#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ADAM6	8755	genome.wustl.edu	37	14	106436535	106436535	+	lincRNA	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr14:106436535G>A	ENST00000452053.1	-	0	1125					NR_002224.2				ADAM metallopeptidase domain 6, pseudogene																		AGCCGGGGAAGATGGGTCACA	0.453																																																	0																																												8755			AI024595		14q32.33	2013-09-05	2012-08-22		ENSG00000233988	ENSG00000271968		"""ADAM metallopeptidase domain containing"""	213	pseudogene	pseudogene			"""chromosome 14 open reading frame 96"", ""a disintegrin and metalloproteinase domain 6"", ""ADAM metallopeptidase domain 6"""	C14orf96			Standard	NR_002224		Approved	tMDCIV	uc001ysu.1		OTTHUMG00000152319		14.37:g.106436535G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000452053.1	37	NULL		14																																																																																			ADAM6	-	-		0.453	ADAM6-001	KNOWN	basic	lincRNA	ADAM6	HGNC	lincRNA	OTTHUMT00000325881.1	G	NR_002224		106436535	-1	no_errors	ENST00000452053	ensembl	human	known	70_37	rna	SNP	0.001	A
ADAMTS20	80070	genome.wustl.edu	37	12	43822200	43822200	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:43822200G>T	ENST00000389420.3	-	26	3788	c.3789C>A	c.(3787-3789)tgC>tgA	p.C1263*	ADAMTS20_ENST00000553158.1_Nonsense_Mutation_p.C1263*|ADAMTS20_ENST00000395541.2_Nonsense_Mutation_p.C381*	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	1263	TSP type-1 8. {ECO:0000255|PROSITE- ProRule:PRU00210}.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		GTGCAGGAGGGCAGGCTGCCA	0.438																																																	0													82.0	81.0	81.0					12																	43822200		2203	4300	6503	SO:0001587	stop_gained	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.3789C>A	12.37:g.43822200G>T	ENSP00000374071:p.Cys1263*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNC9|J3QT00	Nonsense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.C1263*	ENST00000389420.3	37	c.3789	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	G	37	6.215627	0.97385	.	.	ENSG00000173157	ENST00000389420;ENST00000549670;ENST00000395541;ENST00000553158;ENST00000389417	.	.	.	5.35	2.55	0.30701	.	0.000000	0.48767	D	0.000168	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.6352	0.39804	0.2896:0.0:0.7104:0.0	.	.	.	.	X	1263;393;381;1263;1263	.	ENSP00000374068:C1263X	C	-	3	2	ADAMTS20	42108467	1.000000	0.71417	0.971000	0.41717	0.022000	0.10575	2.460000	0.45031	0.912000	0.36772	0.585000	0.79938	TGC	ADAMTS20	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.438	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	G	NM_025003		43822200	-1	no_errors	ENST00000389420	ensembl	human	known	70_37	nonsense	SNP	0.998	T
AGRN	375790	genome.wustl.edu	37	1	980904	980907	+	Splice_Site	DEL	GTGA	GTGA	-			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	GTGA	GTGA					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:980904_980907delGTGA	ENST00000379370.2	+	14	2586		c.e14+1			NM_198576.3	NP_940978.2	O00468	AGRIN_HUMAN	agrin						axon guidance (GO:0007411)|carbohydrate metabolic process (GO:0005975)|chondroitin sulfate metabolic process (GO:0030204)|clustering of voltage-gated sodium channels (GO:0045162)|extracellular matrix organization (GO:0030198)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|neuromuscular junction development (GO:0007528)|neurotransmitter receptor metabolic process (GO:0045213)|phototransduction, visible light (GO:0007603)|plasma membrane organization (GO:0007009)|positive regulation of filopodium assembly (GO:0051491)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of Rho GTPase activity (GO:0032321)|positive regulation of synaptic growth at neuromuscular junction (GO:0045887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|receptor clustering (GO:0043113)|retinoid metabolic process (GO:0001523)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synapse organization (GO:0050808)	basal lamina (GO:0005605)|cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)|integral component of membrane (GO:0016021)|lysosomal lumen (GO:0043202)|plasma membrane (GO:0005886)|synapse (GO:0045202)	acetylcholine receptor regulator activity (GO:0030548)|calcium ion binding (GO:0005509)|chondroitin sulfate binding (GO:0035374)|dystroglycan binding (GO:0002162)|heparan sulfate proteoglycan binding (GO:0043395)|laminin binding (GO:0043236)|sialic acid binding (GO:0033691)|structural constituent of cytoskeleton (GO:0005200)			breast(1)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(2)|lung(20)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	42	all_cancers(77;0.00164)|all_epithelial(69;0.000959)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;8.75e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.128)		UCEC - Uterine corpus endometrioid carcinoma (11;0.00462)|Epithelial(90;5.98e-38)|OV - Ovarian serous cystadenocarcinoma(86;5.43e-23)|Colorectal(212;5.97e-05)|COAD - Colon adenocarcinoma(227;0.000201)|Kidney(185;0.0024)|BRCA - Breast invasive adenocarcinoma(365;0.00246)|STAD - Stomach adenocarcinoma(132;0.00645)|KIRC - Kidney renal clear cell carcinoma(229;0.0354)|Lung(427;0.201)		GGCTGTACACGTGAGTGACAGGGC	0.652																																																	0																																										SO:0001630	splice_region_variant	375790			XM_372195	CCDS30551.1	1p36.33	2014-09-17		2007-02-16	ENSG00000188157	ENSG00000188157		"""Proteoglycans / Extracellular Matrix : Other"""	329	protein-coding gene	gene with protein product	"""agrin proteoglycan"""	103320				1851019, 12270958	Standard	NM_198576		Approved	AGRIN	uc001ack.2	O00468	OTTHUMG00000040778	ENST00000379370.2:c.2536+1GTGA>-	1.37:g.980908_980911delGTGA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SVA1|Q5SVA2|Q60FE1|Q7KYS8|Q8N4J5|Q96IC1|Q9BTD4	Splice_Site	DEL	-	e14+1	ENST00000379370.2	37	c.2536+1_2536+1	CCDS30551.1	1																																																																																			AGRN	-	-		0.652	AGRN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AGRN	HGNC	protein_coding	OTTHUMT00000097990.2	GTGA	NM_198576	Intron	980907	+1	no_errors	ENST00000379370	ensembl	human	known	70_37	splice_site_del	DEL	1.000:1.000:1.000:1.000	-
ANKRD12	23253	genome.wustl.edu	37	18	9255339	9255339	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255339G>C	ENST00000262126.4	+	9	2314	c.2074G>C	c.(2074-2076)Gat>Cat	p.D692H	ANKRD12_ENST00000400020.3_Missense_Mutation_p.D669H|ANKRD12_ENST00000383440.2_Missense_Mutation_p.D669H	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	692						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						tgtggaatttgatagagaatt	0.289																																																	0													47.0	53.0	51.0					18																	9255339		2160	4207	6367	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2074G>C	18.37:g.9255339G>C	ENSP00000262126:p.Asp692His	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D692H	ENST00000262126.4	37	c.2074	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	15.18	2.756661	0.49362	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158	D;D	0.92858	-3.12;-3.12	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.95642	0.8583	M	0.67953	2.075	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.91635	0.999;0.999;0.994	D	0.96014	0.9004	10	0.87932	D	0	-3.7109	18.7884	0.91964	0.0:0.0:1.0:0.0	.	319;669;692	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	H	669;692;399	ENSP00000372932:D669H;ENSP00000262126:D692H	ENSP00000262126:D692H	D	+	1	0	ANKRD12	9245339	1.000000	0.71417	1.000000	0.80357	0.991000	0.79684	9.420000	0.97426	2.505000	0.84491	0.460000	0.39030	GAT	ANKRD12	-	NULL		0.289	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255339	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD12	23253	genome.wustl.edu	37	18	9255384	9255384	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255384G>A	ENST00000262126.4	+	9	2359	c.2119G>A	c.(2119-2121)Gaa>Aaa	p.E707K	ANKRD12_ENST00000400020.3_Missense_Mutation_p.E684K|ANKRD12_ENST00000383440.2_Missense_Mutation_p.E684K	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	707						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						tgatgaaaCTGAAGATCTCTT	0.289																																																	0													38.0	41.0	40.0					18																	9255384		2106	4175	6281	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2119G>A	18.37:g.9255384G>A	ENSP00000262126:p.Glu707Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E707K	ENST00000262126.4	37	c.2119	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	17.64	3.439862	0.63067	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158;ENST00000400020	D;D	0.92699	-3.09;-3.09	5.06	5.06	0.68205	.	0.171355	0.50627	D	0.000112	D	0.93795	0.8016	L	0.60455	1.87	0.50813	D	0.999894	D;P;P	0.55605	0.972;0.925;0.799	P;P;B	0.53912	0.737;0.54;0.318	D	0.94383	0.7606	10	0.72032	D	0.01	-23.4943	18.7884	0.91964	0.0:0.0:1.0:0.0	.	334;684;707	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	K	684;707;414;2	ENSP00000372932:E684K;ENSP00000262126:E707K	ENSP00000262126:E707K	E	+	1	0	ANKRD12	9245384	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	7.547000	0.82146	2.505000	0.84491	0.460000	0.39030	GAA	ANKRD12	-	NULL		0.289	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255384	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKRD12	23253	genome.wustl.edu	37	18	9255387	9255387	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255387G>A	ENST00000262126.4	+	9	2362	c.2122G>A	c.(2122-2124)Gat>Aat	p.D708N	ANKRD12_ENST00000400020.3_Missense_Mutation_p.D685N|ANKRD12_ENST00000383440.2_Missense_Mutation_p.D685N	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	708						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						tgaaaCTGAAGATCTCTTTTT	0.284																																																	0													38.0	40.0	40.0					18																	9255387		2113	4179	6292	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2122G>A	18.37:g.9255387G>A	ENSP00000262126:p.Asp708Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D708N	ENST00000262126.4	37	c.2122	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	18.76	3.693592	0.68386	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158;ENST00000400020	D;D	0.91894	-2.93;-2.93	5.06	5.06	0.68205	.	0.052266	0.85682	D	0.000000	D	0.95046	0.8396	L	0.57536	1.79	0.53688	D	0.999977	D;D;D	0.76494	0.999;0.999;0.976	D;D;P	0.69479	0.964;0.913;0.631	D	0.95158	0.8279	10	0.59425	D	0.04	-18.8594	18.7884	0.91964	0.0:0.0:1.0:0.0	.	335;685;708	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	N	685;708;415;3	ENSP00000372932:D685N;ENSP00000262126:D708N	ENSP00000262126:D708N	D	+	1	0	ANKRD12	9245387	1.000000	0.71417	1.000000	0.80357	0.937000	0.57800	9.420000	0.97426	2.505000	0.84491	0.460000	0.39030	GAT	ANKRD12	-	NULL		0.284	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255387	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKRD12	23253	genome.wustl.edu	37	18	9255389	9255389	+	Missense_Mutation	SNP	T	T	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255389T>A	ENST00000262126.4	+	9	2364	c.2124T>A	c.(2122-2124)gaT>gaA	p.D708E	ANKRD12_ENST00000400020.3_Missense_Mutation_p.D685E|ANKRD12_ENST00000383440.2_Missense_Mutation_p.D685E	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	708						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						aaaCTGAAGATCTCTTTTTAA	0.289																																																	0													37.0	40.0	39.0					18																	9255389		2113	4185	6298	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2124T>A	18.37:g.9255389T>A	ENSP00000262126:p.Asp708Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D708E	ENST00000262126.4	37	c.2124	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	T	12.13	1.846277	0.32606	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158;ENST00000400020	D;D	0.92299	-3.01;-3.01	5.06	2.7	0.31948	.	0.052266	0.85682	D	0.000000	D	0.83161	0.5194	N	0.25647	0.755	0.32362	N	0.557056	P;P;B	0.46784	0.884;0.565;0.214	B;B;B	0.43155	0.41;0.168;0.031	T	0.79694	-0.1696	10	0.11794	T	0.64	-18.8594	5.1949	0.15232	0.0:0.2273:0.1409:0.6318	.	335;685;708	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	E	685;708;415;3	ENSP00000372932:D685E;ENSP00000262126:D708E	ENSP00000262126:D708E	D	+	3	2	ANKRD12	9245389	0.003000	0.15002	0.980000	0.43619	0.919000	0.55068	0.034000	0.13776	0.374000	0.24650	0.377000	0.23210	GAT	ANKRD12	-	NULL		0.289	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	T	NM_015208		9255389	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	0.918	A
ANKRD12	23253	genome.wustl.edu	37	18	9255426	9255426	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255426G>C	ENST00000262126.4	+	9	2401	c.2161G>C	c.(2161-2163)Gaa>Caa	p.E721Q	ANKRD12_ENST00000400020.3_Missense_Mutation_p.E698Q|ANKRD12_ENST00000383440.2_Missense_Mutation_p.E698Q	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	721						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CTTAACATTAGAAAAAAAATC	0.289																																																	0													28.0	30.0	29.0					18																	9255426		2143	4226	6369	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2161G>C	18.37:g.9255426G>C	ENSP00000262126:p.Glu721Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E721Q	ENST00000262126.4	37	c.2161	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	13.49	2.253554	0.39797	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000359158;ENST00000400020	D;D	0.92397	-3.03;-3.03	5.06	5.06	0.68205	.	0.331509	0.30528	N	0.009436	D	0.94640	0.8272	L	0.57536	1.79	0.36889	D	0.889782	D;D;P	0.76494	0.999;0.996;0.935	D;P;P	0.65443	0.935;0.892;0.575	D	0.94400	0.7622	10	0.29301	T	0.29	-14.4551	18.7884	0.91964	0.0:0.0:1.0:0.0	.	348;698;721	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	Q	698;721;428;16	ENSP00000372932:E698Q;ENSP00000262126:E721Q	ENSP00000262126:E721Q	E	+	1	0	ANKRD12	9245426	1.000000	0.71417	0.991000	0.47740	0.664000	0.39144	5.303000	0.65738	2.505000	0.84491	0.460000	0.39030	GAA	ANKRD12	-	NULL		0.289	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255426	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD12	23253	genome.wustl.edu	37	18	9255435	9255435	+	Missense_Mutation	SNP	T	T	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255435T>A	ENST00000262126.4	+	9	2410	c.2170T>A	c.(2170-2172)Tca>Aca	p.S724T	ANKRD12_ENST00000400020.3_Missense_Mutation_p.S701T|ANKRD12_ENST00000383440.2_Missense_Mutation_p.S701T	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	724						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AGAAAAAAAATCAAAATTGGA	0.274																																																	0													28.0	30.0	29.0					18																	9255435		2152	4241	6393	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2170T>A	18.37:g.9255435T>A	ENSP00000262126:p.Ser724Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.S724T	ENST00000262126.4	37	c.2170	CCDS11843.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	3.031|3.031	-0.199599|-0.199599	0.06219|0.06219	.|.	.|.	ENSG00000101745|ENSG00000101745	ENST00000359158|ENST00000383440;ENST00000262126;ENST00000400020	.|D;D;T	.|0.91843	.|-2.92;-2.92;-0.08	5.06|5.06	2.51|2.51	0.30379|0.30379	.|.	.|0.574633	.|0.16867	.|N	.|0.196291	D|D	0.84479|0.84479	0.5481|0.5481	L|L	0.27053|0.27053	0.805|0.805	0.20196|0.20196	N|N	0.999922|0.999922	.|B;B;B	.|0.15473	.|0.013;0.001;0.001	.|B;B;B	.|0.12156	.|0.007;0.003;0.002	T|T	0.73480|0.73480	-0.3969|-0.3969	6|10	0.59425|0.49607	D|T	0.04|0.09	-24.2216|-24.2216	6.6701|6.6701	0.23064|0.23064	0.2677:0.0:0.1395:0.5928|0.2677:0.0:0.1395:0.5928	.|.	.|351;701;724	.|Q9NXU3;Q6UB98-2;Q6UB98	.|.;.;ANR12_HUMAN	N|T	430|701;724;19	.|ENSP00000372932:S701T;ENSP00000262126:S724T;ENSP00000382897:S19T	ENSP00000352073:I430N|ENSP00000262126:S724T	I|S	+|+	2|1	0|0	ANKRD12|ANKRD12	9245435|9245435	0.997000|0.997000	0.39634|0.39634	0.495000|0.495000	0.27527|0.27527	0.861000|0.861000	0.49209|0.49209	1.085000|1.085000	0.30840|0.30840	0.288000|0.288000	0.22398|0.22398	0.377000|0.377000	0.23210|0.23210	ATC|TCA	ANKRD12	-	NULL		0.274	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	T	NM_015208		9255435	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	0.374	A
ANKRD12	23253	genome.wustl.edu	37	18	9255588	9255588	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255588G>C	ENST00000262126.4	+	9	2563	c.2323G>C	c.(2323-2325)Gaa>Caa	p.E775Q	ANKRD12_ENST00000400020.3_Missense_Mutation_p.E752Q|ANKRD12_ENST00000383440.2_Missense_Mutation_p.E752Q	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	775						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AGAAGAGAGAGAAAACATACC	0.348																																																	0													73.0	77.0	76.0					18																	9255588		2200	4292	6492	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2323G>C	18.37:g.9255588G>C	ENSP00000262126:p.Glu775Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E775Q	ENST00000262126.4	37	c.2323	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	15.78	2.935232	0.52866	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.51071	0.72;0.72	5.0	4.12	0.48240	.	0.291905	0.37348	N	0.002129	T	0.52386	0.1731	L	0.47716	1.5	0.41630	D	0.989013	D;P;P	0.53619	0.961;0.93;0.886	P;P;B	0.52159	0.691;0.603;0.398	T	0.57831	-0.7743	10	0.72032	D	0.01	-2.5601	13.8581	0.63542	0.0749:0.0:0.9251:0.0	.	402;752;775	Q9NXU3;Q6UB98-2;Q6UB98	.;.;ANR12_HUMAN	Q	752;775	ENSP00000372932:E752Q;ENSP00000262126:E775Q	ENSP00000262126:E775Q	E	+	1	0	ANKRD12	9245588	1.000000	0.71417	0.979000	0.43373	0.945000	0.59286	5.995000	0.70631	1.226000	0.43582	0.460000	0.39030	GAA	ANKRD12	-	NULL		0.348	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255588	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD12	23253	genome.wustl.edu	37	18	9255690	9255690	+	Nonsense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255690G>T	ENST00000262126.4	+	9	2665	c.2425G>T	c.(2425-2427)Gaa>Taa	p.E809*	ANKRD12_ENST00000400020.3_Nonsense_Mutation_p.E786*|ANKRD12_ENST00000383440.2_Nonsense_Mutation_p.E786*	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	809						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						AATAGACATTGAAAAACAAGA	0.333																																																	0													57.0	60.0	59.0					18																	9255690		2191	4292	6483	SO:0001587	stop_gained	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2425G>T	18.37:g.9255690G>T	ENSP00000262126:p.Glu809*	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Nonsense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E809*	ENST00000262126.4	37	c.2425	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	38	6.742754	0.97805	.	.	ENSG00000101745	ENST00000383440;ENST00000262126;ENST00000400020	.	.	.	4.65	4.65	0.58169	.	0.051277	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-21.9558	17.868	0.88801	0.0:0.0:1.0:0.0	.	.	.	.	X	786;809;80	.	ENSP00000262126:E809X	E	+	1	0	ANKRD12	9245690	1.000000	0.71417	0.991000	0.47740	0.888000	0.51559	4.858000	0.62947	2.291000	0.77112	0.557000	0.71058	GAA	ANKRD12	-	NULL		0.333	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255690	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	nonsense	SNP	0.998	T
ANKRD12	23253	genome.wustl.edu	37	18	9255795	9255795	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255795G>A	ENST00000262126.4	+	9	2770	c.2530G>A	c.(2530-2532)Gaa>Aaa	p.E844K	ANKRD12_ENST00000400020.3_Missense_Mutation_p.E821K|ANKRD12_ENST00000383440.2_Missense_Mutation_p.E821K	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	844						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						CTTTGAAAAAGAAAAGAAGAT	0.294																																																	0													25.0	27.0	27.0					18																	9255795		2195	4279	6474	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2530G>A	18.37:g.9255795G>A	ENSP00000262126:p.Glu844Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E844K	ENST00000262126.4	37	c.2530	CCDS11843.1	18	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	16.64|16.64	3.179474|3.179474	0.57800|0.57800	.|.	.|.	ENSG00000101745|ENSG00000101745	ENST00000383440;ENST00000262126|ENST00000400020	T;T|.	0.67523|.	-0.27;-0.27|.	5.55|5.55	5.55|5.55	0.83447|0.83447	.|.	0.050461|.	0.85682|.	D|.	0.000000|.	T|T	0.75598|0.75598	0.3871|0.3871	M|M	0.64997|0.64997	1.995|1.995	0.80722|0.80722	D|D	1|1	D;D|.	0.71674|.	0.998;0.996|.	D;P|.	0.80764|.	0.994;0.837|.	T|T	0.77376|0.77376	-0.2611|-0.2611	10|6	0.48119|0.87932	T|D	0.1|0	-17.4659|-17.4659	19.1125|19.1125	0.93323|0.93323	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	821;844|.	Q6UB98-2;Q6UB98|.	.;ANR12_HUMAN|.	K|R	821;844|115	ENSP00000372932:E821K;ENSP00000262126:E844K|.	ENSP00000262126:E844K|ENSP00000382897:G115R	E|G	+|+	1|1	0|0	ANKRD12|ANKRD12	9245795|9245795	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.492000|0.492000	0.33523|0.33523	9.476000|9.476000	0.97823|0.97823	2.606000|2.606000	0.88127|0.88127	0.557000|0.557000	0.71058|0.71058	GAA|GGG	ANKRD12	-	NULL		0.294	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255795	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKRD12	23253	genome.wustl.edu	37	18	9255813	9255813	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255813G>A	ENST00000262126.4	+	9	2788	c.2548G>A	c.(2548-2550)Gag>Aag	p.E850K	ANKRD12_ENST00000400020.3_Missense_Mutation_p.E827K|ANKRD12_ENST00000383440.2_Missense_Mutation_p.E827K	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	850						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						GATAAAACATGAGCATAAGTC	0.303																																																	0													28.0	30.0	29.0					18																	9255813		2196	4287	6483	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2548G>A	18.37:g.9255813G>A	ENSP00000262126:p.Glu850Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E850K	ENST00000262126.4	37	c.2548	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	14.71	2.615624	0.46631	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.65732	-0.17;-0.17	5.55	5.55	0.83447	.	0.264472	0.41001	D	0.000973	T	0.61388	0.2343	L	0.55481	1.735	0.80722	D	1	P;P	0.39665	0.592;0.682	B;B	0.37601	0.254;0.172	T	0.65961	-0.6041	10	0.62326	D	0.03	-30.9609	19.1125	0.93323	0.0:0.0:1.0:0.0	.	827;850	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	K	827;850	ENSP00000372932:E827K;ENSP00000262126:E850K	ENSP00000262126:E850K	E	+	1	0	ANKRD12	9245813	1.000000	0.71417	1.000000	0.80357	0.962000	0.63368	9.476000	0.97823	2.606000	0.88127	0.557000	0.71058	GAG	ANKRD12	-	NULL		0.303	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255813	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	A
ANKRD12	23253	genome.wustl.edu	37	18	9255831	9255831	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255831G>C	ENST00000262126.4	+	9	2806	c.2566G>C	c.(2566-2568)Gac>Cac	p.D856H	ANKRD12_ENST00000400020.3_Missense_Mutation_p.D833H|ANKRD12_ENST00000383440.2_Missense_Mutation_p.D833H	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	856						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						GTCAGAAAAAGACAAATTAGA	0.313																																																	0													29.0	30.0	30.0					18																	9255831		2199	4290	6489	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2566G>C	18.37:g.9255831G>C	ENSP00000262126:p.Asp856His	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D856H	ENST00000262126.4	37	c.2566	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	18.71	3.682086	0.68042	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.67345	-0.26;-0.26	5.28	5.28	0.74379	.	0.198270	0.52532	D	0.000073	T	0.77778	0.4181	L	0.50333	1.59	0.58432	D	0.999998	D;D	0.71674	0.998;0.996	D;P	0.65874	0.939;0.871	T	0.79443	-0.1801	10	0.66056	D	0.02	-10.814	18.5316	0.90995	0.0:0.0:1.0:0.0	.	833;856	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	H	833;856	ENSP00000372932:D833H;ENSP00000262126:D856H	ENSP00000262126:D856H	D	+	1	0	ANKRD12	9245831	1.000000	0.71417	0.980000	0.43619	0.940000	0.58332	3.547000	0.53663	2.456000	0.83038	0.557000	0.71058	GAC	ANKRD12	-	NULL		0.313	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255831	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	C
ANKRD12	23253	genome.wustl.edu	37	18	9255921	9255921	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:9255921G>C	ENST00000262126.4	+	9	2896	c.2656G>C	c.(2656-2658)Gag>Cag	p.E886Q	ANKRD12_ENST00000400020.3_Missense_Mutation_p.E863Q|ANKRD12_ENST00000383440.2_Missense_Mutation_p.E863Q	NM_015208.4	NP_056023.3	Q6UB98	ANR12_HUMAN	ankyrin repeat domain 12	886						cytoplasm (GO:0005737)|nucleus (GO:0005634)				NS(1)|breast(3)|central_nervous_system(2)|endometrium(8)|kidney(2)|large_intestine(20)|lung(18)|ovary(3)|pancreas(1)|prostate(4)|skin(1)|urinary_tract(2)	65						TAAAGAAGGTGAGAAGAGCAA	0.328																																																	0													43.0	44.0	44.0					18																	9255921		2198	4295	6493	SO:0001583	missense	23253			AY373757	CCDS11843.1, CCDS42411.1	18p11.22	2013-01-10			ENSG00000101745	ENSG00000101745		"""Ankyrin repeat domain containing"""	29135	protein-coding gene	gene with protein product		610616				10048485	Standard	NM_001204056		Approved	KIAA0874, FLJ20053, GAC-1	uc002knv.3	Q6UB98	OTTHUMG00000131595	ENST00000262126.4:c.2656G>C	18.37:g.9255921G>C	ENSP00000262126:p.Glu886Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O94951|Q658K1|Q6QMF7|Q9H231|Q9H784	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.E886Q	ENST00000262126.4	37	c.2656	CCDS11843.1	18	.	.	.	.	.	.	.	.	.	.	G	18.47	3.630061	0.67015	.	.	ENSG00000101745	ENST00000383440;ENST00000262126	T;T	0.66995	-0.23;-0.24	5.55	5.55	0.83447	.	0.154856	0.56097	D	0.000022	T	0.75004	0.3791	L	0.56769	1.78	0.58432	D	0.999998	D;D	0.57571	0.98;0.966	P;P	0.53649	0.731;0.543	T	0.75144	-0.3421	10	0.48119	T	0.1	-12.2174	19.5021	0.95100	0.0:0.0:1.0:0.0	.	863;886	Q6UB98-2;Q6UB98	.;ANR12_HUMAN	Q	863;886	ENSP00000372932:E863Q;ENSP00000262126:E886Q	ENSP00000262126:E886Q	E	+	1	0	ANKRD12	9245921	1.000000	0.71417	0.955000	0.39395	0.903000	0.53119	9.476000	0.97823	2.606000	0.88127	0.557000	0.71058	GAG	ANKRD12	-	NULL		0.328	ANKRD12-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ANKRD12	HGNC	protein_coding	OTTHUMT00000254478.2	G	NM_015208		9255921	+1	no_errors	ENST00000262126	ensembl	human	known	70_37	missense	SNP	1.000	C
ALPK2	115701	genome.wustl.edu	37	18	56202143	56202143	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:56202143G>T	ENST00000361673.3	-	5	5489	c.5276C>A	c.(5275-5277)cCc>cAc	p.P1759H	RP11-1151B14.4_ENST00000591360.1_RNA	NM_052947.3	NP_443179.3	Q86TB3	ALPK2_HUMAN	alpha-kinase 2	1759						nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|central_nervous_system(3)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(13)|lung(33)|ovary(7)|prostate(1)|skin(10)|upper_aerodigestive_tract(2)	84						TTCGAGTTTGGGCATCTTTTT	0.413																																																	0													189.0	179.0	182.0					18																	56202143		2203	4300	6503	SO:0001583	missense	115701			AY044450	CCDS11966.2	18q21.31	2013-01-11			ENSG00000198796	ENSG00000198796		"""Immunoglobulin superfamily / I-set domain containing"""	20565	protein-coding gene	gene with protein product	"""heart alpha-kinase"""					10021370	Standard	NM_052947		Approved	HAK	uc002lhj.4	Q86TB3	OTTHUMG00000132755	ENST00000361673.3:c.5276C>A	18.37:g.56202143G>T	ENSP00000354991:p.Pro1759His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZUX0|Q8NAT5|Q96L95	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,pfam_Ig_I-set,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase,pfscan_Ig-like	p.P1759H	ENST00000361673.3	37	c.5276	CCDS11966.2	18	.	.	.	.	.	.	.	.	.	.	G	13.09	2.133413	0.37630	.	.	ENSG00000198796	ENST00000361673	T	0.58060	0.36	5.4	5.4	0.78164	.	0.238004	0.37219	N	0.002199	T	0.68109	0.2965	L	0.55990	1.75	0.28608	N	0.908833	D;D	0.89917	1.0;1.0	D;D	0.72075	0.976;0.948	T	0.65125	-0.6244	10	0.72032	D	0.01	-16.5299	16.0898	0.81084	0.0:0.0:1.0:0.0	.	1754;1759	Q86TB3-2;Q86TB3	.;ALPK2_HUMAN	H	1759	ENSP00000354991:P1759H	ENSP00000354991:P1759H	P	-	2	0	ALPK2	54353123	0.161000	0.22892	0.336000	0.25522	0.022000	0.10575	1.803000	0.38863	2.519000	0.84933	0.561000	0.74099	CCC	ALPK2	-	NULL		0.413	ALPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK2	HGNC	protein_coding	OTTHUMT00000256126.1	G	NM_052947		56202143	-1	no_errors	ENST00000361673	ensembl	human	known	70_37	missense	SNP	0.611	T
ARFGEF1	10565	genome.wustl.edu	37	8	68150647	68150647	+	Silent	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr8:68150647G>T	ENST00000262215.3	-	22	3609	c.3220C>A	c.(3220-3222)Cga>Aga	p.R1074R	ARFGEF1_ENST00000520381.1_Silent_p.R528R|ARFGEF1_ENST00000518230.1_5'UTR	NM_006421.4	NP_006412.2	Q9Y6D6	BIG1_HUMAN	ADP-ribosylation factor guanine nucleotide-exchange factor 1 (brefeldin A-inhibited)	1074					endomembrane system organization (GO:0010256)|exocytosis (GO:0006887)|Golgi organization (GO:0007030)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of Rho GTPase activity (GO:0034259)|positive regulation of GTPase activity (GO:0043547)|positive regulation of protein glycosylation in Golgi (GO:0090284)|positive regulation of wound healing (GO:0090303)|protein transport (GO:0015031)|regulation of ARF protein signal transduction (GO:0032012)|regulation of establishment of cell polarity (GO:2000114)|vesicle-mediated transport (GO:0016192)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleolus (GO:0005730)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|small nuclear ribonucleoprotein complex (GO:0030532)|trans-Golgi network (GO:0005802)	ARF guanyl-nucleotide exchange factor activity (GO:0005086)|guanyl-nucleotide exchange factor activity (GO:0005085)|myosin binding (GO:0017022)|protein kinase A regulatory subunit binding (GO:0034237)			breast(1)|endometrium(14)|kidney(4)|large_intestine(17)|lung(20)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	65	Breast(64;0.214)	Lung NSC(129;0.0908)|all_lung(136;0.152)	Epithelial(68;0.0043)|OV - Ovarian serous cystadenocarcinoma(28;0.00578)|all cancers(69;0.0173)|BRCA - Breast invasive adenocarcinoma(89;0.206)			TCTCTGCCTCGCACTGTTCCA	0.403																																																	0													92.0	83.0	86.0					8																	68150647		2203	4300	6503	SO:0001819	synonymous_variant	10565			AF084520	CCDS6199.1	8q13	2011-08-18	2011-08-18		ENSG00000066777	ENSG00000066777			15772	protein-coding gene	gene with protein product		604141				10212200, 8917509	Standard	NM_006421		Approved	DKFZP434L057, BIG1, ARFGEP1, p200	uc003xxo.2	Q9Y6D6	OTTHUMG00000164626	ENST00000262215.3:c.3220C>A	8.37:g.68150647G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NV46|Q9UFV2|Q9UNL0	Silent	SNP	pfam_Sec7,pfam_DUF1981_SEC7_assoc,superfamily_Sec7,superfamily_ARM-type_fold,smart_Sec7,pfscan_Sec7	p.R1074	ENST00000262215.3	37	c.3220	CCDS6199.1	8																																																																																			ARFGEF1	-	superfamily_ARM-type_fold		0.403	ARFGEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARFGEF1	HGNC	protein_coding	OTTHUMT00000379441.4	G	NM_006421		68150647	-1	no_errors	ENST00000262215	ensembl	human	known	70_37	silent	SNP	0.993	T
ARID1A	8289	genome.wustl.edu	37	1	27088756	27088756	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:27088756C>T	ENST00000324856.7	+	7	2736	c.2365C>T	c.(2365-2367)Cag>Tag	p.Q789*	ARID1A_ENST00000374152.2_Nonsense_Mutation_p.Q406*|ARID1A_ENST00000457599.2_Nonsense_Mutation_p.Q789*|RN7SL501P_ENST00000578818.1_RNA	NM_006015.4	NP_006006.3	O14497	ARI1A_HUMAN	AT rich interactive domain 1A (SWI-like)	789					androgen receptor signaling pathway (GO:0030521)|ATP-dependent chromatin remodeling (GO:0043044)|cardiac chamber development (GO:0003205)|chromatin remodeling (GO:0006338)|chromatin-mediated maintenance of transcription (GO:0048096)|forebrain development (GO:0030900)|glucocorticoid receptor signaling pathway (GO:0042921)|intracellular estrogen receptor signaling pathway (GO:0030520)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|neural tube closure (GO:0001843)|nucleosome disassembly (GO:0006337)|nucleosome mobilization (GO:0042766)|optic cup formation involved in camera-type eye development (GO:0003408)|placenta blood vessel development (GO:0060674)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|SWI/SNF complex (GO:0016514)	DNA binding (GO:0003677)|ligand-dependent nuclear receptor binding (GO:0016922)|transcription coactivator activity (GO:0003713)		ARID1A/MAST2_ENST00000361297(2)	NS(1)|autonomic_ganglia(1)|biliary_tract(1)|breast(13)|central_nervous_system(6)|cervix(2)|endometrium(56)|haematopoietic_and_lymphoid_tissue(8)|kidney(10)|large_intestine(41)|liver(31)|lung(34)|ovary(130)|pancreas(18)|prostate(8)|skin(9)|stomach(14)|upper_aerodigestive_tract(4)|urinary_tract(24)	411		all_cancers(24;6.36e-27)|all_epithelial(13;5.93e-24)|Colorectal(325;3.46e-05)|all_lung(284;4.76e-05)|Lung NSC(340;5.83e-05)|Breast(348;9.7e-05)|Renal(390;0.0007)|Ovarian(437;0.00473)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|all cancers(4;2.61e-56)|Epithelial(14;7.53e-55)|OV - Ovarian serous cystadenocarcinoma(117;4.5e-30)|Colorectal(126;2.07e-09)|COAD - Colon adenocarcinoma(152;4.29e-07)|BRCA - Breast invasive adenocarcinoma(304;4.13e-05)|STAD - Stomach adenocarcinoma(196;0.000279)|KIRC - Kidney renal clear cell carcinoma(1967;0.000794)|GBM - Glioblastoma multiforme(114;0.0132)|READ - Rectum adenocarcinoma(331;0.0469)|Lung(427;0.167)|LUSC - Lung squamous cell carcinoma(448;0.242)		GGGCTCCTACCAGCAGAACTC	0.587			"""Mis, N, F, S, D"""		"""clear cell ovarian carcinoma, RCC"""																																			Rec	yes		1	1p35.3	8289	AT rich interactive domain 1A (SWI-like)		E	0													64.0	66.0	66.0					1																	27088756		2203	4300	6503	SO:0001587	stop_gained	8289			AB001895	CCDS285.1, CCDS44091.1	1p36.1-p35	2014-09-17	2006-11-08	2004-01-30	ENSG00000117713	ENSG00000117713		"""-"""	11110	protein-coding gene	gene with protein product		603024	"""SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily f, member 1"", ""AT rich interactive domain 1A (SWI- like)"""	C1orf4, SMARCF1		9630625, 9434167	Standard	NM_139135		Approved	B120, P270, C10rf4, BAF250, BAF250a	uc001bmv.1	O14497	OTTHUMG00000004004	ENST00000324856.7:c.2365C>T	1.37:g.27088756C>T	ENSP00000320485:p.Gln789*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPL1|Q53FK9|Q5T0W1|Q5T0W2|Q5T0W3|Q8NFD6|Q96T89|Q9BY33|Q9HBJ5|Q9UPZ1	Nonsense_Mutation	SNP	pfam_DUF3518,pfam_ARID/BRIGHT_DNA-bd,superfamily_ARID/BRIGHT_DNA-bd,superfamily_ARM-type_fold,smart_ARID/BRIGHT_DNA-bd,pfscan_ARID/BRIGHT_DNA-bd	p.Q789*	ENST00000324856.7	37	c.2365	CCDS285.1	1	.	.	.	.	.	.	.	.	.	.	C	39	7.754343	0.98471	.	.	ENSG00000117713	ENST00000324856;ENST00000457599;ENST00000374152	.	.	.	5.43	5.43	0.79202	.	0.115946	0.64402	D	0.000012	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.17369	T	0.5	-7.2596	19.428	0.94751	0.0:1.0:0.0:0.0	.	.	.	.	X	789;789;406	.	ENSP00000320485:Q789X	Q	+	1	0	ARID1A	26961343	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.081000	0.76844	2.824000	0.97209	0.655000	0.94253	CAG	ARID1A	-	NULL		0.587	ARID1A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ARID1A	HGNC	protein_coding	OTTHUMT00000011437.2	C	NM_139135		27088756	+1	no_errors	ENST00000324856	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ATRX	546	genome.wustl.edu	37	X	76763049	76763049	+	3'UTR	SNP	T	T	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chrX:76763049T>A	ENST00000373344.5	-	0	8473				ATRX_ENST00000480283.1_5'UTR|ATRX_ENST00000395603.3_3'UTR	NM_000489.3	NP_000480.3	P46100	ATRX_HUMAN	alpha thalassemia/mental retardation syndrome X-linked						ATP catabolic process (GO:0006200)|cellular response to hydroxyurea (GO:0072711)|chromatin remodeling (GO:0006338)|DNA damage response, signal transduction by p53 class mediator (GO:0030330)|DNA duplex unwinding (GO:0032508)|DNA methylation (GO:0006306)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication-independent nucleosome assembly (GO:0006336)|forebrain development (GO:0030900)|negative regulation of telomeric RNA transcription from RNA pol II promoter (GO:1901581)|nucleosome assembly (GO:0006334)|positive regulation of nuclear cell cycle DNA replication (GO:0010571)|positive regulation of telomere maintenance (GO:0032206)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|replication fork processing (GO:0031297)|seminiferous tubule development (GO:0072520)|Sertoli cell development (GO:0060009)|spermatogenesis (GO:0007283)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nuclear heterochromatin (GO:0005720)|nucleolus (GO:0005730)|nucleus (GO:0005634)|SWI/SNF superfamily-type complex (GO:0070603)|telomeric heterochromatin (GO:0031933)	ATP binding (GO:0005524)|chromatin binding (GO:0003682)|chromo shadow domain binding (GO:0070087)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA translocase activity (GO:0015616)|helicase activity (GO:0004386)|histone binding (GO:0042393)|methylated histone binding (GO:0035064)|zinc ion binding (GO:0008270)			bone(1)|breast(6)|central_nervous_system(31)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(15)|kidney(14)|large_intestine(1)|liver(1)|lung(40)|ovary(2)|pancreas(13)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	145						AAAATTCATGTGTGGAAGATA	0.388			"""Mis, F, N"""		"""Pancreatic neuroendocrine tumors, paediatric GBM"""		ATR-X (alpha thalassemia/mental retardation) syndrome																																	Rec	yes		X	Xq21.1	546	alpha thalassemia/mental retardation syndrome X-linked	yes	E	0																																										SO:0001624	3_prime_UTR_variant	546			U72937	CCDS14434.1, CCDS14435.1	Xq21.1	2014-06-17	2010-06-24		ENSG00000085224	ENSG00000085224			886	protein-coding gene	gene with protein product	"""RAD54 homolog (S. cerevisiae)"""	300032	"""alpha thalassemia/mental retardation syndrome X-linked (RAD54 (S. cerevisiae) homolog)"", ""Juberg-Marsidi syndrome"""	RAD54, JMS		7874112, 1415255, 8503439, 8630485	Standard	NM_000489		Approved	XH2, XNP	uc004ecp.4	P46100	OTTHUMG00000022686	ENST00000373344.5:c.*780A>T	X.37:g.76763049T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTE2|P51068|Q15886|Q59FB5|Q59H31|Q5H9A2|Q5JWI4|Q7Z2J1|Q9H0Z1|Q9NTS3	RNA	SNP	-	NULL	ENST00000373344.5	37	NULL	CCDS14434.1	X																																																																																			ATRX	-	-		0.388	ATRX-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ATRX	HGNC	protein_coding	OTTHUMT00000058860.2	T	NM_000489		76763049	-1	no_errors	ENST00000480283	ensembl	human	known	70_37	rna	SNP	0.674	A
BAI3	577	genome.wustl.edu	37	6	70034857	70034857	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr6:70034857G>A	ENST00000370598.1	+	21	3729	c.2908G>A	c.(2908-2910)Gta>Ata	p.V970I	BAI3_ENST00000238918.8_Missense_Mutation_p.V176I	NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	970					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				ATATATGGCTGTAACTGGAAA	0.418																																																	0													196.0	185.0	189.0					6																	70034857		2203	4300	6503	SO:0001583	missense	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.2908G>A	6.37:g.70034857G>A	ENSP00000359630:p.Val970Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.V970I	ENST00000370598.1	37	c.2908	CCDS4968.1	6	.	.	.	.	.	.	.	.	.	.	G	35	5.440877	0.96168	.	.	ENSG00000135298	ENST00000370598;ENST00000238918	T;T	0.26518	1.73;1.73	6.07	6.07	0.98685	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	T	0.37156	0.0993	L	0.35723	1.085	0.80722	D	1	D;P;P	0.63046	0.992;0.92;0.924	D;D;P	0.77004	0.989;0.956;0.497	T	0.05852	-1.0860	10	0.59425	D	0.04	.	20.6593	0.99626	0.0:0.0:1.0:0.0	.	176;970;970	B7Z356;A8K0Y1;O60242	.;.;BAI3_HUMAN	I	970;176	ENSP00000359630:V970I;ENSP00000238918:V176I	ENSP00000238918:V176I	V	+	1	0	BAI3	70091578	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.835000	0.99442	2.885000	0.99019	0.655000	0.94253	GTA	BAI3	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib		0.418	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	G			70034857	+1	no_errors	ENST00000370598	ensembl	human	known	70_37	missense	SNP	1.000	A
BEAN1	146227	genome.wustl.edu	37	16	66526895	66526895	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr16:66526895C>T	ENST00000561796.1	+	5	541	c.178C>T	c.(178-180)Cga>Tga	p.R60*	RP11-403P17.5_ENST00000561728.1_Intron|BEAN1_ENST00000563075.1_3'UTR	NM_001197224.2|NM_001197225.2	NP_001184153.1|NP_001184154.1	Q3B7T3	BEAN1_HUMAN	brain expressed, associated with NEDD4, 1	0	Arg-rich.				cell death (GO:0008219)	integral component of membrane (GO:0016021)				kidney(1)	1						CTACTGGGTGCGATCTATGCT	0.572																																																	0																																										SO:0001587	stop_gained	146227			BC000818	CCDS54015.1, CCDS58469.1, CCDS58470.1	16q21	2014-07-30			ENSG00000166546	ENSG00000166546			24160	protein-coding gene	gene with protein product		612051	"""spinocerebellar ataxia 31"""	SCA31		11042109, 8619474, 23607545	Standard	NM_001178020		Approved		uc021tjl.1	Q3B7T3	OTTHUMG00000173370	ENST00000561796.1:c.178C>T	16.37:g.66526895C>T	ENSP00000455212:p.Arg60*	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPC0|H3BP97	Nonsense_Mutation	SNP	NULL	p.R60*	ENST00000561796.1	37	c.178	CCDS58470.1	16																																																																																			BEAN1	-	NULL		0.572	BEAN1-004	NOVEL	basic|CCDS	protein_coding	BEAN1	HGNC	protein_coding	OTTHUMT00000422912.1	C	NM_001136106		66526895	+1	no_errors	ENST00000561796	ensembl	human	novel	70_37	nonsense	SNP	0.056	T
