#version 2.4
## 
## Oncotator v1.8.0.0 | Flat File Reference hg19 | GENCODE v19 EFFECT | UniProt_AAxform 2014_12 | ClinVar 12.03.20 | ESP 6500SI-V2 | ORegAnno UCSC Track | dbSNP build 142 | CCLE_By_GP 09292010 | COSMIC v62_291112 | 1000gp3 20130502 | UniProt_AA 2014_12 | dbNSFP v2.4 | ESP 6500SI-V2 | COSMIC_FusionGenes v62_291112 | gencode_xref_refseq metadata_v19 | CCLE_By_Gene 09292010 | ACHILLES_Lineage_Results 110303 | CGC full_2012-03-15 | UniProt 2014_12 | HumanDNARepairGenes 20110905 | HGNC Sept172014 | COSMIC_Tissue 291112 | Familial_Cancer_Genes 20110905 | TUMORScape 20100104 | Ensembl ICGC MUCOPA | TCGAScape 110405 | MutSig Published Results 20110905 
Hugo_Symbol	Entrez_Gene_Id	Center	NCBI_Build	Chromosome	Start_position	End_position	Strand	Variant_Classification	Variant_Type	Reference_Allele	Tumor_Seq_Allele1	Tumor_Seq_Allele2	dbSNP_RS	dbSNP_Val_Status	Tumor_Sample_Barcode	Matched_Norm_Sample_Barcode	Match_Norm_Seq_Allele1	Match_Norm_Seq_Allele2	Tumor_Validation_Allele1	Tumor_Validation_Allele2	Match_Norm_Validation_Allele1	Match_Norm_Validation_Allele2	Verification_Status	Validation_Status	Mutation_Status	Sequencing_Phase	Sequence_Source	Validation_Method	Score	BAM_file	Sequencer	Tumor_Sample_UUID	Matched_Norm_Sample_UUID	Genome_Change	Annotation_Transcript	Transcript_Strand	Transcript_Exon	Transcript_Position	cDNA_Change	Codon_Change	Protein_Change	Other_Transcripts	Refseq_mRNA_Id	Refseq_prot_Id	SwissProt_acc_Id	SwissProt_entry_Id	Description	UniProt_AApos	UniProt_Region	UniProt_Site	UniProt_Natural_Variations	UniProt_Experimental_Info	GO_Biological_Process	GO_Cellular_Component	GO_Molecular_Function	COSMIC_overlapping_mutations	COSMIC_fusion_genes	COSMIC_tissue_types_affected	COSMIC_total_alterations_in_gene	Tumorscape_Amplification_Peaks	Tumorscape_Deletion_Peaks	TCGAscape_Amplification_Peaks	TCGAscape_Deletion_Peaks	DrugBank	ref_context	gc_content	CCLE_ONCOMAP_overlapping_mutations	CCLE_ONCOMAP_total_mutations_in_gene	CGC_Mutation_Type	CGC_Translocation_Partner	CGC_Tumor_Types_Somatic	CGC_Tumor_Types_Germline	CGC_Other_Diseases	DNARepairGenes_Role	FamilialCancerDatabase_Syndromes	MUTSIG_Published_Results	OREGANNO_ID	OREGANNO_Values	i_1000gp3_AA	i_1000gp3_AC	i_1000gp3_AF	i_1000gp3_AFR_AF	i_1000gp3_AMR_AF	i_1000gp3_AN	i_1000gp3_CIEND	i_1000gp3_CIPOS	i_1000gp3_CS	i_1000gp3_DP	i_1000gp3_EAS_AF	i_1000gp3_END	i_1000gp3_EUR_AF	i_1000gp3_IMPRECISE	i_1000gp3_MC	i_1000gp3_MEINFO	i_1000gp3_MEND	i_1000gp3_MLEN	i_1000gp3_MSTART	i_1000gp3_NS	i_1000gp3_SAS_AF	i_1000gp3_SVLEN	i_1000gp3_SVTYPE	i_1000gp3_TSD	i_ACHILLES_Lineage_Results_Top_Genes	i_BAM_File	i_CGC_Cancer Germline Mut	i_CGC_Cancer Molecular Genetics	i_CGC_Cancer Somatic Mut	i_CGC_Cancer Syndrome	i_CGC_Chr	i_CGC_Chr Band	i_CGC_GeneID	i_CGC_Name	i_CGC_Other Germline Mut	i_CGC_Tissue Type	i_COSMIC_n_overlapping_mutations	i_COSMIC_overlapping_mutation_descriptions	i_COSMIC_overlapping_primary_sites	i_ClinVar_ASSEMBLY	i_ClinVar_HGMD_ID	i_ClinVar_SYM	i_ClinVar_TYPE	i_ClinVar_rs	i_ESP_AA	i_ESP_AAC	i_ESP_AA_AC	i_ESP_AA_AGE	i_ESP_AA_GTC	i_ESP_AvgAAsampleReadDepth	i_ESP_AvgEAsampleReadDepth	i_ESP_AvgSampleReadDepth	i_ESP_CA	i_ESP_CDP	i_ESP_CG	i_ESP_CP	i_ESP_Chromosome	i_ESP_DBSNP	i_ESP_DP	i_ESP_EA_AC	i_ESP_EA_AGE	i_ESP_EA_GTC	i_ESP_EXOME_CHIP	i_ESP_FG	i_ESP_GL	i_ESP_GM	i_ESP_GS	i_ESP_GTC	i_ESP_GTS	i_ESP_GWAS_PUBMED	i_ESP_MAF	i_ESP_PH	i_ESP_PP	i_ESP_Position	i_ESP_TAC	i_ESP_TotalAAsamplesCovered	i_ESP_TotalEAsamplesCovered	i_ESP_TotalSamplesCovered	i_Ensembl_so_accession	i_Ensembl_so_term	i_Entrez_Gene_Id	i_Familial_Cancer_Genes_Reference	i_Familial_Cancer_Genes_Synonym	i_HGNC_Accession Numbers	i_HGNC_CCDS IDs	i_HGNC_Chromosome	i_HGNC_Date Modified	i_HGNC_Date Name Changed	i_HGNC_Date Symbol Changed	i_HGNC_Ensembl Gene ID	i_HGNC_Ensembl ID(supplied by Ensembl)	i_HGNC_Enzyme IDs	i_HGNC_Gene family description	i_HGNC_HGNC ID	i_HGNC_Locus Group	i_HGNC_Locus Type	i_HGNC_Name Synonyms	i_HGNC_OMIM ID(supplied by NCBI)	i_HGNC_Previous Names	i_HGNC_Previous Symbols	i_HGNC_Primary IDs	i_HGNC_Pubmed IDs	i_HGNC_Record Type	i_HGNC_RefSeq(supplied by NCBI)	i_HGNC_Secondary IDs	i_HGNC_Status	i_HGNC_Synonyms	i_HGNC_UCSC ID(supplied by UCSC)	i_HGNC_UniProt ID(supplied by UniProt)	i_HGNC_VEGA IDs	i_HGVS_coding_DNA_change	i_HGVS_genomic_change	i_HGVS_protein_change	i_Mutation_Status	i_ORegAnno_bin	i_Sequence_Source	i_Sequencer	i_Sequencing_Phase	i_UniProt_alt_uniprot_accessions	i_Variant_Classification	i_Variant_Type	i_all_domains	i_amino_acid_change	i_annotation_transcript	i_build	i_c_position	i_ccds_id	i_chromosome_name	i_dbNSFP_1000Gp1_AC	i_dbNSFP_1000Gp1_AF	i_dbNSFP_1000Gp1_AFR_AC	i_dbNSFP_1000Gp1_AFR_AF	i_dbNSFP_1000Gp1_AMR_AC	i_dbNSFP_1000Gp1_AMR_AF	i_dbNSFP_1000Gp1_ASN_AC	i_dbNSFP_1000Gp1_ASN_AF	i_dbNSFP_1000Gp1_EUR_AC	i_dbNSFP_1000Gp1_EUR_AF	i_dbNSFP_Ancestral_allele	i_dbNSFP_CADD_phred	i_dbNSFP_CADD_raw	i_dbNSFP_CADD_raw_rankscore	i_dbNSFP_ESP6500_AA_AF	i_dbNSFP_ESP6500_EA_AF	i_dbNSFP_Ensembl_geneid	i_dbNSFP_Ensembl_transcriptid	i_dbNSFP_FATHMM_pred	i_dbNSFP_FATHMM_rankscore	i_dbNSFP_FATHMM_score	i_dbNSFP_GERP++_NR	i_dbNSFP_GERP++_RS	i_dbNSFP_GERP++_RS_rankscore	i_dbNSFP_Interpro_domain	i_dbNSFP_LRT_Omega	i_dbNSFP_LRT_converted_rankscore	i_dbNSFP_LRT_pred	i_dbNSFP_LRT_score	i_dbNSFP_LR_pred	i_dbNSFP_LR_rankscore	i_dbNSFP_LR_score	i_dbNSFP_MutationAssessor_pred	i_dbNSFP_MutationAssessor_rankscore	i_dbNSFP_MutationAssessor_score	i_dbNSFP_MutationTaster_converted_rankscore	i_dbNSFP_MutationTaster_pred	i_dbNSFP_MutationTaster_score	i_dbNSFP_Polyphen2_HDIV_pred	i_dbNSFP_Polyphen2_HDIV_rankscore	i_dbNSFP_Polyphen2_HDIV_score	i_dbNSFP_Polyphen2_HVAR_pred	i_dbNSFP_Polyphen2_HVAR_rankscore	i_dbNSFP_Polyphen2_HVAR_score	i_dbNSFP_RadialSVM_pred	i_dbNSFP_RadialSVM_rankscore	i_dbNSFP_RadialSVM_score	i_dbNSFP_Reliability_index	i_dbNSFP_SIFT_converted_rankscore	i_dbNSFP_SIFT_pred	i_dbNSFP_SIFT_score	i_dbNSFP_SLR_test_statistic	i_dbNSFP_SiPhy_29way_logOdds	i_dbNSFP_SiPhy_29way_logOdds_rankscore	i_dbNSFP_SiPhy_29way_pi	i_dbNSFP_UniSNP_ids	i_dbNSFP_Uniprot_aapos	i_dbNSFP_Uniprot_acc	i_dbNSFP_Uniprot_id	i_dbNSFP_aaalt	i_dbNSFP_aapos	i_dbNSFP_aapos_FATHMM	i_dbNSFP_aapos_SIFT	i_dbNSFP_aaref	i_dbNSFP_cds_strand	i_dbNSFP_codonpos	i_dbNSFP_fold-degenerate	i_dbNSFP_genename	i_dbNSFP_hg18_pos(1-coor)	i_dbNSFP_phastCons100way_vertebrate	i_dbNSFP_phastCons100way_vertebrate_rankscore	i_dbNSFP_phastCons46way_placental	i_dbNSFP_phastCons46way_placental_rankscore	i_dbNSFP_phastCons46way_primate	i_dbNSFP_phastCons46way_primate_rankscore	i_dbNSFP_phyloP100way_vertebrate	i_dbNSFP_phyloP100way_vertebrate_rankscore	i_dbNSFP_phyloP46way_placental	i_dbNSFP_phyloP46way_placental_rankscore	i_dbNSFP_phyloP46way_primate	i_dbNSFP_phyloP46way_primate_rankscore	i_dbNSFP_refcodon	i_default_gene_name	i_deletion_substructures	i_domain	i_entrez_gene_id	i_gc_content_full	i_gencode_transcript_name	i_gencode_transcript_status	i_gencode_transcript_tags	i_gencode_transcript_type	i_gene_name	i_gene_name_source	i_gene_type	i_havana_transcript	i_reference	i_refseq_mrna_id	i_secondary_variant_classification	i_stop	i_strand	i_transcript_error	i_transcript_name	i_transcript_source	i_transcript_species	i_transcript_status	i_transcript_version	i_trv_type	i_type	i_ucsc_cons	i_variant
ABCC3	8714	genome.wustl.edu	37	17	48742570	48742570	+	Silent	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:48742570C>G	ENST00000285238.8	+	11	1475	c.1395C>G	c.(1393-1395)ctC>ctG	p.L465L	ABCC3_ENST00000427699.1_Silent_p.L465L	NM_003786.3	NP_003777.2	O15438	MRP3_HUMAN	ATP-binding cassette, sub-family C (CFTR/MRP), member 3	465	ABC transmembrane type-1 1. {ECO:0000255|PROSITE-ProRule:PRU00441}.				bile acid and bile salt transport (GO:0015721)|bile acid metabolic process (GO:0008206)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	integral component of plasma membrane (GO:0005887)|membrane (GO:0016020)|plasma membrane (GO:0005886)	ATP binding (GO:0005524)|ATPase activity, coupled to transmembrane movement of substances (GO:0042626)|organic anion transmembrane transporter activity (GO:0008514)			breast(1)|central_nervous_system(2)|endometrium(2)|kidney(1)|large_intestine(6)|liver(1)|lung(11)|prostate(3)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(2)	33			BRCA - Breast invasive adenocarcinoma(22;3.05e-09)		Cisplatin(DB00515)|Clotrimazole(DB00257)|Conjugated Estrogens(DB00286)|Cyclosporine(DB00091)|Doxorubicin(DB00997)|Etoposide(DB00773)|Ezetimibe(DB00973)|Fluorouracil(DB00544)|Folic Acid(DB00158)|Gadoxetate(DB08884)|Glutathione(DB00143)|Glyburide(DB01016)|Indomethacin(DB00328)|Lamivudine(DB00709)|Leucovorin(DB00650)|Methotrexate(DB00563)|Metyrapone(DB01011)|Nifedipine(DB01115)|Omeprazole(DB00338)|Phenobarbital(DB01174)|Probenecid(DB01032)|Rifampicin(DB01045)|Sulfinpyrazone(DB01138)|Verapamil(DB00661)|Vincristine(DB00541)	TGATTCCACTCAACGGAGCTG	0.602																																																	0													147.0	108.0	121.0					17																	48742570		2203	4300	6503	SO:0001819	synonymous_variant	8714			Y17151	CCDS32681.1, CCDS45739.1	17q21	2012-03-14			ENSG00000108846	ENSG00000108846		"""ATP binding cassette transporters / subfamily C"""	54	protein-coding gene	gene with protein product	"""canalicular multispecific organic anion transporter 2"""	604323				8894702, 9827529	Standard	NM_003786		Approved	MRP3, cMOAT2, EST90757, MLP2, MOAT-D	uc002isl.3	O15438	OTTHUMG00000162245	ENST00000285238.8:c.1395C>G	17.37:g.48742570C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RPA9|D3DTX9|O60265|O60922|O75621|O95078|O95289|O95290|Q86X85|Q9UN52	Missense_Mutation	SNP	NULL	p.Q484E	ENST00000285238.8	37	c.1450	CCDS32681.1	17																																																																																			ABCC3	-	NULL		0.602	ABCC3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ABCC3	HGNC	protein_coding	OTTHUMT00000368083.2	C	NM_020038		48742570	+1	no_errors	ENST00000502426	ensembl	human	known	70_37	missense	SNP	0.951	G
ABL2	27	genome.wustl.edu	37	1	179077403	179077403	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:179077403G>C	ENST00000502732.1	-	12	3202	c.2999C>G	c.(2998-3000)tCa>tGa	p.S1000*	ABL2_ENST00000504405.1_Nonsense_Mutation_p.S861*|ABL2_ENST00000367623.4_Nonsense_Mutation_p.S979*|ABL2_ENST00000408940.3_Nonsense_Mutation_p.S964*|ABL2_ENST00000344730.3_Nonsense_Mutation_p.S882*|ABL2_ENST00000512653.1_Nonsense_Mutation_p.S985*|ABL2_ENST00000511413.1_Nonsense_Mutation_p.S897*|ABL2_ENST00000507173.1_Nonsense_Mutation_p.S876*	NM_001168236.1|NM_001168237.1|NM_001168238.1|NM_007314.3	NP_001161708.1|NP_001161709.1|NP_001161710.1|NP_009298.1	P42684	ABL2_HUMAN	ABL proto-oncogene 2, non-receptor tyrosine kinase	1000	Pro-rich.				actin filament bundle assembly (GO:0051017)|axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular protein modification process (GO:0006464)|cellular response to retinoic acid (GO:0071300)|peptidyl-tyrosine phosphorylation (GO:0018108)|positive regulation of cytosolic calcium ion concentration (GO:0007204)|positive regulation of neuron projection development (GO:0010976)|positive regulation of oxidoreductase activity (GO:0051353)|positive regulation of phospholipase C activity (GO:0010863)|regulation of actin cytoskeleton reorganization (GO:2000249)|regulation of autophagy (GO:0010506)|regulation of cell adhesion (GO:0030155)|regulation of cell motility (GO:2000145)|regulation of endocytosis (GO:0030100)|signal transduction (GO:0007165)	actin cytoskeleton (GO:0015629)|cytosol (GO:0005829)	actin filament binding (GO:0051015)|actin monomer binding (GO:0003785)|ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|manganese ion binding (GO:0030145)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein kinase activity (GO:0004672)|protein tyrosine kinase activity (GO:0004713)			breast(8)|central_nervous_system(1)|endometrium(7)|kidney(1)|large_intestine(9)|lung(32)|ovary(3)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	65					Adenosine triphosphate(DB00171)|Dasatinib(DB01254)	TGTAGGGTCTGAGCAGATGGA	0.567			T	ETV6	AML																																			Dom	yes		1	1q24-q25	27	v-abl Abelson murine leukemia viral oncogene homolog 2		L	0													127.0	117.0	120.0					1																	179077403		2203	4300	6503	SO:0001587	stop_gained	27			M14904	CCDS30947.1, CCDS41441.1, CCDS44282.1, CCDS44283.1, CCDS41441.2, CCDS53435.1, CCDS53436.1, CCDS53437.1, CCDS53438.1	1q25.2	2014-06-26	2014-06-26		ENSG00000143322	ENSG00000143322		"""SH2 domain containing"""	77	protein-coding gene	gene with protein product	"""Abelson-related gene"""	164690	"""v-abl Abelson murine leukemia viral oncogene homolog 2 (arg, Abelson-related gene)"", ""v-abl Abelson murine leukemia viral oncogene homolog 2"", ""c-abl oncogene 2, non-receptor tyrosine kinase"""	ABLL		3787260	Standard	NM_001136001		Approved	ARG	uc001gmi.4	P42684	OTTHUMG00000035199	ENST00000502732.1:c.2999C>G	1.37:g.179077403G>C	ENSP00000427562:p.Ser1000*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0M8X0|B7UEF2|B7UEF3|B7UEF4|B7UEF5|Q5T0X6|Q5W0C5|Q6NZY6|Q7Z301	Nonsense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_F-actin_binding,pfam_Prot_kinase_cat_dom,pfam_SH2,pfam_SH3_domain,pfam_SH3_2,pfam_SH3-like_bac,superfamily_Kinase-like_dom,superfamily_SH3_domain,smart_SH3_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,smart_F-actin_binding,pfscan_SH2,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH2	p.S1000*	ENST00000502732.1	37	c.2999	CCDS30947.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.288395	0.80803	.	.	ENSG00000143322	ENST00000502732;ENST00000408940;ENST00000344730;ENST00000512653;ENST00000504405;ENST00000367623;ENST00000507173;ENST00000511413	.	.	.	5.4	5.4	0.78164	.	0.316600	0.22750	N	0.056098	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.45353	T	0.12	.	14.1823	0.65583	0.0:0.1495:0.8505:0.0	.	.	.	.	X	1000;964;882;985;861;979;876;897	.	ENSP00000339209:S882X	S	-	2	0	ABL2	177344026	1.000000	0.71417	0.997000	0.53966	0.543000	0.35085	5.659000	0.68010	2.679000	0.91253	0.655000	0.94253	TCA	ABL2	-	NULL		0.567	ABL2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ABL2	HGNC	protein_coding	OTTHUMT00000085174.3	G	NM_005158		179077403	-1	no_errors	ENST00000502732	ensembl	human	known	70_37	nonsense	SNP	1.000	C
ADAMTS10	81794	genome.wustl.edu	37	19	8657677	8657677	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:8657677C>T	ENST00000597188.1	-	13	1827	c.1557G>A	c.(1555-1557)acG>acA	p.T519T	ADAMTS10_ENST00000595838.1_5'Flank|ADAMTS10_ENST00000270328.4_Silent_p.T519T	NM_030957.2	NP_112219.3	Q9H324	ATS10_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 10	519	Disintegrin.					extracellular matrix (GO:0031012)|microfibril (GO:0001527)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|breast(2)|endometrium(2)|kidney(16)|large_intestine(5)|lung(9)|ovary(1)|pancreas(2)|prostate(3)|skin(10)|urinary_tract(1)	53						TCTGGCACAGCGTGCCCTCGG	0.706																																																	0													35.0	32.0	33.0					19																	8657677		2202	4297	6499	SO:0001819	synonymous_variant	81794			AF163762	CCDS12206.1, CCDS62529.1	19p13.2	2014-08-12	2005-08-19		ENSG00000142303	ENSG00000142303		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	13201	protein-coding gene	gene with protein product		608990	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 10"""				Standard	XM_005272499		Approved	ADAM-TS10	uc002mkj.1	Q9H324	OTTHUMG00000182216	ENST00000597188.1:c.1557G>A	19.37:g.8657677C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	M0QZE4	Silent	SNP	pfam_Peptidase_M12B_N,pfam_Peptidase_M12B,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_PLAC,superfamily_Thrombospondin_1_rpt,smart_Thrombospondin_1_rpt,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B,prints_Peptidase_M12B_ADAM-TS	p.T519	ENST00000597188.1	37	c.1557	CCDS12206.1	19																																																																																			ADAMTS10	-	NULL		0.706	ADAMTS10-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ADAMTS10	HGNC	protein_coding	OTTHUMT00000460085.3	C	NM_030957		8657677	-1	no_errors	ENST00000270328	ensembl	human	known	70_37	silent	SNP	0.999	T
ADAMTS14	140766	genome.wustl.edu	37	10	72517980	72517980	+	Silent	SNP	G	G	A	rs368301219		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:72517980G>A	ENST00000373207.1	+	21	3117	c.3117G>A	c.(3115-3117)acG>acA	p.T1039T	ADAMTS14_ENST00000373208.1_Silent_p.T1042T	NM_080722.3	NP_542453.2	Q8WXS8	ATS14_HUMAN	ADAM metallopeptidase with thrombospondin type 1 motif, 14	1039					collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix organization (GO:0030198)	extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	metalloendopeptidase activity (GO:0004222)|zinc ion binding (GO:0008270)			NS(1)|autonomic_ganglia(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(11)|lung(15)|ovary(7)|prostate(3)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	50						AACTTGGGACGCCAGAGGGGC	0.527																																																	0													102.0	93.0	96.0					10																	72517980		2203	4300	6503	SO:0001819	synonymous_variant	140766			AF358666	CCDS7306.1, CCDS7307.1	10q21	2008-08-01	2005-08-19		ENSG00000138316	ENSG00000138316		"""ADAM metallopeptidases with thrombospondin type 1 motif"""	14899	protein-coding gene	gene with protein product		607506	"""a disintegrin-like and metalloprotease (reprolysin type) with thrombospondin type 1 motif, 14"""			11779638	Standard	NM_139155		Approved		uc001jrg.3	Q8WXS8	OTTHUMG00000018414	ENST00000373207.1:c.3117G>A	10.37:g.72517980G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T4G0|Q5T4G1|Q8TE55|Q8TEY8	Silent	SNP	pfam_Peptidase_M12B_N,pfam_ADAM_spacer1,pfam_Thrombospondin_1_rpt,pfam_Peptidase_M12B,superfamily_Thrombospondin_1_rpt,smart_ADAM_Cys-rich,smart_Thrombospondin_1_rpt,prints_Peptidase_M12B_ADAM-TS,pfscan_PLAC,pfscan_Thrombospondin_1_rpt,pfscan_Peptidase_M12B	p.T1042	ENST00000373207.1	37	c.3126	CCDS7306.1	10																																																																																			ADAMTS14	-	NULL		0.527	ADAMTS14-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	ADAMTS14	HGNC	protein_coding	OTTHUMT00000048522.1	G	NM_080722		72517980	+1	no_errors	ENST00000373208	ensembl	human	known	70_37	silent	SNP	0.007	A
AZIN2	113451	genome.wustl.edu	37	1	33546851	33546851	+	5'UTR	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:33546851C>T	ENST00000294517.6	+	0	138				ADC_ENST00000373441.1_5'Flank|ADC_ENST00000373440.1_5'Flank|ADC_ENST00000373443.3_5'UTR|ADC_ENST00000398167.1_5'UTR|ADC_ENST00000358680.3_5'UTR	NM_052998.2	NP_443724.1	Q96A70	AZIN2_HUMAN							agmatine biosynthetic process (GO:0097055)|cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of protein catabolic process (GO:0042177)|ornithine metabolic process (GO:0006591)|polyamine biosynthetic process (GO:0006596)|polyamine metabolic process (GO:0006595)|positive regulation of catalytic activity (GO:0043085)|positive regulation of polyamine transmembrane transport (GO:1902269)|putrescine transport (GO:0015847)|small molecule metabolic process (GO:0044281)|spermatogenesis (GO:0007283)|trans-Golgi network membrane organization (GO:0098629)	axon (GO:0030424)|cis-Golgi network (GO:0005801)|cytoplasmic vesicle (GO:0031410)|cytosol (GO:0005829)|dendrite (GO:0030425)|endoplasmic reticulum-Golgi intermediate compartment membrane (GO:0033116)|granular vesicle (GO:1990005)|mitochondrion (GO:0005739)|nucleus (GO:0005634)|perikaryon (GO:0043204)|perinuclear region of cytoplasm (GO:0048471)|trans-Golgi network (GO:0005802)|transport vesicle (GO:0030133)	catalytic activity (GO:0003824)|ornithine decarboxylase activator activity (GO:0042978)|putrescine transmembrane transporter activity (GO:0015489)			NS(1)|endometrium(2)|large_intestine(2)|lung(4)|ovary(2)	11		Myeloproliferative disorder(586;0.0255)|all_neural(195;0.0837)			L-Arginine(DB00125)	CCGATTCACTCCCTGGGGAGA	0.711																																																	0																																										SO:0001623	5_prime_UTR_variant	0																														ENST00000294517.6:c.-450C>T	1.37:g.33546851C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RDU5|D3DPQ9|Q5TIF4|Q5TIF5|Q5TIF6|Q8TF56|Q96L54|Q96L55|Q96L56|Q96L57|Q96MD9	RNA	SNP	-	NULL	ENST00000294517.6	37	NULL	CCDS375.1	1																																																																																			ADC	-	-		0.711	ADC-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	ADC	HGNC	protein_coding	OTTHUMT00000011867.1	C			33546851	+1	no_errors	ENST00000462920	ensembl	human	known	70_37	rna	SNP	1.000	T
ADNP	23394	genome.wustl.edu	37	20	49508892	49508892	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr20:49508892C>A	ENST00000396029.3	-	5	2926	c.2359G>T	c.(2359-2361)Gag>Tag	p.E787*	ADNP_ENST00000371602.4_Nonsense_Mutation_p.E787*|ADNP_ENST00000396032.3_Nonsense_Mutation_p.E787*|ADNP_ENST00000349014.3_Nonsense_Mutation_p.E787*	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	787					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						GCTAGCTTCTCAATTTCTCTC	0.418																																																	0													88.0	83.0	85.0					20																	49508892		2203	4300	6503	SO:0001587	stop_gained	23394			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2359G>T	20.37:g.49508892C>A	ENSP00000379346:p.Glu787*	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E787*	ENST00000396029.3	37	c.2359	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	46	12.174023	0.99643	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	5.88	5.88	0.94601	.	0.098367	0.64402	D	0.000001	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-18.9273	20.2187	0.98312	0.0:1.0:0.0:0.0	.	.	.	.	X	787	.	ENSP00000342905:E787X	E	-	1	0	ADNP	48942299	1.000000	0.71417	1.000000	0.80357	0.994000	0.84299	7.476000	0.81055	2.780000	0.95670	0.655000	0.94253	GAG	ADNP	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain		0.418	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	C	NM_181442		49508892	-1	no_errors	ENST00000349014	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ADNP	23394	genome.wustl.edu	37	20	49509062	49509062	+	Missense_Mutation	SNP	C	C	A	rs377051194		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr20:49509062C>A	ENST00000396029.3	-	5	2756	c.2189G>T	c.(2188-2190)cGa>cTa	p.R730L	ADNP_ENST00000371602.4_Missense_Mutation_p.R730L|ADNP_ENST00000396032.3_Missense_Mutation_p.R730L|ADNP_ENST00000349014.3_Missense_Mutation_p.R730L	NM_001282531.1|NM_015339.2	NP_001269460.1|NP_056154.1	Q9H2P0	ADNP_HUMAN	activity-dependent neuroprotector homeobox	730					negative regulation of neuron apoptotic process (GO:0043524)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	extracellular space (GO:0005615)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(1)|breast(4)|endometrium(7)|kidney(1)|large_intestine(13)|lung(7)|ovary(2)|prostate(2)|skin(2)	39						ATCTAACTTTCGTTTTTTCAG	0.443																																																	0													80.0	80.0	80.0					20																	49509062		2203	4300	6503	SO:0001583	missense	23394			AF250860	CCDS13433.1	20q13.13	2011-06-20	2007-07-17		ENSG00000101126	ENSG00000101126		"""Homeoboxes / ZF class"""	15766	protein-coding gene	gene with protein product	"""ADNP homeobox 1"""	611386	"""activity-dependent neuroprotector"""			9872452, 11013255	Standard	NM_015339		Approved	KIAA0784, ADNP1	uc002xvu.1	Q9H2P0	OTTHUMG00000032737	ENST00000396029.3:c.2189G>T	20.37:g.49509062C>A	ENSP00000379346:p.Arg730Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5Y2|O94881|Q5BKU2|Q9UG34	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_C2H2-like,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.R730L	ENST00000396029.3	37	c.2189	CCDS13433.1	20	.	.	.	.	.	.	.	.	.	.	C	15.19	2.760538	0.49468	.	.	ENSG00000101126	ENST00000371602;ENST00000349014;ENST00000396029;ENST00000396032	.	.	.	6.07	5.14	0.70334	.	0.046201	0.85682	D	0.000000	T	0.55000	0.1893	L	0.40543	1.245	0.42726	D	0.993698	B	0.19817	0.039	B	0.12837	0.008	T	0.53669	-0.8406	9	0.54805	T	0.06	-16.7209	15.2523	0.73556	0.0:0.9332:0.0:0.0668	.	730	Q9H2P0	ADNP_HUMAN	L	730	.	ENSP00000342905:R730L	R	-	2	0	ADNP	48942469	0.909000	0.30893	0.977000	0.42913	0.798000	0.45092	2.898000	0.48672	1.584000	0.49913	0.655000	0.94253	CGA	ADNP	-	NULL		0.443	ADNP-002	KNOWN	basic|appris_principal|CCDS	protein_coding	ADNP	HGNC	protein_coding	OTTHUMT00000079705.2	C	NM_181442		49509062	-1	no_errors	ENST00000349014	ensembl	human	known	70_37	missense	SNP	0.974	A
AHNAK2	113146	genome.wustl.edu	37	14	105408926	105408926	+	Missense_Mutation	SNP	C	C	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:105408926C>A	ENST00000333244.5	-	7	12981	c.12862G>T	c.(12862-12864)Gac>Tac	p.D4288Y	AHNAK2_ENST00000557457.1_Intron	NM_138420.2	NP_612429.2	Q8IVF2	AHNK2_HUMAN	AHNAK nucleoprotein 2	4288						costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoplasmic vesicle membrane (GO:0030659)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|T-tubule (GO:0030315)|Z disc (GO:0030018)				cervix(4)|endometrium(4)|large_intestine(3)|lung(14)|ovary(2)|prostate(2)|skin(1)|stomach(3)	33		all_cancers(154;0.115)|Melanoma(154;0.155)|all_epithelial(191;0.183)	all cancers(16;0.000479)|OV - Ovarian serous cystadenocarcinoma(23;0.00659)|Epithelial(46;0.0151)|GBM - Glioblastoma multiforme(11;0.116)			ATGTCCTTGTCGGCTAGGGAC	0.617																																																	0													206.0	220.0	215.0					14																	105408926		2018	4156	6174	SO:0001583	missense	113146			AB095939	CCDS45177.1	14q32.33	2010-04-01	2007-03-26	2007-03-26	ENSG00000185567	ENSG00000185567			20125	protein-coding gene	gene with protein product		608570	"""chromosome 14 open reading frame 78"""	C14orf78		15007166	Standard	NM_138420		Approved		uc010axc.1	Q8IVF2		ENST00000333244.5:c.12862G>T	14.37:g.105408926C>A	ENSP00000353114:p.Asp4288Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5BKX7|Q7Z343|Q7Z358|Q7Z394|Q7Z3G0|Q86WQ6|Q8IYY1|Q8N3G4|Q96EX9	Missense_Mutation	SNP	superfamily_PDZ,smart_PDZ,pfscan_PDZ	p.D4288Y	ENST00000333244.5	37	c.12862	CCDS45177.1	14	.	.	.	.	.	.	.	.	.	.	c	12.52	1.962700	0.34659	.	.	ENSG00000185567	ENST00000333244	T	0.01854	4.6	3.22	1.23	0.21249	.	.	.	.	.	T	0.13243	0.0321	M	0.93898	3.47	0.09310	N	1	D	0.76494	0.999	D	0.73380	0.98	T	0.07635	-1.0762	9	0.62326	D	0.03	-12.5438	4.1603	0.10280	0.0:0.5572:0.2195:0.2233	.	4288	Q8IVF2	AHNK2_HUMAN	Y	4288	ENSP00000353114:D4288Y	ENSP00000353114:D4288Y	D	-	1	0	AHNAK2	104479971	0.655000	0.27376	0.006000	0.13384	0.007000	0.05969	0.878000	0.28126	0.305000	0.22832	0.289000	0.19496	GAC	AHNAK2	-	NULL		0.617	AHNAK2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	AHNAK2	HGNC	protein_coding	OTTHUMT00000410300.1	C	NM_138420		105408926	-1	no_errors	ENST00000333244	ensembl	human	known	70_37	missense	SNP	0.000	A
AK9	221264	genome.wustl.edu	37	6	109837659	109837659	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:109837659C>G	ENST00000424296.2	-	30	3896	c.3820G>C	c.(3820-3822)Gat>Cat	p.D1274H		NM_001145128.2	NP_001138600.2	Q5TCS8	KAD9_HUMAN	adenylate kinase 9	1274					ADP phosphorylation (GO:0006757)|AMP phosphorylation (GO:0006756)|CDP phosphorylation (GO:0061508)|CMP phosphorylation (GO:0061566)|dADP phosphorylation (GO:0006174)|dAMP phosphorylation (GO:0061565)|dCDP phosphorylation (GO:0061570)|dCMP phosphorylation (GO:0061567)|dGDP phosphorylation (GO:0006186)|GDP phosphorylation (GO:0061568)|TDP phosphorylation (GO:0061571)|UDP phosphorylation (GO:0061569)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleolus (GO:0005730)|nucleus (GO:0005634)	ATP binding (GO:0005524)|nucleoside diphosphate kinase activity (GO:0004550)|nucleoside phosphate kinase activity (GO:0050145)										TTATGTGTATCTGCTTCAAAT	0.338																																																	0													134.0	112.0	118.0					6																	109837659		692	1591	2283	SO:0001583	missense	221264			AK131244, BC146443, BC087860	CCDS5077.1, CCDS55048.1	6q21	2013-04-29	2013-04-29	2013-04-29			2.7.4.3		33814	protein-coding gene	gene with protein product		615358	"""chromosome 6 open reading frame 224"", ""adenylate kinase domain containing 2"", ""chromosome 6 open reading frame 199"", ""adenylate kinase domain containing 1"""	C6orf224, AKD2, C6orf199, AKD1		23416111	Standard	NM_145025		Approved	FLJ42177, FLJ25791, dJ70A9.1, MGC26954		Q5TCS8		ENST00000424296.2:c.3820G>C	6.37:g.109837659C>G	ENSP00000410186:p.Asp1274His	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NL75|B2RDJ0|B6ZDM7|Q3MIS4|Q5I0W8|Q6ZNF1|Q6ZVR7|Q8N7C6|Q8WW00|Q96NF4	Missense_Mutation	SNP	pfam_Adenylate_kin,pfam_YHS,smart_AAA+_ATPase	p.D1274H	ENST00000424296.2	37	c.3820	CCDS55048.1	6	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	11.40|11.40	1.628774|1.628774	0.28978|0.28978	.|.	.|.	ENSG00000155085|ENSG00000155085	ENST00000424296|ENST00000470564	T|.	0.67698|.	-0.28|.	4.99|4.99	4.99|4.99	0.66335|0.66335	ATPase, AAA+ type, core (1);|.	.|.	.|.	.|.	.|.	T|T	0.49474|0.49474	0.1559|0.1559	L|L	0.38175|0.38175	1.15|1.15	0.80722|0.80722	D|D	1|1	D|.	0.58970|.	0.984|.	P|.	0.48030|.	0.564|.	T|T	0.46105|0.46105	-0.9215|-0.9215	8|5	.|.	.|.	.|.	.|.	17.9026|17.9026	0.88909|0.88909	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	1274|.	Q5TCS8|.	AKD1_HUMAN|.	H|H	1274|111	ENSP00000410186:D1274H|.	.|.	D|Q	-|-	1|3	0|2	AKD1|AKD1	109944352|109944352	1.000000|1.000000	0.71417|0.71417	0.292000|0.292000	0.24919|0.24919	0.074000|0.074000	0.17049|0.17049	4.293000|4.293000	0.59037|0.59037	2.316000|2.316000	0.78162|0.78162	0.650000|0.650000	0.86243|0.86243	GAT|CAG	AKD1	-	smart_AAA+_ATPase		0.338	AK9-202	KNOWN	basic|appris_principal|CCDS	protein_coding	AKD1	HGNC	protein_coding		C	NM_001145128		109837659	-1	no_errors	ENST00000424296	ensembl	human	known	70_37	missense	SNP	0.989	G
ALDH1A2	8854	genome.wustl.edu	37	15	58284946	58284946	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr15:58284946G>C	ENST00000249750.4	-	7	1522	c.755C>G	c.(754-756)tCt>tGt	p.S252C	ALDH1A2_ENST00000558231.1_Missense_Mutation_p.S223C|ALDH1A2_ENST00000537372.1_Missense_Mutation_p.S231C|ALDH1A2_ENST00000559517.1_Missense_Mutation_p.S156C|ALDH1A2_ENST00000347587.3_Intron	NM_003888.3	NP_003879.2	O94788	AL1A2_HUMAN	aldehyde dehydrogenase 1 family, member A2	252					9-cis-retinoic acid biosynthetic process (GO:0042904)|anterior/posterior pattern specification (GO:0009952)|blood vessel development (GO:0001568)|cardiac muscle tissue development (GO:0048738)|cellular response to retinoic acid (GO:0071300)|determination of bilateral symmetry (GO:0009855)|embryonic camera-type eye development (GO:0031076)|embryonic digestive tract development (GO:0048566)|embryonic forelimb morphogenesis (GO:0035115)|face development (GO:0060324)|heart morphogenesis (GO:0003007)|hindbrain development (GO:0030902)|kidney development (GO:0001822)|liver development (GO:0001889)|lung development (GO:0030324)|midgut development (GO:0007494)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of cell proliferation (GO:0008285)|neural crest cell development (GO:0014032)|neural tube development (GO:0021915)|neuron differentiation (GO:0030182)|pancreas development (GO:0031016)|pituitary gland development (GO:0021983)|positive regulation of apoptotic process (GO:0043065)|positive regulation of cell proliferation (GO:0008284)|positive regulation of gene expression (GO:0010628)|proximal/distal pattern formation (GO:0009954)|regulation of endothelial cell proliferation (GO:0001936)|response to cytokine (GO:0034097)|response to estradiol (GO:0032355)|response to vitamin A (GO:0033189)|retinal metabolic process (GO:0042574)|retinoic acid metabolic process (GO:0042573)|retinoic acid receptor signaling pathway (GO:0048384)|retinol metabolic process (GO:0042572)|ureter maturation (GO:0035799)|vitamin A metabolic process (GO:0006776)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|perinuclear region of cytoplasm (GO:0048471)	3-chloroallyl aldehyde dehydrogenase activity (GO:0004028)|retinal binding (GO:0016918)|retinal dehydrogenase activity (GO:0001758)			NS(1)|central_nervous_system(2)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(7)|lung(15)|prostate(1)|upper_aerodigestive_tract(1)	31				GBM - Glioblastoma multiforme(80;0.152)|all cancers(107;0.18)	Tretinoin(DB00755)|Vitamin A(DB00162)	GCCAATGTGAGAAGCTATTGC	0.493																																																	0													105.0	101.0	102.0					15																	58284946		2192	4292	6484	SO:0001583	missense	8854			AB015228	CCDS10163.1, CCDS10164.1, CCDS45266.1, CCDS55968.1	15q21.2	2011-02-18			ENSG00000128918	ENSG00000128918		"""Aldehyde dehydrogenases"""	15472	protein-coding gene	gene with protein product	"""retinaldehyde dehydrogenase 2"""	603687				9819382	Standard	NM_003888		Approved	RALDH2	uc002aex.3	O94788	OTTHUMG00000132624	ENST00000249750.4:c.755C>G	15.37:g.58284946G>C	ENSP00000249750:p.Ser252Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY52|B4DZR2|F5H2Y9|H0YM00|Q2PJS6|Q8NHQ4|Q9UBR8|Q9UFY0	Missense_Mutation	SNP	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH	p.S252C	ENST00000249750.4	37	c.755	CCDS10163.1	15	.	.	.	.	.	.	.	.	.	.	G	21.6	4.170789	0.78452	.	.	ENSG00000128918	ENST00000249750;ENST00000430119;ENST00000543386;ENST00000537372	T;T	0.17854	2.25;2.25	5.65	5.65	0.86999	Aldehyde dehydrogenase domain (1);Aldehyde dehydrogenase, N-terminal (1);Aldehyde/histidinol dehydrogenase (1);	0.108387	0.64402	D	0.000003	T	0.43500	0.1250	M	0.79805	2.47	0.43564	D	0.995888	D;D;D	0.76494	0.999;0.999;0.998	P;P;P	0.60236	0.817;0.792;0.871	T	0.34254	-0.9836	10	0.87932	D	0	.	18.891	0.92403	0.0:0.0:1.0:0.0	.	223;231;252	B4DH89;F5H2Y9;O94788	.;.;AL1A2_HUMAN	C	252;156;223;231	ENSP00000249750:S252C;ENSP00000438296:S231C	ENSP00000249750:S252C	S	-	2	0	ALDH1A2	56072238	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	3.364000	0.52328	2.941000	0.99782	0.655000	0.94253	TCT	ALDH1A2	-	pfam_Aldehyde_DH_dom,superfamily_Ald_DH/histidinol_DH		0.493	ALDH1A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALDH1A2	HGNC	protein_coding	OTTHUMT00000255869.1	G			58284946	-1	no_errors	ENST00000249750	ensembl	human	known	70_37	missense	SNP	1.000	C
ALOX5	240	genome.wustl.edu	37	10	45920431	45920431	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:45920431G>A	ENST00000374391.2	+	6	738	c.685G>A	c.(685-687)Gaa>Aaa	p.E229K	ALOX5_ENST00000542434.1_Missense_Mutation_p.E229K	NM_000698.3|NM_001256153.1	NP_000689.1|NP_001243082.1	P09917	LOX5_HUMAN	arachidonate 5-lipoxygenase	229	Lipoxygenase. {ECO:0000255|PROSITE- ProRule:PRU00726}.				arachidonic acid metabolic process (GO:0019369)|leukotriene biosynthetic process (GO:0019370)|leukotriene metabolic process (GO:0006691)|leukotriene production involved in inflammatory response (GO:0002540)|lipoxin metabolic process (GO:2001300)|lipoxygenase pathway (GO:0019372)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular space (GO:0005615)|nuclear envelope (GO:0005635)|nuclear envelope lumen (GO:0005641)|nuclear matrix (GO:0016363)|nuclear membrane (GO:0031965)	arachidonate 5-lipoxygenase activity (GO:0004051)|iron ion binding (GO:0005506)			breast(1)|cervix(2)|endometrium(3)|kidney(1)|large_intestine(6)|lung(14)|ovary(2)|pancreas(2)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	37		Lung SC(717;0.0257)			Aminosalicylic Acid(DB00233)|Balsalazide(DB01014)|Diclofenac(DB00586)|Diethylcarbamazine(DB00711)|Masoprocol(DB00179)|Meclofenamic acid(DB00939)|Mesalazine(DB00244)|Minocycline(DB01017)|Montelukast(DB00471)|Sulfasalazine(DB00795)|Vitamin E(DB00163)|Zileuton(DB00744)	TCACTGGCAGGAAGACCTGAT	0.602																																																	0													135.0	135.0	135.0					10																	45920431		2203	4300	6503	SO:0001583	missense	240			J03571	CCDS7212.1, CCDS58078.1	10q11.2	2008-03-18			ENSG00000012779	ENSG00000012779	1.13.11.34	"""Arachidonate lipoxygenases"""	435	protein-coding gene	gene with protein product		152390				2565035	Standard	NM_001256153		Approved	5-LOX	uc001jce.4	P09917	OTTHUMG00000018081	ENST00000374391.2:c.685G>A	10.37:g.45920431G>A	ENSP00000363512:p.Glu229Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLS0|E5FPY5|E5FPY7|E5FPY8|Q5JQ14	Missense_Mutation	SNP	pfam_LipOase_C,pfam_LipOase_LH2,superfamily_LipOase_C,superfamily_Lipase_LipOase,smart_LipOase_LH2,pfscan_LipOase_LH2,prints_LipOase_mml,prints_LipOase_C	p.E229K	ENST00000374391.2	37	c.685	CCDS7212.1	10	.	.	.	.	.	.	.	.	.	.	G	16.62	3.173510	0.57584	.	.	ENSG00000012779	ENST00000542434;ENST00000374391	D;D	0.90563	-2.69;-2.69	5.43	5.43	0.79202	Lipoxygenase, C-terminal (3);	0.164524	0.52532	D	0.000065	D	0.89262	0.6665	M	0.68317	2.08	0.80722	D	1	B;B;B	0.32800	0.385;0.183;0.117	B;B;B	0.28385	0.089;0.068;0.056	D	0.89012	0.3429	10	0.59425	D	0.04	-11.5211	16.7212	0.85410	0.0:0.0:1.0:0.0	.	229;229;229	B7ZLS0;E5FPY8;P09917	.;.;LOX5_HUMAN	K	229	ENSP00000437634:E229K;ENSP00000363512:E229K	ENSP00000363512:E229K	E	+	1	0	ALOX5	45240437	1.000000	0.71417	0.999000	0.59377	0.157000	0.22087	9.869000	0.99810	2.548000	0.85928	0.650000	0.86243	GAA	ALOX5	-	pfam_LipOase_C,superfamily_LipOase_C		0.602	ALOX5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ALOX5	HGNC	protein_coding	OTTHUMT00000047780.1	G			45920431	+1	no_errors	ENST00000374391	ensembl	human	known	70_37	missense	SNP	1.000	A
AMPD1	270	genome.wustl.edu	37	1	115231303	115231303	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:115231303C>T	ENST00000520113.2	-	3	208	c.193G>A	c.(193-195)Gaa>Aaa	p.E65K	AMPD1_ENST00000369538.3_Missense_Mutation_p.E61K|AMPD1_ENST00000353928.6_Missense_Mutation_p.E32K			P23109	AMPD1_HUMAN	adenosine monophosphate deaminase 1	65					IMP salvage (GO:0032264)|nucleobase-containing small molecule metabolic process (GO:0055086)|purine nucleobase metabolic process (GO:0006144)|purine-containing compound salvage (GO:0043101)|response to organic substance (GO:0010033)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)	AMP deaminase activity (GO:0003876)|metal ion binding (GO:0046872)			NS(1)|breast(1)|endometrium(5)|kidney(1)|large_intestine(10)|lung(17)|ovary(3)|pancreas(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(1)	45	all_epithelial(7;7.83e-05)|all_lung(7;0.000179)|Lung NSC(6;0.00195)|Lung SC(450;0.211)	all_cancers(81;4.64e-07)|all_epithelial(167;4.2e-07)|all_lung(203;9.97e-06)|Lung NSC(69;1.74e-05)		Lung(183;0.0234)|Colorectal(144;0.0686)|COAD - Colon adenocarcinoma(174;0.111)|all cancers(265;0.112)|Epithelial(280;0.124)|LUSC - Lung squamous cell carcinoma(189;0.133)	Adenosine monophosphate(DB00131)	CGACCTCCTTCATCTTTGACT	0.423																																																	0													147.0	143.0	145.0					1																	115231303		2203	4300	6503	SO:0001583	missense	270			M60092	CCDS876.1, CCDS876.2, CCDS53349.1	1p13	2010-02-10	2010-02-10		ENSG00000116748	ENSG00000116748	3.5.4.6		468	protein-coding gene	gene with protein product	"""AMPD isoform M"", ""skeletal muscle AMPD"""	102770	"""adenosine monophosphate deaminase 1 (isoform M)"""			1400401	Standard	NM_001172626		Approved	MAD, MADA	uc001efe.2	P23109	OTTHUMG00000011892	ENST00000520113.2:c.193G>A	1.37:g.115231303C>T	ENSP00000430075:p.Glu65Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5N4|B2RAM1|F2Z3B3|Q5TF00|Q5TF02	Missense_Mutation	SNP	pfam_A/AMP_deaminase_dom,pirsf_AMP_deaminase,tigrfam_AMP_deaminase	p.E65K	ENST00000520113.2	37	c.193	CCDS876.2	1	.	.	.	.	.	.	.	.	.	.	C	31	5.076323	0.94000	.	.	ENSG00000116748	ENST00000520113;ENST00000369538;ENST00000353928	T;T;T	0.58506	0.33;0.33;0.33	5.62	5.62	0.85841	.	0.047530	0.85682	D	0.000000	T	0.64483	0.2602	L	0.42245	1.32	0.58432	D	0.999999	P;D	0.67145	0.948;0.996	P;D	0.65233	0.573;0.933	T	0.64521	-0.6388	10	0.59425	D	0.04	-26.247	20.0247	0.97519	0.0:1.0:0.0:0.0	.	61;32	Q5TF02;P23109	.;AMPD1_HUMAN	K	65;61;32	ENSP00000430075:E65K;ENSP00000358551:E61K;ENSP00000316520:E32K	ENSP00000316520:E32K	E	-	1	0	AMPD1	115032826	1.000000	0.71417	1.000000	0.80357	0.683000	0.39861	7.114000	0.77103	2.804000	0.96469	0.655000	0.94253	GAA	AMPD1	-	pirsf_AMP_deaminase		0.423	AMPD1-001	KNOWN	basic|CCDS	protein_coding	AMPD1	HGNC	protein_coding	OTTHUMT00000032860.4	C			115231303	-1	no_errors	ENST00000520113	ensembl	human	known	70_37	missense	SNP	1.000	T
ANKHD1	54882	genome.wustl.edu	37	5	139908053	139908053	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr5:139908053C>T	ENST00000360839.2	+	29	5676	c.5522C>T	c.(5521-5523)tCt>tTt	p.S1841F	ANKHD1_ENST00000544120.1_Missense_Mutation_p.S224F|SNORD45_ENST00000363181.1_RNA|ANKHD1_ENST00000297183.6_Missense_Mutation_p.S1841F|ANKHD1-EIF4EBP3_ENST00000532219.1_Missense_Mutation_p.S1841F	NM_017747.2	NP_060217.1	Q8IWZ3	ANKH1_HUMAN	ankyrin repeat and KH domain containing 1	1841						cytoplasm (GO:0005737)	poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(8)|kidney(6)|large_intestine(14)|lung(18)|ovary(5)|prostate(2)|skin(3)|urinary_tract(2)	60			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			AATGTACGTTCTTCTTTCCCA	0.453																																																	0													158.0	155.0	156.0					5																	139908053		2203	4300	6503	SO:0001583	missense	54882			AF521882	CCDS4225.1, CCDS43371.1, CCDS43372.1, CCDS75319.1	5q31.3	2013-01-10			ENSG00000131503	ENSG00000131503		"""Ankyrin repeat domain containing"""	24714	protein-coding gene	gene with protein product		610500				10470851, 11230166, 16098192	Standard	NM_017747		Approved	MASK, FLJ20288, FLJ11979, FLJ10042, FLJ14127, KIAA1085		Q8IWZ3	OTTHUMG00000161610	ENST00000360839.2:c.5522C>T	5.37:g.139908053C>T	ENSP00000354085:p.Ser1841Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NH85|Q149P2|Q8IWZ2|Q8WY90|Q96G77|Q96GK0|Q9H2U0|Q9HA95|Q9NWG4|Q9UPR7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,pfam_KH_dom_type_1,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,smart_KH_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,pfscan_KH_dom_type_1,prints_Ankyrin_rpt	p.S1841F	ENST00000360839.2	37	c.5522	CCDS4225.1	5	.	.	.	.	.	.	.	.	.	.	C	15.63	2.889311	0.52014	.	.	ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000131503;ENSG00000254996	ENST00000360839;ENST00000297183;ENST00000253810;ENST00000431508;ENST00000536646;ENST00000433049;ENST00000544120;ENST00000532219	T;T;T;T;T;T	0.67698	-0.25;-0.28;1.82;1.83;1.41;-0.28	4.98	4.09	0.47781	.	0.134929	0.52532	D	0.000063	T	0.74543	0.3730	L	0.47716	1.5	0.39331	D	0.965411	D;D;D;P;P	0.69078	0.997;0.989;0.978;0.94;0.94	D;P;P;P;P	0.67725	0.953;0.809;0.694;0.459;0.459	T	0.77869	-0.2427	10	0.72032	D	0.01	.	13.9174	0.63908	0.0:0.925:0.0:0.075	.	224;271;1841;1841;1841	Q8IWG5;Q9H059;E9PF56;Q8IWZ2;Q8IWZ3	.;.;.;.;ANKH1_HUMAN	F	1841;1841;1841;497;276;363;224;1841	ENSP00000354085:S1841F;ENSP00000297183:S1841F;ENSP00000393204:S497F;ENSP00000390034:S363F;ENSP00000437687:S224F;ENSP00000432016:S1841F	ENSP00000432016:S1841F	S	+	2	0	ANKHD1-EIF4EBP3;ANKHD1	139888237	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.672000	0.68102	2.595000	0.87683	0.650000	0.86243	TCT	ANKHD1	-	NULL		0.453	ANKHD1-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	ANKHD1	HGNC	protein_coding	OTTHUMT00000251672.1	C	NM_017747		139908053	+1	no_errors	ENST00000297183	ensembl	human	known	70_37	missense	SNP	1.000	T
ANKRD1	27063	genome.wustl.edu	37	10	92675933	92675933	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:92675933C>T	ENST00000371697.3	-	6	894	c.646G>A	c.(646-648)Gat>Aat	p.D216N		NM_014391.2	NP_055206.2	Q15327	ANKR1_HUMAN	ankyrin repeat domain 1 (cardiac muscle)	216					cardiac muscle tissue morphogenesis (GO:0055008)|cellular lipid metabolic process (GO:0044255)|cellular response to drug (GO:0035690)|cellular response to hypoxia (GO:0071456)|cellular response to interleukin-1 (GO:0071347)|cellular response to lipopolysaccharide (GO:0071222)|cellular response to mechanical stimulus (GO:0071260)|cellular response to organic cyclic compound (GO:0071407)|cellular response to transforming growth factor beta stimulus (GO:0071560)|cellular response to tumor necrosis factor (GO:0071356)|negative regulation of DNA biosynthetic process (GO:2000279)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of apoptotic process (GO:0043065)|positive regulation of DNA damage response, signal transduction by p53 class mediator (GO:0043517)|positive regulation of neuron projection development (GO:0010976)|positive regulation of protein secretion (GO:0050714)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|response to muscle stretch (GO:0035994)|sarcomere organization (GO:0045214)|skeletal muscle cell differentiation (GO:0035914)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|I band (GO:0031674)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcription factor complex (GO:0005667)	DNA binding (GO:0003677)|histone deacetylase binding (GO:0042826)|p53 binding (GO:0002039)|R-SMAD binding (GO:0070412)|RNA polymerase II transcription coactivator activity (GO:0001105)|RNA polymerase II transcription factor binding (GO:0001085)|titin binding (GO:0031432)|transcription corepressor activity (GO:0003714)	p.D216Y(1)		autonomic_ganglia(1)|breast(2)|endometrium(1)|kidney(2)|large_intestine(7)|lung(10)|prostate(3)|skin(1)	27		Colorectal(252;0.0475)				AATACCTTATCTCGGGCGCTA	0.522																																																	1	Substitution - Missense(1)	large_intestine(1)											82.0	79.0	80.0					10																	92675933		2203	4300	6503	SO:0001583	missense	27063			X83703	CCDS7412.1	10q23.33	2014-09-17			ENSG00000148677	ENSG00000148677		"""Ankyrin repeat domain containing"""	15819	protein-coding gene	gene with protein product		609599				7730328	Standard	NM_014391		Approved	C-193, ALRP, CARP, CVARP, MCARP	uc001khe.1	Q15327	OTTHUMG00000018734	ENST00000371697.3:c.646G>A	10.37:g.92675933C>T	ENSP00000360762:p.Asp216Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96LE7	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.D216N	ENST00000371697.3	37	c.646	CCDS7412.1	10	.	.	.	.	.	.	.	.	.	.	C	29.0	4.970762	0.92919	.	.	ENSG00000148677	ENST00000371697	T	0.57107	0.42	5.35	5.35	0.76521	Ankyrin repeat-containing domain (4);	0.000000	0.85682	D	0.000000	T	0.67859	0.2938	L	0.53780	1.695	0.80722	D	1	P	0.50710	0.938	D	0.64237	0.923	T	0.64550	-0.6381	10	0.37606	T	0.19	.	19.0606	0.93091	0.0:1.0:0.0:0.0	.	216	Q15327	ANKR1_HUMAN	N	216	ENSP00000360762:D216N	ENSP00000360762:D216N	D	-	1	0	ANKRD1	92665913	1.000000	0.71417	1.000000	0.80357	0.965000	0.64279	6.977000	0.76141	2.511000	0.84671	0.484000	0.47621	GAT	ANKRD1	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.522	ANKRD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ANKRD1	HGNC	protein_coding	OTTHUMT00000049357.1	C	NM_014391		92675933	-1	no_errors	ENST00000371697	ensembl	human	known	70_37	missense	SNP	1.000	T
ANKRD24	170961	genome.wustl.edu	37	19	4216286	4216286	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:4216286G>A	ENST00000600132.1	+	17	1552	c.1276G>A	c.(1276-1278)Gag>Aag	p.E426K	ANKRD24_ENST00000595096.1_3'UTR|ANKRD24_ENST00000262970.5_Missense_Mutation_p.E516K|ANKRD24_ENST00000318934.4_Missense_Mutation_p.E426K	NM_133475.1	NP_597732.1	Q8TF21	ANR24_HUMAN	ankyrin repeat domain 24	426										endometrium(3)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(4)|lung(9)|prostate(1)|skin(1)	21				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|BRCA - Breast invasive adenocarcinoma(158;0.0233)|STAD - Stomach adenocarcinoma(1328;0.181)		TCCAGGGGCCGAGGTGCTGCT	0.667																																																	0													15.0	16.0	16.0					19																	4216286		1911	4059	5970	SO:0001583	missense	170961			AB075861	CCDS45925.1	19p13.3	2013-01-10				ENSG00000089847		"""Ankyrin repeat domain containing"""	29424	protein-coding gene	gene with protein product						11853319	Standard	NM_133475		Approved	KIAA1981	uc010dtt.1	Q8TF21		ENST00000600132.1:c.1276G>A	19.37:g.4216286G>A	ENSP00000471252:p.Glu426Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	O75268|O95781	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E426K	ENST00000600132.1	37	c.1276	CCDS45925.1	19	.	.	.	.	.	.	.	.	.	.	g	15.92	2.975151	0.53720	.	.	ENSG00000089847	ENST00000318934;ENST00000262970	T;T	0.43688	1.18;0.94	4.58	3.5	0.40072	.	.	.	.	.	T	0.25382	0.0617	L	0.29908	0.895	0.28756	N	0.901195	P;P	0.50710	0.897;0.938	B;B	0.34038	0.084;0.174	T	0.06303	-1.0834	9	0.42905	T	0.14	-5.7614	9.6147	0.39685	0.0:0.0:0.7904:0.2096	.	426;516	Q8TF21;Q8TF21-2	ANR24_HUMAN;.	K	426;516	ENSP00000321731:E426K;ENSP00000262970:E516K	ENSP00000262970:E516K	E	+	1	0	ANKRD24	4167286	1.000000	0.71417	0.220000	0.23810	0.043000	0.13939	6.731000	0.74785	0.870000	0.35726	0.313000	0.20887	GAG	ANKRD24	-	NULL		0.667	ANKRD24-003	KNOWN	basic|appris_candidate|CCDS	protein_coding	ANKRD24	HGNC	protein_coding	OTTHUMT00000458188.1	G	XM_114000		4216286	+1	no_errors	ENST00000318934	ensembl	human	known	70_37	missense	SNP	0.820	A
ANKRD30A	91074	genome.wustl.edu	37	10	37442509	37442509	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:37442509G>A	ENST00000602533.1	+	13	1648	c.1549G>A	c.(1549-1551)Gag>Aag	p.E517K	ANKRD30A_ENST00000361713.1_Missense_Mutation_p.E517K|ANKRD30A_ENST00000374660.1_Missense_Mutation_p.E517K			Q9BXX3	AN30A_HUMAN	ankyrin repeat domain 30A	573					regulation of transcription, DNA-templated (GO:0006355)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)			NS(1)|breast(8)|endometrium(14)|kidney(21)|large_intestine(13)|lung(70)|ovary(8)|pancreas(1)|prostate(3)|skin(15)|stomach(1)|urinary_tract(3)	158						GAGTCTCTGTGAGACTGTTTC	0.269																																																	0													101.0	103.0	102.0					10																	37442509		1794	4062	5856	SO:0001583	missense	91074			AF269087	CCDS7193.1	10p11.21	2013-01-10			ENSG00000148513	ENSG00000148513		"""Ankyrin repeat domain containing"""	17234	protein-coding gene	gene with protein product	"""breast cancer antigen NY-BR-1"""	610856				11280766	Standard	NM_052997		Approved	NY-BR-1	uc001iza.1	Q9BXX3	OTTHUMG00000017968	ENST00000602533.1:c.1549G>A	10.37:g.37442509G>A	ENSP00000473551:p.Glu517Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W025	Missense_Mutation	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom	p.E517K	ENST00000602533.1	37	c.1549		10	.	.	.	.	.	.	.	.	.	.	.	9.485	1.099141	0.20552	.	.	ENSG00000148513	ENST00000361713;ENST00000374660	T;T	0.09911	2.93;2.93	1.47	1.47	0.22746	.	.	.	.	.	T	0.07188	0.0182	L	0.34521	1.04	0.09310	N	1	B	0.25521	0.128	B	0.19666	0.026	T	0.37572	-0.9700	9	0.19590	T	0.45	.	6.4351	0.21819	0.0:0.0:1.0:0.0	.	573	Q9BXX3	AN30A_HUMAN	K	517	ENSP00000354432:E517K;ENSP00000363792:E517K	ENSP00000354432:E517K	E	+	1	0	ANKRD30A	37482515	0.003000	0.15002	0.008000	0.14137	0.004000	0.04260	0.604000	0.24164	1.140000	0.42260	0.384000	0.25694	GAG	ANKRD30A	-	NULL		0.269	ANKRD30A-001	KNOWN	NMD_exception|basic|appris_principal	protein_coding	ANKRD30A	HGNC	protein_coding	OTTHUMT00000047588.2	G	NM_052997		37442509	+1	no_errors	ENST00000361713	ensembl	human	known	70_37	missense	SNP	0.009	A
ANKRD44	91526	genome.wustl.edu	37	2	197870440	197870440	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:197870440C>T	ENST00000328737.2	-	21	2326	c.2250G>A	c.(2248-2250)ccG>ccA	p.P750P	ANKRD44_ENST00000282272.8_Silent_p.P767P|ANKRD44_ENST00000337207.5_Silent_p.P750P|ANKRD44_ENST00000450567.1_Silent_p.P750P			Q8N8A2	ANR44_HUMAN	ankyrin repeat domain 44	775										NS(1)|endometrium(3)|kidney(2)|large_intestine(9)|lung(20)|ovary(4)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)	45			OV - Ovarian serous cystadenocarcinoma(117;0.246)			CCCAGTGCAGCGGCGTGTAGC	0.537																																																	0													100.0	91.0	94.0					2																	197870440		2203	4300	6503	SO:0001819	synonymous_variant	91526			AK097086	CCDS33355.1, CCDS33355.2, CCDS74619.1	2q33.1	2013-01-10			ENSG00000065413	ENSG00000065413		"""Serine/threonine phosphatases / Protein phosphatase 6, regulatory subunits"", ""Ankyrin repeat domain containing"""	25259	protein-coding gene	gene with protein product	"""protein phosphatase 6 ankyrin repeat subunit B"""						Standard	NM_153697		Approved	PP6-ARS-B	uc021vuj.1	Q8N8A2	OTTHUMG00000154411	ENST00000328737.2:c.2250G>A	2.37:g.197870440C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q53SL9|Q6P480|Q86VL5|Q8IZ72|Q9UFA4	Silent	SNP	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.P750	ENST00000328737.2	37	c.2250		2																																																																																			ANKRD44	-	pfam_Ankyrin_rpt,superfamily_Ankyrin_rpt-contain_dom,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom		0.537	ANKRD44-002	KNOWN	basic|appris_principal	protein_coding	ANKRD44	HGNC	protein_coding	OTTHUMT00000335113.1	C	NM_153697		197870440	-1	no_errors	ENST00000328737	ensembl	human	known	70_37	silent	SNP	0.001	T
ARF1	375	genome.wustl.edu	37	1	228285143	228285143	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:228285143G>A	ENST00000541182.1	+	3	511	c.249G>A	c.(247-249)caG>caA	p.Q83Q	ARF1_ENST00000540651.1_Silent_p.Q83Q|MIR3620_ENST00000584469.1_RNA|ARF1_ENST00000478424.1_3'UTR|ARF1_ENST00000272102.5_Silent_p.Q83Q	NM_001024227.1|NM_001024228.1	NP_001019398.1|NP_001019399.1	P84077	ARF1_HUMAN	ADP-ribosylation factor 1	83					antigen processing and presentation of exogenous peptide antigen via MHC class II (GO:0019886)|cellular copper ion homeostasis (GO:0006878)|COPI coating of Golgi vesicle (GO:0048205)|dendritic spine organization (GO:0097061)|GTP catabolic process (GO:0006184)|long term synaptic depression (GO:0060292)|membrane organization (GO:0061024)|phosphatidylinositol biosynthetic process (GO:0006661)|phospholipid metabolic process (GO:0006644)|post-Golgi vesicle-mediated transport (GO:0006892)|protein transport (GO:0015031)|regulation of Arp2/3 complex-mediated actin nucleation (GO:0034315)|regulation of defense response to virus by virus (GO:0050690)|regulation of receptor internalization (GO:0002090)|retrograde vesicle-mediated transport, Golgi to ER (GO:0006890)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)|viral process (GO:0016032)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|Golgi membrane (GO:0000139)|neuron projection (GO:0043005)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|sarcomere (GO:0030017)	GTP binding (GO:0005525)|GTPase activity (GO:0003924)|poly(A) RNA binding (GO:0044822)|receptor signaling protein activity (GO:0005057)			breast(1)|endometrium(2)|kidney(2)|large_intestine(1)|lung(4)	10		Prostate(94;0.0405)				ACTACTTCCAGAACACACAAG	0.597																																																	0													66.0	66.0	66.0					1																	228285143		2203	4300	6503	SO:0001819	synonymous_variant	375			M84326	CCDS1565.1	1q42.13	2014-01-30			ENSG00000143761	ENSG00000143761		"""ADP-ribosylation factors"", ""Endogenous ligands"""	652	protein-coding gene	gene with protein product		103180				1577740	Standard	NM_001658		Approved		uc001hrr.3	P84077	OTTHUMG00000037595	ENST00000541182.1:c.249G>A	1.37:g.228285143G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	P10947|P32889	Silent	SNP	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,prints_Small_GTPase,tigrfam_Small_GTP-bd_dom	p.Q83	ENST00000541182.1	37	c.249	CCDS1565.1	1																																																																																			ARF1	-	pfam_Small_GTPase_ARF/SAR,pfam_SRP_receptor_beta_su,pfam_Small_GTPase,pfam_Gtr1_RagA,pfam_Gprotein_alpha_su,pfam_MIRO-like,smart_Small_GTPase_SAR1,smart_Small_GTPase_ARF,smart_Small_GTPase_Rab_type,prints_Small_GTPase_ARF/SAR,tigrfam_Small_GTP-bd_dom		0.597	ARF1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	ARF1	HGNC	protein_coding	OTTHUMT00000091650.1	G	NM_001024227		228285143	+1	no_errors	ENST00000272102	ensembl	human	known	70_37	silent	SNP	1.000	A
ARSI	340075	genome.wustl.edu	37	5	149677811	149677811	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr5:149677811G>C	ENST00000328668.7	-	2	1255	c.676C>G	c.(676-678)Cag>Gag	p.Q226E		NM_001012301.2	NP_001012301.1	Q5FYB1	ARSI_HUMAN	arylsulfatase family, member I	226					cellular protein metabolic process (GO:0044267)|glycosphingolipid metabolic process (GO:0006687)|post-translational protein modification (GO:0043687)|small molecule metabolic process (GO:0044281)|sphingolipid metabolic process (GO:0006665)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)	arylsulfatase activity (GO:0004065)|metal ion binding (GO:0046872)			central_nervous_system(1)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(3)|lung(11)|ovary(1)|pancreas(1)|skin(1)|urinary_tract(1)	23			KIRC - Kidney renal clear cell carcinoma(527;0.000785)|Kidney(363;0.00101)			AGGGGACGCTGAGGGCTGTGG	0.627																																																	0													57.0	58.0	57.0					5																	149677811		2203	4300	6503	SO:0001583	missense	340075			AY875937	CCDS34275.1	5q32	2014-03-03	2006-03-07			ENSG00000183876		"""Arylsulfatase family"""	32521	protein-coding gene	gene with protein product		610009	"""arylsulfatase I"""			16174644, 24482476	Standard	NM_001012301		Approved	FLJ16069, SPG66	uc003lrv.2	Q5FYB1		ENST00000328668.7:c.676C>G	5.37:g.149677811G>C	ENSP00000333395:p.Gln226Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L3B0|B3KV22|B7XD03	Missense_Mutation	SNP	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core	p.Q226E	ENST00000328668.7	37	c.676	CCDS34275.1	5	.	.	.	.	.	.	.	.	.	.	G	1.162	-0.643611	0.03531	.	.	ENSG00000183876	ENST00000328668;ENST00000515301;ENST00000509146	D;D;D	0.95949	-3.86;-3.86;-3.86	4.32	4.32	0.51571	Alkaline phosphatase-like, alpha/beta/alpha (1);Sulfatase (1);Alkaline-phosphatase-like, core domain (1);	0.627020	0.16495	N	0.211925	D	0.86142	0.5862	N	0.03608	-0.345	0.33555	D	0.596675	B	0.10296	0.003	B	0.19946	0.027	T	0.81035	-0.1115	10	0.06757	T	0.87	.	12.3548	0.55169	0.0:0.0:0.7883:0.2117	.	226	Q5FYB1	ARSI_HUMAN	E	226;83;83	ENSP00000333395:Q226E;ENSP00000426879:Q83E;ENSP00000420955:Q83E	ENSP00000333395:Q226E	Q	-	1	0	ARSI	149658004	0.995000	0.38212	0.873000	0.34254	0.940000	0.58332	3.911000	0.56378	2.401000	0.81631	0.561000	0.74099	CAG	ARSI	-	pfam_Sulfatase,superfamily_Alkaline_phosphatase_core		0.627	ARSI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ARSI	HGNC	protein_coding	OTTHUMT00000373681.1	G	NM_001012301		149677811	-1	no_errors	ENST00000328668	ensembl	human	known	70_37	missense	SNP	0.999	C
ASPM	259266	genome.wustl.edu	37	1	197073358	197073358	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:197073358A>G	ENST00000367409.4	-	18	5279	c.5023T>C	c.(5023-5025)Ttt>Ctt	p.F1675L	ASPM_ENST00000367408.1_Intron|ASPM_ENST00000294732.7_Intron	NM_018136.4	NP_060606.3	Q8IZT6	ASPM_HUMAN	asp (abnormal spindle) homolog, microcephaly associated (Drosophila)	1675	IQ 5. {ECO:0000255|PROSITE- ProRule:PRU00116}.				developmental growth (GO:0048589)|forebrain neuroblast division (GO:0021873)|maintenance of centrosome location (GO:0051661)|mitotic nuclear division (GO:0007067)|negative regulation of asymmetric cell division (GO:0045769)|negative regulation of neuron differentiation (GO:0045665)|neuron migration (GO:0001764)|oogenesis (GO:0048477)|positive regulation of canonical Wnt signaling pathway (GO:0090263)|positive regulation of neuroblast proliferation (GO:0002052)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|midbody (GO:0030496)|nucleus (GO:0005634)|spindle pole (GO:0000922)				breast(6)|central_nervous_system(2)|cervix(2)|endometrium(10)|kidney(9)|large_intestine(28)|liver(1)|lung(87)|ovary(5)|pancreas(2)|prostate(6)|skin(4)|urinary_tract(3)	165						AGGCTCAAAAATTCCTTTTTA	0.313																																																	0													54.0	55.0	54.0					1																	197073358		2200	4294	6494	SO:0001583	missense	259266			AY367065	CCDS1389.1, CCDS55672.1	1q31	2008-02-05	2006-09-12		ENSG00000066279	ENSG00000066279			19048	protein-coding gene	gene with protein product		605481	"""microcephaly, primary autosomal recessive 5"", ""asp (abnormal spindle)-like, microcephaly associated (Drosophila)"""	MCPH5		11078481	Standard	NM_018136		Approved	Calmbp1, ASP, FLJ10517, FLJ10549	uc001gtu.3	Q8IZT6	OTTHUMG00000036277	ENST00000367409.4:c.5023T>C	1.37:g.197073358A>G	ENSP00000356379:p.Phe1675Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4G1H1|Q5VYL3|Q86UX4|Q8IUL2|Q8IZJ7|Q8IZJ8|Q8IZJ9|Q8N4D1|Q9NVS1|Q9NVT6	Missense_Mutation	SNP	pfam_IQ_motif_EF-hand-BS,pfam_CAMSAP_CH,pfam_CH-domain,superfamily_CH-domain,superfamily_ARM-type_fold,smart_CH-domain,smart_IQ_motif_EF-hand-BS,pfscan_CH-domain,pfscan_IQ_motif_EF-hand-BS	p.F1675L	ENST00000367409.4	37	c.5023	CCDS1389.1	1	.	.	.	.	.	.	.	.	.	.	A	22.5	4.303788	0.81136	.	.	ENSG00000066279	ENST00000367409	T	0.72835	-0.69	5.52	5.52	0.82312	.	0.000000	0.85682	D	0.000000	D	0.84433	0.5471	M	0.90309	3.105	0.80722	D	1	P	0.46142	0.873	P	0.55923	0.787	D	0.86854	0.2025	10	0.54805	T	0.06	.	15.1137	0.72380	1.0:0.0:0.0:0.0	.	1675	Q8IZT6	ASPM_HUMAN	L	1675	ENSP00000356379:F1675L	ENSP00000356379:F1675L	F	-	1	0	ASPM	195339981	0.999000	0.42202	0.932000	0.37286	0.860000	0.49131	4.135000	0.57997	2.232000	0.73038	0.477000	0.44152	TTT	ASPM	-	pfam_IQ_motif_EF-hand-BS,superfamily_ARM-type_fold,smart_IQ_motif_EF-hand-BS,pfscan_IQ_motif_EF-hand-BS		0.313	ASPM-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ASPM	HGNC	protein_coding	OTTHUMT00000088256.1	A	NM_018136		197073358	-1	no_errors	ENST00000367409	ensembl	human	known	70_37	missense	SNP	0.999	G
ASZ1	136991	genome.wustl.edu	37	7	117067509	117067509	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:117067509C>T	ENST00000284629.2	-	1	68	c.6G>A	c.(4-6)gcG>gcA	p.A2A		NM_130768.2	NP_570124.1			ankyrin repeat, SAM and basic leucine zipper domain containing 1											breast(1)|central_nervous_system(2)|endometrium(1)|kidney(1)|large_intestine(4)|lung(10)|ovary(1)|prostate(3)|skin(1)	24	Lung NSC(10;0.00156)|all_lung(10;0.00175)		STAD - Stomach adenocarcinoma(10;0.000512)			GCGCGCTCGCCGCCATGCCAG	0.692											OREG0003439	type=REGULATORY REGION|Gene=ASZ1|Dataset=Stanford ENCODE Dataset|EvidenceSubtype=Transient transfection luciferase assay																																					0													43.0	42.0	42.0					7																	117067509		2202	4296	6498	SO:0001819	synonymous_variant	136991			AF461259	CCDS5772.1	7q31.2	2013-01-10	2005-03-15	2004-07-16	ENSG00000154438	ENSG00000154438		"""Sterile alpha motif (SAM) domain containing"", ""Ankyrin repeat domain containing"""	1350	protein-coding gene	gene with protein product		605797	"""ankyrin-like 1"""	C7orf7, ANKL1		12040005, 11279520	Standard	NM_130768		Approved	Orf3, GASZ, ALP1, CT1.19	uc003vjb.2	Q8WWH4	OTTHUMG00000064565	ENST00000284629.2:c.6G>A	7.37:g.117067509C>T		Somatic	1478	WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ankyrin_rpt,pfam_SAM_2,pfam_SAM_type1,superfamily_Ankyrin_rpt-contain_dom,superfamily_SAM/pointed,smart_Ankyrin_rpt,pfscan_Ankyrin_rpt,pfscan_Ankyrin_rpt-contain_dom,prints_Ankyrin_rpt	p.A2	ENST00000284629.2	37	c.6	CCDS5772.1	7																																																																																			ASZ1	-	NULL		0.692	ASZ1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ASZ1	HGNC	protein_coding	OTTHUMT00000138907.7	C	NM_130768		117067509	-1	no_errors	ENST00000284629	ensembl	human	known	70_37	silent	SNP	0.958	T
AZIN1	51582	genome.wustl.edu	37	8	103845404	103845404	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:103845404C>T	ENST00000337198.5	-	9	1947	c.784G>A	c.(784-786)Gaa>Aaa	p.E262K	AZIN1_ENST00000347770.4_Missense_Mutation_p.E262K	NM_148174.2	NP_680479.1	O14977	AZIN1_HUMAN	antizyme inhibitor 1	262					cellular nitrogen compound metabolic process (GO:0034641)|negative regulation of catalytic activity (GO:0043086)|negative regulation of protein catabolic process (GO:0042177)|polyamine biosynthetic process (GO:0006596)|positive regulation of polyamine transmembrane transport (GO:1902269)|regulation of cellular amino acid metabolic process (GO:0006521)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|nucleus (GO:0005634)	catalytic activity (GO:0003824)|enzyme inhibitor activity (GO:0004857)|ornithine decarboxylase activator activity (GO:0042978)			breast(1)|endometrium(1)|kidney(1)|large_intestine(2)|lung(1)|prostate(1)|skin(1)|stomach(1)	9	Lung NSC(17;0.000143)|all_lung(17;0.000294)		OV - Ovarian serous cystadenocarcinoma(57;0.000196)|STAD - Stomach adenocarcinoma(118;0.0414)			CCAGATCCTTCAGGAAAGTAG	0.348																																																	0													82.0	87.0	85.0					8																	103845404		2203	4300	6503	SO:0001583	missense	51582			AAC25391	CCDS6295.1	8p22-q21.3	2005-03-21	2005-03-21	2005-03-21		ENSG00000155096			16432	protein-coding gene	gene with protein product	"""ornithine decarboxylase 1-like"""	607909	"""ornithine decarboxylase antizyme inhibitor"""	OAZIN		9349715, 9110174	Standard	XM_005250969		Approved	OAZI, ODC1L	uc003yky.3	O14977		ENST00000337198.5:c.784G>A	8.37:g.103845404C>T	ENSP00000337180:p.Glu262Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NCD5|Q6IBQ7|Q96D20	Missense_Mutation	SNP	pfam_De-COase2_N,pfam_De-COase2_C,superfamily_Ala_racemase/Decarboxylase_C,prints_Orn_de-COase,prints_Orn/DAP/Arg_de-COase	p.E262K	ENST00000337198.5	37	c.784	CCDS6295.1	8	.	.	.	.	.	.	.	.	.	.	C	7.002	0.554989	0.13436	.	.	ENSG00000155096	ENST00000337198;ENST00000347770	T;T	0.41400	1.0;1.0	6.06	5.18	0.71444	Orn/DAP/Arg decarboxylase 2, N-terminal (1);Alanine racemase/group IV decarboxylase, C-terminal (1);	0.317702	0.39341	N	0.001397	T	0.29850	0.0746	L	0.28115	0.83	0.35769	D	0.820729	B	0.14438	0.01	B	0.23852	0.049	T	0.30534	-0.9975	10	0.22109	T	0.4	-18.1052	10.5555	0.45114	0.1347:0.7926:0.0:0.0727	.	262	O14977	AZIN1_HUMAN	K	262	ENSP00000337180:E262K;ENSP00000321507:E262K	ENSP00000337180:E262K	E	-	1	0	AZIN1	103914580	1.000000	0.71417	1.000000	0.80357	0.022000	0.10575	1.078000	0.30754	1.564000	0.49628	-0.169000	0.13324	GAA	AZIN1	-	pfam_De-COase2_N,superfamily_Ala_racemase/Decarboxylase_C		0.348	AZIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	AZIN1	HGNC	protein_coding	OTTHUMT00000380133.1	C			103845404	-1	no_errors	ENST00000337198	ensembl	human	known	70_37	missense	SNP	0.999	T
BACH1	571	genome.wustl.edu	37	21	30699110	30699110	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr21:30699110C>G	ENST00000399921.1	+	3	1208	c.965C>G	c.(964-966)tCt>tGt	p.S322C	BACH1_ENST00000286800.3_Missense_Mutation_p.S322C	NM_206866.1	NP_996749.1	Q9BX63	FANCJ_HUMAN	BTB and CNC homology 1, basic leucine zipper transcription factor 1	318	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA damage checkpoint (GO:0000077)|DNA duplex unwinding (GO:0032508)|double-strand break repair (GO:0006302)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|small molecule metabolic process (GO:0044281)	cytoplasm (GO:0005737)|nuclear membrane (GO:0031965)|nucleus (GO:0005634)	4 iron, 4 sulfur cluster binding (GO:0051539)|ATP binding (GO:0005524)|ATP-dependent DNA helicase activity (GO:0004003)|DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(5)|kidney(2)|large_intestine(8)|liver(1)|lung(7)|ovary(1)|urinary_tract(2)	27						GGACTTTATTCTTTGTCTCTT	0.403																																																	0													121.0	126.0	124.0					21																	30699110		2203	4300	6503	SO:0001583	missense	571			AF026200	CCDS13585.1	21q22.1	2013-01-10			ENSG00000156273	ENSG00000156273		"""BTB/POZ domain containing"", ""basic leucine zipper proteins"""	935	protein-coding gene	gene with protein product		602751				9544839, 9479503	Standard	NR_027655		Approved	BACH-1, BTBD24	uc002ynj.3	O14867	OTTHUMG00000078878	ENST00000399921.1:c.965C>G	21.37:g.30699110C>G	ENSP00000382805:p.Ser322Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3MJE2|Q8NCI5	Missense_Mutation	SNP	pfam_BTB_POZ,pfam_bZIP,superfamily_BTB/POZ_fold,superfamily_Euk_TF_DNA-bd,smart_BTB/POZ-like,smart_bZIP,pfscan_BTB/POZ-like,pfscan_bZIP	p.S322C	ENST00000399921.1	37	c.965	CCDS13585.1	21	.	.	.	.	.	.	.	.	.	.	C	14.99	2.699624	0.48307	.	.	ENSG00000156273	ENST00000286800;ENST00000399921	T;T	0.73152	-0.72;-0.72	5.65	3.77	0.43336	.	0.233910	0.38436	N	0.001684	T	0.62270	0.2414	L	0.29908	0.895	0.09310	N	0.999999	D	0.55800	0.973	P	0.46975	0.533	T	0.58515	-0.7623	10	0.66056	D	0.02	-12.3444	10.8846	0.46960	0.13:0.8026:0.0:0.0673	.	322	O14867	BACH1_HUMAN	C	322	ENSP00000286800:S322C;ENSP00000382805:S322C	ENSP00000286800:S322C	S	+	2	0	BACH1	29620981	0.097000	0.21791	0.207000	0.23584	0.971000	0.66376	2.579000	0.46059	1.627000	0.50400	0.655000	0.94253	TCT	BACH1	-	NULL		0.403	BACH1-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	BACH1	HGNC	protein_coding	OTTHUMT00000171974.1	C	NM_206866		30699110	+1	no_errors	ENST00000286800	ensembl	human	known	70_37	missense	SNP	0.024	G
