003000	0.03518	3.157000	0.50716	2.586000	0.87340	0.561000	0.74099	TCC	NOX3	-	pfam_Fe3_Rdtase_TM_dom		0.577	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1	G			155764498	-1	no_errors	ENST00000159060	ensembl	human	known	70_37	missense	SNP	0.867	C
NOX3	50508	genome.wustl.edu	37	6	155764527	155764527	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr6:155764527G>A	ENST00000159060.2	-	5	468	c.366C>T	c.(364-366)ttC>ttT	p.F122F		NM_015718.2	NP_056533.1	Q9HBY0	NOX3_HUMAN	NADPH oxidase 3	122	Ferric oxidoreductase.				detection of gravity (GO:0009590)|otolith development (GO:0048840)|superoxide anion generation (GO:0042554)|temperature homeostasis (GO:0001659)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|NADPH oxidase complex (GO:0043020)	superoxide-generating NADPH oxidase activity (GO:0016175)	p.F122F(1)		cervix(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(16)|ovary(1)|pancreas(1)|prostate(4)|upper_aerodigestive_tract(1)	45		Breast(66;0.0183)		OV - Ovarian serous cystadenocarcinoma(155;2.18e-12)|BRCA - Breast invasive adenocarcinoma(81;0.00815)		GTTCCAGGTTGAAGAAATGCG	0.537																																																	1	Substitution - coding silent(1)	cervix(1)											85.0	74.0	78.0					6																	155764527		2203	4300	6503	SO:0001819	synonymous_variant	50508			AF190122	CCDS5250.1	6q25.3	2008-05-15			ENSG00000074771	ENSG00000074771			7890	protein-coding gene	gene with protein product		607105				11376945	Standard	NM_015718		Approved	GP91-3	uc003qqm.3	Q9HBY0	OTTHUMG00000015883	ENST00000159060.2:c.366C>T	6.37:g.155764527G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HBJ9	Silent	SNP	pfam_Fe_red_NAD-bd_6,pfam_FAD-bd_8,pfam_Fe3_Rdtase_TM_dom,pfam_OxRdtase_FAD-bd_dom,superfamily_Riboflavin_synthase-like_b-brl,prints_Cyt_b245_heavy_chain	p.F122	ENST00000159060.2	37	c.366	CCDS5250.1	6																																																																																			NOX3	-	pfam_Fe3_Rdtase_TM_dom,prints_Cyt_b245_heavy_chain		0.537	NOX3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOX3	HGNC	protein_coding	OTTHUMT00000042819.1	G			155764527	-1	no_errors	ENST00000159060	ensembl	human	known	70_37	silent	SNP	0.997	A
NRIP1	8204	genome.wustl.edu	37	21	16337230	16337230	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr21:16337230G>A	ENST00000400202.1	-	3	3996	c.3284C>T	c.(3283-3285)tCt>tTt	p.S1095F	AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000318948.4_Missense_Mutation_p.S1095F|NRIP1_ENST00000400199.1_Missense_Mutation_p.S1095F			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	1095	Interaction with ZNF366.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.S1095F(1)		cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		ACTTTCAGCAGATGAAGCCTC	0.408																																																	1	Substitution - Missense(1)	cervix(1)											186.0	181.0	183.0					21																	16337230		2203	4300	6503	SO:0001583	missense	8204			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.3284C>T	21.37:g.16337230G>A	ENSP00000383063:p.Ser1095Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWE8	Missense_Mutation	SNP	NULL	p.S1095F	ENST00000400202.1	37	c.3284	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	3.849	-0.032211	0.07543	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.08546	3.08;3.08;3.08	5.87	3.99	0.46301	.	0.595196	0.15111	N	0.279961	T	0.04861	0.0131	N	0.16478	0.41	0.24444	N	0.994519	B	0.06786	0.001	B	0.06405	0.002	T	0.32375	-0.9909	10	0.33141	T	0.24	-15.4782	4.6096	0.12395	0.2241:0.2677:0.5083:0.0	.	1095	P48552	NRIP1_HUMAN	F	1095	ENSP00000383060:S1095F;ENSP00000383063:S1095F;ENSP00000327213:S1095F	ENSP00000327213:S1095F	S	-	2	0	NRIP1	15259101	0.724000	0.28038	0.506000	0.27664	0.660000	0.38997	1.699000	0.37804	1.630000	0.50440	0.655000	0.94253	TCT	NRIP1	-	NULL		0.408	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	G	NM_003489		16337230	-1	no_errors	ENST00000318948	ensembl	human	known	70_37	missense	SNP	0.454	A
NRIP1	8204	genome.wustl.edu	37	21	16338244	16338244	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr21:16338244G>A	ENST00000400202.1	-	3	2982	c.2270C>T	c.(2269-2271)tCt>tTt	p.S757F	AF127577.10_ENST00000446301.1_RNA|NRIP1_ENST00000318948.4_Missense_Mutation_p.S757F|NRIP1_ENST00000400199.1_Missense_Mutation_p.S757F			P48552	NRIP1_HUMAN	nuclear receptor interacting protein 1	757	Interaction with ZNF366.|Repression domain 3.				androgen receptor signaling pathway (GO:0030521)|lipid storage (GO:0019915)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|ovarian follicle rupture (GO:0001543)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|histone deacetylase complex (GO:0000118)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|estrogen receptor binding (GO:0030331)|glucocorticoid receptor binding (GO:0035259)|nuclear hormone receptor binding (GO:0035257)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)	p.S757F(1)		cervix(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(6)|lung(13)|prostate(4)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(4)	39				Epithelial(23;1.19e-05)|all cancers(11;4.64e-05)|COAD - Colon adenocarcinoma(22;0.000232)|Colorectal(24;0.0006)|OV - Ovarian serous cystadenocarcinoma(11;0.00418)|Lung(58;0.199)|LUSC - Lung squamous cell carcinoma(23;0.24)		ACAAGGCTCAGATTTTATTTT	0.403																																																	1	Substitution - Missense(1)	cervix(1)											112.0	108.0	109.0					21																	16338244		2203	4300	6503	SO:0001583	missense	8204			X84373	CCDS13568.1	21q11.2	2008-07-31			ENSG00000180530	ENSG00000180530			8001	protein-coding gene	gene with protein product	"""receptor interacting protein 140"", ""nuclear factor RIP140"""	602490				7641693, 9521594	Standard	NM_003489		Approved	RIP140	uc002yjx.2	P48552	OTTHUMG00000074323	ENST00000400202.1:c.2270C>T	21.37:g.16338244G>A	ENSP00000383063:p.Ser757Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IWE8	Missense_Mutation	SNP	NULL	p.S757F	ENST00000400202.1	37	c.2270	CCDS13568.1	21	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285215	0.80803	.	.	ENSG00000180530	ENST00000400199;ENST00000400202;ENST00000318948	T;T;T	0.09723	2.95;2.95;2.95	6.17	6.17	0.99709	.	0.239164	0.30714	N	0.009021	T	0.22475	0.0542	L	0.46157	1.445	0.45946	D	0.998774	D	0.57571	0.98	P	0.55508	0.777	T	0.00007	-1.2494	10	0.87932	D	0	-18.3492	16.2608	0.82541	0.0:0.1316:0.8683:0.0	.	757	P48552	NRIP1_HUMAN	F	757	ENSP00000383060:S757F;ENSP00000383063:S757F;ENSP00000327213:S757F	ENSP00000327213:S757F	S	-	2	0	NRIP1	15260115	1.000000	0.71417	0.998000	0.56505	0.996000	0.88848	7.073000	0.76784	2.941000	0.99782	0.655000	0.94253	TCT	NRIP1	-	NULL		0.403	NRIP1-002	KNOWN	alternative_5_UTR|not_organism_supported|basic|appris_principal|CCDS	protein_coding	NRIP1	HGNC	protein_coding	OTTHUMT00000157926.1	G	NM_003489		16338244	-1	no_errors	ENST00000318948	ensembl	human	known	70_37	missense	SNP	0.998	A
NUDT14	256281	genome.wustl.edu	37	14	105643016	105643016	+	Missense_Mutation	SNP	C	C	T	rs141847132		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:105643016C>T	ENST00000392568.2	-	4	376	c.283G>A	c.(283-285)Ggc>Agc	p.G95S	NUDT14_ENST00000550912.1_5'Flank|RP11-44N21.4_ENST00000548203.1_RNA	NM_177533.4	NP_803877.2	O95848	NUD14_HUMAN	nudix (nucleoside diphosphate linked moiety X)-type motif 14	95	Nudix hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00794}.					cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	ADP-ribose diphosphatase activity (GO:0047631)|metal ion binding (GO:0046872)|UDP-sugar diphosphatase activity (GO:0008768)	p.G95C(1)|p.G95S(1)		cervix(2)|endometrium(1)|lung(3)|ovary(1)|skin(2)|upper_aerodigestive_tract(4)|urinary_tract(1)	14		all_cancers(154;0.0336)|all_epithelial(191;0.0729)|Melanoma(154;0.155)	OV - Ovarian serous cystadenocarcinoma(23;0.00989)|all cancers(16;0.0114)|Epithelial(46;0.0272)	Epithelial(152;0.047)|OV - Ovarian serous cystadenocarcinoma(161;0.148)|all cancers(159;0.208)		CCCGCTGAGCCGGGCAGGGCT	0.677										HNSCC(42;0.11)																																							2	Substitution - Missense(2)	cervix(1)|lung(1)						C	SER/GLY	0,4398		0,0,2199	46.0	45.0	45.0		283	3.9	0.4	14	dbSNP_134	45	1,8577	1.2+/-3.3	0,1,4288	no	missense	NUDT14	NM_177533.3	56	0,1,6487	TT,TC,CC		0.0117,0.0,0.0077	possibly-damaging	95/223	105643016	1,12975	2199	4289	6488	SO:0001583	missense	256281			AB087802	CCDS10000.1	14q32.33	2013-02-15			ENSG00000183828	ENSG00000183828		"""Nudix motif containing"""	20141	protein-coding gene	gene with protein product		609219				12429023	Standard	NM_177533		Approved	UGPP	uc010tyn.3	O95848	OTTHUMG00000170372	ENST00000392568.2:c.283G>A	14.37:g.105643016C>T	ENSP00000376349:p.Gly95Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86SJ8	Missense_Mutation	SNP	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,tigrfam_NDP_pyrophosphatase	p.G95S	ENST00000392568.2	37	c.283	CCDS10000.1	14	.	.	.	.	.	.	.	.	.	.	C	14.99	2.701653	0.48307	0.0	1.17E-4	ENSG00000183828	ENST00000392568;ENST00000535832	.	.	.	3.92	3.92	0.45320	NUDIX hydrolase domain (3);NUDIX hydrolase domain-like (1);	0.264215	0.35646	N	0.003069	T	0.32585	0.0834	N	0.21194	0.64	0.35713	D	0.816516	P	0.52061	0.95	B	0.42593	0.392	T	0.33904	-0.9850	9	0.27785	T	0.31	-17.3214	11.7227	0.51691	0.0:1.0:0.0:0.0	.	95	O95848	NUD14_HUMAN	S	95	.	ENSP00000376349:G95S	G	-	1	0	NUDT14	104714061	0.973000	0.33851	0.432000	0.26747	0.068000	0.16541	4.405000	0.59741	2.480000	0.83734	0.563000	0.77884	GGC	NUDT14	-	pfam_NUDIX_hydrolase_dom,superfamily_NUDIX_hydrolase_dom-like,tigrfam_NDP_pyrophosphatase		0.677	NUDT14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUDT14	HGNC	protein_coding	OTTHUMT00000074544.4	C	NM_177533		105643016	-1	no_errors	ENST00000392568	ensembl	human	known	70_37	missense	SNP	1.000	T
NUFIP1	26747	genome.wustl.edu	37	13	45517691	45517691	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr13:45517691C>G	ENST00000379161.4	-	9	1303	c.1257G>C	c.(1255-1257)aaG>aaC	p.K419N		NM_012345.2	NP_036477.2	Q9UHK0	NUFP1_HUMAN	nuclear fragile X mental retardation protein interacting protein 1	419					box C/D snoRNP assembly (GO:0000492)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|RNA processing (GO:0006396)	cytosolic ribosome (GO:0022626)|nuclear matrix (GO:0016363)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perichromatin fibrils (GO:0005726)|pre-snoRNP complex (GO:0070761)|presynaptic active zone (GO:0048786)|transcription elongation factor complex (GO:0008023)	DNA binding (GO:0003677)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein binding, bridging (GO:0030674)|RNA binding (GO:0003723)	p.K419N(1)		breast(2)|cervix(1)|endometrium(2)|large_intestine(2)|lung(4)|prostate(4)|skin(3)	18		Lung NSC(96;8.23e-05)|Breast(139;0.00378)|Prostate(109;0.0107)|all_hematologic(4;0.014)|Lung SC(185;0.0262)|Hepatocellular(98;0.0524)|Acute lymphoblastic leukemia(4;0.143)	KIRC - Kidney renal clear cell carcinoma(16;0.234)	GBM - Glioblastoma multiforme(144;0.000306)|BRCA - Breast invasive adenocarcinoma(63;0.125)		GGTTCTCACTCTTGGCTTCTG	0.378																																																	1	Substitution - Missense(1)	cervix(1)											102.0	103.0	103.0					13																	45517691		2203	4300	6503	SO:0001583	missense	26747			AF159548	CCDS9393.1	13q14	2008-02-05			ENSG00000083635	ENSG00000083635			8057	protein-coding gene	gene with protein product		604354				10556305, 10894927	Standard	NM_012345		Approved	NUFIP	uc001uzp.2	Q9UHK0	OTTHUMG00000016842	ENST00000379161.4:c.1257G>C	13.37:g.45517691C>G	ENSP00000368459:p.Lys419Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WVM5|Q96SG1	Missense_Mutation	SNP	pfam_NUFIP1_cons_dom,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.K419N	ENST00000379161.4	37	c.1257	CCDS9393.1	13	.	.	.	.	.	.	.	.	.	.	C	12.41	1.928493	0.34002	.	.	ENSG00000083635	ENST00000379161	T	0.49432	0.78	5.72	2.98	0.34508	.	0.735384	0.14092	N	0.341936	T	0.41719	0.1171	M	0.67953	2.075	0.09310	N	1	P	0.44877	0.845	B	0.39379	0.298	T	0.25363	-1.0134	10	0.34782	T	0.22	.	6.3746	0.21501	0.0:0.6832:0.1497:0.167	.	419	Q9UHK0	NUFP1_HUMAN	N	419	ENSP00000368459:K419N	ENSP00000368459:K419N	K	-	3	2	NUFIP1	44415691	0.009000	0.17119	0.105000	0.21289	0.818000	0.46254	-0.076000	0.11412	0.749000	0.32854	0.537000	0.68136	AAG	NUFIP1	-	NULL		0.378	NUFIP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUFIP1	HGNC	protein_coding	OTTHUMT00000044755.2	C	NM_012345		45517691	-1	no_errors	ENST00000379161	ensembl	human	known	70_37	missense	SNP	0.015	G
OSBPL2	9885	genome.wustl.edu	37	20	60856904	60856904	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr20:60856904C>G	ENST00000313733.3	+	9	1043	c.841C>G	c.(841-843)Cac>Gac	p.H281D	OSBPL2_ENST00000439951.2_Missense_Mutation_p.H189D|OSBPL2_ENST00000358053.2_Missense_Mutation_p.H269D	NM_144498.1	NP_653081.1	Q9H1P3	OSBL2_HUMAN	oxysterol binding protein-like 2	281					lipid transport (GO:0006869)		cholesterol binding (GO:0015485)	p.H281D(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(2)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	17	Breast(26;7.76e-09)		BRCA - Breast invasive adenocarcinoma(19;1.33e-06)			AAAAGAACTTCACAAGGTGGA	0.453																																																	1	Substitution - Missense(1)	cervix(1)											122.0	117.0	119.0					20																	60856904		2203	4300	6503	SO:0001583	missense	9885			AB018315	CCDS13494.1, CCDS13495.1, CCDS63323.1	20q13.3	2008-08-01	2001-11-28		ENSG00000130703	ENSG00000130703		"""Oxysterol binding proteins"""	15761	protein-coding gene	gene with protein product		606731	"""oxysterol-binding protein-like 2"""			10588946, 11861666	Standard	NM_144498		Approved	KIAA0772, ORP-2	uc002yck.1	Q9H1P3	OTTHUMG00000032909	ENST00000313733.3:c.841C>G	20.37:g.60856904C>G	ENSP00000316649:p.His281Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K736|Q6IBT0|Q9BZB1|Q9Y4B8	Missense_Mutation	SNP	pfam_Oxysterol-bd	p.H281D	ENST00000313733.3	37	c.841	CCDS13495.1	20	.	.	.	.	.	.	.	.	.	.	C	22.1	4.247393	0.80024	.	.	ENSG00000130703	ENST00000358053;ENST00000313733;ENST00000439951	T;T;T	0.27557	1.66;1.66;1.66	5.1	5.1	0.69264	.	0.000000	0.85682	D	0.000000	T	0.62865	0.2463	M	0.86651	2.83	0.80722	D	1	D;D;D;D	0.89917	0.974;1.0;1.0;1.0	D;D;D;D	0.97110	0.95;1.0;1.0;1.0	T	0.70761	-0.4784	10	0.87932	D	0	-9.0253	18.0999	0.89503	0.0:1.0:0.0:0.0	.	189;281;269;281	E7ET92;B2RDK3;Q9H1P3-2;Q9H1P3	.;.;.;OSBL2_HUMAN	D	269;281;189	ENSP00000350755:H269D;ENSP00000316649:H281D;ENSP00000397602:H189D	ENSP00000316649:H281D	H	+	1	0	OSBPL2	60290299	1.000000	0.71417	0.991000	0.47740	0.788000	0.44548	7.365000	0.79537	2.372000	0.80975	0.655000	0.94253	CAC	OSBPL2	-	pfam_Oxysterol-bd		0.453	OSBPL2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL2	HGNC	protein_coding	OTTHUMT00000080021.1	C	NM_014835		60856904	+1	no_errors	ENST00000313733	ensembl	human	known	70_37	missense	SNP	1.000	G
PAG1	55824	genome.wustl.edu	37	8	81892678	81892678	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:81892678C>T	ENST00000220597.4	-	8	1638	c.928G>A	c.(928-930)Gaa>Aaa	p.E310K		NM_018440.3	NP_060910.3	Q9NWQ8	PHAG1_HUMAN	phosphoprotein membrane anchor with glycosphingolipid microdomains 1	310					epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular signal transduction (GO:0035556)|negative regulation of T cell activation (GO:0050868)|positive regulation of signal transduction (GO:0009967)|regulation of T cell activation (GO:0050863)|signal transduction (GO:0007165)|T cell receptor signaling pathway (GO:0050852)	integral component of membrane (GO:0016021)|membrane raft (GO:0045121)|plasma membrane (GO:0005886)	SH2 domain binding (GO:0042169)|SH3/SH2 adaptor activity (GO:0005070)	p.E310K(1)		breast(2)|cervix(1)|endometrium(1)|large_intestine(3)|lung(2)|prostate(2)	11	Lung NSC(7;5.76e-06)|all_lung(9;2e-05)		BRCA - Breast invasive adenocarcinoma(6;0.0567)|Epithelial(68;0.0634)|all cancers(69;0.197)			ACCTCTTCTTCTGTGAGAGTG	0.378																																																	1	Substitution - Missense(1)	cervix(1)											85.0	81.0	83.0					8																	81892678		2203	4300	6503	SO:0001583	missense	55824			AF240634	CCDS6227.1	8q21.13	2014-04-30	2014-04-30						30043	protein-coding gene	gene with protein product	"""Csk-binding protein"", ""transmembrane adaptor protein PAG"""	605767	"""phosphoprotein associated with glycosphingolipid microdomains 1"""			10790433	Standard	XM_006716461		Approved	PAG, CBP	uc003ybz.3	Q9NWQ8		ENST00000220597.4:c.928G>A	8.37:g.81892678C>T	ENSP00000220597:p.Glu310Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1A3|Q2M1Z9|Q5BKU4|Q9NYK0	Missense_Mutation	SNP	NULL	p.E310K	ENST00000220597.4	37	c.928	CCDS6227.1	8	.	.	.	.	.	.	.	.	.	.	C	20.3	3.963673	0.74016	.	.	ENSG00000076641	ENST00000220597	.	.	.	5.12	5.12	0.69794	.	0.053895	0.64402	D	0.000001	T	0.70971	0.3285	M	0.69823	2.125	0.49483	D	0.999798	P	0.46395	0.877	P	0.49853	0.624	T	0.74919	-0.3500	9	0.59425	D	0.04	-18.1227	16.7186	0.85404	0.0:1.0:0.0:0.0	.	310	Q9NWQ8	PAG1_HUMAN	K	310	.	ENSP00000220597:E310K	E	-	1	0	PAG1	82055233	1.000000	0.71417	1.000000	0.80357	0.931000	0.56810	4.730000	0.62015	2.366000	0.80165	0.655000	0.94253	GAA	PAG1	-	NULL		0.378	PAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAG1	HGNC	protein_coding	OTTHUMT00000379352.3	C	NM_018440		81892678	-1	no_errors	ENST00000220597	ensembl	human	known	70_37	missense	SNP	1.000	T
PCDHAC1	56135	genome.wustl.edu	37	5	140306841	140306841	+	Missense_Mutation	SNP	C	C	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr5:140306841C>A	ENST00000253807.2	+	1	364	c.364C>A	c.(364-366)Cct>Act	p.P122T	PCDHA9_ENST00000532602.1_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA13_ENST00000409494.1_Intron|PCDHA12_ENST00000398631.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA13_ENST00000289272.2_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHAC1_ENST00000409700.3_Missense_Mutation_p.P122T|PCDHA11_ENST00000398640.2_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA10_ENST00000307360.5_Intron	NM_018898.3	NP_061721.2	Q9H158	PCDC1_HUMAN	protocadherin alpha subfamily C, 1	122	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)	p.P122T(1)		NS(2)|breast(3)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(13)|liver(2)|lung(13)|ovary(3)|prostate(2)|skin(7)|upper_aerodigestive_tract(3)|urinary_tract(4)	65			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGACAACTCACCTCTCTTTCC	0.607																																																	1	Substitution - Missense(1)	cervix(1)											64.0	58.0	60.0					5																	140306841		2203	4300	6503	SO:0001583	missense	56135			AF152473	CCDS4241.1	5q31	2010-11-26			ENSG00000248383	ENSG00000248383		"""Cadherins / Protocadherins : Clustered"""	8676	other	complex locus constituent	"""PCDH-ALPHA-C1"""	606320				10380929	Standard	NM_018898		Approved			Q9H158	OTTHUMG00000129603	ENST00000253807.2:c.364C>A	5.37:g.140306841C>A	ENSP00000253807:p.Pro122Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9Y5F5|Q9Y5I5	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.P122T	ENST00000253807.2	37	c.364	CCDS4241.1	5	.	.	.	.	.	.	.	.	.	.	C	34	5.391028	0.95988	.	.	ENSG00000248383	ENST00000409700;ENST00000253807	T;T	0.72394	-0.65;-0.65	5.48	5.48	0.80851	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	.	.	.	.	D	0.90445	0.7008	H	0.97540	4.025	0.43885	D	0.996501	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;0.999	D	0.93577	0.6909	9	0.87932	D	0	.	19.3478	0.94372	0.0:1.0:0.0:0.0	.	122;122	Q9H158;Q9H158-2	PCDC1_HUMAN;.	T	122	ENSP00000386356:P122T;ENSP00000253807:P122T	ENSP00000253807:P122T	P	+	1	0	PCDHAC1	140287025	1.000000	0.71417	0.800000	0.32199	0.988000	0.76386	4.938000	0.63519	2.568000	0.86640	0.561000	0.74099	CCT	PCDHAC1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.607	PCDHAC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHAC1	HGNC	protein_coding	OTTHUMT00000251798.1	C	NM_018898		140306841	+1	no_errors	ENST00000253807	ensembl	human	known	70_37	missense	SNP	1.000	A
PDE4B	5142	genome.wustl.edu	37	1	66732396	66732396	+	Intron	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:66732396G>C	ENST00000329654.4	+	7	821				PDE4B_ENST00000371049.3_Intron|PDE4B_ENST00000423207.2_Intron|PDE4B_ENST00000371048.3_3'UTR	NM_001037341.1	NP_001032418.1	Q07343	PDE4B_HUMAN	phosphodiesterase 4B, cAMP-specific						cAMP catabolic process (GO:0006198)|cellular response to drug (GO:0035690)|cellular response to epinephrine stimulus (GO:0071872)|cellular response to lipopolysaccharide (GO:0071222)|leukocyte migration (GO:0050900)|negative regulation of relaxation of cardiac muscle (GO:1901898)|neutrophil chemotaxis (GO:0030593)|neutrophil homeostasis (GO:0001780)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interleukin-2 production (GO:0032743)|regulation of cardiac muscle cell contraction (GO:0086004)|regulation of high voltage-gated calcium channel activity (GO:1901841)|T cell receptor signaling pathway (GO:0050852)	cell periphery (GO:0071944)|cytosol (GO:0005829)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|Z disc (GO:0030018)	3',5'-cyclic-AMP phosphodiesterase activity (GO:0004115)|3',5'-cyclic-nucleotide phosphodiesterase activity (GO:0004114)|cAMP binding (GO:0030552)|ion channel binding (GO:0044325)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)	37					Adenosine monophosphate(DB00131)|Amrinone(DB01427)|Caffeine(DB00201)|Dyphylline(DB00651)|Enprofylline(DB00824)|Ibudilast(DB05266)|Iloprost(DB01088)|Ketotifen(DB00920)|Papaverine(DB01113)|Pentoxifylline(DB00806)|Roflumilast(DB01656)|Theobromine(DB01412)|Theophylline(DB00277)	GAGCTGCAGAGAGGAAGGGCC	0.393																																																	0													29.0	25.0	26.0					1																	66732396		876	1991	2867	SO:0001627	intron_variant	5142			L20971	CCDS632.1, CCDS30742.1, CCDS30743.1, CCDS72802.1	1p31	2010-06-24	2010-06-24		ENSG00000184588	ENSG00000184588		"""Phosphodiesterases"""	8781	protein-coding gene	gene with protein product	"""phosphodiesterase E4 dunce homolog (Drosophila)"""	600127	"""phosphodiesterase 4B, cAMP-specific (dunce (Drosophila)-homolog phosphodiesterase E4)"", ""phosphodiesterase 4B, cAMP-specific (phosphodiesterase E4 dunce homolog, Drosophila)"""	DPDE4			Standard	XM_005270925		Approved		uc001dco.3	Q07343	OTTHUMG00000009088	ENST00000329654.4:c.634+626G>C	1.37:g.66732396G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A5YW33|O15443|Q13945|Q5TEK4|Q5TEK5|Q5TEK6	RNA	SNP	-	NULL	ENST00000329654.4	37	NULL	CCDS632.1	1																																																																																			PDE4B	-	-		0.393	PDE4B-001	KNOWN	basic|CCDS	protein_coding	PDE4B	HGNC	protein_coding	OTTHUMT00000025188.3	G	NM_002600		66732396	+1	no_errors	ENST00000371048	ensembl	human	known	70_37	rna	SNP	0.000	C
