#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
AKAP13	11214	genome.wustl.edu	37	15	86123232	86123232	+	Nonsense_Mutation	SNP	C	C	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr15:86123232C>T	ENST00000394518.2	+	7	2028	c.1933C>T	c.(1933-1935)Caa>Taa	p.Q645*	RP11-815J21.2_ENST00000561409.1_RNA|AKAP13_ENST00000361243.2_Nonsense_Mutation_p.Q645*	NM_001270546.1|NM_007200.4	NP_001257475.1|NP_009131.2	Q12802	AKP13_HUMAN	A kinase (PRKA) anchor protein 13	645					apoptotic signaling pathway (GO:0097190)|neurotrophin TRK receptor signaling pathway (GO:0048011)|nuclear export (GO:0051168)|positive regulation of apoptotic process (GO:0043065)|protein phosphorylation (GO:0006468)|regulation of cardiac muscle hypertrophy (GO:0010611)|regulation of glucocorticoid mediated signaling pathway (GO:1900169)|regulation of protein kinase activity (GO:0045859)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	cAMP-dependent protein kinase activity (GO:0004691)|metal ion binding (GO:0046872)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|signal transducer activity (GO:0004871)			NS(1)|breast(2)|central_nervous_system(4)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(13)|large_intestine(13)|liver(1)|lung(43)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	98						TGCTCAAAGCCAAAAGGGCAA	0.448																																					Melanoma(94;603 1453 3280 32295 32951)												0													151.0	135.0	141.0					15																	86123232		2202	4299	6501	SO:0001587	stop_gained	11214			M90360	CCDS32319.1, CCDS32320.1, CCDS73778.1	15q24-q25	2013-01-10	2002-06-13			ENSG00000170776		"""A-kinase anchor proteins"", ""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	371	protein-coding gene	gene with protein product		604686	"""lymphoid blast crisis oncogene"""	LBC		9627117, 1860836	Standard	NM_007200		Approved	Ht31, BRX, AKAP-Lbc, c-lbc, PROTO-LB, HA-3, ARHGEF13	uc002blu.2	Q12802		ENST00000394518.2:c.1933C>T	15.37:g.86123232C>T	ENSP00000378026:p.Gln645*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14572|Q59FP6|Q86W90|Q8WXQ6|Q96JP6|Q96P79|Q9Y5T0|Q9Y5T6	Nonsense_Mutation	SNP	pfam_DH-domain,pfam_Pleckstrin_homology,superfamily_DH-domain,superfamily_Ankyrin_rpt-contain_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_DH-domain,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_DH-domain	p.Q645*	ENST00000394518.2	37	c.1933	CCDS32319.1	15	.	.	.	.	.	.	.	.	.	.	C	39	7.639851	0.98406	.	.	ENSG00000170776	ENST00000361243;ENST00000394518;ENST00000394516;ENST00000458540	.	.	.	4.8	3.81	0.43845	.	.	.	.	.	.	.	.	.	.	.	0.22911	N	0.998576	.	.	.	.	.	.	.	.	.	.	0.11182	T	0.66	.	10.4987	0.44794	0.0:0.8031:0.1969:0.0	.	.	.	.	X	645;645;644;644	.	ENSP00000354718:Q645X	Q	+	1	0	AKAP13	83924236	0.001000	0.12720	0.177000	0.23020	0.720000	0.41350	0.794000	0.26958	2.365000	0.80145	0.655000	0.94253	CAA	AKAP13	-	NULL		0.448	AKAP13-004	KNOWN	basic|appris_candidate|CCDS	protein_coding	AKAP13	HGNC	protein_coding	OTTHUMT00000417318.1	C	NM_007200		86123232	+1	no_errors	ENST00000361243	ensembl	human	known	70_37	nonsense	SNP	0.030	T
AOX2P	344454	genome.wustl.edu	37	2	201619758	201619759	+	IGR	DEL	TG	TG	-	rs563268698	byFrequency	TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	TG	TG					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr2:201619758_201619759delTG								AC007163.3 (19858 upstream) : AOX2P (7271 downstream)																							CCTTTCAAATtgtgtgtgtgtg	0.406														2052	0.409744	0.2262	0.3775	5008	,	,		16703	0.4236		0.4254	False		,,,				2504	0.6503																0																																										SO:0001628	intergenic_variant	344454																															2.37:g.201619768_201619769delTG		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL		37	NULL		2																																																																																			AOX2P	-	-	0	0.406					AOX2P	HGNC			TG			201619759	+1	no_errors	ENST00000472376	ensembl	human	known	70_37	rna	DEL	0.000:0.000	-
ARHGEF5	7984	genome.wustl.edu	37	7	144060304	144060304	+	Missense_Mutation	SNP	G	G	C			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr7:144060304G>C	ENST00000056217.5	+	2	716	c.542G>C	c.(541-543)aGa>aCa	p.R181T	ARHGEF5_ENST00000471847.2_5'Flank	NM_005435.3	NP_005426.2	Q12774	ARHG5_HUMAN	Rho guanine nucleotide exchange factor (GEF) 5	181					actin cytoskeleton organization (GO:0030036)|intracellular signal transduction (GO:0035556)|myeloid dendritic cell chemotaxis (GO:0002408)|positive regulation of podosome assembly (GO:0071803)|regulation of Rho GTPase activity (GO:0032319)		GTP binding (GO:0005525)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(1)|endometrium(6)|kidney(8)|large_intestine(9)|liver(1)|lung(8)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	Melanoma(164;0.14)					GGTCAGACCAGATATTATTCT	0.502																																																	0													61.0	67.0	65.0					7																	144060304		2109	4135	6244	SO:0001583	missense	7984			U02082	CCDS34771.1	7q35	2012-09-20			ENSG00000050327	ENSG00000050327		"""Rho guanine nucleotide exchange factors"""	13209	protein-coding gene	gene with protein product	"""transforming immortalized mammary oncogene"", ""guanine nucleotide regulatory protein TIM"""	600888				8134109, 7656213	Standard	NM_005435		Approved	TIM, TIM1, GEF5, P60	uc003wel.3	Q12774	OTTHUMG00000158004	ENST00000056217.5:c.542G>C	7.37:g.144060304G>C	ENSP00000056217:p.Arg181Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNJ2|Q6ZML7	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.R181T	ENST00000056217.5	37	c.542	CCDS34771.1	7	.	.	.	.	.	.	.	.	.	.	G	9.443	1.088671	0.20390	.	.	ENSG00000050327	ENST00000056217	T	0.78003	-1.14	4.33	-0.132	0.13489	.	0.424262	0.17053	U	0.188869	T	0.63462	0.2513	L	0.39898	1.24	0.09310	N	1	B	0.20671	0.047	B	0.19391	0.025	T	0.47045	-0.9147	9	.	.	.	.	6.8596	0.24060	0.0924:0.0:0.2778:0.6298	.	181	Q12774	ARHG5_HUMAN	T	181	ENSP00000056217:R181T	.	R	+	2	0	ARHGEF5	143691237	0.000000	0.05858	0.000000	0.03702	0.010000	0.07245	0.331000	0.19733	-0.232000	0.09811	0.650000	0.86243	AGA	ARHGEF5	-	NULL		0.502	ARHGEF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARHGEF5	HGNC	protein_coding	OTTHUMT00000349981.1	G	NM_005435		144060304	+1	no_errors	ENST00000056217	ensembl	human	known	70_37	missense	SNP	0.000	C
BCL6B	255877	genome.wustl.edu	37	17	6930847	6930847	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr17:6930847G>A	ENST00000293805.5	+	9	1441	c.1349G>A	c.(1348-1350)cGg>cAg	p.R450Q		NM_181844.3	NP_862827	Q8N143	BCL6B_HUMAN	B-cell CLL/lymphoma 6, member B	450					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			skin(1)	1						CTGCATTTCCGGCACAAGAGT	0.612																																																	0													44.0	51.0	49.0					17																	6930847		2074	4212	6286	SO:0001583	missense	255877			AI672318	CCDS42248.1	17p13.1	2014-06-10	2010-04-14		ENSG00000161940	ENSG00000161940		"""-"", ""Zinc fingers, C2H2-type"", ""BTB/POZ domain containing"""	1002	protein-coding gene	gene with protein product		608992	"""zinc finger protein 62"", ""B-cell CLL/lymphoma 6, member B (zinc finger protein)"""	ZNF62		9632807	Standard	NM_181844		Approved	ZBTB28, BAZF	uc010clt.1	Q8N143	OTTHUMG00000177882	ENST00000293805.5:c.1349G>A	17.37:g.6930847G>A	ENSP00000293805:p.Arg450Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PCB4	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_Znf_C2H2,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.R450Q	ENST00000293805.5	37	c.1349	CCDS42248.1	17	.	.	.	.	.	.	.	.	.	.	G	33	5.235127	0.95207	.	.	ENSG00000161940	ENST00000293805	T	0.35789	1.29	5.47	5.47	0.80525	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	T	0.51652	0.1687	L	0.45352	1.415	0.53688	D	0.999975	D	0.89917	1.0	D	0.76071	0.987	T	0.34625	-0.9821	10	0.27785	T	0.31	.	16.8115	0.85722	0.0:0.0:1.0:0.0	.	450	Q8N143	BCL6B_HUMAN	Q	450	ENSP00000293805:R450Q	ENSP00000293805:R450Q	R	+	2	0	BCL6B	6871571	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.334000	0.96470	2.584000	0.87258	0.462000	0.41574	CGG	BCL6B	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.612	BCL6B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BCL6B	HGNC	protein_coding	OTTHUMT00000439455.2	G	NM_181844		6930847	+1	no_errors	ENST00000293805	ensembl	human	known	70_37	missense	SNP	1.000	A
BPIFC	254240	genome.wustl.edu	37	22	32853350	32853350	+	Silent	SNP	G	G	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr22:32853350G>T	ENST00000397452.1	-	2	134	c.24C>A	c.(22-24)gtC>gtA	p.V8V	BPIFC_ENST00000300399.3_Silent_p.V8V|BPIFC_ENST00000534972.1_5'UTR|BPIFC_ENST00000397450.1_Silent_p.V8V|BPIFC_ENST00000432451.2_5'UTR			Q8NFQ6	BPIFC_HUMAN	BPI fold containing family C	8						extracellular region (GO:0005576)	lipopolysaccharide binding (GO:0001530)|phospholipid binding (GO:0005543)										ATCCCCAGAGGACTGGGATTG	0.403											OREG0003513	type=REGULATORY REGION|Gene=BPIL2|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													117.0	110.0	113.0					22																	32853350		2203	4300	6503	SO:0001819	synonymous_variant	254240			AF465766	CCDS13906.1	22q12.3	2011-08-04	2011-08-01	2011-08-01	ENSG00000184459	ENSG00000184459		"""BPI fold containing"""	16503	protein-coding gene	gene with protein product		614109	"""bactericidal/permeability-increasing protein-like 2"""	BPIL2			Standard	NM_174932		Approved	dJ149A16.7	uc003amn.2	Q8NFQ6	OTTHUMG00000058273	ENST00000397452.1:c.24C>A	22.37:g.32853350G>T		Somatic	835	WXS	Illumina HiSeq	Phase_IV	A2RRF1	Silent	SNP	pfam_Lipid-bd_serum_glycop_N,pfam_Lipid-bd_serum_glycop_C,superfamily_Bactericidal_perm-incr_a/b_dom,smart_Lipid-bd_serum_glycop_N,smart_Lipid-bd_serum_glycop_C	p.V8	ENST00000397452.1	37	c.24	CCDS13906.1	22																																																																																			BPIFC	-	NULL		0.403	BPIFC-010	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	BPIFC	HGNC	protein_coding	OTTHUMT00000129029.2	G	NM_174932		32853350	-1	no_errors	ENST00000300399	ensembl	human	known	70_37	silent	SNP	0.048	T
CASP8	841	genome.wustl.edu	37	2	202149755	202149755	+	Missense_Mutation	SNP	T	T	G			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr2:202149755T>G	ENST00000432109.2	+	9	1208	c.1019T>G	c.(1018-1020)tTc>tGc	p.F340C	CASP8_ENST00000323492.7_Missense_Mutation_p.F325C|CASP8_ENST00000264275.5_Missense_Mutation_p.F357C|CASP8_ENST00000358485.4_Missense_Mutation_p.F399C|CASP8_ENST00000392259.2_3'UTR|CASP8_ENST00000392266.3_3'UTR|CASP8_ENST00000264274.9_Missense_Mutation_p.F256C	NM_033355.3	NP_203519.1	Q14790	CASP8_HUMAN	caspase 8, apoptosis-related cysteine peptidase	340					activation of cysteine-type endopeptidase activity (GO:0097202)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|B cell activation (GO:0042113)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|execution phase of apoptosis (GO:0097194)|extrinsic apoptotic signaling pathway (GO:0097191)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|heart development (GO:0007507)|hepatocyte apoptotic process (GO:0097284)|innate immune response (GO:0045087)|intrinsic apoptotic signaling pathway (GO:0097193)|macrophage differentiation (GO:0030225)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|natural killer cell activation (GO:0030101)|negative regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043124)|negative regulation of necroptotic process (GO:0060546)|neural tube formation (GO:0001841)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of extrinsic apoptotic signaling pathway (GO:2001238)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of macrophage differentiation (GO:0045651)|positive regulation of protein insertion into mitochondrial membrane involved in apoptotic signaling pathway (GO:1900740)|positive regulation of proteolysis (GO:0045862)|protein heterooligomerization (GO:0051291)|proteolysis (GO:0006508)|proteolysis involved in cellular protein catabolic process (GO:0051603)|regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001239)|regulation of thymocyte apoptotic process (GO:0070243)|response to antibiotic (GO:0046677)|response to cobalt ion (GO:0032025)|response to cold (GO:0009409)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to tumor necrosis factor (GO:0034612)|syncytiotrophoblast cell differentiation involved in labyrinthine layer development (GO:0060715)|T cell activation (GO:0042110)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor signaling pathway (GO:0002224)|TRAIL-activated apoptotic signaling pathway (GO:0036462)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)|viral process (GO:0016032)	CD95 death-inducing signaling complex (GO:0031265)|cell body (GO:0044297)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|death-inducing signaling complex (GO:0031264)|membrane raft (GO:0045121)|microtubule organizing center (GO:0005815)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|neuron projection (GO:0043005)|Noc1p-Noc2p complex (GO:0030690)|nucleus (GO:0005634)|ripoptosome (GO:0097342)	cysteine-type endopeptidase activity (GO:0004197)|cysteine-type endopeptidase activity involved in apoptotic process (GO:0097153)|cysteine-type endopeptidase activity involved in apoptotic signaling pathway (GO:0097199)|cysteine-type peptidase activity (GO:0008234)|death effector domain binding (GO:0035877)|peptidase activity (GO:0008233)|scaffold protein binding (GO:0097110)|ubiquitin protein ligase binding (GO:0031625)			breast(5)|cervix(2)|endometrium(6)|large_intestine(11)|lung(10)|ovary(3)|prostate(1)|skin(2)|upper_aerodigestive_tract(9)|urinary_tract(3)	52						ACATCTCAGTTCACTGGTTTG	0.483										HNSCC(4;0.00038)																											Melanoma(82;831 1348 20716 36952 40159)												0													134.0	120.0	125.0					2																	202149755		2203	4300	6503	SO:0001583	missense	841			U60520	CCDS2342.1, CCDS2343.1, CCDS2345.1, CCDS42798.1, CCDS42799.1	2q33-q34	2014-09-17	2005-08-17		ENSG00000064012	ENSG00000064012		"""Caspases"""	1509	protein-coding gene	gene with protein product		601763	"""caspase 8, apoptosis-related cysteine protease"""			8681376, 8681377	Standard	NM_033355		Approved	MCH5, MACH, FLICE, Casp-8	uc002uxt.1	Q14790	OTTHUMG00000132821	ENST00000432109.2:c.1019T>G	2.37:g.202149755T>G	ENSP00000412523:p.Phe340Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O14676|Q14791|Q14792|Q14793|Q14794|Q14795|Q14796|Q15780|Q15806|Q53TT5|Q8TDI1|Q8TDI2|Q8TDI3|Q8TDI4|Q8TDI5|Q96T22|Q9C0K4|Q9UQ81	Missense_Mutation	SNP	pfam_DED,pfam_Pept_C14_cat,superfamily_DEATH-like,smart_DED,smart_Pept_C14_p45_core,pfscan_DED,pfscan_Pept_C14_p10,pfscan_Pept_C14_ICE_p20,prints_Pept_C14_p45_core	p.F399C	ENST00000432109.2	37	c.1196	CCDS2342.1	2	.	