BCAP29	55973	genome.wustl.edu	37	7	107254114	107254114	+	Intron	SNP	G	G	A	rs576177767	byFrequency	TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:107254114G>A	ENST00000005259.4	+	7	1029				BCAP29_ENST00000465919.1_Intron|BCAP29_ENST00000445771.2_Missense_Mutation_p.E236K|BCAP29_ENST00000494086.1_Intron|BCAP29_ENST00000379119.2_Missense_Mutation_p.E236K|BCAP29_ENST00000379121.2_Intron|BCAP29_ENST00000379117.2_Intron	NM_018844.3	NP_061332.2	Q9UHQ4	BAP29_HUMAN	B-cell receptor-associated protein 29						apoptotic process (GO:0006915)|ER to Golgi vesicle-mediated transport (GO:0006888)|intracellular protein transport (GO:0006886)|osteoblast differentiation (GO:0001649)|protein localization to endoplasmic reticulum exit site (GO:0070973)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				cervix(1)|kidney(1)|large_intestine(4)|lung(4)|ovary(2)|skin(1)|urinary_tract(1)	14						CAGTTTTGGTGAATTTTTAAG	0.358																																																	0													78.0	81.0	80.0					7																	107254114		2196	4300	6496	SO:0001627	intron_variant	55973				CCDS34730.1, CCDS34731.1	7q22.3	2012-09-20			ENSG00000075790	ENSG00000075790			24131	protein-coding gene	gene with protein product						12477932	Standard	NM_018844		Approved	BAP29, DKFZp686M2086	uc011kma.1	Q9UHQ4	OTTHUMG00000154770	ENST00000005259.4:c.690+237G>A	7.37:g.107254114G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	G5E9L4|O95003	Missense_Mutation	SNP	pfam_Bap31	p.E236K	ENST00000005259.4	37	c.706	CCDS34731.1	7	.	.	.	.	.	.	.	.	.	.	G	8.973	0.973509	0.18736	.	.	ENSG00000075790	ENST00000445771;ENST00000379119	.	.	.	4.07	-0.337	0.12654	.	.	.	.	.	T	0.15262	0.0368	N	0.08118	0	0.09310	N	0.999994	B	0.06786	0.001	B	0.08055	0.003	T	0.19160	-1.0314	8	0.39692	T	0.17	-4.9482	2.6062	0.04878	0.385:0.0:0.4004:0.2146	.	236	G5E9L4	.	K	236	.	ENSP00000368414:E236K	E	+	1	0	BCAP29	107041350	0.008000	0.16893	0.003000	0.11579	0.065000	0.16274	0.316000	0.19469	0.036000	0.15547	0.650000	0.86243	GAA	BCAP29	-	NULL		0.358	BCAP29-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	BCAP29	HGNC	protein_coding	OTTHUMT00000337011.2	G	NM_018844		107254114	+1	no_errors	ENST00000379119	ensembl	human	known	70_37	missense	SNP	0.002	A
BEGAIN	57596	genome.wustl.edu	37	14	101012989	101012989	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:101012989C>T	ENST00000355173.2	-	3	96	c.25G>A	c.(25-27)Gag>Aag	p.E9K	BEGAIN_ENST00000556751.1_5'UTR|BEGAIN_ENST00000554747.1_5'UTR|BEGAIN_ENST00000443071.2_Missense_Mutation_p.E9K	NM_020836.3	NP_065887.1	Q9BUH8	BEGIN_HUMAN	brain-enriched guanylate kinase-associated	9						cytoplasm (GO:0005737)|dendrite (GO:0030425)|membrane (GO:0016020)|neuronal cell body (GO:0043025)		p.E9K(1)		cervix(1)|endometrium(4)|large_intestine(2)|lung(3)|prostate(1)|skin(2)|stomach(1)	14		Melanoma(154;0.212)				CCCTTCTGCTCCTGCAGCGCG	0.687																																					NSCLC(159;1889 2010 9965 27479 40101)												1	Substitution - Missense(1)	skin(1)											56.0	50.0	52.0					14																	101012989		2203	4300	6503	SO:0001583	missense	57596			BC002607	CCDS9962.1	14q32.2	2012-12-07	2012-12-07			ENSG00000183092			24163	protein-coding gene	gene with protein product			"""brain-enriched guanylate kinase-associated homolog (rat)"""			10819331	Standard	NM_020836		Approved	KIAA1446	uc010txa.2	Q9BUH8		ENST00000355173.2:c.25G>A	14.37:g.101012989C>T	ENSP00000347301:p.Glu9Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NPU3|Q9P282	Missense_Mutation	SNP	superfamily_Prefoldin	p.E9K	ENST00000355173.2	37	c.25	CCDS9962.1	14	.	.	.	.	.	.	.	.	.	.	c	13.20	2.165888	0.38217	.	.	ENSG00000183092	ENST00000355173;ENST00000443071;ENST00000553553;ENST00000556188;ENST00000557378;ENST00000554140	T;T;T;T;T;T	0.23348	1.91;1.91;1.91;1.91;1.91;1.91	4.48	3.59	0.41128	.	0.134693	0.49916	U	0.000136	T	0.26412	0.0645	L	0.56769	1.78	0.50039	D	0.99984	P	0.44139	0.827	B	0.41202	0.35	T	0.03773	-1.1005	10	0.62326	D	0.03	.	10.2243	0.43216	0.0:0.8999:0.0:0.1001	.	9	Q9BUH8	BEGIN_HUMAN	K	9;9;21;9;9;28	ENSP00000347301:E9K;ENSP00000411124:E9K;ENSP00000451397:E21K;ENSP00000452157:E9K;ENSP00000450722:E9K;ENSP00000451125:E28K	ENSP00000347301:E9K	E	-	1	0	BEGAIN	100082742	1.000000	0.71417	1.000000	0.80357	0.277000	0.26821	2.564000	0.45931	0.883000	0.36040	-0.370000	0.07254	GAG	BEGAIN	-	superfamily_Prefoldin		0.687	BEGAIN-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	BEGAIN	HGNC	protein_coding	OTTHUMT00000414329.1	C	NM_020836		101012989	-1	no_errors	ENST00000355173	ensembl	human	known	70_37	missense	SNP	1.000	T
BTN2A3P	54718	genome.wustl.edu	37	6	26428906	26428906	+	RNA	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:26428906C>T	ENST00000466808.2	+	0	1340							Q96KV6	BT2A3_HUMAN	butyrophilin, subfamily 2, member A3, pseudogene							integral component of membrane (GO:0016021)											TTTAGCCTTTCCTGAACTACT	0.378																																																	0													208.0	175.0	186.0					6																	26428906		2203	4300	6503			54718			AL021917		6p22.1	2014-01-14	2011-09-06	2011-09-06	ENSG00000124549	ENSG00000124549		"""Butyrophilins"""	13229	pseudogene	pseudogene		613592	"""butyrophilin, subfamily 2, member A3"""	BTN2A3			Standard	NR_027795		Approved	BTN2.3	uc011dkl.1	Q96KV6	OTTHUMG00000014453		6.37:g.26428906C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEF4	RNA	SNP	-	NULL	ENST00000466808.2	37	NULL		6																																																																																			BTN2A3P	-	-		0.378	BTN2A3P-001	KNOWN	basic	processed_transcript	BTN2A3P	HGNC	pseudogene	OTTHUMT00000040118.4	C	NR_027795		26428906	+1	no_errors	ENST00000465856	ensembl	human	known	70_37	rna	SNP	0.095	T
C10orf12	26148	genome.wustl.edu	37	10	98741904	98741904	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:98741904G>A	ENST00000286067.2	+	1	864	c.757G>A	c.(757-759)Gac>Aac	p.D253N		NM_015652.2	NP_056467.2	Q8N655	CJ012_HUMAN	chromosome 10 open reading frame 12	253								p.D253H(1)		NS(1)|breast(2)|endometrium(3)|kidney(1)|large_intestine(8)|lung(19)|ovary(3)|prostate(2)|skin(2)|stomach(4)	45		Colorectal(252;0.172)		Epithelial(162;6.35e-09)|all cancers(201;3.21e-07)		TCCCAGAGAAGACAACCCTGA	0.507																																																	1	Substitution - Missense(1)	breast(1)											95.0	96.0	95.0					10																	98741904		2203	4300	6503	SO:0001583	missense	26148			BC024315	CCDS7452.1	10q24.2	2014-03-11			ENSG00000155640	ENSG00000155640			23420	protein-coding gene	gene with protein product						24550272	Standard	NM_015652		Approved	DKFZP564P1916, FLJ13022	uc001kmv.3	Q8N655	OTTHUMG00000018840	ENST00000286067.2:c.757G>A	10.37:g.98741904G>A	ENSP00000286067:p.Asp253Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9H945|Q9Y457	Missense_Mutation	SNP	NULL	p.D253N	ENST00000286067.2	37	c.757	CCDS7452.1	10	.	.	.	.	.	.	.	.	.	.	G	19.91	3.914992	0.72983	.	.	ENSG00000155640	ENST00000286067;ENST00000539886	T	0.11385	2.78	6.05	6.05	0.98169	.	0.431244	0.19198	N	0.120253	T	0.22513	0.0543	L	0.29908	0.895	0.37730	D	0.925232	D;D	0.89917	1.0;1.0	D;D	0.72338	0.961;0.977	T	0.01202	-1.1420	10	0.38643	T	0.18	-13.5951	16.1087	0.81244	0.0:0.0:1.0:0.0	.	87;253	A0PJI9;Q8N655	.;CJ012_HUMAN	N	253;87	ENSP00000286067:D253N	ENSP00000286067:D253N	D	+	1	0	C10orf12	98731894	0.944000	0.32072	0.994000	0.49952	0.970000	0.65996	1.908000	0.39907	2.880000	0.98712	0.655000	0.94253	GAC	C10orf12	-	NULL		0.507	C10orf12-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C10orf12	HGNC	protein_coding	OTTHUMT00000049627.1	G	NM_015652		98741904	+1	no_errors	ENST00000286067	ensembl	human	known	70_37	missense	SNP	1.000	A
C12orf56	115749	genome.wustl.edu	37	12	64706454	64706454	+	Intron	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:64706454C>T	ENST00000543942.2	-	5	1595				C12orf56_ENST00000333722.5_Intron|RPS11P6_ENST00000535684.1_RNA	NM_001170633.1	NP_001164104.1	Q8IXR9	CL056_HUMAN	chromosome 12 open reading frame 56											NS(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(5)|lung(3)|ovary(1)	15			GBM - Glioblastoma multiforme(3;0.000582)	GBM - Glioblastoma multiforme(28;0.0259)		ATCATCACTTCTTACCTATAT	0.393																																																	0													195.0	185.0	188.0					12																	64706454		692	1591	2283	SO:0001627	intron_variant	115749				CCDS44935.1, CCDS61182.1	12q14.2	2012-08-15			ENSG00000185306	ENSG00000185306			26967	protein-coding gene	gene with protein product							Standard	NM_001099676		Approved		uc021qzu.1	Q8IXR9	OTTHUMG00000168782	ENST00000543942.2:c.968+4G>A	12.37:g.64706454C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	NULL	p.K323	ENST00000543942.2	37	c.969		12																																																																																			C12orf56	-	NULL		0.393	C12orf56-008	PUTATIVE	not_organism_supported|basic|appris_principal|exp_conf	protein_coding	C12orf56	HGNC	protein_coding	OTTHUMT00000401058.2	C	NM_001099676		64706454	-1	no_errors	ENST00000543942	ensembl	human	putative	70_37	silent	SNP	0.898	T
C12orf43	64897	genome.wustl.edu	37	12	121454196	121454196	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:121454196C>G	ENST00000288757.3	-	1	104	c.82G>C	c.(82-84)Gag>Cag	p.E28Q	C12orf43_ENST00000445832.3_5'UTR|C12orf43_ENST00000537817.1_5'UTR|C12orf43_ENST00000539736.1_Missense_Mutation_p.E28Q|C12orf43_ENST00000536407.2_Missense_Mutation_p.E28Q|C12orf43_ENST00000366211.2_5'UTR	NM_022895.1	NP_075046.1	Q96C57	CL043_HUMAN	chromosome 12 open reading frame 43	28								p.E28Q(1)		cervix(1)|endometrium(1)|kidney(1)|large_intestine(1)|lung(10)	14	all_neural(191;0.0684)|Medulloblastoma(191;0.0922)					ATTGCCGCCTCGCGGCACCGC	0.637																																																	1	Substitution - Missense(1)	cervix(1)											43.0	43.0	43.0					12																	121454196		2203	4300	6503	SO:0001583	missense	64897			AK022510	CCDS66486.1, CCDS66487.1	12q24.31	2012-05-30			ENSG00000157895	ENSG00000157895			25719	protein-coding gene	gene with protein product						8619474, 9110174	Standard	NM_001286195		Approved	FLJ12448	uc001tzh.1	Q96C57	OTTHUMG00000169150	ENST00000288757.3:c.82G>C	12.37:g.121454196C>G	ENSP00000288757:p.Glu28Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q53HF0|Q9H9Z7	Missense_Mutation	SNP	NULL	p.E28Q	ENST00000288757.3	37	c.82	CCDS9210.1	12	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	16.60|16.60	3.169457|3.169457	0.57584|0.57584	.|.	.|.	ENSG00000157895|ENSG00000157895	ENST00000288757;ENST00000539736|ENST00000536407	T;T|.	0.58940|.	0.38;0.3|.	5.06|5.06	5.06|5.06	0.68205|0.68205	.|.	0.046078|.	0.85682|.	D|.	0.000000|.	T|T	0.72977|0.72977	0.3528|0.3528	M|M	0.65975|0.65975	2.015|2.015	0.80722|0.80722	D|D	1|1	P;P;D|.	0.64830|.	0.933;0.794;0.994|.	P;P;P|.	0.58577|.	0.812;0.812;0.841|.	T|T	0.75379|0.75379	-0.3338|-0.3338	10|6	0.54805|0.87932	T|D	0.06|0	-38.6147|-38.6147	14.1151|14.1151	0.65149|0.65149	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	28;28;28|.	G5EA44;B4DWJ9;Q96C57|.	.;.;CL043_HUMAN|.	Q|P	28|32	ENSP00000288757:E28Q;ENSP00000437803:E28Q|.	ENSP00000288757:E28Q|ENSP00000437546:R32P	E|R	-|-	1|2	0|0	C12orf43|C12orf43	119938579|119938579	0.984000|0.984000	0.35163|0.35163	1.000000|1.000000	0.80357|0.80357	0.058000|0.058000	0.15608|0.15608	3.546000|3.546000	0.53656|0.53656	2.778000|2.778000	0.95560|0.95560	0.655000|0.655000	0.94253|0.94253	GAG|CGA	C12orf43	-	NULL		0.637	C12orf43-201	KNOWN	basic|appris_principal|CCDS	protein_coding	C12orf43	HGNC	protein_coding		C	NM_022895		121454196	-1	no_errors	ENST00000288757	ensembl	human	known	70_37	missense	SNP	0.999	G
C17orf96	100170841	genome.wustl.edu	37	17	36829966	36829966	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:36829966G>T	ENST00000325814.5	-	1	1221	c.783C>A	c.(781-783)ttC>ttA	p.F261L		NM_001130677.1	NP_001124149.1	A6NHQ4	CQ096_HUMAN	chromosome 17 open reading frame 96	261	Pro-rich.				neuron fate commitment (GO:0048663)												TGTCCAAGGCGAAGCCCTTCG	0.701																																																	0													6.0	7.0	6.0					17																	36829966		680	1574	2254	SO:0001583	missense	100170841				CCDS45661.1	17q12	2014-04-17			ENSG00000179294	ENSG00000273604			34493	protein-coding gene	gene with protein product	"""proline rich 28"""					24550272	Standard	NM_001130677		Approved	LOC100170841, PRR28	uc010wdq.2	A6NHQ4	OTTHUMG00000188495	ENST00000325814.5:c.783C>A	17.37:g.36829966G>T	ENSP00000317905:p.Phe261Leu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.F261L	ENST00000325814.5	37	c.783	CCDS45661.1	17	.	.	.	.	.	.	.	.	.	.	G	15.30	2.793870	0.50102	.	.	ENSG00000179294	ENST00000325814	.	.	.	4.28	1.13	0.20643	.	.	.	.	.	T	0.25382	0.0617	N	0.24115	0.695	0.25762	N	0.984937	B	0.18461	0.028	B	0.15870	0.014	T	0.20773	-1.0265	8	0.25751	T	0.34	.	7.3055	0.26445	0.3084:0.0:0.6916:0.0	.	261	A6NHQ4	CQ096_HUMAN	L	261	.	ENSP00000317905:F261L	F	-	3	2	C17orf96	34083492	1.000000	0.71417	0.954000	0.39281	0.087000	0.18053	0.684000	0.25364	0.268000	0.21939	0.462000	0.41574	TTC	C17orf96	-	NULL		0.701	C17orf96-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C17orf96	HGNC	protein_coding	OTTHUMT00000255465.2	G	NM_001130677		36829966	-1	no_errors	ENST00000325814	ensembl	human	known	70_37	missense	SNP	0.822	T
C2orf16	84226	genome.wustl.edu	37	2	27804570	27804570	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:27804570C>T	ENST00000408964.2	+	1	5182	c.5131C>T	c.(5131-5133)Cac>Tac	p.H1711Y	ZNF512_ENST00000556601.1_5'Flank|ZNF512_ENST00000416005.2_5'Flank|RP11-158I13.2_ENST00000505973.1_RNA|ZNF512_ENST00000413371.2_5'Flank|AC074091.1_ENST00000408604.1_RNA|ZNF512_ENST00000379717.1_5'Flank|ZNF512_ENST00000355467.4_5'Flank	NM_032266.3	NP_115642.3	Q68DN1	CB016_HUMAN	chromosome 2 open reading frame 16	1711	27 X 8 AA approximative tandem repeat of P-S-E-R-S-H-H-S.|Arg-rich.					extracellular vesicular exosome (GO:0070062)|nucleus (GO:0005634)				breast(1)|central_nervous_system(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(1)|lung(33)|urinary_tract(1)	47	Acute lymphoblastic leukemia(172;0.155)					GAGAAGACATCACAGTCCCTC	0.577																																																	0													167.0	169.0	169.0					2																	27804570		1925	4137	6062	SO:0001583	missense	84226			AL136898	CCDS42666.1	2p23.3	2013-09-20			ENSG00000221843	ENSG00000221843			25275	protein-coding gene	gene with protein product	"""P-S-E-R-S-H-H-S repeats containing"""						Standard	NM_032266		Approved	DKFZp434G118	uc002rkz.4	Q68DN1	OTTHUMG00000159099	ENST00000408964.2:c.5131C>T	2.37:g.27804570C>T	ENSP00000386190:p.His1711Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	B9EIQ4|Q53S01|Q8ND64|Q9H088	Missense_Mutation	SNP	NULL	p.H1711Y	ENST00000408964.2	37	c.5131	CCDS42666.1	2	.	.	.	.	.	.	.	.	.	.	C	8.694	0.908073	0.17833	.	.	ENSG00000221843	ENST00000408964	T	0.05139	3.49	3.34	1.5	0.22942	.	.	.	.	.	T	0.06826	0.0174	L	0.50333	1.59	0.09310	N	1	P	0.47604	0.898	B	0.43867	0.434	T	0.32214	-0.9915	9	0.16896	T	0.51	.	6.204	0.20591	0.1828:0.7103:0.0:0.1069	.	1711	Q68DN1	CB016_HUMAN	Y	1711	ENSP00000386190:H1711Y	ENSP00000386190:H1711Y	H	+	1	0	C2orf16	27658074	0.000000	0.05858	0.001000	0.08648	0.001000	0.01503	-0.139000	0.10358	0.401000	0.25424	-0.475000	0.04921	CAC	C2orf16	-	NULL		0.577	C2orf16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C2orf16	HGNC	protein_coding	OTTHUMT00000353292.1	C	NM_032266		27804570	+1	no_errors	ENST00000408964	ensembl	human	known	70_37	missense	SNP	0.003	T
SMIM14	201895	genome.wustl.edu	37	4	39558162	39558162	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr4:39558162G>C	ENST00000295958.5	-	4	539	c.153C>G	c.(151-153)atC>atG	p.I51M	SMIM14_ENST00000510628.1_5'UTR|SMIM14_ENST00000511809.1_Intron|UGDH-AS1_ENST00000504032.1_RNA	NM_174921.1	NP_777581.1	Q96QK8	SIM14_HUMAN	small integral membrane protein 14	51						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)											TTGTAACACTGATGCCATTAT	0.378																																																	0													96.0	84.0	88.0					4																	39558162		2203	4300	6503	SO:0001583	missense	201895			BC008502	CCDS3456.1	4p14	2014-02-10	2012-12-03	2012-12-03	ENSG00000163683	ENSG00000163683			27321	protein-coding gene	gene with protein product			"""chromosome 4 open reading frame 34"""	C4orf34		15231747, 24499674, 23759569	Standard	NM_174921		Approved	FLJ13289	uc003guo.3	Q96QK8	OTTHUMG00000128581	ENST00000295958.5:c.153C>G	4.37:g.39558162G>C	ENSP00000295958:p.Ile51Met	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Uncharacterised_CD034/YQF4	p.S35*	ENST00000295958.5	37	c.104	CCDS3456.1	4	.	.	.	.	.	.	.	.	.	.	G	19.45	3.828941	0.71258	.	.	ENSG00000163683	ENST00000295958;ENST00000505729	.	.	.	5.28	4.44	0.53790	.	0.214276	0.37955	N	0.001870	T	0.41419	0.1158	.	.	.	0.80722	D	1	P	0.39022	0.655	B	0.34536	0.185	T	0.27157	-1.0082	8	0.34782	T	0.22	-11.5323	12.9381	0.58327	0.0789:0.0:0.9211:0.0	.	51	Q96QK8	CD034_HUMAN	M	51	.	ENSP00000295958:I51M	I	-	3	3	C4orf34	39234557	1.000000	0.71417	1.000000	0.80357	0.982000	0.71751	3.271000	0.51608	1.213000	0.43380	-0.136000	0.14681	ATC	C4orf34	-	NULL		0.378	SMIM14-001	KNOWN	basic|appris_principal|exp_conf|CCDS	protein_coding	C4orf34	HGNC	protein_coding	OTTHUMT00000250434.4	G	NM_174921		39558162	-1	no_errors	ENST00000507613	ensembl	human	known	70_37	nonsense	SNP	1.000	C
C5orf64	285668	genome.wustl.edu	37	5	60982894	60982894	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr5:60982894C>G	ENST00000505642.1	+	3	297	c.222C>G	c.(220-222)ttC>ttG	p.F74L	RP11-2O17.2_ENST00000507264.1_RNA|C5orf64_ENST00000510414.1_Intron|RP11-2O17.2_ENST00000513386.1_RNA|RP11-2O17.2_ENST00000505623.1_RNA|C5orf64_ENST00000313303.7_Missense_Mutation_p.F74L	NM_173667.2	NP_775938.1	Q2M2E5	CE064_HUMAN	chromosome 5 open reading frame 64	74						extracellular region (GO:0005576)				breast(1)	1						CTGCAGTTTTCTATGTAAGTA	0.393																																																	0													114.0	109.0	110.0					5																	60982894		1880	4098	5978	SO:0001583	missense	285668				CCDS54860.1	5q12.1	2014-02-12	2011-05-05		ENSG00000178722	ENSG00000178722			26744	protein-coding gene	gene with protein product							Standard	NM_173667		Approved	FLJ37543	uc003jst.1	Q2M2E5	OTTHUMG00000162412	ENST00000505642.1:c.222C>G	5.37:g.60982894C>G	ENSP00000423157:p.Phe74Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M2H1|Q8N1U8	Missense_Mutation	SNP	NULL	p.F74L	ENST00000505642.1	37	c.222	CCDS54860.1	5	.	.	.	.	.	.	.	.	.	.	C	6.439	0.449131	0.12223	.	.	ENSG00000178722	ENST00000505642;ENST00000313303	T;T	0.36520	1.25;1.25	5.14	-5.52	0.02560	.	1.146150	0.06887	N	0.803629	T	0.16769	0.0403	N	0.14661	0.345	0.09310	N	1	B	0.23891	0.093	B	0.19666	0.026	T	0.25467	-1.0131	10	0.21014	T	0.42	-0.0943	6.4313	0.21798	0.0:0.2723:0.3251:0.4026	.	74	Q2M2E5	CE064_HUMAN	L	74	ENSP00000423157:F74L;ENSP00000318395:F74L	ENSP00000318395:F74L	F	+	3	2	C5orf64	61018651	0.000000	0.05858	0.000000	0.03702	0.015000	0.08874	-2.923000	0.00692	-0.908000	0.03857	0.655000	0.94253	TTC	C5orf64	-	NULL		0.393	C5orf64-001	KNOWN	basic|appris_principal|CCDS	protein_coding	C5orf64	HGNC	protein_coding	OTTHUMT00000368790.1	C	NM_173667		60982894	+1	no_errors	ENST00000313303	ensembl	human	known	70_37	missense	SNP	0.000	G
CABIN1	23523	genome.wustl.edu	37	22	24563133	24563133	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr22:24563133G>A	ENST00000398319.2	+	32	5919	c.5534G>A	c.(5533-5535)cGc>cAc	p.R1845H	CABIN1_ENST00000405822.2_Missense_Mutation_p.R1766H|CABIN1_ENST00000263119.5_Missense_Mutation_p.R1845H|CABIN1_ENST00000337989.7_Missense_Mutation_p.R270H	NM_001199281.1	NP_001186210.1	Q9Y6J0	CABIN_HUMAN	calcineurin binding protein 1	1845					cell surface receptor signaling pathway (GO:0007166)|chromatin modification (GO:0016568)|DNA replication-independent nucleosome assembly (GO:0006336)|negative regulation of catalytic activity (GO:0043086)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	protein phosphatase inhibitor activity (GO:0004864)			breast(2)|central_nervous_system(2)|endometrium(6)|kidney(6)|large_intestine(13)|liver(1)|lung(18)|ovary(5)|pancreas(3)|prostate(1)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(1)	65						CGGCTCAGCCGCAAGAGGAAG	0.697																																																	0													21.0	24.0	23.0					22																	24563133		2200	4298	6498	SO:0001583	missense	23523			AF072441	CCDS13823.1, CCDS74830.1	22q11.23	2008-09-16			ENSG00000099991	ENSG00000099991			24187	protein-coding gene	gene with protein product		604251				9655484, 9205841	Standard	NM_001199281		Approved	KIAA0330, PPP3IN	uc002zzi.1	Q9Y6J0	OTTHUMG00000150797	ENST00000398319.2:c.5534G>A	22.37:g.24563133G>A	ENSP00000381364:p.Arg1845His	Somatic		WXS	Illumina HiSeq	Phase_IV	G5E9F3|Q6PHY0|Q9Y460	Missense_Mutation	SNP	pfam_MEF2_binding,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom	p.R1845H	ENST00000398319.2	37	c.5534	CCDS13823.1	22	.	.	.	.	.	.	.	.	.	.	G	29.4	5.003983	0.93287	.	.	ENSG00000099991	ENST00000263119;ENST00000405822;ENST00000398319;ENST00000337989;ENST00000403176	T;T;T;T	0.20069	2.1;2.1;2.1;2.1	5.01	5.01	0.66863	.	0.000000	0.85682	D	0.000000	T	0.37571	0.1008	L	0.34521	1.04	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.83275	0.991;0.996;0.991	T	0.16129	-1.0413	10	0.66056	D	0.02	.	17.7539	0.88444	0.0:0.0:1.0:0.0	.	270;1766;1845	B5MEB3;G5E9F3;Q9Y6J0	.;.;CABIN_HUMAN	H	1845;1766;1845;270;270	ENSP00000263119:R1845H;ENSP00000384694:R1766H;ENSP00000381364:R1845H;ENSP00000336991:R270H	ENSP00000263119:R1845H	R	+	2	0	CABIN1	22893133	1.000000	0.71417	1.000000	0.80357	0.919000	0.55068	9.292000	0.96076	2.503000	0.84419	0.558000	0.71614	CGC	CABIN1	-	NULL		0.697	CABIN1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABIN1	HGNC	protein_coding	OTTHUMT00000320161.2	G	NM_012295		24563133	+1	no_errors	ENST00000263119	ensembl	human	known	70_37	missense	SNP	1.000	A
CABP4	57010	genome.wustl.edu	37	11	67225898	67225898	+	Silent	SNP	G	G	A	rs550153300		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:67225898G>A	ENST00000325656.5	+	5	785	c.708G>A	c.(706-708)ccG>ccA	p.P236P	CABP4_ENST00000438189.2_Silent_p.P131P|CTC-1337H24.1_ENST00000602912.1_lincRNA	NM_145200.3	NP_660201.1	P57796	CABP4_HUMAN	calcium binding protein 4	236	EF-hand 3. {ECO:0000255|PROSITE- ProRule:PRU00448}.				photoreceptor cell morphogenesis (GO:0008594)|phototransduction (GO:0007602)|retinal bipolar neuron differentiation (GO:0060040)|retinal cone cell development (GO:0046549)|signal transduction (GO:0007165)|visual perception (GO:0007601)	cytosol (GO:0005829)|extracellular region (GO:0005576)|synapse (GO:0045202)|terminal bouton (GO:0043195)	calcium ion binding (GO:0005509)			central_nervous_system(2)|large_intestine(3)|lung(2)|ovary(1)|prostate(1)|skin(2)	11			BRCA - Breast invasive adenocarcinoma(15;8.18e-06)			AGGCGGTACCGGCTCTGCTCG	0.632																																																	0													51.0	56.0	55.0					11																	67225898		2200	4295	6495	SO:0001819	synonymous_variant	57010			AC005849	CCDS8166.1, CCDS73333.1	11q13.2	2013-09-20			ENSG00000175544	ENSG00000175544		"""EF-hand domain containing"""	1386	protein-coding gene	gene with protein product		608965				10625670, 16960802	Standard	NM_145200		Approved	CSNB2B	uc001olo.3	P57796	OTTHUMG00000168033	ENST00000325656.5:c.708G>A	11.37:g.67225898G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N4Z2|Q8WWY5	Silent	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.P236	ENST00000325656.5	37	c.708	CCDS8166.1	11																																																																																			CABP4	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.632	CABP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CABP4	HGNC	protein_coding	OTTHUMT00000397624.2	G			67225898	+1	no_errors	ENST00000325656	ensembl	human	known	70_37	silent	SNP	0.000	A
CABP2	51475	genome.wustl.edu	37	11	67287316	67287316	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:67287316G>A	ENST00000294288.4	-	6	654	c.585C>T	c.(583-585)gaC>gaT	p.D195D	CABP2_ENST00000353903.5_Silent_p.D138D	NM_016366.2	NP_057450.2	Q9NPB3	CABP2_HUMAN	calcium binding protein 2	195	EF-hand 4. {ECO:0000255|PROSITE- ProRule:PRU00448}.				signal transduction (GO:0007165)	Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			endometrium(2)|large_intestine(1)|lung(3)|prostate(1)|skin(2)	9						GGAGGATCTCGTCCACCTCCC	0.667																																																	0													76.0	74.0	74.0					11																	67287316		2200	4295	6495	SO:0001819	synonymous_variant	51475			AF169154	CCDS8170.1	11q13.1	2013-01-10			ENSG00000167791	ENSG00000167791		"""EF-hand domain containing"""	1385	protein-coding gene	gene with protein product		607314				10625670	Standard	NM_016366		Approved		uc001omc.1	Q9NPB3	OTTHUMG00000168014	ENST00000294288.4:c.585C>T	11.37:g.67287316G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2	p.D195	ENST00000294288.4	37	c.585	CCDS8170.1	11																																																																																			CABP2	-	pfam_EF-hand,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.667	CABP2-002	KNOWN	basic|CCDS	protein_coding	CABP2	HGNC	protein_coding	OTTHUMT00000397516.1	G			67287316	-1	no_errors	ENST00000294288	ensembl	human	known	70_37	silent	SNP	0.376	A
CFAP45	25790	genome.wustl.edu	37	1	159842990	159842990	+	Intron	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:159842990C>T	ENST00000368099.4	-	11	1417				CCDC19_ENST00000426543.2_Intron|CCDC19_ENST00000476696.1_Intron|RP11-190A12.7_ENST00000544342.1_5'Flank	NM_012337.2	NP_036469.2														endometrium(2)|large_intestine(7)|lung(11)|ovary(1)|prostate(2)|skin(1)|urinary_tract(2)	26	all_hematologic(112;0.0597)		BRCA - Breast invasive adenocarcinoma(70;0.151)			GGAATGAACTCAGCTGAGCTG	0.607																																																	0													25.0	24.0	24.0					1																	159842990		2203	4300	6503	SO:0001627	intron_variant	25790																														ENST00000368099.4:c.1353-32G>A	1.37:g.159842990C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000368099.4	37	NULL	CCDS30914.1	1																																																																																			CCDC19	-	-		0.607	CCDC19-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC19	HGNC	protein_coding	OTTHUMT00000085979.1	C			159842990	-1	no_errors	ENST00000479861	ensembl	human	known	70_37	rna	SNP	0.000	T
CCDC77	84318	genome.wustl.edu	37	12	539854	539854	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:539854C>T	ENST00000239830.4	+	7	714	c.535C>T	c.(535-537)Cag>Tag	p.Q179*	CCDC77_ENST00000422000.1_Nonsense_Mutation_p.Q147*|CCDC77_ENST00000540344.1_3'UTR|CCDC77_ENST00000540180.1_Nonsense_Mutation_p.Q147*|CCDC77_ENST00000412006.2_Nonsense_Mutation_p.Q147*	NM_032358.3	NP_115734.1	Q9BR77	CCD77_HUMAN	coiled-coil domain containing 77	179						centrosome (GO:0005813)|membrane (GO:0016020)				cervix(1)|endometrium(1)|large_intestine(5)|liver(2)|lung(6)|ovary(1)|skin(2)|urinary_tract(1)	19	all_cancers(10;0.0149)|all_epithelial(11;0.035)|all_lung(10;0.111)|Ovarian(42;0.142)|Lung NSC(10;0.156)		OV - Ovarian serous cystadenocarcinoma(31;0.00123)|BRCA - Breast invasive adenocarcinoma(9;0.033)			AAAGACTATCCAGGCTGTAGG	0.373																																																	0													135.0	131.0	132.0					12																	539854		2203	4300	6503	SO:0001587	stop_gained	84318			AK027638	CCDS8503.1, CCDS44781.1	12p13.33	2006-02-16			ENSG00000120647	ENSG00000120647			28203	protein-coding gene	gene with protein product						12477932	Standard	NM_001130148		Approved	MGC13183	uc001qig.3	Q9BR77	OTTHUMG00000129214	ENST00000239830.4:c.535C>T	12.37:g.539854C>T	ENSP00000239830:p.Gln179*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DDE8	Nonsense_Mutation	SNP	NULL	p.Q179*	ENST00000239830.4	37	c.535	CCDS8503.1	12	.	.	.	.	.	.	.	.	.	.	C	24.7	4.557472	0.86231	.	.	ENSG00000120647	ENST00000540180;ENST00000422000;ENST00000543504;ENST00000239830;ENST00000412006	.	.	.	5.18	5.18	0.71444	.	0.821953	0.11212	N	0.587650	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	-5.7966	13.1826	0.59663	0.1604:0.8396:0.0:0.0	.	.	.	.	X	147;147;147;179;147	.	ENSP00000239830:Q179X	Q	+	1	0	CCDC77	410115	0.198000	0.23374	0.030000	0.17652	0.212000	0.24457	1.366000	0.34193	2.415000	0.81967	0.478000	0.44815	CAG	CCDC77	-	NULL		0.373	CCDC77-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCDC77	HGNC	protein_coding	OTTHUMT00000251296.1	C	NM_032358		539854	+1	no_errors	ENST00000239830	ensembl	human	known	70_37	nonsense	SNP	0.013	T
CCT3	7203	genome.wustl.edu	37	1	156290801	156290801	+	Silent	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:156290801G>T	ENST00000295688.3	-	7	718	c.438C>A	c.(436-438)atC>atA	p.I146I	CCT3_ENST00000368261.3_Silent_p.I101I|CCT3_ENST00000368259.2_Silent_p.I108I|CCT3_ENST00000472765.2_Silent_p.I101I	NM_005998.4	NP_005989.3	P49368	TCPG_HUMAN	chaperonin containing TCP1, subunit 3 (gamma)	146					'de novo' posttranslational protein folding (GO:0051084)|binding of sperm to zona pellucida (GO:0007339)|cellular protein metabolic process (GO:0044267)|protein folding (GO:0006457)	cell body (GO:0044297)|chaperonin-containing T-complex (GO:0005832)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|plasma membrane (GO:0005886)|zona pellucida receptor complex (GO:0002199)	ATP binding (GO:0005524)|poly(A) RNA binding (GO:0044822)|unfolded protein binding (GO:0051082)			endometrium(4)|large_intestine(1)|liver(1)|lung(11)|ovary(2)|prostate(1)|skin(1)|urinary_tract(1)	22	Hepatocellular(266;0.158)					CACTGTCACTGATGTCGACTG	0.423																																																	0													142.0	123.0	129.0					1																	156290801		2203	4300	6503	SO:0001819	synonymous_variant	7203			BC008019	CCDS1140.2, CCDS30888.1	1q23	2011-09-02			ENSG00000163468	ENSG00000163468		"""Heat Shock Proteins / Chaperonins"""	1616	protein-coding gene	gene with protein product		600114		TRIC5		8110840	Standard	NM_005998		Approved	Cctg	uc001fol.2	P49368	OTTHUMG00000024061	ENST00000295688.3:c.438C>A	1.37:g.156290801G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NE14|Q5SZY1|Q9BR64	Silent	SNP	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,prints_Chaperone_TCP-1,prints_Chaprnin_Cpn60,tigrfam_Chap_CCT_gamma	p.I146	ENST00000295688.3	37	c.438	CCDS1140.2	1																																																																																			CCT3	-	pfam_Cpn60/TCP-1,superfamily_Cpn60/TCP-1,tigrfam_Chap_CCT_gamma		0.423	CCT3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CCT3	HGNC	protein_coding	OTTHUMT00000060602.3	G	NM_005998		156290801	-1	no_errors	ENST00000295688	ensembl	human	known	70_37	silent	SNP	0.119	T
CD247	919	genome.wustl.edu	37	1	167404653	167404653	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:167404653G>T	ENST00000362089.5	-	5	391	c.319C>A	c.(319-321)Cag>Aag	p.Q107K	CD247_ENST00000483825.1_5'UTR|CD247_ENST00000392122.3_Missense_Mutation_p.Q106K			P20963	CD3Z_HUMAN	CD247 molecule	107	ITAM 2. {ECO:0000255|PROSITE- ProRule:PRU00379}.				Fc-gamma receptor signaling pathway involved in phagocytosis (GO:0038096)|innate immune response (GO:0045087)|regulation of defense response to virus by virus (GO:0050690)|regulation of immune response (GO:0050776)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|viral process (GO:0016032)	alpha-beta T cell receptor complex (GO:0042105)|cytoplasm (GO:0005737)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)|T cell receptor complex (GO:0042101)	identical protein binding (GO:0042802)|protein homodimerization activity (GO:0042803)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(1)|skin(1)	6			LUSC - Lung squamous cell carcinoma(543;0.236)		Muromonab(DB00075)	AGGCCTTCCTGAGGGTTCTTC	0.532																																					Ovarian(192;1815 2869 36877 43334)												0													101.0	94.0	97.0					1																	167404653		2203	4300	6503	SO:0001583	missense	919			BC025703	CCDS1260.1, CCDS1261.1	1q24.2	2014-09-17	2006-03-28	2006-03-09	ENSG00000198821	ENSG00000198821		"""CD molecules"""	1677	protein-coding gene	gene with protein product		186780	"""CD3z antigen, zeta polypeptide (TiT3 complex)"", ""CD247 antigen"""	CD3Z		2974162	Standard	NM_198053		Approved	CD3H, CD3Q	uc001gei.4	P20963	OTTHUMG00000034593	ENST00000362089.5:c.319C>A	1.37:g.167404653G>T	ENSP00000354782:p.Gln107Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AK49|Q5VX13|Q8TAX4	Missense_Mutation	SNP	pfam_Phos_immunorcpt_sig_ITAM,pfam_CR3_zeta/IgE_Fc_rcpt_gamma,smart_Phos_immunorcpt_sig_ITAM,pfscan_Phos_immunorcpt_sig_ITAM	p.Q107K	ENST00000362089.5	37	c.319	CCDS1261.1	1	.	.	.	.	.	.	.	.	.	.	G	11.06	1.529105	0.27387	.	.	ENSG00000198821	ENST00000392122;ENST00000362089	.	.	.	4.32	2.29	0.28610	.	0.741843	0.11177	U	0.591324	T	0.32164	0.0820	L	0.54323	1.7	0.27484	N	0.952472	P;B;B	0.50943	0.94;0.102;0.062	P;B;B	0.46543	0.52;0.115;0.053	T	0.08472	-1.0720	8	0.41790	T	0.15	-7.9718	10.3623	0.44001	0.0:0.0:0.6482:0.3518	.	107;106;107	Q6KAV0;P20963-3;P20963	.;.;CD3Z_HUMAN	K	106;107	.	ENSP00000354782:Q107K	Q	-	1	0	CD247	165671277	0.535000	0.26370	0.643000	0.29450	0.890000	0.51754	2.581000	0.46077	1.018000	0.39521	0.655000	0.94253	CAG	CD247	-	NULL		0.532	CD247-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	CD247	HGNC	protein_coding	OTTHUMT00000083707.1	G	NM_198053		167404653	-1	no_errors	ENST00000362089	ensembl	human	known	70_37	missense	SNP	0.220	T
CD70	970	genome.wustl.edu	37	19	6586411	6586411	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:6586411G>A	ENST00000245903.3	-	3	351	c.202C>T	c.(202-204)Cag>Tag	p.Q68*	CD70_ENST00000423145.3_Nonsense_Mutation_p.Q68*	NM_001252.3	NP_001243.1	P32970	CD70_HUMAN	CD70 molecule	68					cell proliferation (GO:0008283)|cell-cell signaling (GO:0007267)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|signal transduction (GO:0007165)	extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	protease binding (GO:0002020)|receptor binding (GO:0005102)			endometrium(1)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(6)|skin(1)	11						GGGTCCTGCTGAGGTCCTGGG	0.582																																					Pancreas(183;2617 2876 10173 34193)												0													24.0	23.0	24.0					19																	6586411		2203	4299	6502	SO:0001587	stop_gained	970			L08096	CCDS12170.1	19p13	2013-05-22	2006-10-27	2006-10-27		ENSG00000125726		"""Tumor necrosis factor (ligand) superfamily"", ""CD molecules"""	11937	protein-coding gene	gene with protein product		602840	"""tumor necrosis factor (ligand) superfamily, member 7"""	CD27LG, TNFSF7		8387892, 8120384	Standard	NM_001252		Approved	CD27L	uc002mfi.3	P32970		ENST00000245903.3:c.202C>T	19.37:g.6586411G>A	ENSP00000245903:p.Gln68*	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DPR8|Q53XX4|Q96J57	Nonsense_Mutation	SNP	pfam_TNF,superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF	p.Q68*	ENST00000245903.3	37	c.202	CCDS12170.1	19	.	.	.	.	.	.	.	.	.	.	G	36	5.695831	0.96802	.	.	ENSG00000125726	ENST00000423145;ENST00000245903	.	.	.	3.8	3.8	0.43715	.	0.321062	0.22539	N	0.058749	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.38643	T	0.18	-42.3434	11.3198	0.49415	0.0:0.0:1.0:0.0	.	.	.	.	X	68	.	ENSP00000245903:Q68X	Q	-	1	0	CD70	6537411	0.022000	0.18835	0.120000	0.21714	0.987000	0.75469	1.538000	0.36094	2.127000	0.65507	0.556000	0.70494	CAG	CD70	-	superfamily_Tumour_necrosis_fac-like,smart_TNF,pfscan_TNF		0.582	CD70-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD70	HGNC	protein_coding	OTTHUMT00000457860.1	G			6586411	-1	no_errors	ENST00000245903	ensembl	human	known	70_37	nonsense	SNP	0.084	A
CD3EAP	10849	genome.wustl.edu	37	19	45912270	45912270	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:45912270G>C	ENST00000309424.3	+	3	1532	c.1044G>C	c.(1042-1044)gaG>gaC	p.E348D	ERCC1_ENST00000423698.2_3'UTR|CD3EAP_ENST00000589804.1_Missense_Mutation_p.E350D|ERCC1_ENST00000300853.3_3'UTR|ERCC1_ENST00000588738.1_5'Flank|PPP1R13L_ENST00000418234.2_5'Flank	NM_012099.1	NP_036231.1	O15446	RPA34_HUMAN	CD3e molecule, epsilon associated protein	348					rRNA transcription (GO:0009303)|transmembrane receptor protein tyrosine kinase signaling pathway (GO:0007169)	chromosome (GO:0005694)|cytoplasm (GO:0005737)|DNA-directed RNA polymerase I complex (GO:0005736)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)|RNA polymerase I transcription factor complex (GO:0000120)	DNA-directed RNA polymerase activity (GO:0003899)|poly(A) RNA binding (GO:0044822)			breast(2)|endometrium(1)|large_intestine(3)|lung(2)|ovary(2)|prostate(1)	11		all_neural(266;0.224)|Ovarian(192;0.231)		OV - Ovarian serous cystadenocarcinoma(262;0.0251)		AGGCGATGGAGCCAGTGGAGC	0.617																																																	0													53.0	60.0	58.0					19																	45912270		2203	4300	6503	SO:0001583	missense	10849			U86751	CCDS12661.1, CCDS74397.1	19q13.3	2008-02-05	2006-03-28			ENSG00000117877			24219	protein-coding gene	gene with protein product	"""CD3 epsilon associated protein"", ""antisense to ERCC 1"""	107325	"""CD3e antigen, epsilon polypeptide associated protein"""			10373416, 9426281, 15226435	Standard	XM_005258425		Approved	ASE-1, CAST, PAF49	uc002pbq.1	O15446		ENST00000309424.3:c.1044G>C	19.37:g.45912270G>C	ENSP00000310966:p.Glu348Asp	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32N11|Q7Z5U2|Q9UPF6	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol1_su_RPA34	p.E350D	ENST00000309424.3	37	c.1050	CCDS12661.1	19	.	.	.	.	.	.	.	.	.	.	G	13.68	2.310845	0.40895	.	.	ENSG00000117877	ENST00000309424	T	0.16073	2.37	4.32	2.13	0.27403	.	0.371910	0.19388	N	0.115484	T	0.13072	0.0317	L	0.32530	0.975	0.19300	N	0.999978	P;P	0.47841	0.879;0.901	B;P	0.44647	0.327;0.456	T	0.14062	-1.0486	10	0.22706	T	0.39	-10.2403	8.1349	0.31048	0.2058:0.0:0.7942:0.0	.	350;348	O15446-2;O15446	.;RPA34_HUMAN	D	348	ENSP00000310966:E348D	ENSP00000310966:E348D	E	+	3	2	CD3EAP	50604110	0.070000	0.21116	0.002000	0.10522	0.010000	0.07245	3.312000	0.51927	0.945000	0.37605	0.491000	0.48974	GAG	CD3EAP	-	NULL		0.617	CD3EAP-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	CD3EAP	HGNC	protein_coding	OTTHUMT00000459538.1	G	NM_012099		45912270	+1	no_errors	ENST00000589804	ensembl	human	known	70_37	missense	SNP	0.002	C
CD72	971	genome.wustl.edu	37	9	35612927	35612927	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:35612927G>C	ENST00000396757.1	-	7	916	c.752C>G	c.(751-753)tCa>tGa	p.S251*	CD72_ENST00000259633.4_Nonsense_Mutation_p.S251*|CD72_ENST00000490239.1_5'UTR			P21854	CD72_HUMAN	CD72 molecule	251	C-type lectin. {ECO:0000255|PROSITE- ProRule:PRU00040}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|signal transduction (GO:0007165)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	carbohydrate binding (GO:0030246)|receptor binding (GO:0005102)|transmembrane signaling receptor activity (GO:0004888)			large_intestine(5)|liver(1)|lung(6)	12			Lung(28;0.00276)|LUSC - Lung squamous cell carcinoma(32;0.00418)|STAD - Stomach adenocarcinoma(86;0.194)			CCAATTTTTTGAAGTAAGTGA	0.413																																																	0													213.0	193.0	200.0					9																	35612927		2203	4300	6503	SO:0001587	stop_gained	971				CCDS6581.1	9p	2008-07-21	2006-03-28		ENSG00000137101	ENSG00000137101		"""CD molecules"""	1696	protein-coding gene	gene with protein product		107272	"""CD72 antigen"""			2044654, 1711157	Standard	NM_001782		Approved	LYB2, CD72b	uc003zxb.2	P21854	OTTHUMG00000019870	ENST00000396757.1:c.752C>G	9.37:g.35612927G>C	ENSP00000379980:p.Ser251*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin	p.S251*	ENST00000396757.1	37	c.752	CCDS6581.1	9	.	.	.	.	.	.	.	.	.	.	G	12.34	1.909694	0.33721	.	.	ENSG00000137101	ENST00000396757;ENST00000396759;ENST00000259633	.	.	.	5.54	-11.1	0.00147	.	3.654690	0.00887	N	0.002198	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.27785	T	0.31	2.149	6.2671	0.20932	0.079:0.4144:0.317:0.1896	.	.	.	.	X	251	.	ENSP00000259633:S251X	S	-	2	0	CD72	35602927	0.000000	0.05858	0.000000	0.03702	0.001000	0.01503	-2.590000	0.00899	-3.194000	0.00219	-1.360000	0.01215	TCA	CD72	-	pfam_C-type_lectin,superfamily_C-type_lectin_fold,smart_C-type_lectin,pfscan_C-type_lectin		0.413	CD72-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CD72	HGNC	protein_coding	OTTHUMT00000052336.1	G	NM_001782		35612927	-1	no_errors	ENST00000259633	ensembl	human	known	70_37	nonsense	SNP	0.000	C
CECR7	100130418	genome.wustl.edu	37	22	17525858	17525858	+	lincRNA	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr22:17525858G>A	ENST00000441006.1	+	0	871					NR_015352.1				cat eye syndrome chromosome region, candidate 7 (non-protein coding)																		TCTGGTTCCTGGGGAGGAGTC	0.557																																																	0																																												100130418			BC043198		22q11.2	2012-10-16	2009-08-21		ENSG00000237438	ENSG00000237438		"""Long non-coding RNAs"""	1845	non-coding RNA	RNA, long non-coding			"""cat eye syndrome chromosome region, candidate 7"""			11381032	Standard	NR_015352		Approved	SAHL1	uc002zlx.1		OTTHUMG00000150027		22.37:g.17525858G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000441006.1	37	NULL		22																																																																																			CECR7	-	-		0.557	CECR7-001	KNOWN	basic|exp_conf	lincRNA	CECR7	HGNC	lincRNA	OTTHUMT00000315626.1	G	NR_015352		17525858	+1	no_errors	ENST00000414401	ensembl	human	known	70_37	rna	SNP	0.891	A
CEP350	9857	genome.wustl.edu	37	1	180053269	180053269	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:180053269G>C	ENST00000367607.3	+	31	6659	c.6241G>C	c.(6241-6243)Gaa>Caa	p.E2081Q		NM_014810.4	NP_055625.4	Q5VT06	CE350_HUMAN	centrosomal protein 350kDa	2081					microtubule anchoring (GO:0034453)	centrosome (GO:0005813)|cytoplasm (GO:0005737)|membrane (GO:0016020)|nucleus (GO:0005634)				central_nervous_system(1)|endometrium(9)|kidney(4)|large_intestine(7)|lung(35)|ovary(4)|prostate(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	66						AAGGCAAAAGGAAAGACTGAA	0.423																																																	0													76.0	71.0	73.0					1																	180053269		2203	4300	6503	SO:0001583	missense	9857			AF287356	CCDS1336.1	1q25.2	2014-02-20			ENSG00000135837	ENSG00000135837			24238	protein-coding gene	gene with protein product	"""centrosome associated protein 350"""					16314388, 15615782	Standard	NM_014810		Approved	KIAA0480, CAP350	uc001gnt.3	Q5VT06	OTTHUMG00000035269	ENST00000367607.3:c.6241G>C	1.37:g.180053269G>C	ENSP00000356579:p.Glu2081Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	O75068|Q8TDK3|Q8WY20	Missense_Mutation	SNP	pfam_CAP-Gly_domain,superfamily_CAP-Gly_domain,pfscan_CAP-Gly_domain	p.E2081Q	ENST00000367607.3	37	c.6241	CCDS1336.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	25.6|25.6	4.651600|4.651600	0.88056|0.88056	.|.	.|.	ENSG00000135837|ENSG00000135837	ENST00000367607;ENST00000437245|ENST00000429851	T;T|.	0.61859|.	0.07;0.07|.	5.39|5.39	4.46|4.46	0.54185|0.54185	.|.	0.000000|.	0.46145|.	D|.	0.000312|.	T|T	0.70718|0.70718	0.3256|0.3256	M|M	0.64567|0.64567	1.98|1.98	0.48571|0.48571	D|D	0.999677|0.999677	D;D|.	0.89917|.	0.997;1.0|.	D;D|.	0.83275|.	0.986;0.996|.	T|T	0.70185|0.70185	-0.4941|-0.4941	9|5	.|.	.|.	.|.	.|.	15.3409|15.3409	0.74296|0.74296	0.0:0.0:0.8593:0.1407|0.0:0.0:0.8593:0.1407	.|.	2081;2081|.	E7EU22;Q5VT06|.	.;CE350_HUMAN|.	Q|A	2081;88|255	ENSP00000356579:E2081Q;ENSP00000409395:E88Q|.	.|.	E|G	+|+	1|2	0|0	CEP350|CEP350	178319892|178319892	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	9.434000|9.434000	0.97515|0.97515	1.225000|1.225000	0.43566|0.43566	0.555000|0.555000	0.69702|0.69702	GAA|GGA	CEP350	-	NULL		0.423	CEP350-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CEP350	HGNC	protein_coding	OTTHUMT00000085315.2	G	NM_014810		180053269	+1	no_errors	ENST00000367607	ensembl	human	known	70_37	missense	SNP	1.000	C
COL19A1	1310	genome.wustl.edu	37	6	70851786	70851786	+	Splice_Site	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:70851786G>C	ENST00000322773.4	+	21	1586	c.1484G>C	c.(1483-1485)gGa>gCa	p.G495A	COL19A1_ENST00000393344.1_Splice_Site_p.G117A	NM_001858.4	NP_001849.2	Q14993	COJA1_HUMAN	collagen, type XIX, alpha 1	495	Collagen-like 4.|Triple-helical region 3 (COL3).				cell adhesion (GO:0007155)|cell differentiation (GO:0030154)|collagen catabolic process (GO:0030574)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|single organismal cell-cell adhesion (GO:0016337)|skeletal muscle tissue development (GO:0007519)|skeletal system development (GO:0001501)	collagen trimer (GO:0005581)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|proteinaceous extracellular matrix (GO:0005578)	extracellular matrix structural constituent (GO:0005201)|protein binding, bridging (GO:0030674)	p.G495E(1)		breast(4)|central_nervous_system(3)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(5)|kidney(4)|large_intestine(8)|lung(54)|ovary(3)|prostate(2)|skin(10)|upper_aerodigestive_tract(4)|urinary_tract(2)	109						TATTTACAGGGAGAACCTGGG	0.308																																																	1	Substitution - Missense(1)	lung(1)											53.0	58.0	56.0					6																	70851786		2203	4300	6503	SO:0001630	splice_region_variant	1310				CCDS4970.1	6q12-q13	2013-01-16			ENSG00000082293	ENSG00000082293		"""Collagens"""	2196	protein-coding gene	gene with protein product		120165				7916703, 9143499	Standard	NM_001858		Approved		uc003pfc.1	Q14993	OTTHUMG00000014987	ENST00000322773.4:c.1483-1G>C	6.37:g.70851786G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q00559|Q05850|Q12885|Q13676|Q14DH1|Q5JUF0|Q5T424|Q9H572|Q9NPZ2|Q9NQP2	Missense_Mutation	SNP	pfam_Collagen,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G	p.G495A	ENST00000322773.4	37	c.1484	CCDS4970.1	6	.	.	.	.	.	.	.	.	.	.	G	14.83	2.653899	0.47362	.	.	ENSG00000082293	ENST00000322773;ENST00000393344	D;D	0.99329	-5.75;-5.75	5.37	5.37	0.77165	.	0.000000	0.64402	D	0.000001	D	0.99579	0.9848	H	0.96861	3.895	0.35725	D	0.81746	D	0.76494	0.999	D	0.71184	0.972	D	0.99410	1.0930	10	0.87932	D	0	.	12.0565	0.53538	0.0796:0.0:0.9204:0.0	.	495	Q14993	COJA1_HUMAN	A	495;117	ENSP00000316030:G495A;ENSP00000377013:G117A	ENSP00000316030:G495A	G	+	2	0	COL19A1	70908507	1.000000	0.71417	1.000000	0.80357	0.902000	0.53008	4.274000	0.58921	2.666000	0.90696	0.655000	0.94253	GGA	COL19A1	-	pfam_Collagen		0.308	COL19A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL19A1	HGNC	protein_coding	OTTHUMT00000041127.1	G		Missense_Mutation	70851786	+1	no_errors	ENST00000322773	ensembl	human	known	70_37	missense	SNP	1.000	C
COL5A3	50509	genome.wustl.edu	37	19	10107297	10107297	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:10107297C>G	ENST00000264828.3	-	12	1417	c.1332G>C	c.(1330-1332)atG>atC	p.M444I	CTD-2553C6.1_ENST00000592332.1_RNA	NM_015719.3	NP_056534.2	P25940	CO5A3_HUMAN	collagen, type V, alpha 3	444	Triple-helical region.				axon guidance (GO:0007411)|cell-matrix adhesion (GO:0007160)|collagen catabolic process (GO:0030574)|collagen fibril organization (GO:0030199)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|skin development (GO:0043588)	collagen type V trimer (GO:0005588)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)	collagen binding (GO:0005518)|extracellular matrix structural constituent (GO:0005201)|heparin binding (GO:0008201)			NS(2)|breast(3)|central_nervous_system(2)|endometrium(11)|kidney(23)|large_intestine(12)|liver(2)|lung(35)|ovary(8)|prostate(5)|skin(10)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	116			Epithelial(33;7.11e-05)			TTACCGGCATCATGATCACAG	0.627																																																	0													56.0	54.0	55.0					19																	10107297		2203	4300	6503	SO:0001583	missense	50509			AF177941	CCDS12222.1	19p13.2	2013-01-16			ENSG00000080573	ENSG00000080573		"""Collagens"""	14864	protein-coding gene	gene with protein product		120216				10722718	Standard	NM_015719		Approved		uc002mmq.1	P25940	OTTHUMG00000150019	ENST00000264828.3:c.1332G>C	19.37:g.10107297C>G	ENSP00000264828:p.Met444Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9NZQ6	Missense_Mutation	SNP	pfam_Collagen,pfam_Fib_collagen_C,superfamily_ConA-like_lec_gl_sf,smart_Laminin_G,smart_Fib_collagen_C	p.M444I	ENST00000264828.3	37	c.1332	CCDS12222.1	19	.	.	.	.	.	.	.	.	.	.	C	16.18	3.051079	0.55218	.	.	ENSG00000080573	ENST00000264828	D	0.89617	-2.54	5.12	4.02	0.46733	.	0.059938	0.64402	U	0.000004	D	0.84772	0.5546	M	0.64997	1.995	0.44780	D	0.997788	B	0.22276	0.067	B	0.18871	0.023	T	0.78924	-0.2012	10	0.18710	T	0.47	.	10.7782	0.46363	0.0:0.8082:0.1918:0.0	.	444	P25940	CO5A3_HUMAN	I	444	ENSP00000264828:M444I	ENSP00000264828:M444I	M	-	3	0	COL5A3	9968297	1.000000	0.71417	1.000000	0.80357	0.944000	0.59088	4.610000	0.61155	2.406000	0.81754	0.655000	0.94253	ATG	COL5A3	-	NULL		0.627	COL5A3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL5A3	HGNC	protein_coding	OTTHUMT00000315788.1	C	NM_015719		10107297	-1	no_errors	ENST00000264828	ensembl	human	known	70_37	missense	SNP	1.000	G
COL6A1	1291	genome.wustl.edu	37	21	47423450	47423450	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr21:47423450C>T	ENST00000361866.3	+	35	2724	c.2610C>T	c.(2608-2610)gaC>gaT	p.D870D	COL6A1_ENST00000498614.1_3'UTR	NM_001848.2	NP_001839.2	P12109	CO6A1_HUMAN	collagen, type VI, alpha 1	870	C-terminal globular domain.|VWFA 3. {ECO:0000255|PROSITE- ProRule:PRU00219}.				axon guidance (GO:0007411)|cell adhesion (GO:0007155)|cellular response to amino acid stimulus (GO:0071230)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)|osteoblast differentiation (GO:0001649)|protein heterotrimerization (GO:0070208)	collagen type VI trimer (GO:0005589)|endoplasmic reticulum lumen (GO:0005788)|extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular vesicular exosome (GO:0070062)|lysosomal membrane (GO:0005765)|membrane (GO:0016020)|protein complex (GO:0043234)|proteinaceous extracellular matrix (GO:0005578)|sarcolemma (GO:0042383)	platelet-derived growth factor binding (GO:0048407)			breast(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|lung(18)|ovary(1)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	33	all_hematologic(128;0.24)			Colorectal(79;0.0265)|READ - Rectum adenocarcinoma(84;0.0649)		CCGCCCACGACGTGCGGGTGG	0.711																																																	0													19.0	22.0	21.0					21																	47423450		2186	4272	6458	SO:0001819	synonymous_variant	1291			M20776	CCDS13727.1	21q22.3	2014-09-17			ENSG00000142156	ENSG00000142156		"""Collagens"""	2211	protein-coding gene	gene with protein product		120220					Standard	XM_006723964		Approved		uc002zhu.1	P12109	OTTHUMG00000090440	ENST00000361866.3:c.2610C>T	21.37:g.47423450C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O00117|O00118|Q14040|Q14041|Q16258|Q7Z645|Q9BSA8	Silent	SNP	pfam_VWF_A,pfam_Collagen,smart_VWF_A,pfscan_VWF_A	p.D870	ENST00000361866.3	37	c.2610	CCDS13727.1	21																																																																																			COL6A1	-	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A		0.711	COL6A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL6A1	HGNC	protein_coding	OTTHUMT00000206877.1	C	NM_001848		47423450	+1	no_errors	ENST00000361866	ensembl	human	known	70_37	silent	SNP	0.001	T
COL7A1	1294	genome.wustl.edu	37	3	48601912	48601912	+	Intron	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:48601912C>G	ENST00000328333.8	-	118	8926				COL7A1_ENST00000454817.1_Intron|COL7A1_ENST00000470076.1_5'UTR|UCN2_ENST00000273610.3_5'Flank	NM_000094.3	NP_000085.1	Q02388	CO7A1_HUMAN	collagen, type VII, alpha 1						cell adhesion (GO:0007155)|collagen catabolic process (GO:0030574)|endodermal cell differentiation (GO:0035987)|epidermis development (GO:0008544)|extracellular matrix disassembly (GO:0022617)|extracellular matrix organization (GO:0030198)	basement membrane (GO:0005604)|collagen type VII trimer (GO:0005590)|endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)	serine-type endopeptidase inhibitor activity (GO:0004867)			NS(3)|breast(8)|central_nervous_system(1)|endometrium(12)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(18)|lung(57)|ovary(7)|prostate(5)|skin(9)|stomach(1)|upper_aerodigestive_tract(4)|urinary_tract(5)	137				BRCA - Breast invasive adenocarcinoma(193;0.000293)|KIRC - Kidney renal clear cell carcinoma(197;0.00558)|Kidney(197;0.00632)		CGGAGACGCTCAGGCAGAGGC	0.587																																																	0													28.0	29.0	29.0					3																	48601912		692	1591	2283	SO:0001627	intron_variant	1294			L02870	CCDS2773.1	3p21.1	2014-09-17	2008-08-01		ENSG00000114270	ENSG00000114270		"""Collagens"", ""Fibronectin type III domain containing"""	2214	protein-coding gene	gene with protein product	"""collagen VII, alpha-1 polypeptide"", ""LC collagen"""	120120	"""epidermolysis bullosa, dystrophic, dominant and recessive"""	EBDCT, EBD1, EBR1		1871109	Standard	NM_000094		Approved		uc003ctz.2	Q02388	OTTHUMG00000133541	ENST00000328333.8:c.8819-57G>C	3.37:g.48601912C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q14054|Q16507	RNA	SNP	-	NULL	ENST00000328333.8	37	NULL	CCDS2773.1	3																																																																																			COL7A1	-	-		0.587	COL7A1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	COL7A1	HGNC	protein_coding	OTTHUMT00000257519.1	C	NM_000094		48601912	-1	no_errors	ENST00000470076	ensembl	human	known	70_37	rna	SNP	0.000	G
CORO1A	11151	genome.wustl.edu	37	16	30198163	30198163	+	Silent	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr16:30198163G>C	ENST00000219150.5	+	4	653	c.348G>C	c.(346-348)ctG>ctC	p.L116L	RP11-455F5.5_ENST00000568506.1_RNA|CORO1A_ENST00000565497.1_Silent_p.L116L|CORO1A_ENST00000570045.1_Silent_p.L116L|RP11-455F5.5_ENST00000567153.1_RNA|RP11-455F5.5_ENST00000566144.1_RNA	NM_001193333.2|NM_007074.3	NP_001180262.1|NP_009005.1	P31146	COR1A_HUMAN	coronin, actin binding protein, 1A	116					actin cytoskeleton organization (GO:0030036)|actin filament organization (GO:0007015)|calcium ion transport (GO:0006816)|cell-substrate adhesion (GO:0031589)|cellular component movement (GO:0006928)|cellular response to interleukin-4 (GO:0071353)|homeostasis of number of cells within a tissue (GO:0048873)|innate immune response (GO:0045087)|leukocyte chemotaxis (GO:0030595)|negative regulation of actin nucleation (GO:0051126)|phagocytosis (GO:0006909)|phagolysosome assembly (GO:0001845)|positive chemotaxis (GO:0050918)|positive regulation of cell migration (GO:0030335)|positive regulation of T cell proliferation (GO:0042102)|regulation of actin filament polymerization (GO:0030833)|regulation of cell shape (GO:0008360)|T cell homeostasis (GO:0043029)|uropod organization (GO:0032796)	actin filament (GO:0005884)|cell-cell junction (GO:0005911)|cortical actin cytoskeleton (GO:0030864)|cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|immunological synapse (GO:0001772)|lamellipodium (GO:0030027)|membrane (GO:0016020)|phagocytic cup (GO:0001891)|phagocytic vesicle (GO:0045335)|plasma membrane (GO:0005886)|protein complex (GO:0043234)	actin filament binding (GO:0051015)|cytoskeletal protein binding (GO:0008092)|phosphatidylinositol 3-kinase binding (GO:0043548)|poly(A) RNA binding (GO:0044822)|protein C-terminus binding (GO:0008022)|protein homodimerization activity (GO:0042803)			central_nervous_system(1)|kidney(2)|large_intestine(1)|lung(3)|ovary(1)|skin(1)	9						ATGGGGGCCTGATGCTGCCCC	0.647																																																	0													26.0	31.0	29.0					16																	30198163		2197	4299	6496	SO:0001819	synonymous_variant	11151			X89109	CCDS10673.1	16p11.2	2014-09-17	2001-11-28		ENSG00000102879	ENSG00000102879		"""Coronins"", ""WD repeat domain containing"""	2252	protein-coding gene	gene with protein product	"""Clabp TACO"""	605000	"""coronin, actin-binding protein, 1A"""			9778037	Standard	NM_007074		Approved	HCORO1, p57, coronin-1	uc002dww.3	P31146	OTTHUMG00000132148	ENST00000219150.5:c.348G>C	16.37:g.30198163G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RBL1|Q2YD73	Silent	SNP	pfam_DUF1900,pfam_DUF1899,pfam_WD40_repeat,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L116	ENST00000219150.5	37	c.348	CCDS10673.1	16																																																																																			CORO1A	-	pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.647	CORO1A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CORO1A	HGNC	protein_coding	OTTHUMT00000255195.2	G	NM_007074		30198163	+1	no_errors	ENST00000219150	ensembl	human	known	70_37	silent	SNP	0.598	C
CROCCP2	84809	genome.wustl.edu	37	1	16959769	16959769	+	lincRNA	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:16959769C>G	ENST00000412962.1	-	0	74							Q86T23	CROL1_HUMAN	ciliary rootlet coiled-coil, rootletin pseudogene 2						centrosome organization (GO:0051297)	ciliary rootlet (GO:0035253)											ACCCGGCTCTCTGCCAGCCGC	0.667																																																	0																																												84809			AK090414		1p36.13	2010-07-08	2010-07-08	2010-07-08	ENSG00000215908	ENSG00000215908			28170	pseudogene	pseudogene			"""ciliary rootlet coiled-coil, rootletin-like 1"""	CROCCL1		12477932	Standard	NR_026752		Approved	MGC12760	uc001azf.3	Q86T23	OTTHUMG00000037884		1.37:g.16959769C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q8NF65|Q96FR5|Q9BRE8	RNA	SNP	-	NULL	ENST00000412962.1	37	NULL		1																																																																																			CROCCP2	-	-		0.667	CROCCP2-003	KNOWN	basic	lincRNA	CROCCP2	HGNC	lincRNA	OTTHUMT00000092784.1	C	NR_026752.1		16959769	-1	no_errors	ENST00000362058	ensembl	human	known	70_37	rna	SNP	0.992	G
CRY1	1407	genome.wustl.edu	37	12	107391306	107391306	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:107391306C>T	ENST00000008527.5	-	9	2319	c.1452G>A	c.(1450-1452)atG>atA	p.M484I		NM_004075.4	NP_004066.1	Q16526	CRY1_HUMAN	cryptochrome circadian clock 1	484	Interaction with TIMELESS. {ECO:0000250}.				blue light signaling pathway (GO:0009785)|circadian regulation of gene expression (GO:0032922)|DNA damage induced protein phosphorylation (GO:0006975)|DNA repair (GO:0006281)|entrainment of circadian clock by photoperiod (GO:0043153)|gluconeogenesis (GO:0006094)|glucose homeostasis (GO:0042593)|lipid storage (GO:0019915)|negative regulation of circadian rhythm (GO:0042754)|negative regulation of G-protein coupled receptor protein signaling pathway (GO:0045744)|negative regulation of glucocorticoid receptor signaling pathway (GO:2000323)|negative regulation of glucocorticoid secretion (GO:2000850)|negative regulation of protein ubiquitination (GO:0031397)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|protein-chromophore linkage (GO:0018298)|regulation of circadian rhythm (GO:0042752)|regulation of DNA damage checkpoint (GO:2000001)|response to glucagon (GO:0033762)|response to insulin (GO:0032868)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|mitochondrion (GO:0005739)|nucleolus (GO:0005730)|nucleus (GO:0005634)	blue light photoreceptor activity (GO:0009882)|core promoter binding (GO:0001047)|DNA binding (GO:0003677)|DNA photolyase activity (GO:0003913)|double-stranded DNA binding (GO:0003690)|nuclear hormone receptor binding (GO:0035257)|nucleotide binding (GO:0000166)|phosphatase binding (GO:0019902)|transcription factor binding transcription factor activity (GO:0000989)|ubiquitin binding (GO:0043130)			NS(2)|breast(2)|central_nervous_system(1)|cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(3)|skin(1)	29						AGATCTGTTTCATCCTTTCGA	0.373																																																	0													122.0	115.0	117.0					12																	107391306		2203	4300	6503	SO:0001583	missense	1407			BC030519	CCDS9112.1	12q23-q24.1	2014-01-17	2014-01-17		ENSG00000008405	ENSG00000008405			2384	protein-coding gene	gene with protein product		601933	"""cryptochrome 1 (photolyase-like)"""	PHLL1		8921389	Standard	NM_004075		Approved		uc001tmi.4	Q16526	OTTHUMG00000170005	ENST00000008527.5:c.1452G>A	12.37:g.107391306C>T	ENSP00000008527:p.Met484Ile	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Photolyase_FAD-bd/Cryptochr_C,pfam_DNA_photolyase_N,superfamily_Photolyase_FAD-bd/Cryptochr_C,superfamily_DNA_photolyase_N	p.M484I	ENST00000008527.5	37	c.1452	CCDS9112.1	12	.	.	.	.	.	.	.	.	.	.	C	23.5	4.425784	0.83667	.	.	ENSG00000008405	ENST00000008527;ENST00000319645;ENST00000549356	.	.	.	5.79	5.79	0.91817	DNA photolyase, FAD-binding/Cryptochrome, C-terminal (2);	0.000000	0.85682	D	0.000000	T	0.72463	0.3463	L	0.54323	1.7	0.80722	D	1	B	0.31009	0.303	B	0.42188	0.379	T	0.69472	-0.5136	9	0.46703	T	0.11	-19.1981	20.0371	0.97565	0.0:1.0:0.0:0.0	.	484	Q16526	CRY1_HUMAN	I	484;91;4	.	ENSP00000008527:M484I	M	-	3	0	CRY1	105915436	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.734000	0.93682	0.655000	0.94253	ATG	CRY1	-	pfam_Photolyase_FAD-bd/Cryptochr_C,superfamily_Photolyase_FAD-bd/Cryptochr_C		0.373	CRY1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	CRY1	HGNC	protein_coding	OTTHUMT00000406827.1	C	NM_004075		107391306	-1	no_errors	ENST00000008527	ensembl	human	known	70_37	missense	SNP	1.000	T
CXorf67	340602	genome.wustl.edu	37	X	51151294	51151294	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:51151294G>A	ENST00000342995.2	+	1	1528	c.1426G>A	c.(1426-1428)Gag>Aag	p.E476K				Q86X51	CX067_HUMAN	chromosome X open reading frame 67	476										breast(1)|endometrium(4)|large_intestine(1)|lung(11)|ovary(3)|prostate(1)	21						TTTGATGCCTGAGTTTTATGC	0.547																																																	0													60.0	50.0	53.0					X																	51151294		2203	4299	6502	SO:0001583	missense	340602			BC046248		Xp11.22	2014-04-30			ENSG00000187690	ENSG00000187690			33738	protein-coding gene	gene with protein product						23959973	Standard	XR_113306		Approved			Q86X51	OTTHUMG00000187481	ENST00000342995.2:c.1426G>A	X.37:g.51151294G>A	ENSP00000342680:p.Glu476Lys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.E476K	ENST00000342995.2	37	c.1426		X	.	.	.	.	.	.	.	.	.	.	G	15.51	2.855145	0.51376	.	.	ENSG00000187690	ENST00000342995	T	0.54866	0.55	3.7	2.83	0.33086	.	0.490245	0.15232	N	0.273342	T	0.51261	0.1664	.	.	.	0.09310	N	1	D	0.54207	0.965	P	0.50049	0.629	T	0.44528	-0.9322	9	0.66056	D	0.02	-11.2272	4.4965	0.11839	0.1274:0.2283:0.6443:0.0	.	476	Q86X51	CX067_HUMAN	K	476	ENSP00000342680:E476K	ENSP00000342680:E476K	E	+	1	0	CXorf67	51168034	0.059000	0.20769	0.003000	0.11579	0.023000	0.10783	0.939000	0.28978	0.927000	0.37143	0.544000	0.68410	GAG	CXorf67	-	NULL		0.547	CXorf67-201	KNOWN	basic|appris_principal	protein_coding	CXorf67	HGNC	protein_coding		G	NM_203407		51151294	+1	no_errors	ENST00000342995	ensembl	human	known	70_37	missense	SNP	0.002	A
DCAF12L1	139170	genome.wustl.edu	37	X	125685980	125685980	+	Missense_Mutation	SNP	A	A	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:125685980A>T	ENST00000371126.1	-	1	854	c.612T>A	c.(610-612)agT>agA	p.S204R		NM_178470.4	NP_848565.2	Q5VU92	DC121_HUMAN	DDB1 and CUL4 associated factor 12-like 1	204										breast(1)|central_nervous_system(3)|cervix(1)|endometrium(4)|kidney(3)|large_intestine(6)|lung(39)|ovary(2)|prostate(1)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(2)	68						CTACGGTGTCACTCAGCCAGG	0.662																																																	0													34.0	36.0	36.0					X																	125685980		2203	4297	6500	SO:0001583	missense	139170			BC035674	CCDS14610.1	Xq25	2013-01-09	2009-07-17	2009-07-17	ENSG00000198889	ENSG00000198889		"""WD repeat domain containing"""	29395	protein-coding gene	gene with protein product			"""WD repeat domain 40B"""	WDR40B		12477932	Standard	NM_178470		Approved	KIAA1892L	uc004eul.3	Q5VU92	OTTHUMG00000022353	ENST00000371126.1:c.612T>A	X.37:g.125685980A>T	ENSP00000360167:p.Ser204Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8IYK3	Missense_Mutation	SNP	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.S204R	ENST00000371126.1	37	c.612	CCDS14610.1	X	.	.	.	.	.	.	.	.	.	.	A	18.09	3.546308	0.65198	.	.	ENSG00000198889	ENST00000371126	T	0.60548	0.18	3.89	-0.883	0.10600	WD40/YVTN repeat-like-containing domain (1);WD40 repeat-like-containing domain (1);WD40-repeat-containing domain (1);	0.000000	0.38837	N	0.001554	T	0.63224	0.2493	M	0.66939	2.045	0.30867	N	0.732912	D	0.63880	0.993	D	0.63877	0.919	T	0.61367	-0.7077	10	0.48119	T	0.1	.	4.6801	0.12731	0.6001:0.1718:0.228:0.0	.	204	Q5VU92	DC121_HUMAN	R	204	ENSP00000360167:S204R	ENSP00000360167:S204R	S	-	3	2	DCAF12L1	125513661	0.998000	0.40836	0.449000	0.26957	0.952000	0.60782	0.607000	0.24209	-0.280000	0.09154	0.350000	0.21858	AGT	DCAF12L1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.662	DCAF12L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DCAF12L1	HGNC	protein_coding	OTTHUMT00000058186.1	A	NM_178470		125685980	-1	no_errors	ENST00000371126	ensembl	human	known	70_37	missense	SNP	0.998	T
DDX23	9416	genome.wustl.edu	37	12	49229908	49229908	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:49229908C>T	ENST00000308025.3	-	11	1457	c.1378G>A	c.(1378-1380)Gac>Aac	p.D460N	DDX23_ENST00000553182.1_5'Flank	NM_004818.2	NP_004809.2	Q9BUQ8	DDX23_HUMAN	DEAD (Asp-Glu-Ala-Asp) box polypeptide 23	460	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				ATP catabolic process (GO:0006200)|cis assembly of pre-catalytic spliceosome (GO:0000354)|gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)|RNA splicing, via transesterification reactions (GO:0000375)	catalytic step 2 spliceosome (GO:0071013)|extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|U5 snRNP (GO:0005682)	ATP binding (GO:0005524)|ATP-dependent RNA helicase activity (GO:0004004)|poly(A) RNA binding (GO:0044822)			NS(1)|cervix(1)|kidney(4)|large_intestine(6)|lung(17)|ovary(1)|prostate(1)|skin(2)|urinary_tract(3)	36						CCTCACCTGTCAATTTTGGGA	0.478																																																	0													195.0	183.0	187.0					12																	49229908		2203	4300	6503	SO:0001583	missense	9416			AF026402	CCDS8770.1	12q13.11	2013-07-16				ENSG00000174243		"""DEAD-boxes"""	17347	protein-coding gene	gene with protein product		612172	"""PRP28 homolog, yeast"""			9409622, 9539711	Standard	NM_004818		Approved	prp28, U5-100K, PRPF28, SNRNP100	uc001rsm.3	Q9BUQ8		ENST00000308025.3:c.1378G>A	12.37:g.49229908C>T	ENSP00000310723:p.Asp460Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	B2R600|B4DH15|O43188	Missense_Mutation	SNP	pfam_DNA/RNA_helicase_DEAD/DEAH_N,pfam_Helicase_C,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C,pfscan_RNA_helicase_DEAD_Q_motif	p.D460N	ENST00000308025.3	37	c.1378	CCDS8770.1	12	.	.	.	.	.	.	.	.	.	.	C	18.71	3.681970	0.68042	.	.	ENSG00000174243	ENST00000308025	T	0.14766	2.48	5.49	5.49	0.81192	DEAD-like helicase (2);DNA/RNA helicase, DEAD/DEAH box type, N-terminal (1);	0.000000	0.85682	D	0.000000	T	0.10937	0.0267	N	0.11789	0.175	0.80722	D	1	P	0.44006	0.824	B	0.43301	0.415	T	0.29640	-1.0005	10	0.22706	T	0.39	.	18.1267	0.89587	0.0:1.0:0.0:0.0	.	460	Q9BUQ8	DDX23_HUMAN	N	460	ENSP00000310723:D460N	ENSP00000310723:D460N	D	-	1	0	DDX23	47516175	1.000000	0.71417	1.000000	0.80357	0.945000	0.59286	7.601000	0.82783	2.571000	0.86741	0.561000	0.74099	GAC	DDX23	-	pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.478	DDX23-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DDX23	HGNC	protein_coding	OTTHUMT00000408897.2	C	NM_004818		49229908	-1	no_errors	ENST00000308025	ensembl	human	known	70_37	missense	SNP	1.000	T
DHTKD1	55526	genome.wustl.edu	37	10	12160859	12160859	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:12160859C>T	ENST00000263035.4	+	15	2576	c.2514C>T	c.(2512-2514)ctC>ctT	p.L838L	U6_ENST00000606801.1_RNA	NM_018706.5	NP_061176	Q96HY7	DHTK1_HUMAN	dehydrogenase E1 and transketolase domain containing 1	838					cell death (GO:0008219)|generation of precursor metabolites and energy (GO:0006091)|glycolytic process (GO:0006096)|hematopoietic progenitor cell differentiation (GO:0002244)|tricarboxylic acid cycle (GO:0006099)	mitochondrion (GO:0005739)	oxoglutarate dehydrogenase (succinyl-transferring) activity (GO:0004591)|thiamine pyrophosphate binding (GO:0030976)			breast(1)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(11)|liver(2)|lung(14)|ovary(1)|pancreas(1)|prostate(2)|skin(1)|soft_tissue(1)|stomach(3)|upper_aerodigestive_tract(1)	44		Renal(717;0.228)	BRCA - Breast invasive adenocarcinoma(52;0.188)			TAGAGGAACTCTGCCCCTTCC	0.453																																																	0													150.0	148.0	149.0					10																	12160859		2203	4300	6503	SO:0001819	synonymous_variant	55526			BC002477	CCDS7087.1	10p14	2003-11-24			ENSG00000181192	ENSG00000181192			23537	protein-coding gene	gene with protein product		614984				10997877	Standard	NM_018706		Approved	KIAA1630, MGC3090, DKFZP762M115	uc001ild.5	Q96HY7	OTTHUMG00000017677	ENST00000263035.4:c.2514C>T	10.37:g.12160859C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q68CU5|Q9BUM8|Q9HCE2	Silent	SNP	pfam_Transketolase-like_Pyr-bd,pfam_DH_E1,smart_Transketolase-like_Pyr-bd,pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1	p.L838	ENST00000263035.4	37	c.2514	CCDS7087.1	10																																																																																			DHTKD1	-	pirsf_2oxoglutarate_DH_E1,tigrfam_2oxoglutarate_DH_E1		0.453	DHTKD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	DHTKD1	HGNC	protein_coding	OTTHUMT00000046777.1	C	NM_018706		12160859	+1	no_errors	ENST00000263035	ensembl	human	known	70_37	silent	SNP	1.000	T
