#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ADA	100	genome.wustl.edu	37	20	43249625	43249625	+	Intron	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr20:43249625C>T	ENST00000372874.4	-	10	1110				ADA_ENST00000464097.1_5'UTR|Z97053.1_ENST00000597250.1_5'Flank|PKIG_ENST00000372882.3_Intron|ADA_ENST00000537820.1_Intron|PKIG_ENST00000372887.1_Intron	NM_000022.2	NP_000013.2	P00813	ADA_HUMAN	adenosine deaminase						adenosine catabolic process (GO:0006154)|aging (GO:0007568)|cell adhesion (GO:0007155)|dATP catabolic process (GO:0046061)|deoxyadenosine catabolic process (GO:0006157)|embryonic digestive tract development (GO:0048566)|germinal center B cell differentiation (GO:0002314)|histamine secretion (GO:0001821)|hypoxanthine salvage (GO:0043103)|inosine biosynthetic process (GO:0046103)|liver development (GO:0001889)|lung alveolus development (GO:0048286)|negative regulation of adenosine receptor signaling pathway (GO:0060169)|negative regulation of circadian sleep/wake cycle, non-REM sleep (GO:0042323)|negative regulation of inflammatory response (GO:0050728)|negative regulation of leukocyte migration (GO:0002686)|negative regulation of mature B cell apoptotic process (GO:0002906)|negative regulation of mucus secretion (GO:0070256)|negative regulation of penile erection (GO:0060407)|negative regulation of thymocyte apoptotic process (GO:0070244)|nucleobase-containing small molecule metabolic process (GO:0055086)|Peyer's patch development (GO:0048541)|placenta development (GO:0001890)|positive regulation of alpha-beta T cell differentiation (GO:0046638)|positive regulation of B cell proliferation (GO:0030890)|positive regulation of calcium-mediated signaling (GO:0050850)|positive regulation of germinal center formation (GO:0002636)|positive regulation of heart rate (GO:0010460)|positive regulation of smooth muscle contraction (GO:0045987)|positive regulation of T cell differentiation in thymus (GO:0033089)|positive regulation of T cell receptor signaling pathway (GO:0050862)|purine nucleobase metabolic process (GO:0006144)|purine nucleotide salvage (GO:0032261)|purine ribonucleoside monophosphate biosynthetic process (GO:0009168)|purine-containing compound salvage (GO:0043101)|regulation of cell-cell adhesion mediated by integrin (GO:0033632)|response to drug (GO:0042493)|response to hydrogen peroxide (GO:0042542)|response to hypoxia (GO:0001666)|response to morphine (GO:0043278)|response to vitamin E (GO:0033197)|small molecule metabolic process (GO:0044281)|T cell activation (GO:0042110)|trophectodermal cell differentiation (GO:0001829)|xanthine biosynthetic process (GO:0046111)	cell junction (GO:0030054)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite cytoplasm (GO:0032839)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|lysosome (GO:0005764)|membrane (GO:0016020)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	adenosine deaminase activity (GO:0004000)|purine nucleoside binding (GO:0001883)|zinc ion binding (GO:0008270)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(4)|lung(3)|ovary(1)|pancreas(2)|prostate(3)|skin(2)|urinary_tract(1)	18		all_lung(126;1.24e-07)|Lung NSC(126;1.94e-07)|Myeloproliferative disorder(115;0.0122)	COAD - Colon adenocarcinoma(18;0.00189)		Adenosine(DB00640)|Dipyridamole(DB00975)|Edetic Acid(DB00974)|Nelarabine(DB01280)|Pentostatin(DB00552)|Theophylline(DB00277)|Vidarabine(DB00194)	CTCCCAAACCCGAGTCAAGGC	0.527									Adenosine Deaminase Deficiency																																								0													113.0	104.0	107.0					20																	43249625		2203	4300	6503	SO:0001627	intron_variant	100	Familial Cancer Database	Severe Combined Immunodeficiency (SCID) due to ADA-deficiency	X02994	CCDS13335.1	20q13.12	2014-09-17			ENSG00000196839	ENSG00000196839	3.5.4.4		186	protein-coding gene	gene with protein product		608958				6198240, 6090454	Standard	NM_000022		Approved		uc002xmj.3	P00813	OTTHUMG00000033081	ENST00000372874.4:c.975+33G>A	20.37:g.43249625C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53F92|Q6LA59	RNA	SNP	-	NULL	ENST00000372874.4	37	NULL	CCDS13335.1	20																																																																																			ADA	-	-		0.527	ADA-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADA	HGNC	protein_coding	OTTHUMT00000080509.2	C	NM_000022		43249625	-1	no_errors	ENST00000464097	ensembl	human	known	70_37	rna	SNP	0.004	T
ADAM21	8747	genome.wustl.edu	37	14	70924602	70924602	+	Missense_Mutation	SNP	T	T	G	rs72735759	byFrequency	TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr14:70924602T>G	ENST00000603540.1	+	2	644	c.386T>G	c.(385-387)tTt>tGt	p.F129C	RP11-486O13.4_ENST00000556646.1_lincRNA|ADAM21_ENST00000267499.3_Missense_Mutation_p.F129C	NM_003813.3	NP_003804.2	Q9UKJ8	ADA21_HUMAN	ADAM metallopeptidase domain 21	129					binding of sperm to zona pellucida (GO:0007339)|multicellular organism reproduction (GO:0032504)|single fertilization (GO:0007338)	axon (GO:0030424)|integral component of membrane (GO:0016021)|neuronal cell body (GO:0043025)|plasma membrane (GO:0005886)	metalloendopeptidase activity (GO:0004222)|metallopeptidase activity (GO:0008237)|zinc ion binding (GO:0008270)			central_nervous_system(1)|endometrium(1)|kidney(4)|large_intestine(10)|lung(10)|pancreas(1)|prostate(1)|skin(2)|stomach(1)	31				all cancers(60;0.00326)|BRCA - Breast invasive adenocarcinoma(234;0.00646)|OV - Ovarian serous cystadenocarcinoma(108;0.0401)		AGTGCTTGTTTTGGGGGCTTT	0.463																																																	0													84.0	100.0	94.0					14																	70924602		2203	4300	6503	SO:0001583	missense	8747			AF029900	CCDS9804.1	14q24.1	2008-09-05	2005-08-18		ENSG00000139985	ENSG00000139985		"""ADAM metallopeptidase domain containing"""	200	protein-coding gene	gene with protein product		603713	"""a disintegrin and metalloproteinase domain 21"""			9469942	Standard	NM_003813		Approved	ADAM31	uc001xmd.3	Q9UKJ8		ENST00000603540.1:c.386T>G	14.37:g.70924602T>G	ENSP00000474385:p.Phe129Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O43507|Q2VPC6|Q32MR0	Missense_Mutation	SNP	pfam_Peptidase_M12B,pfam_ADAM_Cys-rich,pfam_Peptidase_M12B_N,pfam_Blood-coag_inhib_Disintegrin,superfamily_Blood-coag_inhib_Disintegrin,smart_Blood-coag_inhib_Disintegrin,smart_ADAM_Cys-rich,pfscan_Blood-coag_inhib_Disintegrin,pfscan_Peptidase_M12B,prints_Blood-coag_inhib_Disintegrin	p.F129C	ENST00000603540.1	37	c.386	CCDS9804.1	14	.	.	.	.	.	.	.	.	.	.	T	0.044	-1.273422	0.01421	.	.	ENSG00000139985	ENST00000267499	T	0.01133	5.29	3.76	-7.52	0.01341	Peptidase M12B, propeptide (1);	1.704650	0.03782	U	0.261498	T	0.01523	0.0049	L	0.60067	1.865	0.09310	N	1	B	0.33299	0.407	B	0.37780	0.258	T	0.14924	-1.0455	10	0.46703	T	0.11	.	1.36	0.02189	0.2433:0.3101:0.2623:0.1842	.	129	Q9UKJ8	ADA21_HUMAN	C	129	ENSP00000267499:F129C	ENSP00000267499:F129C	F	+	2	0	ADAM21	69994355	0.000000	0.05858	0.007000	0.13788	0.108000	0.19459	-1.073000	0.03430	-2.633000	0.00433	-0.379000	0.06801	TTT	ADAM21	-	pfam_Peptidase_M12B_N		0.463	ADAM21-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAM21	HGNC	protein_coding	OTTHUMT00000413008.3	T			70924602	+1	no_errors	ENST00000267499	ensembl	human	known	70_37	missense	SNP	0.000	G
ADCK5	203054	genome.wustl.edu	37	8	145616352	145616352	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr8:145616352G>A	ENST00000308860.6	+	6	606	c.562G>A	c.(562-564)Gag>Aag	p.E188K	CPSF1_ENST00000531727.1_5'Flank|ADCK5_ENST00000526231.2_3'UTR	NM_174922.3	NP_777582.4	Q3MIX3	ADCK5_HUMAN	aarF domain containing kinase 5	188	Protein kinase.					integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)	protein serine/threonine kinase activity (GO:0004674)			endometrium(1)|lung(2)|prostate(2)|skin(1)|stomach(2)	8	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;8.96e-41)|Epithelial(56;4.08e-40)|all cancers(56;4.51e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			GTTGTTCCTTGAGGACTTCCA	0.632																																																	0													59.0	57.0	58.0					8																	145616352		2203	4300	6503	SO:0001583	missense	203054			BC032402	CCDS34965.1, CCDS34965.2	8q24.3	2004-07-06			ENSG00000173137	ENSG00000173137			21738	protein-coding gene	gene with protein product							Standard	NM_174922		Approved	FLJ35454	uc003zch.3	Q3MIX3	OTTHUMG00000165190	ENST00000308860.6:c.562G>A	8.37:g.145616352G>A	ENSP00000310547:p.Glu188Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KS46|Q5U4P1|Q6P2S4|Q8N5V3	Missense_Mutation	SNP	pfam_UbiB_dom,superfamily_Kinase-like_dom	p.E188K	ENST00000308860.6	37	c.562	CCDS34965.1	8	.	.	.	.	.	.	.	.	.	.	G	17.37	3.372229	0.61624	.	.	ENSG00000173137	ENST00000308860	T	0.77877	-1.13	5.19	5.19	0.71726	Protein kinase-like domain (1);	0.063208	0.64402	D	0.000010	T	0.71484	0.3345	L	0.43646	1.37	0.80722	D	1	B	0.28801	0.223	B	0.34779	0.189	T	0.65693	-0.6106	10	0.13853	T	0.58	-22.7204	14.196	0.65672	0.0:0.0:1.0:0.0	.	188	Q3MIX3	ADCK5_HUMAN	K	188	ENSP00000310547:E188K	ENSP00000310547:E188K	E	+	1	0	ADCK5	145587160	1.000000	0.71417	0.826000	0.32828	0.824000	0.46624	7.030000	0.76484	2.419000	0.82065	0.462000	0.41574	GAG	ADCK5	-	superfamily_Kinase-like_dom		0.632	ADCK5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADCK5	HGNC	protein_coding	OTTHUMT00000382556.2	G	NM_174922		145616352	+1	no_errors	ENST00000308860	ensembl	human	known	70_37	missense	SNP	1.000	A
ALPK1	80216	genome.wustl.edu	37	4	113360956	113360956	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr4:113360956G>A	ENST00000458497.1	+	14	3745	c.3466G>A	c.(3466-3468)Gaa>Aaa	p.E1156K	ALPK1_ENST00000504176.2_Missense_Mutation_p.E1078K|ALPK1_ENST00000177648.9_Missense_Mutation_p.E1156K	NM_001102406.1|NM_025144.3	NP_001095876.1|NP_079420.3	Q96QP1	ALPK1_HUMAN	alpha-kinase 1	1156	Alpha-type protein kinase. {ECO:0000255|PROSITE-ProRule:PRU00501}.						ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(11)|lung(20)|ovary(6)|prostate(2)|urinary_tract(1)	53		Ovarian(17;0.0446)|Hepatocellular(203;0.217)		OV - Ovarian serous cystadenocarcinoma(123;0.00325)		CAAAGCCACAGAATATGGCTT	0.353																																																	0													64.0	64.0	64.0					4																	113360956		2203	4300	6503	SO:0001583	missense	80216			AY044164	CCDS3697.1, CCDS58923.1	4q26	2008-02-05			ENSG00000073331	ENSG00000073331			20917	protein-coding gene	gene with protein product	"""lymphocyte alpha-kinase"""	607347				10021370, 10819331	Standard	NM_025144		Approved	Lak, FLJ22670, KIAA1527	uc003ian.4	Q96QP1	OTTHUMG00000132911	ENST00000458497.1:c.3466G>A	4.37:g.113360956G>A	ENSP00000398048:p.Glu1156Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B4E3G1|F5H138|Q68CI9|Q6P9F9|Q6ZNK4|Q9P201	Missense_Mutation	SNP	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase	p.E1156K	ENST00000458497.1	37	c.3466	CCDS3697.1	4	.	.	.	.	.	.	.	.	.	.	G	18.05	3.538099	0.65085	.	.	ENSG00000073331	ENST00000458497;ENST00000177648;ENST00000504176	T;T;T	0.06294	3.32;3.32;3.32	5.05	5.05	0.67936	MHCK/EF2 kinase (3);Protein kinase-like domain (1);	0.182111	0.48286	D	0.000193	T	0.11153	0.0272	L	0.31120	0.905	0.35137	D	0.768506	P;P;P	0.49447	0.663;0.924;0.711	B;P;P	0.56823	0.323;0.807;0.451	T	0.22836	-1.0205	10	0.34782	T	0.22	-19.544	11.8586	0.52453	0.0806:0.0:0.9194:0.0	.	1078;1078;1156	F5H138;B4E3G1;Q96QP1	.;.;ALPK1_HUMAN	K	1156;1156;1078	ENSP00000398048:E1156K;ENSP00000177648:E1156K;ENSP00000426044:E1078K	ENSP00000177648:E1156K	E	+	1	0	ALPK1	113580405	1.000000	0.71417	0.996000	0.52242	0.991000	0.79684	3.368000	0.52357	2.344000	0.79699	0.544000	0.68410	GAA	ALPK1	-	pfam_MHCK_EF2_kinase,superfamily_Kinase-like_dom,smart_MHCK_EF2_kinase,pfscan_MHCK_EF2_kinase		0.353	ALPK1-201	KNOWN	basic|appris_principal|CCDS	protein_coding	ALPK1	HGNC	protein_coding	OTTHUMT00000256421.2	G	NM_025144		113360956	+1	no_errors	ENST00000177648	ensembl	human	known	70_37	missense	SNP	0.978	A
AQP10	89872	genome.wustl.edu	37	1	154296882	154296882	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:154296882C>T	ENST00000324978.3	+	6	872	c.832C>T	c.(832-834)Ctg>Ttg	p.L278L	AQP10_ENST00000484864.1_3'UTR|ATP8B2_ENST00000368487.3_5'Flank	NM_080429.2	NP_536354.2	Q96PS8	AQP10_HUMAN	aquaporin 10	278					response to toxic substance (GO:0009636)|transmembrane transport (GO:0055085)|water transport (GO:0006833)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	transporter activity (GO:0005215)			central_nervous_system(1)|endometrium(1)|large_intestine(4)|lung(14)|stomach(2)|upper_aerodigestive_tract(1)	23	all_lung(78;2.62e-30)|Lung NSC(65;3.94e-28)|Hepatocellular(266;0.0877)		LUSC - Lung squamous cell carcinoma(543;0.185)			AGCTCAGGATCTGGTGTCTGC	0.582											OREG0013832	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													77.0	76.0	76.0					1																	154296882		2203	4300	6503	SO:0001819	synonymous_variant	89872			AF159174	CCDS1065.1	1q21.3	2008-02-05			ENSG00000143595	ENSG00000143595		"""Ion channels / Aquaporins"""	16029	protein-coding gene	gene with protein product		606578				11573934	Standard	NM_080429		Approved		uc001feu.3	Q96PS8	OTTHUMG00000035980	ENST00000324978.3:c.832C>T	1.37:g.154296882C>T		Somatic	1762	WXS	Illumina HiSeq	Phase_IV	Q5VYD3|Q5VYD4|Q8NG70	Silent	SNP	pfam_MIP,superfamily_Aquaporin-like,prints_MIP,prints_Aquaporin_10,prints_Aquaporin_3,tigrfam_MIP	p.L278	ENST00000324978.3	37	c.832	CCDS1065.1	1																																																																																			AQP10	-	NULL		0.582	AQP10-002	KNOWN	basic|appris_principal|CCDS	protein_coding	AQP10	HGNC	protein_coding	OTTHUMT00000087661.1	C	NM_080429		154296882	+1	no_errors	ENST00000324978	ensembl	human	known	70_37	silent	SNP	0.000	T
ATG2A	23130	genome.wustl.edu	37	11	64666216	64666216	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr11:64666216G>T	ENST00000377264.3	-	32	4675	c.4563C>A	c.(4561-4563)ttC>ttA	p.F1521L	ATG2A_ENST00000421419.2_Missense_Mutation_p.F1523L	NM_015104.2	NP_055919.2	Q2TAZ0	ATG2A_HUMAN	autophagy related 2A	1521					autophagic vacuole assembly (GO:0000045)|cellular response to nitrogen starvation (GO:0006995)|mitochondrion degradation (GO:0000422)|nucleophagy (GO:0044804)	extrinsic component of membrane (GO:0019898)|lipid particle (GO:0005811)|pre-autophagosomal structure (GO:0000407)				breast(3)|central_nervous_system(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(19)|ovary(3)|prostate(5)|skin(1)|stomach(1)|urinary_tract(3)	55						CCTGCACGATGAACACCTGAC	0.652																																																	0													64.0	56.0	59.0					11																	64666216		2201	4297	6498	SO:0001583	missense	23130				CCDS31602.1	11q13.1	2014-02-12	2012-06-06		ENSG00000110046	ENSG00000110046			29028	protein-coding gene	gene with protein product			"""ATG2 autophagy related 2 homolog A (S. cerevisiae)"""			21887408	Standard	NM_015104		Approved	KIAA0404	uc001obx.3	Q2TAZ0	OTTHUMG00000066831	ENST00000377264.3:c.4563C>A	11.37:g.64666216G>T	ENSP00000366475:p.Phe1521Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O43154|Q14DM2|Q6ZTV2|Q7Z6K8|Q8IVY5|Q8TAI8|Q96HH7	Missense_Mutation	SNP	pfam_Autophagy-rel_C	p.F1523L	ENST00000377264.3	37	c.4569	CCDS31602.1	11	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	12.52|12.52	1.962364|1.962364	0.34659|0.34659	.|.	.|.	ENSG00000110046|ENSG00000110046	ENST00000421419;ENST00000377264|ENST00000418259	T;T|.	0.05855|.	3.38;3.38|.	4.27|4.27	4.27|4.27	0.50696|0.50696	.|.	0.059731|.	0.64402|.	N|.	0.000003|.	T|T	0.35595|0.35595	0.0937|0.0937	N|N	0.11789|0.11789	0.175|0.175	0.41643|0.41643	D|D	0.989087|0.989087	B;B|.	0.10296|.	0.002;0.003|.	B;B|.	0.14578|.	0.005;0.011|.	T|T	0.13710|0.13710	-1.0499|-1.0499	10|5	0.07325|.	T|.	0.83|.	.|.	8.2274|8.2274	0.31577|0.31577	0.108:0.0:0.892:0.0|0.108:0.0:0.892:0.0	.|.	1521;1523|.	Q2TAZ0;Q2TAZ0-3|.	ATG2A_HUMAN;.|.	L|N	1523;1521|1325	ENSP00000410522:F1523L;ENSP00000366475:F1521L|.	ENSP00000366475:F1521L|.	F|H	-|-	3|1	2|0	ATG2A|ATG2A	64422792|64422792	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.988000|0.988000	0.76386|0.76386	2.292000|2.292000	0.43549|0.43549	2.370000|2.370000	0.80446|0.80446	0.561000|0.561000	0.74099|0.74099	TTC|CAT	ATG2A	-	NULL		0.652	ATG2A-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ATG2A	HGNC	protein_coding	OTTHUMT00000143224.1	G	NM_015104		64666216	-1	no_errors	ENST00000421419	ensembl	human	known	70_37	missense	SNP	1.000	T
BCAR1	9564	genome.wustl.edu	37	16	75263742	75263742	+	Silent	SNP	G	G	A	rs371417209		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr16:75263742G>A	ENST00000162330.5	-	7	2406	c.2280C>T	c.(2278-2280)aaC>aaT	p.N760N	BCAR1_ENST00000418647.3_Silent_p.N806N|BCAR1_ENST00000393420.6_Silent_p.N778N|BCAR1_ENST00000535626.2_Silent_p.N612N|BCAR1_ENST00000566982.1_5'UTR|BCAR1_ENST00000546196.1_Silent_p.N731N|BCAR1_ENST00000420641.3_Silent_p.N778N|BCAR1_ENST00000542031.2_Silent_p.N758N|BCAR1_ENST00000538440.2_Silent_p.N760N|RP11-331F4.4_ENST00000489723.1_RNA|BCAR1_ENST00000393422.2_Silent_p.N778N	NM_001170717.1|NM_014567.3	NP_001164188.1|NP_055382.2	P56945	BCAR1_HUMAN	breast cancer anti-estrogen resistance 1	760	Divergent helix-loop-helix motif.				actin filament organization (GO:0007015)|antigen receptor-mediated signaling pathway (GO:0050851)|B cell receptor signaling pathway (GO:0050853)|blood coagulation (GO:0007596)|cell adhesion (GO:0007155)|cell chemotaxis (GO:0060326)|cell division (GO:0051301)|cell migration (GO:0016477)|cell proliferation (GO:0008283)|cellular response to hepatocyte growth factor stimulus (GO:0035729)|epidermal growth factor receptor signaling pathway (GO:0007173)|G-protein coupled receptor signaling pathway (GO:0007186)|hepatocyte growth factor receptor signaling pathway (GO:0048012)|insulin receptor signaling pathway (GO:0008286)|integrin-mediated signaling pathway (GO:0007229)|neurotrophin TRK receptor signaling pathway (GO:0048011)|platelet activation (GO:0030168)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of cell migration (GO:0030335)|positive regulation of endothelial cell migration (GO:0010595)|regulation of apoptotic process (GO:0042981)|regulation of cell growth (GO:0001558)|T cell receptor signaling pathway (GO:0050852)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|lamellipodium (GO:0030027)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|ruffle (GO:0001726)	protein kinase binding (GO:0019901)|signal transducer activity (GO:0004871)			breast(2)|central_nervous_system(5)|endometrium(1)|kidney(6)|large_intestine(1)|liver(1)|lung(13)|ovary(1)|prostate(3)|upper_aerodigestive_tract(2)	35				BRCA - Breast invasive adenocarcinoma(221;0.169)		CGTCCACGGCGTTGGTCAGTG	0.657																																																	0													82.0	75.0	77.0					16																	75263742		2198	4300	6498	SO:0001819	synonymous_variant	9564			AJ242987	CCDS10915.1, CCDS54037.1, CCDS54038.1, CCDS54039.1, CCDS54040.1, CCDS54041.1, CCDS54042.1, CCDS54043.1	16q22-q23	2011-04-13			ENSG00000050820	ENSG00000050820		"""Cas scaffolding proteins"""	971	protein-coding gene	gene with protein product	"""Crk-associated substrate"", ""Cas scaffolding protein family member 1"""	602941				8413311, 10639512	Standard	NM_001170714		Approved	P130Cas, Crkas, CAS, CASS1	uc010vnb.2	P56945	OTTHUMG00000137604	ENST00000162330.5:c.2280C>T	16.37:g.75263742G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KWD7|B4DEV4|B4DGB5|B4DIW5|B7Z7X7|E9PCL5|E9PCV2|F5GXA2|F5GXV6|F5H7Z0|F8WA69|Q6QEF7	Silent	SNP	pfam_CAS_DUF3513,pfam_Serine_rich,pfam_SH3_domain,pfam_SH3_2,superfamily_SH3_domain,smart_SH3_domain,pfscan_SH3_domain,prints_SH3_domain,prints_Spectrin_alpha_SH3	p.N806	ENST00000162330.5	37	c.2418	CCDS10915.1	16																																																																																			BCAR1	-	pfam_CAS_DUF3513		0.657	BCAR1-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BCAR1	HGNC	protein_coding	OTTHUMT00000269017.1	G	NM_014567		75263742	-1	no_errors	ENST00000418647	ensembl	human	known	70_37	silent	SNP	0.997	A
C15orf41	84529	genome.wustl.edu	37	15	37001438	37001438	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr15:37001438C>T	ENST00000566621.1	+	9	809	c.559C>T	c.(559-561)Cgt>Tgt	p.R187C	C15orf41_ENST00000567389.1_Missense_Mutation_p.R89C|C15orf41_ENST00000562877.1_Missense_Mutation_p.R89C|C15orf41_ENST00000569302.1_Missense_Mutation_p.R187C|C15orf41_ENST00000565792.1_3'UTR|C15orf41_ENST00000562489.1_Missense_Mutation_p.R11C|C15orf41_ENST00000437989.2_Missense_Mutation_p.R187C|C15orf41_ENST00000338183.4_Missense_Mutation_p.R89C	NM_001130010.1	NP_001123482.1	Q9Y2V0	CO041_HUMAN	chromosome 15 open reading frame 41	187										kidney(1)|large_intestine(3)|lung(6)|ovary(1)|pancreas(1)	12		all_epithelial(112;3.06e-10)|Lung NSC(122;6.48e-08)|all_lung(180;8.31e-07)|Melanoma(134;0.222)		all cancers(64;1.76e-19)|GBM - Glioblastoma multiforme(113;5.03e-07)|BRCA - Breast invasive adenocarcinoma(123;0.11)		AGATCAGCTTCGTGCAAAGGG	0.299																																																	0													100.0	97.0	98.0					15																	37001438		1821	4075	5896	SO:0001583	missense	84529			BC006254	CCDS45215.1, CCDS45216.1	15q14	2012-05-31			ENSG00000186073	ENSG00000186073			26929	protein-coding gene	gene with protein product		615626					Standard	XM_005254719		Approved	HH114, MGC11326, FLJ22851	uc001zje.4	Q9Y2V0	OTTHUMG00000172659	ENST00000566621.1:c.559C>T	15.37:g.37001438C>T	ENSP00000455397:p.Arg187Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD87	Missense_Mutation	SNP	NULL	p.R187C	ENST00000566621.1	37	c.559	CCDS45215.1	15	.	.	.	.	.	.	.	.	.	.	C	17.44	3.389787	0.61956	.	.	ENSG00000186073	ENST00000437989;ENST00000338183	T	0.68331	-0.32	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	D	0.84754	0.5542	M	0.85373	2.75	0.80722	D	1	D	0.89917	1.0	D	0.97110	1.0	D	0.86203	0.1620	10	0.87932	D	0	-11.6817	20.0359	0.97557	0.0:1.0:0.0:0.0	.	187	Q9Y2V0	CO041_HUMAN	C	187;89	ENSP00000401362:R187C	ENSP00000342433:R89C	R	+	1	0	C15orf41	34788730	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.933000	0.70130	2.805000	0.96524	0.655000	0.94253	CGT	C15orf41	-	NULL		0.299	C15orf41-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C15orf41	HGNC	protein_coding	OTTHUMT00000419741.1	C	NM_032499		37001438	+1	no_errors	ENST00000437989	ensembl	human	known	70_37	missense	SNP	1.000	T
C16orf91	283951	genome.wustl.edu	37	16	1470199	1470199	+	3'UTR	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr16:1470199G>T	ENST00000442039.2	-	0	523				C16orf91_ENST00000310355.1_Missense_Mutation_p.F272L|C16orf91_ENST00000563974.1_3'UTR	NM_001272051.1	NP_001258980.1	Q4G0I0	CSMT1_HUMAN	chromosome 16 open reading frame 91							integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(1)|lung(4)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11						CATCAAATCCGAAGGGCGGCT	0.607																																																	0													64.0	65.0	64.0					16																	1470199		2199	4300	6499	SO:0001624	3_prime_UTR_variant	283951			BC023590	CCDS61789.1	16p13.3	2012-10-10			ENSG00000174109	ENSG00000174109			27558	protein-coding gene	gene with protein product	"""cattle cerebrum and skeletal muscle-specific protein 1 family member"""						Standard	NM_001272051		Approved	gs103, CCSMST1	uc002clr.4	Q4G0I0		ENST00000442039.2:c.*48C>A	16.37:g.1470199G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96RZ0	Missense_Mutation	SNP	prints_CCSMST1	p.F272L	ENST00000442039.2	37	c.816		16	.	.	.	.	.	.	.	.	.	.	G	13.60	2.284623	0.40394	.	.	ENSG00000174109	ENST00000310355	.	.	.	3.47	-5.12	0.02893	.	4.672090	0.00496	N	0.000153	T	0.26412	0.0645	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.17289	-1.0374	6	0.54805	T	0.06	-0.3734	2.1334	0.03755	0.1019:0.2306:0.2164:0.4512	.	.	.	.	L	272	.	ENSP00000311390:F272L	F	-	3	2	C16orf91	1410200	0.000000	0.05858	0.000000	0.03702	0.000000	0.00434	-0.940000	0.03929	-1.048000	0.03238	-1.045000	0.02358	TTC	C16orf91	-	NULL		0.607	C16orf91-001	KNOWN	basic|appris_principal	protein_coding	C16orf91	HGNC	protein_coding	OTTHUMT00000432502.1	G	NM_001010878		1470199	-1	no_errors	ENST00000310355	ensembl	human	known	70_37	missense	SNP	0.000	T
PRR30	339779	genome.wustl.edu	37	2	27361136	27361136	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr2:27361136G>T	ENST00000335524.3	-	3	587	c.62C>A	c.(61-63)aCt>aAt	p.T21N		NM_178553.3	NP_848648.2	Q53SZ7	PRR30_HUMAN		21										cervix(1)|endometrium(2)|large_intestine(5)|lung(6)|ovary(1)|prostate(1)|skin(3)|urinary_tract(1)	20	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.215)					GAAGCCCCAAGTGGGGCGCCC	0.577																																																	0													57.0	61.0	59.0					2																	27361136		2203	4300	6503	SO:0001583	missense	339779																														ENST00000335524.3:c.62C>A	2.37:g.27361136G>T	ENSP00000335017:p.Thr21Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86UE2	Missense_Mutation	SNP	NULL	p.T21N	ENST00000335524.3	37	c.62	CCDS1739.1	2	.	.	.	.	.	.	.	.	.	.	G	10.15	1.270714	0.23221	.	.	ENSG00000186143	ENST00000335524	T	0.32272	1.46	4.44	2.63	0.31362	.	.	.	.	.	T	0.15132	0.0365	N	0.08118	0	0.09310	N	1	B	0.16603	0.018	B	0.20955	0.032	T	0.22068	-1.0227	9	0.51188	T	0.08	-0.0562	5.0281	0.14395	0.1965:0.1724:0.6311:0.0	.	21	Q53SZ7	CB053_HUMAN	N	21	ENSP00000335017:T21N	ENSP00000335017:T21N	T	-	2	0	C2orf53	27214640	0.001000	0.12720	0.001000	0.08648	0.027000	0.11550	0.668000	0.25127	0.430000	0.26230	0.561000	0.74099	ACT	C2orf53	-	NULL		0.577	C2orf53-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf53	HGNC	protein_coding	OTTHUMT00000250188.1	G			27361136	-1	no_errors	ENST00000335524	ensembl	human	known	70_37	missense	SNP	0.000	T
CCDC150	284992	genome.wustl.edu	37	2	197565863	197565863	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr2:197565863G>T	ENST00000389175.4	+	15	1789	c.1654G>T	c.(1654-1656)Gaa>Taa	p.E552*	CCDC150_ENST00000272831.7_Nonsense_Mutation_p.E220*	NM_001080539.1	NP_001074008.1	Q8NCX0	CC150_HUMAN	coiled-coil domain containing 150	552										breast(3)|endometrium(6)|kidney(1)|large_intestine(6)|lung(14)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	33						AAAAATCACTGAAAGTAAAAA	0.313																																																	0													67.0	60.0	62.0					2																	197565863		1808	4067	5875	SO:0001587	stop_gained	284992				CCDS46478.1	2q33.1	2008-04-10			ENSG00000144395	ENSG00000144395			26834	protein-coding gene	gene with protein product							Standard	NM_001080539		Approved	FLJ39660	uc002utp.1	Q8NCX0	OTTHUMG00000154475	ENST00000389175.4:c.1654G>T	2.37:g.197565863G>T	ENSP00000373827:p.Glu552*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P5U6|Q6P663|Q8N8V5	Nonsense_Mutation	SNP	NULL	p.E552*	ENST00000389175.4	37	c.1654	CCDS46478.1	2	.	.	.	.	.	.	.	.	.	.	G	39	7.906849	0.98554	.	.	ENSG00000144395	ENST00000272831;ENST00000389175	.	.	.	5.08	3.17	0.36434	.	1.805470	0.03025	N	0.151320	.	.	.	.	.	.	0.58432	D	0.999999	.	.	.	.	.	.	.	.	.	.	0.13853	T	0.58	-0.3312	5.6408	0.17562	0.1148:0.1981:0.687:0.0	.	.	.	.	X	220;552	.	ENSP00000272831:E220X	E	+	1	0	CCDC150	197274108	0.987000	0.35691	0.766000	0.31476	0.892000	0.51952	1.464000	0.35288	0.739000	0.32628	0.655000	0.94253	GAA	CCDC150	-	NULL		0.313	CCDC150-001	KNOWN	not_organism_supported|basic|appris_principal|CCDS	protein_coding	CCDC150	HGNC	protein_coding	OTTHUMT00000335377.2	G	NM_001080539		197565863	+1	no_errors	ENST00000389175	ensembl	human	known	70_37	nonsense	SNP	0.893	T
CD164L2	388611	genome.wustl.edu	37	1	27709084	27709084	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:27709084G>T	ENST00000374030.1	-	2	302	c.162C>A	c.(160-162)tgC>tgA	p.C54*	CD164L2_ENST00000374027.3_Nonsense_Mutation_p.C54*|CD164L2_ENST00000374025.3_Nonsense_Mutation_p.C54*			Q6UWJ8	C16L2_HUMAN	CD164 sialomucin-like 2	54						integral component of membrane (GO:0016021)				endometrium(1)|large_intestine(1)|lung(1)|urinary_tract(1)	4		all_lung(284;1.6e-05)|Lung NSC(340;2.92e-05)|Colorectal(325;3.46e-05)|Renal(390;0.0007)|Breast(348;0.0021)|Ovarian(437;0.0175)|Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0381)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0415)|OV - Ovarian serous cystadenocarcinoma(117;2.89e-26)|Colorectal(126;1.24e-08)|COAD - Colon adenocarcinoma(152;1.7e-06)|BRCA - Breast invasive adenocarcinoma(304;0.00128)|KIRC - Kidney renal clear cell carcinoma(1967;0.00155)|STAD - Stomach adenocarcinoma(196;0.00303)|READ - Rectum adenocarcinoma(331;0.0419)		CCAGCTGTTTGCAGGCCCCTT	0.632																																																	0													45.0	47.0	46.0					1																	27709084		2203	4299	6502	SO:0001587	stop_gained	388611			AY358761	CCDS302.1	1p36.11	2008-02-05			ENSG00000174950	ENSG00000174950			32043	protein-coding gene	gene with protein product							Standard	XM_005245868		Approved		uc001boc.3	Q6UWJ8	OTTHUMG00000003395	ENST00000374030.1:c.162C>A	1.37:g.27709084G>T	ENSP00000363142:p.Cys54*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPJ0|Q5JXD6	Nonsense_Mutation	SNP	pfam_CD164_MGC24	p.C54*	ENST00000374030.1	37	c.162		1	.	.	.	.	.	.	.	.	.	.	G	16.26	3.074215	0.55646	.	.	ENSG00000174950	ENST00000374030;ENST00000374027;ENST00000374025	.	.	.	4.64	2.74	0.32292	.	0.000000	0.52532	D	0.000061	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-4.5878	5.5185	0.16919	0.102:0.0:0.7019:0.1961	.	.	.	.	X	54	.	ENSP00000363137:C54X	C	-	3	2	CD164L2	27581671	0.999000	0.42202	0.795000	0.32087	0.502000	0.33828	2.460000	0.45031	0.557000	0.29117	0.555000	0.69702	TGC	CD164L2	-	pfam_CD164_MGC24		0.632	CD164L2-001	KNOWN	basic|appris_candidate_longest	protein_coding	CD164L2	HGNC	protein_coding	OTTHUMT00000009518.1	G	NM_207397		27709084	-1	no_errors	ENST00000374030	ensembl	human	known	70_37	nonsense	SNP	0.918	T
CERK	64781	genome.wustl.edu	37	22	47103759	47103759	+	Silent	SNP	C	C	G			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr22:47103759C>G	ENST00000216264.8	-	6	808	c.696G>C	c.(694-696)cgG>cgC	p.R232R	CERK_ENST00000541677.1_Silent_p.R34R	NM_022766.5	NP_073603.2	Q8TCT0	CERK1_HUMAN	ceramide kinase	232	DAGKc. {ECO:0000255|PROSITE- ProRule:PRU00783}.				ceramide metabolic process (GO:0006672)|glycosphingolipid metabolic process (GO:0006687)|lipid phosphorylation (GO:0046834)|protein kinase C-activating G-protein coupled receptor signaling pathway (GO:0007205)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	integral component of membrane (GO:0016021)|mitochondrion (GO:0005739)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ceramide kinase activity (GO:0001729)|diacylglycerol kinase activity (GO:0004143)|magnesium ion binding (GO:0000287)|NAD+ kinase activity (GO:0003951)			cervix(1)|endometrium(1)|large_intestine(2)|lung(11)|ovary(1)|prostate(2)|skin(2)	20		Breast(42;0.00571)|Ovarian(80;0.00965)|all_neural(38;0.0416)|Lung SC(80;0.164)		UCEC - Uterine corpus endometrioid carcinoma (28;0.0182)|BRCA - Breast invasive adenocarcinoma(115;0.171)		TGATTCCAATCCGGAGGCTAC	0.607																																																	0													90.0	98.0	96.0					22																	47103759		2203	4300	6503	SO:0001819	synonymous_variant	64781			AB079066	CCDS14077.1	22q13.31	2008-06-10			ENSG00000100422	ENSG00000100422			19256	protein-coding gene	gene with protein product		610307				11956206, 11258795	Standard	NM_022766		Approved	hCERK, FLJ23239, dA59H18.3, DKFZp434E0211, FLJ21430, KIAA1646, LK4, dA59H18.2	uc003bia.3	Q8TCT0	OTTHUMG00000150395	ENST00000216264.8:c.696G>C	22.37:g.47103759C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A0JNT4|A8K611|Q6NX59|Q9BYB3|Q9UGE5	Silent	SNP	pfam_Diacylglycerol_kinase_cat_dom,superfamily_ATP-NAD_kinase_PpnK-typ,smart_Diacylglycerol_kinase_cat_dom	p.R232	ENST00000216264.8	37	c.696	CCDS14077.1	22																																																																																			CERK	-	pfam_Diacylglycerol_kinase_cat_dom,smart_Diacylglycerol_kinase_cat_dom		0.607	CERK-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CERK	HGNC	protein_coding	OTTHUMT00000317924.2	C	NM_022766		47103759	-1	no_errors	ENST00000216264	ensembl	human	known	70_37	silent	SNP	0.532	G