PDGFRB	5159	genome.wustl.edu	37	5	149506138	149506138	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr5:149506138G>A	ENST00000261799.4	-	11	2088	c.1619C>T	c.(1618-1620)gCc>gTc	p.A540V		NM_002609.3	NP_002600.1	P09619	PGFRB_HUMAN	platelet-derived growth factor receptor, beta polypeptide	540					adrenal gland development (GO:0030325)|aorta morphogenesis (GO:0035909)|cardiac myofibril assembly (GO:0055003)|cell chemotaxis (GO:0060326)|cell migration (GO:0016477)|cell migration involved in coronary angiogenesis (GO:0060981)|cell migration involved in vasculogenesis (GO:0035441)|cellular response to platelet-derived growth factor stimulus (GO:0036120)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|G-protein coupled receptor signaling pathway (GO:0007186)|glycosaminoglycan biosynthetic process (GO:0006024)|in utero embryonic development (GO:0001701)|innate immune response (GO:0045087)|inner ear development (GO:0048839)|metanephric comma-shaped body morphogenesis (GO:0072278)|metanephric glomerular capillary formation (GO:0072277)|metanephric glomerular mesangial cell proliferation involved in metanephros development (GO:0072262)|metanephric mesenchymal cell migration (GO:0035789)|metanephric mesenchyme development (GO:0072075)|metanephric S-shaped body morphogenesis (GO:0072284)|negative regulation of apoptotic process (GO:0043066)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol metabolic process (GO:0046488)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|platelet-derived growth factor receptor-beta signaling pathway (GO:0035791)|positive regulation of calcium ion import (GO:0090280)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation by VEGF-activated platelet derived growth factor receptor signaling pathway (GO:0038091)|positive regulation of chemotaxis (GO:0050921)|positive regulation of collagen biosynthetic process (GO:0032967)|positive regulation of DNA biosynthetic process (GO:2000573)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of MAP kinase activity (GO:0043406)|positive regulation of metanephric mesenchymal cell migration by platelet-derived growth factor receptor-beta signaling pathway (GO:0035793)|positive regulation of mitosis (GO:0045840)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of phosphoprotein phosphatase activity (GO:0032516)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of smooth muscle cell migration (GO:0014911)|positive regulation of smooth muscle cell proliferation (GO:0048661)|protein autophosphorylation (GO:0046777)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of peptidyl-tyrosine phosphorylation (GO:0050730)|response to estradiol (GO:0032355)|response to fluid shear stress (GO:0034405)|response to hydrogen peroxide (GO:0042542)|response to hyperoxia (GO:0055093)|response to retinoic acid (GO:0032526)|response to toxic substance (GO:0009636)|retina vasculature development in camera-type eye (GO:0061298)|signal transduction (GO:0007165)|skeletal system morphogenesis (GO:0048705)|smooth muscle cell chemotaxis (GO:0071670)|smooth muscle tissue development (GO:0048745)|tissue homeostasis (GO:0001894)|transforming growth factor beta receptor signaling pathway (GO:0007179)|wound healing (GO:0042060)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|lysosome (GO:0005764)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|platelet activating factor receptor activity (GO:0004992)|platelet-derived growth factor beta-receptor activity (GO:0005019)|platelet-derived growth factor binding (GO:0048407)|platelet-derived growth factor receptor binding (GO:0005161)|platelet-derived growth factor-activated receptor activity (GO:0005017)|protein kinase binding (GO:0019901)|protein tyrosine kinase activity (GO:0004713)|receptor binding (GO:0005102)|vascular endothelial growth factor binding (GO:0038085)	p.A540V(1)		breast(3)|central_nervous_system(5)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(9)|kidney(3)|large_intestine(12)|lung(20)|ovary(3)|prostate(3)|skin(3)|stomach(6)|urinary_tract(1)	75		all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)		Becaplermin(DB00102)|Dasatinib(DB01254)|Imatinib(DB00619)|Pazopanib(DB06589)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	CACCACCAGGGCCAGGATGGC	0.572			T	"""ETV6, TRIP11, HIP1, RAB5EP, H4, NIN, HCMOGT-1, PDE4DIP"""	"""MPD, AML, CMML, CML"""																																			Dom	yes		5	5q31-q32	5159	"""platelet-derived growth factor receptor, beta polypeptide"""		L	1	Substitution - Missense(1)	cervix(1)											123.0	95.0	105.0					5																	149506138		2203	4300	6503	SO:0001583	missense	5159			M21616	CCDS4303.1	5q33.1	2013-01-29			ENSG00000113721	ENSG00000113721		"""CD molecules"", ""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	8804	protein-coding gene	gene with protein product		173410		PDGFR			Standard	XM_005268464		Approved	JTK12, CD140b, PDGFR1	uc003lro.3	P09619	OTTHUMG00000130053	ENST00000261799.4:c.1619C>T	5.37:g.149506138G>A	ENSP00000261799:p.Ala540Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B5A957|Q8N5L4	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,prints_Tyr_kinase_VEGFR_rcpt_N	p.A540V	ENST00000261799.4	37	c.1619	CCDS4303.1	5	.	.	.	.	.	.	.	.	.	.	G	12.18	1.860488	0.32884	.	.	ENSG00000113721	ENST00000261799;ENST00000544453	T	0.77877	-1.13	4.92	4.92	0.64577	.	0.000000	0.52532	D	0.000070	T	0.78572	0.4304	L	0.33339	1.005	0.48452	D	0.999659	B;D	0.69078	0.376;0.997	B;P	0.61533	0.07;0.89	T	0.72701	-0.4214	10	0.06494	T	0.89	.	18.1376	0.89624	0.0:0.0:1.0:0.0	.	540;540	A8KAM8;P09619	.;PGFRB_HUMAN	V	540;210	ENSP00000261799:A540V	ENSP00000261799:A540V	A	-	2	0	PDGFRB	149486331	1.000000	0.71417	1.000000	0.80357	0.974000	0.67602	3.444000	0.52914	2.285000	0.76669	0.455000	0.32223	GCC	PDGFRB	-	pirsf_Tyr_kinase_CSF1/PDGF_rcpt		0.572	PDGFRB-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDGFRB	HGNC	protein_coding	OTTHUMT00000252332.1	G	NM_002609		149506138	-1	no_errors	ENST00000261799	ensembl	human	known	70_37	missense	SNP	1.000	A
PDLIM1	9124	genome.wustl.edu	37	10	97050722	97050722	+	5'UTR	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr10:97050722G>C	ENST00000329399.6	-	0	59				PDLIM1_ENST00000477757.1_5'UTR	NM_020992.2	NP_066272.1	O00151	PDLI1_HUMAN	PDZ and LIM domain 1						regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|response to oxidative stress (GO:0006979)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|transcription factor complex (GO:0005667)	transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(5)|lung(1)|ovary(1)|skin(2)	10		Colorectal(252;0.083)		Epithelial(162;1.64e-06)|all cancers(201;3.71e-05)		GGCAGGACGCGCGGAACAGCT	0.776																																																	0													7.0	9.0	8.0					10																	97050722		2148	4212	6360	SO:0001623	5_prime_UTR_variant	9124			U90878	CCDS7441.1	10q23.1	2008-07-29	2008-07-29		ENSG00000107438	ENSG00000107438			2067	protein-coding gene	gene with protein product	"""carboxyl terminal LIM domain protein 1"", ""elfin"""	605900	"""PDZ and LIM domain 1 (elfin)"""	CLIM1		10861853	Standard	NM_020992		Approved	CLP-36, hCLIM1, CLP36	uc001kkh.4	O00151	OTTHUMG00000018810	ENST00000329399.6:c.-50C>G	10.37:g.97050722G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBS6|Q5VZH5|Q9BPZ9	RNA	SNP	-	NULL	ENST00000329399.6	37	NULL	CCDS7441.1	10																																																																																			PDLIM1	-	-		0.776	PDLIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDLIM1	HGNC	protein_coding	OTTHUMT00000049508.1	G			97050722	-1	no_errors	ENST00000477757	ensembl	human	known	70_37	rna	SNP	0.000	C
PIWIL4	143689	genome.wustl.edu	37	11	94341823	94341823	+	Silent	SNP	C	C	T	rs146415204	byFrequency	TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr11:94341823C>T	ENST00000299001.6	+	15	2125	c.1914C>T	c.(1912-1914)tgC>tgT	p.C638C	RP11-867G2.8_ENST00000536540.1_RNA|RP11-867G2.8_ENST00000537874.1_RNA	NM_152431.2	NP_689644.2	Q7Z3Z4	PIWL4_HUMAN	piwi-like RNA-mediated gene silencing 4	638	Piwi. {ECO:0000255|PROSITE- ProRule:PRU00150}.				cell differentiation (GO:0030154)|DNA methylation involved in gamete generation (GO:0043046)|gene silencing by RNA (GO:0031047)|meiotic nuclear division (GO:0007126)|multicellular organismal development (GO:0007275)|piRNA metabolic process (GO:0034587)|regulation of translation (GO:0006417)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|P granule (GO:0043186)|piP-body (GO:0071547)	piRNA binding (GO:0034584)	p.C638C(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(10)|prostate(1)|skin(1)|urinary_tract(2)	30		Acute lymphoblastic leukemia(157;2.26e-05)|all_hematologic(158;0.0123)				TTGTTGGATGCGTGGCCAGTG	0.388													c|||	2	0.000399361	0.0	0.0014	5008	,	,		18787	0.0		0.0	False		,,,				2504	0.001																1	Substitution - coding silent(1)	cervix(1)						T		4,4398	8.1+/-20.4	0,4,2197	256.0	225.0	236.0		1914	2.2	1.0	11	dbSNP_134	236	25,8571	17.3+/-56.4	0,25,4273	no	coding-synonymous	PIWIL4	NM_152431.2		0,29,6470	TT,TC,CC		0.2908,0.0909,0.2231		638/853	94341823	29,12969	2201	4298	6499	SO:0001819	synonymous_variant	143689			AB079366	CCDS31656.1	11q12	2013-02-15	2013-02-15			ENSG00000134627		"""Argonaute/PIWI family"""	18444	protein-coding gene	gene with protein product		610315	"""piwi-like 4 (Drosophila)"""			12906857	Standard	NM_152431		Approved	FLJ36156, HIWI2, Miwi2	uc001pfa.3	Q7Z3Z4		ENST00000299001.6:c.1914C>T	11.37:g.94341823C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DEG5|Q68CZ4|Q8N8G9|Q8N9V8|Q8NEH2	Silent	SNP	pfam_Piwi,pfam_PAZ,superfamily_RNaseH-like_dom,superfamily_PAZ,smart_PAZ,smart_Piwi,pfscan_PAZ,pfscan_Piwi	p.C638	ENST00000299001.6	37	c.1914	CCDS31656.1	11																																																																																			PIWIL4	-	pfam_Piwi,superfamily_RNaseH-like_dom,smart_Piwi,pfscan_Piwi		0.388	PIWIL4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PIWIL4	HGNC	protein_coding	OTTHUMT00000396388.1	C	NM_152431		94341823	+1	no_errors	ENST00000299001	ensembl	human	known	70_37	silent	SNP	1.000	T
PHLDB1	23187	genome.wustl.edu	37	11	118498318	118498318	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr11:118498318C>T	ENST00000361417.2	+	7	1190	c.779C>T	c.(778-780)tCa>tTa	p.S260L	PHLDB1_ENST00000356063.5_Missense_Mutation_p.S260L	NM_015157.3	NP_055972.1	Q86UU1	PHLB1_HUMAN	pleckstrin homology-like domain, family B, member 1	260								p.S260L(1)		breast(3)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(10)|liver(3)|lung(14)|ovary(2)|pancreas(1)|prostate(3)|skin(1)	46	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_hematologic(192;0.0735)|all_neural(223;0.224)		BRCA - Breast invasive adenocarcinoma(274;3.4e-05)		CCACTCTCTTCACCAGCCAGC	0.622																																																	1	Substitution - Missense(1)	cervix(1)											91.0	100.0	97.0					11																	118498318		2200	4295	6495	SO:0001583	missense	23187				CCDS8401.1, CCDS44750.1	11q23.3	2013-01-10			ENSG00000019144	ENSG00000019144		"""Pleckstrin homology (PH) domain containing"""	23697	protein-coding gene	gene with protein product		612834				14532993	Standard	NM_015157		Approved	FLJ00141, LL5a, KIAA0638	uc001pts.3	Q86UU1	OTTHUMG00000166341	ENST00000361417.2:c.779C>T	11.37:g.118498318C>T	ENSP00000354498:p.Ser260Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ63|B0YJ64|O75133|Q4KMF8|Q8TEQ2	Missense_Mutation	SNP	pfam_Pleckstrin_homology,superfamily_SMAD_FHA_domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.S260L	ENST00000361417.2	37	c.779	CCDS8401.1	11	.	.	.	.	.	.	.	.	.	.	C	18.84	3.709095	0.68615	.	.	ENSG00000019144	ENST00000361417;ENST00000361465;ENST00000543207;ENST00000356063	T;T	0.35421	1.33;1.31	5.66	5.66	0.87406	.	0.126543	0.56097	D	0.000039	T	0.49253	0.1546	L	0.55481	1.735	0.80722	D	1	D;P;D;P	0.54207	0.965;0.617;0.965;0.941	P;B;P;P	0.55785	0.767;0.173;0.784;0.683	T	0.22661	-1.0210	10	0.26408	T	0.33	-12.8661	17.5299	0.87811	0.0:1.0:0.0:0.0	.	259;260;260;260	B4DIX4;Q86UU1-3;Q86UU1-2;Q86UU1	.;.;.;PHLB1_HUMAN	L	260;19;259;260	ENSP00000354498:S260L;ENSP00000348359:S260L	ENSP00000348359:S260L	S	+	2	0	PHLDB1	118003528	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.206000	0.77891	2.667000	0.90743	0.563000	0.77884	TCA	PHLDB1	-	NULL		0.622	PHLDB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHLDB1	HGNC	protein_coding	OTTHUMT00000389279.1	C	NM_015157		118498318	+1	no_errors	ENST00000361417	ensembl	human	known	70_37	missense	SNP	1.000	T
PLEC	5339	genome.wustl.edu	37	8	144992837	144992837	+	Missense_Mutation	SNP	C	C	T	rs201007788		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:144992837C>T	ENST00000322810.4	-	32	11732	c.11563G>A	c.(11563-11565)Gag>Aag	p.E3855K	PLEC_ENST00000356346.3_Missense_Mutation_p.E3704K|PLEC_ENST00000398774.2_Missense_Mutation_p.E3686K|PLEC_ENST00000354958.2_Missense_Mutation_p.E3696K|PLEC_ENST00000354589.3_Missense_Mutation_p.E3718K|PLEC_ENST00000527096.1_Missense_Mutation_p.E3741K|PLEC_ENST00000436759.2_Missense_Mutation_p.E3745K|PLEC_ENST00000357649.2_Missense_Mutation_p.E3722K|PLEC_ENST00000345136.3_Missense_Mutation_p.E3718K	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3855	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)	p.E3745K(1)|p.E3718K(1)|p.E3855K(1)		NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGGGCCACCTCGGCACTCAGC	0.652																																																	3	Substitution - Missense(3)	cervix(3)											25.0	31.0	29.0					8																	144992837		1927	4061	5988	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.11563G>A	8.37:g.144992837C>T	ENSP00000323856:p.Glu3855Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.E3855K	ENST00000322810.4	37	c.11563	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	14.02	2.410762	0.42817	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76578	-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03;-1.03	3.78	3.78	0.43462	.	0.090535	0.42548	U	0.000691	T	0.71143	0.3305	L	0.29908	0.895	0.58432	D	0.999998	P;P;P;P;P;P;P;P	0.52061	0.938;0.938;0.938;0.95;0.938;0.938;0.938;0.938	B;B;B;P;B;B;B;B	0.45829	0.435;0.361;0.361;0.494;0.361;0.361;0.361;0.361	T	0.77059	-0.2728	10	0.72032	D	0.01	.	14.8963	0.70646	0.0:1.0:0.0:0.0	.	3745;3704;3696;3855;3686;3718;3722;3718	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	K	3718;3722;3718;3686;3855;3696;3704;3745;3741	ENSP00000344848:E3718K;ENSP00000350277:E3722K;ENSP00000346602:E3718K;ENSP00000381756:E3686K;ENSP00000323856:E3855K;ENSP00000347044:E3696K;ENSP00000348702:E3704K;ENSP00000388180:E3745K;ENSP00000434583:E3741K	ENSP00000323856:E3855K	E	-	1	0	PLEC	145064825	1.000000	0.71417	0.915000	0.36163	0.900000	0.52787	7.551000	0.82182	2.103000	0.63969	0.297000	0.19635	GAG	PLEC	-	pfam_Plectin_repeat,smart_Plectin_repeat		0.652	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	C	NM_000445		144992837	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	missense	SNP	1.000	T
PLXNB2	23654	genome.wustl.edu	37	22	50719361	50719361	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr22:50719361C>T	ENST00000449103.1	-	24	3945	c.3805G>A	c.(3805-3807)Gag>Aag	p.E1269K	PLXNB2_ENST00000359337.4_Missense_Mutation_p.E1269K|PLXNB2_ENST00000496720.1_5'Flank			O15031	PLXB2_HUMAN	plexin B2	1269					brain development (GO:0007420)|neural tube closure (GO:0001843)|neuroblast proliferation (GO:0007405)|positive regulation of axonogenesis (GO:0050772)|regulation of cell shape (GO:0008360)|regulation of neuron migration (GO:2001222)|regulation of protein phosphorylation (GO:0001932)|regulation of Rho GTPase activity (GO:0032319)|semaphorin-plexin signaling pathway (GO:0071526)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|intracellular (GO:0005622)	GTPase activator activity (GO:0005096)|semaphorin receptor activity (GO:0017154)	p.E1312K(1)		breast(2)|central_nervous_system(4)|cervix(2)|endometrium(11)|kidney(4)|large_intestine(3)|liver(1)|lung(20)|ovary(5)|prostate(6)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(2)	66		all_cancers(38;5.78e-13)|all_epithelial(38;1.71e-11)|all_lung(38;3.89e-05)|Breast(42;0.000523)|Lung NSC(38;0.000992)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		ATGCCGGCCTCGTGCACGTCG	0.647																																																	1	Substitution - Missense(1)	cervix(1)											77.0	89.0	85.0					22																	50719361		2167	4250	6417	SO:0001583	missense	23654				CCDS43035.1	22q13.33	2008-06-12			ENSG00000196576	ENSG00000196576		"""Plexins"""	9104	protein-coding gene	gene with protein product		604293				10520995, 12183458	Standard	NM_012401		Approved	MM1, KIAA0315, PLEXB2	uc003bkv.4	O15031	OTTHUMG00000150219	ENST00000449103.1:c.3805G>A	22.37:g.50719361C>T	ENSP00000409171:p.Glu1269Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6QRH0|Q7KZU3|Q9BSU7	Missense_Mutation	SNP	pfam_Plexin_cytoplasmic_RasGAP_dom,pfam_IPT_TIG_rcpt,pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Rho_GTPase_activation_prot,superfamily_Ig_E-set,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_IPT_TIG_rcpt,pfscan_Semaphorin/CD100_Ag	p.E1269K	ENST00000449103.1	37	c.3805	CCDS43035.1	22	.	.	.	.	.	.	.	.	.	.	C	27.3	4.821542	0.90873	.	.	ENSG00000196576	ENST00000449103;ENST00000359337	T;T	0.03242	4.0;4.0	4.38	4.38	0.52667	.	0.306262	0.27715	N	0.018156	T	0.15132	0.0365	M	0.68593	2.085	0.58432	D	0.999999	D	0.89917	1.0	D	0.79784	0.993	T	0.13926	-1.0491	10	0.20519	T	0.43	.	17.0975	0.86639	0.0:1.0:0.0:0.0	.	1269	O15031	PLXB2_HUMAN	K	1269	ENSP00000409171:E1269K;ENSP00000352288:E1269K	ENSP00000352288:E1269K	E	-	1	0	PLXNB2	49061488	1.000000	0.71417	0.993000	0.49108	0.548000	0.35241	7.329000	0.79170	2.270000	0.75569	0.561000	0.74099	GAG	PLXNB2	-	NULL		0.647	PLXNB2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLXNB2	HGNC	protein_coding	OTTHUMT00000316874.3	C	NM_012401		50719361	-1	no_errors	ENST00000359337	ensembl	human	known	70_37	missense	SNP	1.000	T
PON3	5446	genome.wustl.edu	37	7	95001611	95001611	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:95001611C>T	ENST00000265627.5	-	4	251	c.241G>A	c.(241-243)Gaa>Aaa	p.E81K	PON1_ENST00000542556.1_Intron|PON3_ENST00000427422.1_Missense_Mutation_p.E81K|PON3_ENST00000451904.1_Missense_Mutation_p.E81K	NM_000940.2	NP_000931.1	Q15166	PON3_HUMAN	paraoxonase 3	81					aromatic compound catabolic process (GO:0019439)|carboxylic acid catabolic process (GO:0046395)|coumarin catabolic process (GO:0046226)|phenylacetate catabolic process (GO:0010124)|response to external stimulus (GO:0009605)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)	3,4-dihydrocoumarin hydrolase activity (GO:0018733)|aryldialkylphosphatase activity (GO:0004063)|arylesterase activity (GO:0004064)|dihydrocoumarin hydrolase activity (GO:0047856)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)	p.E81K(1)		breast(1)|cervix(1)|endometrium(2)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	24	all_cancers(62;1.04e-10)|all_epithelial(64;3.67e-09)|Lung NSC(181;0.239)		STAD - Stomach adenocarcinoma(171;0.0151)		Edetic Acid(DB00974)|Lovastatin(DB00227)	TTTCCTGGTTCATCTGGCGCA	0.353																																																	1	Substitution - Missense(1)	cervix(1)											136.0	128.0	131.0					7																	95001611		2203	4300	6503	SO:0001583	missense	5446			L48516, AF320003	CCDS5639.1	7q21.3	2014-03-14			ENSG00000105852	ENSG00000105852	3.1.1.2	"""Paraoxonases"""	9206	protein-coding gene	gene with protein product	"""arylesterase 3"""	602720				8661009	Standard	NM_000940		Approved			Q15166	OTTHUMG00000153917	ENST00000265627.5:c.241G>A	7.37:g.95001611C>T	ENSP00000265627:p.Glu81Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1H8|O75855|O76060|Q6IRU9|Q8IX97|Q9BZH9	Missense_Mutation	SNP	pfam_Arylesterase,pfam_SGL,pfam_Strictosidine_synth_cons-reg,prints_Arylesterase,prints_Paraoxonase2	p.E81K	ENST00000265627.5	37	c.241	CCDS5639.1	7	.	.	.	.	.	.	.	.	.	.	C	1.837	-0.468438	0.04445	.	.	ENSG00000105852	ENST00000265627;ENST00000427422	T;T	0.16743	2.32;2.32	4.82	-1.31	0.09230	Six-bladed beta-propeller, TolB-like (1);	0.648190	0.16104	N	0.229401	T	0.04770	0.0129	N	0.02275	-0.615	0.09310	N	0.999999	B;B	0.09022	0.002;0.0	B;B	0.06405	0.002;0.001	T	0.42481	-0.9449	10	0.02654	T	1	-4.8313	10.2118	0.43145	0.0:0.2835:0.0:0.7165	.	129;81	B4E2I0;Q15166	.;PON3_HUMAN	K	81	ENSP00000265627:E81K;ENSP00000413276:E81K	ENSP00000265627:E81K	E	-	1	0	PON3	94839547	0.840000	0.29493	0.511000	0.27724	0.758000	0.43043	0.436000	0.21526	-0.134000	0.11516	0.555000	0.69702	GAA	PON3	-	prints_Arylesterase		0.353	PON3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PON3	HGNC	protein_coding	OTTHUMT00000333007.1	C	NM_000940		95001611	-1	no_errors	ENST00000265627	ensembl	human	known	70_37	missense	SNP	0.149	T
