#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
A4GALT	53947	genome.wustl.edu	37	22	43089412	43089412	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:43089412G>A	ENST00000401850.1	-	2	1035	c.546C>T	c.(544-546)ctC>ctT	p.L182L	A4GALT_ENST00000465765.2_5'Flank|A4GALT_ENST00000249005.2_Silent_p.L182L|A4GALT_ENST00000381278.3_Silent_p.L182L			Q9NPC4	A4GAT_HUMAN	alpha 1,4-galactosyltransferase	182					globoside biosynthetic process (GO:0001576)|glycosphingolipid biosynthetic process (GO:0006688)|plasma membrane organization (GO:0007009)|protein glycosylation (GO:0006486)	extracellular vesicular exosome (GO:0070062)|integral component of Golgi membrane (GO:0030173)|membrane (GO:0016020)	galactosyltransferase activity (GO:0008378)|lactosylceramide 4-alpha-galactosyltransferase activity (GO:0050512)|toxic substance binding (GO:0015643)			NS(1)|central_nervous_system(2)|large_intestine(6)|skin(1)|urinary_tract(1)	11						ACTTCCACATGAGTGCGATCC	0.647																																																	0													63.0	56.0	59.0					22																	43089412		2203	4300	6503	SO:0001819	synonymous_variant	53947				CCDS14041.1	22q13.2	2014-07-18	2008-07-31		ENSG00000128274	ENSG00000128274	2.4.1.228		18149	protein-coding gene	gene with protein product	"""Gb3 synthase"", ""CD77 synthase"", ""globotriaosylceramide synthase"", ""lactosylceramide 4-alpha-galactosyltransferase"""	607922	"""alpha 1,4-galactosyltransferase (globotriaosylceramide synthase, P blood group)"""			10854428	Standard	XM_005261643		Approved	A14GALT, Gb3S, P(k)	uc003bdb.3	Q9NPC4	OTTHUMG00000150744	ENST00000401850.1:c.546C>T	22.37:g.43089412G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7C4|Q9P1X5	Silent	SNP	pfam_A1-4-GlycosylTfrase_dom,pfam_GlycoTrfase_DXD_sugar-bd_CS	p.L182	ENST00000401850.1	37	c.546	CCDS14041.1	22																																																																																			A4GALT	-	pfam_GlycoTrfase_DXD_sugar-bd_CS		0.647	A4GALT-004	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	A4GALT	HGNC	protein_coding	OTTHUMT00000319917.1	G	NM_017436		43089412	-1	no_errors	ENST00000249005	ensembl	human	known	70_37	silent	SNP	0.992	A
ABCA13	154664	genome.wustl.edu	37	7	48450142	48450142	+	Missense_Mutation	SNP	C	C	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr7:48450142C>A	ENST00000435803.1	+	40	12120	c.12096C>A	c.(12094-12096)caC>caA	p.H4032Q		NM_152701.3	NP_689914.2	Q86UQ4	ABCAD_HUMAN	ATP-binding cassette, sub-family A (ABC1), member 13	4032	ABC transporter 1. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	integral component of membrane (GO:0016021)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)	p.H3977Q(1)|p.H4032Q(1)		breast(13)|central_nervous_system(8)|endometrium(25)|haematopoietic_and_lymphoid_tissue(4)|kidney(20)|large_intestine(51)|lung(100)|ovary(5)|pancreas(2)|prostate(22)|skin(10)|stomach(3)|upper_aerodigestive_tract(3)|urinary_tract(4)	270						TCACAACCCACCACCTGGATG	0.607																																																	2	Substitution - Missense(2)	large_intestine(2)											111.0	107.0	108.0					7																	48450142		2066	4219	6285	SO:0001583	missense	154664			AY204751	CCDS47584.1	7p12.3	2012-03-14			ENSG00000179869	ENSG00000179869		"""ATP binding cassette transporters / subfamily A"""	14638	protein-coding gene	gene with protein product		607807				12697998	Standard	NM_152701		Approved	FLJ33876, FLJ33951	uc003toq.2	Q86UQ4	OTTHUMG00000155840	ENST00000435803.1:c.12096C>A	7.37:g.48450142C>A	ENSP00000411096:p.His4032Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	K9LC76|K9LC79|K9LCX7|K9LDK8|K9LDY4|Q6ZTT7|Q86WI2|Q8N248	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.H4032Q	ENST00000435803.1	37	c.12096	CCDS47584.1	7	.	.	.	.	.	.	.	.	.	.	C	16.15	3.041493	0.55003	.	.	ENSG00000179869	ENST00000435803	D	0.99607	-6.27	5.33	1.52	0.23074	ATPase, AAA+ type, core (1);ABC transporter-like (1);	0.000000	0.52532	D	0.000080	D	0.99527	0.9831	M	0.88640	2.97	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.91635	0.999;0.998	D	0.99774	1.1025	10	0.87932	D	0	.	9.1481	0.36946	0.0:0.7018:0.0:0.2982	.	1734;4032	Q86UQ4-3;Q86UQ4	.;ABCAD_HUMAN	Q	4032	ENSP00000411096:H4032Q	ENSP00000411096:H4032Q	H	+	3	2	ABCA13	48420688	1.000000	0.71417	0.995000	0.50966	0.428000	0.31595	1.490000	0.35573	0.337000	0.23665	-0.126000	0.14955	CAC	ABCA13	-	smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.607	ABCA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCA13	HGNC	protein_coding	OTTHUMT00000341964.2	C	NM_152701		48450142	+1	no_errors	ENST00000435803	ensembl	human	known	70_37	missense	SNP	1.000	A
ABCF2	10061	genome.wustl.edu	37	7	150913103	150913103	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr7:150913103C>T	ENST00000287844.2	-	12	1460	c.1351G>A	c.(1351-1353)Gat>Aat	p.D451N	ABCF2_ENST00000222388.2_Missense_Mutation_p.D451N|ABCF2_ENST00000473874.1_5'Flank	NM_007189.1	NP_009120.1	Q9UG63	ABCF2_HUMAN	ATP-binding cassette, sub-family F (GCN20), member 2	451	ABC transporter 2. {ECO:0000255|PROSITE- ProRule:PRU00434}.				transport (GO:0006810)	ATP-binding cassette (ABC) transporter complex (GO:0043190)|membrane (GO:0016020)|mitochondrial envelope (GO:0005740)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|transporter activity (GO:0005215)			breast(1)|central_nervous_system(1)|large_intestine(4)|lung(15)|ovary(1)|skin(2)	24			OV - Ovarian serous cystadenocarcinoma(82;0.00448)	UCEC - Uterine corpus endometrioid carcinoma (81;0.168)		ATCATGCCATCTGTGGGTAGT	0.483																																																	0													110.0	98.0	102.0					7																	150913103		2203	4300	6503	SO:0001583	missense	10061			AJ005016	CCDS5922.1, CCDS5923.1	7q36.1	2012-03-14			ENSG00000033050	ENSG00000033050		"""ATP binding cassette transporters / subfamily F"""	71	protein-coding gene	gene with protein product		612510				8894702	Standard	NM_007189		Approved	EST133090, ABC28, M-ABC1, HUSSY-18	uc003wjo.1	Q9UG63	OTTHUMG00000154570	ENST00000287844.2:c.1351G>A	7.37:g.150913103C>T	ENSP00000287844:p.Asp451Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	O60864|Q75MJ0|Q75MJ1|Q96TE8	Missense_Mutation	SNP	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like	p.D451N	ENST00000287844.2	37	c.1351	CCDS5923.1	7	.	.	.	.	.	.	.	.	.	.	C	13.70	2.314624	0.40996	.	.	ENSG00000033050	ENST00000222388;ENST00000287844	D;D	0.93366	-3.21;-3.21	5.5	3.57	0.40892	ATPase, AAA+ type, core (1);ABC transporter-like (2);	0.000000	0.85682	D	0.000000	D	0.88047	0.6332	N	0.17674	0.51	0.80722	D	1	B;B	0.20459	0.045;0.045	B;B	0.34242	0.178;0.178	T	0.82168	-0.0591	10	0.25751	T	0.34	-25.6209	11.2403	0.48966	0.1432:0.7188:0.138:0.0	.	451;451	Q9UG63;Q75MJ1	ABCF2_HUMAN;.	N	451	ENSP00000222388:D451N;ENSP00000287844:D451N	ENSP00000222388:D451N	D	-	1	0	ABCF2	150544036	1.000000	0.71417	0.979000	0.43373	0.338000	0.28826	5.168000	0.64978	1.288000	0.44600	-0.181000	0.13052	GAT	ABCF2	-	pfam_ABC_transporter-like,smart_AAA+_ATPase,pfscan_ABC_transporter-like		0.483	ABCF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCF2	HGNC	protein_coding	OTTHUMT00000336086.1	C	NM_005692		150913103	-1	no_errors	ENST00000222388	ensembl	human	known	70_37	missense	SNP	1.000	T
ACSM4	341392	genome.wustl.edu	37	12	7476146	7476146	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:7476146C>T	ENST00000399422.4	+	9	1346	c.1298C>T	c.(1297-1299)tCt>tTt	p.S433F		NM_001080454.1	NP_001073923.1	P0C7M7	ACSM4_HUMAN	acyl-CoA synthetase medium-chain family member 4	433					acyl-CoA metabolic process (GO:0006637)|fatty acid metabolic process (GO:0006631)	mitochondrion (GO:0005739)	ATP binding (GO:0005524)|butyrate-CoA ligase activity (GO:0047760)|fatty-acyl-CoA synthase activity (GO:0004321)|metal ion binding (GO:0046872)			endometrium(6)|kidney(1)|lung(14)	21						TGTTTCTTCTCTAAATAtgtg	0.418																																																	0													62.0	59.0	60.0					12																	7476146		1833	4079	5912	SO:0001583	missense	341392				CCDS44825.1	12p13.31	2008-06-12			ENSG00000215009	ENSG00000215009		"""Acyl-CoA synthetase family"""	32016	protein-coding gene	gene with protein product	"""similar to olfactory specific medium-chain acyl CoA synthetase"""	614360				17762044	Standard	NM_001080454		Approved		uc001qsx.1	P0C7M7	OTTHUMG00000154975	ENST00000399422.4:c.1298C>T	12.37:g.7476146C>T	ENSP00000382349:p.Ser433Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MTI6	Missense_Mutation	SNP	pfam_AMP-dep_Synth/Lig	p.S433F	ENST00000399422.4	37	c.1298	CCDS44825.1	12	.	.	.	.	.	.	.	.	.	.	C	17.07	3.294958	0.60086	.	.	ENSG00000215009	ENST00000399422	T	0.46063	0.88	3.6	3.6	0.41247	AMP-dependent synthetase/ligase (1);	0.000000	0.38436	U	0.001682	T	0.54759	0.1878	L	0.52126	1.63	0.36316	D	0.857943	D	0.67145	0.996	D	0.66084	0.941	T	0.65512	-0.6150	10	0.62326	D	0.03	-3.0588	13.1051	0.59244	0.0:1.0:0.0:0.0	.	433	P0C7M7	ACSM4_HUMAN	F	433	ENSP00000382349:S433F	ENSP00000382349:S433F	S	+	2	0	ACSM4	7367413	1.000000	0.71417	1.000000	0.80357	0.906000	0.53458	4.350000	0.59392	2.021000	0.59480	0.557000	0.71058	TCT	ACSM4	-	pfam_AMP-dep_Synth/Lig		0.418	ACSM4-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ACSM4	HGNC	protein_coding	OTTHUMT00000337866.2	C	NM_001080454		7476146	+1	no_errors	ENST00000399422	ensembl	human	novel	70_37	missense	SNP	1.000	T
ADAMTS20	80070	genome.wustl.edu	37	12	43840503	43840503	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:43840503C>T	ENST00000389420.3	-	15	2091	c.2092G>A	c.(2092-2094)Gat>Aat	p.D698N	ADAMTS20_ENST00000553158.1_Missense_Mutation_p.D698N	NM_025003.3	NP_079279.3	P59510	ATS20_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 20	698	Cys-rich.				extracellular matrix organization (GO:0030198)|negative regulation of apoptotic process (GO:0043066)|positive regulation of melanocyte differentiation (GO:0045636)|positive regulation of signal transduction (GO:0009967)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(6)|endometrium(3)|kidney(4)|large_intestine(11)|liver(1)|lung(43)|ovary(4)|pancreas(3)|prostate(5)|skin(12)|upper_aerodigestive_tract(1)|urinary_tract(1)	95	all_cancers(12;2.6e-05)|Lung SC(27;0.184)	Lung NSC(34;0.0569)|all_lung(34;0.129)		GBM - Glioblastoma multiforme(48;0.0473)		AACACGTGATCACAACCAGCT	0.378																																																	0													164.0	139.0	148.0					12																	43840503		2203	4300	6503	SO:0001583	missense	80070			AF488804	CCDS31778.2	12q12	2005-08-19	2005-08-19			ENSG00000173157		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	17178	protein-coding gene	gene with protein product		611681	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 20"""			12514189, 12562771	Standard	NM_025003		Approved	GON-1	uc010skx.2	P59510		ENST00000389420.3:c.2092G>A	12.37:g.43840503C>T	ENSP00000374071:p.Asp698Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNC9|J3QT00	Missense_Mutation	SNP	pfam_Pept_M12B_GON-ADAMTSs,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Pept_M12B_GON-ADAMTSs,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.D698N	ENST00000389420.3	37	c.2092	CCDS31778.2	12	.	.	.	.	.	.	.	.	.	.	C	27.6	4.843255	0.91197	.	.	ENSG00000173157	ENST00000389420;ENST00000553158;ENST00000389417	T;T	0.73575	-0.76;-0.76	5.07	5.07	0.68467	.	0.000000	0.52532	D	0.000062	D	0.89336	0.6686	M	0.91717	3.235	0.80722	D	1	D	0.71674	0.998	D	0.72625	0.978	D	0.91325	0.5085	10	0.87932	D	0	.	19.3353	0.94314	0.0:1.0:0.0:0.0	.	698	P59510	ATS20_HUMAN	N	698	ENSP00000374071:D698N;ENSP00000448341:D698N	ENSP00000374068:D698N	D	-	1	0	ADAMTS20	42126770	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	7.445000	0.80570	2.750000	0.94351	0.563000	0.77884	GAT	ADAMTS20	-	prints_Peptidase_M12B_ADAM-TS		0.378	ADAMTS20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS20	HGNC	protein_coding	OTTHUMT00000403643.1	C	NM_025003		43840503	-1	no_errors	ENST00000389420	ensembl	human	known	70_37	missense	SNP	1.000	T
ADD2	119	genome.wustl.edu	37	2	70918050	70918050	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr2:70918050C>T	ENST00000264436.4	-	8	1161	c.717G>A	c.(715-717)atG>atA	p.M239I	AC007395.3_ENST00000457851.1_RNA|ADD2_ENST00000407644.2_Missense_Mutation_p.M239I|ADD2_ENST00000413157.2_Missense_Mutation_p.M239I|ADD2_ENST00000355733.3_Missense_Mutation_p.M239I|ADD2_ENST00000430656.1_Missense_Mutation_p.M255I	NM_001617.3	NP_001608.1	P35612	ADDB_HUMAN	adducin 2 (beta)	239					actin cytoskeleton organization (GO:0030036)|actin filament bundle assembly (GO:0051017)|barbed-end actin filament capping (GO:0051016)|hemopoiesis (GO:0030097)|positive regulation of protein binding (GO:0032092)|protein complex assembly (GO:0006461)	cytoplasmic membrane-bounded vesicle (GO:0016023)|F-actin capping protein complex (GO:0008290)|plasma membrane (GO:0005886)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|spectrin binding (GO:0030507)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|large_intestine(11)|lung(13)|ovary(3)|pancreas(1)|skin(2)	36						GGCCCCACTTCATGGCCGACA	0.582																																																	0													72.0	61.0	65.0					2																	70918050		2203	4300	6503	SO:0001583	missense	119			X58199	CCDS1906.1, CCDS1909.1, CCDS46318.1, CCDS54365.1	2p13.3	2008-02-05			ENSG00000075340	ENSG00000075340			244	protein-coding gene	gene with protein product		102681				1840603	Standard	NM_001617		Approved	ADDB	uc021vjc.1	P35612	OTTHUMG00000129710	ENST00000264436.4:c.717G>A	2.37:g.70918050C>T	ENSP00000264436:p.Met239Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K4P2|B4DM17|D6W5G7|D6W5G8|Q13482|Q16412|Q59G82|Q5U5P4|Q6P0P2|Q6PGQ4|Q7Z688|Q7Z689|Q7Z690|Q7Z691	Missense_Mutation	SNP	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N	p.M239I	ENST00000264436.4	37	c.717	CCDS1906.1	2	.	.	.	.	.	.	.	.	.	.	C	30	5.051059	0.93740	.	.	ENSG00000075340	ENST00000264436;ENST00000407644;ENST00000456320;ENST00000355733;ENST00000356565;ENST00000413157;ENST00000430656	T;T;T;T;T	0.21031	2.03;2.03;2.03;2.03;2.03	5.13	5.13	0.70059	Class II aldolase/adducin, N-terminal (3);	0.000000	0.85682	D	0.000000	T	0.47135	0.1429	M	0.73598	2.24	0.58432	D	0.999999	P;P;P;D	0.55172	0.877;0.858;0.767;0.97	P;P;P;D	0.68943	0.53;0.535;0.667;0.961	T	0.43750	-0.9372	10	0.87932	D	0	-35.3661	16.4661	0.84079	0.0:1.0:0.0:0.0	.	255;239;239;239	B4DM17;P35612-4;P35612;P35612-3	.;.;ADDB_HUMAN;.	I	239;239;239;239;239;239;255	ENSP00000264436:M239I;ENSP00000384677:M239I;ENSP00000347972:M239I;ENSP00000388072:M239I;ENSP00000398112:M255I	ENSP00000264436:M239I	M	-	3	0	ADD2	70771558	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.517000	0.81783	2.823000	0.97156	0.650000	0.86243	ATG	ADD2	-	pfam_Aldolase_II/adducin_N,superfamily_Aldolase_II/adducin_N		0.582	ADD2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ADD2	HGNC	protein_coding	OTTHUMT00000251918.4	C	NM_001617		70918050	-1	no_errors	ENST00000264436	ensembl	human	known	70_37	missense	SNP	1.000	T
APEX2	27301	genome.wustl.edu	37	X	55026966	55026966	+	Silent	SNP	C	C	T	rs370230204		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:55026966C>T	ENST00000374987.3	+	1	177	c.111C>T	c.(109-111)gaC>gaT	p.D37D	APEX2_ENST00000471758.1_3'UTR|PFKFB1_ENST00000545676.1_5'Flank	NM_014481.2	NP_055296.2	Q9UBZ4	APEX2_HUMAN	APEX nuclease (apurinic/apyrimidinic endonuclease) 2	37					base-excision repair (GO:0006284)|cell cycle (GO:0007049)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA catabolic process, exonucleolytic (GO:0000738)|DNA recombination (GO:0006310)	mitochondrial inner membrane (GO:0005743)|nucleus (GO:0005634)	DNA binding (GO:0003677)|DNA-(apurinic or apyrimidinic site) lyase activity (GO:0003906)|double-stranded DNA 3'-5' exodeoxyribonuclease activity (GO:0008311)|zinc ion binding (GO:0008270)			breast(1)|endometrium(8)|large_intestine(4)|lung(6)|prostate(1)|urinary_tract(1)	21						GCATTTTGGACGAGCTGGATG	0.547								Other BER factors																																									0													86.0	58.0	67.0					X																	55026966		2203	4300	6503	SO:0001819	synonymous_variant	27301			AB021260	CCDS14365.1	Xp11.23	2014-02-18			ENSG00000169188	ENSG00000169188	4.2.99.18		17889	protein-coding gene	gene with protein product	"""zinc finger, GRF-type containing 2"""	300773				11376153	Standard	NM_014481		Approved	APEXL2, APE2, XTH2, ZGRF2	uc004dtz.4	Q9UBZ4	OTTHUMG00000021642	ENST00000374987.3:c.111C>T	X.37:g.55026966C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9Y5X7	Silent	SNP	pfam_Endo/exonuclease/phosphatase,pfam_Znf_GRF,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III	p.D37	ENST00000374987.3	37	c.111	CCDS14365.1	X																																																																																			APEX2	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,tigrfam_ExoDNase_III		0.547	APEX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	APEX2	HGNC	protein_coding	OTTHUMT00000056845.1	C			55026966	+1	no_errors	ENST00000374987	ensembl	human	known	70_37	silent	SNP	0.960	T
AUTS2	26053	genome.wustl.edu	37	7	70255460	70255460	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr7:70255460G>A	ENST00000342771.4	+	19	3579	c.3258G>A	c.(3256-3258)cgG>cgA	p.R1086R	AUTS2_ENST00000406775.2_Silent_p.R1062R	NM_015570.2	NP_056385.1	Q8WXX7	AUTS2_HUMAN	autism susceptibility candidate 2	1086										breast(2)|central_nervous_system(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(14)|ovary(4)|prostate(2)|skin(4)|urinary_tract(1)	50		all_cancers(73;0.0264)|all_epithelial(88;0.0198)|Lung NSC(55;0.0599)|all_lung(88;0.093)		LUSC - Lung squamous cell carcinoma(90;0.082)|Lung(90;0.186)		ACATTCACCGGAGAGACCCGC	0.662																																																	0													19.0	22.0	21.0					7																	70255460		2203	4300	6503	SO:0001819	synonymous_variant	26053			AF326917	CCDS5539.1, CCDS47601.1, CCDS47602.1	7q11.22	2014-01-06			ENSG00000158321	ENSG00000158321			14262	protein-coding gene	gene with protein product		607270				12160723	Standard	XM_005250257		Approved	KIAA0442, FBRSL2	uc003tvw.4	Q8WXX7	OTTHUMG00000023865	ENST00000342771.4:c.3258G>A	7.37:g.70255460G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1Y9|L7QET3|L7QF75|Q5D049|Q6PJU5|Q9Y4F2	Silent	SNP	prints_AUTS2	p.R1086	ENST00000342771.4	37	c.3258	CCDS5539.1	7																																																																																			AUTS2	-	NULL		0.662	AUTS2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AUTS2	HGNC	protein_coding	OTTHUMT00000251971.2	G			70255460	+1	no_errors	ENST00000342771	ensembl	human	known	70_37	silent	SNP	0.999	A
BAI3	577	genome.wustl.edu	37	6	69703686	69703686	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:69703686G>A	ENST00000370598.1	+	11	2582	c.1761G>A	c.(1759-1761)caG>caA	p.Q587Q		NM_001704.2	NP_001695	O60242	BAI3_HUMAN	brain-specific angiogenesis inhibitor 3	587					G-protein coupled receptor signaling pathway (GO:0007186)|negative regulation of angiogenesis (GO:0016525)|neuropeptide signaling pathway (GO:0007218)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			NS(2)|breast(4)|central_nervous_system(5)|endometrium(5)|kidney(2)|large_intestine(28)|liver(1)|lung(111)|ovary(10)|pancreas(4)|prostate(7)|skin(22)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(4)	210		all_lung(197;0.212)				CTAAGGGGCAGCGAATGCTGG	0.418																																																	0													210.0	225.0	220.0					6																	69703686		2203	4300	6503	SO:0001819	synonymous_variant	577			AB005299	CCDS4968.1	6q12	2014-08-08			ENSG00000135298	ENSG00000135298		"""-"", ""GPCR / Class B : Orphans"""	945	protein-coding gene	gene with protein product		602684				9533023	Standard	NM_001704		Approved	KIAA0550	uc003pev.4	O60242	OTTHUMG00000014982	ENST00000370598.1:c.1761G>A	6.37:g.69703686G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z1K0|O60297|Q2NKN6|Q5VY37|Q9BX54	Silent	SNP	pfam_GPCR_2_secretin-like,pfam_DUF3497,pfam_Thrombospondin_1_rpt,pfam_GPS_dom,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,smart_GPCR_2_extracellular_dom,smart_GPS_dom,pfscan_CUB,pfscan_GPS_dom,pfscan_Thrombospondin_1_rpt,pfscan_GPCR_2_extracellular_dom,pfscan_GPCR_2-like,prints_GPCR_2_brain-spec_angio_inhib,prints_GPCR_2_secretin-like	p.Q587	ENST00000370598.1	37	c.1761	CCDS4968.1	6																																																																																			BAI3	-	pfam_DUF3497		0.418	BAI3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	BAI3	HGNC	protein_coding	OTTHUMT00000041120.1	G			69703686	+1	no_errors	ENST00000370598	ensembl	human	known	70_37	silent	SNP	0.989	A
C1orf210	149466	genome.wustl.edu	37	1	43748630	43748630	+	Silent	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:43748630G>C	ENST00000523677.1	-	3	401	c.168C>G	c.(166-168)ctC>ctG	p.L56L	C1orf210_ENST00000423420.1_Silent_p.L56L	NM_001164829.1|NM_182517.2	NP_001158301.1|NP_872323.1	Q8IVY1	CA210_HUMAN	chromosome 1 open reading frame 210	56						integral component of membrane (GO:0016021)				breast(1)	1	Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0333)				ATCGGCGGCAGAGGTGGCATT	0.632																																																	0													52.0	51.0	51.0					1																	43748630		2203	4300	6503	SO:0001819	synonymous_variant	149466			BC041633	CCDS481.1	1p34.2	2006-03-22			ENSG00000253313	ENSG00000253313			28755	protein-coding gene	gene with protein product						12477932	Standard	NM_182517		Approved	MGC52423	uc001cit.4	Q8IVY1	OTTHUMG00000007289	ENST00000523677.1:c.168C>G	1.37:g.43748630G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPX2	Silent	SNP	NULL	p.L56	ENST00000523677.1	37	c.168	CCDS481.1	1																																																																																			C1orf210	-	NULL		0.632	C1orf210-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf210	HGNC	protein_coding	OTTHUMT00000019035.2	G	NM_182517		43748630	-1	no_errors	ENST00000423420	ensembl	human	known	70_37	silent	SNP	1.000	C
C1orf116	79098	genome.wustl.edu	37	1	207196584	207196584	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:207196584C>G	ENST00000359470.5	-	4	774	c.525G>C	c.(523-525)caG>caC	p.Q175H	C1orf116_ENST00000461135.2_5'UTR	NM_023938.5	NP_076427.2	Q9BW04	SARG_HUMAN	chromosome 1 open reading frame 116	175						cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)				autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(3)|lung(10)|ovary(1)|prostate(2)|skin(4)|stomach(1)	29	Prostate(682;0.19)					GTTGGCTGCTCTGGCTGACCT	0.627																																																	0													62.0	67.0	65.0					1																	207196584		2203	4300	6503	SO:0001583	missense	79098				CCDS1475.1, CCDS44306.1	1q32.1	2012-06-26			ENSG00000182795	ENSG00000182795			28667	protein-coding gene	gene with protein product	"""specifically androgen-regulated gene"""	611680				15525603, 9389513	Standard	NM_023938		Approved	SARG, FLJ36507, MGC2742, MGC4309	uc001hfd.2	Q9BW04	OTTHUMG00000036580	ENST00000359470.5:c.525G>C	1.37:g.207196584C>G	ENSP00000352447:p.Gln175His	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JV41|Q658X3	Missense_Mutation	SNP	NULL	p.Q175H	ENST00000359470.5	37	c.525	CCDS1475.1	1	.	.	.	.	.	.	.	.	.	.	C	14.33	2.502177	0.44455	.	.	ENSG00000182795	ENST00000359470	T	0.09255	3.0	4.95	1.4	0.22301	.	1.111270	0.06911	N	0.807716	T	0.21227	0.0511	L	0.54323	1.7	0.09310	N	0.999991	D	0.63046	0.992	P	0.57720	0.826	T	0.17715	-1.0360	10	0.48119	T	0.1	-2.7775	6.4221	0.21750	0.0:0.6253:0.0:0.3747	.	175	Q9BW04	SARG_HUMAN	H	175	ENSP00000352447:Q175H	ENSP00000352447:Q175H	Q	-	3	2	C1orf116	205263207	0.000000	0.05858	0.004000	0.12327	0.003000	0.03518	0.251000	0.18257	0.344000	0.23847	0.655000	0.94253	CAG	C1orf116	-	NULL		0.627	C1orf116-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C1orf116	HGNC	protein_coding	OTTHUMT00000088973.1	C	NM_024115		207196584	-1	no_errors	ENST00000359470	ensembl	human	known	70_37	missense	SNP	0.001	G
B3GALT5	10317	genome.wustl.edu	37	21	40971332	40971332	+	Intron	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr21:40971332C>T	ENST00000380620.4	+	2	69				C21orf88_ENST00000489821.1_5'UTR|C21orf88_ENST00000380612.4_Intron			Q9Y2C3	B3GT5_HUMAN	UDP-Gal:betaGlcNAc beta 1,3-galactosyltransferase, polypeptide 5						protein glycosylation (GO:0006486)	endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	UDP-galactose:beta-N-acetylglucosamine beta-1,3-galactosyltransferase activity (GO:0008499)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(5)|prostate(1)|skin(4)|stomach(1)|urinary_tract(1)	16		Prostate(19;2.55e-06)				ACTTTAATCTCTGTGACCAAG	0.547																																																	0																																										SO:0001627	intron_variant	114041			AB020337	CCDS13667.1, CCDS74795.1	21q22.3	2013-02-19			ENSG00000183778	ENSG00000183778		"""Beta 3-glycosyltransferases"""	920	protein-coding gene	gene with protein product	"""homolog of C. elegans Bt toxin resistance gene bre-5"", ""GlcNAc-beta-1,3-galactosyltransferase 5"""	604066				10212226	Standard	NM_006057		Approved	beta3Gal-T5, B3GalT-V, GLCT5, B3T5	uc002yyj.1	Q9Y2C3	OTTHUMG00000086725	ENST00000380620.4:c.-523-5689C>T	21.37:g.40971332C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA86|D3DSI3|Q2M3L5|Q53Z19|Q9NY96|Q9P1X6|Q9P1X7	RNA	SNP	-	NULL	ENST00000380620.4	37	NULL	CCDS13667.1	21																																																																																			C21orf88	-	-		0.547	B3GALT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C21orf88	HGNC	protein_coding	OTTHUMT00000195008.2	C	NM_033170		40971332	-1	no_errors	ENST00000489821	ensembl	human	known	70_37	rna	SNP	0.051	T
C5AR1	728	genome.wustl.edu	37	19	47823991	47823991	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr19:47823991C>T	ENST00000355085.3	+	2	979	c.957C>T	c.(955-957)ctC>ctT	p.L319L		NM_001736.3	NP_001727.1	P21730	C5AR1_HUMAN	complement component 5a receptor 1	319					activation of MAPK activity (GO:0000187)|activation of phospholipase C activity (GO:0007202)|apoptotic process (GO:0006915)|cell proliferation in hindbrain (GO:0021534)|cellular defense response (GO:0006968)|chemotaxis (GO:0006935)|complement component C5a signaling pathway (GO:0038178)|defense response to Gram-positive bacterium (GO:0050830)|immune response (GO:0006955)|inflammatory response (GO:0006954)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of neuron apoptotic process (GO:0043524)|neutrophil chemotaxis (GO:0030593)|organ regeneration (GO:0031100)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|response to lipopolysaccharide (GO:0032496)|response to peptidoglycan (GO:0032494)|sensory perception of chemical stimulus (GO:0007606)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|basolateral plasma membrane (GO:0016323)|cell surface (GO:0009986)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	C5a anaphylatoxin receptor activity (GO:0004944)|complement component C5a receptor activity (GO:0004878)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(11)|ovary(2)|prostate(1)|skin(1)	20		all_cancers(25;2e-09)|all_epithelial(76;9.95e-08)|all_lung(116;7.27e-07)|Lung NSC(112;1.6e-06)|Ovarian(192;0.0139)|all_neural(266;0.026)|Breast(70;0.0503)		all cancers(93;0.000267)|OV - Ovarian serous cystadenocarcinoma(262;0.000618)|Epithelial(262;0.0142)|GBM - Glioblastoma multiforme(486;0.0242)		CCAGCCTCCTCCGGAACGTGT	0.592																																																	0													76.0	74.0	74.0					19																	47823991		2203	4300	6503	SO:0001819	synonymous_variant	728				CCDS33063.1	19q13.3-q13.4	2012-08-10	2006-02-09	2006-02-09		ENSG00000197405		"""CD molecules"", ""Complement system"", ""GPCR / Class A : Complement component receptors"""	1338	protein-coding gene	gene with protein product		113995	"""complement component 5 receptor 1 (C5a ligand)"""	C5R1		1612600	Standard	NM_001736		Approved	C5A, C5AR, CD88	uc002pgj.1	P21730		ENST00000355085.3:c.957C>T	19.37:g.47823991C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_C5A_anaphtx_rcpt,prints_GPCR_Rhodpsn,prints_Anphylx_rcpt,prints_Brdyknn_rcpt,prints_Frt_met_rcpt	p.L319	ENST00000355085.3	37	c.957	CCDS33063.1	19																																																																																			C5AR1	-	NULL		0.592	C5AR1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	C5AR1	HGNC	protein_coding	OTTHUMT00000466925.1	C	NM_001736		47823991	+1	no_errors	ENST00000355085	ensembl	human	known	70_37	silent	SNP	0.002	T
TBC1D32	221322	genome.wustl.edu	37	6	121631950	121631950	+	Missense_Mutation	SNP	T	T	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:121631950T>C	ENST00000398212.2	-	4	588	c.539A>G	c.(538-540)cAg>cGg	p.Q180R	TBC1D32_ENST00000275159.6_Missense_Mutation_p.Q180R	NM_152730.4	NP_689943.4	Q96NH3	BROMI_HUMAN	TBC1 domain family, member 32	180					cilium morphogenesis (GO:0060271)|embryonic digit morphogenesis (GO:0042733)|lens development in camera-type eye (GO:0002088)|protein localization to cilium (GO:0061512)|retinal pigment epithelium development (GO:0003406)|smoothened signaling pathway involved in dorsal/ventral neural tube patterning (GO:0060831)	cilium (GO:0005929)|cytoplasm (GO:0005737)	Rab GTPase activator activity (GO:0005097)										aggatccaactggtctaaaat	0.328																																																	0													55.0	52.0	53.0					6																	121631950		1814	4076	5890	SO:0001583	missense	221322			AK055461	CCDS43501.1	6q22.31	2014-02-20	2013-07-10	2013-07-10	ENSG00000146350	ENSG00000146350			21485	protein-coding gene	gene with protein product	"""broad-minded homolog"""	615867	"""chromosome 6 open reading frame 171"", ""chromosome 6 open reading frame 170"""	C6orf171, C6orf170		20159594, 24285566	Standard	NM_152730		Approved	FLJ30899, dJ310J6.1, FLJ34235, bA57L9.1, BROMI	uc003pyo.1	Q96NH3	OTTHUMG00000015474	ENST00000398212.2:c.539A>G	6.37:g.121631950T>C	ENSP00000381270:p.Gln180Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SZD6|Q5SZM6|Q6ZMY4|Q6ZUR7|Q8NB47	Missense_Mutation	SNP	superfamily_Rab-GTPase-TBC_dom	p.Q180R	ENST00000398212.2	37	c.539	CCDS43501.1	6	.	.	.	.	.	.	.	.	.	.	T	11.89	1.772818	0.31411	.	.	ENSG00000146350	ENST00000275159;ENST00000398212;ENST00000422369	T;T;T	0.17528	2.27;2.27;2.27	4.96	3.82	0.43975	.	0.304208	0.33753	N	0.004588	T	0.03564	0.0102	L	0.35723	1.085	0.28851	N	0.896038	B	0.12013	0.005	B	0.06405	0.002	T	0.38757	-0.9646	10	0.10636	T	0.68	-9.686	6.6074	0.22734	0.0:0.1033:0.0:0.8967	.	180	Q96NH3	BROMI_HUMAN	R	180	ENSP00000275159:Q180R;ENSP00000381270:Q180R;ENSP00000397993:Q180R	ENSP00000275159:Q180R	Q	-	2	0	C6orf170	121673649	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	2.006000	0.40874	2.167000	0.68274	0.482000	0.46254	CAG	C6orf170	-	NULL		0.328	TBC1D32-005	PUTATIVE	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	C6orf170	HGNC	protein_coding	OTTHUMT00000380937.2	T	NM_152730		121631950	-1	no_errors	ENST00000275159	ensembl	human	putative	70_37	missense	SNP	1.000	C
C9orf47	286223	genome.wustl.edu	37	9	91606129	91606129	+	Silent	SNP	G	G	A	rs542361091		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr9:91606129G>A	ENST00000334490.5	+	1	287	c.219G>A	c.(217-219)ccG>ccA	p.P73P	S1PR3_ENST00000358157.2_5'Flank|C9orf47_ENST00000375851.2_Intron|C9orf47_ENST00000375850.3_Intron			Q6ZRZ4	CI047_HUMAN	chromosome 9 open reading frame 47	73						extracellular region (GO:0005576)				endometrium(1)|large_intestine(1)|liver(1)|lung(1)	4						AACAGGGGCCGAAGGGCGAGC	0.706													g|||	1	0.000199681	0.0	0.0	5008	,	,		6922	0.0		0.0	False		,,,				2504	0.001																0													5.0	7.0	7.0					9																	91606129		2101	4152	6253	SO:0001819	synonymous_variant	286223			AK094842	CCDS35062.1, CCDS47989.1	9q22.1	2008-02-05	2004-11-04		ENSG00000186354	ENSG00000186354			23669	protein-coding gene	gene with protein product			"""chromosome 9 open reading frame 108"""	C9orf108			Standard	NM_001001938		Approved	FLJ37523, bA791O21.3	uc004aqc.2	Q6ZRZ4	OTTHUMG00000020172	ENST00000334490.5:c.219G>A	9.37:g.91606129G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZMC7|Q5SQD7|Q7Z568|Q8N1V4	Silent	SNP	NULL	p.P73	ENST00000334490.5	37	c.219	CCDS35062.1	9																																																																																			C9orf47	-	NULL		0.706	C9orf47-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	C9orf47	HGNC	protein_coding	OTTHUMT00000355972.1	G	NM_182599		91606129	+1	no_errors	ENST00000334490	ensembl	human	known	70_37	silent	SNP	0.000	A
CACNA1C	775	genome.wustl.edu	37	12	2716295	2716295	+	Splice_Site	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:2716295G>C	ENST00000347598.4	+	27	3415	c.3415G>C	c.(3415-3417)Gag>Cag	p.E1139Q	CACNA1C-AS3_ENST00000543559.1_RNA|CACNA1C_ENST00000399644.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399597.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399595.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000480911.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399638.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399655.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399621.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000327702.7_Splice_Site_p.E1119Q|CACNA1C_ENST00000399606.1_Splice_Site_p.E1139Q|CACNA1C_ENST00000399629.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399649.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399603.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000406454.3_Splice_Site_p.E1119Q|CACNA1C_ENST00000399641.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399591.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399634.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000399601.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000344100.3_Splice_Site_p.E1119Q|CACNA1C_ENST00000399637.1_Splice_Site_p.E1119Q|CACNA1C_ENST00000402845.3_Splice_Site_p.E1119Q|CACNA1C_ENST00000335762.5_Splice_Site_p.E1144Q|CACNA1C_ENST00000399617.1_Splice_Site_p.E1119Q	NM_001129827.1|NM_199460.2	NP_001123299.1|NP_955630.2	Q13936	CAC1C_HUMAN	calcium channel, voltage-dependent, L type, alpha 1C subunit	1139	Dihydropyridine binding. {ECO:0000250}.				adult walking behavior (GO:0007628)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|calcium ion transport into cytosol (GO:0060402)|calcium ion-dependent exocytosis (GO:0017156)|calcium-mediated signaling using extracellular calcium source (GO:0035585)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|energy reserve metabolic process (GO:0006112)|glucose homeostasis (GO:0042593)|growth hormone secretion (GO:0030252)|insulin secretion (GO:0030073)|membrane depolarization during action potential (GO:0086010)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of blood pressure (GO:0008217)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of insulin secretion (GO:0050796)|regulation of organ growth (GO:0046620)|regulation of vasoconstriction (GO:0019229)|small molecule metabolic process (GO:0044281)|smooth muscle contraction involved in micturition (GO:0060083)|synaptic transmission (GO:0007268)|visual learning (GO:0008542)	caveolar macromolecular signaling complex (GO:0002095)|cytoplasm (GO:0005737)|dendritic shaft (GO:0043198)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|voltage-gated calcium channel complex (GO:0005891)|Z disc (GO:0030018)	alpha-actinin binding (GO:0051393)|calmodulin binding (GO:0005516)|high voltage-gated calcium channel activity (GO:0008331)|metal ion binding (GO:0046872)|voltage-gated calcium channel activity (GO:0005245)			NS(3)|breast(4)|central_nervous_system(4)|cervix(2)|endometrium(12)|kidney(9)|large_intestine(20)|lung(55)|ovary(10)|pancreas(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(4)	132			OV - Ovarian serous cystadenocarcinoma(31;0.00256)	LUAD - Lung adenocarcinoma(1;0.134)	Amlodipine(DB00381)|Cinnarizine(DB00568)|Clevidipine(DB04920)|Dronedarone(DB04855)|Drotaverine(DB06751)|Felodipine(DB01023)|Ibutilide(DB00308)|Isradipine(DB00270)|Magnesium Sulfate(DB00653)|Nicardipine(DB00622)|Nifedipine(DB01115)|Nilvadipine(DB06712)|Nimodipine(DB00393)|Nisoldipine(DB00401)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Verapamil(DB00661)	AGGGTGGCCAGAGTGAGTATG	0.552																																																	0													35.0	37.0	36.0					12																	2716295		2170	4292	6462	SO:0001630	splice_region_variant	775			AF070589	CCDS44787.1, CCDS44788.1, CCDS44789.1, CCDS44790.1, CCDS44791.1, CCDS44792.1, CCDS44793.1, CCDS44794.1, CCDS44795.1, CCDS44796.1, CCDS44797.1, CCDS44798.1, CCDS44799.1, CCDS44800.1, CCDS44801.1, CCDS53733.1, CCDS53734.1, CCDS53735.1, CCDS53736.1	12p13.3	2014-09-17			ENSG00000151067	ENSG00000151067		"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1390	protein-coding gene	gene with protein product		114205		CCHL1A1, CACNL1A1		1650913, 16382099	Standard	NM_001129832		Approved	Cav1.2, CACH2, CACN2, TS, LQT8	uc001qjy.3	Q13936	OTTHUMG00000150243	ENST00000347598.4:c.3416+1G>C	12.37:g.2716295G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUT3|E9PDJ0|Q13917|Q13918|Q13919|Q13920|Q13921|Q13922|Q13923|Q13924|Q13925|Q13926|Q13927|Q13928|Q13929|Q13930|Q13932|Q13933|Q14743|Q14744|Q15877|Q4VMI7|Q4VMI8|Q4VMI9|Q6PKM7|Q8N6C0|Q99025|Q99241|Q99875	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_VDCC_a1su_IQ,pfam_PKD1_2_channel,prints_VDCC_L_a1csu,prints_VDCCAlpha1,prints_VDCC_L_a1su	p.E1119Q	ENST00000347598.4	37	c.3355	CCDS44788.1	12	.	.	.	.	.	.	.	.	.	.	G	14.35	2.510027	0.44660	.	.	ENSG00000151067	ENST00000335762;ENST00000399655;ENST00000480911;ENST00000399644;ENST00000399638;ENST00000399597;ENST00000399621;ENST00000399637;ENST00000399591;ENST00000399641;ENST00000347598;ENST00000399606;ENST00000399601;ENST00000344100;ENST00000399629;ENST00000327702;ENST00000399649;ENST00000402845;ENST00000399603;ENST00000399634;ENST00000399617;ENST00000406454;ENST00000399595;ENST00000322367	D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D;D	0.97553	-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43;-4.43	4.87	4.87	0.63330	Ion transport (1);	0.104188	0.64402	D	0.000003	D	0.96134	0.8740	N	0.13003	0.285	0.43007	D	0.994539	D;D;B;D;D;D;P;B;B;D;P;B;P;D;D;P;B;D;B;P;D;D;B;P;D	0.71674	0.998;0.982;0.233;0.997;0.969;0.982;0.944;0.08;0.004;0.969;0.952;0.391;0.944;0.961;0.988;0.952;0.057;0.969;0.08;0.952;0.969;0.969;0.242;0.701;0.962	D;P;B;D;P;P;P;B;B;P;P;B;P;P;D;P;B;P;B;P;P;P;B;B;P	0.79784	0.993;0.641;0.06;0.993;0.79;0.79;0.833;0.036;0.037;0.79;0.542;0.32;0.833;0.672;0.957;0.636;0.022;0.718;0.036;0.636;0.79;0.718;0.033;0.445;0.708	D	0.93995	0.7270	10	0.14252	T	0.57	.	18.5538	0.91075	0.0:0.0:1.0:0.0	.	1119;1116;1139;1119;1119;1119;1119;1119;1119;1139;1119;1090;1139;1119;1119;1119;1119;1119;1119;1119;1119;1119;1119;1119;1119	Q13936-14;Q13936-35;Q13936;Q13936-33;Q13936-13;Q13936-22;Q13936-32;Q13936-31;Q13936-21;Q13936-30;Q13936-23;Q13936-28;Q13936-11;E9PDJ1;E9PDJ0;F5GY28;Q13936-25;Q13936-15;Q13936-29;Q13936-19;Q13936-24;Q13936-27;Q13936-20;F5H638;Q13936-12	.;.;CAC1C_HUMAN;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.;.	Q	1144;1119;1119;1119;1119;1119;1119;1119;1119;1119;1139;1139;1119;1119;1119;1119;1119;1119;1119;1119;1119;1119;1119;960	ENSP00000336982:E1144Q;ENSP00000382563:E1119Q;ENSP00000437936:E1119Q;ENSP00000382552:E1119Q;ENSP00000382547:E1119Q;ENSP00000382506:E1119Q;ENSP00000382530:E1119Q;ENSP00000382546:E1119Q;ENSP00000382500:E1119Q;ENSP00000382549:E1119Q;ENSP00000266376:E1139Q;ENSP00000382515:E1139Q;ENSP00000382510:E1119Q;ENSP00000341092:E1119Q;ENSP00000382537:E1119Q;ENSP00000329877:E1119Q;ENSP00000382557:E1119Q;ENSP00000385724:E1119Q;ENSP00000382512:E1119Q;ENSP00000382542:E1119Q;ENSP00000382526:E1119Q;ENSP00000385896:E1119Q;ENSP00000382504:E1119Q	ENSP00000323129:E960Q	E	+	1	0	CACNA1C	2586556	1.000000	0.71417	1.000000	0.80357	0.949000	0.60115	6.122000	0.71608	2.691000	0.91804	0.655000	0.94253	GAG	CACNA1C	-	pfam_Ion_trans_dom		0.552	CACNA1C-017	KNOWN	non_canonical_conserved|basic|appris_candidate_longest|CCDS	protein_coding	CACNA1C	HGNC	protein_coding	OTTHUMT00000317035.1	G	NM_000719	Missense_Mutation	2716295	+1	no_errors	ENST00000399634	ensembl	human	known	70_37	missense	SNP	1.000	C
CACNA1H	8912	genome.wustl.edu	37	16	1260464	1260464	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr16:1260464G>C	ENST00000348261.5	+	19	4188	c.3940G>C	c.(3940-3942)Gag>Cag	p.E1314Q	CACNA1H_ENST00000358590.4_Missense_Mutation_p.E1314Q|CACNA1H_ENST00000565831.1_Missense_Mutation_p.E1314Q	NM_021098.2	NP_066921.2	O95180	CAC1H_HUMAN	calcium channel, voltage-dependent, T type, alpha 1H subunit	1314					aldosterone biosynthetic process (GO:0032342)|axon guidance (GO:0007411)|calcium ion import (GO:0070509)|cellular response to hormone stimulus (GO:0032870)|cellular response to potassium ion (GO:0035865)|cortisol biosynthetic process (GO:0034651)|membrane depolarization during action potential (GO:0086010)|muscle contraction (GO:0006936)|muscle organ development (GO:0007517)|myoblast fusion (GO:0007520)|positive regulation of acrosome reaction (GO:2000344)|regulation of heart contraction (GO:0008016)|regulation of membrane potential (GO:0042391)|transport (GO:0006810)	caveola (GO:0005901)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|voltage-gated calcium channel complex (GO:0005891)	low voltage-gated calcium channel activity (GO:0008332)|metal ion binding (GO:0046872)|scaffold protein binding (GO:0097110)			breast(4)|endometrium(5)|kidney(2)|lung(23)	34		Hepatocellular(780;0.00369)			Amiodarone(DB01118)|Bepridil(DB01244)|Cinnarizine(DB00568)|Felodipine(DB01023)|Flunarizine(DB04841)|Isradipine(DB00270)|Nifedipine(DB01115)|Nitrendipine(DB01054)|Spironolactone(DB00421)|Zonisamide(DB00909)	CATCGCCCTGGAGAGGCCTGA	0.622																																																	0													39.0	42.0	41.0					16																	1260464		2177	4272	6449	SO:0001583	missense	8912			AL031703	CCDS45375.1, CCDS45376.1	16p13.3	2012-03-07	2007-02-16					"""Calcium channel subunits"", ""Voltage-gated ion channels / Calcium channels"""	1395	protein-coding gene	gene with protein product		607904				9670923, 16382099	Standard	NM_021098		Approved	Cav3.2	uc002cks.3	O95180		ENST00000348261.5:c.3940G>C	16.37:g.1260464G>C	ENSP00000334198:p.Glu1314Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5ME00|F8WFD1|O95802|Q8WWI6|Q96QI6|Q96RZ9|Q9NYY4|Q9NYY5	Missense_Mutation	SNP	pfam_Ion_trans_dom,pfam_PKD1_2_channel,prints_VDCC_T_a1su,prints_PKD_2	p.E1314Q	ENST00000348261.5	37	c.3940	CCDS45375.1	16	.	.	.	.	.	.	.	.	.	.	G	26.1	4.700793	0.88924	.	.	ENSG00000196557	ENST00000348261;ENST00000358590	D;D	0.97831	-4.56;-4.56	3.77	3.77	0.43336	.	0.000000	0.85682	D	0.000000	D	0.98896	0.9626	M	0.92923	3.36	0.50813	D	0.999896	D;D;D;D;D	0.89917	0.981;0.999;1.0;0.987;0.997	D;D;D;P;D	0.80764	0.954;0.989;0.994;0.882;0.982	D	0.99360	1.0917	10	0.87932	D	0	.	15.0975	0.72247	0.0:0.0:1.0:0.0	.	55;55;55;1314;1314	A2SX38;A2SX35;A2SX37;O95180-2;O95180	.;.;.;.;CAC1H_HUMAN	Q	1314	ENSP00000334198:E1314Q;ENSP00000351401:E1314Q	ENSP00000334198:E1314Q	E	+	1	0	CACNA1H	1200465	1.000000	0.71417	1.000000	0.80357	0.928000	0.56348	7.569000	0.82380	2.098000	0.63641	0.543000	0.68304	GAG	CACNA1H	-	NULL		0.622	CACNA1H-001	KNOWN	basic|CCDS	protein_coding	CACNA1H	HGNC	protein_coding	OTTHUMT00000421601.1	G	NM_001005407		1260464	+1	no_errors	ENST00000348261	ensembl	human	known	70_37	missense	SNP	1.000	C
CAPRIN1	4076	genome.wustl.edu	37	11	34101277	34101277	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:34101277C>G	ENST00000341394.4	+	7	980	c.791C>G	c.(790-792)tCa>tGa	p.S264*	CAPRIN1_ENST00000389645.3_Nonsense_Mutation_p.S264*|CAPRIN1_ENST00000532820.1_Nonsense_Mutation_p.S264*|CAPRIN1_ENST00000530820.1_Nonsense_Mutation_p.S264*|CAPRIN1_ENST00000529307.1_Nonsense_Mutation_p.S183*	NM_005898.4	NP_005889.3	Q14444	CAPR1_HUMAN	cell cycle associated protein 1	264					negative regulation of translation (GO:0017148)|positive regulation of dendrite morphogenesis (GO:0050775)|positive regulation of dendritic spine morphogenesis (GO:0061003)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic mRNA processing body (GO:0000932)|cytoplasmic stress granule (GO:0010494)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)	p.S264L(2)		breast(2)|endometrium(2)|kidney(1)|large_intestine(6)|lung(5)|ovary(1)|prostate(1)	18		Acute lymphoblastic leukemia(5;0.00045)|all_hematologic(20;0.0016)				GAGGCAGCCTCAGCACCTGCA	0.428																																																	2	Substitution - Missense(2)	lung(2)											91.0	82.0	85.0					11																	34101277		2202	4298	6500	SO:0001587	stop_gained	4076			BC001731	CCDS31453.1, CCDS31454.1	11p13	2010-08-03	2007-03-27	2007-03-27	ENSG00000135387	ENSG00000135387			6743	protein-coding gene	gene with protein product	"""cytoplasmic activation/proliferation-associated protein-1"""	601178	"""membrane component, chromosome 11, surface marker 1"", ""GPI-anchored membrane protein 1"""	M11S1, GPIAP1		7657653, 16177067, 17210633, 14764709, 15471883	Standard	NM_005898		Approved	caprin-1, RNG105	uc001mvh.1	Q14444	OTTHUMG00000166248	ENST00000341394.4:c.791C>G	11.37:g.34101277C>G	ENSP00000340329:p.Ser264*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NMY7|D3DR06|Q15074|Q6IMN4|Q6IMN7|Q9BV09	Nonsense_Mutation	SNP	pfam_Caprin-1_C	p.S264*	ENST00000341394.4	37	c.791	CCDS31453.1	11	.	.	.	.	.	.	.	.	.	.	C	20.8	4.051530	0.75960	.	.	ENSG00000135387	ENST00000341394;ENST00000389645;ENST00000532820;ENST00000530820;ENST00000529307	.	.	.	5.66	4.75	0.60458	.	0.567395	0.18763	N	0.131823	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.36615	T	0.2	-6.0354	14.9068	0.70727	0.0:0.9313:0.0:0.0687	.	.	.	.	X	264;264;264;264;183	.	ENSP00000340329:S264X	S	+	2	0	CAPRIN1	34057853	0.981000	0.34729	0.977000	0.42913	0.031000	0.12232	3.198000	0.51035	1.537000	0.49254	-0.154000	0.13518	TCA	CAPRIN1	-	NULL		0.428	CAPRIN1-001	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	CAPRIN1	HGNC	protein_coding	OTTHUMT00000388680.2	C	NM_005898		34101277	+1	no_errors	ENST00000341394	ensembl	human	known	70_37	nonsense	SNP	0.993	G
CD99L2	83692	genome.wustl.edu	37	X	149963742	149963742	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:149963742C>T	ENST00000370377.3	-	6	484	c.367G>A	c.(367-369)Gat>Aat	p.D123N	CD99L2_ENST00000355149.3_Missense_Mutation_p.D51N|CD99L2_ENST00000437787.2_Intron|CD99L2_ENST00000346693.4_5'UTR|CD99L2_ENST00000466436.1_Missense_Mutation_p.D74N	NM_001242614.1|NM_031462.3	NP_001229543.1|NP_113650.2	Q8TCZ2	C99L2_HUMAN	CD99 molecule-like 2	123					cell adhesion (GO:0007155)	focal adhesion (GO:0005925)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				endometrium(4)|large_intestine(4)|lung(10)|ovary(3)|skin(1)|urinary_tract(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					TCCAGGGCATCAGCCAAGTCA	0.453																																																	0													141.0	141.0	141.0					X																	149963742		2203	4300	6503	SO:0001583	missense	83692			BC030536	CCDS14697.1, CCDS14698.1, CCDS35427.1, CCDS55527.1, CCDS76044.1	Xq28	2007-12-04	2006-03-28	2003-02-14	ENSG00000102181	ENSG00000102181			18237	protein-coding gene	gene with protein product		300846	"""MIC2 like 1"", ""CD99 antigen-like 2"""	MIC2L1			Standard	NM_001184808		Approved	CD99B	uc004fek.3	Q8TCZ2	OTTHUMG00000024247	ENST00000370377.3:c.367G>A	X.37:g.149963742C>T	ENSP00000359403:p.Asp123Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2D5|A8K5R0|B3KWG2|B4DDL7|E7EMK5|E9PD27|Q8TAW2|Q8TCZ0|Q8TCZ1|Q9BQG9	Missense_Mutation	SNP	pfam_CD99L2	p.D123N	ENST00000370377.3	37	c.367	CCDS35427.1	X	.	.	.	.	.	.	.	.	.	.	C	15.89	2.967788	0.53507	.	.	ENSG00000102181	ENST00000370377;ENST00000438086;ENST00000355149;ENST00000466436;ENST00000418547	T;T;T;T	0.37584	1.19;1.19;1.19;1.19	3.67	3.67	0.42095	.	0.000000	0.85682	D	0.000000	T	0.62429	0.2427	M	0.87456	2.885	0.80722	D	1	D;D;D	0.89917	1.0;0.996;0.977	D;D;P	0.87578	0.998;0.993;0.856	T	0.68735	-0.5330	9	.	.	.	-29.9133	12.1698	0.54152	0.0:1.0:0.0:0.0	.	51;74;123	Q8TCZ2-3;Q8TCZ2-2;Q8TCZ2	.;.;C99L2_HUMAN	N	123;127;51;74;86	ENSP00000359403:D123N;ENSP00000347275:D51N;ENSP00000417697:D74N;ENSP00000391821:D86N	.	D	-	1	0	CD99L2	149714400	0.998000	0.40836	0.919000	0.36401	0.934000	0.57294	3.338000	0.52128	2.087000	0.62958	0.513000	0.50165	GAT	CD99L2	-	pfam_CD99L2		0.453	CD99L2-001	KNOWN	basic|CCDS	protein_coding	CD99L2	HGNC	protein_coding	OTTHUMT00000061199.1	C	NM_031462		149963742	-1	no_errors	ENST00000370377	ensembl	human	known	70_37	missense	SNP	0.990	T
CELF3	11189	genome.wustl.edu	37	1	151681738	151681738	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:151681738C>T	ENST00000290583.4	-	4	1157	c.364G>A	c.(364-366)Gac>Aac	p.D122N	CELF3_ENST00000290585.4_Missense_Mutation_p.D122N|AL589765.1_ENST00000442233.2_5'Flank|CELF3_ENST00000392706.3_5'Flank|RIIAD1_ENST00000326413.3_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	122	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						GTGCACTCGTCGATGGTCCCG	0.622																																																	0													193.0	183.0	187.0					1																	151681738		2203	4300	6503	SO:0001583	missense	11189			U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.364G>A	1.37:g.151681738C>T	ENSP00000290583:p.Asp122Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.D122N	ENST00000290583.4	37	c.364	CCDS1002.1	1	.	.	.	.	.	.	.	.	.	.	.	20.7	4.041095	0.75732	.	.	ENSG00000159409	ENST00000290585;ENST00000290583;ENST00000368833	D;D	0.85484	-1.99;-1.99	4.39	4.39	0.52855	Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	0.111737	0.64402	D	0.000018	T	0.80639	0.4661	N	0.16708	0.43	0.80722	D	1	D;P;D;D;D	0.62365	0.959;0.939;0.991;0.971;0.964	P;P;P;P;B	0.60236	0.787;0.564;0.871;0.548;0.412	D	0.85196	0.1012	10	0.87932	D	0	-10.8007	14.4846	0.67609	0.0:1.0:0.0:0.0	.	122;122;121;122;121	Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3	.;.;.;CELF3_HUMAN;.	N	122;122;121	ENSP00000290585:D122N;ENSP00000290583:D122N	ENSP00000290583:D122N	D	-	1	0	CELF3	149948362	1.000000	0.71417	1.000000	0.80357	0.731000	0.41821	7.272000	0.78516	2.265000	0.75225	0.462000	0.41574	GAC	CELF3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.622	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF3	HGNC	protein_coding	OTTHUMT00000036663.2	C	NM_007185		151681738	-1	no_errors	ENST00000290583	ensembl	human	known	70_37	missense	SNP	1.000	T