CHM	1121	genome.wustl.edu	37	X	85218961	85218961	+	Silent	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chrX:85218961G>T	ENST00000357749.2	-	5	440	c.411C>A	c.(409-411)gcC>gcA	p.A137A	CHM_ENST00000537751.1_5'UTR|CHM_ENST00000467744.2_Intron	NM_000390.2	NP_000381.1	P24386	RAE1_HUMAN	choroideremia (Rab escort protein 1)	137					blood vessel development (GO:0001568)|protein geranylgeranylation (GO:0018344)|protein targeting to membrane (GO:0006612)|response to stimulus (GO:0050896)|visual perception (GO:0007601)	cytosol (GO:0005829)|Rab-protein geranylgeranyltransferase complex (GO:0005968)	GTPase activator activity (GO:0005096)|Rab geranylgeranyltransferase activity (GO:0004663)|Rab GTPase binding (GO:0017137)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|liver(1)|lung(12)|ovary(1)|prostate(1)	20		all_lung(315;5.41e-06)				TAGGCAGGAAGGCAGAATCTG	0.458																																																	0													86.0	75.0	78.0					X																	85218961		2203	4300	6503	SO:0001819	synonymous_variant	1121			X78121	CCDS14454.1, CCDS48139.1	Xq21.1-q21.3	2014-09-17			ENSG00000188419	ENSG00000188419			1940	protein-coding gene	gene with protein product		300390		TCD, DXS540		1373238	Standard	XM_006724615		Approved	REP-1	uc004eet.3	P24386	OTTHUMG00000021937	ENST00000357749.2:c.411C>A	X.37:g.85218961G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4D2|O43732	Silent	SNP	pfam_GDP_dissociation_inhibitor,pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort,prints_GDP_dissociation_inhibitor	p.A137	ENST00000357749.2	37	c.411	CCDS14454.1	X																																																																																			CHM	-	pirsf_Rab_geranylTrfase_A_euk,prints_Rab_escort		0.458	CHM-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CHM	HGNC	protein_coding	OTTHUMT00000057396.3	G	NM_000390		85218961	-1	no_errors	ENST00000357749	ensembl	human	known	70_37	silent	SNP	0.000	T
CIRH1A	84916	genome.wustl.edu	37	16	69184470	69184470	+	Missense_Mutation	SNP	G	G	A	rs145040987		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr16:69184470G>A	ENST00000314423.7	+	7	946	c.769G>A	c.(769-771)Gag>Aag	p.E257K	CIRH1A_ENST00000352319.4_Missense_Mutation_p.E257K|CIRH1A_ENST00000563094.1_Missense_Mutation_p.E257K|CIRH1A_ENST00000569615.2_3'UTR			Q969X6	CIR1A_HUMAN	cirrhosis, autosomal recessive 1A (cirhin)	257					maturation of SSU-rRNA (GO:0030490)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|kidney(3)|large_intestine(4)|lung(4)|prostate(1)|urinary_tract(1)	16				OV - Ovarian serous cystadenocarcinoma(108;0.125)		GGGCACAGCCGAGGGAACAGT	0.493											OREG0023906	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Melanoma(69;1156 1278 4951 8715 52012)												0								G	LYS/GLU	0,4396		0,0,2198	158.0	151.0	153.0		769	4.9	1.0	16	dbSNP_134	153	1,8599	1.2+/-3.3	0,1,4299	no	missense	CIRH1A	NM_032830.2	56	0,1,6497	AA,AG,GG		0.0116,0.0,0.0077	possibly-damaging	257/687	69184470	1,12995	2198	4300	6498	SO:0001583	missense	84916			AB075868	CCDS10872.1	16q22	2014-04-07			ENSG00000141076	ENSG00000141076		"""WD repeat domain containing"""	1983	protein-coding gene	gene with protein product	"""UTP4, small subunit (SSU) processome component, homolog (yeast)"""	607456				10820129, 20385600	Standard	NM_032830		Approved	NAIC, FLJ14728, KIAA1988, TEX292, CIRHIN, UTP4	uc002ews.4	Q969X6	OTTHUMG00000137570	ENST00000314423.7:c.769G>A	16.37:g.69184470G>A	ENSP00000327179:p.Glu257Lys	Somatic	1112	WXS	Illumina HiSeq	Phase_IV	Q8NCD9|Q8TF14|Q96SP0|Q96SR9|Q96SZ9|Q96T13|Q9BWK6	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom	p.E257K	ENST00000314423.7	37	c.769	CCDS10872.1	16	.	.	.	.	.	.	.	.	.	.	G	23.5	4.420051	0.83559	0.0	1.16E-4	ENSG00000141076	ENST00000314423;ENST00000352319	T;T	0.35605	1.3;1.3	5.86	4.91	0.64330	WD40/YVTN repeat-like-containing domain (1);Quinonprotein alcohol dehydrogenase-like (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.095501	0.64402	D	0.000001	T	0.39384	0.1076	M	0.64170	1.965	0.54753	D	0.999987	D;D;D	0.63880	0.993;0.975;0.981	B;B;B	0.42827	0.399;0.251;0.373	T	0.45673	-0.9245	10	0.87932	D	0	.	14.5019	0.67727	0.0708:0.0:0.9292:0.0	.	257;257;257	Q969X6-2;Q969X6;Q969X6-3	.;CIR1A_HUMAN;.	K	257	ENSP00000327179:E257K;ENSP00000339164:E257K	ENSP00000327179:E257K	E	+	1	0	CIRH1A	67741971	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	5.590000	0.67530	1.491000	0.48482	0.508000	0.49915	GAG	CIRH1A	-	superfamily_WD40_repeat_dom,superfamily_Quinonprotein_ADH-like,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.493	CIRH1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CIRH1A	HGNC	protein_coding	OTTHUMT00000268950.2	G	NM_032830		69184470	+1	no_errors	ENST00000314423	ensembl	human	known	70_37	missense	SNP	1.000	A
CNOT8	9337	genome.wustl.edu	37	5	154252151	154252151	+	Silent	SNP	G	G	A	rs374069510		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr5:154252151G>A	ENST00000517876.1	+	7	1145	c.669G>A	c.(667-669)agG>agA	p.R223R	CNOT8_ENST00000521583.1_Silent_p.R117R|CNOT8_ENST00000520671.1_Silent_p.R117R|CNOT8_ENST00000521450.1_Silent_p.R117R|CNOT8_ENST00000285896.6_Silent_p.R223R|CNOT8_ENST00000403027.2_Silent_p.R223R|CNOT8_ENST00000524105.1_Silent_p.R59R|CNOT8_ENST00000523698.1_Silent_p.R117R|CNOT8_ENST00000519404.1_Silent_p.R169R			Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8	223					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			GGATTGGAAGGCAGCACCAGG	0.478																																					NSCLC(140;1804 1895 27149 29895 35312)												0								G		0,4406		0,0,2203	129.0	121.0	124.0		669	4.2	1.0	5		124	1,8599	1.2+/-3.3	0,1,4299	no	coding-synonymous	CNOT8	NM_004779.4		0,1,6502	AA,AG,GG		0.0116,0.0,0.0077		223/293	154252151	1,13005	2203	4300	6503	SO:0001819	synonymous_variant	9337			AF053318	CCDS4329.1, CCDS75361.1	5q31-q33	2008-07-18			ENSG00000155508	ENSG00000155508			9207	protein-coding gene	gene with protein product	"""PGK promoter directed over production"""	603731		POP2		10036195, 10637334	Standard	XM_005268527		Approved	CAF1, hCAF1, CALIF	uc003lvw.3	Q9UFF9	OTTHUMG00000130192	ENST00000517876.1:c.669G>A	5.37:g.154252151G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B0AZS3|B2RAR8|B7Z8R1|D3DQI8|O95709|Q7Z521|Q9H6Y1	Silent	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.R223	ENST00000517876.1	37	c.669	CCDS4329.1	5																																																																																			CNOT8	-	pfam_RNase_CAF1,superfamily_RNaseH-like_dom		0.478	CNOT8-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNOT8	HGNC	protein_coding	OTTHUMT00000377449.1	G	NM_004779		154252151	+1	no_errors	ENST00000285896	ensembl	human	known	70_37	silent	SNP	1.000	A
CNOT8	9337	genome.wustl.edu	37	5	154252202	154252202	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr5:154252202G>C	ENST00000517876.1	+	7	1196	c.720G>C	c.(718-720)agG>agC	p.R240S	CNOT8_ENST00000521583.1_Missense_Mutation_p.R134S|CNOT8_ENST00000520671.1_Missense_Mutation_p.R134S|CNOT8_ENST00000521450.1_Missense_Mutation_p.R134S|CNOT8_ENST00000285896.6_Missense_Mutation_p.R240S|CNOT8_ENST00000403027.2_Missense_Mutation_p.R240S|CNOT8_ENST00000524105.1_Missense_Mutation_p.R76S|CNOT8_ENST00000523698.1_Missense_Mutation_p.R134S|CNOT8_ENST00000519404.1_Missense_Mutation_p.R186S			Q9UFF9	CNOT8_HUMAN	CCR4-NOT transcription complex, subunit 8	240					exonucleolytic nuclear-transcribed mRNA catabolic process involved in deadenylation-dependent decay (GO:0043928)|gene expression (GO:0010467)|gene silencing by miRNA (GO:0035195)|mRNA metabolic process (GO:0016071)|negative regulation of cell proliferation (GO:0008285)|nuclear-transcribed mRNA catabolic process, deadenylation-dependent decay (GO:0000288)|nuclear-transcribed mRNA poly(A) tail shortening (GO:0000289)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription, DNA-templated (GO:0006355)|regulation of translation (GO:0006417)|RNA metabolic process (GO:0016070)|RNA phosphodiester bond hydrolysis, exonucleolytic (GO:0090503)|transcription, DNA-templated (GO:0006351)	CCR4-NOT complex (GO:0030014)|cytosol (GO:0005829)|intracellular (GO:0005622)|nucleus (GO:0005634)	3'-5'-exoribonuclease activity (GO:0000175)|metal ion binding (GO:0046872)|poly(A)-specific ribonuclease activity (GO:0004535)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(2)|large_intestine(2)|lung(2)|skin(1)|upper_aerodigestive_tract(1)	10	Renal(175;0.00488)	Medulloblastoma(196;0.0523)	KIRC - Kidney renal clear cell carcinoma(527;0.00112)			CTTTCTTTAGGATGAAAGAGG	0.502																																					NSCLC(140;1804 1895 27149 29895 35312)												0													89.0	85.0	86.0					5																	154252202		2203	4300	6503	SO:0001583	missense	9337			AF053318	CCDS4329.1, CCDS75361.1	5q31-q33	2008-07-18			ENSG00000155508	ENSG00000155508			9207	protein-coding gene	gene with protein product	"""PGK promoter directed over production"""	603731		POP2		10036195, 10637334	Standard	XM_005268527		Approved	CAF1, hCAF1, CALIF	uc003lvw.3	Q9UFF9	OTTHUMG00000130192	ENST00000517876.1:c.720G>C	5.37:g.154252202G>C	ENSP00000430493:p.Arg240Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B0AZS3|B2RAR8|B7Z8R1|D3DQI8|O95709|Q7Z521|Q9H6Y1	Missense_Mutation	SNP	pfam_RNase_CAF1,superfamily_RNaseH-like_dom	p.R240S	ENST00000517876.1	37	c.720	CCDS4329.1	5	.	.	.	.	.	.	.	.	.	.	G	16.12	3.033584	0.54896	.	.	ENSG00000155508	ENST00000523698;ENST00000517876;ENST00000521450;ENST00000403027;ENST00000524105;ENST00000285896;ENST00000542339;ENST00000520671;ENST00000521583;ENST00000519404;ENST00000518775	T;T;T;T;T;T;T;T;T;T	0.44482	0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92;0.92	5.95	5.09	0.68999	Ribonuclease H-like (1);	0.000000	0.85682	D	0.000000	T	0.36580	0.0972	L	0.33339	1.005	0.58432	D	0.999999	B;P	0.36183	0.387;0.542	B;B	0.39771	0.309;0.309	T	0.29088	-1.0023	10	0.66056	D	0.02	-19.6801	11.9373	0.52880	0.1494:0.0:0.8506:0.0	.	186;240	B7Z8R1;Q9UFF9	.;CNOT8_HUMAN	S	134;240;134;240;76;240;217;134;134;186;186	ENSP00000428565:R134S;ENSP00000430493:R240S;ENSP00000431034:R134S;ENSP00000384747:R240S;ENSP00000429576:R76S;ENSP00000285896:R240S;ENSP00000428305:R134S;ENSP00000429882:R134S;ENSP00000430833:R186S;ENSP00000429394:R186S	ENSP00000285896:R240S	R	+	3	2	CNOT8	154232395	1.000000	0.71417	1.000000	0.80357	0.820000	0.46376	2.719000	0.47244	1.526000	0.49068	0.655000	0.94253	AGG	CNOT8	-	superfamily_RNaseH-like_dom		0.502	CNOT8-006	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	CNOT8	HGNC	protein_coding	OTTHUMT00000377449.1	G	NM_004779		154252202	+1	no_errors	ENST00000285896	ensembl	human	known	70_37	missense	SNP	1.000	C
CPA1	1357	genome.wustl.edu	37	7	130023300	130023300	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr7:130023300C>T	ENST00000011292.3	+	5	702	c.552C>T	c.(550-552)gtC>gtT	p.V184V	CPA1_ENST00000484324.1_Silent_p.V96V	NM_001868.2	NP_001859.1	P15085	CBPA1_HUMAN	carboxypeptidase A1 (pancreatic)	184					proteolysis (GO:0006508)	extracellular space (GO:0005615)	metallocarboxypeptidase activity (GO:0004181)|zinc ion binding (GO:0008270)			endometrium(3)|kidney(1)|large_intestine(5)|lung(11)|ovary(1)	21	Melanoma(18;0.0435)					GGGAGTGGGTCACCCAGGCCA	0.632																																																	0													57.0	63.0	61.0					7																	130023300		2203	4300	6503	SO:0001819	synonymous_variant	1357				CCDS5820.1	7q32	2012-02-10			ENSG00000091704	ENSG00000091704	3.4.17.1		2296	protein-coding gene	gene with protein product	"""pancreatic carboxypeptidase A"""	114850		CPA			Standard	NM_001868		Approved		uc003vpx.3	P15085	OTTHUMG00000157826	ENST00000011292.3:c.552C>T	7.37:g.130023300C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D1M1|Q53XU0|Q9BS67|Q9UCF2	Silent	SNP	pfam_Peptidase_M14,pfam_Prot_inh_M14A,superfamily_Prot_inh_propept,smart_Peptidase_M14,prints_Peptidase_M14	p.V184	ENST00000011292.3	37	c.552	CCDS5820.1	7																																																																																			CPA1	-	pfam_Peptidase_M14,smart_Peptidase_M14,prints_Peptidase_M14		0.632	CPA1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPA1	HGNC	protein_coding	OTTHUMT00000349736.2	C	NM_001868		130023300	+1	no_errors	ENST00000011292	ensembl	human	known	70_37	silent	SNP	1.000	T
CPSF1	29894	genome.wustl.edu	37	8	145619868	145619868	+	Silent	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr8:145619868G>A	ENST00000349769.3	-	31	3652	c.3558C>T	c.(3556-3558)atC>atT	p.I1186I	CPSF1_ENST00000531727.1_5'Flank|MIR939_ENST00000401314.1_RNA	NM_013291.2	NP_037423.2	Q10570	CPSF1_HUMAN	cleavage and polyadenylation specific factor 1, 160kDa	1186					gene expression (GO:0010467)|mRNA 3'-end processing (GO:0031124)|mRNA cleavage (GO:0006379)|mRNA export from nucleus (GO:0006406)|mRNA polyadenylation (GO:0006378)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|termination of RNA polymerase II transcription (GO:0006369)|transcription from RNA polymerase II promoter (GO:0006366)	mRNA cleavage and polyadenylation specificity factor complex (GO:0005847)|nucleoplasm (GO:0005654)	mRNA 3'-UTR binding (GO:0003730)			NS(1)|autonomic_ganglia(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(5)|lung(15)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	38	all_cancers(97;6.64e-12)|all_epithelial(106;2.89e-10)|Lung NSC(106;5.7e-05)|all_lung(105;0.000174)|Ovarian(258;0.0173)|Acute lymphoblastic leukemia(118;0.155)		OV - Ovarian serous cystadenocarcinoma(54;2.88e-41)|Epithelial(56;1.67e-40)|all cancers(56;1.2e-35)|BRCA - Breast invasive adenocarcinoma(115;0.0323)|Colorectal(110;0.055)			CCTTCTGGCCGATGGCCGACA	0.667																																					NSCLC(133;1088 1848 27708 34777 35269)												0													25.0	25.0	25.0					8																	145619868		2196	4297	6493	SO:0001819	synonymous_variant	29894			U37012	CCDS34966.1	8q24	2014-05-06	2002-08-29		ENSG00000071894	ENSG00000071894			2324	protein-coding gene	gene with protein product		606027	"""cleavage and polyadenylation specific factor 1, 160kD subunit"""			7651824, 7590244	Standard	NM_013291		Approved		uc003zcj.3	Q10570	OTTHUMG00000174612	ENST00000349769.3:c.3558C>T	8.37:g.145619868G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AF0	Silent	SNP	pfam_Cleavage/polyA-sp_fac_asu_C	p.I1186	ENST00000349769.3	37	c.3558	CCDS34966.1	8																																																																																			CPSF1	-	pfam_Cleavage/polyA-sp_fac_asu_C		0.667	CPSF1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CPSF1	HGNC	protein_coding	OTTHUMT00000382422.2	G	NM_013291		145619868	-1	no_errors	ENST00000349769	ensembl	human	known	70_37	silent	SNP	0.941	A
CPT1B	1375	genome.wustl.edu	37	22	51015042	51015042	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr22:51015042G>A	ENST00000360719.2	-	5	621	c.484C>T	c.(484-486)Cgg>Tgg	p.R162W	CPT1B_ENST00000457250.1_Intron|CHKB-CPT1B_ENST00000453634.1_Intron|CPT1B_ENST00000440709.1_Missense_Mutation_p.R162W|CPT1B_ENST00000312108.7_Missense_Mutation_p.R162W|CHKB-CPT1B_ENST00000452668.1_5'Flank|CPT1B_ENST00000395650.2_Missense_Mutation_p.R162W|CPT1B_ENST00000405237.3_Missense_Mutation_p.R162W|CPT1B_ENST00000434492.2_Intron	NM_001145135.1|NM_152245.2	NP_001138607.1|NP_689451.1	Q92523	CPT1B_HUMAN	carnitine palmitoyltransferase 1B (muscle)	162					carnitine shuttle (GO:0006853)|cellular lipid metabolic process (GO:0044255)|fatty acid beta-oxidation (GO:0006635)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)|mitochondrion (GO:0005739)	carnitine O-palmitoyltransferase activity (GO:0004095)			central_nervous_system(1)|endometrium(2)|large_intestine(5)|lung(7)|ovary(2)|prostate(2)|upper_aerodigestive_tract(1)|urinary_tract(2)	22		all_cancers(38;8.8e-15)|all_epithelial(38;1.12e-12)|all_lung(38;3.07e-05)|Breast(42;6.27e-05)|Lung NSC(38;0.000813)|Ovarian(80;0.0221)|Hepatocellular(38;0.0691)|Lung SC(80;0.113)		all cancers(3;3.56e-77)|OV - Ovarian serous cystadenocarcinoma(4;5.39e-74)|Epithelial(4;5.58e-70)|GBM - Glioblastoma multiforme(4;5.59e-08)|LUAD - Lung adenocarcinoma(64;0.0016)|Lung(4;0.00942)|BRCA - Breast invasive adenocarcinoma(115;0.207)		ATAGGGTGCCGGCTGGATAGA	0.587											OREG0026685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																									Esophageal Squamous(170;988 1933 25577 30295 48163)												0													41.0	39.0	39.0					22																	51015042		2202	4296	6498	SO:0001583	missense	1375			U62733	CCDS14098.1, CCDS46734.1	22q13.33	2007-07-26			ENSG00000205560	ENSG00000205560			2329	protein-coding gene	gene with protein product		601987				9070950	Standard	NM_152245		Approved	M-CPT1, CPT1-M	uc003bmm.3	Q92523	OTTHUMG00000137390	ENST00000360719.2:c.484C>T	22.37:g.51015042G>A	ENSP00000353945:p.Arg162Trp	Somatic	974	WXS	Illumina HiSeq	Phase_IV	B7Z4U4|B7Z5T8|E9PCP2|Q13389|Q99655|Q9BY90	Missense_Mutation	SNP	pfam_Carn_acyl_trans	p.R162W	ENST00000360719.2	37	c.484	CCDS14098.1	22	.	.	.	.	.	.	.	.	.	.	G	11.63	1.697082	0.30142	.	.	ENSG00000205560	ENST00000405237;ENST00000312108;ENST00000360719;ENST00000440709;ENST00000395650	T;T;T;T;T	0.80033	-1.33;-1.33;-1.33;-1.33;-1.33	4.82	3.78	0.43462	.	0.169528	0.53938	D	0.000057	D	0.88625	0.6487	M	0.82823	2.61	0.80722	D	1	D;D	0.89917	1.0;0.998	D;D	0.70227	0.968;0.955	D	0.88028	0.2773	10	0.37606	T	0.19	-10.786	12.6163	0.56578	0.0:0.1899:0.8101:0.0	.	162;162	E9PCP2;Q92523	.;CPT1B_HUMAN	W	162	ENSP00000385486:R162W;ENSP00000312189:R162W;ENSP00000353945:R162W;ENSP00000414713:R162W;ENSP00000379011:R162W	ENSP00000312189:R162W	R	-	1	2	CPT1B	49361908	1.000000	0.71417	0.821000	0.32701	0.153000	0.21895	6.067000	0.71193	1.223000	0.43536	0.491000	0.48974	CGG	CPT1B	-	NULL		0.587	CPT1B-201	KNOWN	basic|appris_principal|CCDS	protein_coding	CPT1B	HGNC	protein_coding	OTTHUMT00000317264.5	G	NM_152246		51015042	-1	no_errors	ENST00000312108	ensembl	human	known	70_37	missense	SNP	0.998	A
CYP11A1	1583	genome.wustl.edu	37	15	74637400	74637400	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr15:74637400G>T	ENST00000268053.6	-	3	764	c.610C>A	c.(610-612)Cgc>Agc	p.R204S	CYP11A1_ENST00000541301.1_Intron|CYP11A1_ENST00000419019.2_Missense_Mutation_p.R46S|CYP11A1_ENST00000358632.4_Missense_Mutation_p.R46S	NM_000781.2	NP_000772.2	P05108	CP11A_HUMAN	cytochrome P450, family 11, subfamily A, polypeptide 1	204					biphenyl metabolic process (GO:0018879)|C21-steroid hormone biosynthetic process (GO:0006700)|cellular response to antibiotic (GO:0071236)|cellular response to cadmium ion (GO:0071276)|cellular response to cAMP (GO:0071320)|cellular response to fibroblast growth factor stimulus (GO:0044344)|cellular response to follicle-stimulating hormone stimulus (GO:0071372)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to peptide hormone stimulus (GO:0071375)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|cerebellum development (GO:0021549)|cholesterol metabolic process (GO:0008203)|dibenzo-p-dioxin metabolic process (GO:0018894)|estrogen biosynthetic process (GO:0006703)|fractalkine metabolic process (GO:0050756)|granulosa cell differentiation (GO:0060014)|hippocampus development (GO:0021766)|Leydig cell differentiation (GO:0033327)|maternal process involved in female pregnancy (GO:0060135)|mating behavior (GO:0007617)|phenol-containing compound metabolic process (GO:0018958)|phthalate metabolic process (GO:0018963)|progesterone biosynthetic process (GO:0006701)|response to alkaloid (GO:0043279)|response to corticosterone (GO:0051412)|response to drug (GO:0042493)|response to fungicide (GO:0060992)|response to gamma radiation (GO:0010332)|response to genistein (GO:0033595)|response to hydrogen peroxide (GO:0042542)|response to insecticide (GO:0017085)|response to L-ascorbic acid (GO:0033591)|response to salt stress (GO:0009651)|response to vitamin E (GO:0033197)|Schwann cell differentiation (GO:0014037)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|sterol metabolic process (GO:0016125)|testosterone biosynthetic process (GO:0061370)|vitamin D metabolic process (GO:0042359)|xenobiotic metabolic process (GO:0006805)	mitochondrial crista (GO:0030061)|mitochondrial matrix (GO:0005759)|mitochondrion (GO:0005739)|perikaryon (GO:0043204)	cholesterol binding (GO:0015485)|cholesterol monooxygenase (side-chain-cleaving) activity (GO:0008386)|heme binding (GO:0020037)|iron ion binding (GO:0005506)			breast(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(3)|ovary(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	20					Aminoglutethimide(DB00357)|Cholecalciferol(DB00169)|Clomifene(DB00882)|Clotrimazole(DB00257)|Dexamethasone(DB01234)|Digitoxin(DB01396)|Digoxin(DB00390)|Dinoprostone(DB00917)|Glutethimide(DB01437)|Ketoconazole(DB01026)|Omeprazole(DB00338)|Saquinavir(DB01232)|Terbinafine(DB00857)|Testosterone(DB00624)	AAGGCAAAGCGGAACAGGTCA	0.567																																					Esophageal Squamous(87;818 1337 4093 9268 37314)												0													89.0	83.0	85.0					15																	74637400		2197	4296	6493	SO:0001583	missense	1583			AK056794	CCDS32291.1, CCDS45303.1	15q23-q24	2010-05-04	2003-01-14	2003-01-17	ENSG00000140459	ENSG00000140459	1.14.15.6	"""Cytochrome P450s"""	2590	protein-coding gene	gene with protein product	"""cholesterol monooxygenase (side-chain-cleaving)"""	118485	"""cytochrome P450, subfamily XIA (cholesterol side chain cleavage)"""	CYP11A			Standard	NM_000781		Approved	P450SCC	uc002axt.2	P05108	OTTHUMG00000150716	ENST00000268053.6:c.610C>A	15.37:g.74637400G>T	ENSP00000268053:p.Arg204Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8D5|B3KPU8|G3XAD7|Q15081|Q16805|Q8N1A7	Missense_Mutation	SNP	pfam_Cyt_P450,superfamily_Cyt_P450,prints_Cyt_P450_E_grp-I,prints_Cyt_P450_mitochondrial,prints_Cyt_P450,prints_Cyt_P450_E_grp-IV,prints_Cyt_P450_B	p.R204S	ENST00000268053.6	37	c.610	CCDS32291.1	15	.	.	.	.	.	.	.	.	.	.	G	22.4	4.282905	0.80692	.	.	ENSG00000140459	ENST00000268053;ENST00000358632;ENST00000419019;ENST00000450547	T;T;T	0.69175	-0.38;-0.38;-0.38	4.51	2.49	0.30216	.	0.238158	0.42682	D	0.000663	T	0.76765	0.4033	M	0.81112	2.525	0.80722	D	1	D;P;D	0.65815	0.995;0.941;0.995	D;P;P	0.63703	0.917;0.672;0.878	T	0.77797	-0.2453	10	0.62326	D	0.03	-16.8806	7.4551	0.27261	0.093:0.169:0.738:0.0	.	204;174;204	E7EPP8;B4DTE5;P05108	.;.;CP11A_HUMAN	S	204;46;46;116	ENSP00000268053:R204S;ENSP00000351455:R46S;ENSP00000405488:R46S	ENSP00000268053:R204S	R	-	1	0	CYP11A1	72424453	1.000000	0.71417	1.000000	0.80357	0.971000	0.66376	3.899000	0.56288	2.048000	0.60808	0.643000	0.83706	CGC	CYP11A1	-	pfam_Cyt_P450,superfamily_Cyt_P450		0.567	CYP11A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CYP11A1	HGNC	protein_coding	OTTHUMT00000319737.1	G			74637400	-1	no_errors	ENST00000268053	ensembl	human	known	70_37	missense	SNP	0.993	T
DAPK1	1612	genome.wustl.edu	37	9	90321375	90321375	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr9:90321375G>A	ENST00000408954.3	+	26	3724	c.3389G>A	c.(3388-3390)cGc>cAc	p.R1130H	DAPK1_ENST00000469640.2_Missense_Mutation_p.R1155H|DAPK1_ENST00000358077.5_Missense_Mutation_p.R1130H|DAPK1_ENST00000491893.1_Missense_Mutation_p.R1064H|DAPK1_ENST00000472284.1_Missense_Mutation_p.R1130H	NM_004938.2	NP_004929.2	P53355	DAPK1_HUMAN	death-associated protein kinase 1	1130					apoptotic process (GO:0006915)|apoptotic signaling pathway (GO:0097190)|cellular response to interferon-gamma (GO:0071346)|extrinsic apoptotic signaling pathway via death domain receptors (GO:0008625)|intracellular signal transduction (GO:0035556)|negative regulation of apoptotic process (GO:0043066)|negative regulation of extrinsic apoptotic signaling pathway via death domain receptors (GO:1902042)|negative regulation of translation (GO:0017148)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			breast(5)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(27)|liver(2)|lung(17)|ovary(1)|prostate(2)|skin(3)|stomach(1)	72						GGTGGCGTGCGCATCGTGCCC	0.612									Chronic Lymphocytic Leukemia, Familial Clustering of																																								0													114.0	125.0	121.0					9																	90321375		2201	4292	6493	SO:0001583	missense	1612	Familial Cancer Database	Familial CLL	X76104	CCDS43842.1	9q34.1	2013-01-10			ENSG00000196730	ENSG00000196730		"""Ankyrin repeat domain containing"""	2674	protein-coding gene	gene with protein product		600831				8530096	Standard	XM_005251757		Approved	DAPK	uc004apd.3	P53355	OTTHUMG00000020150	ENST00000408954.3:c.3389G>A	9.37:g.90321375G>A	ENSP00000386135:p.Arg1130His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLD2|B7ZLE7|Q14CQ7|Q1W5W0|Q68CP8|Q6ZRZ3|Q9BTL8	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ankyrin_rpt,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Death,pfam_LipoPS_kinase,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,superfamily_Ankyrin_rpt-contain_dom,superfamily_DEATH-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_Ankyrin_rpt,smart_Death,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_Death,pfscan_Prot_kinase_cat_dom,prints_Ankyrin_rpt	p.R1155H	ENST00000408954.3	37	c.3464	CCDS43842.1	9	.	.	.	.	.	.	.	.	.	.	G	18.65	3.670261	0.67814	.	.	ENSG00000196730	ENST00000358077;ENST00000472284;ENST00000469640;ENST00000408954;ENST00000491893	T;T;T;T;T	0.74315	-0.65;-0.65;-0.79;-0.65;-0.83	5.73	4.84	0.62591	.	0.000000	0.49916	D	0.000137	T	0.71710	0.3372	M	0.68952	2.095	0.80722	D	1	B;B;B	0.32128	0.008;0.357;0.008	B;B;B	0.26693	0.005;0.072;0.005	T	0.73783	-0.3874	10	0.87932	D	0	.	14.8378	0.70197	0.0691:0.0:0.9309:0.0	.	1064;1130;1130	B7ZLE7;P53355-3;P53355	.;.;DAPK1_HUMAN	H	1130;1130;1155;1130;1064	ENSP00000350785:R1130H;ENSP00000417076:R1130H;ENSP00000418885:R1155H;ENSP00000386135:R1130H;ENSP00000419026:R1064H	ENSP00000350785:R1130H	R	+	2	0	DAPK1	89511195	1.000000	0.71417	0.941000	0.38009	0.516000	0.34256	7.765000	0.85310	1.424000	0.47217	0.561000	0.74099	CGC	DAPK1	-	NULL		0.612	DAPK1-010	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DAPK1	HGNC	protein_coding	OTTHUMT00000356843.1	G	NM_004938		90321375	+1	no_errors	ENST00000469640	ensembl	human	known	70_37	missense	SNP	1.000	A
DAPK2	23604	genome.wustl.edu	37	15	64204322	64204322	+	Silent	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr15:64204322G>T	ENST00000457488.1	-	10	963	c.933C>A	c.(931-933)gtC>gtA	p.V311V	DAPK2_ENST00000261891.3_Silent_p.V311V	NM_014326.3	NP_055141.2	Q9UIK4	DAPK2_HUMAN	death-associated protein kinase 2	311	Calmodulin-binding.				anoikis (GO:0043276)|apoptotic process (GO:0006915)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of apoptotic process (GO:0042981)|regulation of autophagy (GO:0010506)|regulation of intrinsic apoptotic signaling pathway (GO:2001242)	cytoplasm (GO:0005737)|cytoplasmic vesicle (GO:0031410)	ATP binding (GO:0005524)|calmodulin binding (GO:0005516)|calmodulin-dependent protein kinase activity (GO:0004683)|identical protein binding (GO:0042802)|protein serine/threonine kinase activity (GO:0004674)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(2)|large_intestine(2)|lung(2)|skin(1)|stomach(1)	11				LUAD - Lung adenocarcinoma(2;0.215)		ACCGCCTGCGGACATACTGCT	0.617																																																	0													67.0	54.0	59.0					15																	64204322		2203	4300	6503	SO:0001819	synonymous_variant	23604			AB018001	CCDS10188.1	15q22.1	2008-07-18			ENSG00000035664	ENSG00000035664			2675	protein-coding gene	gene with protein product						10376525	Standard	XM_005254265		Approved	DRP-1, MGC119312	uc002amr.3	Q9UIK4	OTTHUMG00000132947	ENST00000457488.1:c.933C>A	15.37:g.64204322G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	E9JGM7|O75892|Q24JS1	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_RIO-like_kinase,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.V311	ENST00000457488.1	37	c.933	CCDS10188.1	15																																																																																			DAPK2	-	superfamily_Kinase-like_dom		0.617	DAPK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DAPK2	HGNC	protein_coding	OTTHUMT00000256479.1	G	NM_014326		64204322	-1	no_errors	ENST00000261891	ensembl	human	known	70_37	silent	SNP	1.000	T
DEF6	50619	genome.wustl.edu	37	6	35288970	35288970	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr6:35288970G>A	ENST00000316637.5	+	11	1684	c.1679G>A	c.(1678-1680)cGt>cAt	p.R560H	DEF6_ENST00000542066.1_Missense_Mutation_p.R305H	NM_022047.3	NP_071330.3	Q9H4E7	DEFI6_HUMAN	differentially expressed in FDCP 6 homolog (mouse)	560						cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)|plasma membrane (GO:0005886)				cervix(1)|endometrium(2)|large_intestine(4)|lung(5)|ovary(1)|upper_aerodigestive_tract(2)	15						CCAGATAAGCGTCCGGTCACC	0.632																																																	0													169.0	174.0	172.0					6																	35288970		2203	4300	6503	SO:0001583	missense	50619			AJ276095	CCDS4802.1	6p21.33-p21.1	2013-01-10	2001-11-28		ENSG00000023892	ENSG00000023892		"""Pleckstrin homology (PH) domain containing"""	2760	protein-coding gene	gene with protein product	"""SWAP-70-like adaptor protein of T cells"""	610094	"""differentially expressed in FDCP (mouse homolog) 6"""			19251698	Standard	NM_022047		Approved	IBP, SLAT, SWAP70L	uc003okk.3	Q9H4E7	OTTHUMG00000014563	ENST00000316637.5:c.1679G>A	6.37:g.35288970G>A	ENSP00000319831:p.Arg560His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q86VF4	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.R560H	ENST00000316637.5	37	c.1679	CCDS4802.1	6	.	.	.	.	.	.	.	.	.	.	G	22.8	4.339881	0.81911	.	.	ENSG00000023892	ENST00000542066;ENST00000316637	T;T	0.24908	1.83;3.42	5.42	5.42	0.78866	.	0.000000	0.85682	D	0.000000	T	0.41743	0.1172	M	0.66939	2.045	0.80722	D	1	D;D;D	0.76494	0.999;0.999;0.999	D;D;D	0.80764	0.994;0.98;0.98	T	0.25433	-1.0132	10	0.56958	D	0.05	-13.5522	15.9572	0.79896	0.0:0.0:1.0:0.0	.	305;560;560	F5H853;B2RBP7;Q9H4E7	.;.;DEFI6_HUMAN	H	305;560	ENSP00000442166:R305H;ENSP00000319831:R560H	ENSP00000319831:R560H	R	+	2	0	DEF6	35396948	1.000000	0.71417	0.962000	0.40283	0.944000	0.59088	5.968000	0.70413	2.539000	0.85634	0.561000	0.74099	CGT	DEF6	-	NULL		0.632	DEF6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DEF6	HGNC	protein_coding	OTTHUMT00000040276.1	G	NM_022047		35288970	+1	no_errors	ENST00000316637	ensembl	human	known	70_37	missense	SNP	0.996	A
