#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ANKRD11	29123	genome.wustl.edu	37	16	89352026	89352026	+	Silent	SNP	G	G	A	rs373627320		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr16:89352026G>A	ENST00000301030.4	-	9	1384	c.924C>T	c.(922-924)ttC>ttT	p.F308F	ANKRD11_ENST00000378330.2_Silent_p.F308F	NM_001256183.1|NM_013275.5	NP_001243112.1|NP_037407.4	Q6UB99	ANR11_HUMAN	ankyrin repeat domain 11	308					bone development (GO:0060348)|face morphogenesis (GO:0060325)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|odontogenesis of dentin-containing tooth (GO:0042475)|skeletal system morphogenesis (GO:0048705)|tissue homeostasis (GO:0001894)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				breast(4)|central_nervous_system(3)|endometrium(17)|kidney(2)|large_intestine(18)|lung(20)|ovary(6)|pancreas(1)|prostate(2)|skin(6)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	83		all_hematologic(23;0.00824)|Colorectal(91;0.0475)		Epithelial(1;5.33e-11)|all cancers(4;2.6e-09)|OV - Ovarian serous cystadenocarcinoma(4;2.29e-07)|BRCA - Breast invasive adenocarcinoma(80;0.0142)		TGGAAGGTGCGAAGGATGGTG	0.577																																																	0								G		0,4396		0,0,2198	158.0	128.0	138.0		924	-4.2	0.7	16		138	2,8598	2.2+/-6.3	0,2,4298	no	coding-synonymous	ANKRD11	NM_013275.4		0,2,6496	AA,AG,GG		0.0233,0.0,0.0154		308/2664	89352026	2,12994	2198	4300	6498	SO:0001819	synonymous_variant	29123			AY373756	CCDS32513.1	16q24.3	2013-01-10				ENSG00000167522		"""Ankyrin repeat domain containing"""	21316	protein-coding gene	gene with protein product		611192				11483580	Standard	NM_001256182		Approved	LZ16, T13	uc002fnc.2	Q6UB99		ENST00000301030.4:c.924C>T	16.37:g.89352026G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6NTG1|Q6QMF8	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.F308	ENST00000301030.4	37	c.924	CCDS32513.1	16																																																																																			ANKRD11	-	NULL		0.577	ANKRD11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD11	HGNC	protein_coding	OTTHUMT00000430462.3	G	NM_013275		89352026	-1	no_errors	ENST00000301030	ensembl	human	known	70_37	silent	SNP	0.998	A
ATP13A4	84239	genome.wustl.edu	37	3	193272443	193272446	+	Intron	DEL	GTGT	GTGT	-	rs71879254|rs62287169|rs66654564|rs61326289|rs113367741|rs58073069|rs544456636	byFrequency	TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	GTGT	GTGT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr3:193272443_193272446delGTGT	ENST00000342695.4	-	1	383				ATP13A4_ENST00000295548.3_Intron|ATP13A4-AS1_ENST00000431512.1_RNA|ATP13A4-AS1_ENST00000426459.1_RNA|ATP13A4_ENST00000392443.3_Intron	NM_032279.2	NP_115655.2	Q4VNC1	AT134_HUMAN	ATPase type 13A4							integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|cation-transporting ATPase activity (GO:0019829)|metal ion binding (GO:0046872)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(9)|lung(27)|ovary(2)|prostate(3)|skin(11)|upper_aerodigestive_tract(2)	71	all_cancers(143;1.76e-08)|Ovarian(172;0.0386)		OV - Ovarian serous cystadenocarcinoma(49;2.72e-18)|LUSC - Lung squamous cell carcinoma(58;3.55e-06)|Lung(62;4.19e-06)	GBM - Glioblastoma multiforme(46;0.000109)		tgatgcgtgcgtgtgtgtgtgtgt	0.436																																																	0																																										SO:0001627	intron_variant	101929198			AK095277	CCDS3304.2	3q29	2010-04-20			ENSG00000127249	ENSG00000127249		"""ATPases / P-type"""	25422	protein-coding gene	gene with protein product		609556				14702039, 12975309	Standard	XM_005247829		Approved	DKFZp761I1011, FLJ37958	uc003ftd.3	Q4VNC1	OTTHUMG00000074067	ENST00000342695.4:c.60+82ACAC>-	3.37:g.193272451_193272454delGTGT		Somatic		WXS	Illumina HiSeq	Phase_IV	B7WPC7|Q6UY23|Q8N1Q9|Q9H043	RNA	DEL	-	NULL	ENST00000342695.4	37	NULL	CCDS3304.2	3																																																																																			ATP13A4-AS1	-	-		0.436	ATP13A4-003	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP13A4-AS1	HGNC	protein_coding	OTTHUMT00000157244.4	GTGT	NM_032279		193272446	+1	no_errors	ENST00000426459	ensembl	human	known	70_37	rna	DEL	0.004:0.003:0.002:0.001	-
ATP1A3	478	genome.wustl.edu	37	19	42479784	42479784	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:42479784C>T	ENST00000302102.5	-	16	2410	c.2260G>A	c.(2260-2262)Gag>Aag	p.E754K	ATP1A3_ENST00000545399.1_Missense_Mutation_p.E767K|ATP1A3_ENST00000543770.1_Missense_Mutation_p.E765K|ATP1A3_ENST00000602133.1_Missense_Mutation_p.E724K	NM_152296.4	NP_689509.1	P13637	AT1A3_HUMAN	ATPase, Na+/K+ transporting, alpha 3 polypeptide	754					adult locomotory behavior (GO:0008344)|ATP biosynthetic process (GO:0006754)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular potassium ion homeostasis (GO:0030007)|cellular response to steroid hormone stimulus (GO:0071383)|cellular sodium ion homeostasis (GO:0006883)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|memory (GO:0007613)|potassium ion import (GO:0010107)|response to drug (GO:0042493)|sodium ion export from cell (GO:0036376)|transmembrane transport (GO:0055085)|visual learning (GO:0008542)	axon (GO:0030424)|dendritic spine head (GO:0044327)|dendritic spine neck (GO:0044326)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|myelin sheath (GO:0043209)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)|synapse (GO:0045202)|vesicle (GO:0031982)	ATP binding (GO:0005524)|chaperone binding (GO:0051087)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)|steroid hormone binding (GO:1990239)			NS(1)|breast(2)|endometrium(7)|kidney(2)|large_intestine(11)|liver(1)|lung(19)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)	52						AACTCACCCTCCTCCACCCCT	0.642																																																	0													84.0	61.0	69.0					19																	42479784		2203	4300	6503	SO:0001583	missense	478				CCDS12594.1, CCDS58663.1, CCDS58664.1	19q13.2	2012-10-22			ENSG00000105409	ENSG00000105409	3.6.3.9	"""ATPases / P-type"""	801	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-3"", ""sodium pump subunit alpha-3"", ""sodium-potassium ATPase catalytic subunit alpha-3"""	182350	"""dystonia 12"""	DYT12		17282997	Standard	NM_152296		Approved		uc002osh.4	P13637	OTTHUMG00000137384	ENST00000302102.5:c.2260G>A	19.37:g.42479784C>T	ENSP00000302397:p.Glu754Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2T0|B7Z401|F5H6J6|Q16732|Q16735|Q969K5	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.E754K	ENST00000302102.5	37	c.2260	CCDS12594.1	19	.	.	.	.	.	.	.	.	.	.	C	17.56	3.420549	0.62622	.	.	ENSG00000105409	ENST00000302102;ENST00000441343;ENST00000545399;ENST00000368080;ENST00000535899;ENST00000543770	D;D;D;D	0.95756	-3.69;-3.8;-3.7;-3.69	4.31	4.31	0.51392	ATPase, P-type,  transmembrane domain (1);	0.000000	0.85682	D	0.000000	D	0.98128	0.9382	H	0.96460	3.825	0.80722	D	1	D;B;P;B	0.53619	0.961;0.097;0.468;0.024	P;B;P;B	0.60236	0.871;0.316;0.46;0.168	D	0.99110	1.0846	10	0.87932	D	0	.	14.7003	0.69152	0.0:1.0:0.0:0.0	.	767;765;754;754	B7Z2T0;F5H6J6;E9PC51;P13637	.;.;.;AT1A3_HUMAN	K	754;754;767;724;498;765	ENSP00000302397:E754K;ENSP00000411503:E754K;ENSP00000444688:E767K;ENSP00000437577:E765K	ENSP00000302397:E754K	E	-	1	0	ATP1A3	47171624	1.000000	0.71417	0.993000	0.49108	0.317000	0.28152	7.625000	0.83145	2.409000	0.81822	0.462000	0.41574	GAG	ATP1A3	-	tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr		0.642	ATP1A3-001	KNOWN	basic|CCDS	protein_coding	ATP1A3	HGNC	protein_coding	OTTHUMT00000268107.1	C	NM_152296		42479784	-1	no_errors	ENST00000302102	ensembl	human	known	70_37	missense	SNP	1.000	T
ATP1A4	480	genome.wustl.edu	37	1	160124943	160124943	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:160124943G>A	ENST00000368081.4	+	3	787	c.316G>A	c.(316-318)Gga>Aga	p.G106R		NM_144699.3	NP_653300.2	Q13733	AT1A4_HUMAN	ATPase, Na+/K+ transporting, alpha 4 polypeptide	106					ATP biosynthetic process (GO:0006754)|ATP hydrolysis coupled proton transport (GO:0015991)|fertilization (GO:0009566)|ion transmembrane transport (GO:0034220)|potassium ion transport (GO:0006813)|regulation of cellular pH (GO:0030641)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|sodium:potassium-exchanging ATPase complex (GO:0005890)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|sodium:potassium-exchanging ATPase activity (GO:0005391)			breast(3)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(16)|lung(34)|ovary(2)|prostate(4)|skin(5)|upper_aerodigestive_tract(1)|urinary_tract(2)	75	all_cancers(52;2.56e-18)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.111)			GCAACTGTTCGGAGGCTTCTC	0.512																																																	0													87.0	85.0	86.0					1																	160124943		2203	4300	6503	SO:0001583	missense	480			BC028297	CCDS1197.1, CCDS44255.1	1q23.2	2012-10-22	2002-02-25		ENSG00000132681	ENSG00000132681		"""ATPases / P-type"""	14073	protein-coding gene	gene with protein product	"""sodium/potassium-transporting ATPase subunit alpha-4"", ""sodium pump subunit alpha-4"", ""sodium-potassium ATPase catalytic subunit alpha-4"""	607321	"""ATPase, Na+/K+ transporting, alpha polypeptide-like 2"""	ATP1AL2		1981991, 3035563	Standard	NM_144699		Approved		uc001fve.4	Q13733	OTTHUMG00000031609	ENST00000368081.4:c.316G>A	1.37:g.160124943G>A	ENSP00000357060:p.Gly106Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q504T2|Q7Z4I9|Q8TBN8|Q8WXA7|Q8WXH7|Q8WY13	Missense_Mutation	SNP	pfam_ATPase_P-typ_ATPase-assoc-dom,pfam_ATPase_P-typ_cation-transptr_C,pfam_Dehalogen-like_hydro,pfam_ATPase_P-typ_cation-transptr_N,superfamily_ATPase_cation_domN,superfamily_HAD-like_dom,smart_ATPase_P-typ_cation-transptr_N,prints_ATPase_P-typ_cation-exchng_asu,prints_ATPase_P-typ_ion-transptr,tigrfam_ATPase_P-typ_cation-ex_asu_euk,tigrfam_ATPase_P-typ_ion-transptr	p.G106R	ENST00000368081.4	37	c.316	CCDS1197.1	1	.	.	.	.	.	.	.	.	.	.	G	17.88	3.497335	0.64186	.	.	ENSG00000132681	ENST00000368081	T	0.78707	-1.2	4.48	3.57	0.40892	ATPase, P-type cation-transporter, N-terminal (2);	0.060029	0.64402	D	0.000004	D	0.88396	0.6425	H	0.96460	3.825	0.80722	D	1	D	0.76494	0.999	D	0.74674	0.984	D	0.90213	0.4266	10	0.87932	D	0	.	10.0471	0.42192	0.0988:0.0:0.9012:0.0	.	106	Q13733	AT1A4_HUMAN	R	106	ENSP00000357060:G106R	ENSP00000357060:G106R	G	+	1	0	ATP1A4	158391567	1.000000	0.71417	0.225000	0.23894	0.550000	0.35303	6.536000	0.73842	1.098000	0.41479	0.655000	0.94253	GGA	ATP1A4	-	pfam_ATPase_P-typ_cation-transptr_N,smart_ATPase_P-typ_cation-transptr_N,tigrfam_ATPase_P-typ_cation-ex_asu_euk		0.512	ATP1A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP1A4	HGNC	protein_coding	OTTHUMT00000077415.1	G	NM_144699		160124943	+1	no_errors	ENST00000368081	ensembl	human	known	70_37	missense	SNP	0.989	A
ATP6AP1	537	genome.wustl.edu	37	X	153657145	153657145	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:153657145C>T	ENST00000369762.2	+	1	168	c.107C>T	c.(106-108)gCg>gTg	p.A36V		NM_001183.4	NP_001174.2	Q15904	VAS1_HUMAN	ATPase, H+ transporting, lysosomal accessory protein 1	36					ATP hydrolysis coupled proton transport (GO:0015991)|establishment of organelle localization (GO:0051656)|pH reduction (GO:0045851)|positive regulation of bone resorption (GO:0045780)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of exocytosis (GO:0045921)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of osteoclast development (GO:2001206)|proton transport (GO:0015992)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|proton-transporting two-sector ATPase complex (GO:0016469)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuole (GO:0005773)	ATP binding (GO:0005524)|proton-transporting ATP synthase activity, rotational mechanism (GO:0046933)|proton-transporting ATPase activity, rotational mechanism (GO:0046961)|Rab GTPase binding (GO:0017137)|transporter activity (GO:0005215)			breast(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(5)	14	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					gcggcggcggcggcggcggca	0.756											OREG0003604	type=REGULATORY REGION|Gene=BC009467|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													3.0	6.0	5.0					X																	153657145		1058	2204	3262	SO:0001583	missense	537			D16469	CCDS35451.1	Xq28	2010-03-10	2003-08-28	2003-08-29	ENSG00000071553	ENSG00000071553			868	protein-coding gene	gene with protein product		300197	"""ATPase, H+ transporting, lysosomal (vacuolar proton pump), subunit 1"""	ATP6S1, ATP6IP1		8733135, 8281148	Standard	NM_001183		Approved	ORF, XAP-3, VATPS1, 16A, Ac45, XAP3, CF2	uc004flf.1	Q15904	OTTHUMG00000033291	ENST00000369762.2:c.107C>T	X.37:g.153657145C>T	ENSP00000358777:p.Ala36Val	Somatic	1757	WXS	Illumina HiSeq	Phase_IV	A6ZKI4|Q8NBT4|Q9H0C7	Missense_Mutation	SNP	pfam_BIG/ATPase_V1_suS1	p.A36V	ENST00000369762.2	37	c.107	CCDS35451.1	X	.	.	.	.	.	.	.	.	.	.	c	10.89	1.479698	0.26511	.	.	ENSG00000071553	ENST00000369762;ENST00000422890;ENST00000449556	.	.	.	5.17	-2.81	0.05805	.	0.522077	0.19584	N	0.110779	T	0.23532	0.0569	L	0.38175	1.15	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.26018	-1.0115	9	0.14252	T	0.57	-2.3347	6.2774	0.20989	0.1444:0.2443:0.0:0.6113	.	36	Q15904	VAS1_HUMAN	V	36	.	ENSP00000358777:A36V	A	+	2	0	ATP6AP1	153310339	0.002000	0.14202	0.000000	0.03702	0.003000	0.03518	1.037000	0.30241	-1.038000	0.03279	-0.305000	0.09177	GCG	ATP6AP1	-	NULL		0.756	ATP6AP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ATP6AP1	HGNC	protein_coding	OTTHUMT00000081639.4	C	NM_001183		153657145	+1	no_errors	ENST00000369762	ensembl	human	known	70_37	missense	SNP	0.000	T
BAI2	576	genome.wustl.edu	37	1	32221619	32221619	+	Silent	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:32221619G>A	ENST00000373658.3	-	4	1160	c.819C>T	c.(817-819)ttC>ttT	p.F273F	BAI2_ENST00000527361.1_Silent_p.F273F|BAI2_ENST00000398547.1_Silent_p.F261F|BAI2_ENST00000398556.3_Silent_p.F276F|BAI2_ENST00000257070.4_Silent_p.F273F|BAI2_ENST00000373655.2_Silent_p.F273F|BAI2_ENST00000398538.1_Silent_p.F261F|BAI2_ENST00000398542.1_Silent_p.F261F|MIR4254_ENST00000581063.1_RNA	NM_001703.2	NP_001694.2	O60241	BAI2_HUMAN	brain-specific angiogenesis inhibitor 2	273					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)|peripheral nervous system development (GO:0007422)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(5)|central_nervous_system(2)|endometrium(1)|large_intestine(7)|liver(2)|lung(24)|ovary(7)|pancreas(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	55		Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0606)|all_neural(195;0.0837)|Breast(348;0.174)		STAD - Stomach adenocarcinoma(196;0.0557)		TCTCGGTTGTGAACAGATCAT	0.652																																																	0													65.0	69.0	68.0					1																	32221619		2203	4300	6503	SO:0001819	synonymous_variant	576			AB005298	CCDS72746.1, CCDS72747.1	1p35	2014-08-08			ENSG00000121753	ENSG00000121753		"""-"", ""GPCR / Class B : Orphans"""	944	protein-coding gene	gene with protein product		602683				9533023	Standard	XM_006710783		Approved		uc001btn.3	O60241	OTTHUMG00000003885	ENST00000373658.3:c.819C>T	1.37:g.32221619G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B9EGK9|Q5T6K0|Q8NGW8|Q96GZ9	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.F273	ENST00000373658.3	37	c.819	CCDS346.2	1																																																																																			BAI2	-	NULL		0.652	BAI2-015	KNOWN	basic|CCDS	protein_coding	BAI2	HGNC	protein_coding	OTTHUMT00000381838.1	G	NM_001703		32221619	-1	no_errors	ENST00000373658	ensembl	human	known	70_37	silent	SNP	1.000	A
C12orf42	374470	genome.wustl.edu	37	12	103872172	103872172	+	Missense_Mutation	SNP	T	T	A	rs10778257	byFrequency	TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr12:103872172T>A	ENST00000378113.2	-	2	258	c.33A>T	c.(31-33)gaA>gaT	p.E11D	C12orf42_ENST00000548048.1_De_novo_Start_OutOfFrame|C12orf42_ENST00000548883.1_Missense_Mutation_p.E11D|C12orf42_ENST00000315192.8_Missense_Mutation_p.E11D|C12orf42_ENST00000548789.1_5'UTR	NM_001099336.1	NP_001092806.1	Q96LP6	CL042_HUMAN	chromosome 12 open reading frame 42	11			E -> D (in dbSNP:rs10778257). {ECO:0000269|PubMed:14702039, ECO:0000269|PubMed:15489334}.							NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(7)|ovary(2)|prostate(1)	22						AGAATTCTTCTTCCCTTTGTT	0.333																																																	0													144.0	130.0	135.0					12																	103872172		1857	4089	5946	SO:0001583	missense	374470			AK058052	CCDS44963.1	12q23.2	2012-05-30			ENSG00000179088	ENSG00000179088			24729	protein-coding gene	gene with protein product							Standard	NM_001099336		Approved	FLJ25323	uc001tjt.2	Q96LP6	OTTHUMG00000169988	ENST00000378113.2:c.33A>T	12.37:g.103872172T>A	ENSP00000367353:p.Glu11Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A64|Q4G0S2	Missense_Mutation	SNP	NULL	p.E11D	ENST00000378113.2	37	c.33	CCDS44963.1	12	.	.	.	.	.	.	.	.	.	.	T	12.78	2.041227	0.35989	.	.	ENSG00000179088	ENST00000315192;ENST00000548883;ENST00000378113;ENST00000552578	T;T;T;T	0.53640	0.61;1.27;1.27;1.25	3.44	-0.6	0.11642	.	.	.	.	.	T	0.24005	0.0581	N	0.14661	0.345	0.80722	P	0.0	B	0.28552	0.215	B	0.26693	0.072	T	0.18209	-1.0344	8	0.39692	T	0.17	-8.3748	2.6914	0.05122	0.1934:0.2294:0.0:0.5773	.	11	Q96LP6	CL042_HUMAN	D	11	ENSP00000324984:E11D;ENSP00000447908:E11D;ENSP00000367353:E11D;ENSP00000447795:E11D	ENSP00000324984:E11D	E	-	3	2	C12orf42	102396302	0.004000	0.15560	0.002000	0.10522	0.013000	0.08279	0.051000	0.14141	-0.099000	0.12263	0.459000	0.35465	GAA	C12orf42	-	NULL		0.333	C12orf42-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf42	HGNC	protein_coding	OTTHUMT00000406754.1	T	NM_198521		103872172	-1	no_errors	ENST00000378113	ensembl	human	known	70_37	missense	SNP	0.003	A
C1QTNF9B	387911	genome.wustl.edu	37	13	24471170	24471170	+	5'UTR	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr13:24471170G>A	ENST00000382137.3	-	0	24				C1QTNF9B_ENST00000382140.2_Intron|C1QTNF9B_ENST00000382057.3_5'UTR|C1QTNF9B_ENST00000556521.1_5'UTR|C1QTNF9B-AS1_ENST00000417034.1_RNA|C1QTNF9B_ENST00000382145.1_Intron	NM_001007537.1	NP_001007538.1	B2RNN3	C1T9B_HUMAN	C1q and tumor necrosis factor related protein 9B							collagen trimer (GO:0005581)|extracellular vesicular exosome (GO:0070062)				breast(1)|central_nervous_system(1)|large_intestine(3)|lung(1)	6						CAGAAACCCAGAGGAGAAACC	0.532																																																	0													58.0	57.0	57.0					13																	24471170		2203	4300	6503	SO:0001623	5_prime_UTR_variant	542767			BC110413	CCDS31947.1	13q12.12	2011-05-08			ENSG00000205863	ENSG00000205863			34072	protein-coding gene	gene with protein product		614148				17544811	Standard	NM_001007537		Approved	CTRP9B	uc010tcv.1	B2RNN3	OTTHUMG00000016570	ENST00000382137.3:c.-45C>T	13.37:g.24471170G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A3T6|B9EH31|Q0VGC5|Q5VX65|Q5VX66|Q8IUU4	RNA	SNP	-	NULL	ENST00000382137.3	37	NULL	CCDS31947.1	13																																																																																			C1QTNF9B-AS1	-	-		0.532	C1QTNF9B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	C1QTNF9B-AS1	HGNC	protein_coding		G	NM_001007537		24471170	+1	no_errors	ENST00000417034	ensembl	human	known	70_37	rna	SNP	0.000	A
CACNA1B	774	genome.wustl.edu	37	9	140878595	140878595	+	Silent	SNP	C	C	T	rs200577707		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:140878595C>T	ENST00000371372.1	+	13	1807	c.1662C>T	c.(1660-1662)atC>atT	p.I554I	CACNA1B_ENST00000371357.1_Silent_p.I555I|CACNA1B_ENST00000277549.5_5'UTR|CACNA1B_ENST00000371363.1_Silent_p.I554I|CACNA1B_ENST00000371355.4_Silent_p.I555I|CACNA1B_ENST00000277551.2_Silent_p.I554I	NM_000718.3|NM_001243812.1	NP_000709.1|NP_001230741.1	Q00975	CAC1B_HUMAN	calcium channel, voltage-dependent, N type, alpha 1B subunit	554					calcium ion import (GO:0070509)|locomotory behavior (GO:0007626)|membrane depolarization (GO:0051899)|membrane depolarization during action potential (GO:0086010)|neurotransmitter secretion (GO:0007269)|regulation of blood pressure (GO:0008217)|regulation of calcium ion transport (GO:0051924)|regulation of heart contraction (GO:0008016)|response to pain (GO:0048265)|synaptic transmission (GO:0007268)|transport (GO:0006810)	dendrite (GO:0030425)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated calcium channel complex (GO:0005891)	ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|high voltage-gated calcium channel activity (GO:0008331)|protein C-terminus binding (GO:0008022)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(1)|endometrium(10)|kidney(2)|large_intestine(17)|lung(31)|ovary(1)|prostate(1)|skin(2)|stomach(2)|urinary_tract(2)	80	all_cancers(76;0.166)			OV - Ovarian serous cystadenocarcinoma(145;1.16e-05)|Epithelial(140;0.000476)	Amlodipine(DB00381)|Gabapentin(DB00996)|Levetiracetam(DB01202)|Spironolactone(DB00421)|Verapamil(DB00661)	TGCAGGTCATCGTGGGGAGCG	0.607																																																	0													73.0	88.0	83.0					9																	140878595		2134	4222	6356	SO:0001819	synonymous_variant	774			AB209467	CCDS59522.1, CCDS59523.1	9q34	2013-01-10	2007-02-16		ENSG00000148408	ENSG00000148408		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"", ""EF-hand domain containing"""	1389	protein-coding gene	gene with protein product		601012		CACNL1A5		8825650, 16382099	Standard	NM_000718		Approved	Cav2.2, CACNN	uc004cog.3	Q00975	OTTHUMG00000021002	ENST00000371372.1:c.1662C>T	9.37:g.140878595C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQK5	Silent	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,pfscan_EF_HAND_2,prints_VDCCAlpha1,prints_VDCC_N_a1su,prints_PKD_2	p.I555	ENST00000371372.1	37	c.1665	CCDS59522.1	9																																																																																			CACNA1B	-	pfam_Ion_trans_dom		0.607	CACNA1B-001	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1B	HGNC	protein_coding	OTTHUMT00000055380.1	C	NM_000718		140878595	+1	no_errors	ENST00000371355	ensembl	human	known	70_37	silent	SNP	0.304	T
CCDC105	126402	genome.wustl.edu	37	19	15132457	15132457	+	Missense_Mutation	SNP	G	G	A	rs267605313		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:15132457G>A	ENST00000292574.3	+	5	1153	c.1071G>A	c.(1069-1071)atG>atA	p.M357I		NM_173482.2	NP_775753.2	Q8IYK2	CC105_HUMAN	coiled-coil domain containing 105	357						extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(4)|skin(2)	23						TAGGACTGATGAGGGGAACTA	0.582																																																	0													85.0	84.0	84.0					19																	15132457		2203	4300	6503	SO:0001583	missense	126402			AK097684	CCDS12322.1	19p13.12	2008-02-05				ENSG00000160994			26866	protein-coding gene	gene with protein product						12477932	Standard	NM_173482		Approved	FLJ40365	uc002nae.2	Q8IYK2		ENST00000292574.3:c.1071G>A	19.37:g.15132457G>A	ENSP00000292574:p.Met357Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N7T5|Q8NDL5	Missense_Mutation	SNP	pfam_Tektin	p.M357I	ENST00000292574.3	37	c.1071	CCDS12322.1	19	.	.	.	.	.	.	.	.	.	.	G	6.169	0.399432	0.11696	.	.	ENSG00000160994	ENST00000292574	T	0.02216	4.39	3.91	2.8	0.32819	.	0.318671	0.25540	N	0.029976	T	0.02807	0.0084	M	0.63428	1.95	0.22737	N	0.998791	P	0.38978	0.652	B	0.37780	0.258	T	0.37957	-0.9683	10	0.12103	T	0.63	-27.2454	8.7699	0.34726	0.0:0.0:0.7763:0.2237	.	357	Q8IYK2	CC105_HUMAN	I	357	ENSP00000292574:M357I	ENSP00000292574:M357I	M	+	3	0	CCDC105	14993457	1.000000	0.71417	0.991000	0.47740	0.338000	0.28826	1.707000	0.37888	2.033000	0.60031	0.549000	0.68633	ATG	CCDC105	-	pfam_Tektin		0.582	CCDC105-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC105	HGNC	protein_coding	OTTHUMT00000466293.1	G	NM_173482		15132457	+1	no_errors	ENST00000292574	ensembl	human	known	70_37	missense	SNP	0.970	A
CCDC22	28952	genome.wustl.edu	37	X	49105663	49105663	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:49105663C>T	ENST00000376227.3	+	14	1745	c.1575C>T	c.(1573-1575)atC>atT	p.I525I		NM_014008.3	NP_054727.1	O60826	CCD22_HUMAN	coiled-coil domain containing 22	525										NS(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(5)|prostate(2)|skin(1)	18						AGAAGGAAATCAACTCCCTAT	0.597																																																	0													73.0	60.0	64.0					X																	49105663		2203	4300	6503	SO:0001819	synonymous_variant	28952			BC000972	CCDS14322.1	Xp11.23	2008-02-05	2005-07-24	2005-07-24	ENSG00000101997	ENSG00000101997			28909	protein-coding gene	gene with protein product		300859	"""chromosome X open reading frame 37"""	CXorf37		12477932	Standard	NM_014008		Approved	JM1	uc004dnd.2	O60826	OTTHUMG00000024141	ENST00000376227.3:c.1575C>T	X.37:g.49105663C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7G1	Silent	SNP	pfam_DUF812	p.I525	ENST00000376227.3	37	c.1575	CCDS14322.1	X																																																																																			CCDC22	-	pfam_DUF812		0.597	CCDC22-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC22	HGNC	protein_coding	OTTHUMT00000060822.1	C	NM_014008		49105663	+1	no_errors	ENST00000376227	ensembl	human	known	70_37	silent	SNP	1.000	T
CD47	961	genome.wustl.edu	37	3	107762289	107762289	+	3'UTR	DEL	A	A	-	rs201462458		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr3:107762289delA	ENST00000355354.7	-	0	4876				CD47_ENST00000471694.1_5'UTR	NM_198793.2	NP_942088.1	Q08722	CD47_HUMAN	CD47 molecule						blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|opsonization (GO:0008228)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of inflammatory response (GO:0050729)|positive regulation of phagocytosis (GO:0050766)|positive regulation of T cell activation (GO:0050870)|response to bacterium (GO:0009617)	extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	thrombospondin receptor activity (GO:0070053)			endometrium(1)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|urinary_tract(1)	9			OV - Ovarian serous cystadenocarcinoma(3;0.0191)|Epithelial(53;0.118)			TAATACATATAAAAAAAAAAA	0.269																																																	0																																										SO:0001624	3_prime_UTR_variant	961				CCDS43125.1, CCDS43126.1	3q13.1-q13.2	2013-01-11	2006-03-28		ENSG00000196776	ENSG00000196776		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1682	protein-coding gene	gene with protein product	"""antigen identified by monoclonal antibody 1D8"", ""antigenic surface determinant protein OA3"", ""integrin associated protein"", ""Rh-related antigen"", ""leukocyte surface antigen CD47"", ""CD47 glycoprotein"""	601028	"""CD47 antigen (Rh-related antigen, integrin-associated signal transducer)"""	MER6		8294396, 2277087	Standard	XM_005247908		Approved	IAP, OA3	uc003dwt.1	Q08722	OTTHUMG00000044216	ENST00000355354.7:c.*3842T>-	3.37:g.107762289delA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K198|D3DN59|Q53Y71|Q96A60	RNA	DEL	-	NULL	ENST00000355354.7	37	NULL	CCDS43125.1	3																																																																																			CD47	-	-		0.269	CD47-002	KNOWN	basic|appris_principal|CCDS	protein_coding	CD47	HGNC	protein_coding	OTTHUMT00000102791.1	A	NM_001777		107762289	-1	no_errors	ENST00000471694	ensembl	human	known	70_37	rna	DEL	0.021	-
CDH11	1009	genome.wustl.edu	37	16	64984907	64984907	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr16:64984907C>T	ENST00000268603.4	-	12	2272	c.1657G>A	c.(1657-1659)Gtg>Atg	p.V553M	CDH11_ENST00000394156.3_Missense_Mutation_p.V553M|CDH11_ENST00000566827.1_Missense_Mutation_p.V427M	NM_001797.2	NP_001788.2	P55287	CAD11_HUMAN	cadherin 11, type 2, OB-cadherin (osteoblast)	553	Cadherin 5. {ECO:0000255|PROSITE- ProRule:PRU00043}.				adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|corticospinal tract morphogenesis (GO:0021957)|homophilic cell adhesion (GO:0007156)|ossification (GO:0001503)|skeletal system development (GO:0001501)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(5)|kidney(5)|large_intestine(19)|lung(40)|ovary(3)|prostate(3)|skin(2)|urinary_tract(2)	88		Ovarian(137;0.0973)		OV - Ovarian serous cystadenocarcinoma(108;0.205)		CGGGCGTACACGCCTGCTGTG	0.592			T	USP6	aneurysmal bone cysts					TSP Lung(24;0.17)																														Dom	yes		16	16q22.1	1009	"""cadherin 11, type 2, OB-cadherin (osteoblast)"""		M	0													50.0	50.0	50.0					16																	64984907		2203	4300	6503	SO:0001583	missense	1009			D21255	CCDS10803.1	16q21	2010-01-26			ENSG00000140937	ENSG00000140937		"""Cadherins / Major cadherins"""	1750	protein-coding gene	gene with protein product	"""OB-Cadherin"""	600023				9615235	Standard	NM_001797		Approved	OB, CAD11	uc002eoi.3	P55287	OTTHUMG00000137494	ENST00000268603.4:c.1657G>A	16.37:g.64984907C>T	ENSP00000268603:p.Val553Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5D6|A8MZC8|B7WP28|Q15065|Q15066|Q9UQ93|Q9UQ94	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_cytoplasmic-dom,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.V553M	ENST00000268603.4	37	c.1657	CCDS10803.1	16	.	.	.	.	.	.	.	.	.	.	C	13.46	2.242815	0.39598	.	.	ENSG00000140937	ENST00000268603;ENST00000394156;ENST00000538390	T;T	0.62364	1.98;0.03	5.55	4.59	0.56863	Cadherin (3);Cadherin-like (1);	0.229969	0.45126	D	0.000381	T	0.68723	0.3032	M	0.73962	2.25	0.27581	N	0.949574	D;P	0.56521	0.976;0.947	P;B	0.51833	0.681;0.358	T	0.67130	-0.5748	10	0.87932	D	0	.	10.1408	0.42734	0.0:0.8475:0.0:0.1525	.	553;553	P55287-2;P55287	.;CAD11_HUMAN	M	553;553;536	ENSP00000268603:V553M;ENSP00000377711:V553M	ENSP00000268603:V553M	V	-	1	0	CDH11	63542408	0.091000	0.21658	0.138000	0.22173	0.084000	0.17831	0.485000	0.22324	2.594000	0.87642	0.655000	0.94253	GTG	CDH11	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.592	CDH11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CDH11	HGNC	protein_coding	OTTHUMT00000268755.1	C	NM_033664		64984907	-1	no_errors	ENST00000268603	ensembl	human	known	70_37	missense	SNP	0.320	T
CEACAM7	1087	genome.wustl.edu	37	19	42191081	42191081	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:42191081C>T	ENST00000006724.3	-	2	337	c.136G>A	c.(136-138)Gca>Aca	p.A46T	CEACAM7_ENST00000338196.4_Missense_Mutation_p.A46T|CEACAM7_ENST00000401731.1_Missense_Mutation_p.A46T|CEACAM7_ENST00000602225.1_Missense_Mutation_p.A46T|CEACAM7_ENST00000599715.1_5'UTR	NM_006890.3	NP_008821.1	Q14002	CEAM7_HUMAN	carcinoembryonic antigen-related cell adhesion molecule 7	46	Ig-like V-type.					anchored component of membrane (GO:0031225)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|endometrium(1)|large_intestine(3)|lung(6)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	18				OV - Ovarian serous cystadenocarcinoma(3;0.0027)|all cancers(3;0.00979)|Epithelial(262;0.0366)		TTCCCTTCTGCGACATTGAAC	0.478																																																	0													111.0	108.0	109.0					19																	42191081		2203	4300	6503	SO:0001583	missense	1087			X98311	CCDS12583.1	19q13.2	2013-01-29			ENSG00000007306	ENSG00000007306		"""Immunoglobulin superfamily / V-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	1819	protein-coding gene	gene with protein product	"""carcinoembryonic antigen gene family member 2"""			CGM2		7806520, 9135022	Standard	XM_005278379		Approved	CEA	uc002ori.1	Q14002	OTTHUMG00000151063	ENST00000006724.3:c.136G>A	19.37:g.42191081C>T	ENSP00000006724:p.Ala46Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K848|O15148|O15149|Q0VAC1|Q13983|Q9UPJ2	Missense_Mutation	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,pfscan_Ig-like	p.A46T	ENST00000006724.3	37	c.136	CCDS12583.1	19	.	.	.	.	.	.	.	.	.	.	C	14.23	2.474545	0.43942	.	.	ENSG00000007306	ENST00000006724;ENST00000412062;ENST00000401731;ENST00000338196	T;T;T	0.67865	-0.29;-0.29;-0.29	1.68	1.68	0.24146	Immunoglobulin subtype (1);Immunoglobulin V-set (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.74419	0.3714	M	0.77820	2.39	0.09310	N	1	P;D	0.55605	0.697;0.972	B;P	0.57152	0.181;0.814	T	0.61724	-0.7004	9	0.59425	D	0.04	.	6.8117	0.23809	0.0:1.0:0.0:0.0	.	46;46	Q14002-2;Q14002	.;CEAM7_HUMAN	T	46	ENSP00000006724:A46T;ENSP00000385932:A46T;ENSP00000343286:A46T	ENSP00000006724:A46T	A	-	1	0	CEACAM7	46882921	0.000000	0.05858	0.003000	0.11579	0.003000	0.03518	-0.014000	0.12656	1.235000	0.43724	0.313000	0.20887	GCA	CEACAM7	-	pfam_Ig_V-set,smart_Ig_sub		0.478	CEACAM7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEACAM7	HGNC	protein_coding	OTTHUMT00000321145.1	C	NM_006890		42191081	-1	no_errors	ENST00000006724	ensembl	human	known	70_37	missense	SNP	0.003	T
CIDEB	27141	genome.wustl.edu	37	14	24775181	24775181	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr14:24775181G>A	ENST00000336557.5	-	7	1801	c.499C>T	c.(499-501)Caa>Taa	p.Q167*	NOP9_ENST00000267425.3_3'UTR|CIDEB_ENST00000258807.5_Nonsense_Mutation_p.Q167*|LTB4R2_ENST00000528054.1_5'Flank|CIDEB_ENST00000554411.1_Nonsense_Mutation_p.Q167*			Q9UHD4	CIDEB_HUMAN	cell death-inducing DFFA-like effector b	167					apoptotic process (GO:0006915)|execution phase of apoptosis (GO:0097194)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|regulation of apoptotic process (GO:0042981)	cytosol (GO:0005829)|lipid particle (GO:0005811)	identical protein binding (GO:0042802)			NS(1)|endometrium(1)|kidney(1)|large_intestine(3)|urinary_tract(1)	7				GBM - Glioblastoma multiforme(265;0.0181)		CCAAGTCCTTGAAAGTCACAA	0.473																																																	0													125.0	124.0	124.0					14																	24775181		2203	4300	6503	SO:0001587	stop_gained	27141			AF190901	CCDS32056.1	14q12	2012-09-20			ENSG00000136305	ENSG00000136305			1977	protein-coding gene	gene with protein product		604441				10619428, 10837461	Standard	XM_005267540		Approved		uc001woo.3	Q9UHD4	OTTHUMG00000171555	ENST00000336557.5:c.499C>T	14.37:g.24775181G>A	ENSP00000337731:p.Gln167*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DS73|Q546V8|Q9NNW9	Nonsense_Mutation	SNP	pfam_CAD,smart_CAD,pfscan_CAD	p.Q167*	ENST00000336557.5	37	c.499	CCDS32056.1	14	.	.	.	.	.	.	.	.	.	.	G	38	7.000295	0.97994	.	.	ENSG00000136305	ENST00000554411;ENST00000336557;ENST00000258807;ENST00000541830	.	.	.	4.93	4.04	0.47022	.	0.119846	0.64402	D	0.000018	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.33141	T	0.24	-13.2752	7.8844	0.29642	0.0858:0.0:0.7536:0.1606	.	.	.	.	X	167	.	ENSP00000258807:Q167X	Q	-	1	0	CIDEB	23845021	1.000000	0.71417	0.897000	0.35233	0.984000	0.73092	3.339000	0.52135	1.322000	0.45245	0.563000	0.77884	CAA	CIDEB	-	NULL		0.473	CIDEB-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CIDEB	HGNC	protein_coding	OTTHUMT00000414120.1	G			24775181	-1	no_errors	ENST00000258807	ensembl	human	known	70_37	nonsense	SNP	0.977	A
COL4A5	1287	genome.wustl.edu	37	X	107920734	107920734	+	Silent	SNP	A	A	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:107920734A>T	ENST00000361603.2	+	42	4039	c.3795A>T	c.(3793-3795)ctA>ctT	p.L1265L	Y_RNA_ENST00000384417.1_RNA|COL4A5_ENST00000328300.6_Silent_p.L1271L	NM_000495.4	NP_000486.1	P29400	CO4A5_HUMAN	collagen, type IV, alpha 5	1265	Triple-helical region.				axon guidance (GO:0007411)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|neuromuscular junction development (GO:0007528)	basal lamina (GO:0005605)|collagen type IV trimer (GO:0005587)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|neuromuscular junction (GO:0031594)	extracellular matrix structural constituent (GO:0005201)	p.L1265L(1)		NS(1)|breast(2)|central_nervous_system(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(25)|lung(32)|ovary(4)|prostate(2)|skin(8)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(1)	99						ATTAAGGTCTACCAGGTCCAG	0.433									Alport syndrome with Diffuse Leiomyomatosis																																								1	Substitution - coding silent(1)	prostate(1)											105.0	89.0	94.0					X																	107920734		2203	4300	6503	SO:0001819	synonymous_variant	1287	Familial Cancer Database		M90464	CCDS14543.1, CCDS35366.1	Xq22	2014-09-17	2008-07-28		ENSG00000188153	ENSG00000188153		"""Collagens"""	2207	protein-coding gene	gene with protein product		303630	"""Alport syndrome"""	ASLN, ATS			Standard	NM_000495		Approved		uc004enz.2	P29400	OTTHUMG00000022182	ENST00000361603.2:c.3795A>T	X.37:g.107920734A>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16006|Q16126|Q6LD84|Q7Z700|Q9NUB7	Silent	SNP	pfam_Collagen,pfam_Collagen_VI_NC,superfamily_C-type_lectin_fold,smart_Collagen_VI_NC	p.L1271	ENST00000361603.2	37	c.3813	CCDS14543.1	X																																																																																			COL4A5	-	pfam_Collagen		0.433	COL4A5-001	KNOWN	basic|CCDS	protein_coding	COL4A5	HGNC	protein_coding	OTTHUMT00000057880.2	A			107920734	+1	no_errors	ENST00000328300	ensembl	human	known	70_37	silent	SNP	0.937	T
CPNE4	131034	genome.wustl.edu	37	3	131404727	131404727	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr3:131404727G>A	ENST00000512055.1	-	10	2709	c.583C>T	c.(583-585)Cga>Tga	p.R195*	CPNE4_ENST00000502818.1_Nonsense_Mutation_p.R213*|CPNE4_ENST00000512332.1_Nonsense_Mutation_p.R213*|CPNE4_ENST00000511604.1_Nonsense_Mutation_p.R195*|CPNE4_ENST00000429747.1_Nonsense_Mutation_p.R195*			Q96A23	CPNE4_HUMAN	copine IV	195	C2 2. {ECO:0000255|PROSITE- ProRule:PRU00041}.					extracellular vesicular exosome (GO:0070062)				central_nervous_system(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(7)|liver(1)|lung(16)|prostate(2)|skin(3)|upper_aerodigestive_tract(3)	39						ACCTCAGTTCGGTGCACCAGC	0.378																																																	0													83.0	77.0	79.0					3																	131404727		2203	4300	6503	SO:0001587	stop_gained	131034			H29499	CCDS3072.1, CCDS75010.1	3q22.1	2014-09-04			ENSG00000196353	ENSG00000196353			2317	protein-coding gene	gene with protein product	"""copine 8"""	604208				9430674, 12670487	Standard	XM_005247107		Approved	COPN4, CPN4	uc003eok.3	Q96A23	OTTHUMG00000159631	ENST00000512055.1:c.583C>T	3.37:g.131404727G>A	ENSP00000421705:p.Arg195*	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DNC5|Q8TEX1	Nonsense_Mutation	SNP	pfam_Copine,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_VWF_A,pfscan_C2_membr_targeting	p.R213*	ENST00000512055.1	37	c.637	CCDS3072.1	3	.	.	.	.	.	.	.	.	.	.	G	39	7.684566	0.98431	.	.	ENSG00000196353	ENST00000512055;ENST00000429747;ENST00000512332;ENST00000511604;ENST00000502818	.	.	.	5.81	3.7	0.42460	.	0.099589	0.64402	D	0.000003	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-11.5814	13.5274	0.61603	0.0:0.0:0.5128:0.4872	.	.	.	.	X	195;195;213;195;213	.	ENSP00000411904:R195X	R	-	1	2	CPNE4	132887417	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	2.939000	0.48995	1.300000	0.44818	0.638000	0.83543	CGA	CPNE4	-	pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,pfscan_C2_membr_targeting		0.378	CPNE4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPNE4	HGNC	protein_coding	OTTHUMT00000356583.4	G	NM_130808		131404727	-1	no_errors	ENST00000502818	ensembl	human	known	70_37	nonsense	SNP	1.000	A