C12orf54	121273	genome.wustl.edu	37	12	48882278	48882279	+	Intron	INS	-	-	AC	rs67325885|rs200977170|rs77875864	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:48882278_48882279insAC	ENST00000548364.1	+	4	192				C12orf54_ENST00000548913.1_3'UTR|C12orf54_ENST00000314014.2_Intron|RP11-722P11.4_ENST00000551847.1_RNA			Q6X4T0	CL054_HUMAN	chromosome 12 open reading frame 54											endometrium(1)|large_intestine(4)	5						AAAAAAAAAAAGAAAGAAAGAA	0.332																																																	0																																										SO:0001627	intron_variant	121273			BC031670	CCDS8764.1	12q13.11	2011-01-31			ENSG00000177627	ENSG00000177627			28553	protein-coding gene	gene with protein product						12477932	Standard	NM_152319		Approved	MGC35033	uc001rrr.3	Q6X4T0	OTTHUMG00000170019	ENST00000548364.1:c.136-428->AC	12.37:g.48882278_48882279insAC		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6X4S9|Q8N5S2	RNA	INS	-	NULL	ENST00000548364.1	37	NULL	CCDS8764.1	12																																																																																			C12orf54	-	-		0.332	C12orf54-001	KNOWN	non_canonical_polymorphism|basic|appris_principal|CCDS	protein_coding	C12orf54	HGNC	protein_coding	OTTHUMT00000406875.1	-	NM_152319		48882279	+1	no_errors	ENST00000548913	ensembl	human	known	70_37	rna	INS	0.033:0.007	AC
C6orf165	154313	genome.wustl.edu	37	6	88138520	88138520	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr6:88138520G>A	ENST00000507897.1	+	9	1220	c.1137G>A	c.(1135-1137)gtG>gtA	p.V379V	C6ORF165_ENST00000369562.4_Silent_p.V379V			Q8IYR0	CF165_HUMAN	chromosome 6 open reading frame 165	379										NS(1)|central_nervous_system(1)|large_intestine(5)|lung(8)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		all_cancers(76;3.93e-06)|Acute lymphoblastic leukemia(125;3.55e-10)|Prostate(29;3.51e-09)|all_hematologic(105;3.29e-06)|all_epithelial(107;0.00575)		BRCA - Breast invasive adenocarcinoma(108;0.0419)		AAACTGATGTGTGTAGAATGA	0.348																																																	0													107.0	96.0	100.0					6																	88138520		2203	4300	6503	SO:0001819	synonymous_variant	154313			BC035083	CCDS34498.1	6q15	2012-02-07			ENSG00000213204	ENSG00000213204			21405	protein-coding gene	gene with protein product							Standard	NM_001031743		Approved	FLJ25974, dJ382I10.1	uc003plv.3	Q8IYR0	OTTHUMG00000015173	ENST00000507897.1:c.1137G>A	6.37:g.88138520G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K969|E1P507|Q8N9U4	Silent	SNP	pfam_DUF3508	p.V379	ENST00000507897.1	37	c.1137	CCDS34498.1	6																																																																																			C6orf165	-	pfam_DUF3508		0.348	C6orf165-001	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	nonsense_mediated_decay	C6orf165	HGNC	protein_coding	OTTHUMT00000470406.1	G	NM_178823		88138520	+1	no_errors	ENST00000369562	ensembl	human	known	70_37	silent	SNP	0.000	A
C9orf114	51490	genome.wustl.edu	37	9	131592044	131592044	+	Missense_Mutation	SNP	T	T	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr9:131592044T>A	ENST00000361256.5	-	1	56	c.16A>T	c.(16-18)Agg>Tgg	p.R6W		NM_016390.3	NP_057474.2	Q5T280	CI114_HUMAN	chromosome 9 open reading frame 114	6							poly(A) RNA binding (GO:0044822)			kidney(2)|large_intestine(4)|ovary(1)	7						GGCCGCTTCCTGCCGCGCTCC	0.697																																																	0													13.0	14.0	13.0					9																	131592044		2189	4281	6470	SO:0001583	missense	51490				CCDS6913.1	9q34.11	2014-05-29			ENSG00000198917	ENSG00000198917			26933	protein-coding gene	gene with protein product	"""centromere protein 32"""					20813266	Standard	NM_016390		Approved	HSPC109, CENP-32	uc004bwd.3	Q5T280	OTTHUMG00000020762	ENST00000361256.5:c.16A>T	9.37:g.131592044T>A	ENSP00000354812:p.Arg6Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0D2P6|Q6P469|Q6PGP9|Q6PIJ1|Q6PJV9	Missense_Mutation	SNP	pfam_Put_MeTrfase,superfamily_NA-bd_OB-fold-like	p.R6W	ENST00000361256.5	37	c.16	CCDS6913.1	9	.	.	.	.	.	.	.	.	.	.	T	12.95	2.092803	0.36952	.	.	ENSG00000198917	ENST00000361256;ENST00000372618	T	0.23950	1.88	5.26	-3.07	0.05363	.	1.515430	0.03559	N	0.226807	T	0.13500	0.0327	N	0.22421	0.69	0.09310	N	1	P;B	0.38788	0.647;0.336	B;B	0.33295	0.161;0.103	T	0.14172	-1.0482	10	0.62326	D	0.03	0.0225	1.5769	0.02626	0.1228:0.3104:0.2492:0.3175	.	6;6	E7ESY7;Q5T280	.;CI114_HUMAN	W	6	ENSP00000354812:R6W	ENSP00000354812:R6W	R	-	1	2	C9orf114	130631865	0.000000	0.05858	0.001000	0.08648	0.005000	0.04900	-0.254000	0.08781	-0.504000	0.06577	-0.313000	0.08912	AGG	C9orf114	-	NULL		0.697	C9orf114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C9orf114	HGNC	protein_coding	OTTHUMT00000054500.1	T	NM_016390		131592044	-1	no_errors	ENST00000361256	ensembl	human	known	70_37	missense	SNP	0.000	A
CAPN6	827	genome.wustl.edu	37	X	110496436	110496436	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chrX:110496436G>A	ENST00000324068.1	-	4	473	c.306C>T	c.(304-306)ccC>ccT	p.P102P	CAPN6_ENST00000541758.1_5'UTR	NM_014289.3	NP_055104.2	Q9Y6Q1	CAN6_HUMAN	calpain 6	102	Calpain catalytic. {ECO:0000255|PROSITE- ProRule:PRU00239}.				microtubule bundle formation (GO:0001578)|proteolysis (GO:0006508)|regulation of cytoskeleton organization (GO:0051493)	perinuclear region of cytoplasm (GO:0048471)|spindle microtubule (GO:0005876)	calcium-dependent cysteine-type endopeptidase activity (GO:0004198)|microtubule binding (GO:0008017)			cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(25)|ovary(3)|skin(3)|upper_aerodigestive_tract(1)	47						CCTTATGGTTGGGAATTGTCT	0.403																																																	0													75.0	74.0	74.0					X																	110496436		2203	4300	6503	SO:0001819	synonymous_variant	827			AF029232	CCDS14555.1	Xq23	2008-07-29			ENSG00000077274	ENSG00000077274			1483	protein-coding gene	gene with protein product		300146				9503024, 9339374	Standard	NM_014289		Approved	CAPNX, CalpM, CANPX	uc004epc.2	Q9Y6Q1	OTTHUMG00000022203	ENST00000324068.1:c.306C>T	X.37:g.110496436G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUY7|Q9UEQ1|Q9UJA8	Silent	SNP	pfam_Peptidase_C2_calpain_cat,pfam_Calpain_domain_III,pfam_C2_Ca-dep,superfamily_Calpain_domain_III,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_Peptidase_C2_calpain_cat,smart_Calpain_III,smart_C2_Ca-dep,pfscan_Peptidase_C2_calpain_cat,prints_Calpain_cysteine_protease	p.P102	ENST00000324068.1	37	c.306	CCDS14555.1	X																																																																																			CAPN6	-	pfam_Peptidase_C2_calpain_cat,smart_Peptidase_C2_calpain_cat,pfscan_Peptidase_C2_calpain_cat		0.403	CAPN6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CAPN6	HGNC	protein_coding	OTTHUMT00000057922.1	G			110496436	-1	no_errors	ENST00000324068	ensembl	human	known	70_37	silent	SNP	0.501	A
CASZ1	54897	genome.wustl.edu	37	1	10699830	10699830	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:10699830G>A	ENST00000377022.3	-	21	4766	c.4449C>T	c.(4447-4449)cgC>cgT	p.R1483R	RP4-734G22.3_ENST00000606802.1_RNA	NM_001079843.2	NP_001073312.1	Q86V15	CASZ1_HUMAN	castor zinc finger 1	1483					multicellular organismal development (GO:0007275)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|intracellular membrane-bounded organelle (GO:0043231)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(9)|large_intestine(13)|lung(18)|ovary(2)|prostate(5)|skin(2)|urinary_tract(1)	54	Ovarian(185;0.203)|all_lung(157;0.204)	Lung NSC(185;4.96e-06)|all_lung(284;1.22e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00212)|Hepatocellular(190;0.00913)|Ovarian(437;0.0229)|Myeloproliferative disorder(586;0.0255)	STAD - Stomach adenocarcinoma(5;0.0224)	UCEC - Uterine corpus endometrioid carcinoma (279;0.0265)|Colorectal(212;3.54e-08)|COAD - Colon adenocarcinoma(227;9.56e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000219)|Kidney(185;0.00142)|KIRC - Kidney renal clear cell carcinoma(229;0.00381)|READ - Rectum adenocarcinoma(331;0.0419)|STAD - Stomach adenocarcinoma(132;0.0623)		GGTTGTCCACGCGGTCGTGGT	0.627																																																	0													42.0	58.0	53.0					1																	10699830		2178	4278	6456	SO:0001819	synonymous_variant	54897			AK000328	CCDS120.2, CCDS41246.1	1p36.22	2013-01-07	2007-02-02		ENSG00000130940	ENSG00000130940		"""Zinc fingers, C2H2-type"""	26002	protein-coding gene	gene with protein product	"""zinc finger protein 693"", ""survival related gene"""	609895	"""castor homolog 1, zinc finger (Drosophila)"""			16631614, 21252912	Standard	NM_001079843		Approved	FLJ20321, ZNF693, castor, cst, SRG	uc001aro.4	Q86V15	OTTHUMG00000002035	ENST00000377022.3:c.4449C>T	1.37:g.10699830G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q078S9|Q2EN02|Q5T9S1|Q6ZNM8|Q8WX49|Q8WX50|Q9BT16|Q9NXC6	Silent	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R1483	ENST00000377022.3	37	c.4449	CCDS41246.1	1																																																																																			CASZ1	-	NULL		0.627	CASZ1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	CASZ1	HGNC	protein_coding	OTTHUMT00000005673.2	G	NM_017766		10699830	-1	no_errors	ENST00000377022	ensembl	human	known	70_37	silent	SNP	1.000	A
CCBL2	56267	genome.wustl.edu	37	1	89430628	89430628	+	Silent	SNP	G	G	A	rs138622110		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:89430628G>A	ENST00000260508.4	-	5	674	c.337C>T	c.(337-339)Ctg>Ttg	p.L113L	CCBL2_ENST00000370485.2_Silent_p.L113L|CCBL2_ENST00000446900.2_5'UTR|CCBL2_ENST00000370491.3_Silent_p.L79L	NM_001008661.2	NP_001008661.1	Q6YP21	KAT3_HUMAN	cysteine conjugate-beta lyase 2	113					2-oxoglutarate metabolic process (GO:0006103)|biosynthetic process (GO:0009058)|cellular amino acid metabolic process (GO:0006520)|cellular nitrogen compound metabolic process (GO:0034641)|kynurenine metabolic process (GO:0070189)|L-kynurenine metabolic process (GO:0097052)|small molecule metabolic process (GO:0044281)|tryptophan catabolic process (GO:0006569)	mitochondrion (GO:0005739)	cysteine-S-conjugate beta-lyase activity (GO:0047804)|kynurenine-glyoxylate transaminase activity (GO:0047315)|kynurenine-oxoglutarate transaminase activity (GO:0016212)|poly(A) RNA binding (GO:0044822)|pyridoxal phosphate binding (GO:0030170)			endometrium(3)|kidney(4)|large_intestine(2)|lung(4)|ovary(2)|skin(2)|soft_tissue(1)	18		Lung NSC(277;0.123)		all cancers(265;0.0117)|Epithelial(280;0.0341)		TTTTCATACAGATAGGACAGA	0.333																																																	0													73.0	73.0	73.0					1																	89430628		2203	4297	6500	SO:0001819	synonymous_variant	56267			AF091090	CCDS30766.1, CCDS30767.1	1p22.2	2009-06-23			ENSG00000137944	ENSG00000137944			33238	protein-coding gene	gene with protein product		610656				16376499	Standard	NM_001008662		Approved	RBM1, RP11-82K18.3, KAT3	uc001dmp.2	Q6YP21	OTTHUMG00000010617	ENST00000260508.4:c.337C>T	1.37:g.89430628G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQ13|O95335|Q5JS27|Q5T9T7|Q5T9T8|Q6AI27|Q6ICW1|Q9BVY5	Silent	SNP	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom	p.L113	ENST00000260508.4	37	c.337	CCDS30766.1	1																																																																																			CCBL2	-	pfam_Aminotransferase_I/II,superfamily_PyrdxlP-dep_Trfase_major_dom		0.333	CCBL2-004	KNOWN	basic|CCDS	protein_coding	CCBL2	HGNC	protein_coding	OTTHUMT00000029300.3	G	NM_001008661		89430628	-1	no_errors	ENST00000260508	ensembl	human	known	70_37	silent	SNP	0.980	A
CCDC137	339230	genome.wustl.edu	37	17	79634867	79634867	+	Silent	SNP	C	C	T	rs574701572	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:79634867C>T	ENST00000329214.8	+	2	646	c.243C>T	c.(241-243)atC>atT	p.I81I	OXLD1_ENST00000573786.1_5'Flank|OXLD1_ENST00000374741.3_5'Flank|OXLD1_ENST00000571503.1_5'Flank	NM_199287.2	NP_954981.1	Q6PK04	CC137_HUMAN	coiled-coil domain containing 137	81							poly(A) RNA binding (GO:0044822)			NS(1)|central_nervous_system(2)|endometrium(2)|large_intestine(5)|lung(2)	12	all_neural(118;0.0878)|all_lung(278;0.23)|Melanoma(429;0.242)		BRCA - Breast invasive adenocarcinoma(99;0.0101)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			AAAACCCGATCAGTAACAAGA	0.517																																																	0													28.0	31.0	31.0					17																	79634867		1932	4122	6054	SO:0001819	synonymous_variant	339230			BC009369	CCDS42400.1	17q25.3	2008-07-04				ENSG00000185298			33451	protein-coding gene	gene with protein product		614271					Standard	NM_199287		Approved	MGC16597	uc002kbc.4	Q6PK04		ENST00000329214.8:c.243C>T	17.37:g.79634867C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.I81	ENST00000329214.8	37	c.243	CCDS42400.1	17																																																																																			CCDC137	-	NULL		0.517	CCDC137-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC137	HGNC	protein_coding	OTTHUMT00000440387.1	C			79634867	+1	no_errors	ENST00000329214	ensembl	human	known	70_37	silent	SNP	0.742	T
CCDC168	643677	genome.wustl.edu	37	13	103381995	103381996	+	Frame_Shift_Ins	INS	-	-	A	rs74709711|rs397851855		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr13:103381995_103381996insA	ENST00000322527.2	-	1	7163_7164	c.7164_7165insT	c.(7162-7167)tttgccfs	p.A2389fs		NM_001146197.1	NP_001139669.1	Q8NDH2	CC168_HUMAN	coiled-coil domain containing 168	2389																	GGTACACAGGCAAAAAAAAAGG	0.406																																																	0																																										SO:0001589	frameshift_variant	643677				CCDS73596.1	13q33.1	2014-06-17	2011-08-09	2011-08-09	ENSG00000175820	ENSG00000175820			26851	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 40"""	C13orf40			Standard	NM_001146197		Approved	FLJ40176	uc001vpm.3	Q8NDH2	OTTHUMG00000187287	ENST00000322527.2:c.7165dupT	13.37:g.103382004_103382004dupA	ENSP00000320232:p.Ala2389fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N800	Frame_Shift_Ins	INS	NULL	p.A2388fs	ENST00000322527.2	37	c.7165_7164		13																																																																																			CCDC168	-	NULL		0.406	CCDC168-201	KNOWN	basic|appris_principal	protein_coding	CCDC168	HGNC	protein_coding		-	NM_001146197		103381996	-1	no_errors	ENST00000322527	ensembl	human	known	70_37	frame_shift_ins	INS	0.998:0.998	A
CCDC84	338657	genome.wustl.edu	37	11	118869204	118869204	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr11:118869204G>A	ENST00000334418.1	+	2	241	c.185G>A	c.(184-186)cGa>cAa	p.R62Q	RP11-110I1.12_ENST00000526453.1_lincRNA	NM_198489.1	NP_940891.1	Q86UT8	CCD84_HUMAN	coiled-coil domain containing 84	62										breast(1)|kidney(1)|large_intestine(1)|liver(1)|ovary(1)	5	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0523)|all_neural(223;0.224)|all_hematologic(192;0.243)		BRCA - Breast invasive adenocarcinoma(274;7.72e-05)		GAACACGAGCGATGCTGCTGG	0.677																																																	0													33.0	33.0	33.0					11																	118869204		2200	4294	6494	SO:0001583	missense	338657			AB094093	CCDS8405.1	11q23.3	2006-03-13			ENSG00000186166	ENSG00000186166			30460	protein-coding gene	gene with protein product							Standard	NM_198489		Approved	DLNB14	uc001pul.3	Q86UT8	OTTHUMG00000166348	ENST00000334418.1:c.185G>A	11.37:g.118869204G>A	ENSP00000334767:p.Arg62Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.R62Q	ENST00000334418.1	37	c.185	CCDS8405.1	11	.	.	.	.	.	.	.	.	.	.	G	13.17	2.156508	0.38119	.	.	ENSG00000186166	ENST00000334418	T	0.42513	0.97	5.12	4.14	0.48551	.	0.393091	0.28465	N	0.015259	T	0.17746	0.0426	N	0.03608	-0.345	0.09310	N	0.99999	B	0.19706	0.038	B	0.08055	0.003	T	0.12528	-1.0544	10	0.15066	T	0.55	-19.1235	10.4152	0.44318	0.1019:0.0:0.8981:0.0	.	62	Q86UT8	CCD84_HUMAN	Q	62	ENSP00000334767:R62Q	ENSP00000334767:R62Q	R	+	2	0	CCDC84	118374414	0.924000	0.31332	0.687000	0.30102	0.979000	0.70002	1.995000	0.40767	2.672000	0.90937	0.650000	0.86243	CGA	CCDC84	-	NULL		0.677	CCDC84-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC84	HGNC	protein_coding	OTTHUMT00000389315.1	G	NM_198489		118869204	+1	no_errors	ENST00000334418	ensembl	human	known	70_37	missense	SNP	0.245	A
CHD5	26038	genome.wustl.edu	37	1	6170487	6170487	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:6170487C>T	ENST00000262450.3	-	37	5448	c.5349G>A	c.(5347-5349)gaG>gaA	p.E1783E	CHD5_ENST00000378021.1_Silent_p.E640E	NM_015557.2	NP_056372.1	O00258	WRB_HUMAN	chromodomain helicase DNA binding protein 5	0					tail-anchored membrane protein insertion into ER membrane (GO:0071816)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)				breast(3)|central_nervous_system(3)|liver(1)|lung(1)|ovary(4)|pancreas(1)|skin(1)|upper_aerodigestive_tract(2)	16	Ovarian(185;0.0634)	all_cancers(23;5.36e-32)|all_epithelial(116;2.32e-17)|all_neural(13;3.68e-06)|all_lung(118;3.94e-06)|all_hematologic(16;2.39e-05)|Lung NSC(185;5.33e-05)|Acute lymphoblastic leukemia(12;0.000372)|Glioma(11;0.00127)|Renal(390;0.00188)|Colorectal(325;0.00342)|Breast(487;0.00373)|Hepatocellular(190;0.0218)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.15)		Epithelial(90;3.08e-37)|GBM - Glioblastoma multiforme(13;1.36e-31)|OV - Ovarian serous cystadenocarcinoma(86;7.7e-19)|Colorectal(212;9.97e-08)|COAD - Colon adenocarcinoma(227;1.07e-05)|Kidney(185;6.16e-05)|KIRC - Kidney renal clear cell carcinoma(229;0.00109)|BRCA - Breast invasive adenocarcinoma(365;0.0012)|STAD - Stomach adenocarcinoma(132;0.00346)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.193)		TGTTCTTCATCTCCAGGTAGT	0.597																																																	0													133.0	134.0	134.0					1																	6170487		2203	4300	6503	SO:0001819	synonymous_variant	26038			AF425231	CCDS57.1	1p36.3	2013-01-28			ENSG00000116254	ENSG00000116254		"""Zinc fingers, PHD-type"""	16816	protein-coding gene	gene with protein product		610771				11889561, 12592387	Standard	NM_015557		Approved		uc001amb.2	Q8TDI0	OTTHUMG00000000952	ENST00000262450.3:c.5349G>A	1.37:g.6170487C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAP8|A8MQ44|D3DSH9|O60740	Silent	SNP	pfam_CHD_C2,pfam_SNF2_N,pfam_DUF1086,pfam_CHD_N,pfam_DUF1087,pfam_Znf_PHD-finger,pfam_Chromo_domain,pfam_Helicase_C,pfam_Helicase/UvrB_dom,superfamily_Chromodomain-like,superfamily_Znf_FYVE_PHD,superfamily_HMG_superfamily,smart_Znf_PHD,smart_Chromo_domain/shadow,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Znf_PHD-finger,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_Chromo_domain/shadow	p.E1783	ENST00000262450.3	37	c.5349	CCDS57.1	1																																																																																			CHD5	-	pfam_CHD_C2		0.597	CHD5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHD5	HGNC	protein_coding	OTTHUMT00000002823.2	C	NM_015557		6170487	-1	no_errors	ENST00000262450	ensembl	human	known	70_37	silent	SNP	1.000	T
CHST11	50515	genome.wustl.edu	37	12	105151391	105151391	+	Missense_Mutation	SNP	T	T	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:105151391T>C	ENST00000303694.5	+	3	1308	c.869T>C	c.(868-870)cTg>cCg	p.L290P	CHST11_ENST00000549260.1_Missense_Mutation_p.L285P	NM_018413.5	NP_060883.1	Q9NPF2	CHSTB_HUMAN	carbohydrate (chondroitin 4) sulfotransferase 11	290					carbohydrate biosynthetic process (GO:0016051)|carbohydrate metabolic process (GO:0005975)|chondrocyte development (GO:0002063)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|developmental growth (GO:0048589)|embryonic digit morphogenesis (GO:0042733)|embryonic viscerocranium morphogenesis (GO:0048703)|glycosaminoglycan metabolic process (GO:0030203)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|polysaccharide localization (GO:0033037)|post-anal tail morphogenesis (GO:0036342)|post-embryonic development (GO:0009791)|regulation of cell proliferation (GO:0042127)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	chondroitin 4-sulfotransferase activity (GO:0047756)|N-acetylgalactosamine 4-O-sulfotransferase activity (GO:0001537)|N-acetylgalactosamine 4-sulfate 6-O-sulfotransferase activity (GO:0050659)			breast(2)|endometrium(2)|large_intestine(4)|lung(6)|ovary(1)|prostate(2)|skin(1)	18						AATTACGTCCTGCAGCTGGCA	0.507																																																	0													110.0	96.0	101.0					12																	105151391		2203	4300	6503	SO:0001583	missense	50515			AB042326	CCDS9099.1, CCDS55878.1	12q23.3	2008-02-05				ENSG00000171310	2.8.2.5	"""Sulfotransferases, membrane-bound"""	17422	protein-coding gene	gene with protein product		610128				10781601	Standard	NM_018413		Approved	C4ST1, C4St-1, C4ST, HSA269537	uc001tkz.3	Q9NPF2	OTTHUMG00000169803	ENST00000303694.5:c.869T>C	12.37:g.105151391T>C	ENSP00000305725:p.Leu290Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4F8|Q9NXY6|Q9NY36	Missense_Mutation	SNP	pfam_Sulfotransferase	p.L290P	ENST00000303694.5	37	c.869	CCDS9099.1	12	.	.	.	.	.	.	.	.	.	.	T	17.68	3.448968	0.63178	.	.	ENSG00000171310	ENST00000549260;ENST00000303694	T;T	0.78364	-1.17;-1.17	5.25	5.25	0.73442	.	0.000000	0.85682	D	0.000000	D	0.91432	0.7296	H	0.95437	3.67	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.93939	0.7221	10	0.87932	D	0	-20.9748	15.1649	0.72814	0.0:0.0:0.0:1.0	.	285;290	Q9NPF2-2;Q9NPF2	.;CHSTB_HUMAN	P	285;290	ENSP00000450004:L285P;ENSP00000305725:L290P	ENSP00000305725:L290P	L	+	2	0	CHST11	103675521	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	8.040000	0.89188	1.997000	0.58415	0.454000	0.30748	CTG	CHST11	-	pfam_Sulfotransferase		0.507	CHST11-001	KNOWN	basic|CCDS	protein_coding	CHST11	HGNC	protein_coding	OTTHUMT00000405960.2	T	NM_018413		105151391	+1	no_errors	ENST00000303694	ensembl	human	known	70_37	missense	SNP	1.000	C
CLIP1	6249	genome.wustl.edu	37	12	122794404	122794404	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:122794404G>A	ENST00000540338.1	-	19	3540	c.3499C>T	c.(3499-3501)Cag>Tag	p.Q1167*	CLIP1_ENST00000361654.4_Nonsense_Mutation_p.Q1045*|CLIP1_ENST00000537178.1_Nonsense_Mutation_p.Q1121*|CLIP1_ENST00000545889.1_Nonsense_Mutation_p.Q742*|CLIP1_ENST00000358808.2_Nonsense_Mutation_p.Q1156*|CLIP1_ENST00000302528.7_Nonsense_Mutation_p.Q1156*			P30622	CLIP1_HUMAN	CAP-GLY domain containing linker protein 1	1167					microtubule bundle formation (GO:0001578)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|positive regulation of microtubule polymerization (GO:0031116)|transport (GO:0006810)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|intermediate filament (GO:0005882)|kinetochore (GO:0000776)|membrane (GO:0016020)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)	metal ion binding (GO:0046872)|microtubule binding (GO:0008017)|microtubule plus-end binding (GO:0051010)|nucleic acid binding (GO:0003676)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|endometrium(4)|kidney(5)|large_intestine(16)|liver(1)|lung(21)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	60	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;1.81e-05)|Epithelial(86;6.85e-05)|BRCA - Breast invasive adenocarcinoma(302;0.226)		TGGGACTTCTGAGCTGCTGCC	0.507																																																	0													98.0	78.0	84.0					12																	122794404		2203	4300	6503	SO:0001587	stop_gained	6249				CCDS9232.1, CCDS9233.1, CCDS58285.1	12q24.3	2013-01-17	2007-01-05	2007-01-05	ENSG00000130779	ENSG00000130779			10461	protein-coding gene	gene with protein product	"""restin"""	179838	"""restin (Reed-Steinberg cell-expressed intermediate filament-associated protein)"""	RSN		8222754	Standard	NM_001247997		Approved	CYLN1, CLIP170, CLIP, CLIP-170	uc001ucg.2	P30622	OTTHUMG00000168922	ENST00000540338.1:c.3499C>T	12.37:g.122794404G>A	ENSP00000439093:p.Gln1167*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVD3|Q17RS4|Q29RG0	Nonsense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,superfamily_Znf_CCHC,superfamily_Prefoldin,pfscan_CAP-Gly_domain	p.Q1167*	ENST00000540338.1	37	c.3499	CCDS58285.1	12	.	.	.	.	.	.	.	.	.	.	G	42	9.557330	0.99204	.	.	ENSG00000130779	ENST00000545889;ENST00000302528;ENST00000358808;ENST00000542885;ENST00000392458;ENST00000537178;ENST00000540338	.	.	.	5.5	4.41	0.53225	.	0.471756	0.23987	N	0.042609	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27082	T	0.32	-17.9144	11.5431	0.50677	0.0787:0.1298:0.7915:0.0	.	.	.	.	X	742;1156;1156;886;198;1121;1167	.	ENSP00000303585:Q1156X	Q	-	1	0	CLIP1	121360357	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.521000	0.60532	2.592000	0.87571	0.650000	0.86243	CAG	CLIP1	-	NULL		0.507	CLIP1-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CLIP1	HGNC	protein_coding	OTTHUMT00000401625.1	G	NM_002956		122794404	-1	no_errors	ENST00000540338	ensembl	human	known	70_37	nonsense	SNP	1.000	A
CNTNAP1	8506	genome.wustl.edu	37	17	40843185	40843185	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:40843185G>A	ENST00000264638.4	+	14	2307	c.2090G>A	c.(2089-2091)cGa>cAa	p.R697Q	CTD-3193K9.3_ENST00000592440.1_RNA	NM_003632.2	NP_003623.1	P78357	CNTP1_HUMAN	contactin associated protein 1	697	Fibrinogen C-terminal. {ECO:0000255|PROSITE-ProRule:PRU00739}.				axon cargo transport (GO:0008088)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cytoskeleton organization (GO:0007010)|neuromuscular process controlling balance (GO:0050885)|neuromuscular process controlling posture (GO:0050884)|neuron projection morphogenesis (GO:0048812)|neuronal action potential propagation (GO:0019227)|paranodal junction assembly (GO:0030913)|positive regulation of signal transduction (GO:0009967)|protein localization to paranode region of axon (GO:0002175)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|paranode region of axon (GO:0033270)|voltage-gated potassium channel complex (GO:0008076)	receptor activity (GO:0004872)|SH3 domain binding (GO:0017124)|SH3/SH2 adaptor activity (GO:0005070)			NS(1)|breast(4)|cervix(1)|endometrium(5)|kidney(3)|large_intestine(11)|lung(15)|ovary(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49		Breast(137;0.000143)		BRCA - Breast invasive adenocarcinoma(366;0.143)		TGGATTGGCCGAAATGAGGAG	0.627																																																	0													63.0	63.0	63.0					17																	40843185		2203	4300	6503	SO:0001583	missense	8506			U87223	CCDS11436.1	17q21	2008-07-18				ENSG00000108797			8011	protein-coding gene	gene with protein product	"""neurexin 4"""	602346		NRXN4		9118959	Standard	NM_003632		Approved	p190, Caspr, CNTNAP	uc002iay.3	P78357		ENST00000264638.4:c.2090G>A	17.37:g.40843185G>A	ENSP00000264638:p.Arg697Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Laminin_G,pfam_Coagulation_fac_5/8-C_type_dom,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,superfamily_Fibrinogen_a/b/g_C,smart_Coagulation_fac_5/8-C_type_dom,smart_Laminin_G,smart_Neurexin-like,pfscan_EG-like_dom,pfscan_Coagulation_fac_5/8-C_type_dom,pfscan_Laminin_G	p.R697Q	ENST00000264638.4	37	c.2090	CCDS11436.1	17	.	.	.	.	.	.	.	.	.	.	G	36	5.658584	0.96734	.	.	ENSG00000108797	ENST00000264638	T	0.12039	2.72	5.6	5.6	0.85130	Fibrinogen, alpha/beta/gamma chain, C-terminal globular (1);	0.000000	0.56097	D	0.000022	T	0.19644	0.0472	M	0.76170	2.325	0.52099	D	0.999942	P	0.38863	0.65	B	0.29942	0.109	T	0.04153	-1.0973	10	0.62326	D	0.03	.	19.6023	0.95568	0.0:0.0:1.0:0.0	.	697	P78357	CNTP1_HUMAN	Q	697	ENSP00000264638:R697Q	ENSP00000264638:R697Q	R	+	2	0	CNTNAP1	38096711	1.000000	0.71417	0.964000	0.40570	0.995000	0.86356	7.513000	0.81739	2.653000	0.90120	0.561000	0.74099	CGA	CNTNAP1	-	NULL		0.627	CNTNAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CNTNAP1	HGNC	protein_coding	OTTHUMT00000452342.1	G	NM_003632		40843185	+1	no_errors	ENST00000264638	ensembl	human	known	70_37	missense	SNP	1.000	A
COL6A6	131873	genome.wustl.edu	37	3	130279232	130279232	+	Silent	SNP	C	C	T	rs370873490		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr3:130279232C>T	ENST00000358511.6	+	1	55	c.24C>T	c.(22-24)ctC>ctT	p.L8L	COL6A6_ENST00000453409.2_Silent_p.L8L	NM_001102608.1	NP_001096078.1	A6NMZ7	CO6A6_HUMAN	collagen, type VI, alpha 6	8					cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)				NS(2)|breast(5)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(30)|lung(57)|ovary(8)|pancreas(1)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	134						TTTTGTTCCTCGTGATAATTT	0.289																																																	0								C		0,3610		0,0,1805	133.0	120.0	124.0		24	1.1	0.0	3		124	1,8129		0,1,4064	no	coding-synonymous	COL6A6	NM_001102608.1		0,1,5869	TT,TC,CC		0.0123,0.0,0.0085		8/2264	130279232	1,11739	1805	4065	5870	SO:0001819	synonymous_variant	131873			AL713792	CCDS46911.1	3q22.1	2013-01-16			ENSG00000206384	ENSG00000206384		"""Collagens"""	27023	protein-coding gene	gene with protein product							Standard	NM_001102608		Approved		uc010htl.3	A6NMZ7	OTTHUMG00000159653	ENST00000358511.6:c.24C>T	3.37:g.130279232C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A7DZQ0|A7DZQ1|A7DZQ2|Q69YT0	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.L8	ENST00000358511.6	37	c.24	CCDS46911.1	3																																																																																			COL6A6	-	NULL		0.289	COL6A6-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	COL6A6	HGNC	protein_coding	OTTHUMT00000356705.5	C	NM_001102608		130279232	+1	no_errors	ENST00000358511	ensembl	human	known	70_37	silent	SNP	0.088	T
CROCCP2	84809	genome.wustl.edu	37	1	16959697	16959697	+	lincRNA	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:16959697C>T	ENST00000412962.1	-	0	74							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											AGGTCCTTCTCGTGGAGCACC	0.657																																																	0																																												84809			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16959697C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-		0.657	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	C	NR_026752.1		16959697	-1	no_errors	ENST00000362058	ensembl	human	known	70_37	rna	SNP	0.846	T
DBNDD2	55861	genome.wustl.edu	37	20	44038718	44038718	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr20:44038718G>A	ENST00000372720.3	+	4	949	c.718G>A	c.(718-720)Gca>Aca	p.A240T	DBNDD2_ENST00000360981.4_Missense_Mutation_p.A142T|DBNDD2_ENST00000372723.3_Missense_Mutation_p.A142T|DBNDD2_ENST00000372712.2_Missense_Mutation_p.A142T|TP53TG5_ENST00000494455.1_5'Flank|DBNDD2_ENST00000357275.2_Missense_Mutation_p.A142T|DBNDD2_ENST00000372722.3_3'UTR|DBNDD2_ENST00000372710.3_Missense_Mutation_p.A244T|DBNDD2_ENST00000372717.1_3'UTR	NM_018478.3	NP_060948.3	Q9BQY9	DBND2_HUMAN	dysbindin (dystrobrevin binding protein 1) domain containing 2	240					negative regulation of protein kinase activity (GO:0006469)	cytoplasm (GO:0005737)				breast(1)|lung(2)	3		Myeloproliferative disorder(115;0.0122)				TACGCCCTTGGCACAGTCGGA	0.592																																																	0													44.0	44.0	44.0					20																	44038718		2022	4173	6195	SO:0001583	missense	55861			AF220191	CCDS42880.1, CCDS42881.1, CCDS56193.1, CCDS56194.1	20q13.12	2007-07-23	2006-04-04	2006-04-04	ENSG00000244274	ENSG00000244274			15881	protein-coding gene	gene with protein product		611453	"""chromosome 20 open reading frame 35"""	C20orf35			Standard	NM_001048225		Approved	HSMNP1	uc002xof.3	Q9BQY9	OTTHUMG00000032576	ENST00000372720.3:c.718G>A	20.37:g.44038718G>A	ENSP00000361805:p.Ala240Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q331S6|Q5QPV4|Q5QPV6|Q9BQZ0|Q9BVL1|Q9H1F6|Q9NWZ0|Q9NY07|Q9NZ31	Missense_Mutation	SNP	pfam_Dysbindin	p.A240T	ENST00000372720.3	37	c.718	CCDS56193.1	20	.	.	.	.	.	.	.	.	.	.	G	28.4	4.912895	0.92178	.	.	ENSG00000244274	ENST00000372723;ENST00000357275;ENST00000372720;ENST00000360981;ENST00000372712;ENST00000372710	T;T;T;T;T;T	0.33438	1.5;1.5;1.43;1.5;1.5;1.41	5.72	5.72	0.89469	.	0.154450	0.45867	D	0.000325	T	0.49253	0.1546	L	0.51422	1.61	0.34404	D	0.695593	D	0.65815	0.995	D	0.65140	0.932	T	0.59354	-0.7470	10	0.62326	D	0.03	-13.2136	16.6212	0.84931	0.0:0.0:1.0:0.0	.	240	Q9BQY9	DBND2_HUMAN	T	142;142;240;142;142;244	ENSP00000361808:A142T;ENSP00000349822:A142T;ENSP00000361805:A240T;ENSP00000354250:A142T;ENSP00000361797:A142T;ENSP00000361795:A244T	ENSP00000349822:A142T	A	+	1	0	DBNDD2	43472132	1.000000	0.71417	1.000000	0.80357	0.979000	0.70002	6.298000	0.72763	2.701000	0.92244	0.514000	0.50259	GCA	DBNDD2	-	NULL		0.592	DBNDD2-001	KNOWN	basic|CCDS	protein_coding	DBNDD2	HGNC	protein_coding	OTTHUMT00000079438.1	G	NM_018478		44038718	+1	no_errors	ENST00000372720	ensembl	human	known	70_37	missense	SNP	1.000	A
DDX5	1655	genome.wustl.edu	37	17	62496426	62496426	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:62496426C>T	ENST00000225792.5	-	13	1861	c.1460G>A	c.(1459-1461)gGa>gAa	p.G487E	MIR3064_ENST00000581130.1_RNA|DDX5_ENST00000580026.1_5'UTR|DDX5_ENST00000450599.2_Missense_Mutation_p.G408E|MIR5047_ENST00000579212.1_RNA|DDX5_ENST00000578804.1_Missense_Mutation_p.G487E	NM_004396.3	NP_004387.1	P17844	DDX5_HUMAN	DEAD (Asp-Glu-Ala-Asp) box helicase 5	487	Transactivation domain.				cell growth (GO:0016049)|circadian rhythm (GO:0007623)|in utero embryonic development (GO:0001701)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|mRNA splicing, via spliceosome (GO:0000398)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of intracellular estrogen receptor signaling pathway (GO:0033148)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of osteoblast differentiation (GO:0045667)|regulation of skeletal muscle cell differentiation (GO:2001014)|regulation of viral genome replication (GO:0045069)|transcription, DNA-templated (GO:0006351)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	androgen receptor binding (GO:0050681)|ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|estrogen receptor binding (GO:0030331)|poly(A) RNA binding (GO:0044822)|pre-mRNA binding (GO:0036002)|RNA helicase activity (GO:0003724)|transcription coactivator activity (GO:0003713)			breast(3)|cervix(1)|endometrium(5)|kidney(1)|large_intestine(2)|lung(5)|ovary(2)	19	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;8.6e-12)			CTTCATGCCTCCTCTACCCCT	0.423			T	ETV4	prostate																																NSCLC(22;406 813 4871 19580 40307)			Dom	yes		17	17q21	1655	DEAD (Asp-Glu-Ala-Asp) box polypeptide 5		E	0													72.0	73.0	73.0					17																	62496426		2203	4300	6503	SO:0001583	missense	1655			AF015812	CCDS11659.1	17q21	2012-07-27	2012-02-23		ENSG00000108654	ENSG00000108654		"""DEAD-boxes"""	2746	protein-coding gene	gene with protein product		180630	"""DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 5 (RNA helicase, 68kD)"", ""DEAD (Asp-Glu-Ala-Asp) box polypeptide 5"""	HLR1, G17P1		22156369, 18698352	Standard	NM_004396		Approved	p68	uc002jek.2	P17844	OTTHUMG00000178936	ENST00000225792.5:c.1460G>A	17.37:g.62496426C>T	ENSP00000225792:p.Gly487Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DLW8|B5BU21|D3DU32|E7ETL9|O75681|Q53Y61	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_P68HR,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.G487E	ENST00000225792.5	37	c.1460	CCDS11659.1	17	.	.	.	.	.	.	.	.	.	.	C	9.283	1.048760	0.19827	.	.	ENSG00000108654	ENST00000540698;ENST00000450599;ENST00000225792	.	.	.	5.45	5.45	0.79879	.	0.105298	0.64402	D	0.000005	T	0.57888	0.2084	M	0.80616	2.505	0.80722	D	1	P;B;B	0.43477	0.808;0.001;0.001	B;B;B	0.33690	0.168;0.0;0.0	T	0.64753	-0.6333	9	0.39692	T	0.17	-16.5493	17.1403	0.86752	0.0:1.0:0.0:0.0	.	408;487;487	B4DLW8;B5BUE6;P17844	.;.;DDX5_HUMAN	E	487;417;476	.	ENSP00000225792:G476E	G	-	2	0	DDX5	59926888	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	4.504000	0.60414	2.712000	0.92718	0.591000	0.81541	GGA	DDX5	-	NULL		0.423	DDX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX5	HGNC	protein_coding	OTTHUMT00000444030.1	C	NM_004396		62496426	-1	no_errors	ENST00000225792	ensembl	human	known	70_37	missense	SNP	1.000	T
DDX60L	91351	genome.wustl.edu	37	4	169362599	169362599	+	Missense_Mutation	SNP	C	C	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:169362599C>A	ENST00000511577.1	-	10	1430	c.1183G>T	c.(1183-1185)Gac>Tac	p.D395Y	DDX60L_ENST00000260184.7_Missense_Mutation_p.D395Y|DDX60L_ENST00000505890.1_Missense_Mutation_p.D395Y			Q5H9U9	DDX6L_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 60-like	395							ATP binding (GO:0005524)|helicase activity (GO:0004386)|RNA binding (GO:0003723)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|lung(23)|ovary(2)|prostate(1)|skin(1)|stomach(1)	43		Prostate(90;0.00876)|Renal(120;0.0183)|all_neural(102;0.0837)|Melanoma(52;0.132)		GBM - Glioblastoma multiforme(119;0.175)		TTCCACAGGTCTTCATAATCC	0.348																																																	0													114.0	108.0	110.0					4																	169362599		1818	4081	5899	SO:0001583	missense	91351			AK092461	CCDS47161.1	4q32.3	2008-01-08				ENSG00000181381			26429	protein-coding gene	gene with protein product							Standard	XM_005263341		Approved	FLJ31033	uc003irq.4	Q5H9U9		ENST00000511577.1:c.1183G>T	4.37:g.169362599C>A	ENSP00000422423:p.Asp395Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96ND6	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.D395Y	ENST00000511577.1	37	c.1183		4	.	.	.	.	.	.	.	.	.	.	C	0.016	-1.518917	0.00967	.	.	ENSG00000181381	ENST00000260184;ENST00000511577;ENST00000505890;ENST00000505863	T;T;T;T	0.17691	2.26;2.26;2.26;2.94	3.1	-0.0454	0.13851	.	1.885830	0.03999	U	0.296178	T	0.07098	0.0180	N	0.08118	0	0.09310	N	0.999999	B;B;B	0.02656	0.0;0.0;0.0	B;B;B	0.01281	0.0;0.0;0.0	T	0.27502	-1.0072	10	0.02654	T	1	.	4.6174	0.12433	0.1445:0.4557:0.3998:0.0	.	395;395;395	E9PAP8;D6R906;Q5H9U9	.;.;DDX6L_HUMAN	Y	395;395;395;123	ENSP00000260184:D395Y;ENSP00000422423:D395Y;ENSP00000422202:D395Y;ENSP00000421026:D123Y	ENSP00000260184:D395Y	D	-	1	0	DDX60L	169599174	0.955000	0.32602	0.210000	0.23637	0.406000	0.30931	-0.111000	0.10807	0.395000	0.25257	-0.689000	0.03729	GAC	DDX60L	-	NULL		0.348	DDX60L-001	KNOWN	basic|appris_principal	protein_coding	DDX60L	HGNC	protein_coding	OTTHUMT00000364839.1	C	NM_001012967		169362599	-1	no_errors	ENST00000260184	ensembl	human	known	70_37	missense	SNP	0.374	A
DNAJC17	55192	genome.wustl.edu	37	15	41068475	41068475	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:41068475C>T	ENST00000220496.4	-	6	427	c.397G>A	c.(397-399)Gaa>Aaa	p.E133K		NM_018163.2	NP_060633.1	Q9NVM6	DJC17_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 17	133					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)		nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(1)|kidney(1)|large_intestine(2)|pancreas(1)|skin(1)	6		all_cancers(109;4.16e-14)|all_epithelial(112;9.68e-12)|Lung NSC(122;3.19e-09)|all_lung(180;6.45e-08)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.91e-05)|COAD - Colon adenocarcinoma(120;0.153)|BRCA - Breast invasive adenocarcinoma(123;0.166)		GAACCCTCTTCTCTCAGGCGT	0.592																																																	0													60.0	52.0	55.0					15																	41068475		2203	4300	6503	SO:0001583	missense	55192			AK001496	CCDS10065.1	15q15.1	2014-02-12			ENSG00000104129	ENSG00000104129		"""Heat shock proteins / DNAJ (HSP40)"", ""RNA binding motif (RRM) containing"""	25556	protein-coding gene	gene with protein product						12477932	Standard	NM_018163		Approved	FLJ10634	uc001zms.2	Q9NVM6	OTTHUMG00000130065	ENST00000220496.4:c.397G>A	15.37:g.41068475C>T	ENSP00000220496:p.Glu133Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_DnaJ_N,pfam_RRM_dom,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.E133K	ENST00000220496.4	37	c.397	CCDS10065.1	15	.	.	.	.	.	.	.	.	.	.	C	17.31	3.356213	0.61293	.	.	ENSG00000104129	ENST00000220496	T	0.20598	2.06	4.61	4.61	0.57282	.	0.000000	0.85682	D	0.000000	T	0.18130	0.0435	L	0.38953	1.18	0.80722	D	1	B	0.25007	0.116	B	0.19666	0.026	T	0.04737	-1.0930	10	0.20046	T	0.44	.	17.2528	0.87047	0.0:1.0:0.0:0.0	.	133	Q9NVM6	DJC17_HUMAN	K	133	ENSP00000220496:E133K	ENSP00000220496:E133K	E	-	1	0	DNAJC17	38855767	1.000000	0.71417	0.999000	0.59377	0.915000	0.54546	5.644000	0.67902	2.407000	0.81776	0.561000	0.74099	GAA	DNAJC17	-	NULL		0.592	DNAJC17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAJC17	HGNC	protein_coding	OTTHUMT00000252356.2	C	NM_018163		41068475	-1	no_errors	ENST00000220496	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAJC24	120526	genome.wustl.edu	37	11	31447908	31447909	+	3'UTR	INS	-	-	T	rs11304707|rs571564704|rs398015695	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr11:31447908_31447909insT	ENST00000536040.1	+	0	575_576				DNAJC24_ENST00000465995.1_Intron			Q6P3W2	DJC24_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 24						chaperone-mediated protein folding (GO:0061077)|oxidation-reduction process (GO:0055114)|peptidyl-diphthamide biosynthetic process from peptidyl-histidine (GO:0017183)|positive regulation of ATPase activity (GO:0032781)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)	ATPase activator activity (GO:0001671)|ferrous iron binding (GO:0008198)|zinc ion binding (GO:0008270)			breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|skin(1)|upper_aerodigestive_tract(2)	11						TGAAGGTTGGATTTTTTTTTTC	0.267																																																	0																																										SO:0001624	3_prime_UTR_variant	120526			AL833128	CCDS7873.2	11p14.1	2011-09-02	2008-07-03	2008-07-03	ENSG00000170946	ENSG00000170946		"""Heat shock proteins / DNAJ (HSP40)"""	26979	protein-coding gene	gene with protein product		611072	"""zinc finger, CSL-type containing 3"", ""DPH4 homolog (JJJ3, S. cerevisiae)"", ""DPH4, JJJ3 homolog (S. cerevisiae)"""	ZCSL3, DPH4		15485916	Standard	NM_181706		Approved	JJJ3	uc001msx.3	Q6P3W2	OTTHUMG00000133712	ENST00000536040.1:c.*229->T	11.37:g.31447918_31447918dupT		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0V0|B1ALC1|I6L9B4	RNA	INS	-	NULL	ENST00000536040.1	37	NULL		11																																																																																			DNAJC24	-	-		0.267	DNAJC24-201	KNOWN	basic	protein_coding	DNAJC24	HGNC	protein_coding		-	NM_181706		31447909	+1	no_errors	ENST00000524747	ensembl	human	known	70_37	rna	INS	0.646:0.001	T