DLC1	10395	genome.wustl.edu	37	8	12950310	12950310	+	Missense_Mutation	SNP	T	T	C	rs146051142	byFrequency	TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:12950310T>C	ENST00000276297.4	-	13	3960	c.3551A>G	c.(3550-3552)cAg>cGg	p.Q1184R	DLC1_ENST00000510318.1_5'UTR|DLC1_ENST00000512044.2_Missense_Mutation_p.Q781R|DLC1_ENST00000520226.1_Missense_Mutation_p.Q673R|DLC1_ENST00000358919.2_Missense_Mutation_p.Q747R	NM_182643.2	NP_872584.2	Q96QB1	RHG07_HUMAN	DLC1 Rho GTPase activating protein	1184	Rho-GAP. {ECO:0000255|PROSITE- ProRule:PRU00172}.				actin cytoskeleton organization (GO:0030036)|activation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0006919)|apoptotic process (GO:0006915)|focal adhesion assembly (GO:0048041)|forebrain development (GO:0030900)|heart morphogenesis (GO:0003007)|hindbrain morphogenesis (GO:0021575)|negative regulation of cell migration (GO:0030336)|negative regulation of cell proliferation (GO:0008285)|negative regulation of Rho protein signal transduction (GO:0035024)|negative regulation of stress fiber assembly (GO:0051497)|neural tube closure (GO:0001843)|positive regulation of execution phase of apoptosis (GO:1900119)|positive regulation of protein dephosphorylation (GO:0035307)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of actin cytoskeleton organization (GO:0032956)|regulation of cell shape (GO:0008360)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)	caveola (GO:0005901)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|nucleus (GO:0005634)	lipid binding (GO:0008289)|Rho GTPase activator activity (GO:0005100)|SH2 domain binding (GO:0042169)			NS(2)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(5)|large_intestine(39)|lung(32)|ovary(4)|pancreas(2)|prostate(4)|skin(2)|stomach(2)|upper_aerodigestive_tract(5)|urinary_tract(1)	110						CTTGATGGCCTGCAGGCGCTG	0.532																																																	0													48.0	42.0	44.0					8																	12950310		2203	4300	6503	SO:0001583	missense	10395			AF035119	CCDS5989.1, CCDS5990.1, CCDS5991.1, CCDS5991.2, CCDS55201.1	8p22	2014-06-20	2014-06-20		ENSG00000164741	ENSG00000164741		"""Rho GTPase activating proteins"", ""StAR-related lipid transfer (START) domain containing"""	2897	protein-coding gene	gene with protein product	"""StAR-related lipid transfer (START) domain containing 12"""	604258	"""deleted in liver cancer 1"""			9605766, 11214970	Standard	NM_182643		Approved	HP, ARHGAP7, STARD12, DLC-1, p122-RhoGAP	uc003wwm.2	Q96QB1	OTTHUMG00000090825	ENST00000276297.4:c.3551A>G	8.37:g.12950310T>C	ENSP00000276297:p.Gln1184Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR10|B8PTI0|E9PDZ8|E9PF76|E9PGY9|O14868|O43199|Q7Z5R8|Q86UC6|Q9C0E0|Q9H7A2	Missense_Mutation	SNP	pfam_START_lipid-bd,pfam_RhoGAP_dom,pfam_SAM_2,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,smart_START_lipid-bd,pfscan_START_lipid-bd,pfscan_RhoGAP_dom	p.Q1184R	ENST00000276297.4	37	c.3551	CCDS5989.1	8	.	.	.	.	.	.	.	.	.	.	T	19.70	3.876006	0.72180	.	.	ENSG00000164741	ENST00000276297;ENST00000358919;ENST00000510318;ENST00000512044;ENST00000520226	T;T;T;T	0.18016	2.24;2.24;2.24;2.24	5.08	1.27	0.21489	Rho GTPase-activating protein domain (4);Rho GTPase activation protein (1);	0.170560	0.53938	D	0.000060	T	0.24353	0.0590	L	0.31752	0.955	0.80722	D	1	B;D;B	0.76494	0.047;0.999;0.378	B;D;P	0.87578	0.08;0.998;0.529	T	0.01053	-1.1467	10	0.54805	T	0.06	.	7.9886	0.30226	0.0:0.0671:0.2566:0.6763	.	1184;781;747	Q96QB1;E9PDZ8;Q96QB1-1	RHG07_HUMAN;.;.	R	1184;747;123;781;673	ENSP00000276297:Q1184R;ENSP00000351797:Q747R;ENSP00000422595:Q781R;ENSP00000428028:Q673R	ENSP00000276297:Q1184R	Q	-	2	0	DLC1	12994681	1.000000	0.71417	0.998000	0.56505	0.998000	0.95712	4.986000	0.63851	0.135000	0.18707	0.533000	0.62120	CAG	DLC1	-	pfam_RhoGAP_dom,superfamily_Rho_GTPase_activation_prot,smart_RhoGAP_dom,pfscan_RhoGAP_dom		0.532	DLC1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	DLC1	HGNC	protein_coding	OTTHUMT00000207632.2	T	NM_182643, NM_006094		12950310	-1	no_errors	ENST00000276297	ensembl	human	known	70_37	missense	SNP	1.000	C
DMKN	93099	genome.wustl.edu	37	19	36004044	36004044	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:36004044C>G	ENST00000339686.3	-	1	510	c.334G>C	c.(334-336)Gag>Cag	p.E112Q	DMKN_ENST00000602781.1_5'Flank|DMKN_ENST00000458071.1_5'Flank|DMKN_ENST00000392206.2_5'Flank|DMKN_ENST00000462126.1_5'Flank|DMKN_ENST00000461300.1_5'Flank|DMKN_ENST00000414866.2_5'Flank|DMKN_ENST00000429837.1_Missense_Mutation_p.E112Q|DMKN_ENST00000418261.1_Missense_Mutation_p.E112Q|DMKN_ENST00000436012.1_5'Flank|DMKN_ENST00000447113.2_Missense_Mutation_p.E112Q|DMKN_ENST00000472252.2_5'Flank|DMKN_ENST00000443640.1_5'Flank|DMKN_ENST00000480502.1_5'Flank|DMKN_ENST00000492341.2_5'Flank|DMKN_ENST00000402589.2_5'Flank|DMKN_ENST00000451297.2_Missense_Mutation_p.E112Q|DMKN_ENST00000419602.1_Missense_Mutation_p.E112Q|DMKN_ENST00000424570.2_Missense_Mutation_p.E112Q|DMKN_ENST00000488892.1_5'Flank|DMKN_ENST00000440396.1_Missense_Mutation_p.E112Q|DMKN_ENST00000474928.1_5'Flank|DMKN_ENST00000467637.1_5'Flank	NM_033317.4	NP_201574	Q6E0U4	DMKN_HUMAN	dermokine	112	Gly-rich.					extracellular space (GO:0005615)|extracellular vesicular exosome (GO:0070062)				NS(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|ovary(1)|prostate(1)|skin(2)	27	all_lung(56;1.89e-08)|Lung NSC(56;2.9e-08)|Esophageal squamous(110;0.162)		LUSC - Lung squamous cell carcinoma(66;0.0724)			CTGCCAATCTCGTGCCCAGTG	0.607																																																	0													129.0	110.0	116.0					19																	36004044		2203	4300	6503	SO:0001583	missense	93099			BC035311	CCDS12463.1, CCDS42549.1, CCDS46051.1, CCDS46052.1, CCDS46053.1, CCDS46054.1, CCDS46054.2, CCDS54250.1, CCDS54251.1, CCDS54252.1	19q13.12	2008-10-27			ENSG00000161249	ENSG00000161249			25063	protein-coding gene	gene with protein product						16374476	Standard	NM_001035516		Approved	ZD52F10	uc002nzm.4	Q6E0U4	OTTHUMG00000048101	ENST00000339686.3:c.334G>C	19.37:g.36004044C>G	ENSP00000342012:p.Glu112Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A3EZ79|A3EZ80|A3EZ81|A3EZ82|A3EZ83|C9J4P6|C9J5N8|C9JAL3|Q32W58|Q32W62|Q32W63|Q32W64|Q32W65|Q32W66|Q32W67|Q6E0U5|Q6UXC7|Q96EW8|Q9BSY6	Missense_Mutation	SNP	NULL	p.E112Q	ENST00000339686.3	37	c.334	CCDS12463.1	19	.	.	.	.	.	.	.	.	.	.	C	16.58	3.162536	0.57368	.	.	ENSG00000161249	ENST00000339686;ENST00000392207;ENST00000429837;ENST00000419602;ENST00000447113;ENST00000440396;ENST00000418261;ENST00000424570;ENST00000451297	T;T;T;T;T;T;T;T	0.37058	1.85;1.67;2.04;1.22;1.73;1.3;1.3;1.35	4.21	3.08	0.35506	.	0.000000	0.37178	N	0.002203	T	0.50497	0.1619	L	0.55481	1.735	0.23082	N	0.998327	D;D;D;D;D;D;D	0.67145	0.976;0.996;0.996;0.976;0.976;0.976;0.976	D;D;D;D;P;P;P	0.77004	0.926;0.989;0.989;0.926;0.849;0.849;0.893	T	0.24154	-1.0168	10	0.87932	D	0	-41.3755	10.0718	0.42337	0.0:0.6778:0.3222:0.0	.	112;112;112;112;112;112;112	E7EUS0;Q6E0U4-7;Q6E0U4-3;Q6E0U4-5;C9J4P6;Q6E0U4-4;Q6E0U4	.;.;.;.;.;.;DMKN_HUMAN	Q	112	ENSP00000342012:E112Q;ENSP00000405503:E112Q;ENSP00000391036:E112Q;ENSP00000394908:E112Q;ENSP00000415277:E112Q;ENSP00000414743:E112Q;ENSP00000388404:E112Q;ENSP00000409513:E112Q	ENSP00000342012:E112Q	E	-	1	0	DMKN	40695884	0.449000	0.25689	0.549000	0.28204	0.001000	0.01503	1.984000	0.40658	2.345000	0.79718	0.491000	0.48974	GAG	DMKN	-	NULL		0.607	DMKN-001	KNOWN	basic|CCDS	protein_coding	DMKN	HGNC	protein_coding	OTTHUMT00000109461.2	C	NM_033317		36004044	-1	no_errors	ENST00000339686	ensembl	human	known	70_37	missense	SNP	0.709	G
DNAH12	201625	genome.wustl.edu	37	3	57494205	57494205	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:57494205G>A	ENST00000351747.2	-	7	785	c.605C>T	c.(604-606)tCt>tTt	p.S202F	DNAH12_ENST00000311202.6_Missense_Mutation_p.S202F|DNAH12_ENST00000389536.4_Missense_Mutation_p.S202F	NM_178504.4	NP_848599.3	Q6ZR08	DYH12_HUMAN	dynein, axonemal, heavy chain 12	202	Stem. {ECO:0000250}.				microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)|microtubule motor activity (GO:0003777)	p.S202C(2)		breast(3)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(4)|lung(7)|pancreas(1)|prostate(1)|skin(1)	25						GTGCAAATTAGAGAATATTTG	0.343																																																	2	Substitution - Missense(2)	lung(2)											55.0	57.0	56.0					3																	57494205		2203	4298	6501	SO:0001583	missense	201625			U53532, AK126276	CCDS33771.1	3p21.1	2009-02-04	2006-09-04		ENSG00000174844	ENSG00000174844		"""Axonemal dyneins"""	2943	protein-coding gene	gene with protein product		603340	"""dynein, axonemal, heavy polypeptide 12"", ""dynein heavy chain domain 2"", ""dynein heavy domain 2"", ""dynein, axonemal, heavy chain 12-like"", ""dynein, axonemal, heavy chain 7-like"""	DNHD2, DNAH12L, DNAH7L		8812413, 8666668	Standard	NM_198564		Approved	DLP12, Dnahc3, HL-19, hdhc3, DHC3, FLJ40427, FLJ44290	uc003dit.2	Q6ZR08	OTTHUMG00000158598	ENST00000351747.2:c.605C>T	3.37:g.57494205G>A	ENSP00000295937:p.Ser202Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGI2|Q6ZTR8|Q8N7R9|Q8WXK2|Q92816	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,pfam_ATPase_dyneun-rel_AAA,smart_AAA+_ATPase	p.S202F	ENST00000351747.2	37	c.605		3	.	.	.	.	.	.	.	.	.	.	G	11.67	1.708972	0.30322	.	.	ENSG00000174844	ENST00000351747;ENST00000495027;ENST00000389536;ENST00000311202	T;T;T;T	0.24151	2.02;1.87;3.49;2.96	4.94	2.82	0.32997	.	2.199570	0.02175	N	0.060068	T	0.36744	0.0978	L	0.38175	1.15	0.09310	N	1	D;B	0.54397	0.966;0.412	P;B	0.50860	0.652;0.133	T	0.49790	-0.8902	10	0.66056	D	0.02	.	14.0706	0.64856	0.0:0.0:0.5961:0.4039	.	202;202	Q6ZR08-4;Q6ZR08	.;DYH12_HUMAN	F	202	ENSP00000295937:S202F;ENSP00000418137:S202F;ENSP00000374187:S202F;ENSP00000312554:S202F	ENSP00000312554:S202F	S	-	2	0	DNAH12	57469245	0.754000	0.28360	0.847000	0.33407	0.877000	0.50540	1.982000	0.40638	1.016000	0.39470	0.460000	0.39030	TCT	DNAH12	-	NULL		0.343	DNAH12-202	KNOWN	basic|appris_principal	protein_coding	DNAH12	HGNC	protein_coding		G	NM_178504		57494205	-1	no_errors	ENST00000351747	ensembl	human	known	70_37	missense	SNP	0.001	A
DNAH14	127602	genome.wustl.edu	37	1	225268252	225268252	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:225268252G>A	ENST00000445597.2	+	15	2740	c.2740G>A	c.(2740-2742)Gaa>Aaa	p.E914K	DNAH14_ENST00000430092.1_Missense_Mutation_p.E980K|DNAH14_ENST00000439375.2_Missense_Mutation_p.E980K			Q0VDD8	DYH14_HUMAN	dynein, axonemal, heavy chain 14	914					microtubule-based movement (GO:0007018)	cilium (GO:0005929)|cytoplasm (GO:0005737)|dynein complex (GO:0030286)|microtubule (GO:0005874)	ATP binding (GO:0005524)|microtubule motor activity (GO:0003777)			NS(2)|breast(3)|central_nervous_system(3)|endometrium(8)|kidney(4)|large_intestine(2)|lung(2)|skin(2)|stomach(1)	27						TAATGTGGAAGAAATTACACA	0.393																																																	0													176.0	150.0	158.0					1																	225268252		692	1591	2283	SO:0001583	missense	127602			U61741	CCDS41472.1, CCDS44322.1	1q42.13	2009-02-12	2006-09-04		ENSG00000185842	ENSG00000185842		"""Axonemal dyneins"""	2945	protein-coding gene	gene with protein product		603341	"""dynein, axonemal, heavy polypeptide 14"", ""chromosome 1 open reading frame 67"""	C1orf67		8812413	Standard	NM_144989		Approved	Dnahc14, HL-18, HL18, DKFZp781B1548, MGC27277	uc001how.2	Q0VDD8	OTTHUMG00000037447	ENST00000445597.2:c.2740G>A	1.37:g.225268252G>A	ENSP00000409472:p.Glu914Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NG62|A6NNL2|Q0VDD9|Q4VXC7|Q4VXG4|Q4VXG5|Q5VU33|Q5VU34	Missense_Mutation	SNP	pfam_Dynein_heavy_dom,pfam_Dynein_heavy_dom-2,superfamily_Tautomerase,smart_AAA+_ATPase	p.E980K	ENST00000445597.2	37	c.2938		1	.	.	.	.	.	.	.	.	.	.	G	13.51	2.258100	0.39896	.	.	ENSG00000185842	ENST00000445597;ENST00000430092;ENST00000439375;ENST00000328556	T;T;T;T	0.30981	2.46;1.51;1.51;1.72	5.14	4.17	0.49024	.	.	.	.	.	T	0.23846	0.0577	N	0.14661	0.345	0.47374	D	0.999401	P	0.46064	0.872	P	0.45856	0.495	T	0.03524	-1.1028	9	0.42905	T	0.14	.	14.091	0.64990	0.0:0.152:0.848:0.0	.	980	Q0VDD8-4	.	K	914;980;980;58	ENSP00000409472:E914K;ENSP00000414402:E980K;ENSP00000392061:E980K;ENSP00000332424:E58K	ENSP00000332424:E58K	E	+	1	0	DNAH14	223334875	0.963000	0.33076	0.603000	0.28903	0.653000	0.38743	2.998000	0.49465	2.544000	0.85801	0.508000	0.49915	GAA	DNAH14	-	NULL		0.393	DNAH14-007	PUTATIVE	basic|exp_conf	protein_coding	DNAH14	HGNC	protein_coding	OTTHUMT00000331217.3	G	XM_059166		225268252	+1	no_errors	ENST00000430092	ensembl	human	known	70_37	missense	SNP	0.462	A
DNAJC14	85406	genome.wustl.edu	37	12	56215782	56215782	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:56215782C>T	ENST00000357606.3	-	8	2377	c.2088G>A	c.(2086-2088)gtG>gtA	p.V696V	DNAJC14_ENST00000317269.3_Silent_p.V696V|DNAJC14_ENST00000317287.5_Silent_p.V696V|RP11-762I7.5_ENST00000552719.1_Intron|RP11-762I7.5_ENST00000546837.1_Intron			Q6Y2X3	DJC14_HUMAN	DnaJ (Hsp40) homolog, subfamily C, member 14	696					protein transport (GO:0015031)	endoplasmic reticulum (GO:0005783)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(2)|kidney(1)|large_intestine(8)|lung(7)|ovary(3)|prostate(1)|skin(1)	23						AGGGCCTCCTCACTTTCTTCC	0.542																																																	0													153.0	142.0	146.0					12																	56215782		2203	4300	6503	SO:0001819	synonymous_variant	85406			AF141342	CCDS8894.1	12q12	2011-09-02				ENSG00000135392		"""Heat shock proteins / DNAJ (HSP40)"""	24581	protein-coding gene	gene with protein product		606092				11331877, 11984006	Standard	NM_032364		Approved	DNAJ, DRIP78, HDJ3, LIP6, FLJ32792	uc001shu.2	Q6Y2X3		ENST00000357606.3:c.2088G>A	12.37:g.56215782C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A5YM67|Q17RY2|Q66K17|Q96N59|Q96T63	Silent	SNP	pfam_DnaJ_N,superfamily_DnaJ_N,smart_DnaJ_N,pfscan_DnaJ_N,prints_Hsp_DnaJ	p.V696	ENST00000357606.3	37	c.2088	CCDS8894.1	12																																																																																			DNAJC14	-	NULL		0.542	DNAJC14-002	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	DNAJC14	HGNC	protein_coding	OTTHUMT00000409095.1	C	NM_032364		56215782	-1	no_errors	ENST00000317269	ensembl	human	known	70_37	silent	SNP	1.000	T
DOCK7	85440	genome.wustl.edu	37	1	62959997	62959997	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:62959997C>G	ENST00000340370.5	-	39	5090	c.5073G>C	c.(5071-5073)ttG>ttC	p.L1691F	DOCK7_ENST00000251157.5_Missense_Mutation_p.L1713F	NM_033407.2	NP_212132.2	Q96N67	DOCK7_HUMAN	dedicator of cytokinesis 7	1722	DHR-2.				activation of Rac GTPase activity (GO:0032863)|axonogenesis (GO:0007409)|establishment of neuroblast polarity (GO:0045200)|hematopoietic progenitor cell differentiation (GO:0002244)|interkinetic nuclear migration (GO:0022027)|microtubule cytoskeleton organization (GO:0000226)|neuron projection development (GO:0031175)|pigmentation (GO:0043473)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|regulation of neurogenesis (GO:0050767)|small GTPase mediated signal transduction (GO:0007264)	axon (GO:0030424)|basal part of cell (GO:0045178)|focal adhesion (GO:0005925)|growth cone (GO:0030426)|neuron projection (GO:0043005)	guanyl-nucleotide exchange factor activity (GO:0005085)|Rac GTPase binding (GO:0048365)			NS(1)|breast(4)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(19)|lung(42)|ovary(2)|prostate(3)|skin(2)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	92						CCAGCATGCTCAAATATTCAG	0.443																																																	0													98.0	79.0	85.0					1																	62959997		2203	4300	6503	SO:0001583	missense	85440				CCDS30734.1, CCDS60156.1, CCDS60157.1	1p32.1	2008-02-05			ENSG00000116641	ENSG00000116641			19190	protein-coding gene	gene with protein product		615730				12432077	Standard	NM_033407		Approved	KIAA1771, ZIR2	uc001daq.4	Q96N67	OTTHUMG00000013131	ENST00000340370.5:c.5073G>C	1.37:g.62959997C>G	ENSP00000340742:p.Leu1691Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	Q00M63|Q2PPY7|Q45RE8|Q45RE9|Q5T1B9|Q5T1C0|Q6ZV32|Q8TB82|Q96NG6|Q96NI0|Q9C092	Missense_Mutation	SNP	pfam_DOCK_C,pfam_DOCK_C/D_N,superfamily_ARM-type_fold	p.L1713F	ENST00000340370.5	37	c.5139	CCDS30734.1	1	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	18.12|18.12	3.552745|3.552745	0.65425|0.65425	.|.	.|.	ENSG00000116641|ENSG00000116641	ENST00000454575|ENST00000371140;ENST00000251157;ENST00000340370;ENST00000395441	.|T;T	.|0.05717	.|3.4;3.4	5.99|5.99	5.99|5.99	0.97316|0.97316	.|.	.|0.000000	.|0.85682	.|D	.|0.000000	T|T	0.33556|0.33556	0.0867|0.0867	H|H	0.94658|0.94658	3.565|3.565	0.80722|0.80722	D|D	1|1	.|D;D;D;D;D;D	.|0.89917	.|1.0;1.0;0.999;1.0;1.0;0.999	.|D;D;D;D;D;D	.|0.91635	.|0.999;0.997;0.999;0.999;0.994;0.991	T|T	0.30387|0.30387	-0.9980|-0.9980	5|10	.|0.87932	.|D	.|0	.|.	10.7528|10.7528	0.46219|0.46219	0.0:0.8601:0.0:0.1399|0.0:0.8601:0.0:0.1399	.|.	.|1722;1713;1691;1682;1682;1713	.|Q96N67;Q96N67-2;Q96N67-5;Q96N67-4;Q96N67-3;Q96N67-6	.|DOCK7_HUMAN;.;.;.;.;.	Q|F	885|1722;1713;1691;452	.|ENSP00000251157:L1713F;ENSP00000340742:L1691F	.|ENSP00000251157:L1713F	E|L	-|-	1|3	0|2	DOCK7|DOCK7	62732585|62732585	0.969000|0.969000	0.33509|0.33509	0.998000|0.998000	0.56505|0.56505	0.844000|0.844000	0.47949|0.47949	0.046000|0.046000	0.14035|0.14035	2.840000|2.840000	0.97914|0.97914	0.655000|0.655000	0.94253|0.94253	GAG|TTG	DOCK7	-	NULL		0.443	DOCK7-004	KNOWN	basic|appris_principal|CCDS	protein_coding	DOCK7	HGNC	protein_coding	OTTHUMT00000036806.1	C	NM_033407		62959997	-1	no_errors	ENST00000251157	ensembl	human	known	70_37	missense	SNP	1.000	G
EBLN2	55096	genome.wustl.edu	37	3	73111492	73111492	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:73111492C>T	ENST00000533473.1	+	1	683	c.260C>T	c.(259-261)cCa>cTa	p.P87L	PPP4R2_ENST00000356692.5_Intron|PPP4R2_ENST00000295862.9_Intron|PPP4R2_ENST00000394284.3_Intron	NM_018029.3	NP_060499.3	Q6P2I7	EBLN2_HUMAN	endogenous Bornavirus-like nucleoprotein 2	87										endometrium(1)|large_intestine(3)|lung(1)|prostate(1)	6						AGACAGTATCCACTGGATGCA	0.488																																																	0													35.0	34.0	35.0					3																	73111492		1949	4131	6080	SO:0001583	missense	55096				CCDS54608.1	3p13	2011-06-03			ENSG00000255423	ENSG00000255423			25493	protein-coding gene	gene with protein product	"""endogenous Borna-like N element 2"""	613250				20054395, 20686665	Standard	NM_018029		Approved		uc003dpj.3	Q6P2I7	OTTHUMG00000165897	ENST00000533473.1:c.260C>T	3.37:g.73111492C>T	ENSP00000432104:p.Pro87Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WWH3|Q9NW89	Missense_Mutation	SNP	pfam_P40_nucleoprot_BD-vir,superfamily_P40_nucleoprot_BD-vir	p.P87L	ENST00000533473.1	37	c.260	CCDS54608.1	3	.	.	.	.	.	.	.	.	.	.	C	11.14	1.549692	0.27652	.	.	ENSG00000255423	ENST00000533473	.	.	.	0.458	0.458	0.16670	P40 nucleoprotein, subdomain 1, Borna disease virus (1);	.	.	.	.	T	0.39118	0.1066	N	0.19112	0.55	0.09310	N	1	D	0.69078	0.997	D	0.71870	0.975	T	0.22417	-1.0217	7	0.72032	D	0.01	.	.	.	.	.	87	Q6P2I7	EBLN2_HUMAN	L	87	.	ENSP00000432104:P87L	P	+	2	0	EBLN2	73194182	0.086000	0.21541	0.002000	0.10522	0.002000	0.02628	0.305000	0.19254	0.482000	0.27582	0.484000	0.47621	CCA	EBLN2	-	pfam_P40_nucleoprot_BD-vir,superfamily_P40_nucleoprot_BD-vir		0.488	EBLN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	EBLN2	HGNC	protein_coding	OTTHUMT00000386932.1	C	NM_018029		73111492	+1	no_errors	ENST00000533473	ensembl	human	known	70_37	missense	SNP	0.002	T
ZNF423	23090	genome.wustl.edu	37	16	49713178	49713178	+	Intron	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr16:49713178C>T	ENST00000561648.1	-	4	331				ZNF423_ENST00000262383.2_Intron|AC007339.1_ENST00000408207.1_RNA|ZNF423_ENST00000562871.1_Intron|ZNF423_ENST00000563137.2_Intron|ZNF423_ENST00000562520.1_Intron	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423						cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				gccagggctgcgccctccgtg	0.652																																																	0																																										SO:0001627	intron_variant	0			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.278-40393G>A	16.37:g.49713178C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O94860|Q76N04|Q9NZ13	RNA	SNP	-	NULL	ENST00000561648.1	37	NULL	CCDS32445.1	16																																																																																			AC007339.1	-	-		0.652	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ENSG00000221134	Clone_based_ensembl_gene	protein_coding	OTTHUMT00000423258.1	C	NM_015069		49713178	+1	no_errors	ENST00000408207	ensembl	human	novel	70_37	rna	SNP	0.002	T
TIAM2	26230	genome.wustl.edu	37	6	155575490	155575490	+	Intron	SNP	G	G	T	rs549414155	byFrequency	TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:155575490G>T	ENST00000461783.3	+	28	5586				TIAM2_ENST00000529824.2_Intron|TIAM2_ENST00000360366.4_Intron|TIAM2_ENST00000528391.2_Intron|TIAM2_ENST00000318981.5_Intron|TIAM2_ENST00000367174.2_Intron|TIAM2_ENST00000275246.7_Intron|TIAM2_ENST00000456144.1_Intron|RP11-477D19.2_ENST00000435295.1_RNA|TIAM2_ENST00000456877.2_Intron			Q8IVF5	TIAM2_HUMAN	T-cell lymphoma invasion and metastasis 2						apoptotic signaling pathway (GO:0097190)|cellular lipid metabolic process (GO:0044255)|neurotrophin TRK receptor signaling pathway (GO:0048011)|positive regulation of apoptotic process (GO:0043065)|regulation of small GTPase mediated signal transduction (GO:0051056)|small GTPase mediated signal transduction (GO:0007264)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)	GTPase activator activity (GO:0005096)|guanyl-nucleotide exchange factor activity (GO:0005085)|receptor signaling protein activity (GO:0005057)|Rho guanyl-nucleotide exchange factor activity (GO:0005089)			breast(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(20)|lung(21)|ovary(5)|prostate(1)|skin(2)|upper_aerodigestive_tract(4)	65		Ovarian(120;0.196)		OV - Ovarian serous cystadenocarcinoma(155;8.1e-13)|BRCA - Breast invasive adenocarcinoma(81;0.0053)		ACAGGCGGGCGTGGAATGGAA	0.567																																																	0																																										SO:0001627	intron_variant	0				CCDS34558.1, CCDS34559.1	6q25	2013-01-10			ENSG00000146426	ENSG00000146426		"""Rho guanine nucleotide exchange factors"", ""Pleckstrin homology (PH) domain containing"""	11806	protein-coding gene	gene with protein product		604709				10512681	Standard	NM_012454		Approved	STEF	uc003qqe.3	Q8IVF5	OTTHUMG00000015880	ENST00000461783.3:c.4314-63G>T	6.37:g.155575490G>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B2RP56|C9JZV2|Q6NXN9|Q6ZUP9|Q9UFG6|Q9UKV9|Q9UKW0	RNA	SNP	-	NULL	ENST00000461783.3	37	NULL	CCDS34558.1	6																																																																																			RP11-477D19.2	-	-		0.567	TIAM2-005	KNOWN	basic|appris_principal|readthrough_transcript|CCDS	protein_coding	ENSG00000235381	Clone_based_vega_gene	protein_coding	OTTHUMT00000387980.2	G	NM_012454		155575490	-1	no_errors	ENST00000435295	ensembl	human	known	70_37	rna	SNP	0.000	T
RP11-1166P10.1	0	genome.wustl.edu	37	16	32001717	32001717	+	RNA	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr16:32001717C>G	ENST00000568570.1	+	0	806																											GGCAAGACCTCAATGTGATCA	0.577																																																	0																																												0																															16.37:g.32001717C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000568570.1	37	NULL		16																																																																																			RP11-1166P10.1	-	-		0.577	RP11-1166P10.1-002	KNOWN	basic	processed_transcript	ENSG00000260628	Clone_based_vega_gene	pseudogene	OTTHUMT00000432457.1	C			32001717	+1	no_errors	ENST00000568570	ensembl	human	known	70_37	rna	SNP	0.996	G
ERCC6L2	375748	genome.wustl.edu	37	9	98669408	98669408	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:98669408G>T	ENST00000288985.7	+	4	981	c.676G>T	c.(676-678)Gaa>Taa	p.E226*	RNA5SP289_ENST00000362332.1_RNA|ERCC6L2_ENST00000437817.1_Nonsense_Mutation_p.E37*|ERCC6L2_ENST00000466840.1_3'UTR	NM_001010895.2	NP_001010895.1	Q5T890	ER6L2_HUMAN	excision repair cross-complementation group 6-like 2	226	Helicase ATP-binding. {ECO:0000255|PROSITE-ProRule:PRU00541}.				DNA repair (GO:0006281)	cytoskeleton (GO:0005856)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	ATP binding (GO:0005524)|ATP-dependent helicase activity (GO:0008026)|DNA binding (GO:0003677)										CTGGAAGGATGAATTGGACAC	0.323																																																	0													92.0	96.0	95.0					9																	98669408		2203	4300	6503	SO:0001587	stop_gained	375748			BC022957	CCDS35072.1	9q22.32	2014-03-07	2014-03-07	2012-03-30	ENSG00000182150	ENSG00000182150			26922	protein-coding gene	gene with protein product		615667	"""chromosome 9 open reading frame 102"", ""excision repair cross-complementing rodent repair deficiency, complementation group 6-like 2"""	C9orf102			Standard	NM_001010895		Approved	FLJ37706, RAD26L	uc004avt.4	Q5T890	OTTHUMG00000020289	ENST00000288985.7:c.676G>T	9.37:g.98669408G>T	ENSP00000288985:p.Glu226*	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D997|B2RTP8|Q49AM9|Q5T892|Q8N663|Q8N9D0|Q9NPM7	Nonsense_Mutation	SNP	pfam_SNF2_N,pfam_Helicase_C,pfam_HDA_complex_subunit-2/3,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,smart_Helicase_C,pfscan_Helicase_ATP-bd,pfscan_Helicase_C	p.E37*	ENST00000288985.7	37	c.109	CCDS35072.1	9	.	.	.	.	.	.	.	.	.	.	G	37	6.232840	0.97399	.	.	ENSG00000182150	ENST00000288985;ENST00000437817	.	.	.	5.45	5.45	0.79879	.	0.000000	0.56097	D	0.000032	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	-28.0117	19.2951	0.94118	0.0:0.0:1.0:0.0	.	.	.	.	X	226;37	.	ENSP00000288985:E226X	E	+	1	0	C9orf102	97709229	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	8.635000	0.91006	2.559000	0.86315	0.591000	0.81541	GAA	ERCC6L2	-	pfam_SNF2_N,pfam_DNA/RNA_helicase_DEAD/DEAH_N,smart_Helicase_ATP-bd,pfscan_Helicase_ATP-bd		0.323	ERCC6L2-001	NOVEL	basic|appris_principal|exp_conf|CCDS	protein_coding	ERCC6L2	HGNC	protein_coding	OTTHUMT00000053247.2	G	NM_001010895		98669408	+1	no_errors	ENST00000437817	ensembl	human	known	70_37	nonsense	SNP	1.000	T
ERV3-1	2086	genome.wustl.edu	37	7	64466983	64466983	+	5'UTR	SNP	G	G	A	rs367617551		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:64466983G>A	ENST00000394323.2	-	0	48				ERV3-1_ENST00000528878.1_5'UTR	NM_001007253.3	NP_001007254.2	Q14264	ENR1_HUMAN	endogenous retrovirus group 3, member 1							extracellular vesicular exosome (GO:0070062)|viral envelope (GO:0019031)				breast(1)|cervix(1)|endometrium(3)|large_intestine(3)|lung(8)	16						TGCAGGTAACGAGGCCACAGA	0.597																																																	0																																										SO:0001623	5_prime_UTR_variant	2086			AK295189	CCDS47595.1	7p12-q11	2014-05-02	2011-05-05	2011-05-05	ENSG00000213462	ENSG00000213462			3454	other	endogenous retrovirus		131170	"""endogenous retroviral sequence 3 (includes zinc finger protein H-plk/HPF9)"", ""endogenous retroviral sequence 3"""	ERV3		2115127, 6495650, 21542922	Standard	NM_001007253		Approved	H-PLK, HERV-R, ERV-R, envR	uc011kdr.2	Q14264	OTTHUMG00000165023	ENST00000394323.2:c.-453C>T	7.37:g.64466983G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000394323.2	37	NULL	CCDS47595.1	7																																																																																			ERV3-1	-	-		0.597	ERV3-1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ERV3-1	HGNC	protein_coding	OTTHUMT00000381468.1	G	NM_001007253		64466983	-1	no_errors	ENST00000528878	ensembl	human	known	70_37	rna	SNP	0.342	A
EXD1	161829	genome.wustl.edu	37	15	41476476	41476477	+	Missense_Mutation	DNP	CC	CC	TT			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr15:41476476_41476477CC>TT	ENST00000314992.5	-	10	1387_1388	c.1197_1198GG>AA	c.(1195-1200)gaGGaa>gaAAaa	p.E400K	EXD1_ENST00000458580.2_Missense_Mutation_p.E458K	NM_152596.2	NP_689809.2	Q8NHP7	EXD1_HUMAN	exonuclease 3'-5' domain containing 1	400							3'-5' exonuclease activity (GO:0008408)|nucleic acid binding (GO:0003676)			large_intestine(5)|liver(1)|lung(4)|ovary(2)|prostate(2)|skin(2)	16						GTTTCCCCTTCCTCTGTGGGAG	0.406																																																	0																																										SO:0001583	missense	161829			BC030628	CCDS10072.1, CCDS66738.1	15q15.1	2009-02-24	2009-02-24	2009-02-24	ENSG00000178997	ENSG00000178997			28507	protein-coding gene	gene with protein product			"""exonuclease 3'-5' domain-like 1"""	EXDL1		12477932	Standard	NM_001286441		Approved	MGC33637	uc001znk.3	Q8NHP7	OTTHUMG00000130232	ENST00000314992.5:c.1197_1198delinsTT	15.37:g.41476476_41476477delinsTT	ENSP00000321029:p.Glu400Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K909|B7Z839|Q6ZW94	Missense_Mutation|Silent	SNP	pfam_3'-5'_exonuclease_dom,superfamily_RNaseH-like_dom,smart_3'-5'_exonuclease_dom	p.E400K|p.E399	ENST00000314992.5	37	c.1198|c.1197	CCDS10072.1	15																																																																																			EXD1	-	NULL		0.406	EXD1-001	KNOWN	basic|CCDS	protein_coding	EXD1	HGNC	protein_coding	OTTHUMT00000252553.2	C	NM_152596		41476476|41476477	-1	no_errors	ENST00000314992	ensembl	human	known	70_37	missense|silent	SNP	0.003|0.001	T
FAM133A	286499	genome.wustl.edu	37	X	92964579	92964579	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:92964579G>A	ENST00000355813.5	+	4	687	c.161G>A	c.(160-162)gGt>gAt	p.G54D	FAM133A_ENST00000322139.4_Missense_Mutation_p.G54D|FAM133A_ENST00000538690.1_Missense_Mutation_p.G54D|FAM133A_ENST00000332647.4_Missense_Mutation_p.G54D	NM_001171109.1|NM_173698.2	NP_001164580.1|NP_775969.1	Q8N9E0	F133A_HUMAN	family with sequence similarity 133, member A	54	Lys-rich.									breast(2)|endometrium(2)|large_intestine(8)|lung(7)|upper_aerodigestive_tract(1)	20						AAAAAAACAGGTTCAAAAGCA	0.348																																																	0													28.0	28.0	28.0					X																	92964579		2182	4273	6455	SO:0001583	missense	286499			AK094978	CCDS14466.1	Xq21.32	2010-05-04			ENSG00000179083	ENSG00000179083			26748	protein-coding gene	gene with protein product	"""cancer/testis antigen 115"""						Standard	NM_173698		Approved	RP1-32F7.2, FLJ37659, CT115	uc022bzv.1	Q8N9E0	OTTHUMG00000021975	ENST00000355813.5:c.161G>A	X.37:g.92964579G>A	ENSP00000348067:p.Gly54Asp	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.G54D	ENST00000355813.5	37	c.161	CCDS14466.1	X	.	.	.	.	.	.	.	.	.	.	g	12.25	1.880710	0.33255	.	.	ENSG00000179083	ENST00000538690;ENST00000355813;ENST00000322139;ENST00000332647	T;T;T;T	0.44083	0.93;0.93;0.93;0.93	3.2	2.32	0.28847	.	0.000000	0.85682	D	0.000000	T	0.39358	0.1075	M	0.84326	2.69	0.28279	N	0.924087	P	0.40107	0.703	B	0.34722	0.188	T	0.47711	-0.9096	10	0.87932	D	0	-2.1309	5.4048	0.16316	0.1601:0.0:0.8399:0.0	.	54	Q8N9E0	F133A_HUMAN	D	54	ENSP00000441389:G54D;ENSP00000348067:G54D;ENSP00000318974:G54D;ENSP00000362169:G54D	ENSP00000318974:G54D	G	+	2	0	FAM133A	92851235	1.000000	0.71417	1.000000	0.80357	0.317000	0.28152	2.791000	0.47829	0.731000	0.32448	0.597000	0.82753	GGT	FAM133A	-	NULL		0.348	FAM133A-202	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM133A	HGNC	protein_coding	OTTHUMT00000057452.1	G	NM_173698		92964579	+1	no_errors	ENST00000322139	ensembl	human	known	70_37	missense	SNP	1.000	A
FAM209B	388799	genome.wustl.edu	37	20	55111363	55111363	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr20:55111363G>C	ENST00000371325.1	+	2	481	c.385G>C	c.(385-387)Gaa>Caa	p.E129Q		NM_001013646.2	NP_001013668.2	Q5JX69	F209B_HUMAN	family with sequence similarity 209, member B	129			E -> A (in dbSNP:rs2296129).			integral component of membrane (GO:0016021)|nucleus (GO:0005634)											ATTTGTGTCCGAAGTGCAGAA	0.423																																																	0													97.0	97.0	97.0					20																	55111363		2203	4300	6503	SO:0001583	missense	388799			AL109806	CCDS33494.1	20q13.31	2011-11-24	2011-11-24	2011-11-24	ENSG00000213714	ENSG00000213714			16101	protein-coding gene	gene with protein product			"""chromosome 20 open reading frame 107"""	C20orf107			Standard	NM_001013646		Approved	dJ1153D9.4	uc002xxz.4	Q5JX69	OTTHUMG00000032800	ENST00000371325.1:c.385G>C	20.37:g.55111363G>C	ENSP00000360376:p.Glu129Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q3KRB5	Missense_Mutation	SNP	NULL	p.E129Q	ENST00000371325.1	37	c.385	CCDS33494.1	20	.	.	.	.	.	.	.	.	.	.	g	5.347	0.249398	0.10130	.	.	ENSG00000213714	ENST00000371325	T	0.07688	3.17	3.55	2.44	0.29823	.	0.382680	0.21732	N	0.069953	T	0.04092	0.0114	N	0.08118	0	0.09310	N	0.999996	B	0.14012	0.009	B	0.12837	0.008	T	0.36089	-0.9762	10	0.62326	D	0.03	-10.4598	5.8222	0.18534	0.8743:0.0:0.1257:0.0	.	129	Q5JX69	CT107_HUMAN	Q	129	ENSP00000360376:E129Q	ENSP00000360376:E129Q	E	+	1	0	C20orf107	54544770	1.000000	0.71417	0.985000	0.45067	0.030000	0.12068	1.382000	0.34374	0.544000	0.28883	-0.417000	0.06048	GAA	FAM209B	-	NULL		0.423	FAM209B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM209B	HGNC	protein_coding	OTTHUMT00000079816.1	G			55111363	+1	no_errors	ENST00000371325	ensembl	human	known	70_37	missense	SNP	0.992	C
FAM83B	222584	genome.wustl.edu	37	6	54805040	54805040	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:54805040G>T	ENST00000306858.7	+	5	1387	c.1271G>T	c.(1270-1272)aGt>aTt	p.S424I	RP3-523K23.2_ENST00000562834.1_RNA	NM_001010872.1	NP_001010872.1	Q5T0W9	FA83B_HUMAN	family with sequence similarity 83, member B	424										autonomic_ganglia(1)|breast(2)|cervix(1)|endometrium(7)|haematopoietic_and_lymphoid_tissue(1)|kidney(6)|large_intestine(6)|lung(28)|ovary(6)|prostate(6)|skin(6)|upper_aerodigestive_tract(1)	71	Lung NSC(77;0.0178)|Renal(3;0.122)					GATAGTCTCAGTGTGGCGTCC	0.483																																																	0													71.0	74.0	73.0					6																	54805040		2203	4300	6503	SO:0001583	missense	222584			AK055204	CCDS34479.1	6p12.1	2014-03-13	2006-03-23	2006-03-23	ENSG00000168143	ENSG00000168143			21357	protein-coding gene	gene with protein product			"""chromosome 6 open reading frame 143"""	C6orf143		22886302	Standard	NM_001010872		Approved	FLJ30642	uc003pck.4	Q5T0W9	OTTHUMG00000014899	ENST00000306858.7:c.1271G>T	6.37:g.54805040G>T	ENSP00000304078:p.Ser424Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M1P3|Q96DQ2	Missense_Mutation	SNP	pfam_DUF1669	p.S424I	ENST00000306858.7	37	c.1271	CCDS34479.1	6	.	.	.	.	.	.	.	.	.	.	G	16.71	3.199516	0.58126	.	.	ENSG00000168143	ENST00000306858	T	0.11385	2.78	5.56	5.56	0.83823	.	0.000000	0.85682	D	0.000000	T	0.29288	0.0729	M	0.73598	2.24	0.58432	D	0.999997	D	0.76494	0.999	D	0.83275	0.996	T	0.01909	-1.1249	10	0.72032	D	0.01	-29.5647	19.8898	0.96926	0.0:0.0:1.0:0.0	.	424	Q5T0W9	FA83B_HUMAN	I	424	ENSP00000304078:S424I	ENSP00000304078:S424I	S	+	2	0	FAM83B	54912999	1.000000	0.71417	1.000000	0.80357	0.621000	0.37620	6.652000	0.74377	2.775000	0.95449	0.655000	0.94253	AGT	FAM83B	-	NULL		0.483	FAM83B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAM83B	HGNC	protein_coding	OTTHUMT00000040994.1	G	XM_294139		54805040	+1	no_errors	ENST00000306858	ensembl	human	known	70_37	missense	SNP	1.000	T
FAT1	2195	genome.wustl.edu	37	4	187525001	187525001	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr4:187525001G>C	ENST00000441802.2	-	19	10888	c.10679C>G	c.(10678-10680)tCa>tGa	p.S3560*		NM_005245.3	NP_005236.2	Q14517	FAT1_HUMAN	FAT atypical cadherin 1	3560	Cadherin 33. {ECO:0000255|PROSITE- ProRule:PRU00043}.				actin filament organization (GO:0007015)|anatomical structure morphogenesis (GO:0009653)|cell adhesion (GO:0007155)|cell migration (GO:0016477)|cell-cell signaling (GO:0007267)|establishment or maintenance of cell polarity (GO:0007163)|homophilic cell adhesion (GO:0007156)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|extracellular vesicular exosome (GO:0070062)|filopodium (GO:0030175)|focal adhesion (GO:0005925)|integral component of plasma membrane (GO:0005887)|lamellipodium (GO:0030027)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			NS(1)|breast(3)|central_nervous_system(3)|endometrium(38)|haematopoietic_and_lymphoid_tissue(2)|kidney(12)|large_intestine(33)|lung(88)|ovary(13)|pancreas(2)|prostate(16)|skin(2)|upper_aerodigestive_tract(11)|urinary_tract(4)	228						GACGCCACCTGAGTATTCTTC	0.473										HNSCC(5;0.00058)																											Colon(197;1040 2055 4143 4984 49344)												0													86.0	87.0	87.0					4																	187525001		1962	4139	6101	SO:0001587	stop_gained	2195			X87241	CCDS47177.1	4q35.2	2013-05-31	2013-05-31	2008-10-30	ENSG00000083857	ENSG00000083857		"""Cadherins / Cadherin-related"""	3595	protein-coding gene	gene with protein product	"""cadherin-related family member 8"""	600976	"""FAT tumor suppressor (Drosophila) homolog"", ""FAT tumor suppressor homolog 1 (Drosophila)"""	FAT		8586420	Standard	XM_005262834		Approved	CDHF7, CDHR8	uc003izf.3	Q14517	OTTHUMG00000160320	ENST00000441802.2:c.10679C>G	4.37:g.187525001G>C	ENSP00000406229:p.Ser3560*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Cadherin,pfam_Laminin_G,pfam_EG-like_dom,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Cadherin-like,smart_Cadherin,smart_EG-like_dom,smart_Laminin_G,smart_EGF-like_Ca-bd,pfscan_EG-like_dom,pfscan_Laminin_G,pfscan_Cadherin,prints_Cadherin	p.S3560*	ENST00000441802.2	37	c.10679	CCDS47177.1	4	.	.	.	.	.	.	.	.	.	.	G	53	20.266983	0.99929	.	.	ENSG00000083857	ENST00000441802;ENST00000260147	.	.	.	5.06	5.06	0.68205	.	0.208574	0.42964	D	0.000624	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.37606	T	0.19	.	18.6333	0.91369	0.0:0.0:1.0:0.0	.	.	.	.	X	3560;3562	.	ENSP00000260147:S3562X	S	-	2	0	FAT1	187761995	1.000000	0.71417	0.849000	0.33467	0.740000	0.42216	7.814000	0.86154	2.636000	0.89361	0.563000	0.77884	TCA	FAT1	-	superfamily_Cadherin-like		0.473	FAT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FAT1	HGNC	protein_coding	OTTHUMT00000360209.3	G	NM_005245		187525001	-1	no_errors	ENST00000441802	ensembl	human	known	70_37	nonsense	SNP	0.999	C
FKBP4	2288	genome.wustl.edu	37	12	2909265	2909265	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:2909265G>C	ENST00000001008.4	+	7	1010	c.823G>C	c.(823-825)Gag>Cag	p.E275Q	RP4-816N1.6_ENST00000547834.1_RNA|RP4-816N1.7_ENST00000547042.1_RNA	NM_002014.3	NP_002005.1	Q02790	FKBP4_HUMAN	FK506 binding protein 4, 59kDa	275	Interaction with tubulin. {ECO:0000250}.				androgen receptor signaling pathway (GO:0030521)|chaperone-mediated protein folding (GO:0061077)|copper ion transport (GO:0006825)|embryo implantation (GO:0007566)|male sex differentiation (GO:0046661)|negative regulation of microtubule polymerization (GO:0031115)|negative regulation of microtubule polymerization or depolymerization (GO:0031111)|negative regulation of neuron projection development (GO:0010977)|prostate gland development (GO:0030850)|protein complex localization (GO:0031503)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)|steroid hormone receptor complex assembly (GO:0006463)	axonal growth cone (GO:0044295)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|extracellular vesicular exosome (GO:0070062)|microtubule (GO:0005874)|mitochondrion (GO:0005739)|neuronal cell body (GO:0043025)|nucleus (GO:0005634)|perinuclear region of cytoplasm (GO:0048471)	ATP binding (GO:0005524)|FK506 binding (GO:0005528)|GTP binding (GO:0005525)|heat shock protein binding (GO:0031072)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)|poly(A) RNA binding (GO:0044822)|protein binding, bridging (GO:0030674)			breast(2)|central_nervous_system(1)|cervix(1)|endometrium(2)|large_intestine(2)|lung(3)|prostate(2)|skin(1)	14			OV - Ovarian serous cystadenocarcinoma(31;0.00105)			CATAGTGAAAGAGCGGGGCAC	0.527																																																	0													110.0	108.0	109.0					12																	2909265		2203	4300	6503	SO:0001583	missense	2288			M88279	CCDS8512.1	12p13.33	2013-01-10	2002-08-29		ENSG00000004478	ENSG00000004478		"""Tetratricopeptide (TTC) repeat domain containing"""	3720	protein-coding gene	gene with protein product		600611	"""FK506-binding protein 4 (59kD)"""			1279700	Standard	NM_002014		Approved	FKBP59, FKBP52	uc001qkz.3	Q02790	OTTHUMG00000090429	ENST00000001008.4:c.823G>C	12.37:g.2909265G>C	ENSP00000001008:p.Glu275Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DUQ1|Q9UCP1|Q9UCV7	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,pfam_TPR-1,pfam_TPR_2,smart_TPR_repeat,pfscan_TPR_repeat,pfscan_TPR-contain_dom,pfscan_PPIase_FKBP_dom	p.E275Q	ENST00000001008.4	37	c.823	CCDS8512.1	12	.	.	.	.	.	.	.	.	.	.	G	23.0	4.367127	0.82463	.	.	ENSG00000004478	ENST00000001008	T	0.74737	-0.87	5.38	5.38	0.77491	Elongated TPR repeat-containing domain (1);Tetratricopeptide repeat-containing (1);	0.095878	0.64402	D	0.000001	T	0.79375	0.4435	M	0.78285	2.405	0.80722	D	1	P	0.50943	0.94	P	0.45794	0.493	T	0.82922	-0.0217	10	0.62326	D	0.03	-36.2317	17.7141	0.88331	0.0:0.0:1.0:0.0	.	275	Q02790	FKBP4_HUMAN	Q	275	ENSP00000001008:E275Q	ENSP00000001008:E275Q	E	+	1	0	FKBP4	2779526	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.452000	0.80683	2.528000	0.85240	0.561000	0.74099	GAG	FKBP4	-	smart_TPR_repeat,pfscan_TPR_repeat		0.527	FKBP4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP4	HGNC	protein_coding	OTTHUMT00000206861.1	G			2909265	+1	no_errors	ENST00000001008	ensembl	human	known	70_37	missense	SNP	1.000	C
FKBP9	11328	genome.wustl.edu	37	7	33042416	33042416	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:33042416G>C	ENST00000242209.4	+	9	1670	c.1501G>C	c.(1501-1503)Gac>Cac	p.D501H	AVL9_ENST00000404479.1_Intron|FKBP9_ENST00000490776.2_Missense_Mutation_p.D269H|FKBP9_ENST00000538443.1_Missense_Mutation_p.D363H|FKBP9_ENST00000538336.1_Missense_Mutation_p.D554H|RNU6-388P_ENST00000517012.1_RNA	NM_001284343.1|NM_007270.3	NP_001271272.1|NP_009201.2	O95302	FKBP9_HUMAN	FK506 binding protein 9, 63 kDa	501	EF-hand 1. {ECO:0000255|PROSITE- ProRule:PRU00448}.				chaperone-mediated protein folding (GO:0061077)|protein folding (GO:0006457)|protein peptidyl-prolyl isomerization (GO:0000413)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)	calcium ion binding (GO:0005509)|FK506 binding (GO:0005528)|peptidyl-prolyl cis-trans isomerase activity (GO:0003755)			central_nervous_system(13)|cervix(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(6)|lung(9)|ovary(2)|upper_aerodigestive_tract(1)	39			GBM - Glioblastoma multiforme(11;0.0156)			TGAAGAAATTGACAAGGATGG	0.537																																																	0													117.0	87.0	97.0					7																	33042416		2203	4300	6503	SO:0001583	missense	11328			AF089745	CCDS5439.1, CCDS64622.1, CCDS64623.1	7p11.1	2013-01-10	2002-08-29		ENSG00000122642	ENSG00000122642		"""EF-hand domain containing"""	3725	protein-coding gene	gene with protein product			"""FK506-binding protein 9 (63 kD)"""			12036304	Standard	NM_007270		Approved	FKBP60, FKBP63	uc003tdh.3	O95302	OTTHUMG00000097847	ENST00000242209.4:c.1501G>C	7.37:g.33042416G>C	ENSP00000242209:p.Asp501His	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KY35|B7Z1G9|B7Z6H3|Q2M2A1|Q3MIR7|Q6IN76|Q6P2N1|Q96EX5|Q96IJ9	Missense_Mutation	SNP	pfam_PPIase_FKBP_dom,smart_EF_hand_Ca-bd,pfscan_EF_HAND_2,pfscan_PPIase_FKBP_dom	p.D554H	ENST00000242209.4	37	c.1660	CCDS5439.1	7	.	.	.	.	.	.	.	.	.	.	G	25.4	4.638149	0.87760	.	.	ENSG00000122642	ENST00000242209;ENST00000538336;ENST00000538443;ENST00000490776	T;T;T;T	0.72051	-0.62;-0.62;-0.62;-0.62	4.8	4.8	0.61643	EF-hand-like domain (1);	0.000000	0.85682	D	0.000000	D	0.84620	0.5512	M	0.79123	2.44	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.97110	0.998;0.999;1.0	D	0.87145	0.2205	10	0.87932	D	0	-1.0314	17.8793	0.88835	0.0:0.0:1.0:0.0	.	269;554;501	B7Z1G9;B7Z6H3;O95302	.;.;FKBP9_HUMAN	H	501;554;363;269	ENSP00000242209:D501H;ENSP00000439250:D554H;ENSP00000437504:D363H;ENSP00000441317:D269H	ENSP00000242209:D501H	D	+	1	0	FKBP9	33008941	1.000000	0.71417	0.983000	0.44433	0.988000	0.76386	9.864000	0.99589	2.228000	0.72767	0.555000	0.69702	GAC	FKBP9	-	smart_EF_hand_Ca-bd,pfscan_EF_HAND_2		0.537	FKBP9-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FKBP9	HGNC	protein_coding	OTTHUMT00000215137.1	G	NM_007270		33042416	+1	no_errors	ENST00000538336	ensembl	human	known	70_37	missense	SNP	1.000	C
FLG	2312	genome.wustl.edu	37	1	152279239	152279239	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:152279239G>A	ENST00000368799.1	-	3	8158	c.8123C>T	c.(8122-8124)tCa>tTa	p.S2708L	FLG-AS1_ENST00000420707.1_RNA|FLG-AS1_ENST00000593011.1_RNA	NM_002016.1	NP_002007.1	P20930	FILA_HUMAN	filaggrin	2708	Ser-rich.				establishment of skin barrier (GO:0061436)|keratinocyte differentiation (GO:0030216)|multicellular organismal development (GO:0007275)	cytoplasmic membrane-bounded vesicle (GO:0016023)|intermediate filament (GO:0005882)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|structural molecule activity (GO:0005198)			autonomic_ganglia(1)|breast(13)|central_nervous_system(5)|cervix(2)|endometrium(38)|haematopoietic_and_lymphoid_tissue(1)|kidney(16)|large_intestine(57)|lung(211)|ovary(13)|pancreas(1)|prostate(15)|skin(24)|stomach(5)|upper_aerodigestive_tract(10)|urinary_tract(12)	424	Hepatocellular(266;0.0877)|Melanoma(130;0.116)|all_hematologic(923;0.127)		LUSC - Lung squamous cell carcinoma(543;0.206)			TCCGTGGGCTGACACTGACTG	0.567									Ichthyosis																																								0													5.0	8.0	7.0					1																	152279239		1414	3368	4782	SO:0001583	missense	2312	Familial Cancer Database	X-linked Ichthyosis, Steroid Sulfatase Deficiency, Ichthyosis Vulgaris	XM_048104	CCDS30860.1	1q21.3	2013-01-10			ENSG00000143631	ENSG00000143631		"""EF-hand domain containing"""	3748	protein-coding gene	gene with protein product		135940				2740331, 2248957, 16444271	Standard	NM_002016		Approved		uc001ezu.1	P20930	OTTHUMG00000012202	ENST00000368799.1:c.8123C>T	1.37:g.152279239G>A	ENSP00000357789:p.Ser2708Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q01720|Q5T583|Q9UC71	Missense_Mutation	SNP	pfam_Filaggrin,pfam_S100_Ca-bd_sub,pfscan_EF_HAND_2,prints_Filaggrin	p.S2708L	ENST00000368799.1	37	c.8123	CCDS30860.1	1	.	.	.	.	.	.	.	.	.	.	G	8.558	0.877127	0.17395	.	.	ENSG00000143631	ENST00000368799	T	0.03745	3.82	3.48	0.256	0.15567	.	.	.	.	.	T	0.04497	0.0123	M	0.70595	2.14	0.09310	N	1	D	0.69078	0.997	P	0.60682	0.878	T	0.27640	-1.0068	9	0.46703	T	0.11	.	6.2577	0.20884	0.0:0.1796:0.4515:0.3688	.	2708	P20930	FILA_HUMAN	L	2708	ENSP00000357789:S2708L	ENSP00000357789:S2708L	S	-	2	0	FLG	150545863	0.001000	0.12720	0.000000	0.03702	0.084000	0.17831	0.492000	0.22435	-0.037000	0.13646	0.306000	0.20318	TCA	FLG	-	NULL		0.567	FLG-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FLG	HGNC	protein_coding	OTTHUMT00000033742.1	G	NM_002016		152279239	-1	no_errors	ENST00000368799	ensembl	human	known	70_37	missense	SNP	0.000	A
FLNC	2318	genome.wustl.edu	37	7	128486140	128486140	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:128486140C>T	ENST00000325888.8	+	22	4148	c.3887C>T	c.(3886-3888)tCg>tTg	p.S1296L	FLNC_ENST00000346177.6_Missense_Mutation_p.S1296L	NM_001458.4	NP_001449.3	Q14315	FLNC_HUMAN	filamin C, gamma	1296					cell junction assembly (GO:0034329)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|cytoskeletal protein binding (GO:0008092)			biliary_tract(1)|breast(7)|central_nervous_system(1)|cervix(1)|endometrium(19)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(19)|lung(59)|ovary(2)|pancreas(2)|prostate(1)|skin(6)|upper_aerodigestive_tract(2)	128						CTCAACCCCTCGGGGGCCAAG	0.627																																																	0													44.0	49.0	47.0					7																	128486140		2038	4176	6214	SO:0001583	missense	2318			AB208865	CCDS43644.1, CCDS47705.1	7q32-q35	2014-09-17	2009-07-23		ENSG00000128591	ENSG00000128591			3756	protein-coding gene	gene with protein product	"""actin binding protein 280"""	102565	"""filamin C, gamma (actin binding protein 280)"""	FLN2		7689010, 8088838	Standard	NM_001458		Approved	ABP-280, ABPL	uc003vnz.4	Q14315	OTTHUMG00000023627	ENST00000325888.8:c.3887C>T	7.37:g.128486140C>T	ENSP00000327145:p.Ser1296Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2ZZ88|O95303|Q07985|Q9NS12|Q9NYE5|Q9UMR8|Q9Y503	Missense_Mutation	SNP	pfam_Filamin/ABP280_repeat-like,pfam_CH-domain,superfamily_CH-domain,superfamily_Ig_E-set,smart_CH-domain,smart_Filamin,pfscan_CH-domain,pfscan_Filamin/ABP280_repeat-like	p.S1296L	ENST00000325888.8	37	c.3887	CCDS43644.1	7	.	.	.	.	.	.	.	.	.	.	C	36	5.633050	0.96682	.	.	ENSG00000128591	ENST00000325888;ENST00000346177	D;D	0.93076	-3.16;-3.16	5.07	5.07	0.68467	Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.000000	0.85682	D	0.000000	D	0.97368	0.9139	M	0.90082	3.085	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	0.997;1.0	D	0.98278	1.0507	10	0.87932	D	0	.	18.4511	0.90704	0.0:1.0:0.0:0.0	.	1296;1296	Q14315-2;Q14315	.;FLNC_HUMAN	L	1296	ENSP00000327145:S1296L;ENSP00000344002:S1296L	ENSP00000327145:S1296L	S	+	2	0	FLNC	128273376	1.000000	0.71417	0.985000	0.45067	0.948000	0.59901	7.788000	0.85771	2.360000	0.80028	0.555000	0.69702	TCG	FLNC	-	pfam_Filamin/ABP280_repeat-like,superfamily_Ig_E-set,smart_Filamin,pfscan_Filamin/ABP280_repeat-like		0.627	FLNC-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	FLNC	HGNC	protein_coding	OTTHUMT00000059948.3	C			128486140	+1	no_errors	ENST00000325888	ensembl	human	known	70_37	missense	SNP	1.000	T
FMN2	56776	genome.wustl.edu	37	1	240497525	240497525	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:240497525G>T	ENST00000319653.9	+	13	4991	c.4761G>T	c.(4759-4761)ttG>ttT	p.L1587F	FMN2_ENST00000545751.1_Missense_Mutation_p.L183F	NM_020066.4	NP_064450.3	Q9NZ56	FMN2_HUMAN	formin 2	1587	FH2. {ECO:0000255|PROSITE- ProRule:PRU00774}.				cellular response to DNA damage stimulus (GO:0006974)|cellular response to hypoxia (GO:0071456)|establishment of meiotic spindle localization (GO:0051295)|formin-nucleated actin cable assembly (GO:0070649)|homologous chromosome movement towards spindle pole involved in homologous chromosome segregation (GO:0051758)|intracellular signal transduction (GO:0035556)|intracellular transport (GO:0046907)|multicellular organismal development (GO:0007275)|negative regulation of apoptotic process (GO:0043066)|negative regulation of protein catabolic process (GO:0042177)|oogenesis (GO:0048477)|polar body extrusion after meiotic divisions (GO:0040038)|protein transport (GO:0015031)|vesicle-mediated transport (GO:0016192)	cell cortex (GO:0005938)|cytoplasmic vesicle membrane (GO:0030659)|cytosol (GO:0005829)|endoplasmic reticulum membrane (GO:0005789)|microvillus (GO:0005902)|nucleolus (GO:0005730)|plasma membrane (GO:0005886)|spindle (GO:0005819)	actin binding (GO:0003779)			NS(1)|breast(7)|central_nervous_system(6)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(1)|kidney(10)|large_intestine(13)|lung(87)|ovary(6)|pancreas(3)|prostate(12)|skin(7)|stomach(2)|upper_aerodigestive_tract(6)|urinary_tract(2)	178	Ovarian(103;0.127)	all_cancers(173;0.013)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)			AGAAAGACTTGAAAGGTAACT	0.348																																																	0													95.0	108.0	104.0					1																	240497525		2202	4297	6499	SO:0001583	missense	56776			AF218942	CCDS31069.2	1q43	2008-02-05			ENSG00000155816	ENSG00000155816			14074	protein-coding gene	gene with protein product		606373				10781961	Standard	NM_020066		Approved		uc010pyd.2	Q9NZ56	OTTHUMG00000039883	ENST00000319653.9:c.4761G>T	1.37:g.240497525G>T	ENSP00000318884:p.Leu1587Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	B0QZA7|B4DP05|Q59GF6|Q5VU37|Q9NZ55	Missense_Mutation	SNP	pfam_FH2_actin-bd,pfam_Formin_homology_1,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg,pfscan_DEP_dom	p.L1587F	ENST00000319653.9	37	c.4761	CCDS31069.2	1	.	.	.	.	.	.	.	.	.	.	G	13.05	2.121546	0.37436	.	.	ENSG00000155816	ENST00000319653;ENST00000545751;ENST00000537355;ENST00000406993	T;T	0.19250	2.16;2.16	5.56	1.59	0.23543	Actin-binding FH2/DRF autoregulatory (1);Actin-binding FH2 (3);	0.295721	0.23631	N	0.046140	T	0.26484	0.0647	L	0.38838	1.175	0.80722	D	1	B;B;P;P	0.49696	0.059;0.009;0.863;0.927	B;B;P;P	0.61397	0.037;0.007;0.496;0.888	T	0.03287	-1.1052	10	0.52906	T	0.07	.	4.7783	0.13190	0.2053:0.0:0.5363:0.2585	.	183;233;216;1587	B4DP05;F5H2C1;B4DN09;Q9NZ56	.;.;.;FMN2_HUMAN	F	1587;183;214;63	ENSP00000318884:L1587F;ENSP00000437918:L183F	ENSP00000318884:L1587F	L	+	3	2	FMN2	238564148	1.000000	0.71417	0.992000	0.48379	0.986000	0.74619	0.914000	0.28624	0.039000	0.15632	0.591000	0.81541	TTG	FMN2	-	pfam_FH2_actin-bd,superfamily_FH2_actin-bd,smart_Actin-bd_FH2/DRF_autoreg		0.348	FMN2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FMN2	HGNC	protein_coding	OTTHUMT00000096217.2	G	XM_371352		240497525	+1	no_errors	ENST00000319653	ensembl	human	known	70_37	missense	SNP	0.992	T
FREM2	341640	genome.wustl.edu	37	13	39264593	39264593	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr13:39264593G>A	ENST00000280481.7	+	1	3328	c.3112G>A	c.(3112-3114)Gat>Aat	p.D1038N		NM_207361.4	NP_997244.3	Q5SZK8	FREM2_HUMAN	FRAS1 related extracellular matrix protein 2	1038					cell communication (GO:0007154)|homophilic cell adhesion (GO:0007156)|inner ear development (GO:0048839)|morphogenesis of an epithelium (GO:0002009)	basement membrane (GO:0005604)|extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)	p.D1038Y(1)		NS(1)|breast(2)|central_nervous_system(2)|cervix(1)|endometrium(14)|haematopoietic_and_lymphoid_tissue(3)|kidney(8)|large_intestine(35)|lung(39)|ovary(9)|pancreas(2)|prostate(12)|skin(11)|upper_aerodigestive_tract(7)|urinary_tract(2)	148		Lung NSC(96;1.04e-07)|Prostate(109;0.00384)|Breast(139;0.00396)|Lung SC(185;0.0565)|Hepatocellular(188;0.114)		all cancers(112;3.32e-07)|Epithelial(112;1.66e-05)|OV - Ovarian serous cystadenocarcinoma(117;0.00154)|BRCA - Breast invasive adenocarcinoma(63;0.00631)|GBM - Glioblastoma multiforme(144;0.0312)		GAGTCTGTCAGATATGTCTCA	0.453																																																	1	Substitution - Missense(1)	lung(1)											128.0	130.0	129.0					13																	39264593		2203	4300	6503	SO:0001583	missense	341640			BX538150	CCDS31960.1	13q13.3	2004-12-15			ENSG00000150893	ENSG00000150893			25396	protein-coding gene	gene with protein product		608945				15345741	Standard	NM_207361		Approved	DKFZp686J0811	uc001uwv.3	Q5SZK8	OTTHUMG00000016759	ENST00000280481.7:c.3112G>A	13.37:g.39264593G>A	ENSP00000280481:p.Asp1038Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4QQG1|Q5H9N8|Q5T6Q1|Q6N057|Q6ZSB4|Q7Z305|Q7Z341	Missense_Mutation	SNP	pfam_Calx_beta,superfamily_Cadherin-like,smart_Calx_beta	p.D1038N	ENST00000280481.7	37	c.3112	CCDS31960.1	13	.	.	.	.	.	.	.	.	.	.	G	20.3	3.959489	0.74016	.	.	ENSG00000150893	ENST00000280481	T	0.46063	0.88	5.79	5.79	0.91817	.	0.198299	0.51477	D	0.000093	T	0.48352	0.1495	M	0.73217	2.22	0.80722	D	1	B	0.21452	0.056	B	0.20184	0.028	T	0.40813	-0.9543	10	0.46703	T	0.11	.	20.0413	0.97592	0.0:0.0:1.0:0.0	.	1038	Q5SZK8	FREM2_HUMAN	N	1038	ENSP00000280481:D1038N	ENSP00000280481:D1038N	D	+	1	0	FREM2	38162593	1.000000	0.71417	0.945000	0.38365	0.992000	0.81027	8.015000	0.88690	2.751000	0.94390	0.650000	0.86243	GAT	FREM2	-	NULL		0.453	FREM2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FREM2	HGNC	protein_coding	OTTHUMT00000044599.2	G	NM_207361		39264593	+1	no_errors	ENST00000280481	ensembl	human	known	70_37	missense	SNP	1.000	A
FYCO1	79443	genome.wustl.edu	37	3	45999964	45999964	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:45999964G>T	ENST00000296137.2	-	13	3940	c.3735C>A	c.(3733-3735)agC>agA	p.S1245R	FYCO1_ENST00000535325.1_Missense_Mutation_p.S1245R|FYCO1_ENST00000438446.1_5'UTR	NM_024513.3	NP_078789.2	Q9BQS8	FYCO1_HUMAN	FYVE and coiled-coil domain containing 1	1245					plus-end-directed vesicle transport along microtubule (GO:0072383)	autophagic vacuole (GO:0005776)|cytoplasmic vesicle (GO:0031410)|integral component of membrane (GO:0016021)|late endosome (GO:0005770)|lysosome (GO:0005764)|membrane (GO:0016020)	metal ion binding (GO:0046872)			NS(4)|breast(3)|central_nervous_system(1)|endometrium(11)|kidney(2)|large_intestine(9)|lung(17)|prostate(4)|skin(2)|upper_aerodigestive_tract(1)	54				BRCA - Breast invasive adenocarcinoma(193;0.00147)|KIRC - Kidney renal clear cell carcinoma(197;0.0272)|Kidney(197;0.0323)		GCTCTCCCTGGCTAGTGCCTG	0.612																																																	0													47.0	42.0	44.0					3																	45999964		2203	4300	6503	SO:0001583	missense	79443			AJ292348	CCDS2734.1	3p21.3	2008-02-05			ENSG00000163820	ENSG00000163820		"""Zinc fingers, FYVE domain containing"""	14673	protein-coding gene	gene with protein product		607182				11896456	Standard	NM_024513		Approved	FLJ13335, ZFYVE7	uc003cpb.5	Q9BQS8	OTTHUMG00000133447	ENST00000296137.2:c.3735C>A	3.37:g.45999964G>T	ENSP00000296137:p.Ser1245Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZKT7|Q3MJE6|Q86T41|Q86TB1|Q8TEF9|Q96IV5|Q9H8P9	Missense_Mutation	SNP	pfam_Znf_FYVE,pfam_Run,superfamily_GOLD,superfamily_Znf_FYVE_PHD,superfamily_Prefoldin,superfamily_tRNA-bd_arm,smart_Znf_FYVE,pfscan_GOLD,pfscan_Run,pfscan_Znf_FYVE-rel	p.S1245R	ENST00000296137.2	37	c.3735	CCDS2734.1	3	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	17.03|17.03	3.285875|3.285875	0.59867|0.59867	.|.	.|.	ENSG00000163820|ENSG00000163820	ENST00000433878|ENST00000296137;ENST00000535325	.|T;T	.|0.24151	.|1.87;1.89	5.56|5.56	5.56|5.56	0.83823|0.83823	.|.	.|0.510720	.|0.20843	.|N	.|0.084676	T|T	0.36880|0.36880	0.0983|0.0983	L|L	0.56769|0.56769	1.78|1.78	0.32028|0.32028	N|N	0.599894|0.599894	.|D;D	.|0.55800	.|0.973;0.963	.|P;B	.|0.48873	.|0.593;0.408	T|T	0.48490|0.48490	-0.9031|-0.9031	5|10	.|0.66056	.|D	.|0.02	-18.9904|-18.9904	16.6688|16.6688	0.85260|0.85260	0.0:0.0:1.0:0.0|0.0:0.0:1.0:0.0	.|.	.|1245;1245	.|B7ZKT7;Q9BQS8	.|.;FYCO1_HUMAN	D|R	34|1245	.|ENSP00000296137:S1245R;ENSP00000441178:S1245R	.|ENSP00000296137:S1245R	A|S	-|-	2|3	0|2	FYCO1|FYCO1	45974968|45974968	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.996000|0.996000	0.88848|0.88848	3.312000|3.312000	0.51927|0.51927	2.607000|2.607000	0.88179|0.88179	0.655000|0.655000	0.94253|0.94253	GCC|AGC	FYCO1	-	NULL		0.612	FYCO1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	FYCO1	HGNC	protein_coding	OTTHUMT00000257320.2	G	NM_024513		45999964	-1	no_errors	ENST00000535325	ensembl	human	known	70_37	missense	SNP	1.000	T
FZD6	8323	genome.wustl.edu	37	8	104337017	104337017	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:104337017G>C	ENST00000358755.4	+	4	1000	c.683G>C	c.(682-684)aGa>aCa	p.R228T	FZD6_ENST00000540287.1_Intron|FZD6_ENST00000523739.1_Missense_Mutation_p.R196T|FZD6_ENST00000522566.1_Missense_Mutation_p.R228T	NM_001164616.1|NM_003506.3	NP_001158088.1|NP_003497.2	O60353	FZD6_HUMAN	frizzled class receptor 6	228					angiogenesis (GO:0001525)|axonogenesis (GO:0007409)|cell proliferation in midbrain (GO:0033278)|embryonic nail plate morphogenesis (GO:0035880)|establishment of planar polarity (GO:0001736)|G-protein coupled receptor signaling pathway coupled to cGMP nucleotide second messenger (GO:0007199)|gonad development (GO:0008406)|hair follicle development (GO:0001942)|inner ear morphogenesis (GO:0042472)|negative regulation of canonical Wnt signaling pathway (GO:0090090)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|neural tube closure (GO:0001843)|non-canonical Wnt signaling pathway (GO:0035567)|platelet activation (GO:0030168)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	apical part of cell (GO:0045177)|apicolateral plasma membrane (GO:0016327)|cytoplasm (GO:0005737)|integral component of plasma membrane (GO:0005887)|neuron projection membrane (GO:0032589)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|PDZ domain binding (GO:0030165)|ubiquitin protein ligase binding (GO:0031625)|Wnt-activated receptor activity (GO:0042813)|Wnt-protein binding (GO:0017147)			central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(7)|lung(8)|prostate(1)|skin(1)|urinary_tract(1)	24			OV - Ovarian serous cystadenocarcinoma(57;2.86e-05)|STAD - Stomach adenocarcinoma(118;0.197)			AGAAGATTCAGATACCCAGAG	0.338																																																	0													52.0	52.0	52.0					8																	104337017		2203	4300	6503	SO:0001583	missense	8323			AB012911	CCDS6298.1, CCDS55268.1	8q22.3-q23.1	2014-01-29	2014-01-29		ENSG00000164930	ENSG00000164930		"""GPCR / Class F : Frizzled receptors"""	4044	protein-coding gene	gene with protein product		603409	"""frizzled (Drosophila) homolog 6"", ""frizzled homolog 6 (Drosophila)"", ""frizzled 6, seven transmembrane spanning receptor"", ""frizzled family receptor 6"""			9480858, 14747478	Standard	NM_003506		Approved	Hfz6	uc003ylh.3	O60353	OTTHUMG00000164840	ENST00000358755.4:c.683G>C	8.37:g.104337017G>C	ENSP00000351605:p.Arg228Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	B4DRN0|Q6N0A5|Q6P9C3|Q8WXR9	Missense_Mutation	SNP	pfam_Frizzled,pfam_Frizzled_dom,superfamily_Frizzled_dom,smart_Frizzled_dom,pfscan_Frizzled_dom,pfscan_GPCR_2-like,prints_Frizzled	p.R228T	ENST00000358755.4	37	c.683	CCDS6298.1	8	.	.	.	.	.	.	.	.	.	.	G	22.3	4.276304	0.80580	.	.	ENSG00000164930	ENST00000522566;ENST00000358755;ENST00000523739;ENST00000539487	D;D;D	0.83673	-1.75;-1.75;-1.75	5.6	5.6	0.85130	GPCR, family 2-like (1);	0.000000	0.85682	D	0.000000	D	0.92424	0.7595	M	0.85630	2.765	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.998;0.998;0.998	D	0.93073	0.6484	10	0.87932	D	0	.	19.6086	0.95589	0.0:0.0:1.0:0.0	.	173;228;228	B4E236;B2R9H9;O60353	.;.;FZD6_HUMAN	T	228;228;196;173	ENSP00000429055:R228T;ENSP00000351605:R228T;ENSP00000429528:R196T	ENSP00000351605:R228T	R	+	2	0	FZD6	104406193	1.000000	0.71417	1.000000	0.80357	0.978000	0.69477	9.869000	0.99810	2.640000	0.89533	0.491000	0.48974	AGA	FZD6	-	pfam_Frizzled,pfscan_GPCR_2-like		0.338	FZD6-201	KNOWN	basic|appris_principal|CCDS	protein_coding	FZD6	HGNC	protein_coding	OTTHUMT00000380560.1	G	NM_003506		104337017	+1	no_errors	ENST00000358755	ensembl	human	known	70_37	missense	SNP	1.000	C
GIP	2695	genome.wustl.edu	37	17	47044545	47044545	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:47044545G>A	ENST00000357424.2	-	2	150	c.50C>T	c.(49-51)gCa>gTa	p.A17V		NM_004123.2	NP_004114.1	P09681	GIP_HUMAN	gastric inhibitory polypeptide	17					adult locomotory behavior (GO:0008344)|cellular protein metabolic process (GO:0044267)|digestive system development (GO:0055123)|endocrine pancreas development (GO:0031018)|exploration behavior (GO:0035640)|female pregnancy (GO:0007565)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|positive regulation of cAMP-mediated signaling (GO:0043950)|positive regulation of glucagon secretion (GO:0070094)|positive regulation of glucose transport (GO:0010828)|positive regulation of insulin secretion (GO:0032024)|regulation of insulin secretion (GO:0050796)|response to amino acid (GO:0043200)|response to axon injury (GO:0048678)|response to drug (GO:0042493)|response to glucose (GO:0009749)|response to lipid (GO:0033993)|response to organic cyclic compound (GO:0014070)|response to peptide hormone (GO:0043434)|response to selenium ion (GO:0010269)|response to starvation (GO:0042594)|sensory perception of pain (GO:0019233)|signal transduction (GO:0007165)|triglyceride homeostasis (GO:0070328)	endoplasmic reticulum lumen (GO:0005788)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|neuronal cell body (GO:0043025)|secretory granule lumen (GO:0034774)	hormone activity (GO:0005179)			lung(2)|skin(1)|stomach(1)	4						TAGTCCCACTGCCAGGAACAG	0.522																																																	0													117.0	108.0	111.0					17																	47044545		2203	4300	6503	SO:0001583	missense	2695				CCDS11542.1	17q21.3-q22	2013-02-26			ENSG00000159224	ENSG00000159224		"""Endogenous ligands"""	4270	protein-coding gene	gene with protein product	"""glucose-dependent insulinotropic polypeptide"""	137240				2739653	Standard	NM_004123		Approved		uc002iol.1	P09681	OTTHUMG00000161171	ENST00000357424.2:c.50C>T	17.37:g.47044545G>A	ENSP00000350005:p.Ala17Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q4VB42|Q6NTD3	Missense_Mutation	SNP	pfam_Glucagon_GIP_secretin_VIP,smart_Glucagon_GIP_secretin_VIP	p.A17V	ENST00000357424.2	37	c.50	CCDS11542.1	17	.	.	.	.	.	.	.	.	.	.	G	13.07	2.128353	0.37533	.	.	ENSG00000159224	ENST00000357424	T	0.28454	1.61	5.15	4.16	0.48862	.	0.125926	0.36815	N	0.002389	T	0.17408	0.0418	N	0.14661	0.345	0.32542	N	0.533542	D	0.56968	0.978	P	0.47134	0.539	T	0.04635	-1.0937	10	0.02654	T	1	-6.1934	9.8287	0.40928	0.0955:0.0:0.9045:0.0	.	17	P09681	GIP_HUMAN	V	17	ENSP00000350005:A17V	ENSP00000350005:A17V	A	-	2	0	GIP	44399544	0.954000	0.32549	0.968000	0.41197	0.882000	0.50991	1.561000	0.36342	2.680000	0.91292	0.643000	0.83706	GCA	GIP	-	NULL		0.522	GIP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GIP	HGNC	protein_coding	OTTHUMT00000364044.1	G	NM_004123		47044545	-1	no_errors	ENST00000357424	ensembl	human	known	70_37	missense	SNP	0.923	A
COLGALT2	23127	genome.wustl.edu	37	1	183914630	183914630	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:183914630G>A	ENST00000361927.4	-	9	1576	c.1205C>T	c.(1204-1206)tCc>tTc	p.S402F	COLGALT2_ENST00000367521.1_Missense_Mutation_p.S10F|COLGALT2_ENST00000367520.3_Missense_Mutation_p.S139F|COLGALT2_ENST00000546159.1_Missense_Mutation_p.S402F	NM_015101.2	NP_055916.1	Q8IYK4	GT252_HUMAN	collagen beta(1-O)galactosyltransferase 2	402					extracellular matrix organization (GO:0030198)|lipopolysaccharide biosynthetic process (GO:0009103)	endoplasmic reticulum lumen (GO:0005788)	procollagen galactosyltransferase activity (GO:0050211)										AGGCCTGGAGGAATAGGGATC	0.448																																																	0													151.0	147.0	148.0					1																	183914630		2203	4300	6503	SO:0001583	missense	23127			AF288389	CCDS1360.1	1q25	2013-02-27	2013-02-27	2013-02-27	ENSG00000198756	ENSG00000198756			16790	protein-coding gene	gene with protein product			"""chromosome 1 open reading frame 17"", ""glycosyltransferase 25 domain containing 2"""	C1orf17, GLT25D2		19075007	Standard	XM_005245008		Approved	KIAA0584	uc001gqr.3	Q8IYK4	OTTHUMG00000035460	ENST00000361927.4:c.1205C>T	1.37:g.183914630G>A	ENSP00000354960:p.Ser402Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	O60327|Q9BZR0	Missense_Mutation	SNP	pfam_Glyco_trans_25	p.S402F	ENST00000361927.4	37	c.1205	CCDS1360.1	1	.	.	.	.	.	.	.	.	.	.	G	22.4	4.285964	0.80803	.	.	ENSG00000198756	ENST00000546159;ENST00000361927;ENST00000367521;ENST00000367520	T;T	0.77620	-1.1;-1.11	5.39	5.39	0.77823	.	0.000000	0.85682	D	0.000000	D	0.85379	0.5683	M	0.63843	1.955	0.80722	D	1	D;D;D	0.65815	0.995;0.969;0.992	P;D;D	0.66497	0.83;0.917;0.944	T	0.81446	-0.0929	10	0.19590	T	0.45	.	19.1449	0.93461	0.0:0.0:1.0:0.0	.	402;402;139	F5H3T5;Q8IYK4;Q5SXQ3	.;GT252_HUMAN;.	F	402;402;10;139	ENSP00000439112:S402F;ENSP00000354960:S402F	ENSP00000354960:S402F	S	-	2	0	GLT25D2	182181253	1.000000	0.71417	1.000000	0.80357	0.969000	0.65631	5.013000	0.64023	2.525000	0.85131	0.557000	0.71058	TCC	GLT25D2	-	pfam_Glyco_trans_25		0.448	COLGALT2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GLT25D2	HGNC	protein_coding	OTTHUMT00000086128.1	G	NM_015101		183914630	-1	no_errors	ENST00000361927	ensembl	human	known	70_37	missense	SNP	1.000	A
GPR20	2843	genome.wustl.edu	37	8	142367933	142367933	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:142367933C>T	ENST00000377741.3	-	2	181	c.91G>A	c.(91-93)Gag>Aag	p.E31K	CTD-3064M3.3_ENST00000562459.1_RNA	NM_005293.2	NP_005284.2	Q99678	GPR20_HUMAN	G protein-coupled receptor 20	31					G-protein coupled receptor signaling pathway (GO:0007186)	integral component of plasma membrane (GO:0005887)|receptor complex (GO:0043235)	G-protein coupled receptor activity (GO:0004930)			NS(1)|endometrium(3)|lung(4)|ovary(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)	15	all_cancers(97;4.32e-16)|all_epithelial(106;6.61e-14)|Lung NSC(106;9.4e-06)|all_lung(105;1.35e-05)|Ovarian(258;0.0303)|Acute lymphoblastic leukemia(118;0.155)		BRCA - Breast invasive adenocarcinoma(115;0.0415)			AGGGGCACCTCCAGCCCGCTG	0.682																																																	0													45.0	44.0	45.0					8																	142367933		2203	4300	6503	SO:0001583	missense	2843			U66579	CCDS34949.1	8q24.3	2012-08-21				ENSG00000204882		"""GPCR / Class A : Orphans"""	4475	protein-coding gene	gene with protein product		601908				18347022	Standard	NM_005293		Approved		uc003ywf.3	Q99678		ENST00000377741.3:c.91G>A	8.37:g.142367933C>T	ENSP00000366970:p.Glu31Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17R96	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn	p.E31K	ENST00000377741.3	37	c.91	CCDS34949.1	8	.	.	.	.	.	.	.	.	.	.	C	12.25	1.882514	0.33255	.	.	ENSG00000204882	ENST00000377741	T	0.60797	0.16	3.68	3.68	0.42216	.	0.572132	0.15765	N	0.245738	T	0.39118	0.1066	L	0.27053	0.805	0.36044	D	0.840314	B	0.30482	0.281	B	0.24974	0.057	T	0.37126	-0.9719	10	0.07175	T	0.84	-8.6862	13.2571	0.60085	0.0:1.0:0.0:0.0	.	31	Q99678	GPR20_HUMAN	K	31	ENSP00000366970:E31K	ENSP00000366970:E31K	E	-	1	0	GPR20	142437115	0.120000	0.22244	0.034000	0.17996	0.087000	0.18053	2.836000	0.48183	1.766000	0.52107	0.561000	0.74099	GAG	GPR20	-	NULL		0.682	GPR20-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR20	HGNC	protein_coding	OTTHUMT00000378968.1	C	NM_005293		142367933	-1	no_errors	ENST00000377741	ensembl	human	known	70_37	missense	SNP	0.809	T