.	.	.	.	.	.	.	.	.	T	21.9	4.222799	0.79464	.	.	ENSG00000064012	ENST00000392263;ENST00000264274;ENST00000432109;ENST00000264275;ENST00000358485;ENST00000323492;ENST00000444430	D;D;D;D;D;D;D	0.85339	-1.97;-1.97;-1.97;-1.97;-1.97;-1.97;-1.97	5.68	5.68	0.88126	Peptidase C14, caspase catalytic (1);Peptidase C14, caspase precursor p45, core (1);Peptidase C14, ICE, catalytic subunit p20 (1);	0.047568	0.85682	D	0.000000	D	0.95124	0.8420	H	0.97051	3.93	0.80722	D	1	D;D;D;D;D	0.89917	1.0;1.0;1.0;1.0;1.0	D;D;D;D;D	0.97110	1.0;1.0;1.0;1.0;1.0	D	0.96715	0.9528	10	0.87932	D	0	.	15.9161	0.79521	0.0:0.0:0.0:1.0	.	256;399;340;325;357	Q14790-3;Q14790-9;Q14790;Q14790-2;Q14790-4	.;.;CASP8_HUMAN;.;.	C	325;256;340;357;399;325;119	ENSP00000376091:F325C;ENSP00000264274:F256C;ENSP00000412523:F340C;ENSP00000264275:F357C;ENSP00000351273:F399C;ENSP00000325722:F325C;ENSP00000394434:F119C	ENSP00000264274:F256C	F	+	2	0	CASP8	201858000	1.000000	0.71417	1.000000	0.80357	0.730000	0.41778	7.846000	0.86887	2.170000	0.68504	0.459000	0.35465	TTC	CASP8	-	pfam_Pept_C14_cat,smart_Pept_C14_p45_core,pfscan_Pept_C14_ICE_p20		0.483	CASP8-014	KNOWN	basic|appris_candidate|CCDS	protein_coding	CASP8	HGNC	protein_coding	OTTHUMT00000336853.2	T	NM_001228		202149755	+1	no_errors	ENST00000358485	ensembl	human	known	70_37	missense	SNP	1.000	G
CBFA2T2	9139	genome.wustl.edu	37	20	32211658	32211658	+	Intron	SNP	C	C	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr20:32211658C>A	ENST00000346541.3	+	6	1256				CBFA2T2_ENST00000344201.3_Missense_Mutation_p.P238T|CBFA2T2_ENST00000492345.1_Intron|CBFA2T2_ENST00000359606.3_Intron|CBFA2T2_ENST00000375279.2_Intron|CBFA2T2_ENST00000491618.1_3'UTR|CBFA2T2_ENST00000397800.1_Intron|CBFA2T2_ENST00000342704.6_Intron|CBFA2T2_ENST00000397798.2_Missense_Mutation_p.P238T	NM_005093.3	NP_005084.1	O43439	MTG8R_HUMAN	core-binding factor, runt domain, alpha subunit 2; translocated to, 2						epithelial cell differentiation (GO:0030855)|negative regulation of neuron projection development (GO:0010977)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neuron projection development (GO:0010976)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			breast(1)|central_nervous_system(3)|endometrium(1)|kidney(2)|large_intestine(4)|lung(4)|pancreas(1)|prostate(2)|skin(2)	20						gCCTGCACACCCGGTAAGAAA	0.413																																					Esophageal Squamous(174;142 1955 14837 21276 28041)												0																																										SO:0001627	intron_variant	9139			AF052210	CCDS13221.1, CCDS46590.1	20q11	2007-01-29			ENSG00000078699	ENSG00000078699		"""Zinc fingers, MYND-type"""	1536	protein-coding gene	gene with protein product		603672				9790752	Standard	XM_006723886		Approved	MTGR1, ZMYND3	uc002wze.1	O43439	OTTHUMG00000032261	ENST00000346541.3:c.719+556C>A	20.37:g.32211658C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAE6|F8W6D7|Q5TGE4|Q5TGE5|Q5TGE6|Q5TGE7|Q8IWF3|Q96B06|Q96L00|Q9H436|Q9UJP8|Q9UJP9|Q9UP24	Missense_Mutation	SNP	pfam_TAFH_NHR1,smart_TAFH_NHR1,pfscan_TAFH_NHR1,prints_ETO	p.P238T	ENST00000346541.3	37	c.712	CCDS13221.1	20	.	.	.	.	.	.	.	.	.	.	C	8.139	0.784787	0.16189	.	.	ENSG00000078699	ENST00000344201;ENST00000397798	.	.	.	2.81	1.19	0.21007	.	.	.	.	.	T	0.38054	0.1026	.	.	.	0.09310	N	0.999996	.	.	.	.	.	.	T	0.36696	-0.9737	5	0.87932	D	0	.	4.3737	0.11260	0.0:0.7022:0.0:0.2978	.	.	.	.	T	238	.	ENSP00000341865:P238T	P	+	1	0	CBFA2T2	31675319	0.000000	0.05858	0.003000	0.11579	0.033000	0.12548	0.099000	0.15210	0.331000	0.23511	0.655000	0.94253	CCG	CBFA2T2	-	NULL		0.413	CBFA2T2-201	KNOWN	basic|CCDS	protein_coding	CBFA2T2	HGNC	protein_coding	OTTHUMT00000078708.2	C	NM_001032999		32211658	+1	no_errors	ENST00000397798	ensembl	human	known	70_37	missense	SNP	0.004	A
DLG3	1741	genome.wustl.edu	37	X	69670051	69670051	+	Missense_Mutation	SNP	A	A	C			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chrX:69670051A>C	ENST00000374360.3	+	5	969	c.736A>C	c.(736-738)Aac>Cac	p.N246H	DLG3_ENST00000194900.4_Missense_Mutation_p.N264H|DLG3-AS1_ENST00000424211.1_RNA|DLG3_ENST00000374355.3_5'Flank|RNU4-81P_ENST00000363561.1_RNA|DLG3-AS1_ENST00000431103.1_RNA	NM_021120.3	NP_066943.2	Q92796	DLG3_HUMAN	discs, large homolog 3 (Drosophila)	246	PDZ 2. {ECO:0000255|PROSITE- ProRule:PRU00143}.				axon guidance (GO:0007411)|establishment of planar polarity (GO:0001736)|establishment or maintenance of epithelial cell apical/basal polarity (GO:0045197)|negative regulation of cell proliferation (GO:0008285)|negative regulation of phosphatase activity (GO:0010923)|synaptic transmission (GO:0007268)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|extracellular space (GO:0005615)|growth cone (GO:0030426)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|synapse (GO:0045202)|tight junction (GO:0005923)	phosphatase binding (GO:0019902)			endometrium(4)|kidney(1)|large_intestine(10)|lung(5)|pancreas(1)|urinary_tract(1)	22	Renal(35;0.156)					GGGTATTGGCAACCAGCACAT	0.567																																																	0													52.0	40.0	44.0					X																	69670051		2203	4300	6503	SO:0001583	missense	1741			U49089	CCDS14403.1, CCDS43967.1, CCDS55439.1	Xq13.1	2014-06-12	2008-12-15		ENSG00000082458	ENSG00000082458			2902	protein-coding gene	gene with protein product	"""neuroendocrine-dlg"", ""protein phosphatase 1, regulatory subunit 82"""	300189	"""discs, large homolog 3 (neuroendocrine-dlg, Drosophila)"""			9598320	Standard	NM_021120		Approved	NE-Dlg, SAP102, SAP-102, NEDLG, KIAA1232, MRX90, PPP1R82	uc004dyi.2	Q92796	OTTHUMG00000021778	ENST00000374360.3:c.736A>C	X.37:g.69670051A>C	ENSP00000363480:p.Asn246His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E0H1|D3DVU5|Q5JUW6|Q5JUW7|Q9ULI8	Missense_Mutation	SNP	pfam_Guanylate_kin,pfam_PDZ,pfam_PDZ_assoc,pfam_MAGUK_PEST_N,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,superfamily_PDZ,smart_PDZ,smart_SH3_domain,smart_Guanylate_kin/L-typ_Ca_channel,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ,pfscan_SH3_domain,pfscan_Guanylate_kin	p.N264H	ENST00000374360.3	37	c.790	CCDS14403.1	X	.	.	.	.	.	.	.	.	.	.	A	19.80	3.895574	0.72639	.	.	ENSG00000082458	ENST00000194900;ENST00000374360	T;T	0.28069	1.63;1.63	4.48	4.48	0.54585	PDZ/DHR/GLGF (4);	0.000000	0.85682	D	0.000000	T	0.48466	0.1501	L	0.57536	1.79	0.80722	D	1	D	0.65815	0.995	D	0.71870	0.975	T	0.42749	-0.9433	9	.	.	.	.	12.1544	0.54068	1.0:0.0:0.0:0.0	.	246	Q92796	DLG3_HUMAN	H	264;246	ENSP00000194900:N264H;ENSP00000363480:N246H	.	N	+	1	0	DLG3	69586776	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	8.648000	0.91062	1.658000	0.50742	0.356000	0.21956	AAC	DLG3	-	pfam_PDZ,superfamily_PDZ,smart_PDZ,pirsf_M-assoc_guanylate_kinase,pfscan_PDZ		0.567	DLG3-001	KNOWN	basic|CCDS	protein_coding	DLG3	HGNC	protein_coding	OTTHUMT00000057074.2	A	NM_021120		69670051	+1	no_errors	ENST00000194900	ensembl	human	known	70_37	missense	SNP	1.000	C
OVOL1	5017	genome.wustl.edu	37	11	65563649	65563649	+	3'UTR	SNP	T	T	A	rs368592403		TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr11:65563649T>A	ENST00000335987.3	+	0	1993				RP11-770G2.5_ENST00000531155.1_RNA	NM_004561.3	NP_004552.2	O14753	OVOL1_HUMAN	ovo-like zinc finger 1						cytoskeleton organization (GO:0007010)|epidermal cell differentiation (GO:0009913)|germline cell cycle switching, mitotic to meiotic cell cycle (GO:0051729)|kidney development (GO:0001822)|mesoderm development (GO:0007498)|negative regulation of meiotic cell cycle phase transition (GO:1901994)|spermatogenesis (GO:0007283)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)			central_nervous_system(1)|endometrium(1)|kidney(1)|lung(2)|upper_aerodigestive_tract(1)	6				READ - Rectum adenocarcinoma(159;0.17)		GTGCCTTGGCTCTGGGCGGGG	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	0			BC059408	CCDS8112.1	11q13	2013-10-17	2013-10-17		ENSG00000172818	ENSG00000172818		"""Zinc fingers, C2H2-type"""	8525	protein-coding gene	gene with protein product		602313	"""ovo (Drosophila) homolog-like 1"", ""ovo-like 1(Drosophila)"""			9383297	Standard	NM_004561		Approved	HOVO1	uc001ofp.3	O14753	OTTHUMG00000166600	ENST00000335987.3:c.*837T>A	11.37:g.65563649T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6PCB1	RNA	SNP	-	NULL	ENST00000335987.3	37	NULL	CCDS8112.1	11																																																																																			RP11-770G2.5	-	-		0.577	OVOL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000255404	Clone_based_vega_gene	protein_coding	OTTHUMT00000390690.1	T	NM_004561		65563649	-1	no_errors	ENST00000531155	ensembl	human	known	70_37	rna	SNP	0.001	A
GAS7	8522	genome.wustl.edu	37	17	9939844	9939844	+	Intron	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr17:9939844G>A	ENST00000432992.2	-	2	344				GAS7_ENST00000323816.4_Intron|GAS7_ENST00000585266.1_5'UTR|GAS7_ENST00000540214.1_Intron|GAS7_ENST00000578655.1_5'UTR	NM_201433.1	NP_958839.1	O60861	GAS7_HUMAN	growth arrest-specific 7						actin filament bundle assembly (GO:0051017)|actin filament polymerization (GO:0030041)|cell cycle arrest (GO:0007050)|neuron projection morphogenesis (GO:0048812)|regulation of cell shape (GO:0008360)|regulation of transcription, DNA-templated (GO:0006355)	actin filament (GO:0005884)|cytoplasm (GO:0005737)|ruffle (GO:0001726)	sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(7)|lung(18)|pancreas(1)|prostate(2)|upper_aerodigestive_tract(2)	39						CCAAGACTCCGCCGGCTTCCT	0.607			T	MLL	AML*																																			Dom	yes		17	17p	8522	growth arrest-specific 7		L	0													23.0	21.0	22.0					17																	9939844		692	1591	2283	SO:0001627	intron_variant	8522			AB007854	CCDS11152.1, CCDS42263.1, CCDS45611.1, CCDS58518.1	17p13.1	2004-02-18							4169	protein-coding gene	gene with protein product		603127				9736752	Standard	NM_001130831		Approved	KIAA0394, MGC1348	uc002gmg.1	O60861		ENST00000432992.2:c.184-16630C>T	17.37:g.9939844G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAC2|B2RCK9|O43144|Q53Y77|Q7Z571	RNA	SNP	-	NULL	ENST00000432992.2	37	NULL	CCDS11152.1	17																																																																																			GAS7	-	-		0.607	GAS7-017	KNOWN	basic|appris_principal|CCDS	protein_coding	GAS7	HGNC	protein_coding	OTTHUMT00000439883.1	G	NM_003644, NM_201432, NM_201433		9939844	-1	no_errors	ENST00000578655	ensembl	human	known	70_37	rna	SNP	0.000	A
GMDS	2762	genome.wustl.edu	37	6	2116041	2116041	+	Silent	SNP	T	T	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr6:2116041T>A	ENST00000380815.4	-	4	578	c.309A>T	c.(307-309)acA>acT	p.T103T	GMDS_ENST00000530927.1_Silent_p.T73T	NM_001500.3	NP_001491.1	O60547	GMDS_HUMAN	GDP-mannose 4,6-dehydratase	103					'de novo' GDP-L-fucose biosynthetic process (GO:0042351)|GDP-mannose metabolic process (GO:0019673)|Notch signaling pathway (GO:0007219)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)	GDP-mannose 4,6-dehydratase activity (GO:0008446)|NADP+ binding (GO:0070401)		GMDS/PDE8B(2)	breast(3)|central_nervous_system(2)|cervix(1)|endometrium(4)|large_intestine(2)|lung(8)|prostate(1)	21	Ovarian(93;0.0733)	all_cancers(2;7.64e-19)|all_epithelial(2;3.05e-16)|Colorectal(2;0.00414)|all_hematologic(90;0.00997)|all_lung(73;0.0141)|Lung NSC(90;0.0802)		Epithelial(2;7.61e-06)|all cancers(2;0.000111)|STAD - Stomach adenocarcinoma(2;0.000231)|Colorectal(2;0.00445)|COAD - Colon adenocarcinoma(2;0.0125)|OV - Ovarian serous cystadenocarcinoma(45;0.0563)		TGTAGATCTCTGTGGGCTTTA	0.438																																																	0													210.0	195.0	200.0					6																	2116041		2203	4300	6503	SO:0001819	synonymous_variant	2762			AF042377	CCDS4474.1, CCDS58994.1	6p25	2011-09-14			ENSG00000112699	ENSG00000112699	4.2.1.47	"""Short chain dehydrogenase/reductase superfamily / Extended SDR fold"""	4369	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 3E, member 1"""	602884				9525924, 19027726	Standard	NM_001500		Approved	GMD, SDR3E1	uc003mtq.3	O60547	OTTHUMG00000016143	ENST00000380815.4:c.309A>T	6.37:g.2116041T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	E9PI88|O75357|Q5T954|Q6FH09|Q9UGZ3|Q9UJK9	Silent	SNP	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,tigrfam_GDP_Man_deHydtase	p.T103	ENST00000380815.4	37	c.309	CCDS4474.1	6																																																																																			GMDS	-	pfam_Epimerase_deHydtase,pfam_dTDP_dehydrorham_reduct,tigrfam_GDP_Man_deHydtase		0.438	GMDS-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	GMDS	HGNC	protein_coding	OTTHUMT00000043380.3	T			2116041	-1	no_errors	ENST00000380815	ensembl	human	known	70_37	silent	SNP	0.013	A