PSME3	10197	genome.wustl.edu	37	17	40991365	40991365	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:40991365C>T	ENST00000590720.1	+	10	885	c.652C>T	c.(652-654)Cgg>Tgg	p.R218W	PSME3_ENST00000441946.2_Missense_Mutation_p.R229W|PSME3_ENST00000592169.1_Missense_Mutation_p.R162W|PSME3_ENST00000545225.1_Missense_Mutation_p.R157W|PSME3_ENST00000541124.1_3'UTR|PSME3_ENST00000293362.3_Missense_Mutation_p.R231W			P61289	PSME3_HUMAN	proteasome (prosome, macropain) activator subunit 3 (PA28 gamma; Ki)	218					anaphase-promoting complex-dependent proteasomal ubiquitin-dependent protein catabolic process (GO:0031145)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|apoptotic process (GO:0006915)|cellular nitrogen compound metabolic process (GO:0034641)|DNA damage response, signal transduction by p53 class mediator resulting in cell cycle arrest (GO:0006977)|G1/S transition of mitotic cell cycle (GO:0000082)|gene expression (GO:0010467)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway (GO:2001237)|negative regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051436)|positive regulation of endopeptidase activity (GO:0010950)|positive regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051437)|protein polyubiquitination (GO:0000209)|regulation of apoptotic process (GO:0042981)|regulation of cellular amino acid metabolic process (GO:0006521)|regulation of proteasomal protein catabolic process (GO:0061136)|regulation of ubiquitin-protein ligase activity involved in mitotic cell cycle (GO:0051439)|RNA metabolic process (GO:0016070)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|proteasome activator complex (GO:0008537)|proteasome complex (GO:0000502)	endopeptidase activator activity (GO:0061133)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)	p.R231W(1)		NS(1)|cervix(1)|large_intestine(3)|lung(1)	6		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.156)		TATCAGCCTTCGGCTCATCAT	0.443																																																	1	Substitution - Missense(1)	cervix(1)											80.0	77.0	78.0					17																	40991365		2203	4300	6503	SO:0001583	missense	10197			U11292	CCDS11442.1, CCDS45689.1, CCDS59290.1	17q12-q21	2004-02-17				ENSG00000131467		"""Proteasome (prosome, macropain) subunits"""	9570	protein-coding gene	gene with protein product		605129				7951316	Standard	NM_005789		Approved	Ki, PA28-gamma, REG-GAMMA, PA28G	uc002ibq.4	P61289		ENST00000590720.1:c.652C>T	17.37:g.40991365C>T	ENSP00000466794:p.Arg218Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9A3|O35563|P97373|Q12920|Q13172|Q9BQD9	Missense_Mutation	SNP	pfam_Proteasome_activ_REG_bsu,pfam_Proteasome_activ_REG_asu,superfamily_Proteasome_activ_REG_asu/bsu	p.R231W	ENST00000590720.1	37	c.691	CCDS45689.1	17	.	.	.	.	.	.	.	.	.	.	C	15.17	2.753032	0.49362	.	.	ENSG00000131467	ENST00000545225;ENST00000293362;ENST00000441946	T;T	0.54279	0.58;0.58	5.78	4.81	0.61882	Proteasome activator pa28, REG beta subunit (2);	0.112547	0.64402	D	0.000013	T	0.68613	0.3020	M	0.63208	1.945	0.80722	D	1	D;D;D;D	0.76494	0.998;0.999;0.999;0.999	D;D;D;D	0.69654	0.938;0.965;0.965;0.942	T	0.68689	-0.5342	10	0.38643	T	0.18	-26.7237	16.4262	0.83815	0.1325:0.8675:0.0:0.0	.	157;218;218;231	B3KQ25;Q6FHK7;P61289;P61289-2	.;.;PSME3_HUMAN;.	W	157;231;218	ENSP00000441682:R157W;ENSP00000293362:R231W	ENSP00000293362:R231W	R	+	1	2	PSME3	38244891	1.000000	0.71417	0.967000	0.41034	0.990000	0.78478	4.823000	0.62694	1.450000	0.47717	-0.277000	0.10078	CGG	PSME3	-	pfam_Proteasome_activ_REG_bsu,superfamily_Proteasome_activ_REG_asu/bsu		0.443	PSME3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PSME3	HGNC	protein_coding	OTTHUMT00000452430.1	C	NM_176863		40991365	+1	no_errors	ENST00000293362	ensembl	human	known	70_37	missense	SNP	1.000	T
PZP	5858	genome.wustl.edu	37	12	9354941	9354941	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr12:9354941C>T	ENST00000261336.2	-	4	482	c.454G>A	c.(454-456)Gaa>Aaa	p.E152K	PZP_ENST00000381997.2_Missense_Mutation_p.E21K	NM_002864.2	NP_002855.2	P20742	PZP_HUMAN	pregnancy-zone protein	152					female pregnancy (GO:0007565)|negative regulation of endopeptidase activity (GO:0010951)	blood microparticle (GO:0072562)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	endopeptidase inhibitor activity (GO:0004866)|serine-type endopeptidase inhibitor activity (GO:0004867)	p.E21K(1)|p.E152K(1)		breast(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(21)|lung(46)|ovary(3)|prostate(2)|skin(6)|stomach(3)|upper_aerodigestive_tract(5)	102						CGAAAATTTTCATCCACGGAG	0.443																																					Melanoma(125;1402 1695 4685 34487 38571)												2	Substitution - Missense(2)	cervix(2)											94.0	82.0	86.0					12																	9354941		2203	4300	6503	SO:0001583	missense	5858			X54380, M24416, X51541	CCDS8600.1	12p13-p12.2	2008-02-01			ENSG00000126838	ENSG00000126838			9750	protein-coding gene	gene with protein product		176420					Standard	NM_002864		Approved	CPAMD6	uc001qvl.3	P20742	OTTHUMG00000154915	ENST00000261336.2:c.454G>A	12.37:g.9354941C>T	ENSP00000261336:p.Glu152Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND27|Q15273|Q2NKL2|Q7M4N7	Missense_Mutation	SNP	pfam_A2M_comp,pfam_A2M_N_2,pfam_Macroglobln_a2,pfam_A-macroglobulin_rcpt-bd,pfam_A2M_N,pfam_MacrogloblnA2_thiol-ester-bond,pfam_SV_autoAg,superfamily_Terpenoid_cyclase/PrenylTrfase,superfamily_A-macroglobulin_rcpt-bd	p.E152K	ENST00000261336.2	37	c.454	CCDS8600.1	12	.	.	.	.	.	.	.	.	.	.	C	6.827	0.521822	0.13005	.	.	ENSG00000126838	ENST00000261336;ENST00000381997	T;T	0.73681	-0.77;-0.77	2.44	1.53	0.23141	Alpha-2-macroglobulin, N-terminal (1);	0.108809	0.37761	U	0.001946	T	0.66509	0.2796	M	0.62723	1.935	0.19300	N	0.999971	B;B	0.31790	0.34;0.099	B;B	0.40009	0.316;0.05	T	0.51004	-0.8760	10	0.07990	T	0.79	.	4.9811	0.14166	0.0:0.8244:0.0:0.1756	.	21;152	P20742-2;P20742	.;PZP_HUMAN	K	152;21	ENSP00000261336:E152K;ENSP00000371427:E21K	ENSP00000261336:E152K	E	-	1	0	PZP	9246208	0.014000	0.17966	0.718000	0.30602	0.506000	0.33950	-0.139000	0.10358	0.602000	0.29896	0.460000	0.39030	GAA	PZP	-	pfam_A2M_N		0.443	PZP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PZP	HGNC	protein_coding	OTTHUMT00000337624.1	C	NM_002864		9354941	-1	no_errors	ENST00000261336	ensembl	human	known	70_37	missense	SNP	0.766	T
RALGPS2	55103	genome.wustl.edu	37	1	178846666	178846666	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:178846666C>T	ENST00000367635.3	+	9	979	c.641C>T	c.(640-642)tCa>tTa	p.S214L	RALGPS2_ENST00000367634.2_Missense_Mutation_p.S214L	NM_152663.3	NP_689876.2	Q86X27	RGPS2_HUMAN	Ral GEF with PH domain and SH3 binding motif 2	214	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)	p.S214L(1)		breast(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(11)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						TACATCGATTCAGCATACCCA	0.323																																																	1	Substitution - Missense(1)	cervix(1)											88.0	89.0	88.0					1																	178846666		2203	4300	6503	SO:0001583	missense	55103			AK098470	CCDS1325.1, CCDS65733.1	1q24	2013-01-11			ENSG00000116191	ENSG00000116191		"""Pleckstrin homology (PH) domain containing"""	30279	protein-coding gene	gene with protein product						10747847, 12102558	Standard	NM_152663		Approved	KIAA0351, FLJ10244, FLJ25604	uc001glz.3	Q86X27	OTTHUMG00000035076	ENST00000367635.3:c.641C>T	1.37:g.178846666C>T	ENSP00000356607:p.Ser214Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z7B1|Q5T5Z1|Q5VZ67|Q9NW78	Missense_Mutation	SNP	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.S214L	ENST00000367635.3	37	c.641	CCDS1325.1	1	.	.	.	.	.	.	.	.	.	.	C	17.09	3.300839	0.60195	.	.	ENSG00000116191	ENST00000367635;ENST00000367634;ENST00000324778	T;T;T	0.29917	1.55;1.55;1.55	5.86	5.86	0.93980	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.000000	0.85682	D	0.000000	T	0.25419	0.0618	N	0.21448	0.665	0.80722	D	1	B;B	0.22746	0.012;0.074	B;B	0.25291	0.018;0.059	T	0.05257	-1.0896	10	0.19590	T	0.45	.	19.7866	0.96442	0.0:1.0:0.0:0.0	.	214;214	B7Z7B1;Q86X27	.;RGPS2_HUMAN	L	214;214;179	ENSP00000356607:S214L;ENSP00000356606:S214L;ENSP00000313613:S179L	ENSP00000313613:S179L	S	+	2	0	RALGPS2	177113289	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	7.734000	0.84928	2.770000	0.95276	0.655000	0.94253	TCA	RALGPS2	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.323	RALGPS2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS2	HGNC	protein_coding	OTTHUMT00000084926.2	C	NM_152663		178846666	+1	no_errors	ENST00000367635	ensembl	human	known	70_37	missense	SNP	1.000	T
RASA3	22821	genome.wustl.edu	37	13	114780743	114780743	+	Silent	SNP	C	C	G	rs546150726		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr13:114780743C>G	ENST00000334062.7	-	14	1468	c.1347G>C	c.(1345-1347)ccG>ccC	p.P449P	RASA3_ENST00000389544.4_Silent_p.P417P	NM_007368.2	NP_031394.2	Q14644	RASA3_HUMAN	RAS p21 protein activator 3	449	Ras-GAP. {ECO:0000255|PROSITE- ProRule:PRU00167}.				calcium ion transmembrane transport (GO:0070588)|intracellular signal transduction (GO:0035556)|negative regulation of Ras protein signal transduction (GO:0046580)|positive regulation of Ras GTPase activity (GO:0032320)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|intrinsic component of the cytoplasmic side of the plasma membrane (GO:0031235)	calcium-release channel activity (GO:0015278)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|Ras GTPase activator activity (GO:0005099)	p.P449P(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(8)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	47	Lung NSC(43;0.00814)|all_neural(89;0.0337)|Medulloblastoma(90;0.163)|Lung SC(71;0.218)	all_cancers(25;0.016)|all_epithelial(44;0.00577)|all_lung(25;0.0173)|Lung NSC(25;0.0634)|Breast(118;0.188)	BRCA - Breast invasive adenocarcinoma(86;0.128)			ACATGACGGTCGGGCAGCTCA	0.617																																																	1	Substitution - coding silent(1)	cervix(1)											125.0	108.0	114.0					13																	114780743		2203	4300	6503	SO:0001819	synonymous_variant	22821				CCDS32016.1	13q34	2013-01-10			ENSG00000185989	ENSG00000185989		"""Pleckstrin homology (PH) domain containing"""	20331	protein-coding gene	gene with protein product		605182				7637787, 9382842	Standard	NM_007368		Approved	GAP1IP4BP, GAPIII	uc001vui.3	Q14644	OTTHUMG00000017399	ENST00000334062.7:c.1347G>C	13.37:g.114780743C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL15|F8W6X8|Q8IUY2	Silent	SNP	pfam_RasGAP,pfam_C2_Ca-dep,pfam_Znf_Btk_motif,pfam_Pleckstrin_homology,superfamily_Rho_GTPase_activation_prot,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_RasGAP,smart_Pleckstrin_homology,smart_Znf_Btk_motif,pfscan_C2_membr_targeting,pfscan_Pleckstrin_homology,pfscan_Znf_Btk_motif,pfscan_RasGAP,prints_Znf_Btk_motif	p.P449	ENST00000334062.7	37	c.1347	CCDS32016.1	13																																																																																			RASA3	-	pfam_RasGAP,superfamily_Rho_GTPase_activation_prot,smart_RasGAP,pfscan_RasGAP		0.617	RASA3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RASA3	HGNC	protein_coding	OTTHUMT00000045957.2	C	NM_007368		114780743	-1	no_errors	ENST00000334062	ensembl	human	known	70_37	silent	SNP	0.128	G
RGAG4	340526	genome.wustl.edu	37	X	71350359	71350359	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chrX:71350359G>A	ENST00000545866.1	-	1	1399	c.1032C>T	c.(1030-1032)taC>taT	p.Y344Y	NHSL2_ENST00000540800.1_Intron|RGAG4_ENST00000609883.1_Silent_p.Y344Y	NM_001024455.3	NP_001019626.1	Q5HYW3	RGAG4_HUMAN	retrotransposon gag domain containing 4	344								p.Y417Y(1)		cervix(2)|endometrium(2)|kidney(3)|large_intestine(5)|lung(8)|ovary(3)|skin(1)	24	Renal(35;0.156)					CATCTTCACTGTAGTACTCTT	0.517																																																	1	Substitution - coding silent(1)	cervix(1)											58.0	53.0	54.0					X																	71350359		2004	4161	6165	SO:0001819	synonymous_variant	340526			AB082532	CCDS55446.1	Xq13.1	2008-02-05			ENSG00000242732	ENSG00000242732			29430	protein-coding gene	gene with protein product						12056414, 15716091, 16093683	Standard	NM_001024455		Approved	KIAA2001, Mar5, Mart5	uc004eaj.2	Q5HYW3	OTTHUMG00000021808	ENST00000545866.1:c.1032C>T	X.37:g.71350359G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2W7|Q8NCM4|Q9NPX1	Silent	SNP	pfam_Retrotrans_gag	p.Y344	ENST00000545866.1	37	c.1032	CCDS55446.1	X																																																																																			RGAG4	-	NULL		0.517	RGAG4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG4	HGNC	protein_coding	OTTHUMT00000057171.1	G	NM_001024455		71350359	-1	no_errors	ENST00000479991	ensembl	human	known	70_37	silent	SNP	0.828	A
RNASE13	440163	genome.wustl.edu	37	14	21502046	21502046	+	Silent	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:21502046G>C	ENST00000382951.3	-	2	539	c.402C>G	c.(400-402)ctC>ctG	p.L134L	NDRG2_ENST00000403829.3_Intron|RP11-998D10.1_ENST00000531638.1_3'UTR	NM_001012264.3	NP_001012264.1	Q5GAN3	RNS13_HUMAN	ribonuclease, RNase A family, 13 (non-active)	134						extracellular region (GO:0005576)	nucleic acid binding (GO:0003676)	p.L134L(1)		cervix(1)|endometrium(1)|lung(5)|ovary(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(1)	12	all_cancers(95;0.000759)		OV - Ovarian serous cystadenocarcinoma(11;6.85e-11)|Epithelial(56;9.49e-09)|all cancers(55;3.84e-08)	GBM - Glioblastoma multiforme(265;0.019)		AGAGTAGGTAGAGCTTCTGGT	0.532																																																	1	Substitution - coding silent(1)	cervix(1)											257.0	203.0	221.0					14																	21502046		2203	4300	6503	SO:0001819	synonymous_variant	440163			AY665808	CCDS32039.1	14q11.1	2011-02-10			ENSG00000206150	ENSG00000206150		"""Ribonucleases, RNase A"""	25285	protein-coding gene	gene with protein product							Standard	NM_001012264		Approved		uc001vzj.3	Q5GAN3		ENST00000382951.3:c.402C>G	14.37:g.21502046G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_RNaseA_domain,superfamily_RNaseA_domain	p.L134	ENST00000382951.3	37	c.402	CCDS32039.1	14																																																																																			RNASE13	-	pfam_RNaseA_domain,superfamily_RNaseA_domain		0.532	RNASE13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNASE13	HGNC	protein_coding	OTTHUMT00000411744.1	G			21502046	-1	no_errors	ENST00000382951	ensembl	human	known	70_37	silent	SNP	0.952	C
RRP1B	23076	genome.wustl.edu	37	21	45104458	45104458	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr21:45104458C>T	ENST00000340648.4	+	10	1033	c.916C>T	c.(916-918)Cga>Tga	p.R306*		NM_015056.2	NP_055871.1	Q14684	RRP1B_HUMAN	ribosomal RNA processing 1B	306					negative regulation of phosphatase activity (GO:0010923)|rRNA processing (GO:0006364)	cytosol (GO:0005829)|euchromatin (GO:0000791)|heterochromatin (GO:0000792)|nucleolus (GO:0005730)|nucleus (GO:0005634)|preribosome, small subunit precursor (GO:0030688)	poly(A) RNA binding (GO:0044822)	p.R306*(1)		cervix(1)|endometrium(1)|kidney(3)|large_intestine(4)|lung(3)|ovary(1)|pancreas(1)|prostate(3)|skin(3)|stomach(1)	21				STAD - Stomach adenocarcinoma(101;0.178)		TGTTGCTGATCGACTCCTGGA	0.483																																																	1	Substitution - Nonsense(1)	cervix(1)											157.0	144.0	148.0					21																	45104458		2203	4300	6503	SO:0001587	stop_gained	23076			AK124620	CCDS33577.1	21q22.3	2014-06-13	2013-07-02	2007-03-26	ENSG00000160208	ENSG00000160208			23818	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 136"""	610654	"""KIAA0179"", ""ribosomal RNA processing 1 homolog B (S. cerevisiae)"""	KIAA0179			Standard	NM_015056		Approved	Nnp1, RRP1, PPP1R136	uc002zdk.3	Q14684	OTTHUMG00000086872	ENST00000340648.4:c.916C>T	21.37:g.45104458C>T	ENSP00000339145:p.Arg306*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TBZ4	Nonsense_Mutation	SNP	pfam_Nop52	p.R306*	ENST00000340648.4	37	c.916	CCDS33577.1	21	.	.	.	.	.	.	.	.	.	.	C	37	6.557049	0.97663	.	.	ENSG00000160208	ENST00000340648	.	.	.	5.29	3.45	0.39498	.	0.110735	0.56097	D	0.000026	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-3.5923	6.965	0.24617	0.3782:0.5385:0.0:0.0833	.	.	.	.	X	306	.	ENSP00000339145:R306X	R	+	1	2	RRP1B	43928886	0.964000	0.33143	0.903000	0.35520	0.922000	0.55478	1.323000	0.33701	0.587000	0.29643	-0.253000	0.11424	CGA	RRP1B	-	NULL		0.483	RRP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RRP1B	HGNC	protein_coding	OTTHUMT00000195651.1	C	NM_015056		45104458	+1	no_errors	ENST00000340648	ensembl	human	known	70_37	nonsense	SNP	0.993	T
SDCBP	6386	genome.wustl.edu	37	8	59493158	59493158	+	Missense_Mutation	SNP	T	T	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr8:59493158T>C	ENST00000260130.4	+	8	983	c.833T>C	c.(832-834)aTt>aCt	p.I278T	SDCBP_ENST00000520168.1_Missense_Mutation_p.I219T|SDCBP_ENST00000447182.2_Missense_Mutation_p.I277T|SDCBP_ENST00000447267.2_Missense_Mutation_p.I224T|SDCBP_ENST00000422546.2_Missense_Mutation_p.I277T|SDCBP_ENST00000523483.1_Missense_Mutation_p.I298T|SDCBP_ENST00000413219.2_Missense_Mutation_p.I278T|SDCBP_ENST00000424270.2_Missense_Mutation_p.I272T	NM_001007068.1|NM_001007069.1|NM_005625.3	NP_001007069.1|NP_001007070.1|NP_005616.2	O00560	SDCB1_HUMAN	syndecan binding protein (syntenin)	278					actin cytoskeleton organization (GO:0030036)|axon guidance (GO:0007411)|intracellular signal transduction (GO:0035556)|positive regulation of JNK cascade (GO:0046330)|positive regulation of phosphorylation (GO:0042327)|protein targeting to membrane (GO:0006612)|Ras protein signal transduction (GO:0007265)|substrate-dependent cell migration, cell extension (GO:0006930)|synaptic transmission (GO:0007268)	adherens junction (GO:0005912)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|interleukin-5 receptor complex (GO:0005895)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	cytoskeletal adaptor activity (GO:0008093)|frizzled binding (GO:0005109)|identical protein binding (GO:0042802)|interleukin-5 receptor binding (GO:0005137)|protein heterodimerization activity (GO:0046982)|protein N-terminus binding (GO:0047485)|syndecan binding (GO:0045545)	p.I278T(1)		breast(1)|cervix(2)|kidney(1)|large_intestine(1)|lung(1)|skin(1)|urinary_tract(1)	8		all_lung(136;0.0271)|Lung NSC(129;0.0351)|all_epithelial(80;0.0554)				TTTGAACATATTATTAAGCGG	0.333																																																	1	Substitution - Missense(1)	cervix(1)											83.0	75.0	78.0					8																	59493158		2203	4295	6498	SO:0001583	missense	6386			AF000652	CCDS6172.1, CCDS47862.1, CCDS47863.1	8q12.1	2012-12-04			ENSG00000137575	ENSG00000137575			10662	protein-coding gene	gene with protein product		602217				9391086	Standard	NM_001007067		Approved	SYCL	uc003xtq.3	O00560	OTTHUMG00000164303	ENST00000260130.4:c.833T>C	8.37:g.59493158T>C	ENSP00000260130:p.Ile278Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5Q7|B4DUH3|B7ZLN2|O00173|O43391|Q14CP2	Missense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.I278T	ENST00000260130.4	37	c.833	CCDS6172.1	8	.	.	.	.	.	.	.	.	.	.	T	17.46	3.395564	0.62177	.	.	ENSG00000137575	ENST00000260130;ENST00000422546;ENST00000447182;ENST00000413219;ENST00000424270;ENST00000523483;ENST00000520168;ENST00000447267	T;T;T;T;T;T;T;T	0.17370	2.28;2.28;2.28;2.28;2.28;2.28;2.28;2.28	5.53	5.53	0.82687	PDZ/DHR/GLGF (1);	0.113307	0.64402	D	0.000013	T	0.21145	0.0509	L	0.58101	1.795	0.51012	D	0.999907	B;P;B;B	0.34462	0.021;0.454;0.078;0.047	B;B;B;B	0.35182	0.032;0.197;0.169;0.044	T	0.01972	-1.1237	9	.	.	.	-18.3103	15.9669	0.79979	0.0:0.0:0.0:1.0	.	219;298;272;278	B4DHN5;G5EA09;O00560-3;O00560	.;.;.;SDCB1_HUMAN	T	278;277;277;278;272;298;219;224	ENSP00000260130:I278T;ENSP00000391687:I277T;ENSP00000409288:I277T;ENSP00000411771:I278T;ENSP00000395351:I272T;ENSP00000428184:I298T;ENSP00000430730:I219T;ENSP00000397820:I224T	.	I	+	2	0	SDCBP	59655712	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.841000	0.86834	2.236000	0.73375	0.533000	0.62120	ATT	SDCBP	-	superfamily_PDZ		0.333	SDCBP-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SDCBP	HGNC	protein_coding	OTTHUMT00000378193.1	T	NM_005625		59493158	+1	no_errors	ENST00000260130	ensembl	human	known	70_37	missense	SNP	1.000	C