GPR37	2861	genome.wustl.edu	37	7	124386638	124386638	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:124386638G>T	ENST00000303921.2	-	2	2433	c.1783C>A	c.(1783-1785)Cct>Act	p.P595T		NM_005302.3	NP_005293.1	O15354	GPR37_HUMAN	G protein-coupled receptor 37 (endothelin receptor type B-like)	595					dopamine biosynthetic process (GO:0042416)|G-protein coupled receptor signaling pathway (GO:0007186)|locomotion involved in locomotory behavior (GO:0031987)|positive regulation of dopamine metabolic process (GO:0045964)	endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)|ubiquitin ligase complex (GO:0000151)	G-protein coupled receptor activity (GO:0004930)|heat shock protein binding (GO:0031072)|Hsp70 protein binding (GO:0030544)|ubiquitin protein ligase binding (GO:0031625)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(5)|large_intestine(8)|lung(11)|ovary(2)|prostate(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36						GTACTGAAAGGCGAGAGTTCG	0.463																																																	0													186.0	161.0	170.0					7																	124386638		2203	4300	6503	SO:0001583	missense	2861				CCDS5792.1	7q31	2012-08-21			ENSG00000170775	ENSG00000170775		"""GPCR / Class A : Orphans"""	4494	protein-coding gene	gene with protein product		602583				9339362	Standard	NM_005302		Approved	EDNRBL, hET(B)R-LP, PAELR	uc003vli.4	O15354	OTTHUMG00000157197	ENST00000303921.2:c.1783C>A	7.37:g.124386638G>T	ENSP00000306449:p.Pro595Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D0Y6|O00348|O14768|Q8TD39	Missense_Mutation	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPR37_rcpt,prints_GPCR_Rhodpsn	p.P595T	ENST00000303921.2	37	c.1783	CCDS5792.1	7	.	.	.	.	.	.	.	.	.	.	G	12.90	2.076368	0.36662	.	.	ENSG00000170775	ENST00000303921	T	0.70869	-0.52	5.35	5.35	0.76521	.	0.000000	0.56097	D	0.000023	T	0.61337	0.2339	L	0.29908	0.895	0.80722	D	1	P	0.41597	0.756	B	0.38842	0.283	T	0.62053	-0.6935	10	0.33940	T	0.23	-19.7394	18.0541	0.89358	0.0:0.0:1.0:0.0	.	595	O15354	GPR37_HUMAN	T	595	ENSP00000306449:P595T	ENSP00000306449:P595T	P	-	1	0	GPR37	124173874	1.000000	0.71417	0.657000	0.29651	0.545000	0.35147	9.230000	0.95299	2.489000	0.83994	0.655000	0.94253	CCT	GPR37	-	NULL		0.463	GPR37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	GPR37	HGNC	protein_coding	OTTHUMT00000347873.1	G	NM_005302		124386638	-1	no_errors	ENST00000303921	ensembl	human	known	70_37	missense	SNP	0.999	T
GRIA2	2891	genome.wustl.edu	37	4	158242732	158242732	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr4:158242732C>T	ENST00000264426.9	+	6	1142	c.863C>T	c.(862-864)gCt>gTt	p.A288V	GRIA2_ENST00000393815.2_Missense_Mutation_p.A241V|GRIA2_ENST00000449365.1_Missense_Mutation_p.A241V|GRIA2_ENST00000507898.1_Missense_Mutation_p.A241V|GRIA2_ENST00000296526.7_Missense_Mutation_p.A288V	NM_001083619.1	NP_001077088	P42262	GRIA2_HUMAN	glutamate receptor, ionotropic, AMPA 2	288					ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|signal transduction (GO:0007165)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|endoplasmic reticulum (GO:0005783)|integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)|synaptic vesicle (GO:0008021)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)|ionotropic glutamate receptor activity (GO:0004970)			NS(1)|breast(2)|central_nervous_system(3)|endometrium(5)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(16)|liver(2)|lung(32)|ovary(3)|prostate(3)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	79	all_hematologic(180;0.24)	Renal(120;0.0458)		COAD - Colon adenocarcinoma(41;0.0294)	Amobarbital(DB01351)|Aprobarbital(DB01352)|Butabarbital(DB00237)|Butalbital(DB00241)|Butethal(DB01353)|Heptabarbital(DB01354)|Hexobarbital(DB01355)|Methylphenobarbital(DB00849)|Pentobarbital(DB00312)|Phenobarbital(DB01174)|Primidone(DB00794)|Quinidine barbiturate(DB01346)|Secobarbital(DB00418)|Talbutal(DB00306)|Thiopental(DB00599)	TACCCTGGAGCTCACACAACA	0.373																																																	0													115.0	124.0	121.0					4																	158242732		2203	4300	6503	SO:0001583	missense	2891				CCDS3797.1, CCDS43274.1, CCDS43275.1	4q32.1	2012-08-29			ENSG00000120251	ENSG00000120251		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4572	protein-coding gene	gene with protein product		138247		GLUR2		1311100	Standard	NM_001083619		Approved	GluA2, GLURB	uc003ipl.4	P42262	OTTHUMG00000133836	ENST00000264426.9:c.863C>T	4.37:g.158242732C>T	ENSP00000264426:p.Ala288Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MT92|I6L997|Q96FP6	Missense_Mutation	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.A288V	ENST00000264426.9	37	c.863	CCDS43274.1	4	.	.	.	.	.	.	.	.	.	.	C	22.8	4.343338	0.82022	.	.	ENSG00000120251	ENST00000507898;ENST00000393815;ENST00000296526;ENST00000264426;ENST00000449365	D;D;D;D;D	0.83755	-1.76;-1.76;-1.76;-1.76;-1.76	5.46	5.46	0.80206	Extracellular ligand-binding receptor (1);	0.000000	0.85682	D	0.000000	D	0.88385	0.6422	L	0.49640	1.575	0.80722	D	1	D;D;D	0.89917	0.999;1.0;1.0	P;P;D	0.80764	0.901;0.855;0.994	D	0.84472	0.0600	10	0.18710	T	0.47	.	19.2964	0.94124	0.0:1.0:0.0:0.0	.	288;288;241	P42262;P42262-2;A8MT92	GRIA2_HUMAN;.;.	V	241;241;288;288;241	ENSP00000426845:A241V;ENSP00000377403:A241V;ENSP00000296526:A288V;ENSP00000264426:A288V;ENSP00000389837:A241V	ENSP00000264426:A288V	A	+	2	0	GRIA2	158462182	1.000000	0.71417	0.997000	0.53966	0.941000	0.58515	7.306000	0.78905	2.549000	0.85964	0.591000	0.81541	GCT	GRIA2	-	pfam_ANF_lig-bd_rcpt		0.373	GRIA2-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA2	HGNC	protein_coding	OTTHUMT00000258367.2	C			158242732	+1	no_errors	ENST00000264426	ensembl	human	known	70_37	missense	SNP	1.000	T
GRIA3	2892	genome.wustl.edu	37	X	122319787	122319787	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:122319787G>A	ENST00000371251.1	+	2	265	c.213G>A	c.(211-213)ttG>ttA	p.L71L	GRIA3_ENST00000371256.5_Silent_p.L71L|GRIA3_ENST00000264357.5_Silent_p.L71L|GRIA3_ENST00000371264.3_Silent_p.L71L|GRIA3_ENST00000542149.1_Silent_p.L71L|GRIA3_ENST00000541091.1_Silent_p.L55L|GRIA3_ENST00000479118.1_3'UTR|GRIA3_ENST00000371266.1_Silent_p.L71L			P42263	GRIA3_HUMAN	glutamate receptor, ionotropic, AMPA 3	71					glutamate receptor signaling pathway (GO:0007215)|ion transmembrane transport (GO:0034220)|ionotropic glutamate receptor signaling pathway (GO:0035235)|synaptic transmission (GO:0007268)|synaptic transmission, glutamatergic (GO:0035249)|transport (GO:0006810)	alpha-amino-3-hydroxy-5-methyl-4-isoxazolepropionic acid selective glutamate receptor complex (GO:0032281)|cell junction (GO:0030054)|dendrite (GO:0030425)|endocytic vesicle membrane (GO:0030666)|plasma membrane (GO:0005886)|postsynaptic membrane (GO:0045211)	alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate selective glutamate receptor activity (GO:0004971)|extracellular-glutamate-gated ion channel activity (GO:0005234)			breast(2)|central_nervous_system(1)|endometrium(8)|kidney(3)|large_intestine(8)|lung(25)|ovary(3)|pancreas(2)|skin(2)|soft_tissue(1)|stomach(1)|upper_aerodigestive_tract(1)	57					Lithium(DB01356)	CCTTCCATTTGAATTACCACG	0.473																																																	0													175.0	134.0	148.0					X																	122319787		2203	4300	6503	SO:0001819	synonymous_variant	2892			U10301	CCDS14604.1, CCDS14605.1, CCDS76017.1	Xq25	2012-08-29	2012-02-03		ENSG00000125675	ENSG00000125675		"""Ligand-gated ion channels / Glutamate receptors, ionotropic"", ""Glutamate receptors"""	4573	protein-coding gene	gene with protein product		305915	"""glutamate receptor, ionotrophic, AMPA 3"""	GLUR3		1319477, 10644433	Standard	NM_007325		Approved	GluA3, GLURC, MRX94	uc004etr.4	P42263	OTTHUMG00000022685	ENST00000371251.1:c.213G>A	X.37:g.122319787G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DTF1|Q4VXD5|Q4VXD6|Q9HDA0|Q9HDA1|Q9HDA2|Q9P0H1	Silent	SNP	pfam_Iontro_glu_rcpt,pfam_ANF_lig-bd_rcpt,pfam_Glu_rcpt_Glu/Gly-bd,pfam_SBP_bac_3,smart_Iontro_glu_rcpt,smart_Glu_rcpt_Glu/Gly-bd,prints_NMDA_rcpt	p.L71	ENST00000371251.1	37	c.213	CCDS14604.1	X																																																																																			GRIA3	-	pfam_ANF_lig-bd_rcpt		0.473	GRIA3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	GRIA3	HGNC	protein_coding	OTTHUMT00000058854.1	G	NM_000828		122319787	+1	no_errors	ENST00000264357	ensembl	human	known	70_37	silent	SNP	1.000	A
HEXIM1	10614	genome.wustl.edu	37	17	43226812	43226812	+	Silent	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:43226812G>C	ENST00000332499.2	+	1	2129	c.255G>C	c.(253-255)ctG>ctC	p.L85L	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	85					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						CTAGCTGCCTGAGAGAGGGCG	0.692											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													16.0	19.0	18.0					17																	43226812		2201	4299	6500	SO:0001819	synonymous_variant	10614			AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.255G>C	17.37:g.43226812G>C		Somatic	914	WXS	Illumina HiSeq	Phase_IV	B2R8Y5	Silent	SNP	NULL	p.L85	ENST00000332499.2	37	c.255	CCDS11495.1	17																																																																																			HEXIM1	-	NULL		0.692	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXIM1	HGNC	protein_coding	OTTHUMT00000449821.2	G	NM_006460		43226812	+1	no_errors	ENST00000332499	ensembl	human	known	70_37	silent	SNP	0.705	C
HEXIM1	10614	genome.wustl.edu	37	17	43226833	43226833	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:43226833G>C	ENST00000332499.2	+	1	2150	c.276G>C	c.(274-276)caG>caC	p.Q92H	AC002117.1_ENST00000452741.1_RNA|AC002117.1_ENST00000589950.1_RNA	NM_006460.2	NP_006451.1	O94992	HEXI1_HUMAN	hexamethylene bis-acetamide inducible 1	92					heart development (GO:0007507)|negative regulation of cyclin-dependent protein serine/threonine kinase activity (GO:0045736)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|negative regulation of transcription, DNA-templated (GO:0045892)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	cyclin-dependent protein serine/threonine kinase inhibitor activity (GO:0004861)|snRNA binding (GO:0017069)			breast(1)|kidney(2)|lung(3)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	11						AGAAGGGCCAGAATGGGGACG	0.682											OREG0024474	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													13.0	15.0	14.0					17																	43226833		2197	4297	6494	SO:0001583	missense	10614			AB021179	CCDS11495.1	17q21.31	2006-03-28				ENSG00000186834			24953	protein-coding gene	gene with protein product		607328				12119119, 12832472	Standard	NM_006460		Approved	CLP-1, HIS1, MAQ1, EDG1	uc002iig.3	O94992		ENST00000332499.2:c.276G>C	17.37:g.43226833G>C	ENSP00000328773:p.Gln92His	Somatic	914	WXS	Illumina HiSeq	Phase_IV	B2R8Y5	Missense_Mutation	SNP	NULL	p.Q92H	ENST00000332499.2	37	c.276	CCDS11495.1	17	.	.	.	.	.	.	.	.	.	.	G	10.14	1.267419	0.23136	.	.	ENSG00000186834	ENST00000332499	.	.	.	3.98	3.0	0.34707	.	1.197490	0.06193	N	0.681785	T	0.39545	0.1082	L	0.44542	1.39	0.28905	N	0.893052	B	0.02656	0.0	B	0.06405	0.002	T	0.31724	-0.9933	9	0.15499	T	0.54	-8.3343	8.7558	0.34645	0.0:0.0:0.774:0.226	.	92	O94992	HEXI1_HUMAN	H	92	.	ENSP00000328773:Q92H	Q	+	3	2	HEXIM1	40582616	0.998000	0.40836	1.000000	0.80357	0.823000	0.46562	1.856000	0.39389	0.887000	0.36136	0.561000	0.74099	CAG	HEXIM1	-	NULL		0.682	HEXIM1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HEXIM1	HGNC	protein_coding	OTTHUMT00000449821.2	G	NM_006460		43226833	+1	no_errors	ENST00000332499	ensembl	human	known	70_37	missense	SNP	1.000	C
HIVEP2	3097	genome.wustl.edu	37	6	143092438	143092438	+	Silent	SNP	C	C	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:143092438C>A	ENST00000367604.1	-	4	4077	c.3438G>T	c.(3436-3438)ctG>ctT	p.L1146L	HIVEP2_ENST00000012134.2_Silent_p.L1146L|HIVEP2_ENST00000367603.2_Silent_p.L1146L			P31629	ZEP2_HUMAN	human immunodeficiency virus type I enhancer binding protein 2	1146					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(4)|central_nervous_system(6)|endometrium(7)|haematopoietic_and_lymphoid_tissue(2)|kidney(7)|large_intestine(19)|lung(35)|ovary(4)|prostate(6)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	100				OV - Ovarian serous cystadenocarcinoma(155;1.61e-05)|GBM - Glioblastoma multiforme(68;0.0102)		GCCCCGAGCTCAGCGGGGGAC	0.607																																					Esophageal Squamous(107;843 1510 13293 16805 42198)												0													48.0	54.0	52.0					6																	143092438		2011	4187	6198	SO:0001819	synonymous_variant	3097			M60119	CCDS43510.1	6q23-q24	2013-01-08	2001-11-28		ENSG00000010818	ENSG00000010818		"""Zinc fingers, C2H2-type"""	4921	protein-coding gene	gene with protein product	"""c-myc intron binding protein 1"""	143054	"""human immunodeficiency virus type I enhancer-binding protein 2"""			1733857, 2022670	Standard	NM_006734		Approved	MBP-2, HIV-EP2, MIBP1, ZAS2, Schnurri-2, ZNF40B	uc003qjd.3	P31629	OTTHUMG00000015713	ENST00000367604.1:c.3438G>T	6.37:g.143092438C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q02646|Q5THT5|Q9NS05	Silent	SNP	pfam_Znf_C2H2,pfam_Znf_C2H2_jaz,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.L1146	ENST00000367604.1	37	c.3438	CCDS43510.1	6																																																																																			HIVEP2	-	NULL		0.607	HIVEP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HIVEP2	HGNC	protein_coding	OTTHUMT00000042495.1	C			143092438	-1	no_errors	ENST00000012134	ensembl	human	known	70_37	silent	SNP	0.067	A
HNRNPR	10236	genome.wustl.edu	37	1	23667363	23667363	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:23667363C>G	ENST00000374612.1	-	2	262	c.139G>C	c.(139-141)Gat>Cat	p.D47H	HNRNPR_ENST00000302271.6_Missense_Mutation_p.D47H|HNRNPR_ENST00000478691.1_Intron|HNRNPR_ENST00000606561.1_Intron|HNRNPR_ENST00000426846.2_Intron|HNRNPR_ENST00000427764.2_Missense_Mutation_p.D47H|HNRNPR_ENST00000374616.3_Missense_Mutation_p.D47H	NM_001102398.1|NM_005826.3	NP_001095868.1|NP_005817.1	O43390	HNRPR_HUMAN	heterogeneous nuclear ribonucleoprotein R	47	Asp/Glu-rich (acidic).				gene expression (GO:0010467)|mRNA processing (GO:0006397)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	catalytic step 2 spliceosome (GO:0071013)|cytoplasm (GO:0005737)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|ribonucleoprotein complex (GO:0030529)|spliceosomal complex (GO:0005681)	nucleotide binding (GO:0000166)|poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)			endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(1)|lung(8)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	19		Colorectal(325;3.46e-05)|Lung NSC(340;4.15e-05)|all_lung(284;6.64e-05)|Renal(390;0.000219)|Breast(348;0.00394)|Ovarian(437;0.00539)|Myeloproliferative disorder(586;0.0255)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0228)|OV - Ovarian serous cystadenocarcinoma(117;6.83e-27)|Colorectal(126;6.01e-08)|COAD - Colon adenocarcinoma(152;3.32e-06)|GBM - Glioblastoma multiforme(114;6.69e-05)|BRCA - Breast invasive adenocarcinoma(304;0.00101)|KIRC - Kidney renal clear cell carcinoma(1967;0.00357)|STAD - Stomach adenocarcinoma(196;0.0131)|READ - Rectum adenocarcinoma(331;0.0649)|Lung(427;0.0875)|LUSC - Lung squamous cell carcinoma(448;0.19)		AATATTTCATCAAGTCTTTCT	0.383																																																	0													234.0	211.0	219.0					1																	23667363		2203	4300	6503	SO:0001583	missense	10236			AF000364	CCDS232.1, CCDS44085.1, CCDS60020.1, CCDS72726.1, CCDS72727.1	1p36.12	2013-02-12		2007-08-16	ENSG00000125944	ENSG00000125944		"""RNA binding motif (RRM) containing"""	5047	protein-coding gene	gene with protein product		607201		HNRPR		9421497	Standard	XM_005245711		Approved	hnRNP-R	uc001bgp.4	O43390	OTTHUMG00000003224	ENST00000374612.1:c.139G>C	1.37:g.23667363C>G	ENSP00000363741:p.Asp47His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2L7G6|Q5TEH1|Q9BV64|S4R3J4	Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom,tigrfam_HnRNP_R/Q_splicing_fac	p.D47H	ENST00000374612.1	37	c.139	CCDS232.1	1	.	.	.	.	.	.	.	.	.	.	C	15.45	2.837663	0.50951	.	.	ENSG00000125944	ENST00000374616;ENST00000374612;ENST00000302271;ENST00000427764	T;T;T;T	0.22743	1.94;1.94;1.94;2.14	5.93	5.93	0.95920	.	0.112513	0.64402	D	0.000003	T	0.48537	0.1505	M	0.73430	2.235	0.80722	D	1	D;B;P	0.71674	0.998;0.353;0.819	D;B;P	0.70487	0.969;0.179;0.614	T	0.31364	-0.9946	10	0.46703	T	0.11	-5.5691	18.9006	0.92440	0.0:1.0:0.0:0.0	.	47;47;47	Q2L7G6;O43390;O43390-2	.;HNRPR_HUMAN;.	H	47	ENSP00000363745:D47H;ENSP00000363741:D47H;ENSP00000304405:D47H;ENSP00000392799:D47H	ENSP00000304405:D47H	D	-	1	0	HNRNPR	23539950	1.000000	0.71417	1.000000	0.80357	0.999000	0.98932	6.007000	0.70731	2.805000	0.96524	0.655000	0.94253	GAT	HNRNPR	-	NULL		0.383	HNRNPR-003	KNOWN	alternative_5_UTR|basic|appris_candidate|CCDS	protein_coding	HNRNPR	HGNC	protein_coding	OTTHUMT00000008889.1	C	NM_005826		23667363	-1	no_errors	ENST00000374616	ensembl	human	known	70_37	missense	SNP	1.000	G
HIVEP3	59269	genome.wustl.edu	37	1	42048469	42048469	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:42048469G>C	ENST00000372583.1	-	4	2885	c.2000C>G	c.(1999-2001)tCa>tGa	p.S667*	HIVEP3_ENST00000429157.2_Nonsense_Mutation_p.S667*|HIVEP3_ENST00000372584.1_Nonsense_Mutation_p.S667*|HIVEP3_ENST00000460604.1_5'Flank|HIVEP3_ENST00000247584.5_Nonsense_Mutation_p.S667*	NM_024503.4	NP_078779.2	Q5T1R4	ZEP3_HUMAN	human immunodeficiency virus type I enhancer binding protein 3	667	No DNA binding activity or transactivation activity, but complete prevention of TRAF-dependent NF-Kappa-B activation; associates with TRAF2 and JUN. {ECO:0000250}.				positive regulation of transcription, DNA-templated (GO:0045893)|skeletal muscle cell differentiation (GO:0035914)|transcription, DNA-templated (GO:0006351)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			NS(2)|breast(3)|central_nervous_system(5)|endometrium(13)|kidney(3)|large_intestine(13)|lung(33)|ovary(4)|prostate(5)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	85	Ovarian(52;0.00769)|all_hematologic(146;0.109)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0367)				CTGAAGCTCTGAGCAGTAGTA	0.458																																																	0													122.0	124.0	123.0					1																	42048469		2203	4300	6503	SO:0001587	stop_gained	59269			AF278765	CCDS463.1, CCDS44124.1	1p34	2013-01-08	2001-11-28		ENSG00000127124	ENSG00000127124		"""Zinc fingers, C2H2-type"""	13561	protein-coding gene	gene with protein product	"""kappabinding protein-1"""	606649	"""human immunodeficiency virus type I enhancer-binding protein 3"""			11161801	Standard	NR_038260		Approved	KRC, KBP1, KBP-1, SHN3, FLJ16752, KIAA1555, ZAS3, Schnurri-3, ZNF40C	uc001cha.4	Q5T1R4	OTTHUMG00000006361	ENST00000372583.1:c.2000C>G	1.37:g.42048469G>C	ENSP00000361664:p.Ser667*	Somatic		WXS	Illumina HiSeq	Phase_IV	A7YY91|Q5T1R5|Q9BZS0|Q9HCL7	Nonsense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.S667*	ENST00000372583.1	37	c.2000	CCDS463.1	1	.	.	.	.	.	.	.	.	.	.	G	46	12.731818	0.99692	.	.	ENSG00000127124	ENST00000372584;ENST00000372583;ENST00000247584;ENST00000429157	.	.	.	4.47	4.47	0.54385	.	0.000000	0.44097	D	0.000497	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.72032	D	0.01	0.538	16.914	0.86147	0.0:0.0:1.0:0.0	.	.	.	.	X	667	.	ENSP00000247584:S667X	S	-	2	0	HIVEP3	41821056	1.000000	0.71417	0.990000	0.47175	0.924000	0.55760	7.098000	0.76974	2.326000	0.78906	0.555000	0.69702	TCA	HIVEP3	-	pfscan_Znf_C2H2		0.458	HIVEP3-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	HIVEP3	HGNC	protein_coding	OTTHUMT00000016978.1	G	NM_024503		42048469	-1	no_errors	ENST00000247584	ensembl	human	known	70_37	nonsense	SNP	1.000	C
HOXA4	3201	genome.wustl.edu	37	7	27169114	27169114	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:27169114C>T	ENST00000360046.5	-	2	758	c.693G>A	c.(691-693)gaG>gaA	p.E231E	HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA-AS2_ENST00000521687.1_RNA|HOXA3_ENST00000521401.1_Intron|RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000317201.2_5'Flank|HOXA4_ENST00000428284.2_Silent_p.E231E|HOXA-AS2_ENST00000521159.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	231					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						GGAACTCCTTCTCCAGCTCCA	0.567																																																	0													101.0	96.0	98.0					7																	27169114		2203	4300	6503	SO:0001819	synonymous_variant	3201				CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.693G>A	7.37:g.27169114C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4D180|O43366	Missense_Mutation	SNP	NULL	p.R31K	ENST00000360046.5	37	c.92	CCDS5405.1	7	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.26|15.26	2.781318|2.781318	0.49891|0.49891	.|.	.|.	ENSG00000197576|ENSG00000197576	ENST00000511914|ENST00000548581	D|.	0.97575|.	-4.44|.	5.29|5.29	5.29|5.29	0.74685|0.74685	.|.	0.000000|.	0.53938|.	D|.	0.000048|.	T|T	0.74981|0.74981	0.3788|0.3788	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	T|T	0.73830|0.73830	-0.3859|-0.3859	7|4	0.87932|.	D|.	0|.	.|.	18.9816|18.9816	0.92757|0.92757	0.0:1.0:0.0:0.0|0.0:1.0:0.0:0.0	.|.	.|.	.|.	.|.	K|K	51|31	ENSP00000448015:E51K|.	ENSP00000448015:E51K|.	E|R	-|-	1|2	0|0	HOXA4|HOXA4	27135639|27135639	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	5.967000|5.967000	0.70403|0.70403	2.485000|2.485000	0.83878|0.83878	0.555000|0.555000	0.69702|0.69702	GAA|AGA	HOXA4	-	NULL		0.567	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA4	HGNC	protein_coding	OTTHUMT00000059534.4	C			27169114	-1	no_errors	ENST00000548581	ensembl	human	putative	70_37	missense	SNP	1.000	T
HOXA4	3201	genome.wustl.edu	37	7	27169123	27169123	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:27169123C>G	ENST00000360046.5	-	2	749	c.684G>C	c.(682-684)ttG>ttC	p.L228F	HOXA-AS3_ENST00000518848.1_RNA|HOXA-AS2_ENST00000517550.1_RNA|HOXA-AS2_ENST00000521687.1_RNA|HOXA3_ENST00000521401.1_Intron|RP1-170O19.22_ENST00000467897.2_RNA|HOXA3_ENST00000317201.2_5'Flank|HOXA4_ENST00000428284.2_Missense_Mutation_p.L228F|HOXA-AS2_ENST00000521159.1_RNA	NM_002141.4	NP_002132.3	Q00056	HXA4_HUMAN	homeobox A4	228					anatomical structure morphogenesis (GO:0009653)|anterior/posterior pattern specification (GO:0009952)|embryonic skeletal system morphogenesis (GO:0048704)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)			breast(1)|cervix(1)|endometrium(1)|large_intestine(3)|lung(6)	12						TCTCCAGCTCCAAGACCTGCT	0.572																																																	0													92.0	89.0	90.0					7																	27169123		2203	4300	6503	SO:0001583	missense	3201				CCDS5405.1	7p15.2	2011-06-20	2005-12-22		ENSG00000197576	ENSG00000197576		"""Homeoboxes / ANTP class : HOXL subclass"""	5105	protein-coding gene	gene with protein product		142953	"""homeo box A4"""	HOX1D, HOX1		1973146, 1358459	Standard	NM_002141		Approved		uc003sym.4	Q00056	OTTHUMG00000023213	ENST00000360046.5:c.684G>C	7.37:g.27169123C>G	ENSP00000353151:p.Leu228Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	A4D180|O43366	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_metazoa,prints_Homeobox_antennapedia	p.L228F	ENST00000360046.5	37	c.684	CCDS5405.1	7	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	.|.|.	C|C|C	10.70|10.70|10.70	1.424471|1.424471|1.424471	0.25639|0.25639|0.25639	.|.|.	.|.|.	ENSG00000197576|ENSG00000197576|ENSG00000197576	ENST00000511914|ENST00000360046;ENST00000428284|ENST00000548581	.|D;D|.	.|0.96265|.	.|-3.96;-3.96|.	5.29|5.29|5.29	5.29|5.29|5.29	0.74685|0.74685|0.74685	.|Homeodomain-related (1);Homeobox (3);Homeodomain-like (1);|.	.|0.260141|.	.|0.22428|.	.|N|.	.|0.060197|.	T|T|T	0.63757|0.63757|0.63757	0.2538|0.2538|0.2538	L|L|L	0.49778|0.49778|0.49778	1.585|1.585|1.585	0.80722|0.80722|0.80722	D|D|D	1|1|1	.|D|.	.|0.76494|.	.|0.999|.	.|D|.	.|0.81914|.	.|0.995|.	T|T|T	0.66594|0.66594|0.66594	-0.5884|-0.5884|-0.5884	5|10|6	.|0.87932|0.87932	.|D|D	.|0|0	.|.|.	12.3504|12.3504|12.3504	0.55144|0.55144|0.55144	0.0:0.9225:0.0:0.0775|0.0:0.9225:0.0:0.0775|0.0:0.9225:0.0:0.0775	.|.|.	.|228|.	.|Q00056|.	.|HXA4_HUMAN|.	R|F|S	48|228|28	.|ENSP00000353151:L228F;ENSP00000408845:L228F|.	.|ENSP00000353151:L228F|ENSP00000447249:W28S	G|L|W	-|-|-	1|3|2	0|2|0	HOXA4|HOXA4|HOXA4	27135648|27135648|27135648	1.000000|1.000000|1.000000	0.71417|0.71417|0.71417	1.000000|1.000000|1.000000	0.80357|0.80357|0.80357	0.997000|0.997000|0.997000	0.91878|0.91878|0.91878	1.865000|1.865000|1.865000	0.39479|0.39479|0.39479	2.485000|2.485000|2.485000	0.83878|0.83878|0.83878	0.555000|0.555000|0.555000	0.69702|0.69702|0.69702	GGA|TTG|TGG	HOXA4	-	pfam_Homeodomain,superfamily_Homeodomain-like,smart_Homeodomain,pfscan_Homeodomain,prints_Homeobox_antennapedia		0.572	HOXA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	HOXA4	HGNC	protein_coding	OTTHUMT00000059534.4	C			27169123	-1	no_errors	ENST00000360046	ensembl	human	known	70_37	missense	SNP	1.000	G
IFT46	56912	genome.wustl.edu	37	11	118425278	118425278	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:118425278C>T	ENST00000264021.3	-	7	797	c.379G>A	c.(379-381)Gac>Aac	p.D127N	IFT46_ENST00000530872.1_Missense_Mutation_p.D178N|IFT46_ENST00000264020.2_Missense_Mutation_p.D178N	NM_001168618.1	NP_001162089.1	Q9NQC8	IFT46_HUMAN	intraflagellar transport 46	127					cilium assembly (GO:0042384)|intraciliary transport (GO:0042073)|protein stabilization (GO:0050821)|smoothened signaling pathway (GO:0007224)	centrosome (GO:0005813)|cilium (GO:0005929)|cytoplasm (GO:0005737)|intraciliary transport particle B (GO:0030992)|motile cilium (GO:0031514)|motile primary cilium (GO:0031512)	protein C-terminus binding (GO:0008022)			central_nervous_system(1)|endometrium(2)|kidney(1)|large_intestine(1)|lung(4)	9						CCAAGGTTGTCAGGCTTTCCA	0.428																																																	0													169.0	157.0	161.0					11																	118425278		2200	4295	6495	SO:0001583	missense	56912			AL136934	CCDS8399.1, CCDS53718.1	11q23.3	2014-07-18	2014-07-03	2010-04-22	ENSG00000118096	ENSG00000118096		"""Intraflagellar transport homologs"""	26146	protein-coding gene	gene with protein product	"""cilia and flagella associated protein 32"""		"""chromosome 11 open reading frame 60"", ""intraflagellar transport 46 homolog (Chlamydomonas)"""	C11orf60		10873569, 19253336	Standard	NM_020153		Approved	C11orf2, FLJ21827, CFAP32	uc001pto.2	Q9NQC8	OTTHUMG00000166408	ENST00000264021.3:c.379G>A	11.37:g.118425278C>T	ENSP00000264021:p.Asp127Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K0F6|Q9H6V5	Missense_Mutation	SNP	pfam_Intraflagellar_transp_cmplxB	p.D178N	ENST00000264021.3	37	c.532	CCDS53718.1	11	.	.	.	.	.	.	.	.	.	.	C	37	5.987871	0.97179	.	.	ENSG00000118096	ENST00000264021;ENST00000264020;ENST00000530872;ENST00000531939;ENST00000534156	T;T;T;T;T	0.56103	0.49;0.55;0.55;0.53;0.48	5.85	5.85	0.93711	.	0.047096	0.85682	D	0.000000	T	0.66742	0.2820	M	0.80508	2.5	0.80722	D	1	P;P;P	0.43701	0.815;0.549;0.554	B;B;P	0.46850	0.322;0.31;0.529	T	0.69903	-0.5019	10	0.62326	D	0.03	-10.3344	20.2346	0.98355	0.0:1.0:0.0:0.0	.	178;127;178	E9PR06;Q9NQC8;Q9NQC8-2	.;IFT46_HUMAN;.	N	127;178;178;127;127	ENSP00000264021:D127N;ENSP00000264020:D178N;ENSP00000432384:D178N;ENSP00000435826:D127N;ENSP00000434175:D127N	ENSP00000264020:D178N	D	-	1	0	IFT46	117930488	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	7.260000	0.78391	2.790000	0.95986	0.650000	0.86243	GAC	IFT46	-	pfam_Intraflagellar_transp_cmplxB		0.428	IFT46-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IFT46	HGNC	protein_coding	OTTHUMT00000389627.1	C	NM_020153		118425278	-1	no_errors	ENST00000264020	ensembl	human	known	70_37	missense	SNP	1.000	T
IGLV4-3	28786	genome.wustl.edu	37	22	23213912	23213912	+	RNA	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr22:23213912G>A	ENST00000390318.2	+	0	101									immunoglobulin lambda variable 4-3																		TGCCTGTGCTGACTCAGCCCC	0.532																																																	0													54.0	55.0	55.0					22																	23213912		2103	4216	6319			28786			X57828		22q11.2	2012-02-08			ENSG00000211672	ENSG00000211672		"""Immunoglobulins / IGL locus"""	5919	other	immunoglobulin gene							Standard	NG_000002		Approved				OTTHUMG00000151244		22.37:g.23213912G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Ig_V-set,pfam_Ig_I-set,smart_Ig_sub,smart_Ig_V-set_subgr,pfscan_Ig-like	p.L23	ENST00000390318.2	37	c.69		22																																																																																			IGLV4-3	-	pfam_Ig_V-set,pfscan_Ig-like		0.532	IGLV4-3-001	KNOWN	basic|appris_principal	IG_V_gene	IGLV4-3	HGNC	IG_V_gene	OTTHUMT00000321849.1	G	NG_000002		23213912	+1	no_errors	ENST00000390318	ensembl	human	known	70_37	silent	SNP	0.197	A
IL12A	3592	genome.wustl.edu	37	3	159710811	159710811	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:159710811C>G	ENST00000305579.2	+	3	584	c.277C>G	c.(277-279)Cta>Gta	p.L93V	IL12A_ENST00000466512.1_Missense_Mutation_p.L93V|IL12A_ENST00000480787.1_Intron|IL12A-AS1_ENST00000497452.1_RNA	NM_000882.3	NP_000873.2	P29459	IL12A_HUMAN	interleukin 12A	59					cell cycle arrest (GO:0007050)|cell migration (GO:0016477)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|extrinsic apoptotic signaling pathway (GO:0097191)|immune response (GO:0006955)|negative regulation of interleukin-17 production (GO:0032700)|negative regulation of smooth muscle cell proliferation (GO:0048662)|positive regulation of cell adhesion (GO:0045785)|positive regulation of interferon-gamma production (GO:0032729)|positive regulation of lymphocyte proliferation (GO:0050671)|positive regulation of mononuclear cell proliferation (GO:0032946)|positive regulation of natural killer cell activation (GO:0032816)|positive regulation of natural killer cell mediated cytotoxicity (GO:0045954)|positive regulation of natural killer cell mediated cytotoxicity directed against tumor cell target (GO:0002860)|positive regulation of NK T cell activation (GO:0051135)|positive regulation of smooth muscle cell apoptotic process (GO:0034393)|positive regulation of T cell differentiation (GO:0045582)|positive regulation of T cell mediated cytotoxicity (GO:0001916)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of tyrosine phosphorylation of Stat4 protein (GO:0042520)|response to lipopolysaccharide (GO:0032496)|response to UV-B (GO:0010224)|response to virus (GO:0009615)	cytoplasm (GO:0005737)|extracellular space (GO:0005615)|interleukin-12 complex (GO:0043514)	interleukin-12 beta subunit binding (GO:0042163)|interleukin-12 receptor binding (GO:0005143)|interleukin-27 binding (GO:0045513)|protein heterodimerization activity (GO:0046982)			endometrium(3)|kidney(1)|large_intestine(1)|lung(4)	9			Lung(72;0.00334)|LUSC - Lung squamous cell carcinoma(72;0.00523)			CAGACAAACTCTAGAATTTTA	0.418																																																	0													97.0	110.0	105.0					3																	159710811		2202	4300	6502	SO:0001583	missense	3592			M65271	CCDS3187.1	3q25.33	2014-04-04	2014-04-04		ENSG00000168811	ENSG00000168811		"""Interleukins and interleukin receptors"""	5969	protein-coding gene	gene with protein product	"""natural killer cell stimulatory factor 1, 35 kD subunit"", ""cytotoxic lymphocyte maturation factor 1, p35"", ""interleukin 12, p35"", ""IL-12, subunit p35"", ""NF cell stimulatory factor chain 1"", ""interleukin-12 alpha chain"", ""IL35 subunit"""	161560	"""interleukin 12A (natural killer cell stimulatory factor 1, cytotoxic lymphocyte maturation factor 1, p35)"""	NKSF1		1673147	Standard	NM_000882		Approved	CLMF, IL-12A, p35, NFSK	uc003fcx.3	P29459	OTTHUMG00000158942	ENST00000305579.2:c.277C>G	3.37:g.159710811C>G	ENSP00000303231:p.Leu93Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96QZ1	Missense_Mutation	SNP	pfam_IL12,superfamily_4_helix_cytokine-like_core	p.L93V	ENST00000305579.2	37	c.277	CCDS3187.1	3	.	.	.	.	.	.	.	.	.	.	C	10.11	1.259478	0.23051	.	.	ENSG00000168811	ENST00000305579;ENST00000466512	.	.	.	5.66	1.88	0.25563	.	0.537429	0.16667	N	0.204542	T	0.64994	0.2649	M	0.80183	2.485	0.22096	N	0.999367	D	0.63880	0.993	D	0.80764	0.994	T	0.53265	-0.8463	9	0.66056	D	0.02	-8.814	7.2618	0.26207	0.0:0.6505:0.0:0.3495	.	93	O60595	.	V	93	.	ENSP00000303231:L93V	L	+	1	2	IL12A	161193505	0.009000	0.17119	0.155000	0.22561	0.108000	0.19459	0.177000	0.16801	0.325000	0.23359	0.563000	0.77884	CTA	IL12A	-	pfam_IL12,superfamily_4_helix_cytokine-like_core		0.418	IL12A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL12A	HGNC	protein_coding	OTTHUMT00000352602.2	C	NM_000882		159710811	+1	no_errors	ENST00000305579	ensembl	human	known	70_37	missense	SNP	0.166	G
IL6	3569	genome.wustl.edu	37	7	22769345	22769345	+	Intron	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:22769345C>G	ENST00000404625.1	+	5	930				IL6_ENST00000401630.3_Intron|IL6_ENST00000420258.2_Missense_Mutation_p.D233E|IL6_ENST00000406575.1_Missense_Mutation_p.D179E|IL6_ENST00000407492.1_Intron|AC073072.5_ENST00000325042.2_RNA|IL6_ENST00000258743.5_Intron|IL6_ENST00000401651.1_Missense_Mutation_p.D103E			P05231	IL6_HUMAN	interleukin 6						acute-phase response (GO:0006953)|aging (GO:0007568)|bone remodeling (GO:0046849)|branching involved in salivary gland morphogenesis (GO:0060445)|cell growth (GO:0016049)|cell redox homeostasis (GO:0045454)|cellular response to hydrogen peroxide (GO:0070301)|cellular response to lipopolysaccharide (GO:0071222)|cytokine-mediated signaling pathway (GO:0019221)|defense response to Gram-negative bacterium (GO:0050829)|defense response to Gram-positive bacterium (GO:0050830)|defense response to protozoan (GO:0042832)|defense response to virus (GO:0051607)|endocrine pancreas development (GO:0031018)|epithelial cell proliferation involved in salivary gland morphogenesis (GO:0060664)|glucagon secretion (GO:0070091)|hepatic immune response (GO:0002384)|humoral immune response (GO:0006959)|inflammatory response (GO:0006954)|interleukin-6-mediated signaling pathway (GO:0070102)|monocyte chemotaxis (GO:0002548)|muscle cell cellular homeostasis (GO:0046716)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cell proliferation (GO:0008285)|negative regulation of chemokine biosynthetic process (GO:0045079)|negative regulation of collagen biosynthetic process (GO:0032966)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|negative regulation of cytokine secretion (GO:0050710)|negative regulation of fat cell differentiation (GO:0045599)|negative regulation of gluconeogenesis (GO:0045721)|negative regulation of hormone secretion (GO:0046888)|negative regulation of lipid storage (GO:0010888)|negative regulation of muscle organ development (GO:0048635)|negative regulation of neuron death (GO:1901215)|negative regulation of protein kinase activity (GO:0006469)|neuron projection development (GO:0031175)|neutrophil apoptotic process (GO:0001781)|neutrophil mediated immunity (GO:0002446)|platelet activation (GO:0030168)|positive regulation of acute inflammatory response (GO:0002675)|positive regulation of apoptotic process (GO:0043065)|positive regulation of B cell activation (GO:0050871)|positive regulation of cell proliferation (GO:0008284)|positive regulation of chemokine production (GO:0032722)|positive regulation of DNA replication (GO:0045740)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of ERK1 and ERK2 cascade (GO:0070374)|positive regulation of immunoglobulin secretion (GO:0051024)|positive regulation of interleukin-6 production (GO:0032755)|positive regulation of JAK-STAT cascade (GO:0046427)|positive regulation of leukocyte chemotaxis (GO:0002690)|positive regulation of MAPK cascade (GO:0043410)|positive regulation of neuron differentiation (GO:0045666)|positive regulation of nitric oxide biosynthetic process (GO:0045429)|positive regulation of osteoblast differentiation (GO:0045669)|positive regulation of peptidyl-serine phosphorylation (GO:0033138)|positive regulation of peptidyl-tyrosine phosphorylation (GO:0050731)|positive regulation of protein import into nucleus, translocation (GO:0033160)|positive regulation of protein kinase B signaling (GO:0051897)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|positive regulation of smooth muscle cell proliferation (GO:0048661)|positive regulation of STAT protein import into nucleus (GO:2000366)|positive regulation of T cell proliferation (GO:0042102)|positive regulation of T-helper 2 cell differentiation (GO:0045630)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|positive regulation of translation (GO:0045727)|positive regulation of transmission of nerve impulse (GO:0051971)|positive regulation of type B pancreatic cell apoptotic process (GO:2000676)|positive regulation of tyrosine phosphorylation of Stat3 protein (GO:0042517)|regulation of angiogenesis (GO:0045765)|regulation of cell shape (GO:0008360)|regulation of circadian sleep/wake cycle, non-REM sleep (GO:0045188)|regulation of vascular endothelial growth factor production (GO:0010574)|response to amino acid (GO:0043200)|response to antibiotic (GO:0046677)|response to caffeine (GO:0031000)|response to calcium ion (GO:0051592)|response to cold (GO:0009409)|response to drug (GO:0042493)|response to electrical stimulus (GO:0051602)|response to glucocorticoid (GO:0051384)|response to heat (GO:0009408)|response to insulin (GO:0032868)|response to mechanical stimulus (GO:0009612)|response to nutrient levels (GO:0031667)|response to peptidoglycan (GO:0032494)|T-helper 17 cell lineage commitment (GO:0072540)	external side of plasma membrane (GO:0009897)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|interleukin-6 receptor complex (GO:0005896)	cytokine activity (GO:0005125)|growth factor activity (GO:0008083)|interleukin-6 receptor binding (GO:0005138)			breast(1)|endometrium(2)|large_intestine(4)|lung(1)	8					Ginseng(DB01404)	GTGTCCTGGACAACTCAGGGA	0.428																																					Esophageal Squamous(47;342 1214 13936 33513)												0																																										SO:0001627	intron_variant	3569			M18403	CCDS5375.1	7p21-p15	2014-04-04	2014-04-04		ENSG00000136244	ENSG00000136244		"""Interleukins and interleukin receptors"", ""Interferons"""	6018	protein-coding gene	gene with protein product	"""interferon, beta 2"""	147620	"""interleukin 6 (interferon, beta 2)"""	IFNB2		3294161	Standard	NM_000600		Approved	IL-6, BSF2, HGF, HSF	uc003svj.4	P05231	OTTHUMG00000023178	ENST00000404625.1:c.471+66C>G	7.37:g.22769345C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UCU2|Q9UCU3|Q9UCU4	Missense_Mutation	SNP	pfam_IL6_MGF_GCSF,superfamily_4_helix_cytokine-like_core,smart_IL6_MGF_GCSF,prints_Interleukin_6,prints_IL6_MGF_GCSF	p.D233E	ENST00000404625.1	37	c.699	CCDS5375.1	7	.	.	.	.	.	.	.	.	.	.	C	12.16	1.853990	0.32791	.	.	ENSG00000136244	ENST00000401651;ENST00000420258;ENST00000406575	T;T	0.54279	0.58;0.7	4.15	-0.978	0.10279	.	.	.	.	.	T	0.31358	0.0794	.	.	.	0.09310	N	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.19418	-1.0306	7	.	.	.	-4.456	7.1909	0.25824	0.0:0.2379:0.5598:0.2023	.	233;179	B4DNQ5;B5MC14	.;.	E	103;233;179	ENSP00000405994:D233E;ENSP00000385227:D179E	.	D	+	3	2	IL6	22735870	0.001000	0.12720	0.000000	0.03702	0.002000	0.02628	0.123000	0.15708	-0.193000	0.10415	-0.499000	0.04595	GAC	IL6	-	smart_IL6_MGF_GCSF		0.428	IL6-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IL6	HGNC	protein_coding	OTTHUMT00000250225.2	C	NM_000600		22769345	+1	no_errors	ENST00000420258	ensembl	human	known	70_37	missense	SNP	0.000	G
INPPL1	3636	genome.wustl.edu	37	11	71944182	71944182	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:71944182C>G	ENST00000298229.2	+	17	2219	c.2015C>G	c.(2014-2016)gCc>gGc	p.A672G	INPPL1_ENST00000538751.1_Missense_Mutation_p.A430G|INPPL1_ENST00000541756.1_Missense_Mutation_p.A430G	NM_001567.3	NP_001558.3	O15357	SHIP2_HUMAN	inositol polyphosphate phosphatase-like 1	672					actin filament organization (GO:0007015)|cell adhesion (GO:0007155)|endochondral ossification (GO:0001958)|endocytosis (GO:0006897)|glucose metabolic process (GO:0006006)|immune system process (GO:0002376)|inositol phosphate metabolic process (GO:0043647)|negative regulation of cell proliferation (GO:0008285)|negative regulation of gene expression (GO:0010629)|phosphatidylinositol biosynthetic process (GO:0006661)|phosphatidylinositol dephosphorylation (GO:0046856)|phospholipid metabolic process (GO:0006644)|post-embryonic development (GO:0009791)|response to insulin (GO:0032868)|ruffle assembly (GO:0097178)|small molecule metabolic process (GO:0044281)	cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|Golgi apparatus (GO:0005794)|plasma membrane (GO:0005886)	hydrolase activity (GO:0016787)|SH2 domain binding (GO:0042169)			breast(2)|endometrium(9)|kidney(1)|large_intestine(7)|lung(12)|ovary(1)|pancreas(1)|prostate(3)|skin(5)|upper_aerodigestive_tract(2)|urinary_tract(1)	44						GACACATATGCCTGGCACAAG	0.587																																																	0													43.0	42.0	42.0					11																	71944182		2200	4293	6493	SO:0001583	missense	3636			Y14385	CCDS8213.1	11q23	2013-02-14			ENSG00000165458	ENSG00000165458		"""Sterile alpha motif (SAM) domain containing"", ""SH2 domain containing"""	6080	protein-coding gene	gene with protein product	"""51C protein"""	600829				8530088	Standard	NM_001567		Approved	SHIP2	uc001osf.3	O15357	OTTHUMG00000167879	ENST00000298229.2:c.2015C>G	11.37:g.71944182C>G	ENSP00000298229:p.Ala672Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RTX5|Q13577|Q13578	Missense_Mutation	SNP	pfam_Endo/exonuclease/phosphatase,pfam_SH2,pfam_SAM_2,pfam_SAM_type1,superfamily_Endo/exonuclease/phosphatase,superfamily_SAM/pointed,smart_SH2,smart_IPPc,smart_SAM,pfscan_SAM,pfscan_SH2,prints_SH2	p.A672G	ENST00000298229.2	37	c.2015	CCDS8213.1	11	.	.	.	.	.	.	.	.	.	.	c	17.93	3.510256	0.64522	.	.	ENSG00000165458	ENST00000298229;ENST00000541756;ENST00000538751	T;T;T	0.80824	-1.42;-1.42;-1.42	5.66	4.73	0.59995	Endonuclease/exonuclease/phosphatase (2);Inositol polyphosphate-related phosphatase (1);	0.215984	0.40302	N	0.001122	T	0.74275	0.3695	L	0.43152	1.355	0.43010	D	0.994548	P	0.37122	0.583	B	0.40565	0.333	T	0.76121	-0.3075	10	0.87932	D	0	.	7.9597	0.30064	0.0:0.8307:0.0:0.1693	.	672	O15357	SHIP2_HUMAN	G	672;430;430	ENSP00000298229:A672G;ENSP00000446360:A430G;ENSP00000444619:A430G	ENSP00000298229:A672G	A	+	2	0	INPPL1	71621830	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	5.588000	0.67517	2.830000	0.97506	0.655000	0.94253	GCC	INPPL1	-	pfam_Endo/exonuclease/phosphatase,superfamily_Endo/exonuclease/phosphatase,smart_IPPc		0.587	INPPL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INPPL1	HGNC	protein_coding	OTTHUMT00000396789.1	C	NM_001567		71944182	+1	no_errors	ENST00000298229	ensembl	human	known	70_37	missense	SNP	1.000	G
INTS1	26173	genome.wustl.edu	37	7	1542628	1542628	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:1542628C>T	ENST00000404767.3	-	3	343	c.258G>A	c.(256-258)ctG>ctA	p.L86L	INTS1_ENST00000493531.1_5'Flank|INTS1_ENST00000389470.4_Silent_p.L214L	NM_001080453.2	NP_001073922.2	Q8N201	INT1_HUMAN	integrator complex subunit 1	86					inner cell mass cell proliferation (GO:0001833)|negative regulation of apoptotic process (GO:0043066)|negative regulation of cysteine-type endopeptidase activity involved in apoptotic process (GO:0043154)|snRNA processing (GO:0016180)|U2 snRNA 3'-end processing (GO:0034474)	integral component of membrane (GO:0016021)|integrator complex (GO:0032039)|membrane (GO:0016020)				autonomic_ganglia(1)|cervix(1)|endometrium(14)|kidney(3)|large_intestine(7)|lung(24)|ovary(1)|prostate(4)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(2)	62		Ovarian(82;0.0253)		UCEC - Uterine corpus endometrioid carcinoma (27;0.0181)|OV - Ovarian serous cystadenocarcinoma(56;6.99e-15)		CCAGGGCACTCAGAGGGGGTG	0.607																																																	0													73.0	86.0	82.0					7																	1542628		1964	4155	6119	SO:0001819	synonymous_variant	26173			AB037861	CCDS47526.1	7p22.3	2009-11-06			ENSG00000164880	ENSG00000164880			24555	protein-coding gene	gene with protein product		611345				16239144	Standard	NM_001080453		Approved	DKFZp586J0619, KIAA1440, INT1, NET28	uc003skn.2	Q8N201	OTTHUMG00000151449	ENST00000404767.3:c.258G>A	7.37:g.1542628C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NJ44|Q6NT70|Q6UX74|Q8WV40|Q96D36|Q9NTD1|Q9P2A8|Q9Y3W8	Silent	SNP	pfam_DUF3677,superfamily_ARM-type_fold	p.L214	ENST00000404767.3	37	c.642	CCDS47526.1	7																																																																																			INTS1	-	NULL		0.607	INTS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	INTS1	HGNC	protein_coding	OTTHUMT00000323683.1	C			1542628	-1	no_errors	ENST00000389470	ensembl	human	known	70_37	silent	SNP	1.000	T
IQCC	55721	genome.wustl.edu	37	1	32673549	32673549	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:32673549C>T	ENST00000291358.6	+	5	1288	c.1267C>T	c.(1267-1269)Cat>Tat	p.H423Y	IQCC_ENST00000537469.1_Missense_Mutation_p.H503Y|RP4-622L5.7_ENST00000421616.1_RNA|RP4-622L5.7_ENST00000373604.4_RNA|DCDC2B_ENST00000409358.1_5'Flank	NM_018134.2	NP_060604.2	Q4KMZ1	IQCC_HUMAN	IQ motif containing C	423										endometrium(4)|large_intestine(1)|lung(3)|ovary(4)|skin(2)|urinary_tract(1)	15		Myeloproliferative disorder(586;0.0393)|all_neural(195;0.186)				TGAGCCTAGTCATGAAGGACA	0.507																																																	0													80.0	90.0	87.0					1																	32673549		2203	4300	6503	SO:0001583	missense	55721			AL049795	CCDS355.1, CCDS53293.1	1p36.11-p34.2	2008-02-05			ENSG00000160051	ENSG00000160051			25545	protein-coding gene	gene with protein product							Standard	NM_018134		Approved	FLJ10547	uc001bum.2	Q4KMZ1	OTTHUMG00000005739	ENST00000291358.6:c.1267C>T	1.37:g.32673549C>T	ENSP00000291358:p.His423Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	F5H7T8|Q4KMS3|Q4KMZ5|Q53FL2|Q5TFJ8|Q9NVS3	Missense_Mutation	SNP	pfscan_IQ_motif_EF-hand-BS	p.H503Y	ENST00000291358.6	37	c.1507	CCDS355.1	1	.	.	.	.	.	.	.	.	.	.	C	11.48	1.652134	0.29336	.	.	ENSG00000160051	ENST00000537469;ENST00000291358	T;T	0.25085	1.82;1.85	3.76	1.77	0.24775	.	0.961386	0.08574	N	0.925590	T	0.25044	0.0608	L	0.32530	0.975	0.09310	N	1	D;D	0.60160	0.987;0.987	P;P	0.49085	0.6;0.6	T	0.16276	-1.0408	10	0.59425	D	0.04	0.8206	6.4119	0.21696	0.2106:0.5854:0.204:0.0	.	503;423	F5H7T8;Q4KMZ1	.;IQCC_HUMAN	Y	503;423	ENSP00000442291:H503Y;ENSP00000291358:H423Y	ENSP00000291358:H423Y	H	+	1	0	IQCC	32446136	0.000000	0.05858	0.001000	0.08648	0.144000	0.21451	-0.512000	0.06313	0.516000	0.28340	0.491000	0.48974	CAT	IQCC	-	NULL		0.507	IQCC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCC	HGNC	protein_coding	OTTHUMT00000015731.3	C	NM_018134		32673549	+1	no_errors	ENST00000537469	ensembl	human	known	70_37	missense	SNP	0.001	T
IQCF5	389124	genome.wustl.edu	37	3	51908254	51908254	+	Intron	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:51908254G>T	ENST00000446461.1	-	2	57				IQCF5-AS1_ENST00000440723.1_RNA|RN7SL504P_ENST00000494496.2_RNA	NM_001145059.1	NP_001138531.1	A8MTL0	IQCF5_HUMAN	IQ motif containing F5											kidney(1)	1						CTCTATCAATGATGGCTCCTT	0.532																																																	0																																										SO:0001627	intron_variant	101928999				CCDS46838.1	3p21.1	2008-10-16			ENSG00000214681	ENSG00000214681			35159	protein-coding gene	gene with protein product							Standard	NM_001145059		Approved		uc011bdx.2	A8MTL0	OTTHUMG00000156913	ENST00000446461.1:c.5-63C>A	3.37:g.51908254G>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000446461.1	37	NULL	CCDS46838.1	3																																																																																			IQCF5-AS1	-	-		0.532	IQCF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	IQCF5-AS1	HGNC	protein_coding	OTTHUMT00000346593.1	G	XM_371643		51908254	+1	no_errors	ENST00000440723	ensembl	human	known	70_37	rna	SNP	0.000	T
JAK1	3716	genome.wustl.edu	37	1	65332599	65332599	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:65332599C>T	ENST00000342505.4	-	7	1188	c.940G>A	c.(940-942)Gaa>Aaa	p.E314K		NM_002227.2	NP_002218.2	P23458	JAK1_HUMAN	Janus kinase 1	314	FERM. {ECO:0000255|PROSITE- ProRule:PRU00084}.				cytokine-mediated signaling pathway (GO:0019221)|enzyme linked receptor protein signaling pathway (GO:0007167)|interferon-gamma-mediated signaling pathway (GO:0060333)|interleukin-2-mediated signaling pathway (GO:0038110)|intracellular signal transduction (GO:0035556)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of interferon-gamma-mediated signaling pathway (GO:0060334)|regulation of type I interferon-mediated signaling pathway (GO:0060338)|response to antibiotic (GO:0046677)|type I interferon signaling pathway (GO:0060337)	cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|cytosol (GO:0005829)|focal adhesion (GO:0005925)|membrane (GO:0016020)|nucleus (GO:0005634)	ATP binding (GO:0005524)|growth hormone receptor binding (GO:0005131)|non-membrane spanning protein tyrosine kinase activity (GO:0004715)|protein phosphatase binding (GO:0019903)|protein tyrosine kinase activity (GO:0004713)			breast(5)|central_nervous_system(2)|cervix(1)|endometrium(9)|haematopoietic_and_lymphoid_tissue(48)|kidney(3)|large_intestine(8)|liver(2)|lung(19)|ovary(1)|prostate(12)|skin(1)|soft_tissue(6)|stomach(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	120				BRCA - Breast invasive adenocarcinoma(111;0.0485)	Ruxolitinib(DB08877)|Tofacitinib(DB08895)	ACCATCACTTCGTAGTAGAGA	0.418			Mis		ALL																																			Dom	yes		1	1p32.3-p31.3	3716	Janus kinase 1		L	0													158.0	142.0	147.0					1																	65332599		1973	4156	6129	SO:0001583	missense	3716			M64174	CCDS41346.1	1p32.3-p31.3	2009-07-10	2009-04-23		ENSG00000162434	ENSG00000162434	2.7.10.1		6190	protein-coding gene	gene with protein product		147795		JAK1B		1848670, 7698020	Standard	NM_002227		Approved	JAK1A, JTK3	uc001dbu.1	P23458	OTTHUMG00000009310	ENST00000342505.4:c.940G>A	1.37:g.65332599C>T	ENSP00000343204:p.Glu314Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q59GQ2|Q9UD26	Missense_Mutation	SNP	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,superfamily_FERM_central,smart_Band_41_domain,smart_SH2,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Tyr_kinase_non-rcpt_Jak/Tyk2,prints_Tyr_kinase_non-rcpt_Jak1,prints_Ser-Thr/Tyr_kinase_cat_dom,pfscan_FERM_domain,pfscan_SH2,pfscan_Prot_kinase_cat_dom	p.E314K	ENST00000342505.4	37	c.940	CCDS41346.1	1	.	.	.	.	.	.	.	.	.	.	C	35	5.499599	0.96355	.	.	ENSG00000162434	ENST00000342505	T	0.77750	-1.12	5.59	5.59	0.84812	FERM domain (1);	.	.	.	.	T	0.63307	0.2500	M	0.72118	2.19	0.58432	D	0.999999	P	0.50710	0.938	B	0.29353	0.101	T	0.68496	-0.5393	9	0.23891	T	0.37	-7.2123	19.9758	0.97304	0.0:1.0:0.0:0.0	.	314	P23458	JAK1_HUMAN	K	314	ENSP00000343204:E314K	ENSP00000343204:E314K	E	-	1	0	JAK1	65105187	1.000000	0.71417	1.000000	0.80357	0.812000	0.45895	6.396000	0.73234	2.795000	0.96236	0.655000	0.94253	GAA	JAK1	-	pirsf_Tyr_kinase_non-rcpt_Jak/Tyk2,pfscan_FERM_domain		0.418	JAK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	JAK1	HGNC	protein_coding	OTTHUMT00000025791.1	C	NM_002227		65332599	-1	no_errors	ENST00000342505	ensembl	human	known	70_37	missense	SNP	1.000	T
KDM2A	22992	genome.wustl.edu	37	11	67017739	67017739	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:67017739C>G	ENST00000529006.2	+	17	2684	c.2238C>G	c.(2236-2238)agC>agG	p.S746R	KDM2A_ENST00000308783.5_Missense_Mutation_p.S204R|KDM2A_ENST00000526258.1_3'UTR|KDM2A_ENST00000530342.1_Missense_Mutation_p.S307R|KDM2A_ENST00000398645.2_Missense_Mutation_p.S746R	NM_012308.2	NP_036440.1	Q9Y2K7	KDM2A_HUMAN	lysine (K)-specific demethylase 2A	746					histone H3-K36 demethylation (GO:0070544)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)|nucleolus (GO:0005730)|nucleus (GO:0005634)	histone demethylase activity (H3-K36 specific) (GO:0051864)|unmethylated CpG binding (GO:0045322)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|endometrium(1)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(6)|lung(15)|ovary(5)|skin(1)|urinary_tract(2)	36						CTGGCCCCAGCGACCACCACA	0.647																																																	0													28.0	32.0	31.0					11																	67017739		1961	4148	6109	SO:0001583	missense	22992			BC047486	CCDS44657.1, CCDS58148.1	11q13.1	2014-02-18	2009-04-06	2009-04-06	ENSG00000173120	ENSG00000173120		"""F-boxes / Leucine-rich repeats"", ""Chromatin-modifying enzymes / K-demethylases"""	13606	protein-coding gene	gene with protein product	"""F-box protein FBL11"", ""jumonji C domain-containing histone demethylase 1A"""	605657	"""F-box and leucine-rich repeat protein 11"""	FBXL11		10231032, 10531037	Standard	NM_012308		Approved	KIAA1004, FBL11, LILINA, DKFZP434M1735, FBL7, FLJ00115, CXXC8, JHDM1A	uc001ojw.3	Q9Y2K7	OTTHUMG00000167103	ENST00000529006.2:c.2238C>G	11.37:g.67017739C>G	ENSP00000432786:p.Ser746Arg	Somatic		WXS	Illumina HiSeq	Phase_IV	D4QA03|E9PIL6|I3VM55|Q49A21|Q4G0M3|Q69YY8|Q9BVH5|Q9H7H5|Q9UK66	Missense_Mutation	SNP	pfam_Znf_CXXC,pfam_F-box_dom_cyclin-like,pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,smart_Leu-rich_rpt_Cys-con_subtyp,pfscan_JmjC_dom,pfscan_Znf_PHD-finger,pfscan_Znf_CXXC	p.S746R	ENST00000529006.2	37	c.2238	CCDS44657.1	11	.	.	.	.	.	.	.	.	.	.	C	15.00	2.702891	0.48307	.	.	ENSG00000173120	ENST00000398645;ENST00000529006;ENST00000530342;ENST00000446134;ENST00000308783	T;T;T;T	0.42513	0.97;2.1;1.67;1.74	6.02	4.14	0.48551	.	0.307754	0.44097	D	0.000486	T	0.41534	0.1163	M	0.69358	2.11	0.51767	D	0.999934	P;P	0.52842	0.956;0.956	P;P	0.45474	0.482;0.482	T	0.30446	-0.9978	10	0.18276	T	0.48	-13.6881	10.2608	0.43425	0.0:0.7952:0.0:0.2048	.	204;746	D4QA03;Q9Y2K7	.;KDM2A_HUMAN	R	746;746;307;307;204	ENSP00000381640:S746R;ENSP00000432786:S746R;ENSP00000435776:S307R;ENSP00000309302:S204R	ENSP00000309302:S204R	S	+	3	2	KDM2A	66774315	0.756000	0.28383	1.000000	0.80357	1.000000	0.99986	-0.273000	0.08548	1.554000	0.49487	0.650000	0.86243	AGC	KDM2A	-	NULL		0.647	KDM2A-002	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM2A	HGNC	protein_coding	OTTHUMT00000393140.2	C	NM_012308		67017739	+1	no_errors	ENST00000529006	ensembl	human	known	70_37	missense	SNP	1.000	G
KDM4C	23081	genome.wustl.edu	37	9	7103735	7103735	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:7103735C>T	ENST00000381309.3	+	18	3040	c.2475C>T	c.(2473-2475)atC>atT	p.I825I	KDM4C_ENST00000381306.3_Silent_p.I825I|KDM4C_ENST00000442236.2_Silent_p.I570I|KDM4C_ENST00000536108.1_Missense_Mutation_p.S608F|KDM4C_ENST00000428870.2_Silent_p.I512I	NM_015061.3	NP_055876.2	Q9H3R0	KDM4C_HUMAN	lysine (K)-specific demethylase 4C	825					histone H3-K9 demethylation (GO:0033169)|positive regulation of cell proliferation (GO:0008284)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|transcription, DNA-templated (GO:0006351)	nuclear chromatin (GO:0000790)	androgen receptor binding (GO:0050681)|dioxygenase activity (GO:0051213)|enzyme binding (GO:0019899)|histone demethylase activity (H3-K9 specific) (GO:0032454)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(4)|cervix(1)|endometrium(5)|haematopoietic_and_lymphoid_tissue(2)|kidney(4)|large_intestine(8)|lung(14)|ovary(1)|skin(2)|upper_aerodigestive_tract(1)	43						GAGCCTGCATCCAGTGTTCCT	0.517																																																	0													114.0	106.0	109.0					9																	7103735		2203	4300	6503	SO:0001819	synonymous_variant	23081			AB018323	CCDS6471.1, CCDS55285.1, CCDS55286.1, CCDS55287.1	9p24-p23	2013-01-23	2009-04-06	2009-04-06	ENSG00000107077	ENSG00000107077		"""Chromatin-modifying enzymes / K-demethylases"", ""Tudor domain containing"""	17071	protein-coding gene	gene with protein product	"""tudor domain containing 14C"""	605469	"""jumonji domain containing 2C"""	JMJD2C		9872452, 15138608	Standard	NM_015061		Approved	GASC1, KIAA0780, TDRD14C	uc003zkh.3	Q9H3R0	OTTHUMG00000019536	ENST00000381309.3:c.2475C>T	9.37:g.7103735C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B4E1Y4|B7ZL46|F5H347|F5H7P0|O94877|Q2M3M0|Q5JUC9|Q5VYJ2|Q5VYJ3	Missense_Mutation	SNP	pfam_JmjC_dom,superfamily_Znf_FYVE_PHD,smart_JmjC_dom,smart_Znf_PHD,pfscan_JmjC_dom	p.S608F	ENST00000381309.3	37	c.1823	CCDS6471.1	9	.	.	.	.	.	.	.	.	.	.	C	15.80	2.939308	0.52972	.	.	ENSG00000107077	ENST00000536108	T	0.19250	2.16	5.55	4.65	0.58169	.	.	.	.	.	T	0.35799	0.0944	.	.	.	0.80722	D	1	.	.	.	.	.	.	T	0.04607	-1.0939	6	0.62326	D	0.03	-38.8081	12.2137	0.54394	0.0:0.8647:0.0:0.1353	.	.	.	.	F	608	ENSP00000440656:S608F	ENSP00000440656:S608F	S	+	2	0	KDM4C	7093735	0.955000	0.32602	1.000000	0.80357	0.996000	0.88848	0.109000	0.15417	2.596000	0.87737	0.655000	0.94253	TCC	KDM4C	-	NULL		0.517	KDM4C-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KDM4C	HGNC	protein_coding	OTTHUMT00000051692.1	C	NM_015061		7103735	+1	no_errors	ENST00000536108	ensembl	human	known	70_37	missense	SNP	1.000	T
KIAA0226L	80183	genome.wustl.edu	37	13	46923456	46923456	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr13:46923456G>C	ENST00000429979.1	-	12	2200	c.1596C>G	c.(1594-1596)atC>atG	p.I532M	KIAA0226L_ENST00000322896.6_Missense_Mutation_p.I375M|KIAA0226L_ENST00000378784.4_Missense_Mutation_p.I465M|KIAA0226L_ENST00000378797.2_Missense_Mutation_p.I532M|KIAA0226L_ENST00000389908.3_Missense_Mutation_p.I532M|KIAA0226L_ENST00000378787.3_Missense_Mutation_p.I532M|KIAA0226L_ENST00000378781.3_3'UTR|KIAA0226L_ENST00000409879.2_Missense_Mutation_p.I375M|KIAA0226L_ENST00000534925.1_Missense_Mutation_p.I397M	NM_025113.2	NP_079389.2	Q9H714	K226L_HUMAN	KIAA0226-like	532										NS(2)|cervix(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(7)|pancreas(1)	26						ACAGCTTCTTGATATGGAAGA	0.428																																																	0													69.0	64.0	66.0					13																	46923456		2203	4300	6503	SO:0001583	missense	80183			AK025215	CCDS31970.2, CCDS66543.1, CCDS66544.1, CCDS66545.1, CCDS73569.1	13q14.11	2011-08-09	2011-08-09	2011-08-09	ENSG00000102445	ENSG00000102445			20420	protein-coding gene	gene with protein product			"""chromosome 13 open reading frame 18"""	C13orf18			Standard	NM_001286766		Approved	FLJ21562	uc010acl.3	Q9H714	OTTHUMG00000016868	ENST00000429979.1:c.1596C>G	13.37:g.46923456G>C	ENSP00000396935:p.Ile532Met	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KAG9|A8XR19|B3KS87|Q5W051|Q5W053|Q6PJ74|Q6PK94|Q86XH7|Q8N5J6	Missense_Mutation	SNP	NULL	p.I532M	ENST00000429979.1	37	c.1596	CCDS31970.2	13	.	.	.	.	.	.	.	.	.	.	G	13.86	2.363682	0.41902	.	.	ENSG00000102445	ENST00000429979;ENST00000378797;ENST00000378784;ENST00000389908;ENST00000378787;ENST00000409879;ENST00000322896;ENST00000534925	T;T;T;T;T;T	0.44083	0.99;0.93;0.99;0.99;0.93;1.01	5.16	4.3	0.51218	.	0.281889	0.30969	N	0.008507	T	0.32194	0.0821	L	0.33792	1.035	0.80722	D	1	B;B;P;B;B;P	0.46395	0.256;0.443;0.743;0.418;0.328;0.877	B;P;P;B;B;P	0.48627	0.326;0.525;0.45;0.305;0.237;0.584	T	0.09228	-1.0684	10	0.07644	T	0.81	-4.4385	7.2623	0.26209	0.0914:0.0:0.7373:0.1714	.	375;375;532;397;465;532	B7ZBN5;B7Z6E4;Q9H714;A8KAG9;Q9H714-3;Q9H714-4	.;.;K226L_HUMAN;.;.;.	M	532;532;465;532;532;375;375;397	ENSP00000396935:I532M;ENSP00000368074:I532M;ENSP00000368061:I465M;ENSP00000374558:I532M;ENSP00000368064:I532M;ENSP00000437501:I397M	ENSP00000315633:I375M	I	-	3	3	KIAA0226L	45821457	0.994000	0.37717	0.998000	0.56505	0.847000	0.48162	0.157000	0.16402	2.578000	0.87016	0.558000	0.71614	ATC	KIAA0226L	-	NULL		0.428	KIAA0226L-204	KNOWN	basic|appris_principal|CCDS	protein_coding	KIAA0226L	HGNC	protein_coding	OTTHUMT00000044809.2	G	NM_025113		46923456	-1	no_errors	ENST00000389908	ensembl	human	known	70_37	missense	SNP	1.000	C
KIAA2018	205717	genome.wustl.edu	37	3	113376217	113376217	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:113376217G>C	ENST00000478658.1	-	5	4329	c.4312C>G	c.(4312-4314)Cta>Gta	p.L1438V	KIAA2018_ENST00000491165.1_Intron|KIAA2018_ENST00000316407.4_Missense_Mutation_p.L1438V			Q68DE3	K2018_HUMAN	KIAA2018	1438	Gln-rich.					membrane (GO:0016020)|nucleus (GO:0005634)	calcium ion binding (GO:0005509)|DNA binding (GO:0003677)|mannosyl-oligosaccharide 1,2-alpha-mannosidase activity (GO:0004571)			NS(1)|breast(3)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(13)|liver(1)|lung(30)|ovary(8)|skin(5)|upper_aerodigestive_tract(4)|urinary_tract(2)	80						AGGGCCTGTAGATGCTGACTT	0.498																																																	0													81.0	85.0	83.0					3																	113376217		2186	4279	6465	SO:0001583	missense	205717			AB095938	CCDS43133.1	3q13.2	2014-01-02			ENSG00000176542	ENSG00000176542			30494	protein-coding gene	gene with protein product							Standard	XM_005247208		Approved		uc003eam.3	Q68DE3	OTTHUMG00000159322	ENST00000478658.1:c.4312C>G	3.37:g.113376217G>C	ENSP00000420721:p.Leu1438Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z3L9|Q8IVF3|Q9H8T4	Missense_Mutation	SNP	pfam_HLH_dom,superfamily_HLH_dom,smart_HLH_dom,pfscan_HLH_dom	p.L1438V	ENST00000478658.1	37	c.4312	CCDS43133.1	3	.	.	.	.	.	.	.	.	.	.	G	14.27	2.485186	0.44147	.	.	ENSG00000176542	ENST00000316407;ENST00000478658	T;T	0.15834	2.39;2.39	5.16	5.16	0.70880	.	0.086846	0.48286	D	0.000188	T	0.23806	0.0576	L	0.29908	0.895	0.37271	D	0.907401	D	0.76494	0.999	D	0.65874	0.939	T	0.06991	-1.0796	10	0.72032	D	0.01	-8.0568	6.1726	0.20427	0.2162:0.0:0.7838:0.0	.	1438	Q68DE3	K2018_HUMAN	V	1438	ENSP00000320794:L1438V;ENSP00000420721:L1438V	ENSP00000320794:L1438V	L	-	1	2	KIAA2018	114858907	1.000000	0.71417	0.896000	0.35187	0.954000	0.61252	3.538000	0.53597	2.686000	0.91538	0.491000	0.48974	CTA	KIAA2018	-	NULL		0.498	KIAA2018-003	KNOWN	not_organism_supported|basic|appris_candidate_longest|CCDS	protein_coding	KIAA2018	HGNC	protein_coding	OTTHUMT00000354591.1	G	NM_001009899		113376217	-1	no_errors	ENST00000316407	ensembl	human	known	70_37	missense	SNP	0.905	C
KNTC1	9735	genome.wustl.edu	37	12	123078898	123078898	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:123078898G>C	ENST00000333479.7	+	43	4498	c.4321G>C	c.(4321-4323)Gat>Cat	p.D1441H	KNTC1_ENST00000450485.2_Intron|KNTC1_ENST00000545065.1_3'UTR	NM_014708.4	NP_055523.1	P50748	KNTC1_HUMAN	kinetochore associated 1	1441					mitotic cell cycle (GO:0000278)|mitotic cell cycle checkpoint (GO:0007093)|mitotic nuclear division (GO:0007067)|protein complex assembly (GO:0006461)|regulation of exit from mitosis (GO:0007096)	actin cytoskeleton (GO:0015629)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|kinetochore (GO:0000776)|kinetochore microtubule (GO:0005828)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|spindle pole (GO:0000922)				breast(1)|central_nervous_system(1)|cervix(2)|endometrium(12)|kidney(8)|large_intestine(12)|lung(20)|ovary(7)|prostate(1)|skin(1)|upper_aerodigestive_tract(3)|urinary_tract(4)	72	all_neural(191;0.0837)|Medulloblastoma(191;0.163)			OV - Ovarian serous cystadenocarcinoma(86;7.21e-05)|Epithelial(86;0.000178)|BRCA - Breast invasive adenocarcinoma(302;0.217)		GGAGAATATAGATATGGACAC	0.313																																																	0													117.0	119.0	119.0					12																	123078898		1804	4069	5873	SO:0001583	missense	9735				CCDS45002.1	12q24.31	2013-01-17			ENSG00000184445	ENSG00000184445			17255	protein-coding gene	gene with protein product	"""rough deal homolog (Drosophila)"""	607363				11146660, 11590237	Standard	NM_014708		Approved	KIAA0166, ROD	uc001ucv.3	P50748	OTTHUMG00000168861	ENST00000333479.7:c.4321G>C	12.37:g.123078898G>C	ENSP00000328236:p.Asp1441His	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C4|B3KSG2	Missense_Mutation	SNP	pfam_RZZ-complex_KNTC1/ROD_C,superfamily_Quino_amine_DH_bsu,superfamily_WD40_repeat_dom,superfamily_PAH	p.D1441H	ENST00000333479.7	37	c.4321	CCDS45002.1	12	.	.	.	.	.	.	.	.	.	.	G	8.925	0.962050	0.18583	.	.	ENSG00000184445	ENST00000333479	T	0.14766	2.48	5.37	5.37	0.77165	.	0.334690	0.36628	N	0.002482	T	0.11324	0.0276	L	0.40543	1.245	0.80722	D	1	B	0.17268	0.021	B	0.11329	0.006	T	0.12116	-1.0560	10	0.26408	T	0.33	-22.7842	9.1667	0.37056	0.0772:0.1477:0.7751:0.0	.	1441	P50748	KNTC1_HUMAN	H	1441	ENSP00000328236:D1441H	ENSP00000328236:D1441H	D	+	1	0	KNTC1	121644851	0.997000	0.39634	0.890000	0.34922	0.936000	0.57629	2.899000	0.48679	2.494000	0.84150	0.591000	0.81541	GAT	KNTC1	-	NULL		0.313	KNTC1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	KNTC1	HGNC	protein_coding	OTTHUMT00000396110.2	G			123078898	+1	no_errors	ENST00000333479	ensembl	human	known	70_37	missense	SNP	0.982	C
KSR1	8844	genome.wustl.edu	37	17	25932744	25932744	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:25932744G>C	ENST00000319524.6	+	15	1965	c.1965G>C	c.(1963-1965)aaG>aaC	p.K655N	KSR1_ENST00000398988.3_Missense_Mutation_p.K518N|KSR1_ENST00000509603.2_Missense_Mutation_p.K633N|KSR1_ENST00000268763.6_Missense_Mutation_p.K518N			Q8IVT5	KSR1_HUMAN	kinase suppressor of ras 1	655	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				Ras protein signal transduction (GO:0007265)	endoplasmic reticulum (GO:0005783)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(1)|central_nervous_system(1)|endometrium(5)|large_intestine(5)|lung(12)|prostate(2)|urinary_tract(1)	28	Lung NSC(42;0.00836)		BRCA - Breast invasive adenocarcinoma(3;0.00122)	UCEC - Uterine corpus endometrioid carcinoma (53;0.168)		AGCTCTTCAAGAAAGAGGTGA	0.637																																					Esophageal Squamous(88;1120 1336 6324 10502 16832)												0													20.0	22.0	21.0					17																	25932744		2043	4184	6227	SO:0001583	missense	8844			U43586	CCDS58532.1	17q11.2	2012-05-23	2005-12-14	2005-12-14	ENSG00000141068	ENSG00000141068			6465	protein-coding gene	gene with protein product		601132	"""kinase suppressor of ras"""	KSR		8521512	Standard	XM_006722151		Approved	RSU2	uc031qzj.1	Q8IVT5	OTTHUMG00000132051	ENST00000319524.6:c.1965G>C	17.37:g.25932744G>C	ENSP00000323178:p.Lys655Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	F8WEA9|H7BYU0|Q13476	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.K655N	ENST00000319524.6	37	c.1965		17	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	20.9|20.9	4.063571|4.063571	0.76187|0.76187	.|.	.|.	ENSG00000141068|ENSG00000141068	ENST00000398988|ENST00000319524;ENST00000509603;ENST00000268763;ENST00000398982	.|D;D;D	.|0.82619	.|-1.63;-1.63;-1.63	5.67|5.67	4.7|4.7	0.59300|0.59300	.|Serine-threonine/tyrosine-protein kinase (1);Protein kinase-like domain (1);Protein kinase, catalytic domain (1);	.|0.000000	.|0.85682	.|D	.|0.000000	D|D	0.90625|0.90625	0.7060|0.7060	M|M	0.85299|0.85299	2.745|2.745	0.58432|0.58432	D|D	0.999995|0.999995	.|D;B	.|0.89917	.|1.0;0.128	.|D;B	.|0.87578	.|0.998;0.146	D|D	0.91095|0.91095	0.4910|0.4910	5|10	.|0.87932	.|D	.|0	.|.	9.5277|9.5277	0.39173|0.39173	0.2212:0.0:0.7788:0.0|0.2212:0.0:0.7788:0.0	.|.	.|653;633	.|Q8IVT5;F5H0K8	.|KSR1_HUMAN;.	Q|N	369|655;633;518;518	.|ENSP00000323178:K655N;ENSP00000438795:K633N;ENSP00000268763:K518N	.|ENSP00000268763:K518N	E|K	+|+	1|3	0|2	KSR1|KSR1	22956871|22956871	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.998000|0.998000	0.95712|0.95712	2.736000|2.736000	0.47385|0.47385	1.395000|1.395000	0.46643|0.46643	0.655000|0.655000	0.94253|0.94253	GAA|AAG	KSR1	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.637	KSR1-202	KNOWN	basic|appris_candidate_longest	protein_coding	KSR1	HGNC	protein_coding		G	NM_014238		25932744	+1	no_errors	ENST00000319524	ensembl	human	known	70_37	missense	SNP	1.000	C