GTF3C1	2975	genome.wustl.edu	37	16	27472852	27472852	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr16:27472852C>T	ENST00000356183.4	-	37	6164	c.6149G>A	c.(6148-6150)cGc>cAc	p.R2050H	GTF3C1_ENST00000567806.1_5'Flank|GTF3C1_ENST00000561623.1_Missense_Mutation_p.R2025H	NM_001520.3	NP_001511.2	Q12789	TF3C1_HUMAN	general transcription factor IIIC, polypeptide 1, alpha 220kDa	2050					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|rRNA transcription (GO:0009303)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription (GO:0009304)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)			breast(2)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(14)|liver(3)|lung(28)|ovary(2)|pancreas(1)|prostate(2)|skin(5)|upper_aerodigestive_tract(2)	80						TCTCAGCCAGCGCTTCCGGAT	0.587																																																	0													77.0	67.0	70.0					16																	27472852		2197	4300	6497	SO:0001583	missense	2975			U06485	CCDS32414.1, CCDS66988.1	16p12	2010-03-23	2002-08-29			ENSG00000077235		"""General transcription factors"""	4664	protein-coding gene	gene with protein product		603246	"""general transcription factor IIIC, polypeptide 1 (alpha subunit, 220kD )"""			8164661, 8127861	Standard	NM_001520		Approved	TFIIIC220	uc002dov.2	Q12789		ENST00000356183.4:c.6149G>A	16.37:g.27472852C>T	ENSP00000348510:p.Arg2050His	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP21|Q12838|Q6DKN9|Q9Y4W9	Missense_Mutation	SNP	pfam_TFIIIC_Bblock-bd	p.R2050H	ENST00000356183.4	37	c.6149	CCDS32414.1	16	.	.	.	.	.	.	.	.	.	.	C	14.64	2.596512	0.46318	.	.	ENSG00000077235	ENST00000356183	T	0.23754	1.89	5.12	4.11	0.48088	.	0.909776	0.09641	N	0.775005	T	0.30386	0.0763	L	0.40543	1.245	0.09310	N	1	P;D	0.57899	0.654;0.981	B;P	0.51582	0.058;0.674	T	0.07790	-1.0754	10	0.36615	T	0.2	-10.6528	9.5079	0.39058	0.3098:0.6902:0.0:0.0	.	2050;2025	Q12789;Q12789-3	TF3C1_HUMAN;.	H	2050	ENSP00000348510:R2050H	ENSP00000348510:R2050H	R	-	2	0	GTF3C1	27380353	0.451000	0.25705	0.020000	0.16555	0.198000	0.23893	2.299000	0.43611	2.393000	0.81446	0.556000	0.70494	CGC	GTF3C1	-	NULL		0.587	GTF3C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C1	HGNC	protein_coding	OTTHUMT00000433856.1	C	NM_001520		27472852	-1	no_errors	ENST00000356183	ensembl	human	known	70_37	missense	SNP	0.007	T
HS3ST3A1	9955	genome.wustl.edu	37	17	13504142	13504142	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr17:13504142G>T	ENST00000284110.1	-	1	1102	c.305C>A	c.(304-306)cCc>cAc	p.P102H		NM_006042.1	NP_006033.1	Q9Y663	HS3SA_HUMAN	heparan sulfate (glucosamine) 3-O-sulfotransferase 3A1	102					carbohydrate metabolic process (GO:0005975)|glycosaminoglycan biosynthetic process (GO:0006024)|glycosaminoglycan metabolic process (GO:0030203)|small molecule metabolic process (GO:0044281)	Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine 3-sulfotransferase 3 activity (GO:0033872)|sulfotransferase activity (GO:0008146)			central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	16		all_lung(20;0.114)		UCEC - Uterine corpus endometrioid carcinoma (92;0.101)		gcggggcgcgggcggccggcg	0.781																																																	0													1.0	1.0	1.0					17																	13504142		496	1239	1735	SO:0001583	missense	9955			AF105376	CCDS11165.1	17p12	2007-04-02			ENSG00000153976	ENSG00000153976	2.8.2.23	"""Sulfotransferases, membrane-bound"""	5196	protein-coding gene	gene with protein product		604057				9988767	Standard	NM_006042		Approved	3OST3A1, 30ST3A1	uc002gob.1	Q9Y663	OTTHUMG00000058768	ENST00000284110.1:c.305C>A	17.37:g.13504142G>T	ENSP00000284110:p.Pro102His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7N2	Missense_Mutation	SNP	pfam_Sulfotransferase_dom	p.P102H	ENST00000284110.1	37	c.305	CCDS11165.1	17	.	.	.	.	.	.	.	.	.	.	G	10.08	1.250972	0.22880	.	.	ENSG00000153976	ENST00000284110	T	0.46451	0.87	3.72	1.58	0.23477	.	1.712030	0.05352	U	0.531977	T	0.29976	0.0750	N	0.14661	0.345	0.09310	N	0.999999	B	0.02656	0.0	B	0.01281	0.0	T	0.35251	-0.9796	10	0.87932	D	0	.	10.3301	0.43818	0.0:0.0:0.6442:0.3558	.	102	Q9Y663	HS3SA_HUMAN	H	102	ENSP00000284110:P102H	ENSP00000284110:P102H	P	-	2	0	HS3ST3A1	13444867	0.000000	0.05858	0.002000	0.10522	0.015000	0.08874	0.386000	0.20702	0.281000	0.22233	-0.314000	0.08810	CCC	HS3ST3A1	-	NULL		0.781	HS3ST3A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HS3ST3A1	HGNC	protein_coding	OTTHUMT00000129952.1	G	NM_006042		13504142	-1	no_errors	ENST00000284110	ensembl	human	known	70_37	missense	SNP	0.001	T
HSPA5	3309	genome.wustl.edu	37	9	128001705	128001705	+	Silent	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr9:128001705G>A	ENST00000324460.6	-	4	803	c.600C>T	c.(598-600)aaC>aaT	p.N200N	RP11-65N13.8_ENST00000468244.1_RNA	NM_005347.4	NP_005338.1	P11021	GRP78_HUMAN	heat shock 70kDa protein 5 (glucose-regulated protein, 78kDa)	200					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|cellular protein metabolic process (GO:0044267)|cellular response to antibiotic (GO:0071236)|cellular response to glucose starvation (GO:0042149)|cellular response to interleukin-4 (GO:0071353)|cerebellar Purkinje cell layer development (GO:0021680)|cerebellum structural organization (GO:0021589)|endoplasmic reticulum unfolded protein response (GO:0030968)|ER overload response (GO:0006983)|ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|maintenance of protein localization in endoplasmic reticulum (GO:0035437)|negative regulation of apoptotic process (GO:0043066)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of cell migration (GO:0030335)|positive regulation of protein ubiquitination (GO:0031398)|regulation of protein folding in endoplasmic reticulum (GO:0060904)|substantia nigra development (GO:0021762)	cell surface (GO:0009986)|endoplasmic reticulum (GO:0005783)|endoplasmic reticulum chaperone complex (GO:0034663)|endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)|endoplasmic reticulum-Golgi intermediate compartment (GO:0005793)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|integral component of endoplasmic reticulum membrane (GO:0030176)|membrane (GO:0016020)|midbody (GO:0030496)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|calcium ion binding (GO:0005509)|chaperone binding (GO:0051087)|enzyme binding (GO:0019899)|glycoprotein binding (GO:0001948)|misfolded protein binding (GO:0051787)|protein domain specific binding (GO:0019904)|ribosome binding (GO:0043022)|ubiquitin protein ligase binding (GO:0031625)|unfolded protein binding (GO:0051082)			breast(1)|endometrium(2)|kidney(2)|large_intestine(2)|lung(9)|ovary(4)|prostate(2)|skin(1)	23					Acetylsalicylic acid(DB00945)|Antihemophilic Factor(DB00025)	CTTACGGCTCGTTGATGATCC	0.408										Prostate(1;0.17)																																							0													100.0	101.0	101.0					9																	128001705		2203	4300	6503	SO:0001819	synonymous_variant	3309				CCDS6863.1	9q33.3	2011-09-02	2002-08-29		ENSG00000044574	ENSG00000044574		"""Heat shock proteins / HSP70"""	5238	protein-coding gene	gene with protein product		138120	"""heat shock 70kD protein 5 (glucose-regulated protein, 78kD)"""	GRP78			Standard	NM_005347		Approved	BiP	uc004bpn.3	P11021	OTTHUMG00000020672	ENST00000324460.6:c.600C>T	9.37:g.128001705G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B0QZ61|Q2EF78|Q9NPF1|Q9UK02	Silent	SNP	pfam_Hsp_70_fam,pfam_MreB_Mrl,prints_Hsp_70_fam	p.N200	ENST00000324460.6	37	c.600	CCDS6863.1	9																																																																																			HSPA5	-	pfam_Hsp_70_fam,pfam_MreB_Mrl		0.408	HSPA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HSPA5	HGNC	protein_coding	OTTHUMT00000054062.1	G			128001705	-1	no_errors	ENST00000324460	ensembl	human	known	70_37	silent	SNP	1.000	A
INSR	3643	genome.wustl.edu	37	19	7172413	7172413	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr19:7172413C>T	ENST00000302850.5	-	5	1298	c.1156G>A	c.(1156-1158)Ggc>Agc	p.G386S	INSR_ENST00000341500.5_Missense_Mutation_p.G386S	NM_000208.2	NP_000199.2	P06213	INSR_HUMAN	insulin receptor	386			G -> S (in RMS; may impair receptor processing). {ECO:0000269|PubMed:17201797}.		activation of MAPK activity (GO:0000187)|activation of protein kinase activity (GO:0032147)|activation of protein kinase B activity (GO:0032148)|carbohydrate metabolic process (GO:0005975)|cellular response to growth factor stimulus (GO:0071363)|cellular response to insulin stimulus (GO:0032869)|epidermis development (GO:0008544)|exocrine pancreas development (GO:0031017)|G-protein coupled receptor signaling pathway (GO:0007186)|glucose homeostasis (GO:0042593)|heart morphogenesis (GO:0003007)|insulin receptor signaling pathway (GO:0008286)|male sex determination (GO:0030238)|peptidyl-tyrosine autophosphorylation (GO:0038083)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of developmental growth (GO:0048639)|positive regulation of DNA replication (GO:0045740)|positive regulation of glucose import (GO:0046326)|positive regulation of glycogen biosynthetic process (GO:0045725)|positive regulation of glycolytic process (GO:0045821)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of mitosis (GO:0045840)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein phosphorylation (GO:0001934)|positive regulation of respiratory burst (GO:0060267)|protein autophosphorylation (GO:0046777)|protein heterotetramerization (GO:0051290)|regulation of embryonic development (GO:0045995)|regulation of transcription, DNA-templated (GO:0006355)|signal transduction by phosphorylation (GO:0023014)|transformation of host cell by virus (GO:0019087)	caveola (GO:0005901)|endosome membrane (GO:0010008)|extracellular vesicular exosome (GO:0070062)|insulin receptor complex (GO:0005899)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	ATP binding (GO:0005524)|GTP binding (GO:0005525)|insulin binding (GO:0043559)|insulin receptor substrate binding (GO:0043560)|insulin-activated receptor activity (GO:0005009)|insulin-like growth factor I binding (GO:0031994)|insulin-like growth factor II binding (GO:0031995)|insulin-like growth factor receptor binding (GO:0005159)|phosphatidylinositol 3-kinase binding (GO:0043548)|protein tyrosine kinase activity (GO:0004713)|PTB domain binding (GO:0051425)|receptor signaling protein tyrosine kinase activity (GO:0004716)	p.G386C(1)		breast(1)|central_nervous_system(4)|endometrium(6)|kidney(2)|large_intestine(13)|lung(25)|ovary(4)|prostate(4)|skin(3)|stomach(2)|urinary_tract(2)	66					"""""""Insulin(DB00071)|""""Insulin(DB08914)|Insulin Aspart(DB01306)|Insulin Detemir(DB01307)|Insulin Glargine(DB00047)|Insulin Glulisine(DB01309)|Insulin Lispro(DB00046)|Insulin Regular(DB00030)|Mecasermin(DB01277)"""	TCAATGAGGCCGAGGTTGGCT	0.448																																																	1	Substitution - Missense(1)	lung(1)	GRCh37	CM070168	INSR	M							140.0	128.0	132.0					19																	7172413		2203	4300	6503	SO:0001583	missense	3643			M10051	CCDS12176.1, CCDS42487.1	19p13.3-p13.2	2013-02-11				ENSG00000171105		"""CD molecules"", ""Fibronectin type III domain containing"""	6091	protein-coding gene	gene with protein product		147670				2983222	Standard	NM_000208		Approved	CD220	uc002mgd.1	P06213		ENST00000302850.5:c.1156G>A	19.37:g.7172413C>T	ENSP00000303830:p.Gly386Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RW0|Q59H98|Q9UCB7|Q9UCB8|Q9UCB9	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_EGF_rcpt_L,pfam_Prot_kinase_cat_dom,pfam_Furin-like_Cys-rich_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Growth_fac_rcpt,superfamily_Fibronectin_type3,smart_Furin_repeat,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_insulin-like_rcpt,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.G386S	ENST00000302850.5	37	c.1156	CCDS12176.1	19	.	.	.	.	.	.	.	.	.	.	C	30	5.051572	0.93793	.	.	ENSG00000171105	ENST00000302850;ENST00000341500	T;T	0.78126	-1.15;-1.15	5.12	5.12	0.69794	EGF receptor, L domain (1);	0.000000	0.46758	D	0.000265	D	0.83482	0.5264	L	0.48877	1.53	0.80722	D	1	D;D;D	0.67145	0.995;0.995;0.996	D;D;D	0.69142	0.912;0.952;0.962	T	0.82462	-0.0445	10	0.37606	T	0.19	.	16.0778	0.80979	0.0:1.0:0.0:0.0	.	377;386;386	Q86WY9;P06213-2;P06213	.;.;INSR_HUMAN	S	386	ENSP00000303830:G386S;ENSP00000342838:G386S	ENSP00000303830:G386S	G	-	1	0	INSR	7123413	1.000000	0.71417	0.958000	0.39756	0.982000	0.71751	7.459000	0.80802	2.397000	0.81536	0.561000	0.74099	GGC	INSR	-	pfam_EGF_rcpt_L,pirsf_Tyr_kinase_insulin-like_rcpt		0.448	INSR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	INSR	HGNC	protein_coding	OTTHUMT00000458544.1	C			7172413	-1	no_errors	ENST00000302850	ensembl	human	known	70_37	missense	SNP	1.000	T