CELF3	11189	genome.wustl.edu	37	1	151681743	151681743	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:151681743G>T	ENST00000290583.4	-	4	1152	c.359C>A	c.(358-360)aCc>aAc	p.T120N	CELF3_ENST00000290585.4_Missense_Mutation_p.T120N|AL589765.1_ENST00000442233.2_5'Flank|CELF3_ENST00000392706.3_5'Flank|RIIAD1_ENST00000326413.3_5'Flank|RP11-98D18.1_ENST00000457548.1_RNA|CELF3_ENST00000470688.1_5'UTR	NM_001172648.1|NM_007185.4	NP_001166119.1|NP_009116.3	Q5SZQ8	CELF3_HUMAN	CUGBP, Elav-like family member 3	120	RRM 2. {ECO:0000255|PROSITE- ProRule:PRU00176}.				mRNA splicing, via spliceosome (GO:0000398)|positive regulation of mRNA splicing, via spliceosome (GO:0048026)|regulation of alternative mRNA splicing, via spliceosome (GO:0000381)|RNA splicing (GO:0008380)|sperm motility (GO:0030317)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	mRNA binding (GO:0003729)|nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)	21						CTCGTCGATGGTCCCGAAGGG	0.617																																																	0													204.0	193.0	197.0					1																	151681743		2203	4300	6503	SO:0001583	missense	11189			U80759	CCDS1002.1, CCDS53367.1	1q21	2013-02-12	2010-02-19	2010-02-19	ENSG00000159409	ENSG00000159409		"""Trinucleotide (CAG) repeat containing"", ""RNA binding motif (RRM) containing"""	11967	protein-coding gene	gene with protein product	"""expanded repeat domain, CAG/CTG 4"", ""CAG repeat domain"", ""CUG-BP and ETR-3 like factor 3"""	612678	"""trinucleotide repeat containing 4"""	TNRC4		9225980	Standard	XM_005244859		Approved	CAGH4, BRUNOL1, ERDA4, MGC57297	uc001eys.2	Q5SZQ8	OTTHUMG00000013064	ENST00000290583.4:c.359C>A	1.37:g.151681743G>T	ENSP00000290583:p.Thr120Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKK6|O15414|Q499Y6|Q5SZQ7|Q6NVK0|Q8IZ98|Q9BZC2|Q9HB30	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.T120N	ENST00000290583.4	37	c.359	CCDS1002.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	5.844|5.844	0.339856|0.339856	0.11069|0.11069	.|.	.|.	ENSG00000159409|ENSG00000159409	ENST00000420342|ENST00000290585;ENST00000290583;ENST00000368833	.|D;D	.|0.87256	.|-2.23;-2.23	4.39|4.39	4.39|4.39	0.52855|0.52855	.|Nucleotide-binding, alpha-beta plait (1);RNA recognition motif domain (3);	.|0.164157	.|0.52532	.|D	.|0.000070	T|T	0.64735|0.64735	0.2625|0.2625	N|N	0.26092|0.26092	0.79|0.79	0.80722|0.80722	D|D	1|1	.|B;B;B;B;B	.|0.09022	.|0.001;0.001;0.002;0.002;0.002	.|B;B;B;B;B	.|0.15052	.|0.012;0.001;0.002;0.002;0.004	T|T	0.61128|0.61128	-0.7125|-0.7125	5|10	.|0.15066	.|T	.|0.55	-29.6454|-29.6454	9.6726|9.6726	0.40021|0.40021	0.0:0.0:0.7926:0.2074|0.0:0.0:0.7926:0.2074	.|.	.|120;120;119;120;119	.|Q5SZQ7;Q5SZQ8-2;F8W6B7;Q5SZQ8;Q5SZQ8-3	.|.;.;.;CELF3_HUMAN;.	T|N	121|120;120;119	.|ENSP00000290585:T120N;ENSP00000290583:T120N	.|ENSP00000290583:T120N	P|T	-|-	1|2	0|0	CELF3|CELF3	149948367|149948367	0.646000|0.646000	0.27295|0.27295	1.000000|1.000000	0.80357|0.80357	0.646000|0.646000	0.38490|0.38490	0.260000|0.260000	0.18424|0.18424	2.265000|2.265000	0.75225|0.75225	0.462000|0.462000	0.41574|0.41574	CCA|ACC	CELF3	-	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom		0.617	CELF3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CELF3	HGNC	protein_coding	OTTHUMT00000036663.2	G	NM_007185		151681743	-1	no_errors	ENST00000290583	ensembl	human	known	70_37	missense	SNP	1.000	T
CEP57L1	285753	genome.wustl.edu	37	6	109471422	109471422	+	Missense_Mutation	SNP	A	A	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:109471422A>C	ENST00000517392.1	+	4	868	c.442A>C	c.(442-444)Aac>Cac	p.N148H	CEP57L1_ENST00000359793.3_Missense_Mutation_p.N148H|CEP57L1_ENST00000407272.1_Missense_Mutation_p.N148H|CEP57L1_ENST00000521522.1_Missense_Mutation_p.N148H|CEP57L1_ENST00000520883.1_Missense_Mutation_p.N72H|CEP57L1_ENST00000523787.1_Missense_Mutation_p.N151H|CEP57L1_ENST00000336977.4_Missense_Mutation_p.N72H|CEP57L1_ENST00000519095.1_Missense_Mutation_p.N148H|CEP57L1_ENST00000521277.1_Missense_Mutation_p.N132H|CEP57L1_ENST00000368968.2_Missense_Mutation_p.N148H|CEP57L1_ENST00000368970.2_Missense_Mutation_p.N148H	NM_001271852.1|NM_001271853.1	NP_001258781.1|NP_001258782.1	Q8IYX8	CE57L_HUMAN	centrosomal protein 57kDa-like 1	148					microtubule anchoring (GO:0034453)	cytoplasm (GO:0005737)|microtubule (GO:0005874)				endometrium(1)|kidney(1)|large_intestine(1)|lung(7)|ovary(1)	11						GCGAGAAAAGAACATGATCCT	0.323																																																	0													98.0	100.0	99.0					6																	109471422		2203	4300	6503	SO:0001583	missense	285753			AK092723	CCDS5071.1, CCDS64491.1	6q21	2014-01-28	2010-09-30	2010-09-30	ENSG00000183137	ENSG00000183137			21561	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 182"""	C6orf182			Standard	NM_001083535		Approved	bA487F23.2, MGC21731	uc003psy.4	Q8IYX8	OTTHUMG00000015336	ENST00000517392.1:c.442A>C	6.37:g.109471422A>C	ENSP00000427844:p.Asn148His	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E992	Missense_Mutation	SNP	pfam_Cep57_MT-bd_dom	p.N148H	ENST00000517392.1	37	c.442	CCDS5071.1	6	.	.	.	.	.	.	.	.	.	.	A	18.52	3.642101	0.67244	.	.	ENSG00000183137	ENST00000521277;ENST00000517392;ENST00000407272;ENST00000336977;ENST00000540778;ENST00000519286;ENST00000518853;ENST00000521522;ENST00000524064;ENST00000519407;ENST00000519095;ENST00000368968;ENST00000522490;ENST00000523209;ENST00000368970;ENST00000520883;ENST00000523787;ENST00000359793	T;T;T;T;T;T;T;T;D;T;T;T;D;T;T;T;T	0.82984	0.92;-1.16;-1.16;0.92;0.92;-1.16;0.92;0.92;-1.67;-1.16;-1.16;0.92;-1.67;-1.16;0.92;-1.16;-1.16	5.35	5.35	0.76521	.	0.537042	0.23219	N	0.050586	D	0.82912	0.5140	L	0.50333	1.59	0.21579	N	0.99963	D;P;P;P	0.56521	0.976;0.915;0.915;0.915	P;P;P;P	0.60068	0.868;0.792;0.83;0.83	T	0.78612	-0.2136	10	0.72032	D	0.01	-3.7252	14.9822	0.71319	1.0:0.0:0.0:0.0	.	148;148;148;132	Q8IYX8;G5E992;Q6P2R3;E5RJH1	CE57L_HUMAN;.;.;.	H	132;148;148;72;148;148;148;148;148;10;148;148;10;10;148;72;151;148	ENSP00000430558:N132H;ENSP00000427844:N148H;ENSP00000383936:N148H;ENSP00000337392:N72H;ENSP00000429812:N148H;ENSP00000430265:N148H;ENSP00000428344:N148H;ENSP00000427771:N148H;ENSP00000430565:N10H;ENSP00000430911:N148H;ENSP00000357964:N148H;ENSP00000429957:N10H;ENSP00000430013:N10H;ENSP00000357966:N148H;ENSP00000430011:N72H;ENSP00000430529:N151H;ENSP00000352841:N148H	ENSP00000337392:N72H	N	+	1	0	CEP57L1	109578115	1.000000	0.71417	1.000000	0.80357	0.988000	0.76386	3.612000	0.54142	2.028000	0.59812	0.379000	0.24179	AAC	CEP57L1	-	pfam_Cep57_MT-bd_dom		0.323	CEP57L1-001	KNOWN	basic|CCDS	protein_coding	CEP57L1	HGNC	protein_coding	OTTHUMT00000041734.4	A	NM_173830		109471422	+1	no_errors	ENST00000359793	ensembl	human	known	70_37	missense	SNP	0.951	C
CIR1	9541	genome.wustl.edu	37	2	175213653	175213653	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr2:175213653C>T	ENST00000342016.3	-	10	1017	c.925G>A	c.(925-927)Gag>Aag	p.E309K	CIR1_ENST00000362053.5_3'UTR	NM_004882.3	NP_004873.3	Q86X95	CIR1_HUMAN	corepressor interacting with RBPJ, 1	309	Lys/Ser-rich.				mRNA processing (GO:0006397)|negative regulation of transcription, DNA-templated (GO:0045892)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|RNA splicing (GO:0008380)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(3)|large_intestine(5)|lung(5)|skin(1)	15						TTGTCCTTCTCTTCAGAATCA	0.373																																																	0													170.0	172.0	171.0					2																	175213653		2203	4300	6503	SO:0001583	missense	9541			AF098297	CCDS2256.1	2q31.1	2009-07-14			ENSG00000138433	ENSG00000138433			24217	protein-coding gene	gene with protein product	"""recepin"", ""CBF1 interacting corepressor"""	605228				15652350, 11222720, 9874765	Standard	NM_004882		Approved	CIR	uc002uim.3	Q86X95	OTTHUMG00000132338	ENST00000342016.3:c.925G>A	2.37:g.175213653C>T	ENSP00000339723:p.Glu309Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NFI6|A8K8M4|O95367|Q12804|Q4G1B9|Q6PJI4|Q8IWI2	Missense_Mutation	SNP	pfam_CIR_N_dom,superfamily_Znf_CCHC	p.E309K	ENST00000342016.3	37	c.925	CCDS2256.1	2	.	.	.	.	.	.	.	.	.	.	C	19.61	3.859078	0.71834	.	.	ENSG00000138433	ENST00000342016	.	.	.	6.16	6.16	0.99307	.	0.598976	0.16949	N	0.192986	T	0.45074	0.1324	L	0.47716	1.5	0.32176	N	0.580978	P;P	0.47106	0.89;0.651	B;B	0.43413	0.419;0.154	T	0.46442	-0.9191	9	0.07813	T	0.8	.	18.648	0.91418	0.0:1.0:0.0:0.0	.	309;309	A0PJI7;Q86X95	.;CIR1_HUMAN	K	309	.	ENSP00000339723:E309K	E	-	1	0	CIR1	174921899	1.000000	0.71417	0.795000	0.32087	0.765000	0.43378	3.985000	0.56930	2.937000	0.99478	0.650000	0.86243	GAG	CIR1	-	NULL		0.373	CIR1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIR1	HGNC	protein_coding	OTTHUMT00000255460.1	C	NM_004882		175213653	-1	no_errors	ENST00000342016	ensembl	human	known	70_37	missense	SNP	0.997	T
CLCA2	9635	genome.wustl.edu	37	1	86904663	86904663	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:86904663G>A	ENST00000370565.4	+	7	1239	c.1077G>A	c.(1075-1077)gaG>gaA	p.E359E		NM_006536.5	NP_006527.1	Q9UQC9	CLCA2_HUMAN	chloride channel accessory 2	359	VWFA. {ECO:0000255|PROSITE- ProRule:PRU00219}.				cell adhesion (GO:0007155)|transport (GO:0006810)	cell junction (GO:0030054)|extracellular region (GO:0005576)|integral component of plasma membrane (GO:0005887)	chloride channel activity (GO:0005254)|ligand-gated ion channel activity (GO:0015276)			NS(2)|breast(1)|endometrium(1)|kidney(3)|large_intestine(9)|lung(18)|ovary(2)|pancreas(1)|prostate(1)|skin(3)|stomach(1)	42		Lung NSC(277;0.238)		all cancers(265;0.0233)|Epithelial(280;0.0452)		GCAAAGGAGAGATCAGAGCCC	0.423																																					Melanoma(157;1000 1898 5363 5664 48018)|Ovarian(88;135 1366 2838 28875 34642)												0													138.0	120.0	126.0					1																	86904663		2203	4300	6503	SO:0001819	synonymous_variant	9635				CCDS708.1	1p22.3	2012-02-26	2009-01-29		ENSG00000137975	ENSG00000137975			2016	protein-coding gene	gene with protein product		604003	"""chloride channel, calcium activated, family member 2"", ""chloride channel regulator 2"""				Standard	NM_006536		Approved	CLCRG2	uc001dlr.4	Q9UQC9	OTTHUMG00000010256	ENST00000370565.4:c.1077G>A	1.37:g.86904663G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K2T3|Q9Y6N2	Silent	SNP	pfam_Cl_channel_Ca,pfam_DUF1973,pfam_VWF_A,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot	p.E359	ENST00000370565.4	37	c.1077	CCDS708.1	1																																																																																			CLCA2	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A,tigrfam_CaCC_prot		0.423	CLCA2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLCA2	HGNC	protein_coding	OTTHUMT00000028284.1	G	NM_006536		86904663	+1	no_errors	ENST00000370565	ensembl	human	known	70_37	silent	SNP	0.001	A
CLEC4D	338339	genome.wustl.edu	37	12	8672931	8672931	+	Missense_Mutation	SNP	G	G	A	rs201112913	byFrequency	TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:8672931G>A	ENST00000299665.2	+	5	687	c.494G>A	c.(493-495)cGc>cAc	p.R165H		NM_080387.4	NP_525126.2	Q8WXI8	CLC4D_HUMAN	C-type lectin domain family 4, member D	165	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				innate immune response (GO:0045087)	integral component of membrane (GO:0016021)	carbohydrate binding (GO:0030246)	p.R165H(1)		large_intestine(4)|lung(6)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	14	Lung SC(5;0.184)					TTTAACCCACGCAGAGTGTAA	0.418																																																	1	Substitution - Missense(1)	urinary_tract(1)						G	HIS/ARG	0,4406		0,0,2203	79.0	80.0	80.0		494	-0.9	0.0	12		80	3,8595	3.0+/-9.4	0,3,4296	no	missense	CLEC4D	NM_080387.4	29	0,3,6499	AA,AG,GG		0.0349,0.0,0.0231	benign	165/216	8672931	3,13001	2203	4299	6502	SO:0001583	missense	338339			AF411850	CCDS8593.1	12p13.31	2005-09-21	2005-02-09	2005-02-11		ENSG00000166527		"""C-type lectin domain containing"""	14554	protein-coding gene	gene with protein product		609964	"""C-type (calcium dependent, carbohydrate-recognition domain) lectin, superfamily member 8"""	CLECSF8			Standard	NM_080387		Approved	Mpcl	uc001qun.3	Q8WXI8		ENST00000299665.2:c.494G>A	12.37:g.8672931G>A	ENSP00000299665:p.Arg165His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N5J5	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin,prints_AntifreezeII	p.R165H	ENST00000299665.2	37	c.494	CCDS8593.1	12	.	.	.	.	.	.	.	.	.	.	G	0.709	-0.787974	0.02884	0.0	3.49E-4	ENSG00000166527	ENST00000299665	T	0.17370	2.28	4.67	-0.857	0.10693	C-type lectin fold (1);C-type lectin-like (1);C-type lectin (3);	.	.	.	.	T	0.05593	0.0147	N	0.03209	-0.39	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.42582	-0.9443	8	.	.	.	.	3.9592	0.09403	0.4108:0.3734:0.2158:0.0	.	165	Q8WXI8	CLC4D_HUMAN	H	165	ENSP00000299665:R165H	.	R	+	2	0	CLEC4D	8564198	0.000000	0.05858	0.000000	0.03702	0.034000	0.12701	-0.620000	0.05565	0.039000	0.15632	-0.323000	0.08544	CGC	CLEC4D	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.418	CLEC4D-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLEC4D	HGNC	protein_coding	OTTHUMT00000400565.1	G	NM_080387		8672931	+1	no_errors	ENST00000299665	ensembl	human	known	70_37	missense	SNP	0.000	A
CLPTM1L	81037	genome.wustl.edu	37	5	1344504	1344504	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr5:1344504C>G	ENST00000320895.5	-	2	482	c.225G>C	c.(223-225)ttG>ttC	p.L75F	CLPTM1L_ENST00000507807.1_5'Flank|CLPTM1L_ENST00000320927.6_Missense_Mutation_p.L75F	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	75					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		CTTCCACATTCAAGACCAGGT	0.502																																																	0													97.0	86.0	90.0					5																	1344504		2203	4299	6502	SO:0001583	missense	81037			AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.225G>C	5.37:g.1344504C>G	ENSP00000313854:p.Leu75Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	pfam_CLPTM1	p.L75F	ENST00000320895.5	37	c.225	CCDS3862.1	5	.	.	.	.	.	.	.	.	.	.	C	3.905	-0.021333	0.07634	.	.	ENSG00000049656	ENST00000320895;ENST00000320927	T;T	0.46819	0.88;0.86	4.76	2.94	0.34122	.	0.167395	0.38164	N	0.001783	T	0.31765	0.0807	L	0.36672	1.1	0.43088	D	0.994751	B	0.23128	0.08	B	0.19946	0.027	T	0.06770	-1.0808	10	0.10902	T	0.67	-23.9541	9.1035	0.36683	0.0:0.762:0.0:0.238	.	75	Q96KA5	CLP1L_HUMAN	F	75	ENSP00000313854:L75F;ENSP00000315196:L75F	ENSP00000313854:L75F	L	-	3	2	CLPTM1L	1397504	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	1.206000	0.32321	0.981000	0.38548	0.650000	0.86243	TTG	CLPTM1L	-	pfam_CLPTM1		0.502	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1L	HGNC	protein_coding	OTTHUMT00000253649.2	C	NM_030782		1344504	-1	no_errors	ENST00000320895	ensembl	human	known	70_37	missense	SNP	1.000	G
CLPTM1L	81037	genome.wustl.edu	37	5	1344527	1344527	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr5:1344527C>T	ENST00000320895.5	-	2	459	c.202G>A	c.(202-204)Gag>Aag	p.E68K	CLPTM1L_ENST00000507807.1_5'Flank|CLPTM1L_ENST00000320927.6_Missense_Mutation_p.E68K	NM_030782.3	NP_110409.2	Q96KA5	CLP1L_HUMAN	CLPTM1-like	68					apoptotic process (GO:0006915)	integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	24	Lung NSC(6;5.78e-14)|all_lung(6;4.47e-13)|all_epithelial(6;4.47e-09)		Epithelial(17;0.00931)|OV - Ovarian serous cystadenocarcinoma(19;0.0116)|all cancers(22;0.0181)	KIRC - Kidney renal clear cell carcinoma(5;0.177)|Kidney(13;0.208)		ATGTTGTTCTCAGCACCCAGG	0.542																																																	0													95.0	84.0	88.0					5																	1344527		2203	4299	6502	SO:0001583	missense	81037			AK027306	CCDS3862.1	5p15.33	2008-02-05			ENSG00000049656	ENSG00000049656			24308	protein-coding gene	gene with protein product	"""cisplatin resistance related protein"""	612585				11162647	Standard	NM_030782		Approved	FLJ14400, CRR9	uc003jch.3	Q96KA5	OTTHUMG00000131015	ENST00000320895.5:c.202G>A	5.37:g.1344527C>T	ENSP00000313854:p.Glu68Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTC1|Q658W6|Q7LG29|Q96AZ0|Q9H3N4	Missense_Mutation	SNP	pfam_CLPTM1	p.E68K	ENST00000320895.5	37	c.202	CCDS3862.1	5	.	.	.	.	.	.	.	.	.	.	C	15.57	2.873046	0.51695	.	.	ENSG00000049656	ENST00000320895;ENST00000320927	T;T	0.43688	0.96;0.94	4.76	4.76	0.60689	.	0.169753	0.50627	D	0.000109	T	0.33904	0.0879	L	0.36672	1.1	0.80722	D	1	B	0.26902	0.163	B	0.20384	0.029	T	0.10451	-1.0629	10	0.19147	T	0.46	-41.9525	17.7744	0.88503	0.0:1.0:0.0:0.0	.	68	Q96KA5	CLP1L_HUMAN	K	68	ENSP00000313854:E68K;ENSP00000315196:E68K	ENSP00000313854:E68K	E	-	1	0	CLPTM1L	1397527	0.999000	0.42202	0.872000	0.34217	0.005000	0.04900	4.468000	0.60162	2.186000	0.69663	0.650000	0.86243	GAG	CLPTM1L	-	pfam_CLPTM1		0.542	CLPTM1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CLPTM1L	HGNC	protein_coding	OTTHUMT00000253649.2	C	NM_030782		1344527	-1	no_errors	ENST00000320895	ensembl	human	known	70_37	missense	SNP	1.000	T
COL6A1	1291	genome.wustl.edu	37	21	47406452	47406452	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr21:47406452G>A	ENST00000361866.3	+	4	555	c.441G>A	c.(439-441)ctG>ctA	p.L147L		NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	147	N-terminal globular domain.|VWFA 1. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		GCTCCCACCTGAAGGAGAATA	0.637																																																	0													28.0	28.0	28.0					21																	47406452		2177	4274	6451	SO:0001819	synonymous_variant	1291			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.441G>A	21.37:g.47406452G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.L147	ENST00000361866.3	37	c.441	CCDS13727.1	21																																																																																			COL6A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.637	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	G	NM_001848		47406452	+1	no_errors	ENST00000361866	ensembl	human	known	70_37	silent	SNP	0.374	A
COL6A4P1	344875	genome.wustl.edu	37	3	15219174	15219174	+	RNA	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:15219174C>T	ENST00000446690.2	-	0	769					NR_027927.1				collagen, type VI, alpha 4 pseudogene 1																		CGAGATTGCTCAGACCAGAGA	0.493																																																	0																																												344875			AB299979		3p25.1	2013-01-16	2010-05-24	2010-05-24	ENSG00000230524	ENSG00000230524		"""Collagens"""	33484	pseudogene	pseudogene	"""von Willebrand factor A domain containing 6"", ""collagen, type VI, alpha 4"", ""collagen, type VI, alpha 4, pseudogene"""	612397	"""dual von Willebrand factor A domains"""	DVWA		19507504, 19486942	Standard	NR_027927		Approved	VWA6, DIVA, COL6A4, COL6A4P	uc011avo.1		OTTHUMG00000154983		3.37:g.15219174C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000446690.2	37	NULL		3																																																																																			COL6A4P1	-	-		0.493	COL6A4P1-002	KNOWN	basic	processed_transcript	COL6A4P1	HGNC	pseudogene	OTTHUMT00000337912.1	C	NR_027927		15219174	-1	no_errors	ENST00000446690	ensembl	human	known	70_37	rna	SNP	0.754	T
COL6A4P1	344875	genome.wustl.edu	37	3	15219329	15219329	+	RNA	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:15219329C>T	ENST00000446690.2	-	0	614					NR_027927.1				collagen, type VI, alpha 4 pseudogene 1																		ACATGGTCCTCAACTGGCCCA	0.552																																																	0																																												344875			AB299979		3p25.1	2013-01-16	2010-05-24	2010-05-24	ENSG00000230524	ENSG00000230524		"""Collagens"""	33484	pseudogene	pseudogene	"""von Willebrand factor A domain containing 6"", ""collagen, type VI, alpha 4"", ""collagen, type VI, alpha 4, pseudogene"""	612397	"""dual von Willebrand factor A domains"""	DVWA		19507504, 19486942	Standard	NR_027927		Approved	VWA6, DIVA, COL6A4, COL6A4P	uc011avo.1		OTTHUMG00000154983		3.37:g.15219329C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000446690.2	37	NULL		3																																																																																			COL6A4P1	-	-		0.552	COL6A4P1-002	KNOWN	basic	processed_transcript	COL6A4P1	HGNC	pseudogene	OTTHUMT00000337912.1	C	NR_027927		15219329	-1	no_errors	ENST00000446690	ensembl	human	known	70_37	rna	SNP	0.222	T
COX5B	1329	genome.wustl.edu	37	2	98262630	98262630	+	Silent	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr2:98262630G>C	ENST00000258424.2	+	1	128	c.81G>C	c.(79-81)gcG>gcC	p.A27A	COX5B_ENST00000464949.1_3'UTR	NM_001862.2	NP_001853.2	P10606	COX5B_HUMAN	cytochrome c oxidase subunit Vb	27					cellular metabolic process (GO:0044237)|hydrogen ion transmembrane transport (GO:1902600)|respiratory electron transport chain (GO:0022904)|respiratory gaseous exchange (GO:0007585)|small molecule metabolic process (GO:0044281)	extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrion (GO:0005739)	cytochrome-c oxidase activity (GO:0004129)|metal ion binding (GO:0046872)			endometrium(1)|lung(1)|urinary_tract(1)	3						GCGCGGCCGCGATGCGCTCCA	0.706																																																	0													7.0	7.0	7.0					2																	98262630		2120	4134	6254	SO:0001819	synonymous_variant	1329			BC006229	CCDS2032.1	2q11.2	2011-07-04			ENSG00000135940	ENSG00000135940	1.9.3.1	"""Mitochondrial respiratory chain complex / Complex IV"""	2269	protein-coding gene	gene with protein product		123866					Standard	NM_001862		Approved		uc002sya.3	P10606	OTTHUMG00000130548	ENST00000258424.2:c.81G>C	2.37:g.98262630G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53YB7|Q96J18|Q99610	Silent	SNP	pfam_Cyt_c_oxidase_su5b	p.A27	ENST00000258424.2	37	c.81	CCDS2032.1	2																																																																																			COX5B	-	NULL		0.706	COX5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COX5B	HGNC	protein_coding	OTTHUMT00000252972.2	G	NM_001862		98262630	+1	no_errors	ENST00000258424	ensembl	human	known	70_37	silent	SNP	0.001	C
CRYZ	1429	genome.wustl.edu	37	1	75172972	75172973	+	Intron	DEL	AT	AT	-	rs111874404|rs111254735	byFrequency	TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	AT	AT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:75172972_75172973delAT	ENST00000340866.5	-	7	718				CRYZ_ENST00000417775.1_Intron|CRYZ_ENST00000492102.1_5'UTR|CRYZ_ENST00000370871.3_Intron|CRYZ_ENST00000370872.3_Intron	NM_001889.3	NP_001880.2	Q08257	QOR_HUMAN	crystallin, zeta (quinone reductase)						protein homotetramerization (GO:0051289)|visual perception (GO:0007601)|xenobiotic catabolic process (GO:0042178)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|intracellular membrane-bounded organelle (GO:0043231)	mRNA 3'-UTR binding (GO:0003730)|NADPH binding (GO:0070402)|NADPH:quinone reductase activity (GO:0003960)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|kidney(1)|large_intestine(2)|lung(5)	10					Dicoumarol(DB00266)	TATTATAGAAATATGTTTCAAA	0.257														80	0.0159744	0.0068	0.0303	5008	,	,		15880	0.0		0.0417	False		,,,				2504	0.0082																0																																										SO:0001627	intron_variant	1429				CCDS665.1, CCDS44162.1, CCDS44163.1	1p31.1	2013-02-14			ENSG00000116791	ENSG00000116791			2419	protein-coding gene	gene with protein product		123691					Standard	NM_001889		Approved		uc001dgj.3	Q08257	OTTHUMG00000009620	ENST00000340866.5:c.631-84AT>-	1.37:g.75172974_75172975delAT		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NN60|D3DQ76|Q53FT0|Q59EU7|Q5HYE7|Q6NSK9	RNA	DEL	-	NULL	ENST00000340866.5	37	NULL	CCDS665.1	1																																																																																			CRYZ	-	-		0.257	CRYZ-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRYZ	HGNC	protein_coding	OTTHUMT00000026514.1	AT			75172973	-1	no_errors	ENST00000492102	ensembl	human	known	70_37	rna	DEL	0.003:0.001	-
CSMD2	114784	genome.wustl.edu	37	1	34102038	34102038	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:34102038C>G	ENST00000373380.1	-	9	1730	c.1510G>C	c.(1510-1512)Gag>Cag	p.E504Q	CSMD2_ENST00000373388.2_5'UTR|CSMD2_ENST00000373381.4_Missense_Mutation_p.E1631Q			Q7Z408	CSMD2_HUMAN	CUB and Sushi multiple domains 2	1591	CUB 3. {ECO:0000255|PROSITE- ProRule:PRU00059}.					integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				NS(5)|breast(5)|central_nervous_system(3)|cervix(2)|endometrium(20)|haematopoietic_and_lymphoid_tissue(4)|kidney(9)|large_intestine(43)|lung(114)|ovary(8)|pancreas(1)|prostate(6)|skin(20)|upper_aerodigestive_tract(5)|urinary_tract(1)	246		Myeloproliferative disorder(586;0.0294)|all_neural(195;0.249)				GAGGTGCCCTCAACTTCGTAG	0.622																																																	0													61.0	53.0	55.0					1																	34102038		2203	4300	6503	SO:0001583	missense	114784			AY210418	CCDS380.1, CCDS60082.1	1p34.3	2014-01-28			ENSG00000121904	ENSG00000121904			19290	protein-coding gene	gene with protein product		608398				11472063, 11572484	Standard	NM_001281956		Approved	KIAA1884	uc001bxn.1	Q7Z408	OTTHUMG00000011135	ENST00000373380.1:c.1510G>C	1.37:g.34102038C>G	ENSP00000362478:p.Glu504Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AM50|E7EUA6|Q53TY4|Q5VT59|Q8N963|Q96Q03|Q9H4V7|Q9H4V8|Q9H4V9|Q9H4W0|Q9H4W1|Q9H4W2|Q9H4W3|Q9H4W4|Q9HCY5|Q9HCY6|Q9HCY7	Missense_Mutation	SNP	pfam_CUB,pfam_Sushi_SCR_CCP,superfamily_CUB,superfamily_Complement_control_module,smart_CUB,smart_Sushi_SCR_CCP,pfscan_CUB,pfscan_Sushi_SCR_CCP	p.E1631Q	ENST00000373380.1	37	c.4891		1	.	.	.	.	.	.	.	.	.	.	C	7.123	0.578334	0.13686	.	.	ENSG00000121904	ENST00000373381;ENST00000373380	T;T	0.63255	-0.03;-0.03	5.68	3.77	0.43336	Complement control module (2);Sushi/SCR/CCP (3);	0.057741	0.64402	N	0.000002	T	0.39572	0.1083	N	0.04746	-0.17	0.80722	D	1	B;B;B	0.15141	0.002;0.012;0.012	B;B;B	0.19666	0.026;0.014;0.014	T	0.13899	-1.0492	10	0.10902	T	0.67	.	15.1268	0.72489	0.0:0.5942:0.4058:0.0	.	504;1591;1631	Q7Z408-2;Q7Z408;E7EUA6	.;CSMD2_HUMAN;.	Q	1631;504	ENSP00000362479:E1631Q;ENSP00000362478:E504Q	ENSP00000241312:E1591Q	E	-	1	0	CSMD2	33874625	0.994000	0.37717	0.645000	0.29479	0.423000	0.31445	3.145000	0.50623	0.729000	0.32403	0.313000	0.20887	GAG	CSMD2	-	pfam_Sushi_SCR_CCP,superfamily_Complement_control_module,smart_Sushi_SCR_CCP,pfscan_Sushi_SCR_CCP		0.622	CSMD2-002	KNOWN	basic	protein_coding	CSMD2	HGNC	protein_coding	OTTHUMT00000030635.4	C	NM_052896		34102038	-1	no_errors	ENST00000373381	ensembl	human	known	70_37	missense	SNP	0.926	G
DHRSX	207063	genome.wustl.edu	37	X	2184871	2184871	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:2184871G>A	ENST00000334651.5	-	5	558	c.506C>T	c.(505-507)tCt>tTt	p.S169F	DHRSX_ENST00000464935.1_5'UTR	NM_145177.2	NP_660160.2	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	169							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)	16		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				AGGGGACCCAGACTCTTTCAG	0.552													.|||	2	0.000399361	0.0015	0.0	5008	,	,		20933	0.0		0.0	False		,,,				2504	0.0																0													388.0	346.0	361.0					X																	2184871		2203	4296	6499	SO:0001583	missense	207063			AJ293620	CCDS35195.1	Xp22.33 and Yp11.2	2014-05-07	2003-09-12		ENSG00000169084	ENSG00000169084		"""Pseudoautosomal regions / PAR1"""	18399	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 6"", ""short chain dehydrogenase/reductase family 46C, member 1"", ""dehydrogenase/reductase (SDR family) Y-linked"""		"""dehydrogenase/reductase (SDR family) X chromosome"""			11731500, 19027726	Standard	NM_145177		Approved	DHRS5X, DHRSXY, DHRSY, DHRS5Y, SDR46C1, SDR7C6	uc004cqf.4	Q8N5I4	OTTHUMG00000021068	ENST00000334651.5:c.506C>T	X.37:g.2184871G>A	ENSP00000334113:p.Ser169Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UWC7|Q8WUS4|Q96GR8|Q9NTF6	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.S169F	ENST00000334651.5	37	c.506	CCDS35195.1	X	.	.	.	.	.	.	.	.	.	.	G	12.74	2.029821	0.35797	.	.	ENSG00000169084	ENST00000334651;ENST00000412516;ENST00000444280	T;D;D	0.86297	-1.29;-1.62;-2.1	2.11	2.11	0.27256	NAD(P)-binding domain (1);	0.182059	0.37809	U	0.001937	D	0.94453	0.8215	H	0.94658	3.565	0.25747	N	0.98509	D	0.89917	1.0	D	0.77557	0.99	D	0.87974	0.2738	10	0.87932	D	0	.	12.2461	0.54571	0.0:0.0:1.0:0.0	.	169	Q8N5I4	DHRSX_HUMAN	F	169;146;102	ENSP00000334113:S169F;ENSP00000391778:S146F;ENSP00000402741:S102F	ENSP00000334113:S169F	S	-	2	0	DHRSX	2194871	0.993000	0.37304	0.001000	0.08648	0.188000	0.23474	6.534000	0.73833	0.856000	0.35383	0.272000	0.19324	TCT	DHRSX	-	pfam_DH_sc/Rdtase_SDR,pfam_Epimerase_deHydtase		0.552	DHRSX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRSX	HGNC	protein_coding	OTTHUMT00000055617.3	G	NM_145177		2184871	-1	no_errors	ENST00000334651	ensembl	human	known	70_37	missense	SNP	0.991	A
CT47B1	643311	genome.wustl.edu	37	X	120008813	120008813	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:120008813C>T	ENST00000371311.3	-	1	966	c.712G>A	c.(712-714)Gag>Aag	p.E238K		NM_001145718.1	NP_001139190.1	P0C2W7	CT47B_HUMAN	cancer/testis antigen family 47, member B1	238								p.K235_E243delKLTEEATEE(1)		breast(1)|central_nervous_system(1)|endometrium(7)|kidney(2)|lung(9)|ovary(1)|skin(1)	22						gtggcctcctctgtgagcttc	0.697																																																	1	Deletion - In frame(1)	ovary(1)											54.0	48.0	50.0					X																	120008813		692	1589	2281	SO:0001583	missense	643311				CCDS48161.1	Xq24	2014-05-06	2011-03-24		ENSG00000236446	ENSG00000236446			33293	protein-coding gene	gene with protein product	"""cancer/testis CT47 family, member 13"""	300790				16382448	Standard	NM_001145718		Approved	CT47.13	uc011muc.2	P0C2W7	OTTHUMG00000187483	ENST00000371311.3:c.712G>A	X.37:g.120008813C>T	ENSP00000360360:p.Glu238Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NM97	Missense_Mutation	SNP	NULL	p.E238K	ENST00000371311.3	37	c.712	CCDS48161.1	X	.	.	.	.	.	.	.	.	.	.	C	9.412	1.080733	0.20309	.	.	ENSG00000236446	ENST00000371311	.	.	.	1.72	0.817	0.18773	.	.	.	.	.	T	0.14960	0.0361	L	0.27053	0.805	0.09310	N	1	P	0.50710	0.938	B	0.34931	0.192	T	0.17048	-1.0382	8	0.66056	D	0.02	.	3.6579	0.08228	0.0:0.7417:0.0:0.2583	.	238	P0C2W7	CT47B_HUMAN	K	238	.	ENSP00000360360:E238K	E	-	1	0	CT47B1	119892841	0.001000	0.12720	0.001000	0.08648	0.020000	0.10135	0.873000	0.28052	0.208000	0.20626	0.149000	0.16113	GAG	CT47B1	-	NULL		0.697	CT47B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CT47B1	HGNC	protein_coding	OTTHUMT00000058121.1	C	NM_001145718		120008813	-1	no_errors	ENST00000371311	ensembl	human	known	70_37	missense	SNP	0.001	T
DNHD1	144132	genome.wustl.edu	37	11	6587071	6587071	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:6587071G>C	ENST00000527990.2	+	31	10903	c.10903G>C	c.(10903-10905)Gag>Cag	p.E3635Q	DNHD1_ENST00000254579.6_Missense_Mutation_p.E3635Q			Q96M86	DNHD1_HUMAN	dynein heavy chain domain 1	3635					microtubule-based movement (GO:0007018)	dynein complex (GO:0030286)|extracellular vesicular exosome (GO:0070062)	microtubule motor activity (GO:0003777)			NS(1)|autonomic_ganglia(1)|breast(4)|endometrium(13)|kidney(6)|large_intestine(11)|lung(14)|ovary(2)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	55		Medulloblastoma(188;0.00776)|all_neural(188;0.0652)|Breast(177;0.171)		Epithelial(150;3.93e-08)|BRCA - Breast invasive adenocarcinoma(625;0.13)		gaaagagcaagaggaaaatga	0.468																																																	0													156.0	177.0	170.0					11																	6587071		692	1591	2283	SO:0001583	missense	144132			AK128064	CCDS44532.1, CCDS7767.1	11p15.4	2011-02-10		2005-11-28	ENSG00000179532	ENSG00000179532			26532	protein-coding gene	gene with protein product			"""chromosome 11 open reading frame 47"", ""dynein heavy chain domain 1-like"", ""coiled-coil domain containing 35"""	DHCD1, C11orf47, DNHD1L, CCDC35		12975309	Standard	NM_173589		Approved	FLJ32752, FLJ46184, FLJ35709, DKFZp686J0796	uc001mdw.4	Q96M86	OTTHUMG00000133403	ENST00000527990.2:c.10903G>C	11.37:g.6587071G>C	ENSP00000436180:p.Glu3635Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKK8|Q6UWI9|Q8NAA2|Q8TEE6|Q9NSZ9	Missense_Mutation	SNP	pfam_Dynein_heavy_dom-2,pfam_Dynein_heavy_dom,superfamily_t-SNARE	p.E3635Q	ENST00000527990.2	37	c.10903	CCDS44532.1	11	.	.	.	.	.	.	.	.	.	.	G	9.707	1.155999	0.21454	.	.	ENSG00000179532	ENST00000254579;ENST00000527990;ENST00000529821	T;T	0.29397	1.57;1.57	5.04	-8.11	0.01082	.	.	.	.	.	T	0.12347	0.0300	N	0.08118	0	0.09310	N	1	B	0.19200	0.034	B	0.17098	0.017	T	0.32214	-0.9915	9	0.31617	T	0.26	.	8.6954	0.34293	0.6011:0.2029:0.196:0.0	.	3635	Q96M86	DNHD1_HUMAN	Q	3635;3635;216	ENSP00000254579:E3635Q;ENSP00000436180:E3635Q	ENSP00000254579:E3635Q	E	+	1	0	DNHD1	6543647	0.000000	0.05858	0.000000	0.03702	0.029000	0.11900	-0.512000	0.06313	-1.744000	0.01338	0.655000	0.94253	GAG	DNHD1	-	NULL		0.468	DNHD1-007	NOVEL	basic|appris_principal|CCDS	protein_coding	DNHD1	HGNC	protein_coding	OTTHUMT00000384673.2	G	NM_144666		6587071	+1	no_errors	ENST00000254579	ensembl	human	known	70_37	missense	SNP	0.000	C
DOK6	220164	genome.wustl.edu	37	18	67231744	67231744	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr18:67231744G>T	ENST00000382713.5	+	2	278	c.88G>T	c.(88-90)Gtt>Ttt	p.V30F	RP11-465I4.2_ENST00000583991.1_RNA	NM_152721.5	NP_689934.2	Q6PKX4	DOK6_HUMAN	docking protein 6	30	PH.									central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(2)	20		Colorectal(73;0.083)|Esophageal squamous(42;0.131)				ATGCTGGTTGGTTTTCAAGAA	0.353																																																	0													82.0	82.0	82.0					18																	67231744		2203	4300	6503	SO:0001583	missense	220164			AK057795	CCDS32841.1	18q22.2	2013-01-10	2005-01-18	2005-01-18		ENSG00000206052		"""Pleckstrin homology (PH) domain containing"""	28301	protein-coding gene	gene with protein product		611402	"""docking protein 5-like"""	DOK5L		15286081	Standard	NM_152721		Approved	MGC20785, HsT3226	uc002lkl.3	Q6PKX4		ENST00000382713.5:c.88G>T	18.37:g.67231744G>T	ENSP00000372160:p.Val30Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NNG3|Q4V9S3|Q8WUZ8|Q96HI2|Q96LU2	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.V30F	ENST00000382713.5	37	c.88	CCDS32841.1	18	.	.	.	.	.	.	.	.	.	.	G	32	5.133222	0.94517	.	.	ENSG00000206052	ENST00000382713	T	0.79247	-1.25	5.86	5.86	0.93980	Pleckstrin homology-type (1);Pleckstrin homology domain (2);	0.000000	0.85682	D	0.000000	D	0.85695	0.5756	L	0.59436	1.845	0.80722	D	1	P	0.46706	0.883	P	0.58928	0.848	D	0.85557	0.1225	10	0.87932	D	0	-11.0706	19.5509	0.95319	0.0:0.0:1.0:0.0	.	30	Q6PKX4	DOK6_HUMAN	F	30	ENSP00000372160:V30F	ENSP00000372160:V30F	V	+	1	0	DOK6	65382724	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.342000	0.97044	2.937000	0.99478	0.650000	0.86243	GTT	DOK6	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology		0.353	DOK6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DOK6	HGNC	protein_coding	OTTHUMT00000442969.1	G	NM_152721		67231744	+1	no_errors	ENST00000382713	ensembl	human	known	70_37	missense	SNP	1.000	T
EDEM3	80267	genome.wustl.edu	37	1	184671965	184671965	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:184671965G>C	ENST00000318130.8	-	19	2635	c.2369C>G	c.(2368-2370)tCt>tGt	p.S790C	EDEM3_ENST00000466392.1_5'UTR|EDEM3_ENST00000367512.3_Missense_Mutation_p.S747C	NM_025191.3	NP_079467.3	Q9BZQ6	EDEM3_HUMAN	ER degradation enhancer, mannosidase alpha-like 3	790					cellular protein metabolic process (GO:0044267)|glycoprotein catabolic process (GO:0006516)|post-translational protein modification (GO:0043687)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein folding (GO:0006457)|protein N-linked glycosylation via asparagine (GO:0018279)|response to unfolded protein (GO:0006986)	endoplasmic reticulum lumen (GO:0005788)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|glycoprotein endo-alpha-1,2-mannosidase activity (GO:0004569)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			breast(1)|endometrium(3)|kidney(1)|large_intestine(7)|lung(14)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	30						TGCTTTATCAGAGAGGAGCAC	0.368																																																	0													113.0	101.0	105.0					1																	184671965		2203	4300	6503	SO:0001583	missense	80267			AF288393	CCDS1363.2	1q25	2008-02-05	2006-03-31	2006-03-31	ENSG00000116406	ENSG00000116406			16787	protein-coding gene	gene with protein product		610214	"""chromosome 1 open reading frame 22"""	C1orf22		15537790, 15579471	Standard	NM_025191		Approved		uc010pok.2	Q9BZQ6	OTTHUMG00000035387	ENST00000318130.8:c.2369C>G	1.37:g.184671965G>C	ENSP00000318147:p.Ser790Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCH6|B7ZLZ2|Q0VGM5|Q5TEZ0|Q9HCW1|Q9UFV7	Missense_Mutation	SNP	pfam_Glyco_hydro_47,pfam_Protease-assoc_domain,superfamily_Glyco_hydro_47,prints_Glyco_hydro_47	p.S790C	ENST00000318130.8	37	c.2369	CCDS1363.2	1	.	.	.	.	.	.	.	.	.	.	G	19.51	3.840864	0.71488	.	.	ENSG00000116406	ENST00000318130;ENST00000367512	T;T	0.73897	-0.79;-0.78	4.89	4.89	0.63831	.	0.170734	0.53938	D	0.000051	T	0.77110	0.4082	L	0.34521	1.04	0.80722	D	1	D	0.59767	0.986	P	0.55999	0.789	T	0.79715	-0.1687	10	0.59425	D	0.04	.	18.4468	0.90686	0.0:0.0:1.0:0.0	.	790	Q9BZQ6	EDEM3_HUMAN	C	790;747	ENSP00000318147:S790C;ENSP00000356482:S747C	ENSP00000318147:S790C	S	-	2	0	EDEM3	182938588	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.351000	0.66022	2.430000	0.82344	0.655000	0.94253	TCT	EDEM3	-	NULL		0.368	EDEM3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EDEM3	HGNC	protein_coding	OTTHUMT00000085785.3	G	NM_025191		184671965	-1	no_errors	ENST00000318130	ensembl	human	known	70_37	missense	SNP	1.000	C
EIF4G2	1982	genome.wustl.edu	37	11	10830402	10830402	+	5'UTR	SNP	C	C	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:10830402C>A	ENST00000339995.5	-	0	255				EIF4G2_ENST00000526148.1_5'Flank|EIF4G2_ENST00000525995.1_5'Flank|RP11-685M7.3_ENST00000499765.1_RNA|EIF4G2_ENST00000525681.1_5'Flank|EIF4G2_ENST00000396525.2_5'Flank	NM_001418.3	NP_001409			eukaryotic translation initiation factor 4 gamma, 2											NS(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(2)|large_intestine(7)|lung(14)|ovary(1)|pancreas(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(6)	43				all cancers(16;2.8e-07)|Epithelial(150;4.18e-07)|BRCA - Breast invasive adenocarcinoma(625;0.111)		AAACTCAGCTCAGAGGAGTCG	0.607																																																	0																																										SO:0001623	5_prime_UTR_variant	1982			U73824	CCDS31428.1, CCDS41618.1	11p15	2005-09-29			ENSG00000110321	ENSG00000110321			3297	protein-coding gene	gene with protein product		602325				9030685, 9032289	Standard	NM_001042559		Approved	DAP5, NAT1, p97	uc001mjc.3	P78344	OTTHUMG00000165823	ENST00000339995.5:c.-237G>T	11.37:g.10830402C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000339995.5	37	NULL	CCDS31428.1	11																																																																																			EIF4G2	-	-		0.607	EIF4G2-001	KNOWN	non_ATG_start|basic|CCDS	protein_coding	EIF4G2	HGNC	protein_coding	OTTHUMT00000386384.3	C	NM_001418		10830402	-1	no_errors	ENST00000525972	ensembl	human	known	70_37	rna	SNP	1.000	A
EIF3M	10480	genome.wustl.edu	37	11	32610234	32610234	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:32610234G>A	ENST00000531120.1	+	3	333	c.270G>A	c.(268-270)ctG>ctA	p.L90L	EIF3M_ENST00000524896.1_Intron	NM_006360.4	NP_006351.2			eukaryotic translation initiation factor 3, subunit M											breast(3)|endometrium(4)|kidney(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|skin(1)|urinary_tract(1)	16	Breast(20;0.109)					GTGAAAAGCTGGTCAAATTTC	0.413																																																	0													191.0	175.0	180.0					11																	32610234		2202	4299	6501	SO:0001819	synonymous_variant	10480			AK131064	CCDS7880.1	11p13	2012-12-13	2007-07-27	2007-07-27	ENSG00000149100	ENSG00000149100			24460	protein-coding gene	gene with protein product	"""transport and golgi organization 7 homolog (Drosophila)"""	609641	"""PCI domain containing 1 (herpesvirus entry mediator)"""	PCID1		15919898, 15919899	Standard	NM_006360		Approved	hfl-B5, FLJ29030, GA17, eIF3m, TANGO7	uc001mtu.4	Q7L2H7	OTTHUMG00000166258	ENST00000531120.1:c.270G>A	11.37:g.32610234G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_PCI_dom,superfamily_ARM-type_fold,smart_PCI_dom	p.L90	ENST00000531120.1	37	c.270	CCDS7880.1	11																																																																																			EIF3M	-	superfamily_ARM-type_fold		0.413	EIF3M-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EIF3M	HGNC	protein_coding	OTTHUMT00000388762.2	G	NM_006360		32610234	+1	no_errors	ENST00000531120	ensembl	human	known	70_37	silent	SNP	1.000	A
PPP1R13B	23368	genome.wustl.edu	37	14	104263661	104263661	+	Intron	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr14:104263661G>A	ENST00000202556.9	-	2	440				SNORD51_ENST00000365405.1_RNA	NM_015316.2	NP_056131.2	Q96KQ4	ASPP1_HUMAN	protein phosphatase 1, regulatory subunit 13B						intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|negative regulation of cell cycle (GO:0045786)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				endometrium(6)|kidney(2)|large_intestine(7)|lung(16)|ovary(1)|upper_aerodigestive_tract(1)	33		all_cancers(154;0.173)|all_epithelial(191;0.131)|Melanoma(154;0.155)				AAAAGATGGTGATTTGATTTT	0.353																																																	0													93.0	82.0	86.0					14																	104263661		1849	4099	5948	SO:0001627	intron_variant	0			AB018314	CCDS41997.1	14q32.33	2013-01-10	2011-10-04		ENSG00000088808	ENSG00000088808		"""Serine/threonine phosphatases / Protein phosphatase 1, regulatory subunits"", ""Ankyrin repeat domain containing"""	14950	protein-coding gene	gene with protein product		606455	"""protein phosphatase 1, regulatory (inhibitor) subunit 13B"""			9872452	Standard	NM_015316		Approved	p53BP2-like, KIAA0771, p85, ASPP1	uc001yof.1	Q96KQ4	OTTHUMG00000171647	ENST00000202556.9:c.157+46C>T	14.37:g.104263661G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RMX5|O94870	RNA	SNP	-	NULL	ENST00000202556.9	37	NULL	CCDS41997.1	14																																																																																			SNORD51	-	-		0.353	PPP1R13B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000202275	RFAM	protein_coding	OTTHUMT00000414591.1	G	NM_015316		104263661	-1	no_errors	ENST00000365405	ensembl	human	novel	70_37	rna	SNP	0.004	A
TDRD15	100129278	genome.wustl.edu	37	2	21361407	21361407	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr2:21361407G>A	ENST00000405799.1	+	4	1398	c.1068G>A	c.(1066-1068)ctG>ctA	p.L356L				B5MCY1	TDR15_HUMAN	tudor domain containing 15	356							hydrolase activity, acting on ester bonds (GO:0016788)|nucleic acid binding (GO:0003676)										CATGTTCTCTGACATGTTTGC	0.338																																																	0																																										SO:0001819	synonymous_variant	0					2p24.1	2013-01-23	2013-01-23	2013-01-23	ENSG00000218819	ENSG00000218819		"""Tudor domain containing"""	45037	protein-coding gene	gene with protein product							Standard	XR_425376		Approved			B5MCY1	OTTHUMG00000151795	ENST00000405799.1:c.1068G>A	2.37:g.21361407G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Tudor,superfamily_Staphylococal_nuclease_OB-fold,smart_Tudor,pfscan_Tudor	p.L356	ENST00000405799.1	37	c.1068		2																																																																																			AC010872.2	-	pfam_Tudor		0.338	TDRD15-001	NOVEL	basic|appris_principal|exp_conf	protein_coding	ENSG00000218819	Clone_based_vega_gene	protein_coding	OTTHUMT00000323948.1	G			21361407	+1	no_errors	ENST00000405799	ensembl	human	novel	70_37	silent	SNP	0.976	A
AC007952.5	0	genome.wustl.edu	37	17	18996811	18996811	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:18996811G>C	ENST00000399091.1	+	2	367	c.101G>C	c.(100-102)cGa>cCa	p.R34P	AC007952.5_ENST00000443876.1_Missense_Mutation_p.R50P|AC007952.5_ENST00000428928.1_Missense_Mutation_p.R50P|AC007952.5_ENST00000399093.1_Missense_Mutation_p.R34P|RP11-160E2.19_ENST00000583141.1_lincRNA																							TGGTGTGTCCGAGCCGAAGAG	0.557																																																	0																																										SO:0001583	missense	0																														ENST00000399091.1:c.101G>C	17.37:g.18996811G>C	ENSP00000382042:p.Arg34Pro	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.R50P	ENST00000399091.1	37	c.149		17	.	.	.	.	.	.	.	.	.	.	G	5.832	0.337766	0.11013	.	.	ENSG00000228157	ENST00000399091;ENST00000443876;ENST00000428928;ENST00000399093	.	.	.	1.6	0.518	0.17030	.	.	.	.	.	T	0.44393	0.1291	.	.	.	.	.	.	.	.	.	.	.	.	T	0.53012	-0.8498	4	0.87932	D	0	.	4.383	0.11304	0.2219:0.0:0.7781:0.0	.	.	.	.	P	34;50;50;34	.	ENSP00000382042:R34P	R	+	2	0	AC007952.5	18937536	0.000000	0.05858	0.001000	0.08648	0.026000	0.11368	-0.069000	0.11542	0.210000	0.20664	0.184000	0.17185	CGA	AC007952.5	-	NULL		0.557	AC007952.5-002	NOVEL	not_best_in_genome_evidence|basic|appris_candidate	protein_coding	ENSG00000228157	Clone_based_vega_gene	protein_coding	OTTHUMT00000132165.1	G			18996811	+1	no_errors	ENST00000428928	ensembl	human	known	70_37	missense	SNP	0.001	C
RP11-652G5.1	0	genome.wustl.edu	37	16	32618896	32618896	+	RNA	SNP	A	A	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr16:32618896A>T	ENST00000562976.1	+	0	431																											CTGTGGACACACCTTTCCACA	0.547																																																	0																																												0																															16.37:g.32618896A>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000562976.1	37	NULL		16																																																																																			RP11-652G5.1	-	-		0.547	RP11-652G5.1-002	KNOWN	basic	processed_transcript	ENSG00000259966	Clone_based_vega_gene	pseudogene	OTTHUMT00000432347.1	A			32618896	+1	no_errors	ENST00000562976	ensembl	human	known	70_37	rna	SNP	0.001	T
RP11-44F14.1	0	genome.wustl.edu	37	16	53405032	53405032	+	RNA	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr16:53405032C>T	ENST00000565421.1	-	0	9																											ATCTTTGTTTCACTAACTGCA	0.408																																																	0																																												0																															16.37:g.53405032C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000565421.1	37	NULL		16																																																																																			RP11-44F14.1	-	-		0.408	RP11-44F14.1-002	KNOWN	basic	retained_intron	ENSG00000260078	Clone_based_vega_gene	pseudogene	OTTHUMT00000422364.2	C			53405032	-1	no_errors	ENST00000565421	ensembl	human	known	70_37	rna	SNP	0.759	T
EPC1	80314	genome.wustl.edu	37	10	32561043	32561043	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr10:32561043G>A	ENST00000263062.8	-	13	2254	c.1985C>T	c.(1984-1986)gCt>gTt	p.A662V	EPC1_ENST00000319778.6_Missense_Mutation_p.A639V|RP11-166N17.1_ENST00000415731.2_RNA|EPC1_ENST00000375110.2_Missense_Mutation_p.A589V	NM_025209.2	NP_079485.1	Q9H2F5	EPC1_HUMAN	enhancer of polycomb homolog 1 (Drosophila)	662					chromatin organization (GO:0006325)|histone H2A acetylation (GO:0043968)|histone H4 acetylation (GO:0043967)|negative regulation of gene expression, epigenetic (GO:0045814)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of growth (GO:0040008)|transcription, DNA-templated (GO:0006351)	NuA4 histone acetyltransferase complex (GO:0035267)|nuclear membrane (GO:0031965)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|Piccolo NuA4 histone acetyltransferase complex (GO:0032777)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(3)|lung(8)|ovary(5)|urinary_tract(1)	24		Prostate(175;0.0199)				TGTCACCAAAGCAGAAGCAGC	0.398																																																	0													73.0	64.0	67.0					10																	32561043		2203	4300	6503	SO:0001583	missense	80314			AF277374	CCDS7172.1, CCDS60511.1, CCDS73083.1	10p11	2005-12-12			ENSG00000120616	ENSG00000120616			19876	protein-coding gene	gene with protein product		610999				10976108	Standard	NM_025209		Approved	Epl1	uc001iwg.2	Q9H2F5	OTTHUMG00000017925	ENST00000263062.8:c.1985C>T	10.37:g.32561043G>A	ENSP00000263062:p.Ala662Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DSC3|D3DRX7|Q5VW54|Q5VW56|Q5VW58|Q8NAQ4|Q8NE21|Q96LF4|Q96RR6|Q9H7T7	Missense_Mutation	SNP	pfam_Enhancer_polycomb_C,pfam_Enhancer_polycomb-like_N	p.A662V	ENST00000263062.8	37	c.1985	CCDS7172.1	10	.	.	.	.	.	.	.	.	.	.	G	35	5.475929	0.96291	.	.	ENSG00000120616	ENST00000375110;ENST00000319778;ENST00000263062	.	.	.	5.78	5.78	0.91487	.	0.000000	0.85682	D	0.000000	T	0.77377	0.4121	L	0.55990	1.75	0.80722	D	1	D;D;D	0.89917	1.0;1.0;0.997	D;D;D	0.87578	0.997;0.998;0.994	T	0.76623	-0.2891	9	0.56958	D	0.05	-12.3779	20.0754	0.97739	0.0:0.0:1.0:0.0	.	589;639;662	Q9H2F5-3;Q9H2F5-2;Q9H2F5	.;.;EPC1_HUMAN	V	589;639;662	.	ENSP00000263062:A662V	A	-	2	0	EPC1	32601049	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.472000	0.97709	2.749000	0.94314	0.460000	0.39030	GCT	EPC1	-	pfam_Enhancer_polycomb_C		0.398	EPC1-004	KNOWN	basic|CCDS	protein_coding	EPC1	HGNC	protein_coding	OTTHUMT00000047484.1	G			32561043	-1	no_errors	ENST00000263062	ensembl	human	known	70_37	missense	SNP	1.000	A
EPHA5	2044	genome.wustl.edu	37	4	66356421	66356421	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr4:66356421G>A	ENST00000273854.3	-	5	1676	c.1076C>T	c.(1075-1077)tCt>tTt	p.S359F	EPHA5_ENST00000511294.1_Missense_Mutation_p.S359F|EPHA5_ENST00000432638.2_Intron|EPHA5_ENST00000354839.4_Missense_Mutation_p.S359F	NM_001281765.1|NM_004439.5	NP_001268694.1|NP_004430.4	P54756	EPHA5_HUMAN	EPH receptor A5	359	Fibronectin type-III 1. {ECO:0000255|PROSITE-ProRule:PRU00316}.				axon guidance (GO:0007411)|cAMP-mediated signaling (GO:0019933)|ephrin receptor signaling pathway (GO:0048013)|hippocampus development (GO:0021766)|negative regulation of synapse assembly (GO:0051964)|neuron development (GO:0048666)|positive regulation of CREB transcription factor activity (GO:0032793)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of insulin secretion involved in cellular response to glucose stimulus (GO:0061178)|regulation of Rac GTPase activity (GO:0032314)	dendrite (GO:0030425)|external side of plasma membrane (GO:0009897)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|rough endoplasmic reticulum (GO:0005791)	ATP binding (GO:0005524)|ephrin receptor activity (GO:0005003)|GPI-linked ephrin receptor activity (GO:0005004)|transmembrane-ephrin receptor activity (GO:0005005)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(25)|liver(1)|lung(76)|ovary(3)|pancreas(1)|prostate(1)|skin(3)|stomach(4)|upper_aerodigestive_tract(2)|urinary_tract(3)	142						CCGAGGAGCAGAGGGGGGTCC	0.388										TSP Lung(17;0.13)																																							0													39.0	39.0	39.0					4																	66356421		2203	4300	6503	SO:0001583	missense	2044			L36644	CCDS3513.1, CCDS3514.1, CCDS75131.1, CCDS75132.1, CCDS75133.1	4q13.1	2013-02-11	2004-10-28		ENSG00000145242	ENSG00000145242		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3389	protein-coding gene	gene with protein product		600004	"""EphA5"""			9267020, 7528718	Standard	NM_004439		Approved	Hek7, TYRO4, CEK7, EHK1	uc003hcy.3	P54756	OTTHUMG00000129273	ENST00000273854.3:c.1076C>T	4.37:g.66356421G>A	ENSP00000273854:p.Ser359Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z3F2	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S359F	ENST00000273854.3	37	c.1076	CCDS3513.1	4	.	.	.	.	.	.	.	.	.	.	G	25.8	4.670376	0.88348	.	.	ENSG00000145242	ENST00000273854;ENST00000354839;ENST00000511294	T;T;D	0.97642	0.31;0.31;-4.47	5.86	5.86	0.93980	Fibronectin, type III (4);Immunoglobulin-like fold (1);	0.000000	0.51477	D	0.000095	D	0.99048	0.9674	H	0.95294	3.65	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	1.0;1.0;0.999;0.999	D	0.99174	1.0865	10	0.87932	D	0	.	20.1858	0.98214	0.0:0.0:1.0:0.0	.	359;359;359;359	B7ZKW7;B7ZKJ3;P54756-2;P54756	.;.;.;EPHA5_HUMAN	F	359	ENSP00000273854:S359F;ENSP00000346899:S359F;ENSP00000427638:S359F	ENSP00000273854:S359F	S	-	2	0	EPHA5	66039016	1.000000	0.71417	0.991000	0.47740	0.989000	0.77384	9.869000	0.99810	2.777000	0.95525	0.591000	0.81541	TCT	EPHA5	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,superfamily_Growth_fac_rcpt,smart_Fibronectin_type3,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3		0.388	EPHA5-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	EPHA5	HGNC	protein_coding	OTTHUMT00000251388.2	G	NM_004439		66356421	-1	no_errors	ENST00000273854	ensembl	human	known	70_37	missense	SNP	1.000	A