DOK3	79930	genome.wustl.edu	37	5	176931139	176931139	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:176931139C>T	ENST00000357198.4	-	6	1340	c.1336G>A	c.(1336-1338)Gac>Aac	p.D446N	DOK3_ENST00000377112.4_Intron|DOK3_ENST00000501403.2_Missense_Mutation_p.D390N|RP11-1334A24.6_ENST00000506025.1_RNA|DOK3_ENST00000312943.6_Intron	NM_024872.2	NP_079148.2	Q7L591	DOK3_HUMAN	docking protein 3	446	Pro-rich.				Ras protein signal transduction (GO:0007265)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)				NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(2)|lung(7)	13	all_cancers(89;0.00033)|Renal(175;0.000269)|Lung NSC(126;0.00161)|all_lung(126;0.00286)	all_neural(177;0.00802)|Medulloblastoma(196;0.0145)|all_hematologic(541;0.248)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)|Epithelial(233;0.191)			AGGGTACTGTCGTTGGCCGGG	0.687																																																	0													22.0	26.0	25.0					5																	176931139		2202	4298	6500	SO:0001583	missense	79930			AK026223	CCDS4426.1, CCDS47349.1, CCDS47350.1	5q35	2008-02-05			ENSG00000146094	ENSG00000146094			24583	protein-coding gene	gene with protein product		611435				10733577, 12595900	Standard	NM_024872		Approved	FLJ22570	uc003mhk.3	Q7L591	OTTHUMG00000130850	ENST00000357198.4:c.1336G>A	5.37:g.176931139C>T	ENSP00000349727:p.Asp446Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PAT0|H7BXS0|Q8N864|Q9BQB3|Q9H666	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.D446N	ENST00000357198.4	37	c.1336	CCDS4426.1	5	.	.	.	.	.	.	.	.	.	.	c	6.270	0.418013	0.11870	.	.	ENSG00000146094	ENST00000357198;ENST00000501403	T;T	0.34667	2.03;1.35	4.41	3.54	0.40534	.	3.053960	0.01242	N	0.008635	T	0.28764	0.0713	N	0.17082	0.46	0.09310	N	1	B	0.18310	0.027	B	0.12156	0.007	T	0.23261	-1.0193	10	0.39692	T	0.17	-2.1204	10.0686	0.42319	0.0:0.9037:0.0:0.0963	.	446	Q7L591	DOK3_HUMAN	N	446;390	ENSP00000349727:D446N;ENSP00000421688:D390N	ENSP00000349727:D446N	D	-	1	0	DOK3	176863745	0.005000	0.15991	0.102000	0.21198	0.028000	0.11728	-0.036000	0.12185	0.855000	0.35359	0.306000	0.20318	GAC	DOK3	-	NULL		0.687	DOK3-001	KNOWN	basic|CCDS	protein_coding	DOK3	HGNC	protein_coding	OTTHUMT00000253420.4	C	NM_024872		176931139	-1	no_errors	ENST00000357198	ensembl	human	known	70_37	missense	SNP	0.116	T
DYNC1I2	1781	genome.wustl.edu	37	2	172604356	172604356	+	Missense_Mutation	SNP	G	G	A	rs201120526		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:172604356G>A	ENST00000397119.3	+	18	2041	c.1874G>A	c.(1873-1875)cGa>cAa	p.R625Q	DYNC1I2_ENST00000358002.6_Missense_Mutation_p.R617Q|DYNC1I2_ENST00000263811.4_Missense_Mutation_p.R619Q|DYNC1I2_ENST00000410079.3_Missense_Mutation_p.R617Q|DYNC1I2_ENST00000534253.2_Missense_Mutation_p.R625Q|DYNC1I2_ENST00000340296.4_Missense_Mutation_p.R599Q|DYNC1I2_ENST00000508530.1_Missense_Mutation_p.R598Q|DYNC1I2_ENST00000409773.1_Missense_Mutation_p.R625Q|DYNC1I2_ENST00000409317.1_Missense_Mutation_p.R619Q|DYNC1I2_ENST00000409453.1_Missense_Mutation_p.R624Q|DYNC1I2_ENST00000409197.1_Missense_Mutation_p.R599Q	NM_001378.1	NP_001369.1	Q13409	DC1I2_HUMAN	dynein, cytoplasmic 1, intermediate chain 2	625					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|G2/M transition of mitotic cell cycle (GO:0000086)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic cell cycle (GO:0000278)|transport (GO:0006810)|viral process (GO:0016032)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|cytosol (GO:0005829)|microtubule (GO:0005874)|vesicle (GO:0031982)	microtubule motor activity (GO:0003777)			breast(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(2)|ovary(1)	15			OV - Ovarian serous cystadenocarcinoma(117;0.198)			AATGCAAACCGAGCTGATGCA	0.443																																																	0													58.0	54.0	55.0					2																	172604356		1873	4103	5976	SO:0001583	missense	1781			AK055491	CCDS46450.1, CCDS63054.1, CCDS63056.1, CCDS63057.1	2q31.1	2013-01-10	2005-11-24	2005-11-24	ENSG00000077380	ENSG00000077380		"""Cytoplasmic dyneins"", ""WD repeat domain containing"""	2964	protein-coding gene	gene with protein product		603331	"""dynein, cytoplasmic, intermediate polypeptide 2"""	DNCI2		10049579, 16260502	Standard	NM_001378		Approved		uc002uha.2	Q13409	OTTHUMG00000154061	ENST00000397119.3:c.1874G>A	2.37:g.172604356G>A	ENSP00000380308:p.Arg625Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZA04|D3DPD4|D3DPD5|D3DPD6|Q32LY9|Q53S84|Q5BJF8|Q7Z4X1|Q96NG7|Q96S87|Q9BXZ5|Q9NT58	Missense_Mutation	SNP	pfam_Dynein_IC_1/2,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.R625Q	ENST00000397119.3	37	c.1874	CCDS46450.1	2	.	.	.	.	.	.	.	.	.	.	G	15.90	2.970313	0.53614	.	.	ENSG00000077380	ENST00000340296;ENST00000534253;ENST00000263811;ENST00000397119;ENST00000410079;ENST00000508530;ENST00000409197;ENST00000409317;ENST00000409773;ENST00000409453;ENST00000358002	T;T;T;T;T;T;T;T;T;T;T	0.75367	-0.77;-0.93;-0.77;-0.7;-0.55;-0.55;-0.77;-0.77;-0.7;-0.56;-0.55	5.75	5.75	0.90469	.	0.000000	0.85682	D	0.000000	T	0.72203	0.3431	N	0.05124	-0.11	0.80722	D	1	D;D;D;D;D	0.71674	0.994;0.994;0.997;0.997;0.998	P;P;D;D;D	0.66847	0.885;0.885;0.947;0.947;0.945	T	0.70659	-0.4811	10	0.16896	T	0.51	-8.2044	19.9478	0.97189	0.0:0.0:1.0:0.0	.	348;617;598;599;625	B4DX93;B7ZA04;Q13409-6;Q13409-3;Q13409	.;.;.;.;DC1I2_HUMAN	Q	599;625;619;625;617;598;599;619;625;624;617	ENSP00000339430:R599Q;ENSP00000433791:R625Q;ENSP00000263811:R619Q;ENSP00000380308:R625Q;ENSP00000386522:R617Q;ENSP00000423339:R598Q;ENSP00000386397:R599Q;ENSP00000386591:R619Q;ENSP00000386415:R625Q;ENSP00000386886:R624Q;ENSP00000350692:R617Q	ENSP00000263811:R619Q	R	+	2	0	DYNC1I2	172312602	1.000000	0.71417	1.000000	0.80357	0.981000	0.71138	9.504000	0.97986	2.712000	0.92718	0.591000	0.81541	CGA	DYNC1I2	-	NULL		0.443	DYNC1I2-001	KNOWN	alternative_5_UTR|basic|CCDS	protein_coding	DYNC1I2	HGNC	protein_coding	OTTHUMT00000333683.2	G	NM_001378		172604356	+1	no_errors	ENST00000397119	ensembl	human	known	70_37	missense	SNP	1.000	A
ENOX1	55068	genome.wustl.edu	37	13	43843680	43843680	+	Missense_Mutation	SNP	T	T	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr13:43843680T>G	ENST00000261488.6	-	13	2057	c.1480A>C	c.(1480-1482)Aaa>Caa	p.K494Q	ENOX1_ENST00000412891.1_Missense_Mutation_p.K494Q	NM_001242863.1|NM_017993.3	NP_001229792.1|NP_060463.2	Q8TC92	ENOX1_HUMAN	ecto-NOX disulfide-thiol exchanger 1	494					rhythmic process (GO:0048511)	extracellular region (GO:0005576)|plasma membrane (GO:0005886)	nucleic acid binding (GO:0003676)|nucleotide binding (GO:0000166)|oxidoreductase activity (GO:0016491)			breast(1)|endometrium(3)|large_intestine(7)|lung(18)|pancreas(2)|prostate(1)|skin(1)|urinary_tract(1)	34		Lung NSC(96;0.000518)|Prostate(109;0.0233)|Hepatocellular(98;0.0268)|Lung SC(185;0.0367)|Breast(139;0.0406)		GBM - Glioblastoma multiforme(144;0.00333)|BRCA - Breast invasive adenocarcinoma(63;0.172)		TCTGACTTTTTGTTGTTTAAC	0.368																																																	0													310.0	255.0	273.0					13																	43843680		2203	4300	6503	SO:0001583	missense	55068			EF432052	CCDS9389.1	13q14.11	2013-02-12			ENSG00000120658	ENSG00000120658		"""RNA binding motif (RRM) containing"""	25474	protein-coding gene	gene with protein product		610914				11360993	Standard	NM_001127615		Approved	FLJ10094, PIG38, CNOX, cCNOX	uc001uza.4	Q8TC92	OTTHUMG00000016818	ENST00000261488.6:c.1480A>C	13.37:g.43843680T>G	ENSP00000261488:p.Lys494Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A4GU15|A6NMH9|B7Z5K1|Q2TU81|Q5VT11|Q9NWE0	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K494Q	ENST00000261488.6	37	c.1480	CCDS9389.1	13	.	.	.	.	.	.	.	.	.	.	T	16.14	3.040241	0.55003	.	.	ENSG00000120658	ENST00000261488;ENST00000412891	T;T	0.51071	0.72;0.72	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.63861	0.2547	L	0.55834	1.745	0.80722	D	1	D	0.71674	0.998	D	0.78314	0.991	T	0.59579	-0.7428	10	0.30078	T	0.28	-15.8651	16.4159	0.83738	0.0:0.0:0.0:1.0	.	494	Q8TC92	ENOX1_HUMAN	Q	494	ENSP00000261488:K494Q;ENSP00000415054:K494Q	ENSP00000261488:K494Q	K	-	1	0	ENOX1	42741680	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.245000	0.65405	2.279000	0.76181	0.533000	0.62120	AAA	ENOX1	-	NULL		0.368	ENOX1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENOX1	HGNC	protein_coding	OTTHUMT00000044717.2	T	NM_017993		43843680	-1	no_errors	ENST00000261488	ensembl	human	known	70_37	missense	SNP	1.000	G
PGS1	9489	genome.wustl.edu	37	17	76396041	76396041	+	Intron	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:76396041C>T	ENST00000262764.6	+	5	727				SNORA30_ENST00000363193.1_RNA|PGS1_ENST00000588281.1_Intron|PGS1_ENST00000329897.7_Intron	NM_024419.3	NP_077733.3	Q32NB8	PGPS1_HUMAN	phosphatidylglycerophosphate synthase 1						cardiolipin biosynthetic process (GO:0032049)|diacylglycerol metabolic process (GO:0046339)|glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylglycerol biosynthetic process (GO:0006655)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|CDP-diacylglycerol-glycerol-3-phosphate 3-phosphatidyltransferase activity (GO:0008444)			cervix(2)|endometrium(1)|large_intestine(1)|lung(3)|prostate(1)|skin(1)|urinary_tract(1)	10			BRCA - Breast invasive adenocarcinoma(99;0.00144)|OV - Ovarian serous cystadenocarcinoma(97;0.031)			GCCCTCCCCTCGGCAGTGGGG	0.532																																					Esophageal Squamous(45;182 1126 10685 43198)												0																																										SO:0001627	intron_variant	0				CCDS42391.1	17q25.3	2006-02-09							30029	protein-coding gene	gene with protein product		614942				9880566	Standard	XR_243691		Approved	DKFZP762M186	uc002jvm.3	Q32NB8		ENST00000262764.6:c.701+423C>T	17.37:g.76396041C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZA32|Q8IYK9|Q8TA85|Q96A75|Q9H7G9|Q9NPW7	RNA	SNP	-	NULL	ENST00000262764.6	37	NULL	CCDS42391.1	17																																																																																			SNORA30	-	-		0.532	PGS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000200063	RFAM	protein_coding	OTTHUMT00000437301.1	C	NM_024419		76396041	+1	no_errors	ENST00000363193	ensembl	human	novel	70_37	rna	SNP	0.000	T
LOC102724776	102724776	genome.wustl.edu	37	4	156302323	156302323	+	RNA	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:156302323G>A	ENST00000596165.1	+	0	559																											TATATCAACAGATAGGAGGTT	0.408																																																	0																																												0																															4.37:g.156302323G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Splice_Site	SNP	-	NULL	ENST00000596165.1	37	c.NULL		4																																																																																			AC097467.2	-	-		0.408	AC097467.2-020	KNOWN	basic	antisense	ENSG00000250910	Clone_based_vega_gene	antisense	OTTHUMT00000461403.1	G			156302323	+1	no_errors	ENST00000596165	ensembl	human	known	70_37	splice_site	SNP	1.000	A
SCG3	29106	genome.wustl.edu	37	15	51987959	51987960	+	Intron	INS	-	-	A	rs78233272|rs370571693		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:51987959_51987960insA	ENST00000220478.3	+	8	1271				RP11-313P18.2_ENST00000559918.1_lincRNA|SCG3_ENST00000542355.2_Intron	NM_013243.3	NP_037375.2	Q8WXD2	SCG3_HUMAN	secretogranin III						blood coagulation (GO:0007596)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)	extracellular region (GO:0005576)|membrane (GO:0016020)|secretory granule lumen (GO:0034774)	poly(A) RNA binding (GO:0044822)			breast(1)|large_intestine(3)|lung(12)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	21				all cancers(107;0.00488)		cctcgtctttgaaaaaaaaaaa	0.401																																																	0																																										SO:0001627	intron_variant	0			AF078851	CCDS10142.1, CCDS53947.1	15q21.2	2013-09-23			ENSG00000104112	ENSG00000104112			13707	protein-coding gene	gene with protein product		611796				2053134, 8825061	Standard	NM_013243		Approved	SGIII, FLJ90833	uc002abh.3	Q8WXD2	OTTHUMG00000131748	ENST00000220478.3:c.869-112->A	15.37:g.51987970_51987970dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2B0|B3KQP6|B4DK99|F5H3R8|Q96C83|Q96GE8|Q9Y6G7	RNA	INS	-	NULL	ENST00000220478.3	37	NULL	CCDS10142.1	15																																																																																			RP11-313P18.2	-	-		0.401	SCG3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000259241	Clone_based_vega_gene	protein_coding	OTTHUMT00000254670.2	-	NM_013243		51987960	-1	no_errors	ENST00000559918	ensembl	human	known	70_37	rna	INS	0.003:0.006	A
SCN8A	6334	genome.wustl.edu	37	12	52204038	52204039	+	3'UTR	INS	-	-	A	rs74092804|rs11833203|rs201910276	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:52204038_52204039insA	ENST00000354534.6	+	0	8946_8947				AC068987.1_ENST00000599343.1_Frame_Shift_Ins_p.LK27fs|RP11-923I11.3_ENST00000565518.1_lincRNA	NM_001177984.2|NM_014191.3	NP_001171455.1|NP_055006.1	Q9UQD0	SCN8A_HUMAN	sodium channel, voltage gated, type VIII, alpha subunit						adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|membrane depolarization during action potential (GO:0086010)|muscle organ development (GO:0007517)|myelination (GO:0042552)|nervous system development (GO:0007399)|neuromuscular process (GO:0050905)|neuronal action potential (GO:0019228)|peripheral nervous system development (GO:0007422)|response to toxic substance (GO:0009636)|sensory perception of sound (GO:0007605)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|cytoplasmic vesicle (GO:0031410)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	ATP binding (GO:0005524)|voltage-gated sodium channel activity (GO:0005248)			breast(2)|central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(7)|lung(19)|ovary(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	55				BRCA - Breast invasive adenocarcinoma(357;0.181)	Valproic Acid(DB00313)	TTTCACTTTTTAAAAAAAAAAT	0.475																																																	0																																										SO:0001624	3_prime_UTR_variant	0			AB027567	CCDS44891.1, CCDS53794.1	12q13.1	2012-02-26	2007-01-23			ENSG00000196876		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10596	protein-coding gene	gene with protein product		600702	"""sodium channel, voltage gated, type VIII, alpha polypeptide"""	MED		7670495, 9828131, 16382098	Standard	NM_014191		Approved	Nav1.6, NaCh6, PN4, CerIII	uc001ryw.4	Q9UQD0		ENST00000354534.6:c.*2826->A	12.37:g.52204048_52204048dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B9VWG8|O95788|Q9NYX2|Q9UPB2	RNA	INS	-	NULL	ENST00000354534.6	37	NULL	CCDS44891.1	12																																																																																			RP11-923I11.1	-	-		0.475	SCN8A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000260415	Clone_based_vega_gene	protein_coding	OTTHUMT00000404372.3	-	NM_014191		52204039	+1	no_errors	ENST00000562518	ensembl	human	known	70_37	rna	INS	0.000:0.001	A
LPIN2	9663	genome.wustl.edu	37	18	2946312	2946312	+	Intron	SNP	G	G	A	rs563753432		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr18:2946312G>A	ENST00000261596.4	-	4	829				RP11-737O24.2_ENST00000584431.1_RNA|RP11-737O24.3_ENST00000581139.1_RNA|RP11-737O24.2_ENST00000581488.1_RNA	NM_014646.2	NP_055461.1	Q92539	LPIN2_HUMAN	lipin 2						cellular lipid metabolic process (GO:0044255)|dephosphorylation (GO:0016311)|fatty acid metabolic process (GO:0006631)|glycerophospholipid biosynthetic process (GO:0046474)|lipid metabolic process (GO:0006629)|phosphatidylcholine biosynthetic process (GO:0006656)|phosphatidylethanolamine biosynthetic process (GO:0006646)|phospholipid metabolic process (GO:0006644)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)|triglyceride biosynthetic process (GO:0019432)	cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|nucleus (GO:0005634)	phosphatidate phosphatase activity (GO:0008195)|transcription coactivator activity (GO:0003713)			autonomic_ganglia(1)|breast(1)|endometrium(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(1)	29				READ - Rectum adenocarcinoma(2;0.0419)|Colorectal(6;0.156)		TTGACCTCAGGTTTGACTGGC	0.398													G|||	1	0.000199681	0.0	0.0014	5008	,	,		19957	0.0		0.0	False		,,,				2504	0.0																0																																										SO:0001627	intron_variant	0			D87436	CCDS11829.1	18p	2014-09-17			ENSG00000101577	ENSG00000101577			14450	protein-coding gene	gene with protein product		605519				11138012, 9039502	Standard	NM_014646		Approved	KIAA0249	uc002klo.3	Q92539	OTTHUMG00000131508	ENST00000261596.4:c.590+4740C>T	18.37:g.2946312G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD25|D3DUH3	RNA	SNP	-	NULL	ENST00000261596.4	37	NULL	CCDS11829.1	18																																																																																			RP11-737O24.3	-	-		0.398	LPIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000263606	Clone_based_vega_gene	protein_coding	OTTHUMT00000254363.2	G	NM_014646		2946312	-1	no_errors	ENST00000581139	ensembl	human	known	70_37	rna	SNP	1.000	A
AC010543.1	0	genome.wustl.edu	37	16	57908380	57908381	+	RNA	INS	-	-	A	rs57339735	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr16:57908380_57908381insA	ENST00000580935.1	-	0	53_54																											tacttaagcttaaaaaaaaaaa	0.307																																																	0																																												0																															16.37:g.57908391_57908391dupA		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	INS	-	NULL	ENST00000580935.1	37	NULL		16																																																																																			AC010543.1	-	-		0.307	AC010543.1-201	NOVEL	basic	miRNA	ENSG00000265209	Clone_based_ensembl_gene	miRNA		-			57908381	-1	no_errors	ENST00000580935	ensembl	human	novel	70_37	rna	INS	0.000:0.000	A
FAM50A	9130	genome.wustl.edu	37	X	153677568	153677568	+	Splice_Site	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chrX:153677568G>A	ENST00000393600.3	+	8	758		c.e8-1			NM_004699.3	NP_004690.1	Q14320	FA50A_HUMAN	family with sequence similarity 50, member A						spermatogenesis (GO:0007283)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)			breast(2)|central_nervous_system(1)|lung(9)|ovary(2)|skin(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCCGGATACAGATGAGAAAGG	0.592																																																	0													143.0	120.0	128.0					X																	153677568		2203	4300	6503	SO:0001630	splice_region_variant	9130			BC000028	CCDS14751.1	Xq28	2008-02-05			ENSG00000071859	ENSG00000071859			18786	protein-coding gene	gene with protein product	"""DNA segment on chromosome X (unique) 9928 expressed sequence"""	300453				9339379, 9039504	Standard	NM_004699		Approved	DXS9928E, XAP5, HXC-26, 9F	uc004fll.4	Q14320	OTTHUMG00000033292	ENST00000393600.3:c.649-1G>A	X.37:g.153677568G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAQ4|B2R997|Q5HY37|Q6PJH5	Splice_Site	SNP	-	e8-1	ENST00000393600.3	37	c.649-1	CCDS14751.1	X	.	.	.	.	.	.	.	.	.	.	G	12.17	1.856858	0.32791	.	.	ENSG00000071859	ENST00000393600;ENST00000158526	.	.	.	5.01	5.01	0.66863	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	16.3012	0.82816	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	FAM50A	153330762	1.000000	0.71417	0.915000	0.36163	0.080000	0.17528	7.159000	0.77483	2.189000	0.69895	0.600000	0.82982	.	FAM50A	-	-		0.592	FAM50A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM50A	HGNC	protein_coding	OTTHUMT00000081643.2	G	NM_004699	Intron	153677568	+1	no_errors	ENST00000393600	ensembl	human	known	70_37	splice_site	SNP	1.000	A
FCGRT	2217	genome.wustl.edu	37	19	50028011	50028011	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:50028011G>A	ENST00000221466.5	+	5	1335	c.849G>A	c.(847-849)gcG>gcA	p.A283A	FCGRT_ENST00000596975.1_Silent_p.A191A|FCGRT_ENST00000599988.1_Intron|RCN3_ENST00000270645.3_5'Flank|FCGRT_ENST00000426395.3_Silent_p.A283A	NM_001136019.2	NP_001129491.1	P55899	FCGRN_HUMAN	Fc fragment of IgG, receptor, transporter, alpha	283	Alpha-3.|Ig-like C1-type.				antigen processing and presentation (GO:0019882)|IgG immunoglobulin transcytosis in epithelial cells mediated by FcRn immunoglobulin receptor (GO:0002416)|immune response (GO:0006955)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	IgG binding (GO:0019864)			endometrium(3)|kidney(2)|lung(1)|ovary(1)|prostate(1)|skin(1)	9		all_lung(116;7.84e-06)|Lung NSC(112;2.8e-05)|all_neural(266;0.0966)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.00291)|GBM - Glioblastoma multiforme(134;0.0156)		CGGGGCTGGCGCAGCCCCTCA	0.627																																																	0													33.0	29.0	31.0					19																	50028011		2203	4300	6503	SO:0001819	synonymous_variant	2217			U12255	CCDS12770.1	19q13.3	2013-01-11				ENSG00000104870		"""Immunoglobulin superfamily / C1-set domain containing"""	3621	protein-coding gene	gene with protein product		601437				7964511, 8646894	Standard	NM_001136019		Approved	FCRN, alpha-chain	uc002pog.2	P55899		ENST00000221466.5:c.849G>A	19.37:g.50028011G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5HYM5|Q9HBV7|Q9NZ19	Silent	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.A283	ENST00000221466.5	37	c.849	CCDS12770.1	19																																																																																			FCGRT	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like		0.627	FCGRT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGRT	HGNC	protein_coding	OTTHUMT00000465267.1	G			50028011	+1	no_errors	ENST00000221466	ensembl	human	known	70_37	silent	SNP	0.110	A
FHDC1	85462	genome.wustl.edu	37	4	153896449	153896449	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:153896449G>A	ENST00000511601.1	+	12	2194	c.2006G>A	c.(2005-2007)gGa>gAa	p.G669E	FHDC1_ENST00000260008.3_Missense_Mutation_p.G669E			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	669								p.G669K(1)	ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TTGGCTCTGGGAATTAAGGAG	0.617																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											36.0	38.0	37.0					4																	153896449		2203	4300	6503	SO:0001583	missense	85462			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2006G>A	4.37:g.153896449G>A	ENSP00000427567:p.Gly669Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.G669E	ENST00000511601.1	37	c.2006	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	G	9.835	1.189414	0.21954	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.30714	1.52;1.52	5.29	4.44	0.53790	.	0.671525	0.14905	N	0.291569	T	0.20210	0.0486	L	0.41824	1.3	0.22489	N	0.999052	P	0.39480	0.675	B	0.31442	0.13	T	0.08973	-1.0696	10	0.30078	T	0.28	.	8.2534	0.31739	0.088:0.295:0.617:0.0	.	669	Q9C0D6	FHDC1_HUMAN	E	669	ENSP00000427567:G669E;ENSP00000260008:G669E	ENSP00000260008:G669E	G	+	2	0	FHDC1	154115899	0.995000	0.38212	0.920000	0.36463	0.665000	0.39181	2.431000	0.44775	2.622000	0.88805	0.563000	0.77884	GGA	FHDC1	-	NULL		0.617	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	G	NM_033393		153896449	+1	no_errors	ENST00000260008	ensembl	human	known	70_37	missense	SNP	0.407	A
FHDC1	85462	genome.wustl.edu	37	4	153896463	153896463	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:153896463G>A	ENST00000511601.1	+	12	2208	c.2020G>A	c.(2020-2022)Gag>Aag	p.E674K	FHDC1_ENST00000260008.3_Missense_Mutation_p.E674K			Q9C0D6	FHDC1_HUMAN	FH2 domain containing 1	674									ARFIP1/FHDC1(2)	NS(2)|breast(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(7)|liver(2)|lung(14)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	43	all_hematologic(180;0.093)					TAAGGAGCATGAGCTGGTGAC	0.607																																																	0													38.0	41.0	40.0					4																	153896463		2203	4300	6503	SO:0001583	missense	85462			AB051514	CCDS34081.1	4q31.3	2014-02-12	2007-11-29		ENSG00000137460	ENSG00000137460			29363	protein-coding gene	gene with protein product						15138637	Standard	NM_033393		Approved	KIAA1727	uc003inf.2	Q9C0D6	OTTHUMG00000161452	ENST00000511601.1:c.2020G>A	4.37:g.153896463G>A	ENSP00000427567:p.Glu674Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg	p.E674K	ENST00000511601.1	37	c.2020	CCDS34081.1	4	.	.	.	.	.	.	.	.	.	.	G	17.77	3.470028	0.63625	.	.	ENSG00000137460	ENST00000511601;ENST00000260008	T;T	0.35236	1.32;1.32	5.29	5.29	0.74685	.	0.617484	0.16289	N	0.220980	T	0.38692	0.1050	L	0.55990	1.75	0.58432	D	0.999997	P	0.48503	0.911	B	0.39840	0.311	T	0.39702	-0.9601	10	0.49607	T	0.09	.	19.3156	0.94211	0.0:0.0:1.0:0.0	.	674	Q9C0D6	FHDC1_HUMAN	K	674	ENSP00000427567:E674K;ENSP00000260008:E674K	ENSP00000260008:E674K	E	+	1	0	FHDC1	154115913	1.000000	0.71417	0.946000	0.38457	0.852000	0.48524	3.493000	0.53266	2.622000	0.88805	0.563000	0.77884	GAG	FHDC1	-	NULL		0.607	FHDC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FHDC1	HGNC	protein_coding	OTTHUMT00000364981.2	G	NM_033393		153896463	+1	no_errors	ENST00000260008	ensembl	human	known	70_37	missense	SNP	0.998	A
FRMPD2	143162	genome.wustl.edu	37	10	49400875	49400875	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr10:49400875G>A	ENST00000374201.3	-	16	2319	c.2017C>T	c.(2017-2019)Ctc>Ttc	p.L673F	FRMPD2_ENST00000305531.3_Missense_Mutation_p.L648F|FRMPD2_ENST00000407470.4_Missense_Mutation_p.L641F	NM_001018071.3|NM_001042512.2	NP_001018081|NP_001035977.2	Q68DX3	FRPD2_HUMAN	FERM and PDZ domain containing 2	673					tight junction assembly (GO:0070830)	basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|tight junction (GO:0005923)	1-phosphatidylinositol binding (GO:0005545)			NS(2)|autonomic_ganglia(2)|breast(5)|cervix(1)|endometrium(3)|kidney(7)|large_intestine(15)|lung(24)|ovary(2)|prostate(1)|skin(3)|urinary_tract(1)	66				Kidney(211;0.201)		ATCCAAATGAGAGGCTTAGAC	0.458																																																	0													95.0	89.0	91.0					10																	49400875		2203	4300	6503	SO:0001583	missense	143162			AK123038	CCDS31195.1	10q11	2010-10-13			ENSG00000170324	ENSG00000170324			28572	protein-coding gene	gene with protein product		613323	"""PDZ domain containing 5C"""	PDZD5C, PDZK5C			Standard	NM_001018071		Approved	MGC35285	uc001jdv.3	Q68DX3	OTTHUMG00000018171	ENST00000374201.3:c.2017C>T	10.37:g.49400875G>A	ENSP00000363317:p.Leu673Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B7WNW0|B7ZML5|Q2VY07|Q6GMQ9|Q6ZN38|Q6ZWI2|Q8N5T9	Missense_Mutation	SNP	pfam_PDZ,pfam_FERM_central,pfam_FERM_PH-like_C,pfam_FERM_N,superfamily_PDZ,superfamily_FERM_central,superfamily_Kinase-like_dom,smart_KIND,smart_Band_41_domain,smart_PDZ,pfscan_FERM_domain,pfscan_PDZ,prints_Band_41_fam	p.L673F	ENST00000374201.3	37	c.2017	CCDS31195.1	10	.	.	.	.	.	.	.	.	.	.	G	8.314	0.822851	0.16678	.	.	ENSG00000170324	ENST00000374201;ENST00000305531;ENST00000407470	D;D;D	0.82619	-1.63;-1.63;-1.63	4.7	1.65	0.23941	.	.	.	.	.	T	0.81870	0.4914	L	0.47716	1.5	0.09310	N	1	P;P;P	0.51351	0.944;0.89;0.944	P;B;P	0.53722	0.733;0.367;0.733	T	0.69165	-0.5217	9	0.20519	T	0.43	.	9.3648	0.38217	0.0:0.2947:0.5528:0.1525	.	648;673;641	Q68DX3-2;Q68DX3;F8WCT2	.;FRPD2_HUMAN;.	F	673;648;641	ENSP00000363317:L673F;ENSP00000307079:L648F;ENSP00000384339:L641F	ENSP00000307079:L648F	L	-	1	0	FRMPD2	49070881	0.993000	0.37304	0.001000	0.08648	0.626000	0.37791	1.478000	0.35442	0.118000	0.18165	0.655000	0.94253	CTC	FRMPD2	-	NULL		0.458	FRMPD2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRMPD2	HGNC	protein_coding	OTTHUMT00000047923.3	G	NM_152428		49400875	-1	no_errors	ENST00000374201	ensembl	human	known	70_37	missense	SNP	0.004	A
GDPD1	284161	genome.wustl.edu	37	17	57322867	57322867	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:57322867G>A	ENST00000284116.4	+	3	415	c.278G>A	c.(277-279)aGa>aAa	p.R93K	GDPD1_ENST00000581140.1_Missense_Mutation_p.R93K|GDPD1_ENST00000581276.1_Missense_Mutation_p.R93K	NM_182569.3	NP_872375.2	Q8N9F7	GDPD1_HUMAN	glycerophosphodiester phosphodiesterase domain containing 1	93	GP-PDE.				glycerol metabolic process (GO:0006071)|lipid metabolic process (GO:0006629)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glycerophosphodiester phosphodiesterase activity (GO:0008889)|metal ion binding (GO:0046872)			endometrium(1)|kidney(1)|liver(1)|lung(2)|upper_aerodigestive_tract(1)	6	all_neural(34;0.0837)|Medulloblastoma(34;0.0922)					AATCTAAAGAGAGCAACTGGG	0.358																																																	0													97.0	83.0	88.0					17																	57322867		2203	4300	6503	SO:0001583	missense	284161			AK094770	CCDS11616.1, CCDS58583.1, CCDS58584.1	17q23.2	2011-01-25				ENSG00000153982			20883	protein-coding gene	gene with protein product						14612981	Standard	NM_182569		Approved	FLJ37451, GDE4	uc002ixk.2	Q8N9F7		ENST00000284116.4:c.278G>A	17.37:g.57322867G>A	ENSP00000284116:p.Arg93Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8W735|Q56VR1|Q8N4E3	Missense_Mutation	SNP	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl	p.R93K	ENST00000284116.4	37	c.278	CCDS11616.1	17	.	.	.	.	.	.	.	.	.	.	G	16.94	3.259842	0.59321	.	.	ENSG00000153982	ENST00000284116	T	0.19394	2.15	5.41	5.41	0.78517	PLC-like phosphodiesterase, TIM beta/alpha-barrel domain (2);	0.000000	0.85682	D	0.000000	T	0.56775	0.2008	M	0.91972	3.26	0.58432	D	0.999999	D;D	0.89917	1.0;1.0	D;D	0.81914	0.995;0.992	T	0.67051	-0.5768	10	0.87932	D	0	.	17.8214	0.88651	0.0:0.0:1.0:0.0	.	93;93	Q8N9F7;Q8N9F7-2	GDPD1_HUMAN;.	K	93	ENSP00000284116:R93K	ENSP00000284116:R93K	R	+	2	0	GDPD1	54677649	1.000000	0.71417	1.000000	0.80357	0.960000	0.62799	8.153000	0.89640	2.552000	0.86080	0.485000	0.47835	AGA	GDPD1	-	pfam_GlyceroP-diester-Pdiesterase,superfamily_PLC-like_Pdiesterase_TIM-brl		0.358	GDPD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GDPD1	HGNC	protein_coding	OTTHUMT00000446024.1	G	NM_182569		57322867	+1	no_errors	ENST00000284116	ensembl	human	known	70_37	missense	SNP	1.000	A
GJB5	2709	genome.wustl.edu	37	1	35222961	35222961	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:35222961G>A	ENST00000338513.1	+	2	203	c.30G>A	c.(28-30)ctG>ctA	p.L10L	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	10					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				AGGGACTCCTGAGTGGGGTCA	0.532																																																	0													93.0	85.0	88.0					1																	35222961		2203	4300	6503	SO:0001819	synonymous_variant	2709			BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.30G>A	1.37:g.35222961G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UPA3	Silent	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin311	p.L10	ENST00000338513.1	37	c.30	CCDS382.1	1																																																																																			GJB5	-	pfam_Connexin_N		0.532	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB5	HGNC	protein_coding	OTTHUMT00000011561.1	G	NM_005268		35222961	+1	no_errors	ENST00000338513	ensembl	human	known	70_37	silent	SNP	0.942	A
GOLGA8A	23015	genome.wustl.edu	37	15	34677517	34677517	+	Missense_Mutation	SNP	G	G	A	rs3179271	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:34677517G>A	ENST00000359187.4	-	6	459	c.395C>T	c.(394-396)aCa>aTa	p.T132I	GOLGA8A_ENST00000432566.2_Missense_Mutation_p.T162I|GOLGA8A_ENST00000360553.3_Missense_Mutation_p.T132I|GOLGA8A_ENST00000543376.1_5'UTR	NM_181077.3	NP_851422.1	A7E2F4	GOG8A_HUMAN	golgin A8 family, member A	160						Golgi apparatus (GO:0005794)|membrane (GO:0016020)							all_lung(180;2.78e-08)		all cancers(64;8.27e-19)|GBM - Glioblastoma multiforme(113;6.98e-08)|BRCA - Breast invasive adenocarcinoma(123;0.0156)		CTTTTTCTCTGTGTTCAATCT	0.443													g|||	1236	0.246805	0.205	0.3473	5008	,	,		19221	0.1677		0.2594	False		,,,				2504	0.3006																0													1.0	1.0	1.0					15																	34677517		70	330	400	SO:0001583	missense	23015			BX648160	CCDS10038.1	15q14	2011-10-25	2010-02-12		ENSG00000175265	ENSG00000175265			31972	protein-coding gene	gene with protein product			"""golgi autoantigen, golgin subfamily a, 8A"""			10660574, 10677249	Standard	NM_181077		Approved	GM88, GOLGIN-67	uc001zii.3	A7E2F4	OTTHUMG00000129447	ENST00000359187.4:c.395C>T	15.37:g.34677517G>A	ENSP00000352111:p.Thr132Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MCY9|B7ZMK5|O94937|Q52M46|Q68DK6|Q9NZG8|Q9NZW0|Q9NZW3	Missense_Mutation	SNP	NULL	p.T162I	ENST00000359187.4	37	c.485	CCDS10038.1	15	.	.	.	.	.	.	.	.	.	.	g	0.003	-2.523871	0.00149	.	.	ENSG00000175265	ENST00000359187;ENST00000360553;ENST00000432566	T;T;T	0.12255	2.7;2.7;2.7	0.379	0.379	0.16213	.	.	.	.	.	T	0.03136	0.0092	N	0.00823	-1.155	0.09310	N	0.999999	B	0.06786	0.001	B	0.06405	0.002	T	0.41124	-0.9526	8	0.22109	T	0.4	.	.	.	.	.	132	A7E2F4-3	.	I	132;132;162	ENSP00000352111:T132I;ENSP00000353755:T132I;ENSP00000402791:T162I	ENSP00000352111:T132I	T	-	2	0	GOLGA8A	32464809	0.063000	0.20901	0.001000	0.08648	0.020000	0.10135	-0.265000	0.08644	-0.886000	0.03966	-1.451000	0.01035	ACA	GOLGA8A	-	NULL		0.443	GOLGA8A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GOLGA8A	HGNC	protein_coding	OTTHUMT00000251830.2	G	NM_181076		34677517	-1	no_errors	ENST00000432566	ensembl	human	known	70_37	missense	SNP	0.001	A
GOLT1B	51026	genome.wustl.edu	37	12	21668831	21668831	+	3'UTR	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:21668831G>A	ENST00000229314.5	+	0	716				GOLT1B_ENST00000535593.1_3'UTR|GOLT1B_ENST00000542038.1_3'UTR|GOLT1B_ENST00000540141.1_3'UTR	NM_016072.4	NP_057156.1	Q9Y3E0	GOT1B_HUMAN	golgi transport 1B						positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein transport (GO:0015031)|signal transduction (GO:0007165)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	signal transducer activity (GO:0004871)			large_intestine(2)|lung(3)	5						CTACTCAAGTGAACTAAGAAG	0.368																																																	0																																										SO:0001624	3_prime_UTR_variant	51026			AB097020	CCDS8689.1	12p13.1	2010-06-24	2010-06-24		ENSG00000111711	ENSG00000111711			20175	protein-coding gene	gene with protein product		615078	"""golgi transport 1 homolog B (S. cerevisiae)"""			12414650, 10810093	Standard	NM_016072		Approved	CGI-141, YMR292W, GOT1	uc001rez.2	Q9Y3E0	OTTHUMG00000169133	ENST00000229314.5:c.*190G>A	12.37:g.21668831G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4R4|Q54A40|Q6I9W6|Q9P1R9	RNA	SNP	-	NULL	ENST00000229314.5	37	NULL	CCDS8689.1	12																																																																																			GOLT1B	-	-		0.368	GOLT1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GOLT1B	HGNC	protein_coding	OTTHUMT00000402384.2	G	NM_016072		21668831	+1	no_errors	ENST00000535593	ensembl	human	known	70_37	rna	SNP	0.003	A
GPR114	221188	genome.wustl.edu	37	16	57608854	57608854	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr16:57608854G>A	ENST00000340339.4	+	11	1859	c.1336G>A	c.(1336-1338)Gat>Aat	p.D446N	GPR114_ENST00000394361.4_3'UTR|GPR114_ENST00000349457.3_Missense_Mutation_p.D446N	NM_153837.1	NP_722579.1	Q8IZF4	GP114_HUMAN	G protein-coupled receptor 114	446					G-protein coupled receptor signaling pathway (GO:0007186)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(1)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(3)|large_intestine(5)|lung(5)|ovary(2)|stomach(1)|urinary_tract(1)	23						GGAGCGGGCGGATGCACCAAG	0.652																																																	0													73.0	57.0	63.0					16																	57608854		2198	4300	6498	SO:0001583	missense	221188			AY140956	CCDS10785.1	16q13	2014-08-08			ENSG00000159618	ENSG00000159618		"""-"", ""GPCR / Class B : Orphans"""	19010	protein-coding gene	gene with protein product						12435584	Standard	NM_153837		Approved	PGR27	uc002ely.3	Q8IZF4	OTTHUMG00000133461	ENST00000340339.4:c.1336G>A	16.37:g.57608854G>A	ENSP00000342981:p.Asp446Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXZ5|Q6ZMH7|Q6ZML4|Q86SL8|Q8IZ14	Missense_Mutation	SNP	pfam_GPCR_2_secretin-like,pfam_GPS_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_GPCR_2-like,prints_GPCR_2_secretin-like,prints_GPCR_2_orphan_rcpt_GPR56	p.D446N	ENST00000340339.4	37	c.1336	CCDS10785.1	16	.	.	.	.	.	.	.	.	.	.	G	9.476	1.096945	0.20552	.	.	ENSG00000159618	ENST00000340339;ENST00000349457	T;T	0.42513	0.97;0.97	5.56	0.227	0.15359	GPCR, family 2-like (1);	1.013190	0.07902	N	0.972935	T	0.20455	0.0492	N	0.04880	-0.145	0.09310	N	1	B	0.33777	0.425	B	0.33121	0.158	T	0.18461	-1.0336	10	0.40728	T	0.16	.	5.2303	0.15418	0.3659:0.3485:0.2855:0.0	.	446	Q8IZF4	GP114_HUMAN	N	446	ENSP00000342981:D446N;ENSP00000290823:D446N	ENSP00000342981:D446N	D	+	1	0	GPR114	56166355	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.409000	0.07160	-0.254000	0.09500	0.491000	0.48974	GAT	GPR114	-	pfam_GPCR_2_secretin-like,pfscan_GPCR_2-like		0.652	GPR114-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR114	HGNC	protein_coding	OTTHUMT00000257336.3	G	NM_153837		57608854	+1	no_errors	ENST00000340339	ensembl	human	known	70_37	missense	SNP	0.000	A
GPR68	8111	genome.wustl.edu	37	14	91701285	91701285	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr14:91701285G>A	ENST00000531499.2	-	2	449	c.110C>T	c.(109-111)cCg>cTg	p.P37L	GPR68_ENST00000535815.1_Missense_Mutation_p.P37L|GPR68_ENST00000238699.3_Missense_Mutation_p.P47L|GPR68_ENST00000529300.1_5'Flank			Q15743	OGR1_HUMAN	G protein-coupled receptor 68	37					cellular response to pH (GO:0071467)|G-protein coupled receptor signaling pathway (GO:0007186)|inflammatory response (GO:0006954)|negative regulation of monocyte differentiation (GO:0045656)|positive regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0035774)|positive regulation of osteoclast development (GO:2001206)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			central_nervous_system(2)|endometrium(1)|kidney(1)|lung(2)|skin(1)|urinary_tract(1)	8		all_cancers(154;0.0555)		COAD - Colon adenocarcinoma(157;0.21)		GCAGTTGGCCGGGAAGCCCAC	0.602																																																	0													81.0	71.0	74.0					14																	91701285		2203	4300	6503	SO:0001583	missense	8111			U48405	CCDS9894.1, CCDS9894.2	14q31	2012-08-21				ENSG00000119714		"""GPCR / Class A : Orphans"""	4519	protein-coding gene	gene with protein product		601404				8661159	Standard	NM_001177676		Approved	OGR1	uc001xzg.3	Q15743		ENST00000531499.2:c.110C>T	14.37:g.91701285G>A	ENSP00000434045:p.Pro37Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13334|Q4VBB4|Q6IX34	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_OGR1_rcpt,prints_GPCR_Rhodpsn,prints_P2_purnocptor,prints_Psych_rcpt	p.P47L	ENST00000531499.2	37	c.140	CCDS9894.2	14	.	.	.	.	.	.	.	.	.	.	G	20.4	3.987342	0.74589	.	.	ENSG00000119714	ENST00000531499;ENST00000238699;ENST00000535815;ENST00000529102	T;T;T;T	0.30981	1.51;1.51;1.51;1.51	5.54	5.54	0.83059	.	0.000000	0.85682	D	0.000000	T	0.48169	0.1485	L	0.54323	1.7	0.58432	D	0.999995	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	T	0.32877	-0.9890	10	0.02654	T	1	.	19.48	0.95005	0.0:0.0:1.0:0.0	.	37;37	Q6NWR5;Q15743	.;OGR1_HUMAN	L	37;47;37;37	ENSP00000434045:P37L;ENSP00000238699:P47L;ENSP00000440797:P37L;ENSP00000432740:P37L	ENSP00000238699:P47L	P	-	2	0	GPR68	90771038	1.000000	0.71417	0.829000	0.32907	0.882000	0.50991	7.787000	0.85759	2.606000	0.88127	0.655000	0.94253	CCG	GPR68	-	pfam_7TM_GPCR_olfarory/Srsx,prints_GPCR_Rhodpsn		0.602	GPR68-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR68	HGNC	protein_coding	OTTHUMT00000395245.2	G			91701285	-1	no_errors	ENST00000238699	ensembl	human	known	70_37	missense	SNP	0.974	A
HLA-G	3135	genome.wustl.edu	37	6	29796508	29796508	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr6:29796508G>A	ENST00000360323.6	+	3	556	c.532G>A	c.(532-534)Gaa>Aaa	p.E178K	HLA-G_ENST00000376818.3_Intron|HLA-G_ENST00000376828.2_Missense_Mutation_p.E183K|HLA-G_ENST00000428701.1_Missense_Mutation_p.E178K|HLA-G_ENST00000376815.3_Intron			P17693	HLAG_HUMAN	major histocompatibility complex, class I, G	178	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cellular defense response (GO:0006968)|cytokine-mediated signaling pathway (GO:0019221)|immune response-inhibiting cell surface receptor signaling pathway (GO:0002767)|interferon-gamma-mediated signaling pathway (GO:0060333)|negative regulation of dendritic cell differentiation (GO:2001199)|negative regulation of T cell proliferation (GO:0042130)|positive regulation of interleukin-12 production (GO:0032735)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell tolerance induction (GO:0002666)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)	early endosome membrane (GO:0031901)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|membrane (GO:0016020)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)			central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(4)|ovary(3)|pancreas(1)|prostate(5)|skin(1)	21						CAATGTGGCTGAACAAAGGAG	0.632																																																	0													95.0	77.0	83.0					6																	29796508		1511	2709	4220	SO:0001583	missense	3135				CCDS4668.1	6p21.3	2013-01-11	2007-12-12		ENSG00000204632	ENSG00000204632		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4964	protein-coding gene	gene with protein product	"""b2 microglobulin"""	142871	"""HLA-G histocompatibility antigen, class I, G"""				Standard	NM_002127		Approved		uc003nnw.2	P17693	OTTHUMG00000031157	ENST00000360323.6:c.532G>A	6.37:g.29796508G>A	ENSP00000353472:p.Glu178Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.E183K	ENST00000360323.6	37	c.547	CCDS4668.1	6	.	.	.	.	.	.	.	.	.	.	.	14.09	2.431642	0.43122	.	.	ENSG00000204632	ENST00000376828;ENST00000428701;ENST00000360323	T;T;T	0.00013	9.27;9.27;9.27	1.72	-0.555	0.11807	MHC class I, alpha chain, alpha1/alpha2 (1);MHC classes I/II-like antigen recognition protein (1);MHC class I-like antigen recognition (1);	0.204203	0.22883	U	0.054482	T	0.00144	0.0004	M	0.93808	3.46	0.09310	N	1	D;D	0.76494	0.998;0.999	D;D	0.85130	0.997;0.995	T	0.40021	-0.9585	10	0.87932	D	0	.	4.3059	0.10947	0.1635:0.2342:0.6024:0.0	.	183;178	Q5RJ85;P17693	.;HLAG_HUMAN	K	183;178;178	ENSP00000366024:E183K;ENSP00000412927:E178K;ENSP00000353472:E178K	ENSP00000353472:E178K	E	+	1	0	HLA-G	29904487	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.965000	0.03829	-0.393000	0.07739	0.298000	0.19748	GAA	HLA-G	-	pfam_MHC_I_a_a1/a2		0.632	HLA-G-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-G	HGNC	protein_coding	OTTHUMT00000076286.2	G	NM_002127		29796508	+1	no_errors	ENST00000376828	ensembl	human	known	70_37	missense	SNP	0.002	A