CREBBP	1387	genome.wustl.edu	37	16	3779771	3779771	+	Silent	SNP	T	T	A	rs566062184	byFrequency	TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr16:3779771T>A	ENST00000262367.5	-	31	6086	c.5277A>T	c.(5275-5277)ccA>ccT	p.P1759P	CREBBP_ENST00000382070.3_Silent_p.P1721P	NM_004380.2	NP_004371.2	Q92793	CBP_HUMAN	CREB binding protein	1759	Interaction with TRERF1.				cellular lipid metabolic process (GO:0044255)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|embryonic digit morphogenesis (GO:0042733)|gene expression (GO:0010467)|germ-line stem cell maintenance (GO:0030718)|histone acetylation (GO:0016573)|homeostatic process (GO:0042592)|innate immune response (GO:0045087)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|Notch signaling pathway (GO:0007219)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|protein complex assembly (GO:0006461)|regulation of smoothened signaling pathway (GO:0008589)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|response to hypoxia (GO:0001666)|rhythmic process (GO:0048511)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)|viral process (GO:0016032)	condensed chromosome outer kinetochore (GO:0000940)|cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nuclear body (GO:0016604)|nuclear chromatin (GO:0000790)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|chromatin binding (GO:0003682)|core promoter proximal region sequence-specific DNA binding (GO:0000987)|histone acetyltransferase activity (GO:0004402)|MRF binding (GO:0043426)|p53 binding (GO:0002039)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|RNA polymerase II transcription factor binding transcription factor activity involved in negative regulation of transcription (GO:0001191)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|zinc ion binding (GO:0008270)			NS(1)|breast(5)|central_nervous_system(4)|cervix(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(125)|kidney(5)|large_intestine(32)|lung(43)|ovary(18)|pancreas(2)|prostate(6)|skin(9)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(5)|urinary_tract(21)	295		Ovarian(90;0.0266)		OV - Ovarian serous cystadenocarcinoma(1;3.54e-05)		TCTTTGACTGTGGCTCGCCCT	0.632			"""T, N, F, Mis, O"""	"""MLL, MORF, RUNXBP2"""	"""ALL, AML, DLBCL, B-NHL """		Rubinstein-Taybi syndrome																																	Dom/Rec	yes		16	16p13.3	1387	CREB binding protein (CBP)	yes	L	0													32.0	33.0	33.0					16																	3779771		2197	4299	6496	SO:0001819	synonymous_variant	1387			U85962	CCDS10509.1, CCDS45399.1	16p13.3	2011-07-01	2008-08-01		ENSG00000005339	ENSG00000005339		"""Chromatin-modifying enzymes / K-acetyltransferases"""	2348	protein-coding gene	gene with protein product		600140	"""Rubinstein-Taybi syndrome"""	RSTS		8413673	Standard	NM_001079846		Approved	RTS, CBP, KAT3A	uc002cvv.3	Q92793	OTTHUMG00000129431	ENST00000262367.5:c.5277A>T	16.37:g.3779771T>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUC9|O00147|Q16376|Q4LE28	Silent	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.P1759	ENST00000262367.5	37	c.5277	CCDS10509.1	16																																																																																			CREBBP	-	NULL		0.632	CREBBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CREBBP	HGNC	protein_coding	OTTHUMT00000251591.2	T	NM_004380		3779771	-1	no_errors	ENST00000262367	ensembl	human	known	70_37	silent	SNP	0.987	A
CSGALNACT2	55454	genome.wustl.edu	37	10	43650859	43650859	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr10:43650859G>C	ENST00000374466.3	+	2	597	c.262G>C	c.(262-264)Gaa>Caa	p.E88Q	CSGALNACT2_ENST00000374464.1_Missense_Mutation_p.E88Q	NM_018590.3	NP_061060.3	Q8N6G5	CGAT2_HUMAN	chondroitin sulfate N-acetylgalactosaminyltransferase 2	88					carbohydrate metabolic process (GO:0005975)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate metabolic process (GO:0030204)|chondroitin sulfate proteoglycan biosynthetic process (GO:0050650)|chondroitin sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050653)|dermatan sulfate proteoglycan biosynthetic process (GO:0050651)|dermatan sulfate proteoglycan biosynthetic process, polysaccharide chain biosynthetic process (GO:0050652)|glycosaminoglycan metabolic process (GO:0030203)|proteoglycan biosynthetic process (GO:0030166)|small molecule metabolic process (GO:0044281)	Golgi cisterna membrane (GO:0032580)|Golgi membrane (GO:0000139)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	acetylgalactosaminyltransferase activity (GO:0008376)|glucuronylgalactosylproteoglycan 4-beta-N-acetylgalactosaminyltransferase activity (GO:0047237)|metal ion binding (GO:0046872)			endometrium(12)|kidney(3)|large_intestine(5)|lung(16)|ovary(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	42						AGAATTACAAGAAATGAGTGA	0.428																																																	0													56.0	49.0	52.0					10																	43650859		2203	4300	6503	SO:0001583	missense	55454			AF116646	CCDS7201.1	10q11.21	2013-02-19			ENSG00000169826	ENSG00000169826		"""Beta 4-glycosyltransferases"""	24292	protein-coding gene	gene with protein product	"""chondroitin beta1,4 N-acetylgalactosaminyltransferase 2"""					12446672	Standard	NM_018590		Approved	GALNACT2, MGC40204, PRO0082, GALNACT-2	uc001jan.4	Q8N6G5	OTTHUMG00000018023	ENST00000374466.3:c.262G>C	10.37:g.43650859G>C	ENSP00000363590:p.Glu88Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWL7|Q6MZJ5|Q6MZP6|Q8TCH4|Q9P1I6	Missense_Mutation	SNP	pfam_Chond_GalNAc	p.E88Q	ENST00000374466.3	37	c.262	CCDS7201.1	10	.	.	.	.	.	.	.	.	.	.	G	15.28	2.786821	0.49997	.	.	ENSG00000169826	ENST00000374466;ENST00000374464	T;T	0.79653	2.53;-1.29	5.56	5.56	0.83823	.	0.041945	0.85682	D	0.000000	T	0.76478	0.3993	L	0.43701	1.375	0.80722	D	1	B;B	0.14805	0.011;0.011	B;B	0.20384	0.029;0.028	T	0.69139	-0.5224	10	0.20519	T	0.43	-13.6995	19.9019	0.96988	0.0:0.0:1.0:0.0	.	88;88	Q8N6G5;Q8N6G5-2	CGAT2_HUMAN;.	Q	88	ENSP00000363590:E88Q;ENSP00000363588:E88Q	ENSP00000363588:E88Q	E	+	1	0	CSGALNACT2	42970865	1.000000	0.71417	1.000000	0.80357	0.941000	0.58515	9.378000	0.97191	2.781000	0.95711	0.650000	0.86243	GAA	CSGALNACT2	-	pfam_Chond_GalNAc		0.428	CSGALNACT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CSGALNACT2	HGNC	protein_coding	OTTHUMT00000047693.1	G	NM_018590		43650859	+1	no_errors	ENST00000374466	ensembl	human	known	70_37	missense	SNP	1.000	C
CYTIP	9595	genome.wustl.edu	37	2	158300367	158300367	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:158300367G>A	ENST00000264192.3	-	1	287	c.166C>T	c.(166-168)Cga>Tga	p.R56*	CYTIP_ENST00000540637.1_Intron|AC019201.1_ENST00000401235.1_RNA|CYTIP_ENST00000497432.1_Intron	NM_004288.4	NP_004279.3	O60759	CYTIP_HUMAN	cytohesin 1 interacting protein	56					regulation of cell adhesion (GO:0030155)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|endosome (GO:0005768)|nucleus (GO:0005634)				breast(2)|central_nervous_system(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(1)|skin(2)	15						ACCTGCTTTCGTCCCCGAGGC	0.448																																																	0													143.0	123.0	130.0					2																	158300367		2203	4300	6503	SO:0001587	stop_gained	9595			L06633	CCDS2204.1	2q11.2	2011-09-08	2008-08-14	2008-08-19	ENSG00000115165	ENSG00000115165			9506	protein-coding gene	gene with protein product	"""cytohesin binding protein HE"", ""cytohesin binder and regulator"""	604448	"""pleckstrin homology, Sec7 and coiled-coil domains, binding protein"""	PSCDBP		18926288, 10343115, 11867758, 20530790, 21562043	Standard	NM_004288		Approved	B3-1, HE, CYBR, CASP, CYTHIP	uc002tzj.1	O60759	OTTHUMG00000154551	ENST00000264192.3:c.166C>T	2.37:g.158300367G>A	ENSP00000264192:p.Arg56*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DWH9|Q15630|Q8NE32	Nonsense_Mutation	SNP	pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.R56*	ENST00000264192.3	37	c.166	CCDS2204.1	2	.	.	.	.	.	.	.	.	.	.	G	20.2	3.951051	0.73787	.	.	ENSG00000115165	ENST00000264192;ENST00000439355;ENST00000435117	.	.	.	5.72	-2.46	0.06461	.	0.105877	0.41396	D	0.000883	.	.	.	.	.	.	0.53005	D	0.999966	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-7.5158	10.9116	0.47112	0.0:0.1909:0.2406:0.5684	.	.	.	.	X	56;21;21	.	ENSP00000264192:R56X	R	-	1	2	CYTIP	158008613	0.999000	0.42202	0.384000	0.26145	0.171000	0.22731	1.090000	0.30902	-0.963000	0.03600	-0.953000	0.02652	CGA	CYTIP	-	superfamily_PDZ		0.448	CYTIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYTIP	HGNC	protein_coding	OTTHUMT00000254926.1	G	NM_004288		158300367	-1	no_errors	ENST00000264192	ensembl	human	known	70_37	nonsense	SNP	0.591	A
DACH1	1602	genome.wustl.edu	37	13	72049919	72049919	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr13:72049919C>G	ENST00000359684.2	-	10	2094	c.2095G>C	c.(2095-2097)Gag>Cag	p.E699Q	DACH1_ENST00000354591.4_Missense_Mutation_p.E445Q|DACH1_ENST00000313174.7_Missense_Mutation_p.E499Q|DACH1_ENST00000305425.4_Missense_Mutation_p.E647Q			Q9UI36	DACH1_HUMAN	dachshund family transcription factor 1	699	Interaction with SIN3A. {ECO:0000250}.				cell proliferation (GO:0008283)|development of primary female sexual characteristics (GO:0046545)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation involved in contact inhibition (GO:0060244)|negative regulation of fibroblast proliferation (GO:0048147)|negative regulation of transcription by competitive promoter binding (GO:0010944)|respiratory gaseous exchange (GO:0007585)|suckling behavior (GO:0001967)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter sequence-specific DNA binding transcription factor activity involved in preinitiation complex assembly (GO:0001075)			NS(1)|breast(2)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(23)|ovary(1)|pancreas(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	41		Acute lymphoblastic leukemia(28;0.0503)|Breast(118;0.198)		GBM - Glioblastoma multiforme(99;0.00032)		GTCTCAAACTCAAGTGCTTCC	0.373																																																	0													300.0	278.0	285.0					13																	72049919		1887	4107	5994	SO:0001583	missense	1602			AJ005670	CCDS41899.1, CCDS53874.1, CCDS53873.1	13q22	2014-02-03	2014-02-03	2004-04-02	ENSG00000165659	ENSG00000276644			2663	protein-coding gene	gene with protein product		603803	"""dachshund homolog (Drosophila)"", ""dachshund homolog 1 (Drosophila)"""	DACH		9933575, 10395809, 15057823	Standard	NM_004392		Approved		uc021rkj.1	Q9UI36	OTTHUMG00000017063	ENST00000359684.2:c.2095G>C	13.37:g.72049919C>G	ENSP00000352712:p.Glu699Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D0FY35|D0FY36|O75523|O75687|Q5VYY3|Q5VYY4|Q96SG3|Q96SG4|Q9H524|Q9UMH4	Missense_Mutation	SNP	pfam_Transform_Ski,superfamily_DNA-bd_dom_put	p.E699Q	ENST00000359684.2	37	c.2095		13	.	.	.	.	.	.	.	.	.	.	C	29.2	4.982364	0.93044	.	.	ENSG00000165659	ENST00000305425;ENST00000313174;ENST00000354591;ENST00000359684;ENST00000377826	T;T;T;T	0.39592	1.13;1.18;1.15;1.07	5.35	5.35	0.76521	.	0.000000	0.85682	D	0.000000	T	0.64338	0.2589	M	0.64567	1.98	0.36190	D	0.849988	D;D;D	0.89917	0.996;0.997;1.0	D;D;D	0.91635	0.991;0.993;0.999	T	0.70230	-0.4929	10	0.59425	D	0.04	-12.5036	19.4158	0.94697	0.0:1.0:0.0:0.0	.	443;497;645	Q9UI36-4;Q9UI36-3;Q9UI36-2	.;.;.	Q	647;499;445;699;699	ENSP00000304994:E647Q;ENSP00000318506:E499Q;ENSP00000346604:E445Q;ENSP00000352712:E699Q	ENSP00000304994:E647Q	E	-	1	0	DACH1	70947920	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.593000	0.82686	2.662000	0.90505	0.655000	0.94253	GAG	DACH1	-	NULL		0.373	DACH1-002	KNOWN	not_organism_supported|basic	protein_coding	DACH1	HGNC	protein_coding	OTTHUMT00000045240.1	C	NM_004392		72049919	-1	no_errors	ENST00000359684	ensembl	human	known	70_37	missense	SNP	1.000	G
DCAF6	55827	genome.wustl.edu	37	1	168007719	168007719	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:168007719G>A	ENST00000312263.6	+	11	1693	c.1489G>A	c.(1489-1491)Gat>Aat	p.D497N	DCAF6_ENST00000367840.3_Missense_Mutation_p.D574N|DCAF6_ENST00000367843.3_Missense_Mutation_p.D517N|DCAF6_ENST00000432587.2_Missense_Mutation_p.D543N	NM_001017977.2	NP_001017977.1	Q58WW2	DCAF6_HUMAN	DDB1 and CUL4 associated factor 6	497					positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein ubiquitination (GO:0016567)	Cul4-RING E3 ubiquitin ligase complex (GO:0080008)|nucleus (GO:0005634)	ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(6)|kidney(3)|large_intestine(8)|lung(10)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	36						GAACTTTACAGATGAATGGTA	0.333																																																	0													83.0	81.0	82.0					1																	168007719		2203	4300	6503	SO:0001583	missense	55827			AL136738	CCDS1267.2, CCDS30933.1, CCDS55657.1, CCDS55658.1	1q23.3	2013-01-09	2009-07-17	2009-07-17	ENSG00000143164	ENSG00000143164		"""WD repeat domain containing"", ""DDB1 and CUL4 associated factors"""	30002	protein-coding gene	gene with protein product		610494	"""IQ motif and WD repeats 1"""	IQWD1		12032826	Standard	NM_018442		Approved	PC326	uc001gex.3	Q58WW2	OTTHUMG00000034572	ENST00000312263.6:c.1489G>A	1.37:g.168007719G>A	ENSP00000311949:p.Asp497Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A295|B4DNB8|Q7L8I0|Q8IXH3|Q8TB19	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_IQ_motif_EF-hand-BS,pfscan_WD40_repeat_dom	p.D574N	ENST00000312263.6	37	c.1720	CCDS30933.1	1	.	.	.	.	.	.	.	.	.	.	G	23.6	4.438872	0.83885	.	.	ENSG00000143164	ENST00000367843;ENST00000432587;ENST00000312263;ENST00000367840	T;T;T;T	0.30182	1.54;1.54;1.54;1.54	4.96	4.96	0.65561	WD40 repeat-like-containing domain (1);	0.000000	0.85682	D	0.000000	T	0.38904	0.1058	L	0.36672	1.1	0.44024	D	0.996743	D;D;D;D	0.89917	0.993;0.999;1.0;1.0	P;D;D;D	0.91635	0.823;0.98;0.982;0.999	T	0.20273	-1.0280	9	0.49607	T	0.09	.	18.5734	0.91145	0.0:0.0:1.0:0.0	.	543;574;497;517	B4DNB8;Q58WW2-3;Q58WW2;Q58WW2-2	.;.;DCAF6_HUMAN;.	N	517;543;497;574	ENSP00000356817:D517N;ENSP00000396238:D543N;ENSP00000311949:D497N;ENSP00000356814:D574N	ENSP00000311949:D497N	D	+	1	0	DCAF6	166274343	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.337000	0.79256	2.467000	0.83353	0.460000	0.39030	GAT	DCAF6	-	superfamily_WD40_repeat_dom		0.333	DCAF6-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	DCAF6	HGNC	protein_coding	OTTHUMT00000083661.2	G	NM_018442		168007719	+1	no_errors	ENST00000367840	ensembl	human	known	70_37	missense	SNP	1.000	A
DCHS2	54798	genome.wustl.edu	37	4	155225868	155225868	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr4:155225868G>A	ENST00000357232.4	-	17	4192	c.4193C>T	c.(4192-4194)tCt>tTt	p.S1398F		NM_017639.3	NP_060109.2	Q6V1P9	PCD23_HUMAN	dachsous cadherin-related 2	1398	Cadherin 12. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|central_nervous_system(1)|cervix(3)|endometrium(8)|kidney(5)|large_intestine(54)|lung(63)|ovary(4)|pancreas(1)|prostate(14)|skin(12)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(2)	176	all_hematologic(180;0.208)	Renal(120;0.0854)		LUSC - Lung squamous cell carcinoma(193;0.107)		ATCCATATCAGAGGCTAAAAC	0.373																																																	0													86.0	82.0	83.0					4																	155225868		2203	4300	6503	SO:0001583	missense	54798			BC140919	CCDS3785.1, CCDS47150.1	4q32.1	2014-06-04	2013-10-04	2004-09-03		ENSG00000197410		"""Cadherins / Cadherin-related"""	23111	protein-coding gene	gene with protein product	"""cadherin-related family member 7"""	612486	"""cadherin-like 27"", ""dachsous 2 (Drosophila)"""	CDH27, PCDH23		15003449	Standard	NM_017639		Approved	CDHJ, FLJ20047, PCDHJ, CDHR7	uc003inw.2	Q6V1P9		ENST00000357232.4:c.4193C>T	4.37:g.155225868G>A	ENSP00000349768:p.Ser1398Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RU14|E9PC11|Q4W5P9|Q6ZS61|Q9NXU8	Missense_Mutation	SNP	pfam_Cadherin,pfam_HTH_CenpB_DNA-bd_dom,superfamily_Cadherin-like,superfamily_Homeodomain-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.S1398F	ENST00000357232.4	37	c.4193	CCDS3785.1	4	.	.	.	.	.	.	.	.	.	.	G	2.281	-0.364722	0.05103	.	.	ENSG00000197410	ENST00000357232	T	0.53640	0.61	5.39	-0.117	0.13551	Cadherin (4);Cadherin-like (1);	0.577601	0.16124	N	0.228482	T	0.27063	0.0663	L	0.35341	1.055	0.09310	N	1	B	0.12630	0.006	B	0.12156	0.007	T	0.18840	-1.0324	10	0.10111	T	0.7	.	4.7021	0.12832	0.3177:0.0:0.4346:0.2477	.	1398	Q6V1P9	PCD23_HUMAN	F	1398	ENSP00000349768:S1398F	ENSP00000349768:S1398F	S	-	2	0	DCHS2	155445318	0.000000	0.05858	0.947000	0.38551	0.521000	0.34408	-0.150000	0.10189	0.234000	0.21139	-0.311000	0.09066	TCT	DCHS2	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.373	DCHS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCHS2	HGNC	protein_coding	OTTHUMT00000365281.2	G	NM_001142552		155225868	-1	no_errors	ENST00000357232	ensembl	human	known	70_37	missense	SNP	0.000	A
DCT	1638	genome.wustl.edu	37	13	95095858	95095858	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr13:95095858C>T	ENST00000377028.5	-	7	1626	c.1213G>A	c.(1213-1215)Gag>Aag	p.E405K	DCT_ENST00000446125.1_Missense_Mutation_p.E438K	NM_001922.3	NP_001913.2	P40126	TYRP2_HUMAN	dopachrome tautomerase	405					cell development (GO:0048468)|developmental pigmentation (GO:0048066)|epidermis development (GO:0008544)|melanin biosynthetic process from tyrosine (GO:0006583)|positive regulation of neuroblast proliferation (GO:0002052)|ventricular zone neuroblast division (GO:0021847)	cytosol (GO:0005829)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)	copper ion binding (GO:0005507)|dopachrome isomerase activity (GO:0004167)|oxidoreductase activity (GO:0016491)			NS(1)|breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(14)|liver(1)|lung(16)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(2)	50	all_neural(89;0.0684)|Medulloblastoma(90;0.163)	all_cancers(2;3.71e-42)|all_epithelial(2;3.76e-31)|all_lung(2;5.16e-14)|Lung NSC(4;1.33e-13)|Breast(118;0.0013)|Hepatocellular(115;0.00886)|Renal(2;0.00988)		COAD - Colon adenocarcinoma(199;7.07e-05)|GBM - Glioblastoma multiforme(99;0.000472)		TTCATCCACTCATCAAAGATG	0.453																																																	0													66.0	62.0	64.0					13																	95095858		2203	4300	6503	SO:0001583	missense	1638			D17547	CCDS9470.1, CCDS45060.1	13q32	2012-09-28	2012-09-28		ENSG00000080166	ENSG00000080166	5.3.3.12		2709	protein-coding gene	gene with protein product	"""dopachrome delta-isomerase"""	191275	"""tyrosine-related protein 2"""	TYRP2		8306979	Standard	NM_001922		Approved		uc010afh.3	P40126	OTTHUMG00000017206	ENST00000377028.5:c.1213G>A	13.37:g.95095858C>T	ENSP00000366227:p.Glu405Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q09GT4	Missense_Mutation	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.E438K	ENST00000377028.5	37	c.1312	CCDS9470.1	13	.	.	.	.	.	.	.	.	.	.	C	31	5.089131	0.94100	.	.	ENSG00000080166	ENST00000377021;ENST00000377028;ENST00000446125	D;D	0.99201	-5.21;-5.55	5.79	4.93	0.64822	Tyrosinase (2);Uncharacterised domain, di-copper centre (2);	0.161807	0.53938	D	0.000042	D	0.99023	0.9666	M	0.66506	2.035	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.997;0.999	D	0.99884	1.1118	10	0.25751	T	0.34	-21.3333	16.605	0.84826	0.0:0.8697:0.1303:0.0	.	438;405	Q09GT4;P40126	.;TYRP2_HUMAN	K	12;405;438	ENSP00000366227:E405K;ENSP00000392762:E438K	ENSP00000366220:E12K	E	-	1	0	DCT	93893859	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	4.015000	0.57152	1.394000	0.46624	0.650000	0.86243	GAG	DCT	-	superfamily_Unchr_di-copper_centre		0.453	DCT-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCT	HGNC	protein_coding	OTTHUMT00000045461.3	C			95095858	-1	no_errors	ENST00000446125	ensembl	human	known	70_37	missense	SNP	1.000	T
DNAH3	55567	genome.wustl.edu	37	16	20974837	20974837	+	Nonsense_Mutation	SNP	C	C	A	rs3743695	byFrequency	TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr16:20974837C>A	ENST00000261383.3	-	53	10368	c.10369G>T	c.(10369-10371)Gag>Tag	p.E3457*	DNAH3_ENST00000415178.1_3'UTR	NM_017539.1	NP_060009.1	Q8TD57	DYH3_HUMAN	dynein, axonemal, heavy chain 3	3457			E -> K (in dbSNP:rs3743695).		cilium or flagellum-dependent cell motility (GO:0001539)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)	axonemal dynein complex (GO:0005858)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(3)|autonomic_ganglia(1)|breast(12)|central_nervous_system(3)|cervix(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(4)|kidney(10)|large_intestine(42)|liver(2)|lung(57)|ovary(14)|pancreas(1)|prostate(7)|skin(11)|stomach(5)|upper_aerodigestive_tract(7)|urinary_tract(6)	202				GBM - Glioblastoma multiforme(48;0.207)		AGTTGCTCCTCATGGGGCCAG	0.542																																																	0													88.0	72.0	78.0					16																	20974837		2201	4300	6501	SO:0001587	stop_gained	55567			U83574	CCDS10594.1	16p12.2	2008-08-01	2006-09-04		ENSG00000158486	ENSG00000158486		"""Axonemal dyneins"""	2949	protein-coding gene	gene with protein product		603334	"""dynein, axonemal, heavy polypeptide 3"""			9256245, 9373155	Standard	NM_017539		Approved	Dnahc3b, DLP3, Hsadhc3, DKFZp434N074	uc010vbe.2	Q8TD57	OTTHUMG00000090677	ENST00000261383.3:c.10369G>T	16.37:g.20974837C>A	ENSP00000261383:p.Glu3457*	Somatic		WXS	Illumina HiSeq	Phase_IV	O00437|O15437|O43326|Q3C0H2|Q8WUP9|Q9UEM3|Q9UEM5|Q9UG35	Nonsense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,superfamily_Prefoldin,smart_AAA+_ATPase	p.E3457*	ENST00000261383.3	37	c.10369	CCDS10594.1	16	.	.	.	.	.	.	.	.	.	.	C	49	16.021316	0.99852	.	.	ENSG00000158486	ENST00000261383	.	.	.	5.39	4.43	0.53597	.	0.270020	0.34777	N	0.003683	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.07482	T	0.82	.	13.9519	0.64123	0.0:0.9266:0.0:0.0734	.	.	.	.	X	3457	.	ENSP00000261383:E3457X	E	-	1	0	DNAH3	20882338	0.966000	0.33281	0.225000	0.23894	0.456000	0.32438	2.627000	0.46469	1.259000	0.44117	0.563000	0.77884	GAG	DNAH3	-	pfam_Dynein_heavy_dom		0.542	DNAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DNAH3	HGNC	protein_coding	OTTHUMT00000207361.1	C	NM_017539		20974837	-1	no_errors	ENST00000261383	ensembl	human	known	70_37	nonsense	SNP	0.799	A
DPF3	8110	genome.wustl.edu	37	14	73238501	73238501	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr14:73238501G>A	ENST00000556509.1	-	2	132	c.133C>T	c.(133-135)Cag>Tag	p.Q45*	DPF3_ENST00000541685.1_Nonsense_Mutation_p.Q45*|DPF3_ENST00000546183.1_Nonsense_Mutation_p.Q55*	NM_001280542.1	NP_001267471.1	Q92784	DPF3_HUMAN	D4, zinc and double PHD fingers, family 3	45					chromatin modification (GO:0016568)|nervous system development (GO:0007399)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)	zinc ion binding (GO:0008270)			central_nervous_system(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(3)|lung(13)|ovary(1)	22				BRCA - Breast invasive adenocarcinoma(234;0.00649)|OV - Ovarian serous cystadenocarcinoma(108;0.0654)		ACCCCAGTCTGTGAGTCCAGG	0.607																																																	0													79.0	86.0	84.0					14																	73238501		2198	4300	6498	SO:0001587	stop_gained	8110			U43919	CCDS45133.1, CCDS61495.1, CCDS61496.1, CCDS61497.1	14q24.2	2014-05-13			ENSG00000205683	ENSG00000205683		"""Zinc fingers, PHD-type"""	17427	protein-coding gene	gene with protein product		601672				11845289, 8812431	Standard	NM_012074		Approved	cer-d4, Cerd4, FLJ14079, BAF45c	uc010ari.1	Q92784		ENST00000556509.1:c.133C>T	14.37:g.73238501G>A	ENSP00000450518:p.Gln45*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MSI3|B7Z276|F5H575|Q32UJ0|Q6P9E6|Q6ZT41|Q9H7Y5	Nonsense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.Q100*	ENST00000556509.1	37	c.298		14	.	.	.	.	.	.	.	.	.	.	g	38	6.767348	0.97825	.	.	ENSG00000205683	ENST00000540281;ENST00000556509;ENST00000398816;ENST00000541685;ENST00000546183	.	.	.	5.54	5.54	0.83059	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	19.5011	0.95095	0.0:0.0:1.0:0.0	.	.	.	.	X	45;45;44;45;55	.	ENSP00000381791:Q100X	Q	-	1	0	DPF3	72308254	1.000000	0.71417	0.999000	0.59377	0.987000	0.75469	9.851000	0.99511	2.619000	0.88677	0.651000	0.88453	CAG	DPF3	-	NULL		0.607	DPF3-004	NOVEL	basic|appris_principal|exp_conf	protein_coding	DPF3	HGNC	protein_coding	OTTHUMT00000413152.2	G			73238501	-1	no_errors	ENST00000366353	ensembl	human	known	70_37	nonsense	SNP	1.000	A
DUSP26	78986	genome.wustl.edu	37	8	33449681	33449681	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr8:33449681C>T	ENST00000256261.4	-	4	1003	c.486G>A	c.(484-486)ctG>ctA	p.L162L	DUSP26_ENST00000523956.1_Silent_p.L162L	NM_024025.1	NP_076930.1	Q9BV47	DUS26_HUMAN	dual specificity phosphatase 26 (putative)	162	Tyrosine-protein phosphatase.				negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of protein kinase activity by regulation of protein phosphorylation (GO:0044387)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|peptidyl-tyrosine dephosphorylation (GO:0035335)|positive regulation of cell adhesion (GO:0045785)|positive regulation of peptidyl-serine dephosphorylation (GO:1902310)|protein dephosphorylation (GO:0006470)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	p53 binding (GO:0002039)|phosphoprotein phosphatase activity (GO:0004721)|phosphoserine phosphatase activity (GO:0004647)|protein tyrosine phosphatase activity (GO:0004725)|protein tyrosine/serine/threonine phosphatase activity (GO:0008138)|RNA polymerase II activating transcription factor binding (GO:0001102)			NS(1)|breast(1)|kidney(1)|large_intestine(4)|lung(7)|skin(1)	15				KIRC - Kidney renal clear cell carcinoma(67;0.0918)|Kidney(114;0.111)		AGGCCAGTACCAGGGTGGCGG	0.577																																																	0													103.0	79.0	87.0					8																	33449681		2203	4300	6503	SO:0001819	synonymous_variant	78986			AY902194	CCDS6092.1	8p12	2014-09-09			ENSG00000133878	ENSG00000133878		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Atypical dual specificity phosphatases"""	28161	protein-coding gene	gene with protein product							Standard	NM_024025		Approved	MGC1136, DUSP24	uc003xjp.3	Q9BV47	OTTHUMG00000163961	ENST00000256261.4:c.486G>A	8.37:g.33449681C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DSV8|Q9BTW0	Silent	SNP	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat,prints_Atypical_DUSP_famA,prints_Atypical_DUSP	p.L162	ENST00000256261.4	37	c.486	CCDS6092.1	8																																																																																			DUSP26	-	pfam_Dual-sp_phosphatase_cat-dom,smart_Dual-sp_phosphatase_subgr_cat,pfscan_Tyr/Dual-specificity_Pase,pfscan_Dual-sp_phosphatase_subgr_cat		0.577	DUSP26-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DUSP26	HGNC	protein_coding	OTTHUMT00000376564.1	C	NM_024025		33449681	-1	no_errors	ENST00000256261	ensembl	human	known	70_37	silent	SNP	1.000	T
EHMT1	79813	genome.wustl.edu	37	9	140711934	140711934	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:140711934G>A	ENST00000460843.1	+	24	3445	c.3418G>A	c.(3418-3420)Gtg>Atg	p.V1140M		NM_024757.4	NP_079033.4	Q9H9B1	EHMT1_HUMAN	euchromatic histone-lysine N-methyltransferase 1	1140	SET. {ECO:0000255|PROSITE- ProRule:PRU00190}.				chromatin modification (GO:0016568)|DNA methylation (GO:0006306)|embryo development (GO:0009790)|histone methylation (GO:0016571)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine dimethylation (GO:0018027)|peptidyl-lysine monomethylation (GO:0018026)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	histone methyltransferase activity (H3-K27 specific) (GO:0046976)|histone methyltransferase activity (H3-K9 specific) (GO:0046974)|histone-lysine N-methyltransferase activity (GO:0018024)|methyltransferase activity (GO:0008168)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(2)|cervix(2)|endometrium(3)|kidney(2)|large_intestine(4)|lung(16)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	41	all_cancers(76;0.164)			OV - Ovarian serous cystadenocarcinoma(145;0.000183)|Epithelial(140;0.000728)		GGGCTGGGGCGTGCGGTCCCT	0.612																																																	0													82.0	81.0	81.0					9																	140711934		2203	4300	6503	SO:0001583	missense	79813			AY083210	CCDS7050.1, CCDS7050.2, CCDS56595.1	9q34.3	2013-09-20			ENSG00000181090	ENSG00000181090	2.1.1.43	"""Chromatin-modifying enzymes / K-methyltransferases"", ""Ankyrin repeat domain containing"""	24650	protein-coding gene	gene with protein product		607001	"""euchromatic histone methyltransferase 1"""			11347906, 12004135	Standard	NM_024757		Approved	Eu-HMTase1, FLJ12879, KIAA1876, bA188C12.1, KMT1D	uc011mfc.2	Q9H9B1	OTTHUMG00000020995	ENST00000460843.1:c.3418G>A	9.37:g.140711934G>A	ENSP00000417980:p.Val1140Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQ58|B1AQ59|Q86X08|Q8TCN7|Q96F53|Q96JF1|Q96KH4	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_SET_dom,pfam_Pre-SET_dom,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_Pre-SET_Zn-bd_sub,smart_SET_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_SET_dom,pfscan_Pre-SET_dom,prints_Ankyrin_rpt	p.V1140M	ENST00000460843.1	37	c.3418	CCDS7050.2	9	.	.	.	.	.	.	.	.	.	.	G	28.2	4.900408	0.92035	.	.	ENSG00000181090	ENST00000371400;ENST00000460843	D	0.85339	-1.97	4.55	4.55	0.56014	SET domain (3);	0.000000	0.85682	D	0.000000	D	0.93703	0.7988	M	0.90705	3.14	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.95223	0.8335	10	0.87932	D	0	.	17.3212	0.87236	0.0:0.0:1.0:0.0	.	1140	Q9H9B1	EHMT1_HUMAN	M	1109;1140	ENSP00000417980:V1140M	ENSP00000360453:V1109M	V	+	1	0	EHMT1	139831755	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.243000	0.95416	2.095000	0.63458	0.561000	0.74099	GTG	EHMT1	-	pfam_SET_dom,smart_SET_dom,pfscan_SET_dom		0.612	EHMT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EHMT1	HGNC	protein_coding	OTTHUMT00000055371.2	G	NM_024757		140711934	+1	no_errors	ENST00000460843	ensembl	human	known	70_37	missense	SNP	1.000	A
EMC2	9694	genome.wustl.edu	37	8	109498775	109498775	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr8:109498775C>T	ENST00000220853.3	+	11	877	c.842C>T	c.(841-843)tCt>tTt	p.S281F	EMC2_ENST00000520294.1_3'UTR	NM_014673.3	NP_055488.1	Q15006	EMC2_HUMAN	ER membrane protein complex subunit 2	281						cytoplasm (GO:0005737)|endoplasmic reticulum (GO:0005783)|ER membrane protein complex (GO:0072546)|mitochondrion (GO:0005739)|nucleus (GO:0005634)											ACCAAATATTCTCTTAAGGCT	0.338																																																	0													76.0	75.0	76.0					8																	109498775		2203	4300	6503	SO:0001583	missense	9694			BC021667	CCDS6309.1	8q23.2	2012-05-23	2012-05-23	2012-05-23	ENSG00000104412	ENSG00000104412			28963	protein-coding gene	gene with protein product		607722	"""tetratricopeptide repeat domain 35"""	KIAA0103, TTC35		7788527, 22119785	Standard	NM_014673		Approved		uc003ymw.1	Q15006	OTTHUMG00000164873	ENST00000220853.3:c.842C>T	8.37:g.109498775C>T	ENSP00000220853:p.Ser281Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUE1	Missense_Mutation	SNP	smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.S281F	ENST00000220853.3	37	c.842	CCDS6309.1	8	.	.	.	.	.	.	.	.	.	.	C	25.3	4.623958	0.87560	.	.	ENSG00000104412	ENST00000220853	.	.	.	5.95	5.95	0.96441	.	0.000000	0.85682	D	0.000000	T	0.70465	0.3227	L	0.60455	1.87	0.80722	D	1	D	0.56521	0.976	P	0.50708	0.648	T	0.70839	-0.4763	9	0.54805	T	0.06	-8.1432	20.3748	0.98911	0.0:1.0:0.0:0.0	.	281	Q15006	TTC35_HUMAN	F	281	.	ENSP00000220853:S281F	S	+	2	0	TTC35	109567951	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	6.760000	0.74939	2.817000	0.96982	0.563000	0.77884	TCT	EMC2	-	NULL		0.338	EMC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMC2	HGNC	protein_coding	OTTHUMT00000380717.1	C	NM_014673		109498775	+1	no_errors	ENST00000220853	ensembl	human	known	70_37	missense	SNP	1.000	T
EMILIN2	84034	genome.wustl.edu	37	18	2892200	2892200	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr18:2892200C>T	ENST00000254528.3	+	4	2234	c.2075C>T	c.(2074-2076)aCg>aTg	p.T692M		NM_032048.2	NP_114437.2	Q9BXX0	EMIL2_HUMAN	elastin microfibril interfacer 2	692					cell adhesion (GO:0007155)	collagen trimer (GO:0005581)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix constituent conferring elasticity (GO:0030023)			breast(2)|endometrium(5)|kidney(3)|large_intestine(8)|liver(2)|lung(16)|ovary(1)|prostate(1)|skin(5)|stomach(1)|urinary_tract(4)	48				READ - Rectum adenocarcinoma(2;0.1)		AAGGAATGCACGCAGGGGGTC	0.577																																																	0													103.0	109.0	107.0					18																	2892200		2203	4300	6503	SO:0001583	missense	84034			AF270513	CCDS11828.1	18p11.3	2008-02-05			ENSG00000132205	ENSG00000132205		"""EMI domain containing"""	19881	protein-coding gene	gene with protein product		608928					Standard	NM_032048		Approved	FLJ33200, FOAP-10	uc002kln.3	Q9BXX0	OTTHUMG00000128525	ENST00000254528.3:c.2075C>T	18.37:g.2892200C>T	ENSP00000254528:p.Thr692Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RMY3|Q8NBH3|Q96JQ4	Missense_Mutation	SNP	pfam_EMI_domain,pfam_C1q,superfamily_Tumour_necrosis_fac-like,smart_C1q,pfscan_C1q,pfscan_EMI_domain	p.T692M	ENST00000254528.3	37	c.2075	CCDS11828.1	18	.	.	.	.	.	.	.	.	.	.	C	2.165	-0.391175	0.04932	.	.	ENSG00000132205	ENST00000254528	T	0.34072	1.38	5.48	0.673	0.17941	.	1.012140	0.07909	N	0.973998	T	0.27278	0.0669	N	0.25426	0.745	0.09310	N	1	B	0.29531	0.247	B	0.26094	0.066	T	0.23190	-1.0195	10	0.44086	T	0.13	-1.9919	12.4774	0.55823	0.0:0.7032:0.0:0.2968	.	692	Q9BXX0	EMIL2_HUMAN	M	692	ENSP00000254528:T692M	ENSP00000254528:T692M	T	+	2	0	EMILIN2	2882200	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	0.676000	0.25247	-0.173000	0.10761	-1.155000	0.01812	ACG	EMILIN2	-	NULL		0.577	EMILIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EMILIN2	HGNC	protein_coding	OTTHUMT00000250337.2	C	NM_032048		2892200	+1	no_errors	ENST00000254528	ensembl	human	known	70_37	missense	SNP	0.000	T
ENO4	387712	genome.wustl.edu	37	10	118635637	118635637	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr10:118635637G>A	ENST00000409522.1	+	4	507	c.452G>A	c.(451-453)gGa>gAa	p.G151E	ENO4_ENST00000369207.2_Missense_Mutation_p.G233E|ENO4_ENST00000341276.5_Missense_Mutation_p.G471E			A6NNW6	ENO4_HUMAN	enolase family member 4	471					glycolytic process (GO:0006096)	phosphopyruvate hydratase complex (GO:0000015)	magnesium ion binding (GO:0000287)|phosphopyruvate hydratase activity (GO:0004634)			lung(1)	1						ATAATTGCAGGAACTGCTTCC	0.398																																																	0																																										SO:0001583	missense	387712				CCDS73206.1	10q25.3	2012-04-19	2009-12-15	2009-12-15	ENSG00000188316	ENSG00000188316			31670	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 134"""	C10orf134			Standard	NM_001242699		Approved	AC023283.3	uc021pzj.1	A6NNW6	OTTHUMG00000019113	ENST00000409522.1:c.452G>A	10.37:g.118635637G>A	ENSP00000387194:p.Gly151Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZN9	Missense_Mutation	SNP	pfam_Enolase_C,pfam_Enolase_N	p.G471E	ENST00000409522.1	37	c.1412		10	.	.	.	.	.	.	.	.	.	.	G	11.76	1.733991	0.30684	.	.	ENSG00000188316	ENST00000409522;ENST00000341276;ENST00000369207	T;T;T	0.48201	0.82;0.82;0.82	5.82	3.97	0.46021	.	0.189207	0.45126	N	0.000391	T	0.32194	0.0821	L	0.35288	1.05	0.42111	D	0.991389	B	0.27997	0.197	B	0.27796	0.083	T	0.15549	-1.0433	10	0.37606	T	0.19	-10.5809	5.5779	0.17233	0.3617:0.0:0.6383:0.0	.	151	A6NNW6-2	.	E	151;471;233	ENSP00000387194:G151E;ENSP00000345555:G471E;ENSP00000358208:G233E	ENSP00000345555:G471E	G	+	2	0	ENO4	118625627	0.997000	0.39634	0.889000	0.34880	0.966000	0.64601	3.122000	0.50446	1.458000	0.47871	-0.140000	0.14226	GGA	ENO4	-	pfam_Enolase_C		0.398	ENO4-002	PUTATIVE	basic|exp_conf	protein_coding	ENO4	HGNC	protein_coding	OTTHUMT00000331643.1	G	NM_001242699		118635637	+1	no_errors	ENST00000341276	ensembl	human	known	70_37	missense	SNP	0.939	A
AC008079.9	0	genome.wustl.edu	37	22	18668923	18668923	+	RNA	SNP	G	G	A	rs545692386	byFrequency	TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr22:18668923G>A	ENST00000434390.1	-	0	474																											CGGCGTCCTCGTTGGCGATGC	0.736													g|||	5	0.000998403	0.003	0.0	5008	,	,		15502	0.0		0.0	False		,,,				2504	0.001																0																																												0																															22.37:g.18668923G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000434390.1	37	NULL		22																																																																																			AC008079.9	-	-		0.736	AC008079.9-001	KNOWN	basic	antisense	ENSG00000187979	Clone_based_vega_gene	antisense	OTTHUMT00000316367.2	G			18668923	-1	no_errors	ENST00000440673	ensembl	human	known	70_37	rna	SNP	0.888	A
PLET1	349633	genome.wustl.edu	37	11	112118607	112118608	+	IGR	INS	-	-	AC	rs536125023	byFrequency	TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:112118607_112118608insAC	ENST00000338832.2	-	0	1541				AP002884.1_ENST00000401135.1_RNA	NM_001145024.1	NP_001138496.1	Q6UQ28	PLET1_HUMAN							cell differentiation (GO:0030154)|negative regulation of cell-matrix adhesion (GO:0001953)|positive regulation of cell migration (GO:0030335)|wound healing, spreading of epidermal cells (GO:0035313)	anchored component of membrane (GO:0031225)|apical plasma membrane (GO:0016324)|external side of plasma membrane (GO:0009897)				endometrium(2)	2						tatatgtatatATacacacaca	0.347																																																	0																																										SO:0001628	intergenic_variant	0																															11.37:g.112118607_112118608insAC		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UQ24|Q6UQ25|Q6UQ27	RNA	INS	-	NULL	ENST00000338832.2	37	NULL		11																																																																																			AP002884.1	-	-		0.347	C11orf34-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000215954	Clone_based_ensembl_gene	protein_coding		-			112118608	+1	no_errors	ENST00000401135	ensembl	human	novel	70_37	rna	INS	0.058:0.053	AC
LINC00937	389634	genome.wustl.edu	37	12	8519351	8519351	+	lincRNA	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr12:8519351G>A	ENST00000544461.1	-	0	1081				RP11-113C12.4_ENST00000537764.1_RNA|AC092865.1_ENST00000408177.1_RNA					long intergenic non-protein coding RNA 937																		taaaagtaatggcaaaaacag	0.393																																																	0																																												0			BC073935		12p13.31	2013-05-30			ENSG00000226091	ENSG00000226091		"""Long non-coding RNAs"""	48629	non-coding RNA	RNA, long non-coding							Standard	NR_024420		Approved				OTTHUMG00000168663		12.37:g.8519351G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000544461.1	37	NULL		12																																																																																			AC092865.1	-	-		0.393	LINC00937-001	KNOWN	basic	lincRNA	ENSG00000221104	Clone_based_ensembl_gene	lincRNA	OTTHUMT00000400511.1	G			8519351	+1	no_errors	ENST00000408177	ensembl	human	novel	70_37	rna	SNP	0.347	A