KSR2	283455	genome.wustl.edu	37	12	117914376	117914376	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:117914376C>T	ENST00000339824.5	-	17	3202	c.2475G>A	c.(2473-2475)caG>caA	p.Q825Q	KSR2_ENST00000302438.5_3'UTR|KSR2_ENST00000425217.1_Silent_p.Q796Q			Q6VAB6	KSR2_HUMAN	kinase suppressor of ras 2	825	Protein kinase. {ECO:0000255|PROSITE- ProRule:PRU00159}.				intracellular signal transduction (GO:0035556)	cytoplasm (GO:0005737)|membrane (GO:0016020)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein serine/threonine kinase activity (GO:0004674)			NS(1)|breast(3)|central_nervous_system(2)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(12)|lung(25)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	67	all_neural(191;0.0804)|Medulloblastoma(191;0.0922)					GCCAGCCATTCTGGATGCGCA	0.587																																																	0													56.0	66.0	62.0					12																	117914376		2069	4224	6293	SO:0001819	synonymous_variant	283455			AY345972	CCDS61250.1	12q24.22-q24.23	2014-08-12			ENSG00000171435	ENSG00000171435			18610	protein-coding gene	gene with protein product		610737				12471243	Standard	NM_173598		Approved	FLJ25965	uc001two.2	Q6VAB6	OTTHUMG00000169020	ENST00000339824.5:c.2475G>A	12.37:g.117914376C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJT2|Q3B828|Q8N775	Silent	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_Kinase_C-like_PE/DAG-bd,pfscan_Prot_kinase_cat_dom	p.Q825	ENST00000339824.5	37	c.2475		12																																																																																			KSR2	-	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom		0.587	KSR2-001	KNOWN	non_canonical_conserved|not_organism_supported|basic|appris_principal	protein_coding	KSR2	HGNC	protein_coding	OTTHUMT00000401987.2	C	NM_173598		117914376	-1	no_errors	ENST00000339824	ensembl	human	known	70_37	silent	SNP	0.992	T
LAIR1	3903	genome.wustl.edu	37	19	54868125	54868125	+	Silent	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:54868125G>C	ENST00000391742.2	-	6	710	c.558C>G	c.(556-558)ctC>ctG	p.L186L	LAIR1_ENST00000313038.6_Silent_p.L179L|LAIR1_ENST00000463489.1_5'UTR|LAIR1_ENST00000434277.2_Silent_p.L185L|LAIR1_ENST00000348231.4_Silent_p.L169L|LAIR1_ENST00000474878.1_Silent_p.L168L|LAIR1_ENST00000391743.3_Silent_p.L168L			Q6GTX8	LAIR1_HUMAN	leukocyte-associated immunoglobulin-like receptor 1	186					immune system process (GO:0002376)	extracellular vesicular exosome (GO:0070062)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(1)|cervix(1)|endometrium(1)|large_intestine(6)|lung(9)|ovary(4)|prostate(1)|stomach(3)	26	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.0573)		TCTGGCGATGGAGGCAGAAGA	0.547																																																	0													91.0	97.0	95.0					19																	54868125		2203	4300	6503	SO:0001819	synonymous_variant	3903			AF013249	CCDS12891.1, CCDS12892.1, CCDS74448.1, CCDS74449.1, CCDS74450.1	19q13.4	2013-01-29	2006-03-23		ENSG00000167613	ENSG00000167613		"""Leukocyte-associated Ig like receptors"", ""CD molecules"", ""Immunoglobulin superfamily / Immunoglobulin-like domain containing"""	6477	protein-coding gene	gene with protein product		602992	"""leukocyte-associated Ig-like receptor 1"""			9285412	Standard	XM_005258924		Approved	CD305	uc002qfk.1	Q6GTX8	OTTHUMG00000065545	ENST00000391742.2:c.558C>G	19.37:g.54868125G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	smart_Ig_sub	p.L186	ENST00000391742.2	37	c.558	CCDS12891.1	19																																																																																			LAIR1	-	NULL		0.547	LAIR1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LAIR1	HGNC	protein_coding	OTTHUMT00000140506.1	G			54868125	-1	no_errors	ENST00000391742	ensembl	human	known	70_37	silent	SNP	0.102	C
LARP4	113251	genome.wustl.edu	37	12	50860803	50860803	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:50860803C>T	ENST00000398473.2	+	13	1557	c.1445C>T	c.(1444-1446)tCa>tTa	p.S482L	LARP4_ENST00000347328.5_Missense_Mutation_p.S411L|LARP4_ENST00000293618.8_Missense_Mutation_p.S411L|LARP4_ENST00000518444.1_Missense_Mutation_p.S481L|LARP4_ENST00000429001.3_Missense_Mutation_p.S488L	NM_052879.4|NM_199188.2	NP_443111.4|NP_954658.2	Q71RC2	LARP4_HUMAN	La ribonucleoprotein domain family, member 4	482					cytoskeleton organization (GO:0007010)|regulation of cell morphogenesis (GO:0022604)	membrane (GO:0016020)	poly(A) RNA binding (GO:0044822)			breast(3)|endometrium(3)|kidney(2)|large_intestine(2)|liver(2)|lung(7)|ovary(1)|skin(2)|urinary_tract(1)	23						TTATTAGCCTCAAATTTTCCA	0.383																																																	0													123.0	112.0	116.0					12																	50860803		1863	4101	5964	SO:0001583	missense	113251			AY004310	CCDS41782.1, CCDS44879.1, CCDS44880.1, CCDS44879.2, CCDS53789.1, CCDS53790.1	12q13.12	2005-08-09			ENSG00000161813	ENSG00000161813		"""La ribonucleoprotein domain containing"""	24320	protein-coding gene	gene with protein product						12477932	Standard	NM_052879		Approved	PP13296	uc001rwp.2	Q71RC2	OTTHUMG00000163724	ENST00000398473.2:c.1445C>T	12.37:g.50860803C>T	ENSP00000381490:p.Ser482Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K6T1|E9PDG5|G3XAA8|G5E976|Q5CZ97|Q6ZV14|Q96NF9	Missense_Mutation	SNP	pfam_Lupus_La_RNA-bd,smart_Lupus_La_RNA-bd,pfscan_Lupus_La_RNA-bd	p.S488L	ENST00000398473.2	37	c.1463	CCDS41782.1	12	.	.	.	.	.	.	.	.	.	.	C	23.3	4.394724	0.83011	.	.	ENSG00000161813	ENST00000293618;ENST00000429001;ENST00000398473;ENST00000518444;ENST00000520064;ENST00000347328	T;T;T;T;T	0.32515	1.45;1.45;1.45;1.45;1.45	4.99	4.99	0.66335	.	0.201371	0.44688	D	0.000436	T	0.52996	0.1769	M	0.69358	2.11	0.27981	N	0.93602	P;D;P;P;P;P	0.54397	0.906;0.966;0.51;0.649;0.627;0.702	P;P;B;B;B;P	0.61533	0.713;0.89;0.23;0.439;0.424;0.544	T	0.48340	-0.9044	10	0.56958	D	0.05	.	19.1395	0.93443	0.0:1.0:0.0:0.0	.	383;481;411;411;482;488	Q71RC2-2;Q71RC2-3;G3XAA8;G5E976;Q71RC2;Q71RC2-4	.;.;.;.;LARP4_HUMAN;.	L	411;488;482;481;383;411	ENSP00000293618:S411L;ENSP00000415464:S488L;ENSP00000381490:S482L;ENSP00000429077:S481L;ENSP00000340901:S411L	ENSP00000293618:S411L	S	+	2	0	LARP4	49147070	1.000000	0.71417	1.000000	0.80357	0.511000	0.34104	5.187000	0.65087	2.701000	0.92244	0.455000	0.32223	TCA	LARP4	-	NULL		0.383	LARP4-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	LARP4	HGNC	protein_coding	OTTHUMT00000374981.1	C	NM_052879		50860803	+1	no_errors	ENST00000429001	ensembl	human	known	70_37	missense	SNP	1.000	T
LATS1	9113	genome.wustl.edu	37	6	150004568	150004568	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:150004568G>C	ENST00000543571.1	-	4	2204	c.1657C>G	c.(1657-1659)Caa>Gaa	p.Q553E	LATS1_ENST00000392273.3_Missense_Mutation_p.Q553E|LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Missense_Mutation_p.Q553E	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		GGTGGTCCTTGATAGTTTGGA	0.488																																																	0													188.0	155.0	166.0					6																	150004568		2203	4300	6503	SO:0001583	missense	9113			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.1657C>G	6.37:g.150004568G>C	ENSP00000437550:p.Gln553Glu	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_UBA/transl_elong_EF1B_N,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.Q553E	ENST00000543571.1	37	c.1657	CCDS34551.1	6	.	.	.	.	.	.	.	.	.	.	G	18.61	3.660941	0.67700	.	.	ENSG00000131023	ENST00000543571;ENST00000253339;ENST00000392273	T;T;T	0.52295	0.67;0.67;3.26	5.53	5.53	0.82687	.	0.000000	0.56097	D	0.000030	T	0.59197	0.2176	L	0.55481	1.735	0.80722	D	1	P;D;P	0.67145	0.653;0.996;0.653	B;D;B	0.76071	0.297;0.987;0.366	T	0.52801	-0.8527	9	.	.	.	.	19.8134	0.96556	0.0:0.0:1.0:0.0	.	405;553;553	Q59FN4;O95835-2;O95835	.;.;LATS1_HUMAN	E	553	ENSP00000437550:Q553E;ENSP00000253339:Q553E;ENSP00000444678:Q553E	.	Q	-	1	0	LATS1	150046261	1.000000	0.71417	1.000000	0.80357	0.995000	0.86356	9.174000	0.94824	2.767000	0.95098	0.655000	0.94253	CAA	LATS1	-	NULL		0.488	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS1	HGNC	protein_coding	OTTHUMT00000043923.4	G	NM_004690		150004568	-1	no_errors	ENST00000253339	ensembl	human	known	70_37	missense	SNP	1.000	C
LATS1	9113	genome.wustl.edu	37	6	150005605	150005605	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:150005605G>C	ENST00000543571.1	-	4	1167	c.620C>G	c.(619-621)tCa>tGa	p.S207*	LATS1_ENST00000392273.3_Nonsense_Mutation_p.S207*|LATS1_ENST00000542747.1_5'UTR|LATS1_ENST00000253339.5_Nonsense_Mutation_p.S207*	NM_004690.3	NP_004681.1			large tumor suppressor kinase 1											central_nervous_system(1)|lung(5)	6		Ovarian(120;0.0164)		OV - Ovarian serous cystadenocarcinoma(155;6.93e-13)|GBM - Glioblastoma multiforme(68;0.116)		ATCTGTCTGTGAGTTGGGACT	0.502																																																	0													94.0	90.0	92.0					6																	150005605		2203	4300	6503	SO:0001587	stop_gained	9113			AF104413	CCDS34551.1, CCDS59040.1	6q25.1	2013-04-25	2013-04-25		ENSG00000131023	ENSG00000131023			6514	protein-coding gene	gene with protein product		603473	"""LATS (large tumor suppressor, Drosophila) homolog 1"", ""LATS, large tumor suppressor, homolog 1 (Drosophila)"""			9988268, 15122335	Standard	NM_004690		Approved	WARTS	uc003qmu.2	O95835	OTTHUMG00000016437	ENST00000543571.1:c.620C>G	6.37:g.150005605G>C	ENSP00000437550:p.Ser207*	Somatic		WXS	Illumina HiSeq	Phase_IV		Nonsense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Pkinase_C,pfam_UBA/transl_elong_EF1B_N,superfamily_Kinase-like_dom,superfamily_UBA-like,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_UBA/transl_elong_EF1B_N_euk,pfscan_Prot_kinase_cat_dom	p.S207*	ENST00000543571.1	37	c.620	CCDS34551.1	6	.	.	.	.	.	.	.	.	.	.	G	27.0	4.792840	0.90453	.	.	ENSG00000131023	ENST00000543571;ENST00000253339;ENST00000392273;ENST00000458696	.	.	.	4.9	4.9	0.64082	.	0.143987	0.31949	N	0.006801	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	.	.	.	.	18.0704	0.89404	0.0:0.0:1.0:0.0	.	.	.	.	X	207;207;207;153	.	.	S	-	2	0	LATS1	150047298	1.000000	0.71417	0.998000	0.56505	0.931000	0.56810	6.243000	0.72384	2.265000	0.75225	0.557000	0.71058	TCA	LATS1	-	NULL		0.502	LATS1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LATS1	HGNC	protein_coding	OTTHUMT00000043923.4	G	NM_004690		150005605	-1	no_errors	ENST00000253339	ensembl	human	known	70_37	nonsense	SNP	1.000	C
LENG8	114823	genome.wustl.edu	37	19	54969844	54969844	+	Intron	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:54969844C>T	ENST00000326764.5	+	15	2719				LENG8_ENST00000376514.2_Intron	NM_052925.2	NP_443157.1	Q96PV6	LENG8_HUMAN	leukocyte receptor cluster (LRC) member 8											breast(1)|central_nervous_system(3)|endometrium(3)|kidney(1)|large_intestine(6)|lung(9)|pancreas(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	30	Ovarian(34;0.19)			GBM - Glioblastoma multiforme(193;0.139)		TTTCTCCATTCAGCCCTCCCC	0.627																																																	0																																										SO:0001627	intron_variant	114823			AF211975	CCDS12894.1	19q13.4	2008-02-05			ENSG00000167615	ENSG00000167615			15500	protein-coding gene	gene with protein product						10941842	Standard	XM_005278248		Approved	KIAA1932, MGC40108, pp13842	uc002qfw.2	Q96PV6	OTTHUMG00000065548	ENST00000326764.5:c.2240+144C>T	19.37:g.54969844C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B0VJY9|Q8IZ27|Q8NCX6	Missense_Mutation	SNP	pfam_SAC3/GANP/Nin1/mts3/eIF-3-p25	p.S795L	ENST00000326764.5	37	c.2384	CCDS12894.1	19	.	.	.	.	.	.	.	.	.	.	C	12.43	1.934306	0.34096	.	.	ENSG00000167615	ENST00000376526;ENST00000431846	T;T	0.30981	1.51;1.51	3.56	-4.69	0.03299	.	.	.	.	.	T	0.13628	0.0330	.	.	.	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.29274	-1.0017	7	.	.	.	.	5.2423	0.15479	0.1608:0.2222:0.0:0.617	.	758	F8W9Q9	.	L	758;795	ENSP00000365709:S758L;ENSP00000388053:S795L	.	S	+	2	0	LENG8	59661656	0.000000	0.05858	0.000000	0.03702	0.026000	0.11368	-0.944000	0.03913	-0.920000	0.03799	0.561000	0.74099	TCA	LENG8	-	NULL		0.627	LENG8-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LENG8	HGNC	protein_coding	OTTHUMT00000140523.2	C	NM_052925		54969844	+1	no_errors	ENST00000431846	ensembl	human	putative	70_37	missense	SNP	0.000	T
LHX6	26468	genome.wustl.edu	37	9	124988717	124988717	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:124988717C>T	ENST00000373755.2	-	3	420	c.312G>A	c.(310-312)ctG>ctA	p.L104L	LHX6_ENST00000559529.1_5'Flank|LHX6_ENST00000394319.4_Silent_p.L133L|LHX6_ENST00000340587.3_Silent_p.L133L|LHX6_ENST00000373754.2_Silent_p.L104L|LHX6_ENST00000541397.2_Silent_p.L122L	NM_001242334.1	NP_001229263.1	Q9UPM6	LHX6_HUMAN	LIM homeobox 6	104	LIM zinc-binding 1. {ECO:0000255|PROSITE- ProRule:PRU00125}.|Required for interaction with LDB1. {ECO:0000250}.				cell maturation (GO:0048469)|cerebral cortex GABAergic interneuron migration (GO:0021853)|cerebral cortex radially oriented cell migration (GO:0021799)|cerebral cortex tangential migration (GO:0021800)|forebrain neuron fate commitment (GO:0021877)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(2)|kidney(1)|large_intestine(5)	8						TCTGCTGCCTCAGCGACGTGC	0.647																																																	0													85.0	82.0	83.0					9																	124988717		2203	4300	6503	SO:0001819	synonymous_variant	26468			AB031041	CCDS6837.2, CCDS6838.2, CCDS56583.1, CCDS56584.1, CCDS59144.1	9q33.2	2011-06-20			ENSG00000106852	ENSG00000106852		"""Homeoboxes / LIM class"""	21735	protein-coding gene	gene with protein product		608215				10393337	Standard	NM_014368		Approved	LHX6.1	uc004blx.4	Q9UPM6	OTTHUMG00000020601	ENST00000373755.2:c.312G>A	9.37:g.124988717C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A6PVQ1|A6PVQ2|A8K1B2|B7Z4D0|H0YN76|Q5T7S7|Q5T7S8|Q9NTK3|Q9UPM5	Silent	SNP	pfam_Znf_LIM,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Znf_LIM,smart_Homeodomain,pfscan_Znf_LIM,pfscan_Homeodomain	p.L133	ENST00000373755.2	37	c.399	CCDS56583.1	9																																																																																			LHX6	-	pfam_Znf_LIM,smart_Znf_LIM,pfscan_Znf_LIM		0.647	LHX6-002	KNOWN	not_organism_supported|basic|CCDS	protein_coding	LHX6	HGNC	protein_coding	OTTHUMT00000053924.2	C	NM_014368		124988717	-1	no_errors	ENST00000394319	ensembl	human	known	70_37	silent	SNP	1.000	T
LINC00657	647979	genome.wustl.edu	37	20	34638451	34638451	+	lincRNA	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr20:34638451C>T	ENST00000565493.1	-	0	431					NR_027451.1				long intergenic non-protein coding RNA 657																		AGGCCGCCTTCCCGGGCCGTC	0.716																																																	0																																												647979			AI619767, AK090641, BC011592		20q11.23	2012-10-12			ENSG00000260032	ENSG00000260032		"""Long non-coding RNAs"""	44311	non-coding RNA	RNA, long non-coding							Standard	NR_027451		Approved		uc002xet.3		OTTHUMG00000175580		20.37:g.34638451C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000565493.1	37	NULL		20																																																																																			LINC00657	-	-		0.716	LINC00657-001	KNOWN	basic	lincRNA	LINC00657	HGNC	lincRNA	OTTHUMT00000430538.1	C	NR_027451		34638451	-1	no_errors	ENST00000565493	ensembl	human	known	70_37	rna	SNP	0.000	T
LMF2	91289	genome.wustl.edu	37	22	50942059	50942059	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr22:50942059G>A	ENST00000474879.2	-	14	1900	c.1885C>T	c.(1885-1887)Cag>Tag	p.Q629*	LMF2_ENST00000380796.3_Nonsense_Mutation_p.Q516*|LMF2_ENST00000216080.5_Nonsense_Mutation_p.Q604*|LMF2_ENST00000505981.1_5'Flank	NM_033200.2	NP_149977.2	Q9BU23	LMF2_HUMAN	lipase maturation factor 2	629						endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)				breast(1)|cervix(1)|kidney(1)|lung(4)|prostate(1)|skin(2)	10		all_cancers(38;1.31e-09)|all_epithelial(38;1.81e-08)|all_lung(38;0.000817)|Breast(42;0.00387)|Lung NSC(38;0.0124)|Ovarian(80;0.104)|Lung SC(80;0.162)|Hepatocellular(38;0.178)		BRCA - Breast invasive adenocarcinoma(115;0.205)|LUAD - Lung adenocarcinoma(64;0.247)		GGAGACAGCTGAGAGCGAGTC	0.682																																																	0													15.0	21.0	19.0					22																	50942059		2187	4277	6464	SO:0001587	stop_gained	91289			BC002942	CCDS14093.1, CCDS14093.2	22q13.33	2008-02-04	2007-11-29	2007-11-29	ENSG00000100258	ENSG00000100258			25096	protein-coding gene	gene with protein product			"""transmembrane protein 153"", ""transmembrane protein 112B"""	TMEM153, TMEM112B		12477932	Standard	NM_033200		Approved		uc003blp.2	Q9BU23	OTTHUMG00000150206	ENST00000474879.2:c.1885C>T	22.37:g.50942059G>A	ENSP00000424381:p.Gln629*	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NEZ0|Q13392|Q6ZNR2|Q8WU74|Q96C62	Nonsense_Mutation	SNP	pfam_LMF	p.Q629*	ENST00000474879.2	37	c.1885	CCDS14093.2	22	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	G|G	22.5|22.5	4.295131|4.295131	0.81025|0.81025	.|.	.|.	ENSG00000100258|ENSG00000100258	ENST00000380796;ENST00000474879;ENST00000216080|ENST00000487499	.|.	.|.	.|.	5.33|5.33	4.31|4.31	0.51392|0.51392	.|.	0.515799|.	0.20289|.	N|.	0.095282|.	.|T	.|0.59918	.|0.2229	.|.	.|.	.|.	0.80722|0.80722	D|D	1|1	.|.	.|.	.|.	.|.	.|.	.|.	.|T	.|0.57219	.|-0.7849	.|5	0.29301|0.33141	T|T	0.29|0.24	-1.7929|-1.7929	10.2471|10.2471	0.43347|0.43347	0.0921:0.0:0.9079:0.0|0.0921:0.0:0.9079:0.0	.|.	.|.	.|.	.|.	X|L	516;629;604|635	.|.	ENSP00000216080:Q604X|ENSP00000424764:S635L	Q|S	-|-	1|2	0|0	LMF2|LMF2	49288925|49288925	0.998000|0.998000	0.40836|0.40836	0.698000|0.698000	0.30274|0.30274	0.005000|0.005000	0.04900|0.04900	3.410000|3.410000	0.52664|0.52664	1.382000|1.382000	0.46385|0.46385	0.650000|0.650000	0.86243|0.86243	CAG|TCA	LMF2	-	NULL		0.682	LMF2-002	KNOWN	basic|appris_principal|CCDS	protein_coding	LMF2	HGNC	protein_coding	OTTHUMT00000316833.2	G	NM_033200		50942059	-1	no_errors	ENST00000474879	ensembl	human	known	70_37	nonsense	SNP	0.917	A
LNX2	222484	genome.wustl.edu	37	13	28155748	28155748	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr13:28155748C>T	ENST00000316334.3	-	2	222	c.93G>A	c.(91-93)tgG>tgA	p.W31*		NM_153371.3	NP_699202.1	Q8N448	LNX2_HUMAN	ligand of numb-protein X 2	31					protein homooligomerization (GO:0051260)		zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(2)|cervix(1)|endometrium(6)|kidney(1)|large_intestine(8)|lung(7)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	31		Lung SC(185;0.0156)	Colorectal(13;0.000157)|READ - Rectum adenocarcinoma(15;0.105)	OV - Ovarian serous cystadenocarcinoma(117;0.113)|all cancers(112;0.127)|Epithelial(112;0.248)		TTTCTCTTGTCCAGTGCTGTT	0.458																																																	0													149.0	128.0	135.0					13																	28155748		2203	4300	6503	SO:0001587	stop_gained	222484			AL138699	CCDS9323.1	13q12.2	2013-01-09	2004-01-22	2004-01-23	ENSG00000139517	ENSG00000139517		"""RING-type (C3HC4) zinc fingers"""	20421	protein-coding gene	gene with protein product		609733	"""PDZ domain containing ring finger 1"""	PDZRN1			Standard	NM_153371		Approved	MGC46315	uc001url.4	Q8N448	OTTHUMG00000016634	ENST00000316334.3:c.93G>A	13.37:g.28155748C>T	ENSP00000325929:p.Trp31*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5W0P0|Q6ZMH2|Q96SH4	Nonsense_Mutation	SNP	pfam_PDZ,pfam_Znf_C3HC4_RING-type,superfamily_PDZ,superfamily_TRAF-like,smart_Znf_RING,smart_PDZ,pfscan_PDZ,pfscan_Znf_RING	p.W31*	ENST00000316334.3	37	c.93	CCDS9323.1	13	.	.	.	.	.	.	.	.	.	.	C	36	5.693792	0.96793	.	.	ENSG00000139517	ENST00000316334	.	.	.	6.06	6.06	0.98353	.	0.057770	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.66056	D	0.02	.	13.7717	0.63029	0.0:0.9303:0.0:0.0697	.	.	.	.	X	31	.	ENSP00000325929:W31X	W	-	3	0	LNX2	27053748	1.000000	0.71417	1.000000	0.80357	0.963000	0.63663	2.428000	0.44749	2.882000	0.98803	0.655000	0.94253	TGG	LNX2	-	NULL		0.458	LNX2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LNX2	HGNC	protein_coding	OTTHUMT00000044302.2	C			28155748	-1	no_errors	ENST00000316334	ensembl	human	known	70_37	nonsense	SNP	1.000	T
Unknown	0	genome.wustl.edu	37	GL000219.1	79989	79989	+	IGR	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrGL000219.1:79989C>G								None (None upstream) : None (None downstream)																							TCTGGAATGTCATCTTTTTTC	0.343																																																	0																																										SO:0001628	intergenic_variant	100996779																															GL000219.1.37:g.79989C>G		Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_FRG1,superfamily_Actin_cross-linking	p.D71H		37	c.211		GL000219.1																																																																																			AL592183.1	-	pfam_FRG1	0	0.343					LOC100996779	Clone_based_ensembl_gene			C			79989	-1	no_errors	ENST00000418749	ensembl	human	known	70_37	missense	SNP	NULL	G
GOLGA2P7	388152	genome.wustl.edu	37	15	84873308	84873308	+	RNA	SNP	T	T	C	rs225234		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr15:84873308T>C	ENST00000559668.1	-	0	452				AC136698.1_ENST00000408081.1_RNA|RN7SL331P_ENST00000461138.2_RNA	NR_049748.1																						GCCCCTCGGATGGCCTGGCAG	0.602																																																	0																																												642423																															15.37:g.84873308T>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000559668.1	37	NULL		15																																																																																			AC103965.1	-	-		0.602	AC103965.1-008	KNOWN	basic	processed_transcript	LOC642423	Clone_based_vega_gene	pseudogene	OTTHUMT00000418802.1	T			84873308	-1	no_errors	ENST00000561015	ensembl	human	known	70_37	rna	SNP	0.120	C
LOC653160	653160	genome.wustl.edu	37	1	35442283	35442283	+	RNA	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:35442283C>T	ENST00000417456.1	-	0	836																											TCTTCCCCCCCAGCCACCTAG	0.701																																																	0																																												653160																															1.37:g.35442283C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000417456.1	37	NULL		1																																																																																			RP11-244H3.1	-	-		0.701	RP11-244H3.1-002	KNOWN	basic	sense_overlapping	LOC653160	Clone_based_vega_gene	processed_transcript	OTTHUMT00000011546.3	C			35442283	-1	no_errors	ENST00000311990	ensembl	human	known	70_37	rna	SNP	0.000	T
LINC00839	84856	genome.wustl.edu	37	10	42971127	42971127	+	lincRNA	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:42971127G>C	ENST00000429940.2	+	0	137					NR_026827.1				long intergenic non-protein coding RNA 839																		GGAGAAGGAAGAGAACTGGGT	0.667																																																	0																																												84856					10q11.21	2012-12-20			ENSG00000185904	ENSG00000185904		"""Long non-coding RNAs"""	28269	protein-coding gene	gene with protein product						12477932	Standard	NR_026827		Approved		uc001izy.3		OTTHUMG00000018010		10.37:g.42971127G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000429940.2	37	NULL		10																																																																																			RP11-178A10.1	-	-		0.667	LINC00839-001	KNOWN	basic	lincRNA	LOC84856	Clone_based_vega_gene	lincRNA	OTTHUMT00000047672.2	G	NR_026827		42971127	+1	no_errors	ENST00000332123	ensembl	human	known	70_37	rna	SNP	0.158	C
LRP2	4036	genome.wustl.edu	37	2	170062614	170062614	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:170062614G>A	ENST00000263816.3	-	40	7760	c.7475C>T	c.(7474-7476)tCc>tTc	p.S2492F		NM_004525.2	NP_004516.2	P98164	LRP2_HUMAN	low density lipoprotein receptor-related protein 2	2492					cell proliferation (GO:0008283)|endocytosis (GO:0006897)|forebrain development (GO:0030900)|lipid metabolic process (GO:0006629)|phototransduction, visible light (GO:0007603)|protein glycosylation (GO:0006486)|receptor-mediated endocytosis (GO:0006898)|retinoid metabolic process (GO:0001523)|small molecule metabolic process (GO:0044281)|steroid metabolic process (GO:0008202)|vitamin D metabolic process (GO:0042359)	apical plasma membrane (GO:0016324)|brush border membrane (GO:0031526)|coated pit (GO:0005905)|endocytic vesicle (GO:0030139)|endoplasmic reticulum (GO:0005783)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|lysosomal membrane (GO:0005765)|lysosome (GO:0005764)|plasma membrane (GO:0005886)|receptor complex (GO:0043235)	calcium ion binding (GO:0005509)			biliary_tract(1)|breast(16)|central_nervous_system(6)|cervix(2)|endometrium(24)|haematopoietic_and_lymphoid_tissue(2)|kidney(17)|large_intestine(70)|liver(1)|lung(117)|ovary(19)|pancreas(1)|prostate(2)|skin(17)|upper_aerodigestive_tract(7)|urinary_tract(13)	315				STAD - Stomach adenocarcinoma(1183;0.000766)|COAD - Colon adenocarcinoma(177;0.0101)	"""""""Insulin(DB00071)|Gentamicin(DB00798)|Insulin Regular(DB00030)|Urokinase(DB00013)"""	TTCAGCCATGGAATTAATCAT	0.458																																																	0													150.0	143.0	145.0					2																	170062614		2203	4300	6503	SO:0001583	missense	4036				CCDS2232.1	2q31.1	2013-05-28	2010-01-26		ENSG00000081479	ENSG00000081479		"""Low density lipoprotein receptors"""	6694	protein-coding gene	gene with protein product	"""megalin"""	600073				7959795	Standard	NM_004525		Approved	gp330, DBS	uc002ues.3	P98164	OTTHUMG00000132179	ENST00000263816.3:c.7475C>T	2.37:g.170062614G>A	ENSP00000263816:p.Ser2492Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	O00711|Q16215	Missense_Mutation	SNP	pfam_LDrepeatLR_classA_rpt,pfam_LDLR_classB_rpt,superfamily_Growth_fac_rcpt,superfamily_LDrepeatLR_classA_rpt,superfamily_TIL_dom,smart_LDrepeatLR_classA_rpt,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_LDLR_classB_rpt,pfscan_EG-like_dom,pfscan_LDrepeatLR_classA_rpt,pfscan_LDLR_classB_rpt	p.S2492F	ENST00000263816.3	37	c.7475	CCDS2232.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.257518	0.95368	.	.	ENSG00000081479	ENST00000263816	D	0.91011	-2.77	6.17	6.17	0.99709	Six-bladed beta-propeller, TolB-like (1);	0.000000	0.85682	D	0.000000	D	0.95214	0.8448	M	0.67700	2.07	0.80722	D	1	D	0.76494	0.999	D	0.85130	0.997	D	0.94563	0.7764	10	0.72032	D	0.01	.	20.8794	0.99867	0.0:0.0:1.0:0.0	.	2492	P98164	LRP2_HUMAN	F	2492	ENSP00000263816:S2492F	ENSP00000263816:S2492F	S	-	2	0	LRP2	169770860	1.000000	0.71417	0.997000	0.53966	0.911000	0.54048	9.869000	0.99810	2.941000	0.99782	0.655000	0.94253	TCC	LRP2	-	smart_LDLR_classB_rpt		0.458	LRP2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	LRP2	HGNC	protein_coding	OTTHUMT00000255231.2	G	NM_004525		170062614	-1	no_errors	ENST00000263816	ensembl	human	known	70_37	missense	SNP	1.000	A
MAGEA8	4107	genome.wustl.edu	37	X	149013299	149013299	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:149013299G>A	ENST00000542674.1	+	3	774	c.253G>A	c.(253-255)Gag>Aag	p.E85K	MAGEA8_ENST00000535454.1_Missense_Mutation_p.E85K|MAGEA8_ENST00000493910.1_3'UTR|MAGEA8_ENST00000286482.1_Missense_Mutation_p.E85K	NM_001166401.1	NP_001159873.1	P43361	MAGA8_HUMAN	melanoma antigen family A, 8	85										NS(1)|breast(2)|endometrium(2)|large_intestine(2)|lung(12)|upper_aerodigestive_tract(1)	20	Acute lymphoblastic leukemia(192;6.56e-05)					CCAATCCGATGAGGGTTCCAG	0.597																																																	0													73.0	69.0	70.0					X																	149013299		2203	4298	6501	SO:0001583	missense	4107				CCDS14692.1	Xq28	2009-03-13			ENSG00000156009	ENSG00000156009			6806	protein-coding gene	gene with protein product	"""MAGE-8 antigen"", ""cancer/testis antigen family 1, member 8"""	300341		MAGE8		8575766	Standard	NM_005364		Approved	MGC2182, CT1.8	uc004fdw.2	P43361	OTTHUMG00000022635	ENST00000542674.1:c.253G>A	X.37:g.149013299G>A	ENSP00000443776:p.Glu85Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9BUN9	Missense_Mutation	SNP	pfam_MAGE,pfam_Melanoma_ass_antigen_N,pfscan_MAGE	p.E85K	ENST00000542674.1	37	c.253	CCDS14692.1	X	.	.	.	.	.	.	.	.	.	.	.	13.74	2.328518	0.41197	.	.	ENSG00000156009	ENST00000535454;ENST00000542674;ENST00000286482	T;T;T	0.08458	3.09;3.09;3.09	0.805	0.805	0.18703	Melanoma associated antigen, MAGE, N-terminal (1);	1.707440	0.02924	N	0.138380	T	0.29355	0.0731	M	0.77103	2.36	0.09310	N	1	D	0.89917	1.0	D	0.97110	1.0	T	0.08452	-1.0721	9	0.38643	T	0.18	.	.	.	.	.	85	P43361	MAGA8_HUMAN	K	85	ENSP00000438293:E85K;ENSP00000443776:E85K;ENSP00000286482:E85K	ENSP00000286482:E85K	E	+	1	0	MAGEA8	148773957	0.003000	0.15002	0.002000	0.10522	0.031000	0.12232	1.033000	0.30191	0.659000	0.30945	0.190000	0.17370	GAG	MAGEA8	-	pfam_Melanoma_ass_antigen_N		0.597	MAGEA8-202	KNOWN	basic|appris_principal|CCDS	protein_coding	MAGEA8	HGNC	protein_coding	OTTHUMT00000058728.1	G	NM_005364		149013299	+1	no_errors	ENST00000286482	ensembl	human	known	70_37	missense	SNP	0.001	A
MAP3K9	4293	genome.wustl.edu	37	14	71199564	71199564	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:71199564G>C	ENST00000554752.2	-	11	2521	c.2522C>G	c.(2521-2523)tCc>tGc	p.S841C	MAP3K9_ENST00000553414.1_Missense_Mutation_p.S574C|MAP3K9_ENST00000554146.1_Missense_Mutation_p.S569C|MAP3K9_ENST00000381250.4_Missense_Mutation_p.S818C|MAP3K9_ENST00000555993.2_Missense_Mutation_p.S855C	NM_001284230.1	NP_001271159.1	P80192	M3K9_HUMAN	mitogen-activated protein kinase kinase kinase 9	841					activation of JNKK activity (GO:0007256)|activation of JUN kinase activity (GO:0007257)|apoptotic process (GO:0006915)|positive regulation of apoptotic process (GO:0043065)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)		ATP binding (GO:0005524)|JUN kinase kinase kinase activity (GO:0004706)|MAP kinase kinase activity (GO:0004708)|protein homodimerization activity (GO:0042803)|protein serine/threonine kinase activity (GO:0004674)|protein tyrosine kinase activity (GO:0004713)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(1)|kidney(2)|large_intestine(5)|lung(25)|ovary(2)|prostate(1)|skin(3)|stomach(2)	46				all cancers(60;0.00779)|BRCA - Breast invasive adenocarcinoma(234;0.00884)|OV - Ovarian serous cystadenocarcinoma(108;0.08)		GTTGCACTCGGAGATGGAGGA	0.607																																					GBM(114;411 1587 13539 28235 50070)												0													61.0	56.0	58.0					14																	71199564		2202	4300	6502	SO:0001583	missense	4293			AF251442	CCDS32112.1, CCDS61485.1, CCDS61488.1, CCDS73650.1	14q24.2	2012-10-02			ENSG00000006432	ENSG00000006432		"""Mitogen-activated protein kinase cascade / Kinase kinase kinases"""	6861	protein-coding gene	gene with protein product		600136		MLK1			Standard	NM_001284231		Approved	PRKE1, MEKK9	uc001xml.3	P80192	OTTHUMG00000171249	ENST00000554752.2:c.2522C>G	14.37:g.71199564G>C	ENSP00000451612:p.Ser841Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	A3KN85|Q0D2G7|Q6EH31|Q9H2N5	Missense_Mutation	SNP	pirsf_MAPKKK9/10/11,pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,pfam_SH3_2,pfam_SH3_domain,superfamily_Kinase-like_dom,superfamily_SH3_domain,superfamily_Regulat_G_prot_signal_superfam,smart_SH3_domain,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom,prints_SH3_domain,pfscan_SH3_domain,pfscan_Prot_kinase_cat_dom	p.S855C	ENST00000554752.2	37	c.2564		14	.	.	.	.	.	.	.	.	.	.	G	19.67	3.870841	0.72065	.	.	ENSG00000006432	ENST00000554752;ENST00000005198;ENST00000553414;ENST00000381250;ENST00000554146;ENST00000542284	T;T;T;T	0.79749	-1.25;-1.3;-1.19;-1.28	4.77	4.77	0.60923	.	0.000000	0.85682	D	0.000000	D	0.88012	0.6323	L	0.57536	1.79	0.50467	D	0.999872	D;D;D;D	0.89917	1.0;1.0;1.0;1.0	D;D;D;D	0.80764	0.992;0.956;0.986;0.994	D	0.89127	0.3507	10	0.72032	D	0.01	.	17.9928	0.89174	0.0:0.0:1.0:0.0	.	569;841;855;574	G3V4P9;P80192;P80192-4;G3V347	.;M3K9_HUMAN;.;.	C	841;855;574;818;569;557	ENSP00000451612:S841C;ENSP00000451038:S574C;ENSP00000370649:S818C;ENSP00000451921:S569C	ENSP00000005198:S855C	S	-	2	0	MAP3K9	70269317	1.000000	0.71417	0.963000	0.40424	0.994000	0.84299	4.624000	0.61254	2.478000	0.83669	0.561000	0.74099	TCC	MAP3K9	-	pirsf_MAPKKK9/10/11		0.607	MAP3K9-001	KNOWN	basic	protein_coding	MAP3K9	HGNC	protein_coding	OTTHUMT00000412550.2	G			71199564	-1	no_errors	ENST00000555993	ensembl	human	known	70_37	missense	SNP	0.998	C
MED12	9968	genome.wustl.edu	37	X	70342457	70342457	+	Splice_Site	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:70342457G>C	ENST00000374080.3	+	9	1380	c.1348G>C	c.(1348-1350)Ggc>Cgc	p.G450R	MED12_ENST00000374102.1_Splice_Site_p.G450R|MED12_ENST00000333646.6_Splice_Site_p.G450R			Q93074	MED12_HUMAN	mediator complex subunit 12	450					androgen receptor signaling pathway (GO:0030521)|axis elongation involved in somitogenesis (GO:0090245)|canonical Wnt signaling pathway (GO:0060070)|gene expression (GO:0010467)|heart development (GO:0007507)|intracellular steroid hormone receptor signaling pathway (GO:0030518)|negative regulation of Wnt signaling pathway (GO:0030178)|neural tube closure (GO:0001843)|oligodendrocyte development (GO:0014003)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|positive regulation of transcription, DNA-templated (GO:0045893)|Schwann cell development (GO:0014044)|stem cell maintenance (GO:0019827)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Wnt signaling pathway, planar cell polarity pathway (GO:0060071)	mediator complex (GO:0016592)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin binding (GO:0003682)|ligand-dependent nuclear receptor transcription coactivator activity (GO:0030374)|protein C-terminus binding (GO:0008022)|protein domain specific binding (GO:0019904)|receptor activity (GO:0004872)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II transcription cofactor activity (GO:0001104)|RNA polymerase II transcription factor binding transcription factor activity involved in positive regulation of transcription (GO:0001190)|thyroid hormone receptor binding (GO:0046966)|transcription coactivator activity (GO:0003713)|transcription cofactor activity (GO:0003712)|vitamin D receptor binding (GO:0042809)			breast(6)|central_nervous_system(2)|endometrium(22)|kidney(5)|large_intestine(8)|lung(31)|ovary(2)|pancreas(1)|prostate(11)|skin(5)|soft_tissue(323)|upper_aerodigestive_tract(1)|urinary_tract(3)	420	Renal(35;0.156)					AGCTACTGCAGGTATGTGTCA	0.498			"""M, S"""		uterine leiomyoma		Opitz-Kaveggia Syndrome																																	Dom	yes		X	Xq13	9968	mediator complex subunit 12	Yes	M	0													65.0	62.0	63.0					X																	70342457		1955	4131	6086	SO:0001630	splice_region_variant	9968			U80742	CCDS43970.1	Xq13	2011-02-14	2007-07-30	2004-11-26	ENSG00000184634	ENSG00000184634			11957	protein-coding gene	gene with protein product		300188	"""trinucleotide repeat containing 11 (THR-associated protein, 230kDa subunit)"", ""mediator of RNA polymerase II transcription, subunit 12 homolog (S. cerevisiae)"", ""FG syndrome 1"""	TNRC11, FGS1		9225980, 10198638, 17334363, 20507344	Standard	NM_005120		Approved	CAGH45, HOPA, OPA1, TRAP230, KIAA0192, OKS	uc004dyy.3	Q93074	OTTHUMG00000021788	ENST00000374080.3:c.1348+1G>C	X.37:g.70342457G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O15410|O75557|Q9UHV6|Q9UND7	Missense_Mutation	SNP	pfam_Mediator_Med12_LCEWAV,pfam_Mediator_Med12_catenin-bd,pfam_Mediator_Med12	p.G450R	ENST00000374080.3	37	c.1348	CCDS43970.1	X	.	.	.	.	.	.	.	.	.	.	.	19.17	3.775298	0.70107	.	.	ENSG00000184634	ENST00000333646;ENST00000536756;ENST00000374102;ENST00000374080;ENST00000430072	T;T;T;T	0.34072	1.38;1.38;1.38;1.38	4.85	4.85	0.62838	Mediator complex, subunit Med12, LCEWAV-domain (1);	0.000000	0.85682	D	0.000000	T	0.63331	0.2502	M	0.86420	2.815	0.80722	D	1	B;P;D;P	0.54772	0.387;0.946;0.968;0.936	B;P;P;P	0.60949	0.409;0.767;0.881;0.756	T	0.72067	-0.4402	10	0.87932	D	0	-14.4362	17.2392	0.87008	0.0:0.0:1.0:0.0	.	450;297;450;450	F5H3Y1;Q7Z3Z5;Q93074-3;Q93074	.;.;.;MED12_HUMAN	R	450;450;450;450;418	ENSP00000333125:G450R;ENSP00000363215:G450R;ENSP00000363193:G450R;ENSP00000414203:G418R	ENSP00000333125:G450R	G	+	1	0	MED12	70259182	1.000000	0.71417	1.000000	0.80357	0.793000	0.44817	8.983000	0.93477	2.251000	0.74343	0.502000	0.49764	GGC	MED12	-	pfam_Mediator_Med12_LCEWAV		0.498	MED12-002	KNOWN	basic|appris_candidate|CCDS	protein_coding	MED12	HGNC	protein_coding	OTTHUMT00000057105.1	G	NM_005120	Missense_Mutation	70342457	+1	no_errors	ENST00000333646	ensembl	human	known	70_37	missense	SNP	1.000	C
MEGF11	84465	genome.wustl.edu	37	15	66262906	66262906	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr15:66262906C>G	ENST00000409699.2	-	8	1056	c.884G>C	c.(883-885)gGa>gCa	p.G295A	MEGF11_ENST00000395625.2_Missense_Mutation_p.G220A|MEGF11_ENST00000395614.1_5'UTR|MEGF11_ENST00000422354.1_Missense_Mutation_p.G295A|MEGF11_ENST00000288745.3_Missense_Mutation_p.G220A|MEGF11_ENST00000360698.4_Missense_Mutation_p.G295A			A6BM72	MEG11_HUMAN	multiple EGF-like-domains 11	295	EGF-like 5. {ECO:0000255|PROSITE- ProRule:PRU00076}.				homotypic cell-cell adhesion (GO:0034109)|retina layer formation (GO:0010842)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)				breast(2)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(4)|lung(4)|pancreas(1)|prostate(1)|upper_aerodigestive_tract(1)	19						CCCCATGTATCCAGCTGTACA	0.507																																																	0													134.0	98.0	110.0					15																	66262906		2201	4299	6500	SO:0001583	missense	84465			AB058677	CCDS10213.2	15q22.31	2006-03-31			ENSG00000157890	ENSG00000157890			29635	protein-coding gene	gene with protein product		612454				11347906	Standard	NM_032445		Approved	KIAA1781, DKFZp434L121	uc002apm.2	A6BM72	OTTHUMG00000133175	ENST00000409699.2:c.884G>C	15.37:g.66262906C>G	ENSP00000386908:p.Gly295Ala	Somatic		WXS	Illumina HiSeq	Phase_IV	Q17R86|Q6UXS5|Q8ND91|Q96KG6	Missense_Mutation	SNP	pfam_EGF_laminin,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom,pfscan_EGF_laminin,pfscan_EMI_domain	p.G295A	ENST00000409699.2	37	c.884	CCDS10213.2	15	.	.	.	.	.	.	.	.	.	.	C	24.2	4.501732	0.85176	.	.	ENSG00000157890	ENST00000409699;ENST00000288745;ENST00000422354;ENST00000395625;ENST00000360698	T;T;T;T;T	0.71934	-0.61;-0.61;-0.61;-0.61;-0.61	4.73	4.73	0.59995	EGF-like, laminin (3);EGF-like region, conserved site (2);Epidermal growth factor-like, type 3 (1);	0.000000	0.40222	U	0.001160	D	0.89487	0.6729	H	0.96691	3.865	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.83275	0.996;0.996	D	0.93078	0.6489	10	0.87932	D	0	.	16.8657	0.86028	0.0:1.0:0.0:0.0	.	295;220	A6BM72;A6BM72-2	MEG11_HUMAN;.	A	295;220;295;220;295	ENSP00000386908:G295A;ENSP00000288745:G220A;ENSP00000414475:G295A;ENSP00000378987:G220A;ENSP00000353919:G295A	ENSP00000288745:G220A	G	-	2	0	MEGF11	64049960	1.000000	0.71417	0.994000	0.49952	0.995000	0.86356	7.411000	0.80078	2.452000	0.82932	0.462000	0.41574	GGA	MEGF11	-	pfam_EGF_laminin,pfam_EGF_extracell,smart_EG-like_dom,smart_EGF_laminin,pfscan_EG-like_dom		0.507	MEGF11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MEGF11	HGNC	protein_coding	OTTHUMT00000329307.2	C	NM_032445		66262906	-1	no_errors	ENST00000409699	ensembl	human	known	70_37	missense	SNP	1.000	G
MIR2117	100313779	genome.wustl.edu	37	17	41522139	41522139	+	lincRNA	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:41522139G>C	ENST00000516780.1	+	0	0				RNU6-406P_ENST00000516470.1_RNA	NR_031751.1				microRNA 2117																		CATGTTTATAGAGAGAGCAGT	0.468																																																	0													142.0	125.0	130.0					17																	41522139		692	1591	2283			100313779					17	2011-09-12			ENSG00000252589			"""ncRNAs / Micro RNAs"""	37311	non-coding RNA	RNA, micro							Standard	NR_031751		Approved	hsa-mir-2117	uc021txz.1				17.37:g.41522139G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000516780.1	37	NULL		17																																																																																			hsa-mir-2117	-	-		0.468	MIR2117-201	KNOWN	basic	miRNA	MIR2117	miRBase	lincRNA		G	NR_031751		41522139	+1	no_errors	ENST00000588060	ensembl	human	known	70_37	rna	SNP	0.351	C
MPL	4352	genome.wustl.edu	37	1	43812572	43812572	+	Silent	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:43812572C>G	ENST00000372470.3	+	8	1317	c.1275C>G	c.(1273-1275)ctC>ctG	p.L425L	MPL_ENST00000413998.2_Silent_p.L425L	NM_005373.2	NP_005364.1	P40238	TPOR_HUMAN	MPL proto-oncogene, thrombopoietin receptor	425	Fibronectin type-III 2. {ECO:0000255|PROSITE-ProRule:PRU00316}.				blood coagulation (GO:0007596)|cell proliferation (GO:0008283)|cell surface receptor signaling pathway (GO:0007166)|homeostasis of number of cells (GO:0048872)|platelet activation (GO:0030168)|regulation of chemokine production (GO:0032642)	integral component of plasma membrane (GO:0005887)|plasma membrane (GO:0005886)	cytokine receptor activity (GO:0004896)|transmembrane signaling receptor activity (GO:0004888)			central_nervous_system(1)|endometrium(1)|haematopoietic_and_lymphoid_tissue(551)|large_intestine(3)|lung(7)|pancreas(1)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(1)	567	all_hematologic(146;0.0958)|Acute lymphoblastic leukemia(166;0.155)	Myeloproliferative disorder(586;0.0505)			Eltrombopag(DB06210)|Romiplostim(DB05332)	GTTATCAACTCCGATACACAG	0.572			Mis		MPD	MPD	congenital amegakaryocytic thrombocytopenia																														NSCLC(52;534 1204 10016 41452 44427)		yes	Dom	yes	Familial essential thrombocythemia	1	p34	4352	"""myeloproliferative leukemia virus oncogene, thrombopoietin receptor"""	yes	L	0													54.0	49.0	51.0					1																	43812572		2203	4300	6503	SO:0001819	synonymous_variant	4352			M90102	CCDS483.1	1p34	2014-09-17	2014-06-26		ENSG00000117400	ENSG00000117400		"""CD molecules"", ""Fibronectin type III domain containing"""	7217	protein-coding gene	gene with protein product		159530	"""myeloproliferative leukemia virus oncogene"""			1608974	Standard	NM_005373		Approved	CD110, TPOR	uc001ciw.3	P40238	OTTHUMG00000007429	ENST00000372470.3:c.1275C>G	1.37:g.43812572C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5JUZ0	Silent	SNP	pfam_Growth/epo_recpt_lig-bind,pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3	p.L425	ENST00000372470.3	37	c.1275	CCDS483.1	1																																																																																			MPL	-	pfam_Fibronectin_type3,superfamily_Fibronectin_type3,smart_Fibronectin_type3,pfscan_Fibronectin_type3		0.572	MPL-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MPL	HGNC	protein_coding	OTTHUMT00000019522.1	C	NM_005373		43812572	+1	no_errors	ENST00000372470	ensembl	human	known	70_37	silent	SNP	0.997	G
MSH5	4439	genome.wustl.edu	37	6	31725965	31725965	+	Silent	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:31725965G>C	ENST00000375755.3	+	13	1324	c.1038G>C	c.(1036-1038)ctG>ctC	p.L346L	MSH5_ENST00000375742.3_Silent_p.L363L|MSH5_ENST00000395853.1_Silent_p.L20L|MSH5_ENST00000375750.3_Silent_p.L346L|MSH5-SAPCD1_ENST00000493662.2_Silent_p.L363L|MSH5_ENST00000431848.2_Silent_p.L45L|RNU6-850P_ENST00000516934.1_RNA|MSH5_ENST00000534153.4_Silent_p.L363L|MSH5_ENST00000375703.3_Silent_p.L346L|MSH5_ENST00000375740.3_Silent_p.L363L	NM_002441.4	NP_002432.1	O43196	MSH5_HUMAN	mutS homolog 5	346					ATP catabolic process (GO:0006200)|chiasma assembly (GO:0051026)|homologous chromosome segregation (GO:0045143)|mismatch repair (GO:0006298)|reciprocal meiotic recombination (GO:0007131)	synaptonemal complex (GO:0000795)	ATP binding (GO:0005524)|DNA-dependent ATPase activity (GO:0008094)|mismatched DNA binding (GO:0030983)	p.L346L(1)|p.L363L(1)		breast(1)|ovary(2)|skin(2)	5						CCCTGGGCCTGAGGGATGCCT	0.567								Direct reversal of damage;Mismatch excision repair (MMR)																																									2	Substitution - coding silent(2)	lung(2)											81.0	75.0	77.0					6																	31725965		1507	2708	4215	SO:0001819	synonymous_variant	4439			AF070071	CCDS4720.1, CCDS34409.1, CCDS34410.1, CCDS34409.2	6p21.3	2013-09-12	2013-09-12		ENSG00000204410	ENSG00000204410			7328	protein-coding gene	gene with protein product		603382	"""mutS (E. coli) homolog 5"", ""mutS homolog 5 (E. coli)"""			9740671, 9787078, 17977839	Standard	NM_002441		Approved		uc011hbg.2	O43196	OTTHUMG00000167551	ENST00000375755.3:c.1038G>C	6.37:g.31725965G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B0V033|B0V034|O60586|Q5BLU9|Q5SSR1|Q8IW44|Q9BQC7	Silent	SNP	pfam_DNA_mismatch_repair_MutS_C,pfam_DNA_mismatch_repair_MutS_core,pfam_DNA_mismatch_repair_MutS_clamp,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_C	p.L363	ENST00000375755.3	37	c.1089	CCDS4720.1	6																																																																																			MSH5	-	pfam_DNA_mismatch_repair_MutS_core,superfamily_DNA_mismatch_repair_MutS_core,smart_DNA_mismatch_repair_MutS_core		0.567	MSH5-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	MSH5	HGNC	protein_coding	OTTHUMT00000076243.4	G			31725965	+1	no_errors	ENST00000375742	ensembl	human	known	70_37	silent	SNP	0.993	C
MT-ND5	4540	genome.wustl.edu	37	M	12925	12925	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrM:12925G>A	ENST00000361567.2	+	1	589	c.589G>A	c.(589-591)Gac>Aac	p.D197N	MT-TR_ENST00000387439.1_RNA|MT-TG_ENST00000387429.1_RNA|MT-CYB_ENST00000361789.2_5'Flank|MT-TT_ENST00000387460.2_RNA|MT-TS2_ENST00000387449.1_RNA|MT-TE_ENST00000387459.1_RNA|MT-TH_ENST00000387441.1_RNA|MT-TL2_ENST00000387456.1_RNA			P03915	NU5M_HUMAN	mitochondrially encoded NADH dehydrogenase 5	197					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	integral component of membrane (GO:0016021)|mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(4)|endometrium(29)|kidney(33)|pancreas(1)|prostate(7)	74						CCAACTCATGAGACCCACAAC	0.498																																																	0																																										SO:0001583	missense	4540					mitochondria	2011-07-04	2005-02-15	2005-02-16	ENSG00000198786	ENSG00000198786	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7461	protein-coding gene	gene with protein product	"""complex I ND5 subunit"", ""NADH-ubiquinone oxidoreductase chain 5"""	516005	"""NADH dehydrogenase 5"""	MTND5			Standard			Approved	ND5, NAD5		P03915		ENST00000361567.2:c.589G>A	M.37:g.12925G>A	ENSP00000354813:p.Asp197Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q34773|Q8WCY3	Missense_Mutation	SNP	pfam_NADH_UbQ/plastoQ_OxRdtase,pfam_NADH_DH_su5_C,pfam_NADH_UbQ_OxRdtase_chain5/L_N,tigrfam_NADHpl_OxRdtase_5	p.D197N	ENST00000361567.2	37	c.589		MT																																																																																			MT-ND5	-	pfam_NADH_UbQ/plastoQ_OxRdtase,tigrfam_NADHpl_OxRdtase_5		0.498	MT-ND5-201	KNOWN	basic|appris_principal	protein_coding	MT-ND5	HGNC	protein_coding		G	YP_003024036		12925	+1	no_errors	ENST00000361567	ensembl	human	known	70_37	missense	SNP	NULL	A
MTR	4548	genome.wustl.edu	37	1	236995308	236995309	+	Frame_Shift_Ins	INS	-	-	CATTT			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:236995308_236995309insCATTT	ENST00000366577.5	+	13	1512_1513	c.1118_1119insCATTT	c.(1117-1122)aacattfs	p.-374fs	MTR_ENST00000535889.1_Frame_Shift_Ins_p.-374fs	NM_000254.2	NP_000245.2	Q99707	METH_HUMAN	5-methyltetrahydrofolate-homocysteine methyltransferase						cellular nitrogen compound metabolic process (GO:0034641)|cobalamin metabolic process (GO:0009235)|methylation (GO:0032259)|nervous system development (GO:0007399)|pteridine-containing compound metabolic process (GO:0042558)|small molecule metabolic process (GO:0044281)|sulfur amino acid metabolic process (GO:0000096)|vitamin metabolic process (GO:0006766)|water-soluble vitamin metabolic process (GO:0006767)|xenobiotic metabolic process (GO:0006805)	cytosol (GO:0005829)	cobalamin binding (GO:0031419)|methionine synthase activity (GO:0008705)|S-adenosylmethionine-homocysteine S-methyltransferase activity (GO:0008898)|zinc ion binding (GO:0008270)			breast(4)|central_nervous_system(1)|cervix(1)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(1)|large_intestine(8)|lung(30)|ovary(1)|pancreas(1)|prostate(2)|skin(4)|stomach(1)|upper_aerodigestive_tract(1)	67	Ovarian(103;0.0634)|Breast(184;0.221)	all_cancers(173;2.79e-22)|all_epithelial(177;4.84e-14)|Breast(1374;0.00123)|Prostate(94;0.0181)|Lung SC(1967;0.0262)|Acute lymphoblastic leukemia(190;0.117)	OV - Ovarian serous cystadenocarcinoma(106;0.0106)	KIRC - Kidney renal clear cell carcinoma(1967;0.248)	Cyanocobalamin(DB00115)|Hydroxocobalamin(DB00200)|L-Methionine(DB00134)|Tetrahydrofolic acid(DB00116)	AACTTTGTTAACATTGGAGAGC	0.416																																																	0																																										SO:0001589	frameshift_variant	4548			U73338	CCDS1614.1, CCDS73054.1	1q43	2011-05-12			ENSG00000116984	ENSG00000116984	2.1.1.13		7468	protein-coding gene	gene with protein product		156570				8968735	Standard	NM_000254		Approved	cblG	uc001hyi.4	Q99707	OTTHUMG00000040060	Exception_encountered	1.37:g.236995308_236995309insCATTT	ENSP00000355536:p.Ile374fs	Somatic		WXS	Illumina HiSeq	Phase_IV	A1L4N8|A9Z1W4|B9EGF7|Q99713|Q99723	Frame_Shift_Ins	INS	pfam_S_MeTrfase,pfam_VitB12-dep_Met_synth_activ_dom,pfam_Pterin-binding,pfam_Cbl-bd_cap,pfam_Cobalamin-bd,superfamily_VitB12-dep_Met_synth_activ_dom,superfamily_S_MeTrfase,superfamily_Dihydropteroate_synth-like,superfamily_Cobalamin-bd,superfamily_Cbl-bd_cap,pirsf_MetH,pfscan_VitB12-dep_Met_synth_activ_dom,pfscan_S_MeTrfase,pfscan_Pterin-binding,tigrfam_MetH	p.G375fs	ENST00000366577.5	37	c.1118_1119	CCDS1614.1	1																																																																																			MTR	-	pfam_Pterin-binding,superfamily_S_MeTrfase,superfamily_Dihydropteroate_synth-like,pirsf_MetH,pfscan_Pterin-binding,tigrfam_MetH		0.416	MTR-001	KNOWN	basic|appris_principal|CCDS	protein_coding	MTR	HGNC	protein_coding	OTTHUMT00000096632.2	-	NM_000254		236995309	+1	no_errors	ENST00000366577	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	CATTT
MYT1L	23040	genome.wustl.edu	37	2	1915828	1915828	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:1915828C>T	ENST00000399161.2	-	12	2420	c.1673G>A	c.(1672-1674)cGc>cAc	p.R558H	MYT1L_ENST00000428368.2_Missense_Mutation_p.R556H	NM_015025.2	NP_055840.2	Q9UL68	MYT1L_HUMAN	myelin transcription factor 1-like	558					cell differentiation (GO:0030154)|nervous system development (GO:0007399)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(2)|endometrium(5)|kidney(6)|large_intestine(16)|lung(50)|ovary(5)|prostate(2)|skin(6)|upper_aerodigestive_tract(1)|urinary_tract(2)	97	Acute lymphoblastic leukemia(172;0.0627)|all_hematologic(175;0.0797)	all_cancers(51;0.037)|all_epithelial(98;0.241)		OV - Ovarian serous cystadenocarcinoma(76;0.169)|all cancers(51;0.244)		GACATGCCCGCGCCCCGTGCA	0.597																																																	0													45.0	48.0	47.0					2																	1915828		2055	4221	6276	SO:0001583	missense	23040			AF036943	CCDS46222.1	2p25.3	2013-01-10			ENSG00000186487	ENSG00000186487		"""Zinc fingers, C2HC-type containing"""	7623	protein-coding gene	gene with protein product	"""neural zinc finger transcription factor 1"""	613084				9373037	Standard	XM_006711862		Approved	KIAA1106, NZF1, ZC2HC4B	uc002qxd.3	Q9UL68	OTTHUMG00000151407	ENST00000399161.2:c.1673G>A	2.37:g.1915828C>T	ENSP00000382114:p.Arg558His	Somatic		WXS	Illumina HiSeq	Phase_IV	A7E2C7|B2RP54|Q6IQ17|Q9UPP6	Missense_Mutation	SNP	pfam_Myelin_TF,pfam_Znf_C2HC	p.R558H	ENST00000399161.2	37	c.1673		2	.	.	.	.	.	.	.	.	.	.	C	32	5.109976	0.94292	.	.	ENSG00000186487	ENST00000399161;ENST00000295067;ENST00000428368	T;T	0.57107	0.43;0.42	5.24	5.24	0.73138	.	0.000000	0.85682	D	0.000000	T	0.72020	0.3409	M	0.65975	2.015	0.80722	D	1	D;D	0.89917	1.0;0.999	D;D	0.73380	0.98;0.966	T	0.74463	-0.3657	10	0.72032	D	0.01	-14.8821	19.1783	0.93612	0.0:1.0:0.0:0.0	.	558;556	Q9UL68;Q9UL68-4	MYT1L_HUMAN;.	H	558;504;556	ENSP00000382114:R558H;ENSP00000396103:R556H	ENSP00000295067:R504H	R	-	2	0	MYT1L	1894835	1.000000	0.71417	1.000000	0.80357	0.986000	0.74619	7.677000	0.84024	2.595000	0.87683	0.561000	0.74099	CGC	MYT1L	-	pfam_Znf_C2HC		0.597	MYT1L-001	KNOWN	basic|appris_candidate_longest	protein_coding	MYT1L	HGNC	protein_coding	OTTHUMT00000322493.1	C	NM_015025		1915828	-1	no_errors	ENST00000399161	ensembl	human	known	70_37	missense	SNP	1.000	T
NAA40	79829	genome.wustl.edu	37	11	63706541	63706541	+	5'UTR	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:63706541G>A	ENST00000377793.4	+	0	74				NAA40_ENST00000539656.1_5'UTR|NAA40_ENST00000542163.1_5'Flank|NAA40_ENST00000456907.2_5'UTR|NAA40_ENST00000536939.1_3'UTR	NM_024771.2	NP_079047.2	Q86UY6	NAA40_HUMAN	N(alpha)-acetyltransferase 40, NatD catalytic subunit						lipid metabolic process (GO:0006629)		N-acetyltransferase activity (GO:0008080)			NS(1)|endometrium(1)|lung(2)|prostate(1)	5						AGTGTGTGAAGAAGAAGCTGA	0.677																																																	0													48.0	51.0	50.0					11																	63706541		2201	4297	6498	SO:0001623	5_prime_UTR_variant	79829			AK023910	CCDS8053.1, CCDS73311.1	11q13.1	2013-10-11	2013-08-28	2010-01-14	ENSG00000110583	ENSG00000110583		"""N(alpha)-acetyltransferase subunits"""	25845	protein-coding gene	gene with protein product			"""N-acetyltransferase 11"", ""N-acetyltransferase 11 (GCN5-related, putative)"", ""N(alpha)-acetyltransferase 40, NatD catalytic subunit, homolog (S. cerevisiae)"""	NAT11		19660095	Standard	XM_005274296		Approved	FLJ13848	uc009yoz.3	Q86UY6	OTTHUMG00000167784	ENST00000377793.4:c.-28G>A	11.37:g.63706541G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DR03|B4DU10|Q5HYL5|Q9H897	RNA	SNP	-	NULL	ENST00000377793.4	37	NULL	CCDS8053.1	11																																																																																			NAA40	-	-		0.677	NAA40-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NAA40	HGNC	protein_coding	OTTHUMT00000396266.1	G	NM_024771		63706541	+1	no_errors	ENST00000536939	ensembl	human	known	70_37	rna	SNP	0.760	A
NALCN	259232	genome.wustl.edu	37	13	102047655	102047655	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr13:102047655G>A	ENST00000251127.6	-	3	251	c.170C>T	c.(169-171)aCg>aTg	p.T57M	NALCN_ENST00000376196.3_Missense_Mutation_p.T57M|NALCN_ENST00000470333.1_5'UTR|NALCN_ENST00000376200.5_Missense_Mutation_p.T57M	NM_052867.2	NP_443099.1	Q8IZF0	NALCN_HUMAN	sodium leak channel, non-selective	57					calcium ion import (GO:0070509)|calcium ion transmembrane transport (GO:0070588)|cell death (GO:0008219)|ion transmembrane transport (GO:0034220)|membrane depolarization during action potential (GO:0086010)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	sodium channel activity (GO:0005272)|voltage-gated calcium channel activity (GO:0005245)	p.T57R(1)		NS(1)|autonomic_ganglia(2)|breast(6)|central_nervous_system(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(3)|kidney(10)|large_intestine(33)|liver(2)|lung(81)|ovary(8)|pancreas(3)|prostate(5)|skin(6)|stomach(2)|upper_aerodigestive_tract(2)|urinary_tract(1)	177	all_neural(89;0.0438)|Medulloblastoma(90;0.163)|Lung SC(71;0.184)					GGTCATTGGCGTATTCATACA	0.443																																																	1	Substitution - Missense(1)	large_intestine(1)											154.0	118.0	130.0					13																	102047655		2203	4300	6503	SO:0001583	missense	259232			AY141972	CCDS9498.1	13q32.3	2012-02-21	2007-04-26	2007-04-26	ENSG00000102452	ENSG00000102452		"""Ion channels / Sodium leak channels, non-selective"""	19082	protein-coding gene	gene with protein product		611549	"""voltage gated channel like 1"""	VGCNL1		17448995	Standard	XM_006719943		Approved	bA430M15.1, CanIon	uc001vox.1	Q8IZF0	OTTHUMG00000017295	ENST00000251127.6:c.170C>T	13.37:g.102047655G>A	ENSP00000251127:p.Thr57Met	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6P2S6|Q6ZMI7|Q8IZZ1|Q8TAH1	Missense_Mutation	SNP	pfam_Ion_trans_dom	p.T57M	ENST00000251127.6	37	c.170	CCDS9498.1	13	.	.	.	.	.	.	.	.	.	.	G	23.2	4.387569	0.82902	.	.	ENSG00000102452	ENST00000251127;ENST00000376196;ENST00000376200;ENST00000449582	D;D;D	0.97791	-4.54;-4.54;-4.54	5.67	5.67	0.87782	.	0.000000	0.85682	D	0.000000	D	0.98648	0.9547	M	0.77103	2.36	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.97110	1.0;1.0	D	0.98516	1.0621	10	0.36615	T	0.2	.	19.7619	0.96323	0.0:0.0:1.0:0.0	.	57;57	F2Z323;Q8IZF0	.;NALCN_HUMAN	M	57	ENSP00000251127:T57M;ENSP00000365367:T57M;ENSP00000365373:T57M	ENSP00000251127:T57M	T	-	2	0	NALCN	100845656	1.000000	0.71417	0.999000	0.59377	0.693000	0.40251	9.476000	0.97823	2.681000	0.91329	0.561000	0.74099	ACG	NALCN	-	NULL		0.443	NALCN-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NALCN	HGNC	protein_coding	OTTHUMT00000045663.2	G	NM_052867		102047655	-1	no_errors	ENST00000251127	ensembl	human	known	70_37	missense	SNP	1.000	A
NBEAL1	65065	genome.wustl.edu	37	2	203922058	203922058	+	Frame_Shift_Del	DEL	A	A	-			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:203922058delA	ENST00000449802.1	+	6	730	c.397delA	c.(397-399)aaafs	p.K135fs	NBEAL1_ENST00000478884.1_3'UTR	NM_001114132.1	NP_001107604.1	Q6ZS30	NBEL1_HUMAN	neurobeachin-like 1	135										NS(1)|breast(3)|cervix(1)|endometrium(4)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(8)|liver(1)|lung(8)|ovary(1)|prostate(2)|skin(1)|upper_aerodigestive_tract(1)	37						GTTAAAAAGCAAAAAAAAAGA	0.318																																																	0										21,2035		5,11,1012	127.0	110.0	115.0			4.0	1.0	2		117	67,4497		16,35,2231	no	frameshift	NBEAL1	NM_001114132.1		21,46,3243	A1A1,A1R,RR		1.468,1.0214,1.3293			203922058	88,6532	692	1589	2281	SO:0001589	frameshift_variant	65065			AY172970	CCDS46495.1	2q33	2013-01-10			ENSG00000144426	ENSG00000144426		"""WD repeat domain containing"""	20681	protein-coding gene	gene with protein product		609816	"""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 17"", ""amyotrophic lateral sclerosis 2 (juvenile) chromosome region, candidate 16"""	ALS2CR17, ALS2CR16		15193433	Standard	NM_001114132		Approved	MGC164581	uc002uzt.3	Q6ZS30	OTTHUMG00000154129	ENST00000449802.1:c.397delA	2.37:g.203922058delA	ENSP00000399903:p.Lys135fs	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NHD5|Q6Y876|Q6ZP36|Q6ZQY5|Q8N8R4|Q96Q30|Q96Q31	Frame_Shift_Del	DEL	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ConA-like_lec_gl_sf,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.E136fs	ENST00000449802.1	37	c.397	CCDS46495.1	2																																																																																			NBEAL1	-	superfamily_ARM-type_fold		0.318	NBEAL1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NBEAL1	HGNC	protein_coding	OTTHUMT00000333982.4	A			203922058	+1	no_errors	ENST00000449802	ensembl	human	known	70_37	frame_shift_del	DEL	1.000	-
NDUFB7	4713	genome.wustl.edu	37	19	14676998	14676998	+	Missense_Mutation	SNP	C	C	G	rs1042349		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:14676998C>G	ENST00000215565.2	-	3	422	c.361G>C	c.(361-363)Gag>Cag	p.E121Q		NM_004146.5	NP_004137.2	P17568	NDUB7_HUMAN	NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7, 18kDa	121					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial intermembrane space (GO:0005758)|mitochondrial respiratory chain complex I (GO:0005747)|mitochondrion (GO:0005739)	NADH dehydrogenase (ubiquinone) activity (GO:0008137)			endometrium(3)|large_intestine(2)|lung(2)|ovary(1)	8						TTGGCCAACTCTGCCGCCTTC	0.622																																																	0													25.0	30.0	29.0					19																	14676998		2203	4300	6503	SO:0001583	missense	4713				CCDS12314.1	19p13.12	2011-07-04	2002-08-29		ENSG00000099795	ENSG00000099795		"""Mitochondrial respiratory chain complex / Complex I"""	7702	protein-coding gene	gene with protein product	"""NADH-ubiquinone oxidoreductase B18 subunit"", ""complex I B18 subunit"""	603842	"""NADH dehydrogenase (ubiquinone) 1 beta subcomplex, 7 (18kD, B18)"""			9763677, 10830904	Standard	NM_004146		Approved	B18, CI-B18, MGC2480	uc002mzg.3	P17568		ENST00000215565.2:c.361G>C	19.37:g.14676998C>G	ENSP00000215565:p.Glu121Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q6ICN9|Q9UI16	Missense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_B18_su	p.E121Q	ENST00000215565.2	37	c.361	CCDS12314.1	19	.	.	.	.	.	.	.	.	.	.	C	10.04	1.241541	0.22711	.	.	ENSG00000099795	ENST00000215565	T	0.45668	0.89	4.96	-1.48	0.08745	.	1.934030	0.02931	N	0.139249	T	0.20455	0.0492	N	0.08118	0	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.14227	-1.0480	10	0.10636	T	0.68	-5.0589	5.8007	0.18412	0.1205:0.3248:0.4702:0.0845	.	121	P17568	NDUB7_HUMAN	Q	121	ENSP00000215565:E121Q	ENSP00000215565:E121Q	E	-	1	0	NDUFB7	14537998	0.002000	0.14202	0.001000	0.08648	0.065000	0.16274	0.982000	0.29539	0.048000	0.15891	0.585000	0.79938	GAG	NDUFB7	-	NULL		0.622	NDUFB7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NDUFB7	HGNC	protein_coding	OTTHUMT00000466025.1	C	NM_004146		14676998	-1	no_errors	ENST00000215565	ensembl	human	known	70_37	missense	SNP	0.006	G
NDUFV1	4723	genome.wustl.edu	37	11	67378577	67378577	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:67378577C>G	ENST00000322776.6	+	6	965	c.812C>G	c.(811-813)tCa>tGa	p.S271*	NDUFV1_ENST00000529927.1_Nonsense_Mutation_p.S262*|DOC2GP_ENST00000495263.1_RNA|NDUFV1_ENST00000526169.1_3'UTR|NDUFV1_ENST00000532303.1_Nonsense_Mutation_p.S170*|NDUFV1_ENST00000415352.2_Nonsense_Mutation_p.S264*	NM_001166102.1|NM_007103.3	NP_001159574.1|NP_009034.2	P49821	NDUV1_HUMAN	NADH dehydrogenase (ubiquinone) flavoprotein 1, 51kDa	271					cellular metabolic process (GO:0044237)|mitochondrial electron transport, NADH to ubiquinone (GO:0006120)|respiratory electron transport chain (GO:0022904)|small molecule metabolic process (GO:0044281)	mitochondrial inner membrane (GO:0005743)|mitochondrial respiratory chain complex I (GO:0005747)	4 iron, 4 sulfur cluster binding (GO:0051539)|FMN binding (GO:0010181)|metal ion binding (GO:0046872)|NAD binding (GO:0051287)|NADH dehydrogenase (ubiquinone) activity (GO:0008137)			breast(1)|endometrium(3)|large_intestine(2)|lung(7)|prostate(1)|skin(2)	16						GAACGCAACTCAGGCACCAAA	0.547																																																	0													129.0	107.0	115.0					11																	67378577		2200	4294	6494	SO:0001587	stop_gained	4723			AF092131	CCDS8173.1, CCDS53669.1	11q13	2011-07-04	2002-08-29		ENSG00000167792	ENSG00000167792	1.6.5.3	"""Mitochondrial respiratory chain complex / Complex I"""	7716	protein-coding gene	gene with protein product	"""complex I 51kDa subunit"", ""NADH dehydrogenase [ubiquinone] flavoprotein 1, mitochondrial"""	161015	"""NADH dehydrogenase (ubiquinone) flavoprotein 1 (51kD)"""			1478657	Standard	NM_007103		Approved	CI-51K	uc001omj.2	P49821	OTTHUMG00000166215	ENST00000322776.6:c.812C>G	11.37:g.67378577C>G	ENSP00000322450:p.Ser271*	Somatic		WXS	Illumina HiSeq	Phase_IV	O60924|O60940|Q16104|Q6IBR3|Q96BF8|Q96HS7	Nonsense_Mutation	SNP	pfam_NADH_UbQ_OxRdtase_51kDa_su,pfam_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,pfam_Soluble_ligand-bd,smart_NADH-UbQ_OxRdtase_Fsu_4Fe4S-bd,tigrfam_NADH-UbQ_OxRdtase_suF	p.S271*	ENST00000322776.6	37	c.812	CCDS8173.1	11	.	.	.	.	.	.	.	.	.	.	C	38	6.702711	0.97776	.	.	ENSG00000167792	ENST00000322776;ENST00000532303;ENST00000529927;ENST00000415352;ENST00000453836	.	.	.	4.84	4.84	0.62591	.	0.064020	0.64402	D	0.000005	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.56958	D	0.05	-7.3479	16.6632	0.85246	0.0:1.0:0.0:0.0	.	.	.	.	X	271;170;262;264;142	.	ENSP00000322450:S271X	S	+	2	0	NDUFV1	67135153	1.000000	0.71417	0.968000	0.41197	0.920000	0.55202	7.558000	0.82253	2.506000	0.84524	0.491000	0.48974	TCA	NDUFV1	-	tigrfam_NADH-UbQ_OxRdtase_suF		0.547	NDUFV1-001	KNOWN	basic|appris_candidate_longest|exp_conf|CCDS	protein_coding	NDUFV1	HGNC	protein_coding	OTTHUMT00000388406.1	C	NM_007103		67378577	+1	no_errors	ENST00000322776	ensembl	human	known	70_37	nonsense	SNP	1.000	G
NIN	51199	genome.wustl.edu	37	14	51221467	51221467	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:51221467C>G	ENST00000382041.3	-	19	4847	c.4657G>C	c.(4657-4659)Gaa>Caa	p.E1553Q	NIN_ENST00000324330.9_Missense_Mutation_p.E1553Q|NIN_ENST00000382043.4_Missense_Mutation_p.E840Q|NIN_ENST00000453196.1_Missense_Mutation_p.E1553Q|NIN_ENST00000389868.3_Missense_Mutation_p.E840Q|NIN_ENST00000245441.5_Missense_Mutation_p.E1553Q|NIN_ENST00000530997.2_Missense_Mutation_p.E1553Q	NM_016350.4|NM_182946.1	NP_057434.4|NP_891991	Q8N4C6	NIN_HUMAN	ninein (GSK3B interacting protein)	1553					centrosome localization (GO:0051642)|centrosome-templated microtubule nucleation (GO:0090222)|microtubule anchoring at centrosome (GO:0034454)	centriole (GO:0005814)|centrosome (GO:0005813)|microtubule (GO:0005874)|nucleolus (GO:0005730)|spindle pole (GO:0000922)	calcium ion binding (GO:0005509)|GTP binding (GO:0005525)			breast(4)|central_nervous_system(1)|cervix(2)|endometrium(10)|kidney(5)|large_intestine(13)|lung(16)|ovary(1)|pancreas(1)|prostate(5)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(5)	71	all_epithelial(31;0.00244)|Breast(41;0.127)					taccacatttcttcctgagat	0.279			T	PDGFRB	MPD																																			Dom	yes		14	14q24	51199	ninein (GSK3B interacting protein)		L	0													73.0	63.0	66.0					14																	51221467		2193	4284	6477	SO:0001583	missense	51199			AF212162	CCDS32078.1, CCDS32079.1, CCDS32078.2	14q21-q22	2013-01-10			ENSG00000100503	ENSG00000100503		"""EF-hand domain containing"""	14906	protein-coding gene	gene with protein product		608684				11004522, 11162463	Standard	NM_020921		Approved		uc001wyi.3	Q8N4C6	OTTHUMG00000029569	ENST00000382041.3:c.4657G>C	14.37:g.51221467C>G	ENSP00000371472:p.Glu1553Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDB8|B7WPA3|C9JSB6|C9JSG2|C9JXL2|Q5BKU3|Q6P0P6|Q9BWU6|Q9C012|Q9C013|Q9C014|Q9H5I6|Q9HAT7|Q9HBY5|Q9HCK7|Q9UH61	Missense_Mutation	SNP	superfamily_tRNA-bd_arm,pfscan_EF_HAND_2	p.E1553Q	ENST00000382041.3	37	c.4657	CCDS32079.1	14	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	10.41|10.41	1.343119|1.343119	0.24339|0.24339	.|.	.|.	ENSG00000100503|ENSG00000100503	ENST00000245441;ENST00000311149;ENST00000389868;ENST00000382043;ENST00000324292;ENST00000382041;ENST00000324330;ENST00000453196|ENST00000530997;ENST00000389869;ENST00000530853	T;T;T;T;T;T|.	0.19938|.	2.75;2.15;2.11;2.44;2.44;2.44|.	4.29|4.29	3.36|3.36	0.38483|0.38483	.|.	0.166603|.	0.51477|.	N|.	0.000094|.	T|T	0.54532|0.54532	0.1864|0.1864	M|M	0.66939|0.66939	2.045|2.045	0.30075|0.30075	N|N	0.809725|0.809725	B;B;B;B;P|.	0.38504|.	0.433;0.242;0.023;0.118;0.634|.	B;B;B;B;B|.	0.36989|.	0.238;0.077;0.012;0.111;0.215|.	T|T	0.54403|0.54403	-0.8299|-0.8299	10|5	0.54805|.	T|.	0.06|.	0.0304|0.0304	11.0679|11.0679	0.47987|0.47987	0.0:0.811:0.189:0.0|0.0:0.811:0.189:0.0	.|.	1559;1553;1553;840;1553|.	Q8N4C6-5;C9J066;Q8N4C6;Q5BKU3;Q8N4C6-7|.	.;.;NIN_HUMAN;.;.|.	Q|T	1553;1536;840;840;1559;1553;1553;1553|1043	ENSP00000245441:E1553Q;ENSP00000374518:E840Q;ENSP00000371474:E840Q;ENSP00000371472:E1553Q;ENSP00000324210:E1553Q;ENSP00000412391:E1553Q|.	ENSP00000245441:E1553Q|.	E|R	-|-	1|2	0|0	NIN|NIN	50291217|50291217	1.000000|1.000000	0.71417|0.71417	1.000000|1.000000	0.80357|0.80357	0.997000|0.997000	0.91878|0.91878	2.400000|2.400000	0.44504|0.44504	0.857000|0.857000	0.35407|0.35407	0.561000|0.561000	0.74099|0.74099	GAA|AGA	NIN	-	NULL		0.279	NIN-016	KNOWN	basic|CCDS	protein_coding	NIN	HGNC	protein_coding	OTTHUMT00000395207.2	C	NM_182946		51221467	-1	no_errors	ENST00000245441	ensembl	human	known	70_37	missense	SNP	1.000	G
NIT1	4817	genome.wustl.edu	37	1	161090430	161090430	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:161090430G>C	ENST00000368009.2	+	7	935	c.859G>C	c.(859-861)Gag>Cag	p.E287Q	NIT1_ENST00000392190.5_Missense_Mutation_p.E251Q|NIT1_ENST00000368007.4_Missense_Mutation_p.E272Q|DEDD_ENST00000489249.1_5'Flank|NIT1_ENST00000368008.1_Intron|PFDN2_ENST00000368010.3_5'Flank|PFDN2_ENST00000468311.1_5'Flank	NM_005600.2	NP_005591.1	Q86X76	NIT1_HUMAN	nitrilase 1	287	CN hydrolase. {ECO:0000255|PROSITE- ProRule:PRU00054}.				nitrogen compound metabolic process (GO:0006807)	extracellular vesicular exosome (GO:0070062)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	nitrilase activity (GO:0000257)			NS(1)|breast(2)|endometrium(2)|large_intestine(3)|lung(3)|prostate(1)	12	all_cancers(52;3.39e-19)|Breast(13;0.000577)|all_hematologic(112;0.093)		BRCA - Breast invasive adenocarcinoma(70;0.00165)			CCGCTGCTCTGAGGGGCCAGG	0.612																																																	0													55.0	54.0	55.0					1																	161090430		2203	4300	6503	SO:0001583	missense	4817			AF069984	CCDS1218.1, CCDS53401.1, CCDS53402.1, CCDS53403.1	1q21-q22	2008-05-14			ENSG00000158793	ENSG00000158793			7828	protein-coding gene	gene with protein product		604618				9671749	Standard	NM_005600		Approved		uc001fxv.2	Q86X76	OTTHUMG00000031473	ENST00000368009.2:c.859G>C	1.37:g.161090430G>C	ENSP00000356988:p.Glu287Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AQP3|D3DVF4|O76091	Missense_Mutation	SNP	pfam_C-N_Hydrolase,superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase	p.E287Q	ENST00000368009.2	37	c.859	CCDS1218.1	1	.	.	.	.	.	.	.	.	.	.	G	14.12	2.439268	0.43326	.	.	ENSG00000158793	ENST00000368009;ENST00000368007;ENST00000392190	T;T;T	0.44881	0.91;0.91;0.91	4.9	4.9	0.64082	Nitrilase/cyanide hydratase and apolipoprotein N-acyltransferase (3);	0.192584	0.44097	D	0.000481	T	0.26195	0.0639	M	0.65677	2.01	0.58432	D	0.999996	P;B	0.36944	0.574;0.235	B;B	0.27262	0.078;0.053	T	0.13308	-1.0514	10	0.36615	T	0.2	-4.8361	15.6362	0.76953	0.0:0.0:1.0:0.0	.	272;287	Q86X76-4;Q86X76	.;NIT1_HUMAN	Q	287;272;251	ENSP00000356988:E287Q;ENSP00000356986:E272Q;ENSP00000376028:E251Q	ENSP00000356986:E272Q	E	+	1	0	NIT1	159357054	1.000000	0.71417	0.973000	0.42090	0.737000	0.42083	6.656000	0.74396	2.551000	0.86045	0.563000	0.77884	GAG	NIT1	-	superfamily_C-N_Hydrolase,pfscan_C-N_Hydrolase		0.612	NIT1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NIT1	HGNC	protein_coding	OTTHUMT00000077060.1	G			161090430	+1	no_errors	ENST00000368009	ensembl	human	known	70_37	missense	SNP	1.000	C