SEC14L3	266629	genome.wustl.edu	37	22	30866217	30866217	+	Silent	SNP	C	C	T	rs544591201		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr22:30866217C>T	ENST00000215812.4	-	3	246	c.156G>A	c.(154-156)tcG>tcA	p.S52S	SEC14L3_ENST00000539629.1_5'UTR|SEC14L3_ENST00000401751.1_5'UTR|SEC14L3_ENST00000540910.1_5'UTR|SEC14L3_ENST00000402286.1_5'UTR|SEC14L3_ENST00000415957.2_5'UTR|SEC14L3_ENST00000403066.1_5'UTR	NM_174975.4	NP_777635.1	Q9UDX4	S14L3_HUMAN	SEC14-like 3 (S. cerevisiae)	52						extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|intracellular (GO:0005622)	lipid binding (GO:0008289)|transporter activity (GO:0005215)	p.S52S(1)		NS(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(3)|ovary(3)|pancreas(1)|skin(2)|urinary_tract(1)	19					Vitamin E(DB00163)	GCAAAGCCTCCGACTTCTGCA	0.522																																					Esophageal Squamous(108;290 1516 3584 23771 37333)												1	Substitution - coding silent(1)	cervix(1)											56.0	60.0	59.0					22																	30866217		2203	4300	6503	SO:0001819	synonymous_variant	266629			AY158086	CCDS13877.1, CCDS58800.1, CCDS58801.1	22q12.2	2013-09-23			ENSG00000100012	ENSG00000100012			18655	protein-coding gene	gene with protein product		612824					Standard	NM_174975		Approved	TAP2	uc003ahy.3	Q9UDX4	OTTHUMG00000151259	ENST00000215812.4:c.156G>A	22.37:g.30866217C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E7EN74|E9PE57|Q495V8|Q495W0|Q495W1	Silent	SNP	pfam_CRAL-TRIO_dom,pfam_CRAL/TRIO_N_dom,superfamily_CRAL-TRIO_dom,superfamily_GOLD,superfamily_CRAL/TRIO_N_dom,smart_CRAL-TRIO_dom,pfscan_CRAL-TRIO_dom,pfscan_GOLD,prints_CRAL-bd_toc_tran	p.S52	ENST00000215812.4	37	c.156	CCDS13877.1	22																																																																																			SEC14L3	-	pfam_CRAL/TRIO_N_dom,superfamily_CRAL/TRIO_N_dom,prints_CRAL-bd_toc_tran		0.522	SEC14L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEC14L3	HGNC	protein_coding	OTTHUMT00000321950.4	C	NM_174975		30866217	-1	no_errors	ENST00000215812	ensembl	human	known	70_37	silent	SNP	0.826	T
SEMA3A	10371	genome.wustl.edu	37	7	83640567	83640567	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:83640567A>G	ENST00000265362.4	-	8	1171	c.857T>C	c.(856-858)tTc>tCc	p.F286S	SEMA3A_ENST00000436949.1_Missense_Mutation_p.F286S	NM_006080.2	NP_006071.1	Q14563	SEM3A_HUMAN	sema domain, immunoglobulin domain (Ig), short basic domain, secreted, (semaphorin) 3A	286	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				apoptotic process (GO:0006915)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|axonogenesis involved in innervation (GO:0060385)|branchiomotor neuron axon guidance (GO:0021785)|dendrite morphogenesis (GO:0048813)|dichotomous subdivision of terminal units involved in salivary gland branching (GO:0060666)|facial nerve structural organization (GO:0021612)|gonadotrophin-releasing hormone neuronal migration to the hypothalamus (GO:0021828)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of epithelial cell migration (GO:0010633)|nerve development (GO:0021675)|neural crest cell migration involved in autonomic nervous system development (GO:1901166)|neural crest cell migration involved in sympathetic nervous system development (GO:1903045)|neuron migration (GO:0001764)|olfactory bulb development (GO:0021772)|positive regulation of male gonad development (GO:2000020)|positive regulation of neuron migration (GO:2001224)|regulation of axon extension involved in axon guidance (GO:0048841)|regulation of heart rate (GO:0002027)|semaphorin-plexin signaling pathway (GO:0071526)|semaphorin-plexin signaling pathway involved in axon guidance (GO:1902287)|semaphorin-plexin signaling pathway involved in neuron projection guidance (GO:1902285)|sensory system development (GO:0048880)|sympathetic ganglion development (GO:0061549)|sympathetic nervous system development (GO:0048485)|sympathetic neuron projection extension (GO:0097490)|sympathetic neuron projection guidance (GO:0097491)|trigeminal nerve structural organization (GO:0021637)	axon (GO:0030424)|dendrite (GO:0030425)|extracellular region (GO:0005576)|membrane (GO:0016020)	chemorepellent activity (GO:0045499)|neuropilin binding (GO:0038191)|receptor activity (GO:0004872)	p.F286S(1)		breast(3)|cervix(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|liver(1)|lung(22)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	53						AGCTTTGAGGAATGTTGTCCA	0.393																																																	1	Substitution - Missense(1)	cervix(1)											128.0	117.0	121.0					7																	83640567		2203	4300	6503	SO:0001583	missense	10371			L26081	CCDS5599.1	7p12.1	2013-01-11			ENSG00000075213	ENSG00000075213		"""Semaphorins"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	10723	protein-coding gene	gene with protein product	"""sema III"""	603961		SEMAD		8269517, 7748561	Standard	NM_006080		Approved	SEMA1, SemD, coll-1, Hsema-I	uc003uhz.3	Q14563	OTTHUMG00000023443	ENST00000265362.4:c.857T>C	7.37:g.83640567A>G	ENSP00000265362:p.Phe286Ser	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Ig_sub,pfscan_Semaphorin/CD100_Ag,pfscan_Ig-like	p.F286S	ENST00000265362.4	37	c.857	CCDS5599.1	7	.	.	.	.	.	.	.	.	.	.	A	29.0	4.965826	0.92855	.	.	ENSG00000075213	ENST00000265362;ENST00000436949	T;T	0.40225	1.04;1.04	6.08	6.08	0.98989	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.75729	0.3889	H	0.95114	3.625	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.83492	0.0070	10	0.87932	D	0	.	16.6512	0.85203	1.0:0.0:0.0:0.0	.	286	Q14563	SEM3A_HUMAN	S	286	ENSP00000265362:F286S;ENSP00000415260:F286S	ENSP00000265362:F286S	F	-	2	0	SEMA3A	83478503	1.000000	0.71417	1.000000	0.80357	0.900000	0.52787	9.339000	0.96797	2.333000	0.79357	0.482000	0.46254	TTC	SEMA3A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.393	SEMA3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA3A	HGNC	protein_coding	OTTHUMT00000253355.2	A	NM_006080		83640567	-1	no_errors	ENST00000265362	ensembl	human	known	70_37	missense	SNP	1.000	G
SERINC2	347735	genome.wustl.edu	37	1	31896551	31896551	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:31896551C>T	ENST00000373709.3	+	2	201	c.51C>T	c.(49-51)ctC>ctT	p.L17L	SERINC2_ENST00000491976.1_3'UTR|SERINC2_ENST00000373710.1_Silent_p.L26L|SERINC2_ENST00000536384.1_Silent_p.L21L|SERINC2_ENST00000536859.1_Silent_p.L21L	NM_178865.4	NP_849196.2	Q96SA4	SERC2_HUMAN	serine incorporator 2	17					phosphatidylserine metabolic process (GO:0006658)|positive regulation of transferase activity (GO:0051347)|sphingolipid metabolic process (GO:0006665)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)	L-serine transmembrane transporter activity (GO:0015194)	p.L17L(1)		cervix(1)|endometrium(2)|large_intestine(1)|lung(4)|ovary(1)|prostate(1)|skin(2)	12		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0308)|all_neural(195;0.0629)|Breast(348;0.0707)|Medulloblastoma(700;0.123)		STAD - Stomach adenocarcinoma(196;0.0541)|READ - Rectum adenocarcinoma(331;0.151)		CGTCCTGCCTCTGCGGCTCTG	0.677																																																	1	Substitution - coding silent(1)	cervix(1)											37.0	36.0	36.0					1																	31896551		2203	4299	6502	SO:0001819	synonymous_variant	347735			AY094595	CCDS30662.1, CCDS55583.1, CCDS55584.1, CCDS55585.1	1p35.1	2008-02-05	2005-11-01	2005-11-01	ENSG00000168528	ENSG00000168528			23231	protein-coding gene	gene with protein product		614549	"""tumor differentially expressed 2-like"""	TDE2L		12949800	Standard	NM_178865		Approved	FKSG84, PRO0899, TDE2	uc010ogh.2	Q96SA4	OTTHUMG00000003796	ENST00000373709.3:c.51C>T	1.37:g.31896551C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVB4|B4DJK5|B7Z567|B7ZAP2|E7EUZ9|Q86Y23	Silent	SNP	pfam_TMS_TDE	p.L26	ENST00000373709.3	37	c.78	CCDS30662.1	1																																																																																			SERINC2	-	pfam_TMS_TDE		0.677	SERINC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC2	HGNC	protein_coding	OTTHUMT00000010680.1	C	NM_018565		31896551	+1	no_errors	ENST00000373710	ensembl	human	known	70_37	silent	SNP	1.000	T
SETD3	84193	genome.wustl.edu	37	14	99865319	99865319	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:99865319C>T	ENST00000331768.5	-	13	1641	c.1482G>A	c.(1480-1482)gaG>gaA	p.E494E		NM_032233.2	NP_115609.2	Q86TU7	SETD3_HUMAN	SET domain containing 3	494					histone H3-K36 methylation (GO:0010452)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)|peptidyl-lysine trimethylation (GO:0018023)|positive regulation of muscle cell differentiation (GO:0051149)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	histone methyltransferase activity (H3-K36 specific) (GO:0046975)|histone methyltransferase activity (H3-K4 specific) (GO:0042800)|transcription coactivator activity (GO:0003713)	p.E494E(1)		NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(8)|lung(8)|ovary(1)|skin(1)	25		all_cancers(154;0.224)|all_epithelial(191;0.0644)|Melanoma(154;0.0866)				GAGCCTTTTCCTCCATCTGTT	0.502																																																	1	Substitution - coding silent(1)	cervix(1)											131.0	131.0	131.0					14																	99865319		2203	4300	6503	SO:0001819	synonymous_variant	84193			AK026680	CCDS9951.1, CCDS9952.1	14q32.2	2006-02-15	2006-02-15	2006-02-15	ENSG00000183576	ENSG00000183576			20493	protein-coding gene	gene with protein product		615671	"""chromosome 14 open reading frame 154"""	C14orf154			Standard	NM_032233		Approved	FLJ23027	uc001ygc.3	Q86TU7	OTTHUMG00000028970	ENST00000331768.5:c.1482G>A	14.37:g.99865319C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJU3|A5PLP0|B4DZE8|Q0VAQ2|Q659C0|Q86TU8|Q96GY9|Q9H5U5	Silent	SNP	pfam_Rubisco_LSMT_subst-bd,pfam_SET_dom,superfamily_Rubisco_LSMT_subst-bd	p.E494	ENST00000331768.5	37	c.1482	CCDS9951.1	14																																																																																			SETD3	-	superfamily_Rubisco_LSMT_subst-bd		0.502	SETD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD3	HGNC	protein_coding	OTTHUMT00000072339.3	C	NM_032233		99865319	-1	no_errors	ENST00000331768	ensembl	human	known	70_37	silent	SNP	0.996	T
SETDB2	83852	genome.wustl.edu	37	13	50034278	50034278	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr13:50034278G>A	ENST00000317257.8	+	3	877	c.52G>A	c.(52-54)Gat>Aat	p.D18N	SETDB2_ENST00000354234.4_Missense_Mutation_p.D18N|SETDB2_ENST00000258672.5_Missense_Mutation_p.D18N	NM_031915.2	NP_114121.2	Q96T68	SETB2_HUMAN	SET domain, bifurcated 2	18					chromosome segregation (GO:0007059)|heart looping (GO:0001947)|histone H3-K9 methylation (GO:0051567)|left/right axis specification (GO:0070986)|mitotic nuclear division (GO:0007067)|negative regulation of transcription, DNA-templated (GO:0045892)	chromosome (GO:0005694)|nucleus (GO:0005634)	DNA binding (GO:0003677)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|zinc ion binding (GO:0008270)	p.D18N(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(2)|ovary(1)|upper_aerodigestive_tract(1)	15		Lung NSC(96;0.000408)|Breast(56;0.00131)|Prostate(109;0.00446)|Hepatocellular(98;0.0556)|Glioma(44;0.236)	KIRC - Kidney renal clear cell carcinoma(9;0.206)	GBM - Glioblastoma multiforme(99;3.1e-09)		GCTAGAAGATGATGGAAAAGT	0.343																																																	1	Substitution - Missense(1)	cervix(1)											104.0	113.0	110.0					13																	50034278		2203	4300	6503	SO:0001583	missense	83852			AF334407	CCDS9417.1, CCDS53868.1	13q14	2011-07-01	2003-05-06	2003-05-09	ENSG00000136169	ENSG00000136169		"""Chromatin-modifying enzymes / K-methyltransferases"""	20263	protein-coding gene	gene with protein product		607865	"""chromosome 13 open reading frame 4"""	C13orf4		11306461	Standard	NM_031915		Approved	CLLD8, CLLL8, KMT1F	uc001vda.3	Q96T68	OTTHUMG00000016918	ENST00000317257.8:c.52G>A	13.37:g.50034278G>A	ENSP00000326477:p.Asp18Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5TC65|Q5TC66|Q5W0A7|Q659A7|Q86UD6|Q96AI6	Missense_Mutation	SNP	pfam_SET_dom,pfam_Pre-SET_dom,pfam_Methyl_CpG_DNA-bd,superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Methyl_CpG_DNA-bd,pfscan_SET_dom,pfscan_Pre-SET_dom	p.D18N	ENST00000317257.8	37	c.52	CCDS9417.1	13	.	.	.	.	.	.	.	.	.	.	G	14.75	2.629787	0.46944	.	.	ENSG00000136169	ENST00000354234;ENST00000317257;ENST00000258672	D;D;T	0.87729	-2.29;-2.26;0.99	5.46	2.76	0.32466	.	0.498174	0.21267	N	0.077381	T	0.75287	0.3829	N	0.24115	0.695	0.38739	D	0.953839	B;B;B	0.17268	0.021;0.015;0.016	B;B;B	0.18871	0.011;0.023;0.01	T	0.66200	-0.5983	10	0.51188	T	0.08	.	4.1842	0.10390	0.0868:0.1573:0.5929:0.163	.	18;18;18	Q96T68-3;Q96T68-2;Q96T68	.;.;SETB2_HUMAN	N	18	ENSP00000346175:D18N;ENSP00000326477:D18N;ENSP00000258672:D18N	ENSP00000258672:D18N	D	+	1	0	SETDB2	48932279	1.000000	0.71417	0.998000	0.56505	0.999000	0.98932	0.901000	0.28445	0.353000	0.24079	0.655000	0.94253	GAT	SETDB2	-	NULL		0.343	SETDB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SETDB2	HGNC	protein_coding	OTTHUMT00000044925.1	G	NM_031915		50034278	+1	no_errors	ENST00000317257	ensembl	human	known	70_37	missense	SNP	0.999	A
SFXN4	119559	genome.wustl.edu	37	10	120917551	120917551	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr10:120917551C>T	ENST00000355697.2	-	7	403	c.384G>A	c.(382-384)ctG>ctA	p.L128L	SFXN4_ENST00000461438.1_5'UTR|SFXN4_ENST00000330036.6_Silent_p.L119L	NM_213649.1	NP_998814.1	Q6P4A7	SFXN4_HUMAN	sideroflexin 4	128					iron ion homeostasis (GO:0055072)	integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|mitochondrial inner membrane (GO:0005743)	cation transmembrane transporter activity (GO:0008324)	p.L128L(1)		central_nervous_system(1)|cervix(1)|kidney(3)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	11		Lung NSC(174;0.094)|all_lung(145;0.123)		all cancers(201;0.0261)		TGATCCCTTTCAGTGGCGTCA	0.413																																																	1	Substitution - coding silent(1)	cervix(1)											139.0	138.0	138.0					10																	120917551		2203	4300	6503	SO:0001819	synonymous_variant	119559				CCDS7610.1	10q26.11	2006-03-13			ENSG00000183605	ENSG00000183605		"""Sideroflexins"""	16088	protein-coding gene	gene with protein product		615564				14756423	Standard	NM_213649		Approved		uc001leb.3	Q6P4A7	OTTHUMG00000019147	ENST00000355697.2:c.384G>A	10.37:g.120917551C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6WSU4|Q86TD9	Silent	SNP	pfam_Mtc	p.L128	ENST00000355697.2	37	c.384	CCDS7610.1	10																																																																																			SFXN4	-	pfam_Mtc		0.413	SFXN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFXN4	HGNC	protein_coding	OTTHUMT00000050642.3	C	XM_058406		120917551	-1	no_errors	ENST00000355697	ensembl	human	known	70_37	silent	SNP	0.000	T
SGCD	6444	genome.wustl.edu	37	5	155771677	155771677	+	Missense_Mutation	SNP	A	A	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr5:155771677A>C	ENST00000435422.3	+	2	666	c.179A>C	c.(178-180)aAc>aCc	p.N60T	SGCD_ENST00000517913.1_Missense_Mutation_p.N61T|SGCD_ENST00000447401.1_Missense_Mutation_p.N61T|SGCD_ENST00000337851.4_Missense_Mutation_p.N61T	NM_001128209.1	NP_001121681.1	Q92629	SGCD_HUMAN	sarcoglycan, delta (35kDa dystrophin-associated glycoprotein)	60					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dystrophin-associated glycoprotein complex (GO:0016010)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)		p.N61T(1)		breast(1)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(16)|prostate(1)	24	Renal(175;0.00488)	Medulloblastoma(196;0.0378)|all_neural(177;0.106)	Kidney(164;0.000171)|KIRC - Kidney renal clear cell carcinoma(164;0.000785)			AAAGTCATGAACTTCACAATT	0.423																																																	1	Substitution - Missense(1)	cervix(1)											84.0	89.0	87.0					5																	155771677		1967	4160	6127	SO:0001583	missense	6444			BX537948	CCDS47325.1, CCDS47326.1, CCDS47327.1	5q33-q34	2014-09-17	2002-08-29						10807	protein-coding gene	gene with protein product		601411	"""sarcoglycan, delta (35kD dystrophin-associated glycoprotein)"""			8776597, 8841194, 10974018	Standard	NM_000337		Approved	DAGD, LGMD2F, CMD1L	uc003lwd.4	Q92629		ENST00000435422.3:c.179A>C	5.37:g.155771677A>C	ENSP00000403003:p.Asn60Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9S9|Q53XA5|Q99644	Missense_Mutation	SNP	pfam_Sarcoglycan	p.N61T	ENST00000435422.3	37	c.182	CCDS47327.1	5	.	.	.	.	.	.	.	.	.	.	A	17.77	3.471878	0.63737	.	.	ENSG00000170624	ENST00000517913;ENST00000435422;ENST00000337851;ENST00000447401	D;D;D;D	0.94576	-3.46;-3.46;-3.46;-3.46	5.59	4.42	0.53409	.	0.000000	0.85682	D	0.000000	D	0.94046	0.8092	L	0.61218	1.895	0.80722	D	1	P;P;P	0.42409	0.761;0.718;0.779	P;B;B	0.48524	0.58;0.445;0.445	D	0.91287	0.5056	10	0.25106	T	0.35	-2.8938	12.0667	0.53592	0.871:0.0:0.0:0.129	.	60;61;61	Q92629;Q92629-2;Q92629-3	SGCD_HUMAN;.;.	T	61;60;61;61	ENSP00000429378:N61T;ENSP00000403003:N60T;ENSP00000338343:N61T;ENSP00000408324:N61T	ENSP00000338343:N61T	N	+	2	0	SGCD	155704255	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.394000	0.79862	0.930000	0.37217	0.533000	0.62120	AAC	SGCD	-	pfam_Sarcoglycan		0.423	SGCD-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SGCD	HGNC	protein_coding	OTTHUMT00000373469.3	A			155771677	+1	no_errors	ENST00000337851	ensembl	human	known	70_37	missense	SNP	1.000	C
SHROOM2	357	genome.wustl.edu	37	X	9900723	9900723	+	Missense_Mutation	SNP	C	C	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chrX:9900723C>A	ENST00000380913.3	+	6	3490	c.3400C>A	c.(3400-3402)Cgt>Agt	p.R1134S	SHROOM2_ENST00000493668.1_3'UTR|SHROOM2_ENST00000418909.2_De_novo_Start_OutOfFrame	NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	1134					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)	p.R1134S(1)		breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				TGTCTGTGAGCGTGGAAGCCA	0.652																																																	1	Substitution - Missense(1)	cervix(1)											61.0	52.0	55.0					X																	9900723		2203	4300	6503	SO:0001583	missense	357			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	ENST00000380913.3:c.3400C>A	X.37:g.9900723C>A	ENSP00000370299:p.Arg1134Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R1134S	ENST00000380913.3	37	c.3400	CCDS14135.1	X	.	.	.	.	.	.	.	.	.	.	C	6.809	0.518383	0.13005	.	.	ENSG00000146950	ENST00000380913	T	0.13420	2.59	4.15	1.9	0.25705	.	.	.	.	.	T	0.07548	0.0190	N	0.22421	0.69	0.80722	D	1	B	0.27013	0.166	B	0.20577	0.03	T	0.25363	-1.0134	9	0.32370	T	0.25	.	5.9422	0.19199	0.5494:0.3222:0.1285:0.0	.	1134	Q13796	SHRM2_HUMAN	S	1134	ENSP00000370299:R1134S	ENSP00000370299:R1134S	R	+	1	0	SHROOM2	9860723	0.852000	0.29690	0.037000	0.18230	0.013000	0.08279	1.220000	0.32491	1.682000	0.51000	0.415000	0.27848	CGT	SHROOM2	-	NULL		0.652	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	C	NM_001649		9900723	+1	no_errors	ENST00000380913	ensembl	human	known	70_37	missense	SNP	0.615	A
SMG1	23049	genome.wustl.edu	37	16	18841063	18841063	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr16:18841063C>T	ENST00000446231.2	-	54	9560	c.9148G>A	c.(9148-9150)Gaa>Aaa	p.E3050K	SMG1_ENST00000389467.3_Missense_Mutation_p.E3050K			Q96Q15	SMG1_HUMAN	SMG1 phosphatidylinositol 3-kinase-related kinase	3050					DNA repair (GO:0006281)|gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|peptidyl-serine phosphorylation (GO:0018105)|phosphatidylinositol phosphorylation (GO:0046854)|protein autophosphorylation (GO:0046777)|response to stress (GO:0006950)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)	p.E3050K(1)|p.E3046K(1)		NS(2)|breast(8)|cervix(2)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(16)|lung(37)|ovary(1)|skin(1)|stomach(4)|urinary_tract(1)	92						TTCTGATCTTCAAGTGAACTT	0.328																																																	2	Substitution - Missense(2)	cervix(2)											33.0	32.0	32.0					16																	18841063		1817	4081	5898	SO:0001583	missense	23049			AB061371	CCDS45430.1	16p12.3	2013-07-02	2013-07-02		ENSG00000157106	ENSG00000157106			30045	protein-coding gene	gene with protein product	"""phosphatidylinositol 3-kinase-related kinase"""	607032	"""smg-1 homolog, phosphatidylinositol 3-kinase-related kinase (C. elegans)"""			9455477, 11331269, 17229728	Standard	NM_015092		Approved	LIP, KIAA0421, ATX	uc002dfm.3	Q96Q15	OTTHUMG00000166900	ENST00000446231.2:c.9148G>A	16.37:g.18841063C>T	ENSP00000402515:p.Glu3050Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O43305|Q13284|Q8NFX2|Q96QV0|Q96RW3	Missense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,pfam_FATC,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_PI3/4_kinase_cat_dom,pfscan_PIK_FAT,pfscan_FATC,pfscan_PI3/4_kinase_cat_dom	p.E3050K	ENST00000446231.2	37	c.9148	CCDS45430.1	16	.	.	.	.	.	.	.	.	.	.	C	15.83	2.947758	0.53186	.	.	ENSG00000157106	ENST00000446231;ENST00000389467	T;T	0.01113	5.32;5.32	6.07	6.07	0.98685	.	0.160016	0.44483	D	0.000455	T	0.01254	0.0041	N	0.14661	0.345	0.37355	D	0.910978	B	0.26635	0.155	B	0.15870	0.014	T	0.70995	-0.4720	10	0.36615	T	0.2	.	20.6525	0.99598	0.0:1.0:0.0:0.0	.	3050	Q96Q15	SMG1_HUMAN	K	3050	ENSP00000402515:E3050K;ENSP00000374118:E3050K	ENSP00000374118:E3050K	E	-	1	0	SMG1	18748564	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.853000	0.75435	2.890000	0.99128	0.585000	0.79938	GAA	SMG1	-	NULL		0.328	SMG1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SMG1	HGNC	protein_coding	OTTHUMT00000391817.1	C	NM_015092		18841063	-1	no_errors	ENST00000389467	ensembl	human	known	70_37	missense	SNP	1.000	T