KRT1	3848	genome.wustl.edu	37	12	53069220	53069220	+	Silent	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr12:53069220G>A	ENST00000252244.3	-	9	1750	c.1692C>T	c.(1690-1692)ggC>ggT	p.G564G		NM_006121.3	NP_006112.3	P04264	K2C1_HUMAN	keratin 1	564	Gly/Ser-rich.|Tail.		Missing (in allele 1B). {ECO:0000269|PubMed:1281859}.	G -> S (in Ref. 9; AAA36153). {ECO:0000305}.	complement activation, lectin pathway (GO:0001867)|establishment of skin barrier (GO:0061436)|fibrinolysis (GO:0042730)|negative regulation of inflammatory response (GO:0050728)|regulation of angiogenesis (GO:0045765)|response to oxidative stress (GO:0006979)|retina homeostasis (GO:0001895)	blood microparticle (GO:0072562)|cytoskeleton (GO:0005856)|extracellular matrix (GO:0031012)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|keratin filament (GO:0045095)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor activity (GO:0004872)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(7)|lung(11)|ovary(1)|prostate(7)|skin(3)	39						agccatagctgccacctccgg	0.706																																																	0																																										SO:0001819	synonymous_variant	3848			X69725	CCDS8836.1	12q13.13	2014-06-05	2008-08-01		ENSG00000167768	ENSG00000167768		"""-"", ""Intermediate filaments type II, keratins (basic)"""	6412	protein-coding gene	gene with protein product		139350	"""epidermolytic hyperkeratosis 1"""	EHK1		2461420, 2470667, 16831889	Standard	NM_006121		Approved	KRT1A	uc001sau.1	P04264	OTTHUMG00000169749	ENST00000252244.3:c.1692C>T	12.37:g.53069220G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RA01|P85925|P86104|Q14720|Q6GSJ0|Q9H298	Silent	SNP	pfam_F,superfamily_Prefoldin,prints_Keratin_II	p.G564	ENST00000252244.3	37	c.1692	CCDS8836.1	12																																																																																			KRT1	-	NULL		0.706	KRT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KRT1	HGNC	protein_coding	OTTHUMT00000405706.1	G	NM_006121		53069220	-1	no_errors	ENST00000252244	ensembl	human	known	70_37	silent	SNP	0.375	A
MARS2	92935	genome.wustl.edu	37	2	198571412	198571412	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr2:198571412G>A	ENST00000282276.6	+	1	1326	c.1283G>A	c.(1282-1284)tGc>tAc	p.C428Y	AC011997.1_ENST00000409845.1_Intron	NM_138395.3	NP_612404.1	Q96GW9	SYMM_HUMAN	methionyl-tRNA synthetase 2, mitochondrial	428					cell death (GO:0008219)|gene expression (GO:0010467)|methionyl-tRNA aminoacylation (GO:0006431)|tRNA aminoacylation for protein translation (GO:0006418)	mitochondrial matrix (GO:0005759)	ATP binding (GO:0005524)|methionine-tRNA ligase activity (GO:0004825)			breast(1)|central_nervous_system(1)|kidney(2)|large_intestine(2)|lung(8)|ovary(3)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	22					L-Methionine(DB00134)	TGCACTACCTGCTTCCCTAGT	0.557																																																	0													88.0	90.0	89.0					2																	198571412		2203	4300	6503	SO:0001583	missense	92935			BC009115	CCDS33358.1	2q33.1	2014-01-30	2007-02-26		ENSG00000247626	ENSG00000247626	6.1.1.10	"""Aminoacyl tRNA synthetases / Class I"""	25133	protein-coding gene	gene with protein product	"""methionine tRNA ligase 2, mitochondrial"""	609728				15274629	Standard	NM_138395		Approved	mtMetRS, SPAX3	uc002uuq.3	Q96GW9	OTTHUMG00000154487	ENST00000282276.6:c.1283G>A	2.37:g.198571412G>A	ENSP00000282276:p.Cys428Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVC3|Q76E79|Q8IW62|Q8N7N4	Missense_Mutation	SNP	pfam_Methionyl/Leucyl_tRNA_Synth,pfam_aa-tRNA-synth_Ia,pfam_Cys-tRNA/MSH_ligase,superfamily_tRNAsynth_1a_anticodon-bd,prints_Met-tRNA_synth,tigrfam_Met-tRNA_synth	p.C428Y	ENST00000282276.6	37	c.1283	CCDS33358.1	2	.	.	.	.	.	.	.	.	.	.	G	4.995	0.184836	0.09495	.	.	ENSG00000247626	ENST00000282276;ENST00000499940	T	0.41400	1.0	5.17	4.26	0.50523	Aminoacyl-tRNA synthetase, class 1a, anticodon-binding (1);	0.562536	0.20160	N	0.097975	T	0.31358	0.0794	L	0.47716	1.5	0.40083	D	0.976158	P	0.35551	0.509	B	0.21917	0.037	T	0.11421	-1.0588	10	0.25106	T	0.35	-13.3776	13.1251	0.59349	0.0:0.1621:0.8379:0.0	.	428	Q96GW9	SYMM_HUMAN	Y	428;355	ENSP00000282276:C428Y	ENSP00000282276:C428Y	C	+	2	0	MARS2	198279657	0.994000	0.37717	0.997000	0.53966	0.987000	0.75469	2.558000	0.45879	1.344000	0.45657	0.655000	0.94253	TGC	MARS2	-	superfamily_tRNAsynth_1a_anticodon-bd,tigrfam_Met-tRNA_synth		0.557	MARS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MARS2	HGNC	protein_coding	OTTHUMT00000335477.1	G	NM_138395		198571412	+1	no_errors	ENST00000282276	ensembl	human	known	70_37	missense	SNP	0.990	A
MMP16	4325	genome.wustl.edu	37	8	89053808	89053808	+	Missense_Mutation	SNP	T	T	G			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr8:89053808T>G	ENST00000286614.6	-	10	1986	c.1705A>C	c.(1705-1707)Att>Ctt	p.I569L		NM_005941.4	NP_005932.2	P51512	MMP16_HUMAN	matrix metallopeptidase 16 (membrane-inserted)	569					chondrocyte proliferation (GO:0035988)|collagen catabolic process (GO:0030574)|craniofacial suture morphogenesis (GO:0097094)|embryonic cranial skeleton morphogenesis (GO:0048701)|endochondral ossification (GO:0001958)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|positive regulation of catalytic activity (GO:0043085)	Golgi lumen (GO:0005796)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|enzyme activator activity (GO:0008047)|metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(5)|liver(1)|lung(51)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(5)|urinary_tract(3)	81					Marimastat(DB00786)	ATGCAGGGAATGACAATAGCT	0.463																																																	0													298.0	233.0	255.0					8																	89053808		2203	4300	6503	SO:0001583	missense	4325			D85511	CCDS6246.1	8q21	2009-01-09	2005-08-08		ENSG00000156103	ENSG00000156103			7162	protein-coding gene	gene with protein product		602262	"""matrix metalloproteinase 16 (membrane-inserted)"", ""chromosome 8 open reading frame 57"""	C8orf57		7559440	Standard	NM_005941		Approved	MT3-MMP, DKFZp761D112	uc003yeb.4	P51512	OTTHUMG00000163769	ENST00000286614.6:c.1705A>C	8.37:g.89053808T>G	ENSP00000286614:p.Ile569Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAN7|Q14824|Q52H48	Missense_Mutation	SNP	pfam_Hemopexin/matrixin_repeat,pfam_Pept_M10_metallopeptidase,pfam_Pept_M10A_metallopeptidase_C,pfam_Peptidoglycan-bd-like,superfamily_Hemopexin/matrixin,superfamily_Peptidoglycan-bd-like,smart_Peptidase_Metallo,smart_Hemopexin/matrixin_repeat,pirsf_Pept_M10A_matrix_strom,prints_Pept_M10A_matrixin	p.I569L	ENST00000286614.6	37	c.1705	CCDS6246.1	8	.	.	.	.	.	.	.	.	.	.	T	16.31	3.087411	0.55968	.	.	ENSG00000156103	ENST00000286614	T	0.41065	1.01	5.62	5.62	0.85841	Peptidase M10A, matrix metallopeptidase, C-terminal (1);	0.000000	0.85682	D	0.000000	T	0.40094	0.1103	L	0.41236	1.265	0.80722	D	1	B	0.17852	0.024	B	0.33392	0.163	T	0.20140	-1.0284	10	0.18710	T	0.47	.	15.8189	0.78626	0.0:0.0:0.0:1.0	.	569	P51512	MMP16_HUMAN	L	569	ENSP00000286614:I569L	ENSP00000286614:I569L	I	-	1	0	MMP16	89122924	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	8.036000	0.88901	2.131000	0.65755	0.482000	0.46254	ATT	MMP16	-	pfam_Pept_M10A_metallopeptidase_C		0.463	MMP16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMP16	HGNC	protein_coding	OTTHUMT00000375304.2	T	NM_005941		89053808	-1	no_errors	ENST00000286614	ensembl	human	known	70_37	missense	SNP	1.000	G
MYH3	4621	genome.wustl.edu	37	17	10547729	10547729	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr17:10547729G>A	ENST00000583535.1	-	14	1436	c.1349C>T	c.(1348-1350)aCg>aTg	p.T450M	MYH3_ENST00000226209.7_Missense_Mutation_p.T450M	NM_002470.3	NP_002461.2	P11055	MYH3_HUMAN	myosin, heavy chain 3, skeletal muscle, embryonic	450	Myosin motor.				actin filament-based movement (GO:0030048)|ATP catabolic process (GO:0006200)|embryonic limb morphogenesis (GO:0030326)|face morphogenesis (GO:0060325)|muscle filament sliding (GO:0030049)|muscle organ development (GO:0007517)|sarcomere organization (GO:0045214)|skeletal muscle contraction (GO:0003009)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity, coupled (GO:0042623)|calmodulin binding (GO:0005516)|microfilament motor activity (GO:0000146)			breast(2)|central_nervous_system(2)|cervix(1)|endometrium(8)|kidney(5)|large_intestine(18)|lung(30)|ovary(4)|pancreas(1)|prostate(4)|skin(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	83						TGGAAGCTTCGTATCCAGTTG	0.383																																																	0													140.0	136.0	138.0					17																	10547729		2203	4300	6503	SO:0001583	missense	4621				CCDS11157.1	17p13.1	2013-09-19	2006-09-29		ENSG00000109063	ENSG00000109063		"""Myosins / Myosin superfamily : Class II"""	7573	protein-coding gene	gene with protein product	"""myosin, skeletal, heavy chain, embryonic 1"", ""muscle embryonic myosin heavy chain 3"""	160720	"""myosin, heavy polypeptide 3, skeletal muscle, embryonic"""			2726495	Standard	NM_002470		Approved	MYHC-EMB, MYHSE1, HEMHC, SMHCE	uc002gmq.2	P11055	OTTHUMG00000130367	ENST00000583535.1:c.1349C>T	17.37:g.10547729G>A	ENSP00000464317:p.Thr450Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15492	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.T450M	ENST00000583535.1	37	c.1349	CCDS11157.1	17	.	.	.	.	.	.	.	.	.	.	g	19.97	3.924482	0.73213	.	.	ENSG00000109063	ENST00000226209	D	0.87571	-2.27	4.5	4.5	0.54988	Myosin head, motor domain (2);	.	.	.	.	D	0.95223	0.8451	M	0.93763	3.455	0.50467	D	0.999877	D	0.89917	1.0	D	0.85130	0.997	D	0.96450	0.9333	9	0.87932	D	0	.	17.7575	0.88453	0.0:0.0:1.0:0.0	.	450	P11055	MYH3_HUMAN	M	450	ENSP00000226209:T450M	ENSP00000226209:T450M	T	-	2	0	MYH3	10488454	1.000000	0.71417	0.740000	0.30986	0.586000	0.36452	9.598000	0.98277	2.496000	0.84212	0.558000	0.71614	ACG	MYH3	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.383	MYH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH3	HGNC	protein_coding	OTTHUMT00000252734.2	G	NM_002470		10547729	-1	no_errors	ENST00000226209	ensembl	human	known	70_37	missense	SNP	1.000	A
NLGN4X	57502	genome.wustl.edu	37	X	6069278	6069278	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chrX:6069278G>T	ENST00000381095.3	-	2	857	c.230C>A	c.(229-231)cCc>cAc	p.P77H	NLGN4X_ENST00000381092.1_Missense_Mutation_p.P77H|NLGN4X_ENST00000275857.6_Missense_Mutation_p.P77H|NLGN4X_ENST00000538097.1_Missense_Mutation_p.P77H|NLGN4X_ENST00000469740.1_5'UTR|NLGN4X_ENST00000381093.2_Missense_Mutation_p.P77H	NM_001282145.1|NM_001282146.1|NM_181332.1	NP_001269074.1|NP_001269075.1|NP_851849.1	Q8N0W4	NLGNX_HUMAN	neuroligin 4, X-linked	77					adult behavior (GO:0030534)|brainstem development (GO:0003360)|cell-cell junction organization (GO:0045216)|cerebellum development (GO:0021549)|learning (GO:0007612)|negative regulation of excitatory postsynaptic membrane potential (GO:0090394)|neuron cell-cell adhesion (GO:0007158)|neuron differentiation (GO:0030182)|organ growth (GO:0035265)|presynaptic membrane assembly (GO:0097105)|social behavior (GO:0035176)|synapse organization (GO:0050808)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|excitatory synapse (GO:0060076)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|chloride ion binding (GO:0031404)|neurexin family protein binding (GO:0042043)|protein homodimerization activity (GO:0042803)|receptor activity (GO:0004872)			breast(1)|cervix(2)|endometrium(4)|large_intestine(21)|lung(39)|ovary(4)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(1)	81						TGAGGCATAGGGGACCCCTAA	0.547																																																	0													82.0	74.0	77.0					X																	6069278		2203	4300	6503	SO:0001583	missense	57502			AB033086	CCDS14126.1	Xp22.33	2008-02-05	2004-05-21	2004-05-26	ENSG00000146938	ENSG00000146938			14287	protein-coding gene	gene with protein product		300427	"""neuroligin 4"""	NLGN4		10574462	Standard	XM_005274564		Approved	KIAA1260, NLGN, HLNX	uc004crr.3	Q8N0W4	OTTHUMG00000021093	ENST00000381095.3:c.230C>A	X.37:g.6069278G>T	ENSP00000370485:p.Pro77His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UX10|Q9ULG0	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.P77H	ENST00000381095.3	37	c.230	CCDS14126.1	X	.	.	.	.	.	.	.	.	.	.	G	24.6	4.553653	0.86231	.	.	ENSG00000146938	ENST00000381095;ENST00000381093;ENST00000275857;ENST00000381092;ENST00000538097	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	4.2	4.2	0.49525	Carboxylesterase, type B (1);	.	.	.	.	D	0.93818	0.8023	H	0.98701	4.305	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	1.0;1.0;1.0	D	0.96325	0.9239	9	0.87932	D	0	.	15.0265	0.71674	0.0:0.0:1.0:0.0	.	77;77;77	A6NMU8;Q8N0W4;Q8N0W4-2	.;NLGNX_HUMAN;.	H	77	ENSP00000370485:P77H;ENSP00000370483:P77H;ENSP00000275857:P77H;ENSP00000370482:P77H;ENSP00000439203:P77H	ENSP00000275857:P77H	P	-	2	0	NLGN4X	6079278	1.000000	0.71417	0.997000	0.53966	0.975000	0.68041	8.047000	0.89440	1.719000	0.51432	0.600000	0.82982	CCC	NLGN4X	-	pfam_CarbesteraseB		0.547	NLGN4X-004	KNOWN	basic|CCDS	protein_coding	NLGN4X	HGNC	protein_coding	OTTHUMT00000055673.1	G	NM_020742		6069278	-1	no_errors	ENST00000381093	ensembl	human	known	70_37	missense	SNP	1.000	T