AC092724.1	0	genome.wustl.edu	37	16	77744254	77744254	+	RNA	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr16:77744254G>C	ENST00000408299.1	+	0	57																											ggaactctagggtggagccca	0.473																																																	0																																												0																															16.37:g.77744254G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000408299.1	37	NULL		16																																																																																			AC092724.1	-	-		0.473	AC092724.1-201	NOVEL	basic	miRNA	ENSG00000221226	Clone_based_ensembl_gene	miRNA		G			77744254	+1	no_errors	ENST00000408299	ensembl	human	novel	70_37	rna	SNP	0.002	C
EP300	2033	genome.wustl.edu	37	22	41564513	41564513	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr22:41564513G>A	ENST00000263253.7	+	24	5154	c.3935G>A	c.(3934-3936)cGa>cAa	p.R1312Q	RP1-85F18.6_ENST00000415054.1_RNA|RNU6-375P_ENST00000517050.1_RNA	NM_001429.3	NP_001420.2	Q09472	EP300_HUMAN	E1A binding protein p300	1312	CBP/p300-type HAT. {ECO:0000255|PROSITE- ProRule:PRU01065}.				apoptotic process (GO:0006915)|cellular response to hypoxia (GO:0071456)|chromatin organization (GO:0006325)|circadian rhythm (GO:0007623)|G2/M transition of mitotic cell cycle (GO:0000086)|heart development (GO:0007507)|histone H2B acetylation (GO:0043969)|histone H4 acetylation (GO:0043967)|innate immune response (GO:0045087)|internal peptidyl-lysine acetylation (GO:0018393)|internal protein amino acid acetylation (GO:0006475)|intrinsic apoptotic signaling pathway in response to DNA damage by p53 class mediator (GO:0042771)|lung development (GO:0030324)|mitotic cell cycle (GO:0000278)|N-terminal peptidyl-lysine acetylation (GO:0018076)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|organ morphogenesis (GO:0009887)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of protein binding (GO:0032092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of type I interferon production (GO:0032481)|regulation of androgen receptor signaling pathway (GO:0060765)|regulation of cell cycle (GO:0051726)|regulation of transcription from RNA polymerase II promoter in response to hypoxia (GO:0061418)|regulation of transcription, DNA-templated (GO:0006355)|regulation of tubulin deacetylation (GO:0090043)|response to estrogen (GO:0043627)|response to hypoxia (GO:0001666)|skeletal muscle tissue development (GO:0007519)|somitogenesis (GO:0001756)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytoplasm (GO:0005737)|histone acetyltransferase complex (GO:0000123)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	acetyltransferase activity (GO:0016407)|activating transcription factor binding (GO:0033613)|androgen receptor binding (GO:0050681)|beta-catenin binding (GO:0008013)|chromatin binding (GO:0003682)|chromatin DNA binding (GO:0031490)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine N-acetyltransferase activity, acting on acetyl phosphate as donor (GO:0004468)|nuclear hormone receptor binding (GO:0035257)|pre-mRNA intronic binding (GO:0097157)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|transcription coactivator activity (GO:0003713)|transcription factor binding (GO:0008134)|transferase activity, transferring acyl groups (GO:0016746)|zinc ion binding (GO:0008270)			NS(2)|breast(11)|central_nervous_system(7)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(31)|kidney(5)|large_intestine(31)|liver(2)|lung(33)|ovary(2)|pancreas(4)|prostate(1)|skin(6)|stomach(1)|upper_aerodigestive_tract(8)|urinary_tract(16)	171						TTTCTGAGGCGACAGAATCAC	0.433			"""T,  N, F, Mis, O"""	"""MLL, RUNXBP2"""	"""colorectal, breast, pancreatic, AML, ALL, DLBCL"""				Rubinstein-Taybi syndrome																															Rec	yes		22	22q13	2033	300 kd E1A-Binding protein gene		"""L, E"""	0													125.0	117.0	119.0					22																	41564513		2203	4300	6503	SO:0001583	missense	2033	Familial Cancer Database	Broad Thumb-Hallux syndrome	U01877	CCDS14010.1	22q13.2	2011-07-01			ENSG00000100393	ENSG00000100393		"""Chromatin-modifying enzymes / K-acetyltransferases"""	3373	protein-coding gene	gene with protein product	"""histone acetyltransferase p300"""	602700				7523245	Standard	NM_001429		Approved	p300, KAT3B	uc003azl.4	Q09472	OTTHUMG00000150937	ENST00000263253.7:c.3935G>A	22.37:g.41564513G>A	ENSP00000263253:p.Arg1312Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AKC2	Missense_Mutation	SNP	pfam_Histone_H3-K56_AcTrfase_RTT109,pfam_Nuc_rcpt_coact_CREBbp,pfam_KIX,pfam_DUF902_CREBbp,pfam_Znf_TAZ,pfam_Bromodomain,pfam_Znf_ZZ,superfamily_Bromodomain,superfamily_Znf_TAZ,superfamily_KIX,superfamily_Nuc_rcpt_coact,superfamily_Znf_FYVE_PHD,smart_Znf_TAZ,smart_Bromodomain,smart_Znf_ZZ,pfscan_KIX,pfscan_Znf_TAZ,pfscan_Znf_ZZ,pfscan_Bromodomain,prints_Bromodomain	p.R1312Q	ENST00000263253.7	37	c.3935	CCDS14010.1	22	.	.	.	.	.	.	.	.	.	.	G	34	5.316077	0.95655	.	.	ENSG00000100393	ENST00000263253	D	0.93076	-3.16	5.75	5.75	0.90469	.	0.000000	0.40818	N	0.001006	D	0.96182	0.8755	M	0.63428	1.95	0.52099	D	0.999944	D	0.89917	1.0	D	0.87578	0.998	D	0.94986	0.8130	10	0.38643	T	0.18	-9.3062	19.9535	0.97211	0.0:0.0:1.0:0.0	.	1312	Q09472	EP300_HUMAN	Q	1312	ENSP00000263253:R1312Q	ENSP00000263253:R1312Q	R	+	2	0	EP300	39894459	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	9.869000	0.99810	2.710000	0.92621	0.557000	0.71058	CGA	EP300	-	pfam_Histone_H3-K56_AcTrfase_RTT109		0.433	EP300-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EP300	HGNC	protein_coding	OTTHUMT00000320600.1	G	NM_001429		41564513	+1	no_errors	ENST00000263253	ensembl	human	known	70_37	missense	SNP	1.000	A
ERAS	3266	genome.wustl.edu	37	X	48688086	48688086	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:48688086C>T	ENST00000338270.1	+	1	804	c.553C>T	c.(553-555)Cgg>Tgg	p.R185W	PCSK1N_ENST00000478242.1_5'Flank	NM_181532.2	NP_853510.1	Q7Z444	RASE_HUMAN	ES cell expressed Ras	185					GTP catabolic process (GO:0006184)|small GTPase mediated signal transduction (GO:0007264)	plasma membrane (GO:0005886)	GTP binding (GO:0005525)	p.R185W(1)		endometrium(2)|large_intestine(1)|lung(9)|prostate(1)|urinary_tract(1)	14						GGCCAAAACACGGCAAGGCGT	0.622																																																	1	Substitution - Missense(1)	lung(1)											30.0	26.0	28.0					X																	48688086		2200	4298	6498	SO:0001583	missense	3266			X00419	CCDS35246.1	Xp11.23	2014-05-09	2003-07-14	2003-07-16	ENSG00000187682	ENSG00000187682			5174	protein-coding gene	gene with protein product		300437	"""v-Ha-ras Harvey rat sarcoma viral oncogene homolog pseudogene"""	HRAS2, HRASP		12774123	Standard	NM_181532		Approved		uc031tjl.1	Q7Z444	OTTHUMG00000059533	ENST00000338270.1:c.553C>T	X.37:g.48688086C>T	ENSP00000339136:p.Arg185Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R185W	ENST00000338270.1	37	c.553	CCDS35246.1	X	.	.	.	.	.	.	.	.	.	.	c	13.24	2.179058	0.38511	.	.	ENSG00000187682	ENST00000338270	T	0.70631	-0.5	4.66	3.8	0.43715	Small GTP-binding protein domain (1);	0.228600	0.22687	N	0.056872	T	0.71022	0.3291	M	0.90198	3.095	0.09310	N	0.999992	P	0.40638	0.725	B	0.32677	0.15	T	0.69450	-0.5142	10	0.87932	D	0	.	9.8114	0.40826	0.0:0.8976:0.0:0.1024	.	185	Q7Z444	RASE_HUMAN	W	185	ENSP00000339136:R185W	ENSP00000339136:R185W	R	+	1	2	ERAS	48573030	0.000000	0.05858	0.228000	0.23943	0.491000	0.33493	-0.369000	0.07533	1.106000	0.41623	0.597000	0.82753	CGG	ERAS	-	pfam_Small_GTPase,pfam_Small_GTPase_ARF/SAR,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.622	ERAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERAS	HGNC	protein_coding	OTTHUMT00000132402.1	C	NM_181532		48688086	+1	no_errors	ENST00000338270	ensembl	human	known	70_37	missense	SNP	0.007	T
ERRFI1	54206	genome.wustl.edu	37	1	8073498	8073498	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:8073498C>T	ENST00000377482.5	-	4	1384	c.1161G>A	c.(1159-1161)aaG>aaA	p.K387K	ERRFI1_ENST00000467067.1_3'UTR|ERRFI1_ENST00000474874.1_Intron	NM_018948.3	NP_061821.1	Q9UJM3	ERRFI_HUMAN	ERBB receptor feedback inhibitor 1	387					lung alveolus development (GO:0048286)|lung epithelium development (GO:0060428)|lung vasculature development (GO:0060426)|negative regulation of epidermal growth factor-activated receptor activity (GO:0007175)|negative regulation of protein autophosphorylation (GO:0031953)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of keratinocyte differentiation (GO:0045616)|response to stress (GO:0006950)|skin morphogenesis (GO:0043589)	cytoplasm (GO:0005737)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|nucleus (GO:0005634)	protein kinase binding (GO:0019901)|Rho GTPase activator activity (GO:0005100)			breast(1)|endometrium(2)|large_intestine(3)|liver(3)|lung(3)|ovary(1)|prostate(1)|skin(2)	16	Ovarian(185;0.06)|all_lung(157;0.151)	all_epithelial(116;1.76e-16)|all_lung(118;3.66e-05)|Lung NSC(185;0.000163)|Renal(390;0.000469)|Colorectal(325;0.0033)|Breast(348;0.0044)|Hepatocellular(190;0.0228)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.11)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|all cancers(8;2.33e-70)|GBM - Glioblastoma multiforme(8;8.05e-37)|Colorectal(212;6.23e-08)|COAD - Colon adenocarcinoma(227;6.9e-06)|Kidney(185;4.89e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000864)|KIRC - Kidney renal clear cell carcinoma(229;0.000911)|STAD - Stomach adenocarcinoma(132;0.000985)|READ - Rectum adenocarcinoma(331;0.0642)		AACTAACCTTCTTCCCATTTT	0.423																																																	0													148.0	145.0	146.0					1																	8073498		2203	4300	6503	SO:0001819	synonymous_variant	54206			BC025337	CCDS94.1	1p36.23	2008-02-05			ENSG00000116285	ENSG00000116285			18185	protein-coding gene	gene with protein product		608069				10749885, 2780291, 12226756, 11003669	Standard	NM_018948		Approved	MIG-6, GENE-33, RALT	uc001aoz.3	Q9UJM3	OTTHUMG00000001221	ENST00000377482.5:c.1161G>A	1.37:g.8073498C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDX9|Q9NTG9|Q9UD05	Silent	SNP	pfam_GTPase_binding,pfam_Inhibitor_Mig-6	p.K387	ENST00000377482.5	37	c.1161	CCDS94.1	1																																																																																			ERRFI1	-	NULL		0.423	ERRFI1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERRFI1	HGNC	protein_coding	OTTHUMT00000003617.1	C	NM_018948		8073498	-1	no_errors	ENST00000377482	ensembl	human	known	70_37	silent	SNP	1.000	T
FAM208B	54906	genome.wustl.edu	37	10	5790084	5790084	+	Missense_Mutation	SNP	T	T	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr10:5790084T>A	ENST00000328090.5	+	15	5325	c.4700T>A	c.(4699-4701)cTt>cAt	p.L1567H		NM_017782.4	NP_060252	Q5VWN6	F208B_HUMAN	family with sequence similarity 208, member B	1567																	TTAAAACATCTTGTCTTGGAG	0.388																																																	0													86.0	83.0	84.0					10																	5790084		1860	4096	5956	SO:0001583	missense	54906			BX649177	CCDS41485.1	10p15.1	2011-09-14	2011-09-14	2011-09-14	ENSG00000108021	ENSG00000108021			23484	protein-coding gene	gene with protein product			"""chromosome 10 open reading frame 18"""	C10orf18		12477932	Standard	NM_017782		Approved	FLJ20360, bA318E3.2, KIAA2006	uc001iij.3	Q5VWN6	OTTHUMG00000017605	ENST00000328090.5:c.4700T>A	10.37:g.5790084T>A	ENSP00000328426:p.Leu1567His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2YD91|Q5VWN5|Q6ZRQ8|Q8IVG4|Q9BUZ7|Q9H5J9|Q9H7A4|Q9H996|Q9NXA1	Missense_Mutation	SNP	pfam_DUF3715,pfam_DUF3699	p.L1567H	ENST00000328090.5	37	c.4700	CCDS41485.1	10	.	.	.	.	.	.	.	.	.	.	T	13.70	2.316326	0.40996	.	.	ENSG00000108021	ENST00000328090;ENST00000442808	T	0.07444	3.19	4.86	0.715	0.18186	.	1.133920	0.06636	N	0.760238	T	0.10078	0.0247	L	0.50333	1.59	0.09310	N	1	P	0.51653	0.947	P	0.45946	0.498	T	0.30937	-0.9961	10	0.29301	T	0.29	.	4.1256	0.10126	0.0:0.2223:0.1835:0.5942	.	1567	Q5VWN6	F208B_HUMAN	H	1567;762	ENSP00000328426:L1567H	ENSP00000328426:L1567H	L	+	2	0	C10orf18	5830090	0.000000	0.05858	0.005000	0.12908	0.779000	0.44077	0.206000	0.17375	0.223000	0.20920	0.460000	0.39030	CTT	FAM208B	-	NULL		0.388	FAM208B-003	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM208B	HGNC	protein_coding	OTTHUMT00000046571.2	T	NM_017782		5790084	+1	no_errors	ENST00000328090	ensembl	human	known	70_37	missense	SNP	0.000	A
CCSER2	54462	genome.wustl.edu	37	10	86274128	86274128	+	3'UTR	SNP	G	G	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr10:86274128G>T	ENST00000224756.8	+	0	3519				CCSER2_ENST00000372088.2_3'UTR|CCSER2_ENST00000494144.1_3'UTR	NM_001284243.1|NM_018999.2	NP_001271172.1|NP_061872.2	Q9H7U1	CCSE2_HUMAN	coiled-coil serine-rich protein 2						microtubule bundle formation (GO:0001578)	microtubule cytoskeleton (GO:0015630)											TCCATTGAAAGCCTGCAAATC	0.378																																																	0																																										SO:0001624	3_prime_UTR_variant	54462				CCDS31235.1, CCDS60582.1, CCDS60583.1, CCDS73159.1	10q23.1	2012-12-03	2012-12-03	2012-12-03	ENSG00000107771	ENSG00000107771			29197	protein-coding gene	gene with protein product			"""KIAA1128"", ""family with sequence similarity 190, member B"""	KIAA1128, FAM190B		10574461	Standard	XM_005269905		Approved		uc001kdh.1	Q9H7U1	OTTHUMG00000018641	ENST00000224756.8:c.*829G>T	10.37:g.86274128G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFY4|B4DQU9|B7WPE8|D3DWE2|Q8N6E9|Q9H2S0|Q9ULU1	RNA	SNP	-	NULL	ENST00000224756.8	37	NULL	CCDS31235.1	10																																																																																			FAM190B	-	-		0.378	CCSER2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM190B	HGNC	protein_coding	OTTHUMT00000049132.2	G	NM_018999		86274128	+1	no_errors	ENST00000494144	ensembl	human	known	70_37	rna	SNP	1.000	T
FTSJ2	29960	genome.wustl.edu	37	7	2279272	2279272	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr7:2279272G>A	ENST00000242257.8	-	2	107	c.79C>T	c.(79-81)Cgg>Tgg	p.R27W	NUDT1_ENST00000356714.1_5'Flank|FTSJ2_ENST00000486040.1_5'UTR|FTSJ2_ENST00000440306.2_Missense_Mutation_p.R27W|NUDT1_ENST00000397049.1_5'Flank|NUDT1_ENST00000397046.1_5'Flank|FTSJ2_ENST00000407040.1_5'Flank|NUDT1_ENST00000397048.1_5'Flank	NM_013393.1	NP_037525.1			FtsJ RNA methyltransferase homolog 2 (E. coli)											endometrium(1)|large_intestine(1)|lung(6)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	12		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0822)|OV - Ovarian serous cystadenocarcinoma(56;2.7e-14)		GCGCCTGTCCGATTCTTGCAG	0.567																																																	0													103.0	101.0	102.0					7																	2279272		2203	4300	6503	SO:0001583	missense	29960			AF093415	CCDS5328.1	7p22	2012-06-12	2012-06-12		ENSG00000122687	ENSG00000122687			16352	protein-coding gene	gene with protein product	"""rRNA (uridine-2'-O-)-methyltransferase"", ""MRM2 RNA methyltransferase homolog (S. cerevisiae)"""	606906				11827451	Standard	NM_013393		Approved	FJH1, MRM2	uc003slm.3	Q9UI43	OTTHUMG00000023866	ENST00000242257.8:c.79C>T	7.37:g.2279272G>A	ENSP00000242257:p.Arg27Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_rRNA_MeTrfase_FtsJ_dom,pirsf_rRNA-MeTfrase_E	p.R27W	ENST00000242257.8	37	c.79	CCDS5328.1	7	.	.	.	.	.	.	.	.	.	.	G	17.52	3.410770	0.62399	.	.	ENSG00000122687	ENST00000242257;ENST00000440306	T;T	0.48201	0.82;1.33	5.96	2.88	0.33553	.	0.400943	0.24815	N	0.035378	T	0.69904	0.3163	M	0.92367	3.3	0.20307	N	0.999911	D	0.76494	0.999	D	0.63793	0.918	T	0.62909	-0.6754	10	0.87932	D	0	3.3139	8.9775	0.35944	0.0775:0.0:0.5718:0.3507	.	27	Q9UI43	RRMJ2_HUMAN	W	27	ENSP00000242257:R27W;ENSP00000392343:R27W	ENSP00000242257:R27W	R	-	1	2	FTSJ2	2245798	0.997000	0.39634	0.022000	0.16811	0.231000	0.25187	2.568000	0.45965	0.825000	0.34637	0.655000	0.94253	CGG	FTSJ2	-	pirsf_rRNA-MeTfrase_E		0.567	FTSJ2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FTSJ2	HGNC	protein_coding	OTTHUMT00000060187.1	G	NM_013393		2279272	-1	no_errors	ENST00000242257	ensembl	human	known	70_37	missense	SNP	0.125	A
GEMIN4	50628	genome.wustl.edu	37	17	648202	648202	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:648202C>G	ENST00000319004.5	-	2	3199	c.3081G>C	c.(3079-3081)caG>caC	p.Q1027H	GEMIN4_ENST00000576778.1_Missense_Mutation_p.Q1016H	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	1027					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		CGTGTGCCCTCTGGAGCAAGG	0.547																																																	0													55.0	55.0	55.0					17																	648202		1985	4150	6135	SO:0001583	missense	50628			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.3081G>C	17.37:g.648202C>G	ENSP00000321706:p.Gln1027His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NZS7|Q9UG32|Q9Y4Q2	Missense_Mutation	SNP	NULL	p.Q1027H	ENST00000319004.5	37	c.3081	CCDS45559.1	17	.	.	.	.	.	.	.	.	.	.	C	14.57	2.573609	0.45902	.	.	ENSG00000179409	ENST00000319004	T	0.06294	3.32	5.71	2.55	0.30701	.	0.199024	0.45361	D	0.000365	T	0.09291	0.0229	L	0.54323	1.7	0.80722	D	1	P	0.48503	0.911	P	0.47941	0.562	T	0.06338	-1.0832	10	0.66056	D	0.02	-16.4118	6.1009	0.20047	0.0:0.5439:0.2456:0.2105	.	1027	P57678	GEMI4_HUMAN	H	1027	ENSP00000321706:Q1027H	ENSP00000321706:Q1027H	Q	-	3	2	GEMIN4	594952	1.000000	0.71417	1.000000	0.80357	0.765000	0.43378	1.295000	0.33377	0.789000	0.33779	0.655000	0.94253	CAG	GEMIN4	-	NULL		0.547	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1	C	NM_015721		648202	-1	no_errors	ENST00000319004	ensembl	human	known	70_37	missense	SNP	1.000	G
GEMIN4	50628	genome.wustl.edu	37	17	650523	650523	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:650523C>T	ENST00000319004.5	-	2	878	c.760G>A	c.(760-762)Gag>Aag	p.E254K	GEMIN4_ENST00000576778.1_Missense_Mutation_p.E243K|GEMIN4_ENST00000437269.1_Splice_Site	NM_015721.2	NP_056536.2	P57678	GEMI4_HUMAN	gem (nuclear organelle) associated protein 4	254					gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|spliceosomal snRNP assembly (GO:0000387)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|small nuclear ribonucleoprotein complex (GO:0030532)|SMN complex (GO:0032797)|SMN-Sm protein complex (GO:0034719)				breast(1)|cervix(1)|endometrium(2)|kidney(3)|large_intestine(4)|lung(4)|ovary(4)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22		Myeloproliferative disorder(207;0.204)		UCEC - Uterine corpus endometrioid carcinoma (25;0.022)		GGGTCGTCCTCTGTCAGCGCA	0.612																																																	0													92.0	101.0	98.0					17																	650523		2177	4267	6444	SO:0001583	missense	50628			AF177341	CCDS45559.1	17p13.3	2008-07-18				ENSG00000179409			15717	protein-coding gene	gene with protein product	"""HCC-associated protein 1"", ""component of gems 4"""	606969				10725331	Standard	NM_015721		Approved	HHRF-1, DKFZP434B131, p97, DKFZP434D174, HC56, HCAP1	uc002frs.1	P57678		ENST00000319004.5:c.760G>A	17.37:g.650523C>T	ENSP00000321706:p.Glu254Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NZS7|Q9UG32|Q9Y4Q2	Splice_Site	SNP	-	e3-1	ENST00000319004.5	37	c.499-1	CCDS45559.1	17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	8.608|8.608	0.888548|0.888548	0.17540|0.17540	.|.	.|.	ENSG00000179409|ENSG00000179409	ENST00000437269|ENST00000319004	.|T	.|0.16897	.|2.31	5.5|5.5	5.5|5.5	0.81552|0.81552	.|.	.|0.401303	.|0.26895	.|N	.|0.021941	.|T	.|0.31263	.|0.0791	M|M	0.62723|0.62723	1.935|1.935	0.54753|0.54753	D|D	0.999985|0.999985	.|D	.|0.56521	.|0.976	.|P	.|0.53266	.|0.722	.|T	.|0.00909	.|-1.1518	.|10	.|0.44086	.|T	.|0.13	.|-16.3349	15.5742|15.5742	0.76362|0.76362	0.0:0.8622:0.1378:0.0|0.0:0.8622:0.1378:0.0	.|.	.|254	.|P57678	.|GEMI4_HUMAN	.|K	-1|254	.|ENSP00000321706:E254K	.|ENSP00000321706:E254K	.|E	-|-	.|1	.|0	GEMIN4|GEMIN4	597273|597273	0.287000|0.287000	0.24315|0.24315	0.968000|0.968000	0.41197|0.41197	0.281000|0.281000	0.26958|0.26958	4.625000|4.625000	0.61262|0.61262	2.591000|2.591000	0.87537|0.87537	0.650000|0.650000	0.86243|0.86243	.|GAG	GEMIN4	-	-		0.612	GEMIN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GEMIN4	HGNC	protein_coding	OTTHUMT00000437181.1	C	NM_015721		650523	-1	no_errors	ENST00000437269	ensembl	human	putative	70_37	splice_site	SNP	0.181	T
GLIS3	169792	genome.wustl.edu	37	9	3932409	3932409	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:3932409C>T	ENST00000324333.10	-	5	1662	c.1469G>A	c.(1468-1470)aGa>aAa	p.R490K	GLIS3_ENST00000461870.1_5'UTR|GLIS3_ENST00000381971.3_Missense_Mutation_p.R645K	NM_152629.3	NP_689842.3	Q8NEA6	GLIS3_HUMAN	GLIS family zinc finger 3	490					negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|transcription from RNA polymerase II promoter (GO:0006366)	Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001078)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(12)|lung(4)|ovary(2)|prostate(1)|skin(1)	26		Acute lymphoblastic leukemia(2;0.00464)|Breast(48;0.148)		Lung(2;0.00163)|GBM - Glioblastoma multiforme(50;0.00301)|LUSC - Lung squamous cell carcinoma(2;0.0148)		CACATGCTTTCTTAGGGAACT	0.378																																																	0													219.0	212.0	214.0					9																	3932409		2203	4300	6503	SO:0001583	missense	169792			BC033899	CCDS6451.1, CCDS43784.1	9p24.2	2008-05-02	2004-07-16	2004-07-16	ENSG00000107249	ENSG00000107249		"""Zinc fingers, C2H2-type"""	28510	protein-coding gene	gene with protein product		610192	"""zinc finger protein 515"""	ZNF515		14500813	Standard	NM_152629		Approved	MGC33662	uc003zhx.1	Q8NEA6	OTTHUMG00000019463	ENST00000324333.10:c.1469G>A	9.37:g.3932409C>T	ENSP00000325494:p.Arg490Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AL19|Q1PHK5	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R645K	ENST00000324333.10	37	c.1934	CCDS6451.1	9	.	.	.	.	.	.	.	.	.	.	C	35	5.539014	0.96474	.	.	ENSG00000107249	ENST00000324333;ENST00000381971	T;T	0.35605	1.3;1.3	5.82	5.82	0.92795	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.56097	D	0.000024	T	0.40932	0.1137	N	0.03930	-0.32	0.80722	D	1	D;D;D;D;D	0.76494	0.996;0.999;0.999;0.99;0.996	D;D;D;P;D	0.77004	0.987;0.987;0.984;0.865;0.989	T	0.58885	-0.7557	10	0.87932	D	0	.	20.0991	0.97865	0.0:1.0:0.0:0.0	.	85;158;158;645;490	Q59FQ6;Q1PHK2;Q1PHK3;Q8NEA6-2;Q8NEA6	.;.;.;.;GLIS3_HUMAN	K	490;645	ENSP00000325494:R490K;ENSP00000371398:R645K	ENSP00000325494:R490K	R	-	2	0	GLIS3	3922409	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.752000	0.94435	0.655000	0.94253	AGA	GLIS3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.378	GLIS3-003	KNOWN	basic|CCDS	protein_coding	GLIS3	HGNC	protein_coding	OTTHUMT00000051559.1	C	NM_152629		3932409	-1	no_errors	ENST00000381971	ensembl	human	known	70_37	missense	SNP	1.000	T
GRIA1	2890	genome.wustl.edu	37	5	153190775	153190775	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr5:153190775C>T	ENST00000285900.5	+	16	3054	c.2711C>T	c.(2710-2712)aCg>aTg	p.T904M	GRIA1_ENST00000518142.1_Missense_Mutation_p.T824M|GRIA1_ENST00000340592.5_Missense_Mutation_p.T904M|GRIA1_ENST00000448073.4_Missense_Mutation_p.T914M|GRIA1_ENST00000521843.2_Missense_Mutation_p.T835M|GRIA1_ENST00000518783.1_Missense_Mutation_p.T914M	NM_000827.3|NM_001258019.1	NP_000818.2|NP_001244948.1	P42261	GRIA1_HUMAN	glutamate receptor, ionotropic, AMPA 1	904					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|long-term memory (GO:0007616)|receptor internalization (GO:0031623)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|axonal spine (GO:0044308)|cell junction (GO:0030054)|cell surface (GO:0009986)|dendrite (GO:0030425)|dendrite membrane (GO:0032590)|dendritic spine (GO:0043197)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|neuron spine (GO:0044309)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|glutamate receptor activity (GO:0008066)|PDZ domain binding (GO:0030165)			NS(1)|breast(4)|endometrium(7)|kidney(3)|large_intestine(24)|liver(2)|lung(23)|ovary(4)|pancreas(1)|prostate(5)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(2)	81		Medulloblastoma(196;0.0391)|all_neural(177;0.16)|all_hematologic(541;0.21)	Kidney(363;0.000173)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)		Desflurane(DB01189)|Enflurane(DB00228)|Isoflurane(DB00753)|Methoxyflurane(DB01028)|Perampanel(DB08883)|Sevoflurane(DB01236)	TTGGGAGCCACGGGATTGTAA	0.562																																																	0													42.0	39.0	40.0					5																	153190775		2203	4300	6503	SO:0001583	missense	2890				CCDS4322.1, CCDS47318.1, CCDS58986.1, CCDS58987.1, CCDS58988.1, CCDS58989.1	5q33	2012-08-29			ENSG00000155511	ENSG00000155511		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4571	protein-coding gene	gene with protein product		138248		GLUR1		1652753, 1319477	Standard	NM_000827		Approved	GluA1, GLURA	uc011dcy.2	P42261	OTTHUMG00000130148	ENST00000285900.5:c.2711C>T	5.37:g.153190775C>T	ENSP00000285900:p.Thr904Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2S0|B7Z2W8|B7Z3F6|B7Z9G9|D3DQI4|E7ESV8|Q2NKM6	Missense_Mutation	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.T914M	ENST00000285900.5	37	c.2741	CCDS4322.1	5	.	.	.	.	.	.	.	.	.	.	C	23.8	4.460395	0.84317	.	.	ENSG00000155511	ENST00000285900;ENST00000544403;ENST00000518142;ENST00000340592;ENST00000521843;ENST00000544794;ENST00000518783;ENST00000448073	T;T;T;T;T;T;T	0.13307	2.65;2.6;2.65;2.6;2.6;2.64;2.64	5.03	5.03	0.67393	.	0.368545	0.31734	N	0.007149	T	0.33030	0.0849	L	0.55481	1.735	0.53688	D	0.99997	D;D;D;D;D	0.89917	0.999;0.999;0.999;1.0;1.0	P;P;P;D;D	0.67725	0.826;0.826;0.791;0.916;0.953	T	0.03852	-1.0998	10	0.87932	D	0	.	17.3487	0.87316	0.0:1.0:0.0:0.0	.	914;914;824;904;904	E7ESV8;B7Z9G9;B7Z3F6;P42261-2;P42261	.;.;.;.;GRIA1_HUMAN	M	904;904;824;904;837;835;914;914	ENSP00000285900:T904M;ENSP00000427920:T824M;ENSP00000339343:T904M;ENSP00000427864:T837M;ENSP00000442108:T835M;ENSP00000428994:T914M;ENSP00000415569:T914M	ENSP00000285900:T904M	T	+	2	0	GRIA1	153170968	1.000000	0.71417	0.942000	0.38095	0.936000	0.57629	7.307000	0.78920	2.330000	0.79161	0.561000	0.74099	ACG	GRIA1	-	NULL		0.562	GRIA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA1	HGNC	protein_coding	OTTHUMT00000252456.3	C			153190775	+1	no_errors	ENST00000448073	ensembl	human	known	70_37	missense	SNP	1.000	T
GTF3C5	9328	genome.wustl.edu	37	9	135906463	135906463	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:135906463G>A	ENST00000372097.5	+	1	388	c.65G>A	c.(64-66)cGa>cAa	p.R22Q	GTF3C5_ENST00000342018.8_Missense_Mutation_p.R22Q|GTF3C5_ENST00000485692.1_3'UTR|GTF3C5_ENST00000372095.5_5'UTR|GTF3C5_ENST00000372108.5_Missense_Mutation_p.R22Q|GTF3C5_ENST00000372099.6_Missense_Mutation_p.R22Q	NM_012087.3	NP_036219.2	Q9Y5Q8	TF3C5_HUMAN	general transcription factor IIIC, polypeptide 5, 63kDa	22					5S class rRNA transcription from RNA polymerase III type 1 promoter (GO:0042791)|gene expression (GO:0010467)|skeletal muscle cell differentiation (GO:0035914)|transcription from RNA polymerase III promoter (GO:0006383)|transcription, DNA-templated (GO:0006351)|tRNA transcription from RNA polymerase III promoter (GO:0042797)	nucleoplasm (GO:0005654)|transcription factor TFIIIC complex (GO:0000127)	DNA binding (GO:0003677)	p.R22Q(1)		endometrium(5)|kidney(1)|large_intestine(7)|lung(6)|pancreas(1)|prostate(1)	21				OV - Ovarian serous cystadenocarcinoma(145;4.01e-06)|Epithelial(140;4e-05)		AGGCGGGAGCGACGCATGGTG	0.721																																																	1	Substitution - Missense(1)	lung(1)											38.0	35.0	36.0					9																	135906463		2202	4298	6500	SO:0001583	missense	9328			AF133124	CCDS6958.1, CCDS48050.1, CCDS75927.1	9q34.13	2010-03-23	2002-08-29		ENSG00000148308	ENSG00000148308		"""General transcription factors"""	4668	protein-coding gene	gene with protein product	"""transcription factor IIIC, 63 kD"""	604890	"""general transcription factor IIIC, polypeptide 5 (63kD)"""			10373544	Standard	NM_012087		Approved	TFiiiC2-63, TFIIIC63, TFIIICepsilon	uc004ccj.4	Q9Y5Q8	OTTHUMG00000020856	ENST00000372097.5:c.65G>A	9.37:g.135906463G>A	ENSP00000361169:p.Arg22Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NI44|A6NJB9|Q5T7U2|Q5T7U3|Q8N2U7|Q8N857|Q96GD9|Q9H4P2	Missense_Mutation	SNP	pfam_TF_IIIC_su-5	p.R22Q	ENST00000372097.5	37	c.65	CCDS6958.1	9	.	.	.	.	.	.	.	.	.	.	G	14.96	2.690563	0.48097	.	.	ENSG00000148308	ENST00000372097;ENST00000372099;ENST00000372108;ENST00000342018	T;T;T;T	0.52526	0.67;0.77;0.66;0.69	5.27	2.46	0.29980	.	0.814868	0.11070	N	0.602973	T	0.30916	0.0780	L	0.27053	0.805	0.21740	N	0.999561	B;B	0.23591	0.088;0.024	B;B	0.17433	0.018;0.003	T	0.21348	-1.0248	10	0.41790	T	0.15	-3.6188	4.7281	0.12950	0.3298:0.1492:0.521:0.0	.	22;22	Q9Y5Q8-3;Q9Y5Q8	.;TF3C5_HUMAN	Q	22	ENSP00000361169:R22Q;ENSP00000361171:R22Q;ENSP00000361180:R22Q;ENSP00000339530:R22Q	ENSP00000339530:R22Q	R	+	2	0	GTF3C5	134896284	0.059000	0.20769	0.080000	0.20451	0.753000	0.42808	1.288000	0.33296	0.241000	0.21283	0.561000	0.74099	CGA	GTF3C5	-	NULL		0.721	GTF3C5-003	KNOWN	basic|appris_principal|CCDS	protein_coding	GTF3C5	HGNC	protein_coding	OTTHUMT00000054826.1	G	NM_001122823		135906463	+1	no_errors	ENST00000372108	ensembl	human	known	70_37	missense	SNP	0.046	A
IDH3A	3419	genome.wustl.edu	37	15	78449273	78449273	+	Intron	SNP	G	G	C	rs369849899		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr15:78449273G>C	ENST00000299518.2	+	3	173				IDH3A_ENST00000441490.2_Intron|IDH3A_ENST00000559205.1_Intron|IDH3A_ENST00000558554.1_Intron	NM_005530.2	NP_005521.1	P50213	IDH3A_HUMAN	isocitrate dehydrogenase 3 (NAD+) alpha						carbohydrate metabolic process (GO:0005975)|cellular metabolic process (GO:0044237)|small molecule metabolic process (GO:0044281)|tricarboxylic acid cycle (GO:0006099)	mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	isocitrate dehydrogenase (NAD+) activity (GO:0004449)|magnesium ion binding (GO:0000287)|NAD binding (GO:0051287)			endometrium(1)|large_intestine(5)|lung(5)|stomach(1)	12						AGCTTATGTAGATTACTCTTA	0.333																																																	0								G		0,1750		0,0,875	49.0	51.0	50.0			-2.1	0.0	15		50	2,3978		0,2,1988	no	intron	IDH3A	NM_005530.2		0,2,2863	CC,CG,GG		0.0503,0.0,0.0349			78449273	2,5728	875	1990	2865	SO:0001627	intron_variant	3419				CCDS10297.1	15q25.1-q25.2	2008-07-18			ENSG00000166411	ENSG00000166411	1.1.1.41		5384	protein-coding gene	gene with protein product	"""H-IDH alpha"", ""isocitric dehydrogenase"", ""isocitrate dehydrogenase [NAD] subunit alpha, mitochondrial"", ""NAD+-specific ICDH"", ""NAD(H)-specific isocitrate dehydrogenase alpha subunit"", ""isocitrate dehydrogenase (NAD+) alpha chain"""	601149				8833160	Standard	NM_005530		Approved		uc002bdd.3	P50213	OTTHUMG00000143732	ENST00000299518.2:c.91-617G>C	15.37:g.78449273G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DW83|Q9H3X0	Nonstop_Mutation	SNP	NULL	p.*38Y	ENST00000299518.2	37	c.114	CCDS10297.1	15																																																																																			IDH3A	-	NULL		0.333	IDH3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IDH3A	HGNC	protein_coding	OTTHUMT00000289799.4	G	NM_005530		78449273	+1	no_errors	ENST00000559865	ensembl	human	known	70_37	nonstop	SNP	0.000	C
IGFN1	91156	genome.wustl.edu	37	1	201177907	201177907	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:201177907G>A	ENST00000335211.4	+	12	4016	c.3886G>A	c.(3886-3888)Gag>Aag	p.E1296K	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGGGGCTCCTGAGAATATGGG	0.502																																																	0													35.0	32.0	33.0					1																	201177907		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.3886G>A	1.37:g.201177907G>A	ENSP00000334714:p.Glu1296Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.E1296K	ENST00000335211.4	37	c.3886	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	G	14.67	2.603525	0.46423	.	.	ENSG00000163395	ENST00000335211	D	0.87966	-2.32	2.22	2.22	0.28083	.	.	.	.	.	T	0.73783	0.3631	N	0.08118	0	0.21782	N	0.999545	.	.	.	.	.	.	T	0.61724	-0.7004	6	.	.	.	.	10.4864	0.44724	0.0:0.0:1.0:0.0	.	.	.	.	K	1296	ENSP00000334714:E1296K	.	E	+	1	0	IGFN1	199444530	0.004000	0.15560	0.002000	0.10522	0.051000	0.14879	0.923000	0.28757	1.161000	0.42604	0.491000	0.48974	GAG	IGFN1	-	NULL		0.502	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		G	NM_178275		201177907	+1	no_errors	ENST00000335211	ensembl	human	known	70_37	missense	SNP	0.009	A
IGFN1	91156	genome.wustl.edu	37	1	201178796	201178796	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:201178796G>A	ENST00000335211.4	+	12	4905	c.4775G>A	c.(4774-4776)gGa>gAa	p.G1592E	IGFN1_ENST00000451870.2_Intron|IGFN1_ENST00000295591.8_5'UTR	NM_001164586.1	NP_001158058.1	Q86VF2	IGFN1_HUMAN	immunoglobulin-like and fibronectin type III domain containing 1	0						nucleus (GO:0005634)|Z disc (GO:0030018)				autonomic_ganglia(2)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(6)|lung(21)|ovary(2)|pancreas(1)|prostate(1)|skin(4)|upper_aerodigestive_tract(2)|urinary_tract(1)	45						GGAGGTTCTGGAGAAATGGGG	0.488																																																	0													75.0	61.0	65.0					1																	201178796		692	1591	2283	SO:0001583	missense	91156			AY245430	CCDS53455.1	1q32.1	2013-02-11			ENSG00000163395	ENSG00000163395		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	24607	protein-coding gene	gene with protein product							Standard	NM_001164586		Approved	DKFZp434B1231, EEF1A2BP1	uc001gwc.3	Q86VF2	OTTHUMG00000035728	ENST00000335211.4:c.4775G>A	1.37:g.201178796G>A	ENSP00000334714:p.Gly1592Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	F8WAI1|Q9NT72	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.G1592E	ENST00000335211.4	37	c.4775	CCDS53455.1	1	.	.	.	.	.	.	.	.	.	.	-	11.50	1.657962	0.29425	.	.	ENSG00000163395	ENST00000335211	D	0.95205	-3.64	2.91	-1.67	0.08238	.	.	.	.	.	D	0.83321	0.5229	N	0.08118	0	0.09310	N	0.999999	.	.	.	.	.	.	T	0.73322	-0.4019	6	.	.	.	.	5.0501	0.14503	0.2992:0.1561:0.5446:0.0	.	.	.	.	E	1592	ENSP00000334714:G1592E	.	G	+	2	0	IGFN1	199445419	0.995000	0.38212	0.000000	0.03702	0.000000	0.00434	0.099000	0.15210	-0.138000	0.11434	-3.087000	0.00065	GGA	IGFN1	-	NULL		0.488	IGFN1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	IGFN1	HGNC	protein_coding		G	NM_178275		201178796	+1	no_errors	ENST00000335211	ensembl	human	known	70_37	missense	SNP	0.000	A
IGHV4-59	28392	genome.wustl.edu	37	14	107083548	107083548	+	RNA	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr14:107083548G>C	ENST00000455737.1	-	0	95									immunoglobulin heavy variable 4-59																		CTGCACCTGGGACAGGACCCC	0.592																																																	0													32.0	32.0	32.0					14																	107083548		1813	4067	5880			28392			L10088		14q32.33	2012-02-08			ENSG00000224373	ENSG00000224373		"""Immunoglobulins / IGH locus"""	5654	other	immunoglobulin gene							Standard	NG_001019		Approved				OTTHUMG00000151973		14.37:g.107083548G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Ig_V-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.S19C	ENST00000455737.1	37	c.56		14																																																																																			IGHV4-59	-	pfscan_Ig-like		0.592	IGHV4-59-002	KNOWN	basic|appris_principal	IG_V_gene	IGHV4-59	HGNC	IG_V_gene	OTTHUMT00000324620.1	G	NG_001019		107083548	-1	no_errors	ENST00000455737	ensembl	human	known	70_37	missense	SNP	0.084	C
IL1RAPL2	26280	genome.wustl.edu	37	X	104961411	104961411	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:104961411C>G	ENST00000372582.1	+	7	1580	c.824C>G	c.(823-825)tCt>tGt	p.S275C	IL1RAPL2_ENST00000344799.4_Missense_Mutation_p.S275C	NM_017416.1	NP_059112.1	Q9NP60	IRPL2_HUMAN	interleukin 1 receptor accessory protein-like 2	275	Ig-like C2-type 3.				central nervous system development (GO:0007417)|cytokine-mediated signaling pathway (GO:0019221)	integral component of membrane (GO:0016021)	interleukin-1 receptor activity (GO:0004908)|interleukin-1, Type II, blocking receptor activity (GO:0004910)			breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(14)|lung(23)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49						AGTGGAGAGTCTGGGCCAATG	0.413																																																	0													169.0	158.0	162.0					X																	104961411		2203	4300	6503	SO:0001583	missense	26280			AF181285	CCDS14517.1	Xq22	2013-01-11			ENSG00000189108	ENSG00000189108		"""Interleukins and interleukin receptors"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	5997	protein-coding gene	gene with protein product		300277				10757639	Standard	NM_017416		Approved	IL-1R9, TIGIRR-1, IL1RAPL-2, IL1R9	uc004elz.1	Q9NP60	OTTHUMG00000022141	ENST00000372582.1:c.824C>G	X.37:g.104961411C>G	ENSP00000361663:p.Ser275Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M3U3|Q9NZN0	Missense_Mutation	SNP	pfam_TIR_dom,superfamily_TIR_dom,smart_Ig_sub,smart_TIR_dom,pfscan_TIR_dom,pfscan_Ig-like,prints_IL1_rcpt_1,prints_Interleukin-1_rcpt_II	p.S275C	ENST00000372582.1	37	c.824	CCDS14517.1	X	.	.	.	.	.	.	.	.	.	.	C	17.26	3.343550	0.61073	.	.	ENSG00000189108	ENST00000372582;ENST00000344799	T;T	0.78003	-1.14;-1.14	5.32	5.32	0.75619	Immunoglobulin subtype (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.64402	D	0.000006	D	0.86112	0.5855	M	0.68593	2.085	0.80722	D	1	D	0.89917	1.0	D	0.68943	0.961	D	0.85289	0.1066	10	0.36615	T	0.2	.	16.8989	0.86108	0.0:1.0:0.0:0.0	.	275	Q9NP60	IRPL2_HUMAN	C	275	ENSP00000361663:S275C;ENSP00000344976:S275C	ENSP00000344976:S275C	S	+	2	0	IL1RAPL2	104848067	0.997000	0.39634	0.999000	0.59377	0.975000	0.68041	3.649000	0.54417	2.197000	0.70478	0.506000	0.49869	TCT	IL1RAPL2	-	smart_Ig_sub,pfscan_Ig-like		0.413	IL1RAPL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL1RAPL2	HGNC	protein_coding	OTTHUMT00000057785.1	C	NM_017416		104961411	+1	no_errors	ENST00000344799	ensembl	human	known	70_37	missense	SNP	0.990	G