MTCL1	23255	genome.wustl.edu	37	18	8784515	8784515	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr18:8784515G>C	ENST00000306329.11	+	5	2485	c.2485G>C	c.(2485-2487)Gag>Cag	p.E829Q	SOGA2_ENST00000517570.1_Missense_Mutation_p.E469Q|SOGA2_ENST00000306285.7_5'UTR|SOGA2_ENST00000359865.3_Missense_Mutation_p.E469Q|SOGA2_ENST00000400050.3_Missense_Mutation_p.E469Q																							GCGGACGGTGGAGCGCCTCAT	0.682																																																	0													76.0	89.0	84.0					18																	8784515		2203	4300	6503	SO:0001583	missense	23255																														ENST00000306329.11:c.2485G>C	18.37:g.8784515G>C	ENSP00000305027:p.Glu829Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DUF3166	p.E469Q	ENST00000306329.11	37	c.1405		18	.	.	.	.	.	.	.	.	.	.	G	9.064	0.995331	0.19043	.	.	ENSG00000168502	ENST00000306329;ENST00000517570;ENST00000359865;ENST00000400050	T;T;T	0.42131	0.98;0.98;0.98	5.31	5.31	0.75309	.	0.000000	0.45867	D	0.000340	T	0.58366	0.2117	L	0.58101	1.795	0.80722	D	1	D;D	0.67145	0.987;0.996	P;D	0.63703	0.719;0.917	T	0.50617	-0.8807	10	0.18710	T	0.47	-32.222	18.9661	0.92697	0.0:0.0:1.0:0.0	.	490;469	A8MQ54;Q9Y4B5-3	.;.	Q	490;469;469;469	ENSP00000429556:E469Q;ENSP00000352927:E469Q;ENSP00000382924:E469Q	ENSP00000305027:E490Q	E	+	1	0	CCDC165	8774515	1.000000	0.71417	0.999000	0.59377	0.040000	0.13550	7.737000	0.84957	2.483000	0.83821	0.591000	0.81541	GAG	SOGA2	-	NULL		0.682	SOGA2-015	PUTATIVE	basic|appris_candidate_longest|exp_conf	protein_coding	SOGA2	HGNC	protein_coding	OTTHUMT00000444141.1	G			8784515	+1	no_errors	ENST00000359865	ensembl	human	known	70_37	missense	SNP	1.000	C
SPEN	23013	genome.wustl.edu	37	1	16256225	16256225	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr1:16256225G>A	ENST00000375759.3	+	11	3694	c.3490G>A	c.(3490-3492)Gat>Aat	p.D1164N		NM_015001.2	NP_055816.2	Q96T58	MINT_HUMAN	spen family transcriptional repressor	1164					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|Notch signaling pathway (GO:0007219)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription, DNA-templated (GO:0045893)|viral process (GO:0016032)	extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)|transcriptional repressor complex (GO:0017053)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|single-stranded DNA binding (GO:0003697)|transcription corepressor activity (GO:0003714)	p.D1164N(1)		NS(1)|breast(13)|central_nervous_system(3)|cervix(5)|endometrium(16)|kidney(18)|large_intestine(27)|liver(2)|lung(37)|ovary(7)|prostate(7)|skin(7)|upper_aerodigestive_tract(5)|urinary_tract(1)	149		Colorectal(325;0.000258)|Breast(348;0.000278)|Lung NSC(340;0.000419)|Renal(390;0.000518)|all_lung(284;0.000567)|Ovarian(437;0.0129)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0185)|Colorectal(212;5.96e-07)|COAD - Colon adenocarcinoma(227;3.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000115)|Kidney(64;0.000212)|KIRC - Kidney renal clear cell carcinoma(64;0.003)|STAD - Stomach adenocarcinoma(313;0.013)|READ - Rectum adenocarcinoma(331;0.0681)		CATTGACATCGATCACACGCA	0.393																																																	1	Substitution - Missense(1)	cervix(1)											52.0	46.0	48.0					1																	16256225		2203	4300	6503	SO:0001583	missense	23013				CCDS164.1	1p36	2013-10-17	2013-10-17		ENSG00000065526	ENSG00000065526		"""RNA binding motif (RRM) containing"""	17575	protein-coding gene	gene with protein product		613484	"""SPEN homolog, transcriptional regulator (Drosophila)"", ""spen homolog, transcriptional regulator (Drosophila)"""			10451362, 11331609	Standard	NM_015001		Approved	KIAA0929, MINT, SHARP, RBM15C	uc001axk.1	Q96T58	OTTHUMG00000009376	ENST00000375759.3:c.3490G>A	1.37:g.16256225G>A	ENSP00000364912:p.Asp1164Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H9A8|Q9NWH5|Q9UQ01|Q9Y556	Missense_Mutation	SNP	pfam_RRM_dom,pfam_SPOC_C,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.D1164N	ENST00000375759.3	37	c.3490	CCDS164.1	1	.	.	.	.	.	.	.	.	.	.	G	15.61	2.885277	0.51908	.	.	ENSG00000065526	ENST00000375759	T	0.09538	2.97	5.2	5.2	0.72013	.	.	.	.	.	T	0.32496	0.0831	M	0.66939	2.045	0.80722	D	1	D	0.89917	1.0	D	0.69142	0.962	T	0.01021	-1.1478	9	0.54805	T	0.06	-9.681	18.9154	0.92503	0.0:0.0:1.0:0.0	.	1164	Q96T58	MINT_HUMAN	N	1164	ENSP00000364912:D1164N	ENSP00000364912:D1164N	D	+	1	0	SPEN	16128812	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.439000	0.52878	2.704000	0.92352	0.650000	0.86243	GAT	SPEN	-	NULL		0.393	SPEN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPEN	HGNC	protein_coding	OTTHUMT00000025993.1	G	NM_015001		16256225	+1	no_errors	ENST00000375759	ensembl	human	known	70_37	missense	SNP	1.000	A
SPHK1	8877	genome.wustl.edu	37	17	74383215	74383215	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:74383215G>C	ENST00000545180.1	+	8	1512	c.703G>C	c.(703-705)Gat>Cat	p.D235H	SPHK1_ENST00000392496.3_Missense_Mutation_p.D235H|SPHK1_ENST00000592299.1_Missense_Mutation_p.D235H|SPHK1_ENST00000323374.4_Missense_Mutation_p.D321H|SPHK1_ENST00000590959.1_Missense_Mutation_p.D249H			Q9NYA1	SPHK1_HUMAN	sphingosine kinase 1	235					'de novo' posttranslational protein folding (GO:0051084)|blood vessel development (GO:0001568)|brain development (GO:0007420)|calcium-mediated signaling (GO:0019722)|cellular protein metabolic process (GO:0044267)|cellular response to growth factor stimulus (GO:0071363)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to starvation (GO:0009267)|cyclooxygenase pathway (GO:0019371)|female pregnancy (GO:0007565)|inflammatory response (GO:0006954)|intracellular signal transduction (GO:0035556)|lipid phosphorylation (GO:0046834)|negative regulation of apoptotic process (GO:0043066)|positive regulation of angiogenesis (GO:0045766)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of fibroblast proliferation (GO:0048146)|positive regulation of mitotic cell cycle (GO:0045931)|positive regulation of neuron projection development (GO:0010976)|positive regulation of neurotransmitter secretion (GO:0001956)|positive regulation of NF-kappaB import into nucleus (GO:0042346)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of protein ubiquitination (GO:0031398)|positive regulation of smooth muscle contraction (GO:0045987)|protein folding (GO:0006457)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|regulation of interleukin-1 beta production (GO:0032651)|regulation of tumor necrosis factor-mediated signaling pathway (GO:0010803)|response to amine (GO:0014075)|response to ATP (GO:0033198)|response to interleukin-1 (GO:0070555)|response to magnesium ion (GO:0032026)|response to progesterone (GO:0032570)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingoid catabolic process (GO:0046521)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|sphingosine metabolic process (GO:0006670)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|synaptic vesicle (GO:0008021)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|D-erythro-sphingosine kinase activity (GO:0017050)|diacylglycerol kinase activity (GO:0004143)|DNA binding (GO:0003677)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)|protein phosphatase 2A binding (GO:0051721)|sphinganine kinase activity (GO:0008481)	p.D321H(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)|ovary(1)	11					Fingolimod(DB08868)	GGGCCCGGTAGATGCACACCT	0.642																																					GBM(90;966 1307 27369 33775 44498)												1	Substitution - Missense(1)	cervix(1)											52.0	41.0	45.0					17																	74383215		2203	4300	6503	SO:0001583	missense	8877			BC030553	CCDS11744.1, CCDS45785.1, CCDS59297.1	17q25.2	2004-02-18				ENSG00000176170			11240	protein-coding gene	gene with protein product		603730				9726979	Standard	NM_182965		Approved	SPHK	uc002jrj.2	Q9NYA1		ENST00000545180.1:c.703G>C	17.37:g.74383215G>C	ENSP00000440970:p.Asp235His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N632|Q96GK1|Q9HD92|Q9NY70|Q9NYL3	Missense_Mutation	SNP	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom	p.D321H	ENST00000545180.1	37	c.961	CCDS45785.1	17	.	.	.	.	.	.	.	.	.	.	G	14.33	2.503487	0.44558	.	.	ENSG00000176170	ENST00000545180;ENST00000323374;ENST00000392496;ENST00000543830	T;T;T	0.26373	1.83;1.74;1.83	5.08	2.98	0.34508	.	0.104301	0.64402	D	0.000006	T	0.43233	0.1238	M	0.76574	2.34	0.54753	D	0.999984	D;P;D	0.64830	0.987;0.904;0.994	P;P;P	0.59643	0.847;0.608;0.861	T	0.27571	-1.0070	10	0.51188	T	0.08	-20.7489	10.1874	0.43006	0.1752:0.0:0.8248:0.0	.	321;249;235	Q9NYA1-2;Q96GK1;Q9NYA1	.;.;SPHK1_HUMAN	H	235;321;235;234	ENSP00000440970:D235H;ENSP00000313681:D321H;ENSP00000376285:D235H	ENSP00000313681:D321H	D	+	1	0	SPHK1	71894810	1.000000	0.71417	0.003000	0.11579	0.070000	0.16714	5.727000	0.68523	0.456000	0.26937	0.563000	0.77884	GAT	SPHK1	-	NULL		0.642	SPHK1-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SPHK1	HGNC	protein_coding	OTTHUMT00000450113.1	G	NM_182965, NM_021972		74383215	+1	no_errors	ENST00000323374	ensembl	human	known	70_37	missense	SNP	0.958	C
SPTAN1	6709	genome.wustl.edu	37	9	131344825	131344825	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr9:131344825G>A	ENST00000372731.4	+	13	1750	c.1640G>A	c.(1639-1641)cGc>cAc	p.R547H	SPTAN1_ENST00000372739.3_Missense_Mutation_p.R547H|SPTAN1_ENST00000358161.5_Missense_Mutation_p.R547H	NM_001195532.1|NM_003127.3	NP_001182461.1|NP_003118.2	Q13813	SPTN1_HUMAN	spectrin, alpha, non-erythrocytic 1	547					actin filament capping (GO:0051693)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)	cuticular plate (GO:0032437)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|intracellular membrane-bounded organelle (GO:0043231)|lateral plasma membrane (GO:0016328)|membrane (GO:0016020)|microtubule cytoskeleton (GO:0015630)|spectrin (GO:0008091)|vesicle (GO:0031982)|Z disc (GO:0030018)	actin binding (GO:0003779)|calcium ion binding (GO:0005509)|structural constituent of cytoskeleton (GO:0005200)	p.R547H(1)		NS(2)|breast(8)|cervix(2)|endometrium(6)|kidney(4)|large_intestine(21)|liver(1)|lung(25)|ovary(5)|pancreas(1)|prostate(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	87						GTGGCCACTCGCCGAGATGCT	0.408																																					NSCLC(120;833 1744 2558 35612 37579)												1	Substitution - Missense(1)	cervix(1)											181.0	176.0	178.0					9																	131344825		2203	4300	6503	SO:0001583	missense	6709			M19725	CCDS6905.1, CCDS48036.1, CCDS75914.1	9q34.11	2013-01-10	2012-06-15		ENSG00000197694	ENSG00000197694		"""EF-hand domain containing"""	11273	protein-coding gene	gene with protein product	"""alpha-fodrin"""	182810				3336352	Standard	NM_003127		Approved		uc004bvm.4	Q13813	OTTHUMG00000020754	ENST00000372731.4:c.1640G>A	9.37:g.131344825G>A	ENSP00000361816:p.Arg547His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13186|Q15324|Q16606|Q59EF1|Q5VXV5|Q5VXV6|Q7Z6M5|Q9P0V0	Missense_Mutation	SNP	pfam_Spectrin_repeat,pfam_EF-hand_Ca_insen,pfam_SH3_domain,pfam_EF-hand,pfam_SH3_2,superfamily_SH3_domain,smart_Spectrin/alpha-actinin,smart_SH3_domain,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_SH3_domain,prints_Spectrin_alpha_SH3,prints_SH3_domain	p.R547H	ENST00000372731.4	37	c.1640	CCDS6905.1	9	.	.	.	.	.	.	.	.	.	.	G	20.9	4.063033	0.76187	.	.	ENSG00000197694	ENST00000358161;ENST00000372731;ENST00000372739;ENST00000372719	T;T;T	0.44881	0.91;0.91;0.91	5.82	5.82	0.92795	.	0.000000	0.85682	D	0.000000	T	0.72423	0.3458	M	0.90309	3.105	0.80722	D	1	D;D;D;P;D	0.89917	0.999;0.999;1.0;0.678;1.0	P;D;D;B;D	0.77004	0.907;0.989;0.949;0.16;0.988	T	0.76602	-0.2899	10	0.59425	D	0.04	.	19.0811	0.93182	0.0:0.0:1.0:0.0	.	547;547;547;547;547	A6NG51;B4DTV8;Q13813-3;Q13813-2;Q13813	.;.;.;.;SPTA2_HUMAN	H	547	ENSP00000350882:R547H;ENSP00000361816:R547H;ENSP00000361824:R547H	ENSP00000350882:R547H	R	+	2	0	SPTAN1	130384646	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.476000	0.97823	2.756000	0.94617	0.561000	0.74099	CGC	SPTAN1	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.408	SPTAN1-004	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTAN1	HGNC	protein_coding	OTTHUMT00000054472.1	G	NM_003127		131344825	+1	no_errors	ENST00000358161	ensembl	human	known	70_37	missense	SNP	1.000	A
SRP68	6730	genome.wustl.edu	37	17	74041399	74041399	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:74041399G>A	ENST00000307877.2	-	12	1529	c.1368C>T	c.(1366-1368)ctC>ctT	p.L456L	SRP68_ENST00000542536.2_5'UTR|SRP68_ENST00000355113.5_Silent_p.L355L|SRP68_ENST00000602720.1_Silent_p.L117L|SRP68_ENST00000539137.1_Silent_p.L418L	NM_014230.3	NP_055045.2	Q9UHB9	SRP68_HUMAN	signal recognition particle 68kDa	456					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|nucleolus (GO:0005730)|ribosome (GO:0005840)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|endoplasmic reticulum signal peptide binding (GO:0030942)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)	p.L456L(1)		NS(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(5)|lung(4)|ovary(2)|prostate(3)	23						CCAGAGTCTTGAGGCCTATCT	0.483																																																	1	Substitution - coding silent(1)	cervix(1)											96.0	86.0	90.0					17																	74041399		2203	4297	6500	SO:0001819	synonymous_variant	6730			AF195951	CCDS11738.1, CCDS58600.1, CCDS58601.1	17q25.1	2010-04-30	2002-08-29		ENSG00000167881	ENSG00000167881			11302	protein-coding gene	gene with protein product		604858	"""signal recognition particle 68kD"""			10618370	Standard	NM_014230		Approved		uc002jqk.2	Q9UHB9		ENST00000307877.2:c.1368C>T	17.37:g.74041399G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KUU5|B3KWY7|G3V1U4|Q8NCJ4|Q8WUK2	Silent	SNP	NULL	p.L456	ENST00000307877.2	37	c.1368	CCDS11738.1	17																																																																																			SRP68	-	NULL		0.483	SRP68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP68	HGNC	protein_coding	OTTHUMT00000449487.1	G	NM_014230		74041399	-1	no_errors	ENST00000307877	ensembl	human	known	70_37	silent	SNP	0.985	A
STX16	8675	genome.wustl.edu	37	20	57244413	57244413	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr20:57244413G>C	ENST00000371141.4	+	5	1184	c.460G>C	c.(460-462)Gag>Cag	p.E154Q	STX16_ENST00000358029.4_Missense_Mutation_p.E150Q|STX16_ENST00000496003.1_Intron|STX16_ENST00000359617.4_Missense_Mutation_p.E101Q|STX16_ENST00000361830.3_Missense_Mutation_p.E154Q|STX16_ENST00000371132.4_Missense_Mutation_p.E133Q|STX16_ENST00000361770.5_Missense_Mutation_p.E137Q|STX16_ENST00000355957.5_Missense_Mutation_p.E137Q|STX16-NPEPL1_ENST00000530122.1_Missense_Mutation_p.E154Q	NM_001001433.2	NP_001001433.1	O14662	STX16_HUMAN	syntaxin 16	154					intra-Golgi vesicle-mediated transport (GO:0006891)|intracellular protein transport (GO:0006886)|retrograde transport, endosome to Golgi (GO:0042147)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|intracellular membrane-bounded organelle (GO:0043231)|nucleolus (GO:0005730)|SNARE complex (GO:0031201)	SNAP receptor activity (GO:0005484)	p.E133Q(1)		breast(1)|cervix(1)|large_intestine(3)|lung(9)|ovary(1)|pancreas(1)|urinary_tract(1)	17	all_lung(29;0.0175)		BRCA - Breast invasive adenocarcinoma(13;3.73e-09)|Epithelial(14;8.54e-06)|all cancers(14;6.89e-05)			CTCCGAGCAGGAGGGGCGGCT	0.682																																																	1	Substitution - Missense(1)	cervix(1)											17.0	21.0	19.0					20																	57244413		2184	4257	6441	SO:0001583	missense	100534593			AF038897	CCDS13468.1, CCDS13469.1, CCDS46619.1, CCDS46620.1, CCDS56199.1	20q13.32	2008-07-02			ENSG00000124222	ENSG00000124222			11431	protein-coding gene	gene with protein product		603666				9464276, 9587053, 15800843	Standard	NM_003763		Approved	hsyn16, SYN16	uc002xzi.3	O14662	OTTHUMG00000033084	ENST00000371141.4:c.460G>C	20.37:g.57244413G>C	ENSP00000360183:p.Glu154Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NK32|A6NN69|A8MPP0|B7ZBN1|B7ZBN2|B7ZBN3|E1P5M0|E1P607|O14661|O14663|O60517|Q5W084|Q5W086|Q5W087|Q5XKI6|Q6GMS8|Q9H0Z0|Q9H1T7|Q9H1T8|Q9UIX5	Missense_Mutation	SNP	pfam_T_SNARE_dom,pfam_Syntaxin_N,superfamily_t-SNARE,smart_T_SNARE_dom,pfscan_T_SNARE_dom	p.E154Q	ENST00000371141.4	37	c.460	CCDS13468.1	20	.	.	.	.	.	.	.	.	.	.	G	36	5.732873	0.96856	.	.	ENSG00000124222	ENST00000458280;ENST00000355957;ENST00000361770;ENST00000312283;ENST00000412911;ENST00000359617;ENST00000371141;ENST00000371138;ENST00000371132;ENST00000358029;ENST00000361830;ENST00000438253	T;T;T;T;T;T;T;T;T;T;T	0.18657	2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2;2.2	5.87	5.87	0.94306	t-SNARE (1);Syntaxin, N-terminal (1);	0.000000	0.85682	U	0.000000	T	0.42017	0.1184	M	0.67517	2.055	0.80722	D	1	B;P;B;P	0.50710	0.111;0.571;0.105;0.938	B;P;B;P	0.55965	0.402;0.456;0.11;0.788	T	0.05194	-1.0900	10	0.48119	T	0.1	.	19.1915	0.93669	0.0:0.0:1.0:0.0	.	150;137;133;154	Q6GMS8;O14662-4;O14662-2;O14662	.;.;.;STX16_HUMAN	Q	101;137;137;101;101;101;154;101;133;150;154;96	ENSP00000388348:E101Q;ENSP00000348229:E137Q;ENSP00000355408:E137Q;ENSP00000312086:E101Q;ENSP00000416852:E101Q;ENSP00000352634:E101Q;ENSP00000360183:E154Q;ENSP00000360173:E133Q;ENSP00000350723:E150Q;ENSP00000354445:E154Q;ENSP00000401801:E96Q	ENSP00000360180:E101Q	E	+	1	0	STX16	56677819	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	9.348000	0.97062	2.779000	0.95612	0.655000	0.94253	GAG	STX16-NPEPL1	-	pfam_Syntaxin_N,superfamily_t-SNARE		0.682	STX16-002	KNOWN	basic|CCDS	protein_coding	STX16-NPEPL1	HGNC	protein_coding	OTTHUMT00000080517.2	G	NM_001001433		57244413	+1	no_errors	ENST00000530122	ensembl	human	known	70_37	missense	SNP	1.000	C
SYNPO	11346	genome.wustl.edu	37	5	150028172	150028172	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr5:150028172C>G	ENST00000394243.1	+	3	1441	c.1067C>G	c.(1066-1068)tCt>tGt	p.S356C	SYNPO_ENST00000518872.1_3'UTR|SYNPO_ENST00000522122.1_Missense_Mutation_p.S356C|SYNPO_ENST00000519664.1_Missense_Mutation_p.S112C|SYNPO_ENST00000307662.4_Missense_Mutation_p.S112C	NM_001166208.1	NP_001159680.1	Q8N3V7	SYNPO_HUMAN	synaptopodin	356					positive regulation of actin filament bundle assembly (GO:0032233)|regulation of stress fiber assembly (GO:0051492)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|postsynaptic membrane (GO:0045211)|stress fiber (GO:0001725)|tight junction (GO:0005923)	actin binding (GO:0003779)	p.S112C(1)|p.S356C(1)		NS(1)|cervix(1)|endometrium(3)|large_intestine(6)|lung(4)|prostate(1)|urinary_tract(2)	18		Medulloblastoma(196;0.134)|all_hematologic(541;0.224)	KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			CTGCCACTTTCTAGCATCCAA	0.567																																																	2	Substitution - Missense(2)	cervix(2)											150.0	139.0	143.0					5																	150028172		2203	4300	6503	SO:0001583	missense	11346			AF499137	CCDS4308.1, CCDS54937.1, CCDS54938.1	5q33.1	2008-02-05			ENSG00000171992	ENSG00000171992			30672	protein-coding gene	gene with protein product		608155				9314539, 10470851	Standard	NM_007286		Approved	KIAA1029	uc003lsn.3	Q8N3V7	OTTHUMG00000130078	ENST00000394243.1:c.1067C>G	5.37:g.150028172C>G	ENSP00000377789:p.Ser356Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A5PKZ8|D3DQG8|O15271|Q9UPX1	Missense_Mutation	SNP	NULL	p.S356C	ENST00000394243.1	37	c.1067	CCDS54937.1	5	.	.	.	.	.	.	.	.	.	.	C	9.142	1.014076	0.19277	.	.	ENSG00000171992	ENST00000394243;ENST00000522122;ENST00000307662;ENST00000519664	T;T;T	0.25749	1.78;1.78;1.79	4.49	3.6	0.41247	.	0.657792	0.13324	N	0.396468	T	0.20820	0.0501	L	0.27053	0.805	0.09310	N	1	P;P	0.51791	0.948;0.91	B;B	0.44163	0.443;0.326	T	0.05971	-1.0853	10	0.66056	D	0.02	-1.6483	9.8468	0.41032	0.2049:0.7951:0.0:0.0	.	112;356	Q8N3V7-2;Q8N3V7	.;SYNPO_HUMAN	C	356;356;112;112	ENSP00000377789:S356C;ENSP00000428378:S356C;ENSP00000429268:S112C	ENSP00000302139:S112C	S	+	2	0	SYNPO	150008365	0.003000	0.15002	0.001000	0.08648	0.184000	0.23303	1.711000	0.37930	0.858000	0.35431	0.561000	0.74099	TCT	SYNPO	-	NULL		0.567	SYNPO-002	KNOWN	basic|CCDS	protein_coding	SYNPO	HGNC	protein_coding	OTTHUMT00000252371.1	C	NM_007286		150028172	+1	no_errors	ENST00000394243	ensembl	human	known	70_37	missense	SNP	0.020	G
TFCP2L1	29842	genome.wustl.edu	37	2	121995282	121995282	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:121995282G>A	ENST00000263707.5	-	10	1017	c.920C>T	c.(919-921)cCa>cTa	p.P307L		NM_014553.2	NP_055368.1	Q9NZI6	TF2L1_HUMAN	transcription factor CP2-like 1	307					cell morphogenesis (GO:0000902)|cytoplasm organization (GO:0007028)|determination of adult lifespan (GO:0008340)|epithelial cell maturation (GO:0002070)|female pregnancy (GO:0007565)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of growth (GO:0045927)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|salivary gland development (GO:0007431)|steroid biosynthetic process (GO:0006694)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)	p.P307L(1)		cervix(1)|endometrium(4)|large_intestine(5)|lung(7)|ovary(1)|pancreas(2)|skin(1)|stomach(1)	22	Renal(3;0.01)					CGAAGCTGATGGGAGCAGGTG	0.602																																																	1	Substitution - Missense(1)	cervix(1)											87.0	87.0	87.0					2																	121995282		2203	4300	6503	SO:0001583	missense	29842			AF198488	CCDS2134.1	2q14	2008-02-05			ENSG00000115112	ENSG00000115112			17925	protein-coding gene	gene with protein product		609785				10644752, 11073954	Standard	NM_014553		Approved	LBP-9, CRTR1	uc002tmx.3	Q9NZI6	OTTHUMG00000131443	ENST00000263707.5:c.920C>T	2.37:g.121995282G>A	ENSP00000263707:p.Pro307Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZG43	Missense_Mutation	SNP	pfam_CP2,superfamily_SAM/pointed	p.P307L	ENST00000263707.5	37	c.920	CCDS2134.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.235040	0.95207	.	.	ENSG00000115112	ENST00000263707	T	0.22134	1.97	5.69	5.69	0.88448	Sterile alpha motif/pointed domain (1);	0.000000	0.85682	D	0.000000	T	0.52964	0.1767	M	0.84683	2.71	0.80722	D	1	D	0.63880	0.993	D	0.67382	0.951	T	0.57711	-0.7764	10	0.72032	D	0.01	.	19.819	0.96583	0.0:0.0:1.0:0.0	.	307	Q9NZI6	TF2L1_HUMAN	L	307	ENSP00000263707:P307L	ENSP00000263707:P307L	P	-	2	0	TFCP2L1	121711752	1.000000	0.71417	0.976000	0.42696	0.850000	0.48378	6.474000	0.73578	2.691000	0.91804	0.655000	0.94253	CCA	TFCP2L1	-	superfamily_SAM/pointed		0.602	TFCP2L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFCP2L1	HGNC	protein_coding	OTTHUMT00000338539.1	G	NM_014553		121995282	-1	no_errors	ENST00000263707	ensembl	human	known	70_37	missense	SNP	1.000	A