NXF4	55999	genome.wustl.edu	37	X	101821927	101821927	+	RNA	SNP	G	G	C			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chrX:101821927G>C	ENST00000360035.2	+	0	1680					NR_002216.1				nuclear RNA export factor 4 pseudogene											endometrium(2)|lung(8)	10						TAACTCCTATGTGGTAGACTT	0.522																																																	0																																												55999			AK124700		Xq22	2005-01-24			ENSG00000196970	ENSG00000196970			8074	pseudogene	pseudogene		300318	"""nuclear RNA export factor 4"""			11566096	Standard	NR_002216		Approved		uc004ejf.1		OTTHUMG00000039695		X.37:g.101821927G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000360035.2	37	NULL		X																																																																																			NXF4	-	-		0.522	NXF4-001	KNOWN	basic	processed_transcript	NXF4	HGNC	pseudogene	OTTHUMT00000095720.1	G			101821927	+1	no_errors	ENST00000360035	ensembl	human	known	70_37	rna	SNP	0.001	C
OR13C8	138802	genome.wustl.edu	37	9	107331533	107331533	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr9:107331533G>A	ENST00000335040.1	+	1	85	c.85G>A	c.(85-87)Gtt>Att	p.V29I		NM_001004483.1	NP_001004483.1	Q8NGS7	O13C8_HUMAN	olfactory receptor, family 13, subfamily C, member 8	29						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|kidney(3)|large_intestine(5)|lung(12)|ovary(1)|skin(1)	25						AGTTTTCTTCGTTCTAATTTT	0.428																																																	0													217.0	211.0	213.0					9																	107331533		2203	4300	6503	SO:0001583	missense	138802				CCDS35090.1	9q31.1	2013-09-24			ENSG00000186943	ENSG00000186943		"""GPCR / Class A : Olfactory receptors"""	15103	protein-coding gene	gene with protein product							Standard	NM_001004483		Approved		uc011lvo.2	Q8NGS7	OTTHUMG00000020409	ENST00000335040.1:c.85G>A	9.37:g.107331533G>A	ENSP00000334068:p.Val29Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VVG0|Q96R44	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.V29I	ENST00000335040.1	37	c.85	CCDS35090.1	9	.	.	.	.	.	.	.	.	.	.	G	9.602	1.128922	0.21041	.	.	ENSG00000186943	ENST00000335040	T	0.00285	8.3	4.97	3.14	0.36123	.	0.567764	0.15865	N	0.240859	T	0.00210	0.0006	L	0.39326	1.205	0.25578	N	0.986827	B	0.19331	0.035	B	0.15484	0.013	T	0.24621	-1.0155	10	0.37606	T	0.19	.	9.485	0.38924	0.1772:0.0:0.8228:0.0	.	29	Q8NGS7	O13C8_HUMAN	I	29	ENSP00000334068:V29I	ENSP00000334068:V29I	V	+	1	0	OR13C8	106371354	0.000000	0.05858	1.000000	0.80357	0.337000	0.28794	-0.211000	0.09332	1.461000	0.47929	-0.137000	0.14449	GTT	OR13C8	-	prints_GPCR_Rhodpsn		0.428	OR13C8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR13C8	HGNC	protein_coding	OTTHUMT00000053480.1	G			107331533	+1	no_errors	ENST00000335040	ensembl	human	known	70_37	missense	SNP	0.995	A
PDE2A	5138	genome.wustl.edu	37	11	72308582	72308582	+	Silent	SNP	C	C	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr11:72308582C>A	ENST00000334456.5	-	5	650	c.405G>T	c.(403-405)ctG>ctT	p.L135L	PDE2A_ENST00000540345.1_Silent_p.L126L|PDE2A_ENST00000544570.1_Silent_p.L128L|PDE2A_ENST00000418754.2_Intron|PDE2A_ENST00000376450.3_Intron|PDE2A_ENST00000540380.1_5'UTR|PDE2A_ENST00000444035.2_Silent_p.L126L	NM_002599.4	NP_002590.1	O00408	PDE2A_HUMAN	phosphodiesterase 2A, cGMP-stimulated	135					blood coagulation (GO:0007596)|calcium ion transmembrane transport (GO:0070588)|cAMP catabolic process (GO:0006198)|cAMP-mediated signaling (GO:0019933)|cellular response to cGMP (GO:0071321)|cellular response to drug (GO:0035690)|cellular response to granulocyte macrophage colony-stimulating factor stimulus (GO:0097011)|cellular response to macrophage colony-stimulating factor stimulus (GO:0036006)|cellular response to mechanical stimulus (GO:0071260)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cGMP catabolic process (GO:0046069)|cGMP-mediated signaling (GO:0019934)|establishment of endothelial barrier (GO:0061028)|metabolic process (GO:0008152)|monocyte differentiation (GO:0030224)|negative regulation of cAMP biosynthetic process (GO:0030818)|negative regulation of protein import into nucleus, translocation (GO:0033159)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of vascular permeability (GO:0043116)|positive regulation of inflammatory response (GO:0050729)|positive regulation of vascular permeability (GO:0043117)|protein targeting to mitochondrion (GO:0006626)	axon (GO:0030424)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|mitochondrial matrix (GO:0005759)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|presynaptic membrane (GO:0042734)	calcium channel activity (GO:0005262)|cAMP binding (GO:0030552)|cGMP binding (GO:0030553)|cGMP-stimulated cyclic-nucleotide phosphodiesterase activity (GO:0004118)|cyclic-nucleotide phosphodiesterase activity (GO:0004112)|drug binding (GO:0008144)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|TPR domain binding (GO:0030911)			breast(2)|endometrium(1)|kidney(3)|large_intestine(2)|lung(21)|ovary(2)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	36			BRCA - Breast invasive adenocarcinoma(5;3.55e-05)		Caffeine(DB00201)|Tofisopam(DB08811)	GTGGAGCCACCAGCCTGGCCA	0.642																																																	0													30.0	31.0	31.0					11																	72308582		2200	4293	6493	SO:0001819	synonymous_variant	5138			U67733	CCDS8216.1, CCDS44670.1, CCDS53678.1, CCDS73345.1	11q13.1-q14.1	2008-05-14			ENSG00000186642	ENSG00000186642	3.1.4.17	"""Phosphodiesterases"""	8777	protein-coding gene	gene with protein product		602658				9210593	Standard	NM_002599		Approved		uc010rrc.2	O00408	OTTHUMG00000102045	ENST00000334456.5:c.405G>T	11.37:g.72308582C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R646|B3KRV5|E9PGI1|F6W5Z0|Q5J791|Q5J792|Q5J793|Q6ZMR1	Missense_Mutation	SNP	NULL	p.W146L	ENST00000334456.5	37	c.437	CCDS8216.1	11																																																																																			PDE2A	-	NULL		0.642	PDE2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDE2A	HGNC	protein_coding	OTTHUMT00000219839.2	C	NM_002599		72308582	-1	no_errors	ENST00000485058	ensembl	human	known	70_37	missense	SNP	0.974	A
PKHD1L1	93035	genome.wustl.edu	37	8	110417308	110417308	+	Missense_Mutation	SNP	A	A	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr8:110417308A>T	ENST00000378402.5	+	16	1722	c.1618A>T	c.(1618-1620)Aat>Tat	p.N540Y		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	540					immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TGTGGAAGCTAATTCATGTTC	0.313										HNSCC(38;0.096)																																							0													28.0	28.0	28.0					8																	110417308		1807	4067	5874	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.1618A>T	8.37:g.110417308A>T	ENSP00000367655:p.Asn540Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.N540Y	ENST00000378402.5	37	c.1618	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	A	13.10	2.137428	0.37728	.	.	ENSG00000205038	ENST00000378402	D	0.86164	-2.08	5.65	1.87	0.25490	.	0.712054	0.13931	N	0.352869	D	0.82995	0.5158	M	0.70595	2.14	0.09310	N	1	P	0.44309	0.832	B	0.38106	0.265	T	0.73805	-0.3867	10	0.66056	D	0.02	.	5.4715	0.16672	0.6936:0.1475:0.1589:0.0	.	540	Q86WI1	PKHL1_HUMAN	Y	540	ENSP00000367655:N540Y	ENSP00000367655:N540Y	N	+	1	0	PKHD1L1	110486484	0.000000	0.05858	0.008000	0.14137	0.985000	0.73830	0.292000	0.19011	0.081000	0.16988	0.528000	0.53228	AAT	PKHD1L1	-	NULL		0.313	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	A	NM_177531		110417308	+1	no_errors	ENST00000378402	ensembl	human	known	70_37	missense	SNP	0.055	T
PPP2R5B	5526	genome.wustl.edu	37	11	64693304	64693304	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr11:64693304G>A	ENST00000164133.2	+	2	720	c.98G>A	c.(97-99)cGc>cAc	p.R33H		NM_006244.3	NP_006235.1	Q15173	2A5B_HUMAN	protein phosphatase 2, regulatory subunit B', beta	33					activation of signaling protein activity involved in unfolded protein response (GO:0006987)|cellular protein metabolic process (GO:0044267)|endoplasmic reticulum unfolded protein response (GO:0030968)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|protein phosphatase type 2A complex (GO:0000159)	protein phosphatase type 2A regulator activity (GO:0008601)			central_nervous_system(2)|endometrium(4)|kidney(1)|large_intestine(3)|lung(9)|ovary(2)	21						GGCTTCTCCCGCCGTTCCCTC	0.687																																																	0													14.0	15.0	15.0					11																	64693304		2198	4295	6493	SO:0001583	missense	5526			L42374	CCDS8085.1	11q12	2010-06-18	2010-04-14		ENSG00000068971	ENSG00000068971		"""Serine/threonine phosphatases / Protein phosphatase 2, regulatory subunits"""	9310	protein-coding gene	gene with protein product	"""PP2A, B subunit, B' beta isoform"", ""PP2A, B subunit, B56 beta isoform"", ""PP2A, B subunit, PR61 beta isoform"", ""PP2A, B subunit, R5 beta isoform"", ""serine/threonine protein phosphatase 2A, 56 kDa regulatory subunit, beta isoform"""	601644	"""protein phosphatase 2, regulatory subunit B (B56), beta isoform"", ""protein phosphatase 2, regulatory subunit B', beta isoform"""			7592815	Standard	NM_006244		Approved	FLJ35411, B56B, PR61B	uc001oby.3	Q15173	OTTHUMG00000150043	ENST00000164133.2:c.98G>A	11.37:g.64693304G>A	ENSP00000164133:p.Arg33His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13853	Missense_Mutation	SNP	pfam_PP2A_B56,superfamily_ARM-type_fold,pirsf_PP2A_B56	p.R33H	ENST00000164133.2	37	c.98	CCDS8085.1	11	.	.	.	.	.	.	.	.	.	.	G	27.5	4.833021	0.91036	.	.	ENSG00000068971	ENST00000526559;ENST00000164133;ENST00000359279;ENST00000527441	.	.	.	3.74	3.74	0.42951	.	0.000000	0.64402	D	0.000001	T	0.63046	0.2478	L	0.32530	0.975	0.58432	D	0.999996	D	0.89917	1.0	D	0.67231	0.95	T	0.63699	-0.6578	9	0.44086	T	0.13	-10.3586	13.4611	0.61227	0.0:0.0:1.0:0.0	.	33	Q15173	2A5B_HUMAN	H	33;33;60;33	.	ENSP00000164133:R33H	R	+	2	0	PPP2R5B	64449880	1.000000	0.71417	0.991000	0.47740	0.990000	0.78478	7.077000	0.76814	2.111000	0.64477	0.549000	0.68633	CGC	PPP2R5B	-	pirsf_PP2A_B56		0.687	PPP2R5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPP2R5B	HGNC	protein_coding	OTTHUMT00000385465.1	G	NM_006244		64693304	+1	no_errors	ENST00000164133	ensembl	human	known	70_37	missense	SNP	1.000	A
PROB1	389333	genome.wustl.edu	37	5	138727752	138727752	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr5:138727752G>T	ENST00000434752.2	-	1	3133	c.3019C>A	c.(3019-3021)Ccc>Acc	p.P1007T	MZB1_ENST00000457570.2_5'Flank|MZB1_ENST00000302125.8_5'Flank|MZB1_ENST00000412103.2_5'Flank	NM_001161546.1	NP_001155018.1	E7EW31	PROB1_HUMAN	proline-rich basic protein 1	1007	Pro-rich.																CCCTTGCCGGGCTGGGTGGGA	0.687																																																	0													14.0	20.0	18.0					5																	138727752		692	1590	2282	SO:0001583	missense	389333			AK316483	CCDS54909.1	5q31.2	2012-10-01	2012-10-01	2012-10-01	ENSG00000228672	ENSG00000228672			41906	protein-coding gene	gene with protein product			"""chromosome 5 open reading frame 65"""	C5orf65			Standard	NM_001161546		Approved		uc011czc.1	E7EW31		ENST00000434752.2:c.3019C>A	5.37:g.138727752G>T	ENSP00000416033:p.Pro1007Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E007	Missense_Mutation	SNP	NULL	p.P1007T	ENST00000434752.2	37	c.3019	CCDS54909.1	5	.	.	.	.	.	.	.	.	.	.	G	4.060	0.008886	0.07912	.	.	ENSG00000228672	ENST00000434752	.	.	.	4.63	0.66	0.17868	.	.	.	.	.	T	0.24160	0.0585	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.22347	-1.0219	8	0.45353	T	0.12	-2.0651	1.2991	0.02076	0.2016:0.1708:0.452:0.1756	.	1007	E7EW31	CE065_HUMAN	T	1007	.	ENSP00000416033:P1007T	P	-	1	0	AC135457.1	138755651	0.061000	0.20836	0.037000	0.18230	0.007000	0.05969	0.781000	0.26774	-0.072000	0.12864	-0.254000	0.11334	CCC	PROB1	-	NULL		0.687	PROB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PROB1	HGNC	protein_coding	OTTHUMT00000470735.1	G	NM_001161546		138727752	-1	no_errors	ENST00000434752	ensembl	human	known	70_37	missense	SNP	0.002	T