HS3ST2	9956	genome.wustl.edu	37	16	22926815	22926815	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr16:22926815C>T	ENST00000261374.3	+	2	1470	c.1036C>T	c.(1036-1038)Cga>Tga	p.R346*		NM_006043.1	NP_006034.1	Q9Y278	HS3S2_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 2	346					carbohydrate metabolic process (GO:0005975)|circadian rhythm (GO:0007623)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 2 activity (GO:0033871)|sulfotransferase activity (GO:0008146)			breast(2)|kidney(1)|large_intestine(5)|liver(2)|lung(5)|ovary(1)|pancreas(2)|skin(1)	19				GBM - Glioblastoma multiforme(48;0.0299)		AGACCAGCTCCGAGAATTTTA	0.443																																																	0													128.0	144.0	138.0					16																	22926815		2197	4300	6497	SO:0001587	stop_gained	9956			AF105374	CCDS10606.1	16p12	2008-02-05			ENSG00000122254	ENSG00000122254	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5195	protein-coding gene	gene with protein product		604056				9988767	Standard	NM_006043		Approved	3OST2	uc002dli.3	Q9Y278	OTTHUMG00000094785	ENST00000261374.3:c.1036C>T	16.37:g.22926815C>T	ENSP00000261374:p.Arg346*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q52LZ1	Nonsense_Mutation	SNP	pfam_Sulfotransferase_dom	p.R346*	ENST00000261374.3	37	c.1036	CCDS10606.1	16	.	.	.	.	.	.	.	.	.	.	C	39	7.567708	0.98361	.	.	ENSG00000122254	ENST00000261374	.	.	.	5.2	3.12	0.35913	.	0.066107	0.64402	D	0.000013	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	8.938	0.35711	0.1471:0.775:0.0:0.0778	.	.	.	.	X	346	.	ENSP00000261374:R346X	R	+	1	2	HS3ST2	22834316	0.998000	0.40836	1.000000	0.80357	0.982000	0.71751	3.045000	0.49838	1.188000	0.43014	0.561000	0.74099	CGA	HS3ST2	-	pfam_Sulfotransferase_dom		0.443	HS3ST2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST2	HGNC	protein_coding	OTTHUMT00000211598.1	C	NM_006043		22926815	+1	no_errors	ENST00000261374	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ISOC1	51015	genome.wustl.edu	37	5	128440651	128440651	+	Silent	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:128440651C>G	ENST00000173527.5	+	2	328	c.312C>G	c.(310-312)ctC>ctG	p.L104L		NM_016048.2	NP_057132.2	Q96CN7	ISOC1_HUMAN	isochorismatase domain containing 1	104						extracellular vesicular exosome (GO:0070062)|peroxisome (GO:0005777)	catalytic activity (GO:0003824)			kidney(2)|lung(7)	9		all_cancers(142;0.0813)|Prostate(80;0.0865)	KIRC - Kidney renal clear cell carcinoma(527;0.0186)|Kidney(363;0.0365)	Epithelial(69;0.138)|OV - Ovarian serous cystadenocarcinoma(64;0.164)		TTCCTCAGCTCACTACCCTGG	0.368																																																	0													139.0	127.0	131.0					5																	128440651		1850	4111	5961	SO:0001819	synonymous_variant	51015			AF151869	CCDS43357.1	5q22.1-q33.3	2010-03-19			ENSG00000066583	ENSG00000066583			24254	protein-coding gene	gene with protein product						10810093, 18566572	Standard	NM_016048		Approved	CGI-111	uc003kva.3	Q96CN7	OTTHUMG00000163144	ENST00000173527.5:c.312C>G	5.37:g.128440651C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z770	Silent	SNP	pfam_Isochorismatase-like,superfamily_Isochorismatase-like	p.L104	ENST00000173527.5	37	c.312	CCDS43357.1	5																																																																																			ISOC1	-	superfamily_Isochorismatase-like		0.368	ISOC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ISOC1	HGNC	protein_coding	OTTHUMT00000371826.1	C	NM_016048		128440651	+1	no_errors	ENST00000173527	ensembl	human	known	70_37	silent	SNP	0.986	G
ITCH	83737	genome.wustl.edu	37	20	33026421	33026421	+	Missense_Mutation	SNP	A	A	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr20:33026421A>C	ENST00000262650.6	+	9	923	c.787A>C	c.(787-789)Acc>Ccc	p.T263P	ITCH-AS1_ENST00000454205.1_RNA|ITCH_ENST00000374864.4_Missense_Mutation_p.T222P|ITCH_ENST00000535650.1_Missense_Mutation_p.T112P			Q96J02	ITCH_HUMAN	itchy E3 ubiquitin protein ligase	263	Arg/Pro-rich (PRR domain).				apoptotic process (GO:0006915)|defense response to virus (GO:0051607)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|negative regulation of apoptotic process (GO:0043066)|negative regulation of defense response to virus (GO:0050687)|negative regulation of JNK cascade (GO:0046329)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|negative regulation of type I interferon production (GO:0032480)|Notch signaling pathway (GO:0007219)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|protein K29-linked ubiquitination (GO:0035519)|protein K48-linked ubiquitination (GO:0070936)|protein K63-linked ubiquitination (GO:0070534)|protein ubiquitination (GO:0016567)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|regulation of cell growth (GO:0001558)|regulation of protein deubiquitination (GO:0090085)|ubiquitin-dependent protein catabolic process (GO:0006511)|viral entry into host cell (GO:0046718)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	CXCR chemokine receptor binding (GO:0045236)|ligase activity (GO:0016874)|ribonucleoprotein complex binding (GO:0043021)|ubiquitin-protein transferase activity (GO:0004842)			NS(1)|breast(9)|central_nervous_system(1)|endometrium(3)|kidney(3)|large_intestine(4)|lung(13)|skin(1)|upper_aerodigestive_tract(1)	36						ACCACCACCCACCCCACGTAG	0.438																																																	0													145.0	128.0	134.0					20																	33026421		2203	4300	6503	SO:0001583	missense	83737			AF095745	CCDS13234.1, CCDS58768.1, CCDS58769.1	20q11.22	2014-09-17	2012-02-23		ENSG00000078747	ENSG00000078747			13890	protein-coding gene	gene with protein product		606409	"""itchy (mouse homolog) E3 ubiquitin protein ligase"", ""itchy E3 ubiquitin protein ligase homolog (mouse)"""			11318614	Standard	NM_001257137		Approved	AIP4	uc010geu.2	Q96J02	OTTHUMG00000032300	ENST00000262650.6:c.787A>C	20.37:g.33026421A>C	ENSP00000262650:p.Thr263Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEW4|B4E234|E1P5P3|F5H217|O43584|Q5QP37|Q5TEL0|Q96F66|Q9BY75|Q9H451|Q9H4U5	Missense_Mutation	SNP	pfam_HECT,pfam_WW_Rsp5_WWP,pfam_C2_Ca-dep,superfamily_HECT,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_WW_Rsp5_WWP,smart_C2_Ca-dep,smart_WW_Rsp5_WWP,smart_HECT,pfscan_HECT,pfscan_C2_membr_targeting,pfscan_WW_Rsp5_WWP	p.T263P	ENST00000262650.6	37	c.787	CCDS58768.1	20	.	.	.	.	.	.	.	.	.	.	A	22.5	4.294684	0.81025	.	.	ENSG00000078747	ENST00000374864;ENST00000535650;ENST00000262650	T;T;T	0.38077	1.16;1.16;1.16	5.4	5.4	0.78164	.	0.343455	0.33477	N	0.004864	T	0.47637	0.1456	L	0.32530	0.975	0.80722	D	1	D;D;B	0.89917	0.971;1.0;0.05	B;D;B	0.87578	0.441;0.998;0.046	T	0.35943	-0.9768	10	0.32370	T	0.25	.	13.6622	0.62374	1.0:0.0:0.0:0.0	.	174;263;222	B4DN85;Q96J02;Q5QP37	.;ITCH_HUMAN;.	P	222;112;263	ENSP00000363998:T222P;ENSP00000445608:T112P;ENSP00000262650:T263P	ENSP00000262650:T263P	T	+	1	0	ITCH	32490082	1.000000	0.71417	0.997000	0.53966	0.990000	0.78478	7.634000	0.83273	2.044000	0.60594	0.533000	0.62120	ACC	ITCH	-	NULL		0.438	ITCH-002	KNOWN	basic|CCDS	protein_coding	ITCH	HGNC	protein_coding	OTTHUMT00000078783.2	A			33026421	+1	no_errors	ENST00000262650	ensembl	human	known	70_37	missense	SNP	1.000	C
KHK	3795	genome.wustl.edu	37	2	27317370	27317370	+	Missense_Mutation	SNP	T	T	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:27317370T>C	ENST00000260599.6	+	3	748	c.235T>C	c.(235-237)Tat>Cat	p.Y79H	KHK_ENST00000260598.5_Intron|KHK_ENST00000490823.1_3'UTR	NM_000221.2	NP_000212.1	P50053	KHK_HUMAN	ketohexokinase (fructokinase)	79					carbohydrate metabolic process (GO:0005975)|carbohydrate phosphorylation (GO:0046835)|fructose catabolic process (GO:0006001)|regulation of glycogen metabolic process (GO:0070873)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ketohexokinase activity (GO:0004454)			endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(2)|lung(4)|skin(1)|upper_aerodigestive_tract(1)	16	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					CCTCCGCCGCTATTCTGTGGA	0.592																																																	0													95.0	93.0	93.0					2																	27317370		2203	4300	6503	SO:0001583	missense	3795				CCDS1734.1, CCDS1735.1	2p23.3-p23.2	2008-02-05			ENSG00000138030	ENSG00000138030	2.7.1.3		6315	protein-coding gene	gene with protein product		614058				7833921	Standard	NM_000221		Approved		uc002rim.2	P50053	OTTHUMG00000097077	ENST00000260599.6:c.235T>C	2.37:g.27317370T>C	ENSP00000260599:p.Tyr79His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IBK2|Q99532|Q9BRJ3|Q9UMN1	Missense_Mutation	SNP	pfam_PfkB	p.Y79H	ENST00000260599.6	37	c.235	CCDS1734.1	2	.	.	.	.	.	.	.	.	.	.	T	12.83	2.055290	0.36277	.	.	ENSG00000138030	ENST00000260599;ENST00000429697	T;T	0.76186	-1.0;-1.0	5.63	4.48	0.54585	Carbohydrate/purine kinase (1);	0.886321	0.10215	N	0.701674	T	0.58977	0.2160	N	0.16478	0.41	0.80722	D	1	B;B	0.10296	0.003;0.003	B;B	0.23419	0.046;0.046	T	0.41875	-0.9484	10	0.16896	T	0.51	-2.291	9.0377	0.36298	0.0:0.0891:0.0:0.9109	.	79;79	Q6IBK2;P50053	.;KHK_HUMAN	H	79	ENSP00000260599:Y79H;ENSP00000404741:Y79H	ENSP00000260599:Y79H	Y	+	1	0	KHK	27170874	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	3.664000	0.54525	0.977000	0.38444	0.459000	0.35465	TAT	KHK	-	pfam_PfkB		0.592	KHK-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KHK	HGNC	protein_coding	OTTHUMT00000214196.1	T			27317370	+1	no_errors	ENST00000260599	ensembl	human	known	70_37	missense	SNP	1.000	C
KIFC1	3833	genome.wustl.edu	37	6	33365938	33365938	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr6:33365938G>C	ENST00000428849.2	+	2	595	c.145G>C	c.(145-147)Gag>Cag	p.E49Q		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	49					ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						CCTGGAGCCTGAGAAGGTGAG	0.537																																																	0													58.0	61.0	60.0					6																	33365938		2203	4300	6503	SO:0001583	missense	3833			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.145G>C	6.37:g.33365938G>C	ENSP00000393963:p.Glu49Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.E49Q	ENST00000428849.2	37	c.145	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	G	15.80	2.938952	0.52972	.	.	ENSG00000237649	ENST00000428849;ENST00000450504	T	0.73789	-0.78	4.78	1.84	0.25277	.	0.452031	0.22611	N	0.057830	T	0.31071	0.0785	N	0.24115	0.695	0.23720	N	0.997026	B;B	0.31125	0.309;0.309	B;B	0.24701	0.055;0.055	T	0.10337	-1.0634	10	0.25751	T	0.34	-9.7913	4.9023	0.13781	0.2019:0.2266:0.5715:0.0	.	49;49	B4E063;Q9BW19	.;KIFC1_HUMAN	Q	49	ENSP00000393963:E49Q	ENSP00000393963:E49Q	E	+	1	0	KIFC1	33473916	0.046000	0.20272	0.994000	0.49952	0.965000	0.64279	0.654000	0.24918	0.536000	0.28733	0.455000	0.32223	GAG	KIFC1	-	NULL		0.537	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	G	NM_002263		33365938	+1	no_errors	ENST00000428849	ensembl	human	known	70_37	missense	SNP	0.909	C
KRT86	3892	genome.wustl.edu	37	12	52699033	52699033	+	Missense_Mutation	SNP	G	G	A	rs61914259	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:52699033G>A	ENST00000423955.2	+	7	923	c.745G>A	c.(745-747)Gtt>Att	p.V249I	KRT86_ENST00000544024.1_Missense_Mutation_p.V249I|RP11-845M18.6_ENST00000552441.1_RNA|KRT86_ENST00000293525.5_Missense_Mutation_p.V249I			O43790	KRT86_HUMAN	keratin 86	249	Coil 1B.|Rod.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)	structural molecule activity (GO:0005198)			breast(1)|cervix(1)|large_intestine(1)|lung(5)|ovary(1)|skin(1)	10				BRCA - Breast invasive adenocarcinoma(357;0.189)		GGAGATCCGCGTTCTCCAGTC	0.567																																																	0													146.0	126.0	133.0					12																	52699033		2203	4300	6503	SO:0001583	missense	3892			X99142	CCDS41785.1	12q13	2013-01-16	2006-07-17	2006-07-17		ENSG00000170442		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6463	protein-coding gene	gene with protein product	"""hard keratin type II 6"""	601928	"""keratin, hair, basic, 6 (monilethrix)"""	KRTHB6		9241275, 16831889	Standard	NM_002284		Approved	MNX, Hb6	uc001sad.3	O43790		ENST00000423955.2:c.745G>A	12.37:g.52699033G>A	ENSP00000444533:p.Val249Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	P78387	Missense_Mutation	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.V249I	ENST00000423955.2	37	c.745	CCDS41785.1	12	.	.	.	.	.	.	.	.	.	.	G	9.579	1.123100	0.20959	.	.	ENSG00000170442;ENSG00000170442;ENSG00000170442;ENSG00000258832	ENST00000544024;ENST00000423955;ENST00000293525;ENST00000553310	D;D;D	0.88741	-2.42;-2.42;-2.42	4.69	0.639	0.17747	Filament (1);	0.200519	0.24003	N	0.042444	T	0.79545	0.4464	L	0.39566	1.225	0.09310	N	1	B	0.10296	0.003	B	0.13407	0.009	T	0.61019	-0.7147	10	0.19147	T	0.46	.	5.6128	0.17414	0.3148:0.1288:0.5563:0.0	rs61914259	249	O43790	KRT86_HUMAN	I	249	ENSP00000443169:V249I;ENSP00000444533:V249I;ENSP00000293525:V249I	ENSP00000293525:V249I	V	+	1	0	AC021066.1;KRT86	50985300	0.534000	0.26362	0.012000	0.15200	0.332000	0.28634	2.299000	0.43611	0.091000	0.17302	-0.317000	0.08691	GTT	KRT86	-	pfam_F,superfamily_Prefoldin		0.567	KRT86-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT86	Uniprot_genename	protein_coding	OTTHUMT00000404911.1	G	NM_002284		52699033	+1	no_errors	ENST00000293525	ensembl	human	known	70_37	missense	SNP	0.056	A
LOC645166	645166	genome.wustl.edu	37	1	148951539	148951539	+	lincRNA	SNP	A	A	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:148951539A>G	ENST00000539543.1	+	0	549					NR_027355.2																						AACTTAGCCTAGCATTAAGTT	0.413																																																	0																																												101060590																															1.37:g.148951539A>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000539543.1	37	NULL		1																																																																																			RP11-14N7.2	-	-		0.413	RP11-14N7.2-201	KNOWN	basic	lincRNA	LOC101060590	Clone_based_vega_gene	lincRNA		A			148951539	+1	no_errors	ENST00000452399	ensembl	human	known	70_37	rna	SNP	0.160	G
LRIT1	26103	genome.wustl.edu	37	10	85997035	85997035	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr10:85997035G>C	ENST00000372105.3	-	2	551	c.530C>G	c.(529-531)tCc>tGc	p.S177C		NM_015613.2	NP_056428.1	Q9P2V4	LRIT1_HUMAN	leucine-rich repeat, immunoglobulin-like and transmembrane domains 1	177						integral component of endoplasmic reticulum membrane (GO:0030176)				breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(13)|skin(1)	23						GTGAGCCCAGGAGACGATGAG	0.637																																																	0													14.0	14.0	14.0					10																	85997035		1949	3736	5685	SO:0001583	missense	26103			AB031547	CCDS7373.1	10q23	2013-02-11	2007-06-19	2007-06-19	ENSG00000148602	ENSG00000148602		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	23404	protein-coding gene	gene with protein product	"""fibronectin type III, immunoglobulin and leucine rich repeat domains 9"""		"""leucine rich repeat containing 21"""	LRRC21		10777785	Standard	NM_015613		Approved	PAL, DKFZP434K091, FIGLER9	uc001kcz.1	Q9P2V4	OTTHUMG00000018632	ENST00000372105.3:c.530C>G	10.37:g.85997035G>C	ENSP00000361177:p.Ser177Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0QD41|Q9Y4N7	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Leu-rich_rpt,superfamily_Fibronectin_type3,smart_Leu-rich_rpt_typical-subtyp,smart_Cys-rich_flank_reg_C,smart_Ig_sub,smart_Ig_sub2,pfscan_Fibronectin_type3,pfscan_Ig-like	p.S177C	ENST00000372105.3	37	c.530	CCDS7373.1	10	.	.	.	.	.	.	.	.	.	.	G	5.381	0.255543	0.10185	.	.	ENSG00000148602	ENST00000372105	T	0.53423	0.62	4.55	2.59	0.31030	.	0.716363	0.13595	N	0.376290	T	0.41166	0.1147	L	0.59967	1.855	0.09310	N	1	B	0.21606	0.058	B	0.24394	0.053	T	0.40683	-0.9550	10	0.56958	D	0.05	.	4.8562	0.13561	0.1948:0.1771:0.6281:0.0	.	177	Q9P2V4	LRIT1_HUMAN	C	177	ENSP00000361177:S177C	ENSP00000361177:S177C	S	-	2	0	LRIT1	85987015	0.045000	0.20229	0.051000	0.19133	0.321000	0.28281	0.945000	0.29056	0.462000	0.27095	0.655000	0.94253	TCC	LRIT1	-	smart_Leu-rich_rpt_typical-subtyp		0.637	LRIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRIT1	HGNC	protein_coding	OTTHUMT00000049109.1	G	NM_015613		85997035	-1	no_errors	ENST00000372105	ensembl	human	known	70_37	missense	SNP	0.019	C
LRP1	4035	genome.wustl.edu	37	12	57543506	57543506	+	Intron	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:57543506C>T	ENST00000243077.3	+	6	1307				RP11-545N8.3_ENST00000554476.1_RNA|LRP1_ENST00000553277.1_Silent_p.H295H|RP11-545N8.3_ENST00000555461.1_RNA|LRP1_ENST00000554174.1_Intron|LRP1_ENST00000338962.4_3'UTR	NM_002332.2	NP_002323.2	Q07954	LRP1_HUMAN	low density lipoprotein receptor-related protein 1						aging (GO:0007568)|aorta morphogenesis (GO:0035909)|apoptotic cell clearance (GO:0043277)|beta-amyloid clearance (GO:0097242)|cell proliferation (GO:0008283)|cholesterol metabolic process (GO:0008203)|lipoprotein metabolic process (GO:0042157)|lipoprotein transport (GO:0042953)|negative regulation of neuron apoptotic process (GO:0043524)|negative regulation of platelet-derived growth factor receptor-beta signaling pathway (GO:2000587)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of Wnt signaling pathway (GO:0030178)|phototransduction, visible light (GO:0007603)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of lipid transport (GO:0032370)|positive regulation of protein transport (GO:0051222)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|receptor-mediated endocytosis (GO:0006898)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cholesterol transport (GO:0032374)|regulation of phospholipase A2 activity (GO:0032429)|retinoid metabolic process (GO:0001523)	clathrin-coated vesicle (GO:0030136)|coated pit (GO:0005905)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endosome (GO:0005768)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lysosomal membrane (GO:0005765)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	apolipoprotein binding (GO:0034185)|calcium ion binding (GO:0005509)|lipoprotein particle receptor binding (GO:0070325)|lipoprotein transporter activity (GO:0042954)|poly(A) RNA binding (GO:0044822)|protein complex binding (GO:0032403)|receptor activity (GO:0004872)			NS(1)|breast(9)|central_nervous_system(3)|cervix(3)|endometrium(33)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(26)|lung(58)|ovary(10)|pancreas(2)|prostate(11)|skin(7)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(5)	184				BRCA - Breast invasive adenocarcinoma(357;0.0103)	Antihemophilic Factor(DB00025)|Coagulation Factor IX(DB00100)|Tenecteplase(DB00031)	TGACACAACACGGCTAAGCTC	0.577																																																	0													16.0	14.0	15.0					12																	57543506		871	1981	2852	SO:0001627	intron_variant	4035			X13916	CCDS8932.1	12q13.3	2013-05-28	2010-01-26		ENSG00000123384	ENSG00000123384		"""CD molecules"", ""Low density lipoprotein receptors"""	6692	protein-coding gene	gene with protein product		107770	"""alpha-2-macroglobulin receptor"""	APR, A2MR		2548950	Standard	NM_002332		Approved	LRP, CD91, LRP1A, APOER	uc001snd.3	Q07954	OTTHUMG00000044412	ENST00000243077.3:c.841+4233C>T	12.37:g.57543506C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q2PP12|Q86SW0|Q8IVG8	Silent	SNP	pfam_LDrepeatLR_classA_rpt,pfam_EGF-like_Ca-bd,superfamily_LDrepeatLR_classA_rpt,smart_LDrepeatLR_classA_rpt,smart_EGF-like_Ca-bd,smart_EG-like_dom,pfscan_LDrepeatLR_classA_rpt	p.H295	ENST00000243077.3	37	c.885	CCDS8932.1	12																																																																																			LRP1	-	NULL		0.577	LRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP1	HGNC	protein_coding	OTTHUMT00000412772.2	C	NM_002332		57543506	+1	no_errors	ENST00000553277	ensembl	human	putative	70_37	silent	SNP	0.000	T
LSM14A	26065	genome.wustl.edu	37	19	34717371	34717372	+	Splice_Site	INS	-	-	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:34717371_34717372insA	ENST00000433627.5	+	10	1500		c.e10+2		LSM14A_ENST00000540746.2_Splice_Site|LSM14A_ENST00000544216.3_Intron	NM_001114093.1	NP_001107565.1	Q8ND56	LS14A_HUMAN	LSM14A, SCD6 homolog A (S. cerevisiae)						cytoplasmic mRNA processing body assembly (GO:0033962)|multicellular organismal development (GO:0007275)|positive regulation of type I interferon-mediated signaling pathway (GO:0060340)|regulation of translation (GO:0006417)|RIG-I signaling pathway (GO:0039529)	cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|intracellular membrane-bounded organelle (GO:0043231)	double-stranded DNA binding (GO:0003690)|double-stranded RNA binding (GO:0003725)|poly(A) RNA binding (GO:0044822)|single-stranded RNA binding (GO:0003727)			breast(1)|endometrium(4)|kidney(1)|large_intestine(8)|lung(7)|skin(1)	22	Esophageal squamous(110;0.162)					TTCTGAAAGGTAAAAAAAACAA	0.371																																																	0																																										SO:0001630	splice_region_variant	26065			AL834398	CCDS12435.1, CCDS46040.1	19q13.12	2010-01-27	2006-12-21	2006-01-24		ENSG00000257103			24489	protein-coding gene	gene with protein product		610677	"""chromosome 19 open reading frame 13"", ""family with sequence similarity 61, member A"", ""LSM14 homolog A (SCD6, S. cerevisiae)"""	C19orf13, FAM61A		12477932	Standard	NM_015578		Approved	DKFZP434D1335, RAP55A, RAP55	uc002nva.4	Q8ND56		ENST00000433627.5:c.1389+2->A	19.37:g.34717379_34717379dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DTG6|Q76LX7|Q96AR3|Q96K73|Q96SN5|Q9UFR3	Splice_Site	INS	-	e10+2	ENST00000433627.5	37	c.1392+2_3	CCDS46040.1	19																																																																																			LSM14A	-	-		0.371	LSM14A-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LSM14A	HGNC	protein_coding	OTTHUMT00000451576.3	-	NM_015578	Intron	34717372	+1	no_errors	ENST00000433627	ensembl	human	known	70_37	splice_site_ins	INS	1.000:1.000	A
LYNX1	66004	genome.wustl.edu	37	8	143846091	143846091	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr8:143846091G>T	ENST00000335822.5	-	5	955	c.328C>A	c.(328-330)Ccc>Acc	p.P110T	LYNX1_ENST00000317543.7_Missense_Mutation_p.P76T|RP11-706C16.7_ENST00000523657.1_RNA|LYNX1_ENST00000523332.1_Intron	NM_023946.2	NP_076435.1	Q9BZG9	LYNX1_HUMAN	Ly6/neurotoxin 1	110	UPAR/Ly6.					anchored component of membrane (GO:0031225)|cell projection (GO:0042995)|extracellular vesicular exosome (GO:0070062)|plasma membrane (GO:0005886)				endometrium(1)|lung(2)|skin(1)	4	all_cancers(97;3.96e-12)|all_epithelial(106;1.19e-08)|Lung NSC(106;0.000413)|all_lung(105;0.00106)|Medulloblastoma(13;0.00276)|all_neural(13;0.00559)|Ovarian(258;0.0254)|Acute lymphoblastic leukemia(118;0.155)					CCCAGGCTGGGGATATCGGGG	0.632																																																	0													88.0	86.0	87.0					8																	143846091		2203	4300	6503	SO:0001583	missense	66004			AF321824	CCDS6389.1, CCDS34951.1, CCDS34952.1	8q24.3	2008-03-12			ENSG00000180155	ENSG00000180155			29604	protein-coding gene	gene with protein product		606110				12573258, 10402197	Standard	NM_023946		Approved	SLURP2	uc003yxd.1	Q9BZG9	OTTHUMG00000164694	ENST00000335822.5:c.328C>A	8.37:g.143846091G>T	ENSP00000337950:p.Pro110Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DWI7|G3XAC2|Q86SR0	Missense_Mutation	SNP	pfam_LY6_UPAR	p.P110T	ENST00000335822.5	37	c.328	CCDS34951.1	8	.	.	.	.	.	.	.	.	.	.	G	8.985	0.976350	0.18736	.	.	ENSG00000180155	ENST00000317543;ENST00000335822	T;T	0.68181	-0.31;-0.31	3.18	-5.1	0.02911	CD59 antigen (1);	3.763770	0.00496	N	0.000159	T	0.46678	0.1405	N	0.22421	0.69	0.09310	N	1	B;B	0.22983	0.063;0.078	B;B	0.22880	0.025;0.042	T	0.20009	-1.0288	10	0.62326	D	0.03	-20.9954	0.1993	0.00143	0.3442:0.1459:0.2154:0.2944	.	110;76	G3XAC2;Q86SR0	.;SLUR2_HUMAN	T	76;110	ENSP00000319846:P76T;ENSP00000337950:P110T	ENSP00000319846:P76T	P	-	1	0	LYNX1	143843093	0.000000	0.05858	0.000000	0.03702	0.171000	0.22731	-3.281000	0.00528	-1.259000	0.02468	0.407000	0.27541	CCC	LYNX1	-	pfam_LY6_UPAR		0.632	LYNX1-001	KNOWN	basic|CCDS	protein_coding	LYNX1	HGNC	protein_coding	OTTHUMT00000379786.3	G	NM_177476		143846091	-1	no_errors	ENST00000335822	ensembl	human	known	70_37	missense	SNP	0.000	T
LYRM4	57128	genome.wustl.edu	37	6	5144484	5144484	+	Intron	SNP	C	C	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr6:5144484C>A	ENST00000330636.4	-	3	413				LYRM4_ENST00000480566.1_Intron|LYRM4_ENST00000468929.1_Intron|LYRM4_ENST00000464010.1_Missense_Mutation_p.G74C	NM_020408.4	NP_065141.3	Q9HD34	LYRM4_HUMAN	LYR motif containing 4						small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)				endometrium(1)	1	Ovarian(93;0.11)	all_hematologic(90;0.0901)				GCGGCTGTGCCTTGCTCAGCT	0.542																																					NSCLC(130;1006 2426 17608 36797)												0													48.0	50.0	49.0					6																	5144484		692	1591	2283	SO:0001627	intron_variant	57128			AF258559	CCDS4493.1, CCDS54961.1	6p25.1	2008-02-05	2006-09-19	2006-09-19	ENSG00000214113	ENSG00000214113		"""LYR motif containing"""	21365	protein-coding gene	gene with protein product		613311	"""chromosome 6 open reading frame 149"""	C6orf149			Standard	XM_005249239		Approved	CGI-203, ISD11	uc021ykw.1	Q9HD34	OTTHUMG00000014173	ENST00000330636.4:c.208-34759G>T	6.37:g.5144484C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K543|Q5XKP1	Missense_Mutation	SNP	pfam_Complex1_LYR	p.G74C	ENST00000330636.4	37	c.220	CCDS4493.1	6	.	.	.	.	.	.	.	.	.	.	C	8.695	0.908302	0.17833	.	.	ENSG00000214113	ENST00000464010	T	0.47869	0.83	2.84	0.844	0.18943	.	.	.	.	.	T	0.20292	0.0488	.	.	.	0.09310	N	1	P	0.48834	0.916	B	0.44044	0.439	T	0.06643	-1.0815	8	0.56958	D	0.05	-7.8424	4.3765	0.11272	0.0:0.5999:0.0:0.4001	.	74	C9JRX8	.	C	74	ENSP00000420026:G74C	ENSP00000420026:G74C	G	-	1	0	LYRM4	5089483	0.000000	0.05858	0.001000	0.08648	0.028000	0.11728	-1.044000	0.03532	0.039000	0.15632	0.655000	0.94253	GGC	LYRM4	-	NULL		0.542	LYRM4-001	KNOWN	basic|CCDS	protein_coding	LYRM4	HGNC	protein_coding	OTTHUMT00000353461.3	C	NM_020408		5144484	-1	no_errors	ENST00000464010	ensembl	human	putative	70_37	missense	SNP	0.000	A
MAP1A	4130	genome.wustl.edu	37	15	43813195	43813195	+	5'UTR	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:43813195C>G	ENST00000300231.5	+	0	185				MAP1A_ENST00000399453.1_5'UTR|MAP1A_ENST00000382031.1_Nonsense_Mutation_p.S150*			P78559	MAP1A_HUMAN	microtubule-associated protein 1A						microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	AGCAGCTCATCAGCTTATAAA	0.473																																																	0																																										SO:0001623	5_prime_UTR_variant	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.-266C>G	15.37:g.43813195C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Nonsense_Mutation	SNP	NULL	p.S150*	ENST00000300231.5	37	c.449	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	C	35	5.577586	0.96565	.	.	ENSG00000166963	ENST00000382031	.	.	.	5.2	5.2	0.72013	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-7.8871	18.9294	0.92558	0.0:1.0:0.0:0.0	.	.	.	.	X	150	.	ENSP00000371462:S150X	S	+	2	0	MAP1A	41600487	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	7.266000	0.78452	2.711000	0.92665	0.655000	0.94253	TCA	MAP1A	-	NULL		0.473	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	C	NM_002373		43813195	+1	no_errors	ENST00000382031	ensembl	human	novel	70_37	nonsense	SNP	1.000	G
MAP1A	4130	genome.wustl.edu	37	15	43814952	43814952	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:43814952G>T	ENST00000300231.5	+	4	1731	c.1281G>T	c.(1279-1281)agG>agT	p.R427S	MAP1A_ENST00000399453.1_Missense_Mutation_p.R427S|MAP1A_ENST00000382031.1_Missense_Mutation_p.R665S			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	427	9 X 3 AA repeats of K-K-[DE].|Lys-rich (basic).				microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	aaaaggagaggaaagagctca	0.403																																																	0													34.0	35.0	35.0					15																	43814952		1849	4090	5939	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1281G>T	15.37:g.43814952G>T	ENSP00000300231:p.Arg427Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.R427S	ENST00000300231.5	37	c.1281	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	5.459	0.269850	0.10349	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231;ENST00000442025	T;T;T	0.21031	2.03;2.03;2.03	5.4	2.26	0.28386	.	0.204930	0.24654	N	0.036700	T	0.20047	0.0482	L	0.60455	1.87	0.27659	N	0.947142	B	0.26744	0.158	B	0.23574	0.047	T	0.14448	-1.0472	10	0.66056	D	0.02	-11.5788	8.9037	0.35510	0.4052:0.0:0.5948:0.0	.	427	P78559	MAP1A_HUMAN	S	665;427;427;427	ENSP00000371462:R665S;ENSP00000382380:R427S;ENSP00000300231:R427S	ENSP00000300231:R427S	R	+	3	2	MAP1A	41602244	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	0.770000	0.26618	0.330000	0.23485	-0.156000	0.13503	AGG	MAP1A	-	NULL		0.403	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	G	NM_002373		43814952	+1	no_errors	ENST00000399453	ensembl	human	known	70_37	missense	SNP	0.998	T
MAP1A	4130	genome.wustl.edu	37	15	43815649	43815649	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:43815649G>C	ENST00000300231.5	+	4	2428	c.1978G>C	c.(1978-1980)Gaa>Caa	p.E660Q	MAP1A_ENST00000399453.1_Missense_Mutation_p.E660Q|MAP1A_ENST00000382031.1_Missense_Mutation_p.E898Q			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	660					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	TGAGTTAGAAGAAATGGAGGA	0.478																																																	0													43.0	44.0	44.0					15																	43815649		1937	4122	6059	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.1978G>C	15.37:g.43815649G>C	ENSP00000300231:p.Glu660Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.E660Q	ENST00000300231.5	37	c.1978	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	15.63	2.891738	0.52014	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.57436	0.4;0.4;0.4	5.26	5.26	0.73747	.	0.000000	0.33023	N	0.005374	T	0.72581	0.3478	M	0.79475	2.455	0.58432	D	0.999993	D	0.76494	0.999	D	0.67548	0.952	T	0.70502	-0.4854	10	0.34782	T	0.22	-10.0411	19.0716	0.93140	0.0:0.0:1.0:0.0	.	660	P78559	MAP1A_HUMAN	Q	898;660;660	ENSP00000371462:E898Q;ENSP00000382380:E660Q;ENSP00000300231:E660Q	ENSP00000300231:E660Q	E	+	1	0	MAP1A	41602941	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	7.404000	0.79996	2.735000	0.93741	0.563000	0.77884	GAA	MAP1A	-	NULL		0.478	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	G	NM_002373		43815649	+1	no_errors	ENST00000399453	ensembl	human	known	70_37	missense	SNP	1.000	C
MAP1A	4130	genome.wustl.edu	37	15	43817734	43817734	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:43817734G>A	ENST00000300231.5	+	4	4513	c.4063G>A	c.(4063-4065)Gaa>Aaa	p.E1355K	MAP1A_ENST00000399453.1_Missense_Mutation_p.E1355K|MAP1A_ENST00000382031.1_Missense_Mutation_p.E1593K			P78559	MAP1A_HUMAN	microtubule-associated protein 1A	1355					microtubule cytoskeleton organization (GO:0000226)|sensory perception of sound (GO:0007605)	cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)	structural molecule activity (GO:0005198)			breast(5)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|liver(2)|lung(19)|ovary(5)|pancreas(3)|prostate(2)|skin(6)|soft_tissue(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	66		all_cancers(109;1.03e-14)|all_epithelial(112;2.23e-12)|Lung NSC(122;2.76e-08)|all_lung(180;3.1e-07)|Melanoma(134;0.0476)|Colorectal(260;0.215)		GBM - Glioblastoma multiforme(94;3.05e-06)	Estramustine(DB01196)	CAGAACCTCAGAACAGAAGAA	0.483																																																	0													89.0	85.0	86.0					15																	43817734		1889	4118	6007	SO:0001583	missense	4130			U38292	CCDS42031.1	15q15.3	2006-06-15			ENSG00000166963	ENSG00000166963			6835	protein-coding gene	gene with protein product		600178		MAP1L		7806212, 7629894	Standard	XM_005254385		Approved		uc001zrt.3	P78559	OTTHUMG00000059756	ENST00000300231.5:c.4063G>A	15.37:g.43817734G>A	ENSP00000300231:p.Glu1355Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O95643|Q12973|Q15882|Q9UJT4	Missense_Mutation	SNP	NULL	p.E1355K	ENST00000300231.5	37	c.4063	CCDS42031.1	15	.	.	.	.	.	.	.	.	.	.	G	13.13	2.145284	0.37825	.	.	ENSG00000166963	ENST00000382031;ENST00000399453;ENST00000300231	T;T;T	0.64803	-0.12;-0.12;-0.12	4.89	4.89	0.63831	.	.	.	.	.	T	0.70850	0.3271	M	0.70595	2.14	0.58432	D	0.999997	D	0.55800	0.973	P	0.51657	0.676	T	0.69946	-0.5007	9	0.30854	T	0.27	-12.4285	17.8407	0.88714	0.0:0.0:1.0:0.0	.	1355	P78559	MAP1A_HUMAN	K	1593;1355;1355	ENSP00000371462:E1593K;ENSP00000382380:E1355K;ENSP00000300231:E1355K	ENSP00000300231:E1355K	E	+	1	0	MAP1A	41605026	0.857000	0.29778	0.672000	0.29872	0.119000	0.20118	1.517000	0.35867	2.553000	0.86117	0.563000	0.77884	GAA	MAP1A	-	NULL		0.483	MAP1A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MAP1A	HGNC	protein_coding	OTTHUMT00000132894.5	G	NM_002373		43817734	+1	no_errors	ENST00000399453	ensembl	human	known	70_37	missense	SNP	0.998	A
MAP1B	4131	genome.wustl.edu	37	5	71491138	71491138	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:71491138G>A	ENST00000296755.7	+	5	2254	c.1956G>A	c.(1954-1956)gaG>gaA	p.E652E		NM_005909.3	NP_005900.2	P46821	MAP1B_HUMAN	microtubule-associated protein 1B	652	Lys-rich (highly basic, contains many KKEE and KKEI/V repeats).				axon extension (GO:0048675)|cellular process (GO:0009987)|dendrite development (GO:0016358)|establishment of monopolar cell polarity (GO:0061162)|microtubule bundle formation (GO:0001578)|mitochondrion transport along microtubule (GO:0047497)|negative regulation of intracellular transport (GO:0032387)|positive regulation of axon extension (GO:0045773)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|plasma membrane (GO:0005886)|synapse (GO:0045202)	structural molecule activity (GO:0005198)			NS(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(42)|liver(1)|lung(28)|ovary(1)|pancreas(1)|prostate(3)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	104		Lung NSC(167;0.00202)|Ovarian(174;0.0175)|Prostate(461;0.142)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;7.99e-54)		AGAAAGAGGAGAAAGAAAAGC	0.413																																					Melanoma(17;367 822 11631 31730 47712)												0													81.0	85.0	83.0					5																	71491138		2203	4300	6503	SO:0001819	synonymous_variant	4131			L06237	CCDS4012.1	5q13	2014-06-12			ENSG00000131711	ENSG00000131711			6836	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 102"""	157129				1881920	Standard	NM_005909		Approved	MAP5, PPP1R102	uc003kbw.4	P46821	OTTHUMG00000100952	ENST00000296755.7:c.1956G>A	5.37:g.71491138G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2BDK5	Silent	SNP	pfam_MAP1B_neuraxin	p.E652	ENST00000296755.7	37	c.1956	CCDS4012.1	5																																																																																			MAP1B	-	NULL		0.413	MAP1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MAP1B	HGNC	protein_coding	OTTHUMT00000218561.6	G	NM_005909		71491138	+1	no_errors	ENST00000296755	ensembl	human	known	70_37	silent	SNP	0.994	A
MBD6	114785	genome.wustl.edu	37	12	57920028	57920028	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:57920028C>G	ENST00000355673.3	+	6	1633	c.1277C>G	c.(1276-1278)tCt>tGt	p.S426C	MBD6_ENST00000431731.2_Missense_Mutation_p.S426C	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	426	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						CCTTCCCACTCTGATGGAAGC	0.627																																																	0													79.0	90.0	87.0					12																	57920028		2203	4300	6503	SO:0001583	missense	114785			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.1277C>G	12.37:g.57920028C>G	ENSP00000347896:p.Ser426Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3M0|Q8NA81|Q96Q00	Missense_Mutation	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.S426C	ENST00000355673.3	37	c.1277	CCDS8944.1	12	.	.	.	.	.	.	.	.	.	.	c	13.34	2.208016	0.39003	.	.	ENSG00000166987	ENST00000355673;ENST00000431731	.	.	.	3.82	3.82	0.43975	.	0.380726	0.18645	N	0.135162	T	0.50137	0.1598	N	0.08118	0	0.40273	D	0.978317	D;D	0.76494	0.999;0.999	D;D	0.79784	0.987;0.993	T	0.50423	-0.8830	8	.	.	.	-7.1707	13.0935	0.59178	0.0:1.0:0.0:0.0	.	426;426	Q6P0P0;Q96DN6	.;MBD6_HUMAN	C	426	.	.	S	+	2	0	MBD6	56206295	1.000000	0.71417	1.000000	0.80357	0.980000	0.70556	3.983000	0.56916	2.125000	0.65367	0.556000	0.70494	TCT	MBD6	-	NULL		0.627	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1	C			57920028	+1	no_errors	ENST00000355673	ensembl	human	known	70_37	missense	SNP	1.000	G
MCCC2	64087	genome.wustl.edu	37	5	70930872	70930872	+	Intron	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:70930872G>A	ENST00000340941.6	+	9	1032				MCCC2_ENST00000323375.8_Intron|MCCC2_ENST00000509358.2_Intron|MCCC2_ENST00000510895.2_Intron	NM_022132.4	NP_071415.1	Q9HCC0	MCCB_HUMAN	methylcrotonoyl-CoA carboxylase 2 (beta)						biotin metabolic process (GO:0006768)|branched-chain amino acid catabolic process (GO:0009083)|cellular nitrogen compound metabolic process (GO:0034641)|coenzyme A metabolic process (GO:0015936)|leucine catabolic process (GO:0006552)|small molecule metabolic process (GO:0044281)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)	cytosol (GO:0005829)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)|methylcrotonoyl-CoA carboxylase activity (GO:0004485)			endometrium(2)|kidney(15)|large_intestine(2)|lung(9)|ovary(1)|urinary_tract(1)	30		Lung NSC(167;0.000697)|Prostate(74;0.0107)|Ovarian(174;0.0175)|Breast(144;0.198)		OV - Ovarian serous cystadenocarcinoma(47;2.04e-54)	Biotin(DB00121)	AATTGGATGTGAGTACGATAT	0.358																																																	0													114.0	111.0	112.0					5																	70930872		2203	4300	6503	SO:0001627	intron_variant	64087			AF310971	CCDS34184.1	5q12-q13	2010-04-30	2010-04-30		ENSG00000131844	ENSG00000131844	6.4.1.4		6937	protein-coding gene	gene with protein product		609014	"""methylcrotonoyl-Coenzyme A carboxylase 2 (beta)"""				Standard	NM_022132		Approved	MCCB	uc003kbs.4	Q9HCC0	OTTHUMG00000162505	ENST00000340941.6:c.903+3G>A	5.37:g.70930872G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NIY9|Q96C27|Q9Y4L7	RNA	SNP	-	NULL	ENST00000340941.6	37	NULL	CCDS34184.1	5																																																																																			MCCC2	-	-		0.358	MCCC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCCC2	HGNC	protein_coding	OTTHUMT00000369243.4	G			70930872	+1	no_errors	ENST00000505787	ensembl	human	known	70_37	rna	SNP	1.000	A
MED25	81857	genome.wustl.edu	37	19	50338832	50338832	+	Silent	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:50338832G>T	ENST00000312865.6	+	15	1769	c.1716G>T	c.(1714-1716)ctG>ctT	p.L572L	MED25_ENST00000538643.1_Silent_p.L359L	NM_030973.3	NP_112235.2	Q71SY5	MED25_HUMAN	mediator complex subunit 25	572	Interaction with RARA.|Pro-rich.				cell death (GO:0008219)|gene expression (GO:0010467)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell cycle arrest (GO:0071158)|positive regulation of chromatin binding (GO:0035563)|positive regulation of mediator complex assembly (GO:2001178)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)	retinoic acid receptor binding (GO:0042974)|retinoid X receptor binding (GO:0046965)|transcription factor binding (GO:0008134)			NS(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(6)|ovary(1)|stomach(1)|urinary_tract(1)	17		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00822)|GBM - Glioblastoma multiforme(134;0.0122)		GGCCCATTCTGGAGGACCAAG	0.667																																					GBM(51;894 1657 37868)												0													8.0	9.0	9.0					19																	50338832		2168	4259	6427	SO:0001819	synonymous_variant	81857			AL136746	CCDS33075.1	19q13.3	2014-09-17	2007-07-30			ENSG00000104973			28845	protein-coding gene	gene with protein product		610197	"""mediator of RNA polymerase II transcription, subunit 25 homolog (S. cerevisiae)"""			9110174, 11230166	Standard	NM_030973		Approved	ARC92, ACID1, TCBAP0758, DKFZp434K0512	uc002ppw.2	Q71SY5		ENST00000312865.6:c.1716G>T	19.37:g.50338832G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K095|B9TX30|O95783|Q6P143|Q6QMH5|Q707U4|Q8TB55|Q9H0L5|Q9HB34	Silent	SNP	pfam_Mediator_Med25_VWA,pfam_Mediator_Med25,pfam_Mediator_Med25_SD1,pfam_Mediator_Med25_NR-box	p.L572	ENST00000312865.6	37	c.1716	CCDS33075.1	19																																																																																			MED25	-	NULL		0.667	MED25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED25	HGNC	protein_coding	OTTHUMT00000465316.1	G	NM_030973		50338832	+1	no_errors	ENST00000312865	ensembl	human	known	70_37	silent	SNP	1.000	T