DHRSX	207063	genome.wustl.edu	37	X	2161183	2161183	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chrX:2161183C>T	ENST00000334651.5	-	6	737	c.685G>A	c.(685-687)Gag>Aag	p.E229K		NM_145177.2	NP_660160.2	Q8N5I4	DHRSX_HUMAN	dehydrogenase/reductase (SDR family) X-linked	229							oxidoreductase activity (GO:0016491)			endometrium(1)|kidney(1)|large_intestine(2)|lung(10)|ovary(1)|pancreas(1)	16		all_cancers(21;9e-05)|all_epithelial(21;6.22e-06)|all_lung(23;0.000597)|Lung NSC(23;0.00901)|Lung SC(21;0.186)				TGGCTTCCCTCAGCCGCCAGC	0.647																																																	0													82.0	78.0	80.0					X																	2161183		2203	4296	6499	SO:0001583	missense	207063			AJ293620	CCDS35195.1	Xp22.33 and Yp11.2	2014-05-07	2003-09-12		ENSG00000169084	ENSG00000169084		"""Pseudoautosomal regions / PAR1"""	18399	protein-coding gene	gene with protein product	"""short chain dehydrogenase/reductase family 7C, member 6"", ""short chain dehydrogenase/reductase family 46C, member 1"", ""dehydrogenase/reductase (SDR family) Y-linked"""		"""dehydrogenase/reductase (SDR family) X chromosome"""			11731500, 19027726	Standard	NM_145177		Approved	DHRS5X, DHRSXY, DHRSY, DHRS5Y, SDR46C1, SDR7C6	uc004cqf.4	Q8N5I4	OTTHUMG00000021068	ENST00000334651.5:c.685G>A	X.37:g.2161183C>T	ENSP00000334113:p.Glu229Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6UWC7|Q8WUS4|Q96GR8|Q9NTF6	Missense_Mutation	SNP	pfam_DH_sc/Rdtase_SDR,pfam_PKS_KR,pfam_Epimerase_deHydtase,prints_Glc/ribitol_DH	p.E229K	ENST00000334651.5	37	c.685	CCDS35195.1	X	.	.	.	.	.	.	.	.	.	.	C	4.665	0.123614	0.08931	.	.	ENSG00000169084	ENST00000334651;ENST00000412516	D;D	0.82433	-1.61;-1.61	1.45	-2.91	0.05631	NAD(P)-binding domain (1);	1.176110	0.06377	U	0.714519	T	0.68924	0.3054	N	0.25992	0.78	0.09310	N	1	B	0.24675	0.109	B	0.20767	0.031	T	0.51060	-0.8753	10	0.33940	T	0.23	.	5.3835	0.16204	0.0:0.645:0.2035:0.1514	.	229	Q8N5I4	DHRSX_HUMAN	K	229;206	ENSP00000334113:E229K;ENSP00000391778:E206K	ENSP00000334113:E229K	E	-	1	0	DHRSX	2171183	0.000000	0.05858	0.720000	0.30636	0.348000	0.29142	-0.020000	0.12525	-0.898000	0.03906	0.054000	0.15206	GAG	DHRSX	-	NULL		0.647	DHRSX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHRSX	HGNC	protein_coding	OTTHUMT00000055617.3	C	NM_145177		2161183	-1	no_errors	ENST00000334651	ensembl	human	known	70_37	missense	SNP	0.811	T
ELMO2	63916	genome.wustl.edu	37	20	45023165	45023165	+	5'UTR	SNP	C	C	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr20:45023165C>A	ENST00000290246.6	-	0	151				ELMO2_ENST00000488853.1_5'UTR|ELMO2_ENST00000439931.2_5'UTR|ELMO2_ENST00000445496.2_Intron|ELMO2_ENST00000352077.2_5'Flank|ELMO2_ENST00000372176.1_5'UTR|ELMO2_ENST00000396391.1_Intron	NM_133171.3	NP_573403.1	Q96JJ3	ELMO2_HUMAN	engulfment and cell motility 2						apoptotic process (GO:0006915)|cell chemotaxis (GO:0060326)|Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)	cytoskeleton (GO:0005856)|cytosol (GO:0005829)|membrane (GO:0016020)	receptor tyrosine kinase binding (GO:0030971)			breast(1)|endometrium(1)|large_intestine(4)|lung(8)|ovary(1)|urinary_tract(1)	16		Myeloproliferative disorder(115;0.0122)				AACACAGACACGGCTGCCTGG	0.458																																																	0													67.0	56.0	60.0					20																	45023165		2203	4300	6503	SO:0001623	5_prime_UTR_variant	63916			AF398886	CCDS13398.1	20q13	2010-03-18	2006-01-20		ENSG00000062598	ENSG00000062598		"""Engulfment and cell motility proteins"""	17233	protein-coding gene	gene with protein product		606421	"""engulfment and cell motility 2 (ced-12 homolog, C. elegans)"""			11595183	Standard	NM_133171		Approved	CED12, ELMO-2, CED-12, KIAA1834, FLJ11656	uc002xru.1	Q96JJ3	OTTHUMG00000033070	ENST00000290246.6:c.-44G>T	20.37:g.45023165C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5T3|Q5JVZ6|Q7Z5G9|Q96CJ2|Q96ME5|Q96PA9|Q9H938|Q9H9L5|Q9HAH0|Q9NQQ6	RNA	SNP	-	NULL	ENST00000290246.6	37	NULL	CCDS13398.1	20																																																																																			ELMO2	-	-		0.458	ELMO2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ELMO2	HGNC	protein_coding	OTTHUMT00000080466.1	C	NM_022086		45023165	-1	no_errors	ENST00000460474	ensembl	human	known	70_37	rna	SNP	0.860	A
EEF1A2	1917	genome.wustl.edu	37	20	62121919	62121919	+	Silent	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr20:62121919G>A	ENST00000298049.7	-	5	1012	c.942C>T	c.(940-942)aaC>aaT	p.N314N	EEF1A2_ENST00000217182.3_Silent_p.N314N			Q05639	EF1A2_HUMAN	eukaryotic translation elongation factor 1 alpha 2	314					positive regulation of apoptotic process (GO:0043065)|response to inorganic substance (GO:0010035)	eukaryotic translation elongation factor 1 complex (GO:0005853)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|translation elongation factor activity (GO:0003746)|translation factor activity, nucleic acid binding (GO:0008135)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(14)|stomach(1)	20	all_cancers(38;9.45e-12)		BRCA - Breast invasive adenocarcinoma(10;1.22e-05)			TCACCGACACGTTCTTCACAT	0.627																																																	0													118.0	107.0	111.0					20																	62121919		2200	4295	6495	SO:0001819	synonymous_variant	1917			AF163763	CCDS13522.1	20q13.3	2010-06-03			ENSG00000101210	ENSG00000101210			3192	protein-coding gene	gene with protein product		602959	"""statin-like"", ""statin"""	STNL, STN		8354261, 8812466	Standard	NM_001958		Approved	EEF1AL, HS1	uc002yfe.2	Q05639	OTTHUMG00000033076	ENST00000298049.7:c.942C>T	20.37:g.62121919G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B5BUF3|E1P5J1|P54266|Q0VGC7	Silent	SNP	pfam_EF_GTP-bd_dom,pfam_Transl_elong_EFTu/EF1A_C,pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_EF1A/Init_IF2_C,superfamily_Transl_elong_init/rib_B-barrel,prints_EF_GTP-bd_dom,tigrfam_Transl_elong_EF1A_euk/arc	p.N314	ENST00000298049.7	37	c.942	CCDS13522.1	20																																																																																			EEF1A2	-	pfam_Transl_elong_EFTu/EF1A_2,superfamily_Transl_elong_init/rib_B-barrel,tigrfam_Transl_elong_EF1A_euk/arc		0.627	EEF1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EEF1A2	HGNC	protein_coding	OTTHUMT00000080495.1	G	NM_001958		62121919	-1	no_errors	ENST00000217182	ensembl	human	known	70_37	silent	SNP	1.000	A
AC024132.1	0	genome.wustl.edu	37	4	27209653	27209654	+	lincRNA	DEL	GT	GT	-			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	GT	GT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr4:27209653_27209654delGT	ENST00000382007.1	-	0	1981_1982																											TAAAGACTGAgtgtgtgtgtgt	0.446																																																	0										37,127,2860		0,0,37,4,119,1352						-3.5	0.0		dbSNP_119	46	8,184,4818		1,0,6,9,166,2323	no	intergenic				1,0,43,13,285,3675	A1A1,A1A2,A1R,A2A2,A2R,RR		3.8323,5.4233,4.4312				45,311,7678						0																															4.37:g.27209663_27209664delGT		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	DEL	-	NULL	ENST00000382007.1	37	NULL		4																																																																																			AC024132.1	-	-		0.446	AC024132.1-001	KNOWN	basic	lincRNA	ENSG00000205830	Clone_based_vega_gene	lincRNA	OTTHUMT00000319578.1	GT			27209654	-1	no_errors	ENST00000382007	ensembl	human	known	70_37	rna	DEL	0.000:0.000	-
Unknown	0	genome.wustl.edu	37	GL000212.1	64937	64937	+	IGR	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chrGL000212.1:64937C>T								None (None upstream) : None (None downstream)																							CACAGGGCATCGCCAACGAGG	0.711																																																	0																																										SO:0001628	intergenic_variant	0																															GL000212.1.37:g.64937C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.S229L		37	c.686		GL000212.1																																																																																			AL356585.1	-	NULL	0	0.711					ENSG00000212857	Clone_based_ensembl_gene			C			64937	+1	no_errors	ENST00000391545	ensembl	human	known	70_37	missense	SNP	NULL	T
LOC101927016	101927016	genome.wustl.edu	37	13	64320978	64320978	+	Silent	SNP	C	C	T	rs535421388	byFrequency	TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr13:64320978C>T	ENST00000453638.2	+	1	45	c.45C>T	c.(43-45)agC>agT	p.S15S	RP11-473M10.3_ENST00000418943.1_lincRNA																endometrium(2)|lung(1)|urinary_tract(1)	4						atggctccagctatggctgtg	0.512													c|||	4	0.000798722	0.0008	0.0	5008	,	,		16266	0.0		0.0	False		,,,				2504	0.0031																0																																										SO:0001819	synonymous_variant	0																														ENST00000453638.2:c.45C>T	13.37:g.64320978C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.S15	ENST00000453638.2	37	c.45		13																																																																																			AL445989.1	-	NULL		0.512	AL445989.1-201	KNOWN	basic|appris_principal	protein_coding	ENSG00000226974	Clone_based_ensembl_gene	protein_coding		C			64320978	+1	no_errors	ENST00000453638	ensembl	human	known	70_37	silent	SNP	0.072	T
RP11-782C8.2	0	genome.wustl.edu	37	1	143189125	143189125	+	lincRNA	SNP	G	G	A	rs201126579		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:143189125G>A	ENST00000412204.2	-	0	2503				RP11-782C8.1_ENST00000438000.1_lincRNA|RP11-782C8.3_ENST00000425124.1_lincRNA																							TGATGACTTGGTTGTTTAAAC	0.333																																																	0																																												0																															1.37:g.143189125G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000412204.2	37	NULL		1																																																																																			BX571672.2	-	-		0.333	RP11-782C8.2-004	KNOWN	basic	lincRNA	ENSG00000232274	Clone_based_vega_gene	lincRNA	OTTHUMT00000037567.2	G			143189125	-1	no_errors	ENST00000447389	ensembl	human	known	70_37	rna	SNP	0.014	A
ATP6V1B1	525	genome.wustl.edu	37	2	71175371	71175374	+	Intron	DEL	TTTT	TTTT	-	rs397984964|rs202099001|rs61680005	byFrequency	TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	TTTT	TTTT					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr2:71175371_71175374delTTTT	ENST00000234396.4	+	2	247				AC007040.11_ENST00000606025.1_Intron|AC007040.7_ENST00000447639.1_RNA|AC007040.7_ENST00000422761.1_RNA|ATP6V1B1_ENST00000412314.1_Intron	NM_001692.3	NP_001683.2	P15313	VATB1_HUMAN	ATPase, H+ transporting, lysosomal 56/58kDa, V1 subunit B1						ATP hydrolysis coupled proton transport (GO:0015991)|ATP metabolic process (GO:0046034)|calcium ion homeostasis (GO:0055074)|cellular iron ion homeostasis (GO:0006879)|excretion (GO:0007588)|inner ear morphogenesis (GO:0042472)|insulin receptor signaling pathway (GO:0008286)|interaction with host (GO:0051701)|ossification (GO:0001503)|pH reduction (GO:0045851)|phagosome maturation (GO:0090382)|proton transport (GO:0015992)|regulation of pH (GO:0006885)|sensory perception of sound (GO:0007605)|transferrin transport (GO:0033572)|transmembrane transport (GO:0055085)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|lateral plasma membrane (GO:0016328)|microvillus (GO:0005902)|proton-transporting V-type ATPase, V1 domain (GO:0033180)|vacuolar proton-transporting V-type ATPase complex (GO:0016471)	ATP binding (GO:0005524)|hydrogen ion transmembrane transporter activity (GO:0015078)|hydrolase activity, acting on acid anhydrides, catalyzing transmembrane movement of substances (GO:0016820)			endometrium(5)|kidney(1)|large_intestine(5)|liver(1)|lung(5)|prostate(1)|skin(1)	19						AAATGATCACtttttttttttctt	0.5											OREG0014685	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)		3396	0.678115	0.6589	0.7291	5008	,	,		20205	0.7867		0.5944	False		,,,				2504	0.6421																0																																										SO:0001627	intron_variant	0			AF107466	CCDS1912.1	2p13	2010-04-21	2008-07-31	2002-05-10	ENSG00000116039	ENSG00000116039	3.6.3.14	"""ATPases / V-type"""	853	protein-coding gene	gene with protein product	"""Renal tubular acidosis with deafness"""	192132	"""vacuolar proton pump 3"""	VPP3, ATP6B1		9916796, 2527371	Standard	XM_005264368		Approved	VATB, RTA1B, Vma2	uc002shj.3	P15313	OTTHUMG00000129711	ENST00000234396.4:c.174+4528TTTT>-	2.37:g.71175375_71175378delTTTT		Somatic	1128	WXS	Illumina HiSeq	Phase_IV	Q53FY0|Q6P4H6	RNA	DEL	-	NULL	ENST00000234396.4	37	NULL	CCDS1912.1	2																																																																																			AC007040.7	-	-		0.500	ATP6V1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ENSG00000239322	Clone_based_vega_gene	protein_coding	OTTHUMT00000251920.2	TTTT	NM_001692		71175374	-1	no_errors	ENST00000422761	ensembl	human	known	70_37	rna	DEL	0.000:0.000:0.001:0.002	-
Unknown	0	genome.wustl.edu	37	GL000205.1	139086	139086	+	IGR	SNP	C	C	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chrGL000205.1:139086C>A								None (None upstream) : None (None downstream)																							gattccagaacagtactgtgg	0.468																																																	0																																										SO:0001628	intergenic_variant	0																															GL000205.1.37:g.139086C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		GL000205.1																																																																																			AC011841.10	-	-	0	0.468					ENSG00000266596	Clone_based_ensembl_gene			C			139086	-1	no_errors	ENST00000581664	ensembl	human	novel	70_37	rna	SNP	NULL	A
ERF	2077	genome.wustl.edu	37	19	42752618	42752618	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:42752618C>T	ENST00000222329.4	-	4	1803	c.1646G>A	c.(1645-1647)tGa>tAa	p.*549*	ERF_ENST00000440177.2_Silent_p.*474*|ERF_ENST00000595941.1_5'Flank|AC006486.9_ENST00000594664.1_Intron	NM_006494.2	NP_006485.2	P50548	ERF_HUMAN	Ets2 repressor factor	0					cell cycle (GO:0007049)|cell differentiation (GO:0030154)|chorio-allantoic fusion (GO:0060710)|ectodermal cell differentiation (GO:0010668)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription from RNA polymerase II promoter (GO:0006366)|trophoblast giant cell differentiation (GO:0060707)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding RNA polymerase II transcription factor activity (GO:0000981)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|lung(7)|skin(1)	17		Prostate(69;0.00682)				CCACAGCCCTCAGGAGTCTCG	0.682																																																	0													20.0	24.0	23.0					19																	42752618		2190	4289	6479	SO:0001819	synonymous_variant	2077			U58535	CCDS12600.1	19q13	2008-07-16				ENSG00000105722			3444	protein-coding gene	gene with protein product	"""Ets2 repressor factor"""	611888				7588608, 9192842	Standard	XM_005258644		Approved	PE-2, PE2	uc002ote.4	P50548		ENST00000222329.4:c.1646G>A	19.37:g.42752618C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RAP1|B7Z4R0|Q59G38|Q9UPI7	Silent	SNP	pfam_Ets,smart_Ets,pfscan_Ets,prints_Ets	p.*549	ENST00000222329.4	37	c.1646	CCDS12600.1	19																																																																																			ERF	-	NULL		0.682	ERF-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERF	HGNC	protein_coding	OTTHUMT00000463684.1	C	NM_006494		42752618	-1	no_errors	ENST00000222329	ensembl	human	known	70_37	silent	SNP	1.000	T
FAM65B	9750	genome.wustl.edu	37	6	25042096	25042096	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr6:25042096C>T	ENST00000510784.2	-	1	142	c.59G>A	c.(58-60)cGg>cAg	p.R20Q	RP11-367G6.3_ENST00000606385.1_lincRNA|RP3-425P12.5_ENST00000428903.1_RNA			Q9Y4F9	FA65B_HUMAN	family with sequence similarity 65, member B	0					cell differentiation (GO:0030154)|muscle organ development (GO:0007517)	cell projection (GO:0042995)|cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)				breast(1)|cervix(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(10)|ovary(1)|prostate(2)|upper_aerodigestive_tract(1)	25						CTGGCGCCTCCGGATCCTGTC	0.537																																																	0																																										SO:0001583	missense	9750			U49187	CCDS47383.1, CCDS47384.1, CCDS69057.1, CCDS69058.1, CCDS75410.1	6p22.3-p21.32	2012-11-30	2008-06-13	2008-06-13	ENSG00000111913	ENSG00000111913			13872	protein-coding gene	gene with protein product	"""myogenesis-related and NCAM-associated protein homolog (chicken)"""	611410	"""chromosome 6 open reading frame 32"""	C6orf32		9205841, 17150207, 17825087	Standard	NM_001286447		Approved	KIAA0386, DIFF48, MYONAP	uc003neo.1	Q9Y4F9	OTTHUMG00000014375	ENST00000510784.2:c.59G>A	6.37:g.25042096C>T	ENSP00000441305:p.Arg20Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHP2|Q13529|Q5VV37|Q5VV38|Q9BQ28	Missense_Mutation	SNP	NULL	p.R20Q	ENST00000510784.2	37	c.59		6	.	.	.	.	.	.	.	.	.	.	C	19.89	3.911366	0.72983	.	.	ENSG00000111913	ENST00000510784	T	0.13089	2.62	4.87	4.87	0.63330	.	.	.	.	.	T	0.20981	0.0505	.	.	.	0.80722	D	1	D	0.71674	0.998	D	0.75484	0.986	T	0.00956	-1.1501	8	0.24483	T	0.36	.	13.6959	0.62580	0.0:1.0:0.0:0.0	.	20	B7Z6U4	.	Q	20	ENSP00000441305:R20Q	ENSP00000441305:R20Q	R	-	2	0	FAM65B	25150075	1.000000	0.71417	1.000000	0.80357	0.985000	0.73830	3.505000	0.53356	2.676000	0.91093	0.563000	0.77884	CGG	FAM65B	-	NULL		0.537	FAM65B-201	KNOWN	basic	protein_coding	FAM65B	HGNC	protein_coding		C			25042096	-1	no_errors	ENST00000510784	ensembl	human	known	70_37	missense	SNP	1.000	T
FAM73A	374986	genome.wustl.edu	37	1	78245408	78245408	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:78245408G>T	ENST00000370791.3	+	1	100	c.68G>T	c.(67-69)gGc>gTc	p.G23V	FAM73A_ENST00000443751.2_Missense_Mutation_p.G23V|RNA5SP21_ENST00000410917.1_RNA	NM_001270384.1|NM_198549.3	NP_001257313.1|NP_940951.1	Q8NAN2	FA73A_HUMAN	family with sequence similarity 73, member A	23						integral component of membrane (GO:0016021)				breast(2)|kidney(2)|large_intestine(5)|lung(6)|ovary(2)|skin(1)|urinary_tract(1)	19				Colorectal(170;0.226)		GCTGTACCTGGCCTGGAGCTC	0.692																																																	0													5.0	5.0	5.0					1																	78245408		2143	4182	6325	SO:0001583	missense	374986				CCDS681.1, CCDS72809.1	1p31.1	2008-02-05			ENSG00000180488	ENSG00000180488			24741	protein-coding gene	gene with protein product							Standard	NM_001270384		Approved	FLJ35093	uc010ork.3	Q8NAN2	OTTHUMG00000009766	ENST00000370791.3:c.68G>T	1.37:g.78245408G>T	ENSP00000359827:p.Gly23Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6MZG0	Missense_Mutation	SNP	pfam_DUF2217	p.G23V	ENST00000370791.3	37	c.68	CCDS681.1	1	.	.	.	.	.	.	.	.	.	.	G	12.30	1.897885	0.33535	.	.	ENSG00000180488	ENST00000370791;ENST00000443751	T;T	0.39056	1.77;1.1	4.61	0.387	0.16259	.	0.980175	0.08281	N	0.969998	T	0.09423	0.0232	N	0.08118	0	0.09310	N	1	B;B;B	0.18968	0.032;0.019;0.019	B;B;B	0.21917	0.037;0.017;0.017	T	0.39563	-0.9608	10	0.87932	D	0	8.6355	7.5628	0.27862	0.0968:0.5115:0.3917:0.0	.	23;23;23	F8W7S1;B7ZLZ8;Q8NAN2	.;.;FA73A_HUMAN	V	23	ENSP00000359827:G23V;ENSP00000393675:G23V	ENSP00000359827:G23V	G	+	2	0	FAM73A	78017996	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.449000	0.21744	0.201000	0.20466	-0.172000	0.13284	GGC	FAM73A	-	NULL		0.692	FAM73A-001	KNOWN	basic|CCDS	protein_coding	FAM73A	HGNC	protein_coding	OTTHUMT00000026931.1	G	NM_198549		78245408	+1	no_errors	ENST00000370791	ensembl	human	known	70_37	missense	SNP	0.000	T
FCGBP	8857	genome.wustl.edu	37	19	40399385	40399385	+	Missense_Mutation	SNP	C	C	T	rs201168964		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:40399385C>T	ENST00000221347.6	-	13	6317	c.6310G>A	c.(6310-6312)Gga>Aga	p.G2104R		NM_003890.2	NP_003881.2	Q9Y6R7	FCGBP_HUMAN	Fc fragment of IgG binding protein	2104	VWFD 5. {ECO:0000255|PROSITE- ProRule:PRU00580}.					extracellular vesicular exosome (GO:0070062)				NS(3)|autonomic_ganglia(1)|breast(7)|central_nervous_system(5)|endometrium(13)|kidney(9)|large_intestine(27)|lung(49)|ovary(8)|pancreas(3)|prostate(13)|skin(9)|stomach(9)|upper_aerodigestive_tract(6)|urinary_tract(3)	165	all_cancers(60;6.03e-06)|all_lung(34;5.58e-08)|Lung NSC(34;6.62e-08)|Ovarian(47;0.06)		Epithelial(26;6.25e-23)|all cancers(26;1.13e-20)			AAGGGTGGTCCGTGGCAGGGT	0.597																																																	0													9.0	12.0	11.0					19																	40399385		1085	2084	3169	SO:0001583	missense	8857			D84239		19q13.2	2013-09-20			ENSG00000090920	ENSG00000275395			13572	protein-coding gene	gene with protein product	"""IgG Fc binding protein"", ""Human Fc gamma BP"""					9182547	Standard	NM_003890		Approved	FC(GAMMA)BP	uc002omp.4	Q9Y6R7	OTTHUMG00000182580	ENST00000221347.6:c.6310G>A	19.37:g.40399385C>T	ENSP00000221347:p.Gly2104Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	O95784	Missense_Mutation	SNP	pfam_VWF_type-D,pfam_Unchr_dom_Cys-rich,pfam_TIL_dom,superfamily_TIL_dom,smart_Fol_N,smart_VWF_type-D,smart_Unchr_dom_Cys-rich,smart_EG-like_dom,smart_VWF_C,smart_VWC_out	p.G2104R	ENST00000221347.6	37	c.6310	CCDS12546.1	19	.	.	.	.	.	.	.	.	.	.	C	0.241	-1.013596	0.02095	.	.	ENSG00000090920	ENST00000221347	T	0.59083	0.29	3.01	0.723	0.18231	von Willebrand factor, type D domain (3);	.	.	.	.	T	0.43389	0.1245	L	0.43923	1.385	0.09310	N	1	B	0.19445	0.036	B	0.10450	0.005	T	0.26780	-1.0093	9	0.28530	T	0.3	.	5.6999	0.17877	0.0:0.5011:0.0:0.4989	.	2104	Q9Y6R7	FCGBP_HUMAN	R	2104	ENSP00000221347:G2104R	ENSP00000221347:G2104R	G	-	1	0	FCGBP	45091225	0.000000	0.05858	0.002000	0.10522	0.254000	0.26022	-2.133000	0.01308	0.480000	0.27534	0.298000	0.19748	GGA	FCGBP	-	pfam_VWF_type-D,smart_VWF_type-D		0.597	FCGBP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FCGBP	HGNC	protein_coding	OTTHUMT00000462507.1	C	NM_003890		40399385	-1	no_errors	ENST00000221347	ensembl	human	known	70_37	missense	SNP	0.000	T
FSIP2	401024	genome.wustl.edu	37	2	186678497	186678497	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr2:186678497G>A	ENST00000424728.1	+	18	20053	c.20053G>A	c.(20053-20055)Gat>Aat	p.D6685N	FSIP2_ENST00000343098.5_Missense_Mutation_p.D6774N			Q5CZC0	FSIP2_HUMAN	fibrous sheath interacting protein 2	6685										NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(4)|kidney(1)|large_intestine(11)|lung(46)|pancreas(1)|urinary_tract(2)	69						AGTATTTGAAGATCAAGTGAA	0.338																																																	0													73.0	71.0	72.0					2																	186678497		1850	4091	5941	SO:0001583	missense	401024			AK092099	CCDS54426.1	2q32.1	2010-06-18			ENSG00000188738	ENSG00000188738			21675	protein-coding gene	gene with protein product		615796				14702039	Standard	NM_173651		Approved	FLJ34780	uc002upl.3	Q5CZC0	OTTHUMG00000153874	ENST00000424728.1:c.20053G>A	2.37:g.186678497G>A	ENSP00000401306:p.Asp6685Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53TL3|Q53TN5|Q5HYH2|Q6ZTZ5|Q6ZU14|Q6ZU21	Missense_Mutation	SNP	NULL	p.D6774N	ENST00000424728.1	37	c.20320		2	.	.	.	.	.	.	.	.	.	.	G	15.32	2.799775	0.50208	.	.	ENSG00000188738	ENST00000343098;ENST00000424728	T;T	0.47177	0.85;0.85	5.42	-0.76	0.11041	.	1.970080	0.02073	N	0.051727	T	0.33847	0.0877	L	0.43923	1.385	0.09310	N	1	.	.	.	.	.	.	T	0.03025	-1.1081	8	0.10111	T	0.7	.	1.2466	0.01974	0.2437:0.2735:0.3425:0.1404	.	.	.	.	N	6774;6685	ENSP00000344403:D6774N;ENSP00000401306:D6685N	ENSP00000344403:D6774N	D	+	1	0	FSIP2	186386742	0.000000	0.05858	0.000000	0.03702	0.025000	0.11179	-0.395000	0.07287	-0.331000	0.08501	-0.145000	0.13849	GAT	FSIP2	-	NULL		0.338	FSIP2-001	KNOWN	basic	protein_coding	FSIP2	HGNC	protein_coding	OTTHUMT00000332778.3	G	NM_173651		186678497	+1	no_errors	ENST00000343098	ensembl	human	known	70_37	missense	SNP	0.000	A
GHR	2690	genome.wustl.edu	37	5	42719347	42719347	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr5:42719347G>A	ENST00000230882.4	+	10	1928	c.1738G>A	c.(1738-1740)Ggg>Agg	p.G580R	GHR_ENST00000537449.1_Missense_Mutation_p.G393R|GHR_ENST00000357703.3_Missense_Mutation_p.G558R	NM_000163.4|NM_001242399.2|NM_001242400.2|NM_001242401.3|NM_001242402.2|NM_001242403.2|NM_001242404.2|NM_001242405.2|NM_001242406.2	NP_000154.1|NP_001229328.1|NP_001229329.1|NP_001229330.1|NP_001229331.1|NP_001229332.1|NP_001229333.1|NP_001229334.1|NP_001229335.1	P10912	GHR_HUMAN	growth hormone receptor	580					2-oxoglutarate metabolic process (GO:0006103)|activation of JAK2 kinase activity (GO:0042977)|activation of MAPK activity (GO:0000187)|allantoin metabolic process (GO:0000255)|cellular response to hormone stimulus (GO:0032870)|citrate metabolic process (GO:0006101)|creatine metabolic process (GO:0006600)|creatinine metabolic process (GO:0046449)|endocytosis (GO:0006897)|fatty acid metabolic process (GO:0006631)|growth hormone receptor signaling pathway (GO:0060396)|insulin-like growth factor receptor signaling pathway (GO:0048009)|isoleucine metabolic process (GO:0006549)|JAK-STAT cascade (GO:0007259)|JAK-STAT cascade involved in growth hormone signaling pathway (GO:0060397)|multicellular organismal metabolic process (GO:0044236)|oxaloacetate metabolic process (GO:0006107)|positive regulation of multicellular organism growth (GO:0040018)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|receptor internalization (GO:0031623)|regulation of multicellular organism growth (GO:0040014)|response to cycloheximide (GO:0046898)|response to estradiol (GO:0032355)|succinate metabolic process (GO:0006105)|taurine metabolic process (GO:0019530)|valine metabolic process (GO:0006573)	cell surface (GO:0009986)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|growth hormone receptor complex (GO:0070195)|integral component of membrane (GO:0016021)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	cytokine receptor activity (GO:0004896)|growth factor binding (GO:0019838)|peptide hormone binding (GO:0017046)|proline-rich region binding (GO:0070064)|protein homodimerization activity (GO:0042803)|protein kinase binding (GO:0019901)			NS(2)|endometrium(2)|kidney(3)|large_intestine(8)|lung(19)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	39		Myeloproliferative disorder(839;0.00878)			Pegvisomant(DB00082)|Somatropin recombinant(DB00052)	TGGGAGGCCTGGGACAGGAGA	0.502																																																	0													96.0	81.0	86.0					5																	42719347		2203	4300	6503	SO:0001583	missense	2690				CCDS3940.1, CCDS56364.1, CCDS75239.1, CCDS75240.1	5p14-p12	2013-03-25			ENSG00000112964	ENSG00000112964		"""Fibronectin type III domain containing"""	4263	protein-coding gene	gene with protein product	"""growth hormone binding protein"""	600946					Standard	NM_001242460		Approved	GHBP	uc003jmt.3	P10912	OTTHUMG00000094791	ENST00000230882.4:c.1738G>A	5.37:g.42719347G>A	ENSP00000230882:p.Gly580Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9HCX2	Missense_Mutation	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,pfscan_Fibronectin_type3	p.G580R	ENST00000230882.4	37	c.1738	CCDS3940.1	5	.	.	.	.	.	.	.	.	.	.	G	11.70	1.717117	0.30413	.	.	ENSG00000112964	ENST00000230882;ENST00000357703;ENST00000537449	T;T;T	0.36878	1.23;1.23;1.23	6.08	5.21	0.72293	.	0.409721	0.31760	N	0.007118	T	0.58018	0.2093	M	0.84948	2.725	0.09310	N	0.999998	D	0.55605	0.972	D	0.68192	0.956	T	0.53732	-0.8397	10	0.24483	T	0.36	-1.3023	9.7107	0.40243	0.0697:0.0:0.7891:0.1412	.	580	P10912	GHR_HUMAN	R	580;558;393	ENSP00000230882:G580R;ENSP00000350335:G558R;ENSP00000442206:G393R	ENSP00000230882:G580R	G	+	1	0	GHR	42755104	0.244000	0.23889	0.131000	0.22000	0.698000	0.40448	2.286000	0.43496	2.894000	0.99253	0.591000	0.81541	GGG	GHR	-	NULL		0.502	GHR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GHR	HGNC	protein_coding	OTTHUMT00000211605.2	G	NM_000163		42719347	+1	no_errors	ENST00000230882	ensembl	human	known	70_37	missense	SNP	0.189	A
GPRIN2	9721	genome.wustl.edu	37	10	46999178	46999178	+	Missense_Mutation	SNP	A	A	C	rs7090312	byFrequency	TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr10:46999178A>C	ENST00000374317.1	+	3	571	c.298A>C	c.(298-300)Acc>Ccc	p.T100P	GPRIN2_ENST00000374314.4_Missense_Mutation_p.T100P	NM_014696.3	NP_055511.2	O60269	GRIN2_HUMAN	G protein regulated inducer of neurite outgrowth 2	100			T -> P (in dbSNP:rs7090312).							breast(2)|central_nervous_system(1)|endometrium(6)|kidney(1)|large_intestine(1)|lung(6)|prostate(1)	18						CAATGTGTCCACCATGGGCGG	0.657																																																	0													29.0	31.0	31.0					10																	46999178		2193	4285	6478	SO:0001583	missense	9721			BC011672	CCDS73101.1	10q11.22	2006-08-24	2006-08-24	2006-08-24	ENSG00000204175	ENSG00000204175			23730	protein-coding gene	gene with protein product		611240	"""KIAA0514"""	KIAA0514		9628581	Standard	NM_014696		Approved	MGC15171	uc001jec.3	O60269	OTTHUMG00000018107	ENST00000374317.1:c.298A>C	10.37:g.46999178A>C	ENSP00000363436:p.Thr100Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5SVF0	Missense_Mutation	SNP	NULL	p.T100P	ENST00000374317.1	37	c.298	CCDS31192.1	10	.	.	.	.	.	.	.	.	.	.	A	14.26	2.481989	0.44147	.	.	ENSG00000204175	ENST00000374317;ENST00000374314	T;T	0.03635	3.86;3.86	5.57	-1.01	0.10169	.	0.659438	0.13433	N	0.388285	T	0.03959	0.0111	M	0.65975	2.015	0.09310	N	1	B	0.06786	0.001	B	0.09377	0.004	T	0.40478	-0.9561	10	0.42905	T	0.14	-4.1201	1.1261	0.01735	0.3231:0.1696:0.3426:0.1646	rs7090312	100	O60269	GRIN2_HUMAN	P	100	ENSP00000363436:T100P;ENSP00000363433:T100P	ENSP00000363433:T100P	T	+	1	0	GPRIN2	46419184	0.000000	0.05858	0.005000	0.12908	0.978000	0.69477	0.003000	0.13083	0.152000	0.19188	0.528000	0.53228	ACC	GPRIN2	-	NULL		0.657	GPRIN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPRIN2	HGNC	protein_coding	OTTHUMT00000047836.1	A	NM_014696		46999178	+1	no_errors	ENST00000374314	ensembl	human	known	70_37	missense	SNP	0.084	C
GRIK5	2901	genome.wustl.edu	37	19	42507726	42507726	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:42507726C>T	ENST00000262895.3	-	17	2372	c.2373G>A	c.(2371-2373)gaG>gaA	p.E791E	GRIK5_ENST00000593562.1_Silent_p.E791E|GRIK5_ENST00000301218.4_Silent_p.E791E	NM_002088.4	NP_002079.3	Q16478	GRIK5_HUMAN	glutamate receptor, ionotropic, kainate 5	791					cellular response to glucose stimulus (GO:0071333)|establishment of localization in cell (GO:0051649)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|positive regulation of neuron apoptotic process (GO:0043525)|protein retention in ER lumen (GO:0006621)|receptor clustering (GO:0043113)|regulation of excitatory postsynaptic membrane potential (GO:0060079)|regulation of synaptic vesicle fusion to presynaptic membrane (GO:0031630)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	cell junction (GO:0030054)|dendrite (GO:0030425)|endoplasmic reticulum (GO:0005783)|kainate selective glutamate receptor complex (GO:0032983)|perikaryon (GO:0043204)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|presynaptic membrane (GO:0042734)|terminal bouton (GO:0043195)	extracellular-glutamate-gated ion channel activity (GO:0005234)|kainate selective glutamate receptor activity (GO:0015277)			breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(8)|liver(1)|lung(11)|ovary(2)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)	35		Prostate(69;0.059)				GATGGTCCTCCTCCTTGGGGC	0.637																																																	0													81.0	67.0	72.0					19																	42507726		2203	4300	6503	SO:0001819	synonymous_variant	2901				CCDS12595.1	19q13.2	2012-08-29			ENSG00000105737	ENSG00000105737		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4583	protein-coding gene	gene with protein product		600283		GRIK2		7527545	Standard	NM_002088		Approved	GluK5, KA2	uc002osj.2	Q16478	OTTHUMG00000044573	ENST00000262895.3:c.2373G>A	19.37:g.42507726C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WWG8	Silent	SNP	pfam_ANF_lig-bd_rcpt,pfam_Iontro_glu_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.E791	ENST00000262895.3	37	c.2373	CCDS12595.1	19	.	.	.	.	.	.	.	.	.	.	C	8.182	0.794011	0.16327	.	.	ENSG00000105737	ENST00000454993	.	.	.	4.44	2.23	0.28157	.	.	.	.	.	T	0.56062	0.1960	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.49969	-0.8882	4	.	.	.	.	8.043	0.30532	0.0:0.7785:0.0:0.2215	.	.	.	.	R	168	.	.	G	-	1	0	GRIK5	47199566	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	0.914000	0.28624	0.770000	0.33336	0.555000	0.69702	GGA	GRIK5	-	pfam_Iontro_glu_rcpt		0.637	GRIK5-002	KNOWN	basic|appris_principal|CCDS	protein_coding	GRIK5	HGNC	protein_coding	OTTHUMT00000463453.1	C			42507726	-1	no_errors	ENST00000301218	ensembl	human	known	70_37	silent	SNP	1.000	T