PTGDS	5730	genome.wustl.edu	37	9	139874618	139874618	+	Intron	SNP	T	T	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr9:139874618T>A	ENST00000371625.3	+	5	522				LCNL1_ENST00000408973.2_5'Flank|PTGDS_ENST00000224167.2_Intron	NM_000954.5	NP_000945.3	P41222	PTGDS_HUMAN	prostaglandin D2 synthase 21kDa (brain)						arachidonic acid metabolic process (GO:0019369)|cyclooxygenase pathway (GO:0019371)|prostaglandin biosynthetic process (GO:0001516)|regulation of circadian sleep/wake cycle, sleep (GO:0045187)|response to glucocorticoid (GO:0051384)|small molecule metabolic process (GO:0044281)|transport (GO:0006810)	endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)|rough endoplasmic reticulum (GO:0005791)	fatty acid binding (GO:0005504)|prostaglandin-D synthase activity (GO:0004667)|retinoid binding (GO:0005501)|transporter activity (GO:0005215)			endometrium(2)|kidney(1)|lung(3)|ovary(1)	7	all_cancers(76;0.11)	Myeloproliferative disorder(178;0.0511)	STAD - Stomach adenocarcinoma(284;0.19)	OV - Ovarian serous cystadenocarcinoma(145;2.94e-05)|Epithelial(140;0.00048)		GCCAGCTCCGTCTCCACCCTG	0.667																																																	0													42.0	43.0	43.0					9																	139874618		2203	4299	6502	SO:0001627	intron_variant	5730			AA621632	CCDS7019.1	9q34.2-q34.3	2011-11-15	2002-08-29		ENSG00000107317	ENSG00000107317	5.3.99.2	"""Lipocalins"""	9592	protein-coding gene	gene with protein product	"""lipocalin-type prostaglandin D synthase"""	176803	"""prostaglandin D2 synthase (21kD, brain)"""			1902577	Standard	NM_000954		Approved	PGDS, L-PGDS	uc004cke.3	P41222	OTTHUMG00000020957	ENST00000371625.3:c.449-17T>A	9.37:g.139874618T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R727|Q5SQ10|Q7M4P3|Q9UC22|Q9UCC9|Q9UCD9	RNA	SNP	-	NULL	ENST00000371625.3	37	NULL	CCDS7019.1	9																																																																																			PTGDS	-	-		0.667	PTGDS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTGDS	HGNC	protein_coding	OTTHUMT00000055188.1	T	NM_000954		139874618	+1	no_errors	ENST00000462514	ensembl	human	known	70_37	rna	SNP	0.000	A
RHOV	171177	genome.wustl.edu	37	15	41165482	41165482	+	Missense_Mutation	SNP	C	C	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr15:41165482C>A	ENST00000220507.4	-	3	634	c.485G>T	c.(484-486)cGg>cTg	p.R162L	AC025166.1_ENST00000582049.1_RNA	NM_133639.3	NP_598378.3			ras homolog family member V											central_nervous_system(1)|large_intestine(1)	2		all_cancers(109;1.42e-13)|all_epithelial(112;1.48e-11)|Lung NSC(122;5.77e-09)|all_lung(180;1.08e-07)|Melanoma(134;0.091)|Colorectal(260;0.175)|Ovarian(310;0.243)		GBM - Glioblastoma multiforme(113;2.58e-05)|COAD - Colon adenocarcinoma(120;0.149)|BRCA - Breast invasive adenocarcinoma(123;0.163)		GGGGCCCTCCCGGCCCCCCTG	0.647																																					Pancreas(13;103 483 3593 12123 44457)												0													50.0	58.0	56.0					15																	41165482		2203	4300	6503	SO:0001583	missense	171177			AY059636	CCDS10068.1	15q13.3	2012-02-27	2012-02-27	2004-03-24	ENSG00000104140	ENSG00000104140			18313	protein-coding gene	gene with protein product			"""ras homolog gene family, member V"""	ARHV		11839775	Standard	NM_133639		Approved	Chp, WRCH2	uc001znd.3	Q96L33	OTTHUMG00000130134	ENST00000220507.4:c.485G>T	15.37:g.41165482C>A	ENSP00000220507:p.Arg162Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Ras,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R162L	ENST00000220507.4	37	c.485	CCDS10068.1	15	.	.	.	.	.	.	.	.	.	.	C	18.27	3.587962	0.66105	.	.	ENSG00000104140	ENST00000220507	T	0.65732	-0.17	5.63	4.72	0.59763	Small GTP-binding protein domain (1);	0.384624	0.30556	N	0.009362	T	0.41143	0.1146	N	0.02665	-0.54	0.37674	D	0.923239	P	0.38582	0.638	P	0.45971	0.499	T	0.50276	-0.8847	10	0.44086	T	0.13	-35.5951	6.7836	0.23662	0.0:0.7014:0.0:0.2986	.	162	Q96L33	RHOV_HUMAN	L	162	ENSP00000220507:R162L	ENSP00000220507:R162L	R	-	2	0	RHOV	38952774	0.995000	0.38212	1.000000	0.80357	0.764000	0.43329	2.696000	0.47052	1.384000	0.46424	0.455000	0.32223	CGG	RHOV	-	pfam_Small_GTPase,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Ras,smart_Small_GTPase_Rho,tigrfam_Small_GTP-bd_dom		0.647	RHOV-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RHOV	HGNC	protein_coding	OTTHUMT00000252442.1	C			41165482	-1	no_errors	ENST00000220507	ensembl	human	known	70_37	missense	SNP	1.000	A
RLTPR	146206	genome.wustl.edu	37	16	67685598	67685598	+	Missense_Mutation	SNP	A	A	G			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr16:67685598A>G	ENST00000334583.6	+	25	2766	c.2438A>G	c.(2437-2439)cAg>cGg	p.Q813R	RLTPR_ENST00000545661.1_Missense_Mutation_p.Q777R	NM_001013838.1	NP_001013860.1	Q6F5E8	LR16C_HUMAN	RGD motif, leucine rich repeats, tropomodulin domain and proline-rich containing	813					cell migration (GO:0016477)|establishment of protein localization (GO:0045184)|homeostasis of number of cells (GO:0048872)|maintenance of cell polarity (GO:0030011)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of interferon-gamma secretion (GO:1902715)|positive regulation of interleukin-2 secretion (GO:1900042)|positive regulation of regulatory T cell differentiation (GO:0045591)|positive regulation of T cell proliferation (GO:0042102)|T cell receptor signaling pathway (GO:0050852)|thymus development (GO:0048538)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|F-actin capping protein complex (GO:0008290)|immunological synapse (GO:0001772)|membrane (GO:0016020)				breast(1)|cervix(1)|endometrium(4)|kidney(1)|lung(9)|urinary_tract(2)	18		Acute lymphoblastic leukemia(13;3.23e-05)|all_hematologic(13;0.00251)|Ovarian(137;0.192)		OV - Ovarian serous cystadenocarcinoma(108;0.0146)|Epithelial(162;0.0481)|all cancers(182;0.232)		GACTTCACTCAGGCCACACTG	0.592																																																	0													13.0	15.0	14.0					16																	67685598		2089	4233	6322	SO:0001583	missense	146206			AB113647	CCDS45513.1	16q22.1	2010-09-10				ENSG00000159753			27089	protein-coding gene	gene with protein product	"""RGD, leucine-rich repeat, tropomodulin and proline-rich containing protein"", ""leucine rich repeat containing 16C"""	610859				15588584, 19846667	Standard	XM_005255807		Approved	LRRC16C, CARMIL2	uc002etn.3	Q6F5E8		ENST00000334583.6:c.2438A>G	16.37:g.67685598A>G	ENSP00000334958:p.Gln813Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B8X2Z3	Missense_Mutation	SNP	smart_Leu-rich_rpt_RNase_inh_sub-typ	p.Q813R	ENST00000334583.6	37	c.2438	CCDS45513.1	16	.	.	.	.	.	.	.	.	.	.	A	20.9	4.073945	0.76415	.	.	ENSG00000159753	ENST00000334583;ENST00000545661	T;T	0.15487	2.42;2.43	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000003	T	0.34077	0.0885	L	0.51422	1.61	0.34378	D	0.692807	D;D	0.60160	0.987;0.985	D;P	0.67725	0.953;0.637	T	0.49399	-0.8944	10	0.87932	D	0	-22.0856	12.7681	0.57403	1.0:0.0:0.0:0.0	.	777;813	B8X2Z3;Q6F5E8	.;LR16C_HUMAN	R	813;777	ENSP00000334958:Q813R;ENSP00000441481:Q777R	ENSP00000334958:Q813R	Q	+	2	0	RLTPR	66243099	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.273000	0.58914	2.028000	0.59812	0.533000	0.62120	CAG	RLTPR	-	NULL		0.592	RLTPR-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RLTPR	HGNC	protein_coding	OTTHUMT00000467858.1	A	NM_001013838		67685598	+1	no_errors	ENST00000334583	ensembl	human	known	70_37	missense	SNP	1.000	G
SEMA6D	80031	genome.wustl.edu	37	15	48058809	48058809	+	Intron	SNP	A	A	C			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr15:48058809A>C	ENST00000316364.5	+	16	2085				SEMA6D_ENST00000355997.3_Intron|SEMA6D_ENST00000389433.2_Intron|SEMA6D_ENST00000389428.3_Intron|SEMA6D_ENST00000558014.1_Missense_Mutation_p.H561P|SEMA6D_ENST00000358066.4_Missense_Mutation_p.H561P|SEMA6D_ENST00000389432.2_Missense_Mutation_p.H561P|SEMA6D_ENST00000354744.4_Intron|SEMA6D_ENST00000558816.1_Intron|SEMA6D_ENST00000536845.2_Intron|SEMA6D_ENST00000537942.1_Missense_Mutation_p.H561P	NM_153618.1	NP_705871.1	Q8NFY4	SEM6D_HUMAN	sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6D						axon guidance (GO:0007411)|negative regulation of smooth muscle cell migration (GO:0014912)|positive regulation of smooth muscle cell migration (GO:0014911)|ventricular system development (GO:0021591)	cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	receptor activity (GO:0004872)			biliary_tract(1)|breast(4)|endometrium(4)|kidney(5)|large_intestine(10)|lung(42)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(4)	77		all_lung(180;0.000635)|Myeloproliferative disorder(241;0.116)|Melanoma(134;0.18)		all cancers(107;1.2e-11)|GBM - Glioblastoma multiforme(94;1.2e-06)		TTCCATAACCACAGTGCTGAA	0.458																																																	0													160.0	132.0	141.0					15																	48058809		2198	4297	6495	SO:0001627	intron_variant	80031			AF389430	CCDS32224.1, CCDS32225.1, CCDS32226.1, CCDS32227.1, CCDS32228.1, CCDS32229.1	15q21.1	2006-09-18				ENSG00000137872		"""Semaphorins"""	16770	protein-coding gene	gene with protein product		609295				12110693, 14977921	Standard	NM_020858		Approved	KIAA1479, FLJ11598	uc001zvy.3	Q8NFY4		ENST00000316364.5:c.1647-4A>C	15.37:g.48058809A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF10|A6NM95|A6NNK1|A7E2A0|Q8NFY3|Q8NFY5|Q8NFY6|Q8NFY7|Q9P249	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Plexin_repeat,superfamily_Semaphorin/CD100_Ag,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,pfscan_Semaphorin/CD100_Ag	p.H561P	ENST00000316364.5	37	c.1682	CCDS32225.1	15	.	.	.	.	.	.	.	.	.	.	A	14.08	2.428947	0.43122	.	.	ENSG00000137872	ENST00000537942;ENST00000389432;ENST00000358066	T;T;T	0.16743	2.32;2.36;2.32	5.34	3.06	0.35304	.	.	.	.	.	T	0.08891	0.0220	N	0.08118	0	0.80722	D	1	B	0.25105	0.118	B	0.28232	0.087	T	0.22487	-1.0215	9	0.38643	T	0.18	.	8.1246	0.30990	0.7919:0.0:0.2081:0.0	.	561	Q8NFY4-2	.	P	561	ENSP00000442040:H561P;ENSP00000374083:H561P;ENSP00000350770:H561P	ENSP00000350770:H561P	H	+	2	0	SEMA6D	45846101	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	2.514000	0.45503	0.498000	0.27948	0.533000	0.62120	CAC	SEMA6D	-	superfamily_Plexin-like_fold,smart_Plexin-like		0.458	SEMA6D-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SEMA6D	HGNC	protein_coding	OTTHUMT00000416868.1	A	NM_024966		48058809	+1	no_errors	ENST00000389432	ensembl	human	known	70_37	missense	SNP	1.000	C
SERPINI1	5274	genome.wustl.edu	37	3	167508283	167508283	+	Missense_Mutation	SNP	T	T	G			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr3:167508283T>G	ENST00000295777.5	+	3	805	c.374T>G	c.(373-375)tTg>tGg	p.L125W	SERPINI1_ENST00000446050.2_Missense_Mutation_p.L125W	NM_005025.4	NP_005016.1	Q99574	NEUS_HUMAN	serpin peptidase inhibitor, clade I (neuroserpin), member 1	125					cell death (GO:0008219)|central nervous system development (GO:0007417)|negative regulation of endopeptidase activity (GO:0010951)|peripheral nervous system development (GO:0007422)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(7)|skin(2)	20						GAGGAGTTTTTGCAAATGATG	0.358																																																	0													97.0	101.0	100.0					3																	167508283		2203	4300	6503	SO:0001583	missense	5274			Z81326	CCDS3203.1	3q26.1	2014-02-18	2005-08-18		ENSG00000163536	ENSG00000163536		"""Serine (or cysteine) peptidase inhibitors"""	8943	protein-coding gene	gene with protein product		602445	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 1"""	PI12		24172014	Standard	NM_005025		Approved	neuroserpin	uc003ffa.4	Q99574	OTTHUMG00000158450	ENST00000295777.5:c.374T>G	3.37:g.167508283T>G	ENSP00000295777:p.Leu125Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K217|D3DNP1|Q6AHZ4	Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.L125W	ENST00000295777.5	37	c.374	CCDS3203.1	3	.	.	.	.	.	.	.	.	.	.	T	24.3	4.517115	0.85495	.	.	ENSG00000163536	ENST00000472941;ENST00000446050;ENST00000295777;ENST00000472747	D;T;T;T	0.89552	-2.53;-1.08;-1.08;-1.08	5.51	5.51	0.81932	Serpin domain (3);	0.084064	0.56097	D	0.000034	D	0.96147	0.8744	H	0.95043	3.615	0.80722	D	1	D	0.89917	1.0	D	0.80764	0.994	D	0.97392	0.9990	10	0.87932	D	0	.	15.6237	0.76833	0.0:0.0:0.0:1.0	.	125	Q99574	NEUS_HUMAN	W	125	ENSP00000420133:L125W;ENSP00000397373:L125W;ENSP00000295777:L125W;ENSP00000420561:L125W	ENSP00000295777:L125W	L	+	2	0	SERPINI1	168990977	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	7.698000	0.84413	2.091000	0.63221	0.455000	0.32223	TTG	SERPINI1	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.358	SERPINI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERPINI1	HGNC	protein_coding	OTTHUMT00000351056.1	T			167508283	+1	no_errors	ENST00000295777	ensembl	human	known	70_37	missense	SNP	1.000	G