TGM5	9333	genome.wustl.edu	37	15	43527686	43527686	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr15:43527686G>C	ENST00000220420.5	-	10	1702	c.1695C>G	c.(1693-1695)atC>atG	p.I565M	TGM5_ENST00000349114.4_Missense_Mutation_p.I483M	NM_201631.3	NP_963925.2	O43548	TGM5_HUMAN	transglutaminase 5	565					cellular protein modification process (GO:0006464)|epidermis development (GO:0008544)|peptide cross-linking (GO:0018149)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|protein-glutamine gamma-glutamyltransferase activity (GO:0003810)	p.I565M(1)		central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(5)|large_intestine(11)|lung(15)|skin(6)|urinary_tract(1)	44		all_cancers(109;1.37e-14)|all_epithelial(112;1.26e-12)|Lung NSC(122;2.46e-08)|all_lung(180;2.75e-07)|Melanoma(134;0.0476)|Colorectal(260;0.216)		GBM - Glioblastoma multiforme(94;4e-07)	L-Glutamine(DB00130)	GAGAGAGTGTGATGAACGCTG	0.552																																																	1	Substitution - Missense(1)	cervix(1)											53.0	40.0	45.0					15																	43527686		2203	4299	6502	SO:0001583	missense	9333			AF035960	CCDS32211.1, CCDS32212.1	15q15	2004-07-07				ENSG00000104055		"""Transglutaminases"""	11781	protein-coding gene	gene with protein product		603805				9452468, 11390390	Standard	NM_201631		Approved	TGX	uc001zrd.2	O43548		ENST00000220420.5:c.1695C>G	15.37:g.43527686G>C	ENSP00000220420:p.Ile565Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O43549|Q0VF40|Q9UEZ4	Missense_Mutation	SNP	pfam_Transglutaminase_C,pfam_Transglutaminase_N,pfam_Transglutaminase-like,superfamily_Ig_E-set,superfamily_Transglutaminase_C,smart_Transglutaminase-like	p.I565M	ENST00000220420.5	37	c.1695	CCDS32212.1	15	.	.	.	.	.	.	.	.	.	.	G	9.419	1.082439	0.20309	.	.	ENSG00000104055	ENST00000220420;ENST00000349114;ENST00000396996	T;T	0.63744	1.52;-0.06	4.67	3.73	0.42828	Transglutaminase, C-terminal (2);Immunoglobulin-like fold (1);	0.379291	0.27023	N	0.021319	T	0.51346	0.1669	L	0.45228	1.405	0.32062	N	0.595578	B;B	0.22541	0.027;0.071	B;B	0.31016	0.043;0.123	T	0.54702	-0.8254	10	0.34782	T	0.22	-10.588	6.784	0.23664	0.0979:0.1793:0.7228:0.0	.	483;565	O43548-2;O43548	.;TGM5_HUMAN	M	565;483;564	ENSP00000220420:I565M;ENSP00000220419:I483M	ENSP00000220420:I565M	I	-	3	3	TGM5	41314978	0.907000	0.30839	0.998000	0.56505	0.861000	0.49209	0.550000	0.23345	2.427000	0.82271	0.655000	0.94253	ATC	TGM5	-	pfam_Transglutaminase_C,superfamily_Transglutaminase_C		0.552	TGM5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TGM5	HGNC	protein_coding	OTTHUMT00000432257.1	G	NM_004245		43527686	-1	no_errors	ENST00000220420	ensembl	human	known	70_37	missense	SNP	0.996	C
TIGIT	201633	genome.wustl.edu	37	3	114014436	114014436	+	Missense_Mutation	SNP	G	G	A	rs142063959		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:114014436G>A	ENST00000486257.1	+	3	363	c.106G>A	c.(106-108)Gag>Aag	p.E36K	TIGIT_ENST00000383671.3_Missense_Mutation_p.E36K|TIGIT_ENST00000481065.1_Missense_Mutation_p.E103K			Q495A1	TIGIT_HUMAN	T cell immunoreceptor with Ig and ITIM domains	36	Homodimerization.|Ig-like V-type.				negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|positive regulation of interleukin-10 production (GO:0032733)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)	p.E36K(1)		breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(4)|lung(7)|prostate(1)	17						CATTTCTGCAGAGAAAGGTGG	0.527																																																	1	Substitution - Missense(1)	cervix(1)						G	LYS/GLU	0,4406		0,0,2203	156.0	156.0	156.0		106	-1.0	1.0	3	dbSNP_134	156	2,8598	2.2+/-6.3	0,2,4298	no	missense	TIGIT	NM_173799.3	56	0,2,6501	AA,AG,GG		0.0233,0.0,0.0154	benign	36/245	114014436	2,13004	2203	4300	6503	SO:0001583	missense	201633			AK097192	CCDS2980.1	3q13.31	2013-01-11	2008-10-13	2008-10-13	ENSG00000181847	ENSG00000181847		"""Immunoglobulin superfamily / V-set domain containing"""	26838	protein-coding gene	gene with protein product		612859	"""V-set and immunoglobulin domain containing 9"", ""V-set and transmembrane domain containing 3"""	VSIG9, VSTM3		19011627	Standard	NM_173799		Approved	FLJ39873, DKFZp667A205	uc003ebg.2	Q495A1	OTTHUMG00000159331	ENST00000486257.1:c.106G>A	3.37:g.114014436G>A	ENSP00000419085:p.Glu36Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q495A3|Q5JPD8|Q6MZS2|Q8N877	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Immunoglobulin,smart_Ig_sub,pfscan_Ig-like	p.E36K	ENST00000486257.1	37	c.106	CCDS2980.1	3	.	.	.	.	.	.	.	.	.	.	G	0.812	-0.751519	0.03041	0.0	2.33E-4	ENSG00000181847	ENST00000461158;ENST00000481065;ENST00000486257;ENST00000383671;ENST00000484319	T;T;T;T;T	0.63913	-0.07;-0.07;-0.07;-0.07;-0.07	4.45	-1.01	0.10169	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.912644	0.09269	N	0.825389	T	0.38612	0.1047	N	0.14661	0.345	0.23795	N	0.996827	B	0.06786	0.001	B	0.06405	0.002	T	0.17410	-1.0370	10	0.26408	T	0.33	-3.954	5.6837	0.17790	0.2604:0.2629:0.4767:0.0	.	36	Q495A1	TIGIT_HUMAN	K	15;103;36;36;15	ENSP00000418917:E15K;ENSP00000420552:E103K;ENSP00000419085:E36K;ENSP00000373167:E36K;ENSP00000419706:E15K	ENSP00000373167:E36K	E	+	1	0	TIGIT	115497126	0.923000	0.31300	0.963000	0.40424	0.141000	0.21300	0.294000	0.19047	-0.231000	0.09825	-1.134000	0.01955	GAG	TIGIT	-	pfam_Ig_V-set,smart_Ig_sub,pfscan_Ig-like		0.527	TIGIT-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TIGIT	HGNC	protein_coding	OTTHUMT00000354690.1	G	NM_173799		114014436	+1	no_errors	ENST00000383671	ensembl	human	known	70_37	missense	SNP	0.755	A
TMEM100	55273	genome.wustl.edu	37	17	53798408	53798408	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr17:53798408C>T	ENST00000575734.1	-	4	832	c.24G>A	c.(22-24)gaG>gaA	p.E8E	TMEM100_ENST00000570586.1_5'Flank|TMEM100_ENST00000424486.2_Silent_p.E8E	NM_001099640.1	NP_001093110.1	Q9NV29	TM100_HUMAN	transmembrane protein 100	8					angiogenesis (GO:0001525)|arterial endothelial cell differentiation (GO:0060842)|BMP signaling pathway (GO:0030509)|cellular response to BMP stimulus (GO:0071773)|in utero embryonic development (GO:0001701)|Notch signaling pathway (GO:0007219)|positive regulation of endothelial cell differentiation (GO:0045603)|positive regulation of vasculogenesis (GO:2001214)|protein kinase B signaling (GO:0043491)|vasculogenesis (GO:0001570)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)		p.E8E(1)		cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(4)|skin(2)|upper_aerodigestive_tract(1)	11						CTCCCAGGATCTCCTTGATGG	0.498																																																	1	Substitution - coding silent(1)	cervix(1)											104.0	102.0	102.0					17																	53798408		2203	4300	6503	SO:0001819	synonymous_variant	55273			AK001832	CCDS11587.1	17q23.1	2005-12-16				ENSG00000166292			25607	protein-coding gene	gene with protein product							Standard	NM_018286		Approved	FLJ10970, FLJ37856	uc002iuj.4	Q9NV29		ENST00000575734.1:c.24G>A	17.37:g.53798408C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTY7|I3L214|Q96FZ0	Silent	SNP	NULL	p.E8	ENST00000575734.1	37	c.24	CCDS11587.1	17																																																																																			TMEM100	-	NULL		0.498	TMEM100-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM100	HGNC	protein_coding	OTTHUMT00000439266.2	C	NM_018286		53798408	-1	no_errors	ENST00000424486	ensembl	human	known	70_37	silent	SNP	1.000	T
TMEM43	79188	genome.wustl.edu	37	3	14170936	14170936	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:14170936G>A	ENST00000306077.4	+	2	291	c.37G>A	c.(37-39)Gaa>Aaa	p.E13K		NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	13					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.E13K(1)		breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						TACCCGGAGAGAACATGTCAA	0.423																																																	1	Substitution - Missense(1)	cervix(1)											83.0	84.0	83.0					3																	14170936		2203	4300	6503	SO:0001583	missense	79188			BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.37G>A	3.37:g.14170936G>A	ENSP00000303992:p.Glu13Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Missense_Mutation	SNP	pfam_TMEM43_fam	p.E13K	ENST00000306077.4	37	c.37	CCDS2618.1	3	.	.	.	.	.	.	.	.	.	.	G	12.95	2.090956	0.36855	.	.	ENSG00000170876	ENST00000306077	T	0.37411	1.2	4.74	4.74	0.60224	.	0.183525	0.47093	D	0.000251	T	0.27900	0.0687	N	0.22421	0.69	0.41802	D	0.989923	B	0.06786	0.001	B	0.04013	0.001	T	0.04991	-1.0913	10	0.40728	T	0.16	-6.7534	16.8791	0.86059	0.0:0.0:1.0:0.0	.	13	Q9BTV4	TMM43_HUMAN	K	13	ENSP00000303992:E13K	ENSP00000303992:E13K	E	+	1	0	TMEM43	14145937	1.000000	0.71417	0.870000	0.34147	0.346000	0.29079	6.753000	0.74904	2.341000	0.79615	0.591000	0.81541	GAA	TMEM43	-	NULL		0.423	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM43	HGNC	protein_coding	OTTHUMT00000252030.2	G	NM_024334		14170936	+1	no_errors	ENST00000306077	ensembl	human	known	70_37	missense	SNP	0.995	A
TMEM43	79188	genome.wustl.edu	37	3	14170986	14170986	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:14170986G>A	ENST00000306077.4	+	2	341	c.87G>A	c.(85-87)ctG>ctA	p.L29L		NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	29					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.L29L(2)		breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						TGGAACGGCTGAGCGAGACCT	0.493																																																	2	Substitution - coding silent(2)	cervix(1)|lung(1)											103.0	101.0	101.0					3																	14170986		2203	4300	6503	SO:0001819	synonymous_variant	79188			BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.87G>A	3.37:g.14170986G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Silent	SNP	pfam_TMEM43_fam	p.L29	ENST00000306077.4	37	c.87	CCDS2618.1	3																																																																																			TMEM43	-	NULL		0.493	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM43	HGNC	protein_coding	OTTHUMT00000252030.2	G	NM_024334		14170986	+1	no_errors	ENST00000306077	ensembl	human	known	70_37	silent	SNP	1.000	A
TMEM43	79188	genome.wustl.edu	37	3	14170992	14170992	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:14170992G>A	ENST00000306077.4	+	2	347	c.93G>A	c.(91-93)gaG>gaA	p.E31E		NM_024334.2	NP_077310.1	Q9BTV4	TMM43_HUMAN	transmembrane protein 43	31					nuclear membrane organization (GO:0071763)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)		p.E31E(1)		breast(1)|cervix(3)|endometrium(2)|large_intestine(5)|lung(4)|ovary(1)|prostate(1)|skin(2)	19						GGCTGAGCGAGACCTCGGGTG	0.498																																																	1	Substitution - coding silent(1)	cervix(1)											109.0	105.0	106.0					3																	14170992		2203	4300	6503	SO:0001819	synonymous_variant	79188			BC008054	CCDS2618.1	3p25.1	2014-09-17			ENSG00000170876	ENSG00000170876			28472	protein-coding gene	gene with protein product		612048	"""arrhythmogenic right ventricular dysplasia 5"""	ARVD5		11230166, 18313022	Standard	NM_024334		Approved	MGC3222, DKFZp586G1919, LUMA	uc003byk.2	Q9BTV4	OTTHUMG00000129802	ENST00000306077.4:c.93G>A	3.37:g.14170992G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7L4N5|Q8NC30|Q96A63|Q96F19|Q96JX0|Q9H076	Silent	SNP	pfam_TMEM43_fam	p.E31	ENST00000306077.4	37	c.93	CCDS2618.1	3																																																																																			TMEM43	-	NULL		0.498	TMEM43-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM43	HGNC	protein_coding	OTTHUMT00000252030.2	G	NM_024334		14170992	+1	no_errors	ENST00000306077	ensembl	human	known	70_37	silent	SNP	1.000	A
TRIM9	114088	genome.wustl.edu	37	14	51464737	51464737	+	Intron	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:51464737C>T	ENST00000298355.3	-	7	2725				TRIM9_ENST00000338969.5_Intron|TRIM9_ENST00000360392.4_Missense_Mutation_p.R545Q	NM_015163.5	NP_055978.4	Q9C026	TRIM9_HUMAN	tripartite motif containing 9						negative regulation of calcium ion-dependent exocytosis (GO:0045955)|negative regulation of SNARE complex assembly (GO:0035544)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|synaptic vesicle exocytosis (GO:0016079)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|dendrite (GO:0030425)|synaptic vesicle (GO:0008021)	ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(4)|kidney(2)|large_intestine(7)|liver(1)|lung(11)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	31	all_epithelial(31;0.00418)|Breast(41;0.148)					ACGCAGTTCTCGCTCTGAGGG	0.557																																																	0													74.0	59.0	64.0					14																	51464737		2203	4300	6503	SO:0001627	intron_variant	114088			AF220036	CCDS9703.1, CCDS45105.1	14q21.3	2013-02-11	2011-01-25		ENSG00000100505	ENSG00000100505		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"", ""Fibronectin type III domain containing"""	16288	protein-coding gene	gene with protein product		606555	"""tripartite motif-containing 9"""			11331580, 11524423	Standard	NM_015163		Approved	SPRING, RNF91	uc001wyx.4	Q9C026	OTTHUMG00000140291	ENST00000298355.3:c.1603+30G>A	14.37:g.51464737C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSB7|D3DSB8|Q92557|Q96D24|Q96NI4|Q9C025|Q9C027	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,superfamily_Fibronectin_type3,superfamily_Znf_FYVE_PHD,smart_Znf_RING,smart_Znf_B-box,smart_Bbox_C,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.R545Q	ENST00000298355.3	37	c.1634	CCDS9703.1	14	.	.	.	.	.	.	.	.	.	.	C	16.50	3.141497	0.57044	.	.	ENSG00000100505	ENST00000360392	T	0.54279	0.58	6.06	5.0	0.66597	.	.	.	.	.	T	0.37945	0.1022	.	.	.	0.28892	N	0.893781	B	0.20780	0.048	B	0.08055	0.003	T	0.11966	-1.0566	8	0.40728	T	0.16	.	8.8782	0.35358	0.0:0.7448:0.1664:0.0888	.	545	Q9C026-5	.	Q	545	ENSP00000353561:R545Q	ENSP00000353561:R545Q	R	-	2	0	TRIM9	50534487	0.590000	0.26815	1.000000	0.80357	0.999000	0.98932	-0.012000	0.12699	2.882000	0.98803	0.655000	0.94253	CGA	TRIM9	-	NULL		0.557	TRIM9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM9	HGNC	protein_coding	OTTHUMT00000276874.1	C	NM_015163		51464737	-1	no_errors	ENST00000360392	ensembl	human	known	70_37	missense	SNP	1.000	T
TSC22D2	9819	genome.wustl.edu	37	3	150127938	150127938	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr3:150127938G>A	ENST00000361875.3	+	1	1817	c.801G>A	c.(799-801)caG>caA	p.Q267Q	TSC22D2_ENST00000361136.2_Silent_p.Q267Q	NM_014779.2	NP_055594.1	O75157	T22D2_HUMAN	TSC22 domain family, member 2	267					response to osmotic stress (GO:0006970)		sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q267Q(1)		cervix(2)|endometrium(2)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)|upper_aerodigestive_tract(1)	18			LUSC - Lung squamous cell carcinoma(72;0.0538)|Lung(72;0.066)			CCCAGCCGCAGAGTTTTAGCG	0.697																																																	1	Substitution - coding silent(1)	cervix(1)											7.0	10.0	9.0					3																	150127938		1857	3745	5602	SO:0001819	synonymous_variant	9819			AB014569	CCDS3149.1	3q25.1	2005-03-01			ENSG00000196428	ENSG00000196428			29095	protein-coding gene	gene with protein product						9734811	Standard	NM_014779		Approved	KIAA0669, TILZ4a, TILZ4b, TILZ4c	uc003exv.3	O75157	OTTHUMG00000159744	ENST00000361875.3:c.801G>A	3.37:g.150127938G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNI5|Q6PI50|Q9H2Z6|Q9H2Z7|Q9H2Z8	Silent	SNP	pfam_TSC-22_Dip_Bun	p.Q267	ENST00000361875.3	37	c.801	CCDS3149.1	3																																																																																			TSC22D2	-	NULL		0.697	TSC22D2-001	KNOWN	basic|CCDS	protein_coding	TSC22D2	HGNC	protein_coding	OTTHUMT00000357123.2	G	NM_014779		150127938	+1	no_errors	ENST00000361875	ensembl	human	known	70_37	silent	SNP	0.018	A
U2AF2	11338	genome.wustl.edu	37	19	56180459	56180459	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:56180459G>T	ENST00000308924.4	+	10	996	c.956G>T	c.(955-957)gGg>gTg	p.G319V	U2AF2_ENST00000590551.1_Missense_Mutation_p.G155V|CTD-2537I9.12_ENST00000585940.1_RNA|CTD-2537I9.12_ENST00000589456.1_RNA|CTD-2537I9.13_ENST00000592252.1_RNA|U2AF2_ENST00000450554.2_Missense_Mutation_p.G319V			P26368	U2AF2_HUMAN	U2 small nuclear RNA auxiliary factor 2	319	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA export from nucleus (GO:0006406)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|spliceosomal complex (GO:0005681)	enzyme binding (GO:0019899)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)	p.G319V(1)		biliary_tract(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(9)|ovary(1)|prostate(1)|urinary_tract(2)	21		Colorectal(82;0.00244)|Ovarian(87;0.133)	BRCA - Breast invasive adenocarcinoma(297;0.18)	GBM - Glioblastoma multiforme(193;0.107)		GCCATTGCGGGGCTGAACGGC	0.662																																																	1	Substitution - Missense(1)	cervix(1)											35.0	36.0	36.0					19																	56180459		2203	4300	6503	SO:0001583	missense	11338			BC008740	CCDS12933.1, CCDS46197.1	19q13.43	2014-09-17	2006-04-11			ENSG00000063244		"""RNA binding motif (RRM) containing"""	23156	protein-coding gene	gene with protein product	"""U2 small nuclear ribonucleoprotein auxiliary factor (65kD)"", ""splicing factor U2AF 65 kD subunit"", ""U2 snRNP auxiliary factor large subunit"""	191318	"""U2 (RNU2) small nuclear RNA auxiliary factor 2"""			1538748	Standard	XM_006722994		Approved	U2AF65	uc002qlu.3	P26368		ENST00000308924.4:c.956G>T	19.37:g.56180459G>T	ENSP00000307863:p.Gly319Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96HC5	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_U2AF_lg	p.G319V	ENST00000308924.4	37	c.956	CCDS12933.1	19	.	.	.	.	.	.	.	.	.	.	G	18.88	3.716795	0.68844	.	.	ENSG00000063244	ENST00000308924;ENST00000450554	T;T	0.16324	2.35;2.35	3.63	2.54	0.30619	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.000000	0.85682	D	0.000000	T	0.40015	0.1100	M	0.80422	2.495	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.71656	0.974;0.955	T	0.35919	-0.9769	10	0.66056	D	0.02	-23.8284	11.2469	0.49002	0.0:0.0:0.8151:0.1849	.	319;319	P26368;P26368-2	U2AF2_HUMAN;.	V	319	ENSP00000307863:G319V;ENSP00000388475:G319V	ENSP00000307863:G319V	G	+	2	0	U2AF2	60872271	1.000000	0.71417	0.996000	0.52242	0.931000	0.56810	8.789000	0.91839	0.841000	0.35020	0.591000	0.81541	GGG	U2AF2	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_U2AF_lg		0.662	U2AF2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	U2AF2	HGNC	protein_coding	OTTHUMT00000453599.1	G	NM_007279		56180459	+1	no_errors	ENST00000308924	ensembl	human	known	70_37	missense	SNP	1.000	T
UBE2H	7328	genome.wustl.edu	37	7	129474842	129474842	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr7:129474842C>T	ENST00000355621.3	-	7	880	c.487G>A	c.(487-489)Gac>Aac	p.D163N	UBE2H_ENST00000473814.2_Missense_Mutation_p.D132N	NM_001202498.1|NM_003344.3	NP_001189427.1|NP_003335.1	P62256	UBE2H_HUMAN	ubiquitin-conjugating enzyme E2H	163					protein K11-linked ubiquitination (GO:0070979)|protein K48-linked ubiquitination (GO:0070936)|ubiquitin-dependent protein catabolic process (GO:0006511)		acid-amino acid ligase activity (GO:0016881)|ATP binding (GO:0005524)|ubiquitin-protein transferase activity (GO:0004842)	p.D163N(1)		cervix(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(2)|skin(1)	10	Melanoma(18;0.0435)					GATGAGCTGTCCCCGGTACCC	0.507																																																	1	Substitution - Missense(1)	cervix(1)											94.0	87.0	89.0					7																	129474842		2203	4300	6503	SO:0001583	missense	7328			BC006277	CCDS5814.1, CCDS47710.1	7q32	2012-07-20	2011-05-19		ENSG00000186591	ENSG00000186591	6.3.2.19	"""Ubiquitin-conjugating enzymes E2"""	12484	protein-coding gene	gene with protein product	"""GID complex subunit 3, UBC8 homolog (S. cerevisiae)"""	601082	"""ubiquitin-conjugating enzyme E2H (homologous to yeast UBC8)"", ""ubiquitin-conjugating enzyme E2H (UBC8 homolog, yeast)"""			8132613	Standard	NM_003344		Approved	UBCH, UBC8, GID3	uc003vpf.2	P62256	OTTHUMG00000157650	ENST00000355621.3:c.487G>A	7.37:g.129474842C>T	ENSP00000347836:p.Asp163Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1L6|C9JY93|P37286|Q7Z6F4	Missense_Mutation	SNP	pfam_UBQ-conjugat_E2,superfamily_UBQ-conjugating_enzyme/RWD,pfscan_UBQ-conjugat_E2	p.D163N	ENST00000355621.3	37	c.487	CCDS5814.1	7	.	.	.	.	.	.	.	.	.	.	C	18.20	3.570668	0.65765	.	.	ENSG00000186591	ENST00000355621;ENST00000473814;ENST00000496698	T;T;T	0.74002	-0.13;-0.8;1.44	5.88	5.88	0.94601	Ubiquitin-conjugating enzyme/RWD-like (1);	0.000000	0.85682	D	0.000000	T	0.73040	0.3536	N	0.08118	0	0.80722	D	1	P;B	0.49447	0.924;0.1	P;B	0.59424	0.857;0.024	T	0.76132	-0.3071	10	0.44086	T	0.13	-30.2525	19.2287	0.93829	0.0:1.0:0.0:0.0	.	132;163	A4D1L6;P62256	.;UBE2H_HUMAN	N	163;132;130	ENSP00000347836:D163N;ENSP00000419097:D132N;ENSP00000417681:D130N	ENSP00000347836:D163N	D	-	1	0	UBE2H	129262078	1.000000	0.71417	0.981000	0.43875	0.981000	0.71138	7.466000	0.80914	2.797000	0.96272	0.561000	0.74099	GAC	UBE2H	-	NULL		0.507	UBE2H-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBE2H	HGNC	protein_coding	OTTHUMT00000349327.2	C	NM_003344		129474842	-1	no_errors	ENST00000355621	ensembl	human	known	70_37	missense	SNP	1.000	T