INHBA	3624	genome.wustl.edu	37	7	41729911	41729911	+	Silent	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr7:41729911G>C	ENST00000242208.4	-	3	864	c.618C>G	c.(616-618)ctC>ctG	p.L206L	INHBA_ENST00000442711.1_Silent_p.L206L|AC005027.3_ENST00000416150.1_RNA|INHBA_ENST00000464515.1_5'UTR	NM_002192.2	NP_002183.1	P08476	INHBA_HUMAN	inhibin, beta A	206					activin receptor signaling pathway (GO:0032924)|cell cycle arrest (GO:0007050)|cell differentiation (GO:0030154)|cell surface receptor signaling pathway (GO:0007166)|cell-cell signaling (GO:0007267)|cellular response to cholesterol (GO:0071397)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|defense response (GO:0006952)|endodermal cell differentiation (GO:0035987)|erythrocyte differentiation (GO:0030218)|extrinsic apoptotic signaling pathway (GO:0097191)|eyelid development in camera-type eye (GO:0061029)|G1/S transition of mitotic cell cycle (GO:0000082)|growth (GO:0040007)|hair follicle development (GO:0001942)|hematopoietic progenitor cell differentiation (GO:0002244)|hemoglobin biosynthetic process (GO:0042541)|male gonad development (GO:0008584)|mesodermal cell differentiation (GO:0048333)|negative regulation of B cell differentiation (GO:0045578)|negative regulation of cell cycle (GO:0045786)|negative regulation of cell growth (GO:0030308)|negative regulation of cell proliferation (GO:0008285)|negative regulation of follicle-stimulating hormone secretion (GO:0046882)|negative regulation of interferon-gamma biosynthetic process (GO:0045077)|negative regulation of macrophage differentiation (GO:0045650)|negative regulation of phosphorylation (GO:0042326)|nervous system development (GO:0007399)|odontogenesis (GO:0042476)|ovarian follicle development (GO:0001541)|palate development (GO:0060021)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of erythrocyte differentiation (GO:0045648)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of follicle-stimulating hormone secretion (GO:0046881)|positive regulation of ovulation (GO:0060279)|positive regulation of pathway-restricted SMAD protein phosphorylation (GO:0010862)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|progesterone secretion (GO:0042701)|regulation of follicle-stimulating hormone secretion (GO:0046880)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to drug (GO:0042493)	activin A complex (GO:0043509)|extracellular region (GO:0005576)|inhibin A complex (GO:0043512)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|hormone activity (GO:0005179)|identical protein binding (GO:0042802)|peptide hormone binding (GO:0017046)|type II activin receptor binding (GO:0070699)			biliary_tract(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(15)|lung(26)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	55						CTTTTTCAGAGAGCAACAGTT	0.597										TSP Lung(11;0.080)																																							0													77.0	70.0	72.0					7																	41729911		2203	4300	6503	SO:0001819	synonymous_variant	3624				CCDS5464.1	7p15-p13	2014-01-30	2007-07-30		ENSG00000122641	ENSG00000122641		"""Endogenous ligands"""	6066	protein-coding gene	gene with protein product		147290	"""inhibin, beta A (activin A, activin AB alpha polypeptide)"""			3345731	Standard	NM_002192		Approved		uc003thr.3	P08476	OTTHUMG00000023574	ENST00000242208.4:c.618C>G	7.37:g.41729911G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14599	Silent	SNP	pfam_TGF-b_C,pfam_TGF-b_N,smart_TGF-b_C,prints_Inhibin_betaA,prints_Inhibin_asu	p.L206	ENST00000242208.4	37	c.618	CCDS5464.1	7																																																																																			INHBA	-	pfam_TGF-b_N		0.597	INHBA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INHBA	HGNC	protein_coding	OTTHUMT00000250793.1	G			41729911	-1	no_errors	ENST00000242208	ensembl	human	known	70_37	silent	SNP	0.078	C
INTS4L1	285905	genome.wustl.edu	37	7	64639820	64639820	+	RNA	SNP	C	C	G			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr7:64639820C>G	ENST00000587624.1	+	0	703							Q96LV5	IN4L1_HUMAN	integrator complex subunit 4-like 1																		AGAAAAATCTCTAACAACATC	0.448																																																	0																																												285905					7q11.21	2013-03-26			ENSG00000164669	ENSG00000164669			21925	other	unknown							Standard	XR_426205		Approved	FLJ25037		Q96LV5	OTTHUMG00000156510		7.37:g.64639820C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000587624.1	37	NULL		7																																																																																			INTS4L1	-	-		0.448	INTS4L1-002	KNOWN	non_canonical_conserved|basic	processed_transcript	INTS4L1	HGNC	pseudogene	OTTHUMT00000460821.1	C	XR_041315		64639820	+1	no_errors	ENST00000587624	ensembl	human	known	70_37	rna	SNP	1.000	G
IPPK	64768	genome.wustl.edu	37	9	95378117	95378117	+	Silent	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:95378117G>C	ENST00000287996.3	-	13	1749	c.1473C>G	c.(1471-1473)gtC>gtG	p.V491V	CENPP_ENST00000375587.3_3'UTR|IPPK_ENST00000486841.1_5'UTR|IPPK_ENST00000375522.1_Silent_p.V163V	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	491					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						GAAAGAGTTAGACCTTGTGGA	0.418																																																	0													130.0	102.0	112.0					9																	95378117		2203	4300	6503	SO:0001819	synonymous_variant	64768			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.1473C>G	9.37:g.95378117G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T9F7|Q9H7V8	Silent	SNP	pfam_Ins_P5_2-kin	p.V491	ENST00000287996.3	37	c.1473	CCDS6699.1	9																																																																																			IPPK	-	NULL		0.418	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPPK	HGNC	protein_coding	OTTHUMT00000053101.1	G	NM_022755		95378117	-1	no_errors	ENST00000287996	ensembl	human	known	70_37	silent	SNP	1.000	C
IPPK	64768	genome.wustl.edu	37	9	95378126	95378126	+	Silent	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:95378126G>A	ENST00000287996.3	-	13	1740	c.1464C>T	c.(1462-1464)ctC>ctT	p.L488L	CENPP_ENST00000375587.3_3'UTR|IPPK_ENST00000486841.1_5'UTR|IPPK_ENST00000375522.1_Silent_p.L160L	NM_022755.5	NP_073592.1	Q9H8X2	IPPK_HUMAN	inositol 1,3,4,5,6-pentakisphosphate 2-kinase	488					inositol phosphate metabolic process (GO:0043647)|inositol phosphorylation (GO:0052746)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|intracellular (GO:0005622)|nucleoplasm (GO:0005654)	ATP binding (GO:0005524)|inositol pentakisphosphate 2-kinase activity (GO:0035299)	p.L488L(1)		autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(3)|ovary(2)|skin(2)|urinary_tract(1)	15						AGACCTTGTGGAGAACTAATG	0.428																																																	1	Substitution - coding silent(1)	breast(1)											145.0	113.0	124.0					9																	95378126		2203	4300	6503	SO:0001819	synonymous_variant	64768			AK023225	CCDS6699.1	9q22.31	2010-12-02	2005-10-20	2005-10-20	ENSG00000127080	ENSG00000127080			14645	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 12"""	C9orf12		12084730	Standard	NM_022755		Approved	INSP5K2, FLJ13163, IP5K, IPK1	uc004asl.1	Q9H8X2	OTTHUMG00000020231	ENST00000287996.3:c.1464C>T	9.37:g.95378126G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T9F7|Q9H7V8	Silent	SNP	pfam_Ins_P5_2-kin	p.L488	ENST00000287996.3	37	c.1464	CCDS6699.1	9																																																																																			IPPK	-	NULL		0.428	IPPK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IPPK	HGNC	protein_coding	OTTHUMT00000053101.1	G	NM_022755		95378126	-1	no_errors	ENST00000287996	ensembl	human	known	70_37	silent	SNP	1.000	A
ITGA11	22801	genome.wustl.edu	37	15	68649536	68649536	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr15:68649536C>T	ENST00000315757.7	-	7	788	c.702G>A	c.(700-702)caG>caA	p.Q234Q	ITGA11_ENST00000562826.1_5'UTR|ITGA11_ENST00000423218.2_Silent_p.Q234Q	NM_001004439.1	NP_001004439.1	Q9UKX5	ITA11_HUMAN	integrin, alpha 11	234	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|cell adhesion mediated by integrin (GO:0033627)|cell-matrix adhesion (GO:0007160)|collagen-activated signaling pathway (GO:0038065)|extracellular matrix organization (GO:0030198)|integrin-mediated signaling pathway (GO:0007229)|muscle organ development (GO:0007517)|osteoblast differentiation (GO:0001649)|substrate-dependent cell migration (GO:0006929)	focal adhesion (GO:0005925)|integrin alpha11-beta1 complex (GO:0034681)|integrin complex (GO:0008305)|membrane (GO:0016020)|plasma membrane (GO:0005886)	collagen binding (GO:0005518)|collagen binding involved in cell-matrix adhesion (GO:0098639)|collagen receptor activity (GO:0038064)|metal ion binding (GO:0046872)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(7)|kidney(6)|large_intestine(6)|lung(22)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	52						TTCCTCCTCTCTGCTCAATGT	0.428																																																	0													81.0	80.0	80.0					15																	68649536		1935	4138	6073	SO:0001819	synonymous_variant	22801			AF109681	CCDS45291.1	15q22.3-q23	2010-03-23				ENSG00000137809		"""Integrins"""	6136	protein-coding gene	gene with protein product		604789				10486209	Standard	NM_001004439		Approved	HsT18964	uc002ari.3	Q9UKX5		ENST00000315757.7:c.702G>A	15.37:g.68649536C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	J3KQM2|Q8WYI8|Q9UKQ1	Silent	SNP	pfam_Integrin_alpha-2,pfam_VWF_A,pfam_FG-GAP,smart_Int_alpha_beta-p,smart_VWF_A,pfscan_VWF_A,prints_Integrin_alpha	p.Q234	ENST00000315757.7	37	c.702	CCDS45291.1	15																																																																																			ITGA11	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.428	ITGA11-201	KNOWN	basic|appris_candidate|CCDS	protein_coding	ITGA11	HGNC	protein_coding		C	NM_012211		68649536	-1	no_errors	ENST00000315757	ensembl	human	known	70_37	silent	SNP	1.000	T
ITGB8	3696	genome.wustl.edu	37	7	20406693	20406693	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr7:20406693G>T	ENST00000222573.4	+	3	956	c.272G>T	c.(271-273)aGc>aTc	p.S91I	ITGB8_ENST00000537992.1_5'UTR	NM_002214.2	NP_002205.1	P26012	ITB8_HUMAN	integrin, beta 8	91					cartilage development (GO:0051216)|cell adhesion (GO:0007155)|extracellular matrix organization (GO:0030198)|ganglioside metabolic process (GO:0001573)|integrin-mediated signaling pathway (GO:0007229)|negative regulation of gene expression (GO:0010629)|placenta blood vessel development (GO:0060674)|positive regulation of gene expression (GO:0010628)	cell surface (GO:0009986)|extracellular vesicular exosome (GO:0070062)|integrin alphav-beta8 complex (GO:0034686)|integrin complex (GO:0008305)|plasma membrane (GO:0005886)	extracellular matrix protein binding (GO:1990430)|receptor activity (GO:0004872)			NS(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(17)|prostate(2)|skin(4)|stomach(2)|urinary_tract(1)	37						AATTTAATAAGCAAAGGCTGC	0.343																																																	0													134.0	134.0	134.0					7																	20406693		2203	4300	6503	SO:0001583	missense	3696				CCDS5370.1	7p15.3	2010-03-23			ENSG00000105855	ENSG00000105855		"""Integrins"""	6163	protein-coding gene	gene with protein product		604160					Standard	XM_005249751		Approved		uc003suu.3	P26012	OTTHUMG00000023594	ENST00000222573.4:c.272G>T	7.37:g.20406693G>T	ENSP00000222573:p.Ser91Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D133|B4DHD4	Missense_Mutation	SNP	pfam_Integrin_bsu_N,pfam_EGF_extracell,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,pirsf_Integrin_bsu,prints_Integrin_bsu	p.S91I	ENST00000222573.4	37	c.272	CCDS5370.1	7	.	.	.	.	.	.	.	.	.	.	G	13.69	2.311320	0.40895	.	.	ENSG00000105855	ENST00000222573	D	0.92805	-3.11	5.82	4.93	0.64822	Integrin beta subunit, N-terminal (2);	0.418234	0.27473	N	0.019207	D	0.87752	0.6256	L	0.51914	1.62	0.80722	D	1	B;B	0.25169	0.119;0.096	B;B	0.28465	0.075;0.09	T	0.83255	-0.0051	10	0.45353	T	0.12	-5.2341	4.7209	0.12917	0.2248:0.1757:0.5995:0.0	.	91;91	P26012;Q9BUG9	ITB8_HUMAN;.	I	91	ENSP00000222573:S91I	ENSP00000222573:S91I	S	+	2	0	ITGB8	20373218	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	1.551000	0.36233	1.430000	0.47334	0.655000	0.94253	AGC	ITGB8	-	pfam_Integrin_bsu_N,superfamily_Plexin-like_fold,smart_Plexin-like,smart_Integrin_bsu_N,pirsf_Integrin_bsu,prints_Integrin_bsu		0.343	ITGB8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITGB8	HGNC	protein_coding	OTTHUMT00000059915.3	G	NM_002214		20406693	+1	no_errors	ENST00000222573	ensembl	human	known	70_37	missense	SNP	1.000	T
IWS1	55677	genome.wustl.edu	37	2	128263232	128263232	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:128263232C>T	ENST00000295321.4	-	3	506	c.247G>A	c.(247-249)Gaa>Aaa	p.E83K	IWS1_ENST00000455721.2_Missense_Mutation_p.E90K|AC010976.2_ENST00000599001.1_RNA|IWS1_ENST00000486662.1_5'UTR	NM_017969.2	NP_060439.2	Q96ST2	IWS1_HUMAN	IWS1 homolog (S. cerevisiae)	83	Glu-rich.				mRNA processing (GO:0006397)|mRNA transport (GO:0051028)|regulation of histone H3-K36 trimethylation (GO:2001253)|regulation of histone H4 acetylation (GO:0090239)|regulation of mRNA export from nucleus (GO:0010793)|regulation of mRNA processing (GO:0050684)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleus (GO:0005634)	DNA binding (GO:0003677)			cervix(1)|endometrium(2)|kidney(6)|large_intestine(2)|lung(12)|ovary(1)|prostate(1)|skin(2)|urinary_tract(1)	28	Colorectal(110;0.1)			BRCA - Breast invasive adenocarcinoma(221;0.0735)		TCCTCACTTTCAGAGTCACTA	0.468																																																	0													164.0	166.0	166.0					2																	128263232		2203	4300	6503	SO:0001583	missense	55677			AK000868	CCDS2146.1	2q14.3	2006-03-17			ENSG00000163166	ENSG00000163166			25467	protein-coding gene	gene with protein product							Standard	NM_017969		Approved	DKFZp761G0123, FLJ10006, FLJ14655, FLJ32319	uc002ton.2	Q96ST2	OTTHUMG00000131527	ENST00000295321.4:c.247G>A	2.37:g.128263232C>T	ENSP00000295321:p.Glu83Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TB65|Q6P157|Q8N3E8|Q96MI7|Q9NV97|Q9NWH8	Missense_Mutation	SNP	pfam_TFIIS_N,superfamily_TFIIS_N	p.E83K	ENST00000295321.4	37	c.247	CCDS2146.1	2	.	.	.	.	.	.	.	.	.	.	C	24.6	4.550580	0.86127	.	.	ENSG00000163166	ENST00000295321;ENST00000455721;ENST00000409725	T;T	0.32272	1.46;1.47	5.22	5.22	0.72569	.	0.152919	0.44285	D	0.000469	T	0.41442	0.1159	L	0.61218	1.895	0.43018	D	0.99456	D	0.58268	0.982	P	0.51266	0.664	T	0.19844	-1.0293	10	0.15952	T	0.53	-13.8826	17.3245	0.87244	0.0:1.0:0.0:0.0	.	83	Q96ST2	IWS1_HUMAN	K	83;90;88	ENSP00000295321:E83K;ENSP00000399245:E90K	ENSP00000295321:E83K	E	-	1	0	IWS1	127979702	1.000000	0.71417	1.000000	0.80357	0.958000	0.62258	5.595000	0.67563	2.421000	0.82119	0.491000	0.48974	GAA	IWS1	-	NULL		0.468	IWS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IWS1	HGNC	protein_coding	OTTHUMT00000254384.2	C	NM_017969		128263232	-1	no_errors	ENST00000295321	ensembl	human	known	70_37	missense	SNP	1.000	T
IZUMO3	100129669	genome.wustl.edu	37	9	24544225	24544225	+	Missense_Mutation	SNP	C	C	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:24544225C>A	ENST00000543880.2	-	5	695	c.464G>T	c.(463-465)aGg>aTg	p.R155M	IZUMO3_ENST00000604921.1_Missense_Mutation_p.R149M|RP11-20A20.2_ENST00000602851.1_lincRNA			Q5VZ72	IZUM3_HUMAN	IZUMO family member 3	155						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	protein homodimerization activity (GO:0042803)										TTTGAAGCACCTGTTAGTCAT	0.428																																																	0																																										SO:0001583	missense	100129669				CCDS65020.1	9p21.3	2014-02-17	2010-07-29	2010-07-29	ENSG00000205442	ENSG00000205442		"""-"""	31421	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 134"""	C9orf134		19658160, 22957301	Standard	NM_001271706		Approved	bA20A20.1	uc031tdg.1	Q5VZ72	OTTHUMG00000019704	ENST00000543880.2:c.464G>T	9.37:g.24544225C>A	ENSP00000438895:p.Arg155Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.R155M	ENST00000543880.2	37	c.464		9	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.30|15.30	2.791259|2.791259	0.50102|0.50102	.|.	.|.	ENSG00000205442|ENSG00000205442	ENST00000412335|ENST00000543880;ENST00000418122	.|T;T	.|0.25912	.|2.79;1.77	5.44|5.44	-4.9|-4.9	0.03094|0.03094	.|.	.|1.130430	.|0.06843	.|N	.|0.795999	T|T	0.24509|0.24509	0.0594|0.0594	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.49457|0.49457	-0.8938|-0.8938	3|6	.|0.72032	.|D	.|0.01	0.5674|0.5674	7.1005|7.1005	0.25333|0.25333	0.0:0.1711:0.2608:0.5681|0.0:0.1711:0.2608:0.5681	.|.	.|.	.|.	.|.	H|M	87|155;68	.|ENSP00000438895:R155M;ENSP00000391107:R68M	.|ENSP00000391107:R68M	Q|R	-|-	3|2	2|0	IZUMO3|IZUMO3	24534225|24534225	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.655000|0.655000	0.38815|0.38815	-1.449000|-1.449000	0.02392|0.02392	-0.713000|-0.713000	0.04981|0.04981	0.650000|0.650000	0.86243|0.86243	CAG|AGG	IZUMO3	-	NULL		0.428	IZUMO3-001	NOVEL	not_organism_supported|basic	protein_coding	IZUMO3	HGNC	protein_coding	OTTHUMT00000467652.1	C	NM_001271706		24544225	-1	no_errors	ENST00000543880	ensembl	human	known	70_37	missense	SNP	0.000	A
JAK3	3718	genome.wustl.edu	37	19	17942593	17942593	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:17942593G>A	ENST00000527670.1	-	19	2724	c.2695C>T	c.(2695-2697)Cgg>Tgg	p.R899W	JAK3_ENST00000534444.1_Missense_Mutation_p.R899W|JAK3_ENST00000458235.1_Missense_Mutation_p.R899W			P52333	JAK3_HUMAN	Janus kinase 3	899	Protein kinase 2. {ECO:0000255|PROSITE- ProRule:PRU00159}.				B cell differentiation (GO:0030183)|enzyme linked receptor protein signaling pathway (GO:0007167)|innate immune response (GO:0045087)|interleukin-4-mediated signaling pathway (GO:0035771)|intracellular signal transduction (GO:0035556)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|negative regulation of dendritic cell cytokine production (GO:0002731)|negative regulation of FasL biosynthetic process (GO:0045221)|negative regulation of interleukin-10 production (GO:0032693)|negative regulation of interleukin-12 production (GO:0032695)|negative regulation of T cell activation (GO:0050868)|negative regulation of T-helper 1 cell differentiation (GO:0045626)|negative regulation of thymocyte apoptotic process (GO:0070244)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of dendritic cell apoptotic process (GO:2000670)|positive regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001241)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein phosphorylation (GO:0006468)|regulation of T cell apoptotic process (GO:0070232)|response to interleukin-15 (GO:0070672)|response to interleukin-2 (GO:0070669)|response to interleukin-4 (GO:0070670)|response to interleukin-9 (GO:0071104)|STAT protein import into nucleus (GO:0007262)|T cell homeostasis (GO:0043029)|tyrosine phosphorylation of STAT protein (GO:0007260)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|endometrium(4)|haematopoietic_and_lymphoid_tissue(85)|kidney(4)|large_intestine(11)|lung(22)|ovary(3)|prostate(5)|skin(1)|stomach(2)|upper_aerodigestive_tract(5)	147					Tofacitinib(DB08895)	ATGACCAGCCGCAGGCTCTGG	0.667		2	Mis		"""acute megakaryocytic leukemia, ETP ALL"""																																			Dom	yes		19	19p13.1	3718	Janus kinase 3		L	0													17.0	21.0	20.0					19																	17942593		2169	4247	6416	SO:0001583	missense	3718			U31601	CCDS12366.1	19p13-p12	2014-09-17	2009-04-23		ENSG00000105639	ENSG00000105639	2.7.10.1		6193	protein-coding gene	gene with protein product	"""tyrosine-protein kinase JAK3"", ""leukocyte Janus kinase"""	600173				8921370, 9226382	Standard	NM_000215		Approved	L-JAK, JAKL, LJAK, JAK3_HUMAN, JAK-3	uc002nhn.4	P52333	OTTHUMG00000165648	ENST00000527670.1:c.2695C>T	19.37:g.17942593G>A	ENSP00000432511:p.Arg899Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q13259|Q13260|Q13611|Q8N1E8|Q99699|Q9Y6S2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak3,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R899W	ENST00000527670.1	37	c.2695	CCDS12366.1	19	.	.	.	.	.	.	.	.	.	.	G	18.21	3.572394	0.65765	.	.	ENSG00000105639	ENST00000458235;ENST00000527670;ENST00000534444	T;T;D	0.88818	0.09;0.09;-2.43	2.63	2.63	0.31362	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.413514	0.24336	N	0.039409	D	0.87462	0.6183	N	0.11789	0.175	0.41542	D	0.988528	P;D	0.89917	0.831;1.0	P;D	0.80764	0.512;0.994	D	0.88643	0.3177	10	0.87932	D	0	-28.0207	11.4253	0.50007	0.0:0.0:1.0:0.0	.	899;899	P52333-2;P52333	.;JAK3_HUMAN	W	899	ENSP00000391676:R899W;ENSP00000432511:R899W;ENSP00000436421:R899W	ENSP00000391676:R899W	R	-	1	2	JAK3	17803593	1.000000	0.71417	0.998000	0.56505	0.992000	0.81027	2.233000	0.43027	1.799000	0.52666	0.462000	0.41574	CGG	JAK3	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_Prot_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2		0.667	JAK3-005	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK3	HGNC	protein_coding	OTTHUMT00000385549.1	G	NM_000215		17942593	-1	no_errors	ENST00000458235	ensembl	human	known	70_37	missense	SNP	1.000	A
KIAA0895L	653319	genome.wustl.edu	37	16	67214570	67214570	+	Splice_Site	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr16:67214570C>T	ENST00000290881.7	-	3	871		c.e3-1		KIAA0895L_ENST00000563831.2_Intron|KIAA0895L_ENST00000561621.1_Splice_Site|KIAA0895L_ENST00000563902.1_Splice_Site			Q68EN5	K895L_HUMAN	KIAA0895-like											breast(2)|endometrium(5)|kidney(2)|large_intestine(3)|lung(2)|prostate(2)|skin(1)	17						CTGTCGACCTCTGGGGACACA	0.622																																																	0																																										SO:0001630	splice_region_variant	653319			AK092303	CCDS42177.1	16q22.1	2008-11-27				ENSG00000196123			34408	protein-coding gene	gene with protein product							Standard	NM_001040715		Approved	LOC653319	uc002ert.3	Q68EN5		ENST00000290881.7:c.56-1G>A	16.37:g.67214570C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2VCS8|Q8N3H9|Q8NAQ5|Q96IE5	Splice_Site	SNP	-	e1-1	ENST00000290881.7	37	c.1-1	CCDS42177.1	16																																																																																			KIAA0895L	-	-		0.622	KIAA0895L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0895L	HGNC	protein_coding	OTTHUMT00000421193.4	C	NM_001040715	Intron	67214570	-1	no_errors	ENST00000290881	ensembl	human	known	70_37	splice_site	SNP	0.994	T
KIR3DL3	115653	genome.wustl.edu	37	19	55239168	55239168	+	Missense_Mutation	SNP	G	G	T	rs62132665	byFrequency	TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:55239168G>T	ENST00000291860.1	+	4	465	c.447G>T	c.(445-447)agG>agT	p.R149S	KIR3DL1_ENST00000402254.2_Intron|KIR2DL4_ENST00000396284.2_Intron|KIR3DL1_ENST00000538269.1_Intron|KIR3DL1_ENST00000541392.1_Intron|CTB-61M7.1_ENST00000400864.3_RNA	NM_153443.3	NP_703144.2	Q8N743	KI3L3_HUMAN	killer cell immunoglobulin-like receptor, three domains, long cytoplasmic tail, 3	149	Ig-like C2-type 2. {ECO:0000305}.		R -> S (in allele KIR3DL3*00601, allele KIR3DL3*00602, allele KIR3DL3*01501 and allele KIR3DL3*01601; dbSNP:rs62132665).			integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(7)|lung(5)|ovary(3)|prostate(1)|skin(1)	21				GBM - Glioblastoma multiforme(193;0.0192)		CAGATGTCAGGTTTGAGCGCT	0.567													.|||	535	0.106829	0.0719	0.0692	5008	,	,		10666	0.1786		0.1054	False		,,,				2504	0.1084																0								G	SER/ARG	261,3657		59,143,1757	46.0	38.0	41.0		447	-2.8	0.0	19	dbSNP_129	41	983,5701		327,329,2686	no	missense	KIR3DL3	NM_153443.3	110	386,472,4443	TT,TG,GG		14.7068,6.6616,11.7336	benign	149/411	55239168	1244,9358	1959	3342	5301	SO:0001583	missense	115653			AF352324	CCDS12903.1	19q13.4	2014-05-22			ENSG00000242019	ENSG00000242019		"""Killer cell immunoglobulin-like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	16312	protein-coding gene	gene with protein product		610095				11513144	Standard	NM_153443		Approved	KIRC1, KIR3DL7, KIR44, CD158z	uc002qgu.1	Q8N743	OTTHUMG00000065884	ENST00000291860.1:c.447G>T	19.37:g.55239168G>T	ENSP00000291860:p.Arg149Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A9PL62|A9PL64|A9PL65|A9PL66|A9PL67|A9PL68|A9PZV4|A9PZV7|A9PZV8|A9Q066|A9Q0R5|A9Q242|A9Q250|A9Q251|O95056|Q1X775|Q1X777|Q1X778|Q1X779|Q1X780|Q1X781|Q1X782|Q1X783|Q7Z7N4|Q8NHI2|Q8NHI3|Q9UEI4	Missense_Mutation	SNP	pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2	p.R149S	ENST00000291860.1	37	c.447	CCDS12903.1	19	.	.	.	.	.	.	.	.	.	.	N	6.031	0.374095	0.11409	0.066616	0.147068	ENSG00000242019	ENST00000291860	T	0.02656	4.21	1.38	-2.75	0.05914	Immunoglobulin subtype (1);Immunoglobulin-like fold (1);	2.964280	0.02169	U	0.059553	T	0.00012	0.0000	N	0.16037	0.36	0.80722	P	0.0	B	0.21381	0.055	B	0.23574	0.047	T	0.45249	-0.9274	9	0.46703	T	0.11	.	2.8595	0.05582	0.3742:0.2446:0.3813:0.0	rs62132665	149	Q8N743	KI3L3_HUMAN	S	149	ENSP00000291860:R149S	ENSP00000291860:R149S	R	+	3	2	KIR3DL3	59930980	0.000000	0.05858	0.000000	0.03702	0.009000	0.06853	-0.406000	0.07187	-0.983000	0.03511	0.205000	0.17691	AGG	KIR3DL3	-	smart_Ig_sub		0.567	KIR3DL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIR3DL3	HGNC	protein_coding	OTTHUMT00000141147.1	G	NM_153443		55239168	+1	no_errors	ENST00000291860	ensembl	human	known	70_37	missense	SNP	0.000	T
LAD1	3898	genome.wustl.edu	37	1	201354847	201354847	+	Silent	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:201354847G>A	ENST00000391967.2	-	4	1414	c.1113C>T	c.(1111-1113)ccC>ccT	p.P371P	LAD1_ENST00000367313.3_Silent_p.P385P|LAD1_ENST00000488842.1_5'Flank	NM_005558.3	NP_005549.2	O00515	LAD1_HUMAN	ladinin 1	371						basement membrane (GO:0005604)	structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(6)|prostate(2)|skin(2)	19						AGATGGTCCTGGGGCTGGAGC	0.597											OREG0014078	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													211.0	187.0	195.0					1																	201354847		2203	4300	6503	SO:0001819	synonymous_variant	3898			U42408	CCDS1410.1	1q25.1-q32.3	2008-02-05			ENSG00000159166	ENSG00000159166			6472	protein-coding gene	gene with protein product		602314				8618013, 9119369	Standard	NM_005558		Approved		uc001gwm.3	O00515	OTTHUMG00000035737	ENST00000391967.2:c.1113C>T	1.37:g.201354847G>A		Somatic	2121	WXS	Illumina HiSeq	Phase_IV	O95614|Q96GD8	Silent	SNP	pirsf_Ladinin_1	p.P385	ENST00000391967.2	37	c.1155	CCDS1410.1	1																																																																																			LAD1	-	pirsf_Ladinin_1		0.597	LAD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAD1	HGNC	protein_coding	OTTHUMT00000086946.1	G	NM_005558		201354847	-1	no_errors	ENST00000367313	ensembl	human	known	70_37	silent	SNP	1.000	A
LIN9	286826	genome.wustl.edu	37	1	226465515	226465515	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:226465515C>T	ENST00000328205.5	-	7	1236	c.691G>A	c.(691-693)Gaa>Aaa	p.E231K	LIN9_ENST00000481685.1_Missense_Mutation_p.E196K|LIN9_ENST00000366801.1_Missense_Mutation_p.E180K	NM_173083.3	NP_775106.2	Q5TKA1	LIN9_HUMAN	lin-9 DREAM MuvB core complex component	215	Sufficient for interaction with RB1.				DNA replication (GO:0006260)|G2/M transition of mitotic cell cycle (GO:0000086)|mitotic cell cycle (GO:0000278)|regulation of cell cycle (GO:0051726)|transcription, DNA-templated (GO:0006351)	nucleoplasm (GO:0005654)|transcriptional repressor complex (GO:0017053)				breast(3)|endometrium(4)|kidney(2)|large_intestine(6)|lung(9)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	28	Breast(184;0.158)			GBM - Glioblastoma multiforme(131;0.131)		AAAGGAATTTCATCTGGGAGA	0.343																																					Ovarian(197;1696 2974 11248 14117)												0													124.0	128.0	127.0					1																	226465515		2203	4300	6503	SO:0001583	missense	286826			AY166858	CCDS1553.1	1q42	2014-07-17	2014-07-17		ENSG00000183814	ENSG00000183814			30830	protein-coding gene	gene with protein product	"""TUDOR gene similar"", ""rb related pathway actor"""	609375	"""lin-9 homolog (C. elegans)"""			15538385, 23667535	Standard	NM_173083		Approved	TGS	uc001hqa.3	Q5TKA1	OTTHUMG00000037557	ENST00000328205.5:c.691G>A	1.37:g.226465515C>T	ENSP00000329102:p.Glu231Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5U5L8|Q5U7E1|Q6PI55|Q6ZTV4|Q7Z3J1	Missense_Mutation	SNP	pfam_DIRP	p.E231K	ENST00000328205.5	37	c.691	CCDS1553.1	1	.	.	.	.	.	.	.	.	.	.	C	26.7	4.760235	0.89932	.	.	ENSG00000183814	ENST00000460719;ENST00000328205;ENST00000366808;ENST00000366801;ENST00000481685;ENST00000366807	.	.	.	5.87	5.87	0.94306	.	0.000000	0.85682	D	0.000000	T	0.70789	0.3264	L	0.43646	1.37	0.80722	D	1	D;P;D	0.54964	0.961;0.875;0.969	P;P;P	0.57101	0.813;0.591;0.793	T	0.68104	-0.5497	9	0.44086	T	0.13	.	20.2182	0.98305	0.0:1.0:0.0:0.0	.	196;215;365	C9J5J4;Q5TKA1;B1ANK3	.;LIN9_HUMAN;.	K	191;231;286;180;196;365	.	ENSP00000329102:E231K	E	-	1	0	LIN9	224532138	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.380000	0.79704	2.785000	0.95823	0.655000	0.94253	GAA	LIN9	-	pfam_DIRP		0.343	LIN9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LIN9	HGNC	protein_coding	OTTHUMT00000091523.2	C	NM_173083		226465515	-1	no_errors	ENST00000328205	ensembl	human	known	70_37	missense	SNP	1.000	T
MALAT1	378938	genome.wustl.edu	37	11	65266499	65266499	+	lincRNA	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:65266499C>T	ENST00000534336.1	+	0	1267				AP000769.7_ENST00000602344.1_lincRNA	NR_002819.2		Q9UHZ2	MALAT_HUMAN	metastasis associated lung adenocarcinoma transcript 1 (non-protein coding)																		AAATACGCCTCGCCCGAGCTG	0.527																																																	0													127.0	129.0	129.0					11																	65266499		874	1988	2862			378938			AF001540		11q13.1	2013-12-11	2007-11-20		ENSG00000251562	ENSG00000251562		"""Long non-coding RNAs"", ""-"""	29665	non-coding RNA	RNA, long non-coding	"""metastasis associated in lung adenocarcinoma transcript 1"", ""non-protein coding RNA 47"", ""hepcarcin"", ""nuclear enriched abundant transcript 2"", ""nuclear paraspeckle assembly transcript 2 (non-protein coding)"", ""long intergenic non-protein coding RNA 47"""	607924				12970751, 22560368	Standard	NR_002819		Approved	PRO1073, MALAT-1, NCRNA00047, HCN, NEAT2, LINC00047, mascRNA	uc010roh.3	Q9UHZ2	OTTHUMG00000166322		11.37:g.65266499C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000534336.1	37	NULL		11																																																																																			MALAT1	-	-		0.527	MALAT1-001	KNOWN	basic	lincRNA	MALAT1	HGNC	lincRNA	OTTHUMT00000389143.1	C	NR_002819		65266499	+1	no_errors	ENST00000534336	ensembl	human	known	70_37	rna	SNP	0.001	T
MAP7D3	79649	genome.wustl.edu	37	X	135313040	135313040	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:135313040G>C	ENST00000316077.9	-	9	1719	c.1499C>G	c.(1498-1500)tCt>tGt	p.S500C	MAP7D3_ENST00000495432.1_5'Flank|MAP7D3_ENST00000370661.1_Missense_Mutation_p.S465C|MAP7D3_ENST00000370663.5_Missense_Mutation_p.S482C	NM_024597.3	NP_078873.2	Q8IWC1	MA7D3_HUMAN	MAP7 domain containing 3	500					microtubule cytoskeleton organization (GO:0000226)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)		p.S797Y(1)		central_nervous_system(1)|cervix(2)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(7)|lung(21)|ovary(2)|prostate(1)|skin(1)	44	Acute lymphoblastic leukemia(192;0.000127)					ATTTTCAGGAGATGATGACCA	0.408																																																	1	Substitution - Missense(1)	lung(1)											166.0	147.0	153.0					X																	135313040		1989	4155	6144	SO:0001583	missense	79649			AL832120	CCDS44004.1, CCDS55508.1, CCDS55509.1	Xq26.3	2014-08-13			ENSG00000129680	ENSG00000129680			25742	protein-coding gene	gene with protein product		300930				24927501	Standard	NM_001173516		Approved	FLJ12649	uc004ezt.3	Q8IWC1	OTTHUMG00000022507	ENST00000316077.9:c.1499C>G	X.37:g.135313040G>C	ENSP00000318086:p.Ser500Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2J0|A6NCZ7|A6NHR4|B4DWD2|H7BY77|Q5JXI5|Q5JXI6|Q6P2S1|Q9H9M8	Missense_Mutation	SNP	pfam_E-MAP-115	p.S482C	ENST00000316077.9	37	c.1445	CCDS44004.1	X	.	.	.	.	.	.	.	.	.	.	g	15.59	2.878531	0.51801	.	.	ENSG00000129680	ENST00000370661;ENST00000316077;ENST00000370663;ENST00000370660	T;T;T;T	0.06068	4.19;3.65;3.65;3.35	4.89	4.89	0.63831	.	0.270116	0.19941	N	0.102655	T	0.18341	0.0440	L	0.46157	1.445	0.09310	N	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.91635	0.998;0.999;0.998;0.999	T	0.02009	-1.1230	10	0.72032	D	0.01	-18.9232	12.4998	0.55950	0.0:0.0:1.0:0.0	.	482;459;500;465	B4DWD2;Q8IWC1-2;Q8IWC1;Q8IWC1-3	.;.;MA7D3_HUMAN;.	C	465;500;482;459	ENSP00000359695:S465C;ENSP00000318086:S500C;ENSP00000359697:S482C;ENSP00000359694:S459C	ENSP00000318086:S500C	S	-	2	0	MAP7D3	135140706	0.916000	0.31088	0.008000	0.14137	0.007000	0.05969	4.947000	0.63583	2.000000	0.58554	0.597000	0.82753	TCT	MAP7D3	-	NULL		0.408	MAP7D3-001	PUTATIVE	basic|appris_candidate_longest|CCDS	protein_coding	MAP7D3	HGNC	protein_coding	OTTHUMT00000058487.2	G			135313040	-1	no_errors	ENST00000370663	ensembl	human	known	70_37	missense	SNP	0.036	C
MCL1	4170	genome.wustl.edu	37	1	150550970	150550970	+	Intron	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:150550970G>A	ENST00000369026.2	-	2	748				MCL1_ENST00000307940.3_Intron|MCL1_ENST00000464132.1_5'UTR	NM_001197320.1|NM_021960.4	NP_001184249.1|NP_068779.1	Q07820	MCL1_HUMAN	myeloid cell leukemia 1						apoptotic mitochondrial changes (GO:0008637)|cell fate determination (GO:0001709)|cellular homeostasis (GO:0019725)|extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|multicellular organismal development (GO:0007275)|negative regulation of anoikis (GO:2000811)|negative regulation of extrinsic apoptotic signaling pathway in absence of ligand (GO:2001240)|negative regulation of intrinsic apoptotic signaling pathway (GO:2001243)|positive regulation of oxidative stress-induced neuron intrinsic apoptotic signaling pathway (GO:1903378)|protein transmembrane transport (GO:0071806)|regulation of response to DNA damage stimulus (GO:2001020)|response to cytokine (GO:0034097)	Bcl-2 family protein complex (GO:0097136)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrial matrix (GO:0005759)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	BH3 domain binding (GO:0051434)|protein channel activity (GO:0015266)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			endometrium(2)|large_intestine(1)|lung(4)|prostate(1)	8	all_cancers(9;1.69e-53)|all_epithelial(9;1.95e-43)|all_lung(15;1.09e-34)|Lung NSC(24;4.04e-31)|Breast(34;0.000326)|Lung SC(34;0.00471)|Ovarian(49;0.0167)|all_hematologic(923;0.0395)|Hepatocellular(266;0.108)|Melanoma(130;0.128)|Colorectal(459;0.171)		UCEC - Uterine corpus endometrioid carcinoma (35;0.0241)|Epithelial(6;3.18e-23)|all cancers(9;1.79e-22)|OV - Ovarian serous cystadenocarcinoma(6;1.13e-14)|BRCA - Breast invasive adenocarcinoma(12;0.000503)|LUSC - Lung squamous cell carcinoma(543;0.171)|STAD - Stomach adenocarcinoma(528;0.206)			AAGCATGCCTGAGAAAGAAAA	0.522																																																	0													63.0	67.0	66.0					1																	150550970		2203	4300	6503	SO:0001627	intron_variant	4170			BC017197	CCDS956.1, CCDS957.1, CCDS72909.1	1q21	2014-03-07	2014-03-07		ENSG00000143384	ENSG00000143384			6943	protein-coding gene	gene with protein product		159552	"""myeloid cell leukemia sequence 1 (BCL2-related)"""			7682708, 7835896	Standard	NM_021960		Approved	BCL2L3, Mcl-1	uc001euz.3	Q07820	OTTHUMG00000034867	ENST00000369026.2:c.689-3C>T	1.37:g.150550970G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6B2|D3DV03|D3DV04|Q9HD91|Q9NRQ3|Q9NRQ4|Q9UHR7|Q9UHR8|Q9UHR9|Q9UNJ1	RNA	SNP	-	NULL	ENST00000369026.2	37	NULL	CCDS957.1	1																																																																																			MCL1	-	-		0.522	MCL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCL1	HGNC	protein_coding	OTTHUMT00000084402.1	G	NM_021960		150550970	-1	no_errors	ENST00000464132	ensembl	human	known	70_37	rna	SNP	0.416	A
Unknown	0	genome.wustl.edu	37	17	20492825	20492825	+	IGR	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:20492825G>C								CDRT15L2 (8601 upstream) : AC087499.10 (23399 downstream)																							CCTGGTCTTTGAGAAATGTGA	0.627																																																	0																																										SO:0001628	intergenic_variant	257468																															17.37:g.20492825G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		17																																																																																			MEIS3P2	-	-	0	0.627					MEIS3P2	HGNC			G			20492825	+1	no_errors	ENST00000340731	ensembl	human	known	70_37	rna	SNP	1.000	C
Unknown	0	genome.wustl.edu	37	17	20492960	20492960	+	IGR	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:20492960G>A								CDRT15L2 (8736 upstream) : AC087499.10 (23264 downstream)																							GGTTCGCTCTGAGAGGCCCTT	0.607																																																	0																																										SO:0001628	intergenic_variant	257468																															17.37:g.20492960G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		17																																																																																			MEIS3P2	-	-	0	0.607					MEIS3P2	HGNC			G			20492960	+1	no_errors	ENST00000340731	ensembl	human	known	70_37	rna	SNP	0.998	A
MSH5	4439	genome.wustl.edu	37	6	31729633	31729633	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr6:31729633C>T	ENST00000375755.3	+	23	2506	c.2220C>T	c.(2218-2220)ttC>ttT	p.F740F	MSH5-SAPCD1_ENST00000491552.1_3'UTR|MSH5_ENST00000395853.1_Silent_p.F414F|SAPCD1_ENST00000415669.2_5'Flank|MSH5_ENST00000375703.3_Silent_p.F741F|SAPCD1-AS1_ENST00000419679.1_RNA|MSH5_ENST00000431848.2_Silent_p.F439F|MSH5_ENST00000534153.4_Silent_p.F757F|MSH5_ENST00000375750.3_Silent_p.F740F|SAPCD1_ENST00000425424.1_5'Flank|MSH5-SAPCD1_ENST00000493662.2_Silent_p.F757F|MSH5_ENST00000375742.3_Silent_p.F757F|MSH5_ENST00000375740.3_Silent_p.F758F	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	740					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.F126L(1)|p.F741L(1)|p.F757L(1)		breast(1)|ovary(2)|skin(2)	5						ATCTTGTCTTCTTCTATCAGG	0.522								Direct reversal of damage;Mismatch excision repair (MMR)																																									3	Substitution - Missense(3)	lung(3)											186.0	198.0	193.0					6																	31729633		1510	2709	4219	SO:0001819	synonymous_variant	4439			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.2220C>T	6.37:g.31729633C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Silent	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.F757	ENST00000375755.3	37	c.2271	CCDS4720.1	6																																																																																			MSH5	-	pfam_DNA_mismatch_repair_MutS_C,smart_DNA_mismatch_repair_MutS_C		0.522	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MSH5	HGNC	protein_coding	OTTHUMT00000076243.4	C			31729633	+1	no_errors	ENST00000375742	ensembl	human	known	70_37	silent	SNP	1.000	T