HRH4	59340	genome.wustl.edu	37	18	22040735	22040735	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr18:22040735C>T	ENST00000256906.4	+	1	143	c.43C>T	c.(43-45)Cgt>Tgt	p.R15C	HRH4_ENST00000426880.2_Missense_Mutation_p.R15C	NM_001160166.1|NM_021624.3	NP_001153638.1|NP_067637.2	Q9H3N8	HRH4_HUMAN	histamine receptor H4	15					inflammatory response (GO:0006954)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|regulation of MAPK cascade (GO:0043408)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	histamine receptor activity (GO:0004969)			endometrium(2)|kidney(1)|large_intestine(4)|lung(10)|ovary(2)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	22	all_cancers(21;0.000545)|all_epithelial(16;6.56e-06)|Lung NSC(20;0.0027)|all_lung(20;0.0085)|Colorectal(14;0.0361)|Ovarian(20;0.0991)				Amitriptyline(DB00321)|Amoxapine(DB00543)|Chlorpromazine(DB00477)|Clozapine(DB00363)|Doxepin(DB01142)|Histamine Phosphate(DB00667)|Loxapine(DB00408)|Mianserin(DB06148)|Olanzapine(DB00334)	ACTAAGCACTCGTGTTACTTT	0.348																																																	0													214.0	180.0	192.0					18																	22040735		2202	4299	6501	SO:0001583	missense	59340			AF312230	CCDS11887.1, CCDS45841.1	18q11.2	2012-08-08			ENSG00000134489	ENSG00000134489		"""GPCR / Class A : Histamine receptors"""	17383	protein-coding gene	gene with protein product		606792				11118334, 10973974	Standard	NM_021624		Approved	H4R, HH4R, AXOR35, GPCR105, GPRv53	uc002kvi.3	Q9H3N8	OTTHUMG00000131945	ENST00000256906.4:c.43C>T	18.37:g.22040735C>T	ENSP00000256906:p.Arg15Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B0YJ19|B2KJ48|Q4G0I6|Q9GZQ0	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,prints_Histamine_H4_recept,prints_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM	p.R15C	ENST00000256906.4	37	c.43	CCDS11887.1	18	.	.	.	.	.	.	.	.	.	.	C	10.66	1.413806	0.25465	.	.	ENSG00000134489	ENST00000256906;ENST00000426880	T;T	0.39406	1.08;1.08	5.64	-7.93	0.01156	.	3.664910	0.00575	N	0.000309	T	0.18215	0.0437	N	0.08118	0	0.09310	N	1	B;B;B	0.16802	0.019;0.001;0.002	B;B;B	0.06405	0.002;0.0;0.001	T	0.12785	-1.0534	10	0.56958	D	0.05	21.8006	1.7589	0.02988	0.4868:0.1331:0.171:0.2091	.	15;15;15	B2KJ49;B2KJ48;Q9H3N8	.;.;HRH4_HUMAN	C	15	ENSP00000256906:R15C;ENSP00000402526:R15C	ENSP00000256906:R15C	R	+	1	0	HRH4	20294733	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-0.609000	0.05635	-1.097000	0.03042	-0.911000	0.02809	CGT	HRH4	-	NULL		0.348	HRH4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRH4	HGNC	protein_coding	OTTHUMT00000254904.1	C			22040735	+1	no_errors	ENST00000256906	ensembl	human	known	70_37	missense	SNP	0.000	T
HRNR	388697	genome.wustl.edu	37	1	152189050	152189050	+	Silent	SNP	C	C	T	rs576397826	byFrequency	TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:152189050C>T	ENST00000368801.2	-	3	5130	c.5055G>A	c.(5053-5055)tcG>tcA	p.S1685S	FLG-AS1_ENST00000593011.1_RNA|FLG-AS1_ENST00000420707.1_RNA	NM_001009931.1	NP_001009931.1	Q86YZ3	HORN_HUMAN	hornerin	1685					establishment of skin barrier (GO:0061436)|hematopoietic progenitor cell differentiation (GO:0002244)|keratinization (GO:0031424)	cornified envelope (GO:0001533)|extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)			autonomic_ganglia(1)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(22)|haematopoietic_and_lymphoid_tissue(1)|kidney(11)|large_intestine(19)|liver(1)|lung(84)|ovary(5)|prostate(6)|skin(12)|stomach(9)|upper_aerodigestive_tract(5)|urinary_tract(6)	192	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			AGCGGGAAGACGAACGTGAGC	0.612													c|||	7	0.00139776	0.0023	0.0043	5008	,	,		20352	0.0		0.001	False		,,,				2504	0.0																0													53.0	1.0	21.0					1																	152189050		1031	1668	2699	SO:0001819	synonymous_variant	388697			AB104446	CCDS30859.1	1q21.3	2013-01-10			ENSG00000197915	ENSG00000197915		"""EF-hand domain containing"""	20846	protein-coding gene	gene with protein product	"""filaggrin family member 3"""						Standard	NM_001009931		Approved	S100a18, S100A16, FLG3	uc001ezt.2	Q86YZ3	OTTHUMG00000012243	ENST00000368801.2:c.5055G>A	1.37:g.152189050C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5DT20|Q5U1F4	Silent	SNP	pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2	p.S1685	ENST00000368801.2	37	c.5055	CCDS30859.1	1																																																																																			HRNR	-	NULL		0.612	HRNR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HRNR	HGNC	protein_coding	OTTHUMT00000034016.1	C	XM_373868		152189050	-1	no_errors	ENST00000368801	ensembl	human	known	70_37	silent	SNP	0.000	T
ICA1	3382	genome.wustl.edu	37	7	8272304	8272304	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr7:8272304C>T	ENST00000402384.3	-	3	365	c.99G>A	c.(97-99)acG>acA	p.T33T	ICA1_ENST00000422063.2_Silent_p.T33T|ICA1_ENST00000396675.3_Silent_p.T33T|ICA1_ENST00000265577.7_Silent_p.T32T|ICA1_ENST00000407906.1_Silent_p.T33T|ICA1_ENST00000406470.2_Silent_p.T33T|ICA1_ENST00000401396.1_Silent_p.T21T			Q05084	ICA69_HUMAN	islet cell autoantigen 1, 69kDa	33					neurotransmitter transport (GO:0006836)	cell junction (GO:0030054)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|Golgi membrane (GO:0000139)|secretory granule membrane (GO:0030667)|synaptic vesicle membrane (GO:0030672)		p.T33T(1)		breast(1)|central_nervous_system(2)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(6)|lung(8)|urinary_tract(1)	23		Ovarian(82;0.0612)		UCEC - Uterine corpus endometrioid carcinoma (126;0.246)		AGGCCTGCTTCGTCTCCCAAT	0.428																																																	1	Substitution - coding silent(1)	kidney(1)											184.0	158.0	167.0					7																	8272304		2203	4300	6503	SO:0001819	synonymous_variant	3382				CCDS34602.1, CCDS64595.1	7p22	2006-12-13	2002-08-29		ENSG00000003147	ENSG00000003147			5343	protein-coding gene	gene with protein product		147625	"""islet cell autoantigen 1 (69kD)"""			7918678, 8777998	Standard	NM_001276478		Approved	ICAp69	uc003srm.3	Q05084	OTTHUMG00000152008	ENST00000402384.3:c.99G>A	7.37:g.8272304C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K7U1|B3FTQ2|P78506|Q13824|Q96HG3	Silent	SNP	pfam_Arfaptin_homology_dom,pfam_Islet_autoAg_Ica1_C,pfscan_Arfaptin_homology_dom	p.T33	ENST00000402384.3	37	c.99	CCDS34602.1	7																																																																																			ICA1	-	pfam_Arfaptin_homology_dom		0.428	ICA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ICA1	HGNC	protein_coding	OTTHUMT00000324793.1	C	NM_004968		8272304	-1	no_errors	ENST00000422063	ensembl	human	known	70_37	silent	SNP	0.045	T
ITPK1	3705	genome.wustl.edu	37	14	93424612	93424612	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr14:93424612C>T	ENST00000267615.6	-	8	777	c.604G>A	c.(604-606)Gtg>Atg	p.V202M	ITPK1_ENST00000555495.1_Missense_Mutation_p.V83M|ITPK1_ENST00000556954.1_5'UTR|ITPK1_ENST00000556603.2_Missense_Mutation_p.V202M|ITPK1_ENST00000354313.3_Missense_Mutation_p.V202M			Q13572	ITPK1_HUMAN	inositol-tetrakisphosphate 1-kinase	202	ATP-grasp. {ECO:0000255|PROSITE- ProRule:PRU00409}.				blood coagulation (GO:0007596)|dephosphorylation (GO:0016311)|inositol phosphate metabolic process (GO:0043647)|inositol trisphosphate metabolic process (GO:0032957)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	ATP binding (GO:0005524)|catalytic activity (GO:0003824)|inositol tetrakisphosphate 1-kinase activity (GO:0047325)|inositol-1,3,4,5,6-pentakisphosphate 1-phosphatase activity (GO:0052825)|inositol-1,3,4,6-tetrakisphosphate 1-phosphatase activity (GO:0052831)|inositol-1,3,4,6-tetrakisphosphate 6-phosphatase activity (GO:0052830)|inositol-1,3,4-trisphosphate 5-kinase activity (GO:0052726)|inositol-1,3,4-trisphosphate 6-kinase activity (GO:0052725)|inositol-3,4,6-trisphosphate 1-kinase activity (GO:0052835)|isomerase activity (GO:0016853)|magnesium ion binding (GO:0000287)			endometrium(1)|large_intestine(3)|lung(6)|ovary(1)	11		all_cancers(154;0.077)|all_epithelial(191;0.247)		Epithelial(152;0.124)|all cancers(159;0.169)		TCGCCAACCACGAACACCTTG	0.562																																																	0													174.0	143.0	154.0					14																	93424612		2203	4300	6503	SO:0001583	missense	3705			U51336	CCDS9907.1, CCDS45157.1	14q32.12	2012-08-16	2011-04-28		ENSG00000100605	ENSG00000100605	2.7.1.134		6177	protein-coding gene	gene with protein product		601838	"""inositol 1,3,4-triphosphate 5/6 kinase"""			8662638, 11042108	Standard	NM_014216		Approved		uc001ybh.3	Q13572	OTTHUMG00000171226	ENST00000267615.6:c.604G>A	14.37:g.93424612C>T	ENSP00000267615:p.Val202Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BTL6|Q9H2E7	Missense_Mutation	SNP	pfam_Inositol_tetrakis-P_1-kinase	p.V202M	ENST00000267615.6	37	c.604	CCDS9907.1	14	.	.	.	.	.	.	.	.	.	.	C	33	5.245454	0.95272	.	.	ENSG00000100605	ENST00000354313;ENST00000405174;ENST00000556603;ENST00000555495;ENST00000267615;ENST00000311458;ENST00000554999;ENST00000556185	T	0.11930	2.73	5.22	5.22	0.72569	ATP-grasp fold (1);	0.126294	0.53938	D	0.000056	T	0.39963	0.1098	M	0.87269	2.87	0.80722	D	1	D;D	0.69078	0.997;0.996	P;P	0.56865	0.808;0.653	T	0.49428	-0.8941	10	0.87932	D	0	-25.6396	18.8139	0.92070	0.0:1.0:0.0:0.0	.	202;202	Q13572;Q13572-2	ITPK1_HUMAN;.	M	202;232;202;83;202;202;160;220	ENSP00000346272:V202M	ENSP00000267615:V202M	V	-	1	0	ITPK1	92494365	1.000000	0.71417	0.997000	0.53966	0.985000	0.73830	7.665000	0.83852	2.432000	0.82394	0.655000	0.94253	GTG	ITPK1	-	pfam_Inositol_tetrakis-P_1-kinase		0.562	ITPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ITPK1	HGNC	protein_coding	OTTHUMT00000412421.2	C	NM_014216		93424612	-1	no_errors	ENST00000267615	ensembl	human	known	70_37	missense	SNP	1.000	T
KCNT1	57582	genome.wustl.edu	37	9	138657024	138657024	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr9:138657024G>A	ENST00000263604.3	+	12	1126	c.1126G>A	c.(1126-1128)Gcc>Acc	p.A376T	KCNT1_ENST00000490355.2_Missense_Mutation_p.A376T|KCNT1_ENST00000487664.1_Missense_Mutation_p.A350T|KCNT1_ENST00000488444.2_Missense_Mutation_p.A376T|KCNT1_ENST00000491806.2_Missense_Mutation_p.A362T|KCNT1_ENST00000298480.5_Missense_Mutation_p.A395T|KCNT1_ENST00000486577.2_Missense_Mutation_p.A356T|KCNT1_ENST00000371757.2_Missense_Mutation_p.A395T			Q5JUK3	KCNT1_HUMAN	potassium channel, subfamily T, member 1	376					potassium ion transmembrane transport (GO:0071805)	voltage-gated potassium channel complex (GO:0008076)	calcium-activated potassium channel activity (GO:0015269)|voltage-gated potassium channel activity (GO:0005249)			breast(2)|central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(8)|lung(18)|ovary(1)|pancreas(3)|prostate(5)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	50		Myeloproliferative disorder(178;0.0821)		OV - Ovarian serous cystadenocarcinoma(145;2.11e-07)|Epithelial(140;1.57e-06)|all cancers(34;9.22e-05)		CGAGTTCTACGCCCACCCCCG	0.637																																																	0													160.0	150.0	153.0					9																	138657024		2203	4300	6503	SO:0001583	missense	57582			AB037843	CCDS35175.1, CCDS35175.2, CCDS65188.1	9q34.3	2012-07-05			ENSG00000107147	ENSG00000107147		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18865	protein-coding gene	gene with protein product		608167				10718198, 16382103	Standard	NM_020822		Approved	KCa4.1, KIAA1422	uc011mdq.2	Q5JUK3	OTTHUMG00000020917	ENST00000263604.3:c.1126G>A	9.37:g.138657024G>A	ENSP00000263604:p.Ala376Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KXF7|B7ZVY4|B9EGP2|G5E9V0|Q9P2C5	Missense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2	p.A395T	ENST00000263604.3	37	c.1183		9	.	.	.	.	.	.	.	.	.	.	G	28.0	4.879438	0.91740	.	.	ENSG00000107147	ENST00000487664;ENST00000298480;ENST00000371757;ENST00000486577;ENST00000491806;ENST00000488444;ENST00000490355;ENST00000263604	T;T;T;T	0.23552	1.9;1.9;1.9;1.9	4.21	4.21	0.49690	NAD(P)-binding domain (1);	0.000000	0.85682	U	0.000000	T	0.52025	0.1709	M	0.78916	2.43	0.80722	D	1	D;D;D;P	0.89917	0.999;0.999;1.0;0.883	D;D;D;B	0.76575	0.988;0.963;0.983;0.371	T	0.59451	-0.7452	10	0.72032	D	0.01	-46.5416	15.713	0.77646	0.0:0.0:1.0:0.0	.	362;395;350;376	C9JYL2;B9EGP2;G5E9V0;Q5JUK3	.;.;.;KCNT1_HUMAN	T	350;395;395;356;362;376;376;376	ENSP00000417851:A350T;ENSP00000298480:A395T;ENSP00000360822:A395T;ENSP00000263604:A376T	ENSP00000263604:A376T	A	+	1	0	KCNT1	137796845	1.000000	0.71417	0.949000	0.38748	0.926000	0.56050	9.285000	0.95894	2.181000	0.69327	0.462000	0.41574	GCC	KCNT1	-	NULL		0.637	KCNT1-201	KNOWN	basic|appris_candidate	protein_coding	KCNT1	HGNC	protein_coding		G	NM_020822		138657024	+1	no_errors	ENST00000298480	ensembl	human	known	70_37	missense	SNP	1.000	A
KCNU1	157855	genome.wustl.edu	37	8	36780037	36780037	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr8:36780037C>T	ENST00000399881.3	+	24	2663	c.2626C>T	c.(2626-2628)Cag>Tag	p.Q876*		NM_001031836.2	NP_001027006.2	A8MYU2	KCNU1_HUMAN	potassium channel, subfamily U, member 1	876					multicellular organism reproduction (GO:0032504)|potassium ion transmembrane transport (GO:0071805)|single fertilization (GO:0007338)|sperm-egg recognition (GO:0035036)	plasma membrane (GO:0005886)|voltage-gated potassium channel complex (GO:0008076)	large conductance calcium-activated potassium channel activity (GO:0060072)|potassium channel activity (GO:0005267)|voltage-gated potassium channel activity (GO:0005249)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(1)|large_intestine(9)|lung(31)|ovary(1)|urinary_tract(1)	57				KIRC - Kidney renal clear cell carcinoma(67;0.0504)|Kidney(114;0.0634)		CTTTATTGAACAGCTTGGTGG	0.448																																																	0													135.0	133.0	134.0					8																	36780037		1927	4132	6059	SO:0001587	stop_gained	157855			BC028701	CCDS55220.1	8p11.2	2012-07-05				ENSG00000215262		"""Potassium channels"", ""Voltage-gated ion channels / Potassium channels, calcium-activated"""	18867	protein-coding gene	gene with protein product		615215				16382103	Standard	NM_001031836		Approved	KCa5.1, Slo3, KCNMC1, Kcnma3	uc010lvw.3	A8MYU2		ENST00000399881.3:c.2626C>T	8.37:g.36780037C>T	ENSP00000382770:p.Gln876*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_K_chnl_Ca-activ_BK_asu,pfam_Ion_trans_2,prints_K_chnl_Ca-activ_BK_asu	p.Q876*	ENST00000399881.3	37	c.2626	CCDS55220.1	8	.	.	.	.	.	.	.	.	.	.	C	36	5.703844	0.96812	.	.	ENSG00000215262	ENST00000399881	.	.	.	5.32	5.32	0.75619	.	0.323197	0.23373	U	0.048881	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	-14.8866	12.3074	0.54910	0.0:0.8297:0.1703:0.0	.	.	.	.	X	876	.	ENSP00000382770:Q876X	Q	+	1	0	KCNU1	36899195	0.244000	0.23889	0.996000	0.52242	0.363000	0.29612	1.862000	0.39448	2.485000	0.83878	0.655000	0.94253	CAG	KCNU1	-	NULL		0.448	KCNU1-001	KNOWN	non_canonical_conserved|basic|appris_principal|CCDS	protein_coding	KCNU1	HGNC	protein_coding	OTTHUMT00000376631.1	C	NM_001031836		36780037	+1	no_errors	ENST00000399881	ensembl	human	known	70_37	nonsense	SNP	0.761	T
KIAA1731	85459	genome.wustl.edu	37	11	93431613	93431613	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr11:93431613G>A	ENST00000325212.6	+	15	3697	c.3535G>A	c.(3535-3537)Gct>Act	p.A1179T	KIAA1731_ENST00000531700.1_Intron|KIAA1731_ENST00000411936.1_Missense_Mutation_p.A1179T|KIAA1731_ENST00000344196.4_5'UTR			Q9C0D2	K1731_HUMAN	KIAA1731	1179						centrosome (GO:0005813)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)				breast(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)	11		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00824)				AATACTTGGTGCTAAAGAAGG	0.413																																																	0													55.0	48.0	51.0					11																	93431613		692	1591	2283	SO:0001583	missense	85459			AB051518	CCDS44708.1	11q21	2014-03-11			ENSG00000166004	ENSG00000166004			29366	protein-coding gene	gene with protein product						20844083	Standard	NM_033395		Approved		uc009ywb.1	Q9C0D2	OTTHUMG00000167449	ENST00000325212.6:c.3535G>A	11.37:g.93431613G>A	ENSP00000316681:p.Ala1179Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J5H9|C9JQY8|Q8N7L4|Q8N919|Q8N9B0|Q96LT8	Missense_Mutation	SNP	NULL	p.A1179T	ENST00000325212.6	37	c.3535	CCDS44708.1	11	.	.	.	.	.	.	.	.	.	.	G	1.610	-0.524308	0.04141	.	.	ENSG00000166004	ENST00000325212;ENST00000411936	T;T	0.11930	2.74;2.73	4.96	-1.55	0.08558	.	2.211930	0.02141	N	0.057174	T	0.12646	0.0307	L	0.49778	1.585	0.09310	N	0.999998	B	0.16396	0.017	B	0.10450	0.005	T	0.35201	-0.9798	10	0.52906	T	0.07	1.9205	1.2586	0.01996	0.3274:0.1409:0.3876:0.1441	.	1179	Q9C0D2	K1731_HUMAN	T	1179	ENSP00000316681:A1179T;ENSP00000406505:A1179T	ENSP00000316681:A1179T	A	+	1	0	KIAA1731	93071261	0.001000	0.12720	0.004000	0.12327	0.029000	0.11900	0.512000	0.22755	0.031000	0.15407	-0.908000	0.02827	GCT	KIAA1731	-	NULL		0.413	KIAA1731-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	KIAA1731	HGNC	protein_coding	OTTHUMT00000394640.1	G	NM_033395		93431613	+1	no_errors	ENST00000411936	ensembl	human	known	70_37	missense	SNP	0.000	A
KIFC1	3833	genome.wustl.edu	37	6	33373178	33373178	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr6:33373178C>T	ENST00000428849.2	+	7	1756	c.1306C>T	c.(1306-1308)Cgg>Tgg	p.R436W		NM_002263.3	NP_002254.2	Q9BW19	KIFC1_HUMAN	kinesin family member C1	436	Kinesin motor. {ECO:0000255|PROSITE- ProRule:PRU00283}.				ATP catabolic process (GO:0006200)|blood coagulation (GO:0007596)|metabolic process (GO:0008152)|microtubule-based movement (GO:0007018)|mitotic sister chromatid segregation (GO:0000070)|spindle assembly (GO:0051225)	endosome (GO:0005768)|kinesin complex (GO:0005871)|membrane (GO:0016020)|microtubule (GO:0005874)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)|minus-end-directed microtubule motor activity (GO:0008569)			endometrium(1)|kidney(1)|large_intestine(1)|lung(6)|prostate(3)|skin(1)	13						GCTGATCCCTCGGGCCCTGCG	0.582																																																	0													41.0	43.0	42.0					6																	33373178		2203	4300	6503	SO:0001583	missense	3833			D14678	CCDS34430.1	6p21.32	2014-05-15	2003-01-09	2003-01-10	ENSG00000237649	ENSG00000237649		"""Kinesins"""	6389	protein-coding gene	gene with protein product		603763	"""kinesin-like 2"""	KNSL2		8276466	Standard	NM_002263		Approved	HSET	uc003oef.4	Q9BW19	OTTHUMG00000031209	ENST00000428849.2:c.1306C>T	6.37:g.33373178C>T	ENSP00000393963:p.Arg436Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	O60887|Q14834|Q4KMP0|Q5SU09|Q6GMS7|Q6P4A5|Q9UQP7	Missense_Mutation	SNP	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom,prints_Kinesin_motor_dom	p.R436W	ENST00000428849.2	37	c.1306	CCDS34430.1	6	.	.	.	.	.	.	.	.	.	.	C	16.23	3.064953	0.55432	.	.	ENSG00000237649	ENST00000428849	T	0.52983	0.64	5.08	3.19	0.36642	Kinesin, motor domain (4);	0.063724	0.64402	D	0.000010	T	0.76622	0.4013	H	0.99454	4.575	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.84613	0.0679	10	0.87932	D	0	-10.0117	11.2574	0.49063	0.4549:0.5451:0.0:0.0	.	428;436	B4E063;Q9BW19	.;KIFC1_HUMAN	W	436	ENSP00000393963:R436W	ENSP00000393963:R436W	R	+	1	2	KIFC1	33481156	0.490000	0.26012	0.998000	0.56505	0.715000	0.41141	0.845000	0.27668	1.337000	0.45525	0.655000	0.94253	CGG	KIFC1	-	pfam_Kinesin_motor_dom,smart_Kinesin_motor_dom,pfscan_Kinesin_motor_dom		0.582	KIFC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KIFC1	HGNC	protein_coding	OTTHUMT00000076417.1	C	NM_002263		33373178	+1	no_errors	ENST00000428849	ensembl	human	known	70_37	missense	SNP	0.974	T
KIT	3815	genome.wustl.edu	37	4	55594198	55594198	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr4:55594198G>A	ENST00000288135.5	+	13	1998	c.1901G>A	c.(1900-1902)cGg>cAg	p.R634Q		NM_000222.2|NM_001093772.1	NP_000213.1|NP_001087241.1	P10721	KIT_HUMAN	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	634	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				actin cytoskeleton reorganization (GO:0031532)|activation of MAPK activity (GO:0000187)|cell chemotaxis (GO:0060326)|cellular response to thyroid hormone stimulus (GO:0097067)|cytokine-mediated signaling pathway (GO:0019221)|dendritic cell cytokine production (GO:0002371)|detection of mechanical stimulus involved in sensory perception of sound (GO:0050910)|digestive tract development (GO:0048565)|ectopic germ cell programmed cell death (GO:0035234)|embryonic hemopoiesis (GO:0035162)|epidermal growth factor receptor signaling pathway (GO:0007173)|epithelial cell proliferation (GO:0050673)|erythrocyte differentiation (GO:0030218)|erythropoietin-mediated signaling pathway (GO:0038162)|Fc receptor signaling pathway (GO:0038093)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|germ cell migration (GO:0008354)|glycosphingolipid metabolic process (GO:0006687)|hemopoiesis (GO:0030097)|immature B cell differentiation (GO:0002327)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|Kit signaling pathway (GO:0038109)|lamellipodium assembly (GO:0030032)|lymphoid progenitor cell differentiation (GO:0002320)|male gonad development (GO:0008584)|mast cell chemotaxis (GO:0002551)|mast cell cytokine production (GO:0032762)|mast cell degranulation (GO:0043303)|mast cell differentiation (GO:0060374)|mast cell proliferation (GO:0070662)|megakaryocyte development (GO:0035855)|melanocyte adhesion (GO:0097326)|melanocyte differentiation (GO:0030318)|melanocyte migration (GO:0097324)|myeloid progenitor cell differentiation (GO:0002318)|negative regulation of programmed cell death (GO:0043069)|neurotrophin TRK receptor signaling pathway (GO:0048011)|ovarian follicle development (GO:0001541)|peptidyl-tyrosine phosphorylation (GO:0018108)|phosphatidylinositol-mediated signaling (GO:0048015)|pigmentation (GO:0043473)|positive regulation of cell migration (GO:0030335)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of long-term neuronal synaptic plasticity (GO:0048170)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of Notch signaling pathway (GO:0045747)|positive regulation of phosphatidylinositol 3-kinase activity (GO:0043552)|positive regulation of phosphatidylinositol 3-kinase signaling (GO:0014068)|positive regulation of phospholipase C activity (GO:0010863)|positive regulation of pseudopodium assembly (GO:0031274)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of tyrosine phosphorylation of Stat1 protein (GO:0042511)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|positive regulation of tyrosine phosphorylation of Stat5 protein (GO:0042523)|protein autophosphorylation (GO:0046777)|regulation of cell proliferation (GO:0042127)|regulation of cell shape (GO:0008360)|regulation of developmental pigmentation (GO:0048070)|signal transduction (GO:0007165)|signal transduction by phosphorylation (GO:0023014)|somatic stem cell division (GO:0048103)|somatic stem cell maintenance (GO:0035019)|spermatid development (GO:0007286)|spermatogenesis (GO:0007283)|stem cell differentiation (GO:0048863)|stem cell maintenance (GO:0019827)|T cell differentiation (GO:0030217)|visual learning (GO:0008542)	acrosomal vesicle (GO:0001669)|cell-cell junction (GO:0005911)|cytoplasmic side of plasma membrane (GO:0009898)|external side of plasma membrane (GO:0009897)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)|mast cell granule (GO:0042629)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|cytokine binding (GO:0019955)|metal ion binding (GO:0046872)|protein homodimerization activity (GO:0042803)|protein tyrosine kinase activity (GO:0004713)|receptor signaling protein tyrosine kinase activity (GO:0004716)|stem cell factor receptor activity (GO:0005020)|transmembrane receptor protein tyrosine kinase activity (GO:0004714)			NS(8)|autonomic_ganglia(1)|bone(21)|breast(2)|central_nervous_system(4)|endometrium(10)|eye(12)|genital_tract(18)|haematopoietic_and_lymphoid_tissue(1820)|kidney(17)|large_intestine(17)|lung(27)|ovary(23)|pancreas(4)|prostate(1)|salivary_gland(15)|skin(228)|soft_tissue(4117)|stomach(3)|testis(55)|thymus(7)|upper_aerodigestive_tract(1)	6411	all_cancers(7;0.00453)|all_lung(4;0.000565)|Lung NSC(11;0.00129)|all_epithelial(27;0.0104)|Glioma(25;0.08)|all_neural(26;0.101)		LUSC - Lung squamous cell carcinoma(32;0.000276)|Epithelial(7;0.209)	Colorectal(1;0.0276)|COAD - Colon adenocarcinoma(1;0.171)	Dasatinib(DB01254)|Imatinib(DB00619)|Nilotinib(DB04868)|Pazopanib(DB06589)|Ponatinib(DB08901)|Regorafenib(DB08896)|Sorafenib(DB00398)|Sunitinib(DB01268)	TTGACAGAACGGGAAGCCCTC	0.448		1	"""Mis, O"""		"""GIST, AML, TGCT, mastocytosis, mucosal melanoma"""	"""GIST, epithelioma"""	Piebald trait		Piebaldism;Mast Cell disease, Familial Clustering of;Gastrointestinal Stromal Tumors, Sporadic Multiple Primary;Familial Gastrointestinal Stromal Tumors																														yes	Dom	yes	Familial gastrointestinal stromal tumour	4	4q12	3815	v-kit Hardy-Zuckerman 4 feline sarcoma viral oncogene homolog	yes	"""L, M, O, E"""	0													141.0	129.0	133.0					4																	55594198		2203	4300	6503	SO:0001583	missense	3815	Familial Cancer Database	Piebald trait;incl.: Familial Cutaneous Mastocytosis (Urticaria Pigmentosum);Sporadic Multiple GIST;Familial GIST, incl. Multiple Familial Gastrointestinal Autonomic Nerve Tumors (GANT)	S67773	CCDS3496.1, CCDS47058.1	4q12	2014-09-17			ENSG00000157404	ENSG00000157404		"""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6342	protein-coding gene	gene with protein product		164920	"""piebald trait"""	PBT		9027509	Standard	NM_001093772		Approved	CD117, SCFR, C-Kit	uc010igr.3	P10721	OTTHUMG00000128713	ENST00000288135.5:c.1901G>A	4.37:g.55594198G>A	ENSP00000288135:p.Arg634Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5A956|D5LXN2|D5M931|F5H8F8|Q6IQ28|Q99662|Q9UM99	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_Ig_I-set,pfam_Immunoglobulin,superfamily_Kinase-like_dom,smart_Ig_sub,smart_Ig_sub2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_cat_dom,pfscan_Ig-like	p.R634Q	ENST00000288135.5	37	c.1901	CCDS3496.1	4	.	.	.	.	.	.	.	.	.	.	G	14.47	2.545201	0.45280	.	.	ENSG00000157404	ENST00000288135;ENST00000412167	D;D	0.82526	-1.62;-1.62	6.06	5.21	0.72293	Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Tyrosine-protein kinase, catalytic domain (1);Protein kinase, catalytic domain (1);	0.000000	0.52532	D	0.000061	T	0.82089	0.4961	N	0.16233	0.39	0.22541	N	0.999009	D;D;D	0.89917	0.992;0.984;1.0	P;B;D	0.66497	0.512;0.427;0.944	T	0.74472	-0.3654	10	0.52906	T	0.07	.	10.8889	0.46984	0.0666:0.0:0.8015:0.1319	.	141;630;634	D5MAV8;P10721-2;P10721	.;.;KIT_HUMAN	Q	634;630	ENSP00000288135:R634Q;ENSP00000390987:R630Q	ENSP00000288135:R634Q	R	+	2	0	KIT	55288955	1.000000	0.71417	0.315000	0.25238	0.161000	0.22273	4.157000	0.58144	1.550000	0.49438	0.655000	0.94253	CGG	KIT	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pirsf_Tyr_kinase_CSF1/PDGF_rcpt,pfscan_Prot_kinase_cat_dom		0.448	KIT-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	KIT	HGNC	protein_coding	OTTHUMT00000250618.1	G			55594198	+1	no_errors	ENST00000288135	ensembl	human	known	70_37	missense	SNP	0.223	A
KLRB1	3820	genome.wustl.edu	37	12	9754172	9754172	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr12:9754172G>T	ENST00000229402.3	-	2	155	c.109C>A	c.(109-111)Cat>Aat	p.H37N		NM_002258.2	NP_002249.1	Q12918	KLRB1_HUMAN	killer cell lectin-like receptor subfamily B, member 1	37					cell surface receptor signaling pathway (GO:0007166)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|transmembrane signaling receptor activity (GO:0004888)			endometrium(2)|large_intestine(6)|lung(4)	12						GCAAATTGATGCCAAGGTGAA	0.398																																																	0													147.0	127.0	134.0					12																	9754172		2203	4300	6503	SO:0001583	missense	3820			U11276	CCDS8601.1	12p13	2014-05-22			ENSG00000111796	ENSG00000111796		"""Killer cell lectin-like receptors"", ""CD molecules"", ""C-type lectin domain containing"""	6373	protein-coding gene	gene with protein product		602890		NKR		8077657	Standard	NM_002258		Approved	CD161, NKR-P1, NKR-P1A, hNKR-P1A, CLEC5B	uc010sgt.2	Q12918	OTTHUMG00000168581	ENST00000229402.3:c.109C>A	12.37:g.9754172G>T	ENSP00000229402:p.His37Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q24K24	Missense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.H37N	ENST00000229402.3	37	c.109	CCDS8601.1	12	.	.	.	.	.	.	.	.	.	.	G	17.49	3.403450	0.62288	.	.	ENSG00000111796	ENST00000229402	T	0.34275	1.37	3.15	3.15	0.36227	.	0.000000	0.39407	N	0.001376	T	0.52533	0.1740	M	0.61703	1.905	0.21762	N	0.999555	D	0.89917	1.0	D	0.83275	0.996	T	0.30357	-0.9981	10	0.52906	T	0.07	-17.0537	10.118	0.42603	0.0:0.0:1.0:0.0	.	37	Q12918	KLRB1_HUMAN	N	37	ENSP00000229402:H37N	ENSP00000229402:H37N	H	-	1	0	KLRB1	9645439	0.936000	0.31750	0.463000	0.27130	0.480000	0.33159	1.486000	0.35530	2.082000	0.62665	0.650000	0.86243	CAT	KLRB1	-	NULL		0.398	KLRB1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KLRB1	HGNC	protein_coding	OTTHUMT00000400280.1	G	NM_002258		9754172	-1	no_errors	ENST00000229402	ensembl	human	known	70_37	missense	SNP	0.500	T
LARP4B	23185	genome.wustl.edu	37	10	871711	871711	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr10:871711G>A	ENST00000316157.3	-	11	1265	c.1225C>T	c.(1225-1227)Cga>Tga	p.R409*		NM_015155.1	NP_055970.1	Q92615	LAR4B_HUMAN	La ribonucleoprotein domain family, member 4B	409					positive regulation of translation (GO:0045727)	cytoplasm (GO:0005737)|cytoplasmic stress granule (GO:0010494)|cytosol (GO:0005829)|membrane (GO:0016020)|nucleolus (GO:0005730)|polysomal ribosome (GO:0042788)	poly(A) RNA binding (GO:0044822)			NS(1)|breast(2)|central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(13)|lung(13)|ovary(2)|skin(2)|urinary_tract(2)	38						TGCCTGCTTCGAGGAGGATAC	0.507																																																	0													45.0	42.0	43.0					10																	871711		2203	4300	6503	SO:0001587	stop_gained	23185			D86971	CCDS31131.1	10p15.3	2011-08-24	2009-06-09	2009-06-09	ENSG00000107929	ENSG00000107929		"""La ribonucleoprotein domain containing"""	28987	protein-coding gene	gene with protein product			"""KIAA0217"", ""La ribonucleoprotein domain family, member 5"""	KIAA0217, LARP5		9039502, 20573744	Standard	NM_015155		Approved		uc031ptb.1	Q92615	OTTHUMG00000017534	ENST00000316157.3:c.1225C>T	10.37:g.871711G>A	ENSP00000326128:p.Arg409*	Somatic		WXS	Illumina HiSeq	Phase_IV	A7MD20|Q5T3R3|Q5T3R4|Q5T3R5|Q68CY4	Nonsense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.R409*	ENST00000316157.3	37	c.1225	CCDS31131.1	10	.	.	.	.	.	.	.	.	.	.	G	38	6.686654	0.97764	.	.	ENSG00000107929	ENST00000316157	.	.	.	5.08	1.38	0.22167	.	0.137023	0.64402	D	0.000004	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.19147	T	0.46	-10.3376	7.8148	0.29252	0.0:0.071:0.3034:0.6256	.	.	.	.	X	409	.	ENSP00000326128:R409X	R	-	1	2	LARP4B	861711	0.998000	0.40836	0.727000	0.30756	0.929000	0.56500	1.462000	0.35266	0.070000	0.16634	-0.274000	0.10170	CGA	LARP4B	-	NULL		0.507	LARP4B-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LARP4B	HGNC	protein_coding	OTTHUMT00000046395.2	G	NM_015155		871711	-1	no_errors	ENST00000316157	ensembl	human	known	70_37	nonsense	SNP	0.903	A