MFN2	9927	genome.wustl.edu	37	1	12065800	12065800	+	Missense_Mutation	SNP	C	C	T	rs146092040		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:12065800C>T	ENST00000235329.5	+	15	1850	c.1528C>T	c.(1528-1530)Cgg>Tgg	p.R510W	MFN2_ENST00000444836.1_Missense_Mutation_p.R510W	NM_014874.3	NP_055689.1	O95140	MFN2_HUMAN	mitofusin 2	510					apoptotic process (GO:0006915)|autophagy (GO:0006914)|blastocyst formation (GO:0001825)|blood coagulation (GO:0007596)|camera-type eye morphogenesis (GO:0048593)|mitochondrial fusion (GO:0008053)|mitochondrial membrane organization (GO:0007006)|mitochondrion localization (GO:0051646)|negative regulation of Ras protein signal transduction (GO:0046580)|negative regulation of smooth muscle cell proliferation (GO:0048662)|protein localization to pre-autophagosomal structure (GO:0034497)|protein targeting to mitochondrion (GO:0006626)|response to unfolded protein (GO:0006986)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|intrinsic component of mitochondrial outer membrane (GO:0031306)|microtubule cytoskeleton (GO:0015630)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|ubiquitin protein ligase binding (GO:0031625)	p.R510W(1)		endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(3)|ovary(1)|pancreas(1)|prostate(2)|skin(2)	20	Ovarian(185;0.249)	Lung NSC(185;8.69e-05)|all_lung(284;9.87e-05)|Renal(390;0.000147)|Breast(348;0.00093)|Colorectal(325;0.00205)|Ovarian(437;0.00965)|Hepatocellular(190;0.0202)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|Colorectal(212;7.25e-06)|COAD - Colon adenocarcinoma(227;0.000302)|BRCA - Breast invasive adenocarcinoma(304;0.000329)|Kidney(185;0.000896)|KIRC - Kidney renal clear cell carcinoma(229;0.00274)|STAD - Stomach adenocarcinoma(313;0.00773)|READ - Rectum adenocarcinoma(331;0.0656)		TGTGTCTGTGCGGAGTCAGAT	0.522																																																	1	Substitution - Missense(1)	skin(1)						C	TRP/ARG,TRP/ARG	0,4406		0,0,2203	250.0	247.0	248.0		1528,1528	4.9	1.0	1	dbSNP_134	248	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	MFN2	NM_001127660.1,NM_014874.3	101,101	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	probably-damaging,probably-damaging	510/758,510/758	12065800	1,13005	2203	4300	6503	SO:0001583	missense	9927			AF036536	CCDS30587.1	1p36.22	2014-09-17			ENSG00000116688	ENSG00000116688			16877	protein-coding gene	gene with protein product		608507				12499352, 11181170	Standard	NM_014874		Approved	CPRP1, KIAA0214, MARF, CMT2A2	uc009vni.3	O95140	OTTHUMG00000002392	ENST00000235329.5:c.1528C>T	1.37:g.12065800C>T	ENSP00000235329:p.Arg510Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1B3|O95572|Q5JXC3|Q5JXC4|Q9H131|Q9NSX8	Missense_Mutation	SNP	pfam_Fzo/mitofusin_HR2,pfam_Dynamin_GTPase	p.R510W	ENST00000235329.5	37	c.1528	CCDS30587.1	1	.	.	.	.	.	.	.	.	.	.	C	19.69	3.874575	0.72180	0.0	1.16E-4	ENSG00000116688	ENST00000444836;ENST00000235329;ENST00000376337	D;D	0.86366	-2.11;-2.11	4.93	4.93	0.64822	.	0.000000	0.85682	D	0.000000	D	0.90655	0.7069	M	0.64997	1.995	0.80722	D	1	D	0.76494	0.999	D	0.64776	0.929	D	0.88674	0.3197	10	0.33940	T	0.23	-33.3454	12.7932	0.57545	0.1634:0.8366:0.0:0.0	.	510	O95140	MFN2_HUMAN	W	510;510;208	ENSP00000416338:R510W;ENSP00000235329:R510W	ENSP00000235329:R510W	R	+	1	2	MFN2	11988387	1.000000	0.71417	1.000000	0.80357	0.914000	0.54420	1.600000	0.36762	2.753000	0.94483	0.555000	0.69702	CGG	MFN2	-	NULL		0.522	MFN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MFN2	HGNC	protein_coding	OTTHUMT00000006859.2	C	NM_014874		12065800	+1	no_errors	ENST00000235329	ensembl	human	known	70_37	missense	SNP	1.000	T
MT-CO1	4512	genome.wustl.edu	37	M	3184	3184	+	5'Flank	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chrM:3184C>T	ENST00000361624.2	+	0	0				MT-RNR1_ENST00000389680.2_RNA|MT-TC_ENST00000387405.1_RNA|MT-TA_ENST00000387392.1_RNA|MT-TL1_ENST00000386347.1_RNA|MT-TM_ENST00000387377.1_RNA|MT-TQ_ENST00000387372.1_RNA|MT-ND1_ENST00000361390.2_5'Flank|MT-TI_ENST00000387365.1_RNA|MT-RNR2_ENST00000387347.2_RNA|MT-TW_ENST00000387382.1_RNA|MT-TF_ENST00000387314.1_RNA|MT-TV_ENST00000387342.1_RNA|MT-ND2_ENST00000361453.3_5'Flank|MT-TN_ENST00000387400.1_RNA|MT-TY_ENST00000387409.1_RNA			P00395	COX1_HUMAN	mitochondrially encoded cytochrome c oxidase I						aerobic respiration (GO:0009060)|cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|oxidative phosphorylation (GO:0006119)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex IV (GO:0005751)|respiratory chain complex IV (GO:0045277)	cytochrome-c oxidase activity (GO:0004129)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(4)|endometrium(25)|kidney(19)|lung(3)|prostate(3)	54						GTAAATGATATCATCTCAACT	0.428																																																	0																																										SO:0001631	upstream_gene_variant	100616263					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198804	ENSG00000198804		"""Mitochondrial respiratory chain complex / Complex IV"""	7419	protein-coding gene	gene with protein product		516030	"""cytochrome c oxidase I"""	MTCO1		7219534	Standard			Approved	COX1, COI		P00395			M.37:g.3184C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34770	RNA	SNP	-	NULL	ENST00000361624.2	37	NULL		MT																																																																																			MIR4485	-	-		0.428	MT-CO1-201	KNOWN	basic|appris_principal	protein_coding	MIR4485	HGNC	protein_coding		C	YP_003024028		3184	+1	no_errors	ENST00000387347	ensembl	human	known	70_37	rna	SNP	NULL	T
MMP1	4312	genome.wustl.edu	37	11	102663348	102663348	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr11:102663348G>A	ENST00000315274.6	-	7	1088	c.1021C>T	c.(1021-1023)Cgg>Tgg	p.R341W	WTAPP1_ENST00000525739.2_RNA	NM_001145938.1|NM_002421.3	NP_001139410.1|NP_002412.1	P03956	MMP1_HUMAN	matrix metallopeptidase 1 (interstitial collagenase)	341					blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|leukocyte migration (GO:0050900)|proteolysis (GO:0006508)|viral process (GO:0016032)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(2)|endometrium(1)|large_intestine(2)|lung(18)|ovary(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(1)	30	all_epithelial(12;0.0127)	all_neural(303;0.000318)|all_hematologic(158;0.00092)|Acute lymphoblastic leukemia(157;0.000967)	Epithelial(9;0.072)|Lung(13;0.0828)|LUSC - Lung squamous cell carcinoma(19;0.151)|all cancers(10;0.233)	OV - Ovarian serous cystadenocarcinoma(223;1.82e-07)|Epithelial(105;1.51e-06)|BRCA - Breast invasive adenocarcinoma(274;0.014)	Marimastat(DB00786)	TTGAAAAACCGGACTTCATCT	0.383																																																	0													113.0	116.0	115.0					11																	102663348		2203	4299	6502	SO:0001583	missense	4312			X54925	CCDS8322.1	11q21-q22	2014-01-30	2005-08-08		ENSG00000196611	ENSG00000196611	3.4.24.7	"""Endogenous ligands"""	7155	protein-coding gene	gene with protein product		120353	"""matrix metalloproteinase 1 (interstitial collagenase)"""	CLG			Standard	NM_002421		Approved		uc001phi.2	P03956	OTTHUMG00000048192	ENST00000315274.6:c.1021C>T	11.37:g.102663348G>A	ENSP00000322788:p.Arg341Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	P08156	Missense_Mutation	SNP	pfam_Pept_M10_metallopeptidase,pfam_Hemopexin/matrixin_repeat,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.R341W	ENST00000315274.6	37	c.1021	CCDS8322.1	11	.	.	.	.	.	.	.	.	.	.	g	16.91	3.253146	0.59212	.	.	ENSG00000196611	ENST00000315274	T	0.02323	4.34	6.16	3.05	0.35203	Hemopexin/matrixin (2);	3.201940	0.01475	N	0.016430	T	0.12305	0.0299	L	0.58302	1.8	0.09310	N	1	D	0.76494	0.999	D	0.78314	0.991	T	0.14839	-1.0458	10	0.72032	D	0.01	.	4.8208	0.13390	0.1574:0.0:0.4441:0.3984	.	341	P03956	MMP1_HUMAN	W	341	ENSP00000322788:R341W	ENSP00000322788:R341W	R	-	1	2	MMP1	102168558	0.000000	0.05858	0.331000	0.25455	0.991000	0.79684	-0.499000	0.06413	1.597000	0.50072	0.650000	0.86243	CGG	MMP1	-	pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom		0.383	MMP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP1	HGNC	protein_coding	OTTHUMT00000109632.1	G	NM_002421		102663348	-1	no_errors	ENST00000315274	ensembl	human	known	70_37	missense	SNP	0.000	A
MTMR4	9110	genome.wustl.edu	37	17	56572621	56572621	+	Missense_Mutation	SNP	G	G	A	rs376612881		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:56572621G>A	ENST00000323456.5	-	16	3006	c.2882C>T	c.(2881-2883)tCa>tTa	p.S961L	MTMR4_ENST00000579925.1_Missense_Mutation_p.S904L	NM_004687.4	NP_004678.3	Q9NYA4	MTMR4_HUMAN	myotubularin related protein 4	961					negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|peptidyl-tyrosine dephosphorylation (GO:0035335)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|protein dephosphorylation (GO:0006470)|response to denervation involved in regulation of muscle adaptation (GO:0014894)|small molecule metabolic process (GO:0044281)|transforming growth factor beta receptor signaling pathway (GO:0007179)	cytosol (GO:0005829)|early endosome membrane (GO:0031901)|extracellular space (GO:0005615)	metal ion binding (GO:0046872)|protein serine/threonine phosphatase activity (GO:0004722)|protein tyrosine phosphatase activity (GO:0004725)			breast(10)|endometrium(2)|kidney(2)|large_intestine(5)|lung(12)|skin(5)	36	Medulloblastoma(34;0.127)|all_neural(34;0.237)					ACAGACAGGTGACTTCACACC	0.522																																																	0								G	LEU/SER	1,4405	2.1+/-5.4	0,1,2202	108.0	110.0	109.0		2882	5.7	1.0	17		109	0,8600		0,0,4300	no	missense	MTMR4	NM_004687.4	145	0,1,6502	AA,AG,GG		0.0,0.0227,0.0077	possibly-damaging	961/1196	56572621	1,13005	2203	4300	6503	SO:0001583	missense	9110			AB014547	CCDS11608.1	17q22-q23	2011-06-09				ENSG00000108389		"""Zinc fingers, FYVE domain containing"", ""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7452	protein-coding gene	gene with protein product		603559				9736772	Standard	NM_004687		Approved	KIAA0647, ZFYVE11	uc002iwj.2	Q9NYA4		ENST00000323456.5:c.2882C>T	17.37:g.56572621G>A	ENSP00000325285:p.Ser961Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTZ6|Q8IV27|Q9Y4D5	Missense_Mutation	SNP	pfam_Myotub-related,pfam_Znf_FYVE,superfamily_Znf_FYVE_PHD,smart_Znf_FYVE,pfscan_Znf_FYVE-rel,pfscan_Tyr/Dual-specificity_Pase	p.S961L	ENST00000323456.5	37	c.2882	CCDS11608.1	17	.	.	.	.	.	.	.	.	.	.	G	14.53	2.562589	0.45694	2.27E-4	0.0	ENSG00000108389	ENST00000323456	D	0.93019	-3.15	5.68	5.68	0.88126	.	0.564454	0.16432	N	0.214678	D	0.88548	0.6466	L	0.36672	1.1	0.26198	N	0.979484	P	0.38922	0.651	B	0.36030	0.216	T	0.83111	-0.0123	10	0.48119	T	0.1	.	9.4602	0.38781	0.0762:0.1446:0.7791:0.0	.	961	Q9NYA4	MTMR4_HUMAN	L	961	ENSP00000325285:S961L	ENSP00000325285:S961L	S	-	2	0	MTMR4	53927620	0.998000	0.40836	1.000000	0.80357	0.929000	0.56500	2.943000	0.49026	2.674000	0.91012	0.555000	0.69702	TCA	MTMR4	-	NULL		0.522	MTMR4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTMR4	HGNC	protein_coding	OTTHUMT00000444721.1	G	NM_004687		56572621	-1	no_errors	ENST00000323456	ensembl	human	known	70_37	missense	SNP	1.000	A
MUC12	10071	genome.wustl.edu	37	7	100641798	100641798	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr7:100641798C>G	ENST00000379442.3	+	5	8383	c.8383C>G	c.(8383-8385)Cca>Gca	p.P2795A	MUC12_ENST00000536621.1_Missense_Mutation_p.P2652A			Q9UKN1	MUC12_HUMAN	mucin 12, cell surface associated	2795	28 X 19 AA approximate tandem repeats of E-E-S-X-X-X-H-X-X-P-X-X-T-X-T-X-X-X-P.|Ser-rich.				cellular protein metabolic process (GO:0044267)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|regulation of cell growth (GO:0001558)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)				breast(6)|central_nervous_system(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|prostate(1)|stomach(13)	25						TACCACAACACCAGGCCTCAG	0.532																																																	0													2.0	2.0	2.0					7																	100641798		552	1282	1834	SO:0001583	missense	10071			AF147790, AF147791	CCDS55139.1	7q22	2007-01-17	2006-03-14		ENSG00000205277	ENSG00000205277		"""Mucins"""	7510	protein-coding gene	gene with protein product		604609	"""mucin 11"""	MUC11		10463611	Standard	NM_001164462		Approved		uc003uxo.3	Q9UKN1	OTTHUMG00000157042	ENST00000379442.3:c.8383C>G	7.37:g.100641798C>G	ENSP00000368755:p.Pro2795Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND38|F5GWV9|Q9UKN0	Missense_Mutation	SNP	pfam_SEA	p.P2795A	ENST00000379442.3	37	c.8383		7	.	.	.	.	.	.	.	.	.	.	-	0.416	-0.910911	0.02434	.	.	ENSG00000205277	ENST00000379442;ENST00000536621	T;T	0.14391	2.51;2.51	0.704	-1.41	0.08941	.	.	.	.	.	T	0.04182	0.0116	N	0.08118	0	0.09310	N	1	.	.	.	.	.	.	T	0.38908	-0.9639	6	0.07813	T	0.8	.	.	.	.	.	.	.	.	A	2795;2652	ENSP00000368755:P2795A;ENSP00000441929:P2652A	ENSP00000368755:P2795A	P	+	1	0	MUC12	100428518	0.001000	0.12720	0.002000	0.10522	0.031000	0.12232	-0.987000	0.03743	-1.952000	0.01027	-1.436000	0.01078	CCA	MUC12	-	NULL		0.532	MUC12-001	NOVEL	basic|appris_candidate_longest	protein_coding	MUC12	HGNC	protein_coding	OTTHUMT00000347234.1	C	XM_379904		100641798	+1	no_errors	ENST00000379442	ensembl	human	known	70_37	missense	SNP	0.002	G
MUC5B	727897	genome.wustl.edu	37	11	1274084	1274084	+	Missense_Mutation	SNP	G	G	A	rs369603904		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr11:1274084G>A	ENST00000529681.1	+	33	15149	c.15091G>A	c.(15091-15093)Gtg>Atg	p.V5031M	MUC5B_ENST00000447027.1_Missense_Mutation_p.V5034M	NM_002458.2	NP_002449.2	Q9HC84	MUC5B_HUMAN	mucin 5B, oligomeric mucus/gel-forming	5031					cellular protein metabolic process (GO:0044267)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to glucocorticoid stimulus (GO:0071385)|cellular response to retinoic acid (GO:0071300)|epithelial cell differentiation (GO:0030855)|O-glycan processing (GO:0016266)|post-translational protein modification (GO:0043687)|response to lipopolysaccharide (GO:0032496)|response to ozone (GO:0010193)|response to sulfur dioxide (GO:0010477)|response to vitamin A (GO:0033189)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi lumen (GO:0005796)				cervix(2)|endometrium(36)|kidney(9)|lung(89)|urinary_tract(1)	137		all_cancers(49;6.97e-08)|all_epithelial(84;3.45e-05)|Breast(177;0.000307)|Ovarian(85;0.000953)|Medulloblastoma(188;0.0109)|all_neural(188;0.0299)|Lung NSC(207;0.229)		BRCA - Breast invasive adenocarcinoma(625;0.00141)|Lung(200;0.0853)|LUSC - Lung squamous cell carcinoma(625;0.1)		GGCCAGGTGCGTGGGTGACAA	0.632																																																	0								G	MET/VAL	0,4278		0,0,2139	56.0	66.0	63.0		15091	3.9	0.1	11		63	2,8450		0,2,4224	no	missense	MUC5B	NM_002458.2	21	0,2,6363	AA,AG,GG		0.0237,0.0,0.0157	probably-damaging	5031/5763	1274084	2,12728	2139	4226	6365	SO:0001583	missense	727897			U95031, AF086604	CCDS44515.1, CCDS44515.2	11p15.5	2007-01-19	2006-03-14			ENSG00000117983		"""Mucins"""	7516	protein-coding gene	gene with protein product		600770	"""mucin 5, subtype B, tracheobronchial"""	MUC5		9804771	Standard	NM_002458		Approved	MG1	uc001lta.3	Q9HC84		ENST00000529681.1:c.15091G>A	11.37:g.1274084G>A	ENSP00000436812:p.Val5031Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O00447|O00573|O14985|O15494|O95291|O95451|Q14881|Q7M4S5|Q99552|Q9UE28	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,pfam_VWF_C,superfamily_TIL_dom,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_VWC_out,smart_VWF_C,smart_Cys_knot_C,pfscan_Cys_knot_C,pfscan_VWF_C	p.V5034M	ENST00000529681.1	37	c.15100	CCDS44515.2	11	.	.	.	.	.	.	.	.	.	.	G	9.251	1.040801	0.19669	0.0	2.37E-4	ENSG00000117983	ENST00000529681;ENST00000447027;ENST00000349637;ENST00000406844	T;T	0.16743	2.32;2.51	4.86	3.93	0.45458	.	.	.	.	.	T	0.16214	0.0390	L	0.36672	1.1	0.09310	N	1	D;D	0.63880	0.993;0.993	B;B	0.44278	0.352;0.445	T	0.08806	-1.0704	9	0.87932	D	0	.	9.5817	0.39493	0.0:0.161:0.6837:0.1553	.	5353;5034	A7Y9J9;E9PBJ0	.;.	M	5031;5034;4975;4730	ENSP00000436812:V5031M;ENSP00000415793:V5034M	ENSP00000343037:V4975M	V	+	1	0	MUC5B	1230660	0.002000	0.14202	0.112000	0.21494	0.032000	0.12392	0.755000	0.26405	1.310000	0.45006	0.561000	0.74099	GTG	MUC5B	-	NULL		0.632	MUC5B-002	NOVEL	basic|appris_candidate|CCDS	protein_coding	MUC5B	HGNC	protein_coding	OTTHUMT00000390041.2	G	XM_001126093		1274084	+1	no_errors	ENST00000447027	ensembl	human	known	70_37	missense	SNP	0.271	A
MYO9A	4649	genome.wustl.edu	37	15	72119066	72119066	+	Missense_Mutation	SNP	T	T	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr15:72119066T>G	ENST00000356056.5	-	42	7974	c.7502A>C	c.(7501-7503)aAa>aCa	p.K2501T	MYO9A_ENST00000444904.1_Missense_Mutation_p.K2482T|MYO9A_ENST00000564571.1_3'UTR|MYO9A_ENST00000424560.1_Missense_Mutation_p.K2572T	NM_006901.3	NP_008832.2	B2RTY4	MYO9A_HUMAN	myosin IXA	2501	Tail.				regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|visual perception (GO:0007601)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|GTPase activator activity (GO:0005096)|metal ion binding (GO:0046872)|motor activity (GO:0003774)			NS(4)|breast(3)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(29)|lung(27)|ovary(1)|pancreas(1)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	88						ATTCTTTAATTTTTGTTTGCC	0.502																																																	0													156.0	161.0	159.0					15																	72119066		2199	4297	6496	SO:0001583	missense	4649			AF117888	CCDS10239.1	15q22-q23	2011-09-27			ENSG00000066933	ENSG00000066933		"""Myosins / Myosin superfamily : Class IX"""	7608	protein-coding gene	gene with protein product		604875				10409426	Standard	NM_006901		Approved	FLJ11061, FLJ13244, MGC71859	uc002atl.5	B2RTY4	OTTHUMG00000133440	ENST00000356056.5:c.7502A>C	15.37:g.72119066T>G	ENSP00000348349:p.Lys2501Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1T5|C9IYB3|C9JA86|Q14787|Q3YLD7|Q3YLD8|Q6P986|Q9H8T5|Q9NTG2|Q9NUY2|Q9UEP3|Q9UNJ2	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_RhoGAP_dom,pfam_Ras-assoc,pfam_IQ_motif_EF-hand-BS,superfamily_Rho_GTPase_activation_prot,smart_Ras-assoc,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_RhoGAP_dom,pfscan_IQ_motif_EF-hand-BS,pfscan_Ras-assoc,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_RhoGAP_dom,prints_Myosin_head_motor_dom	p.K2572T	ENST00000356056.5	37	c.7715	CCDS10239.1	15	.	.	.	.	.	.	.	.	.	.	T	18.99	3.739620	0.69304	.	.	ENSG00000066933	ENST00000356056;ENST00000424560;ENST00000444904	D;D;D	0.88124	-2.33;-2.34;-2.32	5.2	5.2	0.72013	.	.	.	.	.	D	0.88753	0.6522	L	0.32530	0.975	0.42644	D	0.993421	D;D	0.76494	0.998;0.999	P;P	0.61658	0.863;0.892	D	0.90366	0.4377	9	0.72032	D	0.01	.	15.042	0.71799	0.0:0.0:0.0:1.0	.	2501;2265	B2RTY4;B2RTY4-5	MYO9A_HUMAN;.	T	2501;2572;2482	ENSP00000348349:K2501T;ENSP00000399162:K2572T;ENSP00000398250:K2482T	ENSP00000348349:K2501T	K	-	2	0	MYO9A	69906120	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	5.761000	0.68801	1.949000	0.56562	0.460000	0.39030	AAA	MYO9A	-	NULL		0.502	MYO9A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO9A	HGNC	protein_coding	OTTHUMT00000257308.1	T	NM_006901		72119066	-1	no_errors	ENST00000424560	ensembl	human	known	70_37	missense	SNP	1.000	G
NAA15	80155	genome.wustl.edu	37	4	140291474	140291474	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:140291474G>T	ENST00000296543.5	+	15	2186	c.1863G>T	c.(1861-1863)caG>caT	p.Q621H	NAA15_ENST00000398947.1_Missense_Mutation_p.Q621H	NM_057175.3	NP_476516.1	Q9BXJ9	NAA15_HUMAN	N(alpha)-acetyltransferase 15, NatA auxiliary subunit	621	Interaction with HYPK.				angiogenesis (GO:0001525)|cell differentiation (GO:0030154)|N-terminal protein amino acid acetylation (GO:0006474)|negative regulation of apoptotic process (GO:0043066)|positive regulation of transcription, DNA-templated (GO:0045893)|protein stabilization (GO:0050821)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|membrane (GO:0016020)|NatA complex (GO:0031415)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	N-acetyltransferase activity (GO:0008080)|poly(A) RNA binding (GO:0044822)|ribosome binding (GO:0043022)			NS(1)|endometrium(3)|large_intestine(7)|liver(2)|lung(8)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	29						aaaagcagcagagaaatcaga	0.363																																																	0													70.0	68.0	69.0					4																	140291474		1841	4087	5928	SO:0001583	missense	80155			AY039242	CCDS43270.1	4q31.1	2010-01-14	2010-01-14	2010-01-14	ENSG00000164134	ENSG00000164134		"""N(alpha)-acetyltransferase subunits"""	30782	protein-coding gene	gene with protein product		608000	"""NMDA receptor regulated 1"""	NARG1		12140756, 11478804, 19660095	Standard	XM_005263236		Approved	TBDN100, NATH, FLJ13340	uc003ihu.1	Q9BXJ9	OTTHUMG00000137363	ENST00000296543.5:c.1863G>T	4.37:g.140291474G>T	ENSP00000296543:p.Gln621His	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNY6|Q52LG9|Q8IWH4|Q8NEV2|Q9H8P6	Missense_Mutation	SNP	pfam_NatA_aux_su,smart_TPR_repeat,pirsf_NatA_aux_su,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.Q621H	ENST00000296543.5	37	c.1863	CCDS43270.1	4	.	.	.	.	.	.	.	.	.	.	G	18.62	3.663936	0.67700	.	.	ENSG00000164134	ENST00000296543;ENST00000544077;ENST00000398947	T;T	0.44482	0.92;0.92	5.92	4.12	0.48240	.	0.322238	0.30723	N	0.009001	T	0.47432	0.1445	L	0.38175	1.15	0.80722	D	1	P	0.51791	0.948	P	0.57776	0.827	T	0.37686	-0.9695	10	0.49607	T	0.09	-1.5886	11.1294	0.48339	0.1605:0.0:0.8395:0.0	.	621	Q9BXJ9	NAA15_HUMAN	H	621;495;621	ENSP00000296543:Q621H;ENSP00000381920:Q621H	ENSP00000296543:Q621H	Q	+	3	2	NAA15	140510924	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	0.725000	0.25970	0.738000	0.32606	0.650000	0.86243	CAG	NAA15	-	pirsf_NatA_aux_su		0.363	NAA15-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NAA15	HGNC	protein_coding	OTTHUMT00000267839.2	G	NM_057175		140291474	+1	no_errors	ENST00000296543	ensembl	human	known	70_37	missense	SNP	1.000	T
NBAS	51594	genome.wustl.edu	37	2	15614432	15614432	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:15614432G>A	ENST00000281513.5	-	15	1383	c.1358C>T	c.(1357-1359)gCc>gTc	p.A453V	NBAS_ENST00000441750.1_Missense_Mutation_p.A453V	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	453					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						TCGTTTGGGGGCAAGTTTAAT	0.328																																																	0													31.0	31.0	31.0					2																	15614432		2203	4300	6503	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.1358C>T	2.37:g.15614432G>A	ENSP00000281513:p.Ala453Val	Somatic		WXS	Illumina HiSeq	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.A453V	ENST00000281513.5	37	c.1358	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	G	9.523	1.108875	0.20714	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.09817	2.94;3.08	5.76	4.85	0.62838	.	0.052446	0.85682	D	0.000000	T	0.07234	0.0183	N	0.20685	0.6	0.29714	N	0.839188	B	0.32829	0.386	B	0.28553	0.091	T	0.08269	-1.0730	10	0.87932	D	0	.	10.7047	0.45948	0.0766:0.1338:0.7896:0.0	.	453	A2RRP1	NBAS_HUMAN	V	453	ENSP00000413201:A453V;ENSP00000281513:A453V	ENSP00000281513:A453V	A	-	2	0	NBAS	15531883	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	4.272000	0.58908	2.721000	0.93114	0.563000	0.77884	GCC	NBAS	-	NULL		0.328	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	G	NM_015909		15614432	-1	no_errors	ENST00000281513	ensembl	human	known	70_37	missense	SNP	1.000	A
NINL	22981	genome.wustl.edu	37	20	25443162	25443162	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr20:25443162C>G	ENST00000278886.6	-	20	3512	c.3439G>C	c.(3439-3441)Gat>Cat	p.D1147H	NINL_ENST00000422516.1_Missense_Mutation_p.D798H	NM_025176.4	NP_079452.3	Q9Y2I6	NINL_HUMAN	ninein-like	1147					G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)	cytosol (GO:0005829)|microtubule (GO:0005874)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(13)|lung(25)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	57						GATAATTGATCCTTGTAGTTC	0.383																																																	0													126.0	123.0	124.0					20																	25443162		2203	4300	6503	SO:0001583	missense	22981				CCDS33452.1	20p11.22-p11.1	2013-01-10			ENSG00000101004	ENSG00000101004		"""EF-hand domain containing"""	29163	protein-coding gene	gene with protein product	"""ninein-like protein"""	609580				10231032	Standard	XM_005260678		Approved	KIAA0980, NLP	uc002wux.1	Q9Y2I6	OTTHUMG00000032127	ENST00000278886.6:c.3439G>C	20.37:g.25443162C>G	ENSP00000278886:p.Asp1147His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJN0|B3V9H6|B7Z1V8|Q5JYP0|Q8NE38|Q9NQE3	Missense_Mutation	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D1147H	ENST00000278886.6	37	c.3439	CCDS33452.1	20	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	14.92|14.92	2.680036|2.680036	0.47886|0.47886	.|.	.|.	ENSG00000101004|ENSG00000101004	ENST00000278886;ENST00000422516|ENST00000336104	T;T|.	0.32272|.	3.44;1.46|.	5.17|5.17	3.11|3.11	0.35812|0.35812	.|.	0.295951|.	0.32548|.	N|.	0.005953|.	T|T	0.42154|0.42154	0.1190|0.1190	L|L	0.46157|0.46157	1.445|1.445	0.24276|0.24276	N|N	0.995221|0.995221	D;D|.	0.71674|.	0.998;0.99|.	D;P|.	0.64321|.	0.924;0.898|.	T|T	0.25433|0.25433	-1.0132|-1.0132	10|5	0.59425|.	D|.	0.04|.	-14.1715|-14.1715	10.7599|10.7599	0.46258|0.46258	0.0:0.8198:0.0:0.1802|0.0:0.8198:0.0:0.1802	.|.	798;1147|.	Q9Y2I6-2;Q9Y2I6|.	.;NINL_HUMAN|.	H|A	1147;798|99	ENSP00000278886:D1147H;ENSP00000410431:D798H|.	ENSP00000278886:D1147H|.	D|G	-|-	1|2	0|0	NINL|NINL	25391162|25391162	0.906000|0.906000	0.30813|0.30813	0.206000|0.206000	0.23566|0.23566	0.799000|0.799000	0.45148|0.45148	0.145000|0.145000	0.16157|0.16157	1.425000|1.425000	0.47237|0.47237	0.561000|0.561000	0.74099|0.74099	GAT|GGA	NINL	-	NULL		0.383	NINL-007	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	NINL	HGNC	protein_coding	OTTHUMT00000078445.3	C	NM_025176		25443162	-1	no_errors	ENST00000278886	ensembl	human	known	70_37	missense	SNP	0.928	G
NR3C1	2908	genome.wustl.edu	37	5	142658932	142658932	+	3'UTR	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:142658932G>A	ENST00000343796.2	-	0	5849				NR3C1_ENST00000394464.2_3'UTR|NR3C1_ENST00000415690.2_Silent_p.I742I	NM_001018074.1|NM_001018075.1|NM_001018077.1	NP_001018084.1|NP_001018085.1|NP_001018087.1	P04150	GCR_HUMAN	nuclear receptor subfamily 3, group C, member 1 (glucocorticoid receptor)						adrenal gland development (GO:0030325)|chromatin modification (GO:0016568)|gene expression (GO:0010467)|glucocorticoid metabolic process (GO:0008211)|mammary gland duct morphogenesis (GO:0060603)|negative regulation of glucocorticoid mediated signaling pathway (GO:1900170)|positive regulation of neuron apoptotic process (GO:0043525)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of glucocorticoid biosynthetic process (GO:0031946)|regulation of gluconeogenesis (GO:0006111)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction (GO:0007165)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	glucocorticoid receptor activity (GO:0004883)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid binding (GO:0005496)|zinc ion binding (GO:0008270)			breast(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(10)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	35		Acute lymphoblastic leukemia(2;3.2e-05)|all_hematologic(2;0.000361)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)		Alclometasone(DB00240)|Amcinonide(DB00288)|Beclomethasone(DB00394)|Betamethasone(DB00443)|Budesonide(DB01222)|Ciclesonide(DB01410)|Clobetasol propionate(DB01013)|Clocortolone(DB00838)|Cortisone acetate(DB01380)|Desonide(DB01260)|Desoximetasone(DB00547)|Dexamethasone(DB01234)|Diflorasone(DB00223)|Difluprednate(DB06781)|Fludrocortisone(DB00687)|Flumethasone Pivalate(DB00663)|Flunisolide(DB00180)|Fluocinolone Acetonide(DB00591)|Fluocinonide(DB01047)|Fluorometholone(DB00324)|Fluoxymesterone(DB01185)|Flurandrenolide(DB00846)|Fluticasone furoate(DB08906)|Fluticasone Propionate(DB00588)|Halobetasol Propionate(DB00596)|Hydrocortamate(DB00769)|Hydrocortisone(DB00741)|Loteprednol(DB00873)|Medrysone(DB00253)|Megestrol acetate(DB00351)|Methylprednisolone(DB00959)|Mifepristone(DB00834)|Mometasone(DB00764)|Paramethasone(DB01384)|Prednicarbate(DB01130)|Prednisolone(DB00860)|Prednisone(DB00635)|Rimexolone(DB00896)|Spironolactone(DB00421)|Triamcinolone(DB00620)	ATGAAAATCAGATTAATGTGT	0.333																																																	0													165.0	149.0	154.0					5																	142658932		1844	4083	5927	SO:0001624	3_prime_UTR_variant	2908			X03225	CCDS4278.1, CCDS34258.1, CCDS47298.1	5q31-q32	2013-01-16	2002-08-27		ENSG00000113580	ENSG00000113580		"""Nuclear hormone receptors"""	7978	protein-coding gene	gene with protein product		138040	"""nuclear receptor subfamily 3, group C, member 1"""	GRL		2867473	Standard	NM_001204258		Approved	GR	uc003lnb.3	P04150	OTTHUMG00000129677	ENST00000343796.2:c.*2522C>T	5.37:g.142658932G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0ZXF9|B0LPG8|D3DQF4|P04151|Q53EP5|Q6N0A4	Silent	SNP	pfam_Glcrtcd_rcpt,pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Glcrtcd_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.I742	ENST00000343796.2	37	c.2226	CCDS4278.1	5																																																																																			NR3C1	-	NULL		0.333	NR3C1-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	NR3C1	HGNC	protein_coding	OTTHUMT00000370829.1	G			142658932	-1	no_errors	ENST00000415690	ensembl	human	known	70_37	silent	SNP	0.007	A
HABP2	3026	genome.wustl.edu	37	10	115351979	115351979	+	IGR	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr10:115351979G>A	ENST00000351270.3	+	0	3009				NRAP_ENST00000360478.3_Missense_Mutation_p.R1505W|NRAP_ENST00000359988.3_Missense_Mutation_p.R1540W|NRAP_ENST00000369358.4_Missense_Mutation_p.R1548W|NRAP_ENST00000369360.3_Missense_Mutation_p.R1513W	NM_004132.3	NP_004123.1	Q14520	HABP2_HUMAN	hyaluronan binding protein 2						cell adhesion (GO:0007155)	extracellular region (GO:0005576)|extracellular space (GO:0005615)	glycosaminoglycan binding (GO:0005539)|serine-type endopeptidase activity (GO:0004252)			breast(2)|endometrium(1)|kidney(1)|large_intestine(5)|lung(8)|ovary(2)|skin(2)|upper_aerodigestive_tract(2)	23		Colorectal(252;0.0233)|Breast(234;0.0672)		Epithelial(162;0.00319)|all cancers(201;0.0112)	Hyaluronan(DB08818)	CTAGATGCCCGGGCAGTCTGG	0.507																																																	0													75.0	74.0	74.0					10																	115351979		2203	4300	6503	SO:0001628	intergenic_variant	4892				CCDS7577.1, CCDS53579.1	10q25.3	2008-08-01	2001-11-28		ENSG00000148702	ENSG00000148702			4798	protein-coding gene	gene with protein product	"""plasma hyaluronan binding protein"", ""factor VII activating protein"""	603924	"""hyaluronan-binding protein 2"""			8827452, 12437095	Standard	NM_004132		Approved	HABP, PHBP, HGFAL, FSAP	uc001lai.4	Q14520	OTTHUMG00000019073		10.37:g.115351979G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K467|B7Z8U5|F5H5M6|O00663	Missense_Mutation	SNP	pfam_Nebulin_35r-motif,pfam_Znf_LIM,smart_Znf_LIM,smart_Nebulin_35r-motif,pfscan_Znf_LIM,pfscan_Nebulin_35r-motif,prints_Nebulin	p.R1548W	ENST00000351270.3	37	c.4642	CCDS7577.1	10	.	.	.	.	.	.	.	.	.	.	G	23.9	4.467789	0.84533	.	.	ENSG00000197893	ENST00000369358;ENST00000369360;ENST00000359988;ENST00000360478	T;T;T;T	0.21543	2.28;2.27;2.14;2.0	5.67	3.49	0.39957	.	0.053770	0.64402	D	0.000001	T	0.33847	0.0877	L	0.39898	1.24	0.39846	D	0.973179	D;D;D	0.76494	0.999;0.999;0.999	D;D;P	0.67382	0.918;0.951;0.895	T	0.19811	-1.0294	10	0.87932	D	0	.	12.2035	0.54339	0.0:0.0:0.4366:0.5634	.	1540;1505;1540	A0AVL2;Q86VF7-4;Q86VF7	.;.;NRAP_HUMAN	W	1548;1513;1540;1505	ENSP00000358365:R1548W;ENSP00000358367:R1513W;ENSP00000353078:R1540W;ENSP00000353666:R1505W	ENSP00000353078:R1540W	R	-	1	2	NRAP	115341969	1.000000	0.71417	0.965000	0.40720	0.997000	0.91878	4.548000	0.60718	1.472000	0.48140	0.655000	0.94253	CGG	NRAP	-	smart_Nebulin_35r-motif,pfscan_Nebulin_35r-motif		0.507	HABP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NRAP	HGNC	protein_coding	OTTHUMT00000050428.1	G	NM_004132		115351979	-1	no_errors	ENST00000369358	ensembl	human	known	70_37	missense	SNP	1.000	A
OR10S1	219873	genome.wustl.edu	37	11	123847819	123847819	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr11:123847819C>T	ENST00000531945.1	-	1	669	c.580G>A	c.(580-582)Gac>Aac	p.D194N		NM_001004474.1	NP_001004474.1	Q8NGN2	O10S1_HUMAN	olfactory receptor, family 10, subfamily S, member 1	194						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D194N(1)		endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(16)|ovary(1)|prostate(2)|skin(2)|urinary_tract(1)	36		Breast(109;0.00867)|Medulloblastoma(222;0.0523)|Lung NSC(97;0.118)|all_lung(97;0.126)|all_neural(223;0.22)		BRCA - Breast invasive adenocarcinoma(274;4.88e-06)|OV - Ovarian serous cystadenocarcinoma(99;0.0399)		GGGGGTATGTCGCAGAAGAAG	0.567																																																	1	Substitution - Missense(1)	large_intestine(1)											93.0	76.0	82.0					11																	123847819		2202	4299	6501	SO:0001583	missense	219873			BK004509	CCDS31701.1	11q24.1	2012-08-09			ENSG00000196248	ENSG00000196248		"""GPCR / Class A : Olfactory receptors"""	14807	protein-coding gene	gene with protein product							Standard	NM_001004474		Approved		uc001pzm.1	Q8NGN2	OTTHUMG00000165963	ENST00000531945.1:c.580G>A	11.37:g.123847819C>T	ENSP00000431914:p.Asp194Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EH43|Q6IEV3|Q96R78	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D194N	ENST00000531945.1	37	c.580	CCDS31701.1	11	.	.	.	.	.	.	.	.	.	.	C	16.40	3.111956	0.56398	.	.	ENSG00000196248	ENST00000531945	T	0.00188	8.59	5.08	4.17	0.49024	GPCR, rhodopsin-like superfamily (1);	0.000000	0.43919	U	0.000510	T	0.00412	0.0013	M	0.91459	3.21	0.25226	N	0.989868	D	0.58620	0.983	P	0.46208	0.507	T	0.28996	-1.0026	10	0.87932	D	0	-21.1723	13.5941	0.61979	0.0:0.9245:0.0:0.0755	.	194	Q8NGN2	O10S1_HUMAN	N	194	ENSP00000431914:D194N	ENSP00000431914:D194N	D	-	1	0	OR10S1	123353029	0.999000	0.42202	0.998000	0.56505	0.700000	0.40528	2.165000	0.42396	1.379000	0.46325	-0.127000	0.14921	GAC	OR10S1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt		0.567	OR10S1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR10S1	HGNC	protein_coding	OTTHUMT00000387265.2	C	NM_001004474		123847819	-1	no_errors	ENST00000531945	ensembl	human	known	70_37	missense	SNP	0.981	T
PANK4	55229	genome.wustl.edu	37	1	2446787	2446787	+	Intron	SNP	C	C	T	rs113463932		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:2446787C>T	ENST00000378466.3	-	10	1387				PANK4_ENST00000435556.3_Intron	NM_018216.1	NP_060686.1	Q9NVE7	PANK4_HUMAN	pantothenate kinase 4						coenzyme A biosynthetic process (GO:0015937)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|pantothenate kinase activity (GO:0004594)			breast(2)|cervix(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|lung(4)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(4)	23	all_cancers(77;0.000158)|all_epithelial(69;8.01e-05)|all_lung(157;0.0212)|Lung NSC(156;0.0376)|Ovarian(185;0.0634)	all_epithelial(116;3.18e-20)|all_lung(118;1.67e-08)|Lung NSC(185;2.69e-06)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;1.54e-37)|OV - Ovarian serous cystadenocarcinoma(86;6.95e-23)|GBM - Glioblastoma multiforme(42;2.81e-08)|Colorectal(212;4.25e-05)|COAD - Colon adenocarcinoma(227;0.000196)|Kidney(185;0.000342)|BRCA - Breast invasive adenocarcinoma(365;0.00445)|KIRC - Kidney renal clear cell carcinoma(229;0.00549)|STAD - Stomach adenocarcinoma(132;0.00644)|Lung(427;0.201)		CAACGTGCCTCGCAGACGCCA	0.522																																																	0																																										SO:0001627	intron_variant	55229			AK001644	CCDS42.1	1p36.32	2008-02-05			ENSG00000157881	ENSG00000157881			19366	protein-coding gene	gene with protein product		606162				11479594	Standard	XR_241034		Approved	FLJ10782	uc001ajm.1	Q9NVE7	OTTHUMG00000000791	ENST00000378466.3:c.1374+213G>A	1.37:g.2446787C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B9DI84|Q53EU3|Q5TA84|Q7RTX3|Q9H3X5	Silent	SNP	pfam_Type_II_PanK,superfamily_DUF89	p.A182	ENST00000378466.3	37	c.546	CCDS42.1	1																																																																																			PANK4	-	NULL		0.522	PANK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PANK4	HGNC	protein_coding	OTTHUMT00000002082.1	C			2446787	-1	no_errors	ENST00000468002	ensembl	human	known	70_37	silent	SNP	0.001	T
PCDHA7	56141	genome.wustl.edu	37	5	140214113	140214113	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:140214113G>A	ENST00000525929.1	+	1	145	c.145G>A	c.(145-147)Gcg>Acg	p.A49T	PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA7_ENST00000378125.3_Missense_Mutation_p.A49T|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA1_ENST00000394633.3_Intron	NM_018910.2	NP_061733.1	Q9UN72	PCDA7_HUMAN	protocadherin alpha 7	49	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|biliary_tract(1)|breast(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(27)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	63			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GGGCCGCATCGCGCAGGACCT	0.602																																					NSCLC(160;258 2013 5070 22440 28951)												0													58.0	73.0	68.0					5																	140214113		2203	4299	6502	SO:0001583	missense	56141			AF152485	CCDS54918.1	5q31	2010-11-26				ENSG00000204963		"""Cadherins / Protocadherins : Clustered"""	8673	other	complex locus constituent	"""KIAA0345-like 7"", ""ortholog to mouse CNR4"""	606313		CNRS4		10380929, 10662547	Standard	NM_018910		Approved	CNR4, CRNR4		Q9UN72		ENST00000525929.1:c.145G>A	5.37:g.140214113G>A	ENSP00000436426:p.Ala49Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O75282	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A49T	ENST00000525929.1	37	c.145	CCDS54918.1	5	.	.	.	.	.	.	.	.	.	.	G	24.4	4.524256	0.85600	.	.	ENSG00000204963	ENST00000525929;ENST00000378125	T;T	0.55413	0.52;0.52	4.17	4.17	0.49024	Cadherin, N-terminal (1);Cadherin (2);Cadherin-like (1);	.	.	.	.	T	0.72550	0.3474	M	0.86343	2.81	0.35762	D	0.820232	D;D	0.76494	0.998;0.999	P;P	0.58660	0.729;0.843	D	0.83898	0.0288	9	0.59425	D	0.04	.	16.9132	0.86145	0.0:0.0:1.0:0.0	.	49;49	Q9UN72-2;Q9UN72	.;PCDA7_HUMAN	T	49	ENSP00000436426:A49T;ENSP00000367365:A49T	ENSP00000367365:A49T	A	+	1	0	PCDHA7	140194297	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	5.471000	0.66762	2.028000	0.59812	0.449000	0.29647	GCG	PCDHA7	-	pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin		0.602	PCDHA7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA7	HGNC	protein_coding	OTTHUMT00000372887.2	G	NM_018910		140214113	+1	no_errors	ENST00000525929	ensembl	human	known	70_37	missense	SNP	1.000	A
PCDHA8	56140	genome.wustl.edu	37	5	140221358	140221358	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:140221358G>A	ENST00000531613.1	+	1	452	c.452G>A	c.(451-453)cGg>cAg	p.R151Q	PCDHA5_ENST00000529619.1_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA6_ENST00000529310.1_Intron|PCDHA8_ENST00000378123.3_Missense_Mutation_p.R151Q|PCDHA1_ENST00000394633.3_Intron	NM_018911.2	NP_061734.1	Q9Y5H6	PCDA8_HUMAN	protocadherin alpha 8	151					cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			NS(2)|breast(3)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(10)|lung(31)|ovary(2)|prostate(2)|skin(4)|stomach(2)|upper_aerodigestive_tract(6)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			CCAGACTCTCGGTTTCCGCTA	0.483																																																	0													82.0	89.0	87.0					5																	140221358		2203	4300	6503	SO:0001583	missense	56140			AF152486	CCDS54919.1	5q31	2010-11-26				ENSG00000204962		"""Cadherins / Protocadherins : Clustered"""	8674	other	complex locus constituent	"""KIAA0345-like 6"""	606314				10380929	Standard	NM_018911		Approved			Q9Y5H6		ENST00000531613.1:c.452G>A	5.37:g.140221358G>A	ENSP00000434655:p.Arg151Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGT7|O75281	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R151Q	ENST00000531613.1	37	c.452	CCDS54919.1	5	.	.	.	.	.	.	.	.	.	.	G	28.2	4.901422	0.92035	.	.	ENSG00000204962	ENST00000531613;ENST00000378123	T;T	0.52526	0.66;0.66	3.72	3.72	0.42706	Cadherin (2);Cadherin-like (1);	2.567710	0.02688	U	0.110285	T	0.65811	0.2727	M	0.78801	2.425	0.23376	N	0.997807	P;B	0.34522	0.455;0.4	B;B	0.43867	0.434;0.143	T	0.61342	-0.7082	10	0.72032	D	0.01	.	15.9239	0.79597	0.0:0.0:1.0:0.0	.	151;151	Q9Y5H6;Q9Y5H6-2	PCDA8_HUMAN;.	Q	151	ENSP00000434655:R151Q;ENSP00000367363:R151Q	ENSP00000367363:R151Q	R	+	2	0	PCDHA8	140201542	0.012000	0.17670	0.502000	0.27614	0.893000	0.52053	1.737000	0.38197	1.794000	0.52575	0.552000	0.68991	CGG	PCDHA8	-	pfam_Cadherin,superfamily_Cadherin-like		0.483	PCDHA8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA8	HGNC	protein_coding	OTTHUMT00000372830.2	G	NM_018911		140221358	+1	no_errors	ENST00000531613	ensembl	human	known	70_37	missense	SNP	0.932	A