MSN	4478	genome.wustl.edu	37	X	64953115	64953115	+	Silent	SNP	C	C	T	rs184924480		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:64953115C>T	ENST00000360270.5	+	7	940	c.768C>T	c.(766-768)gtC>gtT	p.V256V		NM_002444.2	NP_002435.1	P26038	MOES_HUMAN	moesin	256	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cellular component movement (GO:0006928)|establishment of endothelial barrier (GO:0061028)|leukocyte cell-cell adhesion (GO:0007159)|leukocyte migration (GO:0050900)|membrane to membrane docking (GO:0022614)|positive regulation of gene expression (GO:0010628)|regulation of lymphocyte migration (GO:2000401)	apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|blood microparticle (GO:0072562)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|extrinsic component of membrane (GO:0019898)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|microvillus (GO:0005902)|plasma membrane (GO:0005886)|uropod (GO:0001931)|vesicle (GO:0031982)	cell adhesion molecule binding (GO:0050839)|double-stranded RNA binding (GO:0003725)|protein kinase binding (GO:0019901)|receptor binding (GO:0005102)|structural constituent of cytoskeleton (GO:0005200)		MSN/ALK(6)	breast(4)|central_nervous_system(3)|endometrium(7)|kidney(5)|large_intestine(6)|lung(11)|ovary(3)|prostate(1)|skin(2)|urinary_tract(1)	43						AGAAATTTGTCATCAAGCCCA	0.428			T	ALK	ALCL																																			Dom	yes		X	Xq11.2-q12	4478	moesin		L	0													100.0	91.0	94.0					X																	64953115		2203	4300	6503	SO:0001819	synonymous_variant	4478			M69066	CCDS14382.1	Xq11.1	2010-10-20			ENSG00000147065	ENSG00000147065			7373	protein-coding gene	gene with protein product		309845				1924289, 7628534	Standard	XM_005262269		Approved		uc004dwf.3	P26038	OTTHUMG00000021723	ENST00000360270.5:c.768C>T	X.37:g.64953115C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pirsf_ERM,pfam_ERM_C,pfam_FERM_PH-like_C,pfam_FERM_central,pfam_FERM_N,superfamily_FERM_central,superfamily_Moesin,smart_Band_41_domain,prints_Ez/rad/moesin,prints_Band_41_fam,pfscan_FERM_domain	p.V256	ENST00000360270.5	37	c.768	CCDS14382.1	X																																																																																			MSN	-	pirsf_ERM,pfam_FERM_PH-like_C,pfscan_FERM_domain		0.428	MSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MSN	HGNC	protein_coding	OTTHUMT00000056981.1	C	NM_002444		64953115	+1	no_errors	ENST00000360270	ensembl	human	known	70_37	silent	SNP	1.000	T
MYO3B	140469	genome.wustl.edu	37	2	171070968	171070968	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:171070968C>T	ENST00000408978.4	+	4	544	c.401C>T	c.(400-402)tCa>tTa	p.S134L	MYO3B_ENST00000334231.6_Missense_Mutation_p.S143L|MYO3B_ENST00000602629.1_3'UTR|MYO3B_ENST00000409044.3_Missense_Mutation_p.S134L	NM_138995.4	NP_620482.3	Q8WXR4	MYO3B_HUMAN	myosin IIIB	134	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of filopodium assembly (GO:0051491)|protein autophosphorylation (GO:0046777)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytoplasm (GO:0005737)|filopodium tip (GO:0032433)|myosin complex (GO:0016459)|photoreceptor inner segment (GO:0001917)|photoreceptor outer segment (GO:0001750)|stereocilium bundle tip (GO:0032426)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(9)|lung(25)|ovary(6)|pancreas(1)|prostate(1)|skin(5)|stomach(1)|upper_aerodigestive_tract(2)	59						GCAATGATCTCATACATCTTG	0.478																																																	0													95.0	91.0	92.0					2																	171070968		1949	4150	6099	SO:0001583	missense	140469				CCDS42773.1, CCDS46446.1	2q31.1-q31.2	2011-09-27			ENSG00000071909	ENSG00000071909		"""Myosins / Myosin superfamily : Class III"""	15576	protein-coding gene	gene with protein product		610040					Standard	NM_001083615		Approved		uc002ufy.3	Q8WXR4	OTTHUMG00000154002	ENST00000408978.4:c.401C>T	2.37:g.171070968C>T	ENSP00000386213:p.Ser134Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B8ZZR2|Q53QE1|Q53T08|Q8IX64|Q8IX65|Q8IX66|Q8IX67|Q8IX68|Q96N94	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,pfscan_Prot_kinase_cat_dom,prints_Myosin_head_motor_dom	p.S143L	ENST00000408978.4	37	c.428	CCDS42773.1	2	.	.	.	.	.	.	.	.	.	.	C	23.4	4.416441	0.83449	.	.	ENSG00000071909	ENST00000409044;ENST00000408978;ENST00000317915;ENST00000484338;ENST00000334231	T;T;T;T	0.64991	-0.13;-0.13;-0.13;-0.13	5.41	5.41	0.78517	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.60287	0.2257	L	0.29908	0.895	0.58432	D	0.999998	P;P;P;P	0.45768	0.696;0.866;0.835;0.866	B;P;B;P	0.46208	0.281;0.507;0.311;0.507	T	0.65504	-0.6152	10	0.87932	D	0	.	19.1959	0.93689	0.0:1.0:0.0:0.0	.	134;134;134;134	Q8WXR4-5;B7ZM71;Q8WXR4-4;Q8WXR4	.;.;.;MYO3B_HUMAN	L	134;134;133;143;143	ENSP00000386497:S134L;ENSP00000386213:S134L;ENSP00000446237:S143L;ENSP00000335100:S143L	ENSP00000314213:S133L	S	+	2	0	MYO3B	170779214	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	7.412000	0.80091	2.549000	0.85964	0.650000	0.86243	TCA	MYO3B	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.478	MYO3B-004	NOVEL	basic|appris_candidate_longest|CCDS	protein_coding	MYO3B	HGNC	protein_coding	OTTHUMT00000333410.1	C			171070968	+1	no_errors	ENST00000334231	ensembl	human	known	70_37	missense	SNP	1.000	T
MYOM1	8736	genome.wustl.edu	37	18	3151753	3151753	+	Silent	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr18:3151753G>A	ENST00000356443.4	-	12	2115	c.1782C>T	c.(1780-1782)ttC>ttT	p.F594F	MYOM1_ENST00000261606.7_Silent_p.F594F|MYOM1_ENST00000400569.3_Silent_p.F594F	NM_003803.3|NM_019856.1	NP_003794.3|NP_062830.1	P52179	MYOM1_HUMAN	myomesin 1	594	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				muscle contraction (GO:0006936)	M band (GO:0031430)|striated muscle myosin thick filament (GO:0005863)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|structural constituent of muscle (GO:0008307)			NS(2)|autonomic_ganglia(1)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(15)|lung(20)|ovary(4)|pancreas(1)|prostate(4)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	77						CTCGAGATGGGAAACCTATTC	0.458											OREG0024839	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													88.0	89.0	89.0					18																	3151753		1908	4147	6055	SO:0001819	synonymous_variant	8736			AF185573	CCDS45823.1, CCDS45824.1	18p11.31	2014-09-17	2012-10-17		ENSG00000101605	ENSG00000101605		"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7613	protein-coding gene	gene with protein product	"""skelemin"""	603508	"""myomesin 1 (skelemin) (185kD)"", ""myomesin 1 (skelemin) 185kDa"", ""myomesin 1, 185kDa"""			9806852	Standard	NM_019856		Approved		uc002klp.3	P52179	OTTHUMG00000178209	ENST00000356443.4:c.1782C>T	18.37:g.3151753G>A		Somatic	609	WXS	Illumina HiSeq	Phase_IV	Q14BD6|Q6H969|Q6ZUU0	Silent	SNP	pfam_Fibronectin_type3,pfam_Ig_I-set,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,pfscan_Fibronectin_type3,pfscan_Ig-like	p.F594	ENST00000356443.4	37	c.1782	CCDS45824.1	18																																																																																			MYOM1	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3		0.458	MYOM1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MYOM1	HGNC	protein_coding	OTTHUMT00000441037.2	G	NM_003803		3151753	-1	no_errors	ENST00000356443	ensembl	human	known	70_37	silent	SNP	0.001	A
NR1H2	7376	genome.wustl.edu	37	19	50837639	50837639	+	Intron	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:50837639G>A	ENST00000600978.1	+	2	74				KCNC3_ENST00000391818.2_5'Flank|KCNC3_ENST00000474951.1_5'Flank|NAPSB_ENST00000527780.1_RNA|NR1H2_ENST00000542413.1_Intron			P55055	NR1H2_HUMAN	nuclear receptor subfamily 1, group H, member 2						cellular lipid metabolic process (GO:0044255)|gene expression (GO:0010467)|negative regulation of cholesterol storage (GO:0010887)|negative regulation of interferon-gamma-mediated signaling pathway (GO:0060336)|negative regulation of lipid transport (GO:0032369)|negative regulation of macrophage derived foam cell differentiation (GO:0010745)|negative regulation of pinocytosis (GO:0048550)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cellular protein metabolic process (GO:0032270)|positive regulation of cholesterol efflux (GO:0010875)|positive regulation of cholesterol transport (GO:0032376)|positive regulation of fatty acid biosynthetic process (GO:0045723)|positive regulation of lipoprotein lipase activity (GO:0051006)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of triglyceride biosynthetic process (GO:0010867)|regulation of cholesterol homeostasis (GO:2000188)|retinoic acid receptor signaling pathway (GO:0048384)|transcription initiation from RNA polymerase II promoter (GO:0006367)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	apolipoprotein A-I receptor binding (GO:0034191)|ATPase binding (GO:0051117)|DNA binding (GO:0003677)|ligand-activated sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0004879)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|sequence-specific transcription regulatory region DNA binding RNA polymerase II transcription factor recruiting transcription factor activity (GO:0001133)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(2)|large_intestine(1)|lung(3)|upper_aerodigestive_tract(2)	8		all_neural(266;0.057)		OV - Ovarian serous cystadenocarcinoma(262;0.00757)|GBM - Glioblastoma multiforme(134;0.0186)		GGAGCTTTGGGATTTCTGAGC	0.552																																																	0																																										SO:0001627	intron_variant	256236			U14534	CCDS42593.1, CCDS58673.1	19q13.3	2013-01-16				ENSG00000131408		"""Nuclear hormone receptors"""	7965	protein-coding gene	gene with protein product	"""liver X receptor-beta"""	600380	"""ubiquitously-expressed nuclear receptor"""	UNR		7782080, 7971966	Standard	NM_007121		Approved	NER, NER-I, RIP15, LXR-b	uc010enw.4	P55055		ENST00000600978.1:c.75-3620G>A	19.37:g.50837639G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K490|B4DNM6|E7EWA6|Q12970|Q5I0Y1	RNA	SNP	-	NULL	ENST00000600978.1	37	NULL		19																																																																																			NAPSB	-	-		0.552	NR1H2-012	KNOWN	basic	processed_transcript	NAPSB	HGNC	protein_coding	OTTHUMT00000464783.1	G			50837639	-1	no_errors	ENST00000527780	ensembl	human	known	70_37	rna	SNP	0.955	A
NCOA6	23054	genome.wustl.edu	37	20	33345195	33345195	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr20:33345195C>T	ENST00000374796.2	-	8	3926	c.1356G>A	c.(1354-1356)caG>caA	p.Q452Q	NCOA6_ENST00000359003.2_Silent_p.Q452Q			Q14686	NCOA6_HUMAN	nuclear receptor coactivator 6	452	CREBBP-binding region.|Gln-rich.|NCOA1-binding region.|TBP/GTF2A-binding region.				brain development (GO:0007420)|cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-templated transcription, initiation (GO:0006352)|glucocorticoid receptor signaling pathway (GO:0042921)|heart development (GO:0007507)|intracellular estrogen receptor signaling pathway (GO:0030520)|labyrinthine layer blood vessel development (GO:0060716)|myeloid cell differentiation (GO:0030099)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|response to hormone (GO:0009725)|small molecule metabolic process (GO:0044281)|transcription initiation from RNA polymerase II promoter (GO:0006367)	histone methyltransferase complex (GO:0035097)|intracellular membrane-bounded organelle (GO:0043231)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	chromatin binding (GO:0003682)|enzyme binding (GO:0019899)|estrogen receptor binding (GO:0030331)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|retinoid X receptor binding (GO:0046965)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)			NS(2)|breast(6)|central_nervous_system(3)|cervix(1)|endometrium(9)|kidney(8)|large_intestine(16)|lung(37)|ovary(4)|prostate(5)|skin(13)|upper_aerodigestive_tract(2)|urinary_tract(1)	107						TTGGTCCCATCTGCTGCTGAG	0.572																																																	0													100.0	106.0	104.0					20																	33345195		2203	4300	6503	SO:0001819	synonymous_variant	23054			AF128458	CCDS13241.1, CCDS74720.1	20q11	2008-08-01			ENSG00000198646	ENSG00000198646			15936	protein-coding gene	gene with protein product	"""nuclear receptor coactivator RAP250"", ""activating signal cointegrator-2"", ""peroxisome proliferator-activated receptor interacting protein"""	605299				8724849, 8263591	Standard	NM_014071		Approved	KIAA0181, RAP250, ASC2, AIB3, PRIP, TRBP, NRC	uc002xaw.3	Q14686	OTTHUMG00000032311	ENST00000374796.2:c.1356G>A	20.37:g.33345195C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLF1|B2RMN5|E1P5P7|Q9NTZ9|Q9UH74|Q9UK86	Silent	SNP	NULL	p.Q452	ENST00000374796.2	37	c.1356	CCDS13241.1	20																																																																																			NCOA6	-	NULL		0.572	NCOA6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NCOA6	HGNC	protein_coding	OTTHUMT00000078811.2	C	NM_014071		33345195	-1	no_errors	ENST00000359003	ensembl	human	known	70_37	silent	SNP	1.000	T
NEK1	4750	genome.wustl.edu	37	4	170428890	170428890	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr4:170428890C>T	ENST00000439128.2	-	20	2443	c.1803G>A	c.(1801-1803)agG>agA	p.R601R	NEK1_ENST00000512193.1_Silent_p.R532R|NEK1_ENST00000511633.1_Silent_p.R585R|NEK1_ENST00000510533.1_Silent_p.R557R|NEK1_ENST00000507142.1_Silent_p.R629R	NM_012224.2	NP_036356.1	Q96PY6	NEK1_HUMAN	NIMA-related kinase 1	601					cellular response to DNA damage stimulus (GO:0006974)|cilium assembly (GO:0042384)|mitotic nuclear division (GO:0007067)|response to ionizing radiation (GO:0010212)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|nucleus (GO:0005634)|pericentriolar material (GO:0000242)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			NS(1)|breast(3)|endometrium(3)|kidney(2)|large_intestine(13)|lung(18)|ovary(2)|prostate(2)|stomach(1)	45		Prostate(90;0.00601)|Renal(120;0.0183)		GBM - Glioblastoma multiforme(119;0.0287)|KIRC - Kidney renal clear cell carcinoma(143;0.0325)|Kidney(143;0.0385)|LUSC - Lung squamous cell carcinoma(193;0.14)		TTTTTTTGCGCCTCATGTCAG	0.338																																																	0													129.0	118.0	121.0					4																	170428890		1840	4090	5930	SO:0001819	synonymous_variant	4750			AB067488	CCDS47162.1, CCDS56348.1, CCDS56349.1, CCDS56350.1, CCDS56351.1	4q32.3	2012-11-15	2012-11-15		ENSG00000137601	ENSG00000137601			7744	protein-coding gene	gene with protein product		604588	"""NIMA (never in mitosis gene a)-related kinase 1"""			1382974, 8274451	Standard	NM_012224		Approved	NY-REN-55, KIAA1901	uc003isd.2	Q96PY6	OTTHUMG00000160963	ENST00000439128.2:c.1803G>A	4.37:g.170428890C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	G5E9Z3|Q05DG5|Q14CB7|Q5H9T1|Q6PIB8|Q96SS2|Q9H6P7|Q9Y594	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.R629	ENST00000439128.2	37	c.1887	CCDS47162.1	4																																																																																			NEK1	-	NULL		0.338	NEK1-001	KNOWN	basic|CCDS	protein_coding	NEK1	HGNC	protein_coding	OTTHUMT00000363157.3	C			170428890	-1	no_errors	ENST00000507142	ensembl	human	known	70_37	silent	SNP	0.969	T
NID2	22795	genome.wustl.edu	37	14	52520405	52520405	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr14:52520405C>T	ENST00000216286.5	-	5	1320	c.1321G>A	c.(1321-1323)Gaa>Aaa	p.E441K	NID2_ENST00000541773.1_Missense_Mutation_p.E388K	NM_007361.3	NP_031387.3	Q14112	NID2_HUMAN	nidogen 2 (osteonidogen)	441					basement membrane organization (GO:0071711)|cell adhesion (GO:0007155)|cell-matrix adhesion (GO:0007160)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|cell surface (GO:0009986)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)			NS(1)|breast(5)|endometrium(9)|kidney(4)|large_intestine(11)|liver(1)|lung(40)|ovary(2)|pancreas(2)|prostate(2)|skin(3)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(2)	87	Breast(41;0.0639)|all_epithelial(31;0.123)					ATTTCTTCTTCAGGATGAGCT	0.532																																																	0													95.0	94.0	94.0					14																	52520405		2203	4300	6503	SO:0001583	missense	22795			AB009799	CCDS9706.1	14q22.1	2008-05-14			ENSG00000087303	ENSG00000087303			13389	protein-coding gene	gene with protein product		605399				9733643	Standard	NM_007361		Approved		uc001wzo.3	Q14112	OTTHUMG00000140298	ENST00000216286.5:c.1321G>A	14.37:g.52520405C>T	ENSP00000216286:p.Glu441Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6I7|B4DU19|O43710	Missense_Mutation	SNP	pfam_G2_nidogen/fibulin_G2F,pfam_LDLR_classB_rpt,pfam_Nidogen_extracell_dom,pfam_Thyroglobulin_1,pfam_EGF-like_Ca-bd,superfamily_Green_fluorescent_prot-like,superfamily_Thyroglobulin_1,smart_Nidogen_extracell_dom,smart_EG-like_dom,smart_G2_nidogen/fibulin_G2F,smart_EGF-like_Ca-bd,smart_Thyroglobulin_1,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDLR_classB_rpt,pfscan_G2_nidogen/fibulin_G2F,pfscan_Thyroglobulin_1	p.E441K	ENST00000216286.5	37	c.1321	CCDS9706.1	14	.	.	.	.	.	.	.	.	.	.	C	7.348	0.622288	0.14193	.	.	ENSG00000087303	ENST00000216286;ENST00000541773;ENST00000395707	D;D	0.84070	-1.8;-1.7	5.5	4.62	0.57501	.	1.138210	0.06378	N	0.714729	T	0.75635	0.3876	L	0.27053	0.805	0.09310	N	1	B;B;B	0.29037	0.231;0.146;0.105	B;B;B	0.25291	0.059;0.038;0.036	T	0.59984	-0.7351	10	0.25751	T	0.34	.	13.0996	0.59212	0.0:0.9216:0.0:0.0784	.	388;443;441	Q14112-2;Q5CZI2;Q14112	.;.;NID2_HUMAN	K	441;388;443	ENSP00000216286:E441K;ENSP00000443730:E388K	ENSP00000216286:E441K	E	-	1	0	NID2	51590155	0.000000	0.05858	0.014000	0.15608	0.095000	0.18619	0.428000	0.21395	1.319000	0.45190	0.655000	0.94253	GAA	NID2	-	NULL		0.532	NID2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NID2	HGNC	protein_coding	OTTHUMT00000276888.1	C			52520405	-1	no_errors	ENST00000216286	ensembl	human	known	70_37	missense	SNP	0.201	T
NPAP1	23742	genome.wustl.edu	37	15	24923236	24923236	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr15:24923236C>T	ENST00000329468.2	+	1	2696	c.2222C>T	c.(2221-2223)tCa>tTa	p.S741L		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	741					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)		p.S741*(1)									AACACTGCCTCAGTCCAAGGC	0.542																																																	1	Substitution - Nonsense(1)	lung(1)											108.0	110.0	109.0					15																	24923236		2203	4300	6503	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.2222C>T	15.37:g.24923236C>T	ENSP00000333735:p.Ser741Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S741L	ENST00000329468.2	37	c.2222	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	2.930	-0.221242	0.06061	.	.	ENSG00000185823	ENST00000329468	T	0.05081	3.5	2.31	-3.31	0.04988	.	2.387900	0.02127	N	0.056063	T	0.05273	0.0140	L	0.31926	0.97	0.09310	N	1	B	0.20052	0.041	B	0.11329	0.006	T	0.39440	-0.9614	10	0.66056	D	0.02	.	1.6627	0.02796	0.1953:0.2776:0.3863:0.1408	.	741	Q9NZP6	CO002_HUMAN	L	741	ENSP00000333735:S741L	ENSP00000333735:S741L	S	+	2	0	C15orf2	22474329	0.000000	0.05858	0.000000	0.03702	0.043000	0.13939	-1.065000	0.03458	-0.747000	0.04759	0.195000	0.17529	TCA	NPAP1	-	NULL		0.542	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	C	NM_018958		24923236	+1	no_errors	ENST00000329468	ensembl	human	known	70_37	missense	SNP	0.000	T
NPAS2	4862	genome.wustl.edu	37	2	101554272	101554272	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:101554272G>A	ENST00000335681.5	+	5	616	c.331G>A	c.(331-333)Gac>Aac	p.D111N	NPAS2_ENST00000486017.1_3'UTR|NPAS2_ENST00000542504.1_Missense_Mutation_p.D176N	NM_002518.3	NP_002509.2	Q99743	NPAS2_HUMAN	neuronal PAS domain protein 2	111	PAS 1. {ECO:0000255|PROSITE- ProRule:PRU00140}.				cellular lipid metabolic process (GO:0044255)|cellular response to DNA damage stimulus (GO:0006974)|central nervous system development (GO:0007417)|circadian regulation of gene expression (GO:0032922)|circadian sleep/wake cycle (GO:0042745)|locomotor rhythm (GO:0045475)|negative regulation of cell death (GO:0060548)|positive regulation of DNA repair (GO:0045739)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of response to DNA damage stimulus (GO:2001020)|response to redox state (GO:0051775)|small molecule metabolic process (GO:0044281)|transcription, DNA-templated (GO:0006351)	cytosol (GO:0005829)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	core promoter binding (GO:0001047)|DNA binding (GO:0003677)|Hsp90 protein binding (GO:0051879)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)|signal transducer activity (GO:0004871)			cervix(1)|endometrium(3)|large_intestine(7)|lung(9)|ovary(3)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	29						CTATGTCTCTGACAGTATCAC	0.448																																																	0													258.0	223.0	235.0					2																	101554272		2203	4300	6503	SO:0001583	missense	4862			U77970	CCDS2048.1	2q11.2	2013-05-21			ENSG00000170485	ENSG00000170485		"""Basic helix-loop-helix proteins"""	7895	protein-coding gene	gene with protein product		603347				9012850, 9079689	Standard	NM_002518		Approved	MOP4, PASD4, bHLHe9	uc002tap.1	Q99743	OTTHUMG00000130675	ENST00000335681.5:c.331G>A	2.37:g.101554272G>A	ENSP00000338283:p.Asp111Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4ZFV9|Q53SQ3|Q86V96|Q99629	Missense_Mutation	SNP	pfam_PAS_fold_3,pfam_PAS_fold,pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,smart_PAS,smart_PAC,prints_Nuc_translocat,pfscan_PAS,pfscan_HLH_dom,tigrfam_PAS	p.D176N	ENST00000335681.5	37	c.526	CCDS2048.1	2	.	.	.	.	.	.	.	.	.	.	G	35	5.571226	0.96553	.	.	ENSG00000170485	ENST00000335681;ENST00000542504;ENST00000451740	T;T;T	0.18174	2.23;2.23;2.23	5.93	5.93	0.95920	PAS (3);PAS fold (1);	0.000000	0.85682	D	0.000000	T	0.50888	0.1642	M	0.87682	2.9	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.76575	0.987;0.988	T	0.55205	-0.8177	10	0.87932	D	0	.	19.9457	0.97181	0.0:0.0:1.0:0.0	.	176;111	F5H027;Q99743	.;NPAS2_HUMAN	N	111;176;97	ENSP00000338283:D111N;ENSP00000438428:D176N;ENSP00000395265:D97N	ENSP00000338283:D111N	D	+	1	0	NPAS2	100920704	1.000000	0.71417	0.974000	0.42286	0.991000	0.79684	8.902000	0.92568	2.808000	0.96608	0.655000	0.94253	GAC	NPAS2	-	pfam_PAS_fold,smart_PAS,pfscan_PAS,tigrfam_PAS		0.448	NPAS2-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	NPAS2	HGNC	protein_coding	OTTHUMT00000253168.3	G			101554272	+1	no_errors	ENST00000542504	ensembl	human	known	70_37	missense	SNP	1.000	A
NPLOC4	55666	genome.wustl.edu	37	17	79564319	79564319	+	Silent	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:79564319G>A	ENST00000331134.6	-	10	1160	c.945C>T	c.(943-945)ctC>ctT	p.L315L	NPLOC4_ENST00000539314.1_Silent_p.L154L|NPLOC4_ENST00000374747.5_Silent_p.L315L	NM_017921.2	NP_060391.2	Q8TAT6	NPL4_HUMAN	nuclear protein localization 4 homolog (S. cerevisiae)	315					ER-associated ubiquitin-dependent protein catabolic process (GO:0030433)|Golgi organization (GO:0007030)|membrane fusion (GO:0061025)	endoplasmic reticulum (GO:0005783)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)|nucleus (GO:0005634)	zinc ion binding (GO:0008270)			central_nervous_system(1)|kidney(1)|large_intestine(3)|lung(5)|ovary(1)	11	all_neural(118;0.0878)|Melanoma(429;0.242)|all_lung(278;0.246)		BRCA - Breast invasive adenocarcinoma(99;0.0282)|OV - Ovarian serous cystadenocarcinoma(97;0.0739)			CTTCTGAGACGAGGTCTGTAA	0.488																																																	0													116.0	113.0	114.0					17																	79564319		1964	4148	6112	SO:0001819	synonymous_variant	55666			AB040932	CCDS45812.1	17q25.3	2012-09-20			ENSG00000182446	ENSG00000182446			18261	protein-coding gene	gene with protein product		606590				11574150, 10811609	Standard	NM_017921		Approved	NPL4, FLJ20657, KIAA1499	uc002kas.3	Q8TAT6	OTTHUMG00000177990	ENST00000331134.6:c.945C>T	17.37:g.79564319G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3J1|Q9H8V2|Q9H964|Q9NWR5|Q9P229	Silent	SNP	pfam_NPL4,pfam_NPL4_Zn-bd_put,pfam_Npl4_Ub-like_dom,pirsf_PolyUb_recognition_cplx_Npl4	p.L315	ENST00000331134.6	37	c.945	CCDS45812.1	17																																																																																			NPLOC4	-	pfam_NPL4,pirsf_PolyUb_recognition_cplx_Npl4		0.488	NPLOC4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPLOC4	HGNC	protein_coding	OTTHUMT00000440140.1	G			79564319	-1	no_errors	ENST00000374747	ensembl	human	known	70_37	silent	SNP	0.046	A
NXF1	10482	genome.wustl.edu	37	11	62567920	62567920	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:62567920C>T	ENST00000532297.1	-	11	1574	c.945G>A	c.(943-945)ctG>ctA	p.L315L	NXF1_ENST00000531709.2_Silent_p.L315L|NXF1_ENST00000439713.2_Silent_p.L315L|NXF1_ENST00000294172.2_Silent_p.L315L|NXF1_ENST00000531131.1_Silent_p.L178L			Q9UBU9	NXF1_HUMAN	nuclear RNA export factor 1	315					gene expression (GO:0010467)|mRNA export from nucleus (GO:0006406)|poly(A)+ mRNA export from nucleus (GO:0016973)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear inclusion body (GO:0042405)|nuclear pore (GO:0005643)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)	mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(9)|lung(13)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						CTTCTAGCTTCAGCCCCTTTA	0.552																																																	0													153.0	108.0	123.0					11																	62567920		2201	4299	6500	SO:0001819	synonymous_variant	10482			AF112880	CCDS8037.1, CCDS44629.1	11q12-q13	2008-07-21			ENSG00000162231	ENSG00000162231			8071	protein-coding gene	gene with protein product	"""tip associating protein"""	602647				9175835, 9660949	Standard	NM_001081491		Approved	TAP, Mex67, DKFZp667O0311	uc001nvf.1	Q9UBU9	OTTHUMG00000167612	ENST00000532297.1:c.945G>A	11.37:g.62567920C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E269|Q99799|Q9UQL2	Silent	SNP	pfam_Tap_RNA-bd,pfam_NTF2,pfam_TAP_C_dom,pfam_Leu-rich_rpt,superfamily_UBA-like,smart_TAP_C_dom,pfscan_Nuclear_transport_factor_2_euk	p.L315	ENST00000532297.1	37	c.945	CCDS8037.1	11																																																																																			NXF1	-	NULL		0.552	NXF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NXF1	HGNC	protein_coding	OTTHUMT00000395365.2	C	NM_006362		62567920	-1	no_errors	ENST00000294172	ensembl	human	known	70_37	silent	SNP	1.000	T
OBSCN	84033	genome.wustl.edu	37	1	228554822	228554822	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:228554822C>T	ENST00000422127.1	+	86	19618	c.19574C>T	c.(19573-19575)aCg>aTg	p.T6525M	OBSCN_ENST00000570156.2_Missense_Mutation_p.T7482M|OBSCN_ENST00000366707.4_Missense_Mutation_p.T4159M	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	6525	Protein kinase 1. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				CCGCTGGTCACGGGGCTGCTG	0.642																																																	0													36.0	39.0	38.0					1																	228554822		2079	4202	6281	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.19574C>T	1.37:g.228554822C>T	ENSP00000409493:p.Thr6525Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.T6525M	ENST00000422127.1	37	c.19574	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	C	27.7	4.854699	0.91355	.	.	ENSG00000154358	ENST00000422127;ENST00000366707	T;T	0.39592	1.07;1.07	4.83	4.83	0.62350	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	1.397800	0.04630	N	0.403404	T	0.47710	0.1460	N	0.05574	-0.02	0.80722	D	1	D	0.89917	1.0	D	0.72075	0.976	T	0.36744	-0.9735	10	0.37606	T	0.19	.	12.5249	0.56081	0.0:0.9197:0.0:0.0802	.	6525	Q5VST9	OBSCN_HUMAN	M	6525;4159	ENSP00000409493:T6525M;ENSP00000355668:T4159M	ENSP00000355668:T4159M	T	+	2	0	OBSCN	226621445	0.992000	0.36948	0.788000	0.31933	0.924000	0.55760	3.064000	0.49986	2.508000	0.84585	0.591000	0.81541	ACG	OBSCN	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.642	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		C	NM_052843		228554822	+1	no_errors	ENST00000422127	ensembl	human	known	70_37	missense	SNP	0.998	T
OR1A1	8383	genome.wustl.edu	37	17	3119561	3119561	+	Missense_Mutation	SNP	C	C	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:3119561C>A	ENST00000304094.1	+	1	647	c.647C>A	c.(646-648)tCc>tAc	p.S216Y		NM_014565.2	NP_055380.2	Q9P1Q5	OR1A1_HUMAN	olfactory receptor, family 1, subfamily A, member 1	216						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(7)|ovary(1)|pancreas(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	23						ATCATTGTCTCCTATATTCGA	0.488																																																	0													275.0	242.0	253.0					17																	3119561		2203	4300	6503	SO:0001583	missense	8383			AF087918	CCDS11022.1	17p13.3	2012-08-09			ENSG00000172146	ENSG00000172146		"""GPCR / Class A : Olfactory receptors"""	8179	protein-coding gene	gene with protein product						10673334	Standard	NM_014565		Approved	OR17-7	uc010vrc.2	Q9P1Q5	OTTHUMG00000090637	ENST00000304094.1:c.647C>A	17.37:g.3119561C>A	ENSP00000305207:p.Ser216Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A5D914|Q6IFM1|Q6NTA9|Q96R87	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.S216Y	ENST00000304094.1	37	c.647	CCDS11022.1	17	.	.	.	.	.	.	.	.	.	.	C	15.44	2.835600	0.50951	.	.	ENSG00000172146	ENST00000304094	T	0.46063	0.88	4.96	4.96	0.65561	GPCR, rhodopsin-like superfamily (1);	0.000000	0.50627	D	0.000109	T	0.79299	0.4422	H	0.98901	4.365	0.49687	D	0.999818	D	0.89917	1.0	D	0.91635	0.999	D	0.87955	0.2726	10	0.87932	D	0	.	16.9322	0.86193	0.0:1.0:0.0:0.0	.	216	Q9P1Q5	OR1A1_HUMAN	Y	216	ENSP00000305207:S216Y	ENSP00000305207:S216Y	S	+	2	0	OR1A1	3066311	1.000000	0.71417	1.000000	0.80357	0.071000	0.16799	7.199000	0.77831	2.584000	0.87258	0.436000	0.28706	TCC	OR1A1	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.488	OR1A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR1A1	HGNC	protein_coding	OTTHUMT00000207292.1	C	NM_014565		3119561	+1	no_errors	ENST00000304094	ensembl	human	known	70_37	missense	SNP	1.000	A
OR5T3	390154	genome.wustl.edu	37	11	56019727	56019727	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:56019727G>A	ENST00000303059.3	+	1	52	c.52G>A	c.(52-54)Gaa>Aaa	p.E18K		NM_001004747.1	NP_001004747.1	Q8NGG3	OR5T3_HUMAN	olfactory receptor, family 5, subfamily T, member 3	18						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(3)|lung(23)|prostate(2)|skin(2)|upper_aerodigestive_tract(3)	39	Esophageal squamous(21;0.00448)					AGTAAAAACTGAAATGGACAA	0.363																																																	0													72.0	70.0	71.0					11																	56019727		2201	4295	6496	SO:0001583	missense	390154			AB065837	CCDS31524.1	11q11	2012-08-09			ENSG00000172489	ENSG00000172489		"""GPCR / Class A : Olfactory receptors"""	15297	protein-coding gene	gene with protein product							Standard	NM_001004747		Approved	OR5T3Q	uc010rjd.2	Q8NGG3	OTTHUMG00000166852	ENST00000303059.3:c.52G>A	11.37:g.56019727G>A	ENSP00000305403:p.Glu18Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IFC7	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.E18K	ENST00000303059.3	37	c.52	CCDS31524.1	11	.	.	.	.	.	.	.	.	.	.	G	12.12	1.841391	0.32513	.	.	ENSG00000172489	ENST00000303059	T	0.00003	9.82	4.7	-3.82	0.04281	.	.	.	.	.	T	0.00039	0.0001	N	0.08118	0	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.00110	-1.2048	9	0.30854	T	0.27	.	5.9474	0.19227	0.4772:0.0:0.3985:0.1243	.	18	Q8NGG3	OR5T3_HUMAN	K	18	ENSP00000305403:E18K	ENSP00000305403:E18K	E	+	1	0	OR5T3	55776303	0.000000	0.05858	0.000000	0.03702	0.052000	0.14988	-2.990000	0.00658	-0.484000	0.06763	-0.149000	0.13747	GAA	OR5T3	-	NULL		0.363	OR5T3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR5T3	HGNC	protein_coding	OTTHUMT00000391599.1	G	NM_001004747		56019727	+1	no_errors	ENST00000303059	ensembl	human	known	70_37	missense	SNP	0.000	A
OR5G5P	81191	genome.wustl.edu	37	11	56570111	56570111	+	RNA	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:56570111G>A	ENST00000378368.2	-	0	301									olfactory receptor, family 5, subfamily G, member 5 pseudogene																		GTCTGGAGTCGAGAATCCATC	0.448																																																	0																																												81191					11q12.1	2014-03-20			ENSG00000205025	ENSG00000205025		"""GPCR / Class A : Olfactory receptors"""	15289	pseudogene	pseudogene							Standard	NG_004191		Approved				OTTHUMG00000154297		11.37:g.56570111G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000378368.2	37	NULL		11																																																																																			OR5G5P	-	-		0.448	OR5G5P-003	KNOWN	basic	processed_transcript	OR5G5P	HGNC	pseudogene	OTTHUMT00000392444.1	G			56570111	-1	no_errors	ENST00000378368	ensembl	human	known	70_37	rna	SNP	0.000	A
OR6C1	390321	genome.wustl.edu	37	12	55714984	55714984	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr12:55714984G>T	ENST00000379668.2	+	1	639	c.601G>T	c.(601-603)Gct>Tct	p.A201S		NM_001005182.1	NP_001005182.1	Q96RD1	OR6C1_HUMAN	olfactory receptor, family 6, subfamily C, member 1	201						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(3)|large_intestine(5)|liver(2)|lung(13)|ovary(1)|upper_aerodigestive_tract(1)	25						ATTTTCTTGTGCTGCGTTTAC	0.343																																																	0													95.0	83.0	87.0					12																	55714984		2202	4300	6502	SO:0001583	missense	390321			AF399506	CCDS31818.1	12q13.13	2012-08-09			ENSG00000205330	ENSG00000205330		"""GPCR / Class A : Olfactory receptors"""	8355	protein-coding gene	gene with protein product							Standard	NM_001005182		Approved	OST267	uc010spi.2	Q96RD1	OTTHUMG00000168102	ENST00000379668.2:c.601G>T	12.37:g.55714984G>T	ENSP00000368990:p.Ala201Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNM0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A201S	ENST00000379668.2	37	c.601	CCDS31818.1	12	.	.	.	.	.	.	.	.	.	.	g	13.96	2.392045	0.42410	.	.	ENSG00000205330	ENST00000379668	T	0.37058	1.22	4.77	4.77	0.60923	GPCR, rhodopsin-like superfamily (1);	0.000000	0.64402	D	0.000014	T	0.39517	0.1081	L	0.41710	1.295	0.28312	N	0.922644	P	0.40794	0.729	P	0.48304	0.573	T	0.34551	-0.9824	10	0.62326	D	0.03	.	12.4357	0.55598	0.0:0.0:0.8316:0.1684	.	201	Q96RD1	OR6C1_HUMAN	S	201	ENSP00000368990:A201S	ENSP00000368990:A201S	A	+	1	0	OR6C1	54001251	0.002000	0.14202	0.809000	0.32408	0.748000	0.42578	1.167000	0.31847	2.461000	0.83175	0.563000	0.77884	GCT	OR6C1	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM		0.343	OR6C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR6C1	HGNC	protein_coding	OTTHUMT00000398152.1	G	NM_001005182		55714984	+1	no_errors	ENST00000379668	ensembl	human	known	70_37	missense	SNP	0.606	T
PAPSS2	9060	genome.wustl.edu	37	10	89503210	89503210	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr10:89503210C>T	ENST00000361175.4	+	10	1657	c.1288C>T	c.(1288-1290)Cta>Tta	p.L430L	PAPSS2_ENST00000427144.2_Silent_p.L434L|PAPSS2_ENST00000456849.1_Silent_p.L435L	NM_004670.3	NP_004661.2	O95340	PAPS2_HUMAN	3'-phosphoadenosine 5'-phosphosulfate synthase 2	430					3'-phosphoadenosine 5'-phosphosulfate biosynthetic process (GO:0050428)|3'-phosphoadenosine 5'-phosphosulfate metabolic process (GO:0050427)|blood coagulation (GO:0007596)|bone development (GO:0060348)|carbohydrate metabolic process (GO:0005975)|glycosaminoglycan metabolic process (GO:0030203)|skeletal system development (GO:0001501)|small molecule metabolic process (GO:0044281)|sulfate assimilation (GO:0000103)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	adenylylsulfate kinase activity (GO:0004020)|ATP binding (GO:0005524)|nucleotidyltransferase activity (GO:0016779)|sulfate adenylyltransferase (ATP) activity (GO:0004781)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(4)|lung(8)|ovary(1)|skin(1)|stomach(1)	20		Melanoma(5;0.019)|Colorectal(252;0.123)		UCEC - Uterine corpus endometrioid carcinoma (6;0.00164)|Colorectal(12;0.000323)|COAD - Colon adenocarcinoma(12;0.00124)		CCGCAGGCTCCTAGAGAGGGG	0.592																																																	0													102.0	98.0	99.0					10																	89503210		2203	4300	6503	SO:0001819	synonymous_variant	9060			AF091242	CCDS7385.1, CCDS44453.1	10q24	2008-02-07			ENSG00000198682	ENSG00000198682	2.7.7.4, 2.7.1.25		8604	protein-coding gene	gene with protein product		603005				9771708	Standard	NM_004670		Approved	ATPSK2	uc001kex.3	O95340	OTTHUMG00000018683	ENST00000361175.4:c.1288C>T	10.37:g.89503210C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BZL2|Q9P0G6|Q9UHM1|Q9UKD3|Q9UP30	Silent	SNP	pfam_Sulfurylase_cat_dom,pfam_APS_kinase,superfamily_PUA-like_domain,tigrfam_Sulphate_adenylyltransferase,tigrfam_APS_kinase	p.L435	ENST00000361175.4	37	c.1303	CCDS7385.1	10																																																																																			PAPSS2	-	pfam_Sulfurylase_cat_dom,tigrfam_Sulphate_adenylyltransferase		0.592	PAPSS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAPSS2	HGNC	protein_coding	OTTHUMT00000049229.1	C			89503210	+1	no_errors	ENST00000456849	ensembl	human	known	70_37	silent	SNP	1.000	T
PCDH7	5099	genome.wustl.edu	37	4	30723058	30723058	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr4:30723058G>A	ENST00000361762.2	+	1	1022	c.14G>A	c.(13-15)cGg>cAg	p.R5Q	PCDH7_ENST00000543491.1_Missense_Mutation_p.R5Q	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	5					homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						CTGAGGATGCGGACCGCGGGA	0.731																																																	0													5.0	7.0	7.0					4																	30723058		2104	4141	6245	SO:0001583	missense	5099			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.14G>A	4.37:g.30723058G>A	ENSP00000355243:p.Arg5Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.R5Q	ENST00000361762.2	37	c.14	CCDS33971.1	4	.	.	.	.	.	.	.	.	.	.	G	18.09	3.546433	0.65198	.	.	ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135	T;T	0.52057	0.72;0.68	5.17	5.17	0.71159	.	.	.	.	.	T	0.31482	0.0798	N	0.08118	0	0.41286	D	0.986944	P;P;P	0.51933	0.927;0.927;0.949	B;B;B	0.41174	0.349;0.349;0.19	T	0.27773	-1.0064	9	0.40728	T	0.16	.	18.2655	0.90051	0.0:0.0:1.0:0.0	.	5;5;5	F5GWJ1;O60245-3;O60245	.;.;PCDH7_HUMAN	Q	5	ENSP00000355243:R5Q;ENSP00000441802:R5Q	ENSP00000330302:R5Q	R	+	2	0	PCDH7	30332156	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	4.389000	0.59639	2.415000	0.81967	0.455000	0.32223	CGG	PCDH7	-	NULL		0.731	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1	G	NM_032457, NM_002589		30723058	+1	no_errors	ENST00000543491	ensembl	human	known	70_37	missense	SNP	1.000	A