EPHB1	2047	genome.wustl.edu	37	3	134670480	134670480	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:134670480G>C	ENST00000398015.3	+	3	761	c.391G>C	c.(391-393)Gag>Cag	p.E131Q	EPHB1_ENST00000488154.1_3'UTR	NM_004441.4	NP_004432.1	P54762	EPHB1_HUMAN	EPH receptor B1	131	Eph LBD. {ECO:0000255|PROSITE- ProRule:PRU00883}.				angiogenesis (GO:0001525)|axon guidance (GO:0007411)|camera-type eye morphogenesis (GO:0048593)|cell chemotaxis (GO:0060326)|cell-substrate adhesion (GO:0031589)|central nervous system projection neuron axonogenesis (GO:0021952)|dendritic spine development (GO:0060996)|dendritic spine morphogenesis (GO:0060997)|detection of temperature stimulus involved in sensory perception of pain (GO:0050965)|ephrin receptor signaling pathway (GO:0048013)|establishment of cell polarity (GO:0030010)|neural precursor cell proliferation (GO:0061351)|neurogenesis (GO:0022008)|optic nerve morphogenesis (GO:0021631)|positive regulation of synapse assembly (GO:0051965)|protein autophosphorylation (GO:0046777)|regulation of ERK1 and ERK2 cascade (GO:0070372)|regulation of JNK cascade (GO:0046328)|retinal ganglion cell axon guidance (GO:0031290)	axon (GO:0030424)|early endosome membrane (GO:0031901)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|membrane raft (GO:0045121)	ATP binding (GO:0005524)|axon guidance receptor activity (GO:0008046)|transmembrane-ephrin receptor activity (GO:0005005)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(2)|large_intestine(13)|lung(63)|ovary(8)|pancreas(2)|prostate(8)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(2)	130						CTTCTGGTCTGAGGCCCCCTA	0.512																																																	0													112.0	111.0	111.0					3																	134670480		2002	4223	6225	SO:0001583	missense	2047			L40636	CCDS46921.1	3q21-q23	2013-02-11	2004-10-28			ENSG00000154928		"""EPH receptors"", ""Sterile alpha motif (SAM) domain containing"", ""Fibronectin type III domain containing"""	3392	protein-coding gene	gene with protein product		600600	"""EphB1"""	EPHT2		8666391	Standard	NM_004441		Approved	Hek6	uc003eqt.3	P54762		ENST00000398015.3:c.391G>C	3.37:g.134670480G>C	ENSP00000381097:p.Glu131Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K593|B3KTB2|B5A969|O43569|O95142|O95143|Q0VG87	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Ephrin_rcpt_lig-bd_dom,pfam_Prot_kinase_cat_dom,pfam_Fibronectin_type3,pfam_SAM_type1,pfam_SAM_2,superfamily_Galactose-bd-like,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,superfamily_SAM/pointed,superfamily_Growth_fac_rcpt,smart_Ephrin_rcpt_lig-bd_dom,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_SAM,pirsf_Tyr_kinase_ephrin_rcpt,pfscan_Fibronectin_type3,pfscan_SAM,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.E131Q	ENST00000398015.3	37	c.391	CCDS46921.1	3	.	.	.	.	.	.	.	.	.	.	G	24.4	4.532514	0.85812	.	.	ENSG00000154928	ENST00000460895;ENST00000398015;ENST00000474732	T;T;T	0.04015	3.73;3.73;3.73	5.49	5.49	0.81192	Ephrin receptor, ligand binding (2);Galactose-binding domain-like (1);	0.109676	0.64402	D	0.000011	T	0.26011	0.0634	M	0.84156	2.68	0.80722	D	1	D;D	0.89917	1.0;0.957	D;P	0.73380	0.98;0.782	T	0.01093	-1.1454	10	0.72032	D	0.01	.	19.3701	0.94480	0.0:0.0:1.0:0.0	.	131;131	B5A969;P54762	.;EPHB1_HUMAN	Q	109;131;109	ENSP00000417435:E109Q;ENSP00000381097:E131Q;ENSP00000418352:E109Q	ENSP00000381097:E131Q	E	+	1	0	EPHB1	136153170	1.000000	0.71417	0.998000	0.56505	0.991000	0.79684	9.869000	0.99810	2.574000	0.86865	0.650000	0.86243	GAG	EPHB1	-	pfam_Ephrin_rcpt_lig-bd_dom,superfamily_Galactose-bd-like,smart_Ephrin_rcpt_lig-bd_dom,pirsf_Tyr_kinase_ephrin_rcpt		0.512	EPHB1-005	KNOWN	basic|appris_principal|CCDS	protein_coding	EPHB1	HGNC	protein_coding	OTTHUMT00000357671.1	G	NM_004441		134670480	+1	no_errors	ENST00000398015	ensembl	human	known	70_37	missense	SNP	1.000	C
FAM179A	165186	genome.wustl.edu	37	2	29247030	29247030	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr2:29247030C>T	ENST00000379558.4	+	13	1994	c.1643C>T	c.(1642-1644)tCt>tTt	p.S548F	FAM179A_ENST00000403861.2_Missense_Mutation_p.S493F|FAM179A_ENST00000465300.1_3'UTR	NM_199280.2	NP_954974.2	Q6ZUX3	F179A_HUMAN	family with sequence similarity 179, member A	548										breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(5)|lung(9)|ovary(3)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	26						TCCAAGGTGTCTCACCTGGCC	0.607																																																	0													23.0	24.0	23.0					2																	29247030		1976	4148	6124	SO:0001583	missense	165186			AK125239, AK125744	CCDS1769.2	2p23.2	2008-10-30			ENSG00000189350	ENSG00000189350			33715	protein-coding gene	gene with protein product						16344560	Standard	NM_199280		Approved	FLJ43249, LOC165186	uc010ezl.3	Q6ZUX3	OTTHUMG00000128432	ENST00000379558.4:c.1643C>T	2.37:g.29247030C>T	ENSP00000368876:p.Ser548Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ZUF5	Missense_Mutation	SNP	pfam_CLASP_N_dom,superfamily_ARM-type_fold	p.S548F	ENST00000379558.4	37	c.1643	CCDS1769.2	2	.	.	.	.	.	.	.	.	.	.	C	20.4	3.983207	0.74474	.	.	ENSG00000189350	ENST00000379558;ENST00000403861;ENST00000440012	T;T;T	0.68331	-0.32;-0.32;-0.19	4.93	4.93	0.64822	Armadillo-like helical (1);Armadillo-type fold (1);CLASP N-terminal domain (1);	0.000000	0.64402	D	0.000010	T	0.82171	0.4979	M	0.78456	2.415	0.48830	D	0.999711	D;D	0.89917	1.0;1.0	D;D	0.76071	0.977;0.987	D	0.84239	0.0471	10	0.56958	D	0.05	.	17.7168	0.88340	0.0:1.0:0.0:0.0	.	493;548	F8W8E4;Q6ZUX3	.;F179A_HUMAN	F	548;493;43	ENSP00000368876:S548F;ENSP00000384699:S493F;ENSP00000396739:S43F	ENSP00000368876:S548F	S	+	2	0	FAM179A	29100534	0.972000	0.33761	0.999000	0.59377	0.762000	0.43233	2.330000	0.43885	2.262000	0.75019	0.462000	0.41574	TCT	FAM179A	-	pfam_CLASP_N_dom,superfamily_ARM-type_fold		0.607	FAM179A-003	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	FAM179A	HGNC	protein_coding	OTTHUMT00000317848.4	C	NM_199280		29247030	+1	no_errors	ENST00000379558	ensembl	human	known	70_37	missense	SNP	1.000	T
NUTM2F	54754	genome.wustl.edu	37	9	97082512	97082512	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr9:97082512G>A	ENST00000253262.4	-	5	1366	c.1346C>T	c.(1345-1347)tCc>tTc	p.S449F	NUTM2F_ENST00000335456.7_Missense_Mutation_p.S434F|NUTM2F_ENST00000341207.4_Missense_Mutation_p.S434F	NM_017561.1	NP_060031.1	A1L443	NTM2F_HUMAN	NUT family member 2F	449																	GTCTTCCTGGGAACACAGCTT	0.567																																																	0													41.0	50.0	47.0					9																	97082512		1895	4106	6001	SO:0001583	missense	54754				CCDS47994.1	9q22.32	2013-05-02	2013-03-14	2013-05-02	ENSG00000130950	ENSG00000130950			23450	protein-coding gene	gene with protein product			"""family with sequence similarity 22, member F"""	FAM22F			Standard	NM_017561		Approved	DKFZp434I1117		A1L443	OTTHUMG00000020260	ENST00000253262.4:c.1346C>T	9.37:g.97082512G>A	ENSP00000253262:p.Ser449Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B6ZDF0|Q5SR58|Q5SR59|Q9UFB1	Missense_Mutation	SNP	NULL	p.S449F	ENST00000253262.4	37	c.1346	CCDS47994.1	9	.	.	.	.	.	.	.	.	.	.	.	14.12	2.441524	0.43326	.	.	ENSG00000130950	ENST00000335456;ENST00000253262;ENST00000341207;ENST00000375347	T;T;T	0.37411	1.2;2.01;1.92	1.2	0.095	0.14483	Nuclear Testis protein, C-terminal (1);	0.378699	0.22866	N	0.054691	T	0.51075	0.1653	M	0.75615	2.305	0.27630	N	0.948058	D	0.76494	0.999	D	0.77004	0.989	T	0.40213	-0.9575	10	0.87932	D	0	.	4.8766	0.13658	0.0:0.3957:0.6043:0.0	.	449	A1L443	FA22F_HUMAN	F	434;449;434;283	ENSP00000335067:S434F;ENSP00000253262:S449F;ENSP00000343865:S434F	ENSP00000253262:S449F	S	-	2	0	FAM22F	96122333	0.582000	0.26749	0.765000	0.31456	0.361000	0.29550	0.868000	0.27982	0.045000	0.15804	0.456000	0.33151	TCC	FAM22F	-	NULL		0.567	NUTM2F-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FAM22F	HGNC	protein_coding	OTTHUMT00000053173.2	G	NM_017561		97082512	-1	no_errors	ENST00000253262	ensembl	human	known	70_37	missense	SNP	0.818	A
FAM83A	84985	genome.wustl.edu	37	8	124219598	124219598	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:124219598C>T	ENST00000518448.1	+	5	2989	c.975C>T	c.(973-975)tcC>tcT	p.S325S	FAM83A_ENST00000546351.1_Silent_p.S269S|FAM83A_ENST00000522648.1_Silent_p.S269S|FAM83A_ENST00000318462.6_Silent_p.S325S|FAM83A_ENST00000536633.1_Silent_p.S325S|FAM83A_ENST00000276699.6_Silent_p.S325S			Q86UY5	FA83A_HUMAN	family with sequence similarity 83, member A	325	Ser-rich.									breast(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(3)|ovary(3)|prostate(2)|skin(1)	17	Lung NSC(37;1.55e-09)|Ovarian(258;0.0205)		STAD - Stomach adenocarcinoma(47;0.00527)			GCAGTGGCTCCGCCAGTGACC	0.721																																																	0													13.0	15.0	14.0					8																	124219598		2192	4288	6480	SO:0001819	synonymous_variant	84985			BC052300	CCDS6339.1, CCDS6340.1, CCDS75784.1	8q24.13	2014-03-13			ENSG00000147689	ENSG00000147689			28210	protein-coding gene	gene with protein product						22886303	Standard	XM_005251087		Approved	MGC14128, BJ-TSA-9	uc003ypx.3	Q86UY5	OTTHUMG00000165083	ENST00000518448.1:c.975C>T	8.37:g.124219598C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q71HL2|Q8N7I1|Q96I47	Silent	SNP	pfam_DUF1669	p.S325	ENST00000518448.1	37	c.975	CCDS6340.1	8																																																																																			FAM83A	-	NULL		0.721	FAM83A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83A	HGNC	protein_coding	OTTHUMT00000381737.1	C	NM_032899		124219598	+1	no_errors	ENST00000318462	ensembl	human	known	70_37	silent	SNP	0.000	T
FAT3	120114	genome.wustl.edu	37	11	92087080	92087080	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:92087080C>T	ENST00000298047.6	+	1	1819	c.1802C>T	c.(1801-1803)tCa>tTa	p.S601L	FAT3_ENST00000525166.1_Missense_Mutation_p.S451L|FAT3_ENST00000409404.2_Missense_Mutation_p.S601L|FAT3_ENST00000541502.1_Missense_Mutation_p.S601L			Q8TDW7	FAT3_HUMAN	FAT atypical cadherin 3	601	Cadherin 6. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)|multicellular organismal development (GO:0007275)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(2)|endometrium(10)|kidney(4)|large_intestine(11)|liver(2)|lung(37)|ovary(5)|pancreas(1)|prostate(4)|skin(2)|stomach(1)|upper_aerodigestive_tract(5)	85		Acute lymphoblastic leukemia(157;3.01e-05)|all_hematologic(158;0.00858)				ACAGCAGTCTCAGCGATCGAT	0.393										TCGA Ovarian(4;0.039)																																							0													57.0	59.0	58.0					11																	92087080		1878	4118	5996	SO:0001583	missense	120114			AB076400		11q14.3	2013-05-31	2013-05-31		ENSG00000165323	ENSG00000165323		"""Cadherins / Cadherin-related"""	23112	protein-coding gene	gene with protein product	"""cadherin-related family member 10"""	612483	"""FAT tumor suppressor homolog 3 (Drosophila)"""			11811999	Standard	NM_001008781		Approved	KIAA1989, CDHF15, CDHR10	uc001pdj.4	Q8TDW7	OTTHUMG00000154468	ENST00000298047.6:c.1802C>T	11.37:g.92087080C>T	ENSP00000298047:p.Ser601Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDB0|Q96AU6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S601L	ENST00000298047.6	37	c.1802		11	.	.	.	.	.	.	.	.	.	.	C	20.2	3.950358	0.73787	.	.	ENSG00000165323	ENST00000298047;ENST00000409404;ENST00000541502;ENST00000525166	T;T;T;T	0.38401	1.14;1.14;1.14;1.14	5.74	5.74	0.90152	.	.	.	.	.	T	0.58637	0.2136	L	0.60067	1.865	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	T	0.54063	-0.8349	9	0.45353	T	0.12	.	18.8971	0.92427	0.0:1.0:0.0:0.0	.	601	Q8TDW7-3	.	L	601;601;601;451	ENSP00000298047:S601L;ENSP00000387040:S601L;ENSP00000443786:S601L;ENSP00000432586:S451L	ENSP00000298047:S601L	S	+	2	0	FAT3	91726728	1.000000	0.71417	0.966000	0.40874	0.883000	0.51084	7.755000	0.85180	2.709000	0.92574	0.591000	0.81541	TCA	FAT3	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.393	FAT3-201	KNOWN	basic	protein_coding	FAT3	HGNC	protein_coding		C	NM_001008781		92087080	+1	no_errors	ENST00000298047	ensembl	human	known	70_37	missense	SNP	1.000	T
LINC00905	148231	genome.wustl.edu	37	19	16146741	16146741	+	RNA	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr19:16146741G>C	ENST00000588117.2	+	0	1004					NR_024335.1|NR_024336.1				long intergenic non-protein coding RNA 905																		TTCCCGACTTGATGAAGGCAG	0.627																																																	0																																												148231			BC031284, BC069223, DB461577		19p13.12	2013-05-21			ENSG00000167459	ENSG00000167459		"""Long non-coding RNAs"""	26334	non-coding RNA	RNA, long non-coding							Standard	NR_110321		Approved	FLJ25328			OTTHUMG00000182270		19.37:g.16146741G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000588117.2	37	NULL		19	.	.	.	.	.	.	.	.	.	.	G	0.025	-1.379683	0.01204	.	.	ENSG00000167459	ENST00000397365	.	.	.	0.235	0.235	0.15431	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	.	3.8765	0.09059	1.0E-4:0.4738:0.5259:1.0E-4	.	.	.	.	S	206	.	.	X	+	2	2	AC004790.1	16007741	0.997000	0.39634	0.104000	0.21259	0.107000	0.19398	0.367000	0.20382	0.308000	0.22923	0.313000	0.20887	TGA	AC114273.1	-	-		0.627	LINC00905-001	KNOWN	basic	lincRNA	FLJ25328	Clone_based_vega_gene	processed_transcript	OTTHUMT00000460313.2	G	NR_024335		16146741	+1	no_errors	ENST00000397365	ensembl	human	known	70_37	rna	SNP	1.000	C
FLNA	2316	genome.wustl.edu	37	X	153594730	153594730	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:153594730C>G	ENST00000369850.3	-	8	1410	c.1174G>C	c.(1174-1176)Gag>Cag	p.E392Q	FLNA_ENST00000360319.4_Missense_Mutation_p.E392Q|FLNA_ENST00000344736.4_Missense_Mutation_p.E392Q|FLNA_ENST00000422373.1_Missense_Mutation_p.E392Q	NM_001110556.1	NP_001104026.1	P21333	FLNA_HUMAN	filamin A, alpha	392					actin crosslink formation (GO:0051764)|actin cytoskeleton reorganization (GO:0031532)|adenylate cyclase-inhibiting dopamine receptor signaling pathway (GO:0007195)|blood coagulation (GO:0007596)|cell junction assembly (GO:0034329)|cilium assembly (GO:0042384)|cytoplasmic sequestering of protein (GO:0051220)|early endosome to late endosome transport (GO:0045022)|epithelial to mesenchymal transition (GO:0001837)|establishment of protein localization (GO:0045184)|mRNA transcription from RNA polymerase II promoter (GO:0042789)|negative regulation of protein catabolic process (GO:0042177)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|platelet activation (GO:0030168)|platelet aggregation (GO:0070527)|platelet degranulation (GO:0002576)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of transcription factor import into nucleus (GO:0042993)|protein localization to cell surface (GO:0034394)|protein stabilization (GO:0050821)|receptor clustering (GO:0043113)|spindle assembly involved in mitosis (GO:0090307)	actin cytoskeleton (GO:0015629)|actin filament (GO:0005884)|apical dendrite (GO:0097440)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|dendritic shaft (GO:0043198)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|membrane (GO:0016020)|Myb complex (GO:0031523)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	actin filament binding (GO:0051015)|Fc-gamma receptor I complex binding (GO:0034988)|glycoprotein binding (GO:0001948)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|Rac GTPase binding (GO:0048365)|Ral GTPase binding (GO:0017160)|Rho GTPase binding (GO:0017048)|signal transducer activity (GO:0004871)|small GTPase binding (GO:0031267)|transcription factor binding (GO:0008134)			breast(6)	6	all_cancers(53;3.7e-16)|all_epithelial(53;2.97e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					CCACTGGGCTCCAGGCCGGGA	0.612																																																	0													74.0	75.0	75.0					X																	153594730		2135	4230	6365	SO:0001583	missense	2316			X70082	CCDS44021.1, CCDS48194.1	Xq28	2009-07-23	2009-07-23		ENSG00000196924	ENSG00000196924			3754	protein-coding gene	gene with protein product	"""actin binding protein 280"""	300017	"""filamin A, alpha (actin binding protein 280)"""	FLN1, FLN, OPD2, OPD1		8406501, 12612583	Standard	NM_001456		Approved	ABP-280	uc004fkk.2	P21333	OTTHUMG00000022712	ENST00000369850.3:c.1174G>C	X.37:g.153594730C>G	ENSP00000358866:p.Glu392Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	E9KL45|Q5HY53|Q5HY55|Q8NF52	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.E392Q	ENST00000369850.3	37	c.1174	CCDS48194.1	X	.	.	.	.	.	.	.	.	.	.	C	4.544	0.100945	0.08731	.	.	ENSG00000196924	ENST00000360319;ENST00000369852;ENST00000422373;ENST00000369850;ENST00000344736	D;D;D;D	0.86297	-2.1;-2.1;-2.1;-2.1	4.71	3.85	0.44370	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.166819	0.40908	D	0.000987	D	0.86818	0.6024	L	0.59436	1.845	0.80722	D	1	B;B	0.31705	0.336;0.153	B;B	0.40901	0.343;0.256	D	0.83710	0.0187	10	0.41790	T	0.15	.	12.5519	0.56231	0.0:0.9162:0.0:0.0838	.	392;392	P21333-2;P21333	.;FLNA_HUMAN	Q	392;365;392;392;392	ENSP00000353467:E392Q;ENSP00000416926:E392Q;ENSP00000358866:E392Q;ENSP00000358863:E392Q	ENSP00000358863:E392Q	E	-	1	0	FLNA	153247924	1.000000	0.71417	0.998000	0.56505	0.077000	0.17291	7.809000	0.86057	0.797000	0.33971	-0.370000	0.07254	GAG	FLNA	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.612	FLNA-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNA	HGNC	protein_coding	OTTHUMT00000058942.3	C			153594730	-1	no_errors	ENST00000369850	ensembl	human	known	70_37	missense	SNP	1.000	G
FRS2	10818	genome.wustl.edu	37	12	69968293	69968293	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:69968293G>A	ENST00000550389.1	+	7	1331	c.1085G>A	c.(1084-1086)cGc>cAc	p.R362H	FRS2_ENST00000299293.2_Missense_Mutation_p.R362H|FRS2_ENST00000549921.1_Missense_Mutation_p.R362H|FRS2_ENST00000397997.2_Missense_Mutation_p.R362H	NM_001278353.1|NM_001278357.1	NP_001265282.1|NP_001265286.1	Q8WU20	FRS2_HUMAN	fibroblast growth factor receptor substrate 2	362					activation of MAPK activity (GO:0000187)|activation of MAPKK activity (GO:0000186)|anterior/posterior axis specification, embryo (GO:0008595)|epidermal growth factor receptor signaling pathway (GO:0007173)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|forebrain development (GO:0030900)|G-protein coupled receptor signaling pathway (GO:0007186)|gastrulation with mouth forming second (GO:0001702)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|lens fiber cell development (GO:0070307)|neuroblast proliferation (GO:0007405)|neurotrophin TRK receptor signaling pathway (GO:0048011)|optic placode formation involved in camera-type eye formation (GO:0046619)|organ induction (GO:0001759)|phosphatidylinositol-mediated signaling (GO:0048015)|prostate epithelial cord arborization involved in prostate glandular acinus morphogenesis (GO:0060527)|regulation of apoptotic process (GO:0042981)|regulation of epithelial cell proliferation (GO:0050678)|regulation of ERK1 and ERK2 cascade (GO:0070372)|transmembrane receptor protein tyrosine phosphatase signaling pathway (GO:0007185)|ventricular septum development (GO:0003281)	cell-cell junction (GO:0005911)|endosome (GO:0005768)|integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	fibroblast growth factor receptor binding (GO:0005104)|neurotrophin TRKA receptor binding (GO:0005168)|phosphatase activator activity (GO:0019211)|transmembrane receptor protein tyrosine kinase adaptor activity (GO:0005068)			autonomic_ganglia(1)|breast(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	22	Breast(13;2.15e-06)|Esophageal squamous(21;0.187)		Epithelial(6;2.94e-18)|Lung(24;9.68e-05)|OV - Ovarian serous cystadenocarcinoma(12;0.000984)|LUAD - Lung adenocarcinoma(15;0.00107)|STAD - Stomach adenocarcinoma(21;0.0151)|Kidney(9;0.143)|LUSC - Lung squamous cell carcinoma(43;0.24)			TGGGAAGCCCGCAAGCTAAGT	0.388																																																	0													72.0	68.0	70.0					12																	69968293		1866	4112	5978	SO:0001583	missense	10818			AF036717	CCDS41809.1	12q15	2008-02-05				ENSG00000166225			16971	protein-coding gene	gene with protein product		607743				8761293, 9660748	Standard	NM_001278351		Approved	SNT-1, FRS2alpha, SNT1, FRS2A	uc001suz.3	Q8WU20		ENST00000550389.1:c.1085G>A	12.37:g.69968293G>A	ENSP00000447241:p.Arg362His	Somatic		WXS	Illumina HiSeq	Phase_IV	B0LPF2|B2R684|O43558|Q7LDQ6	Missense_Mutation	SNP	pfam_Insln_rcpt_S1,smart_Insln_rcpt_S1,pfscan_Insln_rcpt_S1	p.R362H	ENST00000550389.1	37	c.1085	CCDS41809.1	12	.	.	.	.	.	.	.	.	.	.	G	11.46	1.644672	0.29246	.	.	ENSG00000166225	ENST00000299293;ENST00000549921;ENST00000550389;ENST00000397997	T;T;T;T	0.25250	1.81;1.81;1.81;1.81	6.14	4.01	0.46588	.	0.314649	0.34628	N	0.003814	T	0.18718	0.0449	L	0.29908	0.895	0.43555	D	0.995869	B	0.02656	0.0	B	0.04013	0.001	T	0.04607	-1.0939	9	.	.	.	-2.4463	14.0138	0.64513	0.1414:0.0:0.8586:0.0	.	362	Q8WU20	FRS2_HUMAN	H	362	ENSP00000299293:R362H;ENSP00000450048:R362H;ENSP00000447241:R362H;ENSP00000381083:R362H	.	R	+	2	0	FRS2	68254560	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	3.311000	0.51919	1.612000	0.50221	0.650000	0.86243	CGC	FRS2	-	NULL		0.388	FRS2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FRS2	HGNC	protein_coding	OTTHUMT00000403760.1	G	NM_006654		69968293	+1	no_errors	ENST00000299293	ensembl	human	known	70_37	missense	SNP	1.000	A
GJB5	2709	genome.wustl.edu	37	1	35223480	35223480	+	Missense_Mutation	SNP	G	G	C	rs544692090		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:35223480G>C	ENST00000338513.1	+	2	722	c.549G>C	c.(547-549)aaG>aaC	p.K183N	GJB4_ENST00000339480.1_5'Flank	NM_005268.3	NP_005259.1	O95377	CXB5_HUMAN	gap junction protein, beta 5, 31.1kDa	183					cell communication (GO:0007154)|epidermis development (GO:0008544)|labyrinthine layer morphogenesis (GO:0060713)|spongiotrophoblast differentiation (GO:0060708)	connexon complex (GO:0005922)|integral component of membrane (GO:0016021)				endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(3)|ovary(1)|skin(1)|stomach(1)	10		Myeloproliferative disorder(586;0.0393)				CCTCAGAGAAGAACATTTTCA	0.522																																																	0													105.0	95.0	98.0					1																	35223480		2203	4300	6503	SO:0001583	missense	2709			BC004379	CCDS382.1	1p34.3	2008-05-14	2007-11-06		ENSG00000189280	ENSG00000189280		"""Ion channels / Gap junction proteins (connexins)"""	4287	protein-coding gene	gene with protein product	"""connexin 31.1"""	604493	"""gap junction protein, beta 5 (connexin 31.1)"", ""gap junction protein, beta 5"""			9843209	Standard	NM_005268		Approved	CX31.1	uc001bxu.4	O95377	OTTHUMG00000004053	ENST00000338513.1:c.549G>C	1.37:g.35223480G>C	ENSP00000340811:p.Lys183Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UPA3	Missense_Mutation	SNP	pfam_Connexin_N,pfam_Connexin_CCC,smart_Connexin_N,prints_Connexin,prints_Connexin311	p.K183N	ENST00000338513.1	37	c.549	CCDS382.1	1	.	.	.	.	.	.	.	.	.	.	G	15.56	2.869521	0.51588	.	.	ENSG00000189280	ENST00000338513	D	0.99121	-5.45	5.9	0.817	0.18773	Gap junction protein, cysteine-rich domain (1);	0.000000	0.85682	D	0.000000	D	0.99390	0.9785	H	0.96015	3.755	0.45161	D	0.998175	D	0.89917	1.0	D	0.97110	1.0	D	0.99793	1.1032	10	0.87932	D	0	.	10.7481	0.46191	0.4407:0.0:0.5593:0.0	.	183	O95377	CXB5_HUMAN	N	183	ENSP00000340811:K183N	ENSP00000340811:K183N	K	+	3	2	GJB5	34996067	1.000000	0.71417	0.995000	0.50966	0.510000	0.34073	0.932000	0.28884	-0.083000	0.12618	0.563000	0.77884	AAG	GJB5	-	pfam_Connexin_CCC,prints_Connexin		0.522	GJB5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GJB5	HGNC	protein_coding	OTTHUMT00000011561.1	G	NM_005268		35223480	+1	no_errors	ENST00000338513	ensembl	human	known	70_37	missense	SNP	0.999	C
GLB1	2720	genome.wustl.edu	37	3	33094985	33094985	+	Missense_Mutation	SNP	A	A	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:33094985A>T	ENST00000399402.3	-	7	831	c.700T>A	c.(700-702)Ttg>Atg	p.L234M	GLB1_ENST00000307363.5_Missense_Mutation_p.L264M|GLB1_ENST00000307377.8_Missense_Mutation_p.L133M|GLB1_ENST00000445488.2_Missense_Mutation_p.L312M	NM_001079811.1	NP_001073279	P16278	BGAL_HUMAN	galactosidase, beta 1	264					carbohydrate metabolic process (GO:0005975)|galactose catabolic process (GO:0019388)|glycosaminoglycan catabolic process (GO:0006027)|glycosaminoglycan metabolic process (GO:0030203)|glycosphingolipid metabolic process (GO:0006687)|keratan sulfate catabolic process (GO:0042340)|keratan sulfate metabolic process (GO:0042339)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|lysosomal lumen (GO:0043202)	beta-galactosidase activity (GO:0004565)|galactoside binding (GO:0016936)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(3)|ovary(1)|skin(1)|urinary_tract(1)	21		Melanoma(143;0.104)				ATTCTTACCAAGGGTCCTTTG	0.478																																																	0													111.0	109.0	109.0					3																	33094985		2003	4187	6190	SO:0001583	missense	2720			M22590	CCDS43061.1, CCDS43062.1, CCDS46785.1	3p22.3	2012-10-02			ENSG00000170266	ENSG00000170266	3.2.1.23		4298	protein-coding gene	gene with protein product		611458	"""elastin receptor 1, 67kDa"", ""elastin receptor 1 (67kD)"""	ELNR1		110522, 3143362	Standard	NM_000404		Approved	EBP	uc003cfi.1	P16278	OTTHUMG00000155781	ENST00000399402.3:c.700T>A	3.37:g.33094985A>T	ENSP00000382333:p.Leu234Met	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R7H8|B7Z6B0|P16279	Missense_Mutation	SNP	pfam_Glycoside_Hdrlase_35,pfam_Glyco_hydro_42_N,superfamily_Glycoside_hydrolase_SF,superfamily_Galactose-bd-like,prints_Glycoside_Hdrlase_35	p.L312M	ENST00000399402.3	37	c.934	CCDS43062.1	3	.	.	.	.	.	.	.	.	.	.	A	18.08	3.543272	0.65198	.	.	ENSG00000170266	ENST00000399402;ENST00000307363;ENST00000445488;ENST00000307377;ENST00000415454	D;D;D;D;D	0.98362	-4.89;-4.89;-4.89;-4.89;-4.89	5.64	1.89	0.25635	Glycoside hydrolase, subgroup, catalytic domain (1);Glycoside hydrolase, superfamily (1);	0.000000	0.85682	D	0.000000	D	0.98713	0.9568	M	0.86953	2.85	0.58432	D	0.999995	D;D;D;D	0.89917	0.995;1.0;0.995;0.995	D;D;D;D	0.91635	0.961;0.999;0.961;0.972	D	0.98344	1.0540	10	0.66056	D	0.02	-21.7655	9.4123	0.38500	0.7915:0.0:0.2085:0.0	.	264;133;264;312	Q53G40;E7EQ29;P16278;B7Z6Q5	.;.;BGAL_HUMAN;.	M	234;264;312;133;105	ENSP00000382333:L234M;ENSP00000306920:L264M;ENSP00000393377:L312M;ENSP00000305920:L133M;ENSP00000411813:L105M	ENSP00000306920:L264M	L	-	1	2	GLB1	33069989	0.474000	0.25886	0.941000	0.38009	0.715000	0.41141	0.728000	0.26013	0.144000	0.18951	0.460000	0.39030	TTG	GLB1	-	pfam_Glycoside_Hdrlase_35,superfamily_Glycoside_hydrolase_SF		0.478	GLB1-002	NOVEL	basic|exp_conf|CCDS	protein_coding	GLB1	HGNC	protein_coding	OTTHUMT00000341570.2	A	NM_000404		33094985	-1	no_errors	ENST00000445488	ensembl	human	known	70_37	missense	SNP	0.974	T
GNB1	2782	genome.wustl.edu	37	1	1736005	1736005	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:1736005G>C	ENST00000378609.4	-	7	614	c.283C>G	c.(283-285)Ctg>Gtg	p.L95V		NM_001282539.1|NM_002074.3	NP_001269468.1|NP_002065.1	P62873	GBB1_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1	95					adenylate cyclase-activating dopamine receptor signaling pathway (GO:0007191)|blood coagulation (GO:0007596)|cellular response to catecholamine stimulus (GO:0071870)|cellular response to glucagon stimulus (GO:0071377)|cellular response to prostaglandin E stimulus (GO:0071380)|energy reserve metabolic process (GO:0006112)|G-protein coupled acetylcholine receptor signaling pathway (GO:0007213)|GTP catabolic process (GO:0006184)|phototransduction, visible light (GO:0007603)|platelet activation (GO:0030168)|Ras protein signal transduction (GO:0007265)|regulation of rhodopsin mediated signaling pathway (GO:0022400)|rhodopsin mediated signaling pathway (GO:0016056)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|synaptic transmission (GO:0007268)	extracellular vesicular exosome (GO:0070062)|heterotrimeric G-protein complex (GO:0005834)|intracellular (GO:0005622)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|photoreceptor disc membrane (GO:0097381)|plasma membrane (GO:0005886)|vesicle (GO:0031982)	GTPase activity (GO:0003924)|GTPase binding (GO:0051020)|protein complex binding (GO:0032403)|signal transducer activity (GO:0004871)			breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(3)|skin(1)	12	all_cancers(77;0.000708)|all_epithelial(69;0.000943)|all_lung(157;0.00963)|Lung NSC(156;0.0232)|Ovarian(185;0.0634)	all_epithelial(116;5.62e-19)|all_lung(118;2.3e-08)|Lung NSC(185;2.38e-06)|Renal(390;0.00183)|Breast(487;0.00354)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Medulloblastoma(700;0.123)|Lung SC(97;0.128)		Epithelial(90;1.14e-35)|OV - Ovarian serous cystadenocarcinoma(86;7.31e-23)|GBM - Glioblastoma multiforme(42;3.1e-07)|COAD - Colon adenocarcinoma(227;0.000323)|Colorectal(212;0.000374)|Kidney(185;0.00392)|BRCA - Breast invasive adenocarcinoma(365;0.00573)|STAD - Stomach adenocarcinoma(132;0.0072)|KIRC - Kidney renal clear cell carcinoma(229;0.0482)|Lung(427;0.236)		GAGGAGCGCAGAGGGATGGCG	0.468																																																	0													63.0	55.0	58.0					1																	1736005		2203	4300	6503	SO:0001583	missense	2782			BC004186	CCDS34.1, CCDS72685.1	1p36.33	2013-01-10			ENSG00000078369	ENSG00000078369		"""WD repeat domain containing"""	4396	protein-coding gene	gene with protein product		139380					Standard	NM_002074		Approved		uc001aif.3	P62873	OTTHUMG00000000940	ENST00000378609.4:c.283C>G	1.37:g.1736005G>C	ENSP00000367872:p.Leu95Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AJZ7|P04697|P04901|Q1RMY8	Missense_Mutation	SNP	pirsf_Guanine_nucleotide-bd_bsu,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Gprotein_B,prints_G-protein_beta_WD-40_rep,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L95V	ENST00000378609.4	37	c.283	CCDS34.1	1	.	.	.	.	.	.	.	.	.	.	g	12.92	2.083323	0.36758	.	.	ENSG00000078369	ENST00000378609;ENST00000378606;ENST00000434686;ENST00000439272;ENST00000437146	T;T;T;T	0.01323	5.01;5.01;5.01;5.01	5.5	4.58	0.56647	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);G-protein, beta subunit (1);	0.148730	0.46442	D	0.000298	T	0.04907	0.0132	M	0.84948	2.725	0.80722	D	1	P	0.38800	0.648	P	0.44561	0.453	T	0.23511	-1.0186	10	0.39692	T	0.17	0.0171	13.1456	0.59459	0.0764:0.0:0.9236:0.0	.	95	P62873	GBB1_HUMAN	V	95;95;95;82;95	ENSP00000367872:L95V;ENSP00000392765:L95V;ENSP00000399741:L82V;ENSP00000416651:L95V	ENSP00000367869:L95V	L	-	1	2	GNB1	1725865	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	3.877000	0.56123	1.331000	0.45412	0.645000	0.84053	CTG	GNB1	-	pirsf_Guanine_nucleotide-bd_bsu,superfamily_WD40_repeat_dom,smart_WD40_repeat,prints_Gprotein_B,pfscan_WD40_repeat_dom		0.468	GNB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB1	HGNC	protein_coding	OTTHUMT00000002762.3	G	NM_002074		1736005	-1	no_errors	ENST00000378606	ensembl	human	known	70_37	missense	SNP	1.000	C
GNB1L	54584	genome.wustl.edu	37	22	19776256	19776256	+	Silent	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:19776256G>T	ENST00000329517.6	-	8	1196	c.960C>A	c.(958-960)ctC>ctA	p.L320L	GNB1L_ENST00000403325.1_Silent_p.L320L|GNB1L_ENST00000405009.1_Intron|GNB1L_ENST00000460402.1_5'UTR	NM_053004.2	NP_443730.1	Q9BYB4	GNB1L_HUMAN	guanine nucleotide binding protein (G protein), beta polypeptide 1-like	320					G-protein coupled receptor signaling pathway (GO:0007186)|intracellular signal transduction (GO:0035556)|social behavior (GO:0035176)	cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)				breast(1)|kidney(1)|large_intestine(2)|lung(4)|prostate(3)|skin(1)	12	Colorectal(54;0.0993)					AGAGTGACCAGAGGCTGATCC	0.682																																																	0													53.0	50.0	51.0					22																	19776256		2203	4299	6502	SO:0001819	synonymous_variant	54584			AF238328	CCDS13768.1	22q11.2	2013-05-21			ENSG00000185838	ENSG00000185838		"""WD repeat domain containing"""	4397	protein-coding gene	gene with protein product		610778				11072084	Standard	NM_053004		Approved	GY2, WDR14	uc002zqf.1	Q9BYB4	OTTHUMG00000150279	ENST00000329517.6:c.960C>A	22.37:g.19776256G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H2S2|Q9H4M4	Silent	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L320	ENST00000329517.6	37	c.960	CCDS13768.1	22																																																																																			GNB1L	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.682	GNB1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GNB1L	HGNC	protein_coding	OTTHUMT00000075202.1	G			19776256	-1	no_errors	ENST00000329517	ensembl	human	known	70_37	silent	SNP	1.000	T
GPR179	440435	genome.wustl.edu	37	17	36484561	36484561	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:36484561C>T	ENST00000342292.4	-	11	4911	c.4891G>A	c.(4891-4893)Gat>Aat	p.D1631N	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1631					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				GCTGTGACATCTTCGATTTCC	0.517																																																	0													122.0	122.0	122.0					17																	36484561		1929	4131	6060	SO:0001583	missense	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.4891G>A	17.37:g.36484561C>T	ENSP00000345060:p.Asp1631Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.D1631N	ENST00000342292.4	37	c.4891	CCDS42308.1	17	.	.	.	.	.	.	.	.	.	.	C	14.38	2.519322	0.44866	.	.	ENSG00000188888	ENST00000342292	T	0.55234	0.53	4.83	3.86	0.44501	.	0.451542	0.18681	N	0.134178	T	0.50103	0.1596	L	0.44542	1.39	0.09310	N	1	D	0.57899	0.981	P	0.52109	0.69	T	0.33752	-0.9856	10	0.32370	T	0.25	-2.4533	6.9513	0.24546	0.0:0.7314:0.1754:0.0932	.	1631	Q6PRD1	GP179_HUMAN	N	1631	ENSP00000345060:D1631N	ENSP00000345060:D1631N	D	-	1	0	GPR179	33738087	0.082000	0.21442	0.016000	0.15963	0.039000	0.13416	2.641000	0.46587	1.388000	0.46506	0.655000	0.94253	GAT	GPR179	-	NULL		0.517	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	C			36484561	-1	no_errors	ENST00000342292	ensembl	human	known	70_37	missense	SNP	0.013	T
GPR179	440435	genome.wustl.edu	37	17	36484589	36484589	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:36484589C>T	ENST00000342292.4	-	11	4883	c.4863G>A	c.(4861-4863)gaG>gaA	p.E1621E	GPR179_ENST00000584976.1_5'Flank	NM_001004334.2	NP_001004334.2	Q6PRD1	GP179_HUMAN	G protein-coupled receptor 179	1621					visual perception (GO:0007601)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)			breast(4)|cervix(2)|endometrium(9)|kidney(3)|large_intestine(16)|lung(15)|ovary(4)|pancreas(1)|prostate(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	60	Breast(7;2.97e-12)	Breast(25;0.0101)|Ovarian(249;0.15)				CAGGCATTTTCTCCTTGTCCT	0.498																																																	0													134.0	133.0	133.0					17																	36484589		1926	4123	6049	SO:0001819	synonymous_variant	440435				CCDS42308.1	17q21.1	2014-05-06	2006-02-16	2006-02-16	ENSG00000188888	ENSG00000277399		"""GPCR / Class C : Orphans"""	31371	protein-coding gene	gene with protein product		614515	"""GPR158-like 1"", ""GPR179"""	GPR158L1			Standard	NM_001004334		Approved	CSNB1E	uc002hpz.3	Q6PRD1	OTTHUMG00000188545	ENST00000342292.4:c.4863G>A	17.37:g.36484589C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_GPCR_3_C,superfamily_Growth_fac_rcpt,pfscan_GPCR_3_C	p.E1621	ENST00000342292.4	37	c.4863	CCDS42308.1	17																																																																																			GPR179	-	NULL		0.498	GPR179-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR179	HGNC	protein_coding	OTTHUMT00000255329.2	C			36484589	-1	no_errors	ENST00000342292	ensembl	human	known	70_37	silent	SNP	0.683	T
HCK	3055	genome.wustl.edu	37	20	30681813	30681813	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr20:30681813C>T	ENST00000520553.1	+	11	1423	c.1177C>T	c.(1177-1179)Cgg>Tgg	p.R393W	HCK_ENST00000534862.1_Missense_Mutation_p.R394W|HCK_ENST00000375862.2_Missense_Mutation_p.R413W|HCK_ENST00000518730.1_Missense_Mutation_p.R392W|HCK_ENST00000538448.1_Missense_Mutation_p.R393W|HCK_ENST00000375852.2_Missense_Mutation_p.R414W	NM_001172129.1|NM_001172130.1|NM_001172131.1|NM_002110.3	NP_001165600.1|NP_001165601.1|NP_001165602.1|NP_002101.2	P08631	HCK_HUMAN	HCK proto-oncogene, Src family tyrosine kinase	414	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				cell adhesion (GO:0007155)|cytokine-mediated signaling pathway (GO:0019221)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|innate immune response-activating signal transduction (GO:0002758)|integrin-mediated signaling pathway (GO:0007229)|interferon-gamma-mediated signaling pathway (GO:0060333)|leukocyte degranulation (GO:0043299)|leukocyte migration involved in immune response (GO:0002522)|lipopolysaccharide-mediated signaling pathway (GO:0031663)|mesoderm development (GO:0007498)|negative regulation of apoptotic process (GO:0043066)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of actin cytoskeleton reorganization (GO:2000251)|positive regulation of actin filament polymerization (GO:0030838)|positive regulation of cell proliferation (GO:0008284)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cell shape (GO:0008360)|regulation of defense response to virus by virus (GO:0050690)|regulation of inflammatory response (GO:0050727)|regulation of phagocytosis (GO:0050764)|regulation of podosome assembly (GO:0071801)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|respiratory burst after phagocytosis (GO:0045728)|viral process (GO:0016032)	caveola (GO:0005901)|cell projection (GO:0042995)|cytoplasmic vesicle (GO:0031410)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extrinsic component of cytoplasmic side of plasma membrane (GO:0031234)|focal adhesion (GO:0005925)|Golgi apparatus (GO:0005794)|lysosome (GO:0005764)|nucleus (GO:0005634)	ATP binding (GO:0005524)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein tyrosine kinase activity (GO:0004713)	p.R393W(1)		NS(1)|central_nervous_system(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(18)|ovary(2)|pancreas(1)|prostate(2)|skin(4)	36			UCEC - Uterine corpus endometrioid carcinoma (5;0.0241)		Bosutinib(DB06616)	GTACACGGCTCGGGAAGGTAG	0.537																																																	1	Substitution - Missense(1)	prostate(1)											143.0	121.0	128.0					20																	30681813		2203	4300	6503	SO:0001583	missense	3055			AK026432	CCDS33460.1, CCDS54453.1, CCDS54455.1, CCDS54456.1	20q11-q12	2014-06-25	2014-06-25		ENSG00000101336	ENSG00000101336		"""SH2 domain containing"""	4840	protein-coding gene	gene with protein product		142370	"""hemopoietic cell kinase"""			3496523	Standard	NM_002110		Approved	JTK9	uc002wxh.3	P08631	OTTHUMG00000032204	ENST00000520553.1:c.1177C>T	20.37:g.30681813C>T	ENSP00000429848:p.Arg393Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1I1|B4DQB6|E1P5M2|Q29RX1|Q2VPE2|Q504R5|Q5T7K1|Q5T7K2|Q96CC0|Q9H5Y5|Q9NUA4|Q9UMJ5	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2,prints_SH3_domain	p.R414W	ENST00000520553.1	37	c.1240	CCDS54455.1	20	.	.	.	.	.	.	.	.	.	.	C	19.60	3.857119	0.71834	.	.	ENSG00000101336	ENST00000534862;ENST00000538448;ENST00000375862;ENST00000520553;ENST00000518730;ENST00000375852	D;D;D;D;D;D	0.83591	-1.74;-1.74;-1.74;-1.74;-1.74;-1.74	5.05	5.05	0.67936	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.64402	D	0.000001	D	0.89093	0.6617	M	0.68728	2.09	0.47949	D	0.999558	D;D	0.76494	0.999;0.999	D;D	0.72338	0.961;0.977	D	0.89672	0.3884	10	0.87932	D	0	.	12.6533	0.56774	0.1649:0.8351:0.0:0.0	.	392;414	P08631-3;P08631	.;HCK_HUMAN	W	394;393;413;393;392;414	ENSP00000444986:R394W;ENSP00000441169:R393W;ENSP00000365022:R413W;ENSP00000429848:R393W;ENSP00000427757:R392W;ENSP00000365012:R414W	ENSP00000365012:R414W	R	+	1	2	HCK	30145474	0.919000	0.31177	1.000000	0.80357	0.940000	0.58332	1.896000	0.39789	2.632000	0.89209	0.542000	0.68232	CGG	HCK	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.537	HCK-006	KNOWN	NAGNAG_splice_site|basic|appris_candidate|CCDS	protein_coding	HCK	HGNC	protein_coding	OTTHUMT00000375751.1	C			30681813	+1	no_errors	ENST00000375852	ensembl	human	known	70_37	missense	SNP	0.998	T
HCN1	348980	genome.wustl.edu	37	5	45645500	45645500	+	Silent	SNP	C	C	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr5:45645500C>A	ENST00000303230.4	-	2	693	c.636G>T	c.(634-636)gtG>gtT	p.V212V		NM_021072.3	NP_066550.2	O60741	HCN1_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 1	212					apical protein localization (GO:0045176)|cellular response to cAMP (GO:0071320)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|regulation of membrane potential (GO:0042391)|retinal cone cell development (GO:0046549)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	axon (GO:0030424)|dendrite (GO:0030425)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cAMP binding (GO:0030552)|intracellular cAMP activated cation channel activity (GO:0005222)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(3)|breast(4)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(21)|liver(1)|lung(98)|ovary(1)|prostate(7)|skin(4)|upper_aerodigestive_tract(3)|urinary_tract(5)	156						TCATCTTGATCACTTTGGGGT	0.378																																																	0													89.0	84.0	86.0					5																	45645500		2203	4300	6503	SO:0001819	synonymous_variant	348980			AF064876	CCDS3952.1	5p12	2011-07-05			ENSG00000164588	ENSG00000164588		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	4845	protein-coding gene	gene with protein product		602780		BCNG1		9405696, 9630217, 16382102	Standard	NM_021072		Approved	BCNG-1, HAC-2	uc003jok.3	O60741	OTTHUMG00000131155	ENST00000303230.4:c.636G>T	5.37:g.45645500C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.V212	ENST00000303230.4	37	c.636	CCDS3952.1	5																																																																																			HCN1	-	pfam_Ion_trans_dom		0.378	HCN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN1	HGNC	protein_coding	OTTHUMT00000253847.1	C	NM_021072		45645500	-1	no_errors	ENST00000303230	ensembl	human	known	70_37	silent	SNP	0.997	A
HCN4	10021	genome.wustl.edu	37	15	73614928	73614928	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr15:73614928C>T	ENST00000261917.3	-	8	4499	c.3506G>A	c.(3505-3507)gGg>gAg	p.G1169E		NM_005477.2	NP_005468.1	Q9Y3Q4	HCN4_HUMAN	hyperpolarization activated cyclic nucleotide-gated potassium channel 4	1169					blood circulation (GO:0008015)|cation transport (GO:0006812)|cellular response to cAMP (GO:0071320)|cellular response to cGMP (GO:0071321)|in utero embryonic development (GO:0001701)|muscle contraction (GO:0006936)|potassium ion transmembrane transport (GO:0071805)|regulation of heart rate (GO:0002027)|regulation of membrane potential (GO:0042391)|sodium ion transmembrane transport (GO:0035725)|synaptic transmission (GO:0007268)	integral component of plasma membrane (GO:0005887)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)|terminal bouton (GO:0043195)	cAMP binding (GO:0030552)|cation channel activity (GO:0005261)|identical protein binding (GO:0042802)|intracellular cAMP activated cation channel activity (GO:0005222)|voltage-gated potassium channel activity (GO:0005249)|voltage-gated sodium channel activity (GO:0005248)			NS(2)|biliary_tract(1)|breast(1)|endometrium(4)|kidney(1)|large_intestine(13)|liver(1)|lung(18)|ovary(6)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(1)	55				COAD - Colon adenocarcinoma(1;0.142)		GGCTCTTGCCCCAAACAAAGA	0.642																																																	0													23.0	24.0	24.0					15																	73614928		2197	4295	6492	SO:0001583	missense	10021			AJ132429	CCDS10248.1	15q24.1	2011-07-05			ENSG00000138622	ENSG00000138622		"""Voltage-gated ion channels / Cyclic nucleotide-regulated channels"""	16882	protein-coding gene	gene with protein product		605206				10228147, 10430953, 16382102	Standard	NM_005477		Approved		uc002avp.3	Q9Y3Q4	OTTHUMG00000137563	ENST00000261917.3:c.3506G>A	15.37:g.73614928C>T	ENSP00000261917:p.Gly1169Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UMQ7	Missense_Mutation	SNP	pfam_Ion_trans_N,pfam_cNMP-bd_dom,pfam_Ion_trans_dom,superfamily_cNMP-bd-like,smart_cNMP-bd_dom,pfscan_cNMP-bd_dom,prints_K_chnl_volt-dep_EAG/ELK/ERG	p.G1169E	ENST00000261917.3	37	c.3506	CCDS10248.1	15	.	.	.	.	.	.	.	.	.	.	C	10.50	1.367192	0.24771	.	.	ENSG00000138622	ENST00000261917	D	0.99304	-5.72	3.4	3.4	0.38934	.	.	.	.	.	D	0.97170	0.9075	L	0.40543	1.245	0.32081	N	0.593082	B	0.13594	0.008	B	0.15484	0.013	D	0.99013	1.0815	9	0.38643	T	0.18	.	7.9067	0.29765	0.0:0.8797:0.0:0.1203	.	1169	Q9Y3Q4	HCN4_HUMAN	E	1169	ENSP00000261917:G1169E	ENSP00000261917:G1169E	G	-	2	0	HCN4	71401981	1.000000	0.71417	0.986000	0.45419	0.014000	0.08584	2.483000	0.45233	1.717000	0.51406	0.442000	0.29010	GGG	HCN4	-	NULL		0.642	HCN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HCN4	HGNC	protein_coding	OTTHUMT00000268900.2	C	NM_005477		73614928	-1	no_errors	ENST00000261917	ensembl	human	known	70_37	missense	SNP	1.000	T
HIST1H2BG	8339	genome.wustl.edu	37	6	26216559	26216559	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:26216559C>T	ENST00000244601.3	-	1	313	c.313G>A	c.(313-315)Gga>Aga	p.G105R	HIST1H2AE_ENST00000303910.2_5'Flank	NM_003518.3	NP_003509.1	P62807	H2B1C_HUMAN	histone cluster 1, H2bg	105					antibacterial humoral response (GO:0019731)|chromatin organization (GO:0006325)|defense response to Gram-positive bacterium (GO:0050830)|innate immune response in mucosa (GO:0002227)|nucleosome assembly (GO:0006334)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|nucleoplasm (GO:0005654)|nucleosome (GO:0000786)|nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|large_intestine(1)|lung(3)|ovary(1)|prostate(1)|upper_aerodigestive_tract(1)	8		all_hematologic(11;0.196)				GCCAGCTCTCCGGGAAGCAGC	0.567																																																	0													93.0	93.0	93.0					6																	26216559		2203	4300	6503	SO:0001583	missense	8339			M60750	CCDS4594.1	6p21.3	2011-01-27	2006-10-11	2003-02-14	ENSG00000187990	ENSG00000273802		"""Histones / Replication-dependent"""	4746	protein-coding gene	gene with protein product		602798	"""H2B histone family, member A"", ""histone 1, H2bg"""	H2BFA		1916825, 12408966	Standard	NM_003518		Approved	H2B/a, H2B.1A	uc003ngz.2	P62807	OTTHUMG00000014446	ENST00000244601.3:c.313G>A	6.37:g.26216559C>T	ENSP00000244601:p.Gly105Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	P02278|Q3B872|Q4VB69|Q93078|Q93080	Missense_Mutation	SNP	pfam_Histone_core_D,pfam_CBFA_NFYB_domain,superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B	p.G105R	ENST00000244601.3	37	c.313	CCDS4594.1	6	.	.	.	.	.	.	.	.	.	.	.	16.71	3.199773	0.58126	.	.	ENSG00000187990	ENST00000244601	T	0.61742	0.08	3.89	3.89	0.44902	.	0.000000	0.33553	U	0.004795	T	0.64305	0.2586	.	.	.	0.44469	D	0.997406	.	.	.	.	.	.	T	0.70238	-0.4927	7	0.72032	D	0.01	.	15.3699	0.74554	0.0:1.0:0.0:0.0	.	.	.	.	R	105	ENSP00000244601:G105R	ENSP00000244601:G105R	G	-	1	0	HIST1H2BG	26324538	1.000000	0.71417	0.998000	0.56505	0.039000	0.13416	7.499000	0.81566	2.172000	0.68678	0.561000	0.74099	GGA	HIST1H2BG	-	superfamily_Histone-fold,smart_Histone_H2B,prints_Histone_H2B		0.567	HIST1H2BG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIST1H2BG	HGNC	protein_coding	OTTHUMT00000040109.2	C	NM_003518		26216559	-1	no_errors	ENST00000244601	ensembl	human	known	70_37	missense	SNP	1.000	T
HLA-C	3107	genome.wustl.edu	37	6	31239015	31239015	+	Nonsense_Mutation	SNP	C	C	A	rs281860484		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:31239015C>A	ENST00000376228.5	-	3	468	c.454G>T	c.(454-456)Gag>Tag	p.E152*	HLA-C_ENST00000383329.3_Nonsense_Mutation_p.E152*	NM_002117.5	NP_002108.4	Q95604	1C17_HUMAN	major histocompatibility complex, class I, C	152	Alpha-2.				antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-independent (GO:0002480)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytokine-mediated signaling pathway (GO:0019221)|interferon-gamma-mediated signaling pathway (GO:0060333)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|regulation of immune response (GO:0050776)|type I interferon signaling pathway (GO:0060337)|viral process (GO:0016032)	cell surface (GO:0009986)|early endosome membrane (GO:0031901)|endoplasmic reticulum (GO:0005783)|ER to Golgi transport vesicle membrane (GO:0012507)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|integral component of lumenal side of endoplasmic reticulum membrane (GO:0071556)|MHC class I protein complex (GO:0042612)|phagocytic vesicle membrane (GO:0030670)|plasma membrane (GO:0005886)	peptide antigen binding (GO:0042605)			central_nervous_system(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(2)|lung(4)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	17						CGCAGGTCCTCGTTCAGGGCG	0.692																																																	0													37.0	28.0	31.0					6																	31239015		2188	4258	6446	SO:0001587	stop_gained	3107			M11886	CCDS34393.1	6p21.3	2014-01-30			ENSG00000204525	ENSG00000204525		"""Histocompatibility complex"", ""Immunoglobulin superfamily / C1-set domain containing"""	4933	protein-coding gene	gene with protein product		142840	"""psoriasis susceptibility 1"""	HLA-JY3, D6S204, PSORS1		3863816, 16642438	Standard	NM_001243042		Approved		uc003nsy.3	P04222	OTTHUMG00000031154	ENST00000376228.5:c.454G>T	6.37:g.31239015C>A	ENSP00000365402:p.Glu152*	Somatic		WXS	Illumina HiSeq	Phase_IV	O02864|O02958|Q29643|Q9MY30	Nonsense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,pfam_MHC_I_a_C,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like,prints_MHC_I_a_a1/a2	p.E189*	ENST00000376228.5	37	c.565	CCDS34393.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	18.07|18.07	3.542100|3.542100	0.65198|0.65198	.|.	.|.	ENSG00000204525|ENSG00000204525	ENST00000376228;ENST00000383329;ENST00000396254;ENST00000539307|ENST00000415537	.|.	.|.	.|.	2.81|2.81	1.93|1.93	0.25924|0.25924	.|.	0.822880|.	0.09658|.	U|.	0.772841|.	.|T	.|0.20088	.|0.0483	.|.	.|.	.|.	0.80722|0.80722	A|A	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.09952	.|-1.0651	.|3	0.72032|.	D|.	0.01|.	.|.	4.9446|4.9446	0.13984|0.13984	0.0:0.7119:0.0:0.2881|0.0:0.7119:0.0:0.2881	.|.	.|.	.|.	.|.	X|L	152;152;152;189|151	.|.	ENSP00000365402:E152X|.	E|R	-|-	1|2	0|0	HLA-C|HLA-C	31346994|31346994	0.000000|0.000000	0.05858|0.05858	0.987000|0.987000	0.45799|0.45799	0.094000|0.094000	0.18550|0.18550	-0.373000|-0.373000	0.07494|0.07494	0.751000|0.751000	0.32900|0.32900	0.305000|0.305000	0.20034|0.20034	GAG|CGA	HLA-C	-	pfam_MHC_I_a_a1/a2,superfamily_MHC_I/II-like_Ag-recog,prints_MHC_I_a_a1/a2		0.692	HLA-C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HLA-C	HGNC	protein_coding	OTTHUMT00000076281.3	C	NM_002117		31239015	-1	no_errors	ENST00000539307	ensembl	human	known	70_37	nonsense	SNP	0.987	A