PCDHGC5	56097	genome.wustl.edu	37	5	140870650	140870650	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:140870650G>T	ENST00000252087.1	+	1	1843	c.1843G>T	c.(1843-1845)Gcc>Tcc	p.A615S	PCDHGC4_ENST00000306593.1_Intron|PCDHGA6_ENST00000517434.1_Intron|PCDHGA5_ENST00000518069.1_Intron|PCDHGA4_ENST00000571252.1_Intron|PCDHGA1_ENST00000517417.1_Intron|PCDHGA8_ENST00000398604.2_Intron|PCDHGA2_ENST00000394576.2_Intron|PCDHGA9_ENST00000573521.1_Intron|PCDHGB2_ENST00000522605.1_Intron|PCDHGA7_ENST00000518325.1_Intron|PCDHGB7_ENST00000398594.2_Intron|PCDHGC3_ENST00000308177.3_Intron|PCDHGB1_ENST00000523390.1_Intron|PCDHGA12_ENST00000252085.3_Intron|PCDHGB6_ENST00000520790.1_Intron|PCDHGA10_ENST00000398610.2_Intron|PCDHGA11_ENST00000518882.1_Intron|PCDHGB4_ENST00000519479.1_Intron|PCDHGA11_ENST00000398587.2_Intron|PCDHGA3_ENST00000253812.6_Intron|PCDHGB3_ENST00000576222.1_Intron	NM_018929.2|NM_032403.2|NM_032407.1	NP_061752.1|NP_115779.1|NP_115783.1	Q9Y5F6	PCDGM_HUMAN	protocadherin gamma subfamily C, 5	615	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(4)|large_intestine(4)|lung(10)|ovary(4)|prostate(1)|urinary_tract(2)	35			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			ACAGTCCACAGCCCCAGGACT	0.607																																																	0													75.0	69.0	71.0					5																	140870650		2203	4300	6503	SO:0001583	missense	56097			AF152526	CCDS4263.1, CCDS75350.1	5q31	2010-01-26			ENSG00000240764	ENSG00000240764		"""Cadherins / Protocadherins : Clustered"""	8718	other	protocadherin		606306				10380929	Standard	NM_018929		Approved	PCDH-GAMMA-C5	uc003lla.2	Q9Y5F6	OTTHUMG00000129624	ENST00000252087.1:c.1843G>T	5.37:g.140870650G>T	ENSP00000252087:p.Ala615Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9Y5C2	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.A615S	ENST00000252087.1	37	c.1843	CCDS4263.1	5	.	.	.	.	.	.	.	.	.	.	G	10.88	1.475407	0.26511	.	.	ENSG00000240764	ENST00000252087	T	0.20200	2.09	5.45	3.52	0.40303	Cadherin (4);Cadherin-like (1);	0.227351	0.31301	N	0.007898	T	0.11793	0.0287	N	0.11255	0.115	0.30715	N	0.748898	B;B	0.21821	0.061;0.024	B;B	0.15052	0.012;0.009	T	0.07790	-1.0754	10	0.59425	D	0.04	.	12.2094	0.54371	0.1618:0.0:0.8382:0.0	.	615;615	Q9Y5F6-2;Q9Y5F6	.;PCDGM_HUMAN	S	615	ENSP00000252087:A615S	ENSP00000252087:A615S	A	+	1	0	PCDHGC5	140850834	0.997000	0.39634	1.000000	0.80357	0.953000	0.61014	3.381000	0.52455	1.526000	0.49068	0.655000	0.94253	GCC	PCDHGC5	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.607	PCDHGC5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHGC5	HGNC	protein_coding	OTTHUMT00000251819.1	G	NM_018929		140870650	+1	no_errors	ENST00000252087	ensembl	human	known	70_37	missense	SNP	1.000	T
PLA2G12A	81579	genome.wustl.edu	37	4	110650839	110650839	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:110650839G>A	ENST00000243501.5	-	1	394	c.127C>T	c.(127-129)Cat>Tat	p.H43Y	PLA2G12A_ENST00000502283.1_Missense_Mutation_p.H43Y	NM_030821.4	NP_110448.2	Q9BZM1	PG12A_HUMAN	phospholipase A2, group XIIA	43					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi apparatus (GO:0005794)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)			kidney(1)|lung(1)|ovary(1)|skin(1)	4				OV - Ovarian serous cystadenocarcinoma(123;0.000268)		TCTATCTTATGAACGCCGTTC	0.632																																																	0													59.0	48.0	52.0					4																	110650839		2203	4299	6502	SO:0001583	missense	81579				CCDS3686.1	4q25	2010-11-24	2004-01-13	2004-01-14	ENSG00000123739	ENSG00000123739	3.1.1.4		18554	protein-coding gene	gene with protein product		611652	"""phospholipase A2, group XII"""	PLA2G12		11031251	Standard	NM_030821		Approved		uc003hzp.3	Q9BZM1	OTTHUMG00000131915	ENST00000243501.5:c.127C>T	4.37:g.110650839G>A	ENSP00000243501:p.His43Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BZ89	Missense_Mutation	SNP	pfam_PLipase_A2_secretory_G12,superfamily_PLipase_A2	p.H43Y	ENST00000243501.5	37	c.127	CCDS3686.1	4	.	.	.	.	.	.	.	.	.	.	G	27.3	4.821500	0.90873	.	.	ENSG00000123739	ENST00000243501;ENST00000502283	.	.	.	3.83	3.83	0.44106	.	0.000000	0.85682	D	0.000000	T	0.77068	0.4076	M	0.68317	2.08	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.83275	0.996;0.996	T	0.80692	-0.1269	9	0.66056	D	0.02	-22.4239	16.3027	0.82831	0.0:0.0:1.0:0.0	.	43;43	Q542Y6;Q9BZM1	.;PG12A_HUMAN	Y	43	.	ENSP00000243501:H43Y	H	-	1	0	PLA2G12A	110870288	1.000000	0.71417	0.998000	0.56505	0.936000	0.57629	8.427000	0.90275	2.119000	0.64992	0.313000	0.20887	CAT	PLA2G12A	-	pfam_PLipase_A2_secretory_G12		0.632	PLA2G12A-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PLA2G12A	HGNC	protein_coding	OTTHUMT00000254868.3	G			110650839	-1	no_errors	ENST00000243501	ensembl	human	known	70_37	missense	SNP	1.000	A
PNPLA5	150379	genome.wustl.edu	37	22	44287689	44287689	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr22:44287689G>A	ENST00000597664.1	-	1	201	c.72C>T	c.(70-72)caC>caT	p.H24H	PNPLA5_ENST00000381198.2_Silent_p.H24H|PNPLA5_ENST00000593866.1_Silent_p.H24H|PNPLA5_ENST00000216177.4_Silent_p.H24H			Q7Z6Z6	PLPL5_HUMAN	patatin-like phospholipase domain containing 5	24	Patatin.				lipid catabolic process (GO:0016042)		hydrolase activity (GO:0016787)			endometrium(3)|kidney(1)|large_intestine(3)|lung(8)|ovary(1)	16		all_neural(38;0.0966)|Ovarian(80;0.105)|Glioma(61;0.222)				TGGCGCCCACGTGGTGGGCGC	0.711																																																	0													4.0	5.0	5.0					22																	44287689		1620	3066	4686	SO:0001819	synonymous_variant	150379			Z97055	CCDS14053.1, CCDS54537.1	22q13.31	2009-01-12			ENSG00000100341	ENSG00000100341		"""Patatin-like phospholipase domain containing"""	24888	protein-coding gene	gene with protein product		611589				16799181, 19029121	Standard	NM_138814		Approved	dJ388M5.4, GS2L	uc003beg.3	Q7Z6Z6	OTTHUMG00000030779	ENST00000597664.1:c.72C>T	22.37:g.44287689G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHL8|B3KPR1|Q6ZST0	Silent	SNP	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase	p.H24	ENST00000597664.1	37	c.72		22																																																																																			PNPLA5	-	pfam_Patatin/PLipase_A2-rel,superfamily_Acyl_Trfase/lysoPLipase		0.711	PNPLA5-001	KNOWN	basic|appris_principal	protein_coding	PNPLA5	HGNC	protein_coding	OTTHUMT00000075667.4	G	NM_138814		44287689	-1	no_errors	ENST00000216177	ensembl	human	known	70_37	silent	SNP	1.000	A
PPP1R3A	5506	genome.wustl.edu	37	7	113518156	113518156	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr7:113518156G>T	ENST00000284601.3	-	4	3059	c.2991C>A	c.(2989-2991)ttC>ttA	p.F997L		NM_002711.3	NP_002702.2	Q16821	PPR3A_HUMAN	protein phosphatase 1, regulatory subunit 3A	997					glycogen metabolic process (GO:0005977)	integral component of membrane (GO:0016021)				NS(2)|breast(8)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(14)|liver(1)|lung(43)|ovary(10)|pancreas(7)|prostate(3)|skin(15)|stomach(1)|upper_aerodigestive_tract(2)	121						CTTCTGTTTGGAAAATCTGGC	0.383																																																	0													116.0	113.0	114.0					7																	113518156		2202	4298	6500	SO:0001583	missense	5506			AF024578	CCDS5759.1	7q31.1	2012-04-17	2011-10-04	2001-07-02	ENSG00000154415	ENSG00000154415	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"""	9291	protein-coding gene	gene with protein product	"""glycogen-associated regulatory subunit of protein phosphatase-1"", ""protein phosphatase 1 regulatory subunit GM"""	600917	"""protein phosphatase 1, regulatory (inhibitor) subunit 3A (glycogen and sarcoplasmic reticulum binding subunit, skeletal muscle)"", ""protein phosphatase 1, regulatory (inhibitor) subunit 3A"""	PPP1R3		7926294	Standard	NM_002711		Approved	GM	uc010ljy.1	Q16821	OTTHUMG00000156944	ENST00000284601.3:c.2991C>A	7.37:g.113518156G>T	ENSP00000284601:p.Phe997Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVQ2|A4D0T6|O43476|Q75LN8|Q7KYM8|Q86UI6	Missense_Mutation	SNP	pfam_CBM_21,pfscan_CBM_21	p.F997L	ENST00000284601.3	37	c.2991	CCDS5759.1	7	.	.	.	.	.	.	.	.	.	.	G	0.010	-1.771352	0.00645	.	.	ENSG00000154415	ENST00000284601	T	0.14516	2.5	5.29	1.19	0.21007	.	0.790034	0.11533	N	0.554499	T	0.08088	0.0202	L	0.31065	0.9	0.09310	N	1	B	0.09022	0.002	B	0.09377	0.004	T	0.44574	-0.9319	10	0.09590	T	0.72	2.4124	6.0321	0.19686	0.223:0.0:0.647:0.13	.	997	Q16821	PPR3A_HUMAN	L	997	ENSP00000284601:F997L	ENSP00000284601:F997L	F	-	3	2	PPP1R3A	113305392	0.137000	0.22531	0.002000	0.10522	0.059000	0.15707	0.540000	0.23191	0.163000	0.19507	0.650000	0.86243	TTC	PPP1R3A	-	NULL		0.383	PPP1R3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP1R3A	HGNC	protein_coding	OTTHUMT00000346724.1	G	NM_002711		113518156	-1	no_errors	ENST00000284601	ensembl	human	known	70_37	missense	SNP	0.004	T
PRELID2	153768	genome.wustl.edu	37	5	145198976	145198976	+	Splice_Site	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:145198976G>A	ENST00000334744.4	-	4	261	c.209C>T	c.(208-210)tCc>tTc	p.S70F	PRELID2_ENST00000505416.1_Intron|PRELID2_ENST00000394450.2_Intron|PRELID2_ENST00000511435.1_Intron|PRELID2_ENST00000358004.2_Intron	NM_182960.2	NP_892005.1	Q8N945	PRLD2_HUMAN	PRELI domain containing 2	70	PRELI/MSF1. {ECO:0000255|PROSITE- ProRule:PRU00158}.				phospholipid transport (GO:0015914)	mitochondrial intermembrane space (GO:0005758)	phosphatidic acid transporter activity (GO:1990050)			endometrium(2)|large_intestine(1)|lung(2)|prostate(1)	6			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGTGCTTAAGGACTTCAAAGA	0.358																																																	0													87.0	85.0	85.0					5																	145198976		2202	4300	6502	SO:0001630	splice_region_variant	153768			AK095695	CCDS34261.1, CCDS34262.1, CCDS43377.1	5q32	2012-04-23			ENSG00000186314	ENSG00000186314			28306	protein-coding gene	gene with protein product						12477932	Standard	NM_182960		Approved	MGC21644, FLJ38376	uc003lnq.1	Q8N945	OTTHUMG00000163384	ENST00000334744.4:c.208-1C>T	5.37:g.145198976G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	G5EA01|Q96EQ3	Missense_Mutation	SNP	pfam_PRELI/MSF1,pfscan_PRELI/MSF1	p.S70F	ENST00000334744.4	37	c.209	CCDS34262.1	5	.	.	.	.	.	.	.	.	.	.	G	3.259	-0.151643	0.06585	.	.	ENSG00000186314	ENST00000334744	T	0.16196	2.36	5.25	2.51	0.30379	PRELI/MSF1 (2);	0.516994	0.17193	N	0.183416	T	0.09247	0.0228	N	0.14661	0.345	0.18873	N	0.999982	B	0.02656	0.0	B	0.06405	0.002	T	0.30707	-0.9969	10	0.33141	T	0.24	-10.5397	7.8204	0.29284	0.2639:0.0:0.7361:0.0	.	70	Q8N945	PRLD2_HUMAN	F	70	ENSP00000335675:S70F	ENSP00000335675:S70F	S	-	2	0	PRELID2	145179169	0.997000	0.39634	0.020000	0.16555	0.006000	0.05464	1.327000	0.33746	0.338000	0.23692	-0.272000	0.10252	TCC	PRELID2	-	pfam_PRELI/MSF1,pfscan_PRELI/MSF1		0.358	PRELID2-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRELID2	HGNC	protein_coding	OTTHUMT00000372970.1	G	NM_182960	Missense_Mutation	145198976	-1	no_errors	ENST00000334744	ensembl	human	known	70_37	missense	SNP	0.187	A
PPP2R2B	5521	genome.wustl.edu	37	5	146257654	146257654	+	De_novo_Start_InFrame	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:146257654G>A	ENST00000394413.3	-	0	551				PPP2R2B_ENST00000394414.1_Missense_Mutation_p.T60M|PPP2R2B_ENST00000504198.1_Intron|PPP2R2B_ENST00000356826.3_De_novo_Start_InFrame|PPP2R2B_ENST00000453001.1_De_novo_Start_InFrame|PPP2R2B_ENST00000336640.6_Intron|PPP2R2B_ENST00000394409.3_Missense_Mutation_p.T52M|PPP2R2B_ENST00000394410.2_Intron|PPP2R2B_ENST00000530902.1_5'UTR|PPP2R2B_ENST00000508545.2_Intron|PPP2R2B_ENST00000394411.4_De_novo_Start_InFrame			Q00005	2ABB_HUMAN	protein phosphatase 2, regulatory subunit B, beta						apoptotic process (GO:0006915)|regulation of catalytic activity (GO:0050790)|signal transduction (GO:0007165)	cytoskeleton (GO:0005856)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			endometrium(3)|kidney(4)|large_intestine(6)|liver(2)|lung(9)|ovary(1)|prostate(4)|skin(3)	32			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			GCTTACTTGCGTGGGAACCAG	0.587																																																	0													96.0	84.0	88.0					5																	146257654		2203	4300	6503			5521			M64930	CCDS4283.1, CCDS4284.1, CCDS43380.1, CCDS4284.2, CCDS64282.1	5q32	2013-01-10	2010-04-14		ENSG00000156475	ENSG00000156475	3.1.3.16	"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"", ""WD repeat domain containing"""	9305	protein-coding gene	gene with protein product	"""PP2A subunit B isoform beta"""	604325	"""spinocerebellar ataxia 12"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B (PR 52), beta isoform"", ""protein phosphatase 2 (formerly 2A), regulatory subunit B, beta isoform"""	SCA12		1849734, 10581021	Standard	NM_181674		Approved	PR55-BETA, PR52B	uc003log.5	Q00005	OTTHUMG00000163381		5.37:g.146257654G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEJ2|A8K102|B3KPD0|B7Z2F2|B7Z304|D3DQF7|D3DQF8|G3V149	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_PP2A_PR55,prints_PP2A_PR55	p.T60M	ENST00000394413.3	37	c.179	CCDS4284.1	5	.	.	.	.	.	.	.	.	.	.	G	8.412	0.844489	0.16963	.	.	ENSG00000156475	ENST00000394414;ENST00000394409	T;T	0.32515	1.45;1.45	4.1	4.1	0.47936	.	.	.	.	.	T	0.49355	0.1552	.	.	.	0.80722	D	1	D	0.64830	0.994	P	0.62014	0.897	T	0.52087	-0.8622	8	0.66056	D	0.02	-2.6353	11.62	0.51113	0.0:0.1808:0.8192:0.0	.	52	Q00005-4	.	M	60;52	ENSP00000377936:T60M;ENSP00000377931:T52M	ENSP00000377931:T52M	T	-	2	0	AC011357.1	146237847	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.852000	0.55934	2.291000	0.77112	0.561000	0.74099	ACG	PPP2R2B	-	NULL		0.587	PPP2R2B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R2B	HGNC	protein_coding	OTTHUMT00000251893.2	G	NM_181678		146257654	-1	no_errors	ENST00000394414	ensembl	human	known	70_37	missense	SNP	1.000	A
PRR25	388199	genome.wustl.edu	37	16	863350	863350	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr16:863350C>T	ENST00000301698.1	+	3	698	c.698C>T	c.(697-699)cCg>cTg	p.P233L		NM_001013638.1	NP_001013660.1	Q96S07	PRR25_HUMAN	proline rich 25	233										large_intestine(1)|lung(1)|skin(1)	3						GCTGCGGGACCGGCAAGGACG	0.716																																																	0													11.0	15.0	14.0					16																	863350		1994	4131	6125	SO:0001583	missense	388199			BC156145	CCDS45372.1	16p13.3	2009-09-11			ENSG00000167945	ENSG00000167945			37230	protein-coding gene	gene with protein product						11157797	Standard	NM_001013638		Approved	gs64	uc010uut.2	Q96S07		ENST00000301698.1:c.698C>T	16.37:g.863350C>T	ENSP00000301698:p.Pro233Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.P233L	ENST00000301698.1	37	c.698	CCDS45372.1	16	.	.	.	.	.	.	.	.	.	.	C	0.417	-0.910190	0.02434	.	.	ENSG00000167945	ENST00000301698	T	0.41400	1.0	0.158	-0.317	0.12736	.	.	.	.	.	T	0.19005	0.0456	N	0.08118	0	0.09310	N	1	B	0.10296	0.003	B	0.01281	0.0	T	0.16988	-1.0384	8	0.87932	D	0	.	.	.	.	.	233	Q96S07	PRR25_HUMAN	L	233	ENSP00000301698:P233L	ENSP00000301698:P233L	P	+	2	0	PRR25	803351	0.008000	0.16893	0.004000	0.12327	0.004000	0.04260	-1.574000	0.02133	-1.029000	0.03317	-1.021000	0.02439	CCG	PRR25	-	NULL		0.716	PRR25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR25	HGNC	protein_coding	OTTHUMT00000440563.1	C	NM_001013638		863350	+1	no_errors	ENST00000301698	ensembl	human	known	70_37	missense	SNP	0.005	T
PUS7	54517	genome.wustl.edu	37	7	105148719	105148719	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr7:105148719C>G	ENST00000356362.2	-	2	455	c.241G>C	c.(241-243)Gag>Cag	p.E81Q	PUS7_ENST00000469408.1_Missense_Mutation_p.E81Q	NM_019042.3	NP_061915.2	Q96PZ0	PUS7_HUMAN	pseudouridylate synthase 7 (putative)	81					pseudouridine synthesis (GO:0001522)|tRNA processing (GO:0008033)		enzyme binding (GO:0019899)|poly(A) RNA binding (GO:0044822)|pseudouridine synthase activity (GO:0009982)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(8)|pancreas(1)|skin(1)	23						TCTTCTTCCTCATCTTCCAAC	0.498																																					Colon(138;2387 3051 17860)												0													220.0	190.0	201.0					7																	105148719		2203	4300	6503	SO:0001583	missense	54517			AK128629	CCDS34725.1	7q22.3	2014-02-14	2014-02-14		ENSG00000091127	ENSG00000091127			26033	protein-coding gene	gene with protein product			"""pseudouridylate synthase 7 homolog (S. cerevisiae)"""			11572484	Standard	NM_019042		Approved	FLJ20485	uc003vcx.3	Q96PZ0	OTTHUMG00000157399	ENST00000356362.2:c.241G>C	7.37:g.105148719C>G	ENSP00000348722:p.Glu81Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q75MG4|Q9NX19	Missense_Mutation	SNP	pfam_PsdUridine_synth_TruD,superfamily_PsdUridine_synth_cat_dom,pirsf_PsdUridine_synth_TruD_euk,pfscan_PsdUridine_synth_TruD_insert,tigrfam_PsdUridine_synth_TruD	p.E81Q	ENST00000356362.2	37	c.241	CCDS34725.1	7	.	.	.	.	.	.	.	.	.	.	C	11.59	1.684156	0.29872	.	.	ENSG00000091127	ENST00000356362;ENST00000544995;ENST00000469408	T;T	0.44881	0.91;0.91	5.59	5.59	0.84812	.	0.252951	0.38164	N	0.001792	T	0.35068	0.0919	L	0.46157	1.445	0.36640	D	0.8768	B;B	0.23735	0.09;0.09	B;B	0.26310	0.068;0.068	T	0.31447	-0.9943	10	0.22706	T	0.39	-9.5449	10.1701	0.42904	0.0:0.8482:0.0:0.1517	.	81;81	B3KY42;Q96PZ0	.;PUS7_HUMAN	Q	81	ENSP00000348722:E81Q;ENSP00000417402:E81Q	ENSP00000348722:E81Q	E	-	1	0	PUS7	104935955	0.995000	0.38212	0.961000	0.40146	0.440000	0.31957	3.217000	0.51184	2.620000	0.88729	0.561000	0.74099	GAG	PUS7	-	pirsf_PsdUridine_synth_TruD_euk		0.498	PUS7-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	PUS7	HGNC	protein_coding	OTTHUMT00000348681.1	C	NM_019042		105148719	-1	no_errors	ENST00000356362	ensembl	human	known	70_37	missense	SNP	0.945	G
RALGPS1	9649	genome.wustl.edu	37	9	129739991	129739991	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr9:129739991G>T	ENST00000259351.5	+	4	450	c.183G>T	c.(181-183)atG>atT	p.M61I	RALGPS1_ENST00000373434.1_Missense_Mutation_p.M61I|RALGPS1_ENST00000424082.2_Missense_Mutation_p.M61I|RALGPS1_ENST00000394022.3_Missense_Mutation_p.M61I|RALGPS1_ENST00000480993.1_3'UTR|RALGPS1_ENST00000373436.1_Missense_Mutation_p.M61I|RALGPS1_ENST00000394011.3_Missense_Mutation_p.M61I	NM_014636.2	NP_055451.1	Q5JS13	RGPS1_HUMAN	Ral GEF with PH domain and SH3 binding motif 1	61	Ras-GEF. {ECO:0000255|PROSITE- ProRule:PRU00168}.				intracellular signal transduction (GO:0035556)|positive regulation of GTPase activity (GO:0043547)|positive regulation of Ral GTPase activity (GO:0032852)|regulation of Ral protein signal transduction (GO:0032485)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	guanyl-nucleotide exchange factor activity (GO:0005085)|Ral guanyl-nucleotide exchange factor activity (GO:0008321)			kidney(2)|large_intestine(6)|lung(7)|ovary(1)|skin(1)|upper_aerodigestive_tract(2)	19						TTACATTAATGGATATACCTG	0.388																																																	0													156.0	146.0	149.0					9																	129739991		2203	4300	6503	SO:0001583	missense	9649			AB002349	CCDS35143.1, CCDS55344.1, CCDS55345.1, CCDS55346.1	9q33.3	2013-01-10			ENSG00000136828	ENSG00000136828		"""Pleckstrin homology (PH) domain containing"""	16851	protein-coding gene	gene with protein product		614444				9205841, 10747847	Standard	NM_001190728		Approved	RALGPS1A, RALGEF2, KIAA0351	uc004bqo.2	Q5JS13	OTTHUMG00000020696	ENST00000259351.5:c.183G>T	9.37:g.129739991G>T	ENSP00000259351:p.Met61Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR86|E9PBQ5|O15059|Q5JT60|Q5JT65|Q5JUG5|Q8N4S6|Q8N5H4|Q8WUV7|Q9NZ16	Missense_Mutation	SNP	pfam_RasGRF_CDC25,pfam_Pleckstrin_homology,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_RasGRF_CDC25	p.M61I	ENST00000259351.5	37	c.183	CCDS35143.1	9	.	.	.	.	.	.	.	.	.	.	G	17.45	3.392895	0.62066	.	.	ENSG00000136828	ENST00000259351;ENST00000424082;ENST00000394022;ENST00000373439;ENST00000394011;ENST00000319107;ENST00000373436;ENST00000373434	T;T;T;T;T;T;T	0.24723	1.88;1.88;1.88;1.84;1.88;1.88;1.88	5.5	5.5	0.81552	Guanine-nucleotide dissociation stimulator CDC25 (4);Ras guanine nucleotide exchange factor, domain (1);	0.082269	0.85682	D	0.000000	T	0.30603	0.0770	N	0.20845	0.615	0.58432	D	0.999999	B;B;B;D	0.53885	0.125;0.063;0.103;0.963	B;B;B;P	0.58660	0.154;0.061;0.096;0.843	T	0.01648	-1.1304	10	0.27082	T	0.32	.	15.2567	0.73591	0.0:0.0:1.0:0.0	.	61;61;61;61	E9PBQ5;Q5JS13-3;Q5JS13-2;Q5JS13	.;.;.;RGPS1_HUMAN	I	61	ENSP00000259351:M61I;ENSP00000415630:M61I;ENSP00000377590:M61I;ENSP00000377579:M61I;ENSP00000317149:M61I;ENSP00000362535:M61I;ENSP00000362533:M61I	ENSP00000259351:M61I	M	+	3	0	RALGPS1	128779812	1.000000	0.71417	1.000000	0.80357	0.921000	0.55340	5.925000	0.70062	2.741000	0.93983	0.650000	0.86243	ATG	RALGPS1	-	pfam_RasGRF_CDC25,superfamily_Ras_GEF_dom,smart_RasGRF_CDC25,pfscan_RasGRF_CDC25		0.388	RALGPS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RALGPS1	HGNC	protein_coding	OTTHUMT00000054133.1	G	NM_014636		129739991	+1	no_errors	ENST00000259351	ensembl	human	known	70_37	missense	SNP	1.000	T
RBM15	64783	genome.wustl.edu	37	1	110888941	110888941	+	3'UTR	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:110888941G>A	ENST00000369784.3	+	0	3886				RBM15_ENST00000487146.2_Missense_Mutation_p.E959K	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15						negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		AAAACTGGTTGAACAGCGGAT	0.373			T	MKL1	acute megakaryocytic leukemia																																			Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0													237.0	236.0	236.0					1																	110888941		876	1991	2867	SO:0001624	3_prime_UTR_variant	64783			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.*52G>A	1.37:g.110888941G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	RNA	SNP	-	NULL	ENST00000369784.3	37	NULL	CCDS822.1	1																																																																																			RBM15	-	-		0.373	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	HGNC	protein_coding	OTTHUMT00000031114.2	G	NM_022768		110888941	+1	no_errors	ENST00000487146	ensembl	human	known	70_37	rna	SNP	1.000	A
RBMXL3	139804	genome.wustl.edu	37	X	114424169	114424169	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chrX:114424169C>T	ENST00000424776.3	+	1	207	c.165C>T	c.(163-165)acC>acT	p.T55T	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	55	RRM. {ECO:0000255|PROSITE- ProRule:PRU00176}.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						CGTTCGTCACCTTCGAAAGCC	0.542																																																	0													73.0	69.0	70.0					X																	114424169		692	1591	2283	SO:0001819	synonymous_variant	139804			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.165C>T	X.37:g.114424169C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T55	ENST00000424776.3	37	c.165	CCDS55478.1	X																																																																																			RBMXL3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.542	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	C	NM_001145346		114424169	+1	no_errors	ENST00000424776	ensembl	human	known	70_37	silent	SNP	1.000	T
RFWD3	55159	genome.wustl.edu	37	16	74685965	74685965	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr16:74685965G>T	ENST00000361070.4	-	3	671	c.574C>A	c.(574-576)Cca>Aca	p.P192T	RFWD3_ENST00000571750.1_Missense_Mutation_p.P192T	NM_018124.3	NP_060594.3	Q6PCD5	RFWD3_HUMAN	ring finger and WD repeat domain 3	192					DNA repair (GO:0006281)|mitotic G1 DNA damage checkpoint (GO:0031571)|protein ubiquitination (GO:0016567)|regulation of DNA damage checkpoint (GO:2000001)|response to ionizing radiation (GO:0010212)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ligase activity (GO:0016874)|MDM2/MDM4 family protein binding (GO:0097371)|p53 binding (GO:0002039)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(3)|lung(12)|ovary(1)|skin(2)|stomach(1)|urinary_tract(1)	26						GTGGTAGCTGGCAAGTCAGGC	0.448																																																	0													89.0	84.0	85.0					16																	74685965		2198	4300	6498	SO:0001583	missense	55159			AK001382	CCDS32486.1	16q22.3	2013-01-09						"""WD repeat domain containing"", ""RING-type (C3HC4) zinc fingers"""	25539	protein-coding gene	gene with protein product		614151				21504906	Standard	XM_005256021		Approved	FLJ10520, RNF201	uc002fda.3	Q6PCD5		ENST00000361070.4:c.574C>A	16.37:g.74685965G>T	ENSP00000354361:p.Pro192Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K585|B2RE35|D3DUJ8|Q5XKR3|Q9H9Q3|Q9NVT4	Missense_Mutation	SNP	pfam_WD40_repeat,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_WD40_repeat,pfscan_Znf_RING	p.P192T	ENST00000361070.4	37	c.574	CCDS32486.1	16	.	.	.	.	.	.	.	.	.	.	G	8.948	0.967491	0.18659	.	.	ENSG00000168411	ENST00000361070	T	0.19806	2.12	5.93	-1.01	0.10169	.	0.729040	0.12670	N	0.448866	T	0.15565	0.0375	L	0.56769	1.78	0.09310	N	1	B	0.12013	0.005	B	0.10450	0.005	T	0.28138	-1.0053	10	0.30078	T	0.28	-13.7056	2.0028	0.03471	0.2912:0.1238:0.4582:0.1268	.	192	Q6PCD5	RFWD3_HUMAN	T	192	ENSP00000354361:P192T	ENSP00000354361:P192T	P	-	1	0	RFWD3	73243466	0.000000	0.05858	0.000000	0.03702	0.447000	0.32167	-0.421000	0.07053	0.060000	0.16281	0.650000	0.86243	CCA	RFWD3	-	NULL		0.448	RFWD3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RFWD3	HGNC	protein_coding	OTTHUMT00000436506.2	G	NM_018124		74685965	-1	no_errors	ENST00000361070	ensembl	human	known	70_37	missense	SNP	0.000	T
RP1	6101	genome.wustl.edu	37	8	55533806	55533806	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr8:55533806C>T	ENST00000220676.1	+	2	428	c.280C>T	c.(280-282)Cgc>Tgc	p.R94C		NM_006269.1	NP_006260.1	P56715	RP1_HUMAN	retinitis pigmentosa 1 (autosomal dominant)	94	Doublecortin 1. {ECO:0000255|PROSITE- ProRule:PRU00072}.				axoneme assembly (GO:0035082)|cellular response to light stimulus (GO:0071482)|intracellular signal transduction (GO:0035556)|photoreceptor cell development (GO:0042461)|photoreceptor cell maintenance (GO:0045494)|photoreceptor cell outer segment organization (GO:0035845)|phototransduction, visible light (GO:0007603)|retinal cone cell development (GO:0046549)|retinal rod cell development (GO:0046548)|visual perception (GO:0007601)	axoneme (GO:0005930)|microtubule (GO:0005874)|microtubule associated complex (GO:0005875)|photoreceptor connecting cilium (GO:0032391)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)	microtubule binding (GO:0008017)			NS(4)|breast(6)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(4)|kidney(7)|large_intestine(29)|lung(69)|ovary(6)|pancreas(1)|prostate(9)|skin(17)|upper_aerodigestive_tract(3)|urinary_tract(2)	169		all_lung(136;0.0831)|Lung NSC(129;0.109)|all_epithelial(80;0.123)	OV - Ovarian serous cystadenocarcinoma(7;4.4e-07)|Epithelial(17;3.37e-05)|all cancers(17;0.000285)			CAGCATCACGCGCCTGGAGGA	0.622																																					Colon(91;1014 1389 7634 14542 40420)												0													82.0	71.0	74.0					8																	55533806		2203	4300	6503	SO:0001583	missense	6101			AF146592	CCDS6160.1	8q12.1	2013-01-08				ENSG00000104237			10263	protein-coding gene	gene with protein product		603937				1783394	Standard	NM_006269		Approved	DCDC4A	uc003xsd.1	P56715		ENST00000220676.1:c.280C>T	8.37:g.55533806C>T	ENSP00000220676:p.Arg94Cys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom	p.R94C	ENST00000220676.1	37	c.280	CCDS6160.1	8	.	.	.	.	.	.	.	.	.	.	C	5.017	0.188756	0.09547	.	.	ENSG00000104237	ENST00000220676	D	0.86432	-2.12	5.17	-5.8	0.02347	Doublecortin domain (5);	1.176500	0.06083	N	0.662311	T	0.75539	0.3863	N	0.17082	0.46	0.09310	N	0.999998	B	0.22346	0.068	B	0.15052	0.012	T	0.63202	-0.6690	10	0.87932	D	0	0.9536	10.8393	0.46706	0.6963:0.1025:0.0:0.2011	.	94	P56715	RP1_HUMAN	C	94	ENSP00000220676:R94C	ENSP00000220676:R94C	R	+	1	0	RP1	55696359	0.000000	0.05858	0.077000	0.20336	0.134000	0.20937	-0.649000	0.05384	-0.797000	0.04450	-0.861000	0.03010	CGC	RP1	-	pfam_Doublecortin_dom,superfamily_Doublecortin_dom,smart_Doublecortin_dom,pfscan_Doublecortin_dom		0.622	RP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RP1	HGNC	protein_coding	OTTHUMT00000378532.2	C	NM_006269		55533806	+1	no_errors	ENST00000220676	ensembl	human	known	70_37	missense	SNP	0.000	T
RPGRIP1	57096	genome.wustl.edu	37	14	21793410	21793410	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr14:21793410C>T	ENST00000400017.2	+	15	2235	c.2235C>T	c.(2233-2235)ttC>ttT	p.F745F	RPGRIP1_ENST00000553500.1_3'UTR|RPGRIP1_ENST00000382933.4_Intron|RPGRIP1_ENST00000557771.1_Silent_p.F707F|RPGRIP1_ENST00000307974.4_Silent_p.F104F|RPGRIP1_ENST00000206660.6_Silent_p.F745F|RPGRIP1_ENST00000556336.1_Intron	NM_020366.3	NP_065099.3	Q96KN7	RPGR1_HUMAN	retinitis pigmentosa GTPase regulator interacting protein 1	745					eye photoreceptor cell development (GO:0042462)|response to stimulus (GO:0050896)|retina development in camera-type eye (GO:0060041)|visual perception (GO:0007601)	axoneme (GO:0005930)|nonmotile primary cilium (GO:0031513)		p.F361F(1)|p.F745F(1)		breast(3)|endometrium(2)|kidney(4)|large_intestine(11)|lung(10)|ovary(4)|pancreas(1)|prostate(3)|stomach(1)	39	all_cancers(95;0.0017)	all_cancers(140;0.0973)	Epithelial(56;6.24e-07)|all cancers(55;6.56e-06)	GBM - Glioblastoma multiforme(265;0.00888)		GAGAAGAGTTCGGGGTTCTAG	0.493																																																	2	Substitution - coding silent(2)	prostate(2)											48.0	47.0	47.0					14																	21793410		1876	4111	5987	SO:0001819	synonymous_variant	57096			AF227257	CCDS45080.1	14q11.2	2013-06-06			ENSG00000092200	ENSG00000092200			13436	protein-coding gene	gene with protein product		605446		RPGRIP		10958647, 10958648	Standard	NM_020366		Approved	RGI1, LCA6, CORD13	uc001wag.3	Q96KN7	OTTHUMG00000170758	ENST00000400017.2:c.2235C>T	14.37:g.21793410C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z2W6|Q8IXV5|Q96QA8|Q9HB94|Q9HB95|Q9HBK6|Q9NR40	Silent	SNP	pfam_DUF3250,superfamily_C2_Ca/lipid-bd_dom_CaLB	p.F745	ENST00000400017.2	37	c.2235	CCDS45080.1	14																																																																																			RPGRIP1	-	pfam_DUF3250		0.493	RPGRIP1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RPGRIP1	HGNC	protein_coding	OTTHUMT00000410258.1	C	NM_020366		21793410	+1	no_errors	ENST00000206660	ensembl	human	known	70_37	silent	SNP	0.550	T
RUSC1	23623	genome.wustl.edu	37	1	155290563	155290563	+	5'Flank	DEL	A	A	-			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:155290563delA	ENST00000368352.5	+	0	0				RUSC1-AS1_ENST00000443642.1_RNA|RUSC1-AS1_ENST00000450199.1_RNA|RUSC1_ENST00000368354.3_5'Flank|RUSC1-AS1_ENST00000543656.1_RNA|RUSC1-AS1_ENST00000446880.1_RNA	NM_001105203.1	NP_001098673.1	Q9BVN2	RUSC1_HUMAN	RUN and SH3 domain containing 1						positive regulation of signal transduction (GO:0009967)|protein polyubiquitination (GO:0000209)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|early endosome (GO:0005769)|Golgi apparatus (GO:0005794)|microtubule (GO:0005874)|microtubule cytoskeleton (GO:0015630)|nucleus (GO:0005634)|postsynaptic membrane (GO:0045211)	actin binding (GO:0003779)|SH3/SH2 adaptor activity (GO:0005070)			breast(2)|endometrium(2)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(2)|skin(1)|urinary_tract(1)	21	Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;1.55e-10)|all cancers(21;4.15e-10)|BRCA - Breast invasive adenocarcinoma(34;0.000549)|LUSC - Lung squamous cell carcinoma(543;0.127)			CCCAGGGGCCAAAAGCTTAGG	0.602																																																	0													31.0	34.0	33.0					1																	155290563		1970	4142	6112	SO:0001631	upstream_gene_variant	284618			AB026894	CCDS1112.1, CCDS41410.1, CCDS41411.1, CCDS41412.1	1q21-q22	2011-04-28			ENSG00000160753	ENSG00000160753			17153	protein-coding gene	gene with protein product						10760598	Standard	NM_001105203		Approved	NESCA	uc001fkj.2	Q9BVN2	OTTHUMG00000013910		1.37:g.155290563delA	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWM9|Q5T9U9|Q5T9V0|Q5T9V1|Q5T9V2|Q9UPY4|Q9Y4T5	RNA	DEL	-	NULL	ENST00000368352.5	37	NULL	CCDS41410.1	1																																																																																			RUSC1-AS1	-	-		0.602	RUSC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RUSC1-AS1	HGNC	protein_coding	OTTHUMT00000039071.1	A			155290563	-1	no_errors	ENST00000450199	ensembl	human	known	70_37	rna	DEL	0.000	-
SDK2	54549	genome.wustl.edu	37	17	71420166	71420166	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:71420166C>T	ENST00000392650.3	-	13	1649	c.1649G>A	c.(1648-1650)aGa>aAa	p.R550K	SDK2_ENST00000388726.3_Missense_Mutation_p.R550K	NM_001144952.1	NP_001138424.1	Q58EX2	SDK2_HUMAN	sidekick cell adhesion molecule 2	550	Ig-like C2-type 6.				cell adhesion (GO:0007155)	integral component of membrane (GO:0016021)				breast(4)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(15)|lung(31)|ovary(3)|prostate(2)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(3)	86						GGAGCCGTTTCTGTCCAGGCG	0.597																																																	0													51.0	40.0	43.0					17																	71420166		2203	4300	6503	SO:0001583	missense	54549			AB040947	CCDS45769.1	17q21.31	2013-02-11	2011-12-09		ENSG00000069188	ENSG00000069188		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	19308	protein-coding gene	gene with protein product		607217	"""sidekick homolog 2 (chicken)"""			12230981, 15213259	Standard	NM_001144952		Approved	FLJ10832, KIAA1514	uc010dfm.3	Q58EX2	OTTHUMG00000152726	ENST00000392650.3:c.1649G>A	17.37:g.71420166C>T	ENSP00000376421:p.Arg550Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMR8|C9JA57|Q86VY3|Q9NTD2|Q9NVB3|Q9P214	Missense_Mutation	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.R550K	ENST00000392650.3	37	c.1649	CCDS45769.1	17	.	.	.	.	.	.	.	.	.	.	C	3.303	-0.142532	0.06669	.	.	ENSG00000069188	ENST00000409227;ENST00000392650;ENST00000388726;ENST00000316893	T;T	0.65916	-0.18;-0.18	5.55	-2.13	0.07144	Immunoglobulin subtype (1);Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.583463	0.18651	N	0.134984	T	0.24509	0.0594	N	0.00815	-1.16	0.09310	N	1	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.001	T	0.30909	-0.9962	10	0.07644	T	0.81	.	13.0033	0.58690	0.0:0.5393:0.0:0.4607	.	550;550	Q58EX2-2;Q58EX2	.;SDK2_HUMAN	K	174;550;550;550	ENSP00000376421:R550K;ENSP00000373378:R550K	ENSP00000324967:R550K	R	-	2	0	SDK2	68931761	0.000000	0.05858	0.050000	0.19076	0.884000	0.51177	0.247000	0.18179	-0.759000	0.04684	-0.302000	0.09304	AGA	SDK2	-	pfam_Ig_I-set,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like		0.597	SDK2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SDK2	HGNC	protein_coding	OTTHUMT00000327598.2	C	NM_019064		71420166	-1	no_errors	ENST00000392650	ensembl	human	known	70_37	missense	SNP	0.013	T
SETD1A	9739	genome.wustl.edu	37	16	30982737	30982737	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr16:30982737C>T	ENST00000262519.8	+	13	3741	c.3055C>T	c.(3055-3057)Ctg>Ttg	p.L1019L		NM_014712.1	NP_055527.1	O15047	SET1A_HUMAN	SET domain containing 1A	1019	Ser-rich. {ECO:0000255}.				histone H3-K4 methylation (GO:0051568)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|histone methyltransferase complex (GO:0035097)|nucleus (GO:0005634)|Set1C/COMPASS complex (GO:0048188)	histone methyltransferase activity (H3-K4 specific) (GO:0042800)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			NS(2)|breast(2)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(21)|ovary(3)|prostate(2)|skin(4)|upper_aerodigestive_tract(4)|urinary_tract(1)	59						CAAATGTTCTCTGTATGCTGA	0.567																																																	0													157.0	155.0	156.0					16																	30982737		2197	4300	6497	SO:0001819	synonymous_variant	9739			AB002337	CCDS32435.1	16p11.2	2013-02-12			ENSG00000099381	ENSG00000099381		"""Chromatin-modifying enzymes / K-methyltransferases"", ""RNA binding motif (RRM) containing"""	29010	protein-coding gene	gene with protein product		611052				9205841, 12670868	Standard	XM_005255723		Approved	KIAA0339, Set1, KMT2F	uc002ead.1	O15047	OTTHUMG00000150474	ENST00000262519.8:c.3055C>T	16.37:g.30982737C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NP62|Q6PIF3|Q8TAJ6	Silent	SNP	pfam_COMPASS_Set1_N-SET,pfam_SET_dom,pfam_RRM_dom,smart_RRM_dom,smart_SET_dom,smart_Post-SET_dom,pfscan_SET_dom,pfscan_Post-SET_dom,pfscan_RRM_dom	p.L1019	ENST00000262519.8	37	c.3055	CCDS32435.1	16																																																																																			SETD1A	-	NULL		0.567	SETD1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD1A	HGNC	protein_coding	OTTHUMT00000318244.2	C	NM_014712		30982737	+1	no_errors	ENST00000262519	ensembl	human	known	70_37	silent	SNP	1.000	T
SEZ6	124925	genome.wustl.edu	37	17	27291100	27291100	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:27291100G>A	ENST00000317338.12	-	5	1548	c.1120C>T	c.(1120-1122)Cac>Tac	p.H374Y	SEZ6_ENST00000442608.3_Missense_Mutation_p.H374Y|SEZ6_ENST00000335960.6_Missense_Mutation_p.H374Y|PIPOX_ENST00000583215.1_Intron|SEZ6_ENST00000360295.9_Missense_Mutation_p.H374Y			Q53EL9	SEZ6_HUMAN	seizure related 6 homolog (mouse)	374	Sushi 1. {ECO:0000255|PROSITE- ProRule:PRU00302}.				adult locomotory behavior (GO:0008344)|cerebellar Purkinje cell layer development (GO:0021680)|negative regulation of dendrite development (GO:2000171)|positive regulation of dendrite development (GO:1900006)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of protein kinase C signaling (GO:0090036)|synapse maturation (GO:0060074)	apical dendrite (GO:0097440)|dendritic shaft (GO:0043198)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(4)|lung(11)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	29	Lung NSC(42;0.0137)		Epithelial(11;4.73e-06)|all cancers(11;2.91e-05)|BRCA - Breast invasive adenocarcinoma(11;8.06e-05)|OV - Ovarian serous cystadenocarcinoma(11;0.111)			CCCCCTGGGTGGAGGCTGGTG	0.582																																																	0													35.0	36.0	36.0					17																	27291100		2004	4162	6166	SO:0001583	missense	124925			AY038048	CCDS45638.1, CCDS45639.1	17q11.2	2008-03-06	2001-11-28		ENSG00000063015	ENSG00000063015			15955	protein-coding gene	gene with protein product			"""seizure related gene 6 (mouse) homolog"""			17086543	Standard	NM_178860		Approved		uc002hdp.2	Q53EL9	OTTHUMG00000168010	ENST00000317338.12:c.1120C>T	17.37:g.27291100G>A	ENSP00000312942:p.His374Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B6ZDN1|Q8N701|Q8NB57|Q8ND50|Q8TD25|Q96NI5|Q96NQ3	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_CUB,superfamily_CUB,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,smart_CUB,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.H374Y	ENST00000317338.12	37	c.1120	CCDS45639.1	17	.	.	.	.	.	.	.	.	.	.	G	29.2	4.986330	0.93044	.	.	ENSG00000063015	ENST00000442608;ENST00000360295;ENST00000317338;ENST00000335960;ENST00000541381	T;T;T	0.63913	-0.07;-0.07;-0.07	5.59	5.59	0.84812	Complement control module (2);Sushi/SCR/CCP (3);	0.000000	0.85682	D	0.000000	T	0.78078	0.4227	M	0.65498	2.005	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.999	D;D;D	0.80764	0.994;0.986;0.982	T	0.79797	-0.1652	10	0.87932	D	0	.	17.0771	0.86589	0.0:0.0:1.0:0.0	.	374;374;374	F5GZF9;Q53EL9-3;Q53EL9	.;.;SEZ6_HUMAN	Y	374;374;249;374;374	ENSP00000403784:H374Y;ENSP00000353440:H374Y;ENSP00000337407:H374Y	ENSP00000312942:H249Y	H	-	1	0	SEZ6	24315226	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	9.431000	0.97494	2.625000	0.88918	0.561000	0.74099	CAC	SEZ6	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.582	SEZ6-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SEZ6	HGNC	protein_coding	OTTHUMT00000397475.3	G			27291100	-1	no_errors	ENST00000317338	ensembl	human	known	70_37	missense	SNP	1.000	A
SFMBT2	57713	genome.wustl.edu	37	10	7244472	7244472	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr10:7244472C>G	ENST00000361972.4	-	13	1547	c.1457G>C	c.(1456-1458)aGa>aCa	p.R486T	SFMBT2_ENST00000397167.1_Missense_Mutation_p.R486T	NM_001018039.1	NP_001018049.1	Q5VUG0	SMBT2_HUMAN	Scm-like with four mbt domains 2	486					negative regulation of gene expression (GO:0010629)|regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	histone binding (GO:0042393)			NS(2)|breast(3)|central_nervous_system(4)|endometrium(7)|kidney(2)|large_intestine(26)|lung(34)|ovary(5)|pancreas(2)|skin(9)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	99						TGCAATCTTTCTCTTCTTTTG	0.393																																																	0													157.0	135.0	143.0					10																	7244472		2203	4300	6503	SO:0001583	missense	57713			AB046837	CCDS31138.1	10p15.1	2013-01-10	2003-11-14		ENSG00000198879	ENSG00000198879		"""Sterile alpha motif (SAM) domain containing"""	20256	protein-coding gene	gene with protein product		615392	"""Scm-related gene containing four mbt domains 2"""			10997877	Standard	NM_001029880		Approved	KIAA1617	uc009xio.2	Q5VUG0	OTTHUMG00000017630	ENST00000361972.4:c.1457G>C	10.37:g.7244472C>G	ENSP00000355109:p.Arg486Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD09|Q9HCF5	Missense_Mutation	SNP	pfam_Mbt,pfam_DUF3588,pfam_SAM_type1,pfam_Pointed_dom,superfamily_SAM/pointed,superfamily_ARM-type_fold,smart_Mbt,smart_SAM,pfscan_Mbt	p.R486T	ENST00000361972.4	37	c.1457	CCDS31138.1	10	.	.	.	.	.	.	.	.	.	.	C	15.18	2.756195	0.49362	.	.	ENSG00000198879	ENST00000361972;ENST00000397167	T;T	0.40756	1.02;1.02	5.53	4.62	0.57501	.	0.162881	0.64402	D	0.000008	T	0.46983	0.1421	M	0.71581	2.175	0.80722	D	1	D	0.53151	0.958	P	0.45343	0.477	T	0.48927	-0.8991	10	0.37606	T	0.19	.	13.8378	0.63419	0.0:0.926:0.0:0.074	.	486	Q5VUG0	SMBT2_HUMAN	T	486	ENSP00000355109:R486T;ENSP00000380353:R486T	ENSP00000355109:R486T	R	-	2	0	SFMBT2	7284478	1.000000	0.71417	1.000000	0.80357	0.936000	0.57629	2.100000	0.41777	1.305000	0.44909	0.655000	0.94253	AGA	SFMBT2	-	NULL		0.393	SFMBT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SFMBT2	HGNC	protein_coding	OTTHUMT00000046673.1	C	NM_001029880		7244472	-1	no_errors	ENST00000361972	ensembl	human	known	70_37	missense	SNP	1.000	G
SH2D6	284948	genome.wustl.edu	37	2	85660240	85660240	+	5'Flank	SNP	G	G	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:85660240G>C	ENST00000340326.2	+	0	0				SH2D6_ENST00000481426.2_3'UTR|SH2D6_ENST00000389938.2_5'UTR|Y_RNA_ENST00000384478.1_RNA	NM_198482.1	NP_940884.1	Q7Z4S9	SH2D6_HUMAN	SH2 domain containing 6											central_nervous_system(1)|lung(2)	3						GCATCGTCCAGAGTGGTGAGC	0.567																																																	0																																										SO:0001631	upstream_gene_variant	284948			AF450483	CCDS1976.1	2p11.2	2013-02-14			ENSG00000152292	ENSG00000152292		"""SH2 domain containing"""	30439	protein-coding gene	gene with protein product						12477932	Standard	NM_198482		Approved	FLJ35993	uc002spq.3	Q7Z4S9	OTTHUMG00000130176		2.37:g.85660240G>C	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND14|Q6R306	RNA	SNP	-	NULL	ENST00000340326.2	37	NULL	CCDS1976.1	2																																																																																			SH2D6	-	-		0.567	SH2D6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SH2D6	HGNC	protein_coding	OTTHUMT00000252493.2	G	NM_198482		85660240	+1	no_errors	ENST00000481426	ensembl	human	known	70_37	rna	SNP	0.244	C