MIR9-2	407047	genome.wustl.edu	37	5	87968837	87968837	+	IGR	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr5:87968837G>T								LINC00461 (6080 upstream) : CTC-467M3.1 (3198 downstream)																							GGCAGGAACCGAGGCGCCGGC	0.572																																																	0																																										SO:0001628	intergenic_variant	645323																															5.37:g.87968837G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL		37	NULL		5																																																																																			LINC00461	-	-	0	0.572					LINC00461	HGNC			G			87968837	-1	no_errors	ENST00000500197	ensembl	human	known	70_37	rna	SNP	0.639	T
MCM2	4171	genome.wustl.edu	37	3	127323781	127323781	+	Missense_Mutation	SNP	G	G	A	rs200231306		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr3:127323781G>A	ENST00000265056.7	+	4	699	c.455G>A	c.(454-456)cGc>cAc	p.R152H		NM_004526.2	NP_004517.2	P49736	MCM2_HUMAN	minichromosome maintenance complex component 2	152	Interaction with KAT7. {ECO:0000250}.				cell cycle (GO:0007049)|cellular response to interleukin-4 (GO:0071353)|DNA replication (GO:0006260)|DNA replication initiation (GO:0006270)|DNA strand elongation involved in DNA replication (GO:0006271)|DNA unwinding involved in DNA replication (GO:0006268)|G1/S transition of mitotic cell cycle (GO:0000082)|mitotic cell cycle (GO:0000278)|nucleosome assembly (GO:0006334)	chromatin (GO:0000785)|cytoplasm (GO:0005737)|MCM complex (GO:0042555)|microtubule cytoskeleton (GO:0015630)|nuclear origin of replication recognition complex (GO:0005664)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	ATP binding (GO:0005524)|DNA binding (GO:0003677)|DNA helicase activity (GO:0003678)|DNA replication origin binding (GO:0003688)|metal ion binding (GO:0046872)			ovary(3)|skin(2)|stomach(1)	6						CGCAAGCGCCGCCAGGTGGAG	0.652													G|||	1	0.000199681	0.0	0.0	5008	,	,		16017	0.001		0.0	False		,,,				2504	0.0																0													36.0	35.0	35.0					3																	127323781		2202	4300	6502	SO:0001583	missense	4171			X67334	CCDS3043.1	3q21	2007-04-04	2007-04-04		ENSG00000073111	ENSG00000073111			6944	protein-coding gene	gene with protein product	"""mitotin"""	116945	"""minichromosome maintenance deficient (S. cerevisiae) 2 (mitotin)"", ""MCM2 minichromosome maintenance deficient 2, mitotin (S. cerevisiae)"""	CCNL1, CDCL1		1710453, 8258304	Standard	NM_004526		Approved	D3S3194, KIAA0030, BM28, cdc19	uc003ejp.4	P49736	OTTHUMG00000159637	ENST00000265056.7:c.455G>A	3.37:g.127323781G>A	ENSP00000265056:p.Arg152His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q14577|Q15023|Q8N2V1|Q969W7|Q96AE1|Q9BRM7	Missense_Mutation	SNP	pfam_MCM_DNA-dep_ATPase,pfam_MCM_2,pfam_Mg_chelatse_chII,pfam_ATPase_AAA-3,pfam_ATPase_dyneun-rel_AAA,superfamily_NA-bd_OB-fold-like,smart_MCM_DNA-dep_ATPase,pfscan_MCM_DNA-dep_ATPase,prints_MCM_2,prints_MCM_DNA-dep_ATPase	p.R152H	ENST00000265056.7	37	c.455	CCDS3043.1	3	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	0|0	0.0|0.0	G|G	22.5|22.5	4.291682|4.291682	0.80914|0.80914	.|.	.|.	ENSG00000073111|ENSG00000073111	ENST00000491422|ENST00000265056;ENST00000539922;ENST00000543142	.|T	.|0.25250	.|1.81	5.29|5.29	4.39|4.39	0.52855|0.52855	.|.	.|0.412070	.|0.27130	.|N	.|0.020791	T|T	0.41673|0.41673	0.1169|0.1169	L|L	0.43923|0.43923	1.385|1.385	0.58432|0.58432	D|D	0.999999|0.999999	.|P;D;D	.|0.89917	.|0.954;0.979;1.0	.|P;B;D	.|0.75020	.|0.557;0.289;0.985	T|T	0.11641|0.11641	-1.0579|-1.0579	5|10	.|0.33141	.|T	.|0.24	-29.0128|-29.0128	15.0272|15.0272	0.71680|0.71680	0.0:0.0:0.8566:0.1434|0.0:0.0:0.8566:0.1434	.|.	.|133;22;152	.|F5H1E9;B4DSV5;P49736	.|.;.;MCM2_HUMAN	T|H	15|152;56;133	.|ENSP00000265056:R152H	.|ENSP00000265056:R152H	A|R	+|+	1|2	0|0	MCM2|MCM2	128806471|128806471	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.985000|0.985000	0.73830|0.73830	7.244000|7.244000	0.78228|0.78228	1.181000|1.181000	0.42912|0.42912	0.591000|0.591000	0.81541|0.81541	GCC|CGC	MCM2	-	pfam_MCM_2		0.652	MCM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MCM2	HGNC	protein_coding	OTTHUMT00000356612.1	G			127323781	+1	no_errors	ENST00000265056	ensembl	human	known	70_37	missense	SNP	1.000	A
MLLT4	4301	genome.wustl.edu	37	6	168351979	168351979	+	Silent	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr6:168351979G>A	ENST00000447894.2	+	29	3924	c.3924G>A	c.(3922-3924)caG>caA	p.Q1308Q	MLLT4_ENST00000392112.1_Silent_p.Q1291Q|MLLT4_ENST00000392108.3_Silent_p.Q1308Q|MLLT4_ENST00000351017.4_Silent_p.Q1315Q|MLLT4_ENST00000366806.2_Silent_p.Q1308Q|MLLT4_ENST00000344191.4_Silent_p.Q1308Q|MLLT4_ENST00000400822.3_Silent_p.Q1307Q			P55196	AFAD_HUMAN	myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4	1308					adherens junction organization (GO:0034332)|cell adhesion (GO:0007155)|cell junction assembly (GO:0034329)|cell-cell junction organization (GO:0045216)|cell-cell signaling (GO:0007267)|signal transduction (GO:0007165)	apical part of cell (GO:0045177)|cell junction (GO:0030054)|cell-cell adherens junction (GO:0005913)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	protein C-terminus binding (GO:0008022)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(6)|kidney(13)|large_intestine(10)|lung(19)|ovary(2)|pancreas(1)|prostate(2)|skin(1)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	65		Breast(66;1.07e-05)|Ovarian(120;0.024)		Epithelial(4;2.38e-32)|OV - Ovarian serous cystadenocarcinoma(33;9.99e-23)|BRCA - Breast invasive adenocarcinoma(4;1.2e-11)|GBM - Glioblastoma multiforme(31;0.00117)		GGATAAATCAGAGCTCCTCAC	0.502			T	MLL	AL																																			Dom	yes		6	6q27	4301	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax homolog, Drosophila); translocated to, 4 (AF6)"""		L	0													92.0	100.0	97.0					6																	168351979		2203	4300	6503	SO:0001819	synonymous_variant	4301			AB011399	CCDS47517.1, CCDS75553.1	6q27	2008-02-05	2001-11-28		ENSG00000130396	ENSG00000130396			7137	protein-coding gene	gene with protein product		159559	"""myeloid/lymphoid or mixed-lineage leukemia (trithorax (Drosophila) homolog); translocated to, 4"""			8242616	Standard	NM_001040000		Approved	AF-6, AF6	uc021zij.1	P55196	OTTHUMG00000016031	ENST00000447894.2:c.3924G>A	6.37:g.168351979G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	O75087|O75088|O75089|Q59FP0|Q5TIG6|Q5TIG7|Q9NSN7|Q9NU92	Silent	SNP	pfam_Ras-assoc,pfam_Dil_domain,pfam_PDZ,pfam_FHA_dom,superfamily_PDZ,superfamily_SMAD_FHA_domain,smart_Ras-assoc,smart_FHA_dom,smart_PDZ,pfscan_Dilute,pfscan_PDZ,pfscan_Ras-assoc	p.Q1308	ENST00000447894.2	37	c.3924		6																																																																																			MLLT4	-	NULL		0.502	MLLT4-013	PUTATIVE	basic|appris_candidate_longest	protein_coding	MLLT4	HGNC	protein_coding	OTTHUMT00000372077.1	G	NM_005936		168351979	+1	no_errors	ENST00000366806	ensembl	human	known	70_37	silent	SNP	1.000	A
MMEL1	79258	genome.wustl.edu	37	1	2528008	2528008	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:2528008T>C	ENST00000378412.3	-	14	1554	c.1393A>G	c.(1393-1395)Aag>Gag	p.K465E	MMEL1_ENST00000288709.6_Missense_Mutation_p.K456E|MMEL1_ENST00000502556.1_Missense_Mutation_p.K308E			Q495T6	MMEL1_HUMAN	membrane metallo-endopeptidase-like 1	465						endoplasmic reticulum (GO:0005783)|extracellular space (GO:0005615)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			cervix(3)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(1)|lung(13)|ovary(2)|prostate(1)|urinary_tract(1)	27	all_cancers(77;0.000233)|all_epithelial(69;8.55e-05)|all_lung(157;0.0228)|Lung NSC(156;0.0402)|Ovarian(185;0.0634)	all_epithelial(116;1.03e-20)|all_lung(118;5.15e-09)|Lung NSC(185;9.02e-07)|Breast(487;0.00147)|Renal(390;0.00183)|Hepatocellular(190;0.00826)|Myeloproliferative disorder(586;0.0122)|Ovarian(437;0.0308)|Lung SC(97;0.0847)|Medulloblastoma(700;0.123)		Epithelial(90;4.31e-38)|OV - Ovarian serous cystadenocarcinoma(86;8.52e-23)|GBM - Glioblastoma multiforme(42;1.49e-08)|Colorectal(212;4.79e-05)|COAD - Colon adenocarcinoma(227;0.000213)|Kidney(185;0.000371)|BRCA - Breast invasive adenocarcinoma(365;0.00219)|KIRC - Kidney renal clear cell carcinoma(229;0.00571)|STAD - Stomach adenocarcinoma(132;0.00645)|Lung(427;0.131)		ACCATGCTCTTGCTGTCTCCA	0.672																																																	0													100.0	79.0	86.0					1																	2528008		2203	4300	6503	SO:0001583	missense	79258			AF336981	CCDS30569.1, CCDS30569.2	1p36	2008-02-05			ENSG00000142606	ENSG00000142606			14668	protein-coding gene	gene with protein product			"""membrane metallo-endopeptidase-like 2"""	MMEL2			Standard	NM_033467		Approved	SEP, NL1, NL2, NEPII	uc001ajy.2	Q495T6	OTTHUMG00000000846	ENST00000378412.3:c.1393A>G	1.37:g.2528008T>C	ENSP00000367668:p.Lys465Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B9DI79|Q495T7|Q495T8|Q5SZS6|Q96PH9	Missense_Mutation	SNP	pfam_Peptidase_M13_N,pfam_Peptidase_M13_C,prints_Peptidase_M13_C	p.K465E	ENST00000378412.3	37	c.1393	CCDS30569.2	1	.	.	.	.	.	.	.	.	.	.	T	16.29	3.081401	0.55753	.	.	ENSG00000142606	ENST00000378411;ENST00000288709;ENST00000378412;ENST00000502556	T;T;T	0.80909	-1.43;-1.43;-1.43	4.65	3.43	0.39272	Peptidase M13 (1);Metallopeptidase, catalytic domain (1);	0.090924	0.85682	D	0.000000	D	0.82737	0.5102	M	0.85859	2.78	0.80722	D	1	P	0.51933	0.949	P	0.46685	0.524	D	0.85087	0.0949	10	0.87932	D	0	-33.927	9.1209	0.36786	0.1636:0.0:0.0:0.8364	.	465	Q495T6	MMEL1_HUMAN	E	308;456;465;308	ENSP00000288709:K456E;ENSP00000367668:K465E;ENSP00000422492:K308E	ENSP00000288709:K456E	K	-	1	0	MMEL1	2517868	1.000000	0.71417	0.981000	0.43875	0.602000	0.36980	4.685000	0.61693	1.740000	0.51718	0.459000	0.35465	AAG	MMEL1	-	pfam_Peptidase_M13_N		0.672	MMEL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MMEL1	HGNC	protein_coding	OTTHUMT00000002395.2	T	NM_033467		2528008	-1	no_errors	ENST00000378412	ensembl	human	known	70_37	missense	SNP	1.000	C
MT-ND5	4540	genome.wustl.edu	37	M	13688	13688	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chrM:13688T>C	ENST00000361567.2	+	1	1352	c.1352T>C	c.(1351-1353)cTa>cCa	p.L451P	MT-TP_ENST00000387461.2_RNA|MT-TH_ENST00000387441.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TT_ENST00000387460.2_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TS2_ENST00000387449.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	451					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCCCACCCTACTAAACCCCAT	0.488																																																	0																																										SO:0001583	missense	4540					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.1352T>C	M.37:g.13688T>C	ENSP00000354813:p.Leu451Pro	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.L451P	ENST00000361567.2	37	c.1352		MT																																																																																			MT-ND5	-	pfam_NADH_DH_su5_C,tigrfam_NADHpl_OxRdtase_5		0.488	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		T	YP_003024036		13688	+1	no_errors	ENST00000361567	ensembl	human	known	70_37	missense	SNP	NULL	C
MYH2	4620	genome.wustl.edu	37	17	10436605	10436605	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr17:10436605C>A	ENST00000245503.5	-	21	2822	c.2438G>T	c.(2437-2439)aGa>aTa	p.R813I	MYH2_ENST00000532183.2_Intron|RP11-799N11.1_ENST00000581304.1_RNA|CTC-297N7.11_ENST00000587182.2_RNA|MYH2_ENST00000397183.2_Missense_Mutation_p.R813I|RP11-799N11.1_ENST00000399342.2_RNA	NM_017534.5	NP_060004.3	Q9UKX2	MYH2_HUMAN	myosin, heavy chain 2, skeletal muscle, adult	813	IQ. {ECO:0000255|PROSITE- ProRule:PRU00116}.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|membrane organization (GO:0061024)|metabolic process (GO:0008152)|muscle contraction (GO:0006936)|muscle filament sliding (GO:0030049)|plasma membrane repair (GO:0001778)|response to activity (GO:0014823)	A band (GO:0031672)|actomyosin contractile ring (GO:0005826)|cell-cell junction (GO:0005911)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|muscle myosin complex (GO:0005859)|myofibril (GO:0030016)|myosin filament (GO:0032982)|protein complex (GO:0043234)|sarcomere (GO:0030017)	ATP binding (GO:0005524)|microfilament motor activity (GO:0000146)			NS(1)|biliary_tract(1)|breast(9)|central_nervous_system(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(1)|kidney(8)|large_intestine(16)|lung(99)|ovary(6)|pancreas(4)|prostate(3)|skin(8)|upper_aerodigestive_tract(2)|urinary_tract(4)	176						TTTATACCTTCTCTCCACCAT	0.433																																																	0													84.0	85.0	85.0					17																	10436605		2203	4300	6503	SO:0001583	missense	4620				CCDS11156.1	17p13.1	2014-02-04	2006-09-29		ENSG00000125414	ENSG00000125414		"""Myosins / Myosin superfamily : Class II"""	7572	protein-coding gene	gene with protein product		160740	"""myosin, heavy polypeptide 2, skeletal muscle, adult"", ""inclusion body myopathy 3, autosomal dominant"""	IBM3		7545970, 11889243	Standard	NM_001100112		Approved	MYH2A, MYHSA2, MyHC-IIa, MYHas8, MyHC-2A	uc010coi.3	Q9UKX2	OTTHUMG00000130363	ENST00000245503.5:c.2438G>T	17.37:g.10436605C>A	ENSP00000245503:p.Arg813Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVL4|Q14322|Q16229|Q567P6|Q86T56	Missense_Mutation	SNP	pfam_Myosin_tail,pfam_Myosin_head_motor_dom,pfam_Myosin_N,superfamily_Prefoldin,superfamily_Ribosomal_L29,superfamily_t-SNARE,smart_Myosin_head_motor_dom,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS,prints_Myosin_head_motor_dom	p.R813I	ENST00000245503.5	37	c.2438	CCDS11156.1	17	.	.	.	.	.	.	.	.	.	.	C	16.78	3.217223	0.58560	.	.	ENSG00000125414	ENST00000245503;ENST00000397183	T;T	0.72835	-0.69;-0.69	5.26	5.26	0.73747	.	0.000000	0.42420	U	0.000716	D	0.84275	0.5436	H	0.95437	3.67	0.80722	D	1	B	0.22800	0.075	B	0.36567	0.228	D	0.85012	0.0906	10	0.87932	D	0	.	19.0759	0.93161	0.0:1.0:0.0:0.0	.	813	Q9UKX2	MYH2_HUMAN	I	813	ENSP00000245503:R813I;ENSP00000380367:R813I	ENSP00000245503:R813I	R	-	2	0	MYH2	10377330	0.980000	0.34600	0.998000	0.56505	0.053000	0.15095	5.880000	0.69698	2.739000	0.93911	0.655000	0.94253	AGA	MYH2	-	pfscan_IQ_motif_EF-hand-BS		0.433	MYH2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MYH2	HGNC	protein_coding	OTTHUMT00000252726.3	C	NM_017534		10436605	-1	no_errors	ENST00000245503	ensembl	human	known	70_37	missense	SNP	1.000	A
NAV2	89797	genome.wustl.edu	37	11	20057524	20057524	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr11:20057524G>C	ENST00000396087.3	+	13	2956	c.2857G>C	c.(2857-2859)Gtc>Ctc	p.V953L	NAV2_ENST00000311043.8_Missense_Mutation_p.V16L|NAV2_ENST00000396085.1_Missense_Mutation_p.V930L|NAV2_ENST00000360655.4_Missense_Mutation_p.V866L|NAV2_ENST00000533917.1_Missense_Mutation_p.V16L|NAV2_ENST00000527559.2_Missense_Mutation_p.V882L|NAV2_ENST00000349880.4_Missense_Mutation_p.V930L|NAV2_ENST00000540292.1_Missense_Mutation_p.V884L	NM_001244963.1	NP_001231892.1	Q8IVL1	NAV2_HUMAN	neuron navigator 2	953					glossopharyngeal nerve development (GO:0021563)|locomotory behavior (GO:0007626)|optic nerve development (GO:0021554)|regulation of systemic arterial blood pressure by baroreceptor feedback (GO:0003025)|sensory perception of smell (GO:0007608)|sensory perception of sound (GO:0007605)|vagus nerve development (GO:0021564)	interstitial matrix (GO:0005614)|nucleus (GO:0005634)	ATP binding (GO:0005524)|helicase activity (GO:0004386)|heparin binding (GO:0008201)			NS(1)|breast(2)|central_nervous_system(5)|endometrium(15)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(26)|lung(38)|ovary(3)|pancreas(1)|prostate(7)|skin(5)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	116						CAGCAGCTCCGTCAGCAGCGG	0.552																																																	0													219.0	137.0	165.0					11																	20057524		2203	4300	6503	SO:0001583	missense	89797			AB037840	CCDS7850.1, CCDS7851.2, CCDS44552.1, CCDS53612.1, CCDS58126.1	11p15.1	2008-07-18			ENSG00000166833	ENSG00000166833	3.6.1.1		15997	protein-coding gene	gene with protein product	"""pore membrane and/or filament interacting like protein 2"", ""retinoic acid inducible gene in neuroblastoma 1"", ""helicase, APC down-regulated 1"""	607026				12079279, 12062803	Standard	NM_145117		Approved	FLJ10633, FLJ11030, HELAD1, KIAA1419, POMFIL2, RAINB1, FLJ23707	uc010rdm.2	Q8IVL1	OTTHUMG00000151837	ENST00000396087.3:c.2857G>C	11.37:g.20057524G>C	ENSP00000379396:p.Val953Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEC1|Q8IVK3|Q8IVK4|Q8IVK5|Q8IVK6|Q8IVK7|Q8IVK8|Q8NHC9|Q8NHD0|Q8TDE9|Q8TDF0|Q8TEB3|Q96B30|Q9NUZ6|Q9NVM7|Q9P2C8	Missense_Mutation	SNP	pfam_CH-domain,superfamily_CH-domain,smart_CH-domain,smart_AAA+_ATPase,pfscan_CH-domain	p.V953L	ENST00000396087.3	37	c.2857	CCDS58126.1	11	.	.	.	.	.	.	.	.	.	.	G	20.3	3.963461	0.74016	.	.	ENSG00000166833	ENST00000360655;ENST00000396085;ENST00000349880;ENST00000396087;ENST00000527559;ENST00000540292;ENST00000533917;ENST00000525322;ENST00000530408;ENST00000311043;ENST00000536595	T;T;T;T;T;T;T;T;T;T	0.41758	1.06;1.16;1.17;1.15;1.05;1.05;2.77;1.46;0.99;2.77	5.88	5.88	0.94601	.	0.000000	0.56097	D	0.000022	T	0.63283	0.2498	L	0.59436	1.845	0.80722	D	1	P;P;D;D	0.76494	0.877;0.935;0.999;0.999	B;P;D;D	0.79784	0.415;0.691;0.967;0.993	T	0.57556	-0.7791	9	.	.	.	.	20.2265	0.98340	0.0:0.0:1.0:0.0	.	16;16;930;866	Q8IVL1-5;E9PNV5;Q8IVL1-3;Q8IVL1-4	.;.;.;.	L	866;930;930;953;882;884;16;16;16;16;16	ENSP00000353871:V866L;ENSP00000379394:V930L;ENSP00000309577:V930L;ENSP00000379396:V953L;ENSP00000435395:V882L;ENSP00000443489:V884L;ENSP00000437316:V16L;ENSP00000437136:V16L;ENSP00000431276:V16L;ENSP00000312169:V16L	.	V	+	1	0	NAV2	20014100	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	8.058000	0.89460	2.769000	0.95229	0.655000	0.94253	GTC	NAV2	-	NULL		0.552	NAV2-001	KNOWN	basic|CCDS	protein_coding	NAV2	HGNC	protein_coding	OTTHUMT00000324112.1	G	NM_145117		20057524	+1	no_errors	ENST00000396087	ensembl	human	known	70_37	missense	SNP	1.000	C
NBAS	51594	genome.wustl.edu	37	2	15427261	15427261	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr2:15427261G>A	ENST00000281513.5	-	42	5099	c.5074C>T	c.(5074-5076)Cgt>Tgt	p.R1692C	NBAS_ENST00000441750.1_Missense_Mutation_p.R1572C	NM_015909.3	NP_056993.2	A2RRP1	NBAS_HUMAN	neuroblastoma amplified sequence	1692					negative regulation of nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:2000623)|nuclear-transcribed mRNA catabolic process (GO:0000956)	cytoplasm (GO:0005737)|membrane (GO:0016020)				NS(4)|breast(4)|central_nervous_system(3)|endometrium(6)|kidney(5)|large_intestine(12)|liver(1)|lung(54)|ovary(2)|pancreas(3)|prostate(9)|skin(6)|stomach(3)	112						ACACTGTAACGTTGTGCCAGA	0.468																																																	0													138.0	132.0	134.0					2																	15427261		2203	4300	6503	SO:0001583	missense	51594			BC051792	CCDS1685.1	2p24.3	2009-02-23			ENSG00000151779	ENSG00000151779			15625	protein-coding gene	gene with protein product		608025				9926938, 12706883	Standard	NM_015909		Approved	NAG	uc002rcc.2	A2RRP1	OTTHUMG00000121153	ENST00000281513.5:c.5074C>T	2.37:g.15427261G>A	ENSP00000281513:p.Arg1692Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	O95790|Q2VPJ7|Q53TK6|Q86V39|Q8NFY8|Q9Y3W5	Missense_Mutation	SNP	pfam_Sec39,superfamily_Quino_amine_DH_bsu	p.R1692C	ENST00000281513.5	37	c.5074	CCDS1685.1	2	.	.	.	.	.	.	.	.	.	.	G	17.22	3.333283	0.60853	.	.	ENSG00000151779	ENST00000441750;ENST00000281513	T;T	0.12361	2.69;2.88	5.55	3.67	0.42095	.	0.098253	0.64402	D	0.000001	T	0.35068	0.0919	M	0.69823	2.125	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.76071	0.987;0.939	T	0.22277	-1.0221	10	0.87932	D	0	.	13.5051	0.61479	0.0:0.0:0.7178:0.2822	.	1572;1692	A2RRP1-2;A2RRP1	.;NBAS_HUMAN	C	1572;1692	ENSP00000413201:R1572C;ENSP00000281513:R1692C	ENSP00000281513:R1692C	R	-	1	0	NBAS	15344712	1.000000	0.71417	0.733000	0.30861	0.435000	0.31806	3.720000	0.54933	1.565000	0.49641	-0.182000	0.12963	CGT	NBAS	-	NULL		0.468	NBAS-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBAS	HGNC	protein_coding	OTTHUMT00000241638.1	G	NM_015909		15427261	-1	no_errors	ENST00000281513	ensembl	human	known	70_37	missense	SNP	1.000	A
NBPF14	25832	genome.wustl.edu	37	1	145292925	145292925	+	Intron	SNP	C	C	T	rs6424351		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:145292925C>T	ENST00000468030.1	+	5	970				NBPF10_ENST00000369338.1_5'Flank|NBPF10_ENST00000342960.5_5'Flank|NBPF10_ENST00000369339.3_Intron																							GGGAAAGACACGGGTCTGTGG	0.448																																																	0																																										SO:0001627	intron_variant	100132406																														ENST00000468030.1:c.635-189C>T	1.37:g.145292925C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000468030.1	37	NULL		1																																																																																			NBPF10	-	-		0.448	RP11-458D21.5-001	KNOWN	basic|appris_principal|readthrough_transcript	nonsense_mediated_decay	NBPF10	HGNC	protein_coding	OTTHUMT00000038553.9	C			145292925	+1	no_errors	ENST00000464433	ensembl	human	known	70_37	rna	SNP	0.000	T
NCF1B	654816	genome.wustl.edu	37	7	72639950	72639950	+	RNA	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr7:72639950G>A	ENST00000423083.1	+	0	158					NR_003186.1		A6NI72	NCF1B_HUMAN	neutrophil cytosolic factor 1B pseudogene							cytoplasm (GO:0005737)	phosphatidylinositol binding (GO:0035091)|superoxide-generating NADPH oxidase activity (GO:0016175)										GCAGCGGGCCGCCGAGAACCA	0.637																																																	0																																												654816					7q11.23	2014-03-20	2006-09-19		ENSG00000182487	ENSG00000182487			32522	pseudogene	pseudogene			"""neutrophil cytosolic factor 1B"""				Standard	NR_003186		Approved	SH3PXD1B	uc011ker.1	A6NI72	OTTHUMG00000156804		7.37:g.72639950G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000423083.1	37	NULL		7																																																																																			NCF1B	-	-		0.637	NCF1B-003	KNOWN	basic	processed_transcript	NCF1B	HGNC	pseudogene	OTTHUMT00000345924.1	G	NR_003186		72639950	+1	no_errors	ENST00000432102	ensembl	human	known	70_37	rna	SNP	0.580	A
NDN	4692	genome.wustl.edu	37	15	23931920	23931920	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr15:23931920G>A	ENST00000331837.4	-	1	530	c.445C>T	c.(445-447)Cgg>Tgg	p.R149W		NM_002487.2	NP_002478.1	Q99608	NECD_HUMAN	necdin, melanoma antigen (MAGE) family member	149	MAGE. {ECO:0000255|PROSITE- ProRule:PRU00127}.				axon extension (GO:0048675)|axonal fasciculation (GO:0007413)|central nervous system development (GO:0007417)|genetic imprinting (GO:0071514)|glial cell migration (GO:0008347)|multicellular organismal homeostasis (GO:0048871)|negative regulation of cell proliferation (GO:0008285)|nervous system development (GO:0007399)|neuron migration (GO:0001764)|neurotrophin TRK receptor signaling pathway (GO:0048011)|post-embryonic development (GO:0009791)|regulation of growth (GO:0040008)|regulation of transcription, DNA-templated (GO:0006355)|respiratory system process (GO:0003016)|sensory perception of pain (GO:0019233)|transcription, DNA-templated (GO:0006351)	cell projection (GO:0042995)|centrosome (GO:0005813)|cytosol (GO:0005829)|nucleus (GO:0005634)	DNA binding (GO:0003677)			breast(2)|endometrium(3)|kidney(2)|large_intestine(5)|lung(23)|ovary(1)|prostate(2)|skin(1)	39		all_cancers(20;1.78e-24)|all_epithelial(15;7.75e-22)|Lung NSC(15;2.96e-18)|all_lung(15;2.8e-17)|Breast(32;0.000625)|Colorectal(260;0.14)		all cancers(64;8.37e-11)|Epithelial(43;9.29e-10)|BRCA - Breast invasive adenocarcinoma(123;0.00179)|GBM - Glioblastoma multiforme(186;0.018)|Lung(196;0.153)		CCGAACACCCGGGCGAGGATG	0.602									Prader-Willi syndrome																																								0													42.0	44.0	43.0					15																	23931920		2203	4300	6503	SO:0001583	missense	4692	Familial Cancer Database	Prader-Labhart-Willi syndrome	U35139	CCDS10014.1	15q11-q12	2012-12-07	2012-12-07		ENSG00000182636	ENSG00000182636			7675	protein-coding gene	gene with protein product	"""Prader-Willi syndrome chromosome region"""	602117	"""necdin (mouse) homolog"", ""necdin homolog (mouse)"""			9302265	Standard	NM_002487		Approved	HsT16328, PWCR	uc001ywk.3	Q99608	OTTHUMG00000129161	ENST00000331837.4:c.445C>T	15.37:g.23931920G>A	ENSP00000332643:p.Arg149Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R6Z5	Missense_Mutation	SNP	pfam_MAGE,pfscan_MAGE	p.R149W	ENST00000331837.4	37	c.445	CCDS10014.1	15	.	.	.	.	.	.	.	.	.	.	G	16.53	3.148960	0.57151	.	.	ENSG00000182636	ENST00000331837	T	0.04970	3.52	4.08	2.04	0.26737	.	0.214829	0.39274	N	0.001411	T	0.09905	0.0243	N	0.14661	0.345	0.18873	N	0.999984	D	0.89917	1.0	D	0.72075	0.976	T	0.10042	-1.0647	10	0.87932	D	0	.	9.2003	0.37254	0.0:0.0:0.5105:0.4895	.	149	Q99608	NECD_HUMAN	W	149	ENSP00000332643:R149W	ENSP00000332643:R149W	R	-	1	2	NDN	21483013	0.710000	0.27896	0.370000	0.25965	0.992000	0.81027	0.694000	0.25512	0.360000	0.24265	0.561000	0.74099	CGG	NDN	-	pfam_MAGE,pfscan_MAGE		0.602	NDN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDN	HGNC	protein_coding	OTTHUMT00000251226.2	G	NM_002487		23931920	-1	no_errors	ENST00000331837	ensembl	human	known	70_37	missense	SNP	0.274	A
NLGN3	54413	genome.wustl.edu	37	X	70389651	70389651	+	Missense_Mutation	SNP	G	G	A	rs17857400		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chrX:70389651G>A	ENST00000358741.3	+	8	2554	c.2251G>A	c.(2251-2253)Ggg>Agg	p.G751R	NLGN3_ENST00000476589.1_3'UTR|NLGN3_ENST00000536169.1_Missense_Mutation_p.G711R|NLGN3_ENST00000374051.3_Missense_Mutation_p.G731R	NM_181303.1	NP_851820.1	Q9NZ94	NLGN3_HUMAN	neuroligin 3	751			G -> W (in dbSNP:rs17857400). {ECO:0000269|PubMed:15489334}.		adult behavior (GO:0030534)|axon extension (GO:0048675)|learning (GO:0007612)|neuron cell-cell adhesion (GO:0007158)|oligodendrocyte differentiation (GO:0048709)|positive regulation of alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:2000969)|positive regulation of excitatory postsynaptic membrane potential (GO:2000463)|positive regulation of synapse assembly (GO:0051965)|positive regulation of synaptic transmission, glutamatergic (GO:0051968)|postsynaptic membrane assembly (GO:0097104)|presynaptic membrane assembly (GO:0097105)|receptor-mediated endocytosis (GO:0006898)|regulation of dendritic spine morphogenesis (GO:0061001)|regulation of inhibitory postsynaptic membrane potential (GO:0060080)|regulation of long-term synaptic potentiation (GO:1900271)|regulation of N-methyl-D-aspartate selective glutamate receptor activity (GO:2000310)|regulation of respiratory gaseous exchange by neurological system process (GO:0002087)|regulation of synaptic transmission (GO:0050804)|regulation of terminal button organization (GO:2000331)|rhythmic synaptic transmission (GO:0060024)|social behavior (GO:0035176)|synapse assembly (GO:0007416)|synapse organization (GO:0050808)|visual learning (GO:0008542)|vocalization behavior (GO:0071625)	cell junction (GO:0030054)|cell surface (GO:0009986)|endocytic vesicle (GO:0030139)|excitatory synapse (GO:0060076)|integral component of plasma membrane (GO:0005887)|synapse (GO:0045202)	cell adhesion molecule binding (GO:0050839)|neurexin family protein binding (GO:0042043)|receptor activity (GO:0004872)			biliary_tract(1)|breast(1)|central_nervous_system(2)|endometrium(4)|large_intestine(10)|lung(14)|ovary(2)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	37	Renal(35;0.156)					GCGGGGAGCCGGGGCCCCGGA	0.667													G|||	1	0.000264901	0.0	0.0	3775	,	,		10430	0.0		0.0	False		,,,				2504	0.001				Esophageal Squamous(103;760 1488 16849 22250 40351)												0													18.0	18.0	18.0					X																	70389651		2197	4294	6491	SO:0001583	missense	54413			AB040913	CCDS14407.1, CCDS55441.1, CCDS55442.1	Xq13.1	2008-08-01			ENSG00000196338	ENSG00000196338			14289	protein-coding gene	gene with protein product		300336				10767552, 10819331	Standard	NM_181303		Approved	HNL3, KIAA1480, ASPGX1, AUTSX1	uc004dzd.2	Q9NZ94	OTTHUMG00000021790	ENST00000358741.3:c.2251G>A	X.37:g.70389651G>A	ENSP00000351591:p.Gly751Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBK1|D2X2H6|D3DVV0|D3DVV1|Q86V51|Q8NCD0|Q9NZ95|Q9NZ96|Q9NZ97|Q9P248	Missense_Mutation	SNP	pfam_CarbesteraseB,pfam_AB_hydrolase_3,prints_Neuroligin	p.G751R	ENST00000358741.3	37	c.2251	CCDS55441.1	X	.	.	.	.	.	.	.	.	.	.	G	5.176	0.217985	0.09810	.	.	ENSG00000196338	ENST00000536169;ENST00000374051;ENST00000358741	T;T;T	0.64991	-0.12;-0.12;-0.13	5.06	5.06	0.68205	.	0.130763	0.52532	D	0.000079	T	0.41442	0.1159	N	0.08118	0	0.33201	D	0.552188	B;B;B	0.33964	0.097;0.308;0.434	B;B;B	0.32533	0.03;0.07;0.147	T	0.51100	-0.8748	10	0.16896	T	0.51	.	16.3153	0.82918	0.0:0.0:1.0:0.0	.	711;751;731	D3DVV1;Q9NZ94;Q9NZ94-2	.;NLGN3_HUMAN;.	R	711;731;751	ENSP00000445298:G711R;ENSP00000363163:G731R;ENSP00000351591:G751R	ENSP00000351591:G751R	G	+	1	0	NLGN3	70306376	1.000000	0.71417	0.888000	0.34837	0.522000	0.34438	4.343000	0.59348	2.372000	0.80975	0.431000	0.28591	GGG	NLGN3	-	NULL		0.667	NLGN3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	NLGN3	HGNC	protein_coding	OTTHUMT00000057121.1	G	NM_018977		70389651	+1	no_errors	ENST00000358741	ensembl	human	known	70_37	missense	SNP	0.728	A
NOL11	25926	genome.wustl.edu	37	17	65734032	65734032	+	Missense_Mutation	SNP	G	G	T	rs201705930		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr17:65734032G>T	ENST00000253247.4	+	13	1588	c.1473G>T	c.(1471-1473)caG>caT	p.Q491H	NOL11_ENST00000535137.1_Missense_Mutation_p.Q309H|SNORA38B_ENST00000363524.1_RNA	NM_015462.3	NP_056277.2	Q9H8H0	NOL11_HUMAN	nucleolar protein 11	491					maturation of SSU-rRNA (GO:0030490)|positive regulation of transcription of nuclear large rRNA transcript from RNA polymerase I promoter (GO:1901838)|transcription, DNA-templated (GO:0006351)	nucleolus (GO:0005730)|t-UTP complex (GO:0034455)	poly(A) RNA binding (GO:0044822)			haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(3)|lung(3)|upper_aerodigestive_tract(1)	11	all_cancers(12;1.54e-10)		BRCA - Breast invasive adenocarcinoma(8;7.48e-08)|Colorectal(3;0.0518)|COAD - Colon adenocarcinoma(4;0.0977)|LUSC - Lung squamous cell carcinoma(166;0.24)			TCTGTCTACAGCAGTTCCCTG	0.358																																																	0													97.0	101.0	99.0					17																	65734032		2203	4300	6503	SO:0001583	missense	25926			AK023702	CCDS11671.1	17q24.2	2005-08-08							24557	protein-coding gene	gene with protein product		615366				12477932	Standard	NM_015462		Approved	DKFZP586L0724	uc002jgd.1	Q9H8H0		ENST00000253247.4:c.1473G>T	17.37:g.65734032G>T	ENSP00000253247:p.Gln491His	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z5V9|Q7L5S1|Q9UG18	Missense_Mutation	SNP	pfam_NUC205	p.Q491H	ENST00000253247.4	37	c.1473	CCDS11671.1	17	.	.	.	.	.	.	.	.	.	.	G	7.216	0.596353	0.13875	.	.	ENSG00000130935	ENST00000253247;ENST00000535137	T	0.49720	0.77	5.11	-0.67	0.11384	.	0.118609	0.64402	N	0.000017	T	0.32912	0.0845	L	0.49513	1.565	0.44668	D	0.997654	B	0.17852	0.024	B	0.15052	0.012	T	0.04229	-1.0967	10	0.34782	T	0.22	-4.5918	3.651	0.08203	0.2705:0.1045:0.5184:0.1067	.	491	Q9H8H0	NOL11_HUMAN	H	491;309	ENSP00000253247:Q491H	ENSP00000253247:Q491H	Q	+	3	2	NOL11	63164494	1.000000	0.71417	0.932000	0.37286	0.258000	0.26162	0.674000	0.25218	-0.519000	0.06444	-0.813000	0.03139	CAG	NOL11	-	NULL		0.358	NOL11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NOL11	HGNC	protein_coding	OTTHUMT00000448074.1	G	NM_015462		65734032	+1	no_errors	ENST00000253247	ensembl	human	known	70_37	missense	SNP	0.991	T