IFI27L1	122509	genome.wustl.edu	37	14	94568898	94568898	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr14:94568898C>T	ENST00000555523.1	+	5	518	c.299C>T	c.(298-300)tCa>tTa	p.S100L	IFI27L1_ENST00000556381.1_3'UTR|IFI27L1_ENST00000557218.1_Missense_Mutation_p.S46L|IFI27L1_ENST00000553664.1_3'UTR|IFI27L1_ENST00000557066.1_Missense_Mutation_p.S46L|IFI27L1_ENST00000554562.1_3'UTR|IFI27L1_ENST00000393115.3_Missense_Mutation_p.S100L|IFI27L1_ENST00000553350.1_Intron|IFI27L1_ENST00000554544.1_Missense_Mutation_p.S35L	NM_206949.2	NP_996832.1	Q96BM0	I27L1_HUMAN	interferon, alpha-inducible protein 27-like 1	100						integral component of membrane (GO:0016021)				lung(2)	2						TGGCTGGGTTCACCCCCTTCC	0.572																																																	0													57.0	56.0	57.0					14																	94568898		2203	4300	6503	SO:0001583	missense	122509			BC015423	CCDS9919.1	14q32.13	2008-10-08	2008-10-08	2008-10-08		ENSG00000165948			19754	protein-coding gene	gene with protein product		611320	"""family with sequence similarity 14, member B"""	FAM14B			Standard	NM_145249		Approved		uc001yck.3	Q96BM0		ENST00000555523.1:c.299C>T	14.37:g.94568898C>T	ENSP00000451851:p.Ser100Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Interferon-induced_6-16	p.S100L	ENST00000555523.1	37	c.299	CCDS9919.1	14	.	.	.	.	.	.	.	.	.	.	c	8.009	0.757187	0.15846	.	.	ENSG00000165948	ENST00000555523;ENST00000393115;ENST00000557218;ENST00000554544;ENST00000557066	T;T	0.35048	1.33;1.33	2.01	-4.03	0.04021	.	1.964930	0.04632	U	0.403751	T	0.18964	0.0455	N	0.17474	0.49	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.10683	-1.0619	10	0.66056	D	0.02	.	0.2435	0.00195	0.2579:0.2512:0.1492:0.3417	.	100	Q96BM0	I27L1_HUMAN	L	100;100;46;35;46	ENSP00000451851:S100L;ENSP00000376824:S100L	ENSP00000376824:S100L	S	+	2	0	IFI27L1	93638651	0.017000	0.18338	0.000000	0.03702	0.003000	0.03518	-0.564000	0.05936	-2.443000	0.00548	-0.359000	0.07587	TCA	IFI27L1	-	NULL		0.572	IFI27L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFI27L1	HGNC	protein_coding	OTTHUMT00000412868.1	C	NM_206949		94568898	+1	no_errors	ENST00000393115	ensembl	human	known	70_37	missense	SNP	0.000	T
ITM2B	9445	genome.wustl.edu	37	13	48830439	48830439	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr13:48830439G>A	ENST00000378565.5	+	3	576	c.373G>A	c.(373-375)Gaa>Aaa	p.E125K	ITM2B_ENST00000378549.5_Intron	NM_021999.4	NP_068839.1	Q9Y287	ITM2B_HUMAN	integral membrane protein 2B	125	Necessary for interaction with APP and inhibitor effects on APP processing.				extrinsic apoptotic signaling pathway in absence of ligand (GO:0097192)|negative regulation of amyloid precursor protein biosynthetic process (GO:0042985)|nervous system development (GO:0007399)	endosome (GO:0005768)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|Golgi-associated vesicle membrane (GO:0030660)|integral component of organelle membrane (GO:0031301)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|beta-amyloid binding (GO:0001540)			endometrium(1)|large_intestine(2)|lung(3)	6		all_cancers(8;2.2e-31)|all_epithelial(8;6.77e-15)|all_lung(13;9.67e-07)|all_hematologic(8;9.72e-06)|Lung NSC(96;8.3e-05)|Breast(56;0.000141)|Acute lymphoblastic leukemia(8;0.00045)|Prostate(109;0.000669)|Myeloproliferative disorder(33;0.039)|Hepatocellular(98;0.0556)|Lung SC(185;0.102)|Glioma(44;0.236)		GBM - Glioblastoma multiforme(144;1.97e-06)		CTTTGAAGAAGAAGAAGTTGA	0.398																																																	0													89.0	89.0	89.0					13																	48830439		2203	4300	6503	SO:0001583	missense	9445			AF092128	CCDS9409.1	13q14.2	2012-10-10			ENSG00000136156	ENSG00000136156		"""BRICHOS domain containing"""	6174	protein-coding gene	gene with protein product	"""BRICHOS domain containing 2B"""	603904				9795190	Standard	NM_021999		Approved	BRI, E25B, E3-16, BRICD2B	uc001vbz.3	Q9Y287	OTTHUMG00000016894	ENST00000378565.5:c.373G>A	13.37:g.48830439G>A	ENSP00000367828:p.Glu125Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W0A3|Q96B24|Q9NYH1	Missense_Mutation	SNP	pfam_BRICHOS_dom,pfscan_BRICHOS_dom	p.E125K	ENST00000378565.5	37	c.373	CCDS9409.1	13	.	.	.	.	.	.	.	.	.	.	G	20.2	3.952373	0.73787	.	.	ENSG00000136156	ENST00000378565	T	0.35789	1.29	5.76	5.76	0.90799	.	0.240677	0.48286	D	0.000198	T	0.42108	0.1188	M	0.71036	2.16	0.80722	D	1	B	0.27853	0.191	B	0.23275	0.045	T	0.28490	-1.0042	10	0.48119	T	0.1	-15.9585	18.9522	0.92644	0.0:0.0:1.0:0.0	.	125	Q9Y287	ITM2B_HUMAN	K	125	ENSP00000367828:E125K	ENSP00000367828:E125K	E	+	1	0	ITM2B	47728440	1.000000	0.71417	0.971000	0.41717	0.832000	0.47134	8.956000	0.93066	2.721000	0.93114	0.650000	0.86243	GAA	ITM2B	-	NULL		0.398	ITM2B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITM2B	HGNC	protein_coding	OTTHUMT00000044870.3	G	NM_021999		48830439	+1	no_errors	ENST00000378565	ensembl	human	known	70_37	missense	SNP	1.000	A
JUP	3728	genome.wustl.edu	37	17	39919565	39919565	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:39919565C>T	ENST00000393931.3	-	8	1285	c.1167G>A	c.(1165-1167)ctG>ctA	p.L389L	JUP_ENST00000393930.1_Silent_p.L389L|JUP_ENST00000540235.1_Intron|JUP_ENST00000310706.5_Silent_p.L389L	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	389					adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GCACACTCTCCAGGCCCTCCT	0.572																																					Colon(16;42 520 6044 17852 28530)												0													62.0	57.0	59.0					17																	39919565		2203	4300	6503	SO:0001819	synonymous_variant	3728			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.1167G>A	17.37:g.39919565C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.L389	ENST00000393931.3	37	c.1167	CCDS11407.1	17																																																																																			JUP	-	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo		0.572	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257406.1	C			39919565	-1	no_errors	ENST00000310706	ensembl	human	known	70_37	silent	SNP	1.000	T
JUP	3728	genome.wustl.edu	37	17	39925391	39925391	+	Silent	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:39925391C>G	ENST00000393931.3	-	4	655	c.537G>C	c.(535-537)ctG>ctC	p.L179L	JUP_ENST00000393930.1_Silent_p.L179L|JUP_ENST00000540235.1_Silent_p.L179L|JUP_ENST00000310706.5_Silent_p.L179L	NM_002230.2	NP_002221.1	P14923	PLAK_HUMAN	junction plakoglobin	179	Interaction with DSC1 and DSG1.				adherens junction organization (GO:0034332)|atrioventricular valve morphogenesis (GO:0003181)|bundle of His cell to Purkinje myocyte communication (GO:0086069)|cell junction assembly (GO:0034329)|cell migration (GO:0016477)|cell morphogenesis (GO:0000902)|cell-cell junction organization (GO:0045216)|cellular response to indole-3-methanol (GO:0071681)|cytoskeletal anchoring at plasma membrane (GO:0007016)|desmosome assembly (GO:0002159)|detection of mechanical stimulus (GO:0050982)|ectoderm development (GO:0007398)|endothelial cell-cell adhesion (GO:0071603)|establishment of protein localization to plasma membrane (GO:0090002)|gastrulation (GO:0007369)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of heart induction by canonical Wnt signaling pathway (GO:0003136)|negative regulation of Wnt signaling pathway involved in heart development (GO:0003308)|nervous system development (GO:0007399)|oocyte development (GO:0048599)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of protein import into nucleus (GO:0042307)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein heterooligomerization (GO:0051291)|regulation of cell proliferation (GO:0042127)|regulation of heart rate by cardiac conduction (GO:0086091)|single organismal cell-cell adhesion (GO:0016337)|skin development (GO:0043588)|ventricular cardiac muscle cell action potential (GO:0086005)	actin cytoskeleton (GO:0015629)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|catenin complex (GO:0016342)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|desmosome (GO:0030057)|extracellular vesicular exosome (GO:0070062)|fascia adherens (GO:0005916)|focal adhesion (GO:0005925)|gamma-catenin-TCF7L2 complex (GO:0071665)|intercalated disc (GO:0014704)|intermediate filament (GO:0005882)|lateral plasma membrane (GO:0016328)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein-DNA complex (GO:0032993)|Z disc (GO:0030018)|zonula adherens (GO:0005915)	alpha-catenin binding (GO:0045294)|cadherin binding (GO:0045296)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)|protein phosphatase binding (GO:0019903)|structural constituent of cell wall (GO:0005199)|structural molecule activity (GO:0005198)|transcription coactivator activity (GO:0003713)			breast(1)|central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(4)|lung(6)|ovary(3)|upper_aerodigestive_tract(1)	23		Breast(137;0.000162)	BRCA - Breast invasive adenocarcinoma(4;0.233)	BRCA - Breast invasive adenocarcinoma(366;0.15)		GCGAGCCCATCAGGGCCCGCC	0.657																																					Colon(16;42 520 6044 17852 28530)												0													37.0	36.0	36.0					17																	39925391		2203	4300	6503	SO:0001819	synonymous_variant	3728			AF233882	CCDS11407.1	17q21	2014-09-17	2004-08-09		ENSG00000173801	ENSG00000173801		"""Armadillo repeat containing"""	6207	protein-coding gene	gene with protein product		173325	"""catenin (cadherin-associated protein), gamma 80kDa"""	CTNNG		1889810, 7604000	Standard	NM_021991		Approved	DP3, PDGB, PKGB, DPIII	uc002hxs.2	P14923	OTTHUMG00000133494	ENST00000393931.3:c.537G>C	17.37:g.39925391C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15093|Q15151|Q7L3S5|Q86W21|Q9BWC4|Q9HCX9	Silent	SNP	pfam_Armadillo,superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin	p.L179	ENST00000393931.3	37	c.537	CCDS11407.1	17																																																																																			JUP	-	superfamily_ARM-type_fold,smart_Armadillo,pfscan_Armadillo,prints_Beta-catenin		0.657	JUP-008	KNOWN	basic|appris_principal|CCDS	protein_coding	JUP	HGNC	protein_coding	OTTHUMT00000257406.1	C			39925391	-1	no_errors	ENST00000310706	ensembl	human	known	70_37	silent	SNP	0.998	G
KANK1	23189	genome.wustl.edu	37	9	710904	710904	+	Silent	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr9:710904C>G	ENST00000382303.1	+	7	790	c.138C>G	c.(136-138)ctC>ctG	p.L46L	KANK1_ENST00000489369.1_3'UTR|KANK1_ENST00000382293.3_5'UTR|KANK1_ENST00000382297.2_Silent_p.L46L	NM_001256876.1	NP_001243805.1	Q14678	KANK1_HUMAN	KN motif and ankyrin repeat domains 1	46	Nuclear export signal 1 (NES 1).				negative regulation of actin filament polymerization (GO:0030837)|negative regulation of cell migration (GO:0030336)|negative regulation of insulin receptor signaling pathway (GO:0046627)|negative regulation of lamellipodium morphogenesis (GO:2000393)|negative regulation of neuron projection development (GO:0010977)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of ruffle assembly (GO:1900028)|negative regulation of substrate adhesion-dependent cell spreading (GO:1900025)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of Wnt signaling pathway (GO:0030177)|positive regulation of wound healing (GO:0090303)|regulation of establishment of cell polarity (GO:2000114)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)|ruffle membrane (GO:0032587)	beta-catenin binding (GO:0008013)			autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(8)|ovary(3)|pancreas(1)|prostate(3)|stomach(4)|upper_aerodigestive_tract(1)	43		Lung NSC(10;9.84e-12)|all_lung(10;1.02e-11)|Breast(48;0.128)		Epithelial(6;0.000153)|OV - Ovarian serous cystadenocarcinoma(1;0.000358)|Lung(218;0.0222)		TAGATTTCCTCAAATATGTGG	0.468																																																	0													90.0	89.0	90.0					9																	710904		2203	4300	6503	SO:0001819	synonymous_variant	23189			AL833161	CCDS6441.1, CCDS34976.1	9p24.3	2013-01-10	2008-01-29	2008-01-29	ENSG00000107104	ENSG00000107104		"""KN motif and ankyrin repeat domain containing"", ""Ankyrin repeat domain containing"""	19309	protein-coding gene	gene with protein product		607704	"""ankyrin repeat domain 15"""	ANKRD15		12133830, 17996375, 19554261	Standard	NM_015158		Approved	KIAA0172, KANK	uc003zgn.2	Q14678	OTTHUMG00000019434	ENST00000382303.1:c.138C>G	9.37:g.710904C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A2A2W8|D3DRH3|Q5W0W0|Q8IY65|Q8WX74	Silent	SNP	pfam_Ankyrin_rpt,pfam_KN_motif,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.L46	ENST00000382303.1	37	c.138	CCDS34976.1	9																																																																																			KANK1	-	pfam_KN_motif		0.468	KANK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KANK1	HGNC	protein_coding	OTTHUMT00000051484.2	C	NM_015158		710904	+1	no_errors	ENST00000382297	ensembl	human	known	70_37	silent	SNP	1.000	G
KCNN4	3783	genome.wustl.edu	37	19	44278346	44278346	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr19:44278346C>T	ENST00000262888.3	-	3	1076	c.681G>A	c.(679-681)gaG>gaA	p.E227E		NM_002250.2	NP_002241.1	O15554	KCNN4_HUMAN	potassium intermediate/small conductance calcium-activated channel, subfamily N, member 4	227					calcium ion transport (GO:0006816)|cell volume homeostasis (GO:0006884)|defense response (GO:0006952)|immune system process (GO:0002376)|phospholipid translocation (GO:0045332)|positive regulation of protein secretion (GO:0050714)|positive regulation of T cell receptor signaling pathway (GO:0050862)|potassium ion export (GO:0071435)|potassium ion transmembrane transport (GO:0071805)|potassium ion transport (GO:0006813)|saliva secretion (GO:0046541)|stabilization of membrane potential (GO:0030322)|synaptic transmission (GO:0007268)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|membrane raft (GO:0045121)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|calmodulin binding (GO:0005516)|Intermediate conductance calcium-activated potassium channel activity (GO:0022894)|protein phosphatase binding (GO:0019903)			biliary_tract(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|prostate(1)|upper_aerodigestive_tract(1)	15		Prostate(69;0.0352)			Clotrimazole(DB00257)|Enflurane(DB00228)|Halothane(DB01159)|Miconazole(DB01110)|Procaine(DB00721)|Quinine(DB00468)	ACCCTCACCTCTCGGCCACGG	0.677											OREG0025535	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													15.0	17.0	17.0					19																	44278346		2194	4293	6487	SO:0001819	synonymous_variant	3783			AF022797	CCDS12630.1	19q13.2	2012-07-05				ENSG00000104783		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	6293	protein-coding gene	gene with protein product		602754				9380751, 9407042, 16382103	Standard	NM_002250		Approved	KCa3.1, hSK4, hKCa4, hIKCa1	uc002oxl.3	O15554		ENST00000262888.3:c.681G>A	19.37:g.44278346C>T		Somatic	922	WXS	Illumina HiSeq	Phase_IV	Q53XR4	Silent	SNP	pfam_K_chnl_Ca-activ_SK,pfam_CaM-bd_dom,pfam_Ion_trans_2,superfamily_CaM-bd_dom	p.E227	ENST00000262888.3	37	c.681	CCDS12630.1	19																																																																																			KCNN4	-	pfam_Ion_trans_2		0.677	KCNN4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KCNN4	HGNC	protein_coding	OTTHUMT00000463598.1	C	NM_002250		44278346	-1	no_errors	ENST00000262888	ensembl	human	known	70_37	silent	SNP	1.000	T
KHDC3L	154288	genome.wustl.edu	37	6	74072594	74072594	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:74072594G>A	ENST00000370367.3	+	1	195	c.142G>A	c.(142-144)Gag>Aag	p.E48K		NM_001017361.2	NP_001017361.1	Q587J8	KHD3L_HUMAN	KH domain containing 3-like, subcortical maternal complex member	48	KH; atypical.						RNA binding (GO:0003723)										AGTTCGCCTTGAGGTTTGGCT	0.557																																																	0													96.0	95.0	96.0					6																	74072594		2203	4300	6503	SO:0001583	missense	154288			AB211062	CCDS34484.1	6q13	2012-06-25	2012-06-25	2012-06-25	ENSG00000203908	ENSG00000203908			33699	protein-coding gene	gene with protein product	"""ES cell associated transcript 1"""	611687	"""chromosome 6 open reading frame 221"""	C6orf221		21885028	Standard	NM_001017361		Approved	ECAT1	uc003pgt.4	Q587J8	OTTHUMG00000015024	ENST00000370367.3:c.142G>A	6.37:g.74072594G>A	ENSP00000359392:p.Glu48Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNW7	Missense_Mutation	SNP	NULL	p.E48K	ENST00000370367.3	37	c.142	CCDS34484.1	6	.	.	.	.	.	.	.	.	.	.	G	14.97	2.694843	0.48202	.	.	ENSG00000203908	ENST00000370367	T	0.42131	0.98	3.53	2.66	0.31614	.	0.000000	0.44902	D	0.000412	T	0.42086	0.1187	M	0.62723	1.935	0.26589	N	0.973232	D	0.71674	0.998	D	0.73380	0.98	T	0.16276	-1.0408	10	0.87932	D	0	-42.4705	6.9721	0.24654	0.1244:0.0:0.8756:0.0	.	48	Q587J8	ECAT1_HUMAN	K	48	ENSP00000359392:E48K	ENSP00000359392:E48K	E	+	1	0	C6orf221	74129315	0.969000	0.33509	0.525000	0.27900	0.367000	0.29736	2.490000	0.45294	1.083000	0.41159	0.561000	0.74099	GAG	KHDC3L	-	NULL		0.557	KHDC3L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KHDC3L	HGNC	protein_coding	OTTHUMT00000041202.3	G	NM_001017361		74072594	+1	no_errors	ENST00000370367	ensembl	human	known	70_37	missense	SNP	0.528	A
KIAA0232	9778	genome.wustl.edu	37	4	6862786	6862786	+	Missense_Mutation	SNP	A	A	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr4:6862786A>G	ENST00000307659.5	+	7	1132	c.677A>G	c.(676-678)aAc>aGc	p.N226S	KIAA0232_ENST00000425103.1_Missense_Mutation_p.N226S	NM_014743.2	NP_055558.2	Q92628	K0232_HUMAN	KIAA0232	226							ATP binding (GO:0005524)			breast(2)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(10)|lung(12)|ovary(2)|prostate(4)|skin(1)|urinary_tract(1)	41						AAGGACTGCAACAGTGAAAGT	0.443																																																	0													107.0	108.0	108.0					4																	6862786		2005	4191	6196	SO:0001583	missense	9778			D86985	CCDS43209.1	4p16.1	2012-11-29			ENSG00000170871	ENSG00000170871			28992	protein-coding gene	gene with protein product						9039502	Standard	NM_014743		Approved		uc003gjq.4	Q92628	OTTHUMG00000160072	ENST00000307659.5:c.677A>G	4.37:g.6862786A>G	ENSP00000303928:p.Asn226Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2D2	Missense_Mutation	SNP	NULL	p.N226S	ENST00000307659.5	37	c.677	CCDS43209.1	4	.	.	.	.	.	.	.	.	.	.	A	14.14	2.446172	0.43429	.	.	ENSG00000170871	ENST00000425103;ENST00000307659	.	.	.	5.53	4.35	0.52113	.	0.092458	0.64402	D	0.000001	T	0.35451	0.0932	N	0.24115	0.695	0.36440	D	0.865438	B	0.24823	0.112	B	0.20955	0.032	T	0.35151	-0.9800	9	0.59425	D	0.04	-3.1755	7.0656	0.25149	0.7967:0.0:0.0717:0.1316	.	226	Q92628	K0232_HUMAN	S	226	.	ENSP00000303928:N226S	N	+	2	0	KIAA0232	6913687	1.000000	0.71417	0.993000	0.49108	0.973000	0.67179	3.144000	0.50616	0.940000	0.37473	0.533000	0.62120	AAC	KIAA0232	-	NULL		0.443	KIAA0232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0232	HGNC	protein_coding	OTTHUMT00000359102.2	A	NM_014743		6862786	+1	no_errors	ENST00000307659	ensembl	human	known	70_37	missense	SNP	1.000	G
LAMA5	3911	genome.wustl.edu	37	20	60893630	60893631	+	Frame_Shift_Ins	INS	-	-	CGGT	rs148907937	byFrequency	TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr20:60893630_60893631insCGGT	ENST00000252999.3	-	53	7184_7185	c.7118_7119insACCG	c.(7117-7119)cggfs	p.-2373fs		NM_005560.3	NP_005551.3	O15230	LAMA5_HUMAN	laminin, alpha 5						angiogenesis (GO:0001525)|branching involved in salivary gland morphogenesis (GO:0060445)|branching involved in ureteric bud morphogenesis (GO:0001658)|cell differentiation (GO:0030154)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cell recognition (GO:0008037)|cilium assembly (GO:0042384)|cytoskeleton organization (GO:0007010)|embryo development (GO:0009790)|endothelial cell differentiation (GO:0045446)|establishment of protein localization to plasma membrane (GO:0090002)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|focal adhesion assembly (GO:0048041)|hair follicle development (GO:0001942)|integrin-mediated signaling pathway (GO:0007229)|lung development (GO:0030324)|morphogenesis of a polarized epithelium (GO:0001738)|morphogenesis of embryonic epithelium (GO:0016331)|muscle organ development (GO:0007517)|neural crest cell migration (GO:0001755)|odontogenesis of dentin-containing tooth (GO:0042475)|regulation of cell adhesion (GO:0030155)|regulation of cell migration (GO:0030334)|regulation of cell proliferation (GO:0042127)|regulation of embryonic development (GO:0045995)|substrate adhesion-dependent cell spreading (GO:0034446)	basal lamina (GO:0005605)|basement membrane (GO:0005604)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|laminin-1 complex (GO:0005606)|laminin-10 complex (GO:0043259)|laminin-11 complex (GO:0043260)|laminin-5 complex (GO:0005610)|nucleus (GO:0005634)	integrin binding (GO:0005178)|structural molecule activity (GO:0005198)			breast(2)|central_nervous_system(3)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(3)|kidney(7)|lung(40)|ovary(1)|pancreas(1)|prostate(3)|skin(6)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	81	Breast(26;1.57e-08)		BRCA - Breast invasive adenocarcinoma(19;4.36e-06)			GCTGGGCCAGCCGGTCGCGGGT	0.688																																																	0																																										SO:0001589	frameshift_variant	3911			AF443072	CCDS33502.1	20q13.2-q13.3	2013-03-01			ENSG00000130702	ENSG00000130702		"""Laminins"""	6485	protein-coding gene	gene with protein product		601033				9271224	Standard	NM_005560		Approved		uc002ycq.3	O15230	OTTHUMG00000032908	ENST00000252999.3:c.7115_7118dupACCG	20.37:g.60893631_60893634dupCGGT	ENSP00000252999:p.Arg2373fs	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8TDF8|Q8WZA7|Q9H1P1	Frame_Shift_Ins	INS	pfam_EGF_laminin,pfam_Laminin_I,pfam_Laminin_G,pfam_Laminin_N,pfam_Laminin_II,pfam_Laminin_B_type_IV,superfamily_ConA-like_lec_gl_sf,superfamily_Galactose-bd-like,smart_Laminin_N,smart_EGF_laminin,smart_EG-like_dom,smart_Laminin_B_subgr,smart_Laminin_G,pfscan_Laminin_B_type_IV,pfscan_EGF_laminin,pfscan_Laminin_G,pfscan_Laminin_N,pfscan_TNFR/NGFR_Cys_rich_reg	p.L2374fs	ENST00000252999.3	37	c.7119_7118	CCDS33502.1	20																																																																																			LAMA5	-	pfam_Laminin_I		0.688	LAMA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LAMA5	HGNC	protein_coding	OTTHUMT00000080014.2	-	NM_005560		60893631	-1	no_errors	ENST00000252999	ensembl	human	known	70_37	frame_shift_ins	INS	0.657:0.009	CGGT
LEF1	51176	genome.wustl.edu	37	4	109000667	109000667	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr4:109000667C>T	ENST00000265165.1	-	7	1480	c.826G>A	c.(826-828)Gac>Aac	p.D276N	LEF1_ENST00000510624.1_Missense_Mutation_p.D180N|LEF1_ENST00000503879.1_5'Flank|LEF1_ENST00000438313.2_Missense_Mutation_p.D248N|LEF1_ENST00000379951.2_Missense_Mutation_p.D248N	NM_016269.4	NP_057353.1	Q9UJU2	LEF1_HUMAN	lymphoid enhancer-binding factor 1	276					alpha-beta T cell differentiation (GO:0046632)|anatomical structure regression (GO:0060033)|apoptotic process involved in morphogenesis (GO:0060561)|apoptotic process involved in patterning of blood vessels (GO:1902262)|B cell proliferation (GO:0042100)|BMP signaling pathway (GO:0030509)|canonical Wnt signaling pathway (GO:0060070)|cell chemotaxis (GO:0060326)|cellular response to cytokine stimulus (GO:0071345)|cellular response to interleukin-4 (GO:0071353)|chorio-allantoic fusion (GO:0060710)|dentate gyrus development (GO:0021542)|embryonic limb morphogenesis (GO:0030326)|epithelial to mesenchymal transition (GO:0001837)|eye pigmentation (GO:0048069)|face morphogenesis (GO:0060325)|forebrain neuroblast division (GO:0021873)|forebrain neuron differentiation (GO:0021879)|forebrain radial glial cell differentiation (GO:0021861)|formation of radial glial scaffolds (GO:0021943)|histone H3 acetylation (GO:0043966)|histone H4 acetylation (GO:0043967)|hypothalamus development (GO:0021854)|mammary gland development (GO:0030879)|muscle fiber development (GO:0048747)|negative regulation of apoptotic process (GO:0043066)|negative regulation of apoptotic process in bone marrow (GO:0071866)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell-cell adhesion (GO:0022408)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of DNA binding (GO:0043392)|negative regulation of estrogen receptor binding (GO:0071899)|negative regulation of interleukin-13 production (GO:0032696)|negative regulation of interleukin-4 production (GO:0032713)|negative regulation of interleukin-5 production (GO:0032714)|negative regulation of striated muscle tissue development (GO:0045843)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|neural crest cell migration (GO:0001755)|neutrophil differentiation (GO:0030223)|odontoblast differentiation (GO:0071895)|odontogenesis of dentin-containing tooth (GO:0042475)|osteoblast differentiation (GO:0001649)|palate development (GO:0060021)|paraxial mesoderm formation (GO:0048341)|patterning of blood vessels (GO:0001569)|positive regulation by host of viral transcription (GO:0043923)|positive regulation of cell cycle process (GO:0090068)|positive regulation of cell growth (GO:0030307)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of cell proliferation in bone marrow (GO:0071864)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of gene expression (GO:0010628)|positive regulation of granulocyte differentiation (GO:0030854)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of cell-cell adhesion (GO:0022407)|regulation of striated muscle tissue development (GO:0016202)|sensory perception of taste (GO:0050909)|somitogenesis (GO:0001756)|sprouting angiogenesis (GO:0002040)|steroid hormone mediated signaling pathway (GO:0043401)|T cell receptor V(D)J recombination (GO:0033153)|T-helper 1 cell differentiation (GO:0045063)|tongue development (GO:0043586)|trachea gland development (GO:0061153)|transcription from RNA polymerase II promoter (GO:0006366)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|protein-DNA complex (GO:0032993)|transcription factor complex (GO:0005667)	armadillo repeat domain binding (GO:0070016)|beta-catenin binding (GO:0008013)|C2H2 zinc finger domain binding (GO:0070742)|chromatin binding (GO:0003682)|cysteine-type endopeptidase inhibitor activity involved in apoptotic process (GO:0043027)|DNA binding (GO:0003677)|DNA binding, bending (GO:0008301)|enhancer binding (GO:0035326)|estrogen receptor activity (GO:0030284)|estrogen receptor binding (GO:0030331)|gamma-catenin binding (GO:0045295)|histone binding (GO:0042393)|RNA polymerase II core promoter proximal region sequence-specific DNA binding (GO:0000978)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity (GO:0003705)|RNA polymerase II regulatory region sequence-specific DNA binding (GO:0000977)|RNA polymerase II transcription regulatory region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001228)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region DNA binding (GO:0044212)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(14)|prostate(1)|urinary_tract(1)	25				OV - Ovarian serous cystadenocarcinoma(123;0.000224)		AGGTCACTGTCAGTGTGGGGA	0.502																																																	0													285.0	226.0	246.0					4																	109000667		2203	4300	6503	SO:0001583	missense	51176				CCDS3679.1, CCDS47122.1, CCDS47123.1, CCDS54791.1	4q23-q25	2011-07-08			ENSG00000138795	ENSG00000138795			6551	protein-coding gene	gene with protein product		153245				1783375	Standard	NM_016269		Approved	TCF1ALPHA, TCF10, TCF7L3	uc003hyt.2	Q9UJU2	OTTHUMG00000131809	ENST00000265165.1:c.826G>A	4.37:g.109000667C>T	ENSP00000265165:p.Asp276Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DG38|B7Z8E2|E9PDK3|Q3ZCU4|Q9HAZ0	Missense_Mutation	SNP	pfam_CTNNB1-bd_N,pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.D276N	ENST00000265165.1	37	c.826	CCDS3679.1	4	.	.	.	.	.	.	.	.	.	.	C	21.9	4.214002	0.79352	.	.	ENSG00000138795	ENST00000265165;ENST00000379951;ENST00000438313;ENST00000510624	D;D;D;D	0.99226	-5.57;-5.56;-5.57;-5.59	5.61	5.61	0.85477	.	0.043155	0.85682	D	0.000000	D	0.98473	0.9491	N	0.14661	0.345	0.80722	D	1	P;B;P;D;B	0.61080	0.734;0.18;0.557;0.989;0.007	B;B;B;P;B	0.61800	0.239;0.112;0.172;0.894;0.009	D	0.99886	1.1124	10	0.46703	T	0.11	-15.8545	19.6476	0.95789	0.0:1.0:0.0:0.0	.	180;133;248;248;276	E9PDK3;B4DZY5;Q9UJU2-6;Q9UJU2-5;Q9UJU2	.;.;.;.;LEF1_HUMAN	N	276;248;248;180	ENSP00000265165:D276N;ENSP00000369284:D248N;ENSP00000406176:D248N;ENSP00000422840:D180N	ENSP00000265165:D276N	D	-	1	0	LEF1	109220116	0.999000	0.42202	0.997000	0.53966	0.996000	0.88848	3.694000	0.54742	2.653000	0.90120	0.655000	0.94253	GAC	LEF1	-	NULL		0.502	LEF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LEF1	HGNC	protein_coding	OTTHUMT00000254749.2	C			109000667	-1	no_errors	ENST00000265165	ensembl	human	known	70_37	missense	SNP	1.000	T
LINC00083	400797	genome.wustl.edu	37	1	178464055	178464055	+	RNA	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:178464055C>G	ENST00000445098.2	-	0	2274							Q6ZU45	YA021_HUMAN	long intergenic non-protein coding RNA 83								carbohydrate binding (GO:0030246)										CCCGCCCACTCTGCACTTCGC	0.617																																																	0																																												400797			AK125993		1q25.2	2012-10-12	2011-08-11	2011-08-11	ENSG00000188585	ENSG00000188585		"""Long non-coding RNAs"""	34521	non-coding RNA	RNA, long non-coding			"""non-protein coding RNA 83"""	NCRNA00083			Standard	XR_248661		Approved	FLJ44005, RP4-593C16.2		Q6ZU45	OTTHUMG00000035021		1.37:g.178464055C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000445098.2	37	NULL		1																																																																																			LINC00083	-	-		0.617	LINC00083-002	KNOWN	basic	processed_transcript	LINC00083	HGNC	processed_transcript	OTTHUMT00000467411.1	C	XR_040317		178464055	-1	no_errors	ENST00000445098	ensembl	human	known	70_37	rna	SNP	0.000	G
TAP1	6890	genome.wustl.edu	37	6	32813284	32813284	+	3'UTR	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:32813284C>G	ENST00000354258.4	-	0	2660				PSMB8_ENST00000374881.2_5'Flank|PSMB8_ENST00000395339.3_5'Flank|TAPSAR1_ENST00000453426.1_lincRNA|PSMB8_ENST00000374882.3_5'Flank|TAP1_ENST00000425148.2_3'UTR|PSMB9_ENST00000395330.1_Intron	NM_000593.5	NP_000584.2	Q03518	TAP1_HUMAN	transporter 1, ATP-binding cassette, sub-family B (MDR/TAP)						antigen processing and presentation of endogenous peptide antigen via MHC class I (GO:0019885)|antigen processing and presentation of exogenous peptide antigen via MHC class I (GO:0042590)|antigen processing and presentation of exogenous peptide antigen via MHC class I, TAP-dependent (GO:0002479)|antigen processing and presentation of peptide antigen via MHC class I (GO:0002474)|cytosol to ER transport (GO:0046967)|defense response (GO:0006952)|intracellular transport of viral protein in host cell (GO:0019060)|peptide transport (GO:0015833)|transmembrane transport (GO:0055085)	endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)|mitochondrion (GO:0005739)|TAP complex (GO:0042825)	ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|MHC class Ib protein binding (GO:0023029)|peptide antigen binding (GO:0042605)|peptide transporter activity (GO:0015197)|protein homodimerization activity (GO:0042803)|TAP1 binding (GO:0046978)|TAP2 binding (GO:0046979)			breast(2)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(4)|prostate(1)|skin(1)	21					Lapatinib(DB01259)	GCTGCCTACTCTGCAGCTGTG	0.512																																																	0																																										SO:0001624	3_prime_UTR_variant	100507463				CCDS4758.1	6p21.3	2014-09-17			ENSG00000168394	ENSG00000168394		"""ATP binding cassette transporters / subfamily B"""	43	protein-coding gene	gene with protein product		170260		ABCB2		1529427, 1946428	Standard	NM_000593		Approved	PSF1, RING4, D6S114E	uc003ocg.3	Q03518	OTTHUMG00000031067	ENST00000354258.4:c.*72G>C	6.37:g.32813284C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q16149|Q96CP4	RNA	SNP	-	NULL	ENST00000354258.4	37	NULL	CCDS4758.1	6																																																																																			XXbac-BPG246D15.8	-	-		0.512	TAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LOC100507463	Clone_based_vega_gene	protein_coding	OTTHUMT00000076087.2	C	NM_000593		32813284	+1	no_errors	ENST00000412095	ensembl	human	known	70_37	rna	SNP	0.000	G
LOC643406	643406	genome.wustl.edu	37	20	5454497	5454497	+	lincRNA	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr20:5454497C>T	ENST00000430097.2	+	0	505					NR_029405.1																						GCCCAGCTATCTGCAGGCGAA	0.527																																																	0																																												643406																															20.37:g.5454497C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000430097.2	37	NULL		20																																																																																			RP5-828H9.1	-	-		0.527	RP5-828H9.1-001	KNOWN	basic	lincRNA	LOC643406	Clone_based_vega_gene	lincRNA	OTTHUMT00000077864.1	C			5454497	+1	no_errors	ENST00000430097	ensembl	human	known	70_37	rna	SNP	0.000	T
LRRC41	10489	genome.wustl.edu	37	1	46764081	46764081	+	Intron	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:46764081C>T	ENST00000343304.6	-	2	485				LRRC41_ENST00000472710.1_5'UTR	NM_006369.4	NP_006360.3	Q15345	LRC41_HUMAN	leucine rich repeat containing 41						protein ubiquitination (GO:0016567)	membrane (GO:0016020)				breast(2)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(7)|ovary(3)|pancreas(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	28	Acute lymphoblastic leukemia(166;0.155)					TTCCTCCCCTCCCCCTCCCAC	0.418																																																	0													33.0	37.0	36.0					1																	46764081		2201	4300	6501	SO:0001627	intron_variant	10489			AK024051	CCDS533.1	1p34.1	2008-02-05			ENSG00000132128	ENSG00000132128			16917	protein-coding gene	gene with protein product						11384984	Standard	XM_005270376		Approved	MUF1	uc001cpn.3	Q15345	OTTHUMG00000007810	ENST00000343304.6:c.200-39G>A	1.37:g.46764081C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5G8|Q3MJ96|Q5TDF5|Q71RA8|Q9BSM0	RNA	SNP	-	NULL	ENST00000343304.6	37	NULL	CCDS533.1	1																																																																																			LRRC41	-	-		0.418	LRRC41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRRC41	HGNC	protein_coding	OTTHUMT00000021438.1	C	NM_006369		46764081	-1	no_errors	ENST00000469150	ensembl	human	known	70_37	rna	SNP	0.001	T
LRRIQ1	84125	genome.wustl.edu	37	12	85517847	85517847	+	Splice_Site	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:85517847G>C	ENST00000393217.2	+	17	3618		c.e17-1			NM_001079910.1	NP_001073379.1	Q96JM4	LRIQ1_HUMAN	leucine-rich repeats and IQ motif containing 1											breast(1)|central_nervous_system(1)|cervix(1)|endometrium(6)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(21)|liver(1)|lung(28)|ovary(5)|prostate(1)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)	83				GBM - Glioblastoma multiforme(134;0.212)		TATTTGTTCAGAGATGTATTT	0.318																																																	0													36.0	38.0	37.0					12																	85517847		2203	4300	6503	SO:0001630	splice_region_variant	84125			AK022365	CCDS41816.1	12q21	2008-02-05			ENSG00000133640	ENSG00000133640			25708	protein-coding gene	gene with protein product						11347906	Standard	NM_001079910		Approved	FLJ12303, KIAA1801	uc001tac.3	Q96JM4	OTTHUMG00000166185	ENST00000393217.2:c.3558-1G>C	12.37:g.85517847G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q567P4|Q9BS17|Q9HA36	Splice_Site	SNP	-	e16-1	ENST00000393217.2	37	c.3558-1	CCDS41816.1	12	.	.	.	.	.	.	.	.	.	.	G	10.20	1.284489	0.23392	.	.	ENSG00000133640	ENST00000256007;ENST00000378580;ENST00000393217	.	.	.	5.28	4.38	0.52667	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	14.3927	0.66991	0.0:0.1474:0.8526:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	LRRIQ1	84041978	1.000000	0.71417	0.167000	0.22817	0.274000	0.26718	6.480000	0.73604	1.219000	0.43474	0.585000	0.79938	.	LRRIQ1	-	-		0.318	LRRIQ1-004	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	LRRIQ1	HGNC	protein_coding	OTTHUMT00000388249.2	G	NM_032165	Intron	85517847	+1	no_errors	ENST00000393217	ensembl	human	known	70_37	splice_site	SNP	0.866	C
LTN1	26046	genome.wustl.edu	37	21	30329098	30329098	+	Missense_Mutation	SNP	T	T	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr21:30329098T>A	ENST00000361371.5	-	16	3144	c.3065A>T	c.(3064-3066)gAg>gTg	p.E1022V	LTN1_ENST00000389194.2_Missense_Mutation_p.E1068V			O94822	LTN1_HUMAN	listerin E3 ubiquitin protein ligase 1	1022					protein ubiquitination (GO:0016567)		ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|central_nervous_system(1)|endometrium(4)|kidney(5)|large_intestine(12)|lung(19)|ovary(5)|pancreas(1)|prostate(2)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)	60						TTTCTCAAGCTCATTATTTTC	0.294																																																	0													54.0	48.0	50.0					21																	30329098		2199	4294	6493	SO:0001583	missense	26046			AK001915	CCDS33527.1, CCDS33527.2	21q21.3	2013-01-09	2010-09-17	2010-09-17	ENSG00000198862	ENSG00000198862		"""RING-type (C3HC4) zinc fingers"""	13082	protein-coding gene	gene with protein product	"""listerin"""	613083	"""chromosome 21 open reading frame 98"", ""zinc finger protein 294"", ""ring finger protein 160"""	C21orf98, C21orf10, ZNF294, RNF160		20835226, 19196968	Standard	NM_015565		Approved	KIAA0714, FLJ11053, LISTERIN	uc002ymr.2	O94822	OTTHUMG00000078803	ENST00000361371.5:c.3065A>T	21.37:g.30329098T>A	ENSP00000354977:p.Glu1022Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL41|A7E2D0|B2RTS0|C9J7U3|J3KPL4|Q05C47|Q9H8M4|Q9NUY5|Q9P0E9	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,superfamily_ARM-type_fold,smart_Znf_RING-CH,pfscan_Znf_RING	p.E1022V	ENST00000361371.5	37	c.3065		21	.	.	.	.	.	.	.	.	.	.	T	11.38	1.620958	0.28889	.	.	ENSG00000198862	ENST00000389194;ENST00000361371	T;T	0.19669	2.13;2.14	5.1	3.94	0.45596	.	0.257704	0.38272	N	0.001758	T	0.11793	0.0287	N	0.14661	0.345	0.25297	N	0.989314	B	0.06786	0.001	B	0.04013	0.001	T	0.19778	-1.0295	10	0.34782	T	0.22	.	9.2614	0.37614	0.1885:0.0:0.0:0.8115	.	1022	O94822	LTN1_HUMAN	V	1068;1022	ENSP00000373846:E1068V;ENSP00000354977:E1022V	ENSP00000354977:E1022V	E	-	2	0	LTN1	29250969	0.996000	0.38824	0.997000	0.53966	0.930000	0.56654	3.417000	0.52714	0.949000	0.37715	0.533000	0.62120	GAG	LTN1	-	NULL		0.294	LTN1-008	NOVEL	basic|appris_principal	protein_coding	LTN1	HGNC	protein_coding	OTTHUMT00000472108.1	T	NM_015565		30329098	-1	no_errors	ENST00000361371	ensembl	human	known	70_37	missense	SNP	1.000	A
MAP3K4	4216	genome.wustl.edu	37	6	161519323	161519323	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:161519323C>G	ENST00000392142.4	+	17	3686	c.3538C>G	c.(3538-3540)Cct>Gct	p.P1180A	MAP3K4_ENST00000366919.2_Intron|MAP3K4_ENST00000366920.2_Missense_Mutation_p.P1176A|MAP3K4_ENST00000348824.7_Intron	NM_005922.2	NP_005913	Q9Y6R4	M3K4_HUMAN	mitogen-activated protein kinase kinase kinase 4	1180					activation of MAPKK activity (GO:0000186)|chorionic trophoblast cell differentiation (GO:0060718)|intracellular signal transduction (GO:0035556)|male germ-line sex determination (GO:0019100)|MAPK cascade (GO:0000165)|placenta development (GO:0001890)|positive regulation of JUN kinase activity (GO:0043507)|positive regulation of p38MAPK cascade (GO:1900745)|regulation of gene expression (GO:0010468)|response to UV-C (GO:0010225)	cytoplasm (GO:0005737)	ATP binding (GO:0005524)|MAP kinase kinase kinase activity (GO:0004709)|metal ion binding (GO:0046872)			breast(6)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(20)|lung(28)|ovary(3)|skin(2)|stomach(1)	77		Breast(66;0.000776)|Ovarian(120;0.0367)|Prostate(117;0.0771)		OV - Ovarian serous cystadenocarcinoma(65;1.85e-18)|BRCA - Breast invasive adenocarcinoma(81;3.04e-05)		TCGGAGCATGCCTTCCGACGC	0.527																																																	0													134.0	144.0	141.0					6																	161519323		2203	4300	6503	SO:0001583	missense	4216			AF002715	CCDS34565.1, CCDS34566.1, CCDS75544.1	6q26	2012-10-02			ENSG00000085511	ENSG00000085511		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6856	protein-coding gene	gene with protein product		602425		MEKK4		9305639	Standard	XM_005266988		Approved	MTK1, MAPKKK4, KIAA0213	uc003qtn.3	Q9Y6R4	OTTHUMG00000015968	ENST00000392142.4:c.3538C>G	6.37:g.161519323C>G	ENSP00000375986:p.Pro1180Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	A6H8W0|B7ZLD3|B9EG75|Q5VTT8|Q5VTT9|Q92612|Q9H408	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.P1180A	ENST00000392142.4	37	c.3538	CCDS34565.1	6	.	.	.	.	.	.	.	.	.	.	C	11.99	1.803307	0.31869	.	.	ENSG00000085511	ENST00000392142;ENST00000366920	T;T	0.70869	-0.49;-0.52	5.75	3.97	0.46021	.	0.070085	0.64402	D	0.000019	T	0.42381	0.1200	L	0.29908	0.895	0.80722	D	1	B;B	0.26400	0.144;0.148	B;B	0.26094	0.066;0.055	T	0.46176	-0.9210	10	0.66056	D	0.02	-10.8711	9.9884	0.41856	0.0:0.79:0.1378:0.0722	.	1176;1180	F5H538;Q9Y6R4	.;M3K4_HUMAN	A	1180;1176	ENSP00000375986:P1180A;ENSP00000355887:P1176A	ENSP00000355887:P1176A	P	+	1	0	MAP3K4	161439313	1.000000	0.71417	0.952000	0.39060	0.280000	0.26924	3.152000	0.50677	0.763000	0.33175	0.650000	0.86243	CCT	MAP3K4	-	NULL		0.527	MAP3K4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MAP3K4	HGNC	protein_coding	OTTHUMT00000042988.3	C			161519323	+1	no_errors	ENST00000392142	ensembl	human	known	70_37	missense	SNP	1.000	G
MBD6	114785	genome.wustl.edu	37	12	57919663	57919663	+	Silent	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:57919663G>C	ENST00000355673.3	+	6	1268	c.912G>C	c.(910-912)ctG>ctC	p.L304L	MBD6_ENST00000431731.2_Silent_p.L304L	NM_052897.3	NP_443129.3	Q96DN6	MBD6_HUMAN	methyl-CpG binding domain protein 6	304	Pro-rich.					chromocenter (GO:0010369)|nucleus (GO:0005634)	chromatin binding (GO:0003682)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(6)|kidney(2)|large_intestine(8)|lung(8)|ovary(1)|urinary_tract(1)	31						TGGGGCCCCTGGGAGGGGCCC	0.692																																																	0													21.0	28.0	26.0					12																	57919663		2153	4264	6417	SO:0001819	synonymous_variant	114785			AB067474	CCDS8944.1	12q13.2	2008-02-05				ENSG00000166987			20445	protein-coding gene	gene with protein product						12529184	Standard	NM_052897		Approved	KIAA1887	uc001soj.1	Q96DN6		ENST00000355673.3:c.912G>C	12.37:g.57919663G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N3M0|Q8NA81|Q96Q00	Silent	SNP	superfamily_DNA-bd_integrase-typ,smart_Methyl_CpG_DNA-bd,pfscan_Methyl_CpG_DNA-bd	p.L304	ENST00000355673.3	37	c.912	CCDS8944.1	12																																																																																			MBD6	-	NULL		0.692	MBD6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MBD6	HGNC	protein_coding	OTTHUMT00000407250.1	G			57919663	+1	no_errors	ENST00000355673	ensembl	human	known	70_37	silent	SNP	0.987	C
MED1	5469	genome.wustl.edu	37	17	37565278	37565278	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:37565278G>A	ENST00000300651.6	-	17	3419	c.3196C>T	c.(3196-3198)Cag>Tag	p.Q1066*	MED1_ENST00000394287.3_Intron|CTB-131K11.1_ENST00000582842.1_RNA	NM_004774.3	NP_004765.2	O95243	MBD4_HUMAN	mediator complex subunit 1	0					base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|depyrimidination (GO:0045008)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|intrinsic apoptotic signaling pathway in response to DNA damage (GO:0008630)|mitotic G2 DNA damage checkpoint (GO:0007095)|response to radiation (GO:0009314)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	endodeoxyribonuclease activity (GO:0004520)|pyrimidine-specific mismatch base pair DNA N-glycosylase activity (GO:0008263)|satellite DNA binding (GO:0003696)			NS(1)|breast(2)|cervix(3)|kidney(3)|large_intestine(7)|lung(25)|ovary(2)|pancreas(1)|prostate(1)|skin(6)|upper_aerodigestive_tract(7)|urinary_tract(1)	59		Ovarian(249;1.78e-06)|Lung SC(565;0.0262)	Lung(15;0.0178)|LUAD - Lung adenocarcinoma(14;0.146)	UCEC - Uterine corpus endometrioid carcinoma (308;6.64e-05)|BRCA - Breast invasive adenocarcinoma(366;0.00136)|READ - Rectum adenocarcinoma(1115;0.0649)		TTAGGAATCTGAATAGTGATT	0.522										HNSCC(31;0.082)																											Pancreas(21;279 768 2492 4877 24026)												0													102.0	99.0	100.0					17																	37565278		2203	4300	6503	SO:0001587	stop_gained	5469			L40366	CCDS11336.1	17q12	2007-07-30	2007-07-30	2007-07-30	ENSG00000125686	ENSG00000125686			9234	protein-coding gene	gene with protein product		604311	"""PPAR binding protein"""	TRIP2, PPARGBP, PPARBP		9325263, 10485914	Standard	NM_004774		Approved	PBP, TRAP220, RB18A, DRIP230, CRSP200, CRSP1	uc002hrv.4	Q15648	OTTHUMG00000133216	ENST00000300651.6:c.3196C>T	17.37:g.37565278G>A	ENSP00000300651:p.Gln1066*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DZN2|D3DNC3|D3DNC4|E9PEE4|Q2MD36|Q7Z4T3|Q96F09	Nonsense_Mutation	SNP	pfam_Mediator_Med1_met/fun	p.Q1066*	ENST00000300651.6	37	c.3196	CCDS11336.1	17	.	.	.	.	.	.	.	.	.	.	G	40	7.966036	0.98585	.	.	ENSG00000125686	ENST00000300651	.	.	.	5.87	5.87	0.94306	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.25751	T	0.34	-6.4877	20.5827	0.99408	0.0:0.0:1.0:0.0	.	.	.	.	X	1066	.	ENSP00000300651:Q1066X	Q	-	1	0	MED1	34818804	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	9.526000	0.98042	2.941000	0.99782	0.655000	0.94253	CAG	MED1	-	NULL		0.522	MED1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MED1	HGNC	protein_coding	OTTHUMT00000256943.3	G	NM_004774		37565278	-1	no_errors	ENST00000300651	ensembl	human	known	70_37	nonsense	SNP	1.000	A
MICA	100507436	genome.wustl.edu	37	6	31379931	31379931	+	Missense_Mutation	SNP	A	A	T	rs1063635	byFrequency	TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:31379931A>T	ENST00000449934.2	+	4	875	c.821A>T	c.(820-822)cAa>cTa	p.Q274L	HCP5_ENST00000414046.2_RNA	NM_001177519.1	NP_001170990.1			MHC class I polypeptide-related sequence A											breast(1)|endometrium(3)|kidney(1)	5		Ovarian(999;0.0253)				AGGATTTGCCGAGGAGAGGAG	0.602																																																	0													20.0	19.0	19.0					6																	31379931		692	1591	2283	SO:0001583	missense	100507436			L14848	CCDS56412.1, CCDS75421.1	6p21.3	2013-01-11			ENSG00000204520	ENSG00000204520		"""Immunoglobulin superfamily / C1-set domain containing"""	7090	protein-coding gene	gene with protein product		600169				8022771	Standard	NM_000247		Approved	PERB11.1	uc003ntk.1	Q29983	OTTHUMG00000031073	ENST00000449934.2:c.821A>T	6.37:g.31379931A>T	ENSP00000413079:p.Gln274Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_MHC_I_a_a1/a2,pfam_Ig_C1-set,superfamily_MHC_I/II-like_Ag-recog,smart_Ig_C1-set,pfscan_Ig-like	p.R274L	ENST00000449934.2	37	c.821	CCDS56412.1	6																																																																																			MICA	-	pfam_Ig_C1-set,smart_Ig_C1-set,pfscan_Ig-like		0.602	MICA-001	KNOWN	not_best_in_genome_evidence|basic|appris_principal|CCDS	protein_coding	MICA	HGNC	protein_coding	OTTHUMT00000076101.7	A	NM_001177519		31379931	+1	no_errors	ENST00000364810	ensembl	human	known	70_37	missense	SNP	0.001	T
MPL	4352	genome.wustl.edu	37	1	43814553	43814553	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:43814553G>C	ENST00000372470.3	+	9	1390	c.1348G>C	c.(1348-1350)Gag>Cag	p.E450Q	MPL_ENST00000413998.2_Missense_Mutation_p.E450Q	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	450	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	AGGGACCCTGGAGCTGCGCCC	0.677			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														NSCLC(52;534 1204 10016 41452 44427)		yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	0													8.0	12.0	11.0					1																	43814553		2119	4150	6269	SO:0001583	missense	4352			M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.1348G>C	1.37:g.43814553G>C	ENSP00000361548:p.Glu450Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JUZ0	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.E450Q	ENST00000372470.3	37	c.1348	CCDS483.1	1	.	.	.	.	.	.	.	.	.	.	g	24.7	4.563519	0.86335	.	.	ENSG00000117400	ENST00000372468;ENST00000372470;ENST00000413998	T;T	0.57436	0.4;0.4	4.59	4.59	0.56863	Fibronectin, type III (4);Long hematopoietin receptor, single chain, conserved site (1);Immunoglobulin-like fold (1);	1.926800	0.01998	N	0.046072	T	0.67258	0.2874	L	0.47716	1.5	0.28305	N	0.922954	P;B;D	0.69078	0.84;0.255;0.997	P;B;P	0.62089	0.459;0.164;0.898	T	0.57087	-0.7871	10	0.18276	T	0.48	-6.2149	14.6326	0.68666	0.0:0.0:1.0:0.0	.	443;450;450	Q308M1;P40238;Q5JUY5	.;TPOR_HUMAN;.	Q	450	ENSP00000361548:E450Q;ENSP00000414004:E450Q	ENSP00000361546:E450Q	E	+	1	0	MPL	43587140	1.000000	0.71417	1.000000	0.80357	0.933000	0.57130	5.029000	0.64121	2.093000	0.63338	0.444000	0.29173	GAG	MPL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.677	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPL	HGNC	protein_coding	OTTHUMT00000019522.1	G	NM_005373		43814553	+1	no_errors	ENST00000372470	ensembl	human	known	70_37	missense	SNP	1.000	C
MRPL28	10573	genome.wustl.edu	37	16	419128	419128	+	Silent	SNP	C	C	A	rs374245702		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr16:419128C>A	ENST00000199706.8	-	3	416	c.381G>T	c.(379-381)gtG>gtT	p.V127V	MRPL28_ENST00000389675.2_Silent_p.V127V|MRPL28_ENST00000429738.1_Intron	NM_006428.4	NP_006419.2	Q13084	RM28_HUMAN	mitochondrial ribosomal protein L28	127					translation (GO:0006412)	cytoplasm (GO:0005737)|mitochondrial ribosome (GO:0005761)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|structural constituent of ribosome (GO:0003735)			breast(1)|kidney(1)|lung(1)|ovary(1)|prostate(1)	5		Hepatocellular(16;0.000105)|Lung NSC(18;0.0324)|all_lung(18;0.064)				TCCGCATGGTCACAGTCACTG	0.552																																																	0													200.0	149.0	166.0					16																	419128		2203	4300	6503	SO:0001819	synonymous_variant	10573			U19796	CCDS32349.1	16p13.12	2012-09-26	2002-11-13		ENSG00000086504	ENSG00000086504		"""Mitochondrial ribosomal proteins / large subunits"""	14484	protein-coding gene	gene with protein product		604853	"""melanoma-associated antigen recognised by cytotoxic T lymphocytes"""	MAAT1		11551941, 19753307	Standard	NM_006428		Approved	p15	uc002cgs.2	Q13084	OTTHUMG00000047994	ENST00000199706.8:c.381G>T	16.37:g.419128C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCM4|D3DU46|Q4TT39|Q96S26|Q9BQD8|Q9BR04	Silent	SNP	NULL	p.V127	ENST00000199706.8	37	c.381	CCDS32349.1	16																																																																																			MRPL28	-	NULL		0.552	MRPL28-006	KNOWN	basic|appris_principal|CCDS	protein_coding	MRPL28	HGNC	protein_coding	OTTHUMT00000139285.2	C			419128	-1	no_errors	ENST00000199706	ensembl	human	known	70_37	silent	SNP	1.000	A
MTMR1	8776	genome.wustl.edu	37	X	149919523	149919523	+	Intron	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:149919523C>T	ENST00000370390.3	+	13	1813				MTMR1_ENST00000544228.1_Intron|MTMR1_ENST00000538506.1_Nonsense_Mutation_p.R385*|MTMR1_ENST00000445323.2_Intron|MTMR1_ENST00000451863.2_Nonsense_Mutation_p.R560*|MTMR1_ENST00000541925.1_Intron	NM_003828.2	NP_003819.1	Q13613	MTMR1_HUMAN	myotubularin related protein 1						phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|plasma membrane (GO:0005886)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			central_nervous_system(1)|endometrium(4)|kidney(3)|large_intestine(7)|lung(5)|ovary(2)|prostate(1)	23	Acute lymphoblastic leukemia(192;6.56e-05)					tgggacccagcgagcccgtgg	0.582																																																	0													17.0	16.0	16.0					X																	149919523		876	1990	2866	SO:0001627	intron_variant	8776			U58032	CCDS14695.1	Xq28	2011-06-09			ENSG00000063601	ENSG00000063601		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	7449	protein-coding gene	gene with protein product		300171				9828128	Standard	XM_005274765		Approved		uc004fei.3	Q13613	OTTHUMG00000024159	ENST00000370390.3:c.1656+208C>T	X.37:g.149919523C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0A024RC07|Q9UBX6|Q9UEM0|Q9UQD5	Nonsense_Mutation	SNP	pfam_Myotub-related,pfam_GRAM,smart_GRAM,smart_Tyr_Pase_cat,pfscan_Tyr/Dual-specificity_Pase	p.R560*	ENST00000370390.3	37	c.1678	CCDS14695.1	X	.	.	.	.	.	.	.	.	.	.	C	15.25	2.778982	0.49891	.	.	ENSG00000063601	ENST00000451863;ENST00000538506	.	.	.	2.73	-5.46	0.02608	.	.	.	.	.	.	.	.	.	.	.	0.39408	A	0.966696	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	.	0.6106	0.00761	0.428:0.1584:0.1413:0.2724	.	.	.	.	X	560;385	.	ENSP00000387446:R560X	R	+	1	2	MTMR1	149670181	0.000000	0.05858	0.000000	0.03702	0.023000	0.10783	-2.262000	0.01175	-1.958000	0.01019	-0.504000	0.04507	CGA	MTMR1	-	NULL		0.582	MTMR1-013	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR1	HGNC	protein_coding	OTTHUMT00000060863.2	C	NM_003828, NM_176789		149919523	+1	no_errors	ENST00000451863	ensembl	human	known	70_37	nonsense	SNP	0.000	T