SLAMF7	57823	genome.wustl.edu	37	1	160722997	160722998	+	3'UTR	INS	-	-	A	rs111989802		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:160722997_160722998insA	ENST00000368043.3	+	0	1075_1076				SLAMF7_ENST00000458602.2_3'UTR|SLAMF7_ENST00000359331.4_3'UTR|SLAMF7_ENST00000368042.3_3'UTR|SLAMF7_ENST00000444090.2_3'UTR|SLAMF7_ENST00000458104.2_3'UTR|SLAMF7_ENST00000441662.2_3'UTR	NM_001282595.1|NM_021181.3	NP_001269524.1|NP_067004.3	Q9NQ25	SLAF7_HUMAN	SLAM family member 7						cell adhesion (GO:0007155)|natural killer cell activation (GO:0030101)|natural killer cell mediated cytotoxicity (GO:0042267)|regulation of natural killer cell activation (GO:0032814)	external side of plasma membrane (GO:0009897)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(10)|ovary(1)|prostate(1)|skin(4)	24	all_cancers(52;2.63e-17)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.0175)			AGTCTCTGCTCAAAAAAAAAAC	0.416																																																	0																																										SO:0001624	3_prime_UTR_variant	57823			AB027233	CCDS1209.1, CCDS60321.1, CCDS60322.1, CCDS60323.1, CCDS60324.1, CCDS60325.1, CCDS72956.1, CCDS72957.1	1q23.1-q24.1	2013-01-11			ENSG00000026751	ENSG00000026751		"""CD molecules"", ""Immunoglobulin superfamily / V-set domain containing"""	21394	protein-coding gene	gene with protein product		606625				11802771, 11220635	Standard	XM_005245386		Approved	CRACC, 19A, CS1, CD319	uc001fwq.3	Q9NQ25	OTTHUMG00000024008	ENST00000368043.3:c.*31->A	1.37:g.160723007_160723007dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3U1|B4DPU4|B4DPY3|B4DWA3|Q8N6Y8|Q8ND32|Q9NY08|Q9NY23	RNA	INS	-	NULL	ENST00000368043.3	37	NULL	CCDS1209.1	1																																																																																			SLAMF7	-	-		0.416	SLAMF7-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SLAMF7	HGNC	protein_coding	OTTHUMT00000060464.1	-	NM_021181		160722998	+1	no_errors	ENST00000484221	ensembl	human	known	70_37	rna	INS	0.000:0.002	A
SLC30A6	55676	genome.wustl.edu	37	2	32445705	32445705	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:32445705C>G	ENST00000282587.5	+	14	1346	c.1309C>G	c.(1309-1311)Caa>Gaa	p.Q437E	SLC30A6_ENST00000538303.1_Missense_Mutation_p.Q408E|SLC30A6_ENST00000357055.3_Missense_Mutation_p.Q240E|SLC30A6_ENST00000406369.1_Missense_Mutation_p.Q363E|SLC30A6_ENST00000379343.2_Missense_Mutation_p.Q477E|SLC30A6_ENST00000435660.1_Missense_Mutation_p.Q414E	NM_017964.3	NP_060434.2	Q6NXT4	ZNT6_HUMAN	solute carrier family 30 (zinc transporter), member 6	437					cellular protein metabolic process (GO:0044267)|Golgi to endosome transport (GO:0006895)|transmembrane transport (GO:0055085)	Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	zinc ion transmembrane transporter activity (GO:0005385)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(4)|lung(5)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	19	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.208)					TGGAGCAACTCAAGGATTGAG	0.378																																																	0													82.0	80.0	81.0					2																	32445705		2203	4300	6503	SO:0001583	missense	55676			AK055663	CCDS1780.1, CCDS54341.1, CCDS54342.1, CCDS54343.1	2p22.3	2013-05-22			ENSG00000152683	ENSG00000152683		"""Solute carriers"""	19305	protein-coding gene	gene with protein product		611148					Standard	NM_017964		Approved	FLJ31101, ZNT6	uc002rof.2	Q6NXT4	OTTHUMG00000128456	ENST00000282587.5:c.1309C>G	2.37:g.32445705C>G	ENSP00000282587:p.Gln437Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A5YM45|B7Z901|Q8N5C9|Q96NC3	Missense_Mutation	SNP	pfam_Cation_efflux,tigrfam_Cation_efflux	p.Q437E	ENST00000282587.5	37	c.1309	CCDS1780.1	2	.	.	.	.	.	.	.	.	.	.	C	13.63	2.293487	0.40594	.	.	ENSG00000152683	ENST00000379343;ENST00000282587;ENST00000435660;ENST00000538303;ENST00000357055;ENST00000406369	T;T	0.77620	-1.11;-1.11	5.44	5.44	0.79542	.	0.130610	0.50627	D	0.000102	T	0.75932	0.3917	L	0.32530	0.975	0.48511	D	0.999667	B;B;P;B	0.44044	0.255;0.187;0.825;0.118	B;B;P;B	0.46026	0.057;0.058;0.501;0.039	T	0.77819	-0.2446	10	0.56958	D	0.05	-19.6262	19.217	0.93782	0.0:1.0:0.0:0.0	.	408;414;477;437	B7Z901;Q6NXT4-3;Q6NXT4-2;Q6NXT4	.;.;.;ZNT6_HUMAN	E	477;437;414;408;240;363	ENSP00000282587:Q437E;ENSP00000440678:Q408E	ENSP00000282587:Q437E	Q	+	1	0	SLC30A6	32299209	1.000000	0.71417	0.718000	0.30602	0.409000	0.31022	6.119000	0.71590	2.702000	0.92279	0.591000	0.81541	CAA	SLC30A6	-	NULL		0.378	SLC30A6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC30A6	HGNC	protein_coding	OTTHUMT00000250254.2	C			32445705	+1	no_errors	ENST00000282587	ensembl	human	known	70_37	missense	SNP	0.997	G
SLC35E2B	728661	genome.wustl.edu	37	1	1601573	1601573	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:1601573G>A	ENST00000378662.1	-	7	1485	c.725C>T	c.(724-726)tCa>tTa	p.S242L	RP11-345P4.7_ENST00000596308.1_RNA|SLC35E2B_ENST00000234800.6_Missense_Mutation_p.S242L			P0CK96	S352B_HUMAN	solute carrier family 35, member E2B	242						integral component of membrane (GO:0016021)				kidney(1)|lung(1)	2						CAGCTTTTTTGAAAAAACATT	0.438																																																	0													124.0	104.0	110.0					1																	1601573		692	1591	2283	SO:0001583	missense	728661				CCDS44041.1	1p36.33	2013-05-22			ENSG00000189339	ENSG00000189339		"""Solute carriers"""	33941	protein-coding gene	gene with protein product							Standard	XM_006710870		Approved		uc001ahg.4	P0CK96	OTTHUMG00000078639	ENST00000378662.1:c.725C>T	1.37:g.1601573G>A	ENSP00000367931:p.Ser242Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWR0|O75035|Q2TAY8|Q569F8|Q5CZA4|Q9Y3J8	Missense_Mutation	SNP	pfam_DUF250,pfam_DMT,pfam_UAA	p.S242L	ENST00000378662.1	37	c.725	CCDS44041.1	1	.	.	.	.	.	.	.	.	.	.	g	34	5.382117	0.95967	.	.	ENSG00000189339	ENST00000378662;ENST00000234800	T;T	0.65178	-0.14;-0.14	5.64	5.64	0.86602	Domain of unknown function DUF250 (1);	0.081437	0.51477	D	0.000099	D	0.82604	0.5073	M	0.86343	2.81	0.58432	D	0.999999	D	0.89917	1.0	D	0.87578	0.998	D	0.84569	0.0654	10	0.59425	D	0.04	-21.178	18.681	0.91546	0.0:0.0:1.0:0.0	.	242	P0CK96	S352B_HUMAN	L	242	ENSP00000367931:S242L;ENSP00000234800:S242L	ENSP00000234800:S242L	S	-	2	0	SLC35E2B	1591436	1.000000	0.71417	0.976000	0.42696	0.974000	0.67602	8.476000	0.90421	2.650000	0.89964	0.585000	0.79938	TCA	SLC35E2B	-	pfam_DUF250,pfam_DMT,pfam_UAA		0.438	SLC35E2B-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SLC35E2B	HGNC	protein_coding	OTTHUMT00000171589.1	G			1601573	-1	no_errors	ENST00000234800	ensembl	human	known	70_37	missense	SNP	1.000	A
SRP72	6731	genome.wustl.edu	37	4	57355616	57355616	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:57355616C>T	ENST00000342756.5	+	13	2008	c.1287C>T	c.(1285-1287)ttC>ttT	p.F429F	SRP72_ENST00000510663.1_Silent_p.F368F	NM_006947.3	NP_008878.3	O76094	SRP72_HUMAN	signal recognition particle 72kDa	429					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|response to drug (GO:0042493)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|signal recognition particle, endoplasmic reticulum targeting (GO:0005786)	7S RNA binding (GO:0008312)|poly(A) RNA binding (GO:0044822)|signal recognition particle binding (GO:0005047)			breast(2)|endometrium(4)|kidney(1)|large_intestine(4)|liver(2)|lung(7)|ovary(2)	22	Glioma(25;0.08)|all_neural(26;0.101)					TTGAGGTCTTCACACAAGCTA	0.353																																																	0													125.0	113.0	117.0					4																	57355616		2203	4300	6503	SO:0001819	synonymous_variant	6731			AF069765	CCDS3506.1, CCDS58898.1	4q11	2013-01-10	2002-08-29		ENSG00000174780	ENSG00000174780		"""Tetratricopeptide (TTC) repeat domain containing"""	11303	protein-coding gene	gene with protein product		602122	"""signal recognition particle 72kD"""			9224693, 9857079	Standard	NM_006947		Approved		uc003hbv.3	O76094	OTTHUMG00000128843	ENST00000342756.5:c.1287C>T	4.37:g.57355616C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	G5E9Z8|Q7Z3C0	Silent	SNP	pfam_Signal_recog_part_SRP72_RNA-bd,pfam_TPR-1,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.F429	ENST00000342756.5	37	c.1287	CCDS3506.1	4																																																																																			SRP72	-	smart_TPR_repeat		0.353	SRP72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRP72	HGNC	protein_coding	OTTHUMT00000250782.7	C			57355616	+1	no_errors	ENST00000342756	ensembl	human	known	70_37	silent	SNP	1.000	T
SRRM4	84530	genome.wustl.edu	37	12	119594444	119594444	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:119594444G>A	ENST00000267260.4	+	13	2065	c.1677G>A	c.(1675-1677)cgG>cgA	p.R559R		NM_194286.3	NP_919262.2	A7MD48	SRRM4_HUMAN	serine/arginine repetitive matrix 4	559	Arg-rich.|Ser-rich.				cell differentiation (GO:0030154)|mRNA processing (GO:0006397)|nervous system development (GO:0007399)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|regulation of RNA splicing (GO:0043484)|RNA splicing (GO:0008380)|sensory perception of sound (GO:0007605)	nucleus (GO:0005634)	mRNA binding (GO:0003729)			breast(2)|central_nervous_system(2)|endometrium(5)|kidney(1)|large_intestine(2)|lung(8)|ovary(3)|upper_aerodigestive_tract(1)	24						gccggagccggagacggagcc	0.731																																																	0													6.0	8.0	8.0					12																	119594444		1970	4133	6103	SO:0001819	synonymous_variant	84530			AB058756	CCDS44994.1	12q24.23	2009-09-22	2009-09-21	2009-09-21	ENSG00000139767	ENSG00000139767			29389	protein-coding gene	gene with protein product	"""neural-specific SR-related protein of 100 kDa"""	613103	"""KIAA1853"""	KIAA1853		19737518	Standard	NM_194286		Approved	nSR100	uc001txa.2	A7MD48	OTTHUMG00000168928	ENST00000267260.4:c.1677G>A	12.37:g.119594444G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5P6|B2RZH7|Q7Z5F0|Q96JH4	Silent	SNP	NULL	p.R559	ENST00000267260.4	37	c.1677	CCDS44994.1	12																																																																																			SRRM4	-	NULL		0.731	SRRM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SRRM4	HGNC	protein_coding	OTTHUMT00000401640.2	G	NM_194286		119594444	+1	no_errors	ENST00000267260	ensembl	human	known	70_37	silent	SNP	0.961	A
SRRT	51593	genome.wustl.edu	37	7	100482651	100482651	+	Missense_Mutation	SNP	G	G	T	rs572333813		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr7:100482651G>T	ENST00000347433.4	+	9	1307	c.1149G>T	c.(1147-1149)aaG>aaT	p.K383N	SRRT_ENST00000388793.4_Missense_Mutation_p.K383N|SRRT_ENST00000457580.2_Missense_Mutation_p.K383N|SRRT_ENST00000432932.1_Missense_Mutation_p.K383N			Q9BXP5	SRRT_HUMAN	serrate, RNA effector molecule	383	Glu-rich.				cell proliferation (GO:0008283)|neuronal stem cell maintenance (GO:0097150)|primary miRNA processing (GO:0031053)|regulation of transcription, DNA-templated (GO:0006355)|response to arsenic-containing substance (GO:0046685)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(5)|ovary(3)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	40						AGGAGGAGAAGGAGGAGGCCG	0.587																																																	0													144.0	169.0	160.0					7																	100482651		2203	4300	6503	SO:0001583	missense	51593				CCDS34709.1, CCDS47665.1, CCDS47666.1, CCDS47667.1	7q21	2014-04-14	2014-04-14		ENSG00000087087	ENSG00000087087			24101	protein-coding gene	gene with protein product	"""arsenite resistance protein"""	614469	"""serrate RNA effector molecule homolog (Arabidopsis)"""			11239002, 11230166	Standard	NM_015908		Approved	Asr2, serrate, ARS2	uc003uwy.2	Q9BXP5	OTTHUMG00000157031	ENST00000347433.4:c.1149G>T	7.37:g.100482651G>T	ENSP00000314491:p.Lys383Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2E5|A4D2E6|A6NK22|B4DJL4|B4DZA6|O95808|Q32MI4|Q6NT74|Q8TDQ5|Q9BWP6|Q9BXP4|Q9Y4S4	Missense_Mutation	SNP	pfam_Arsenite-R_2,pfam_DUF3546	p.K383N	ENST00000347433.4	37	c.1149	CCDS34709.1	7	.	.	.	.	.	.	.	.	.	.	G	9.238	1.037646	0.19669	.	.	ENSG00000087087	ENST00000457580;ENST00000388793;ENST00000432932;ENST00000347433;ENST00000448764	T;T	0.17691	2.26;2.26	5.14	3.32	0.38043	.	0.461311	0.22214	N	0.063054	T	0.24198	0.0586	L	0.29908	0.895	0.44110	D	0.996884	D;D;D;D	0.76494	0.999;0.999;0.999;0.998	D;D;D;D	0.78314	0.991;0.991;0.991;0.981	T	0.02015	-1.1229	10	0.31617	T	0.26	.	7.4343	0.27145	0.256:0.0:0.744:0.0	.	383;383;383;383	Q9BXP5-3;Q9BXP5-4;Q9BXP5-2;Q9BXP5	.;.;.;SRRT_HUMAN	N	383;383;383;383;13	ENSP00000416553:K383N;ENSP00000314491:K383N	ENSP00000314491:K383N	K	+	3	2	SRRT	100320587	0.999000	0.42202	0.998000	0.56505	0.748000	0.42578	1.190000	0.32126	0.558000	0.29135	0.655000	0.94253	AAG	SRRT	-	NULL		0.587	SRRT-004	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	SRRT	HGNC	protein_coding	OTTHUMT00000347168.1	G	NM_015908		100482651	+1	no_errors	ENST00000388793	ensembl	human	known	70_37	missense	SNP	1.000	T
STAM2	10254	genome.wustl.edu	37	2	153004816	153004817	+	Splice_Site	INS	-	-	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:153004816_153004817insA	ENST00000263904.4	-	3	475		c.e3-2		STAM2_ENST00000465460.1_Splice_Site	NM_005843.4	NP_005834.4	O75886	STAM2_HUMAN	signal transducing adaptor molecule (SH3 domain and ITAM motif) 2						endosomal transport (GO:0016197)|epidermal growth factor receptor signaling pathway (GO:0007173)|intracellular protein transport (GO:0006886)|membrane organization (GO:0061024)|negative regulation of epidermal growth factor receptor signaling pathway (GO:0042059)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome (GO:0005768)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|nucleus (GO:0005634)				endometrium(3)|large_intestine(4)|lung(8)|ovary(1)	16				BRCA - Breast invasive adenocarcinoma(221;0.22)		TCTTTCGCTCTAAAAAAAAAAA	0.297																																																	0																																										SO:0001630	splice_region_variant	10254			AF042274	CCDS2196.1	2q23.3	2009-04-29			ENSG00000115145	ENSG00000115145			11358	protein-coding gene	gene with protein product	"""HSE1 homolog (S. cerevisiae)"""	606244				10899310, 10993906	Standard	NM_005843		Approved	Hbp	uc002tyc.4	O75886	OTTHUMG00000131885	ENST00000263904.4:c.126-2->T	2.37:g.153004827_153004827dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8A0|D3DPA1|Q7LDQ0|Q9UF58	Splice_Site	INS	-	e3-2	ENST00000263904.4	37	c.126-3_126-2	CCDS2196.1	2																																																																																			STAM2	-	-		0.297	STAM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAM2	HGNC	protein_coding	OTTHUMT00000254835.2	-	NM_005843	Intron	153004817	-1	no_errors	ENST00000263904	ensembl	human	known	70_37	splice_site_ins	INS	1.000:0.002	A
SYNE2	23224	genome.wustl.edu	37	14	64676741	64676741	+	Missense_Mutation	SNP	C	C	T	rs377305355		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr14:64676741C>T	ENST00000344113.4	+	103	18834	c.18622C>T	c.(18622-18624)Cgc>Tgc	p.R6208C	SYNE2_ENST00000394768.2_Missense_Mutation_p.R2593C|SYNE2_ENST00000555022.1_Missense_Mutation_p.R86C|SYNE2_ENST00000554584.1_Missense_Mutation_p.R6167C|ESR2_ENST00000542956.1_Intron|SYNE2_ENST00000555002.1_Missense_Mutation_p.R2842C|SYNE2_ENST00000358025.3_Missense_Mutation_p.R6208C|SYNE2_ENST00000554805.1_5'UTR|SYNE2_ENST00000357395.3_Missense_Mutation_p.R2593C	NM_015180.4	NP_055995.4	Q8WXH0	SYNE2_HUMAN	spectrin repeat containing, nuclear envelope 2	6208					centrosome localization (GO:0051642)|cytoskeletal anchoring at nuclear membrane (GO:0090286)|establishment or maintenance of cell polarity (GO:0007163)|fibroblast migration (GO:0010761)|nuclear envelope organization (GO:0006998)|nuclear migration (GO:0007097)|nuclear migration along microfilament (GO:0031022)|positive regulation of cell migration (GO:0030335)|protein localization to nucleus (GO:0034504)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|filopodium membrane (GO:0031527)|focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|intermediate filament cytoskeleton (GO:0045111)|lamellipodium membrane (GO:0031258)|mitochondrion (GO:0005739)|nuclear envelope (GO:0005635)|nuclear lumen (GO:0031981)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)|sarcoplasmic reticulum (GO:0016529)|SUN-KASH complex (GO:0034993)|Z disc (GO:0030018)	actin binding (GO:0003779)			NS(5)|breast(17)|central_nervous_system(3)|cervix(8)|endometrium(17)|haematopoietic_and_lymphoid_tissue(2)|kidney(21)|large_intestine(34)|lung(75)|ovary(10)|pancreas(2)|prostate(8)|skin(8)|stomach(1)|upper_aerodigestive_tract(9)|urinary_tract(4)	224				all cancers(60;0.00153)|OV - Ovarian serous cystadenocarcinoma(108;0.00444)|BRCA - Breast invasive adenocarcinoma(234;0.0681)		CCGGGAGAACCGCACAGACAC	0.637																																																	0								C	CYS/ARG,CYS/ARG	0,4406		0,0,2203	42.0	44.0	44.0		18622,18622	4.7	1.0	14		44	4,8596	3.7+/-12.6	0,4,4296	no	missense,missense	SYNE2	NM_015180.4,NM_182914.2	180,180	0,4,6499	TT,TC,CC		0.0465,0.0,0.0308	probably-damaging,probably-damaging	6208/6886,6208/6908	64676741	4,13002	2203	4300	6503	SO:0001583	missense	23224			AB023228	CCDS9761.2, CCDS41963.1, CCDS45124.1, CCDS45125.1	14q22.1-q22.3	2014-09-17			ENSG00000054654	ENSG00000054654			17084	protein-coding gene	gene with protein product	"""nuclear envelope spectrin repeat-2"", ""nucleus and actin connecting element"""	608442				10231032, 10878022	Standard	NM_182910		Approved	SYNE-2, DKFZP434H2235, Nesprin-2, NUANCE, NUA, KIAA1011, Nesp2	uc001xgl.3	Q8WXH0	OTTHUMG00000140349	ENST00000344113.4:c.18622C>T	14.37:g.64676741C>T	ENSP00000341781:p.Arg6208Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q540G1|Q8N1S3|Q8NF49|Q8TER7|Q8WWW3|Q8WWW4|Q8WWW5|Q8WXH1|Q9NU50|Q9UFQ4|Q9Y2L4|Q9Y4R1	Missense_Mutation	SNP	pfam_CH-domain,pfam_KASH,pfam_Spectrin_repeat,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,pfscan_CH-domain,pfscan_KASH	p.R6208C	ENST00000344113.4	37	c.18622	CCDS41963.1	14	.	.	.	.	.	.	.	.	.	.	C	16.63	3.177005	0.57692	0.0	4.65E-4	ENSG00000054654	ENST00000358025;ENST00000357395;ENST00000344113;ENST00000554584;ENST00000261678;ENST00000555002;ENST00000394768;ENST00000555022	T;T;T;T;T;T;T	0.35048	1.33;1.33;1.33;1.33;1.33;1.33;1.33	5.63	4.74	0.60224	.	0.135690	0.33290	N	0.005062	T	0.62183	0.2407	M	0.81802	2.56	0.80722	D	1	D;D;P;D;D	0.89917	1.0;1.0;0.76;0.999;1.0	D;D;B;D;D	0.97110	1.0;1.0;0.147;0.995;0.959	T	0.68277	-0.5451	10	0.87932	D	0	.	14.4049	0.67075	0.0:0.9285:0.0:0.0715	.	2593;596;6167;6208;6208	Q8WXH0-7;Q7Z362;G3V5X4;Q8WXH0;Q8WXH0-2	.;.;.;SYNE2_HUMAN;.	C	6208;2593;6208;6167;6173;2842;2593;86	ENSP00000350719:R6208C;ENSP00000349969:R2593C;ENSP00000341781:R6208C;ENSP00000452570:R6167C;ENSP00000450831:R2842C;ENSP00000378249:R2593C;ENSP00000451009:R86C	ENSP00000261678:R6173C	R	+	1	0	SYNE2	63746494	1.000000	0.71417	1.000000	0.80357	0.975000	0.68041	7.562000	0.82300	1.351000	0.45789	0.609000	0.83330	CGC	SYNE2	-	pfam_Spectrin_repeat,smart_Spectrin/alpha-actinin		0.637	SYNE2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SYNE2	HGNC	protein_coding	OTTHUMT00000276994.2	C	NM_182914		64676741	+1	no_errors	ENST00000358025	ensembl	human	known	70_37	missense	SNP	1.000	T
TBC1D14	57533	genome.wustl.edu	37	4	7026927	7026927	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr4:7026927G>A	ENST00000409757.4	+	13	2078	c.1954G>A	c.(1954-1956)Gag>Aag	p.E652K	TBC1D14_ENST00000448507.1_Missense_Mutation_p.E652K|TBC1D14_ENST00000451522.2_Missense_Mutation_p.E372K|TBC1D14_ENST00000446947.2_Missense_Mutation_p.E299K|TBC1D14_ENST00000410031.1_Missense_Mutation_p.E424K	NM_020773.2	NP_065824.2	Q9P2M4	TBC14_HUMAN	TBC1 domain family, member 14	652					negative regulation of autophagy (GO:0010507)|recycling endosome to Golgi transport (GO:0071955)|regulation of autophagic vacuole assembly (GO:2000785)	autophagic vacuole (GO:0005776)|Golgi apparatus (GO:0005794)|recycling endosome (GO:0055037)	protein kinase binding (GO:0019901)|Rab GTPase activator activity (GO:0005097)			breast(1)|endometrium(5)|large_intestine(4)|lung(9)|ovary(1)|pancreas(1)|upper_aerodigestive_tract(1)	22						CCTGCCCGCCGAGGAGCTGTT	0.602																																																	0													88.0	76.0	80.0					4																	7026927		2203	4300	6503	SO:0001583	missense	57533			AL833868	CCDS3394.2, CCDS47006.1, CCDS75104.1	4p16.1	2008-01-22			ENSG00000132405	ENSG00000132405			29246	protein-coding gene	gene with protein product		614855				10718198	Standard	NM_020773		Approved	KIAA1322	uc003gjs.4	Q9P2M4	OTTHUMG00000090493	ENST00000409757.4:c.1954G>A	4.37:g.7026927G>A	ENSP00000386921:p.Glu652Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B9A6L5|D3DVT4|E9PAZ6|Q8IW15|Q8NDK3	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E652K	ENST00000409757.4	37	c.1954	CCDS3394.2	4	.	.	.	.	.	.	.	.	.	.	G	17.39	3.378203	0.61735	.	.	ENSG00000132405	ENST00000448507;ENST00000409757;ENST00000410031;ENST00000451522;ENST00000446947	T;T;T;T;T	0.24151	1.87;1.87;1.87;1.87;1.87	5.15	5.15	0.70609	Rab-GAP/TBC domain (1);	0.281705	0.38005	N	0.001855	T	0.28267	0.0698	M	0.65498	2.005	0.58432	D	0.999999	P;P;P	0.42973	0.796;0.487;0.47	B;B;B	0.34242	0.147;0.178;0.07	T	0.17440	-1.0369	10	0.48119	T	0.1	-9.1509	17.6366	0.88124	0.0:0.0:1.0:0.0	.	299;372;652	F5GXK4;Q9P2M4-2;Q9P2M4	.;.;TBC14_HUMAN	K	652;652;424;372;299	ENSP00000404041:E652K;ENSP00000386921:E652K;ENSP00000386343:E424K;ENSP00000388886:E372K;ENSP00000405875:E299K	ENSP00000386921:E652K	E	+	1	0	TBC1D14	7077828	1.000000	0.71417	0.039000	0.18376	0.772000	0.43724	5.121000	0.64691	2.409000	0.81822	0.561000	0.74099	GAG	TBC1D14	-	superfamily_Rab-GTPase-TBC_dom		0.602	TBC1D14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D14	HGNC	protein_coding	OTTHUMT00000206981.3	G	NM_020773		7026927	+1	no_errors	ENST00000409757	ensembl	human	known	70_37	missense	SNP	0.986	A
TBX22	50945	genome.wustl.edu	37	X	79278734	79278734	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chrX:79278734G>A	ENST00000373294.5	+	2	379	c.351G>A	c.(349-351)gcG>gcA	p.A117A	TBX22_ENST00000442340.1_5'UTR|TBX22_ENST00000373291.1_5'UTR|TBX22_ENST00000373296.3_Silent_p.A117A	NM_016954.2	NP_058650.1	Q9Y458	TBX22_HUMAN	T-box 22	117					multicellular organismal development (GO:0007275)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(2)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(13)|lung(38)|ovary(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	65						TTACTAAAGCGGGCAGGTTCG	0.448																																																	0													62.0	57.0	58.0					X																	79278734		2203	4300	6503	SO:0001819	synonymous_variant	50945			AL031000	CCDS14445.1, CCDS43975.1	Xq21.1	2011-02-11			ENSG00000122145	ENSG00000122145		"""T-boxes"""	11600	protein-coding gene	gene with protein product		300307	"""cleft palate and/or ankyloglossia"""	CPX, CLPA		11559848, 14729838	Standard	NM_001109878		Approved		uc004edj.1	Q9Y458	OTTHUMG00000021901	ENST00000373294.5:c.351G>A	X.37:g.79278734G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JZ06|Q96LC0|Q9HBF1	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.A117	ENST00000373294.5	37	c.351	CCDS14445.1	X																																																																																			TBX22	-	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box		0.448	TBX22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX22	HGNC	protein_coding	OTTHUMT00000057334.1	G	NM_016954		79278734	+1	no_errors	ENST00000373294	ensembl	human	known	70_37	silent	SNP	0.655	A
TLL2	7093	genome.wustl.edu	37	10	98172979	98172979	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr10:98172979C>T	ENST00000357947.3	-	8	1243	c.1018G>A	c.(1018-1020)Gct>Act	p.A340T	TLL2_ENST00000469598.1_5'UTR	NM_012465.3	NP_036597.1	Q9Y6L7	TLL2_HUMAN	tolloid-like 2	340	Metalloprotease. {ECO:0000250}.				cell differentiation (GO:0030154)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|multicellular organismal development (GO:0007275)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|breast(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(15)|lung(22)|ovary(1)|pancreas(1)|prostate(1)|skin(3)	58		Colorectal(252;0.0846)		Epithelial(162;1.51e-07)|all cancers(201;7.59e-06)		CGGGCTTGAGCTATGTCTCCC	0.557																																																	0													67.0	59.0	62.0					10																	98172979		2203	4300	6503	SO:0001583	missense	7093			AF059516	CCDS7449.1	10q23-q24	2008-07-29			ENSG00000095587	ENSG00000095587			11844	protein-coding gene	gene with protein product		606743				10516436	Standard	NM_012465		Approved		uc001kml.2	Q9Y6L7	OTTHUMG00000018833	ENST00000357947.3:c.1018G>A	10.37:g.98172979C>T	ENSP00000350630:p.Ala340Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDK0|Q2M1H1|Q6PJN5|Q9UQ00	Missense_Mutation	SNP	pfam_CUB,pfam_Peptidase_M12A,pfam_EGF-like_Ca-bd,superfamily_CUB,smart_Peptidase_Metallo,smart_CUB,smart_EGF-like_Ca-bd,smart_EG-like_dom,pirsf_BMP_1/tolloid-like,pfscan_CUB,pfscan_EG-like_dom,prints_Peptidase_M12A	p.A340T	ENST00000357947.3	37	c.1018	CCDS7449.1	10	.	.	.	.	.	.	.	.	.	.	C	20.9	4.069068	0.76301	.	.	ENSG00000095587	ENST00000357947	T	0.63744	-0.06	5.28	5.28	0.74379	Peptidase M12A, astacin (2);Metallopeptidase, catalytic domain (1);	0.000000	0.45361	D	0.000370	T	0.52581	0.1743	L	0.34521	1.04	0.58432	D	0.999999	P	0.44659	0.84	B	0.38500	0.275	T	0.54833	-0.8234	10	0.37606	T	0.19	.	17.9	0.88900	0.0:1.0:0.0:0.0	.	340	Q9Y6L7	TLL2_HUMAN	T	340	ENSP00000350630:A340T	ENSP00000350630:A340T	A	-	1	0	TLL2	98162969	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	4.815000	0.62634	2.478000	0.83669	0.455000	0.32223	GCT	TLL2	-	pfam_Peptidase_M12A,pirsf_BMP_1/tolloid-like,prints_Peptidase_M12A		0.557	TLL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TLL2	HGNC	protein_coding	OTTHUMT00000049608.1	C			98172979	-1	no_errors	ENST00000357947	ensembl	human	known	70_37	missense	SNP	1.000	T
TMEM182	130827	genome.wustl.edu	37	2	103380846	103380846	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:103380846G>A	ENST00000412401.2	+	3	496	c.291G>A	c.(289-291)atG>atA	p.M97I	TMEM182_ENST00000486293.1_3'UTR|TMEM182_ENST00000409528.1_Start_Codon_SNP_p.M1I|TMEM182_ENST00000409173.1_Missense_Mutation_p.M54I	NM_144632.3	NP_653233.3	Q6ZP80	TM182_HUMAN	transmembrane protein 182	97						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(5)	11						ACCCCTTCATGAGAGGCGAGC	0.483																																																	0													166.0	133.0	145.0					2																	103380846		2203	4300	6503	SO:0001583	missense	130827			AK054856	CCDS2064.1	2q12.1	2009-08-25			ENSG00000170417	ENSG00000170417			26391	protein-coding gene	gene with protein product						12477932	Standard	NM_144632		Approved	FLJ30294	uc010fjb.3	Q6ZP80	OTTHUMG00000130779	ENST00000412401.2:c.291G>A	2.37:g.103380846G>A	ENSP00000394178:p.Met97Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JML7|Q3B7B8|Q53TT9|Q6GMU0|Q8WW45|Q96NR4	Missense_Mutation	SNP	NULL	p.M97I	ENST00000412401.2	37	c.291	CCDS2064.1	2	.	.	.	.	.	.	.	.	.	.	G	13.26	2.184667	0.38609	.	.	ENSG00000170417	ENST00000454536;ENST00000409528;ENST00000409173;ENST00000412401	T;T;T;T	0.40756	1.02;1.06;1.02;1.02	5.83	4.95	0.65309	.	0.577329	0.21556	N	0.072649	T	0.14056	0.0340	N	0.02011	-0.69	0.25130	N	0.990576	B;B	0.02656	0.0;0.0	B;B	0.04013	0.001;0.0	T	0.16897	-1.0387	10	0.15499	T	0.54	-7.7002	3.2941	0.06960	0.1505:0.1464:0.5686:0.1344	.	97;54	Q6ZP80;B8ZZ71	TM182_HUMAN;.	I	54;1;54;97	ENSP00000392106:M54I;ENSP00000387258:M1I;ENSP00000387184:M54I;ENSP00000394178:M97I	ENSP00000387184:M54I	M	+	3	0	TMEM182	102747278	0.938000	0.31826	1.000000	0.80357	0.982000	0.71751	0.786000	0.26844	1.459000	0.47892	0.655000	0.94253	ATG	TMEM182	-	NULL		0.483	TMEM182-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM182	HGNC	protein_coding	OTTHUMT00000253293.1	G	NM_144632		103380846	+1	no_errors	ENST00000412401	ensembl	human	known	70_37	missense	SNP	0.793	A
TMEM63A	9725	genome.wustl.edu	37	1	226047210	226047210	+	Intron	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:226047210G>A	ENST00000366835.3	-	15	1494				TMEM63A_ENST00000474478.1_5'Flank	NM_014698.2	NP_055513.2	O94886	CSCL1_HUMAN	transmembrane protein 63A						ion transport (GO:0006811)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)	nucleotide binding (GO:0000166)			breast(2)|endometrium(3)|large_intestine(5)|lung(6)|ovary(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	24	Breast(184;0.197)					AGGTCCCCAAGAGCTCAGAGG	0.522																																																	0																																										SO:0001627	intron_variant	9725				CCDS31042.1	1q42.12	2008-02-05	2005-07-25	2005-07-25	ENSG00000196187	ENSG00000196187			29118	protein-coding gene	gene with protein product			"""KIAA0792"""	KIAA0792		9872452, 9455484	Standard	NM_014698		Approved		uc001hpm.2	O94886	OTTHUMG00000037442	ENST00000366835.3:c.1224-161C>T	1.37:g.226047210G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53GI7|Q5TE96|Q8N2U2	RNA	SNP	-	NULL	ENST00000366835.3	37	NULL	CCDS31042.1	1																																																																																			TMEM63A	-	-		0.522	TMEM63A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TMEM63A	HGNC	protein_coding	OTTHUMT00000091154.2	G	NM_014698		226047210	-1	no_errors	ENST00000487971	ensembl	human	known	70_37	rna	SNP	0.058	A
TNFSF15	9966	genome.wustl.edu	37	9	117553053	117553053	+	Silent	SNP	T	T	C			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr9:117553053T>C	ENST00000374045.4	-	4	548	c.435A>G	c.(433-435)ggA>ggG	p.G145G	TNFSF15_ENST00000374044.1_Silent_p.G68G|AL390240.1_ENST00000408807.1_RNA	NM_001204344.1|NM_005118.3	NP_001191273.1|NP_005109.2	O95150	TNF15_HUMAN	tumor necrosis factor (ligand) superfamily, member 15	145					activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|activation of NF-kappaB-inducing kinase activity (GO:0007250)|cytokine metabolic process (GO:0042107)|immune response (GO:0006955)|positive regulation of cytokine secretion (GO:0050715)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	receptor binding (GO:0005102)			breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(4)|skin(1)	11						TGAAGTAGTCTCCCGACTCTG	0.507																																																	0													132.0	125.0	127.0					9																	117553053		2203	4300	6503	SO:0001819	synonymous_variant	9966			AF039390	CCDS6809.1	9q32	2008-07-21			ENSG00000181634	ENSG00000181634		"""Tumor necrosis factor (ligand) superfamily"""	11931	protein-coding gene	gene with protein product	"""vascular endothelial cell growth inhibitor"", ""TNF superfamily ligand TL1A"", ""TNF ligand-related molecule 1"", ""vascular endothelial growth inhibitor-192A"""	604052				9434163	Standard	NM_005118		Approved	TL1, VEGI, TL1A, VEGI192A, MGC129934, MGC129935	uc004bjh.3	O95150	OTTHUMG00000021011	ENST00000374045.4:c.435A>G	9.37:g.117553053T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3SX69|Q5VJK8|Q5VWH1|Q8NFE9	Silent	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF,prints_TNF_a/b/c	p.G145	ENST00000374045.4	37	c.435	CCDS6809.1	9																																																																																			TNFSF15	-	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF		0.507	TNFSF15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TNFSF15	HGNC	protein_coding	OTTHUMT00000055424.2	T	NM_005118		117553053	-1	no_errors	ENST00000374045	ensembl	human	known	70_37	silent	SNP	1.000	C
TRIM42	287015	genome.wustl.edu	37	3	140401595	140401595	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr3:140401595C>T	ENST00000286349.3	+	2	824	c.633C>T	c.(631-633)caC>caT	p.H211H		NM_152616.4	NP_689829.3	Q8IWZ5	TRI42_HUMAN	tripartite motif containing 42	211						intracellular (GO:0005622)	zinc ion binding (GO:0008270)	p.H211H(1)		breast(1)|central_nervous_system(1)|cervix(2)|endometrium(2)|large_intestine(11)|lung(33)|ovary(2)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	69						ACTACCTGCACGGGCGTCTCA	0.612																																																	1	Substitution - coding silent(1)	prostate(1)											75.0	74.0	74.0					3																	140401595		2203	4300	6503	SO:0001819	synonymous_variant	287015			AF521868	CCDS3113.1	3q23	2014-02-17	2011-01-25		ENSG00000155890	ENSG00000155890		"""Tripartite motif containing / Tripartite motif containing"", ""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Fibronectin type III domain containing"", ""RING-type (C3HC4) zinc fingers"""	19014	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 40"""		"""tripartite motif-containing 42"""				Standard	NM_152616		Approved	FLJ40097, PPP1R40	uc003eto.2	Q8IWZ5	OTTHUMG00000160170	ENST00000286349.3:c.633C>T	3.37:g.140401595C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4B4|Q8N832|Q8NDL3	Silent	SNP	pfam_Znf_B-box,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Znf_B-box,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Znf_B-box,pfscan_Znf_RING	p.H211	ENST00000286349.3	37	c.633	CCDS3113.1	3																																																																																			TRIM42	-	NULL		0.612	TRIM42-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM42	HGNC	protein_coding	OTTHUMT00000359531.2	C	NM_152616		140401595	+1	no_errors	ENST00000286349	ensembl	human	known	70_37	silent	SNP	0.812	T
TRIM63	84676	genome.wustl.edu	37	1	26387774	26387774	+	Missense_Mutation	SNP	C	C	G			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:26387774C>G	ENST00000374272.3	-	3	522	c.384G>C	c.(382-384)gaG>gaC	p.E128D	TRIM63_ENST00000483052.1_5'UTR	NM_032588.3	NP_115977.2	Q969Q1	TRI63_HUMAN	tripartite motif containing 63, E3 ubiquitin protein ligase	128	Interaction with TTN.				cellular response to dexamethasone stimulus (GO:0071549)|muscle contraction (GO:0006936)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|regulation of gene expression (GO:0010468)|response to electrical stimulus involved in regulation of muscle adaptation (GO:0014878)|response to interleukin-1 (GO:0070555)|signal transduction (GO:0007165)|skeletal muscle atrophy (GO:0014732)	contractile fiber (GO:0043292)|cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	ligase activity (GO:0016874)|signal transducer activity (GO:0004871)|titin binding (GO:0031432)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			kidney(1)|large_intestine(1)|ovary(1)|skin(1)|stomach(1)	5		Colorectal(325;3.46e-05)|Lung NSC(340;0.000154)|all_lung(284;0.00021)|Renal(390;0.0007)|Ovarian(437;0.00473)|Breast(348;0.0133)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0298)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0178)|OV - Ovarian serous cystadenocarcinoma(117;9.15e-26)|Colorectal(126;3.16e-08)|COAD - Colon adenocarcinoma(152;1.72e-06)|KIRC - Kidney renal clear cell carcinoma(1967;0.000767)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|STAD - Stomach adenocarcinoma(196;0.00151)|GBM - Glioblastoma multiforme(114;0.00655)|READ - Rectum adenocarcinoma(331;0.0649)		TGTTGATTTTCTCATCTTCGT	0.572																																																	0													153.0	114.0	127.0					1																	26387774		2203	4300	6503	SO:0001583	missense	84676			AF353673	CCDS273.1	1p34-p33	2014-09-17	2012-02-23	2004-11-17	ENSG00000158022	ENSG00000158022		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	16007	protein-coding gene	gene with protein product	"""muscle-specific RING finger protein 1"", ""iris ring finger protein"", ""striated muscle RING zinc finger protein"""	606131	"""ring finger protein 28"", ""tripartite motif-containing 63"", ""tripartite motif containing 63"""	RNF28		11243782, 11283016	Standard	NM_032588		Approved	MURF-1, IRF, SMRZ	uc001bli.2	Q969Q1	OTTHUMG00000007510	ENST00000374272.3:c.384G>C	1.37:g.26387774C>G	ENSP00000363390:p.Glu128Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DN95|Q5T2I1|Q96BD3|Q96KD9|Q9BYV4	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,pfam_Znf_B-box,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.E128D	ENST00000374272.3	37	c.384	CCDS273.1	1	.	.	.	.	.	.	.	.	.	.	C	23.1	4.380349	0.82682	.	.	ENSG00000158022	ENST00000374272	T	0.48522	0.81	5.12	3.24	0.37175	Zinc finger, RING/FYVE/PHD-type (1);Zinc finger, B-box (3);	0.000000	0.85682	D	0.000000	T	0.74741	0.3756	H	0.96015	3.755	0.50039	D	0.999847	D	0.89917	1.0	D	0.81914	0.995	T	0.77531	-0.2553	10	0.87932	D	0	.	8.7111	0.34385	0.0:0.7627:0.0:0.2373	.	128	Q969Q1	TRI63_HUMAN	D	128	ENSP00000363390:E128D	ENSP00000363390:E128D	E	-	3	2	TRIM63	26260361	1.000000	0.71417	0.998000	0.56505	0.993000	0.82548	1.751000	0.38339	0.659000	0.30945	0.591000	0.81541	GAG	TRIM63	-	pfam_Znf_B-box,smart_Znf_B-box,pfscan_Znf_B-box		0.572	TRIM63-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM63	HGNC	protein_coding	OTTHUMT00000019750.1	C	NM_032588		26387774	-1	no_errors	ENST00000374272	ensembl	human	known	70_37	missense	SNP	1.000	G
TRIT1	54802	genome.wustl.edu	37	1	40307502	40307502	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr1:40307502G>A	ENST00000316891.5	-	11	1332	c.1318C>T	c.(1318-1320)Cag>Tag	p.Q440*	TRIT1_ENST00000372818.1_Nonsense_Mutation_p.Q414*|TRIT1_ENST00000541099.1_Nonsense_Mutation_p.Q58*|TRIT1_ENST00000545233.1_Nonsense_Mutation_p.Q194*|TRIT1_ENST00000537223.1_Nonsense_Mutation_p.Q136*|TRIT1_ENST00000441669.2_Nonsense_Mutation_p.Q358*|TRIT1_ENST00000491865.1_5'UTR|TRIT1_ENST00000537440.1_Nonsense_Mutation_p.Q136*	NM_017646.4	NP_060116.2	Q9H3H1	MOD5_HUMAN	tRNA isopentenyltransferase 1	440					tRNA processing (GO:0008033)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|tRNA dimethylallyltransferase activity (GO:0052381)			breast(1)|large_intestine(5)|liver(1)|lung(3)|ovary(2)|pancreas(1)|stomach(1)|urinary_tract(1)	15	all_cancers(7;4.55e-14)|all_lung(5;1.23e-16)|all_epithelial(6;2.17e-16)|Lung NSC(20;7.03e-07)|Ovarian(52;0.00167)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;3.29e-18)|Epithelial(16;3.07e-17)|all cancers(16;6.21e-16)|LUSC - Lung squamous cell carcinoma(16;0.000261)|Lung(16;0.000457)			GAAACACTCTGACTTTCTATG	0.423																																																	0													282.0	266.0	272.0					1																	40307502		2203	4300	6503	SO:0001587	stop_gained	54802			AF074918	CCDS30681.1	1p34.2	2012-10-05			ENSG00000043514	ENSG00000043514	2.5.1.8		20286	protein-coding gene	gene with protein product						11111046, 15870694	Standard	NM_017646		Approved	FLJ20061, IPT	uc021olz.1	Q9H3H1	OTTHUMG00000009245	ENST00000316891.5:c.1318C>T	1.37:g.40307502G>A	ENSP00000321810:p.Gln440*	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4X7|Q3T7B5|Q5QPK5|Q5QPK6|Q6IAC9|Q96FJ3|Q96L45|Q9NXT7	Nonsense_Mutation	SNP	pfam_IPPT,pfam_Isopentenyl_transferase,pfam_Znf_C2H2_jaz,smart_Znf_U1,tigrfam_tRNA_delta_PyrP_Trfase	p.Q440*	ENST00000316891.5	37	c.1318	CCDS30681.1	1	.	.	.	.	.	.	.	.	.	.	G	11.85	1.762622	0.31228	.	.	ENSG00000043514	ENST00000046894;ENST00000372825;ENST00000441669;ENST00000316891;ENST00000372818;ENST00000534869;ENST00000545233;ENST00000537440;ENST00000537223;ENST00000541099	.	.	.	5.93	5.0	0.66597	.	0.665977	0.14630	N	0.307899	.	.	.	.	.	.	0.44247	D	0.997094	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-4.2851	14.9269	0.70887	0.0:0.1426:0.8573:0.0	.	.	.	.	X	414;358;352;440;414;333;194;136;136;58	.	ENSP00000046894:Q414X	Q	-	1	0	TRIT1	40080089	0.884000	0.30299	0.315000	0.25238	0.126000	0.20510	3.364000	0.52328	1.467000	0.48044	0.655000	0.94253	CAG	TRIT1	-	NULL		0.423	TRIT1-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	TRIT1	HGNC	protein_coding	OTTHUMT00000025627.2	G	NM_017646		40307502	-1	no_errors	ENST00000316891	ensembl	human	known	70_37	nonsense	SNP	0.106	A
TRPM4	54795	genome.wustl.edu	37	19	49714020	49714020	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:49714020C>T	ENST00000252826.5	+	22	3508	c.3382C>T	c.(3382-3384)Cat>Tat	p.H1128Y	TRPM4_ENST00000355712.5_Missense_Mutation_p.H774Y|TRPM4_ENST00000427978.2_Missense_Mutation_p.H983Y	NM_017636.3	NP_060106.2	Q8TD43	TRPM4_HUMAN	transient receptor potential cation channel, subfamily M, member 4	1128	Calmodulin-binding.				calcium ion transmembrane transport (GO:0070588)|cardiac conduction (GO:0061337)|dendritic cell chemotaxis (GO:0002407)|ion transmembrane transport (GO:0034220)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of cell proliferation (GO:0008284)|protein sumoylation (GO:0016925)|regulation of membrane potential (GO:0042391)|regulation of T cell cytokine production (GO:0002724)|transmembrane transport (GO:0055085)|vasoconstriction (GO:0042310)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|calcium activated cation channel activity (GO:0005227)|calcium channel activity (GO:0005262)			breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(2)|lung(18)|ovary(2)|prostate(4)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(2)	49		all_lung(116;8.54e-05)|Lung NSC(112;0.000139)|all_neural(266;0.0506)|Ovarian(192;0.15)		all cancers(93;2.88e-05)|OV - Ovarian serous cystadenocarcinoma(262;0.000222)|GBM - Glioblastoma multiforme(486;0.00339)|Epithelial(262;0.00751)		GGAATCGGTGCATAAGGAGAA	0.632																																																	0													36.0	41.0	40.0					19																	49714020		2203	4300	6503	SO:0001583	missense	54795			AK000048	CCDS33073.1, CCDS56098.1	19q13.3	2011-12-14				ENSG00000130529		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	17993	protein-coding gene	gene with protein product		606936				11535825, 16382100	Standard	NM_017636		Approved	FLJ20041	uc002pmw.3	Q8TD43		ENST00000252826.5:c.3382C>T	19.37:g.49714020C>T	ENSP00000252826:p.His1128Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU25|Q7Z5D9|Q96L84|Q9NXV1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.H1128Y	ENST00000252826.5	37	c.3382	CCDS33073.1	19	.	.	.	.	.	.	.	.	.	.	C	15.10	2.734016	0.48939	.	.	ENSG00000130529	ENST00000252826;ENST00000427978;ENST00000355712	T;T;T	0.47177	0.85;0.85;0.85	4.57	4.57	0.56435	.	0.308103	0.31685	N	0.007225	T	0.35451	0.0932	N	0.22421	0.69	0.46542	D	0.999096	P;P;P;B	0.34909	0.475;0.467;0.467;0.229	B;B;B;B	0.31686	0.063;0.134;0.086;0.043	T	0.38779	-0.9645	10	0.62326	D	0.03	-9.6008	16.6395	0.85068	0.0:1.0:0.0:0.0	.	774;954;983;1128	B4DIX5;Q8TD43-2;Q8TD43-3;Q8TD43	.;.;.;TRPM4_HUMAN	Y	1128;983;774	ENSP00000252826:H1128Y;ENSP00000407492:H983Y;ENSP00000347944:H774Y	ENSP00000252826:H1128Y	H	+	1	0	TRPM4	54405832	1.000000	0.71417	1.000000	0.80357	0.040000	0.13550	3.908000	0.56355	2.532000	0.85374	0.561000	0.74099	CAT	TRPM4	-	NULL		0.632	TRPM4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TRPM4	HGNC	protein_coding	OTTHUMT00000465543.2	C	NM_017636		49714020	+1	no_errors	ENST00000252826	ensembl	human	known	70_37	missense	SNP	1.000	T