UBR3	130507	genome.wustl.edu	37	2	170930076	170930076	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:170930076G>A	ENST00000272793.5	+	36	5208	c.5158G>A	c.(5158-5160)Gag>Aag	p.E1720K	UBR3_ENST00000418381.1_Missense_Mutation_p.E1720K|UBR3_ENST00000392631.1_Missense_Mutation_p.E541K			Q6ZT12	UBR3_HUMAN	ubiquitin protein ligase E3 component n-recognin 3 (putative)	1720					embryo development (GO:0009790)|in utero embryonic development (GO:0001701)|olfactory behavior (GO:0042048)|sensory perception of smell (GO:0007608)|suckling behavior (GO:0001967)|ubiquitin-dependent protein catabolic process (GO:0006511)	integral component of membrane (GO:0016021)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)	p.E1720K(1)|p.E573K(1)		breast(2)|cervix(1)|endometrium(5)|kidney(2)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(3)|stomach(1)	33						GTGGTGTTTTGAGATAAAATC	0.388																																																	2	Substitution - Missense(2)	cervix(2)											109.0	106.0	107.0					2																	170930076		2203	4299	6502	SO:0001583	missense	130507			AL834144	CCDS2238.2	2q31.1	2008-06-23	2008-06-23	2007-11-29	ENSG00000144357	ENSG00000144357		"""Ubiquitin protein ligase E3 component n-recognins"""	30467	protein-coding gene	gene with protein product		613831	"""zinc finger protein 650"""	ZNF650		17462990	Standard	NM_172070		Approved	KIAA2024, DKFZp434P117, FLJ37422	uc010zdi.2	Q6ZT12	OTTHUMG00000132229	ENST00000272793.5:c.5158G>A	2.37:g.170930076G>A	ENSP00000272793:p.Glu1720Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZR7|Q2KHN5|Q6ZR55|Q6ZSC2|Q8IVE7|Q8ND96	Missense_Mutation	SNP	pfam_Znf_N-recognin,smart_Znf_N-recognin_met,pfscan_Znf_N-recognin	p.E1720K	ENST00000272793.5	37	c.5158		2	.	.	.	.	.	.	.	.	.	.	G	34	5.360289	0.95877	.	.	ENSG00000144357	ENST00000272793;ENST00000442603;ENST00000418381;ENST00000392631;ENST00000439681	T;T;T;T	0.40756	1.02;1.02;1.02;1.02	5.41	5.41	0.78517	.	0.000000	0.85682	D	0.000000	T	0.62270	0.2414	M	0.64997	1.995	0.52501	D	0.999953	D;D;D	0.71674	0.997;0.998;0.993	D;D;D	0.78314	0.98;0.991;0.971	T	0.54139	-0.8338	10	0.23302	T	0.38	.	19.5612	0.95373	0.0:0.0:1.0:0.0	.	1720;541;1749	Q6ZT12;Q6ZT12-2;E7EVK3	UBR3_HUMAN;.;.	K	1720;1749;1720;541;420	ENSP00000272793:E1720K;ENSP00000396068:E1720K;ENSP00000376408:E541K;ENSP00000389097:E420K	ENSP00000272793:E1720K	E	+	1	0	UBR3	170638322	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.923000	0.92808	2.687000	0.91594	0.655000	0.94253	GAG	UBR3	-	NULL		0.388	UBR3-001	KNOWN	non_canonical_conserved|basic|appris_principal	protein_coding	UBR3	HGNC	protein_coding	OTTHUMT00000255290.2	G	NM_172070		170930076	+1	no_errors	ENST00000272793	ensembl	human	known	70_37	missense	SNP	1.000	A
ULK1	8408	genome.wustl.edu	37	12	132393320	132393320	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr12:132393320G>A	ENST00000321867.4	+	6	799	c.448G>A	c.(448-450)Gcc>Acc	p.A150T		NM_003565.2	NP_003556	O75385	ULK1_HUMAN	unc-51 like autophagy activating kinase 1	150	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				autophagic vacuole assembly (GO:0000045)|axon extension (GO:0048675)|cellular response to nutrient levels (GO:0031669)|cerebellar granule cell differentiation (GO:0021707)|negative regulation of collateral sprouting (GO:0048671)|neuron projection development (GO:0031175)|neuron projection regeneration (GO:0031102)|positive regulation of autophagy (GO:0010508)|positive regulation of macroautophagy (GO:0016239)|protein autophosphorylation (GO:0046777)|protein localization (GO:0008104)|protein phosphorylation (GO:0006468)|radial glia guided migration of cerebellar granule cell (GO:0021933)|Ras protein signal transduction (GO:0007265)|receptor internalization (GO:0031623)|regulation of autophagy (GO:0010506)|regulation of neurotrophin TRK receptor signaling pathway (GO:0051386)|response to starvation (GO:0042594)	ATG1/UKL1 signaling complex (GO:0034273)|autophagic vacuole (GO:0005776)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|extrinsic component of autophagic vacuole membrane (GO:0097635)|extrinsic component of omegasome membrane (GO:0097629)|extrinsic component of pre-autophagosomal structure membrane (GO:0097632)|neuron projection (GO:0043005)|neuronal cell body (GO:0043025)|pre-autophagosomal structure membrane (GO:0034045)|ULK1-ATG13-FIP200 complex (GO:0070969)	ATP binding (GO:0005524)|protein complex binding (GO:0032403)|protein serine/threonine kinase activity (GO:0004674)|Rab GTPase binding (GO:0017137)			breast(1)|central_nervous_system(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(11)|ovary(1)|prostate(2)|skin(2)|urinary_tract(2)	29	all_neural(191;0.0982)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;2.07e-08)|Epithelial(86;2.56e-07)|all cancers(50;3.01e-07)		GTCCAACCCCGCCGGCCGCCG	0.721																																																	0													20.0	22.0	21.0					12																	132393320		2196	4286	6482	SO:0001583	missense	8408			AF045458	CCDS9274.1	12q24.3	2014-02-12	2013-07-02		ENSG00000177169	ENSG00000177169			12558	protein-coding gene	gene with protein product	"""ATG1 autophagy related 1 homolog (S. cerevisiae)"""	603168	"""unc-51 (C. elegans)-like kinase 1"", ""unc-51-like kinase 1 (C. elegans)"""			9693035	Standard	NM_003565		Approved	ATG1, ATG1A	uc001uje.3	O75385	OTTHUMG00000168052	ENST00000321867.4:c.448G>A	12.37:g.132393320G>A	ENSP00000324560:p.Ala150Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UQ28	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ser/Thr_kinase_C,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.A150T	ENST00000321867.4	37	c.448	CCDS9274.1	12	.	.	.	.	.	.	.	.	.	.	G	10.02	1.234916	0.22626	.	.	ENSG00000177169	ENST00000321867;ENST00000537421;ENST00000542313	T;T;T	0.64991	-0.13;-0.13;-0.13	5.51	2.74	0.32292	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.379278	0.27826	N	0.017698	T	0.38295	0.1035	N	0.12502	0.225	0.21604	N	0.999622	B	0.14012	0.009	B	0.17098	0.017	T	0.18777	-1.0326	10	0.08599	T	0.76	-16.4284	10.7836	0.46393	0.204:0.0:0.796:0.0	.	150	O75385	ULK1_HUMAN	T	150;67;44	ENSP00000324560:A150T;ENSP00000438953:A67T;ENSP00000444983:A44T	ENSP00000324560:A150T	A	+	1	0	ULK1	130959273	0.976000	0.34144	0.004000	0.12327	0.715000	0.41141	2.803000	0.47924	0.308000	0.22923	0.455000	0.32223	GCC	ULK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_LipoPS_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Ser/Thr_kin_STPK_Ulk-1/2,pfscan_Prot_kinase_cat_dom		0.721	ULK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK1	HGNC	protein_coding	OTTHUMT00000397769.3	G			132393320	+1	no_errors	ENST00000321867	ensembl	human	known	70_37	missense	SNP	0.005	A
UQCRC2	7385	genome.wustl.edu	37	16	21994417	21994417	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr16:21994417G>A	ENST00000268379.4	+	14	2051	c.1287G>A	c.(1285-1287)aaG>aaA	p.K429K	UQCRC2_ENST00000561553.1_Missense_Mutation_p.R378K	NM_003366.2	NP_003357.2	P22695	QCR2_HUMAN	ubiquinol-cytochrome c reductase core protein II	429					aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex III (GO:0005750)|mitochondrion (GO:0005739)	metal ion binding (GO:0046872)|metalloendopeptidase activity (GO:0004222)	p.K429K(1)		breast(1)|cervix(1)|endometrium(2)|large_intestine(5)|lung(4)|prostate(1)|skin(1)	15				GBM - Glioblastoma multiforme(48;0.0264)		AGGCGGCAAAGAAGTTTGTTT	0.338																																					Colon(123;450 1645 12841 25393 45623)												1	Substitution - coding silent(1)	cervix(1)											98.0	89.0	92.0					16																	21994417		2198	4300	6498	SO:0001819	synonymous_variant	7385			J04973	CCDS10601.1	16p12	2011-07-04			ENSG00000140740	ENSG00000140740	1.10.2.2	"""Mitochondrial respiratory chain complex / Complex III"""	12586	protein-coding gene	gene with protein product		191329				8288258, 2547763	Standard	NM_003366		Approved	QCR2, UQCR2	uc002djx.3	P22695	OTTHUMG00000131585	ENST00000268379.4:c.1287G>A	16.37:g.21994417G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSN4|Q9BQ05	Missense_Mutation	SNP	pfam_Pept_M16_N,pfam_Peptidase_M16_C,superfamily_Metalloenz_metal-bd	p.R378K	ENST00000268379.4	37	c.1133	CCDS10601.1	16																																																																																			UQCRC2	-	NULL		0.338	UQCRC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UQCRC2	HGNC	protein_coding	OTTHUMT00000254466.1	G	NM_003366		21994417	+1	no_errors	ENST00000561553	ensembl	human	putative	70_37	missense	SNP	1.000	A
URM1	81605	genome.wustl.edu	37	9	131150142	131150142	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr9:131150142G>C	ENST00000372853.4	+	3	216	c.154G>C	c.(154-156)Gag>Cag	p.E52Q	URM1_ENST00000452446.1_Missense_Mutation_p.E52Q|URM1_ENST00000372847.1_3'UTR|URM1_ENST00000483206.1_3'UTR|URM1_ENST00000372850.1_Missense_Mutation_p.E52Q	NM_001265582.1|NM_030914.3	NP_001252511.1|NP_112176.1			ubiquitin related modifier 1									p.E52Q(2)		cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(1)	5						TTTGCTAAAAGAGCGGCCAGA	0.537																																																	2	Substitution - Missense(2)	cervix(2)											121.0	120.0	120.0					9																	131150142		2203	4300	6503	SO:0001583	missense	81605			AK097029	CCDS6900.1, CCDS48035.1, CCDS59148.1	9q34.13	2010-06-24	2010-06-24	2006-11-28	ENSG00000167118	ENSG00000167118			28378	protein-coding gene	gene with protein product		612693	"""chromosome 9 open reading frame 74"", ""ubiquitin related modifier 1 homolog (S. cerevisiae)"""	C9orf74		16046629, 16864801	Standard	NM_030914		Approved	MGC2668	uc011may.2	Q9BTM9	OTTHUMG00000020742	ENST00000372853.4:c.154G>C	9.37:g.131150142G>C	ENSP00000361944:p.Glu52Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Urm1,superfamily_Mopterin_synth/thiamin_S_b	p.E52Q	ENST00000372853.4	37	c.154	CCDS6900.1	9	.	.	.	.	.	.	.	.	.	.	G	29.2	4.989911	0.93106	.	.	ENSG00000167118	ENST00000372853;ENST00000452446;ENST00000372850	.	.	.	5.67	5.67	0.87782	Molybdopterin synthase/thiamin biosynthesis sulphur carrier, beta-grasp (1);Beta-grasp fold, ferredoxin-type (1);	0.000000	0.85682	D	0.000000	D	0.85635	0.5742	M	0.90019	3.08	0.80722	D	1	D;D	0.89917	1.0;0.99	D;D	0.76071	0.987;0.976	D	0.87937	0.2714	9	0.72032	D	0.01	-9.3488	18.751	0.91814	0.0:0.0:1.0:0.0	.	52;52	Q9BTM9-2;Q9BTM9	.;URM1_HUMAN	Q	52	.	ENSP00000361941:E52Q	E	+	1	0	URM1	130189963	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.484000	0.90445	2.666000	0.90696	0.561000	0.74099	GAG	URM1	-	pfam_Urm1,superfamily_Mopterin_synth/thiamin_S_b		0.537	URM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	URM1	HGNC	protein_coding	OTTHUMT00000054422.1	G	NM_030914		131150142	+1	no_errors	ENST00000452446	ensembl	human	known	70_37	missense	SNP	1.000	C
USHBP1	83878	genome.wustl.edu	37	19	17374921	17374921	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:17374921G>A	ENST00000252597.3	-	3	266	c.93C>T	c.(91-93)gtC>gtT	p.V31V	USHBP1_ENST00000598570.1_Intron|USHBP1_ENST00000431146.2_Intron	NM_031941.3	NP_114147.2			Usher syndrome 1C binding protein 1									p.V31V(1)		breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(4)|large_intestine(10)|liver(1)|lung(12)|ovary(3)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)	44						TGGCTGCCTCGACCTCCTCTG	0.677																																																	1	Substitution - coding silent(1)	cervix(1)											34.0	36.0	35.0					19																	17374921		2203	4300	6503	SO:0001819	synonymous_variant	83878			AK096028	CCDS12353.1	19p13.11	2013-06-10			ENSG00000130307	ENSG00000130307			24058	protein-coding gene	gene with protein product		611810				11311560	Standard	XM_005260093		Approved	MCC2, AIEBP, FLJ38709	uc002nfs.1	Q8N6Y0	OTTHUMG00000182730	ENST00000252597.3:c.93C>T	19.37:g.17374921G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_USH1C-bd_PDZ_domain	p.V31	ENST00000252597.3	37	c.93	CCDS12353.1	19																																																																																			USHBP1	-	NULL		0.677	USHBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USHBP1	HGNC	protein_coding	OTTHUMT00000463328.1	G	NM_031941		17374921	-1	no_errors	ENST00000252597	ensembl	human	known	70_37	silent	SNP	0.000	A
USP38	84640	genome.wustl.edu	37	4	144106889	144106889	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:144106889C>G	ENST00000307017.4	+	1	792	c.286C>G	c.(286-288)Ctg>Gtg	p.L96V	RP11-284M14.1_ENST00000507486.1_RNA|USP38_ENST00000510377.1_Missense_Mutation_p.L96V|RP11-284M14.1_ENST00000507826.1_RNA	NM_032557.5	NP_115946.2	Q8NB14	UBP38_HUMAN	ubiquitin specific peptidase 38	96					protein deubiquitination (GO:0016579)|ubiquitin-dependent protein catabolic process (GO:0006511)		ubiquitin-specific protease activity (GO:0004843)	p.L96V(1)		breast(2)|cervix(1)|endometrium(1)|kidney(1)|large_intestine(9)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|urinary_tract(3)	33	all_hematologic(180;0.158)					CTACCACTCTCTGGACAGGAA	0.557																																																	1	Substitution - Missense(1)	cervix(1)											102.0	80.0	88.0					4																	144106889		2203	4300	6503	SO:0001583	missense	84640			AF211481	CCDS3758.1	4q31.1	2008-02-05	2005-08-08		ENSG00000170185	ENSG00000170185		"""Ubiquitin-specific peptidases"""	20067	protein-coding gene	gene with protein product			"""ubiquitin specific protease 38"""			12838346	Standard	NM_032557		Approved	KIAA1891, HP43.8KD	uc003ijb.3	Q8NB14	OTTHUMG00000161420	ENST00000307017.4:c.286C>G	4.37:g.144106889C>G	ENSP00000303434:p.Leu96Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KX93|Q3ZCV1|Q8NDF5|Q96DK6|Q96PZ6|Q9BY55	Missense_Mutation	SNP	pfam_Peptidase_C19,pfscan_Peptidase_C19	p.L96V	ENST00000307017.4	37	c.286	CCDS3758.1	4	.	.	.	.	.	.	.	.	.	.	C	2.427	-0.331661	0.05314	.	.	ENSG00000170185	ENST00000510377;ENST00000307017	T;T	0.66099	-0.19;3.1	5.12	4.28	0.50868	.	0.090297	0.45867	N	0.000336	T	0.47229	0.1434	L	0.29908	0.895	0.43065	D	0.994695	B;B	0.14012	0.009;0.009	B;B	0.14578	0.008;0.011	T	0.41413	-0.9510	10	0.38643	T	0.18	-7.1026	8.9174	0.35590	0.0:0.6396:0.2853:0.075	.	96;96	Q8NB14;Q3ZCV1	UBP38_HUMAN;.	V	96	ENSP00000427647:L96V;ENSP00000303434:L96V	ENSP00000303434:L96V	L	+	1	2	USP38	144326339	0.298000	0.24417	1.000000	0.80357	0.968000	0.65278	0.934000	0.28910	1.376000	0.46267	0.561000	0.74099	CTG	USP38	-	NULL		0.557	USP38-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP38	HGNC	protein_coding	OTTHUMT00000364869.1	C	NM_032557		144106889	+1	no_errors	ENST00000307017	ensembl	human	known	70_37	missense	SNP	0.995	G
VIT	5212	genome.wustl.edu	37	2	36986238	36986238	+	Intron	SNP	C	C	T	rs61745550		TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:36986238C>T	ENST00000389975.3	+	6	789				VIT_ENST00000457137.2_Missense_Mutation_p.T179M|VIT_ENST00000379241.3_Intron|VIT_ENST00000404084.1_Intron|VIT_ENST00000497382.1_Intron|VIT_ENST00000401530.1_Intron|VIT_ENST00000379242.3_Intron	NM_001177969.1|NM_001177970.1	NP_001171440.1|NP_001171441.1	Q6UXI7	VITRN_HUMAN	vitrin						extracellular matrix organization (GO:0030198)|positive regulation of cell-substrate adhesion (GO:0010811)	interstitial matrix (GO:0005614)	glycosaminoglycan binding (GO:0005539)			autonomic_ganglia(1)|breast(3)|endometrium(18)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(15)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	57		all_hematologic(82;0.248)				TCCATGAACACGCGACGTGTT	0.473																																																	0								C	,,,MET/THR,	0,4406		0,0,2203	81.0	79.0	80.0		,,,536,	-9.0	0.0	2	dbSNP_129	80	1,8599	1.2+/-3.3	0,1,4299	no	intron,intron,intron,missense,intron	VIT	NM_001177969.1,NM_001177970.1,NM_001177971.1,NM_001177972.1,NM_053276.3	,,,81,	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	,,,,	,,,179/204,	36986238	1,13005	2203	4300	6503	SO:0001627	intron_variant	5212			AF063833	CCDS33180.1, CCDS54347.1, CCDS54348.1, CCDS54349.1, CCDS54350.1	2p22.2	2008-05-15			ENSG00000205221	ENSG00000205221			12697	protein-coding gene	gene with protein product							Standard	NM_001177969		Approved		uc002rpl.3	Q6UXI7	OTTHUMG00000152149	ENST00000389975.3:c.487+49C>T	2.37:g.36986238C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A526|A6NKI9|A8K7Y4|E9PF47|Q6P7T3|Q96DM8|Q96DT1|Q9UDN0	Missense_Mutation	SNP	pfam_LCCL,superfamily_LCCL,smart_LCCL,pfscan_LCCL	p.T179M	ENST00000389975.3	37	c.536	CCDS54347.1	2	.	.	.	.	.	.	.	.	.	.	C	0.694	-0.793228	0.02862	0.0	1.16E-4	ENSG00000205221	ENST00000457137	D	0.90955	-2.76	4.76	-8.99	0.00751	.	.	.	.	.	T	0.75191	0.3816	.	.	.	0.09310	N	1	B	0.09022	0.002	B	0.06405	0.002	T	0.61028	-0.7145	7	.	.	.	.	2.598	0.04859	0.1019:0.172:0.3305:0.3957	rs61745550	179	Q6UXI7-3	.	M	179	ENSP00000393561:T179M	.	T	+	2	0	VIT	36839742	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-3.208000	0.00557	-1.426000	0.01994	-0.519000	0.04390	ACG	VIT	-	NULL		0.473	VIT-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	VIT	HGNC	protein_coding		C			36986238	+1	no_errors	ENST00000457137	ensembl	human	known	70_37	missense	SNP	0.000	T
VNN3	55350	genome.wustl.edu	37	6	133048037	133048037	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr6:133048037G>A	ENST00000367927.5	-	4	724	c.652C>T	c.(652-654)Cat>Tat	p.H218Y	VNN3_ENST00000425515.2_3'UTR|VNN3_ENST00000580813.1_5'Flank|VNN3_ENST00000275223.3_Intron|VNN3_ENST00000392393.3_Intron|VNN3_ENST00000519686.2_Intron|VNN3_ENST00000414302.2_3'UTR|VNN3_ENST00000207771.3_Missense_Mutation_p.H218Y|VNN3_ENST00000450865.2_Intron|VNN3_ENST00000417437.2_Intron|VNN3_ENST00000427187.2_Intron|VNN3_ENST00000509351.1_Intron|VNN3_ENST00000423615.2_Intron			Q9NY84	VNN3_HUMAN	vanin 3	218	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	anchored component of membrane (GO:0031225)|plasma membrane (GO:0005886)	pantetheine hydrolase activity (GO:0017159)	p.H218Y(2)		cervix(1)|endometrium(1)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	8	Breast(56;0.135)			OV - Ovarian serous cystadenocarcinoma(155;0.00242)|GBM - Glioblastoma multiforme(226;0.0168)		GCTGGGTCATGAGAAAAAATG	0.463																																																	2	Substitution - Missense(2)	cervix(2)											98.0	80.0	86.0					6																	133048037		2203	4300	6503	SO:0001583	missense	55350			AJ238982		6q23.2	2014-04-09	2010-11-15	2010-11-15	ENSG00000093134	ENSG00000093134	3.5.1.92	"""Vanins"""	16431	other	unknown		606592				10501839, 19932582, 19322213	Standard	NR_028290		Approved	HSA238982	uc010kfs.3	Q9NY84	OTTHUMG00000015589	ENST00000367927.5:c.652C>T	6.37:g.133048037G>A	ENSP00000438024:p.His218Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2DFY0|B2DFY1|B2DFY3|B2DFY5|B2DFY6|B2DFY7|B2DFY8|Q3SX90|Q9BQY2	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase	p.H218Y	ENST00000367927.5	37	c.652		6	.	.	.	.	.	.	.	.	.	.	G	5.007	0.186987	0.09547	.	.	ENSG00000093134	ENST00000367927;ENST00000207771	D;D	0.85013	-1.93;-1.93	5.36	1.03	0.20045	.	0.684728	0.13705	N	0.368552	T	0.41096	0.1144	.	.	.	0.24237	N	0.995373	.	.	.	.	.	.	T	0.45833	-0.9234	7	0.02654	T	1	-7.5775	10.6579	0.45686	0.4393:0.0:0.5607:0.0	.	.	.	.	Y	218	ENSP00000438024:H218Y;ENSP00000440594:H218Y	ENSP00000440594:H218Y	H	-	1	0	VNN3	133089730	0.012000	0.17670	0.255000	0.24374	0.957000	0.61999	0.533000	0.23082	0.206000	0.20587	0.543000	0.68304	CAT	VNN3	-	superfamily_C-N_Hydrolase,pirsf_Biotinidase_euk,pfscan_C-N_Hydrolase		0.463	VNN3-001	KNOWN	NMD_exception|basic	protein_coding	VNN3	HGNC	protein_coding	OTTHUMT00000042265.4	G	NR_028290		133048037	-1	no_errors	ENST00000207771	ensembl	human	known	70_37	missense	SNP	0.427	A
ZC3H14	79882	genome.wustl.edu	37	14	89039043	89039043	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:89039043G>A	ENST00000251038.5	+	6	778	c.553G>A	c.(553-555)Gac>Aac	p.D185N	ZC3H14_ENST00000556945.1_Missense_Mutation_p.D185N|ZC3H14_ENST00000557607.1_Missense_Mutation_p.D30N|ZC3H14_ENST00000336693.4_Missense_Mutation_p.D151N|ZC3H14_ENST00000555755.1_Missense_Mutation_p.D185N|ZC3H14_ENST00000359301.3_Missense_Mutation_p.D151N|ZC3H14_ENST00000393514.5_Missense_Mutation_p.D185N|ZC3H14_ENST00000302216.8_Missense_Mutation_p.D185N	NM_001160103.1|NM_001160104.1|NM_024824.4	NP_001153575.1|NP_001153576.1|NP_079100.2	Q6PJT7	ZC3HE_HUMAN	zinc finger CCCH-type containing 14	185						cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)	p.D185N(1)		cervix(2)|endometrium(3)|kidney(2)|large_intestine(3)|lung(6)|ovary(2)|prostate(1)|skin(2)	21						CATTGACGAAGACCTCAACTT	0.433																																																	1	Substitution - Missense(1)	cervix(1)											168.0	169.0	169.0					14																	89039043		2203	4300	6503	SO:0001583	missense	79882			AF155107	CCDS32133.1, CCDS32134.1, CCDS32135.1, CCDS32136.1, CCDS55938.1	14q31.3	2014-08-12			ENSG00000100722	ENSG00000100722		"""Zinc fingers, CCCH-type domain containing"""	20509	protein-coding gene	gene with protein product		613279				10508479	Standard	NM_024824		Approved	FLJ11806, UKp68, NY-REN-37	uc001xww.3	Q6PJT7	OTTHUMG00000170803	ENST00000251038.5:c.553G>A	14.37:g.89039043G>A	ENSP00000251038:p.Asp185Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MY46|B4DXU8|B4DZW7|B4E2H4|G3V5R4|Q6MZU4|Q6PJ32|Q6PUI6|Q6PUI8|Q86TQ5|Q86TW0|Q86TW1|Q8NCT6|Q8NCZ3|Q8TDE2|Q9HAC9|Q9Y5A0	Missense_Mutation	SNP	smart_Znf_CCCH	p.D185N	ENST00000251038.5	37	c.553	CCDS32133.1	14	.	.	.	.	.	.	.	.	.	.	G	22.3	4.268933	0.80469	.	.	ENSG00000100722	ENST00000251038;ENST00000393530;ENST00000353091;ENST00000359301;ENST00000302216;ENST00000380684;ENST00000556945;ENST00000556158;ENST00000557607;ENST00000555799;ENST00000555755;ENST00000393514;ENST00000336693	.	.	.	5.83	5.83	0.93111	.	0.195357	0.53938	D	0.000054	T	0.78355	0.4270	M	0.64997	1.995	0.47949	D	0.999558	B;D;D;P;D;P	0.89917	0.005;1.0;0.988;0.843;1.0;0.843	B;D;P;P;D;P	0.87578	0.009;0.998;0.836;0.661;0.998;0.661	T	0.75434	-0.3319	9	0.41790	T	0.15	-3.8358	20.106	0.97895	0.0:0.0:1.0:0.0	.	185;166;185;185;185;185	G3V256;F8W848;G3V5R4;Q6PJT7-2;Q6PJT7-3;Q6PJT7	.;.;.;.;.;ZC3HE_HUMAN	N	185;185;185;151;185;166;185;172;30;151;185;185;151	.	ENSP00000251038:D185N	D	+	1	0	ZC3H14	88108796	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	8.063000	0.89482	2.758000	0.94735	0.655000	0.94253	GAC	ZC3H14	-	NULL		0.433	ZC3H14-001	KNOWN	basic|CCDS	protein_coding	ZC3H14	HGNC	protein_coding	OTTHUMT00000410387.1	G	NM_024824		89039043	+1	no_errors	ENST00000251038	ensembl	human	known	70_37	missense	SNP	1.000	A