NMI	9111	genome.wustl.edu	37	2	152132175	152132175	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:152132175C>G	ENST00000243346.5	-	6	927	c.457G>C	c.(457-459)Gaa>Caa	p.E153Q		NM_004688.2	NP_004679.2	Q13287	NMI_HUMAN	N-myc (and STAT) interactor	153					inflammatory response (GO:0006954)|JAK-STAT cascade (GO:0007259)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	transcription cofactor activity (GO:0003712)			endometrium(2)|large_intestine(3)|lung(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	11				BRCA - Breast invasive adenocarcinoma(221;0.0571)		TTAGAAACTTCTACATAAACC	0.343																																																	0													72.0	77.0	75.0					2																	152132175		2203	4300	6503	SO:0001583	missense	9111			U32849	CCDS2192.1	2q23	2008-05-23			ENSG00000123609	ENSG00000123609			7854	protein-coding gene	gene with protein product		603525				8668343, 9989503	Standard	NM_004688		Approved		uc002txi.2	Q13287	OTTHUMG00000131867	ENST00000243346.5:c.457G>C	2.37:g.152132175C>G	ENSP00000243346:p.Glu153Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	B5BU69|Q53TI8|Q9BVE5	Missense_Mutation	SNP	pfam_Nmi/IFP35,pfam_Interferon_induced_35kDa_N	p.E153Q	ENST00000243346.5	37	c.457	CCDS2192.1	2	.	.	.	.	.	.	.	.	.	.	C	7.071	0.568354	0.13560	.	.	ENSG00000123609	ENST00000243346	T	0.42131	0.98	5.33	3.12	0.35913	Nmi/IFP 35 (1);Nucleotide-binding, alpha-beta plait (1);	0.753274	0.13847	N	0.358644	T	0.21921	0.0528	N	0.15975	0.35	0.09310	N	1	B	0.16603	0.018	B	0.17722	0.019	T	0.13361	-1.0512	10	0.23302	T	0.38	-2.9384	4.7632	0.13118	0.0:0.6172:0.2401:0.1427	.	153	Q13287	NMI_HUMAN	Q	153	ENSP00000243346:E153Q	ENSP00000243346:E153Q	E	-	1	0	NMI	151840421	0.011000	0.17503	0.150000	0.22450	0.817000	0.46193	1.326000	0.33735	1.378000	0.46305	0.591000	0.81541	GAA	NMI	-	pfam_Nmi/IFP35		0.343	NMI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NMI	HGNC	protein_coding	OTTHUMT00000254817.2	C	NM_004688		152132175	-1	no_errors	ENST00000243346	ensembl	human	known	70_37	missense	SNP	0.035	G
NOL8	55035	genome.wustl.edu	37	9	95078028	95078028	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:95078028C>G	ENST00000535387.1	-	6	878	c.879G>C	c.(877-879)aaG>aaC	p.K293N	NOL8_ENST00000442668.2_Missense_Mutation_p.K293N|NOL8_ENST00000545558.1_Missense_Mutation_p.K293N|NOL8_ENST00000542053.1_Missense_Mutation_p.K225N|NOL8_ENST00000358855.4_Missense_Mutation_p.K225N					nucleolar protein 8											endometrium(3)|kidney(2)|large_intestine(5)|lung(5)|ovary(1)	16						TGCTGTTTCTCTTCTTGGCAG	0.358																																																	0													44.0	40.0	41.0					9																	95078028		1844	4099	5943	SO:0001583	missense	55035			AB109030	CCDS47993.1, CCDS59135.1	9q22.32	2013-02-12	2004-01-12	2004-01-14	ENSG00000198000	ENSG00000198000		"""RNA binding motif (RRM) containing"""	23387	protein-coding gene	gene with protein product		611534	"""chromosome 9 open reading frame 34"""	C9orf34		12477932	Standard	NM_017948		Approved	FLJ20736, Nop132	uc022bjx.1	Q76FK4	OTTHUMG00000020221	ENST00000535387.1:c.879G>C	9.37:g.95078028C>G	ENSP00000441300:p.Lys293Asn	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.K293N	ENST00000535387.1	37	c.879	CCDS47993.1	9	.	.	.	.	.	.	.	.	.	.	C	0.009	-1.848564	0.00563	.	.	ENSG00000198000	ENST00000442668;ENST00000375594;ENST00000358855;ENST00000545558;ENST00000535387;ENST00000542053;ENST00000432670;ENST00000433029	T;T;T;T;T;T;T	0.44482	2.53;2.53;2.53;2.76;2.53;2.26;0.92	5.57	-7.75	0.01236	.	0.996520	0.08139	N	0.991920	T	0.13798	0.0334	N	0.11201	0.11	0.09310	N	1	B	0.02656	0.0	B	0.04013	0.001	T	0.25117	-1.0141	10	0.09843	T	0.71	0.0038	1.2286	0.01938	0.3537:0.3115:0.1059:0.229	.	293	Q76FK4	NOL8_HUMAN	N	293;295;225;293;293;225;293;293	ENSP00000401177:K293N;ENSP00000351723:K225N;ENSP00000441140:K293N;ENSP00000441300:K293N;ENSP00000440709:K225N;ENSP00000414112:K293N;ENSP00000412471:K293N	ENSP00000351723:K225N	K	-	3	2	NOL8	94117849	0.000000	0.05858	0.000000	0.03702	0.065000	0.16274	-0.826000	0.04429	-1.541000	0.01727	-0.188000	0.12872	AAG	NOL8	-	NULL		0.358	NOL8-010	NOVEL	basic|exp_conf|CCDS	protein_coding	NOL8	HGNC	protein_coding	OTTHUMT00000053082.2	C	NM_017948		95078028	-1	no_errors	ENST00000442668	ensembl	human	known	70_37	missense	SNP	0.000	G
NR2C1	7181	genome.wustl.edu	37	12	95434349	95434349	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr12:95434349C>T	ENST00000333003.5	-	10	1486	c.1156G>A	c.(1156-1158)Gag>Aag	p.E386K	NR2C1_ENST00000393101.3_Missense_Mutation_p.E386K|NR2C1_ENST00000330677.7_Missense_Mutation_p.E386K|NR2C1_ENST00000545833.1_5'UTR	NM_003297.3	NP_003288.2	P13056	NR2C1_HUMAN	nuclear receptor subfamily 2, group C, member 1	386					gene expression (GO:0010467)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of retinoic acid receptor signaling pathway (GO:0048386)|transcription initiation from RNA polymerase II promoter (GO:0006367)	nucleoplasm (GO:0005654)|PML body (GO:0016605)	DNA binding (GO:0003677)|receptor activity (GO:0004872)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)	13						TTCAGGTACTCAGGCATAGGA	0.413																																																	0													132.0	113.0	119.0					12																	95434349		2203	4300	6503	SO:0001583	missense	7181			M29960	CCDS9051.1, CCDS41821.1, CCDS44953.1	12q22	2013-01-16				ENSG00000120798		"""Nuclear hormone receptors"""	7971	protein-coding gene	gene with protein product		601529		TR2		2597158	Standard	NM_001032287		Approved	TR2-11	uc001tdm.5	P13056	OTTHUMG00000170131	ENST00000333003.5:c.1156G>A	12.37:g.95434349C>T	ENSP00000333275:p.Glu386Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5K4|Q15625|Q15626	Missense_Mutation	SNP	pfam_Nucl_hrmn_rcpt_lig-bd_core,pfam_Znf_hrmn_rcpt,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_Znf_hrmn_rcpt,prints_Str_hrmn_rcpt	p.E386K	ENST00000333003.5	37	c.1156	CCDS9051.1	12	.	.	.	.	.	.	.	.	.	.	C	27.4	4.832240	0.91036	.	.	ENSG00000120798	ENST00000333003;ENST00000393101;ENST00000330677	D;D;D	0.96651	-4.08;-4.08;-4.08	6.06	5.17	0.71159	Nuclear hormone receptor, ligand-binding (2);Nuclear hormone receptor, ligand-binding, core (1);	0.044404	0.85682	D	0.000000	D	0.94241	0.8151	M	0.64404	1.975	0.58432	D	0.999999	P;B;B;B	0.46395	0.877;0.003;0.2;0.002	B;B;B;B	0.37731	0.257;0.002;0.042;0.003	D	0.93022	0.6441	10	0.29301	T	0.29	.	15.5372	0.76013	0.0:0.934:0.0:0.066	.	386;386;386;386	B6ZGT7;P13056-3;P13056-2;P13056	.;.;.;NR2C1_HUMAN	K	386	ENSP00000333275:E386K;ENSP00000376813:E386K;ENSP00000328843:E386K	ENSP00000328843:E386K	E	-	1	0	NR2C1	93958480	1.000000	0.71417	0.998000	0.56505	0.823000	0.46562	7.792000	0.85828	1.577000	0.49804	-0.150000	0.13652	GAG	NR2C1	-	superfamily_Nucl_hormone_rcpt_ligand-bd		0.413	NR2C1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	NR2C1	HGNC	protein_coding	OTTHUMT00000407565.2	C	NM_003297		95434349	-1	no_errors	ENST00000333003	ensembl	human	known	70_37	missense	SNP	1.000	T
OGG1	4968	genome.wustl.edu	37	3	9791867	9791867	+	5'UTR	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:9791867G>C	ENST00000344629.7	+	0	240				OGG1_ENST00000349503.5_5'UTR|OGG1_ENST00000436092.1_3'UTR|OGG1_ENST00000302003.7_5'UTR|OGG1_ENST00000449570.2_5'UTR|OGG1_ENST00000339511.5_5'UTR|OGG1_ENST00000302008.8_5'UTR|OGG1_ENST00000383826.5_5'UTR|OGG1_ENST00000302036.7_5'UTR			O15527	OGG1_HUMAN	8-oxoguanine DNA glycosylase						acute inflammatory response (GO:0002526)|base-excision repair (GO:0006284)|base-excision repair, AP site formation (GO:0006285)|cellular response to cadmium ion (GO:0071276)|depurination (GO:0045007)|DNA catabolic process, endonucleolytic (GO:0000737)|DNA repair (GO:0006281)|nucleic acid phosphodiester bond hydrolysis (GO:0090305)|nucleotide-excision repair (GO:0006289)|regulation of protein import into nucleus, translocation (GO:0033158)|regulation of transcription, DNA-templated (GO:0006355)|response to drug (GO:0042493)|response to estradiol (GO:0032355)|response to ethanol (GO:0045471)|response to folic acid (GO:0051593)|response to oxidative stress (GO:0006979)|response to radiation (GO:0009314)	mitochondrion (GO:0005739)|nuclear matrix (GO:0016363)|nuclear speck (GO:0016607)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	8-oxo-7,8-dihydroguanine DNA N-glycosylase activity (GO:0034039)|damaged DNA binding (GO:0003684)|endonuclease activity (GO:0004519)|oxidized purine nucleobase lesion DNA N-glycosylase activity (GO:0008534)			kidney(2)|large_intestine(2)|lung(2)|skin(1)|urinary_tract(1)	8	Medulloblastoma(99;0.227)					CCGTGTGGGCGAGGCCTTAAG	0.622								Base excision repair (BER), DNA glycosylases																																									0																																										SO:0001623	5_prime_UTR_variant	4968			U96710	CCDS2576.1, CCDS2577.1, CCDS2578.1, CCDS2579.1, CCDS2580.1, CCDS2581.1, CCDS43046.1, CCDS46742.1	3p26	2010-11-23			ENSG00000114026	ENSG00000114026	3.2.2.-, 4.2.99.18		8125	protein-coding gene	gene with protein product	"""8-hydroxyguanine DNA glycosylase"", ""OGG1 type 1e"", ""OGG1 type 1d"", ""OGG1 type 1g"", ""OGG1 type 1h"""	601982				9207108, 10449904	Standard	NM_002542		Approved	HMMH, HOGG1, OGH1, MUTM	uc003bsj.3	O15527	OTTHUMG00000097091	ENST00000344629.7:c.-104G>C	3.37:g.9791867G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8K1E3|O00390|O00670|O00705|O14876|O95488|P78554|Q9BW42|Q9UIK0|Q9UIK1|Q9UIK2|Q9UL34|Q9Y2C0|Q9Y2C1|Q9Y6C3|Q9Y6C4	RNA	SNP	-	NULL	ENST00000344629.7	37	NULL	CCDS2581.1	3																																																																																			OGG1	-	-		0.622	OGG1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	OGG1	HGNC	protein_coding	OTTHUMT00000214223.2	G	NM_016821		9791867	+1	no_errors	ENST00000436092	ensembl	human	putative	70_37	rna	SNP	0.000	C
OSBPL5	114879	genome.wustl.edu	37	11	3128499	3128499	+	Silent	SNP	C	C	G	rs35251100		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:3128499C>G	ENST00000263650.7	-	9	1212	c.1053G>C	c.(1051-1053)ctG>ctC	p.L351L	OSBPL5_ENST00000348039.5_Silent_p.L283L|OSBPL5_ENST00000525498.1_Silent_p.L262L|OSBPL5_ENST00000542243.1_Intron|OSBPL5_ENST00000389989.3_Silent_p.L283L	NM_020896.3	NP_065947.1	Q9H0X9	OSBL5_HUMAN	oxysterol binding protein-like 5	351					cholesterol metabolic process (GO:0008203)|cholesterol transport (GO:0030301)|Golgi to plasma membrane transport (GO:0006893)	cytosol (GO:0005829)|endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	cholesterol binding (GO:0015485)|oxysterol binding (GO:0008142)			breast(2)|central_nervous_system(1)|endometrium(2)|kidney(3)|large_intestine(7)|lung(8)|prostate(1)|upper_aerodigestive_tract(1)	25		all_epithelial(84;0.000236)|Medulloblastoma(188;0.00106)|Breast(177;0.00328)|Ovarian(85;0.00556)|all_neural(188;0.00681)		BRCA - Breast invasive adenocarcinoma(625;0.00607)|LUSC - Lung squamous cell carcinoma(625;0.207)		TCACCTCCCCCAGCTCCTCCT	0.677																																																	0													34.0	39.0	37.0					11																	3128499		2202	4297	6499	SO:0001819	synonymous_variant	114879			AF392453	CCDS31343.1, CCDS31344.1	11p15.4	2013-01-10			ENSG00000021762	ENSG00000021762		"""Oxysterol binding proteins"", ""Pleckstrin homology (PH) domain containing"""	16392	protein-coding gene	gene with protein product		606733					Standard	NM_145638		Approved	KIAA1534, ORP5	uc001lxk.2	Q9H0X9	OTTHUMG00000011702	ENST00000263650.7:c.1053G>C	11.37:g.3128499C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NDP0|A6NJS8|Q54A90|Q8N596|Q9BZB0|Q9P1Z4	Silent	SNP	pfam_Oxysterol-bd,pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.L351	ENST00000263650.7	37	c.1053	CCDS31344.1	11																																																																																			OSBPL5	-	NULL		0.677	OSBPL5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OSBPL5	HGNC	protein_coding	OTTHUMT00000032332.2	C			3128499	-1	no_errors	ENST00000263650	ensembl	human	known	70_37	silent	SNP	0.448	G
OR52E2	119678	genome.wustl.edu	37	11	5080666	5080666	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:5080666G>A	ENST00000321522.2	-	1	191	c.192C>T	c.(190-192)ttC>ttT	p.F64F		NM_001005164.2	NP_001005164.2	Q8NGJ4	O52E2_HUMAN	olfactory receptor, family 52, subfamily E, member 2	64						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	G-protein coupled receptor activity (GO:0004930)|olfactory receptor activity (GO:0004984)			endometrium(2)|lung(13)|ovary(2)|skin(3)	20		Medulloblastoma(188;0.0061)|all_neural(188;0.0479)|Breast(177;0.086)		Epithelial(150;1.03e-09)|BRCA - Breast invasive adenocarcinoma(625;0.135)|LUSC - Lung squamous cell carcinoma(625;0.191)		ACATGGCCAGGAAGTAGAACA	0.483																																																	0													104.0	90.0	95.0					11																	5080666		2201	4298	6499	SO:0001819	synonymous_variant	119678			AB065800	CCDS31371.1	11p15.4	2012-08-09			ENSG00000176787	ENSG00000176787		"""GPCR / Class A : Olfactory receptors"""	14769	protein-coding gene	gene with protein product							Standard	NM_001005164		Approved		uc010qyw.2	Q8NGJ4	OTTHUMG00000066608	ENST00000321522.2:c.192C>T	11.37:g.5080666G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_Olfact_rcpt,prints_GPCR_Rhodpsn	p.F64	ENST00000321522.2	37	c.192	CCDS31371.1	11																																																																																			OR52E2	-	pfam_GPCR_Rhodpsn,pfscan_GPCR_Rhodpsn_7TM,prints_GPCR_Rhodpsn		0.483	OR52E2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	OR52E2	HGNC	protein_coding	OTTHUMT00000142815.1	G	NM_001005164		5080666	-1	no_errors	ENST00000321522	ensembl	human	known	70_37	silent	SNP	0.999	A
PAFAH1B1	5048	genome.wustl.edu	37	17	2570453	2570453	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:2570453C>T	ENST00000397195.5	+	5	811	c.360C>T	c.(358-360)ttC>ttT	p.F120F	PAFAH1B1_ENST00000572915.2_3'UTR	NM_000430.3	NP_000421.1			platelet-activating factor acetylhydrolase 1b, regulatory subunit 1 (45kDa)											endometrium(2)|kidney(1)|large_intestine(4)|liver(2)|lung(1)|skin(1)	11						ATCCTGTGTTCAGTGTTATGG	0.453																																																	0													107.0	97.0	100.0					17																	2570453		2203	4300	6503	SO:0001819	synonymous_variant	5048			L25107	CCDS32528.1	17p13.3	2014-04-04	2010-02-10		ENSG00000007168	ENSG00000007168		"""WD repeat domain containing"""	8574	protein-coding gene	gene with protein product	"""lissencephaly-1"""	601545	"""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit (45kD)"", ""Miller-Dieker syndrome chromosome region"", ""platelet-activating factor acetylhydrolase, isoform Ib, alpha subunit 45kDa"", ""platelet-activating factor acetylhydrolase, isoform Ib, subunit 1 (45kDa)"""	MDCR, MDS		8355785, 9063735	Standard	NM_000430		Approved	LIS1, PAFAH	uc002fuw.4	P43034	OTTHUMG00000177574	ENST00000397195.5:c.360C>T	17.37:g.2570453C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_WD40_repeat,pfam_LisH_dimerisation_subgr,superfamily_WD40_repeat_dom,smart_LisH_dimerisation,smart_WD40_repeat,pirsf_Dynein_regulator,prints_G-protein_beta_WD-40_rep,pfscan_LisH_dimerisation,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.F120	ENST00000397195.5	37	c.360	CCDS32528.1	17																																																																																			PAFAH1B1	-	pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pirsf_Dynein_regulator,pfscan_WD40_repeat,pfscan_WD40_repeat_dom		0.453	PAFAH1B1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PAFAH1B1	HGNC	protein_coding	OTTHUMT00000437797.2	C	NM_000430		2570453	+1	no_errors	ENST00000397195	ensembl	human	known	70_37	silent	SNP	1.000	T
PAX4	5078	genome.wustl.edu	37	7	127255468	127255468	+	Nonsense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:127255468G>C	ENST00000341640.2	-	1	312	c.107C>G	c.(106-108)tCa>tGa	p.S36*	PAX4_ENST00000378740.2_Nonsense_Mutation_p.S36*|PAX4_ENST00000338516.3_Nonsense_Mutation_p.S44*|PAX4_ENST00000463946.1_5'UTR	NM_006193.2	NP_006184.2	O43316	PAX4_HUMAN	paired box 4	44	Paired. {ECO:0000255|PROSITE- ProRule:PRU00381}.				cell differentiation (GO:0030154)|circadian rhythm (GO:0007623)|endocrine pancreas development (GO:0031018)|negative regulation of apoptotic process (GO:0043066)|organ morphogenesis (GO:0009887)|positive regulation of cell differentiation (GO:0045597)|response to cAMP (GO:0051591)|response to drug (GO:0042493)|retina development in camera-type eye (GO:0060041)	nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|double-stranded DNA binding (GO:0003690)|RNA polymerase II distal enhancer sequence-specific DNA binding (GO:0000980)|RNA polymerase II distal enhancer sequence-specific DNA binding transcription factor activity involved in negative regulation of transcription (GO:0001206)			cervix(1)|kidney(2)|large_intestine(6)|lung(20)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)|urinary_tract(1)	35						AAGGATCCGTGAGATGTCACA	0.597																																					Ovarian(113;737 1605 7858 27720 34092)												0													91.0	91.0	91.0					7																	127255468		2203	4300	6503	SO:0001587	stop_gained	5078				CCDS5797.1	7q32.1	2011-06-20	2007-07-12		ENSG00000106331	ENSG00000106331		"""Paired boxes"", ""Homeoboxes / PRD class"""	8618	protein-coding gene	gene with protein product		167413	"""paired box gene 4"""				Standard	NM_006193		Approved	MODY9	uc010lld.1	O43316	OTTHUMG00000157562	ENST00000341640.2:c.107C>G	7.37:g.127255468G>C	ENSP00000339906:p.Ser36*	Somatic		WXS	Illumina HiSeq	Phase_IV	O95161|Q6B0H0	Nonsense_Mutation	SNP	pfam_Paired_dom,pfam_Homeodomain,superfamily_Homeodomain-like,smart_Paired_dom,smart_Homeodomain,pfscan_Homeodomain,pfscan_Paired_dom,prints_Paired_dom	p.S36*	ENST00000341640.2	37	c.107	CCDS5797.1	7	.	.	.	.	.	.	.	.	.	.	G	36	5.884658	0.97062	.	.	ENSG00000106331	ENST00000341640;ENST00000338516;ENST00000378740	.	.	.	5.73	5.73	0.89815	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	17.4002	0.87458	0.0:0.0:1.0:0.0	.	.	.	.	X	36;44;44	.	ENSP00000344297:S44X	S	-	2	0	PAX4	127042704	1.000000	0.71417	0.999000	0.59377	0.936000	0.57629	9.559000	0.98135	2.693000	0.91896	0.655000	0.94253	TCA	PAX4	-	pfam_Paired_dom,superfamily_Homeodomain-like,smart_Paired_dom,pfscan_Paired_dom,prints_Paired_dom		0.597	PAX4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PAX4	HGNC	protein_coding	OTTHUMT00000349165.1	G			127255468	-1	no_errors	ENST00000341640	ensembl	human	known	70_37	nonsense	SNP	1.000	C
ASPRV1	151516	genome.wustl.edu	37	2	70191430	70191430	+	5'Flank	SNP	C	C	T	rs559928595		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:70191430C>T	ENST00000320256.4	-	0	0				PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000596259.1_RNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000419542.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA	NM_152792.2	NP_690005.2			aspartic peptidase, retroviral-like 1											endometrium(3)|large_intestine(4)|lung(6)|ovary(1)	14						GATGGCCCTTCGGGCTGTGTC	0.567													C|||	1	0.000199681	0.0	0.0	5008	,	,		16785	0.001		0.0	False		,,,				2504	0.0																0																																										SO:0001631	upstream_gene_variant	400960			AK055994	CCDS1897.1	2p13.3	2008-02-20			ENSG00000244617	ENSG00000244617			26321	protein-coding gene	gene with protein product	"""Skin ASpartic Protease"""	611765				16098038, 16565508	Standard	NM_152792		Approved	Taps, SASPase, FLJ25084	uc002sfz.4	Q53RT3	OTTHUMG00000129647		2.37:g.70191430C>T	Exception_encountered	Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000320256.4	37	NULL	CCDS1897.1	2																																																																																			PCBP1-AS1	-	-		0.567	ASPRV1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCBP1-AS1	HGNC	protein_coding	OTTHUMT00000334161.1	C	NM_152792		70191430	-1	no_errors	ENST00000435880	ensembl	human	known	70_37	rna	SNP	0.000	T
PCBP1	5093	genome.wustl.edu	37	2	70315274	70315274	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:70315274G>A	ENST00000303577.5	+	1	690	c.399G>A	c.(397-399)gtG>gtA	p.V133V	PCBP1-AS1_ENST00000432604.1_RNA|PCBP1-AS1_ENST00000437019.1_RNA|PCBP1-AS1_ENST00000435880.2_RNA|PCBP1-AS1_ENST00000596665.1_RNA|PCBP1-AS1_ENST00000444320.1_RNA|PCBP1-AS1_ENST00000416395.1_RNA|PCBP1-AS1_ENST00000599673.1_RNA|PCBP1-AS1_ENST00000425333.1_RNA|PCBP1-AS1_ENST00000413436.1_RNA|PCBP1-AS1_ENST00000429599.2_RNA|PCBP1-AS1_ENST00000452431.1_RNA|AC016700.2_ENST00000455541.1_lincRNA|PCBP1-AS1_ENST00000415222.1_RNA|PCBP1-AS1_ENST00000442040.1_RNA|PCBP1-AS1_ENST00000419963.1_RNA|PCBP1-AS1_ENST00000418308.1_RNA|PCBP1-AS1_ENST00000434781.1_RNA|PCBP1-AS1_ENST00000415060.2_RNA|PCBP1-AS1_ENST00000457076.1_RNA|PCBP1-AS1_ENST00000411429.1_RNA|PCBP1-AS1_ENST00000596028.1_RNA|PCBP1-AS1_ENST00000609075.1_RNA|PCBP1-AS1_ENST00000420309.1_RNA|PCBP1-AS1_ENST00000595459.1_RNA|PCBP1-AS1_ENST00000444410.1_RNA|PCBP1-AS1_ENST00000457770.1_RNA|PCBP1-AS1_ENST00000594548.1_RNA|PCBP1-AS1_ENST00000439670.2_RNA|PCBP1-AS1_ENST00000458698.2_RNA|PCBP1-AS1_ENST00000423402.1_RNA|PCBP1-AS1_ENST00000413069.1_RNA|PCBP1-AS1_ENST00000601396.1_RNA|PCBP1-AS1_ENST00000366234.3_RNA|PCBP1-AS1_ENST00000416068.1_RNA|PCBP1-AS1_ENST00000610168.1_RNA|PCBP1-AS1_ENST00000413791.1_RNA|PCBP1-AS1_ENST00000439892.1_RNA|PCBP1-AS1_ENST00000456161.1_RNA|PCBP1-AS1_ENST00000425601.1_RNA|PCBP1-AS1_ENST00000596573.1_RNA|PCBP1-AS1_ENST00000418564.1_RNA|PCBP1-AS1_ENST00000437456.1_RNA|PCBP1-AS1_ENST00000421843.1_RNA|PCBP1-AS1_ENST00000449178.1_RNA|PCBP1-AS1_ENST00000422515.1_RNA|PCBP1-AS1_ENST00000458686.1_RNA|PCBP1-AS1_ENST00000421255.1_RNA|PCBP1-AS1_ENST00000415742.1_RNA	NM_006196.3	NP_006187.2	Q15365	PCBP1_HUMAN	poly(rC) binding protein 1	133	KH 2. {ECO:0000255|PROSITE- ProRule:PRU00117}.				gene expression (GO:0010467)|mRNA splicing, via spliceosome (GO:0000398)|RNA splicing (GO:0008380)	cytoplasm (GO:0005737)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nucleoplasm (GO:0005654)|ribonucleoprotein complex (GO:0030529)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|single-stranded DNA binding (GO:0003697)			endometrium(2)|kidney(1)|large_intestine(6)|lung(2)|skin(1)	12						AGGTCCAGGTGGCGGGGGATA	0.637																																					Colon(85;1146 1307 3484 18706 25380)												0													48.0	54.0	52.0					2																	70315274		2203	4300	6503	SO:0001819	synonymous_variant	5093				CCDS1898.1	2p13-p12	2013-07-16	2001-11-28		ENSG00000169564	ENSG00000169564			8647	protein-coding gene	gene with protein product	"""heterogeneous nuclear ribonucleoprotein E1"""	601209	"""poly(rC)-binding protein 1"""			8833161	Standard	NM_006196		Approved	HNRPE1, hnRNP-E1, HNRPX, hnRNP-X	uc002sgf.3	Q15365	OTTHUMG00000129645	ENST00000303577.5:c.399G>A	2.37:g.70315274G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q13157|Q14975	Silent	SNP	pfam_KH_dom_type_1,pfam_KH_dom_type_2,smart_KH_dom,pfscan_KH_dom_type_1	p.V133	ENST00000303577.5	37	c.399	CCDS1898.1	2																																																																																			PCBP1	-	pfam_KH_dom_type_1,smart_KH_dom,pfscan_KH_dom_type_1		0.637	PCBP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PCBP1	HGNC	protein_coding	OTTHUMT00000251844.1	G	NM_006196		70315274	+1	no_errors	ENST00000303577	ensembl	human	known	70_37	silent	SNP	1.000	A
PCDHGA1	56114	genome.wustl.edu	37	5	140710615	140710615	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr5:140710615G>C	ENST00000517417.1	+	1	364	c.364G>C	c.(364-366)Gaa>Caa	p.E122Q	PCDHGA1_ENST00000378105.3_Missense_Mutation_p.E122Q|AC005618.6_ENST00000606901.1_lincRNA	NM_018912.2	NP_061735.1	Q9Y5H4	PCDG1_HUMAN	protocadherin gamma subfamily A, 1	122	Cadherin 1. {ECO:0000255|PROSITE- ProRule:PRU00043}.				homophilic cell adhesion (GO:0007156)	integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	calcium ion binding (GO:0005509)			breast(1)|cervix(1)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(18)|lung(32)|ovary(1)|pancreas(1)|prostate(2)|skin(3)|stomach(1)|upper_aerodigestive_tract(2)|urinary_tract(3)	78			KIRC - Kidney renal clear cell carcinoma(527;0.00112)|Kidney(363;0.00191)			TGTTGAAGTAGAAATAATTGA	0.418																																																	0													91.0	106.0	101.0					5																	140710615		2203	4300	6503	SO:0001583	missense	56114			AF152318	CCDS54922.1	5q31	2010-01-26				ENSG00000204956		"""Cadherins / Protocadherins : Clustered"""	8696	other	protocadherin		606288				10380929	Standard	NM_018912		Approved	PCDH-GAMMA-A1		Q9Y5H4		ENST00000517417.1:c.364G>C	5.37:g.140710615G>C	ENSP00000431083:p.Glu122Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2M273|Q9Y5D6	Missense_Mutation	SNP	pfam_Cadherin,pfam_Cadherin_N,superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin,prints_Cadherin	p.E122Q	ENST00000517417.1	37	c.364	CCDS54922.1	5	.	.	.	.	.	.	.	.	.	.	G	16.91	3.252977	0.59212	.	.	ENSG00000204956	ENST00000517417;ENST00000378105	T;T	0.52983	0.64;0.65	4.2	4.2	0.49525	Cadherin (3);Cadherin conserved site (1);Cadherin-like (1);	0.000000	0.50627	D	0.000110	T	0.64832	0.2634	M	0.85777	2.775	0.29713	N	0.839217	D;P	0.54207	0.965;0.848	P;P	0.52554	0.702;0.507	T	0.69877	-0.5026	10	0.87932	D	0	.	16.7229	0.85414	0.0:0.0:1.0:0.0	.	122;122	Q9Y5H4-2;Q9Y5H4	.;PCDG1_HUMAN	Q	122	ENSP00000431083:E122Q;ENSP00000367345:E122Q	ENSP00000367345:E122Q	E	+	1	0	PCDHGA1	140690799	0.996000	0.38824	1.000000	0.80357	0.980000	0.70556	4.371000	0.59523	2.349000	0.79799	0.655000	0.94253	GAA	PCDHGA1	-	superfamily_Cadherin-like,smart_Cadherin,pfscan_Cadherin		0.418	PCDHGA1-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PCDHGA1	HGNC	protein_coding	OTTHUMT00000374737.1	G	NM_018912		140710615	+1	no_errors	ENST00000517417	ensembl	human	known	70_37	missense	SNP	1.000	C
PDPK1	5170	genome.wustl.edu	37	16	2607870	2607870	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr16:2607870C>T	ENST00000342085.4	+	2	340	c.191C>T	c.(190-192)tCc>tTc	p.S64F	PDPK1_ENST00000268673.7_Missense_Mutation_p.S64F|PDPK1_ENST00000441549.3_Missense_Mutation_p.S64F|PDPK1_ENST00000389224.3_Missense_Mutation_p.S37F|PDPK1_ENST00000354836.5_Missense_Mutation_p.S64F|RP11-20I23.11_ENST00000569220.1_RNA|RP11-20I23.13_ENST00000563449.2_RNA	NM_002613.4	NP_002604.1	O15530	PDPK1_HUMAN	3-phosphoinositide dependent protein kinase 1	64					actin cytoskeleton organization (GO:0030036)|activation of protein kinase B activity (GO:0032148)|blood coagulation (GO:0007596)|calcium-mediated signaling (GO:0019722)|cell migration (GO:0016477)|cellular response to epidermal growth factor stimulus (GO:0071364)|cellular response to insulin stimulus (GO:0032869)|epidermal growth factor receptor signaling pathway (GO:0007173)|extrinsic apoptotic signaling pathway (GO:0097191)|Fc-epsilon receptor signaling pathway (GO:0038095)|fibroblast growth factor receptor signaling pathway (GO:0008543)|focal adhesion assembly (GO:0048041)|hyperosmotic response (GO:0006972)|innate immune response (GO:0045087)|insulin receptor signaling pathway (GO:0008286)|intracellular signal transduction (GO:0035556)|negative regulation of cardiac muscle cell apoptotic process (GO:0010667)|negative regulation of protein kinase activity (GO:0006469)|negative regulation of toll-like receptor signaling pathway (GO:0034122)|negative regulation of transforming growth factor beta receptor signaling pathway (GO:0030512)|neurotrophin TRK receptor signaling pathway (GO:0048011)|peptidyl-threonine phosphorylation (GO:0018107)|phosphatidylinositol-mediated signaling (GO:0048015)|platelet activation (GO:0030168)|positive regulation of establishment of protein localization to plasma membrane (GO:0090004)|positive regulation of phospholipase activity (GO:0010518)|positive regulation of release of sequestered calcium ion into cytosol (GO:0051281)|protein autophosphorylation (GO:0046777)|protein phosphorylation (GO:0006468)|regulation of endothelial cell migration (GO:0010594)|regulation of I-kappaB kinase/NF-kappaB signaling (GO:0043122)|regulation of mast cell degranulation (GO:0043304)|regulation of transcription, DNA-templated (GO:0006355)|synaptic transmission (GO:0007268)|T cell costimulation (GO:0031295)|T cell receptor signaling pathway (GO:0050852)|transcription, DNA-templated (GO:0006351)|type B pancreatic cell development (GO:0003323)	cell junction (GO:0030054)|cell projection (GO:0042995)|cytoplasm (GO:0005737)|cytoplasmic membrane-bounded vesicle (GO:0016023)|cytosol (GO:0005829)|nucleoplasm (GO:0005654)|plasma membrane (GO:0005886)	3-phosphoinositide-dependent protein kinase activity (GO:0004676)|ATP binding (GO:0005524)|kinase activity (GO:0016301)|phospholipase activator activity (GO:0016004)|phospholipase binding (GO:0043274)|protein serine/threonine kinase activity (GO:0004674)			central_nervous_system(2)|endometrium(1)|large_intestine(1)|lung(2)|ovary(1)	7		Ovarian(90;0.17)			Celecoxib(DB00482)	GGCGCCGGCTCCCTGCAGCAT	0.667																																																	0													8.0	10.0	10.0					16																	2607870		1430	3003	4433	SO:0001583	missense	5170			AF017995	CCDS10472.1, CCDS10473.1, CCDS58411.1	16p13.3	2014-03-20	2014-03-20		ENSG00000140992	ENSG00000140992			8816	protein-coding gene	gene with protein product	"""PkB kinase"""	605213				9094314, 9445477	Standard	NM_002613		Approved	PDK1	uc002cqs.4	O15530	OTTHUMG00000128874	ENST00000342085.4:c.191C>T	16.37:g.2607870C>T	ENSP00000344220:p.Ser64Phe	Somatic		WXS	Illumina HiSeq	Phase_IV	H0Y4Z0|Q59EH6|Q6FI20|Q8IV52|Q9BRD5	Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.S64F	ENST00000342085.4	37	c.191	CCDS10472.1	16	.	.	.	.	.	.	.	.	.	.	C	8.551	0.875577	0.17395	.	.	ENSG00000140992	ENST00000342085;ENST00000441549;ENST00000268673;ENST00000354836;ENST00000389224	T;T;T;T	0.72394	-0.65;0.91;-0.15;-0.63	4.36	3.38	0.38709	.	0.304109	0.31922	N	0.006855	T	0.60766	0.2294	L	0.29908	0.895	0.09310	N	0.999999	P;P;P;B;B	0.41748	0.761;0.641;0.736;0.115;0.303	B;B;P;B;B	0.44477	0.365;0.135;0.451;0.143;0.172	T	0.50717	-0.8795	10	0.21014	T	0.42	-0.2606	12.1786	0.54199	0.1724:0.8276:0.0:0.0	.	37;102;37;64;64	Q6A1A2;Q59EH6;E3W993;O15530-4;O15530	PDPK2_HUMAN;.;.;.;PDPK1_HUMAN	F	64;102;64;64;37	ENSP00000344220:S64F;ENSP00000268673:S64F;ENSP00000346895:S64F;ENSP00000373876:S37F	ENSP00000268673:S64F	S	+	2	0	PDPK1	2547871	0.021000	0.18746	0.016000	0.15963	0.367000	0.29736	2.681000	0.46926	0.804000	0.34136	0.543000	0.68304	TCC	PDPK1	-	NULL		0.667	PDPK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PDPK1	HGNC	protein_coding	OTTHUMT00000250831.3	C			2607870	+1	no_errors	ENST00000342085	ensembl	human	known	70_37	missense	SNP	0.275	T
PKHD1L1	93035	genome.wustl.edu	37	8	110450559	110450559	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:110450559G>A	ENST00000378402.5	+	31	3738	c.3634G>A	c.(3634-3636)Gag>Aag	p.E1212K		NM_177531.4	NP_803875.2	Q86WI1	PKHL1_HUMAN	polycystic kidney and hepatic disease 1 (autosomal recessive)-like 1	1212	IPT/TIG 5.				immune response (GO:0006955)	cytosol (GO:0005829)|extracellular space (GO:0005615)|integral component of membrane (GO:0016021)	receptor activity (GO:0004872)			NS(4)|breast(13)|central_nervous_system(6)|cervix(1)|endometrium(19)|kidney(17)|large_intestine(34)|lung(122)|ovary(11)|pancreas(3)|prostate(9)|skin(3)|stomach(4)|upper_aerodigestive_tract(13)|urinary_tract(4)	263			OV - Ovarian serous cystadenocarcinoma(57;9.88e-13)			TTAGAAAACTGAGGGTACAGT	0.294										HNSCC(38;0.096)																																							0													19.0	18.0	18.0					8																	110450559		1770	3960	5730	SO:0001583	missense	93035			AY219181	CCDS47911.1	8q23	2003-03-28			ENSG00000205038	ENSG00000205038			20313	protein-coding gene	gene with protein product		607843				12620974	Standard	NM_177531		Approved		uc003yne.3	Q86WI1	OTTHUMG00000164934	ENST00000378402.5:c.3634G>A	8.37:g.110450559G>A	ENSP00000367655:p.Glu1212Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q567P2|Q9UF27	Missense_Mutation	SNP	pfam_IPT_TIG_rcpt,pfam_G8_domain,pfam_PA14,superfamily_Ig_E-set,superfamily_Pectin_lyase_fold/virulence,superfamily_Cupredoxin,smart_IPT_TIG_rcpt,smart_PA14,smart_PbH1	p.E1212K	ENST00000378402.5	37	c.3634	CCDS47911.1	8	.	.	.	.	.	.	.	.	.	.	G	24.9	4.578562	0.86645	.	.	ENSG00000205038	ENST00000378402	T	0.76968	-1.06	5.88	5.88	0.94601	Cell surface receptor IPT/TIG (2);Immunoglobulin E-set (1);Immunoglobulin-like fold (1);	0.068538	0.56097	D	0.000030	D	0.86904	0.6045	M	0.85041	2.73	0.32223	N	0.575003	D	0.55172	0.97	P	0.60286	0.872	D	0.85450	0.1160	10	0.13108	T	0.6	.	17.7101	0.88319	0.0:0.0:1.0:0.0	.	1212	Q86WI1	PKHL1_HUMAN	K	1212	ENSP00000367655:E1212K	ENSP00000367655:E1212K	E	+	1	0	PKHD1L1	110519735	1.000000	0.71417	0.993000	0.49108	0.838000	0.47535	3.186000	0.50942	2.784000	0.95788	0.655000	0.94253	GAG	PKHD1L1	-	pfam_IPT_TIG_rcpt,superfamily_Ig_E-set,smart_IPT_TIG_rcpt		0.294	PKHD1L1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PKHD1L1	HGNC	protein_coding	OTTHUMT00000381017.1	G	NM_177531		110450559	+1	no_errors	ENST00000378402	ensembl	human	known	70_37	missense	SNP	0.997	A
PKLR	5313	genome.wustl.edu	37	1	155270044	155270044	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:155270044C>G	ENST00000342741.4	-	2	166	c.128G>C	c.(127-129)aGt>aCt	p.S43T	PKLR_ENST00000392414.3_Missense_Mutation_p.S12T	NM_000298.5	NP_000289.1	P30613	KPYR_HUMAN	pyruvate kinase, liver and RBC	43					ATP biosynthetic process (GO:0006754)|carbohydrate metabolic process (GO:0005975)|cellular response to insulin stimulus (GO:0032869)|endocrine pancreas development (GO:0031018)|energy reserve metabolic process (GO:0006112)|glucose metabolic process (GO:0006006)|glycolytic process (GO:0006096)|positive regulation of cellular metabolic process (GO:0031325)|pyruvate biosynthetic process (GO:0042866)|response to ATP (GO:0033198)|response to cAMP (GO:0051591)|response to glucose (GO:0009749)|response to heat (GO:0009408)|response to hypoxia (GO:0001666)|response to lithium ion (GO:0010226)|response to nutrient (GO:0007584)|response to other organism (GO:0051707)|small molecule metabolic process (GO:0044281)	cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)	ATP binding (GO:0005524)|magnesium ion binding (GO:0000287)|potassium ion binding (GO:0030955)|pyruvate kinase activity (GO:0004743)			NS(1)|autonomic_ganglia(1)|breast(1)|central_nervous_system(1)|endometrium(3)|kidney(1)|large_intestine(4)|lung(16)|ovary(1)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	35	all_lung(78;6.99e-23)|Hepatocellular(266;0.0877)|all_hematologic(923;0.145)		Epithelial(20;3.18e-10)|all cancers(21;7.9e-10)|BRCA - Breast invasive adenocarcinoma(34;0.00116)|LUSC - Lung squamous cell carcinoma(543;0.127)		Pyruvic acid(DB00119)	TTGGGCCACACTGGCCCGCCG	0.632																																																	0													22.0	23.0	23.0					1																	155270044		2202	4297	6499	SO:0001583	missense	5313			BC025737, M15465	CCDS1109.1, CCDS44240.1	1q22	2012-10-02			ENSG00000143627	ENSG00000143627	2.7.1.40		9020	protein-coding gene	gene with protein product		609712				3566732	Standard	NM_000298		Approved		uc001fkb.4	P30613	OTTHUMG00000035875	ENST00000342741.4:c.128G>C	1.37:g.155270044C>G	ENSP00000339933:p.Ser43Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	O75758|P11973	Missense_Mutation	SNP	pfam_Pyrv_Knase_brl,pfam_Pyrv_Knase_C,superfamily_Pyrv/PenolPyrv_Kinase,superfamily_Pyrv_Knase_C,superfamily_Pyrv_Knase-like_insert_dom,prints_Pyr_Knase,tigrfam_Pyr_Knase	p.S43T	ENST00000342741.4	37	c.128	CCDS1109.1	1	.	.	.	.	.	.	.	.	.	.	C	12.51	1.960637	0.34565	.	.	ENSG00000143627	ENST00000423816;ENST00000392414;ENST00000342741	D;D	0.99677	-6.31;-6.37	4.61	3.68	0.42216	.	0.239223	0.40818	N	0.001001	D	0.96904	0.8989	L	0.36672	1.1	0.28079	N	0.932254	B;B	0.12013	0.005;0.005	B;B	0.08055	0.003;0.003	D	0.97300	0.9930	10	0.51188	T	0.08	-1.3971	5.9997	0.19513	0.1909:0.7108:0.0:0.0983	.	43;34	P30613;B1AVT1	KPYR_HUMAN;.	T	68;12;43	ENSP00000376214:S12T;ENSP00000339933:S43T	ENSP00000339933:S43T	S	-	2	0	PKLR	153536668	0.703000	0.27826	0.914000	0.36105	0.882000	0.50991	1.553000	0.36255	1.020000	0.39573	0.579000	0.79373	AGT	PKLR	-	NULL		0.632	PKLR-001	KNOWN	basic|CCDS	protein_coding	PKLR	HGNC	protein_coding	OTTHUMT00000087407.2	C	NM_000298		155270044	-1	no_errors	ENST00000342741	ensembl	human	known	70_37	missense	SNP	0.960	G
PKP4	8502	genome.wustl.edu	37	2	159314798	159314798	+	Intron	SNP	C	C	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:159314798C>A	ENST00000389759.3	+	1	107				CCDC148_ENST00000283233.5_5'Flank|PKP4_ENST00000389757.3_Intron|CCDC148_ENST00000536771.1_5'Flank|CCDC148_ENST00000409889.1_5'Flank|CCDC148_ENST00000491563.1_5'Flank	NM_003628.3	NP_003619.2	Q99569	PKP4_HUMAN	plakophilin 4						cell-cell junction assembly (GO:0007043)|cell-cell signaling (GO:0007267)|positive regulation of cytokinesis (GO:0032467)|positive regulation of gene expression (GO:0010628)|positive regulation of Rho GTPase activity (GO:0032321)|regulation of cell adhesion (GO:0030155)|single organismal cell-cell adhesion (GO:0016337)	cell-cell junction (GO:0005911)|cytoplasm (GO:0005737)|cytoplasmic side of plasma membrane (GO:0009898)|cytoskeleton (GO:0005856)|desmosome (GO:0030057)|midbody (GO:0030496)|mitotic spindle (GO:0072686)|perinuclear region of cytoplasm (GO:0048471)|plasma membrane (GO:0005886)|spindle midzone (GO:0051233)|spindle pole (GO:0000922)				breast(2)|central_nervous_system(1)|endometrium(7)|kidney(3)|large_intestine(9)|lung(21)|ovary(6)|skin(5)|upper_aerodigestive_tract(6)|urinary_tract(1)	61						AGCCAGAGGTCACCGGAGCAT	0.652										HNSCC(62;0.18)																																							0																																										SO:0001627	intron_variant	8502			X81889	CCDS33305.1, CCDS33306.1	2q24.1	2013-02-14			ENSG00000144283	ENSG00000144283		"""Armadillo repeat containing"""	9026	protein-coding gene	gene with protein product		604276				9342840, 8937994	Standard	NM_003628		Approved	p0071	uc002tzv.3	Q99569	OTTHUMG00000153969	ENST00000389759.3:c.-6+1068C>A	2.37:g.159314798C>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q86W91	RNA	SNP	-	NULL	ENST00000389759.3	37	NULL	CCDS33305.1	2																																																																																			PKP4	-	-		0.652	PKP4-002	KNOWN	basic|appris_principal|CCDS	protein_coding	PKP4	HGNC	protein_coding	OTTHUMT00000333250.1	C			159314798	+1	no_errors	ENST00000462335	ensembl	human	known	70_37	rna	SNP	1.000	A
TINCR	257000	genome.wustl.edu	37	19	5561091	5561091	+	lincRNA	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:5561091G>C	ENST00000448587.1	-	0	819					NR_027064.1				tissue differentiation-inducing non-protein coding RNA																		TCCTGGGCAAGAGCGGAAGTG	0.577																																																	0													51.0	56.0	54.0					19																	5561091		692	1591	2283			257000			BG354568		19p13.3	2013-09-11	2012-12-05	2012-12-05	ENSG00000223573	ENSG00000223573		"""Long non-coding RNAs"", ""-"""	14607	non-coding RNA	RNA, long non-coding	"""non-protein coding RNA 36"", ""long intergenic non-protein coding RNA 36"", ""terminal differentiation-induced ncRNA"""	615241	"""placenta-specific 2"", ""placenta-specific 2 (non-protein coding)"""	PLAC2		23201690, 24019000	Standard	NR_027064		Approved	FLJ90734, NCRNA00036, LINC00036	uc002mcc.5		OTTHUMG00000150390		19.37:g.5561091G>C		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000448587.1	37	NULL		19																																																																																			PLAC2	-	-		0.577	TINCR-001	KNOWN	basic	lincRNA	PLAC2	HGNC	lincRNA	OTTHUMT00000317918.1	G	NR_027064		5561091	-1	no_errors	ENST00000448587	ensembl	human	known	70_37	rna	SNP	0.000	C
PLEC	5339	genome.wustl.edu	37	8	145002027	145002027	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:145002027G>C	ENST00000322810.4	-	26	3974	c.3805C>G	c.(3805-3807)Ctg>Gtg	p.L1269V	PLEC_ENST00000398774.2_Missense_Mutation_p.L1100V|PLEC_ENST00000354958.2_Missense_Mutation_p.L1110V|PLEC_ENST00000354589.3_Missense_Mutation_p.L1132V|PLEC_ENST00000436759.2_Missense_Mutation_p.L1159V|PLEC_ENST00000345136.3_Missense_Mutation_p.L1132V|PLEC_ENST00000527096.1_Missense_Mutation_p.L1155V|PLEC_ENST00000357649.2_Missense_Mutation_p.L1136V|PLEC_ENST00000356346.3_Missense_Mutation_p.L1118V	NM_201380.2	NP_958782.1	Q15149	PLEC_HUMAN	plectin	1269	Globular 1.				apoptotic process (GO:0006915)|cell junction assembly (GO:0034329)|cellular component disassembly involved in execution phase of apoptosis (GO:0006921)|extracellular matrix organization (GO:0030198)|hemidesmosome assembly (GO:0031581)	costamere (GO:0043034)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|extracellular vesicular exosome (GO:0070062)|focal adhesion (GO:0005925)|hemidesmosome (GO:0030056)|intermediate filament cytoskeleton (GO:0045111)|plasma membrane (GO:0005886)|sarcolemma (GO:0042383)|sarcoplasm (GO:0016528)	ankyrin binding (GO:0030506)|poly(A) RNA binding (GO:0044822)|structural constituent of muscle (GO:0008307)			NS(1)|breast(3)|central_nervous_system(4)|cervix(7)|endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|kidney(9)|large_intestine(8)|lung(57)|ovary(4)|pancreas(2)|prostate(11)|skin(9)|stomach(2)|upper_aerodigestive_tract(10)	137						GATACCTTCAGAGAGGCCTTG	0.687																																																	0													14.0	19.0	17.0					8																	145002027		1913	4116	6029	SO:0001583	missense	5339			U53204	CCDS43769.1, CCDS43770.1, CCDS43771.1, CCDS43772.1, CCDS43773.1, CCDS43774.1, CCDS43775.1, CCDS47936.1	8q24	2010-02-04	2010-02-04	2010-02-04	ENSG00000178209	ENSG00000178209			9069	protein-coding gene	gene with protein product		601282	"""plectin 1, intermediate filament binding protein, 500kD"", ""epidermolysis bullosa simplex 1 (Ogna)"", ""plectin 1, intermediate filament binding protein 500kDa"""	EBS1, PLEC1		8633055, 8696340	Standard	XM_005250976		Approved	PCN, PLTN	uc003zaf.1	Q15149	OTTHUMG00000165291	ENST00000322810.4:c.3805C>G	8.37:g.145002027G>C	ENSP00000323856:p.Leu1269Val	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15148|Q16640|Q6S376|Q6S377|Q6S378|Q6S379|Q6S380|Q6S381|Q6S382|Q6S383	Missense_Mutation	SNP	pfam_Plectin_repeat,pfam_CH-domain,pfam_S10_plectin_N,superfamily_CH-domain,superfamily_Chorismate_mutase_type_II,smart_CH-domain,smart_Spectrin/alpha-actinin,smart_Plectin_repeat,pfscan_CH-domain	p.L1269V	ENST00000322810.4	37	c.3805	CCDS43772.1	8	.	.	.	.	.	.	.	.	.	.	G	8.815	0.936130	0.18206	.	.	ENSG00000178209	ENST00000345136;ENST00000357649;ENST00000354589;ENST00000398774;ENST00000322810;ENST00000354958;ENST00000356346;ENST00000436759;ENST00000527096	T;T;T;T;T;T;T;T;T	0.36878	1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23;1.23	5.44	3.28	0.37604	.	0.108809	0.37304	U	0.002150	T	0.37571	0.1008	M	0.69523	2.12	0.47547	D	0.99945	B;B;B;B;B;B;B;B	0.33694	0.167;0.167;0.167;0.104;0.167;0.167;0.421;0.167	B;B;B;B;B;B;B;B	0.33750	0.169;0.169;0.169;0.081;0.169;0.169;0.169;0.169	T	0.42682	-0.9437	10	0.87932	D	0	.	11.0735	0.48016	0.0793:0.0:0.7894:0.1313	.	1159;1118;1110;1269;1100;1132;1136;1132	Q15149-2;Q15149-9;Q15149-8;Q15149;Q15149-7;Q15149-5;Q15149-6;Q15149-4	.;.;.;PLEC_HUMAN;.;.;.;.	V	1132;1136;1132;1100;1269;1110;1118;1159;1155	ENSP00000344848:L1132V;ENSP00000350277:L1136V;ENSP00000346602:L1132V;ENSP00000381756:L1100V;ENSP00000323856:L1269V;ENSP00000347044:L1110V;ENSP00000348702:L1118V;ENSP00000388180:L1159V;ENSP00000434583:L1155V	ENSP00000323856:L1269V	L	-	1	2	PLEC	145074015	0.993000	0.37304	0.361000	0.25849	0.467000	0.32768	2.085000	0.41634	1.261000	0.44149	0.637000	0.83480	CTG	PLEC	-	smart_Spectrin/alpha-actinin		0.687	PLEC-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEC	HGNC	protein_coding	OTTHUMT00000383281.1	G	NM_000445		145002027	-1	no_errors	ENST00000322810	ensembl	human	known	70_37	missense	SNP	0.951	C
PLEKHA4	57664	genome.wustl.edu	37	19	49351177	49351177	+	Missense_Mutation	SNP	C	C	T	rs200384203	byFrequency	TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:49351177C>T	ENST00000263265.6	-	14	2101	c.1546G>A	c.(1546-1548)Gag>Aag	p.E516K	PLEKHA4_ENST00000355496.5_Missense_Mutation_p.E491K	NM_020904.2	NP_065955.2	Q9H4M7	PKHA4_HUMAN	pleckstrin homology domain containing, family A (phosphoinositide binding specific) member 4	516						cytoplasm (GO:0005737)|membrane (GO:0016020)	1-phosphatidylinositol binding (GO:0005545)			NS(1)|breast(5)|central_nervous_system(1)|endometrium(4)|kidney(1)|large_intestine(5)|lung(5)|ovary(1)|prostate(3)|skin(2)|urinary_tract(2)	30		all_lung(116;4.89e-05)|Lung NSC(112;8.3e-05)|all_epithelial(76;0.000108)|all_neural(266;0.0506)|Ovarian(192;0.113)		OV - Ovarian serous cystadenocarcinoma(262;0.00027)|all cancers(93;0.00084)|GBM - Glioblastoma multiforme(486;0.0244)|Epithelial(262;0.0364)		GAGGACTCCTCGCCCTGGAGC	0.612													.|||	6	0.00119808	0.0	0.0	5008	,	,		14837	0.0		0.0	False		,,,				2504	0.0061																0								C	LYS/GLU,LYS/GLU	1,4405	2.1+/-5.4	0,1,2202	61.0	55.0	57.0		1471,1546	2.8	1.0	19		57	0,8600		0,0,4300	yes	missense,missense	PLEKHA4	NM_001161354.1,NM_020904.2	56,56	0,1,6502	TT,TC,CC		0.0,0.0227,0.0077	possibly-damaging,possibly-damaging	491/584,516/780	49351177	1,13005	2203	4300	6503	SO:0001583	missense	57664			AY007233	CCDS12737.1, CCDS54291.1	19q13.33	2013-01-10	2002-01-14			ENSG00000105559		"""Pleckstrin homology (PH) domain containing"""	14339	protein-coding gene	gene with protein product		607769	"""pleckstrin homology domain-containing, family A (phosphoinositide binding specific) member 4"""			11001876	Standard	NM_020904		Approved	PEPP1	uc002pkx.3	Q9H4M7		ENST00000263265.6:c.1546G>A	19.37:g.49351177C>T	ENSP00000263265:p.Glu516Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8N4M8|Q8N658	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E516K	ENST00000263265.6	37	c.1546	CCDS12737.1	19	.	.	.	.	.	.	.	.	.	.	C	20.8	4.044870	0.75732	2.27E-4	0.0	ENSG00000105559	ENST00000263265;ENST00000355496	T;T	0.35421	1.31;1.31	4.89	2.77	0.32553	.	0.000000	0.36374	N	0.002640	T	0.39064	0.1064	L	0.36672	1.1	0.24705	N	0.993239	B;D	0.89917	0.014;1.0	B;D	0.73708	0.006;0.981	T	0.20438	-1.0275	10	0.09590	T	0.72	.	6.9069	0.24313	0.0:0.7986:0.0:0.2013	.	491;516	Q9H4M7-2;Q9H4M7	.;PKHA4_HUMAN	K	516;491	ENSP00000263265:E516K;ENSP00000347683:E491K	ENSP00000263265:E516K	E	-	1	0	PLEKHA4	54042989	0.639000	0.27234	0.996000	0.52242	0.844000	0.47949	0.814000	0.27239	1.402000	0.46780	0.650000	0.86243	GAG	PLEKHA4	-	NULL		0.612	PLEKHA4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHA4	HGNC	protein_coding	OTTHUMT00000466216.1	C			49351177	-1	no_errors	ENST00000263265	ensembl	human	known	70_37	missense	SNP	0.981	T
PLEKHO2	80301	genome.wustl.edu	37	15	65157665	65157665	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr15:65157665G>C	ENST00000323544.4	+	6	1179	c.1051G>C	c.(1051-1053)Gag>Cag	p.E351Q	AC069368.3_ENST00000437723.1_Intron	NM_001195059.1|NM_025201.4	NP_001181988.1|NP_079477.2	Q8TD55	PKHO2_HUMAN	pleckstrin homology domain containing, family O member 2	351	Pro-rich.									NS(1)|breast(1)|cervix(3)|endometrium(1)|kidney(2)|large_intestine(5)|lung(9)|ovary(1)|skin(1)|upper_aerodigestive_tract(1)	25						TGACAGTCCTGAGCCTGCCAA	0.587																																																	0													68.0	68.0	68.0					15																	65157665		2202	4299	6501	SO:0001583	missense	80301			AF318373	CCDS10196.1, CCDS73739.1	15q22.31	2013-01-10	2007-12-14	2007-12-14	ENSG00000241839	ENSG00000241839		"""Pleckstrin homology (PH) domain containing"""	30026	protein-coding gene	gene with protein product			"""pleckstrin homology domain containing, family Q member 1"""	PLEKHQ1		12477932	Standard	NM_025201		Approved	DKFZp761K2312, PP1628, pp9099	uc002anv.3	Q8TD55	OTTHUMG00000133050	ENST00000323544.4:c.1051G>C	15.37:g.65157665G>C	ENSP00000326706:p.Glu351Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q7L4H4|Q8WYS8	Missense_Mutation	SNP	pfam_Pleckstrin_homology,smart_Pleckstrin_homology,pfscan_Pleckstrin_homology	p.E351Q	ENST00000323544.4	37	c.1051	CCDS10196.1	15	.	.	.	.	.	.	.	.	.	.	G	8.593	0.885099	0.17540	.	.	ENSG00000241839	ENST00000323544	T	0.32272	1.46	5.42	3.51	0.40186	.	0.422191	0.24851	N	0.035088	T	0.20210	0.0486	L	0.29908	0.895	0.09310	N	1	B;B	0.30937	0.301;0.118	B;B	0.24974	0.057;0.026	T	0.17107	-1.0380	10	0.62326	D	0.03	.	9.0174	0.36179	0.0791:0.1462:0.7747:0.0	.	301;351	Q8TD55-2;Q8TD55	.;PKHO2_HUMAN	Q	351	ENSP00000326706:E351Q	ENSP00000326706:E351Q	E	+	1	0	PLEKHO2	62944718	0.906000	0.30813	0.029000	0.17559	0.067000	0.16453	2.347000	0.44036	1.260000	0.44134	-0.175000	0.13238	GAG	PLEKHO2	-	NULL		0.587	PLEKHO2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PLEKHO2	HGNC	protein_coding	OTTHUMT00000256659.1	G	NM_025201		65157665	+1	no_errors	ENST00000323544	ensembl	human	known	70_37	missense	SNP	0.068	C
PNPLA7	375775	genome.wustl.edu	37	9	140356868	140356868	+	Intron	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:140356868G>A	ENST00000277531.4	-	30	3604				PNPLA7_ENST00000406427.1_Intron|PNPLA7_ENST00000371457.1_Intron|PNPLA7_ENST00000492278.1_5'UTR	NM_152286.3	NP_689499.3	Q6ZV29	PLPL7_HUMAN	patatin-like phospholipase domain containing 7						lipid metabolic process (GO:0006629)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|lysosome (GO:0005764)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	lysophospholipase activity (GO:0004622)			breast(1)|central_nervous_system(3)|endometrium(2)|haematopoietic_and_lymphoid_tissue(3)|large_intestine(9)|lung(13)|ovary(1)|prostate(1)|skin(2)|stomach(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	40	all_cancers(76;0.126)			OV - Ovarian serous cystadenocarcinoma(145;0.000268)|Epithelial(140;0.000839)		AGGTTCTGGGGACCCATCCTC	0.711																																																	0																																										SO:0001627	intron_variant	375775			AK126267	CCDS7045.1, CCDS48070.1	9q34.3	2009-01-12	2006-06-12	2006-06-12	ENSG00000130653	ENSG00000130653		"""Patatin-like phospholipase domain containing"""	24768	protein-coding gene	gene with protein product		612122	"""chromosome 9 open reading frame 111"""	C9orf111		16799181, 12640454, 19029121	Standard	XM_005266082		Approved	FLJ43070, FLJ31318, FLJ44279, RP11-48C7.2, NTEL1, NTE-R1	uc010ncj.1	Q6ZV29	OTTHUMG00000020990	ENST00000277531.4:c.3418-85C>T	9.37:g.140356868G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	B5MDD3|Q5T364|Q658X0|Q658Y3|Q6ZTS1|Q86YU8|Q8TAY5|Q96N75|Q9H7N5	RNA	SNP	-	NULL	ENST00000277531.4	37	NULL	CCDS7045.1	9																																																																																			PNPLA7	-	-		0.711	PNPLA7-007	KNOWN	basic|appris_candidate|CCDS	protein_coding	PNPLA7	HGNC	protein_coding	OTTHUMT00000254787.1	G	NM_152286		140356868	-1	no_errors	ENST00000492278	ensembl	human	known	70_37	rna	SNP	0.000	A
POLR1B	84172	genome.wustl.edu	37	2	113306925	113306925	+	Missense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:113306925G>T	ENST00000263331.5	+	4	1154	c.574G>T	c.(574-576)Gca>Tca	p.A192S	POLR1B_ENST00000417433.2_Missense_Mutation_p.A136S|POLR1B_ENST00000541869.1_Missense_Mutation_p.A230S|POLR1B_ENST00000409894.3_Missense_Mutation_p.A192S|POLR1B_ENST00000537335.1_Intron	NM_019014.4	NP_061887.2	Q9H9Y6	RPA2_HUMAN	polymerase (RNA) I polypeptide B, 128kDa	192					gene expression (GO:0010467)|termination of RNA polymerase I transcription (GO:0006363)|transcription elongation from RNA polymerase I promoter (GO:0006362)|transcription from RNA polymerase I promoter (GO:0006360)|transcription initiation from RNA polymerase I promoter (GO:0006361)	cytoplasm (GO:0005737)|nucleolus (GO:0005730)|nucleoplasm (GO:0005654)	DNA binding (GO:0003677)|DNA-directed RNA polymerase activity (GO:0003899)|metal ion binding (GO:0046872)|ribonucleoside binding (GO:0032549)			breast(3)|endometrium(9)|kidney(2)|large_intestine(9)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	42						TTTTCCCATTGCAATGATAAG	0.343																																					Ovarian(16;256 576 9537 23969 41147)												0													56.0	60.0	59.0					2																	113306925		2203	4299	6502	SO:0001583	missense	84172			AK001678	CCDS2097.1, CCDS46395.1, CCDS62988.1, CCDS62989.1, CCDS62990.1	2q13	2013-01-21			ENSG00000125630	ENSG00000125630		"""RNA polymerase subunits"""	20454	protein-coding gene	gene with protein product		602000					Standard	NM_001137604		Approved	Rpo1-2, FLJ21921, FLJ10816, RPA2	uc002thw.2	Q9H9Y6	OTTHUMG00000131314	ENST00000263331.5:c.574G>T	2.37:g.113306925G>T	ENSP00000263331:p.Ala192Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B7Z6Y7|B7Z823|F5GZX4|F8W898|Q2TAM4|Q585T5|Q6ZRR2|Q9H9D3	Missense_Mutation	SNP	pfam_DNA-dir_RNA_pol_su2_6,pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_3,pfam_RNA_pol_Rpb2_7,pfam_RNA_pol_Rpa2-specific,pfam_RNA_pol_Rpb2_2,pfam_RNA_pol_Rpb2_5	p.A230S	ENST00000263331.5	37	c.688	CCDS2097.1	2	.	.	.	.	.	.	.	.	.	.	G	33	5.250862	0.95305	.	.	ENSG00000125630	ENST00000263331;ENST00000541869;ENST00000409894;ENST00000417433	T;T;T;T	0.63580	-0.05;-0.05;-0.05;-0.05	5.63	5.63	0.86233	RNA polymerase, beta subunit, protrusion (1);RNA polymerase Rpb2, domain 2 (1);	0.000000	0.85682	D	0.000000	T	0.78233	0.4251	M	0.66939	2.045	0.80722	D	1	D;D;P;D	0.76494	0.998;0.999;0.909;0.999	D;D;P;D	0.80764	0.972;0.994;0.646;0.99	T	0.77273	-0.2649	10	0.46703	T	0.11	-17.2684	18.4811	0.90812	0.0:0.0:1.0:0.0	.	230;192;136;192	F5GZX4;F8W898;Q9H9Y6-2;Q9H9Y6	.;.;.;RPA2_HUMAN	S	192;230;192;136	ENSP00000263331:A192S;ENSP00000444136:A230S;ENSP00000387143:A192S;ENSP00000405358:A136S	ENSP00000263331:A192S	A	+	1	0	POLR1B	113023396	1.000000	0.71417	0.988000	0.46212	0.998000	0.95712	9.797000	0.99108	2.652000	0.90054	0.655000	0.94253	GCA	POLR1B	-	pfam_RNA_pol_bsu_protrusion,pfam_RNA_pol_Rpb2_2		0.343	POLR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	POLR1B	HGNC	protein_coding	OTTHUMT00000254083.1	G	NM_019014		113306925	+1	no_errors	ENST00000541869	ensembl	human	known	70_37	missense	SNP	1.000	T
POLR2J4	84820	genome.wustl.edu	37	7	44009353	44009353	+	RNA	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:44009353G>A	ENST00000427076.1	-	0	1177				RP5-1165K10.2_ENST00000454572.1_RNA	NR_003655.2				polymerase (RNA) II (DNA directed) polypeptide J4, pseudogene																		ACAGAGCAGCGTAGCTGGCAG	0.687																																																	0																																												84820					7p13	2008-08-21			ENSG00000214783	ENSG00000214783			28195	pseudogene	pseudogene						15586814	Standard	NR_003655		Approved	MGC13098	uc010kxw.2		OTTHUMG00000155253		7.37:g.44009353G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000427076.1	37	NULL		7																																																																																			POLR2J4	-	-		0.687	POLR2J4-002	KNOWN	basic|readthrough_transcript	processed_transcript	POLR2J4	HGNC	processed_transcript	OTTHUMT00000473169.1	G	NR_003655		44009353	-1	no_errors	ENST00000427076	ensembl	human	known	70_37	rna	SNP	0.965	A
TRIM37	4591	genome.wustl.edu	37	17	57057649	57057649	+	IGR	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:57057649C>G	ENST00000393066.3	-	0	3622				PPM1E_ENST00000308249.2_Missense_Mutation_p.Q509E	NM_001005207.2	NP_001005207.1	O94972	TRI37_HUMAN	tripartite motif containing 37						aggresome assembly (GO:0070842)|negative regulation of centriole replication (GO:0046600)|negative regulation of NF-kappaB transcription factor activity (GO:0032088)|positive regulation of NF-kappaB transcription factor activity (GO:0051092)|positive regulation of sequence-specific DNA binding transcription factor activity (GO:0051091)|protein autoubiquitination (GO:0051865)	aggresome (GO:0016235)|cytoplasm (GO:0005737)|cytosol (GO:0005829)|peroxisome (GO:0005777)	chromatin binding (GO:0003682)|ligase activity (GO:0016874)|protein homodimerization activity (GO:0042803)|tumor necrosis factor receptor binding (GO:0005164)|ubiquitin protein ligase binding (GO:0031625)|ubiquitin-protein transferase activity (GO:0004842)|zinc ion binding (GO:0008270)			breast(1)|endometrium(3)|kidney(3)|large_intestine(10)|lung(13)|ovary(1)|pancreas(2)|skin(1)|upper_aerodigestive_tract(1)|urinary_tract(2)	37	Medulloblastoma(34;0.0922)|all_neural(34;0.101)					GAACTCTTTTCAAGGAGGGCA	0.483									Mulibrey Nanism																																								0													120.0	116.0	117.0					17																	57057649		2203	4300	6503	SO:0001628	intergenic_variant	22843	Familial Cancer Database	Perheentupa syndrome	AB020705	CCDS32694.1, CCDS45746.1	17q	2014-02-17	2011-01-25	2001-11-30		ENSG00000108395		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	7523	protein-coding gene	gene with protein product	"""RING-B-box-coiled-coil protein"""	605073	"""tripartite motif-containing 37"""	MUL		9106536, 10888877	Standard	NM_015294		Approved	KIAA0898, POB1, TEF3	uc002iwy.4	O94972			17.37:g.57057649C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	Q7Z3E6|Q8IYF7|Q8WYF7	Missense_Mutation	SNP	pfam_PP2C-like,superfamily_PP2C-like,smart_PP2C-like	p.Q509E	ENST00000393066.3	37	c.1525	CCDS45746.1	17	.	.	.	.	.	.	.	.	.	.	C	10.98	1.505504	0.26949	.	.	ENSG00000175175	ENST00000308249;ENST00000443121	T	0.17370	2.28	5.71	4.73	0.59995	.	0.596797	0.18726	N	0.132881	T	0.12518	0.0304	N	0.24115	0.695	0.24889	N	0.992173	B;B	0.13594	0.008;0.008	B;B	0.11329	0.006;0.006	T	0.16394	-1.0404	10	0.40728	T	0.16	-7.0686	11.3897	0.49806	0.142:0.7214:0.1366:0.0	.	518;509	Q8WY54-3;Q8WY54-2	.;.	E	509;360	ENSP00000312411:Q509E	ENSP00000312411:Q509E	Q	+	1	0	PPM1E	54412431	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	1.023000	0.30065	1.412000	0.46977	0.491000	0.48974	CAA	PPM1E	-	NULL		0.483	TRIM37-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PPM1E	HGNC	protein_coding	OTTHUMT00000445928.1	C	NM_015294		57057649	+1	no_errors	ENST00000308249	ensembl	human	known	70_37	missense	SNP	0.987	G
PRAMEF2	65122	genome.wustl.edu	37	1	12918971	12918971	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:12918971A>G	ENST00000240189.2	+	2	194	c.107A>G	c.(106-108)tAt>tGt	p.Y36C		NM_023014.1	NP_075390.1	O60811	PRAM2_HUMAN	PRAME family member 2	36					negative regulation of apoptotic process (GO:0043066)|negative regulation of cell differentiation (GO:0045596)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|negative regulation of transcription, DNA-templated (GO:0045892)|positive regulation of cell proliferation (GO:0008284)					breast(2)|endometrium(1)|kidney(2)|large_intestine(2)|lung(22)|prostate(6)|skin(3)|upper_aerodigestive_tract(4)	42	Ovarian(185;0.249)	Renal(390;0.000469)|Lung NSC(185;0.00143)|all_lung(284;0.00181)|Colorectal(325;0.00215)|Breast(348;0.00224)|Myeloproliferative disorder(586;0.0393)|Hepatocellular(190;0.0623)|Ovarian(437;0.0731)		UCEC - Uterine corpus endometrioid carcinoma (279;0.00812)|Colorectal(212;2.4e-06)|Kidney(185;4.89e-05)|COAD - Colon adenocarcinoma(227;0.000152)|KIRC - Kidney renal clear cell carcinoma(229;0.000194)|BRCA - Breast invasive adenocarcinoma(304;0.000293)|STAD - Stomach adenocarcinoma(313;0.0072)|READ - Rectum adenocarcinoma(331;0.0649)		AGGGTGCTCTATCTCCCACTC	0.622																																																	0													105.0	113.0	111.0					1																	12918971		2201	4296	6497	SO:0001583	missense	65122				CCDS149.1	1p36.21	2013-01-17			ENSG00000120952	ENSG00000120952		"""-"""	28841	protein-coding gene	gene with protein product							Standard	NM_023014		Approved	FLJ43580	uc001aum.1	O60811	OTTHUMG00000001986	ENST00000240189.2:c.107A>G	1.37:g.12918971A>G	ENSP00000240189:p.Tyr36Cys	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	NULL	p.Y36C	ENST00000240189.2	37	c.107	CCDS149.1	1	.	.	.	.	.	.	.	.	.	.	A	6.544	0.468667	0.12461	.	.	ENSG00000120952	ENST00000240189	T	0.04970	3.52	0.842	-1.68	0.08212	.	0.229124	0.38111	N	0.001819	T	0.08802	0.0218	L	0.27053	0.805	0.09310	N	1	D	0.71674	0.998	D	0.64595	0.927	T	0.29027	-1.0025	10	0.87932	D	0	.	4.4558	0.11642	0.2895:0.0:0.0:0.7105	.	36	O60811	PRAM2_HUMAN	C	36	ENSP00000240189:Y36C	ENSP00000240189:Y36C	Y	+	2	0	PRAMEF2	12841558	0.016000	0.18221	0.000000	0.03702	0.000000	0.00434	-0.807000	0.04520	-1.480000	0.01865	-1.254000	0.01491	TAT	PRAMEF2	-	NULL		0.622	PRAMEF2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	PRAMEF2	HGNC	protein_coding	OTTHUMT00000005517.1	A	NM_023014		12918971	+1	no_errors	ENST00000240189	ensembl	human	known	70_37	missense	SNP	0.000	G
PRDM2	7799	genome.wustl.edu	37	1	14105740	14105740	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:14105740C>T	ENST00000235372.7	+	8	2306	c.1450C>T	c.(1450-1452)Ccg>Tcg	p.P484S	PRDM2_ENST00000413440.1_Missense_Mutation_p.P283S|PRDM2_ENST00000343137.4_Missense_Mutation_p.P283S|PRDM2_ENST00000505823.1_Intron|PRDM2_ENST00000311066.5_Missense_Mutation_p.P484S|PRDM2_ENST00000376048.5_Intron|PRDM2_ENST00000503842.1_Intron	NM_012231.4	NP_036363.2	Q13029	PRDM2_HUMAN	PR domain containing 2, with ZNF domain	484					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|histone-lysine N-methyltransferase activity (GO:0018024)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			endometrium(9)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(16)|lung(20)|ovary(3)|prostate(3)|skin(1)|urinary_tract(2)	55	Ovarian(185;0.249)	all_lung(284;2.56e-05)|Lung NSC(185;4.94e-05)|Renal(390;0.000147)|Breast(348;0.000162)|Colorectal(325;0.00058)|Ovarian(437;0.00965)|Hepatocellular(190;0.0245)|Myeloproliferative disorder(586;0.0255)	GBM - Glioblastoma multiforme(2;0.00182)	UCEC - Uterine corpus endometrioid carcinoma (279;0.00224)|Colorectal(212;3.23e-08)|BRCA - Breast invasive adenocarcinoma(304;2.16e-05)|COAD - Colon adenocarcinoma(227;2.53e-05)|Kidney(185;0.000762)|KIRC - Kidney renal clear cell carcinoma(229;0.00258)|STAD - Stomach adenocarcinoma(313;0.00446)|READ - Rectum adenocarcinoma(331;0.0276)|Lung(427;0.145)		AGAACTTCATCCGTGCAAATA	0.423																																																	0													44.0	41.0	42.0					1																	14105740		2203	4300	6503	SO:0001583	missense	7799			U17838	CCDS150.1, CCDS151.1, CCDS30603.1, CCDS44061.1	1p36	2011-07-01			ENSG00000116731	ENSG00000116731		"""Chromatin-modifying enzymes / K-methyltransferases"""	9347	protein-coding gene	gene with protein product	"""retinoblastoma protein-binding zinc finger protein"", ""retinoblastoma protein-interacting zinc finger protein"", ""MTE-binding protein"", ""zinc-finger DNA-binding protein"", ""GATA-3 binding protein G3B"""	601196				7538672	Standard	NM_012231		Approved	RIZ, RIZ1, RIZ2, KMT8, MTB-ZF, HUMHOXY1	uc001avi.3	Q13029	OTTHUMG00000007917	ENST00000235372.7:c.1450C>T	1.37:g.14105740C>T	ENSP00000235372:p.Pro484Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	B1AJZ4|B5MC68|Q13149|Q14550|Q5THJ1|Q5VUL9	Missense_Mutation	SNP	pfam_SET_dom,smart_SET_dom,smart_Znf_C2H2-like,pirsf_RIZ_retinblastoma-bd_prot,pfscan_SET_dom,pfscan_Znf_C2H2	p.P484S	ENST00000235372.7	37	c.1450	CCDS150.1	1	.	.	.	.	.	.	.	.	.	.	C	16.39	3.108585	0.56291	.	.	ENSG00000116731	ENST00000235372;ENST00000311066;ENST00000400800;ENST00000413440;ENST00000343137	T;T;T;T	0.77358	-1.09;-1.09;-1.09;-1.09	5.48	5.48	0.80851	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (2);	0.000000	0.85682	D	0.000000	D	0.82737	0.5102	L	0.32530	0.975	0.80722	D	1	D;D;D;D	0.89917	1.0;1.0;0.999;1.0	D;D;D;D	0.97110	0.997;1.0;0.997;0.994	T	0.81366	-0.0965	10	0.35671	T	0.21	.	17.925	0.88980	0.0:1.0:0.0:0.0	.	484;342;484;484	A8MW16;Q5THJ0;Q13029;Q13029-2	.;.;PRDM2_HUMAN;.	S	484;484;484;283;283	ENSP00000235372:P484S;ENSP00000312352:P484S;ENSP00000411103:P283S;ENSP00000341621:P283S	ENSP00000235372:P484S	P	+	1	0	PRDM2	13978327	1.000000	0.71417	0.997000	0.53966	0.854000	0.48673	5.757000	0.68766	2.564000	0.86499	0.561000	0.74099	CCG	PRDM2	-	smart_Znf_C2H2-like,pirsf_RIZ_retinblastoma-bd_prot,pfscan_Znf_C2H2		0.423	PRDM2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRDM2	HGNC	protein_coding	OTTHUMT00000021792.2	C	NM_012231		14105740	+1	no_errors	ENST00000235372	ensembl	human	known	70_37	missense	SNP	1.000	T
PRG4	10216	genome.wustl.edu	37	1	186276585	186276585	+	Silent	SNP	A	A	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:186276585A>C	ENST00000445192.2	+	7	1779	c.1734A>C	c.(1732-1734)ccA>ccC	p.P578P	PRG4_ENST00000367484.3_Intron|PRG4_ENST00000367486.3_Silent_p.P535P|PRG4_ENST00000367483.4_Silent_p.P537P|PRG4_ENST00000367485.4_Silent_p.P485P	NM_005807.3	NP_005798.2	Q92954	PRG4_HUMAN	proteoglycan 4	578	59 X 8 AA repeats of K-X-P-X-P-T-T-X.				cell proliferation (GO:0008283)|hematopoietic stem cell proliferation (GO:0071425)|immune response (GO:0006955)|negative regulation of interleukin-6 biosynthetic process (GO:0045409)|regulation of cell proliferation (GO:0042127)	extracellular space (GO:0005615)	polysaccharide binding (GO:0030247)|scavenger receptor activity (GO:0005044)			NS(2)|breast(1)|central_nervous_system(1)|endometrium(26)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(12)|lung(33)|prostate(7)|skin(9)|upper_aerodigestive_tract(2)|urinary_tract(1)	102						AGCCTGCCCCAACTACCCCCA	0.642																																																	0													89.0	92.0	91.0					1																	186276585		2203	4300	6503	SO:0001819	synonymous_variant	10216			U70136	CCDS1369.1, CCDS44287.1, CCDS44288.1	1q25-q31	2008-07-18	2004-11-15		ENSG00000116690	ENSG00000116690			9364	protein-coding gene	gene with protein product	"""lubricin"", ""megakaryocyte stimulating factor"", ""articular superficial zone protein"", ""Jacobs camptodactyly-arthropathy-pericarditis syndrome"", ""camptodactyly, arthropathy, coxa vara, pericarditis syndrome"", ""bG174L6.2 (MSF: megakaryocyte stimulating factor )"""	604283	"""proteoglycan 4, (megakaryocyte stimulating factor, articular superficial zone protein, camptodactyly, arthropathy, coxa vara, pericarditis syndrome)"""	CACP		10545950, 9920774	Standard	NM_005807		Approved	JCAP, SZP, MSF, HAPO, bG174L6.2, FLJ32635	uc001gru.4	Q92954	OTTHUMG00000035574	ENST00000445192.2:c.1734A>C	1.37:g.186276585A>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q6DNC4|Q6DNC5|Q6ZMZ5|Q9BX49	Silent	SNP	pfam_Somatomedin_B_dom,pfam_Hemopexin/matrixin_repeat,superfamily_Hemopexin/matrixin,smart_Somatomedin_B_dom,smart_Hemopexin/matrixin_repeat,pfscan_Somatomedin_B_dom,prints_Somatomedin_B_chordata	p.P578	ENST00000445192.2	37	c.1734	CCDS1369.1	1																																																																																			PRG4	-	NULL		0.642	PRG4-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	PRG4	HGNC	protein_coding	OTTHUMT00000086346.1	A	NM_005807		186276585	+1	no_errors	ENST00000445192	ensembl	human	known	70_37	silent	SNP	0.000	C
PSIP1	11168	genome.wustl.edu	37	9	15486008	15486008	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:15486008C>T	ENST00000380733.4	-	6	795	c.452G>A	c.(451-453)aGa>aAa	p.R151K	PSIP1_ENST00000380716.4_Missense_Mutation_p.R151K|PSIP1_ENST00000380738.4_Missense_Mutation_p.R151K|PSIP1_ENST00000397519.2_Missense_Mutation_p.R151K|PSIP1_ENST00000380715.1_Missense_Mutation_p.R151K			O75475	PSIP1_HUMAN	PC4 and SFRS1 interacting protein 1	151					establishment of integrated proviral latency (GO:0075713)|mRNA 5'-splice site recognition (GO:0000395)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of transcription, DNA-templated (GO:0006355)|response to heat (GO:0009408)|response to oxidative stress (GO:0006979)|transcription, DNA-templated (GO:0006351)|viral process (GO:0016032)	cytosol (GO:0005829)|nuclear heterochromatin (GO:0005720)|nuclear periphery (GO:0034399)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)|transcriptionally active chromatin (GO:0035327)	activating transcription factor binding (GO:0033613)|chromatin binding (GO:0003682)|poly(A) RNA binding (GO:0044822)|RNA polymerase II transcription coactivator activity (GO:0001105)|supercoiled DNA binding (GO:0097100)			breast(2)|endometrium(2)|kidney(1)|lung(3)|prostate(1)	9				GBM - Glioblastoma multiforme(50;2.38e-06)		AATTACCTTTCTCTTTCTCCC	0.338																																																	0													143.0	147.0	146.0					9																	15486008		2203	4300	6503	SO:0001583	missense	11168			AF098482	CCDS6479.1, CCDS6480.1	9p22.2	2008-02-05	2004-02-24		ENSG00000164985	ENSG00000164985			9527	protein-coding gene	gene with protein product		603620	"""PC4 and SFRS1 interacting protein 2"""	PSIP2		9822615, 9885563	Standard	NM_033222		Approved	p52, LEDGF, p75	uc003zlw.4	O75475	OTTHUMG00000021021	ENST00000380733.4:c.452G>A	9.37:g.15486008C>T	ENSP00000370109:p.Arg151Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRI9|O00256|O95368|Q6P391|Q86YB9|Q9NZI3|Q9UER6	Missense_Mutation	SNP	pfam_LEDGF,pfam_PWWP,smart_PWWP,pfscan_PWWP,prints_Treacle-like_TCS	p.R151K	ENST00000380733.4	37	c.452	CCDS6479.1	9	.	.	.	.	.	.	.	.	.	.	C	25.4	4.629912	0.87660	.	.	ENSG00000164985	ENST00000380733;ENST00000380738;ENST00000380715;ENST00000380716;ENST00000397519	T;T;T;T;T	0.44482	0.98;0.98;0.92;0.92;0.92	5.18	5.18	0.71444	.	0.094242	0.64402	D	0.000001	T	0.59128	0.2171	L	0.54323	1.7	0.46113	D	0.998875	D;P;P	0.56035	0.974;0.956;0.956	D;P;D	0.67725	0.953;0.899;0.931	T	0.50558	-0.8814	10	0.23891	T	0.37	.	19.0507	0.93043	0.0:1.0:0.0:0.0	.	151;151;151	O75475-2;Q05CM9;O75475	.;.;PSIP1_HUMAN	K	151	ENSP00000370109:R151K;ENSP00000370114:R151K;ENSP00000370091:R151K;ENSP00000370092:R151K;ENSP00000380653:R151K	ENSP00000370091:R151K	R	-	2	0	PSIP1	15476008	1.000000	0.71417	1.000000	0.80357	0.961000	0.63080	4.871000	0.63042	2.584000	0.87258	0.561000	0.74099	AGA	PSIP1	-	NULL		0.338	PSIP1-003	KNOWN	basic|appris_principal|CCDS	protein_coding	PSIP1	HGNC	protein_coding	OTTHUMT00000055445.1	C	NM_033222		15486008	-1	no_errors	ENST00000380733	ensembl	human	known	70_37	missense	SNP	1.000	T