PCDH7	5099	genome.wustl.edu	37	4	30725352	30725352	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr4:30725352G>A	ENST00000361762.2	+	1	3316	c.2308G>A	c.(2308-2310)Gac>Aac	p.D770N	PCDH7_ENST00000543491.1_Missense_Mutation_p.D770N	NM_002589.2	NP_002580.2	O60245	PCDH7_HUMAN	protocadherin 7	770	Cadherin 7. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(8)|liver(1)|lung(26)|ovary(2)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	55						GTTGGCAACAGACAGTGATGA	0.453																																																	0													65.0	61.0	63.0					4																	30725352		2203	4300	6503	SO:0001583	missense	5099			AB006755	CCDS33971.1, CCDS75116.1	4p15	2014-06-13	2007-02-12			ENSG00000169851		"""Cadherins / Protocadherins : Non-clustered"""	8659	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 120"""	602988	"""BH-protocadherin (brain-heart)"""			9615233	Standard	NM_002589		Approved	BH-Pcdh, PPP1R120	uc021xnd.1	O60245		ENST00000361762.2:c.2308G>A	4.37:g.30725352G>A	ENSP00000355243:p.Asp770Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O60246|O60247|Q4W5C4	Missense_Mutation	SNP	pfam_Cadherin,pfam_Protocadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.D770N	ENST00000361762.2	37	c.2308	CCDS33971.1	4	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	21.0|21.0	4.085768|4.085768	0.76642|0.76642	.|.	.|.	ENSG00000169851|ENSG00000169851	ENST00000361762;ENST00000543491;ENST00000333135|ENST00000511884	T;T|.	0.61627|.	0.09;0.09|.	5.16|5.16	5.16|5.16	0.70880|0.70880	Cadherin (4);Cadherin-like (1);|.	.|.	.|.	.|.	.|.	D|D	0.91717|0.91717	0.7381|0.7381	H|H	0.99391|0.99391	4.545|4.545	0.80722|0.80722	D|D	1|1	D;D;D|.	0.89917|.	1.0;1.0;1.0|.	D;D;D|.	0.97110|.	0.999;0.999;1.0|.	D|D	0.95178|0.95178	0.8296|0.8296	9|5	0.87932|.	D|.	0|.	.|.	18.8391|18.8391	0.92174|0.92174	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	770;723;770|.	F5GWJ1;O60245-3;O60245|.	.;.;PCDH7_HUMAN|.	N|K	770;770;723|459	ENSP00000355243:D770N;ENSP00000441802:D770N|.	ENSP00000330302:D723N|.	D|R	+|+	1|2	0|0	PCDH7|PCDH7	30334450|30334450	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	9.657000|9.657000	0.98554|0.98554	2.683000|2.683000	0.91414|0.91414	0.655000|0.655000	0.94253|0.94253	GAC|AGA	PCDH7	-	pfam_Cadherin,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.453	PCDH7-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PCDH7	HGNC	protein_coding	OTTHUMT00000360366.1	G	NM_032457, NM_002589		30725352	+1	no_errors	ENST00000543491	ensembl	human	known	70_37	missense	SNP	1.000	A
PCLO	27445	genome.wustl.edu	37	7	82764745	82764745	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr7:82764745C>T	ENST00000333891.9	-	3	2458	c.2121G>A	c.(2119-2121)gtG>gtA	p.V707V	PCLO_ENST00000423517.2_Silent_p.V707V	NM_033026.5	NP_149015.2			piccolo presynaptic cytomatrix protein									p.V707V(2)|p.V653V(1)		breast(3)|central_nervous_system(3)|cervix(5)|endometrium(19)|haematopoietic_and_lymphoid_tissue(3)|kidney(19)|large_intestine(35)|lung(145)|ovary(7)|prostate(4)|upper_aerodigestive_tract(14)|urinary_tract(2)	259						TTGGTTGTTTCACTAGTGGTG	0.542																																																	3	Substitution - coding silent(3)	lung(3)											180.0	179.0	179.0					7																	82764745		2003	4168	6171	SO:0001819	synonymous_variant	27445			AB011131	CCDS47630.1, CCDS47631.1	7q11.23-q21.3	2013-01-07	2013-01-07		ENSG00000186472	ENSG00000186472			13406	protein-coding gene	gene with protein product	"""aczonin"""	604918	"""piccolo (presynaptic cytomatrix protein)"""			8900486, 9628581	Standard	NM_014510		Approved	KIAA0559, DKFZp779G1236, ACZ	uc003uhx.2	Q9Y6V0	OTTHUMG00000154853	ENST00000333891.9:c.2121G>A	7.37:g.82764745C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Znf_piccolo,pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_PDZ,superfamily_Znf_FYVE_PHD,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ	p.V707	ENST00000333891.9	37	c.2121	CCDS47630.1	7																																																																																			PCLO	-	NULL		0.542	PCLO-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PCLO	HGNC	protein_coding	OTTHUMT00000337368.5	C	NM_014510		82764745	-1	no_errors	ENST00000333891	ensembl	human	known	70_37	silent	SNP	0.917	T
PI4KB	5298	genome.wustl.edu	37	1	151278698	151278698	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:151278698G>A	ENST00000368873.1	-	5	1492	c.1324C>T	c.(1324-1326)Cga>Tga	p.R442*	PI4KB_ENST00000368872.1_Nonsense_Mutation_p.R427*|PI4KB_ENST00000368874.4_Nonsense_Mutation_p.R427*|PI4KB_ENST00000271657.5_Nonsense_Mutation_p.R454*|PI4KB_ENST00000529142.1_Nonsense_Mutation_p.R110*|PI4KB_ENST00000368875.2_Nonsense_Mutation_p.R454*			Q9UBF8	PI4KB_HUMAN	phosphatidylinositol 4-kinase, catalytic, beta	442					phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol-mediated signaling (GO:0048015)|phospholipid metabolic process (GO:0006644)|receptor-mediated endocytosis (GO:0006898)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|Golgi membrane (GO:0000139)|mitochondrial outer membrane (GO:0005741)|plasma membrane (GO:0005886)	1-phosphatidylinositol 4-kinase activity (GO:0004430)|ATP binding (GO:0005524)			breast(3)|endometrium(5)|kidney(3)|large_intestine(2)|lung(7)|ovary(2)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)	27	Lung SC(34;0.00471)|Ovarian(49;0.0147)|Hepatocellular(266;0.0997)|all_hematologic(923;0.127)|Melanoma(130;0.185)		UCEC - Uterine corpus endometrioid carcinoma (35;0.112)|LUSC - Lung squamous cell carcinoma(543;0.181)			CTGCCAGCTCGCTGCTCATGG	0.562																																					Colon(154;765 1838 9854 28443 37492)												0													104.0	88.0	93.0					1																	151278698		2203	4300	6503	SO:0001587	stop_gained	5298			AB005910	CCDS993.1, CCDS55637.1, CCDS55638.1	1q21	2008-02-05	2007-08-14	2007-08-02	ENSG00000143393	ENSG00000143393			8984	protein-coding gene	gene with protein product		602758		PIK4CB		9020160, 9405938	Standard	NM_002651		Approved	PI4K-BETA, pi4K92	uc001exu.3	Q9UBF8	OTTHUMG00000012348	ENST00000368873.1:c.1324C>T	1.37:g.151278698G>A	ENSP00000357867:p.Arg442*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DGI2|O15096|P78405|Q5VWB9|Q5VWC0|Q5VWC1|Q9BWR6	Nonsense_Mutation	SNP	pfam_PI3/4_kinase_cat_dom,superfamily_Kinase-like_dom,smart_PI3/4_kinase_cat_dom,pfscan_PI3/4_kinase_cat_dom	p.R454*	ENST00000368873.1	37	c.1360		1	.	.	.	.	.	.	.	.	.	.	G	41	8.750980	0.98939	.	.	ENSG00000143393	ENST00000368874;ENST00000368875;ENST00000271657;ENST00000368873;ENST00000529142;ENST00000368872;ENST00000430800	.	.	.	5.88	4.97	0.65823	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.06494	T	0.89	-16.528	9.7092	0.40233	0.0741:0.0:0.7858:0.1402	.	.	.	.	X	427;454;454;442;110;427;110	.	ENSP00000271657:R454X	R	-	1	2	PI4KB	149545322	1.000000	0.71417	1.000000	0.80357	0.976000	0.68499	2.080000	0.41586	1.489000	0.48450	-0.157000	0.13467	CGA	PI4KB	-	superfamily_Kinase-like_dom		0.562	PI4KB-002	KNOWN	basic	protein_coding	PI4KB	HGNC	protein_coding	OTTHUMT00000034400.3	G	NM_002651		151278698	-1	no_errors	ENST00000271657	ensembl	human	known	70_37	nonsense	SNP	1.000	A
PKM	5315	genome.wustl.edu	37	15	72492830	72492830	+	Missense_Mutation	SNP	A	A	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr15:72492830A>T	ENST00000335181.5	-	10	1577	c.1474T>A	c.(1474-1476)Ttt>Att	p.F492I	PKM_ENST00000565184.1_Missense_Mutation_p.F492I|PKM_ENST00000568459.1_Missense_Mutation_p.F492I|PKM_ENST00000565154.1_Missense_Mutation_p.F492I|PKM_ENST00000449901.2_Missense_Mutation_p.F477I|GRAMD2_ENST00000309731.7_5'Flank|PKM_ENST00000389093.3_Missense_Mutation_p.F492I|PKM_ENST00000319622.6_Missense_Mutation_p.F492I|PKM_ENST00000568883.1_Missense_Mutation_p.F327I	NM_002654.4	NP_002645.3	P14618	KPYM_HUMAN	pyruvate kinase, muscle	492	Interaction with POU5F1.				carbohydrate metabolic process (GO:0005975)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|programmed cell death (GO:0012501)|small molecule metabolic process (GO:0044281)	cilium (GO:0005929)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular matrix (GO:0031012)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|MHC class II protein complex binding (GO:0023026)|poly(A) RNA binding (GO:0044822)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			endometrium(1)|lung(7)	8					Pyruvic acid(DB00119)	TTCATGGCAAAGTTCACCCGG	0.607																																																	0													53.0	49.0	50.0					15																	72492830		2199	4297	6496	SO:0001583	missense	5315			M23725	CCDS32284.1, CCDS32285.1, CCDS55972.1, CCDS73752.1	15q23	2012-10-02		2012-05-23	ENSG00000067225	ENSG00000067225	2.7.1.40		9021	protein-coding gene	gene with protein product		179050		PKM2		2040271	Standard	NM_002654		Approved	THBP1, OIP3, PK3	uc002atr.1	P14618	OTTHUMG00000172709	ENST00000335181.5:c.1474T>A	15.37:g.72492830A>T	ENSP00000334983:p.Phe492Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFK3|B2R5N8|B3KRY0|B4DFX8|B4DUU6|P14786|Q53GK4|Q96E76|Q9BWB5|Q9UCV6|Q9UPF2	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.F492I	ENST00000335181.5	37	c.1474	CCDS32284.1	15	.	.	.	.	.	.	.	.	.	.	A	16.50	3.140536	0.56936	.	.	ENSG00000067225	ENST00000319622;ENST00000335181;ENST00000434220;ENST00000327974;ENST00000389093;ENST00000449901	D;D;D;D	0.99023	-5.34;-5.34;-5.34;-5.34	5.03	1.63	0.23807	Pyruvate kinase, C-terminal (2);Pyruvate kinase, alpha/beta (1);	0.132849	0.52532	D	0.000077	D	0.95717	0.8607	N	0.13235	0.315	0.47476	D	0.999436	B;B;B;B;B;B;B;B;B	0.34200	0.441;0.02;0.023;0.184;0.044;0.018;0.281;0.158;0.155	B;B;B;B;B;B;B;B;B	0.40982	0.14;0.089;0.048;0.221;0.131;0.028;0.345;0.14;0.276	D	0.91599	0.5293	10	0.59425	D	0.04	-6.4871	4.2326	0.10610	0.4641:0.0:0.3797:0.1563	.	418;477;472;472;492;492;327;419;327	B4DNK4;B4DUU6;B4DRT3;E7EUQ8;P14618;P14618-2;Q504U3;E9PF79;E7EUJ4	.;.;.;.;KPYM_HUMAN;.;.;.;.	I	492;492;419;327;492;477	ENSP00000320171:F492I;ENSP00000334983:F492I;ENSP00000373745:F492I;ENSP00000403365:F477I	ENSP00000320171:F492I	F	-	1	0	PKM2	70279884	0.994000	0.37717	1.000000	0.80357	0.992000	0.81027	0.480000	0.22244	0.394000	0.25230	0.459000	0.35465	TTT	PKM	-	pfam_Pyrv_Knase_C,superfamily_Pyrv_Knase_C,tigrfam_Pyr_Knase		0.607	PKM-004	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PKM	HGNC	protein_coding	OTTHUMT00000420056.1	A			72492830	-1	no_errors	ENST00000319622	ensembl	human	known	70_37	missense	SNP	1.000	T
PLBD1	79887	genome.wustl.edu	37	12	14659146	14659146	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr12:14659146C>T	ENST00000240617.5	-	10	2081	c.1429G>A	c.(1429-1431)Gag>Aag	p.E477K		NM_024829.5	NP_079105.4	Q6P4A8	PLBL1_HUMAN	phospholipase B domain containing 1	477					glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|lysosome (GO:0005764)	hydrolase activity (GO:0016787)			central_nervous_system(1)|cervix(2)|endometrium(3)|kidney(3)|large_intestine(2)|lung(3)|prostate(1)|upper_aerodigestive_tract(1)	16						TTCAGGTCCTCACGGCAGCAG	0.448																																																	0													126.0	111.0	116.0					12																	14659146		2203	4300	6503	SO:0001583	missense	79887			BC000909	CCDS31751.1	12p13.1	2013-10-11			ENSG00000121316	ENSG00000121316			26215	protein-coding gene	gene with protein product	"""PLB homolog 1 (Dictyostelium)"""					15193148, 19019078	Standard	NM_024829		Approved	FLJ22662	uc001rcc.1	Q6P4A8	OTTHUMG00000168821	ENST00000240617.5:c.1429G>A	12.37:g.14659146C>T	ENSP00000240617:p.Glu477Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4E9|Q9BVV3|Q9H625	Missense_Mutation	SNP	pfam_PLipase_B-like	p.E477K	ENST00000240617.5	37	c.1429	CCDS31751.1	12	.	.	.	.	.	.	.	.	.	.	C	8.254	0.809761	0.16537	.	.	ENSG00000121316	ENST00000240617	T	0.18502	2.21	5.91	2.98	0.34508	.	0.497962	0.22993	N	0.053164	T	0.14270	0.0345	L	0.47716	1.5	0.09310	N	0.999998	B	0.16166	0.016	B	0.16722	0.016	T	0.32798	-0.9893	10	0.12766	T	0.61	-7.1055	11.2326	0.48920	0.1351:0.605:0.2599:0.0	.	477	Q6P4A8	PLBL1_HUMAN	K	477	ENSP00000240617:E477K	ENSP00000240617:E477K	E	-	1	0	PLBD1	14550413	0.045000	0.20229	0.794000	0.32065	0.945000	0.59286	1.271000	0.33098	0.347000	0.23924	0.655000	0.94253	GAG	PLBD1	-	pfam_PLipase_B-like		0.448	PLBD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLBD1	HGNC	protein_coding	OTTHUMT00000401203.1	C	NM_024829		14659146	-1	no_errors	ENST00000240617	ensembl	human	known	70_37	missense	SNP	0.224	T
POLG2	11232	genome.wustl.edu	37	17	62473998	62473998	+	Missense_Mutation	SNP	T	T	A	rs537103723		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:62473998T>A	ENST00000539111.2	-	8	1467	c.1400A>T	c.(1399-1401)cAt>cTt	p.H467L	POLG2_ENST00000582501.1_5'Flank	NM_007215.3	NP_009146.2	Q9UHN1	DPOG2_HUMAN	polymerase (DNA directed), gamma 2, accessory subunit	467					DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)	extracellular vesicular exosome (GO:0070062)|mitochondrial chromosome (GO:0000262)|mitochondrial nucleoid (GO:0042645)	DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(1)|lung(4)|skin(2)|stomach(1)|urinary_tract(1)	15	Breast(5;2.15e-14)		BRCA - Breast invasive adenocarcinoma(8;4.97e-11)			TTTGGATATATGCATCATTTC	0.284																																					Colon(3;18 21 435 17652 48887)												0													90.0	82.0	84.0					17																	62473998		2202	4297	6499	SO:0001583	missense	11232			U94703	CCDS32706.1	17q23.3	2012-05-18			ENSG00000256525	ENSG00000256525		"""DNA polymerases"""	9180	protein-coding gene	gene with protein product		604983				9153213	Standard	NM_007215		Approved	MTPOLB, HP55	uc002jei.3	Q9UHN1		ENST00000539111.2:c.1400A>T	17.37:g.62473998T>A	ENSP00000442563:p.His467Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O00419|Q0IJ81|Q96GW2|Q9UK35|Q9UK94	Missense_Mutation	SNP	pfam_Anticodon-bd,superfamily_Anticodon-bd	p.H467L	ENST00000539111.2	37	c.1400	CCDS32706.1	17	.	.	.	.	.	.	.	.	.	.	T	19.71	3.877657	0.72294	.	.	ENSG00000256525	ENST00000539111	D	0.82803	-1.65	5.76	5.76	0.90799	Anticodon-binding (3);	0.000000	0.85682	D	0.000000	D	0.90865	0.7130	M	0.81239	2.535	0.80722	D	1	D	0.76494	0.999	D	0.87578	0.998	D	0.89594	0.3830	10	0.28530	T	0.3	-19.3048	16.114	0.81289	0.0:0.0:0.0:1.0	.	467	Q9UHN1	DPOG2_HUMAN	L	467	ENSP00000442563:H467L	ENSP00000442563:H467L	H	-	2	0	POLG2	59904460	1.000000	0.71417	1.000000	0.80357	0.488000	0.33401	7.503000	0.81632	2.213000	0.71641	0.372000	0.22366	CAT	POLG2	-	pfam_Anticodon-bd,superfamily_Anticodon-bd		0.284	POLG2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLG2	HGNC	protein_coding	OTTHUMT00000443820.1	T	NM_007215		62473998	-1	no_errors	ENST00000539111	ensembl	human	known	70_37	missense	SNP	1.000	A
PREX2	80243	genome.wustl.edu	37	8	69069589	69069589	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr8:69069589G>T	ENST00000288368.4	+	35	4541	c.4264G>T	c.(4264-4266)Gac>Tac	p.D1422Y		NM_024870.2|NM_025170.4	NP_079146.2|NP_079446.3	Q70Z35	PREX2_HUMAN	phosphatidylinositol-3,4,5-trisphosphate-dependent Rac exchange factor 2	1422					adult locomotory behavior (GO:0008344)|dendrite morphogenesis (GO:0048813)|G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|positive regulation of Rac GTPase activity (GO:0032855)		Rac GTPase activator activity (GO:0030675)|Rac guanyl-nucleotide exchange factor activity (GO:0030676)			NS(6)|biliary_tract(1)|breast(4)|endometrium(11)|kidney(16)|large_intestine(25)|liver(4)|lung(57)|ovary(2)|pancreas(4)|prostate(3)|skin(42)|upper_aerodigestive_tract(1)|urinary_tract(2)	178						TTATTACAGAGACAATGTTTC	0.358																																																	0													112.0	113.0	113.0					8																	69069589		2203	4300	6503	SO:0001583	missense	80243			AK024079	CCDS6201.1	8q13.1	2014-06-13	2008-09-15	2008-09-15	ENSG00000046889	ENSG00000046889		"""Rho guanine nucleotide exchange factors"""	22950	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 129"""	612139	"""DEP domain containing 2"""	DEPDC2		15304342, 15304343	Standard	NM_024870		Approved	DEP.2, FLJ12987, P-REX2, PPP1R129	uc003xxv.1	Q70Z35	OTTHUMG00000164402	ENST00000288368.4:c.4264G>T	8.37:g.69069589G>T	ENSP00000288368:p.Asp1422Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DFX0|Q32KL0|Q32KL1|Q6R7Q3|Q6R7Q4|Q9H805|Q9H961	Missense_Mutation	SNP	pfam_DH-domain,pfam_DEP_dom,pfam_PDZ,superfamily_DH-domain,superfamily_PDZ,smart_DH-domain,smart_Pleckstrin_homology,smart_DEP_dom,smart_PDZ,pfscan_DEP_dom,pfscan_PDZ,pfscan_Pleckstrin_homology,pfscan_DH-domain	p.D1422Y	ENST00000288368.4	37	c.4264	CCDS6201.1	8	.	.	.	.	.	.	.	.	.	.	G	26.3	4.721534	0.89298	.	.	ENSG00000046889	ENST00000288368	T	0.47869	0.83	5.7	5.7	0.88788	.	0.000000	0.85682	D	0.000000	T	0.56337	0.1978	L	0.42245	1.32	0.80722	D	1	D	0.55605	0.972	P	0.52710	0.707	T	0.57717	-0.7763	10	0.72032	D	0.01	.	19.8383	0.96670	0.0:0.0:1.0:0.0	.	1422	Q70Z35	PREX2_HUMAN	Y	1422	ENSP00000288368:D1422Y	ENSP00000288368:D1422Y	D	+	1	0	PREX2	69232143	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	9.429000	0.97481	2.683000	0.91414	0.650000	0.86243	GAC	PREX2	-	NULL		0.358	PREX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PREX2	HGNC	protein_coding	OTTHUMT00000378620.1	G	NM_025170		69069589	+1	no_errors	ENST00000288368	ensembl	human	known	70_37	missense	SNP	1.000	T
PRF1	5551	genome.wustl.edu	37	10	72357976	72357976	+	Missense_Mutation	SNP	G	G	A	rs200589152		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr10:72357976G>A	ENST00000441259.1	-	3	1661	c.1501C>T	c.(1501-1503)Ccc>Tcc	p.P501S	PRF1_ENST00000373209.2_Missense_Mutation_p.P501S	NM_001083116.1|NM_005041.4	NP_001076585.1|NP_005032.2	P14222	PERF_HUMAN	perforin 1 (pore forming protein)	501					apoptotic process (GO:0006915)|cellular defense response (GO:0006968)|cytolysis (GO:0019835)|defense response to tumor cell (GO:0002357)|defense response to virus (GO:0051607)|immune response to tumor cell (GO:0002418)|protein homooligomerization (GO:0051260)|transmembrane transport (GO:0055085)	cytolytic granule (GO:0044194)|cytoplasmic membrane-bounded vesicle (GO:0016023)|endosome (GO:0005768)|extracellular region (GO:0005576)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|wide pore channel activity (GO:0022829)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(3)|urinary_tract(3)	23						CCAGACTTGGGAGCCTGATCA	0.602			M			"""various leukaemia, lymphoma"""	Type 2 familial hemophagocytic lymphohistiocytosis		Familial Hemophagocytic Lymphohistiocytosis																														yes	Rec			10	10q22	5551	perforin 1 (pore forming protein)		L	0								G	SER/PRO,SER/PRO	0,4406		0,0,2203	135.0	133.0	134.0		1501,1501	1.9	0.0	10		134	1,8599	1.2+/-3.3	0,1,4299	yes	missense,missense	PRF1	NM_001083116.1,NM_005041.4	74,74	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging,possibly-damaging	501/556,501/556	72357976	1,13005	2203	4300	6503	SO:0001583	missense	5551	Familial Cancer Database	FHLH, FHL, Familial Hemophagocytic Reticulosis, FHR	BC047695	CCDS7305.1	10q22	2014-09-17			ENSG00000180644	ENSG00000180644			9360	protein-coding gene	gene with protein product	"""Perforin"", ""perforin 1 (preforming protein)"""	170280				1505959, 2592021	Standard	NM_005041		Approved	PFP, P1, HPLH2	uc001jrf.4	P14222	OTTHUMG00000018412	ENST00000441259.1:c.1501C>T	10.37:g.72357976G>A	ENSP00000398568:p.Pro501Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6X4|Q59F57|Q86WX7	Missense_Mutation	SNP	pfam_MACPF,pfam_C2_Ca-dep,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_MACPF,smart_C2_Ca-dep,pfscan_C2_membr_targeting	p.P501S	ENST00000441259.1	37	c.1501	CCDS7305.1	10	.	.	.	.	.	.	.	.	.	.	G	12.67	2.007252	0.35415	0.0	1.16E-4	ENSG00000180644	ENST00000373209;ENST00000441259;ENST00000318971	D;D	0.91180	-2.8;-2.8	5.97	1.89	0.25635	C2 calcium-dependent membrane targeting (1);C2 calcium/lipid-binding domain, CaLB (1);	0.307137	0.36303	N	0.002670	D	0.88955	0.6578	M	0.79475	2.455	0.09310	N	1	P	0.46457	0.878	B	0.35899	0.213	T	0.80908	-0.1172	10	0.54805	T	0.06	-6.6539	16.8561	0.86006	0.0:0.4906:0.5094:0.0	.	501	P14222	PERF_HUMAN	S	501	ENSP00000362305:P501S;ENSP00000398568:P501S	ENSP00000316746:P501S	P	-	1	0	PRF1	72027982	0.001000	0.12720	0.000000	0.03702	0.000000	0.00434	0.603000	0.24149	0.086000	0.17137	-0.913000	0.02753	CCC	PRF1	-	superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep		0.602	PRF1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	PRF1	HGNC	protein_coding	OTTHUMT00000048517.2	G	NM_005041		72357976	-1	no_errors	ENST00000318971	ensembl	human	known	70_37	missense	SNP	0.019	A
PRPF31	26121	genome.wustl.edu	37	19	54629910	54629910	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:54629910G>A	ENST00000321030.4	+	9	1212	c.863G>A	c.(862-864)cGg>cAg	p.R288Q	PRPF31_ENST00000498612.1_3'UTR|PRPF31_ENST00000391755.1_Missense_Mutation_p.R288Q|PRPF31_ENST00000419967.1_Missense_Mutation_p.R288Q|AC012314.8_ENST00000452097.1_RNA	NM_015629.3	NP_056444.3	Q8WWY3	PRP31_HUMAN	pre-mRNA processing factor 31	288	Nop. {ECO:0000255|PROSITE- ProRule:PRU00690}.				mRNA splicing, via spliceosome (GO:0000398)|spliceosomal tri-snRNP complex assembly (GO:0000244)	Cajal body (GO:0015030)|MLL1 complex (GO:0071339)|nuclear speck (GO:0016607)|nucleus (GO:0005634)|U2-type spliceosomal complex (GO:0005684)|U4 snRNP (GO:0005687)|U4/U6 x U5 tri-snRNP complex (GO:0046540)|U4atac snRNP (GO:0005690)	poly(A) RNA binding (GO:0044822)|ribonucleoprotein complex binding (GO:0043021)|snRNP binding (GO:0070990)			breast(1)|kidney(1)|large_intestine(2)|lung(3)|ovary(2)|urinary_tract(3)	12	all_cancers(19;0.00681)|all_epithelial(19;0.00362)|all_lung(19;0.0175)|Lung NSC(19;0.0325)|Ovarian(34;0.19)					CAGGATCTGCGGCGGAAAGCG	0.612																																																	0													24.0	26.0	25.0					19																	54629910		2202	4299	6501	SO:0001583	missense	26121			AL050369	CCDS12879.1	19q13.4	2013-07-16	2013-06-10		ENSG00000105618	ENSG00000105618			15446	protein-coding gene	gene with protein product		606419	"""PRP31 pre-mRNA processing factor 31 homolog (yeast)"", ""PRP31 pre-mRNA processing factor 31 homolog (S. cerevisiae)"""	RP11		11545739	Standard	NM_015629		Approved	NY-BR-99, PRP31, hPrp31, SNRNP61	uc002qdh.2	Q8WWY3	OTTHUMG00000066040	ENST00000321030.4:c.863G>A	19.37:g.54629910G>A	ENSP00000324122:p.Arg288Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RB4|Q8N7F9|Q9H271|Q9Y439	Missense_Mutation	SNP	pfam_SnoRNA-bd_dom,pfam_Prp31_C,pfam_NOSIC,smart_NOSIC	p.R288Q	ENST00000321030.4	37	c.863	CCDS12879.1	19	.	.	.	.	.	.	.	.	.	.	G	31	5.089486	0.94149	.	.	ENSG00000105618	ENST00000321030;ENST00000263436;ENST00000419967;ENST00000391755	T;T;T	0.80214	-1.35;-1.35;-1.35	5.56	5.56	0.83823	Pre-mRNA processing ribonucleoprotein, snoRNA-binding domain (1);	0.052425	0.85682	D	0.000000	D	0.88742	0.6519	M	0.81341	2.54	0.51767	D	0.999934	D;D	0.89917	1.0;0.998	D;P	0.72625	0.978;0.904	D	0.88459	0.3054	10	0.49607	T	0.09	-43.3866	12.0825	0.53680	0.0799:0.0:0.9201:0.0	.	288;288	E7ESA8;Q8WWY3	.;PRP31_HUMAN	Q	288	ENSP00000324122:R288Q;ENSP00000405166:R288Q;ENSP00000375635:R288Q	ENSP00000263436:R288Q	R	+	2	0	PRPF31	59321722	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	7.116000	0.77119	2.782000	0.95742	0.655000	0.94253	CGG	PRPF31	-	pfam_SnoRNA-bd_dom		0.612	PRPF31-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRPF31	HGNC	protein_coding	OTTHUMT00000141417.2	G			54629910	+1	no_errors	ENST00000321030	ensembl	human	known	70_37	missense	SNP	1.000	A
PTK7	5754	genome.wustl.edu	37	6	43100468	43100468	+	Intron	SNP	A	A	G			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr6:43100468A>G	ENST00000230419.4	+	7	1449				PTK7_ENST00000349241.2_Intron|PTK7_ENST00000471863.1_Missense_Mutation_p.N424S|PTK7_ENST00000345201.2_Intron|PTK7_ENST00000352931.2_Intron|PTK7_ENST00000481273.1_Intron	NM_002821.4	NP_002812.2	Q13308	PTK7_HUMAN	protein tyrosine kinase 7						actin cytoskeleton reorganization (GO:0031532)|axis elongation (GO:0003401)|canonical Wnt signaling pathway (GO:0060070)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cellular response to retinoic acid (GO:0071300)|cochlea morphogenesis (GO:0090103)|convergent extension (GO:0060026)|establishment of epithelial cell apical/basal polarity (GO:0045198)|establishment of planar polarity (GO:0001736)|lung-associated mesenchyme development (GO:0060484)|neural tube closure (GO:0001843)|peptidyl-tyrosine phosphorylation (GO:0018108)|planar cell polarity pathway involved in neural tube closure (GO:0090179)|positive regulation of neuron projection development (GO:0010976)|signal transduction (GO:0007165)|wound healing (GO:0042060)	cell-cell junction (GO:0005911)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)	ATP binding (GO:0005524)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(12)|lung(12)|ovary(2)|prostate(3)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	46			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00784)|OV - Ovarian serous cystadenocarcinoma(102;0.0423)			GTGGAGGGGAACACAGGTCTG	0.592																																																	0													16.0	12.0	13.0					6																	43100468		2156	4209	6365	SO:0001627	intron_variant	5754			AF447176	CCDS4884.1, CCDS4885.1, CCDS4886.1, CCDS4887.1, CCDS59021.1	6p21.1-p12.2	2013-02-18	2013-02-18		ENSG00000112655	ENSG00000112655	2.7.10.1	"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	9618	protein-coding gene	gene with protein product		601890	"""PTK7 protein tyrosine kinase 7"""			7478540	Standard	NM_002821		Approved	CCK4	uc011dve.2	Q13308	OTTHUMG00000014721	ENST00000230419.4:c.1228+43A>G	6.37:g.43100468A>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K974|B7Z477|E9PFZ5|Q13417|Q5T650|Q6IQ54|Q8NFA5|Q8NFA6|Q8NFA7|Q8NFA8	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,smart_Ig_sub,smart_Ig_sub2,pfscan_Ig-like	p.N424S	ENST00000230419.4	37	c.1271	CCDS4884.1	6	.	.	.	.	.	.	.	.	.	.	A	5.254	0.232345	0.09969	.	.	ENSG00000112655	ENST00000471863;ENST00000481946	T;T	0.60797	0.37;0.16	3.7	-3.64	0.04515	.	.	.	.	.	T	0.11281	0.0275	.	.	.	0.21950	N	0.999451	B	0.02656	0.0	B	0.01281	0.0	T	0.17289	-1.0374	7	.	.	.	.	0.517	0.00605	0.2152:0.3077:0.1948:0.2824	.	424	Q86X91	.	S	424;177	ENSP00000419037:N424S;ENSP00000420165:N177S	.	N	+	2	0	PTK7	43208446	0.000000	0.05858	0.001000	0.08648	0.093000	0.18481	-0.843000	0.04350	-0.647000	0.05444	-0.475000	0.04921	AAC	PTK7	-	NULL		0.592	PTK7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTK7	HGNC	protein_coding	OTTHUMT00000040580.2	A			43100468	+1	no_errors	ENST00000471863	ensembl	human	putative	70_37	missense	SNP	0.001	G
RAPSN	5913	genome.wustl.edu	37	11	47460263	47460264	+	Intron	INS	-	-	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:47460263_47460264insC	ENST00000298854.2	-	7	1380				RAPSN_ENST00000524487.1_Intron|RAPSN_ENST00000528356.1_Intron|RAPSN_ENST00000529341.1_Frame_Shift_Ins_p.W337fs|RAPSN_ENST00000352508.3_Intron|RNU6-1302P_ENST00000516518.1_RNA	NM_005055.4	NP_005046.2	Q13702	RAPSN_HUMAN	receptor-associated protein of the synapse						positive regulation of neuron apoptotic process (GO:0043525)|synaptic transmission (GO:0007268)|synaptic transmission, cholinergic (GO:0007271)	cell junction (GO:0030054)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|neuromuscular junction (GO:0031594)|postsynaptic membrane (GO:0045211)	acetylcholine receptor binding (GO:0033130)|zinc ion binding (GO:0008270)			endometrium(1)|large_intestine(3)|lung(6)|ovary(2)	12						ACCCCTGTCCACCCCCCCAGGA	0.604																																																	0																																										SO:0001627	intron_variant	5913				CCDS7936.1, CCDS7937.1	11p11.2	2009-04-28	2007-02-23		ENSG00000165917	ENSG00000165917		"""RING-type (C3HC4) zinc fingers"""	9863	protein-coding gene	gene with protein product	"""rapsyn"""	601592	"""receptor-associated protein of the synapse, 43kD"""			8812503	Standard	NM_005055		Approved	RNF205, CMS1D, CMS1E	uc001nfi.2	Q13702	OTTHUMG00000166891	ENST00000298854.2:c.1166+18->G	11.37:g.47460270_47460270dupC		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDF3|Q9BTD9	Frame_Shift_Ins	INS	pfam_Rapsyn_myristoylation/link_N,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,prints_Postsynaptic	p.W336fs	ENST00000298854.2	37	c.1009_1008	CCDS7936.1	11																																																																																			RAPSN	-	NULL		0.604	RAPSN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAPSN	HGNC	protein_coding	OTTHUMT00000391726.1	-			47460264	-1	no_errors	ENST00000529341	ensembl	human	novel	70_37	frame_shift_ins	INS	0.013:0.005	C
RCC1	1104	genome.wustl.edu	37	1	28862519	28862519	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:28862519C>T	ENST00000373833.6	+	10	1083	c.798C>T	c.(796-798)ctC>ctT	p.L266L	RCC1_ENST00000373831.3_Silent_p.L297L|RCC1_ENST00000373832.1_Silent_p.L266L|RCC1_ENST00000398958.2_Silent_p.L266L			P18754	RCC1_HUMAN	regulator of chromosome condensation 1	266					chromosome segregation (GO:0007059)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic nuclear division (GO:0007067)|mitotic spindle organization (GO:0007052)|positive regulation of Ran GTPase activity (GO:0032853)|regulation of mitosis (GO:0007088)|spindle assembly (GO:0051225)|viral process (GO:0016032)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|nuclear chromatin (GO:0000790)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|histone binding (GO:0042393)|nucleosomal DNA binding (GO:0031492)|Ran guanyl-nucleotide exchange factor activity (GO:0005087)			breast(1)|kidney(2)|large_intestine(6)|lung(4)|ovary(1)	14		Colorectal(325;3.46e-05)|Lung NSC(340;0.000318)|all_lung(284;0.000434)|Renal(390;0.00121)|Breast(348;0.00345)|all_neural(195;0.00989)|Myeloproliferative disorder(586;0.0255)|Ovarian(437;0.0261)|Medulloblastoma(700;0.123)		Colorectal(126;2.96e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|STAD - Stomach adenocarcinoma(196;0.00299)|KIRC - Kidney renal clear cell carcinoma(1967;0.0101)|BRCA - Breast invasive adenocarcinoma(304;0.022)|READ - Rectum adenocarcinoma(331;0.0649)		GCTTCGGCCTCTCCAACTACC	0.597																																																	0													94.0	80.0	85.0					1																	28862519		2203	4300	6503	SO:0001819	synonymous_variant	1104			X12654	CCDS323.1, CCDS41295.1	1p35.3	2008-08-18	2005-05-09	2005-05-09	ENSG00000180198	ENSG00000180198			1913	protein-coding gene	gene with protein product		179710	"""chromosome condensation 1"""	CHC1		7851910	Standard	NM_001048199		Approved		uc001bqf.2	P18754	OTTHUMG00000003645	ENST00000373833.6:c.798C>T	1.37:g.28862519C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16269|Q6NT97	Silent	SNP	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens,prints_Reg_chr_condens	p.L297	ENST00000373833.6	37	c.891	CCDS323.1	1																																																																																			RCC1	-	pfam_Reg_chr_condens,superfamily_Reg_csome_cond/b-lactamase_inh,pfscan_Reg_chr_condens		0.597	RCC1-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RCC1	HGNC	protein_coding	OTTHUMT00000010323.3	C	NM_001269		28862519	+1	no_errors	ENST00000373831	ensembl	human	known	70_37	silent	SNP	1.000	T
RBMXL1	494115	genome.wustl.edu	37	1	89448812	89448812	+	Missense_Mutation	SNP	T	T	G			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:89448812T>G	ENST00000321792.5	-	2	1125	c.698A>C	c.(697-699)gAt>gCt	p.D233A	CCBL2_ENST00000260508.4_Intron|CCBL2_ENST00000370485.2_Intron|CCBL2_ENST00000446900.2_Intron|RBMXL1_ENST00000413769.1_5'Flank|RBMXL1_ENST00000399794.2_Missense_Mutation_p.D233A|CCBL2_ENST00000370491.3_Intron	NM_019610.5	NP_062556.2	Q96E39	RMXL1_HUMAN	RNA binding motif protein, X-linked-like 1	233					mRNA processing (GO:0006397)|RNA splicing (GO:0008380)	nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)	nucleotide binding (GO:0000166)|RNA binding (GO:0003723)	p.D233A(3)									TGGTGCATAATCTCTTGTATC	0.423																																																	3	Substitution - Missense(3)	kidney(3)											205.0	178.0	187.0					1																	89448812		2203	4300	6503	SO:0001583	missense	494115			BC012942	CCDS716.1	1p22.2	2013-02-12	2007-01-04	2007-01-04	ENSG00000213516	ENSG00000213516		"""RNA binding motif (RRM) containing"""	25073	protein-coding gene	gene with protein product	"""kynurenine aminotransferase III"""					10441733	Standard	NM_019610		Approved	KAT3	uc001dms.3	Q96E39	OTTHUMG00000010661	ENST00000321792.5:c.698A>C	1.37:g.89448812T>G	ENSP00000318415:p.Asp233Ala	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_RRM_dom,pfam_RBM1CTR,smart_RRM_dom_euk,smart_RRM_dom,pfscan_RRM_dom	p.D233A	ENST00000321792.5	37	c.698	CCDS716.1	1	.	.	.	.	.	.	.	.	.	.	T	21.0	4.084835	0.76642	.	.	ENSG00000213516	ENST00000321792;ENST00000399794	D;D	0.83163	-1.69;-1.69	1.53	1.53	0.23141	.	0.000000	0.85682	D	0.000000	T	0.79100	0.4389	M	0.71036	2.16	0.46499	D	0.999078	D	0.59357	0.985	P	0.53102	0.718	T	0.78889	-0.2026	10	0.66056	D	0.02	.	6.8078	0.23786	0.0:0.0:0.0:1.0	.	233	Q96E39	RBMXL_HUMAN	A	233	ENSP00000318415:D233A;ENSP00000446099:D233A	ENSP00000318415:D233A	D	-	2	0	RBMXL1	89221400	1.000000	0.71417	0.996000	0.52242	0.787000	0.44495	5.062000	0.64326	0.706000	0.31912	0.254000	0.18369	GAT	RBMXL1	-	NULL		0.423	RBMXL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL1	HGNC	protein_coding	OTTHUMT00000029403.3	T	NM_019610		89448812	-1	no_errors	ENST00000321792	ensembl	human	known	70_37	missense	SNP	1.000	G
REV1	51455	genome.wustl.edu	37	2	100058894	100058894	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:100058894G>C	ENST00000258428.3	-	5	616	c.388C>G	c.(388-390)Cag>Gag	p.Q130E	REV1_ENST00000393445.3_Missense_Mutation_p.Q130E|REV1_ENST00000465835.1_5'UTR	NM_001037872.1|NM_016316.2	NP_001032961.1|NP_057400.1	Q9UBZ9	REV1_HUMAN	REV1, polymerase (DNA directed)	130	BRCT. {ECO:0000255|PROSITE- ProRule:PRU00033}.				DNA repair (GO:0006281)|DNA replication (GO:0006260)|DNA-dependent DNA replication (GO:0006261)|error-prone translesion synthesis (GO:0042276)|response to UV (GO:0009411)	nucleoplasm (GO:0005654)	damaged DNA binding (GO:0003684)|deoxycytidyl transferase activity (GO:0017125)|DNA-directed DNA polymerase activity (GO:0003887)|magnesium ion binding (GO:0000287)			NS(1)|breast(1)|endometrium(2)|kidney(1)|large_intestine(14)|lung(12)|ovary(2)|prostate(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	39						GTGTACAGCTGATATGGAATG	0.443								Direct reversal of damage																																									0													133.0	121.0	125.0					2																	100058894		2203	4300	6503	SO:0001583	missense	51455			AF206019	CCDS2045.1, CCDS42722.1	2q11.1-q11.2	2012-05-18	2012-05-18	2006-11-07	ENSG00000135945	ENSG00000135945		"""DNA polymerases"""	14060	protein-coding gene	gene with protein product		606134	"""REV1 (yeast homolog)- like"", ""REV1-like (yeast)"", ""REV1 homolog (S. cerevisiae)"""	REV1L		10536157	Standard	XM_005263968		Approved		uc002tad.3	Q9UBZ9	OTTHUMG00000130636	ENST00000258428.3:c.388C>G	2.37:g.100058894G>C	ENSP00000258428:p.Gln130Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	O95941|Q53SI7|Q9C0J4|Q9NUP2	Missense_Mutation	SNP	pfam_DNA_repair_prot_UmuC-like,pfam_DNA_pol_Y-fam_little_finger,pfam_BRCT_dom,superfamily_BRCT_dom,superfamily_DNA_pol_Y-fam_little_finger,smart_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom,pfscan_DNA_repair_prot_UmuC-like_N	p.Q130E	ENST00000258428.3	37	c.388	CCDS2045.1	2	.	.	.	.	.	.	.	.	.	.	G	20.4	3.978013	0.74360	.	.	ENSG00000135945	ENST00000393445;ENST00000258428	T;T	0.10763	2.84;2.84	5.59	5.59	0.84812	BRCT (2);	0.000000	0.85682	D	0.000000	T	0.28863	0.0716	M	0.72894	2.215	0.80722	D	1	P;P;P	0.51653	0.947;0.548;0.528	P;B;P	0.55508	0.777;0.415;0.552	T	0.00290	-1.1843	10	0.39692	T	0.17	.	19.5763	0.95446	0.0:0.0:1.0:0.0	.	109;130;130	Q9UBZ9-3;Q9UBZ9;Q9UBZ9-2	.;REV1_HUMAN;.	E	130	ENSP00000377091:Q130E;ENSP00000258428:Q130E	ENSP00000258428:Q130E	Q	-	1	0	REV1	99425326	1.000000	0.71417	1.000000	0.80357	0.954000	0.61252	8.678000	0.91211	2.646000	0.89796	0.655000	0.94253	CAG	REV1	-	superfamily_BRCT_dom,pirsf_REV1,pfscan_BRCT_dom		0.443	REV1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	REV1	HGNC	protein_coding	OTTHUMT00000253123.2	G	NM_016316		100058894	-1	no_errors	ENST00000258428	ensembl	human	known	70_37	missense	SNP	1.000	C
RIMS2	9699	genome.wustl.edu	37	8	105260960	105260960	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr8:105260960G>A	ENST00000436393.2	+	25	3803	c.3562G>A	c.(3562-3564)Gat>Aat	p.D1188N	RIMS2_ENST00000339750.2_Missense_Mutation_p.D106N|RIMS2_ENST00000507740.1_Missense_Mutation_p.D984N|RIMS2_ENST00000262231.10_Missense_Mutation_p.D1009N|RIMS2_ENST00000406091.3_Missense_Mutation_p.D1170N			Q9UQ26	RIMS2_HUMAN	regulating synaptic membrane exocytosis 2	1232					calcium ion-dependent exocytosis (GO:0017156)|calcium ion-dependent exocytosis of neurotransmitter (GO:0048791)|cAMP-mediated signaling (GO:0019933)|insulin secretion (GO:0030073)|intracellular protein transport (GO:0006886)|positive regulation of gene expression (GO:0010628)|positive regulation of inhibitory postsynaptic membrane potential (GO:0097151)|regulation of exocytosis (GO:0017157)	cell junction (GO:0030054)|plasma membrane (GO:0005886)|presynaptic active zone (GO:0048786)	metal ion binding (GO:0046872)			NS(1)|breast(4)|central_nervous_system(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(22)|liver(1)|lung(68)|ovary(6)|pancreas(2)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(10)|urinary_tract(1)	144			OV - Ovarian serous cystadenocarcinoma(57;7.7e-07)|STAD - Stomach adenocarcinoma(118;0.229)			CTTGGCCTCTGATAGCCAGTT	0.463										HNSCC(12;0.0054)																																							0													113.0	112.0	112.0					8																	105260960		2133	4270	6403	SO:0001583	missense	9699			AB018294	CCDS43761.1, CCDS64948.1, CCDS64949.1	8q22.3	2008-08-08	2002-06-12	2002-06-14					17283	protein-coding gene	gene with protein product		606630	"""RAB3 interacting protein 3"""	RAB3IP3		9872452, 12578829	Standard	NM_014677		Approved	KIAA0751, RIM2, OBOE	uc003ylp.3	Q9UQ26		ENST00000436393.2:c.3562G>A	8.37:g.105260960G>A	ENSP00000390665:p.Asp1188Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KX91|F8WD47|O43413|Q86XL9|Q8IWV9|Q8IWW1	Missense_Mutation	SNP	pfam_C2_Ca-dep,pfam_PDZ,superfamily_C2_Ca/lipid-bd_dom_CaLB,superfamily_Znf_FYVE_PHD,superfamily_PDZ,smart_PDZ,smart_C2_Ca-dep,pfscan_C2_membr_targeting,pfscan_PDZ,pfscan_Rab-bd_domain,pfscan_Znf_FYVE-rel	p.D1170N	ENST00000436393.2	37	c.3508		8	.	.	.	.	.	.	.	.	.	.	G	35	5.470890	0.96274	.	.	ENSG00000176406	ENST00000329869;ENST00000406091;ENST00000402998;ENST00000262231;ENST00000507740;ENST00000408894;ENST00000436393;ENST00000523362;ENST00000339750	T;T;T;T;T;T;T	0.24723	2.57;2.27;2.32;1.84;2.52;2.13;2.11	5.34	5.34	0.76211	.	.	.	.	.	T	0.47857	0.1468	L	0.56199	1.76	0.80722	D	1	D;P;P;P;P	0.61697	0.99;0.877;0.954;0.557;0.557	P;B;D;B;B	0.67900	0.903;0.411;0.954;0.295;0.295	T	0.38929	-0.9638	9	0.59425	D	0.04	.	19.4079	0.94655	0.0:0.0:1.0:0.0	.	1232;1188;1009;984;1170	Q9UQ26;D6RA03;Q9UQ26-1;Q9UQ26-3;F8WD47	RIMS2_HUMAN;.;.;.;.	N	1207;1170;1232;1009;984;1177;1188;106;106	ENSP00000384892:D1170N;ENSP00000262231:D1009N;ENSP00000423559:D984N;ENSP00000386228:D1177N;ENSP00000390665:D1188N;ENSP00000428478:D106N;ENSP00000342051:D106N	ENSP00000262231:D1009N	D	+	1	0	RIMS2	105330136	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	9.813000	0.99286	2.664000	0.90586	0.650000	0.86243	GAT	RIMS2	-	NULL		0.463	RIMS2-007	NOVEL	basic|exp_conf	protein_coding	RIMS2	HGNC	protein_coding	OTTHUMT00000367217.1	G	NM_001100117		105260960	+1	no_errors	ENST00000406091	ensembl	human	known	70_37	missense	SNP	1.000	A