NUP210L	91181	genome.wustl.edu	37	1	154018618	154018618	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:154018618G>A	ENST00000368559.3	-	27	3694	c.3623C>T	c.(3622-3624)gCt>gTt	p.A1208V	NUP210L_ENST00000368553.1_Missense_Mutation_p.A141V|NUP210L_ENST00000271854.3_Missense_Mutation_p.A1208V	NM_207308.2	NP_997191.2	Q5VU65	P210L_HUMAN	nucleoporin 210kDa-like	1208					Sertoli cell development (GO:0060009)|spermatid development (GO:0007286)	integral component of membrane (GO:0016021)				NS(1)|breast(6)|central_nervous_system(1)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(12)|lung(34)|ovary(4)|pancreas(1)|prostate(2)|skin(6)|urinary_tract(2)	80	all_lung(78;9.35e-31)|Lung NSC(65;1.33e-28)|Hepatocellular(266;0.0877)|Melanoma(130;0.128)		LUSC - Lung squamous cell carcinoma(543;0.151)|Colorectal(543;0.198)			CCCAGGATTAGCATTGCTGAA	0.433																																																	0													105.0	96.0	99.0					1																	154018618		1884	4115	5999	SO:0001583	missense	91181			AK125924	CCDS41399.1, CCDS53370.1	1q21.3	2008-02-05			ENSG00000143552	ENSG00000143552			29915	protein-coding gene	gene with protein product							Standard	NM_207308		Approved		uc001fdw.3	Q5VU65	OTTHUMG00000035852	ENST00000368559.3:c.3623C>T	1.37:g.154018618G>A	ENSP00000357547:p.Ala1208Val	Somatic		WXS	Illumina HiSeq	Phase_IV	E7EP56|Q5T4L7|Q6ZRN1|Q6ZRT4|Q6ZU81|Q8NDI6|Q9UF31	Missense_Mutation	SNP	pfam_Big_2,superfamily_Invasin/intimin_cell_adhesion,smart_Big_2	p.A1208V	ENST00000368559.3	37	c.3623	CCDS41399.1	1	.	.	.	.	.	.	.	.	.	.	G	26.2	4.713516	0.89112	.	.	ENSG00000143552	ENST00000368559;ENST00000368553;ENST00000271854	T;T;T	0.24723	3.4;1.84;3.18	5.49	5.49	0.81192	.	0.000000	0.64402	D	0.000004	T	0.40448	0.1117	M	0.71206	2.165	0.43130	D	0.994863	D;D	0.76494	0.999;0.999	D;D	0.80764	0.994;0.994	T	0.07673	-1.0760	10	0.24483	T	0.36	-13.0745	17.1477	0.86770	0.0:0.0:1.0:0.0	.	1208;1208	E7EP56;Q5VU65	.;P210L_HUMAN	V	1208;141;1208	ENSP00000357547:A1208V;ENSP00000357541:A141V;ENSP00000271854:A1208V	ENSP00000271854:A1208V	A	-	2	0	NUP210L	152285242	1.000000	0.71417	0.995000	0.50966	0.993000	0.82548	4.063000	0.57499	2.582000	0.87167	0.650000	0.86243	GCT	NUP210L	-	NULL		0.433	NUP210L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NUP210L	HGNC	protein_coding	OTTHUMT00000087270.3	G	NM_207308		154018618	-1	no_errors	ENST00000368559	ensembl	human	known	70_37	missense	SNP	0.997	A
OR7C1	26664	genome.wustl.edu	37	19	14910923	14910923	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:14910923G>T	ENST00000248073.2	-	1	100	c.26C>A	c.(25-27)gCc>gAc	p.A9D	OR7A5_ENST00000601611.1_Intron	NM_198944.1	NP_945182.1	O76099	OR7C1_HUMAN	olfactory receptor, family 7, subfamily C, member 1	9					spermatogenesis (GO:0007283)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			breast(2)|central_nervous_system(1)|endometrium(2)|large_intestine(8)|lung(2)|ovary(2)|prostate(1)	18						AAATTCTTGGGCATGTGTTTG	0.428																																																	0													83.0	84.0	84.0					19																	14910923		2193	4266	6459	SO:0001583	missense	26664			X89676	CCDS12317.1	19p13.1	2012-08-09						"""GPCR / Class A : Olfactory receptors"""	8373	protein-coding gene	gene with protein product				OR7C4			Standard	NM_198944		Approved	OR19-5	uc010xnz.2	O76099		ENST00000248073.2:c.26C>A	19.37:g.14910923G>T	ENSP00000248073:p.Ala9Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15621|Q6IFP2|Q96R94	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfam_7TM_GPCR_olfarory/Srsx,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.A9D	ENST00000248073.2	37	c.26	CCDS12317.1	19	.	.	.	.	.	.	.	.	.	.	g	9.075	0.997751	0.19043	.	.	ENSG00000127530	ENST00000248073	T	0.00510	6.9	3.76	-1.67	0.08238	.	1.397630	0.05763	U	0.605218	T	0.00412	0.0013	N	0.24115	0.695	0.09310	N	1	B	0.02656	0.0	B	0.06405	0.002	T	0.42565	-0.9444	10	0.59425	D	0.04	.	8.7527	0.34626	0.5867:0.0:0.4133:0.0	.	9	O76099	OR7C1_HUMAN	D	9	ENSP00000248073:A9D	ENSP00000248073:A9D	A	-	2	0	OR7C1	14771923	0.000000	0.05858	0.000000	0.03702	0.002000	0.02628	-0.068000	0.11561	-0.588000	0.05882	-0.320000	0.08662	GCC	OR7C1	-	NULL		0.428	OR7C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR7C1	HGNC	protein_coding	OTTHUMT00000466519.1	G			14910923	-1	no_errors	ENST00000248073	ensembl	human	known	70_37	missense	SNP	0.001	T
NWD1	284434	genome.wustl.edu	37	19	16918399	16918399	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:16918399G>A	ENST00000552788.1	+	16	3739	c.3739G>A	c.(3739-3741)Gag>Aag	p.E1247K	NWD1_ENST00000549814.1_Missense_Mutation_p.E1205K|NWD1_ENST00000523826.1_Missense_Mutation_p.E1041K|NWD1_ENST00000339803.6_Missense_Mutation_p.E1112K|NWD1_ENST00000379808.3_Missense_Mutation_p.E1247K|NWD1_ENST00000524140.2_Missense_Mutation_p.E1247K			Q149M9	NWD1_HUMAN	NACHT and WD repeat domain containing 1	1247							ATP binding (GO:0005524)			NS(3)|breast(2)|cervix(1)|endometrium(8)|large_intestine(17)|lung(18)|ovary(2)|pancreas(3)|prostate(5)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	67						CCTGGCAGGCGAGGAACAAGA	0.502																																																	0													106.0	115.0	112.0					19																	16918399		2203	4300	6503	SO:0001583	missense	284434			BX648940	CCDS32945.1, CCDS32945.2	19p13.11	2013-01-09				ENSG00000188039		"""WD repeat domain containing"""	27619	protein-coding gene	gene with protein product							Standard	NM_001007525		Approved		uc002neu.4	Q149M9		ENST00000552788.1:c.3739G>A	19.37:g.16918399G>A	ENSP00000447224:p.Glu1247Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	C9J021|Q68CT3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E1247K	ENST00000552788.1	37	c.3739		19	.	.	.	.	.	.	.	.	.	.	G	1.020	-0.685015	0.03328	.	.	ENSG00000188039	ENST00000420818;ENST00000524140;ENST00000549814;ENST00000379808;ENST00000523826;ENST00000552788;ENST00000339803	T;T;T;T;T;T	0.63913	-0.07;1.25;-0.07;2.31;1.62;2.31	5.27	1.84	0.25277	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	1.284940	0.05163	N	0.498143	T	0.46600	0.1401	L	0.35723	1.085	0.09310	N	1	B;B;B	0.17465	0.007;0.022;0.007	B;B;B	0.12837	0.002;0.008;0.003	T	0.24977	-1.0145	10	0.05620	T	0.96	-19.6428	5.5192	0.16923	0.1814:0.163:0.6556:0.0	.	1247;1247;1112	Q149M9;Q149M9-3;C9J2Y8	NWD1_HUMAN;.;.	K	1112;1247;1205;1247;1041;1247;1112	ENSP00000428579:E1247K;ENSP00000447548:E1205K;ENSP00000369136:E1247K;ENSP00000428955:E1041K;ENSP00000447224:E1247K;ENSP00000340159:E1112K	ENSP00000340159:E1112K	E	+	1	0	NWD1	16779399	0.896000	0.30565	0.760000	0.31359	0.003000	0.03518	1.143000	0.31553	0.195000	0.20347	-0.122000	0.15005	GAG	NWD1	-	superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat_dom		0.502	NWD1-005	NOVEL	basic|appris_candidate_longest	protein_coding	NWD1	HGNC	protein_coding	OTTHUMT00000403569.1	G	NM_001007525		16918399	+1	no_errors	ENST00000379808	ensembl	human	known	70_37	missense	SNP	0.038	A
P2RX2	22953	genome.wustl.edu	37	12	133197642	133197642	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr12:133197642C>T	ENST00000389110.3	+	8	867	c.830C>T	c.(829-831)tCg>tTg	p.S277L	P2RX2_ENST00000449132.2_Missense_Mutation_p.S243L|P2RX2_ENST00000343948.4_Missense_Mutation_p.S277L|P2RX2_ENST00000352418.4_Missense_Mutation_p.S205L|P2RX2_ENST00000348800.5_Missense_Mutation_p.S277L|P2RX2_ENST00000351222.4_Missense_Mutation_p.S185L|P2RX2_ENST00000350048.5_Missense_Mutation_p.S253L	NM_170682.2|NM_170683.2|NM_174873.1	NP_733782.1|NP_733783.1|NP_777362.1	Q9UBL9	P2RX2_HUMAN	purinergic receptor P2X, ligand-gated ion channel, 2	277					behavioral response to pain (GO:0048266)|cation transmembrane transport (GO:0098655)|cation transport (GO:0006812)|detection of hypoxic conditions in blood by carotid body chemoreceptor signaling (GO:0003029)|ion transmembrane transport (GO:0034220)|neuromuscular junction development (GO:0007528)|neuromuscular synaptic transmission (GO:0007274)|neuronal action potential (GO:0019228)|peristalsis (GO:0030432)|positive regulation of calcium ion transport into cytosol (GO:0010524)|positive regulation of calcium-mediated signaling (GO:0050850)|protein heterooligomerization (GO:0051291)|protein homooligomerization (GO:0051260)|purinergic nucleotide receptor signaling pathway (GO:0035590)|response to ATP (GO:0033198)|response to carbohydrate (GO:0009743)|response to hypoxia (GO:0001666)|sensory perception of sound (GO:0007605)|sensory perception of taste (GO:0050909)|skeletal muscle fiber development (GO:0048741)|urinary bladder smooth muscle contraction (GO:0014832)	apical plasma membrane (GO:0016324)|cell surface (GO:0009986)|dendritic spine (GO:0043197)|integral component of nuclear inner membrane (GO:0005639)|integral component of plasma membrane (GO:0005887)|neuronal cell body (GO:0043025)|postsynaptic density (GO:0014069)|presynaptic membrane (GO:0042734)|receptor complex (GO:0043235)|terminal bouton (GO:0043195)	ATP binding (GO:0005524)|cadmium ion binding (GO:0046870)|cobalt ion binding (GO:0050897)|copper ion binding (GO:0005507)|drug binding (GO:0008144)|extracellular ATP-gated cation channel activity (GO:0004931)|identical protein binding (GO:0042802)|ligand-gated ion channel activity (GO:0015276)|mercury ion binding (GO:0045340)|nickel cation binding (GO:0016151)|phosphatidylinositol binding (GO:0035091)|purinergic nucleotide receptor activity (GO:0001614)|zinc ion binding (GO:0008270)	p.S277W(1)		NS(1)|breast(1)|kidney(2)|large_intestine(2)|liver(2)|lung(8)|ovary(1)|prostate(3)	20	all_neural(191;0.0982)|Medulloblastoma(191;0.163)	all_epithelial(31;0.0767)		OV - Ovarian serous cystadenocarcinoma(86;2.32e-08)|Epithelial(86;8.62e-08)|all cancers(50;4.5e-06)		CTGCCTGCATCGGAGTGCAAC	0.597																																																	1	Substitution - Missense(1)	prostate(1)											128.0	103.0	111.0					12																	133197642		2203	4300	6503	SO:0001583	missense	22953			AF109387	CCDS31930.1, CCDS31931.1, CCDS31932.1, CCDS31933.1, CCDS31934.1, CCDS31935.1, CCDS61286.1, CCDS73548.1	12q24.33	2013-03-22			ENSG00000187848	ENSG00000187848		"""Purinergic receptors"", ""Ligand-gated ion channels / Purinergic receptors, ionotropic"""	15459	protein-coding gene	gene with protein product		600844	"""deafness, autosomal dominant 41"""	DFNA41		10570044, 7523952, 23345450	Standard	XM_005266154		Approved	P2X2	uc001ukk.1	Q9UBL9	OTTHUMG00000168018	ENST00000389110.3:c.830C>T	12.37:g.133197642C>T	ENSP00000373762:p.Ser277Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGB4|A6NH93|A6NHC2|A6NHU3|A6NIG9|Q6V9R6|Q9NR37|Q9NR38|Q9UHD5|Q9UHD6|Q9UHD7|Q9Y637|Q9Y638	Missense_Mutation	SNP	pfam_P2X_purnocptor,prints_P2X2_purnocptor,prints_P2X_purnocptor,tigrfam_P2X_purnocptor	p.S277L	ENST00000389110.3	37	c.830	CCDS31931.1	12	.	.	.	.	.	.	.	.	.	.	C	10.28	1.306024	0.23736	.	.	ENSG00000187848	ENST00000389110;ENST00000449132;ENST00000343948;ENST00000352418;ENST00000350048;ENST00000351222;ENST00000348800	T;T;T;T;T;T;T	0.04603	3.59;3.59;3.59;3.59;3.59;3.59;3.59	4.96	4.07	0.47477	.	0.340826	0.28742	N	0.014281	T	0.07279	0.0184	M	0.67700	2.07	0.09310	N	0.999991	B;B;B;B;B;B;B;B	0.32324	0.2;0.122;0.364;0.194;0.351;0.243;0.2;0.078	B;B;B;B;B;B;B;B	0.27608	0.023;0.08;0.024;0.016;0.081;0.024;0.023;0.009	T	0.16041	-1.0416	10	0.87932	D	0	-7.8533	11.4205	0.49978	0.0:0.9156:0.0:0.0844	.	277;243;185;205;253;277;277;277	Q32MC3;Q9UBL9-7;Q9UBL9-5;Q9UBL9-6;Q9UBL9-3;Q9UBL9-4;Q9UBL9;Q9UBL9-2	.;.;.;.;.;.;P2RX2_HUMAN;.	L	277;243;277;205;253;185;277	ENSP00000373762:S277L;ENSP00000405531:S243L;ENSP00000343339:S277L;ENSP00000341419:S205L;ENSP00000343904:S253L;ENSP00000344502:S185L;ENSP00000345095:S277L	ENSP00000343339:S277L	S	+	2	0	P2RX2	131707715	0.012000	0.17670	0.002000	0.10522	0.001000	0.01503	2.561000	0.45905	1.333000	0.45449	0.561000	0.74099	TCG	P2RX2	-	pfam_P2X_purnocptor,tigrfam_P2X_purnocptor		0.597	P2RX2-006	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	P2RX2	HGNC	protein_coding	OTTHUMT00000397542.1	C			133197642	+1	no_errors	ENST00000343948	ensembl	human	known	70_37	missense	SNP	0.037	T
AKAP2	11217	genome.wustl.edu	37	9	112899283	112899283	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr9:112899283G>A	ENST00000259318.7	+	2	973	c.766G>A	c.(766-768)Gag>Aag	p.E256K	AKAP2_ENST00000434623.2_Missense_Mutation_p.E345K|AKAP2_ENST00000555236.1_Missense_Mutation_p.E487K|AKAP2_ENST00000510514.5_Missense_Mutation_p.E487K|AKAP2_ENST00000374525.1_Missense_Mutation_p.E345K|PALM2-AKAP2_ENST00000302798.7_Missense_Mutation_p.E487K|PALM2-AKAP2_ENST00000374530.3_Missense_Mutation_p.E487K	NM_001136562.2	NP_001130034.1	Q9Y2D5	AKAP2_HUMAN	A kinase (PRKA) anchor protein 2	256										breast(1)|endometrium(3)|kidney(2)|large_intestine(5)|lung(16)|ovary(3)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	33						GCAGCTGGACGAGGAACATCT	0.542																																																	0													41.0	45.0	44.0					9																	112899283		2203	4300	6503	SO:0001583	missense	445815			AB023137	CCDS43861.1, CCDS48003.1, CCDS56581.1	9q31.3	2009-10-16			ENSG00000241978	ENSG00000241978		"""A-kinase anchor proteins"""	372	protein-coding gene	gene with protein product	"""protein kinase A2"""	604582		PRKA2		10231032	Standard	NM_001136562		Approved	AKAP-KL, KIAA0920, DKFZp564L0716		Q9Y2D5	OTTHUMG00000156811	ENST00000259318.7:c.766G>A	9.37:g.112899283G>A	ENSP00000259318:p.Glu256Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1ALX9|B2RTU4|B3KQ00|B4DTZ2|B7ZW07|B9EJB5|Q9UG26	Missense_Mutation	SNP	pfam_Paralemmin,pfam_RII_binding_1	p.E487K	ENST00000259318.7	37	c.1459	CCDS48003.1	9	.	.	.	.	.	.	.	.	.	.	G	17.17	3.319987	0.60634	.	.	ENSG00000157654;ENSG00000157654;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978;ENSG00000241978	ENST00000374530;ENST00000302798;ENST00000555236;ENST00000510514;ENST00000434623;ENST00000374525;ENST00000480388;ENST00000259318	T;T;T;T;T;T;T;T	0.48522	0.81;0.81;0.81;0.81;0.81;0.81;0.81;0.81	5.72	4.81	0.61882	.	0.382557	0.29152	N	0.012998	T	0.61640	0.2363	M	0.62723	1.935	0.33957	D	0.645113	D;D;D;D;D;P;P;P	0.89917	0.987;0.996;1.0;0.996;0.993;0.901;0.901;0.739	P;P;D;P;P;B;B;B	0.73708	0.588;0.793;0.981;0.793;0.625;0.09;0.09;0.041	T	0.69518	-0.5124	10	0.30078	T	0.28	-27.1291	10.692	0.45877	0.0:0.1432:0.708:0.1488	.	256;345;339;345;346;487;487;305	Q9Y2D5;Q9Y2D5-7;B4E2K2;Q9Y2D5-5;B1ALY1;Q9Y2D5-6;Q9Y2D5-4;C9JVY5	AKAP2_HUMAN;.;.;.;.;.;.;.	K	487;487;487;487;345;345;305;256	ENSP00000363654:E487K;ENSP00000305861:E487K;ENSP00000451476:E487K;ENSP00000421522:E487K;ENSP00000404782:E345K;ENSP00000363649:E345K;ENSP00000419268:E305K;ENSP00000259318:E256K	ENSP00000259318:E256K	E	+	1	0	PALM2-AKAP2;AKAP2	111939104	1.000000	0.71417	0.917000	0.36280	0.968000	0.65278	3.188000	0.50958	1.372000	0.46190	0.655000	0.94253	GAG	PALM2-AKAP2	-	NULL		0.542	AKAP2-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	PALM2-AKAP2	HGNC	protein_coding	OTTHUMT00000346067.3	G	NM_001004065		112899283	+1	no_errors	ENST00000374530	ensembl	human	known	70_37	missense	SNP	0.926	A
PCDHA11	56138	genome.wustl.edu	37	5	140250026	140250026	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr5:140250026C>T	ENST00000398640.2	+	1	1338	c.1338C>T	c.(1336-1338)gaC>gaT	p.D446D	PCDHA5_ENST00000529619.1_Intron|PCDHA1_ENST00000394633.3_Intron|PCDHA4_ENST00000530339.1_Intron|PCDHA6_ENST00000527624.1_Intron|PCDHA10_ENST00000307360.5_Intron|PCDHA4_ENST00000512229.2_Intron|PCDHA8_ENST00000531613.1_Intron|PCDHA3_ENST00000522353.2_Intron|PCDHA10_ENST00000506939.2_Intron|PCDHA9_ENST00000532602.1_Intron|PCDHA7_ENST00000525929.1_Intron|PCDHA1_ENST00000504120.2_Intron|PCDHA2_ENST00000526136.1_Intron|PCDHA5_ENST00000529859.1_Intron|PCDHA6_ENST00000529310.1_Intron	NM_018902.3	NP_061725.1	Q9Y5I1	PCDAB_HUMAN	protocadherin alpha 11	446	Cadherin 4. {ECO:0000255|PROSITE- ProRule:PRU00043}.				cell adhesion (GO:0007155)|homophilic cell adhesion (GO:0007156)|nervous system development (GO:0007399)	integral component of plasma membrane (GO:0005887)	calcium ion binding (GO:0005509)			breast(1)|lung(1)	2			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AGGTGGCCGACGTGAACGACA	0.637																																																	0													138.0	143.0	141.0					5																	140250026		2203	4300	6503	SO:0001819	synonymous_variant	56138			AF152476	CCDS47284.1, CCDS75326.1	5q31	2010-11-26			ENSG00000249158	ENSG00000249158		"""Cadherins / Protocadherins : Clustered"""	8665	other	complex locus constituent	"""KIAA0345-like 3"", ""ortholog of mouse CNR7"""	606317		CNRS7		10380929, 10662547	Standard	NM_018902		Approved	CNR7, CRNR7, CNRN7, PCDH-ALPHA11		Q9Y5I1	OTTHUMG00000163369	ENST00000398640.2:c.1338C>T	5.37:g.140250026C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RN58|O75279	Silent	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin	p.D446	ENST00000398640.2	37	c.1338	CCDS47284.1	5																																																																																			PCDHA11	-	superfamily_Cadherin-like,smart_Cadherin,prints_Cadherin,pfscan_Cadherin		0.637	PCDHA11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCDHA11	HGNC	protein_coding	OTTHUMT00000372885.2	C	NM_018902		140250026	+1	no_errors	ENST00000398640	ensembl	human	known	70_37	silent	SNP	1.000	T
PCYOX1L	78991	genome.wustl.edu	37	5	148747993	148747993	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr5:148747993G>C	ENST00000274569.4	+	6	1323	c.1261G>C	c.(1261-1263)Gag>Cag	p.E421Q	PCYOX1L_ENST00000514349.1_Missense_Mutation_p.E331Q	NM_024028.3	NP_076933.3	Q8NBM8	PCYXL_HUMAN	prenylcysteine oxidase 1 like	421					prenylcysteine catabolic process (GO:0030328)	extracellular region (GO:0005576)|membrane (GO:0016020)	prenylcysteine oxidase activity (GO:0001735)			breast(2)|kidney(1)|large_intestine(2)|lung(2)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	11			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			GCAGACAGCTGAGTGGCAGGC	0.622																																					Ovarian(62;1136 1477 27277 27495)												0													70.0	73.0	72.0					5																	148747993		2203	4300	6503	SO:0001583	missense	78991				CCDS4296.1	5q33.1	2008-02-05			ENSG00000145882	ENSG00000145882			28477	protein-coding gene	gene with protein product						12477932	Standard	NM_024028		Approved	MGC3265	uc003lqk.2	Q8NBM8	OTTHUMG00000130052	ENST00000274569.4:c.1261G>C	5.37:g.148747993G>C	ENSP00000274569:p.Glu421Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z4S2|Q8NCY5|Q8NF69|Q9BTE8|Q9BWS3	Missense_Mutation	SNP	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase	p.E421Q	ENST00000274569.4	37	c.1261	CCDS4296.1	5	.	.	.	.	.	.	.	.	.	.	G	8.964	0.971179	0.18659	.	.	ENSG00000145882	ENST00000274569;ENST00000514349	T;T	0.14893	2.47;2.47	5.51	4.6	0.57074	Prenylcysteine lyase (1);	0.108709	0.64402	D	0.000008	T	0.15305	0.0369	L	0.33485	1.01	0.47245	D	0.999367	B;B;B	0.28233	0.204;0.077;0.134	B;B;B	0.30105	0.111;0.064;0.062	T	0.07888	-1.0749	10	0.16420	T	0.52	-32.391	17.9533	0.89061	0.0:0.1311:0.8689:0.0	.	303;331;421	B3KXF9;E7EVZ5;Q8NBM8	.;.;PCYXL_HUMAN	Q	421;331	ENSP00000274569:E421Q;ENSP00000428512:E331Q	ENSP00000274569:E421Q	E	+	1	0	PCYOX1L	148728186	1.000000	0.71417	0.969000	0.41365	0.683000	0.39861	5.255000	0.65462	2.577000	0.86979	0.561000	0.74099	GAG	PCYOX1L	-	pfam_Prenylcys_lyase,pirsf_Prenylcysteine_Oxase		0.622	PCYOX1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCYOX1L	HGNC	protein_coding	OTTHUMT00000252331.2	G	NM_024028		148747993	+1	no_errors	ENST00000274569	ensembl	human	known	70_37	missense	SNP	0.936	C
PDK2	5164	genome.wustl.edu	37	17	48185735	48185735	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr17:48185735C>T	ENST00000503176.1	+	8	976	c.815C>T	c.(814-816)cCc>cTc	p.P272L	PDK2_ENST00000007708.3_Missense_Mutation_p.P208L	NM_002611.4	NP_002602.2	Q15119	PDK2_HUMAN	pyruvate dehydrogenase kinase, isozyme 2	272	Histidine kinase. {ECO:0000255|PROSITE- ProRule:PRU00107}.				cellular metabolic process (GO:0044237)|cellular response to nutrient (GO:0031670)|cellular response to reactive oxygen species (GO:0034614)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|insulin receptor signaling pathway (GO:0008286)|intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)|protein phosphorylation (GO:0006468)|pyruvate metabolic process (GO:0006090)|regulation of acetyl-CoA biosynthetic process from pyruvate (GO:0010510)|regulation of cellular ketone metabolic process (GO:0010565)|regulation of gluconeogenesis (GO:0006111)|regulation of glucose metabolic process (GO:0010906)|regulation of pH (GO:0006885)|small molecule metabolic process (GO:0044281)	mitochondrial matrix (GO:0005759)|mitochondrial pyruvate dehydrogenase complex (GO:0005967)	ATP binding (GO:0005524)|protein homodimerization activity (GO:0042803)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|pyruvate dehydrogenase (acetyl-transferring) kinase activity (GO:0004740)			central_nervous_system(4)|endometrium(2)|kidney(1)|large_intestine(2)|lung(7)|prostate(2)|skin(1)|urinary_tract(1)	20						ATTCTCCCACCCATCAAGGTC	0.577									Autosomal Dominant Polycystic Kidney Disease																																								0													81.0	68.0	72.0					17																	48185735		2203	4300	6503	SO:0001583	missense	5164	Familial Cancer Database	ADPKD	L42451	CCDS11559.1, CCDS56039.1	17q21.33	2012-07-18	2005-11-16		ENSG00000005882	ENSG00000005882			8810	protein-coding gene	gene with protein product		602525	"""pyruvate dehydrogenase kinase, isoenzyme 2"""			7499431	Standard	NM_001199898		Approved	PDHK2	uc002iqc.3	Q15119	OTTHUMG00000161948	ENST00000503176.1:c.815C>T	17.37:g.48185735C>T	ENSP00000420927:p.Pro272Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3A7|B3KNW0|Q6P515|Q9BS05	Missense_Mutation	SNP	pfam_BCDHK/PDK_N,pfam_ATPase-like_ATP-bd,superfamily_BCDHK/PDK_N,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core	p.P272L	ENST00000503176.1	37	c.815	CCDS11559.1	17	.	.	.	.	.	.	.	.	.	.	C	26.6	4.753253	0.89753	.	.	ENSG00000005882	ENST00000007708;ENST00000503176;ENST00000503614	T;T;T	0.54071	0.59;0.59;0.59	4.61	4.61	0.57282	Signal transduction histidine kinase, core (1);ATPase-like, ATP-binding domain (4);	0.131848	0.51477	D	0.000082	T	0.71576	0.3356	M	0.86651	2.83	0.80722	D	1	D	0.54047	0.964	P	0.55545	0.778	T	0.78861	-0.2037	10	0.72032	D	0.01	-14.0616	16.633	0.85039	0.0:1.0:0.0:0.0	.	272	Q15119	PDK2_HUMAN	L	208;272;208	ENSP00000007708:P208L;ENSP00000420927:P272L;ENSP00000425265:P208L	ENSP00000007708:P208L	P	+	2	0	PDK2	45540734	0.600000	0.26899	0.082000	0.20525	0.898000	0.52572	5.888000	0.69758	2.289000	0.77006	0.555000	0.69702	CCC	PDK2	-	pfam_ATPase-like_ATP-bd,superfamily_ATPase-like_ATP-bd,smart_ATPase-like_ATP-bd,pfscan_Sig_transdc_His_kinase_core		0.577	PDK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDK2	HGNC	protein_coding	OTTHUMT00000366492.2	C	NM_002611		48185735	+1	no_errors	ENST00000503176	ensembl	human	known	70_37	missense	SNP	0.990	T
PLA2G2A	5320	genome.wustl.edu	37	1	20305466	20305467	+	Intron	INS	-	-	CA	rs3061293|rs376364585|rs562663581|rs71857665|rs58884069|rs531707871	byFrequency	TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:20305466_20305467insCA	ENST00000375111.3	-	3	166				PLA2G2A_ENST00000496748.1_Intron|PLA2G2A_ENST00000400520.3_Intron	NM_000300.3|NM_001161727.1	NP_000291.1|NP_001155199.1	P14555	PA2GA_HUMAN	phospholipase A2, group IIA (platelets, synovial fluid)						defense response to Gram-positive bacterium (GO:0050830)|glycerophospholipid biosynthetic process (GO:0046474)|lipid catabolic process (GO:0016042)|low-density lipoprotein particle remodeling (GO:0034374)|negative regulation of epithelial cell proliferation (GO:0050680)|phosphatidic acid biosynthetic process (GO:0006654)|phosphatidic acid metabolic process (GO:0046473)|phosphatidylcholine acyl-chain remodeling (GO:0036151)|phosphatidylethanolamine acyl-chain remodeling (GO:0036152)|phosphatidylglycerol acyl-chain remodeling (GO:0036148)|phosphatidylinositol acyl-chain remodeling (GO:0036149)|phosphatidylserine acyl-chain remodeling (GO:0036150)|phospholipid metabolic process (GO:0006644)|positive regulation of inflammatory response (GO:0050729)|positive regulation of macrophage derived foam cell differentiation (GO:0010744)|small molecule metabolic process (GO:0044281)|somatic stem cell maintenance (GO:0035019)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|secretory granule (GO:0030141)	calcium ion binding (GO:0005509)|calcium-dependent phospholipase A2 activity (GO:0047498)|phospholipase A2 activity (GO:0004623)|phospholipid binding (GO:0005543)			central_nervous_system(1)|lung(6)|prostate(1)|stomach(1)	9		Colorectal(325;0.000147)|Renal(390;0.000469)|all_lung(284;0.00459)|Lung NSC(340;0.00475)|Breast(348;0.00526)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0427)		UCEC - Uterine corpus endometrioid carcinoma (279;0.018)|COAD - Colon adenocarcinoma(152;1.11e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000138)|Kidney(64;0.000171)|GBM - Glioblastoma multiforme(114;0.00032)|KIRC - Kidney renal clear cell carcinoma(64;0.00258)|STAD - Stomach adenocarcinoma(196;0.00644)|READ - Rectum adenocarcinoma(331;0.0649)	Diclofenac(DB00586)|Ginkgo biloba(DB01381)|Indomethacin(DB00328)|Suramin(DB04786)	CTCCAGCAATGcacacacacac	0.554																																																	0																																										SO:0001627	intron_variant	5320			BC005919	CCDS201.1	1p35	2008-09-19			ENSG00000188257	ENSG00000188257	3.1.1.4		9031	protein-coding gene	gene with protein product		172411		PLA2B, PLA2L		8838795	Standard	NM_000300		Approved		uc010odb.2	P14555	OTTHUMG00000002699	ENST00000375111.3:c.106-94->TG	1.37:g.20305475_20305476dupCA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5I7|Q6DN24|Q6IBD9|Q9UCD2	RNA	INS	-	NULL	ENST00000375111.3	37	NULL	CCDS201.1	1																																																																																			PLA2G2A	-	-		0.554	PLA2G2A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLA2G2A	HGNC	protein_coding	OTTHUMT00000007675.1	-	NM_000300		20305467	-1	no_errors	ENST00000461140	ensembl	human	known	70_37	rna	INS	0.000:0.006	CA
PGBD5	79605	genome.wustl.edu	37	1	230486817	230486817	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:230486817C>T	ENST00000525115.1	-	3	597	c.574G>A	c.(574-576)Gat>Aat	p.D192N	PGBD5_ENST00000391860.1_Missense_Mutation_p.D146N|PGBD5_ENST00000321327.2_Missense_Mutation_p.D291N			Q8N414	PGBD5_HUMAN	piggyBac transposable element derived 5	192						integral component of membrane (GO:0016021)				biliary_tract(1)|breast(1)|central_nervous_system(1)|cervix(1)|endometrium(8)|kidney(2)|large_intestine(8)|lung(6)|ovary(2)|prostate(2)|skin(1)	33	Breast(184;0.0397)	Prostate(94;0.167)		GBM - Glioblastoma multiforme(131;0.201)		GGATCCTCATCGATCAGGGGT	0.522																																																	0													93.0	78.0	83.0					1																	230486817		2203	4300	6503	SO:0001583	missense	79605			AK021475		1q42.13	2008-02-05			ENSG00000177614	ENSG00000177614			19405	protein-coding gene	gene with protein product							Standard	NM_001258311		Approved	DKFZp761A0620, FLJ11413	uc031psq.1	Q8N414	OTTHUMG00000037759	ENST00000525115.1:c.574G>A	1.37:g.230486817C>T	ENSP00000431404:p.Asp192Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJF3|B9EK58|Q5SR37|Q6PJN2	Missense_Mutation	SNP	NULL	p.D291N	ENST00000525115.1	37	c.871		1	.	.	.	.	.	.	.	.	.	.	C	34	5.400245	0.96030	.	.	ENSG00000177614	ENST00000391860;ENST00000321327;ENST00000525115	T;T;T	0.18502	2.24;2.21;2.21	5.91	5.91	0.95273	.	0.000000	0.85682	D	0.000000	T	0.29817	0.0745	L	0.27053	0.805	0.80722	D	1	D	0.76494	0.999	D	0.64042	0.921	T	0.00780	-1.1569	10	0.35671	T	0.21	-43.8315	20.2985	0.98592	0.0:1.0:0.0:0.0	.	192	Q8N414	PGBD5_HUMAN	N	146;291;192	ENSP00000375733:D146N;ENSP00000322530:D291N;ENSP00000431404:D192N	ENSP00000322530:D291N	D	-	1	0	PGBD5	228553440	1.000000	0.71417	0.952000	0.39060	0.973000	0.67179	7.609000	0.82925	2.793000	0.96121	0.655000	0.94253	GAT	PGBD5	-	NULL		0.522	PGBD5-002	PUTATIVE	basic|exp_conf	protein_coding	PGBD5	HGNC	protein_coding	OTTHUMT00000382617.1	C	NM_024554		230486817	-1	no_errors	ENST00000321327	ensembl	human	known	70_37	missense	SNP	1.000	T
PNLIPRP1	5407	genome.wustl.edu	37	10	118353847	118353847	+	Intron	SNP	G	G	C			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr10:118353847G>C	ENST00000528052.1	+	5	401				PNLIPRP1_ENST00000358834.4_Intron|PNLIPRP1_ENST00000534537.1_Intron|PNLIPRP1_ENST00000442761.1_Missense_Mutation_p.R116T|PNLIPRP1_ENST00000480870.2_3'UTR			P54315	LIPR1_HUMAN	pancreatic lipase-related protein 1						lipid metabolic process (GO:0006629)	extracellular region (GO:0005576)	calcium ion binding (GO:0005509)|triglyceride lipase activity (GO:0004806)			breast(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(5)|liver(1)|lung(23)|ovary(1)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	38				all cancers(201;0.0161)		GCATCGCCAAGAGCCTGAAAG	0.438																																																	0													23.0	23.0	23.0					10																	118353847		876	1991	2867	SO:0001627	intron_variant	5407			BC025784	CCDS7595.1	10q26.12	2006-07-04			ENSG00000187021	ENSG00000187021			9156	protein-coding gene	gene with protein product		604422				1379598	Standard	NM_006229		Approved	PLRP1	uc001lco.1	P54315	OTTHUMG00000019109	ENST00000528052.1:c.331-395G>C	10.37:g.118353847G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68D83|Q68DR6|Q8TAU2|Q9BS82	Missense_Mutation	SNP	pfam_Lipase_N,prints_Lipase_panc,prints_Lipase	p.R117T	ENST00000528052.1	37	c.350	CCDS7595.1	10	.	.	.	.	.	.	.	.	.	.	G	9.180	1.023397	0.19433	.	.	ENSG00000187021	ENST00000442761	T	0.32988	1.43	3.03	1.15	0.20763	.	.	.	.	.	T	0.29914	0.0748	.	.	.	0.09310	N	1	.	.	.	.	.	.	T	0.28004	-1.0057	6	0.87932	D	0	.	5.2248	0.15389	0.2776:0.0:0.7224:0.0	.	.	.	.	T	116	ENSP00000400963:R116T	ENSP00000400963:R116T	R	+	2	0	PNLIPRP1	118343837	0.094000	0.21725	0.002000	0.10522	0.001000	0.01503	0.726000	0.25984	0.330000	0.23485	-0.157000	0.13467	AGA	PNLIPRP1	-	NULL		0.438	PNLIPRP1-011	KNOWN	alternative_5_UTR|basic|appris_candidate_longest|CCDS	protein_coding	PNLIPRP1	HGNC	protein_coding	OTTHUMT00000384633.1	G	NM_006229		118353847	+1	no_errors	ENST00000497792	ensembl	human	known	70_37	missense	SNP	0.003	C