MTMR14	64419	genome.wustl.edu	37	3	9711148	9711148	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:9711148G>T	ENST00000296003.4	+	5	648	c.526G>T	c.(526-528)Gac>Tac	p.D176Y	MTMR14_ENST00000351233.5_Missense_Mutation_p.D176Y|MTMR14_ENST00000420925.1_Intron|MTMR14_ENST00000353332.5_Missense_Mutation_p.D176Y	NM_001077525.2	NP_001070993.1	Q8NCE2	MTMRE_HUMAN	myotubularin related protein 14	176					phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)|ruffle (GO:0001726)	phosphatidylinositol-3-phosphatase activity (GO:0004438)|protein tyrosine phosphatase activity (GO:0004725)			breast(1)|endometrium(3)|kidney(2)|lung(10)|skin(3)|upper_aerodigestive_tract(2)	21	Medulloblastoma(99;0.227)					AGATGTGGAGGACGTCACGGA	0.607																																																	0													187.0	208.0	201.0					3																	9711148		2144	4250	6394	SO:0001583	missense	64419			BC001674	CCDS43043.1, CCDS43044.1, CCDS43045.1	3p26	2011-06-09	2006-12-18	2006-12-18	ENSG00000163719	ENSG00000163719		"""Protein tyrosine phosphatases / Class I Cys-based PTPs : Myotubularins"""	26190	protein-coding gene	gene with protein product	"""egg-derived tyrosine phosphatase homolog (Drosophila)"""	611089	"""chromosome 3 open reading frame 29"""	C3orf29		15186772	Standard	NM_022485		Approved	FLJ22405, FLJ90311, hJumpy, hEDTP	uc003brz.3	Q8NCE2	OTTHUMG00000155111	ENST00000296003.4:c.526G>T	3.37:g.9711148G>T	ENSP00000296003:p.Asp176Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0JTH5|Q0JU83|Q6PIZ4|Q6QE21|Q86VK9|Q8IYK1|Q8TCM7|Q9H6C0	Missense_Mutation	SNP	NULL	p.D176Y	ENST00000296003.4	37	c.526	CCDS43043.1	3	.	.	.	.	.	.	.	.	.	.	G	18.41	3.617647	0.66787	.	.	ENSG00000163719	ENST00000353332;ENST00000296003;ENST00000351233;ENST00000419048	.	.	.	5.55	5.55	0.83447	.	0.098388	0.64402	D	0.000001	T	0.74298	0.3698	L	0.47716	1.5	0.80722	D	1	D;D;D	0.89917	1.0;0.998;0.99	D;D;P	0.72338	0.977;0.93;0.73	T	0.75872	-0.3164	9	0.72032	D	0.01	.	17.3062	0.87196	0.0:0.0:1.0:0.0	.	176;176;176	Q8NCE2-3;Q8NCE2-2;Q8NCE2	.;.;MTMRE_HUMAN	Y	176	.	ENSP00000296003:D176Y	D	+	1	0	MTMR14	9686148	1.000000	0.71417	0.157000	0.22605	0.991000	0.79684	7.997000	0.88414	2.615000	0.88500	0.650000	0.86243	GAC	MTMR14	-	NULL		0.607	MTMR14-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	MTMR14	HGNC	protein_coding	OTTHUMT00000338435.1	G	NM_022485		9711148	+1	no_errors	ENST00000296003	ensembl	human	known	70_37	missense	SNP	0.991	T
MYH10	4628	genome.wustl.edu	37	17	8384713	8384713	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:8384713C>T	ENST00000269243.4	-	36	5236	c.5098G>A	c.(5098-5100)Gag>Aag	p.E1700K	MYH10_ENST00000379980.4_Missense_Mutation_p.E1716K|MYH10_ENST00000360416.3_Missense_Mutation_p.E1731K|MYH10_ENST00000396239.1_Missense_Mutation_p.E1721K	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	1700					actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						CGGGCTCGCTCAGATGAGGCA	0.602																																																	0													87.0	74.0	79.0					17																	8384713		2203	4300	6503	SO:0001583	missense	4628			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.5098G>A	17.37:g.8384713C>T	ENSP00000269243:p.Glu1700Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1721K	ENST00000269243.4	37	c.5161	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	C	24.6	4.551398	0.86127	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980	D;T;T;T	0.86627	-2.15;-1.39;-1.39;-1.39	5.08	5.08	0.68730	Myosin tail (1);	0.000000	0.85682	D	0.000000	D	0.94693	0.8288	M	0.89904	3.07	0.80722	D	1	D;D;D	0.62365	0.991;0.989;0.991	D;D;D	0.70016	0.967;0.911;0.967	D	0.95478	0.8558	10	0.87932	D	0	.	18.6618	0.91474	0.0:1.0:0.0:0.0	.	1709;1731;1700	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	K	1700;1731;1721;1716	ENSP00000269243:E1700K;ENSP00000353590:E1731K;ENSP00000379539:E1721K;ENSP00000369315:E1716K	ENSP00000269243:E1700K	E	-	1	0	MYH10	8325438	1.000000	0.71417	0.958000	0.39756	0.306000	0.27790	7.609000	0.82925	2.632000	0.89209	0.655000	0.94253	GAG	MYH10	-	pfam_Myosin_tail		0.602	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	C			8384713	-1	no_errors	ENST00000396239	ensembl	human	known	70_37	missense	SNP	1.000	T
MYH10	4628	genome.wustl.edu	37	17	8508240	8508240	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:8508240C>G	ENST00000269243.4	-	3	544	c.406G>C	c.(406-408)Gag>Cag	p.E136Q	MYH10_ENST00000379980.4_Missense_Mutation_p.E136Q|MYH10_ENST00000360416.3_Missense_Mutation_p.E136Q|MYH10_ENST00000396239.1_Missense_Mutation_p.E136Q	NM_005964.3	NP_005955.3	P35580	MYH10_HUMAN	myosin, heavy chain 10, non-muscle	136	Myosin motor.				actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|cardiac myofibril assembly (GO:0055003)|cell adhesion (GO:0007155)|cell proliferation (GO:0008283)|cerebellar Purkinje cell layer development (GO:0021680)|exocytosis (GO:0006887)|fourth ventricle development (GO:0021592)|in utero embryonic development (GO:0001701)|lateral ventricle development (GO:0021670)|mitotic cytokinesis (GO:0000281)|neuromuscular process controlling balance (GO:0050885)|neuron migration (GO:0001764)|nuclear migration (GO:0007097)|plasma membrane repair (GO:0001778)|regulation of cell shape (GO:0008360)|retina development in camera-type eye (GO:0060041)|substrate-dependent cell migration, cell extension (GO:0006930)|third ventricle development (GO:0021678)|ventricular cardiac muscle cell development (GO:0055015)	actomyosin (GO:0042641)|axon (GO:0030424)|cell cortex (GO:0005938)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|dendritic spine (GO:0043197)|extracellular vesicular exosome (GO:0070062)|growth cone (GO:0030426)|midbody (GO:0030496)|myosin complex (GO:0016459)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle (GO:0005819)|stress fiber (GO:0001725)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			breast(5)|endometrium(9)|kidney(2)|large_intestine(16)|lung(9)|ovary(3)|prostate(3)|skin(4)|stomach(1)	52						ATAATATTCTCAGAGTAAATT	0.333																																																	0													66.0	69.0	68.0					17																	8508240		2203	4298	6501	SO:0001583	missense	4628			M69181	CCDS11144.1, CCDS58515.1, CCDS73984.1	17p13	2011-09-27	2006-09-29		ENSG00000133026	ENSG00000133026		"""Myosins / Myosin superfamily : Class II"""	7568	protein-coding gene	gene with protein product		160776	"""myosin, heavy polypeptide 10, non-muscle"""			1860190	Standard	NM_001256012		Approved	NMMHCB	uc002glm.4	P35580	OTTHUMG00000108195	ENST00000269243.4:c.406G>C	17.37:g.8508240C>G	ENSP00000269243:p.Glu136Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RWP9|D3DTS1|F8VTL3|Q12989|Q149N3|Q149N4|Q16087|Q4LE45|Q6PK16|Q9BWG0	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,superfamily_HR1_rho-bd,superfamily_UBA-like,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E136Q	ENST00000269243.4	37	c.406	CCDS11144.1	17	.	.	.	.	.	.	.	.	.	.	C	27.8	4.860653	0.91433	.	.	ENSG00000133026	ENST00000269243;ENST00000360416;ENST00000396239;ENST00000379980;ENST00000411957	D;D;D;D;D	0.87650	-2.28;-2.28;-2.28;-2.28;-2.28	5.09	5.09	0.68999	Myosin head, motor domain (2);	0.104289	0.64402	D	0.000005	D	0.91818	0.7411	M	0.64404	1.975	0.80722	D	1	D;P;D	0.59357	0.985;0.826;0.985	D;D;D	0.63957	0.918;0.92;0.918	D	0.90670	0.4597	10	0.38643	T	0.18	.	18.6797	0.91543	0.0:1.0:0.0:0.0	.	136;136;136	B2RWP9;F8VTL3;P35580	.;.;MYH10_HUMAN	Q	136	ENSP00000269243:E136Q;ENSP00000353590:E136Q;ENSP00000379539:E136Q;ENSP00000369315:E136Q;ENSP00000408220:E136Q	ENSP00000269243:E136Q	E	-	1	0	MYH10	8448965	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.600000	0.82769	2.627000	0.88993	0.563000	0.77884	GAG	MYH10	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.333	MYH10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH10	HGNC	protein_coding	OTTHUMT00000227001.2	C			8508240	-1	no_errors	ENST00000396239	ensembl	human	known	70_37	missense	SNP	1.000	G
MYH7	4625	genome.wustl.edu	37	14	23885517	23885517	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr14:23885517G>A	ENST00000355349.3	-	34	4811	c.4649C>T	c.(4648-4650)tCc>tTc	p.S1550F	CTD-2201G16.1_ENST00000557368.1_RNA|MIR208B_ENST00000401172.1_RNA	NM_000257.2	NP_000248.2	P12883	MYH7_HUMAN	myosin, heavy chain 7, cardiac muscle, beta	1550					adult heart development (GO:0007512)|ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|regulation of heart rate (GO:0002027)|regulation of the force of heart contraction (GO:0002026)|striated muscle contraction (GO:0006941)|ventricular cardiac muscle tissue morphogenesis (GO:0055010)	cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|muscle myosin complex (GO:0005859)|myosin complex (GO:0016459)|myosin filament (GO:0032982)|nucleus (GO:0005634)|sarcomere (GO:0030017)|stress fiber (GO:0001725)|Z disc (GO:0030018)	actin-dependent ATPase activity (GO:0030898)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)			NS(3)|breast(4)|central_nervous_system(2)|cervix(2)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(5)|large_intestine(19)|lung(57)|ovary(5)|prostate(9)|skin(5)|stomach(1)|upper_aerodigestive_tract(3)|urinary_tract(5)	137	all_cancers(95;2.54e-05)			GBM - Glioblastoma multiforme(265;0.00725)		GTGCTCCAGGGAGGCCTGGGA	0.612																																																	0													64.0	67.0	66.0					14																	23885517		2203	4300	6503	SO:0001583	missense	4625			M58018	CCDS9601.1	14q11.2-q13	2014-09-17	2006-09-29		ENSG00000092054	ENSG00000092054		"""Myosins / Myosin superfamily : Class II"""	7577	protein-coding gene	gene with protein product		160760	"""myopathy, distal 1"", ""myosin, heavy polypeptide 7, cardiac muscle, beta"""	CMH1, MPD1		2494889, 8483915, 15322983	Standard	XM_005267696		Approved	CMD1S	uc001wjx.3	P12883	OTTHUMG00000028755	ENST00000355349.3:c.4649C>T	14.37:g.23885517G>A	ENSP00000347507:p.Ser1550Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A2TDB6|B6D424|Q14836|Q14837|Q14904|Q16579|Q2M1Y6|Q92679|Q9H1D5|Q9UDA2|Q9UMM8	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.S1550F	ENST00000355349.3	37	c.4649	CCDS9601.1	14	.	.	.	.	.	.	.	.	.	.	G	20.5	4.008921	0.75046	.	.	ENSG00000092054	ENST00000355349;ENST00000544444	T	0.78816	-1.21	4.55	4.55	0.56014	Myosin tail (1);	.	.	.	.	D	0.86481	0.5943	M	0.70903	2.155	0.58432	D	0.999999	P	0.42620	0.785	P	0.58454	0.839	D	0.87991	0.2749	9	0.87932	D	0	.	17.8682	0.88803	0.0:0.0:1.0:0.0	.	1550	P12883	MYH7_HUMAN	F	1550;1555	ENSP00000347507:S1550F	ENSP00000347507:S1550F	S	-	2	0	MYH7	22955357	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	9.026000	0.93700	2.537000	0.85549	0.655000	0.94253	TCC	MYH7	-	pfam_Myosin_tail		0.612	MYH7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH7	HGNC	protein_coding	OTTHUMT00000071798.3	G	NM_000257		23885517	-1	no_errors	ENST00000355349	ensembl	human	known	70_37	missense	SNP	1.000	A
MYH8	4626	genome.wustl.edu	37	17	10304060	10304060	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:10304060C>G	ENST00000403437.2	-	27	3476	c.3382G>C	c.(3382-3384)Gag>Cag	p.E1128Q	RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|RP11-799N11.1_ENST00000399342.2_RNA	NM_002472.2	NP_002463.2	P13535	MYH8_HUMAN	myosin, heavy chain 8, skeletal muscle, perinatal	1128					ATP catabolic process (GO:0006200)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|skeletal muscle contraction (GO:0003009)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|muscle myosin complex (GO:0005859)|myosin filament (GO:0032982)|sarcomere (GO:0030017)	actin filament binding (GO:0051015)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|myosin light chain binding (GO:0032027)|structural constituent of muscle (GO:0008307)			NS(3)|breast(8)|central_nervous_system(2)|endometrium(11)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(23)|lung(61)|ovary(3)|prostate(3)|skin(10)|upper_aerodigestive_tract(2)|urinary_tract(2)	134						GACGCCCTCTCTGCCTCGATT	0.552									Trismus-Pseudocamptodactyly Syndrome with Cardiac Myxoma and Freckling																																								0													44.0	49.0	47.0					17																	10304060		2202	4300	6502	SO:0001583	missense	4626	Familial Cancer Database	Carney Complex Variant		CCDS11153.1	17p13.1	2013-09-19	2006-09-29		ENSG00000133020	ENSG00000133020		"""Myosins / Myosin superfamily : Class II"""	7578	protein-coding gene	gene with protein product		160741	"""myosin, heavy polypeptide 8, skeletal muscle, perinatal"""			2373371	Standard	NM_002472		Approved	MyHC-peri, MyHC-pn	uc002gmm.2	P13535	OTTHUMG00000130361	ENST00000403437.2:c.3382G>C	17.37:g.10304060C>G	ENSP00000384330:p.Glu1128Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14910	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_t-SNARE,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E1128Q	ENST00000403437.2	37	c.3382	CCDS11153.1	17	.	.	.	.	.	.	.	.	.	.	C	21.4	4.139178	0.77775	.	.	ENSG00000133020	ENST00000252173;ENST00000403437	D	0.85171	-1.95	5.38	5.38	0.77491	Myosin tail (1);	0.000000	0.41938	U	0.000786	D	0.95478	0.8531	H	0.97340	3.985	0.58432	D	0.999998	D	0.76494	0.999	D	0.73380	0.98	D	0.96696	0.9514	10	0.87932	D	0	.	19.3244	0.94256	0.0:1.0:0.0:0.0	.	1128	P13535	MYH8_HUMAN	Q	1128	ENSP00000384330:E1128Q	ENSP00000252173:E1128Q	E	-	1	0	MYH8	10244785	1.000000	0.71417	1.000000	0.80357	0.707000	0.40811	7.531000	0.81973	2.794000	0.96219	0.655000	0.94253	GAG	MYH8	-	pfam_Myosin_tail		0.552	MYH8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH8	HGNC	protein_coding	OTTHUMT00000252724.2	C	NM_002472		10304060	-1	no_errors	ENST00000403437	ensembl	human	known	70_37	missense	SNP	1.000	G
MYH9	4627	genome.wustl.edu	37	22	36700097	36700097	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:36700097C>G	ENST00000216181.5	-	19	2564	c.2334G>C	c.(2332-2334)aaG>aaC	p.K778N		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	778					actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CGTCGGTGATCTTCAGGTCTC	0.622			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													67.0	62.0	64.0					22																	36700097		2203	4300	6503	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2334G>C	22.37:g.36700097C>G	ENSP00000216181:p.Lys778Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.K778N	ENST00000216181.5	37	c.2334	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	22.6	4.308719	0.81247	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	T	0.72835	-0.69	5.12	5.12	0.69794	.	0.000000	0.85682	D	0.000000	D	0.88078	0.6340	H	0.95982	3.75	0.80722	D	1	D	0.89917	1.0	D	0.75484	0.986	D	0.90805	0.4697	10	0.87932	D	0	.	12.0024	0.53240	0.0:0.8745:0.0:0.1255	.	778	P35579	MYH9_HUMAN	N	642;778	ENSP00000216181:K778N	ENSP00000216181:K778N	K	-	3	2	MYH9	35030043	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	4.084000	0.57650	2.553000	0.86117	0.655000	0.94253	AAG	MYH9	-	smart_IQ_motif_EF-hand-BS		0.622	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	C	NM_002473		36700097	-1	no_errors	ENST00000216181	ensembl	human	known	70_37	missense	SNP	1.000	G
MYH9	4627	genome.wustl.edu	37	22	36700117	36700117	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:36700117C>T	ENST00000216181.5	-	19	2544	c.2314G>A	c.(2314-2316)Gag>Aag	p.E772K		NM_002473.4	NP_002464.1	P35579	MYH9_HUMAN	myosin, heavy chain 9, non-muscle	772	Myosin motor.				actin cytoskeleton reorganization (GO:0031532)|actin filament-based movement (GO:0030048)|actomyosin structure organization (GO:0031032)|angiogenesis (GO:0001525)|ATP catabolic process (GO:0006200)|axon guidance (GO:0007411)|blood vessel endothelial cell migration (GO:0043534)|cytokinesis (GO:0000910)|establishment of meiotic spindle localization (GO:0051295)|establishment of T cell polarity (GO:0001768)|in utero embryonic development (GO:0001701)|integrin-mediated signaling pathway (GO:0007229)|leukocyte migration (GO:0050900)|meiotic spindle organization (GO:0000212)|membrane protein ectodomain proteolysis (GO:0006509)|monocyte differentiation (GO:0030224)|myoblast fusion (GO:0007520)|platelet aggregation (GO:0070527)|platelet formation (GO:0030220)|protein transport (GO:0015031)|regulation of cell shape (GO:0008360)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|uropod organization (GO:0032796)	actin cytoskeleton (GO:0015629)|actomyosin (GO:0042641)|actomyosin contractile ring (GO:0005826)|cell leading edge (GO:0031252)|cell-cell adherens junction (GO:0005913)|cleavage furrow (GO:0032154)|cortical cytoskeleton (GO:0030863)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|membrane (GO:0016020)|myosin II complex (GO:0016460)|myosin II filament (GO:0097513)|neuromuscular junction (GO:0031594)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|ruffle (GO:0001726)|spindle (GO:0005819)|stress fiber (GO:0001725)|uropod (GO:0001931)	actin binding (GO:0003779)|actin filament binding (GO:0051015)|actin-dependent ATPase activity (GO:0030898)|ADP binding (GO:0043531)|ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microfilament motor activity (GO:0000146)|motor activity (GO:0003774)|poly(A) RNA binding (GO:0044822)|protein anchor (GO:0043495)|protein homodimerization activity (GO:0042803)			NS(1)|breast(8)|central_nervous_system(3)|cervix(2)|endometrium(5)|kidney(4)|large_intestine(16)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|skin(1)|upper_aerodigestive_tract(6)|urinary_tract(3)	86						CGCTCCTCCTCCAGGTGGGCC	0.597			T	ALK	ALCL		"""Deafness, autosomal dominant 17, Epstein syndrome, Fechtner syndrome, May-Hegglin anomaly, Sebastian syndrome"""		Hereditary Macrothrombocytopenia, MYH9-associated																															Dom	yes		22	22q13.1	4627	"""myosin, heavy polypeptide 9, non-muscle"""	yes	L	0													69.0	63.0	65.0					22																	36700117		2203	4300	6503	SO:0001583	missense	4627	Familial Cancer Database	MYHIIA syndrome, incl. Fechtner Syndrome, FTNS, and May-Hegglin Anomaly, MHA		CCDS13927.1	22q13.1	2014-09-17	2006-09-29		ENSG00000100345	ENSG00000100345		"""Myosins / Myosin superfamily : Class II"""	7579	protein-coding gene	gene with protein product	"""nonmuscle myosin heavy chain II-A"""	160775	"""myosin, heavy polypeptide 9, non-muscle"""	DFNA17		1860190, 11023810	Standard	NM_002473		Approved	NMMHCA, NMHC-II-A, MHA, FTNS, EPSTS	uc003apg.3	P35579	OTTHUMG00000030429	ENST00000216181.5:c.2314G>A	22.37:g.36700117C>T	ENSP00000216181:p.Glu772Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6E4|O60805|Q60FE2|Q86T83	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,pfam_Myosin_tail,pfam_Myosin_N,pfam_IQ_motif_EF-hand-BS,superfamily_Regulat_G_prot_signal_superfam,superfamily_Prefoldin,superfamily_Myosin_S1_N,superfamily_STAT_TF_coiled-coil,superfamily_tRNA-bd_arm,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.E772K	ENST00000216181.5	37	c.2314	CCDS13927.1	22	.	.	.	.	.	.	.	.	.	.	C	36	5.738087	0.96865	.	.	ENSG00000100345	ENST00000337818;ENST00000216181	T	0.74737	-0.87	5.12	5.12	0.69794	Myosin head, motor domain (1);	0.000000	0.85682	D	0.000000	D	0.93344	0.7878	H	0.99783	4.775	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96586	0.9434	10	0.87932	D	0	.	18.9188	0.92516	0.0:1.0:0.0:0.0	.	772	P35579	MYH9_HUMAN	K	636;772	ENSP00000216181:E772K	ENSP00000216181:E772K	E	-	1	0	MYH9	35030063	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.818000	0.86416	2.553000	0.86117	0.655000	0.94253	GAG	MYH9	-	smart_Myosin_head_motor_dom		0.597	MYH9-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	MYH9	HGNC	protein_coding	OTTHUMT00000259110.3	C	NM_002473		36700117	-1	no_errors	ENST00000216181	ensembl	human	known	70_37	missense	SNP	1.000	T
MYLK	4638	genome.wustl.edu	37	3	123419838	123419838	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:123419838G>A	ENST00000475616.1	-	15	2476	c.2477C>T	c.(2476-2478)gCc>gTc	p.A826V	MYLK_ENST00000360304.3_Missense_Mutation_p.A826V|MYLK_ENST00000510775.1_5'Flank|MYLK_ENST00000360772.3_Missense_Mutation_p.A826V|MYLK_ENST00000359169.1_Missense_Mutation_p.A826V|MYLK_ENST00000346322.5_Missense_Mutation_p.A757V			Q15746	MYLK_HUMAN	myosin light chain kinase	826					actin filament organization (GO:0007015)|aorta smooth muscle tissue morphogenesis (GO:0060414)|bleb assembly (GO:0032060)|cellular hypotonic response (GO:0071476)|muscle contraction (GO:0006936)|positive regulation of calcium ion transport (GO:0051928)|positive regulation of cell migration (GO:0030335)|positive regulation of wound healing (GO:0090303)|protein phosphorylation (GO:0006468)|smooth muscle contraction (GO:0006939)|tonic smooth muscle contraction (GO:0014820)	cell-cell junction (GO:0005911)|cleavage furrow (GO:0032154)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lamellipodium (GO:0030027)|stress fiber (GO:0001725)	ATP binding (GO:0005524)|calmodulin-dependent protein kinase activity (GO:0004683)|metal ion binding (GO:0046872)|myosin light chain kinase activity (GO:0004687)			NS(2)|breast(4)|central_nervous_system(1)|endometrium(24)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(17)|lung(37)|ovary(7)|prostate(3)|skin(5)|stomach(1)|upper_aerodigestive_tract(5)|urinary_tract(2)	113		Lung NSC(201;0.0496)		GBM - Glioblastoma multiforme(114;0.0736)		CTCGCAGCTGGCAGGCTCCCT	0.587																																																	0													24.0	28.0	26.0					3																	123419838		2152	4210	6362	SO:0001583	missense	4638			X85337	CCDS3023.1, CCDS43141.1, CCDS46896.1, CCDS46897.1, CCDS58849.1	3q21	2013-02-11	2008-01-23		ENSG00000065534	ENSG00000065534	2.7.11.18	"""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	7590	protein-coding gene	gene with protein product	"""smooth muscle myosin light chain kinase"""	600922	"""myosin, light polypeptide kinase"""			8575746	Standard	NM_053026		Approved	MLCK, smMLCK, MYLK1, MLCK1	uc003ego.3	Q15746	OTTHUMG00000141304	ENST00000475616.1:c.2477C>T	3.37:g.123419838G>A	ENSP00000418335:p.Ala826Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DUE3|D3DN97|O95796|O95797|O95798|O95799|Q14844|Q16794|Q17S15|Q3ZCP9|Q5MY99|Q5MYA0|Q6P2N0|Q7Z4J0|Q9C0L5|Q9UBG5|Q9UBY6|Q9UIT9	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Prot_kinase_cat_dom,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,superfamily_Kinase-like_dom,superfamily_Fibronectin_type3,smart_Ig_sub,smart_Ig_sub2,smart_Fibronectin_type3,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.A826V	ENST00000475616.1	37	c.2477	CCDS46896.1	3	.	.	.	.	.	.	.	.	.	.	G	15.17	2.754959	0.49362	.	.	ENSG00000065534	ENST00000360772;ENST00000360304;ENST00000359169;ENST00000346322;ENST00000475616	T;T;T;T;T	0.66638	-0.22;-0.17;-0.22;-0.17;-0.17	5.55	5.55	0.83447	.	.	.	.	.	T	0.60038	0.2238	L	0.44542	1.39	0.80722	D	1	B;B;P;B;B	0.41232	0.04;0.177;0.743;0.18;0.397	B;B;B;B;B	0.40444	0.026;0.097;0.329;0.067;0.146	T	0.56177	-0.8022	9	0.15499	T	0.54	.	16.644	0.85172	0.0:0.0:1.0:0.0	.	826;757;826;757;826	Q15746-6;Q15746-4;Q15746-3;Q15746-2;Q15746	.;.;.;.;MYLK_HUMAN	V	826;826;826;757;826	ENSP00000354004:A826V;ENSP00000353452:A826V;ENSP00000352088:A826V;ENSP00000320622:A757V;ENSP00000418335:A826V	ENSP00000320622:A757V	A	-	2	0	MYLK	124902528	1.000000	0.71417	1.000000	0.80357	0.888000	0.51559	3.781000	0.55394	2.624000	0.88883	0.561000	0.74099	GCC	MYLK	-	NULL		0.587	MYLK-004	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	MYLK	HGNC	protein_coding	OTTHUMT00000356464.1	G	NM_053025		123419838	-1	no_errors	ENST00000360304	ensembl	human	known	70_37	missense	SNP	1.000	A
MYO18B	84700	genome.wustl.edu	37	22	26164199	26164199	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:26164199G>A	ENST00000407587.2	+	4	485	c.316G>A	c.(316-318)Ggc>Agc	p.G106S	MYO18B_ENST00000536101.1_Missense_Mutation_p.G106S|MYO18B_ENST00000335473.7_Missense_Mutation_p.G106S			Q8IUG5	MY18B_HUMAN	myosin XVIIIB	106	Ser-rich.					cytoplasm (GO:0005737)|nucleus (GO:0005634)|unconventional myosin complex (GO:0016461)	ATP binding (GO:0005524)|motor activity (GO:0003774)			NS(2)|breast(6)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(4)|kidney(5)|large_intestine(27)|liver(2)|lung(60)|ovary(7)|prostate(8)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	146						AGACATTCTGGGCAAGGAGAG	0.602																																																	0													75.0	81.0	79.0					22																	26164199		1968	4152	6120	SO:0001583	missense	84700			AJ310931	CCDS54507.1	22q12.1	2011-09-27			ENSG00000133454	ENSG00000133454		"""Myosins / Myosin superfamily : Class XVIII"""	18150	protein-coding gene	gene with protein product		607295				12209013, 12547197	Standard	NM_032608		Approved	BK125H2.1	uc003abz.1	Q8IUG5	OTTHUMG00000151129	ENST00000407587.2:c.316G>A	22.37:g.26164199G>A	ENSP00000386096:p.Gly106Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RWP3|F5GYU7|Q8NDI8|Q8TE65|Q8WWS0|Q96KH2|Q96KR8|Q96KR9	Missense_Mutation	SNP	pfam_Myosin_head_motor_dom,superfamily_tRNA-bd_arm,superfamily_Ribosomal_zn-bd_dom,smart_Myosin_head_motor_dom,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.G106S	ENST00000407587.2	37	c.316		22	.	.	.	.	.	.	.	.	.	.	G	12.42	1.931952	0.34096	.	.	ENSG00000133454	ENST00000536101;ENST00000335473;ENST00000407587	D;D;D	0.86694	-2.14;-2.14;-2.16	4.71	-1.68	0.08212	.	0.440233	0.16897	N	0.195058	D	0.82595	0.5071	M	0.63428	1.95	0.09310	N	1	B	0.02656	0.0	B	0.09377	0.004	T	0.70726	-0.4793	10	0.46703	T	0.11	.	11.108	0.48214	0.4117:0.0:0.5883:0.0	.	106	F5GYU7	.	S	106	ENSP00000441229:G106S;ENSP00000334563:G106S;ENSP00000386096:G106S	ENSP00000334563:G106S	G	+	1	0	MYO18B	24494199	0.008000	0.16893	0.000000	0.03702	0.358000	0.29455	1.126000	0.31344	-0.428000	0.07339	-1.626000	0.00786	GGC	MYO18B	-	NULL		0.602	MYO18B-006	NOVEL	non_canonical_conserved|basic|appris_candidate_longest|exp_conf	protein_coding	MYO18B	HGNC	protein_coding	OTTHUMT00000400691.1	G	NM_032608		26164199	+1	no_errors	ENST00000335473	ensembl	human	known	70_37	missense	SNP	0.000	A
MYO5B	4645	genome.wustl.edu	37	18	47500758	47500758	+	Silent	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr18:47500758G>C	ENST00000285039.7	-	10	1583	c.1284C>G	c.(1282-1284)ctC>ctG	p.L428L		NM_001080467.2	NP_001073936.1	Q9ULV0	MYO5B_HUMAN	myosin VB	428	Myosin motor.				endosome localization (GO:0032439)|metabolic process (GO:0008152)|protein transport (GO:0015031)|transmembrane transport (GO:0055085)|vesicle-mediated transport (GO:0016192)|water transport (GO:0006833)	apical cortex (GO:0045179)|cytoplasmic vesicle membrane (GO:0030659)|extracellular vesicular exosome (GO:0070062)|myosin complex (GO:0016459)|protein complex (GO:0043234)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)|Rab GTPase binding (GO:0017137)			NS(1)|breast(6)|central_nervous_system(2)|endometrium(12)|haematopoietic_and_lymphoid_tissue(2)|kidney(9)|large_intestine(6)|lung(29)|ovary(3)|pancreas(1)|prostate(1)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(4)	87				READ - Rectum adenocarcinoma(32;0.103)		AGTGCTGCTTGAGGGAGGTGT	0.572																																																	0													123.0	134.0	130.0					18																	47500758		2173	4254	6427	SO:0001819	synonymous_variant	4645			AB032945	CCDS42436.1	18q	2011-09-27			ENSG00000167306	ENSG00000167306		"""Myosins / Myosin superfamily : Class V"""	7603	protein-coding gene	gene with protein product		606540				8884266, 17462998	Standard	NM_001080467		Approved	KIAA1119	uc002leb.2	Q9ULV0		ENST00000285039.7:c.1284C>G	18.37:g.47500758G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B0I1R3|Q0P656|Q9H6Y6	Silent	SNP	pfam_Myosin_head_motor_dom,pfam_Dil_domain,pfam_IQ_motif_EF-hand-BS,superfamily_Prefoldin,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_Dilute,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.L428	ENST00000285039.7	37	c.1284	CCDS42436.1	18																																																																																			MYO5B	-	pfam_Myosin_head_motor_dom,smart_Myosin_head_motor_dom		0.572	MYO5B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYO5B	HGNC	protein_coding	OTTHUMT00000448515.2	G			47500758	-1	no_errors	ENST00000285039	ensembl	human	known	70_37	silent	SNP	1.000	C
N4BP2L2	10443	genome.wustl.edu	37	13	33054766	33054766	+	5'UTR	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr13:33054766C>T	ENST00000380121.3	-	0	9				N4BP2L2_ENST00000399396.3_Intron|N4BP2L2_ENST00000446957.2_Intron|N4BP2L2_ENST00000357505.6_Intron|N4BP2L2_ENST00000504114.1_Intron			Q92802	N42L2_HUMAN	NEDD4 binding protein 2-like 2						negative regulation of hematopoietic stem cell differentiation (GO:1902037)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of hematopoietic stem cell proliferation (GO:1902035)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|transcriptional repressor complex (GO:0017053)	enzyme binding (GO:0019899)|RNA polymerase II transcription corepressor activity (GO:0001106)			kidney(4)|large_intestine(3)|liver(1)|lung(6)|skin(1)|urinary_tract(1)	16		Lung SC(185;0.0262)		all cancers(112;9.5e-07)|Epithelial(112;5.07e-06)|OV - Ovarian serous cystadenocarcinoma(117;0.00196)|BRCA - Breast invasive adenocarcinoma(63;0.00438)|GBM - Glioblastoma multiforme(144;0.243)		GATATTTCTTCAGTCACACCT	0.333																																																	0																																										SO:0001623	5_prime_UTR_variant	10443			U50532	CCDS9346.1, CCDS45024.1, CCDS61307.1	13q13.1	2010-12-02			ENSG00000244754	ENSG00000244754			26916	protein-coding gene	gene with protein product	"""phosphonoformate immuno-associated protein 5"""	615788				8812419	Standard	NM_014887		Approved	CG005, PFAAP5	uc010abe.1	Q92802	OTTHUMG00000016700	ENST00000380121.3:c.-2798G>A	13.37:g.33054766C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A3KME8	RNA	SNP	-	NULL	ENST00000380121.3	37	NULL		13																																																																																			N4BP2L2	-	-		0.333	N4BP2L2-013	KNOWN	basic|exp_conf	processed_transcript	N4BP2L2	HGNC	protein_coding	OTTHUMT00000468133.1	C	NM_014887		33054766	-1	no_errors	ENST00000473025	ensembl	human	known	70_37	rna	SNP	0.200	T
NDST3	9348	genome.wustl.edu	37	4	118975531	118975531	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr4:118975531G>C	ENST00000296499.5	+	2	869	c.466G>C	c.(466-468)Gaa>Caa	p.E156Q	NDST3_ENST00000433996.2_Missense_Mutation_p.E156Q	NM_004784.2	NP_004775.1	O95803	NDST3_HUMAN	N-deacetylase/N-sulfotransferase (heparan glucosaminyl) 3	156	Heparan sulfate N-deacetylase 3.				heparan sulfate proteoglycan biosynthetic process (GO:0015012)|heparin biosynthetic process (GO:0030210)	Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	[heparan sulfate]-glucosamine N-sulfotransferase activity (GO:0015016)|deacetylase activity (GO:0019213)			NS(1)|breast(3)|cervix(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(23)|prostate(1)|skin(3)|upper_aerodigestive_tract(3)|urinary_tract(1)	54						ATACTGTGTAGAATATGGTGT	0.328																																																	0													54.0	55.0	55.0					4																	118975531		2203	4299	6502	SO:0001583	missense	9348			AF074924	CCDS3708.1	4q26	2008-08-04			ENSG00000164100	ENSG00000164100		"""Sulfotransferases, membrane-bound"""	7682	protein-coding gene	gene with protein product		603950				9915799	Standard	NM_004784		Approved	HSST3	uc003ibx.3	O95803	OTTHUMG00000132959	ENST00000296499.5:c.466G>C	4.37:g.118975531G>C	ENSP00000296499:p.Glu156Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DI67|Q4W5C1|Q4W5D0|Q6UWC5|Q9UP21	Missense_Mutation	SNP	pfam_Heparan_SO4_deacetylase,pfam_Sulfotransferase_dom	p.E156Q	ENST00000296499.5	37	c.466	CCDS3708.1	4	.	.	.	.	.	.	.	.	.	.	G	17.44	3.391378	0.62066	.	.	ENSG00000164100	ENST00000296499;ENST00000433996	T;T	0.51325	1.03;0.71	5.3	5.3	0.74995	.	0.101356	0.64402	D	0.000003	T	0.67059	0.2853	L	0.58428	1.81	0.53688	D	0.999979	D;B;B	0.76494	0.999;0.345;0.211	D;B;B	0.87578	0.998;0.279;0.045	T	0.68089	-0.5501	10	0.56958	D	0.05	.	18.9397	0.92600	0.0:0.0:1.0:0.0	.	156;156;156	B4DI67;O95803;O95803-2	.;NDST3_HUMAN;.	Q	156	ENSP00000296499:E156Q;ENSP00000396625:E156Q	ENSP00000296499:E156Q	E	+	1	0	NDST3	119194979	1.000000	0.71417	0.992000	0.48379	0.978000	0.69477	9.829000	0.99411	2.464000	0.83262	0.655000	0.94253	GAA	NDST3	-	pfam_Heparan_SO4_deacetylase		0.328	NDST3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDST3	HGNC	protein_coding	OTTHUMT00000256517.4	G	NM_004784		118975531	+1	no_errors	ENST00000296499	ensembl	human	known	70_37	missense	SNP	1.000	C
NDUFA6	4700	genome.wustl.edu	37	22	42483070	42483070	+	Silent	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:42483070G>C	ENST00000498737.2	-	2	459	c.327C>G	c.(325-327)gtC>gtG	p.V109V	NDUFA6_ENST00000602404.1_Silent_p.V83V|RP1-257I20.14_ENST00000602718.1_RNA|NDUFA6_ENST00000470753.1_Silent_p.V26V	NM_002490.3	NP_002481.2	P56556	NDUA6_HUMAN	NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6, 14kDa	109					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|response to oxidative stress (GO:0006979)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial membrane (GO:0031966)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			kidney(1)|lung(3)|upper_aerodigestive_tract(1)	5						TTACCTTAATGACCAGAAGAT	0.428																																																	0													166.0	163.0	164.0					22																	42483070		2203	4300	6503	SO:0001819	synonymous_variant	4700			AF047182	CCDS33656.1	22q13.2	2010-05-07	2002-08-29		ENSG00000184983	ENSG00000184983		"""LYR motif containing"", ""Mitochondrial respiratory chain complex / Complex I"""	7690	protein-coding gene	gene with protein product	"""complex I B14 subunit"""	602138	"""NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 6 (14kD, B14)"""			9763676, 9425316	Standard	NM_002490		Approved	B14, LYRM6, CI-B14, NADHB14	uc003bcb.3	P56556	OTTHUMG00000151287	ENST00000498737.2:c.327C>G	22.37:g.42483070G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RE54|O43675|Q6FGW0|Q6IBT8|Q6IC39	Silent	SNP	pfam_Complex1_LYR	p.V109	ENST00000498737.2	37	c.327	CCDS33656.1	22																																																																																			NDUFA6	-	pfam_Complex1_LYR		0.428	NDUFA6-001	KNOWN	basic|CCDS	protein_coding	NDUFA6	HGNC	protein_coding	OTTHUMT00000322089.4	G	NM_002490		42483070	-1	no_errors	ENST00000498737	ensembl	human	known	70_37	silent	SNP	1.000	C
NEK6	10783	genome.wustl.edu	37	9	127054795	127054795	+	Intron	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr9:127054795C>G	ENST00000320246.5	+	2	116				NEK6_ENST00000545174.1_Intron|NEK6_ENST00000373600.3_Intron|NEK6_ENST00000394199.2_Intron|NEK6_ENST00000546191.1_Intron|NEK6_ENST00000539416.1_Missense_Mutation_p.S8C|NEK6_ENST00000540326.1_Intron|NEK6_ENST00000373603.1_Intron	NM_014397.5	NP_055212.2	Q9HC98	NEK6_HUMAN	NIMA-related kinase 6						apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|cytokinesis (GO:0000910)|G2 DNA damage checkpoint (GO:0031572)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of cellular senescence (GO:2000772)|regulation of mitotic cell cycle (GO:0007346)|regulation of mitotic metaphase/anaphase transition (GO:0030071)|signal transduction (GO:0007165)|spindle assembly (GO:0051225)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|kinesin binding (GO:0019894)|magnesium ion binding (GO:0000287)|protein kinase binding (GO:0019901)|protein serine/threonine kinase activity (GO:0004674)|signal transducer activity (GO:0004871)			endometrium(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|prostate(1)|skin(1)|stomach(1)	15						GGATGGGATTCTAGATGCTCG	0.572																																					NSCLC(122;934 1785 18647 44295 45571)												0													67.0	68.0	68.0					9																	127054795		692	1591	2283	SO:0001627	intron_variant	10783			AF087909	CCDS6854.1, CCDS48015.1, CCDS55338.1, CCDS55339.1	9q33.3-q34.11	2012-11-15	2012-11-15		ENSG00000119408	ENSG00000119408			7749	protein-coding gene	gene with protein product	"""putative serine-threonine protein kinase"""	604884	"""NIMA (never in mitosis gene a)-related kinase 6"""			10702691	Standard	NM_001145001		Approved	SID6-1512	uc004boh.3	Q9HC98	OTTHUMG00000020650	ENST00000320246.5:c.-29-9420C>G	9.37:g.127054795C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2D9|Q5TBG3|Q5TBG9|Q6FG86|Q6IAR3|Q96E83|Q9ULX2	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S8C	ENST00000320246.5	37	c.23	CCDS6854.1	9	.	.	.	.	.	.	.	.	.	.	C	4.534	0.099209	0.08681	.	.	ENSG00000119408	ENST00000539416	T	0.72051	-0.62	2.37	-3.25	0.05079	.	.	.	.	.	T	0.59307	0.2184	.	.	.	0.09310	N	0.999995	.	.	.	.	.	.	T	0.54689	-0.8256	6	0.49607	T	0.09	.	4.3138	0.10982	0.3392:0.2275:0.4333:0.0	.	.	.	.	C	8	ENSP00000439651:S8C	ENSP00000439651:S8C	S	+	2	0	NEK6	126094616	0.000000	0.05858	0.000000	0.03702	0.011000	0.07611	-0.766000	0.04725	-0.761000	0.04670	-1.302000	0.01329	TCT	NEK6	-	NULL		0.572	NEK6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NEK6	HGNC	protein_coding	OTTHUMT00000054016.1	C	NM_014397		127054795	+1	no_errors	ENST00000539416	ensembl	human	known	70_37	missense	SNP	0.000	G
NFE2L2	4780	genome.wustl.edu	37	2	178095888	178095888	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr2:178095888G>A	ENST00000397062.3	-	5	1997	c.1443C>T	c.(1441-1443)ttC>ttT	p.F481F	NFE2L2_ENST00000397063.4_Silent_p.F465F|NFE2L2_ENST00000464747.1_Silent_p.F465F|NFE2L2_ENST00000446151.2_Silent_p.F458F	NM_006164.4	NP_006155.2	Q16236	NF2L2_HUMAN	nuclear factor, erythroid 2-like 2	481					cellular response to hydrogen peroxide (GO:0070301)|cellular response to laminar fluid shear stress (GO:0071499)|cellular response to tumor necrosis factor (GO:0071356)|endoplasmic reticulum unfolded protein response (GO:0030968)|negative regulation of endothelial cell apoptotic process (GO:2000352)|negative regulation of oxidative stress-induced intrinsic apoptotic signaling pathway (GO:1902176)|positive regulation of blood coagulation (GO:0030194)|positive regulation of reactive oxygen species metabolic process (GO:2000379)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription from RNA polymerase II promoter in response to stress (GO:0036003)|proteasomal ubiquitin-independent protein catabolic process (GO:0010499)|proteasome-mediated ubiquitin-dependent protein catabolic process (GO:0043161)|protein ubiquitination (GO:0016567)|regulation of embryonic development (GO:0045995)|regulation of removal of superoxide radicals (GO:2000121)|transcription from RNA polymerase II promoter (GO:0006366)	centrosome (GO:0005813)|chromatin (GO:0000785)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	DNA binding (GO:0003677)|protein domain specific binding (GO:0019904)|RNA polymerase II activating transcription factor binding (GO:0001102)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001205)|sequence-specific DNA binding transcription factor activity (GO:0003700)			central_nervous_system(1)|cervix(4)|endometrium(14)|kidney(5)|large_intestine(4)|liver(13)|lung(71)|oesophagus(29)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	158			Epithelial(96;0.00442)|OV - Ovarian serous cystadenocarcinoma(117;0.00739)|all cancers(119;0.0195)|LUSC - Lung squamous cell carcinoma(2;0.036)|Lung(16;0.0935)			TCATTTCGTTGAAGTCAACAA	0.433			Mis		"""NSCLC, HNSCC"""					HNSCC(56;0.16)																														Dom	yes		2	2q31	4780	nuclear factor (erythroid-derived 2)-like 2 (NRF2)		E	0													175.0	155.0	161.0					2																	178095888		1851	4093	5944	SO:0001819	synonymous_variant	4780				CCDS42782.1, CCDS46457.1, CCDS46458.1	2q31	2013-08-23	2013-08-23		ENSG00000116044	ENSG00000116044		"""basic leucine zipper proteins"""	7782	protein-coding gene	gene with protein product	"""NF-E2-related factor 2"""	600492	"""nuclear factor (erythroid-derived 2)-like 2"""			7937919	Standard	NM_006164		Approved	NRF2	uc002ulh.5	Q16236	OTTHUMG00000133620	ENST00000397062.3:c.1443C>T	2.37:g.178095888G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBU2|B4E338|E9PGJ7|Q53RW6|Q59HH2|Q96F71	Silent	SNP	pfam_bZIP,superfamily_Euk_TF_DNA-bd,superfamily_Serpin_dom,smart_bZIP,pfscan_bZIP	p.F481	ENST00000397062.3	37	c.1443	CCDS42782.1	2																																																																																			NFE2L2	-	superfamily_Euk_TF_DNA-bd		0.433	NFE2L2-001	KNOWN	basic|CCDS	protein_coding	NFE2L2	HGNC	protein_coding	OTTHUMT00000257752.4	G	NM_006164		178095888	-1	no_errors	ENST00000397062	ensembl	human	known	70_37	silent	SNP	1.000	A
NGEF	25791	genome.wustl.edu	37	2	233744295	233744295	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr2:233744295C>G	ENST00000264051.3	-	15	2315	c.2037G>C	c.(2035-2037)caG>caC	p.Q679H	NGEF_ENST00000373552.4_Missense_Mutation_p.Q587H|NGEF_ENST00000539537.1_Missense_Mutation_p.Q402H	NM_019850.2	NP_062824.2	Q8N5V2	NGEF_HUMAN	neuronal guanine nucleotide exchange factor	679					apoptotic signaling pathway (GO:0097190)|ephrin receptor signaling pathway (GO:0048013)|negative regulation of dendritic spine morphogenesis (GO:0061002)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of GTPase activity (GO:0043087)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	cell projection (GO:0042995)|cytosol (GO:0005829)|membrane (GO:0016020)	Rho guanyl-nucleotide exchange factor activity (GO:0005089)			central_nervous_system(4)|endometrium(8)|kidney(2)|large_intestine(3)|lung(10)|ovary(3)|pancreas(1)|skin(4)	35		Breast(86;0.00279)|Renal(207;0.00339)|all_hematologic(139;0.00793)|Acute lymphoblastic leukemia(138;0.0182)|all_lung(227;0.0271)|Lung NSC(271;0.0839)		Epithelial(121;8.65e-17)|BRCA - Breast invasive adenocarcinoma(100;0.00037)|LUSC - Lung squamous cell carcinoma(224;0.00813)|Lung(119;0.00984)|GBM - Glioblastoma multiforme(43;0.0604)		CCTTGAGGTTCTGGGACCGGA	0.587																																																	0													93.0	94.0	94.0					2																	233744295		2203	4300	6503	SO:0001583	missense	25791			AJ238899	CCDS2500.1, CCDS46544.1	2q37	2012-07-24			ENSG00000066248	ENSG00000066248		"""Rho guanine nucleotide exchange factors"""	7807	protein-coding gene	gene with protein product	"""ephexin"""	605991				10777665	Standard	NM_019850		Approved	ARHGEF27	uc002vts.2	Q8N5V2	OTTHUMG00000133272	ENST00000264051.3:c.2037G>C	2.37:g.233744295C>G	ENSP00000264051:p.Gln679His	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DMB8|B9A045|E9PC42|Q53QQ4|Q53ST7|Q6GMQ5|Q9NQD6	Missense_Mutation	SNP	pfam_DH-domain,pfam_SH3_domain,pfam_SH3_2,superfamily_DH-domain,superfamily_SH3_domain,smart_DH-domain,smart_Pleckstrin_homology,smart_SH3_domain,pfscan_Pleckstrin_homology,pfscan_SH3_domain,pfscan_DH-domain	p.Q679H	ENST00000264051.3	37	c.2037	CCDS2500.1	2	.	.	.	.	.	.	.	.	.	.	c	13.72	2.320190	0.41096	.	.	ENSG00000066248	ENST00000264051;ENST00000373552;ENST00000541023;ENST00000539537	T;T;T	0.71817	-0.39;-0.6;-0.56	4.19	3.29	0.37713	.	0.000000	0.85682	D	0.000000	T	0.72835	0.3510	N	0.24115	0.695	0.53005	D	0.999961	P;D	0.89917	0.613;1.0	B;D	0.83275	0.248;0.996	T	0.73401	-0.3994	10	0.54805	T	0.06	-30.1363	12.2291	0.54478	0.0:0.9142:0.0:0.0858	.	587;679	E9PC42;Q8N5V2	.;NGEF_HUMAN	H	679;587;569;402	ENSP00000264051:Q679H;ENSP00000362653:Q587H;ENSP00000439035:Q402H	ENSP00000264051:Q679H	Q	-	3	2	NGEF	233452539	1.000000	0.71417	1.000000	0.80357	0.989000	0.77384	2.342000	0.43992	0.703000	0.31848	0.558000	0.71614	CAG	NGEF	-	NULL		0.587	NGEF-001	KNOWN	basic|CCDS	protein_coding	NGEF	HGNC	protein_coding	OTTHUMT00000257051.2	C	XM_044799		233744295	-1	no_errors	ENST00000264051	ensembl	human	known	70_37	missense	SNP	1.000	G
NGLY1	55768	genome.wustl.edu	37	3	25770649	25770649	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:25770649C>G	ENST00000280700.5	-	10	1746	c.1586G>C	c.(1585-1587)aGa>aCa	p.R529T	NGLY1_ENST00000428257.1_Missense_Mutation_p.R511T|NGLY1_ENST00000396649.3_Missense_Mutation_p.R529T|NGLY1_ENST00000422724.2_3'UTR|NGLY1_ENST00000467224.1_5'UTR|NGLY1_ENST00000417874.2_Missense_Mutation_p.R487T	NM_018297.3	NP_060767.2	Q96IV0	NGLY1_HUMAN	N-glycanase 1	529	PAW. {ECO:0000255|PROSITE- ProRule:PRU00731}.				glycoprotein catabolic process (GO:0006516)	cytoplasm (GO:0005737)	metal ion binding (GO:0046872)|peptide-N4-(N-acetyl-beta-glucosaminyl)asparagine amidase activity (GO:0000224)			breast(1)|endometrium(1)|kidney(2)|large_intestine(4)|lung(7)|prostate(2)|skin(1)	18						TTCAACTTTTCTGAATATAGA	0.313																																																	0													129.0	119.0	122.0					3																	25770649		2202	4299	6501	SO:0001583	missense	55768			AF250924	CCDS33719.1, CCDS46777.1, CCDS46778.1, CCDS46779.1	3p23	2006-08-30			ENSG00000151092	ENSG00000151092			17646	protein-coding gene	gene with protein product		610661					Standard	NM_018297		Approved	FLJ11005, PNG1	uc003cdl.3	Q96IV0	OTTHUMG00000155600	ENST00000280700.5:c.1586G>C	3.37:g.25770649C>G	ENSP00000280700:p.Arg529Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DJE9|Q59FB1|Q6PJD8|Q9BVR8|Q9NR70	Missense_Mutation	SNP	pfam_PUB_domain,pfam_Transglutaminase-like,pfam_Rad4/PNGase_transGLS-fold,pfam_Peptide_N_glycanase_PAW_dom,superfamily_Galactose-bd-like,smart_PUG-dom,smart_Transglutaminase-like,smart_Peptide_N_glycanase_PAW_dom	p.R529T	ENST00000280700.5	37	c.1586	CCDS33719.1	3	.	.	.	.	.	.	.	.	.	.	C	28.9	4.958460	0.92726	.	.	ENSG00000151092	ENST00000428257;ENST00000280700;ENST00000396649;ENST00000308710;ENST00000417874	T;T;T;T	0.54071	0.59;0.59;0.59;0.59	5.82	5.82	0.92795	Peptide N glycanase, PAW domain (3);Galactose-binding domain-like (1);	0.000000	0.85682	D	0.000000	T	0.77658	0.4163	M	0.85462	2.755	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.998;1.0	D;D;D;D	0.97110	0.995;0.999;0.957;1.0	T	0.80037	-0.1550	10	0.87932	D	0	-19.6035	20.1006	0.97874	0.0:1.0:0.0:0.0	.	487;511;529;529	B4DJE9;Q96IV0-2;Q96IV0-3;Q96IV0	.;.;.;NGLY1_HUMAN	T	511;529;529;508;487	ENSP00000387430:R511T;ENSP00000280700:R529T;ENSP00000307980:R508T;ENSP00000389888:R487T	ENSP00000280700:R529T	R	-	2	0	NGLY1	25745653	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	5.545000	0.67237	2.757000	0.94681	0.561000	0.74099	AGA	NGLY1	-	pfam_Peptide_N_glycanase_PAW_dom,superfamily_Galactose-bd-like,smart_Peptide_N_glycanase_PAW_dom		0.313	NGLY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NGLY1	HGNC	protein_coding	OTTHUMT00000340832.2	C			25770649	-1	no_errors	ENST00000280700	ensembl	human	known	70_37	missense	SNP	1.000	G
NPAP1	23742	genome.wustl.edu	37	15	24921288	24921288	+	Missense_Mutation	SNP	C	C	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr15:24921288C>A	ENST00000329468.2	+	1	748	c.274C>A	c.(274-276)Ctg>Atg	p.L92M		NM_018958.2	NP_061831.2	Q9NZP6	NPAP1_HUMAN	nuclear pore associated protein 1	92					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)											GGGTTGGGGGCTGGCCATCAG	0.667																																																	0													22.0	21.0	21.0					15																	24921288		2191	4276	6467	SO:0001583	missense	23742			AF179681	CCDS10015.1	15q11-q13	2012-07-19	2012-06-14	2012-06-14	ENSG00000185823	ENSG00000185823			1190	protein-coding gene	gene with protein product		610922	"""chromosome 15 open reading frame 2"""	C15orf2		10783265, 22694955	Standard	NM_018958		Approved		uc001ywo.3	Q9NZP6	OTTHUMG00000129179	ENST00000329468.2:c.274C>A	15.37:g.24921288C>A	ENSP00000333735:p.Leu92Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.L92M	ENST00000329468.2	37	c.274	CCDS10015.1	15	.	.	.	.	.	.	.	.	.	.	.	9.483	1.098779	0.20552	.	.	ENSG00000185823	ENST00000329468	T	0.05996	3.36	0.713	-0.929	0.10444	.	.	.	.	.	T	0.10121	0.0248	L	0.29908	0.895	0.09310	N	1	D	0.59767	0.986	D	0.63793	0.918	T	0.27191	-1.0081	8	0.45353	T	0.12	.	.	.	.	.	92	Q9NZP6	CO002_HUMAN	M	92	ENSP00000333735:L92M	ENSP00000333735:L92M	L	+	1	2	C15orf2	22472381	0.108000	0.22018	0.000000	0.03702	0.009000	0.06853	-0.155000	0.10115	-0.291000	0.09012	0.195000	0.17529	CTG	NPAP1	-	NULL		0.667	NPAP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NPAP1	HGNC	protein_coding	OTTHUMT00000251253.1	C	NM_018958		24921288	+1	no_errors	ENST00000329468	ensembl	human	known	70_37	missense	SNP	0.000	A
NUMA1	4926	genome.wustl.edu	37	11	71726075	71726075	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:71726075G>A	ENST00000393695.3	-	15	2805	c.2474C>T	c.(2473-2475)gCa>gTa	p.A825V	RP11-849H4.4_ENST00000502284.1_RNA|NUMA1_ENST00000351960.6_Intron|NUMA1_ENST00000358965.6_Missense_Mutation_p.A825V	NM_006185.2	NP_006176.2			nuclear mitotic apparatus protein 1											central_nervous_system(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(3)|kidney(4)|large_intestine(12)|lung(20)|ovary(5)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(3)	65						GCCATACTGTGCCTCCTCTTG	0.582			T	RARA	APL																																			Dom	yes		11	11q13	4926	nuclear mitotic apparatus protein 1		L	0													106.0	103.0	104.0					11																	71726075		2200	4293	6493	SO:0001583	missense	4926			Z11584	CCDS31633.1, CCDS66156.1	11q13	2008-02-05				ENSG00000137497			8059	protein-coding gene	gene with protein product		164009				8406455	Standard	NM_006185		Approved		uc001orl.1	Q14980		ENST00000393695.3:c.2474C>T	11.37:g.71726075G>A	ENSP00000377298:p.Ala825Val	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	superfamily_Prefoldin	p.A825V	ENST00000393695.3	37	c.2474	CCDS31633.1	11	.	.	.	.	.	.	.	.	.	.	G	15.74	2.921829	0.52653	.	.	ENSG00000137497	ENST00000358965;ENST00000393695;ENST00000359652;ENST00000542977	T;T;T	0.32023	2.7;2.7;1.47	5.91	5.0	0.66597	.	0.206543	0.34652	N	0.003794	T	0.23330	0.0564	L	0.33485	1.01	0.30958	N	0.723949	P;B;B;P	0.35575	0.51;0.25;0.068;0.51	B;B;B;B	0.36666	0.23;0.117;0.019;0.23	T	0.20672	-1.0268	10	0.40728	T	0.16	.	8.7617	0.34678	0.0751:0.0:0.773:0.1518	.	831;309;825;825	Q4LE64;Q59HB8;Q14980-2;Q14980	.;.;.;NUMA1_HUMAN	V	825;825;388;825	ENSP00000351851:A825V;ENSP00000377298:A825V;ENSP00000444880:A825V	ENSP00000351851:A825V	A	-	2	0	NUMA1	71403723	0.011000	0.17503	0.891000	0.34965	0.786000	0.44442	1.565000	0.36386	1.494000	0.48533	0.655000	0.94253	GCA	NUMA1	-	NULL		0.582	NUMA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUMA1	HGNC	protein_coding	OTTHUMT00000395769.1	G			71726075	-1	no_errors	ENST00000393695	ensembl	human	known	70_37	missense	SNP	0.886	A