RPS28	6234	genome.wustl.edu	37	19	8386554	8386554	+	Silent	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:8386554G>A	ENST00000600659.2	+	2	85	c.54G>A	c.(52-54)ctG>ctA	p.L18L	NDUFA7_ENST00000301457.2_5'Flank|NDUFA7_ENST00000598884.1_5'Flank	NM_001031.4	NP_001022.1	P62857	RS28_HUMAN	ribosomal protein S28	18					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit biogenesis (GO:0042274)|RNA metabolic process (GO:0016070)|rRNA processing (GO:0006364)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)										CCAAGGTCCTGGGCAGGACCG	0.637																																																	0													12.0	14.0	13.0					19																	8386554		1887	4095	5982	SO:0001819	synonymous_variant	6234			D14530	CCDS45953.1	19p13.2	2011-04-06				ENSG00000233927		"""S ribosomal proteins"""	10418	protein-coding gene	gene with protein product	"""40S ribosomal protein S28"""	603685				8415000, 9582194	Standard	NM_001031		Approved	S28	uc002mjn.3	P62857		ENST00000600659.2:c.54G>A	19.37:g.8386554G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	P25112	Silent	SNP	pfam_Ribosomal_S28e,superfamily_NA-bd_OB-fold-like	p.L18	ENST00000600659.2	37	c.54	CCDS45953.1	19																																																																																			RPS28	-	pfam_Ribosomal_S28e,superfamily_NA-bd_OB-fold-like		0.637	RPS28-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS28	HGNC	protein_coding	OTTHUMT00000461377.3	G	NM_001031		8386554	+1	no_errors	ENST00000600659	ensembl	human	known	70_37	silent	SNP	1.000	A
RUVBL2	10856	genome.wustl.edu	37	19	49518398	49518398	+	Silent	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:49518398G>C	ENST00000595090.1	+	13	1706	c.1242G>C	c.(1240-1242)cgG>cgC	p.R414R	RUVBL2_ENST00000601968.1_Intron|RUVBL2_ENST00000413176.2_Silent_p.R369R	NM_006666.1	NP_006657.1	Q9Y230	RUVB2_HUMAN	RuvB-like AAA ATPase 2	414					ATP catabolic process (GO:0006200)|cellular response to estradiol stimulus (GO:0071392)|cellular response to UV (GO:0034644)|chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA duplex unwinding (GO:0032508)|DNA recombination (GO:0006310)|DNA repair (GO:0006281)|establishment of protein localization to chromatin (GO:0071169)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of estrogen receptor binding (GO:0071899)|positive regulation of histone acetylation (GO:0035066)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein folding (GO:0006457)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)|transcriptional activation by promoter-enhancer looping (GO:0071733)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Ino80 complex (GO:0031011)|intracellular (GO:0005622)|membrane (GO:0016020)|MLL1 complex (GO:0071339)|NuA4 histone acetyltransferase complex (GO:0035267)|nuclear euchromatin (GO:0005719)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|Swr1 complex (GO:0000812)	ATP binding (GO:0005524)|ATP-dependent 5'-3' DNA helicase activity (GO:0043141)|ATP-dependent DNA helicase activity (GO:0004003)|chromatin DNA binding (GO:0031490)|damaged DNA binding (GO:0003684)|DNA helicase activity (GO:0003678)|identical protein binding (GO:0042802)|RNA polymerase II core promoter sequence-specific DNA binding (GO:0000979)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|unfolded protein binding (GO:0051082)			large_intestine(1)|upper_aerodigestive_tract(1)	2		all_epithelial(76;5.29e-07)|all_lung(116;1.7e-06)|Lung NSC(112;3.55e-06)|all_neural(266;0.0189)|Ovarian(192;0.0261)		all cancers(93;0.000449)|OV - Ovarian serous cystadenocarcinoma(262;0.000555)|GBM - Glioblastoma multiforme(486;0.00585)|Epithelial(262;0.047)		TGGTGTGCCGGAAACGCAAGG	0.602																																																	0													18.0	21.0	20.0					19																	49518398		2132	4235	6367	SO:0001819	synonymous_variant	10856			AF155138	CCDS42588.1	19q13.3	2013-09-12	2013-09-12					"""INO80 complex subunits"", ""ATPases / AAA-type"""	10475	protein-coding gene	gene with protein product	"""reptin"", ""INO80 complex subunit J"""	604788	"""RuvB (E coli homolog)-like 2"", ""RuvB-like 2 (E. coli)"""			10428817, 10998447	Standard	XM_005258426		Approved	RVB2, TIP48, TIP49b, Reptin52, ECP51, TIH2, INO80J, Rvb2	uc002plr.1	Q9Y230		ENST00000595090.1:c.1242G>C	19.37:g.49518398G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KQ59|E7ETE5|Q6FIB9|Q6PK27|Q9Y361	Silent	SNP	pfam_TIP49_C,pfam_ATPase_AAA_core,pfam_DNA_helicase_DnaB-like_C,superfamily_NA-bd_OB-fold-like,smart_AAA+_ATPase,prints_DNA_repair_RadA	p.R414	ENST00000595090.1	37	c.1242	CCDS42588.1	19																																																																																			RUVBL2	-	NULL		0.602	RUVBL2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUVBL2	HGNC	protein_coding	OTTHUMT00000466235.1	G			49518398	+1	no_errors	ENST00000595090	ensembl	human	known	70_37	silent	SNP	1.000	C
S100A1	6271	genome.wustl.edu	37	1	153603994	153603994	+	Intron	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:153603994G>C	ENST00000292169.1	+	3	254				S100A13_ENST00000491177.1_5'Flank|S100A1_ENST00000368698.3_Intron|RP1-178F15.4_ENST00000607839.1_RNA|RP1-178F15.5_ENST00000497086.1_RNA|CHTOP_ENST00000403433.1_5'Flank|S100A13_ENST00000368699.1_Intron|S100A1_ENST00000368696.3_Missense_Mutation_p.E50Q|S100A1_ENST00000469893.1_Intron|CHTOP_ENST00000368694.3_5'Flank|RP1-178F15.4_ENST00000469931.2_RNA	NM_006271.1	NP_006262.1	P23297	S10A1_HUMAN	S100 calcium binding protein A1						intracellular signal transduction (GO:0035556)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of voltage-gated calcium channel activity (GO:1901387)|regulation of heart contraction (GO:0008016)|substantia nigra development (GO:0021762)	M band (GO:0031430)|neuron projection (GO:0043005)|nucleus (GO:0005634)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|Z disc (GO:0030018)	ATPase binding (GO:0051117)|calcium ion binding (GO:0005509)|identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|S100 protein binding (GO:0044548)			breast(1)|cervix(1)|lung(2)	4	all_lung(78;1.84e-32)|Lung NSC(65;6.67e-31)|Hepatocellular(266;0.0877)|Melanoma(130;0.199)		LUSC - Lung squamous cell carcinoma(543;0.171)		Olopatadine(DB00768)	CCAGGTGAAAGAGCTTATGCT	0.448																																					Ovarian(74;601 1703 10548 31787)												0																																										SO:0001627	intron_variant	6271			BC014392	CCDS1047.1	1q21	2013-01-10	2001-11-28		ENSG00000160678	ENSG00000160678		"""S100 calcium binding proteins"", ""EF-hand domain containing"""	10486	protein-coding gene	gene with protein product		176940	"""S100 calcium-binding protein A1"""	S100A		1998503	Standard	NM_006271		Approved	S100-alpha	uc001fck.1	P23297	OTTHUMG00000037041	ENST00000292169.1:c.142-180G>C	1.37:g.153603994G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R5D9|Q5T7Y3	Missense_Mutation	SNP	pfam_S100_Ca-bd_sub	p.E50Q	ENST00000292169.1	37	c.148	CCDS1047.1	1	.	.	.	.	.	.	.	.	.	.	G	9.899	1.206371	0.22205	.	.	ENSG00000160678	ENST00000368696	T	0.19394	2.15	4.03	-0.193	0.13244	.	.	.	.	.	T	0.07954	0.0199	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.34675	-0.9819	6	0.62326	D	0.03	.	4.2624	0.10747	0.3067:0.1867:0.5066:0.0	.	.	.	.	Q	50	ENSP00000357685:E50Q	ENSP00000357685:E50Q	E	+	1	0	S100A1	151870618	0.002000	0.14202	0.000000	0.03702	0.001000	0.01503	0.657000	0.24963	-0.281000	0.09141	-0.211000	0.12701	GAG	S100A1	-	NULL		0.448	S100A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	S100A1	HGNC	protein_coding	OTTHUMT00000089933.1	G	NM_006271		153603994	+1	no_errors	ENST00000368696	ensembl	human	known	70_37	missense	SNP	0.000	C
SCN1A	6323	genome.wustl.edu	37	2	166896082	166896082	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:166896082C>T	ENST00000303395.4	-	14	2439	c.2440G>A	c.(2440-2442)Gaa>Aaa	p.E814K	AC010127.3_ENST00000595647.1_RNA|SCN1A_ENST00000409050.1_Missense_Mutation_p.E786K|SCN1A_ENST00000423058.2_Missense_Mutation_p.E814K|AC010127.3_ENST00000599041.1_RNA|AC010127.3_ENST00000595268.1_RNA|SCN1A_ENST00000375405.3_Missense_Mutation_p.E803K			P35498	SCN1A_HUMAN	sodium channel, voltage-gated, type I, alpha subunit	814					adult walking behavior (GO:0007628)|membrane depolarization during action potential (GO:0086010)|neuromuscular process controlling posture (GO:0050884)|neuronal action potential (GO:0019228)|neuronal action potential propagation (GO:0019227)|sodium ion transmembrane transport (GO:0035725)|sodium ion transport (GO:0006814)	axon initial segment (GO:0043194)|intercalated disc (GO:0014704)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|plasma membrane (GO:0005886)|T-tubule (GO:0030315)|voltage-gated sodium channel complex (GO:0001518)|Z disc (GO:0030018)	voltage-gated sodium channel activity (GO:0005248)			NS(4)|breast(5)|endometrium(16)|haematopoietic_and_lymphoid_tissue(4)|kidney(8)|large_intestine(33)|lung(87)|ovary(7)|pancreas(1)|prostate(9)|skin(23)|upper_aerodigestive_tract(2)|urinary_tract(1)	200					Dronedarone(DB04855)|Nitrazepam(DB01595)|Permethrin(DB04930)|Phenacemide(DB01121)|Phenazopyridine(DB01438)|Phenytoin(DB00252)|Topiramate(DB00273)|Valproic Acid(DB00313)|Zonisamide(DB00909)	AGAAACATTTCTGCTGTAAAG	0.333																																																	0													62.0	63.0	63.0					2																	166896082		2203	4300	6503	SO:0001583	missense	6323			AB093548	CCDS33316.1, CCDS54413.1, CCDS54414.1	2q24.3	2014-09-17	2007-01-23		ENSG00000144285	ENSG00000144285		"""Sodium channels"", ""Voltage-gated ion channels / Sodium channels"""	10585	protein-coding gene	gene with protein product		182389	"""febrile convulsions 3"""	SCN1, FEB3		8062593, 16382098, 11823106	Standard	NM_006920		Approved	Nav1.1, GEFSP2, HBSCI, NAC1, SMEI	uc021vsb.1	P35498	OTTHUMG00000044173	ENST00000303395.4:c.2440G>A	2.37:g.166896082C>T	ENSP00000303540:p.Glu814Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PG49|Q16172|Q585T7|Q8IUJ6|Q96LA3|Q9C008	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_DUF3451,pfam_Na_trans_assoc,pfam_PKD1_2_channel,prints_Na_channel_a1su,prints_Na_channel_asu,prints_PKD_2	p.E814K	ENST00000303395.4	37	c.2440	CCDS54413.1	2	.	.	.	.	.	.	.	.	.	.	C	22.5	4.291792	0.80914	.	.	ENSG00000144285	ENST00000423058;ENST00000303395;ENST00000375405;ENST00000409050	D;D;D;D	0.98822	-5.16;-5.16;-5.16;-5.16	4.66	4.66	0.58398	Ion transport (1);	0.209904	0.33477	N	0.004862	D	0.99622	0.9862	H	0.99838	4.83	0.80722	D	1	D;D;D	0.69078	0.996;0.997;0.974	D;D;P	0.77004	0.981;0.989;0.897	D	0.97101	0.9797	10	0.87932	D	0	.	17.8943	0.88881	0.0:1.0:0.0:0.0	.	803;786;814	P35498-2;E9PG49;P35498	.;.;SCN1A_HUMAN	K	814;814;803;786	ENSP00000407030:E814K;ENSP00000303540:E814K;ENSP00000364554:E803K;ENSP00000386312:E786K	ENSP00000303540:E814K	E	-	1	0	SCN1A	166604328	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	7.738000	0.84966	2.307000	0.77673	0.650000	0.86243	GAA	SCN1A	-	pfam_Ion_trans_dom		0.333	SCN1A-001	KNOWN	non_canonical_U12|basic|appris_principal|CCDS	protein_coding	SCN1A	HGNC	protein_coding	OTTHUMT00000102661.1	C	NM_006920		166896082	-1	no_errors	ENST00000303395	ensembl	human	known	70_37	missense	SNP	1.000	T
SEMA5A	9037	genome.wustl.edu	37	5	9202081	9202081	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr5:9202081G>C	ENST00000382496.5	-	9	1583	c.918C>G	c.(916-918)atC>atG	p.I306M		NM_003966.2	NP_003957.2	Q13591	SEM5A_HUMAN	sema domain, seven thrombospondin repeats (type 1 and type 1-like), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 5A	306	Sema. {ECO:0000255|PROSITE- ProRule:PRU00352}.				axon guidance (GO:0007411)|axonal fasciculation (GO:0007413)|blood vessel endothelial cell proliferation involved in sprouting angiogenesis (GO:0002043)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell-cell signaling (GO:0007267)|diencephalon development (GO:0021536)|negative regulation of axon extension involved in axon guidance (GO:0048843)|negative regulation of cell adhesion (GO:0007162)|negative regulation of endothelial cell apoptotic process (GO:2000352)|nervous system development (GO:0007399)|patterning of blood vessels (GO:0001569)|positive chemotaxis (GO:0050918)|positive regulation of actin filament depolymerization (GO:0030836)|positive regulation of angiogenesis (GO:0045766)|positive regulation of axon extension involved in axon guidance (GO:0048842)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of protein kinase B signaling (GO:0051897)|signal clustering (GO:1990256)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|plasma membrane (GO:0005886)	axon guidance receptor activity (GO:0008046)|chondroitin sulfate proteoglycan binding (GO:0035373)|heparan sulfate proteoglycan binding (GO:0043395)|semaphorin receptor binding (GO:0030215)|syndecan binding (GO:0045545)			biliary_tract(1)|breast(4)|central_nervous_system(2)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(13)|lung(40)|ovary(2)|prostate(5)|skin(2)|upper_aerodigestive_tract(3)|urinary_tract(1)	81						TGGTGGTAAAGATGCCATAGA	0.423																																																	0													61.0	61.0	61.0					5																	9202081		2203	4300	6503	SO:0001583	missense	9037			U52840	CCDS3875.1	5p15.2	2008-05-15			ENSG00000112902	ENSG00000112902		"""Semaphorins"""	10736	protein-coding gene	gene with protein product		609297		SEMAF		8817451, 9464278	Standard	NM_003966		Approved	semF	uc003jek.2	Q13591	OTTHUMG00000090501	ENST00000382496.5:c.918C>G	5.37:g.9202081G>C	ENSP00000371936:p.Ile306Met	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTC6|O60408|Q1RLL9	Missense_Mutation	SNP	pfam_Semaphorin/CD100_Ag,pfam_Thrombospondin_1_rpt,superfamily_Semaphorin/CD100_Ag,superfamily_Thrombospondin_1_rpt,superfamily_Plexin-like_fold,smart_Semaphorin/CD100_Ag,smart_Plexin-like,smart_Thrombospondin_1_rpt,pfscan_Semaphorin/CD100_Ag,pfscan_Thrombospondin_1_rpt	p.I306M	ENST00000382496.5	37	c.918	CCDS3875.1	5	.	.	.	.	.	.	.	.	.	.	G	16.13	3.036686	0.54896	.	.	ENSG00000112902	ENST00000382496	T	0.13420	2.59	5.84	3.85	0.44370	WD40/YVTN repeat-like-containing domain (1);Semaphorin/CD100 antigen (4);	0.000000	0.85682	D	0.000000	T	0.24314	0.0589	M	0.77406	2.37	0.48632	D	0.999687	P	0.40731	0.728	P	0.45037	0.467	T	0.05037	-1.0910	10	0.87932	D	0	.	12.0423	0.53460	0.0:0.1236:0.735:0.1413	.	306	Q13591	SEM5A_HUMAN	M	306	ENSP00000371936:I306M	ENSP00000371936:I306M	I	-	3	3	SEMA5A	9255081	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.334000	0.33827	1.448000	0.47680	0.655000	0.94253	ATC	SEMA5A	-	pfam_Semaphorin/CD100_Ag,superfamily_Semaphorin/CD100_Ag,smart_Semaphorin/CD100_Ag,pfscan_Semaphorin/CD100_Ag		0.423	SEMA5A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEMA5A	HGNC	protein_coding	OTTHUMT00000206989.2	G			9202081	-1	no_errors	ENST00000382496	ensembl	human	known	70_37	missense	SNP	1.000	C
SERINC3	10955	genome.wustl.edu	37	20	43132618	43132618	+	Missense_Mutation	SNP	T	T	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr20:43132618T>C	ENST00000342374.4	-	8	1050	c.893A>G	c.(892-894)aAc>aGc	p.N298S	SERINC3_ENST00000541235.1_Missense_Mutation_p.N243S|SERINC3_ENST00000255175.1_Missense_Mutation_p.N298S	NM_006811.2	NP_006802.1	Q13530	SERC3_HUMAN	serine incorporator 3	298					phosphatidylserine metabolic process (GO:0006658)|positive regulation of endoplasmic reticulum stress-induced intrinsic apoptotic signaling pathway (GO:1902237)|sphingolipid metabolic process (GO:0006665)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	L-serine transmembrane transporter activity (GO:0015194)			endometrium(4)|large_intestine(2)|lung(8)|skin(3)|urinary_tract(1)	18		Myeloproliferative disorder(115;0.0122)	Colorectal(3;0.000291)|COAD - Colon adenocarcinoma(18;0.00189)			GCTCATCAGGTTGGGATTGCA	0.443																																																	0													118.0	117.0	118.0					20																	43132618		2203	4300	6503	SO:0001583	missense	10955			U49188	CCDS13333.1	20q13.12	2008-05-14	2005-11-15	2005-11-15	ENSG00000132824	ENSG00000132824			11699	protein-coding gene	gene with protein product		607165	"""tumor differentially expressed 1"""	TDE1		10559794	Standard	NM_006811		Approved	DIFF33, TDE, SBBI99, TMS-1, AIGP1	uc002xme.3	Q13530	OTTHUMG00000033087	ENST00000342374.4:c.893A>G	20.37:g.43132618T>C	ENSP00000340243:p.Asn298Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUE9|O43717|Q9BR33	Missense_Mutation	SNP	pfam_TMS_TDE	p.N298S	ENST00000342374.4	37	c.893	CCDS13333.1	20	.	.	.	.	.	.	.	.	.	.	T	1.472	-0.559433	0.03967	.	.	ENSG00000132824	ENST00000411544;ENST00000255175;ENST00000342374;ENST00000538937;ENST00000541235	T;T;T;T	0.12569	2.67;2.67;2.67;2.67	5.24	2.03	0.26663	.	0.311100	0.42821	N	0.000643	T	0.02193	0.0068	N	0.00085	-2.2	0.21822	N	0.999529	B;B	0.02656	0.0;0.0	B;B	0.01281	0.0;0.0	T	0.44772	-0.9306	10	0.08381	T	0.77	.	10.5669	0.45177	0.0:0.6189:0.3108:0.0703	.	298;298	Q53GK8;Q13530	.;SERC3_HUMAN	S	37;298;298;265;243	ENSP00000414197:N37S;ENSP00000255175:N298S;ENSP00000340243:N298S;ENSP00000440966:N243S	ENSP00000255175:N298S	N	-	2	0	SERINC3	42566032	0.979000	0.34478	0.216000	0.23742	0.775000	0.43874	1.154000	0.31688	0.263000	0.21812	-0.132000	0.14878	AAC	SERINC3	-	pfam_TMS_TDE		0.443	SERINC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SERINC3	HGNC	protein_coding	OTTHUMT00000080544.3	T	NM_006811		43132618	-1	no_errors	ENST00000255175	ensembl	human	known	70_37	missense	SNP	0.892	C
SFSWAP	6433	genome.wustl.edu	37	12	132239006	132239006	+	Silent	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr12:132239006G>A	ENST00000261674.4	+	9	1557	c.1416G>A	c.(1414-1416)ctG>ctA	p.L472L	SFSWAP_ENST00000541286.1_Silent_p.L472L|RP11-495K9.5_ENST00000537032.1_lincRNA	NM_004592.3	NP_004583.2	Q12872	SFSWA_HUMAN	splicing factor, suppressor of white-apricot family	472					mRNA processing (GO:0006397)|mRNA splice site selection (GO:0006376)|negative regulation of mRNA splicing, via spliceosome (GO:0048025)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(8)|ovary(1)|skin(2)	25						GGAACGGCCTGAAGTTCGAGA	0.537																																																	0													57.0	58.0	58.0					12																	132239006		2203	4300	6503	SO:0001819	synonymous_variant	6433			U08377	CCDS9273.1, CCDS58290.1	12q24.33	2014-04-14	2014-04-14	2010-09-15	ENSG00000061936	ENSG00000061936			10790	protein-coding gene	gene with protein product		601945	"""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot, Drosophila homolog)"", ""splicing factor, arginine/serine-rich 8 (suppressor-of-white-apricot homolog, Drosophila)"", ""splicing factor, suppressor of white-apricot homolog (Drosophila)"""	SFRS8		8940107	Standard	NM_004592		Approved	SWAP	uc010tbn.2	Q12872	OTTHUMG00000168319	ENST00000261674.4:c.1416G>A	12.37:g.132239006G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RN45|B7ZM97|F5H6B8|Q6PJF7	Silent	SNP	pfam_SWAP_N_domain,pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp	p.L472	ENST00000261674.4	37	c.1416	CCDS9273.1	12																																																																																			SFSWAP	-	pfam_Surp,superfamily_Surp,smart_Surp,pfscan_Surp		0.537	SFSWAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	SFSWAP	HGNC	protein_coding	OTTHUMT00000399276.1	G	NM_004592		132239006	+1	no_errors	ENST00000261674	ensembl	human	known	70_37	silent	SNP	0.430	A
SGCG	6445	genome.wustl.edu	37	13	23898522	23898522	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr13:23898522G>A	ENST00000218867.3	+	8	842	c.718G>A	c.(718-720)Gaa>Aaa	p.E240K	SGCG_ENST00000537476.1_Missense_Mutation_p.E240K|SGCG_ENST00000545013.1_Missense_Mutation_p.E240K	NM_000231.2	NP_000222	Q13326	SGCG_HUMAN	sarcoglycan, gamma (35kDa dystrophin-associated glycoprotein)	240					muscle organ development (GO:0007517)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcoglycan complex (GO:0016012)|sarcolemma (GO:0042383)				NS(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(9)|lung(5)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	22		all_cancers(29;4.34e-23)|all_epithelial(30;4.4e-19)|all_lung(29;2.45e-18)|Lung SC(185;0.0228)|Breast(139;0.188)		all cancers(112;0.00255)|Epithelial(112;0.0129)|OV - Ovarian serous cystadenocarcinoma(117;0.0365)|Lung(94;0.205)		GCTTGATGCTGAAACTGTGTG	0.527																																																	0													99.0	81.0	87.0					13																	23898522		2203	4300	6503	SO:0001583	missense	6445			U34976	CCDS9299.1	13q12-q13	2014-09-17	2002-08-29		ENSG00000102683	ENSG00000102683			10809	protein-coding gene	gene with protein product	"""Maghrebian myopathy (autosomal recessive)"", ""35kD dystrophin-associated glycoprotein"", ""limb girdle muscular dystrophy 2C (Duchenne-like muscular dystrophy, autosomal recessive)"", ""gamma sarcoglycan"""	608896	"""sarcoglycan, gamma (35kD dystrophin-associated glycoprotein)"""	DMDA1, MAM, LGMD2C		8968757	Standard	NM_000231		Approved	SCARMD2, DAGA4, SCG3, DMDA, TYPE, A4, MGC130048	uc001uom.2	Q13326	OTTHUMG00000016563	ENST00000218867.3:c.718G>A	13.37:g.23898522G>A	ENSP00000218867:p.Glu240Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32M32|Q5T9J6	Missense_Mutation	SNP	pfam_Sarcoglycan	p.E240K	ENST00000218867.3	37	c.718	CCDS9299.1	13	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959312	0.74016	.	.	ENSG00000102683	ENST00000218867;ENST00000537476;ENST00000545013	D;D;D	0.94687	-3.49;-3.49;-3.49	5.28	5.28	0.74379	.	0.049370	0.85682	D	0.000000	D	0.94305	0.8170	M	0.62723	1.935	0.80722	D	1	P	0.44380	0.834	P	0.48189	0.57	D	0.92440	0.5961	10	0.09590	T	0.72	-3.5486	18.9107	0.92483	0.0:0.0:1.0:0.0	.	240	Q13326	SGCG_HUMAN	K	240	ENSP00000218867:E240K;ENSP00000444100:E240K;ENSP00000442232:E240K	ENSP00000218867:E240K	E	+	1	0	SGCG	22796522	1.000000	0.71417	1.000000	0.80357	0.528000	0.34623	8.950000	0.93019	2.476000	0.83614	0.555000	0.69702	GAA	SGCG	-	pfam_Sarcoglycan		0.527	SGCG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SGCG	HGNC	protein_coding	OTTHUMT00000044151.1	G	NM_000231		23898522	+1	no_errors	ENST00000218867	ensembl	human	known	70_37	missense	SNP	1.000	A
SLC5A4	6527	genome.wustl.edu	37	22	32630960	32630960	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr22:32630960G>A	ENST00000266086.4	-	8	796	c.785C>T	c.(784-786)tCc>tTc	p.S262F	RP1-90G24.10_ENST00000434942.1_RNA	NM_014227.2	NP_055042.1	Q9NY91	SC5A4_HUMAN	solute carrier family 5 (glucose activated ion channel), member 4	262					carbohydrate transport (GO:0008643)|sodium ion transport (GO:0006814)	integral component of membrane (GO:0016021)	symporter activity (GO:0015293)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(15)|pancreas(2)|prostate(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GATGTGGAAGGAGTCCGCCCG	0.507																																																	0													211.0	190.0	197.0					22																	32630960		2203	4300	6503	SO:0001583	missense	6527			U41897	CCDS13903.1	22q12.3	2013-07-19	2013-07-19		ENSG00000100191	ENSG00000100191		"""Solute carriers"""	11039	protein-coding gene	gene with protein product			"""solute carrier family 5 (low affinity glucose cotransporter), member 4"""			9501190, 12354616	Standard	NM_014227		Approved	SAAT1, SGLT3, DJ90G24.4	uc003ami.3	Q9NY91	OTTHUMG00000150007	ENST00000266086.4:c.785C>T	22.37:g.32630960G>A	ENSP00000266086:p.Ser262Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	O15279	Missense_Mutation	SNP	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr	p.S262F	ENST00000266086.4	37	c.785	CCDS13903.1	22	.	.	.	.	.	.	.	.	.	.	.	11.67	1.708442	0.30322	.	.	ENSG00000100191	ENST00000266086	D	0.89415	-2.51	4.78	3.77	0.43336	.	0.158922	0.64402	D	0.000017	D	0.85191	0.5640	L	0.47016	1.485	0.58432	D	0.999998	B	0.09022	0.002	B	0.23716	0.048	T	0.82954	-0.0201	10	0.87932	D	0	.	11.0399	0.47825	0.0912:0.0:0.9088:0.0	.	262	Q9NY91	SC5A4_HUMAN	F	262	ENSP00000266086:S262F	ENSP00000266086:S262F	S	-	2	0	SLC5A4	30960960	1.000000	0.71417	1.000000	0.80357	0.085000	0.17905	9.523000	0.98034	1.385000	0.46445	0.650000	0.86243	TCC	SLC5A4	-	pfam_Na/solute_symporter,pfscan_Na/solute_symporter,tigrfam_Na/solute_symporter_subgr		0.507	SLC5A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC5A4	HGNC	protein_coding	OTTHUMT00000315724.1	G	NM_014227		32630960	-1	no_errors	ENST00000266086	ensembl	human	known	70_37	missense	SNP	1.000	A
SLIT2	9353	genome.wustl.edu	37	4	20569140	20569140	+	Splice_Site	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr4:20569140G>A	ENST00000504154.1	+	28	3102		c.e28-1		SLIT2_ENST00000503823.1_Splice_Site|SLIT2_ENST00000503837.1_Splice_Site|SLIT2_ENST00000273739.5_Splice_Site	NM_004787.1	NP_004778.1	O94813	SLIT2_HUMAN	slit homolog 2 (Drosophila)						apoptotic process involved in luteolysis (GO:0061364)|axon extension involved in axon guidance (GO:0048846)|axon guidance (GO:0007411)|branching morphogenesis of an epithelial tube (GO:0048754)|cell migration involved in sprouting angiogenesis (GO:0002042)|cellular response to heparin (GO:0071504)|cellular response to hormone stimulus (GO:0032870)|chemorepulsion involved in postnatal olfactory bulb interneuron migration (GO:0021836)|corticospinal neuron axon guidance through spinal cord (GO:0021972)|dorsal/ventral axon guidance (GO:0033563)|in utero embryonic development (GO:0001701)|induction of negative chemotaxis (GO:0050929)|mammary duct terminal end bud growth (GO:0060763)|metanephros development (GO:0001656)|motor neuron axon guidance (GO:0008045)|negative chemotaxis (GO:0050919)|negative regulation of actin filament polymerization (GO:0030837)|negative regulation of axon extension (GO:0030517)|negative regulation of catalytic activity (GO:0043086)|negative regulation of cell growth (GO:0030308)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of cellular response to growth factor stimulus (GO:0090288)|negative regulation of chemokine-mediated signaling pathway (GO:0070100)|negative regulation of endothelial cell migration (GO:0010596)|negative regulation of gene expression (GO:0010629)|negative regulation of lamellipodium assembly (GO:0010593)|negative regulation of leukocyte chemotaxis (GO:0002689)|negative regulation of monocyte chemotaxis (GO:0090027)|negative regulation of mononuclear cell migration (GO:0071676)|negative regulation of neutrophil chemotaxis (GO:0090024)|negative regulation of protein phosphorylation (GO:0001933)|negative regulation of retinal ganglion cell axon guidance (GO:0090260)|negative regulation of small GTPase mediated signal transduction (GO:0051058)|negative regulation of smooth muscle cell chemotaxis (GO:0071672)|negative regulation of smooth muscle cell migration (GO:0014912)|negative regulation of vascular permeability (GO:0043116)|positive regulation of apoptotic process (GO:0043065)|positive regulation of axonogenesis (GO:0050772)|response to cortisol (GO:0051414)|retinal ganglion cell axon guidance (GO:0031290)|Roundabout signaling pathway (GO:0035385)|single organismal cell-cell adhesion (GO:0016337)|ureteric bud development (GO:0001657)	cell surface (GO:0009986)|cytoplasm (GO:0005737)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)|chemorepellent activity (GO:0045499)|GTPase inhibitor activity (GO:0005095)|heparin binding (GO:0008201)|identical protein binding (GO:0042802)|laminin-1 binding (GO:0043237)|protein homodimerization activity (GO:0042803)|proteoglycan binding (GO:0043394)|Roundabout binding (GO:0048495)			NS(1)|breast(4)|central_nervous_system(4)|cervix(1)|endometrium(5)|kidney(7)|large_intestine(17)|lung(60)|ovary(3)|pancreas(1)|prostate(2)|skin(10)|upper_aerodigestive_tract(1)	116						TTCTTCTCCAGGGGCAGGACT	0.443																																																	0													117.0	108.0	111.0					4																	20569140		2203	4299	6502	SO:0001630	splice_region_variant	9353			AF055585	CCDS3426.1, CCDS75110.1, CCDS75111.1	4p15.2	2008-08-01	2001-11-28		ENSG00000145147	ENSG00000145147			11086	protein-coding gene	gene with protein product		603746	"""slit (Drosophila) homolog 2"""	SLIL3		9813312, 18269211	Standard	XM_005248211		Approved	Slit-2	uc003gpr.1	O94813	OTTHUMG00000128551	ENST00000504154.1:c.2851-1G>A	4.37:g.20569140G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLR5|O95710|Q17RU3|Q9Y5Q7	Splice_Site	SNP	-	e28-1	ENST00000504154.1	37	c.2851-1	CCDS3426.1	4	.	.	.	.	.	.	.	.	.	.	G	23.1	4.377166	0.82682	.	.	ENSG00000145147	ENST00000503823;ENST00000504154;ENST00000273739;ENST00000382173;ENST00000503837;ENST00000511508;ENST00000509941	.	.	.	5.86	5.86	0.93980	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	20.259	0.98436	0.0:0.0:1.0:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	SLIT2	20178238	1.000000	0.71417	1.000000	0.80357	0.908000	0.53690	9.869000	0.99810	2.793000	0.96121	0.644000	0.83932	.	SLIT2	-	-		0.443	SLIT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLIT2	HGNC	protein_coding	OTTHUMT00000250396.2	G		Intron	20569140	+1	no_errors	ENST00000504154	ensembl	human	known	70_37	splice_site	SNP	1.000	A
SPTBN4	57731	genome.wustl.edu	37	19	40998873	40998873	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:40998873C>T	ENST00000352632.3	+	5	585	c.499C>T	c.(499-501)Caa>Taa	p.Q167*	SPTBN4_ENST00000598249.1_Nonsense_Mutation_p.Q167*|SPTBN4_ENST00000338932.3_Nonsense_Mutation_p.Q167*|SPTBN4_ENST00000344104.3_Nonsense_Mutation_p.Q167*|SPTBN4_ENST00000595535.1_Nonsense_Mutation_p.Q167*			Q9H254	SPTN4_HUMAN	spectrin, beta, non-erythrocytic 4	167	Actin-binding.				actin filament capping (GO:0051693)|adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|axonogenesis (GO:0007409)|cardiac conduction (GO:0061337)|central nervous system projection neuron axonogenesis (GO:0021952)|clustering of voltage-gated sodium channels (GO:0045162)|cytoskeletal anchoring at plasma membrane (GO:0007016)|establishment of protein localization to plasma membrane (GO:0090002)|fertilization (GO:0009566)|negative regulation of heart rate (GO:0010459)|positive regulation of multicellular organism growth (GO:0040018)|regulation of peptidyl-serine phosphorylation (GO:0033135)|regulation of sodium ion transport (GO:0002028)|sensory perception of sound (GO:0007605)|transmission of nerve impulse (GO:0019226)|vesicle-mediated transport (GO:0016192)	adherens junction (GO:0005912)|axon hillock (GO:0043203)|axon initial segment (GO:0043194)|cell body fiber (GO:0070852)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|node of Ranvier (GO:0033268)|nuclear matrix (GO:0016363)|paranode region of axon (GO:0033270)|plasma membrane (GO:0005886)|PML body (GO:0016605)|spectrin (GO:0008091)	actin binding (GO:0003779)|ankyrin binding (GO:0030506)|phosphatase binding (GO:0019902)|phospholipid binding (GO:0005543)|spectrin binding (GO:0030507)|structural constituent of cytoskeleton (GO:0005200)			breast(4)|central_nervous_system(1)|endometrium(6)|kidney(7)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	73			Lung(22;0.000114)|LUSC - Lung squamous cell carcinoma(20;0.000384)			TTCACAGATTCAAGTCATCAA	0.522																																																	0													81.0	69.0	73.0					19																	40998873		2203	4300	6503	SO:0001587	stop_gained	57731			AF082075	CCDS12559.1, CCDS42569.1	19q13.13	2013-01-10				ENSG00000160460		"""Pleckstrin homology (PH) domain containing"""	14896	protein-coding gene	gene with protein product		606214				11086001	Standard	NM_020971		Approved	SPTBN3, KIAA1642	uc002onz.3	Q9H254		ENST00000352632.3:c.499C>T	19.37:g.40998873C>T	ENSP00000263373:p.Gln167*	Somatic		WXS	Illumina HiSeq	Phase_IV	E9PGQ5|Q9H1K7|Q9H1K8|Q9H1K9|Q9H253|Q9H3G8|Q9HCD0	Nonsense_Mutation	SNP	pirsf_Spectrin_bsu,pfam_Spectrin_repeat,pfam_CH-domain,pfam_Pleckstrin_homology,pfam_CAMSAP_CH,superfamily_CH-domain,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Pleckstrin_homology,prints_PH_dom-spectrin-type,pfscan_CH-domain,pfscan_Pleckstrin_homology	p.Q167*	ENST00000352632.3	37	c.499	CCDS12559.1	19	.	.	.	.	.	.	.	.	.	.	C	37	6.022746	0.97211	.	.	ENSG00000160460	ENST00000428507;ENST00000352632;ENST00000338932;ENST00000344104	.	.	.	3.82	3.82	0.43975	.	1.463730	0.05474	U	0.553556	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	14.6764	0.68983	0.0:1.0:0.0:0.0	.	.	.	.	X	167	.	ENSP00000340345:Q167X	Q	+	1	0	SPTBN4	45690713	1.000000	0.71417	1.000000	0.80357	0.876000	0.50452	7.571000	0.82399	1.980000	0.57719	0.281000	0.19383	CAA	SPTBN4	-	pirsf_Spectrin_bsu,superfamily_CH-domain		0.522	SPTBN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPTBN4	HGNC	protein_coding	OTTHUMT00000462559.2	C			40998873	+1	no_errors	ENST00000352632	ensembl	human	known	70_37	nonsense	SNP	1.000	T
STARD7	56910	genome.wustl.edu	37	2	96852484	96852484	+	Missense_Mutation	SNP	C	C	A	rs533954441		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:96852484C>A	ENST00000337288.5	-	8	1480	c.1097G>T	c.(1096-1098)cGg>cTg	p.R366L	STARD7_ENST00000462501.1_5'Flank	NM_020151.3	NP_064536.2	Q9NQZ5	STAR7_HUMAN	StAR-related lipid transfer (START) domain containing 7	366						mitochondrion (GO:0005739)	lipid binding (GO:0008289)			endometrium(2)|kidney(1)|large_intestine(1)|lung(8)|stomach(2)	14						ATACTCAATCCGAGCAGGGCC	0.537																																																	0													76.0	71.0	72.0					2																	96852484		2203	4300	6503	SO:0001583	missense	56910			AF270647	CCDS2017.2	2p11.1	2011-09-12	2007-08-16		ENSG00000084090	ENSG00000084090		"""StAR-related lipid transfer (START) domain containing"""	18063	protein-coding gene	gene with protein product			"""START domain containing 7"""				Standard	NM_020151		Approved	GTT1	uc002svm.4	Q9NQZ5	OTTHUMG00000130457	ENST00000337288.5:c.1097G>T	2.37:g.96852484C>A	ENSP00000338030:p.Arg366Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DXG9|Q53T44|Q6GU43|Q969M6	Missense_Mutation	SNP	pfam_START_lipid-bd,smart_START_lipid-bd,pfscan_START_lipid-bd	p.R366L	ENST00000337288.5	37	c.1097	CCDS2017.2	2	.	.	.	.	.	.	.	.	.	.	C	15.00	2.703077	0.48412	.	.	ENSG00000084090	ENST00000337288	T	0.50548	0.74	5.84	1.74	0.24563	.	0.273456	0.37348	N	0.002126	T	0.30978	0.0782	N	0.24115	0.695	0.27576	N	0.949726	B	0.27498	0.18	B	0.23275	0.045	T	0.14008	-1.0488	10	0.54805	T	0.06	-9.602	10.6208	0.45478	0.0:0.6257:0.0:0.3743	.	366	Q9NQZ5	STAR7_HUMAN	L	366	ENSP00000338030:R366L	ENSP00000338030:R366L	R	-	2	0	STARD7	96216211	0.976000	0.34144	0.445000	0.26908	0.857000	0.48899	1.679000	0.37597	-0.154000	0.11118	-0.797000	0.03246	CGG	STARD7	-	NULL		0.537	STARD7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STARD7	HGNC	protein_coding	OTTHUMT00000252848.2	C			96852484	-1	no_errors	ENST00000337288	ensembl	human	known	70_37	missense	SNP	0.762	A
TAB3	257397	genome.wustl.edu	37	X	30864732	30864732	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:30864732C>G	ENST00000378933.1	-	5	1917	c.1740G>C	c.(1738-1740)atG>atC	p.M580I	TAB3_ENST00000378932.2_Missense_Mutation_p.M580I|TAB3_ENST00000378930.3_Missense_Mutation_p.M580I|TAB3_ENST00000288422.2_Missense_Mutation_p.M580I|TAB3_ENST00000378928.1_Missense_Mutation_p.M31I	NM_152787.3	NP_690000.2	Q8N5C8	TAB3_HUMAN	TGF-beta activated kinase 1/MAP3K7 binding protein 3	580					activation of MAPK activity (GO:0000187)|Fc-epsilon receptor signaling pathway (GO:0038095)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|innate immune response (GO:0045087)|JNK cascade (GO:0007254)|MyD88-dependent toll-like receptor signaling pathway (GO:0002755)|MyD88-independent toll-like receptor signaling pathway (GO:0002756)|nucleotide-binding domain, leucine rich repeat containing receptor signaling pathway (GO:0035872)|nucleotide-binding oligomerization domain containing signaling pathway (GO:0070423)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|stress-activated MAPK cascade (GO:0051403)|toll-like receptor 10 signaling pathway (GO:0034166)|toll-like receptor 2 signaling pathway (GO:0034134)|toll-like receptor 3 signaling pathway (GO:0034138)|toll-like receptor 4 signaling pathway (GO:0034142)|toll-like receptor 5 signaling pathway (GO:0034146)|toll-like receptor 9 signaling pathway (GO:0034162)|toll-like receptor signaling pathway (GO:0002224)|toll-like receptor TLR1:TLR2 signaling pathway (GO:0038123)|toll-like receptor TLR6:TLR2 signaling pathway (GO:0038124)|TRIF-dependent toll-like receptor signaling pathway (GO:0035666)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|endosome membrane (GO:0010008)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(8)|kidney(1)|large_intestine(6)|lung(6)|ovary(2)|pancreas(1)|skin(1)	27						GTTGTCTGTTCATGCTTCTCA	0.368																																					Pancreas(164;1598 1985 29022 43301 49529)												0													204.0	169.0	181.0					X																	30864732		2202	4300	6502	SO:0001583	missense	257397			AY331591	CCDS14226.1	Xp21.2	2010-02-05	2010-02-05	2010-02-05	ENSG00000157625	ENSG00000157625			30681	protein-coding gene	gene with protein product	"""TAK1 binding protein 3"""	300480	"""mitogen-activated protein kinase kinase kinase 7 interacting protein 3"""	MAP3K7IP3		14633987, 14670075	Standard	XM_005274482		Approved		uc004dcj.3	Q8N5C8	OTTHUMG00000021329	ENST00000378933.1:c.1740G>C	X.37:g.30864732C>G	ENSP00000368215:p.Met580Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDD9|Q6VQR0	Missense_Mutation	SNP	pfam_CUE,pfam_Znf_RanBP2,superfamily_UBA-like,smart_CUE,smart_Znf_RanBP2,pfscan_CUE,pfscan_Znf_RanBP2	p.M580I	ENST00000378933.1	37	c.1740	CCDS14226.1	X	.	.	.	.	.	.	.	.	.	.	C	7.308	0.614339	0.14129	.	.	ENSG00000157625	ENST00000378933;ENST00000378930;ENST00000288422;ENST00000378932;ENST00000378928	T;T;T;T	0.71579	-0.58;-0.58;-0.58;-0.58	5.23	4.31	0.51392	.	0.303387	0.36628	N	0.002483	T	0.44180	0.1281	N	0.03608	-0.345	0.26949	N	0.966078	B;B	0.11235	0.0;0.004	B;B	0.08055	0.001;0.003	T	0.23762	-1.0179	10	0.21014	T	0.42	-0.495	10.5203	0.44914	0.1373:0.7139:0.1488:0.0	.	580;580	Q8N5C8-2;Q8N5C8	.;TAB3_HUMAN	I	580;580;580;580;31	ENSP00000368215:M580I;ENSP00000368212:M580I;ENSP00000288422:M580I;ENSP00000368214:M580I	ENSP00000288422:M580I	M	-	3	0	TAB3	30774653	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	0.707000	0.25704	2.186000	0.69663	0.538000	0.68166	ATG	TAB3	-	NULL		0.368	TAB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAB3	HGNC	protein_coding	OTTHUMT00000056173.1	C	NM_152787		30864732	-1	no_errors	ENST00000288422	ensembl	human	known	70_37	missense	SNP	1.000	G