PRKD1	5587	genome.wustl.edu	37	14	30100144	30100144	+	Silent	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr14:30100144G>A	ENST00000331968.5	-	10	1705	c.1476C>T	c.(1474-1476)ttC>ttT	p.F492F	PRKD1_ENST00000415220.2_Silent_p.F500F	NM_002742.2	NP_002733.2	Q15139	KPCD1_HUMAN	protein kinase D1	492	PH. {ECO:0000255|PROSITE- ProRule:PRU00145}.				angiogenesis (GO:0001525)|apoptotic process (GO:0006915)|cell proliferation (GO:0008283)|cellular response to oxidative stress (GO:0034599)|cellular response to vascular endothelial growth factor stimulus (GO:0035924)|Golgi organization (GO:0007030)|Golgi vesicle transport (GO:0048193)|inflammatory response (GO:0006954)|innate immune response (GO:0045087)|integrin-mediated signaling pathway (GO:0007229)|intracellular signal transduction (GO:0035556)|negative regulation of cell death (GO:0060548)|negative regulation of endocytosis (GO:0045806)|peptidyl-serine phosphorylation (GO:0018105)|positive regulation of angiogenesis (GO:0045766)|positive regulation of blood vessel endothelial cell migration (GO:0043536)|positive regulation of CREB transcription factor activity (GO:0032793)|positive regulation of endothelial cell chemotaxis (GO:2001028)|positive regulation of endothelial cell chemotaxis by VEGF-activated vascular endothelial growth factor receptor signaling pathway (GO:0038033)|positive regulation of endothelial cell migration (GO:0010595)|positive regulation of endothelial cell proliferation (GO:0001938)|positive regulation of histone deacetylase activity (GO:1901727)|positive regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043123)|positive regulation of neuron projection development (GO:0010976)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|protein autophosphorylation (GO:0046777)|regulation of integrin-mediated signaling pathway (GO:2001044)|regulation of keratinocyte proliferation (GO:0010837)|signal transduction (GO:0007165)|small molecule metabolic process (GO:0044281)|sphingolipid biosynthetic process (GO:0030148)|sphingolipid metabolic process (GO:0006665)|vascular endothelial growth factor receptor signaling pathway (GO:0048010)	cell cortex (GO:0005938)|cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|integral component of plasma membrane (GO:0005887)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|trans-Golgi network (GO:0005802)	ATP binding (GO:0005524)|identical protein binding (GO:0042802)|metal ion binding (GO:0046872)|protein kinase C activity (GO:0004697)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(21)|lung(32)|ovary(2)|prostate(1)|skin(4)|urinary_tract(2)	78	Hepatocellular(127;0.0604)		LUAD - Lung adenocarcinoma(48;0.00527)|Lung(238;0.0252)	GBM - Glioblastoma multiforme(265;0.00888)		TAGTGATTTCGAAACAATGAG	0.398																																																	0													130.0	121.0	124.0					14																	30100144		2203	4300	6503	SO:0001819	synonymous_variant	5587				CCDS9637.1	14q11	2013-01-10	2004-10-28	2004-10-30	ENSG00000184304	ENSG00000184304	2.7.11.1	"""Pleckstrin homology (PH) domain containing"""	9407	protein-coding gene	gene with protein product		605435	"""protein kinase C, mu"""	PRKCM		8119958, 10965134	Standard	NM_002742		Approved	PKCM, PKD, PKC-mu	uc001wqh.3	Q15139	OTTHUMG00000140203	ENST00000331968.5:c.1476C>T	14.37:g.30100144G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL64|B2RAF6	Silent	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_Kinase_C-like_PE/DAG-bd,pfam_Pleckstrin_homology,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Pleckstrin_homology,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Pleckstrin_homology,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_DAG/PE-bd	p.F492	ENST00000331968.5	37	c.1476	CCDS9637.1	14																																																																																			PRKD1	-	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology		0.398	PRKD1-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	PRKD1	HGNC	protein_coding	OTTHUMT00000276611.2	G	NM_002742		30100144	-1	no_errors	ENST00000331968	ensembl	human	known	70_37	silent	SNP	1.000	A
PRR15	222171	genome.wustl.edu	37	7	29606289	29606289	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr7:29606289C>T	ENST00000319694.2	+	2	1056	c.344C>T	c.(343-345)cCg>cTg	p.P115L		NM_175887.2	NP_787083.1	Q8IV56	PRR15_HUMAN	proline rich 15	115			P -> S (in dbSNP:rs10271996).		multicellular organismal development (GO:0007275)					endometrium(1)|lung(1)|skin(1)	3						GGCAGGTCCCCGGAGGAGGCA	0.662																																																	0													7.0	8.0	8.0					7																	29606289		2181	4264	6445	SO:0001583	missense	222171			BC029131	CCDS5421.1	7p15.1	2006-08-21			ENSG00000176532	ENSG00000176532			22310	protein-coding gene	gene with protein product						12477932	Standard	NM_175887		Approved		uc003tac.1	Q8IV56	OTTHUMG00000128555	ENST00000319694.2:c.344C>T	7.37:g.29606289C>T	ENSP00000317836:p.Pro115Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.P115L	ENST00000319694.2	37	c.344	CCDS5421.1	7	.	.	.	.	.	.	.	.	.	.	C	9.245	1.039384	0.19669	.	.	ENSG00000176532	ENST00000319694	T	0.50277	0.75	4.63	1.35	0.21983	.	1.228850	0.05969	N	0.642086	T	0.39200	0.1069	L	0.47716	1.5	0.09310	N	0.999999	B	0.12013	0.005	B	0.08055	0.003	T	0.29882	-0.9997	10	0.42905	T	0.14	7.0E-4	4.5141	0.11926	0.3703:0.5116:0.0:0.1181	.	115	Q8IV56	PRR15_HUMAN	L	115	ENSP00000317836:P115L	ENSP00000317836:P115L	P	+	2	0	PRR15	29572814	0.001000	0.12720	0.006000	0.13384	0.374000	0.29953	0.636000	0.24644	0.445000	0.26639	0.491000	0.48974	CCG	PRR15	-	NULL		0.662	PRR15-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRR15	HGNC	protein_coding	OTTHUMT00000250402.2	C	NM_175887		29606289	+1	no_errors	ENST00000319694	ensembl	human	known	70_37	missense	SNP	0.005	T
PTX4	390667	genome.wustl.edu	37	16	1538815	1538815	+	Silent	SNP	C	C	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr16:1538815C>A	ENST00000447419.2	-	1	121	c.96G>T	c.(94-96)ggG>ggT	p.G32G	PTX4_ENST00000293922.1_5'Flank|PTX4_ENST00000440447.2_Silent_p.G32G			Q96A99	PTX4_HUMAN	pentraxin 4, long	32						extracellular region (GO:0005576)	metal ion binding (GO:0046872)			breast(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|large_intestine(3)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	17						GTTTCCTGGGCCCCACTGGGG	0.532																																																	0																																										SO:0001819	synonymous_variant	390667				CCDS32362.1	16p13.3	2011-01-06	2010-03-30	2010-03-30	ENSG00000251692	ENSG00000251692			14171	protein-coding gene	gene with protein product		613442	"""chromosome 16 open reading frame 38"""	C16orf38			Standard	NM_001013658		Approved		uc010uvf.2	Q96A99		ENST00000447419.2:c.96G>T	16.37:g.1538815C>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Pentaxin,pfam_Laminin_G,superfamily_ConA-like_lec_gl_sf,smart_Pentaxin,prints_Pentaxin	p.G32	ENST00000447419.2	37	c.96		16																																																																																			PTX4	-	NULL		0.532	PTX4-001	KNOWN	not_organism_supported|basic|appris_principal	protein_coding	PTX4	HGNC	protein_coding	OTTHUMT00000432526.1	C	NM_001013658		1538815	-1	no_errors	ENST00000447419	ensembl	human	known	70_37	silent	SNP	0.014	A
RAB11B	9230	genome.wustl.edu	37	19	8464928	8464928	+	Silent	SNP	C	C	T	rs564081021		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:8464928C>T	ENST00000328024.6	+	2	440	c.222C>T	c.(220-222)cgC>cgT	p.R74R	RAB11B_ENST00000601897.1_Intron|RAB11B_ENST00000594216.1_Silent_p.R74R	NM_004218.3	NP_004209.2	Q15907	RB11B_HUMAN	RAB11B, member RAS oncogene family	74					cellular response to acidic pH (GO:0071468)|constitutive secretory pathway (GO:0045054)|establishment of protein localization to membrane (GO:0090150)|GTP catabolic process (GO:0006184)|insulin secretion involved in cellular response to glucose stimulus (GO:0035773)|melanosome transport (GO:0032402)|receptor recycling (GO:0001881)|regulated secretory pathway (GO:0045055)|regulation of anion transport (GO:0044070)|regulation of endocytic recycling (GO:2001135)|regulation of protein localization to cell surface (GO:2000008)|retrograde transport, endosome to plasma membrane (GO:1990126)|small GTPase mediated signal transduction (GO:0007264)|transferrin transport (GO:0033572)	cell junction (GO:0030054)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|phagocytic vesicle (GO:0045335)|recycling endosome (GO:0055037)|recycling endosome membrane (GO:0055038)|synaptic vesicle (GO:0008021)	GDP binding (GO:0019003)|GTP binding (GO:0005525)|GTPase activity (GO:0003924)|myosin V binding (GO:0031489)			large_intestine(2)|lung(1)|ovary(1)	4						AGCGCTACCGCGCCATCACCT	0.667													C|||	1	0.000199681	0.0	0.0	5008	,	,		17461	0.0		0.0	False		,,,				2504	0.001																0													61.0	56.0	58.0					19																	8464928		2203	4299	6502	SO:0001819	synonymous_variant	9230			X79780	CCDS12201.1	19p13.2	2012-07-02			ENSG00000185236	ENSG00000185236		"""RAB, member RAS oncogene"""	9761	protein-coding gene	gene with protein product		604198				7811277	Standard	NM_004218		Approved	H-YPT3	uc002mju.4	Q15907		ENST00000328024.6:c.222C>T	19.37:g.8464928C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A5YM50|B2R7I4|B4DMK0|D6W671|Q2YDT2|Q5U0I1|Q6FHR0|Q6FI42|Q8NI07	Silent	SNP	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.R74	ENST00000328024.6	37	c.222	CCDS12201.1	19																																																																																			RAB11B	-	pfam_Small_GTPase,pfam_MIRO-like,pfam_Small_GTPase_ARF/SAR,pfam_EF_GTP-bd_dom,smart_Small_GTPase_Ras,smart_Small_GTPase_Rab_type,smart_Small_GTPase_Rho,smart_Ran_GTPase,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom		0.667	RAB11B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RAB11B	HGNC	protein_coding	OTTHUMT00000460343.2	C	NM_004218		8464928	+1	no_errors	ENST00000328024	ensembl	human	known	70_37	silent	SNP	0.914	T
RSBN1L	222194	genome.wustl.edu	37	7	77326305	77326305	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr7:77326305C>T	ENST00000334955.8	+	1	546	c.519C>T	c.(517-519)ctC>ctT	p.L173L	RSBN1L_ENST00000445288.1_5'Flank|RSBN1L-AS1_ENST00000440088.1_lincRNA	NM_198467.2	NP_940869.2	Q6PCB5	RSBNL_HUMAN	round spermatid basic protein 1-like	173						nucleus (GO:0005634)				central_nervous_system(1)|endometrium(12)|large_intestine(2)|lung(8)|ovary(2)|pancreas(1)|skin(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	30						GGCACGGTCTCGGTGGGGCCC	0.741																																																	0													4.0	4.0	4.0					7																	77326305		1794	3977	5771	SO:0001819	synonymous_variant	222194			AK124517	CCDS43607.1	7q21.11	2004-08-11			ENSG00000187257	ENSG00000187257			24765	protein-coding gene	gene with protein product						12477932	Standard	NM_198467		Approved	FLJ42526, FLJ45813, MGC71764	uc010ldt.1	Q6PCB5	OTTHUMG00000155517	ENST00000334955.8:c.519C>T	7.37:g.77326305C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	C9K0P1|Q6ZS58|Q6ZVI9|Q86X48	Silent	SNP	NULL	p.L173	ENST00000334955.8	37	c.519	CCDS43607.1	7																																																																																			RSBN1L	-	NULL		0.741	RSBN1L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RSBN1L	HGNC	protein_coding	OTTHUMT00000340455.3	C	NM_198467		77326305	+1	no_errors	ENST00000334955	ensembl	human	known	70_37	silent	SNP	0.929	T
RUNDC3A	10900	genome.wustl.edu	37	17	42390802	42390802	+	Missense_Mutation	SNP	G	G	A	rs563233289		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr17:42390802G>A	ENST00000426726.3	+	4	663	c.389G>A	c.(388-390)cGg>cAg	p.R130Q	RUNDC3A_ENST00000590941.1_Missense_Mutation_p.R125Q|RUNDC3A_ENST00000225441.7_Missense_Mutation_p.R130Q|AC003102.3_ENST00000588097.1_RNA	NM_001144825.1	NP_001138297.1	Q59EK9	RUN3A_HUMAN	RUN domain containing 3A	130	Interaction with RAP2A. {ECO:0000250}.|RUN. {ECO:0000255|PROSITE- ProRule:PRU00178}.				positive regulation of cGMP biosynthetic process (GO:0030828)|small GTPase mediated signal transduction (GO:0007264)	cytosol (GO:0005829)|plasma membrane (GO:0005886)	guanylate cyclase activator activity (GO:0030250)|small GTPase regulator activity (GO:0005083)			large_intestine(1)|lung(1)|ovary(2)	4		Prostate(33;0.0233)		BRCA - Breast invasive adenocarcinoma(366;0.189)		GCATGGATCCGGGTGGCACTG	0.597													G|||	1	0.000199681	0.0	0.0014	5008	,	,		18674	0.0		0.0	False		,,,				2504	0.0				Pancreas(82;1061 1416 11136 20771 23901)												0													65.0	69.0	68.0					17																	42390802		2035	4190	6225	SO:0001583	missense	10900			AF055026	CCDS45698.1, CCDS45699.1, CCDS59294.1	17q21.31	2008-02-05			ENSG00000108309	ENSG00000108309			16984	protein-coding gene	gene with protein product		605448				9523700	Standard	NM_006695		Approved	RPIP8, RAP2IP	uc002igl.4	Q59EK9	OTTHUMG00000169259	ENST00000426726.3:c.389G>A	17.37:g.42390802G>A	ENSP00000410862:p.Arg130Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R974|O15483|O60651|Q7Z3S2|Q9UF50	Missense_Mutation	SNP	pfam_Run,smart_Run,pfscan_Run	p.R130Q	ENST00000426726.3	37	c.389	CCDS45698.1	17	.	.	.	.	.	.	.	.	.	.	g	32	5.117967	0.94385	.	.	ENSG00000108309	ENST00000426726;ENST00000225441	T;T	0.38240	1.15;1.15	4.56	4.56	0.56223	RUN (3);	0.000000	0.64402	D	0.000001	T	0.65512	0.2698	M	0.87456	2.885	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.87578	0.998;0.996;0.996;0.996	T	0.73877	-0.3844	10	0.87932	D	0	-20.1616	16.0991	0.81158	0.0:0.0:1.0:0.0	.	130;130;125;130	Q59EK9;Q59EK9-4;Q59EK9-2;Q59EK9-3	RUN3A_HUMAN;.;.;.	Q	130	ENSP00000410862:R130Q;ENSP00000225441:R130Q	ENSP00000225441:R130Q	R	+	2	0	RUNDC3A	39746328	1.000000	0.71417	1.000000	0.80357	0.950000	0.60333	9.236000	0.95360	2.098000	0.63641	0.462000	0.41574	CGG	RUNDC3A	-	pfam_Run,smart_Run,pfscan_Run		0.597	RUNDC3A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RUNDC3A	HGNC	protein_coding	OTTHUMT00000403173.2	G	NM_006695		42390802	+1	no_errors	ENST00000426726	ensembl	human	known	70_37	missense	SNP	1.000	A
SERPINI2	5276	genome.wustl.edu	37	3	167183309	167183309	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr3:167183309C>T	ENST00000476257.1	-	5	929	c.631G>A	c.(631-633)Gtc>Atc	p.V211I	SERPINI2_ENST00000471111.1_Missense_Mutation_p.V211I|SERPINI2_ENST00000264677.4_Missense_Mutation_p.V211I|SERPINI2_ENST00000461846.1_Missense_Mutation_p.V211I			O75830	SPI2_HUMAN	serpin peptidase inhibitor, clade I (pancpin), member 2	211					cellular component movement (GO:0006928)|negative regulation of endopeptidase activity (GO:0010951)|regulation of cell adhesion (GO:0030155)|regulation of proteolysis (GO:0030162)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(1)|breast(1)|endometrium(2)|kidney(4)|large_intestine(6)|lung(20)|prostate(1)|skin(5)|urinary_tract(1)	41						GGAATTTTGACAGTTGAACCA	0.343																																																	0													87.0	86.0	86.0					3																	167183309		2203	4300	6503	SO:0001583	missense	5276			AB006423	CCDS3200.1, CCDS75047.1	3q26.1	2014-02-18	2005-08-18		ENSG00000114204	ENSG00000114204		"""Serine (or cysteine) peptidase inhibitors"""	8945	protein-coding gene	gene with protein product		605587	"""serine (or cysteine) proteinase inhibitor, clade I (neuroserpin), member 2"", ""serine (or cysteine) proteinase inhibitor, clade I (pancpin), member 2"""	PI14		9624529, 24172014	Standard	NM_006217		Approved	PANCPIN, TSA2004, MEPI, pancpin	uc003fes.2	O75830	OTTHUMG00000158231	ENST00000476257.1:c.631G>A	3.37:g.167183309C>T	ENSP00000420621:p.Val211Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom	p.V211I	ENST00000476257.1	37	c.631	CCDS3200.1	3	.	.	.	.	.	.	.	.	.	.	C	4.984	0.182759	0.09495	.	.	ENSG00000114204	ENST00000476257;ENST00000461846;ENST00000264677;ENST00000471111	T;T;T;T	0.76709	-1.04;-1.04;-1.04;-1.04	5.74	0.296	0.15757	Serpin domain (3);	0.434081	0.24669	N	0.036567	T	0.66867	0.2833	L	0.43646	1.37	0.09310	N	1	B;B	0.13594	0.008;0.008	B;B	0.16289	0.015;0.009	T	0.56360	-0.7992	10	0.39692	T	0.17	.	10.5099	0.44855	0.0:0.6036:0.0:0.3964	.	211;211	B4DDY9;O75830	.;SPI2_HUMAN	I	211	ENSP00000420621:V211I;ENSP00000417692:V211I;ENSP00000264677:V211I;ENSP00000419407:V211I	ENSP00000264677:V211I	V	-	1	0	SERPINI2	168666003	0.000000	0.05858	0.001000	0.08648	0.020000	0.10135	0.084000	0.14891	0.094000	0.17404	-0.136000	0.14681	GTC	SERPINI2	-	pfam_Serpin_dom,superfamily_Serpin_dom,smart_Serpin_dom		0.343	SERPINI2-003	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	SERPINI2	HGNC	protein_coding	OTTHUMT00000350450.1	C	NM_006217		167183309	-1	no_errors	ENST00000264677	ensembl	human	known	70_37	missense	SNP	0.000	T
SETD8	387893	genome.wustl.edu	37	12	123879787	123879787	+	Silent	SNP	C	C	A	rs567542063		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr12:123879787C>A	ENST00000402868.3	+	4	909	c.483C>A	c.(481-483)atC>atA	p.I161I	SETD8_ENST00000330479.4_Silent_p.I161I|SETD8_ENST00000478781.2_3'UTR			Q9NQR1	SETD8_HUMAN	SET domain containing (lysine methyltransferase) 8	202					histone lysine methylation (GO:0034968)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|peptidyl-lysine monomethylation (GO:0018026)|regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043516)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	histone-lysine N-methyltransferase activity (GO:0018024)|p53 binding (GO:0002039)|protein-lysine N-methyltransferase activity (GO:0016279)|transcription corepressor activity (GO:0003714)			central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(4)|prostate(3)|urinary_tract(1)	13	all_neural(191;0.101)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;0.00101)|Epithelial(86;0.00425)		AAAAGCCCATCAAGGGCAAAC	0.517																																																	0													17.0	19.0	18.0					12																	123879787		2203	4299	6502	SO:0001819	synonymous_variant	387893			AY102937	CCDS9247.1	12q24.31	2011-07-01			ENSG00000183955	ENSG00000183955		"""Chromatin-modifying enzymes / K-methyltransferases"""	29489	protein-coding gene	gene with protein product		607240				15933070, 12086618, 12121615	Standard	NM_020382		Approved	SET8, SET07, PR-Set7, KMT5A	uc001uew.3	Q9NQR1	OTTHUMG00000150477	ENST00000402868.3:c.483C>A	12.37:g.123879787C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9D0|Q86W83|Q8TD09	Silent	SNP	pfam_SET_dom,smart_SET_dom,pirsf_Hist_H4-K20_MeTrfase,pfscan_SET_dom	p.I161	ENST00000402868.3	37	c.483	CCDS9247.1	12																																																																																			SETD8	-	pirsf_Hist_H4-K20_MeTrfase		0.517	SETD8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SETD8	HGNC	protein_coding	OTTHUMT00000318263.1	C	NM_020382		123879787	+1	no_errors	ENST00000330479	ensembl	human	known	70_37	silent	SNP	0.425	A
SMARCC1	6599	genome.wustl.edu	37	3	47629584	47629584	+	3'UTR	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr3:47629584G>T	ENST00000254480.5	-	0	3552				SMARCC1_ENST00000425518.1_5'UTR	NM_003074.3	NP_003065.3	Q92922	SMRC1_HUMAN	SWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily c, member 1						ATP-dependent chromatin remodeling (GO:0043044)|chromatin remodeling (GO:0006338)|insulin receptor signaling pathway (GO:0008286)|nervous system development (GO:0007399)|nucleosome disassembly (GO:0006337)|organ morphogenesis (GO:0009887)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nBAF complex (GO:0071565)|npBAF complex (GO:0071564)|nuclear chromatin (GO:0000790)|nucleus (GO:0005634)|protein complex (GO:0043234)|SWI/SNF complex (GO:0016514)|XY body (GO:0001741)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|protein N-terminus binding (GO:0047485)|transcription coactivator activity (GO:0003713)			breast(1)|endometrium(5)|kidney(2)|large_intestine(3)|lung(15)|prostate(1)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33				BRCA - Breast invasive adenocarcinoma(193;7.47e-05)|KIRC - Kidney renal clear cell carcinoma(197;0.00862)|Kidney(197;0.01)		ACACGTGCTTGGAGCTGTGAG	0.527																																																	0																																										SO:0001624	3_prime_UTR_variant	6599			U66615	CCDS2758.1	3p21.31	2008-05-15			ENSG00000173473	ENSG00000173473			11104	protein-coding gene	gene with protein product		601732				8804307	Standard	NM_003074		Approved	BAF155, SRG3, Rsc8, CRACC1	uc003crq.2	Q92922	OTTHUMG00000133519	ENST00000254480.5:c.*115C>A	3.37:g.47629584G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q17RS0|Q6P172|Q8IWH2	RNA	SNP	-	NULL	ENST00000254480.5	37	NULL	CCDS2758.1	3																																																																																			SMARCC1	-	-		0.527	SMARCC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMARCC1	HGNC	protein_coding	OTTHUMT00000257491.1	G			47629584	-1	no_errors	ENST00000425518	ensembl	human	known	70_37	rna	SNP	0.467	T
SMCHD1	23347	genome.wustl.edu	37	18	2707601	2707601	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr18:2707601G>A	ENST00000320876.6	+	16	2442	c.2104G>A	c.(2104-2106)Gaa>Aaa	p.E702K	SMCHD1_ENST00000261598.8_Missense_Mutation_p.E702K|RP11-703M24.5_ENST00000583546.1_RNA	NM_015295.2	NP_056110.2	A6NHR9	SMHD1_HUMAN	structural maintenance of chromosomes flexible hinge domain containing 1	702					chromosome organization (GO:0051276)|inactivation of X chromosome by DNA methylation (GO:0060821)	Barr body (GO:0001740)	ATP binding (GO:0005524)			NS(3)|breast(3)|cervix(1)|endometrium(3)|kidney(3)|large_intestine(16)|lung(15)|pancreas(1)	45						TGAAGGAGATGAATTATTGCC	0.343																																																	0													185.0	173.0	176.0					18																	2707601		1818	4078	5896	SO:0001583	missense	23347			AB014550	CCDS45822.1	18p11.32	2010-05-12			ENSG00000101596	ENSG00000101596			29090	protein-coding gene	gene with protein product		614982				9734811	Standard	NM_015295		Approved	KIAA0650	uc002klm.4	A6NHR9		ENST00000320876.6:c.2104G>A	18.37:g.2707601G>A	ENSP00000326603:p.Glu702Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O75141|Q6AHX6|Q6ZTQ8|Q9H6Q2|Q9UG39	Missense_Mutation	SNP	pfam_SMC_hinge,superfamily_SMC_hinge,superfamily_ATPase-like_ATP-bd,smart_SMC_hinge	p.E702K	ENST00000320876.6	37	c.2104	CCDS45822.1	18	.	.	.	.	.	.	.	.	.	.	G	15.14	2.746202	0.49257	.	.	ENSG00000101596	ENST00000320876;ENST00000261598	T;T	0.25579	1.79;1.8	5.46	5.46	0.80206	.	0.317848	0.29073	N	0.013233	T	0.16642	0.0400	N	0.19112	0.55	0.34750	D	0.731719	P	0.49090	0.919	B	0.37015	0.239	T	0.23261	-1.0193	10	0.66056	D	0.02	-18.2757	14.1759	0.65542	0.0:0.0:0.8502:0.1497	.	702	A6NHR9	SMHD1_HUMAN	K	702	ENSP00000326603:E702K;ENSP00000261598:E702K	ENSP00000261598:E702K	E	+	1	0	SMCHD1	2697601	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	4.927000	0.63440	2.543000	0.85770	0.563000	0.77884	GAA	SMCHD1	-	NULL		0.343	SMCHD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SMCHD1	HGNC	protein_coding	OTTHUMT00000441082.2	G			2707601	+1	no_errors	ENST00000320876	ensembl	human	known	70_37	missense	SNP	1.000	A
SPARC	6678	genome.wustl.edu	37	5	151049234	151049234	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr5:151049234G>T	ENST00000231061.4	-	6	755	c.442C>A	c.(442-444)Cct>Act	p.P148T	SPARC_ENST00000537849.1_5'Flank	NM_003118.3	NP_003109.1	P09486	SPRC_HUMAN	secreted protein, acidic, cysteine-rich (osteonectin)	148	Kazal-like. {ECO:0000255|PROSITE- ProRule:PRU00798}.				blood coagulation (GO:0007596)|bone development (GO:0060348)|cellular response to growth factor stimulus (GO:0071363)|extracellular matrix organization (GO:0030198)|heart development (GO:0007507)|inner ear development (GO:0048839)|lung development (GO:0030324)|negative regulation of angiogenesis (GO:0016525)|negative regulation of endothelial cell proliferation (GO:0001937)|ossification (GO:0001503)|platelet activation (GO:0030168)|platelet degranulation (GO:0002576)|positive regulation of endothelial cell migration (GO:0010595)|regulation of cell morphogenesis (GO:0022604)|response to cadmium ion (GO:0046686)|response to calcium ion (GO:0051592)|response to cAMP (GO:0051591)|response to cytokine (GO:0034097)|response to ethanol (GO:0045471)|response to glucocorticoid (GO:0051384)|response to gravity (GO:0009629)|response to L-ascorbic acid (GO:0033591)|response to lead ion (GO:0010288)|response to lipopolysaccharide (GO:0032496)|response to peptide hormone (GO:0043434)|signal transduction (GO:0007165)	basement membrane (GO:0005604)|cell surface (GO:0009986)|cytoplasm (GO:0005737)|endocytic vesicle lumen (GO:0071682)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|nuclear matrix (GO:0016363)|platelet alpha granule (GO:0031091)|platelet alpha granule lumen (GO:0031093)|platelet alpha granule membrane (GO:0031092)	calcium ion binding (GO:0005509)|collagen binding (GO:0005518)|extracellular matrix binding (GO:0050840)			central_nervous_system(3)|large_intestine(5)|lung(5)|ovary(1)|urinary_tract(1)	15		Medulloblastoma(196;0.109)|all_hematologic(541;0.122)	Kidney(363;0.000171)|KIRC - Kidney renal clear cell carcinoma(527;0.000785)	OV - Ovarian serous cystadenocarcinoma(192;0.00118)		CATTTGCAAGGCCCGATGTAG	0.577																																																	0													104.0	92.0	96.0					5																	151049234		2203	4300	6503	SO:0001583	missense	6678				CCDS4318.1	5q31-q33	2012-10-02			ENSG00000113140	ENSG00000113140			11219	protein-coding gene	gene with protein product	"""cysteine-rich protein"", ""osteonectin"""	182120		ON		2838412, 3410046	Standard	NM_003118		Approved		uc003lui.4	P09486	OTTHUMG00000130122	ENST00000231061.4:c.442C>A	5.37:g.151049234G>T	ENSP00000231061:p.Pro148Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQH9|Q6IBK4	Missense_Mutation	SNP	pfam_SPARC/Testican_Ca-bd-dom,pfam_Follistatin/Osteonectin_EGF,pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Fol_N,smart_Prot_inh_Kazal	p.P148T	ENST00000231061.4	37	c.442	CCDS4318.1	5	.	.	.	.	.	.	.	.	.	.	G	14.60	2.584265	0.46110	.	.	ENSG00000113140	ENST00000231061;ENST00000538026;ENST00000521569	T;T;T	0.75477	-0.94;-0.94;-0.94	5.7	4.84	0.62591	Proteinase inhibitor I1, Kazal (2);	0.050417	0.85682	D	0.000000	T	0.75759	0.3893	L	0.60957	1.885	0.80722	D	1	P	0.36027	0.533	B	0.42163	0.378	T	0.77832	-0.2441	10	0.72032	D	0.01	-4.1379	14.7881	0.69819	0.0693:0.0:0.9307:0.0	.	148	P09486	SPRC_HUMAN	T	148;57;57	ENSP00000231061:P148T;ENSP00000440127:P57T;ENSP00000428119:P57T	ENSP00000231061:P148T	P	-	1	0	SPARC	151029427	1.000000	0.71417	0.998000	0.56505	0.995000	0.86356	3.568000	0.53820	1.409000	0.46915	0.655000	0.94253	CCT	SPARC	-	pfam_Prot_inh_Kazal,pfam_Kazal-type_dom,smart_Prot_inh_Kazal		0.577	SPARC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPARC	HGNC	protein_coding	OTTHUMT00000252430.1	G	NM_003118		151049234	-1	no_errors	ENST00000231061	ensembl	human	known	70_37	missense	SNP	0.995	T
SPON1	10418	genome.wustl.edu	37	11	14279441	14279441	+	RNA	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr11:14279441G>A	ENST00000310358.7	+	0	2024							Q9HCB6	SPON1_HUMAN	spondin 1, extracellular matrix protein						cell adhesion (GO:0007155)	extracellular space (GO:0005615)|proteinaceous extracellular matrix (GO:0005578)				NS(1)|endometrium(1)|large_intestine(5)|lung(11)|prostate(2)|upper_aerodigestive_tract(1)	21				Epithelial(150;0.00898)		CTGCAGTGACGAAGGTGAGGA	0.632																																																	0													14.0	17.0	16.0					11																	14279441		2026	4160	6186			10418			AB018305	CCDS73262.1	11p15.2	2014-05-06	2004-03-05		ENSG00000152268	ENSG00000262655			11252	protein-coding gene	gene with protein product		604989	"""spondin 1, (f-spondin) extracellular matrix protein"""			9872452	Standard	NM_006108		Approved	KIAA0762, f-spondin	uc001mle.3	Q9HCB6	OTTHUMG00000181576		11.37:g.14279441G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6W5|O94862|Q8NCD7|Q8WUR5	RNA	SNP	-	NULL	ENST00000310358.7	37	NULL		11	.	.	.	.	.	.	.	.	.	.	G	16.15	3.043052	0.55003	.	.	ENSG00000152268	ENST00000310358	.	.	.	5.45	4.53	0.55603	.	0.112865	0.64402	D	0.000013	T	0.24470	0.0593	.	.	.	0.47584	D	0.999469	P	0.52842	0.956	B	0.35655	0.207	T	0.29882	-0.9997	7	0.14252	T	0.57	.	13.3009	0.60324	0.0:0.0:0.8404:0.1596	.	497	Q9HCB6	SPON1_HUMAN	K	496	.	ENSP00000309297:E496K	E	+	1	0	SPON1	14236017	1.000000	0.71417	0.868000	0.34077	0.955000	0.61496	9.476000	0.97823	1.284000	0.44531	0.561000	0.74099	GAA	SPON1	-	-		0.632	SPON1-201	KNOWN	basic	processed_transcript	SPON1	HGNC	processed_transcript		G	NM_145584		14279441	+1	no_errors	ENST00000310358	ensembl	human	known	70_37	rna	SNP	0.997	A
TBC1D26	353149	genome.wustl.edu	37	17	15640800	15640800	+	Missense_Mutation	SNP	A	A	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr17:15640800A>T	ENST00000437605.2	+	5	411	c.161A>T	c.(160-162)gAg>gTg	p.E54V	TBC1D26_ENST00000579428.1_Missense_Mutation_p.E54V|AC005324.6_ENST00000433873.1_RNA|ZNF286A_ENST00000413242.2_3'UTR|AC005324.6_ENST00000434017.1_RNA|ZNF286A_ENST00000593105.1_3'UTR	NM_178571.4	NP_848666	Q86UD7	TBC26_HUMAN	TBC1 domain family, member 26	54							Rab GTPase activator activity (GO:0005097)			endometrium(1)|large_intestine(1)|lung(4)|skin(1)	7				UCEC - Uterine corpus endometrioid carcinoma (92;0.0822)|READ - Rectum adenocarcinoma(1115;0.0222)|BRCA - Breast invasive adenocarcinoma(8;0.078)		CCTTACAGTGAGATGGAGCTG	0.642																																																	0													32.0	36.0	34.0					17																	15640800		1945	4103	6048	SO:0001583	missense	353149				CCDS42265.1	17p11.2	2008-11-04			ENSG00000214946	ENSG00000214946			28745	protein-coding gene	gene with protein product						11347906	Standard	NM_178571		Approved	MGC51025	uc010cov.3	Q86UD7	OTTHUMG00000059071	ENST00000437605.2:c.161A>T	17.37:g.15640800A>T	ENSP00000410111:p.Glu54Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K929|Q4G172	Missense_Mutation	SNP	pfam_Rab-GTPase-TBC_dom,superfamily_Rab-GTPase-TBC_dom,smart_Rab-GTPase-TBC_dom,pfscan_Rab-GTPase-TBC_dom	p.E54V	ENST00000437605.2	37	c.161	CCDS42265.1	17	.	.	.	.	.	.	.	.	.	.	a	13.23	2.175468	0.38413	.	.	ENSG00000214946	ENST00000437605	T	0.34472	1.36	0.888	0.888	0.19206	.	0.219997	0.37348	U	0.002129	T	0.50051	0.1593	M	0.77486	2.375	0.29432	N	0.859756	D;D	0.63046	0.992;0.991	D;P	0.65684	0.937;0.905	T	0.43196	-0.9406	10	0.59425	D	0.04	.	3.9962	0.09559	1.0:0.0:0.0:0.0	.	54;54	Q86UD7;Q86UD7-2	TBC26_HUMAN;.	V	54	ENSP00000410111:E54V	ENSP00000410111:E54V	E	+	2	0	TBC1D26	15581525	1.000000	0.71417	0.043000	0.18650	0.098000	0.18820	3.072000	0.50049	0.632000	0.30432	0.338000	0.21704	GAG	TBC1D26	-	NULL		0.642	TBC1D26-201	KNOWN	basic|appris_principal|CCDS	protein_coding	TBC1D26	HGNC	protein_coding		A	NM_178571		15640800	+1	no_errors	ENST00000437605	ensembl	human	known	70_37	missense	SNP	0.891	T
TBCD	6904	genome.wustl.edu	37	17	80724217	80724217	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr17:80724217C>T	ENST00000355528.4	+	4	538	c.408C>T	c.(406-408)gtC>gtT	p.V136V	TBCD_ENST00000539345.2_Silent_p.V136V|TBCD_ENST00000397466.2_5'UTR	NM_005993.4	NP_005984.3	Q9BTW9	TBCD_HUMAN	tubulin folding cofactor D	136					'de novo' posttranslational protein folding (GO:0051084)|adherens junction assembly (GO:0034333)|cellular protein metabolic process (GO:0044267)|negative regulation of cell-substrate adhesion (GO:0010812)|negative regulation of microtubule polymerization (GO:0031115)|positive regulation of GTPase activity (GO:0043547)|post-chaperonin tubulin folding pathway (GO:0007023)|protein folding (GO:0006457)|tight junction assembly (GO:0070830)	adherens junction (GO:0005912)|cytoplasm (GO:0005737)|lateral plasma membrane (GO:0016328)|microtubule (GO:0005874)|tight junction (GO:0005923)	beta-tubulin binding (GO:0048487)|chaperone binding (GO:0051087)|GTPase activator activity (GO:0005096)					Breast(20;0.000523)|all_neural(118;0.0779)	all_cancers(8;0.0266)|all_epithelial(8;0.0696)	OV - Ovarian serous cystadenocarcinoma(97;0.0868)|BRCA - Breast invasive adenocarcinoma(99;0.18)			TAGATTTGGTCACAATTCAGA	0.483																																																	0													143.0	142.0	142.0					17																	80724217		1987	4148	6135	SO:0001819	synonymous_variant	6904			BC003094	CCDS45818.1	17q25.3	2006-11-21	2006-11-21			ENSG00000141556			11581	protein-coding gene	gene with protein product		604649	"""tubulin-specific chaperone d"""				Standard	NM_005993		Approved		uc002kfz.3	Q9BTW9		ENST00000355528.4:c.408C>T	17.37:g.80724217C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O95458|Q7L8K1|Q8IXP6|Q8NAX0|Q8WYH4|Q96E74|Q9UF82|Q9UG46|Q9Y2J3	Silent	SNP	pfam_Tubulin_specific_chaperoneD_C,superfamily_ARM-type_fold	p.V136	ENST00000355528.4	37	c.408	CCDS45818.1	17																																																																																			TBCD	-	superfamily_ARM-type_fold		0.483	TBCD-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBCD	HGNC	protein_coding	OTTHUMT00000439415.1	C	NM_005993		80724217	+1	no_errors	ENST00000355528	ensembl	human	known	70_37	silent	SNP	0.014	T