OBSCN	84033	genome.wustl.edu	37	1	228511046	228511046	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:228511046G>A	ENST00000422127.1	+	56	15435	c.15391G>A	c.(15391-15393)Gag>Aag	p.E5131K	OBSCN_ENST00000570156.2_Missense_Mutation_p.E6088K|OBSCN_ENST00000366709.4_Missense_Mutation_p.E2250K|OBSCN_ENST00000366707.4_Missense_Mutation_p.E2765K|OBSCN_ENST00000284548.11_Missense_Mutation_p.E5131K	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	5131	Ig-like 49.				apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GTTCCTGACTGAGTTGCAGAA	0.547																																																	0													45.0	48.0	47.0					1																	228511046		2096	4210	6306	SO:0001583	missense	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.15391G>A	1.37:g.228511046G>A	ENSP00000409493:p.Glu5131Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Missense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.E5131K	ENST00000422127.1	37	c.15391	CCDS58065.1	1	.	.	.	.	.	.	.	.	.	.	G	20.2	3.941914	0.73557	.	.	ENSG00000154358	ENST00000284548;ENST00000422127;ENST00000366707;ENST00000366709	T;T;T;T	0.65364	-0.15;-0.15;-0.15;-0.15	5.07	4.14	0.48551	Immunoglobulin I-set (1);Immunoglobulin-like (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	T	0.67078	0.2855	L	0.33293	1	0.44316	D	0.997196	D;D	0.58970	0.984;0.98	P;P	0.61201	0.885;0.817	T	0.67440	-0.5670	10	0.40728	T	0.16	.	15.4962	0.75653	0.0:0.1389:0.8611:0.0	.	5131;5131	Q5VST9;Q5VST9-3	OBSCN_HUMAN;.	K	5131;5131;2765;2250	ENSP00000284548:E5131K;ENSP00000409493:E5131K;ENSP00000355668:E2765K;ENSP00000355670:E2250K	ENSP00000284548:E5131K	E	+	1	0	OBSCN	226577669	1.000000	0.71417	0.908000	0.35775	0.259000	0.26198	4.448000	0.60027	1.320000	0.45209	0.655000	0.94253	GAG	OBSCN	-	pfam_Ig_I-set,pfscan_Ig-like		0.547	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		G	NM_052843		228511046	+1	no_errors	ENST00000422127	ensembl	human	known	70_37	missense	SNP	0.996	A
OBSCN	84033	genome.wustl.edu	37	1	228560176	228560176	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:228560176C>T	ENST00000422127.1	+	94	21741	c.21697C>T	c.(21697-21699)Cag>Tag	p.Q7233*	OBSCN_ENST00000570156.2_Nonsense_Mutation_p.Q8190*|OBSCN_ENST00000366707.4_Nonsense_Mutation_p.Q4867*	NM_001098623.2	NP_001092093.2	Q5VST9	OBSCN_HUMAN	obscurin, cytoskeletal calmodulin and titin-interacting RhoGEF	7233					apoptotic signaling pathway (GO:0097190)|multicellular organismal development (GO:0007275)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|protein localization to M-band (GO:0036309)|regulation of small GTPase mediated signal transduction (GO:0051056)|sarcomere organization (GO:0045214)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|M band (GO:0031430)|myofibril (GO:0030016)|Z disc (GO:0030018)	ankyrin binding (GO:0030506)|ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)|structural constituent of muscle (GO:0008307)|titin binding (GO:0031432)			NS(2)|breast(7)|central_nervous_system(5)|cervix(2)|endometrium(30)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(37)|lung(89)|ovary(8)|pancreas(3)|prostate(13)|skin(6)|stomach(11)|upper_aerodigestive_tract(2)|urinary_tract(3)	223		Prostate(94;0.0405)				GGCTGAGTCCCAGTCGGAGGA	0.692																																																	0													13.0	17.0	16.0					1																	228560176		2078	4202	6280	SO:0001587	stop_gained	84033			AJ002535	CCDS1570.2, CCDS58065.1, CCDS59204.1	1q42	2014-09-17			ENSG00000154358	ENSG00000154358		"""Rho guanine nucleotide exchange factors"", ""Immunoglobulin superfamily / I-set domain containing"", ""Fibronectin type III domain containing"""	15719	protein-coding gene	gene with protein product		608616				11448995, 11814696	Standard	NM_001098623		Approved	KIAA1556, UNC89, KIAA1639, ARHGEF30	uc001hsq.2	Q5VST9	OTTHUMG00000039772	ENST00000422127.1:c.21697C>T	1.37:g.228560176C>T	ENSP00000409493:p.Gln7233*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2A664|Q5T7G8|Q5T7G9|Q5VSU2|Q86YC7|Q8NHN0|Q8NHN1|Q8NHN2|Q8NHN3|Q8NHN4|Q8NHN5|Q8NHN6|Q8NHN7|Q8NHN8|Q8NHN9|Q96AA2|Q9HCD3|Q9HCL6	Nonsense_Mutation	SNP	pfam_Ig_I-set,pfam_Immunoglobulin,pfam_Ig_V-set,pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Fibronectin_type3,pfam_DH-domain,pfam_IQ_motif_EF-hand-BS,superfamily_Kinase-like_dom,superfamily_DH-domain,superfamily_Fibronectin_type3,superfamily_SH3_domain,smart_Ig_sub,smart_Ig_sub2,smart_Ig_V-set_subgr,smart_Fibronectin_type3,smart_IQ_motif_EF-hand-BS,smart_DH-domain,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Fibronectin_type3,pfscan_IQ_motif_EF-hand-BS,pfscan_Pleckstrin_homology,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like,pfscan_DH-domain	p.Q7233*	ENST00000422127.1	37	c.21697	CCDS58065.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	64|64	83.416526|83.416526	0.99995|0.99995	.|.	.|.	ENSG00000154358|ENSG00000154358	ENST00000441106|ENST00000422127;ENST00000366707	.|.	.|.	.|.	1.05|1.05	1.05|1.05	0.20165|0.20165	.|.	.|0.325854	.|0.26820	.|N	.|0.022332	T|.	0.11836|.	0.0288|.	.|.	.|.	.|.	0.09310|0.09310	N|N	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|.	0.23797|.	-1.0178|.	4|.	.|0.07325	.|T	.|0.83	.|.	3.3597|3.3597	0.07182|0.07182	0.0:0.6821:0.0:0.3179|0.0:0.6821:0.0:0.3179	.|.	.|.	.|.	.|.	L|X	1849|7233;4867	.|.	.|ENSP00000355668:Q4867X	P|Q	+|+	2|1	0|0	OBSCN|OBSCN	226626799|226626799	0.000000|0.000000	0.05858|0.05858	0.697000|0.697000	0.30258|0.30258	0.377000|0.377000	0.30045|0.30045	0.125000|0.125000	0.15749|0.15749	0.119000|0.119000	0.18210|0.18210	0.121000|0.121000	0.15741|0.15741	CCA|CAG	OBSCN	-	NULL		0.692	OBSCN-204	KNOWN	basic|CCDS	protein_coding	OBSCN	HGNC	protein_coding		C	NM_052843		228560176	+1	no_errors	ENST00000422127	ensembl	human	known	70_37	nonsense	SNP	0.007	T
OPTN	10133	genome.wustl.edu	37	10	13169814	13169814	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr10:13169814G>T	ENST00000378748.3	+	13	1674	c.1312G>T	c.(1312-1314)Gct>Tct	p.A438S	OPTN_ENST00000378764.2_Missense_Mutation_p.A432S|OPTN_ENST00000263036.5_Missense_Mutation_p.A438S|OPTN_ENST00000378752.3_Missense_Mutation_p.A432S|OPTN_ENST00000378757.2_Missense_Mutation_p.A438S|OPTN_ENST00000378747.3_Missense_Mutation_p.A438S	NM_001008211.1|NM_001008213.1	NP_001008212|NP_001008214	Q96CV9	OPTN_HUMAN	optineurin	438	Interaction with HD.|Interaction with MYO6.				cell death (GO:0008219)|defense response to Gram-negative bacterium (GO:0050829)|G2/M transition of mitotic cell cycle (GO:0000086)|Golgi organization (GO:0007030)|Golgi ribbon formation (GO:0090161)|Golgi to plasma membrane protein transport (GO:0043001)|macroautophagy (GO:0016236)|mitotic cell cycle (GO:0000278)|negative regulation of receptor recycling (GO:0001920)|protein targeting to Golgi (GO:0000042)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|endosome (GO:0005768)|Golgi apparatus (GO:0005794)|Golgi membrane (GO:0000139)|nucleoplasm (GO:0005654)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)	polyubiquitin binding (GO:0031593)|protein C-terminus binding (GO:0008022)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(2)|large_intestine(5)|lung(9)|ovary(2)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	22						GAAGGCTCTGGCTTCCAAACA	0.468																																																	0													97.0	91.0	93.0					10																	13169814		2203	4300	6503	SO:0001583	missense	10133			AF420371	CCDS7094.1	10p14	2014-01-28	2003-09-08		ENSG00000123240	ENSG00000123240			17142	protein-coding gene	gene with protein product		602432	"""glaucoma 1, open angle, E (adult-onset)"""	GLC1E		11834836, 9488477	Standard	NM_001008211		Approved	FIP2, HYPL, FIP-2, TFIIIA-INTP, NRP, HIP7	uc001ilx.1	Q96CV9	OTTHUMG00000017690	ENST00000378748.3:c.1312G>T	10.37:g.13169814G>T	ENSP00000368022:p.Ala438Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KP00|D3DRS4|D3DRS8|Q5T672|Q5T673|Q5T674|Q5T675|Q7LDL9|Q8N562|Q9UET9|Q9UEV4|Q9Y218	Missense_Mutation	SNP	pfam_NEMO_N	p.A438S	ENST00000378748.3	37	c.1312	CCDS7094.1	10	.	.	.	.	.	.	.	.	.	.	G	29.8	5.035127	0.93575	.	.	ENSG00000123240	ENST00000263036;ENST00000378764;ENST00000378757;ENST00000378752;ENST00000378748;ENST00000378747	D;D;D;D;D;D	0.87809	-2.3;-2.3;-2.3;-2.3;-2.3;-2.3	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.92886	0.7737	M	0.73962	2.25	0.80722	D	1	D;D	0.69078	0.996;0.997	D;P	0.66602	0.945;0.882	D	0.92393	0.5923	10	0.48119	T	0.1	-11.1466	18.5373	0.91015	0.0:0.0:1.0:0.0	.	432;438	Q96CV9-2;Q96CV9	.;OPTN_HUMAN	S	438;432;438;432;438;438	ENSP00000263036:A438S;ENSP00000368040:A432S;ENSP00000368032:A438S;ENSP00000368027:A432S;ENSP00000368022:A438S;ENSP00000368021:A438S	ENSP00000263036:A438S	A	+	1	0	OPTN	13209820	1.000000	0.71417	1.000000	0.80357	0.790000	0.44656	8.413000	0.90235	2.670000	0.90874	0.462000	0.41574	GCT	OPTN	-	NULL		0.468	OPTN-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	OPTN	HGNC	protein_coding	OTTHUMT00000046834.1	G	NM_021980		13169814	+1	no_errors	ENST00000263036	ensembl	human	known	70_37	missense	SNP	1.000	T
OR2L3	391192	genome.wustl.edu	37	1	248224230	248224230	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:248224230G>C	ENST00000359959.3	+	1	247	c.247G>C	c.(247-249)Gat>Cat	p.D83H	OR2L13_ENST00000366478.2_Intron	NM_001004687.1	NP_001004687.1	Q8NG85	OR2L3_HUMAN	olfactory receptor, family 2, subfamily L, member 3	83						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)	p.D83N(1)		cervix(1)|endometrium(2)|large_intestine(7)|lung(28)|prostate(1)|skin(1)|urinary_tract(1)	41	all_cancers(71;0.000149)|all_epithelial(71;1.27e-05)|Breast(184;0.00909)|Ovarian(71;0.0377)|all_lung(81;0.127)|Lung NSC(105;0.136)		OV - Ovarian serous cystadenocarcinoma(106;0.0278)			GATGGCATCTGATTTTCTGTC	0.453																																																	1	Substitution - Missense(1)	skin(1)											292.0	268.0	276.0					1																	248224230		2203	4300	6503	SO:0001583	missense	391192			AB065950	CCDS31104.1	1q44	2012-08-09			ENSG00000198128	ENSG00000198128		"""GPCR / Class A : Olfactory receptors"""	15009	protein-coding gene	gene with protein product							Standard	NM_001004687		Approved		uc001idx.1	Q8NG85	OTTHUMG00000040195	ENST00000359959.3:c.247G>C	1.37:g.248224230G>C	ENSP00000353044:p.Asp83His	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EH44	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.D83H	ENST00000359959.3	37	c.247	CCDS31104.1	1	.	.	.	.	.	.	.	.	.	.	.	6.733	0.503969	0.12822	.	.	ENSG00000198128	ENST00000359959	T	0.00419	7.48	2.05	-1.24	0.09435	GPCR, rhodopsin-like superfamily (1);	0.955940	0.08428	U	0.947360	T	0.00271	0.0008	L	0.28014	0.82	0.09310	N	1	B	0.10296	0.003	B	0.12837	0.008	T	0.34079	-0.9843	10	0.72032	D	0.01	.	6.4919	0.22119	0.6472:0.0:0.3528:0.0	.	83	Q8NG85	OR2L3_HUMAN	H	83	ENSP00000353044:D83H	ENSP00000353044:D83H	D	+	1	0	OR2L3	246290853	0.000000	0.05858	0.000000	0.03702	0.087000	0.18053	-0.733000	0.04898	-0.346000	0.08312	0.462000	0.41574	GAT	OR2L3	-	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM		0.453	OR2L3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR2L3	HGNC	protein_coding	OTTHUMT00000096852.1	G	NM_001004687		248224230	+1	no_errors	ENST00000359959	ensembl	human	known	70_37	missense	SNP	0.000	C
OR3A4P	390756	genome.wustl.edu	37	17	3213841	3213841	+	RNA	SNP	C	C	T	rs61734052	byFrequency	TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:3213841C>T	ENST00000573491.1	-	0	359																											GTGTCAGTGTCACTGTCCCTG	0.552													C|||	18	0.00359425	0.0136	0.0	5008	,	,		21242	0.0		0.0	False		,,,				2504	0.0																0													145.0	130.0	135.0					17																	3213841		2203	4300	6503			390756																															17.37:g.3213841C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000573491.1	37	NULL		17																																																																																			OR3A4P	-	-		0.552	RP11-64J4.2-001	KNOWN	basic	sense_overlapping	OR3A4P	HGNC	sense_overlapping	OTTHUMT00000438371.1	C			3213841	+1	no_errors	ENST00000323164	ensembl	human	known	70_37	rna	SNP	0.992	T
OR4N4	283694	genome.wustl.edu	37	15	22383378	22383378	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr15:22383378G>C	ENST00000328795.4	+	1	997	c.906G>C	c.(904-906)ttG>ttC	p.L302F	RP11-69H14.6_ENST00000558896.1_RNA	NM_001005241.2	NP_001005241.2	Q8N0Y3	OR4N4_HUMAN	olfactory receptor, family 4, subfamily N, member 4	302						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(1)|endometrium(3)|kidney(3)|large_intestine(6)|lung(19)|ovary(4)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	40		all_cancers(20;1.94e-20)|all_epithelial(15;3.94e-18)|Lung NSC(15;8.53e-15)|all_lung(15;2.87e-14)|Breast(32;0.00519)|Colorectal(260;0.101)	GBM - Glioblastoma multiforme(6;0.124)	all cancers(64;1.64e-11)|Epithelial(43;5.81e-10)|BRCA - Breast invasive adenocarcinoma(123;0.000255)|Kidney(6;0.00736)|KIRC - Kidney renal clear cell carcinoma(6;0.0135)|GBM - Glioblastoma multiforme(186;0.0963)		AGAGGTTATTGAGTCGACATG	0.368																																																	0													60.0	57.0	58.0					15																	22383378		2184	4253	6437	SO:0001583	missense	283694			AI018459	CCDS32173.1	15q11.2	2012-08-09				ENSG00000183706		"""GPCR / Class A : Olfactory receptors"""	15375	protein-coding gene	gene with protein product							Standard	NM_001005241		Approved		uc010tzv.2	Q8N0Y3		ENST00000328795.4:c.906G>C	15.37:g.22383378G>C	ENSP00000332500:p.Leu302Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6IEY3|Q6IF56	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.L302F	ENST00000328795.4	37	c.906	CCDS32173.1	15	.	.	.	.	.	.	.	.	.	.	.	0	-2.728073	0.00091	.	.	ENSG00000183706	ENST00000328795	T	0.42131	0.98	3.18	2.11	0.27256	.	0.781717	0.10925	N	0.619055	T	0.25419	0.0618	N	0.17901	0.54	0.09310	N	1	B	0.06786	0.001	B	0.06405	0.002	T	0.21552	-1.0242	10	0.26408	T	0.33	-0.3363	7.0706	0.25177	0.0:0.0:0.6143:0.3857	.	302	Q8N0Y3	OR4N4_HUMAN	F	302	ENSP00000332500:L302F	ENSP00000332500:L302F	L	+	3	2	OR4N4	19884742	0.000000	0.05858	0.484000	0.27391	0.148000	0.21650	-0.686000	0.05161	0.471000	0.27319	0.399000	0.26434	TTG	OR4N4	-	NULL		0.368	OR4N4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR4N4	HGNC	protein_coding	OTTHUMT00000414922.1	G			22383378	+1	no_errors	ENST00000328795	ensembl	human	known	70_37	missense	SNP	0.134	C
PDE1C	5137	genome.wustl.edu	37	7	31887617	31887617	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr7:31887617C>G	ENST00000396191.1	-	9	1400	c.945G>C	c.(943-945)atG>atC	p.M315I	PDE1C_ENST00000396184.3_Missense_Mutation_p.M315I|PDE1C_ENST00000396193.1_Missense_Mutation_p.M375I|PDE1C_ENST00000321453.7_Missense_Mutation_p.M315I|PDE1C_ENST00000396182.2_Missense_Mutation_p.M315I	NM_001191057.1	NP_001177986.1	Q14123	PDE1C_HUMAN	phosphodiesterase 1C, calmodulin-dependent 70kDa	315	Catalytic. {ECO:0000250}.				activation of phospholipase C activity (GO:0007202)|epidermal growth factor receptor signaling pathway (GO:0007173)|fibroblast growth factor receptor signaling pathway (GO:0008543)|innate immune response (GO:0045087)|metabolic process (GO:0008152)|neurotrophin TRK receptor signaling pathway (GO:0048011)|signal transduction (GO:0007165)	cytosol (GO:0005829)	calmodulin-dependent cyclic-nucleotide phosphodiesterase activity (GO:0004117)|metal ion binding (GO:0046872)			NS(1)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(10)|lung(38)|prostate(4)|skin(8)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(2)	81			GBM - Glioblastoma multiforme(11;0.216)		Caffeine(DB00201)	TCAAAATATTCATTTCCTCGT	0.408																																																	0													110.0	102.0	105.0					7																	31887617		2203	4300	6503	SO:0001583	missense	5137			U40371	CCDS5437.1, CCDS55099.1, CCDS55100.1	7p15.1-p14.3	2008-05-15	2002-08-29		ENSG00000154678	ENSG00000154678	3.1.4.17	"""Phosphodiesterases"""	8776	protein-coding gene	gene with protein product		602987	"""phosphodiesterase 1C, calmodulin-dependent (70kD)"""			8557689	Standard	XM_005249769		Approved	Hcam3	uc003tco.2	Q14123	OTTHUMG00000023836	ENST00000396191.1:c.945G>C	7.37:g.31887617C>G	ENSP00000379494:p.Met315Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KPC6|E9PE92|Q14124|Q8NB10	Missense_Mutation	SNP	pfam_PDEase_catalytic_dom,pfam_PDEase_N,smart_HD/PDEase_dom,prints_PDEase	p.M315I	ENST00000396191.1	37	c.945	CCDS55099.1	7	.	.	.	.	.	.	.	.	.	.	C	21.6	4.177349	0.78564	.	.	ENSG00000154678	ENST00000396193;ENST00000396191;ENST00000321453;ENST00000396184;ENST00000396182	T;T;T;T;T	0.80994	-1.44;-1.44;-1.44;-1.44;-1.44	6.06	6.06	0.98353	Metal-dependent phosphohydrolase, HD domain (1);5&apos (2);-cyclic nucleotide phosphodiesterase, catalytic domain (2);3&apos (2);	0.000000	0.85682	D	0.000000	T	0.81597	0.4856	L	0.42245	1.32	0.80722	D	1	B;P;P	0.44627	0.161;0.559;0.839	B;B;P	0.47891	0.137;0.268;0.56	T	0.78463	-0.2194	10	0.34782	T	0.22	.	20.2348	0.98355	0.0:1.0:0.0:0.0	.	315;375;315	Q14123-2;E9PE92;Q14123	.;.;PDE1C_HUMAN	I	375;315;315;315;315	ENSP00000379496:M375I;ENSP00000379494:M315I;ENSP00000318105:M315I;ENSP00000379487:M315I;ENSP00000379485:M315I	ENSP00000318105:M315I	M	-	3	0	PDE1C	31854142	1.000000	0.71417	1.000000	0.80357	0.983000	0.72400	7.818000	0.86416	2.880000	0.98712	0.650000	0.86243	ATG	PDE1C	-	pfam_PDEase_catalytic_dom,smart_HD/PDEase_dom		0.408	PDE1C-006	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	PDE1C	HGNC	protein_coding	OTTHUMT00000328458.1	C			31887617	-1	no_errors	ENST00000321453	ensembl	human	known	70_37	missense	SNP	1.000	G
PEX5L	51555	genome.wustl.edu	37	3	179754389	179754389	+	5'UTR	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:179754389C>T	ENST00000467460.1	-	0	329				PEX5L_ENST00000263962.8_5'UTR|PEX5L_ENST00000485199.1_5'UTR|PEX5L_ENST00000465751.1_5'UTR|PEX5L_ENST00000472994.1_5'UTR	NM_001256751.1|NM_016559.2	NP_001243680.1|NP_057643.1	Q8IYB4	PEX5R_HUMAN	peroxisomal biogenesis factor 5-like						maintenance of protein location (GO:0045185)|protein import into peroxisome matrix (GO:0016558)|protein import into peroxisome matrix, docking (GO:0016560)|regulation of cAMP-mediated signaling (GO:0043949)|regulation of membrane potential (GO:0042391)	cytosol (GO:0005829)|dendrite (GO:0030425)|peroxisomal membrane (GO:0005778)|receptor complex (GO:0043235)	peroxisome matrix targeting signal-1 binding (GO:0005052)|peroxisome targeting sequence binding (GO:0000268)|small GTPase binding (GO:0031267)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(2)|large_intestine(7)|lung(23)|ovary(3)|prostate(1)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	49	all_cancers(143;3.94e-14)|Ovarian(172;0.0338)|Breast(254;0.183)		OV - Ovarian serous cystadenocarcinoma(80;1.75e-26)|GBM - Glioblastoma multiforme(14;0.000518)			CTGGTACATTCTGCTTCGGTT	0.527																																																	0													151.0	154.0	153.0					3																	179754389		2203	4300	6503	SO:0001623	5_prime_UTR_variant	51555			AJ245503	CCDS3236.1, CCDS58861.1, CCDS58862.1, CCDS58863.1, CCDS58864.1, CCDS58865.1, CCDS58866.1, CCDS58867.1	3q27.1	2013-01-10			ENSG00000114757	ENSG00000114757		"""Tetratricopeptide (TTC) repeat domain containing"""	30024	protein-coding gene	gene with protein product		611058				11463335	Standard	NM_016559		Approved	PEX5R, PXR2	uc003fki.2	Q8IYB4	OTTHUMG00000157363	ENST00000467460.1:c.-2G>A	3.37:g.179754389C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z2A5|B7Z305|B7Z318|B7Z5Z5|B7Z8P2|E7EUV8|E7EUZ0|E9PEC1|E9PH97|Q9NQD1|Q9P2U3|Q9P2U4	RNA	SNP	-	NULL	ENST00000467460.1	37	NULL	CCDS3236.1	3																																																																																			PEX5L	-	-		0.527	PEX5L-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PEX5L	HGNC	protein_coding	OTTHUMT00000348577.1	C	NM_016559		179754389	-1	no_errors	ENST00000474909	ensembl	human	known	70_37	rna	SNP	1.000	T
PHAX	51808	genome.wustl.edu	37	5	125939337	125939337	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr5:125939337C>T	ENST00000297540.4	+	2	867	c.172C>T	c.(172-174)Cga>Tga	p.R58*	PHAX_ENST00000514725.1_3'UTR	NM_032177.3	NP_115553.2	Q9H814	PHAX_HUMAN	phosphorylated adaptor for RNA export	58	Necessary for interaction with CBP80. {ECO:0000250}.				gene expression (GO:0010467)|ncRNA metabolic process (GO:0034660)|protein transport (GO:0015031)|RNA metabolic process (GO:0016070)|snRNA export from nucleus (GO:0006408)|spliceosomal snRNP assembly (GO:0000387)	cytosol (GO:0005829)|intracellular membrane-bounded organelle (GO:0043231)|neuronal cell body (GO:0043025)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	RNA binding (GO:0003723)|toxic substance binding (GO:0015643)			haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(3)|lung(2)|prostate(1)	8						ATCACATTATCGAGCTGTTGA	0.433																																																	0													140.0	142.0	141.0					5																	125939337		2203	4300	6503	SO:0001587	stop_gained	51808			AK023255	CCDS4138.1	5q23.2	2011-05-24	2008-10-01	2008-10-01	ENSG00000164902	ENSG00000164902			10241	protein-coding gene	gene with protein product		604924	"""RNA U, small nuclear RNA export adaptor (phosphorylation regulated)"""	RNUXA		10786834	Standard	NM_032177		Approved	FLJ13193	uc003kua.2	Q9H814	OTTHUMG00000163273	ENST00000297540.4:c.172C>T	5.37:g.125939337C>T	ENSP00000297540:p.Arg58*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H8W1	Nonsense_Mutation	SNP	pfam_PHAX_RNA-binding_domain	p.R58*	ENST00000297540.4	37	c.172	CCDS4138.1	5	.	.	.	.	.	.	.	.	.	.	C	40	8.481153	0.98829	.	.	ENSG00000164902	ENST00000297540;ENST00000456348	.	.	.	5.74	4.87	0.63330	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-2.1355	15.2142	0.73250	0.2555:0.7445:0.0:0.0	.	.	.	.	X	58	.	ENSP00000297540:R58X	R	+	1	2	PHAX	125967236	1.000000	0.71417	1.000000	0.80357	0.163000	0.22366	5.746000	0.68681	1.422000	0.47177	-0.169000	0.13324	CGA	PHAX	-	NULL		0.433	PHAX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PHAX	HGNC	protein_coding	OTTHUMT00000250924.1	C	NM_032177		125939337	+1	no_errors	ENST00000297540	ensembl	human	known	70_37	nonsense	SNP	1.000	T
PHLDA1	22822	genome.wustl.edu	37	12	76424550	76424550	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:76424550C>T	ENST00000266671.5	-	1	3162	c.972G>A	c.(970-972)caG>caA	p.Q324Q	RP11-290L1.3_ENST00000552367.1_RNA|PHLDA1_ENST00000602540.1_Silent_p.Q183Q|RP11-290L1.2_ENST00000547721.1_RNA			Q8WV24	PHLA1_HUMAN	pleckstrin homology-like domain, family A, member 1	324	15 X 2 AA repeats of P-Q.				apoptotic process (GO:0006915)|FasL biosynthetic process (GO:0045210)|forebrain neuron differentiation (GO:0021879)|positive regulation of apoptotic process (GO:0043065)	cytoplasmic vesicle (GO:0031410)|membrane (GO:0016020)|nucleus (GO:0005634)				breast(3)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(4)|skin(1)	14		Colorectal(145;0.09)				gcggctgaggctgaggctggg	0.682																																																	0													35.0	27.0	30.0					12																	76424550		2109	4148	6257	SO:0001819	synonymous_variant	22822			Z50194	CCDS31861.1	12q15	2008-08-05				ENSG00000139289			8933	protein-coding gene	gene with protein product	"""proline-histidine rich protein"""	605335				12384558, 15037619	Standard	NM_007350		Approved	TDAG51, DT1P1B11, PHRIP	uc001sxu.3	Q8WV24		ENST00000266671.5:c.972G>A	12.37:g.76424550C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1A4G9|Q15184|Q2TAN2|Q9NZ17	Silent	SNP	smart_Pleckstrin_homology	p.Q324	ENST00000266671.5	37	c.972	CCDS31861.1	12																																																																																			PHLDA1	-	NULL		0.682	PHLDA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PHLDA1	HGNC	protein_coding	OTTHUMT00000405846.2	C	NM_007350		76424550	-1	no_errors	ENST00000266671	ensembl	human	known	70_37	silent	SNP	0.992	T
PIEZO1	9780	genome.wustl.edu	37	16	88787119	88787119	+	Missense_Mutation	SNP	C	C	G	rs12445112	byFrequency	TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr16:88787119C>G	ENST00000301015.9	-	40	5952	c.5706G>C	c.(5704-5706)gaG>gaC	p.E1902D	PIEZO1_ENST00000327397.7_5'Flank|RP5-1142A6.9_ENST00000564984.1_RNA	NM_001142864.2	NP_001136336.2	Q92508	PIEZ1_HUMAN	piezo-type mechanosensitive ion channel component 1	1902					cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of mechanical stimulus (GO:0050982)|positive regulation of cell-cell adhesion mediated by integrin (GO:0033634)|positive regulation of integrin activation (GO:0033625)|regulation of membrane potential (GO:0042391)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	cation channel activity (GO:0005261)|mechanically-gated ion channel activity (GO:0008381)			NS(1)|breast(3)|central_nervous_system(1)|endometrium(2)|prostate(2)|skin(1)	10						GGGcctctttctcttcctccc	0.652																																																	0													117.0	111.0	112.0					16																	88787119		692	1591	2283	SO:0001583	missense	9780			D87071	CCDS54058.1	16q24.3	2011-08-31	2011-08-31	2011-08-31	ENSG00000103335	ENSG00000103335			28993	protein-coding gene	gene with protein product		611184	"""family with sequence similarity 38, member A"""	FAM38A		20813920, 21056836, 21299953, 21696149	Standard	NM_001142864		Approved	KIAA0233	uc010vpb.2	Q92508	OTTHUMG00000156776	ENST00000301015.9:c.5706G>C	16.37:g.88787119C>G	ENSP00000301015:p.Glu1902Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHT9|A7E2B7|Q0KKZ9	Missense_Mutation	SNP	pfam_DUF3595	p.E1902D	ENST00000301015.9	37	c.5706	CCDS54058.1	16	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	12.87|12.87	2.068223|2.068223	0.36470|0.36470	.|.	.|.	ENSG00000103335|ENSG00000103335	ENST00000301015|ENST00000451779	T|.	0.72835|.	-0.69|.	3.94|3.94	0.503|0.503	0.16940|0.16940	.|.	1.680740|1.680740	0.02938|0.02938	N|N	0.140077|0.140077	T|T	0.35335|0.35335	0.0928|0.0928	L|L	0.48642|0.48642	1.525|1.525	0.09310|0.09310	N|N	1|1	B|.	0.06786|.	0.001|.	B|.	0.04013|.	0.001|.	T|T	0.09207|0.09207	-1.0685|-1.0685	10|7	0.16420|0.18710	T|T	0.52|0.47	-4.821|-4.821	3.1443|3.1443	0.06466|0.06466	0.206:0.5295:0.0:0.2645|0.206:0.5295:0.0:0.2645	.|.	1902|.	Q92508|.	PIEZ1_HUMAN|.	D|Q	1902|1848	ENSP00000301015:E1902D|.	ENSP00000301015:E1902D|ENSP00000408244:E1848Q	E|E	-|-	3|1	2|0	FAM38A|FAM38A	87314620|87314620	0.000000|0.000000	0.05858|0.05858	0.000000|0.000000	0.03702|0.03702	0.011000|0.011000	0.07611|0.07611	-1.695000|-1.695000	0.01913|0.01913	0.003000|0.003000	0.14656|0.14656	0.561000|0.561000	0.74099|0.74099	GAG|GAA	PIEZO1	-	NULL		0.652	PIEZO1-001	NOVEL	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	PIEZO1	HGNC	protein_coding	OTTHUMT00000345699.4	C	NM_014745		88787119	-1	no_errors	ENST00000301015	ensembl	human	novel	70_37	missense	SNP	0.000	G
PLEC	5339	genome.wustl.edu	37	8	144994596	144994596	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:144994596C>T	ENST00000322810.4	-	32	9973	c.9804G>A	c.(9802-9804)ctG>ctA	p.L3268L	PLEC_ENST00000354589.3_Silent_p.L3131L|PLEC_ENST00000356346.3_Silent_p.L3117L|PLEC_ENST00000398774.2_Silent_p.L3099L|PLEC_ENST00000436759.2_Silent_p.L3158L|PLEC_ENST00000345136.3_Silent_p.L3131L|PLEC_ENST00000527096.1_Silent_p.L3154L|PLEC_ENST00000354958.2_Silent_p.L3109L|PLEC_ENST00000357649.2_Silent_p.L3135L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	3268	Globular 2.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CCAACAGGCGCAGGCCCTGCT	0.687																																																	0													13.0	17.0	16.0					8																	144994596		2011	4157	6168	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.9804G>A	8.37:g.144994596C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.L3268	ENST00000322810.4	37	c.9804	CCDS43772.1	8																																																																																			PLEC	-	pfam_Plectin_repeat,smart_Plectin_repeat		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	C	NM_000445		144994596	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	silent	SNP	0.982	T
PLEC	5339	genome.wustl.edu	37	8	144996767	144996767	+	Missense_Mutation	SNP	C	C	G	rs371885759		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:144996767C>G	ENST00000322810.4	-	31	7910	c.7741G>C	c.(7741-7743)Gat>Cat	p.D2581H	PLEC_ENST00000354589.3_Missense_Mutation_p.D2444H|PLEC_ENST00000356346.3_Missense_Mutation_p.D2430H|PLEC_ENST00000398774.2_Missense_Mutation_p.D2412H|PLEC_ENST00000436759.2_Missense_Mutation_p.D2471H|PLEC_ENST00000345136.3_Missense_Mutation_p.D2444H|PLEC_ENST00000527096.1_Missense_Mutation_p.D2467H|PLEC_ENST00000354958.2_Missense_Mutation_p.D2422H|PLEC_ENST00000357649.2_Missense_Mutation_p.D2448H	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2581	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						CGCTCGGCATCATGGTCACTC	0.622																																																	0													41.0	45.0	44.0					8																	144996767		2177	4269	6446	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7741G>C	8.37:g.144996767C>G	ENSP00000323856:p.Asp2581His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.D2581H	ENST00000322810.4	37	c.7741	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	11.82	1.753866	0.31046	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.76839	-1.01;-1.01;-1.05;-1.04;-1.03;-1.01;-1.01;-1.01;-1.01	4.56	4.56	0.56223	.	0.080489	0.47852	U	0.000207	T	0.79598	0.4473	N	0.22421	0.69	0.52501	D	0.999953	D;D;D;D;D;D;D;D	0.69078	0.997;0.997;0.997;0.995;0.997;0.997;0.997;0.997	D;D;D;P;D;D;D;D	0.63192	0.912;0.912;0.912;0.819;0.912;0.912;0.912;0.912	T	0.82108	-0.0620	10	0.54805	T	0.06	.	17.0989	0.86644	0.0:1.0:0.0:0.0	.	2471;2430;2422;2581;2412;2444;2448;2444	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	H	2444;2448;2444;2412;2581;2422;2430;2471;2467	ENSP00000344848:D2444H;ENSP00000350277:D2448H;ENSP00000346602:D2444H;ENSP00000381756:D2412H;ENSP00000323856:D2581H;ENSP00000347044:D2422H;ENSP00000348702:D2430H;ENSP00000388180:D2471H;ENSP00000434583:D2467H	ENSP00000323856:D2581H	D	-	1	0	PLEC	145068755	1.000000	0.71417	0.703000	0.30354	0.179000	0.23085	4.668000	0.61568	2.379000	0.81126	0.549000	0.68633	GAT	PLEC	-	NULL		0.622	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	C	NM_000445		144996767	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	missense	SNP	1.000	G
PLEC	5339	genome.wustl.edu	37	8	144997377	144997377	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:144997377C>T	ENST00000322810.4	-	31	7300	c.7131G>A	c.(7129-7131)ctG>ctA	p.L2377L	PLEC_ENST00000354589.3_Silent_p.L2240L|PLEC_ENST00000356346.3_Silent_p.L2226L|PLEC_ENST00000398774.2_Silent_p.L2208L|PLEC_ENST00000436759.2_Silent_p.L2267L|PLEC_ENST00000345136.3_Silent_p.L2240L|PLEC_ENST00000527096.1_Silent_p.L2263L|PLEC_ENST00000354958.2_Silent_p.L2218L|PLEC_ENST00000357649.2_Silent_p.L2244L	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2377	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TGAGCTTGCTCAGCTCCTCCA	0.637																																																	0													27.0	28.0	27.0					8																	144997377		2192	4289	6481	SO:0001819	synonymous_variant	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.7131G>A	8.37:g.144997377C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Silent	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.L2377	ENST00000322810.4	37	c.7131	CCDS43772.1	8																																																																																			PLEC	-	superfamily_Chorismate_mutase_type_II		0.637	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	C	NM_000445		144997377	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	silent	SNP	0.900	T
PLEC	5339	genome.wustl.edu	37	8	144998429	144998429	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:144998429C>T	ENST00000322810.4	-	31	6248	c.6079G>A	c.(6079-6081)Gac>Aac	p.D2027N	PLEC_ENST00000354589.3_Missense_Mutation_p.D1890N|PLEC_ENST00000356346.3_Missense_Mutation_p.D1876N|PLEC_ENST00000398774.2_Missense_Mutation_p.D1858N|PLEC_ENST00000436759.2_Missense_Mutation_p.D1917N|PLEC_ENST00000345136.3_Missense_Mutation_p.D1890N|PLEC_ENST00000527096.1_Missense_Mutation_p.D1913N|PLEC_ENST00000354958.2_Missense_Mutation_p.D1868N|PLEC_ENST00000357649.2_Missense_Mutation_p.D1894N	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	2027	Central fibrous rod domain.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						TCCTCGATGTCAGCCTTGTGT	0.711																																																	0													11.0	13.0	12.0					8																	144998429		2130	4211	6341	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.6079G>A	8.37:g.144998429C>T	ENSP00000323856:p.Asp2027Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.D2027N	ENST00000322810.4	37	c.6079	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	C	14.07	2.426968	0.43122	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	D;D;D;D;D;D;D;D;D	0.91295	-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82;-2.82	4.28	4.28	0.50868	.	0.276676	0.27023	U	0.021305	D	0.90717	0.7087	N	0.17474	0.49	0.46416	D	0.999039	D;D;P;D;D;D;D;D	0.76494	0.999;0.997;0.935;0.996;0.999;0.999;0.995;0.999	D;D;P;D;D;D;D;D	0.87578	0.997;0.993;0.889;0.985;0.997;0.997;0.991;0.998	D	0.90520	0.4488	10	0.34782	T	0.22	.	16.5144	0.84295	0.0:1.0:0.0:0.0	.	1917;1876;1868;2027;1858;1890;1894;1890	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	N	1890;1894;1890;1858;2027;1868;1876;1917;1913	ENSP00000344848:D1890N;ENSP00000350277:D1894N;ENSP00000346602:D1890N;ENSP00000381756:D1858N;ENSP00000323856:D2027N;ENSP00000347044:D1868N;ENSP00000348702:D1876N;ENSP00000388180:D1917N;ENSP00000434583:D1913N	ENSP00000323856:D2027N	D	-	1	0	PLEC	145070417	0.999000	0.42202	0.782000	0.31804	0.255000	0.26057	4.486000	0.60286	2.220000	0.72140	0.549000	0.68633	GAC	PLEC	-	NULL		0.711	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	C	NM_000445		144998429	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	missense	SNP	1.000	T
PPM1N	147699	genome.wustl.edu	37	19	46003774	46003774	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr19:46003774C>G	ENST00000451287.2	+	3	1118	c.1118C>G	c.(1117-1119)tCa>tGa	p.S373*	PPM1N_ENST00000456399.2_Nonsense_Mutation_p.S55*|PPM1N_ENST00000396735.2_Nonsense_Mutation_p.S55*|PPM1N_ENST00000401705.1_Nonsense_Mutation_p.S55*|PPM1N_ENST00000401593.1_Nonsense_Mutation_p.S55*|PPM1N_ENST00000396737.2_Nonsense_Mutation_p.S55*|PPM1N_ENST00000324688.4_3'UTR|PPM1N_ENST00000396736.2_Nonsense_Mutation_p.S55*	NM_001080401.1	NP_001073870.1	Q8N819	PPM1N_HUMAN	protein phosphatase, Mg2+/Mn2+ dependent, 1N (putative)	373							magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|phosphoprotein phosphatase activity (GO:0004721)			NS(1)|breast(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(6)	9						ACTCTGGCCTCAGAGGACATC	0.582																																																	0													27.0	27.0	27.0					19																	46003774		1902	4113	6015	SO:0001587	stop_gained	147699			AK097444	CCDS46115.1	19q13.32	2012-04-17			ENSG00000213889	ENSG00000213889		"""Serine/threonine phosphatases / Protein phosphatases, Mg2+/Mn2+ dependent"""	26845	protein-coding gene	gene with protein product							Standard	NM_001080401		Approved	FLJ40125	uc002pce.3	Q8N819	OTTHUMG00000140397	ENST00000451287.2:c.1118C>G	19.37:g.46003774C>G	ENSP00000397050:p.Ser373*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P662	Nonsense_Mutation	SNP	pfam_PP2C-like,pfam_PP2C_C,superfamily_PP2C-like,superfamily_PP2C_C,smart_PP2C-like	p.S373*	ENST00000451287.2	37	c.1118	CCDS46115.1	19	.	.	.	.	.	.	.	.	.	.	c	24.0	4.481803	0.84747	.	.	ENSG00000213889	ENST00000401705;ENST00000456399;ENST00000396737;ENST00000451287;ENST00000396734;ENST00000396735;ENST00000401593;ENST00000402807;ENST00000396736	.	.	.	3.37	2.33	0.28932	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	.	9.0996	0.36660	0.0:0.887:0.0:0.113	.	.	.	.	X	55;55;55;373;373;55;55;55;55	.	ENSP00000379960:S373X	S	+	2	0	PPM1N	50695614	0.003000	0.15002	0.942000	0.38095	0.930000	0.56654	1.559000	0.36320	1.007000	0.39238	-0.142000	0.14014	TCA	PPM1N	-	pfam_PP2C_C,superfamily_PP2C_C		0.582	PPM1N-007	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	PPM1N	HGNC	protein_coding	OTTHUMT00000326517.2	C	NM_001080401		46003774	+1	no_errors	ENST00000451287	ensembl	human	known	70_37	nonsense	SNP	0.988	G
PRDM10	56980	genome.wustl.edu	37	11	129830857	129830857	+	Start_Codon_SNP	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:129830857C>T	ENST00000360871.3	-	2	234	c.3G>A	c.(1-3)atG>atA	p.M1I	PRDM10_ENST00000528746.1_Start_Codon_SNP_p.M1I|PRDM10_ENST00000358825.5_Start_Codon_SNP_p.M1I	NM_199437.1	NP_955469.1	Q9NQV6	PRD10_HUMAN	PR domain containing 10	1					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|methyltransferase activity (GO:0008168)			breast(2)|endometrium(6)|kidney(3)|large_intestine(14)|lung(15)|pancreas(2)|skin(1)|stomach(3)|urinary_tract(2)	48	all_hematologic(175;0.0537)	Breast(109;0.000496)|Lung NSC(97;0.000693)|all_lung(97;0.00151)|Medulloblastoma(222;0.0425)|all_neural(223;0.0837)		OV - Ovarian serous cystadenocarcinoma(99;0.0174)|Lung(977;0.176)|LUSC - Lung squamous cell carcinoma(976;0.185)		CTTTGGAATCCATCTTCTCCC	0.517																																																	0													120.0	108.0	112.0					11																	129830857		2201	4297	6498	SO:0001582	initiator_codon_variant	56980			AF275817	CCDS8484.1, CCDS8485.1, CCDS44771.1, CCDS44772.1	11q24.3	2013-01-08			ENSG00000170325	ENSG00000170325		"""Zinc fingers, C2H2-type"""	13995	protein-coding gene	gene with protein product	"""PRDM zinc finger transcription factor"", ""PR-domain family member 7"", ""tristanin"""					12175877	Standard	NM_020228		Approved	KIAA1231, PFM7, MGC131802	uc001qfm.3	Q9NQV6	OTTHUMG00000165762	ENST00000360871.3:c.3G>A	11.37:g.129830857C>T	ENSP00000354118:p.Met1Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZL71|G3XAE5|J3KP23|Q17R90|Q2KHR4|Q863Z2|Q9NXI4|Q9ULI9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M1I	ENST00000360871.3	37	c.3	CCDS8484.1	11	.	.	.	.	.	.	.	.	.	.	C	23.9	4.470089	0.84533	.	.	ENSG00000170325	ENST00000358825;ENST00000360871;ENST00000528746;ENST00000527581;ENST00000531431	T;T;T;T;T	0.56275	2.6;2.64;2.56;0.47;0.61	5.5	5.5	0.81552	.	0.137241	0.64402	D	0.000007	T	0.74390	0.3710	.	.	.	0.80722	D	1	D;P;P	0.53745	0.962;0.908;0.851	D;D;P	0.66716	0.946;0.922;0.838	T	0.76512	-0.2932	9	0.87932	D	0	-35.7219	19.7671	0.96349	0.0:1.0:0.0:0.0	.	1;1;1	Q9NQV6-4;G3XAE5;Q9NQV6	.;.;PRD10_HUMAN	I	1	ENSP00000351686:M1I;ENSP00000354118:M1I;ENSP00000431262:M1I;ENSP00000432093:M1I;ENSP00000436681:M1I	ENSP00000351686:M1I	M	-	3	0	PRDM10	129336067	1.000000	0.71417	1.000000	0.80357	0.671000	0.39405	5.208000	0.65203	2.751000	0.94390	0.650000	0.86243	ATG	PRDM10	-	NULL		0.517	PRDM10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRDM10	HGNC	protein_coding	OTTHUMT00000386076.1	C	NM_199437	Missense_Mutation	129830857	-1	no_errors	ENST00000358825	ensembl	human	known	70_37	missense	SNP	1.000	T
PRRT1	80863	genome.wustl.edu	37	6	32116549	32116549	+	3'UTR	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:32116549G>A	ENST00000211413.5	-	0	1495				PRRT1_ENST00000375150.2_3'UTR|PRRT1_ENST00000375152.2_3'UTR|PRRT1_ENST00000467780.1_5'UTR	NM_030651.3	NP_085154.3	Q99946	PRRT1_HUMAN	proline-rich transmembrane protein 1						response to biotic stimulus (GO:0009607)	cell junction (GO:0030054)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|synapse (GO:0045202)				breast(2)|endometrium(1)|kidney(1)|lung(2)	6						GTCTGTGGGCGAGGCCTGGAG	0.577																																																	0																																										SO:0001624	3_prime_UTR_variant	80863			AK054885	CCDS4739.1	6p21.32	2011-10-10	2005-07-24	2005-07-24		ENSG00000204314		"""Proline-rich transmembrane proteins"""	13943	protein-coding gene	gene with protein product	"""interferon induced transmembrane protein domain containing 7"""		"""chromosome 6 open reading frame 31"""	C6orf31			Standard	XM_006715221		Approved	NG5, IFITMD7	uc003nzt.3	Q99946		ENST00000211413.5:c.*450C>T	6.37:g.32116549G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6ND08|A6ND40|B0S869|Q5SSW4|Q5SSX7|Q5STI1|Q96DW3|Q96NQ8	RNA	SNP	-	NULL	ENST00000211413.5	37	NULL	CCDS4739.1	6																																																																																			PRRT1	-	-		0.577	PRRT1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PRRT1	HGNC	protein_coding	OTTHUMT00000076255.2	G	NM_030651		32116549	-1	no_errors	ENST00000467780	ensembl	human	known	70_37	rna	SNP	0.001	A
PTDSS1	9791	genome.wustl.edu	37	8	97311943	97311943	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:97311943C>T	ENST00000517309.1	+	6	948	c.622C>T	c.(622-624)Ccc>Tcc	p.P208S	PTDSS1_ENST00000522072.1_Missense_Mutation_p.P5S|PTDSS1_ENST00000518776.1_3'UTR|PTDSS1_ENST00000455950.2_Missense_Mutation_p.P62S	NM_014754.1	NP_055569.1	P48651	PTSS1_HUMAN	phosphatidylserine synthase 1	208					glycerophospholipid biosynthetic process (GO:0046474)|phosphatidylserine biosynthetic process (GO:0006659)|phospholipid metabolic process (GO:0006644)|small molecule metabolic process (GO:0044281)	endoplasmic reticulum membrane (GO:0005789)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	transferase activity (GO:0016740)			endometrium(2)|kidney(2)|large_intestine(8)|lung(14)|ovary(1)|prostate(1)|stomach(1)	29	Breast(36;6.18e-05)				Phosphatidylserine(DB00144)	GCATCTCCTCCCCAATTTTGC	0.463																																																	0													215.0	194.0	201.0					8																	97311943		2203	4300	6503	SO:0001583	missense	9791			D14694	CCDS6271.1	8q22	2008-05-02			ENSG00000156471	ENSG00000156471			9587	protein-coding gene	gene with protein product		612792					Standard	NM_014754		Approved	KIAA0024, PSSA, PSS1	uc003yht.1	P48651	OTTHUMG00000164687	ENST00000517309.1:c.622C>T	8.37:g.97311943C>T	ENSP00000430548:p.Pro208Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	E5RFC5|Q9BUQ5	Missense_Mutation	SNP	pfam_PSS	p.P208S	ENST00000517309.1	37	c.622	CCDS6271.1	8	.	.	.	.	.	.	.	.	.	.	C	33	5.223217	0.95139	.	.	ENSG00000156471	ENST00000517309;ENST00000455950;ENST00000522072	T;T;T	0.61392	0.11;0.28;0.26	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.83211	0.5205	H	0.94345	3.525	0.80722	D	1	D	0.89917	1.0	D	0.91635	0.999	D	0.87646	0.2525	10	0.87932	D	0	-19.5083	17.8705	0.88810	0.0:1.0:0.0:0.0	.	208	P48651	PTSS1_HUMAN	S	208;62;5	ENSP00000430548:P208S;ENSP00000401248:P62S;ENSP00000430928:P5S	ENSP00000401248:P62S	P	+	1	0	PTDSS1	97381119	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.818000	0.86416	2.648000	0.89879	0.650000	0.86243	CCC	PTDSS1	-	pfam_PSS		0.463	PTDSS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PTDSS1	HGNC	protein_coding	OTTHUMT00000379743.2	C			97311943	+1	no_errors	ENST00000517309	ensembl	human	known	70_37	missense	SNP	1.000	T
QTRTD1	79691	genome.wustl.edu	37	3	113798870	113798870	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:113798870C>G	ENST00000493014.1	+	4	614	c.546C>G	c.(544-546)ttC>ttG	p.F182L	QTRTD1_ENST00000485050.1_Missense_Mutation_p.F300L|QTRTD1_ENST00000281273.4_Missense_Mutation_p.F288L|QTRTD1_ENST00000479882.1_Missense_Mutation_p.F165L	NM_001256836.1	NP_001243765.1			queuine tRNA-ribosyltransferase domain containing 1											central_nervous_system(1)|endometrium(1)|large_intestine(1)|lung(5)|skin(2)	10						CCCTGACTTTCAGTTTTGATT	0.413																																																	0													177.0	176.0	176.0					3																	113798870		2203	4300	6503	SO:0001583	missense	79691			AK023022	CCDS33828.1, CCDS58846.1, CCDS58845.1, CCDS58844.1	3q13.31	2010-11-16			ENSG00000151576	ENSG00000151576			25771	protein-coding gene	gene with protein product						12477932	Standard	NM_024638		Approved	FLJ12960	uc003eaz.4	Q9H974	OTTHUMG00000159336	ENST00000493014.1:c.546C>G	3.37:g.113798870C>G	ENSP00000419169:p.Phe182Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_tRNA_ribo_trans,superfamily_tRNA_ribo_trans,tigrfam_tRNA_ribo_trans	p.F288L	ENST00000493014.1	37	c.864	CCDS58845.1	3	.	.	.	.	.	.	.	.	.	.	C	26.2	4.719326	0.89205	.	.	ENSG00000151576	ENST00000485050;ENST00000281273;ENST00000479882;ENST00000493014	.	.	.	5.81	5.81	0.92471	.	0.000000	0.85682	D	0.000000	T	0.77343	0.4116	M	0.68317	2.08	0.58432	D	0.999999	D;D	0.89917	1.0;0.988	D;D	0.76071	0.987;0.944	T	0.78548	-0.2162	9	0.72032	D	0.01	-12.7262	15.2448	0.73499	0.0:0.9311:0.0:0.0689	.	182;288	B7Z472;Q9H974	.;QTRD1_HUMAN	L	300;288;165;182	.	ENSP00000281273:F288L	F	+	3	2	QTRTD1	115281560	1.000000	0.71417	1.000000	0.80357	0.959000	0.62525	2.919000	0.48836	2.755000	0.94549	0.650000	0.86243	TTC	QTRTD1	-	pfam_tRNA_ribo_trans,superfamily_tRNA_ribo_trans,tigrfam_tRNA_ribo_trans		0.413	QTRTD1-004	PUTATIVE	basic|exp_conf|CCDS	protein_coding	QTRTD1	HGNC	protein_coding	OTTHUMT00000354711.1	C	NM_024638		113798870	+1	no_errors	ENST00000281273	ensembl	human	known	70_37	missense	SNP	1.000	G
RAD21	5885	genome.wustl.edu	37	8	117875458	117875458	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:117875458C>T	ENST00000297338.2	-	3	472	c.185G>A	c.(184-186)gGa>gAa	p.G62E	RAD21_ENST00000523547.1_5'UTR	NM_006265.2	NP_006256.1	O60216	RAD21_HUMAN	RAD21 homolog (S. pombe)	62					apoptotic process (GO:0006915)|chromosome segregation (GO:0007059)|DNA recombination (GO:0006310)|double-strand break repair (GO:0006302)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|protein localization to chromatin (GO:0071168)|reciprocal meiotic recombination (GO:0007131)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	chromosome (GO:0005694)|chromosome, centromeric region (GO:0000775)|cohesin complex (GO:0008278)|cytosol (GO:0005829)|membrane (GO:0016020)|nuclear meiotic cohesin complex (GO:0034991)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)				endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(7)|lung(16)|ovary(1)|prostate(1)|skin(1)|stomach(1)	32	all_cancers(13;1.21e-21)|Lung NSC(37;0.000134)|Ovarian(258;0.0172)					TCGAACTACTCCCAGTAAGAG	0.373																																																	0													157.0	150.0	153.0					8																	117875458		2203	4300	6503	SO:0001583	missense	5885			BC050381	CCDS6321.1	8q24.11	2014-09-17	2001-11-28		ENSG00000164754	ENSG00000164754			9811	protein-coding gene	gene with protein product	"""sister chromatid cohesion 1"""	606462	"""RAD21 (S. pombe) homolog"""			8812457	Standard	NM_006265		Approved	KIAA0078, hHR21, SCC1	uc003yod.3	O60216	OTTHUMG00000164959	ENST00000297338.2:c.185G>A	8.37:g.117875458C>T	ENSP00000297338:p.Gly62Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0E0|Q15001|Q99568	Missense_Mutation	SNP	pfam_Rad21_Rec8_N,pfam_Rad21/Rec8_C_eu,pfam_ScpA	p.G62E	ENST00000297338.2	37	c.185	CCDS6321.1	8	.	.	.	.	.	.	.	.	.	.	C	32	5.179202	0.94846	.	.	ENSG00000164754	ENST00000297338;ENST00000520992;ENST00000517485;ENST00000519837;ENST00000522699	D;D;D;D;D	0.82255	-1.59;-1.59;-1.59;-1.59;-1.59	5.51	5.51	0.81932	Rad21/Rec8-like protein, N-terminal (1);	0.000000	0.85682	D	0.000000	D	0.94827	0.8329	H	0.97611	4.04	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.96385	0.9284	10	0.87932	D	0	-7.3566	19.4192	0.94713	0.0:1.0:0.0:0.0	.	62	O60216	RAD21_HUMAN	E	62	ENSP00000297338:G62E;ENSP00000429342:G62E;ENSP00000427923:G62E;ENSP00000430524:G62E;ENSP00000428158:G62E	ENSP00000297338:G62E	G	-	2	0	RAD21	117944639	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.757000	0.85209	2.586000	0.87340	0.650000	0.86243	GGA	RAD21	-	pfam_Rad21_Rec8_N		0.373	RAD21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAD21	HGNC	protein_coding	OTTHUMT00000381184.1	C	NM_006265		117875458	-1	no_errors	ENST00000297338	ensembl	human	known	70_37	missense	SNP	1.000	T
RBM15	64783	genome.wustl.edu	37	1	110882124	110882124	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:110882124C>T	ENST00000369784.3	+	1	997	c.97C>T	c.(97-99)Cag>Tag	p.Q33*	RBM15_ENST00000487146.2_Nonsense_Mutation_p.Q33*|RBM15_ENST00000602849.1_Nonsense_Mutation_p.Q33*|RP5-1074L1.1_ENST00000449169.1_RNA	NM_022768.4	NP_073605.4	Q96T37	RBM15_HUMAN	RNA binding motif protein 15	33					negative regulation of myeloid cell differentiation (GO:0045638)|patterning of blood vessels (GO:0001569)|placenta blood vessel development (GO:0060674)|positive regulation of transcription of Notch receptor target (GO:0007221)|spleen development (GO:0048536)|ventricular septum morphogenesis (GO:0060412)|viral process (GO:0016032)	membrane (GO:0016020)|nucleus (GO:0005634)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)			ovary(3)	3		all_cancers(81;2.89e-06)|all_epithelial(167;2.96e-06)|all_lung(203;0.000116)|Lung NSC(277;0.000233)|Breast(1374;0.0634)		BRCA - Breast invasive adenocarcinoma(282;0.000224)|Epithelial(280;0.000476)|Kidney(133;0.000539)|KIRC - Kidney renal clear cell carcinoma(1967;0.000716)|all cancers(265;0.00144)|Lung(183;0.0238)|Colorectal(144;0.103)|LUSC - Lung squamous cell carcinoma(189;0.135)		GCGGGTTACTCAGCTCCGCGG	0.667			T	MKL1	acute megakaryocytic leukemia																																			Dom	yes		1	1p13	64783	RNA binding motif protein 15		L	0													18.0	22.0	20.0					1																	110882124		2203	4298	6501	SO:0001587	stop_gained	64783			AF368063	CCDS822.1, CCDS59198.1	1p13	2013-02-12			ENSG00000162775	ENSG00000162775		"""RNA binding motif (RRM) containing"""	14959	protein-coding gene	gene with protein product	"""one twenty-two"""	606077				11431691, 11344311	Standard	NM_001201545		Approved	OTT, OTT1	uc001dzl.1	Q96T37	OTTHUMG00000011284	ENST00000369784.3:c.97C>T	1.37:g.110882124C>T	ENSP00000358799:p.Gln33*	Somatic		WXS	Illumina HiSeq	Phase_IV	A1A693|Q3ZB86|Q4V760|Q5D058|Q5T613|Q86VW9|Q96PE4|Q96SC5|Q96SC6|Q96SC9|Q96SD0|Q96T38|Q9BRA5|Q9H6R8|Q9H9Y0	Nonsense_Mutation	SNP	pfam_SPOC_C,pfam_RRM_dom,superfamily_SPOC-like,smart_RRM_dom,pfscan_SPOC_met,pfscan_RRM_dom	p.Q33*	ENST00000369784.3	37	c.97	CCDS822.1	1	.	.	.	.	.	.	.	.	.	.	C	44	11.233463	0.99534	.	.	ENSG00000162775	ENST00000369784	.	.	.	5.31	4.38	0.52667	.	0.527164	0.15915	N	0.238407	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	-0.4369	6.4889	0.22105	0.1817:0.7291:0.0:0.0893	.	.	.	.	X	33	.	ENSP00000358799:Q33X	Q	+	1	0	RBM15	110683647	0.982000	0.34865	0.887000	0.34795	0.920000	0.55202	1.996000	0.40776	1.429000	0.47314	0.655000	0.94253	CAG	RBM15	-	NULL		0.667	RBM15-001	KNOWN	basic|CCDS	protein_coding	RBM15	HGNC	protein_coding	OTTHUMT00000031114.2	C	NM_022768		110882124	+1	no_errors	ENST00000369784	ensembl	human	known	70_37	nonsense	SNP	0.772	T
RBMXL3	139804	genome.wustl.edu	37	X	114427079	114427079	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:114427079C>T	ENST00000424776.3	+	1	3117	c.3075C>T	c.(3073-3075)ctC>ctT	p.L1025L	LRCH2_ENST00000538422.1_Intron|LRCH2_ENST00000317135.8_Intron	NM_001145346.1	NP_001138818.1	Q8N7X1	RMXL3_HUMAN	RNA binding motif protein, X-linked-like 3	1025	Gly-rich.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			endometrium(13)|kidney(2)|skin(1)	16						ATCGTGGGCTCCCTCTGCCCA	0.672																																																	0													35.0	34.0	34.0					X																	114427079		692	1591	2283	SO:0001819	synonymous_variant	139804			AK097568	CCDS55478.1	Xq23	2013-02-12	2009-03-24	2009-03-24	ENSG00000175718	ENSG00000175718		"""RNA binding motif (RRM) containing"""	26859	protein-coding gene	gene with protein product			"""chromosome X open reading frame 55"""	CXorf55			Standard	NM_001145346		Approved	FLJ40249	uc011mte.1	Q8N7X1	OTTHUMG00000022230	ENST00000424776.3:c.3075C>T	X.37:g.114427079C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DXC0	Silent	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.L1025	ENST00000424776.3	37	c.3075	CCDS55478.1	X																																																																																			RBMXL3	-	NULL		0.672	RBMXL3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RBMXL3	HGNC	protein_coding	OTTHUMT00000057968.3	C	NM_001145346		114427079	+1	no_errors	ENST00000424776	ensembl	human	known	70_37	silent	SNP	0.439	T