SHROOM2	357	genome.wustl.edu	37	X	9864525	9864526	+	Missense_Mutation	DNP	GA	GA	TG			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G|A	G|A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chrX:9864525_9864526GA>TG	ENST00000380913.3	+	4	2667_2668	c.2577_2578GA>TG	c.(2575-2580)gaGAag>gaTGag	p.859_860EK>DE		NM_001649.2	NP_001640.1	Q13796	SHRM2_HUMAN	shroom family member 2	859					apical protein localization (GO:0045176)|brain development (GO:0007420)|camera-type eye development (GO:0043010)|camera-type eye morphogenesis (GO:0048593)|cell migration (GO:0016477)|cell-cell junction maintenance (GO:0045217)|cellular pigment accumulation (GO:0043482)|ear development (GO:0043583)|establishment of melanosome localization (GO:0032401)|eye pigment granule organization (GO:0008057)|lens morphogenesis in camera-type eye (GO:0002089)|melanosome organization (GO:0032438)|negative regulation of actin filament depolymerization (GO:0030835)|sodium ion transmembrane transport (GO:0035725)	apical plasma membrane (GO:0016324)|cell cortex (GO:0005938)|cell-cell adherens junction (GO:0005913)|cytoskeleton (GO:0005856)|extracellular vesicular exosome (GO:0070062)|filamentous actin (GO:0031941)|microtubule (GO:0005874)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|tight junction (GO:0005923)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|beta-catenin binding (GO:0008013)|ligand-gated sodium channel activity (GO:0015280)			breast(4)|central_nervous_system(2)|cervix(3)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(3)|skin(6)|upper_aerodigestive_tract(2)	57		Hepatocellular(5;0.000888)				GCGCAGCGGAGAAGGCAGGGAC	0.658																																																	0																																										SO:0001583	missense	357			X83543	CCDS14135.1	Xp22.3	2008-02-05	2006-07-20	2006-07-20	ENSG00000146950	ENSG00000146950			630	protein-coding gene	gene with protein product		300103	"""apical protein, Xenopus laevis-like"", ""apical protein-like (Xenopus laevis)"""	APXL		7795590, 16615870	Standard	NM_001649		Approved		uc004csu.1	Q13796	OTTHUMG00000021121	Exception_encountered	X.37:g.9864525_9864526delinsTG	ENSP00000370299:p.E859_K860delinsDE	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIQ7	Missense_Mutation	SNP	pfam_ASD2,pfam_ASD1,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.E859D|p.K860E	ENST00000380913.3	37	c.2577|c.2578	CCDS14135.1	X																																																																																			SHROOM2	-	NULL		0.658	SHROOM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SHROOM2	HGNC	protein_coding	OTTHUMT00000055721.1	G|A	NM_001649		9864525|9864526	+1	no_errors	ENST00000380913	ensembl	human	known	70_37	missense	SNP	0.000	T|G
SPACA1	81833	genome.wustl.edu	37	6	88767424	88767424	+	Silent	SNP	T	T	C			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr6:88767424T>C	ENST00000237201.1	+	3	477	c.360T>C	c.(358-360)gaT>gaC	p.D120D		NM_030960.2	NP_112222.1	Q9HBV2	SACA1_HUMAN	sperm acrosome associated 1	120					acrosome assembly (GO:0001675)	acrosomal membrane (GO:0002080)|integral component of membrane (GO:0016021)				endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(12)|skin(1)|upper_aerodigestive_tract(2)	20		all_cancers(76;8.24e-09)|Acute lymphoblastic leukemia(125;2.15e-10)|Prostate(29;4.11e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;0.00011)		BRCA - Breast invasive adenocarcinoma(108;0.11)		GACCAACAGATTGTGGCTGTG	0.448																																																	0													103.0	101.0	102.0					6																	88767424		2203	4300	6503	SO:0001819	synonymous_variant	81833			AF203447	CCDS5014.1	6q15	2012-09-20			ENSG00000118434	ENSG00000118434			14967	protein-coding gene	gene with protein product		612739					Standard	NM_030960		Approved	SAMP32	uc003pmn.3	Q9HBV2	OTTHUMG00000015183	ENST00000237201.1:c.360T>C	6.37:g.88767424T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.D120	ENST00000237201.1	37	c.360	CCDS5014.1	6																																																																																			SPACA1	-	NULL		0.448	SPACA1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SPACA1	HGNC	protein_coding	OTTHUMT00000041459.1	T			88767424	+1	no_errors	ENST00000237201	ensembl	human	known	70_37	silent	SNP	0.985	C
STAG2	10735	genome.wustl.edu	37	X	123195682	123195682	+	Silent	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chrX:123195682G>A	ENST00000371160.1	+	17	1886	c.1596G>A	c.(1594-1596)gcG>gcA	p.A532A	STAG2_ENST00000469481.1_Intron|STAG2_ENST00000218089.9_Silent_p.A532A|STAG2_ENST00000371157.3_Silent_p.A532A|STAG2_ENST00000371144.3_Silent_p.A532A|STAG2_ENST00000354548.5_Silent_p.A463A|STAG2_ENST00000371145.3_Silent_p.A532A	NM_001282418.1	NP_001269347.1	Q8N3U4	STAG2_HUMAN	stromal antigen 2	532					meiotic nuclear division (GO:0007126)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of DNA endoreduplication (GO:0032876)|sister chromatid cohesion (GO:0007062)|stem cell maintenance (GO:0019827)	actin cytoskeleton (GO:0015629)|chromatin (GO:0000785)|chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cytosol (GO:0005829)|intermediate filament cytoskeleton (GO:0045111)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	chromatin binding (GO:0003682)			breast(5)|central_nervous_system(4)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(8)|large_intestine(9)|lung(21)|ovary(5)|prostate(2)|skin(5)|urinary_tract(4)	78						TTAGACAAGCGGCTGAATGTC	0.358																																																	0													68.0	67.0	68.0					X																	123195682		2203	4300	6503	SO:0001819	synonymous_variant	10735			Z75331	CCDS14607.1, CCDS43990.1	Xq25	2014-09-17			ENSG00000101972	ENSG00000101972			11355	protein-coding gene	gene with protein product		300826				9305759	Standard	NM_001042750		Approved	SA-2, SCC3B	uc004eua.3	Q8N3U4	OTTHUMG00000022725	ENST00000371160.1:c.1596G>A	X.37:g.123195682G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AMT5|D3DTF5|O00540|Q5JTI6|Q68DE9|Q9H1N8	Silent	SNP	pfam_STAG,superfamily_ARM-type_fold	p.A532	ENST00000371160.1	37	c.1596	CCDS14607.1	X																																																																																			STAG2	-	superfamily_ARM-type_fold		0.358	STAG2-018	KNOWN	basic|appris_candidate|CCDS	protein_coding	STAG2	HGNC	protein_coding	OTTHUMT00000156159.2	G	NM_006603		123195682	+1	no_errors	ENST00000218089	ensembl	human	known	70_37	silent	SNP	0.963	A
TJP1	7082	genome.wustl.edu	37	15	30025009	30025009	+	Missense_Mutation	SNP	G	G	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr15:30025009G>T	ENST00000346128.6	-	14	2221	c.1747C>A	c.(1747-1749)Cta>Ata	p.L583I	TJP1_ENST00000356107.6_Missense_Mutation_p.L583I|TJP1_ENST00000545208.2_Missense_Mutation_p.L583I|TJP1_ENST00000400011.2_Missense_Mutation_p.L587I	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	583	SH3. {ECO:0000255|PROSITE- ProRule:PRU00192}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ACACTGGCTAGCTGCTCAGCT	0.403																																					Melanoma(77;681 1843 6309 6570)												0													36.0	35.0	35.0					15																	30025009		1838	4090	5928	SO:0001583	missense	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.1747C>A	15.37:g.30025009G>T	ENSP00000281537:p.Leu583Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.L583I	ENST00000346128.6	37	c.1747	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	G	18.39	3.612818	0.66672	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T;T;T	0.17370	2.28;2.28;2.28;2.28	5.73	-2.04	0.07343	Src homology-3 domain (3);	0.000000	0.85682	D	0.000000	T	0.32763	0.0840	L	0.58428	1.81	0.80722	D	1	D;D;D;D	0.89917	0.999;1.0;0.999;0.998	D;D;D;D	0.87578	0.997;0.998;0.997;0.996	T	0.02365	-1.1170	9	.	.	.	.	14.5422	0.68002	0.3105:0.0:0.6895:0.0	.	576;583;583;587	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	I	583;587;583;583;583	ENSP00000281537:L583I;ENSP00000382890:L587I;ENSP00000441202:L583I;ENSP00000348416:L583I	.	L	-	1	2	TJP1	27812301	1.000000	0.71417	0.515000	0.27774	0.973000	0.67179	1.646000	0.37249	-0.271000	0.09272	0.655000	0.94253	CTA	TJP1	-	superfamily_SH3_domain,pfscan_SH3_domain		0.403	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	G	NM_003257		30025009	-1	no_errors	ENST00000346128	ensembl	human	known	70_37	missense	SNP	0.976	T
TRIP12	9320	genome.wustl.edu	37	2	230660005	230660006	+	Frame_Shift_Ins	INS	-	-	C			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr2:230660005_230660006insC	ENST00000283943.5	-	25	3810_3811	c.3632_3633insG	c.(3631-3633)ggtfs	p.G1211fs	TRIP12_ENST00000389044.4_Frame_Shift_Ins_p.G1259fs|TRIP12_ENST00000389045.3_Frame_Shift_Ins_p.G941fs	NM_001284214.1|NM_004238.1	NP_001271143.1|NP_004229.1	Q14669	TRIPC_HUMAN	thyroid hormone receptor interactor 12	1211					cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|embryo development (GO:0009790)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ligase activity (GO:0016874)|thyroid hormone receptor binding (GO:0046966)|ubiquitin-protein transferase activity (GO:0004842)			breast(2)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(19)|lung(32)|ovary(5)|prostate(4)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	87		Renal(207;0.025)|all_hematologic(139;0.122)|all_lung(227;0.126)|Acute lymphoblastic leukemia(138;0.164)		Epithelial(121;4.76e-13)|all cancers(144;4.34e-10)|LUSC - Lung squamous cell carcinoma(224;0.00864)|Lung(119;0.0116)		AAGGTGCATTACCCACTGGTTC	0.406																																																	0																																										SO:0001589	frameshift_variant	9320			L40383	CCDS33391.1, CCDS63145.1, CCDS63146.1	2q36.3	2008-05-27			ENSG00000153827	ENSG00000153827			12306	protein-coding gene	gene with protein product		604506				7776974	Standard	XM_005246961		Approved	KIAA0045	uc002vpw.1	Q14669	OTTHUMG00000153623	ENST00000283943.5:c.3633dupG	2.37:g.230660008_230660008dupC	ENSP00000283943:p.Gly1211fs	Somatic		WXS	Illumina HiSeq	Phase_IV	D4HL82|Q14CA3|Q14CF1|Q15644|Q53R87|Q53TE7	Frame_Shift_Ins	INS	pfam_HECT,superfamily_HECT,superfamily_ARM-type_fold,smart_HECT,pfscan_HECT,pfscan_WWE-dom	p.N1212fs	ENST00000283943.5	37	c.3633_3632	CCDS33391.1	2																																																																																			TRIP12	-	NULL		0.406	TRIP12-001	KNOWN	basic|CCDS	protein_coding	TRIP12	HGNC	protein_coding	OTTHUMT00000331861.3	-	NM_004238		230660006	-1	no_errors	ENST00000283943	ensembl	human	known	70_37	frame_shift_ins	INS	0.976:1.000	C
TSHZ3	57616	genome.wustl.edu	37	19	31770279	31770279	+	Silent	SNP	C	C	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr19:31770279C>T	ENST00000240587.4	-	2	747	c.420G>A	c.(418-420)caG>caA	p.Q140Q		NM_020856.2	NP_065907.2	Q63HK5	TSH3_HUMAN	teashirt zinc finger homeobox 3	140					in utero embryonic development (GO:0001701)|kidney morphogenesis (GO:0060993)|kidney smooth muscle cell differentiation (GO:0072195)|lung development (GO:0030324)|metanephros development (GO:0001656)|musculoskeletal movement (GO:0050881)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of smooth muscle cell differentiation (GO:0051152)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|sensory perception of touch (GO:0050975)|transcription, DNA-templated (GO:0006351)|ureter smooth muscle cell differentiation (GO:0072193)|ureteric bud development (GO:0001657)|ureteric peristalsis (GO:0072105)	growth cone (GO:0030426)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(4)|endometrium(15)|kidney(9)|large_intestine(20)|lung(60)|ovary(4)|pancreas(2)|prostate(4)|skin(5)	123	Esophageal squamous(110;0.226)					CCGAGGAGGGCTGGTGCAGGT	0.587																																																	0													97.0	101.0	100.0					19																	31770279		2199	4290	6489	SO:0001819	synonymous_variant	57616			AL136805	CCDS12421.2	19q13.11	2013-11-20	2007-07-16	2006-03-14	ENSG00000121297	ENSG00000121297		"""Teashirt zinc fingers"", ""Homeoboxes / ZF class"", ""Zinc fingers, C2H2-type"""	30700	protein-coding gene	gene with protein product	"""teashirt 3"""	614119	"""zinc finger protein 537"", ""teashirt family zinc finger 3"""	ZNF537			Standard	NM_020856		Approved	KIAA1474, TSH3	uc002nsy.4	Q63HK5	OTTHUMG00000150184	ENST00000240587.4:c.420G>A	19.37:g.31770279C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H0G6|Q9P254	Silent	SNP	superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.Q140	ENST00000240587.4	37	c.420	CCDS12421.2	19																																																																																			TSHZ3	-	NULL		0.587	TSHZ3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSHZ3	HGNC	protein_coding	OTTHUMT00000316743.2	C	NM_020856		31770279	-1	no_errors	ENST00000240587	ensembl	human	known	70_37	silent	SNP	1.000	T
UBR2	23304	genome.wustl.edu	37	6	42626564	42626565	+	Splice_Site	INS	-	-	A	rs35416750|rs543409747|rs35713624|rs398001323	byFrequency	TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr6:42626564_42626565insA	ENST00000372899.1	+	29	3500		c.e29+2		UBR2_ENST00000372883.3_Splice_Site|UBR2_ENST00000372901.1_Splice_Site	NM_015255.2	NP_056070.1	Q8IWV8	UBR2_HUMAN	ubiquitin protein ligase E3 component n-recognin 2						cellular response to leucine (GO:0071233)|chromatin silencing (GO:0006342)|histone H2A ubiquitination (GO:0033522)|male meiosis I (GO:0007141)|negative regulation of TOR signaling (GO:0032007)|spermatogenesis (GO:0007283)|ubiquitin-dependent protein catabolic process (GO:0006511)	chromatin (GO:0000785)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|ubiquitin ligase complex (GO:0000151)	leucine binding (GO:0070728)|ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|endometrium(10)|kidney(7)|large_intestine(14)|lung(22)|ovary(3)|pancreas(1)|skin(5)	64	Colorectal(47;0.196)		Colorectal(64;0.00062)|COAD - Colon adenocarcinoma(64;0.00152)|all cancers(41;0.004)|KIRC - Kidney renal clear cell carcinoma(15;0.02)|Kidney(15;0.0388)|OV - Ovarian serous cystadenocarcinoma(102;0.196)			TGATCATAGGTaaaaaaaaaaa	0.347																																																	0																																										SO:0001630	splice_region_variant	23304			BC024217	CCDS4870.1, CCDS55001.1	6p21.1	2008-06-23	2005-01-10	2005-01-12	ENSG00000024048	ENSG00000024048		"""Ubiquitin protein ligase E3 component n-recognins"""	21289	protein-coding gene	gene with protein product		609134	"""chromosome 6 open reading frame 133"""	C6orf133			Standard	NM_015255		Approved	bA49A4.1, dJ392M17.3, KIAA0349	uc011dur.2	Q8IWV8	OTTHUMG00000014703	ENST00000372899.1:c.3242+2->A	6.37:g.42626575_42626575dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	O15057|Q4VXK2|Q5TFH6|Q6P2I2|Q6ZUD0	Splice_Site	INS	-	e29+2	ENST00000372899.1	37	c.3242+2_3242+1	CCDS4870.1	6																																																																																			UBR2	-	-		0.347	UBR2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	UBR2	HGNC	protein_coding	OTTHUMT00000040558.2	-	NM_015255	Intron	42626565	+1	no_errors	ENST00000372899	ensembl	human	known	70_37	splice_site_ins	INS	1.000:0.490	A