YY1	7528	genome.wustl.edu	37	14	100705962	100705962	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr14:100705962C>T	ENST00000262238.4	+	1	641	c.381C>T	c.(379-381)ttC>ttT	p.F127F	RP11-638I2.4_ENST00000554537.1_RNA	NM_003403.3	NP_003394.1	P25490	TYY1_HUMAN	YY1 transcription factor	127	Interaction with the SMAD1/SMAD4 complex.				anterior/posterior pattern specification (GO:0009952)|camera-type eye morphogenesis (GO:0048593)|cell differentiation (GO:0030154)|cellular response to DNA damage stimulus (GO:0006974)|cellular response to UV (GO:0034644)|chromosome organization (GO:0051276)|double-strand break repair via homologous recombination (GO:0000724)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to prostaglandin F (GO:0034696)|response to UV-C (GO:0010225)|RNA localization (GO:0006403)|spermatogenesis (GO:0007283)	Ino80 complex (GO:0031011)|nucleus (GO:0005634)|PcG protein complex (GO:0031519)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|four-way junction DNA binding (GO:0000400)|RNA binding (GO:0003723)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription coactivator activity (GO:0003713)|transcription corepressor activity (GO:0003714)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)	p.F127F(1)		cervix(1)|endometrium(1)|large_intestine(1)|liver(2)|lung(1)|prostate(4)|skin(1)	11		Melanoma(154;0.152)				AGGACGGCTTCGAGGATCAGA	0.706																																																	1	Substitution - coding silent(1)	cervix(1)											35.0	38.0	37.0					14																	100705962		2198	4296	6494	SO:0001819	synonymous_variant	7528			BC020324	CCDS9957.1	14q	2013-01-08			ENSG00000100811	ENSG00000100811		"""INO80 complex subunits"", ""Zinc fingers, C2H2-type"""	12856	protein-coding gene	gene with protein product	"""INO80 complex subunit S"", ""Yin and Yang 1 protein"""	600013				1655281, 7912122	Standard	NM_003403		Approved	NF-E1, DELTA, UCRBP, YIN-YANG-1, INO80S	uc001ygy.2	P25490	OTTHUMG00000150479	ENST00000262238.4:c.381C>T	14.37:g.100705962C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14935	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pirsf_TF_Yin_yang,pfscan_Znf_C2H2	p.F127	ENST00000262238.4	37	c.381	CCDS9957.1	14																																																																																			YY1	-	pirsf_TF_Yin_yang		0.706	YY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YY1	HGNC	protein_coding	OTTHUMT00000318277.1	C	NM_003403		100705962	+1	no_errors	ENST00000262238	ensembl	human	known	70_37	silent	SNP	1.000	T
ZC3H8	84524	genome.wustl.edu	37	2	112995977	112995977	+	Silent	SNP	T	T	C			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr2:112995977T>C	ENST00000409573.2	-	3	414	c.285A>G	c.(283-285)caA>caG	p.Q95Q	ZC3H8_ENST00000272570.5_Silent_p.Q95Q			Q8N5P1	ZC3H8_HUMAN	zinc finger CCCH-type containing 8	95					apoptotic process (GO:0006915)|negative regulation of T cell differentiation in thymus (GO:0033085)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of thymocyte apoptotic process (GO:0070245)|positive regulation of transcription from RNA polymerase III promoter (GO:0045945)|response to antibiotic (GO:0046677)|snRNA transcription from RNA polymerase II promoter (GO:0042795)|snRNA transcription from RNA polymerase III promoter (GO:0042796)|T cell homeostasis (GO:0043029)	Cajal body (GO:0015030)|histone locus body (GO:0035363)|nucleus (GO:0005634)|transcription elongation factor complex (GO:0008023)|transcriptionally active chromatin (GO:0035327)	metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.Q95Q(1)		breast(1)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)	7						GTATGTACTGTTGAAGCTCTT	0.378																																																	1	Substitution - coding silent(1)	cervix(1)											182.0	169.0	173.0					2																	112995977		1851	4104	5955	SO:0001819	synonymous_variant	84524			AF334161	CCDS46392.1	2q13	2012-07-05	2005-06-02	2005-06-02	ENSG00000144161	ENSG00000144161		"""Zinc fingers, CCCH-type domain containing"""	30941	protein-coding gene	gene with protein product			"""zinc finger CCCH-type domain containing 8"""	ZC3HDC8		12477932	Standard	NM_032494		Approved	Fliz1	uc021vmw.1	Q8N5P1	OTTHUMG00000153270	ENST00000409573.2:c.285A>G	2.37:g.112995977T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BZ75	Silent	SNP	pfam_Znf_CCCH,smart_Znf_CCCH	p.Q95	ENST00000409573.2	37	c.285	CCDS46392.1	2																																																																																			ZC3H8	-	NULL		0.378	ZC3H8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZC3H8	HGNC	protein_coding	OTTHUMT00000330521.3	T	NM_032494		112995977	-1	no_errors	ENST00000272570	ensembl	human	known	70_37	silent	SNP	0.524	C
ZFP37	7539	genome.wustl.edu	37	9	115806340	115806340	+	Silent	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr9:115806340C>T	ENST00000374227.3	-	4	585	c.558G>A	c.(556-558)caG>caA	p.Q186Q	ZFP37_ENST00000553380.1_Silent_p.Q201Q|ZFP37_ENST00000555206.1_Silent_p.Q187Q	NM_001282515.1|NM_001282518.1	NP_001269444.1|NP_001269447.1	Q9Y6Q3	ZFP37_HUMAN	ZFP37 zinc finger protein	186					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)	p.Q186Q(1)		NS(1)|breast(3)|cervix(1)|endometrium(1)|kidney(3)|large_intestine(6)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(3)	38						AATCTAAATTCTGTTTCAAAA	0.318																																																	1	Substitution - coding silent(1)	cervix(1)											99.0	102.0	101.0					9																	115806340		2203	4298	6501	SO:0001819	synonymous_variant	7539			AF022158	CCDS6787.1, CCDS65109.1, CCDS65110.1	9q32	2013-01-08	2012-11-27		ENSG00000136866	ENSG00000136866		"""Zinc fingers, C2H2-type"", ""-"""	12863	protein-coding gene	gene with protein product		602951	"""zinc finger protein homologous to Zfp37 in mouse"", ""zinc finger protein 37 homolog (mouse)"""				Standard	NM_001282515		Approved	ZNF906	uc004bgm.1	Q9Y6Q3	OTTHUMG00000021019	ENST00000374227.3:c.558G>A	9.37:g.115806340C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVJ9|B4DVX4|G3V3L7|Q5T7Q4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.Q201	ENST00000374227.3	37	c.603	CCDS6787.1	9																																																																																			ZFP37	-	NULL		0.318	ZFP37-001	KNOWN	basic|CCDS	protein_coding	ZFP37	HGNC	protein_coding	OTTHUMT00000055439.1	C	NM_003408		115806340	-1	no_errors	ENST00000553380	ensembl	human	known	70_37	silent	SNP	0.318	T
ZNF14	7561	genome.wustl.edu	37	19	19823848	19823848	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:19823848C>G	ENST00000344099.3	-	4	380	c.242G>C	c.(241-243)gGa>gCa	p.G81A		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	81					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.G81A(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AGTGGTTTCTCCACATTTGCT	0.348																																																	1	Substitution - Missense(1)	cervix(1)											118.0	111.0	113.0					19																	19823848		2203	4300	6503	SO:0001583	missense	7561			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.242G>C	19.37:g.19823848C>G	ENSP00000340514:p.Gly81Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G81A	ENST00000344099.3	37	c.242	CCDS12409.1	19	.	.	.	.	.	.	.	.	.	.	C	6.118	0.389941	0.11581	.	.	ENSG00000105708	ENST00000344099	T	0.05447	3.44	1.67	-1.15	0.09709	.	.	.	.	.	T	0.10465	0.0256	M	0.87682	2.9	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.31336	-0.9947	9	0.72032	D	0.01	.	4.3469	0.11138	0.0:0.5786:0.0:0.4214	.	81	P17017	ZNF14_HUMAN	A	81	ENSP00000340514:G81A	ENSP00000340514:G81A	G	-	2	0	ZNF14	19684848	0.996000	0.38824	0.000000	0.03702	0.008000	0.06430	0.450000	0.21762	-0.408000	0.07565	0.460000	0.39030	GGA	ZNF14	-	NULL		0.348	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF14	HGNC	protein_coding	OTTHUMT00000460775.1	C	NM_021030		19823848	-1	no_errors	ENST00000344099	ensembl	human	known	70_37	missense	SNP	0.006	G
ZNF14	7561	genome.wustl.edu	37	19	19825240	19825240	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:19825240C>G	ENST00000344099.3	-	2	198	c.60G>C	c.(58-60)ttG>ttC	p.L20F		NM_021030.2	NP_066358.2	P17017	ZNF14_HUMAN	zinc finger protein 14	20	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.L20F(1)		breast(1)|cervix(2)|endometrium(1)|large_intestine(9)|lung(8)|ovary(4)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	32		Renal(1328;0.0474)				AAGAATCCAGCAAAGCCCACT	0.448																																																	1	Substitution - Missense(1)	cervix(1)											102.0	98.0	99.0					19																	19825240		2203	4300	6503	SO:0001583	missense	7561			AA286756	CCDS12409.1	19p13.11	2013-01-08	2006-05-10					"""Zinc fingers, C2H2-type"", ""-"""	12924	protein-coding gene	gene with protein product		194556	"""zinc finger protein 14 (KOX 6)"""				Standard	NM_021030		Approved	KOX6, GIOT-4	uc002nnk.1	P17017		ENST00000344099.3:c.60G>C	19.37:g.19825240C>G	ENSP00000340514:p.Leu20Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGA4|Q9ULZ5	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.L20F	ENST00000344099.3	37	c.60	CCDS12409.1	19	.	.	.	.	.	.	.	.	.	.	C	14.27	2.484249	0.44147	.	.	ENSG00000105708	ENST00000344099	T	0.02177	4.41	2.1	-3.49	0.04724	Krueppel-associated box (4);	.	.	.	.	T	0.06872	0.0175	M	0.79258	2.445	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.30268	-0.9984	9	0.27082	T	0.32	.	0.4649	0.00522	0.2305:0.301:0.272:0.1965	.	20	P17017	ZNF14_HUMAN	F	20	ENSP00000340514:L20F	ENSP00000340514:L20F	L	-	3	2	ZNF14	19686240	0.000000	0.05858	0.573000	0.28510	0.991000	0.79684	-0.178000	0.09782	-0.368000	0.08040	0.467000	0.42956	TTG	ZNF14	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.448	ZNF14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF14	HGNC	protein_coding	OTTHUMT00000460775.1	C	NM_021030		19825240	-1	no_errors	ENST00000344099	ensembl	human	known	70_37	missense	SNP	0.060	G
ZNF184	7738	genome.wustl.edu	37	6	27420477	27420477	+	Silent	SNP	G	G	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr6:27420477G>A	ENST00000211936.6	-	6	1145	c.861C>T	c.(859-861)ttC>ttT	p.F287F	ZNF184_ENST00000377419.1_Silent_p.F287F	NM_007149.2	NP_009080.2	Q99676	ZN184_HUMAN	zinc finger protein 184	287					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)	p.F287F(2)		breast(1)|cervix(1)|endometrium(4)|kidney(9)|large_intestine(13)|lung(14)|ovary(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	48						GACCCTCAATGAAGCCTTTTC	0.378																																																	2	Substitution - coding silent(2)	cervix(1)|kidney(1)											77.0	80.0	79.0					6																	27420477		2203	4300	6503	SO:0001819	synonymous_variant	7738			U66561	CCDS4624.1	6p21.3	2013-01-08	2006-06-28		ENSG00000096654	ENSG00000096654		"""Zinc fingers, C2H2-type"", ""-"""	12975	protein-coding gene	gene with protein product		602277	"""zinc finger protein 184 (Kruppel-like)"""				Standard	NM_007149		Approved		uc003nji.3	Q99676	OTTHUMG00000014478	ENST00000211936.6:c.861C>T	6.37:g.27420477G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R715|O60792|Q8TBA9	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F287	ENST00000211936.6	37	c.861	CCDS4624.1	6																																																																																			ZNF184	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	ZNF184-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF184	HGNC	protein_coding	OTTHUMT00000040146.1	G	NM_007149		27420477	-1	no_errors	ENST00000211936	ensembl	human	known	70_37	silent	SNP	1.000	A
ZNF518B	85460	genome.wustl.edu	37	4	10446457	10446457	+	Missense_Mutation	SNP	C	C	A			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr4:10446457C>A	ENST00000326756.3	-	3	1934	c.1496G>T	c.(1495-1497)gGa>gTa	p.G499V		NM_053042.2	NP_444270.2	Q9C0D4	Z518B_HUMAN	zinc finger protein 518B	499					regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription from RNA polymerase II promoter (GO:0006366)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)	p.G499V(1)		breast(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(16)|ovary(3)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)	42						TGATGCAGCTCCAAGACTACG	0.373																																																	1	Substitution - Missense(1)	cervix(1)											91.0	95.0	94.0					4																	10446457		2203	4300	6503	SO:0001583	missense	85460			AB051516	CCDS33960.1	4p16.1	2007-12-07				ENSG00000178163		"""Zinc fingers, C2H2-type"""	29365	protein-coding gene	gene with protein product						11214970	Standard	XM_005248193		Approved	KIAA1729	uc003gmn.3	Q9C0D4		ENST00000326756.3:c.1496G>T	4.37:g.10446457C>A	ENSP00000317614:p.Gly499Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LN8	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.G499V	ENST00000326756.3	37	c.1496	CCDS33960.1	4	.	.	.	.	.	.	.	.	.	.	C	13.59	2.283254	0.40394	.	.	ENSG00000178163	ENST00000326756	T	0.01981	4.52	5.43	3.51	0.40186	.	0.681976	0.13735	N	0.366413	T	0.01489	0.0048	N	0.25647	0.755	0.18873	N	0.999981	B	0.34372	0.451	B	0.23150	0.044	T	0.48055	-0.9068	10	0.34782	T	0.22	-13.7159	2.9949	0.05995	0.1987:0.5358:0.1671:0.0983	.	499	Q9C0D4	Z518B_HUMAN	V	499	ENSP00000317614:G499V	ENSP00000317614:G499V	G	-	2	0	ZNF518B	10055555	0.000000	0.05858	0.020000	0.16555	0.715000	0.41141	0.574000	0.23714	1.478000	0.48253	0.655000	0.94253	GGA	ZNF518B	-	NULL		0.373	ZNF518B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF518B	HGNC	protein_coding	OTTHUMT00000359040.1	C	NM_053042		10446457	-1	no_errors	ENST00000326756	ensembl	human	known	70_37	missense	SNP	0.001	A
ZNF540	163255	genome.wustl.edu	37	19	38103818	38103818	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:38103818C>T	ENST00000592533.1	+	5	1969	c.1637C>T	c.(1636-1638)tCt>tTt	p.S546F	ZNF540_ENST00000343599.5_Missense_Mutation_p.S546F|ZNF540_ENST00000316433.4_Missense_Mutation_p.S546F|ZNF540_ENST00000589117.1_Missense_Mutation_p.S514F	NM_152606.4	NP_689819.1	Q8NDQ6	ZN540_HUMAN	zinc finger protein 540	546					negative regulation of transcription, DNA-templated (GO:0045892)|negative regulation of translation (GO:0017148)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|translation repressor activity, nucleic acid binding (GO:0000900)	p.S546F(1)		breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(13)|lung(8)|skin(1)	28			COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			AAAATTCATTCTGGTTTAAAA	0.393																																																	1	Substitution - Missense(1)	cervix(1)											84.0	94.0	91.0					19																	38103818		2203	4300	6503	SO:0001583	missense	163255			AL832315	CCDS12506.1, CCDS54258.1	19q13.13	2013-01-08				ENSG00000171817		"""Zinc fingers, C2H2-type"", ""-"""	25331	protein-coding gene	gene with protein product		613903					Standard	NM_152606		Approved	DKFZp547B0714	uc002ogq.4	Q8NDQ6		ENST00000592533.1:c.1637C>T	19.37:g.38103818C>T	ENSP00000466274:p.Ser546Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVS5|A8K371|Q05D58|Q3LIC5|Q6ZN36|Q7Z3C8|Q86T31	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S546F	ENST00000592533.1	37	c.1637	CCDS12506.1	19	.	.	.	.	.	.	.	.	.	.	C	28.5	4.927660	0.92389	.	.	ENSG00000171817	ENST00000316433;ENST00000343599	T	0.19806	2.12	2.39	2.39	0.29439	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.39091	0.1065	M	0.65320	2	0.32086	N	0.592537	D;D	0.65815	0.994;0.995	P;D	0.63703	0.808;0.917	T	0.51116	-0.8746	9	0.72032	D	0.01	.	11.8424	0.52361	0.0:1.0:0.0:0.0	.	514;546	Q8NDQ6-2;Q8NDQ6	.;ZN540_HUMAN	F	546;514	ENSP00000324598:S546F	ENSP00000324598:S546F	S	+	2	0	ZNF540	42795658	0.000000	0.05858	0.003000	0.11579	0.979000	0.70002	0.113000	0.15499	1.313000	0.45069	0.305000	0.20034	TCT	ZNF540	-	pfscan_Znf_C2H2		0.393	ZNF540-009	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	ZNF540	HGNC	protein_coding	OTTHUMT00000459481.1	C	NM_152606		38103818	+1	no_errors	ENST00000316433	ensembl	human	known	70_37	missense	SNP	0.998	T
ZNF525	170958	genome.wustl.edu	37	19	53884257	53884257	+	5'Flank	SNP	C	C	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr19:53884257C>G	ENST00000355326.3	+	0	0				ZNF525_ENST00000600148.1_3'UTR|ZNF525_ENST00000593918.1_Intron|ZNF525_ENST00000467003.1_Nonsense_Mutation_p.S106*|ZNF525_ENST00000474037.1_Nonsense_Mutation_p.S142*|ZNF525_ENST00000475179.1_Intron			Q8N782	ZN525_HUMAN	zinc finger protein 525						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(3)|kidney(3)|lung(3)	9						CAGCTTGGATCAAGCTTTCAT	0.388																																																	0																																										SO:0001631	upstream_gene_variant	170958			AB075859		19q13.42	2013-01-16			ENSG00000203326	ENSG00000203326		"""Zinc fingers, C2H2-type"", ""-"""	29423	protein-coding gene	gene with protein product						11853319	Standard	NR_003699		Approved	KIAA1979	uc010eqn.3	Q8N782	OTTHUMG00000158277		19.37:g.53884257C>G	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TF23	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S142*	ENST00000355326.3	37	c.425		19	.	.	.	.	.	.	.	.	.	.	C	15.60	2.882381	0.51908	.	.	ENSG00000203326	ENST00000474037;ENST00000467003	.	.	.	0.972	-0.201	0.13212	.	.	.	.	.	.	.	.	.	.	.	0.48341	D	0.999636	.	.	.	.	.	.	.	.	.	.	0.30078	T	0.28	.	4.0697	0.09876	0.0:0.2317:0.0:0.7683	.	.	.	.	X	142;106	.	ENSP00000419136:S106X	S	+	2	0	ZNF525	58576069	0.000000	0.05858	0.011000	0.14972	0.017000	0.09413	-0.079000	0.11357	-0.089000	0.12484	-0.856000	0.03024	TCA	ZNF525	-	NULL		0.388	ZNF525-201	KNOWN	basic	protein_coding	ZNF525	HGNC	protein_coding		C	NR_003699		53884257	+1	no_errors	ENST00000474037	ensembl	human	putative	70_37	nonsense	SNP	0.799	G
ZNF74	7625	genome.wustl.edu	37	22	20760282	20760282	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A0VN-01A-21D-A10S-08	TCGA-DS-A0VN-10A-01D-A10S-08	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	dae06e68-c43d-468e-a526-f52e8f549873	9feea440-0b98-4652-98db-817e1bb3b066	g.chr22:20760282A>G	ENST00000400451.2	+	5	1473	c.959A>G	c.(958-960)aAc>aGc	p.N320S	ZNF74_ENST00000356671.5_Missense_Mutation_p.N320S|ZNF74_ENST00000405993.1_Missense_Mutation_p.N288S|ZNF74_ENST00000357502.5_3'UTR|ZNF74_ENST00000403682.3_3'UTR	NM_003426.3	NP_003417.2	Q16587	ZNF74_HUMAN	zinc finger protein 74	320					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	actin cytoskeleton (GO:0015629)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)	p.N320S(1)		central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(4)|lung(7)|ovary(1)|skin(1)|urinary_tract(1)	19	Melanoma(16;0.000465)|Ovarian(15;0.0025)|Colorectal(54;0.0221)|all_neural(72;0.219)	Lung SC(17;0.0262)|all_lung(157;0.248)	LUSC - Lung squamous cell carcinoma(15;0.00102)|Lung(15;0.0173)			TCGTCCCTCAACGTGCACCAG	0.662																																																	1	Substitution - Missense(1)	cervix(1)											42.0	47.0	45.0					22																	20760282		2203	4300	6503	SO:0001583	missense	7625			X71623	CCDS42982.1, CCDS58794.1	22q11.2	2013-01-08	2006-05-12		ENSG00000185252	ENSG00000185252		"""Zinc fingers, C2H2-type"", ""-"""	13144	protein-coding gene	gene with protein product		194548	"""zinc finger protein 74 (Cos52)"""			1639391, 10591208	Standard	NM_003426		Approved	Cos52, Zfp520, ZNF520	uc010gsm.4	Q16587	OTTHUMG00000150687	ENST00000400451.2:c.959A>G	22.37:g.20760282A>G	ENSP00000383301:p.Asn320Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MCE3|B7Z5Y2|Q6IBV2|Q6PJP1|Q9UC04|Q9UF05|Q9UF06|Q9UF07	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.N320S	ENST00000400451.2	37	c.959	CCDS42982.1	22	.	.	.	.	.	.	.	.	.	.	A	12.78	2.040875	0.35989	.	.	ENSG00000185252	ENST00000400451;ENST00000356671;ENST00000405993	T;T;T	0.35421	3.99;3.99;1.31	3.85	2.77	0.32553	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.165190	0.28742	N	0.014281	T	0.17704	0.0425	N	0.11364	0.135	0.09310	N	1	P	0.43826	0.818	B	0.43413	0.419	T	0.11299	-1.0593	10	0.11485	T	0.65	-31.0201	6.5035	0.22182	0.6061:0.0:0.0:0.3938	.	320	Q16587	ZNF74_HUMAN	S	320;320;288	ENSP00000383301:N320S;ENSP00000349098:N320S;ENSP00000385855:N288S	ENSP00000349098:N320S	N	+	2	0	ZNF74	19090282	0.000000	0.05858	0.942000	0.38095	0.955000	0.61496	-0.150000	0.10189	0.787000	0.33731	0.533000	0.62120	AAC	ZNF74	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.662	ZNF74-005	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF74	HGNC	protein_coding	OTTHUMT00000319648.2	A	NM_003426		20760282	+1	no_errors	ENST00000356671	ensembl	human	known	70_37	missense	SNP	0.268	G