REV3L	5980	genome.wustl.edu	37	6	111694699	111694699	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:111694699C>G	ENST00000358835.3	-	14	5313	c.4859G>C	c.(4858-4860)aGt>aCt	p.S1620T	REV3L_ENST00000435970.1_Missense_Mutation_p.S1542T|REV3L_ENST00000368805.1_Missense_Mutation_p.S1620T|REV3L_ENST00000368802.3_Missense_Mutation_p.S1620T			O60673	DPOLZ_HUMAN	REV3-like, polymerase (DNA directed), zeta, catalytic subunit	1620					DNA-dependent DNA replication (GO:0006261)|translesion synthesis (GO:0019985)	chromosome (GO:0005694)|nucleus (GO:0005634)|zeta DNA polymerase complex (GO:0016035)	4 iron, 4 sulfur cluster binding (GO:0051539)|DNA binding (GO:0003677)|DNA-directed DNA polymerase activity (GO:0003887)|metal ion binding (GO:0046872)|nucleotide binding (GO:0000166)			NS(2)|breast(1)|endometrium(6)|kidney(7)|large_intestine(30)|lung(25)|ovary(3)|prostate(5)|skin(8)|upper_aerodigestive_tract(1)	88		all_cancers(87;7.57e-06)|Acute lymphoblastic leukemia(125;2.46e-08)|all_hematologic(75;1.08e-06)|all_epithelial(87;0.00138)|Colorectal(196;0.021)		OV - Ovarian serous cystadenocarcinoma(136;0.0314)|Epithelial(106;0.057)|all cancers(137;0.0663)		AAAGATGGGACTATCATCTGA	0.308								DNA polymerases (catalytic subunits)																																									0													64.0	71.0	69.0					6																	111694699		2198	4294	6492	SO:0001583	missense	5980			AF058701	CCDS5091.2, CCDS69177.1	6q22	2012-05-18	2012-05-18		ENSG00000009413	ENSG00000009413		"""DNA polymerases"""	9968	protein-coding gene	gene with protein product	"""polymerase, DNA, zeta"""	602776	"""REV3 (yeast homolog)-like, catalytic subunit of DNA polymerase zeta"", ""REV3-like, catalytic subunit of DNA polymerase zeta (yeast)"""			9618506, 9925914	Standard	NM_001286431		Approved	POLZ, REV3	uc003puy.4	O60673	OTTHUMG00000016318	ENST00000358835.3:c.4859G>C	6.37:g.111694699C>G	ENSP00000351697:p.Ser1620Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O43214|Q5TC33	Missense_Mutation	SNP	pfam_DNA-dir_DNA_pol_B_multi_dom,pfam_DNA-dir_DNA_pol_B_exonuc,superfamily_RNaseH-like_dom,smart_DNA-dir_DNA_pol_B,prints_DNA-dir_DNA_pol_B	p.S1620T	ENST00000358835.3	37	c.4859	CCDS5091.2	6	.	.	.	.	.	.	.	.	.	.	C	16.53	3.148391	0.57151	.	.	ENSG00000009413	ENST00000368802;ENST00000368805;ENST00000358835;ENST00000435970	T;T;T;T	0.02158	4.51;4.51;4.51;4.42	6.04	6.04	0.98038	Ribonuclease H-like (1);	0.161691	0.56097	D	0.000036	T	0.03739	0.0106	M	0.63843	1.955	0.36119	D	0.845321	P	0.52842	0.956	P	0.47528	0.549	T	0.41360	-0.9513	10	0.62326	D	0.03	-6.8205	20.5948	0.99439	0.0:1.0:0.0:0.0	.	1620	O60673	DPOLZ_HUMAN	T	1620;1620;1620;1542	ENSP00000357792:S1620T;ENSP00000357795:S1620T;ENSP00000351697:S1620T;ENSP00000402003:S1542T	ENSP00000351697:S1620T	S	-	2	0	REV3L	111801392	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	5.453000	0.66645	2.873000	0.98535	0.563000	0.77884	AGT	REV3L	-	superfamily_RNaseH-like_dom		0.308	REV3L-201	KNOWN	basic|appris_principal|CCDS	protein_coding	REV3L	HGNC	protein_coding	OTTHUMT00000043695.1	C	NM_002912		111694699	-1	no_errors	ENST00000358835	ensembl	human	known	70_37	missense	SNP	1.000	G
RGS8	85397	genome.wustl.edu	37	1	182616020	182616020	+	Silent	SNP	C	C	T	rs147293552		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:182616020C>T	ENST00000483095.2	-	7	650	c.393G>A	c.(391-393)acG>acA	p.T131T	RGS8_ENST00000367557.4_Silent_p.T131T|RGS8_ENST00000367556.1_Silent_p.T131T|RGS8_ENST00000258302.4_Silent_p.T149T			P57771	RGS8_HUMAN	regulator of G-protein signaling 8	131	RGS. {ECO:0000255|PROSITE- ProRule:PRU00171}.				positive regulation of GTPase activity (GO:0043547)|termination of G-protein coupled receptor signaling pathway (GO:0038032)	cytoplasm (GO:0005737)|plasma membrane (GO:0005886)	GTPase activator activity (GO:0005096)	p.T149T(1)		haematopoietic_and_lymphoid_tissue(1)|ovary(1)|stomach(2)|upper_aerodigestive_tract(1)	5						GGTTCTTCCTCGTGGCTTCTC	0.527													C|||	1	0.000199681	0.0	0.0	5008	,	,		17602	0.001		0.0	False		,,,				2504	0.0				Ovarian(189;1262 3804 41973)												1	Substitution - coding silent(1)	haematopoietic_and_lymphoid_tissue(1)						C	,	1,4405	2.1+/-5.4	0,1,2202	159.0	155.0	156.0		393,447	-1.6	1.0	1	dbSNP_134	156	0,8600		0,0,4300	no	coding-synonymous,coding-synonymous	RGS8	NM_001102450.1,NM_033345.2	,	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	,	131/181,149/199	182616020	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	85397			AF297015	CCDS1349.1, CCDS41443.1	1q25	2008-07-18	2007-08-14		ENSG00000135824	ENSG00000135824		"""Regulators of G-protein signaling"""	16810	protein-coding gene	gene with protein product		607189	"""regulator of G-protein signalling 8"""			11318611	Standard	NM_001102450		Approved	MGC119067, MGC119068, MGC119069	uc001gpm.1	P57771	OTTHUMG00000035219	ENST00000483095.2:c.393G>A	1.37:g.182616020C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DGL9|Q3SYD2	Silent	SNP	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.T149	ENST00000483095.2	37	c.447	CCDS41443.1	1																																																																																			RGS8	-	pfam_Regulat_G_prot_signal,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,pfscan_Regulat_G_prot_signal		0.527	RGS8-005	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	RGS8	HGNC	protein_coding	OTTHUMT00000358979.1	C	NM_033345		182616020	-1	no_errors	ENST00000258302	ensembl	human	known	70_37	silent	SNP	0.946	T
RNF128	79589	genome.wustl.edu	37	X	105970628	105970628	+	Splice_Site	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:105970628G>A	ENST00000255499.2	+	1	734		c.e1+1		RNF128_ENST00000324342.3_Intron	NM_194463.1	NP_919445.1	Q8TEB7	RN128_HUMAN	ring finger protein 128, E3 ubiquitin protein ligase						negative regulation of cytokine biosynthetic process (GO:0042036)	cytoskeleton (GO:0005856)|endoplasmic reticulum (GO:0005783)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)	ligase activity (GO:0016874)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(2)|large_intestine(1)|lung(6)|ovary(1)	11						TCTCACCCGGGTGAGTGCAGC	0.562																																																	0													43.0	43.0	43.0					X																	105970628		2203	4300	6503	SO:0001630	splice_region_variant	79589			AK027169	CCDS14520.1, CCDS14521.1	Xq22.3	2013-01-09	2012-02-23		ENSG00000133135	ENSG00000133135		"""RING-type (C3HC4) zinc fingers"""	21153	protein-coding gene	gene with protein product		300439	"""ring finger protein 128"""				Standard	NM_024539		Approved	FLJ23516, GRAIL	uc004eml.3	Q8TEB7	OTTHUMG00000022151	ENST00000255499.2:c.484+1G>A	X.37:g.105970628G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJI4|Q6PH80|Q6ZTJ8|Q96RF3|Q9H5E4	Splice_Site	SNP	-	e1+1	ENST00000255499.2	37	c.484+1	CCDS14521.1	X	.	.	.	.	.	.	.	.	.	.	G	12.54	1.967447	0.34754	.	.	ENSG00000133135	ENST00000255499	.	.	.	4.0	3.12	0.35913	.	.	.	.	.	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6443	0.45610	0.0:0.1915:0.8085:0.0	.	.	.	.	.	-1	.	.	.	+	.	.	RNF128	105857284	1.000000	0.71417	0.999000	0.59377	0.450000	0.32258	6.925000	0.75829	0.805000	0.34159	0.513000	0.50165	.	RNF128	-	-		0.562	RNF128-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF128	HGNC	protein_coding	OTTHUMT00000057804.1	G	NM_024539	Intron	105970628	+1	no_errors	ENST00000255499	ensembl	human	known	70_37	splice_site	SNP	1.000	A
RPS25	6230	genome.wustl.edu	37	11	118888132	118888132	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:118888132C>T	ENST00000527673.1	-	3	628	c.223G>A	c.(223-225)Gag>Aag	p.E75K	MIR3656_ENST00000577421.1_RNA|TRAPPC4_ENST00000359005.4_5'Flank|TRAPPC4_ENST00000533058.1_5'Flank|RPS25_ENST00000528547.1_5'Flank|TRAPPC4_ENST00000528230.1_5'Flank|TRAPPC4_ENST00000434101.2_5'Flank|TRAPPC4_ENST00000525303.1_5'Flank|TRAPPC4_ENST00000533632.1_5'Flank	NM_001028.2	NP_001019.1	P62851	RS25_HUMAN	ribosomal protein S25	75					cellular protein metabolic process (GO:0044267)|gene expression (GO:0010467)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|ribosomal small subunit assembly (GO:0000028)|RNA metabolic process (GO:0016070)|SRP-dependent cotranslational protein targeting to membrane (GO:0006614)|translation (GO:0006412)|translational elongation (GO:0006414)|translational initiation (GO:0006413)|translational termination (GO:0006415)|viral life cycle (GO:0019058)|viral process (GO:0016032)|viral transcription (GO:0019083)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|cytosolic small ribosomal subunit (GO:0022627)|extracellular vesicular exosome (GO:0070062)|nucleolus (GO:0005730)|nucleus (GO:0005634)|ribosome (GO:0005840)|small ribosomal subunit (GO:0015935)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|structural constituent of ribosome (GO:0003735)			endometrium(1)	1	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.55e-05)		TTCAGTCTCTCAGAGACCACA	0.448																																																	0													37.0	39.0	38.0					11																	118888132		2200	4292	6492	SO:0001583	missense	6230			M64716	CCDS8406.1	11q23.3	2011-04-06			ENSG00000118181	ENSG00000118181		"""S ribosomal proteins"""	10413	protein-coding gene	gene with protein product		180465				1748303	Standard	NM_001028		Approved	S25	uc001pun.2	P62851	OTTHUMG00000166350	ENST00000527673.1:c.223G>A	11.37:g.118888132C>T	ENSP00000435096:p.Glu75Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R4M7|P25111	Missense_Mutation	SNP	pfam_Ribosomal_S25	p.E75K	ENST00000527673.1	37	c.223	CCDS8406.1	11	.	.	.	.	.	.	.	.	.	.	C	37	6.005153	0.97195	.	.	ENSG00000118181	ENST00000527673	.	.	.	5.79	5.79	0.91817	.	0.046480	0.85682	D	0.000000	T	0.81908	0.4922	M	0.89095	3.005	0.80722	D	1	B	0.29341	0.242	B	0.39590	0.304	T	0.81931	-0.0707	9	0.72032	D	0.01	-17.4404	20.0281	0.97530	0.0:1.0:0.0:0.0	.	75	P62851	RS25_HUMAN	K	75	.	ENSP00000435096:E75K	E	-	1	0	RPS25	118393342	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.723000	0.84788	2.727000	0.93392	0.655000	0.94253	GAG	RPS25	-	pfam_Ribosomal_S25		0.448	RPS25-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RPS25	HGNC	protein_coding	OTTHUMT00000389324.1	C	NM_001028		118888132	-1	no_errors	ENST00000527673	ensembl	human	known	70_37	missense	SNP	1.000	T
RS1	6247	genome.wustl.edu	37	X	18662565	18662565	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chrX:18662565C>T	ENST00000379984.3	-	5	547	c.507G>A	c.(505-507)caG>caA	p.Q169Q	RS1_ENST00000476595.1_5'UTR|CDKL5_ENST00000379989.3_Intron|CDKL5_ENST00000379996.3_Intron	NM_000330.3	NP_000321.1	O15537	XLRS1_HUMAN	retinoschisin 1	169	F5/8 type C. {ECO:0000255|PROSITE- ProRule:PRU00081}.				adaptation of rhodopsin mediated signaling (GO:0016062)|cell adhesion (GO:0007155)|multicellular organismal development (GO:0007275)|retina layer formation (GO:0010842)|visual perception (GO:0007601)	extracellular space (GO:0005615)|extrinsic component of plasma membrane (GO:0019897)	phosphatidylinositol-3,4,5-trisphosphate binding (GO:0005547)|phosphatidylinositol-3,4-bisphosphate binding (GO:0043325)|phosphatidylinositol-3,5-bisphosphate binding (GO:0080025)|phosphatidylinositol-3-phosphate binding (GO:0032266)|phosphatidylinositol-4,5-bisphosphate binding (GO:0005546)|phosphatidylinositol-4-phosphate binding (GO:0070273)|phosphatidylinositol-5-phosphate binding (GO:0010314)|phosphatidylserine binding (GO:0001786)			cervix(1)|endometrium(4)|large_intestine(5)|lung(2)|ovary(2)|skin(1)	15	Hepatocellular(33;0.183)					TGTTTCCAGTCTGGTCCTTGT	0.567																																																	0													145.0	115.0	125.0					X																	18662565		2203	4300	6503	SO:0001819	synonymous_variant	6247			AF014459	CCDS14187.1	Xp22.2-p22.1	2014-09-17	2008-07-29		ENSG00000102104	ENSG00000102104			10457	protein-coding gene	gene with protein product		300839	"""retinoschisis (X-linked, juvenile) 1"""	RS		9326935, 17804407	Standard	NM_000330		Approved	XLRS1	uc004cyo.3	O15537	OTTHUMG00000021216	ENST00000379984.3:c.507G>A	X.37:g.18662565C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q0QD39	Silent	SNP	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom	p.Q169	ENST00000379984.3	37	c.507	CCDS14187.1	X																																																																																			RS1	-	pfam_Coagulation_fac_5/8-C_type_dom,superfamily_Galactose-bd-like,smart_Coagulation_fac_5/8-C_type_dom,pfscan_Coagulation_fac_5/8-C_type_dom		0.567	RS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RS1	HGNC	protein_coding	OTTHUMT00000055949.1	C			18662565	-1	no_errors	ENST00000379984	ensembl	human	known	70_37	silent	SNP	1.000	T
RYR1	6261	genome.wustl.edu	37	19	39063838	39063838	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr19:39063838C>T	ENST00000359596.3	+	96	14020	c.14020C>T	c.(14020-14022)Cgg>Tgg	p.R4674W	RYR1_ENST00000355481.4_Missense_Mutation_p.R4669W|RYR1_ENST00000360985.3_Missense_Mutation_p.R4669W			P21817	RYR1_HUMAN	ryanodine receptor 1 (skeletal)	4674					calcium ion transport (GO:0006816)|cellular response to caffeine (GO:0071313)|cytosolic calcium ion homeostasis (GO:0051480)|ion transmembrane transport (GO:0034220)|muscle contraction (GO:0006936)|ossification involved in bone maturation (GO:0043931)|outflow tract morphogenesis (GO:0003151)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|skeletal muscle fiber development (GO:0048741)|skin development (GO:0043588)|transmembrane transport (GO:0055085)	cell cortex (GO:0005938)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|I band (GO:0031674)|integral component of plasma membrane (GO:0005887)|junctional membrane complex (GO:0030314)|junctional sarcoplasmic reticulum membrane (GO:0014701)|plasma membrane (GO:0005886)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|T-tubule (GO:0030315)|terminal cisterna (GO:0014802)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|voltage-gated calcium channel activity (GO:0005245)			NS(4)|autonomic_ganglia(2)|breast(3)|central_nervous_system(5)|endometrium(26)|haematopoietic_and_lymphoid_tissue(3)|kidney(34)|large_intestine(42)|liver(1)|lung(106)|ovary(11)|pancreas(5)|prostate(9)|skin(12)|stomach(11)|upper_aerodigestive_tract(4)|urinary_tract(7)	285	all_cancers(60;7.91e-06)		Lung(45;0.00172)|LUSC - Lung squamous cell carcinoma(53;0.00272)		Caffeine(DB00201)|Dantrolene(DB01219)|Suramin(DB04786)	AATCTTTAAGCGGGAGAAGGA	0.587																																																	0													83.0	78.0	80.0					19																	39063838		2203	4300	6503	SO:0001583	missense	6261			J05200	CCDS33011.1, CCDS42563.1	19q13.1	2014-09-17				ENSG00000196218		"""Ion channels / Ryanodine receptors"""	10483	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 137"""	180901	"""central core disease of muscle"""	MHS, MHS1, CCO		1862346, 16621918	Standard	NM_000540		Approved	RYR, PPP1R137	uc002oit.3	P21817		ENST00000359596.3:c.14020C>T	19.37:g.39063838C>T	ENSP00000352608:p.Arg4674Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q16314|Q16368|Q9NPK1|Q9P1U4	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,superfamily_MG_RAP_rcpt_1,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_MIR_motif	p.R4674W	ENST00000359596.3	37	c.14020	CCDS33011.1	19	.	.	.	.	.	.	.	.	.	.	C	12.24	1.877451	0.33162	.	.	ENSG00000196218	ENST00000359596;ENST00000355481;ENST00000360985	D;D;D	0.98105	-4.72;-4.72;-4.72	4.39	3.34	0.38264	.	0.000000	0.64402	U	0.000004	D	0.98560	0.9519	M	0.84683	2.71	0.50039	D	0.999848	D;D	0.89917	1.0;1.0	D;D	0.85130	0.997;0.993	D	0.99198	1.0872	10	0.87932	D	0	.	12.4518	0.55681	0.3006:0.6994:0.0:0.0	.	4669;4674	P21817-2;P21817	.;RYR1_HUMAN	W	4674;4669;4669	ENSP00000352608:R4674W;ENSP00000347667:R4669W;ENSP00000354254:R4669W	ENSP00000347667:R4669W	R	+	1	2	RYR1	43755678	1.000000	0.71417	1.000000	0.80357	0.972000	0.66771	2.412000	0.44609	1.049000	0.40321	0.313000	0.20887	CGG	RYR1	-	NULL		0.587	RYR1-010	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	RYR1	HGNC	protein_coding	OTTHUMT00000462137.1	C			39063838	+1	no_errors	ENST00000359596	ensembl	human	known	70_37	missense	SNP	1.000	T
RYR2	6262	genome.wustl.edu	37	1	237777443	237777443	+	Missense_Mutation	SNP	T	T	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:237777443T>A	ENST00000366574.2	+	37	5332	c.5015T>A	c.(5014-5016)gTg>gAg	p.V1672E	RYR2_ENST00000542537.1_Missense_Mutation_p.V1656E|RYR2_ENST00000360064.6_Missense_Mutation_p.V1670E	NM_001035.2	NP_001026.2	Q92736	RYR2_HUMAN	ryanodine receptor 2 (cardiac)	1672	4 X approximate repeats.				BMP signaling pathway (GO:0030509)|calcium ion transport (GO:0006816)|calcium ion transport into cytosol (GO:0060402)|calcium-mediated signaling (GO:0019722)|calcium-mediated signaling using intracellular calcium source (GO:0035584)|canonical Wnt signaling pathway (GO:0060070)|cardiac muscle contraction (GO:0060048)|cardiac muscle hypertrophy (GO:0003300)|cell communication by electrical coupling involved in cardiac conduction (GO:0086064)|cellular calcium ion homeostasis (GO:0006874)|cellular response to caffeine (GO:0071313)|cellular response to epinephrine stimulus (GO:0071872)|cytosolic calcium ion homeostasis (GO:0051480)|detection of calcium ion (GO:0005513)|embryonic heart tube morphogenesis (GO:0003143)|establishment of protein localization to endoplasmic reticulum (GO:0072599)|ion transmembrane transport (GO:0034220)|left ventricular cardiac muscle tissue morphogenesis (GO:0003220)|positive regulation of calcium-transporting ATPase activity (GO:1901896)|positive regulation of heart rate (GO:0010460)|positive regulation of ryanodine-sensitive calcium-release channel activity by adrenergic receptor signaling pathway involved in positive regulation of cardiac muscle contraction (GO:0086094)|positive regulation of sequestering of calcium ion (GO:0051284)|Purkinje myocyte to ventricular cardiac muscle cell signaling (GO:0086029)|regulation of cardiac muscle contraction (GO:0055117)|regulation of cardiac muscle contraction by regulation of the release of sequestered calcium ion (GO:0010881)|regulation of heart rate (GO:0002027)|release of sequestered calcium ion into cytosol (GO:0051209)|release of sequestered calcium ion into cytosol by sarcoplasmic reticulum (GO:0014808)|response to caffeine (GO:0031000)|response to hypoxia (GO:0001666)|response to redox state (GO:0051775)|sarcoplasmic reticulum calcium ion transport (GO:0070296)|transmembrane transport (GO:0055085)|type B pancreatic cell apoptotic process (GO:0097050)|ventricular cardiac muscle cell action potential (GO:0086005)	calcium channel complex (GO:0034704)|extracellular vesicular exosome (GO:0070062)|junctional sarcoplasmic reticulum membrane (GO:0014701)|membrane (GO:0016020)|plasma membrane (GO:0005886)|protein complex (GO:0043234)|sarcoplasmic reticulum (GO:0016529)|sarcoplasmic reticulum membrane (GO:0033017)|smooth endoplasmic reticulum (GO:0005790)|Z disc (GO:0030018)	calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium-induced calcium release activity (GO:0048763)|calcium-release channel activity (GO:0015278)|calmodulin binding (GO:0005516)|enzyme binding (GO:0019899)|identical protein binding (GO:0042802)|intracellular ligand-gated calcium channel activity (GO:0005218)|ion channel binding (GO:0044325)|protein kinase A catalytic subunit binding (GO:0034236)|protein kinase A regulatory subunit binding (GO:0034237)|ryanodine-sensitive calcium-release channel activity (GO:0005219)|suramin binding (GO:0043924)			NS(4)|breast(8)|central_nervous_system(11)|cervix(2)|endometrium(39)|haematopoietic_and_lymphoid_tissue(5)|kidney(17)|large_intestine(83)|liver(4)|lung(353)|ovary(18)|pancreas(5)|prostate(12)|skin(8)|stomach(1)|upper_aerodigestive_tract(12)|urinary_tract(4)	586	Ovarian(103;0.103)	all_cancers(173;0.000368)|Melanoma(53;0.0179)|all_epithelial(177;0.0225)	OV - Ovarian serous cystadenocarcinoma(106;0.00606)			AACCACCGGGTGGCCCATGCC	0.527																																																	0													65.0	67.0	66.0					1																	237777443		2096	4219	6315	SO:0001583	missense	6262			X91869	CCDS55691.1	1q43	2014-09-17			ENSG00000198626	ENSG00000198626		"""Ion channels / Ryanodine receptors"", ""EF-hand domain containing"""	10484	protein-coding gene	gene with protein product		180902	"""arrhythmogenic right ventricular dysplasia 2"""	ARVD2		2380170, 8406504, 11159936	Standard	NM_001035		Approved	ARVC2, VTSIP	uc001hyl.1	Q92736	OTTHUMG00000039543	ENST00000366574.2:c.5015T>A	1.37:g.237777443T>A	ENSP00000355533:p.Val1672Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15411|Q546N8|Q5T3P2	Missense_Mutation	SNP	pfam_Ca-rel_channel,pfam_Ryanodine_rcpt,pfam_Ryanrecept_TM4-6,pfam_SPRY_rcpt,pfam_Ins145_P3_rcpt,pfam_MIR_motif,pfam_RIH_assoc-dom,pfam_Ion_trans_dom,superfamily_MIR_motif,superfamily_ConA-like_lec_gl_sf,smart_MIR_motif,smart_SPla/RYanodine_receptor_subgr,prints_Ryan_recept,pfscan_B30.2/SPRY,pfscan_EF_HAND_2,pfscan_MIR_motif	p.V1670E	ENST00000366574.2	37	c.5009	CCDS55691.1	1	.	.	.	.	.	.	.	.	.	.	T	25.7	4.663031	0.88251	.	.	ENSG00000198626	ENST00000366574;ENST00000360064;ENST00000542537	D;D;D	0.98060	-4.69;-4.67;-4.68	5.78	5.78	0.91487	.	0.000000	0.56097	D	0.000029	D	0.98717	0.9569	M	0.83012	2.62	0.80722	D	1	D	0.89917	1.0	D	0.87578	0.998	D	0.99833	1.1055	10	0.87932	D	0	.	16.1205	0.81351	0.0:0.0:0.0:1.0	.	1672	Q92736	RYR2_HUMAN	E	1672;1670;1656	ENSP00000355533:V1672E;ENSP00000353174:V1670E;ENSP00000443798:V1656E	ENSP00000353174:V1670E	V	+	2	0	RYR2	235844066	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	6.260000	0.72502	2.205000	0.71048	0.533000	0.62120	GTG	RYR2	-	NULL		0.527	RYR2-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	RYR2	HGNC	protein_coding	OTTHUMT00000095402.2	T	NM_001035		237777443	+1	no_errors	ENST00000360064	ensembl	human	known	70_37	missense	SNP	1.000	A
SCAPER	49855	genome.wustl.edu	37	15	77096936	77096936	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr15:77096936G>C	ENST00000563290.1	-	6	527	c.432C>G	c.(430-432)ttC>ttG	p.F144L	SCAPER_ENST00000538941.2_5'UTR|SCAPER_ENST00000324767.7_Missense_Mutation_p.F144L			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	144						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TCAATGCTTTGAAATCTCTTA	0.358																																																	0													113.0	101.0	105.0					15																	77096936		1837	4074	5911	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.432C>G	15.37:g.77096936G>C	ENSP00000454973:p.Phe144Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.F144L	ENST00000563290.1	37	c.432	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	G	20.4	3.979555	0.74360	.	.	ENSG00000140386	ENST00000324767;ENST00000303521	T	0.64260	-0.09	5.34	1.24	0.21308	.	0.000000	0.85682	D	0.000000	T	0.76506	0.3997	M	0.82517	2.595	0.47374	D	0.999406	D;D	0.76494	0.999;0.999	D;D	0.77557	0.99;0.99	T	0.76052	-0.3100	10	0.72032	D	0.01	.	9.4528	0.38736	0.3452:0.0:0.6548:0.0	.	144;159	Q6NSF1;Q9BY12-2	.;.	L	144;160	ENSP00000326924:F144L	ENSP00000303560:F160L	F	-	3	2	SCAPER	74883991	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	2.013000	0.40942	0.227000	0.20999	-0.145000	0.13849	TTC	SCAPER	-	NULL		0.358	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	G	NM_020843		77096936	-1	no_errors	ENST00000324767	ensembl	human	known	70_37	missense	SNP	1.000	C
SEPT5	5413	genome.wustl.edu	37	22	19709399	19709399	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:19709399C>T	ENST00000455784.2	+	10	994	c.869C>T	c.(868-870)aCg>aTg	p.T290M	GP1BB_ENST00000366425.3_5'Flank|SEPT5_ENST00000438754.2_Silent_p.H295H|SEPT5_ENST00000383045.3_Missense_Mutation_p.T299M|SEPT5_ENST00000406395.1_Silent_p.H286H	NM_002688.5	NP_002679.2	Q99719	SEPT5_HUMAN	septin 5	290	Septin-type G.				cytokinesis (GO:0000910)|GTP catabolic process (GO:0006184)|regulation of exocytosis (GO:0017157)|regulation of synaptic vesicle exocytosis (GO:2000300)|synaptic vesicle targeting (GO:0016080)	plasma membrane (GO:0005886)|septin complex (GO:0031105)|synaptic vesicle (GO:0008021)|terminal bouton (GO:0043195)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|structural molecule activity (GO:0005198)			lung(1)|upper_aerodigestive_tract(1)	2	Colorectal(54;0.0993)					CTCATCCGCACGCATATGCAC	0.657																																																	0													62.0	56.0	58.0					22																	19709399		2203	4299	6502	SO:0001583	missense	5413			Y11593	CCDS13764.1, CCDS56224.1	22q11.2	2013-01-21	2005-01-11	2005-01-12	ENSG00000184702	ENSG00000184702		"""Septins"""	9164	protein-coding gene	gene with protein product		602724	"""peanut-like 1 (Drosophila)"""	PNUTL1		9385360, 9611266	Standard	NM_002688		Approved	HCDCREL-1, H5		Q99719	OTTHUMG00000150399	ENST00000455784.2:c.869C>T	22.37:g.19709399C>T	ENSP00000391311:p.Thr290Met	Somatic		WXS	Illumina HiSeq	Phase_IV	O15251|Q96MY5	Missense_Mutation	SNP	pfam_Cell_div_GTP-bd,pfam_Ribosome_biogen_GTPase_RsgA,pirsf_Septin	p.T299M	ENST00000455784.2	37	c.896	CCDS13764.1	22	.	.	.	.	.	.	.	.	.	.	C	35	5.546492	0.96488	.	.	ENSG00000184702	ENST00000455784;ENST00000412544;ENST00000383045	T;T;T	0.55052	0.54;0.54;0.54	3.82	3.82	0.43975	.	0.215360	0.37530	N	0.002041	T	0.80813	0.4695	H	0.95884	3.735	0.80722	D	1	D	0.65815	0.995	D	0.77557	0.99	D	0.88009	0.2761	10	0.87932	D	0	.	16.2687	0.82603	0.0:1.0:0.0:0.0	.	290	Q99719	SEPT5_HUMAN	M	290;243;299	ENSP00000391311:T290M;ENSP00000408678:T243M;ENSP00000372515:T299M	ENSP00000372515:T299M	T	+	2	0	SEPT5	18089399	1.000000	0.71417	1.000000	0.80357	0.984000	0.73092	7.532000	0.81985	2.145000	0.66743	0.478000	0.44815	ACG	SEPT5	-	pfam_Cell_div_GTP-bd,pirsf_Septin		0.657	SEPT5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SEPT5	HGNC	protein_coding	OTTHUMT00000317937.1	C	NM_002688		19709399	+1	no_errors	ENST00000383045	ensembl	human	known	70_37	missense	SNP	1.000	T
SERBP1	26135	genome.wustl.edu	37	1	67890585	67890585	+	Silent	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:67890585G>C	ENST00000370995.2	-	4	766	c.681C>G	c.(679-681)gtC>gtG	p.V227V	SERBP1_ENST00000370990.5_Silent_p.V221V|SERBP1_ENST00000484880.1_5'UTR|SERBP1_ENST00000370994.4_Silent_p.V221V|SERBP1_ENST00000361219.6_Silent_p.V227V			Q8NC51	PAIRB_HUMAN	SERPINE1 mRNA binding protein 1	227					regulation of apoptotic process (GO:0042981)|regulation of mRNA stability (GO:0043488)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	mRNA 3'-UTR binding (GO:0003730)|poly(A) RNA binding (GO:0044822)			breast(1)|endometrium(2)|large_intestine(3)|lung(4)|skin(1)|upper_aerodigestive_tract(2)	13						ATTCGTCTTTGACAGTTCCCC	0.368																																																	0													81.0	78.0	79.0					1																	67890585		2203	4300	6503	SO:0001819	synonymous_variant	26135			AF151813	CCDS639.1, CCDS30746.1, CCDS30747.1, CCDS30748.1	1p31	2009-12-17			ENSG00000142864	ENSG00000142864			17860	protein-coding gene	gene with protein product		607378				11001948, 10810093, 18440126, 17698176	Standard	NM_001018067		Approved	PAI-RBP1, DKFZP564M2423, CGI-55, HABP4L, PAIRBP1, CHD3IP	uc001ddv.3	Q8NC51	OTTHUMG00000009372	ENST00000370995.2:c.681C>G	1.37:g.67890585G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5VU19|Q5VU20|Q5VU22|Q8WUH0|Q96SE2|Q9BTY3|Q9BUM4|Q9Y367|Q9Y4S3	Silent	SNP	pfam_HABP4_PAIRBP1-bd	p.V227	ENST00000370995.2	37	c.681	CCDS30746.1	1																																																																																			SERBP1	-	pfam_HABP4_PAIRBP1-bd		0.368	SERBP1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SERBP1	HGNC	protein_coding	OTTHUMT00000025984.2	G	NM_001018067		67890585	-1	no_errors	ENST00000370995	ensembl	human	known	70_37	silent	SNP	1.000	C
SIAH3	283514	genome.wustl.edu	37	13	46357699	46357699	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr13:46357699C>T	ENST00000400405.2	-	2	735	c.629G>A	c.(628-630)cGg>cAg	p.R210Q		NM_198849.2	NP_942146.2	Q8IW03	SIAH3_HUMAN	siah E3 ubiquitin protein ligase family member 3	210					multicellular organismal development (GO:0007275)|ubiquitin-dependent protein catabolic process (GO:0006511)	mitochondrion (GO:0005739)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			large_intestine(3)|lung(7)|ovary(1)|skin(1)	12						CTTGAGGCGCCGATGGTTTCT	0.617																																																	0													44.0	51.0	49.0					13																	46357699		1989	4142	6131	SO:0001583	missense	283514				CCDS41883.1	13q14.12	2012-02-23	2012-02-23		ENSG00000215475	ENSG00000215475			30553	protein-coding gene	gene with protein product		615609	"""seven in absentia homolog 3 (Drosophila)"""			12477932	Standard	NM_198849		Approved	FLJ39203	uc001vap.3	Q8IW03	OTTHUMG00000016862	ENST00000400405.2:c.629G>A	13.37:g.46357699C>T	ENSP00000383256:p.Arg210Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZBP0|Q8N8M6	Missense_Mutation	SNP	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like	p.R210Q	ENST00000400405.2	37	c.629	CCDS41883.1	13	.	.	.	.	.	.	.	.	.	.	C	34	5.330775	0.95733	.	.	ENSG00000215475	ENST00000400405	T	0.26660	1.72	5.07	5.07	0.68467	TRAF-type (1);Seven-in-absentia protein, TRAF-like domain (1);TRAF-like (1);	0.000000	0.85682	U	0.000000	T	0.54046	0.1834	M	0.77616	2.38	0.43010	D	0.994541	D	0.89917	1.0	D	0.85130	0.997	T	0.60495	-0.7252	10	0.87932	D	0	-14.3027	17.4324	0.87543	0.0:1.0:0.0:0.0	.	210	Q8IW03	SIAH3_HUMAN	Q	210	ENSP00000383256:R210Q	ENSP00000383256:R210Q	R	-	2	0	SIAH3	45255700	1.000000	0.71417	0.996000	0.52242	0.886000	0.51366	7.703000	0.84585	2.369000	0.80426	0.561000	0.74099	CGG	SIAH3	-	pfam_7-in-absentia-prot_TRAF-dom,superfamily_TRAF-like		0.617	SIAH3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIAH3	HGNC	protein_coding	OTTHUMT00000044788.2	C	NM_198849		46357699	-1	no_errors	ENST00000400405	ensembl	human	known	70_37	missense	SNP	1.000	T
SLC13A1	6561	genome.wustl.edu	37	7	122787347	122787347	+	Silent	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr7:122787347G>T	ENST00000194130.2	-	7	717	c.678C>A	c.(676-678)acC>acA	p.T226T	SLC13A1_ENST00000539873.1_3'UTR	NM_022444.3	NP_071889.2	Q9BZW2	S13A1_HUMAN	solute carrier family 13 (sodium/sulfate symporter), member 1	226					transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium:sulfate symporter activity (GO:0015382)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(9)|lung(20)|ovary(2)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	45					Succinic acid(DB00139)	TTCGATATTTGGTTCTCATGC	0.433																																																	0													190.0	147.0	162.0					7																	122787347		2203	4300	6503	SO:0001819	synonymous_variant	6561				CCDS5786.1	7q31.32	2013-07-18	2013-07-18		ENSG00000081800	ENSG00000081800		"""Solute carriers"""	10916	protein-coding gene	gene with protein product		606193	"""solute carrier family 13 (sodium/sulphate symporters), member 1"""			11161786	Standard	NM_022444		Approved	NaSi-1, NAS1	uc003vkm.3	Q9BZW2	OTTHUMG00000157087	ENST00000194130.2:c.678C>A	7.37:g.122787347G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H5Z0	Silent	SNP	pfam_Na/sul_symport,pfam_Cit_transptr-like_dom	p.T226	ENST00000194130.2	37	c.678	CCDS5786.1	7																																																																																			SLC13A1	-	pfam_Na/sul_symport		0.433	SLC13A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC13A1	HGNC	protein_coding	OTTHUMT00000347404.1	G	NM_022444		122787347	-1	no_errors	ENST00000194130	ensembl	human	known	70_37	silent	SNP	0.001	T
SLC22A7	10864	genome.wustl.edu	37	6	43267781	43267781	+	Silent	SNP	T	T	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr6:43267781T>C	ENST00000372585.5	+	5	899	c.804T>C	c.(802-804)tgT>tgC	p.C268C	SLC22A7_ENST00000487175.1_3'UTR|SLC22A7_ENST00000372574.3_Silent_p.C266C|SLC22A7_ENST00000372589.3_Silent_p.C266C	NM_153320.2	NP_696961.2	Q9Y694	S22A7_HUMAN	solute carrier family 22 (organic anion transporter), member 7	268					organic anion transport (GO:0015711)|response to stilbenoid (GO:0035634)|transmembrane transport (GO:0055085)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	sodium-independent organic anion transmembrane transporter activity (GO:0015347)			NS(2)|endometrium(1)|kidney(1)|large_intestine(8)|lung(10)|prostate(1)|skin(3)	26			Colorectal(64;0.00245)|COAD - Colon adenocarcinoma(64;0.00536)|all cancers(41;0.00998)|OV - Ovarian serous cystadenocarcinoma(102;0.0305)		Acetylsalicylic acid(DB00945)|Allopurinol(DB00437)|Aminohippurate(DB00345)|Bumetanide(DB00887)|Cefalotin(DB00456)|Cefamandole(DB01326)|Cefoperazone(DB01329)|Cefotaxime(DB00493)|Cimetidine(DB00501)|Clarithromycin(DB01211)|Dinoprost Tromethamine(DB01160)|Dinoprostone(DB00917)|Docetaxel(DB01248)|Enalapril(DB00584)|Erythromycin(DB00199)|Fluorouracil(DB00544)|Ganciclovir(DB01004)|Glyburide(DB01016)|Indomethacin(DB00328)|Ketoprofen(DB01009)|Methotrexate(DB00563)|Minocycline(DB01017)|Oxtriphylline(DB01303)|Oxytetracycline(DB00595)|Pravastatin(DB00175)|Probenecid(DB01032)|Rifampicin(DB01045)|Salicylic acid(DB00936)|Testosterone(DB00624)|Tetracycline(DB00759)|Theophylline(DB00277)|Valproic Acid(DB00313)|Zalcitabine(DB00943)|Zidovudine(DB00495)	CCCTGCCTTGTGCCCCAGGCA	0.582																																																	0													168.0	126.0	140.0					6																	43267781		2203	4300	6503	SO:0001819	synonymous_variant	10864			AF097518	CCDS4892.1, CCDS4893.2	6p21.1	2013-05-22			ENSG00000137204	ENSG00000137204		"""Solute carriers"""	10971	protein-coding gene	gene with protein product		604995				9650585, 10773670	Standard	XM_006714970		Approved	NLT, OAT2	uc003out.3	Q9Y694	OTTHUMG00000014726	ENST00000372585.5:c.804T>C	6.37:g.43267781T>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2CZX6|Q5T046|Q5T048|Q5T050|Q9H2W5	Silent	SNP	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp	p.C268	ENST00000372585.5	37	c.804	CCDS4893.2	6																																																																																			SLC22A7	-	pfam_MFS,pfam_Sub_transporter,superfamily_MFS_dom_general_subst_transpt,pfscan_MFS_dom,tigrfam_Orgcat_transp		0.582	SLC22A7-004	KNOWN	basic|CCDS	protein_coding	SLC22A7	HGNC	protein_coding	OTTHUMT00000040588.1	T			43267781	+1	no_errors	ENST00000372585	ensembl	human	known	70_37	silent	SNP	0.002	C
SLC46A3	283537	genome.wustl.edu	37	13	29278264	29278265	+	Intron	INS	-	-	A	rs113200616|rs34310301|rs537016644|rs554117979|rs536813326	byFrequency	TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr13:29278264_29278265insA	ENST00000266943.6	-	5	1514				SLC46A3_ENST00000475385.1_5'UTR|RNU6-53P_ENST00000365367.1_RNA|SLC46A3_ENST00000380814.4_Intron	NM_001135919.1|NM_181785.3	NP_001129391.1|NP_861450.1	Q7Z3Q1	S46A3_HUMAN	solute carrier family 46, member 3						transmembrane transport (GO:0055085)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)				central_nervous_system(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(2)|prostate(1)|skin(1)	15		Lung SC(185;0.0367)		all cancers(112;0.159)		AGAGAGAGAGGAAAAAAAAAAG	0.381																																																	0																																										SO:0001627	intron_variant	283537				CCDS9332.1, CCDS45021.1	13q12.3	2013-05-22	2007-03-29		ENSG00000139508	ENSG00000139508		"""Solute carriers"""	27501	protein-coding gene	gene with protein product							Standard	NM_001135919		Approved	DKFZp686A1775, FLJ42613	uc001usj.3	Q7Z3Q1	OTTHUMG00000016650	ENST00000266943.6:c.1145-28->T	13.37:g.29278274_29278274dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	Q3ZCV8|Q6NUK5|Q6P9B3|Q6ZVG5|Q96QA1	RNA	INS	-	NULL	ENST00000266943.6	37	NULL	CCDS9332.1	13																																																																																			SLC46A3	-	-		0.381	SLC46A3-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	SLC46A3	HGNC	protein_coding	OTTHUMT00000276111.1	-	NM_181785		29278265	-1	no_errors	ENST00000475385	ensembl	human	known	70_37	rna	INS	0.001:0.000	A
SLC9A7P1	121456	genome.wustl.edu	37	12	98849969	98849969	+	RNA	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr12:98849969G>C	ENST00000554295.1	-	0	954					NR_033801.1				solute carrier family 9, subfamily A (NHE7, cation proton antiporter 7), member 7 pseudogene 1																		TCAAAGGCGTGAGTTGAAGTT	0.428																																																	0																																												121456					12q23.1	2013-05-22	2012-03-22		ENSG00000227825	ENSG00000227825		"""Solute carriers"""	32679	pseudogene	pseudogene			"""solute carrier family 9 (sodium/hydrogen exchanger), member 7 pseudogene 1"""				Standard	NR_033801		Approved		uc009ztm.2		OTTHUMG00000170629		12.37:g.98849969G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000554295.1	37	NULL		12																																																																																			SLC9A7P1	-	-		0.428	SLC9A7P1-002	PUTATIVE	basic	processed_transcript	SLC9A7P1	HGNC	pseudogene	OTTHUMT00000409869.1	G			98849969	-1	no_errors	ENST00000554295	ensembl	human	putative	70_37	rna	SNP	0.997	C
SPATA5	166378	genome.wustl.edu	37	4	123850306	123850306	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr4:123850306C>G	ENST00000274008.4	+	3	469	c.400C>G	c.(400-402)Ctt>Gtt	p.L134V	SPATA5_ENST00000422835.2_3'UTR	NM_145207.2	NP_660208.2	Q8NB90	SPAT5_HUMAN	spermatogenesis associated 5	134					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)	ATP binding (GO:0005524)			endometrium(2)|kidney(2)|large_intestine(6)|lung(10)|ovary(1)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	24						GGTCCAGCCTCTTGTGGGTGC	0.522																																																	0													130.0	118.0	122.0					4																	123850306		2203	4300	6503	SO:0001583	missense	166378			AF361489	CCDS3730.1	4q28.1	2010-04-21			ENSG00000145375	ENSG00000145375		"""ATPases / AAA-type"""	18119	protein-coding gene	gene with protein product	"""ATPase family gene 2 homolog (S. cerevisiae)"""	613940				16465403	Standard	NM_145207		Approved	SPAF, AFG2	uc003iez.4	Q8NB90	OTTHUMG00000133074	ENST00000274008.4:c.400C>G	4.37:g.123850306C>G	ENSP00000274008:p.Leu134Val	Somatic		WXS	Illumina HiSeq	Phase_IV	C9JT97|Q86XW1|Q8NI20|Q8TDL7	Missense_Mutation	SNP	pfam_ATPase_AAA_core,pfam_DNA_helicase_Holl-junc_RuvB_N,superfamily_Asp_de-COase-like_fold,smart_AAA+_ATPase	p.L134V	ENST00000274008.4	37	c.400	CCDS3730.1	4	.	.	.	.	.	.	.	.	.	.	C	5.833	0.337927	0.11013	.	.	ENSG00000145375	ENST00000274008	D	0.94687	-3.49	4.63	0.513	0.17000	Aspartate decarboxylase-like fold (1);	0.444910	0.22284	N	0.062086	D	0.86016	0.5832	L	0.27053	0.805	0.09310	N	0.999997	B;B	0.14805	0.007;0.011	B;B	0.16722	0.004;0.016	T	0.71391	-0.4607	10	0.20046	T	0.44	-18.7682	3.93	0.09281	0.2403:0.278:0.4007:0.0811	.	134;134	Q8NB90;Q8NB90-3	SPAT5_HUMAN;.	V	134	ENSP00000274008:L134V	ENSP00000274008:L134V	L	+	1	0	SPATA5	124069756	0.392000	0.25229	0.775000	0.31657	0.943000	0.58893	0.040000	0.13905	0.150000	0.19136	0.561000	0.74099	CTT	SPATA5	-	superfamily_Asp_de-COase-like_fold		0.522	SPATA5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA5	HGNC	protein_coding	OTTHUMT00000256714.2	C	NM_145207		123850306	+1	no_errors	ENST00000274008	ensembl	human	known	70_37	missense	SNP	0.036	G
SPDYE3	441272	genome.wustl.edu	37	7	99905525	99905525	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr7:99905525C>T	ENST00000332397.6	+	1	201	c.17C>T	c.(16-18)cCg>cTg	p.P6L	SPDYE3_ENST00000437326.2_5'UTR	NM_001004351.4	NP_001004351.3	A6NKU9	SPDE3_HUMAN	speedy/RINGO cell cycle regulator family member E3	6										endometrium(10)|kidney(1)|lung(8)|urinary_tract(1)	20						AGCCATCAACCGCAGCCCCAG	0.572																																																	0													16.0	15.0	15.0					7																	99905525		874	1984	2858	SO:0001583	missense	441272			BC056606	CCDS47658.1, CCDS47658.2	7q22.1	2013-05-08	2013-05-08		ENSG00000214300	ENSG00000214300		"""Speedy homologs"""	35462	protein-coding gene	gene with protein product			"""speedy homolog E3 (Xenopus laevis)"""				Standard	NM_001004351		Approved		uc022aij.1	A6NKU9	OTTHUMG00000155462	ENST00000332397.6:c.17C>T	7.37:g.99905525C>T	ENSP00000329565:p.Pro6Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q495Y9|Q6PHC4	Missense_Mutation	SNP	pfam_Cell_cycle_regulatory_Spy1	p.P6L	ENST00000332397.6	37	c.17	CCDS47658.2	7	.	.	.	.	.	.	.	.	.	.	C	10.22	1.291455	0.23564	.	.	ENSG00000214300	ENST00000332397	.	.	.	0.128	0.128	0.14733	.	.	.	.	.	T	0.16171	0.0389	N	0.14661	0.345	0.09310	N	0.999998	.	.	.	.	.	.	T	0.29731	-1.0002	5	0.08381	T	0.77	.	.	.	.	.	.	.	.	L	6	.	ENSP00000329565:P6L	P	+	2	0	SPDYE3	99743461	0.188000	0.23250	0.007000	0.13788	0.007000	0.05969	-0.773000	0.04689	0.283000	0.22279	0.289000	0.19496	CCG	SPDYE3	-	NULL		0.572	SPDYE3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SPDYE3	HGNC	protein_coding	OTTHUMT00000340224.2	C	NM_001004351		99905525	+1	no_errors	ENST00000332397	ensembl	human	known	70_37	missense	SNP	0.008	T
SPON1	10418	genome.wustl.edu	37	11	14282292	14282292	+	RNA	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:14282292G>A	ENST00000534587.1	-	0	480				SPON1_ENST00000310358.7_RNA																							CATGCTCCCTGAATGCCGTAA	0.557																																																	0													78.0	81.0	80.0					11																	14282292		2038	4192	6230			10418																															11.37:g.14282292G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000534587.1	37	NULL		11	.	.	.	.	.	.	.	.	.	.	G	21.5	4.158119	0.78114	.	.	ENSG00000152268	ENST00000310358	.	.	.	4.57	4.57	0.56435	.	0.056340	0.64402	D	0.000001	T	0.62624	0.2443	.	.	.	0.52099	D	0.999946	P	0.52463	0.953	P	0.57679	0.825	T	0.60999	-0.7151	7	0.15066	T	0.55	.	14.9279	0.70893	0.0:0.0:1.0:0.0	.	664	Q9HCB6	SPON1_HUMAN	K	663	.	ENSP00000309297:E663K	E	+	1	0	SPON1	14238868	1.000000	0.71417	0.852000	0.33557	0.980000	0.70556	9.263000	0.95617	2.363000	0.80096	0.655000	0.94253	GAA	SPON1	-	-		0.557	RP11-21L19.1-001	KNOWN	basic	antisense	SPON1	HGNC	antisense	OTTHUMT00000386031.1	G			14282292	+1	no_errors	ENST00000310358	ensembl	human	known	70_37	rna	SNP	0.998	A
STK3	6788	genome.wustl.edu	37	8	99719434	99719434	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:99719434G>A	ENST00000419617.2	-	5	597	c.457C>T	c.(457-459)Ctc>Ttc	p.L153F	STK3_ENST00000523601.1_Missense_Mutation_p.L181F	NM_006281.3	NP_006272.2	Q13188	STK3_HUMAN	serine/threonine kinase 3	153	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				apoptotic process (GO:0006915)|cell differentiation involved in embryonic placenta development (GO:0060706)|central nervous system development (GO:0007417)|endocardium development (GO:0003157)|hepatocyte apoptotic process (GO:0097284)|hippo signaling (GO:0035329)|intracellular signal transduction (GO:0035556)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of cell proliferation (GO:0008285)|negative regulation of organ growth (GO:0046621)|neural tube formation (GO:0001841)|positive regulation of apoptotic process (GO:0043065)|positive regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902043)|positive regulation of JNK cascade (GO:0046330)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of protein serine/threonine kinase activity (GO:0071902)|primitive hemopoiesis (GO:0060215)|protein phosphorylation (GO:0006468)|signal transduction (GO:0007165)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|protein dimerization activity (GO:0046983)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activator activity (GO:0043539)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|endometrium(2)|kidney(1)|large_intestine(4)|lung(6)|ovary(1)|upper_aerodigestive_tract(1)	17	Breast(36;2.4e-06)	Breast(495;0.106)	OV - Ovarian serous cystadenocarcinoma(57;0.0382)	KIRC - Kidney renal clear cell carcinoma(542;9.44e-06)		GTATTGAGGAGAATATTTCCA	0.323																																																	0													64.0	61.0	62.0					8																	99719434		1820	4110	5930	SO:0001583	missense	6788			BC010640	CCDS47900.1, CCDS59108.1, CCDS75774.1	8q22.2	2011-05-24	2010-06-25		ENSG00000104375	ENSG00000104375			11406	protein-coding gene	gene with protein product		605030	"""serine/threonine kinase 3 (Ste20, yeast homolog)"""			8816758	Standard	NM_006281		Approved	MST2, KRS1	uc003yip.4	Q13188	OTTHUMG00000164651	ENST00000419617.2:c.457C>T	8.37:g.99719434G>A	ENSP00000390500:p.Leu153Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K722|B3KYA7|Q15445|Q15801|Q96FM6	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_SARAH_domain,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_SARAH,pfscan_Prot_kinase_cat_dom	p.L153F	ENST00000419617.2	37	c.457	CCDS47900.1	8	.	.	.	.	.	.	.	.	.	.	G	22.5	4.295800	0.81025	.	.	ENSG00000104375	ENST00000419617;ENST00000523601	T;T	0.34472	1.36;1.36	5.32	5.32	0.75619	Serine/threonine-protein kinase-like domain (1);Serine/threonine-protein kinase, catalytic  domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.000000	0.85682	D	0.000000	T	0.62060	0.2397	M	0.72894	2.215	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	T	0.65463	-0.6162	10	0.87932	D	0	.	18.9913	0.92793	0.0:0.0:1.0:0.0	.	153;181	Q13188;B3KYA7	STK3_HUMAN;.	F	153;181	ENSP00000390500:L153F;ENSP00000429744:L181F	ENSP00000390500:L153F	L	-	1	0	STK3	99788610	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	6.640000	0.74319	2.493000	0.84123	0.561000	0.74099	CTC	STK3	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.323	STK3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK3	HGNC	protein_coding	OTTHUMT00000379635.1	G	NM_006281		99719434	-1	no_errors	ENST00000419617	ensembl	human	known	70_37	missense	SNP	1.000	A
STXBP4	252983	genome.wustl.edu	37	17	53237197	53237197	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:53237197G>C	ENST00000376352.2	+	18	1794	c.1587G>C	c.(1585-1587)atG>atC	p.M529I	STXBP4_ENST00000434978.2_Missense_Mutation_p.M507I	NM_178509.5	NP_848604.3	Q6ZWJ1	STXB4_HUMAN	syntaxin binding protein 4	529	WW. {ECO:0000255|PROSITE- ProRule:PRU00224}.				cellular response to DNA damage stimulus (GO:0006974)|glucose transport (GO:0015758)|insulin receptor signaling pathway (GO:0008286)|positive regulation of cell cycle G1/S phase transition (GO:1902808)|positive regulation of keratinocyte proliferation (GO:0010838)|protein stabilization (GO:0050821)|protein targeting (GO:0006605)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|intermediate filament cytoskeleton (GO:0045111)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(4)|ovary(1)|upper_aerodigestive_tract(2)	19						ATCCCGTGATGAGTGTCCTGA	0.433																																																	0													128.0	104.0	112.0					17																	53237197		2203	4300	6503	SO:0001583	missense	252983			BC041485	CCDS11584.2	17q22	2008-02-05			ENSG00000166263	ENSG00000166263			19694	protein-coding gene	gene with protein product		610415				12855681	Standard	XM_005257187		Approved	Synip, MGC50337	uc002iuf.1	Q6ZWJ1	OTTHUMG00000074043	ENST00000376352.2:c.1587G>C	17.37:g.53237197G>C	ENSP00000365530:p.Met529Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IVZ5	Missense_Mutation	SNP	pfam_WW_Rsp5_WWP,pfam_PDZ,superfamily_PDZ,superfamily_WW_Rsp5_WWP,smart_PDZ,smart_WW_Rsp5_WWP,pfscan_PDZ,pfscan_WW_Rsp5_WWP	p.M529I	ENST00000376352.2	37	c.1587	CCDS11584.2	17	.	.	.	.	.	.	.	.	.	.	G	11.82	1.753571	0.31046	.	.	ENSG00000166263	ENST00000376352;ENST00000434978	T;T	0.03468	3.92;3.93	5.22	2.97	0.34412	WW/Rsp5/WWP (3);	0.343317	0.26824	N	0.022303	T	0.01661	0.0053	N	0.05199	-0.095	0.80722	D	1	B;B	0.23442	0.085;0.085	B;B	0.14023	0.01;0.01	T	0.54357	-0.8306	10	0.27785	T	0.31	-6.2618	3.8553	0.08973	0.2361:0.1981:0.5658:0.0	.	507;529	E7EPP7;Q6ZWJ1	.;STXB4_HUMAN	I	529;507	ENSP00000365530:M529I;ENSP00000391087:M507I	ENSP00000365530:M529I	M	+	3	0	STXBP4	50592196	0.963000	0.33076	0.988000	0.46212	0.984000	0.73092	0.191000	0.17076	1.288000	0.44600	0.563000	0.77884	ATG	STXBP4	-	superfamily_WW_Rsp5_WWP,smart_WW_Rsp5_WWP,pfscan_WW_Rsp5_WWP		0.433	STXBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STXBP4	HGNC	protein_coding	OTTHUMT00000157184.1	G	NM_178509		53237197	+1	no_errors	ENST00000376352	ensembl	human	known	70_37	missense	SNP	0.988	C
SUV420H2	84787	genome.wustl.edu	37	19	55856064	55856064	+	Intron	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr19:55856064C>T	ENST00000255613.3	+	6	818				AC020922.1_ENST00000539076.1_5'UTR|SUV420H2_ENST00000402499.4_3'UTR	NM_032701.3	NP_116090.2	Q86Y97	SV422_HUMAN	suppressor of variegation 4-20 homolog 2 (Drosophila)						histone H4-K20 trimethylation (GO:0034773)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	condensed nuclear chromosome, centromeric region (GO:0000780)|nuclear heterochromatin (GO:0005720)|nucleus (GO:0005634)|pericentric heterochromatin (GO:0005721)	histone methyltransferase activity (H4-K20 specific) (GO:0042799)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|lung(2)	4	Breast(117;0.191)		BRCA - Breast invasive adenocarcinoma(297;0.209)	GBM - Glioblastoma multiforme(193;0.044)		CAGAGAGCCCCAGGGGCCAGG	0.672																																																	0													11.0	12.0	11.0					19																	55856064		873	1989	2862	SO:0001627	intron_variant	84787			BC005842	CCDS12922.1	19q13.42	2011-07-01			ENSG00000133247	ENSG00000133247		"""Chromatin-modifying enzymes / K-methyltransferases"""	28405	protein-coding gene	gene with protein product		613198				12477932	Standard	NM_032701		Approved	MGC2705, KMT5C	uc002qkj.4	Q86Y97	OTTHUMG00000150483	ENST00000255613.3:c.570+699C>T	19.37:g.55856064C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WZ10|Q9BRZ6	RNA	SNP	-	NULL	ENST00000255613.3	37	NULL	CCDS12922.1	19	.	.	.	.	.	.	.	.	.	.	C	11.44	1.638182	0.29157	.	.	ENSG00000133247	ENST00000402499	.	.	.	2.31	2.31	0.28768	.	.	.	.	.	T	0.33904	0.0879	.	.	.	0.26043	N	0.98159	.	.	.	.	.	.	T	0.20472	-1.0274	5	0.27785	T	0.31	.	8.6233	0.33875	0.0:1.0:0.0:0.0	.	.	.	.	L	59	.	ENSP00000386042:P59L	P	+	2	0	SUV420H2	60547876	0.000000	0.05858	0.003000	0.11579	0.051000	0.14879	-2.083000	0.01364	1.254000	0.44035	0.561000	0.74099	CCA	SUV420H2	-	-		0.672	SUV420H2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SUV420H2	HGNC	protein_coding	OTTHUMT00000318309.2	C	NM_032701		55856064	+1	no_errors	ENST00000402499	ensembl	human	known	70_37	rna	SNP	0.013	T
TBC1D20	128637	genome.wustl.edu	37	20	419231	419231	+	Nonstop_Mutation	SNP	C	C	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr20:419231C>A	ENST00000354200.4	-	8	1358	c.1211G>T	c.(1210-1212)tGa>tTa	p.*404L	TBC1D20_ENST00000461188.1_5'UTR	NM_144628.2	NP_653229.1	Q96BZ9	TBC20_HUMAN	TBC1 domain family, member 20	0					acrosome assembly (GO:0001675)|cargo loading into COPII-coated vesicle (GO:0090110)|ER to Golgi vesicle-mediated transport (GO:0006888)|Golgi organization (GO:0007030)|lens fiber cell morphogenesis (GO:0070309)|lipid particle organization (GO:0034389)|positive regulation of ER to Golgi vesicle-mediated transport (GO:1902953)|positive regulation of GTP catabolic process (GO:0033126)|positive regulation of Rab GTPase activity (GO:0032851)|seminiferous tubule development (GO:0072520)|virion assembly (GO:0019068)	endoplasmic reticulum membrane (GO:0005789)|integral component of Golgi membrane (GO:0030173)|nuclear membrane (GO:0031965)	Rab GTPase activator activity (GO:0005097)|Rab GTPase binding (GO:0017137)			central_nervous_system(1)|endometrium(2)|kidney(2)|large_intestine(3)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	12		all_epithelial(17;0.228)|Breast(17;0.231)				CTCTGGCTTTCAGGGAAACAG	0.517																																																	0													70.0	75.0	73.0					20																	419231		2203	4300	6503	SO:0001578	stop_lost	128637			AK055573	CCDS13002.1	20p13	2013-07-10	2005-01-05	2005-01-05	ENSG00000125875	ENSG00000125875			16133	protein-coding gene	gene with protein product		611663	"""chromosome 20 open reading frame 140"""	C20orf140		17901050	Standard	XM_005260661		Approved	dJ852M4.2	uc002wds.3	Q96BZ9	OTTHUMG00000031637	ENST00000354200.4:c.1211G>T	20.37:g.419231C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6I3|B9A6M1|Q5JWQ7|Q6ZSY8|Q96NE1|Q9BYM7|Q9H140	Nonstop_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.*404L	ENST00000354200.4	37	c.1211	CCDS13002.1	20	.	.	.	.	.	.	.	.	.	.	C	12.54	1.969106	0.34754	.	.	ENSG00000125875	ENST00000354200;ENST00000246077	.	.	.	6.17	0.223	0.15292	.	.	.	.	.	.	.	.	.	.	.	0.09310	N	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	10.6035	0.45381	0.0:0.6323:0.0:0.3677	.	.	.	.	L	404;429	.	.	X	-	2	2	TBC1D20	367231	0.998000	0.40836	0.655000	0.29622	0.976000	0.68499	0.966000	0.29331	0.068000	0.16574	0.655000	0.94253	TGA	TBC1D20	-	NULL		0.517	TBC1D20-004	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D20	HGNC	protein_coding	OTTHUMT00000251397.2	C	NM_144628		419231	-1	no_errors	ENST00000354200	ensembl	human	known	70_37	nonstop	SNP	0.974	A