TSKS	60385	genome.wustl.edu	37	19	50266447	50266447	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:50266447C>T	ENST00000246801.3	-	1	140	c.58G>A	c.(58-60)Gac>Aac	p.D20N	RNU6-841P_ENST00000383872.1_RNA	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	20					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		GTGGGGGTGTCCCCGGCCTCA	0.657																																																	0													61.0	66.0	64.0					19																	50266447		2203	4300	6503	SO:0001583	missense	60385			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.58G>A	19.37:g.50266447C>T	ENSP00000246801:p.Asp20Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WXJ0	Missense_Mutation	SNP	NULL	p.D20N	ENST00000246801.3	37	c.58	CCDS12780.1	19	.	.	.	.	.	.	.	.	.	.	C	16.55	3.154504	0.57259	.	.	ENSG00000126467	ENST00000246801	T	0.51325	0.71	4.93	4.93	0.64822	.	0.000000	0.45126	D	0.000387	T	0.56124	0.1964	L	0.27053	0.805	0.80722	D	1	D	0.67145	0.996	D	0.79784	0.993	T	0.61202	-0.7110	10	0.87932	D	0	-27.6998	15.0676	0.72008	0.0:1.0:0.0:0.0	.	20	Q9UJT2	TSKS_HUMAN	N	20	ENSP00000246801:D20N	ENSP00000246801:D20N	D	-	1	0	TSKS	54958259	1.000000	0.71417	0.998000	0.56505	0.019000	0.09904	4.151000	0.58105	2.299000	0.77371	0.467000	0.42956	GAC	TSKS	-	NULL		0.657	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	C	NM_021733		50266447	-1	no_errors	ENST00000246801	ensembl	human	known	70_37	missense	SNP	1.000	T
TSKS	60385	genome.wustl.edu	37	19	50266487	50266487	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:50266487C>T	ENST00000246801.3	-	1	100	c.18G>A	c.(16-18)gtG>gtA	p.V6V	RNU6-841P_ENST00000383872.1_RNA	NM_021733.1	NP_068379.1	Q9UJT2	TSKS_HUMAN	testis-specific serine kinase substrate	6					negative regulation of phosphatase activity (GO:0010923)	centriole (GO:0005814)	protein kinase binding (GO:0019901)			breast(3)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(12)|liver(1)|lung(9)|prostate(3)|skin(3)	38		all_lung(116;3.24e-07)|Lung NSC(112;1.6e-06)|all_neural(266;0.0459)|Ovarian(192;0.0728)		OV - Ovarian serous cystadenocarcinoma(262;0.00153)|GBM - Glioblastoma multiforme(134;0.0145)		AGATCGTCTTCACCACCACGC	0.637																																																	0													55.0	58.0	57.0					19																	50266487		2203	4300	6503	SO:0001819	synonymous_variant	60385			BC058862	CCDS12780.1	19q13.3	2014-06-13							30719	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 161"""	608253				11444856, 18495105	Standard	NM_021733		Approved	TSSKS, PPP1R161	uc002ppm.3	Q9UJT2		ENST00000246801.3:c.18G>A	19.37:g.50266487C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WXJ0	Silent	SNP	NULL	p.V6	ENST00000246801.3	37	c.18	CCDS12780.1	19																																																																																			TSKS	-	NULL		0.637	TSKS-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TSKS	HGNC	protein_coding	OTTHUMT00000465795.1	C	NM_021733		50266487	-1	no_errors	ENST00000246801	ensembl	human	known	70_37	silent	SNP	1.000	T
UNC50	25972	genome.wustl.edu	37	2	99226302	99226302	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:99226302C>T	ENST00000357765.2	+	2	232	c.80C>T	c.(79-81)gCc>gTc	p.A27V	UNC50_ENST00000409975.1_Missense_Mutation_p.A44V|COA5_ENST00000409997.1_5'Flank|COA5_ENST00000483527.1_5'Flank|UNC50_ENST00000409347.1_Missense_Mutation_p.A44V|COA5_ENST00000328709.3_5'Flank	NM_014044.5	NP_054763.2	Q53HI1	UNC50_HUMAN	unc-50 homolog (C. elegans)	27					cell surface receptor signaling pathway (GO:0007166)|protein transport (GO:0015031)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)|nuclear inner membrane (GO:0005637)	RNA binding (GO:0003723)			breast(1)|kidney(1)|large_intestine(2)|liver(1)|lung(4)|skin(1)	10						AGACACACAGCCGGAGCGAAA	0.483																																																	0													172.0	172.0	172.0					2																	99226302		2203	4300	6503	SO:0001583	missense	25972				CCDS2035.1	2q12.2	2008-02-05			ENSG00000115446	ENSG00000115446			16046	protein-coding gene	gene with protein product						10980252	Standard	NM_014044		Approved	URP, UNCL, GMH1	uc002szc.4	Q53HI1	OTTHUMG00000130562	ENST00000357765.2:c.80C>T	2.37:g.99226302C>T	ENSP00000350409:p.Ala27Val	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DVH4|Q53S98|Q53TD6|Q5U5U2|Q6X7B9|Q9UQF4|Q9Y4S6	Missense_Mutation	SNP	pfam_UNC-50	p.A44V	ENST00000357765.2	37	c.131	CCDS2035.1	2	.	.	.	.	.	.	.	.	.	.	C	36	5.631092	0.96682	.	.	ENSG00000115446	ENST00000357765;ENST00000409975;ENST00000409347	.	.	.	5.36	5.36	0.76844	.	0.000000	0.85682	D	0.000000	T	0.79828	0.4513	M	0.76838	2.35	0.80722	D	1	D	0.89917	1.0	D	0.83275	0.996	T	0.79147	-0.1923	9	0.39692	T	0.17	-15.1323	18.0646	0.89387	0.0:1.0:0.0:0.0	.	27	Q53HI1	UNC50_HUMAN	V	27;44;44	.	ENSP00000350409:A27V	A	+	2	0	UNC50	98592734	1.000000	0.71417	0.996000	0.52242	0.984000	0.73092	7.344000	0.79328	2.505000	0.84491	0.591000	0.81541	GCC	UNC50	-	NULL		0.483	UNC50-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC50	HGNC	protein_coding	OTTHUMT00000252987.1	C	NM_014044		99226302	+1	no_errors	ENST00000409347	ensembl	human	known	70_37	missense	SNP	1.000	T
TTN	7273	genome.wustl.edu	37	2	179498554	179498554	+	Silent	SNP	C	C	T	rs368155350		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:179498554C>T	ENST00000591111.1	-	181	37973	c.37749G>A	c.(37747-37749)ctG>ctA	p.L12583L	TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000431752.1_RNA|TTN_ENST00000589042.1_Silent_p.L14224L|TTN-AS1_ENST00000418062.1_RNA|TTN-AS1_ENST00000589830.1_RNA|TTN_ENST00000460472.2_Silent_p.L5159L|TTN_ENST00000342992.6_Silent_p.L11656L|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000589487.1_RNA|TTN_ENST00000359218.5_Silent_p.L5284L|TTN_ENST00000342175.6_Silent_p.L5351L|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000590807.1_RNA			Q8WZ42	TITIN_HUMAN	titin	12583	Ig-like 83.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			CTAAGACCTTCAGCTGTGCTG	0.388																																																	0													183.0	175.0	178.0					2																	179498554		1876	4099	5975	SO:0001819	synonymous_variant	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.37749G>A	2.37:g.179498554C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Silent	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.L11656	ENST00000591111.1	37	c.34968		2																																																																																			TTN	-	superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,pfscan_Ig-like		0.388	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179498554	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	silent	SNP	0.029	T
UNC5A	90249	genome.wustl.edu	37	5	176292672	176292672	+	Intron	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:176292672C>T	ENST00000329542.4	+	3	566				UNC5A_ENST00000261961.3_Missense_Mutation_p.T41M	NM_133369.2	NP_588610.2	Q6ZN44	UNC5A_HUMAN	unc-5 homolog A (C. elegans)						anterior/posterior axon guidance (GO:0033564)|apoptotic process (GO:0006915)|axon guidance (GO:0007411)|positive regulation of apoptotic process (GO:0043065)|regulation of apoptotic process (GO:0042981)|signal transduction (GO:0007165)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|kidney(3)|large_intestine(2)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	34	all_cancers(89;0.000119)|Renal(175;0.000269)|Lung NSC(126;0.00696)|all_lung(126;0.0115)	Medulloblastoma(196;0.00498)|all_neural(177;0.0138)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			AGTGGCGCCACGCCGCCAAAG	0.547																																																	0																																										SO:0001627	intron_variant	90249			AB075856	CCDS34299.1	5q35.3	2013-01-11	2001-11-28		ENSG00000113763	ENSG00000113763		"""Immunoglobulin superfamily / I-set domain containing"""	12567	protein-coding gene	gene with protein product		607869	"""unc5 (C.elegans homolog) a"""				Standard	XM_006714927		Approved	KIAA1976, UNC5H1	uc003mey.3	Q6ZN44	OTTHUMG00000163225	ENST00000329542.4:c.293-2459C>T	5.37:g.176292672C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RXE6|Q8TF26|Q96GP4	Missense_Mutation	SNP	pfam_ZU5,pfam_Death,pfam_Ig_I-set,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.T41M	ENST00000329542.4	37	c.122	CCDS34299.1	5	.	.	.	.	.	.	.	.	.	.	c	9.311	1.055612	0.19907	.	.	ENSG00000113763	ENST00000261961	T	0.38722	1.12	3.06	-4.33	0.03677	.	.	.	.	.	T	0.24699	0.0599	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.19647	-1.0299	8	0.46703	T	0.11	.	4.903	0.13784	0.0:0.3629:0.1635:0.4736	.	41	Q6ZN44-3	.	M	41	ENSP00000261961:T41M	ENSP00000261961:T41M	T	+	2	0	UNC5A	176225278	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.650000	0.05378	-0.932000	0.03742	-1.300000	0.01332	ACG	UNC5A	-	NULL		0.547	UNC5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UNC5A	HGNC	protein_coding	OTTHUMT00000372166.1	C	XM_030300		176292672	+1	no_errors	ENST00000261961	ensembl	human	known	70_37	missense	SNP	0.000	T
USP34	9736	genome.wustl.edu	37	2	61510366	61510366	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:61510366G>T	ENST00000398571.2	-	37	4988	c.4912C>A	c.(4912-4914)Cat>Aat	p.H1638N		NM_014709.3	NP_055524.3	Q70CQ2	UBP34_HUMAN	ubiquitin specific peptidase 34	1638					positive regulation of canonical Wnt signaling pathway (GO:0090263)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|ubiquitin-dependent protein catabolic process (GO:0006511)|Wnt signaling pathway (GO:0016055)		cysteine-type endopeptidase activity (GO:0004197)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)			autonomic_ganglia(1)|breast(14)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(24)|lung(52)|ovary(8)|prostate(10)|skin(6)|urinary_tract(2)	138			Epithelial(17;0.229)			GAACAGCAATGAGCCCAACTC	0.338																																																	0													81.0	75.0	77.0					2																	61510366		1851	4101	5952	SO:0001583	missense	9736			AB011142	CCDS42686.1	2p16.1-p15	2005-08-08	2005-08-08		ENSG00000115464	ENSG00000115464		"""Ubiquitin-specific peptidases"""	20066	protein-coding gene	gene with protein product		615295	"""ubiquitin specific protease 34"""			12838346	Standard	NM_014709		Approved	KIAA0570, KIAA0729	uc002sbe.3	Q70CQ2	OTTHUMG00000152265	ENST00000398571.2:c.4912C>A	2.37:g.61510366G>T	ENSP00000381577:p.His1638Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MWD0|B3KWU9|O60316|O94834|Q3B777|Q6P6C9|Q7L8P6|Q8N3T9|Q8TBW2|Q9UGA1	Missense_Mutation	SNP	pfam_Peptidase_C19,superfamily_ARM-type_fold,pfscan_Peptidase_C19	p.H1638N	ENST00000398571.2	37	c.4912	CCDS42686.1	2	.	.	.	.	.	.	.	.	.	.	G	18.97	3.735809	0.69189	.	.	ENSG00000115464	ENST00000263989;ENST00000398569;ENST00000398571	T	0.04083	3.71	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	T	0.15825	0.0381	L	0.54323	1.7	0.51482	D	0.999928	D	0.54601	0.967	P	0.58210	0.835	T	0.00159	-1.1974	10	0.39692	T	0.17	.	19.9059	0.97007	0.0:0.0:1.0:0.0	.	1638	Q70CQ2	UBP34_HUMAN	N	1486;1486;1638	ENSP00000381577:H1638N	ENSP00000263989:H1486N	H	-	1	0	USP34	61363870	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.863000	0.87023	2.693000	0.91896	0.655000	0.94253	CAT	USP34	-	NULL		0.338	USP34-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USP34	HGNC	protein_coding	OTTHUMT00000325650.4	G			61510366	-1	no_errors	ENST00000398571	ensembl	human	known	70_37	missense	SNP	1.000	T
VPS33A	65082	genome.wustl.edu	37	12	122745896	122745896	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:122745896C>T	ENST00000267199.4	-	4	507	c.395G>A	c.(394-396)gGa>gAa	p.G132E	RP11-512M8.5_ENST00000535844.1_Missense_Mutation_p.G132E|VPS33A_ENST00000542310.1_5'UTR|VPS33A_ENST00000451053.2_Missense_Mutation_p.G132E	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	132					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		AATAAAGGATCCCAAGACACC	0.473																																																	0													114.0	101.0	106.0					12																	122745896		2203	4300	6503	SO:0001583	missense	65082			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.395G>A	12.37:g.122745896C>T	ENSP00000267199:p.Gly132Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q547V4|Q9H5Q0	Missense_Mutation	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.G132E	ENST00000267199.4	37	c.395	CCDS9231.1	12	.	.	.	.	.	.	.	.	.	.	C	25.3	4.618912	0.87460	.	.	ENSG00000139719	ENST00000267199;ENST00000451053	T;T	0.28666	1.6;1.6	5.11	5.11	0.69529	.	0.237215	0.42682	D	0.000663	T	0.56381	0.1981	M	0.74258	2.255	0.58432	D	0.999999	D;D	0.63880	0.993;0.992	D;D	0.65140	0.932;0.921	T	0.60662	-0.7219	10	0.72032	D	0.01	-22.205	18.8821	0.92360	0.0:1.0:0.0:0.0	.	132;132	F5H6Y0;Q96AX1	.;VP33A_HUMAN	E	132	ENSP00000267199:G132E;ENSP00000442951:G132E	ENSP00000446319:G132E	G	-	2	0	VPS33A	121311849	0.996000	0.38824	0.999000	0.59377	0.956000	0.61745	2.985000	0.49362	2.544000	0.85801	0.561000	0.74099	GGA	VPS33A	-	pfam_Sec1-like,superfamily_Sec1-like		0.473	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33A	HGNC	protein_coding	OTTHUMT00000401607.2	C			122745896	-1	no_errors	ENST00000267199	ensembl	human	known	70_37	missense	SNP	1.000	T
VPS33A	65082	genome.wustl.edu	37	12	122745916	122745916	+	Silent	SNP	C	C	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr12:122745916C>T	ENST00000267199.4	-	4	487	c.375G>A	c.(373-375)ttG>ttA	p.L125L	RP11-512M8.5_ENST00000535844.1_Silent_p.L125L|VPS33A_ENST00000542310.1_5'UTR|VPS33A_ENST00000451053.2_Silent_p.L125L	NM_022916.4	NP_075067.2	Q96AX1	VP33A_HUMAN	vacuolar protein sorting 33 homolog A (S. cerevisiae)	125					lysosome localization (GO:0032418)|melanosome localization (GO:0032400)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of developmental pigmentation (GO:0048070)|vesicle docking involved in exocytosis (GO:0006904)|vesicle-mediated transport (GO:0016192)	early endosome (GO:0005769)|late endosome (GO:0005770)|lysosomal membrane (GO:0005765)|perinuclear region of cytoplasm (GO:0048471)				NS(2)|breast(1)|central_nervous_system(1)|endometrium(4)|large_intestine(4)|lung(13)|ovary(1)|skin(2)	28	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.000336)|Epithelial(86;0.000606)|BRCA - Breast invasive adenocarcinoma(302;0.23)		CCAGATCCTTCAACCGCTGTT	0.478																																																	0													105.0	93.0	97.0					12																	122745916		2203	4300	6503	SO:0001819	synonymous_variant	65082			AK026048	CCDS9231.1	12q24.31	2008-06-23	2006-04-04		ENSG00000139719	ENSG00000139719			18179	protein-coding gene	gene with protein product		610034	"""vacuolar protein sorting 33A (yeast)"""			11250079	Standard	NM_022916		Approved		uc001ucd.3	Q96AX1	OTTHUMG00000168920	ENST00000267199.4:c.375G>A	12.37:g.122745916C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q547V4|Q9H5Q0	Silent	SNP	pfam_Sec1-like,superfamily_Sec1-like	p.L125	ENST00000267199.4	37	c.375	CCDS9231.1	12																																																																																			VPS33A	-	pfam_Sec1-like,superfamily_Sec1-like		0.478	VPS33A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS33A	HGNC	protein_coding	OTTHUMT00000401607.2	C			122745916	-1	no_errors	ENST00000267199	ensembl	human	known	70_37	silent	SNP	1.000	T
VSTM2A	222008	genome.wustl.edu	37	7	54612464	54612464	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr7:54612464G>A	ENST00000407838.3	+	2	635	c.229G>A	c.(229-231)Gag>Aag	p.E77K	VSTM2A_ENST00000402026.2_Missense_Mutation_p.E76K|VSTM2A_ENST00000404951.1_Missense_Mutation_p.E77K|VSTM2A_ENST00000302287.3_Missense_Mutation_p.E77K|VSTM2A_ENST00000402613.3_Missense_Mutation_p.E77K	NM_182546.2	NP_872352.2	Q8TAG5	VTM2A_HUMAN	V-set and transmembrane domain containing 2A	77	Ig-like V-type.					extracellular region (GO:0005576)				endometrium(1)|large_intestine(2)|lung(12)|prostate(1)	16			STAD - Stomach adenocarcinoma(5;0.0525)			TCCCGGGGCCGAGGGGGCCGG	0.741																																																	0													13.0	15.0	14.0					7																	54612464		2191	4294	6485	SO:0001583	missense	222008			BC028404	CCDS5512.2, CCDS75604.1	7p11.2	2013-01-11	2007-08-10	2007-08-10	ENSG00000170419	ENSG00000170419		"""Immunoglobulin superfamily / V-set domain containing"""	28499	protein-coding gene	gene with protein product			"""V-set and transmembrane domain containing 2"""	VSTM2		12477932	Standard	XM_006715663		Approved	MGC33530	uc010kzf.3	Q8TAG5	OTTHUMG00000129271	ENST00000407838.3:c.229G>A	7.37:g.54612464G>A	ENSP00000384967:p.Glu77Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D2E9|B5MC94	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.E76K	ENST00000407838.3	37	c.226	CCDS5512.2	7	.	.	.	.	.	.	.	.	.	.	G	11.25	1.583563	0.28268	.	.	ENSG00000170419	ENST00000302287;ENST00000407838;ENST00000404951;ENST00000402026;ENST00000402613	T;T;T;T;T	0.28454	1.61;1.61;1.61;1.61;1.61	5.19	5.19	0.71726	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.245446	0.40064	N	0.001194	T	0.24774	0.0601	L	0.29908	0.895	0.43032	D	0.994609	P;P;D	0.59357	0.729;0.907;0.985	B;B;P	0.44860	0.195;0.246;0.462	T	0.02498	-1.1150	10	0.15952	T	0.53	-5.8211	14.2057	0.65732	0.0:0.0:1.0:0.0	.	77;77;77	Q8TAG5;Q8TAG5-2;B5MCX6	VTM2A_HUMAN;.;.	K	77;77;77;76;77	ENSP00000303108:E77K;ENSP00000384967:E77K;ENSP00000384701:E77K;ENSP00000385933:E76K;ENSP00000384103:E77K	ENSP00000303108:E77K	E	+	1	0	VSTM2A	54579958	1.000000	0.71417	0.129000	0.21949	0.032000	0.12392	8.064000	0.89483	2.418000	0.82041	0.542000	0.68232	GAG	VSTM2A	-	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like		0.741	VSTM2A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VSTM2A	HGNC	protein_coding	OTTHUMT00000318694.1	G	NM_182546		54612464	+1	no_errors	ENST00000402026	ensembl	human	known	70_37	missense	SNP	0.994	A
VWA7	80737	genome.wustl.edu	37	6	31733689	31733689	+	Missense_Mutation	SNP	G	G	A	rs28399998	byFrequency	TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr6:31733689G>A	ENST00000375688.4	-	16	2670	c.2470C>T	c.(2470-2472)Cgg>Tgg	p.R824W	VWA7_ENST00000467576.1_5'Flank|SAPCD1-AS1_ENST00000419679.1_RNA|VWA7_ENST00000375686.3_Missense_Mutation_p.R824W			Q9Y334	VWA7_HUMAN	von Willebrand factor A domain containing 7	824						extracellular region (GO:0005576)											ACCAGGAGCCGGAGGAAAGCA	0.612													G|||	2	0.000399361	0.0	0.0	5008	,	,		17156	0.001		0.001	False		,,,				2504	0.0																0													105.0	119.0	114.0					6																	31733689		1511	2708	4219	SO:0001583	missense	80737				CCDS4721.2	6p21	2011-12-13	2011-12-13	2011-12-13	ENSG00000204396	ENSG00000204396			13939	protein-coding gene	gene with protein product		609693	"""chromosome 6 open reading frame 27"""	C6orf27			Standard	NM_025258		Approved	G7c, NG37	uc011dog.2	Q9Y334	OTTHUMG00000031132	ENST00000375688.4:c.2470C>T	6.37:g.31733689G>A	ENSP00000364840:p.Arg824Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A2BEX8|A6NHR6|B0V041|Q5SSR5|Q96QC8|Q9UMP9	Missense_Mutation	SNP	NULL	p.R824W	ENST00000375688.4	37	c.2470	CCDS4721.2	6	.	.	.	.	.	.	.	.	.	.	G	13.96	2.392675	0.42410	.	.	ENSG00000204396	ENST00000375688;ENST00000375686	T;T	0.17691	2.49;2.26	4.75	2.9	0.33743	.	0.558194	0.14873	N	0.293460	T	0.04998	0.0134	L	0.34521	1.04	0.80722	D	1	B	0.15930	0.015	B	0.16722	0.016	T	0.11275	-1.0594	10	0.54805	T	0.06	-10.6306	5.5699	0.17190	0.1017:0.0:0.6829:0.2154	rs28399998;rs28399998	824	Q9Y334	G7C_HUMAN	W	824	ENSP00000364840:R824W;ENSP00000364838:R824W	ENSP00000364838:R824W	R	-	1	2	C6orf27	31841668	0.994000	0.37717	1.000000	0.80357	0.908000	0.53690	0.749000	0.26320	0.670000	0.31165	0.563000	0.77884	CGG	VWA7	-	NULL		0.612	VWA7-001	NOVEL	not_organism_supported|basic|appris_principal|CCDS	protein_coding	VWA7	HGNC	protein_coding	OTTHUMT00000076233.2	G	NM_025258		31733689	-1	no_errors	ENST00000375686	ensembl	human	known	70_37	missense	SNP	1.000	A
WDR36	134430	genome.wustl.edu	37	5	110428130	110428130	+	Silent	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr5:110428130G>A	ENST00000513710.2	+	1	148	c.144G>A	c.(142-144)ctG>ctA	p.L48L	WDR36_ENST00000505303.1_5'UTR|WDR36_ENST00000506538.2_Silent_p.L48L|CTC-551A13.2_ENST00000507269.3_RNA			Q8NI36	WDR36_HUMAN	WD repeat domain 36	48					regulation of axon extension (GO:0030516)|response to stimulus (GO:0050896)|retina homeostasis (GO:0001895)|rRNA processing (GO:0006364)|visual perception (GO:0007601)	nucleus (GO:0005634)|small-subunit processome (GO:0032040)	poly(A) RNA binding (GO:0044822)			cervix(1)|endometrium(9)|kidney(4)|large_intestine(11)|lung(13)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	45		all_cancers(142;2.72e-05)|all_epithelial(76;4.4e-07)|Prostate(80;0.00955)|Lung NSC(167;0.0418)|Ovarian(225;0.0443)|Colorectal(57;0.0465)|all_lung(232;0.0508)|Breast(839;0.244)		OV - Ovarian serous cystadenocarcinoma(64;1.39e-08)|Epithelial(69;1.82e-07)|all cancers(49;2.04e-05)|COAD - Colon adenocarcinoma(37;0.111)		GACCAGAGCTGAGAGGAGCTG	0.622																																																	0													49.0	57.0	54.0					5																	110428130		2202	4300	6502	SO:0001819	synonymous_variant	134430			AF385437	CCDS4102.1	5q22.2	2013-01-09			ENSG00000134987	ENSG00000134987		"""WD repeat domain containing"""	30696	protein-coding gene	gene with protein product		609669	"""glaucoma 1, open angle, G"""	GLC1G		15590835, 15677485	Standard	NM_139281		Approved	TA-WDRP, UTP21	uc003kpd.3	Q8NI36	OTTHUMG00000128790	ENST00000513710.2:c.144G>A	5.37:g.110428130G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUS4|Q68E02|Q8N1Q2	Silent	SNP	pfam_SSU_processome_Utp21,pfam_WD40_repeat,superfamily_Quinonprotein_ADH-like,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L48	ENST00000513710.2	37	c.144	CCDS4102.1	5																																																																																			WDR36	-	NULL		0.622	WDR36-008	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	WDR36	HGNC	protein_coding	OTTHUMT00000373504.3	G	NM_139281		110428130	+1	no_errors	ENST00000506538	ensembl	human	known	70_37	silent	SNP	0.000	A
XPO1	7514	genome.wustl.edu	37	2	61726050	61726051	+	Splice_Site	INS	-	-	A	rs372688892		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:61726050_61726051insA	ENST00000401558.2	-	8	1318		c.e8-2		XPO1_ENST00000404992.2_Splice_Site|XPO1_ENST00000406957.1_Splice_Site	NM_003400.3	NP_003391.1	O14980	XPO1_HUMAN	exportin 1						gene expression (GO:0010467)|intracellular transport of virus (GO:0075733)|mitotic cell cycle (GO:0000278)|mRNA metabolic process (GO:0016071)|mRNA transport (GO:0051028)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|protein export from nucleus (GO:0006611)|protein localization to nucleus (GO:0034504)|regulation of centrosome duplication (GO:0010824)|regulation of protein catabolic process (GO:0042176)|regulation of protein export from nucleus (GO:0046825)|response to drug (GO:0042493)|ribosomal large subunit export from nucleus (GO:0000055)|ribosomal small subunit export from nucleus (GO:0000056)|RNA metabolic process (GO:0016070)|transforming growth factor beta receptor signaling pathway (GO:0007179)|viral life cycle (GO:0019058)|viral process (GO:0016032)	annulate lamellae (GO:0005642)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|kinetochore (GO:0000776)|membrane (GO:0016020)|nuclear envelope (GO:0005635)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleocytoplasmic transporter activity (GO:0005487)|protein transporter activity (GO:0008565)|RNA binding (GO:0003723)|transporter activity (GO:0005215)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(5)|lung(5)|ovary(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	39			LUSC - Lung squamous cell carcinoma(7;5.71e-05)|Epithelial(17;0.0662)|all cancers(80;0.226)			TTGCACATGCTAAAAAAAAAAA	0.262			Mis		CLL																																		-'	Dom	yes		2	2p15	7514	"""exportin 1 (CRM1 homolog, yeast)"""		L	0																																										SO:0001630	splice_region_variant	7514			Y08614	CCDS33205.1	2p15	2014-02-19	2014-02-19		ENSG00000082898	ENSG00000082898		"""Exportins"""	12825	protein-coding gene	gene with protein product	"""chromosome region maintenance 1 homolog (yeast)"""	602559	"""exportin 1 (CRM1, yeast, homolog)"", ""exportin 1 (CRM1 homolog, yeast)"""			9205132, 9368044	Standard	XM_005264544		Approved	CRM1, emb	uc002sbj.3	O14980	OTTHUMG00000152316	ENST00000401558.2:c.591-2->T	2.37:g.61726061_61726061dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL14|A8K1K5|D6W5E2|Q63HP8|Q68CP3|Q99433	Splice_Site	INS	-	e7-2	ENST00000401558.2	37	c.591-3_591-2	CCDS33205.1	2																																																																																			XPO1	-	-		0.262	XPO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO1	HGNC	protein_coding	OTTHUMT00000325872.3	-	NM_003400	Intron	61726051	-1	no_errors	ENST00000401558	ensembl	human	known	70_37	splice_site_ins	INS	1.000:0.996	A
ZFP36L2	678	genome.wustl.edu	37	2	43452542	43452542	+	Missense_Mutation	SNP	A	A	T			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr2:43452542A>T	ENST00000282388.3	-	2	694	c.401T>A	c.(400-402)cTc>cAc	p.L134H	THADA_ENST00000330266.7_Intron	NM_006887.4	NP_008818.3	P47974	TISD_HUMAN	ZFP36 ring finger protein-like 2	134					cell proliferation (GO:0008283)|definitive hemopoiesis (GO:0060216)|hemopoiesis (GO:0030097)|mRNA catabolic process (GO:0006402)|negative regulation of stem cell differentiation (GO:2000737)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|positive regulation of nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:1900153)|regulation of mRNA stability (GO:0043488)|regulation of transcription, DNA-templated (GO:0006355)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|T cell differentiation in thymus (GO:0033077)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	AU-rich element binding (GO:0017091)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|mRNA 3'-UTR AU-rich region binding (GO:0035925)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(3)|large_intestine(2)|lung(6)|upper_aerodigestive_tract(1)	15		Acute lymphoblastic leukemia(82;0.00323)|all_hematologic(82;0.00824)				CAGGTGCAGGAGGTGCTGGCT	0.662																																																	0													24.0	28.0	27.0					2																	43452542		2203	4300	6503	SO:0001583	missense	678			X78992	CCDS1811.1	2p22.3-p21	2012-11-27	2012-11-27	2001-11-23	ENSG00000152518	ENSG00000152518		"""RING-type (C3HC4) zinc fingers"""	1108	protein-coding gene	gene with protein product		612053	"""zinc finger protein 36, C3H type-like 1"", ""zinc finger protein 36, C3H type-like 2"""	BRF2		7835719, 8545129, 14981510, 17172869	Standard	NM_006887		Approved	ERF2, RNF162C, TIS11D	uc002rsv.4	P47974	OTTHUMG00000128642	ENST00000282388.3:c.401T>A	2.37:g.43452542A>T	ENSP00000282388:p.Leu134His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TB4|Q9BSJ3	Missense_Mutation	SNP	pfam_Tis11B_N,pfam_Znf_CCCH,smart_Znf_CCCH	p.L134H	ENST00000282388.3	37	c.401	CCDS1811.1	2	.	.	.	.	.	.	.	.	.	.	A	13.48	2.249952	0.39797	.	.	ENSG00000152518	ENST00000282388	T	0.48201	0.82	4.7	4.7	0.59300	Tis11B-like protein, N-terminal (1);	0.000000	0.64402	D	0.000014	T	0.60983	0.2311	L	0.55481	1.735	0.80722	D	1	D	0.76494	0.999	D	0.65684	0.937	T	0.62863	-0.6764	10	0.52906	T	0.07	-20.2061	13.1679	0.59581	1.0:0.0:0.0:0.0	.	134	P47974	TISD_HUMAN	H	134	ENSP00000282388:L134H	ENSP00000282388:L134H	L	-	2	0	ZFP36L2	43306046	1.000000	0.71417	1.000000	0.80357	0.298000	0.27526	4.245000	0.58734	1.754000	0.51921	0.459000	0.35465	CTC	ZFP36L2	-	pfam_Tis11B_N		0.662	ZFP36L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFP36L2	HGNC	protein_coding	OTTHUMT00000250513.2	A	NM_006887		43452542	-1	no_errors	ENST00000282388	ensembl	human	known	70_37	missense	SNP	1.000	T
ZMAT1	84460	genome.wustl.edu	37	X	101139637	101139637	+	Missense_Mutation	SNP	T	T	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chrX:101139637T>A	ENST00000372782.3	-	7	809	c.762A>T	c.(760-762)agA>agT	p.R254S	ZMAT1_ENST00000540921.1_Missense_Mutation_p.R254S|ZMAT1_ENST00000494068.1_5'UTR|ZMAT1_ENST00000458570.1_Missense_Mutation_p.R83S	NM_001011657.3	NP_001011657	Q5H9K5	ZMAT1_HUMAN	zinc finger, matrin-type 1	254						nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(2)|large_intestine(6)|lung(6)|ovary(1)|prostate(1)|skin(1)|urinary_tract(2)	22						CTTCTCTGTATCTACGGGTTT	0.428																																																	0													185.0	165.0	172.0					X																	101139637		2203	4300	6503	SO:0001583	missense	84460			Z69304	CCDS35348.1	Xq21	2012-10-05	2010-09-15		ENSG00000166432	ENSG00000166432		"""Zinc fingers, matrin-type"""	29377	protein-coding gene	gene with protein product							Standard	NM_001011657		Approved	KIAA1789	uc011mrl.2	Q5H9K5	OTTHUMG00000022044	ENST00000372782.3:c.762A>T	X.37:g.101139637T>A	ENSP00000361868:p.Arg254Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NDS3|Q96JN6	Missense_Mutation	SNP	superfamily_Asn/Gln_tRNA_amidoTrfrase-rel,smart_Znf_U1,smart_Znf_C2H2-like	p.R254S	ENST00000372782.3	37	c.762	CCDS35348.1	X	.	.	.	.	.	.	.	.	.	.	T	3.988	-0.004994	0.07773	.	.	ENSG00000166432	ENST00000372782;ENST00000540921;ENST00000458570	T;T;T	0.21543	2.58;2.58;2.0	4.14	-1.85	0.07784	.	0.772531	0.11127	N	0.596736	T	0.10766	0.0263	N	0.24115	0.695	0.09310	N	1	B	0.25105	0.118	B	0.17433	0.018	T	0.23048	-1.0199	10	0.45353	T	0.12	-0.2628	3.8513	0.08955	0.2967:0.1954:0.0:0.5079	.	254	Q5H9K5	ZMAT1_HUMAN	S	254;254;83	ENSP00000361868:R254S;ENSP00000437529:R254S;ENSP00000413044:R83S	ENSP00000361868:R254S	R	-	3	2	ZMAT1	101026293	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-1.880000	0.01627	-0.597000	0.05813	0.437000	0.28790	AGA	ZMAT1	-	NULL		0.428	ZMAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZMAT1	HGNC	protein_coding	OTTHUMT00000057598.1	T			101139637	-1	no_errors	ENST00000372782	ensembl	human	known	70_37	missense	SNP	0.000	A
ZNF207	7756	genome.wustl.edu	37	17	30700349	30700349	+	IGR	SNP	T	T	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr17:30700349T>A	ENST00000321233.6	+	0	2283				ZNF207_ENST00000584416.1_3'UTR|ZNF207_ENST00000394670.4_3'UTR|ZNF207_ENST00000577908.1_Intron	NM_003457.3	NP_003448.1	O43670	ZN207_HUMAN	zinc finger protein 207						attachment of spindle microtubules to kinetochore (GO:0008608)|mitotic sister chromatid segregation (GO:0000070)|mitotic spindle assembly checkpoint (GO:0007094)|protein stabilization (GO:0050821)|regulation of chromosome segregation (GO:0051983)|regulation of transcription, DNA-templated (GO:0006355)	kinetochore (GO:0000776)|microtubule (GO:0005874)|nucleus (GO:0005634)	DNA binding (GO:0003677)|heparin binding (GO:0008201)|microtubule binding (GO:0008017)|poly(A) RNA binding (GO:0044822)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|endometrium(2)|kidney(2)|lung(3)|urinary_tract(2)	10		Breast(31;0.116)|Ovarian(249;0.182)	BRCA - Breast invasive adenocarcinoma(9;0.239)			aaaaaaaaaattttaatGCAT	0.343																																																	0																																										SO:0001628	intergenic_variant	7756			AF046001	CCDS11271.1, CCDS32614.1, CCDS42294.1	17q11.2	2008-07-10			ENSG00000010244	ENSG00000010244		"""Zinc fingers, C2H2-type"""	12998	protein-coding gene	gene with protein product		603428				9799612	Standard	NM_001098507		Approved		uc002hhj.4	O43670	OTTHUMG00000132810		17.37:g.30700349T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6Y6|E1P660|E1P661|E1P662|Q53XS9|Q96HW5|Q9BUQ7	RNA	SNP	-	NULL	ENST00000321233.6	37	NULL	CCDS11271.1	17																																																																																			ZNF207	-	-		0.343	ZNF207-003	KNOWN	basic|CCDS	protein_coding	ZNF207	HGNC	protein_coding	OTTHUMT00000256251.2	T			30700349	+1	no_errors	ENST00000584416	ensembl	human	putative	70_37	rna	SNP	0.000	A
ZNF621	285268	genome.wustl.edu	37	3	40570895	40570895	+	Missense_Mutation	SNP	G	G	A	rs374160688		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr3:40570895G>A	ENST00000339296.5	+	3	562	c.110G>A	c.(109-111)gGg>gAg	p.G37E	ZNF621_ENST00000431278.1_Intron|ZNF621_ENST00000490457.1_3'UTR|ZNF621_ENST00000403205.2_Missense_Mutation_p.G37E|ZNF621_ENST00000310898.1_Missense_Mutation_p.G37E	NM_198484.3	NP_940886.1	Q6ZSS3	ZN621_HUMAN	zinc finger protein 621	37	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(1)|kidney(2)|large_intestine(6)|lung(8)|ovary(1)|prostate(1)|upper_aerodigestive_tract(2)	21				KIRC - Kidney renal clear cell carcinoma(284;0.0515)|Kidney(284;0.0648)		GCCCTGTACGGGGAGGTGATG	0.522																																																	0								G	GLU/GLY,GLU/GLY	0,4406		0,0,2203	174.0	169.0	171.0		110,110	0.7	1.0	3		171	1,8599	1.2+/-3.3	0,1,4299	no	missense,missense	ZNF621	NM_198484.3,NM_001098414.1	98,98	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign,benign	37/440,37/440	40570895	1,13005	2203	4300	6503	SO:0001583	missense	285268			AK127181	CCDS2693.1, CCDS74920.1	3p21.33	2013-01-08			ENSG00000172888	ENSG00000172888		"""Zinc fingers, C2H2-type"", ""-"""	24787	protein-coding gene	gene with protein product							Standard	XM_005265079		Approved	FLJ45246	uc003ckm.2	Q6ZSS3	OTTHUMG00000131389	ENST00000339296.5:c.110G>A	3.37:g.40570895G>A	ENSP00000340841:p.Gly37Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14DC7|Q8TE91	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.G37E	ENST00000339296.5	37	c.110	CCDS2693.1	3	.	.	.	.	.	.	.	.	.	.	g	11.57	1.679207	0.29783	0.0	1.16E-4	ENSG00000172888	ENST00000403205;ENST00000310898;ENST00000339296;ENST00000453351	T;T;T;T	0.01613	4.73;4.73;4.73;4.73	3.48	0.722	0.18225	Krueppel-associated box (4);	0.997432	0.08112	N	0.996098	T	0.01489	0.0048	N	0.12182	0.205	0.21386	N	0.999704	B	0.16396	0.017	B	0.22880	0.042	T	0.48736	-0.9009	10	0.72032	D	0.01	.	6.9237	0.24403	0.3303:0.0:0.6697:0.0	.	37	Q6ZSS3	ZN621_HUMAN	E	37	ENSP00000386051:G37E;ENSP00000312144:G37E;ENSP00000340841:G37E;ENSP00000408779:G37E	ENSP00000312144:G37E	G	+	2	0	ZNF621	40545899	0.995000	0.38212	0.956000	0.39512	0.756000	0.42949	0.846000	0.27682	0.144000	0.18951	-0.251000	0.11542	GGG	ZNF621	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.522	ZNF621-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF621	HGNC	protein_coding	OTTHUMT00000254178.2	G	NM_198484		40570895	+1	no_errors	ENST00000339296	ensembl	human	known	70_37	missense	SNP	0.979	A
ZNF829	374899	genome.wustl.edu	37	19	37382909	37382909	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:37382909G>A	ENST00000391711.3	-	6	1148	c.784C>T	c.(784-786)Cac>Tac	p.H262Y	ZNF829_ENST00000520965.1_Missense_Mutation_p.H343Y|ZNF345_ENST00000432005.2_Intron|ZNF345_ENST00000526123.1_Intron	NM_001037232.3	NP_001032309.2	Q3KNS6	ZN829_HUMAN	zinc finger protein 829	262					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			endometrium(2)|kidney(1)|large_intestine(11)|lung(8)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	29	Esophageal squamous(110;0.183)		COAD - Colon adenocarcinoma(19;0.114)|Colorectal(19;0.177)			TCACCAGTGTGAATTCTCTGA	0.368																																																	0													45.0	48.0	47.0					19																	37382909		2200	4300	6500	SO:0001583	missense	374899			BC107131	CCDS42557.1, CCDS59380.1	19q13.12	2013-01-08			ENSG00000185869	ENSG00000185869		"""Zinc fingers, C2H2-type"", ""-"""	34032	protein-coding gene	gene with protein product							Standard	NM_001037232		Approved	DKFZp779O175	uc021utr.1	Q3KNS6	OTTHUMG00000048161	ENST00000391711.3:c.784C>T	19.37:g.37382909G>A	ENSP00000429266:p.His262Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KNS7|Q6ZNN0|Q7Z657	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.H343Y	ENST00000391711.3	37	c.1027	CCDS42557.1	19	.	.	.	.	.	.	.	.	.	.	G	19.52	3.843769	0.71488	.	.	ENSG00000185869	ENST00000520965;ENST00000391711	T	0.67523	-0.27	3.41	3.41	0.39046	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	D	0.85906	0.5806	H	0.95402	3.665	0.37171	D	0.903033	D	0.76494	0.999	D	0.70016	0.967	D	0.91930	0.5554	9	0.87932	D	0	.	14.7529	0.69540	0.0:0.0:1.0:0.0	.	262	Q3KNS6	ZN829_HUMAN	Y	262	ENSP00000429266:H262Y	ENSP00000429266:H262Y	H	-	1	0	ZNF829	42074749	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	6.829000	0.75314	2.199000	0.70637	0.650000	0.86243	CAC	ZNF829	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.368	ZNF829-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF829	HGNC	protein_coding	OTTHUMT00000109575.3	G	NM_001037232		37382909	-1	no_errors	ENST00000520965	ensembl	human	known	70_37	missense	SNP	1.000	A
ZNFX1	57169	genome.wustl.edu	37	20	47874075	47874075	+	Missense_Mutation	SNP	C	C	T	rs139657531		TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr20:47874075C>T	ENST00000396105.1	-	8	2789	c.2543G>A	c.(2542-2544)cGg>cAg	p.R848Q	ZNFX1_ENST00000371754.4_Missense_Mutation_p.R848Q|ZNFX1_ENST00000371752.1_Missense_Mutation_p.R848Q	NM_021035.2	NP_066363.1	Q9P2E3	ZNFX1_HUMAN	zinc finger, NFX1-type containing 1	848							metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			cervix(2)|endometrium(8)|kidney(7)|large_intestine(15)|liver(1)|lung(17)|ovary(2)|prostate(4)|skin(3)|urinary_tract(1)	60			BRCA - Breast invasive adenocarcinoma(12;0.00173)|COAD - Colon adenocarcinoma(4;0.14)|Colorectal(8;0.166)			CTTCTTCCGCCGCTGGGGCCT	0.572													C|||	1	0.000199681	0.0008	0.0	5008	,	,		5735	0.0		0.0	False		,,,				2504	0.0																0								C	GLN/ARG	0,4406		0,0,2203	149.0	138.0	142.0		2543	3.6	0.0	20	dbSNP_134	142	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZNFX1	NM_021035.2	43	0,1,6502	TT,TC,CC		0.0116,0.0,0.0077	possibly-damaging	848/1919	47874075	1,13005	2203	4300	6503	SO:0001583	missense	57169			AK022641	CCDS13417.1	20q13.13	2014-02-12			ENSG00000124201	ENSG00000124201			29271	protein-coding gene	gene with protein product						10718198	Standard	NM_021035		Approved	KIAA1404, FLJ11277	uc002xui.3	Q9P2E3	OTTHUMG00000032696	ENST00000396105.1:c.2543G>A	20.37:g.47874075C>T	ENSP00000379412:p.Arg848Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BQM7|Q9BQM8|Q9H8C1|Q9H9S2|Q9NUM1|Q9NWW1	Missense_Mutation	SNP	superfamily_ARM-type_fold,smart_Znf_NFX1	p.R848Q	ENST00000396105.1	37	c.2543	CCDS13417.1	20	.	.	.	.	.	.	.	.	.	.	C	9.036	0.988381	0.18966	0.0	1.16E-4	ENSG00000124201	ENST00000396106;ENST00000371754;ENST00000371752;ENST00000396105;ENST00000371744;ENST00000455070	D;D;D;T;T	0.86297	-1.83;-2.1;-2.1;-0.78;-1.49	5.87	3.61	0.41365	.	0.179467	0.45867	N	0.000322	T	0.75759	0.3893	L	0.31752	0.955	0.09310	N	1	B	0.09022	0.002	B	0.04013	0.001	T	0.56329	-0.7997	10	0.11485	T	0.65	-16.7347	8.3989	0.32574	0.0:0.7084:0.1323:0.1592	.	848	Q9P2E3	ZNFX1_HUMAN	Q	848;848;848;848;848;652	ENSP00000360819:R848Q;ENSP00000360817:R848Q;ENSP00000379412:R848Q;ENSP00000360809:R848Q;ENSP00000413800:R652Q	ENSP00000360809:R848Q	R	-	2	0	ZNFX1	47307482	0.001000	0.12720	0.040000	0.18447	0.027000	0.11550	0.931000	0.28871	1.492000	0.48499	0.655000	0.94253	CGG	ZNFX1	-	NULL		0.572	ZNFX1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNFX1	HGNC	protein_coding	OTTHUMT00000079647.2	C	NM_021035		47874075	-1	no_errors	ENST00000371752	ensembl	human	known	70_37	missense	SNP	0.010	T
ZSWIM4	65249	genome.wustl.edu	37	19	13928068	13928068	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WH-01A-22D-A351-09	TCGA-DS-A7WH-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	c1b9a90f-1b7e-4ce1-955e-d67478395417	3593a6b0-2918-42ea-a3aa-1855ded8c03b	g.chr19:13928068G>A	ENST00000254323.2	+	7	1408	c.1219G>A	c.(1219-1221)Gaa>Aaa	p.E407K	ZSWIM4_ENST00000440752.2_Missense_Mutation_p.E241K|RN7SL619P_ENST00000581753.1_RNA	NM_023072.2	NP_075560.2	Q9H7M6	ZSWM4_HUMAN	zinc finger, SWIM-type containing 4	407							zinc ion binding (GO:0008270)			central_nervous_system(3)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(2)|lung(11)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	27			OV - Ovarian serous cystadenocarcinoma(19;2.94e-23)|Epithelial(5;4.58e-19)			CACCAACACCGAAGGATGGGT	0.632																																																	0													74.0	73.0	73.0					19																	13928068		2203	4300	6503	SO:0001583	missense	65249			AK022283	CCDS32924.1	19p13.13	2012-02-23			ENSG00000132003	ENSG00000132003		"""Zinc fingers, SWIM-type"""	25704	protein-coding gene	gene with protein product							Standard	NM_023072		Approved	FLJ12221	uc002mxh.1	Q9H7M6		ENST00000254323.2:c.1219G>A	19.37:g.13928068G>A	ENSP00000254323:p.Glu407Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfscan_Znf_SWIM	p.E407K	ENST00000254323.2	37	c.1219	CCDS32924.1	19	.	.	.	.	.	.	.	.	.	.	G	33	5.282923	0.95489	.	.	ENSG00000132003	ENST00000254323;ENST00000440752	T;T	0.48201	0.82;0.84	4.79	4.79	0.61399	.	0.198962	0.32357	N	0.006212	T	0.61664	0.2365	L	0.60455	1.87	0.51767	D	0.999934	P;D	0.69078	0.681;0.997	B;P	0.61397	0.155;0.888	T	0.63972	-0.6516	10	0.52906	T	0.07	-2.0711	15.3128	0.74048	0.0:0.0:1.0:0.0	.	241;407	E7ERX2;Q9H7M6	.;ZSWM4_HUMAN	K	407;241	ENSP00000254323:E407K;ENSP00000405278:E241K	ENSP00000254323:E407K	E	+	1	0	ZSWIM4	13789068	1.000000	0.71417	0.877000	0.34402	0.830000	0.47004	9.483000	0.97937	2.215000	0.71742	0.400000	0.26472	GAA	ZSWIM4	-	NULL		0.632	ZSWIM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZSWIM4	HGNC	protein_coding	OTTHUMT00000457457.1	G	XM_031342		13928068	+1	no_errors	ENST00000254323	ensembl	human	known	70_37	missense	SNP	1.000	A