RGAG1	57529	genome.wustl.edu	37	X	109697207	109697207	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:109697207C>T	ENST00000465301.2	+	3	3608	c.3362C>T	c.(3361-3363)tCg>tTg	p.S1121L	RGAG1_ENST00000540313.1_Missense_Mutation_p.S1121L	NM_020769.2	NP_065820.1	Q8NET4	RGAG1_HUMAN	retrotransposon gag domain containing 1	1121								p.S1121L(1)		NS(1)|autonomic_ganglia(1)|breast(2)|cervix(2)|endometrium(8)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(15)|liver(1)|lung(29)|ovary(1)|prostate(5)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(2)	73						AAGCCCACATCGCACATGACT	0.517																																																	1	Substitution - Missense(1)	large_intestine(1)											163.0	147.0	153.0					X																	109697207		2203	4300	6503	SO:0001583	missense	57529			AY121804	CCDS14552.1	Xq23	2008-02-05			ENSG00000243978	ENSG00000243978			29245	protein-coding gene	gene with protein product						10718198, 15716091, 16093683	Standard	NM_020769		Approved	KIAA1318, Mart9, Mar9	uc004eor.2	Q8NET4	OTTHUMG00000022196	ENST00000465301.2:c.3362C>T	X.37:g.109697207C>T	ENSP00000419786:p.Ser1121Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9P2M8	Missense_Mutation	SNP	NULL	p.S1121L	ENST00000465301.2	37	c.3362	CCDS14552.1	X	.	.	.	.	.	.	.	.	.	.	C	13.13	2.144449	0.37825	.	.	ENSG00000243978	ENST00000465301;ENST00000540313;ENST00000540483	T;T	0.47528	0.84;0.84	4.26	4.26	0.50523	.	0.611619	0.13674	N	0.370681	T	0.27663	0.0680	N	0.08118	0	0.09310	N	1	B	0.21147	0.052	B	0.15870	0.014	T	0.06391	-1.0829	9	.	.	.	-6.4529	13.5204	0.61563	0.0:1.0:0.0:0.0	.	1121	Q8NET4	RGAG1_HUMAN	L	1121;1121;682	ENSP00000419786:S1121L;ENSP00000441452:S1121L	.	S	+	2	0	RGAG1	109583863	0.004000	0.15560	0.009000	0.14445	0.032000	0.12392	1.908000	0.39907	2.356000	0.79943	0.600000	0.82982	TCG	RGAG1	-	NULL		0.517	RGAG1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGAG1	HGNC	protein_coding	OTTHUMT00000057906.2	C	NM_020769		109697207	+1	no_errors	ENST00000465301	ensembl	human	known	70_37	missense	SNP	0.036	T
RGS14	10636	genome.wustl.edu	37	5	176797663	176797663	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr5:176797663C>G	ENST00000408923.3	+	10	1313	c.1125C>G	c.(1123-1125)ttC>ttG	p.F375L		NM_006480.4	NP_006471.2	O43566	RGS14_HUMAN	regulator of G-protein signaling 14	375	Necessary for interaction with RABGEF1. {ECO:0000250}.|RBD 2. {ECO:0000255|PROSITE- ProRule:PRU00262}.				cell division (GO:0051301)|chromosome segregation (GO:0007059)|intracellular signal transduction (GO:0035556)|learning (GO:0007612)|long-term memory (GO:0007616)|long-term synaptic potentiation (GO:0060291)|mitotic nuclear division (GO:0007067)|negative regulation of ERK1 and ERK2 cascade (GO:0070373)|negative regulation of MAP kinase activity (GO:0043407)|negative regulation of synaptic plasticity (GO:0031914)|nucleocytoplasmic transport (GO:0006913)|platelet-derived growth factor receptor signaling pathway (GO:0048008)|positive regulation of GTPase activity (GO:0043547)|positive regulation of neurogenesis (GO:0050769)|regulation of DNA-templated transcription in response to stress (GO:0043620)|regulation of G-protein coupled receptor protein signaling pathway (GO:0008277)|response to oxidative stress (GO:0006979)|spindle organization (GO:0007051)|termination of G-protein coupled receptor signaling pathway (GO:0038032)|visual learning (GO:0008542)|zygote asymmetric cell division (GO:0010070)	cell junction (GO:0030054)|centrosome (GO:0005813)|cytoplasm (GO:0005737)|dendrite (GO:0030425)|dendritic spine (GO:0043197)|microtubule (GO:0005874)|nuclear body (GO:0016604)|nucleus (GO:0005634)|plasma membrane (GO:0005886)|postsynaptic density (GO:0014069)|postsynaptic membrane (GO:0045211)|spindle (GO:0005819)|spindle pole (GO:0000922)	GDP-dissociation inhibitor activity (GO:0005092)|GTPase activator activity (GO:0005096)|microtubule binding (GO:0008017)|receptor signaling complex scaffold activity (GO:0030159)|receptor signaling protein activity (GO:0005057)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(2)|lung(3)|skin(3)|upper_aerodigestive_tract(1)	12	all_cancers(89;2.04e-05)|Renal(175;0.000269)|Lung NSC(126;0.000832)|all_lung(126;0.00152)	all_neural(177;0.00409)|Medulloblastoma(196;0.00498)|all_hematologic(541;0.21)	Kidney(164;2.23e-05)|KIRC - Kidney renal clear cell carcinoma(164;0.000178)			GGATCACCTTCGAGTGAGTGT	0.632																																					NSCLC(47;353 1896 28036)												0													76.0	87.0	83.0					5																	176797663		2026	4170	6196	SO:0001583	missense	10636			AF037195	CCDS43405.1	5q35.3	2008-02-05	2007-08-14		ENSG00000169220	ENSG00000169220		"""Regulators of G-protein signaling"""	9996	protein-coding gene	gene with protein product		602513	"""regulator of G-protein signalling 14"""				Standard	NM_006480		Approved		uc003mgf.3	O43566	OTTHUMG00000163324	ENST00000408923.3:c.1125C>G	5.37:g.176797663C>G	ENSP00000386229:p.Phe375Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O43565|Q506M1|Q6ZWA4|Q8TD62	Missense_Mutation	SNP	pfam_Raf-like_ras-bd,pfam_Regulat_G_prot_signal,pfam_GoLoco_motif,superfamily_Regulat_G_prot_signal_superfam,smart_Regulat_G_prot_signal,smart_Raf-like_ras-bd,smart_GoLoco_motif,pfscan_GoLoco_motif,pfscan_Raf-like_ras-bd,pfscan_Regulat_G_prot_signal,prints_Regulat_G_prot_signal	p.F375L	ENST00000408923.3	37	c.1125	CCDS43405.1	5	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	C|C	15.06|15.06	2.720206|2.720206	0.48728|0.48728	.|.	.|.	ENSG00000169220|ENSG00000169220	ENST00000408923;ENST00000336477|ENST00000511890	T|.	0.59502|.	0.26|.	4.52|4.52	0.337|0.337	0.15966|0.15966	Raf-like Ras-binding (2);|.	0.118223|.	0.64402|.	N|.	0.000020|.	T|T	0.59810|0.59810	0.2221|0.2221	M|M	0.74647|0.74647	2.275|2.275	0.80722|0.80722	D|D	1|1	B;B;B|.	0.34147|.	0.097;0.075;0.438|.	B;B;B|.	0.38106|.	0.048;0.048;0.265|.	T|T	0.55528|0.55528	-0.8127|-0.8127	10|5	0.49607|.	T|.	0.09|.	-11.3976|-11.3976	3.6211|3.6211	0.08096|0.08096	0.0:0.2879:0.2076:0.5045|0.0:0.2879:0.2076:0.5045	.|.	146;223;375|.	B3KUX0;O43566-5;O43566|.	.;.;RGS14_HUMAN|.	L|W	375;156|246	ENSP00000386229:F375L|.	ENSP00000336864:F156L|.	F|S	+|+	3|2	2|0	RGS14|RGS14	176730269|176730269	0.994000|0.994000	0.37717|0.37717	0.997000|0.997000	0.53966|0.53966	0.748000|0.748000	0.42578|0.42578	0.257000|0.257000	0.18369|0.18369	0.158000|0.158000	0.19367|0.19367	-0.254000|-0.254000	0.11334|0.11334	TTC|TCG	RGS14	-	pfam_Raf-like_ras-bd,smart_Raf-like_ras-bd,pfscan_Raf-like_ras-bd		0.632	RGS14-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RGS14	HGNC	protein_coding	OTTHUMT00000372676.1	C	NM_006480		176797663	+1	no_errors	ENST00000408923	ensembl	human	known	70_37	missense	SNP	1.000	G
RIOK1	83732	genome.wustl.edu	37	6	7414492	7414492	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:7414492C>G	ENST00000379834.2	+	16	1972	c.1465C>G	c.(1465-1467)Caa>Gaa	p.Q489E		NM_031480.2|NM_153005.1	NP_113668.2|NP_694550.1	Q9BRS2	RIOK1_HUMAN	RIO kinase 1	489							ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)			cervix(1)|haematopoietic_and_lymphoid_tissue(1)|kidney(1)|large_intestine(2)|lung(6)|ovary(2)|pancreas(1)|prostate(1)|skin(2)|stomach(1)|upper_aerodigestive_tract(1)	19	Ovarian(93;0.0418)					CCTAGAAAATCAAGTGGAGGA	0.418																																																	0													80.0	85.0	83.0					6																	7414492		2203	4300	6503	SO:0001583	missense	83732			BC006104	CCDS4500.1	6p24.3	2012-12-10	2012-12-10		ENSG00000124784	ENSG00000124784			18656	protein-coding gene	gene with protein product			"""RIO kinase 1 (yeast)"""				Standard	NM_031480		Approved	AD034, FLJ30006, bA288G3.1, RRP10	uc003mxn.3	Q9BRS2	OTTHUMG00000014207	ENST00000379834.2:c.1465C>G	6.37:g.7414492C>G	ENSP00000369162:p.Gln489Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RB28|Q8NDC8|Q96NV9	Missense_Mutation	SNP	pfam_RIO-like_kinase,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_RIO_kinase,pirsf_Ser/Thr_kinase_Rio1	p.Q489E	ENST00000379834.2	37	c.1465	CCDS4500.1	6	.	.	.	.	.	.	.	.	.	.	C	0.391	-0.923477	0.02377	.	.	ENSG00000124784	ENST00000379834	T	0.04970	3.52	5.58	2.7	0.31948	.	0.843870	0.10924	N	0.619073	T	0.00875	0.0029	N	0.13299	0.325	0.09310	N	1	B	0.02656	0.0	B	0.01281	0.0	T	0.47086	-0.9144	10	0.02654	T	1	-6.615	9.2395	0.37486	0.144:0.6035:0.2525:0.0	.	489	Q9BRS2	RIOK1_HUMAN	E	489	ENSP00000369162:Q489E	ENSP00000369162:Q489E	Q	+	1	0	RIOK1	7359491	0.021000	0.18746	0.002000	0.10522	0.473000	0.32948	0.380000	0.20602	0.252000	0.21531	0.563000	0.77884	CAA	RIOK1	-	pirsf_Ser/Thr_kinase_Rio1		0.418	RIOK1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RIOK1	HGNC	protein_coding	OTTHUMT00000039780.2	C	NM_031480		7414492	+1	no_errors	ENST00000379834	ensembl	human	known	70_37	missense	SNP	0.006	G
RMI1	80010	genome.wustl.edu	37	9	86617752	86617752	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:86617752G>A	ENST00000325875.3	+	3	2183	c.1851G>A	c.(1849-1851)gaG>gaA	p.E617E		NM_024945.2	NP_079221.2	Q9H9A7	RMI1_HUMAN	RecQ mediated genome instability 1	617					DNA replication (GO:0006260)|glucose homeostasis (GO:0042593)|multicellular organism growth (GO:0035264)|reduction of food intake in response to dietary excess (GO:0002023)|response to glucose (GO:0009749)	nucleus (GO:0005634)		p.E617D(1)		biliary_tract(1)|central_nervous_system(1)|kidney(2)|large_intestine(7)|lung(3)|ovary(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	18						AACACCTTGAGAATCTAAAGA	0.269																																																	1	Substitution - Missense(1)	upper_aerodigestive_tract(1)											58.0	54.0	55.0					9																	86617752		2203	4300	6503	SO:0001819	synonymous_variant	80010			AK022950	CCDS6669.1	9q22.1	2013-06-10	2013-06-10	2006-06-12	ENSG00000178966	ENSG00000178966			25764	protein-coding gene	gene with protein product	"""BLM-Associated Polypeptide, 75 kDa"""	610404	"""chromosome 9 open reading frame 76"", ""RMI1, RecQ mediated genome instability 1, homolog (S. cerevisiae)"""	C9orf76		15775963, 20826341	Standard	NM_024945		Approved	FLJ12888, BLAP75	uc004anq.4	Q9H9A7	OTTHUMG00000020113	ENST00000325875.3:c.1851G>A	9.37:g.86617752G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q05BX1|Q05CW3|Q5SQG8|Q5SQG9|Q6P1Q4|Q6PI89|Q7Z6L6	Silent	SNP	pfam_DUF1767	p.E617	ENST00000325875.3	37	c.1851	CCDS6669.1	9																																																																																			RMI1	-	NULL		0.269	RMI1-002	KNOWN	basic|appris_principal|CCDS	protein_coding	RMI1	HGNC	protein_coding	OTTHUMT00000052870.1	G	NM_024945		86617752	+1	no_errors	ENST00000325875	ensembl	human	known	70_37	silent	SNP	0.816	A
RNF185	91445	genome.wustl.edu	37	22	31592952	31592952	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr22:31592952G>C	ENST00000326132.6	+	5	498	c.339G>C	c.(337-339)caG>caC	p.Q113H	RNF185_ENST00000426256.2_Missense_Mutation_p.Q51H|RNF185_ENST00000266252.7_Intron	NM_152267.3	NP_689480.2	Q96GF1	RN185_HUMAN	ring finger protein 185	113					autophagy (GO:0006914)|protein ubiquitination (GO:0016567)	endoplasmic reticulum (GO:0005783)|integral component of membrane (GO:0016021)|mitochondrial outer membrane (GO:0005741)	ligase activity (GO:0016874)|zinc ion binding (GO:0008270)			NS(1)|large_intestine(1)|lung(3)|skin(1)	6						CTCAAGGACAGAGGCCAGAGC	0.448																																																	0													49.0	54.0	52.0					22																	31592952		2203	4300	6503	SO:0001583	missense	91445				CCDS13890.1, CCDS46689.1	22q12.2	2013-01-09			ENSG00000138942	ENSG00000138942		"""RING-type (C3HC4) zinc fingers"""	26783	protein-coding gene	gene with protein product	"""hypothetical protein FLJ38628"""					12477932	Standard	NM_152267		Approved	FLJ38628	uc003akb.3	Q96GF1	OTTHUMG00000151253	ENST00000326132.6:c.339G>C	22.37:g.31592952G>C	ENSP00000320508:p.Gln113His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K5C1|A9X3T8|Q8N900	Missense_Mutation	SNP	pfam_Znf_C3HC4_RING-type,smart_Znf_RING,pfscan_Znf_RING	p.Q113H	ENST00000326132.6	37	c.339	CCDS13890.1	22	.	.	.	.	.	.	.	.	.	.	G	15.59	2.878607	0.51801	.	.	ENSG00000138942	ENST00000426256;ENST00000326132;ENST00000436825	D	0.95724	-3.79	5.73	2.16	0.27623	.	0.000000	0.85682	D	0.000000	D	0.96645	0.8905	M	0.75264	2.295	0.58432	D	0.999994	D;P	0.64830	0.994;0.943	D;D	0.75484	0.986;0.948	D	0.94935	0.8086	10	0.42905	T	0.14	.	9.3702	0.38250	0.2623:0.0:0.7377:0.0	.	51;113	B4DMD6;Q96GF1	.;RN185_HUMAN	H	51;113;113	ENSP00000320508:Q113H	ENSP00000320508:Q113H	Q	+	3	2	RNF185	29922952	1.000000	0.71417	1.000000	0.80357	0.987000	0.75469	2.025000	0.41059	0.595000	0.29777	0.555000	0.69702	CAG	RNF185	-	NULL		0.448	RNF185-001	KNOWN	basic|appris_principal|CCDS	protein_coding	RNF185	HGNC	protein_coding	OTTHUMT00000321927.2	G	NM_152267		31592952	+1	no_errors	ENST00000326132	ensembl	human	known	70_37	missense	SNP	1.000	C
SCAPER	49855	genome.wustl.edu	37	15	76866515	76866515	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr15:76866515C>G	ENST00000563290.1	-	23	2917	c.2822G>C	c.(2821-2823)aGa>aCa	p.R941T	SCAPER_ENST00000324767.7_Missense_Mutation_p.R941T|SCAPER_ENST00000538941.2_Missense_Mutation_p.R695T			Q9BY12	SCAPE_HUMAN	S-phase cyclin A-associated protein in the ER	941						endoplasmic reticulum (GO:0005783)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|kidney(4)|large_intestine(8)|lung(16)|ovary(2)|prostate(2)|skin(1)|urinary_tract(2)	39						TTCCAGTATTCTAGTGATCTC	0.393																																																	0													91.0	81.0	84.0					15																	76866515		1844	4091	5935	SO:0001583	missense	49855			AB040887, AF242528	CCDS53961.1, CCDS53962.1	15q24.3	2012-10-05	2009-03-11	2007-08-20	ENSG00000140386	ENSG00000140386		"""Zinc fingers, C2H2-type"""	13081	protein-coding gene	gene with protein product		611611	"""zinc finger protein 291"""	ZNF291		17698606	Standard	NM_020843		Approved	Zfp291	uc002bby.3	Q9BY12	OTTHUMG00000172655	ENST00000563290.1:c.2822G>C	15.37:g.76866515C>G	ENSP00000454973:p.Arg941Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	F5H7X8|H3BNR7|Q3B7X7|Q96BS9|Q9H3D8|Q9NT03|Q9P274	Missense_Mutation	SNP	smart_Znf_U1	p.R941T	ENST00000563290.1	37	c.2822	CCDS53962.1	15	.	.	.	.	.	.	.	.	.	.	C	20.1	3.934007	0.73442	.	.	ENSG00000140386	ENST00000324767;ENST00000538941;ENST00000303521	T;T	0.46819	0.98;0.86	5.72	5.72	0.89469	.	0.101219	0.64402	D	0.000002	T	0.72479	0.3465	M	0.82823	2.61	0.58432	D	0.999996	D;D	0.76494	0.999;0.999	D;D	0.74023	0.974;0.982	T	0.75941	-0.3140	10	0.87932	D	0	.	18.6448	0.91407	0.0:1.0:0.0:0.0	.	940;695	Q9BY12;F5H7X8	SCAPE_HUMAN;.	T	941;695;963	ENSP00000326924:R941T;ENSP00000442190:R695T	ENSP00000303560:R963T	R	-	2	0	SCAPER	74653570	1.000000	0.71417	0.999000	0.59377	0.647000	0.38526	6.886000	0.75611	2.698000	0.92095	0.455000	0.32223	AGA	SCAPER	-	NULL		0.393	SCAPER-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SCAPER	HGNC	protein_coding	OTTHUMT00000419698.1	C	NM_020843		76866515	-1	no_errors	ENST00000324767	ensembl	human	known	70_37	missense	SNP	1.000	G
SEL1L3	23231	genome.wustl.edu	37	4	25806242	25806242	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr4:25806242C>T	ENST00000399878.3	-	10	1819	c.1697G>A	c.(1696-1698)tGc>tAc	p.C566Y	SEL1L3_ENST00000502949.1_Missense_Mutation_p.C413Y|SEL1L3_ENST00000264868.5_Missense_Mutation_p.C531Y	NM_015187.3	NP_056002.2	Q68CR1	SE1L3_HUMAN	sel-1 suppressor of lin-12-like 3 (C. elegans)	566						integral component of membrane (GO:0016021)				breast(1)|endometrium(1)|kidney(2)|large_intestine(1)|lung(6)|prostate(1)|urinary_tract(2)	14						GTATCCACAGCAGCTGGAATC	0.443																																																	0													83.0	79.0	80.0					4																	25806242		1908	4138	6046	SO:0001583	missense	23231			BC009945	CCDS47037.1, CCDS75113.1	4p15.2	2009-09-24			ENSG00000091490	ENSG00000091490			29108	protein-coding gene	gene with protein product	"""KIAA0746 protein"""					9872452	Standard	XM_005248143		Approved	KIAA0746	uc003gru.4	Q68CR1	OTTHUMG00000160331	ENST00000399878.3:c.1697G>A	4.37:g.25806242C>T	ENSP00000382767:p.Cys566Tyr	Somatic		WXS	Illumina HiSeq	Phase_IV	A0PJH6|A8K0X2|O94847|Q6P999|Q96G59	Missense_Mutation	SNP	pfam_Sel1-like,superfamily_ConA-like_lec_gl_sf,smart_Sel1-like	p.C566Y	ENST00000399878.3	37	c.1697	CCDS47037.1	4	.	.	.	.	.	.	.	.	.	.	C	22.1	4.240839	0.79912	.	.	ENSG00000091490	ENST00000399878;ENST00000264868;ENST00000502949	T;T;T	0.17213	2.47;2.49;2.29	6.02	6.02	0.97574	Tetratricopeptide-like helical (1);	0.000000	0.85682	D	0.000000	T	0.44664	0.1304	M	0.66939	2.045	0.58432	D	0.999991	D	0.89917	1.0	D	0.91635	0.999	T	0.13953	-1.0490	10	0.66056	D	0.02	-31.2151	20.5407	0.99260	0.0:1.0:0.0:0.0	.	566	Q68CR1	SE1L3_HUMAN	Y	566;531;413	ENSP00000382767:C566Y;ENSP00000264868:C531Y;ENSP00000425438:C413Y	ENSP00000264868:C531Y	C	-	2	0	SEL1L3	25415340	1.000000	0.71417	1.000000	0.80357	0.997000	0.91878	5.677000	0.68142	2.865000	0.98341	0.655000	0.94253	TGC	SEL1L3	-	NULL		0.443	SEL1L3-003	KNOWN	basic|appris_principal|CCDS	protein_coding	SEL1L3	HGNC	protein_coding	OTTHUMT00000360261.1	C	NM_015187		25806242	-1	no_errors	ENST00000399878	ensembl	human	known	70_37	missense	SNP	1.000	T
SI	6476	genome.wustl.edu	37	3	164757752	164757752	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:164757752C>T	ENST00000264382.3	-	19	2229	c.2167G>A	c.(2167-2169)Gag>Aag	p.E723K		NM_001041.3	NP_001032.2	P14410	SUIS_HUMAN	sucrase-isomaltase (alpha-glucosidase)	723	Isomaltase.				carbohydrate metabolic process (GO:0005975)|polysaccharide digestion (GO:0044245)|small molecule metabolic process (GO:0044281)	brush border (GO:0005903)|extracellular vesicular exosome (GO:0070062)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	alpha-1,4-glucosidase activity (GO:0004558)|carbohydrate binding (GO:0030246)|oligo-1,6-glucosidase activity (GO:0004574)|sucrose alpha-glucosidase activity (GO:0004575)			NS(4)|breast(1)|central_nervous_system(2)|cervix(1)|endometrium(13)|haematopoietic_and_lymphoid_tissue(6)|kidney(10)|large_intestine(18)|lung(124)|ovary(9)|pancreas(1)|prostate(6)|skin(6)|upper_aerodigestive_tract(16)|urinary_tract(1)	218		Prostate(884;0.00314)|Melanoma(1037;0.0153)|all_neural(597;0.0199)			Acarbose(DB00284)|Scopolamine(DB00747)	TTCGTATCCTCATAAAACCTA	0.348										HNSCC(35;0.089)																																							0													107.0	111.0	110.0					3																	164757752		2203	4300	6503	SO:0001583	missense	6476			X63597	CCDS3196.1	3q25.2-q26.2	2004-04-06	2004-04-06		ENSG00000090402	ENSG00000090402	3.2.1.10		10856	protein-coding gene	gene with protein product	"""Oligosaccharide alpha-1,6-glucosidase"""	609845	"""sucrase-isomaltase"""			2962903, 1353958	Standard	NM_001041		Approved		uc003fei.3	P14410	OTTHUMG00000158065	ENST00000264382.3:c.2167G>A	3.37:g.164757752C>T	ENSP00000264382:p.Glu723Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RUC3|Q1JQ80|Q1RMC2	Missense_Mutation	SNP	pfam_Glyco_hydro_31,pfam_P_trefoil,superfamily_Glycoside_hydrolase_SF,superfamily_Glyco_hydro-type_carb-bd,smart_P_trefoil	p.E723K	ENST00000264382.3	37	c.2167	CCDS3196.1	3	.	.	.	.	.	.	.	.	.	.	C	3.709	-0.059843	0.07317	.	.	ENSG00000090402	ENST00000264382	D	0.83755	-1.76	4.99	-1.55	0.08558	.	0.693236	0.14617	N	0.308625	T	0.65154	0.2664	L	0.31752	0.955	0.09310	N	1	B	0.19200	0.034	B	0.19391	0.025	T	0.48502	-0.9030	10	0.09843	T	0.71	.	4.4575	0.11650	0.1355:0.3267:0.4016:0.1362	.	723	P14410	SUIS_HUMAN	K	723	ENSP00000264382:E723K	ENSP00000264382:E723K	E	-	1	0	SI	166240446	0.030000	0.19436	0.037000	0.18230	0.519000	0.34347	-0.390000	0.07332	-0.228000	0.09869	-0.953000	0.02652	GAG	SI	-	pfam_Glyco_hydro_31		0.348	SI-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SI	HGNC	protein_coding	OTTHUMT00000350116.1	C	NM_001041		164757752	-1	no_errors	ENST00000264382	ensembl	human	known	70_37	missense	SNP	0.000	T
SIPA1L2	57568	genome.wustl.edu	37	1	232538176	232538176	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:232538176C>G	ENST00000366630.1	-	21	5342	c.4984G>C	c.(4984-4986)Gaa>Caa	p.E1662Q	SIPA1L2_ENST00000262861.4_Missense_Mutation_p.E1662Q|SIPA1L2_ENST00000308942.4_Missense_Mutation_p.E718Q			Q9P2F8	SI1L2_HUMAN	signal-induced proliferation-associated 1 like 2	1662					regulation of small GTPase mediated signal transduction (GO:0051056)		GTPase activator activity (GO:0005096)			NS(1)|breast(5)|central_nervous_system(2)|endometrium(15)|haematopoietic_and_lymphoid_tissue(1)|kidney(7)|large_intestine(13)|lung(49)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(2)	103		all_cancers(173;0.00605)|Prostate(94;0.128)|all_epithelial(177;0.186)				AGAATTAATTCCAGCTGATTG	0.398																																																	0													147.0	138.0	141.0					1																	232538176		1854	4097	5951	SO:0001583	missense	57568			AB037810	CCDS41474.1	1q42.2	2008-02-05			ENSG00000116991	ENSG00000116991			23800	protein-coding gene	gene with protein product		611609					Standard	NM_020808		Approved	KIAA1389	uc001hvg.3	Q9P2F8	OTTHUMG00000037820	ENST00000366630.1:c.4984G>C	1.37:g.232538176C>G	ENSP00000355589:p.Glu1662Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q2TV88|Q5VXR7|Q5VXR8|Q641Q4|Q8NA38|Q96DZ3|Q9H9F6	Missense_Mutation	SNP	pfam_DUF3401,pfam_Rap_GAP,pfam_PDZ,superfamily_PDZ,smart_PDZ,pfscan_PDZ,pfscan_Rap_GAP	p.E1662Q	ENST00000366630.1	37	c.4984	CCDS41474.1	1	.	.	.	.	.	.	.	.	.	.	C	19.59	3.855876	0.71834	.	.	ENSG00000116991	ENST00000366630;ENST00000262861;ENST00000308942	T;T;T	0.42131	0.98;0.98;0.98	5.47	5.47	0.80525	.	0.102243	0.64402	D	0.000004	T	0.66489	0.2794	M	0.73598	2.24	0.52501	D	0.999953	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.997	T	0.63659	-0.6587	10	0.41790	T	0.15	-23.4889	19.5817	0.95469	0.0:1.0:0.0:0.0	.	1662;718	Q9P2F8;Q9P2F8-2	SI1L2_HUMAN;.	Q	1662;1662;718	ENSP00000355589:E1662Q;ENSP00000262861:E1662Q;ENSP00000309102:E718Q	ENSP00000262861:E1662Q	E	-	1	0	SIPA1L2	230604799	1.000000	0.71417	0.998000	0.56505	0.135000	0.20990	7.343000	0.79319	2.850000	0.98022	0.650000	0.86243	GAA	SIPA1L2	-	pfam_DUF3401		0.398	SIPA1L2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SIPA1L2	HGNC	protein_coding	OTTHUMT00000092318.1	C	XM_045839		232538176	-1	no_errors	ENST00000262861	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC10A3	8273	genome.wustl.edu	37	X	153717091	153717091	+	Silent	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chrX:153717091G>C	ENST00000393587.4	-	3	452	c.189C>G	c.(187-189)ggC>ggG	p.G63G	SLC10A3_ENST00000263512.4_Silent_p.G63G|SLC10A3_ENST00000393586.1_Silent_p.G118G|UBL4A_ENST00000369653.4_5'Flank|UBL4A_ENST00000369660.4_5'Flank|SLC10A3_ENST00000369649.4_Silent_p.G63G|UBL4A_ENST00000477777.1_5'Flank	NM_001142391.1|NM_001142392.1	NP_001135863.1|NP_001135864.1	P09131	P3_HUMAN	solute carrier family 10, member 3	63					response to retinoic acid (GO:0032526)	integral component of membrane (GO:0016021)	bile acid:sodium symporter activity (GO:0008508)			endometrium(1)|kidney(1)|large_intestine(2)|lung(7)|ovary(1)|prostate(1)|skin(1)|upper_aerodigestive_tract(1)	15	all_cancers(53;5.05e-16)|all_epithelial(53;1.87e-10)|all_lung(58;1.84e-07)|Lung NSC(58;5.84e-07)|all_hematologic(71;2.45e-06)|Acute lymphoblastic leukemia(192;6.56e-05)|Breast(217;0.176)					TCAAGTAGCGGCCCCCAGTCG	0.627																																																	0													131.0	104.0	113.0					X																	153717091		2203	4300	6503	SO:0001819	synonymous_variant	8273			X12458	CCDS14755.1, CCDS48195.1	Xq28	2013-07-18	2013-07-18		ENSG00000126903	ENSG00000126903		"""Solute carriers"""	22979	protein-coding gene	gene with protein product		312090				8733135	Standard	NM_019848		Approved	P3, DXS253E	uc004flq.3	P09131	OTTHUMG00000013369	ENST00000393587.4:c.189C>G	X.37:g.153717091G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	Q5HY79|Q9BSL2	Silent	SNP	pfam_BilAc/Na_symport,tigrfam_Bil_ac_transpt	p.G63	ENST00000393587.4	37	c.189	CCDS14755.1	X																																																																																			SLC10A3	-	NULL		0.627	SLC10A3-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A3	HGNC	protein_coding	OTTHUMT00000037235.3	G	NM_019848		153717091	-1	no_errors	ENST00000263512	ensembl	human	known	70_37	silent	SNP	0.122	C
SLC10A4	201780	genome.wustl.edu	37	4	48490485	48490485	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr4:48490485C>G	ENST00000273861.4	+	3	1062	c.843C>G	c.(841-843)ttC>ttG	p.F281L	ZAR1_ENST00000327939.4_5'Flank	NM_152679.3	NP_689892.1	Q96EP9	NTCP4_HUMAN	solute carrier family 10, member 4	281						integral component of membrane (GO:0016021)|plasma membrane (GO:0005886)	bile acid:sodium symporter activity (GO:0008508)			central_nervous_system(1)|large_intestine(1)|lung(1)|ovary(1)|prostate(1)|urinary_tract(1)	6						TGGTCCTTTTCATAATGACCG	0.443																																																	0													173.0	175.0	174.0					4																	48490485		2203	4300	6503	SO:0001583	missense	201780			BC012048	CCDS3482.1	4p12	2013-07-18	2013-07-18		ENSG00000145248	ENSG00000145248		"""Solute carriers"""	22980	protein-coding gene	gene with protein product							Standard	NM_152679		Approved	MGC29802	uc003gyc.2	Q96EP9	OTTHUMG00000102092	ENST00000273861.4:c.843C>G	4.37:g.48490485C>G	ENSP00000273861:p.Phe281Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	Q8WUZ2	Missense_Mutation	SNP	pfam_BilAc/Na_symport	p.F281L	ENST00000273861.4	37	c.843	CCDS3482.1	4	.	.	.	.	.	.	.	.	.	.	C	15.95	2.985330	0.53934	.	.	ENSG00000145248	ENST00000273861	T	0.13420	2.59	5.62	5.62	0.85841	.	0.000000	0.85682	D	0.000000	T	0.29223	0.0727	M	0.72894	2.215	0.80722	D	1	P	0.48503	0.911	P	0.49752	0.621	T	0.00435	-1.1741	10	0.40728	T	0.16	-16.0927	20.0359	0.97557	0.0:1.0:0.0:0.0	.	281	Q96EP9	NTCP4_HUMAN	L	281	ENSP00000273861:F281L	ENSP00000273861:F281L	F	+	3	2	SLC10A4	48185242	1.000000	0.71417	1.000000	0.80357	0.092000	0.18411	4.636000	0.61339	2.805000	0.96524	0.655000	0.94253	TTC	SLC10A4	-	pfam_BilAc/Na_symport		0.443	SLC10A4-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC10A4	HGNC	protein_coding	OTTHUMT00000219926.3	C	NM_152679		48490485	+1	no_errors	ENST00000273861	ensembl	human	known	70_37	missense	SNP	1.000	G
SLC24A2	25769	genome.wustl.edu	37	9	19786763	19786763	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:19786763C>T	ENST00000341998.2	-	1	163	c.102G>A	c.(100-102)ctG>ctA	p.L34L	SLC24A2_ENST00000286344.3_Silent_p.L34L	NM_001193288.2|NM_020344.3	NP_001180217.1|NP_065077.1	Q9UI40	NCKX2_HUMAN	solute carrier family 24 (sodium/potassium/calcium exchanger), member 2	34					cellular calcium ion homeostasis (GO:0006874)|ion transmembrane transport (GO:0034220)|ion transport (GO:0006811)|learning (GO:0007612)|long term synaptic depression (GO:0060292)|long-term synaptic potentiation (GO:0060291)|memory (GO:0007613)|sodium ion transmembrane transport (GO:0035725)|transmembrane transport (GO:0055085)|visual perception (GO:0007601)	integral component of membrane (GO:0016021)|intrinsic component of plasma membrane (GO:0031226)|plasma membrane (GO:0005886)	cadmium ion binding (GO:0046870)|calcium channel activity (GO:0005262)|calcium ion binding (GO:0005509)|calcium, potassium:sodium antiporter activity (GO:0008273)|manganese ion binding (GO:0030145)|nickel cation binding (GO:0016151)|potassium ion binding (GO:0030955)|sodium ion binding (GO:0031402)|symporter activity (GO:0015293)			endometrium(3)|kidney(1)|large_intestine(9)|lung(13)|ovary(3)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	33				GBM - Glioblastoma multiforme(1;1.67e-55)|Lung(42;0.0443)		GAATTAACTTCAGTTTTTTCT	0.433																																																	0													145.0	147.0	146.0					9																	19786763		2203	4300	6503	SO:0001819	synonymous_variant	25769			AF097366	CCDS6493.1, CCDS55297.1	9p22.1	2013-05-22			ENSG00000155886	ENSG00000155886		"""Solute carriers"""	10976	protein-coding gene	gene with protein product		609838				10662833	Standard	NM_020344		Approved	NCKX2	uc003zoa.2	Q9UI40	OTTHUMG00000019646	ENST00000341998.2:c.102G>A	9.37:g.19786763C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	B7ZLL8|Q9NTN5|Q9NZQ4	Silent	SNP	pfam_NaCa_Exmemb,tigrfam_K/Na/Ca-exchanger	p.L34	ENST00000341998.2	37	c.102	CCDS6493.1	9																																																																																			SLC24A2	-	NULL		0.433	SLC24A2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SLC24A2	HGNC	protein_coding	OTTHUMT00000051866.2	C	NM_020344		19786763	-1	no_errors	ENST00000341998	ensembl	human	known	70_37	silent	SNP	0.998	T
SLC37A4	2542	genome.wustl.edu	37	11	118900036	118900036	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:118900036G>A	ENST00000545985.1	-	3	800	c.44C>T	c.(43-45)tCa>tTa	p.S15L	SLC37A4_ENST00000330775.7_Missense_Mutation_p.S15L|SLC37A4_ENST00000525102.1_5'UTR|SLC37A4_ENST00000357590.5_Missense_Mutation_p.S15L|SLC37A4_ENST00000538950.1_Intron	NM_001164277.1|NM_001467.5	NP_001157749.1|NP_001458.1	O43826	G6PT1_HUMAN	solute carrier family 37 (glucose-6-phosphate transporter), member 4	15					carbohydrate metabolic process (GO:0005975)|glucose homeostasis (GO:0042593)|glucose metabolic process (GO:0006006)|glucose transport (GO:0015758)|glucose-6-phosphate transport (GO:0015760)|hexose transport (GO:0008645)|small molecule metabolic process (GO:0044281)|transmembrane transport (GO:0055085)|transport (GO:0006810)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum membrane (GO:0005789)|integral component of endoplasmic reticulum membrane (GO:0030176)|integral component of membrane (GO:0016021)|membrane (GO:0016020)	glucose-6-phosphate transmembrane transporter activity (GO:0015152)|transporter activity (GO:0005215)			endometrium(1)|kidney(2)|large_intestine(1)|lung(1)|prostate(1)	6	all_hematologic(175;0.0839)	Medulloblastoma(222;0.0425)|all_neural(223;0.112)|all_hematologic(192;0.207)		BRCA - Breast invasive adenocarcinoma(274;7.58e-05)		AAACATGGCTGAGAAGATCAC	0.512																																																	0													86.0	86.0	86.0					11																	118900036		2039	4185	6224	SO:0001583	missense	2542			Y15409		11q23.3	2014-09-17	2007-03-28	2003-09-10		ENSG00000137700		"""Solute carriers"""	4061	protein-coding gene	gene with protein product		602671	"""glucose-6-phosphatase, transport (glucose-6-phosphate) protein 1"""	G6PT1, G6PT2, G6PT3		9428641, 9463334	Standard	NM_001164277		Approved	GSD1b, GSD1c, GSD1d	uc010ryt.1	O43826		ENST00000545985.1:c.44C>T	11.37:g.118900036G>A	ENSP00000475241:p.Ser15Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O96016|Q5J7V4|Q9UI19|Q9UNS4	RNA	SNP	-	NULL	ENST00000545985.1	37	NULL		11																																																																																			SLC37A4	-	-		0.512	SLC37A4-204	KNOWN	basic|appris_principal	protein_coding	SLC37A4	HGNC	protein_coding		G	NM_001467		118900036	-1	no_errors	ENST00000330775	ensembl	human	known	70_37	rna	SNP	0.292	A
SLFN13	146857	genome.wustl.edu	37	17	33767735	33767735	+	Missense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:33767735G>A	ENST00000285013.6	-	6	2848	c.2573C>T	c.(2572-2574)tCa>tTa	p.S858L	SLFN13_ENST00000542635.1_Missense_Mutation_p.S858L|SLFN13_ENST00000534689.1_Missense_Mutation_p.S540L|SLFN13_ENST00000360502.2_Missense_Mutation_p.S540L|SLFN13_ENST00000526861.1_Missense_Mutation_p.S858L|SLFN13_ENST00000533791.1_Missense_Mutation_p.S858L	NM_144682.5	NP_653283.3	Q68D06	SLN13_HUMAN	schlafen family member 13	858						intracellular (GO:0005622)	ATP binding (GO:0005524)	p.S858L(1)		NS(1)|breast(1)|endometrium(1)|large_intestine(10)|lung(8)|ovary(3)|pancreas(1)|prostate(5)|stomach(1)	31				UCEC - Uterine corpus endometrioid carcinoma (308;0.0185)		TTCCAGGCCTGAGAATCGCCG	0.488																																																	1	Substitution - Missense(1)	lung(1)											233.0	204.0	214.0					17																	33767735		2203	4300	6503	SO:0001583	missense	146857			AL832726	CCDS32620.1	17q12	2006-04-05				ENSG00000154760			26481	protein-coding gene	gene with protein product		614957				9846487	Standard	NM_144682		Approved	FLJ31952	uc002hjl.2	Q68D06		ENST00000285013.6:c.2573C>T	17.37:g.33767735G>A	ENSP00000285013:p.Ser858Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P645|Q658M1|Q6ZS51|Q96A81	Missense_Mutation	SNP	pfam_ATPase_AAA-4,pfam_DUF2075	p.S858L	ENST00000285013.6	37	c.2573	CCDS32620.1	17	.	.	.	.	.	.	.	.	.	.	g	24.4	4.531660	0.85706	.	.	ENSG00000154760	ENST00000285013;ENST00000360502;ENST00000526861;ENST00000542635;ENST00000534689	D;D;D;D;D	0.82433	-1.61;-1.61;-1.61;-1.61;-1.61	3.27	2.28	0.28536	.	0.000000	0.38837	N	0.001555	D	0.89058	0.6607	M	0.84948	2.725	0.29484	N	0.856134	P;D	0.57899	0.836;0.981	P;D	0.67231	0.609;0.95	T	0.83015	-0.0170	10	0.87932	D	0	.	6.3126	0.21173	0.1453:0.0:0.8547:0.0	.	540;858	Q68D06-2;Q68D06	.;SLN13_HUMAN	L	858;540;858;858;540	ENSP00000285013:S858L;ENSP00000353692:S540L;ENSP00000434439:S858L;ENSP00000444016:S858L;ENSP00000435442:S540L	ENSP00000285013:S858L	S	-	2	0	SLFN13	30791848	1.000000	0.71417	0.892000	0.35008	0.932000	0.56968	4.118000	0.57884	0.686000	0.31488	0.407000	0.27541	TCA	SLFN13	-	NULL		0.488	SLFN13-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SLFN13	HGNC	protein_coding	OTTHUMT00000381883.1	G	NM_144682		33767735	-1	no_errors	ENST00000285013	ensembl	human	known	70_37	missense	SNP	0.926	A
SMC6	79677	genome.wustl.edu	37	2	17889941	17889941	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:17889941C>G	ENST00000448223.2	-	17	2079	c.1810G>C	c.(1810-1812)Gac>Cac	p.D604H	SMC6_ENST00000351948.4_Missense_Mutation_p.D604H|SMC6_ENST00000402989.1_Missense_Mutation_p.D604H|SMC6_ENST00000381272.4_Missense_Mutation_p.D630H	NM_001142286.1	NP_001135758.1	Q96SB8	SMC6_HUMAN	structural maintenance of chromosomes 6	604	Flexible hinge.				cellular senescence (GO:0090398)|double-strand break repair via homologous recombination (GO:0000724)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|intracellular (GO:0005622)|nucleolus (GO:0005730)|nucleus (GO:0005634)|PML body (GO:0016605)|Smc5-Smc6 complex (GO:0030915)	ATP binding (GO:0005524)			NS(1)|biliary_tract(1)|breast(6)|central_nervous_system(4)|cervix(1)|endometrium(4)|kidney(6)|large_intestine(3)|lung(13)|prostate(1)|skin(1)|upper_aerodigestive_tract(2)	43	Acute lymphoblastic leukemia(172;0.155)|all_hematologic(175;0.158)					CCTCTCATGTCAATTAGGCTA	0.348																																																	0													105.0	101.0	102.0					2																	17889941		2203	4300	6503	SO:0001583	missense	79677			AJ310551	CCDS1690.1	2p24.3	2008-02-05	2006-07-06	2006-07-06	ENSG00000163029	ENSG00000163029		"""Structural maintenance of chromosomes proteins"""	20466	protein-coding gene	gene with protein product		609387	"""SMC6 structural maintenance of chromosomes 6-like 1 (yeast)"""	SMC6L1		11230166	Standard	NM_024624		Approved	FLJ22116	uc002rcn.3	Q96SB8	OTTHUMG00000090675	ENST00000448223.2:c.1810G>C	2.37:g.17889941C>G	ENSP00000404092:p.Asp604His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K8Q6|D6W518|Q05BV4|Q9H0X3|Q9H6M0	Missense_Mutation	SNP	NULL	p.D630H	ENST00000448223.2	37	c.1888	CCDS1690.1	2	.	.	.	.	.	.	.	.	.	.	C	24.2	4.499474	0.85069	.	.	ENSG00000163029	ENST00000448223;ENST00000351948;ENST00000381272;ENST00000402989;ENST00000446852	T;T;T;T;T	0.42900	2.15;2.15;2.15;2.15;0.96	6.03	6.03	0.97812	RecF/RecN/SMC (1);	0.041423	0.85682	D	0.000000	T	0.64450	0.2599	M	0.72894	2.215	0.80722	D	1	D;D;D	0.89917	1.0;1.0;1.0	D;D;D	0.87578	0.993;0.995;0.998	T	0.64296	-0.6441	10	0.59425	D	0.04	.	15.6618	0.77193	0.0:0.9331:0.0:0.0669	.	630;630;604	C9JMN1;Q96SB8-2;Q96SB8	.;.;SMC6_HUMAN	H	604;604;630;604;630	ENSP00000404092:D604H;ENSP00000323439:D604H;ENSP00000370672:D630H;ENSP00000384539:D604H;ENSP00000408644:D630H	ENSP00000323439:D604H	D	-	1	0	SMC6	17753422	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	5.096000	0.64535	2.861000	0.98227	0.655000	0.94253	GAC	SMC6	-	NULL		0.348	SMC6-002	KNOWN	basic|appris_principal|CCDS	protein_coding	SMC6	HGNC	protein_coding	OTTHUMT00000207359.1	C	NM_024624		17889941	-1	no_errors	ENST00000381272	ensembl	human	known	70_37	missense	SNP	1.000	G
SPATA16	83893	genome.wustl.edu	37	3	172835168	172835168	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:172835168C>G	ENST00000351008.3	-	2	537	c.354G>C	c.(352-354)aaG>aaC	p.K118N		NM_031955.5	NP_114161.3	Q9BXB7	SPT16_HUMAN	spermatogenesis associated 16	118					cell differentiation (GO:0030154)|multicellular organismal development (GO:0007275)|spermatogenesis (GO:0007283)	Golgi apparatus (GO:0005794)				breast(2)|cervix(1)|large_intestine(8)|lung(20)|ovary(2)|prostate(1)|skin(5)|upper_aerodigestive_tract(3)|urinary_tract(1)	43	Ovarian(172;0.00319)|Breast(254;0.197)		LUSC - Lung squamous cell carcinoma(14;1.48e-14)|Lung(28;6.63e-14)			CCATTATGTTCTTTAAGGGGA	0.418																																																	0													344.0	317.0	326.0					3																	172835168		2203	4300	6503	SO:0001583	missense	83893			AF345909	CCDS3221.1	3q26.31	2009-01-05			ENSG00000144962	ENSG00000144962			29935	protein-coding gene	gene with protein product		609856				12529416, 17847006	Standard	NM_031955		Approved	NYD-SP12	uc003fin.4	Q9BXB7	OTTHUMG00000156865	ENST00000351008.3:c.354G>C	3.37:g.172835168C>G	ENSP00000341765:p.Lys118Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0R0N4|Q0R0S0|Q0R0W2|Q0R129|Q0R131|Q0R140|Q0R1B8|Q0R1G5|Q0R1I2|Q0R1J6|Q0R1S4|Q0R202|Q0R280|Q0R2F8|Q0R2N6|Q0R2N7|Q0R2R0|Q0R2R1|Q0R2S3|Q0R2S4|Q0R2S5|Q0R2T4|Q0R2T7|Q0R2U2|Q0R2U8|Q0R2U9|Q0R2V5|Q0R2V7|Q8NE67	Missense_Mutation	SNP	NULL	p.K118N	ENST00000351008.3	37	c.354	CCDS3221.1	3	.	.	.	.	.	.	.	.	.	.	C	14.13	2.443670	0.43429	.	.	ENSG00000144962	ENST00000351008	T	0.17054	2.3	5.67	4.77	0.60923	.	0.097221	0.45126	D	0.000391	T	0.09423	0.0232	N	0.17082	0.46	0.32148	N	0.584595	P	0.39759	0.687	B	0.34779	0.189	T	0.11275	-1.0594	10	0.39692	T	0.17	-17.4842	8.7339	0.34516	0.0:0.7658:0.1492:0.085	.	118	Q9BXB7	SPT16_HUMAN	N	118	ENSP00000341765:K118N	ENSP00000341765:K118N	K	-	3	2	SPATA16	174317862	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	1.183000	0.32041	1.324000	0.45282	0.555000	0.69702	AAG	SPATA16	-	NULL		0.418	SPATA16-001	KNOWN	basic|appris_principal|CCDS	protein_coding	SPATA16	HGNC	protein_coding	OTTHUMT00000346322.1	C	NM_031955		172835168	-1	no_errors	ENST00000351008	ensembl	human	known	70_37	missense	SNP	1.000	G
SRPK2	6733	genome.wustl.edu	37	7	104844135	104844135	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:104844135C>G	ENST00000393651.3	-	3	256	c.169G>C	c.(169-171)Gag>Cag	p.E57Q	SRPK2_ENST00000489828.1_Missense_Mutation_p.E46Q|SRPK2_ENST00000357311.3_Missense_Mutation_p.E46Q	NM_182692.1	NP_872634.1			SRSF protein kinase 2											NS(1)|breast(1)|central_nervous_system(3)|endometrium(1)|kidney(11)|large_intestine(6)|lung(4)|ovary(3)|skin(1)|stomach(1)|upper_aerodigestive_tract(3)	35						ATCTCCTCCTCTGGCTCCGGG	0.617																																																	0													93.0	79.0	84.0					7																	104844135		2203	4300	6503	SO:0001583	missense	6733			U88666	CCDS5735.1, CCDS34724.1	7q22-q31.1	2010-06-23	2010-06-23		ENSG00000135250	ENSG00000135250			11306	protein-coding gene	gene with protein product	"""SR protein kinase 2"", ""serine/arginine-rich splicing factor kinase 2"""	602980	"""SFRS protein kinase 2"""			8208298, 9472028	Standard	NM_182692		Approved	SFRSK2	uc003vcv.4	P78362	OTTHUMG00000157405	ENST00000393651.3:c.169G>C	7.37:g.104844135C>G	ENSP00000377262:p.Glu57Gln	Somatic		WXS	Illumina HiSeq	Phase_IV		Missense_Mutation	SNP	pfam_Prot_kinase_cat_dom,pfam_Ser-Thr/Tyr_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom	p.E57Q	ENST00000393651.3	37	c.169	CCDS34724.1	7	.	.	.	.	.	.	.	.	.	.	C	17.80	3.478683	0.63849	.	.	ENSG00000135250	ENST00000393651;ENST00000357311;ENST00000489828;ENST00000482897;ENST00000460391	T;T;T;T;T	0.32515	1.45;1.46;1.46;3.3;2.86	6.04	6.04	0.98038	.	0.000000	0.85682	D	0.000000	T	0.46190	0.1380	L	0.34521	1.04	0.58432	D	0.999997	D;D	0.71674	0.998;0.981	D;D	0.80764	0.994;0.954	T	0.10660	-1.0620	10	0.34782	T	0.22	-22.4378	18.3674	0.90396	0.0:1.0:0.0:0.0	.	57;46	P78362-2;P78362	.;SRPK2_HUMAN	Q	57;46;46;94;46	ENSP00000377262:E57Q;ENSP00000349863:E46Q;ENSP00000419791:E46Q;ENSP00000419240:E94Q;ENSP00000417357:E46Q	ENSP00000349863:E46Q	E	-	1	0	SRPK2	104631371	1.000000	0.71417	0.998000	0.56505	0.956000	0.61745	7.147000	0.77382	2.873000	0.98535	0.561000	0.74099	GAG	SRPK2	-	NULL		0.617	SRPK2-008	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SRPK2	HGNC	protein_coding	OTTHUMT00000348723.1	C	NM_182691		104844135	-1	no_errors	ENST00000393651	ensembl	human	known	70_37	missense	SNP	1.000	G
STAC2	342667	genome.wustl.edu	37	17	37368565	37368565	+	Missense_Mutation	SNP	C	C	G	rs571015047		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:37368565C>G	ENST00000333461.5	-	11	1585	c.1216G>C	c.(1216-1218)Gac>Cac	p.D406H		NM_198993.3	NP_945344.1	Q6ZMT1	STAC2_HUMAN	SH3 and cysteine rich domain 2	406					intracellular signal transduction (GO:0035556)		metal ion binding (GO:0046872)			NS(2)|endometrium(1)|kidney(2)|large_intestine(1)|lung(7)|pancreas(1)|prostate(1)|skin(2)	17						GTCAGGGCGTCGACTGGCACC	0.627																																																	0													62.0	57.0	59.0					17																	37368565		2203	4300	6503	SO:0001583	missense	342667			AJ608762	CCDS11335.1	17q21.2	2012-11-19			ENSG00000141750	ENSG00000141750			23990	protein-coding gene	gene with protein product							Standard	NM_198993		Approved	24b2	uc002hrs.3	Q6ZMT1	OTTHUMG00000179039	ENST00000333461.5:c.1216G>C	17.37:g.37368565C>G	ENSP00000327509:p.Asp406His	Somatic		WXS	Illumina HiSeq	Phase_IV	Q32MA3	Missense_Mutation	SNP	pfam_SH3_2,pfam_SH3_domain,pfam_Prot_Kinase_C-like_PE/DAG-bd,superfamily_SH3_domain,smart_Prot_Kinase_C-like_PE/DAG-bd,smart_SH3_domain,pfscan_SH3_domain,pfscan_Prot_Kinase_C-like_PE/DAG-bd,prints_SH3_domain,prints_p67phox	p.D406H	ENST00000333461.5	37	c.1216	CCDS11335.1	17	.	.	.	.	.	.	.	.	.	.	N	19.43	3.825893	0.71143	.	.	ENSG00000141750	ENST00000333461	D	0.81908	-1.55	4.56	2.5	0.30297	Src homology-3 domain (1);	0.323017	0.31020	N	0.008419	T	0.79992	0.4542	L	0.52905	1.665	0.45777	D	0.998662	P	0.43477	0.808	P	0.44897	0.463	T	0.77515	-0.2559	10	0.87932	D	0	-18.1804	8.4941	0.33117	0.152:0.7642:0.0:0.0838	.	406	Q6ZMT1	STAC2_HUMAN	H	406	ENSP00000327509:D406H	ENSP00000327509:D406H	D	-	1	0	STAC2	34622091	0.983000	0.35010	0.989000	0.46669	0.988000	0.76386	1.600000	0.36762	0.359000	0.24239	0.555000	0.69702	GAC	STAC2	-	superfamily_SH3_domain		0.627	STAC2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STAC2	HGNC	protein_coding	OTTHUMT00000444533.2	C	NM_198993		37368565	-1	no_errors	ENST00000333461	ensembl	human	known	70_37	missense	SNP	0.997	G
STK39	27347	genome.wustl.edu	37	2	168811454	168811454	+	3'UTR	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:168811454G>C	ENST00000355999.4	-	0	2895				STK39_ENST00000487143.1_5'UTR	NM_013233.2	NP_037365.2	Q9UEW8	STK39_HUMAN	serine threonine kinase 39						cellular hypotonic response (GO:0071476)|intracellular signal transduction (GO:0035556)|negative regulation of potassium ion transmembrane transport (GO:1901380)|negative regulation of potassium ion transmembrane transporter activity (GO:1901017)|negative regulation of rubidium ion transmembrane transporter activity (GO:2000687)|negative regulation of rubidium ion transport (GO:2000681)|peptidyl-serine phosphorylation (GO:0018105)|peptidyl-threonine phosphorylation (GO:0018107)|positive regulation of potassium ion transport (GO:0043268)|protein phosphorylation (GO:0006468)|regulation of inflammatory response (GO:0050727)|response to stress (GO:0006950)|signal transduction by phosphorylation (GO:0023014)	apical plasma membrane (GO:0016324)|basolateral plasma membrane (GO:0016323)|cytoplasm (GO:0005737)|cytoskeleton (GO:0005856)|nucleus (GO:0005634)	ATP binding (GO:0005524)|protein serine/threonine kinase activity (GO:0004674)|receptor signaling protein serine/threonine kinase activity (GO:0004702)			central_nervous_system(1)|endometrium(2)|large_intestine(3)|lung(3)|prostate(2)|skin(2)	13						ATAAATATATGAAAAATAAAA	0.239																																																	0																																										SO:0001624	3_prime_UTR_variant	27347			AF099989	CCDS42770.1	2q24.3	2010-06-25	2010-06-25		ENSG00000198648	ENSG00000198648			17717	protein-coding gene	gene with protein product	"""STE20/SPS1 homolog (yeast)"""	607648				10980603	Standard	NM_013233		Approved	DCHT, SPAK	uc002uea.3	Q9UEW8	OTTHUMG00000133745	ENST00000355999.4:c.*552C>G	2.37:g.168811454G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	O14774|Q53S90|Q53SL7|Q53SS1|Q9UER4|X5D9C8	RNA	SNP	-	NULL	ENST00000355999.4	37	NULL	CCDS42770.1	2																																																																																			STK39	-	-		0.239	STK39-001	KNOWN	basic|appris_principal|CCDS	protein_coding	STK39	HGNC	protein_coding	OTTHUMT00000258112.2	G	NM_013233		168811454	-1	no_errors	ENST00000487143	ensembl	human	known	70_37	rna	SNP	1.000	C
SVEP1	79987	genome.wustl.edu	37	9	113245917	113245917	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:113245917C>G	ENST00000401783.2	-	10	2323	c.1987G>C	c.(1987-1989)Gag>Cag	p.E663Q	SVEP1_ENST00000374469.1_Missense_Mutation_p.E640Q|SVEP1_ENST00000374461.1_Missense_Mutation_p.E640Q|SVEP1_ENST00000302728.8_Missense_Mutation_p.E663Q|SVEP1_ENST00000467821.1_5'UTR	NM_153366.3	NP_699197.3	Q4LDE5	SVEP1_HUMAN	sushi, von Willebrand factor type A, EGF and pentraxin domain containing 1	663	HYR 2. {ECO:0000255|PROSITE- ProRule:PRU00113}.				cell adhesion (GO:0007155)	cytoplasm (GO:0005737)|extracellular region (GO:0005576)|membrane (GO:0016020)	calcium ion binding (GO:0005509)|chromatin binding (GO:0003682)			NS(1)|autonomic_ganglia(1)|breast(5)|central_nervous_system(1)|cervix(2)|endometrium(19)|kidney(8)|large_intestine(24)|lung(58)|ovary(7)|prostate(7)|skin(1)|stomach(4)|upper_aerodigestive_tract(5)|urinary_tract(4)	147						TGTACCTTCTCCGAGACCTGG	0.473																																																	0													65.0	64.0	64.0					9																	113245917		1989	4173	6162	SO:0001583	missense	79987			AK027870		9q31-q32	2008-02-05	2005-03-15	2005-03-17	ENSG00000165124	ENSG00000165124			15985	protein-coding gene	gene with protein product		611691	"""chromosome 9 open reading frame 13"""	C9orf13			Standard	NM_153366		Approved	bA427L11.3, POLYDOM, FLJ13529	uc010mtz.3	Q4LDE5	OTTHUMG00000020482	ENST00000401783.2:c.1987G>C	9.37:g.113245917C>G	ENSP00000384917:p.Glu663Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q0P675|Q5D213|Q5T938|Q5VTE4|Q5VTE5|Q7Z387|Q7Z3G3|Q8NBT9|Q96JU7|Q9H284|Q9H8J9	Missense_Mutation	SNP	pfam_Sushi_SCR_CCP,pfam_EG-like_dom,pfam_Tyr-kin_ephrin_A/B_rcpt-like,pfam_Hyalin,pfam_VWF_A,pfam_Pentaxin,pfam_EGF_extracell,pfam_EGF-like_Ca-bd,superfamily_ConA-like_lec_gl_sf,superfamily_Complement_control_module,superfamily_Growth_fac_rcpt,smart_VWF_A,smart_Sushi_SCR_CCP,smart_EGF-like_Ca-bd,smart_EG-like_dom,smart_Pentaxin,pfscan_EG-like_dom,pfscan_Hyalin,pfscan_Sushi_SCR_CCP,pfscan_VWF_A,prints_Pentaxin	p.E663Q	ENST00000401783.2	37	c.1987	CCDS48004.1	9	.	.	.	.	.	.	.	.	.	.	C	15.83	2.949693	0.53186	.	.	ENSG00000165124	ENST00000401783;ENST00000374469;ENST00000302728;ENST00000374461	T;T;T;T	0.21932	1.98;1.98;1.98;1.98	5.42	4.5	0.54988	Hyalin (2);	0.313089	0.36200	N	0.002739	T	0.28101	0.0693	M	0.73962	2.25	0.32745	N	0.507142	P;P;P	0.43231	0.801;0.801;0.763	B;B;B	0.40636	0.265;0.335;0.173	T	0.45411	-0.9263	10	0.41790	T	0.15	.	15.0655	0.71992	0.0:0.9283:0.0:0.0717	.	663;663;663	E9PBN8;Q4LDE5;Q4LDE5-2	.;SVEP1_HUMAN;.	Q	663;640;663;640	ENSP00000384917:E663Q;ENSP00000363593:E640Q;ENSP00000304118:E663Q;ENSP00000363585:E640Q	ENSP00000304118:E663Q	E	-	1	0	SVEP1	112285738	0.983000	0.35010	0.943000	0.38184	0.161000	0.22273	2.679000	0.46909	2.718000	0.92993	0.591000	0.81541	GAG	SVEP1	-	pfam_Hyalin,pfscan_Hyalin		0.473	SVEP1-202	KNOWN	basic|appris_principal|CCDS	protein_coding	SVEP1	HGNC	protein_coding		C			113245917	-1	no_errors	ENST00000401783	ensembl	human	known	70_37	missense	SNP	0.993	G
TAF3	83860	genome.wustl.edu	37	10	8006430	8006430	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:8006430G>A	ENST00000344293.5	+	3	1163	c.957G>A	c.(955-957)aaG>aaA	p.K319K		NM_031923.3	NP_114129.1	Q5VWG9	TAF3_HUMAN	TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140kDa	319					maintenance of protein location in nucleus (GO:0051457)|negative regulation of sequence-specific DNA binding transcription factor activity (GO:0043433)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)|transcription factor TFIID complex (GO:0005669)	zinc ion binding (GO:0008270)			NS(2)|breast(4)|endometrium(2)|kidney(1)|large_intestine(6)|lung(16)|ovary(3)|prostate(4)|skin(2)	40						agagccccaagagtcccaaga	0.493																																																	0													39.0	40.0	40.0					10																	8006430		1864	4093	5957	SO:0001819	synonymous_variant	83860			AJ292190	CCDS41487.1	10p15.1	2013-01-28	2002-08-29		ENSG00000165632	ENSG00000165632		"""Zinc fingers, PHD-type"""	17303	protein-coding gene	gene with protein product		606576	"""TAF3 RNA polymerase II, TATA box binding protein (TBP)-associated factor, 140 kD"""			11438666, 18549481	Standard	NM_031923		Approved	TAF140, TAFII140	uc010qbd.3	Q5VWG9	OTTHUMG00000017643	ENST00000344293.5:c.957G>A	10.37:g.8006430G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q05DA0|Q6GMS5|Q6P6B5|Q86VY6|Q9BQS9|Q9UFI8	Silent	SNP	pfam_BTP,pfam_Znf_PHD-finger,superfamily_Znf_FYVE_PHD,superfamily_Histone-fold,smart_BTP,smart_Znf_PHD,pfscan_Znf_PHD-finger	p.K319	ENST00000344293.5	37	c.957	CCDS41487.1	10																																																																																			TAF3	-	NULL		0.493	TAF3-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF3	HGNC	protein_coding	OTTHUMT00000046725.1	G	NM_031923		8006430	+1	no_errors	ENST00000344293	ensembl	human	known	70_37	silent	SNP	0.893	A
SVIL	6840	genome.wustl.edu	37	10	29843751	29843751	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:29843751G>C	ENST00000355867.4	-	5	873	c.121C>G	c.(121-123)Cga>Gga	p.R41G	SVIL_ENST00000375400.3_Missense_Mutation_p.R41G|SVIL_ENST00000375398.2_Missense_Mutation_p.R41G	NM_021738.2	NP_068506.2	O95425	SVIL_HUMAN	supervillin	41	Interaction with MYLK. {ECO:0000250}.				cytoskeleton organization (GO:0007010)|skeletal muscle tissue development (GO:0007519)	actin cytoskeleton (GO:0015629)|cell projection (GO:0042995)|costamere (GO:0043034)|cytoplasm (GO:0005737)|focal adhesion (GO:0005925)|nucleus (GO:0005634)|plasma membrane (GO:0005886)	actin filament binding (GO:0051015)			breast(1)|central_nervous_system(3)|cervix(1)|endometrium(17)|haematopoietic_and_lymphoid_tissue(1)|kidney(5)|large_intestine(24)|lung(35)|ovary(8)|prostate(2)|skin(4)|stomach(7)|upper_aerodigestive_tract(2)|urinary_tract(2)	112		Breast(68;0.103)				CTCATGTATCGAGGGGTGTCT	0.612																																																	0													43.0	41.0	42.0					10																	29843751		2203	4300	6503	SO:0001583	missense	6840			AF051851	CCDS7163.1, CCDS7164.1	10p11.2	2008-07-29			ENSG00000197321	ENSG00000197321			11480	protein-coding gene	gene with protein product	"""archvillin"""	604126				9382871	Standard	NM_003174		Approved		uc001iut.1	O95425	OTTHUMG00000017882	ENST00000355867.4:c.121C>G	10.37:g.29843751G>C	ENSP00000348128:p.Arg41Gly	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DRW9|M1J557|O60611|O60612|Q5VZK5|Q5VZK6|Q9H1R7	Missense_Mutation	SNP	pfam_Gelsolin_dom,pfam_Villin_headpiece,superfamily_Villin_headpiece,smart_Gelsolin,smart_Villin_headpiece,prints_Gelsolin,pfscan_Villin_headpiece	p.R41G	ENST00000355867.4	37	c.121	CCDS7164.1	10	.	.	.	.	.	.	.	.	.	.	G	22.1	4.243199	0.79912	.	.	ENSG00000197321	ENST00000375400;ENST00000375398;ENST00000355867	T;T;T	0.49720	0.77;0.77;0.77	5.82	-3.35	0.04928	.	0.000000	0.85682	D	0.000000	T	0.66237	0.2769	M	0.71581	2.175	0.80722	D	1	D;D	0.89917	1.0;1.0	D;D	0.87578	0.998;0.998	T	0.70597	-0.4828	9	.	.	.	-17.2309	22.5832	0.99973	0.0:0.0:0.8098:0.1902	.	41;41	O95425-2;O95425	.;SVIL_HUMAN	G	41	ENSP00000364549:R41G;ENSP00000364547:R41G;ENSP00000348128:R41G	.	R	-	1	2	SVIL	29883757	0.198000	0.23374	0.960000	0.40013	0.986000	0.74619	-0.022000	0.12480	-0.441000	0.07201	0.655000	0.94253	CGA	SVIL	-	NULL		0.612	SVIL-003	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	SVIL	HGNC	protein_coding	OTTHUMT00000047395.1	G			29843751	-1	no_errors	ENST00000355867	ensembl	human	known	70_37	missense	SNP	0.954	C
TAF6L	10629	genome.wustl.edu	37	11	62554674	62554674	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:62554674C>G	ENST00000294168.3	+	11	1976	c.1775C>G	c.(1774-1776)tCg>tGg	p.S592W	TMEM223_ENST00000527073.1_Intron|TMEM179B_ENST00000533861.1_5'Flank|TMEM179B_ENST00000333449.4_5'Flank|RP11-727F15.12_ENST00000601484.1_RNA	NM_006473.3	NP_006464.1	Q9Y6J9	TAF6L_HUMAN	TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65kDa	592					chromatin organization (GO:0006325)|chromatin remodeling (GO:0006338)|DNA-templated transcription, initiation (GO:0006352)|histone H3 acetylation (GO:0043966)|regulation of sequence-specific DNA binding transcription factor activity (GO:0051090)|regulation of transcription from RNA polymerase II promoter (GO:0006357)	histone deacetylase complex (GO:0000118)|STAGA complex (GO:0030914)	DNA binding (GO:0003677)|transcription coactivator activity (GO:0003713)			endometrium(2)|large_intestine(5)|lung(4)|ovary(3)|prostate(1)|skin(1)	16						AGCCCGGCCTCGCGCTACGTG	0.687											OREG0021030	type=REGULATORY REGION|TFbs=CTCF|Dataset=CTCF ChIP-chip sites (Ren lab)|EvidenceSubtype=ChIP-on-chip (ChIP-chip)																																					0													10.0	12.0	11.0					11																	62554674		2123	4210	6333	SO:0001583	missense	10629			BC008785	CCDS8035.1	11q12.3	2008-02-01	2002-08-29		ENSG00000162227	ENSG00000162227			17305	protein-coding gene	gene with protein product		602946	"""TAF6-like RNA polymerase II, p300/CBP-associated factor (PCAF)-associated factor, 65 kD"""			9674425	Standard	NM_006473		Approved	PAF65A	uc001nvc.3	Q9Y6J9	OTTHUMG00000167610	ENST00000294168.3:c.1775C>G	11.37:g.62554674C>G	ENSP00000294168:p.Ser592Trp	Somatic	1062	WXS	Illumina HiSeq	Phase_IV	B2RAT0|Q96HA6	Missense_Mutation	SNP	pfam_TAF_TATA-bd,pfam_DUF1546,superfamily_Histone-fold,smart_TAF_TATA-bd	p.S592W	ENST00000294168.3	37	c.1775	CCDS8035.1	11	.	.	.	.	.	.	.	.	.	.	C	21.8	4.202595	0.79127	.	.	ENSG00000162227	ENST00000294168	T	0.51325	0.71	4.85	3.93	0.45458	.	0.142241	0.49305	D	0.000144	T	0.48277	0.1491	N	0.19112	0.55	0.80722	D	1	D	0.76494	0.999	P	0.61800	0.894	T	0.52697	-0.8541	10	0.87932	D	0	-9.7489	11.0794	0.48051	0.0:0.9089:0.0:0.0911	.	592	Q9Y6J9	TAF6L_HUMAN	W	592	ENSP00000294168:S592W	ENSP00000294168:S592W	S	+	2	0	TAF6L	62311250	1.000000	0.71417	1.000000	0.80357	0.915000	0.54546	6.161000	0.71868	1.252000	0.44001	0.484000	0.47621	TCG	TAF6L	-	NULL		0.687	TAF6L-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TAF6L	HGNC	protein_coding	OTTHUMT00000395352.1	C	NM_006473		62554674	+1	no_errors	ENST00000294168	ensembl	human	known	70_37	missense	SNP	1.000	G
TATDN3	128387	genome.wustl.edu	37	1	212985578	212985578	+	Intron	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:212985578C>G	ENST00000366974.4	+	9	694				TATDN3_ENST00000531963.1_Missense_Mutation_p.L204V|TATDN3_ENST00000366973.4_Intron|TATDN3_ENST00000525569.1_Intron|TATDN3_ENST00000526997.1_Intron|TATDN3_ENST00000532324.1_Missense_Mutation_p.L204V|TATDN3_ENST00000526641.1_Intron	NM_001042552.2|NM_001042553.2|NM_001146169.1|NM_001146171.1	NP_001036017.1|NP_001036018.1|NP_001139641.1|NP_001139643.1	Q17R31	TATD3_HUMAN	TatD DNase domain containing 3						DNA catabolic process (GO:0006308)	intracellular organelle (GO:0043229)|mitochondrion (GO:0005739)|nucleus (GO:0005634)	deoxyribonuclease activity (GO:0004536)|endodeoxyribonuclease activity, producing 5'-phosphomonoesters (GO:0016888)|metal ion binding (GO:0046872)			endometrium(1)|large_intestine(2)|lung(6)	9				OV - Ovarian serous cystadenocarcinoma(81;0.00699)|all cancers(67;0.0118)|GBM - Glioblastoma multiforme(131;0.0801)|Epithelial(68;0.104)		GCTGCTTTCTCTTTTCTCTAA	0.303																																																	0													41.0	42.0	42.0					1																	212985578		2200	4299	6499	SO:0001627	intron_variant	128387			AL832248	CCDS31019.1, CCDS41465.1, CCDS53475.1, CCDS53476.1, CCDS53477.1	1q32.3	2008-02-05			ENSG00000203705	ENSG00000203705			27010	protein-coding gene	gene with protein product							Standard	NM_001042552		Approved		uc001hjo.2	Q17R31	OTTHUMG00000036805	ENST00000366974.4:c.601-12C>G	1.37:g.212985578C>G		Somatic		WXS	Illumina HiSeq	Phase_IV	A6NGS3|B7Z1C1|B7Z978|B7ZLQ6|E9PJE5|E9PNH3|G3V151|Q4G0L1	Missense_Mutation	SNP	pfam_TatD_family,pirsf_TatD_family	p.L204V	ENST00000366974.4	37	c.610	CCDS31019.1	1	.	.	.	.	.	.	.	.	.	.	C	0.218	-1.031073	0.02029	.	.	ENSG00000203705	ENST00000532324;ENST00000531963	.	.	.	5.24	-1.12	0.09808	.	.	.	.	.	T	0.22551	0.0544	N	0.08118	0	0.49798	D	0.999828	B;B	0.06786	0.001;0.001	B;B	0.09377	0.003;0.004	T	0.09422	-1.0675	8	0.16420	T	0.52	.	2.4903	0.04608	0.1694:0.1548:0.1164:0.5594	.	204;204	G3V151;E9PJE5	.;.	V	204	.	ENSP00000433755:L204V	L	+	1	0	TATDN3	211052201	0.705000	0.27846	0.031000	0.17742	0.019000	0.09904	-0.028000	0.12350	-0.418000	0.07450	-0.914000	0.02751	CTT	TATDN3	-	pfam_TatD_family,pirsf_TatD_family		0.303	TATDN3-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TATDN3	HGNC	protein_coding	OTTHUMT00000089396.2	C	XM_375838		212985578	+1	no_errors	ENST00000531963	ensembl	human	putative	70_37	missense	SNP	0.275	G
TBX18	9096	genome.wustl.edu	37	6	85473690	85473690	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr6:85473690G>A	ENST00000369663.5	-	1	547	c.210C>T	c.(208-210)gaC>gaT	p.D70D	TBX18_ENST00000606521.1_5'Flank|TBX18_ENST00000606784.1_5'Flank	NM_001080508.1	NP_001073977.1	O95935	TBX18_HUMAN	T-box 18	70					anterior/posterior axis specification (GO:0009948)|cochlea morphogenesis (GO:0090103)|morphogenesis of embryonic epithelium (GO:0016331)|negative regulation of canonical Wnt signaling pathway involved in neural plate anterior/posterior pattern formation (GO:0060829)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|positive regulation of cell-cell adhesion (GO:0022409)|positive regulation of epithelial cell proliferation (GO:0050679)|positive regulation of mesenchymal cell proliferation involved in ureter development (GO:2000729)|sensory perception of sound (GO:0007605)|sinoatrial node development (GO:0003163)|smooth muscle cell differentiation (GO:0051145)|somitogenesis (GO:0001756)|ureter development (GO:0072189)	nucleus (GO:0005634)	protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)|RNA polymerase II transcription corepressor activity (GO:0001106)|sequence-specific DNA binding transcription factor activity (GO:0003700)|transcription regulatory region sequence-specific DNA binding (GO:0000976)			NS(1)|breast(2)|endometrium(2)|kidney(1)|large_intestine(9)|liver(1)|lung(31)|ovary(2)|pancreas(3)|prostate(6)|skin(3)	61		all_cancers(76;0.000283)|Acute lymphoblastic leukemia(125;3.66e-08)|all_hematologic(105;8.61e-05)|all_epithelial(107;0.0858)		BRCA - Breast invasive adenocarcinoma(108;0.0267)		CAGCGCCTTCGTCTCCCTCAG	0.756																																																	0													4.0	5.0	5.0					6																	85473690		1979	3992	5971	SO:0001819	synonymous_variant	9096			AJ010278	CCDS34495.1	6q14.1-q15	2012-12-19			ENSG00000112837	ENSG00000112837		"""T-boxes"""	11595	protein-coding gene	gene with protein product		604613				9888994, 16688725, 23242162	Standard	NM_001080508		Approved		uc003pkl.2	O95935	OTTHUMG00000015129	ENST00000369663.5:c.210C>T	6.37:g.85473690G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU13|Q7Z6U4|Q9UJI6	Silent	SNP	pfam_TF_T-box,superfamily_p53-like_TF_DNA-bd,smart_TF_T-box,pfscan_TF_T-box,prints_TF_T-box	p.D70	ENST00000369663.5	37	c.210	CCDS34495.1	6																																																																																			TBX18	-	NULL		0.756	TBX18-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TBX18	HGNC	protein_coding	OTTHUMT00000041378.2	G	NM_001080508		85473690	-1	no_errors	ENST00000369663	ensembl	human	known	70_37	silent	SNP	0.217	A
TDRD10	126668	genome.wustl.edu	37	1	154516982	154516982	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:154516982C>T	ENST00000368480.3	+	10	871	c.786C>T	c.(784-786)caC>caT	p.H262H	TDRD10_ENST00000368482.4_Silent_p.H262H|TDRD10_ENST00000479937.1_3'UTR			Q5VZ19	TDR10_HUMAN	tudor domain containing 10	262	Tudor.						nucleotide binding (GO:0000166)|RNA binding (GO:0003723)			breast(1)|cervix(1)|endometrium(2)|kidney(1)|large_intestine(5)|lung(14)|ovary(1)|prostate(1)|skin(1)|stomach(1)|upper_aerodigestive_tract(1)	29	all_lung(78;1.72e-29)|Lung NSC(65;2.96e-27)|Hepatocellular(266;0.0877)|all_hematologic(923;0.088)		LUSC - Lung squamous cell carcinoma(543;0.185)			ATTATGGACACGCCTGGAACA	0.607																																																	0													28.0	31.0	30.0					1																	154516982		2203	4300	6503	SO:0001819	synonymous_variant	126668			AL713777	CCDS30878.2, CCDS41406.1	1q21.3	2013-02-12			ENSG00000163239	ENSG00000163239		"""Tudor domain containing"", ""RNA binding motif (RRM) containing"""	25316	protein-coding gene	gene with protein product						12975309	Standard	NM_182499		Approved	DKFZp434M202	uc009wow.3	Q5VZ19	OTTHUMG00000037264	ENST00000368480.3:c.786C>T	1.37:g.154516982C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	A4FU09|B0QZ53|B4DXV4|Q3ZCP1|Q3ZCS7|Q5SXY7|Q6UXV2|Q8TCN3	Silent	SNP	pfam_Tudor,pfam_RRM_dom,smart_RRM_dom,pfscan_RRM_dom	p.H262	ENST00000368480.3	37	c.786	CCDS41406.1	1																																																																																			TDRD10	-	pfam_Tudor		0.607	TDRD10-002	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	TDRD10	HGNC	protein_coding	OTTHUMT00000090700.2	C	NM_182499		154516982	+1	no_errors	ENST00000368480	ensembl	human	known	70_37	silent	SNP	0.018	T
TEP1	7011	genome.wustl.edu	37	14	20864069	20864069	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:20864069G>C	ENST00000262715.5	-	11	1739	c.1699C>G	c.(1699-1701)Ctt>Gtt	p.L567V	TEP1_ENST00000556935.1_Missense_Mutation_p.L459V	NM_007110.4	NP_009041.2	Q99973	TEP1_HUMAN	telomerase-associated protein 1	567	TROVE. {ECO:0000255|PROSITE- ProRule:PRU00343}.				RNA-dependent DNA replication (GO:0006278)|telomere maintenance via recombination (GO:0000722)	chromosome, telomeric region (GO:0000781)|cytoplasm (GO:0005737)|nuclear matrix (GO:0016363)|ribonucleoprotein complex (GO:0030529)|telomerase holoenzyme complex (GO:0005697)	ATP binding (GO:0005524)|RNA binding (GO:0003723)			NS(4)|breast(1)|central_nervous_system(4)|endometrium(10)|haematopoietic_and_lymphoid_tissue(2)|kidney(2)|large_intestine(9)|lung(48)|ovary(7)|pancreas(1)|prostate(2)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(1)	96	all_cancers(95;0.00123)	all_lung(585;0.235)	Epithelial(56;7.42e-08)|all cancers(55;6.46e-07)	GBM - Glioblastoma multiforme(265;0.028)|READ - Rectum adenocarcinoma(17;0.233)		TGGGCGTTAAGAAATCTGAAT	0.517																																																	0													130.0	126.0	127.0					14																	20864069		2203	4300	6503	SO:0001583	missense	7011				CCDS9548.1	14q11.2	2013-01-10			ENSG00000129566	ENSG00000129566		"""WD repeat domain containing"""	11726	protein-coding gene	gene with protein product	"""TROVE domain family, member 1"""	601686				9403057	Standard	NM_007110		Approved	TP1, TLP1, VAULT2, p240, TROVE1	uc001vxe.3	Q99973	OTTHUMG00000029515	ENST00000262715.5:c.1699C>G	14.37:g.20864069G>C	ENSP00000262715:p.Leu567Val	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AUV9	Missense_Mutation	SNP	pfam_TROVE,pfam_TEP1_N,pfam_WD40_repeat,superfamily_WD40_repeat_dom,smart_WD40_repeat,pfscan_NACHT_NTPase,pfscan_TROVE,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.L567V	ENST00000262715.5	37	c.1699	CCDS9548.1	14	.	.	.	.	.	.	.	.	.	.	G	22.7	4.324486	0.81580	.	.	ENSG00000129566	ENST00000262715;ENST00000359243;ENST00000556935	T;T	0.36157	1.27;1.27	5.43	5.43	0.79202	TROVE (2);	0.000000	0.85682	D	0.000000	T	0.63177	0.2489	M	0.79926	2.475	0.80722	D	1	D;D	0.89917	0.999;1.0	D;D	0.87578	0.994;0.998	T	0.67098	-0.5756	10	0.66056	D	0.02	-4.243	16.1484	0.81586	0.0:0.0:1.0:0.0	.	459;567	G3V5X7;Q99973	.;TEP1_HUMAN	V	567;567;459	ENSP00000262715:L567V;ENSP00000452574:L459V	ENSP00000262715:L567V	L	-	1	0	TEP1	19933909	1.000000	0.71417	1.000000	0.80357	0.884000	0.51177	6.548000	0.73896	2.541000	0.85698	0.655000	0.94253	CTT	TEP1	-	pfam_TROVE,pfscan_TROVE		0.517	TEP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TEP1	HGNC	protein_coding	OTTHUMT00000073563.2	G	NM_007110		20864069	-1	no_errors	ENST00000262715	ensembl	human	known	70_37	missense	SNP	1.000	C
TESK2	10420	genome.wustl.edu	37	1	45810904	45810904	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:45810904C>T	ENST00000372086.3	-	11	1724	c.1324G>A	c.(1324-1326)Gac>Aac	p.D442N	TESK2_ENST00000372084.1_Missense_Mutation_p.D413N|TESK2_ENST00000486676.1_5'UTR|TESK2_ENST00000538496.1_Missense_Mutation_p.D359N|TESK2_ENST00000341771.6_Missense_Mutation_p.D413N	NM_007170.2	NP_009101.2	Q96S53	TESK2_HUMAN	testis-specific kinase 2	442					actin cytoskeleton organization (GO:0030036)|focal adhesion assembly (GO:0048041)|protein phosphorylation (GO:0006468)|spermatogenesis (GO:0007283)	cytoplasm (GO:0005737)|nucleus (GO:0005634)	ATP binding (GO:0005524)|metal ion binding (GO:0046872)|protein kinase activity (GO:0004672)|protein serine/threonine kinase activity (GO:0004674)|protein serine/threonine/tyrosine kinase activity (GO:0004712)|protein tyrosine kinase activity (GO:0004713)			breast(3)|endometrium(6)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(5)|liver(1)|lung(9)|ovary(2)|pancreas(2)|prostate(1)|stomach(1)|upper_aerodigestive_tract(1)	32	Acute lymphoblastic leukemia(166;0.155)					TCCTGCCAGTCAGCCAGGGGC	0.587																																																	0													41.0	45.0	44.0					1																	45810904		1906	4108	6014	SO:0001583	missense	10420			AJ132545	CCDS41323.1	1p32	2010-04-27			ENSG00000070759	ENSG00000070759	2.7.12.1		11732	protein-coding gene	gene with protein product		604746				10512679	Standard	NM_007170		Approved		uc001cns.1	Q96S53	OTTHUMG00000007680	ENST00000372086.3:c.1324G>A	1.37:g.45810904C>T	ENSP00000361158:p.Asp442Asn	Somatic		WXS	Illumina HiSeq	Phase_IV	Q5T422|Q5T423|Q8N520|Q9Y3Q6	Missense_Mutation	SNP	pfam_Ser-Thr/Tyr_kinase_cat_dom,pfam_Prot_kinase_cat_dom,superfamily_Kinase-like_dom,smart_Ser/Thr_dual-sp_kinase_dom,smart_Tyr_kinase_cat_dom,pfscan_Prot_kinase_cat_dom,prints_Ser-Thr/Tyr_kinase_cat_dom	p.D442N	ENST00000372086.3	37	c.1324	CCDS41323.1	1	.	.	.	.	.	.	.	.	.	.	C	10.49	1.365461	0.24684	.	.	ENSG00000070759	ENST00000372084;ENST00000372086;ENST00000372083;ENST00000341771;ENST00000538496	T;T;T;T	0.74737	-0.75;-0.6;-0.75;-0.87	5.89	5.89	0.94794	.	0.416659	0.25186	N	0.032499	T	0.59649	0.2209	N	0.11560	0.145	0.80722	D	1	B;B	0.06786	0.001;0.001	B;B	0.06405	0.002;0.002	T	0.53049	-0.8493	10	0.31617	T	0.26	-9.8488	18.4274	0.90613	0.0:1.0:0.0:0.0	.	413;442	Q96S53-3;Q96S53	.;TESK2_HUMAN	N	413;442;426;413;359	ENSP00000361156:D413N;ENSP00000361158:D442N;ENSP00000343940:D413N;ENSP00000441746:D359N	ENSP00000343940:D413N	D	-	1	0	TESK2	45583491	0.998000	0.40836	0.996000	0.52242	0.548000	0.35241	3.150000	0.50662	2.781000	0.95711	0.555000	0.69702	GAC	TESK2	-	NULL		0.587	TESK2-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TESK2	HGNC	protein_coding	OTTHUMT00000020523.1	C	NM_007170		45810904	-1	no_errors	ENST00000372086	ensembl	human	known	70_37	missense	SNP	0.985	T