TAF1L	138474	genome.wustl.edu	37	9	32630431	32630431	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr9:32630431G>A	ENST00000242310.4	-	1	5236	c.5147C>T	c.(5146-5148)tCt>tTt	p.S1716F		NM_153809.2	NP_722516.1	Q8IZX4	TAF1L_HUMAN	TAF1 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa-like	1716					DNA-templated transcription, initiation (GO:0006352)|histone acetylation (GO:0016573)|male meiosis (GO:0007140)|positive regulation of transcription, DNA-templated (GO:0045893)|protein phosphorylation (GO:0006468)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	transcription factor TFIID complex (GO:0005669)	DNA binding (GO:0003677)|histone acetyltransferase activity (GO:0004402)|lysine-acetylated histone binding (GO:0070577)|protein serine/threonine kinase activity (GO:0004674)|TBP-class protein binding (GO:0017025)			breast(6)|central_nervous_system(4)|endometrium(14)|kidney(11)|large_intestine(32)|liver(2)|lung(68)|ovary(2)|pancreas(2)|prostate(7)|skin(9)|stomach(1)|upper_aerodigestive_tract(1)	159			LUSC - Lung squamous cell carcinoma(29;0.0181)	GBM - Glioblastoma multiforme(74;0.00301)		ATCCACATCAGAGTCTTCCTC	0.493																																																	0													190.0	174.0	180.0					9																	32630431		2203	4300	6503	SO:0001583	missense	138474			AF390562	CCDS35003.1	9p12	2007-07-27	2007-07-27		ENSG00000122728	ENSG00000122728			18056	protein-coding gene	gene with protein product		607798	"""TAF1-like RNA polymerase II, TATA box binding protein (TBP)-associated factor, 210kDa"""			12217962	Standard	NM_153809		Approved		uc003zrg.1	Q8IZX4	OTTHUMG00000019747	ENST00000242310.4:c.5147C>T	9.37:g.32630431G>A	ENSP00000418379:p.Ser1716Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0VG57	Missense_Mutation	SNP	pirsf_TAF1_animal,pfam_TFIID_sub1_DUF3591,pfam_Bromodomain,pfam_TAF_II_230-bd,superfamily_Bromodomain,superfamily_TAF_II_230-bd,smart_Bromodomain,prints_Bromodomain,pfscan_Bromodomain	p.S1716F	ENST00000242310.4	37	c.5147	CCDS35003.1	9	.	.	.	.	.	.	.	.	.	.	G	10.47	1.358072	0.24598	.	.	ENSG00000122728	ENST00000242310	T	0.08634	3.07	0.149	0.149	0.14863	.	.	.	.	.	T	0.03915	0.0110	N	0.14661	0.345	0.22701	N	0.998839	P	0.44734	0.842	B	0.38378	0.272	T	0.42666	-0.9438	9	0.20519	T	0.43	.	6.0152	0.19598	5.0E-4:0.0:0.9995:0.0	.	1716	Q8IZX4	TAF1L_HUMAN	F	1716	ENSP00000418379:S1716F	ENSP00000418379:S1716F	S	-	2	0	TAF1L	32620431	1.000000	0.71417	0.057000	0.19452	0.052000	0.14988	3.008000	0.49544	0.192000	0.20272	0.195000	0.17529	TCT	TAF1L	-	pirsf_TAF1_animal		0.493	TAF1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF1L	HGNC	protein_coding	OTTHUMT00000052012.2	G			32630431	-1	no_errors	ENST00000242310	ensembl	human	known	70_37	missense	SNP	1.000	A
TENM2	57451	genome.wustl.edu	37	5	167630771	167630771	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr5:167630771G>C	ENST00000518659.1	+	18	3547	c.3508G>C	c.(3508-3510)Gag>Cag	p.E1170Q	TENM2_ENST00000545108.1_Missense_Mutation_p.E1170Q|TENM2_ENST00000403607.2_Missense_Mutation_p.E994Q|TENM2_ENST00000520394.1_Missense_Mutation_p.E938Q|TENM2_ENST00000519204.1_Missense_Mutation_p.E1049Q	NM_001122679.1	NP_001116151.1	Q9NT68	TEN2_HUMAN	teneurin transmembrane protein 2	1170					axon guidance (GO:0007411)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|heterophilic cell-cell adhesion (GO:0007157)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of filopodium assembly (GO:0051491)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)|single organismal cell-cell adhesion (GO:0016337)|transcription, DNA-templated (GO:0006351)	cell junction (GO:0030054)|cell-cell junction (GO:0005911)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|endoplasmic reticulum (GO:0005783)|filopodium (GO:0030175)|Golgi apparatus (GO:0005794)|growth cone (GO:0030426)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|PML body (GO:0016605)|postsynaptic membrane (GO:0045211)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|receptor binding (GO:0005102)										TCAGGGATTCGAGCTGGACCC	0.502																																																	0													145.0	138.0	140.0					5																	167630771		1884	4103	5987	SO:0001583	missense	57451			AB032953		5q35	2012-10-02	2012-10-02	2012-10-02	ENSG00000145934	ENSG00000145934			29943	protein-coding gene	gene with protein product		610119	"""odz, odd Oz/ten-m homolog 2 (Drosophila)"""	ODZ2		10625539	Standard	NM_001122679		Approved	KIAA1127, Ten-M2	uc010jjd.3	Q9NT68	OTTHUMG00000162928	ENST00000518659.1:c.3508G>C	5.37:g.167630771G>C	ENSP00000429430:p.Glu1170Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9ULU2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,superfamily_CarboxyPept-like_regulatory,superfamily_Quino_amine_DH_bsu,superfamily_ConA-like_lec_gl_sf,superfamily_Cytokine_IL1-like,smart_EG-like_dom,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.E1170Q	ENST00000518659.1	37	c.3508		5	.	.	.	.	.	.	.	.	.	.	g	27.8	4.862929	0.91511	.	.	ENSG00000145934	ENST00000518659;ENST00000545108;ENST00000519204;ENST00000520394;ENST00000403607	D;D;D;D;D	0.90197	-2.18;-2.15;-2.29;-2.6;-2.63	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	D	0.95875	0.8657	M	0.86178	2.8	0.58432	D	0.999997	D;D;D	0.89917	1.0;1.0;0.998	D;D;D	0.97110	1.0;0.999;0.992	D	0.96319	0.9235	10	0.72032	D	0.01	.	18.809	0.92050	0.0:0.0:1.0:0.0	.	1170;1170;938	F5H2D1;Q9NT68;F8VNQ3	.;TEN2_HUMAN;.	Q	1170;1170;1049;938;994	ENSP00000429430:E1170Q;ENSP00000438635:E1170Q;ENSP00000428964:E1049Q;ENSP00000427874:E938Q;ENSP00000384905:E994Q	ENSP00000384905:E994Q	E	+	1	0	ODZ2	167563349	1.000000	0.71417	0.981000	0.43875	0.945000	0.59286	9.810000	0.99221	2.499000	0.84300	0.645000	0.84053	GAG	TENM2	-	superfamily_ConA-like_lec_gl_sf		0.502	TENM2-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	TENM2	HGNC	protein_coding	OTTHUMT00000376096.1	G	NM_001122679		167630771	+1	no_errors	ENST00000518659	ensembl	human	known	70_37	missense	SNP	1.000	C
TENM4	26011	genome.wustl.edu	37	11	78780941	78780941	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:78780941C>T	ENST00000278550.7	-	5	511	c.49G>A	c.(49-51)Gac>Aac	p.D17N	TENM4_ENST00000533038.1_5'UTR	NM_001098816.2	NP_001092286.2	Q6N022	TEN4_HUMAN	teneurin transmembrane protein 4	17	Teneurin N-terminal. {ECO:0000255|PROSITE-ProRule:PRU00694}.				cardiac cell fate specification (GO:0060912)|cardiac muscle cell proliferation (GO:0060038)|central nervous system myelin formation (GO:0032289)|gastrulation with mouth forming second (GO:0001702)|neuron development (GO:0048666)|positive regulation of gastrulation (GO:2000543)|positive regulation of myelination (GO:0031643)|positive regulation of oligodendrocyte differentiation (GO:0048714)|self proteolysis (GO:0097264)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection (GO:0043005)|nucleus (GO:0005634)	protein homodimerization activity (GO:0042803)										CGCTCGGCGTCGCGGCGCCGG	0.677																																																	0													30.0	34.0	33.0					11																	78780941		692	1591	2283	SO:0001583	missense	26011			AB037723	CCDS44688.1	11q13	2012-10-02	2012-10-02	2012-10-02		ENSG00000149256			29945	protein-coding gene	gene with protein product		610084	"""odz, odd Oz/ten-m homolog 4 (Drosophila)"""	ODZ4		12000766, 10625539	Standard	NM_001098816		Approved	KIAA1302, Ten-M4	uc001ozl.4	Q6N022		ENST00000278550.7:c.49G>A	11.37:g.78780941C>T	ENSP00000278550:p.Asp17Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND26|Q7Z3C7|Q96MS6|Q9P2P4|Q9Y4S2	Missense_Mutation	SNP	pfam_Ten_N,pfam_EGF_extracell,pfam_YD,superfamily_CarboxyPept-like_regulatory,smart_EG-like_dom,pfscan_EG-like_dom,tigrfam_YD,tigrfam_Rhs_assc_core	p.D17N	ENST00000278550.7	37	c.49	CCDS44688.1	11	.	.	.	.	.	.	.	.	.	.	C	29.4	5.001870	0.93227	.	.	ENSG00000149256	ENST00000278550	T	0.36699	1.24	4.54	4.54	0.55810	Teneurin intracellular, N-terminal (2);	0.000000	0.85682	D	0.000000	T	0.46386	0.1390	N	0.22421	0.69	0.58432	D	0.999996	D;D	0.89917	1.0;0.999	D;D	0.83275	0.996;0.989	T	0.37267	-0.9713	9	.	.	.	.	17.8567	0.88765	0.0:1.0:0.0:0.0	.	17;17	G3CAT1;Q6N022	.;TEN4_HUMAN	N	17	ENSP00000278550:D17N	.	D	-	1	0	ODZ4	78458589	1.000000	0.71417	0.957000	0.39632	0.968000	0.65278	7.294000	0.78760	2.525000	0.85131	0.655000	0.94253	GAC	TENM4	-	pfam_Ten_N		0.677	TENM4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TENM4	HGNC	protein_coding	OTTHUMT00000391406.2	C			78780941	-1	no_errors	ENST00000278550	ensembl	human	known	70_37	missense	SNP	1.000	T
TFB2M	64216	genome.wustl.edu	37	1	246714575	246714575	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:246714575G>T	ENST00000366514.4	-	5	920	c.735C>A	c.(733-735)gaC>gaA	p.D245E	TFB2M_ENST00000544618.1_3'UTR	NM_022366.2	NP_071761.1	Q9H5Q4	TFB2M_HUMAN	transcription factor B2, mitochondrial	245					gene expression (GO:0010467)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription from mitochondrial promoter (GO:0006390)|transcription initiation from mitochondrial promoter (GO:0006391)	mitochondrial matrix (GO:0005759)|mitochondrial nucleoid (GO:0042645)	poly(A) RNA binding (GO:0044822)|rRNA (adenine-N6,N6-)-dimethyltransferase activity (GO:0000179)|transcription cofactor activity (GO:0003712)			breast(1)|endometrium(1)|kidney(12)|large_intestine(3)|lung(5)|ovary(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	28	all_cancers(71;4.25e-05)|all_epithelial(71;4.92e-06)|Ovarian(71;0.0254)|all_lung(81;0.0272)|Breast(184;0.0318)|Lung NSC(105;0.0376)		OV - Ovarian serous cystadenocarcinoma(106;0.00358)			CATGATACAAGTCTGGATTTC	0.313																																																	0													79.0	82.0	81.0					1																	246714575		2203	4300	6503	SO:0001583	missense	64216			AK026835	CCDS1627.1	1q44	2008-02-05			ENSG00000162851	ENSG00000162851			18559	protein-coding gene	gene with protein product		607055					Standard	NM_022366		Approved	FLJ23182, FLJ22661, Hkp1	uc001ibn.3	Q9H5Q4	OTTHUMG00000040091	ENST00000366514.4:c.735C>A	1.37:g.246714575G>T	ENSP00000355471:p.Asp245Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H626	Missense_Mutation	SNP	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur	p.D245E	ENST00000366514.4	37	c.735	CCDS1627.1	1	.	.	.	.	.	.	.	.	.	.	G	0.507	-0.868080	0.02590	.	.	ENSG00000162851	ENST00000366514	T	0.27890	1.64	5.19	-2.04	0.07343	.	2.244550	0.01628	N	0.023362	T	0.19886	0.0478	L	0.40543	1.245	0.09310	N	1	B	0.12013	0.005	B	0.17979	0.02	T	0.06734	-1.0810	10	0.08179	T	0.78	-0.0567	1.3858	0.02240	0.1637:0.2054:0.3484:0.2825	.	245	Q9H5Q4	TFB2M_HUMAN	E	245	ENSP00000355471:D245E	ENSP00000355471:D245E	D	-	3	2	TFB2M	244781198	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	0.093000	0.15086	-0.045000	0.13468	-0.226000	0.12346	GAC	TFB2M	-	pfam_rRNA_Ade_methylase_transferase,smart_rRNA_Ade_methylase_Trfase_N,pirsf_Mt_di-Me-Ado_Trfase_2_prcur		0.313	TFB2M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TFB2M	HGNC	protein_coding	OTTHUMT00000096673.1	G	NM_022366		246714575	-1	no_errors	ENST00000366514	ensembl	human	known	70_37	missense	SNP	0.000	T
TMEM209	84928	genome.wustl.edu	37	7	129815407	129815407	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr7:129815407C>T	ENST00000397622.2	-	11	1411	c.1289G>A	c.(1288-1290)aGa>aAa	p.R430K	RP11-775D22.3_ENST00000483283.1_RNA|TMEM209_ENST00000462753.1_Missense_Mutation_p.R429K|TMEM209_ENST00000473456.1_Missense_Mutation_p.R388K|TMEM209_ENST00000336804.8_Missense_Mutation_p.R387K	NM_032842.3	NP_116231.2	Q96SK2	TM209_HUMAN	transmembrane protein 209	430						integral component of membrane (GO:0016021)				NS(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(6)|ovary(2)|skin(1)	12	Melanoma(18;0.0435)					GTCGCCACCTCTGTTCCATCG	0.393																																																	0													58.0	59.0	59.0					7																	129815407		2102	4243	6345	SO:0001583	missense	84928				CCDS47712.1, CCDS75661.1	7q32.2	2008-02-26			ENSG00000146842	ENSG00000146842			21898	protein-coding gene	gene with protein product						12958361	Standard	NM_032842		Approved	FLJ14803, NET31	uc003vpn.2	Q96SK2	OTTHUMG00000157653	ENST00000397622.2:c.1289G>A	7.37:g.129815407C>T	ENSP00000380747:p.Arg430Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1L1|Q49A50|Q6PF00|Q8NCH3|Q96SL6	Missense_Mutation	SNP	pfam_Cytochrome_B561-rel	p.R430K	ENST00000397622.2	37	c.1289	CCDS47712.1	7	.	.	.	.	.	.	.	.	.	.	C	12.81	2.050732	0.36181	.	.	ENSG00000146842	ENST00000397622;ENST00000462753;ENST00000473456;ENST00000336804	T;T;T;T	0.29917	1.55;1.55;1.55;1.55	5.52	4.64	0.57946	.	0.306080	0.36374	N	0.002622	T	0.17704	0.0425	N	0.24115	0.695	0.32454	N	0.544995	B;B	0.09022	0.002;0.002	B;B	0.08055	0.003;0.003	T	0.21075	-1.0256	10	0.11182	T	0.66	-21.3419	9.1301	0.36839	0.0:0.7761:0.1464:0.0775	.	388;430	Q96SK2-3;Q96SK2	.;TM209_HUMAN	K	430;429;388;387	ENSP00000380747:R430K;ENSP00000419697:R429K;ENSP00000417258:R388K;ENSP00000338388:R387K	ENSP00000338388:R387K	R	-	2	0	TMEM209	129602643	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	5.330000	0.65899	1.339000	0.45563	0.591000	0.81541	AGA	TMEM209	-	pfam_Cytochrome_B561-rel		0.393	TMEM209-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TMEM209	HGNC	protein_coding	OTTHUMT00000349339.1	C	NM_032842		129815407	-1	no_errors	ENST00000397622	ensembl	human	known	70_37	missense	SNP	1.000	T
TRIM55	84675	genome.wustl.edu	37	8	67062588	67062588	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr8:67062588C>T	ENST00000315962.4	+	7	1245	c.872C>T	c.(871-873)gCa>gTa	p.A291V	TRIM55_ENST00000353317.5_Missense_Mutation_p.A291V|TRIM55_ENST00000350034.4_Intron|TRIM55_ENST00000276573.7_Missense_Mutation_p.A291V	NM_184085.1	NP_908973.1	Q9BYV6	TRI55_HUMAN	tripartite motif containing 55	291	COS. {ECO:0000255|PROSITE- ProRule:PRU00586}.				signal transduction (GO:0007165)	cytoplasm (GO:0005737)|microtubule (GO:0005874)|nucleus (GO:0005634)	identical protein binding (GO:0042802)|signal transducer activity (GO:0004871)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(13)|ovary(1)|prostate(2)|skin(6)|upper_aerodigestive_tract(2)	39		Lung NSC(129;0.138)|all_lung(136;0.221)	Epithelial(68;0.0136)|all cancers(69;0.0582)|BRCA - Breast invasive adenocarcinoma(89;0.0628)|OV - Ovarian serous cystadenocarcinoma(28;0.0904)			ATCTCGGAAGCATCAAAGGCA	0.358																																																	0													102.0	101.0	101.0					8																	67062588		2203	4300	6503	SO:0001583	missense	84675			AJ291712	CCDS6184.1, CCDS6185.1, CCDS6186.1, CCDS6187.1	8q13.1	2013-01-09	2011-01-25	2004-11-17	ENSG00000147573	ENSG00000147573		"""RING-type (C3HC4) zinc fingers"", ""Tripartite motif containing / Tripartite motif containing"""	14215	protein-coding gene	gene with protein product		606469	"""ring finger protein 29"", ""tripartite motif-containing 55"""	RNF29		11243782	Standard	NM_033058		Approved	MURF-2	uc003xvv.3	Q9BYV6	OTTHUMG00000164473	ENST00000315962.4:c.872C>T	8.37:g.67062588C>T	ENSP00000323913:p.Ala291Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRC0|B3KRJ3|Q53XX3|Q8IUD9|Q8IUE4|Q96DV2|Q96DV3|Q9BYV5	Missense_Mutation	SNP	pfam_Znf_B-box,pfam_Znf_C3HC4_RING-type,smart_Znf_RING,smart_Znf_B-box,pfscan_Znf_B-box,pfscan_Znf_RING	p.A291V	ENST00000315962.4	37	c.872	CCDS6184.1	8	.	.	.	.	.	.	.	.	.	.	.	23.5	4.423382	0.83559	.	.	ENSG00000147573	ENST00000315962;ENST00000353317;ENST00000276573	T;T;T	0.34072	1.38;1.44;1.39	5.84	5.84	0.93424	COS domain (1);	0.094738	0.64402	D	0.000001	T	0.59865	0.2225	M	0.75615	2.305	0.80722	D	1	P;P;D	0.54772	0.938;0.892;0.968	P;P;P	0.59056	0.851;0.642;0.851	T	0.60831	-0.7185	10	0.66056	D	0.02	.	20.1535	0.98095	0.0:1.0:0.0:0.0	.	291;291;291	Q9BYV6-2;Q9BYV6;Q9BYV6-3	.;TRI55_HUMAN;.	V	291	ENSP00000323913:A291V;ENSP00000297348:A291V;ENSP00000276573:A291V	ENSP00000276573:A291V	A	+	2	0	TRIM55	67225142	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	4.778000	0.62368	2.764000	0.94973	0.650000	0.86243	GCA	TRIM55	-	NULL		0.358	TRIM55-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM55	HGNC	protein_coding	OTTHUMT00000378921.1	C	NM_184085		67062588	+1	no_errors	ENST00000315962	ensembl	human	known	70_37	missense	SNP	1.000	T
TRPV2	51393	genome.wustl.edu	37	17	16331655	16331655	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr17:16331655G>A	ENST00000338560.7	+	9	1774	c.1375G>A	c.(1375-1377)Gtg>Atg	p.V459M	AC093484.4_ENST00000441875.1_RNA|TRPV2_ENST00000583241.1_3'UTR|TRPV2_ENST00000577397.1_Missense_Mutation_p.V29M	NM_016113.4	NP_057197.2	Q9Y5S1	TRPV2_HUMAN	transient receptor potential cation channel, subfamily V, member 2	459				V -> L (in Ref. 2; AAD41724). {ECO:0000305}.	calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|positive regulation of axon extension (GO:0045773)|positive regulation of calcium ion import (GO:0090280)|response to heat (GO:0009408)|response to temperature stimulus (GO:0009266)|sensory perception (GO:0007600)|transmembrane transport (GO:0055085)|transport (GO:0006810)	axonal growth cone (GO:0044295)|cell body (GO:0044297)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endomembrane system (GO:0012505)|growth cone membrane (GO:0032584)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	calcium channel activity (GO:0005262)|cation channel activity (GO:0005261)|ion channel activity (GO:0005216)|ion transmembrane transporter activity (GO:0015075)			breast(1)|central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(9)|ovary(1)|pancreas(1)|prostate(2)|stomach(3)	28				UCEC - Uterine corpus endometrioid carcinoma (92;0.0837)		GCGGCGCCACGTGTTCATCTG	0.577											OREG0024202	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													200.0	183.0	189.0					17																	16331655		2203	4300	6503	SO:0001583	missense	51393			AF129112	CCDS32576.1	17p11.2	2013-01-10			ENSG00000187688	ENSG00000187688		"""Voltage-gated ion channels / Transient receptor potential cation channels"", ""Ankyrin repeat domain containing"""	18082	protein-coding gene	gene with protein product		606676				10201375, 16382100	Standard	NM_016113		Approved	VRL, VRL-1, VRL1	uc002gpy.3	Q9Y5S1	OTTHUMG00000058989	ENST00000338560.7:c.1375G>A	17.37:g.16331655G>A	ENSP00000342222:p.Val459Met	Somatic	709	WXS	Illumina HiSeq	Phase_IV	A6NML2|A8K0Z0|Q9Y670	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_TRPV1-4_channel,tigrfam_TRP_channel	p.V459M	ENST00000338560.7	37	c.1375	CCDS32576.1	17	.	.	.	.	.	.	.	.	.	.	G	13.70	2.315835	0.40996	.	.	ENSG00000187688	ENST00000338560	D	0.89681	-2.55	5.57	3.6	0.41247	Ion transport (1);	0.405134	0.26796	N	0.022442	T	0.77558	0.4148	N	0.08118	0	0.09310	N	0.999996	B	0.31879	0.344	B	0.35550	0.205	T	0.67237	-0.5721	10	0.34782	T	0.22	-39.5043	9.9192	0.41453	0.0:0.7824:0.1415:0.0761	.	459	Q9Y5S1	TRPV2_HUMAN	M	459	ENSP00000342222:V459M	ENSP00000342222:V459M	V	+	1	0	TRPV2	16272380	0.223000	0.23663	0.917000	0.36280	0.495000	0.33615	0.645000	0.24782	0.729000	0.32403	-0.139000	0.14373	GTG	TRPV2	-	tigrfam_TRP_channel		0.577	TRPV2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPV2	HGNC	protein_coding	OTTHUMT00000130464.2	G	NM_016113		16331655	+1	no_errors	ENST00000338560	ensembl	human	known	70_37	missense	SNP	0.993	A
TTN	7273	genome.wustl.edu	37	2	179454227	179454227	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr2:179454227C>T	ENST00000591111.1	-	254	57526	c.57302G>A	c.(57301-57303)aGa>aAa	p.R19101K	TTN_ENST00000342175.6_Missense_Mutation_p.R11869K|TTN-AS1_ENST00000592689.1_RNA|TTN-AS1_ENST00000590807.1_RNA|TTN-AS1_ENST00000592630.1_RNA|TTN-AS1_ENST00000590932.1_RNA|TTN_ENST00000359218.5_Missense_Mutation_p.R11802K|TTN_ENST00000460472.2_Missense_Mutation_p.R11677K|TTN-AS1_ENST00000456053.1_RNA|TTN-AS1_ENST00000592750.1_RNA|TTN-AS1_ENST00000589234.1_RNA|TTN_ENST00000589042.1_Missense_Mutation_p.R20742K|TTN_ENST00000342992.6_Missense_Mutation_p.R18174K|TTN-AS1_ENST00000589907.1_RNA|TTN-AS1_ENST00000591332.1_RNA|TTN-AS1_ENST00000586452.1_RNA|TTN-AS1_ENST00000419746.1_RNA|TTN-AS1_ENST00000585451.1_RNA|TTN-AS1_ENST00000590743.1_RNA			Q8WZ42	TITIN_HUMAN	titin	19101	Fibronectin type-III 38. {ECO:0000255|PROSITE-ProRule:PRU00316}.				adult heart development (GO:0007512)|blood coagulation (GO:0007596)|cardiac muscle contraction (GO:0060048)|cardiac muscle fiber development (GO:0048739)|cardiac muscle hypertrophy (GO:0003300)|cardiac muscle tissue morphogenesis (GO:0055008)|cardiac myofibril assembly (GO:0055003)|detection of muscle stretch (GO:0035995)|forward locomotion (GO:0043056)|in utero embryonic development (GO:0001701)|mitotic chromosome condensation (GO:0007076)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|regulation of catalytic activity (GO:0050790)|regulation of protein kinase activity (GO:0045859)|regulation of relaxation of cardiac muscle (GO:1901897)|response to calcium ion (GO:0051592)|sarcomere organization (GO:0045214)|sarcomerogenesis (GO:0048769)|skeletal muscle myosin thick filament assembly (GO:0030241)|skeletal muscle thin filament assembly (GO:0030240)|somitogenesis (GO:0001756)|striated muscle contraction (GO:0006941)	condensed nuclear chromosome (GO:0000794)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|I band (GO:0031674)|M band (GO:0031430)|nucleus (GO:0005634)|striated muscle thin filament (GO:0005865)|Z disc (GO:0030018)	actin filament binding (GO:0051015)|actinin binding (GO:0042805)|ATP binding (GO:0005524)|calcium ion binding (GO:0005509)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|muscle alpha-actinin binding (GO:0051371)|protease binding (GO:0002020)|protein kinase binding (GO:0019901)|protein self-association (GO:0043621)|protein serine/threonine kinase activity (GO:0004674)|structural constituent of muscle (GO:0008307)|structural molecule activity conferring elasticity (GO:0097493)|telethonin binding (GO:0031433)			NS(24)|autonomic_ganglia(1)|breast(64)|central_nervous_system(14)|cervix(14)|endometrium(96)|haematopoietic_and_lymphoid_tissue(16)|kidney(91)|large_intestine(303)|liver(1)|lung(595)|ovary(58)|pancreas(17)|prostate(38)|skin(60)|stomach(29)|upper_aerodigestive_tract(1)|urinary_tract(26)	1448			OV - Ovarian serous cystadenocarcinoma(117;0.023)|Epithelial(96;0.0454)|all cancers(119;0.134)			TGTTTGCACTCTGAACTCATA	0.398																																																	0													76.0	76.0	76.0					2																	179454227		1893	4122	6015	SO:0001583	missense	7273			X90568	CCDS54421.1, CCDS54422.1, CCDS54423.1, CCDS54424.1, CCDS33337.1, CCDS59435.1, CCDS74610.1	2q31	2014-09-17	2004-02-13		ENSG00000155657	ENSG00000155657		"""Immunoglobulin superfamily / I-set domain containing"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"", ""Fibronectin type III domain containing"""	12403	protein-coding gene	gene with protein product		188840	"""cardiomyopathy, dilated 1G (autosomal dominant)"""	CMD1G		2129545, 10051295	Standard	NM_003319		Approved	CMPD4, FLJ32040, TMD, CMH9, LGMD2J, MYLK5	uc031rqd.1	Q8WZ42	OTTHUMG00000154448	ENST00000591111.1:c.57302G>A	2.37:g.179454227C>T	ENSP00000465570:p.Arg19101Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NKB1|E7EQE6|E7ET18|K7ENY1|Q10465|Q10466|Q15598|Q2XUS3|Q32Q60|Q4U1Z6|Q4ZG20|Q6NSG0|Q6PDB1|Q6PJP0|Q7KYM2|Q7KYN4|Q7KYN5|Q7LDM3|Q7Z2X3|Q8TCG8|Q8WZ42|Q8WZ51|Q8WZ52|Q8WZ53|Q8WZB3|Q92761|Q92762|Q9UD97|Q9UP84|Q9Y6L9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Fibronectin_type3,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Titin_Z,pfam_PPAK_motif,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_RNaseH-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R18174K	ENST00000591111.1	37	c.54521		2	.	.	.	.	.	.	.	.	.	.	C	15.05	2.719058	0.48622	.	.	ENSG00000155657	ENST00000342992;ENST00000460472;ENST00000342175;ENST00000359218;ENST00000356127	T;T;T;T	0.59364	0.27;0.27;0.27;0.27	6.16	6.16	0.99307	Fibronectin, type III (4);Peptidase C2, calpain, large subunit, domain III (1);Ribonuclease H-like (1);Immunoglobulin-like fold (1);	.	.	.	.	T	0.71417	0.3337	M	0.73372	2.23	0.58432	D	0.999998	P;P;P;P	0.51791	0.948;0.948;0.948;0.948	P;P;P;P	0.52481	0.7;0.7;0.7;0.7	T	0.72551	-0.4259	9	0.87932	D	0	.	20.8598	0.99761	0.0:1.0:0.0:0.0	.	11677;11802;11869;19101	D3DPF9;E7EQE6;E7ET18;Q8WZ42	.;.;.;TITIN_HUMAN	K	18174;11677;11869;11802;11675	ENSP00000343764:R18174K;ENSP00000434586:R11677K;ENSP00000340554:R11869K;ENSP00000352154:R11802K	ENSP00000340554:R11869K	R	-	2	0	TTN	179162473	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	6.011000	0.70760	2.937000	0.99478	0.650000	0.86243	AGA	TTN	-	pfam_Fibronectin_type3,superfamily_Calpain_domain_III,superfamily_Fibronectin_type3,superfamily_RNaseH-like_dom,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.398	TTN-019	PUTATIVE	basic	protein_coding	TTN	HGNC	protein_coding	OTTHUMT00000460310.1	C	NM_133378		179454227	-1	no_errors	ENST00000342992	ensembl	human	known	70_37	missense	SNP	1.000	T
UGT2B17	7367	genome.wustl.edu	37	4	69426371	69426371	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr4:69426371C>T	ENST00000317746.2	-	3	931	c.889G>A	c.(889-891)Gtg>Atg	p.V297M		NM_001077.3	NP_001068.1	O75795	UDB17_HUMAN	UDP glucuronosyltransferase 2 family, polypeptide B17	297					cellular glucuronidation (GO:0052695)|steroid metabolic process (GO:0008202)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucuronosyltransferase activity (GO:0015020)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(14)|ovary(2)|prostate(1)	30					Losartan(DB00678)	GAGCTCTGCACAAACTCTTCC	0.408																																					Melanoma(18;649 833 28984 37818 38500)												0													14.0	26.0	22.0					4																	69426371		1843	3809	5652	SO:0001583	missense	7367			U59209	CCDS3523.1	4q13	2008-02-05	2005-07-20		ENSG00000197888	ENSG00000197888		"""UDP glucuronosyltransferases"""	12547	protein-coding gene	gene with protein product		601903	"""UDP glycosyltransferase 2 family, polypeptide B17"""			8798464	Standard	NM_001077		Approved		uc021xov.1	O75795	OTTHUMG00000129305	ENST00000317746.2:c.889G>A	4.37:g.69426371C>T	ENSP00000320401:p.Val297Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_UDP_glucos_trans,pfam_Glyco_trans_28_C	p.V297M	ENST00000317746.2	37	c.889	CCDS3523.1	4	.	.	.	.	.	.	.	.	.	.	c	14.87	2.665450	0.47677	.	.	ENSG00000197888	ENST00000317746	T	0.62105	0.05	2.41	1.52	0.23074	.	0.181371	0.35235	U	0.003354	T	0.61413	0.2345	L	0.58969	1.84	0.22435	N	0.999104	.	.	.	.	.	.	T	0.56263	-0.8008	8	0.87932	D	0	.	7.4123	0.27023	0.0:0.8529:0.0:0.1471	.	.	.	.	M	297	ENSP00000320401:V297M	ENSP00000320401:V297M	V	-	1	0	UGT2B17	69108966	0.956000	0.32656	0.752000	0.31206	0.911000	0.54048	2.600000	0.46240	0.316000	0.23135	0.400000	0.26472	GTG	UGT2B17	-	pfam_UDP_glucos_trans		0.408	UGT2B17-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UGT2B17	HGNC	protein_coding	OTTHUMT00000251436.1	C	NM_001077		69426371	-1	no_errors	ENST00000317746	ensembl	human	known	70_37	missense	SNP	0.998	T
UNC13A	23025	genome.wustl.edu	37	19	17759739	17759739	+	Silent	SNP	C	C	T			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr19:17759739C>T	ENST00000519716.2	-	15	1577	c.1578G>A	c.(1576-1578)acG>acA	p.T526T	UNC13A_ENST00000551649.1_Silent_p.T526T|UNC13A_ENST00000252773.7_Silent_p.T526T|UNC13A_ENST00000428389.2_Silent_p.T614T|UNC13A_ENST00000552293.1_Silent_p.T526T|UNC13A_ENST00000550896.1_Silent_p.T524T	NM_001080421.2	NP_001073890.2	Q9UPW8	UN13A_HUMAN	unc-13 homolog A (C. elegans)	526					beta-amyloid metabolic process (GO:0050435)|innervation (GO:0060384)|intracellular signal transduction (GO:0035556)|neuromuscular junction development (GO:0007528)|neurotransmitter secretion (GO:0007269)|positive regulation of neurotransmitter secretion (GO:0001956)|regulation of short-term neuronal synaptic plasticity (GO:0048172)|regulation of synaptic transmission, glutamatergic (GO:0051966)|synaptic transmission, glutamatergic (GO:0035249)|synaptic vesicle docking involved in exocytosis (GO:0016081)|synaptic vesicle maturation (GO:0016188)	axon (GO:0030424)|cell junction (GO:0030054)|cytoplasm (GO:0005737)|neuromuscular junction (GO:0031594)|neuron projection (GO:0043005)|presynaptic active zone (GO:0048786)|presynaptic membrane (GO:0042734)	diacylglycerol binding (GO:0019992)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)|syntaxin-1 binding (GO:0017075)			breast(2)|cervix(1)|endometrium(6)|kidney(3)|large_intestine(11)|lung(31)|ovary(5)|prostate(2)	61						CGTTGTTCAACGTGCTGGAGG	0.617																																																	0													27.0	32.0	31.0					19																	17759739		1996	4163	6159	SO:0001819	synonymous_variant	23025			AB028955	CCDS46013.1, CCDS46013.2	19p13.12	2008-02-05				ENSG00000130477			23150	protein-coding gene	gene with protein product		609894					Standard	NM_001080421		Approved	KIAA1032, Munc13-1	uc031rjv.1	Q9UPW8		ENST00000519716.2:c.1578G>A	19.37:g.17759739C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E5RHY9	Silent	SNP	pfam_Munc13_subgr_dom-2,pfam_C2_Ca-dep,pfam_Ca-dep_secretion_activator,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_C2_Ca/lipid-bd_dom_CaLB,smart_C2_Ca-dep,smart_Prot_Kinase_C-like_PE/DAG-bd,pfscan_C2_membr_targeting,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_C2_dom	p.T614	ENST00000519716.2	37	c.1842	CCDS46013.2	19																																																																																			UNC13A	-	NULL		0.617	UNC13A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC13A	HGNC	protein_coding	OTTHUMT00000376169.2	C	XM_038604		17759739	-1	no_errors	ENST00000428389	ensembl	human	known	70_37	silent	SNP	0.273	T
USP33	23032	genome.wustl.edu	37	1	78183553	78183553	+	Splice_Site	SNP	A	A	C			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr1:78183553A>C	ENST00000370793.1	-	18	2356	c.2010T>G	c.(2008-2010)agT>agG	p.S670R	USP33_ENST00000357428.1_Splice_Site_p.S670R|USP33_ENST00000370792.3_Splice_Site_p.S662R|USP33_ENST00000370794.3_Splice_Site_p.S639R	NM_015017.4	NP_055832.3	Q8TEY7	UBP33_HUMAN	ubiquitin specific peptidase 33	670	USP.				axon guidance (GO:0007411)|cell migration (GO:0016477)|centrosome duplication (GO:0051298)|endocytosis (GO:0006897)|protein deubiquitination (GO:0016579)|protein K48-linked deubiquitination (GO:0071108)|protein K63-linked deubiquitination (GO:0070536)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|ubiquitin-dependent protein catabolic process (GO:0006511)	cell body (GO:0044297)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|Golgi apparatus (GO:0005794)|VCB complex (GO:0030891)	cysteine-type endopeptidase activity (GO:0004197)|G-protein coupled receptor binding (GO:0001664)|ubiquitin thiolesterase activity (GO:0004221)|ubiquitin-specific protease activity (GO:0004843)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|endometrium(4)|kidney(4)|large_intestine(10)|lung(19)|ovary(1)|prostate(2)|urinary_tract(1)	44						TATACTTACTACTTGCAGTTC	0.388																																					Melanoma(152;72 1870 11110 26780 42647)												0													92.0	94.0	94.0					1																	78183553		2203	4300	6503	SO:0001630	splice_region_variant	23032			AF383173	CCDS678.1, CCDS679.1, CCDS680.1	1p31	2008-02-05	2005-08-08		ENSG00000077254	ENSG00000077254		"""Ubiquitin-specific peptidases"""	20059	protein-coding gene	gene with protein product		615146	"""ubiquitin specific protease 33"""			12838346	Standard	NM_015017		Approved	KIAA1097, VDU1	uc001dht.4	Q8TEY7	OTTHUMG00000009651	ENST00000370793.1:c.2011+1T>G	1.37:g.78183553A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TEY6|Q96AV6|Q9H9F0|Q9UPQ5	Missense_Mutation	SNP	pfam_Peptidase_C19,pfam_Pept_C19_DUSP,pfam_Znf_UBP,smart_Znf_UBP,smart_Pept_C19_DUSP,pfscan_Znf_UBP,pfscan_Peptidase_C19	p.S670R	ENST00000370793.1	37	c.2010	CCDS678.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	15.61|15.61	2.883748|2.883748	0.51908|0.51908	.|.	.|.	ENSG00000077254|ENSG00000077254	ENST00000370794;ENST00000370793;ENST00000357428;ENST00000370792|ENST00000481579	T;T;T;T|.	0.33654|.	1.4;1.47;1.47;1.4|.	4.7|4.7	1.06|1.06	0.20224|0.20224	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2, conserved site (1);Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (2);|.	0.000000|.	0.85682|.	D|.	0.000000|.	T|T	0.40040|0.40040	0.1101|0.1101	L|L	0.49350|0.49350	1.555|1.555	0.52501|0.52501	D|D	0.999951|0.999951	P;P;P;P|.	0.51933|.	0.937;0.831;0.949;0.544|.	P;P;P;P|.	0.59825|.	0.786;0.602;0.864;0.555|.	T|T	0.26467|0.26467	-1.0102|-1.0102	10|5	0.31617|.	T|.	0.26|.	.|.	7.5241|7.5241	0.27645|0.27645	0.4985:0.0:0.5015:0.0|0.4985:0.0:0.5015:0.0	.|.	662;639;670;4|.	Q8TEY7-3;Q8TEY7-2;Q8TEY7;Q9Y417|.	.;.;UBP33_HUMAN;.|.	R|G	639;670;670;662|275	ENSP00000359830:S639R;ENSP00000359829:S670R;ENSP00000350009:S670R;ENSP00000359828:S662R|.	ENSP00000350009:S670R|.	S|V	-|-	3|2	2|0	USP33|USP33	77956141|77956141	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.951000|0.951000	0.60555|0.60555	2.532000|2.532000	0.45659|0.45659	0.288000|0.288000	0.22398|0.22398	0.460000|0.460000	0.39030|0.39030	AGT|GTA	USP33	-	pfam_Peptidase_C19,pfscan_Peptidase_C19		0.388	USP33-002	KNOWN	basic|CCDS	protein_coding	USP33	HGNC	protein_coding	OTTHUMT00000026923.2	A	NM_015017	Missense_Mutation	78183553	-1	no_errors	ENST00000357428	ensembl	human	known	70_37	missense	SNP	1.000	C
ZFPL1	7542	genome.wustl.edu	37	11	64853951	64853951	+	Silent	SNP	C	C	T	rs369879946		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr11:64853951C>T	ENST00000294258.3	+	4	431	c.279C>T	c.(277-279)gcC>gcT	p.A93A	CDCA5_ENST00000404147.3_5'Flank|AP003068.6_ENST00000525544.2_5'Flank|CDCA5_ENST00000275517.3_5'Flank	NM_006782.3	NP_006773.2	O95159	ZFPL1_HUMAN	zinc finger protein-like 1	93					regulation of transcription, DNA-templated (GO:0006355)|vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(3)|lung(4)|ovary(1)|skin(1)	11						CGGCACCTGCCGGCTATCAGT	0.612																																																	0								C		0,4402		0,0,2201	137.0	145.0	142.0		279	-9.3	0.9	11		142	1,8593	1.2+/-3.3	0,1,4296	no	coding-synonymous	ZFPL1	NM_006782.3		0,1,6497	TT,TC,CC		0.0116,0.0,0.0077		93/311	64853951	1,12995	2201	4297	6498	SO:0001819	synonymous_variant	7542				CCDS8092.1	11q13	2013-01-08			ENSG00000162300	ENSG00000162300			12868	protein-coding gene	gene with protein product	"""zinc-finger protein in MEN1 region"""					9653652	Standard	NM_006782		Approved	D11S750, MCG4	uc001ocq.1	O95159	OTTHUMG00000165597	ENST00000294258.3:c.279C>T	11.37:g.64853951C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7E9|O14616|Q9UID0	Missense_Mutation	SNP	NULL	p.P56L	ENST00000294258.3	37	c.167	CCDS8092.1	11																																																																																			ZFPL1	-	NULL		0.612	ZFPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZFPL1	HGNC	protein_coding	OTTHUMT00000385196.1	C	NM_006782		64853951	+1	no_errors	ENST00000531761	ensembl	human	known	70_37	missense	SNP	0.659	T
ZNF182	7569	genome.wustl.edu	37	X	47835797	47835797	+	Silent	SNP	C	C	T	rs146981847		TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chrX:47835797C>T	ENST00000396965.1	-	7	2039	c.1689G>A	c.(1687-1689)acG>acA	p.T563T	ZNF182_ENST00000305127.6_Silent_p.T563T|ZNF182_ENST00000376943.3_Silent_p.T544T	NM_001178099.1	NP_001171570.1	P17025	ZN182_HUMAN	zinc finger protein 182	563					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(5)|kidney(1)|large_intestine(8)|lung(5)|ovary(2)|prostate(1)	22						CTCCCGTGTGCGTTCTCTGAT	0.423																																																	0								C	,,	1,3834		0,1,1631,571	122.0	103.0	110.0		1632,1689,1689	-4.9	1.0	X	dbSNP_134	110	0,6728		0,0,2428,1872	no	coding-synonymous,coding-synonymous,coding-synonymous	ZNF182	NM_001007088.1,NM_001178099.1,NM_006962.1	,,	0,1,4059,2443	TT,TC,CC,C		0.0,0.0261,0.0095	,,	544/621,563/640,563/640	47835797	1,10562	2203	4300	6503	SO:0001819	synonymous_variant	7569			AK122874, R98366	CCDS35235.1, CCDS35236.1	Xp11.23	2013-01-08	2006-05-10	2006-05-10	ENSG00000147118	ENSG00000147118		"""Zinc fingers, C2H2-type"", ""-"""	13001	protein-coding gene	gene with protein product		314993	"""zinc finger protein 182 (HHZ150)"", ""zinc finger protein 21 (KOX 14)"""	ZNF21		8088786, 2014798, 8914609	Standard	NM_001178099		Approved	KOX14, HHZ150, Zfp182	uc004dit.3	P17025	OTTHUMG00000021460	ENST00000396965.1:c.1689G>A	X.37:g.47835797C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2IDD7|Q3KP67|Q96QH7	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.T563	ENST00000396965.1	37	c.1689	CCDS35236.1	X																																																																																			ZNF182	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF182-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF182	HGNC	protein_coding	OTTHUMT00000277055.1	C	NM_006962		47835797	-1	no_errors	ENST00000305127	ensembl	human	known	70_37	silent	SNP	0.745	T
ZNF512B	57473	genome.wustl.edu	37	20	62595998	62595998	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3QD-01A-32D-A22X-09	TCGA-EA-A3QD-10A-01D-A22X-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	af4a9109-60a7-4fb5-8ea3-b5251f608b3c	1ec975a5-140e-40f6-8797-4b86e5ce058b	g.chr20:62595998G>A	ENST00000450537.1	-	6	1166	c.1106C>T	c.(1105-1107)cCc>cTc	p.P369L	ZNF512B_ENST00000217130.3_Missense_Mutation_p.P369L|ZNF512B_ENST00000369888.1_Missense_Mutation_p.P369L			Q96KM6	Z512B_HUMAN	zinc finger protein 512B	369					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|cervix(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(3)|large_intestine(3)|lung(16)|ovary(1)|prostate(4)|skin(1)	33	all_cancers(38;2.14e-11)|all_epithelial(29;3.41e-13)|Lung NSC(23;3.41e-09)|all_lung(23;1.06e-08)					CATGGAGGAGGGGCCGTACTC	0.672																																																	0													64.0	57.0	60.0					20																	62595998		2203	4300	6503	SO:0001583	missense	57473			AB033022	CCDS13548.1	20q13.33	2011-02-09			ENSG00000196700	ENSG00000196700			29212	protein-coding gene	gene with protein product						10574462	Standard	NM_020713		Approved	GM632, MGC149845, MGC149846	uc002yhl.2	Q96KM6	OTTHUMG00000033008	ENST00000450537.1:c.1106C>T	20.37:g.62595998G>A	ENSP00000393795:p.Pro369Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q08AK9|Q9ULM4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.P369L	ENST00000450537.1	37	c.1106	CCDS13548.1	20	.	.	.	.	.	.	.	.	.	.	G	9.435	1.086454	0.20390	.	.	ENSG00000196700	ENST00000369888;ENST00000450537;ENST00000217130	T;T;T	0.23552	1.9;1.9;1.9	5.55	4.51	0.55191	.	0.545691	0.18918	N	0.127550	T	0.18635	0.0447	L	0.34521	1.04	0.49051	D	0.999745	B	0.06786	0.001	B	0.06405	0.002	T	0.04946	-1.0916	10	0.52906	T	0.07	-3.121	7.9368	0.29935	0.1841:0.0:0.8159:0.0	.	369	Q96KM6	Z512B_HUMAN	L	369	ENSP00000358904:P369L;ENSP00000393795:P369L;ENSP00000217130:P369L	ENSP00000217130:P369L	P	-	2	0	ZNF512B	62066442	0.790000	0.28787	0.289000	0.24876	0.146000	0.21551	2.635000	0.46537	2.608000	0.88229	0.591000	0.81541	CCC	ZNF512B	-	NULL		0.672	ZNF512B-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF512B	HGNC	protein_coding	OTTHUMT00000080246.1	G	NM_020713		62595998	-1	no_errors	ENST00000217130	ensembl	human	known	70_37	missense	SNP	0.747	A