VSIG10L	147645	genome.wustl.edu	37	19	51837453	51837453	+	Missense_Mutation	SNP	C	C	T			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr19:51837453C>T	ENST00000335624.4	-	8	2410	c.2411G>A	c.(2410-2412)cGc>cAc	p.R804H		NM_001163922.1	NP_001157394.1	Q86VR7	VS10L_HUMAN	V-set and immunoglobulin domain containing 10 like	804						integral component of membrane (GO:0016021)				breast(1)|endometrium(2)|kidney(1)	4						ACCACGAAAGCGGCACAGGCA	0.622																																																	0													37.0	49.0	45.0					19																	51837453		692	1591	2283	SO:0001583	missense	147645				CCDS54300.1	19q13.41	2013-01-11				ENSG00000186806		"""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	27111	protein-coding gene	gene with protein product						12477932	Standard	NM_001163922		Approved		uc002pwf.3	Q86VR7		ENST00000335624.4:c.2411G>A	19.37:g.51837453C>T	ENSP00000335623:p.Arg804His	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.R804H	ENST00000335624.4	37	c.2411	CCDS54300.1	19	.	.	.	.	.	.	.	.	.	.	C	12.09	1.834542	0.32421	.	.	ENSG00000186806	ENST00000335624	T	0.27402	1.67	5.36	2.07	0.26955	.	0.127621	0.35838	N	0.002950	T	0.33585	0.0868	M	0.87682	2.9	0.09310	N	1	B	0.24882	0.113	B	0.15484	0.013	T	0.38693	-0.9649	10	0.72032	D	0.01	-7.7259	5.5096	0.16874	0.0:0.6568:0.1642:0.179	.	804	Q86VR7	VS10L_HUMAN	H	804	ENSP00000335623:R804H	ENSP00000335623:R804H	R	-	2	0	VSIG10L	56529265	0.018000	0.18449	0.004000	0.12327	0.881000	0.50899	-0.351000	0.07711	0.255000	0.21593	0.467000	0.42956	CGC	VSIG10L	-	NULL		0.622	VSIG10L-001	NOVEL	basic|appris_principal|CCDS	protein_coding	VSIG10L	HGNC	protein_coding	OTTHUMT00000464535.1	C	NM_001163922		51837453	-1	no_errors	ENST00000335624	ensembl	human	novel	70_37	missense	SNP	0.015	T
WNT7B	7477	genome.wustl.edu	37	22	46319122	46319122	+	Nonsense_Mutation	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr22:46319122G>A	ENST00000339464.4	-	4	1038	c.664C>T	c.(664-666)Cga>Tga	p.R222*	WNT7B_ENST00000410089.1_Nonsense_Mutation_p.R206*|WNT7B_ENST00000409496.3_Nonsense_Mutation_p.R226*	NM_058238.2	NP_478679.1	P56706	WNT7B_HUMAN	wingless-type MMTV integration site family, member 7B	222					activation of JUN kinase activity (GO:0007257)|anatomical structure regression (GO:0060033)|apoptotic process involved in patterning of blood vessels (GO:1902262)|canonical Wnt signaling pathway (GO:0060070)|cell fate commitment (GO:0045165)|cellular metabolic process (GO:0044237)|cellular response to retinoic acid (GO:0071300)|central nervous system vasculogenesis (GO:0022009)|chorio-allantoic fusion (GO:0060710)|developmental growth involved in morphogenesis (GO:0060560)|embryonic organ development (GO:0048568)|embryonic placenta morphogenesis (GO:0060669)|establishment or maintenance of polarity of embryonic epithelium (GO:0016332)|fibroblast proliferation (GO:0048144)|forebrain regionalization (GO:0021871)|homeostatic process (GO:0042592)|in utero embryonic development (GO:0001701)|inner medullary collecting duct development (GO:0072061)|lens fiber cell development (GO:0070307)|lobar bronchus development (GO:0060482)|lung development (GO:0030324)|lung epithelium development (GO:0060428)|lung morphogenesis (GO:0060425)|lung-associated mesenchyme development (GO:0060484)|mammary gland epithelium development (GO:0061180)|metanephric collecting duct development (GO:0072205)|metanephric epithelium development (GO:0072207)|metanephric loop of Henle development (GO:0072236)|metanephros morphogenesis (GO:0003338)|negative regulation of smoothened signaling pathway (GO:0045879)|neuron differentiation (GO:0030182)|neuron projection morphogenesis (GO:0048812)|odontogenesis of dentin-containing tooth (GO:0042475)|outer medullary collecting duct development (GO:0072060)|oxygen homeostasis (GO:0032364)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JNK cascade (GO:0046330)|positive regulation of osteoblast differentiation (GO:0045669)|regulation of cell projection size (GO:0032536)|renal inner medulla development (GO:0072053)|renal outer medulla development (GO:0072054)|response to glucocorticoid (GO:0051384)|smooth muscle cell differentiation (GO:0051145)|stem cell proliferation (GO:0072089)|synapse organization (GO:0050808)|trachea cartilage morphogenesis (GO:0060535)|Wnt signaling pathway (GO:0016055)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|plasma membrane (GO:0005886)|proteinaceous extracellular matrix (GO:0005578)	frizzled binding (GO:0005109)			endometrium(1)|kidney(1)|large_intestine(3)|lung(8)|ovary(2)|skin(3)|upper_aerodigestive_tract(1)	19		Ovarian(80;0.00965)|all_neural(38;0.0416)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0178)|LUAD - Lung adenocarcinoma(64;0.247)		CCCACCTCTCGGAACTTGGGC	0.652																																																	0													42.0	43.0	43.0					22																	46319122		2203	4299	6502	SO:0001587	stop_gained	7477			AF416743	CCDS33667.1	22q13	2013-02-28			ENSG00000188064	ENSG00000188064		"""Wingless-type MMTV integration sites"", ""Endogenous ligands"""	12787	protein-coding gene	gene with protein product		601967				8168088, 9284940, 11562755	Standard	NM_058238		Approved		uc003bgo.2	P56706	OTTHUMG00000154636	ENST00000339464.4:c.664C>T	22.37:g.46319122G>A	ENSP00000341032:p.Arg222*	Somatic		WXS	Illumina HiSeq	Phase_IV	B8A596|Q96Q12	Nonsense_Mutation	SNP	pfam_Wnt,smart_Wnt,prints_Wnt,prints_Wnt7	p.R222*	ENST00000339464.4	37	c.664	CCDS33667.1	22	.	.	.	.	.	.	.	.	.	.	G	39	7.474962	0.98306	.	.	ENSG00000188064	ENST00000339464;ENST00000410089;ENST00000409496	.	.	.	3.18	3.18	0.36537	.	0.000000	0.64402	U	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	9.9192	0.41453	0.0:0.0:0.78:0.22	.	.	.	.	X	222;206;226	.	ENSP00000341032:R222X	R	-	1	2	WNT7B	44697786	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	2.618000	0.46393	1.493000	0.48517	0.305000	0.20034	CGA	WNT7B	-	pfam_Wnt,smart_Wnt		0.652	WNT7B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WNT7B	HGNC	protein_coding	OTTHUMT00000336418.1	G	NM_058238		46319122	-1	no_errors	ENST00000339464	ensembl	human	known	70_37	nonsense	SNP	1.000	A
XYLT1	64131	genome.wustl.edu	37	16	17353101	17353101	+	Silent	SNP	G	G	A	rs146043560	byFrequency	TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr16:17353101G>A	ENST00000261381.6	-	3	741	c.657C>T	c.(655-657)ccC>ccT	p.P219P		NM_022166.3	NP_071449.1	Q86Y38	XYLT1_HUMAN	xylosyltransferase I	219					cellular response to heat (GO:0034605)|chondroitin sulfate biosynthetic process (GO:0030206)|glycosaminoglycan biosynthetic process (GO:0006024)|heparan sulfate proteoglycan biosynthetic process (GO:0015012)	endoplasmic reticulum (GO:0005783)|extracellular region (GO:0005576)|Golgi membrane (GO:0000139)|integral component of membrane (GO:0016021)	acetylglucosaminyltransferase activity (GO:0008375)|protein xylosyltransferase activity (GO:0030158)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(9)|kidney(2)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CTCTGTCCCCGGGAGGCAGCA	0.587																																																	0								G		0,4394		0,0,2197	105.0	118.0	114.0		657	-10.9	0.0	16	dbSNP_134	114	3,8597	2.2+/-6.3	0,3,4297	no	coding-synonymous	XYLT1	NM_022166.3		0,3,6494	AA,AG,GG		0.0349,0.0,0.0231		219/960	17353101	3,12991	2197	4300	6497	SO:0001819	synonymous_variant	64131			AJ277441	CCDS10569.1	16p12	2013-02-25			ENSG00000103489	ENSG00000103489	2.4.2.26	"""Glucosaminyl (N-acetyl) transferase and xylosyltransferase family"""	15516	protein-coding gene	gene with protein product	"""protein xylosyltransferase 1"""	608124				11099377	Standard	NM_022166		Approved	XT-I, PXYLT1	uc002dfa.3	Q86Y38	OTTHUMG00000129975	ENST00000261381.6:c.657C>T	16.37:g.17353101G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H1B6	Silent	SNP	pfam_XylT,pfam_Glyco_trans_14	p.P219	ENST00000261381.6	37	c.657	CCDS10569.1	16																																																																																			XYLT1	-	NULL		0.587	XYLT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XYLT1	HGNC	protein_coding	OTTHUMT00000252241.2	G	NM_022166		17353101	-1	no_errors	ENST00000261381	ensembl	human	known	70_37	silent	SNP	0.000	A
ZNF442	79973	genome.wustl.edu	37	19	12461054	12461054	+	Nonsense_Mutation	SNP	G	G	A	rs372883273		TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr19:12461054G>A	ENST00000242804.4	-	6	1927	c.1345C>T	c.(1345-1347)Cga>Tga	p.R449*	CTD-3105H18.13_ENST00000563695.2_lincRNA|ZNF442_ENST00000438182.1_Nonsense_Mutation_p.R380*	NM_030824.2	NP_110451.1	Q9H7R0	ZN442_HUMAN	zinc finger protein 442	449					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(8)|lung(8)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	31						TCATGTCTTCGAAGGGAACTA	0.368																																																	0								G	stop/ARG	0,4406		0,0,2203	70.0	75.0	73.0		1345	-0.5	0.0	19		73	1,8599	1.2+/-3.3	0,1,4299	no	stop-gained	ZNF442	NM_030824.2		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		449/628	12461054	1,13005	2203	4300	6503	SO:0001587	stop_gained	79973			AK024418	CCDS12271.1	19p13.13	2013-01-08			ENSG00000198342	ENSG00000198342		"""Zinc fingers, C2H2-type"", ""-"""	20877	protein-coding gene	gene with protein product							Standard	NM_030824		Approved	FLJ14356	uc002mtr.1	Q9H7R0	OTTHUMG00000156411	ENST00000242804.4:c.1345C>T	19.37:g.12461054G>A	ENSP00000242804:p.Arg449*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DJ48	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R449*	ENST00000242804.4	37	c.1345	CCDS12271.1	19	.	.	.	.	.	.	.	.	.	.	G	14.67	2.606178	0.46527	0.0	1.16E-4	ENSG00000198342	ENST00000242804;ENST00000438182	.	.	.	0.832	-0.474	0.12108	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.06236	T	0.91	.	2.8609	0.05586	0.0:0.3092:0.3809:0.3099	.	.	.	.	X	449;380	.	ENSP00000242804:R449X	R	-	1	2	ZNF442	12322054	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-1.609000	0.02066	-0.114000	0.11936	0.313000	0.20887	CGA	ZNF442	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.368	ZNF442-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF442	HGNC	protein_coding	OTTHUMT00000344109.1	G	NM_030824		12461054	-1	no_errors	ENST00000242804	ensembl	human	known	70_37	nonsense	SNP	0.001	A
ZNF529	57711	genome.wustl.edu	37	19	37039059	37039059	+	Missense_Mutation	SNP	G	G	A			TCGA-DS-A7WI-01A-12D-A351-09	TCGA-DS-A7WI-10A-01D-A351-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	4167b53e-960b-412e-b556-4fe236a9c990	e8d9f25c-40cd-4e8c-943b-5f44a8284476	g.chr19:37039059G>A	ENST00000591340.1	-	5	559	c.401C>T	c.(400-402)cCt>cTt	p.P134L	ZNF529_ENST00000334116.7_Missense_Mutation_p.P29L	NM_020951.4	NP_066002.3	Q6P280	ZN529_HUMAN	zinc finger protein 529	134					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1	Esophageal squamous(110;0.198)					TCCCACTTCAGGTCCTTGTAA	0.398																																																	0													105.0	91.0	95.0					19																	37039059		1868	4097	5965	SO:0001583	missense	57711			AK025110	CCDS54256.1	19q13.13	2014-08-22			ENSG00000186020	ENSG00000186020		"""Zinc fingers, C2H2-type"", ""-"""	29328	protein-coding gene	gene with protein product						10997877	Standard	NM_020951		Approved	KIAA1615	uc002oeh.4	Q6P280	OTTHUMG00000180714	ENST00000591340.1:c.401C>T	19.37:g.37039059G>A	ENSP00000465578:p.Pro134Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	K7EKE1|Q9H731|Q9HCF7	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.P134L	ENST00000591340.1	37	c.401	CCDS54256.1	19	.	.	.	.	.	.	.	.	.	.	G	12.74	2.028078	0.35797	.	.	ENSG00000186020	ENST00000334116	.	.	.	3.83	0.0183	0.14116	.	.	.	.	.	T	0.25419	0.0618	N	0.24115	0.695	0.09310	N	1	B;B	0.27679	0.185;0.116	B;B	0.29716	0.106;0.033	T	0.25710	-1.0124	8	0.25106	T	0.35	.	6.3254	0.21240	0.0934:0.0:0.5869:0.3197	.	29;101	Q6P280-2;Q6P280	.;ZN529_HUMAN	L	134	.	ENSP00000334695:P134L	P	-	2	0	ZNF529	41730899	0.000000	0.05858	0.346000	0.25655	0.146000	0.21551	-0.287000	0.08388	0.265000	0.21872	0.591000	0.81541	CCT	ZNF529	-	NULL		0.398	ZNF529-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF529	HGNC	protein_coding	OTTHUMT00000452730.1	G	NM_020951		37039059	-1	no_errors	ENST00000591340	ensembl	human	known	70_37	missense	SNP	0.071	A