THAP7	80764	genome.wustl.edu	37	22	21354527	21354527	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr22:21354527C>T	ENST00000215742.4	-	4	746	c.572G>A	c.(571-573)tGc>tAc	p.C191Y	THAP7_ENST00000399133.2_Missense_Mutation_p.C191Y|THAP7-AS1_ENST00000429962.1_RNA|THAP7-AS1_ENST00000452284.1_RNA|THAP7-AS1_ENST00000436079.1_RNA	NM_030573.2	NP_085050.2	Q9BT49	THAP7_HUMAN	THAP domain containing 7	191					negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	chromosome (GO:0005694)|nuclear speck (GO:0016607)	C2H2 zinc finger domain binding (GO:0070742)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)|protein N-terminus binding (GO:0047485)			cervix(1)|lung(2)|prostate(3)|skin(1)|stomach(1)	8	all_cancers(11;1.83e-25)|all_epithelial(7;9.19e-23)|Lung NSC(8;3.06e-15)|all_lung(8;5.05e-14)|Melanoma(16;0.000465)|Ovarian(15;0.0028)|Colorectal(54;0.0332)|all_neural(72;0.142)	Lung SC(17;0.0262)	LUSC - Lung squamous cell carcinoma(15;0.000204)|Lung(15;0.00494)|Epithelial(17;0.195)			CTGGGCGCTGCAGCCTGCTTC	0.687																																																	0													6.0	7.0	7.0					22																	21354527		2134	4198	6332	SO:0001583	missense	80764			BC004346	CCDS13787.1	22q11.2	2013-01-25			ENSG00000184436	ENSG00000184436		"""THAP (C2CH-type zinc finger) domain containing"""	23190	protein-coding gene	gene with protein product		609518				12575992	Standard	NM_030573		Approved	MGC10963	uc002ztr.1	Q9BT49	OTTHUMG00000150879	ENST00000215742.4:c.572G>A	22.37:g.21354527C>T	ENSP00000215742:p.Cys191Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RD97|D3DX40	Missense_Mutation	SNP	pfam_Znf_C2CH,smart_Znf_C2CH,pfscan_Znf_C2CH	p.C191Y	ENST00000215742.4	37	c.572	CCDS13787.1	22	.	.	.	.	.	.	.	.	.	.	C	14.51	2.557243	0.45590	.	.	ENSG00000184436	ENST00000215742;ENST00000399133	D;D	0.95980	-3.87;-3.87	4.42	3.39	0.38822	.	0.704218	0.13370	N	0.393018	D	0.87164	0.6109	N	0.08118	0	0.34674	D	0.723984	B	0.02656	0.0	B	0.01281	0.0	T	0.82977	-0.0189	10	0.18710	T	0.47	-10.0312	8.3025	0.32023	0.0:0.8901:0.0:0.1099	.	191	Q9BT49	THAP7_HUMAN	Y	191	ENSP00000215742:C191Y;ENSP00000382084:C191Y	ENSP00000215742:C191Y	C	-	2	0	THAP7	19684527	0.995000	0.38212	0.995000	0.50966	0.976000	0.68499	1.877000	0.39598	1.169000	0.42739	0.655000	0.94253	TGC	THAP7	-	NULL		0.687	THAP7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	THAP7	HGNC	protein_coding	OTTHUMT00000320405.1	C	NM_030573		21354527	-1	no_errors	ENST00000215742	ensembl	human	known	70_37	missense	SNP	0.991	T
TOX	9760	genome.wustl.edu	37	8	59872530	59872530	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr8:59872530G>A	ENST00000361421.1	-	2	360	c.140C>T	c.(139-141)cCg>cTg	p.P47L		NM_014729.2	NP_055544.1	O94900	TOX_HUMAN	thymocyte selection-associated high mobility group box	47						nucleus (GO:0005634)	DNA binding (GO:0003677)			endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|large_intestine(11)|lung(13)|prostate(1)|skin(2)|stomach(1)	33		all_cancers(86;0.165)|Myeloproliferative disorder(644;0.00452)|all_lung(136;0.036)|Lung NSC(129;0.0464)|all_epithelial(80;0.0607)				GTCCTGGCTCGGCTCTGTCAT	0.388																																					Pancreas(161;610 1969 17913 21374 22725)												0													96.0	90.0	92.0					8																	59872530		2203	4300	6503	SO:0001583	missense	9760				CCDS34897.1	8q12.2-q12.3	2009-04-17			ENSG00000198846	ENSG00000198846			18988	protein-coding gene	gene with protein product		606863				9872452, 11850626	Standard	NM_014729		Approved	KIAA0808, TOX1	uc003xtw.1	O94900	OTTHUMG00000164331	ENST00000361421.1:c.140C>T	8.37:g.59872530G>A	ENSP00000354842:p.Pro47Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96AV5	Missense_Mutation	SNP	pfam_HMG_superfamily,superfamily_HMG_superfamily,smart_HMG_superfamily,pfscan_HMG_superfamily	p.P47L	ENST00000361421.1	37	c.140	CCDS34897.1	8	.	.	.	.	.	.	.	.	.	.	G	17.81	3.481422	0.63849	.	.	ENSG00000198846	ENST00000361421	T	0.11930	2.73	5.88	5.88	0.94601	.	0.087598	0.50627	D	0.000117	T	0.33294	0.0858	L	0.46157	1.445	0.80722	D	1	D	0.89917	1.0	D	0.81914	0.995	T	0.00197	-1.1930	9	.	.	.	.	20.2279	0.98344	0.0:0.0:1.0:0.0	.	47	O94900	TOX_HUMAN	L	47	ENSP00000354842:P47L	.	P	-	2	0	TOX	60035084	1.000000	0.71417	1.000000	0.80357	0.880000	0.50808	7.842000	0.86851	2.778000	0.95560	0.655000	0.94253	CCG	TOX	-	NULL		0.388	TOX-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOX	HGNC	protein_coding	OTTHUMT00000378307.1	G	NM_014729		59872530	-1	no_errors	ENST00000361421	ensembl	human	known	70_37	missense	SNP	1.000	A
TPR	7175	genome.wustl.edu	37	1	186326620	186326620	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:186326620C>T	ENST00000367478.4	-	14	1929	c.1633G>A	c.(1633-1635)Gag>Aag	p.E545K	TPR_ENST00000474852.1_5'UTR	NM_003292.2	NP_003283.2	P12270	TPR_HUMAN	translocated promoter region, nuclear basket protein	545					carbohydrate metabolic process (GO:0005975)|cellular response to heat (GO:0034605)|cellular response to interferon-alpha (GO:0035457)|cytokine-mediated signaling pathway (GO:0019221)|glucose transport (GO:0015758)|hexose transport (GO:0008645)|MAPK import into nucleus (GO:0000189)|mitotic cell cycle (GO:0000278)|mitotic nuclear division (GO:0007067)|mitotic nuclear envelope disassembly (GO:0007077)|mitotic spindle assembly checkpoint (GO:0007094)|mRNA export from nucleus in response to heat stress (GO:0031990)|negative regulation of RNA export from nucleus (GO:0046832)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of translational initiation (GO:0045947)|nuclear pore organization (GO:0006999)|positive regulation of heterochromatin assembly (GO:0031453)|positive regulation of intracellular protein transport (GO:0090316)|positive regulation of mitotic cell cycle spindle assembly checkpoint (GO:0090267)|positive regulation of protein export from nucleus (GO:0046827)|positive regulation of protein import into nucleus (GO:0042307)|protein import into nucleus (GO:0006606)|regulation of glucose transport (GO:0010827)|regulation of mitotic sister chromatid separation (GO:0010965)|regulation of spindle assembly involved in mitosis (GO:1901673)|response to epidermal growth factor (GO:0070849)|RNA export from nucleus (GO:0006405)|RNA import into nucleus (GO:0006404)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|viral process (GO:0016032)	cytoplasm (GO:0005737)|cytoplasmic dynein complex (GO:0005868)|extrinsic component of membrane (GO:0019898)|kinetochore (GO:0000776)|mitotic spindle (GO:0072686)|nuclear envelope (GO:0005635)|nuclear inclusion body (GO:0042405)|nuclear membrane (GO:0031965)|nuclear periphery (GO:0034399)|nuclear pore (GO:0005643)|nuclear pore nuclear basket (GO:0044615)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|dynein complex binding (GO:0070840)|heat shock protein binding (GO:0031072)|mitogen-activated protein kinase binding (GO:0051019)|mRNA binding (GO:0003729)|nucleocytoplasmic transporter activity (GO:0005487)|poly(A) RNA binding (GO:0044822)|protein homodimerization activity (GO:0042803)|tubulin binding (GO:0015631)			autonomic_ganglia(1)|breast(5)|central_nervous_system(4)|cervix(2)|endometrium(9)|kidney(12)|large_intestine(23)|liver(1)|lung(45)|ovary(2)|pancreas(1)|prostate(6)|skin(3)|stomach(1)|urinary_tract(8)	123		Breast(1374;0.000659)|Lung SC(1967;0.0262)|Prostate(1639;0.157)		Colorectal(1306;1.12e-05)|KIRC - Kidney renal clear cell carcinoma(1967;0.00553)		TGTTGAAGCTCTTCAATATTT	0.393			T	NTRK1	papillary thyroid																																			Dom	yes		1	1q25	7175	translocated promoter region		E	0													153.0	140.0	144.0					1																	186326620		1846	4093	5939	SO:0001583	missense	7175			U69668	CCDS41446.1	1q25	2012-03-13	2012-03-13		ENSG00000047410	ENSG00000047410			12017	protein-coding gene	gene with protein product		189940	"""translocated promoter region (to activated MET oncogene)"""			1611909, 15229283	Standard	NM_003292		Approved		uc001grv.3	P12270	OTTHUMG00000035580	ENST00000367478.4:c.1633G>A	1.37:g.186326620C>T	ENSP00000356448:p.Glu545Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15655|Q5SWY0|Q99968	Missense_Mutation	SNP	pfam_TPR_MLP1_2,superfamily_Prefoldin,superfamily_tRNA-bd_arm	p.E545K	ENST00000367478.4	37	c.1633	CCDS41446.1	1	.	.	.	.	.	.	.	.	.	.	C	36	5.752653	0.96890	.	.	ENSG00000047410	ENST00000367478	T	0.38887	1.11	5.39	5.39	0.77823	.	0.046381	0.85682	D	0.000000	T	0.70561	0.3238	M	0.86651	2.83	0.80722	D	1	P;D	0.69078	0.479;0.997	B;D	0.75020	0.167;0.985	T	0.74711	-0.3573	10	0.59425	D	0.04	.	19.4987	0.95085	0.0:1.0:0.0:0.0	.	545;545	Q15624;P12270	.;TPR_HUMAN	K	545	ENSP00000356448:E545K	ENSP00000356448:E545K	E	-	1	0	TPR	184593243	1.000000	0.71417	1.000000	0.80357	0.993000	0.82548	7.202000	0.77856	2.685000	0.91497	0.591000	0.81541	GAG	TPR	-	NULL		0.393	TPR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TPR	HGNC	protein_coding	OTTHUMT00000086353.2	C	NM_003292		186326620	-1	no_errors	ENST00000367478	ensembl	human	known	70_37	missense	SNP	1.000	T
UHRF1BP1	54887	genome.wustl.edu	37	6	34826295	34826295	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr6:34826295C>T	ENST00000192788.5	+	14	2333	c.2162C>T	c.(2161-2163)cCc>cTc	p.P721L	UHRF1BP1_ENST00000452449.2_Missense_Mutation_p.P721L	NM_017754.3	NP_060224.3	Q6BDS2	URFB1_HUMAN	UHRF1 binding protein 1	721							histone deacetylase binding (GO:0042826)|identical protein binding (GO:0042802)	p.P721L(1)		breast(1)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(11)|lung(24)|ovary(3)|prostate(4)|skin(1)|upper_aerodigestive_tract(2)	54						TTTGTAGCCCCCTTCCCCCTG	0.552																																																	1	Substitution - Missense(1)	large_intestine(1)											64.0	67.0	66.0					6																	34826295		1892	4103	5995	SO:0001583	missense	54887			AB126777	CCDS43455.1	6p21.31	2008-10-28	2008-08-15	2007-11-27	ENSG00000065060	ENSG00000065060			21216	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 107"""	C6orf107			Standard	NM_017754		Approved	FLJ20302, dJ349A12.1, ICBP90	uc003oju.4	Q6BDS2	OTTHUMG00000014557	ENST00000192788.5:c.2162C>T	6.37:g.34826295C>T	ENSP00000192788:p.Pro721Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NXE0	Missense_Mutation	SNP	NULL	p.P721L	ENST00000192788.5	37	c.2162	CCDS43455.1	6	.	.	.	.	.	.	.	.	.	.	C	17.92	3.506921	0.64410	.	.	ENSG00000065060	ENST00000192788;ENST00000452449	T;T	0.08807	3.05;3.05	5.55	5.55	0.83447	.	0.124289	0.56097	D	0.000039	T	0.06234	0.0161	L	0.46157	1.445	0.80722	D	1	P	0.42785	0.79	B	0.37650	0.255	T	0.13469	-1.0508	10	0.87932	D	0	-11.7106	19.5532	0.95330	0.0:1.0:0.0:0.0	.	721	Q6BDS2	URFB1_HUMAN	L	721	ENSP00000192788:P721L;ENSP00000400628:P721L	ENSP00000192788:P721L	P	+	2	0	UHRF1BP1	34934273	0.922000	0.31269	1.000000	0.80357	0.994000	0.84299	5.753000	0.68736	2.624000	0.88883	0.585000	0.79938	CCC	UHRF1BP1	-	NULL		0.552	UHRF1BP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UHRF1BP1	HGNC	protein_coding	OTTHUMT00000040260.1	C	NM_017754		34826295	+1	no_errors	ENST00000192788	ensembl	human	known	70_37	missense	SNP	1.000	T
WDR81	124997	genome.wustl.edu	37	17	1637014	1637014	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr17:1637014C>T	ENST00000409644.1	+	7	4683	c.4683C>T	c.(4681-4683)agC>agT	p.S1561S	RP11-961A15.1_ENST00000576540.1_RNA|WDR81_ENST00000545662.1_Silent_p.S192S|WDR81_ENST00000446363.1_Silent_p.S200S|WDR81_ENST00000419248.1_Silent_p.S334S|WDR81_ENST00000309182.5_Silent_p.S510S|WDR81_ENST00000437219.2_Silent_p.S358S	NM_001163809.1	NP_001157281.1	Q562E7	WDR81_HUMAN	WD repeat domain 81	1561					negative regulation of phosphatase activity (GO:0010923)		transferase activity, transferring phosphorus-containing groups (GO:0016772)			cervix(1)|endometrium(1)|kidney(3)|lung(6)|ovary(2)|prostate(2)|skin(1)	16				UCEC - Uterine corpus endometrioid carcinoma (25;0.0822)		CCTTTGGGAGCGTCCTGGTGG	0.706																																																	0													30.0	30.0	30.0					17																	1637014		2203	4296	6499	SO:0001819	synonymous_variant	124997			AK074111	CCDS54061.1, CCDS54062.1, CCDS54063.1	17p13.3	2014-06-13			ENSG00000167716	ENSG00000167716		"""WD repeat domain containing"""	26600	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 166"""	614218					Standard	NM_001163673		Approved	FLJ33817, PPP1R166	uc002ftj.2	Q562E7	OTTHUMG00000153941	ENST00000409644.1:c.4683C>T	17.37:g.1637014C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B3KW16|B3KXU1|B7Z579|E9PHG7|Q24JP6|Q8N277|Q8N3F3|Q8TEL1	Silent	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_Kinase-like_dom,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S1561	ENST00000409644.1	37	c.4683	CCDS54062.1	17																																																																																			WDR81	-	NULL		0.706	WDR81-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	WDR81	HGNC	protein_coding	OTTHUMT00000333118.2	C	NM_152348		1637014	+1	no_errors	ENST00000409644	ensembl	human	known	70_37	silent	SNP	0.944	T
ZBTB3	79842	genome.wustl.edu	37	11	62519844	62519844	+	Silent	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr11:62519844G>A	ENST00000394807.3	-	2	1568	c.1443C>T	c.(1441-1443)ttC>ttT	p.F481F		NM_024784.3	NP_079060.1	Q9H5J0	ZBTB3_HUMAN	zinc finger and BTB domain containing 3	481					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)	p.F481L(1)		breast(4)|endometrium(3)|kidney(1)|large_intestine(2)|liver(1)|lung(9)|ovary(2)|prostate(2)	24						AAGAGCATGAGAAGGTCTTCC	0.552																																																	1	Substitution - Missense(1)	prostate(1)											79.0	71.0	74.0					11																	62519844		2202	4299	6501	SO:0001819	synonymous_variant	79842			AK027045	CCDS8034.1	11q12.3	2013-01-09				ENSG00000185670		"""-"", ""BTB/POZ domain containing"", ""Zinc fingers, C2H2-type"""	22918	protein-coding gene	gene with protein product							Standard	NM_024784		Approved	FLJ23392	uc001nuz.3	Q9H5J0		ENST00000394807.3:c.1443C>T	11.37:g.62519844G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_BTB_POZ,superfamily_BTB/POZ_fold,smart_BTB/POZ-like,smart_Znf_C2H2-like,pfscan_BTB/POZ-like,pfscan_Znf_C2H2	p.F481	ENST00000394807.3	37	c.1443	CCDS8034.1	11																																																																																			ZBTB3	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.552	ZBTB3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZBTB3	HGNC	protein_coding	OTTHUMT00000395342.1	G	NM_024784		62519844	-1	no_errors	ENST00000394807	ensembl	human	known	70_37	silent	SNP	1.000	A
ZCWPW2	152098	genome.wustl.edu	37	3	28476698	28476698	+	Missense_Mutation	SNP	G	G	A	rs370104321		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr3:28476698G>A	ENST00000383768.2	+	4	618	c.430G>A	c.(430-432)Gat>Aat	p.D144N	ZCWPW2_ENST00000421010.1_Missense_Mutation_p.D144N			Q504Y3	ZCPW2_HUMAN	zinc finger, CW type with PWWP domain 2	144	PWWP. {ECO:0000255|PROSITE- ProRule:PRU00162}.						zinc ion binding (GO:0008270)	p.D144N(1)		haematopoietic_and_lymphoid_tissue(1)|large_intestine(8)|lung(6)|ovary(2)	17						ATTCCTGGGCGATCCCCATTC	0.383																																																	1	Substitution - Missense(1)	large_intestine(1)						G	ASN/ASP	0,4406		0,0,2203	111.0	114.0	113.0		430	2.9	1.0	3		113	1,8599	1.2+/-3.3	0,1,4299	no	missense	ZCWPW2	NM_001040432.1	23	0,1,6502	AA,AG,GG		0.0116,0.0,0.0077	benign	144/357	28476698	1,13005	2203	4300	6503	SO:0001583	missense	152098			BC065764	CCDS33723.1	3p23	2005-08-22			ENSG00000206559	ENSG00000206559			23574	protein-coding gene	gene with protein product						14607086	Standard	XM_005264892		Approved	ZCW2	uc003cei.3	Q504Y3	OTTHUMG00000155705	ENST00000383768.2:c.430G>A	3.37:g.28476698G>A	ENSP00000373278:p.Asp144Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_CW,pfam_PWWP,pfscan_PWWP,pfscan_Znf_CW	p.D144N	ENST00000383768.2	37	c.430	CCDS33723.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	14.17|14.17	2.455621|2.455621	0.43634|0.43634	0.0|0.0	1.16E-4|1.16E-4	ENSG00000206559|ENSG00000206559	ENST00000383768;ENST00000421010|ENST00000428875	T;T|.	0.73047|.	-0.71;-0.71|.	6.06|6.06	2.88|2.88	0.33553|0.33553	PWWP (2);|.	0.386348|.	0.25613|.	N|.	0.029471|.	T|T	0.31420|0.31420	0.0796|0.0796	L|L	0.29908|0.29908	0.895|0.895	0.27918|0.27918	N|N	0.938353|0.938353	B|.	0.28470|.	0.213|.	B|.	0.26517|.	0.07|.	T|T	0.20273|0.20273	-1.0280|-1.0280	9|5	.|.	.|.	.|.	-10.0984|-10.0984	6.6991|6.6991	0.23215|0.23215	0.1771:0.1518:0.6711:0.0|0.1771:0.1518:0.6711:0.0	.|.	144|.	Q504Y3|.	ZCPW2_HUMAN|.	N|Q	144|127	ENSP00000373278:D144N;ENSP00000412386:D144N|.	.|.	D|R	+|+	1|2	0|0	ZCWPW2|ZCWPW2	28451702|28451702	0.995000|0.995000	0.38212|0.38212	0.988000|0.988000	0.46212|0.46212	0.967000|0.967000	0.64934|0.64934	1.073000|1.073000	0.30691|0.30691	0.881000|0.881000	0.35993|0.35993	0.650000|0.650000	0.86243|0.86243	GAT|CGA	ZCWPW2	-	pfam_PWWP,pfscan_PWWP		0.383	ZCWPW2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ZCWPW2	HGNC	protein_coding	OTTHUMT00000341318.1	G	XM_087384		28476698	+1	no_errors	ENST00000383768	ensembl	human	known	70_37	missense	SNP	0.927	A
ZIM2	23619	genome.wustl.edu	37	19	57293339	57293339	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:57293339G>A	ENST00000391708.3	-	10	1170	c.628C>T	c.(628-630)Cgg>Tgg	p.R210W	AC006115.3_ENST00000594400.1_RNA|ZIM2_ENST00000599935.1_Missense_Mutation_p.R210W|ZIM2_ENST00000601070.1_Missense_Mutation_p.R210W|AC006115.3_ENST00000597946.1_RNA|ZIM2_ENST00000221722.5_Missense_Mutation_p.R210W|ZIM2_ENST00000593711.1_Missense_Mutation_p.R210W|AC006115.3_ENST00000595954.1_RNA	NM_001146326.1|NM_001146327.1	NP_001139798.1|NP_001139799.1	Q9NZV7	ZIM2_HUMAN	zinc finger, imprinted 2	210	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			NS(1)|breast(1)|endometrium(1)|kidney(1)|large_intestine(10)|lung(20)|ovary(3)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	44		Colorectal(82;0.000256)|all_neural(62;0.103)|Ovarian(87;0.243)		GBM - Glioblastoma multiforme(193;0.0314)		ACCAGGTTCCGGTAATTCTCC	0.517																																																	0													123.0	118.0	119.0					19																	57293339		2203	4300	6503	SO:0001583	missense	23619			AF166122	CCDS33123.1	19q13.4	2012-10-31				ENSG00000269699		"""Zinc fingers, C2H2-type"""	12875	protein-coding gene	gene with protein product							Standard	NM_015363		Approved	ZNF656		Q9NZV7		ENST00000391708.3:c.628C>T	19.37:g.57293339G>A	ENSP00000375589:p.Arg210Trp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M3K1	Missense_Mutation	SNP	pfam_Krueppel-associated_box,pfam_Znf_C2H2,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R210W	ENST00000391708.3	37	c.628	CCDS33123.1	19	.	.	.	.	.	.	.	.	.	.	G	13.81	2.347286	0.41599	.	.	ENSG00000198300	ENST00000391708;ENST00000221722	T;T	0.02140	4.43;4.43	5.21	-1.22	0.09494	Krueppel-associated box (4);	.	.	.	.	T	0.02807	0.0084	M	0.62209	1.925	.	.	.	B	0.30236	0.274	B	0.26094	0.066	T	0.21965	-1.0230	8	0.54805	T	0.06	.	5.9697	0.19344	0.1849:0.0:0.4333:0.3818	.	210	Q9NZV7	ZIM2_HUMAN	W	210	ENSP00000375589:R210W;ENSP00000221722:R210W	ENSP00000221722:R210W	R	-	1	2	ZIM2	61985151	0.000000	0.05858	0.083000	0.20561	0.668000	0.39293	-1.081000	0.03403	-0.175000	0.10725	-0.126000	0.14955	CGG	ZIM2	-	pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.517	ZIM2-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ZIM2	HGNC	protein_coding	OTTHUMT00000416094.2	G			57293339	-1	no_errors	ENST00000221722	ensembl	human	known	70_37	missense	SNP	0.209	A
ZNF292	23036	genome.wustl.edu	37	6	87964521	87964521	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr6:87964521A>G	ENST00000369577.3	+	8	1217	c.1174A>G	c.(1174-1176)Agt>Ggt	p.S392G	ZNF292_ENST00000339907.4_Missense_Mutation_p.S387G	NM_015021.1	NP_055836.1	O60281	ZN292_HUMAN	zinc finger protein 292	392						nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|RNA polymerase II core promoter proximal region sequence-specific DNA binding transcription factor activity involved in positive regulation of transcription (GO:0001077)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(16)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(27)|lung(21)|ovary(4)|prostate(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	89		all_cancers(76;3.82e-09)|Prostate(29;1.34e-10)|Acute lymphoblastic leukemia(125;2.17e-10)|all_hematologic(105;1.08e-06)|all_epithelial(107;5.31e-05)		BRCA - Breast invasive adenocarcinoma(108;0.0199)		TTGTCAACTGAGTGAATTTCT	0.368																																																	0													125.0	117.0	120.0					6																	87964521		1902	4130	6032	SO:0001583	missense	23036			AB011102	CCDS47457.1	6q15	2008-10-23			ENSG00000188994	ENSG00000188994		"""Zinc fingers, C2H2-type"""	18410	protein-coding gene	gene with protein product						9628581	Standard	NM_015021		Approved	KIAA0530, ZFP292, bA393I2.3, Zn-15, Zn-16	uc003plm.4	O60281	OTTHUMG00000015164	ENST00000369577.3:c.1174A>G	6.37:g.87964521A>G	ENSP00000358590:p.Ser392Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W0B2|Q7Z3L7|Q9H8G3|Q9H8J4	Missense_Mutation	SNP	smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S392G	ENST00000369577.3	37	c.1174	CCDS47457.1	6	.	.	.	.	.	.	.	.	.	.	A	18.47	3.631241	0.67015	.	.	ENSG00000188994	ENST00000369577;ENST00000339907	T;T	0.48201	0.82;0.82	5.92	5.92	0.95590	.	0.041757	0.85682	D	0.000000	T	0.42063	0.1186	L	0.38175	1.15	0.44728	D	0.997723	D	0.63046	0.992	P	0.52627	0.704	T	0.45848	-0.9233	10	0.87932	D	0	.	16.3604	0.83263	1.0:0.0:0.0:0.0	.	392	O60281	ZN292_HUMAN	G	392;387	ENSP00000358590:S392G;ENSP00000342847:S387G	ENSP00000342847:S387G	S	+	1	0	ZNF292	88021240	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	9.339000	0.96797	2.260000	0.74910	0.528000	0.53228	AGT	ZNF292	-	NULL		0.368	ZNF292-005	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF292	HGNC	protein_coding	OTTHUMT00000376192.2	A	NM_015021		87964521	+1	no_errors	ENST00000369577	ensembl	human	known	70_37	missense	SNP	1.000	G
ZNF436	80818	genome.wustl.edu	37	1	23689691	23689691	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:23689691C>T	ENST00000314011.4	-	4	320	c.184G>A	c.(184-186)Gag>Aag	p.E62K	ZNF436_ENST00000374608.3_Missense_Mutation_p.E62K	NM_001077195.1	NP_001070663.1	Q9C0F3	ZN436_HUMAN	zinc finger protein 436	62	KRAB. {ECO:0000255|PROSITE- ProRule:PRU00119}.				regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|central_nervous_system(1)|endometrium(3)|large_intestine(2)|lung(8)|skin(1)|stomach(1)|upper_aerodigestive_tract(2)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00262)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0227)|OV - Ovarian serous cystadenocarcinoma(117;6.44e-26)|Colorectal(126;5.5e-08)|COAD - Colon adenocarcinoma(152;3.09e-06)|GBM - Glioblastoma multiforme(114;5.97e-05)|BRCA - Breast invasive adenocarcinoma(304;0.000977)|KIRC - Kidney renal clear cell carcinoma(1967;0.00336)|STAD - Stomach adenocarcinoma(196;0.0127)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0853)|LUSC - Lung squamous cell carcinoma(448;0.187)		GGATTTACCTCGTTCTCACTC	0.363																																																	0													83.0	83.0	83.0					1																	23689691		2203	4300	6503	SO:0001583	missense	80818			AB051497	CCDS233.1	1p36	2013-01-08			ENSG00000125945	ENSG00000125945		"""Zinc fingers, C2H2-type"", ""-"""	20814	protein-coding gene	gene with protein product		611703				11214970	Standard	NM_001077195		Approved	KIAA1710, Zfp46	uc001bgt.3	Q9C0F3	OTTHUMG00000003232	ENST00000314011.4:c.184G>A	1.37:g.23689691C>T	ENSP00000313582:p.Glu62Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q658I9	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.E62K	ENST00000314011.4	37	c.184	CCDS233.1	1	.	.	.	.	.	.	.	.	.	.	C	13.24	2.178965	0.38511	.	.	ENSG00000125945	ENST00000314011;ENST00000374609;ENST00000374608	T;T;T	0.00801	5.68;5.68;5.68	5.85	5.85	0.93711	Krueppel-associated box (3);	0.101831	0.43416	D	0.000578	T	0.00695	0.0023	N	0.10664	0.02	0.38178	D	0.939535	B	0.25007	0.116	B	0.17979	0.02	T	0.59467	-0.7449	10	0.06494	T	0.89	-19.1839	16.0378	0.80642	0.0:1.0:0.0:0.0	.	62	Q9C0F3	ZN436_HUMAN	K	62	ENSP00000313582:E62K;ENSP00000363737:E62K;ENSP00000363736:E62K	ENSP00000313582:E62K	E	-	1	0	ZNF436	23562278	0.010000	0.17322	0.973000	0.42090	0.976000	0.68499	0.631000	0.24568	2.941000	0.99782	0.655000	0.94253	GAG	ZNF436	-	superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,pfscan_Krueppel-associated_box		0.363	ZNF436-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF436	HGNC	protein_coding	OTTHUMT00000008908.1	C	NM_030634		23689691	-1	no_errors	ENST00000314011	ensembl	human	known	70_37	missense	SNP	0.956	T
ZNF461	92283	genome.wustl.edu	37	19	37128584	37128585	+	IGR	INS	-	-	A	rs377169661		TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:37128584_37128585insA	ENST00000588268.1	-	0	2584				ZNF461_ENST00000540605.2_5'Flank	NM_153257.2	NP_694989.2	Q8TAF7	ZN461_HUMAN	zinc finger protein 461						regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)|sequence-specific DNA binding transcription factor activity (GO:0003700)			endometrium(4)|kidney(1)|large_intestine(4)|lung(17)|prostate(1)|urinary_tract(2)	29	Esophageal squamous(110;0.198)		COAD - Colon adenocarcinoma(19;0.0454)|Colorectal(19;0.065)			gggtgtgtctcaaaaaaaaaaa	0.411																																																	0																																										SO:0001628	intergenic_variant	92283			BX649031	CCDS54257.1, CCDS74348.1	19q13.13	2013-01-08				ENSG00000197808		"""Zinc fingers, C2H2-type"", ""-"""	21629	protein-coding gene	gene with protein product		608640				11579202, 15004467	Standard	XM_005259402		Approved	GIOT-1, MGC33911	uc002oem.3	Q8TAF7			19.37:g.37128595_37128595dupA		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K9W9|Q6VSF7|Q9ULZ8	RNA	INS	-	NULL	ENST00000588268.1	37	NULL	CCDS54257.1	19																																																																																			ZNF461	-	-		0.411	ZNF461-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF461	HGNC	protein_coding	OTTHUMT00000453202.1	-	NM_153257		37128585	-1	no_errors	ENST00000589442	ensembl	human	known	70_37	rna	INS	0.003:0.035	A
ZNF536	9745	genome.wustl.edu	37	19	30934829	30934829	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr19:30934829C>T	ENST00000355537.3	+	2	507	c.360C>T	c.(358-360)atC>atT	p.I120I		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	120					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					TGAGCGACATCGAGGACGACG	0.637																																																	0													64.0	51.0	55.0					19																	30934829		2203	4300	6503	SO:0001819	synonymous_variant	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.360C>T	19.37:g.30934829C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU18	Silent	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.I120	ENST00000355537.3	37	c.360	CCDS32984.1	19																																																																																			ZNF536	-	NULL		0.637	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	C	NM_014717		30934829	+1	no_errors	ENST00000355537	ensembl	human	known	70_37	silent	SNP	0.941	T
ZNF70	7621	genome.wustl.edu	37	22	24086430	24086430	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr22:24086430G>A	ENST00000341976.3	-	2	1358	c.898C>T	c.(898-900)Cgg>Tgg	p.R300W		NM_021916.2	NP_068735.1	Q9UC06	ZNF70_HUMAN	zinc finger protein 70	300					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(7)|ovary(3)|prostate(1)|urinary_tract(1)	21						GTGTGGATCCGCTGGTGTCGG	0.552																																																	0													101.0	90.0	94.0					22																	24086430		2203	4300	6503	SO:0001583	missense	7621			X60077	CCDS13812.1	22q11.23	2013-01-08	2006-05-12		ENSG00000187792	ENSG00000187792		"""Zinc fingers, C2H2-type"""	13140	protein-coding gene	gene with protein product		194544	"""zinc finger protein 70 (Cos17)"""			1639391	Standard	NM_021916		Approved	Cos17, MGC48959	uc002zxs.3	Q9UC06	OTTHUMG00000150739	ENST00000341976.3:c.898C>T	22.37:g.24086430G>A	ENSP00000339314:p.Arg300Trp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R300W	ENST00000341976.3	37	c.898	CCDS13812.1	22	.	.	.	.	.	.	.	.	.	.	G	16.05	3.012903	0.54468	.	.	ENSG00000187792	ENST00000341976	T	0.02498	4.27	3.34	-1.55	0.08558	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.05227	0.0139	M	0.90019	3.08	0.25594	N	0.986666	P	0.47484	0.896	B	0.35182	0.197	T	0.17228	-1.0376	9	0.87932	D	0	-24.3398	7.0643	0.25143	0.1283:0.0:0.5328:0.3388	.	300	Q9UC06	ZNF70_HUMAN	W	300	ENSP00000339314:R300W	ENSP00000339314:R300W	R	-	1	2	ZNF70	22416430	0.000000	0.05858	0.965000	0.40720	0.892000	0.51952	-1.768000	0.01794	-0.329000	0.08527	0.456000	0.33151	CGG	ZNF70	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.552	ZNF70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF70	HGNC	protein_coding	OTTHUMT00000319881.1	G	NM_021916		24086430	-1	no_errors	ENST00000341976	ensembl	human	known	70_37	missense	SNP	0.930	A
ZYG11A	440590	genome.wustl.edu	37	1	53308582	53308582	+	Silent	SNP	C	C	T			TCGA-EK-A2GZ-01A-11D-A17W-09	TCGA-EK-A2GZ-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	011036d5-7495-4d6f-9294-edd6cf42d72a	0c7a6420-3ad0-4790-9c3b-2139d4edcc0a	g.chr1:53308582C>T	ENST00000371528.1	+	1	175	c.27C>T	c.(25-27)caC>caT	p.H9H	ZYG11A_ENST00000371532.1_5'UTR	NM_001004339.2	NP_001004339.2	Q6WRX3	ZY11A_HUMAN	zyg-11 family member A, cell cycle regulator	9										breast(2)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|skin(1)	10						ACCCGGGCCACACGCCCCGGA	0.697																																																	0													26.0	27.0	26.0					1																	53308582		692	1591	2283	SO:0001819	synonymous_variant	440590				CCDS44148.1	1p32.3	2013-01-17	2012-12-10		ENSG00000203995	ENSG00000203995		"""ZYG11 cell cycle regulator family"""	32058	protein-coding gene	gene with protein product			"""zyg-11 homolog A (C. elegans)"""				Standard	NM_001004339		Approved	ZYG11	uc001cuk.2	Q6WRX3	OTTHUMG00000008923	ENST00000371528.1:c.27C>T	1.37:g.53308582C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCK5	Silent	SNP	superfamily_ARM-type_fold	p.H9	ENST00000371528.1	37	c.27	CCDS44148.1	1																																																																																			ZYG11A	-	NULL		0.697	ZYG11A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZYG11A	HGNC	protein_coding	OTTHUMT00000024856.3	C	NM_001004339		53308582	+1	no_errors	ENST00000371528	ensembl	human	known	70_37	silent	SNP	0.000	T