THRA	7067	genome.wustl.edu	37	17	38249337	38249337	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:38249337C>T	ENST00000264637.4	+	10	1755	c.1175C>T	c.(1174-1176)tCa>tTa	p.S392L	THRA_ENST00000394121.4_Missense_Mutation_p.S392L|NR1D1_ENST00000246672.3_Silent_p.*615*|THRA_ENST00000584985.1_Intron	NM_003250.5	NP_003241.2	P10827	THA_HUMAN	thyroid hormone receptor, alpha	392					cartilage condensation (GO:0001502)|cytoplasmic sequestering of transcription factor (GO:0042994)|erythrocyte differentiation (GO:0030218)|female courtship behavior (GO:0008050)|gene expression (GO:0010467)|hormone-mediated signaling pathway (GO:0009755)|learning or memory (GO:0007611)|negative regulation of DNA-templated transcription, initiation (GO:2000143)|negative regulation of RNA polymerase II transcriptional preinitiation complex assembly (GO:0017055)|negative regulation of transcription, DNA-templated (GO:0045892)|ossification (GO:0001503)|positive regulation of female receptivity (GO:0045925)|positive regulation of myotube differentiation (GO:0010831)|positive regulation of transcription from RNA polymerase II promoter (GO:0045944)|regulation of heart contraction (GO:0008016)|regulation of lipid catabolic process (GO:0050994)|regulation of myeloid cell apoptotic process (GO:0033032)|regulation of thyroid hormone mediated signaling pathway (GO:0002155)|regulation of transcription from RNA polymerase II promoter (GO:0006357)|response to cold (GO:0009409)|thyroid gland development (GO:0030878)|transcription from RNA polymerase II promoter (GO:0006366)|transcription initiation from RNA polymerase II promoter (GO:0006367)|Type I pneumocyte differentiation (GO:0060509)	cytosol (GO:0005829)|nucleoplasm (GO:0005654)|nucleus (GO:0005634)	chromatin DNA binding (GO:0031490)|protein domain specific binding (GO:0019904)|sequence-specific DNA binding (GO:0043565)|sequence-specific DNA binding transcription factor activity (GO:0003700)|steroid hormone receptor activity (GO:0003707)|steroid receptor RNA activator RNA binding (GO:0002153)|TBP-class protein binding (GO:0017025)|thyroid hormone binding (GO:0070324)|thyroid hormone receptor activity (GO:0004887)|transcription factor binding (GO:0008134)|transcription regulatory region DNA binding (GO:0044212)|zinc ion binding (GO:0008270)			endometrium(1)|kidney(3)|large_intestine(2)|lung(4)|prostate(1)	11	Colorectal(19;0.000442)	Myeloproliferative disorder(1115;0.0255)			Dextrothyroxine(DB00509)|Levothyroxine(DB00451)|Liothyronine(DB00279)|Liotrix(DB01583)	CCGGGCGGGTCACTGGGCGTC	0.582																																																	0													46.0	50.0	48.0					17																	38249337		2203	4300	6503	SO:0001583	missense	7067			J03239	CCDS11360.1, CCDS42316.1, CCDS58546.1	17q21.1	2013-01-16	2011-05-19		ENSG00000126351	ENSG00000126351		"""Nuclear hormone receptors"""	11796	protein-coding gene	gene with protein product		190120	"""thyroid hormone receptor, alpha (avian erythroblastic leukemia viral (v-erb-a) oncogene homolog)"", ""thyroid hormone receptor, alpha (erythroblastic leukemia viral (v-erb-a) oncogene homolog, avian)"""	THRA1, THRA2, ERBA1		6323162, 6589608	Standard	NM_003250		Approved	EAR-7.1/EAR-7.2, THRA3, AR7, ERBA, NR1A1	uc002htw.3	P10827	OTTHUMG00000133332	ENST00000264637.4:c.1175C>T	17.37:g.38249337C>T	ENSP00000264637:p.Ser392Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	A8K3B5|P21205|Q8N6A1|Q96H73	Missense_Mutation	SNP	pfam_Znf_hrmn_rcpt,pfam_Nucl_hrmn_rcpt_lig-bd_core,superfamily_Nucl_hormone_rcpt_ligand-bd,smart_Znf_hrmn_rcpt,smart_Nucl_hrmn_rcpt_lig-bd_core,pfscan_Znf_hrmn_rcpt,prints_ThyrH_rcpt,prints_Str_hrmn_rcpt,prints_Znf_hrmn_rcpt	p.S392L	ENST00000264637.4	37	c.1175	CCDS11360.1	17	.	.	.	.	.	.	.	.	.	.	C	12.80	2.046832	0.36085	.	.	ENSG00000126351	ENST00000394121;ENST00000264637	D;D	0.93247	-3.19;-3.19	5.05	5.05	0.67936	.	0.353444	0.25786	N	0.028302	D	0.87489	0.6190	.	.	.	0.80722	D	1	P	0.34662	0.462	B	0.22386	0.039	D	0.85930	0.1451	8	.	.	.	.	15.9565	0.79891	0.0:1.0:0.0:0.0	.	392	P10827	THA_HUMAN	L	392	ENSP00000377679:S392L;ENSP00000264637:S392L	.	S	+	2	0	THRA	35502863	0.999000	0.42202	1.000000	0.80357	0.998000	0.95712	0.429000	0.21412	2.618000	0.88619	0.563000	0.77884	TCA	THRA	-	NULL		0.582	THRA-001	KNOWN	basic|CCDS	protein_coding	THRA	HGNC	protein_coding	OTTHUMT00000257160.2	C			38249337	+1	no_errors	ENST00000264637	ensembl	human	known	70_37	missense	SNP	1.000	T
TOR1B	27348	genome.wustl.edu	37	9	132569559	132569559	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:132569559C>T	ENST00000259339.2	+	3	618	c.558C>T	c.(556-558)atC>atT	p.I186I		NM_014506.1	NP_055321.1	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B)	186					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum organization (GO:0007029)|nuclear membrane organization (GO:0071763)|protein homooligomerization (GO:0051260)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)	12		Ovarian(14;0.0586)				ACCCCGGGATCATTGACGCAA	0.498																																																	0													195.0	183.0	187.0					9																	132569559		2203	4300	6503	SO:0001819	synonymous_variant	27348			AF007872	CCDS6929.1	9q34	2008-07-21			ENSG00000136816	ENSG00000136816			11995	protein-coding gene	gene with protein product		608050				9288096, 10644435	Standard	NM_014506		Approved	DQ1, MGC4386	uc004byk.1	O14657	OTTHUMG00000020795	ENST00000259339.2:c.558C>T	9.37:g.132569559C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Torsin,pfam_ATPase_AAA_core,pirsf_Torsin_subgr	p.I186	ENST00000259339.2	37	c.558	CCDS6929.1	9																																																																																			TOR1B	-	pfam_ATPase_AAA_core,pirsf_Torsin_subgr		0.498	TOR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR1B	HGNC	protein_coding	OTTHUMT00000054615.1	C	NM_014506		132569559	+1	no_errors	ENST00000259339	ensembl	human	known	70_37	silent	SNP	1.000	T
TOR1B	27348	genome.wustl.edu	37	9	132569634	132569634	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:132569634C>T	ENST00000259339.2	+	3	693	c.633C>T	c.(631-633)atC>atT	p.I211I		NM_014506.1	NP_055321.1	O14657	TOR1B_HUMAN	torsin family 1, member B (torsin B)	211					ATP catabolic process (GO:0006200)|chaperone mediated protein folding requiring cofactor (GO:0051085)|endoplasmic reticulum organization (GO:0007029)|nuclear membrane organization (GO:0071763)|protein homooligomerization (GO:0051260)|response to unfolded protein (GO:0006986)	endoplasmic reticulum (GO:0005783)|endoplasmic reticulum lumen (GO:0005788)|extracellular vesicular exosome (GO:0070062)|membrane (GO:0016020)|nuclear envelope (GO:0005635)	ATP binding (GO:0005524)|ATPase activity (GO:0016887)			endometrium(3)|kidney(1)|large_intestine(1)|lung(7)	12		Ovarian(14;0.0586)				CCATCTTCATCTTTCTCAGGT	0.483																																																	0													184.0	178.0	180.0					9																	132569634		2203	4300	6503	SO:0001819	synonymous_variant	27348			AF007872	CCDS6929.1	9q34	2008-07-21			ENSG00000136816	ENSG00000136816			11995	protein-coding gene	gene with protein product		608050				9288096, 10644435	Standard	NM_014506		Approved	DQ1, MGC4386	uc004byk.1	O14657	OTTHUMG00000020795	ENST00000259339.2:c.633C>T	9.37:g.132569634C>T		Somatic		WXS	Illumina HiSeq	Phase_IV		Silent	SNP	pfam_Torsin,pfam_ATPase_AAA_core,pirsf_Torsin_subgr	p.I211	ENST00000259339.2	37	c.633	CCDS6929.1	9																																																																																			TOR1B	-	pfam_ATPase_AAA_core,pirsf_Torsin_subgr		0.483	TOR1B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TOR1B	HGNC	protein_coding	OTTHUMT00000054615.1	C	NM_014506		132569634	+1	no_errors	ENST00000259339	ensembl	human	known	70_37	silent	SNP	1.000	T
TRIM49	57093	genome.wustl.edu	37	11	89532887	89532887	+	Nonsense_Mutation	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr11:89532887G>A	ENST00000329758.1	-	7	1184	c.856C>T	c.(856-858)Cga>Tga	p.R286*	TRIM49_ENST00000532501.2_Nonsense_Mutation_p.R209*	NM_020358.2	NP_065091.1	P0CI25	TRI49_HUMAN	tripartite motif containing 49	286	B30.2/SPRY. {ECO:0000255|PROSITE- ProRule:PRU00548}.					intracellular (GO:0005622)	zinc ion binding (GO:0008270)			breast(2)|central_nervous_system(1)|endometrium(2)|haematopoietic_and_lymphoid_tissue(1)|large_intestine(2)|liver(1)|lung(14)|prostate(1)|skin(2)|stomach(1)	27		Acute lymphoblastic leukemia(157;2.31e-05)|all_hematologic(158;0.00556)				GACTTACCTCGGAATTGGTTG	0.458																																																	0																																										SO:0001587	stop_gained	57093			AB037682	CCDS8287.1	11p11.12-q12	2012-05-21	2011-01-25	2004-11-17	ENSG00000168930	ENSG00000168930		"""Tripartite motif containing / Tripartite motif containing"", ""RING-type (C3HC4) zinc fingers"""	13431	protein-coding gene	gene with protein product		606124	"""ring finger protein 18"", ""tripartite motif-containing 49"""	RNF18		11018261	Standard	NM_020358		Approved	TRIM49A	uc001pdb.3	P0CI25		ENST00000329758.1:c.856C>T	11.37:g.89532887G>A	ENSP00000327604:p.Arg286*	Somatic		WXS	Illumina HiSeq	Phase_IV	A0AVR7|A0AVR9|Q6DJV1|Q9NS80	Nonsense_Mutation	SNP	pfam_SPRY_rcpt,pfam_Znf_B-box,superfamily_ConA-like_lec_gl_sf,superfamily_Lambda_DNA-bd_dom,smart_Znf_RING,smart_Znf_B-box,smart_SPla/RYanodine_receptor_subgr,pfscan_B30.2/SPRY,pfscan_Znf_B-box,pfscan_Znf_RING,prints_Butyrophylin	p.R286*	ENST00000329758.1	37	c.856	CCDS8287.1	11	.	.	.	.	.	.	.	.	.	.	G	13.44	2.238341	0.39598	.	.	ENSG00000168930	ENST00000329758;ENST00000532501	.	.	.	0.763	0.763	0.18459	.	.	.	.	.	.	.	.	.	.	.	0.58432	D	0.999994	.	.	.	.	.	.	.	.	.	.	.	.	.	.	4.9784	0.14153	0.0:0.0:1.0:0.0	.	.	.	.	X	286;209	.	.	R	-	1	2	TRIM49	89172535	0.000000	0.05858	0.001000	0.08648	0.025000	0.11179	-0.169000	0.09911	0.747000	0.32809	0.134000	0.15878	CGA	TRIM49	-	superfamily_ConA-like_lec_gl_sf,pfscan_B30.2/SPRY,prints_Butyrophylin		0.458	TRIM49-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIM49	HGNC	protein_coding	OTTHUMT00000395435.1	G	NM_020358		89532887	-1	no_errors	ENST00000329758	ensembl	human	known	70_37	nonsense	SNP	0.001	A
TRIP11	9321	genome.wustl.edu	37	14	92472576	92472576	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:92472576C>T	ENST00000267622.4	-	11	2117	c.1744G>A	c.(1744-1746)Gag>Aag	p.E582K		NM_004239.3	NP_004230.2	Q15643	TRIPB_HUMAN	thyroid hormone receptor interactor 11	582					protein targeting to Golgi (GO:0000042)|regulation of RNA biosynthetic process (GO:2001141)|transcription from RNA polymerase II promoter (GO:0006366)|ventricular septum development (GO:0003281)	acrosomal membrane (GO:0002080)|cis-Golgi network (GO:0005801)|cytoskeleton (GO:0005856)|Golgi apparatus (GO:0005794)|nucleus (GO:0005634)	transcription coactivator activity (GO:0003713)			breast(3)|central_nervous_system(2)|endometrium(1)|kidney(8)|large_intestine(12)|lung(17)|ovary(7)|pancreas(1)|prostate(1)|skin(3)|upper_aerodigestive_tract(2)|urinary_tract(1)	58				COAD - Colon adenocarcinoma(157;0.223)		ACTTTGTCCTCAAGTTTCTGC	0.313			T	PDGFRB	AML																																Ovarian(84;609 1888 9852 42686)			Dom	yes		14	14q31-q32	9321	thyroid hormone receptor interactor 11		L	0													107.0	106.0	106.0					14																	92472576		2203	4297	6500	SO:0001583	missense	9321			L40380	CCDS9899.1	14q31-q32	2008-05-02				ENSG00000100815			12305	protein-coding gene	gene with protein product		604505				7776974, 9373237	Standard	NM_004239		Approved	CEV14, Trip230, GMAP-210	uc001xzy.3	Q15643		ENST00000267622.4:c.1744G>A	14.37:g.92472576C>T	ENSP00000267622:p.Glu582Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RUT2|O14689|O15154|O95949	Missense_Mutation	SNP	superfamily_Ribosomal_L29,pfscan_GRIP	p.E582K	ENST00000267622.4	37	c.1744	CCDS9899.1	14	.	.	.	.	.	.	.	.	.	.	C	15.23	2.770959	0.49680	.	.	ENSG00000100815	ENST00000267622;ENST00000542257	T	0.04194	3.68	5.9	3.93	0.45458	.	0.425152	0.27577	N	0.018760	T	0.10637	0.0260	M	0.70275	2.135	0.32033	N	0.599271	P;P	0.51351	0.944;0.905	P;P	0.50825	0.651;0.544	T	0.07693	-1.0759	10	0.15952	T	0.53	.	11.5978	0.50984	0.1148:0.5516:0.3336:0.0	.	318;582	F5H1Z0;Q15643	.;TRIPB_HUMAN	K	582;318	ENSP00000267622:E582K	ENSP00000267622:E582K	E	-	1	0	TRIP11	91542329	1.000000	0.71417	0.346000	0.25655	0.290000	0.27261	1.854000	0.39368	1.455000	0.47813	0.650000	0.86243	GAG	TRIP11	-	NULL		0.313	TRIP11-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRIP11	HGNC	protein_coding	OTTHUMT00000411823.1	C			92472576	-1	no_errors	ENST00000267622	ensembl	human	known	70_37	missense	SNP	0.910	T
TRPC4AP	26133	genome.wustl.edu	37	20	33591061	33591061	+	Nonsense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr20:33591061C>T	ENST00000252015.2	-	19	2371	c.2282G>A	c.(2281-2283)tGg>tAg	p.W761*	TRPC4AP_ENST00000539834.1_Nonsense_Mutation_p.W363*|TRPC4AP_ENST00000451813.2_Nonsense_Mutation_p.W753*|TRPC4AP_ENST00000432634.2_Nonsense_Mutation_p.W722*			Q8TEL6	TP4AP_HUMAN	transient receptor potential cation channel, subfamily C, member 4 associated protein	761					calcium ion transmembrane transport (GO:0070588)|ion transmembrane transport (GO:0034220)|protein ubiquitination (GO:0016567)|transmembrane transport (GO:0055085)|ubiquitin-dependent protein catabolic process (GO:0006511)	Cul4A-RING E3 ubiquitin ligase complex (GO:0031464)|plasma membrane (GO:0005886)	phosphatase binding (GO:0019902)			breast(3)|central_nervous_system(2)|endometrium(3)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(5)|lung(13)|skin(1)|stomach(1)|urinary_tract(1)	32			BRCA - Breast invasive adenocarcinoma(18;0.00936)			TGTCTCCTTCCAGTATGAGAA	0.602																																																	0													68.0	62.0	64.0					20																	33591061		2203	4300	6503	SO:0001587	stop_gained	26133			AF055022	CCDS13246.1, CCDS46591.1	20q11.23	2014-06-13	2003-10-06	2003-10-08	ENSG00000100991	ENSG00000100991			16181	protein-coding gene	gene with protein product	"""protein phosphatase 1, regulatory subunit 158"""	608430	"""chromosome 20 open reading frame 188"""	C20orf188			Standard	NM_015638		Approved	DKFZP727M231, DKFZp586C1223, dJ756N5.2, TRRP4AP, PPP1R158	uc002xbk.3	Q8TEL6	OTTHUMG00000032319	ENST00000252015.2:c.2282G>A	20.37:g.33591061C>T	ENSP00000252015:p.Trp761*	Somatic		WXS	Illumina HiSeq	Phase_IV	E1P5Q0|E1P5Q1|Q96H82|Q9BVB8|Q9H429|Q9UFS6	Nonsense_Mutation	SNP	pfam_DUF3689	p.W761*	ENST00000252015.2	37	c.2282	CCDS13246.1	20	.	.	.	.	.	.	.	.	.	.	C	37	6.389770	0.97529	.	.	ENSG00000100991	ENST00000252015;ENST00000451813;ENST00000539834;ENST00000432634;ENST00000541994	.	.	.	4.79	4.79	0.61399	.	0.117908	0.64402	D	0.000007	.	.	.	.	.	.	0.80722	D	1	.	.	.	.	.	.	.	.	.	.	0.02654	T	1	.	18.0236	0.89262	0.0:1.0:0.0:0.0	.	.	.	.	X	761;753;363;722;746	.	ENSP00000252015:W761X	W	-	2	0	TRPC4AP	33054722	1.000000	0.71417	1.000000	0.80357	0.996000	0.88848	7.616000	0.83018	2.468000	0.83385	0.563000	0.77884	TGG	TRPC4AP	-	NULL		0.602	TRPC4AP-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TRPC4AP	HGNC	protein_coding	OTTHUMT00000078832.2	C	NM_015638		33591061	-1	no_errors	ENST00000252015	ensembl	human	known	70_37	nonsense	SNP	1.000	T
TSGA13	114960	genome.wustl.edu	37	7	130356546	130356546	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr7:130356546G>C	ENST00000456951.1	-	8	1464	c.613C>G	c.(613-615)Cag>Gag	p.Q205E	COPG2_ENST00000445977.2_5'Flank|TSGA13_ENST00000356588.3_Missense_Mutation_p.Q205E			Q96PP4	TSG13_HUMAN	testis specific, 13	205										endometrium(1)|kidney(3)|large_intestine(3)|lung(6)|ovary(2)|skin(2)|upper_aerodigestive_tract(1)	18	Melanoma(18;0.0435)					AAGGTGAGCTGAGGGTACATT	0.428																																																	0													225.0	213.0	217.0					7																	130356546		2203	4300	6503	SO:0001583	missense	114960			AK093329	CCDS5824.1	7q32	2008-02-04			ENSG00000213265	ENSG00000213265			12369	protein-coding gene	gene with protein product							Standard	NM_052933		Approved		uc003vqi.3	Q96PP4	OTTHUMG00000154999	ENST00000456951.1:c.613C>G	7.37:g.130356546G>C	ENSP00000406047:p.Gln205Glu	Somatic		WXS	Illumina HiSeq	Phase_IV	B3KSC9	Missense_Mutation	SNP	NULL	p.Q205E	ENST00000456951.1	37	c.613	CCDS5824.1	7	.	.	.	.	.	.	.	.	.	.	G	11.14	1.550641	0.27739	.	.	ENSG00000213265	ENST00000456951;ENST00000418126;ENST00000356588	.	.	.	5.57	3.59	0.41128	.	0.420416	0.20317	N	0.094720	T	0.19046	0.0457	N	0.19112	0.55	0.21822	N	0.999525	B	0.33318	0.408	B	0.28784	0.094	T	0.12993	-1.0526	9	0.15499	T	0.54	-2.5403	9.2646	0.37634	0.0:0.1619:0.6815:0.1566	.	205	Q96PP4	TSG13_HUMAN	E	205	.	ENSP00000348996:Q205E	Q	-	1	0	TSGA13	130007086	0.992000	0.36948	1.000000	0.80357	0.840000	0.47671	0.585000	0.23879	1.284000	0.44531	0.555000	0.69702	CAG	TSGA13	-	NULL		0.428	TSGA13-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TSGA13	HGNC	protein_coding	OTTHUMT00000337997.1	G	NM_052933		130356546	-1	no_errors	ENST00000356588	ensembl	human	known	70_37	missense	SNP	0.994	C
TUBBP1	92755	genome.wustl.edu	37	8	30209526	30209526	+	RNA	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:30209526G>A	ENST00000518096.1	+	0	138									tubulin, beta pseudogene 1																		TTTTAACCATGAGGGAAATCG	0.468																																																	0																																												92755			J00317		8p12	2012-10-16	2005-11-15		ENSG00000127589	ENSG00000127589			12414	pseudogene	pseudogene			"""tubulin, beta polypeptide pseudogene 1"""			7070533	Standard	NG_001206		Approved				OTTHUMG00000163834		8.37:g.30209526G>A		Somatic		WXS	Illumina HiSeq	Phase_IV		RNA	SNP	-	NULL	ENST00000518096.1	37	NULL		8																																																																																			TUBBP1	-	-		0.468	TUBBP1-002	KNOWN	basic	processed_transcript	TUBBP1	HGNC	pseudogene	OTTHUMT00000375880.1	G	NG_001206		30209526	+1	no_errors	ENST00000518096	ensembl	human	known	70_37	rna	SNP	1.000	A
TYRP1	7306	genome.wustl.edu	37	9	12694281	12694281	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr9:12694281C>T	ENST00000388918.5	+	2	414	c.285C>T	c.(283-285)ttC>ttT	p.F95F	TYRP1_ENST00000381137.2_5'UTR|TYRP1_ENST00000381136.2_5'Flank	NM_000550.2	NP_000541.1	P17643	TYRP1_HUMAN	tyrosinase-related protein 1	95					acetoacetic acid metabolic process (GO:0043438)|melanin biosynthetic process (GO:0042438)|melanocyte differentiation (GO:0030318)|melanosome organization (GO:0032438)	clathrin-coated endocytic vesicle membrane (GO:0030669)|endosome membrane (GO:0010008)|integral component of membrane (GO:0016021)|melanosome (GO:0042470)|melanosome membrane (GO:0033162)	copper ion binding (GO:0005507)|oxidoreductase activity, acting on paired donors, with incorporation or reduction of molecular oxygen, another compound as one donor, and incorporation of one atom of oxygen (GO:0016716)|protein heterodimerization activity (GO:0046982)|protein homodimerization activity (GO:0042803)			NS(1)|endometrium(4)|kidney(2)|large_intestine(4)|lung(10)|stomach(1)	22		all_cancers(3;3.1e-05)|all_lung(3;1.7e-06)|Lung NSC(3;2.09e-06)|all_epithelial(3;0.000695)|all_hematologic(3;0.0033)|Acute lymphoblastic leukemia(23;0.0744)		GBM - Glioblastoma multiforme(50;9.85e-06)		TGCGCTTCTTCAATAGGACAT	0.587									Oculocutaneous Albinism																																								0													47.0	42.0	44.0					9																	12694281		2203	4300	6503	SO:0001819	synonymous_variant	7306	Familial Cancer Database		L33830	CCDS34990.1	9p23	2013-01-08			ENSG00000107165	ENSG00000107165			12450	protein-coding gene	gene with protein product		115501		TYRP, CAS2		9434945	Standard	NM_000550		Approved	GP75, CATB, TRP, b-PROTEIN, OCA3	uc003zkv.4	P17643	OTTHUMG00000021034	ENST00000388918.5:c.285C>T	9.37:g.12694281C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	P78468|P78469|Q13721|Q15679	Silent	SNP	pfam_Tyrosinase,superfamily_Unchr_di-copper_centre,prints_Tyrosinase	p.F95	ENST00000388918.5	37	c.285	CCDS34990.1	9																																																																																			TYRP1	-	superfamily_Unchr_di-copper_centre		0.587	TYRP1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	TYRP1	HGNC	protein_coding	OTTHUMT00000055502.3	C	NM_000550		12694281	+1	no_errors	ENST00000388918	ensembl	human	known	70_37	silent	SNP	1.000	T
UBFD1	56061	genome.wustl.edu	37	16	23570965	23570965	+	Nonsense_Mutation	SNP	G	G	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr16:23570965G>T	ENST00000395878.3	+	3	913	c.532G>T	c.(532-534)Gag>Tag	p.E178*	UBFD1_ENST00000219638.4_Nonsense_Mutation_p.E402*|EARS2_ENST00000564501.1_5'Flank|UBFD1_ENST00000567212.1_Nonsense_Mutation_p.E169*|EARS2_ENST00000563459.1_5'Flank|EARS2_ENST00000449606.1_5'Flank|UBFD1_ENST00000571064.1_3'UTR|UBFD1_ENST00000567264.1_Nonsense_Mutation_p.E178*|EARS2_ENST00000563232.1_5'Flank	NM_019116.2	NP_061989.2	O14562	UBFD1_HUMAN	ubiquitin family domain containing 1	178							poly(A) RNA binding (GO:0044822)			endometrium(1)|kidney(1)|large_intestine(2)|lung(3)	7				GBM - Glioblastoma multiforme(48;0.0331)		AAAGGCCGAAGAGAACAAGAA	0.507																																					Melanoma(22;290 1069 22358 48158)												0													50.0	51.0	50.0					16																	23570965		1906	4118	6024	SO:0001587	stop_gained	56061			AK124139	CCDS10613.2	16p12.1	2008-11-05			ENSG00000103353	ENSG00000103353			30565	protein-coding gene	gene with protein product	"""ubiquitin-binding protein homolog"""					10493829	Standard	XM_006721064		Approved	FLJ42145, FLJ38870, UBPH	uc002dlv.3	O14562	OTTHUMG00000128855	ENST00000395878.3:c.532G>T	16.37:g.23570965G>T	ENSP00000379217:p.Glu178*	Somatic		WXS	Illumina HiSeq	Phase_IV	A8MW58|D3DWF2	Nonsense_Mutation	SNP	pfam_Ubiquitin,smart_Ubiquitin,pfscan_Ubiquitin_supergroup	p.E402*	ENST00000395878.3	37	c.1204	CCDS10613.2	16	.	.	.	.	.	.	.	.	.	.	G	27.3	4.819475	0.90873	.	.	ENSG00000103353	ENST00000219638;ENST00000395878;ENST00000399462	.	.	.	5.18	5.18	0.71444	.	0.000000	0.85682	D	0.000000	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.52906	T	0.07	-10.6017	17.6813	0.88243	0.0:0.0:1.0:0.0	.	.	.	.	X	402;178;55	.	ENSP00000219638:E402X	E	+	1	0	UBFD1	23478466	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	9.020000	0.93667	2.404000	0.81709	0.557000	0.71058	GAG	UBFD1	-	NULL		0.507	UBFD1-001	KNOWN	basic|appris_principal|CCDS	protein_coding	UBFD1	HGNC	protein_coding	OTTHUMT00000250795.2	G	NM_019116		23570965	+1	no_errors	ENST00000219638	ensembl	human	known	70_37	nonsense	SNP	1.000	T
UPF2	26019	genome.wustl.edu	37	10	12046574	12046574	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:12046574C>T	ENST00000356352.2	-	4	1932	c.1459G>A	c.(1459-1461)Gaa>Aaa	p.E487K	UPF2_ENST00000397053.2_Missense_Mutation_p.E487K|UPF2_ENST00000357604.5_Missense_Mutation_p.E487K			Q9HAU5	RENT2_HUMAN	UPF2 regulator of nonsense transcripts homolog (yeast)	487					gene expression (GO:0010467)|liver development (GO:0001889)|mRNA export from nucleus (GO:0006406)|mRNA metabolic process (GO:0016071)|nuclear-transcribed mRNA catabolic process, nonsense-mediated decay (GO:0000184)|organ regeneration (GO:0031100)|RNA metabolic process (GO:0016070)	cytoplasm (GO:0005737)|cytosol (GO:0005829)|exon-exon junction complex (GO:0035145)|nucleus (GO:0005634)	RNA binding (GO:0003723)			breast(3)|central_nervous_system(3)|cervix(1)|endometrium(5)|kidney(6)|large_intestine(14)|lung(17)|ovary(2)|skin(3)|urinary_tract(2)	56		Renal(717;0.228)				CAACTTTTTTCATTGTCTTTA	0.328																																																	0													71.0	67.0	69.0					10																	12046574		2203	4300	6503	SO:0001583	missense	26019			AB037829	CCDS7086.1	10p14-p13	2011-06-21			ENSG00000151461	ENSG00000151461			17854	protein-coding gene	gene with protein product	"""smg-3 homolog, nonsense mediated mRNA decay factor (C. elegans)"""	605529				11073994, 11113196	Standard	NM_080599		Approved	RENT2, DKFZP434D222, KIAA1408, smg-3	uc001ilb.3	Q9HAU5	OTTHUMG00000017678	ENST00000356352.2:c.1459G>A	10.37:g.12046574C>T	ENSP00000348708:p.Glu487Lys	Somatic		WXS	Illumina HiSeq	Phase_IV	A6NLJ5|D3DRS0|Q14BM1|Q5W0J4|Q8N8U1|Q9H1J2|Q9NWL1|Q9P2D9|Q9Y4M9	Missense_Mutation	SNP	pfam_MIF4G-like_typ-3,pfam_Up-fram_suppressor-2,superfamily_ARM-type_fold,smart_MIF4G-like_typ-3	p.E487K	ENST00000356352.2	37	c.1459	CCDS7086.1	10	.	.	.	.	.	.	.	.	.	.	C	18.19	3.569976	0.65765	.	.	ENSG00000151461	ENST00000356352;ENST00000357604;ENST00000379172;ENST00000397053;ENST00000313977	T;T;T	0.28895	1.59;1.59;1.59	5.06	5.06	0.68205	.	0.000000	0.85682	D	0.000000	T	0.42449	0.1203	N	0.25647	0.755	0.80722	D	1	D;B	0.56035	0.974;0.296	D;B	0.70487	0.969;0.074	T	0.15378	-1.0439	10	0.23302	T	0.38	.	18.4495	0.90697	0.0:1.0:0.0:0.0	.	457;487	Q9HAU5-2;Q9HAU5	.;RENT2_HUMAN	K	487;487;457;487;457	ENSP00000348708:E487K;ENSP00000350221:E487K;ENSP00000380244:E487K	ENSP00000313617:E457K	E	-	1	0	UPF2	12086580	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.818000	0.86416	2.357000	0.79964	0.563000	0.77884	GAA	UPF2	-	NULL		0.328	UPF2-001	KNOWN	alternative_5_UTR|basic|appris_principal|CCDS	protein_coding	UPF2	HGNC	protein_coding	OTTHUMT00000046783.1	C			12046574	-1	no_errors	ENST00000356352	ensembl	human	known	70_37	missense	SNP	1.000	T
VCAN	1462	genome.wustl.edu	37	5	82818048	82818048	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr5:82818048C>G	ENST00000265077.3	+	7	4488	c.3923C>G	c.(3922-3924)tCt>tGt	p.S1308C	VCAN_ENST00000502527.2_Intron|VCAN_ENST00000342785.4_Missense_Mutation_p.S1308C|VCAN_ENST00000343200.5_Intron|VCAN_ENST00000512590.2_Missense_Mutation_p.S1260C	NM_004385.4	NP_004376.2	P13611	CSPG2_HUMAN	versican	1308	GAG-alpha (glucosaminoglycan attachment domain).				carbohydrate metabolic process (GO:0005975)|cell adhesion (GO:0007155)|cell recognition (GO:0008037)|chondroitin sulfate biosynthetic process (GO:0030206)|chondroitin sulfate catabolic process (GO:0030207)|chondroitin sulfate metabolic process (GO:0030204)|dermatan sulfate biosynthetic process (GO:0030208)|extracellular matrix organization (GO:0030198)|glial cell migration (GO:0008347)|glycosaminoglycan metabolic process (GO:0030203)|heart development (GO:0007507)|multicellular organismal development (GO:0007275)|osteoblast differentiation (GO:0001649)|small molecule metabolic process (GO:0044281)	extracellular matrix (GO:0031012)|extracellular region (GO:0005576)|extracellular space (GO:0005615)|Golgi lumen (GO:0005796)|intracellular membrane-bounded organelle (GO:0043231)|lysosomal lumen (GO:0043202)|membrane (GO:0016020)|proteinaceous extracellular matrix (GO:0005578)	calcium ion binding (GO:0005509)|carbohydrate binding (GO:0030246)|glycosaminoglycan binding (GO:0005539)|hyaluronic acid binding (GO:0005540)			NS(2)|biliary_tract(1)|breast(3)|central_nervous_system(1)|endometrium(11)|haematopoietic_and_lymphoid_tissue(2)|kidney(6)|large_intestine(52)|lung(64)|ovary(8)|pancreas(3)|prostate(13)|skin(14)|stomach(2)|upper_aerodigestive_tract(3)|urinary_tract(5)	190		Lung NSC(167;0.0216)|all_lung(232;0.0251)|Ovarian(174;0.142)		OV - Ovarian serous cystadenocarcinoma(54;2.47e-41)|Epithelial(54;2.51e-34)|all cancers(79;5.19e-29)	Hyaluronan(DB08818)	CAGGCGCTTTCTACGCCACAG	0.443																																																	0													59.0	60.0	60.0					5																	82818048		2203	4299	6502	SO:0001583	missense	1462			X15998	CCDS4060.1, CCDS47242.1, CCDS54875.1, CCDS54876.1	5q14.2-q14.3	2013-05-07	2007-02-15	2007-02-15	ENSG00000038427	ENSG00000038427		"""Immunoglobulin superfamily / V-set domain containing"", ""Proteoglycans / Extracellular Matrix : Hyalectans"""	2464	protein-coding gene	gene with protein product	"""versican proteoglycan"""	118661	"""chondroitin sulfate proteoglycan 2"""	CSPG2		1478664, 21063030	Standard	NM_004385		Approved	PG-M	uc003kii.3	P13611	OTTHUMG00000131321	ENST00000265077.3:c.3923C>G	5.37:g.82818048C>G	ENSP00000265077:p.Ser1308Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	P20754|Q13010|Q13189|Q15123|Q9UCL9|Q9UNW5	Missense_Mutation	SNP	pfam_Link,pfam_C-type_lectin,pfam_Ig_V-set,pfam_EG-like_dom,pfam_Sushi_SCR_CCP,superfamily_C-type_lectin_fold,superfamily_Complement_control_module,smart_Ig_sub,smart_Link,smart_EG-like_dom,smart_EGF-like_Ca-bd,smart_C-type_lectin,smart_Sushi_SCR_CCP,pfscan_EG-like_dom,pfscan_C-type_lectin,pfscan_Link,pfscan_Sushi_SCR_CCP,pfscan_Ig-like,prints_Link	p.S1308C	ENST00000265077.3	37	c.3923	CCDS4060.1	5	.	.	.	.	.	.	.	.	.	.	C	11.26	1.585133	0.28268	.	.	ENSG00000038427	ENST00000265077;ENST00000342785;ENST00000512590	D;D;D	0.89617	-2.54;-2.27;-2.29	5.81	5.81	0.92471	.	0.000000	0.64402	D	0.000007	D	0.93726	0.7995	M	0.74258	2.255	0.33459	D	0.584719	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.997	D	0.95800	0.8832	10	0.87932	D	0	.	13.2992	0.60315	0.0:0.9281:0.0:0.0719	.	1308;1308	P13611-3;P13611	.;CSPG2_HUMAN	C	1308;1308;1260	ENSP00000265077:S1308C;ENSP00000342768:S1308C;ENSP00000425959:S1260C	ENSP00000265077:S1308C	S	+	2	0	VCAN	82853804	0.997000	0.39634	0.485000	0.27403	0.003000	0.03518	3.573000	0.53856	2.756000	0.94617	0.655000	0.94253	TCT	VCAN	-	NULL		0.443	VCAN-001	KNOWN	basic|CCDS	protein_coding	VCAN	HGNC	protein_coding	OTTHUMT00000254092.3	C	NM_004385		82818048	+1	no_errors	ENST00000265077	ensembl	human	known	70_37	missense	SNP	0.760	G
VPS26A	9559	genome.wustl.edu	37	10	70883965	70883965	+	5'UTR	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:70883965G>C	ENST00000373382.1	+	0	585				VPS26A_ENST00000541711.1_5'Flank|VPS26A_ENST00000546041.1_5'UTR|VPS26A_ENST00000263559.6_5'UTR|VPS26A_ENST00000395098.1_5'UTR			O75436	VP26A_HUMAN	vacuolar protein sorting 26 homolog A (S. pombe)						retrograde transport, endosome to Golgi (GO:0042147)	cytosol (GO:0005829)|endosome (GO:0005768)|extracellular vesicular exosome (GO:0070062)|intracellular membrane-bounded organelle (GO:0043231)|membrane (GO:0016020)|vesicle (GO:0031982)	protein transporter activity (GO:0008565)			breast(1)|central_nervous_system(1)|endometrium(1)|large_intestine(3)|lung(2)	8						GGAGCGGAGGGAGCCGGGGCT	0.736																																					Colon(90;545 1358 4729 6702 16773)												0													15.0	24.0	21.0					10																	70883965		683	1589	2272	SO:0001623	5_prime_UTR_variant	9559			AF054179	CCDS7286.1, CCDS41536.1	10q21.1	2007-01-12	2007-01-12	2005-10-11	ENSG00000122958	ENSG00000122958			12711	protein-coding gene	gene with protein product		605506	"""vacuolar protein sorting 26 (yeast homolog)"", ""vacuolar protein sorting 26 (yeast)"", ""vacuolar protein sorting 26 homolog A (yeast)"""	VPS26		1638986, 9653160	Standard	NM_004896		Approved	Hbeta58, PEP8A	uc001jpb.3	O75436	OTTHUMG00000018376	ENST00000373382.1:c.-69G>C	10.37:g.70883965G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A8MZ56|B2RDD3|Q8TBH4|Q9H982	RNA	SNP	-	NULL	ENST00000373382.1	37	NULL	CCDS7286.1	10																																																																																			VPS26A	-	-		0.736	VPS26A-001	KNOWN	basic|appris_principal|CCDS	protein_coding	VPS26A	HGNC	protein_coding	OTTHUMT00000048403.1	G	NM_004896		70883965	+1	no_errors	ENST00000489656	ensembl	human	known	70_37	rna	SNP	0.278	C
VWA5B1	127731	genome.wustl.edu	37	1	20675597	20675597	+	Intron	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:20675597G>C	ENST00000375079.2	+	18	3089				VWA5B1_ENST00000289815.8_Intron|VWA5B1_ENST00000525343.1_Intron|VWA5B1_ENST00000375083.4_Missense_Mutation_p.R961T	NM_001039500.2	NP_001034589.2	Q5TIE3	VW5B1_HUMAN	von Willebrand factor A domain containing 5B1							extracellular region (GO:0005576)				central_nervous_system(1)|endometrium(3)|kidney(1)|prostate(1)|skin(1)	7						CCAGGTCCTAGAAAGTGCTCA	0.478																																																	0																																										SO:0001627	intron_variant	127731			AK125833, AK057346		1p36.12	2014-02-12			ENSG00000158816	ENSG00000158816			26538	protein-coding gene	gene with protein product							Standard	NM_001039500		Approved	FLJ32784	uc009vps.2	Q5TIE3	OTTHUMG00000002835	ENST00000375079.2:c.2893+728G>C	1.37:g.20675597G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	A4IF35|A4IF36|Q3ZCM4|Q6ZUB4|Q96M71	Missense_Mutation	SNP	pfam_VWF_A,smart_VWF_A,pfscan_VWF_A	p.R961T	ENST00000375079.2	37	c.2882		1	.	.	.	.	.	.	.	.	.	.	G	6.018	0.371732	0.11409	.	.	ENSG00000158816	ENST00000375083	T	0.04194	3.68	3.16	3.16	0.36331	.	.	.	.	.	T	0.03783	0.0107	.	.	.	0.29047	N	0.884717	.	.	.	.	.	.	T	0.33954	-0.9848	6	0.13853	T	0.58	.	10.0827	0.42399	0.0:0.0:1.0:0.0	.	.	.	.	T	961	ENSP00000364224:R961T	ENSP00000364224:R961T	R	+	2	0	VWA5B1	20548184	0.047000	0.20315	0.008000	0.14137	0.011000	0.07611	1.290000	0.33319	2.100000	0.63781	0.542000	0.68232	AGA	VWA5B1	-	NULL		0.478	VWA5B1-001	NOVEL	not_organism_supported|basic|appris_principal	protein_coding	VWA5B1	HGNC	protein_coding	OTTHUMT00000007945.4	G	XM_001722222		20675597	+1	no_errors	ENST00000375083	ensembl	human	known	70_37	missense	SNP	0.008	C
WDFY4	57705	genome.wustl.edu	37	10	50004403	50004403	+	Missense_Mutation	SNP	A	A	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	A	A					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr10:50004403A>G	ENST00000325239.5	+	23	4345	c.4318A>G	c.(4318-4320)Atc>Gtc	p.I1440V	WDFY4_ENST00000413659.2_Intron	NM_020945.1	NP_065996.1	Q6ZS81	WDFY4_HUMAN	WDFY family member 4	1440						integral component of membrane (GO:0016021)				NS(2)|breast(5)|central_nervous_system(4)|endometrium(16)|haematopoietic_and_lymphoid_tissue(1)|kidney(3)|lung(3)|pancreas(2)|prostate(5)|skin(6)|stomach(1)	48						TTTTCAGCTGATCCTCTCAGT	0.473																																																	0													136.0	120.0	125.0					10																	50004403		692	1591	2283	SO:0001583	missense	57705			AK074085	CCDS44385.1	10q11.23	2013-01-10			ENSG00000128815	ENSG00000128815		"""WD repeat domain containing"""	29323	protein-coding gene	gene with protein product		613316	"""chromosome 10 open reading frame 64"""	C10orf64		10997877	Standard	NM_020945		Approved	KIAA1607, Em:AC060234.3, FLJ45748	uc001jha.4	Q6ZS81	OTTHUMG00000018180	ENST00000325239.5:c.4318A>G	10.37:g.50004403A>G	ENSP00000320563:p.Ile1440Val	Somatic		WXS	Illumina HiSeq	Phase_IV	B9ZVP2|Q86WZ4|Q8N4A3|Q8TEN7|Q96BE1|Q9H7H8|Q9HCG5	Missense_Mutation	SNP	pfam_BEACH_dom,pfam_WD40_repeat,superfamily_BEACH_dom,superfamily_WD40_repeat_dom,superfamily_ARM-type_fold,smart_WD40_repeat,pfscan_BEACH_dom,pfscan_WD40_repeat,pfscan_WD40_repeat_dom	p.I1440V	ENST00000325239.5	37	c.4318	CCDS44385.1	10	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	.|.	A|A	0.280|0.280	-0.987071|-0.987071	0.02180|0.02180	.|.	.|.	ENSG00000128815|ENSG00000128815	ENST00000312002|ENST00000426033;ENST00000325239	.|T	.|0.57436	.|0.4	5.2|5.2	-2.09|-2.09	0.07232|0.07232	.|.	.|0.400309	.|0.25692	.|N	.|0.028925	T|T	0.34048|0.34048	0.0884|0.0884	L|L	0.52364|0.52364	1.645|1.645	0.80722|0.80722	D|D	1|1	.|B	.|0.06786	.|0.001	.|B	.|0.08055	.|0.003	T|T	0.05257|0.05257	-1.0896|-1.0896	5|9	.|.	.|.	.|.	.|.	1.4493|1.4493	0.02372|0.02372	0.446:0.2712:0.1519:0.1309|0.446:0.2712:0.1519:0.1309	.|.	.|1440	.|Q6ZS81	.|WDFY4_HUMAN	G|V	530|1440	.|ENSP00000320563:I1440V	.|.	D|I	+|+	2|1	0|0	WDFY4|WDFY4	49674409|49674409	0.997000|0.997000	0.39634|0.39634	0.854000|0.854000	0.33618|0.33618	0.232000|0.232000	0.25224|0.25224	1.065000|1.065000	0.30592|0.30592	-0.278000|-0.278000	0.09180|0.09180	-1.508000|-1.508000	0.00951|0.00951	GAT|ATC	WDFY4	-	NULL		0.473	WDFY4-201	KNOWN	basic|appris_principal|CCDS	protein_coding	WDFY4	HGNC	protein_coding		A	XM_033379		50004403	+1	no_errors	ENST00000325239	ensembl	human	known	70_37	missense	SNP	0.649	G
WDR48	57599	genome.wustl.edu	37	3	39136444	39136444	+	3'UTR	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr3:39136444G>C	ENST00000302313.5	+	0	2272				WDR48_ENST00000396258.3_3'UTR|WDR48_ENST00000544962.1_3'UTR|WDR48_ENST00000466405.1_3'UTR	NM_020839.2	NP_065890.1	Q8TAF3	WDR48_HUMAN	WD repeat domain 48						double-strand break repair via homologous recombination (GO:0000724)|embryonic organ development (GO:0048568)|homeostasis of number of cells (GO:0048872)|multicellular organism growth (GO:0035264)|positive regulation of epithelial cell proliferation (GO:0050679)|protein deubiquitination (GO:0016579)|regulation of protein monoubiquitination (GO:1902525)|seminiferous tubule development (GO:0072520)|single fertilization (GO:0007338)|skeletal system morphogenesis (GO:0048705)|skin development (GO:0043588)|spermatogenesis (GO:0007283)|viral process (GO:0016032)	intracellular membrane-bounded organelle (GO:0043231)|lysosome (GO:0005764)|nucleus (GO:0005634)				breast(2)|kidney(1)|large_intestine(2)|lung(4)|ovary(1)|pancreas(1)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	15				KIRC - Kidney renal clear cell carcinoma(284;0.0588)|Kidney(284;0.0738)		CAGGGAAGCAGAGTGCAAGAG	0.433																																																	0																																										SO:0001624	3_prime_UTR_variant	57599			AF468833	CCDS33738.1	3p21.33	2014-06-16			ENSG00000114742	ENSG00000114742		"""WD repeat domain containing"""	30914	protein-coding gene	gene with protein product		612167				10819331, 12196293, 24482476	Standard	NM_020839		Approved	KIAA1449, P80, SPG60	uc003cit.3	Q8TAF3	OTTHUMG00000155972	ENST00000302313.5:c.*210G>C	3.37:g.39136444G>C		Somatic		WXS	Illumina HiSeq	Phase_IV	B4DM86|B4DQI2|B4DY84|Q63HJ2|Q658Y1|Q8N3Z1|Q9NSK8|Q9P279	RNA	SNP	-	NULL	ENST00000302313.5	37	NULL	CCDS33738.1	3																																																																																			WDR48	-	-		0.433	WDR48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	WDR48	HGNC	protein_coding	OTTHUMT00000342529.1	G	NM_020839		39136444	+1	no_errors	ENST00000466405	ensembl	human	known	70_37	rna	SNP	0.529	C
WDTC1	23038	genome.wustl.edu	37	1	27633122	27633122	+	3'UTR	DEL	C	C	-			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:27633122delC	ENST00000319394.3	+	0	2817				WDTC1_ENST00000361771.3_3'UTR	NM_001276252.1|NM_015023.3	NP_001263181.1|NP_055838.2	Q8N5D0	WDTC1_HUMAN	WD and tetratricopeptide repeats 1						cellular chemical homeostasis (GO:0055082)|cellular response to insulin stimulus (GO:0032869)|glucose metabolic process (GO:0006006)|in utero embryonic development (GO:0001701)|multicellular organism growth (GO:0035264)|negative regulation of fatty acid biosynthetic process (GO:0045717)|negative regulation of transcription from RNA polymerase II promoter (GO:0000122)|protein ubiquitination (GO:0016567)|regulation of cell size (GO:0008361)	cytosol (GO:0005829)|nucleus (GO:0005634)	enzyme inhibitor activity (GO:0004857)			central_nervous_system(1)|endometrium(5)|kidney(1)|large_intestine(7)|lung(5)|ovary(1)|skin(1)	21		all_cancers(24;3.12e-19)|all_epithelial(13;4.18e-18)|Colorectal(325;0.000147)|all_lung(284;0.000366)|Lung NSC(340;0.000548)|Renal(390;0.00211)|Breast(348;0.00257)|Myeloproliferative disorder(586;0.0393)|Ovarian(437;0.0707)|all_neural(195;0.0966)		UCEC - Uterine corpus endometrioid carcinoma (279;0.0443)|OV - Ovarian serous cystadenocarcinoma(117;1.09e-27)|Colorectal(126;8.83e-09)|COAD - Colon adenocarcinoma(152;1.02e-06)|BRCA - Breast invasive adenocarcinoma(304;0.000544)|KIRC - Kidney renal clear cell carcinoma(1967;0.00201)|STAD - Stomach adenocarcinoma(196;0.00321)|READ - Rectum adenocarcinoma(331;0.0476)		CCTCCATATGCCCCCCCCCAT	0.582																																																	0																																										SO:0001624	3_prime_UTR_variant	23038			AK023778	CCDS296.1, CCDS60044.1	1p35.3	2013-01-11			ENSG00000142784	ENSG00000142784		"""DDB1 and CUL4 associated factors"", ""WD repeat domain containing"", ""Tetratricopeptide (TTC) repeat domain containing"""	29175	protein-coding gene	gene with protein product	"""adipose homolog (Drosophila)"", ""DDB1 and CUL4 associated factor 9"""					12717455, 19238144	Standard	NM_015023		Approved	KIAA1037, ADP, DCAF9	uc009vst.3	Q8N5D0	OTTHUMG00000004273	ENST00000319394.3:c.*248C>-	1.37:g.27633122delC		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DPL5|Q5SSC5|Q9NV87|Q9UPW4	RNA	DEL	-	NULL	ENST00000319394.3	37	NULL		1																																																																																			WDTC1	-	-		0.582	WDTC1-201	KNOWN	basic|appris_candidate_longest	protein_coding	WDTC1	HGNC	protein_coding		C	NM_015023		27633122	+1	no_errors	ENST00000491239	ensembl	human	known	70_37	rna	DEL	0.002	-
XPO7	23039	genome.wustl.edu	37	8	21837640	21837640	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr8:21837640T>C	ENST00000252512.9	+	9	983	c.883T>C	c.(883-885)Ttt>Ctt	p.F295L	XPO7_ENST00000433566.4_Missense_Mutation_p.F296L|XPO7_ENST00000434536.1_Missense_Mutation_p.F304L	NM_015024.4	NP_055839.3	Q9UIA9	XPO7_HUMAN	exportin 7	295				Missing (in Ref. 3; BAA34465). {ECO:0000305}.	mRNA transport (GO:0051028)|protein export from nucleus (GO:0006611)	cytoplasm (GO:0005737)|nuclear pore (GO:0005643)|nucleus (GO:0005634)	nuclear export signal receptor activity (GO:0005049)			autonomic_ganglia(1)|breast(2)|central_nervous_system(1)|endometrium(4)|kidney(4)|large_intestine(2)|lung(12)|ovary(2)|pancreas(1)|prostate(2)|skin(3)|upper_aerodigestive_tract(1)|urinary_tract(1)	36				Colorectal(74;0.0187)|COAD - Colon adenocarcinoma(73;0.0724)		AAGATCCCTGTTTAACAATGC	0.393																																																	0													123.0	115.0	117.0					8																	21837640		1909	4119	6028	SO:0001583	missense	23039			AF064729	CCDS47818.1	8p21	2011-04-13	2003-03-11	2003-03-14	ENSG00000130227	ENSG00000130227		"""Exportins"""	14108	protein-coding gene	gene with protein product		606140	"""RAN binding protein 16"""	RANBP16		11024021, 9872452	Standard	NM_015024		Approved	KIAA0745	uc003xaa.4	Q9UIA9	OTTHUMG00000163789	ENST00000252512.9:c.883T>C	8.37:g.21837640T>C	ENSP00000252512:p.Phe295Leu	Somatic		WXS	Illumina HiSeq	Phase_IV	O94846|Q6PJK9|Q8NEK7	Missense_Mutation	SNP	pfam_Importin-beta_N,superfamily_ARM-type_fold,smart_Importin-beta_N,pfscan_Importin-beta_N	p.F304L	ENST00000252512.9	37	c.910	CCDS47818.1	8	.	.	.	.	.	.	.	.	.	.	T	34	5.305795	0.95629	.	.	ENSG00000130227	ENST00000434536;ENST00000252512;ENST00000433566	T;T;T	0.43688	0.94;0.94;0.94	5.57	5.57	0.84162	Armadillo-type fold (1);	0.000000	0.85682	D	0.000000	T	0.70334	0.3212	M	0.93939	3.475	0.80722	D	1	D;D;D	0.65815	0.995;0.989;0.989	P;P;P	0.60886	0.88;0.88;0.88	T	0.78355	-0.2236	10	0.52906	T	0.07	-13.8637	15.4138	0.74948	0.0:0.0:0.0:1.0	.	296;304;295	E7ESC6;E9PEN8;Q9UIA9	.;.;XPO7_HUMAN	L	304;295;296	ENSP00000404853:F304L;ENSP00000252512:F295L;ENSP00000410249:F296L	ENSP00000252512:F295L	F	+	1	0	XPO7	21893586	1.000000	0.71417	1.000000	0.80357	0.992000	0.81027	8.040000	0.89188	2.120000	0.65058	0.533000	0.62120	TTT	XPO7	-	superfamily_ARM-type_fold		0.393	XPO7-001	KNOWN	basic|appris_principal|CCDS	protein_coding	XPO7	HGNC	protein_coding	OTTHUMT00000375494.1	T	NM_015024		21837640	+1	no_errors	ENST00000434536	ensembl	human	known	70_37	missense	SNP	1.000	C
YIPF5	81555	genome.wustl.edu	37	5	143543784	143543785	+	Frame_Shift_Ins	INS	-	-	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	-	-					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr5:143543784_143543785insT	ENST00000274496.5	-	4	453_454	c.319_320insA	c.(319-321)acafs	p.T107fs	YIPF5_ENST00000513112.1_Frame_Shift_Ins_p.T53fs|YIPF5_ENST00000448443.2_Frame_Shift_Ins_p.T107fs	NM_001271732.1|NM_030799.7	NP_001258661.1|NP_110426.4	Q969M3	YIPF5_HUMAN	Yip1 domain family, member 5	107					protein transport (GO:0015031)|regulation of ER to Golgi vesicle-mediated transport (GO:0060628)|vesicle-mediated transport (GO:0016192)	endoplasmic reticulum exit site (GO:0070971)|ER to Golgi transport vesicle (GO:0030134)|Golgi apparatus (GO:0005794)|integral component of membrane (GO:0016021)|nuclear outer membrane-endoplasmic reticulum membrane network (GO:0042175)				large_intestine(2)|lung(5)|ovary(1)|skin(1)	9		all_hematologic(541;0.118)	KIRC - Kidney renal clear cell carcinoma(527;0.00111)|Kidney(363;0.00176)			TACTGTTAGTGTTTTTTGCCAG	0.332																																																	0																																										SO:0001589	frameshift_variant	81555			AF318329	CCDS4279.1, CCDS64277.1	5q31.3	2009-01-12			ENSG00000145817	ENSG00000145817		"""Yip1 domain family"""	24877	protein-coding gene	gene with protein product		611483				12975309, 18718466	Standard	NM_001024947		Approved	SMAP-5, FinGER5	uc003lnl.5	Q969M3	OTTHUMG00000129679	ENST00000274496.5:c.320dupA	5.37:g.143543790_143543790dupT	ENSP00000274496:p.Thr107fs	Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQF5|Q4VSN6|Q53EX4|Q8NHE5|Q9H338|Q9H3U4	Frame_Shift_Ins	INS	pfam_Yip1	p.T107fs	ENST00000274496.5	37	c.320_319	CCDS4279.1	5																																																																																			YIPF5	-	pfam_Yip1		0.332	YIPF5-001	KNOWN	basic|appris_principal|CCDS	protein_coding	YIPF5	HGNC	protein_coding	OTTHUMT00000251882.1	-	NM_030799		143543785	-1	no_errors	ENST00000274496	ensembl	human	known	70_37	frame_shift_ins	INS	1.000:1.000	T
ZFHX2	85446	genome.wustl.edu	37	14	23992625	23992625	+	Nonsense_Mutation	SNP	C	C	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:23992625C>A	ENST00000419474.3	-	9	6881	c.6526G>T	c.(6526-6528)Gag>Tag	p.E2176*	RP11-66N24.4_ENST00000553985.1_RNA|ZFHX2_ENST00000606808.1_5'Flank|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	2176					adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						CGAACCGCCTCCTTGAGCTTG	0.592																																																	0																																										SO:0001587	stop_gained	85446			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.6526G>T	14.37:g.23992625C>A	ENSP00000413418:p.Glu2176*	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UPU6	Nonsense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E2176*	ENST00000419474.3	37	c.6526	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	c	46	12.656104	0.99686	.	.	ENSG00000136367	ENST00000419474	.	.	.	4.42	3.53	0.40419	.	0.000000	0.45126	D	0.000400	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.54805	T	0.06	.	11.4025	0.49878	0.0:0.91:0.0:0.09	.	.	.	.	X	2176	.	ENSP00000413418:E2176X	E	-	1	0	ZFHX2	23062465	1.000000	0.71417	1.000000	0.80357	0.813000	0.45954	5.863000	0.69568	1.096000	0.41439	0.457000	0.33378	GAG	ZFHX2	-	smart_Znf_U1		0.592	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	C	NM_014894		23992625	-1	no_errors	ENST00000419474	ensembl	human	known	70_37	nonsense	SNP	1.000	A
ZFHX2	85446	genome.wustl.edu	37	14	23993957	23993957	+	Missense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr14:23993957C>G	ENST00000419474.3	-	9	5549	c.5194G>C	c.(5194-5196)Gag>Cag	p.E1732Q	RP11-66N24.4_ENST00000553985.1_RNA|ZFHX2_ENST00000606808.1_5'Flank|RP11-66N24.4_ENST00000556354.1_RNA|RP11-66N24.4_ENST00000554403.1_RNA	NM_033400.2	NP_207646.2	Q9C0A1	ZFHX2_HUMAN	zinc finger homeobox 2	1732	Glu-rich.				adult behavior (GO:0030534)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	sequence-specific DNA binding (GO:0043565)|zinc ion binding (GO:0008270)			NS(1)|breast(2)|haematopoietic_and_lymphoid_tissue(1)|pancreas(1)	5						AATGGGCCCTCAGGCCCTGCT	0.572																																																	0																																										SO:0001583	missense	85446			AB051549	CCDS55907.1	14q11.2	2012-03-09			ENSG00000136367	ENSG00000136367		"""Zinc fingers, C2H2-type"", ""Homeoboxes / ZF class"""	20152	protein-coding gene	gene with protein product			"""zinc finger protein 409"""	ZNF409		11214970, 10470851	Standard	NM_033400		Approved	KIAA1762, KIAA1056, ZFH-5	uc010tno.2	Q9C0A1	OTTHUMG00000156894	ENST00000419474.3:c.5194G>C	14.37:g.23993957C>G	ENSP00000413418:p.Glu1732Gln	Somatic		WXS	Illumina HiSeq	Phase_IV	Q9UPU6	Missense_Mutation	SNP	pfam_Homeodomain,superfamily_Homeodomain-like,superfamily_Adenylate_cyclase-assoc_CAP_N,smart_Znf_C2H2-like,smart_Znf_U1,smart_Homeodomain,pfscan_Homeodomain,pfscan_Znf_C2H2	p.E1732Q	ENST00000419474.3	37	c.5194	CCDS55907.1	14	.	.	.	.	.	.	.	.	.	.	C	12.10	1.835381	0.32421	.	.	ENSG00000136367	ENST00000419474	T	0.78003	-1.14	4.58	0.348	0.16026	.	1.101820	0.07040	N	0.830005	T	0.61652	0.2364	L	0.27053	0.805	0.09310	N	1	B	0.06786	0.001	B	0.04013	0.001	T	0.40646	-0.9552	10	0.15952	T	0.53	.	6.0382	0.19720	0.0:0.5341:0.2907:0.1751	.	1732	Q9C0A1	ZFHX2_HUMAN	Q	1732	ENSP00000413418:E1732Q	ENSP00000413418:E1732Q	E	-	1	0	ZFHX2	23063797	0.001000	0.12720	0.000000	0.03702	0.611000	0.37282	0.344000	0.19962	0.166000	0.19597	0.313000	0.20887	GAG	ZFHX2	-	NULL		0.572	ZFHX2-001	KNOWN	not_organism_supported|basic|appris_principal|exp_conf|CCDS	protein_coding	ZFHX2	HGNC	protein_coding	OTTHUMT00000346484.3	C	NM_014894		23993957	-1	no_errors	ENST00000419474	ensembl	human	known	70_37	missense	SNP	0.000	G
ZNF385B	151126	genome.wustl.edu	37	2	180306848	180306848	+	3'UTR	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr2:180306848C>T	ENST00000410066.1	-	0	3148				ZNF385B_ENST00000409343.1_3'UTR|ZNF385B_ENST00000466398.1_5'UTR|ZNF385B_ENST00000336917.5_3'UTR	NM_152520.4	NP_689733.3	Q569K4	Z385B_HUMAN	zinc finger protein 385B						intrinsic apoptotic signaling pathway by p53 class mediator (GO:0072332)	nucleus (GO:0005634)	nucleic acid binding (GO:0003676)|p53 binding (GO:0002039)|zinc ion binding (GO:0008270)			breast(1)|kidney(1)|large_intestine(6)|lung(11)|ovary(1)|skin(4)|upper_aerodigestive_tract(2)	26			Epithelial(96;0.174)|OV - Ovarian serous cystadenocarcinoma(117;0.201)			CCCCTGATATCACAAACATTC	0.373																																					Colon(155;204 2491 32774 51842)												0																																										SO:0001624	3_prime_UTR_variant	151126			AK057999	CCDS33339.1, CCDS46463.1, CCDS46464.1	2q31.3-q32.1	2012-10-05	2007-12-06	2007-12-06	ENSG00000144331	ENSG00000144331			26332	protein-coding gene	gene with protein product		612344	"""zinc finger protein 533"""	ZNF533		12477932	Standard	NM_152520		Approved	FLJ25270	uc002unn.4	Q569K4	OTTHUMG00000154559	ENST00000410066.1:c.*1129G>A	2.37:g.180306848C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	Q49A04|Q6ZMZ7|Q8IY01|Q8N8H2|Q96DK4	RNA	SNP	-	NULL	ENST00000410066.1	37	NULL	CCDS33339.1	2																																																																																			ZNF385B	-	-		0.373	ZNF385B-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF385B	HGNC	protein_coding	OTTHUMT00000335972.1	C	NM_152520		180306848	-1	no_errors	ENST00000466398	ensembl	human	known	70_37	rna	SNP	1.000	T
ZNF48	197407	genome.wustl.edu	37	16	30409622	30409622	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr16:30409622C>T	ENST00000320159.2	+	2	1427	c.1051C>T	c.(1051-1053)Cgc>Tgc	p.R351C	SEPT1_ENST00000570039.1_5'Flank	NM_001214906.1|NM_001214907.1|NM_001214909.1|NM_152652.2	NP_001201835.1|NP_001201836.1|NP_001201838.1|NP_689865.2	Q96MX3	ZNF48_HUMAN	zinc finger protein 48	351				R -> H (in Ref. 2; AAH41388). {ECO:0000305}.	regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(3)|kidney(1)|large_intestine(1)|lung(11)|ovary(2)|pancreas(1)|skin(1)	21						CAAACACCTCCGCACCCACAG	0.652																																																	0													98.0	71.0	80.0					16																	30409622		2197	4300	6497	SO:0001583	missense	197407			M88358, AK056313	CCDS10679.1, CCDS73868.1	16p11.2	2013-01-08			ENSG00000180035	ENSG00000180035		"""Zinc fingers, C2H2-type"""	13114	protein-coding gene	gene with protein product			"""zinc finger protein 553"""	ZNF553		1505991	Standard	NM_152652		Approved	DKFZp762K013, FLJ31751, MGC43952	uc021tgi.1	Q96MX3	OTTHUMG00000048195	ENST00000320159.2:c.1051C>T	16.37:g.30409622C>T	ENSP00000324056:p.Arg351Cys	Somatic		WXS	Illumina HiSeq	Phase_IV	Q15920|Q4G0R3|Q69YP3|Q96IL9	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.R351C	ENST00000320159.2	37	c.1051	CCDS10679.1	16	.	.	.	.	.	.	.	.	.	.	C	15.24	2.773636	0.49786	.	.	ENSG00000180035	ENST00000495929;ENST00000320159	T	0.25749	1.78	4.95	4.95	0.65309	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.41605	D	0.000857	T	0.58163	0.2103	M	0.94101	3.495	0.38501	D	0.948237	D	0.89917	1.0	D	0.74348	0.983	T	0.69811	-0.5044	10	0.87932	D	0	-17.359	10.736	0.46126	0.1897:0.8103:0.0:0.0	.	351	Q96MX3	ZNF48_HUMAN	C	476;351	ENSP00000324056:R351C	ENSP00000324056:R351C	R	+	1	0	ZNF48	30317123	0.004000	0.15560	1.000000	0.80357	0.868000	0.49771	0.684000	0.25364	2.575000	0.86900	0.460000	0.39030	CGC	ZNF48	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.652	ZNF48-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF48	HGNC	protein_coding	OTTHUMT00000255549.2	C	NM_152652		30409622	+1	no_errors	ENST00000320159	ensembl	human	known	70_37	missense	SNP	0.977	T
ZNF423	23090	genome.wustl.edu	37	16	49671713	49671713	+	Missense_Mutation	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr16:49671713C>T	ENST00000561648.1	-	4	1403	c.1350G>A	c.(1348-1350)atG>atA	p.M450I	ZNF423_ENST00000262383.2_Missense_Mutation_p.M450I|ZNF423_ENST00000535559.1_Missense_Mutation_p.M333I|ZNF423_ENST00000562871.1_Missense_Mutation_p.M390I|ZNF423_ENST00000567169.1_Missense_Mutation_p.M333I|ZNF423_ENST00000563137.2_Missense_Mutation_p.M390I|ZNF423_ENST00000562520.1_Missense_Mutation_p.M390I	NM_001271620.1	NP_001258549.1	Q2M1K9	ZN423_HUMAN	zinc finger protein 423	450					cell differentiation (GO:0030154)|negative regulation of transcription, DNA-templated (GO:0045892)|nervous system development (GO:0007399)|Notch signaling pathway (GO:0007219)|positive regulation of BMP signaling pathway (GO:0030513)|positive regulation of transcription, DNA-templated (GO:0045893)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(8)|kidney(6)|large_intestine(16)|lung(47)|ovary(1)|pancreas(2)|prostate(4)|skin(1)|urinary_tract(2)	89		all_cancers(37;0.0155)				AGAGGGTGGGCATGGAGTCCA	0.567																																																	0													147.0	127.0	134.0					16																	49671713		2198	4300	6498	SO:0001583	missense	23090			AB018303	CCDS32445.1, CCDS61930.1	16q12	2014-01-28				ENSG00000102935		"""Zinc fingers, C2H2-type"""	16762	protein-coding gene	gene with protein product	"""OLF-1/EBF associated zinc finger gene"", "" Smad- and Olf-interacting zinc finger protein"", ""early B-cell factor associated zinc finger protein"""	604557				9872452, 10660046	Standard	NM_001271620		Approved	KIAA0760, OAZ, Roaz, Ebfaz, Zfp104, NPHP14, JBTS19	uc031qwd.1	Q2M1K9		ENST00000561648.1:c.1350G>A	16.37:g.49671713C>T	ENSP00000455426:p.Met450Ile	Somatic		WXS	Illumina HiSeq	Phase_IV	O94860|Q76N04|Q9NZ13	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.M450I	ENST00000561648.1	37	c.1350	CCDS32445.1	16	.	.	.	.	.	.	.	.	.	.	C	12.84	2.057096	0.36277	.	.	ENSG00000102935	ENST00000262383;ENST00000535559	T;T	0.27256	1.68;1.68	5.05	5.05	0.67936	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (1);	0.170968	0.56097	D	0.000038	T	0.14960	0.0361	N	0.08118	0	0.51482	D	0.999925	B	0.14012	0.009	B	0.09377	0.004	T	0.09707	-1.0662	9	.	.	.	.	18.4335	0.90634	0.0:1.0:0.0:0.0	.	450	Q2M1K9	ZN423_HUMAN	I	450;333	ENSP00000262383:M450I;ENSP00000442321:M333I	.	M	-	3	0	ZNF423	48229214	1.000000	0.71417	1.000000	0.80357	0.990000	0.78478	5.757000	0.68766	2.346000	0.79739	0.561000	0.74099	ATG	ZNF423	-	smart_Znf_C2H2-like		0.567	ZNF423-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF423	HGNC	protein_coding	OTTHUMT00000423258.1	C	NM_015069		49671713	-1	no_errors	ENST00000262383	ensembl	human	known	70_37	missense	SNP	1.000	T
ZNF536	9745	genome.wustl.edu	37	19	30936388	30936388	+	Missense_Mutation	SNP	T	T	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:30936388T>C	ENST00000355537.3	+	2	2066	c.1919T>C	c.(1918-1920)tTc>tCc	p.F640S		NM_014717.1	NP_055532.1	O15090	ZN536_HUMAN	zinc finger protein 536	640					negative regulation of neuron differentiation (GO:0045665)|negative regulation of retinoic acid receptor signaling pathway (GO:0048387)|regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	metal ion binding (GO:0046872)|retinoic acid-responsive element binding (GO:0044323)			NS(3)|breast(6)|endometrium(10)|haematopoietic_and_lymphoid_tissue(1)|kidney(2)|large_intestine(22)|lung(119)|ovary(7)|prostate(4)|skin(4)|upper_aerodigestive_tract(1)|urinary_tract(3)	182	Esophageal squamous(110;0.0834)					GGCCGGGTGTTCCGCACTTAC	0.637																																																	0													79.0	90.0	86.0					19																	30936388		2203	4300	6503	SO:0001583	missense	9745				CCDS32984.1	19q13.11	2013-01-08				ENSG00000198597		"""Zinc fingers, C2H2-type"""	29025	protein-coding gene	gene with protein product						9205841	Standard	XM_005259445		Approved	KIAA0390	uc002nsu.1	O15090		ENST00000355537.3:c.1919T>C	19.37:g.30936388T>C	ENSP00000347730:p.Phe640Ser	Somatic		WXS	Illumina HiSeq	Phase_IV	A2RU18	Missense_Mutation	SNP	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2	p.F640S	ENST00000355537.3	37	c.1919	CCDS32984.1	19	.	.	.	.	.	.	.	.	.	.	T	18.43	3.622754	0.66787	.	.	ENSG00000198597	ENST00000355537	T	0.73469	-0.75	5.68	5.68	0.88126	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	0.000000	0.85682	D	0.000000	D	0.88005	0.6321	M	0.87682	2.9	0.58432	D	0.99999	D;D	0.89917	1.0;1.0	D;D	0.91635	0.999;0.999	D	0.90105	0.4187	10	0.87932	D	0	-33.1636	15.9325	0.79675	0.0:0.0:0.0:1.0	.	640;640	A7E228;O15090	.;ZN536_HUMAN	S	640	ENSP00000347730:F640S	ENSP00000347730:F640S	F	+	2	0	ZNF536	35628228	1.000000	0.71417	1.000000	0.80357	0.998000	0.95712	7.667000	0.83888	2.148000	0.66965	0.533000	0.62120	TTC	ZNF536	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.637	ZNF536-004	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF536	HGNC	protein_coding	OTTHUMT00000459667.2	T	NM_014717		30936388	+1	no_errors	ENST00000355537	ensembl	human	known	70_37	missense	SNP	1.000	C
ZNF555	148254	genome.wustl.edu	37	19	2851618	2851618	+	Missense_Mutation	SNP	G	G	C	rs202164293		TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:2851618G>C	ENST00000334241.4	+	3	421	c.283G>C	c.(283-285)Gat>Cat	p.D95H	AC006130.3_ENST00000589365.1_RNA|ZNF555_ENST00000591539.1_Missense_Mutation_p.D95H	NM_001172775.1|NM_152791.4	NP_001166246.1|NP_690004.4	Q8NEP9	ZN555_HUMAN	zinc finger protein 555	95					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(2)|kidney(2)|large_intestine(6)|lung(3)|ovary(1)|prostate(1)|skin(3)|urinary_tract(4)	23				UCEC - Uterine corpus endometrioid carcinoma (162;6.64e-05)|OV - Ovarian serous cystadenocarcinoma(105;1.09e-113)|Epithelial(107;3.79e-112)|all cancers(105;1.67e-104)|BRCA - Breast invasive adenocarcinoma(158;0.00136)|STAD - Stomach adenocarcinoma(1328;0.18)		TAGCATCGAAGATCAAACCAC	0.393																																																	0													56.0	57.0	56.0					19																	2851618		2203	4300	6503	SO:0001583	missense	148254			AL832140	CCDS12096.1, CCDS59329.1	19p13.3	2013-09-20			ENSG00000186300	ENSG00000186300		"""Zinc fingers, C2H2-type"", ""-"""	28382	protein-coding gene	gene with protein product						12477932	Standard	NM_152791		Approved	MGC26707	uc002lwo.3	Q8NEP9	OTTHUMG00000180500	ENST00000334241.4:c.283G>C	19.37:g.2851618G>C	ENSP00000334853:p.Asp95His	Somatic		WXS	Illumina HiSeq	Phase_IV	A8KA89|K7EQM2|Q8NA46|Q96MP1	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.D95H	ENST00000334241.4	37	c.283	CCDS12096.1	19	.	.	.	.	.	.	.	.	.	.	G	10.10	1.258286	0.23051	.	.	ENSG00000186300	ENST00000334241;ENST00000382127	T	0.06849	3.25	3.26	-0.572	0.11745	.	.	.	.	.	T	0.12561	0.0305	L	0.52011	1.625	0.09310	N	1	D;B	0.89917	1.0;0.042	D;B	0.65573	0.936;0.017	T	0.27673	-1.0067	9	0.12766	T	0.61	.	0.8172	0.01105	0.2376:0.1816:0.396:0.1848	.	95;95	Q8NEP9;A8KA89	ZN555_HUMAN;.	H	95	ENSP00000334853:D95H	ENSP00000334853:D95H	D	+	1	0	ZNF555	2802618	0.996000	0.38824	0.044000	0.18714	0.020000	0.10135	1.351000	0.34022	0.076000	0.16826	0.555000	0.69702	GAT	ZNF555	-	NULL		0.393	ZNF555-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZNF555	HGNC	protein_coding	OTTHUMT00000451637.3	G	NM_152791		2851618	+1	no_errors	ENST00000334241	ensembl	human	known	70_37	missense	SNP	0.119	C
ZNF627	199692	genome.wustl.edu	37	19	11727567	11727567	+	Silent	SNP	C	C	T			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:11727567C>T	ENST00000361113.5	+	4	457	c.249C>T	c.(247-249)ttC>ttT	p.F83F	ZNF627_ENST00000588174.1_3'UTR	NM_145295.3	NP_660338.1	Q7L945	ZN627_HUMAN	zinc finger protein 627	83					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|central_nervous_system(1)|endometrium(1)|kidney(1)|large_intestine(6)|prostate(1)|skin(2)|upper_aerodigestive_tract(1)	14						AAGAAACCTTCAGCCAGATTC	0.393																																					Melanoma(112;173 1614 10731 17751 23322)												0													88.0	85.0	86.0					19																	11727567		1913	4142	6055	SO:0001819	synonymous_variant	199692			AK074846	CCDS42502.1	19p13.2	2013-01-08				ENSG00000198551		"""Zinc fingers, C2H2-type"", ""-"""	30570	protein-coding gene	gene with protein product		612248				12477932	Standard	NM_145295		Approved	FLJ90365	uc002msk.2	Q7L945		ENST00000361113.5:c.249C>T	19.37:g.11727567C>T		Somatic		WXS	Illumina HiSeq	Phase_IV	O14846|Q4KMP9|Q6NT81|Q9BRG4	Silent	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.F83	ENST00000361113.5	37	c.249	CCDS42502.1	19																																																																																			ZNF627	-	NULL		0.393	ZNF627-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF627	HGNC	protein_coding	OTTHUMT00000458875.1	C	NM_145295		11727567	+1	no_errors	ENST00000361113	ensembl	human	known	70_37	silent	SNP	0.547	T
ZNF766	90321	genome.wustl.edu	37	19	52794063	52794063	+	Nonsense_Mutation	SNP	C	C	G			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	C	C					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:52794063C>G	ENST00000439461.1	+	4	1062	c.1019C>G	c.(1018-1020)tCa>tGa	p.S340*	CTD-2525I3.5_ENST00000594865.1_RNA|ZNF766_ENST00000359102.4_Nonsense_Mutation_p.S355*|ZNF766_ENST00000599581.1_3'UTR|ZNF766_ENST00000593612.1_Nonsense_Mutation_p.S355*	NM_001010851.2	NP_001010851.1	Q5HY98	ZN766_HUMAN	zinc finger protein 766	340					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)|endometrium(6)|kidney(1)|large_intestine(3)|lung(5)|prostate(1)	17				GBM - Glioblastoma multiforme(134;0.00236)|OV - Ovarian serous cystadenocarcinoma(262;0.00871)		AGTGGGCATTCAAGCCTCACC	0.383																																																	0													32.0	34.0	33.0					19																	52794063		2127	4271	6398	SO:0001587	stop_gained	90321			AK024074	CCDS46163.1	19q13.33	2013-01-08				ENSG00000196214		"""Zinc fingers, C2H2-type"", ""-"""	28063	protein-coding gene	gene with protein product							Standard	XM_006723458		Approved		uc002pyr.1	Q5HY98		ENST00000439461.1:c.1019C>G	19.37:g.52794063C>G	ENSP00000409652:p.Ser340*	Somatic		WXS	Illumina HiSeq	Phase_IV	B2RNE0|Q7Z326	Nonsense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.S355*	ENST00000439461.1	37	c.1064	CCDS46163.1	19	.	.	.	.	.	.	.	.	.	.	C	29.4	5.006676	0.93287	.	.	ENSG00000196214	ENST00000439461;ENST00000359102	.	.	.	2.38	2.38	0.29361	.	.	.	.	.	.	.	.	.	.	.	0.80722	A	1	.	.	.	.	.	.	.	.	.	.	0.87932	D	0	.	11.8491	0.52401	0.0:1.0:0.0:0.0	.	.	.	.	X	340;355	.	ENSP00000352005:S355X	S	+	2	0	ZNF766	57485875	0.000000	0.05858	0.019000	0.16419	0.012000	0.07955	0.012000	0.13287	1.318000	0.45170	0.650000	0.86243	TCA	ZNF766	-	pfam_Znf_C2H2,smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.383	ZNF766-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF766	HGNC	protein_coding	OTTHUMT00000462764.1	C	NM_001010851		52794063	+1	no_errors	ENST00000359102	ensembl	human	known	70_37	nonsense	SNP	0.118	G
ZNF548	147694	genome.wustl.edu	37	19	57911010	57911010	+	Missense_Mutation	SNP	G	G	C			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr19:57911010G>C	ENST00000366197.5	+	3	1605	c.1355G>C	c.(1354-1356)aGa>aCa	p.R452T	AC004076.7_ENST00000597410.1_Intron|ZNF548_ENST00000336128.7_Missense_Mutation_p.R464T|AC003002.6_ENST00000596400.1_Intron|AC003002.6_ENST00000600421.1_Intron	NM_152909.3	NP_690873.2	Q8NEK5	ZN548_HUMAN	zinc finger protein 548	452					regulation of transcription, DNA-templated (GO:0006355)|transcription, DNA-templated (GO:0006351)	nucleus (GO:0005634)	DNA binding (GO:0003677)|metal ion binding (GO:0046872)			breast(1)	1		Colorectal(82;0.000256)|all_neural(62;0.0577)|Ovarian(87;0.221)		UCEC - Uterine corpus endometrioid carcinoma (67;0.168)|GBM - Glioblastoma multiforme(193;0.026)		TACGAGTGCAGAGAGTGTGGG	0.468																																																	0													64.0	68.0	66.0					19																	57911010		2189	4295	6484	SO:0001583	missense	147694			AK057494	CCDS46209.1, CCDS54324.1	19q13.43	2013-01-08				ENSG00000188785		"""Zinc fingers, C2H2-type"", ""-"""	26561	protein-coding gene	gene with protein product						12477932	Standard	NM_152909		Approved	FLJ32932	uc002qon.3	Q8NEK5		ENST00000366197.5:c.1355G>C	19.37:g.57911010G>C	ENSP00000379482:p.Arg452Thr	Somatic		WXS	Illumina HiSeq	Phase_IV	Q96M05	Missense_Mutation	SNP	pfam_Znf_C2H2,pfam_Krueppel-associated_box,superfamily_Krueppel-associated_box,smart_Krueppel-associated_box,smart_Znf_C2H2-like,pfscan_Znf_C2H2,pfscan_Krueppel-associated_box	p.R464T	ENST00000366197.5	37	c.1391	CCDS46209.1	19	.	.	.	.	.	.	.	.	.	.	G	8.136	0.784214	0.16189	.	.	ENSG00000188785	ENST00000336128;ENST00000366197	T;T	0.14640	2.49;2.49	2.26	1.2	0.21068	Zinc finger, C2H2-like (1);Zinc finger, C2H2 (3);Zinc finger, C2H2-type/integrase, DNA-binding (1);	.	.	.	.	T	0.04634	0.0126	N	0.02539	-0.55	0.09310	N	1	B;B	0.19445	0.029;0.036	B;B	0.19666	0.015;0.026	T	0.37911	-0.9685	9	0.38643	T	0.18	.	2.9675	0.05912	0.2883:0.2402:0.4715:0.0	.	464;452	Q8NEK5-2;Q8NEK5	.;ZN548_HUMAN	T	464;452	ENSP00000337555:R464T;ENSP00000379482:R452T	ENSP00000337555:R464T	R	+	2	0	ZNF548	62602822	0.000000	0.05858	0.003000	0.11579	0.954000	0.61252	-2.088000	0.01359	0.524000	0.28502	0.655000	0.94253	AGA	ZNF548	-	smart_Znf_C2H2-like,pfscan_Znf_C2H2		0.468	ZNF548-001	KNOWN	basic|appris_candidate|CCDS	protein_coding	ZNF548	HGNC	protein_coding	OTTHUMT00000465937.1	G	NM_152909		57911010	+1	no_errors	ENST00000336128	ensembl	human	known	70_37	missense	SNP	0.002	C
ZNF830	91603	genome.wustl.edu	37	17	33288933	33288933	+	Silent	SNP	G	G	A			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	G	G					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr17:33288933G>A	ENST00000361952.3	+	1	385	c.348G>A	c.(346-348)gcG>gcA	p.A116A	CCT6B_ENST00000436961.3_5'Flank|CCT6B_ENST00000421975.3_5'Flank|CCT6B_ENST00000314144.5_5'Flank	NM_052857.3	NP_443089.3	Q96NB3	ZN830_HUMAN	zinc finger protein 830	116					blastocyst growth (GO:0001832)|mitotic nuclear division (GO:0007067)|nuclear cell cycle DNA replication (GO:0033260)	cytoplasm (GO:0005737)|nuclear speck (GO:0016607)|nucleus (GO:0005634)	metal ion binding (GO:0046872)			breast(1)|cervix(1)|endometrium(2)|large_intestine(1)|liver(2)|lung(2)|stomach(2)|upper_aerodigestive_tract(1)|urinary_tract(1)	13		Ovarian(249;0.17)				TCAAGAGAGCGAAGGCCACCT	0.567																																																	0													87.0	87.0	87.0					17																	33288933		2203	4300	6503	SO:0001819	synonymous_variant	91603			AK055707	CCDS32618.1	17q12	2013-10-23	2008-03-25	2008-03-25	ENSG00000198783	ENSG00000198783			28291	protein-coding gene	gene with protein product	"""orphan maintenance of genome 1"""		"""coiled-coil domain containing 16"""	CCDC16		23066043	Standard	NM_052857		Approved	MGC20398, OMCG1	uc002hih.4	Q96NB3	OTTHUMG00000179771	ENST00000361952.3:c.348G>A	17.37:g.33288933G>A		Somatic		WXS	Illumina HiSeq	Phase_IV	Q96F60|Q96GZ5|Q9BU38	Silent	SNP	smart_Znf_U1	p.A116	ENST00000361952.3	37	c.348	CCDS32618.1	17																																																																																			ZNF830	-	NULL		0.567	ZNF830-001	KNOWN	basic|appris_principal|CCDS	protein_coding	ZNF830	HGNC	protein_coding	OTTHUMT00000448018.1	G	NM_052857		33288933	+1	no_errors	ENST00000361952	ensembl	human	known	70_37	silent	SNP	0.909	A
ZRANB2	9406	genome.wustl.edu	37	1	71535065	71535065	+	Intron	DEL	T	T	-			TCGA-EK-A2H0-01A-11D-A17W-09	TCGA-EK-A2H0-10A-01D-A17W-09	T	T					Unknown	Untested	Somatic	Phase_I	WXS	none			Illumina GAIIx	5dfbbeb7-8a28-4ce1-aead-6fcf508fd43c	09be50c4-0ffb-4335-a35d-d39c5b0177ea	g.chr1:71535065delT	ENST00000370920.3	-	8	985				ZRANB2_ENST00000254821.6_Intron|ZRANB2_ENST00000477096.1_5'Flank|ZRANB2-AS1_ENST00000426999.1_RNA|MIR186_ENST00000384988.1_RNA|ZRANB2-AS1_ENST00000450461.1_RNA	NM_203350.2	NP_976225.1	O95218	ZRAB2_HUMAN	zinc finger, RAN-binding domain containing 2						mRNA processing (GO:0006397)|regulation of transcription, DNA-templated (GO:0006355)|RNA splicing (GO:0008380)	nucleus (GO:0005634)	poly(A) RNA binding (GO:0044822)|RNA binding (GO:0003723)|sequence-specific DNA binding transcription factor activity (GO:0003700)|zinc ion binding (GO:0008270)			breast(1)|central_nervous_system(1)|cervix(1)|endometrium(1)|large_intestine(4)|lung(4)|ovary(2)|stomach(1)	15						CATGGAACGATTTTTTTTTTC	0.378																																																	0													60.0	63.0	62.0					1																	71535065		2203	4300	6503	SO:0001627	intron_variant	9406			AF065391	CCDS659.1, CCDS660.1	1p31	2008-02-05	2006-06-28	2006-06-28	ENSG00000132485	ENSG00000132485		"""Zinc fingers, RAN-binding domain containing"""	13058	protein-coding gene	gene with protein product		604347	"""zinc finger protein 265"""	ZNF265		9931435	Standard	NM_005455		Approved	ZIS, ZIS1, ZIS2	uc001dft.3	O95218	OTTHUMG00000009660	ENST00000370920.3:c.684-20A>-	1.37:g.71535065delT		Somatic		WXS	Illumina HiSeq	Phase_IV	D3DQ75|Q53GS3|Q59F92|Q5VV33|Q5VV34|Q8IXN6|Q9UP63	RNA	DEL	-	NULL	ENST00000370920.3	37	NULL	CCDS659.1	1																																																																																			ZRANB2	-	-		0.378	ZRANB2-001	KNOWN	basic|appris_candidate_longest|CCDS	protein_coding	ZRANB2	HGNC	protein_coding	OTTHUMT00000026636.1	T	NM_203350		71535065	-1	no_errors	ENST00000487510	ensembl	human	known	70_37	rna	DEL	1.000	-