TCEB3C	162699	genome.wustl.edu	37	18	44555665	44555665	+	Silent	SNP	G	G	A	rs139609120		TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr18:44555665G>A	ENST00000330682.2	-	1	784	c.549C>T	c.(547-549)ggC>ggT	p.G183G	KATNAL2_ENST00000245121.5_Intron|KATNAL2_ENST00000592005.1_Intron|KATNAL2_ENST00000356157.7_Intron	NM_145653.3	NP_663628.2	Q8NG57	ELOA3_HUMAN	transcription elongation factor B polypeptide 3C (elongin A3)	183	Pro-rich.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	integral component of membrane (GO:0016021)|nucleus (GO:0005634)	DNA binding (GO:0003677)			NS(1)|cervix(1)|endometrium(5)|kidney(4)|large_intestine(1)|lung(16)|skin(2)	30						CGGGCTCAGGGCCCTCGGGCA	0.726																																																	0													1.0	1.0	1.0					18																	44555665		27	70	97	SO:0001819	synonymous_variant	162699			AB076840	CCDS11931.1	18q21.1	2008-08-13			ENSG00000183791	ENSG00000183791			24617	protein-coding gene	gene with protein product	"""elongin A3"""					11932239, 11994304	Standard	NM_145653		Approved	HsT829, TCEB3L2	uc010xdb.2	Q8NG57	OTTHUMG00000132651	ENST00000330682.2:c.549C>T	18.37:g.44555665G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_RNA_pol_II_trans_fac_SIII_A,pfam_TFIIS_N,superfamily_TFIIS_N,smart_TFIIS/CRSP70_N_sub	p.G183	ENST00000330682.2	37	c.549	CCDS11931.1	18																																																																																			TCEB3C	-	NULL		0.726	TCEB3C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TCEB3C	HGNC	protein_coding	OTTHUMT00000255902.1	G	NM_145653		44555665	-1	no_errors	ENST00000330682	ensembl	human	known	70_37	silent	SNP	0.003	A
TG	7038	genome.wustl.edu	37	8	133919127	133919127	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:133919127C>T	ENST00000220616.4	+	17	3869	c.3829C>T	c.(3829-3831)Cag>Tag	p.Q1277*	TG_ENST00000377869.1_Nonsense_Mutation_p.Q1277*	NM_003235.4	NP_003226.4	P01266	THYG_HUMAN	thyroglobulin	1277					hormone biosynthetic process (GO:0042446)|iodide transport (GO:0015705)|regulation of myelination (GO:0031641)|signal transduction (GO:0007165)|thyroid gland development (GO:0030878)|thyroid hormone generation (GO:0006590)	extracellular region (GO:0005576)|extracellular space (GO:0005615)				NS(1)|breast(11)|central_nervous_system(3)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(34)|liver(2)|lung(59)|ovary(9)|pancreas(2)|prostate(6)|skin(7)|stomach(4)|upper_aerodigestive_tract(4)|urinary_tract(8)	168	Ovarian(258;0.00438)|Acute lymphoblastic leukemia(118;0.155)	Myeloproliferative disorder(644;0.00878)|Acute lymphoblastic leukemia(644;0.0559)|Breast(495;0.0735)	BRCA - Breast invasive adenocarcinoma(115;0.000701)	KIRC - Kidney renal clear cell carcinoma(542;0.0546)		ACAGCTGCCTCAGCCCCGGGC	0.642																																																	0													27.0	23.0	24.0					8																	133919127		2202	4300	6502	SO:0001587	stop_gained	7038			AU141420	CCDS34944.1	8q24	2012-10-02			ENSG00000042832	ENSG00000042832			11764	protein-coding gene	gene with protein product		188450					Standard	NM_003235		Approved	TGN, AITD3	uc003ytw.3	P01266	OTTHUMG00000164649	ENST00000220616.4:c.3829C>T	8.37:g.133919127C>T	ENSP00000220616:p.Gln1277*	Somatic		WXS	Illumina HiSeq	Phase_IV	O15274|O43899|Q15593|Q15948|Q9NYR1|Q9NYR2|Q9UMZ0|Q9UNY3	Nonsense_Mutation	SNP	pfam_Thyroglobulin_1,pfam_CarbesteraseB,pfam_Tyr-kin_ephrin_A/B_rcpt-like,superfamily_Thyroglobulin_1,smart_Thyroglobulin_1,pirsf_Thyroglobulin,pfscan_Thyroglobulin_1	p.Q1277*	ENST00000220616.4	37	c.3829	CCDS34944.1	8	.	.	.	.	.	.	.	.	.	.	C	37	6.328804	0.97480	.	.	ENSG00000042832	ENST00000377869;ENST00000543313;ENST00000220616	.	.	.	5.42	4.53	0.55603	.	0.576620	0.15635	N	0.252194	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	10.5089	0.44849	0.0:0.9096:0.0:0.0904	.	.	.	.	X	1277;83;1277	.	ENSP00000220616:Q1277X	Q	+	1	0	TG	133988309	0.158000	0.22850	0.326000	0.25389	0.079000	0.17450	4.930000	0.63462	1.256000	0.44068	0.609000	0.83330	CAG	TG	-	pirsf_Thyroglobulin		0.642	TG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TG	HGNC	protein_coding	OTTHUMT00000379606.1	C	NM_003235		133919127	+1	no_errors	ENST00000220616	ensembl	human	known	70_37	nonsense	SNP	0.799	T
TGFB1I1	7041	genome.wustl.edu	37	16	31487834	31487834	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr16:31487834C>T	ENST00000394863.3	+	9	1051	c.921C>T	c.(919-921)caC>caT	p.H307H	TGFB1I1_ENST00000394858.2_Silent_p.H290H|TGFB1I1_ENST00000567607.1_Silent_p.H290H|TGFB1I1_ENST00000361773.3_Silent_p.H290H	NM_001042454.2	NP_001035919.1	O43294	TGFI1_HUMAN	transforming growth factor beta 1 induced transcript 1	307	LIM zinc-binding 2. {ECO:0000255|PROSITE- ProRule:PRU00125}.				androgen receptor signaling pathway (GO:0030521)|cell adhesion (GO:0007155)|cell fate commitment (GO:0045165)|epithelial cell differentiation (GO:0030855)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|positive regulation of epithelial to mesenchymal transition (GO:0010718)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of transforming growth factor beta receptor signaling pathway (GO:0030511)|response to heat (GO:0009408)|transcription from RNA polymerase II promoter (GO:0006366)|ubiquitin-dependent SMAD protein catabolic process (GO:0030579)|Wnt signaling pathway (GO:0016055)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|focal adhesion (GO:0005925)|intracellular (GO:0005622)|nucleus (GO:0005634)	androgen receptor binding (GO:0050681)|I-SMAD binding (GO:0070411)|Roundabout binding (GO:0048495)|transcription coactivator activity (GO:0003713)|zinc ion binding (GO:0008270)			lung(8)|upper_aerodigestive_tract(1)	9						CTCACTGGCACCCAGAGCATT	0.642																																																	0													52.0	51.0	51.0					16																	31487834		2196	4298	6494	SO:0001819	synonymous_variant	7041			AB007836	CCDS10713.1, CCDS42156.1	16p11	2008-02-05			ENSG00000140682	ENSG00000140682			11767	protein-coding gene	gene with protein product		602353				9422762, 10075738	Standard	NM_015927		Approved	Hic-5, TSC-5, ARA55, HIC-5	uc002ecd.2	O43294	OTTHUMG00000132467	ENST00000394863.3:c.921C>T	16.37:g.31487834C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2R8D5|Q9BPW3|Q9Y2V5	Silent	SNP	pfam_Znf_LIM,smart_Znf_LIM,pirsf_Leupaxin,pfscan_Znf_LIM	p.H307	ENST00000394863.3	37	c.921	CCDS42156.1	16																																																																																			TGFB1I1	-	pfam_Znf_LIM,smart_Znf_LIM,pirsf_Leupaxin,pfscan_Znf_LIM		0.642	TGFB1I1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TGFB1I1	HGNC	protein_coding	OTTHUMT00000255630.3	C			31487834	+1	no_errors	ENST00000394863	ensembl	human	known	70_37	silent	SNP	1.000	T
TIAF1	9220	genome.wustl.edu	37	17	27400946	27400946	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:27400946G>T	ENST00000359450.6	-	1	4929	c.272C>A	c.(271-273)cCa>cAa	p.P91Q	MYO18A_ENST00000533112.1_3'UTR|MYO18A_ENST00000354329.4_3'UTR|MYO18A_ENST00000529578.1_5'UTR|TIAF1_ENST00000408971.2_Missense_Mutation_p.P91Q|MYO18A_ENST00000527372.1_3'UTR|MYO18A_ENST00000531253.1_3'UTR	NM_004740.3	NP_004731.2	O95411	TIAF1_HUMAN	TGFB1-induced anti-apoptotic factor 1	91					apoptotic process (GO:0006915)|I-kappaB kinase/NF-kappaB signaling (GO:0007249)|negative regulation of apoptotic process (GO:0043066)	nucleus (GO:0005634)				kidney(1)|lung(1)|urinary_tract(1)	3	Lung NSC(42;0.015)		Epithelial(11;1.19e-05)|all cancers(11;6.57e-05)|BRCA - Breast invasive adenocarcinoma(11;0.000153)|Colorectal(6;0.0102)|COAD - Colon adenocarcinoma(6;0.031)			GGCAGTGCTTGGATCAGCCCT	0.517																																																	0													167.0	142.0	151.0					17																	27400946		2203	4300	6503	SO:0001583	missense	9220			AF105277	CCDS32599.1	17q11.2	2006-08-07				ENSG00000221995			11803	protein-coding gene	gene with protein product		609517				9918798	Standard	NM_004740		Approved		uc002hdv.1	O95411		ENST00000359450.6:c.272C>A	17.37:g.27400946G>T	ENSP00000352424:p.Pro91Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RRE2|Q6PEG2	Missense_Mutation	SNP	NULL	p.P91Q	ENST00000359450.6	37	c.272	CCDS32599.1	17	.	.	.	.	.	.	.	.	.	.	G	9.870	1.198773	0.22121	.	.	ENSG00000221995	ENST00000408971;ENST00000511177	.	.	.	4.39	3.39	0.38822	.	.	.	.	.	T	0.34483	0.0899	N	0.08118	0	0.22305	N	0.999215	D	0.76494	0.999	D	0.74023	0.982	T	0.08806	-1.0704	8	0.87932	D	0	.	5.4883	0.16761	0.1013:0.0:0.6986:0.2001	.	91	O95411	TIAF1_HUMAN	Q	91	.	ENSP00000386130:P91Q	P	-	2	0	TIAF1	24425072	0.948000	0.32251	0.996000	0.52242	0.981000	0.71138	2.199000	0.42715	1.173000	0.42796	0.655000	0.94253	CCA	TIAF1	-	NULL		0.517	TIAF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TIAF1	HGNC	protein_coding	OTTHUMT00000372394.2	G	NM_004740		27400946	-1	no_errors	ENST00000359450	ensembl	human	known	70_37	missense	SNP	0.876	T
TJP1	7082	genome.wustl.edu	37	15	29997798	29997798	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr15:29997798C>G	ENST00000346128.6	-	26	5476	c.5002G>C	c.(5002-5004)Gag>Cag	p.E1668Q	TJP1_ENST00000400011.2_Missense_Mutation_p.E1592Q|TJP1_ENST00000545208.2_Missense_Mutation_p.E1588Q|TJP1_ENST00000356107.6_Missense_Mutation_p.E1668Q	NM_003257.3|NM_175610.2	NP_003248.3|NP_783297.2	Q07157	ZO1_HUMAN	tight junction protein 1	1668	ZU5. {ECO:0000255|PROSITE- ProRule:PRU00485}.				apoptotic process (GO:0006915)|blastocyst formation (GO:0001825)|cell-cell junction assembly (GO:0007043)|cell-cell signaling involved in cell-cell junction organization (GO:1901350)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|cellular response to glucose stimulus (GO:0071333)|hippo signaling (GO:0035329)|membrane organization (GO:0061024)|negative regulation of vascular permeability (GO:0043116)|response to drug (GO:0042493)|response to ethanol (GO:0045471)|response to lipopolysaccharide (GO:0032496)|response to magnetism (GO:0071000)|sensory perception of sound (GO:0007605)	apical junction complex (GO:0043296)|apical part of cell (GO:0045177)|apical plasma membrane (GO:0016324)|apicolateral plasma membrane (GO:0016327)|basolateral plasma membrane (GO:0016323)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|gap junction (GO:0005921)|intercalated disc (GO:0014704)|intercellular canaliculus (GO:0046581)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|tight junction (GO:0005923)				breast(4)|central_nervous_system(2)|endometrium(8)|kidney(3)|large_intestine(12)|liver(1)|lung(29)|ovary(4)|pancreas(1)|prostate(3)|urinary_tract(1)	68		all_lung(180;7.48e-11)|Breast(32;0.000153)		all cancers(64;3.29e-10)|Epithelial(43;5.34e-09)|BRCA - Breast invasive adenocarcinoma(123;0.0034)|GBM - Glioblastoma multiforme(186;0.0139)|Lung(196;0.186)		ATTTCCTGCTCAACTCCTTCG	0.428																																					Melanoma(77;681 1843 6309 6570)												0													85.0	83.0	84.0					15																	29997798		1899	4129	6028	SO:0001583	missense	7082				CCDS42007.1, CCDS45199.1, CCDS73702.1	15q13	2012-07-12	2012-07-12		ENSG00000104067	ENSG00000104067			11827	protein-coding gene	gene with protein product	"""zona occludens 1"", ""tight junction protein ZO-1"""	601009				8825647	Standard	XM_005254616		Approved	ZO-1, MGC133289, DKFZp686M05161	uc001zcr.3	Q07157	OTTHUMG00000137397	ENST00000346128.6:c.5002G>C	15.37:g.29997798C>G	ENSP00000281537:p.Glu1668Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3K1|Q2NKP3|Q4ZGJ6	Missense_Mutation	SNP	pfam_PDZ,pfam_ZU5,pfam_Guanylate_kin,pfam_SH3_2,superfamily_PDZ,superfamily_SH3_domain,smart_PDZ,smart_Guanylate_kin/L-typ_Ca_channel,smart_ZU5,pfscan_PDZ,pfscan_SH3_domain,pfscan_ZU5,pfscan_Guanylate_kin,prints_ZonOcculS1,prints_ZonOcculdens	p.E1668Q	ENST00000346128.6	37	c.5002	CCDS42007.1	15	.	.	.	.	.	.	.	.	.	.	C	17.27	3.347084	0.61183	.	.	ENSG00000104067	ENST00000346128;ENST00000400011;ENST00000545208;ENST00000400007;ENST00000356107	T;T	0.44083	0.93;0.93	4.96	4.96	0.65561	ZU5 (3);	0.051515	0.85682	D	0.000000	T	0.39627	0.1085	N	0.01640	-0.785	0.80722	D	1	D;D;B;D	0.69078	0.992;0.973;0.075;0.997	D;P;B;D	0.81914	0.941;0.812;0.187;0.995	T	0.64659	-0.6355	10	0.72032	D	0.01	.	18.4059	0.90536	0.0:1.0:0.0:0.0	.	1661;1588;1668;1592	A9CQZ8;Q07157-2;Q07157;G5E9E7	.;.;ZO1_HUMAN;.	Q	1668;1592;1668;1588;1588	ENSP00000281537:E1668Q;ENSP00000382890:E1592Q	ENSP00000281537:E1668Q	E	-	1	0	TJP1	27785090	1.000000	0.71417	0.800000	0.32199	0.997000	0.91878	7.651000	0.83577	2.585000	0.87301	0.655000	0.94253	GAG	TJP1	-	pfam_ZU5,smart_ZU5,pfscan_ZU5		0.428	TJP1-001	KNOWN	basic|CCDS	protein_coding	TJP1	HGNC	protein_coding	OTTHUMT00000268237.3	C	NM_003257		29997798	-1	no_errors	ENST00000346128	ensembl	human	known	70_37	missense	SNP	1.000	G
TRAPPC8	22878	genome.wustl.edu	37	18	29444664	29444664	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr18:29444664C>G	ENST00000283351.4	-	19	3006	c.2671G>C	c.(2671-2673)Gag>Cag	p.E891Q	TRAPPC8_ENST00000582539.1_Missense_Mutation_p.E837Q	NM_014939.3	NP_055754	Q9Y2L5	TPPC8_HUMAN	trafficking protein particle complex 8	891					vesicle-mediated transport (GO:0016192)	Golgi apparatus (GO:0005794)				breast(2)|central_nervous_system(1)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(7)|liver(2)|lung(13)|ovary(6)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	47						GATGTTTTCTCTTCTTTTGTG	0.358																																																	0													125.0	118.0	120.0					18																	29444664		2202	4300	6502	SO:0001583	missense	22878			AB023229	CCDS11901.1	18q12.1	2011-10-10	2010-06-29	2010-06-29	ENSG00000153339	ENSG00000153339		"""Trafficking protein particle complex"""	29169	protein-coding gene	gene with protein product	"""general sporulation gene 1 homolog (S. cerevisiae)"""	614136	"""KIAA1012"""	KIAA1012		10231032, 11230166	Standard	NM_014939		Approved	HsT2706, TRS85, GSG1	uc002kxc.4	Q9Y2L5	OTTHUMG00000132267	ENST00000283351.4:c.2671G>C	18.37:g.29444664C>G	ENSP00000283351:p.Glu891Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A0JP15|B3KME5|Q9H0L2	Missense_Mutation	SNP	NULL	p.E891Q	ENST00000283351.4	37	c.2671	CCDS11901.1	18	.	.	.	.	.	.	.	.	.	.	C	16.25	3.070996	0.55646	.	.	ENSG00000153339	ENST00000283351	T	0.09630	2.96	5.91	5.91	0.95273	.	0.095769	0.64402	D	0.000001	T	0.22666	0.0547	L	0.43554	1.36	0.80722	D	1	D	0.63046	0.992	P	0.57324	0.818	T	0.00356	-1.1793	10	0.23891	T	0.37	.	20.3011	0.98612	0.0:1.0:0.0:0.0	.	891	Q9Y2L5	TPPC8_HUMAN	Q	891	ENSP00000283351:E891Q	ENSP00000283351:E891Q	E	-	1	0	TRAPPC8	27698662	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	7.247000	0.78257	2.809000	0.96659	0.555000	0.69702	GAG	TRAPPC8	-	NULL		0.358	TRAPPC8-001	KNOWN	NAGNAG_splice_site|basic|appris_principal|CCDS	protein_coding	TRAPPC8	HGNC	protein_coding	OTTHUMT00000255355.1	C	NM_014939		29444664	-1	no_errors	ENST00000283351	ensembl	human	known	70_37	missense	SNP	1.000	G
TRPM5	29850	genome.wustl.edu	37	11	2439793	2439793	+	Silent	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:2439793G>A	ENST00000155858.6	-	5	686	c.678C>T	c.(676-678)ctC>ctT	p.L226L	TRPM5_ENST00000452833.1_Silent_p.L228L|TRPM5_ENST00000533060.1_Silent_p.L226L|TRPM5_ENST00000528453.1_Silent_p.L226L	NM_014555.3	NP_055370.1			transient receptor potential cation channel, subfamily M, member 5											breast(1)|central_nervous_system(1)|endometrium(4)|liver(1)|lung(8)|ovary(2)|prostate(2)|skin(2)|urinary_tract(2)	23		Medulloblastoma(188;0.0049)|Breast(177;0.00586)|all_epithelial(84;0.0075)|Ovarian(85;0.0256)|all_neural(188;0.0311)		BRCA - Breast invasive adenocarcinoma(625;0.00147)|LUSC - Lung squamous cell carcinoma(625;0.191)		CCAGCAAGCAGAGGACAGGGA	0.662																																					NSCLC(1;49 61 17205 18850 43201)												0													48.0	42.0	44.0					11																	2439793		2198	4297	6495	SO:0001819	synonymous_variant	29850			AF177473	CCDS31340.1	11p15.5	2011-12-14			ENSG00000070985	ENSG00000070985		"""Voltage-gated ion channels / Transient receptor potential cation channels"""	14323	protein-coding gene	gene with protein product		604600				10607831, 16382100	Standard	NM_014555		Approved	LTRPC5, MTR1	uc001lwm.4	Q9NZQ8	OTTHUMG00000009896	ENST00000155858.6:c.678C>T	11.37:g.2439793G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	superfamily_Ankyrin_rpt-contain_dom	p.L228	ENST00000155858.6	37	c.684	CCDS31340.1	11																																																																																			TRPM5	-	NULL		0.662	TRPM5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	TRPM5	HGNC	protein_coding	OTTHUMT00000027378.1	G	NM_014555		2439793	-1	no_errors	ENST00000452833	ensembl	human	known	70_37	silent	SNP	0.835	A
TST	7263	genome.wustl.edu	37	22	37414661	37414661	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:37414661G>A	ENST00000403892.3	-	1	847	c.113C>T	c.(112-114)tCa>tTa	p.S38L	TST_ENST00000249042.3_Missense_Mutation_p.S38L|MPST_ENST00000397129.1_5'Flank|MPST_ENST00000429360.2_5'Flank|MPST_ENST00000401419.3_5'Flank|MPST_ENST00000404802.3_5'Flank|MPST_ENST00000404393.1_5'Flank|MPST_ENST00000341116.3_5'Flank	NM_001270483.1	NP_001257412.1	Q16762	THTR_HUMAN	thiosulfate sulfurtransferase (rhodanese)	38	Rhodanese 1. {ECO:0000255|PROSITE- ProRule:PRU00173}.				cellular nitrogen compound metabolic process (GO:0034641)|cyanate catabolic process (GO:0009440)|epithelial cell differentiation (GO:0030855)|rRNA import into mitochondrion (GO:0035928)|rRNA transport (GO:0051029)|small molecule metabolic process (GO:0044281)|sulfide oxidation, using sulfide:quinone oxidoreductase (GO:0070221)|sulfur amino acid catabolic process (GO:0000098)|sulfur amino acid metabolic process (GO:0000096)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrial inner membrane (GO:0005743)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)	5S rRNA binding (GO:0008097)|thiosulfate sulfurtransferase activity (GO:0004792)			kidney(1)|large_intestine(1)|lung(2)|prostate(1)|skin(1)|urinary_tract(1)	7						GGTGCCTGGTGAGTACCAGGA	0.672																																																	0													5.0	5.0	5.0					22																	37414661		2051	4087	6138	SO:0001583	missense	7263			Z73420	CCDS13938.1	22q13.1	2002-02-05			ENSG00000128311	ENSG00000128311	2.8.1.1		12388	protein-coding gene	gene with protein product		180370				1953758	Standard	NM_003312		Approved	RDS	uc003aqh.4	Q16762	OTTHUMG00000150533	ENST00000403892.3:c.113C>T	22.37:g.37414661G>A	ENSP00000385828:p.Ser38Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KRM1|Q6IB06	Missense_Mutation	SNP	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom	p.S38L	ENST00000403892.3	37	c.113	CCDS13938.1	22	.	.	.	.	.	.	.	.	.	.	G	4.768	0.142759	0.09083	.	.	ENSG00000128311	ENST00000403892;ENST00000249042;ENST00000413912;ENST00000438203	T;T;T	0.38240	1.15;1.15;1.15	5.36	4.32	0.51571	Rhodanese-like (5);	0.378995	0.26919	N	0.021840	T	0.04907	0.0132	N	0.00020	-2.76	0.09310	N	0.999992	B	0.02656	0.0	B	0.01281	0.0	T	0.34477	-0.9827	10	0.02654	T	1	-13.2964	8.0479	0.30559	0.073:0.0:0.5331:0.394	.	38	Q16762	THTR_HUMAN	L	38	ENSP00000385828:S38L;ENSP00000249042:S38L;ENSP00000400764:S38L	ENSP00000249042:S38L	S	-	2	0	TST	35744607	0.000000	0.05858	0.878000	0.34440	0.977000	0.68977	1.015000	0.29963	1.220000	0.43490	0.561000	0.74099	TCA	TST	-	pfam_Rhodanese-like_dom,superfamily_Rhodanese-like_dom,smart_Rhodanese-like_dom,pfscan_Rhodanese-like_dom		0.672	TST-002	KNOWN	basic|appris_principal|CCDS	protein_coding	TST	HGNC	protein_coding	OTTHUMT00000318790.1	G			37414661	-1	no_errors	ENST00000249042	ensembl	human	known	70_37	missense	SNP	0.220	A
TTC39A	22996	genome.wustl.edu	37	1	51767348	51767348	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:51767348G>T	ENST00000447632.2	-	12	1105	c.1057C>A	c.(1057-1059)Cac>Aac	p.H353N	TTC39A_ENST00000262675.7_Missense_Mutation_p.H290N|TTC39A_ENST00000451380.1_Missense_Mutation_p.H317N|TTC39A_ENST00000413473.2_Missense_Mutation_p.H321N|TTC39A_ENST00000371750.5_Missense_Mutation_p.H318N|TTC39A_ENST00000371747.3_Missense_Mutation_p.H352N|TTC39A_ENST00000262676.5_3'UTR			Q5SRH9	TT39A_HUMAN	tetratricopeptide repeat domain 39A	353								p.0?(2)		breast(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(3)|lung(2)|prostate(2)|skin(3)|urinary_tract(1)	17						TAGCACATGTGGTGGAACTGC	0.607																																																	2	Whole gene deletion(2)	thyroid(1)|central_nervous_system(1)											67.0	69.0	68.0					1																	51767348		2121	4221	6342	SO:0001583	missense	22996			AB007921	CCDS44143.1, CCDS44144.1, CCDS72789.1, CCDS72790.1	1p32.3	2013-01-11	2008-06-23	2008-06-23	ENSG00000085831	ENSG00000085831		"""Tetratricopeptide (TTC) repeat domain containing"""	18657	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 34"""	C1orf34		9455484, 9461476	Standard	XM_005270643		Approved	KIAA0452, DEME-6	uc010onf.2	Q5SRH9	OTTHUMG00000008193	ENST00000447632.2:c.1057C>A	1.37:g.51767348G>T	ENSP00000393952:p.His353Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z782|E7EQY9|G3XAF8|O43417|O75040|Q5SRH5|Q5SRH6|Q5SRH7|Q5SRH8|Q5SRI0|Q5SRI1|Q5SRI2|Q5T7S1|Q6PIU8|Q9BT24	Missense_Mutation	SNP	pfam_OMP_IML2_mit/TPR_39,smart_TPR_repeat	p.H353N	ENST00000447632.2	37	c.1057		1	.	.	.	.	.	.	.	.	.	.	G	28.3	4.909372	0.92107	.	.	ENSG00000085831	ENST00000447632;ENST00000413473;ENST00000262675;ENST00000451380;ENST00000371750;ENST00000371747	T;T;T;T;T;T	0.49432	0.78;0.78;0.78;0.78;0.78;0.86	4.8	4.8	0.61643	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.73249	0.3563	M	0.90309	3.105	0.80722	D	1	D;D;D;D;D;D	0.89917	1.0;1.0;0.999;0.999;1.0;0.999	D;D;D;D;D;D	0.81914	0.992;0.995;0.988;0.988;0.995;0.979	T	0.75161	-0.3415	10	0.28530	T	0.3	-15.6674	17.1965	0.86894	0.0:0.0:1.0:0.0	.	321;317;290;317;353;318	Q5SRH9-4;E7EQY9;D3DQ30;B7Z782;Q5SRH9;G3XAF8	.;.;.;.;TT39A_HUMAN;.	N	353;321;290;317;318;352	ENSP00000393952:H353N;ENSP00000406144:H321N;ENSP00000262675:H290N;ENSP00000397207:H317N;ENSP00000360815:H318N;ENSP00000360812:H352N	ENSP00000262675:H290N	H	-	1	0	TTC39A	51539936	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	9.635000	0.98437	2.377000	0.81083	0.462000	0.41574	CAC	TTC39A	-	pfam_OMP_IML2_mit/TPR_39		0.607	TTC39A-004	KNOWN	basic	protein_coding	TTC39A	HGNC	protein_coding	OTTHUMT00000022434.2	G			51767348	-1	no_errors	ENST00000447632	ensembl	human	known	70_37	missense	SNP	1.000	T
UBR5	51366	genome.wustl.edu	37	8	103359135	103359135	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:103359135G>A	ENST00000520539.1	-	6	1178	c.572C>T	c.(571-573)tCa>tTa	p.S191L	UBR5_ENST00000220959.4_Missense_Mutation_p.S191L|UBR5_ENST00000521922.1_Missense_Mutation_p.S191L	NM_001282873.1|NM_015902.5	NP_001269802.1|NP_056986.2	O95071	UBR5_HUMAN	ubiquitin protein ligase E3 component n-recognin 5	191					cell proliferation (GO:0008283)|cellular response to DNA damage stimulus (GO:0006974)|DNA repair (GO:0006281)|negative regulation of double-strand break repair (GO:2000780)|negative regulation of histone H2A K63-linked ubiquitination (GO:1901315)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of catenin import into nucleus (GO:0035413)|positive regulation of protein import into nucleus, translocation (GO:0033160)|progesterone receptor signaling pathway (GO:0050847)|protein polyubiquitination (GO:0000209)|protein ubiquitination involved in ubiquitin-dependent protein catabolic process (GO:0042787)|ubiquitin-dependent protein catabolic process (GO:0006511)	cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)	ligase activity (GO:0016874)|RNA binding (GO:0003723)|ubiquitin-protein transferase activity (GO:0004842)|ubiquitin-ubiquitin ligase activity (GO:0034450)|zinc ion binding (GO:0008270)			NS(1)|breast(13)|central_nervous_system(1)|cervix(1)|endometrium(7)|kidney(8)|large_intestine(19)|liver(1)|lung(51)|ovary(6)|pancreas(1)|prostate(5)|skin(6)|upper_aerodigestive_tract(2)|urinary_tract(2)	124	all_cancers(14;8e-07)|all_epithelial(15;2.18e-08)|Lung NSC(17;2.55e-05)|all_lung(17;8.85e-05)		OV - Ovarian serous cystadenocarcinoma(57;0.000442)			CCATACCTGTGAAATCAGCTC	0.478																																					Ovarian(131;96 1741 5634 7352 27489)												0													72.0	78.0	76.0					8																	103359135		2203	4300	6503	SO:0001583	missense	51366			AF006010	CCDS34933.1, CCDS64946.1	8q22	2008-06-23	2007-06-19	2007-06-19	ENSG00000104517	ENSG00000104517		"""Ubiquitin protein ligase E3 component n-recognins"""	16806	protein-coding gene	gene with protein product		608413	"""E3 ubiquitin protein ligase, HECT domain containing, 1"""	EDD1		10030672, 16055722	Standard	NM_015902		Approved	DD5, HYD, EDD, KIAA0896	uc003ykr.2	O95071	OTTHUMG00000164755	ENST00000520539.1:c.572C>T	8.37:g.103359135G>A	ENSP00000429084:p.Ser191Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP24|J3KMW7|O94970|Q9NPL3	Missense_Mutation	SNP	pfam_HECT,pfam_E3_UbLigase_EDD_UBA,pfam_PABP_HYD,pfam_Znf_N-recognin,superfamily_HECT,superfamily_PABP_HYD,superfamily_Reg_csome_cond/b-lactamase_inh,smart_Znf_N-recognin_met,smart_PABP_HYD,smart_HECT,pfscan_HECT,pfscan_Znf_N-recognin	p.S191L	ENST00000520539.1	37	c.572	CCDS34933.1	8	.	.	.	.	.	.	.	.	.	.	G	24.8	4.566115	0.86439	.	.	ENSG00000104517	ENST00000520539;ENST00000220959;ENST00000521922	T;T;T	0.47177	0.85;0.85;0.85	5.43	5.43	0.79202	E3 ubiquitin ligase EDD, ubiquitin-associated domain (1);	0.070540	0.56097	D	0.000024	T	0.40145	0.1105	N	0.19112	0.55	0.80722	D	1	B;B	0.27882	0.192;0.192	B;B	0.30943	0.122;0.122	T	0.35301	-0.9794	10	0.72032	D	0.01	.	19.6166	0.95636	0.0:0.0:1.0:0.0	.	191;191	E7EMW7;O95071	.;UBR5_HUMAN	L	191	ENSP00000429084:S191L;ENSP00000220959:S191L;ENSP00000427819:S191L	ENSP00000220959:S191L	S	-	2	0	UBR5	103428311	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.813000	0.99286	2.721000	0.93114	0.655000	0.94253	TCA	UBR5	-	pfam_E3_UbLigase_EDD_UBA		0.478	UBR5-001	KNOWN	NAGNAG_splice_site|basic|appris_candidate_longest|CCDS	protein_coding	UBR5	HGNC	protein_coding	OTTHUMT00000380075.2	G	NM_015902		103359135	-1	no_errors	ENST00000520539	ensembl	human	known	70_37	missense	SNP	1.000	A
UHMK1	127933	genome.wustl.edu	37	1	162469921	162469921	+	Missense_Mutation	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:162469921C>T	ENST00000489294.1	+	2	603	c.445C>T	c.(445-447)Ctt>Ttt	p.L149F	UHMK1_ENST00000545294.1_Missense_Mutation_p.L75F|UHMK1_ENST00000282169.8_3'UTR|UHMK1_ENST00000538489.1_Missense_Mutation_p.L149F	NM_175866.4	NP_787062.1	Q8TAS1	UHMK1_HUMAN	U2AF homology motif (UHM) kinase 1	149	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159, ECO:0000305}.				cell cycle arrest (GO:0007050)|neuron projection development (GO:0031175)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of translational initiation (GO:0045948)|protein autophosphorylation (GO:0046777)|regulation of protein export from nucleus (GO:0046825)	axon (GO:0030424)|dendrite cytoplasm (GO:0032839)|neuronal ribonucleoprotein granule (GO:0071598)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|ribonucleoprotein complex binding (GO:0043021)|RNA binding (GO:0003723)|transferase activity (GO:0016740)			endometrium(1)|large_intestine(2)|lung(6)|prostate(2)	11	all_hematologic(112;0.115)		BRCA - Breast invasive adenocarcinoma(70;0.126)			CCTTGCTTTTCTTCATCATGA	0.438																																																	0													164.0	142.0	150.0					1																	162469921		2203	4300	6503	SO:0001583	missense	127933			BC026046	CCDS1239.1, CCDS53423.1, CCDS53424.1	1q23.1	2013-02-12			ENSG00000152332	ENSG00000152332		"""RNA binding motif (RRM) containing"""	19683	protein-coding gene	gene with protein product		608849				12093740, 12782393	Standard	NM_175866		Approved	KIS, Kist	uc001gcc.2	Q8TAS1	OTTHUMG00000031373	ENST00000489294.1:c.445C>T	1.37:g.162469921C>T	ENSP00000420270:p.Leu149Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8K4|G3V1M1|Q96C22	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RRM_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_RRM_dom,pfscan_RRM_dom,pfscan_Prot_kinase_cat_dom	p.L149F	ENST00000489294.1	37	c.445	CCDS1239.1	1	.	.	.	.	.	.	.	.	.	.	C	25.6	4.654483	0.88056	.	.	ENSG00000152332	ENST00000545294;ENST00000538489;ENST00000489294	T;T;T	0.39787	1.06;1.06;1.06	5.73	4.81	0.61882	Serine/threonine-protein kinase-like domain (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	0.067254	0.64402	D	0.000008	T	0.56396	0.1982	M	0.78344	2.41	.	.	.	D;D;P	0.76494	0.999;0.999;0.846	D;D;P	0.83275	0.994;0.996;0.461	T	0.66484	-0.5912	9	0.87932	D	0	1.6638	13.6113	0.62080	0.1552:0.8448:0.0:0.0	.	149;149;75	Q8TAS1-2;Q8TAS1;G3V1M1	.;UHMK1_HUMAN;.	F	75;149;149	ENSP00000441226:L75F;ENSP00000446416:L149F;ENSP00000420270:L149F	ENSP00000420270:L149F	L	+	1	0	UHMK1	160736545	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	4.146000	0.58072	1.540000	0.49301	0.655000	0.94253	CTT	UHMK1	-	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.438	UHMK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHMK1	HGNC	protein_coding	OTTHUMT00000076788.1	C	NM_175866		162469921	+1	no_errors	ENST00000489294	ensembl	human	known	70_37	missense	SNP	1.000	T
ULK4	54986	genome.wustl.edu	37	3	41439743	41439743	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr3:41439743C>G	ENST00000301831.4	-	35	3967	c.3505G>C	c.(3505-3507)Gat>Cat	p.D1169H		NM_017886.2	NP_060356.2	Q96C45	ULK4_HUMAN	unc-51 like kinase 4	1169					cilium morphogenesis (GO:0060271)|epithelial cilium movement (GO:0003351)|microtubule cytoskeleton organization (GO:0000226)|regulation of JNK cascade (GO:0046328)|regulation of MAPK cascade (GO:0043408)|regulation of neuron migration (GO:2001222)|regulation of neuron projection development (GO:0010975)|regulation of p38MAPK cascade (GO:1900744)|regulation of protein kinase C signaling (GO:0090036)|ventricular system development (GO:0021591)		ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			breast(2)|cervix(1)|large_intestine(6)|lung(7)|prostate(5)|skin(1)	22				KIRC - Kidney renal clear cell carcinoma(284;0.214)		ATCTCAGGATCTTCATTAGGA	0.378																																																	0													67.0	62.0	64.0					3																	41439743		1816	4080	5896	SO:0001583	missense	54986			AK000581	CCDS43071.1	3p22.1	2013-07-02	2013-07-02		ENSG00000168038	ENSG00000168038			15784	protein-coding gene	gene with protein product			"""unc-51-like kinase 4 (C. elegans)"""			12477932	Standard	NM_017886		Approved	FLJ20574, REC01035, FAM7C1	uc003ckv.4	Q96C45	OTTHUMG00000156210	ENST00000301831.4:c.3505G>C	3.37:g.41439743C>G	ENSP00000301831:p.Asp1169His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NF15|Q8IW79|Q9NWV6|Q9UF96	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_ARM-type_fold,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.D1169H	ENST00000301831.4	37	c.3505	CCDS43071.1	3	.	.	.	.	.	.	.	.	.	.	C	7.257	0.604455	0.14002	.	.	ENSG00000168038	ENST00000301831	T	0.69435	-0.4	5.7	5.7	0.88788	Armadillo-like helical (1);Armadillo-type fold (1);	5.840820	0.02170	U	0.059595	T	0.66781	0.2824	L	0.38175	1.15	0.80722	D	1	B	0.25719	0.132	B	0.19946	0.027	T	0.36890	-0.9729	10	0.87932	D	0	.	17.6102	0.88050	0.0:1.0:0.0:0.0	.	1169	Q96C45	ULK4_HUMAN	H	1169	ENSP00000301831:D1169H	ENSP00000301831:D1169H	D	-	1	0	ULK4	41414747	1.000000	0.71417	1.000000	0.80357	0.021000	0.10359	5.502000	0.66956	2.695000	0.91970	0.462000	0.41574	GAT	ULK4	-	superfamily_ARM-type_fold		0.378	ULK4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ULK4	HGNC	protein_coding	OTTHUMT00000343490.1	C	XM_929989		41439743	-1	no_errors	ENST00000301831	ensembl	human	known	70_37	missense	SNP	1.000	G
UNC5D	137970	genome.wustl.edu	37	8	35542112	35542112	+	Missense_Mutation	SNP	G	G	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr8:35542112G>T	ENST00000404895.2	+	6	1092	c.764G>T	c.(763-765)tGg>tTg	p.W255L	UNC5D_ENST00000453357.2_Missense_Mutation_p.W250L|UNC5D_ENST00000287272.2_Intron|UNC5D_ENST00000416672.1_Missense_Mutation_p.W255L|UNC5D_ENST00000420357.1_Intron	NM_080872.2	NP_543148.2	Q6UXZ4	UNC5D_HUMAN	unc-5 homolog D (C. elegans)	255	TSP type-1 1. {ECO:0000255|PROSITE- ProRule:PRU00210}.				apoptotic process (GO:0006915)|axon guidance (GO:0007411)|pyramidal neuron differentiation (GO:0021859)|regulation of neuron migration (GO:2001222)|signal transduction (GO:0007165)	cell surface (GO:0009986)|integral component of membrane (GO:0016021)				NS(2)|breast(7)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(4)|kidney(2)|large_intestine(14)|lung(56)|ovary(3)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(6)|urinary_tract(2)	112				READ - Rectum adenocarcinoma(1;1.31e-05)|Colorectal(1;0.000723)		AATGGAGGCTGGTCTTCCTGG	0.532																																																	0													107.0	102.0	104.0					8																	35542112		2203	4300	6503	SO:0001583	missense	137970			AB055056	CCDS6093.2	8p12	2013-01-11			ENSG00000156687	ENSG00000156687		"""Immunoglobulin superfamily / I-set domain containing"""	18634	protein-coding gene	gene with protein product						18402767	Standard	NM_080872		Approved	KIAA1777, Unc5h4	uc003xjr.2	Q6UXZ4	OTTHUMG00000157145	ENST00000404895.2:c.764G>T	8.37:g.35542112G>T	ENSP00000385143:p.Trp255Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WYP7	Missense_Mutation	SNP	pfam_ZU5,pfam_Ig_I-set,pfam_Thrombospondin_1_rpt,pfam_Death,pfam_Immunoglobulin,superfamily_DEATH-like,superfamily_Thrombospondin_1_rpt,smart_Ig_sub,smart_Ig_sub2,smart_Thrombospondin_1_rpt,smart_ZU5,smart_Death,pfscan_Thrombospondin_1_rpt,pfscan_ZU5,pfscan_Ig-like	p.W255L	ENST00000404895.2	37	c.764	CCDS6093.2	8	.	.	.	.	.	.	.	.	.	.	G	27.5	4.838008	0.91117	.	.	ENSG00000156687	ENST00000404895;ENST00000416672;ENST00000453357	T;T;T	0.19105	2.17;2.17;2.17	5.06	5.06	0.68205	.	0.110191	0.64402	D	0.000003	T	0.37839	0.1018	M	0.90425	3.115	0.80722	D	1	P;P;P	0.42827	0.791;0.649;0.748	B;B;B	0.39876	0.312;0.249;0.246	T	0.55121	-0.8190	10	0.72032	D	0.01	-12.9631	18.8209	0.92097	0.0:0.0:1.0:0.0	.	255;250;255	C9J2B6;Q6UXZ4-2;Q6UXZ4	.;.;UNC5D_HUMAN	L	255;255;250	ENSP00000385143:W255L;ENSP00000412652:W255L;ENSP00000394303:W250L	ENSP00000385143:W255L	W	+	2	0	UNC5D	35661654	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	9.869000	0.99810	2.520000	0.84964	0.655000	0.94253	TGG	UNC5D	-	superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_Thrombospondin_1_rpt		0.532	UNC5D-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	UNC5D	HGNC	protein_coding	OTTHUMT00000347586.2	G			35542112	+1	no_errors	ENST00000404895	ensembl	human	known	70_37	missense	SNP	1.000	T
USPL1	10208	genome.wustl.edu	37	13	31221109	31221109	+	Missense_Mutation	SNP	G	G	A			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr13:31221109G>A	ENST00000255304.4	+	7	1495	c.1153G>A	c.(1153-1155)Gag>Aag	p.E385K		NM_005800.4	NP_005791.3	Q5W0Q7	USPL1_HUMAN	ubiquitin specific peptidase like 1	385	SUMO-binding.|USP.				Cajal body organization (GO:0030576)|cell proliferation (GO:0008283)|protein desumoylation (GO:0016926)	Cajal body (GO:0015030)|extracellular space (GO:0005615)	SUMO binding (GO:0032183)|SUMO-specific isopeptidase activity (GO:0070140)			breast(1)|endometrium(2)|kidney(1)|large_intestine(9)|lung(15)|pancreas(3)|skin(3)	34		Lung SC(185;0.0257)|Breast(139;0.203)		all cancers(112;0.0306)|Epithelial(112;0.131)|OV - Ovarian serous cystadenocarcinoma(117;0.134)		TGTCATCCCTGAGTGGCACCC	0.318																																					Ovarian(60;318 1180 1554 28110 31601)												0													111.0	107.0	108.0					13																	31221109		2203	4300	6503	SO:0001583	missense	10208			X59131	CCDS9336.1	13q12-q14	2012-11-14	2005-11-24	2005-11-24	ENSG00000132952	ENSG00000132952			20294	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 22"""	C13orf22		22878415	Standard	NM_005800		Approved	bA121O19.1, D13S106E	uc001utc.2	Q5W0Q7	OTTHUMG00000016675	ENST00000255304.4:c.1153G>A	13.37:g.31221109G>A	ENSP00000255304:p.Glu385Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14109|Q6AI45|Q8IY30|Q8IYE8	Missense_Mutation	SNP	pfscan_Peptidase_C19	p.E385K	ENST00000255304.4	37	c.1153	CCDS9336.1	13	.	.	.	.	.	.	.	.	.	.	G	17.38	3.374943	0.61735	.	.	ENSG00000132952	ENST00000255304	T	0.52295	0.67	5.56	3.83	0.44106	Peptidase C19, ubiquitin carboxyl-terminal hydrolase 2 (1);	0.183939	0.56097	N	0.000023	T	0.43456	0.1248	M	0.72118	2.19	0.33881	D	0.636154	P	0.35628	0.513	B	0.29524	0.103	T	0.59611	-0.7422	10	0.72032	D	0.01	-9.1337	10.1475	0.42774	0.1556:0.0:0.8444:0.0	.	385	Q5W0Q7	USPL1_HUMAN	K	385	ENSP00000255304:E385K	ENSP00000255304:E385K	E	+	1	0	USPL1	30119109	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	3.392000	0.52537	0.827000	0.34685	0.650000	0.86243	GAG	USPL1	-	pfscan_Peptidase_C19		0.318	USPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	USPL1	HGNC	protein_coding	OTTHUMT00000044369.1	G	NM_005800		31221109	+1	no_errors	ENST00000255304	ensembl	human	known	70_37	missense	SNP	1.000	A
WDR70	55100	genome.wustl.edu	37	5	37727020	37727020	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr5:37727020C>G	ENST00000265107.4	+	17	1906	c.1750C>G	c.(1750-1752)Ctc>Gtc	p.L584V		NM_018034.2	NP_060504.1	Q9NW82	WDR70_HUMAN	WD repeat domain 70	584							enzyme binding (GO:0019899)			central_nervous_system(1)|endometrium(5)|kidney(2)|large_intestine(5)|lung(18)|ovary(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	all_lung(31;0.000285)		COAD - Colon adenocarcinoma(61;0.14)|Colorectal(62;0.202)			CGGGGGCACTCTCTCTTCCTA	0.458																																																	0													108.0	108.0	108.0					5																	37727020		2203	4300	6503	SO:0001583	missense	55100			BC009648	CCDS34147.1	5p13.2	2013-01-09			ENSG00000082068	ENSG00000082068		"""WD repeat domain containing"""	25495	protein-coding gene	gene with protein product						12477932	Standard	NM_018034		Approved	FLJ10233	uc003jkv.3	Q9NW82	OTTHUMG00000162263	ENST00000265107.4:c.1750C>G	5.37:g.37727020C>G	ENSP00000265107:p.Leu584Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H053	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L584V	ENST00000265107.4	37	c.1750	CCDS34147.1	5	.	.	.	.	.	.	.	.	.	.	C	17.41	3.383593	0.61845	.	.	ENSG00000082068	ENST00000265107	T	0.70516	-0.49	5.51	3.4	0.38934	.	0.000000	0.64402	D	0.000003	D	0.83908	0.5356	M	0.86864	2.845	0.80722	D	1	D	0.76494	0.999	D	0.80764	0.994	D	0.85787	0.1365	10	0.72032	D	0.01	-48.5231	10.8233	0.46617	0.0:0.7198:0.0:0.2802	.	584	Q9NW82	WDR70_HUMAN	V	584	ENSP00000265107:L584V	ENSP00000265107:L584V	L	+	1	0	WDR70	37762777	0.758000	0.28405	1.000000	0.80357	0.933000	0.57130	1.293000	0.33353	1.330000	0.45394	-0.145000	0.13849	CTC	WDR70	-	NULL		0.458	WDR70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR70	HGNC	protein_coding	OTTHUMT00000368294.1	C	NM_018034		37727020	+1	no_errors	ENST00000265107	ensembl	human	known	70_37	missense	SNP	0.994	G
XRCC6	2547	genome.wustl.edu	37	22	42049549	42049549	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr22:42049549C>T	ENST00000359308.4	+	8	1801	c.1146C>T	c.(1144-1146)ttC>ttT	p.F382F	XRCC6_ENST00000428575.2_Silent_p.F249F|XRCC6_ENST00000405506.1_Silent_p.F332F|XRCC6_ENST00000360079.3_Silent_p.F382F|XRCC6_ENST00000405878.1_Silent_p.F382F|XRCC6_ENST00000402580.3_Silent_p.F341F			P12956	XRCC6_HUMAN	X-ray repair complementing defective repair in Chinese hamster cells 6	382	Ku.				brain development (GO:0007420)|cellular hyperosmotic salinity response (GO:0071475)|cellular response to X-ray (GO:0071481)|DNA duplex unwinding (GO:0032508)|DNA ligation (GO:0006266)|DNA repair (GO:0006281)|double-strand break repair (GO:0006302)|double-strand break repair via nonhomologous end joining (GO:0006303)|establishment of integrated proviral latency (GO:0075713)|innate immune response (GO:0045087)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of neurogenesis (GO:0050769)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of type I interferon production (GO:0032481)|telomere maintenance (GO:0000723)|transcription, DNA-templated (GO:0006351)|V(D)J recombination (GO:0033151)|viral process (GO:0016032)	cytosol (GO:0005829)|Ku70:Ku80 complex (GO:0043564)|membrane (GO:0016020)|nonhomologous end joining complex (GO:0070419)|nuclear telomere cap complex (GO:0000783)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	5'-deoxyribose-5-phosphate lyase activity (GO:0051575)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|damaged DNA binding (GO:0003684)|DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|telomeric DNA binding (GO:0042162)|transcription regulatory region DNA binding (GO:0044212)			central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(4)|liver(2)|lung(12)|ovary(1)|pancreas(1)|prostate(2)|skin(2)|upper_aerodigestive_tract(1)	31						CAACCCTGTTCAGTGCTCTGC	0.473								Non-homologous end-joining																																									0													106.0	108.0	107.0					22																	42049549		2203	4300	6503	SO:0001819	synonymous_variant	2547			J04607	CCDS14021.1, CCDS74870.1, CCDS74871.1	22q13.2	2011-09-12	2008-07-31	2005-05-06	ENSG00000196419	ENSG00000196419			4055	protein-coding gene	gene with protein product	"""Ku autoantigen, 70kDa"""	152690	"""thyroid autoantigen 70kD (Ku antigen)"", ""thyroid autoantigen 70kDa (Ku antigen)"""	G22P1		9200330, 9223317	Standard	NM_001469		Approved	D22S731, D22S671, KU70, ML8	uc003bao.1	P12956	OTTHUMG00000151190	ENST00000359308.4:c.1146C>T	22.37:g.42049549C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B1AHC8|Q6FG89|Q9UCQ2|Q9UCQ3	Silent	SNP	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_Ku_N,pfam_DNA_helicase_ATP-dep_Ku,pfam_Ku_C,pfam_SAP_DNA-bd,superfamily_SPOC-like,smart_DNA_helicase_ATP-dep_Ku,smart_SAP_DNA-bd,pfscan_SAP_DNA-bd,tigrfam_DNA_helicase_ATP-dep_Ku70	p.F382	ENST00000359308.4	37	c.1146	CCDS14021.1	22																																																																																			XRCC6	-	pirsf_DNA_helicase_ATP-dep_Ku70,pfam_DNA_helicase_ATP-dep_Ku,superfamily_SPOC-like,smart_DNA_helicase_ATP-dep_Ku,tigrfam_DNA_helicase_ATP-dep_Ku70		0.473	XRCC6-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	XRCC6	HGNC	protein_coding	OTTHUMT00000321688.1	C	NM_001469		42049549	+1	no_errors	ENST00000359308	ensembl	human	known	70_37	silent	SNP	0.989	T
ZBED5	58486	genome.wustl.edu	37	11	10875792	10875792	+	Missense_Mutation	SNP	T	T	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr11:10875792T>C	ENST00000432999.2	-	3	1199	c.701A>G	c.(700-702)tAt>tGt	p.Y234C	ZBED5_ENST00000413761.2_Missense_Mutation_p.Y234C|ZBED5_ENST00000525350.1_Intron	NM_001143667.1|NM_021211.3	NP_001137139.1|NP_067034.2	Q49AG3	ZBED5_HUMAN	zinc finger, BED-type containing 5	234							DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(1)	4						ttttttactatattgttcatc	0.388																																																	0													103.0	81.0	87.0					11																	10875792		692	1591	2283	SO:0001583	missense	58486			AF205601		11p15.3	2013-05-03			ENSG00000236287	ENSG00000236287		"""Zinc fingers, BED-type"""	30803	protein-coding gene	gene with protein product		615251				10607616, 23533661	Standard	NM_021211		Approved	Buster1	uc009ygh.3	Q49AG3	OTTHUMG00000150341	ENST00000432999.2:c.701A>G	11.37:g.10875792T>C	ENSP00000398106:p.Tyr234Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RCC1|Q05D82|Q86WW3|Q9NT24|Q9UBJ4	Missense_Mutation	SNP	superfamily_RNaseH-like_dom,pfscan_Znf_BED_prd	p.Y234C	ENST00000432999.2	37	c.701		11	.	.	.	.	.	.	.	.	.	.	T	8.278	0.814996	0.16607	.	.	ENSG00000236287	ENST00000432999;ENST00000413761	T;T	0.08282	3.11;3.11	4.18	4.18	0.49190	.	0.000000	0.30742	N	0.008979	T	0.06826	0.0174	L	0.32530	0.975	0.31910	N	0.614837	B	0.27997	0.197	B	0.24541	0.054	T	0.05550	-1.0878	10	0.38643	T	0.18	.	9.917	0.41442	0.0:0.0:0.0:1.0	.	234	Q49AG3	ZBED5_HUMAN	C	234	ENSP00000398106:Y234C;ENSP00000415939:Y234C	ENSP00000415939:Y234C	Y	-	2	0	ZBED5	10832368	0.987000	0.35691	0.996000	0.52242	0.978000	0.69477	2.802000	0.47916	2.117000	0.64856	0.528000	0.53228	TAT	ZBED5	-	NULL		0.388	ZBED5-001	PUTATIVE	basic|appris_principal|exp_conf	protein_coding	ZBED5	HGNC	protein_coding	OTTHUMT00000317691.1	T	NM_021211		10875792	-1	no_errors	ENST00000413761	ensembl	human	putative	70_37	missense	SNP	0.997	C
ZNF232	7775	genome.wustl.edu	37	17	5009474	5009474	+	Missense_Mutation	SNP	C	C	G			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr17:5009474C>G	ENST00000250076.3	-	5	1634	c.980G>C	c.(979-981)gGa>gCa	p.G327A	ZNF232_ENST00000575538.1_5'Flank|ZNF232_ENST00000416429.2_3'UTR|ZNF232_ENST00000575898.1_Missense_Mutation_p.G318A	NM_014519.2	NP_055334.2	Q9UNY5	ZN232_HUMAN	zinc finger protein 232	300					transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			kidney(1)|large_intestine(2)|liver(1)|lung(4)|ovary(1)|prostate(2)	11						GGGTTTCTCTCCAGAATGAAC	0.413																																																	0													106.0	108.0	108.0					17																	5009474		2203	4300	6503	SO:0001583	missense	7775			AF080169	CCDS11068.1	17p13.2	2013-01-09			ENSG00000167840	ENSG00000167840		"""-"", ""Zinc fingers, C2H2-type"""	13026	protein-coding gene	gene with protein product						11311944	Standard	NM_014519		Approved	ZSCAN11	uc002gat.3	Q9UNY5	OTTHUMG00000099450	ENST00000250076.3:c.980G>C	17.37:g.5009474C>G	ENSP00000250076:p.Gly327Ala	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Tscrpt_reg_SCAN,pfam_Znf_C2H2,superfamily_Retrov_capsid_C,smart_Tscrpt_reg_SCAN,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Tscrpt_reg_SCAN	p.G327A	ENST00000250076.3	37	c.980	CCDS11068.1	17	.	.	.	.	.	.	.	.	.	.	C	16.06	3.014374	0.54468	.	.	ENSG00000167840	ENST00000250076	T	0.01505	4.82	2.99	2.99	0.34606	Zinc finger, C2H2 (1);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.31847	N	0.006977	T	0.06917	0.0176	M	0.62154	1.92	0.80722	D	1	D;D	0.76494	0.999;0.999	D;D	0.64506	0.926;0.916	T	0.12993	-1.0526	10	0.72032	D	0.01	.	12.2055	0.54350	0.0:1.0:0.0:0.0	.	300;291	Q9UNY5;Q9UNY5-2	ZN232_HUMAN;.	A	327	ENSP00000250076:G327A	ENSP00000250076:G327A	G	-	2	0	ZNF232	4950198	0.109000	0.22037	1.000000	0.80357	0.999000	0.98932	1.317000	0.33631	1.958000	0.56883	0.655000	0.94253	GGA	ZNF232	-	pfscan_Znf_C2H2		0.413	ZNF232-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF232	HGNC	protein_coding	OTTHUMT00000216915.1	C	NM_014519		5009474	-1	no_errors	ENST00000250076	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF684	127396	genome.wustl.edu	37	1	41012986	41012986	+	Missense_Mutation	SNP	G	G	C			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr1:41012986G>C	ENST00000372699.3	+	5	1242	c.991G>C	c.(991-993)Gaa>Caa	p.E331Q	ZNF684_ENST00000493756.1_3'UTR	NM_152373.3	NP_689586.3	Q5T5D7	ZN684_HUMAN	zinc finger protein 684	331					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(2)|endometrium(2)|kidney(2)|lung(3)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)	13	Ovarian(52;0.00769)|all_hematologic(146;0.0501)|Acute lymphoblastic leukemia(166;0.074)	Myeloproliferative disorder(586;0.0393)	OV - Ovarian serous cystadenocarcinoma(33;5.42e-18)			CAGTTGTATTGAATGTGGCAA	0.423																																																	0													99.0	104.0	102.0					1																	41012986		2203	4300	6503	SO:0001583	missense	127396				CCDS454.1	1p34.2	2013-01-08			ENSG00000117010	ENSG00000117010		"""Zinc fingers, C2H2-type"", ""-"""	28418	protein-coding gene	gene with protein product	"""hypothetical protein MGC27466"""					12477932	Standard	NM_152373		Approved	MGC27466	uc001cft.2	Q5T5D7	OTTHUMG00000007359	ENST00000372699.3:c.991G>C	1.37:g.41012986G>C	ENSP00000361784:p.Glu331Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2NKY4	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E331Q	ENST00000372699.3	37	c.991	CCDS454.1	1	.	.	.	.	.	.	.	.	.	.	G	11.67	1.707905	0.30322	.	.	ENSG00000117010	ENST00000372699	T	0.07444	3.19	4.38	0.0482	0.14284	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.447307	0.16590	N	0.207785	T	0.04998	0.0134	L	0.33339	1.005	0.09310	N	1	B	0.10296	0.003	B	0.10450	0.005	T	0.38045	-0.9679	10	0.25751	T	0.34	.	2.6108	0.04890	0.1814:0.146:0.5234:0.1492	.	331	Q5T5D7	ZN684_HUMAN	Q	331	ENSP00000361784:E331Q	ENSP00000361784:E331Q	E	+	1	0	ZNF684	40785573	0.000000	0.05858	0.981000	0.43875	0.955000	0.61496	0.187000	0.16998	0.216000	0.20781	-0.176000	0.13171	GAA	ZNF684	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.423	ZNF684-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF684	HGNC	protein_coding	OTTHUMT00000019260.3	G	NM_152373		41012986	+1	no_errors	ENST00000372699	ensembl	human	known	70_37	missense	SNP	0.049	C
ZNF768	79724	genome.wustl.edu	37	16	30536771	30536771	+	Silent	SNP	C	C	T			TCGA-EA-A3Y4-01A-51D-A243-09	TCGA-EA-A3Y4-10A-01D-A243-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	22c5a391-cf06-4a8c-9a14-c3663eec3a5f	c151cb80-3624-46a8-b4c6-9141699c4cd7	g.chr16:30536771C>T	ENST00000380412.5	-	2	865	c.690G>A	c.(688-690)gaG>gaA	p.E230E	ZNF768_ENST00000562803.1_Silent_p.E199E	NM_024671.3	NP_078947.3	Q9H5H4	ZN768_HUMAN	zinc finger protein 768	230					regulation of transcription, DNA-templated (GO:0006355)|transcription from RNA polymerase II promoter (GO:0006366)	DNA-directed RNA polymerase II, core complex (GO:0005665)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|poly(A) RNA binding (GO:0044822)			endometrium(2)|kidney(1)|large_intestine(4)|lung(7)|prostate(1)	15						TCTGAAGCATCTCAAACTGCG	0.652																																																	0													56.0	61.0	59.0					16																	30536771		2197	4300	6497	SO:0001819	synonymous_variant	79724			BC013760	CCDS10681.2	16p11.2	2013-01-08			ENSG00000169957	ENSG00000169957		"""Zinc fingers, C2H2-type"""	26273	protein-coding gene	gene with protein product						12477932	Standard	NM_024671		Approved	FLJ23436	uc002dyk.4	Q9H5H4	OTTHUMG00000132392	ENST00000380412.5:c.690G>A	16.37:g.30536771C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q569L7|Q96CX4	Silent	SNP	pfam_Znf_C2H2,pfam_RNA_pol_II_repeat_euk,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.E230	ENST00000380412.5	37	c.690	CCDS10681.2	16																																																																																			ZNF768	-	NULL		0.652	ZNF768-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF768	HGNC	protein_coding	OTTHUMT00000255522.2	C	NM_024671		30536771	-1	no_errors	ENST00000380412	ensembl	human	known	70_37	silent	SNP	1.000	T
